Enhancers and Promoters: Methods and Protocols (Methods in Molecular Biology, 2351) 1071615963, 9781071615966

Citation preview

Methods in Molecular Biology 2351

Tilman Borggrefe Benedetto Daniele Giaimo Editors

Enhancers and Promoters Methods and Protocols

METHODS

IN

MOLECULAR BIOLOGY

Series Editor John M. Walker School of Life and Medical Sciences University of Hertfordshire Hatfield, Hertfordshire, UK

For further volumes: http://www.springer.com/series/7651

For over 35 years, biological scientists have come to rely on the research protocols and methodologies in the critically acclaimed Methods in Molecular Biology series. The series was the first to introduce the step-by-step protocols approach that has become the standard in all biomedical protocol publishing. Each protocol is provided in readily-reproducible step-bystep fashion, opening with an introductory overview, a list of the materials and reagents needed to complete the experiment, and followed by a detailed procedure that is supported with a helpful notes section offering tips and tricks of the trade as well as troubleshooting advice. These hallmark features were introduced by series editor Dr. John Walker and constitute the key ingredient in each and every volume of the Methods in Molecular Biology series. Tested and trusted, comprehensive and reliable, all protocols from the series are indexed in PubMed.

Enhancers and Promoters Methods and Protocols

Edited by

Tilman Borggrefe and Benedetto Daniele Giaimo Institute of Biochemistry, University of Giessen, Gießen, Hessen, Germany

Editors Tilman Borggrefe Institute of Biochemistry University of Giessen Gießen, Hessen, Germany

Benedetto Daniele Giaimo Institute of Biochemistry University of Giessen Gießen, Hessen, Germany

ISSN 1064-3745 ISSN 1940-6029 (electronic) Methods in Molecular Biology ISBN 978-1-0716-1596-6 ISBN 978-1-0716-1597-3 (eBook) https://doi.org/10.1007/978-1-0716-1597-3 © The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021 2019, Corrected Publication 2021 Chapters 4 and 11 are licensed under the terms of the Creative Commons Attribution 4.0 International License (http:// creativecommons.org/licenses/by/4.0/). For further details see license information in the chapter. This work is subject to copyright. All rights are solely and exclusively licensed by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. This Humana imprint is published by the registered company Springer Science+Business Media, LLC, part of Springer Nature. The registered company address is: 1 New York Plaza, New York, NY 10004, U.S.A.

Preface It is our pleasure to present this book entitled “Enhancers and Promoters: Methods and Protocols” to you. How enhancers control gene expression is still not fully understood and several mechanistic aspects are still to be elucidated. In the recent years, several novel methods to better dissect their role in gene expression have been developed. This book comprises six main sections: (1) “Enhancer–Promoter Transcripts”, (2) “Nucleosome Occupancy and DNA Accessibility”, (3) “Chromatin Interactions”, (4) “Protein–DNA Interactions”, (5) “Functional Analysis” and (6) “DNA Methylation”. “Enhancer–Promoter Transcripts” offers protocols to detect so-called enhancer RNAs (eRNAs) that are inherently unstable. “Nucleosome Occupancy and DNA Accessibility” covers protocols that allow to study nucleosome distribution on a genome-wide level as well as their composition. The section on “Chromatin Interactions” contains protocols aimed to identify genomic regions that interact with each other. The section on “Protein–DNA Interactions” provides protocols aimed to investigate genomic occupancy of a relevant protein of interest. In the section on “Functional Analysis”, the reader will find protocols aimed to study the function of the genomic elements of choice making use of the CRISPR/Cas9 technology. Finally, the section on “DNA Methylation” provides protocols to study the distribution of DNA methylation, known to control chromatin function. Together, this book provides a plethora of protocols that allow to investigate the function of enhancers and promoters and should be not only of interest to transcription and chromatin community but also of use for young, sprouting investigators or scientists from other research areas. Our hope is that this book will be a useful guide for your future experiments. Gießen, Hessen, Germany

Tilman Borggrefe Benedetto Daniele Giaimo

v

Contents Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

PART I

INTRODUCTION

1 A Comprehensive Toolbox to Analyze Enhancer–Promoter Functions. . . . . . . . . Benedetto Daniele Giaimo, Tobias Friedrich, and Tilman Borggrefe

PART II

3

ENHANCER-PROMOTER TRANSCRIPTS

2 Global Run-on Sequencing (GRO-Seq) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Petros Tzerpos, Bence Daniel, and Laszlo Nagy 3 Illuminating Enhancer Transcription at Nucleotide Resolution with Native Elongating Transcript Sequencing (NET-Seq) . . . . . . . . . . . . . . . . . . . Olga Jasnovidova, Mirjam Arnold, and Andreas Mayer 4 Low Quantity Single Strand CAGE (LQ-ssCAGE) Maps Regulatory Enhancers and Promoters . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Hazuki Takahashi, Hiromi Nishiyori-Sueki, Jordan A. Ramilowski, Masayoshi Itoh, and Piero Carninci

PART III

v ix

25

41

67

NUCLEOSOME OCCUPANCY AND DNA ACCESSIBILITY

5 Analyses of Promoter, Enhancer, and Nucleosome Organization in Mammalian Cells by MNase-Seq . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 93 Cyril Esnault, Talha Magat, Encar Garcı´a-Oliver, and Jean-Christophe Andrau 6 Measuring Chromatin Accessibility: ATAC-Seq . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 105 Sanjeeb Kumar Sahu, Amitava Basu, and Vijay K. Tiwari 7 High-Resolution ChIP-MNase Mapping of Nucleosome Positions at Selected Genomic Loci and Alleles . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 123 Dominic van Essen, Agata Oruba, and Simona Saccani 8 Sequential Chromatin Immunoprecipitation to Identify Heterotypic Nucleosomes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 147 Maxim Nekrasov and David J. Tremethick

PART IV

CHROMATIN INTERACTIONS

9 Low Input Targeted Chromatin Capture (Low-T2C) . . . . . . . . . . . . . . . . . . . . . . . 165 Ilias Boltsis, Karol Nowosad, Rutger W. W. Brouwer, Przemko Tylzanowski, Wilfred F. J. van IJcken, Danny Huylebroeck, Frank Grosveld, and Petros Kolovos

vii

viii

10

11

12

13

Contents

Proximity Ligation-Assisted ChIP-Seq (PLAC-Seq) . . . . . . . . . . . . . . . . . . . . . . . . . Miao Yu, Ivan Juric, Armen Abnousi, Ming Hu, and Bing Ren Analysis of Enhancer–Promoter Interactions using CAGE and RADICL-Seq Technologies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Alessandro Bonetti, Andrew Tae-Jun Kwon, Erik Arner, and Piero Carninci Using Open Chromatin Enrichment and Network Hi-C (OCEAN-C) to Identify Open Chromatin Interactions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Lumeng Jia, Cheng Li, and Tingting Li Assessment of 3D Interactions Between Promoters and Distal Regulatory Elements with Promoter Capture Hi-C (PCHi-C) . . . . . . . . . . . . . . . . . . . . . . . . . . Nezih Karasu and Tom Sexton

PART V 14

15 16

18

201

211

229

PROTEIN–DNA INTERACTIONS

Native Chromatin Proteomics (N-ChroP) to Characterize Histone Post-translational Modification (PTM) Combinatorics at Distinct Genomic Regions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 251 Luciano Nicosia and Tiziana Bonaldi Using ChIP-SICAP to Identify Proteins That Co-localize in Chromatin . . . . . . . 275 Mahmoud-Reza Rafiee and Jeroen Krijgsveld Genome-Wide Profiling of Protein–DNA Interactions with Chromatin Endogenous Cleavage and High-Throughput Sequencing (ChEC-Seq) . . . . . . . 289 Moustafa M. Saleh, Jason P. Tourigny, and Gabriel E. Zentner

PART VI 17

181

FUNCTIONAL ANALYSIS

Transcriptional Activation of Heterochromatin by Recruitment of dCas9 Activators . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 307 Lukas Frank, Robin Weinmann, Fabian Erdel, Jorge Trojanowski, and Karsten Rippe Deletion of Regulatory Elements with All-in-One CRISPR-Cas9 Vectors . . . . . . 321 Ineˆs Cebola

PART VII

DNA METHYLATION

19

Simultaneous Tagmentation-Based Detection of ChIP/ATAC Signal with Bisulfite Sequencing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 337 Priscillia Lhoumaud and Jane Skok 20 Low-Input Whole-Genome Bisulfite Sequencing . . . . . . . . . . . . . . . . . . . . . . . . . . . 353 Anna Krepelova and Francesco Neri Correction to: Enhancers and Promoters . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C1 Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

369

Contributors ARMEN ABNOUSI • Department of Quantitative Health Sciences, Lerner Research Institute, Cleveland Clinic Foundation, Cleveland, OH, USA JEAN-CHRISTOPHE ANDRAU • Institut de Ge´ne´tique Mole´culaire de Montpellier, University of Montpellier, CNRS-UMR, Montpellier, France ERIK ARNER • RIKEN Center for Integrative Medical Sciences (IMS), Yokohama, Kanagawa, Japan MIRJAM ARNOLD • Otto-Warburg-Laboratory, Max Planck Institute for Molecular Genetics, Berlin, Germany; Department of Biology, Chemistry, and Pharmacy, Freie Universit€ at Berlin, Berlin, Germany AMITAVA BASU • Institute of Molecular Biology (IMB), Mainz, Germany ILIAS BOLTSIS • Department of Cell Biology, Erasmus Medical Center, Rotterdam, The Netherlands TIZIANA BONALDI • Department of Experimental Oncology, IEO, European Institute of Oncology IRCCS, Milan, Italy ALESSANDRO BONETTI • RIKEN Center for Integrative Medical Sciences (IMS), Yokohama, Kanagawa, Japan; Department of Cell and Molecular Biology, Karolinska Institutet, Stockholm, Sweden TILMAN BORGGREFE • Institute of Biochemistry, University of Giessen, Giessen, Germany RUTGER W. W. BROUWER • Department of Cell Biology, Erasmus Medical Center, Rotterdam, The Netherlands; Center for Biomics, Erasmus Medical Center, Rotterdam, The Netherlands PIERO CARNINCI • RIKEN Center for Integrative Medical Sciences (IMS), Yokohama, Kanagawa, Japan; Human Technopole, Milan, Italy INEˆS CEBOLA • Section of Genetics and Genomics, Department of Metabolism, Digestion and Reproduction, Imperial College London, London, UK BENCE DANIEL • Departments of Medicine and Biological Chemistry, Johns Hopkins University School of Medicine, Institute for Fundamental Biomedical Research, Johns Hopkins All Children’s Hospital, St. Petersburg, FL, USA; Department of Pathology, Stanford University School of Medicine, Stanford, CA, USA FABIAN ERDEL • LBME, Centre de Biologie Inte´grative (CBI), CNRS, UPS, Toulouse, France CYRIL ESNAULT • Institut de Ge´ne´tique Mole´culaire de Montpellier, University of Montpellier, CNRS-UMR, Montpellier, France LUKAS FRANK • Division of Chromatin Networks, German Cancer Research Center (DKFZ) and Bioquant, Heidelberg, Germany TOBIAS FRIEDRICH • Institute of Biochemistry, University of Giessen, Giessen, Germany ENCAR GARCI´A-OLIVER • Institut de Ge´ne´tique Mole´culaire de Montpellier, University of Montpellier, CNRS-UMR, Montpellier, France BENEDETTO DANIELE GIAIMO • Institute of Biochemistry, University of Giessen, Giessen, Germany FRANK GROSVELD • Department of Cell Biology, Erasmus Medical Center, Rotterdam, The Netherlands

ix

x

Contributors

MING HU • Department of Quantitative Health Sciences, Lerner Research Institute, Cleveland Clinic Foundation, Cleveland, OH, USA DANNY HUYLEBROECK • Department of Cell Biology, Erasmus Medical Center, Rotterdam, The Netherlands; Department of Development and Regeneration, KU Leuven, Leuven, Belgium MASAYOSHI ITOH • RIKEN Preventive Medicine and Diagnosis Innovation Program (PMI), Saitama, Japan OLGA JASNOVIDOVA • Otto-Warburg-Laboratory, Max Planck Institute for Molecular Genetics, Berlin, Germany LUMENG JIA • Center for Bioinformatics, School of Life Sciences, Center for Statistical Science, Peking University, Beijing, China IVAN JURIC • Department of Quantitative Health Sciences, Lerner Research Institute, Cleveland Clinic Foundation, Cleveland, OH, USA NEZIH KARASU • Institute of Genetics and Molecular and Cellular Biology (IGBMC), Illkirch, France; CNRS UMR7104, Illkirch, France; INSERM U1258, Illkirch, France; University of Strasbourg, llkirch, France PETROS KOLOVOS • Department of Molecular Biology and Genetics, Democritus University of Thrace, University Campus Dragana, Alexandroupolis, Greece ANNA KREPELOVA • Leibniz Institute on Aging—Fritz Lipmann Institute (FLI), Jena, Germany JEROEN KRIJGSVELD • German Cancer Research Center (DKFZ), Heidelberg, Germany; Medical Faculty, Heidelberg University, Heidelberg, Germany ANDREW TAE-JUN KWON • RIKEN Center for Integrative Medical Sciences (IMS), Yokohama, Kanagawa, Japan PRISCILLIA LHOUMAUD • New York University Langone Health, New York, NY, USA CHENG LI • Center for Bioinformatics, School of Life Sciences, Center for Statistical Science, Peking University, Beijing, China TINGTING LI • State Key Laboratory of Proteomics, Institute of Basic Medical Sciences, National Center of Biomedical Analysis, Beijing, China TALHA MAGAT • Institut de Ge´ne´tique Mole´culaire de Montpellier, University of Montpellier, CNRS-UMR, Montpellier, France ANDREAS MAYER • Otto-Warburg-Laboratory, Max Planck Institute for Molecular Genetics, Berlin, Germany LASZLO NAGY • Department of Biochemistry and Molecular Biology, Faculty of Medicine, University of Debrecen, Debrecen, Hungary; Departments of Medicine and Biological Chemistry, Johns Hopkins University School of Medicine, Institute for Fundamental Biomedical Research, Johns Hopkins All Children’s Hospital, St. Petersburg, FL, USA MAXIM NEKRASOV • The John Curtin School of Medical Research, The Australian National University, Canberra, ACT, Australia FRANCESCO NERI • Leibniz Institute on Aging—Fritz Lipmann Institute (FLI), Jena, Germany LUCIANO NICOSIA • Department of Experimental Oncology, IEO, European Institute of Oncology IRCCS, Milan, Italy HIROMI NISHIYORI-SUEKI • RIKEN Center for Integrative Medical Sciences (IMS), Yokohama, Kanagawa, Japan KAROL NOWOSAD • Department of Cell Biology, Erasmus Medical Center, Rotterdam, The Netherlands; Department of Biochemistry and Molecular Biology, Medical University of

Contributors

xi

Lublin, Lublin, Poland; The Postgraduate School of Molecular Medicine, Medical University of Warsaw, Warsaw, Poland AGATA ORUBA MAHMOUD-REZA RAFIEE • The Francis Crick Institute, London, UK JORDAN A. RAMILOWSKI • RIKEN Center for Integrative Medical Sciences (IMS), Yokohama, Kanagawa, Japan; Advanced Medical Research Center, Yokohama City University, Yokohama, Kanagawa, Japan BING REN • Ludwig Institute for Cancer Research, La Jolla, CA, USA; Center for Epigenomics, Department of Cellular and Molecular Medicine, Moores Cancer Center and Institute of Genome Medicine, University of California San Diego, School of Medicine, La Jolla, CA, USA KARSTEN RIPPE • Division of Chromatin Networks, German Cancer Research Center (DKFZ) and Bioquant, Heidelberg, Germany SIMONA SACCANI • INSERM U1081, CNRS UMR7284, IRCAN, Universite´ Coˆte d’Azur, Nice, France SANJEEB KUMAR SAHU • Salk Institute for Biological Studies, La Jolla, CA, USA MOUSTAFA M. SALEH • Department of Biology, Indiana University, Bloomington, IN, USA TOM SEXTON • Institute of Genetics and Molecular and Cellular Biology (IGBMC), Illkirch, France; CNRS UMR7104, Illkirch, France; INSERM U1258, Illkirch, France; University of Strasbourg, Illkirch, France JANE SKOK • New York University Langone Health, New York, NY, USA; Laura and Isaac Perlmutter Cancer Center, NYU School of Medicine, New York, NY, USA HAZUKI TAKAHASHI • RIKEN Center for Integrative Medical Sciences (IMS), Yokohama, Kanagawa, Japan VIJAY K. TIWARI • Wellcome-Wolfson Institute for Experimental Medicine, School of Medicine, Dentistry and Biomedical Science, Queen’s University Belfast, Belfast, UK JASON P. TOURIGNY • Department of Biology, Indiana University, Bloomington, IN, USA DAVID J. TREMETHICK • The John Curtin School of Medical Research, The Australian National University, Canberra, ACT, Australia JORGE TROJANOWSKI • Division of Chromatin Networks, German Cancer Research Center (DKFZ) and Bioquant, Heidelberg, Germany PRZEMKO TYLZANOWSKI • Department of Biochemistry and Molecular Biology, Medical University of Lublin, Lublin, Poland; Department of Development and Regeneration, Skeletal Biology and Engineering Research Center, University of Leuven, Leuven, Belgium PETROS TZERPOS • Department of Biochemistry and Molecular Biology, Faculty of Medicine, University of Debrecen, Debrecen, Hungary DOMINIC VAN ESSEN WILFRED F. J. VAN IJCKEN • Department of Cell Biology, Erasmus Medical Center, Rotterdam, The Netherlands; Center for Biomics, Erasmus Medical Center, Rotterdam, The Netherlands ROBIN WEINMANN • Division of Chromatin Networks, German Cancer Research Center (DKFZ) and Bioquant, Heidelberg, Germany MIAO YU • Ludwig Institute for Cancer Research, La Jolla, CA, USA; State Key Laboratory of Genetic Engineering, School of Life Sciences, Fudan University, Shanghai, China GABRIEL E. ZENTNER • Department of Biology, Indiana University, Bloomington, IN, USA; Indiana University Melvin and Bren Simon Comprehensive Cancer Center, Indianapolis, IN, USA

Part I Introduction

Chapter 1 A Comprehensive Toolbox to Analyze Enhancer–Promoter Functions Benedetto Daniele Giaimo, Tobias Friedrich, and Tilman Borggrefe

1

Introduction Complex developmental processes are intricately regulated by transcriptional networks. Constituents of such networks include cell type-specific transcription factors (TFs) and ubiquitously expressed cofactors. Transcriptional activation involves the ordered recruitment of specific transcription factors and general factors as well as alterations in chromatin structure, including nucleosome remodeling and post-translational modification (PTM) of histones. Enhancers and locus control regions (LCRs), which are remote from the genes they activate, recruit the complexes that carry out these alterations. While core promoters are sufficient to drive gene transcription, in many cases the expression is regulated by specific enhancers that are able to stimulate (enhance) high levels of transcription (see Figs. 1 and 2). Enhancers confer specificity in timeand space-specificity, and this is mediated by sequence-specific TFs that are in turn specifically expressed. TFs efficiently induce transcription by contacting the basal transcription machinery. The multisubunit Mediator complex is also an essential bridging factor between transcriptional activators and the RNA polymerase (RNAP). One of the first examples of a cis-acting element that has been described is represented by the lac operon of Escherichia coli in which gene transcription is inhibited by the LacI repressor which binds in trans to the lac operator [1]. Subsequent studies in Saccharomyces cerevisiae described the upstream activating sequence (UAS) which, acting as an enhancer, induces transcription of target genes upon binding of the galactose-induced TF Gal4 [2–4].

Tilman Borggrefe and Benedetto Daniele Giaimo (eds.), Enhancers and Promoters: Methods and Protocols, Methods in Molecular Biology, vol. 2351, https://doi.org/10.1007/978-1-0716-1597-3_1, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

3

4

Benedetto Daniele Giaimo et al.

Fig. 1 Overview on transcriptional regulation and the content of the book. The binding of transcription factors (TFs) to enhancers allow to recruit chromatin modulators as well as the Mediator complex that interacts with the RNA polymerase II (RNAPII) bound to the promoter. This communication leads to chromatin looping and gene activation which produces messenger RNAs (mRNAs) as well as enhancer RNAs (eRNAs). Promoter–enhancer communications produce chromatin loops that can be studied by low input targeted chromatin capture (low-T2C, Chapter 9), (PLAC-Seq, Chapter 10), RNA and DNA interacting complexes ligated and sequenced (RADICL-Seq, Chapter 11), open chromatin enrichment and network Hi-C (OCEAN-C, Chapter 12) or promoter capture Hi-C (PCHi-C). Transcripts produced both at enhancers and promoters can be studied by global run-on sequencing (GRO-Seq, Chapter 2), native elongating transcript sequencing (NET-Seq, Chapter 3) or low quantity single strand CAGE (LQ-ssCAGE, Chapter 4). Nucleosome occupancy and DNA accessibility can be studied by Micrococcal Nuclease sequencing (MNase-Seq, Chapter 5), assay for Transposase-accessible chromatin using sequencing (ATAC-Seq, Chapter 6), ChIP-MNase (Chapter 7) or ChIP-reChIP (Chapter 8). Protein–DNA interactions can be studied by Native Chromatin Proteomics (N-ChroP, Chapter 14), selective isolation of chromatin-associated proteins (ChIP-SICAP, Chapter 15) or chromatin endogenous cleavage sequencing (ChEC-Seq, Chapter 16). The CRISPR/Cas9 technology (see Chapter 8) can be used to edit the genome for example mutating an enhancer or leading to its activation (see Chapter 17). Finally, DNA methylation can be studied by EpiMethylTag (Chapter 19) or low input whole genome bisulfite sequencing (WGBS, Chapter 20). White lollipops indicate unmethylated CpG islands while black lollipops indicate methylated CpG islands

Similarly to yeast, gene expression in multicellular organism is also controlled by enhancers or even super-enhancers also known as LCRs. One particular well-studied LCR is the LCR at the betaglobin locus, characterized by several DNaseI hypersensitive sites that are essential binding sites for specific TFs that drive the expression of the β-globin gene [5–13]. Following up the work on LCRs, the concept of “super-enhancer” has been brought up: Superenhancers are clusters of enhancers particularly enriched for H3K27ac and BRD4 (bromodomain-containing protein 4)

Dissecting Molecular Mechanisms of Enhancer–Promoter Communication

5

occupancy. They are characterized by a large size (several kilobases) and by high TFs density as well as high Mediator occupancy [14– 16]. Whether LCR and super-enhancers represent different regulatory domain is still under debate [17–19]. The mRNA synthetic machinery of eukaryotes comprises general and gene-specific components. The general components, which include RNA polymerase II (RNAPII) and five general transcription factors (GTFs), known as TFIIB,
D,
E, –F, and –H, recognize and initiate transcription of a core, or minimal promoter, consisting of a TATA box and transcription start site. The genespecific components include activator and repressor proteins, which interact with enhancers, also known as cis-regulatory elements. Transcriptional regulation requires the communication between general and specific components. The Mediator complex integrates signals of promoter-specific regulators and passes them on to the transcription machinery. The Mediator is the bridge between a multitude of transcription factors and the RNA polymerase II. It has been identified by biochemical [20] and genetic studies [21] in yeast and later on also in human systems (summarized and reviewed in [22, 23]). Interestingly, no enzymatic functions or even protein domains are found within the over 20 Mediator subunits, but clearly, the phosphorylation of the C-terminal domain (CTD) of RNAPII mediated by TFIIH depends on Mediator [20, 24]. Mechanistically, Mediator not only interacts with transcriptional activators but also with the heptameric (CTD) of the RNAPII. Mediator was also found to cross-link in ChIP experiments with enhancers and, by now, is a well-established mark for LCRs or super-enhancers, which are covered with multiple TF-binding sites. Mechanistically, it was shown, that RNAPII pause-release depends on Mediator. Since the CTD of RNAPII and its hyper-phosphorylation are central for the switch from initiation to elongation, Mediator, directly interacting with the CTD, could coordinate not only initiation but also interlinked post-transcriptional processes such as capping, polyadenylation, splicing, and export.

2

The Chromatin Landscape of Enhancers and Promoters Over the years, different approaches have been adopted to identify enhancers and promoters as well as to define their activation state and characterize their function. Early studies made use of electrophoretic mobility shift assay (EMSA) and DNaseI footprinting to define the sequence(s) bound by TFs while gene reporter assays and deletion mutants were used to study enhancers and promoters activity. The development of new methods and in particular of sequencing technologies allowed a massive and wider investigation of enhancers and promoters functions. Early genome-wide studies

6

Benedetto Daniele Giaimo et al.

Fig. 2 Histone marks enrichment represent predictors of promoters and enhancers. GVIZ snapshot of the Stxbp2 gene locus for PU1 (also known as SPI1), RNA polymerase II (RNAPII), ATAC-Seq, H3K4me3, H3K4me1, H3K27ac, H4ac, EP300, interferon regulatory factor 1 (IRF1), interferon regulatory factor 8 (IRF8), and signal transducer and activator of transcription 2 (STAT2). The

Dissecting Molecular Mechanisms of Enhancer–Promoter Communication

7

allowed to develop criteria for the identification of enhancers and promoters in fact, these studies observed high H3K4me1 and low H3K4me3 at enhancers while high H3K4me3 and low H3K4me1 were observed at promoters ([25–27], see Fig. 2). These studies suggested that H3K4me1 enrichment is predictive of enhancers while H3K4me3 enrichment is predictive of promoters. In addition, H3K27ac was observed at active chromatin while the enrichment of H3K27me3 defines facultative repressive heterochromatin and H3K9me3 marks constitutive repressive heterochromatin. Of note, while H3K27ac is enriched at both enhancers and promoters (see Fig. 2), H3K27me3 is found only at a subclass of enhancers in embryonic stem cells (ESCs) [28, 29]. Based on these studies, enhancers were classified as active when enriched for H3K27ac and poised when lacking of this acetylation (Fig. 3). Poised enhancers gain H3K27ac upon activation and active enhancers lose it upon repression (Fig. 3a, b, respectively). A recent study identified in macrophages an additional class of enhancers defined as latent enhancers which lack of both H3K27ac and H3K4me1 and of TFs in these terminally differentiated cells, but they acquire both histone marks and TFs binding upon stimulation ([30], see Fig. 3c). Given that once turned off those enhancers lose H3K27ac but retain H3K4me1 as well as TFs binding, they have been suggested to be associated with transcriptional memory in macrophages. Once primed, these enhancers confer a faster transcriptional response when induced for a second time [30]. In addition, both enhancers and promoters are regulated by histone variants that confer specific functions to the nucleosomes and among them H2A.Z plays a key role in regulating gene expression [31–36]. All of these studies are based on chromatin immunoprecipitation (ChIP) which, making use of antibodies that specifically recognize the histone modification or TF of choice, allows to purify the protein–DNA complex. After purification of the DNA, it can be analyzed via qPCR, microarray, or deep sequencing. Several protocols exist to perform ChIP in different cell types [37–39] and several ChIP-based techniques have been developed over the time. For example, ChIP-reChIP allows to determine the ä Fig. 2 (continued) promoter located close to the transcription starting site (TSS) of Stxbp2 is strongly enriched for H3K4me3 and poorly enriched for H3K4me1 while the enhancer is strongly enriched for H3K4me1 and almost depleted of H3K4me3. Raw FASTQ files (GSE38379, GSE119693, GSE56123, GSE19553, GSE33163) were quality and adaptor trimmed using TrimGalore and aligned against mm9 with Hisat2. PCR duplicates and blacklisted regions were removed using Picard tools and bedtools. BAM files were converted in bigWigs [RPKM (reads per kilobase million) normalized coverage] with deeptools and plotted within R using the Gviz package

8

Benedetto Daniele Giaimo et al.

Fig. 3 Poised, repressed, and latent enhancers are characterized by their pattern of histone modifications and transcription factors (TFs) binding. GVIZ snapshot of a (a) poised, (b) repressed, or (c) latent enhancer for PU1 (also known as SPI1), RNA polymerase II (RNAPII), ATAC-Seq, H3K4me1, H3K27ac, H4ac, EP300, interferon regulatory factor 1 (IRF1), interferon regulatory factor 8 (IRF8), and signal transducer and activator of transcription 2 (STAT2) without treatment as control or after stimulation with lipopolysaccharide (LPS) for 2 h (only EP300) or 4 h. Raw FASTQ files (GSE38379, GSE119693, GSE56123, GSE19553, GSE33163) were quality and adaptor trimmed using TrimGalore and aligned against mm9 with Hisat2. PCR duplicates and blacklisted regions were removed using Picard tools and bedtools. BAM files were converted in bigWig [RPKM (reads per kilobase million) normalized coverage] with deeptools and plotted within R using the Gviz package. (a) Example of a poised enhancer. A poised enhancer (marked with the black box) is enriched for H3K4me1 and for binding of pioneering factors such as PU1 but not for histone acetylation (H3K27ac and H4ac). Upon stimulation with LPS the activation of the enhancer is reflected in increased histone acetylation (H3K27ac and H4ac), increased RNAPII, EP300, and TFs (IRF1, IRF8, and STAT2) occupancy as well as increased chromatin

Dissecting Molecular Mechanisms of Enhancer–Promoter Communication

9

co-occurrence of two histone marks or of two TFs on the same genomic region by performing a sequential antibody-based purification using two different antibodies (see Fig. 1). However, ChIPreChIP is frequently challenging and in Chapter 8 Nekrasov and Tremethick provide a detailed protocol to efficiently perform ChIP-reChIP versus histone proteins, a protocol that has been used to characterize the genome-wide distribution of homotypic (H2A.Z only-containing) nucleosomes and heterotypic (H2A.Z/ H2A-containing) nucleosomes [40]. Additional methods have been developed to investigate the combinatorial occurrence of histone PTMs and in Chapter 14 Nicosia and Bonaldi describe a protocol to perform Native Chromatin Proteomics (N-ChroP) in which ChIP is combined with MS to identify PTMs that occur within specific genomic regions (see Fig. 1). While ChIP has been extensively used, it has significant limitations for example, the fixation may mask the epitopes reducing the immunoprecipitation efficiency and at the same time the antibody may bind not specifically increasing the background. Several methods have been developed to overcome these limitations for example, in chromatin endogenous cleavage (ChEC) the protein under investigation is genetically fused to Micrococcal Nuclease (MNase) leading to release of the DNA proximal to the sites bound by the TF of interest. Upon purification of the DNA, it is analyzed by deep sequencing (ChEC-Seq [41]). In Chapter 16, Saleh and colleagues provide a detailed protocol to perform ChEC-Seq in yeast cells (see Fig. 1). One key issue to understand the function of both enhancers and promoters is to determine the proteins that are bound together at the same time at the genomic location under investigation. While ChIP and ChIP-reChIP are biased techniques that allow to study the protein that is specifically recognized by the antibody of choice, more unbiased approaches are needed to identify all the proteins bound at a specific enhancer or promoter. Following this line, in Chapter 15 Rafiee and Krijgsveld provide a detailed protocol to perform selective isolation of chromatin-associated proteins (ChIPSICAP) that allows to determine the proteins that interact with the loci occupied by a protein recognized by the antibody of choice ([42], see Fig. 1). ä Fig. 3 (continued) accessibility as detected by ATAC-Seq. (b) Example of a repressed enhancer. An enhancer that is repressed upon stimulation with LPS (marked with the black box) loses histone acetylation (H3K27ac and H4ac) as well as EP300 and RNAPII occupancy and presents with a reduced chromatin accessibility as detected by ATAC-Seq. H3K4me1 as well as TFs (PU1, IRF1, IRF8, and STAT2) occupancy are poorly affected. (c) Example of a latent enhancer. A latent enhancer (marked with the black box) is not detectable in unstimulated macrophages in fact, it is not enriched for H3K4me1 and/or pioneering factors such as PU1. Similarly, no chromatin accessibility is detectable by ATAC-Seq. Upon stimulation with LPS latent enhancers gain H3K4me1 and histone acetylation (H3K27ac and H4ac) as well as TFs (PU1, IRF1, IRF8, and STAT2), EP300, and RNAPII occupancy. Enhancer activation is also reflected in increased chromatin accessibility as detected by ATAC-Seq

10

Benedetto Daniele Giaimo et al.

It is important to mark that the binding of TFs to the DNA modifies its conformation leading to opening of the chromatin structure via displacement of the nucleosomes. This event results in increased accessibility that can be studied using different approaches such as formaldehyde-assisted isolation of regulatory elements (FAIRE, [43]), DNaseI sensitivity [44], or assay for transposase-accessible chromatin using sequencing (ATAC-Seq) which is extensively described in Chapter 6 by Sahu and colleagues (see Fig. 1). The main obstacle to DNA-based processes as well as to the binding of TFs is represented by nucleosomes. As consequence, analyzing nucleosome distribution along the genome is essential to determine which genomic sites are accessible to TFs and in Chapter 5 Esnault and colleagues provide a detailed protocol to perform MNase-Seq (see Fig. 1), including in conditions where the more “labile” nucleosomes can be mapped. Following the same line, van Essen and colleagues offer a detailed protocol to perform ChIP-MNase that allows to determine nucleosome positioning of nucleosome that are characterized by specific modifications ([45], see Fig. 1). As already mentioned above, classical procedures to study enhancers and promoters function include the use of gene reporters and deletion mutants but recently the introduction and development of CRISPR/Cas9 techniques [46] open the road to a more efficient investigation of their function. For example, the CRISPR/ Cas9 technology has been already used to mutate consensus motifs or delete enhancers [47–51], and it can also be used for protein tethering at given loci. Following this line, Frank and colleagues provide in Chapter 17 a protocol that makes use of the CRISPR-Cas9 technology to induce activation of pericentric heterochromatin (PCH, see Fig. 1) while in Chapter 18 Cebola provides a single-step protocol to clone two sgRNAs in a single vector that can be used to edit regulatory regions (see Fig. 1). Finally, we want to mark that new methods have been developed to study the preference of transcriptional cofactors versus specific promoters [52] and to study enhancer activity [53] in a systematic fashion.

3

Monitoring Enhancer–Promoter Contacts As described above, the communication between enhancers and promoters is achieved via the Mediator complex. This enhancer– promoter interaction leads to chromatin looping, which is dependent on CTCF (CCCTC binding factor) and the cohesin complex [54, 55]. Several techniques have been developed over the years to study the enhancer–promoter interaction. Chromatin conformation capture (3C) assays and its derivatives make use of restriction enzymes to identify which enhancer(s) contacts which promoter(s). Below, we briefly describe these techniques:

Dissecting Molecular Mechanisms of Enhancer–Promoter Communication

11

– In classical 3C, cells are first fixed with formaldehyde and subsequently, the genome is cleaved with a four-base (or a six-base) cutter restriction enzyme. After relegation of the DNA ends, crosslinks are reversed and ligation events that occur between interacting DNA fragments are quantified in qPCR using primers specific for the regions under investigation [56, 57]. This means that 3C allows to study the interaction between two specific sites, defined as a one-to-one interaction; – In 4C [chromatin conformation capture (3C)-on-Chip], after relegation of the DNA ends and de-crosslinking, the circularized fragments are PCR amplified with primers specific for the region of choice. Finally, the PCR fragments are analyzed via deep sequencing or microarray allowing to identify all the genomic regions that interact with the region of choice in a one-to-all interaction setting [57, 58]. Of note, in 4C a four-base cutter is preferred as it gives smaller fragments that are required for the linear amplification of the captured DNA fragments; – In 5C (3C-Carbon Copy), after relegation of the DNA ends and de-crosslinking as in 3C, the fragments are used in a multiplex ligation-mediated amplification and finally analyzed via microarray or deep sequencing allowing to identify several contacts in a many-to-many interaction setting [57, 59]; – In Hi-C, cells are first crosslinked and the DNA is digested with a restriction enzyme that leaves a 50 overhang. The 50 overhang is subsequently filled up with nucleotides (including one biotinylated nucleotide) and after relegation, the chromatin is sheared. Finally, the biotinylated fragments that were in close proximity are purified using streptavidin beads and subjected to deep sequencing analysis [60]. This approach allows to identify genomic interaction in an all-to-all setting however, Hi-C significantly suffers of the low efficiency of biotin incorporation and of recovery of biotinylated fragments. To circumvent these limitations a new protocol, defined as easy Hi-C (eHi-C) has been developed [61]. In eHi-C, no end-repair with biotinylated nucleotides occurs and after a first digestion with HindIII, the fragments are relegated. After nuclear lysis and shearing, the DNA is digested with a 4-base cutter such as DpnII and relegated. Finally, samples are treated with exonuclease to remove linear DNA and the circularized DNA is once more digested with HindIII to produce linear fragments that are analyzed by deep sequencing [61]; – In chromatin interaction analysis by paired-end tag sequencing (ChIA-PET), cells are first crosslinked and after shearing, specific protein–DNA complexes are captured via immunoprecipitation with the antibody of choice. After end-repair and ligation of biotinylated half-linker that contains a MmeI restriction site, a

12

Benedetto Daniele Giaimo et al.

second ligation is performed. Finally, after digestion with MmeI, biotinylated fragments are purified with streptavidin beads and subjected to deep sequencing [62, 63]. This approach allows to identify all the genomic interactions that occur in presence of the protein specifically recognized by the antibody of choice. Hi-C allows to detect all the genomic interactions that occur within the nucleus; however, it requires a significant sequencing effort. To overcome the limitations of Hi-C different approaches have been developed for example targeted chromatin capture (T2C, [64]). In Chapter 9, Boltsis and colleagues describe a T2C protocol optimized for low input material defined as low input targeted chromatin capture (low-T2C, see Fig. 1). Additional methods that have been developed to overcome the limitations of Hi-C include for example open chromatin enrichment and network Hi-C (OCEAN-C) [65] in which the principle of FAIRE is associated [43] to the one of Hi-C to identify genomic interactions that involve open chromatin. In Chapter 12, Jia and colleagues provide a detailed protocol for OCEAN-C (see Fig. 1). Furthermore, in promoter capture Hi-C (PCHi-C) the use of biotin-labeled probes directed against promoters allows to focus exclusively on the interactions that involve promoters. In Chapter 13, Karasu and Sexton provide a detailed protocol to perform PCHi-C in mouse thymocytes (see Fig. 1). Finally, with the goal of reducing the sequencing efforts, HiChIP [66] and PLAC-Seq (Proximity ligation-assisted ChIP-Seq [67]) combine the principle of the Hi-C with the one of the ChIP in fact, after crosslinking, restriction digestion and proximity ligation, the protein–DNA complexes are immunoprecipitated with the antibody of choice. After sonication, the biotinlabeled DNA fragments are purified with streptavidin beads and finally analyzed by deep sequencing. The two methods (HiChIP and PLAC-Seq) mainly differ for the library preparation procedure (see Chapter 10; [66, 67]). In Chapter 10, Yu and colleagues provide a detailed protocol to perform PLAC-Seq (see Fig. 1).

4

DNA Methylation One additional layer of regulation is represented by modifications of the DNA. Probably, the most studied DNA modification is the methylation in position 5 of the cytosine (5mC) which supports a closed (repressed) chromatin conformation that leads to gene silencing even if recent studies observed DNA methylation also at active genes. In addition, a recent study has been shown that intragenic DNA methylation prevents spurious transcription [68]. DNA methylation usually occurs within regions of the chromatin that are enriched for CG dinucleotides and are defined as CpG islands (reviewed in [69]). DNA methylation is generally

Dissecting Molecular Mechanisms of Enhancer–Promoter Communication

13

stable due to the activity of the DNA methyltransferase 1 (DNMT1) which restores the DNA methylation profile upon DNA replication. However, there is a rapid loss of DNA methylation during early embryogenesis and in this case, the DNA methylation pattern is re-established due to the activity of the de novo DNA methyltransferases DNMT3A and DNMT3B [70–72]. The message represented by the 5mC is read by proteins that contain the methylated DNA-binding domain (MBD) which recruits additional enzymes to modulate chromatin function [73]. It has been shown that unmethylated CpG islands are bound by CXXC finger protein 1 (CFP1) and that this binding supports H3K4me3 [74] probably due to the interaction between CFP1 and SETD1 which is a histone methyltransferase versus H3K4 [75, 76]. Additional studies have further pointed out to the strong relationship between DNA methylation at CpG islands and H3K4me3 [77]; in fact, DNMT3L which stimulates the activity of the de novo DNMT3A and DNMT3B [78] interacts exclusively with histone H3 when it is unmethylated on K4 promoting de novo DNA methylation [79]. DNA methylation has been usually considered to be highly stable leading to gene silencing; however, in the last decade, it became evident that gene silencing can be reverted due to the activity of TET (ten-eleven translocation) enzymes that hydroxylate 5mC producing 5hmC. Classical approaches to study DNA methylation made use of bisulfite treatment which converts unmodified cytosines to uracil without affecting 5mC. In Chapter 20, Krepelova and Neri provide an optimized protocol to perform low input whole genome bisulfite sequencing (WGBS, see Fig. 1). Additional methods that have been used in the past make use of protein-based purification of the methylated DNA for example, fusing the methyl binding domain (MBD) to IgG or binding the whole MBD protein to a Sepharose matrix [80, 81] or alternatively, using antibodies raised against the 5mC to purify the methylated DNA [82–84]. While it is believed that DNA methylation counteracts the binding of TFs to the DNA, recent studies highlighted that some TFs bind directly to methylated DNA [85–87] and different approaches have been developed in the recent years to investigate whether a specific TF or histone modification preferentially associates with methylated DNA [87–90] or to study at the same time DNA methylation and nucleosome occupancy [91]. However, these methods suffer of more limitations including the high amount of starting material or the use of DNA rather than chromatin. To overcome these limitations, recently a new method (called EpiMethylTag) that combines ATAC-Seq or ChIPmentation with bisulfite conversion has been developed [92]. In Chapter 19, Lhoumaud and Skok provide a detailed protocol to perform EpiMethylTag (see Fig. 1).

14

5

Benedetto Daniele Giaimo et al.

Transcription at Enhancers and Promoters Recent studies highlighted both enhancers and promoters give rise to bidirectional transcription that produces non-coding transcripts [93–97]. The so-called enhancer RNAs (eRNAs) seem to be transcribed earlier than the adjacent protein-coding gene [93]. However, it is still not clear whether they have an active role in gene transcription. Some studies observed that knockdown of eRNAs results in decreased expression of the associated genes. Similarly, gene expression increases when the associated eRNAs are overexpressed suggesting a strong link between eRNAs and proteincoding gene expression [98–100]. A recent study suggested that eRNAs may facilitate the binding of TFs able to bind RNAs, for example, Yin-Yang 1 (YY1) is able to bind both DNA and RNA [101]. Changes in RNA levels influence YY1 binding at chromatin and eRNA tethering near YY1 binding sites leads to increased YY1 occupancy [101]. However, studying these non-coding RNAs (ncRNAs) is not easy due to their low stability and basic RNA purification methods do not allow their efficient recovery. As a consequence, different protocols have been developed to purify these RNA populations such as global run-on sequencing (GRO-Seq, [94, 102]) and native elongating transcript sequencing (NET-Seq, [103]). In Chapter 2, Tzerpos and colleagues present a detailed GRO-Seq protocol (see Fig. 1) while in Chapter 3 Jasnovidova and colleagues provide a detailed NET-Seq protocol (see Fig. 1). On the other hand, it is also possible to exclusively study RNAs that are characterized by the 5´-CAP, and this is achievable using cap analysis of gene expression (CAGE [104–109]) for which Takahashi and colleagues provide in Chapter 4 a detailed protocol to perform low quantity single strand CAGE (LQ-ssCAGE, see Fig. 1). Additional techniques include cap immunoprecipitation sequencing (CAPIP-Seq) that makes use of cap-specific antibody to purify capped RNAs [68] and DECAP-Seq that makes use of 50 pyrophosphohydrolase (RppH) enzyme to remove the CAP leaving a 50 monophosphate group that is subsequently used to ligate adaptors to map CAP sites [68]. Recently, a new approach called RNA and DNA interacting complexes ligated and sequenced (RADICL-Seq) has been developed to study the interactions that occur between RNA and chromatin [110]. In Chapter 11, Bonetti and colleagues provide a pipeline that combines CAGE and RADICL-Seq data to associate genes to enhancer elements (see Fig. 1).

Dissecting Molecular Mechanisms of Enhancer–Promoter Communication

6

15

Concluding Remarks NGS technologies have clearly revolutionized transcription and chromatin research as also seen in the wealth of novel techniques that elucidate fundamental understanding but also have clinical applications. Not only coding-mutations in mono-genic diseases but now also mutations in regulatory regions such as enhancers (in addition to splice-site mutations) should be considered for future studies. In our view, there is also a need to combine several techniques such as gene expression (i.e., RNA-Seq), chromatin marks (i.e., ChIP-Seq), nucleosome positioning (i.e., ATAC-Seq), and chromatin-looping (i.e., Hi-C). We hope that this book will be useful for researchers who will take up this challenge.

Acknowledgments B.D.G. is supported by a research grant of the University Medical Center Giessen and Marburg (UKGM) and by a Prize of the Justus Liebig University Giessen. T.B. is supported by the Deutsche Forschungsgemeinschaft (DFG, German Research Foundation) - TRR 81/3 - 109546710 and BO1639/9- 393040308, the BehringRo¨ntgen foundation and Excellence Cluster for Cardio Pulmonary System (ECCPS) in Giessen. The authors are grateful to Dr. Jean-Christophe Andrau (Institut de Ge´ne´tique Mole´culaire de Montpellier, University of Montpellier, France) for the critical reading of this manuscript and to Dr. Iros Barozzi (Faculty of Medicine, Department of Surgery & Cancer, Imperial College London, United Kingdom) for his support. References 1. Jacob F, Monod J (1961) Genetic regulatory mechanisms in the synthesis of proteins. J Mol Biol 3:318–356. https://doi.org/10.1016/ s0022-2836(61)80072-7 2. Webster N, Jin JR, Green S, Hollis M, Chambon P (1988) The yeast UASG is a transcriptional enhancer in human HeLa cells in the presence of the GAL4 trans-activator. Cell 52 (2):169–178. https://doi.org/10.1016/ 0092-8674(88)90505-3 3. Fischer JA, Giniger E, Maniatis T, Ptashne M (1988) GAL4 activates transcription in Drosophila. Nature 332(6167):853–856. https://doi.org/10.1038/332853a0

4. Kakidani H, Ptashne M (1988) GAL4 activates gene expression in mammalian cells. Cell 52(2):161–167. https://doi.org/10. 1016/0092-8674(88)90504-1 5. Fraser P, Grosveld F (1998) Locus control regions, chromatin activation and transcription. Curr Opin Cell Biol 10(3):361–365. https://doi.org/10.1016/s0955-0674(98) 80012-4 6. Li Q, Harju S, Peterson KR (1999) Locus control regions: coming of age at a decade plus. Trends Genet 15(10):403–408. https://doi.org/10.1016/s0168-9525(99) 01780-1

16

Benedetto Daniele Giaimo et al.

7. Kioussis D, Festenstein R (1997) Locus control regions: overcoming heterochromatininduced gene inactivation in mammals. Curr Opin Genet Dev 7(5):614–619. https://doi. org/10.1016/s0959-437x(97)80008-1 8. Kioussis D, Vanin E, deLange T, Flavell RA, Grosveld FG (1983) Beta-globin gene inactivation by DNA translocation in gamma betathalassaemia. Nature 306(5944):662–666. https://doi.org/10.1038/306662a0 9. Van der Ploeg LH, Konings A, Oort M, Roos D, Bernini L, Flavell RA (1980) gamma-beta-Thalassaemia studies showing that deletion of the gamma- and delta-genes influences beta-globin gene expression in man. Nature 283(5748):637–642. https:// doi.org/10.1038/283637a0 10. Fraser P, Pruzina S, Antoniou M, Grosveld F (1993) Each hypersensitive site of the human beta-globin locus control region confers a different developmental pattern of expression on the globin genes. Genes Dev 7(1):106–113. https://doi.org/10.1101/gad.7.1.106 11. Pruzina S, Antoniou M, Hurst J, Grosveld F, Philipsen S (1994) Transcriptional activation by hypersensitive site three of the human betaglobin locus control region in murine erythroleukemia cells. Biochim Biophys Acta 1219(2):351–360. https://doi.org/10. 1016/0167-4781(94)90059-0 12. Talbot D, Grosveld F (1991) The 5’HS2 of the globin locus control region enhances transcription through the interaction of a multimeric complex binding at two functionally distinct NF-E2 binding sites. EMBO J 10 (6):1391–1398 13. Pruzina S, Hanscombe O, Whyatt D, Grosveld F, Philipsen S (1991) Hypersensitive site 4 of the human beta globin locus control region. Nucleic Acids Res 19(7):1413–1419. https://doi.org/10.1093/nar/19.7.1413 14. Hnisz D, Abraham BJ, Lee TI, Lau A, SaintAndre V, Sigova AA, Hoke HA, Young RA (2013) Super-enhancers in the control of cell identity and disease. Cell 155(4):934–947. https://doi.org/10.1016/j.cell.2013.09. 053 15. Loven J, Hoke HA, Lin CY, Lau A, Orlando DA, Vakoc CR, Bradner JE, Lee TI, Young RA (2013) Selective inhibition of tumor oncogenes by disruption of super-enhancers. Cell 153(2):320–334. https://doi.org/10. 1016/j.cell.2013.03.036 16. Whyte WA, Orlando DA, Hnisz D, Abraham BJ, Lin CY, Kagey MH, Rahl PB, Lee TI, Young RA (2013) Master transcription factors and mediator establish super-enhancers at key cell identity genes. Cell 153

(2):307–319. https://doi.org/10.1016/j. cell.2013.03.035 17. Jia Y, Chng WJ, Zhou J (2019) Superenhancers: critical roles and therapeutic targets in hematologic malignancies. J Hematol Oncol 12(1):77. https://doi.org/10.1186/ s13045-019-0757-y 18. Gurumurthy A, Shen Y, Gunn EM, Bungert J (2019) Phase separation and transcription regulation: are super-enhancers and locus control regions primary sites of transcription complex assembly? BioEssays 41(1): e1800164. https://doi.org/10.1002/bies. 201800164 19. Smith E, Shilatifard A (2014) Enhancer biology and enhanceropathies. Nat Struct Mol Biol 21(3):210–219. https://doi.org/10. 1038/nsmb.2784 20. Flanagan PM, Kelleher RJ 3rd, Sayre MH, Tschochner H, Kornberg RD (1991) A mediator required for activation of RNA polymerase II transcription in vitro. Nature 350 (6317):436–438. https://doi.org/10.1038/ 350436a0 21. Thompson CM, Koleske AJ, Chao DM, Young RA (1993) A multisubunit complex associated with the RNA polymerase II CTD and TATA-binding protein in yeast. Cell 73 (7):1361–1375. https://doi.org/10.1016/ 0092-8674(93)90362-t 22. Bourbon HM, Aguilera A, Ansari AZ, Asturias FJ, Berk AJ, Bjorklund S, Blackwell TK, Borggrefe T, Carey M, Carlson M, Conaway JW, Conaway RC, Emmons SW, Fondell JD, Freedman LP, Fukasawa T, Gustafsson CM, Han M, He X, Herman PK, Hinnebusch AG, Holmberg S, Holstege FC, Jaehning JA, Kim YJ, Kuras L, Leutz A, Lis JT, Meisterernest M, Naar AM, Nasmyth K, Parvin JD, Ptashne M, Reinberg D, Ronne H, Sadowski I, Sakurai H, Sipiczki M, Sternberg PW, Stillman DJ, Strich R, Struhl K, Svejstrup JQ, Tuck S, Winston F, Roeder RG, Kornberg RD (2004) A unified nomenclature for protein subunits of mediator complexes linking transcriptional regulators to RNA polymerase II. Mol Cell 14(5):553–557. https://doi. org/10.1016/j.molcel.2004.05.011 23. Jeronimo C, Robert F (2017) The mediator complex: at the nexus of RNA polymerase II transcription. Trends Cell Biol 27 (10):765–783. https://doi.org/10.1016/j. tcb.2017.07.001 24. Kelleher RJ 3rd, Flanagan PM, Kornberg RD (1990) A novel mediator between activator proteins and the RNA polymerase II transcription apparatus. Cell 61(7):1209–1215.

Dissecting Molecular Mechanisms of Enhancer–Promoter Communication https://doi.org/10.1016/0092-8674(90) 90685-8 25. Heintzman ND, Stuart RK, Hon G, Fu Y, Ching CW, Hawkins RD, Barrera LO, Van Calcar S, Qu C, Ching KA, Wang W, Weng Z, Green RD, Crawford GE, Ren B (2007) Distinct and predictive chromatin signatures of transcriptional promoters and enhancers in the human genome. Nat Genet 39(3):311–318. https://doi.org/10.1038/ ng1966 26. Barski A, Cuddapah S, Cui K, Roh TY, Schones DE, Wang Z, Wei G, Chepelev I, Zhao K (2007) High-resolution profiling of histone methylations in the human genome. Cell 129(4):823–837. https://doi.org/10. 1016/j.cell.2007.05.009 27. Wang Z, Zang C, Rosenfeld JA, Schones DE, Barski A, Cuddapah S, Cui K, Roh TY, Peng W, Zhang MQ, Zhao K (2008) Combinatorial patterns of histone acetylations and methylations in the human genome. Nat Genet 40(7):897–903. https://doi.org/10. 1038/ng.154 28. Zentner GE, Tesar PJ, Scacheri PC (2011) Epigenetic signatures distinguish multiple classes of enhancers with distinct cellular functions. Genome Res 21(8):1273–1283. https://doi.org/10.1101/gr.122382.111 29. Rada-Iglesias A, Bajpai R, Swigut T, Brugmann SA, Flynn RA, Wysocka J (2011) A unique chromatin signature uncovers early developmental enhancers in humans. Nature 470(7333):279–283. https://doi.org/10. 1038/nature09692 30. Ostuni R, Piccolo V, Barozzi I, Polletti S, Termanini A, Bonifacio S, Curina A, Prosperini E, Ghisletti S, Natoli G (2013) Latent enhancers activated by stimulation in differentiated cells. Cell 152(1–2):157–171. https://doi.org/10.1016/j.cell.2012.12. 018 31. Giaimo BD, Ferrante F, Herchenrother A, Hake SB, Borggrefe T (2019) The histone variant H2A.Z in gene regulation. Epigenetics Chromatin 12(1):37. https://doi.org/ 10.1186/s13072-019-0274-9 32. Nekrasov M, Soboleva TA, Jack C, Tremethick DJ (2013) Histone variant selectivity at the transcription start site: H2A.Z or H2A. Lap1. Nucleus 4(6):431–438. https://doi. org/10.4161/nucl.26862 33. Soboleva TA, Nekrasov M, Ryan DP, Tremethick DJ (2014) Histone variants at the transcription start-site. Trends Genet 30 (5):199–209. https://doi.org/10.1016/j. tig.2014.03.002

17

34. Chen P, Wang Y, Li G (2014) Dynamics of histone variant H3.3 and its coregulation with H2A.Z at enhancers and promoters. Nucleus 5(1):21–27. https://doi.org/10.4161/nucl. 28067 35. Huang C, Zhu B (2014) H3.3 turnover: a mechanism to poise chromatin for transcription, or a response to open chromatin? BioEssays 36(6):579–584. https://doi.org/10. 1002/bies.201400005 36. Cauchy P, Koch F, Andrau JC (2017) Two possible modes of pioneering associated with combinations of H2A.Z and p300/CBP at nucleosome-occupied enhancers. Transcription 8(3):179–184. https://doi.org/10. 1080/21541264.2017.1291395 37. Giaimo BD, Ferrante F, Borggrefe T (2017) Chromatin immunoprecipitation (ChIP) in mouse T-cell lines. J Vis Exp 124:55907. https://doi.org/10.3791/55907 38. Decaprio J, Kohl TO (2020) Chromatin immunoprecipitation. Cold Spring Harb Protoc 2020(8):pdb prot098665. https://doi. org/10.1101/pdb.prot098665 39. Font-Tello A, Kesten N, Xie Y, Taing L, Vareslija D, Young LS, Hamid AA, Van Allen EM, Sweeney CJ, Gjini E, Lako A, Hodi FS, Bellmunt J, Brown M, Cejas P, Long HW (2020) FiTAc-seq: fixed-tissue ChIP-seq for H3K27ac profiling and super-enhancer analysis of FFPE tissues. Nat Protoc 15 (8):2503–2518. https://doi.org/10.1038/ s41596-020-0340-6 40. Nekrasov M, Amrichova J, Parker BJ, Soboleva TA, Jack C, Williams R, Huttley GA, Tremethick DJ (2012) Histone H2A.Z inheritance during the cell cycle and its impact on promoter organization and dynamics. Nat Struct Mol Biol 19(11):1076–1083. https:// doi.org/10.1038/nsmb.2424 41. Zentner GE, Kasinathan S, Xin B, Rohs R, Henikoff S (2015) ChEC-seq kinetics discriminates transcription factor binding sites by DNA sequence and shape in vivo. Nat Commun 6:8733. https://doi.org/10.1038/ ncomms9733 42. Rafiee MR, Girardot C, Sigismondo G, Krijgsveld J (2016) Expanding the circuitry of pluripotency by selective isolation of chromatin-associated proteins. Mol Cell 64 (3):624–635. https://doi.org/10.1016/j. molcel.2016.09.019 43. Giresi PG, Kim J, McDaniell RM, Iyer VR, Lieb JD (2007) FAIRE (formaldehydeassisted isolation of regulatory elements) isolates active regulatory elements from human chromatin. Genome Res 17(6):877–885. https://doi.org/10.1101/gr.5533506

18

Benedetto Daniele Giaimo et al.

44. Song L, Crawford GE (2010) DNase-seq: a high-resolution technique for mapping active gene regulatory elements across the genome from mammalian cells. Cold Spring Harb Protoc 2010(2):pdb prot5384. https://doi.org/ 10.1101/pdb.prot5384 45. Oruba A, Saccani S, van Essen D (2020) Role of cell-type specific nucleosome positioning in inducible activation of mammalian promoters. Nat Commun 11(1):1075. https://doi.org/ 10.1038/s41467-020-14950-5 46. Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F (2013) Genome engineering using the CRISPR-Cas9 system. Nat Protoc 8(11):2281–2308. https://doi.org/10. 1038/nprot.2013.143 47. Petrovic J, Zhou Y, Fasolino M, Goldman N, Schwartz GW, Mumbach MR, Nguyen SC, Rome KS, Sela Y, Zapataro Z, Blacklow SC, Kruhlak MJ, Shi J, Aster JC, Joyce EF, Little SC, Vahedi G, Pear WS, Faryabi RB (2019) Oncogenic notch promotes long-range regulatory interactions within hyperconnected 3D cliques. Mol Cell 73(6):1174–1190.e1112. https://doi.org/10.1016/j.molcel.2019.01. 006 48. Weiterer SS, Meier-Soelch J, Georgomanolis T, Mizi A, Beyerlein A, Weiser H, Brant L, Mayr-Buro C, Jurida L, Beuerlein K, Muller H, Weber A, Tenekeci U, Dittrich-Breiholz O, Bartkuhn M, Nist A, Stiewe T, van IWF RT, Schmitz ML, Papantonis A, Kracht M (2020) Distinct IL-1alpha-responsive enhancers promote acute and coordinated changes in chromatin topology in a hierarchical manner. EMBO J 39(1):e101533. https://doi.org/10.15252/ embj.2019101533 49. Miguel-Escalada I, Bonas-Guarch S, Cebola I, Ponsa-Cobas J, Mendieta-Esteban J, Atla G, Javierre BM, Rolando DMY, Farabella I, Morgan CC, Garcia-Hurtado J, Beucher A, Moran I, Pasquali L, Ramos-Rodriguez M, Appel EVR, Linneberg A, Gjesing AP, Witte DR, Pedersen O, Grarup N, Ravassard P, Torrents D, Mercader JM, Piemonti L, Berney T, de Koning EJP, Kerr-Conte J, Pattou F, Fedko IO, Groop L, Prokopenko I, Hansen T, Marti-Renom MA, Fraser P, Ferrer J (2019) Human pancreatic islet three-dimensional chromatin architecture provides insights into the genetics of type 2 diabetes. Nat Genet 51 (7):1137–1148. https://doi.org/10.1038/ s41588-019-0457-0 50. Alomairi J, Molitor AM, Sadouni N, Hussain S, Torres M, Saadi W, Dao LTM, Charbonnier G, Santiago-Algarra D, Andrau

JC, Puthier D, Sexton T, Spicuglia S (2020) Integration of high-throughput reporter assays identify a critical enhancer of the Ikzf1 gene. PLoS One 15(5):e0233191. https:// doi.org/10.1371/journal.pone.0233191 51. Dao LTM, Galindo-Albarran AO, CastroMondragon JA, Andrieu-Soler C, MedinaRivera A, Souaid C, Charbonnier G, Griffon A, Vanhille L, Stephen T, Alomairi J, Martin D, Torres M, Fernandez N, Soler E, van Helden J, Puthier D, Spicuglia S (2017) Genome-wide characterization of mammalian promoters with distal enhancer functions. Nat Genet 49(7):1073–1081. https://doi.org/ 10.1038/ng.3884 52. Haberle V, Arnold CD, Pagani M, Rath M, Schernhuber K, Stark A (2019) Transcriptional cofactors display specificity for distinct types of core promoters. Nature 570 (7759):122–126. https://doi.org/10.1038/ s41586-019-1210-7 53. Vanhille L, Griffon A, Maqbool MA, ZacariasCabeza J, Dao LT, Fernandez N, Ballester B, Andrau JC, Spicuglia S (2015) Highthroughput and quantitative assessment of enhancer activity in mammals by CapStarrseq. Nat Commun 6:6905. https://doi.org/ 10.1038/ncomms7905 54. Ali T, Renkawitz R, Bartkuhn M (2016) Insulators and domains of gene expression. Curr Opin Genet Dev 37:17–26. https://doi.org/ 10.1016/j.gde.2015.11.009 55. Hansen AS, Cattoglio C, Darzacq X, Tjian R (2018) Recent evidence that TADs and chromatin loops are dynamic structures. Nucleus 9 (1):20–32. https://doi.org/10.1080/ 19491034.2017.1389365 56. Dekker J, Rippe K, Dekker M, Kleckner N (2002) Capturing chromosome conformation. Science 295(5558):1306–1311. https://doi.org/10.1126/science.1067799 57. Simonis M, Kooren J, de Laat W (2007) An evaluation of 3C-based methods to capture DNA interactions. Nat Methods 4 (11):895–901. https://doi.org/10.1038/ nmeth1114 58. Simonis M, Klous P, Splinter E, Moshkin Y, Willemsen R, de Wit E, van Steensel B, de Laat W (2006) Nuclear organization of active and inactive chromatin domains uncovered by chromosome conformation capture-on-chip (4C). Nat Genet 38(11):1348–1354. https://doi.org/10.1038/ng1896 59. Dostie J, Richmond TA, Arnaout RA, Selzer RR, Lee WL, Honan TA, Rubio ED, Krumm A, Lamb J, Nusbaum C, Green RD, Dekker J (2006) Chromosome Conformation Capture Carbon Copy (5C): a massively

Dissecting Molecular Mechanisms of Enhancer–Promoter Communication parallel solution for mapping interactions between genomic elements. Genome Res 16 (10):1299–1309. https://doi.org/10.1101/ gr.5571506 60. Lieberman-Aiden E, van Berkum NL, Williams L, Imakaev M, Ragoczy T, Telling A, Amit I, Lajoie BR, Sabo PJ, Dorschner MO, Sandstrom R, Bernstein B, Bender MA, Groudine M, Gnirke A, Stamatoyannopoulos J, Mirny LA, Lander ES, Dekker J (2009) Comprehensive mapping of long-range interactions reveals folding principles of the human genome. Science 326(5950):289–293. https://doi.org/ 10.1126/science.1181369 61. Lu L, Liu X, Huang WK, Giusti-Rodriguez P, Cui J, Zhang S, Xu W, Wen Z, Ma S, Rosen JD, Xu Z, Bartels CF, Kawaguchi R, Hu M, Scacheri PC, Rong Z, Li Y, Sullivan PF, Song H, Ming GL, Li Y, Jin F (2020) Robust Hi-C maps of enhancer-promoter interactions reveal the function of non-coding genome in neural development and diseases. Mol Cell 79 (3):521–534.e515. https://doi.org/10. 1016/j.molcel.2020.06.007 62. Fullwood MJ, Liu MH, Pan YF, Liu J, Xu H, Mohamed YB, Orlov YL, Velkov S, Ho A, Mei PH, Chew EG, Huang PY, Welboren WJ, Han Y, Ooi HS, Ariyaratne PN, Vega VB, Luo Y, Tan PY, Choy PY, Wansa KD, Zhao B, Lim KS, Leow SC, Yow JS, Joseph R, Li H, Desai KV, Thomsen JS, Lee YK, Karuturi RK, Herve T, Bourque G, Stunnenberg HG, Ruan X, Cacheux-Rataboul V, Sung WK, Liu ET, Wei CL, Cheung E, Ruan Y (2009) An oestrogen-receptor-alphabound human chromatin interactome. Nature 462(7269):58–64. https://doi.org/10. 1038/nature08497 63. Zhang J, Poh HM, Peh SQ, Sia YY, Li G, Mulawadi FH, Goh Y, Fullwood MJ, Sung WK, Ruan X, Ruan Y (2012) ChIA-PET analysis of transcriptional chromatin interactions. Methods 58(3):289–299. https://doi.org/ 10.1016/j.ymeth.2012.08.009 64. Kolovos P, van de Werken HJ, Kepper N, Zuin J, Brouwer RW, Kockx CE, Wendt KS, van IWF, Grosveld F, Knoch TA (2014) Targeted Chromatin Capture (T2C): a novel high resolution high throughput method to detect genomic interactions and regulatory elements. Epigenetics Chromatin 7:10. https://doi.org/10.1186/1756-8935-7-10 65. Li T, Jia L, Cao Y, Chen Q, Li C (2018) OCEAN-C: mapping hubs of open chromatin interactions across the genome reveals gene regulatory networks. Genome Biol 19(1):54.

19

https://doi.org/10.1186/s13059-0181430-4 66. Mumbach MR, Rubin AJ, Flynn RA, Dai C, Khavari PA, Greenleaf WJ, Chang HY (2016) HiChIP: efficient and sensitive analysis of protein-directed genome architecture. Nat Methods 13(11):919–922. https://doi.org/ 10.1038/nmeth.3999 67. Fang R, Yu M, Li G, Chee S, Liu T, Schmitt AD, Ren B (2016) Mapping of long-range chromatin interactions by proximity ligationassisted ChIP-seq. Cell Res 26 (12):1345–1348. https://doi.org/10.1038/ cr.2016.137 68. Neri F, Rapelli S, Krepelova A, Incarnato D, Parlato C, Basile G, Maldotti M, Anselmi F, Oliviero S (2017) Intragenic DNA methylation prevents spurious transcription initiation. Nature 543(7643):72–77. https://doi.org/ 10.1038/nature21373 69. Deaton AM, Bird A (2011) CpG islands and the regulation of transcription. Genes Dev 25 (10):1010–1022. https://doi.org/10.1101/ gad.2037511 70. Gujar H, Weisenberger DJ, Liang G (2019) The roles of human DNA methyltransferases and their isoforms in shaping the epigenome. Genes (Basel) 10(2):172. https://doi.org/ 10.3390/genes10020172 71. Wong KK, Lawrie CH, Green TM (2019) Oncogenic roles and inhibitors of DNMT1, DNMT3A, and DNMT3B in acute myeloid leukaemia. Biomark Insights 14:1177271919846454. https://doi.org/ 10.1177/1177271919846454 72. Lyko F (2018) The DNA methyltransferase family: a versatile toolkit for epigenetic regulation. Nat Rev Genet 19(2):81–92. https:// doi.org/10.1038/nrg.2017.80 73. Menafra R, Stunnenberg HG (2014) MBD2 and MBD3: elusive functions and mechanisms. Front Genet 5:428. https://doi.org/ 10.3389/fgene.2014.00428 74. Thomson JP, Skene PJ, Selfridge J, Clouaire T, Guy J, Webb S, Kerr AR, Deaton A, Andrews R, James KD, Turner DJ, Illingworth R, Bird A (2010) CpG islands influence chromatin structure via the CpG-binding protein Cfp1. Nature 464 (7291):1082–1086. https://doi.org/10. 1038/nature08924 75. Lee JH, Skalnik DG (2005) CpG-binding protein (CXXC finger protein 1) is a component of the mammalian Set1 histone H3-Lys4 methyltransferase complex, the analogue of the yeast Set1/COMPASS complex. J Biol

20

Benedetto Daniele Giaimo et al.

Chem 280(50):41725–41731. https://doi. org/10.1074/jbc.M508312200 76. Lee JH, Tate CM, You JS, Skalnik DG (2007) Identification and characterization of the human Set1B histone H3-Lys4 methyltransferase complex. J Biol Chem 282 (18):13419–13428. https://doi.org/10. 1074/jbc.M609809200 77. Hughes AL, Kelley JR, Klose RJ (2020) Understanding the interplay between CpG island-associated gene promoters and H3K4 methylation. Biochim Biophys Acta Gene Regul Mech 1863(8):194567. https://doi. org/10.1016/j.bbagrm.2020.194567 78. Suetake I, Shinozaki F, Miyagawa J, Takeshima H, Tajima S (2004) DNMT3L stimulates the DNA methylation activity of Dnmt3a and Dnmt3b through a direct interaction. J Biol Chem 279(26):27816–27823. https://doi.org/10.1074/jbc.M400181200 79. Ooi SK, Qiu C, Bernstein E, Li K, Jia D, Yang Z, Erdjument-Bromage H, Tempst P, Lin SP, Allis CD, Cheng X, Bestor TH (2007) DNMT3L connects unmethylated lysine 4 of histone H3 to de novo methylation of DNA. Nature 448(7154):714–717. https://doi.org/10.1038/nature05987 80. Gebhard C, Schwarzfischer L, Pham TH, Schilling E, Klug M, Andreesen R, Rehli M (2006) Genome-wide profiling of CpG methylation identifies novel targets of aberrant hypermethylation in myeloid leukemia. Cancer Res 66(12):6118–6128. https://doi.org/ 10.1158/0008-5472.CAN-06-0376 81. Selker EU, Tountas NA, Cross SH, Margolin BS, Murphy JG, Bird AP, Freitag M (2003) The methylated component of the Neurospora crassa genome. Nature 422 (6934):893–897. https://doi.org/10.1038/ nature01564 82. Mohn F, Weber M, Schubeler D, Roloff TC (2009) Methylated DNA immunoprecipitation (MeDIP). Methods Mol Biol 507:55–64. https://doi.org/10.1007/9781-59745-522-0_5 83. Weber M, Hellmann I, Stadler MB, Ramos L, Paabo S, Rebhan M, Schubeler D (2007) Distribution, silencing potential and evolutionary impact of promoter DNA methylation in the human genome. Nat Genet 39 (4):457–466. https://doi.org/10.1038/ ng1990 84. Ben Maamar M, Sadler-Riggleman I, Beck D, Skinner MK (2021) Genome-wide mapping of DNA methylation 5mC by methylated DNA immunoprecipitation (MeDIP)sequencing. Methods Mol Biol

2198:301–310. https://doi.org/10.1007/ 978-1-0716-0876-0_23 85. Bartels SJ, Spruijt CG, Brinkman AB, Jansen PW, Vermeulen M, Stunnenberg HG (2011) A SILAC-based screen for Methyl-CpG binding proteins identifies RBP-J as a DNA methylation and sequence-specific binding protein. PLoS One 6(10):e25884. https://doi.org/ 10.1371/journal.pone.0025884 86. Hu S, Wan J, Su Y, Song Q, Zeng Y, Nguyen HN, Shin J, Cox E, Rho HS, Woodard C, Xia S, Liu S, Lyu H, Ming GL, Wade H, Song H, Qian J, Zhu H (2013) DNA methylation presents distinct binding sites for human transcription factors. elife 2:e00726. https:// doi.org/10.7554/eLife.00726 87. Yin Y, Morgunova E, Jolma A, Kaasinen E, Sahu B, Khund-Sayeed S, Das PK, Kivioja T, Dave K, Zhong F, Nitta KR, Taipale M, Popov A, Ginno PA, Domcke S, Yan J, Schubeler D, Vinson C, Taipale J (2017) Impact of cytosine methylation on DNA binding specificities of human transcription factors. Science 356(6337):eaaj2239. https://doi.org/10.1126/science.aaj2239 88. Brinkman AB, Gu H, Bartels SJ, Zhang Y, Matarese F, Simmer F, Marks H, Bock C, Gnirke A, Meissner A, Stunnenberg HG (2012) Sequential ChIP-bisulfite sequencing enables direct genome-scale investigation of chromatin and DNA methylation cross-talk. Genome Res 22(6):1128–1138. https://doi. org/10.1101/gr.133728.111 89. Feldmann A, Ivanek R, Murr R, Gaidatzis D, Burger L, Schubeler D (2013) Transcription factor occupancy can mediate active turnover of DNA methylation at regulatory regions. PLoS Genet 9(12):e1003994. https://doi. org/10.1371/journal.pgen.1003994 90. Statham AL, Robinson MD, Song JZ, Coolen MW, Stirzaker C, Clark SJ (2012) Bisulfite sequencing of chromatin immunoprecipitated DNA (BisChIP-seq) directly informs methylation status of histone-modified DNA. Genome Res 22(6):1120–1127. https://doi. org/10.1101/gr.132076.111 91. Kelly TK, Liu Y, Lay FD, Liang G, Berman BP, Jones PA (2012) Genome-wide mapping of nucleosome positioning and DNA methylation within individual DNA molecules. Genome Res 22(12):2497–2506. https:// doi.org/10.1101/gr.143008.112 92. Lhoumaud P, Sethia G, Izzo F, Sakellaropoulos T, Snetkova V, Vidal S, Badri S, Cornwell M, Di Giammartino DC, Kim KT, Apostolou E, Stadtfeld M, Landau DA, Skok J (2019) EpiMethylTag: simultaneous detection of ATAC-seq or ChIP-seq

Dissecting Molecular Mechanisms of Enhancer–Promoter Communication signals with DNA methylation. Genome Biol 20(1):248. https://doi.org/10.1186/ s13059-019-1853-6 93. De Santa F, Barozzi I, Mietton F, Ghisletti S, Polletti S, Tusi BK, Muller H, Ragoussis J, Wei CL, Natoli G (2010) A large fraction of extragenic RNA pol II transcription sites overlap enhancers. PLoS Biol 8(5):e1000384. https://doi.org/10.1371/journal.pbio. 1000384 94. Core LJ, Waterfall JJ, Lis JT (2008) Nascent RNA sequencing reveals widespread pausing and divergent initiation at human promoters. Science 322(5909):1845–1848. https://doi. org/10.1126/science.1162228 95. Seila AC, Calabrese JM, Levine SS, Yeo GW, Rahl PB, Flynn RA, Young RA, Sharp PA (2008) Divergent transcription from active promoters. Science 322(5909):1849–1851. https://doi.org/10.1126/science.1162253 96. Kim TK, Hemberg M, Gray JM, Costa AM, Bear DM, Wu J, Harmin DA, Laptewicz M, Barbara-Haley K, Kuersten S, MarkenscoffPapadimitriou E, Kuhl D, Bito H, Worley PF, Kreiman G, Greenberg ME (2010) Widespread transcription at neuronal activityregulated enhancers. Nature 465 (7295):182–187. https://doi.org/10.1038/ nature09033 97. Lepoivre C, Belhocine M, Bergon A, Griffon A, Yammine M, Vanhille L, ZacariasCabeza J, Garibal MA, Koch F, Maqbool MA, Fenouil R, Loriod B, Holota H, Gut M, Gut I, Imbert J, Andrau JC, Puthier D, Spicuglia S (2013) Divergent transcription is associated with promoters of transcriptional regulators. BMC Genomics 14:914. https:// doi.org/10.1186/1471-2164-14-914 98. Alvarez-Dominguez JR, Knoll M, Gromatzky AA, Lodish HF (2017) The super-enhancerderived alncRNA-EC7/bloodlinc potentiates red blood cell development in trans. Cell Rep 19(12):2503–2514. https://doi.org/10. 1016/j.celrep.2017.05.082 99. Jiao W, Chen Y, Song H, Li D, Mei H, Yang F, Fang E, Wang X, Huang K, Zheng L, Tong Q (2018) HPSE enhancer RNA promotes cancer progression through driving chromatin looping and regulating hnRNPU/p300/EGR1/HPSE axis. Oncogene 37(20):2728–2745. https://doi.org/ 10.1038/s41388-018-0128-0 100. Li W, Notani D, Ma Q, Tanasa B, Nunez E, Chen AY, Merkurjev D, Zhang J, Ohgi K, Song X, Oh S, Kim HS, Glass CK, Rosenfeld MG (2013) Functional roles of enhancer RNAs for oestrogen-dependent transcriptional activation. Nature 498

21

(7455):516–520. https://doi.org/10.1038/ nature12210 101. Sigova AA, Abraham BJ, Ji X, Molinie B, Hannett NM, Guo YE, Jangi M, Giallourakis CC, Sharp PA, Young RA (2015) Transcription factor trapping by RNA in gene regulatory elements. Science 350 (6263):978–981. https://doi.org/10.1126/ science.aad3346 102. Daniel B, Nagy G, Hah N, Horvath A, Czimmerer Z, Poliska S, Gyuris T, Keirsse J, Gysemans C, Van Ginderachter JA, Balint BL, Evans RM, Barta E, Nagy L (2014) The active enhancer network operated by liganded RXR supports angiogenic activity in macrophages. Genes Dev 28(14):1562–1577. https://doi. org/10.1101/gad.242685.114 103. Mayer A, di Iulio J, Maleri S, Eser U, Vierstra J, Reynolds A, Sandstrom R, Stamatoyannopoulos JA, Churchman LS (2015) Native elongating transcript sequencing reveals human transcriptional activity at nucleotide resolution. Cell 161(3):541–554. https://doi.org/10.1016/j.cell.2015.03. 010 104. Shiraki T, Kondo S, Katayama S, Waki K, Kasukawa T, Kawaji H, Kodzius R, Watahiki A, Nakamura M, Arakawa T, Fukuda S, Sasaki D, Podhajska A, Harbers M, Kawai J, Carninci P, Hayashizaki Y (2003) Cap analysis gene expression for high-throughput analysis of transcriptional starting point and identification of promoter usage. Proc Natl Acad Sci U S A 100 (26):15776–15781. https://doi.org/10. 1073/pnas.2136655100 105. Cvetesic N, Leitch HG, Borkowska M, Muller F, Carninci P, Hajkova P, Lenhard B (2018) SLIC-CAGE: high-resolution transcription start site mapping using nanogramlevels of total RNA. Genome Res 28 (12):1943–1956. https://doi.org/10.1101/ gr.235937.118 106. Kodzius R, Kojima M, Nishiyori H, Nakamura M, Fukuda S, Tagami M, Sasaki D, Imamura K, Kai C, Harbers M, Hayashizaki Y, Carninci P (2006) CAGE: cap analysis of gene expression. Nat Methods 3(3):211–222. https://doi.org/10.1038/ nmeth0306-211 107. Murata M, Nishiyori-Sueki H, KojimaIshiyama M, Carninci P, Hayashizaki Y, Itoh M (2014) Detecting expressed genes using CAGE. Methods Mol Biol 1164:67–85. https://doi.org/10.1007/978-1-49390805-9_7 108. Plessy C, Bertin N, Takahashi H, Simone R, Salimullah M, Lassmann T, Vitezic M,

22

Benedetto Daniele Giaimo et al.

Severin J, Olivarius S, Lazarevic D, Hornig N, Orlando V, Bell I, Gao H, Dumais J, Kapranov P, Wang H, Davis CA, Gingeras TR, Kawai J, Daub CO, Hayashizaki Y, Gustincich S, Carninci P (2010) Linking promoters to functional transcripts in small samples with nanoCAGE and CAGEscan. Nat Methods 7(7):528–534. https://doi.org/ 10.1038/nmeth.1470 109. Takahashi H, Lassmann T, Murata M, Carninci P (2012) 5’ end-centered expression profiling using cap-analysis gene expression and next-generation sequencing. Nat Protoc 7(3):542–561. https://doi.org/10.1038/ nprot.2012.005

110. Bonetti A, Agostini F, Suzuki AM, Hashimoto K, Pascarella G, Gimenez J, Roos L, Nash AJ, Ghilotti M, Cameron CJF, Valentine M, Medvedeva YA, Noguchi S, Agirre E, Kashi K, Samudyata LJ, Cazzoli R, Agrawal S, Luscombe NM, Blanchette M, Kasukawa T, Hoon M, Arner E, Lenhard B, Plessy C, Castelo-Branco G, Orlando V, Carninci P (2020) RADICL-seq identifies general and cell type-specific principles of genome-wide RNA-chromatin interactions. Nat Commun 11(1):1018. https://doi.org/ 10.1038/s41467-020-14337-6

Part II Enhancer-Promoter Transcripts

Chapter 2 Global Run-on Sequencing (GRO-Seq) Petros Tzerpos, Bence Daniel, and Laszlo Nagy

1

Introduction “Global Run-on Sequencing” (GRO-Seq) is a powerful method to map the nascent RNA products of transcriptionally active RNA polymerases (RNAPs) [1–3]. It is based on the basic principle of the nuclear run-on assay that RNA polymerase II (RNAPII) is allowed to transcribe chromatin in vitro for a limited time (typically 5 min) in the presence of modified nucleotides. Briefly, the key steps of the GRO-Seq protocol are: (a) nuclei isolation and storage at
80  C, (b) resumption of transcription at 30  C in the presence of 5-bromouridine 50 -triphosphate (Br-UTP), (c) enrichment of RNA molecules that incorporated Br-UTP with beads coated with antibodies against 5-bromo-2-deoxyuridine (anti-BrdU), and (d) generation of cDNA library for sequencing (Fig. 1). One of the main advantages of GRO-Seq is that it allows the unbiased mapping of nascent transcription genome-wide, even of low abundance and inherently unstable RNA molecules [4]. It also provides unsurpassed sensitivity and robust coverage of sense and antisense nascent transcription in promoter and enhancer regions making it possible to determine the transcriptional activity of noncoding genomic regions [5]. GRO-Seq has been successfully used to estimate the transcriptional activity genome-wide, sheding light on mechanisms regulating pause release control and elongation, bidirectional and divergent transciption around promoters and distal regulatory elements, transcript cleavage, and termination [4, 6–8]. Importantly, GRO-Seq has been applied to annotate low abundant noncoding RNA expression from enhancers (eRNA) [9, 10] and long intergenic noncoding genes (lincRNA) [11] and also to reliably measure and compare dynamic transcriptional responses to external stimuli as well [9, 12, 13].

Tilman Borggrefe and Benedetto Daniele Giaimo (eds.), Enhancers and Promoters: Methods and Protocols, Methods in Molecular Biology, vol. 2351, https://doi.org/10.1007/978-1-0716-1597-3_2, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

25

26

Petros Tzerpos et al.

Fig. 1 Schematic overview of the main steps in the GRO-Seq protocol

From a technical point of view, GRO-Seq has been viewed as a laborious technique with multiple critical enzymatic and immunopreciptitation steps and a series of precipitation rounds which can result in low yield recoveries. We find that the use of 32P-CTP in the run-on reaction, although optional, greatly helps to monitor the efficiency of limiting steps in the protocol such as the BrU-RNA enrichment and the 50 and 30 RNA-adaptor ligation. Here, we outline a detailed GRO-Seq library preparation protocol using RNA–RNA adaptor ligation based on the original protocol versions from Lis [1, 2] and Kraus [3] laboratories with minor modifications [12].

2 2.1

Materials Nuclei Isolation

1. Lysis Buffer: 10 mM Tris–HCl pH 7.4, 0.5% NP-40, 3 mM CaCl2, 2 mM MgCl2, protease inhibitors, and RNase inhibitor. 2. Freezing Buffer: 50 mM Tris–HCl pH 8.3, 40% glycerol, 5 mM MgCl2, 0.1 mM EDTA. 3. 0.4% Trypan Blue Solution (Sigma-Aldrich).

2.2 Nuclear Run-on Reaction

1. 2 Nuclear Run-On Buffer: 10 mM Tris–HCl pH 8.0, 5 mM MgCl2, 1 mM DTT, 300 mM KCl, 0.5 mM rATP, 0.5 mM rGTP, 0.002 mM rCTP, 0.5 mM Br-UTP, 1% Sarcosyl, 0.4 U/ mL SUPERase In, 10 μL 32P-CTP (0.33 μM) for each 100 μL reaction, RNase-free water. Always prepare it fresh. 2. STOP solution: 20 mM Tris–HCl pH 7.4, 10 mM EDTA, 2% SDS. 3. 3000 Ci/mmol 32P-CTP (see Note 1). 4. UltraPure™ DNase/RNase-Free Distilled Water (Thermo Fisher Scientific). 5. 20 U/μL SUPERase In RNase Inhibitor (Thermo Fisher Scientific).

GRO-Seq Protocol

27

6. Trizol LS reagent (Thermo Fisher Scientific). 7. 20 mg/mL Proteinase-K (Thermo Fisher Scientific). 8. 15 mg/mL GlycoBlue (Thermo Fisher Scientific). 9. 5 M NaCl. 10. Chloroform, molecular biology grade. 11. Ethanol, molecular biology grade. 2.3 Base Hydrolysis and Dnase Treatment

1. 1 N NaOH. 2. 1 M Tris–HCl pH 6.8. 3. 0.5 M EDTA pH: 8.0. 4. 1 U/μL RQ1 RNase-Free DNase (Promega). 5. RQ1 DNase 10 Reaction Buffer (Promega). 6. Bio-Spin Column with Bio-Gel P-30 (Bio-Rad). 7. Formamide Loading Buffer (FLB): 80% Formamide, 10 mM EDTA pH 8.0, 1 mg/mL Xylene Cyanol, 1 mg/mL Bromophenol Blue. Aliquot and store at –20  C. 8. 6% Pre-cast Novex TBE-Urea Gel (Invitrogen).

2.4 BrU-RNA Enrichment

1. Anti-BrdU-conjugated Biotechnologies).

agarose

beads

(Santa

Cruz

2. 50 mg/mL UltraPure BSA (Thermo Fisher Scientific). 3. TE buffer: 10 mM Tris–HCl, 1 mM EDTA, pH 7.4. 4. UltraPure™ DNase/RNase-Free Distilled Water (Thermo Fisher Scientific). 5. 15 mg/mL GlycoBlue (Thermo Fisher Scientific). 6. 5 M NaCl. 7. Chloroform, molecular biology grade. 8. Ethanol, molecular biology grade. 9. 20 U/μL SUPERase In RNase Inhibitor (Thermo Fisher Scientific). 10. Formamide Loading Buffer (FLB): 80% Formamide, 10 mM EDTA pH 8.0, 1 mg/mL Xylene Cyanol, 1 mg/mL Bromophenol Blue. Aliquot and store at –20  C. 11. Binding buffer: 0.25 SSPE, 0.05% Tween 20, 37.5 mM NaCl, 1 mM EDTA pH 8.0, RNase-free H2O. Add 2 μL SUPERase In just before use, for every 10 mL of buffer. 12. Blocking buffer: 1 binding buffer with the addition of 0.1% polyvinylpyrrolidone (PVP) and 0.1% ultra pure BSA. Add 2 μL SUPERase In just before use, for every 10 mL of buffer. 13. Low-salt wash buffer: 0.2 SSPE, 0.05% Tween 20, 1 mM EDTA pH 8.0, RNase-free H2O. Add 2 μL SUPERase In just before use, for every 10 mL of buffer.

28

Petros Tzerpos et al.

14. High-salt wash buffer: 0.2 SSPE, 137.5 mM NaCl, 0.05% Tween 20, 1 mM EDTA pH 8.0, RNase-free H2O. Add 2 μL SUPERase In just before use, for every 10 mL of buffer. 15. TET buffer: TE buffer, 0.05% Tween 20. Add 2 μL SUPERase In just before use, for every 10 mL of buffer. 16. Elution buffer: 50 mM Tris–HCl pH 7.5, 150 mM NaCl, 0.1% SDS, 20 mM DTT, 1 mM EDTA, RNase-free H2O. Add 2 μL SUPERase In just before use, for every 10 mL of buffer. 2.5 End Repair: Decapping and PNK Treatment

1. 10 U/μL Tobacco Acid Pyrophosphatase (TAP, New England Biolabs, see Note 6). 2. 10 Tobacco Acid Pyrophosphatase Buffer (New England Biolabs). 3. 10 U/μL T4 Polynucleotide Kinase (PNK, New England Biolabs). 4. 10 T4 Polynucleotide Kinase Buffer (New England Biolabs). 5. UltraPure™ DNase/RNase-Free Distilled Water (Thermo Fisher Scientific). 6. 15 mg/mL GlycoBlue (Thermo Fisher Scientific). 7. 5 M NaCl. 8. 0.3 M MgCl2. 9. 0.5 M EDTA pH:8.0. 10. 100 mM Adenosine 50 -Triphosphate (ATP, New England Biolabs). 11. Ethanol, molecular biology grade. 12. 20 U/μL SUPERase In RNase Inhibitor (Thermo Fisher Scientific). 13. Formamide Loading Buffer (FLB): 80% Formamide, 10 mM EDTA pH 8.0, 1 mg/mL Xylene Cyanol, 1 mg/mL Bromophenol Blue. Aliquot and store at –20  C.

2.6 50 -Adaptor Ligation

1. 10 U/μL T4 RNA Ligase 1 (New England Biolabs). 2. 50% (w/v) Polyethylene glycol (PEG) 8000 (Sigma-Aldrich). 3. 50 RNA Adaptor oligo sequence: 50 -GUUCAGAGUUCUACA GUCCGACGAUC-30 (26 bases). 4. Anti-BrdU-conjugated Biotechnologies).

agarose

beads

(Santa

Cruz

5. Formamide Loading Buffer (FLB): 80% Formamide, 10 mM EDTA pH 8.0, 1 mg/mL Xylene Cyanol, 1 mg/mL Bromophenol Blue. Aliquot and store at –20  C. 6. Binding buffer: 0.25 SSPE, 0.05% Tween 20, 37.5 mM NaCl, 1 mM EDTA pH 8.0, RNase-free H2O. Add 2 μL SUPERase In just before use, for every 10 mL of buffer.

GRO-Seq Protocol

29

7. Blocking buffer: 1 binding buffer with the addition of 0.1%. polyvinylpyrrolidone (PVP) and 0.1% ultra pure BSA. Add 2 μL SUPERase In just before use, for every 10 mL of buffer. 8. Low-salt wash buffer: 0.2 SSPE, 0.05% Tween 20, 1 mM EDTA pH 8.0, RNase-free H2O. Add 2 μL SUPERase In just before use, for every 10 mL of buffer. 9. High-salt wash buffer: 0.2 SSPE, 137.5 mM NaCl, 0.05% Tween 20, 1 mM EDTA pH 8.0, RNase-free H2O. Add 2 μL SUPERase In just before use, for every 10 mL of buffer. 10. TET buffer: TE buffer, 0.05% Tween 20. Add 2 μL SUPERase In just before use, for every 10 mL of buffer. 11. Elution buffer: 50 mM Tris–HCl pH 7.5, 150 mM NaCl, 0.1% SDS, 20 mM DTT, 1 mM EDTA, RNase-free H2O. Add 2 μL SUPERase In just before use, for every 10 mL of buffer. 2.7 30 -Adaptor Ligation

1. 30 RNA Adaptor oligo sequence: 50 P- UCGUAUGCCGU CUUCUGCUUGUidT-30 (26 bases). 2. Anti-BrdU-conjugated Biotechnologies).

agarose

beads

(Santa

Cruz

3. Formamide Loading Buffer (FLB): 80% Formamide, 10 mM EDTA pH 8.0, 1 mg/mL Xylene Cyanol, 1 mg/mL Bromophenol Blue. Aliquot and store at –20  C. 4. Binding buffer: 0.25 SSPE, 0.05% Tween 20, 37.5 mM NaCl, 1 mM EDTA pH 8.0, RNase-free H2O. Add 2 μL SUPERase In just before use, for every 10 mL of buffer. 5. Blocking buffer: 1 binding buffer with the addition of 0.1% polyvinylpyrrolidone (PVP) and 0.1% ultra pure BSA. Add 2 μL SUPERase In just before use, for every 10 mL of buffer. 6. Low-salt wash buffer: 0.2 SSPE, 0.05% Tween 20, 1 mM EDTA pH 8.0, RNase-free H2O. Add 2 μL SUPERase In just before use, for every 10 mL of buffer. 7. High-salt wash buffer: 0.2 SSPE, 137.5 mM NaCl, 0.05% Tween 20, 1 mM EDTA pH 8.0, RNase-free H2O. Add 2 μL SUPERase In just before use, for every 10 mL of buffer. 8. TET buffer: TE buffer, 0.05% Tween 20. Add 2 μL SUPERase In just before use, for every 10 mL of buffer. 9. Elution buffer: 50 mM Tris–HCl pH 7.5, 150 mM NaCl, 0.1% SDS, 20 mM DTT, 1 mM EDTA, RNase-free H2O. Add 2 μL SUPERase In just before use, for every 10 mL of buffer. 2.8 Reverse Transcription (RT) Reaction

1. 200 U/μL SuperScript™ III Reverse Transcriptase (Thermo Fisher Scientific). 2. RNase Cocktail Enzyme Mix (2 mg/mL RNase A, 5000 U/ mL RNaseT1, Thermo Fisher Scientific).

30

Petros Tzerpos et al.

3. 5 U/μL Ambion™ RNase H (Thermo Fisher Scientific). 4. RT oligo: 50 -CAAGCAGAAGACGGCATACGA-30 (21 bases). 2.9

PCR Reaction

1. 2 U/μL Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific). 2. 5 M Betaine, PCR-reagent (Sigma-Aldrich). 3. Small RNA PCR Primer 1:50 - CAAGCAGAAGACGGCA TACGA-30 .Used as RT oligo as well (21 bases). 4. Small RNA PCR Primer2: 50 AATGATACGGCGACCACCGA CAGGTTCAGAGTTCTACAGTCCGA-30 (44 bases).

2.10 Gel Purification of Libraries

1. 2.5% Agarose gel. 2. 25:24:1 (v/v) Phenol/Chloroform/Isoamyl Alcohol, Molecular Biology Grade (Millipore). 3. UltraPure™ DNase/Rnase-Free Distilled Water (Thermo Fisher Scientific). 4. 15 mg/mL GlycoBlue (Thermo Fisher Scientific). 5. 6 DNA Gel Loading Dye (Thermo Fisher Scientific). 6. Clean scalpel. 7. 21-Gauge needle. 8. 6%Pre-cast Novex TBE Gel (Thermo Fisher Scientific). 9. Sybr gold nucleic acid gel stain (Thermo Fisher Scientific). 10. TE: 10 mM Tris–HCl, 1 mM EDTA, pH 7.4. 11. Elution buffer: TE, 150 mM NaCl, 0.1% Tween-20. 12. Corning Costar Spin-X centrifuge tube filters (Sigma-Aldrich).

2.11 Quantification and Quality Control of the GRO-seq Library

3

1. Bioanalyzer High Sensitivity DNA Assay (Agilent). 2. PicoGreen dsDNA quantitation assay (Thermo Fisher Scientific).

Methods

3.1 Nuclei Isolation and Freezing

1. Collect 5  106 cells on ice and centrifuge at 4  C at 500  g for 5 min. 2. Resuspend cells in 5 mL ice-cold Lysis Buffer and incubate on ice for 5 min. 3. Centrifuge at 4  C at 500  g for 5 min. 4. Resuspend cells in 1.5 mL ice-cold Lysis Buffer and pipette up and down 20 times to release the nuclei completely. Cell lysis can be checked with Trypan Blue staining. 5. Centrifuge nuclei at 4  C at 500  g for 5 min.

GRO-Seq Protocol

31

6. Resuspend pellet in 100 μL Freezing Buffer. Flash-freeze nuclei in liquid nitrogen and store them at
80  C. Nuclei can be stored at
80  C for several months. 3.2 Nuclear Run-On Reaction

1. Prepare just before use the 2 Nuclear Run-On Buffer and preheat it to 30  C (see Note 2). 2. Thaw 100 μL nuclei aliquot (5  106). Add 100 μL 2 Nuclear Run-On Buffer and place tubes in a heat block shaker at 30  C for 5 min. 3. Add 600 μL Trizol LS Reagent to stop the reaction. Pipette up and down several times and incubate at room temperature for 5 min in a shaker to permit complete dissociation of nucleoprotein complexes. 4. Add 160 μL chloroform and shake vigorously for 20 s. Incubate at room temperature for 2–3 min and centrifuge at 4  C at 12,000  g for 15 min. 5. Transfer the aqueous phase containing the RNA to a new 1.5 mL tube. Add 22.5 μL of 5 M NaCl, 2 μL GlycoBlue and 1 mL of ice cold 100% ethanol. Shake vigorously for 10 s and incubate at
20  C for at least 1 h or overnight (see Note 3). 6. Centrifuge at 4  C at 12,000  g for 20 min. Wash pellet with 75% room temperature ethanol. Centrifuge at 4  C at 12,000  g for 5 min. 7. Resuspend in 20 μL RNase-free H2O and place sample on ice.

3.3 Base Hydrolysis and Dnase Treatment

1. Add 5 μL 1 N NaOH and incubate on ice for 10–20 min. 2. Neutralize reaction with 25 μL 1 M Tris–HCl pH 6.8. 3. Buffer exchange once by running through a Bio-Spin Column with Bio-Gel P-30. 4. Determine volume and add appropriate amount of 10 RQ1 DNase buffer, 3 μL RQ1 DNase, and incubate at 37  C for 10 min. 5. Buffer exchange the reaction again by running through BioSpin Column with Bio-Gel P-30. 6. Bring volume to 100 μL and add EDTA to a final concentation of 2 mM. 12. Remove 5 μL (5%) from the sample into FLB for downstream control analyses (see Note 4).

3.4 Br-U RNA Enrichment

1. Equilibrate 60 μL anti-BrdU-conjugated agarose beads per sample in 500 μL binding buffer in a rotator for 5 min at room temperature. Spin down the beads at 1000  g for 2 min at room temperature, then aspirate supernatant and repeat once.

32

Petros Tzerpos et al.

2. Block the beads in 500 μL Blocking buffer for 1–2 h. Add an extra 2 μL SUPERase In for every mL of Blocking buffer during this step. 3. Wash beads twice in 500 μL binding buffer (each wash is 5 min at room temperature in a rotator). 4. Resuspend beads in 400 μL Binding buffer. 5. Heat the BrU-RNA sample to 65  C for 5 min, then place on ice for 2 min. 6. Add the BrU-RNA sample to the resuspended beads (step 4 of this section), and let beads bind to RNA for 60 min at room temperature in a rotator. 7. Spin down beads at 1000  g for 2 min and save the supernatant as the unbound control (see Notes 4 and 5). 8. Wash the beads for 5 min with 500 μL of 1 binding buffer at room temperature in a rotator and spin down beads at 1000  g for 2 min at room temperature. 9. Repeat step 8 of this section with 500 μL of 1 Low-Salt Buffer. 10. Repeat step 8 of this section with 500 μL of 1 High-Salt Buffer (not more than 5 min). 11. Repeat step 8 of this section with 500 μL of 2 TET buffer. 12. Elute four times with 125 μL with Elution Buffer in a heat block shaker at 42  C, 300–500 rpm, for 10 min for each elution step. 13. Precipitate RNA from both bound and unbound (step 7 of this section) samples by adding 15 μL of 5 M NaCl to the bound samples and 22.5 μL of 5 M NaCl to the unbound sample. Add 1 μL GlycoBlue and 1 mL 100% ice-cold ethanol to each of the samples and incubate at
20  C for at least 1 h or overnight. 14. Centrifuge at 4  C at 12,000  g for 20 min. Wash pellet with 75% room temperature ethanol. Centrifuge at 4  C at 12,000  g for 5 min. 15. Resuspend in 20 μL RNase-free H2O, then place on ice. 16. Remove 0.5 μL from the sample and add into 10 μL FLB for downstream control analyses (see Notes 4 and 5). 3.5 End Repair: Decapping/PNK Treatment

1. Incubate RNA samples to 65  C for 5 min and then place them on ice for 2 min. 2. Add 3 μL 10 TAP buffer, 5 μL RNase-free H2O, 1 μL SUPERase IN, 1.5 μL TAP (see Note 6). 3. Incubate samples at 37  C for 1.5 h. 4. Add 1 μL PNK and 1 μL 0.3 M MgCl2 (10 mM final) and incubate for another 30 min at 37  C.

GRO-Seq Protocol

33

5. Add 20 μL PNK buffer, 2 μL of 100 mM ATP, and 142 μL RNase-free H2O, 1 μL SUPERase IN, and another 2 μL PNK. 6. Incubate for another 30 min at 37  C. 7. Add 95 μL RNase-free H2O and 5 μL of 0.5 M EDTA pH: 8.0. Add NaCl to 300 mM final concentration. Add 1 μL GlycoBlue and 1 mL 100% ice-cold ethanol to each of the samples and incubate at
20  C for at least 1 h or overnight. 8. Centrifuge at 4  C at 12,000  g for 20 min. Wash pellet with 75% room temperature ethanol. Centrifuge at 4  C at 12,000  g for 5 min. 9. Resuspend in 9.5 μL RNase-free H2O, then place on ice. 10. Take a 5% aliquot (~0.5) μL into 10 μL 1 FLB (see Notes 4 and 5). 3.6 50 -Adaptor Ligation

1. Set up the following 20 μL reaction for the 50 adaptor ligation: Reagent

For one reaction (μL)

BrU-RNA

9

25 μM 50 adaptor

1.5

10 RNA ligation buffer

2

T4 RNA ligase 1

1.5

SuperRNase Inhibitor

1

50% PEG 8000

5

First heat RNA, adaptor, and PEG to 65  C for 5 min, then cool on ice and add the rest of the reaction components. 2. Incubate at 22  C or room temperature for 4–6 h. 3. Remove 0.5 μL of ligation and mix it with 10 μL of 1 FLB loading dye (2.5% final). 4. Add 28 μL of RNase-free H2O and 2 μL of 0.5 M EDTA. 5. Heat to 65  C for 2 min and then place on ice for 2 min. Add 390 μL binding buffer and 60 μL of preblocked beads as described in steps 1–7 of Subheading 3.4. Incubate 30–60 min at room temperature in a rotator. 6. Wash/elute beads and precipitate RNA, as described in steps 8–14 of Subheading 3.4. 7. Resuspend in 9.5 μL of RNase-free H2O, then place on ice. 8. Remove 0.475 μL from the sample and add into 10 μL of FLB for downstream control analyses (see Notes 4 and 5).

34

Petros Tzerpos et al.

3.7 30 Adaptor Ligation

1. Set up the following 20 μL reaction for the 30 adaptor ligation: Reagent

For one reaction (μL)

Purified RNA

9

25 μM 30 adaptor

1.5

10 RNA ligation buffer

2

T4 RNA ligase 1

1.5

SuperRNase Inhibitor

1

50% PEG 8000

5

First heat RNA, adaptor, and PEG to 65  C for 5 min, then cool on ice and add the other components. 2. Repeat steps 2–6 from Subheading 3.6. 3. Resuspend in 8.5 μL RNase-free H2O, then place on ice. Remove 0.475 μL from the sample and add into 10 μL of FLB for downstream control analyses (see Notes 4 and 5). 3.8 Reverse Transcription (RT) Reaction

1. Set up the following 20 μL reaction for the RT reaction: Reagent

For one reaction (μL)

Purified RNA

8

100 μM RT oligo

1

5 first strand buffer

4

10 mM dNTPs

2

100 mM DTT

2

RNAse inhibitor

1

SSIII

2

2. Heat RNA and RT oligo to 65  C for 10 min. 3. Cool on ice, briefly spin down, and add the rest of the reagents besides SSIII. 4. Incubate at 48  C for 3 min and then add 2 μL SSIII. 5. Incubate at 48  C for 20 min and then at 54  C for 45 min. 6. Add 0.3 μL RNase cocktail (Rnase A/T1) and 0.3 μL RNaseH and incubate at 37  C for 15 min. Add 4.4 μL RNase-free H2O to bring the final volume at 25 μL and then place on ice.

GRO-Seq Protocol

3.9

PCR Reaction

35

1. Set up two 50 μL reactions for the PCR amplification of the RT (see Note 7): Reagent

For one reaction (μL)

RT reaction

12.5

5 phusion HF buffer

10

25 μM Small RNA PCR primer-1

0.5

25 μM Small RNA PCR primer-2

0.5

12.5 mM dNTP mix

1.5

Phusion DNA Polymerase

0.5

5 M Betaine

10

RNase-free H2O

14.5

Total volume

50

2. Use the following PCR program:

3.10 Gel Purification of Libraries

Step

Temperature ( C)

Time

Cycles

Denature

98

30 s

1

Denature

98

10 s

14

Anneal

54

30 s

Extension

72

15 s

Extension

72

10 min

4

Pause

1

1. Pool the two PCR reactions (final volume: 100 μL). Run 5 μL on 2.5% agarose gel to confirm the presence of a smear DNA. 2. Add equal volume (95 μL) of phenol/chloroform/IAA (25:24:1) and mix well by inverting the tube ten times. Let the tube stand 2 min in RT and centrifuge at room temperature at 12,000  g for 5 min. 3. Transfer carefully the aqueous phase to a new clean 1.5 mL tube. Add 1 μL GlycoBlue and two volumes of 100% ice-cold ethanol to each of the samples and incubate at
20  C for at least 1 h or overnight. 4. Centrifuge at 4  C at 12,000  g for 20 min. Wash pellet with 75% room temperature ethanol. Centrifuge at 4  C at 12,000  g for 5 min. Resuspend pellet in 25 μL RNase-free H2O and mix with Gel Loading Buffer. 5. Prepare a 6% native PAGE gel and run samples along with a low molecular weight DNA ladder.

36

Petros Tzerpos et al.

6. Stain the gel with SYBR gold in a clean container. Protect the staining solution from light by covering it with aluminum foil or by placing it in the dark. After for 2–3 min, view the gel on a Dark Reader transilluminator. 7. Excise DNA fragments between 150 and 300 bp with a clean scalpel. 8. Place the gel slice in a sterile, nuclease-free, 0.5 mL microtube that has been punctured at the bottom 4–5 times with a 21-gauge needle in order to create small holes. Place the 0.5 mL microtube into a sterile, round-bottom, nuclease-free, 2 mL microtube. 9. Centrifuge the stacked tubes at 10,000  g for 2 min at room temperature to shred the gel through the holes into the 2 mL tube. 10. Add 500 μL of Elution Buffer and elute overnight with rotation at 37  C. Transfer the eluate to a clean microtube and repeat elution (500 μL) for extra 4 h. 11. Pool the eluates and the gel debris to the top of a Spin-X filter column. 12. Centrifuge the filter column for 2 min at 10,000  g. Transfer the eluates into a clean microtube. Add 500 μL RNase-free H2O to the gel pieces with a wide-bore pipet, so that you can move the gel pieces to the Spin-X column, and spin the remaining eluate through. Pool the elutions and lyophilize the sample to bring the volume to 500 μL so that the final concentration of NaCl is 300 mM. Perform phenol/chloroform and chloroform extraction of the eluates, after spinning the eluate through the Spin-X columns. Precipitate DNA with 2 μL Glycogen, 300 mM NaCl (final), and 2.5 volumes of ethanol. 13. Wash pellet with 70% ethanol. 14. Resuspend in 10–20 μL RNase-free H2O. 3.11 Quantification and Quality Control of the GRO-seq Library

1. Library quality can be evaluated on a 2% gel agarose gel and with a Bioanalyzer High Sensitivity DNA analysis kit (Agilent). The expected size range should be 150–300 bp (Fig. 2a, b). 2. Use Picogreen kit to accurately measure the library concentration. 3. Store library at
20  C. 4. Proceed to sequencing of the libraries in Single-End runs (>50 bp). Typically 10–20 million reads are enough to detect trancripts in gene bodies. For more robust coverage of transcipts in noncoding regions, >50 million reads are required. Figure 2c shows a typical genome track view from a successful GRO-Seq experiment where nascent RNA transcripts can be mapped in gene bodies and distal regulatory elements.

GRO-Seq Protocol

37

Fig. 2 Typical size distribution of a GRO-Seq library. (a) Agarose gel image. (b) Bioanalyzer electropherogram and digital gel image. (c) Genome track visualization of GRO-Seq sequencing reads in the murine Abca1 gene locus upon its expression induction with the retinoic X receptor (RXR) ligand (LG268) in bone marrow-derived macrophages. Note the robust transcript coverage in the gene body and the distal upstream genomic elements.

4

Notes 1. Radiolabeled CTP is added to make tracking of the experiment easier. It can be left out completely, or at least reduced in amount. However, it does allow you to check the status of the RNA after each step (by running on a TBE-Urea gel), determine the incorporation level of nucleotides, and determine the final yield of the protocol (by scintillation counting). 2. Sarkosyl causes the reaction to get very viscous so it is important to properly mix the reaction in order to evenly distribute the nucleotides. When adding the nuclei to the reaction mix, use a wide-bore pipette tip, or cut the last centimeter off a normal one with clean scissors. Gently, but thoroughly pipette the reaction 15 times before placing at 30  C. 3. NaCl is used in all precipitation steps since all other salts typically used for precipitation inhibit downstream reactions to a greater extent than NaCl. NaCl will inhibit PNK and T4 RNA ligase, so all precipitations must be made as clean as possible. After removing the first supernatant, spin the samples down briefly and remove residual liquid before doing the 75% ethanol wash. 4. Removing a small amount from each step is optional because it reduces yield. However, it is helpful to remove a sample from the first and last bead binding fractions. After the first bead binding is complete, the protocol can be continued, but run the input, unbound, and eluted samples on a 6–8% denaturing TBE-Urea gel and count each fraction with scintillation counting to verify the size of the RNA and the efficiency of the first isolation. If these are good, then continue with the rest of the protocol. 5. Check if the binding is at or near completion by spinning the beads down and removing the supernatant but saving it. Check

38

Petros Tzerpos et al.

the beads and supernatant with the gieger counter. If the supernatant has 5–10 times fewer counts than the beads, then the binding is likely complete. 6. Tobacco Acid Pyrophosphatase (TAP) has recently been discontinued from the market. If an old stock is not available in your laboratory, RppH enzyme (NEB) can be used instead, as suggested by recent studies, e.g., [14]. 7. Betaine is used to increase the amplification efficiency of GC-rich regions.

Acknowledgments We would like to specially thank Drs. Nasun Hah (Salk Institute) and W. Lee Kraus (UT Soutwestern) to introduce us to GRO-Seq and Leighton Core (UConn) for kindly sharing the GRO-Seq protocol with us. References 1. Core LJ, Waterfall JJ, Lis JT (2008) Nascent RNA sequencing reveals widespread pausing and divergent initiation at human promoters. Science 322(5909):1845–1848. https://doi. org/10.1126/science.1162228 2. Core LJ, Lis JT (2008) Transcription regulation through promoter-proximal pausing of RNA polymerase II. Science 319 (5871):1791–1792. https://doi.org/10. 1126/science.1150843 3. Hah N, Danko CG, Core L, Waterfall JJ, Siepel A, Lis JT, Kraus WL (2011) A rapid, extensive, and transient transcriptional response to estrogen signaling in breast cancer cells. Cell 145(4):622–634. https://doi.org/ 10.1016/j.cell.2011.03.042 4. Kwak H, Fuda NJ, Core LJ, Lis JT (2013) Precise maps of RNA polymerase reveal how promoters direct initiation and pausing. Science 339(6122):950–953. https://doi.org/ 10.1126/science.1229386 5. Danko CG, Hyland SL, Core LJ, Martins AL, Waters CT, Lee HW, Cheung VG, Kraus WL, Lis JT, Siepel A (2015) Identification of active transcriptional regulatory elements from GRO-seq data. Nat Methods 12(5):433–438. https://doi.org/10.1038/nmeth.3329 6. Antosz W, Deforges J, Begcy K, Bruckmann A, Poirier Y, Dresselhaus T, Grasser KD (2020) Critical role of transcript cleavage in arabidopsis RNA polymerase II transcriptional elongation. Plant Cell 32(5):1449–1463. https:// doi.org/10.1105/tpc.19.00891

7. Core LJ, Waterfall JJ, Gilchrist DA, Fargo DC, Kwak H, Adelman K, Lis JT (2012) Defining the status of RNA polymerase at promoters. Cell Rep 2(4):1025–1035. https://doi.org/ 10.1016/j.celrep.2012.08.034 8. Maxwell CS, Kruesi WS, Core LJ, Kurhanewicz N, Waters CT, Lewarch CL, Antoshechkin I, Lis JT, Meyer BJ, Baugh LR (2014) Pol II docking and pausing at growth and stress genes in C. elegans. Cell Rep 6 (3):455–466. https://doi.org/10.1016/j.cel rep.2014.01.008 9. Wang D, Garcia-Bassets I, Benner C, Li W, Su X, Zhou Y, Qiu J, Liu W, Kaikkonen MU, Ohgi KA, Glass CK, Rosenfeld MG, Fu XD (2011) Reprogramming transcription by distinct classes of enhancers functionally defined by eRNA. Nature 474(7351):390–394. https://doi.org/10.1038/nature10006 10. Lam MT, Cho H, Lesch HP, Gosselin D, Heinz S, Tanaka-Oishi Y, Benner C, Kaikkonen MU, Kim AS, Kosaka M, Lee CY, Watt A, Grossman TR, Rosenfeld MG, Evans RM, Glass CK (2013) Rev-Erbs repress macrophage gene expression by inhibiting enhancerdirected transcription. Nature 498 (7455):511–515. https://doi.org/10.1038/ nature12209 11. Sigova AA, Mullen AC, Molinie B, Gupta S, Orlando DA, Guenther MG, Almada AE, Lin C, Sharp PA, Giallourakis CC, Young RA (2013) Divergent transcription of long noncoding RNA/mRNA gene pairs in embryonic

GRO-Seq Protocol stem cells. Proc Natl Acad Sci U S A 110 (8):2876–2881. https://doi.org/10.1073/ pnas.1221904110 12. Daniel B, Nagy G, Hah N, Horvath A, Czimmerer Z, Poliska S, Gyuris T, Keirsse J, Gysemans C, Van Ginderachter JA, Balint BL, Evans RM, Barta E, Nagy L (2014) The active enhancer network operated by liganded RXR supports angiogenic activity in macrophages. Genes Dev 28(14):1562–1577. https://doi. org/10.1101/gad.242685.114 13. Daniel B, Nagy G, Czimmerer Z, Horvath A, Hammers DW, Cuaranta-Monroy I, Poliska S, Tzerpos P, Kolostyak Z, Hays TT, Patsalos A,

39

Houtman R, Sauer S, Francois-Deleuze J, Rastinejad F, Balint BL, Sweeney HL, Nagy L (2018) The nuclear receptor PPARgamma controls progressive macrophage polarization as a ligand-insensitive epigenomic ratchet of transcriptional memory. Immunity 49 (4):615–626.e616. https://doi.org/10. 1016/j.immuni.2018.09.005 14. Hetzel J, Duttke SH, Benner C, Chory J (2016) Nascent RNA sequencing reveals distinct features in plant transcription. Proc Natl Acad Sci U S A 113(43):12316–12321. https://doi.org/10.1073/pnas.1603217113

Chapter 3 Illuminating Enhancer Transcription at Nucleotide Resolution with Native Elongating Transcript Sequencing (NET-Seq) Olga Jasnovidova, Mirjam Arnold, and Andreas Mayer

1

Introduction Transcription by RNA polymerase II (Pol II) is not restricted to genes and also occurs in intergenic regions including enhancers [1– 3]. Transcription at enhancer regions is usually bidirectional where transcription in one direction is accompanied by a transcriptional activity in the opposite orientation [4, 5]. Both transcriptional activities originate in close proximity to each other. Transcripts that arise from enhancer regions, the so-called enhancer RNAs (eRNAs), are unstable with half-lives significantly lower as compared to those of messenger RNAs [6]. Due to these features enhancer transcription and eRNAs mostly escape detection by standard RNA-Seq methods that typically measure steady-state levels of stable and mainly cytoplasmic mature RNAs [7]. To study the regulation and functional roles of enhancer transcription methods are required that ideally provide a DNA strandspecific and quantitative measure for transcription genome-wide with high spatial resolution. One genome-wide approach, which combines all these features and can be used to study enhancer transcription is native elongating transcript sequencing (NET-Seq). NET-Seq was originally developed for budding yeast [8]. In the following years, NET-Seq protocols became available for other species including mammals [9, 10], plants [11, 12], fission yeast [13, 14], and for bacteria [15, 16]. Although NET-Seq has so far

Olga Jasnovidova and Mirjam Arnold contributed equally to this work. Tilman Borggrefe and Benedetto Daniele Giaimo (eds.), Enhancers and Promoters: Methods and Protocols, Methods in Molecular Biology, vol. 2351, https://doi.org/10.1007/978-1-0716-1597-3_3, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

41

42

Olga Jasnovidova et al.

mainly been used to study nascent transcription by Pol II, the yeast NET-Seq protocol has been adapted for the analysis of Pol I transcription [17]. New applications that originated from the NET-Seq approach have also become recently available [18–22]. The NET-Seq approach consists of four major modules: (a) enrichment of transcribing RNA polymerase along with the nascent RNA, (b) efficient conversion of 30 -nascent RNA ends into a sequencing library, (c) next-generation sequencing, and (d) computational data analysis. NET-Seq exploits the high stability of the ternary complex formed by transcribing Pol II, the DNA template, and the nascent RNA [23]. Following cell lysis, transcribing Pol II along with the nascent RNA is purified. In the original NET-Seq protocol for budding yeast, this was accomplished by immunoprecipitation (IP) of Pol II elongation complexes [8]. Our NET-Seq approach for mammalian cells uses a simple and efficient chromatin fractionation method to enrich transcribing RNA polymerase together with the nascent RNA (Fig. 1a) [9, 24, 25]. The chromatin fractionation approach relies on a protocol originally developed by the Schibler and Black laboratories [26– 28] and has been extensively optimized to ensure that nearly all Pol II elongation complexes are captured in the chromatin fraction [9]. This fractionation method simplifies the protocol due to fewer experimental steps and most importantly avoids artifacts that typically arise from IP mainly due to cross-reactivity of antibodies, epitope masking, and low IP efficiencies. To avoid run-on transcription during sample processing, cell lysis and chromatin preparation are performed in the presence of α-amanitin, a potent Pol II inhibitor [29, 30]. The high stability of the Pol II elongation complex, even in the presence of high amounts of urea, salts, or detergents [26, 31, 32], allows stringent washes of the chromatin and results in an almost complete enrichment of transcribing Pol II (>95%) along with the nascent RNA (Fig. 1a). Next, nascent RNA is prepared from the chromatin and a DNA linker that contains a unique molecular identifier (UMI) is ligated to the 30 -ends of the nascent RNA (Fig. 1b). The UMI serves as a molecular barcode and allows PCR duplicates to be identified and computationally removed. After RNA fragmentation, 30 -ends of the nascent RNA are strand-specifically converted into cDNA and circularized (Fig. 1b). cDNA that originated from mature chromatin-associated RNAs are removed by subtractive hybridization (Fig. 1c). Before the NET-Seq library can be submitted for next-generation sequencing, it is amplified using a limited and optimized number of PCR amplification cycles. Following deep sequencing from the 30 -end, the NET-Seq data is computationally analyzed. By mapping NET-Seq reads to the reference genome and by recording the 30 -most nucleotide corresponding to the last nucleotide that was incorporated into the nascent RNA chain, the genome-wide and DNA strand-specific

Enhancer Transcription at Nucleotide Resolution

43

Fig. 1 Schematic overview of the main steps of the NET-Seq protocol. (a) Chromatin preparation (see 3.2). Purification of transcriptionally engaged RNA polymerases by chromatin isolation in the presence of α-amanitin. (b) Key experimental steps of the NET-Seq library preparation and deep sequencing (see 3.4 and 3.5). 30 -ddC, 30 -dideoxycytosine; 50 -rApp, 50 -riboadenylate; dsDNA, double-stranded DNA. (c) Specific depletion of highly abundant mature RNAs (see 3.4.6). Schematic view of specific depletion of highly abundant mature RNAs is accomplished by subtractive hybridization with biotinylated DNA oligos that are complementary to the target cDNA

density of transcriptionally engaged Pol II is revealed with singlenucleotide resolution. Here, we provide step-by-step guidance for performing NETSeq in mammalian cells. This protocol includes an updated list of enzymes, reagents, and kits. All experimental steps starting from

44

Olga Jasnovidova et al.

Table 1 Overview of experimental steps and time considerations Can I stop How can I after? stop? ( C)

Day Subheading Procedure

Time

1

Preparation of buffers for subcellular fractionation Subcellular fractionation RNA purification with miRNeasy kit, DNase I cleavage on the column

1h 1h 1.5–2 h

Yes Yes

80 80

Ligation with DNA barcode linker RNA fragmentation Purification of the ligated and fragmented RNA 15% TBE-urea gel RNA size selection RNA extraction from the 15% TBE-urea gel

4h 20 min 30 min

Yes

80

100 min 30 min 80 min

Yes

80

cDNA synthesis by Superscript IV 10% TBE-urea gel cDNA size selection ss cDNA extraction from PAGE cDNA circularization Depletion of abundant RNA species Precipitation of depleted circular cDNA

1h 95 min 30 min 1h 1.5 h 2h 3 h–overnight

Yes

20

Yes Yes

20 20

Yes

20

Recovery of precipitated circular cDNA Test PCR 8% TBE gel Optimized PCR 8% TBE gel

1.5 h 30 min 80 min 30 min 80 min

Yes

20

Yes

20

Library extraction from the PAGE gel DNA precipitation

3 h–overnight 4h Yes

20

2.2.1 3.2 3.3

2

3

3.4.1 3.4.1 3.4.2

3.4.3 3.4.4

3.4.5 3.4.6 4 3.4.7 3.4.8 5

the cell lysis to the submission of NET-Seq libraries for nextgeneration sequencing can be completed within 5 days. Table 1 outlines the time requirements of each experimental module.

2

Materials

2.1 Equipment and Supplies

1. UV-Vis Spectrophotometer, e.g., Nanodrop2000 (ThermoFisher Scientific). 2. RNase/DNase-free PCR tubes, 0.2 mL. 3. RNase/DNase-free microcentrifuge tubes, 0.5 mL. 4. DNA/RNA low-binding RNase/DNase-free microcentrifuge tubes, 1.5 and 2 mL.

Enhancer Transcription at Nucleotide Resolution

45

5. Microcentrifuge tube filter, e.g., Costar Spin-X centrifuge tube filters (Sigma-Aldrich). 6. RNase/DNase-free centrifuge tubes, 15 mL. 7. Syringe needle, 20G. 8. RNase/DNase-free scalpels. 9. Cell counter. 10. Refrigerated centrifuge. 11. Refrigerated microcentrifuge. 12. TBE-urea gels, 15% (w/v) (Life Technologies). 13. TBE-urea gels, 10% (w/v) (Life Technologies). 14. TBE gels, 8% (w/v) (Life Technologies). 15. Mini-Cell polyacrylamide gel box, XCell SureLock (Life Technologies). 16. Electrophoresis power supply. 17. Gel staining box. 18. Microcentrifuge tube rotator. 19. Vortexer. 20. Magnetic rack for 1.5 mL tubes. 21. PCR Thermal cycler. 22. Thermomixer for 1.5 and 2 mL tubes. 23. 2100 Bioanalyzer or Tapestation (Agilent Technologies). 24. Qubit™ Fluorometer, Assay Tubes, Quant-iT™ Qubit RNA BR Assay-kit, and Qubit™ dsDNA HS Assay-Kit (ThermoFisher Scientific). 25. Low retention filter tips. 26. 1 mL wide orifice pipette tips. 27. 5PRIME Phase Lock Gel, 2 mL tubes, heavy (QuantaBio). 2.2 Reagents and Buffers

All buffers need to be freshly prepared using RNase-free reagents and should be kept on ice till use.

2.2.1 Chromatin Preparation

1. 50 Protease inhibitor mix: dissolve one tablet of Protease inhibitor mix cOmplete™, EDTA-free (Roche) in 1 mL of pre-cooled RNase-free H2O. Use immediately or store aliquots for up to 1 year at 20  C. 2. 1 mM α-Amanitin stock solution: dissolve 1 mg of α-amanitin (Sigma-Aldrich) in 1 mL of RNase-free H2O. Use immediately or store aliquots for up to 1 year at 20  C. 3. 5 M urea stock solution: dissolve 1.5 g of urea, molecular biology grade, in 4 mL of RNase-free H2O. Urea solution is not stable, therefore use on the same day.

46

Olga Jasnovidova et al.

4. 50% (w/v) sucrose stock solution: dissolve 25 g of sucrose, molecular biology grade, in 50 mL of RNase-free H2O. Filtersterilize, make 10 mL aliquots, and store at 4  C for up to several months. 5. Cytoplasmic lysis buffer: 0.15% (v/v) NP-40, 10 mM Tris– HCl (pH 7.0), 150 mM NaCl, 25 μM α-amanitin, 10 U SUPERase.In™, and 1 protease inhibitor mix. For one reaction, prepare 250 μL of the buffer: mix 3.8 μL of 10% (v/v) NP-40, 2.5 μL of 1 M Tris–HCl (pH 7.0), 7.5 μL of 5 M NaCl, 5 μL of 50 protease inhibitor mix, 6.2 μL of 1 mM α-amanitin, 0.6 μL of SUPERase. In™ (20 U/μL), and 224.4 μL of RNase-free H2O. 6. Sucrose buffer: 10 mM Tris–HCl (pH 7.0), 150 mM NaCl, 25% (w/v) sucrose, 25 μM α-amanitin, 20 U SUPERase.In™, and 1 protease inhibitor mix. For one reaction, prepare 500 μL of the buffer: mix 5 μL of 1 M Tris–HCl (pH 7.0), 15 μL of 5 M NaCl and 250 μL of 50% (w/v) filter-sterilized sucrose, 10 μL of 50 protease inhibitor mix, 12.5 μL of 1 mM α-amanitin, 1.2 μL of SUPERase.In™ (20 U/μL), and 206.3 μL of RNase-free H2O. 7. Nuclei wash buffer: 0.1% (v/v) Triton X-100, 1 mM EDTA, 25 μM α-amanitin, 40 U SUPERase.In™, and 1 protease inhibitor mix in 1 PBS. For one reaction, prepare 600 μL of the buffer: mix 1.2 μL of 0.5 M EDTA solution, 6 μL of 10% (v/v) Triton X-100, 12 μL of 50 protease inhibitor mix, 15 μL of 1 mM α-amanitin, 1.5 μL of SUPERase.In™ (20 U/μL), and 564.3 μL of 1 PBS. 8. Glycerol buffer: 20 mM Tris–HCl (pH 8.0), 75 mM NaCl, 0.5 mM EDTA, 50% (v/v) glycerol, 0.85 mM DTT, 25 μM α-amanitin, 10 U SUPERase.In™, and 1 protease inhibitor mix. For one reaction, prepare 250 μL of the buffer: mix 5 μL of 1 M Tris–HCl (pH 8.0), 3.8 μL of 5 M NaCl, 0.5 μL of 0.25 M EDTA, 125 μL of 100% (v/v) filter-sterilized glycerol, 2.1 μL of 0.1 M filter- sterilized DTT, 5 μL of 1 protease inhibitor mix (50), 6.2 μL of 1 mM α-amanitin, 0.6 μL of SUPERase.In™ (20 U/μL), and 101.8 μL of RNase-free H2O. 9. Nuclei lysis buffer: 1% (v/v) NP-40, 20 mM HEPES (pH 7.5), 300 mM NaCl, 1 M urea, 0.2 mM EDTA, 1 mM DTT, 25 μM α-amanitin, 10 U SUPERase.In™, and 1 protease inhibitor mix. For one reaction, prepare 280 μL of the buffer: mix 25 μL of 10% (v/v) NP-40, 5 μL of 1 M HEPES (pH 7.5), 0.5 μL of 0.1 M EDTA, 15 μL of 5 M NaCl, 25 μL of 10 M filtersterilized urea, 2.5 μL of 0.1 M filter-sterilized DTT, 5 μL of 50 protease inhibitor mix, 6.2 μL of 1 mM α-amanitin, 0.6 μL of SUPERase (20 U/μL), and 165.2 μL of RNase-free H2O.

Enhancer Transcription at Nucleotide Resolution

47

10. Chromatin resuspension solution: 25 μM α-amanitin, 20 U SUPERase.In™ and 1 protease inhibitor mix in 1 PBS. For one reaction, prepare 120 μL of the buffer: mix 3 μL of 1 mM α-amanitin, 2.4 μL of 50 protease inhibitor mix, 0.3 μL of SUPERase.In™ (20 U/μL), and 114.3 μL of 1 PBS. 2.2.2 Nascent RNA Extraction

Work under the chemical hood! Phenol and chloroform are toxic. 1. miRNeasy mini kit (50; Qiagen) (see Note 1), RNase-free DNase set (50; Qiagen). 2. Chloroform, molecular biology grade. 3. Ethanol, molecular biology grade.

2.2.3 Library Preparation

1. DNA soaking buffer: for one reaction (668 μL), mix 6.7 μL of 1 M Tris–HCl (pH 8.0), 40 μL of 5 M NaCl, 1.3 μL of 0.5 M EDTA, and 620 μL of RNase-free H2O. Prepare buffer immediately before the experiment and keep at room temperature. 2. 1 N HCl: dilute 821 μL of 37% hydrochloric acid concentrate by adding DNase-free H2O to a final volume of 10 mL. Store 1 N HCl for up to 1 year at room temperature.

Name

Function

Sequence

Length (nt)

oGAB11

Positive control

AGUCACUUAGCGAUGUACACUGACUGUG

28

Hexamer barcode DNA linker

Ligation

5rApp/NNNNNNCTGTAGGCACCATCAAT/ 3ddC

25

oLSC007

Reverse transcription

5Phos/ATCTCGTATGCCGTCTTCTGCTTG/ iSp18/CACTCA/iSp18/TCCGACGATCATT GATGGTGCCTACAG

57

universal reverse PCR amplification CAAGCAGAAGACGGCATACGA primer oNTI23

22

indexed forward primer

PCR amplification, sample barcoding

86 AATGATACGGCGACCACCGAGATCTACAC GATCGGAAGAGCACACGTCTGAACTCC AGTCAC (Illumina TruSeq index) TCCGACGAT CATTGATGG

oLSC006

Custom sequencing primer

TCCGACGATCATTGATGGTGCCTACAG

N: random nucleotides to distinguish unique sequences from PCR duplicates 5rApp: 50 -riboadenylate, necessary for the RNA 30 -OH ligation 3ddC: 30 -dideoxycytidine to avoid self-ligation iSp18: internal 18-atom hexa-ethylenglycol spacer 5Phos: 50 -phosphate Illumina index: 6-nucleotide TruSeq index of choice

27

48

Olga Jasnovidova et al.

3. RNA and DNA oligos for NET-Seq library construction: 4. Depletion oligo mix for abundant mature RNA species: resuspend each of the 20 biotinylated DNA oligos (see below, Note 2; every oligo contains a 50 biotin-tetraethylene glycol group) with 10 mM Tris–HCl (pH 8.0) to the final concentration of 200 μM. Next, combine 5 μL of each depletion oligo solution and mix. The final concentration of each DNA oligo in the depletion oligo mix will be 10 μM. The final volume of the depletion oligo mix is 100 μL. Prepare the mix before use and store indefinitely at 20  C.

Gene

Transcript

DNA sequence

RNA5S1

rRNA

GTACTTGGATGGGAGACCGCCTGGGAATACCGGGTG

RNA28S5

rRNA

TGCGATCTATTGAAAGTCAGCCCTCGACACAAGGGTTTGT

RNVU1-1

snRNA

GGTAGTGGGGGACTGCGTTCGCGCTTTCCCCTG

SNORD3D

snoRNA

TTGGGGAGTGAGAGGGAGAGAACGCGGTCTGAGTGG

RNU2-1

snRNA

CATCGACCTGGTATTGCAGTACCTCCAGGAACGGTGCA

RNA5-8S5

rRNA

CCTCCCGGGGCTACGCCTGTCTGAGCGTCGCT

RNU5B-1

snRNA

GTCTTAAGCTAATTTTTTGAGGCCTTGTTCCGACAAGGCT

SNORD80

snoRNA

CGCTGATGAGCAATATTAAGTCTTTCGCTCCTATCTGATG

SNORD31

snoRNA

ATACCGCCCCAGTCTGATCAATGTGTGACTGAAAGGTA

SNORD12C snoRNA

CATCAGATCGACAATGCTGACGTCTTATATTTTGCCAGTTAG

SNORD29

snoRNA

GCTCACTATGACCGACAGTGAAAATACATGAACACCTGAG

RNU5E-1

snRNA

CTTAACCCAATTTTTTGAGGCCTTGCTTTGGCAAGGCT

SNORD81

snoRNA

CCAACTTGAACTCTCTCACTGATTACTTGATGACAA

RNVU1-7

snRNA

AGTGGGGGACTGCGTCCGCGCTTTCCCCTG

SNORD27

snoRNA

GCATATGGCTGAACTTTCAAGTGATGTCATCTTACTACTGAG

SNORD12B snoRNA

GATCGACTATGTTGATCTAACTTTTCTAAGCCAGTTTCTGTCTG

RNU4-1

TGGCAATTTTTGACAGTCTCTACGGAGACTGCTGTAGGC

snRNA

SNORD118 snoRNA

CTCTGCGTAATCAGGTCTTGCAACACCCTGATTGCTCC

MT-TM

mitochondrial tRNA

CCCATACCCCGAAAATGTTGGTTATACCCTTCCCGTAC

MT-TV

mitochondrial tRNA

CACTTAGGAGATTTCAACTTAACTTGACCGCTCTGACCA

Enhancer Transcription at Nucleotide Resolution

49

5. 2 Magnetic bead equilibration buffer: 5 mM Tris–HCl (pH 7.0), 2 M NaCl, 1 mM EDTA and 0.2% (v/v) Triton X-100. To prepare 1 mL for up to five reactions, mix 5 μL of 1 M Tris–HCl (pH 7.0), 400 μL of 5 M NaCl, 2 μL of 0.5 M EDTA, 20 μL of 10% Triton X-100, and 573 μL of RNase-free H2O. Store it at room temperature for up to several months. 6. Circular cDNA precipitation mix: for one reaction (326 μL), mix 2 μL of GlycoBlue, 24 μL of 5 M NaCl, and 300 μL of RNase-free H2O. 7. Gel soaking buffer: for one gel piece, prepare 668 μL of buffer. Mix 6.7 μL 1 M Tris–HCl (pH 8.0), 40 μL 5 M NaCl, 1.3 μL 0.5 M EDTA, 620 μL nuclease-free H2O to each tube. 8. 6 DNA loading buffer: dissolve 6 g of sucrose and 30 mg of Orange G (Sigma-Aldrich) in 20 mL of RNase-free H2O. Adjust to a final volume of 25 mL using RNase-free H2O. Store protected from light at room temperature for up to 1 year. 9. Gel staining solution: to stain one TBE or TBE-urea gel, add 4 μL of SYBR Gold nucleic acid gel stain to 40 mL of 1 TBE buffer and mix. Prepare this solution immediately before use and keep it at room temperature protected from light. 10. NEBNext® Magnesium RNA Fragmentation Module: NEBNext® RNA Fragmentation Buffer, NEBNext® RNA Fragmentation Stop Solution. 11. RNA Clean and Concentrator-5 (ZYMO Research). 12. ZR small-RNA PAGE Recovery Kit (ZYMO Research). 13. T4 RNA ligase 2 truncated module: polyethylene glycol (PEG) 8000, molecular biology grade, 10 T4 RNA ligase buffer, T4 RNA ligase 2 truncated (NEB). 14. SYBR Gold nucleic acid gel stain (10,000 concentrate; Life Technologies). 15. DNA ladder (20 bp; Takara Bio). 16. 2 TBE-urea (TBU) denaturing sample buffer (Life Technologies). 17. SuperScript™ IV Reverse Transcriptase, 5 RT buffer, 0.1 M DTT (ThermoFisher Scientific). 18. 10 TBE buffer. 19. dNTP mix (10 mM; Life Technologies). 20. CircLigase ssDNA ligase (100 U/μL), 10 CircLigase reaction buffer, 1 mM ATP, 50 mM MnCl2 (Epicentre). 21. Dynabeads MyOne streptavidin C1 (Life Technologies). 22. 20 SSC buffer.

50

Olga Jasnovidova et al.

23. Phusion high-fidelity (HF) DNA polymerase (2000 U/mL) and 5 Phusion HF buffer (NEB). 24. DMSO, molecular biology grade.

3 3.1

Methods Cell Culture

3.2 Chromatin Preparation

Grow adherent or suspension cells in a suitable growth medium and at an appropriate density or concentration, as recommended by the ENCODE guidelines. For isolation of the chromatin-associated RNA, the cell population should have a viability of at least 90%. The method presented here can be combined with various treatments such as addition of transcription inhibitors (e.g., flavopiridol [9]). The chromatin preparation method works successfully for an input of 1–15 million cells. Up to six samples can typically be processed in parallel. Use RNA/DNA low-binding tubes and low-binding pipette tips throughout the procedure. It is essential to prepare all buffers with RNase-free reagents immediately before the experiment and precool buffers on ice till use. The 5 M urea stock solution needs to be freshly prepared before each experiment. The preparation of the buffers requires 45–60 min. Unless indicated otherwise, all steps are performed on ice. 1. Count cells and collect 1  107 cells in a 15 mL falcon tube. Pellet cells for 4 min at 200  g at 4  C. Discard the supernatant. 2. To wash out media traces, gently resuspend cells in 5 mL of ice-cold PBS. Pellet cells for 4 min at 200  g at 4  C. Discard the supernatant. 3. Carefully resuspend cells in 0.5 mL of ice-cold PBS. Transfer the cells into 1.5 mL tubes, spin 3 min at 60  g, 4  C. Discard the supernatant. 4. Resuspend the cell pellet in 200 μL of cytoplasmic lysis buffer by gently pipetting up and down several times using a widebore P1000 tip. Incubate the cells on ice for 5 min (see Note 3). 5. During the incubation prepare tubes with sucrose cushion. Pipette 400 μL of sucrose buffer into a new 1.5 mL tube. Briefly spin tubes. 6. Using a wide bore tip carefully layer the lysed cells onto the sucrose cushion. The cell lysate will form a layer on the top of the cushion. Centrifuge for 10 min at 16,000  g, 4  C. The nuclei will form a white pellet.

Enhancer Transcription at Nucleotide Resolution

51

7. Discard the supernatant (cytoplasm) or transfer into a new 1.5 mL tube. Avoid lifting the nuclei pellet (see Note 4). 8. Gently wash nuclei pellet with 500 μL nuclei wash buffer. Centrifuge for 2 min at 1150  g, 4  C. Discard the supernatant. 9. Carefully resuspend the nuclei pellet in 200 μL glycerol buffer by pipetting up and down several times using a wide-bore P1000 tip. Ensure that the buffer was mixed well before adding to the sample. The nuclei suspension should be homogenous. 10. Add 200 μL nuclei lysis buffer. Pipette up and down with a cut tip. Invert the tube a few times, until the “precipitating” chromatin becomes visible. 11. Pulse-vortex three times for 5 s. Incubate on ice for 2 min. Centrifuge for 2 min at 18,500  g, 4  C. 12. Discard the supernatant (nucleoplasm) or transfer to a new 1.5 mL tube (see Note 4). 13. Briefly spin and discard the supernatant. 14. Wash the chromatin pellet with 0.5 mL of PBS. This will help to remove nucleoplasmic remnants. 15. Add 100 μL of chromatin resuspension buffer to the chromatin pellet. 16. Add 700 μL Qiazol. Place the tube on a rotator for 10 min. Vortex for 5 min. Repeat until chromatin is completely dissolved (see Note 5). Potential pause point: store the sample at 80  C. 3.3 Purification of Nascent RNA

Phenol and chloroform are toxic. Perform all steps under the chemical hood. 1. Prepare the phase lock tubes by spinning them for 30 s at 12,000  g at room temperature. 2. Transfer the sample dissolved in Qiazol into the phase lock tube. 3. Add 140 μL chloroform (1 volume of Qiazol: 0.2 volume of chloroform). 4. Thoroughly mix the sample by gently inverting the tube for 15 s. Do not vortex! Incubate for 2 min at room temperature. 5. Centrifuge for 5 min at 13,000  g at room temperature. 6. Transfer the aqueous phase to a 1.5 mL tube. Measure volume of the solution by pipetting. Add 1.5 sample volumes of 100% (v/v) ethanol. Mix by inversion (see Note 6). 7. Continue RNA extraction according to manufacturer’s instructions. Critical: perform on-column DNase I cleavage according to manufacturer’s instructions.

52

Olga Jasnovidova et al.

8. Elute RNA with 35 μL nuclease-free H2O. Add H2O directly onto the membrane, incubate for 2 min at room temperature. Centrifuge for 2 min at 10,000  g, room temperature. Discard the column and keep the eluate on ice. 9. Quantify the RNA using Nanodrop or Qubit fluorometer according to the manufacturer’s instructions. In case human cancer cell lines are used, the expected RNA yield is 1–2 μg per one million of cells (see Note 7). 10. Keep samples on ice and proceed. Potential pause point: store the sample at 80  C for months. 3.4 Preparation of Sequencing Library 3.4.1 DNA Barcode Linker Ligation, RNA Fragmentation, and RNA Clean Up

Next, 30 -hydroxyl group (-OH) of nascent RNAs are ligated to the DNA linker, which contains a random hexamer sequence at its 50 -end. In a typical NET-Seq library preparation, 3 μg of the RNA are used as an input. As a control of the ligation efficiency, we recommend to also process the custom control RNA oligo oGAB11 (see 2.2.3). 1. Denature 3.5 μg of RNA using a heating block or PCR cycler for 2 min at 80  C. Cool the RNA on ice for 2 min. Also, denature 3 μL of oGAB11 (see Note 8). 2. Prepare the DNA linker ligation master mix at room temperature as described below. Mix well. Add the enzyme at the end and mix.

Reagent

oGAB11 RNA sample Master mix for 3.5 control (triplicate!) (μL) reactions (μL) (μL)

RNase/DNase-free H2O

Count

Count

5.2

PEG 8000 [50% (v/v)]

8

28

8

DMSO

2

7

2

10 T4 RNA ligase buffer

2

7

2

Hexamer barcode DNA linker (100 μM)

1

3.5

1

RNA sample (1 μg/ reaction)

Count

Count

–

oGAB11 (10 μM)

–

–

1

Truncated T4 RNA ligase 2

1

3.5

1

Total volume

20

20/tube

20

Enhancer Transcription at Nucleotide Resolution

53

3. Incubate the reaction at 37  C for 3 h in a PCR cycler. 4. Transfer ligation reactions on ice. Keep the oGAB11 control sample on ice (no fragmentation). For the oGAB11 control, proceed with step 8. For the other samples, proceed with step 5. 5. Add 2.0 μL NEBNext® RNA Fragmentation Buffer to each tube (see Note 9). Mix by pipetting. 6. Incubate at 95  C for 10 min. Preheat the PCR cycler before adding the samples (see Note 10). 7. Stop fragmentation immediately by adding 2 μL of NEBNext® RNA Fragmentation Stop Solution to each sample. Briefly vortex samples, spin and mix by pipetting up and down several times. Keep samples on ice. 8. Pool the three reactions corresponding to the same original sample. Purify the ligated and fragmented RNA using the ZYMO RNA clean and concentrator-5 according to manufacturer’s protocol. Purify the ligated oGAB11 control. 9. Elute ligated RNA with 17 μL RNase-free H2O. Repeat the elution with additional 17 μL RNase-free H2O into the same tube. Elute oGAB11 with 12 μL of RNase-free H2O. 10. Keep the purified ligated and fragmented RNA on ice. Potential pause point: store the sample at 80  C. 3.4.2 RNA Size Selection and Gel Extraction

1. For the samples, add 30 μL 2 TBU sample buffer to 30 μL eluate; for the oGAB11 control, add 10 μL 2 TBU sample buffer to 10 μL of the oGAB11 eluate as well as to 10 μL of the unligated oGAB11. Denature the samples at 80  C for 2 min in a heating block. Prepare the Takara 20 bp DNA ladder by mixing 9.5 μL H2O and 0.5 μL of the ladder with 10 μL TBU sample buffer. Denature the DNA ladder at 80  C for 5 min. Place samples and DNA ladder on ice for 3 min. 2. Pre-run a 15% (w/v) TBE-urea acrylamide gel for 15 min at 200 V. 3. After pre-cleaning the wells by pipetting the running buffer, load 10 μL of the ladder, and 20 μL sample into different wells. Also, load 20 μL of each of the oGAB11 controls. 4. Run the gel for 65 min at 200 V at room temperature. 5. Stain the gel for 5 min in 1 SYBR Gold in 1 TBE running buffer on a shaker. 6. Visualize the RNA on a blue light table. Wear suitable protective glasses! If the linker ligation worked efficiently, >90% of oGAB11 should be shifted by 25 nt to the higher molecular weight as compared to unligated oGAB11.

54

Olga Jasnovidova et al.

Fig. 2 Gallery of size selections performed during NET-Seq library preparation. (a) Size selection of fragmented RNA (see 3.4.2). The fragmented RNA was separated on a 15% (w/v) TBE-urea gel. 1 μg of fragmented RNA was loaded per lane. The size-selected region is shown by yellow frames. (b) Size selection of cDNA following reverse transcription (RT) (see 3.4.4). The cDNA was separated on a 10% (w/v) TBE-urea gel and sizeselected, as indicated by black frames. RT, reverse transcription. (c) PCR amplifications to determine the lowest number of amplification cycles that is required (see 3.4.7). The PCR was stopped after 6, 8, 10, and 12 amplification cycles. The PCR products were separated on an 8% (w/v) TBE gel. The NET-Seq library runs at ~150 bp. The PCR product that arises from empty circles runs at ~120 bp. PCR products in the higher molecular range are indicative for overamplification. Seven amplification cycles were optimal in this NET-Seq library preparation. (d) Final NET-Seq libraries were separated on an 8% (w/v) TBE gel (Subheading 3.4.8). The excised band is indicated by a black box. NET-Seq library was generated for human K562 cells (A–D)

7. Cut out the smear between 45 and 120 nt (see Fig. 2a). 8. Homogenize gel slices. Pierce the bottom of a 0.5 mL low-bind tube with a 20G needle and place into a 2 mL low-bind tube. Transfer the gel slice of each lane into the pierced tube. Centrifuge for 4 min at 20,000  g at room temperature. Repeat centrifugation, if pieces of the gel remain in the inner tube. Discard the pierced tube. 9. Purify the ligated RNA using the ZR small-RNA PAGE Recovery Kit. Add 400 μL RNA recovery buffer. 10. Transfer the homogenized gel to a Zymo-Spin III-F filter using a wide bore P1000 tip. 11. Incubate the sample on the column for 15 min at 65  C and 1000 rpm in a thermomixer. 12. Freeze the sample for 5 min on dry ice or at a 80  C. 13. Transfer the sample to 65  C for 5 min. 14. Centrifuge the Zymo-Spin III-F filter at 5000  g for 2 min. 15. Transfer the flow-through to a Zymo-Spin IIICG column. Centrifuge for 30 s at 2000  g.

Enhancer Transcription at Nucleotide Resolution

55

16. Collect the flow-through and measure its volume. Add two volumes of RNA MAX buffer to the flow-through. Mix by pipetting. 17. Transfer up to 700 μL to a white Zymo-Spin IC column. Transfer the material from the three gel pieces of the same sample that were processed separately onto the same column. 18. Centrifuge for 30 s at 13,000  g. Repeat to load the remaining sample volume. Discard the flow-through. Place the column back into the collection tube. 19. Add 400 μL RNA Prep buffer to the column and centrifuge for 1 min at 13,000  g. Discard the flow-through. 20. Add 800 μL RNA Wash buffer and centrifuge for 30 s at 13,000  g. Discard the flow-through. Repeat this step with 400 μL RNA Wash buffer. 21. Place the column into a fresh collection tube and centrifuge for 2 min at 13,000  g to remove the residual wash buffer. Place the column into a fresh 1.5 mL tube. 22. Add 11 μL nuclease-free H2O onto the membrane. Let the column stand on the benchtop for 2 min, then centrifuge for 1 min at 10,000  g to elute the RNA. 23. Reapply the eluate to the column. Let the column stand on the benchtop for 2 min before centrifugation, centrifuge for 1 min at 10,000  g. 24. Keep the RNA on ice. Potential pause point: store the sample at 80  C for months. 3.4.3 Reverse Transcription

1. If only one sample is further processed, add the required amount of oLS007 oligo (see 2.2.3) and dNTPs directly to 10 μL of RNA. Keep on ice. If multiple samples are further processed, prepare a master mix and add 1.3 μL per RNA sample. Mix several times by pipetting. Reagent

For one reaction (μL)

oLS007 oligo (10 μM)

0.5

dNTP (10 mM)

0.8

ligated and fragmented RNA

10

Total volume

11.3

2. Denature the RNA and allow oligo annealing using a PCR cycler: 2 min at 80  C, 5 min at 65  C, 2 min at 4  C. Transfer tubes to ice.

56

Olga Jasnovidova et al.

3. Prepare the reverse transcription reaction mix as described below: Reagent

For one reaction (μL)

5 SSIV buffer

3.5

0.1 M DTT

0.85

RNase OUT

0.85

Superscript™ IV

0.85

Total volume

6

4. If more than one sample is processed, prepare a master mix without Superscript™ IV and aliquot. Add Superscript™ IV and mix by pipetting several times. Proceed sample by sample. 5. Perform reverse transcription for 20 min at 55  C in a PCR cycler. 6. Degrade the RNA by alkaline RNA hydrolysis. Add 1.8 μL of 1 M NaOH to each tube and mix by pipetting several times. Incubate the reaction for 20 min at 98  C in a PCR cycler. 7. Stop and neutralize the reaction by adding 1.8 μL of 1 N HCl. Potential pause point: store the sample at 20  C overnight. 3.4.4 ssDNA Size Selection and Gel Extraction

1. Add 19 μL of 2 TBU sample buffer to each sample. Prepare the DNA ladder as described in step 1, Subheading 3.4.2. Denature the samples and the ladder at 95  C for 3 min in the PCR cycler, then place samples and ladder on ice for 3 min. 2. Pre-run a 10% (w/v) TBE-urea acrylamide gel for 15 min at 200 V in 1 TBE. 3. Load 10 μL of the ladder or 20 μL sample per lane. 4. Run the gel for 65 min at 200 V at room temperature. 5. Transfer the gel into the staining solution and stain for 5 min on a shaking platform. 6. Visualize the DNA on a blue light table. Wear suitable protective glasses! 7. Cut out the part between 90 nt and 170 nt (see Fig. 2b). 8. Homogenize the gel pieces as described in step 8, Subheading 3.4.2. Prepare one tube per lane to be extracted. 9. Use the ZR small-RNA PAGE Recovery Kit for purification as described in steps 9–21, Subheading 3.4.2. Pool the material of the same sample that was processed separately upon loading to the Zymo-Spin IC column (see 3.4.2, step 17).

Enhancer Transcription at Nucleotide Resolution

57

10. Add 16 μL nuclease-free H2O onto the column. Let the column stand on the benchtop for 2 min. Centrifuge for 1 min at 10,000  g to elute the ssDNA. 11. Reapply the eluate to the column as described in the previous step. Keep the ssDNA on ice. Potential pause point: store the sample at 20  C indefinitely. 3.4.5 Circularization

1. Add 2.0 μL 10 CircLigase buffer, 1.0 μL 1 mM ATP, 0.5 μL 50 mM MnCl2, and 1.0 μL CircLigase to 15.5 μL cDNA from step 11, Subheading 3.4.4. Mix by pipetting several times (see Note 11). Reagent

For one reaction (μL)

10 CircLigase buffer

2

1 mM ATP

1

50 mM MnCl2

0.5

eluted ssDNA

15.5

CircLigase

1

Total volume

20

2. In a PCR cycler, incubate the reaction for 60 min at 60  C, followed by 10 min at 80  C to stop the reaction. 3. Keep the sample on ice. Potential pause point: store the sample indefinitely at 20  C. 3.4.6 Depletion of Abundant Mature RNAs

1. Prepare a circular cDNA precipitation mix, aliquot the amount needed for one library (326 μL) into a new 1.5 mL tube. Keep on ice. 2. Prepare a 1 magnetic bead equilibration buffer by diluting the 2 magnetic bead equilibration buffer. One reaction requires 330 μL. 3. Resuspend the streptavidin-coated magnetic beads by gentle vortexing. For one reaction, transfer 110 μL of beads into a new 1.5 mL tube. In case of multiple reactions beads can be combined in one tube (e.g., for N reactions, take N.2  volume). 4. Place the tube on a magnetic rack for 2 min. Remove the clarified liquid. 5. Remove the tube from the magnetic rack. Resuspend beads in 110 μL of 1 magnetic bead equilibration buffer. Place the tube on a magnetic rack for 2 min. Remove the clarified liquid. Repeat for a total of three washes.

58

Olga Jasnovidova et al.

6. Following the final wash, resuspend the beads for one reaction in 40 μL of 2 magnetic bead equilibration buffer. If multiple reactions are prepared, scale up the volume accordingly. Pipette slowly to avoid foaming. Prepare 40 μL aliquots of washed and resuspended beads. 7. Equilibrate the beads at 37 15–30 min.



C in a thermomixer for

8. Meanwhile, proceed with the hybridization reaction. Add the components listed below directly to the circularized cDNA obtained in Subheading 3.4.5. Reagent

For one reaction (μL)

circularized cDNA

20

Depletion oligo mix

4

20 SSC buffer

4

RNase/DNase-free H2O

12

Total volume

40

9. In a PCR cycler, perform the hybridization of depletion oligos and the complementary cDNA using the following program. Step

Temperature 

Denature

99 C

Annealing

99  C ! 37  C in 0.1  C steps; 1 s per 0.1  C

Final annealing

37  C

Time 90 s

15 min

10. Add the hybridization mix (40 μL) to 40 μL of the equilibrated magnetic beads and mix well by pipetting. Incubate for 15 min at 37  C and 1000 rpm in a thermomixer. This needs to be done quickly to prevent premature cooling of the samples. 11. Transfer tubes to a magnetic rack, incubate for 1 min, and then transfer the entire supernatant to a new 1.5 mL tube containing 326 μL of the circular cDNA precipitation mix. It is critical to avoid transferring any magnetic beads. Mix well and keep on ice. 12. Add 600 μL of 100% isopropanol, mix well and put on ice for 15 min. Precipitate at 20  C overnight. 13. Pellet the ssDNA precipitate by centrifugation for at least 1 h at 20,000  g, 4  C. Carefully remove the supernatant and avoid touching the blue pellet. 14. Wash the pellet with 750 μL of freshly prepared ice-cold 80% (v/v) ethanol. Spin at 20,000  g and 4  C for 2 min. Discard

Enhancer Transcription at Nucleotide Resolution

59

the supernatant. Repeat for a total of two washes. After the final wash, briefly spin the tube and carefully remove the remaining liquid. Dry the pellets at room temperature until all visible liquid has evaporated and the pellet appears transparent, i.e. for 8–10 min. Resuspend the pellet in 16 μL nucleasefree H2O. Potential pause point: store the sample indefinitely at 20  C. 3.4.7 PCR Cycle Optimization

In order to minimize the amount of PCR duplicates and the formation of concatemers, it is crucial to limit the number of amplification cycles. To determine the minimal number of required PCR cycles, we usually test 6, 8, 10 and 12 cycles. Different index primers can behave differently. 1. For each condition, prepare one reaction as shown below (see Note 12). To test all four conditions, prepare a master mix. Mix the primers by pipetting up and down several times before adding to the master mix. Add the enzyme and gently mix. Aliquot 20 μL into new PCR tubes. Keep the samples on ice.

Reagent

For one reaction (μL)

Master mix for 4.2 reactions (μL)

5 Phusion HF buffer

3.8

16

10 mM dNTP

0.375

1.6

indexed forward primer (100 μM)

0.1

0.4

universal reverse primer oNTI231 (100 μM)

0.1

0.4

RNase-free H2O

14.4

60.5

Phusion DNA polymerase

0.225

0.9

DNA template

1

4.2

Total volume

20

20/tube

2. Perform PCR as follows: Step

Temperature ( C)

Time (s)

Cycles

Denature

98

30

1

Denature Annealing Extension

98 60 72

10 10 5

6–12

4

Pause

1

60

Olga Jasnovidova et al.

3. Stop the PCR after completion of the respective amplification cycle by placing the sample on ice. Do not stop or pause the PCR program. 4. Add 4 μL 6 DNA loading buffer per PCR sample. Prepare the DNA ladder and add an appropriate volume of 6 DNA loading buffer. Load 24 μL of each sample and an appropriate volume of the ladder on an 8% (w/v) TBE gel. 5. Run the gel at 180 V for 60 min. 6. Stain the gel in 1 TBE containing 1 SYBR Gold for 5 min on a shaker at room temperature. 7. Visualize the RNA on a blue light table or UV light. Wear suitable protective glasses! 3.4.8 NET-Seq Library Amplification and Final Quality Checks

For the final library amplification, choose the number of PCR amplification cycles that result in a clearly visible PCR product at around 150 bp but does not yet lead to products of higher molecular weight (Fig. 2c, d, see Note 12). 1. Prepare a master mix for 6–8 reactions as shown in Subheading 3.4.7. 2. Perform PCR as shown in Subheading 3.4.7 using the optimized number of PCR cycles. 3. Perform the gel electrophoresis as described in Subheading 3.4.7. 4. Visualize the PCR product on a blue light table. Wear suitable protective glasses! Excise the broad band at around 150 nt, corresponding to the NET-Seq library. 5. PCR products of two lanes are extracted together. Pierce the bottom of a 0.5 mL low-bind tube with a 20 G needle and place into a 2 mL low-bind tube as described in step 8, Subheading 3.4.2. Transfer the gel slices (from two lanes) into the pierced 0.5 mL tube. Centrifuge for 4 min at 20,000  g, room temperature. Repeat, if gel pieces remain in the inner tube. Discard the inner tube. 6. Add 668 μL of fresh DNA soaking buffer. Put the tubes on a shaker at room temperature, 1400 rpm overnight. 7. Transfer the gel slurry from two lanes onto one filter tube and centrifuge for 3 min at 20,000  g. Repeat the centrifugation step to increase the recovery of the NET-Seq library. 8. Add 2 μL of GlycoBlue and 680 μL 100% isopropanol to each tube. Mix by inverting the tubes several times. Put the sample to 20  C for at least 1 h. Potential pause point: store the sample overnight at 20  C.

Enhancer Transcription at Nucleotide Resolution

61

9. Centrifuge the sample for at least 1 h at 20,000  g, 4  C to collect the precipitated library. A blue compact pellet is visible. 10. Remove the supernatant. Wash the pellets by adding 750 μL freshly prepared ice-cold 80% (v/v) ethanol. Immediately remove most of the ethanol without disturbing the pellet. Spin 2 min at 12,000  g, 4  C. Carefully remove any remaining supernatant. Air-dry the pellets until they become transparent (100 million reads. In case NET-Seq is mainly used for studying enhancer transcription, we recommend to sequence NET-Seq libraries to greater depth due to overall lower transcription levels at enhancer regions.

3.6 Computational Analysis

Finally, the obtained mammalian NET-Seq data sets are computationally analyzed. An updated version of the computational NETSeq analysis pipeline is provided at our GitHub site that can be accessed here: https://github.molgen.mpg.de/MayerGroup/netseq-pipeline. Briefly, NET-Seq data processing begins with the extraction of the hexamer barcode, followed by trimming of adapter sequences and aligning the sequencing reads to the reference genome. The 50 -nucleotide of the reads corresponding to the 30 -most nucleotide of the original nascent RNA is extracted and recorded. PCR duplicates are identified as reads with identical sequences and the same barcodes and are removed. Our analysis pipeline also identifies artifacts that can arise during reverse transcription due to mispriming as reads for which the hexamer barcode is identical to the adjacent sequence in the reference genome. The computational analysis of NET-Seq data results in DNA strandspecific occupancy profiles of transcriptionally engaged Pol II (Fig. 3).

62

Olga Jasnovidova et al.

Fig. 3 Exemplary NET-Seq result for a transcribed enhancer. NET-Seq reads for Watson and Crick strands are displayed in red and blue, respectively. ChIP signal for H3K4 mono- and tri-methylation [33], and Fantom5 enhancer annotation are displayed as reference. Results are shown for human K562 cells

4

Notes 1. In order to capture short RNA species (17 nt). 2. The set of depletion oligos listed here was originally designed for HeLa cells but also functions efficiently for K562 and HEK293 cells, and potentially also for other human cell lines. You can easily replace or add depletion oligos if necessary to increase the fraction of informative reads. 3. Efficiency of cell lysis can be monitored using light microscopy. On a glass slide, mix 1 μL of Trypan blue dye with 1 μL of lysed cells. Under the microscope, nuclei of lysed cells will appear as small and dark blue colored dots as compared to non-lysed cells, which are larger in size and less colored. Always use a sample of non-lysed cells as a control. 4. For each new cell line, we recommend to monitor the success of the cell fractionation by Western blot analysis probing at least for the cytoplasmic marker GAPDH, the chromatin marker histone H2B and for p-Ser2 RPB1 corresponding to the elongating form of Pol II. For Western blot analysis, perform the fractionation as described in Subheading 3.2. Omit α-amanitin and RNase inhibitors in subcellular fractionation buffers. Solubilize the chromatin pellet by benzonase nuclease treatment: add 1 μL of benzonase to the chromatin fraction, incubate sample with gentle agitation at room temperature until the pellet is solubilized. Adjust volumes of the cytoplasmic, nucleoplasmic, and chromatin samples to allow comparisons of Western blot signals between the subcellular fractions. >95% of p-Ser2 RPB1 should be detected in the chromatin

Enhancer Transcription at Nucleotide Resolution

63

fraction. A lower percentage indicates harsh handling of cells or nuclei. For additional information, please consult our protocol on subcellular RNA-Seq [24]. 5. Pipetting with a regular P1000 helps to dissolve vortexresistant chromatin clumps. Do not use a syringe. Incomplete resuspension will decrease the RNA yield. 6. If the organic and aqueous phases are not well separated after centrifugation, this could be due to a high density of the aqueous phase. To reduce the density, add 50–100 μL of either RNase-free H2O or PBS to the sample prior to centrifugation. 7. The number of cells that are required as an input for the NET-Seq library preparation depends on the cell type. Stable cancer cell lines have overall more expression as compared to primary cells. Therefore, less cells are required as an input as compared to primary cells. 8. Avoid presence of free divalent ions in the RNA samples as they will cause degradation of RNA upon heating. 9. RNA fragmentation is based on the reactivity of Mg2+ ions. While other buffer formulations are also able to fragment RNA, we found NEBNext® RNA Fragmentation Buffer to give the most reproducible results. 10. The RNA fragmentation time should be optimized for each new lot of fragmentation buffer. To determine the optimal fragmentation time, prepare a ligation reaction mix for four reactions. Add reactions to four 0.2 mL tubes. To save reagents, the DNA linker as well as the ligase can be replaced by nuclease-free H2O. Do not replace other buffer components. Add 2 μL NEBNext® RNA Fragmentation Buffer to each tube and proceed as explained in step 6 of 3.4.1, but stop fragmentation after 6, 8, 10, and 12 min. Purify the samples as described in steps 8 to 9 of 3.4.1 and monitor the size distribution with both gel electrophoresis using a 15% TBE-urea gel and a BioAnalyzer or TapeStation. 11. The concentration of Mn2+ ions in the circularization reaction is critical. An excess of Mn2+ ions can result in a brown precipitate and a failure of the circularization reaction. Another possibility for inefficient circularization is the degradation of ATP over time. Therefore, we recommend to store ATP in aliquots to limit the number of freeze-thaw cycles. We also recommend to replace unused ATP solutions every 4 months. 12. If none of the tested PCR conditions seem suitable, you can increase the sample volume to 1.5 or 2.0 μL per reaction. Using more than 1 μL of template will reduce the number of PCR cycles that are required to obtain sufficient amounts of the NET-Seq library.

64

Olga Jasnovidova et al.

Acknowledgments We thank all members of the Mayer group for critical comments on the manuscript. This work was funded by the Max Planck Society (to A.M.) and the Deutsche Forschungsgemeinschaft (DFG, grant no. 418415292 to A.M. and the International Research Training Group (IRTG) 2403 to A.M. and M.A.). O.J. was supported by a 2017 FEBS Long-Term Fellowship. References 1. Kim T-K, Hemberg M, Gray JM et al (2010) Widespread transcription at neuronal activityregulated enhancers. Nature 465:182–187 2. Li W, Notani D, Rosenfeld MG (2016) Enhancers as non-coding RNA transcription units: recent insights and future perspectives. Nat Rev Genet 17:207–223 3. Andersson R, Gebhard C, Miguel-Escalada I et al (2014) An atlas of active enhancers across human cell types and tissues. Nature 507:455–461 4. Lam MTY, Li W, Rosenfeld MG et al (2014) Enhancer RNAs and regulated transcriptional programs. Trends Biochem Sci 39:170–182 5. Chen H, Du G, Song X et al (2017) Non-coding transcripts from enhancers: new insights into enhancer activity and gene expression regulation. Genom Proteom Bioinformat 15:201–207 6. Schwalb B, Michel M, Zacher B et al (2016) TT-seq maps the human transient transcriptome. Science 352:1225–1228 7. Wissink EM, Vihervaara A, Tippens ND et al (2019) Nascent RNA analyses: tracking transcription and its regulation. Nat Rev Genet 20:705–723 8. Churchman LS, Weissman JS (2011) Nascent transcript sequencing visualizes transcription at nucleotide resolution. Nature 469:368–373 9. Mayer A, di Iulio J, Maleri S et al (2015) Native elongating transcript sequencing reveals human transcriptional activity at nucleotide resolution. Cell 161:541–554 10. Nojima T, Gomes T, Grosso ARF et al (2015) Mammalian NET-Seq reveals genome-wide nascent transcription coupled to RNA processing. Cell 161:526–540 11. Zhu J, Liu M, Liu X et al (2018) RNA polymerase II activity revealed by GRO-seq and pNET-seq in Arabidopsis. Nat Plants 4:1112–1123 12. Kindgren P, Ivanov M, Marquardt S (2020) Native elongation transcript sequencing reveals

temperature dependent dynamics of nascent RNAPII transcription in Arabidopsis. Nucleic Acids Res 48:2332–2347 13. Shetty A, Kallgren SP, Demel C et al (2017) Spt5 plays vital roles in the control of sense and antisense transcription elongation. Mol Cell 66:77–88.e5 14. Wery M, Gautier C, Descrimes M et al (2018) Native elongating transcript sequencing reveals global anti-correlation between sense and antisense nascent transcription in fission yeast. RNA 24:196–208 15. Larson MH, Mooney RA, Peters JM et al (2014) A pause sequence enriched at translation start sites drives transcription dynamics in vivo. Science 344:1042–1047 16. Vvedenskaya IO, Vahedian-Movahed H, Bird JG et al (2014) Interactions between RNA polymerase and the “core recognition element” counteract pausing. Science 344:1285–1289 17. Clarke AM, Engel KL, Giles KE et al (2018) NETSeq reveals heterogeneous nucleotide incorporation by RNA polymerase I. Proc Natl Acad Sci 115:E11633–E11641 18. Drexler HL, Choquet K, Churchman LS (2020) Splicing kinetics and coordination revealed by direct nascent RNA sequencing through nanopores. Mol Cell 77:985–998.e8 19. Mylonas C, Tessarz P (2019) NET-prism enables RNA polymerase-dedicated transcriptional interrogation at nucleotide resolution. RNA Biol 16:1156–1165 20. Hirabayashi S, Bhagat S, Matsuki Y et al (2019) NET-CAGE characterizes the dynamics and topology of human transcribed cis-regulatory elements. Nat Genet 51:1369–1379 21. Fischl H, Howe FS, Furger A, Mellor J (2017) Paf1 has distinct roles in transcription elongation and differential transcript fate. Mol Cell 65:685–698.e8 22. Imashimizu M, Takahashi H, Oshima T et al (2015) Visualizing translocation dynamics and

Enhancer Transcription at Nucleotide Resolution nascent transcript errors in paused RNA polymerases in vivo. Genome Biol 16:98 23. Bernecky C, Herzog F, Baumeister W et al (2016) Structure of transcribing mammalian RNA polymerase II. Nature 529:551–554 24. Mayer A, Churchman LS (2017) A detailed protocol for subcellular RNA sequencing (subRNA-seq). Curr Protoc Mol Biol 120:4.29.1–4.29.18 25. Mayer A, Churchman LS (2016) Genomewide profiling of RNA polymerase transcription at nucleotide resolution in human cells with native elongating transcript sequencing. Nat Protoc 11:813–833 26. Wuarin J, Schibler U (1994) Physical isolation of nascent RNA chains transcribed by RNA polymerase II: evidence for cotranscriptional splicing. Mol Cell Biol 14:7219–7225 27. Pandya-Jones A (2011) Pre-mRNA splicing during transcription in the mammalian system. Wiley Interdiscip Rev RNA 2:700–717 28. Bhatt DM, Pandya-Jones A, Tong A-J et al (2012) Transcript dynamics of

65

proinflammatory genes revealed by sequence analysis of subcellular RNA fractions. Cell 150:279–290 29. Brueckner F, Cramer P (2008) Structural basis of transcription inhibition by α-amanitin and implications for RNA polymerase II translocation. Nat Struct Mol Biol 15:811–818 30. Lindell TJ, Weinberg F, Morris PW et al (1970) Specific inhibition of nuclear RNA polymerase II by alpha-amanitin. Science 170:447–449 31. Cai H, Luse DS (1987) Transcription initiation by RNA polymerase II in vitro. Properties of preinitiation, initiation, and elongation complexes. J Biol Chem 262:298–304 32. Kireeva ML, Komissarova N, Waugh DS et al (2000) The 8-nucleotide-long RNA:DNA hybrid is a primary stability determinant of the RNA polymerase II elongation complex. J Biol Chem 275:6530–6536 33. Shah RN, Grzybowski AT, Cornett EM et al (2018) Examining the roles of H3K4 methylation states with systematically characterized antibodies. Mol Cell 72:162–177.e7

Chapter 4 Low Quantity Single Strand CAGE (LQ-ssCAGE) Maps Regulatory Enhancers and Promoters Hazuki Takahashi, Hiromi Nishiyori-Sueki, Jordan A. Ramilowski, Masayoshi Itoh, and Piero Carninci

1

Introduction Cap Analysis of Gene Expression (CAGE) is a method to profile RNA expression and precisely identify promoters and regulatory elements such as enhancers. CAGE can identify not only proteincoding RNAs but also noncoding RNAs, which are capped when produced by RNA polymerase II. CAGE technology has been developed and modified over the years to follow advanced sequencing technologies and biological interests [1–6]. Classically, promoters and enhancers are defined as genomic elements which proximally initiate and distally enhance transcription, respectively. A part of promoters is highly cell type specific and dynamically associate with nuclear architecture such as histone modifications and nucleosome-depleted regions, together with the enhancer RNAs (eRNAs). Unlike RNAs derived from standard promoters, eRNAs are typically unstable and poorly adenylated transcripts, and located up to 1 Mb apart from the core promoter in the nucleus. However, many transcriptome analyses have shown that distal enhancers might also play roles in the promoter activity (reviewed in [7]). We previously analyzed comprehensive cell nuclear CAGE datasets from polyadenylated (poly-A) and nonpoly-A RNAs with chromatin architectural datasets from

Hazuki Takahashi and Hiromi Nishiyori-Sueki authors contributed equally to this work. The original version of this chapter was revised. The correction to this chapter is available at https://doi.org/ 10.1007/978-1-0716-1597-3_21 Tilman Borggrefe and Benedetto Daniele Giaimo (eds.), Enhancers and Promoters: Methods and Protocols, Methods in Molecular Biology, vol. 2351, https://doi.org/10.1007/978-1-0716-1597-3_4, © The Author(s) 2021, Corrected Publication 2021

67

68

Hazuki Takahashi et al.

ENCODE consortium, which showed that promoters are associated with the complex three-dimensional interconnected chromatin network [8]. Enhancers and promoters are known to act as highly cell typespecific regulatory elements [8–10] and active enhancers are likely to transcribe eRNAs that are interacting through chromatin looping with promoters [11]. Further analysis of enhancer–promoter (EP) interactions of ENCODE CAGE datasets also showed that eRNAs expression associated with predicted EP interactions are clearly cell type specific [12]. Importantly, together with eRNAs and promoters, long noncoding RNAs (lncRNAs) overlap regions known to be involved in human genetic traits. In particular, these elements overlap expression quantitative trait loci (eQTL) and single nucleotide polymorphisms (SNPs) associated with genome-wide association studies (GWAS). In particular, lncRNAs corresponding to promoters/enhancers are significantly and specifically co-expressed in cell types that are interrelated in several human diseases [13]. In addition, the single-base resolution of CAGE TSS mapping has revealed that transcription initiation at thousands of promoters dynamically shifts throughout the specific zebrafish early developmental stage, which are orchestrated with epigenomic chromatin modifications [14]. To further broaden these analyses, we have developed the highthroughput low quantify single strand (LQ-ssCAGE) method, which is based on previously developed cap trapper technologies [15]. The method is designed to analyze promoters and enhancers usages with single nucleotide resolution from large number of sample, which may include human patient samples, early developmental stage samples and specific cell types. An initial study using the LQ-ssCAGE method demonstrated that antisense lncRNA– mRNA pairs have specific expression patterns in the cellular compartment from zebrafish early developmental stage [16]. The LQ-ssCAGE presented here captures both poly-A and non-poly-A transcripts by using a 15 nucleotides (N15) random primer in the reverse transcriptase (RT) reaction, before CAP trapper procedures (see the workflow of the protocol in Fig. 1). A key advantage of the LQ-ssCAGE is in using small quantities of RNA yet avoiding PCR amplification, which would otherwise lead to biased and noisy quantification of expression. In addition to promoter and enhancer annotations from single CAGE reads, the LQ-ssCAGE can provide complexity of the promotome-transcript structure from paired-end reads [3]. Compared to other CAGE methods [4, 5], the LQ-ssCAGE protocol is further simplified, as the loaded in the sequencer material consists simply of single stranded cap selected cDNAs. In summary, LQ-ssCAGE protocol (1) can work with RNA amount as little as 25 ng, (2) shortens the preparation time (less than 3 days) and (3) allows for preparing multiple libraries in parallel in

LQ-ssCAGE Protocol and the Analysis

69

RT reaction in different well using RT primer with barcode barcode 1 㻾㻺㻭

㻔㻻㻴㻕㻞㻙 㻯㻭㻼

㻭㻭㻭㻭㻭㻭㻭䞉䞉䞉㻭㻭㻭㻭㻭㻭 㻾㼀㻌㼜㼞㼕㼙㼑㼞㻌㻔㻺㻝㻡㻕㻌㻗㻌㼎㼍㼞㼏㼛㼐㼑㻌㻔㻣㼚㼠㻕㻌㻗 㼀㻯㼀 barcode 2

㻾㻺㻭

㻔㻻㻴㻕㻞㻙㻯㻭㻼

㻭㻭㻭㻭㻭㻭㻭䞉䞉䞉㻭㻭㻭㻭㻭㻭 㻾㼀㻌㼜㼞㼕㼙㼑㼞㻌㻔㻺㻝㻡㻕㻌㻗㻌㼎㼍㼞㼏㼛㼐㼑㻌㻔㻣㼚㼠㻕㻌㻗 㼀㻯㼀 barcode 3

㻾㻺㻭

㻔㻻㻴㻕㻞㻙㻯㻭㻼

㻿㼑㼏㼠㼕㼛㼚㻌㻟㻚㻝

㻭㻭㻭㻭㻭㻭㻭䞉䞉䞉㻭㻭㻭㻭㻭㻭 㻾㼀㻌㼜㼞㼕㼙㼑㼞㻌㻔㻺㻝㻡㻕㻌㻗㻌㼎㼍㼞㼏㼛㼐㼑㻌㻔㻣㼚㼠㻕㻌㻗 㼀㻯㼀 barcode 4

㻾㻺㻭

㻔㻻㻴㻕㻞㻙 㻯㻭㻼

㻭㻭㻭㻭㻭㻭㻭䞉䞉䞉㻭㻭㻭㻭㻭㻭

㻟 㻾㼀㻌㼜㼞㼕㼙㼑㼞㻌㻔㻺㻝㻡㻕㻌㻗㻌㼎㼍㼞㼏㼛㼐㼑㻌㻔㻣㼚㼠㻕㻌㻗 㼀㻯㼀

㻾㻺㻭

㻔㻻㻴㻕㻞㻙 㻯㻭㻼

barcode 96 㻭㻭㻭㻭㻭㻭㻭䞉䞉䞉㻭㻭㻭㻭㻭㻭 㻟㻓 㻾㼀㻌㼜㼞㼕㼙㼑㼞㻌㻔㻺㻝㻡㻕㻌㻗㻌㼎㼍㼞㼏㼛㼐㼑㻌㻔㻣㼚㼠㻕㻌㻗 㼀㻯㼀

㻿㼍㼙㼜㼘㼑 㼙㼕㼤㼠㼡㼞㼑 㻔㻻㻴㻕㻞㻙 㻯㻭㻼 㻟㻓

㻭㻭㻭㻭㻭㻭㻭䞉䞉䞉㻭㻭㻭㻭㻭㻭 㻙㻼 㼎㼍㼞㼏㼛㼐㼑

㼏㻰㻺㻭

㻿㼑㼏㼠㼕㼛㼚㻌㻟㻚㻞㻙㻟㻚㻠

㻻㼤㼕㼐㼍㼠㼕㼛㼚㻛㻮㼕㼛㼠㼕㼚㼥㼘㼍㼠㼕㼛㼚 㻮

㻭㻭㻭㻭㻭㻭㻭䞉䞉䞉㻭㻭㻭㻭㻭㻭

㻯㻭㻼 㻟㻓

㻮

㻙㻼 㼎㼍㼞㼏㼛㼐㼑

㻾㻺㼍㼟㼑 㻻㻺㻱

㻿㼑㼏㼠㼕㼛㼚㻌㻟㻚㻡 㻟㻓 㻙㻼㻡 㼎㼍㼞㼏㼛㼐㼑

㻯㻭㻼 㻟㻓

㻯㼍㼜㻙㻙㼠㼞㼍㼜 㻮

㻟㻓 㻙㻼 㼎㼍㼞㼏㼛㼐㼑

㻯㻭㻼 㻟㻓

㻿㼑㼏㼠㼕㼛㼚㻌㻟㻚㻢㻙㻟㻚㻤

㻾㼑㼘㼑㼍㼟㼑

㻟㻓

㼏㻰㻺㻭

㻙㻼 㼎㼍㼞㼏㼛㼐㼑

㻿㼑㼏㼠㼕㼛㼚㻌㻟㻚㻥㻙㻟㻚㻝㻜

㻡㻓 㼑㼚㼐 㼍㼐㼛㼜㼠㼛㼞 㻸㼕㼓㼍㼠㼕㼛㼚 㻡㻓㻌㻸㼕㼚㼗㼑㼞 㻳㻛㻺㻺㻺㻺㻺 㻙㻼

㻡㻓 㻼㻙

㼎㼍㼞㼏㼛㼐㼑

㻿㼑㼏㼠㼕㼛㼚㻌㻟㻚㻝㻝

㻟㻓 㼑㼚㼐 㼍㼐㼛㼜㼠㼛㼞 㻸㼕㼓㼍㼠㼕㼛㼚 㻟㻓㻌㻸㼕㼚㼗㼑㼞㻌㼣㻛 㼕㼚㼐㼑㼤

㻡㻓㻌㻸㼕㼚㼗㼑㼞 㻡㻓 㻼㻙

㻡㻓㻺㻺㻺㻭㻳㻭 㻙 㼎㼍㼞㼏㼛㼐㼑

㻳㻛㻺㻺㻺㻺㻺

㻙㻼 㻡㻓

㼜㼡㼞㼕㼒㼕㼏㼍㼠㼕㼛㼚

㻿㼑㼏㼠㼕㼛㼚㻌㻟㻚㻝㻞 㻡㻓

㼎㼍㼞㼏㼛㼐㼑

Fig. 1 The workflow of LQ-ssCAGE library preparation. The section numbers correspond to those in the methods

70

Hazuki Takahashi et al.

microtiter plates. Such libraries can be efficiently sequenced on various Illumina sequencing platforms by using Illumina Index and original barcode identifiers. With a proper organization of library workflow, an operator can easily prepare 96 samples simultaneously in a 96-well plate. To show high reproducibility and to confirm that the method can be used to identify key regulatory elements, including enhancers and lncRNA promoters, we prepared LQ-ssCAGE libraries from human acute monocytic leukemia (THP-1) cells and analyzed regulatory RNAs comparing our data to FANTOM CageAssociated Transcripts (CAT) gene models and annotations [13]. As examples, we identified enhancers and promoter-derived regulatory RNAs, including GAS5 promoter-derived lncRNA, previously shown to be associated with apoptosis pathway in THP-1 cells [17], and a novel bidirectional genomic region transcribing e-lncRNAs.

2 2.1

Materials Equipment

1. 0.2 mL Polypropylene PCR Tube Strips and Domed Cap Strips, 8 Tubes/Strip, 8 Domed Caps/Strip, Clear, Nonsterile. 2. 1.5 mL Maxymum Recovery Snaplock Microcentrifuge Tube, Polypropylene, Clear, Nonsterile. 3. 16-well Polypropylene PCR Microplate, Clear, Nonsterile. 4. 96-well Polypropylene PCR Microplate, No Skirt, Clear, Nonsterile. 5. PCR 1
8 Strip Domed Caps, Fit 0.2 mL PCR Tube Strips, Clear, Nonsterile. 6. X-Pierce Sealing Films, Sterile (EXCEL Scientific, Inc.). 7. Low binding barrier tips of 10 μL (0.1–10 μL), 20 μL (1–20 μL), 200 μL (1–200 μL), and 1000 μL (100–1000 μL). 8. PIPETMAN P2, P20, P200, and P1000. 9. Thermal Cycler. 10. Centrifuge for plates, PCR tubes, and 1.5 mL tubes. 11. 8 channel pipettes for 0.5–10 μL and 10–100 μL and 30–300 μL. 12. Vortex mixer. 13. miVAC DNA (SP Scientific Genevac). 14. miVac rotor for micro plate (SP Scientific Genevac). 15. Dynabeads MPC-S (Magnetic (Thermo Fisher Scientific).

Particle

Concentrator)

16. DynaMag-96 Side Skirted Magnet (Thermo Fisher Scientific).

LQ-ssCAGE Protocol and the Analysis

2.2 Commercial Reagents

71

1. Agencourt AMPure XP (BECKMAN COULTER). 2. Agencourt RNAClean XP (BECKMAN COULTER). 3. KAPA Library Quantification Kits (KAPA BIOSYSTEMS). 4. 11 M Sodium Chloride (NaCl), Molecular Biology Grade. 5. RNase One Ribonuclease (Promega). 6. 8 M Lithium chloride solution, for molecular biology, 99%. 7. 3 M Sodium acetate buffer solution BioXtra, pH 7.0  0.05 (25  C) for molecular biology, nonsterile; 0.2 μm filtered. 8. Sodium periodate (NaIO4) powder, ACS Reagent Grade. 9. DNA Ligation Kit Mighty Mix (Takara Bio Inc). 10. Ribonuclease H (RNase H) (20–60 U/μL) (Takara Bio Inc). 11. 10 mM dNTP Mix. 12. Dynabeads M-270 Streptavidin (Thermo Fisher Scientific). 13. RNase Decontamination Solution. 14. SuperScript III Reverse Transcriptase (Thermo Scientific).

Fisher

15. UltraPure 0.5 M EDTA pH 8.0. 16. UltraPure DNase/RNase-Free Distilled Water. 17. Biotin (Long Arm) Hydrazide (Vector Laboratories). 18. 0.5 M EDTA pH 8.0. 19. 10% w/v Polyoxyethylene (20) Sorbitan Monolaurate Solution. 20. 1 M Tris–HCl pH 7.0, pH 7.5 and pH 8.5. 21. 3 M Sodium Acetate pH 5.2. 22. Dimethyl Sulfoxide. 23. 70% ethanol. 24. 2 M NaOH. 25. Hybridization buffer HT1 (Illumina). 2.3 Homemade Solutions

Water used should be DNase/RNase-Free Distilled Water 1. 250 mM NaIO4: Dissolve 1 mg of Sodium periodate in 18.7 μL of water and keep in the dark. The solution can be aliquoted to 50 μL and stored at 80  C. 2. 100 mM Biotin (long arm) Hydrazide: Dissolve 50 mg of Biotin (long arm) Hydrazide in 1.345 mL of DMSO. The solution can be aliquoted to 50 μL and stored at 80  C. 3. LiCl buffer: mix 35 mL of 8 M Lithium chloride solution, 800 μL of 1 M Tris–HCl pH 7.5, 400 μL of 10% w/v Polyoxyethylene (20) Sorbitan Monolaurate Solution, 160 μL of

72

Hazuki Takahashi et al.

0.5 M EDTA pH 8.0 and 3.64 mL of water, and store at room temperature. 4. TE wash buffer: Mix 39.12 mL of water, 400 μL of 1 M Tris– HCl pH 7.5, 400 μL of 10 w/v% Polyoxyethylene (20) Sorbitan Monolaurate Solution, and 80 μL of 0.5 M EDTA pH 8.0, and store at room temperature. 5. Release buffer: Mix 100 μL of RNase ONE 10
Reaction Buffer, 1 μL of 10% w/v Polyoxyethylene (20) Sorbitan Monolaurate Solution and 899 μL of water, and store at room temperature. 6. 1
TE buffer: Mix 500 μL of 1 M Tris–HCl pH 8.0, 100 μL of 0.5 M EDTA pH 8.0, and 49.4 mL of water, and store at room temperature. 7. 0.1 M NaCl/TE buffer: Mix 500 μL of 1 M NaCl and 4.5 mL of 1
TE buffer, and store at room temperature. 2.4 Primers and Linker Sequences

See Tables 1, 2, and 3.

Table 1 List of RT primers containing barcode Name

Sequence (50 ! 30 )

TCT_7nt_N15_#001

PhosTCTGATGCTCNNNNNNNNNNNNNNN

TCT_7nt_N15_#002

PhosTCTTATGAGCNNNNNNNNNNNNNNN

TCT_7nt_N15_#003

PhosTCTCGACGATNNNNNNNNNNNNNNN

TCT_7nt_N15_#004

PhosTCTTAGTCACNNNNNNNNNNNNNNN

TCT_7nt_N15_#005

PhosTCTCGTACTGNNNNNNNNNNNNNNN

TCT_7nt_N15_#006

PhosTCTTACGTAGNNNNNNNNNNNNNNN

TCT_7nt_N15_#007

PhosTCTAGACTCGNNNNNNNNNNNNNNN

TCT_7nt_N15_#008

PhosTCTTCGCTGANNNNNNNNNNNNNNN

TCT_7nt_N15_#009

PhosTCTCGATCTGNNNNNNNNNNNNNNN

TCT_7nt_N15_#010

PhosTCTTGTCACGNNNNNNNNNNNNNNN

TCT_7nt_N15_#011

PhosTCTATGCACTNNNNNNNNNNNNNNN

TCT_7nt_N15_#012

PhosTCTGACATCGNNNNNNNNNNNNNNN

TCT_7nt_N15_#013

PhosTCTATCTAGCNNNNNNNNNNNNNNN

TCT_7nt_N15_#014

PhosTCTTGTCGCANNNNNNNNNNNNNNN

TCT_7nt_N15_#015

PhosTCTCAGATCTNNNNNNNNNNNNNNN

TCT_7nt_N15_#016

PhosTCTTCAGAGCNNNNNNNNNNNNNNN (continued)

LQ-ssCAGE Protocol and the Analysis

73

Table 1 (continued) Name

Sequence (50 ! 30 )

TCT_7nt_N15_#017

PhosTCTATACTGCNNNNNNNNNNNNNNN

TCT_7nt_N15_#018

PhosTCTATCGTGANNNNNNNNNNNNNNN

TCT_7nt_N15_#019

PhosTCTGAGCTCTNNNNNNNNNNNNNNN

TCT_7nt_N15_#020

PhosTCTTCTCGAGNNNNNNNNNNNNNNN

TCT_7nt_N15_#021

PhosTCTCAGTGTCNNNNNNNNNNNNNNN

TCT_7nt_N15_#022

PhosTCTGCTACGANNNNNNNNNNNNNNN

TCT_7nt_N15_#023

PhosTCTAGTACGCNNNNNNNNNNNNNNN

TCT_7nt_N15_#024

PhosTCTGACTAGCNNNNNNNNNNNNNNN

TCT_7nt_N15_#025

PhosTCTTACGCTANNNNNNNNNNNNNNN

TCT_7nt_N15_#026

PhosTCTGCTATAGNNNNNNNNNNNNNNN

TCT_7nt_N15_#027

PhosTCTACACTGTNNNNNNNNNNNNNNN

TCT_7nt_N15_#028

PhosTCTACATGTCNNNNNNNNNNNNNNN

TCT_7nt_N15_#029

PhosTCTGCAGACTNNNNNNNNNNNNNNN

TCT_7nt_N15_#030

PhosTCTTAGCGACNNNNNNNNNNNNNNN

TCT_7nt_N15_#031

PhosTCTACAGTCGNNNNNNNNNNNNNNN

TCT_7nt_N15_#032

PhosTCTGTATGACNNNNNNNNNNNNNNN

TCT_7nt_N15_#033

PhosTCTCAGCAGTNNNNNNNNNNNNNNN

TCT_7nt_N15_#034

PhosTCTACAGCTGNNNNNNNNNNNNNNN

TCT_7nt_N15_#035

PhosTCTGCTGATANNNNNNNNNNNNNNN

TCT_7nt_N15_#036

PhosTCTTGTCGACNNNNNNNNNNNNNNN

TCT_7nt_N15_#037

PhosTCTTGCGATANNNNNNNNNNNNNNN

TCT_7nt_N15_#038

PhosTCTAGTGTCANNNNNNNNNNNNNNN

TCT_7nt_N15_#039

PhosTCTATACGTCNNNNNNNNNNNNNNN

TCT_7nt_N15_#040

PhosTCTCACTATGNNNNNNNNNNNNNNN

TCT_7nt_N15_#041

PhosTCTTCACAGTNNNNNNNNNNNNNNN

TCT_7nt_N15_#042

PhosTCTTACGCGTNNNNNNNNNNNNNNN

TCT_7nt_N15_#043

PhosTCTCGACGTANNNNNNNNNNNNNNN

TCT_7nt_N15_#044

PhosTCTAGCATGCNNNNNNNNNNNNNNN

TCT_7nt_N15_#045

PhosTCTATCGCGTNNNNNNNNNNNNNNN

TCT_7nt_N15_#046

PhosTCTGATATGCNNNNNNNNNNNNNNN

TCT_7nt_N15_#047

PhosTCTTAGCATCNNNNNNNNNNNNNNN (continued)

74

Hazuki Takahashi et al.

Table 1 (continued) Name

Sequence (50 ! 30 )

TCT_7nt_N15_#048

PhosTCTGCTCATGNNNNNNNNNNNNNNN

TCT_7nt_N15_#049

PhosTCTCTGATGCNNNNNNNNNNNNNNN

TCT_7nt_N15_#050

PhosTCTGCATATGNNNNNNNNNNNNNNN

TCT_7nt_N15_#051

PhosTCTGTCACATNNNNNNNNNNNNNNN

TCT_7nt_N15_#052

PhosTCTCTAGCATNNNNNNNNNNNNNNN

TCT_7nt_N15_#053

PhosTCTCACGTGTNNNNNNNNNNNNNNN

TCT_7nt_N15_#054

PhosTCTCTAGTACNNNNNNNNNNNNNNN

TCT_7nt_N15_#055

PhosTCTGATCGTANNNNNNNNNNNNNNN

TCT_7nt_N15_#056

PhosTCTCTAGTCGNNNNNNNNNNNNNNN

TCT_7nt_N15_#057

PhosTCTGACACTGNNNNNNNNNNNNNNN

TCT_7nt_N15_#058

PhosTCTAGCTCGANNNNNNNNNNNNNNN

TCT_7nt_N15_#059

PhosTCTGACTGCANNNNNNNNNNNNNNN

TCT_7nt_N15_#060

PhosTCTAGACGCTNNNNNNNNNNNNNNN

TCT_7nt_N15_#061

PhosTCTCAGTCTGNNNNNNNNNNNNNNN

TCT_7nt_N15_#062

PhosTCTTGACTGCNNNNNNNNNNNNNNN

TCT_7nt_N15_#063

PhosTCTATCAGCGNNNNNNNNNNNNNNN

TCT_7nt_N15_#064

PhosTCTCTCAGAGNNNNNNNNNNNNNNN

TCT_7nt_N15_#065

PhosTCTTATGCACNNNNNNNNNNNNNNN

TCT_7nt_N15_#066

PhosTCTTGCTACANNNNNNNNNNNNNNN

TCT_7nt_N15_#067

PhosTCTATGCGCANNNNNNNNNNNNNNN

TCT_7nt_N15_#068

PhosTCTTCGTGACNNNNNNNNNNNNNNN

TCT_7nt_N15_#069

PhosTCTCGATACGNNNNNNNNNNNNNNN

TCT_7nt_N15_#070

PhosTCTGCTAGCANNNNNNNNNNNNNNN

TCT_7nt_N15_#071

PhosTCTTAGCGTANNNNNNNNNNNNNNN

TCT_7nt_N15_#072

PhosTCTCTGACGANNNNNNNNNNNNNNN

TCT_7nt_N15_#073

PhosTCTTACGTCANNNNNNNNNNNNNNN

TCT_7nt_N15_#074

PhosTCTCATAGCTNNNNNNNNNNNNNNN

TCT_7nt_N15_#075

PhosTCTTCGATCANNNNNNNNNNNNNNN

TCT_7nt_N15_#076

PhosTCTCATATCGNNNNNNNNNNNNNNN

TCT_7nt_N15_#077

PhosTCTCTCGATANNNNNNNNNNNNNNN

TCT_7nt_N15_#078

PhosTCTAGTCAGTNNNNNNNNNNNNNNN (continued)

LQ-ssCAGE Protocol and the Analysis

75

Table 1 (continued) Name

Sequence (50 ! 30 )

TCT_7nt_N15_#079

PhosTCTTCGATAGNNNNNNNNNNNNNNN

TCT_7nt_N15_#080

PhosTCTGCGTATANNNNNNNNNNNNNNN

TCT_7nt_N15_#081

PhosTCTATGTCAGNNNNNNNNNNNNNNN

TCT_7nt_N15_#082

PhosTCTACGTCGANNNNNNNNNNNNNNN

TCT_7nt_N15_#083

PhosTCTCACTAGTNNNNNNNNNNNNNNN

TCT_7nt_N15_#084

PhosTCTTCACGTGNNNNNNNNNNNNNNN

TCT_7nt_N15_#085

PhosTCTGCTGTACNNNNNNNNNNNNNNN

TCT_7nt_N15_#086

PhosTCTTACTGAGNNNNNNNNNNNNNNN

TCT_7nt_N15_#087

PhosTCTCGATGCANNNNNNNNNNNNNNN

TCT_7nt_N15_#088

PhosTCTTGTCAGANNNNNNNNNNNNNNN

TCT_7nt_N15_#089

PhosTCTCTCTAGANNNNNNNNNNNNNNN

TCT_7nt_N15_#090

PhosTCTCGTACATNNNNNNNNNNNNNNN

TCT_7nt_N15_#091

PhosTCTCTAGCTGNNNNNNNNNNNNNNN

TCT_7nt_N15_#092

PhosTCTCGCTATANNNNNNNNNNNNNNN

TCT_7nt_N15_#093

PhosTCTTAGCTCANNNNNNNNNNNNNNN

TCT_7nt_N15_#094

PhosTCTGTATAGCNNNNNNNNNNNNNNN

TCT_7nt_N15_#095

PhosTCTGTGACTCNNNNNNNNNNNNNNN

TCT_7nt_N15_#096

PhosTCTAGCATCGNNNNNNNNNNNNNNN

TCT_7nt_N15_#097

PhosTCTTGAGCATNNNNNNNNNNNNNNN

TCT_7nt_N15_#098

PhosTCTCGTATAGNNNNNNNNNNNNNNN

TCT_7nt_N15_#099

PhosTCTACTAGCGNNNNNNNNNNNNNNN

TCT_7nt_N15_#100

PhosTCTACTGATGNNNNNNNNNNNNNNN

TCT_7nt_N15_#101

PhosTCTGTACATGNNNNNNNNNNNNNNN

TCT_7nt_N15_#102

PhosTCTTGACTCANNNNNNNNNNNNNNN

TCT_7nt_N15_#103

PhosTCTGATCTCANNNNNNNNNNNNNNN

TCT_7nt_N15_#104

PhosTCTCGACTGTNNNNNNNNNNNNNNN

TCT_7nt_N15_#105

PhosTCTCAGTAGCNNNNNNNNNNNNNNN

TCT_7nt_N15_#106

PhosTCTACTATGCNNNNNNNNNNNNNNN

TCT_7nt_N15_#107

PhosTCTACGATCGNNNNNNNNNNNNNNN

TCT_7nt_N15_#108

PhosTCTGATCACGNNNNNNNNNNNNNNN

TCT_7nt_N15_#109

PhosTCTTGCATAGNNNNNNNNNNNNNNN (continued)

76

Hazuki Takahashi et al.

Table 1 (continued) Name

Sequence (50 ! 30 )

TCT_7nt_N15_#110

PhosTCTCGTCATANNNNNNNNNNNNNNN

TCT_7nt_N15_#111

PhosTCTAGCTCAGNNNNNNNNNNNNNNN

TCT_7nt_N15_#112

PhosTCTGTAGCACNNNNNNNNNNNNNNN

TCT_7nt_N15_#113

PhosTCTCTATGCGNNNNNNNNNNNNNNN

TCT_7nt_N15_#114

PhosTCTGACTACTNNNNNNNNNNNNNNN

TCT_7nt_N15_#115

PhosTCTGATCGCTNNNNNNNNNNNNNNN

TCT_7nt_N15_#116

PhosTCTCTGATAGNNNNNNNNNNNNNNN

TCT_7nt_N15_#117

PhosTCTGTGCATANNNNNNNNNNNNNNN

TCT_7nt_N15_#118

PhosTCTGATGCATNNNNNNNNNNNNNNN

TCT_7nt_N15_#119

PhosTCTACTGCAGNNNNNNNNNNNNNNN

TCT_7nt_N15_#120

PhosTCTTGATCACNNNNNNNNNNNNNNN

Phos indicates phosphorylation and underline indicates barcode at RT primers

Table 2 List of 50 linkers Name

Sequence (50 ! 30 )

50 Adaptor N6

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC GCTCTTCCGATCTNNNNNNPhos

50 Adaptor GN5

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC GCTCTTCCGATCTGNNNNNPhos

50 Adaptor down

PhosAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTC GGTGGTCGCCGTATCATTPhos

Phos indicates phosphorylation

Table 3 List of 30 linkers Name

Sequence (50 ! 30 )

30 End adaptor up 01

NNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTC GTATGCCGTCTTCTGCTTGPhos

30 End adaptor down 01

CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACG TGTGCTCTTCCGA

30 End adaptor up 02

NNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTC GTATGCCGTCTTCTGCTTGPhos (continued)

LQ-ssCAGE Protocol and the Analysis

77

Table 3 (continued) Name

Sequence (50 ! 30 )

30 End adaptor down 02

CAAGCAGAAGACGGCATACGAGATACATCGGTGACTGGAGTTCAGACG TGTGCTCTTCCGA

30 End adaptor up 03

NNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTC GTATGCCGTCTTCTGCTTGPhos

30 End adaptor down 03

CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTCAGACG TGTGCTCTTCCGA

30 End adaptor up 04

NNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTC GTATGCCGTCTTCTGCTTGPhos

30 End adaptor down 04

CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACTGGAGTTCAGACG TGTGCTCTTCCGA

30 End adaptor up 05

NNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTC GTATGCCGTCTTCTGCTTGPhos

30 End adaptor down 05

CAAGCAGAAGACGGCATACGAGATCACTGTGTGACTGGAGTTCAGACG TGTGCTCTTCCGA

30 End adaptor up 06

NNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTC GTATGCCGTCTTCTGCTTGPhos

30 End adaptor down 06

CAAGCAGAAGACGGCATACGAGATATTGGCGTGACTGGAGTTCAGACG TGTGCTCTTCCGA

30 End adaptor up 07

NNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTC GTATGCCGTCTTCTGCTTGPhos

30 End adaptor down 07

CAAGCAGAAGACGGCATACGAGATGATCTGGTGACTGGAGTTCAGACG TGTGCTCTTCCGA

30 End adaptor up 08

NNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTC GTATGCCGTCTTCTGCTTGPhos

30 End adaptor down 08

CAAGCAGAAGACGGCATACGAGATTCAAGTGTGACTGGAGTTCAGACG TGTGCTCTTCCGA

30 End adaptor up 09

NNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTC GTATGCCGTCTTCTGCTTGPhos

30 End adaptor down 09

CAAGCAGAAGACGGCATACGAGATCTGATCGTGACTGGAGTTCAGACG TGTGCTCTTCCGA

30 End adaptor up 10

NNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTATCTC GTATGCCGTCTTCTGCTTGPhos

30 End adaptor down 10

CAAGCAGAAGACGGCATACGAGATAAGCTAGTGACTGGAGTTCAGACG TGTGCTCTTCCGA

30 End adaptor up 11

NNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACATCTC GTATGCCGTCTTCTGCTTGPhos

30 End adaptor down 11

CAAGCAGAAGACGGCATACGAGATGTAGCCGTGACTGGAGTTCAGACG TGTGCTCTTCCGA (continued)

78

Hazuki Takahashi et al.

Table 3 (continued) Name

Sequence (50 ! 30 )

30 End adaptor up 12

NNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTC GTATGCCGTCTTCTGCTTGPhos

30 End adaptor down 12

CAAGCAGAAGACGGCATACGAGATTACAAGGTGACTGGAGTTCAGACG TGTGCTCTTCCGA

30 End adaptor up 13

NNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATC TCGTATGCCGTCTTCTGCTTGPhos

30 End adaptor down 13

CAAGCAGAAGACGGCATACGAGATTGTTGACTGTGACTGGAG TTCAGACGTGTGCTCTTCCGA

30 End adaptor up 14

NNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATC TCGTATGCCGTCTTCTGCTTGPhos

30 End adaptor down 14

CAAGCAGAAGACGGCATACGAGATACGGAACTGTGACTGGAG TTCAGACGTGTGCTCTTCCGA

30 End adaptor up 15

NNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATC TCGTATGCCGTCTTCTGCTTGPhos

30 End adaptor down 15

CAAGCAGAAGACGGCATACGAGATTCTGACATGTGACTGGAG TTCAGACGTGTGCTCTTCCGA

30 End adaptor up 16

NNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGAT CTCGTATGCCGTCTTCTGCTTGPhos

30 End adaptor down 16

CAAGCAGAAGACGGCATACGAGATCGGGACGGGTGACTGGAG TTCAGACGTGTGCTCTTCCGA

30 End adaptor up 18

NNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATC TCGTATGCCGTCTTCTGCTTGPhos

30 End adaptor down 18

CAAGCAGAAGACGGCATACGAGATGTGCGGACGTGACTGGAG TTCAGACGTGTGCTCTTCCGA

30 End adaptor up 19

NNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATC TCGTATGCCGTCTTCTGCTTGPhos

30 End adaptor down 19

CAAGCAGAAGACGGCATACGAGATCGTTTCACGTGACTGGAG TTCAGACGTGTGCTCTTCCGA

30 End adaptor up 20

NNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGGCCTTATC TCGTATGCCGTCTTCTGCTTGPhos

30 End adaptor down 20

CAAGCAGAAGACGGCATACGAGATAAGGCCACGTGACTGGAG TTCAGACGTGTGCTCTTCCGA

30 End adaptor up 21

NNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTTCGGAATC TCGTATGCCGTCTTCTGCTTGPhos

30 End adaptor down 21

CAAGCAGAAGACGGCATACGAGATTCCGAAACGTGACTGGAG TTCAGACGTGTGCTCTTCCGA

30 End adaptor up 22

NNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTACGTAATC TCGTATGCCGTCTTCTGCTTGPhos (continued)

LQ-ssCAGE Protocol and the Analysis

79

Table 3 (continued) Name

Sequence (50 ! 30 )

30 End adaptor down 22

CAAGCAGAAGACGGCATACGAGATTACGTACGGTGACTGGAG TTCAGACGTGTGCTCTTCCGA

30 End adaptor up 23

NNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGTGGATATC TCGTATGCCGTCTTCTGCTTGPhos

30 End adaptor down 23

CAAGCAGAAGACGGCATACGAGATATCCACTCGTGACTGGAG TTCAGACGTGTGCTCTTCCGA

30 End adaptor up 25

NNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACACTGATATATC TCGTATGCCGTCTTCTGCTTGPhos

30 End adaptor down 25

CAAGCAGAAGACGGCATACGAGATATATCAGTGTGACTGGAG TTCAGACGTGTGCTCTTCCGA

30 End adaptor up 27

NNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCCTTTATC TCGTATGCCGTCTTCTGCTTGPhos

30 End adaptor down 27

CAAGCAGAAGACGGCATACGAGATAAAGGAATGTGACTGGAG TTCAGACGTGTGCTCTTCCGA

Phos indicates phosphorylation and underline indicates Index at 30 linkers

3

Methods Water used should be DNase/RNase-Free Distilled Water.

3.1 Reverse Transcription (Timing: 5.5 h)

1. Mix 4 μL of 50 ng RNAs (12.5 ng/μL) and 1 μL of 1.25 mM RT primers in a 96-well plate by pipetting to generate RNA and primer mix on ice (see Notes 1 and 2). 2. Incubate the RNA-primer mix from step 1 of this section 65  C for 5 min and immediately place on ice for 2 min. 3. Mix the following components (enzyme mix) (see Note 3). Reagent

Volume (μL) Final concentration

5
First Strand buffer

2

1


0.1 M DTT

0.5

0.01 M

10 mM dNTPs

0.5

1 mM

RNase-free water

1

–

SuperScript III Reverse Transcriptase

1

200 U

Total volume

5

80

Hazuki Takahashi et al.

4. Add 5 μL of enzyme mix from step 3 of this section to RNA-primer mix solution from step 2 of this section and carefully mix ten times by pipetting on ice. 5. Incubate at 25  C for 30 s, followed by 50  C for 30 min and keep at 4  C to generate RNA-cDNA hybrids. 6. Mix samples using following steps (see Note 4). Transfer each 10 μL of RNA-cDNA hybrids from step 5 of this section to new 1.5 mL tubes on ice (total volume is 480 μL). 7. Add 15 μL of water to the first 8 wells of the 96-well plate from step 5 of this section, wash wells by pipetting, and transfer the 15 μL of the solutions to the next 8 wells. 8. Wash the 8 wells by pipetting and transfer 15 μL of the solutions to the next 8 wells. 9. Repeat step 8 of this section three times until the end of 8 wells and transfer all samples [total volume is 120 μL (15 μL
8 wells)] to the 1.5 mL tube at step 6 of this section (final volume is 600 μL). 10. Mix 600 μL of the solution from step 9 of this section by vortex, spin down and aliquot 200 μL in new 1.5 mL tube on ice (total 200 μL in three 1.5 mL tubes) (see Note 4). 11. Add 360 μL (1.8 folds) of RNAClean XP beads to the 48 mixed RNA-cDNA hybrids in the 1.5 mL tube from step 10 of this section, mix well by pipetting and then elute the mixed RNA-cDNA hybrids in the following steps at room temperature unless otherwise specified. 12. Incubate for 10 min, spin down and set the 1.5 mL tube on a magnetic stand for 5 min. 13. Discard the supernatant by pipette aspiration. 14. Wash the beads with 1.2 mL of 70% ethanol. 15. Place the 1.5 mL tube on magnetic stand for 5 min. 16. Discard the supernatant by pipette aspiration. 17. Repeat steps 14–16 of this section twice. 18. Discard the 70% ethanol completely by pipette aspiration. 19. Add 100 μL of water and mix by pipetting extensively (more than 60 times) to elute RNA-cDNA hybrids. 20. Incubate at room temperature for 5 min. 21. Spin down and place the tube on magnetic stand for 5 min. 22. Transfer 100 μL of the RNA-cDNA hybrids to new 1.5 mL tubes. 23. Repeat steps 19–22 of this section twice (final volume is 200 μL in one tube, total three tubes).

LQ-ssCAGE Protocol and the Analysis

81

24. Concentrate 200 μL of the RNA-cDNA hybrids solutions from step 23 of this section to around 40 μL by SpeedVac vacuum concentrator at 37  C, and collect the solutions from three 1.5 mL tubes to one 1.5 mL tube (total volume is around 120 μL) and concentrate to 40 μL in the 1.5 mL tube at 37  C. The timing is around 2 h (see Note 5). 25. Check the sample volume several times during the concentration and adjust the final volume to 40 μL with water when the volume becomes less than 40 μL. 3.2 Oxidation to Modify Diol Group of Cap Structure (Timing: 10 min)

1. Mix 40 μL of RNA-cDNA hybrid from Subheading 3.1, 2 μL of 1 M NaOAc pH 4.5 and 2 μL of 250 mM NaIO4 by ten times pipetting on ice. 2. Incubate for 5 min on ice in dark by aluminum foil wrapping. 3. Add 16 μL of 1 M Tris–HCl pH 8.5 to neutralize the solution and mix well by pipetting on ice.

3.3 Purification (Timing: 1 h)

Add 108 μL (1.8 folds) of RNACleanXP beads to 60 μL of oxidated RNA-cDNA hybrid from Subheading 3.2, mix well by pipetting and then elute the 48 samples mixed RNA-cDNA hybrids in the following steps at room temperature. 1. Incubate for 5 min. 2. Spin down and set the tube on the magnetic stand for 5 min. 3. Discard the supernatant by pipette aspiration. 4. Wash the beads with 200 μL of 70% ethanol. 5. Discard the 70% ethanol. 6. Repeat steps 4 and 5 of this section twice and discard 70% ethanol completely. 7. Add 42 μL of water and mix by pipetting extensively (more than 60 times) to elute supernatant. 8. Incubate for 5 min. 9. Spin down and set the tube on the magnetic stand for 5 min. 10. Transfer 40 μL of the supernatant to new tube.

3.4 Biotinylation by the Coupling Reaction to the Oxidized RNAcDNA Hybrids (See Note 6) (Timing: 1.5 h)

1. Mix 40 μL of purified oxidized RNA/cDNA hybrid from Subheading 3.3, 4 μL of 1 M NaOAc pH 6.3 and 4 μL of 100 mM Biotin (long arm) hydrazide by ten times pipetting (total 48 μL). 2. Incubate for 30 min at 40  C. 3. Add 86.4 μL of RNACleanXP (1.8 folds) to 48 μL of solution from step 2 of this section and perform purification as previously described in Subheading 3.3.

82

Hazuki Takahashi et al.

3.5 RNaseONE Treatment to Digest RNA of RNA-cDNA Hybrids (See Note 7) (Timing: 1.5 h)

1. Add 4.5 μL of 10
RNaseONE buffer and 0.5 μL of RNaseONE to 40 μL of purified biotinylated RNA-cDNA hybrids from Subheading 3.4 and mix by ten times pipetting (total 45 μL). 2. Incubate for 30 min at 37  C. 3. Add 81 μL of RNACleanXP (1.8 folds) to the solution from step 2 of this section and perform purification as previously described in Subheading 3.3.

3.6 Dynabeads M270 Streptavidin Beads Preparation (Timing: 0.5 h)

1. Add 30 μL of Dynabeads M-270 Streptavidin to new 1.5 mL tube, place on the magnetic stand for 5 min, and discard supernatant. 2. Wash the beads with 30 μL of LiCl buffer, set on the magnetic stand for 5 min, and discard supernatant. 3. Repeat step 2 of this section twice. 4. Resuspend the beads in 95 μL of LiCl buffer.

3.7 CapTrap Reaction (Timing: 1 h)

1. Add 95 μL of beads from Subheading 3.6 to 40 μL of RNA-cDNA hybrids from Subheading 3.5 and mix well by pipetting. 2. Incubate for 15 min at 37  C and mix by pipetting after the first 7 min. 3. Spin down, set the tube on the magnetic stand for 2 min, and discard the supernatant by pipette aspiration. 4. Add 150 μL of TE wash buffer and mix by 60 times pipetting. Spin down, place the tube on the magnetic stand for 2 min, and discard the supernatant. 5. Repeat step 4 of this section three more times. 6. Add 35 μL of release buffer to the beads and mix by 60 times pipetting. 7. Incubate for 5 min at 95  C and subsequently on ice for 1 min. 8. Spin down and place the tube on the magnetic stand for 2 min. 9. Transfer the 35 μL of supernatant to new tube. 10. Add 30 μL of release buffer to the beads and mix well by pipetting. Spin down and place the tube on the magnetic stand for 2 min. 11. Transfer the 30 μL of supernatant to the tube containing the CapTrapped cDNA of step 9 of this section (total 65 μL).

3.8 RNaseONE and RNaseH Reaction to Remaining RNAs (Timing: 2.5 h)

1. Add 2.9 μL of release buffer, 2 μL of RNaseONE and 0.1 μL of RNase H to 65 μL of CapTrapped cDNA from Subheading 3.7 and mix by ten times pipetting (total 70 μL). 2. Incubate at 37  C for 30 min.

LQ-ssCAGE Protocol and the Analysis

83

3. Add 126 μL of AMPureXP (1.8 folds) to 70 μL of cDNA from step 2 of this section and perform purification as previously described in Subheading 3.3. 4. Dry up 40 μL of purified CapTrapped cDNA using SpeedVac concentrator at 37  C for around 75 min. 5. Add 4 μL of water to the dried pellet. 3.9 50 Single Strand Linker Ligation (Timing: 16.5 h)

1. Mix 4 μL of 1 mM 50 adaptor GN5, 4 μL of 1 mM 50 adaptor down, 4 μL of 1 M NaCl and 28 μL of 1
TE buffer, and carry out the annealing reaction to generate 100 μM GN5 linker as follows: Step

Temperature

Time (min)

Denature

95  C

5

Annealing

95  C ! 83  C in 0.1  C steps; 1 s per 0.1  C 83  C 83  C ! 71  C in 0.1  C steps; 1 s per 0.1  C 71  C 71  C ! 59  C in 0.1  C steps; 1 s per 0.1  C 59  C 59  C ! 47  C in 0.1  C steps; 1 s per 0.1  C 47  C 47  C ! 35  C in 0.1  C steps; 1 s per 0.1  C 35  C 35  C ! 23  C in 0.1  C steps; 1 s per 0.1  C 23  C 23  C ! 11  C in 0.1  C steps; 1 s per 0.1  C 11  C

5 5 5 5 5 5 Pause

2. Mix 1 μL of 1 mM 50 adaptor N6, 1 μL of 1 mM 50 adaptor down, 1 μL of 1 M NaCl, and 7 μL of 1
TE buffer and repeat the annealing reaction at step 1 of this section to generate 100 μM N6 linker. 3. Mix 40 μL of 100 μM GN5 linker from step 1 of this section and 10 μL of 100 μM N6 linker from step 2 of this section. 4. Dilute 100 μM of mixed 50 linkers to 2.5 μM in 0.1 M NaCl/ TE buffer. For instance, add 2.5 μL of 100 μM mixed linkers from step 3 of this section to 97.5 μL of 0.1 M NaCl/TE buffer for 25 samples. 2.5 μM and 100 M mixed 50 linkers can be stored at 20  C. 5. Incubate 4 μL of CapTrapped cDNA from Subheading 3.8 at 95  C for 5 min and put on ice for 2 min. 6. Incubate 4 μL of 2.5 μM 50 linker from step 4 of this section at 55  C for 5 min and put on ice for 2 min.

84

Hazuki Takahashi et al.

7. Mix 4 μL of CapTrapped cDNA from step 5 of this section, 4 μL of 2.5 μM 50 linker from step 6 of this section, and 16 μL of Mighty Mix by pipetting (total volume is 24 μL). 8. Incubate at 16  C for 16 h (overnight). 3.10 Purification to Remove Excess 50 Linkers and Linker Dimers (Timing: 2 h)

1. Add 46 μL of water and 126 μL of AMPureXP (1.8 folds) to 24 μL of cDNA from Subheading 3.9 and mix well by pipetting. 2. Perform purification as previously described in Subheading 3.3. 3. Incubate 40 μL of cDNA from step 2 from this section at 95  C for 5 min and immediately put on ice for 2 min. 4. Add 48 μL of AMPureXP beads (1.2 folds) to 40 μL of cDNA from step 3 of this section and mix well by pipetting. 5. Perform purification again as previously described in Subheading 3.3. 6. Dry up 40 μL of cDNA from step 5 of this section by SpeedVac concentrator at 80  C for 35 min. 7. Add 4 μL of water to the dried pellet.

3.11 30 Single Strand Linker Ligation (See Note 8) (Timing: 4.5 h)

1. Mix 1 μL of 1 mM 30 adaptor up, 1 μL of 1 mM 30 adaptor down, 1 μL of 1 M NaCl, and 7 μL of 1
TE buffer and carry out the annealing reaction at the step 1 of Subheading 3.9 to generate 100 μM of 30 linker. 2. Dilute 100 μM mixed linker from step 1 of this section to 2.5 μM with 0.1 M NaCl/TE buffer (see details at the step 4 of Subheading 3.9). 3. Incubate 4 μL of cDNA from Subheading 3.10 at 95  C for 5 min and place on ice for 2 min. 4. Incubate 4 μL of 2.5 μM 30 linker from step 2 of this section at 65  C for 5 min and place on ice for 2 min. 5. Mix 4 μL of cDNA from step 3 of this section, 4 μL of 30 linker from step 4 of this section and 16 μL of Mighty Mix by pipetting (total volume is 24 μL). 6. Incubate at 30  C for 4 h.

3.12 Purification to Remove Excess 30 Linkers And Linker Dimers (Final Library) (Timing: 1.5 h)

1. Add 46 μL of water and 126 μL of AMPureXP (1.8 folds) to 24 μL of cDNA from Subheading 3.11 and mix well by pipetting. 2. Perform purification as previously described in Subheading 3.3. 3. Incubate 40 μL of cDNA from step 2 from this section at 95  C for 5 min and immediately put on ice for 2 min.

LQ-ssCAGE Protocol and the Analysis

85

4. Add 48 μL of AMPureXP beads (1.2 folds) to 40 μL of cDNA from step 3 of this section and mix well by pipetting. 5. Perform purification again as previously described in Subheading 3.3. 3.13 Library Quantification (Timing: 2.5 h)

3.14

Sequencing

Quantify the concentration of library by KAPA Library Quantification Kit with a small modification of manufacture’s protocol. Briefly, the 1 μL of final library from Subheading 3.12 was 50 times diluted and used for kapa assay (see Note 9). 1. Mix the following components (see Note 10). Reagent

Volume (μL)

Library (2250 attomole)




2 N NaOH

1

Water




Total volume

20

Final concentration

0.1 N

2. Denature library by incubating at room temperature for 5 min. 3. Put the tube on ice and add 20 μL of 1 M Tris–HCl pH 7.0 (pre-chilled) to neutralize. 4. Add 110 μL of HT1 buffer. 5. Transfer 150 μL of the denatured and diluted library (final concentration is 15 pM) (see Note 10) to HiSeq2500 with 50 bp Paired-End sequencing (see Fig. 1 for the library structure). Read 1 allows to read sequence information of cDNA, read 2 allows to read sequence information of barcode in RT primer and Index read 1 allows to read sequence information of Index at the 30 linker. Read 1 contains cDNA sequence, read 2 contains barcode sequence of the RT primer and Index read 1 contains sequence of the Illumina Index at the 30 linker. 3.15 Bioinformatics Analysis and Results 3.15.1 Sequencing Coverage and Reproducibility

We made 240 samples from 50 ng of RNA extracted from THP-1 cells and generated a total of ~134.44 million reads (median of 575,008 reads) using paired-end 50 cycles kit on Illumina HiSeq2000 and Illumina HiSeq-2500 sequencers in two independent sequencing runs. Reproducibility across all biological replicates was generally quite high (Pearson’s correlation coefficients 0.93–0.98). Examples of correlations for four LQ-ssCAGE libraries with different barcodes selected from two different sequencing runs are shown in Fig. 2.

86

Hazuki Takahashi et al. 1 10

library 1 10000 1000 100 10 1

1000

1 10

1000

0.98

0.96

0.97

library 2

0.95

0.96

library 3

10000 1000 100 10 1

10000 1000 100 10 1

0.96

10000 1000 100 10 1

library 4 1 10

1 10

1000

1000

Fig. 2 Person correlations between pairs of four selected biological replicates in THP-1 whole cell showing technical reproducibility of the method c coding_mRNA N = 18,616

coding_mRNA N = 14,292

lncRNA_intergenic N = 9,425 lncRNA_divergent N = 8,975

e_lncRNA N = 6,920

sense_overlap_RNA N = 4,403 lncRNA_sense_intronic N = 3,195

p_lncRNA_divergent N = 5,817

pseudogene N = 3,137 lncRNA_antisense N = 1,988

p_lncRNA_intergenic N = 1,331

other N = 4,361 0

5,000

10,000

15,000

Number of genes

20,000

0

5,000

10,000

Number of genes

15,000

0

1

2

3

4

log10(TPM + 1)

Fig. 3 Coverage and expression levels of annotated genes in LQ-ssCAGE. (a) Number of genes in a given gene class with at least one CAGE tag in one library as defined in [13]. (b) Number of genes with DNase I hypersensitive sites (DHSs) classified as either enhancer or promoter [18]. (c) Mean expression levels of each epigenetic gene class as in (b) 3.15.2 Annotated Genes Coverage

Using the FANTOM CAT gene annotations [13], we cover (defined as identification of at least one CAGE tag in at least one library) 54,100 out of 124,047 genes, ranging from 4403 to 18,616 genes for sense-overlap-RNAs and protein-coding genes, respectively (Fig. 3a). From these, 6920 genes were annotated as enhancer lncRNA (e-lncRNA), 5817 as promoter-derived intergenic lncRNA and 1331 as promoter-derived divergent lncRNA

LQ-ssCAGE Protocol and the Analysis

a

87

50 bp ChrX: 1386000

1386500

1387000

Entrez gene hg38 LQ-ssCAGE signal

b 100 bp Chr1: 173867900

Entrez gene hg38

173868000

GAS5

LQ-ssCAGE signal

Fig. 4 Genome browser views of selected examples of ssCAGE results. (a) Example of an e-lncRNA (novel gene). (b) Example of a p-intergenic-lncRNA (GAS5). CAGE tags in green correspond to the sense strand and in violet correspond to the antisense strand

(Fig. 3b), when considering a subset of 44,069 genes with their DNase I hypersensitive sites (DHSs) classified as either enhancer or promoter [18]. Specifically, LQ-ssCAGE method has an advantage of capturing many lowly expressed e-lncRNAs (Fig. 3c): here we found 6920 of all e-lncRNAs in one cellular state, which is definitely a large number considering the high cell type specificity of e-lncRNAs expression. Selected examples, a novel e-lncRNA (CATG00000112934.1) and a p-lncRNA (GAS5) with the average expression of ~22 transcripts per million (TPM) and ~226 TPM, respectively, are shown in Fig. 4. 3.15.3 CAGE Tags Mapping and Gene Expression Quantification

CAGE tags were mapped to the human genome assembly hg38 using STAR (version 2.5.3a). The average mapping rate was 69.5%, with ~500,000 mapped counts obtained on average across all 240 samples. First, expression for CAGE promoters was estimated by counting the numbers of mapped CAGE tags falling under the 379,952 promoter regions of FANTOM 6 CAT gene models (described in [19]). Next, the expression of the corresponding 124,047 genes was estimated by summing up the expression values of all promoters assigned to a given gene. We found 54,100 genes to have at least one CAGE tag across all 240 libraries. CAGE sequencing summary, raw and summarized gene expression tables are available at https://fantom.gsc.riken.jp/6/suppl/Takahashi_ et_al_2020/.

88

Hazuki Takahashi et al.

3.15.4 CAGE Library Correlations

Expression values for the 54,100 genes with at least one CAGE tag across all 240 libraries were correlated for all pairs of CAGE libraries using the Pearson correlation from the “cor” function (“stats” R package 4.0.0). Correlation for four libraries chosen from two different sequencing runs and with two different barcodes were plotted using “plotCorrelation2” function [20] with “tagCountThreshold ¼ 1” and “applyThresholdBoth ¼ FALSE” parameters.

3.15.5 Genomic and Epigenomic Gene Classes

DHS_type, genomic and epigenomic classifications of genes were inherited from FANTOM CAT annotations [13] and the numbers were plotted for all genes with at least one CAGE tag across all 240 libraries and with available annotations. Genomic classes: “short_ncRNA”, “uncertain_coding”, “small_RNA”, and “structural_RNA” were broadly classified as “other”. Detailed annotations of all genes are available at https://fantom.gsc.riken.jp/6/ suppl/Takahashi_et_al_2020/.

3.15.6

Raw sequencing data generated in this study have been deposited at NCBI under the BioProject accession number PRJNA664583 (https://www.ncbi.nlm.nih.gov/bioproject/PRJNA664583). Expression data can be accessed through the FANTOM6 project portal (https://fantom.gsc.riken.jp/6/suppl/Takahashi_et_al_ 2020/) (see Note 11).

4

Data Availability

Notes 1. The amount of RNAs in each tube should be 25–100 ng. After the reverse transcription, samples will be barcodes and then they can be mixed, using up to 5 μg/tube. For instance, if the starting RNA amount is 50 ng, 100 samples can be mixed in one tube for subsequent analysis. If starting from 100 ng of RNAs, process the pooled library in two tubes. The number of mixed samples is dependent on how many samples the operator needs to process. We describe here, for example, a mix of 48 samples from 50 ng starting RNA. Users can modify these numbers taking care of Note 2. 2. The mixed solution should contain no more than 5 μg of starting sample; otherwise, the following linkers at Subheadings 3.9 and 3.11 may become insufficient for the linker ligation. 3. In order to avoid void volume, we advise to prepare premix solution for the number of samples needed considering a factor of 1.1 for each sample.

LQ-ssCAGE Protocol and the Analysis

89

4. Step 6 of Subheading 3.1 is needed for the collection of remaining molecules to avoid losing any RNA-cDNA hybrids in the wells. We recommend to aliquot less than 200 μL per each 1.5 mL tube at step 10 of Subheading 3.1. Due to the volume limitations of next RNAClean XP purification step. 5. DO NOT DRY UP the RNA-cDNA hybrids solutions by using the concentrator because RNAs stick very easily to the surface of tubes when dried. 6. Biotinylation occurs at both 50 end of capped RNAs and 30 end of RNA (described in Fig. 2 in the published protocol [4]), but RNAse treatment removes the 30 end biotin. 7. RNase treatment is critical to digest uncompleted cDNA synthesis to the 50 end of capped RNAs (described in Fig. 2 at published protocol [4]). 8. When generating more than two libraries with same barcode in the RT primers, use different Index in the 30 linker to mix (see Table 3). 9. The ideal concentration of one library from 48 mixed samples is 20–23 pM in 10 μL (400 attomole), which is from 50 ng RNA. In order to obtain high cost performance analysis, an operator can mix equal mol libraries up to 2250 attomole after the quantification of the library at Subheading 3.13. After mix, adjust a volume to 19 μL by SpeedVac vacuum concentrator at 37  C and repeat Subheading 3.13. 10. The concentration of the final library 15 pM was determined by a Flow Cell spec of the HiSeq2500 with 50 bp Paired-End sequencing. The concentration should be optimized for each spec of Illumina Flow Cell technology. 11. Only Read 1 were used for our CAGE data analysis and made publicly available.

Acknowledgments We special thank our colleagues Mitsuyoshi Murata, Shohei Noma, Miki Kojima, and Michihira Tagami for the technical development, Takeya Kasukawa for help with the data dissemination and the Laboratory for Comprehensive Genomic Analysis at RIKEN IMS for the sequencing service. This work was supported by a Research Grant from the Japanese Ministry of Education Culture, Sports, Science, and Technology (MEXT) to the RIKEN Center for Integrative Medical Sciences.

90

Hazuki Takahashi et al.

References 1. Shiraki T, Kondo S, Katayama S et al (2003) Cap analysis gene expression for highthroughput analysis of transcriptional starting point and identification of promoter usage. Proc Natl Acad Sci USA 100 (26):15776–15781 2. Kodzius R, Kojima M, Nishiyori H et al (2006) CAGE: cap analysis of gene expression. Nat Methods 3(3):211–222 3. Plessy C, Bertin N, Takahashi H et al (2010) Linking promoters to functional transcripts in small samples with nanoCAGE and CAGEscan. Nat Methods 7(7):528–534 4. Takahashi H, Lassmann T, Murata M et al (2012) 5’ end-centered expression profiling using cap-analysis gene expression and nextgeneration sequencing. Nat Protoc 7 (3):542–561 5. Murata M, Nishiyori-Sueki H, KojimaIshiyama M et al (2014) Detecting expressed genes using CAGE. Methods Mol Biol 1164:67–85 6. Cvetesic N, Leitch HG, Borkowska M et al (2018) SLIC-CAGE: high-resolution transcription start site mapping using nanogramlevels of total RNA. Genome Res 28 (12):1943–1956 7. Andersson R, Sandelin A (2020) Determinants of enhancer and promoter activities of regulatory elements. Nat Rev Genet 21(2):71–87 8. Consortium EP (2012) An integrated encyclopedia of DNA elements in the human genome. Nature 489(7414):57–74 9. Forrest AR, Kawaji H, Rehli M et al (2014) A promoter-level mammalian expression atlas. Nature 507(7493):462–470 10. Andersson R, Gebhard C, Miguel-Escalada I et al (2014) An atlas of active enhancers across human cell types and tissues. Nature 507 (7493):455–461

11. Sanyal A, Lajoie BR, Jain G et al (2012) The long-range interaction landscape of gene promoters. Nature 489(7414):109–113 12. Rennie S, Dalby M, van Duin L et al (2018) Transcriptional decomposition reveals active chromatin architectures and cell specific regulatory interactions. Nat Commun 9(1):487 13. Hon CC, Ramilowski JA, Harshbarger J et al (2017) An atlas of human long non-coding RNAs with accurate 5’ ends. Nature 543 (7644):199–204 14. Haberle V, Li N, Hadzhiev Y et al (2014) Two independent transcription initiation codes overlap on vertebrate core promoters. Nature 507(7492):381–385 15. Carninci P, Kvam C, Kitamura A et al (1996) High-efficiency full-length cDNA cloning by biotinylated CAP trapper. Genomics 37 (3):327–336 16. Pillay S, Takahashi H, Carninci P et al (2020) Antisense ncRNAs during early vertebrate development are divided in groups with distinct features. Genome Res. Online ahead of print (https://doi.org/10.1101/gr.262964. 120) 17. Chen L, Yang W, Guo Y et al (2017) Exosomal lncRNA GAS5 regulates the apoptosis of macrophages and vascular endothelial cells in atherosclerosis. PLoS One 12(9):e0185406 18. Kundaje A, Meuleman W, Ernst J et al (2015) Integrative analysis of 111 reference human epigenomes. Nature 518(7539):317–330 19. Ramilowski JA, Yip CW, Agrawal S et al (2020) Functional annotation of human long noncoding RNAs via molecular phenotyping. Genome Res 30(7):1060–1072 20. Haberle V, Forrest AR, Hayashizaki Y et al (2015) CAGEr: precise TSS data retrieval and high-resolution promoterome mining for integrative analyses. Nucleic Acids Res 43(8):e51

Open Access This chapter is licensed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license and indicate if changes were made. The images or other third party material in this chapter are included in the chapter’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the chapter’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.

Part III Nucleosome Occupancy and DNA Accessibility

Chapter 5 Analyses of Promoter, Enhancer, and Nucleosome Organization in Mammalian Cells by MNase-Seq Cyril Esnault, Talha Magat, Encar Garcı´a-Oliver, and Jean-Christophe Andrau

1

Introduction Transcriptional regulatory elements are central in organizing complex mammalian genomes [1], in establishing transcription programs, and in controlling developmental or physiological processes [1–3]. Promoters or enhancers activities and regulation are intrinsically linked to the chromatin organization and dynamics [4]. The nucleosome-histone octamer bound to DNA represents the fundamental unit of the chromatin and its association with DNA at specific features is associated to gene expression control. In mammals, promoters depict very specific chromatin architecture; with nucleosome-depleted regions (NDRs) surrounded by at least two very well-positioned nucleosomes, often-designated
1 and +1 relating to the TSS [5, 6]. Chromatin opening at promoter will generally favor association of the preinitiation complex (PIC) and thus gene activity. It is a prerequisite for transcription to occur and may be regulated through the properties of specific genomic features such as CpG islands, DNA methylation, histone modification marks, transcription factors, and other regulators [7–10]. In addition, at NDRs, unstable nucleosomes containing H3.3 and H2A.Z are also found contributing to the gene regulation [11]. Over the recent years, a wide range of genome-wide technologies has emerged to study chromatin dynamics [12]. Among them, MNase-Seq is a very powerful tool to study chromatin organization (Fig. 1). It allows high-resolution mapping at the resolution of single-nucleosomes, defining precisely nucleosome positioning, NDRs, or sliding of nucleosomes across conditions or cell types

Tilman Borggrefe and Benedetto Daniele Giaimo (eds.), Enhancers and Promoters: Methods and Protocols, Methods in Molecular Biology, vol. 2351, https://doi.org/10.1007/978-1-0716-1597-3_5, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

93

94

Cyril Esnault et al.

Nucleosome Depleted Region (NDR) MNase

MNase digestion Mono-nucleosomes

~146bp

DNA purification

High throughput sequencing Alignment and analysis MNase-seq signal

Nucleosome mapping Nucleosome depletion Fig. 1 Schematic view of the MNase-seq procedure and principles. MNase digests inter-nucleosomal DNA allowing release of nucleosome DNA. After digestion, DNA is purified, subjected to library preparation and sequenced using high-throughput sequencing. Following alignment and bioinformatics analyses, mono-nucleosomes can be mapped. Their position at high resolution as well as nucleosome-depleted regions (NDRs) location can be determined

[13–15]. In addition, using settled digestion conditions; it also allows studying histone properties and leave access to labile nucleosomes at regulatory elements [16, 17].

2

Materials Prepare all solutions using ultrapure water (prepared by purifying deionized water to attain a sensitivity of 18 MΩ-cm at 25  C) and analytical grade reagents. Prepare and store all reagents at room temperature (unless indicated otherwise). Diligently follow all waste disposal regulations when disposing waste materials. We recommend filtering all buffers at 0.2 μm before use and storage (see Note 1).

2.1

MNase

1. Micrococcal nuclease, Nuclease S7 from Staphylococcus aureus ~15,000 U/mg (Roche).

Analyses of Nucleosome Organization by MNase-Seq

95

2. Resuspension buffer: 20 mM Tris–HCl pH 7.5, 50 mM NaCl, 50% glycerol. 2.2 MNase Digestion of Cell in Suspension

1. Suspension cell buffer (see Note 2): 35 mM HEPES pH 7.4, 150 mM sucrose, 80 mM KCl, 5 mM KH2PO4, 5 mM MgCl2, 0.2% NP40. 2. Digestion buffer for cell in suspension: 50 mM Tris–HCl pH 8.0, 150 mM sucrose, 50 mM NaCl, 5 m M CaCl2. 3. Lysis Buffer: 50 mM Tris–HCl pH 8.0, 1% SDS, 10 mM Ethylenediaminetetraacetic acid (EDTA).

2.3 MNase Digestion of Adherent Cells

1. Trypsin. 2. Nuclei buffer I: 15 mM Tris–HCl pH 7.5, 300 mM sucrose, 60 mM KCl, 15 mM NaCl, 5 mM MgCl2, 0.1 mM ethylene glycol-bis N,N,N0 ,N0 -tetra-acetic acid (EGTA), 0.5 mM dithiothreitol (DTT), 0.1 mM phenylmethylsulfonyl fluoride (PMSF), 3.6 μg/mL aprotinin (see Note 2). 3. Nuclei buffer II: 15 mM Tris–HCl pH 7.5, 300 mM sucrose, 60 mM KCl, 15 mM NaCl, 5 mM MgCl2, 0.1 mM EGTA, 0.5 mM DTT, 0.1 mM PMSF, 3.6 μg/mL aprotinin, 0.4% IGEPAL CA-630. 4. Nuclei buffer III: 15 mM Tris–HCl pH 7.5, 1.2 M sucrose, 60 mM KCl, 15 mM NaCl, 5 mM MgCl2, 0.1 mM EGTA, 0.5 mM DTT, 0.1 mM PMSF, 3.6 μg/mL aprotinin. 5. MNase digestion buffer for adherent cells: 50 mM Tris–HCl pH 7.5, 320 mM sucrose, 4 mM MgCl2, 1 mM CaCl2, 0.1 mM PMSF. 6. Lysis Buffer: 50 mM Tris–HCl pH 8.0, 1% SDS, 10 mM Ethylenediaminetetraacetic acid (EDTA).

2.4 Other Buffers and Reagents

1. 500 mM ethylenediaminetetraacetic acid (EDTA). 2. Phosphate-Buffered Saline (PBS). 3. RNase A (10 μg/μL). 4. Proteinase K (800 U/mL). 5. TE Buffer: 10 mM Tris–HCl pH 8.0, 1 mM EDTA. 6. Ammonium acetate (NH4OAc). 7. Phenol:chloroform:isoamyl alcohol (25:24:1). 8. 100% ethanol. 9. Filter units with pore size 0.2 μm (Nalgene). 10. QUiaquick purification kit (Quiagen). 11. Purification beads: AMPure XP for PCR Purification.

96

Cyril Esnault et al.

2.5 MNase Resuspension

1. Dilute MNase at 15 U/μL in the resuspension buffer.

2.6

1. Agarose gel: 1.5% agarose diluted in TBE buffer (Tris–borateEDTA—130 mM Tris–HCl pH 7.5, 45 mM boric acid, 2.5 mM EDTA).

Quality Control

2. Aliquot the resuspend MNase and store at
20 Note 3).



C (see

2. Bioanalyzer (Agilent). 2.7 Library Preparation and Bioinformatics

3

1. High-throughput sequencing library kit: TruSeq ChIP Library Preparation Kit (Illumina). 2. Analytical bioinformatics package: PASHA [18].

Methods Carry out all procedures at room temperature unless otherwise specified.

3.1 Preparation of the Digestion Mix for Cell in Suspension

1. Prepare for each experiment five tubes with decreasing amount of MNase. Optimal enzyme unit concentration needs to be defined for each stock (usually between 50 and 3 U, see Note 4). 2. Dilute MNase into five tubes in cascade in the digestion buffer for cell in suspension. We recommend preparing a first tube with 110 U in 1.1 mL. Then, dilute by factor two in cascade into four different new tubes. Using this procedure, prepare digestion mixes ranging from 55 U in 550 μL (this represents 50 U in 500 μL) to 6.9 U in 1.1 mL (representing 3.125 U in 500 μL). 3. Keep one tube without enzyme as control. 4. Before use, pre-warm the mix at 37  C for at least 5 min but no more than 1 h (see Note 5).

3.2 Preparation of Cell in Suspension

1. Pellet 30 million cells by centrifugation at 400  g for 5 min and discard the supernatant. 2. Resuspend the cells in 300 μL in suspension cell buffer and aliquot per 50 μL (five million cells per aliquot). 3. Keep the cells at 37  C for 5 min (see Note 4).

3.3 Chromatin Digestion by MNase of Cells in Suspension

1. Add 500 μL of the digestion mixes prepared in Subheading 3.2 for cell to 50 μL of the cellular preparation (see Subheading 3.3 and Notes 6 and 7). 2. Mix by gentle pipetting and incubate at 37  C for exactly 10 min (see Notes 6 and 7).

Analyses of Nucleosome Organization by MNase-Seq

97

3. Then stop the reaction by adding 11 μL EDTA (500 mM) and mix well by pipetting to inactivate the MNase. 4. Keep the samples on ice. (Then go to Subheading 3.7). 3.4 Preparation of Adherent Cell

1. Harvest 30 million cells with standard procedure (depending of the cell type, usually using trypsin). 2. Pellet 30 million cells by centrifugation at 400  g for 5 min and discard the supernatant. 3. Rinse the cells in ice-cold PBS, centrifuge at 400  g for 5 min at 4  C, and discard the supernatant. 4. Resuspend the cells in 250 μL of ice-cold Nuclei buffer I. Then, add 250 μL of ice-cold Nuclei buffer II, mix gently, and place on ice for 10 min. 5. Prepare 1.5 mL Eppendorf tubes containing 1 mL of ice-cold Nuclei buffer III. Carefully layer 500 μL of the cell suspension on the 1 mL sucrose cushion (Nuclei buffer III). Do not mix layers (see Note 8). 6. Centrifuge at 10,000  g for 20 min at 4  C. Following this step, the nuclei will form a pellet on the bottom of the tube, whereas the cytoplasmic components will remain in the top layer. 7. Carefully remove the supernatant. This is a critical step, as the top solution contains the detergent IGEPAL CA-630 that should not come into contact with the nuclear pellet, which is at the bottom of the tube. We recommend changing the tip between layers (see Note 9). 8. Resuspend very carefully the nuclei pellet into 600 μL of MNase digestion buffer for adherent cells and put on ice for 3 min. 9. Aliquots per 100 μL and incubate the six samples for 5 min at 37  C (each aliquot correspond to the nuclei of 5 million cells). This 5 min of incubation time can be used to prepare the digestion mixture (see Subheading 3.6).

3.5 Chromatin Digestion by MNase of Adherent Cells

1. Prepare for each experiment five tubes with decreasing amount of MNase. Optimal enzyme unit concentration needs to be defined for each stock (usually between 50 and 3 U, see Note 4). Add one extra tube without enzyme as control. Thus, dilute MNase into five tubes in cascade in the resuspension buffer. We recommend preparing a first tube with 120 U in 12 μL. Then dilute by factor two in cascade into four different new tubes. Using this procedure, you would prepare digestion mixes ranging from 60 U in 6 μL (representing 50 U in 5 μL) to 7.5 U in 12 μL (this represents 3.125 U in 5 μL).

98

Cyril Esnault et al.

2. Add 5 μL of each enzyme concentration mixture to 100 μL of the cellular preparation (from Subheading 3.5). 3. Mix by gentle pipetting and incubate at 37  C for exactly 10 min (see Note 6). 4. Then stop the reaction by adding 11 μL of 500 mM EDTA and mix well by pipetting to inactivate MNase. 5. Add 445 μL of ice-cold ultrapure water and put the samples on ice (then go to Subheading 3.7). 3.6 Cell Lysis and DNA Extraction

1. Add 550 μL of Lysis Buffer and incubate on ice for 10 min. 2. Add 1.1 mL of ice-cold ultrapure water to dilute the sample. 3. Add 5 μL of RNase A (10 μg/μL) and incubate at 37  C for 2 h. 4. Add 4 μL of Proteinase K (800 U/mL) and incubate at 56  C for 2 h.

3.7

Quality Controls

1. DNA extraction: for a rapid assessment, column-based protocols can be used on 100 μL of the samples. We recommend the use the QIAquick PCR Purification Kit (Qiagen). Otherwise, favor DNA purification by Phenol extraction. 500 μL of samples would yield enough material for quality controls and to prepare sequencing libraries. The rest of the samples can be stored for further use at
20  C for 6 months. 2. Control the quality of the digestion on a 1.5% Agarose gel and on bioanalyzer (Agilent) (Fig. 2a, b; see Note 11). Standard MNase digestion should yield about 75% of mononucleosomes migrating around 150 bp. However, milder digested samples are also of interest allowing the analysis of labile nucleosomes (Fig. 2c, d) [16, 17].

3.8 Mononucleosome Purification

1. For mono-nucleosomes purification, while gel extraction protocols can be used, we recommend to use purification beads such as AMPure XP for PCR Purification. Hence, dilute 500 ng of MNase digested sample in 100 μL of ultrapure water. 2. Add 60 μL of AMPure XP beads and pipet up and down thoroughly to mix the beads and the samples. 3. Incubate the mixture at room temperature for 5–15 min to bind DNA to the beads. 4. Place the tube(s) on a magnetic rack and wait until the liquid is clear to capture the beads. 5. Carefully collect the supernatant that contains fragments below ~250 bp. (the beads can be kept if you are interested in larger fragments. DNA can be collected following the procedure at step 10 of this section with the beads).

Analyses of Nucleosome Organization by MNase-Seq

99

A 200 6u

0 200

12u 25u

150

Fluorescence

50u Fluorescence

3u

3u

200

100

0 200

0 200

6u

12u

25u

50 0 200

50u

0

bp 2000 1000 500 300 100 50u

25u

12u

6u

3u

0 38

bp

10

35

0 38

C % of mononucleosome

B

10

0 50 0 60 0 10 00 20 00

40

0 30

10 0 15 0 20 0

35

0 bp

100 90 80 70 60 50 40 30 20 10 0 0

10

20 30 40 50 MNase units (u)

60

Fig. 2 (a) Bioanalyzer profiles after MNase digestion. Raji cells were used to assay the protocol. The quantity of MNase used is indicated in the colored legend: (left) overlay of all profiles; (right) profiles obtained at 3, 6, 12, 25, and 50 U of MNase are shown individually. (b) Analysis of the MNase digestion by electrophoresis. DNA fragments obtained by MNase digestion were analyzed on 1.5% agarose gel and visualized using SYBR safe. (c) Analysis of the mono-nucleosome fractions. Using bioanalyzer profiles and quantifications, the fractions corresponding to mono-nucleosomes (between 50 and 250 bp) were determined. (d) MNase-Seq profiles at EEF1A1 promoter and at the enhancer of PU.1. MNase-Seq profiles after analysis by PASHA [18] are displayed. In pink are shown results from a digestion at 6 U and in blue at 50 U. Positions of labile nucleosomes and NDRs are highlighted

100

Cyril Esnault et al.

D EEF1A1 Promoter

6u

50u

Reads per million

250

NDR labile nucleosome

70

PU.1 Enhancer 250

NDR labile nucleosome

70

1kb

1kb

Enhancer

EEF1A1

Fig. 2 (continued)

6. Mix now 150 μL of collected supernatants with 270 μL of AMPure XP beads and pipet up and down thoroughly to mix the beads and the samples. 7. Incubate the mixture at room temperature for 5–15 min to bind DNA to the beads. 8. Place the tube(s) on a magnetic rack and wait until the liquid is clear to capture the beads. 9. Carefully remove and discard the supernatant. 10. Keep the tube(s) on the magnetic rack and add 200 μL of 80% ethanol to wash the beads. 11. Incubate the tube(s) at room temperature and wait for 30–60 s. 12. Carefully discard remaining ethanol. 13. Repeat steps 10–12 of this section again. 14. Try to remove the residual ethanol as much as possible without disturbing the beads. 15. Dry the beads at room temperature. To avoid over-drying the beads, drying time should be no longer than 15 min. 16. Remove the tube from the magnetic rack. 17. Resuspend the beads in 25 μL TE Buffer. 18. Incubate the tube(s) at room temperature for 2 min to elute DNA from the beads. 19. Place the tube back on the magnetic rack to capture the beads. Incubate until the liquid is clear. 20. Collect the supernatants that contain mono-nucleosomes.

Analyses of Nucleosome Organization by MNase-Seq

3.9 Library Construction and Bioinformatics

101

1. We recommend verifying the quality of the mono-nucleosome purification on a bioanalyzer chip before further processing the library preparation. This should yield above 90% of mononucleosomes. Please note that fragment size selection can still be performed later in silico during the bioinformatics analysis, if this can’t be achieved [18, 19]. 2. Use 10 ng of DNA to prepare sequencing libraries (see Note 12). We recommend the Illumina ChIP Sample Library Prep Kit (Illumina, USA). Follow the manufacturer’s instructions. In summary, fragments are end-repaired and ligated to adaptors. After elimination of adaptors, the library is amplified by 10 cycles of PCR. 3. Libraries can now be sequenced using high-throughput sequencing technologies such as Illumina Hiseq4000. We recommend performing paired-ended sequencing. This would allow later fragment size selection during the bioinformatics analyze and enhance the alignment quality. We also recommend to sequence at a depth of at least 100 million tags for nucleosome mapping. Below that depth, NDRs detection could still be performed but mono-nucleosome maps would be ambiguous. 4. Sequencing files can now be analyzed using dedicated tools such as PASHA [18].

4

Notes 1. All our buffers have been filtered using 0.2 μm pore size. For sucrose containing buffers, we advise to aliquot the stock. Protease inhibitors, in particular PMSF, are rather unstable in aqueous solutions. Therefore, PMSF, as well as DTT, NP40, and aprotinin, should be added just before use. Buffers prior PMSF, DTT, NP40, or aprotinin additions can be stored at
4  C. 2. Our methods have been divided into two versions for either cell in suspension or adherent cells. The first version is rapid and robust, however adherent cells that have been harvested using trypsin tend to clamp when tested. Therefore, we also propose a version where nuclei have been purified first. This version is more time consuming but is also extremely robust. While it is proposed here for adherent cells, it can also be used on cells grown in suspension. 3. MNase activity may vary from lot to lot or manufacturers. We highly recommend testing the activity of each new stock solution. Therefore, follow the protocol for 35 million cells and

102

Cyril Esnault et al.

start at 100 U instead of 50. Aliquot the MNase solution after solubilization, usually per 15 μL and store at
20  C. The solution can be stored for several months but avoid freezing and thawing cycles. 4. In our experience, 75% of nucleosome is usually reached at 25 U of MNase and represents the optimal concentration for nucleosome mapping. For your experiments, we suggest to start the dilution procedure at twice that point (usually 50 U). 5. For reproducibility, it is very important to pre-warm buffers, nuclei, and cell preparations at 37  C before MNase digestion. 6. Handling several tubes at once may be difficult. Thus, whenever possible, we propose to start the digestion of each tubes 30 s apart, therefore also stopping the reactions with delays of 30 s between each tube. 7. It is important to mix well the cellular or nuclei preparations when starting the MNase digestion and to be careful not to leave drops on the tube sides as this would lead to remaining undigested chromatin at later steps. 8. Be extremely careful to layer the 500 μL of cellular preparation on the 1 mL ice-cold Nuclei buffer III (sucrose cushion). It is easier to put the tip of the pipette on the side of the tube to delicately place the cellular preparation on the top of the sucrose cushion. 9. When collecting the nuclear pellets during their preparation, it is very important to avoid contacts between the different layers. Indeed, as previously mentioned the upper solution contains IGEPAL CA-630, which could impair the integrity of nuclear membranes. We also recommend changing tips between the layers. 10. This protocol is designed for high-throughput sequencing technologies. However, it is possible to assess the chromatin density using qPCR probes. In that case, probes located at housekeeping gene promoters can be used as control. 11. Controlling the MNase digestion is key for the success of the experiment. Usual nucleosome maps performed at ~75% of mono-nucleosome digestion levels. But, other settled conditions are also of interest and can inform on labile nucleosomes that are important for transcription regulation (Fig. 2c, d) [16, 17]. 12. We propose to use Illumina library preparation kits but our protocol is suitable for other library preparation methods.

Analyses of Nucleosome Organization by MNase-Seq

103

Acknowledgments This work was supported by the French National Research Agency (ANR, ANR-18-CE12-0020) and the CNRS-UMR 5535 Institut de Ge´ne´tique Mole´culaire de Montpellier. References 1. Andersson R, Sandelin A (2020) Determinants of enhancer and promoter activities of regulatory elements. Nat Rev Genet 21(2):71–87. https://doi.org/10.1038/s41576-019-01738 2. Lonfat N, Montavon T, Darbellay F, Gitto S, Duboule D (2014) Convergent evolution of complex regulatory landscapes and pleiotropy at Hox loci. Science 346(6212):1004–1006. https://doi.org/10.1126/science.1257493 3. Lupianez DG, Kraft K, Heinrich V, Krawitz P, Brancati F, Klopocki E, Horn D, Kayserili H, Opitz JM, Laxova R, Santos-Simarro F, Gilbert-Dussardier B, Wittler L, Borschiwer M, Haas SA, Osterwalder M, Franke M, Timmermann B, Hecht J, Spielmann M, Visel A, Mundlos S (2015) Disruptions of topological chromatin domains cause pathogenic rewiring of gene-enhancer interactions. Cell 161(5):1012–1025. https://doi.org/10.1016/j.cell.2015.04.004 4. Natoli G, Andrau JC (2012) Noncoding transcription at enhancers: general principles and functional models. Annu Rev Genet 46:1–19. https://doi.org/10.1146/annurev-genet110711-155459 5. Jiang C, Pugh BF (2009) Nucleosome positioning and gene regulation: advances through genomics. Nat Rev Genet 10(3):161–172. https://doi.org/10.1038/nrg2522 6. Lenhard B, Sandelin A, Carninci P (2012) Metazoan promoters: emerging characteristics and insights into transcriptional regulation. Nat Rev Genet 13(4):233–245. https://doi. org/10.1038/nrg3163 7. Lay FD, Liu Y, Kelly TK, Witt H, Farnham PJ, Jones PA, Berman BP (2015) The role of DNA methylation in directing the functional organization of the cancer epigenome. Genome Res 25(4):467–477. https://doi.org/10.1101/gr. 183368.114 8. Esnault C, Gualdrini F, Horswell S, Kelly G, Stewart A, East P, Matthews N, Treisman R (2017) ERK-induced activation of TCF family of SRF cofactors initiates a chromatin modification cascade associated with transcription. Mol Cell 65(6):1081–1095.e1085. https:// doi.org/10.1016/j.molcel.2017.02.005

9. Zippo A, Serafini R, Rocchigiani M, Pennacchini S, Krepelova A, Oliviero S (2009) Histone crosstalk between H3S10ph and H4K16ac generates a histone code that mediates transcription elongation. Cell 138 (6):1122–1136. https://doi.org/10.1016/j. cell.2009.07.031 10. Fenouil R, Cauchy P, Koch F, Descostes N, Cabeza JZ, Innocenti C, Ferrier P, Spicuglia S, Gut M, Gut I, Andrau JC (2012) CpG islands and GC content dictate nucleosome depletion in a transcription-independent manner at mammalian promoters. Genome Res 22(12):2399–2408. https://doi.org/10. 1101/gr.138776.112 11. Jin C, Zang C, Wei G, Cui K, Peng W, Zhao K, Felsenfeld G (2009) H3.3/H2A.Z double variant-containing nucleosomes mark ‘nucleosome-free regions’ of active promoters and other regulatory regions. Nat Genet 41 (8):941–945. https://doi.org/10.1038/ng. 409 12. Meyer CA, Liu XS (2014) Identifying and mitigating bias in next-generation sequencing methods for chromatin biology. Nat Rev Genet 15(11):709–721. https://doi.org/10. 1038/nrg3788 13. Schones DE, Cui K, Cuddapah S, Roh TY, Barski A, Wang Z, Wei G, Zhao K (2008) Dynamic regulation of nucleosome positioning in the human genome. Cell 132(5):887–898. https://doi.org/10.1016/j.cell.2008.02.022 14. Valouev A, Johnson SM, Boyd SD, Smith CL, Fire AZ, Sidow A (2011) Determinants of nucleosome organization in primary human cells. Nature 474(7352):516–520. https:// doi.org/10.1038/nature10002 15. Teif VB, Beshnova DA, Vainshtein Y, Marth C, Mallm JP, Hofer T, Rippe K (2014) Nucleosome repositioning links DNA (de)methylation and differential CTCF binding during stem cell development. Genome Res 24(8):1285–1295. https://doi.org/10.1101/gr.164418.113 16. Mieczkowski J, Cook A, Bowman SK, Mueller B, Alver BH, Kundu S, Deaton AM, Urban JA, Larschan E, Park PJ, Kingston RE, Tolstorukov MY (2016) MNase titration reveals differences between nucleosome

104

Cyril Esnault et al.

occupancy and chromatin accessibility. Nat Commun 7:11485. https://doi.org/10. 1038/ncomms11485 17. Iwafuchi-Doi M, Donahue G, Kakumanu A, Watts JA, Mahony S, Pugh BF, Lee D, Kaestner KH, Zaret KS (2016) The pioneer transcription factor FoxA maintains an accessible nucleosome configuration at enhancers for tissuespecific gene activation. Mol Cell 62 (1):79–91. https://doi.org/10.1016/j. molcel.2016.03.001

18. Fenouil R, Descostes N, Spinelli L, Koch F, Maqbool MA, Benoukraf T, Cauchy P, Innocenti C, Ferrier P, Andrau JC (2016) Pasha: a versatile R package for piling chromatin HTS data. Bioinformatics 32 (16):2528–2530. https://doi.org/10.1093/ bioinformatics/btw206 19. Teves SS, Henikoff S (2011) Heat shock reduces stalled RNA polymerase II and nucleosome turnover genome-wide. Genes Dev 25 (22):2387–2397. https://doi.org/10.1101/ gad.178079.111

Chapter 6 Measuring Chromatin Accessibility: ATAC-Seq Sanjeeb Kumar Sahu, Amitava Basu, and Vijay K. Tiwari

1

Introduction The nucleosome is the core structural element of chromatin, consisting of an octamer of four histone proteins encircled by ~147 bp of DNA [1]. Chromatin plays an essential role in establishing and maintaining cellular identity by regulating physical access to DNA [2]. The composition and post-translational modifications (histone and DNA modifications) of nucleosomes reflect distinct functional states [3], which regulate chromatin accessibility through a variety of mechanisms, such as altering transcription factor binding through steric hindrance and modulating nucleosome affinity for active chromatin remodelers [4]. These modifications on histones and DNA are heritable and termed as epigenetic modifications. The topological organization of nucleosomes across the genome is nonuniform. The nucleosomes are densely arranged within facultative and constitutive heterochromatin, which is less dynamic in nature while they are depleted at regulatory loci, including regions within promoters, enhancers, insulators, and transcribed gene bodies [5] (see Fig. 1). The chromatin states are reversible in nature and chromatin accessibility changes dynamically in response to developmental cues and external stimuli and, therefore complicated mechanisms have evolved to ensure the stable inheritance and maintenance of chromatin states. Such precise regulation of chromatin state defines cell type-specific gene expression patterns, which are critical for the development of an organism and maintaining homeostasis among various types of tissues.

Sanjeeb Kumar Sahu and Amitava Basu contributed equally. Tilman Borggrefe and Benedetto Daniele Giaimo (eds.), Enhancers and Promoters: Methods and Protocols, Methods in Molecular Biology, vol. 2351, https://doi.org/10.1007/978-1-0716-1597-3_6, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

105

106

Sanjeeb Kumar Sahu et al.

Dynamics

H3K9me3

Closed chromatin

TFs

TFs

TFs

TFs

H3K27me3

Permissive chromatin

Pol II

H3K4me3 H3K27ac

Open chromatin

Fig. 1 Chromatin organization and its dynamicity

Chromatin accessibility is the degree to which nuclear macromolecules can physically interact with the DNA. It is determined by the occupancy and topological organization of nucleosomes as well as other chromatin-binding factors that regulate access to DNA. The organization of accessible chromatin across the genome is a highly dynamic process, and the chromatin accessibility is crucial for the regulation of gene expression in specific cells as well as during diverse biological processes [2, 6]. The proper activities of enhancers and gene promoters are essential for coordinated transcription within a cell. Understanding the functions of regulatory elements and the determinants thereof is a major challenge in the field. In line with this, various tools were developed to measure chromatin accessibility [2]. Assay for Transposase-Accessible Chromatin with high-throughput sequencing (ATAC-Seq) is the most recent and a simple, sensitive, and effective method to investigate chromatin accessibility at a genome-wide level [7]. 1.1 Different Methods for Measuring Chromatin Accessibility

In 1973, Hewish and colleagues used DNA endonucleases to fragment the genome and found periodic hypersensitivity in it [8]. This periodicity was confirmed with Southern blot hybridization, which showed a canonical 100–200 bp phasing pattern among DNase hypersensitivity sites (DHSs) that were conserved across the genomic loci. This and subsequent work provided the earliest direct evidence for stereotypical nucleosome phasing. Some of the widely used methods for the determination of chromatin accessibility are described below (see Fig. 2 and Table 1). DNase-Seq: Historically open chromatin has been identified by the hypersensitivity of genomic sites to nonspecific doublestrand endonuclease DNase I [9]. In a typical experiment, low concentrations of DNase I preferentially cut within nucleosomefree genomic regions characterized as DNase hypersensitivity sites

Genome-wide Assessment of Chromatin Accessibility using ATAC-Seq Assay a

b

c

MNase-Seq

DNase-Seq

MNase

DNase

107

d FAIRE-Seq

ATAC-Seq Tn5 Transposase with adaptors

Sonicate

Cut & digest the open DNA

TF s

TF s

TF s

TF s

TF s

Formaldehyde crosslink

Cut the open DNA

TF s

TF s

Phenol-chloroform extraction of DNA

Isolate DNA

DNA isolation

T F s

T F s

Isolate DNA

Adapter ligation & Library preparation

With or without size selection

Adapter ligation & Library preparation

PCR amplification & Size selection

DNA from aqueous phase

Adapter ligation & Library preparation

Fig. 2 Graphical representation of various methods used to determine chromatin accessibility

or DHSs (see Fig. 2a). Either lysed cell or isolated nuclei were preferable for such experiment followed by DNA isolation. Genome-wide measurements of open chromatin were first reported in 2006 in a pair of studies that hybridized DNase I-cleaved fragments isolated from native chromatin onto tiled microarrays spanning 1% of the human genome [10]. MNase-Seq: Given the central role of histone proteins in regulating chromatin accessibility, the nucleosome occupancy and positioning technique micrococcal nuclease sequencing (MNaseSeq) has recently been adapted to measure accessibility. MNase acts both as an endonuclease to cleave inter-nucleosomal DNA and an exonuclease to degrade cleaved DNA not protected by proteins. For MNase assay, cells need to be crosslinked and lysed before MNase treatment followed by DNA isolation (see Fig. 2b). A notable difference between MNase-Seq and both DNase-Seq and ATAC-Seq is the absence of nucleosomal DNA cleavage events [11]. FAIRE : One of the easiest methods for directly probing nucleosome-depleted areas of a genome is FAIRE (Formaldehyde-Assisted Isolation of Regulatory Elements). However, the high background in the output data limits its usefulness. FAIRE is based on the phenol-chloroform separation of nucleosome-bound and free areas of a genome in the interphase and aqueous phase, respectively. The procedure involves the initial crosslinking of chromatin with formaldehyde to capture in vivo protein–DNA interactions followed by subsequent shearing of chromatin by sonication. Following phenol-chloroform extraction, nucleosome-depleted areas of the genome are released into the

108

Sanjeeb Kumar Sahu et al.

Table 1 Comparison of various methods used to determine chromatin accessibility MNase-Seq

DNase-Seq

FAIRE-Seq

ATAC-Seq

Cell number range

1–10 millions

1–10 millions

100,000 to 10 millions

500–50,000

Cell stage

Fresh or fixed

Fresh or fixed

Fresh or fixed

Fresh or slowly cryopreserved

Sequencing type

Single/paired end Single/paired end

Single/paired end

Paired end

Principle

MNase digest unprotected DNA

DNase 1 cuts unprotected DNA

Tn5 transposase During phenolintegrates the chloroform provided adaptors separation, into accessible nucleosomechromatin bound genome stays in the interphase and free DNA stays in the aqueous phase

Readouts

Nucleosome position with quantitative manner

Open chromatin

Open chromatin

Open chromatin and some extent nucleosome occupancy

2–3 days

2–4 days

2–3 h

Required time 2–3 days

150–200 millions 20–50 millions reads Required reads sequencing depth for human cells Cons

l

l

l

Pros

Required many cells Need enzyme activity optimization Don’t provide direct information on active regulatory regions

l

l

l

Required many cells Complicated and time consuming protocol Enzyme titration required

Precise position of Transcription factors nucleosome binding site

20–50 millions reads 50–100 millions reads

l

l

Low signal-tonoise ratio Quality further decreases with more differentiated cell type

l

Mitochondrial DNA contamination or overrepresentation

l

Required very less cells Simpler and fast protocol High signalto-noise ratio

l

l

Genome-wide Assessment of Chromatin Accessibility using ATAC-Seq Assay

109

aqueous phase of the solution due to much higher crosslinking efficiency of histones to DNA, compared to other regulatory factors [12] (see Fig. 2c). ATAC-Seq: ATAC-Seq is the most recent method for probing open chromatin, based on the ability of hyperactive Tn5 transposase to fragment DNA and integrate adaptor sequence into active regulatory regions in vivo. For ATAC-Seq, 500–50,000 unfixed cells are treated with a mild detergent to isolate the nuclei and tagged in vitro with sequencing adaptors by purified Tn5 transposase. Due to steric hindrance, the majority of adaptors are integrated into regions of accessible chromatin that are subsequently PCR amplified for library construction followed by paired-end sequencing [7] (see Fig. 2d). ATAC-Seq can produce reads from a small number of cells reflecting the accessible regions that correspond to nucleosome positioning and transcription factor-binding sites [13].

2

Materials The ATAC-Seq protocol described here is adapted from Buenrostro et al. 2015. Over the year, there have been several publications from different laboratories. However, the basic underlying principle of the protocol remains the same and described in this chapter. 1. Cultured cells or tissue samples. 2. Cells or tissue dissociating reagents (e.g.,Trypsin or Papain based). 3. Phosphate-buffered saline (PBS). 4. 0.4% Trypan blue stain. 5. Lysis buffer: 10 mM Tris pH 7.4, 10 mM NaCl, 3 mM MgCl2, 0.1% (v/v) Igepal CA-630, or Nonidet P-40 (NP40). 6. TD (2X reaction buffer from Nextera kit; Illumina). 7. TDE1 (Nextera Tn5 Transposase from Nextera kit; Illumina). 8. Nuclease-free water. 9. Qiagen MinElute PCR Purification Kit. 10. Barcoded PCR Primer 1 and 2. 11. NEB Next High-Fidelity 2X PCR Master Mix (New England Biolabs). 12. Bioanalyzer High-Sensitivity DNA Analysis kit (Agilent). 13. KAPA Library Quantification Kit Illumina® platforms. 14. 100 SYBR Green I. 15. Ampure XP beads.

110

Sanjeeb Kumar Sahu et al.

16. 80% Ethanol. 17. Refrigerated centrifuge. 18. 0.2 mL PCR tubes. 19. PCR thermal cycler. 20. qPCR instrument.

3

Methods

3.1 Preparation of Samples and Nuclei Isolation

1. If starting with adherent cultured cells, gently dissociate the cells by trypsinization using 0.25% Trypsin followed by neutralization of Trypsin with media containing FBS (Fetal Bovine Serum). Pellet cells in a centrifuge at 300  g for 3 min at 4  C. If the starting material is from in vivo tissue samples, follow the appropriate dissociation protocol to acquire single-cell suspension (Critical step: see Note 1). 2. Resuspend the pelleted cells in ice-cold PBS and count the cells using an automated cell counter after trypan blue staining or manually by hemocytometer. Collect 50,000 cells in a 1.5 mL Eppendorf tube by centrifuging at 300  g for 3 min at 4  C (Critical step: see Note 2). 3. Discard the supernatant and add 50 μL of 1X ice-cold lysis buffer to the pelleted cells and gently mix by pipetting up and down. Depending upon cell types, the incubation time may vary from 0 to10 min on ice (see Note 3 and Critical step: see Note 4). 4. Pellet the nuclei in the lysis buffer at 500  g for 15 min at 4  C in a fixed angle centrifuge to prevent possible loss of nuclei (see Note 5).

3.2 Tn5 Transposition Reaction

1. Prepare the transposition reaction mixture on ice as below: Reagent

For reaction (μL)

2 reaction buffer TD (Nextera kit)

25

Tn5 transposase with adaptors (Nextera kit)

2.5

Nuclease-free water

22.5

Total volume

50

2. Mix the isolated nuclei from Subheading 3.1, step 4 with 50 μL transposition mixture and incubate at 37  C with gentle mixing for 30 min (see Note 6 and Critical step: see Note 7). 3. After the transposition reaction, purify the DNA using Qiagen MinElute PCR Purification kit following the manufacturer’s

Genome-wide Assessment of Chromatin Accessibility using ATAC-Seq Assay

111

protocol and finally elute the DNA in 10 μL of elution buffer. Eluted DNA samples can be stored at this point for later use. Use this eluted DNA for the library preparation (see Note 8). 3.3 Library Preparation

1. Perform library preparation in a 0.2 mL PCR tube by mixing the following components. The nucleotide sequences of the primers are provided in Table 2 (see Table 2).

Reagent

For reaction (μL)

Transposed DNA from Subheading 3.2, step 3

10

25 μM PCR Primer 1 (Ad1_noMX)

2.5

25 μM Barcoded PCR Primer 2 (Any primer from Ad 2.1 to 2.5 Ad 2.24) NEB Next High-Fidelity 2 PCR Master Mix

25

Nuclease-free water

10

Total volume

50

Set up a first PCR amplification step using the thermal cycler program below. The initial 5 min extension is important for filling up single-stranded gaps opposite to adaptor sequence. Step

Temperature ( C)

Time

Cycles

Initial extension

72

5 min

1

Initial denaturation

98

30 s

1

Denaturation Annealing Extension

98 63 72

10 s 30 s 1 min

5

4

Pause

After the initial amplification, perform a qPCR with the sample from this step for determining additional number of PCR cycles required to prepare the final library (see Note 9). 2. Set up a qPCR reaction as below.

Reagent

For reaction (μL)

PCR-amplified DNA from Subheading 3.3, step 1

5

25 μM PCR Primer 1 (Ad1_noMX)

0.25

25 μM Barcoded PCR Primer 2 (Use the same one as in Subheading 3.3, step 1)

0.25 (continued)

112

Sanjeeb Kumar Sahu et al.

Table 2 Oligos for ATAC library preparation (Adapted from Nature Methods: doi:10.1038/nmeth.2688) Primer name and barcode

Sequence

Ad1_noMX:

AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGA TGTG

Ad2.1_TAAGGCGA

CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGC TCGGAGATGT

Ad2.2_CGTACTAG

CAAGCAGAAGACGGCATACGAGATCTAGTACGGTCTCGTGGGC TCGGAGATGT

Ad2.3_AGGCAGAA

CAAGCAGAAGACGGCATACGAGATTTCTGCCTGTCTCGTGGGC TCGGAGATGT

Ad2.4_TCCTGAGC

CAAGCAGAAGACGGCATACGAGATGCTCAGGAGTCTCGTGGGC TCGGAGATGT

Ad2.5_GGACTCCT

CAAGCAGAAGACGGCATACGAGATAGGAGTCCGTCTCGTGGGC TCGGAGATGT

Ad2.6_TAGGCATG

CAAGCAGAAGACGGCATACGAGATCATGCCTAGTCTCGTGGGC TCGGAGATGT

Ad2.7_CTCTCTAC

CAAGCAGAAGACGGCATACGAGATGTAGAGAGGTCTCGTGGGC TCGGAGATGT

Ad2.8_CAGAGAGG

CAAGCAGAAGACGGCATACGAGATCCTCTCTGGTCTCGTGGGC TCGGAGATGT

Ad2.9_GCTACGCT

CAAGCAGAAGACGGCATACGAGATAGCGTAGCGTCTCGTGGGC TCGGAGATGT

Ad2.10_CGAGGCTG CAAGCAGAAGACGGCATACGAGATCAGCCTCGGTCTCGTGGGC TCGGAGATGT Ad2.11_AAGAGGCA

CAAGCAGAAGACGGCATACGAGATTGCCTCTTGTCTCGTGGGC TCGGAGATGT

Ad2.12_GTAGAGGA

CAAGCAGAAGACGGCATACGAGATTCCTCTACGTCTCGTGGGC TCGGAGATGT

Ad2.13_GTCGTGAT

CAAGCAGAAGACGGCATACGAGATATCACGACGTCTCGTGGGC TCGGAGATGT

Ad2.14_ACCACTGT

CAAGCAGAAGACGGCATACGAGATACAGTGGTGTCTCGTGGGC TCGGAGATGT

Ad2.15_TGGATCTG

CAAGCAGAAGACGGCATACGAGATCAGATCCAGTCTCGTGGGC TCGGAGATGT

Ad2.16_CCGTTTGT

CAAGCAGAAGACGGCATACGAGATACAAACGGGTCTCGTGGGC TCGGAGATGT

Ad2.17_TGCTGGGT CAAGCAGAAGACGGCATACGAGATACCCAGCAGTCTCGTGGGC TCGGAGATGT (continued)

Genome-wide Assessment of Chromatin Accessibility using ATAC-Seq Assay

113

Table 2 (continued) Primer name and barcode

Sequence

Ad2.18_GAGGGGTT CAAGCAGAAGACGGCATACGAGATAACCCCTCGTCTCGTGGGC TCGGAGATGT Ad2.19_AGGTTGGG CAAGCAGAAGACGGCATACGAGATCCCAACCTGTCTCGTGGGC TCGGAGATGT Ad2.20_GTGTGGTG CAAGCAGAAGACGGCATACGAGATCACCACACGTCTCGTGGGC TCGGAGATGT Ad2.21_TGGGTTTC

CAAGCAGAAGACGGCATACGAGATGAAACCCAGTCTCGTGGGC TCGGAGATGT

Ad2.22_TGGTCACA

CAAGCAGAAGACGGCATACGAGATTGTGACCAGTCTCGTGGGC TCGGAGATGT

Ad2.23_TTGACCCT

CAAGCAGAAGACGGCATACGAGATAGGGTCAAGTCTCGTGGGC TCGGAGATGT

Ad2.24_CCACTCCT

CAAGCAGAAGACGGCATACGAGATAGGAGTGGGTCTCGTGGGC TCGGAGATGT

Reagent

For reaction (μL)

100 SYBR Green I

0.09

NEB Next High-Fidelity 2 PCR Master Mix

5

Nuclease-free water

4.41

Total volume

15

Perform the following qPCR cycles in a light cycler instrument: Step

Temperature ( C)

Time

Cycles

Initial denaturation

98

30 s

1

Denaturation Annealing Extension

98 63 72

10 s 30 s 1 min

30

4

Pause

3. Use the light cycler program showing the plot between the linear Rn (fluorescent signal from SYBR Green I) vs. the number of cycles to get the additional number of cycles needed for final library preparation of the remaining 45 μL PCR reaction

114

Sanjeeb Kumar Sahu et al.

Fig. 3 Representative amplification plot demonstrating the correct number of additional cycles to perform ATAC-Seq library for the tested sample

mix. Select the cycle number that corresponds to one-third of the maximum fluorescent intensity. Let us take an example below from Applied Biosystem qPCR software. First, go to “Analysis” and select “multicomponent Plot”. Calculate the cycle number that corresponds to one-third the maximum fluorescent intensity, which will give the number of additional cycles required for optimal library concentration (see example below in Fig. 3). 3.4 Determination of Additional Cycle Number for Library Preparation

In the above example, the maximum fluorescent intensity is approximately 3,750,000. Hence, one-third of the max intensity is 1,250,000. Therefore, we need to check in the graph the cycle number corresponding to 1,250,000, which is approximately 8 cycles. So, in this case (16-8=8) 8 additional PCR cycles are required for this sample (see Fig. 3 and Note 10). 1. Run the remaining 45 μL PCR samples for the desired number of cycles () in a PCR machine using the program below: Step

Temperature ( C)

Time

Cycles

Initial denaturation

98

30 s

1

Denaturation Annealing Extension

98 63 72

10 s 30 s 1 min



4

Pause

Genome-wide Assessment of Chromatin Accessibility using ATAC-Seq Assay

115

Fig. 4 Schematic illustration for ATAC-Seq

2. Purify the PCR products using Qiagen Mini Elute PCR Purification kit following the manufacturer protocol and elute in 20 μL of elution buffer (see also Note 11). The protocol is summarized in Fig. 4. 3.5 SPRI Bead Purification of Library

The ATAC libraries contain a significant number of fragments greater than 1 kb in length. For this purpose, we select for desired library fragments using Solid Phase Reversible Immobilization (SPRI) beads such as Ampure XP beads. 1. Make up the sample volume of ATAC library to 50 μL and add 45 μL Ampure XP beads. Incubate at room temperature for 10 min to allow DNA to bind the beads (see Note 12 and Critical step: see Note 13). 2. Separate beads by using a magnetic rack and discard the supernatant without disturbing the beads. Wash beads twice with 200 μL of freshly prepared 80% ethanol for 30 s each without disturbing the beads. Give a brief pulse spin and transfer the tube to magnetic rack and carefully remove the remaining ethanol. 3. Dry beads at room temperature (5 to 10 min) and take out the PCR tube from magnetic rack. Add 21 μL of 1X TE buffer (10 mM Tris-HCl (pH 8.0), 0.1 mM EDTA) to the beads, mix well, and incubate at RT for 5 min. Elute the supernatant containing the library from beads after placing in a magnetic rack (see Critical step: see Note 14).

116

Sanjeeb Kumar Sahu et al.

Free DNA

Nucleosome bound DNA

Fig. 5 Bioanalyzer profile of a typical ATAC-Seq sample

3.6

Quality Control

1. Check the quality of the purified library in a Bioanalyzer or Tapestation using the High-sensitivity dsDNA chip according to manufacturer’s instructions. Proper nucleosome phasing should be visible in the bioanalyzer profile (see Fig. 5). 2. Perform qPCR on the ATAC library using short amplicons (70–80 bp) for active promoters as positive control and intergenic sites as a negative control. For qPCR, dilute samples 100 times before use. For ATAC-Seq, proceed with the undiluted library for sequencing.

3.7 Library Quantitation and Sequencing

Use qPCR-based quantitation methods for the ATAC-Seq libraries as other methods prevent accurate quantitation arising from high molecular weight fragments in the library. One of the recommended ways is using the KAPA Library Quant Kit for Illumina Sequencing Platforms (KAPA Biosystems) following the manufacturer’s protocol. For high-throughput analysis, different ATAC libraries can be multiplexed after ensuring that no two barcodes are the same (for single index:Barcoded PCR Primer 1 is common and Barcoded PCR Primer 2 needed to be with unique index sequence, while for dual index both Barcoded PCR Primers 1 and 2 needed to be designed with unique index sequences). For NextSeq run, a 50 bp paired-end sequencing with 50 million reads is sufficient to get the desired information from the ATAC-Seq data. However, depending on the requirement, sequencing with higher read depth and longer reads can be performed.

3.8

Several commonly used NGS softwares are used for ATAC-Seq analysis. Online platforms also host various customized packages to perform different ATAC-Seq analysis. The basic steps involved in ATAC-Seq analysis are as follows. Firstly, quality control of ATACSeq reads is performed followed by adaptor trimming. Reads are

Data Analysis

Genome-wide Assessment of Chromatin Accessibility using ATAC-Seq Assay

117

next aligned to the reference genome using software like Bowtie followed by the exclusion of mitochondrial reads. Peaks are determined using software like MACS2 or ZIMBA. Finally, differential peaks are identified between control and test samples. Links to some of these tools are given below: l

l

Picard Tools: http://broadinstitute.github.io/picard/

l

Samtools): http://www.htslib.org/

l

Cutadapt: https://pypi.python.org/pypi/cutadapt

l

l

l

3.9 Variations of ATAC-Seq

FastQC: http://www.bioinformatics.babraham.ac.uk/pro jects/fastqc/

Trim Galore: http://www.bioinformatics.babraham.ac.uk/pro jects/trim_galore/ bowtie2: http://bowtie-bio.sourceforge.net/bowtie2/index. shtml MACS2: https://pypi.python.org/pypi/MACS2

Since the ATAC-Seq method was first developed, it has been improved to adapt broader usage in research. Single-cell ATACSeq (scATAC-Seq) provides the first insightful examination of cellto-cell variability in chromatin organization, which can be achieved by a programmable microfluidic device or combinatorial cellular indexing scheme [14]. Moreover, Omni-ATAC-Seq is another improved ATAC-Seq protocol to detect chromatin accessibility. Based on the standard ATAC-Seq protocol, the Omni-ATAC-Seq adds a washing step using detergents after cell lysis to remove mitochondria from the transposition reaction and reduce the unwanted mitochondrial reads in sequencing [15]. Single-cell ATAC-Seq (scATAC-Seq): To check the variation of chromatin accessibility within a group of individual cells, scATAC-Seq is being increasingly used. Earlier scATAC protocols involved the use of microfluidics platform from Fluidigm for deriving single cells. Currently, a lot of focus has shifted on using alternate approaches like the 10 Genomics platform. In scATAC-Seq, the single cells are isolated followed by their tagmentation and library preparation using barcodes which can be mapped back to a particular cell. The individual libraries are amplified with unique barcoded primers, multiplexed and sequenced together (see Fig. 6). Omni ATAC-Seq: This method removes the mitochondria from the samples and consequently the mitochondrial reads from ATAC-Seq results. The mitochondrial reads are nonsignificant and are a mere waste of the sequencing resources (see Note 15). In this method, the nuclei obtained after cell lysis are further washed with a detergent such as 0.1% Tween-20 to remove mitochondria. This method also allows frozen material to be used as the source for

118

Sanjeeb Kumar Sahu et al.

Fig. 6 Comparative browser track for bulk ATAC-Seq vs. single-cell ATAC-Seq

doing the ATAC-Seq. Interestingly, a recent paper has shown the usefulness of such abundant mitochondrial reads for cellular barcoding [16]. ATAC-See: This method adds a florescent cluster together with DNA markers in the transposase enzyme which allows for visualization of open chromatin in the nuclei by immunofluorescence. methyl-ATAC-Seq (mATAC-Seq): This method not only gives information about the chromatin accessibility but also determines precisely the DNA methylation status of the DNA by bisulfite sequencing in the open chromatin region. Combined ATAC and RNA-Seq: It is now possible to simultaneously check chromatin accessibility and gene expression dynamics by ATAC-Seq and RNA-Seq, respectively. This is very useful in combining the data from these two methods of regulation in the cell to get a better picture of what happens at the molecular level.

4

Notes 1. Spin cells at low speed to prevent possible bursting of cells due to the centrifugal force. 2. The number of cells used is very crucial as the amount of Tn5 transposase used for the protocol changes accordingly. While a higher number of cells lead to under-transposition resulting in large fragment size distribution in the library, a smaller number

Genome-wide Assessment of Chromatin Accessibility using ATAC-Seq Assay

119

of cells contribute to over-transposition. The ATAC protocol permits cell number as low as 500 for carrying out ATAC reaction although greater noise is observed when using a low number of cells. However, in such a case, we need to optimize the volume of lysis buffer and the transposase. 3. The Igepal CA-630/NP-40 in the lysis buffer gently disrupts the cell membrane to release the nuclei into the lysis buffer. The nuclear membrane stays intact and the content inside the nucleus is unperturbed. 4. Resuspend the cells very gently to avoid disruption of the nuclear membrane, which will cause a higher background signal in the ATAC-Seq. Furthermore, the lysis time needs to be optimized for different cell types. If using a low number of cells, the lysis buffer can be reduced up to 10 μL. 5. This step pellets the nuclei from the lysis buffer, which also contains the cytoplasmic contents of the cells. Frequently, there is contamination of the mitochondrial DNA in ATAC-Seq results implying the carry-over of mitochondria during this step. 6. At this stage, the transposase enters into the nucleus and performs tagmentation reaction most preferably at open chromatin regions. The NGS adaptors preloaded on the transposase are hereby ligated at the end of the DNA that is cleaved by transposases. 7. The transposition time must be optimized for different cell types. 8. This is a convenient pause point for the protocol as the purified DNA can be stored at 20  C before proceeding to the next step. 9. Library preparation PCR: This step is crucial to remove PCR bias set up in the presence of limited reagents. The ATAC libraries should be amplified only for the desired number of cycles to prevent PCR duplication as well as bias in PCR during the exhaustion of PCR reagents. Paired-end reads are better suited to remove PCR duplicates from the sequencing results. 10. For the resulting value between 2 cycle numbers, use the smaller cycle number. 11. This is another convenient stopping point for this protocol as libraries can be stored at 20  C or taken forward for bead purification. 12. A 0.9 volume of Beads: 1 volume of the library works well in most cases. 13. Ampure beads should be equilibrated at room temperature for minimum of 30 min and vortexed well before using.

120

Sanjeeb Kumar Sahu et al.

14. The drying of beads is critical as the beads should neither contain any residual ethanol nor be totally dried as it affects the recovery of the samples. 15. Mitochondria reads: Though the mitochondrial reads don’t interfere directly with the ATAC-Seq results, they are a wastage of sequencing reads in the samples. Certain cells or samples might give more mitochondrial reads than others. In such cases, variations like omni-ATAC-Seq can be helpful.

Acknowledgments We would like to thank the members of the Tiwari lab for their cooperation and critical feedback. Importantly, we are very much thankful to Dr. Benedetto Daniele Giaimo for his critical suggestions in shaping this chapter. References 1. Kornberg RD, Thomas JO (1974) Chromatin structure; oligomers of the histones. Science 184(4139):865–868. https://doi.org/10. 1126/science.184.4139.865 2. Bell O, Tiwari VK, Thoma NH, Schubeler D (2011) Determinants and dynamics of genome accessibility. Nat Rev Genet 12(8):554–564. https://doi.org/10.1038/nrg3017 3. Allis CD, Jenuwein T (2016) The molecular hallmarks of epigenetic control. Nat Rev Genet 17(8):487–500. https://doi.org/10. 1038/nrg.2016.59 4. Dann GP, Liszczak GP, Bagert JD, Muller MM, Nguyen UTT, Wojcik F, Brown ZZ, Bos J, Panchenko T, Pihl R, Pollock SB, Diehl KL, Allis CD, Muir TW (2017) ISWI chromatin remodellers sense nucleosome modifications to determine substrate preference. Nature 548(7669):607–611. https://doi. org/10.1038/nature23671 5. Thurman RE, Rynes E, Humbert R, Vierstra J, Maurano MT, Haugen E, Sheffield NC, Stergachis AB, Wang H, Vernot B, Garg K, John S, Sandstrom R, Bates D, Boatman L, Canfield TK, Diegel M, Dunn D, Ebersol AK, Frum T, Giste E, Johnson AK, Johnson EM, Kutyavin T, Lajoie B, Lee BK, Lee K, London D, Lotakis D, Neph S, Neri F, Nguyen ED, Qu H, Reynolds AP, Roach V, Safi A, Sanchez ME, Sanyal A, Shafer A, Simon JM, Song L, Vong S, Weaver M, Yan Y, Zhang Z, Zhang Z, Lenhard B, Tewari M, Dorschner MO, Hansen RS, Navas PA, Stamatoyannopoulos G, Iyer VR, Lieb JD,

Sunyaev SR, Akey JM, Sabo PJ, Kaul R, Furey TS, Dekker J, Crawford GE, Stamatoyannopoulos JA (2012) The accessible chromatin landscape of the human genome. Nature 489 (7414):75–82. https://doi.org/10.1038/ nature11232 6. Klemm SL, Shipony Z, Greenleaf WJ (2019) Chromatin accessibility and the regulatory epigenome. Nat Rev Genet 20(4):207–220. https://doi.org/10.1038/s41576-018-0089-8 7. Buenrostro JD, Giresi PG, Zaba LC, Chang HY, Greenleaf WJ (2013) Transposition of native chromatin for fast and sensitive epigenomic profiling of open chromatin, DNA-binding proteins and nucleosome position. Nat Methods 10(12):1213–1218. https://doi.org/10.1038/nmeth.2688 8. Hewish DR, Burgoyne LA (1973) Chromatin sub-structure. The digestion of chromatin DNA at regularly spaced sites by a nuclear deoxyribonuclease. Biochem Biophys Res Commun 52(2):504–510. https://doi.org/ 10.1016/0006-291x(73)90740-7 9. Weintraub H, Groudine M (1976) Chromosomal subunits in active genes have an altered conformation. Science 193(4256):848–856. https://doi.org/10.1126/science.948749 10. Crawford GE, Davis S, Scacheri PC, Renaud G, Halawi MJ, Erdos MR, Green R, Meltzer PS, Wolfsberg TG, Collins FS (2006) DNase-chip: a high-resolution method to identify DNase I hypersensitive sites using tiled microarrays. Nat Methods 3(7):503–509. https://doi.org/10. 1038/nmeth888

Genome-wide Assessment of Chromatin Accessibility using ATAC-Seq Assay 11. Mieczkowski J, Cook A, Bowman SK, Mueller B, Alver BH, Kundu S, Deaton AM, Urban JA, Larschan E, Park PJ, Kingston RE, Tolstorukov MY (2016) MNase titration reveals differences between nucleosome occupancy and chromatin accessibility. Nat Commun 7:11485. https://doi.org/10.1038/ ncomms11485 12. Giresi PG, Kim J, McDaniell RM, Iyer VR, Lieb JD (2007) FAIRE (FormaldehydeAssisted Isolation of Regulatory Elements) isolates active regulatory elements from human chromatin. Genome Res 17(6):877–885. https://doi.org/10.1101/gr.5533506 13. Sun Y, Miao N, Sun T (2019) Detect accessible chromatin using ATAC-sequencing, from principle to applications. Hereditas 156:29. https:// doi.org/10.1186/s41065-019-0105-9 14. Buenrostro JD, Wu B, Litzenburger UM, Ruff D, Gonzales ML, Snyder MP, Chang

121

HY, Greenleaf WJ (2015) Single-cell chromatin accessibility reveals principles of regulatory variation. Nature 523(7561):486–490. https://doi.org/10.1038/nature14590 15. Corces MR, Trevino AE, Hamilton EG, Greenside PG, Sinnott-Armstrong NA, Vesuna S, Satpathy AT, Rubin AJ, Montine KS, Wu B, Kathiria A, Cho SW, Mumbach MR, Carter AC, Kasowski M, Orloff LA, Risca VI, Kundaje A, Khavari PA, Montine TJ, Greenleaf WJ, Chang HY (2017) An improved ATAC-seq protocol reduces background and enables interrogation of frozen tissues. Nat Methods 14(10):959–962. https://doi.org/10.1038/nmeth.4396 16. Ludwig et al (2019) Lineage tracing in humans enabled by mitochondrial mutations and single-cell genomics. Cell 176:1325–1339.e22. https://doi.org/10.1016/j.cell.2019.01.022

Chapter 7 High-Resolution ChIP-MNase Mapping of Nucleosome Positions at Selected Genomic Loci and Alleles Dominic van Essen, Agata Oruba, and Simona Saccani

1

Introduction Genomic DNA in all eukaryotes is packaged as chromatin by wrapping around an octameric complex of histone proteins to form nucleosomes [1]. This packaging modifies or restricts the accessibility of genomic DNA [2–4]. Despite the broad ability of nucleosomes to assemble from a wide range of DNA sequences, they have been found in vivo to occupy consistent and non-random positions at most genomic locations [5, 6]. Thus, the precise positions of nucleosomes at each genomic site will influence the accessibility of the underlying DNA and can thereby affect the efficiency or even completely curb the activities of diverse genomic processes [3]. The in vivo positions of nucleosomes can be determined by a number of experimental techniques [7, 8], among which enzymatic digestion of internucleosomal “linker” DNA is the most widely used. Digestion of total genomic chromatin with micrococcal nuclease (MNase), followed by determination of the pre-digestion nucleosome positions by high-throughput sequencing of the cut DNA ends and alignment to the genome sequence, has emerged as a powerful and conceptually straightforward approach to analyze nucleosome positioning across the entire genome (see Chapter 5 [5, 9–13]). Global nucleosome “maps” generated using this technique have yielded significant insights into the rules that govern nucleosome occupancies at diverse genomic elements and sequences, and into the interplay between nucleosome positioning and gene-regulatory processes [3]. However, the unbiased nature of nucleosome mapping in this way also presents some limitations:

Tilman Borggrefe and Benedetto Daniele Giaimo (eds.), Enhancers and Promoters: Methods and Protocols, Methods in Molecular Biology, vol. 2351, https://doi.org/10.1007/978-1-0716-1597-3_7, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

123

124

Dominic van Essen et al.

firstly, since all genomic locations are analyzed, this represents a very inefficient way to study nucleosome positioning at particular features-of-interest since these are generally represented by only a small fraction of the data, with a consequent limit to the resolution that can be achieved at any given depth of sequencing. As a result, previous analyses of nucleosome positioning have often relied on averaging data across a large number of genomic loci that are presumed to behave similarly (such as active or inactive promoters) to circumvent the modest resolution at each individual locus [14– 17]. Secondly, despite advances in sequencing technology, the level of sequencing required to determine nucleosome positions across large genomes (such as those of mammals) is still significant, with the upshot that most studies to date have been restricted to analysis of only a single experimental condition as a “snapshot,” often without even any analysis of replicate samples to allow an estimation of reproducibility [9–13]. Finally, since the chromatin used as a substrate for MNase digestion is almost invariably derived from a large number of cells, the inferred nucleosome positions represent an average of those in all cells in the population, and cannot reflect any possible heterogeneity—either of overall cell behaviur or of the molecular processes that were taking place at each genomic locus at the time that the experimental sample was prepared. To circumvent these limitations, we recently devised a targeted strategy for mapping nucleosome positioning at defined genomic features, which we term “ChIP-MNase” [18]. The protocol couples chromatin immunoprecipitation (ChIP) of a chosen molecular feature with on-beads MNase digestion of the recovered chromatin fragments (see Fig. 1) and enables very high-resolution analysis of selected features-of-interest, and can also be used to separate loci undergoing specific molecular processes (such as ongoing transcriptional initiation or elongation). This strategy avoids the limitations described above, with the obvious trade-off that nucleosome positioning information is not recovered for other genomic regions. The degree of enrichment (and, accordingly, of increased resolution) can be chosen by varying the breadth of coverage surrounding each feature, based on the size of the chromatin fragments used for ChIP. However, even using very broad coverage of up to 10 kb surrounding transcriptional regulatory elements, ChIP-MNase is able to enrich the coverage across many promoters by five- to ten-fold compared to genome-wide MNase analysis. Smaller fragment sizes allow still higher levels of enrichment, and can enable selective analysis of nucleosome positioning at closely spaced genomic loci based on their instantaneous molecular composition at the time of analysis (see [18]).

ChIP-MNase

125

K4me1 K4me1

1 Enrich chosen elements by ChIP

(for example using anti-H3K4me1 to enrich for promoters + enhancers)

MNase:

2 Digest inter-nucleosomal DNA K4me1 K4me1

using Micrococcal nuclease

3 Extract DNA & sequence ends Fig. 1 Outline of ChIP-MNase technique (adapted from reference [18])

2

Materials Note that several reagents required for ChIP-MNase are toxic or otherwise hazardous. Use adequate protective equipment and precautions and dispose of spent reagents in line with good laboratory practice.

2.1 Reagents for Cell Culture and Sample Preparation

1. (Reagents for normal cell culture) medium for cell growth and passaging: for 3T3 fibroblasts, DMEM supplemented with 10% fetal calf serum (FCS); sterile phosphate-buffered saline solution (PBS); 1
trypsin-EDTA solution (0.25% trypsin, 2 mM EDTA in PBS). 2. Sterile cell culture plasticware: for 3T3 fibroblasts and other adherent cells, 10 cm tissue culture-treated petri dishes. 3. Trays of ice with sufficient room to place around forty 10 cm petri dishes (or more, according to the size of the experiment). 4. 37% Formaldehyde solution. Around 50 mL is required for each sample preparation. 5. PBS: 26.8 mM KCl, 1.47 mM KH2PO4, 137 mM NaCl, 8.1 mM Na2HPO4 pH 7.0. Prepare several liters and store at 4  C (see Note 1). 6. Cell scrapers (for adherent cells). 7. Benchtop centrifuge for 50 mL tubes. 8. Lysis buffer L1: 50 mM Tris–HCl pH 8.0, 2 mM EDTA, 0.1% NP40, 10% glycerol. Prepare 500 mL and store at 4  C. 9. 100
Protease inhibitors: protease inhibitors are prepared at 100
final concentration and stored at 20  C in aliquots of 100 μL. Aprotinin: 100
stock is 200 μg/mL; Bestatin: 100
stock is 4 mg/mL; Leupeptin: 100
stock is 200 μg/mL. Add inhibitors to lysis buffer L1 (Subheading 3.1, step 8) immediately before use.

126

Dominic van Essen et al.

10. 100 mM PMSF solution (100
) in ethanol. Prepare 100 mL and store at room temperature. Add PMSF to buffers immediately before use. 11. 1 M DTT solution (500
). Prepare 10 mL and store aliquots of 200 μL at 20  C. Add DTT to buffers immediately before use. 12. Wash buffer D: 50 mM Tris–HCl pH 8.0, 0.1 mM EDTA, 5 mM Mg acetate, 5 mM DTT, 25% glycerol. Prepare 500 mL without DTT and store at 4  C; add DTT immediately before use. 13. Microcentrifuge for 1.5 mL tubes. 14. MNase buffer: 10 mM Tris–HCl pH 7.4, 15 mM NaCl, 60 mM KCl, 1 mM CaCl2, 250 mM sucrose, 0.5 mM DTT. Prepare 10 mL and store at 4  C for up to 1 month. 15. Tip or waterbath sonicator (see Note 2). Suitable models include Sonics Vibra-cell (VCX 130PB) with micro-tip (SM423); Branson SLPE150 with 2.4 mm tip, or Diagenode “bioruptor plus.” 2.2 Reagents for ChIP-MNase

1. MNase storage buffer: 10 mM Tris–HCl pH 7.5, 50 mM NaCl, 1 mM EDTA, 50% glycerol. Prepare 10 mL and store at 4  C. 2. Micrococcal nuclease: prepare a fresh working solution (from commercial stock at typically  300 U/μL) at a concentration of 1 U/μL in MNase storage buffer for each series of experiments, in 100 μL volume, and store at 20  C for up to 1 month. 3. Shaking thermo-block. 4. 500 mM EDTA pH 8.0 solution. 5. ChIP elution buffer (EB): 10 mM Tris–HCl pH 8.0, 1 mM EDTA, 2% SDS. Prepare freshly before using. 6. DNA purification kit (see Note 3). Suitable kits include Qiagen MinElute PCR Purification Kit, or MP Biomedicals Miniprep Express matrix. 7. Apparatus and reagents for agarose gel electrophoresis and visualization of ethidium bromide-stained gels (see Note 4). 8. Buffer V: 50 mM Tris pH 7.4, 50 mM NaCl, 5 mM EDTA. Prepare 500 mL and store at room temperature. 9. Sepharose-coupled protein-A or protein-G (see Note 5): 50% and 33% slurries. Wash the required quantity of beads twice in at least an equal volume of buffer V immediately before use. Resuspend the bead pellet in buffer V to generate a 50% slurry (for pre-clearing) or a 33% slurry (for ChIP).

ChIP-MNase

127

10. ChIP antibody (see Note 6): Approximately 12 μg are required per experimental sample for a complete ChIP-MNase experiment. 11. End-over-end rotator at 4  C. A rotator wheel with clips for 1.5 mL tubes is suitable. 12. ChIP wash buffer (WB): 20 mM Tris–HCl pH 8.0, 500 mM NaCl, 2 mM EDTA, 1% NP40. Prepare 500 mL and store at 4  C. 13. 65  C oven or heating apparatus for 1.5 mL tubes. 2.3 Reagents for Quality Control and Sequencing

1. Apparatus and reagents for quantitative PCR analysis. 2. Apparatus and reagents for high-sensitivity fluorescence-based DNA quantitation: the NanoDrop 3300 or Qubit fluorometers, combined with Thermo PicoGreen or Biotium AccuGreen High Sensitivity reagents, represent suitable setups. 3. Apparatus and reagents for quantitative analysis of DNA size distribution by capillary electrophoresis: the Agilent Bioanalyzer 2100, used with high-sensitivity DNA chips, represents a suitable setup. 4. Apparatus for gel-purification of DNA within a defined size range (for single-end sequencing). The Invitrogen E-Gel system with “SizeSelect II” precast gels represents a suitable setup. 5. Apparatus and reagents for sequencing library generation and high-throughput single-end or paired-end short-read sequencing.

2.4 Software for Data Processing

1. General software for text file manipulation: the core Linux command-line utilities, including awk, are suitable for this. 2. Software for genomic alignment of short-read sequences: bowtie ([19]; http://bowtie-bio.sourceforge.net) is a suitable program. 3. Software for filtering and combining lists of genomic coordinates: bedtools ([20]; http://bedtools.readthedocs.io) is a suitable software package. 4. Software for identifying high-coverage genomic intervals. Macs [21], bedtools, or deepTools ([22]; http://deeptools. readthedocs.io) represent suitable software packages. 5. Software for calculating genomic coverage levels from the density of aligned sequence reads: deepTools is a suitable software package. 6. Software for statistical and graphical analysis: the R programming language ([23]; https://www.r-project.org) is suitable.

128

3

Dominic van Essen et al.

Methods

3.1 Cell Culture and Sample Preparation

The aim of this section is to prepare samples of cross-linked chromatin that can be stored frozen until needed and used for the MNase titration and ChIP-MNase (Subheadings 3.2 and 3.3, respectively). The number of cells needed for each sample will vary according to the abundance of the chosen antigen and the efficiency of the antibody used to recover it by ChIP (more-abundant antigens and higher efficiency recovery will necessitate fewer cells), as well as the degree of fragmentation chosen to attain the desired breadth of genomic coverage (see Subheading 3.2 and Note 7). The principal limiting step is the MNase titration after ChIP (see Subheading 3.3), in which sufficient material is required to visualize the pattern of digestion products after capillary electrophoresis. Here, we describe the quantities required to perform ChIP-MNase using the H3K4me1 mark as an example target antigen to enrich for transcriptional regulatory elements in mouse 3T3 fibroblasts. Cell cultures used to prepare samples for ChIP-MNase should be homogeneous (only one cell-type, and all cells behaving identically) and growing under normal conditions, without significant cell death (see Note 8). When using non-adherent cells, please see Note 9 that summarizes alterations to the protocol given here.

3.1.1 One Day Before

1. The day before sample preparation split cells to approximately half-confluency (see Note 8): for 3T3 fibroblasts, plate-out forty 10 cm petri dishes (see Note 10) for each experimental condition, plus one additional 10 cm petri dish (see Note 11), with one million cells per 10 cm petri dish, in 8 mL of growth medium (see Note 12).

3.1.2 Day 1

1. Count the cells in one 10 cm petri dish and calculate the total number of cells for each experimental condition (for 3T3 fibroblasts this is the total number of cells in all 40 petri dishes). Expect around 1½–2 million cells for every million cells platedout the day before. 2. Fix cells with 4% formaldehyde for 10 min at room temperature, by adding 973 μL of 37% formaldehyde solution directly to each petri dish of cells in 8 mL growth medium, and immediately mixing by swirling the petri dish. It is important to be precise and to fix each petri dish of cells for the same duration: add to each dish at a fixed time interval and stop the fixation (step 3 of this section) using the same interval. A plate-to-plate interval of 15 s is manageable and recommended (see Note 13). 3. Stop fixation by pouring away the medium containing the formaldehyde, and quickly washing with approximately 10 mL of ice-cold PBS: use an electric pipettor with a 25 mL

ChIP-MNase

129

pipette to add the ice-cold PBS to each plate and pour it away immediately. After washing, add 10 mL of ice-cold PBS and transfer each plate onto ice. Each plate should be processed at the same plate-to-plate interval that was used for fixation in step 2 of this section to ensure that every plate is fixed for the same time interval. 4. Wash all plates twice for 10 min on ice with 15 mL of ice-cold PBS (see Note 1). 5. Collect cells by scraping: after the last wash, pour away almost all the PBS and scrape the cells in the small remaining volume (usually around ½–1 mL) using a cell scraper. Do not add any more PBS. Collect the scraped cells in the remaining PBS using a 1 mL pipette (P1000). Collect cells from all the petri dishes from the same experimental condition (for 3T3 fibroblasts, 40 dishes) into a single 50 mL tube (see Note 14). 6. Pellet the collected cells by centrifugation for 10 min at 450
g in a benchtop centrifuge at 4  C. 7. Discard the supernatant and dislodge/loosen the cell pellet by flicking or rapping the tube. 8. Resuspend the cell pellet in 1 mL of lysis buffer L1 + freshly added protease inhibitors + 1 mM PMSF + 2 mM DTT per 20 million cells. Typically, for 40 petri dishes of 3T3 fibroblasts in each experimental condition, this corresponds to 60 million cells, requiring 3 mL of lysis buffer L1. Divide into 1 mL aliquots in 1.5 mL tubes (so that each tube contains approximately 20 million resuspended cells). 9. Incubate on ice for 5 min. This step lyses the cells’ plasma membranes, resulting in a suspension of predominantly nuclei. 10. Pellet nuclei by centrifugation for 5 min at 960
g in a microfuge at 4  C. 11. Carefully remove and discard the supernatant using a 1 mL pipette (P1000) or using a pipette tip connected to a vacuum pump. 12. Resuspend the nuclei in 750 μL of ice-cold wash buffer D (see Note 15), and pellet again by centrifugation as in step 10 of this section. 13. Repeat steps 11 and 12 of this section one more time. 14. Resuspend the nuclei in 400 μL of MNase buffer per tube of 20 million nuclei and store at 80  C. Note: This is a safe pause-point in the protocol. Samples of fixed nuclei can be stored at 80  C until required; otherwise, continue with the nuclei disruption and chromatin fragmentation (Subheading 3.2).

130

Dominic van Essen et al.

3.2 Chromatin Fragmentation

3.2.1 Day 1: Nuclei Disruption

The aim of this section is to digest the cross-linked chromatin into fragments with sizes corresponding to the chosen breadth of coverage surrounding the locations of the antigens used for ChIPMNase. For instance, to analyze transcriptional regulatory elements marked by H3K4me1, we aimed for fragments of 5–10 kb, to allow determination of nucleosome positions within 10 kb genomic windows around promoters & enhancers [18]. Steps 1–3 of day 1 (Subheading 3.2.1) describe the initial nuclei disruption by sonication; steps 4–11 of day 1 (Subheading 3.2.1) and steps 1 and 2 of day 2 (Subheading 3.2.2) describe the small-scale titration to determine the level of digestion required to attain the chosen fragment size; this is then used in steps 3–10 of days 2 and 3 (Subheading 3.2.2) to fragment the full chromatin sample. The total time required, including analysis of the final fragmented chromatin preparation, is 3 days. 1. Thaw samples from 80  C and disrupt nuclei by performing two cycles of freeze-thaw in liquid nitrogen. Frozen samples can be thawed at 37  C for a short time with gentle shaking. 2. Release chromatin by sonication. Sonication here is intended to release chromatin into solution without breaking it into small fragments: use the smallest amount of sonication required (see Notes 2 and 16). 3. Pool all sonicated tubes from the same experimental sample together and remove a 120 μL sample (corresponding to chromatin from approximately six million nuclei) to use for MNase titration (see next step [step 4] of this section). Proceed directly to MNase titration or store this at 80  C until needed. Store all the remaining samples of fixed chromatin at 80  C, in aliquots of at least 1.2 mL (the volume required for one ChIP-MNase experiment in Subheading 3.3). 4. MNase titration. Divide the 120 μL sample of fixed chromatin into six 20 μL (corresponding to chromatin from  one million nuclei) aliquots in separate 1.5 mL tubes and store on ice. 5. Set up a series of five five-fold dilutions of MNase on ice in MNase buffer, at concentrations of 800, 160, 32, 6.4, 1.28, and 0 mU/μL. The volume required is 5 μL for each experimental sample, plus an additional 5 μL (see Note 17). 6. Add 5 μL of each of the dilutions of MNase to the tubes of 20 μL of fixed chromatin. This corresponds to 4000, 800, 160, 32, 1.6, and 0 mU MNase per  one million nuclei. 7. Transfer tubes to a thermoblock and incubate at 25  C for 30 min, with 1200 rpm shaking. 8. Stop the MNase digestion by transferring tubes onto ice, add 1 μL of 500 mM EDTA pH 8.0 to each tube, and quickly mix by vortexing.

ChIP-MNase

131

9. Pellet insoluble material by centrifugation for 10 min at 10,600
g in a microfuge at 4  C. Transfer the supernatants to new 1.5 mL tubes. 10. Add 26 μL of ChIP EB to each tube and mix. 11. Incubate tubes at 65  C overnight (or for at least 6 h) to release cross-links. 3.2.2 Day 2 and 3: Nuclei Disruption

1. Extract DNA using a commercial kit compatible with samples containing SDS (see Note 3). Elute purified DNA in 30 μL of water. 2. Analyze size distribution of DNA fragments by electrophoresis using a 2% agarose gel, and determine the correct dose of MNase that generates the chosen fragment size distribution (Fig. 2 and see Notes 4 and 7). 3. Full sample fragmentation by digestion with MNase. Thaw frozen samples of fixed chromatin (from Subheading 3.2.1, step 3) on ice. Pipette briefly up and down to resuspend any sedimented material. 4. Add MNase to all of the fixed chromatin samples to the final dose per million nuclei determined in Subheadings 3.2.1 and 3.2.2. Use 1 U/μL MNase working solution, mix well by pipetting up and down, and distribute into 1.5 mL tubes on ice in aliquots of 200 μL or smaller (see Note 18). 5. Immediately transfer the aliquoted samples to a thermoblock and incubate at 25  C for 30 min, with 1200 rpm shaking (see Note 19). 6. Stop the MNase digestion by transferring tubes onto ice, add EDTA pH 8.0 to a final concentration of 17 mM to each tube (for 200 μL reactions this corresponds to addition of 7 μL of 500 mM EDTA), pipetting up and down 2–3 times to mix. Once EDTA has been added to all the tubes, replace them in the thermoblock with 1200 rpm shaking for a few seconds at 25  C to thoroughly mix them. 7. Quick-spin samples to collect droplets from the walls of the tubes. 8. Pool the tubes from each experimental sample back together and pellet insoluble material by centrifugation for 10 min at 10,600
g in a microfuge at 4  C. 9. Carefully recover the supernatants (containing soluble, fragmented chromatin). From each sample, remove 20 μL (corresponding to chromatin from  one million nuclei) and transfer to a new 1.5 mL tube. Store the remaining samples of fragmented, fixed chromatin at 80  C until they will be used for ChIP-MNase (Subheading 3.3). If the samples will be used for more than one ChIP-MNase, it may be convenient to store them in aliquots of 400 μL.

132

Dominic van Essen et al. MNase mU/million cells

4000

8000

160

32

6.4

2

3

4

5

6

0

bp: 6000 4000 3000 2000 1200 700 600

350

lane:

1

7

Fig. 2 MNase titration for chromatin fragmentation (Subheading 3.2.1, steps 4–11 and Subheading 3.2.2, steps 1 and 2). Agarose gel electrophoresis of digested chromatin from the MNase titration, visualized by ethidium bromide staining. Lane 1 contains molecular weight markers (sizes indicated in bp); lanes 2–6 contain digestion products of chromatin from one million nuclei each, with 4000, 800, 160, 32, and 6.4 mU MNase. Lane 7 contains DNA extracted from undigested chromatin. In this experiment, the desired fragment size (corresponding to the intended breadth of ChIP-MNase coverage surrounding each region-of-interest) was 5–10 kb and 100 mU MNase per million nuclei (lane 5) was selected as the appropriate dose (corresponding to 2 U MNase to fragment each sample of 20 million nuclei in Subheading 3.2.2, step 4)

10. Process the 20 μL samples (removed in step 9), according to steps 10 and 11 of Subheading 3.2.1 and steps 1 and 2 of this section, to verify correct fragmentation of fixed chromatin. If chromatin fragmentation is satisfactory, proceed to ChIP MNase (Subheading 3.3). 3.3

ChIP-MNase

This section is the main step of the protocol, comprising ChIP for the target antigen using the fixed and fragmented chromatin prepared in Subheadings 3.1 and 3.2, followed by on-beads MNase digestion to cut internucleosomal gaps in the immunoprecipitated chromatin. The total time required is 3 days.

ChIP-MNase 3.3.1 Day 1

133

1. Thaw frozen samples of fixed and fragmented chromatin from Subheading 3.2.2, step 9 on ice. Pipette briefly up and down to resuspend any sedimented material. 2. For each experimental sample, set up three parallel immunoprecipitations, each with fixed and fragmented chromatin from around 18–20 million nuclei, corresponding to a volume of 400 μL of digested chromatin from Subheading 3.2.2, step 9 Perform each IP in a separate 1.5 mL tube. 3. Dilute by addition of 1 mL buffer V to each tube (containing 400 μL of chromatin). 4. Pre-clear chromatin by adding 40 μL (bead volume, corresponding to 80 μL of 50% slurry) of sepharose-proteinG or sepharose-protein-A (see Note 5) to each tube and rotate end-over-end for 1 h at 4  C. 5. Pellet sepharose beads by centrifugation in a microfuge at top speed for 30 s. 6. Transfer the supernatant containing pre-cleared chromatin to a new 1.5 mL tube and remove a 10 μL aliquot from each tube: this will be the “input” control sample. Aliquots from the three different tubes of the same experimental sample can be pooled together. Store the “input” control samples at 20  C. 7. Add 4 μg antibody to each tube (see Note 6). 8. Rotate tubes end-over-end overnight at 4  C.

3.3.2 Day 2

1. Add 15 μL (bead volume, corresponding to 45 μL of 33% slurry; see Note 20) of sepharose-protein-G/protein-A to each tube and rotate end-over-end for 30 min at 4  C. 2. Pellet sepharose beads by centrifugation for 1 min at top speed (at least 10,000
g) in a microfuge at 4  C. 3. Carefully remove the supernatant (containing unbound chromatin) without touching the pellet of sepharose beads. Unbound chromatin may be used as an additional control (processed in the same way as the “input” sample) or discarded. 4. Wash the sepharose beads rapidly: add 900 μL of WB + freshly added 1 mM PMSF, immediately centrifuge for 1 min at top speed in a microfuge at 4  C, and carefully remove and discard the supernatant. 5. Add 900 μL of WB + freshly added 1 mM PMSF directly to the beads, ensuring that the beads are well resuspended. Avoid pipetting up and down, as this can easily lead to loss of beads sticking to the inside of the pipette tip. 6. Incubate beads on ice for 5 min, with the tubes laid on their sides to prevent the beads from sedimenting into a compact pellet.

134

Dominic van Essen et al.

7. Pellet sepharose beads by centrifugation for 1 min at top speed in a microfuge at 4  C and carefully remove and discard the supernatant. 8. Repeat steps 5–7 of this section two more times, for a total of three 5 min washes in WB. 9. Add 900 μL of MNase buffer directly to the beads, ensuring that the beads are well resuspended and incubate on ice for 5 min. 10. Perform two 5 min washes in MNase buffer by repeating steps 6, 7, and 9 of this section twice. 11. After the second wash in MNase buffer, remove a 45 μL aliquot of resuspended beads from each tube (corresponding to 5% of the 900 μL of resuspended beads): this will be the “bounduncut” control sample. Aliquots from different tubes of the same experimental sample can be pooled together. Store the “bound-uncut” control samples on ice (see Notes 21 and 22). 12. Pellet sepharose beads by centrifugation for 1 min at top speed in a microfuge at 4  C and carefully remove and discard the supernatant. Close the tubes and store the bead pellets on ice. 13. On-beads MNase digestion. Prepare three different dilutions of MNase on ice in MNase buffer, at concentrations of 133, 67, and 17 mU/μL. The volume required is 15 μL for each experimental sample (so the three dilutions correspond to 2 U, 1 U, and 250 mU per 15 μL), plus an additional 15 μL (see Note 23). 14. Add 15 μL of each dilution of MNase to each of the three parallel ChIP tubes for each experimental sample from step 12 (which each contain a 15 μL pellet of beads, for a total reaction volume of 30 μL). 15. Immediately transfer the tubes to a thermoblock and incubate at 25  C for 30 min, with 1200 rpm shaking. 16. Stop the MNase digestion by transferring tubes onto ice, add 2 μL of 500 mM EDTA pH 8.0 to each tube (corresponding to a final concentration of 34 mM), and quickly mix by vortexing. 17. Add 70 μL of ChIP EB to each tube, shake all the tubes for 10 min at 37  C, and quick-spin down any droplets. 18. For the “bound-uncut” control samples (from step 11 of this section): the pellet of beads is very tiny. Pellet sepharose beads by centrifugation in a microfuge at top speed for 1 min at room temperature, and carefully remove most of the supernatant, leaving approximately 30 μL, taking care not to aspirate any beads. Add 30 μL of ChIP EB to each tube and mix.

ChIP-MNase

135

19. For the “input” control samples (from step 6 of Subheading 3.3.1): add an equal volume of ChIP EB to each tube and mix (the total volume will be 30 μL [from the three pooled 10 μL aliquots] + 30 μL ChIP EB). 20. Incubate tubes at 65  C overnight to release cross-links. 3.3.3 Day 3

3.4 Quality Control and Sequencing

1. Extract DNA using a commercial kit compatible with samples containing SDS (see Note 3). For ChIP samples: elute purified DNA in 17 μL and then elute a second time in 17 μL, and pool the two elutions (total 34 μL, minus any volume lost in column). For “bound-uncut” and “input” control samples: elute purified DNA in 100 μL each. The steps in this section include quality controls to (1) ensure that the ChIP has enriched for the intended target regions and to (2) select the level of MNase digestion from each experimental sample that yields predominantly mononucleosomal DNA fragments, without over-digestion. When these aspects are satisfactory, the DNA is used for high-throughput sequencing. 1. (ChIP quality control) Analyze the “bound-uncut” and “input” control samples by quantitative PCR to determine the level of recovery and enrichment of selected target genomic regions. Selected regions should include independent positive and negative control regions. A successful ChIP experiment should yield an enrichment of at least ten-fold (and ideally higher) when comparing the recoveries of positive and negative control regions within the same sample (see Note 24). 2. (MNase digestion quality control) Use 1 μL of each sample to quantify the amount of purified DNA using a high-sensitivity fluorescence-based kit and apparatus (see Note 25). 3. Use 1 μL of each sample to analyze the size distribution of ChIP-MNase DNA by capillary electrophoresis. From the three parallel ChIP-MNase samples for each experimental sample, select a sample with digestion that yields around 80% mononucleosomal DNA fragments (130–170 bp) and 20% dinucleosomal fragments (260–340 bp), with minimal subnucleosomal fragments (150 million reads). A more quantitative quality check is strongly recommended and such information may be acquired from shallow sequencing results (see Subheading 3.6).

PLAC-Seq

2

183

Materials

2.1 Cell Harvest and Crosslink

1. 16% Formaldehyde (methanol-free). 2. 1.25 M Glycine (prepared by dissolving 4.69 g glycine in 50 mL ddH2O). 3. 1
PBS, pH 7.4. 4. Liquid nitrogen.

2.2 In situ Digestion and Proximity Ligation

1. Thermomixer. 2. Hi-C Lysis buffer: 10 mM Tris–HCl pH 8.0, 10 mM NaCl, 0.2% IGEPAL CA-630 (also known as NP-40). Store at 4  C; add proteinase inhibitor cocktail (PIC) to 1
before use. 3. 0.5% SDS solution in water. 4. 10% Triton X-100 solution in water. 5. 10
NEBuffer 2. 6. 25 U/μL MboI. 7. 10 mM dCTP. 8. 10 mM dGTP. 9. 10 mM dTTP. 10. 0.4 mM Biotin-14-dATP. 11. 5 U/μL Klenow. 12. 20 mg/mL BSA. 13. 400 U/μL T4 DNA ligase and 10
T4 ligase buffer (NEB).

2.3

ChIP

1. Primary antibodies targeting the protein of interest (e.g., H3K4me3, H3K27ac, CTCF). 2. Anti-rabbit or anti-mouse IgG magnetic beads (depending on the choice of primary antibodies). 3. PBS/BSA: 5 mg/mL BSA in 1
PBS, pH 7.4. Freshly prepared and keep on ice. 4. RIPA buffer: 10 mM Tris–HCl pH 8.0, 140 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% SDS, 0.1% sodium deoxycholate. Store at 4  C; add PIC to 1
before use. 5. Dilution buffer: 10 mM Tris–HCl pH 8.0, 280 mM NaCl, 1 mM EDTA, 2% Triton X-100, 0.1% SDS, 0.2% sodium deoxycholate. Store at 4  C; add PIC to 1
before use. 6. High-salt RIPA buffer: 10 mM Tris–HCl pH 8.0, 300 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% SDS, 0.1% sodium deoxycholate. Store at 4  C.

184

Miao Yu et al.

7. LiCl buffer: 10 mM Tris–HCl pH 8.0, 150 mM LiCl, 1 mM EDTA, 0.5% IGEPAL CA-630, 0.1% sodium deoxycholate. Freshly prepared and chill on ice before use. 8. TE buffer: 10 mM Tris–HCl pH 8.0, 0.1 mM EDTA. Store at 4  C. 9. Extraction buffer: Add 15μL of 10% SDS, 12μL 5 M NaCl and 1μL RNase A (10 mg/mL) to 135μL TE buffer per sample before use. 10. Shearing buffer: 10 mM Tris–HCl pH 8.0, 1 mM EDTA, 0.1% SDS. Store at 4  C; add PIC to 1
before use. 11. Covaris ultrasonicator M220 or other sonicators. 12. microTUBE AFA Fiber Snap-Cap or milliTUBE 1 mL AFA Fiber (Covaris). 13. 20 mg/mL Proteinase K. 14. DNA Clean & Concentrator™-5 or any other column-based DNA purification kit. 15. Magnetic stand for 1.5/2 mL microcentrifuge tubes. 16. Thermomixer. 17. Qubit 2.0 Fluorometer (Thermo Fisher Scientific). 18. Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific). 2.4 Library Preparation

1. Dynabeads™ MyOne™ Streptavidin C1 (Thermo Fisher Scientific). 2. 1
Tween Washing Buffer (TWB): 5 mM Tris–HCl pH 7.5, 0.5 mM EDTA, 1 M NaCl, 0.05% Tween 20. 3. 2
Binding Buffer (BB): 10 mM Tris–HCl pH 7.5, 1 mM EDTA, 2 M NaCl 4. QIAseq Ultralow Input Library Kit and GeneRead Adaptor I Set A or B (Qiagen) or any other library preparation kit. 5. KAPA Library Quantification Kit (KAPA Biosystems). 6. SPRI beads (Beckman Coulter). 7. 80% EtOH, prepare freshly just before use. 8. 10 mM Tris–HCl pH 8.0 solution. 9. Qubit 2.0 Fluorometer (Thermo Fisher Scientific). 10. Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific). 11. Tapestation 4200 (Agilent Technologies) or any other bioanalyzer. 12. High Sensitivity D1000 ScreenTape and Reagents (Agilent Technologies).

PLAC-Seq

2.5 Quality Control of Hi-C Part

185

13. 10 mM Tris–HCl pH 8.0. 14. 10 mg/mL RNase A. 15. 20 mg/mL Proteinase K. 16. Agarose. 17. Basic Power Supply. 18. Mini Gel Electrophoresis Systems.

3

Methods

3.1 Cell Harvest and Crosslink

1. Collect cells by centrifugation at 200
g for 5 min at room temperature (see Note 1). 2. Resuspend cell pellet with fresh medium without serum at the concentration of 1
106 cells/mL. 3. Add methanol-free formaldehyde to a final concentration of 1% (w/v) and rotate for 10 min at room temperature. 4. Add 1.25 M glycine solution to a final concentration of 125 mM to quench crosslinking reaction. 5. Spin at 2000
g for 5 min at 4  C and discard the supernatant. 6. Wash cell pellets with cold 1
PBS, pH 7.4 and spin at 2000
g for 5 min at 4  C. Discard the supernatant. 7. The crosslinked cell pellets can be snap-frozen in liquid nitrogen and stored at 80  C or proceeded to Subheading 3.2.

3.2 In situ Digestion and Proximity Ligation

NO stop points from Subheading 3.2, step 1 through Subheading 3.3.1, step 19 for histone marks or from Subheading 3.2, step 1 through Subheading 3.3.2, step 22 for TFs; these steps have to be finished in 1 day. 1. Thaw the crosslinked cell pellet on ice for 5 min. 2. Resuspend up to five million crosslinked cells in 300μL cold Hi-C Lysis buffer with 1
PIC. Rotate at 4  C for at least 15 min (see Note 2). 3. Spin at 2500
g for 5 min at 4  C and remove the supernatant. 4. Resuspend the pellet with 500μL cold Hi-C Lysis buffer with 1
PIC. Spin at 2500
g for 5 min at 4  C and then remove the supernatant. 5. Gently resuspend cell pellet in 50μL 0.5% SDS (avoid excess foaming) and incubate for exactly 10 min at 62  C (see Note 3). 6. Add 135μL water and 25μL freshly prepared 10% Triton X-100 to quench SDS. Mix well gently (avoid excess foaming) and incubate for 15 min at 37  C.

186

Miao Yu et al.

7. Mix well and transfer 10μL to a clean 1.7 mL microcentrifuge tube as QC1; refer to Subheading 3.5 for details. 8. Add 25μL 10
NEBuffer 2 and 200 Unit MboI. 9. Mix well and digest chromatins at 37  C in thermomixer, shaking at 900 rpm for 2 h (see Note 4). 10. Inactivate MboI by incubation at 62  C for 20 min and then cool the reaction to room temperature (~10 min). 11. Mix well and transfer 10μL to a clean 1.7 mL microcentrifuge tube as QC2; refer to Subheading 3.5 for details. 12. Add the following reagents to fill in overhangs and mark with biotin: Reagent

For one reaction (μL)

10 mM dCTP

1.5

10 mM dGTP

1.5

10 mM dTTP

1.5

0.4 mM Biotin-14-dATP

37.5

5 U/μL Klenow

8

13. Mix well and incubate at 37  C in thermomixer for 1 h, shaking at 900 rpm. 14. Prepare ligation master mix as follows: Reagent

For one reaction (μL)

H2O

664

10
T4 ligase buffer

120

10% Triton X-100

100

20 mg/mL BSA

6

400 U/μL T4 DNA ligase

10

15. Add above ligase mix to the reaction and mix well by inverting the tube. Rotate slowly at room temperature for 2 h. 16. Mix well and transfer 50μL to a clean 1.7 mL microcentrifuge tube as QC3; refer to Subheading 3.5 for details. 3.3

ChIP

The best practice for this section is to first optimize ChIP-Seq protocol for the target protein and the cell type of interest. When the ChIP-Seq signal is satisfactory, then the same immunoprecipitation protocol can be adapted to PLAC-Seq. The immunoprecipitation protocol provided here may need further optimization. Refer to Table 2 for a list of validated primary antibodies for H3K4me3, H3K27ac, and CTCF PLAC-Seq.

PLAC-Seq

187

Table 2 A list of antibodies tested for H3K4me3, H3K27ac, and CTCF PLAC-Seq FRiP in PLAC-Seq (%)

Minimal cell number for 10–20 ng ChIPed DNA (estimated) (million)

15–50

1–3

H3K27ac

Diagenode C15200184-50 or 10–30 Active motif 91193

4–6

CTCF

Cell signaling 3418T

10–15

Target

Vendor and cat.no.

H3K4me3 Millipore 04-745

6–12

The ChIP procedure described in Subheading 3.3.1 works well with antibodies against H3K4me3 and H3K27ac but is not optimal for TFs due to the lack of pre-clearing step. Refer to Subheading 3.3.2 for alternative ChIP protocol for TFs. 3.3.1 For Histone Marks

1. For each experiment, transfer 50μL resuspended anti-rabbit or anti-mouse IgG beads (for up to five million cells) to 1.7 mL microcentrifuge tube containing 500μL cold PBS/BSA and mix well. If multiple reactions are performed in parallel, prepare beads in different tubes and do not make a master mix (see Note 5). 2. Place the tube on the magnetic rack for 2 min and remove the supernatant. 3. Resuspend beads in 500μL cold PBS/BSA and then place the tube on the magnetic rack for 2 min. Remove the supernatant. 4. Repeat step 3 of this section three times. 5. Resuspend the beads in 500μL cold PBS/BSA, add 5μg primary antibody and mix well. Rotate at 4  C for at least 3 h (see Note 6). 6. Spin down the nuclei from Subheading 3.2, step 15 at 2500
g for 5 min at 4  C and carefully remove and discard supernatant. 7. Gently rinse the sides of the tube with 300μL shearing buffer with 1
PIC. Slowly dispense the buffer down the entire circumference of the upper-inside of the tube, taking care not to disturb the nuclei pellet. 8. Collect nuclei by centrifugation at 2500
g for 5 min, 4  C. Decant the supernatant without disturbing the nuclei pellet. 9. Repeat steps 7 and 8 of this section one additional time. Carefully remove and discard the supernatant, taking care not to disturb the nuclei pellet. 10. Resuspend up to three million nuclei pellet in 130μL shearing buffer with 1
PIC and transfer it to microTUBE AFA Fiber Snap-Cap.

188

Miao Yu et al.

11. Shear the chromatin using Covaris M220 with the following setting for the target size of 200–700 bp (see Note 7): Settings Power

75 W

Duty factor

10%

Cycles per Burst

200

Time

Temperature

10 min

7 C

12. Transfer sheared chromatins to a pre-chilled 1.7 mL microcentrifuge tube. 13. Wash the microTUBE with 120μL dilution buffer with 1
PIC and add to the sample. Add additional 300μL RIPA buffer with 1
PIC to bring the total volume to ~550μL. 14. Spin at 20,000
g for 15 min at 4  C and transfer the supernatant (cell lysate) to a pre-chilled, clean 1.7 mL microcentrifuge tube (see Note 8). 15. Mix well and transfer 20μL supernatant to another clean 1.7 mL microcentrifuge tube and save as input. Continue to step 32 of this section. 16. Briefly spin down the antibody-coated beads from step 5 of this section after 3 h incubation and place the tube on the magnetic rack for 2 min. Remove the supernatant. 17. Wash the antibody-coated beads three times with 500μL cold PBS/BSA as described in step 3 of this section. 18. After final wash, resuspend the antibody-coated beads in 500μL RIPA buffer with 1
PIC. 19. Add the antibody-coated beads to cell lysate (~500–530μL from step 14 of this section) and rotate at 4  C overnight or for at least 12 h. 20. After incubation, brief spin the tube and collect the beads by placing the tube on the magnetic rack for 2 min. Discard the supernatant. 21. Add 1 mL RIPA buffer to the beads and shake at 1000 rpm for 3 min at 4  C in thermomixer. 22. Briefly spin down and collect the beads by placing the tube on the magnetic rack for 2 min. Discard the supernatant. 23. Repeat the wash as described in steps 21 and 22 of this section twice with RIPA buffer, twice with high-salt RIPA buffer, once with LiCl buffer and twice with TE buffer. 24. Add 163μL freshly prepared extraction buffer to the beads and mix well, followed by shaking at 1000 rpm for 1 h at 37  C in thermomixer.

PLAC-Seq

189

25. Add 50μg proteinase K and shake at 1000 rpm for at least 2 h or overnight at 65  C in thermomixer for reverse crosslinking. 26. Remove the tube from thermomixer and put it on magnetic stand for 2 min. 27. Transfer the supernatant containing ChIPed DNA to another clean 1.7 mL microcentrifuge tube. 28. Resuspend beads with 100μL TE buffer and put it on magnetic stand for 2 min. 29. Transfer the supernatant to the tube containing ChIPed DNA in step 27 of this section. 30. Purify ChIPed DNA (~260μL in total from steps 27 and 29 of this section) with DNA Clean & Concentrator™-5. Elute DNA in 22μL 10 mM Tris–HCl pH 8.0 twice and combine the eluate (~42μL in total) (see Note 9). 31. Take 2μL eluate to measure the concentration of ChIPed DNA with Qubit dsDNA HS Assay Kit: c(IP). 32. For input samples saved from step 15 of this section, follow the similar reverse crosslinking steps as ChIPed DNA at the same time: add 163μL freshly prepared extraction buffer to the input sample and mix well, followed by shaking at 1000 rpm for 1 h at 37  C in thermomixer. 33. Add 50μg proteinase K and shake at 1000 rpm for at least 2 h or overnight at 65  C in thermomixer. 34. Purify input DNA with DNA Clean & Concentrator™-5, elute in 22μL 10 mM Tris–HCl pH 8.0 twice and combine the eluate (~42μL in total). 35. Take 2μL eluate to measure the concentration of input DNA with Qubit dsDNA HS Assay Kit: c(input). 36. Calculate IP yield using formula below. For H3K4me3 or H3K27ac PLAC-Seq with primary antibodies listed in Table 2, normally this number is 0.1–1% when starting from ./ feather/feather_pipe preprocess -c FALSE -j FALSE -f1 fastqfile1 -f2 fastqfile2 -b bwa_index_file -a ChIP_Seq_peaks_filename. 2. Check Hi-C performance: A PLAC-Seq library with good Hi-C performance is expected to have the following features: low proportion of inter-chromosomal (trans) read pairs (low trans_ratio in Table 3) and high proportion of long-range

Table 3 QC metrics from feather (numbers in output file “.feather.qc”) Name

Description

fastq_all

Number of read pairs in the fastq files

mapped

Number of read pairs after mapping to reference genome and pairing up

not_duplicated Number of mapped read pairs that were kept after PCR duplication removal (number of reads in output file #5 in “Output file description”, referred as “the final bam file” in this table) intra_all

Number of intra-chromosomal read pairs in the final bam file after removing alternative and mtDNA chromosomes (if any)

short_all

Number of all short-range (defined by the input argument to feather, default  1000 bp) intra-chromosomal reads in the final bam file after removing alternative and mtDNA chromosomes (if any)

short_final

Number of “valid” short-range reads (the two ends of reads coming from two different strands) in the final bam file after removing alternative and mtDNA chromosomes (if any)

long_intra

Number of long-range (defined by the input argument to feather, default > 1000 bp) intra-chromosomal read pairs in the final bam file after removing alternative and mtDNA chromosomes (if any)

inter_all

Number of inter-chromosomal read pairs in the final bam file

trans_ratio

Inter_all/not_duplicated

long_cis_ratio

Long_intra/intra_all

FRiP

Short_final reads that overlap with ChIP-Seq peaks divided by the total number of short_final reads

196

Miao Yu et al.

intra-chromosomal (cis) read pairs (high long_cis_ratio in Table 3). From our experience, a good PLAC-Seq library often has 50–70% long_cis_ratio. A greater trans rate indicates high level of spurious ligation and a lower long-range cis rate suggests inefficient digestion, biotin fill-in, and/or ligation. 3. Check immunoprecipitation performance: Similar to ChIPSeq experiment, the global ChIP enrichment level in PLACSeq may be measured by the fraction of all mapped reads that fall into peak regions (FRiP) [13] (see Note 18).

4

Notes 1. Refer to Table 2 for recommendation of the minimal number of cells to start with for different histone marks or transcription factors (TFs). However, the exact number of cells needed per experiment may vary depending on cell type, number of protein-binding sites in the genome, quality of primary antibody, and desired sequence depth. 2. If starting from more than five million cells, aliquot into multiple tubes with equal or less than five million cells per tube. 3. Alternatively, 0.3% SDS in 1
NEBuffer 2 at 42  C for 30 min (shaking at 750 rpm on thermomixer) may be used. From our test of H3K4me3 and H3K27ac PLAC-Seq with GM12878 cells, such milder condition may help preserve the structure of DNA–protein complex and result in better enrichment during immunoprecipitation. However, it is notable that with this milder condition the restriction enzyme digestion is also less complete and larger DNA fragments (average size of 5 kb or longer) are expected from QC2 (from Subheading 3.2, step 11). 4. Overnight digestion is NOT recommended, which may disrupt the structure of DNA–protein complex and result in inefficient enrichment of sequencing reads on the targeted genomic loci. 5. If starting from >5 million cells, increase the amount of beads and antibody linearly. 6. To save time, Subheading 3.3.1, steps 1–5 may be performed during end fill-in (Subheading 3.2, step 13). 7. Use up to three million cells in 130μL microTUBE. If starting from more cells, either aliquot to different tubes or use 1 mL milliTUBE instead (refer to truChIP Chromatin Shearing Kit protocol for details). Covaris M220 setting for 1 mL milliTUBE: Settings Time Temperature (continued)

PLAC-Seq

Settings Power

75 W

Duty factor

10%

Cycles per Burst

200

197

Time

Temperature

20 min

7 C

Other sonicators such as Bioruptor and QSonica may be used. Sonication conditions may need optimization for specific cell types/different number of cells for the best result. 8. If the chromatin shearing condition is optimal, there should be almost no visible cell debris (or only a tiny pellet) at the bottom of the tube after centrifugation when starting from 15 amino acids) and/or intact proteins, in particular for highly charged proteins such as histones. In this case, electron capture dissociation (ECD) and electron transfer dissociation (ETD) are preferred since they generate better-quality MS/MS spectra and increased sequence coverage of histone proteoforms. An advantage of analyzing long histone peptides is the possibility of investigating long-distance combinatorial PTMs (occurring for instance on H3K4me1 and H3K27ac). Nevertheless, MS and MS/MS spectra are much more complex and the postacquisition analysis is more challenging. 43. Other histone PTMs can be added as variable modifications in the MQ search. However, increasing the number of variable modifications leads to the expansion of the search space, which, in turn, leads to a decreased confidence of modified peptide identification. To circumvent this problem, when multiple modifications are to be searched, it is advisable to divide the search in parallel jobs containing a limited number of PTMs each. This can be achieved by increasing the number of “parameter groups” in the MQ software. 44. The mass and composition of the D6-acylation and methyl + D6-acylation should be added in the Andromeda search engine, as follows: for D6-acylation the mass is 45.0294 Da and the composition H(1) C(2) O D(3), while for methyl + D6-acylation the mass is 59.0450 Da and the composition H C (3) O D(3). 45. The function “Match between runs” allows detecting unmodified and modified peptides that are present but not identified by MS/MS in some of the samples. This is achieved by matching unidentified peaks in a sample with the corresponding peaks in another sample where the MS/MS fragmentation has been instead assigned to a peptide sequence. The matching is performed based on the exact m/z and the retention time values. 46. In case of hyper-modified peptides, such as histones, it could happen that MQ assigns incorrectly the position of a specific modification. It is, therefore, recommended to carry out a thorough manual inspection of the MS2 fragmentation spectra and the product ions to verify the sequence reconstruction and the PTM site attribution and thus reduce false-positive site assignments.

272

Luciano Nicosia and Tiziana Bonaldi

47. To obtain a statistical assessment of the enrichment/depletion of histone PTMs at specific genomic regions (in the IP-ed chromatin), the experiment should be performed at least in triplicate (n ¼ 3). Significance can be calculated by two-side ttest, with Bonferroni correction using an appropriate negative control ChIP, which can be represented, for instance, by ChIP directed towards H3K9me3 (heterochromatin) as the mock control for the ChIP towards H3K4me1 [23]. Alternatively, the statistical significance can be assessed by comparing the % RA values of each modification in the Input and ChIP samples through a paired t-test, with at least n ¼ 3 experimental replicates.

Acknowledgments T.B. research activity is supported by grants from the Italian Association for Cancer Research (grant# 15741) and by EPIC-XS, project number 823839, funded by the Horizon 2020 program of the European Union. We would like to thank M. Soldi and A. Pagliarulo for their contribution to the development and optimization of the method. References 1. Kornberg RD (1974) Chromatin structure: a repeating unit of histones and DNA. Science 184(4139):868–871. https://doi.org/10. 1126/science.184.4139.868 2. Kouzarides T (2007) Chromatin modifications and their function. Cell 128:693–705. https:// doi.org/10.1016/j.cell.2007.02.005 3. Bannister AJ, Kouzarides T (2011) Regulation of chromatin by histone modifications. Cell Res 21:381–395. https://doi.org/10.1038/ cr.2011.22 4. Jenuwein T (2001) Translating the histone code. Science 293:1074–1080. https://doi. org/10.1126/science.1063127 5. Rossetto D, Avvakumov N, Coˆte´ J (2012) Histone phosphorylation. Epigenetics 7:1098–1108. https://doi.org/10.4161/epi. 21975 6. Chen Y, Sprung R, Tang Y et al (2007) Lysine propionylation and butyrylation are novel posttranslational modifications in histones. Mol Cell Proteomics 6(5):812–819. https://doi. org/10.1074/mcp.M700021-MCP200 7. Sabari BR, Tang Z, Huang H et al (2015) Intracellular crotonyl-CoA stimulates transcription through p300-catalyzed histone

crotonylation. Mol Cell 58(2):203–215. https://doi.org/10.1016/j.molcel.2015.02. 029 8. Zheng Q, Osunsade A, David Y (2020) Protein arginine deiminase 4 antagonizes methylglyoxal-induced histone glycation. Nat Commun 11:3241. https://doi.org/10. 1038/s41467-020-17066-y 9. Margueron R, Reinberg D (2010) Chromatin structure and the inheritance of epigenetic information. Nat Rev Genet 11:285–296. https://doi.org/10.1038/nrg2752 10. Barski A, Cuddapah S, Cui K et al (2007) High-resolution profiling of histone methylations in the human genome. Cell 129 (4):823–837. https://doi.org/10.1016/j.cell. 2007.05.009 11. Pokholok DK, Harbison CT, Levine S et al (2005) Genome-wide map of nucleosome acetylation and methylation in yeast. Cell 122 (4):517–527. https://doi.org/10.1016/j.cell. 2005.06.026 12. Johnson DS, Mortazavi A, Myers RM, Wold B (2007) Genome-wide mapping of in vivo protein-DNA interactions. Science 316

Analysis of Histone PTMs at Individual Chromatin Regions by N-ChroP (5830):1497–1502. https://doi.org/10. 1126/science.1141319 13. Robertson G, Hirst M, Bainbridge M et al (2007) Genome-wide profiles of STAT1 DNA association using chromatin immunoprecipitation and massively parallel sequencing. Nat Methods 4:651–657. https://doi.org/10. 1038/nmeth1068 14. Noberini R, Osti D, Miccolo C et al (2018) Extensive and systematic rewiring of histone post-translational modifications in cancer model systems. Nucleic Acids Res 46 (8):3817–3832. https://doi.org/10.1093/ nar/gky224 15. Noberini R, Uggetti A, Pruneri G et al (2016) Pathology tissue-quantitative mass spectrometry analysis to profile histone post-translational modification patterns in patient samples. Mol Cell Proteomics 15(3):866–877. https://doi. org/10.1074/mcp.M115.054510 16. Sidoli S, Cheng L, Jensen ON (2012) Proteomics in chromatin biology and epigenetics: Elucidation of post-translational modifications of histone proteins by mass spectrometry. J Proteome 75:3419–3433. https://doi.org/ 10.1016/j.jprot.2011.12.029 17. Soldi M, Bonaldi T (2013) The proteomic investigation of chromatin functional domains reveals novel synergisms among distinct heterochromatin components. Mol Cell Proteomics 12(3):764–780. https://doi.org/10. 1074/mcp.M112.024307 18. Rafiee MR, Girardot C, Sigismondo G, Krijgsveld J (2016) Expanding the circuitry of pluripotency by selective isolation of chromatinassociated proteins. Mol Cell 64(3):624–635. https://doi.org/10.1016/j.molcel.2016.09. 019 19. Lambert JP, Mitchell L, Rudner A et al (2009) A novel proteomics approach for the discovery of chromatin-associated protein networks. Mol Cell Proteomics 8(4):870–882. https://doi. org/10.1074/mcp.M800447-MCP200 20. Ji X, Dadon DB, Abraham BJ et al (2015) Chromatin proteomic profiling reveals novel proteins associated with histone-marked genomic regions. Proc Natl Acad Sci U S A 112 (12):3841–3846. https://doi.org/10.1073/ pnas.1502971112 21. Mohammed H, Taylor C, Brown GD et al (2016) Rapid immunoprecipitation mass spectrometry of endogenous proteins (RIME) for analysis of chromatin complexes. Nat Protoc 11:316–326. https://doi.org/10.1038/ nprot.2016.020 22. Sansoni V, Casas-Delucchi CS, Rajan M et al (2014) The histone variant H2A.Bbd is

273

enriched at sites of DNA synthesis. Nucleic Acids Res 42(10):6405–6420. https://doi. org/10.1093/nar/gku303 23. Soldi M, Mari T, Nicosia L et al (2017) Chromatin proteomics reveals novel combinatorial histone modification signatures that mark distinct subpopulations of macrophage enhancers. Nucleic Acids Res 45(21):12195–12213. https://doi.org/10.1093/nar/gkx821 24. Ong SE, Mann M (2006) A practical recipe for stable isotope labeling by amino acids in cell culture (SILAC). Nat Protoc 1(6):2650–2660. https://doi.org/10.1038/nprot.2006.427 25. Cluntun AA, Huang H, Dai L et al (2015) The rate of glycolysis quantitatively mediates specific histone acetylation sites. Cancer Metab 3:10. https://doi.org/10.1186/s40170-0150135-3 26. An M, Shen H, Cao J et al (2016) The alteration of H4-K16ac and H3-K27met influences the differentiation of neural stem cells. Anal Biochem 509:92–99. https://doi.org/10. 1016/j.ab.2016.07.005 27. Noberini R, Bonaldi T (2017) A super-SILAC strategy for the accurate and multiplexed profiling of histone posttranslational modifications. Methods Enzymol 586:311–332 28. Jaffe JD, Wang Y, Chan HM et al (2013) Global chromatin profiling reveals NSD2 mutations in pediatric acute lymphoblastic leukemia. Nat Genet 45:1386–1391. https://doi. org/10.1038/ng.2777 29. Jung HR, Pasini D, Helin K, Jensen ON (2010) Quantitative mass spectrometry of histones H3.2 and H3.3 in Suz12-deficient mouse embryonic stem cells reveals distinct, dynamic post-translational modifications at Lys-27 and Lys-36. Mol Cell Proteomics 9 (5):838–850. https://doi.org/10.1074/mcp. M900489-MCP200 30. Rappsilber J, Mann M, Ishihama Y (2007) Protocol for micro-purification, enrichment, pre-fractionation and storage of peptides for proteomics using StageTips. Nat Protoc 2 (8):1896–1906. https://doi.org/10.1038/ nprot.2007.261 31. Cox J, Mann M (2008) MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteomewide protein quantification. Nat Biotechnol 26(12):1367–1372. https://doi.org/10. 1038/nbt.1511 32. Cox J, Neuhauser N, Michalski A et al (2011) Andromeda: a peptide search engine integrated into the MaxQuant environment. J Proteome Res 10(4):1794–1805. https://doi.org/10. 1021/pr101065j

274

Luciano Nicosia and Tiziana Bonaldi

33. Shevchenko A, Tomas H, Havlisˇ J et al (2007) In-gel digestion for mass spectrometric characterization of proteins and proteomes. Nat Protoc 1(6):2856–2860. https://doi.org/10. 1038/nprot.2006.468 34. Sidoli S, Garcia BA (2017) Characterization of individual histone posttranslational modifications and their combinatorial patterns by mass

spectrometry-based proteomics strategies. Methods Mol Biol 1528:121–148 35. Maile TM, Izrael-Tomasevic A, Cheung T et al (2015) Mass spectrometric quantification of histone post-translational modifications by a hybrid chemical labeling method. Mol Cell Proteomics 14(4):1148–1158. https://doi. org/10.1074/mcp.O114.046573

Chapter 15 Using ChIP-SICAP to Identify Proteins That Co-localize in Chromatin Mahmoud-Reza Rafiee and Jeroen Krijgsveld

1

Introduction ChIP-Seq has made a remarkable contribution in the field of genome biology to identify where a chromatin protein of interest binds to the genome, to subsequently infer its role in regulating gene expression [1]. Complementary to this DNA-centric view, the identification of proteins that co-localize with a given protein in chromatin (say, a transcription factor), will provide valuable information to understand the mechanisms of gene expression regulation [2]. One way to approach this is via a ChIP-MS (Chromatin Immunoprecipitation-Mass Spectrometry) assay, however this does not allow to distinguish protein interactions that occur on or off chromatin (the latter often named as soluble interactors [3]). Moreover, highly charged phosphodiester backbone of DNA brings about contamination by nonspecific interactions with abundant proteins. These “hitch-hikers” proteins [4] are hardly eliminated by regular washing steps applied to a ChIP assay resulting in a high unspecific background in subsequent MS analysis. To improve the accuracy and specificity of ChIP-MS, we developed a double purification method which we call Selective Isolation of Chromatin-Associated Proteins (SICAP) [5]. ChIP-SICAP purifies chromatin complexes by chromatin immunoprecipitation of a protein of interest, followed by enzymatic in vitro biotinylation of endogenous DNA. In this way, chromatin fragments obtained by ChIP can be recaptured by streptavidin beads, allowing stringent washes by denaturing reagents to eliminate contaminating proteins and obtain highly purified chromatin, followed by MS for unbiased protein identification. Ideally, ChIP-SICAP is performed using

Tilman Borggrefe and Benedetto Daniele Giaimo (eds.), Enhancers and Promoters: Methods and Protocols, Methods in Molecular Biology, vol. 2351, https://doi.org/10.1007/978-1-0716-1597-3_15, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

275

276

Mahmoud-Reza Rafiee and Jeroen Krijgsveld

protease-resistant streptavidin to minimize contamination by streptavidin-derived peptides and enhance overall sensitivity of the assay [6]. ChIP-SICAP can be performed in a single cellular condition to identify proteins that associate with a chromatin factor of interest, or it can be applied in a comparative manner to characterize the factors that are gained or lost in the complex upon a cellular perturbation. Furthermore, after digesting the proteins, DNA fragments can be retrieved for sequencing, effectively performing ChIP-Seq and ChIP-SICAP from the same experiment.

2 2.1

Materials ChIP

1. 1.5% (v/v) formaldehyde (methanol-free) in PBS. 2. 1 M glycine. 3. IP-grade antibody (see Note 1). 4. Protein A/G magnetic beads. 5. Sonication device Bioruptor Pico).

for

chromatin

shearing

(e.g.,

6. 1.5 mL Bioruptor Pico Microtubes with Caps. 7. Sonication buffer: 10 mM Tris–HCl pH 8.0, 100 mM NaCl, 1 mM EDTA pH 8.0, 0.5 mM EGTA, 0.1% (v/v) Na-deoxycholate, 0.5% (v/v) N-lauroylsarcosine. 8. IP buffer: 1% (v/v) Triton X-100, 0.5% (v/v) NP40, 50 mM Tris–HCl pH 7.5, 5 mM EDTA pH 8.0, 150 mM NaCl. 9. 10% (v/v) Tritone X-100. 10. PBS-T: PBS, 0.1% (v/v) Tween 20. 11. StemPro Accutase Cell Dissociation Reagent. 2.2

SICAP

1. BCA protein assay kit. 2. Benzonase. 3. Terminal deoxynucleotidyl Transferase (TdT) and 5
TdT buffer (Thermo EP0162). 4. T4 Polynucleotidekinase (T4 PNK). 5. 20 mg/mL BSA. 6. 1 mM Biotin-ddUTP (Jenabioscience) or 1 mM Biotin-dCTP (Jenabioscience). 7. 5000 U/mL Klenow exo- and 10
Cutsmart Buffer (optional see Note 2). 8. 1 mM Biotin-7dATP (Jenabioscience, optional see Note 2). 9. SDS wash buffer: PBS, 1% (v/v) SDS.

ChIP-SICAP to Study Chromatin-Specific Proteins

277

10. NaCl wash buffer: 10 mM Tris–HCl pH 8, 1 mM EDTA, 2 M NaCl. 11. Propanol wash buffer: 20% (v/v) 2-propanol. 12. Acetonitrile wash buffer: 40% (v/v) Acetonitrile. 13. Elution buffer: 7.5% (v/v) SDS, 200 mM DTT in H2O. 2.3 Protein Digestion for Mass Spectrometry

1. 50 mM Ammonium Bicarbonate or 100 mM Triethylammonium bicarbonate buffer (TEAB). 2. 0.4 M Iodoacetimide (IAA). 3. 1 M Dithiothreitol (DTT). 4. Trypsin for Mass Spectrometry. 5. LysC for Mass Spectrometry. 6. 10% (v/v) Trifluoroacetic acid (TFA). 7. 0.1% (v/v) Trifluoroacetic acid (TFA). 8. Acetonitrile (neat liquid with any chemical grade). 9. 80% (v/v) Acetonitrile in 0.1% (v/v) Formic acid. 10. 2% (v/v) Dimethyl sulfoxide (DMSO) in 0.1% (v/v) Formic acid. 11. Zip-Tips with 0.6μL C18 resin. 12. Glass inserts for autosampler. 13. Ampure XP or SPRI beads (optional). 14. 80% (v/v) Ethanol (optional).

2.4 ProteaseResistant Streptavidin

1. 0.2 M Sodium cyanoborohydride in PBS-T. 2. 4% (v/v) Formaldehyde (methanol-free) in PBS-T. 3. 100 mM Tris–HCl pH 7.5. 4. Streptavidin magnetic beads (NEB).

3

Methods The protocol presented here describes the general procedure for a ChIP-SICAP experiment, which should form a solid basis for its implementation in a variety of cell systems and biological contexts (Fig. 1a shows the schematic workflow). Yet, while giving global guidelines that should work for most conditions, we note that a number of variables may need optimization to achieve optimal results, where the expression level of the target protein and the quality of the used antibody will determine the number of cells that should be used as an input. Generally, we recommend using 4–24 million cells as a starting point, which may be adjusted to obtain maximally informative proteome data. The experiment should be

278

Mahmoud-Reza Rafiee and Jeroen Krijgsveld

Fig. 1 (a) Schematic workflow of the ChIP-SICAP assay. (b) Volcano plot shows the enriched proteins by ChIPSICAP using RNAPII antibody in comparison to the normal IgG control. (c) Proteins were categorized to potential true positive (PTP) and potential false positive (PFP) based on their Gene Ontology (GO) and Physical Interactions. RNAPII interactors (teal) and DNA/Chromatin-binders (green) are considered as PTP. Ribosomal Proteins (gray) and Cytoplasmic proteins that have not been reported in the nucleus (dark gray) are considered as PFP. The left chart compares protein abundances and the right chart compares the number of proteins

aimed at identifying proteins that are biologically relevant and informative even if this encompasses few proteins. Hence, maximizing the number of protein identifications should not be an aim in itself. When running the protocol for the first time, it is advisable to include a positive control, i.e., targeting a protein that is expressed in most cell types and for which an antibody is available that has been demonstrated to perform well for ChIP-SICAP (see Note 1). A negative control should always be included, which may be a no-antibody control, or preferably normal IgG. A non-biotinylated control is not necessary; however, this may be included to demonstrate that the identified proteins are chromatin-binders. If available, the best negative control is a knockout of the target protein so that the specificity of the antibody can be assessed as an internal validation (i.e., by the enrichment and MS identification of the expected bait protein). Although SILAC (Stable Isoform Labeling by Aminoacid Cell culture) will help to quantify differences in chromatin association when comparing two cellular states, this is not a necessity and is therefore not described in this protocol. Finally, ChIP-SICAP performs best when using

ChIP-SICAP to Study Chromatin-Specific Proteins

279

protease-resistant streptavidin beads to prevent contamination by abundant streptavidin-derived peptides [6]. We thus recommend preparing a batch before starting the actual ChIP-SICAP protocol, which we therefore describe first. 3.1 Preparation of Protease-resistant Streptavidin beads

1. Pour 5 mL of streptavidin beads (e.g., NEB) into a 15 mL tube. 2. Transfer the tube on the magnet, wait 5 min, and then discard the liquid. 3. Wash the beads once again with 10 mL PBS-T. 4. Put the tube on the magnet, wait 5 min, and then discard the liquid (see Note 3). 5. In a fume hood, resuspend the beads in 7 mL of 0.2 M sodium cyanoborohydride. 6. Add 7 mL of 4% (v/v) formaldehyde. 7. Rotate 2 h at room temperature. 8. Put the tube on the magnet, wait 5 min, and then discard the liquid (see Note 4). 9. Wash the beads with 10 mL of 0.1 M Tris–HCl pH 7.5. 10. Put the tube on the magnet, wait 5 min, and then discard the liquid. 11. Wash the beads with 10 mL PBS-T. 12. Put the tube on the magnet, wait 5 min, and then discard the liquid. 13. Resuspend the beads in 5 mL PBS-T (see Note 5). 14. Keep the beads in the fridge. The beads are stable at +4  C for months.

3.2 Fixing the Cells and Chromatin Crosslinking by Formaldehyde

3.2.1 Detaching the Cells and Crosslinking

This section and the next Subheading 3.3 essentially describe a ChIP protocol. If an optimized ChIP protocol has already been established, this may be readily used for ChIP-SICAP. Part 1 here has two alternative approaches for crosslinking the cells by formaldehyde that may be chosen depending on the cell type or application: Approach Subheading 3.2.1 describes detachment of cells, followed by counting, fixing, and freezing, while in approach Subheading 3.2.2 cells are crosslinked in the plate, before harvesting and freezing. 1. Detach the cells by Accutase. Accutase does not lyse cells, so it is more suitable for single cell preparation. After detaching the cells, make sure that they do not clump, achieved by pipetting in the medium. 2. Count the cells.

280

Mahmoud-Reza Rafiee and Jeroen Krijgsveld

3. Spin the cells at 200
g for 5 min at room temperature and remove the medium. 4. Resuspend the cells in 1.5% (v/v) formaldehyde in PBS. Roughly for every ten million mammalian cells, add 10 mL of 1.5% formaldehyde. Pipette up and down to disrupt the cell pellet completely. 5. Rotate occasionally and keep it 15 min at room temperature. 6. Add 1 M glycine to stop the crosslinking, so the final concentration will be 130 mM (1.5 mL glycine for every 10 mL of formaldehyde). 7. Rotate occasionally 5 min at room temperature. 8. Spin the cells at 1400
g, 2 min at room temperature. Discard the supernatant (SN). 9. Resuspend the cells with PBS-T, equal volume to the formaldehyde volume which was used in step 4 of Subheading 3.2.1. 10. Spin the cells at 1400
g, 2 min at room temperature and discard the SN. 11. Resuspend the cells in 20 mL PBS-T. 12. Count the cells, and aliquot them, e.g., 24 million per 15 mL tube (see Note 6). 13. Spin the cells at 1400
g, 2 min at room temperature and discard the SN. Freeze the cells in liquid nitrogen. Pause point: The cells could be frozen in 80  C for months. 3.2.2 Crosslinking of the Cells in a Plate and Harvesting

1. Inside a fume hood, remove the medium, and pour 10 mL of 1.5% formaldehyde in a 10 cm dish. 2. Wait 15 min and rotate the plate gently. 3. Add 1 M Glycine to the final concentration of 130 mM. 4. Rotate the plate gently, and wait 5 min. 5. Discard the liquid, gently pour 10 mL of PBS on the cells, rotate, and discard it. 6. Repeat the step 5 of this section once again. 7. Pour 3 mL of PBS-T on the plate (see Note 7). 8. Scrape the cells with a cell lifter and collect them in one side of the plate. Then transfer them by a pipet to a tube (e.g., 15 mL or 50 mL depending on the number of plates). 9. Repeat the last two steps once again for each plate. 10. Spin the cells at 1400
g for 2 min at room temperature and discard the supernatant. 11. Resuspend the cells in proper amount of PBS-T to prepare aliquots of 20 million cells.

ChIP-SICAP to Study Chromatin-Specific Proteins

281

12. Spin the cells at 1400
g for 2 min at room temperature and discard the supernatant. 13. Freeze the cells in liquid nitrogen and keep them in 80  C. Pause point: cells can be kept at 80  C for months. 3.3

ChIP

1. Resuspend the cells in 0.9 mL of 10 mM Tris–HCl pH 7.5. Then add 100μL of 10% (v/v) Tritone X-100. Leave the cells on ice for 5 min (see Note 8). 2. Spin the cells 2 min at 1400
g at room temperature. Discard the supernatant. 3. Resuspend the cells in 1 mL sonication buffer. Spin the cells 2 min at 1400
g at room temperature. Discard the supernatant. 4. Repeat step 3 of this section once again. 5. Resuspend every eight million cells in 250μL LB3 buffer. 6. Aliquot 250μL of the resuspended cells into a 1.5 mL Bioruptor Pico microtube. 7. Sonicating conditions depend on the cell type. For mES cells using Bioruptor Pico, we apply 7 cycles ON and OFF (30 s– 30 s) (see Note 9). 8. After the sonication, spin the sonication microtubes 10 min at 12,000
g at 4  C. 9. Collect the supernatant and transfer it into a 2 mL tube or a 15 mL tube. Sheared chromatin obtained from one replicate can be pooled (see Note 10). 10. Measure the protein concentration using a BCA protein assay kit. Briefly, take 5–10μL of the sheared chromatin, and pour it into a PCR tube. Add 25μL of 1% (v/v) SDS. Do the same with the standard controls and the negative control. Heat the samples at 95  C for 5 min. Add 0.5μL of Benzonase and gently vortex. Take 25μL of each sample and pour it in a 96-well plate. Follow the kit manual to measure the protein concentration. 11. Pour up to 1 mg of protein (chromatin) in a 2 mL tube for one replicate. If SILAC is used to compare two/three cellular states all using the same antibody, samples may be mixed at this step. However, if SILAC is used to compare a bait-specific antibody with normal IgG or no-antibody as the negative control, please mix the samples in step 17 Subheading 3.4. 12. Add 10% (v/v) Triton X-100 to make the final concentration of 1%. Pause point: Samples may be kept at 80  C for weeks. Keep 1% as the input control for ChIP-qPCR/Seq.

282

Mahmoud-Reza Rafiee and Jeroen Krijgsveld

13. Add proper amounts of a suitable antibody to the samples. Depending on the antibody between 2–10μg and 1:50–1:100 (v/v) may be needed. 14. Agitate at 800 rpm overnight in a Thermomixer at 4  C or cold room. 15. After the overnight incubation, spin the samples at 12,000
g for 10 min at 4  C. 16. Collect 95% of the liquid and transfer it into a new 2 mL tube. 17. Adjust the volume to 1 mL by adding IP buffer. 18. For each tube, prepare 40μL of Protein A or Protein G Dynabeads (see Note 11). Wash the magnetic beads once with IP buffer. More washing is not necessary. 19. Add 40μL of the magnetic Dynabeads to each tube. 20. Rotate the samples 2–4 h at 4  C (cold room) on a rotating wheel (see Note 12). 3.4 Selective Isolation of Chromatin-Associated Proteins (SICAP)

1. Put the tubes on the magnet, after 1 min remove the liquid, and take the tubes off the magnet. Immediately pour 1000μL of 10 mM Tris–HCl pH 7.5 (without EDTA) on the beads (see Note 13). 2. Resuspend the beads by rotating end to end and transfer them to a new 2 mL tube (see Note 14). Optional Steps: TdT adds all type of biotinylated nucleotides to all types of DNA ends (i.e., 30 -overhangs, 50 -overhangs and blunt ends). Klenow 30 exo- adds biotin-dATP to 50 -overhangs or blunt ends. Although TdT is good enough for DNA end-labeling, combination of TdT and Klenow 30 exoboosts DNA end-labeling. Thus, steps 3–6 are: 3. Put the samples one by one on the magnet, remove the liquid, and take the tubes off the magnet. Resuspend the beads in 200μL of 1
NEB Cutsmart buffer. Do not pipet the beads. Gently swirl the tube to resuspend the beads. 4. Prepare the following mixture for each tube. dBTP means all nucleotides except dATP. A master mix may be prepared for all the tubes: Reagent

For one reaction (μL)

10
Cutsmart buffer

10

5000 U/mL Klenow 30 exo-

2

10 mM dBTP (C+G+T)

1

1 mM Biotin-7dATP

10

H2O

77

Total volume

100

ChIP-SICAP to Study Chromatin-Specific Proteins

283

5. Put the samples one by one on the magnet, remove the liquid, and take the tubes off the magnet. Pour the mixture prepared in the previous step on the beads. Gently swirl to resuspend the beads (see Note 15). 6. Incubate at 37  C in a thermomixer with agitation at 700 rpm for 30 min. 7. Put the samples one by one on the magnet, remove the liquid, and take the tubes off the magnet. Resuspend the beads in 100μL of 1
TdT buffer (see Note 16). 8. Prepare the following mixture for each tube. A master mix may be prepared for all tubes (see Note 17): Reagent

For one reaction (μL)

TdT buffer 5


20

20 mg/mL BSA

5

1 mM Biotin-dCTP

5

1 mM Biotin-ddUTP

5

10,000 U/mL T4 Polynucleotide kinase (PNK) TdT RNase A (Optional, see Note 18)

1 4 1

H2O

59

Total volume

100

9. Put the samples one by one on the magnet, remove the liquid, and take the tubes off the magnet. Pour the mixture prepared in the previous step 8 on the beads. Gently swirl to resuspend the beads. 10. Incubate at 37  C in a thermomixer with agitation at 800 rpm for 30 min. 11. Wash the beads four times at rt. with 1 mL ice-cold IP buffer (see Note 19). 12. Remove the last IP wash buffer. 13. Resuspend the beads in 100μL of Elution buffer, and vortex vigorously. 14. Incubate 15 min at 37  C in a thermomixer, with 1000 rpm agitation. 15. Put the samples on the magnet, collect the liquid, and discard the beads. 16. Dilute the liquid with 1000μL IP buffer. 17. Add 70μL of (protease-resistant) streptavidin magnetic beads to each tube. Rotate the tubes for 45–60 min at room temperature.

284

Mahmoud-Reza Rafiee and Jeroen Krijgsveld

Fig. 2 Capturing chromatin fragments on streptavidin magnetic beads. After two or three washes with the SDS wash buffer, streptavidin magnetic beads disperse in the test samples (in this case RNAPII), while they accumulate at one spot in the negative control (normal IgG). This is probably due to the denaturation of the proteins by SDS. As a result, denatured proteins on the chromatin fragments push the beads away

18. Put the tubes on the magnet and, after 2 min discard the solution. 19. Wash the beads three times with SDS wash buffer. Each washing consists of resuspending the beads in the washing solution by vortexing, briefly spinning, and putting on the magnet for 2 min to remove the solution. Figure 2 shows how the beads look like. 20. Wash with NaCl wash buffer, once. 21. Wash the beads with 2-propanol wash buffer, once. 22. Wash the beads with acetonitrile wash buffer, twice. 23. Resuspend the beads in 80μL acetonitrile wash buffer and transfer it into a PCR tubes. 24. Put the tubes on the magnet and remove the acetonitrile wash buffer. 25. Spin the tubes briefly and remove the residues of the acetonitrile wash buffer. 3.5 Digesting Proteins and Sample Preparation for Mass Spectrometry

1. Resuspend the beads in 20μL of 50 mM ammonium bicarbonate + 10 mM DTT (or 50 mM TEAB for dimethylation or TMT labeling) (see Note 20). 2. Incubate the beads at 50  C for 15 min. 3. Chill the beads and add 2μL of 0.4 M IAA. Vortex and keep the tubes in a drawer for 15–30 min. 4. Add 0.5μL of 1 M DTT to neutralize IAA. 5. Add 300 ng of LysC (3μL of 100 ng/μL), vortex, and spin briefly. 6. Incubate overnight at 37  C (12–16 h).

ChIP-SICAP to Study Chromatin-Specific Proteins

285

7. Remove the beads and transfer the liquid into new PCR tubes (see Note 21). 8. Heat the samples (without the beads) at 95  C for 5 min to reverse the formaldehyde crosslinking. 9. Chill the samples briefly. 10. Add 200 ng of Trypsin (2μL of 100 ng/μL). 11. Incubate at 37  C for 8 h. 12. Add 1μL of 10% TFA to the digested samples to acidify to pH 3–4. 13. Pour 50μL of 80% Acetonitrile in 0.1% formic acid in a glass insert. 14. Set a P20 pipette on 20μL and pick up a Zip-Tip. 15. Pipet 20μL neat Acetonitrile and discard the liquid. Repeat once again. 16. Equilibrate the Zip-Tip by pipetting 20μL 0.1% TFA and discard the liquid. Repeat twice again. 17. Pipet one sample ten times. Do not generate bubbles. 18. Wash the Zip-Tip by pipetting 20μL of 0.1% (v/v) TFA, and discard the liquid. Repeat once again (see Note 22). 19. Elute the peptides by pipetting 80% (v/v) Acetonitrile + 0.1% (v/v) formic acid in the glass insert. 20. Dry out the eluent in an appropriate speed vac. 21. Reconstitute the peptides in 8μL of 2% (v/v) DMSO in 0.1% (v/v) formic acid. 22. Inject 7μL out of 8μL to a mass spectrometer using a datadependent HCD-IT MS-MS method over a 1-h gradient. Figure 1b shows the anticipated results in a volcano plot to indicate significance and fold-enrichment of proteins identified by ChIP-SICAP using an antibody for RNA polymerase II (RNAPII), compared to an IgG control. Figure 1c indicates that the expected classes of proteins are enriched (chromatinbinders) and that suspected background proteins are depleted (e.g., ribosomal proteins). 3.6 Clean Up the DNA by Ampure XP Beads

Optional steps: DNA fragments remain on streptavidin beads after the LysC digestion. In order to recover DNA fragments to do a ChIP-qPCR or a ChIP-Seq assay (Fig. 1a), carry out the following steps: 1. After step 7 of Subheading 3.5, resuspend the streptavidin beads in 23μL of SDS wash buffer. 2. Add 2μL of Proteinase K (20 mg/μL). 3. Incubate the beads at 55  C for 15 min.

286

Mahmoud-Reza Rafiee and Jeroen Krijgsveld

4. Incubate the beads at 95  C for 10 min. 5. Put the tubes on a magnetic rack to separate the beads. 6. Collect the supernatants and transfer them to new PCR tubes. 7. Add 50μL of Ampure XP beads to the samples. Vortex and wait 10 min at rt. 8. Spin the samples, and put them on a magnetic rack to separate the beads. 9. Discard the liquid, add 200μL of freshly prepared 80% (v/v) EtOH, and wait a few seconds. 10. Discard the liquid, repeat step 8 of this section once again. 11. Spin the samples and put them on a magnetic rack to separate the beads. 12. Discard the residual ethanol. 13. Resuspend the beads in 20μL of 10 mM Tris–HCl pH 8.0. 14. Spin the samples and put them on a magnetic rack to separate the beads. 15. Collect the samples and transfer them to new tubes. The samples can be used for qPCR or NGS library preparation.

4

Notes 1. Since Suz12 is expressed in many cell types, a Suz12 antibody (Cell Signaling Technologies) may be used as a positive control, which works well under ChIP conditions. 2. When working with tissue, it is recommended to use these Klenow exo- and Biotin-7dATP to boost the efficiency of DNA end-labeling. 3. Then work in a fume hood until the last washing step. 4. This solution is toxic and should be discarded properly. 5. The modified beads may be stored in the original bottle after washing to remove non-modified beads. 6. Use polypropylen (soft) tubes. Do not use polystyrene (rigid) tubes, as a lot of cells will bind to the walls. 7. Triton X-100 allows to collect the cells more efficiently. Without a detergent many cells stick to the plate. Adding complete protease inhibitor is optional. Apparently, endogenous proteases are inactivated by formaldehyde. 8. Adding protease inhibitor is optional. 9. Bioruptor Pico is faster; however, Covaris is more precise and reproducible. Adding SDS to the final concentration of 0.1% (v/v) improves the efficiency of sonication. However, some

ChIP-SICAP to Study Chromatin-Specific Proteins

287

antibodies are sensitive to it. Instead of SDS, 0.1% sodium deoxycholate or 0.1% (v/v) Sarkosyl could be used. Too many cycles of sonication detach the proteins from chromatin. 10. LoBind tubes slightly improve the results. The pellet may not be easily seen; however, sometimes there is a transparent precipitation. A 2 mL tube is necessary for efficient agitation in the next steps. 11. Please check the affinity of your antibody to protein A or G in the following link: https://international.neb.com/tools-and-resources/selec tion-charts/affinity-of-protein-ag-for-igg-types-from-differ ent-species 12. Alternatively, rotate the samples overnight at 4  C. 13. Process the tubes one by one. Never allow the beads to dry. Here the idea is to remove the inhibitors of the enzymatic reactions (e.g., EDTA). Stringent washes come later. 14. A 2 mL tube is necessary because agitation is more efficient and beads do not precipitate in the subsequent steps. 15. Be careful not to dry the beads. Samples should be treated one by one to avoid drying the beads. 16. Do not vortex the beads. Gently swirl the beads to resuspend the beads. 17. Biotin-dCTP is cheaper than biotin-ddUTP; however, the biotin-ddUTP allows chain termination. Thus, it is slightly more efficient. Either nucleotide or a combination (1:1) could be used for DNA labeling. 18. TdT is a quite specific enzyme for DNA labeling, as evident by TUNEL assay. Adding RNase A reassures specific DNA labeling. 19. During each wash, invert the tubes to resuspend the beads. Then spin them briefly. Put them on the magnet and remove the liquid. Take the tube off the magnet and pour 1 mL of the aforementioned wash buffers. Treat the tubes one by one on the magnet to avoid drying the beads. 20. Freshly prepared ammonium bicarbonate buffer should be used. 21. Do not discard the beads as they contain the DNA fragments. Follow the DNA purification steps to prepare the DNA for qPCR or sequencing. 22. Discard the aliquots of 0.1% TFA to avoid carry over between the samples.

288

Mahmoud-Reza Rafiee and Jeroen Krijgsveld

References 1. Solomon MJ, Larsen PL, Varshavsky A (1988) Mapping protein-DNA interactions in vivo with formaldehyde: evidence that histone H4 is retained on a highly transcribed gene. Cell 53 (6):937–947. https://doi.org/10.1016/ s0092-8674(88)90469-2 2. Wang CI, Alekseyenko AA, LeRoy G, Elia AE, Gorchakov AA, Britton LM, Elledge SJ, Kharchenko PV, Garcia BA, Kuroda MI (2013) Chromatin proteins captured by ChIP-mass spectrometry are linked to dosage compensation in Drosophila. Nat Struct Mol Biol 20 (2):202–209. https://doi.org/10.1038/nsmb. 2477 3. Lambert JP, Tucholska M, Pawson T, Gingras AC (2014) Incorporating DNA shearing in standard affinity purification allows simultaneous identification of both soluble and chromatinbound interaction partners. J Proteome 100:55–59. https://doi.org/10.1016/j.jprot. 2013.12.022

4. Ohta S, Bukowski-Wills JC, Sanchez-Pulido L, Alves Fde L, Wood L, Chen ZA, Platani M, Fischer L, Hudson DF, Ponting CP, Fukagawa T, Earnshaw WC, Rappsilber J (2010) The protein composition of mitotic chromosomes determined using multiclassifier combinatorial proteomics. Cell 142 (5):810–821. https://doi.org/10.1016/j.cell. 2010.07.047 5. Rafiee MR, Girardot C, Sigismondo G, Krijgsveld J (2016) Expanding the circuitry of pluripotency by selective isolation of chromatinassociated proteins. Mol Cell 64(3):624–635. https://doi.org/10.1016/j.molcel.2016.09. 019 6. Rafiee MR, Sigismondo G, Kalxdorf M, Forster L, Brugger B, Bethune J, Krijgsveld J (2020) Protease-resistant streptavidin for interaction proteomics. Mol Syst Biol 16(5):e9370. https://doi.org/10.15252/msb.20199370

Chapter 16 Genome-Wide Profiling of Protein–DNA Interactions with Chromatin Endogenous Cleavage and High-Throughput Sequencing (ChEC-Seq) Moustafa M. Saleh, Jason P. Tourigny, and Gabriel E. Zentner

1

Introduction Genome-wide mapping of protein-binding sites is crucial for understanding chromatin-resident processes, including transcription, replication, and repair. Currently, the most well-established method for this purpose is chromatin immunoprecipitation and high-throughput sequencing (ChIP-Seq). ChIP-Seq generally involves in vivo crosslinking of proteins to DNA, fragmentation of the crosslinked chromatin by sonication, immunoprecipitation of the protein of interest, and purification and sequencing of its associated DNA fragments [1]. Since its introduction in 2007 [2– 5], ChIP-Seq has been modified in numerous ways. For instance, its spatial resolution has been improved by post-immunoprecipitation removal of unbound DNA by exonuclease digestion [6, 7] or initial digestion of chromatin with micrococcal nuclease (MNase), a calcium-dependent exo/endonuclease that preferentially cuts exposed double-stranded DNA, nicking each strand when the helix breathes, and “chews” the exposed DNA ends until blocked by an obstacle such as a nucleosome or transcription factor (TF) [8, 9] (also see Chapter 7). Despite extensive and ongoing development since its introduction over a decade ago, sources of bias remain inherent to the ChIP-Seq method [10]. These biases include differential recovery of genomic regions depending on their chromatin state [11–14] and hyper-ChIPable regions that yield high signal even when a ChIP is performed against an irrelevant protein [15, 16] or in a genetic background that is protein-null for the factor of interest [17, 18]. Thus, while ChIP-Seq and its

Tilman Borggrefe and Benedetto Daniele Giaimo (eds.), Enhancers and Promoters: Methods and Protocols, Methods in Molecular Biology, vol. 2351, https://doi.org/10.1007/978-1-0716-1597-3_16, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

289

290

Moustafa M. Saleh et al.

myriad derivatives have been used to great effect in the genomewide characterization of chromatin-resident processes, there is a need for orthogonal approaches to confirm and expand upon the findings of ChIP-Seq studies. Indeed, in parallel to the development of ChIP-Seq, a number of orthogonal methods, based on genetic or immunological targeting of various enzymatic activities to factor-bound loci, were developed and subsequently adapted to high-throughput sequencing readouts. One such method is DNA adenine methyltransferase identification (DamID), which employs fusion of a chromatinbinding protein to E. coli Dam methyltransferase, targeting adenine methylation to GATC tetranucleotides in the vicinity of the fusion partner’s binding sites [19, 20]. Another enzymatic approach to profiling genome-wide protein–DNA interactions is Calling Card-Seq, which employs fusion of a protein of interest with a transposase or transposase-interacting protein to direct transposon integration proximal to its target sites [21, 22]. More recently, techniques based on targeted MNase cleavage of DNA have been adapted to high-throughput sequencing readouts. In 2004, Laemmli and colleagues published a paper describing two MNase-based mapping methods, chromatin immunocleavage (ChIC) and chromatin endogenous cleavage (ChEC) [23]. In ChIC, cells are permeabilized and incubated with an antibody against the protein of interest. Following an optional incubation with a secondary antibody, cells are incubated with a fusion of two immunoglobulin-binding domains from staphylococcal protein A and MNase (pA-MN). Following the formation of antibody-pAMN complexes, calcium is added to activate MNase, resulting in cleavage of DNA in the vicinity of sites bound by the antibodytargeted factor, fragments of which can then be recovered and characterized. ChIC was later adapted to high-throughput sequencing in the forms of cleavage under targets and release using nuclease (CUT&RUN) [24] and single-cell ChIC-Seq (scChIC-Seq) [25]. The related method cleavage under targets and tagmentation (CUT&Tag) [26] alternatively uses a fusion of pA to Tn5 transposase to fragment the genome while adding sequencing adaptors at loci bound by the protein under study. The second method presented in the Laemmli paper, ChEC, depends on genetic fusion of the factor of interest to MNase, which is kept inactive by the low level of free calcium in the nucleoplasm. Upon permeabilization of the cells and calcium addition, MNase cleaves DNA proximal to sites bound by the fusion factor, releasing small DNA fragments that are then purified for analysis. We combined ChEC with high-throughput sequencing (ChEC-Seq) (Fig. 1) and mapped the binding of the yeast general regulatory factors ARS-binding factor 1 (Abf1), repressor/activator site-binding protein 1 (Rap1), and RNA polymerase I enhancerbinding protein (Reb1) [27]. We also applied ChEC-Seq to subunits of Mediator, a transcriptional coactivator complex that does

Global Profiling of Protein–DNA Interactions with ChEC-Seq

291

a Ca+2 t0 OD600 = 0.2 - 0.3 tend OD600 = 0.5 - 0.7 expand

+digitonin

S. cerevisiae

MNase fusion

Stop solution

overnight 50ml

DNA cleavage

b

c

Deproteination

Size selection

Library preparation

g - rou t High-throughput sequencing n

Fig. 1 Schematic of the ChEC-Seq method. (a) Cell growth, harvest, and ChEC. A 50 mL culture of the appropriate yeast strain is prepared by diluting an overnight culture into fresh YPD or SC at an OD600 equivalent to early log-phase (0.2–0.3). At this stage, the protein of interest (orange) tagged with MNase (green) binds to DNA but generates very little cleavage due to the low level of intranuclear calcium. At mid log-phase (OD600 ¼ 0.5–0.7), cells are pelleted, washed, and transferred to a microfuge tube. Digitonin is added to permeabilize cells and calcium is added to induce cleavage of DNA proximal to sites bound by the MNase-tagged factor. At each desired time point, an aliquot of the digest is transferred to a tube containing Stop solution. (b) DNA purification. Each tube now contains a mixture of DNA, protein, and cellular debris. DNA is purified away from proteins and debris and subjected to size selection to enrich small DNA fragments. (c) Library preparation and sequencing. Size-selected DNA fragments are prepared for sequencing using a standard ChIP-Seq-type protocol and sequenced in paired-end mode on an Illumina platform. Components of this figure were made using Servier Medical Art templates under a Creative Commons Attribution 3.0 Unported License; https://smart.servier.com

not directly associate with DNA [28, 29]. Other groups have used yeast ChEC-Seq to map the genomic binding of diverse factors including the Spt-Ada-Gcn5-Acetyltransferase (SAGA) and Transcription Factor IID (TFIID) coactivator complexes [30], ATP-dependent chromatin remodeling complexes [31], the basal initiation factor TATA-binding protein (TBP) [32], the Minichromosome maintenance 2–7 (Mcm2–7) replicative helicase complex [33], and additional sequence-specific transcription factors [34– 36]. Here, we provide an optimized protocol for ChEC-Seq in budding yeast. Given its simplicity and speed, it is likely to be applicable to other organisms in conjunction with the appropriate protocols for expression of MNase fusion proteins. Indeed, recent studies have reported ChEC-Seq of DNA replication factors in

292

Moustafa M. Saleh et al.

mammalian cells via lentiviral integration of MNase fusions [37] and in C. elegans embryos via CRISPR tagging of endogenous loci with MNase [38].

2

Materials

2.1 Plasmids and Strains 2.1.1 Vectors (See Note 1)

1. MNase-tagging vectors. We constructed vectors for endogenous C-terminal tagging of a protein of interest with 3  FLAG-MNase tag with a kanMX6, HIS3MX6, or TRP1 selectable marker. The length of the linker between the C-terminus of the tagged protein is 33 aa. These vectors (pGZ108-110) are derived from pFA6a-type plasmids and are thus compatible with the F2/R1 primer sets commonly used for C-terminal tagging (https://yeastgfp.yeastgenome.org/ yeastGFPOligoSequence.txt). We also generated a kanMX6marked vector for C-terminal MNase-tagging with a short (8 aa) linker lacking the 3  FLAG tag (pGZ173). 2. Control vector. For expression of nuclear-localized, unfused (“free”) MNase, we generated pGZ136, expressing 3FLAGMNase-NLS under the control of the REB1 promoter. This vector is based on pRS406 and can thus be integrated at the URA3 locus following digestion with NcoI or StuI. The promoter may also be replaced depending on the expression level of the protein(s) to be profiled by ChEC-Seq.

2.1.2 Strains

1. MNase fusion strain. In the desired genetic background, generate an MNase-tagged allele of your factor of interest using a donor cassette amplified from pGZ108, 109, or 110 with F2/R1 primers (https://yeastgfp.yeastgenome.org/ yeastGFPOligoSequence.txt) by standard yeast genetic methods. Integration can be confirmed using a forward primer in the body of the gene of interest (available from the above webpage) and the reverse primer 50 -TTGTGCAGCTTCTTGG TAC0 -3, located at the 50 end of the MNase coding sequence. FLAG immunoblotting can also be used to confirm tagging, with an upward shift of ~20.6 kDa expected. 2. Free MNase strain. Linearize pGZ136 or a variant with a different MNase-driving promoter with NdeI (cuts in the URA3 promoter) or NcoI or StuI (both cut in the URA3 coding sequence) and transform. Free MNase under the control of the desired promoter can also be expressed from an extrachromosomal plasmid with growth in the appropriate selective medium, an approach we used to generate MED8 promoter-driven free MNase [28]. Free MNase expression can be confirmed by FLAG immunoblotting, with a ~20.6 kDa band expected.

Global Profiling of Protein–DNA Interactions with ChEC-Seq

2.2 Reagents and Buffers

293

1. Yeast growth medium. Cells with no selection requirements may be grown in yeast extract-peptone-dextrose (YPD) growth medium: 1% (w/v) yeast extract, 2% (w/v) peptone, 2% (w/v) dextrose. For selection, grow cells in synthetic complete (SC) medium: 6.7 g/L yeast nitrogen base without amino acids and with ammonium sulfate, 1 amino acid mix (with the appropriate amino acid(s) dropped out), 2% (w/v) dextrose. 2. Buffer A: 15 mM Tris–HCl (pH 7.5), 80 mM KCl, 0.1 mM EGTA, protease inhibitors, 0.2 mM spermine, 0.5 mM spermidine (see Note 2). Protease inhibitors, spermine, and spermidine should only be added just before starting a ChEC experiment. Prepare 4 mL complete buffer A for each sample to be processed. 3. 2% digitonin: Dissolve 20 mg high-purity digitonin in 1 mL DMSO and store 100 μL aliquots protected from light at 20  C. 4. 1 M CaCl2. 5. 2 Stop solution: 400 mM NaCl, 20 mM EDTA, 4 mM EGTA, 1% SDS (see Note 3). We have observed that SDS precipitates in stocks of Stop solution, likely due to their relatively high salt content, and so recommend making a stock of SDS-free 2 Stop solution and preparing complete Stop solution only when beginning a ChEC experiment. For each time point to be collected, combine 90 μL SDS-free 2 Stop solution and 10 μL 10% SDS in a microfuge tube, preferably from a master mix. Alternatively, warm and aliquot complete Stop solution before use. If desired, spike-in DNA can also be added to the Stop solution master mix before use (see Note 4). 6. Proteinase K (20 mg/mL). 7. Phenol:chloroform:isoamyl alcohol (25:24:1). 8. 100% (absolute) ethanol. 9. 75% ethanol. 10. Nuclease-free water for buffers and ethanol dilution. 11. RNase resuspension solution: per sample, combine 29 μL 10 mM Tris–HCl (pH 8.0) or other comparable buffer (e.g., TE) with 1 μL RNase A (10 mg/mL). 12. SPRI beads (see Note 5). 13. Linear acrylamide (5 mg/mL).

2.3

Equipment

1. Magnetic rack. 2. Agilent TapeStation 2200/4200.

294

3 3.1

Moustafa M. Saleh et al.

Methods Cell Growth

1. The afternoon of the day before ChEC is to be performed, inoculate 3 mL of YPD or SC medium with a single colony of each strain expressing an MNase-tagged factor. Also prepare an overnight culture of a free MNase control strain. 2. Grow cultures overnight at 30  C with shaking at 180 RPM. 3. In the morning, dilute each overnight culture into 50 mL YPD or SC to an OD600 of 0.2–0.3. 4. Grow cultures at 30  C with shaking at 180 RPM until OD600 ¼ 0.5–0.7.

3.2

ChEC

1. Before starting, prepare the appropriate volumes of complete Buffer A and aliquot 2 Stop solution into time point tubes. 2. Decant cultures into 50 mL tubes and pellet cells at 1500  g for 2 min. 3. Decant supernatants, resuspend cells in 1 mL Buffer A, and transfer cells to a microfuge tube. 4. Pellet cells at 1500  g for 1 min. 5. Aspirate supernatants, resuspend cells in 1 mL Buffer A, and spin as in the previous step. Repeat this wash once more. 6. Resuspend cells in 570 μL Buffer A. 7. Add 30 μL 2% digitonin and invert to mix. Incubate cells for 5 min at 30  C. 8. Prior to calcium addition, transfer 100 μL of permeabilized cells to a stop tube as a zero time point/untreated control sample and mix by vortexing or pipetting up and down. Stop tubes can be left at room temperature. 9. Add 1.1 μL 1 M CaCl2 (~2 mM final) to the remaining ~500 μL ChEC volume and rapidly invert the tube to mix (see Note 6). Place the tube back at 30  C for active MNase incubation. 10. At each desired time point, transfer 100 μL of cell suspension to a Stop solution tube as described in step 8 from Subheading 3.2 (see Note 7).

3.3

DNA Purification

1. To each stopped sample, add 2 μL 20 mg/mL proteinase K, vortex to mix, and incubate at 55  C for 20 min (see Note 8). 2. Add 200 μL phenol:chloroform:isoamyl alcohol to each sample, vortex to mix, and centrifuge at 10,000  g for 1 min in a microfuge.

Global Profiling of Protein–DNA Interactions with ChEC-Seq

295

3. Transfer aqueous phases to new tubes, add 2 μL 5 mg/mL linear acrylamide and 500 μL 100% ethanol, and invert tubes several times to mix. 4. Precipitate nucleic acids at 80  C for  30 min. 5. Centrifuge samples at maximum speed and 4  C for 20 min. 6. Carefully decant supernatants and wash with 1 mL 75% ethanol. 7. Decant wash and remove the remaining 75% ethanol by pipetting (a P200 pipette is recommended); avoid disturbing the pellet. 8. Invert tubes on a paper towel with caps open to air dry pellets for ~5 min. 9. Resuspend each pellet in 30 μL Tris–HCl (pH 8.0)/RNase A and incubate at 37  C for 20 min (see Note 9). 10. Run 5 μL of each RNase-treated sample on a 1.5% agarose gel to verify progressive DNA fragmentation if desired (Fig. 2).

0

Time + Ca2+ (min) 1 2.5 5 10 20 0 1 2.5 5 10 20

bp

bp 1500 1000 700 500 400 300 200

2000 1000 500 400 300 200 100

100 50 25 Agarose gel (1.5%) SYBR Gold

TapeStation HSD1000 ScreenTape

Fig. 2 ChEC DNA fragmentation time course. (Left) A 1.5% agarose gel showing a time-dependent increase in genomic DNA fragmentation by Reb1-MNase. In order to more readily visualize small fragments, this gel was stained with SYBR Gold, which is much more sensitive than ethidium bromide. However, smearing of genomic DNA, indicative of calcium-dependent cleavage, can easily be detected with ethidium bromide. (Right) A simulated gel produced by an Agilent TapeStation 2200 instrument using a High-Sensitivity D1000 ScreenTape, allowing sharper visualization of the small fragments generated by Reb1-MNase digestion. Note the increasing prevalence of bands at ~180 and ~350 bp, indicative of the release of mono- and dinucleosomal fragments and likely overdigestion of the genome at later time points

296

3.4

Moustafa M. Saleh et al.

Size Selection

1. Dilute RNase-treated samples to 200 μL with 10 mM Tris pH 8. 2. Add 160 μL SPRI beads (0.8:1 beads:sample ratio) and pipette up and down 10 times to mix. Incubate 5 min at RT. While this incubation proceeds, prepare an equal number of fresh microfuge tubes containing 16 μL 5 M NaCl. 3. Collect beads on a magnetic rack for 2 min. 4. Remove supernatants (~400 μL) to the previously prepared microfuge tubes containing 16 μL 5 M NaCl (~200 mM final). 5. Add 400 μL phenol/chloroform/isoamyl alcohol, vortex to mix, and centrifuge at 10,000  g for 1 min in a microfuge. 6. Transfer aqueous phases to new tubes, add 1 mL 100% ethanol, and invert tubes several times to mix. 7. Precipitate nucleic acids at 80  C for  30 min. 8. Centrifuge samples at maximum speed and 4  C for 20 min. 9. Carefully decant supernatants and wash pellets with 1 mL 75% ethanol. 10. Decant wash and remove the remaining 75% ethanol by pipetting (a P200 pipette is recommended); avoid disturbing the pellet. 11. Invert tubes on a paper towel with caps open to air dry pellets for ~5 min. 12. Resuspend pellets in 20–30 μL 10 mM Tris–HCl (pH 8), T low-E (low-EDTA TE), or other comparable buffer. 13. Analyze the size distribution and quantity of ChEC DNA on a TapeStation with a High-Sensitivity D5000 ScreenTape (see Note 10). 14. Proceed to library preparation (see Note 11), sequencing (see Note 12), and data analysis (see Note 13). Figure 3 provides examples of ChEC-Seq profiles.

4

Notes 1. All vectors described are available from Addgene (https:// www.addgene.org/browse/article/16062/). 2. Any broad-spectrum protease inhibitors in tablet or solution form may be used as long as they do not contain EDTA, which chelates Ca2+ ions and will thus inhibit the calcium-dependent cleavage activity of MNase. 3. Stop solution immediately terminates MNase activity via chelation of Ca2+ ions by EGTA and EDTA, as well as denaturation by SDS.

6 kb

ChrXII:55500-118000

400

Abf1 ChEC-seq 0 200

Abf1 CUT&RUN 0 1200

Reb1 ChEC-seq 0 300

Reb1 CUT&RUN 0 400

W1588-4C free MNase 0 250

Med17 ChEC-seq 0 10

MetaMediator ChIP-chip -2 250

BY4705 free MNase 0

Fig. 3 Regulatory landscape of a yeast genomic segment as profiled by ChEC-Seq. Gviz [39] tracks of Abf1, Reb1, and Med17 ChEC-Seq and free MNase data at a representative segment of the yeast genome. Abf1 and Reb1 CUT&RUN data [24] and MetaMediator ChIP-chip data [40] are also shown for comparison. W1588-4Cfree MNase is genetic background matched to the Abf1-MNase and Reb1-MNase strains and BY4705-free MNase is genetic background matched to the Med17-MNase strain. For ChEC-Seq and free MNase data, all time points 1 m were merged following alignment (10–60 s in 10 s intervals for Abf1, Reb1, and W1588-4Cfree MNase; 30 and 60 s for Med17 and BY4705-free MNase). For CUT&RUN data, all time points 128 s were merged (1, 2, 4, 8, 16, 32, 64, and 128 s). Furthermore, only CUT&RUN fragments 120 bp were considered when calculating coverage. MetaMediator ChIP-chip data is shown as the normalized log2 ratio of signal from epitope-tagged Mediator subunits to that from a no-tag strain

298

Moustafa M. Saleh et al.

4. To enable spike-in normalization of ChEC-Seq data, MNasedigested Drosophila DNA can be added to the Stop solution master mix in an amount proportional to the culture’s OD600 [30]. 5. SPRI beads may be purchased (e.g., Ampure XP, Beckman Coulter A63880) or can be generated in-house using SeraMag SpeedBead Carboxylate-Modified Magnetic Particles (GE Life Sciences 45152105050250) as described [41]. 6. Donczew et al. reported that a 5 min incubation using ten-fold less calcium (~0.2 mM) resulted in improved signal and reduced background digestion for ChEC-Seq experiments mapping subunits of the SAGA and TFIID coactivator complexes [30]. 7. In the original ChEC-Seq protocol [27], permeabilization and digestion was performed at 30  C, a standard growth temperature for budding yeast. At short time points, this yields robust cleavage at binding sites for the fusion factor and low, uniform cleavage by free MNase. However, at longer incubation times, decreased specific MNase fusion signal is observed, while free MNase signal increases as it progressively cleaves nucleosomedepleted regions (Fig. 4a, b). These convergent trends in signal change ultimately result in little difference between fusion factor and free MNase at longer time points. We attribute the decrease of MNase fusion signal over time to unbinding of the factor from and subsequent digestion of its target sites, as well as increased nonspecific cleavage of the genome by released fusion molecules. The increase in free MNase signal reflects the preferential digestion of open chromatin by MNase over time. We thus suggest that, in most cases, short digestion times (1 min) will provide the best enrichment of the MNasetagged factor(s) of interest versus free MNase using this protocol. As mentioned in Note 6, longer digestion times with lower calcium may also be used. 8. To save time and pipetting, Proteinase K can also be added to the Stop solution master mix before use. 9. Similar to Note 8, this second extraction can be skipped to save time and pipetting. Instead of extracting the aqueous solution following the first extraction, make a master mix consisting of 2 μL 5 mg/mL linear acrylamide and 1 μL 10 mg/mL RNase A per sample and aliquot 3 μL to the required number of fresh microfuge tubes. Add the aqueous phases directly to these tubes, vortex to mix, and proceed with RNase digestion as in step 9 of Subheading 3.3 before DNA QC and size selection. 10. We recommend analysis of ChEC DNA on a TapeStation or Bioanalyzer instrument, rather than quantification using a fluorescence-based method such as the Qubit because the

Global Profiling of Protein–DNA Interactions with ChEC-Seq

a

Abf1 30 s

-1

0

40

b

free MNase

1m

0

1 -1

80

0

5m

0

80

40

30 s

30

30 s

1m

1 -1

0 0 1 -1 Distance from ATG (kb)

1 -1

0

40

299

80

0

2

4

5m

0

60

2

1m

1 -1

4

60

2

1

4

6

5m Abf1 free MNase

Abf1 free MNase

Abf1 free MNase

0

20

10

0 -1

0

1

-1

0 Distance from ATG (kb)

1

-1

0

1

Fig. 4 Time-dependent changes in ChEC-Seq and free MNase signal. (a) Heatmaps of CPM-normalized Abf1 ChEC-Seq and REB1 promoter-driven free MNase signal at 30 s, 1 min, and 5 min of calcium incubation at 30  C centered on the start codons of 5155 non-mitochondrial verified ORFs). Heatmaps are sorted descending by average signal in each region for the 30 s Abf1 sample. Note the different CPM scales for Abf1 (0–100) and free MNase (0–6). ChEC-Seq signal is high at early time points and decays with longer incubation, while free MNase signal increases over time. (b) Average plots comparing Abf1 ChEC-Seq and free MNase signal at each time point shown in (a), illustrating robust enrichment of Abf1 ChEC-Seq signal over free MNase at shorter time points but little distinction between the two samples at the 5 min time point. All plots are scaled to the same y-axis value to allow comparison across time points. For these heatmaps and average plots, 25 bp paired-end ChEC-Seq reads were not extended to the length of their corresponding fragments when calculating coverage. As the ends of ChEC fragments correspond to sites of MNase cleavage and are thus represented by the first base in each paired-end read, not extending ChEC-Seq reads provides higher resolution information about the location of MNase cleavages versus the information on genomic coverage by MNase-released fragments provided by read extension. In particular, this allows sharper visualization of the cleavage of gene body nucleosome linkers by free MNase at 5 min of calcium incubation

300

Moustafa M. Saleh et al.

small amount of large genomic DNA fragments remaining in the sample following size selection will dominate the total DNA concentration. TapeStation analysis allows quantification of specific size ranges for a more accurate estimate of the quantity of small fragments of interest released during ChEC. 11. ChEC samples can be prepared for sequencing using standard ChIP-Seq-type library preparation protocols. 12. We recommend that samples be sequenced in paired-end mode to retain fragment length information. 13. ChEC-Seq data can be analyzed similarly to ChIP-Seq data using standard bioinformatic tools. We currently use Bowtie2 [42] for alignment with default parameters plus --no-unal --no-mixed --no-discordant --dovetail -I 10 -X 700. This set of parameters (a) disables reporting of unmapped reads; (b) disallows alignment of reads whose mates do not align; (c) prevents alignment of reads not in convergent orientation; (d) allows mate-paired reads to extend past one another (possibly important for short fragments); and (e) limits the allowed mappable fragment size to 10–700 bases. SAM files generated by Bowtie2 alignment are then converted to sorted and indexed BAM files with SAMTools [43]. We then visualize genome coverage as bigWig files with deepTools [44] bamCoverage using counts per million (CPM) normalization. If a spike-in was used, a normalization factor, calculated as 10,000 (an arbitrarily chosen value) divided by the number of reads mapped to the spike-in genome, can be input to the -scaleFactor argument of bamCoverage. Aggregation of signal around features of interest is performed with deepTools computeMatrix and plotHeatmap. For peak calling, we have successfully used both MACS2 [45] and HOMER [46] with default parameters and a free MNase sample as the background control. We have integrated these steps (excepting aggregation of signal around features of interest) into an automated pipeline for ChEC-Seq analysis (https://github.com/ zentnerlab/ZentTools). References 1. Park PJ (2009) ChIP-seq: advantages and challenges of a maturing technology. Nat Rev Genet 10(10):669–680 2. Albert I, Mavrich TN, Tomsho LP, Qi J, Zanton SJ, Schuster SC, Pugh BF (2007) Translational and rotational settings of H2A.Z nucleosomes across the Saccharomyces cerevisiae genome. Nature 446(7135):572–576. https://doi.org/10.1038/nature05632 3. Johnson DS, Mortazavi A, Myers RM, Wold B (2007) Genome-wide mapping of in vivo protein-DNA interactions. Science 316

(5830):1497–1502. https://doi.org/10. 1126/science.1141319 4. Barski A, Cuddapah S, Cui K, Roh T-Y, Schones DE, Wang Z, Wei G, Chepelev I, Zhao K (2007) High-resolution profiling of histone methylations in the human genome. Cell 129(4):823–837. https://doi.org/10. 1016/j.cell.2007.05.009 5. Mikkelsen TS, Ku M, Jaffe DB, Issac B, Lieberman E, Giannoukos G, Alvarez P, Brockman W, Kim T-K, Koche RP, Lee W, Mendenhall E, O’Donovan A, Presser A,

Global Profiling of Protein–DNA Interactions with ChEC-Seq Russ C, Xie X, Meissner A, Wernig M, Jaenisch R, Nusbaum C, Lander ES, Bernstein BE (2007) Genome-wide maps of chromatin state in pluripotent and lineage-committed cells. Nature 448(7153):553–560. http:// www.nature.com/nature/journal/v448/ n7153/suppinfo/nature06008_S1.html. 6. Rhee HS, Pugh BF (2011) Comprehensive genome-wide protein-DNA interactions detected at single-nucleotide resolution. Cell 147(6):1408–1419 7. He Q, Johnston J, Zeitlinger J (2015) ChIPnexus enables improved detection of in vivo transcription factor binding footprints. Nat Biotechnol 33(4):395–401. https://doi.org/ 10.1038/nbt.3121. http://www.nature.com/ nbt/journal/vaop/ncurrent/abs/nbt.3121. html.—Supplementary-information 8. Skene PJ, Henikoff S (2015) A simple method for generating high-resolution maps of genome-wide protein binding. elife 4:e09225. https://doi.org/10.7554/eLife.09225 9. Gutin J, Sadeh R, Bodenheimer N, JosephStrauss D, Klein-Brill A, Alajem A, Ram O, Friedman N (2018) Fine-resolution mapping of TF binding and chromatin interactions. Cell Rep 22(10):2797–2807. https://doi.org/10. 1016/j.celrep.2018.02.052 10. Policastro RA, Zentner GE (2017) Enzymatic methods for genome-wide profiling of protein binding sites. Briefings in Functional Genomics 17(2):138–145. https://doi.org/10.1093/ bfgp/elx030 11. Schwartz YB, Kahn TG, Pirrotta V (2005) Characteristic low density and shear sensitivity of cross-linked chromatin containing polycomb complexes. Mol Cell Biol 25 (1):432–439. https://doi.org/10.1128/mcb. 25.1.432-439.2005 12. Auerbach RK, Euskirchen G, Rozowsky J, Lamarre-Vincent N, Moqtaderi Z, Lefranc¸ois P, Struhl K, Gerstein M, Snyder M (2009) Mapping accessible chromatin regions using Sono-Seq. Proc Natl Acad Sci U S A 106 (35):14926–14931. https://doi.org/10. 1073/pnas.0905443106 ¨ zaydın B, Zill O, Lefranc¸ois P, 13. Teytelman L, O Snyder M, Rine J, Eisen MB (2009) Impact of chromatin structures on DNA processing for genomic analyses. PLoS One 4(8):e6700. https://doi.org/10.1371/journal.pone. 0006700 14. Vega VB, Cheung E, Palanisamy N, Sung W-K (2009) Inherent signals in sequencing-based chromatin-immunoprecipitation control libraries. PLoS One 4(4):e5241. https://doi. org/10.1371/journal.pone.0005241

301

15. Teytelman L, Thurtle DM, Rine J, van Oudenaarden A (2013) Highly expressed loci are vulnerable to misleading ChIP localization of multiple unrelated proteins. Proc Natl Acad Sci U S A 110(46):18602–18607. https://doi. org/10.1073/pnas.1316064110 16. Park D, Lee Y, Bhupindersingh G, Iyer VR (2013) Widespread misinterpretable ChIP-seq bias in yeast. PLoS One 8(12):e83506. https://doi.org/10.1371/journal.pone. 0083506 17. Krebs W, Schmidt SV, Goren A, De Nardo D, Labzin L, Bovier A, Ulas T, Theis H, Kraut M, Latz E, Beyer M, Schultze JL (2014) Optimization of transcription factor binding map accuracy utilizing knockout-mouse models. Nucleic Acids Res 42(21):13051–13060. https://doi.org/10.1093/nar/gku1078 18. Jain D, Baldi S, Zabel A, Straub T, Becker PB (2015) Active promoters give rise to false positive ‘Phantom Peaks’ in ChIP-seq experiments. Nucleic Acids Res 43(14):6959–6968. https://doi.org/10.1093/nar/gkv637 19. van Steensel B, Henikoff S (2000) Identification of in vivo DNA targets of chromatin proteins using tethered Dam methyltransferase. Nat Biotechnol 18(4):424–428 20. Luo SD, Shi GW, Baker BS (2011) Direct targets of the D. melanogaster DSXF protein and the evolution of sexual development. Development 138(13):2761–2771. https://doi.org/ 10.1242/dev.065227 21. Wang H, Johnston M, Mitra RD (2007) Calling cards for DNA-binding proteins. Genome Res 17(8):1202–1209. https://doi.org/10. 1101/gr.6510207 22. Wang H, Mayhew D, Chen X, Johnston M, Mitra RD (2011) Calling Cards enable multiplexed identification of the genomic targets of DNA-binding proteins. Genome Res 21 (5):748–755. https://doi.org/10.1101/gr. 114850.110 23. Schmid M, Durussel T, Laemmli UK (2004) ChIC and ChEC: genomic mapping of chromatin proteins. Mol Cell 16(1):147–157. https://doi.org/10.1016/j.molcel.2004.09. 007 24. Skene PJ, Henikoff S (2017) An efficient targeted nuclease strategy for high-resolution mapping of DNA binding sites. elife 6: e21856. https://doi.org/10.7554/eLife. 21856 25. Ku WL, Nakamura K, Gao W, Cui K, Hu G, Tang Q, Ni B, Zhao K (2019) Single-cell chromatin immunocleavage sequencing (scChICseq) to profile histone modification. Nat

302

Moustafa M. Saleh et al.

Methods 16(4):323–325. https://doi.org/10. 1038/s41592-019-0361-7 26. Kaya-Okur HS, Wu SJ, Codomo CA, Pledger ES, Bryson TD, Henikoff JG, Ahmad K, Henikoff S (2019) CUT&Tag for efficient epigenomic profiling of small samples and single cells. Nat Commun 10(1):1930. https://doi. org/10.1038/s41467-019-09982-5 27. Zentner GE, Kasinathan S, Xin B, Rohs R, Henikoff S (2015) ChEC-seq kinetics discriminates transcription factor binding sites by DNA sequence and shape in vivo. Nat Commun 6:8733. https://doi.org/10.1038/ ncomms9733 28. Gru¨nberg S, Henikoff S, Hahn S, Zentner GE (2016) Mediator binding to UASs is broadly uncoupled from transcription and cooperative with TFIID recruitment to promoters. EMBO J 35(22):2435–2446 29. Bruzzone MJ, Gru¨nberg S, Kubik S, Zentner GE, Shore D (2018) Distinct patterns of histone acetyltransferase and Mediator deployment at yeast protein-coding genes. Genes Dev 32(17–18):1252–1265. https://doi.org/ 10.1101/gad.312173.118 30. Donczew R, Warfield L, Pacheco D, Erijman A, Hahn S (2020) Two roles for the yeast transcription coactivator SAGA and a set of genes redundantly regulated by TFIID and SAGA. elife 9:e50109. https://doi.org/10.7554/ eLife.50109 31. Kubik S, Bruzzone MJ, Challal D, Dreos R, Mattarocci S, Bucher P, Libri D, Shore D (2019) Opposing chromatin remodelers control transcription initiation frequency and start site selection. Nat Struct Mol Biol 26 (8):744–754. https://doi.org/10.1038/ s41594-019-0273-3 32. Gill JK, Maffioletti A, Garcı´a-Molinero V, Stutz F, Soudet J (2020) Fine chromatindriven mechanism of transcription interference by antisense noncoding transcription. Cell Rep 31(5):107612. https://doi.org/10.1016/j.cel rep.2020.107612 33. Foss EJ, Gatbonton-Schwager T, Thiesen AH, Taylor E, Soriano R, Lao U, MacAlpine DM, Bedalov A (2019) Sir2 suppresses transcription-mediated displacement of Mcm2-7 replicative helicases at the ribosomal DNA repeats. PLoS Genet 15(5):e1008138. https://doi.org/10.1371/journal.pgen. 1008138 34. Chapal M, Mintzer S, Brodsky S, Carmi M, Barkai N (2019) Resolving noise–control conflict by gene duplication. PLoS Biol 17(11): e3000289. https://doi.org/10.1371/journal. pbio.3000289

35. Brodsky S, Jana T, Mittelman K, Chapal M, Kumar DK, Carmi M, Barkai N (2020) Intrinsically disordered regions direct transcription factor in vivo binding specificity. Mol Cell 79:459-471.e4. https://doi.org/10.1016/j. molcel.2020.05.032 36. Albert B, Tomassetti S, Gloor Y, Dilg D, Mattarocci S, Kubik S, Hafner L, Shore D (2019) Sfp1 regulates transcriptional networks driving cell growth and division through multiple promoter-binding modes. Genes Dev 33 (5-6):288–293. https://doi.org/10.1101/ gad.322040.118 37. Foss EJ, Sripathy S, Gatbonton-Schwager T, Kwak H, Thiesen AH, Lao U, Bedalov A (2020) Chromosomal Mcm2-7 distribution is the primary driver of the genome replication program in species from yeast to humans. bioRxiv. https://doi.org/10.1101/737742 38. Strobino M, Wenda JM, Steiner FA (2019) Loss of histone H3.3 results in DNA replication defects and altered origin dynamics in C. elegans. bioRxiv. https://doi.org/10. 1101/854455 39. Hahne F, Ivanek R (2016) Visualizing genomic data using Gviz and bioconductor. In: Mathe´ E, Davis S (eds) Statistical genomics: methods and protocols. Springer, New York, NY, pp 335–351. https://doi.org/10.1007/ 978-1-4939-3578-9_16 40. Jeronimo C, Langelier M-F, Bataille Alain R, Pascal John M, Pugh BF, Robert F (2016) Tail and kinase modules differently regulate core mediator recruitment and function in vivo. Mol Cell 64(3):455–466. https://doi.org/ 10.1016/j.molcel.2016.09.002 41. Rohland N, Reich D (2012) Cost-effective, high-throughput DNA sequencing libraries for multiplexed target capture. Genome Res 22(5):939–946. https://doi.org/10.1101/gr. 128124.111 42. Langmead B, Salzberg SL (2012) Fast gappedread alignment with Bowtie 2. Nat Methods 9 (4):357–359. https://doi.org/10.1038/ nmeth.1923. http://www.nature.com/ nmeth/journal/v9/n4/abs/nmeth.1923. html.—Supplementary-information 43. Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, Durbin R, Subgroup GPDP (2009) The sequence alignment/map format and SAMtools. Bioinformatics 25(16):2078–2079. https://doi.org/10.1093/bioinformatics/ btp352 44. Ramı´rez F, Ryan DP, Gru¨ning B, Bhardwaj V, Kilpert F, Richter AS, Heyne S, Du¨ndar F, Manke T (2016) deepTools2: a next

Global Profiling of Protein–DNA Interactions with ChEC-Seq generation web server for deep-sequencing data analysis. Nucleic Acids Res 44(W1): W160–W165. https://doi.org/10.1093/ nar/gkw257 45. Zhang Y, Liu T, Meyer CA, Eeckhoute J, Johnson DS, Bernstein BE, Nusbaum C, Myers RM, Brown M, Li W, Liu XS (2008) Modelbased analysis of ChIP-Seq (MACS). Genome Biol 9(9):R137

303

46. Heinz S, Benner C, Spann N, Bertolino E, Lin YC, Laslo P, Cheng JX, Murre C, Singh H, Glass CK (2010) Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities. Mol Cell 38 (4):576–589. https://doi.org/10.1016/j. molcel.2010.05.004

Part VI Functional Analysis

Chapter 17 Transcriptional Activation of Heterochromatin by Recruitment of dCas9 Activators Lukas Frank, Robin Weinmann, Fabian Erdel, Jorge Trojanowski, and Karsten Rippe

1

Introduction Pericentric heterochromatin (PCH) in mouse cells is a prototypic example of a transcriptionally silenced heterochromatin state [1, 2]. It represents a large chromatin domain that is formed by pericentric major satellite repeat (MSR) sequences and is characterized by repressive epigenetic marks like DNA methylation and trimethylation of histone H3 at lysine 9 (H3K9me3). The increased DNA density and high A/T content of these regions leads to an intense DAPI staining of PCH domains and their designation as “chromocenters.” Moreover, several chromosomal proteins are enriched that include heterochromatin protein 1 (HP1) as a marker recognizing H3K9me3 via its chromodomain. The MSR sequences are silenced in differentiated cells like fibroblasts but are more actively transcribed in pluripotent cells or in fibroblasts lacking the H3K9me3 methyltransferases Suv39h1 and Suv39h2 [3– 5]. Silenced chromocenters can be re-activated by recruitment of suitable activators. Here, we use the synthetic tripartite activator VPR (VP64-p65-Rta) for this purpose [6]. VPR contains transcription activation domains from the herpes simplex virus VP16 protein, the Epstein–Barr virus Rta protein and the human p65 transcription factor. As shown previously, VPR fused to dCas9 can decondense PCH upon recruitment [7]. This process is accompanied by an accumulation of acetylation of histone H3 at lysine

Supplementary Information The online version of this chapter (https://doi.org/10.1007/978-1-0716-15973_17) contains supplementary material, which is available to authorized users. Tilman Borggrefe and Benedetto Daniele Giaimo (eds.), Enhancers and Promoters: Methods and Protocols, Methods in Molecular Biology, vol. 2351, https://doi.org/10.1007/978-1-0716-1597-3_17, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

307

308

Lukas Frank et al.

27 (H3K27ac) and binding of active RNA polymerase II (RNAPII) phosphorylated at serine 5. The methods described here comprise the recruitment of VPR via dCas9 labeled with green fluorescent protein (GFP) as a dCas9-GFP-VPR fusion construct and a mock control (dCas9-GFP) to MSR sequences (Fig. 1a). As a cellular system mouse fibroblast are used and the analysis of the activation process at chromocenters is conducted via fluorescence microscopy. The image features analyzed include DNA decondensation visualized by DAPI staining and changes in acetylation of histone H3 at lysine 27 (H3K27ac) detected by immunostaining. A set of R analysis scripts is provided that enables automated image segmentation, curation of segmentation results, and plotting parameters for decondensation and H3K27ac enrichment at PCH (Fig. 1b–d). The purely microscopy-based analysis described in the present protocol can be complemented by readouts for bulk PCH transcription. We and others have successfully used qRT-PCR on MSR RNA to measure differences in mouse PCH silencing between cell lines and/or genotypes [4, 5]. Combining MSR RNA qRT-PCR with dCas9-based activation allows it to directly correlate transcriptional output with chromocenter state changes. Furthermore, by changing dCas9 fusion constructs, guide RNA sequences or immunostaining antibodies, the approach described here can be extended to study other chromatin features or loci. For instance, immunostaining against phosphorylation of RNAP II at serine 5 [7] or RNA FISH against MSR RNA [3] can be used to monitor active transcription in single cells comparing unperturbed to perturbed chromocenters. Finally, our protocol can be adapted to study functional principles of chromatin changes due to transcriptional activation or silencing at other chromatin loci given that they can be efficiently targeted with dCas9 constructs and are suitable for microscopy readouts like (sub)telomeres [8, 9], endogenous repetitive chromosome regions found at some genes [10, 11], or artificial gene arrays [12, 13].

2 2.1

Materials Plasmids

1. In the dCas9-GFP vector (“dCas9-mock”), the dCas9 open reading frame derived from Addgene plasmid #60910 was cloned into a pEGFP-N1 backbone (Clontech) carrying the sequence for the enhanced GFP. 2. For the dCas9-GFP-VPR plasmid, the coding sequence for VPR from Addgene plasmid #63798 was inserted downstream of the coding sequence for dCas9-GFP. 3. The plasmid encoding for different single guide RNAs (sgRNAs) was derived from Addgene plasmid #61424. The sgRNA targeting region for MSRs was 50 - GGGCAA GAAAACTGAAAATCA-30 .

Heterochromatin Activation by dCas9-VPR

a

309

Chromocenter dCas9-VPR

Active & decondensed

Silenced & condensed

dCas9-GFP

DNA (DAPI)

dCas9-GFP-VPR

DNA (DAPI)

Activation

b

Step 1: SegmentCC 3-channel image

Nucleus Chromocenter (CC) Nucleoplasm (NP)

Blurring & filtering

Intensity, area & shape quantification dCas9 dCas9

DAPI

DAPI

Marker

Marker

dCas9

Nucleus & chromocenter masks

c

Step 2: CurateCC

d

Step 3: PlotCC

Position 1 cell 1

Chromocenter enrichment

Cell 2

Intensity CC/NP

6 5 4 3 2 1

...

DAPI

dCas9

Marker

Semi-automated data curation

Fig. 1 Workflow for the fluorescence microscopy-based analysis of chromocenter changes upon dCas9-VPR recruitment. (a) Recruitment of mock activator dCas9-GFP to MSRs in mouse fibroblasts does not affect chromocenter integrity (left). In contrast, the activator dCas9-GFP-VPR induces chromocenter decondensation

310

Lukas Frank et al.

2.2 Cell Culture and Transfection

1. Immortalized mouse embryonic fibroblast (iMEFs) (see Note 1). 2. Sterile 12 mm round uncoated glass coverslips to be placed in a standard plastic 24-well cell culture plate. 3. Complete medium: 4.5 g/L DMEM medium without phenolred (Gibco) supplemented with 10% tetracycline free fetal calf serum (FCS) (PAN Biotech), 2 mM L-glutamine (PAN Biotech), 1% penicillin/streptomycin (PAN Biotech). 4. Phosphate-buffered saline (PBS). 5. 0.05% trypsin/0.02% EDTA (Gibco) in PBS. 6. Opti-MEM I reduced serum medium (Gibco). 7. Lipofectamine Scientific).

3000

transfection

kit

(Thermo

Fisher

8. 1.5 mL DNA low binding tubes (Sarstedt). 2.3 DAPI and Immunostaining

1. 4% paraformaldehyde in PBS. 2. 0.2% Triton X-100 in PBS. 3. 0.002% NP-40 in PBS. 4. Blocking buffer: 10% goat serum (Cell Signaling Technology) in PBS. 5. Rabbit polyclonal anti-H3K27ac antibody (Abcam). 6. Goat polyclonal anti-rabbit IgG/Alexa Fluor 568 (Thermo Fisher Scientific). 7. DAPI staining solution (Abcam). 8. Prolong diamond antifade mountant without DAPI (Thermo Fisher Scientific).

2.4

Microscope

For imaging at high resolution, a confocal microscope with appropriate image acquisition software is recommended. We have used an Andor Dragonfly 505 spinning disk microscope equipped with the following parts:

ä Fig. 1 (continued) as reflected by loss of DAPI enrichment and inflated chromocenter area/volume (right). (b–d) R image analysis pipeline (see steps 1–3, Subheading 3.6) to quantify features of chromocenters upon dCas9-mediated PCH activation from fluorescence microscopy images. Scale bars, 5 μm. (b) SegmentCC segments nuclei and chromocenters and generates a set of binary masks (nucleus, chromocenters, nucleoplasm) for subsequent image intensity, nucleus shape, and area quantifications (Subheading 3.6.1). Analysis of DNA/DAPI, dCas9 channel and one additional “marker” channel is implemented. Here, H3K27 acetylation immunostaining was used as an exemplary mark that correlated well with VPR-mediated chromocenter decondensation [7]. (c) CurateCC provides a semi-automated way to manually inspect and filter output files from SegmentCC (Subheading 3.6.2). (d) The (optional) PlotCC script contains exemplary plotting routines for visualization and normalization of data obtained from SegmentCC/CurateCC (Subheading 3.6.3). See text for details

Heterochromatin Activation by dCas9-VPR

311

1. 100/1.35 silicone immersion objective. 2. iXon EMCCD camera. 3. 405 nm laser to image DAPI-stained DNA as a measure for chromocenter compaction. 4. 488 nm laser to image GFP-tagged dCas9 effector constructs. 5. 561 nm or 637 nm laser to image additional markers labeled by fluorescent antibody-staining (e.g., Alexa568, Alexa633). 2.5

Software

1. R (version 3.6.0) [14]. 2. RStudio (version 1.2.1335) [15]. 3. R packages EBImage (version 4.26.0) [16], abind (version 1.4.5). 4. Custom R functions “makeChromocenterMask” and “makeNucMask”, available in the Supplementary Materials. 5. The Fiji distribution 2.0.0 [17] of ImageJ [18] for general purpose image analysis and pre-processing.

3

Methods

3.1 Transfection of dCas9 Constructs

1. iMEF cells are maintained at standard cell culture conditions (37  C and 5% CO2) and split (1:6 to 1:10) every 3–4 days. They can be frozen in DMEM complete medium supplemented with 10% DMSO and 40% FCS for storage in liquid nitrogen or at 150  C. 2. On day 0, seed iMEF cells (see Note 1) on 12 mm round glass coverslips in a 24-well plate in 1 mL medium at a density of 5  104 per well. 3. On day 1, prepare lipofectamine 3000 transfection mixes in a DNA low binding tube, according to the manufacturer’s instructions. Cells should be ~50–70% confluent for optimal transfection efficiency. Co-transfect cells with a 1:1 mass ratio of dCas9-VPR/dCas9-mock and sgRNA plasmid targeting MSRs. When using the lipofectamine 3000 transfection kit, we typically dilute 2 μL of lipofectamine 3000 in 25 μL pre-warmed Opti-MEM medium. In a separate tube, 0.5 μL P3000 reagent are combined with 25 μL Opti-MEM and 1 μg plasmid DNA. Both are left to incubate for 5 min at room temperature, then combined together and incubated another 10 min, before being added to the cells in a drop-wise manner. Typically, 1 μg of plasmid DNA is transfected per well (24-well). 4. 4–5 h after transfection: exchange medium with fresh pre-warmed medium.

312

Lukas Frank et al.

5. 30 h after transfection, wash three times with PBS and fix cells with 4% paraformaldehyde in PBS for 15 min at room temperature (RT). 6. Wash three times with PBS. Stop point: If desired, cells can be stored in PBS at 4  C for up to 3 days in the dark. Alternatively, continue with Subheading 3.2. 3.2 DAPI and Immunostaining

This part starts with fixed cells prepared as described in Subheading 3.1. 1. Permeabilize cells with 0.2% Triton X-100 in PBS for 12 min at RT and wash three times with PBS for 5 min. 2. Incubate with blocking buffer for at least 1 h at RT. 3. Incubate cells with primary antibodies diluted to the appropriate concentration in blocking buffer (1:500 for rabbit antiH3K27ac used here) for at least 1 h at RT by placing coverslips face-down on 30 μL drops of antibody solution on parafilm. Cover the samples to protect them from light and drying out. 4. Wash three times with 0.002% NP-40 in PBS for 5 min. 5. Incubate cells with fluorescently labeled secondary antibodies diluted in blocking buffer for at least 1 h at RT in the dark (as described in step 3 of this section). We typically use a 1:300 dilution in blocking buffer for standard fluorescently labeled secondary antibodies. Minimize light exposure for all subsequent steps. 6. Wash three times with PBS for 5 min in the dark and stain DNA with DAPI (1 μM DAPI in PBS) for 15 min at RT in the dark (see Note 2). 7. Rinse coverslips three times with PBS and once with distilled water, then dehydrate in 100% ethanol for 1 min in the dark. 8. Transfer the coverslips to a clean tissue paper and air-dry them for 5–10 min (cell side up) before mounting them on glass slides with an appropriate mounting medium (e.g., prolong diamond), which preserves fluorescence signals of both Alexatype dyes and proteins like GFP. 9. Dry mounted samples for up to 24 h in the dark. Seal with nail polish (optional). 10. Store slides at 4  C in the dark until use.

3.3 Image Acquisition

Imaging routines depend on the dCas9 construct transfection efficiency (GFP channel) for a particular sample to record enough images of fixed and stained iMEF cells that have dCas9 recruitment to PCH/chromocenters. With the protocol described here, transfection efficiencies of 5–10% are typically observed, yielding between 50–150 usable cells per coverslip (1–3 cells per image

Heterochromatin Activation by dCas9-VPR

313

position using a 100 objective). For efficient imaging, position lists comprising regions of interest (ROI) with a high density of transfected cells can be defined manually after recording lower resolution overview images or by specific “targeted microscopy” imaging workflows [19]. These position lists can then be used to automatically acquire multichannel stacks in the corresponding ROIs. Alternatively, tile-scan based imaging may be used. For typical three-channel experiment with (a) DAPI, (b) transfected dCas9-GFP constructs, and (c) H3K27ac immunostaining in iMEFs it is recommended to record 10 μm z-stacks with a step size of 0.2 μm. Depending on the objective, focus stability, sample planarity, and cell type-specific cell volume, the observation volume and z-step size can be reduced to increase throughput. In the examples shown here, images were acquired as 16-bit TIF images with dimensions of 1024  1024 pixels and a pixel size of 0.13 μm per pixel. 3.4 Imaging-Based Analysis of PCH Activation Features

The imaging experiments described above result in a series of multichannel, multi-slice image stacks. In the following sections, an automated strategy for segmentation-based quantification of chromocenter features (DAPI, H3K27ac enrichment, area) is summarized according to the general workflow depicted in Fig. 1.

3.5 Pre-processing of Confocal Images in Fiji

The default output from the Andor Dragonfly microscope are multichannel z-stacks stored in the Imaris-Software (.IMS) file format. For image analysis in R, the IMS format needs to be converted into 16-bit TIF images. If available, this can be carried out within the Imaris or Andor software. Alternatively, the open access Fiji distribution of ImageJ can be used for this task. Conversion requires Fiji version 2.0.0 (or later) and version 5.2.0 (or later) of the netcdfAll plugin. The conversion step in Fiji can also be used to directly generate maximum intensity z-projections for the subsequent analysis in R Studio.

3.6 Automated Analysis of Confocal Images in R Studio

Figure 1a shows a typical chromocenter state transition from a condensed to a decondensed state upon recruitment of the dCas9-GFP-VPR activator to MSRs in iMEFs. Activation alters chromocenter appearance to a more decondensed and fibrous state (dCas9 channel), accompanied by reduction of DNA density (DAPI channel). The workflow depicted in Fig. 1b–d can be used to automatically quantify these feature changes on microscopy images. The image analysis is conducted using three R scripts that are applied sequentially and comprise the following steps: 1. Segmentation of nuclei and PCH/chromocenters of dCas9transfected cells and intensity quantifications applied on the segmentation masks [R script “SegmentCC” and associated functions “makeNucMask()”, “makeChromocenterMask()”].

314

Lukas Frank et al.

2. Semi-automated curation of segmented images (“CurateCC” R script). 3. Filtering and visualization of image features quantified (“PlotCC” R script). Example scripts are provided in the supplementary materials that also include a set of sample TIF images for testing the workflow. The scripts are also available at https://github.com/ RippeLab/Chromocenters. The image analysis is performed in RStudio [15] and is mainly based on the EBImage package [16]. We provide additional functions for segmentation of nuclei and chromocenters (makeNucMask(), makeChromocenterMask()). Details of the analysis workflow are included within the example script comments. Parameters for segmentation and filtering are specified in the head section of each script and may need adjustment for images acquired with different settings. As an input for the analysis scripts, we use multichannel maximum intensity z-projections. The type of projection depends on the user’s biological question and needs to be adapted appropriately for quantifying or comparing absolute image intensities (e.g., to mean/median intensity projection or other types). In the analysis described here, the focus is on quantifying the area changes of chromocenters as a measure for decondensation as well as on retrieving some relative measures of DNA signal (DAPI) and H3K27ac enrichment at dCas9-bound chromocenters from the underlying images. Based on this specific question and the flat morphology of mouse fibroblast cells, a maximum intensity z-projection is suitable to extract the relevant features. 3.6.1 Nuclei and Chromocenter Segmentation using SegmentCC

The SegmentCC script uses the two externally defined functions named makeNucMask and makeChromocenterMask to segment nuclei and chromocenters/PCH foci on images, respectively (Fig. 1b). First, the maximum z-projections are read, blurred, and nuclear masks are generated based on a user-defined thresholding offset handed over to the EBImage adaptive thresholding function thresh() (Fig. 1b, left). In the head section of the script, the user can specify which channel to use for nuclear segmentation (e.g., DAPI or H3K27ac or any other uniform nuclear signal). Moreover, SegmentCC provides optional filtering for image border nuclei and nucleus size. After nuclei segmentation, mean nuclear intensities are measured for each channel, thereby automatically identifying dCas9-expressing cells based on a user-defined cutoff criterion (default setting: mean dCas9 nuclear intensity > 1.5 * median of the dCas9 image intensity). Then, the script proceeds in computing chromocenter (CC) masks only for the dCas9-positive cells in the dCas9 channel (Fig. 1b, right). The threshold above which pixels are considered to belong to a dCas9-bound chromocenter is

Heterochromatin Activation by dCas9-VPR

315

handed over to the makeChromocenterMask function, which returns smoothened and hole-free binary masks. The chromocenter threshold is given by the formula: median(nuclear dCas9 intensity) + sat_cutoff * [maximum(nuclear dCas9 intensity)-median(nuclear dCas9 intensity)]. The parameter sat_cutoff (0.1 by default) can be adjusted in the head section to fine-tune segmentation stringency (see Note 3). The inverse of the chromocenter mask (nucleoplasm mask, NP) is also created and later used for computing intensity enrichment scores relative to the nuclear background (Fig. 1b, top right). SegmentCC quantifies mean intensities, standard deviation, and areas for all masks throughout all channels. Furthermore, the script provides additional outputs like the number of chromocenter masks per nucleus, nuclear shape features, and xy-positions of all nuclei. The latter are required for the subsequent curation of segmented images (Fig. 1c) and optionally enables user-defined search and filtering to exclude aberrantly shaped nuclei or artifacts from the analysis (not discussed here). Besides summarizing the quantification results as data table, SegmentCC also exports RGB mask overlay TIF images for all three channels for visualization (as depicted in Fig. 1b). These images are also required for the subsequent curation of segmentation results (Fig. 1c). In the following, the use and output formats of the SegmentCC script are described. Please refer to the comments within the script for further details. 1. In the head section of the script, define the location of the input folder containing the 3-channel image z-projections (16-bit TIF files, 1024  1024 pixels) for segmentation. Ensure that the channel order is dCas9, DAPI, and marker channel (here H3K27ac, ac). Sample images are provided for a test run. 2. Run the script with default settings for the adjustable parameters (head section). 3. SegmentCC will generate a results folder within the input folder named “date_time_segmentCC_results” and containing the following files: (a) RGB image mask overlays (e.g., FILENAME_dcas9_with_masks.tif) for each channel of each processed image position. (b) A list of the image positions (file names) processed in this run (_positions.csv). (c) A table of the adjustable parameter values used in this particular run. (_segmentation_parameters.csv). (d) Summary of position-associated nucleus xy-coordinates and shape features (_nucleus_shape_features.csv). (e) Intensity and area quantifications for the segmented masks in all channels (_mean_sd_projection.csv).

316

Lukas Frank et al.

4. Manually inspect the segmentation results (RGB image overlays). If not satisfactory, rerun the script, manually adjusting the initial parameters (head section). 3.6.2 Semi-Automated Curation of Segmented Images using CurateCC

The R script CurateCC reads results files from the SegmentCC script, displays the segmentation results (RGB mask overlays for DAPI and dCas9 channel) in the RStudio plot window, and asks for a quality assessment by the user through the console (Fig. 1c). 1. Specify the location of the input folder (SegmentCC results folder) in the head section and run the CurateCC script. 2. Evaluate the segmentation of the currently displayed image by following the instructions in the console window: “Take segmentation as is? yes: y no: n”. Selecting “y” will evaluate every segmentation result on this image as good (g) and proceed to the next image. Selecting “n” will allow the user to annotate every single segmented cell as good(g) or bad(b) based on the subjective quality of the segmentation or other user-defined criteria. 3. CurateCC creates a results folder (date_time_curateCC_results) within the specified SegmentCC results folder and the file “mean_sd_projection_curated.csv”. The file contains the same information as mean_sd_projection.csv (generated by SegmentCC) but with an additional annotation column (“g”, “b” – or “n” for cells without chromocenter segmentation).

3.6.3 Plotting Measured Parameters of Chromocenter Activation with PlotCC

After quantification and curation of the extracted image features, the result table data (.csv tables) can be plotted with any tool of choice (e.g., Excel, RStudio, GraphPad). The R script PlotCC provides some exemplary strategies to plot (a) mean nuclear intensity, (b) enrichment of factors at PCH foci/chromocenters, and (c) relative PCH foci/chromocenter area (Fig. 1d). In our hands, the latter two have proven as robust measures for correlating chromocenter decondensation with specific changes of interest (e.g., increase in H3K27ac) [7]. Example plots are provided for the 3-channel experiment discussed above (DAPI, dCas9, H3K27ac) where dCas9-GFP-VPR and dCas9-GFP (mock) are recruited to PCH (Fig. 2). Instructions for using the (optional) PlotCC script are given below: 1. In the head section of the plotCC script, specify the location of the curated results table (curateCC output folder) and decide whether to include/exclude certain cells based on their previously annotated segmentation quality (parameter “cell_filter”). 2. Run the script. 3. plotCC will create and save three boxplots (median +/ upper and lower quartile of analyzed cell population) as PDFs in the curateCC results folder:

Heterochromatin Activation by dCas9-VPR

Mock control

317

Activation Chromatin state change

dCas9

H3K27ac CC area Nuclear CC area (%)

Intensity CC/NP

Enrichment chromocenters 2

1

40 30 20 10

dCas9-VPR

H3K27ac

Enrichment chromocenters

50

0 DAPI dCas9 H3K27ac

DAPI

6

CC area Nuclear CC area (%)

dCas9

Intensity CC/NP

DAPI

dCas9-VPR

5 4 3 2

50 40 30 20 10 0

1 DAPI dCas9 H3K27ac

Fig. 2 Analysis results of chromocenter activation by dCas9-VPR. Changes of PCH features are obtained from quantitating cells transfected with the dCas9-GFP mock activator (left) as a baseline reference and compared to a similarly sized data set of dCas9-GFP-VPR transfected cells (right). Representative images for both experimental conditions are shown with overlaid segmentation masks for DAPI, dCas9-GFP/dCas9-GFP-VPR, and H3K27ac channel marking chromocenters (CC, blue outline), nucleoplasm (NP, red shading), nucleus (yellow outline). The image analysis results and output from PlotCC are shown at the bottom for dCas9-GFP (n ¼ 21, left) and dCas9-GFP-VPR (n ¼ 15, right)

(a) “Average nuclear levels”: Mean absolute nuclear intensities in all three channels of the cells analyzed. The absolute nuclear intensities give a first impression of signal heterogeneity between single cells and can be used to group cells into, e.g., low/medium/high level fractions. (b) “Enrichment in CC over NP”: Depicts the mean intensity in chromocenter masks (CC) divided by the mean intensity in the nucleoplasm mask (NP) for the analyzed cells. This ratio (or enrichment score) reflects to which extent a certain signal is enriched (>1), not enriched (0) or depleted (40% of the nuclear area (Fig. 2, right) [7].

4

Notes 1. The iMEF cells are convenient to culture and have a clearly visible and compact chromocenter morphology. They are maintained at standard cell culture conditions (37  C and 5% CO2) and split (1:6 to 1:10) every 3–4 days. For storage, iMEFs can be frozen in DMEM complete medium supplemented with 10% DMSO and 40% FCS in liquid nitrogen or at 150  C. 2. We recommend performing a separate DAPI staining before mounting instead of using DAPI-containing mounting medium (e.g., prolong diamond with DAPI) since the latter can sometimes result in cell density-dependent DAPI staining efficiency. 3. The threshold formula may need adjustment for optimal ROI segmentation as it depends on the nuclear pixel intensity distribution in the dCas9 channel. For cases where the majority of the nuclear area is covered by dCas9-bound regions with high pixel intensity, the median fails as an estimate of the nuclear background. For such cases, it is recommended to try other nuclear background estimates, e.g., the 30% quantile of nuclear pixel intensity in the dCas9 channel.

Acknowledgments This work was funded by the Deutsche Forschungsgemeinschaft (DFG) Priority Program 2191 “Molecular Mechanisms of Functional Phase Separation” via grant RI1283/16-1 and the START-

Heterochromatin Activation by dCas9-VPR

319

HD project of the HMLS program of the University of Heidelberg. Data storage at SDS@hd was supported by the Ministry of Science, Research and the Arts Baden-Wu¨rttemberg (MWK) and the DFG through grants INST 35/1314-1 FUGG and INST 35/ 1503-1 FUGG. References 1. Probst AV, Almouzni G (2008) Pericentric heterochromatin: dynamic organization during early development in mammals. Differentiation 76(1):15–23. https://doi.org/10.1111/j. 1432-0436.2007.00220.x 2. Fodor BD, Shukeir N, Reuter G, Jenuwein T (2010) Mammalian Su(var) genes in chromatin control. Annu Rev Cell Dev Biol 26:471–501. https://doi.org/10.1146/annurev.cellbio. 042308.113225 3. Probst AV, Okamoto I, Casanova M, El Marjou F, Le Baccon P, Almouzni G (2010) A strand-specific burst in transcription of pericentric satellites is required for chromocenter formation and early mouse development. Dev Cell 19(4):625–638. https://doi.org/10. 1016/j.devcel.2010.09.002 4. Muller-Ott K, Erdel F, Matveeva A, Mallm JP, Rademacher A, Hahn M, Bauer C, Zhang Q, Kaltofen S, Schotta G, Hofer T, Rippe K (2014) Specificity, propagation, and memory of pericentric heterochromatin. Mol Syst Biol 10(8):746. https://doi.org/10.15252/msb. 20145377 5. Tosolini M, Brochard V, Adenot P, Chebrout M, Grillo G, Navia V, Beaujean N, Francastel C, Bonnet-Garnier A, Jouneau A (2018) Contrasting epigenetic states of heterochromatin in the different types of mouse pluripotent stem cells. Sci Rep 8(1):5776. https:// doi.org/10.1038/s41598-018-23822-4 6. Chavez A, Scheiman J, Vora S, Pruitt BW, Tuttle M, PRI E, Lin S, Kiani S, Guzman CD, Wiegand DJ, Ter-Ovanesyan D, Braff JL, Davidsohn N, Housden BE, Perrimon N, Weiss R, Aach J, Collins JJ, Church GM (2015) Highly efficient Cas9-mediated transcriptional programming. Nat Methods 12 (4):326–328. https://doi.org/10.1038/ nmeth.3312 7. Erdel F, Rademacher A, Vlijm R, Tunnermann J, Frank L, Weinmann R, Schweigert E, Yserentant K, Hummert J, Bauer C, Schumacher S, Al Alwash A, Normand C, Herten DP, Engelhardt J, Rippe K (2020) Mouse heterochromatin adopts digital compaction states without showing hallmarks of HP1-driven liquid-liquid phase

separation. Mol Cell 78(2):236–249.e237. https://doi.org/10.1016/j.molcel.2020.02. 005 8. Le Berre G, Hossard V, Riou JF, GuieyssePeugeot AL (2019) Repression of TERRA expression by subtelomeric DNA methylation is dependent on NRF1 binding. Int J Mol Sci 20(11):2791. https://doi.org/10.3390/ ijms20112791 9. Brane AC, Tollefsbol TO (2019) Targeting telomeres and telomerase: studies in aging and disease utilizing CRISPR/Cas9 technology. Cell 8(2):186. https://doi.org/10. 3390/cells8020186 10. Qin P, Parlak M, Kuscu C, Bandaria J, Mir M, Szlachta K, Singh R, Darzacq X, Yildiz A, Adli M (2017) Live cell imaging of low- and non-repetitive chromosome loci using CRISPR-Cas9. Nat Commun 8:14725. https://doi.org/10.1038/ncomms14725 11. Chen B, Gilbert LA, Cimini BA, Schnitzbauer J, Zhang W, Li GW, Park J, Blackburn EH, Weissman JS, Qi LS, Huang B (2013) Dynamic imaging of genomic loci in living human cells by an optimized CRISPR/ Cas system. Cell 155(7):1479–1491. https:// doi.org/10.1016/j.cell.2013.12.001 12. Janicki SM, Tsukamoto T, Salghetti SE, Tansey WP, Sachidanandam R, Prasanth KV, Ried T, Shav-Tal Y, Bertrand E, Singer RH, Spector DL (2004) From silencing to gene expression: real-time analysis in single cells. Cell 116 (5):683–698. https://doi.org/10.1016/ s0092-8674(04)00171-0 13. Rademacher A, Erdel F, Trojanowski J, Schumacher S, Rippe K (2017) Real-time observation of light-controlled transcription in living cells. J Cell Sci 130(24):4213–4224. https://doi.org/10.1242/jcs.205534 14. R Core Team (2013) R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria 15. RStudio Team (2015) RStudio: Integrated Development for R. RStudio, Inc., Boston, MA 16. Pau G, Fuchs F, Sklyar O, Boutros M, Huber W (2010) EBImage—an R package for image

320

Lukas Frank et al.

processing with applications to cellular phenotypes. Bioinformatics 26(7):979–981. https:// doi.org/10.1093/bioinformatics/btq046 17. Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, Preibisch S, Rueden C, Saalfeld S, Schmid B, Tinevez JY, White DJ, Hartenstein V, Eliceiri K, Tomancak P, Cardona A (2012) Fiji: an opensource platform for biological-image analysis. Nat Methods 9(7):676–682. https://doi.org/ 10.1038/nmeth.2019

18. Schneider CA, Rasband WS, Eliceiri KW (2012) NIH Image to ImageJ: 25 years of image analysis. Nat Methods 9(7):671–675 19. Gunkel M, Chung I, Worz S, Deeg KI, Simon R, Sauter G, Jones DTW, Korshunov A, Rohr K, Erfle H, Rippe K (2017) Quantification of telomere features in tumor tissue sections by an automated 3D imaging-based workflow. Methods 114:60–73. https://doi.org/10.1016/j. ymeth.2016.09.014

Chapter 18 Deletion of Regulatory Elements with All-in-One CRISPRCas9 Vectors Ineˆs Cebola

1

Introduction The CRISPR-Cas9 system is now a well-established lab tool to edit virtually any genomic sequence in human cells and model systems. In addition to random indel insertions, CRISPR-mediated activation (CRISPRa) (see Chapter 17) and inhibition (CRISPRi), CRISPR-Cas9 can be applied to study CREs via full deletion of the element, by delivering pairs of single guide RNAs (sgRNAs) to cells of interest. As the lexicon of CREs is still not fully understood, large defined deletions are often better suited to study their function than short indels [1–3]. The generation of large deletions with CRISPR-Cas9 can be facilitated by the co-expression of two sgRNAs from a single expression vector. In the past, different strategies were proposed to clone pairs of sgRNAs into expression vectors, namely for fast generation of CRISPR-Cas9 deletion libraries [4, 5]. However, those methods rely on synthesis of long oligonucleotides (>100 nt) that already contain two sgRNAs, which does not allow repurposing of oligonucleotides in alternative experimental designs. Repurposing of sgRNAs to generate multiple deletions of the same CRE may prove a cost-effective experimental design to yield robust perturbation data, following a similar logic to the delivery of multiple siRNAs against a gene to demonstrate on-target rather than off-target effects ([6], see Note 1). Here, I describe a protocol to delete CREs using dual sgRNA CRISPRCas9 vectors, providing an overview of the experimental design and an inexpensive single-step dual sgRNA cloning protocol method, in which each sgRNA is provided by a different oligonucleotide

Tilman Borggrefe and Benedetto Daniele Giaimo (eds.), Enhancers and Promoters: Methods and Protocols, Methods in Molecular Biology, vol. 2351, https://doi.org/10.1007/978-1-0716-1597-3_18, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

321

322

Ineˆs Cebola

Fig. 1 One-step dual cloning protocol overview. As an example, dual sgRNA cloning into the pSpCas9(BB)T2A-HygR backbone (Addgene #118153) is shown. RE restriction enzyme

(Fig. 1), enabling their repurposing in different deletions (Fig. 2, see Note 1). This protocol involves pairing of two sgRNAs during a PCR that uses as template a vector containing an sgRNA scaffold and a H1 promoter sequence (Fig. 1, see Note 2). This PCR amplicon is then digested and ligated into a CRISPR-Cas9 expression vector of choice (see Note 3) in a single reaction. The ligation products can be directly used for transformation of chemically competent bacteria, followed by confirmation by Sanger sequencing. The resulting vectors can be used in downstream protocols for CRISPR-Cas9 targeting, which are cell type dependent (see Note 4). The protocol provided here can be applied to clone sgRNA pairs into many commonly used CRISPR-Cas9 expression vectors containing BbsI (BpiI) sites, such as pX458 [8], pX459 [8], and SpCas9-Hygro [7]; and it can be adapted for applications with lentiviral backbones, such as lentiCRISPRv2 ([9], see Note 5). If necessary, oligonucleotides originally designed for cloning into vectors with BbsI (BpiI) sites can be repurposed for cloning into vectors with BsmBI (Esp3I) sites by changing the cut-ligation step (see Note 6). This protocol has been successfully applied to clone sgRNA pairs for deletion of transcriptional enhancers and control regions in human pancreatic beta cells [7]. The choice of delivery method

Deletion of Regulatory Elements with CRISPR-Cas9

323

Fig. 2 Example of two pairs of sgRNAs designed to yield deletion of a human pancreatic islet enhancer. (a) Example of data visualization for designing pairs of sgRNAs to delete a human islet enhancer. In this case, human islet H3K27ac and Med1 (Mediator complex) ChIP-Seq along with ATAC-Seq tracks were used to define the target region. sgRNAs were designed using http://www.rgenome.net/cas-designer/. (b) Genotyping PCR on targeted pools of cells. sgRNA pairs were cloned into SpCas9-Hygro (Addgene #118153). Dual sgRNA plasmids were delivered to human pancreatic beta cells (EndoC ßH3 cell line) by nucleofection as described previously [7] using the combinations of the sgRNAs shown in (a). By designing two sgRNAs on either side of the enhancer, we were able to obtain four different deletions of the same element

and expression backbone is crucial to achieve high deletion rate and should therefore be carefully considered before performing CRE deletion experiments (see Note 4).

324

2

Ineˆs Cebola

Materials

2.1 Microbiology Reagents

Prepare all media for microbiology in advance. Plates containing antibiotics should be stored at 4  C and used within a month of preparation. 1. Super optimal broth (SOC) medium: add 20 g tryptone, 5 g yeast extract, 0.584 g NaCl, and 0.186 g KCl to 950 mL of deionized water. Adjust pH of the medium to 7.0 with 5 N NaOH (~0.2 mL). Adjust the volume to 1 L with deionized water and sterilize by autoclaving on liquid cycle. Make 100 mL aliquots. Before use, add 0.5 mL sterile 2 M MgCl2 and 1.8 mL sterile 20% (w/v) glucose per 100 mL aliquot. 2. Luria-Bertani (LB) liquid medium: add 10 g tryptone, 10 g NaCl, and 5 g yeast extract to 950 mL deionized water. Adjust pH of the medium to 7.0 with 5 N NaOH (~0.2 mL). Adjust the volume to 1 L with deionized water and sterilize by autoclaving on liquid cycle. 3. Kanamycin: prepare a stock solution of 50 mg/mL of kanamycin sulfate salt in deionized water (1000 concentrated) and store at 20  C. 4. Ampicillin: prepare a stock solution of 100 mg/mL of ampicillin sodium salt in deionized water (1000 concentrated) and store at 20  C. 5. LB-kanamycin plates: prepare LB liquid medium (above) adding 15 g/L of agar. Sterilize by autoclaving on liquid cycle. Allow medium to cool to 50–60  C before adding kanamycin at 1:1000 (working concentration of 50 μg/mL). Mix the medium by swirling to avoid formation of bubbles on the plates. Pour ~20 mL per Petri dish (90 mm diameter). 6. LB-ampicillin plates: prepare LB liquid medium (above) adding 15 g/L of agar. Sterilize by autoclaving on liquid cycle. Allow medium to cool to 50–60  C before adding ampicillin at 1:1000 (working concentration of 100 μg/mL). Mix the medium by swirling to avoid formation of bubbles on the plates. Pour ~20 mL per Petri dish (90 mm diameter). 7. Chemically competent E. coli with reduced recombination of cloned DNA (see Note 7). 8. Miniprep kit for plasmid isolation.

2.2

Plasmids

1. pScaffold-H1 (Addgene #118152) (see Note 2). 2. Plasmid backbone, such as px458 (Addgene #48138), SpCas9Hygro (Addgene #118153) (see Note 8).

Deletion of Regulatory Elements with CRISPR-Cas9

2.3 Molecular Cloning

325

1. Primers: prepare all primer stock solutions at 100 μM in nuclease-free water and store at 20  C. To prepare working solutions, dilute stock 1:10 in nuclease-free water (working solution of 10 μM). 2. Q5 High-Fidelity Polymerase (New England Biolabs) or equivalent (see Note 9). 3. 5 Q5 Reaction Buffer (provided with Q5 High-Fidelity Polymerase) or equivalent. 4. 10 mM dNTPs. 5. Column-affinity PCR purification kit. 6. FastDigest BpiI (Thermo Scientific) (see Notes 10). 7. Tango buffer (10): 330 mM Tris–acetate (pH 7.9), 100 mM magnesium acetate, 660 mM potassium acetate, 0.1 mg/mL bovine serum albumin (BSA). 8. 0.1 M DTT. 9. 10 mM ATP. 10. T7 Ligase (3000 units/μL).

2.4 Primers for Sanger Sequencing

3

Either one of these primers will enable sequencing of the dual sgRNA insert: GACTATCATATGCTTACCGT (LKO.1) and GA GGGCCTATTTCCCATGATT (hU6-F) (see Note 11).

Method

3.1 Guide RNA Design

Any genomic segment flanked by two SpCas9 PAM sequences (NGG) may potentially be targeted for deletion (see Notes 12 and 13). The design guidelines provided here are valid for sgRNA expression vectors with BbsI/BpiI restriction sites. For applications with lentiviral backbones, see Note 5. 1. Identify the target CRE for deletion (see Note 14) (Fig. 2). 2. Identify one or more local control regions for deletion (see Note 15). 3. Design SpCas9 sgRNAs of 17–20 nt with a computational tool (see Notes 1 and 16). 4. For each sgRNA pair, design oligonucleotides as shown in Fig. 3 (see Note 17). 5. Request synthesis of oligonucleotides (desalted grade) from a commercial vendor.

3.2 Coupling of Pair of Guide RNAs by PCR

The following instructions are per pair of sgRNAs to be cloned. If cloning multiple pairs in parallel, prepare a master mix for the number of pairs to be cloned with all reagents except the primers, including a 10% excess volume.

326

Ineˆs Cebola

1. On ice, set up in a PCR tube the following reaction: Reagent

For one reaction (μL)

5 Q5 Buffer

4

10 mM dNTP

0.4

10 μM forward primer (containing gRNA #1)

1

10 μM reverse primer (containing gRNA #2)

1

Q5 High-Fidelity DNA Polymerase

0.2

1 ng/μL pScaffold-H1

1

nuclease-free water

13.4

Total volume

20

2. Perform PCR with the following conditions: Step

Temperature ( C)

Time (s)

Cycles

Denature

98

30

1

Denature Anneal Extension

98 58 72

10 15 15

30

12

Pause

1

Fig. 3 Primer design for dual sgRNA cloning into CRISPR-Cas9 vectors with BbsI/BpiI insertion sites (see Note 5 describing the design for BsmBI/Esp3I vectors)

3. Check PCR product by running 3 μL in a 1.5% (v/w) agarose gel at 120 V for 40 min. The PCR should yield a clear band of 353 bp (Fig. 4). 4. Purify the PCR product to remove PCR reagents with a column-affinity kit, eluting the product in 20 μL of nucleasefree water. 5. Measure concentration of the PCR product by Nanodrop and dilute to 10 ng/μL in nuclease-free water. The PCR product can be used immediately in the digestion-ligation reaction or stored at 20  C until use.

Deletion of Regulatory Elements with CRISPR-Cas9

327

Fig. 4 Expected result of successful PCR for pairing of sgRNAs. After amplification with oligonucleotides carrying sgRNAs, a clear 353 bp band should be detected by electrophoresis in a 1.5% agarose gel (second lane). Cassette, DNA fragment with the sgRNA scaffold and H1 promoter present in the pScaffold-H1 vector that is used as PCR template

3.3 Single-Step Digestion-Ligation Reaction

The reaction described below is valid for sgRNA expression vectors with BbsI/BpiI restriction sites such as pX458 or SpCas9-Hygro (see Notes 4 and 8). For applications with lentiviral backbones, see Note 5. For repurposing of PCR amplicons with different restriction sites see Note 6. 1. Ligate the amplified PCR product containing a pair of guide RNAs into the desired vector by preparing the following reaction mix on ice in a PCR tube:

328

Ineˆs Cebola

Reagent

For one reaction (μL)

10 Tango buffer

2

100 ng/μL Vector

1

10 ng/μL PCR product

1

0.1 M DTT

1

FastDigest BpiI

1

10 mM ATP

1

3000 units/μL T7 Ligase

0.5

nuclease-free water

12.5

Total volume

20

2. Transfer tube to a thermal cycler and perform the following program: Step

3.4 Transformation Into Chemically Competent Bacteria

Temperature ( C)

Time (min)

Cycles

37 23

5 5

6

37

10

1

4

Pause

1

Before starting, pre-warm a water bath at 42  C and the SOC medium at room temperature. During the transformation, pre-warm LB-agar plates with antibiotic at 37  C. 1. Thaw competent cells on ice. 2. Add 2 μL of the ligation into a tube with 50 μL of competent cells (see Note 18) and mix very gently. Do not vortex. 3. Incubate on ice for 30 min. 4. Heat-shock the cells for 30 s at 42  C in a water bath. 5. Remove the tube from the water bath and place it on ice for 2 min. 6. Add 250 μL of pre-warmed SOC medium to the tube. 7. Shake horizontally at 37  C for 1 h at 225 rpm in a shaking incubator. 8. Spread 50 μL from the transformation mix on a pre-warmed LB-agar plate with appropriate antibiotic resistance (see Note 19). 9. Invert the selective plate and incubate at 37  C overnight to allow growth of isolated colonies (see Note 20).

Deletion of Regulatory Elements with CRISPR-Cas9

329

Fig. 5 Example of Sanger sequencing analysis of successful dual sgRNA cloning. (a) Detection of the two individual sgRNAs in the correct orientation. (b) Analysis of the Sanger sequencing output using SnapGene Viewer and automated DNA feature detection. Typical results enable detection of two gRNA scaffold sequences, interspaced by a H1 promoter. It is also common to detect the promoter driving the expression of SpCas9 when cloning into vectors such as pX458 or SpCas9-Hygro 3.5 Confirmation of Successful Cloning

Successful cloning of the sgRNA pair can be directly confirmed by Sanger sequencing (see Note 21). 1. Pick one colony from the plate and inoculate 2 mL of LB liquid medium. 2. Incubate overnight at 225 rpm in an orbital shaking incubator. 3. On the following day, isolate the plasmid with a miniprep kit and send for Sanger sequencing using either primer LKO.1 or hU6. 4. Sanger sequencing of successfully cloned pairs should yield results similar to the example shown in Fig. 5, in which the two sgRNAs are detectable interspaced by a H1 promoter sequence (see Notes 22 and 23). 5. Confirmed colonies can be repicked to inoculate LB media for midi- or maxiprep plasmid isolation with the kit of choice. After isolation of the plasmid DNA, vectors are ready to be delivered to cells to achieve deletion of the target sequences.

330

4

Ineˆs Cebola

Notes 1. It is advisable to perform multiple independent deletions of the same CRE and control regions. A way of achieving this is by combining multiple sgRNAs located both upstream and downstream of the CRE. As shown in Fig. 2, a design that includes only two sgRNAs in either side of the CRE can yield four different deletions. 2. The pScaffold-H1 vector used as PCR template contains a kanamycin resistance cassette in contrast with the most commonly used CRISPR vectors, which contain an ampicillin resistance cassette. This design avoids detection of colonies containing the pScaffold-H1 vector due to plasmid carryover. 3. Depending on the vector used, a different restriction enzyme may be needed to carry out this protocol. Vectors commonly used for CRISPR-Cas9 experiments with plasmid transfection such as pX458 contain BbsI (BpiI) sites. Whereas for lentiviralbased experiments, backbones such as lentiCRISPRv2 contain BsmBI (Esp3I) sites (see Note 5 for instructions on how to adapt the protocol). 4. In our experience, protocols that yield high levels of Cas9 expression also yield higher deletion efficiencies and a higher proportion of homozygous clones. Before starting genome editing experiments with a new cellular model, it is highly recommended to test different CRISPR-Cas9 expression systems to maximize the rate of deleted alleles. Plasmids containing both sgRNAs and SpCas9 are very large. For that reason, transfection conditions optimized with smaller plasmids (which are often provided with transfection kits) tend to transfer poorly to CRISPR-Cas9 applications. Therefore, it is recommended to optimize the vector delivery conditions using CRISPR-Cas9 vectors. 5. If using a lentiviral backbone for cloning of dual sgRNA cassettes, such as lentiCRISPRv2, the primer design, and digestion-ligation reaction must be modified. The forward primer should be ACCGTCTCTCACCGNNNNNNNNNN NNNNNNNNNNGTTTTAGAGCTAGAAATAGCAA , where N corresponds to the protospacer sequence; and reverse primer should be CCCGTCTCCAAACNNNNNNNNNNN NNNNNNNNNGGGAAAGAGTGGTCTCA , where N corresponds to the reverse complement of the protospacer sequence. In the digestion-ligation reaction, the restriction enzyme BpiI should be replaced by Esp3I and the tango buffer should be replaced by Esp3I FastDigest buffer (1 final concentration).

Deletion of Regulatory Elements with CRISPR-Cas9

331

6. The cohesive ends generated by the BbsI/BpiI and the BsmbI/ Esp3I enzymes are identical. Therefore, primers containing a different restriction site than the destination vector (e.g., BbsI primers and BsmBI vector) can be used to clone the pair of sgRNAs in this vector using an additional digestion step. This allows the repurposing of a single pair of primers for both types of vector. The additional digestion step is performed after Subheading 3.2. Briefly, 500 ng of the purified PCR product are digested following the same procedure as described in Subheading 3.3 with the restriction enzyme corresponding to the primers used, but omitting the vector, ATP and T7 ligase, and incubating 1 h at 37  C. The digested product is purified using a column-based PCR purification kit and diluted to 10 ng/μL. The protocol can then be continued at Subheading 3.3 using the restriction enzyme corresponding of the destination vector’s restriction sites. 7. It is highly recommended to use an E. coli strain suitable for cloning unstable DNA constructs (e.g., RecA, RecA1, or RecA13 strain), such as One Shot Stbl3 Chemically Competent E. coli (Invitrogen) or NEB Stable Competent E. coli (New England Biolabs). Using other E. coli strains may lead to unwanted plasmid recombination events. 8. These plasmids are suitable for applications such as transfection or nucleofection of targeted cells, with co-expression of sgRNAs and SpCas9. Alternative vectors containing only an sgRNA expression cassette [e.g., sgRNA(MS2), Addgene #61424] can also be used with this protocol. The choice of plasmid for CRISPR-Cas9 expression (and its delivery) is cell type dependent and not covered in this protocol. See also Note 4. 9. Using a high-fidelity DNA polymerase is highly recommended to avoid introduction of mismatches in the sgRNA sequence. While the PCR mix described in this protocol contains Q5, other high-fidelity polymerases should work equally well. If changing the polymerase, it is advisable to optimize the cycling conditions following manufacturer’s instructions. 10. BpiI and BbsI are isoschizomers and can therefore be used interchangeably for vectors such as pX458. However, change in the enzyme manufacturer may require adjustment of the reaction buffer. See Note 5 for instructions to adapt this protocol to BsmBI/Esp3I vectors. 11. Either one of these primers is suitable for sequencing dual sgRNA inserts cloned into vectors that contain a U6 promoter for sgRNA expression (common to the majority of SpCas9 system vectors). Backbones with different promoters will have to be sequenced with different primers to be determined by the user.

332

Ineˆs Cebola

12. We have successfully applied this protocol to delete enhancers in human pancreatic beta cells [7]. This protocol can also be deployed to clone sgRNA pairs for targeting of other genomic sequences, including lncRNAs, miRNAs, promoters, CTCF sites, and even coding sequences if the desired outcome is a defined deletion. While other applications are not in the scope of this protocol, we also anticipate that this cloning strategy may be combined with other CRISPR-Cas9-mediated CRE perturbations such as CRISPRi or CRISPRa with two sgRNAs against the same genes/CREs for boosted effects, or even against two different target genes/CREs for analysis of combinatorial targeting. 13. Repetitive regions may be problematic and tend to be more difficult to target with high efficiency. For this reason, using repetitive regions as target sequences for sgRNA recognition should be avoided. This can be done by visualizing the genomic region containing the target CRE on a browser such as the UCSC Genome Browser (https://genome.ucsc.edu/) along with the RepeatMasker track, in which repetitive sequences will be highlighted. Most of the current sgRNA design tools already avoid repetitive sequences by default and provide the number of sequences in the target genome with 0, 1, and 2 mismatches for each sgRNA. Ideally, sgRNAs that only recognize one target site in the genome (i.e., only one sequence with zero mismatches) should be selected for deletion applications. A simple method to double check sgRNA sequence uniqueness in the target genome is to blast their sequence (this function is also available in the UCSC Genome Browser). 14. For most CREs, the target region can be restricted to the open chromatin region demarcated by stronger ATAC-Seq or DNase I hypersensitivity signal (usually a region between 300 and 800 bp), as in the example in Fig. 2. Alternatively, strong ChIP-Seq enrichment signal for co-activators (p300 or Mediator) and tissue-specific transcription factors may also be used to define the core sequence of a CRE. Very strong CREs such as super enhancers represent larger genomic segments that can encompass several kilobases, which can be equally deleted using the method described in this protocol. It is advisable to use control deletions of a roughly similar size whenever possible (see also Note 15). 15. Control deletions can be, for example, nearby inactive chromatin regions [preferentially within the same topologically associating domain (TAD)]. Distally located regions whose deletion is not expected to induce a transcriptional response can be used as additional internal controls.

Deletion of Regulatory Elements with CRISPR-Cas9

333

16. There are several online tools suitable for sgRNA design. We routinely design sgRNAs with protospacer sequences between 17 and 20 nt for targeting of human cells using http://www. rgenome.net/cas-designer/, selecting the latest available version of the genome (Homo sapiens GRCh38/hg38). 17. A common mistake is to design the reverse primer (containing the sgRNA #2) incorrectly. In order to express the correct combination of sgRNAs, it is necessary to include in the reverse primer the reverse complement sequence of the corresponding sgRNA’s protospacer, instead of its actual sequence. 18. We routinely use 1 μL of ligation with 12–15 μL of competent cells per transformation, which still yields a good number of colonies (>20 colonies/plate). 19. The antibiotic resistance in the selective LB-agar plates should correspond to the cassette present in the destination vector. For the majority of CRISPR-Cas9 vectors plates should contain ampicillin or carbenicillin (a semi-synthetic ampicillin analog). 20. It is quite rare to not obtain colonies with this protocol. If this happens, it may be due to using the wrong antibiotic selection or a poor transformation efficiency. It is recommended to double check the antibiotic in the plates before use, as well as making sure that the water bath is set at the right temperature. Using a positive control in the experiment (e.g., circularized vector with same antibiotic resistance as destination vector used in the cloning) is also recommended. 21. Using this protocol, we usually observe an efficiency of >95% for most backbones. For this reason, we do not perform colony PCR or restriction digestion to screen for positive colonies ahead of Sanger sequencing. 22. When cloning into a vector containing a Cas9 expression cassette, its promoter is usually detected in the sequencing result as well (as shown in the example in Fig. 5b). 23. Possible reasons for not detecting the correct insert may be usage of an incorrect or faulty restriction enzyme, or errors in the primer design. The activity of the restriction enzyme can be quickly checked by digesting the destination vector, analyzing the restriction product by gel electrophoresis. If the primers contain the wrong restriction enzyme, they may still be repurposed by following the steps described in Note 6. If one of the sgRNAs is detected in the wrong direction, this indicates an error in the primer design. It is important to make sure that the reverse complement of the sgRNA #2 sequence is included in the reverse primer. On rare occasions, a small number of colonies carry errors in the sgRNA sequence, which indicates low

334

Ineˆs Cebola

quality in the oligonucleotide synthesis. This usually yields plasmids carrying small base pair changes in the sgRNA sequence. If this happens, pick a new colony, miniprep and send for Sanger sequencing again. If second and third colonies still contain errors, it is best to re-order the primer. References 1. Han J, Zhang J, Chen L, Shen B, Zhou J, Hu B, Du Y, Tate PH, Huang X, Zhang W (2014) Efficient in vivo deletion of a large imprinted lncRNA by CRISPR/Cas9. RNA Biol 11 (7):829–835. https://doi.org/10.4161/rna. 29624 ˜ ez DG, Kraft K, Heinrich V, Krawitz P, 2. Lupia´n Brancati F, Klopocki E, Horn D, Kayserili H, Opitz JM, Laxova R, Santos-Simarro F, Gilbert-Dussardier B, Wittler L, Borschiwer M, Haas SA, Osterwalder M, Franke M, Timmermann B, Hecht J, Spielmann M, Visel A, Mundlos S (2015) Disruptions of topological chromatin domains cause pathogenic rewiring of gene-enhancer interactions. Cell 161(5):1012–1025. https://doi.org/10.1016/ j.cell.2015.04.004 3. Gasperini M, Findlay GM, McKenna A, Milbank JH, Lee C, Zhang MD, Cusanovich DA, Shendure J (2017) CRISPR/Cas9-mediated scanning for regulatory elements required for HPRT1 expression via thousands of large, programmed genomic deletions. Am J Hum Genet 101(2):192–205. https://doi.org/10.1016/j. ajhg.2017.06.010 4. Aparicio-Prat E, Arnan C, Sala I, Bosch N, Guigo´ R, Johnson R (2015) DECKO: Singleoligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs. BMC Genomics 16(1):846–815. https://doi.org/10. 1186/s12864-015-2086-z 5. Vidigal JA, Ventura A (2015) Rapid and efficient one-step generation of paired gRNA CRISPR-

Cas9 libraries. Nat Commun 6(1):8083–8087. https://doi.org/10.1038/ncomms9083 6. Fakhr E, Zare F, Teimoori-Toolabi L (2016) Precise and efficient siRNA design: a key point in competent gene silencing. Cancer Gene Ther 23(4):73–82. https://doi.org/10.1038/cgt. 2016.4 7. Miguel-Escalada I, Bona`s-Guarch S, Cebola I, Ponsa-Cobas J, Mendieta-Esteban J, Atla G, Javierre BM, Rolando DMY, Farabella I, Morgan CC, Garcı´a-Hurtado J, Beucher A, Mora´n I, Pasquali L, Ramos-Rodrı´guez M, Appel EVR, Linneberg A, Gjesing AP, Witte DR, Pedersen O, Grarup N, Ravassard P, Torrents D, Mercader JM, Piemonti L, Berney T, de Koning EJP, Kerr-Conte J, Pattou F, Fedko IO, Groop L, Prokopenko I, Hansen T, Marti-Renom MA, Fraser P, Ferrer J (2019) Human pancreatic islet threedimensional chromatin architecture provides insights into the genetics of type 2 diabetes. Nat Genet 51(7):1137–1148. https://doi.org/ 10.1038/s41588-019-0457-0 8. Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F (2013) Genome engineering using the CRISPR-Cas9 system. Nat Protoc 8 (11):2281–2308. https://doi.org/10.1038/ nprot.2013.143 9. Sanjana NE, Shalem O, Zhang F (2014) Improved vectors and genome-wide libraries for CRISPR screening. Nat Methods 11 (8):783–784. https://doi.org/10.1038/ nmeth.3047

Part VII DNA Methylation

Chapter 19 Simultaneous Tagmentation-Based Detection of ChIP/ATAC Signal with Bisulfite Sequencing Priscillia Lhoumaud and Jane Skok

1

Introduction The role of DNA methylation (DNAme) in gene regulation has been widely described [1–4], and it is known that as a general rule methylation reduces accessibility and prohibits TF binding at enhancers and promoters [5, 6]. However, some TFs can bind methylated DNA [2], but due to limitations in the techniques available for this kind of analysis, few genome-wide studies have been performed to identify the preferences of individual factors. Several techniques have been developed to measure DNAme genome wide. Whole-genome bisulfite sequencing (WGBS) is the only method that covers all genomic regions, but achieving sufficient sequencing coverage comes at a high price. On the other hand, reduced representation bisulfite sequencing (RRBS), which preferentially captures CpG-dense sequences known as CpG islands that can potentially act as regulatory elements, requires less sequencing depth, [7]. This method has the drawback of eliminating all non-CpG-dense sequences. Furthermore, both approaches require additional assays on different batches of cells to elucidate the interplay between DNAme, chromatin accessibility, and TF binding. Nucleosome Occupancy and Methylome sequencing (NOME-Seq) [8] simultaneously analyzes methylation together with accessibility but as for WGBS, sequencing of the entire genome is costly. Another approach, high-throughput systematic evolution of ligands by exponential enrichment (HT-SELEX [9]) analyzes DNA rather than chromatin and existing protocols that combine chromatin immunoprecipitation with bisulfite sequencing

Tilman Borggrefe and Benedetto Daniele Giaimo (eds.), Enhancers and Promoters: Methods and Protocols, Methods in Molecular Biology, vol. 2351, https://doi.org/10.1007/978-1-0716-1597-3_19, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

337

338

Priscillia Lhoumaud and Jane Skok Methyl-ATAC (M-ATAC)

Methyl-ChIP (M-ChIP) Magnetic bead

Native chromatin Nucleus lysis: 30 min Tagmentation: 30 min DNA purification: 30 min

Antibody Chromatin-bound factor

Set-up and immunoprecipitation: 4 hours Washes and tagmentation: 30 min Crosslinking: overnight DNA purification: 30 min

Tagmentation (Tn5 + Methylated adaptors)

Oligonucleotide replacement and gap repair: 60 min Bisulfite conversion: overnight Purification of converted samples: 30 min Library amplication with real-time PCR monitoring: 2 hours

Fig. 1 Principle and timing of EpiMethylTag steps (adapted from [15]). Components and steps of the EpiMethyltag procedure. Steps specific to Methyl-ATAC (upper-left), Methyl-ChIP (upper-right) and common between the two techniques (bottom). Of note, 10% of the sample can be taken before bisulfite conversion and be treated in parallel for amplification

(ChIP-bisulfite [10], BisChIP-Seq [11], ChIP-BisSeq [12]) require large numbers of cells to obtain an adequate concentration of DNA. To overcome all these drawbacks, we developed EpiMethylTag based on an approach originally developed for tagmentation-based WGBS [13–15]. It involves the use of the Tn5 transposase, loaded with adaptors harboring methylated cytosines. For M-ATAC, tagmentation occurs on nuclear lysates as per the conventional ATACSeq protocol [16] while in M-ChIP, tagmentation occurs during chromatin immunoprecipitation as per the ChIPmentation protocol [17]. Following DNA purification, the sample is bisulfite converted and PCR amplified for downstream sequencing (Fig. 1, adapted from [15]). The reads obtained provide information about coverage as well as CG methylation status. The protocol can be analyzed using a pipeline we developed that is publicly available online on Github (https://github.com/skoklab/ EpiMethylTag).

2

Materials (See Note 1)

2.1 Preannealing of the Adaptor Tn5mCAdapt and Assembly of the Transposome

1. Oligonucleotides Tn5mC-Apt1 and Tn5mC1.1-a1block (see Table 1 and Note 2). 2. Molecular grade H2O and sterile 100% glycerol. 3. 1.5 mL reaction tube and eight-well strip with lid. 4. 96-well gradient thermocycler. 5. Heater block. 6. EZ-Tn5 hKan-2i insertion kit (Biozym; Epicentre).

ChIP/ATAC-Sequencing Combined with Bisulfite Sequencing

2.2 Preparation of Nuclei for M-ATAC Samples and Tagmentation of Fresh DNA

339

1. Molecular grade H2O. 2. Bench centrifuge at 4  C. 3. Phosphate-Buffered Saline (PBS). 4. Molecular biology grade IGEPAL CA-630. 5. Lysis buffer (LB): 10 mM Tris–HCl, pH 7.4, 10 mM NaCl, 3 mM MgCl2, 0.1% IGEPAL CA-630. 6. Tagmentation DNA buffer (2 TD; the buffer is a component of the Nextera DNA sample preparation kit; Illumina). 7. Transposase (see preparation in Methods Subheading 3.1). 8. Qiagen MinElute PCR Purification Kit.

2.3 Preparation of ChIP Samples and Tagmentation of BeadBounds ChIPped DNA

1. Phosphate-Buffered Saline (PBS). 2. 20% Formaldehyde stock (Tousimis). 3. 2 M Glycine. 4. Protein A or G Magnetic beads (Dynabeads, Invitrogen). 5. 20 mg/mL BSA (NEB). 6. ChIP Lysis Buffer (store at 4  C; L3B): 10 mM Tris–HCl pH 8.0, 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 0.1% Na-Deoxycholate, 0.5% N-lauroylsarcosine, 1 complete protease inhibitor. 7. Triton X100. 8. Diagenode Bioruptor. 9. Rotating wheel (one at room temperature and one in cold room). 10. ChIP Wash Buffer 1 (WB1; store at 4  C): 20 mM Tris–HCl pH 7.4, 150 mM NaCl, 0.1% SDS, 1% Triton X 100, 2 mM EDTA. 11. ChIP Wash Buffer 2 (WB2, store at 4  C): 250 mM LiCl, 1% Triton X-100, 0.7% DOC, and 10 mM Tris–HCl, 1 mM EDTA. 12. Tris(hydroxymethyl)aminomethane (Sigma-Aldrich), 1 M solutions at pH 7.5 and pH 8, 10 mM solution at pH 8. 13. Tagmentation DNA buffer (prepare fresh): 10 mM Tris–HCl pH 8.0, 5 mM MgCl2, and 10% (v/v) dimethylformamide. 14. Transposase from Methods Subheading 3.1. 15. Tris–HCl-EDTA-Tween buffer (TET, store at 4  C): 0.2% Tween 20, 10 mM Tris–HCl/pH 8.0, 1 mM EDTA. 16. Elution buffer (prepare fresh and keep at room temperature): 0.5% SDS, 300 mM NaCl, 5 mM EDTA, 10 mM Tris–HCl pH 8.0. 17. Dimethylformamide (Merck). 18. MgCl2 (Sigma).

340

Priscillia Lhoumaud and Jane Skok

19. 20 mg/mL Proteinase K (NEB). 20. Qiagen MinElute PCR Purification Kit. 21. Thermomixer. 22. 1.5 mL reaction tube (Protein and DNA LoBind). 2.4 Oligonucleotide Replacement and Gap Repair

1. Oligonucleotide Tn5mC-ReplO1 (see Table 1 and Note 2). 2. Deoxynucleotide mix (100 mM of each dNTP). Dilute 1:40 in H2O to have a final concentration of 2.5 mM of each dNTP. 3. T4 DNA polymerase (New England BioLabs). 4. Phage-λ DNA, unmethylated (Promega). 5. dNTP mix: dATP, dTTP, dGTP, dCTP, 2.5 mM each, 10 mM final. 6. Ampligase, thermostable DNA ligase, with 10 buffer (Biozym). 7. 96-well gradient thermocycler.

2.5 SPRI Bead Purification after Oligonucleotide Replacement 2.6 Bisulfite Treatment and DNA Purification

1. Agencourt AMPure XP beads. 2. 100% Ethanol, diluted fresh at 80% in molecular grade H2O. 3. 1.5 mL reaction tube and eight-well strip with lid. 1. EZ DNA Methylation™ Kit (ZYMO Research) with the following components: CT conversion reagent, M-dilution buffer, M-binding buffer, M-desulfonation buffer, M-wash buffer, and M-elution buffer. 2. DNA LoBind reaction tubes and eight-well strip with lid. 3. 96-well thermocycler. 4. Benchtop centrifuge.

2.7

Real-Time PCR

1. PCR primers 1 and 2 (stocks at 5 μM and 1 μM, see Table 1 and Note 2). 2. KAPA HiFi HotStart Uracil+ ReadyMix (2) (Kapa). 3. SYBR Green I nucleic acid gel stain, 10,000 (Life Technologies): 100 SYBRGreen is 1 μL 10,000 SYBR® Green I nucleic acid gel stain dissolved with 99 μL H2O, 10 SYBRGreen is 10 μL 100 SYBR® Green I nucleic acid gel stain dissolved with 90 μL H2O. These solutions can be stored protected from light at 20  C for at least 6 months. 4. Molecular grade H2O. 5. 96-well real-time PCR plate and either PCR plate or PCR strips. 6. Thermocycler. 7. Real-time thermocycler.

PCR

PCR primer 2

CAAGCAGAAGACGGCATACGAGAT-NNNNNNNNNGTCTCGTGGGCT CGGAGATGT

AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTC

PCR

p CTGTCTCTTATACAddC

PCR primer 1

Load adaptor

Tn5mC1.1A1block

TcGTcGGcAGcGTcAGATGTGTATAAGAGAcAG

pcTGTcTcTTATAcAcATcTccGAGccCAcGAGAcinvT

Load adaptor

Tn5mC-Apt1

Sequence (50 to 30 )

Tn5mC-ReplO1 Replacement Adaptor

Purpose

Name

Table 1 List and sequences of oligonucleotides and PCR primers

p: phosphate,c: 5C-methylated, invT: inverted deoxythymidylate

p: phosphate,ddC: dideoxycytidylate

c: 5C-methylated

Modifications

ChIP/ATAC-Sequencing Combined with Bisulfite Sequencing 341

342

Priscillia Lhoumaud and Jane Skok

2.8 Library Purification and Determination of the Library Size Range and DNA Concentration

1. Agencourt AMPure XP beads. 2. 100% Ethanol (Sigma-Aldrich), diluted fresh at 80% in molecular grade H2O. 3. Tapestation reagents: High Sensitivity D1000 ScreenTape (Agilent) and High Sensitivity D1000 Reagents (Agilent). Alternatively, a bioanalyzer and subsequent reagents can be used. 4. Qubit dsDNA HS assay kit (Invitrogen). 5. Qubit 2.0 fluorometer. 6. Qubit assay tubes.

3

Method

3.1 Preannealing of the Adaptor Tn5mCAdapt and Assembly of the Transposome (See Note 3)

1. In a 200 μL PCR tube, mix 10 μL each of oligonucleotides Tn5mC-Apt1 and Tn5mC1.1-A1block (100 μM each; see Table 1 and Note 2) and 80 μL of H2O. 2. Set the thermocycler conditions for adaptor assembly as follows: Step

Temperature ( C)

Time

Denature

95

3 min

Anneal

70

3 min

Anneal

70

30 s

25

Pause

Ramp to 26  C

Cycles 1

–1  C/cycle, 30 s

45 1

3. Heat 100 μL glycerol (99.5%) to 90  C in a thermocycler. Hot glycerol can be precisely pipetted. 4. Transfer 50 μL of hot glycerol to a 1.5 mL reaction tube and cool it down to room temperature by incubation on ice for 3 min. 5. Add 50 μL of adaptor Tn5mC-Adapt (10 μM) from step 2 of this method section and mix it by repeated pipetting. 6. Transfer 10 μL of the glycerol-adaptor mixture (stable at 20  C for at least 6 months) to a new 1.5 mL reaction tube, add 10 μL of Ez-Tn5 transposase (from the EZ-Tn5 hKan2iinsertion kit); mix by repeated pipetting. 7. Maintain the adaptor-transposase mixture (the transposome) at room temperature for 30 min, and then place it on ice. The 20 μL mixture is sufficient for eight tagmentation reactions for M-ATAC and for 20 reactions for M-ChIP. The transposome can be stored at 20  C for at least 1 month.

ChIP/ATAC-Sequencing Combined with Bisulfite Sequencing

3.2 Preparation of Nuclei for M-ATAC Samples and Tagmentation of Fresh DNA

343

1. Harvest cells (no fixation), protocol to be defined by the user. 2. Spin down 50,000 cells at 500  g for 5 min, 4  C. 3. Wash once with 50 μL of cold 1 PBS buffer. Spin down at 500  g for 5 min, 4  C. 4. Gently pipette to resuspend the cell pellet in 50 μL of cold LB. Spin down immediately at 500  g for 10 min, 4  C. 5. Discard the supernatant and immediately continue to transposition reaction. 6. Make sure the cell pellet is set on ice. 7. To make the transposition reaction mix, combine the following: 25 μL 2 TD Buffer (Illumina), 2.5 μL Tn5me Transposase (with methylated adaptors for M-ATAC), and 22.5 μL Nuclease-Free H2O ¼ 50 μL total. 8. Gently pipette to resuspend nuclei in the transposition reaction mix. 9. Incubate the transposition reaction at 37  C for 30 min. 10. Immediately following transposition, purify using a Qiagen MinElute Kit. 11. Elute transposed DNA in 10 μL Elution Buffer provided in the Qiagen MiniElute Kit (wait 3 min). Purified DNA can be stored at 20  C.

3.3 Preparation of ChIP Samples and Tagmentation of BeadBounds ChIPped DNA

1. Cross-link cells by 1% formaldehyde in PBS or growing media (1 volume of 20% formaldehyde +19 volumes of 1 PBS or growing media) for 10 min at room temperature under agitation and covered from light with foil. For adherent cells, remove media and then add formaldehyde to the plate/well. For suspension cells, pellet at 500  g, and resuspend the cell pellet with 1% formaldehyde. Add 1/16 volume of 2 M glycine (0.125 M final concentration) to quench the formaldehyde. Leave on bench for 5 min under gentle agitation and covered with foil. 2. Pellet cells using 500  g, 4  C, 5 min. Wash the cell pellet twice with ice-cold 1 PBS and centrifuge again. 3. Wash Magnetic Protein A or Protein G beads (dependent on the antibody) twice in 1 PBS supplemented with 0.5% BSA. 4. Resuspend beads in 400 μL of 1 PBS supplemented with 0.5% BSA. 5. Add the antibody and rotate for at least 1 h at room temperature. 6. Wash beads twice in PBS supplemented with 0.5% BSA.

344

Priscillia Lhoumaud and Jane Skok

7. Prepare the cell nuclei: resuspend cells in 350 μL LB containing freshly added protease inhibitors, rotate in cold room for 10 min. 8. Sonication: sonicate or 2–5 cycles (30 s on/off) using Diagenode Bioruptor (aiming for 100–500 bp sonicated DNA for histone modifications; 200–1000 bp for transcription factors, see Note 4). 9. Supplement lysates with 38 μL of 10% Triton -X- 100 (1% final). Alternatively, depending on the cell type, triton can be reduced to 0.1% and/or SDS 0.1% final can be added. 10. Centrifuge at 16,000  g for 5 min at 4  C. 11. Transfer the supernatant containing the sonicated chromatin to a new protein 1.5 mL LoBind tube. 12. Make sure the volume is high enough to have liquid moving. Increase volume with LB and triton. An input sample can be taken at this step (see Note 5). 13. Add blocked antibody conjugated magnetic beads to the tube containing the chromatin and incubate for 3–6 h at 4  C (see Note 6). 14. Wash twice with 0.5 mL of WBI. 15. Wash twice with 0.5 mL of WBII. 16. Wash beads once with cold 10 mM Tris–HCl pH 8.0 to remove detergent, salts, and EDTA. 17. Wash beads once more with cold 10 mM Tris–HCl pH 8.0 but do not immediately place the reaction on a magnet to discard supernatant. Instead, transfer the whole reaction including beads to a new tube, then place on a magnet to remove supernatant. This will decrease tagmentation of unspecific chromatin fragments sticking to the tube wall. 18. Resuspend beads carefully in 25 μL of the tagmentation DNA buffer and add 1 μL of Tagment DNA enzyme with methylated adaptors (from Subheading 3.1, step 7) per tube and incubate at 37  C for 1 min in a thermocycler (see Note 7). 19. Place tagmentation reaction on a cold magnet, discard the supernatant, and wash beads twice with TF-WBI. It is recommended to wash beads with a buffer containing SDS/EDTA to inactivate and strip the transposase from DNA after tagmentation. 20. Wash twice with 0.5 mL of TET. Transfer the reaction in a new tube when washing for the second time. This will decrease carry-over of tagmented unspecific fragments sticking to the tube wall. 21. Incubate beads with 70 μL of elution buffer containing 2 μL of Proteinase K for 1 h at 55  C and at least 8 h (overnight) at

ChIP/ATAC-Sequencing Combined with Bisulfite Sequencing

345

65  C. Transfer the supernatant to a new tube. Add another 30 μL of elution buffer to the beads for 1 min and combine the eluates. Incubate with another 1 μL of Proteinase K for 1 h at 55  C. 22. Purify DNA with Qiagen MinElute columns. Elute in 10 μL of elution buffer (an incubation of 3 to 5 min on the column can increase the yield of eluted DNA, see Note 8). 3.4 Oligonucleotide Replacement and Gap Repair

1. To the 9 μL of tagmented DNA (from Subheading 3.2 step 11 for M-ATAC or Subheading 3.3 step 22 for M-ChIP), add 2 μL of unmethylated carrier Phage-λ DNA (2 ng), 2 μL of dNTP mix, 2 μL of 10 Ampligase buffer, and 2 μL of replacement oligo Tn5mC-ReplO1 (10 μM; see Table 1 and Note 2); mix by repeated pipetting. 2. Set the thermocycler conditions for replacement and annealing as follows: Step

Temperature ( C)

Time (min)

Denature

50

1

Anneal

45

10

Anneal

45

Ramp to 37  C

1 0.1  C/s1

37

Cycles

Pause

1 1

3. While the strip remains in the thermocycler, add 1 μL of T4 DNA polymerase and 2.5 μL of Ampligase per well; mix by repeated pipetting. 4. Continue the reaction in the thermocycler with the following conditions for gap repair:

3.5 SPRI Beads Purification after Oligonucleotide Replacement

Step

Temperature ( C)

Time (min)

Cycles

Repair

37

30

1

4

Pause

1

1. To the samples (20.5 μL per well), add 36 μL of AMPure beads (1.8, no size selection) per well; mix to homogeneity by repeated pipetting. Incubate at room temperature for 15 min. 2. While the strip is still on the magnetic separator, wash the beads in each well with 50 μL of 80% Ethanol. Remove the supernatant in each well completely by pipetting without disturbing the bead pellet; discard the supernatant. 3. Keep the eight-well strip open on the magnetic separator for 10 min. Complete removal of any liquid and droplets is essential; the beads must be completely dry before the next step.

346

Priscillia Lhoumaud and Jane Skok

4. Remove the eight-well strip from the magnetic separator and thoroughly resuspend the magnetic beads in 50 μL of H2O. Incubate for 3 min. 5. Transfer the strip to the magnetic separator, transfer the supernatant (the eluate containing the tagmented and gap-repaired DNA) from each well into a new well of a new eight-well strip without disturbing the bead pellets. Transfer 5 μL of the eluate from each well to a 1.5 mL LoBind reaction tube for troubleshooting by real-time PCR or for preparation of a sequencing library for genome analysis without bisulfite treatment. Purified DNA can be stored at 20  C. 3.6 Bisulfite Treatment and DNA Purification

1. Add 5 μL of M-dilution buffer to the 45 μL of eluate in each well of the eight-well strip from the previous step and mix by repeated pipetting. 2. Set the thermocycler conditions as follows: Step

Temperature ( C)

Time

Cycles

Repair

37

15 min

1

25

Pause

1

3. Add 100 μL of liquid CT conversion reagent to each well and mix by repeated pipetting; split the mixture from each well into two new wells, each containing an equal aliquot of 75 μL, and continue the reaction in the thermocycler as follows: Step

Temperature ( C)

Time

Cycles

Denature

95

15 s

16

Conversion

50

60 min

4

Pause

1

4. Transfer 400 μL of M-binding buffer to each of eight ZymoSpin IC Columns inserted in collection tubes. Load each cooled sample, consisting of 2  75 μL, into a Zymo-Spin IC column containing M-binding buffer. Close the column caps and mix by inverting several times. Centrifuge at 11,000  g for 30 s at room temperature and discard the flow-through. 5. Add 100 μL of M-wash buffer to each column, centrifuge at 11,000  g for 30 s at room temperature, and discard the flowthrough. 6. Add 200 μL of M-desulfonation buffer to each column and keep at room temperature for 15–20 min; centrifuge at 11,000  g for 30 s at room temperature and discard the flow-through.

ChIP/ATAC-Sequencing Combined with Bisulfite Sequencing

347

7. Add 200 μL of M-wash buffer to each column, centrifuge at 11,000  g for 30 s at room temperature and discard the flowthrough. Repeat this wash step once, and then finally centrifuge at 17,000  g for 3 min at room temperature. 8. Transfer each column to a 1.5 mL LoBind reaction tube and add 12 μL of M-elution buffer directly to each column matrix. Centrifuge the tubes at 16,000  g for 30 s at room temperature to elute the converted DNA. Repeat this elution step once with another 12 μL of M-elution buffer. Purified DNA can be stored at 80  C for at least 1 month. 3.7

Real-Time PCR

1. To amplify the transposed DNA fragments (bisulfite converted and not converted), combine the following in a PCR tube:

Reagent

For one reaction (μL)

Final concentration

Kapa HS uracil+ ready mix 2

15

1

DNA (converted or not)

12

Primer 1 (5 μM, see Table 1)

2

0.3 μM

Primer 2 (with barcode, 5 μM, see Table 1)

2

0.3 μM

Sybr Green 100

0.3

1

Molecular grade H2O (for not converted 7 samples) Total volume

30

2. Set the thermocycler conditions as follows: Step

Temperature ( C)

Time

Cycles

Denature

95

3 min

1

Denature

98

20 s

5

Annealing

62

15 s

Read

72

1 min

Extension

72

1 min

4

Pause

1

3. To reduce GC and size bias in PCR, monitor the PCR reaction using qPCR to stop amplification prior to saturation. To run a qPCR side reaction, combine the following:

348

Priscillia Lhoumaud and Jane Skok

Reagent

For one reaction (μL)

Final concentration

Kapa HS uracil+ ready mix 2

7.5

1

DNA amplified 5 cycles

3

Primer 1 (1 μM, see Table 1)

1

0.066 μM

Primer 2 (with barcode, 1 μM, see Table 1)

1

0.066 μM

Sybr Green 10

0.15

1

Molecular grade H2O

2.35

Total volume

15

4. Set the real-time thermocycler conditions as follows: Step

Temperature ( C)

Time

Cycles

Denature

95

3 min

1

Denature

98

20 s

31

Annealing

62

15 s

Read

72

1 min

5. Determine the number of additional cycles needed for each sample as follows. On the qPCR analysis software, plot linear Rn vs. Cycle to determine maximum intensity for each sample. For each sample, take one-fourth of maximum intensity and calculate the number of cycles corresponding on the X axis. Re-insert tubes in the PCR machine for the appropriate number of additional cycles (Fig. 2, see Note 9). 3.8 Library Purification and Determination of Library Size Range and DNA Concentration

1. Transfer the PCR reaction mix to an eight-well strip and add 45 μL (1.8-fold volume) AMPure beads to each; homogenize by repeated pipetting. For M-ChIP, a size selection step can be added (see Note 10). 2. Repeat steps 2–5 from Subheading 3.5 but wash the beads with 200 μL 80% ethanol (instead of 50 μL) and resuspend the beads in 22 μL elution buffer. 3. Transfer the clear supernatants corresponding to the libraries to 1.5 mL LoBind tubes. 4. Proceed to determine fragment size distributions with the Agilent Bioanalyzer or Tapestation (Fig. 3, see Note 10) and of the DNA concentrations by Qubit fluorimetry.

ChIP/ATAC-Sequencing Combined with Bisulfite Sequencing

349

FU 75,000 70,000 65,000 60,000 55,000 50,000 45,000 40,000 35,000 30,000 25,000 20,000 15,000 10,000 5,000 0

-5,000 0 2 4 6 # of extra cycles 4 5 5 6

8

Sample 1

10

12 14 Cycle

Sample 2

16

Sample 3

18

20

22

24

26

Sample 4

Fig. 2 Real-time PCR amplification curves of EpiMethylTag libraries. Following the 5 initial samples performed by PCR, the number of extra cycles is determined by real-time PCR using the value on the X axis corresponding to one-fourth of the Y value at peak signal. If the value in X falls between two cycles, the lowest one should be taken. For example, to the 5 initial cycles for all samples, we added 5 cycles for samples 1 and 2, 6 cycles for sample 3, and 4 cycles for sample 4 3.9 Next-Generation Sequencing of the Libraries and Bioinformatic Analysis

1. Quantify libraries using Kapa qPCR kit and sequence using the HiSeq 2500 for paired end 50 bp reads. The number of reads will depend on the target and the required coverage. Ideally, aim for a coverage of 10 reads per CpG for accurate methylation percentage analysis. 2. Process data as per the pipeline available on Github (https:// github.com/skoklab/EpiMethylTag). Briefly, trim reads using trim-galore/0.4.4 and align to the most recent reference genome (mm10 or hg38) using Bismark/0.18.1 (bowtie2) [18] for M-ChIP and M-ATAC to account for bisulfite conversion. Remove reads with quality < 30 and duplicated reads using Samtools/1.3[19]. Call peaks using Macs/2.1.0 [20]

b

CTCF Methyl-ChIP not converted L

216

U

FU

600

600

500

500

400

400

300

300

200

200

100

100

0

214

U

d

Methyl-ATAC not converted L

213 354

U

1500

700

1000

400

500

300

200

size (bp)

Methyl-ATAC Bisulfite converted FU

600

600

500

500

400

400

300

300

200

200

100

100

0

100

size (bp)

25

1500

700

1000

500

400

200

300

100

50

25

0

c

L

210

U

357

1500

700

1000

500

400

300

200

1500

700

1000

500

400

300

200

100

50

25

0 size (bp)

100

FU

L

50

FU

CTCF Methyl-ChIP Bisulfite converted

50

a

Priscillia Lhoumaud and Jane Skok

25

350

size (bp)

Fig. 3 Fragment size range of tagmented libraries with and without bisulfite conversion as determined by automated electrophoresis system, for CTCF Methyl-ChIP not converted (a), bisulfite converted (b), MethylATAC not converted (c), and bisulfite converted (d)

with the following parameters: --qvalue 0.01 --nomodel --shift 0 -B --call-summits. Generate bigwigs from bam files with RPKM normalization using Deeptools [21] for visualization on IGV. Use default parameters from Bismark/0.18.1 (Bowtie2) [18] to generate coverage files containing methylation information.

4

Notes 1. Use only filter pipetting tips throughout the whole procedure. 2. Oligonucleotides: all modified oligonucleotides (Table 1) were custom-made and purchased from IDT. The modified oligonucleotides Tn5mC-Apt1, Tn5mC1.1-A1block, and Tn5mCReplO1 were synthesized at a 50 nmol scale and HPLCpurified PCR primers were purchased from Life technology, synthesized at a 25 nmol scale and desalted. 3. Be sure to have the Transposase with methylated adaptors ready before the tagmentation of fresh DNA for M-ATAC and before the washes for M-ChIP. This takes 1 h and can be stored for a few months at 20  C. 4. For sonication in the M-ChIP protocol, the number of cycles need to be optimized for each cell type. Check size of fragments on 1.5% agarose gels.

ChIP/ATAC-Sequencing Combined with Bisulfite Sequencing

351

5. For the M-ChIP protocol, it is recommended to take an input to analyze the efficiency of the IP by qPCR. As the on-beads tagmentation will not apply to the input, these will not be amplified and sequenced. A non-converted negative IgG control IP can be included in the design of the experiment to evaluate the background of the ChIP signal and use it as an input for peak calling. 6. For the M-ChIP protocol, the immunoprecipitation step may need to be optimized depending on the cell type or antibody. 7. As per the ChIPmentation protocol, the tagmentation step could in theory be extended up to 10 min for low efficiency immunoprecipitations or low number of cells although we did not test it. 8. For the M-ChIP protocol, the procedure has been successful using less than 1 ng of immunoprecipitated DNA after purification (less than 0.1 ng/μL in 10 μL, below Qubit sensitivity). The number of cells per IP will need to be optimized for each cell type and antibody (e.g., ChIP for DNA bound factors such as CTCF or KLF4 will require more cells than ChIP for histone modifications. Quantifying DNA concentration after ChIP DNA purification is not necessary. 9. For the amplification of the libraries, it is recommended to monitor the number of PCR cycles needed by real-time PCR. We recommend amplifying for no more than 13 cycles total to avoid PCR duplicates. If the concentration of the samples is too low for sequencing after 13 cycles, adding extra cycles may lead to poor quality results due to high duplication rates (Fig. 2). 10. For M-ATAC, it is recommended to not perform library size selection after PCR amplification, while for M-ChIP, a size selection step can be added if primer dimers (smaller than 100 bp) or large DNA fragments (greater than 700 bp) are detected from step 4, Subheading 3.8. Of note, bisulfite conversion may lead to DNA fragmentation, which will be observed by a smaller average size after conversion and loss of nucleosome fragments larger than two nucleosomes (Fig. 3, compare c and d). References 1. Dor Y, Cedar H (2018) Principles of DNA methylation and their implications for biology and medicine. Lancet 392(10149):777–786. https://doi.org/10.1016/S0140-6736(18) 31268-6 2. Hu S, Wan J, Su Y, Song Q, Zeng Y, Nguyen HN, Shin J, Cox E, Rho HS, Woodard C, Xia S, Liu S, Lyu H, Ming GL, Wade H, Song H, Qian J, Zhu H (2013) DNA

methylation presents distinct binding sites for human transcription factors. elife 2:e00726. https://doi.org/10.7554/eLife.00726 3. Maurano MT, Wang H, John S, Shafer A, Canfield T, Lee K, Stamatoyannopoulos JA (2015) Role of DNA methylation in modulating transcription factor occupancy. Cell Rep 12 (7):1184–1195. https://doi.org/10.1016/j. celrep.2015.07.024

352

Priscillia Lhoumaud and Jane Skok

4. Zhu H, Wang G, Qian J (2016) Transcription factors as readers and effectors of DNA methylation. Nat Rev Genet 17(9):551–565. https://doi.org/10.1038/nrg.2016.83 5. Fouse SD, Shen Y, Pellegrini M, Cole S, Meissner A, Van Neste L, Jaenisch R, Fan G (2008) Promoter CpG methylation contributes to ES cell gene regulation in parallel with Oct4/Nanog, PcG complex, and histone H3 K4/K27 trimethylation. Cell Stem Cell 2 (2):160–169. https://doi.org/10.1016/j. stem.2007.12.011 6. Natarajan A, Yardimci GG, Sheffield NC, Crawford GE, Ohler U (2012) Predicting cell-type-specific gene expression from regions of open chromatin. Genome Res 22 (9):1711–1722. https://doi.org/10.1101/gr. 135129.111 7. Meissner A, Gnirke A, Bell GW, Ramsahoye B, Lander ES, Jaenisch R (2005) Reduced representation bisulfite sequencing for comparative high-resolution DNA methylation analysis. Nucleic Acids Res 33(18):5868–5877. https://doi.org/10.1093/nar/gki901 8. Kelly TK, Liu Y, Lay FD, Liang G, Berman BP, Jones PA (2012) Genome-wide mapping of nucleosome positioning and DNA methylation within individual DNA molecules. Genome Res 22(12):2497–2506. https://doi.org/10. 1101/gr.143008.112 9. Yin Y, Morgunova E, Jolma A, Kaasinen E, Sahu B, Khund-Sayeed S, Das PK, Kivioja T, Dave K, Zhong F, Nitta KR, Taipale M, Popov A, Ginno PA, Domcke S, Yan J, Schubeler D, Vinson C, Taipale J (2017) Impact of cytosine methylation on DNA binding specificities of human transcription factors. Science 356(6337):eaaj2239. https://doi. org/10.1126/science.aaj2239 10. Brinkman AB, Gu H, Bartels SJ, Zhang Y, Matarese F, Simmer F, Marks H, Bock C, Gnirke A, Meissner A, Stunnenberg HG (2012) Sequential ChIP-bisulfite sequencing enables direct genome-scale investigation of chromatin and DNA methylation cross-talk. Genome Res 22(6):1128–1138. https://doi. org/10.1101/gr.133728.111 11. Statham AL, Robinson MD, Song JZ, Coolen MW, Stirzaker C, Clark SJ (2012) Bisulfite sequencing of chromatin immunoprecipitated DNA (BisChIP-seq) directly informs methylation status of histone-modified DNA. Genome Res 22(6):1120–1127. https://doi.org/10. 1101/gr.132076.111 12. Feldmann A, Ivanek R, Murr R, Gaidatzis D, Burger L, Schubeler D (2013) Transcription factor occupancy can mediate active turnover of DNA methylation at regulatory regions.

PLoS Genet 9(12):e1003994. https://doi. org/10.1371/journal.pgen.1003994 13. Adey A, Shendure J (2012) Ultra-low-input, tagmentation-based whole-genome bisulfite sequencing. Genome Res 22(6):1139–1143. https://doi.org/10.1101/gr.136242.111 14. Wang Q, Gu L, Adey A, Radlwimmer B, Wang W, Hovestadt V, Bahr M, Wolf S, Shendure J, Eils R, Plass C, Weichenhan D (2013) Tagmentation-based whole-genome bisulfite sequencing. Nat Protoc 8 (10):2022–2032. https://doi.org/10.1038/ nprot.2013.118 15. Lhoumaud P, Sethia G, Izzo F, Sakellaropoulos T, Snetkova V, Vidal S, Badri S, Cornwell M, Di Giammartino DC, Kim KT, Apostolou E, Stadtfeld M, Landau DA, Skok J (2019) EpiMethylTag: simultaneous detection of ATAC-seq or ChIP-seq signals with DNA methylation. Genome Biol 20 (1):248. https://doi.org/10.1186/s13059019-1853-6 16. Buenrostro JD, Giresi PG, Zaba LC, Chang HY, Greenleaf WJ (2013) Transposition of native chromatin for fast and sensitive epigenomic profiling of open chromatin, DNA-binding proteins and nucleosome position. Nat Methods 10(12):1213–1218. https://doi.org/10.1038/nmeth.2688 17. Schmidl C, Rendeiro AF, Sheffield NC, Bock C (2015) ChIPmentation: fast, robust, low-input ChIP-seq for histones and transcription factors. Nat Methods 12(10):963–965. https:// doi.org/10.1038/nmeth.3542 18. Krueger F, Andrews SR (2011) Bismark: a flexible aligner and methylation caller for BisulfiteSeq applications. Bioinformatics 27 (11):1571–1572. https://doi.org/10.1093/ bioinformatics/btr167 19. Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, Durbin R, Genome Project Data Processing S (2009) The sequence alignment/map format and SAMtools. Bioinformatics 25 (16):2078–2079. https://doi.org/10.1093/ bioinformatics/btp352 20. Zhang Y, Liu T, Meyer CA, Eeckhoute J, Johnson DS, Bernstein BE, Nusbaum C, Myers RM, Brown M, Li W, Liu XS (2008) Modelbased analysis of ChIP-Seq (MACS). Genome Biol 9(9):R137. https://doi.org/10.1186/ gb-2008-9-9-r137 21. Ramirez F, Ryan DP, Gruning B, Bhardwaj V, Kilpert F, Richter AS, Heyne S, Dundar F, Manke T (2016) deepTools2: a next generation web server for deep-sequencing data analysis. Nucleic Acids Res 44(W1):W160–W165. https://doi.org/10.1093/nar/gkw257

Chapter 20 Low-Input Whole-Genome Bisulfite Sequencing Anna Krepelova and Francesco Neri

1

Introduction DNA methylation plays a pivotal role in regulating gene transcription and chromatin structure and, consequently, influences many biological processes such as embryonic development [1], X-chromosome inactivation [2], genomic imprinting [3], stem cell differentiation, and transposon inactivation [4, 5]. Deregulation of DNA methylation leads to aberrant DNA methylation patterns which are associated with aging and several human diseases including cancer [6–8]. DNA methylation consists in the covalent addition of a methyl-group to cytosines of CpG dinucleotides. In eukaryotic cells, 5-methylcytosine (5-mC) occurs almost exclusively within a CpG context, and is established de novo by the Dnmt3 enzymes (Dnmt3a, Dnmt3b), and maintained over cell divisions by the Dnmt1 enzyme [3, 4, 9]. DNA methylation has been predominantly associated with chromatin repression and transcriptional silencing, particularly when established in promoter regions. However, DNA methylation can also be established outside promoters (gene bodies or intergenic regions) (Fig. 1) [10]. It has been demonstrated that non-promoter DNA methylation can regulate binding of transcription factors to enhancer regions [11– 13], transcriptional elongation [14], alternative splicing [15], determination of alternative promoters [16], as well as spurious transcription [17]. The majority of the DNA methylation pattern of a specific cellular lineage is established during the embryonic development [5]; however, more recent studies pointed out that a finely tuned regulation of the DNA methylation is also essential for adult stem cell differentiation, and tissue homeostasis and functionality [18, 19]. Stem cell differentiation is regulated by the activation of lineage-specific gene promoters and enhancers [20–23], and the

Tilman Borggrefe and Benedetto Daniele Giaimo (eds.), Enhancers and Promoters: Methods and Protocols, Methods in Molecular Biology, vol. 2351, https://doi.org/10.1007/978-1-0716-1597-3_20, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

353

354

Anna Krepelova and Francesco Neri

CpG Island

Intergenic Region

Transposable Element

CpG Island

Expressed Gene Unmethylated CpG Methylated CpG

Fig. 1 DNA methylation landscape in mammals. The majority of CpGs in intergenic regions, repeated and transposable elements, and in gene bodies are usually methylated. While CpG islands (rich in CpGs) are usually unmethylated and correspond to active promoters (expressed genes)

epigenetic characterization of these genomic elements is crucial in many research areas. However, the genome-wide analysis of the chromatin status in stem, progenitor, and differentiated cell populations presents still some technical barriers, principally represented by a low amount of starting material when these cell populations are directly isolated from laboratory animals or human biopsies. Numerous genome-wide methods have been developed to investigate DNA methylation [24]. They include methylation sensitive endonuclease-based methods that take advantage of restriction endonucleases with different sensitivity towards methylated cytosine residues present in the cleavage site (e.g., HpaII, MspI enzymes), and affinity-based methods using antibodies or proteins that bind to methylated DNA such as methylated DNA immunoprecipitation sequencing (MeDIP-Seq), or methyl-CpG binding domain sequencing (MBD-Seq); however, these methods suffer from a lack of sensitivity that makes analysis of CpG-poor regions and the detection of small variations very challenging. Sodium bisulfite conversion-based methods rely on the fact that, during bisulfite treatment, unmethylated cytosine behaves differently than methylated cytosine, allowing a single-base resolution after sequencing with no limitations depending on the level of methylation or the CpG frequency [25, 26]. During bisulfite conversion each unmethylated cytosine, which is not protected by a methylgroup becomes deaminated into uracil, whereas methylated cytosines remain unaltered (Fig. 2a). During subsequent PCR and sequencing, uracil is amplified and detected as thymine while methylated cytosine is amplified and detected as cytosine (Fig. 2b). Among the most standard bisulfite conversion-based methods there are whole-genome bisulfite sequencing (WGBS) and reduced representation bisulfite sequencing (RRBS). WGBS sequencing is the most informative but also the most costexpensive single-base resolution technology since the entire genome is analyzed. RRBS method is a less expensive variation of WGBS that combines the restriction digestion by MspI enzyme, DNA size selection, and bisulfite sequencing [27]. The genomic

Whole-Genome Bisulfite Sequencing

355

a Hydrolytic Deamination

Sulphonation NH2

NH2

OH

N H

O

+ HN

HSO3-

N

O

O

O

+

NH4

OH-

HN

-

Cytosine

H2 O

Alkali Desulphonation

N H

SO3-

Cytosine-sulphonate

O

N H

SO3-

Uracil-sulphonate

HSO3-

HN O

N H

Uracil

NH2 CH3

N O

HSO3-

N H

5-methylcytosine

b G - G - T - C - A - T - A - G - A - mC - G - A - T Bisulfite conversion

G - G - T - U - A - T - A - G - A - mC - G - A - T PCR amplification and sequencing

G-G-T-T-A-T-A-G-A-C-G-A-T

Fig. 2 Catalytic mechanism of bisulfite-catalyzed conversion of cytosine to uracil. (a) Heat denaturation of DNA is followed by the sulfonation of the cytosine residues at the C-6 position, hydrolytic deamination at the C-4 position to produce uracil-sulfonate, and final desulfonation under alkaline conditions to produce uracil. Methylated cytosine is not susceptible to bisulfite conversion due to the inability of bisulfite to access the C-6 position. (b) During subsequent PCR and sequencing, uracil is amplified and detected as thymine while methylated cytosine is amplified and detected as cytosine

fragments covered by the RRBS method are principally CpG-rich regions (CpG islands) that include many, but not all of the promoter and enhancer regions. WGBS was initially very expensive due to the high DNA sequencing costs and required ~5μg of input

356

Anna Krepelova and Francesco Neri

DNA [28, 29], therefore being very limiting with precious and low-input samples. To the original protocol, several variants have been developed in the following years [e.g., Tagmentation-based Whole-Genome Bisulfite Sequencing (T-WGBS), Post-Bisulfite Adaptor Tagging (PBAT), and others] with the aim to reduce the input DNA and improve the sequencing coverage [30, 31]. Many current protocols recommend a DNA input of 50–150 ng ([32], Qiagen, Illumina EpiGnome) that is definitely less than the original protocol; however, it still remains barely applicable to rare cell populations. Here, we provide detailed experimental protocol for low-input WGBS library preparation compatible with the Illumina platform. This protocol is designed for low inputs of genomic DNA (1–10 ng) still maintaining an optimal sequencing saturation rate and genome coverage. By following the procedure described in this chapter, we obtained an average of 16.3  1.5% duplicated reads (with more than 450 M reads sequenced per samples), a comparable fraction if not lower as the current standards using other protocols (as reported being between 19% and 41%) [33]. This protocol is particularly indicated for the WGBS analysis of stem, progenitor, and rare differentiated cells isolated from animal models and human samples.

2 2.1

Materials DNA Isolation

1. NucleoSpin® Tissue XS kit (Macherey-Nagel). 2. Ethanol (96–100%). 3. RNase Cocktail™ Enzyme Mix (Ambion). 4. Microcentrifuge tubes (1.5 mL). 5. Vortex mixer. 6. Thermal heating-block or thermomixer. 7. Centrifuge for microcentrifuge tubes.

2.2 DNA Quantification

1. Qubit® dsDNA HS Assay Kit (Thermo Fisher Scientific). 2. Qubit® assay tubes (Thermo Fisher Scientific). 3. Disposable tubes. 4. Qubit® fluorometer (Thermo Fisher Scientific).

2.3 Whole-Genome Bisulfite Library Preparation

1. Pico Methyl-Seq™ Library Prep Kit (ZymoResearch). 2. Ethanol (96–100%). 3. PCR tubes. 4. Thermocycler. 5. Thermal heating-block. 6. Centrifuge for microcentrifuge tubes.

Whole-Genome Bisulfite Sequencing

2.4 Quantification and Validation of the Library

357

1. Qubit® dsDNA HS Assay Kit (Thermo Fisher Scientific). 2. Qubit® Assay tubes (Thermo Fisher Scientific). 3. Disposable tubes. 4. Qubit® fluorometer (Thermo Fisher Scientific). 5. HS NGS Fragment Kit (1-6000 bp) (Agilent). 6. Fragment Analyzer System (Agilent).

2.5 Sequencing of the Library

3 3.1

1. PhiX Control v3 (Illumina). 2. HiSeq 2500 (Illumina).

Methods DNA Isolation

Genomic DNA is isolated by using the NucleoSpin® Tissue XS kit (Macherey-Nagel) (see Note 1), which is recommended for very small samples. All column purifications in this section are carried out at room temperature. Cells (up to 105 cells in total) stored in 10 μL 1 PBS (or 1 PBS supplemented with 2% FBS) at 80  C are thawed on ice and processed further, as described below: 1. Briefly centrifuge the tube containing the thawed cells for 5 min at 500  g at 4  C. 2. If necessary, aspirate carefully the excess of 1 PBS. 3. Resuspend the cell pellet in a final volume of 80 μL Lysis Buffer T1. 4. Add 4 μL of RNase Cocktail™ Enzyme Mix (see Note 2) and mix by flicking the tube or by mild vortexing for 5 s (see Note 3). 5. Incubate the sample at 37  C for 15 min. 6. Add 8 μL Proteinase K solution and mix by mild vortexing twice for 5 s. 7. Incubate the sample at 56  C for 10 min. 8. Set up the thermal heating-block temperature to 70  C for the next step. 9. Add 80 μL Lysis Buffer B3, mix by mild vortexing twice for 5 s, and incubate the sample at 70  C for 5 min. Vortex briefly at the end of the incubation. 10. Let the lysate cool down to room temperature. 11. Add 80 μL ethanol (96–100%) to the lysate, mix immediately by mild vortexing twice for 5 s, and spin down briefly to clear the lid. 12. Place a NucleoSpin® Tissue XS column into a collection tube (2 mL).

358

Anna Krepelova and Francesco Neri

13. Load the sample onto the column and centrifuge for 1 min at 11,000  g. 14. Discard the flow-through and place the column into a new collection tube (2 mL). 15. Add 50 μL Wash Buffer B5 to NucleoSpin® Tissue XS column and centrifuge for 1 min at 11,000  g. Repeat this wash step once again. 16. Discard flow-through and centrifuge the NucleoSpin® Tissue XS column for 1 min at 11,000  g to dry the membrane. 17. Transfer the NucleoSpin® Tissue XS column in a new 1.5 mL microcentrifuge tube and add 15 μL Elution Buffer BE to the center of the membrane (see Note 4). 18. Incubate for 2 min at room temperature and then centrifuge for 1 min at 11,000  g. 19. Save the isolated genomic DNA and quantify on Qubit (see Note 5). 3.2 DNA Quantification

The genomic DNA is quantified on Qubit® fluorometer (Thermo Fisher Scientific) using the dsDNA HS Assay Kit (Thermo Fisher Scientific) (see Note 6). 1. Set up two Assay Tubes for the standards and one Assay Tube for each sample. 2. In a disposable tube prepare the Qubit® Working Solution by diluting the Qubit® dsDNA HS Reagent 1:200 in Qubit® dsDNA HS Buffer. Prepare 200 μL of Working Solution for each standard and sample. 3. Mix well the Qubit® Working Solution by vortexing for 5 s. Keep at room temperature. 4. Prepare the Assay Tubes according as follows: Reagent

Standard assay tubes (μL) Sample assay tubes

Working Solution

190

198–199

Standards (#1 and #2) 10

–

Sample

–

1–2

Total Volume

200

200

5. Mix well by vortexing for 5 s and spin shortly. 6. Incubate the standards and samples for 2 min at room temperature. 7. Calibrate the Qubit® fluorometer with the standards. 8. Measure the concentration of the samples following the procedure appropriate for your instrument.

Whole-Genome Bisulfite Sequencing

359

3.3 Whole-Genome Bisulfite Library Preparation

The whole-genome bisulfite library is generated by using the Pico Methyl-Seq™ Library Prep Kit (ZymoResearch) (Fig. 3), which is designed for low genomic DNA input (see Note 7).

3.3.1 Bisulfite Conversion of Genomic DNA

All column purifications in this section are carried out at room temperature. 1. Pre-program the thermal cycler with the lid temperature set at 99  C with the following program Step

Temperature ( C)

Time

1

98

8 min

2

54

60 min

3

4

Up to 20 h

2. Mix 1–10 ng genomic DNA, adjusted with distilled water to a total volume of 20 μL and 130 μL Lightning Conversion Reagent in a PCR tube. 3. Shortly spin the tube to ensure there are no droplets in the cap or sides of the tube. 4. Incubate the mixture (a total volume of 150 μL) in a pre-programmed thermal cycler (see Note 8). 5. Load 600 μL M-Binding buffer to a Zymo-Spin™ IC column in a collection tube and add the bisulfite-converted sample (150 μL) to the column. 6. Close the lid and invert several times to mix the content. 7. Centrifuge for 30 s at full speed (10,000  g) and discard the flow-through. 8. Add 100 μL M-Wash Buffer to the column and centrifuge for 30 s at full speed (10,000  g). 9. Add 200 μL L-Desulfonation Buffer to the column and incubate at room temperature for 17 min (see Note 9). After the incubation, centrifuge for 30 s at full speed (10,000  g). 10. Add 200 μL of M-Wash Buffer to the column and centrifuge at full speed (10,000  g) for 30 s. Repeat this wash step once again. 11. Discard the flow-through and centrifuge for 1 min at full speed (10,000  g) to dry the membrane. 12. Transfer the column to a new 1.5 mL tube and add 8 μL MElution Buffer to the center of the membrane. 13. Incubate at room temperature for 2 min and then centrifuge at full speed (10,000  g) for 1 min. 14. Save the bisulfite-converted DNA for the next step. Keep on ice.

360

Anna Krepelova and Francesco Neri

Genomic DNA isolation

Bisulfite treatment and random fragmentation of DNA

NNNN

PCR amplification with random primers NNNN

PCR amplification with adapter primers

Final PCR amplification with index primers

Quality control and sequencing

5500

RFU

4500 3500

LM 2500

UM 1500 1 100

300

500

6000

Size (bp)

Fig. 3 Overview of the WGBS protocol. Isolated genomic DNA is randomly fragmented during the initial bisulfite treatment and subsequently amplified in three rounds of PCR amplification with uniquely designed primers. Library quality is checked before sequencing

Whole-Genome Bisulfite Sequencing 3.3.2 Amplification with the PrepAmp Primer

361

All steps in this section are performed on ice. 1. Dilute the PrepAmp Primer (40μM) to 20μM. 2. Pre-program the thermal cycler with the lid temperature set at 25  C with the following program (see Note 10): Step

Temperature ( C)

Time

1

98

2 min

2

8

1 min, Hold

3

Cycle 1: Spin tubes and add 5.05 μL PrepAmp mix Cycle 2: Spin tubes and add 0.3 μL PrepAmp Polymerase

4

8

4 min

5

16

1 min (Ramp rate: 0.1  C/s)

6

22

1 min (Ramp rate: 0.1  C/s)

7

28

1 min (Ramp rate: 0.1  C/s)

8

36

1 min (Ramp rate: 0.1  C/s)

9

36.5

1 min (Ramp rate: 0.1  C/s)

10

37

8 min

11

Go to step 1 and repeat for one additional cycle (Cycle 2)

12

4

Hold

3. In a PCR tube prepare the Priming Reaction by mixing 7 μL bisulfite-converted DNA with 2 μL PrepAmp Buffer (5), and 1 μL PrepAmp Primer (20μM). Keep on ice. 4. In a separate tube prepare the PrepAmp Mix by mixing 1 μL PrepAmp Buffer (5) with 3.75 μL PrepAmp Pre-mix, and 0.3 μL PrepAmp Polymerase (13 U/μL). Keep on ice. 5. Incubate the PCR tube with the Priming Reaction from the step 3 in a pre-programmed thermal cycler for a total of two amplification cycles accordingly to the program in step 2. 6. During step 3 of Cycle 1, add 5.05 μL PrepAmp Mix to the PCR tube, mix and spin shortly. Immediately put back in the thermal cycler. 7. During step 3 of Cycle 2, add only 0.3 μL PrepAmp Polymerase to the PCR tube, mix and spin shortly. Immediately put back in the thermal cycler. 3.3.3 Purification with the DNA Clean-up and Concentrator™ (DCC™)

All column purifications in this section are carried out at room temperature. Pre-warm the DNA Elution Buffer to 56  C. 1. In a 1.5 mL tube, add 100 μL DNA-Binding Buffer to the PCR product from the previous section and mix well by flicking the tube. Spin down briefly.

362

Anna Krepelova and Francesco Neri

2. Transfer the sample to a Zymo-Spin™ IC column in a collection tube and centrifuge for 30 s at full speed (10,000  g). 3. Add 200 μL DNA Wash Buffer to the column and centrifuge at full speed (10,000  g) for 30 s. Repeat this wash step once again. 4. Discard the flow-through and centrifuge for 1 min at full speed (10,000  g) to dry the membrane. 5. Transfer the column to a new 1.5 mL tube and add 12 μL DNA Elution Buffer pre-warmed to 56  C to the center of the membrane. Incubate at room temperature for 2 min and then centrifuge at full speed (10,000  g) for 1 min. 6. Save the eluate for the next step. Keep on ice. 3.3.4 Amplification with LibraryAmp Primers

All steps in this section are performed on ice. Pre-program the thermal cycler with the lid temperature set at 99  C with the following program (see Note 11). Step

Temperature ( C)

Time

Cycles

1

94

30 s

1

2

94

30 s

8

3

45

30 s

4

55

30 s

5

68

1 min

6

68

5 min

1

7

4

Hold

1

1. In a PCR tube, mix 11.5 μL purified PCR product from the previous section with 12.5 μL LibraryAmp Master Mix (2) and 1 μL LibraryAmp Primers (10μM). 2. Incubate the mixture (a total volume of 25 μL) in a pre-programmed thermal cycler for a total of eight amplification cycles. 3.3.5 Purification with the DNA Clean-up and Concentrator™ (DCC™)

All column purifications in this section are carried out at room temperature. Pre-warm the DNA Elution Buffer to 56  C. 1. In a 1.5 mL tube, add 175 μL DNA-Binding Buffer to the PCR product from the previous section and mix well. Spin down briefly. 2. Transfer the sample to a Zymo-Spin™ IC column in a collection tube and centrifuge for 30 s at full speed (10,000  g).

Whole-Genome Bisulfite Sequencing

363

3. Add 200 μL DNA Wash Buffer to the column and centrifuge at full speed (10,000  g) for 30 s. Repeat this wash step once again. 4. Discard the flow-through and centrifuge for 1 min at full speed (10,000  g) to dry the membrane. 5. Transfer the column to a new 1.5 mL tube and add 12.5 μL DNA Elution Buffer pre-warmed to 56  C to the center of the membrane. Incubate at room temperature for 2 min and then centrifuge at full speed (10,000  g) for 1 min. 6. Save the eluate for the next step. Keep on ice. 3.3.6 Amplification with Index Primer

All steps in this section are performed on ice. Pre-program the thermal cycler with the lid temperature set at 99  C with the following program: Step

Temperature ( C)

Time

Cycles

1

94

30 s

1

2 3 4

94 58 68

30 s 30 s 1 min

10

6

68

5 min

1

7

4

Hold

1

1. In a PCR tube, mix 12 μL purified PCR product from the previous section with 12.5 μL LibraryAmp Master Mix (2) and 0.5 μL Index Primer (10μM). 2. Incubate the mixture (a total volume of 25 μL) in the pre-programmed thermal cycler for a total of ten amplification cycles. 3. Purify the final PCR product exactly in the same way as described in the Subheading 3.3.5. 4. Quantify the library on Qubit and validate its size using Fragment Analyzer System (Agilent) or similar. 5. Store the library at 3.4 Quantification and Validation of Library

20  C.

The library is quantified on Qubit® fluorometer (Thermo Fisher Scientific) using the dsDNA HS Assay Kit (Thermo Fisher Scientific). Subsequently, size and purity of the library are evaluated on Fragment Analyzer System (Agilent) using the HS NGS Fragment Kit (1–6000 bp) (Agilent) (see Note 12). 1. Quantify the concentration of the library as described in the Subheading 3.2. 2. Use 1 μL of the library for quantification (see Note 13).

364

Anna Krepelova and Francesco Neri 5500

6000

5000 1500

4500

RFU

4000 500

3500 3000

300

LM

2500 UM

2000

100

1500 1

1

100 300 Size (bp)

500

1500 6000

Fig. 4 Quality check of the WGBS library. Size distribution profile of the final WGBS library analyzed by Fragment Analyzer (Agilent). RFU relative fluorescence unit, LM lower marker; UM upper marker

3. Analyze size and purity of the library on Fragment Analyzer System (Agilent) (Fig. 4). Depending on the concentration of the library use 0.5–1 μL for quality control. The maximum total DNA concentration per well which can be loaded using the HS NGS Fragment Kit is 10 ng. 3.5 Sequencing of the Library

The WGBS library generated with the Pico Methyl-Seq™ Library Prep Kit (ZymoResearch) is compatible with Illumina’s TruSeq chemistries for the HiSeq™ and MiSeq™ sequencing platforms. Each library should be sequenced to obtain at least 45–60 Gb of sequencing reads corresponding to a 15–20 genomic coverage (calculated for human and mouse genomes). Further information can be found here [34]. During WGBS library preparation the majority of the non-CpG cytosines are converted to thymine, thus largely reducing the base composition diversity of the sequencing libraries. For this reason, it is recommended to spike in an unconverted DNA (e.g., PhiX DNA) in the WGBS sequencing run on Illumina Platforms. Further recommendation can be found at the following link: https://support.illumina.com/ bulletins/2017/02/how-much-phix-spike-in-is-recommendedwhen-sequencing-low-divers.html. The three PCR-based amplification steps can decrease the library complexity increasing the sequencing saturation and lead to libraries that can hardly reach a recommended genomic coverage without sequencing more than the expected number of bases. During initial experiments and protocol establishment, we strongly recommend to perform a small pilot sequencing experiment to assess the library complexity. Further information about sequencing library complexity, how to assess it, and available software can

Whole-Genome Bisulfite Sequencing

Promoter

365

Enhancer

mESC

ISC

H3K4me1 H3K27ac

Slc2a3

Fig. 5 Genomic view of WGBS sequencing reads. Orange highlight shows the enhancer region (marked by H3K4me1 and H3K27ac histone modifications) and blue highlight shows the promoter region of the Slc2a3 gene gaining DNA methylation in the intestinal stem cells (ISCs) with respect to the mouse embryonic stem cells (mESCs)

be found at the following link: http://smithlabresearch.org/soft ware/preseq/, https://github.com/smithlabcode/preseq. Sequenced reads can be visualized on different genome browsers like Integrative Genomics Viewer (IGV - https://software. broadinstitute.org/software/igv/igvtools) or UCSC genome browser (https://genome.ucsc.edu/). Figure 5 shows an example of a genomic view of sequenced reads from different WGBS experiments. The picture highlights a promoter and an enhancer region showing differential methylation level in different cell types.

4

Notes 1. There are several kits for genomic DNA isolation from different kinds of starting material like cells, tissues, blood, etc. In our laboratory, we use the NucleoSpin® Tissue XS kit for the isolation of genomic DNA from very small samples. The NucleoSpin® Tissue XS Columns have a special funnel designed with a significantly reduced dead volume thus allowing very small elution volumes and highly concentrated DNA. 2. For library construction the input DNA must be free of contaminating RNA. In this protocol, RNase Cocktail Enzyme

366

Anna Krepelova and Francesco Neri

Mix (Ambion) is used instead of RNase A. This enzyme mix contains both RNase A and RNase T1. The use of both enzymes together leads to a higher reduction in RNA fragment size than the use of individual enzymes. 3. Harsh vortexing should be avoided during genomic DNA isolation and manipulation because it leads to its fragmentation. 4. The elution volume depends on the starting amount of material used (number of cells) and on the amount supposed to be used for library preparation (e.g., a part of the isolated DNA may be stored for further experiments). It is recommended to elute the isolated genomic DNA with 5–30 μL Elution buffer. 5. If a very low number of cells is used (less than 103 cells), the quantification step can be omitted. The eluted genomic DNA can be directly used for bisulfite conversion. In that case, the elution volume should not exceed 20 μL. If not all the isolated genomic DNA is used for library construction, then it should be stored at 80  C for long-term storage. 6. There are different methods to quantify the genomic DNA concentration (NanoDrop, PicoGreen). In our laboratory, we routinely use Qubit fluorometer as it is a very accurate method to measure very low concentrations of DNA. The dsDNA HS Assay Kit (Thermo Fisher Scientific) is optimal for initial sample concentrations from 10 pg/μL to 100 ng/μL. 7. In our laboratory, we routinely use between 1 and 10 ng genomic DNA input. 8. The 4  C PCR step 3 is optional. We always process the bisulfite conversion till completion as soon as possible. 9. The incubation with L-Desulfonation Buffer should not exceed 20 min because it may lead to degradation of input DNA. 10. The lid temperature should not exceed 40  C. The PrepAmp Polymerase is not heat stable and will be denatured at high temperatures. 11. The number of PCR cycles depends on the starting input of genomic DNA. For genomic DNA input between 1 and 10 ng, eight (8) PCR cycles in total are recommended. 12. In our laboratory, we use Fragment Analyzer System for quality control of the libraries. The Agilent 2100 Bioanalyzer System is another accurate method that can be used. If these methods are not available in the laboratory, then library size and purity can be evaluated on a 2% agarose gel. 13. Total yield of the library should be between 100 ng and 250 ng starting with 1–10 ng genomic DNA input. The size of the WGBS library should range from 150 to 500 bp.

Whole-Genome Bisulfite Sequencing

367

Acknowledgments This work was supported by funding from the Alexander von Humboldt foundation (1164767-ITA-SKP), Fritz Thyssen Foundation grant (10.17.2.021MN), and the Leibniz Institute on Aging (FLI). References 1. Okano M, Bell DW, Haber DA, Li E (1999) DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development. Cell 99:247–257. https://doi.org/10.1016/s0092-8674(00) 81656-6 2. Pontier DB, Gribnau J (2011) Xist regulation and function eXplored. Hum Genet 130:223–236. https://doi.org/10.1007/ s00439-011-1008-7 3. Reik W, Walter J (2001) Genomic imprinting: parental influence on the genome. Nat Rev Genet 2:21–32. https://doi.org/10.1038/ 35047554 4. Li E (2002) Chromatin modification and epigenetic reprogramming in mammalian development. Nat Rev Genet 3:662–673. https:// doi.org/10.1038/nrg887 5. Smith ZD, Meissner A (2013) DNA methylation: roles in mammalian development. Nat Rev Genet 14:204–220. https://doi.org/10. 1038/nrg3354 6. Jones PA (2002) DNA methylation and cancer. Oncogene 21:5358–5360. https://doi.org/ 10.1038/sj.onc.1205597 7. Ermolaeva M, Neri F, Ori A, Rudolph KL (2018) Cellular and epigenetic drivers of stem cell ageing. Nat Rev Mol Cell Biol 19:594–610. https://doi.org/10.1038/ s41580-018-0020-3 8. Xu G-L, Bestor TH, Bourc’his D et al (1999) Chromosome instability and immunodeficiency syndrome caused by mutations in a DNA methyltransferase gene. Nature 402:187–191. https://doi.org/10.1038/ 46052 9. Bestor TH (2000) The DNA methyltransferases of mammals. Hum Mol Genet 9:2395–2402. https://doi.org/10.1093/ hmg/9.16.2395 10. Agirre X, Castellano G, Pascual M et al (2015) Whole-epigenome analysis in multiple myeloma reveals DNA hypermethylation of B cellspecific enhancers. Clin Lymphoma Myeloma Leukemia 15:e86–e87. https://doi.org/10. 1016/j.clml.2015.07.243

11. Schmidl C, Klug M, Boeld TJ et al (2009) Lineage-specific DNA methylation in T cells correlates with histone methylation and enhancer activity. Genome Res 19:1165–1174. https://doi.org/10.1101/gr. 091470.109 12. Stadler MB, Murr R, Burger L et al (2011) DNA-binding factors shape the mouse methylome at distal regulatory regions. Nature 480:490–495. https://doi.org/10.1038/ nature10716 13. Thurman RE, Rynes E, Humbert R et al (2012) The accessible chromatin landscape of the human genome. Nature 489:75–82. https://doi.org/10.1038/nature11232 14. Hahn MA, Wu X, Li AX et al (2011) Relationship between gene body DNA methylation and intragenic H3K9me3 and H3K36me3 chromatin marks. PLoS One e18844:6. https:// doi.org/10.1371/journal.pone.0018844 15. Maunakea AK, Chepelev I, Cui K, Zhao K (2013) Intragenic DNA methylation modulates alternative splicing by recruiting MeCP2 to promote exon recognition. Cell Res 23:1256–1269. https://doi.org/10.1038/cr. 2013.110 16. Maunakea AK, Nagarajan RP, Bilenky M et al (2010) Conserved role of intragenic DNA methylation in regulating alternative promoters. Nature 466:253–257. https://doi.org/ 10.1038/nature09165 17. Neri F, Rapelli S, Krepelova A et al (2017) Intragenic DNA methylation prevents spurious transcription initiation. Nature 543:72–77. https://doi.org/10.1038/nature21373 18. Sheaffer KL, Kim R, Aoki R et al (2014) DNA methylation is required for the control of stem cell differentiation in the small intestine. Genes Dev 28:652–664. https://doi.org/10.1101/ gad.230318.113 19. Ziller MJ, Ortega JA, Quinlan KA et al (2018) Dissecting the functional consequences of de novo DNA methylation dynamics in human motor neuron differentiation and physiology. Cell Stem Cell 22:559–574.e9. https://doi. org/10.1016/j.stem.2018.02.012

368

Anna Krepelova and Francesco Neri

20. Go¨ttgens B, Nastos A, Kinston S et al (2002) Establishing the transcriptional programme for blood: the SCL stem cell enhancer is regulated by a multiprotein complex containing Ets and GATA factors. EMBO J 21:3039–3050. https://doi.org/10.1093/emboj/cdf286 21. Adam RC, Yang H, Rockowitz S et al (2015) Pioneer factors govern super-enhancer dynamics in stem cell plasticity and lineage choice. Nature 521:366–370. https://doi.org/10. 1038/nature14289 22. Singh SA, Lerdrup M, Gomes A-LR et al (2019) PLZF targets developmental enhancers for activation during osteogenic differentiation of human mesenchymal stem cells. elife 8: e40364. https://doi.org/10.7554/elife. 40364 23. Choukrallah M-A, Song S, Rolink AG et al (2015) Enhancer repertoires are reshaped independently of early priming and heterochromatin dynamics during B cell differentiation. Nat Commun 6:8324. https://doi.org/ 10.1038/ncomms9324 24. Rauch TA, Pfeifer GP (2011) Handbook of epigenetics. Sect III Epigen Technol 2011:135–147. https://doi.org/10.1016/ b978-0-12-375709-8.00009-5 25. Susan JCI, Harrison J, Paul CL, Frommer M (1994) High sensitivity mapping of methylated cytosines. Nucleic Acids Res 22:2990–2997. https://doi.org/10.1093/nar/22.15.2990 26. Hayatsu H (2008) Discovery of bisulfitemediated cytosine conversion to uracil, the key reaction for DNA methylation analysis—A personal account. Proc Jpn Acad Ser B 84:321–330. https://doi.org/10.2183/pjab. 84.321 27. Meissner A, Gnirke A, Bell GW et al (2005) Reduced representation bisulfite sequencing

for comparative high-resolution DNA methylation analysis. Nucleic Acids Res 33:5868–5877. https://doi.org/10.1093/ nar/gki901 28. Gu H, Smith ZD, Bock C et al (2011) Preparation of reduced representation bisulfite sequencing libraries for genome-scale DNA methylation profiling. Nat Protoc 6:468–481. https://doi.org/10.1038/nprot.2010.190 29. Lister R, Pelizzola M, Dowen RH et al (2009) Human DNA methylomes at base resolution show widespread epigenomic differences. Nature 462:315–322. https://doi.org/10. 1038/nature08514 30. Miura F, Enomoto Y, Dairiki R, Ito T (2012) Amplification-free whole-genome bisulfite sequencing by post-bisulfite adaptor tagging. Nucleic Acids Res 40:e136. https://doi.org/ 10.1093/nar/gks454 31. Wang Q, Gu L, Adey A et al (2013) Tagmentation-based whole-genome bisulfite sequencing. Nat Protoc 8:2022–2032. https://doi.org/10.1038/nprot.2013.118 32. Jeong M, Guzman AG, Goodell MA (2017) Methods in molecular biology. Method Mol Biol Clifton N J 1633:137–149. https://doi. org/10.1007/978-1-4939-7142-8_9 33. Zhou L, Ng HK, Drautz-Moses DI et al (2019) Systematic evaluation of library preparation methods and sequencing platforms for high-throughput whole genome bisulfite sequencing. Sci Report 9:10383. https://doi. org/10.1038/s41598-019-46875-5 34. Ziller MJ, Hansen KD, Meissner A, Aryee MJ (2015) Coverage recommendations for methylation analysis by whole-genome bisulfite sequencing. Nat Methods 12:230–232. https://doi.org/10.1038/nmeth.3152

Correction to: Enhancers and Promoters Tilman Borggrefe and Benedetto Daniele Giaimo

Correction to: Chapters 4 and 11 in: Tilman Borggrefe and Benedetto Daniele Giaimo (eds.)), Enhancers and Promoters: Methods and Protocols, Methods in Molecular Biology, vol. 2351, https://doi.org/10.1007/978-1-0716-1597-3_21 Chapters 4 and 11 were previously published non-open access. They have now been changed to open access under a CC BY 4.0 license and the copyright holder updated to ‘The Author(s)’. The book has been updated with these changes.

The updated online version of the book can be found at https://doi.org/10.1007/978-1-0716-1597-3_4 https://doi.org/10.1007/978-1-0716-1597-3_11 Tilman Borggrefe and Benedetto Daniele Giaimo (eds.), Enhancers and Promoters: Methods and Protocols, Methods in Molecular Biology, vol. 2351, https://doi.org/10.1007/978-1-0716-1597-3_21, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

C1

INDEX A Accutase ................................................................ 276, 279 Acetic acid (AA; CH3COOH) ..................................... 258 Acetonitrile (CAN; CH3CN) acetonitrile wash buffer........................................... 257 Adaptor ...............................................7, 8, 33, 34, 76–79, 83, 84, 101, 109–111, 116, 119, 341, 343, 344 Adenosine 5’-Triphosphate (ATP)......................... 28, 33, 49, 57, 63, 245, 325, 328, 331 Agarose ................................................. 27–31, 35–37, 96, 98, 99, 126, 131, 132, 137, 142, 149, 153, 156, 171–174, 185, 194, 197, 213, 218, 222, 223, 232, 236, 243, 256, 260, 261, 295, 326, 327, 350, 366 Ak0380........................................................................... 142 Alexa Fluor 568............................................................. 310 α-amanitin ............................................. 42, 43, 45–47, 62 Amino acid .................................................. 147, 271, 293 Ammonium acetate (NH4OAc) ..................................... 95 Ammonium bicarbonate (AmBic)...............................257, 258, 263, 277, 284, 287 Ammonium hydroxide (NH4OH)............................... 258 Ammonium sulfate ((NH4)2SO4) ............................... 293 ApoI ............................................ 166, 171–174, 176, 177 Aprotinin ...............................................95, 101, 125, 256 ARS-binding factor 1 (Abf1)...................... 290, 297, 299 ATAC-See ...................................................................... 118 ATAC-Seq.......................................................... 4, 6, 8–10, 13, 15, 105–120, 323, 332, 338 A-tailing mixture .................................................. 233, 237

B BbsI............................................. 322, 325–327, 330, 331 Benzonase.......................................................62, 276, 281 Bestatin .......................................................................... 125 β-globin ............................................................................. 4 Betaine ................................................................ 30, 35, 38 Binding buffer (BB) .................................................27–29, 32, 184, 191, 214, 219, 233, 241, 322, 361, 362 Bio-Spin Column ......................................................27, 31 Biotin-7dATP .............................................. 276, 282, 286 Biotin-14-dATP .......................................... 183, 186, 213 Biotin-dCTP................................................ 276, 283, 287 Biotin-ddUTP ............................................. 276, 283, 287

Biotin (long arm) Hydrazide....................................71, 81 BisChIP-Seq .................................................................. 338 Bisulfite ............................ 4, 13, 118, 337–351, 353–367 Bovine serum albumin (BSA).........................27, 29, 183, 186–191, 213, 216, 232, 243, 257, 276, 283, 325, 339, 343 BpiI ............................................. 322, 325–328, 330, 331 Bradford assay ............................................................... 261 Bromodomain-containing protein 4 occupancy (BRD4)................................................ 4 Bromophenol Blue....................................................27–29 5-Bromouridine-50 -triphosphate (Br-UTP) ............25, 26 BsmBI ..................................................322, 326, 330, 331 Buffer blocking buffer ...................27, 29, 32, 261, 262, 312 buffer I...................................... 95, 97, 152, 155, 158 buffer II ................................................. 153, 155, 158 buffer III......................................................... 154, 158 buffer V.................................................. 126, 133, 141 buffer A................................. 264, 265, 270, 293, 294 buffer A solution ............................................ 264, 270 buffer B solution ..................................................... 258 B&W buffer.................................................... 233, 237 cell lysis buffer ................................................ 214, 215 ChIP elution buffer (EB) ....................................... 126 ChIP Incubation buffer .......................................... 261 ChIP Lysis Buffer (L3B) ........................................ 339 ChIP Wash Buffer ................................................... 127 ChIP Wash Buffer 1 (WB1) ................................... 339 ChIP Wash Buffer 2 (WB2) ................................... 339 cytoplasmic lysis buffer ............................................. 46 dialysis buffer.................................................. 260, 268 dialysis buffer I ........................................................ 150 dialysis buffer II....................................................... 150 digestion buffer for cell in suspension ...............95, 96 dilution buffer ................................................ 188, 190 DNA soaking buffer.................................................. 46 elution buffer.............................................32, 36, 265, 339, 343–345, 358, 361–363 extraction buffer............................................. 184, 188 FAIRE lysis buffer.......................................... 214, 217 formamide loading buffer (FLB) ....................... 27–29 glycerol buffer ........................................................... 51 Hi-C Lysis buffer .................................................... 185 high-salt RIPA buffer.............................................. 188

Tilman Borggrefe and Benedetto Daniele Giaimo (eds.), Enhancers and Promoters: Methods and Protocols, Methods in Molecular Biology, vol. 2351, https://doi.org/10.1007/978-1-0716-1597-3, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

369

ENHANCERS AND PROMOTERS: METHODS AND PROTOCOLS

370 Index

Buffer (cont.) high-salt wash buffer...........................................28, 29 HT1 buffer ................................................................ 85 IP buffer .................................................................. 283 LB3 .......................................................................... 281 LiCl buffer ...................................................... 159, 188 low-EDTA TE (T low-E) ....................................... 296 low-salt wash buffer ............................................27, 29 low TE buffer ........................................ 236, 238, 240 lysis buffer..................................................30, 98, 110, 119, 170, 174, 215, 339, 357 lysis buffer L1 ................................................. 125, 129 MNase digestion buffer .............................95, 97, 154 NaCl wash buffer ........................................... 277, 284 N-Buffer solution........................................... 256, 259 Nuclear Run-On Buffer............................................ 31 Nuclei buffer .......................................................95, 97 Nuclei buffer II ...................................................95, 97 Nuclei buffer III.........................................95, 97, 102 nuclei lysis buffer.................................................46, 51 nuclei wash buffer ...............................................46, 51 PBS-T ............................................276, 277, 279, 280 propanol wash buffer ..................................... 277, 284 resuspension buffer ................................................... 51 RIPA buffer ................................... 158–160, 188, 191 RNase resuspension solution.................................. 293 SCX elution buffer .................................................. 265 SDS wash buffer .................................... 276, 284, 285 shearing buffer ............................................... 187, 190 sonication buffer ............................................ 276, 281 SSC buffer ...........................................................49, 58 SSPE..................................................................... 27–29 STOP solution ........................................................ 294 sucrose buffer ............................................................ 46 suspension cell buffer................................................ 96 TAE .......................................................................... 149 tagmentation DNA buffer ............................. 339, 344 tango buffer.................................................... 325, 330 TBE........................................................ 49, 53, 60, 96 TBE-urea .............................................................49, 63 TBU .............................................................. 49, 53, 56 TB&W buffer .......................................................... 237 TE buffer ...................................................83, 84, 115, 158–160, 184, 188, 189 triethylammonium bicarbonate buffer (TEAB) .............................................................. 277 Tris-acetate-EDTA .................................................. 149 Tris-borate-EDTA..................................................... 96 Tris-HCl ................................................26, 27, 29–31, 46–49, 61, 71, 72, 81, 85, 95, 96, 115, 125–127, 150, 151, 168, 169, 171, 183–185, 189, 192–194, 213, 214, 217–219, 222, 232, 233, 256, 257, 276, 277, 279, 281, 282, 286, 293, 295, 296, 339

Tris-HCl-EDTA-Tween buffer .............................. 339 Tween Washing Buffer (TWB)...................... 184, 214 Wash Buffer D ....................................... 126, 129, 140 Washing Buffer A ........................................... 257, 261 Washing Buffer B ........................................... 257, 261 Washing Buffer C ........................................... 257, 261

C Ca2+ ................................................................................ 295 Cage-Associated Transcripts (CAT).................. 70, 86–88 Calcium chloride (CaCl2) ....................................... 62, 95, 126, 150, 256, 293, 294 Calling Card-Seq........................................................... 290 CAP cap analysis of gene expression (CAGE)................. 14, 68, 201 cap immunoprecipitation sequencing ...................... 14 CAPIP-Seq ................................................................ 14 DECAP-Seq .............................................................. 14 Capture C/Hi-C ........................................................... 181 3C-Carbon Copy (5C) ................................................... 11 CCCTC binding factor (CTCF) ........................ 166, 183, 186, 187, 197, 198, 350, 351 C-C Motif Chemokine Ligand 22 (Ccl22) ................. 142 cDNA................................................................. 25, 42–44, 49, 54, 57, 58, 81–85, 89 CHiCAGO .................................................................... 242 ChiCMaxima ........................................................ 242, 243 ChIP-BisSeq .................................................................. 338 ChIP-bisulfite ................................................................ 338 ChIPmentation ..............................................13, 338, 351 ChIP-MNase ............................................. 4, 10, 123–144 ChIP-reChIP sequential ChIP (reChIP)........................................... 9 Chloroform ................................................ 27, 30, 35, 36, 46, 51, 95, 169, 172, 174, 177, 197, 212, 213, 217, 218, 232, 235, 293, 294, 296 Chromatin conformation capture (3C) ................ 10, 181 Chromatin conformation capture (3C)-on-C (4C)................................................... 11 Chromatin endogenous cleavage sequencing (ChEC-Seq) ......................................4, 9, 289–300 Chromatin immunocleavage (ChIC)........................... 290 Chromatin immunoprecipitation (ChIP; ChIP-qPCR) ............................... 281, 285, 289, 290, 300, 337, 338 Chromatin immunoprecipitation linked to micrococcal nuclease mapping .............................................. 289 Chromatin immunoprecipitation sequencing (ChIP-Seq) ....................................... 15, 144, 181, 186, 195, 196, 198, 211, 243, 275, 276, 285, 289, 290, 300 Chromatin immunoprecipitation with bisulfite sequencing ........................................... 337

ENHANCERS Chromatin interaction analysis by paired-end tag sequencing (ChIA-PET) ..................................... 11 Chromatin resuspension solution .................................. 47 Chromocenters..................................................... 307–318 CircLigase ..................................................................49, 57 Cis-regulatory elements (CREs) ...................................... 5 Cleavage under targets and release using nuclease (CUT&RUN) .................................... 290 Cleavage under targets and tagmentation (CUT&TAG) .................................................... 290 Coiled-coil domain-containing protein 158 (Ccdc158).......................................................... 142 CpG islands ......................... 4, 12, 13, 93, 337, 354, 355 CRISPR/Cas9 CRISPRa......................................................... 321, 332 CRISPRi ......................................................... 321, 332 dCas9 .............................................................. 307–318 dCas9-GFP ........................... 308, 309, 313, 316–318 dCas9-GFP-VPR.................. 308, 309, 313, 317, 318 NGG ........................................................................ 325 single guide RNA (sgRNA)............................ 10, 308, 311, 321–323, 325–327, 329–334 C-technologies .............................................................. 181 C-terminal domain (CTD) ............................................... 5 CXXC finger protein 1 (CFP1)...................................... 13 Cytosine ................................................. 12, 353–355, 364

D D6-acetic anhydride .................................... 257, 263, 270 dBTP.............................................................................. 282 Deep sequencing .............................................7, 9, 11, 12, 42, 43, 182, 198 Deoxyadenosine triphosphate (dATP) .......................214, 220, 232, 233, 282, 340 Deoxycytidine triphosphate (dCTP)...........................183, 186, 213, 216, 340 Deoxyguanosine triphosphate (dGTP).......................183, 186, 213, 216, 232, 340 Deoxynucleoside triphosphate (dNTP)................. 35, 49, 54, 59, 71, 214, 220, 233, 238, 326, 340, 344 Deoxythymidine triphosphate (dTTP) .......................183, 186, 213, 216, 232, 340 Dextrose ........................................................................ 293 40 ,6-Diamidino-2-phenylindole (DAPI) ....................307, 308, 310, 312–315, 317, 318 Digitonin ..................................................... 291, 293, 294 Dimethylformamide...................................................... 339 Dimethyl sulfoxide (DMSO).................................. 50, 52, 71, 233, 238, 277, 285, 293, 311, 317 Dithiothreitol (DTT)........................................26, 28, 29, 34, 46, 49, 56, 79, 95, 101, 126, 129, 150–154, 158, 160, 256, 257, 261, 269, 277, 284, 325, 328 DNA adenine methyltransferase identification (DamID) ............................................................ 290

AND

PROMOTERS: METHODS

AND

PROTOCOLS Index 371

DNA–DNA interactions ............................................... 211 DNA Gel Loading Dye................................................... 30 DNA methylation (DNAme) ............................. 4, 12–13, 93, 118, 307, 337, 340, 353, 354, 365 DNA methyltransferase (DNMT) DNMT1 .................................................................... 13 DNMT3A .................................................................. 13 DNMT3B .................................................................. 13 DNMT3L .................................................................. 13 DNA polymerase (DNAP) ..................................... 30, 35, 50, 59, 213, 214, 216, 220, 232, 233, 238, 326, 331, 340, 344 DNA–protein interactions ............................................ 211 DNaseI DNase I hypersensitive site (DHS) ...................86–88, 106, 107, 148 Double-stranded DNA (dsDNA) .......................... 30, 43, 45, 61, 116, 149, 151, 156, 160, 177, 184, 189, 194, 214, 232, 236, 342, 356–358, 363, 366 DpnII ................................... 11, 165, 173, 174, 177, 225 Dulbecco’s modified Eagle medium (DMEM)................................ 125, 168, 170, 231, 235, 254, 259, 310, 311, 317

E Easy Hi-C (eHi-C).......................................................... 11 Electrophoretic mobility shift assay (EMSA) .................. 5 Elements overlap expression quantitative trait loci (eQTL).................................................. 68 Embryonic stem cells (ESCs; ES) mouse embryonic stem cells (mESCs).......... 203, 365 Encyclopedia of DNA Elements (ENCODE) ......................................................... 50 Enhancer enhancer lncRNA (e-lncRNA) .................... 70, 86, 87 enhancer RNA (eRNA) ..................14, 25, 41, 67, 68 EP300 ........................................................................6, 8, 9 EpiMethylTag............................................ 4, 13, 338, 349 Esp3I....................................................322, 326, 330, 331 Ethanol (EtOH)...................................................... 27, 28, 31–33, 35–37, 46, 51, 58, 61, 71, 80, 81, 95, 98, 110, 115, 120, 126, 150, 151, 156, 169, 172–174, 184, 193, 197, 213, 218, 219, 222, 232, 236, 238, 277, 286, 293, 295, 296, 312, 340, 342, 344, 348, 356, 357 Ethylenediaminetetraacetic acid (EDTA) ...............26–31, 33, 46, 49, 71, 72, 95–98, 125–127, 130, 131, 134, 149–151, 155, 183, 184, 213, 214, 232, 233, 256, 257, 260, 276, 277, 282, 287, 293, 296, 310, 339, 344 Ethylene glycol-bis(β-aminoethyl ether)-N,N,N0 , N0 -tetraacetic acid (EGTA)................................. 95 Eukaryotic translation elongation factor 1 alpha 1 (EEF1A1) ............................................... 99

ENHANCERS AND PROMOTERS: METHODS AND PROTOCOLS

372 Index F

Fall into peak regions (FRiP) .............187, 195, 196, 198 Fetal calf serum (FCS) ............................... 125, 168, 170, 310, 311, 317 5-hydroxymethylcytosine (5hmC) ................................. 13 5-methylcytosine (5mC)............................................... 353 5’-riboadenylate (5’-rApp) .......................................43, 47 50 -untranslated region (5’-UTR) ................................. 205 Foetal bovine serum (FBS).................110, 254, 259, 357 Formaldehyde formaldehyde-assisted isolation of regulatory elements (FAIRE) ............................................. 107 Formamide ................................................................27–29 Formic Acid (FA; CH2O2) ......................... 258, 277, 285 Functional Annotation of the Mammalian Genome (FANTOM)............................. 70, 86–88

G Gal4.................................................................................... 3 Gene ontology (GO) .................................................... 278 General transcription factors (GTFs) ............................... 5 Genome architecture .................................................... 166 Genome-wide ........................................... 5, 9, 25, 41, 42, 93, 106, 107, 124, 181, 202, 211, 212, 229, 251, 289–300, 354 Genome-wide association studies (GWAS) .......... 68, 212 Global run-on sequencing (GRO-Seq) ...................25–38 Glucose .......................................................................... 324 Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) ............................................................ 62 Glycerol..................................................... 26, 46, 95, 125, 126, 150, 338, 342 Glycine .......................................150, 152, 168, 170, 183, 185, 213, 215, 232, 235, 276, 280, 339, 343 GlycoBlue .................................27, 28, 30–33, 35, 49, 60 Glycogen.............................. 36, 172, 174, 213, 218, 219 Green fluorescent protein (GFP) ........................ 308, 312

H HEPES..................................................... 46, 95, 150, 256 Heterochromatin protein 1 (HP1) .............................. 307 Hi-C......................................................4, 11, 12, 15, 166, 181–183, 185, 194, 195, 211, 212, 215, 229–231, 236, 238–242, 245, 246 HiChIP ................................ 12, 181, 182, 195, 211, 231 HiC-Pro...............................................212, 215, 224, 242 HiCUP........................................................................... 242 High-Throughput systematic evolution of ligands by exponential enrichment (HT-SELEX) ............. 337 HindIII ..................................................11, 232, 235, 236 Histone H2A ................................................................ 147, 148 H2A.Z ......................................................7, 9, 93, 148

H2B .................................................................. 62, 147 H3 ...................................................13, 147, 231, 243, 251–255, 263, 270, 307, 308 H3.3........................................................................... 93 H3K4ac.................................................................... 255 H3K4me1.................... 6–8, 252, 255, 271, 272, 365 H3K4me2................................................................ 255 H3K4me3............................... 6, 7, 13, 148, 252, 255 H3K9me3.......................................... 7, 252, 272, 307 H3K27ac .............................. 6–8, 252, 271, 308, 365 H3K27me3 ................................................7, 148, 243 H3K36me3 ............................................................. 148 H4 ................................ 147, 251, 252, 254, 263, 269 H4ac ........................................................................ 6, 8 HpaII ............................................................................. 354 Hubs of open chromatin interactions (HOCIs) .......................................... 212, 223, 225 Hydrogen chloride (HCl) ...................... 47, 56, 168, 169

I IGEPAL CA-630 .................................................... 95, 97, 102, 107, 119, 158, 183, 184, 232, 339 IgG........................................................13, 183, 187, 189, 190, 278, 281, 284, 285, 310, 351 Immunoprecipitation (IP) ..............................7, 9, 11, 42, 124, 133, 141, 147–161, 181, 182, 186, 189, 196, 197, 251, 252, 254, 259, 261, 267, 268, 276, 282, 283, 289, 338, 351 Interferon regulatory factor 1 (IRF1) .....................6, 8, 9 Interferon regulatory factor 8 (IRF8) .....................6, 8, 9 Interleukin 12b (Il12b) ................................................ 142 Intestinal stem cells (ISC) ............................................ 365 Iodoacetimide (IAA)......................................35, 277, 284 Isoamyl alcohol (IAA).....................................30, 95, 169, 172, 174, 177, 213, 217, 218, 232, 235, 293, 294, 296 Isopropanol ............................................. 58, 60, 232, 236

J Juicer.............................................................................. 242

K Klenow............................................... 183, 186, 213, 214, 216, 220, 232, 233, 276, 282, 286 Kruppel-like factor 4 (KLF4) ....................................... 351

L Label-free quantification (LFQ).......................... 254, 255 Latent enhancer............................................................. 7–9 Leucine-rich repeat-containing protein 4C (Lrrc4c) .............................................................. 142 Leupeptin ............................................................. 125, 256 LG268 ............................................................................. 37

ENHANCERS Linear acrylamide ........................................ 293, 295, 298 Lithium chloride (LiCl) ................. 71, 82, 151, 184, 339 Locus control region (LCR) ....................................3, 4, 6 Long intergenic noncoding genes (lincRNA) ............................................................ 25 Long noncoding RNA (lncRNA) ............................70, 86 Low input targeted chromatin capture (Low-T2C) ............................................... 165–177 Low quantity single strand CAGE (LQ-ssCAGE)................................................67–89 Luria-Bertani (LB) ........................................................ 324 LB-ampicillin plates ................................................ 324 LB liquid medium ................................................... 324 LysC............................................................. 277, 284, 285

M Magnesium acetate (Mg acetate) ........................ 126, 325 Magnesium chloride (MgCl2) ................................ 26, 28, 32, 95, 109, 150, 256, 324, 339 Magnetic beads ........................................ 49, 57, 58, 153, 158, 183, 245, 261, 276, 277, 282–284, 339, 344, 346 Manganese(II) chloride (MnCl2).............................49, 57 MAPS............................................. 67–89, 101, 102, 123, 138, 166, 167, 176, 195, 204, 207, 209, 223, 224, 242, 243, 291 Mass spectrometry (MS)..................................... 148, 251, 252, 254, 255, 257–259, 265–266, 269–271, 275, 277, 278, 284, 285 M-ATAC ............................ 338, 339, 342–344, 349–351 MboI ........................................................... 183, 186, 194, 212, 213, 216, 224, 225 M-ChIP ...................................... 338, 342, 344, 348–351 Mediator Med1........................................................................ 323 MED8...................................................................... 292 Methanol (MeOH) .................................... 149, 152, 161, 258, 264, 270 Methyl-ATAC-Seq (mATAC-Seq) ............................... 118 Methylated DNA-binding domain (MBD) ................... 13 Methylated DNA immunoprecipitation sequencing (MeDIP-Seq) ................................. 354 Methyl-CpG binding domain sequencing (MBD-Seq) ........................................................ 354 Mg2+ ................................................................................ 63 Microarray .......................................................... 7, 11, 107 Micrococcal Nuclease (MNase) MNase-Seq ........................... 4, 10, 93–102, 107, 108 Minichromosome maintenance 2-7 (Mcm2-7) .......................................................... 291 MmeI .........................................................................11, 12 Mn2+ ................................................................................ 63 Mononucleosomal DNA ...........134, 136, 139, 142, 157 Monophosphate .............................................................. 14

AND

PROMOTERS: METHODS

AND

PROTOCOLS Index 373

Monopotassium phosphate (KH2PO4) ............... 95, 125, 150, 151, 256 Mouse Erythroleukemia Cells (MEL) ........................168, 172–174 Mouse oligodendrocyte progenitor cell (mOPC) .................................................... 207, 208 MS-extracted ion chromatogram (XIC) .....................254, 255, 266, 267 MspI............................................................................... 354

N Na-Deoxycholate (DOC) .................................... 276, 339 Native Chromatin Proteomics (N-ChroP)..................... 9, 251–272 Native elongating transcript sequencing (NET-Seq) ..........................................4, 14, 41–64 Next generation sequencing (NGS) .................... 15, 116, 119, 214, 215, 286, 357, 363, 364 N-lauroylsarcosine sodium salt............................ 276, 339 Non-coding RNA (ncRNA) ..................... 14, 25, 67, 203 Nonidet P-40 (NP-40) ...................................26, 46, 107, 119, 150, 151, 168, 169, 183, 232, 310, 312 Novex TBE-Urea Gel ..................................................... 27 Nucleosome.....................................................3, 4, 10, 13, 15, 93–103, 105–109, 116, 123–144, 147–161, 251, 252, 289, 299, 351 Nucleosome-depleted region (NDR) .................... 67, 93, 94, 99, 101, 107, 211 Nucleosome Occupancy and Methylome sequencing (NOME-Seq) ................................. 337

O Omni ATAC-Seq.................................................. 117, 120 Open chromatin enrichment and network Hi-C (OCEAN-C) .........................................4, 12, 211–225, 231 Opti- Minimal Essential Medium (Opti-MEM)............................................. 310, 311 Orange G ......................................................................... 49

P Paraformaldehyde (PFA) ..................................... 310, 312 PASHA..............................................................96, 99, 101 32 P-CTP........................................................................... 26 Penicillin ............................................................... 254, 310 Peptone.......................................................................... 293 Pericentric heterochromatin (PCH) ...........................307, 308, 310, 312–315, 317, 318 Pericentric major satellite repeat (MSR)............. 307, 308 Phage-λ DNA ....................................................... 340, 344 Phenol......................................................... 30, 35, 36, 46, 51, 95, 98, 169, 172, 174, 177, 197, 212, 213, 217, 218, 232, 235, 293, 294, 296

ENHANCERS AND PROMOTERS: METHODS AND PROTOCOLS

374 Index

Phenylmethylsulfonyl fluoride (PMSF) ........................ 95, 101, 126, 129, 133, 256, 257, 260, 261 Phosphate-Buffered Saline (PBS) .......................... 46, 47, 51, 63, 95, 97, 107, 110, 125, 128, 129, 137, 140, 150–153, 161, 168, 170, 183, 185, 187–191, 213, 215, 232, 235, 256, 257, 259, 267, 276, 280, 310, 312, 339, 343, 357 PolyAcrylamide ...................................................... 45, 252 Polyethylene glycol (PEG) ..................................... 28, 33, 34, 49, 52 Polymerase chain reaction (PCR) ................................... 7, 8, 11, 30, 35, 42, 44, 45, 47, 52–54, 56–61, 63, 68, 70, 95, 98, 101, 107, 109–111, 113–115, 119, 126, 137, 143, 149, 151, 156, 165, 182, 193, 195, 197, 221, 222, 226, 230, 233, 234, 237–242, 246, 256, 260, 261, 281, 284–286, 322, 323, 325–328, 330, 331, 333, 338–342, 346–351, 354–356, 359–363, 366 Polyoxyethylene (20) Sorbitan Monolaurate ..................................................71, 72 Polyvinylpyrrolidone (PVP) .....................................27, 29 Post-Bisulfite Adaptor Tagging (PBAT)...................... 356 Posttranslational modifications (PTMs) .....................147, 251, 252, 254, 255, 267, 269–272 Potassium acetate (CH3COOK) .................................. 325 Potassium chloride (KCl) ....................................... 26, 95, 125, 126, 150, 256, 293, 324 Preinitiation complex (PIC) .......................................... 93, 183–185, 187, 188, 190, 191 Promoter capture Hi-C (PCHi-C) ...........................4, 12, 229–246 Promoters ............................................................ 3–15, 25, 67–89, 93–102, 106, 116, 124, 130, 142, 144, 147, 166, 201–203, 205, 206, 211, 229–246, 252, 261, 292, 322, 327, 329, 331–333, 353–355, 365 2-Propanol............................................................ 277, 284 Protease inhibitor.............................................. 26, 45–47, 101, 125, 129, 140, 150–154, 158–160, 168, 169, 213, 215, 232, 256, 257, 260, 261, 286, 293, 296, 339, 344 Protein A .................................................... 126, 133, 139, 151, 153, 158–161, 276, 282, 287, 290, 339, 343 Proteinase K ......................................................27, 95, 98, 150, 151, 156, 169, 171, 172, 184, 185, 189, 194, 213, 217, 219, 232, 235, 285, 293, 294, 298, 340, 344, 345, 357 Protein G .................................................... 126, 139, 151, 153, 161, 257, 261, 282, 343 Protospacer adjacent motif (PAM) .............................. 325 Proximity ligation-assisted ChIP-Seq (PLAC-Seq) ........................................12, 181–198 PU1............................................................................6, 8, 9 50 Pyrophosphohydrolase (RppH) ................................. 14

Q Quality control (QC)........................................30, 36, 96, 116, 127, 134, 141, 156, 172–174, 181, 182, 185, 194–196, 222, 223, 226, 245, 261, 298, 364, 366 Quantitative PCR (qPCR).................................. 102, 110, 111, 113, 114, 116, 127, 134, 192, 286, 287, 347–349, 351 Quantitative reverse transcription (qRT-PCR) ........................................................ 308

R rATP................................................................................. 26 rCTP ................................................................................ 26 Reduced representation bisulfite sequencing (RRBS)............................................. 337, 354, 355 Relative Enrichment (RE) .......................... 255, 267, 322 Repressor/activator site binding protein 1 (Rap1) ................................................................ 290 Retinoic X receptor (RXR) ............................................. 37 Reverse Transcriptase (RT)...............................29, 30, 34, 35, 49, 54, 60, 68, 71, 72, 76, 79, 85, 89, 115, 194, 238, 296, 312 rGTP ................................................................................ 26 RNA and DNA interacting complexes ligated and sequenced (RADICL-Seq) .....................4, 14, 201–209 RNA–chromatin interactions .............................. 202, 203 RNA fluorescence in situ hybridization (FISH)................................................................ 308 RNA polymerase I enhancer binding protein (Reb1) ......................................290, 292, 297, 299 RNA polymerase II (RNAPII) ................................4–6, 8, 9, 41, 143, 231, 278, 284, 285, 308 RNase A ...................................................... 29, 34, 95, 98, 150, 151, 156, 169, 171, 172, 184, 185, 194, 217, 219, 232, 235, 283, 287, 293, 295, 298, 366 RNase-free ......................................................... 26–36, 45, 46, 49, 53, 59, 63, 71, 79 RNase H ............................................................. 30, 71, 82 RNase inhibitor .................................................. 26–28, 34 RNA-Seq ................................................... 15, 41, 63, 118 RNaseT1.......................................................................... 29 RPB1 p-Ser2 RPB1.............................................................. 62 RQ1 RNase-Free DNase ................................................ 27 Rta (Epstein-Barr-virus Rta protein) ........................... 307

S Sarcosyl ............................................................................ 26 Selective isolation of chromatin-associated proteins (SICAP) ChIP-SICAP............................................................ 275

ENHANCERS Sepharose ...............................................13, 133, 134, 141 SETD1 ............................................................................. 13 Signal transducer and activator of transcription 2 (STAT2) .........................................................6, 8, 9 Single-cell ATAC-Seq (scATAC-Seq) .......................... 117 Single-cell chromatin immunocleavage sequencing (scChIC-Seq)..................................................... 290 Single nucleotide polymorphisms (SNPs) ............ 68, 212 Single stranded DNA (ssDNA) ......................... 49, 56–58 Sodium acetate (NaOAc) ...............................71, 81, 169, 174, 213, 218, 219, 232, 236, 257, 263 Sodium butyrate (Na Butyrate) ......................... 256, 257, 260, 261 Sodium chloride (NaCl) ..........................................27–33, 36, 37, 46, 49, 71, 72, 83, 84, 95, 107, 125–127, 150, 151, 158, 159, 168, 169, 183, 184, 213, 214, 232, 233, 256, 257, 276, 277, 284, 293, 296, 324, 339 Sodium cyanoborohydride (NaBH3CN)..................... 277 Sodium deoxycholate.......................................... 151, 158, 183, 184, 287 Sodium dodecyl sulfate (SDS)................................ 26, 28, 29, 95, 126, 131, 134, 139, 151, 156, 158, 169, 171, 176, 183–185, 196, 213–216, 232, 235, 243, 256, 257, 261, 276, 277, 281, 284–287, 293, 296, 339, 344 Sodium dodecyl sulphate-PolyAcrylamide Gel Electrophoresis (SDS-PAGE) ..........................252, 254, 257, 261, 269 Sodium fluoride (NaF) .......................256, 257, 260, 261 Sodium hydrogen phosphate (Na2HPO4) .................125, 150, 151, 256 Sodium hydroxide (NaOH) ................................... 27, 31, 56, 71, 85, 324 Sodium orthovanadate (Na3VO4) ..................... 256, 257, 260, 261 Sodium periodate (NaIO4) ............................................ 71 Solute Carrier Family 2 Member 3 (Slc2a3) .............................................................. 365 Sonication .............................................12, 107, 130, 137, 140, 182, 197, 217, 218, 222, 223, 225, 226, 236, 237, 245, 276, 281, 286, 287, 289, 344, 350 Spermidine............................................................ 256, 293 Spermine ............................................................... 256, 293 SPI1 ............................................................................... 6, 8 Spt-Ada-Gcn5-Acetyltransferase (SAGA) .................... 291 Stable isotope labelling with amino acids in cell culture (SILAC) ........................ 254, 278, 281 Streptomycin ........................................................ 256, 310 Structural variant (SV) .................................................. 166 Sucrose.......................................46, 49, 95, 97, 101, 102, 126, 150, 154, 252, 253, 256, 259, 267, 268 SUPERase In................................................26–29, 32, 33 Super optimal broth (SOC) ................................ 324, 328

AND

PROMOTERS: METHODS

AND

PROTOCOLS Index 375

Suppressor Of Variegation 3-9 Homolog 1 (Suv39h1) .......................................................... 307 Suppressor Of Variegation 3-9 Homolog 2 (Suv39h2) .......................................................... 307 Suz12 ............................................................................. 286 Syntaxin Binding Protein 2 (Stxbp2) .......................... 6, 7

T Tagmentation-based Whole-Genome Bisulfite Sequencing (T-WGBS) ..................................... 356 Tag per million (TPM) ........................................ 205, 208 Targeted chromatin capture (T2C) ...........................4, 12 TATA-binding protein (TBP) ...................................... 291 T4 DNA ligase ........................................... 169, 183, 186, 213, 216, 232, 235, 237 Ten-eleven translocation (TET) ............................. 13, 28, 29, 32, 339, 344 Terminal deoxynucleotidyl Transferase (TdT) ............ 276 3’-dideoxycytosine (3’-ddC) .......................................... 43 Three-dimensional/3-dimensional (3D)...................... 68, 165, 181, 201, 202, 229–246 T7 Ligase ..................................................... 325, 328, 331 Tobacco Acid Pyrophosphatase (TAP) ............. 28, 32, 38 Topologically associating domains (TADs) ................165, 166, 176, 212 T4 Polynucleotide Kinase (T4 PNK)............................ 28, 214, 220, 276, 283 Transcription factor (TF)............................ 166, 289, 337 Transcription Factor IID (TFIID)...................... 291, 298 Transcription starting site (TSS) .............. 7, 68, 142, 148 Transcripts per million (TPM) ....................................... 87 Transposase Tn5 transposase............................. 107–110, 118, 290 Trifluoroacetic acid (TFA; CF3COOH) ..................... 258 Tris-acetate ........................................................... 149, 325 Tris(hydroxymethyl)aminomethane............................. 339 Triton X-100 ........................ 46, 49, 158, 169, 171, 172, 176, 183, 185, 186, 213, 214, 216, 232, 233, 235, 243, 256, 276, 281, 286, 310, 312, 339 Trizma base .......................................................... 168, 169 Trizol .........................................................................27, 31 T4 RNA Ligase 1 ............................................... 28, 33, 34 Trypan Blue Solution.....................................26, 150, 153 Trypsin ....................................................95, 97, 101, 107, 110, 125, 254, 258, 263, 269, 270, 277, 285, 310 Tryptone ........................................................................ 324 Tween 20..................................................................27–30, 117, 151, 153, 184, 213, 214, 276

U Unique molecular identifier (UMI)............................... 42 Upstream activating sequence (UAS) .............................. 3 Urea .................................................................... 42, 45, 46

ENHANCERS AND PROMOTERS: METHODS AND PROTOCOLS

376 Index V

X

Vacuum ...................................................81, 89, 129, 233, 240, 257, 258, 263–265, 270 Volcano-plot .................................................................. 285 VP16 (herpes simplex virus VP16 protein) ................. 307 VP64-p65-Rta ............................................................... 307 VPR.............................................................. 307, 308, 318

Xylene Cyanol ...........................................................27–29

W Whole Genome Bisulphite Sequencing (WGBS)..................................................4, 13, 337, 338, 354–356, 360, 364–366

Y Yeast yeast extract ............................................................. 324 yeast extract-peptone-dextrose (YPD)........................................................ 291, 293 Yin-Yang 1 (YY1) ............................................................ 14