Drug-DNA Interaction Protocols [2 ed.] 9781603274173, 1603274170

Citation preview

METHODS

IN

MOLECULAR BIOLOGY™

Series Editor John M. Walker School of Life Sciences University of Hertfordshire Hatfield, Hertfordshire, AL10 9AB, UK

For other titles published in this series, go to www.springer.com/series/7651

Drug-DNA Interaction Protocols Second Edition

Edited by

Keith R. Fox School of Biological Sciences, University of Southampton, Southampton, UK

Editor Keith R. Fox School of Biological Sciences University of Southampton Southampton UK [email protected]

ISSN 1064-3745 e-ISSN 1940-6029 ISBN 978-1-60327-417-3 e-ISBN 978-1-60327-418-0 DOI 10.1007/978-1-60327-418-0 Springer New York Dordrecht Heidelberg London Library of Congress Control Number: 2009940801 © Humana Press, a part of Springer Science+Business Media, LLC 1998, 2010 All rights reserved. This work may not be translated or copied in whole or in part without the written permission of the publisher (Humana Press, c/o Springer Science+Business Media, LLC, 233 Spring Street, New York, NY 10013, USA), except for brief excerpts in connection with reviews or scholarly analysis. Use in connection with any form of information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed is forbidden. The use in this publication of trade names, trademarks, service marks, and similar terms, even if they are not identified as such, is not to be taken as an expression of opinion as to whether or not they are subject to proprietary rights. While the advice and information in this book are believed to be true and accurate at the date of going to press, neither the authors nor the editors nor the publisher can accept any legal responsibility for any errors or omissions that may be made. The publisher makes no warranty, express or implied, with respect to the material contained herein. Cover illustration: Background art is derived from Figure 6 in Chapter 9. Printed on acid-free paper Springer is part of Springer Science+Business Media (www.springer.com)

Preface DNA has been known to be the cellular target for many cytotoxic anticancer agents for several decades. The knowledge of its structure in atomic detail and the ease with which DNA fragments (both synthetic oligonucleotides and natural sequences) can be prepared and manipulated has aided the design of compounds that bind to it with improved selectivity. On the basis of this information, new generations of sequence reading compounds (including triplex forming oligonucleotides and minor groove binding ligands) have been prepared, which have the potential for targeting specific DNA sequences as anti-gene agents. Within the last 10 years, it has also become apparent that the familiar DNA duplex is not the only structure that can be targeted by DNA-binding ligands and there has been increased interest in triplex and quadruplex structures as drug targets, as well as proteinDNA complexes, such as those with nucleosomes or topoisomerases. Each of these advances has required the availability and development of an arsenal of techniques for probing the interactions in both qualitative and quantitative terms. This volume of Methods in Molecular Biology brings together several techniques that are currently useful for examining these interactions. Some of these are updates on ones that were included in the earlier volume (Methods in Molecular Biology 90), published 12 years ago, while others are new. Molecular science is a multidisciplinary enterprise, and while individuals and laboratories may become experts in a few techniques, a detailed description of DNA-ligand interactions requires a combination of approaches. This volume should therefore be useful for established workers who wish to broaden their experimental repertoire, as well as for those who are new to the field and need expert advice and guidance. The chapters have all been written by scientists who are experts in their own fields. They will obviously reflect their local preferences in experimental protocols, which can be modified to suit the requirements of the individual researcher. Each chapter begins with a short introduction, which outlines the background to the technique, the principles of its application, and the importance of the particular method. The most important part of each chapter is the methods section. These set out the experimental protocols in a stepby-step fashion and are accompanied by Notes sections which provide technical tips, based on experience, giving valuable information about potential problems and pitfalls and emphasizing the points at which special care is required. This volume should therefore be useful for post-graduates, post-doctoral workers, and established scientists, working in drug-DNA interactions. The chapters in this volume combine a wide range of approaches, from the cellular to the structural. The first nine chapters describe various biophysical techniques for quantifying drug-DNA interactions and for describing these in molecular and atomic detail, while the later chapters describe molecular and cellular approaches. Together these provide methods for assessing the strength and mode of binding, the sequence selectivity, and their effect on biological systems. Southampton, UK

Keith R. Fox

v

Contents Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Contributors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 Quantitative Analysis of Small Molecule–Nucleic Acid Interactions with a Biosensor Surface and Surface Plasmon Resonance Detection . . . . . . . . . . . Yang Liu and W. David Wilson 2 Thermal Melting Studies of Ligand DNA Interactions . . . . . . . . . . . . . . . . . . . . . Aurore Guédin, Laurent Lacroix, and Jean-Louis Mergny 3 Circular and Linear Dichroism of Drug-DNA Systems . . . . . . . . . . . . . . . . . . . . . Alison Rodger 4 Drug Binding to DNA⋅RNA Hybrid Structures . . . . . . . . . . . . . . . . . . . . . . . . . . Richard T. Wheelhouse and Jonathan B. Chaires 5 Quantification of Binding Data Using Capillary Electrophoresis . . . . . . . . . . . . . . Fitsumbirhan Araya, Graham G. Skellern, and Roger D. Waigh 6 Determination of Equilibrium Association Constants of Ligand–DNA Complexes by Electrospray Mass Spectrometry . . . . . . . . . . . . . . . . . . . . . . . . . . . Valérie Gabelica 7 Detection of Adriamycin-DNA Adducts by Accelerator Mass Spectrometry. . . . . . Kate Coldwell, Suzanne M. Cutts, Ted J. Ognibene, Paul T. Henderson, and Don R. Phillips 8 Molecular Modelling Methods to Quantitate Drug-DNA Interactions . . . . . . . . . Hao Wang and Charles A. Laughton 9 Application of Anomalous Diffraction Methods to the Study of DNA and DNA-Complexes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Derrick Watkins, Tinoush Moulaei, Seiji Komeda, and Loren Dean Williams 10 DNase I Footprinting . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Antonia S. Cardew and Keith R. Fox 11 Methods to Characterize the Effect of DNA-Modifying Compounds on Nucleosomal DNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Vidya Subramanian, Robert M. Williams, Dale L. Boger, and Karolin Luger 12 REPSA: Combinatorial Approach for Identifying Preferred Drug–DNA Binding Sequences . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Michael W. Van Dyke 13 In vitro Transcription Assay for Resolution of Drug-DNA Interactions at Defined DNA Sequences . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Benny J. Evison, Don R. Phillips, and Suzanne M. Cutts 14 In vitro Footprinting of Promoter Regions Within Supercoiled Plasmid DNA . . . . Daekyu Sun

vii

v ix 1 25 37 55 71

89 103

119

133

153

173

193

207 223

viii

Contents

15 Topoisomerase I-Mediated DNA Relaxation as a Tool to Study Intercalation of Small Molecules into Supercoiled DNA . . . . . . . . . . . . . . . . . . . . Paul Peixoto, Christian Bailly, and Marie-Hélène David-Cordonnier 16 A High-Throughput Assay for DNA Topoisomerases and Other Enzymes, Based on DNA Triplex Formation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Matthew R. Burrell, Nicolas P. Burton, and Anthony Maxwell 17 Measurement of DNA Interstrand Crosslinking in Individual Cells Using the Single Cell Gel Electrophoresis (Comet) Assay . . . . . . . . . . . . . . . . . . . Victoria J. Spanswick, Janet M. Hartley, and John A. Hartley 18 Measurement of DNA Interstrand Crosslinking in Naked DNA Using Gel-Based Methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Konstantinos Kiakos, Janet M. Hartley, and John A. Hartley 19 An Evaluation Cascade for G-Quadruplex Telomere Targeting Agents in Human Cancer Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Mekala Gunaratnam and Stephen Neidle Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

235

257

267

283

303 315

Contributors FITSUMBIRHAN ARAYA • Institute of Pharmacy and Biomedical Sciences, University of Strathclyde, Glasgow, UK CHRISTIAN BAILLY • Jean-Pierre Aubert Research Center (JPARC), Institut de Recherches sur le Cancer de Lille, Lille, France IMPRT-IFR114, Lille, France Pierre Fabre Research Institute, Toulouse, France DALE L. BOGER • Department of Chemistry, The Scripps Research Institute, La Jolla, CA, USA MATTHEW R. BURRELL • Dept Biological Chemistry, John Innes Centre, Colney, Norwich, UK NICOLAS P. BURTON • Inspiralis Ltd., Norwich Bioincubator, Norwich Research Park, Norwich, UK ANTONIA S. CARDEW • School of Biological Sciences, University of Southampton, Southampton, UK JONATHAN B. CHAIRES • James Graham Brown Cancer Center, University of Louisville, Louisville, KY, USA KATE COLDWELL • Department of Biochemistry, La Trobe University, Bundoora, VIC, Australia SUZANNE M. CUTTS • Department of Biochemistry, La Trobe University, Bundoora, VIC, Australia MARIE-HELENE DAVID-CORDONNIER • INSERM U-837, Jean-Pierre Aubert Research Center (JPARC), Institut de Recherches sur le Cancer de Lille, Lille, France IMPRT-IFR114, Lille, France BENNY J. EVISON • Department of Biochemistry, La Trobe University, Bundoora, VIC, Australia KEITH R. FOX • School of Biological Sciences, University of Southampton, Southampton, UK VALÉRIE GABELICA • Physical Chemistry and Mass Spectrometry Laboratory, Department of Chemistry, University of Liège, Belgium GIGA-Systems Biology and Chemical Biology, University of Liège, Belgium AURORE GUÉDIN • Equipe Santé, Laboratoire ‘Régulation et Dynamique des Génomes’, Muséum National d’Histoire Naturelle USM 503, INSERM UR 565, CNRS UMR 5153, Paris, France MEKALA GUNARATNAM • The Cancer Research UK Biomolecular Structure Group, The School of Pharmacy, University of London, London, UK JANET M. HARTLEY • Cancer Research UK Drug-DNA Interactions Research Group, UCL Cancer Institute, University College London, London, UK JOHN A. HARTLEY • Cancer Research UK Drug-DNA Interactions Research Group, UCL Cancer Institute, University College London, London, UK

ix

x

Contributors

PAUL T. HENDERSON • Division of Hematology and Oncology, Department of Internal Medicine, UC Davis Cancer Center, University of California Davis Medical Center, Sacramento, CA, USA KONSTANTINOS KIAKOS • Cancer Research UK Drug-DNA Interactions Research Group, UCL Cancer Institute, Paul O’Gorman Building, University College London, London, UK SEIJI KOMEDA • School of Chemistry and Biochemistry, Georgia Institute of Technology, Atlanta, GA, USA LAURENT LACROIX • Equipe Santé, Laboratoire ‘Régulation et Dynamique des Génomes’, Muséum National d’Histoire Naturelle USM 503, INSERM UR 565, CNRS UMR 5153, Paris, France CHARLES A. LAUGHTON • Centre for Biomolecular Sciences, School of Pharmacy, University of Nottingham, Nottingham, UK YANG LIU • Department of Chemistry, Georgia State University, Atlanta, GA, USA KAROLIN LUGER • Department of Biochemistry and Molecular Biology, Colorado State University, Fort Collins, CO, USA ANTHONY MAXWELL • Department of Biological Chemistry, John Innes Centre, Colney, Norwich, UK JEAN-LOUIS MERGNY • Equipe Santé, Laboratoire ‘Régulation et Dynamique des Génomes’, Muséum National d’Histoire Naturelle USM 503, INSERM UR 565, CNRS UMR 5153, Paris, France TINOUSH MOULAEI • School of Chemistry and Biochemistry, Georgia Institute of Technology, Atlanta, GA, USA Stephen Neidle • The Cancer Research UK Biomolecular Structure Group, The School of Pharmacy, University of London, London, UK TED J. OGNIBENE • Chemistry, Materials, Earth and Life Sciences, Center for Accelerator Mass Spectrometry, Lawrence Livermore National Laboratory, 7000 East Avenue, L-452, Livermore, CA 94551, USA PAUL PEIXOTO • INSERM U-837, Jean-Pierre Aubert Research Center (JPARC), Institut de Recherches sur le Cancer de Lille, Lille, France IMPRT-IFR114, Lille, France DON R. PHILLIPS • Department of Biochemistry, La Trobe University, Bundoora, VIC, Australia ALISON RODGER • Department of Chemistry, University of Warwick, Coventry, UK GRAHAM G. SKELLERN • Institute of Pharmacy and Biomedical Sciences, University of Strathclyde, Glasgow, UK VICTORIA J. SPANSWICK • Cancer Research UK Drug-DNA Interactions Research Group, UCL Cancer Institute, Paul O’Gorman Building, University College London, London, UK VIDYA SUBRAMANIAN • Department of Biochemistry and Molecular Biology, Colorado State University, Fort Collins, CO, USA DAEKYU SUN • Department of Pharmacology and Toxicology, College of Pharmacy, University of Arizona, BIO5 Institute, Tucson, AZ, USA MICHAEL VAN DYKE • Molecular & Cellular Oncology, M.D. Anderson Cancer Center, University of Texas, Houston, TX, USA

Contributors

ROGER D. WAIGH • Institute of Pharmacy and Biomedical Sciences, University of Strathclyde, Glasgow G4 0NR, UK HAO WANG • Department of Oral and Dental Science, University of Bristol, UK DERRICK WATKINS • School of Chemistry and Biochemistry, Georgia Institute of Technology, Atlanta, GA, USA RICHARD T. WHEELHOUSE • School of Pharmacy, University of Bradford, Bradford, West Yorkshire, UK LOREN D. WILLIAMS • School of Chemistry and Biochemistry, Georgia Institute of Technology, Atlanta, GA, USA ROBERT M. WILLIAMS • Department of Chemistry, Colorado State University, Fort Collins, CO, USA The University of Colorado Cancer Center, Aurora, CO, USA W. DAVID WILSON • Department of Chemistry, Georgia State University, Atlanta, GA, USA

xi

Chapter 1 Quantitative Analysis of Small Molecule–Nucleic Acid Interactions with a Biosensor Surface and Surface Plasmon Resonance Detection Yang Liu and W. David Wilson Abstract Surface plasmon resonance (SPR) technology with biosensor surfaces has become a widely-used tool for the study of nucleic acid interactions without any labeling requirements. The method provides simultaneous kinetic and equilibrium characterization of the interactions of biomolecules as well as small molecule-biopolymer binding. SPR monitors molecular interactions in real time and provides significant advantages over optical or calorimetic methods for systems with strong binding coupled to small spectroscopic signals and/or reaction heats. A detailed and practical guide for nucleic acid interaction analysis using SPR-biosensor methods is presented. Details of the SPR technology and basic fundamentals are described with recommendations on the preparation of the SPR instrument, sensor chips, and samples, as well as extensive information on experimental design, quantitative and qualitative data analysis and presentation. A specific example of the interaction of a minor-groove-binding agent with DNA is evaluated by both kinetic and steady-state SPR methods to illustrate the technique. Since the molecules that bind cooperatively to specific DNA sequences are attractive for many applications, a cooperative small molecule–DNA interaction is also presented. Key words: Biosensor, Surface plasmon resonance, Small molecule–nucleic acid interaction, Kinetics, Steady-state analysis, Cooperativity, Biacore, Minor groove

1. Introduction Biological systems function on a platform of complex and integrated biomolecular interactions (1–3). Signaling, transcription control of gene expression, and a host of other complex processes, frequently, are built on sets of sequential biomolecular interactions and subsequent reactions (4–8). These sequential processes that control and direct cellular functions can generally be understood

K.R. Fox (ed.), Drug-DNA Interaction Protocols, Methods in Molecular Biology, vol. 613, DOI 10.1007/978-1-60327-418-0_1, © Humana Press, a part of Springer Science + Business Media, LLC 1998, 2010

1

2

Liu and Wilson

in terms of the interaction of a small number of molecules in each step. Appropriate assembly of the entire sequential array gives the beautifully intricate mechanism of cell function. The entire process can be understood and explained on the basis of thermodynamic theory that has been firmly established for over 100 years. The biomolecular associations involve macromolecular complexes as well as small molecule-macromolecule interactions that are essential for the control of cell processes. Most drugs, for example, are small molecules that must interact with a macromolecular receptor in order to affect the target cell function in a selective manner (5–12). The field of chemical biology is built around design and use of small molecules to control specific aspects of cell function through biopolymer interactions (13–15). In order to understand this intricate array of interactions and control systems, it is very informative to evaluate all of the specific sequential steps that can be isolated. This quantitative interaction information is essential to put available structural results into the appropriate context of cell function. To establish a basic quantitative characterization of the interactions, it is essential to determine a set of basic thermodynamic quantities (16–21). Two questions must be answered at the start of the investigations: (1) what do we want to know about the interactions and (2) how can we accurately and with a reasonable effort determine the desired information? In the optimum case, the binding affinity (the equilibrium constant, K, and Gibbs energy of binding, DG), stoichiometry (n, the number of compounds bound to the biopolymer), cooperative effects in binding, and binding kinetics (the rate constants, k, that define the dynamics of the interaction) should be determined. These fundamental parameters are the keys to a molecular understanding of the interactions and how they affect cellular functions. To determine these parameters, an accurate method of determining the concentration of each component that is not bound and the concentration of their complex is required. The information must be determined as a function of concentration at equilibrium for accurate K and n, and as a function of time for k. For each system then, the question becomes one of how to accurately determine the necessary concentrations as a function of time, reactant total concentrations, solution conditions, temperature, etc. The interacting systems can range from as little as two molecules to as many as required to form the final complex. As described above, a more complete understanding of the biomolecular complexes requires determination of additional thermodynamic quantities that characterize complex formation in detail. Because biological molecules have widely different molecular characteristics that can and generally do change on complex formation, it can be difficult to find methods to evaluate the full array of interactions under an appropriate variety of conditions.

Quantitative Analysis of Small Molecule–Nucleic Acid Interactions

3

This is the “reasonable effort” part of question (2) above. For many biologically important interactions, binding is very strong, and experiments must be conducted at very low concentrations, down to the nanomolar or lower levels. In a binding experiment, the compound concentration should vary from below to above the Kd in order to obtain accurate binding results, and this requires significant concentrations of both free and complexed molecules (16, 22–24). In many methods, for example, those that involve some separation of free and bound forms such as dialysis, the unbound concentration has to be determined, and if this is below around 100 nM, as expected for the large K values generally observed in biological systems and as generally required for effective drug molecules, measurement can be difficult or impossible. These concentrations fall below the detection limit for many systems and may require special methods, such as radiolabels or fluorescent probes, for added sensitivity in detection. The labels may significantly increase the sensitivity of detection; however, they may also perturb the interaction that is being investigated. An attractive alternative method, which is operational down to very low concentrations, is the use of biosensors with surface plasmon resonance (SPR) detection (17, 25–30). SPR responds to the refractive index or mass changes at the biospecific sensor surface on complex formation (27–32). Since the SPR signal responds directly to the amount of bound compound in real time, as versus indirect signals at equilibrium that are obtained for many physical measurements, it provides a very powerful method to study biomolecular interaction thermodynamics and kinetics. Use of the SPR signal and direct mass response to monitor biomolecular reactions also removes many difficulties with labeling or characterizing the diverse properties of biomolecules (25–31). To illustrate the power of the SPR method, small organic cation interactions with specific DNA sequences will be used as examples. Small molecule targeting of DNA has applications in therapeutics, from cancer treatment to antiparasitic applications, and in biotechnology, and development of such molecules for control of nucleic acid function is at the heart of chemical biology (5–10, 16, 25, 29, 32–47). The interaction of nucleic acids with small molecules has been a primary area of interest and research since before the discovery of the double helical structure of DNA. There are many successful anticancer agents that intercalate or alkylate DNA, and they can have quite varied structure and properties (34–37). Dicationic minor groove binding heterocycles which target eukaryotic organisms that cause parasitic diseases, such as malaria and sleeping sickness, have also been known for many years and are used in humans and animals (9, 10, 38–40). Therapeutic targeting of nucleic acids recently entered a new and very exciting area with the discovery that four-stranded, quadruplex

4

Liu and Wilson

DNA structures can occur in important cellular DNA regions from chromosomal telomeres to oncogene promoters (34, 35, 41–46). Several studies have clearly shown that interactions of a range of small molecules with quadruplexes can yield anticancer activity. Although this discussion focuses on DNA, essentially all of the methods can be applied to RNA interactions. Additional treatment of the biosensor surfaces may be required when using RNA, however, due to possible hydrolysis of RNA by a number of agents. Applications with small molecules can be very challenging, in terms of signal obtained on binding in a biosensor-SPR experiment. The larger the bound molecule, the larger the SPR signal and macromolecule binding can give large signal to noise ratios (27, 29, 31). We will show, however, that the biosensor-SPR method with a macromolecular sensor surface can be used under appropriate conditions to investigate small molecule binding with current state-of-the-art instruments. Because of the varied properties of the compounds, it is difficult and time-consuming to find other suitable methods that can quantitatively define their interactions with DNA (or RNA) under a variety of conditions. As described above, in biosensor-SPR instruments and experiments, it is the bound compound on the surface that is detected by the change in plasmon resonance angle, and this can be determined very accurately from a low to a high fraction of surface binding sites covered. The unbound or free solution compound concentration is not measured but is simply prepared by dilution and is in a constant concentration in the solution that flows over the sensor surface. Since the SPR signal responds to the refractive index or mass changes at the biospecific sensor surface on complex formation, no specific labeling of detection ability for the compounds is required (25–27, 31). For compounds that have molecular weights of approximately 300 or more, the SPR technology provides a very attractive method to study interactions with nucleic acids or proteins immobilized to form a biospecific target surface. 1.1. Fundamentals of Molecular Interactions by Biosensor-SPR Methods

For a single compound (C), binding to n equivalent sites on DNA (or other biopolymer) to give a complex (DNA·nCbound), the interaction process is described by kinetic and equilibrium equations as follows: DNA (site) + nCfree

ka kd

DNA.nCbound Ka =ka/kd = 1/ Kd

(1)

More complex models with nonequivalent sites are also well-known and are treated in a similar manner with more complex functions (27) (and described below under Subheading 3.2). Although a discussion of complex data fitting is beyond the

Quantitative Analysis of Small Molecule–Nucleic Acid Interactions

5

scope of this article, the topic is covered in most biophysical chemistry texts, and more complex models are included in commercial SPR instrument software packages as well as in software available from Myszka and coworkers (http://www. cores.utah.edu/interaction/software.html). In the most common case, it is of interest to study a variety of compounds for binding to a limited number of different DNAs. For this case, however, it is more convenient and efficient to immobilize, the DNAs on the sensor surface to monitor complex formation. Biacore T100 and 2000/3000 instruments have sensor chips with four channels such that three DNAs can be immobilized, with one flow cell left blank as a control for bulk refractive index subtraction. With a common sensor surface that has covalently attached streptavidin, a nucleic acid strand with biotin linked to either the 5¢ or 3¢ terminus can be captured to create the biospecific surface. The terminal attachment of biotin, through a flexible linker, leaves the nucleic acid binding sites open for complex formation. If streptavidin or the biotin linker creates problems with the interaction or nonspecific compound interactions, the nucleic acid can be synthesized with a terminal alkyl amine and the amine can be used to form a direct covalent amide bond with the surface through activation of carboxyl groups on the sensor surface. In Biacore instruments, which have been most widely used to date in the area of biosensor-SPR experiments, any molecule with free amino groups can be immobilized through amide bonds with activated carboxyl groups from sensor chip surface-linked carboxymethyl (CM) dextran. A range of other sensor chips surfaces and immobilization chemistries are also available and it is generally possible to find an appropriate surface for any biological interaction application (for Biacore instruments, see the web http://www.biacore.com/lifesciences/products/ sensor_chips/guide/index.html). The results from a biosensor-SPR experiment are typically presented as a set of sensorgrams, which plot a function that is directly related to the SPR angle versus time as shown in Fig. 1. The angle change is reported in Biacore technology as resonance units (RU) where a 1,000 RU response is equivalent to a change in surface concentration of about 1 ng/mm2 of protein or DNA (the relationship between RU and ng of material bound will vary with the refractive index of the bound molecule) (27, 29, 31). With a DNA sequence immobilized on the chip surface, a compound solution is injected and as the solution flows over the surface, compound binding to the DNA is monitored by a change in SPR angle (as RU). After a selected time, buffer flow is restarted and dissociation of the complex can be monitored for an additional selected time period (Fig. 1). Note that when the association phase collection time is long enough, a steady state plateau is reached such that the rate of binding of the small

6

Liu and Wilson

Fig. 1. Representative SPR sensorgrams for the interaction of DB293 with AATT and ATGA oligomer hairpin duplexes. The DB293 concentrations from bottom to top are 0–1 mM

molecule equals the rate of dissociation of the complex and no change of signal with time is observed. The response of interest is the difference between the response in cells with immobilized DNA minus the response of the blank flow cell without DNA. If the added molecule does not bind to a target/receptor at the surface, the SPR angle change in the sample and reference flow cells will be the same in a properly functioning instrument, and the signals, after subtraction, give a zero net RU response that is indicative of no binding. In the case in which binding does occur, an extra amount, relative to the blank surface, of the added molecule is bound at the sensor surface, and an additional SPR angle change is generated in the sample flow cell. Again, the amount of unbound compound in the flow solution is the same in the sample and reference flow cells, and is subtracted so that only the bound molecule generates a positive SPR signal. The concentration of the unbound molecule is constant and is fixed by the concentration in the flow solution. Both the association and dissociation phases of the sensorgram can be simultaneously fit to a desired binding model in several sensorgrams at different concentrations with a global fit routine (27–32). Global fitting allows the most accurate determination of the kinetics constants as well as calculation of the equilibrium constant, Ka, from the ratio of kinetic constants (Eq. 1). It is also possible to determine Ka independently of rate constants by fitting the steady-state response versus the concentration of the binding molecule in the flow solution over a range of concentrations. For the binding process in Eq. (1) the steady-state RU

Quantitative Analysis of Small Molecule–Nucleic Acid Interactions

7

at each compound concentration is determined and Ka can be obtained by fitting to the following equation: RU = (RUmax •฀n •฀Ka฀•฀Cf)/(1 + Ka • Cf)

(2)

where RUmax is the maximum change in RU for binding to a single DNA site. It can be calculated, determined experimentally at high compound concentrations or used in the above equation as a fitting parameter such that Ka, n and RUmax are determined by fitting RU versus C f. Note that the common term “r”, the moles of compound bound per mole of DNA, is equal to RU/RU max. At high C f,where all binding sites are filled with compound, RU = RUmax • n. The refractive index change in SPR experiments generates essentially the same response for each bound molecule and can provide a direct determination of the stoichiometry, n, in Eqs. 1 and 2, provided that the amount of immobilized nucleic acid is known (29, 31). If the complex dissociates slowly, the surface can be regenerated before complete dissociation has occurred by a solution that causes rapid dissociation of the complex without irreversible damage to the immobilized DNA (29, 47). For example, a solution at low or high pH can unfold DNA and cause complex dissociation. It should be noted, however, that accurate fitting of the dissociation part of the curve requires collection of as much of the total dissociation signal as possible. Additional injections of buffer at pH near 7 allow the DNA to refold for the next binding experiment. If the immobilized DNA is composed of separate strands, the duplex must be reformed by hybridization. After the dissociation/regeneration phase is over and a stable baseline is reestablished, a second concentration sample can be injected to generate a second sensorgram. This process can be repeated with as many concentrations as needed to obtain a broad coverage of the fraction of compound bound to the nucleic acid site or sites (see Fig. 1). The kinetic and equilibrium constants that describe the reaction in Eq. 1.1 are obtained by global fitting the sensorgrams with equations from a kinetic model or by fitting steady-state RU versus concentration plots to an appropriate binding model. The models are the same for all types of binding experiments and are not unique to SPR methods. It should be emphasized that to obtain accurate kinetic information for a binding reaction, it is essential that the kinetics for transfer of the binding molecule to the surface immobilized nucleic acid (mass transfer) be faster than the binding reaction. Equilibrium information can be obtained, however, by fitting sensorgrams even when mass transfer limitations prevent accurate determination of kinetics (48). It should be emphasized that, when properly conducted, biosensor-SPR kinetic and equilibrium results are in excellent agreement with other methods (26, 27, 29, 30, 48–50).

8

Liu and Wilson

2. Materials 2.1. Required Materials for Instrument Cleaning

These materials are for the Biacore T100, 3000 and 2000 research instruments but similar materials are required for other instruments. 1. Maintenance chip with a glass flow cell surface. 2. 0.5% SDS (Biacore desorb solution 1). 3. 50 mM glycine pH 9.5 (Biacore desorb solution 2) (see Note 1). 4. 1% (v/v) acetic acid solution. 5. 0.2 M sodium bicarbonate solution. 6. 6 M guanidine HCl solution. 7. 10 mM HCl solution. (see Note 2)

2.2. Running Buffer for Immobilization of DNA

1. HBS-EP buffer: 10 mM HEPES pH 7.4, 150 mM NaCl, 3 mM EDTA, 0.005%, v/v polysorbate 20. (GE Healthcare Inc.) 2. HBS-N buffer: 10 mM HEPES pH 7.4, 150 mM NaCl. (GE Healthcare Inc.) 3. Filter and degas all solution quite thoroughly. 4. It should be emphasized that the internal flow system of the instrument has microcapillaries that can be damaged by particulate matter in any solution.

2.3. Sensor chip Preparation for DNA Immobilization: CM5 or CM4 Chip

1. A CM5 or CM4 sensor chip that has been at room temperature for at least 30 min (all sensor chips are available from GE Healthcare Inc.). 2. 100 mM N-hydroxysuccinimide (NHS) freshly prepared in water. 3. 400 mM N-ethyl-N¢-(dimethylaminopropyl) carbodiimide (EDC) freshly prepared in water. 4. 10 mM acetate buffer pH 4.5 (immobilization buffer). 5. 200–400 mg/ml streptavidin in immobilization buffer. 6. Amino-labeled nucleic acid solutions (~25 nM of single strand or hairpin dissolved in HBS-EP buffer). (5¢- end modified DNA obtained from Integrated DNA Technologies, Coralville, IA) 7. 1 M ethanolamine hydrochloride in water pH 8.5 (deactivation solution). 8. Dock the CM4 or CM5 chip, Prime with running buffer. Start a sensorgram in all flow cells with a flow rate of 5 µl/min. “Dock” and “Prime” are Biacore software commands that instruct the instruments to carry out specific operations. The commands and operations are listed in Table 1. 9. With NHS (100 mM) in one vial and EDC (400 mM) in other, use the “Dilute” command to make a 1:1 mixture of NHS/EDC.

Quantitative Analysis of Small Molecule–Nucleic Acid Interactions

9

Table 1 Biacore instrument commands Software commands

Function

Dock

Docks the sensor chip

Undock

Undocks the sensor chip

Prime

Flushes the flow system with running buffer

Dilute

Diluting samples with buffer or for preparing a defined mixture of two samples

Manual inject

Manually controlled injection

Desorb

Removes adsorbed samples from the autosampler and IFC using SDS and glycine

Sanitize

Cleans pumps, IFC and autosampler from micro-organisms using BIA disinfectant solution

10. Inject NHS/EDC for 10 min (50 µl) to activate the carboxymethyl surface to reactive esters. 11. Using “Manual Inject” with a flow rate of 5 µl/min, load the loop with ~100 µl of streptavidin in the appropriate buffer and inject streptavidin over all flow cells. Track the number of RUs immobilized, which is available in real time readout, and stop the injection after the desired level is reached (typically 2,500–3,000 RU for CM5 chip and 1,000–1,500 RU for CM4 chip). 12. Inject ethanolamine hydrochloride for 10 min (50 µl) to deactivate any remaining reactive esters. 13. Prime several times to ensure surface stability. 14. DNA is immobilized as described under Subheading 2.4. 15. To reduce the nonspecific binding to immobilized streptavidin by small molecules, covalent immobilization using aminolabeled DNA could also be used. In this way, DNA can be directly captured on the EDC/NHS activated carboxymethyl dextran surface of the sensor chip (from step 16 to step 19). 16. Start from step 8 to step 10 to activate the sensor chip surface. Then, start a new sensorgram with a flow rate of 2 µl/ min and select one desired flow cell on which to immobilize the nucleic acid. 17. Use Manual Inject, load the injection loop with ~100 µl of a 25 nM nucleic acid solution and inject over the low cell. Track the number of RUs immobilized and stop the injection after a desired level is reached (see Note 3).

10

Liu and Wilson

18. Inject ethanolamine hydrochloride for 10 min (50 µl) to deactivate any remaining reactive esters. 19. Prime several times to ensure surface stability. 2.4. Sensor chip Preparation for DNA Immobilization: SA Chip

1. A streptavidin-coated sensor chip (SA chip or prepared as outlined above) that has been at room temperature for at least 30 min. 2. HBS-EP buffer is used as running buffer. 3. Activation buffer: 1 M NaCl, 50 mM NaOH. 4. Biotin-labeled nucleic acid solutions (~25 nM of single-strand or hairpin dissolved in HBS-EP buffer). 5. Dock a streptavidin-coated chip and start a sensorgram with a 20 µl/min flow rate. 6. Inject activation buffer: 1 M NaCl, 50 mM NaOH for 1 min (20 µl) five to seven times to remove any unbound streptavidin from the sensor chip. 7. Allow buffer to flow at least 5 min before immobilizing the nucleic acids. 8. Start a new sensorgram with a flow rate of 2 µl/min and select one desired flow cell on which to immobilize the nucleic acid. Take care not to immobilize nucleic acid on the flow cell chosen as the control flow cell. Generally, flow cell 1 (fc1) is used as a control and is left blank for subtraction. It is often desirable to immobilize different nucleic acids on the remaining three flow cells (see Note 4). 9. Wait for the baseline to stabilize which usually takes a few minutes. Use Manual Inject, load the injection loop with ~100 µl of a 25 nM nucleic acid solution and inject over the low cell. Track the number of RUs immobilized and stop the injection after a desired level is reached (see Note 3). 10. At the end of the injection and after the baseline has stabilized, use the instrument crosshair to determine the RUs of nucleic acid immobilized and record this amount. The amount of nucleic acid immobilized is required to determine the theoretical moles of small molecule binding sites for the flow cell. 11. Repeat steps 4–6 for another flow cell (e.g., fc3 or fc4) (see Note 5).

2.5. Sensor chip Preparation for DNA Immobilization: HPA Chip

1. A HPA sensor chip that has been at room temperature for at least 30 min (see Note 6). 2. HBS-N buffer: 10 mM HEPES pH 7.4, 150 mM NaCl is used as running buffer (see Note 7). 3. 40 mM n-octyl glucoside (Sigma Chemical Co.) water solution.

Quantitative Analysis of Small Molecule–Nucleic Acid Interactions

11

4. 100 mM NaOH water solution. 5. Cholesterol conjugated nucleic acid solutions (~25 nM of hairpin dissolved in HBS-N buffer). (3¢- end conjugated DNA obtained from Integrated DNA Technologies, Coralville, IA or another source) 6. 0.1 mg/ml bovine serum albumin (BSA) prepared in HBS-N running buffer. 7. Before starting, the instrument must be kept scrupulously clean by running “Desorb” followed by “Sanitize”, then run on “Standby” or a low continuous flow rate overnight with distilled water. Switch to running buffer for the experiment. Make sure all solutions used are properly filtered and thoroughly degassed. 8. Liposomes for adsorption on HPA chips should be prepared in running buffer, using standard liposome preparation techniques (51). A liposome concentration of 0.5 mM, with respect to phospholipids, is usually sufficient. 9. Choose an appropriate experimental temperature based on the phase transition temperature (Tc) of liposome to be prepared. At temperatures below Tc, adsorption may be slow and the lipids may not form a monolayer on the surface (see Note 8). 10. Dock an HPA chip and start a sensorgram with a 20 µl/min flow rate using HBS-N running buffer. The chip is precleaned and conditioned by injecting twice with 40 mM n-octyl glucoside for 5 min every time. 11. Start a new sensorgram with a flow rate of 2 µl/min and select one desired flow cell on which to immobilize liposome preparation. Inject 60–180 µl liposome preparation (~0.5 mM), depending on lipid composition, liposome size and experimental temperature. Adsorption is seen as a steady increase in response, which flattens out as the surface coverage approaches completion. Typically, the maximum responses reached are in the region of 1,500–2,000 RU. 12. Inject 10 µl 100 mM NaOH water solution to remove loosely bound structures such as partially fused liposomes and multilayered structure. 13. Start a new sensorgram with a flow rate of 2 µl/min and select one desired flow cell (fc2–fc4) on which to immobilize cholesterol conjugated DNA hairpin. Use Manual Inject, load the injection loop with ~100 µl of a 25 nM nucleic acid solution and inject over the low cell. Track the number of RUs immobilized and stop the injection after a desired level is reached (see Note 3).

12

Liu and Wilson

14. Inject 10–50 µl 0.1 mg/ml BSA or another inert protein to block any exposed hydrophobic area on the sensor chip. 15. Prime several times to ensure surface stability. 2.6. Flow Solutions: Buffers and Samples (see Note 9)

1. HBS-EP buffer:10 mM HEPES pH 7.4, 150 mM NaCl, 3 mM EDTA, 0.005%, v/v polysorbate 20 (GE Healthcare Inc.). 2. MES10 buffer: 10 mM MES [2-(N-morpholino) ethanesulfonic acid] pH 6.25, 100 mM NaCl, 1 mM EDTA, 0.005%, v/v polysorbate 20. 3. CCL10 buffer: 10 mM CCL [cacodylic acid] pH 6.25, 100 mM NaCl, 1 mM EDTA, 0.005%, v/v polysorbate 20. 4. Tris10 buffer: 10 mM Tris-HCl pH 7.4, 100 mM NaCl, 1 mM EDTA, 0.005%, v/v polysorbate 20. 5. Regeneration solution: 10 mM Glycine-HCl (pH 2.5) (see Note 10)

3. Methods The Biacore software supplied with the instruments allows users to write a method or to use a software wizard to set up experiments. Several important factors, such as flow rate, association time and dissociation time, injection order and surface regeneration, must be considered in setting up experiments. A sample method used to collect small molecule binding results on nucleic acid surfaces is shown below. The structure of the compound (DB293) and the biotin-labeled DNA sequences (ATGA, AATT, ATAT) used in this example are shown in Fig. 2. 3.1. Data Collection and Processing

1. A Biacore T100 instrument (GE Healthcare Inc.) is used in this study. 2. Three biotin-labeled DNA hairpins are immobilized in different flow cells of a SA chip as described in Subheading 2.4. Approximately the same moles of each DNA oligomer a immobilized on the surface of these flow cells, so that the sensorgram saturation levels can be compared directly for stoichiometry differences. 3. Serial dilutions (concentration range is from 1 nM to 1 µM) of DB293 compound are prepared with the running buffer as the diluent to minimize the effect of bulk refractive index changes. (see Notes 11 and 12) 4. The flow rate is set to 25 µl/min (see Note 13).

Quantitative Analysis of Small Molecule–Nucleic Acid Interactions

13

Fig. 2. Structure of DB293 and sequences of 5¢-biotin-labeled DNA hairpins

5. A wait period of 5 min is used with running buffer flowing at the beginning of each concentration injection cycle to give a very stable baseline that is essential for accurate small molecule binding analysis. Several buffer samples are injected at the start of each experiment and these indicate whether the instrument is performing within specifications as well as serving as controls for data processing. (see Notes 14 and 15) 6. Inject 250 µl of each concentration of the compound solutions and set 600 s as the dissociation time (see Note 16). Inject samples from low to high concentration to eliminate the artifacts in the data from adsorption carry over on the instrument flow system (see Note 17 and 18). 7. At the end of the dissociation phase, inject two short pulses of regeneration solution (see Note 19), followed by a Mix command with excess volume of buffer and two 1-min injections of running buffer. 8. At the end of each cycle, 5 min waiting with running buffer flowing is also set to ensure that the chip surface is reequilibrated for binding (i.e., the dextran matrix is reequilibrated with running buffer) and the baseline has stabilized before the next sample injection. 9. After the data are collected, open the experimental sensorgrams in the BIAevaluation software for processing (see Note 20). First, zero the sensorgrams on the y-axis (RU) to allow the responses of each flow cell to be compared. Generally, the

14

Liu and Wilson

average of a stable time region of the sensorgram, prior to sample injection, should be selected and set to zero for each sensorgram. Then, zero on the x-axis (time) to align the beginnings of the injections with respect to each other. 10. Subtract the control flow cell (fc1) sensorgram from the reaction flow cell sensorgrams (i.e. fc2−fc1, fc3−fc1, and fc4−fc1). This removes any bulk shift contribution to the change in RUs. 11. Subtract a buffer injection, or better, an average of several buffer injections from the compound injections (different concentrations) on the same reaction flow cell (see Note 21). This is known as double subtraction and removes any flow cell specific baseline irregularities (27). At this point, the data should be of optimum quality and are ready for analysis as shown below. 3.2. Data Analysis

1. After the data are processed as described, kinetic and/or steady-state analysis is performed. Both kinetic and steadystate fitting can be done in Biacore software or in other available software packages (27, 29). As can be seen in Fig. 1, DB293 binding results reach a steady-state plateau in the injection period so that both kinetic and steady analysis can be used. In this case, the binding rate is not limited by mass transfer, and the association and dissociation rate constants can be determined. The average of the data over a selected time period in the steady-state region of each sensorgram can be obtained, converted to r (r = RU/RUmax), and plotted as a function of compound concentration in the flow solution (see Note 22). 2. Equilibrium constants can be obtained by fitting the results to the equivalent site model in Eq. 1.1. For two nonequivalent sites, the following equation can be used: 2

r = (K1 Cfree + 2 K1K2 C free)/(1 + K1Cfree + K1 K2Cfree2)

(3)

where K1 and K2 are the macroscopic thermodynamic binding constants (for a single site K2 = 0) and Cfree is the constant concentration of the compound in the flow solution (see Note 23). As described above, the binding stoichiometry can also be obtained directly from comparing the maximum response with the predicted response per compound. 3. Since in this example, equal moles of DNA hairpin duplexes were immobilized, the difference in maximum responses among the sets of sensorgrams is readily seen and directly reflects the difference in binding stoichiometry. The differences in kinetics constants, binding constants, stoichiometry

Quantitative Analysis of Small Molecule–Nucleic Acid Interactions

15

Fig. 3. Kinetic fitting to the AATT DNA data at low compound concentrations. The DB293 concentrations from bottom to top are 1, 4, 6, 10, 15 and 20 nM. The kinetic analysis is performed with mass transport kinetic 1:1 binding model. The smooth lines are the best fit lines using global fitting

and cooperativity for binding of DB293 to two different DNA hairpins, AATT and ATGA, can now be obtained as illustrated in Figs. 3 and 4. Under these experimental conditions, DB293 binds with a 1:1 ratio to the AATT site or the ATAT site (not shown), but with a 2:1 ratio to the ATGA site. 4. The sensorgram in Fig. 1 contains several distinct regions. In region (1), buffer flows over all surfaces, and a reference baseline is established. In region (2), DB293 is injected, and the kinetics of association can be determined. With time, a steady-state plateau region is established when binding and dissociation of DB293 are equal. In region (3), buffer flow is again started, and the DB293-DNA complex dissociates until the baseline is reached. If complete dissociation does not occur in a time period, a surface regeneration solution can be introduced. The RU on the surface is directly related to the DB293 bound. Based on the RU at saturation, we can determine that DB293 forms a 1:1 complex with the AATT DNA, as expected, and an unusual 2:1 complex with ATGA. 5. The steady state data for compound binding are fit with onesite (AATT) or two-site (ATGA) binding models (Fig. 4 and Table 2). The relative values of the macroscopic equilibrium constants, K1 and K2, reflect a highly cooperativity interac-

16

Liu and Wilson

Fig. 4. Comparison of the SPR binding affinity for AATT and ATGA. RU values from the steady-state region of SPR sensorgrams were converted to r (r = RU/RUmax) and are plotted against the unbound compound concentration (flow solution) for DB293 binding with AATT (squares) and ATGA (circles). The lines are the best fit values using appropriate binding models as described in the text

Table 2 Binding affinity comparison from steady-state fitting DNA binding site

K1 × 107 (1/M)

K2 × 107 (1/M)

CF (K2/K1) × 4

Binding mode

ATGA

0.41

0.98

9.6

Dimer, cooperative

AATT

4.87

—

—

Monomer

ATAT

0.62

—

—

Monomer

tion with ATGA. A cooperativity factor to assess the degree of cooperativity is defined as CF = (K2/K1) × 4. For interaction with no cooperativity, CF = 1, and CF > 1 for positive cooperativity and 2.5 Formic acid HCl 10 mM Glycine/ HCl

pH < 9 10 mM pH < 9 50% HEPES/NaOH ethylene glycol

Intermediate strength

pH 2–2.5 pH 9–10 NaOH Formic acid HCl 10 mM Glycine/ 10 mM Glycine/HCl NaOH H3PO4

Strong strength pH < 2 Formic acid HCl 10 mM Glycine/ HCl H3PO4

pH > 10 NaOH

Hydrophobic

Ionic 1 M NaCl

pH 9–10 50% ethylene glycol

2 M MgCl2

pH > 10 25–50% ethylene glycol

4 M MgCl2 6M guanidine chloride

20

Liu and Wilson

13. For the steady-state method, equilibrium, but not kinetics, constants can be obtained even when mass transfer effects dominate the observed kinetics. Thus, higher flow rates are not required in steady-state experiments, as long as a clear steady-state plateau is obtained for determining RU at the steady-state. Higher flow rates (>50 µl/min) are used for kinetic experiments to minimize mass transport effects. 14. The sample solution must be prepared in the same buffer used to establish the baseline − the running buffer. 15. If the small molecule requires the presence of a small amount of an organic solvent (e.g., 180

108

ACGC

>180

120

TCGT

134

220

Evison, Phillips, and Cutts

4. Notes 1. The promoter selected for this assay must fulfil a number of suitable criteria. The promoter must accommodate a high fidelity of transcription from its start site and permit the initiated transcription complex to possess a half-life of at least several hours. Ideally, no additional transcription activating elements such as CAP and cAMP should be required. These requirements have been fully summarized previously along with a list of promoters that satisfy these criteria (4, 5). 2. It is important to use high purity sterile water to prepare all solutions for this procedure since the presence of trace amounts of metal ions, bacteria or nucleases can completely destroy transcription complexes. 3. Two methoxy nucleotides are generally sufficient for sequencing purposes. These should be chosen based on the expected sequence specificity of the agent under investigation. Alternatively, dideoxynucleotides can be utilised. 4. DTT has a limited half-life. Store in frozen aliquots and use a fresh aliquot for each experiment. 5. The exact MgCl2 concentration is critical to ensure that transcription proceeds efficiently and that natural pausing by the RNA polymerase is minimised. 6. The sequencing mixes are made up as 3× mixes and can be made for any of the four ribonucleotides. Dideoxynucleotides can be used as an alternative to methoxy nucleotides for sequencing reactions. However, a higher concentration is required to ensure adequate incorporation of the dideoxynucleotide. 7. Alternatively, use appropriate restriction enzymes or PCR primers to isolate the lac UV5 promoter from other sources as appropriate. 8. If ethidium bromide is included in the agarose gel, then single-strand nicks may be induced in the DNA, and this will result in a high background of truncated transcripts during the elongation phase of the transcription assay. 9. The Elutrap electroelution procedure has a high efficiency of recovery of DNA from agarose (typically greater than 95%). 10. Pierce the agarose slice with a pipette tip to inject a small amount of loading dye containing bromophenol blue before electroelution. Location of this dye in the electroelution trap after electroelution will help to assess that the process is complete. 11. Comparing the amount of full length transcript produced after three different time periods will allow selection of the

In vitro Transcription Assay for Resolution of Drug-DNA

221

optimal conditions for further experiments, and the repetition involved also allows experimenters to become competent with the technique before progressing to more complex experiments involving the transcription of multiple drugreacted DNA samples. 12. This procedure can be simplified by incubating the initiated transcript directly with drug as previously described (4, 5). This is mandatory if non-covalent drug-DNA interactions are being analysed. Some covalent drug-DNA interactions can also be assessed using this technique, but only if the initiated transcription complex is not damaged by the drug of choice. 13. Subsaturating levels of drug are ideal as this ensures that most drug binding sites are unoccupied, and subsequently a range of truncated transcript lengths that define different blockage sites can be obtained. If drug levels were saturating, transcription would terminate at the first blockage site encountered, thus revealing limited information. 14. The cleanup procedure chosen needs to be relevant to the drug of choice. The procedure is required to remove noncovalently bound drug that may interfere with transcription and other agents that are detrimental to subsequent formation of the transcription complex.

Acknowledgments We thank the Australian Research Council (ARC), National Health and Medical Research Council (NHMRC), and The CASS Foundation for funding our research.

References 1. Hampshire AJ, Rusling DA, Broughton-Head VJ, Fox KR (2007) Footprinting: a method for determining the sequence selectivity, affinity and kinetics of DNA-binding ligands. Methods 42:128–140 2. Murray VA (1999) A survey of the sequencespecific interaction of damaging agents with DNA: emphasis on antitumor agents. Prog Nucleic Acid Res Mol Biol 63:367–415 3. Portugal J (1989) Footprinting analysis of sequence-specific DNA-drug interactions. Chem Biol Interact 71:311–324 4. Phillips DR, Cutts SM, Cullinane CM, Crothers DM (2001) High-resolution transcription assay for probing drug-DNA interactions at

individual drug sites. Methods Enzymol 340: 466–485 5. Phillips DR, Cullinane CM, Crothers DM (1998) An in vitro transcription assay for probing drug-DNA interactions at individual drug sites. Mol Biotechnol 10:63–75 6. White RJ, Phillips DR (1988) Transcriptional analysis of multisite drug-DNA dissociation kinetics: delayed termination of transcription by actinomycin D. Biochemistry 27: 9122–9132 7. Trist H, Phillips DR (1989) In vitro transcription analysis of the role of flanking sequence on the DNA sequence specificity of adriamycin. Nucleic Acids Res 17:3673–3688

222

Evison, Phillips, and Cutts

8. Panousis C, Phillips DR (1994) DNA sequence specificity of mitoxantrone. Nucleic Acids Res 22:1342–1345 9. Cullinane C, Phillips DR (1990) Induction of stable transcriptional blockage sites by adriamycin: GpC specificity of apparent adriamycin-DNA adducts and dependence on iron(III) ions. Biochemistr y 29: 5638–5646 10. Gray PJ, Cullinane C, Phillips DR (1991) In vitro transcription analysis of DNA alkylation by nitrogen mustard. Biochemistry 30: 8036–8040

11. Parker BS, Cutts SM, Phillips DR (2001) Cytosine methylation enhances mitoxantroneDNA adduct formation at CpG dinucleotides. J Biol Chem 276:15953–15960 12. Evison BJ, Chiu F, Pezzoni G, Phillips DR, Cutts SM (2008) Formaldehyde-activated Pixantrone is a monofunctional DNA alkylator that binds selectively to CpG and CpA doublets. Mol Pharmacol 74:184–194 13. Cullinane C, Phillips DR (1993) Thermal stability of DNA adducts induced by cyanomorpholinoadriamycin in vitro. Nucleic Acids Res 21:1857–1862

Chapter 14 In vitro Footprinting of Promoter Regions Within Supercoiled Plasmid DNA Daekyu Sun Abstract Polypurine/polypyrimidine (pPu/pPy) tracts, which exist in the promoter regions of many growth-related genes, have been proposed to be very dynamic in their conformation. In this chapter, we describe a detailed protocol for DNase I and S1 nuclease footprinting experiments with supercoiled plasmid DNA containing the promoter regions to probe whether there are conformational transitions to B-type DNA, melted DNA, and G-quadruplex structures within this tract. This is demonstrated with the proximal promoter region of the human vascular endothelial growth factor (VEGF) gene, which also contains multiple binding sites for Sp1 and Egr-1 transcription factors. Key words: Plasmid footprinting, DNA Secondary structure, G-quadruplex, VEGF

1. Introduction Polypurine/polypyrimidine tracts are known to exist at multiple sites in mammalian genomes, particularly in the proximal promoter regions of growth-related genes (1–7), including VEGF (Fig. 1). These cis-regulatory elements contain multiple Sp1binding sites, and several studies have independently reported the presence of DNase I- or S1 nuclease-hypersensitive sites within the regions of DNA harboring this tract in both chromatin and negatively supercoiled plasmid DNA, suggesting that this tract is structurally dynamic and easily converted into alternative conformations different from the typical B-DNA structure (8–11). In general, the structural transition of B-DNA to alternative secondary structures is preceded by the local melting or unwinding of duplex DNA, which is facilitated by a negative supercoiling stress naturally generated behind the translocating RNA polymerase complex during the transcription of the genes (12–14). Thus, the K.R. Fox (ed.), Drug-DNA Interaction Protocols, Methods in Molecular Biology, vol. 613, DOI 10.1007/978-1-60327-418-0_14, © Humana Press, a part of Springer Science + Business Media, LLC 1998, 2010

223

224

Sun

Fig. 1. Schematic diagram showing the location of the pPu/pPy tract in the proximal promoter region of the VEGF gene.

structural transition of B-DNA to alternative non-B-conformations is believed to temporarily relieve a negative supercoiling stress generated under normal physiological conditions (15, 16). The proximal region of the VEGF promoter contains such a pPu/ pPy tract (Fig. 1), and this chapter uses this as an example for examining the structural dynamics, determining whether it can assume a number of different topological forms. 1.1. VEGF

Most primary solid tumors go through a dormant state in which the maximum attainable size is about 1–2 mm in diameter when the tumor cells use only preexisting host blood vessels (17, 18). However, the growth of new blood vessels from preexisting vessels by a process called angiogenesis allows the tumor cells to progressively expand and disseminate to distant organs (17, 18). Therefore, angiogenesis represents an essential step for tumor growth and metastasis by providing not only oxygen and nutrients to proliferating tumor cells, but also escape routes for metastatic tumor cells (17, 18). The switch to an angiogenic phenotype is mediated by a number of key regulators, such as fibroblast growth factors (FGFs), vascular endothelial growth factors (VEGFs) and angiopoietins, semaphorin, ephrin, Notch/Delta, and the roundabout/slit families of proteins (17, 18). Among them, VEGF (or VEGF-A) has been considered to be the key mediator of tumor angiogenesis by stimulating proliferation, migration, survival, and permeability of endothelial cells (19–21). VEGF expression is mainly regulated at the transcriptional level, and its expression is induced by a variety of factors, including hypoxia, pH, activated oncogenes, inactivated tumor suppressor genes, and growth factors (22–29). VEGF is frequently overexpressed in many types of cancer and the stable expression of VEGF appears to arise from increased VEGF promoter activity (20–30). The VEGF promoter region contains binding sites for several putative transcription factors, such as HIF-1, AP-1, AP-2, Egr-1, Sp1, and many others, suggesting that they may be involved in VEGF transcriptional regulation (3, 22–29).

In vitro Footprinting of Promoter Regions Within Supercoiled Plasmid DNA

225

Functional analysis of the human VEGF promoter using the fulllength VEGF promoter reporter revealed that the proximal 36-bp region (−85 to −50 relative to transcription initiation site) is essential for basal or inducible VEGF promoter activity in several human cancer cells (3). 1.2. Probes for Unusual DNA Structures

The presence of the pPu/pPy tract within the proximal region of the VEGF promoter (Fig. 1) led us to speculate that this region might be structurally dynamic and could potentially assume a number of different topological forms. Since our previous studies demonstrated that oligonucleotides representing the coding strands of this tract could adopt G-quadruplex structures (30), we further investigated the structural dynamics and the overall forms of the pPu/pPy tract within the promoter of the VEGF gene. We employed in vitro footprinting analysis utilizing a negatively supercoiled plasmid DNA containing this region in order to mimic the in vivo situation, where negative supercoils prevail due to the active DNA transaction (12–16, 30). The footprinting agents used in this study include DNase I, and S1 nuclease, since the reactivity of these probes is very sensitive to the conformation of DNA molecules (31, 32). These reagents have been utilized in many previous studies to probe structural transitions from B-DNA to non-B-type DNA structures, such as melted DNA, hairpin structures, G-quadruplex structures, and others (9–11). While DNase I preferentially cleaves locally unwound or normal duplex regions over single-stranded regions, S1 nuclease preferentially cleaves single-stranded regions of DNA over duplex DNA (9–11). However, both enzymes show the lowest cleavage activity toward highly organized secondary structures, such as hairpins or G-quadruplex structures (9–11, 31, 32). For these reasons, the combined use of both nucleases in in vitro footprinting experiments reveal pertinent information about unusual structural features of defined elements within the global region of DNA duplex molecules (31, 32).

2. Materials 2.1. Labeling 5¢-Termini of Nucleic Acids With [ 32P]

1. T4 polynucleotide kinase (Fermentas). 2. Kinase buffer (10×): 500 mM Tris-HCl (pH 7.6), 100 mM MgCl2, 50 mM DTT, 1 mM spermidine, and 1 mM EDTA. 3. Adenosine 5´-gamma 32P triphosphate (g-32P ATP), triethylammonium salt (6,000 Ci/mmole, 10 mCi/mL, GE, Healthcare). 4. Micro Bio-Spin™ 30 Columns (Bio-Rad).

226

Sun

2.2. Digestion of Plasmid DNA With Nucleases

1. DNase I (Promega). 2. S1 nuclease (Promega). 3. A supercoiled plasmid such as pGL3-V789 (see Note 1). 4. KCl buffer (10×): 1M KCl, 100 mM Tris-HCl (pH 7.4 at 25°C) (see Note 2). 5. Control buffer (10×): 100 mM Tris-HCl (pH 7.4 at 25°C).

2.3. Radioactive Cycle Sequencing and Linear Amplification

1. Thermo Sequenase DNA Polymerase (USB); 4 units/ml, 0.0006 units/ml Thermoplasma acidophilum inorganic pyrophosphatase; 50 mM Tris-HCl, pH 8.0, 0.1 mM EDTA, 1 mM dithiothreitol (DTT), 0.5% Tween®−20, 0.5% Igepal™ CA-630, 50% glycerol. 2. Reaction Buffer (concentrate): 260 mM Tris-HCl, pH 9.5, 65 mM MgCl2. 3. Telomestatin (see Note 3). 4. Gene-specific primer: 0.5 pmol/ml; (such as VEGF) 5¢CCCAGCGCCACGACCTCCGAGCTACC -3¢ (see Notes 4–5). 5. dNTP (10 mM) solution: 10 mM each dATP, dGTP, dCTP, dTTP (see Note 6). 6. ddG Termination Mix: 150 mM each dATP, dCTP, 7-deazadGTP, dTTP; 1.5 mM ddGTP. 7. ddA Termination Mix: 150 mM each dATP, dCTP, 7-deazadGTP, dTTP; 1.5 mM ddATP. 8. ddT Termination Mix: 150 mM each dATP, dCTP, 7-deazadGTP, dTTP; 1.5 mM ddTTP. 9. ddC Termination Mix: 150 mM each dATP, dCTP, 7-deazadGTP, dTTP; 1.5 mM ddCTP. 10. Stop Solution: 95% formamide, 20 mM EDTA, 0.05% bromophenol blue, 0.05% xylene cyanol.

2.4. Denaturing PAGE

1. TBE electrophoresis buffer (10×): 0.89M Tris, 0.89M boric acid, 20 mM EDTA, pH 8.0. Store at room temperature. 2. Sixteen percent acrylamide/bisacrylamide (29:1 with 3.3% C) with 8M urea and N,N,N¢,N¢- TEMED, Bio-Rad, Hercules, CA. 3. Ammonium persulfate: prepare 10% solution in water. Store at 4°C up to 1 month.

In vitro Footprinting of Promoter Regions Within Supercoiled Plasmid DNA

227

3. Methods In order to test if the pPu/pPy tract of a promoter region is structurally dynamic and can easily adopt a non-B-DNA conformation under physiological conditions, in vitro footprinting with DNase I and S1 nuclease is performed with a supercoiled form of a plasmid (such as pGL3-V789, which contains the VEGF promoter region from –727 to +50). This plasmid is incubated in the absence of any salt, or in the presence of 100 mM KCl to facilitate the evolution of the secondary structures from the pPu/pPy region. To test the binding of the G-quadruplex interactive agent to the secondary structures, the plasmid DNA is incubated with and without 1 mM telomestatin (33) for 1 h at 37°C, and then treated with DNase I or S1 nuclease for 2 min. To map S1 and DNase I cleavage sites, linear amplification by PCR was performed with 32P-labeled-gene-specific primers to amplify the top strand of both nucleases treated plasmid DNA. An overall strategy to perform in vitro footprinting of the wild-type VEGF promoter contained in a supercoiled plasmid in the presence of K+ and G-quadruplex-interactive compounds is shown schematically in Fig. 2.

Fig. 2. Flowchart of DNase I and S1 nuclease footprinting experiments of the VEGF promoter region in a supercoiled plasmid.

228

Sun

3.1. Isolation of Supercoiled Plasmids

The supercoiled plasmids are isolated from transformed E. coli strain DH5a using the QIAGEN Plasmid Maxi Kit. This method is based on modified SDS-alkaline lysis of bacterial cells in combination with selective binding of the DNA to silica beads in the presence of certain salts (see Note 7).

3.2. Treatment Plasmid DNA With Nuclease

1. In an empty tube, supercoiled plasmid (2 mg) and 2.5 ml of 10× KCl or control buffer are mixed and brought to 25 ml with the addition of DDW (see Note 8). 2. The incubation proceeds at 37°C for over 12 h or overnight to allow the secondary structures to evolve from the pPu/pPy region. 3. For testing the drug binding to the secondary structures, add 1 ml of diluted drug solution in KCl or control buffer (e.g., 25 mM telomestatin in KCl or control buffer) to 25 mL DNA solution and mix them by vortexing and centrifuge briefly. 4. Incubate the reaction mixture at 37°C for 1 h. 5. Add 2 mL of diluted DNase I (0.2 U) or 200 U of S1 nuclease to the tube, mix gently by pipetting up and down several times, cap the tubes and centrifuge briefly. After 1 min digestion, add 100 mL of 0.3M sodium acetate to the reactions followed by DNA precipitation with two volumes 100% ethanol and placement at −20°C overnight. 6. Spin in microfuge for 30 min and allow pellet to air dry. 7. Resuspend the dried pellet completely in 25 mL of TE buffer.

3.3. Labeling 5¢-Termini GeneSpecific Primers With [32P]

1. Prepare a reaction mixture (25 mL), containing oligonucleotide (4 mM), 3 mL g-32P ATP (6,000 Ci/mmole, 10 mCi/ mL), T4 polynucleotide kinase (10 U), 2.5 mL 10× kinase buffer, and water. 2. Incubate the reaction mixture at 37°C for 1 h in water bath for labeling 5¢-termini of oligonucleotides with g-[32P]-ATP. 3. After completion of the reaction, use Micro Bio-Spin™ 30 Columns (Bio-Rad) to remove unincorporated radioactive g-32P ATP (6,000 Ci/mmole, 10 mCi/mL) from labeled DNA. The instructions for use of Bio-Spin™ 30 Columns are based on recommendations from the manufacturer. In brief, the reaction mixture (25 mL) is loaded at the top of the column after centrifuging the column at 1,000× g for 4 min in a swinging bucket and removing the packing buffer. The column is then centrifuged for 4 min at 1,000× g to collect the purified 5¢-end-labeled oligonucleotide in water (see Note 9).

3.4. Radiolabeled Primer Cycle Sequencing

1. Label four tubes representing G, A, T and C. 2. Place 4 ml of the ddGTP termination mix in the tube labeled G. Similarly, fill the A, T and C tubes with 4 ml of the ddATP, ddTTP and ddCTP termination mixes respectively.

In vitro Footprinting of Promoter Regions Within Supercoiled Plasmid DNA

229

3. In a separate microcentrifuge tube, combine the following: 1 mL of plasmid DNA (20 pmole), 0.5 mL of concentrated reaction buffer, 1.0 mL of labeled primer, 1.0 mL of distilled water and 0.5 mL of Thermo Sequenase DNA Polymerase (see Note 10). 4. Transfer it to the PCR tube (from step 1), mix gently by pipetting up and down several times, cap the tubes and place them in the thermal cycler (see Note 11). 5. Carry out PCR using cycling conditions consisting of an initial 10-min denaturation step at 94°C, 1 min at 60°C, and 1 min at 72°C, for a total of 42 cycles (see Note 12). 6. Add 4 ml of stop solution to each of the termination reactions, mix thoroughly and centrifuge briefly. 3.5. Linear Amplification of the Plasmid DNA Digested With DNase I or S1 Nuclease Using 32 P-Labeled Primers

1. Place 4 ml of the plasmid DNA digested with DNase I or S1 nuclease from Subheading 3.2 in each PCR tube. 2. In a separate microcentrifuge tube, combine the following: 0.5 mL of 10 mM dNTP solution, 0.5 mL of concentrated reaction buffer, 0.5 mL of labeled primer, 2.0 mL of distilled water and 0.5 mL of Thermo Sequenase DNA Polymerase (see Note 9). 3. Transfer it to the PCR tube (from step 1), mix gently by pipetting up and down several times, cap the tubes and place them in the thermal cycler (see Note 13). 4. Carry out PCR using cycling conditions consisting of an initial 10-min denaturation step at 94°C, 1 min at 60°C, and 1 min at 72°C, for a total of 42 cycles (see Note 14).

3.6. Separation of PCR Products on Denaturing PAGE

1. Set up a denaturing 10% polyacrylamide gel of 30 cm × 30 cm × 0.4 mm. 2. Prepare 60 mL of gel solution by mixing 6 mL TBE buffer (10×), 15 mL of 40% acrylamide/bisacrylamide (29:1), and 30 g urea and adding water to 60 mL. After adding 100 mL ammonium persulfate solution and 20 mL TEMED, pour the gel and insert the comb. 3. Once the gel is polymerized, carefully remove the comb, and wash the well with TBE buffer (1×) using a pasture pipette. 4. Attach the gel plates to the electrophoresis apparatus, and fill both reservoirs of the electrophoresis tank with 1× TBE. Prerun and warm the gel for at least 30 minutes at 1,400 V (constant voltage) using a DC power supply. 5. Heat the samples and sequencing ladders at 95°C for 3 min, and chill the sample on ice before loading. Run the gel at about 1,400 V.

230

Sun

6. After the desired resolution is obtained, detach the gel plates from the electrophoresis apparatus, and carefully separate both plates, leaving the gel attached to one plate. 7. Place a piece of thin chromatography paper (DE81) on top of the gel, and slowly pull back on the paper to transfer gels to the paper. 8. Place a piece of Whatman paper (3MM) underneath, and cover the wet gel with plastic wrap on top. 9. Put the gel sandwich in a dryer between a plastic fiber mat and clear plastic sheet, and dry the gel at 80°C for at least 1 h with a vacuum. 10. Place the dried gel in an X-ray film cassette. Obtain an autoradiogram by exposing the X-ray film to the dried gel. Alternatively, the image can be obtained by exposing the dried gel to the phosphor screen for an appropriate time and scanning the phosphor screen. Fig. 3 is an example of an

Fig. 3. In vitro footprinting of the VEGF promoter region with DNase I, S1 nuclease or DMS. Autoradiograms showing S1 nuclease and DNase I cleavage sites on the G-strand of a supercoiled pGL3-V789 plasmid. This plasmid was incubated in control (lane 1), or in KCl buffer without (lane 2), and with 1 mM telomestatin (lane 3) at 37°C for 1 h before digesting with nucleases. Arrows indicate the hypersensitive cleavage sites to nucleases. The primer extension reaction revealed a long protected region at approximately −53 to −123 bp, including the G-rich sequences, when a supercoiled pGL3V789 plasmid was incubated with 100 mM KCl and digested with DNase I (compare lanes 1 and 2). This indicates a possible transition from B-DNA to a G-quadruplex structure in the VEGF promoter region, which is consequently resistant to DNase I digestion. Significantly, a striking hypersensitivity was found in the presence of KCl and telomestatin at a cytosine located at the 3¢-side of the G-quadruplex-forming region (underlined sequence), which is the junction site separating the putative G-quadruplex from the adjacent normal B-DNA (see arrow “A” in lane 3). The reactivity of S1 nuclease at the VEGF proximal promoter region was also moderately reduced in the presence of telomestatin and KCl, and the hypersensitivity site observed with S1 nuclease corresponds to one of those obtained with DNase I in the presence of telomestatin and KCl (lane 3) (Figure modified from ref (30)).

In vitro Footprinting of Promoter Regions Within Supercoiled Plasmid DNA

231

autoradiogram of a 10% polyacrylamide sequencing gel, showing the results of S1 and DNase I footprinting experiments carried out with a supercoiled pGL3-V789 plasmid.

4. Notes 1. Plasmid pGL3-V789 was originally constructed by Dr. Keping Xie by subcloning a 789 bp fragment containing 5¢ VEGF promoter sequences from −729 to +50 relative to the transcription initiation site into the KpnI and NheI sites of pGL3-basic (Promega, Madison, WI), which contains firefly luciferase coding sequences (3). 2. KCl Buffer provides optimum conditions for the formation of G-quadruplex structures from the single stranded DNA. 3. Telomestatin was kindly provided by Dr. Kazuo Shin-ya. 4. It is also a good idea to check the sequence of the primer for possible self-annealing (dimer formation could result) and for potential “hairpin” formation, especially those involving the 3¢-end of the primer. 5. Finally, check for possible sites of false priming in the vector or other known sequence if possible, again stressing matches which include the 3¢-end of the primer. 6. All enclosed reagents should be stored frozen at −20°C and keep all reagents on ice once removed from storage for use. 7. The protocol is suitable for obtaining pure plasmid DNA up to 100 mg from 30~100 ml bacterial culture grown in LB medium. The culture volume should be reduced to half or less when bacteria grown in rich medium are used. 8. It is best to prepare one large reaction mix and then aliquot 25 ml into each sample tube. 9. No further purification is required for most sequencing. 10. Use 1.0 pmol of fresh 32P-labeled primers, but two- to fivefold more primer can be used for shorter exposure times. 11. It is best to prepare one large reaction mix and then aliquot 4 ml into each sample tube. 12. The specific cycling parameters used will depend on the primer length and sequence and the amount and purity of the template DNA. 13. It is best to prepare one large reaction mix and then aliquot 4 ml into each sample tube. 14. If your gels seem to require longer exposures, and more template is not available, increase the number of PCR cycles.

232

Sun

Acknowledgments This research was supported by grants from the National Institutes of Health (CA109069). We are grateful to Drs. Allison Hays and Keith Fox for proofreading and editing the final version of the manuscript and figures. We also thank Drs Keping Xie and Kazuo Shin-ya for providing pGL3-V789 and telomestatin, respectively, for this study. References 1. McCarthy JG, Heywood SM (1987) A long polypyrimidine/polypurine tract induces an altered DNA conformation on the 3¢ coding region of the adjacent myosin heavy chain gene. Nucleic Acids Res 15:8069–8085 2. Michelotti GA, Michelotti EF, Pullner A, Duncan RC, Eick D, Levens D (1996) Multiple single-stranded cis elements are associated with activated chromatin of the human c-myc gene in vivo. Mol Cell Biol 16:2656–2669 3. Shi Q, Le X, Abbruzzese JL, Peng Z, Qian CN, Tang H et al (2001) Constitutive Sp1 activity is essential for differential constitutive expression of vascular endothelial growth factor in human pancreatic adenocarcinoma. Cancer Res 61:4143–4154 4. Rustighi A, Tessari MA, Vascotto F, Sgarra R, Giancotti V, Manfioletti G (2002) A polypyrimidine/polypurine tract within the Hmga2 minimal promoter: a common feature of many growth-related genes. Biochemistry 41:1229–1240 5. Cogoi S, Xodo LE (2006) G-quadruplex formation within the promoter of the KRAS protooncogene and its effect on transcription. Nucleic Acids Res 34:2536–2549 6. De Armond R, Wood S, Sun D, Hurley LH, Ebbinghaus SW (2005) Evidence for the presence of a guanine quadruplex forming region within a polypurine tract of the hypoxia inducible factor 1a promoter. Biochemistry 44:16341–16350 7. Guo K, Pourpak A, Beetz-Rogers K, Gokhale V, Sun D, Hurley LH (2007) Formation of pseudosymmetrical G-quadruplex and i-motif structures in the proximal promoter region of the RET oncogene. J Am Chem Soc 129:10220–10228 8. Pullner A, Mautner J, Albert T, Eick D (1996) Nucleosomal structure of active and inactive c-myc genes. J Biol Chem 271: 31452–31457

9. Wang Z, Lin XH, Qiu QQ, Deuel TF (1992) Modulation of transcription of the plateletderived growth factor A-chain gene by a promoter region sensitive to S1 nuclease. J Biol Chem 267:17022–17031 10. Siebenlist U, Henninghausen L, Battey J, Leder P (1984) Chromatin structure and protein binding in the putative regulatory region of the c-myc gene in Burkitt lymphoma. Cell 37:381–391 11. Evans T, Efstratiadis A (1986) Sequencedependent S1 nuclease hypersensitivity of a heteronomous DNA duplex. J Biol Chem 261:14771–14780 12. Benham CJ (1985) Theoretical analysis of conformational equilibria in superhelical DNA. Ann Rev Biophys Biophysical Chem 14:23–45 13. Liu LF, Wang JC (1987) Supercoiling of the DNA template during transcription. Proc Natl Acad Sci USA 84:7024–7027 14. Williams DL, Kowalski D (1993) Easily unwound DNA sequences and hairpin structures in the Epstein-Barr virus origin of plasmid replication. J Virol 67:2707–2715 15. Kouzine F, Levens D (2007) Supercoil-driven DNA structures regulate genetic transactions. Front Biosci 12:4409–4423 16. Kouzine F, Sanford S, Elisha-Feil Z, Levens D (2008) The functional response of upstream DNA to dynamic supercoiling in vivo. Nat Struct Mol Biol 15:146–154 17. Folkman J (2002) Role of angiogenesis in tumor growth and metastasis. Semin Oncol 29:15–18 18. Sullivan DC, Bicknell R (2003) New molecular pathways in angiogenesis. Br J Cancer 89:228–231 19. Martiny-Baron G, Marme D (1995) VEGFmediated tumour angiogenesis: a new target for cancer therapy. Curr Opin Biotechnol 6:675–680

In vitro Footprinting of Promoter Regions Within Supercoiled Plasmid DNA 20. Goodsell DS (2003) The molecular perspective: VEGF and angiogenesis. Stem Cells 21:118–119 21. Jain RK (2002) Tumor angiogenesis and accessibility: role of vascular endothelial growth factor. Semin Oncol 29:3–9 22. Gunningham SP, Currie MJ, Han C, Turner K, Scott PA, Robinson BA et al (2001) Vascular endothelial growth factor-B and vascular endothelial growth factor-C expression in renal cell carcinomas: regulation by the von Hippel-Lindau gene and hypoxia. Cancer Res 61:3206–3211 23. Schafer G, Cramer T, Suske G, Kemmner W, Wiedenmann B, Hocker M (2003) Oxidative stress regulates vascular endothelial growth factor-A gene transcription through Sp1- and Sp3-dependent activation of two proximal GC-rich promoter elements. J Biol Chem 278:8190–8198 24. Maeno T, Tanaka T, Sando Y, Suga T, Maeno Y, Nakagawa J et al (2002) Stimulation of vascular endothelial growth factor gene transcription by all trans retinoic acid through Sp1 and Sp3 sites in human bronchioloalveolar carcinoma cells. Am J Respir Cell Mol Biol 26:246–253 25. Chen H, Ye D, Xie X, Chen B, Lu W (2004) VEGF, VEGFRs expressions and activated STATs in ovarian epithelial carcinoma. Gynecol Oncol 94:630–635 26. Pal S, Datta K, Khosravi-Far R, Mukhopadhyay D (2001) Role of protein kinase Czeta in Rasmediated transcriptional activation of vascular permeability factor/vascular endothelial growth factor expression. J Biol Chem 276: 2395–2403

233

27. Tanaka T, Kanai H, Sekiguchi K, Aihara Y, Yokoyama T, Arai M et al (2000) Induction of VEGF gene transcription by IL-1 beta is mediated through stress-activated MAP kinases and Sp1 sites in cardiac myocytes. J Mol Cell Cardiol 32:1955–1967 28. Finkenzeller G, Sparacio A, Technau A, Marme D, Siemeister G (1997) Sp1 recognition sites in the proximal promoter of the human vascular endothelial growth factor gene are essential for platelet-derived growth factor-induced gene expression. Oncogene 15:669–676 29. Forsythe JA, Jiang BH, Iyer NV, Agani F, Leung SW, Koos RD et al (1996) Activation of vascular endothelial growth factor gene transcription by hypoxia-inducible factor 1. Mol Cell Biol 16:4604–4613 30. Sun D, Guo K, Rusche JJ, Hurley LH (2005) Facilitation of a structural transition in the polypurine/polypyrimidine tract within the proximal promoter region of the human VEGF gene by the presence of potassium and G-quadruplex-interactive agents. Nucleic Acids Res 33:6070–6080 31. Saluz HP, Jost JP (1993) Approaches to characterize protein-DNA interactions in vivo. Crit Rev Eukaryot Gene Expr 3:1–29 32. Dabrowiak JC, Goodisman J, Ward B (1997) Quantitative DNA footprinting. Methods Mol Biol 90:23–42 33. Kim MY, Vankayalapati H, Shin-Ya K, Wierzba K, Hurley LH (2002) Telomestatin, a potent telomerase inhibitor that interacts quite specifically with the human telomeric intramolecular G-quadruplex. J Am Chem Soc 124: 2098–2099

Chapter 15 Topoisomerase I-Mediated DNA Relaxation as a Tool to Study Intercalation of Small Molecules into Supercoiled DNA Paul Peixoto, Christian Bailly, and Marie-Hélène David-Cordonnier Abstract Several biochemical and biophysical methods are available to study the intercalation of a small molecule between two consecutive base pairs of DNA. Among them, the topoisomerase I-mediated DNA relaxation assay has proved highly efficient, relatively easy to handle and very informative to investigate drug binding to DNA. The test relies on the use of a supercoiled plasmid to mimic the topological constraints of genomic DNA. The three main components of the assay – the topoisomerase I enzyme, DNA helix and intercalating small molecules – are presented here in a structural context. The principle of the assay is described in detail, along with a typical experimental protocol. Key words: DNA topoisomerase, DNA relaxation, Intercalation process, Drug/DNA binding, Mechanism of action

1. Introduction The method presented here has been routinely used over many years to characterise the interaction of small molecules with DNA, in particular anticancer agents. The relaxation assay using topoisomerase I is one of the most robust approaches to evidence intercalation of small molecules into DNA. It is based on a process naturally occurring in every living cell. Here, we describe the typical experimental protocol and, to begin with, the players and the principle of the assay. 1.1. DNA Topoisomerase I

DNA is a long-established anticancer target. Many vital cellular processes, such as DNA replication and repair, transcription, chromosome aggregation and segregation, are highly active in proliferative

K.R. Fox (ed.), Drug-DNA Interaction Protocols, Methods in Molecular Biology, vol. 613, DOI 10.1007/978-1-60327-418-0_15, © Humana Press, a part of Springer Science + Business Media, LLC 1998, 2010

235

236

Peixoto, Bailly, and David-Cordonnier

tumour cells. These processes induce extensive constraints and tangles in the DNA helix that are resolved by specific proteins capable of manipulating DNA structures: the DNA topoisomerases (1–8). Topoisomerase forms a protein/DNA complex in a 1:1 (topoisomerase I) or 2:1 (topoisomerase II) stoichiometry, requiring ATP and the presence (topoisomerase II) or absence (topoisomerase I) of divalent cations (Mg2+), cutting one (topoisomerase I) or both strands (topoisomerase II) of the DNA helix. The enzymatic cycle for topoisomerase I is presented in Fig. 1A and B. Structurally, topoisomerase I is subdivided into four domains, namely I, II, III and IV (only domains I to III are presented in Fig. 1C) and a linker helical domain (L) (9–12). After DNA recognition (step a in Fig. 1A and B), a transesterification reaction links the reactive tyrosine residue of the protein (Y723, localised in domain III for human topoisomerase IB, see Fig. 1B) to the 3¢-phosphate end of a DNA fragment (steps a–b). This reaction leads to the formation of a covalent topoisomerase–DNA complex (step b), referred to as the “cleavable complex” that slackens off local DNA constraints at the free strand. Subsequently, a reversible nicking reaction (stage c) occurs from a second nucleophilic attack between the free 5¢-OH group (for topoisomerase I) of the opened strand and the 3¢-phosphotyrosyl bond, to give back a native and relaxed DNA helix (step d) and a functional free topoisomerase I enzyme, ready to initiate a new enzymatic cycle. Structurally, topoisomerase IB surrounds DNA like a hand with its fingers tightly clamped around the DNA helix (Fig. 15.1C) and the arm being the linker domain L. Topoisomerase IB cuts the DNA on one strand, links to the 3¢-end, allowing the revolution of the 5¢ part of the open-strand over the non-cut strand, acting as a swivel. Then, 3¢- and 5¢-ends are religated to give back the full-length double-stand DNA helix, without the loss of genetic information. From X-ray data, the “fingers” surround the DNA downstream from the scissile strand very closely and are maintained closed by a disulphide bond so that to block full rotation of the DNA strand. In this way, no extensive opening of the protein clamp can occur, suggesting that only small shifts in the orientation of the cap and linker domains accommodate with full rotation of the open strand (13). Consequently, unwinding of the DNA by topoisomerase IB does not lead to a total release of all

Fig. 1. (continued) to the protein, DNA interaction step; b, cleavage of the DNA from a transesterification process leading to the formation of the cleavable complex; c, religation of the DNA resulting from the second transesterification process and d, dissociation of the topoisomerase I, DNA complex leading to the release of the functional enzyme and relaxed DNA (compare constraint and relaxed DNA helix in a and c steps on the bottom panel). The structure of topoisomerase I corresponds to that obtained from the 70-kDa protein lacking part of the C-terminal domain. (C) Topoisomerase binding to DNA matching the position of a hand with fingers holding tight the helix. The position of the gap between the two parts of the surrounding hand is presented as an arrow. Structural subdomains I, II, III and linker domain L are localised.

Topoisomerase I-Mediated DNA Relaxation as a Tool to Study Intercalation

237

Fig. 1. Topoisomerase I enzymatic reaction cycle and global structure. The reaction cycle is presented as a typical cycle (A) or as the chemical transesterification process (B). Four different reaction steps are identified: a, recognition corresponding

238

Peixoto, Bailly, and David-Cordonnier

supercoils in one step, but is a multi-step phenomenon with the “hand” holding tight and then releasing the DNA at each step. The resulting number of released supercoils is, however, not linear, but follows an exponential distribution as a consequence of the torque sensitivity of topoisomerase IB: the more twisted the DNA, the higher number of released supercoils (14). This phenomenon is the basis for topoisomerase-induced DNA relaxation studies to identify the intercalative properties of a DNA-binding compound, based on the helicity of the DNA and the constraints produced by the DNA intercalation of a small molecule between two adjacent base pairs. 1.2. DNA: The Properties of a Helix

In cells, the DNA helix is mainly organised as a right-handed helix (Fig. 2a). This “right-hand screw” has however a complex geometry at the origin of the internal curvature and flexibility of the DNA (15–18). Rotation over the three geometrical axes can occur (Fig. 15.2b), leading to multiple structural movements such as twist (W), tilt (t), roll (r) and slide (s) effects of the base steps (see Fig. 2c). These parameters directly depend on the nature of the bases following each other along the helix, but also indirectly on the presence and nature of salts or proteins bound to the DNA. Indeed, the degree of propeller twist is higher in A·T than in G·C base pairs and follows from the flexibility of hydrogen bonds between base pairs to allow better overlapping of the bases from the van der Waals stacking. Overall, each type of base steps present a different set of W, r and s values (16, 19–24) that are also affected by the nature of both 5’- and 3’-bases, widening the variability in structure conformations of the DNA helix. W is ~30° for ApT step, contrasting with W of ~40° for TpA step, exemplifying the zigzag conformation of alternative Y/R and R/Y base pairs DNA (25); runs of adenines present typical propeller twist with only poor W, r and s variations leading to stiff DNA (26, 27) with a full helix turn obtained with only 10.0 bp instead of 10.6 for mixed-bases DNA. GG, CG and GC steps present the highest s and lowest W values, and are therefore more flexible than AA and AT steps belonging to the rigid subgroup with lowest s and highest W effects (17, 28–32). By contrast, W and s values for TA step are closer to that for GG, CG, GC than for AT or AA steps. Topoisomerase I exquisitely manipulates the various W/t/ r/s parameters in DNA helix.

1.3. Intercalation of Small Compounds into the DNA: Structural Consequences

Many small molecules, particularly (but not exclusively) those containing a flat aromatic chromophore, can insert between two consecutive base pairs as a DNA intercalation process that produces specific DNA constraints. As a helical stair representation of the DNA, with base pairs being the steps, the space between two

Topoisomerase I-Mediated DNA Relaxation as a Tool to Study Intercalation

239

Fig. 2. DNA helix and helical turns. (a) Right-handed DNA as a typical B-form with the medium 36° of twisting between adjacent base pairs. The helicity of the DNA is presented for one DNA strand as an arrow in front of (black arrow) or behind (grey arrow) the successive base pairs. (b) Illustration of the tri-dimensional coordinates (x, y and z) for base pairs movements. The base pairs are presented as a rectangle. Each side of the base pairs corresponds to a different colour on the frame. (c) Examples of the orientation changes in DNA base pairs by slipping (slide) along the y axis or rotation along the x (tilt), y (roll) or z (twist) axes. (d) Examples of slide (s) and roll (r) effects. This figure (adapted from Calladine and Drew (15)) evidences the global torsion of the DNA structure visualised by the DNA axis (central grey lane) and DNA strand distortions (black, grey arrows) and concomitant reduction of the length of the DNA fragment when both slide and roll effects are applied (right panel).

successive base pairs is around 0.34 nm (3.4 Å). Subsequent incorporation of a planar molecule in this space, sandwiched between the two base pair raises the height of the step to 0.68 nm, at least in theory (Fig. 3).

240

Peixoto, Bailly, and David-Cordonnier

Fig. 3. DNA relaxation upon mono- or bis-intercalation. Normal DNA helix (a), mono-intercalation (b) or bis-intercalation of the DNA (c). The intercalating chromophores (Interc) are presented in blue. Their respective positioning between adjacent base pairs (−1 and +1) induces a different twisting angle (x° or y°) that is specific of the nature of the intercalating, bis-intercalating compound. The intercalation, bis-intercalation processes lead to an increase in the length of the DNA visualised by a brace (D length) and an unwinding of the DNA helix as visualised by the arrow on the top of each panel.

Different examples of DNA intercalating drugs are given in Fig. 4. The planar chromophores could have different orientations relative to the base pair axis from perpendicular (33–37) to parallel (38–41) (Fig. 4). The intercalation process occurs preferentially between alternating base pairs (preferentially CpG/CpG), but can also occur between identical base pairs as reported with cryptolepine easily intercalated between two successive C·G base pairs (CpC/GpG site) (42). DNA intercalation produces an unwinding of the helix that can be measured and varies depending on the structure of the intercalating agent (Fig. 3): the mono-intercalators ethidium bromide and actinomycin D induce an unwinding angle of 26°, close to that measured with methylene blue (24°C) (43), whereas the anthracycline derivative daunorubicin or imide derivatives of 3-nitro-1,8-naphthalic acid unwind the DNA less profoundly with a smaller angle of 11° (33, 44). Bis-intercalators bearing two planar chromophores can double (or nearly) the unwinding value (Fig. 3), for example, that for the bis-intercalator echinomycin is 1.82 ± 0.30 times that of ethidium bromide (45, 46); the synthetic bis-quinoxaline drug TANDEM extensively unwinds DNA with an unwinding angle of 45° (47, 48) and the bis-naphthalimide drug elinafide (LU79553) by 37° (49, 50). Typically, the intercalation process differs from the groove binding mode by a weaker binding constant (ranging from 10−4

241

Topoisomerase I-Mediated DNA Relaxation as a Tool to Study Intercalation

–1 CH3 +N

Interc

NH2

N H

+1

N

Cryptolepine perpendicular O

parallel

N

HN

OCH3

COCH2R OH OCH3 O

OH

Cl

N

O

–

Br

Quinacrine

CH3

OH NH3 H3C

Daunomycin R = H Adriamycin R = OH

+

N

NH2

CH3

Ethidium bromide

CH3

Methylene blue O

N

N O

2-methyl-9-hydroxyellipticinium

S

CH3

N+

N H

+

N

N

H2N

N

+

HO

9-amino-DACA (acridine-carboxamide)

CH3

OH

+ N

N H

O

O

O

NH N

NH O

O

N

O

N

NH2

O

O

N O

N

O H N

CH3

O

HN

O O

N

N H

CH3

Ellipticine

Actinomycin D Fig. 4. Orientation of the intercalating chromophore in DNA helix. The intercalating compounds could be positioned parallel (along the y-axis) or perpendicular (along the x-axis) relatively to the adjacent base pairs. In perpendicular orientation, parts of the intercalating molecule could protrude in either the minor or the major groove of the DNA helix.

to 10−6 M−1 and 10−5 to 10−9 M−1, respectively) and high rates for association/dissociation constants (for example, anthraquinone derivatives stay for less than a millisecond in its intercalative site (51)). But of course, there are always exceptions to the rule; highaffinity intercalators and low-affinity groove binders do exist.

2. Materials 2.1. Plasmid Purification on CsCl Gradient

Circular plasmid DNA is a very useful template to study the activity of topoisomerase I, drugs inhibiting topoisomerase I or compounds modifying the DNA topology such as DNA intercalators. The global folding of closed circular duplex DNA depends not only on the slide/roll/twist of the base pairs and on bending/

242

Peixoto, Bailly, and David-Cordonnier Sc Topo I Interc

electrophoretic migration

well

0 –1 –2 –3 –4 –5 –6 –7 –8 negative Right-handed supercoils

– –

0 +1 +2 +3 +4 +5 +6 +7 +8

+ +

positive Left-handed supercoils

Fig. 5. Schematic representation of the DNA relaxation process of supercoiled plasmid DNA. Migration on an agarose gel in the absence of ethidium bromide reveals different topoisomers (illustrated for eight different possible topoisomers) generated by the cleavage, religation cycle of topoisomerase I. The supercoiled plasmid DNA (Sc), presented as a control of migration present underwound helical turns (negative or right-handed supercoils). Supercoiled plasmid incubated with increasing concentration on intercalating agent (“Interc”) and then treated with topoisomerase I (lanes “Topo I”) reveals the transition from negative topoisomers (numbered and illustrated on the left of the panel) to fully relaxed DNA (“0”) and then to positively (left-handed) supercoiled DNA (numbered and illustrated on the right of the panel).

twisting of the helix but also on the number of supercoils, also referred as the linking number (Lk, where Lk = T + W, T being the twist and W the writhe of the DNA double helix) and corresponding to the number of times the two strands of the helix are wrapped around one another before resealing. It is important to bear in mind that the supercoiled DNA can be underwound (negative supercoils) or overwound (positive supercoils). The three-dimensional representations of supercoiled DNA at minimal energy define different organisations with, for example, linear inter-wound (as presented in Fig. 5, see “-1” form), asymmetric three lobe branches or trefoil structure (17, 52–56). In bacteria, the plasmids are negatively supercoiled (57) with up to one superhelical turn per 200–250 bp (58). Various double-strand supercoiled plasmids could be used as substrates. However, the greater the number of base pairs, the greater the number of topoisomers and, as a consequence, plasmids containing between 2,500 and 3,500 bp present a sufficient number of topoisomers and should be preferred to vectors of 4,000 or more base pairs, which are usually more difficult to manipulate (requiring lower resolution on gels).

Topoisomerase I-Mediated DNA Relaxation as a Tool to Study Intercalation

243

The classical pUC18 or pUC19 plasmids (2,686 bp; Fermentas GMBH, St Leon-Rot, Germany), pBluescript-II-SK/KS (2,961 bp; Stratagene), (pSP64/65, 2,999 bp; Promega), pGEM-T (3,000 bp; Promega) or pBS(−) (3,204 bp; Stratagene) are typical examples of routinely used templates for topoisomerase I-induced DNA relaxation assays. In order to get an enrichment of the supercoiled form of the plasmid DNA over the nicked or linear forms, the method of purification is important. –

LB (Luria Bertoni) medium: peptone 10 g/L; yeast extract 5 g/L, NaCl 86 mM; pH 7.5; sterilised.

–

Antibiotic: ampicillin 0.5 mg/mL final solution, for the plasmid vectors presented above.

–

A shaker with the temperature fixed at 37°C for 500 mL culture bacteria vials.

–

A centrifuge for collecting the bacteria from medium with 200 mL centrifuge vials and an appropriate rotor.

–

Buffer 1: 25 % saccharose in 50 mM Tris–HCl, pH 8.0.

–

Lysozyme : stock at 10 mg/mL.

–

Buffer 2: 50 mM Tris–HCl, pH 8.0, EDTA 20 mM, Triton X-100 0.1%.

2.1.3. Elimination of Bacterial Remnants from Lysis.

–

Swinging rotor such as the SW-41 Ti rotor from Beckman Coulter.

–

9 g of CsCl (precisely weighted).

2.1.4. Separation of Plasmid DNA from Bacterial Genomic DNA

–

Ethidium bromide stock solution: 10 mg/mL.

–

Ultracentrifugation system and fixed angle rotor (such as the TI80 rotor from Kontron).

2.1.5. Recovery of the Plasmid

–

G45 needle.

–

2 mL syringe.

–

UV transilluminator (366 nm).

–

Tris/EDTA dialysis buffer: 10 mM Tris–HCl, 1 mM EDTA, pH 8.0.

–

Buffer BPE: 6 mM Na2HPO4, 2 mM NaH2PO4, 1 mM EDTA, pH 7.4.

–

UV spectrophotometer coupled to a thermostated element (for example an UVIKON 943 spectrophotometer coupled to the Neslab RTE111 temperature controller system).

–

1-cm path length quartz cuvettes.

2.1.1. Amplification of the Plasmid in Bacteria

2.1.2. Lysis of Bacteria

2.1.6. Removal of Ethidium Bromide

244

Peixoto, Bailly, and David-Cordonnier

2.1.7. Alternative Plasmid Purification System

–

Purification columns: NucleoBond PC (Machery-Nagel Gmbh, Germany) or HiSpeed Plasmid Kits (Qiagen SA, France), for examples.

2.2. Agarose Gel

–

Agarose: Ultra-pure agarose powder (Qbiogene).

–

1X TBE buffer: 89-mM Tris–borate pH 8.3, 1 mM EDTA.

–

Electrophoresis apparatus with small (11 × 14 cm) or large (20 × 25 cm) electrophoresis sets.

–

Microwave.

–

Heat-resistant adhesive tape.

2.3.1. Drug/DNA Interaction

–

Topoisomerase I reaction buffer: 10 mM Tris–HCl, pH 7.9, 150 mM NaCl, 0.1% BSA, 0.1 mM spermidine.

2.3.2. Topoisomerase I-Induced Relaxation

–

Commercially available Topoisomerase I enzyme (for example from Topogen, Colombus, OH).

2.3.3. Degradation of the Protein

–

SDS stock solution: SDS powder (Sigma) 10% in water.

–

Proteinase K stock solution: 5 mg/mL of proteinase K powder (from Sigma).

2.3.4. Separation of the Forms of DNA on Agarose Gel

–

Electrophoresis dye mixture: saccharose 40%, bromophenol blue 0.25%, EDTA 1 mM ; pH 8.0.

–

1 Kb molecular weight DNA ladder.

2.3.5. Staining of the Gel Using Ethidium Bromide

–

Ethidium bromide (Sigma): 10 mg/mL.

–

A bath tray reserved for ethidium bromide staining.

2.3.6. Visualisation of the DNA Forms

–

UV transilluminator coupled with a camera.

2.3. Topoisomerase I-Induced Relaxation of Supercoiled Plasmid in the Presence of Increasing Concentrations of the Test Compound

3. Methods The following part describes the different steps of a so-called “DNA relaxation assay” aimed at characterising the effect of a small molecule on DNA structure, using topoisomerase I as a conformation-

Topoisomerase I-Mediated DNA Relaxation as a Tool to Study Intercalation

245

sensitive sensor. Typically, supercoiled plasmid DNA at a fixed concentration is incubated with graded concentrations of a test compound prior to being relaxed using a fixed amount of topoisomerase I. The various forms of DNA resulting from the relaxation reaction are then resolved on a native agarose gel (without ethidium bromide) and the DNA bands are visualised after electrophoresis by staining the gel in a solution of ethidium bromide. An illustration of the expected forms (and bands) of the plasmid DNA after gel electrophoresis is presented in Fig. 5. The different parts of the protocol are exemplified below. 3.1. Plasmid Purification on CsCl Gradients

The aim of this method is to purify a high quantity with the highest quality of supercoiled plasmid DNA from transformed bacterial cultures, mainly Escherichia coli. Usually, this method gives 90–98% of supercoiled DNA (usually referred as form I), the remaining 2–10% correspond to the plasmid nicked on one of the two strands of the DNA helix (open circular DNA, usually referred as form II) or on both two strands (linear DNA, also referred as form III).

3.1.1. Amplification of the Plasmid in Bacteria

One transformed bacterial clone is cultured at 37°C under agitation in 10 mL of LB medium (supplemented with appropriate antibiotic for 8 h); this pre-culture is then added to a larger flask containing 200 mL of LB medium plus antibiotic for selection (specific to the plasmid to be amplified). The bacteria are grown at 37°C in the shaker for 18–24 h and then collected by centrifugation at 4,000 g for 15 min at 4°C.

3.1.2. Lysis of Bacteria

The pellet is then resuspended in 2.5 mL of buffer 1 and the bacterial membrane lysed by the addition of 1 mL of lysozyme stock solution. This is incubated for 10 min on ice until the suspension becomes slightly viscous, followed by the addition of 4.5 mL of buffer 2. The solution is mixed strongly to get a very viscous solution and incubated for a further 20 min.

3.1.3. Elimination of Bacterial Remnants from Lysis

A centrifugation at 10,000 g for 30 min at 4°C in a swinging rotor (such as the SW-41 Ti rotor from Beckman Coulter) is performed to remove the lysed bacterial walls.

3.1.4. Separation of Plasmid DNA from Bacterial Genomic DNA

The cleared supernatant (9 mL) is transferred to a fresh tube containing 9 g of CsCl (precisely weighted). After dissolution, 45 µl of ethidium bromide (10 mg/mL) are added. Ethidium bromide has long been used as a potent DNA binder (59) and its intrinsic fluorescence is strongly enhanced when bound to DNA (60). This is a cheap and routinely used laboratory drug, but nevertheless, it is important to remember that this carcinogenic compound must be handled with a great care (and gloves). The tubes are filled with buffer 2 and sealed with a specific pair of pliers.

246

Peixoto, Bailly, and David-Cordonnier

An isopycnic CsCl gradient is then obtained by centrifugation at 300,000 g for 20 h at 16°C in a fixed angle rotor. The deceleration rate should be very slow (usually no brake at all) to avoid perturbation of the CsCl gradient. From this isopycnic centrifugation, the denatured proteins stay at the top of the tube and two bands of DNA are separated in the middle of the tube: the plasmid DNA and the genomic DNA. The circular genomic DNA varies in size from 160 Kb for Carsonella ruddii (61) to more than 12 Mb for the myxobacterium Sorangium cellulosum (62) and is around 4.6 Mb for the Escherichia coli strain typically used to amplify plasmid DNA. This genomic DNA, therefore, binds a larger amount of ethidium bromide than the short plasmid DNA, which appears denser. In a similar manner, the supercoiled DNA incorporates less ethidium bromide than the linearised plasmid DNA and migrates in a denser (lower) portion of the tube and will be separated from the linear DNA (broken plasmid) and open circular DNA which generally migrates between the supercoiled plasmid band and the genomic DNA band or could rather co-migrates with the genomic DNA band. The RNA fraction, which is highly dense due to important folding of the molecules, migrates towards the bottom of the tube (Fig. 6). In order to isolate the supercoiled DNA, a needle is inserted at the top of the tub (to allow the outflow of the DNA without internal pressure disturbance during the sucking up) prior to the insertion of the collecting syringe equipped with a needle that is picked just under the supercoiled DNA band. The syringe is filled slowly with the supercoiled plasmid DNA fraction, avoiding mixing and recovery of the bacterial DNA just above (Fig. 6). Usually, the quantity of DNA is enough to see DNA bands under visible light as a pink band in the tube, but in cases of low levels of DNA production, the DNA sample can be observed and recovered proteins linear + open circular plasmid DNA CsCl density

3.1.5. Recovery of the Plasmid

1.60

supercoiled plasmid DNA

1.65 1.70 1.75 1.80

RNA

Fig. 6. Schematic representation of the supercoiled plasmid DNA purification on isopycnic CsCl gradients. The centrifuged tube was firstly pierced on the top to avoid pressure variations during the recovery of the DNA. A syringe was then used to collect the plasmid DNA fraction. The internal density obtained from isopycnic CsCl gradient is indicated on the left of the tube.

Topoisomerase I-Mediated DNA Relaxation as a Tool to Study Intercalation

247

under UV light (366 nm). In this latter case, the UV illumination needs to be as short as possible and DNA collection should be done rapidly to avoid UV-induced DNA damage. In general, less than 1 mL of concentrated DNA sample is collected and it is better to keep this precious concentrated DNA solution out of the day light. 3.1.6. Removal of Ethidium Bromide

Ethidium bromide is removed from the DNA sample by three washings with three volumes of isobutanol. The extracted DNA is dialysed twice against 1 L of Tris/EDTA buffer. The DNA concentration is quantified in a quartz cuvette by determining the absorbance at 260 nm (typically, 10 µl of stock solution in 1-mL BPE buffer). An extinction coefficient of 6,600 M−1 cm−1 is typically used to estimate the DNA concentration (in bases), with naturally occurring DNA with a balanced AT/GC content. If it is too dilute, the DNA sample precipitated with ethanol and redissolved in an appropriate amount of TE buffer. The supercoiled DNA is stored frozen in small aliquot at −20°C.

3.1.7. Alternative Plasmid Purification System

An alternative procedure, more flexible but generally less efficient, employs purification columns, such as NucleoBond PC (MacheryNagel Gmbh, Germany) or HiSpeed Plasmid Kits (Qiagen SA, France), used according to the manufacturer protocols. However, these approaches generally lead to a higher amount of open circular DNA compared to our favoured (but manual) CsCl procedure.

3.2. Agarose Gel

Gels are prepared by dissolving 1% of agarose powder in 1X TBE buffer (see Note 1). Depending on the number of wells needed for the experiment, small or large electrophoresis sets are used. These should be filled with an appropriate volume of agarose mixture, usually 120 mL or 400 mL for the small and large gels, respectively. The agarose is melted for approximately 3 min at 700 W in a microwave (see Note 2). The electrophoresis gel is then poured on the base set, previously sealed at each end using adhesive tape and equipped with a comb of 5 mm length and 1 mm thick (depending on the volume of the samples to be loaded) to generate appropriates wells (see Note 3). After total stiffening of the gel at room temperature (see Note 4), removing of the comb and adhesive tape, the agarose gel is maintained wet by dipping it in the electrophoresis apparatus filled with 1X TBE buffer. Since drying of the wells will interfere with proper migration of the DNA samples, the gels should be completely covered with the 1X TBE buffer.

248

Peixoto, Bailly, and David-Cordonnier

3.3. Topoisomerase I-Induced Relaxation of Supercoiled Plasmid in the Presence of Increasing Concentrations of the Test Compound 3.3.1. Drug/DNA Interaction

Graded concentrations (usually up to 50 µM) of the compounds to be evaluated are incubated with supercoiled plasmid DNA (130 ng) in 20 µl of Topo I reaction buffer for 15 min at room temperature to ensure binding equilibrium.

3.3.2. Topoisomerase I-Induced Relaxation

Human recombinant topoisomerase I (5U) is added to the mixture and incubated at 37°C for 45 min to ensure relaxation of the DNA (see Note 5).

3.3.3. Degradation of the Protein

The reactions are then stopped by adding SDS and proteinase K to a final concentration of 0.25% and 250 µg/mL, respectively. The samples are incubated at 50°C for 30 min to totally remove the protein from DNA. At this stage, there is no need to extract DNA with solvents; the degraded protein fragments will not hinder DNA migration during the electrophoresis.

3.3.4. Separation of the Forms of DNA on Agarose Gel

DNA samples are completed by adding 3 µl of the electrophoresis dye mixture and loaded on to the 1% agarose gel, which is covered with 1X TBE buffer. The different forms of DNA are then separated by electrophoresis at room temperature for 2 h and 45 min at 120 V for small gels or 150 V for large ones. Various controls need to be loaded at the same time: supercoiled and linearised DNA plasmids (both of them in the same amount and in the same buffer as the samples of interest) and, if possible, a sample of molecular weight ladders (usually a commercially available 1-kb ladder).

3.3.5. Staining of the Gel Using Ethidium Bromide

Gels are run without ethidium bromide in order to obtain the various separated topoisomers. To visualise the DNA forms, the gel is stained post-electrophoresis by soaking in a bath containing 25-µM ethidium bromide for 30 min at room temperature. By contrast, gels used for DNA cleavage assays usually contain ethidium bromide, which is added when preparing the agarose gel prior and so do not need to be stained post-migration. The gels are finally washed for at least 4 h to overnight in 300 mL of purified water (see Note 6).

3.3.6. Visualisation of the DNA Forms

The gels are photographed under UV light (366 nm) using a UV transilluminator coupled with a camera and the data stored for further analysis (see Note 7). It should be remembered that the greater the number of supercoils, the faster the migration on agarose gel. Visualisation of DNA in agarose gels is based on the increase of

Topoisomerase I-Mediated DNA Relaxation as a Tool to Study Intercalation

249

fluorescence emitted by DNA-bound ethidium bromide molecules. This was initially demonstrated by LePecq and Paoletti (60) who evidenced a 21-fold activation of the fluorescence of ethidium bromide when bound to DNA. It is important to notice that ethidium bromide does not stain the different forms of plasmid DNA to the same extent. Indeed, the open circular plasmid can incorporate more ethidium bromide molecules than closed circular DNA. This characteristic is used to separate the supercoiled plasmid DNA from linear DNA by isopycnic centrifugation, as described in Subheading 1.1. This difference was quantified as a 1.8 ratio for the pBR322 vector (63, 64) and explains why the level of fluorescence in total DNA from each particular lane changes during the topoisomerase I-induced DNA relaxation process, evidenced by agarose gel migration and ethidium bromide staining. The different staining capacity of linear vs. supercoiled DNA should also be considered if the proportions of each DNA band need to be quantified. 3.4. An Example of DNA Relaxation Induced by Intercalating Agents

In the present example, ethidium bromide is used as a reference compound to evidence the topoisomerase I-induced DNA relaxation (Fig. 7a). Compounds 1, 2 and 3 are used as test compounds (Fig. 7b). The pUC19 plasmid (2,686 bp) was used and gave seven clearly identified topoisomers (marked by arrow heads in Fig. 7). In this case, as mentioned above, the gels were stained with ethidium bromide after electrophoresis and were washed extensively to give uniform staining, independent of the initial concentration of ethidium bromide used in the staining solution. The drug-free DNA sample is negatively supercoiled and migrates through the gel as a single band. A tiny proportion of nicked “open circular” DNA can be detected (lane “DNA”). Its profile changes markedly in the presence of increasing concentrations of ethidium bromide. Two phases can be distinguished. First at low concentrations, the intercalation of ethidium bromide between DNA base pairs induces a relaxation of DNA and the bulky, fully relaxed form migrates slowly through the gel. The top band in lane, containing 0.25-mM ethidium bromide corresponds to the formation of fully relaxed DNA molecules (which co-migrate with open circular DNA molecules). As the ethidium bromide concentration is further increased, the DNA molecules wind in the opposite way so as to produce more compact, positive supercoils (e.g. in lane corresponding to 0.75 mM ethidium bromide), which then migrate faster than the negatively supercoiled DNA topoisomers. When the DNA is fully positively supercoiled (e.g. in the lane corresponding to 2.5 mM ethidium bromide), it migrates as a single band with an electrophoretic mobility close (but nevertheless slightly reduced compared) to that of the native negatively supercoiled plasmid (lane “DNA”). At high ethidium bromide concentrations (>2.5 mM), a gel-shift is observed; the

250

Peixoto, Bailly, and David-Cordonnier

Topoisomerase I

a

0.01 0.025 0.05 0.1 0.25 0.5 0.75 1 2.5 5 7.5 10 0 DNA

Ethidium bromide (µM)

relaxed topoisomers

bound

supercoiled helical฀superturns

– – – –

0

+ + + + + + +

–+

Topoisomerase I

b

Cpd-2

Cpd-3 (µM)

DNA 0 5 10 20 30 40 50 5 10 20 30 40 50 1 2 5 10 20 50 DNA Topo I

Cpd-1

relaxed฀ ฀ topoisomers฀ bound฀

supercoiled฀฀ helical฀superturns฀

–– – 0 + + + + –0 + + + + – –0 + + + – –

Fig. 7. Topoisomerase I-induced DNA relaxation in the presence of ethidium bromide. Negative supercoiled pUC19 vector was incubated with ethidium bromide at the concentrations indicated on the top of the lanes prior to be treated with topoisomerase I. Control DNA (lane “DNA”) was treated in the same manner but in the absence of topoisomerase I and ethidium bromide. The supercoiled (full arrow), relaxed (open arrow) and various topoisomers forms (spears of arrow) of DNA are localised on the left. Supercoiled DNA with bound ethidium bromide inducing a gel shift is localised using a bracket on the right of the panel. The positive or negative helical super-turns are represented as plus or minus symbols.

DNA is saturated and non-specific DNA binding occurs. The upand-down profile seen here with ethidium bromide (negative supercoiled → relaxed → positive supercoils) is typical of an intercalating agent. It is certainly one of the most robust approaches (together with viscometry) to characterise a DNA intercalating agent. Similar profiles can be seen with the test compounds 1–3 in Fig. 7. In all three cases, the negatively supercoiled plasmid substrate is first relaxed and then intercalation leads to the formation of positively supercoiled DNA. The concentration of the compound required to produce the fully relaxed DNA species

Topoisomerase I-Mediated DNA Relaxation as a Tool to Study Intercalation

251

varies from one compound to the other, with the following ranking: cpd-3 > cpd-1 > cpd-2 and this reflects their respective binding affinities. The three molecules are less potent DNA intercalators than ethidium bromide, but there is no doubt that they are typical intercalators, producing the characteristic up-and-down profile. With cpd-3 at high concentrations (20–50 mM), the positively supercoiled DNA is saturated and a gel-shift is observed. This type of behaviour is frequently seen with non-specific “sticky” DNA-binding drugs. Non-specific binding can be prevented, or at least reduced, using one of the two following procedures. First, by adding SDS (1%) in the samples as well as in the gel at the preparation stage. However, this method is not recommended, because it requires extensive washings of the gel after electrophoresis to be able to stain it properly with ethidium bromide. Since SDS is difficult to totally eliminate, some traces remain and limit the post-electrophoresis staining. Second, by extracting DNA prior to electrophoresis. The elimination of ethidium bromide in the samples of DNA is in this latter case performed before loading on the gel. For this purpose, a phenol/chloroform extraction is performed (vol./vol.), the samples are centrifuged 5 min at 13,000 g. The aqueous phase is recovered, transferred to a fresh tube and subjected to a chloroform extraction (vol./vol.). After similar centrifugation, the DNA fraction is precipitated with 2.5 vol. of cold pure ethanol followed by a last centrifugation 20 min at 13,000 g. The DNA pellet is dried and subsequently dissolved in an appropriate amount of 1X TBE buffer prior to the addition of the loading buffer and migration on the agarose gel, as usual. Because of the multi-step process, much attention needs to be given at each step to ensure the homogeneity in the quantity of recovered DNA in each point of the experiment. This second method works well, but it is time-consuming and requires practise. In most cases, the standard procedure, without extraction, can be recommended. 3.5. Conclusions

The DNA relaxation assay is a robust method to characterise the intercalation of small molecules into DNA and more generally to investigate drug–DNA interactions. It demands a good knowledge of the principle, based on the topoisomerase I-guided manipulation of DNA conformation. It also requires technical skills and proficiency, but overall, the assay is relatively simple to execute. In our highly complex, technology and machine-driven scientific society, this gel-based assay is a successful old-fashioned manual tool. It is a robust and highly reproducible method, which has been routinely used in our laboratories, by many people including many students.

252

Peixoto, Bailly, and David-Cordonnier

4. Notes 1. Ready-to-use solutions of 0.5–2% agarose in 1× TBE buffer can be purchased. 2. The mixture must be allowed to boil, but the heating must be stopped in time to avoid overflowing of a foaming hot gel. Complete dissolution of the agarose powder needs to be checked carefully to ensure a good quality gel (free of bubbles or “fishes”), essential to obtain good migration profiles of DNAs. The dissolved agarose mixture is very hot, and should be allowed to cool for 3–5 min (to ~50°C) prior to pouring the gel. 3. Bubble formation needs to be avoided at this step or removed prior to further cooling and stiffening of the agarose gel. 4. The gel should be prepared at least 1 h before use. 5. Commercially available topoisomerase I enzymes are usually satisfactory (which is not the case for topoisomerase II). Alternatively, topoisomerase I can be extracted and purified from eukaryotic cells or bacteria, according to published procedures (65–73). 6. However, due to the mutagenic effect of ethidium bromide, all liquid and solid wastes have to be eliminated using specific elimination procedures. Alternatively, gels can be stained using other dyes, such as chloroquine (Sigma), SYBR Gold (Invitrogen), SYBR Green (Molecular Probes), GoldView (SBS Genetech), GeneFinder (Bio-v Company) or GelRed (FluoProbes) (74– 80). However, these chemicals are more expensive than ethidium bromide, certainly very efficient as DNA stains, but would also be considered as potential mutagenic agents. That is why ethidium bromide is our method of choice. 7. Under UV light, the gel needs to be photographed rapidly to avoid fluorescence fading of the ethidium bromide/DNA complex (81). The variation of fluorescence during irradiation of ethidium bromide-stained DNA depends on the emission/ excitation wavelength and time of exposition to the light. The photodestruction of the ethidium fluorophore is sufficiently slow to allow a proper analysis.

Acknowledgements M.-H.D.-C. thanks the Institut pour la Recherche sur le Cancer (IRCL), Association pour la Recherche contre le Cancer (ARC) and the Ligue Nationale contre le Cancer (Comité du Nord) for grants. P.P. thanks the Institut pour la Recherche sur le Cancer

Topoisomerase I-Mediated DNA Relaxation as a Tool to Study Intercalation

253

sur le Cancer de Lille (IRCL), the Conseil Régional Nord-Pasde-Calais and the ARC for a PhD fellowship. The authors are grateful to Sabine Depauw for her technical expertise. References 1. Wang JC (1996) DNA topoisomerase. Annu Rev Biochem 65:635–692 2. Wang JC (2002) Cellular roles of DNA topoisomerases: a molecular perspective. Nat Rev Mol Cell Biol 3:430–440 3. Champoux JJ (2001) DNA topoisomerases: structure, function, and mechanism. Annu Rev Biochem 70:369–413 4. Corbett KD, Berger JM (2004) Structure, molecular mechanisms, and evolutionary relationships in DNA topoisomerases. Annu Rev Biophys Biomol Struct 33:95–118 5. Leppard JB, Champoux JJ (2005) Human DNA topoisomerase I: relaxation, roles, and damage control. Chromosoma 114:75–85 6. Giles GI, Sharma RP (2005) Topoisomerase enzymes as therapeutic targets for cancer chemotherapy. Med Chem 1:383–394 7. Forterre P, Gribaldo S, Gadelle D, Serre MC (2007) Origin and evolution of DNA topoisomerases. Biochimie 89:427–446 8. McClendon AK, Osheroff N (2007) DNA topoisomerase II, genotoxicity, and cancer. Mutat Res 623:83–97 9. Champoux JJ (2002) A first view of the structure of a type IA topoisomerase with bound DNA. Trends Pharmacol Sci 23: 199–201 10. Staker BL, Hjerrild K, Feese MD, Behnke CA, Burgin AB Jr, Stewart L (2002) The mechanism of topoisomerase I poisoning by a camptothecin analog. Proc Natl Acad Sci U S A 99:15387–15392 11. Staker BL, Feese MD, Cushman M, Pommier Y, Zembower D, Stewart L, Burgin AB (2005) Structures of three classes of anticancer agents bound to the human topoisomerase I-DNA covalent complex. J Med Chem 48: 2336–2345 12. Xiong B, Burk DL, Shen J, Luo X, Liu H, Shen J, Berghuis AM (2008) The type IA topoisomerase catalytic cycle: A normal mode analysis and molecular dynamics simulation. Proteins 71:1984–1994 13. Carey JF, Schultz SJ, Sisson L, Fazzio TG, Champoux JJ (2003) DNA relaxation by human topoisomerase I occurs in the closed clamp conformation of the protein. Proc Natl Acad Sci U S A 100:5640–5645

14. Koster DA, Croquette V, Dekker C, Shuman S, Dekker NH (2005) Friction and torque govern the relaxation of DNA supercoils by eukaryotic topoisomerase IB. Nature 434: 671–674 15. Calladine CR, Drew HR (1997) The molecule and how it works. In: Understanding DNA, 2nd edn, p 56 16. Calladine CR, Drew HR, Luisi BF, Travers AA (2004) Different kinds of Double Helix. In: Understanding DNA, 3rd edn, pp 39–63 17. Olson WK, Babcock MS, Gorin A, Liu G, Marky NL, Martino JA, Pedersen SC, Srinivasan AR, Tobias I, Westcott TP, Zhang P (1995) Flexing and folding double helical DNA. Biophys Chem 55:7–29 18. Olson WK, Marky NL, Jernigan RL, Zhurkin VB (1993) Influence of fluctuations on DNA curvature. A comparison of flexible and static wedge models of intrinsically bent DNA. J Mol Biol 232:530–554 19. Dickerson RE, Drew HR (1981) Structure of a B-DNA dodecamer: II. Influence of base sequence on helix structure. J Mol Biol 149:761–786 20. Dickerson RE, Klug A (1983) Base sequence and helix structure variation in B and A DNA. J Mol Biol 166:419–441 21. Calladine CR, Drew HR, McCall MJ (1988) The intrinsic curvature of DNA in solution. J Mol Biol 201:127–137 22. Hunter CA, Lu X-J (1997) DNA base-stacking interactions: a comparison of theoretical calculations with oligonucleotide X-ray crystal structures. J Mol Biol 265:603–619 23. Pedone F, Mazzei F, Matzeu M, Barone F (2001) Torsional constant of 27-mer DNA oligomers of different sequences. Biophys Chem 94:175–184 24. Anselmi C, De Santis P, Paparcone R, Savino M, Scipioni A (2002) From the sequence to the superstructural properties of DNAs. Biophys Chem 95:23–47 25. Klug A, Jack A, Viswamitra MA, Kennard O, Shakked Z, Steitz TA (1979) A hypothesis on a specific sequence-dependent conformation of DNA and its relation to the binding of the lac repressor protein. J Mol Biol 131: 669–680

254

Peixoto, Bailly, and David-Cordonnier

26. Drew HR, Dickerson RE (1981) Structure of a B-DNA dodecamer. III. Geometry of hydration. J Mol Biol 151:535–556 27. Nelson HC, Finch JT, Luisi BF, Klug A (1978) The structure of an oligo(dA). oligo(dT) tract and its biological implications. Nature 330:221–226 28. El Hassan MA, Calladine CR (1996) PropellerTwisting of Base-pairs and the Conformational Mobility of Dinucleotide Steps in DNA. J Mol Biol 259:95–103 29. El Hassan MA, Calladine CR (1996) Structural mechanics of bent DNA. Endeavour 20:61–67 30. Suzuki M, Amano N, Kakinuma J, Tateno M (1997) Use of a 3D structure data base for understanding sequence-dependent conformational aspects of DNA. J Mol Biol 274:421–435 31. Zuccheri G, Scipioni A, Cavaliere V, Gargiulo G, De Santis P, Samori B (2001) Mapping the intrinsic curvature and the flexibility along the DNA chain. Proc Natl Acad Sci U S A 98:3074–3079 32. Bharanidharan D, Gautham N (2006) Principal component analysis of DNA oligonucleotide structural data. Biochem Biophys Res Commun 340:1229–1237 33. Frederick CA, Williams LD, Ughetto G, Van der Marel GA, Van Boom JH, Rich A, Wang AHJ (1990) Structural comparison of anticancer drug-DNA complexes: adriamycin and daunomycin. Biochemistry 29: 2538–2549 34. Liao LB, Zhou HY, Xiao XM (2005) Spectroscopic and viscosity study of doxorubicin interaction with DNA. J Mol Struct 749:108–113 35. Lerman LS (1961) Structural considerations in the interaction of DNA and acridines. J Mol Biol 3:18–30 36. Adams A (2002) Crystal structures of acridines complexed with nucleic acids. Curr Med Chem 18:1667–1675 37. Monnot M, Mauffret O, Lescot E, Fermandjian S (1992) Probing intercalation and conformational effects of the anticancer drug 2-methyl-9-hydroxyellipticinium acetate in DNA fragments with circular dichroism. Eur J Biochem 204:1035–1039 38. Neidle S, Thurston DE (1994) New targets for cancer chemotherapy. In: Kerr DJ, Workman P (eds) CRC Press, Boca Raton, FL, pp 159–75 39. Lerman LS (1963) The structure of the DNAacridine complex. Proc Natl Acad Sci U S A 49:94–104

40. Adams A, Guss JM, Collyer CA, Denny WA, Wakelin LPG (1999) Crystal structure of the topoisomerase II poison 9-amino-[N-(2dimethylamino)ethyl]acridine-4-carboxamide bound to the DNA hexanucleotide d(CGTACG)2. Biochemistry 38:9221–9233 41. Rohs R, Sklenar H, Lavery R, Roder B (2000) Methylene blue binding to DNA with alternating GC base sequence: a modeling study. J Am Chem Soc 122:2860–2866 42. Lisgarten JN, Coll M, Portugal J, Wright CW, Aymami J (2002) The antimalarial and cytotoxic drug cryptolepine intercalates into DNA at cytosine-cytosine sites. Nat Struct Biol 9:57–60 43. OhUigin C, McConnell DJ, Kelly JM, van der Putten WJM (1987) Methylene blue photosensitised strand cleavage of DNA: effects of dye binding and oxygen. Nucleic Acids Res 15:7411–7427 44. Waring MJ, González A, Jiménez A, Vázquez D (1979) Intercalative binding to DNA of antitumour drugs derived from 3-nitro-1, 8-naphthalic acid. Nucleic Acids Res 7:217–230 45. Waring MJ, Wakelin LP (1974) Echinomycin: a bifunctional intercalating antibiotic. Nature 252:653–657 46. Wakelin SP, Waring MJ (1976) The binding of echinomycin to deoxyribonucleic acid. Biochem J 157:721–740 47. Lee JS, Waring MJ (1978) Interaction between synthetic analogues of quinoxaline antibiotics and nucleic acids. Changes in mechanism and specificity related to structural alterations. Biochem J 173:129–144 48. Viswamitra MA, Kennard O, Cruse WB, Egert E, Sheldrick GM, Jones PG, Waring MJ, Wakelin LP, Olsen RK (1981) Structure of TANDEM and its implication for bifunctional intercalation into DNA. Nature 289:817–819 49. Bailly C, Braña M, Waring MJ (1996) Sequence-selective intercalation of antitumour bis-naphthalimides into DNA. Evidence for an approach via the major groove. Eur J Biochem 240:195–208 50. Gallego J, Reid BR (1999) Solution structure and dynamics of a complex between DNA and the antitumor bisnaphthalimide LU-79553: intercalated ring flipping on the millisecond time scale. Biochemistry 38:15104–15115 51. Armitage BA, Yu C, Devadoss C, Schuster GB (1994) Cationic anthraquinone derivatives as catalytic DNA photonucleases: mechanisms for DNA damage and quinone recycling. J Am Chem Soc 116:9847–9859

Topoisomerase I-Mediated DNA Relaxation as a Tool to Study Intercalation 52. Rybenkov VV, Cozzarelli NR, Vologodskii AV (1993) Probability of DNA knotting and the effective diameter of the DNA double helix. Proc Natl Acad Sci U S A 90: 5307–5311 53. Katritch V, Bednar J, Michoud D, Scharein RG, Dubochet J, Stasiak A (1996) Geometry and physics of knots. Nature 384:142–145 54. Podtelezhnikov AA, Cozzarelli NR, Vologodskii AV (1999) Equilibrium distributions of topological states in circular DNA: interplay of supercoiling and knotting. Proc Natl Acad Sci U S A 96:12974–12979 55. Metzler R, Hanke A (2006) Knots, bubbles, untying, and breathing: probing the topology of DNA and other biomolecules, handbook of theoretical and computational nanotechnology. American Scientific Publishers, Stevenson Ranch, CA 56. Burnier Y, Dorier J, Stasiak A (2008) DNA supercoiling inhibits DNA knotting. Nucleic Acids Res 36:4956–4963 57. Drlica K (1992) Control of bacterial DNA supercoiling. Mol Microbiol 6:425–433 58. Shishido K, Komiyama N, Ikawa S (1987) Increased production of a knotted form of plasmid pBR322 DNA in Escherichia coli DNA topoisomerase mutants. J Mol Biol 195:215–218 59. Waring MJ (1964) Complex formation with DNA and inhibition of Escherichia coli RNA polymerase by ethidium bromide. Biochim Biophys Acta 87:358–361 60. LePecq JB, Paoletti C (1967) A fluorescent complex between ethidium bromide and nucleic acids. Physical–chemical characterization. J Mol Biol 27:87–106 61. Nakabachi A, Yamashita A, Toh H, Ishikawa H, Dunbar H, Moran N, Hattori M (2006) The 160-kilobase genome of the bacterial endosymbiont Carsonella. Science 314:267 62. Pradella S, Hans A, Spröer C, Reichenbach H, Gerth K, Beyer S (2002) Characterisation, genome size and genetic manipulation of the myxobacterium Sorangium cellulosum So ce56. Arch Microbiol 178:484–492 63. Hertzberg RP, Caranfa MJ, Hecht SM (1989) On the mechanism of topoisomerase I inhibition by camptothecin: evidence for binding to an enzyme-DNA complex. Biochemistry 28:4629–4638 64. Boege F, Straub T, Kehr A, Boesenberg C, Christiansen K, Andersen A, Jakob F, Köhrler J (1996) Selected novel flavones inhibit the DNA binding or the DNA religation step of eukaryotic topoisomerase I. J Biol Chem 271:2262–2270

255

65. Attardi DG, De Paolis A, Tocchini-Valentini GP (1981) Purification and characterization of Xenopus laevis type I topoisomerase. J Biol Chem 256:3654–3661 66. Ishii K, Hasegawa T, Fujisawa K, Andoh T (1983) Rapid purification and characterization of DNA topoisomerase I from cultured mouse mammary carcinoma FM3A cells. J Biol Chem 258:12728–12732 67. Tanizawa A, Pommier Y (1992) Topoisomerase I alteration in a camptothecin-resistant cell line derived from Chinese hamster DC3F cells in culture. Cancer Res 52:1848–1854 68. Jensen AD, Svejstrup JQ (1996) Purification and characterization of human topoisomerase I mutants. Eur J Biochem 236:389–394 69. Rossi F, Labourier E, Forné T, Divita G, Derancourt J, Riou JF, Antoine E, Cathala G, Brunel C, Tazi J (1996) Specific phosphorylation of SR proteins by mammalian DNA topoisomerase I. Nature 381:80–82 70. Zhu CX, Tse-Dinh YC (1999) Overexpression and purification of bacterial DNA topoisomerase I. Methods Mol Biol 94:145–151 71. Stewart L, Champoux JJ (1999) Purification of baculovirus-expressed human DNA topoisomerase I. Methods Mol Biol 94:223–234 72. Bronstein IB, Wynne-Jones A, Sukhanova A, Fleury F, Ianoul A, Holden JA, Alix AJ, Dodson GG, Jardillier JC, Nabiev I, Wilkinson AJ (1999) Expression, purification and DNAcleavage activity of recombinant 68-kDa human topoisomerase I-target for antitumor drugs. Anticancer Res 19:317–327 73. Takahashi T, Matsuhara S, Abe M, Komeda Y (2002) Disruption of a DNA topoisomerase I gene affects morphogenesis in Arabidopsis. Plant Cell 14:2085–2093 74. Jaxel C, Kohn KW, Wani MC, Wall ME, Pommier Y (1989) Structure-activity study of the actions of camptothecin derivatives on mammalian topoisomerase I: evidence for a specific receptor site and a relation to antitumor activity. Cancer Res 49:1465–1469 75. Kiltie AE, Ryan AJ (1997) SYBR Green I staining of pulsed field agarose gels is a sensitive and inexpensive way of quantitating DNA double-strand breaks in mammalian cells. Nucleic Acids Res 25:2945–2946 76. Miller SE, Taillon-Miller P, Kwok PY (1999) Cost-effective staining of DNA with SYBR green in preparative agarose gel electrophoresis. Biotechniques 27:34–36 77. Huang Q, Fu WL (2005) Comparative analysis of the DNA staining efficiencies of different fluorescent dyes in preparative agarose gel electrophoresis. Clin Chem Lab Med 43:841–842

256

Peixoto, Bailly, and David-Cordonnier

78. Maxwell A, Burton NP, O’Hagan N (2006) High-throughput assays for DNA gyrase and other topoisomerases. Nucleic Acids Res 34:e104 79. Li D, Li G, Guo W, Li P, Wang E, Wang J (2008) Glutathione-mediated release of functional plasmid DNA from positively charged quantum dots. Biomaterials 29:2776–2782 80. Sun YX, Zeng X, Meng QF, Zhang XZ, Cheng SX, Zhuo RX (2008) The influence

of RGD addition on the gene transfer characteristics of disulfide-containing polyethyleneimine, DNA complexes. Biomaterials 29:4356–4365 81. Wahl P, Paoletti J, Le Pecq JB (1970) Decay of fluorescence emission anisotropy of the ethidium bromide-DNA complex. Evidence for an internal motion in DNA. Proc Natl Acad Sci U S A 65:417–421

Chapter 16 A High-Throughput Assay for DNA Topoisomerases and Other Enzymes, Based on DNA Triplex Formation Matthew R. Burrell, Nicolas P. Burton, and Anthony Maxwell Abstract We have developed a rapid, high-throughput assay for measuring the catalytic activity (DNA supercoiling or relaxation) of topoisomerase enzymes that is also capable of monitoring the activity of other enzymes that alter the topology of DNA. The assay utilises intermolecular triplex formation to resolve supercoiled and relaxed forms of DNA, the principle being the greater efficiency of a negatively supercoiled plasmid to form an intermolecular triplex with an immobilised oligonucleotide than the relaxed form. The assay provides a number of advantages over the standard gel-based methods, including greater speed of analysis, reduced sample handling, better quantitation and improved reliability and accuracy of output data. The assay is performed in microtitre plates and can be adapted to high-throughput screening of libraries of potential inhibitors of topoisomerases including bacterial DNA gyrase. Key words: Topoisomerase, DNA gyrase, Triplex formation, Supercoiling, Relaxation, High-throughput screening

1. Introduction DNA topoisomerases are essential, ubiquitous enzymes that control the topological state of DNA in cells (1). As such, the enzymes are important, established targets of anti-bacterial and anti-tumour drugs and are potential herbicide and anti-viral targets. All topoisomerases can relax supercoiled DNA, and DNA gyrase, essential in bacteria, can also introduce negative supercoils into DNA. Topoisomerases are also capable of catenation and decatenation, and knotting and unknotting. The basic reaction catalysed by topoisomerases, the interconversion of relaxed and supercoiled DNA, is not readily monitored. The standard assay resolves the reaction products on the basis of their different mobilities on an agarose gel, and while it is K.R. Fox (ed.), Drug-DNA Interaction Protocols, Methods in Molecular Biology, vol. 613, DOI 10.1007/978-1-60327-418-0_16, © Humana Press, a part of Springer Science + Business Media, LLC 1998, 2010

257

258

Burrell, Burton, and Maxwell

information-rich, it suffers from the drawbacks of being slow and, due to the electrophoresis step, requires a lot of sample handling. Therefore, the screening of combinatorial chemical libraries for novel topoisomerase inhibitors is greatly hindered by the lack of a rapid high-throughput assay. To address this issue, we have developed a rapid microtitre plate assay, based on DNA triplex formation, that is capable of monitoring topoisomerase activity with large number of samples (2). The underlying principle of the assay is the greater efficiency of triplex formation in negatively supercoiled DNA compared with the relaxed form (3, 4). Previously, immobilised biotinylated triplex-forming oligonucleotides have been shown to be able to capture supercoiled plasmid DNA (5). Using this principle, supercoiling or relaxation of DNA is readily monitored through fluorescence staining of plasmid DNA trapped to a microtitre plate through an intermolecular triplex (2).

2. Materials Unless otherwise stated, all materials are purchased from Sigma and are of the highest grade available (see Note 1). Ultrapure water with a resistivity of ~18 MW cm should be used throughout. 2.1. Buffers

1. Wash buffer: 20 mM Tris–HCl (pH 7.6), 137 mM NaCl, 0.01% (w/v) bovine serum albumin (acetylated), 0.05% (v/v) Tween-20. Stored at 4°C. 2. Triplex Formation (TF) buffer: 50 mM sodium acetate (pH 5.0), 50 mM NaCl, 50 mM MgCl2. Stored at room temperature. 3. T10 buffer: 10 mM Tris–HCl (pH 8.0), 1 mM EDTA. Stored at room temperature. 4. DNA Gyrase Supercoiling buffer: 35 mM Tris–HCl (pH 7.5), 24 mM KCl, 4 mM MgCl2, 2 mM DTT, 1.8 mM spermidine, 1 mM ATP, 6.5% (w/v) glycerol, 0.1 mg/mL bovine serum albumin. The buffer is stored as a 5× concentrate at −20°C. 5. DNA Gyrase Dilution buffer: 50 mM Tris–HCl (pH 7.5), 100 mM KCl, 2 mM DTT, 1 mM EDTA, 10% (w/v) glycerol. Stored at −20°C. 6. Topoisomerase I Relaxation buffer: 20 mM Tris–HCl (pH 7.5), 50 mM NaCl, 0.1 mM EDTA. The buffer is stored as a 10× concentrate at −20°C. 7. Topoisomerase I Dilution buffer: 10 mM Tris–HCl (pH 7.5), 1 mM DTT, 1 mM EDTA, 50% (v/v) glycerol, 100 µg/mL bovine serum albumin.

A High-Throughput Assay for DNA Topoisomerases and Other Enzymes

259

Table 1 Oligonucleotides used in the high-throughput assay

2.2. DNA

Name

Sequence (5¢–3¢)

5¢ Modification

TFO1

TCTCTCTCTCTCTCTC

Biotin

TFO1W

TCGGAG AGAGAGAGAGAGAG

TFO1C

CCGATCTCTCTCTCTCTCTC

1. Plasmid pNO1 is constructed from plasmid pBR322* (2) (a high-copy number version of pBR322, based on the work of Boros et al. (6)) by ligating the annealed oligos TFO1W and TFO1C (Table 1) into the AvaI site of the plasmid. Supercoiled pNO1 is prepared by transforming it into Escherichia coli competent cells (e.g. Top10, Invitrogen), growing the cells overnight in Luria–Bertani (LB) medium containing 100 µg/mL ampicillin and purifying the DNA using Qiagen mini- or midiprep kits according to the manufacturer’s instructions. To prepare DNA with a specific linking difference (superhelix density, s) of ~0.06, the plasmid can then be further treated with Topoisomerase I (200 µg plasmid with 200 units Topoisomerase I) in Topoisomerase I Relaxation buffer in the presence of ethidium bromide (30 µg/mL) for 90 min at 37°C. The DNA is extracted with butan-1-ol to remove the ethidium bromide followed by phenol/chloroform extractions and ethanol precipitation. The plasmid is resuspended in T10 buffer to a concentration of 1 mg/mL. 2. Relaxed pNO1 is prepared by incubating the supercoiled form with topoisomerase I (~40–50 µg plasmid with 200 units topoisomerase I in Topoisomerase I Relaxation buffer) for 1 h at 37°C. The DNA is extracted with two phenol/chloroform extractions and purified by ethanol precipitation. 3. TFO1 oligo (Table 1) with a 5¢ biotin tag (e.g. Sigma-Genosys, Bioneer) is resuspended to 100 µM in T10 buffer and stored at −20°C.

2.3. Enzymes

1. E. coli DNA gyrase subunits GyrA and GyrB are expressed in E. coli and purified according to the literature methods (7). The subunits are stored separately in DNA Gyrase Dilution buffer at −80°C (see Note 2). The complete enzyme is reconstituted at 4°C by mixing equal concentrations of GyrA and GyrB prior to use. 2. Human topoisomerase I (see Note 1) may be prepared by overexpressing in baculovirus-infected insect cells (Spodoptera frugiperda) and purified as described by Stewart et al. (8). It is stored at −80°C in Topoisomerase I Dilution buffer.

260

Burrell, Burton, and Maxwell

3. All restriction enzymes are purchased from New England Biolabs and stored according to the manufacturer’s instructions. 2.4. Equipment and DNA Staining

1. Black streptavidin-coated ReactiBind 96-well plates (Greiner) are used for the assay. The wells are rehydrated with three 200 µL volumes of Wash buffer before use. Plates should be stored, covered, at 4°C. 2. DNA is stained with SYBR Gold (Invitrogen), which is stored as a 10,000× concentrate at −20°C before use. SYBR Gold is diluted 10,000-fold in T10 buffer. 3. Fluorescence measurements are made using a SPECTRAmax Gemini fluorimeter and Softmax Pro Software. Alternative plate readers with fluorescence measurement capability can be used.

3. Methods 3.1. DNA Gyrase Supercoiling Assay

1. Wash microtitre plate wells with three 200 µL volumes of Wash buffer (see Note 3). 2. Load 100 µL 500 nM biotinylated TFO1 oligo (diluted in Wash buffer) into wells and allow immobilisation to proceed for 2 min at room temperature. 3. Remove oligo solution and wash carefully with three 200 µL volumes of Wash buffer (see Note 3). 4. The DNA gyrase supercoiling reaction is performed in the wells in a 30 µL volume containing the following: 1–6 µL reconstituted DNA gyrase (1–2 units (see Note 4); the total volume of gyrase is made up to 6 µL with DNA Gyrase Dilution buffer), 1 µL 1 µg/µL relaxed pNO1, 6 µL 5× DNA Gyrase Reaction buffer and H2O to 30 µL (see Note 5). Incubate the reaction at 37°C for 30 min (this can be carried out in the plate reader if temperature control is available). 5. The reaction is stopped with the addition of 200 µL TF buffer, which lowers the pH, and the plate is incubated at room temperature for 30 min to allow triplex formation. Supercoiled DNA becomes trapped on the plate while relaxed DNA remains in solution. 6. Remove unbound relaxed and linear plasmid by washing the wells thoroughly with three 200 µL volumes of TF buffer. 7. Drain the wells and stain DNA with 200 µL 1× SYBR Gold (diluted in T10 buffer). The plate is incubated for a further 20 min at 37°C. After incubation, mix the contents of the well.

A High-Throughput Assay for DNA Topoisomerases and Other Enzymes

b

261

80,000

Fluorescence

a Gyrase U 0 0.063 0.125 0.25 0.5

1

2.5

5

60,000 40,000 20,000 0

c

0

2

4

6

[gyrase] U

250

Fluorescence

200 150 100 50 0

0

1

2

3 4 [gyrase] U

5

6

Fig. 1. Monitoring the DNA gyrase supercoiling reaction using the high-throughput and gel-based assays. Assays were performed with relaxed pNO1 using the indicated amounts of enzyme in units. Samples were analysed by gel electrophoresis ((a) and (b)) and by SYBR Gold fluorescence using the microtitre plate assay (c). (Reproduced from Maxwell et al. (2), with permission from Oxford University Press.)

8. Read fluorescence using excitation at 495 nm and emission at 537 nm. Wells are washed with three 200 µL volumes of Wash buffer and the plate is stored at 4°C for future use (see Notes 6 and 7). Supercoiling activity is calculated by reference to control reactions containing 1 µg supercoiled pNO1 without enzyme (see Fig. 1 for example data). 3.2. Topoisomerase I Relaxation Assay

1. All steps of the relaxation assay are as described above for the supercoiling assay, except for the reaction step, which is performed as follows: the reaction is performed in a 30 µL volume containing 1–2 units topoisomerase I (the enzyme is made up to 6 µL with Topoisomerase I Dilution buffer), 1 µL 1 µg/µL supercoiled pNO1, 3 µL 10× Topoisomerase I Reaction buffer and H2O to 30 µL. The reaction is incubated at 37°C for 30 min.

3.3. Other Enzymes

In principle, the high-throughput assay can be used to monitor the activity of any enzyme that causes a change in the linking number of the plasmid substrate. For example, the method can be used for rapidly monitoring restriction endonuclease activity.

262

Burrell, Burton, and Maxwell

1. To assay the activity of a restriction enzyme that cuts the pNO1 plasmid, such as AatII, all steps are performed as described for the supercoiling assay, except the reaction step. The reaction is performed in the plate in a 30 µL volume containing 1 µg supercoiled pNO1, 1 unit of AatII and the reaction buffer supplied by the manufacturer and is incubated at 37°C for 60 min. A negative control using AvaI, which does not cut the plasmid, may also be performed. Restriction enzyme activity results in a loss of fluorescence compared to untreated plasmid due to the formation of linear DNA, which is unable to form the triplex. 3.4. High-Throughput Screening of Gyrase Inhibitors and Determination of IC50 Values

The high-throughput assay can be used for screening chemical libraries for potential topoisomerase inhibitors. For example, the assay has been used to characterise inhibition of DNA gyrase by a series of modified aminocoumarin antibiotics that contain alterations to the prenylated hydroxbenzoate ring (9). Because several inhibitor concentrations can be quickly tested on a single plate and the resulting output is a series of reliable quantitative measurements of enzyme activity, the assay lends itself to the rapid and accurate determination of IC50 values for compounds of interest. A general protocol for screening inhibitors is given below. 1. DNA gyrase supercoiling assays can be performed as described above using an enzyme concentration that gives ~50% supercoiling (i.e. ~1 unit; see Note 8). All reaction components except inhibitors are added in a ‘master-mix’, which is stored on ice until use to prevent the supercoiling reaction from occurring. The master mix is loaded onto the microtitre plate wells containing immobilised TF oligo, inhibitors are added and mixed well and the plate is incubated at 37°C for 30 min. Novobiocin (or a similarly characterised inhibitor) should be included as a reference. The solvent that test compounds are dissolved in should be included in control reactions (see Note 9). 2. To determine IC50 values for the inhibition of DNA gyrase by selected compounds, supercoiling assays are performed with a wide range of inhibitor concentrations (see Note 10). Typically, eight inhibitor concentrations, spanning three orders of magnitude, would be used (see Fig. 2 for example data). Controls with a known DNA gyrase inhibitor should also be performed. In addition, the highest concentration of the test compound used for the IC50 determination should be added to a reaction without DNA gyrase to ensure that the inhibitor does not increase or decrease the background fluorescence. 3. IC50 values are computed by plotting the inhibition data and using the exponential decay equation to fit them using a curvefitting program such as SigmaPlot.

A High-Throughput Assay for DNA Topoisomerases and Other Enzymes

263

Fig. 2. Characterisation of the activity of DNA gyrase inhibitors using the high-throughput assay. Supercoiling activity was determined at a range of concentrations of either novobiocin (a) or a novobiocin analogue (9) (b), and normalised to control data obtained in the absence of drug. An exponential decay equation was used to fit the data and determine IC50 values. Error bars show the spread of the data for three separate measurements

4 Notes 1. The triplex-based microplate assay described is protected by patent application WO06/051303. Commercial performance of the assay requires a licence, available from Plant Bioscience Ltd. (Norwich, UK; http://www.pbltechnology.com/).

264

Burrell, Burton, and Maxwell

The assay is available as a kit from Inspiralis Ltd. (Norwich, UK; http://www.inspiralis.com/) who also supply pNO1 and a range of topoisomerase enzymes including E. coli DNA gyrase and topoisomerase IV, and human topoisomerases I and II. 2. DNA gyrase and other topoisomerases can lose activity upon repeated freeze-thaw cycles and therefore should be stored at −80°C in the minimum practical aliquot size. 3. It is essential that wells are washed and buffer removed completely, where indicated in the assay procedure. Unbound TFO1 oligo remaining in the wells will interfere with the binding of pNO1 to the immobilised oligo causing invalid results and residual buffers may also affect subsequent steps. 4. One unit of supercoiling activity is defined as the amount of enzyme required to fully supercoil 0.5 µg relaxed pNO1 at 37°C in 30 min. The extent of supercoiling is determined by the inclusion of a control containing 1 µg supercoiled pNO1 without enzyme. Conversely, a unit of relaxation activity is defined as the amount of enzyme required to relax 0.5 µg supercoiled pNO1 at 37°C in 30 min. Units of enzyme activity are quantified by performing the reaction over a range of enzyme concentrations. For example, to quantify units of DNA gyrase supercoiling activity using the triplex assay, supercoiling would be assayed with gyrase between 2 and 20 nM, and the amount of enzyme corresponding to one unit can then be extrapolated from a linear regression of these data. 5. The assay can be carried out with less DNA (e.g. 0.75 µg) and correspondingly less enzyme. 6. Microtitre plates can be re-used for at least three subsequent assays without significant loss in signal quality (2). To re-use a plate, the wells should be washed with Wash buffer thoroughly after SYBR Gold staining and fluorescence measurement. The TFO1 oligo remains bound to the plate so does not need to be re-immobilised prior to subsequent reactions. 7. When troubleshooting problems with the assay (e.g. lack of signal), it is useful to perform the reactions with twice the normal volume and analyse the products of half the reaction mixture on a 1% (w/v) agarose gel. This will show whether the problem is related to the high-throughput assay system or the enzyme reaction step. For agarose gel analysis, 30 µL of the mixture is removed and the reaction terminated with the addition of an equal volume of STEB (40% sucrose, 100 mM Tris– HCl (pH 7.5), 100 mM EDTA, 0.5 mg/mL bromophenol blue),

A High-Throughput Assay for DNA Topoisomerases and Other Enzymes

265

and the DNA extracted with chloroform:isoamyl alcohol (24:1). A sample (15 µL) of the upper blue phase is loaded onto a 1% (w/v) agarose gel in 1× TAE (40 mM Tris-acetate, 2 mM EDTA) and run at ~7.5 V/cm for ~2 h. The gel is stained in 1 µg/mL ethidium bromide for ~10 min, destained in 1× TAE for ~10 min and bands are visualised on a gel documentation system (Syngene). Supercoiling or relaxation activity can be determined by reference to supercoiled and relaxed pNO1 control reactions. 8. The advantage of using an enzyme concentration that gives less than 100% supercoiling (e.g. 50%) is that it makes the assay more sensitive to small changes in supercoiling activity. For large-scale drug screening, using an amount of enzyme that gives full supercoiling is likely to be acceptable in a primary screen. However, the actual enzyme concentration should be borne in mind when carrying out screening as this will give a lower limit in sensitivity to the assay in terms of the IC50s of test compounds (9). 9. Topoisomerase inhibitors, such as aminocoumarin antibiotics, are often poorly soluble in water and are typically dissolved in dimethyl sulphoxide (DMSO). Appropriate stock concentrations of inhibitors should be used such that the final DMSO concentration in the assay does not exceed 3–5% (v/v), but this should be determined empirically for each enzyme. When a range of inhibitor concentrations is used, appropriate dilutions of the stock inhibitor are made so that the DMSO concentration is the same in each reaction. 10. IC50 values obtained with the high-throughput assay are generally lower than those obtained with the standard gel-based assay. This discrepancy is due to the fact that the gel assay is unable to resolve supercoiled topoisomers with s greater than~−0.3, and as a result, significant inhibition occurs before a change is observed on the gel and IC50 values are therefore overestimated (2). Despite the difference in absolute IC50 values, the relative values obtained with either method will be similar.

Acknowledgements This work was supported by BBSRC (UK) and Plant Biosciences Ltd; we thank Martin Stocks and James Taylor for helpful comments.

266

Burrell, Burton, and Maxwell

References 1. Bates AD, Maxwell A (2005) DNA topology. Oxford University Press, Oxford 2. Maxwell A, Burton NP, O’Hagan N (2006) High-throughput assays for DNA gyrase and other topoisomerases. Nucleic Acids Res 34:e104 3. Hanvey JC, Shimizu M, Wells RD (1988) Intramolecular DNA triplexes in supercoiled plasmids. Proc Natl Acad Sci USA 85: 6292–6296 4. Sakamoto N, Akasaka K, Yamamoto T, Shimada H (1996) A triplex DNA structure of the polypyrimidine:polypurine stretch in the 5¢ flanking region of the sea urchin arylsulfatase gene. Zoolog Sci 13:105–109 5. Kawabata Y, Ooya T, Lee WK, Yui N (2002) Self-assembled plasmid DNA network prepared through both triple-helix formation and

6. 7.

8. 9.

streptavidin–biotin interaction. Macromol Biosci 2:195–198 Boros I, Pósfai G, Venetianer P (1984) Highcopy-number derivatives of the plasmid cloning vector pBR322. Gene 30:257–260 Maxwell A, Howells AJ (1999) Overexpression and purification of bacterial DNA gyrase. In: Bjornsti M-A, Osheroff N (eds) DNA topoisomerase protocols I. DNA topology and enzymes. Humana, Totowa, New Jersey, pp 135–144 Stewart L, Ireton GC, Champoux JJ (1996) The domain organization of human topoisomerase I. J Biol Chem 271:7602–7608 Anderle C, Stieger M, Burrell M, Reinelt S, Maxwell A, Page M, Heide L (2008) Biological activities of novel gyrase inhibitors of the aminocoumarin class. Antimicrob Agents Chemother 52:1982–1990

Chapter 17 Measurement of DNA Interstrand Crosslinking in Individual Cells Using the Single Cell Gel Electrophoresis (Comet) Assay Victoria J. Spanswick, Janet M. Hartley, and John A. Hartley Abstract The Single Cell Gel Electrophoresis (Comet) assay, originally developed to allow visualisation of DNA strand break damage in individual cells, has been adapted to measure DNA interstrand cross-links. DNA interstrand cross-links are formed in cells by a number of commonly used cancer chemotherapy agents and are considered to be the critical lesion formed by such agents. This technique allows the analysis of DNA interstrand cross-link formation and repair at a single cell level, requires few cells, allows the determination of heterogeneity of response within a cell population and is sensitive enough to measure DNA interstrand cross-links at pharmacologically relevant doses. The method can be applied to any in vitro or in vivo application where a single cell suspension can be obtained. The method has also become invaluable in studies using human tissue and can be used as a method for pharmacodynamic analysis in early clinical trials. Key words: Single gel electrophoresis (Comet) assay, Comet assay, DNA interstrand, Cross-links, DNA repair, Cross-linking drugs, Nitrogen mustards, Platinum drugs, Pharmacodynamic analysis

1. Introduction Drugs capable of producing interstrand cross-links in cellular DNA have been widely used in cancer chemotherapy for many years for the treatment of both solid tumours and haematological malignancies. These include members of the nitrogen mustard class (e.g. mechloroethamine, chlorambucil, melphalan, cyclophosphamide, ifosfamide), chloroethyl-nitrosoureas (e.g. BCNU), dimethanesulphonates (e.g. busulphan), some natural products (e.g. mitomycin C) and platinum drug (e.g. cisplatin, carboplatin and oxaliplatin). In addition, novel interstrand cross-linking agents continue to be developed (e.g. SJG-136 (1)), and conversion of K.R. Fox (ed.), Drug-DNA Interaction Protocols, Methods in Molecular Biology, vol. 613, DOI 10.1007/978-1-60327-418-0_17, © Humana Press, a part of Springer Science + Business Media, LLC 1998, 2010

267

268

Spanswick, Hartley, and Hartley

prodrugs into potent DNA cross-linking agents is being tested clinically in a variety of applications including direct (2), antibodydirected (3), gene-directed (4), and virus-directed prodrug therapies (5). The covalent linkage of the two complementary strands of DNA produced by an interstrand cross-link prevents separation of the strands during critical cellular processes, such as replication and transcription, and it is therefore highly cytotoxic DNA damage. In addition, the involvement of both strands of DNA poses particular problems for the cellular DNA repair machinery and repair of interstrand cross-links is complex (6). The inability of tumour cells to repair these specific lesions contributes to the inherent sensitivity of some cancers (7), and increased repair can contribute clinically to acquired resistance to cross-linking drugs (7, 8). The inability of the two strands of DNA to separate under denaturing conditions resulting from interstrand cross-linking has been exploited in methods to detect cross-linking in naked DNA (see Chapter 18, this volume) and in intact cells. Indeed, the ability to measure DNA interstrand cross-linking in cells at pharmacologically relevant doses has been possible for several decades using the technique of alkaline elution developed by Kohn and co-workers (9). This method, however, requires a relatively large number of cells and the prior radiolabelling of cellular DNA. As a result, it cannot easily be adapted for studies in vivo. More recently, the single cell gel electrophoresis (Comet) assay has been adapted to measure interstrand cross-links (10). Originally developed to measure strand breaks (11), the comet assay allows visualization of DNA damage in individual cells. In order to detect DNA interstrand cross-links, cells are irradiated immediately prior to analysis to deliver a fixed level of random strand breaks to the genome. Cells are then embedded in agarose on a microscope slide and lysed to remove cellular proteins. The DNA is then denatured under alkaline conditions and subjected to electrophoresis. During electrophoresis, any relaxed or broken DNA fragments migrate further than the supercoiled, undamaged DNA. After appropriate staining, the DNA resembles a “comet” with a brightly stained head, and a tail whose length and intensity is determined by the level of strand breakage produced within that cell. The presence of DNA interstrand cross-links retards the migration of the irradiated DNA during electrophoresis compared to irradiated, non-cross-linked controls. The extent of retardation is proportional to the level of interstrand cross-linking. Removal (“unhooking”) of the interstrand cross-link from the DNA can also be assessed with time following a drug-free incubation period. The technique is highly reproducible, more sensitive than alkaline elution, requires fewer cells, and has the important

Measurement of DNA Interstrand Crosslinking in Individual Cells

269

advantage that analysis can be made at a single cell level. It is therefore possible to determine heterogeneity of interstrand cross-link formation and repair in a cell population. The method is applicable to any application where a single cell suspension can be obtained. This includes cells cultured in vitro, and cells isolated from in vivo sources. Recently, the method has become invaluable in mechanistic studies using human tissue (e.g. lymphocytes, haematological and solid tumour cells (7, 8, 12)), and is increasingly being used as a method for pharmacodynamic analysis in early clinical trials (2, 3, 13–15).

2. Materials 2.1. Cell Preparation and Drug Treatment

1. Appropriate tissue culture medium.

2.1.1. Suspension Cell Lines

3. FCS (Autogen Bioclear).

2.1.2. Adherent Cell Lines

1. Appropriate tissue culture medium.

2. L-glutamine (Autogen Bioclear, Calne, UK).

2. L-glutamine (Autogen Bioclear). 3. FCS (Autogen Bioclear). 4. Trypsin/ethylenediaminetetraacetic acid (EDTA) (1×) (Autogen Bioclear). 2.1.3. Human Lymphocytes

1. Vacutainer® CPT™ tubes (Becton Dickinson, Oxford, UK) (see Note 1). 2. RPMI 1640 tissue culture medium (Autogen Bioclear). 3. L-glutamine (Autogen Bioclear). 4. Foetal calf serum (FCS) (Autogen Bioclear).

2.1.4. Solid Tumour Tissue/ Aspirates

1. RPMI 1640 tissue culture media (Autogen Bioclear). 2. L-glutamine (Autogen Bioclear). 3. FCS (Autogen Bioclear).

2.1.5. Ascites

1. Dulbecco’s modification of Eagle’s medium (DMEM) (Autogen Bioclear). 2. L-glutamine (Autogen Bioclear). 3. FCS (Autogen Bioclear).

2.2. Single Cell Gel Electrophoresis (Comet) Assay

1. Single-frosted glass microscope slides and glass 24 × 40 mm coverslips. 2. Agarose, Type 1-A (Sigma, Poole, UK). 3. Agarose, Type VII: low gelling temperature (LGT) (Sigma).

270

Spanswick, Hartley, and Hartley

4. Lysis buffer: 100 mM disodium EDTA, 2.5 M NaCl, 10 mM Tris-HCl, pH to 10.5–11.0 with sodium hydroxide pellets. 1% triton X-100 to be added immediately before use. Store at 4°C. 5. Alkali buffer: 50 mM NaOH, 1 mM disodium EDTA, pH 12.5. Caution: Corrosive. Store at 4°C. 6. Neutralisation buffer: 0.5 M Tris-HCl, pH 7.5. Store at 4°C. 7. Phosphate buffered saline (PBS), pH 7.4. Store at 4°C. 8. Flat bed electrophoresis. This should be of sufficient size to hold a large number of slides e.g., 30 × 25 cm gel tank from Flowgen Bioscience, Nottingham, U.K. which holds up to 45 slides. 2.3. Staining and Visualisation

1. Propidium iodide (Sigma), 2.5 µg/mL. Make up fresh before use. Caution: Toxic and light sensitive. 2. Glass coverslips, 24 × 40 mm. 3. Double distilled water. 4. Epi-fluorescence microscope equipped with high pressure mercury light source using a 580 nm dichroic mirror, 535 nm excitation filter and 645 nm emission filter for propidium iodide staining (e.g. Olympus BX51 inverted microscope with Olympus U-RFL-T mercury lamp and Sony XCD-X710 digital camera). 5. Images are visualised, captured and analysed using a suitable image analysis system. Our laboratory uses Komet 5.5 analysis software from Andor Technology, formerly Kinetic Imaging (Belfast, UK) (see Note 2).

3. Methods 3.1. Cell Preparation and Drug Treatment 3.1.1. Suspension Cell Lines

1. Exponentially growing cells should be used at a density of 2.5–3.0 × 104 cells/mL in an appropriate medium containing 2 mM glutamine and 10% FCS. 2. A minimum of 2 mL cells are treated with the cross-linking agent and incubated for the appropriate time at 37°C in a humidified atmosphere with 5% carbon dioxide (see Note 3). 3. Pellet cells by centrifugation at 200× g for 5 min at room temperature. 4. Remove supernatant and resuspend cells in 2 mL of fresh drug-free medium containing 2 mM glutamine and 10% FCS maintained at 37°C. 5. Incubate cells using the above conditions for the required post-treatment time (see Note 4).

Measurement of DNA Interstrand Crosslinking in Individual Cells

271

6. Cells are now ready to be processed as described in Subheading 3.2, step 2. 7. Alternatively, cells can be frozen and stored at −80ºC following treatment with the cross-linking agent. This allows samples to be taken at different time points e.g. for repair studies. The samples can then be processed in a single assay reducing the possibility of inter-assay variation. Following treatment, centrifuge the cells at 200× g for 5 min at 4ºC. Discard the supernatant and resuspend the pellet in 2 mL freezing mixture (FCS containing 10% dimethylsulphoxide) (Sigma). Aliquot into 2 × 1 mL freezing vials and freeze at −80ºC (see Notes 5 and 6). 3.1.2. Adherent Cell Lines

1. Exponentially growing cells are treated with the cross-linking agent and incubated for the appropriate time at 37°C in a humidified atmosphere with 5% carbon dioxide (see Note 3). 2. After the appropriate incubation, carefully remove the media and replace with fresh drug-free medium containing 2 mM glutamine and 10% FCS maintained at 37°C. 3. Incubate cells for the required post-treatment time (see Note 4). 4. Remove media and trypsinize cells with tryspin/EDTA solution until all cells have rounded up and detached (see Note 7). 5. Neutralise trypsinisation by the addition of fresh media containing 2 mM glutamine and 10% FCS. 6. Transfer cells to a universal tube, wash twice with media containing 2 mM glutamine and 10% FCS maintained at 4°C by centrifuging at 200× g for 5 min at 4ºC. 7. Cells are now ready to be processed as described in Subheading 3.2, step 2. 8. Alternatively, cells can be frozen and stored at −80ºC as described in Subheading 3.1.1, step 7, and the Single Cell Gel Electrophoresis (Comet) assay performed at a later date.

3.1.3. Human Lymphocytes

1. Collect whole blood using Vacutainer® CPT™ system. This allows sterile blood collection and cell separation using a single centrifugation step (see Note 1). 2. Centrifuge at 1,500× g for 20 min at room temperature (see Note 8). 3. Remove layer of lymphocytes at the interface and wash twice with RPMI 1640 media containing 2 mM L-glutamine and 10% FCS maintained at 37°C. 4. For ex vivo experiments, i.e., where isolated lymphocytes are treated with drug, count the lymphocytes using a haemocytometer and dilute to 2.5–3.0 × 104 cells/mL in RPMI 1640 media containing 2 mM L-glutamine and 10% FCS.

272

Spanswick, Hartley, and Hartley

Treat minimum of 2 mL of lymphocytes with the relevant concentration of cross-linking agent and incubate for the appropriate time at 37ºC in a humidified atmosphere with 5% carbon dioxide (see Note 3). 5. Remove the cross-linking agent by centrifuging the lymphocytes at 200× g for 5 min at room temperature. 6. Remove supernatant and resuspend the lymphocytes in fresh drug-free RPMI 1640 containing 2 mM L-glutamine and 10% FCS maintained at 37ºC. 7. Incubate lymphocytes at 37°C for the required post-treatment time (see Note 4). 8. Lymphocytes are now ready to be processed using the Single Cell Gel Electrophoresis (Comet) assay as described in Subheading 3.2, step 2. 9. For in vivo investigations, i.e., where DNA interstrand cross-links are to be detected in patients treated with DNA cross-linking agents, isolate lymphocytes as quickly as possible after sampling (see Note 8). Wash lymphocytes twice with RPMI 1640 containing 2 mM L-glutamine and 10% FCS maintained at 4ºC and dilute to a final concentration of 2.5 × 104/mL. Continue assay from Subheading 3.2, step 4. 10. Alternatively, for both ex vivo and in vivo experiments, lymphocytes can be frozen and stored at −80ºC as described in Subheading 3.1.1, step 7. (see Note 5). 3.1.4. Solid Tumour Tissue/ Aspirates

1. Solid tumour/aspirate samples should be placed in 10 mL RPMI 1640 medium containing 2 mM L-glutamine and 10% FCS maintained at 4°C immediately after collection (see Note 8). 2. Place the tumour material in a 10 cm petri dish and cover with 1–2 mL of cold RPM1 1640 medium. This should be carried out in a class II biological safety cabinet. 3. Using two sterile scalpels, finely chop the tumour tissue using a cross-cutting action until a single cell suspension is formed. The petri dish must be kept on ice throughout the procedure (see Note 9). 4. Transfer cell suspension to a 15 mL falcon tube and make up the volume to 5 mL with cold RPMI 1640 medium containing 2 mM L-glutamine and 10% FCS and centrifuge at 200× g for 5 min at 4ºC. 5. Drug treatments (ex vivo), in vivo investigations and freezing procedure can be performed as described in Subheading 3.1.3, steps 4 and 10.

Measurement of DNA Interstrand Crosslinking in Individual Cells 3.1.5. Ascites

273

1. Ascitic fluid containing tumour cells and normal mesothelial cells, for example, from ovarian cancer patients, should be collected under sterile conditions. 2. Aliquot the fluid into 50 mL conical tubes and centrifuge at 200× g for 5 min at 4ºC. 3. Discard the supernatant and resuspend in 40 mL DMEM medium containing 2 mM L-glutamine and 10% FCS and seed into 150 cm2 tissue culture flasks. 4. Incubate cells for 1 hour at 37ºC with 5 % carbon dioxide in a humidified atmosphere. 5. After 1 h, remove the entire volume of tissue culture medium containing unattached cells from the flask and transfer to new flask and incubate at 37ºC with 5% carbon dioxide in a humidified atmosphere. 6. Tumour cells require a significant length of time to adhere to plastic, whereas normal mesothelial cells generally attach within the first hour of incubation. 7. Once a significant tumour cell population has been achieved, cells are maintained at 37ºC with 5% carbon dioxide in a humidified atmosphere. 8. Tumour cells are treated with the cross-linking agent in duplicate as described in Subheading 3.1.3, step 4, and incubated for the appropriate time at 37°C in a humidified atmosphere with 5% carbon dioxide (see Note 3). 9. After the appropriate incubation, carefully remove the media and replace with fresh drug-free medium containing 2 mM glutamine and 10% FCS maintained at 37°C. 10. Incubate cells using the above conditions for the required post-treatment time (see Note 4). 11. Remove media and trypsinize cells with tryspin/EDTA solution until all cells have rounded up and detached (see Note 7). 12. Neutralise trypsinisation by the addition of fresh media containing 2 mM glutamine and 10% FCS. 13. Transfer cells to a universal tube, wash twice with media containing 2 mM glutamine and 10% FCS maintained at 4°C by centrifuging at 200× g for 5 min at 4ºC. 14. Cells are now ready to be processed as described in Subheading 3.2, step 2. 15. Alternatively, cells can be frozen and stored at −80ºC as described in Subheading 3.1.1, step 7, and the Single Cell Gel Electrophoresis (Comet) assay performed at a later date.

274

Spanswick, Hartley, and Hartley

3.2. Single Cell Gel Electrophoresis (Comet) Assay

Important: All stages of this assay should be carried out on ice under subdued lighting, solutions maintained at 4°C, and incubations performed in the dark where indicated (see Notes 10 and 11). 1. Precoat microscope slides with 1% type 1-A agarose in water by pipetting 1 mL of molten agarose onto the centre of the slide and place a coverslip on top. Allow to set and remove the coverslip. Slides are then allowed to dry overnight at room temperature. The slides must be dry before use (see Note 12). 2. After required drug exposure/repair time, pellet cells by centrifuging at 200× g for 5 min at 4°C. Remove supernatant and resuspend cells to a final concentration of 2.5 × 104 cells/ mL in the appropriate tissue culture media maintained at 4°C ensuring that a single cell suspension has been achieved. 3. Alternatively, if samples are frozen following isolation and treatment, thaw and remove freezing mixture by centrifugation. Resuspend samples in the appropriate tissue culture medium at 4°C and centrifuge at 200× g for 5 min at 4°C. Discard the supernatant, resuspend sample in the appropriate tissue culture medium at 4°C to a final concentration of 2.5 × 104 cells/mL as a single cell suspension. 4. Irradiate samples on ice with the appropriate X-ray dose, except for the untreated unirradiated control (see Notes 13–15). 5. Take 0.5 mL of resuspended cells and put in a 24 well plate on ice. Add 1 mL of molten 1% LGT agarose in water cooled to 40°C, mix, pipette 1 mL onto the centre of the slide on ice and place a coverslip on top (see Note 16). Once set, remove coverslip and place in a tray on ice. Duplicate slides should be prepared (see Note 17). 6. Add ice cold lysis buffer containing 1% triton X-100 ensuring that all slides are sufficiently covered. 7. Incubate on ice for 1 h in the dark. 8. Carefully remove lysis buffer ensuring that the gels are intact and remain on the slides (see Note 18). 9. Add ice cold double distilled water to completely cover the slides. Incubate on ice for 15 min in the dark. This should then be repeated three times. 10. Remove slides from tray and transfer carefully to an electrophoresis tank (see Note 19). 11. Cover slides with ice cold alkali buffer and incubate for 45 min in the dark (see Note 20). 12. Electrophorese for 25 min at 18 V (0.6 V/cm), 250 mA. This must be carried out in the dark (see Note 21).

Measurement of DNA Interstrand Crosslinking in Individual Cells

275

13. Carefully remove slides from the buffer and place on a horizontal slide rack. 14. Flood each slide twice with 1 mL neutralisation buffer and incubate for 10 min. 15. Rinse slides twice with 1 mL PBS and incubate for 10 min. 16. Remove all excess liquid from slides and allow to dry overnight at room temperature. 3.3. Staining and Visualisation

1. Re-hydrate slides in double distilled water for 30 min. 2. Flood each slide twice with 1 mL 2.5 µg/mL propidium iodide solution and incubate for at least 30 min at room temperature in the dark (see Note 22). 3. Rinse slides twice with double distilled water for 10 min and once for 30 min. 4. Allow slides to dry at 40ºC in the dark (see Note 23). 5. Once dry, place a few drops of distilled water onto the slide and cover with a coverslip (see Note 24). 6. Examine individual cells and comets at 20× magnification analysing a minimum of 25 images per duplicate slide (i.e., minimum 50 in total) (see Note 25). 7. Remove coverslip and store slides in a light-proof box at room temperature (see Note 26) 8. The tail moment is used as a measure of DNA damage and is defined as the product of the percentage DNA in the comet tail, and the distance between the means of the head and tail distributions, based on the definition by Olive et al. (16). The percentage decrease in tail moment is therefore calculated using the following formula: é æ (TMdi - TMcu )ö ù % decrease in tail moment = ê1 - ç ÷ ú ´ 100 ëê è (TMci - TMcu )ø ûú where TMdi = tail moment of drug treated irradiated sample. TMcu = tail moment of untreated unirradiated control. TMci = tail moment of untreated irradiated control 9. In samples treated under conditions that can also produce strand breaks, e.g., combination of a cross-link agent with an agent known to produce single strand breaks, e.g., gemcitabine. Cross-linking is expressed as percentage decrease in tail moment compared to irradiated controls calculated by the formula below. This formula is used to compensate for the additional single strand breaks induced by agents such as gemcitabine in addition to those produced by the irradiation step.

276

Spanswick, Hartley, and Hartley

% decrease in tail moment é æ öù (TMdi - TMcu ) = ê1 - ç ú ´ 100 ÷ êë è (TMci - TMcu ) + (TMdu - TMcu )ø úû where TMdi = tail moment of drug treated irradiated sample. TMcu = tail moment of untreated unirradiated control. TMci = tail moment of untreated irradiated control. TMdu = tail moment of drug treated unirradiated sample. The percentage decrease in tail moment is proportional to the level of DNA cross-linking. 3.4. Examples

Figure 1 illustrates typical comet images obtained following the in vitro treatment of NIH187 human small cell lung cancer cells with melphalan. In the control untreated, unirradiated cells (a), no DNA damage is detected and the high molecular weight supercoiled DNA remains intact. Following irradiation of cells with 15 Gy X-ray to introduce a fixed number of random DNA strand breaks, the resulting shorter fragments of DNA migrate from the bulk of the DNA during electrophoresis to produce typical comet images (b). In irradiated samples following treatment with 25 mM melphalan, (c), comet tails are visible but with reduced length and intensity when compared to irradiated controls (b). Increasing the dose to 100 mM melphalan (d) results in a further reduction in comet tail length and intensity due to the retention of DNA by the melphalan-induced DNA interstrand cross-links in the head of the comet. When expressed as percentage decrease in tail moment compared with untreated irradiated controls, a dose-dependent increase in DNA interstrand crosslink formation can be observed in NIH187 cells following treatment with increasing doses of melphalan (Fig. 2). The formation and repair (“unhooking”) of cisplatin-induced DNA interstrand cross-links in A549 human non-small cell lung cancer cells is shown in Fig. 3. Peak of DNA interstrand cross-link formation is observed 9 h following a 1 h treatment with cisplatin. This is followed by significant repair of cisplatin-induced DNA interstrand cross-links at 24 and 48 h post-treatment.

4. Notes 1. The traditional method for isolating lymphocytes using FicollHypaque can also be used. However, in comparison to the Vacutainer® CPT™ system, the processing time is significantly increased and the whole blood must be layered on to the Ficoll-Hypaque before centrifugation. 2. Other Comet analysis programs are available incorporating all major measurement parameters, such as percentage head/tail

Measurement of DNA Interstrand Crosslinking in Individual Cells

277

Fig. 1. Typical comet images from NIH187 human small cell lung cancer cells following in vitro treatment with melphalan. (a) Untreated unirradiated control cells, (b) Untreated irradiated (15 Gy) control cells, (c) Irradiated melphalan treated (25 mM) cells and (d) Irradiated melphalan treated (100 mM) cells. Cells were treated with melphalan for 1 h followed by a 16 h post-incubation in the absence of drug.

DNA, tail length and Olive tail moment, for example Comet Assay IV, Perceptive Instruments, Haverhill, UK and LAI Comet Analysis System (LACAS), Loats Associates Incorporated, Westminster, Maryland, USA. Automatic analysis programs

Spanswick, Hartley, and Hartley 100

75 %฀decrease฀in฀tail฀ moment

278

50

25

0

0

25

50

75

100

Melphalan฀(uM)

Fig. 2. In vitro formation of melphalan-induced DNA interstrand cross-links in NIH187 human small cell lung cancer cells. Cells were treated with melphalan for 1 h followed by a 16 h post-incubation in the absence of drug. Results are expressed as percentage decrease in tail moment for 50 cells analysed (mean ± standard error).

100

75 % decrease in 50 tail moment 25

0 0

12

24

36

48

Time (hours post-treatment)

Fig. 3. Formation and repair of cisplatin-induced DNA interstrand cross-links in A549 human non-small cell lung cancer cells. Cells were treated with 150 mM cisplatin for 1 h, then incubated in drug-free medium and samples taken at various time points. Results are expressed as percentage decrease in tail moment for 50 cells analysed (mean ± standard error).

are available allowing unattended automatic comet acquisition and measurement of comet parameters, for example Metafer CometScan, Metasystems, Altlussheim, Germany and AutoComet III, TriTek Corporation, Sumerduck, Virginia, USA. 3. If the chosen drug is to be reconstituted in solvents such as dimethylsulphoxide, the final concentration of solvent added to the cells should be no greater than 0.1%. This is to avoid any additional DNA damage and cell death.

Measurement of DNA Interstrand Crosslinking in Individual Cells

279

4. The length of the post-treatment time is dependent on the type of cross-linking agent used and the peak of interstrand cross-link formation. A time-course experiment should be performed to ascertain this. For example, following a 1 h treatment the peak of interstrand cross-linking for chlorambucil is reached following a 3 h post-incubation, while melphalan requires a post-incubation of 16 h. For repair experiments, the post-treatment time can be further extended. 5. Samples should be resuspended fully in the freezing mixture to prevent DNA damage and cell death. This should be carried out by gently resuspending the sample using a Pasteur pipette rather than vortexing. 6. Our laboratory has validated the effects of long term storage at −80ºC and samples can be stored up to 12 months without any detrimental effects to the integrity of the cells and DNA. 7. Trypsinise cells at 37ºC as quickly as possible to avoid any additional DNA damage and to prevent crosslink repair. Alternatively a non-enzymatic preparation can be used such as cell disassociation solution (Sigma). It is imperative that a single cell suspension is achieved. If several cells migrate together through the gel, an overestimated comet tail moment will result. 8. Lymphocytes and tumour cells should be separated within 30 min of collection to prevent any DNA damage and cell death induced by long term storage and to reduce repair of DNA interstrand cross-links when performing in vivo investigations. 9. Other methods can be used such as cell disaggregation enzymes. The disadvantage with these is that samples require incubation at 37ºC for up to 1 h. Significant repair of DNA damage is therefore likely to occur in samples from treated patients or animals. 10. It is imperative that the comet assay should be performed on ice and in subdued lighting and incubations carried out in the dark where indicated throughout the text. This is to prevent any DNA repair. All solutions should be ice cold and maintained at 4°C. 11. Reagent kits for the Single Cell Gel Electrophoresis (Comet) assay are available (CometAssay™, Trevigen Incorporated, Gaithersburg, Maryland, USA and CometAssay™, R & D Systems, Abingdon, UK). These kits contain precoated Comet slides, LGT agarose, lysis solution, EDTA and SYBR® Green I nucleic acid gel stain and provide enough reagents for 25 slides. The assay protocols for these kits have not, however, been optimized for individual requirements.

280

Spanswick, Hartley, and Hartley

For example, lysis, alkali denaturation and electrophoresis incubation times are not standardized and require significant optimization by the user to achieve consistent results. Also such kits are significantly more expensive when compared to purchasing and preparing reagents individually. 12. Precoated slides should be prepared and dried in advance. Slides can be stored dry at room temperature for up to 6 months in an airtight container. 13. Our laboratory uses an AGO HS MP-1 X-ray machine with a Varian ND1-321 tube to produce X rays at a dose rate of 2.5 Gy/min. 14. Each experiment should include an untreated unirradiated control. In addition, an untreated irradiated control should also be included with every group of irradiated samples to allow for variation. It is also important to determine in the first instance if the drug under test will produce any detectable single strand breaks in addition to cross-links. This may be achieved by performing the comet assay on drug treated cells but excluding the irradiation step. This also applies when samples are treated in combination with an agent known to cause single strand breaks. 15. A standard curve for irradiation dose in non-drug treated cells should be performed to establish the optimum radiation dose for a given cell type. Ideally, the dose should give a head to tail DNA ratio of approximately 1:1. Our laboratory finds 15 Gy X-rays optimum for most cell lines, lymphocytes and tumour samples. 16. When sample sizes are small, for example lymphocytes, ascitic and tumour/aspirate samples from clinical investigations, the sample and gel size may be reduced. Take 100 mL cell suspension at a final concentration 2.5 × 104/mL and add to a 96 well plate. Add 200mL molten 1% LGT in water cooled to 40ºC, mix and pipette 300 mL onto the centre of the slide. Place 13 mm diameter circular coverslip on top. Once set, remove coverslip and place slide in a tray on ice. Continue assay from Subheading 3.2, step 4. 17. Molten 1% LGT agarose should be maintained at 40°C to aid uniform gel preparation. The thickness of the gel must be consistent between slides to ensure uniform DNA migration and reduce assay variability. All gels should have the dimensions of the coverslip. The gel should not flood the entire slide or the frosted section and should not contain air bubbles. 18. A number of protocols have stated that following lysis the slides can be kept overnight or even days in this solution prior to alkali DNA unwinding and electrophoresis.

Measurement of DNA Interstrand Crosslinking in Individual Cells

281

We do not advise that this should be carried out as the gels tend to break up and slip off the slide. It is therefore recommended that Subheading 3.2, steps 2–16 should be carried out in a single day. 19. Slides should be placed in a flat bed electrophoresis tank lengthways with the frosted end towards the anode. It is essential that the tank is level and all slides face the same direction to ensure low variability between slides. 20. The volume of alkali buffer added to the electrophoresis tank should be consistent from one experiment to the next. It is advisable to measure the volume of buffer required ensuring that all slides are covered by at least 5 mm buffer. 21. These electrophoresis parameters are optimal for our equipment. The current can be adjusted to suit individual requirements. 22. The most commonly used fluorescent stains are propidium iodide and ethidium bromide. The highly sensitive fluorochrome SYBR® Green I nucleic acid gel stain has also been used successfully. It has the advantage of being far more sensitive that propidium iodide and produces no background fluorescence. However, it fades much more rapidly under intense UV light. Comet images can also be visualised using silver staining (CometAssay™ Silver Staining Kit, Trevigen Incorporated, Gaithersburg, Maryland, USA and CometAssay™ Silver kit, R & D Systems Europe Limited, Abingdon, UK). This can be carried out after comets have been analysed using other staining methods and allows visualisation by standard light microscopy and provides a permanent staining for sample archiving. 23. Visualising the slides dry produces optimum results as all the cells are in the same plane giving clear cellular definition (17). This is favoured instead of the traditional wet slide method, which can cause difficulties in focusing and quantitation. 24. Slides should be analysed as quickly as possible. If the coverslip is left on for a considerable length of time, it will become permanently stuck. 25. Each slide should ideally be scored blind to avoid any bias, taking care to ensure that comets are measured from the entire gel area and no part of the slide is analysed more than once. 26. Slides may be stored for at least 5 years and re-analysed at any time as described in Subheading 3.3, steps 5–9. Slides may also be re-stained as described in Subheading 3.3, steps 1–4 if the staining has faded during storage.

282

Spanswick, Hartley, and Hartley

References 1. Hartley JA, Spanswick VJ, Brooks N, Clingen PH, McHugh PJ, Hochhauser D, Pedley RB, Kelland LR, Alley MC, Schultz R, Hollingshead MG, Sausville EA, Gregson SJ, Howard PW, Thurston DE (2004) SJG-136 (NSC 694501) A novel rationally designed DNA minor groove interstrand cross-linking agent with potent and broad spectrum antitumour activity. Part 1: Cellular pharmacology, in vitro and initial in vivo antitumour activity. Cancer Res 64:6693–6699 2. Sarker D, Anderson D, Spanswick VJ, Davies S, Agarwal R, Aitken G, Kerr D, Hartley JA, Judson I, Middleton MR (2008) Preliminary results of a Cancer Research UK phase I trial combining the dinitrobenzamide prodrug CB1954 (tretazicar) and the NQO2 substrate EP-0152R (caricotamide) intraveneously (IV) every 3 weeks. J Clin Oncol 26(May 20 suppl):2505 3. Mayer A, Francis RJ, Sharma SK, Tolner B, Springer CJ, Martin J, Boxer GM, Bell J, Green AJ, Hartley JA, Cruickshank C, Wren J, Chester KA, Begent RH (2006) A phase I study of single administration of antibodydirected enzyme prodrug therapy with the recombinant anti-carcinoembryonic antigen antibody-enzyme fusion protein MFECP1 and a bis-iodo phenol mustard prodrug. Clin Cancer Res 12:6509–6516 4. Hedley D, Ogilvie L, Springer C (2007) Carboxypeptidase-G2-based gene-directed enzyme-prodrug therapy: a new weapon in the GDEPT armoury. Nat Rev Cancer 7:870–879 5. Palmer DH, Mautner V, Mirza D, Oliff S, Gerritsen W, van der Sijp JR, Hubscher S, Reynolds G, Bonney S, Rajaratnam R, Hull D, Horne M, Ellis J, Mountain A, Hill S, Harris PA, Searle PF, Young LS, James ND, Kerr DJ (2004) Virus-directed enzyme prodrug therapy: intratumoural administration of a replication-deficient adenovirus encoding nitroreductase to patients with resectable liver cancer. J Clin Oncol 22:1535–1537 6. McHugh PJ, Spanswick VJ, Hartley JA (2001) Repair of DNA interstrand cross-links: molecular mechanisms and clinical relevance. Lancet Oncol 2:483–490 7. Spanswick VJ, Craddock C, Sekhar M, Mahendra P, Shankaranarayana P, Hughes RG, Hochhauser D, Hartley JA (2002) Repair of DNA interstrand cross-links as a mechanism of clinical resistance to melphalan in multiple myeloma. Blood 100:224–229 8. Wynne P, Newton C, Ledermann JA, Olaitan A, Mould TA, Hartley JA (2007) Enhanced

9.

10.

11.

12.

13.

14.

15.

16.

17.

repair of DNA interstrand cross-linking in ovarian cancer cells from patients following treatment with platinum-based chemotherapy. Br J Cancer 97:927–933 Kohn KW, Ewig RAG, Erickson LC, Zwelling LA (1981) Measurement of strand breaks and cross-links by alkaline elution. In: Friedberg EC, Hanawalt PC (eds) DNA repair. Dekker, New York, pp 379–408 Hartley JM, Spanswick VJ, Gander M, Giacomini G, Whelan J, Souhami RL, Hartley JA (1999) Measurement of DNA cross-linking in patients on ifosfamide therapy using the single cell gel electrophoresis (Comet) assay. Clin Cancer Res 5:507–512 Ostling O, Johanson KL (1984) Microelectrophoretic study of radiationinduced DNA damages in individual mammalian cells. Biochem Biophys Res Commun 123:291–298 Webley SD, Francis RJ, Pedley RB, Sharma SK, Begent RH, Hartley JA, Hochhauser D (2001) Measurement of the critical DNA lesions produced by antibody-directed enzyme prodrug therapy (ADEPT) in vitro, in vivo and in clinical material. Br J Cancer 84:1671–1676 Corrie PG, Shaw J, Spanswick VJ, Sehmbi R, Jonson A, Mayer A, Bulusu R, Hartley JA, Cree I (2005) Phase I trial combining gemcitabine and treosulfan in advanced cutaneous and uveal melanoma patients. Br J Cancer 92:1997–2003 Lederman J, Gabra H, Jayson GC, Spanswick VJ, Rustin GJ, Jital M, James LE, Hartley JA (2007) Combination chemotherapy with carboplatin and gemcitabine in patients in platinum-resistant ovarian cancer chemotherapy – a phase II study demonstrating inhibition of DNA cross link repair by gemcitabine. Eur J Cancer Suppl 5:320 Puzanov I, Lee W, Berlin JD, Calcutt MW, Hachey DL, Vermeulen WL, Spanswick VJ, Hartley JA, Chen A, Rothenburg ML (2008) Final results of phase I and pharmacokinetic trial of SJG136 administered on a daily x3 schedule. J Clin Oncol 26, May 20 suppl., abstract 2504 Olive PL, Banath JP, Durand RE (1990) Heterogeneity in radiation-induced DNA damage and repair in tumour and normal cells measured using the “comet” assay. Radiat Res 122:86–94 Klaude M, Erikkson S, Nygren J, Ahnstrom G (1996) The comet assay: mechanisms and technical considerations. Mutat Res 363:89–96

Chapter 18 Measurement of DNA Interstrand Crosslinking in Naked DNA Using Gel-Based Methods Konstantinos Kiakos, Janet M. Hartley, and John A. Hartley Abstract Bifunctional DNA damaging agents continue to be the mainstay in various chemotherapeutic regimens used in the clinic. DNA interstrand crosslinks are considered to be the critical cytotoxic lesions for the biological activity of such agents. Gel-based electrophoretic assays can efficiently separate denatured singlestranded DNA from double-stranded, covalently-linked DNA resulting from the presence of an interstrand crosslink. The methods described here offer a simple way for the assessment of crosslinking efficiencies of bifunctional agents in both long fragments of DNA (e.g. 1–5 kb) and short oligonucleotide DNA duplexes. As the repair of interstrand crosslinks is a key determinant of cellular and clinical chemosensitivity, these methods can be useful for the characterization and isolation of site-directed adducted substrates for use in subsequent biochemical analysis of cellular recognition and DNA repair processes. Key words: Gel electrophoresis, Agarose gel, Polyacrylamide gel, Crosslinking drugs, DNA interstrand crosslinks, Plasmid DNA, Oligonucleotide duplexes, DNA repair

1. Introduction DNA damaging agents still remain at the core of several single agent or combination chemotherapeutic regimens. Despite a shift in cancer drug discovery towards the development of targeted agents for cancer therapeutics, conventional cytotoxic drugs are in many instances the only therapeutic option still available. Some of the most potent chemotherapy agents used in the clinic are bifunctional, possessing two reactive moieties capable of forming crosslinks. These agents, in general, tend to be considerably more cytotoxic than their monofunctional counterparts (1). DNA interstrand crosslinks, in particular, are believed to be the most critical lesions for exerting the observed biological activity of these drugs and the most challenging for the cellular DNA repair mechanisms. K.R. Fox (ed.), Drug-DNA Interaction Protocols, Methods in Molecular Biology, vol. 613, DOI 10.1007/978-1-60327-418-0_18, © Humana Press, a part of Springer Science + Business Media, LLC 1998, 2010

283

284

Kiakos, Hartley, and Hartley

Electrophoretic methodologies have been developed for the assessment of the ability of bifunctional agents to induce this type of lesions (2). The principle of these methods is based on the fact that the presence of a covalent interstrand crosslink can prevent complete denaturation of the two DNA strands. Electrophoresis can therefore separate permanently denatured single-stranded DNA from double-stranded, covalently-linked DNA. A simple agarose-based method described here allows the detection of interstrand crosslink formation in long fragments of linear DNA (e.g. linear plasmid DNA). The denaturation conditions of this method can be adjusted so that crosslinks of different nature can be detected (Figs. 1 and 2). The crosslinking potential of agents determined in plasmid DNA is relevant to their biological activity as it often correlates with in vitro cytotoxic potency and crosslinking efficiencies in cells (3–5). In addition to conventional clinical agents, novel bifunctional alkylating agents continue to emerge and to be evaluated in clinical trials. Some of these agents are rationally designed to target predetermined sequences. Polyacrylamide gel-based methods presented here employ synthetic oligonucleotides for the study of the interaction of these drugs with duplexes containing specific potential target binding sites (Fig. 3). 5¢-end-labeled duplexes can confirm sequence specificity, probe crosslinking reactivities within different sequence contexts, and offer an insight into the effect of base alterations flanking the site of interaction and spatial requirements such as reactive base pair span and the linker length of the agent (Fig. 4) (6, 7). The ability to repair interstrand crosslinks is a critical determinant of cellular sensitivity to these agents. The polyacrylamide gel-based methods employing non-labeled duplexes can be used for the characterization and isolation of DNA duplexes with a defined interstrand crosslink placed at a unique site (Fig. 5). These can serve, alone or incorporated into closed-circular DNA, as substrates for use in biochemical assays, which can monitor the recognition and processing of different interstrand crosslinks by cellular repair mechanisms.

2. Materials 2.1. Agarose Gel-Based Method for the Detection of DNA Interstrand Crosslinking in Long Fragments of Linear DNA

1. DNA. As an example, pUC19 plasmid DNA (2686 base pairs) is used. 2. Restriction enzymes and their appropriate buffers. BamHI (10 U/mL) (New England Biolabs (UK)) was used to digest pUC19 (see Note 1).

Measurement of DNA Interstrand Crosslinking in Naked DNA Using Gel-Based Methods

100

% Double-stranded (Crosslinked) DNA

c

285

80 60 40 20 0 0.1

1

10

100

Cisplatin concentration (mM)

Fig. 1. Autoradiographs of representative agarose gels showing DNA interstrand crosslinking by cisplatin in linear pUC19 plasmid DNA. Drug treatments were for 2 h at 37ºC. DS is the double-stranded undenatured control and SS is the singlestranded heat denatured control. All other samples were subjected to (a). heat or (b). alkali denaturation. (c). Doublestranded and single-stranded DNA bands in each lane were quantified by densitometry to obtain a dose response curve plotted as % double-stranded (crosslinked) DNA against the cisplatin concentration. With cisplatin, the result from gels in (a) and (b) is identical for both heat (solid line) and alkali (dotted line) denaturation. The increased mobility of doublestranded DNA at high cisplatin concentration is due to the formation of intrastrand crosslinks.

3. Bacterial alkaline phosphatase (BAP): 150 U/mL in 10 mM Tris-HCl, pH 8.0, 120 mM NaCl, 50% (v/v) glycerol (Invitrogen, Paisley, UK). 4. Dephosphorylation buffer (10×): 100 mM Tris-HCl, pH 8.0 (Invitrogen).

286

Kiakos, Hartley, and Hartley

100

% Double-stranded (Crosslinked) DNA

c

80 60 40 20 0 0.0001

0.001

0.01

0.1

1

10

100

SJG-136 concentration (mM)

Fig. 2. Autoradiographs of representative agarose gels showing DNA interstrand crosslinking by the pyrrolobenzodiazepine dimer SJG-136 in linear pUC19 plasmid DNA. Drug treatments were for 2 h at 37ºC. DS is the double-stranded undenatured control and SS is the singe-stranded heat denatured control. All other samples were subjected to (a) heat or (b) alkali denaturation. (c) Double-stranded and single-stranded DNA bands in each lane were quantified by laser densitometry to obtain a dose response curve plotted as % double-stranded (crosslinked) DNA against the SJG-136 concentration. With SJG-136, the result from gels A and B is different for heat (solid line) and alkali (dotted) denaturation due to some heat lability of the crosslinks.

5. Phenol:chloroform:isoamyl alcohol (25:24:1) (v/v/v) saturated with 10 mM Tris, pH 8.0, 1 mM EDTA (SigmaAldrich). 6. Chloroform (Sigma-Aldrich).

Measurement of DNA Interstrand Crosslinking in Naked DNA Using Gel-Based Methods

287

a 5’-GTACTATTTATAATAGATCTAAATATTA-3’ 3’-ATAAATATTATCTAGATTTATAATGATC-5’ b 5’-GTACTATTTATAATTGCATAATATTATTA-3’ 3’-ATAAATATTAACGTATTATAATAATGATC-5’ Fig. 3. Oligomer duplexes incorporating a single, centrally located interstrand crosslink site for (a) SJG-136 at 5¢-GATC-3¢ and (b) Cisplatin at 5¢-GC-3¢ were designed. The crosslinked duplexes isolated from gels (a) and (b) in Fig. 5 were successfully ligated in plasmid DNA.

Fig. 4. Autoradiograph showing interstrand DNA crosslinking in 5 mg of the 5¢-end radiolabeled oligonucleotide duplex A (Fig. 3) following incubation at the denoted concentrations with SJG-136, at 37ºC overnight. The crosslinked DNA duplex has a lower electrophoretic mobility than the denatured, single-stranded DNA. The latter is electrophoresed as control beside the drug treated samples to ensure that non crosslinked DNA is fully denatured, hence any double-stranded products are the result of the presence of drug-induced interstrand crosslinks.

7. Sodium acetate buffer: 3 M, pH 7.2. 8. Industrial Methylated Spirit (IMS) (Surgipath Europe Limited, Bretton, UK). 9. 95% and 70% Ethanol. 10. Lyophilizer or vacuum dryer.

288

Kiakos, Hartley, and Hartley

Fig. 5. (a) UV shadowing of 50 mg of oligonucleotide duplex A (Fig. 3) treated with SJG-136 at the denoted concentrations at 37ºC, overnight. 0 is the untreated control. DS corresponds to the crosslinked species and SS to the denatured, single-stranded oligonucleotides. (b) UV shadowing of 250 mg of oligonucleotide duplex B (Fig. 3) treated with cisplatin at the concentrations shown at 22ºC, overnight.

Measurement of DNA Interstrand Crosslinking in Naked DNA Using Gel-Based Methods

289

11. T4 polynucleotide kinase (PNK): 10 U/mL in 50 mM Tris-HCl, pH 7.6, 25 mM KCl, 5 mM DTT, 0.1 mM ATP, 0.2 mg/mL BSA, 50% glycerol (v/v) (Invitrogen). 12. Forward reaction buffer (5×): 350 mM Tris-HCl, pH 7.6, 50 mM MgCl2, 500 mM KCl, 5 mM 2-mercaptoethanol, 350 mM ADP (Invitrogen). 13. Adenosine-5¢-triphosphate [g-32P], 9.25 MBq, 6000 Ci/ mmol (Perkin Elmer, Boston, MA, USA). 14. Ammonium acetate buffer: 7.5 M. 15. TEOA buffer: 25 mM triethanolamine, 1 mM Na2EDTA, pH 7.2. 16. Alkylation stop solution: 0.6 M sodium acetate, 20 mM Na2EDTA, 100 mg/mL tRNA (see Note 2). 17. Non-denaturing loading buffer: 6% sucrose and 0.04% bromophenol blue in distilled and deionized water. 18. Strand separation buffer: 30% dimethyl sulphoxide, 1 mM EDTA, 0.04% bromophenol blue and 0.04% xylene cyanol. 19. Alkali denaturation buffer (6% sucrose, 0.4% sodium hydroxide, 0.04% bromophenol blue). 20. Agarose (Invitrogen). 21. TAE agarose gel and running buffer: 40 mM Tris, 20 mM acetic assay, 2 mM EDTA, pH 8.1. 22. Horizontal gel electrophoresis unit e.g. AGT4 submarine gel tank (VWR International Limited, Lutterworth, UK). Typically, for plasmid DNA a 20 cm × 20 cm × 0.5 cm gel was used. 23. Power supply e.g. VWR Power supply 300 V 500 MA. 24. 3 MM filter paper (Whatman, Maidstone, UK). 25. DE 81 filter paper (Whatman). 26. Saran wrap. 27. Standard vacuum heated gel drying unit. 28. Autoradiography cassettes. 29. X-ray film and developing facilities or imaging densitometer. 2.2. Polyacrylamide Gel-Based Method for the Detection and Analysis of DNA Interstrand Crosslinking in DNA Oligonucleotide Duplexes

1. HPSF (High purity salt free) purified oligonucleotides approximately 20–30 bases (0.05-mmol scale) (see Note 11). 2. TEOA buffer: 25 mM triethanolamine, 1 mM Na2EDTA, pH 7.2. 3. Sodium acetate: 3 M, pH 5.2. 4. 95% ethanol. 5. T4 polynucleotide kinase (PNK): 10 U/mL in 50 mM TrisHCl, pH 7.6, 25 mM KCl, 5 mM DTT, 0.1 mM ATP, 0.2 mg/mL BSA, 50% glycerol (v/v) (Invitrogen).

290

Kiakos, Hartley, and Hartley

6. Forward reaction buffer (5×): 350 mM Tris-HCl, pH 7.6, 50 mM MgCl2, 500 mM KCl, 5 mM 2-mercaptoethanol, 350 mM ADP (Invitrogen). 7. Adenosine 5¢-triphosphate [g-32P], 9.25 MBq, 6000 Ci/ mmol (Perkin Elmer). 8. Bio-spin disposable chromatography columns (Biorad Laboratories, UK). 9. Biogel-P6 spin column solution: 8% P6-biogel (w/v) (Biorad), 0.02% sodium azide (w/v) in distilled and deionized water. 10. TE buffer: 10 mM Tris-HCl, pH 7.6, and 1 mM EDTA. 11. Glycogen (20 mg/mL) (Roche diagnostics). 12. Ultrapure Sequagel™ Sequencing system comprising concentrate (19:1 acrylamide: bisacrylamide, 8.3 M urea), diluent (8.3 M Urea) and buffer (10× TBE, 8.3 M urea pH 8) solutions (National Diagnostics, Hull, UK) 13. Vertical slab gel electrophoresis unit e.g. Sequi-Gen® GT Sequencing Cell with glass plates 21 × 50 cm, 0.4 mm apart (BioRad). 14. 150 mL syringe and tubing. 15. High voltage power supply e.g. Power pac 3000 (Biorad). 16. Silanization Solution II (Fluka Chemicals). 17. Ammonium persulphate (Sigma). 18. Tetramethylenediamine (TEMED) (Sigma). 19. TBE buffer: 89 mM Tris base, 89 mM Boric acid, 2 mM EDTA (disodium salt), pH 8.3. 20. Formamide loading buffer (96% (v/v) formamide (deionized), 20 mM EDTA, 0.03% (w/v) bromophenol blue and 0.03% (w/v) xylene cyanol). 21. 3MM filter paper (Whatman, Maidstone, UK). 22. DE 81 filter paper (Whatman). 23. Saran wrap. 24. Standard vacuum heated gel drying unit. 25. Autoradiography cassettes. 26. X-ray film and developing facilities or imaging densitometer. 2.3. Isolation of Double Stranded Oligonucleotide Containing a Single Crosslink

1. Complementary HPSF purified oligonucleotides approximately 20–30 bases. 2. TEOA buffer: 25 mM triethanolamine, 1 mM Na2EDTA, pH 7.2. 3. 95% ethanol.

Measurement of DNA Interstrand Crosslinking in Naked DNA Using Gel-Based Methods

291

4. Ultrapure Sequagel™ Sequencing system system (National Diagnostics, UK) 5. Vertical slab gel electrophoresis unit e.g. Sequi-Gen® GT Sequencing Cell with glass plates 21 × 50 cm, 0.4 mm apart (BioRad). 6. 150 mL syringe and tubing. 7. High voltage power supply e.g. Power pac 3000 (Biorad). 8. Silanization Solution II (Fluka Chemicals). 9. Ammonium persulphate (Sigma). 10. Tetramethylenediamine (TEMED) (Sigma). 11. TBE buffer: 89 mM Tris base, 89 mM Boric acid, 2 mM EDTA (disodium salt), pH 8.3. 12. Formamide loading buffer (96% (v/v) formamide (deionized), 20 mM EDTA, 0.03% (w/v) bromophenol blue and 0.03% (w/v) xylene cyanol) with and without the marker dyes. 13. Saran wrap. 14. Gel elution buffer: Ammonium acetate 0.5 M, Magnesium acetate 10 mM, EDTA 1 mM pH 8.0, SDS 1% 15. Aluminium backed silica gel 60 F254 TLC plate 20 × 20 cm (Machery Nagel, Duren, Germany) 16. Handheld shortwave UV lamp (254 nm).

3. Methods 3.1. Agarose GelBased Method for the Detection of DNA Interstrand Crosslinking in Long Fragments of Linear DNA 3.1.1. Linearization of Plasmid DNA

1. Linearize 20 mg of the closed circular pUC19 plasmid DNA with the restriction enzyme BamHI (10 U) in its appropriate buffer, incubating at 37 ºC for 45 min. 2. Terminate the restriction reaction by adding 0.1 vol 3 M sodium acetate, and precipitate the DNA with 3 vol of 95% ethanol. 3. Vortex and freeze the samples in a dry ice/IMS bath for 15 min. 4. Centrifuge at top speed (16,000 g) in a cooling centrifuge for 15 min. 5. Remove the supernatant and wash the pelleted DNA with 2 × 200 mL of 70% (room temperature) ethanol. 6. Dry under vacuum. 7. Resuspend the dry DNA pellet in an appropriate volume of distilled and deionized water to provide a concentration of 0.5 mg/mL.

292

Kiakos, Hartley, and Hartley

3.1.2. Dephosphorylation of Linearized DNA

1. Dephosphorylate the linearized DNA with bacterial alkaline phosphatase (3 U/mg) in the dephosphorylation buffer provided and in a final volume of 100 mL of distilled water, at 65ºC for 1 h. 2. Allow the mixture to cool at room temperatute. 3. Extract the dephosphorylated DNA with phenol:chloroform:isoamyl alcohol (25:24:1).

2

vol

of

4. Vortex, spin at top speed (16,000 g) for 5 min, and transfer the upper aqueous layer to another Eppendorf tube. 5. Vortex with an equal volume of chloroform, spin, and collect again the aqueous phase in a fresh tube. 6. Back extract the organic layers with 100 mL of distilled water, and combine the aqueous layers of the Eppendorfs in steps 4 and 5. 7. Precipitate with sodium acetate and 95% ethanol, centrifuge and vacuum to dryness as described in steps 2–6 in Subheading 3.1.1. 8. Resuspend the DNA in 40 mL of distilled and deionized water providing a stock of linearized and dephosphorylated DNA at a concentration of 5 mg/10mL and store at −20ºC. 3.1.3. 5¢-End Labeling of Plasmid DNA

1. 5¢-end label 5 mg of the linearized and dephosphorylated DNA (10 mL of the stock of step 8 in Subheading 3.1.2) with [g-32P] ATP (10 mCi), T4 PNK (2 U/mg) and 1× forward reaction buffer in a final volume of 20 mL, with the addition of distilled and deionized water. 2. Incubate the kinase reaction mixture at 37ºC for 45 min. 3. Add an equal volume of 7.5 M ammonium acetate, and precipitate the DNA with 3 vol 95% ethanol (see Note 3). 4. Freeze, centrifuge, and dry as in steps 3, 4, and 6 in Subheading 3.1.1. 5. Resuspend the dry DNA pellet in 50 mL of distilled and deionized water. 6. Precipitate the DNA a second time with 0.1 vol of 3 M sodium acetate and 3 vol 95% ethanol, freeze, centrifuge, and vacuum or lyophilize to dryness. 7. Resuspend the DNA in 40 mL of distilled and deionized water yielding a concentration of 125 ng/mL.

3.1.4. Drug-DNA Incubations

1. Dilute 8 mL of the 5¢-end labeled DNA (125 ng/mL) in 100 mL of TEOA buffer, allowing for 10 experimental points, each containing 10 ng of DNA per 10 mL of buffer.

Measurement of DNA Interstrand Crosslinking in Naked DNA Using Gel-Based Methods

293

2. Dilute a stock solution of drug dissolved in the appropriate solvent, in TEOA buffer. 3. For drug treated samples, add the appropriate drug dilution volume to the 10 mL of DNA. Make all samples up to a final volume of 50 mL with TEOA buffer, per experimental point. 4. Incubate the DNA with a range of drug concentrations at 37ºC for the appropriate time (see Note 4). 5. Terminate the drug-DNA reactions by addition of an equal volume of alkylation stop solution, followed by 3 vol of 95 % ethanol. 6. Follow steps 3–6 (see Subheading 3.1.1). 7. Resuspend the undenatured double-stranded control samples in 10 mL of non-denaturing loading buffer. Dissolve the drugtreated samples and the single-stranded controls to be subjected to appropriate denaturation conditions, in an equal volume of either strand separation buffer or alkali denaturation buffer (for heat or alkali denaturation, respectively) (see Note 5). 8. Heat denature the relevant samples by incubating at 90ºC for 3 min. Chill immediately in an ice water bath to prevent reannealing. Samples for alkali denaturation should be vortexed vigorously for 3 min prior to gel loading. Control non-denatured samples are loaded directly on the agarose gel. 3.1.5. Agarose Gel Electrophoresis

1. Prepare a 0.8% neutral agarose gel in TAE buffer. For plasmid DNA, a 20 cm × 25 cm × 0.5 cm gel was prepared and horizontally submerged in the same running buffer. 2. Load the samples and electrophorese at 40 V overnight. Alternatively, electrophoresis can be carried out for less time at a higher voltage.

3.1.6. Autoradiography

1. Transfer gels onto one layer of Whatman 3 MM and one layer of DE 81 filter paper. Cover with Saran wrap. 2. Dry at 80ºC for 2 h on a gel drier. 3. Expose X-ray film to the dried gel to visualize the DNA fragments. Exposure times vary, depending on the amount of radioactivity. Overnight exposure of the gel at room temperature is usually sufficient to provide sharp images of satisfactory intensity (see Note 6). Typical examples are shown in Figs. 1a and 2a. 4. Quantify film bands using an imaging densitometer (see Notes 7–10).

294

Kiakos, Hartley, and Hartley

3.2. Polyacrylamide Gel-Based Method for the Detection and Analysis of DNA Interstrand Crosslinking in DNA Oligonucleotide Duplexes 3.2.1. Oligonucleotide Annealing 3.2.2. Oligonucleotide Labeling

1. Reconstitute each of the two oligonucleotides required to make the target duplex in distilled and deionized H2O to a concentration of, e.g., 1 µg/µL (see Notes 12 and 13). 2. Anneal the oligonucleotides by mixing equal volumes of each (e.g. 2.5 mg) in a total volume of 20 mL in TEOA buffer, and heat at 90ºC for 2 min in a heating block. Transfer the samples to a preheated waterbath set at 90ºC and switch it off, allowing them to slowly cool and fully anneal (see Note 14 and 15).

1. 5¢-end radiolabel e.g. 5 mg of annealed duplex with [g-32P] ATP (10 mCi), T4 PNK (2 U/mg) and 1× forward reaction buffer in a final volume of 20 mL, with the addition of distilled and deionized water (see Notes 16). 2. Incubate the kinase reaction mixture at 37ºC for 45 min. 3. Make up a total volume of 100 mL with the addition of TE buffer. 4. Load the kinase reaction mixture to a biogel spin column (see Note 17). 5. Spin for 5 min at 1,200 g to elute the end-labeled DNA. 6. Collect the radioactive probe.

3.2.3. Drug Treatment

1. Drug treat 10 ml of the eluted probe (~0.5 mg) for the appropriate time in a final volume of 50 mL of TEOA buffer (see Note 18). 2. Add 0.1 vol 3 M sodium acetate, and precipitate the DNA with 3 vol of 95% ethanol (see Note 19). 3. Vortex and freeze the samples in a dry ice/IMS bath for 15 min. 4. Centrifuge at top speed (16,000 g) in a cooling centrifuge for 15 min. 5. Remove the supernatant and dry under vacuum (see Note 20). 6. Lyophilize to dryness.

3.2.4. Denaturing Polyacrylamide Gel Electrophoresis

1. Prepare a 20% denaturing polyacrylamide gel. Polymerize the Ultrapure Sequagel™ Sequencing system solutions mixture used in this study, by adding 0.32 mL of freshly prepared 25% ammonium persulphate and 40 mL of TEMED and mixing immediately prior to pouring the gel. 2. Cast the gel using a syringe (applicable for the Sequi-Gen® GT Sequencing Cell) (see Note 21). 3. Insert a 16-well comb at the top of the gel and allow to polymerize.

Measurement of DNA Interstrand Crosslinking in Naked DNA Using Gel-Based Methods

295

4. Pre-run the gel in TBE buffer for 30 min, at 1,200 V. 5. Reconsitute the dry samples in 7 mL of formamide loading buffer and load directly onto the gel (see Notes 22 and 23). 6. Electrophorese at 1,200 V for about 5 h (or until the bromophenol blue marker has migrated 20–25 cm) to allow sufficient separation of the single-stranded and double-stranded DNA species (see Note 24). 7. Transfer the gel onto Whatman 3 MM paper, supported by a layer of DE 81 filter paper and cover with Saran wrap. 8. Dry on gel dryer (see Note 25). 3.2.5. Autoradiography and Densitometry

Expose X-ray film to the dry gel overnight at room temperature. The crosslinked DNA duplex has reduced mobility compared to the corresponding labeled denatured single strands (e.g. Fig. 4) and can be quantified using densitometry. Alternatively, the gel can be placed in contact with a phosphorimage plate for 2 h and scanned with a phosphorimager.

3.3. Isolation of Double Stranded Oligonucleotide Containing a Single Crosslink

1. Reconstitute each of the complementary oligonucleotides in H2O to yield a concentration of 10 µg/µL (see Notes 11–13 and 26).

3.3.1. Oligonucleotide Drug Treatment

2. Anneal the oligonucleotides as in step 2 in Subheading 3.2.1 (see Notes 14 and 15). 3. Drug treat the DNA duplexes (e.g. 5–250 mg) in a total volume of 100 mL TEOA at 37ºC for appropriate time (see Notes 18 and 27). 4. Precipitate the DNA with addition of 0.1 vol of 3 M sodium acetate and 3 vol of 95% ethanol. 5. Freeze in a dry ice/IMS bath for 20 min. 6. Centrifuge at 16,000 g for 15 min at 4ºC. 7. Remove the supernatant and dry (see Note 28). 8. At this point the samples can be stored at −80ºC to be run on the denaturing gel at a later date.

3.3.2. Denaturing Gel Separation

1. Cast and pre-run a 20% polyacrylamide denaturing gel (see Subheading 3.2.4). 2. In the first well, load 10 mL of formamide loading buffer containing the marker dyes to monitor migration during electrophoresis. 3. Next, load a control untreated sample to act as a marker of the single-stranded DNA species and a control drug-treated sample to act as a marker of the double-stranded DNA species. Allow a space of 1–2 wells between the two controls. These samples should be dissolved in dyeless formamide buffer (see Note 29)

296

Kiakos, Hartley, and Hartley

4. Load the drug treated samples for elution in the remaining wells, allowing enough space between these and the two controls. These samples should also be dissolved in dyeless formamide loading solution. 5. Run the gel at 1200 V until the bromophenol blue marker dye has migrated 20–25 cm from the well (approximately 5 h) (see Note 24). 6. Switch off the power, disconnect the electrodes, and remove the gel setup. Lay the setup on the bench, and gently remove the upper plate leaving the gel intact on the lower plate (see Note 21). 7. Cover the gel with Saran wrap, and gently peel it off the glass plate. It is best to start at a corner, and slowly peel back across and then down the gel. 8. Lay the gel with the Saran wrap side down, and cover the exposed side with Saran wrap. 3.3.3. Visualizing and Isolating the Crosslinked Products

1. Place an aluminium TLC plate with fluorescent indicator under the wrapped gel at the area where the DNA samples should be located, as identified by comparison to formamide marker in the first well (see Note 30). 2. Cover the samples for elution to prevent DNA damage. Shine the UV light on the rest of the gel to visualize the control samples. 3. DNA is identified as a shadow cast on the TLC plate under a shortwave UV lamp. The untreated control should present as one band corresponding to the denatured single-stranded DNA. The drug treated control is expected to present as two bands (if not fully crosslinked). The one migrating slower should correspond to the double-stranded, crosslinked species. 4. Mark the position of the crosslinked product of the treated control on the gel. Turn off the UV light before uncovering the rest of the gel. 5. Using the marked area of the control as a guide, identify the crosslinked species of the treated samples. 6. Cut out the areas of gel containing the crosslinked product with a scalpel, remove the Saran wrap, and place the gel slice in an Eppendorf tube. 7. Crush the piece of the gel to powder using a pipette tip, and add 1 mL of gel elution buffer. Mix well (see Note 31). 8. Incubate at 37ºC overnight. 9. Centrifuge at 16,000 g for 10 min and remove the supernatant to a fresh Eppendorf tube.

Measurement of DNA Interstrand Crosslinking in Naked DNA Using Gel-Based Methods

297

10. Precipitate the DNA by adding 0.1 vol of 3 M sodium acetate, 3 vol 95% ethanol and placing in a dry ice/ethanol freezing in a dry ice/IMS bath for 20 min. 11. Centrifuge at 16,000 g for 10 min and lyophilize to dryness (see Note 28). 12. Store dry at −20ºC until use (see Note 32).

4. Notes 4.1. Agarose GelBased Method

1. The restriction endonucleases considered should have a unique restriction site on the plasmid DNA to be linearized. Such enzymes can cleave the substrate DNA with varying efficiencies. 1 U/mg of BamHI efficiently cleaves supercoiled pUC19 under standard reaction conditions (as opposed to 5 U/mg required by HindIII or BspMI which even at 100 U/mg can achieve less than 10% cleavage). Complete digestion can be confirmed by electrophoresis of a small amount (1 mg) of the linearized plasmid and an equal amount of undigested closed-circular control on a 1% ethidium stained agarose minigel in TAE buffer. DNA is dissolved in nondenaturing loading buffer, loaded onto the gel and electrophoresed for 1 h at 75 V. Bands are visualized under UV. 2. Inclusion of tRNA in the stop solution is important as it facilitates DNA precipitation. 3. As polynucleotide kinase is inhibited by ammonium ions, precipitation steps prior to radiolabeling must only be carried out with sodium acetate. 4. The rate of crosslink formation varies markedly between different agents. For example, crosslinking agents such as the clinically used Busulphan produce low levels of crosslinks that form slowly, and are still increasing at 24 h. In contrast, crosslinks produced by mechlorethamine form within 1 h of exposure. Incubation times must be therefore adjusted according to the reactivity of the agent under investigation, as established by time course experiments. 5. The choice of appropriate denaturation conditions depends on the crosslinking agent under investigation. Although heat denaturation is most readily used, particularly for agents which crosslink via purine-N7 positions, some agents, e.g. pyrrolobenzodiazepine dimers, which crosslink through guanine-N2 positions induce interstrand crosslinks, which show some lability to heat treatments. Use of heat denaturation can therefore result in inaccurate estimate of the extent

298

Kiakos, Hartley, and Hartley

and efficiency of crosslinking (see Fig. 2). Other agents e.g. CC-1065-type bifunctional analogues such as bizelesin, which produce crosslinks through adenine-N3 positions, upon thermal denaturation produce DNA single-strand breaks due to the release of the covalently modified purines, in which case the sole presence of single-stranded DNA species can be misinterpreted as inability of those agents to crosslink DNA. Crosslinks of heat-labile nature should therefore be assessed with this assay by alkali denaturation. Finally, in rare cases, drugs may induce alkali-labile sites, necessitating the use of heat denaturation. 6. Autoradiographs can alternatively be obtained after shorter exposure of film with an intensifying screen, for 2–4 h at −70ºC, at the expense of the sharpness of the image. 7. Percentage crosslinking in each lane is calculated by measuring the total amount of DNA (summed density for the double-stranded and single-stranded bands) relative to the amount of crosslinked DNA (density of double-stranded band alone). Such quantitation provides a measure of crosslinking in a given DNA sample. The determined percentage level of crosslinked DNA can be then plotted against a range of drug concentrations providing a dose-response curve (see Figs. 1b and 2b). From this the XL50 value for a specific agent (the concentration of agent required for 50% crosslinking of plasmid DNA) can be extrapolated and the relative crosslinking efficiencies of various agents, under the conditions employed, compared. 8. Alternatively, the percentage level of crosslinked DNA can be plotted against time, providing a measure of the rate of formation of DNA interstrand crosslinks by an agent. In this case, drug treatments are continuous at 37ºC, and aliquots from a single reaction mixture are removed (and stopped) at relevant time intervals. Further processing of these samples proceeds as described in Subheading 3.1.4. When performing this experiment, concentrations which induce 80%), this maintenance is the result of the expression of the telomerase specialized reverse transcriptase enzyme. Telomerase catalyses the synthesis of TTAGGG repeats during replication with the effect that telomeric DNA length remains constant in cancer cells. The enzyme has been validated as a therapeutic target (4) by a variety of approaches (notably using antisense, siRNA, dominant negative mutants or catalytic inhibitors), which have shown that inhibition of telomerase results in telomere shortening, and eventual senescence and selective cancer cell death. Telomerase function and its significance as an anti-cancer target have been extensively reviewed; especially recommended reviews are (5, 6). The concept that small molecules binding to the singlestranded overhang of human telomeric DNA can inhibit the activity of the telomerase enzyme was first demonstrated in vitro using a small library of amidoanthraquinone derivatives (7) with an amidoanthraquinone molecule stabilising the quadruplex. A large number of small molecules have subsequently been investigated as telomeric quadruplex ligands (8, 9). Cell-based studies have shown that they inhibit telomerase, resulting in telomere shortening and senescence (7, 8). An initially unexpected finding was that they produce short-term growth arrest, as a consequence of their ability to competitively displace bound telomeric proteins, especially hPOT1 and hTERT at the single-strand overhang (9–14). This displacement effectively exposes telomeric DNA, invoking a DNA damage response and consequent apoptosis. We describe here a cascade of assays currently in place in our laboratory (14–17), which enables a library of compounds, synthetic or natural products, to be systemativcally examined for evidence that they are active as quadruplex-binding telomere targeting agents. These assays comprise: ●฀

●฀

●฀

●฀

●฀

Acute and long-term cytotoxicity: Effects on a panel of cancer cells and on normal cells, both to determine concentrations required to inhibit 50% of cell growth (IC50 values) and to determine whether at sub-IC50 concentrations cell growth can be inhibited following incubation, which is characteristic of telomerase inhibition and telomere uncapping. Quadruplex affinity: Selectivity for quadruplex vs. duplex DNA using a high-throughput assay that exploits the Fluorescence Resonance Energy Transfer (FRET) effect with quadruplex DNA (18). Inhibition of telomerase catalytic activity. The LIG-TRAP protocol is described (16), which ensures that the second PCR part of this assay is uncontaminated by ligand. Telomere length determination using Southern blotting – see Fig. 1 for an illustration of telomere shortening following long-term exposure. Induction of senescence using a b-galactosidase assay

An Evaluation Cascade for G-Quadruplex Telomere Targeting Agents

305

Fig. 1. Telomere length analysis of A2780 cells treated with the experimental drug BRACO19 for up to 5 weeks.

The reader may refer to the relevant literature for information on other important assays, especially for displacement of telomerecapping proteins hPOT1 and hTERT (11–13, 19), and for in vivo studies of anti-tumour activity (20, 21).

2. Materials 2.1. Cell Lines and Protein Extraction

The human ovarian cancer cell line A2780 was purchased from American Type Cell Culture and maintained in Dulbecco’s Modified Eagles Media containing 10% foetal bovine serum (Invitrogen, UK), 0.5 mg/ml hydrocortisone (Acros Chemicals, Loughborough, UK), 2 mM L-glutamine (Invitrogen, Netherlands), and nonessential amino acids 1× (Invitrogen, Netherlands) at 37°C, 5% CO2.

306

Gunaratnam and Neidle

Protein was extracted from exponentially growing cells and was used as the enzyme source. Total cell protein extraction and quantification was carried out using the Bradford assay. Cells were lysed in lysis buffer [50 mM HEPES (pH 7.4), 250 mM NaCl, 0.1% NP40/IGEPAL and protease cocktail inhibitors] on ice for 30 min (see Note 1). Samples were then centrifuged at 14,000 rpm for 15 min at 4°C and lysates were stored at −80°C. Bradford assay was performed by setting up a standard curve with BSA (concentration range of BSA from 1 to 30 µg/ml). Samples were diluted (1:200) in water and absorbance of both standards and samples in duplicates were read at 596 nm. 2.2. Ligands

Ligands in general should have their purity analytically confirmed. 10 mM stock solutions of the free bases are made in 100% DMSO followed by a further dilution to 1 mM in distilled water, adding 1% HCl. These 1 mM stock solutions are always freshly prepared before use in the assays.

2.3. Buffers and Reagents

1. TE buffer: 10 mM Tris–HCl pH 8.0 containing 1 mM EDTA 2. FRET buffer: 60 mM KCl, Kcacodylate, pH 7.4 3. TRAP buffer: 20 mM Tris–HCl, pH 8.3, containing 68 mM KCl, 1.5 mM MgCl2, 1 mM EGTA, 0.05% v/v Tween-20. 4. Lysis buffer: 10 mM Tris–HCl, pH 7.5, containing 1 mM MgCl2, 1 mM EGTA, 0.5% CHAPS, 10% glycerol, 5 mM b-mercaptoethanol, 0.1 mM AEBSF. 5. EB Buffer: 10 mM Tris–HCl, pH 8.5. 6. QIA quick nucleotide purification kit (Qiagen).

3. Methods 3.1. The FRET Assay

FRET oligonucleotides (Eurogentec Ltd., U.K.) have the sequences: F21T, 5¢FAM-d[G3(T2AG3)3]-TAMRA3¢; duplex, 5¢FAM-d [(TA)2GC(TA)2T6(TA)2GC(TA)2]-TAMRA3¢, where FAM is 6-carboxyfluoresein and TAMRA 6-carboxytetramethylrhodamine. 1. The oligonucleotide is suspended in FRET buffer at a concentration of 400 nM and heated to 85°C for 10 min prior to cooling to room temperature. 2. It is distributed (50 ml) across a 96 well RT-PCR plate (BioRad) to which ligand is added (50 ml; stored as a 20 mM DMSO stock, −20°C; diluted to 1 mM in HPLC grade DMSO) to afford the required concentration. 3. FRET buffer is used as a negative control.

An Evaluation Cascade for G-Quadruplex Telomere Targeting Agents

307

4. DNA melting is assessed with a MJ Research Opticon DNA Engine Continuous Fluorescence Detector exciting at 450– 495 nm. This is an RT-PCR machine, and a number of others are available that are suitable for this purpose. 5. Fluorescence values are recorded at 515–545 nm at 0.5°C intervals as the plate is heated from 30°C to 100°C. 6. The data are analyzed with the Origin 7.0 software package (Origin Lab Corp., Northampton, MA). 7. Melting curves can be fitted to sigmoid curves prior to analysis. 8. The change in melting temperature at 1 mM ligand concentration (DTm1mM) is calculated from four experiments by subtraction of the averaged negative control from the averaged 1 mM ligand melting temperature ± the maximum standard deviation (sd). 9. Competition Assay: This is performed as described above for the G-quadruplex experiment but with addition of varying concentrations of calf thymus DNA (Sigma-Aldrich, UK). 10. Concentrations expressed as G-tetrad:base pair ratios. The experiments were run at the ratios 1:1, 1:10, 1:100 and 1:300. 11. The percentage retained stabilization is calculated from three experiments, and normalized to the DTm1mM for that ligand with no CT-DNA competitor (100%) ± normalized sd. 3.2.The LIG-TRAP Telomerase Assay (see Fig. 2)

The TRAP assay has been modified from a two-step to the threestep TRAP-LIG procedure: step 1, initial primer elongation by telomerase and addition of ligand; step 2, subsequent removal of the ligand; step 3, PCR amplification of the products of telomerase elongation. 1. Step 1 Prepare a master mix containing the TS forward primer (0.1 mg; 5’-AAT CCG TCG AGC AGA GTT-3’), TRAP buffer, bovine serum albumin (0.05 mg), dNTPs (125 mM each), and protein extract (1000 ng/sample) diluted in lysis buffer. 2. The PCR master mix is added to tubes containing freshly prepared ligand at various concentrations and to a negative control containing no ligand. 3. The initial elongation step is carried out for 10 min at 30°C, followed by 94°C for 5 min and a final maintenance of the mixture at 20°C. 4. Step 2 To purify the elongated product and to remove the bound ligands, the QIA quick nucleotide purification kit (Qiagen) is used according to the manufacturer’s instructions. This kit is especially designed for the purification of both double and single-stranded oligonucleotides from 17 bases in length. It employs a high-salt buffer to bind the negatively

308

Gunaratnam and Neidle

Fig. 2. Inhibition of telomerase enzyme activity determined by the LIG-TRAP telomerase assay. Fig 2A (a) shows inhibition of telomerase activity in A2780 human ovarian protein extract by the known telomerase inhibitor AZT-triphosphate. Almost complete inhibition of telomerase is evident at a 50 µM concentration of compound. Fig 2B (b) shows LIG-TRAP gel of the inactive counterpart, the parent molecule AZT itself, where no inhibition of telomerase is seen up to 50 µM. Negative and positive control lanes are at left- and right-hand sides of each gel, respectively.

charged oligonucleotides to the positively charged spin-tube membrane through centrifugation, so that all other components, including positively charged and neutral ligand molecules would be eluted. PCR-grade water is then used (rather than the manufacturers’ recommendation of an ethanolbased buffer) to wash any impurities away before elution of the DNA using a low-salt concentration solution (see Note 2). 5. The purified samples are freeze-dried and then re-dissolved in PCR-grade water at room temperature prior to the second amplification step (see Notes 3 and 4). 6. Step 3 The purified extended sample is then subject to PCR amplification 7. A second PCR master mix is prepared consisting of ACX reverse primer (1 mM; 5¢-GCGCGG[CTTACC]3CTAACC-3¢), TS forward primer (0.1 mg; 5¢-AAT CCG TCGAGCAGAGTT-3¢), TRAP buffer, BSA (5 µg), 0.5 mM dNTPs, and 2U of TAQ polymerase (RedHot, ABgene, Surrey, UK).

An Evaluation Cascade for G-Quadruplex Telomere Targeting Agents

309

8. An aliquot of 10 µl of the master mix is added to the purified telomerase extended samples and amplified for 35 cycles of 94°C for 30 s, at 61°C for 1 min and 72°C for 1 min. 9. Samples are separated on a 12% PAGE and visualised with SYBR green (Aldrich) staining (see Note 5). 10. Gels are quantified using a gel scanner and gene tool software (Sygene, Cambridge, UK). 11. Drug samples are normalised against positive control containing protein only. 12. All samples are corrected for background by subtracting the fluorescence reading of negative controls. Data for all ligands are collected at a range of concentrations in order to obtain dose–response curves from which EC50 values (the concentration required for 50% enzyme inhibition, corresponding to a 50% decrease in total integrated ladder intensity) can be obtained by inspection. Graphs may be fitted to dose–response curves using, for example, the Origin 6.0 software package. 3.3. Sulforhodamine B short-term cytotoxicity assay

1. Cells are seeded (4,000 cells/wells) into the wells of 96-well plates in DMEM and incubated overnight to allow the cells to attach (see Notes 6 and 7). 2. Subsequently, cells are exposed to freshly made solutions of ligand at increasing concentrations and incubated for a further 96 h. 3. Following this, the cells are fixed with ice-cold trichloroacetic acid (TCA) (10%, w/v) for 30 min (see Note 8) and stained with 0.4% Sulforhodamine B (SRB) dissolved in 1% acetic acid for 15 min. All incubations are carried out at room temperature, except for the TCA incubation, which is at 4°C. 4. The IC50 value, the concentration required to inhibit cell growth by 50%, can be determined from the mean absorbance at 540 nm for each ligand concentration expressed as a percentage of the control untreated well absorbance.

3.4. Sub-Cytotoxic Long-Term Growth Inhibition Assay (see Fig. 3)

1. 1 × 105 cells are seeded in 75 cm3 tissue culture flasks and exposed to appropriate concentrations of ligands as single agents (or in combination) (see Note 9). 2. The concentrations are chosen according to individual IC50 values as determined in the SRB assay. 3. Cells are grown in a final volume of 10 ml DMEM and incubated as described previously. 4. Cells are exposed to ligands twice a week by replacing them with fresh media containing drug on day 3. 5. On day 7, media is removed and cells are washed with PBS once and trypsinised using 3 ml of trypsin.

310

Gunaratnam and Neidle

Accumulative Population Doublings

30

VC 2µM BRACO19 3µM BRACO19

25

20

15

10

5

0 0

1

2

3

4

Time (weeks) Fig. 3. Accumulated population doublings of the cis-platinum resistant human ovarian cancer cell line (A2780cis) exposed to sub-cytotoxic concentrations of the acridine compound BRACO19 over a period of 4 weeks.

6. Cells are then pelleted and re-suspended in 10 ml of DMEM and viability is determined with a haemocytometer. 7. Cells are counted with a Neubauer hemocytometer (Assistant, Germany) and the number of cellular population doublings are assessed by the equation n = (log Pn − log P0)/log2, where Pn is the number of cells collected and P0 the initial seeding density. 8. From this 1 × 105 cells are reseeded and the experiment is continued for a total of (for example) four weeks. 3.5. Staining for senescenceassociated b-galactosidase activity

1. MCF7 Cells (1 × 105, 10 ml media, ATCC-LGC Promochem) are exposed to two independent sub-cytotoxic concentrations of the required ligand over a 1 week period with a biweekly treatment. 2. A media-negative control is also screened. 3. Cells are stained for senescence using the b-galactosidase staining kit (Cell Signalling Technology) according to the manufacturer’s instructions (see Note 10). Cells are seeded (1 × 105, 2 ml) in a 6-well plate (Fisher-Scientific) with the required ligand concentration and incubated overnight. 4. The medium is removed, the well washed with PBS (2 ml) prior to fixing (1× fixative solution, 10 min).

An Evaluation Cascade for G-Quadruplex Telomere Targeting Agents

311

5. The fixative is removed and the well washed with PBS ( × 2 x 2 ml) prior to the addition of the staining solution (1 ml) and the plates incubated overnight. 6. Three independent fields of cells are visualized (200× magnification) from both repeats with the mean percentage of blue senescent cells reported ± sd. 3.6. Telomere length determination

1. DNA is extracted from cell pellets using the QIAGEN Blood and cell culture DNA Mini Kit following manufacture’s instructions. 2. The DNA concentration is determined by measurement of the absorbance at 260 nm using a GeneQuant spectrophotometer. Purity of each sample is determined as a ratio of absorbance at 260 nm/280 nm. 3. 20 mmol of the C-rich oligonucleotide d(CCTAACCCTAACCCTAACCC) is incubated with 80 µCi of g-32P -ATP, 1 ml of T4PNK enzyme (BioLabs), 3 ml of T4 Phosphonucleotide kinase buffer (BioLabs) and 16 µl of TE buffer for 1 h at 37°C. 4. Labelled oligonucleotide is purified using the QIAquick Nucleotide Removal Kit following manufacturer’s instructions. 5. The oligonucleotide is resuspended in 100 µl of EB buffer. 6. 2 µg of genomic DNA of each sample is digested with 1.5 µl of Hinf I and 1.5 µl Rsal restriction enzymes (Roche, Germany) and labeled with 3.5 ml of 32P-C-rich probe, in 3 µl of NEB buffer 2 (BioLabs), and up to 30 µl of TE buffer (pH 8.0) at 37°C overnight. 7. 5 ml of loading buffer is added to each tube to stop the reaction and samples are electrophoresed in 0.7% agarose gels with 0.5 mg/ml of ethidium bromide for 2.5 h at 115 V in 1× TBE buffer along with 35S DNA Marker (Amersham Biosciences, UK). 8. Subsequently, the gel is dried, firstly for two hours in filter paper and paper towel sandwich, followed by in a gel dryer for 20 min. The gel is then exposed to an X-ray film overnight (Molecular Dynamics) and telomeric DNA smears are visualized using a phosphorimager (Molecular Dynamics). See Fig. 19.1 for an example.

4. Notes 1. Protease cocktail inhibitors should be added to the lysis buffer freshly prior to the lysis of the pellets to increase yield.

312

Gunaratnam and Neidle

2. The TRAP assay is sensitive to even trace amounts of ethanol, which is present as residual in the PCR reaction mixture from the spin tube purification step. Even when 1% ethanol is present, it is found to inhibit the subsequent PCR step severely. To overcome this problem, it is first necessary to freeze dry the eluted samples in order to remove any traces of ethanol from the purification step. 3. TRAP Assay – extended products from the first PCR reaction should be dried thoroughly, but care should be taken to avoid over drying of samples, as this has shown to damage the samples and resulting in poor PCR extension. 4. Resuscitate freeze-dried extended products at room temperature, allow around 20 min for complete resuscitation, and add second PCR master mix directly to the same PCR tube. Avoid transferring resuscitated samples between tubes to prevent carry over sample loss. 5. Prior to running samples pre-run the gel for 5 min to equilibrate. 6. Cell culturing – Seeding density should be kept at 1:20 for subculturing A2780cis cells, as the doubling time is rapid. 7. Sulforhodamine B assay – optimum seeding density should be verified for each cell line in use as this varies considerably between different cancer lines. 8. TCA should be prepared freshly on the day of use and add enough TCA to fill about 2/3 of the well. 9. Long-term growth inhibition study – seeding density should be adjusted for each cell line in use 10. For staining for senescence-associated b-galactosidase staining the fixative and X-gal should be prepared freshly every time. References 1. de Lange T (2005) Shelterin: the protein complex that shapes and safeguards human telomeres. Genes Dev 19:2100–2110 2. Autexier C, Lue NF (2006) The structure and function of telomerase reverse transcriptase. Annu Rev Biochem 75:493–517 3. Kim NW, Piatyszek MA, Prowse KR, Harley CB, West MD, Ho PLC, Coviello GM, Wright WE, Weinrich R, Shay JW (1994) Specific association of human telomerase activity with immortal cells and cancer. Science 266: 2011–2015 4. Hahn WC, Stewart SA, Brooks MW, York SG, Eaton E, Kurachi A, Beijersbergen RL, Knoll JH, Meyerson M, Weinberg RA (1999)

Inhibition of telomerase limits the growth of human cancer cells. Nat Med 5:1164–1170 5. Oganesian L, Bryan TM (2007) Physiological relevance of telomeric G-quadruplex formation: a potential drug target. Bioessays 29:155–165 6. De Cian A, Lacroix L, Douarre C, TemimeSmaali N, Trentesaux C, Riou J-F, Mergny J-L (2008) Targeting telomeres and telomerase. Biochimie 90:131–155 7. Sun D, Thompson B, Cathers BE, Salazar M, Kerwin SM, Trent JO, Jenkins TC, Neidle S, Hurley LH (1997) Inhibition of human telomerase by a G-quadruplex-interactive compound. J Med Chem 40:2113–2116

An Evaluation Cascade for G-Quadruplex Telomere Targeting Agents 8. Monchaud D, Teulade-Fichou MP (2008) A hitchhiker’s guide to G-quadruplex ligands. Org Biomol Chem 6:627–636 9. Tan JH, Gu LQ, Wu JY (2008) Design of selective G-quadruplex ligands as potential anticancer agents. Mini Rev Med Chem 8:1163–1178 10. Mergny J-L, Lacroix L, Teulade-Fichou MP, Hounsou C, Guittat L, Hoarau M, Arimondo PB, Vigneron J-P, Lehn J-M, Riou J-F, Garestier T, Hélène C (2001) Telomerase inhibitors based on quadruplex ligands selected by a fluorescence assay. Proc Natl Acad Sci U S A 98:3062–3067 11. Gomez D, Wenner T, Brassart B, Douarre C, O’Donohue M-F, El Khoury V, Shin-ya K, Morjani H, Trentesaux C, Riou J-F (2006) Telomestatin-induced telomere uncapping is modulated by POT1 through G-overhang extension in HT1080 human tumor cells. J Biol Chem 281:38721–38729 12. Gomez D, O’Donohue M-F, Wenner T, Douarre C, Macadré J, Koebel P, GiraudPanis M-J, Kaplan H, Kolkes A, Shin-ya K, Riou J-F (2006) The G-quadruplex ligand telomestatin inhibits POT1 binding to telomeric sequences in vitro and induces GFPPOT1 dissociation from telomeres in human cells. Cancer Res 66:6908–6912 13. Leonetti C, Amodei S, D’Angelo C, Rizzo A, Benassi B, Antonelli A, Elli R, Stevens MFG, D’Incalci M, Zupi G, Biroccio A (2004) Biological activity of the G-quadruplex ligand RHPS4 (3, 11-difluoro-6, 8, 13-trimethyl8H-quino[4, 3, 2-kl]acridinium methosulfate) is associated with telomere capping alteration. Mol Pharm 66:1138–1146 14. Gunaratnam M, Greciano O, Martins C, Reszka AP, Schultes CM, Morjani H, Riou J-F, Neidle S (2007) Mechanism of acridinebased telomerase inhibition and telomere shortening. Biochem Pharmacol 74:679–689 15. Schultes CM, Guyen B, Cuesta J, Neidle S (2004) Synthesis, biophysical and biological

16.

17.

18.

19.

20.

21.

313

evaluation of 3, 6-bis-amidoacridines with extended 9-anilino substituents as potent G-quadruplex-binding telomerase inhibitors. Bioorg Med Chem Lett 14:4347–4351 Reed JE, Gunaratnam M, Beltran M, Reszka AP, Vilar R, Neidle S (2008) TRAP-LIG, a modified TRAP assay to quantitate telomerase inhibition by small molecules. Anal Biochem 380:99–105 Moore MJ, Schultes CM, Cuesta J, Cuenca F, Gunaratnam M, Tanious FA, Wilson WD, Neidle S (2006) Trisubstituted acridines as G-quadruplex telomere targeting agents. Effects of extensions of the 3, 6- and 9-side chains on quadruplex binding, telomerase activity, and cell proliferation. J Med Chem 49:582–599 De Cian A, Guittat L, Shin-Ya K, Riou J-F, Mergny J-L (2005) Affinity and selectivity of G4 ligands measured by FRET. Nucleic Acids Symp Ser (Oxf) 235–236 Brassart B, Gomez D, De Cian A, Paterski R, Montagnac A, Qui KH, Temime-Smaali N, Trentesaux C, Mergny J-L, Gueritte F, Riou J-F (2007) A new steroid derivative stabilizes G-quadruplexes and induces telomere uncapping in human tumor cells. Mol Pharmacol 72:631–640 Burger AM, Dai F, Schultes CM, Reszka AP, Moore MJ, Double JA, Neidle S (2005) The G-quadruplex-interactive molecule BRACO19 inhibits tumor growth, consistent with telomere targeting and interference with telomerase function. Cancer Res 65:1489–1496 Leonetti C, Scarsella M, Riggio G, Rizzo A, Salvati E, D’Incalci M, Staszewsky L, Frapolli R, Stevens MF, Stoppacciaro A, Mottolese M, Antoniani B, Gilson E, Zupi G, Biroccio A (2008) G-quadruplex ligand RHPS4 potentiates the antitumor activity of camptothecins in preclinical models of solid tumors. Clin Cancer Res 14:7284–7291

INDEX A Absorbance ........................................ 25–28, 30, 33, 38–42, 45, 47–53, 64, 68, 78, 167, 247, 306, 309, 311 Acceleration voltage ........................................................ 98 Accelerator mass spectrometry .............................. 103–117 Actinomycin .............................................57, 194, 240, 241 Adherent cell lines ................................................. 269, 271 A-DNA ......................................................................... 184 Adriamycin ..............103–106, 108–109, 112–116, 143, 144 Adriamycin-DNA adducts .................................... 103–117 Agarose gel electrophoresis............ 176, 178–180, 182, 183, 187–190, 293 Alkylation ....................................... 174, 175, 183, 289, 293 AMBER ................................................................ 125, 127 Amidoanthraquinone .................................................... 304 Aminoglycoside ............................................................... 57 Analyte ....................................17, 19, 41, 47, 77, 87, 89, 99 Angiogenesis ................................................................. 224 Anomalous diffraction ........................................... 133–149 Anomalous map......................................138, 146, 147, 149 Anomalous scattering ............................................ 133–139 Anthracycline ........................................................ 142, 240 Anthraquinone ...................................................... 241, 304 Antitumor antibiotic...................................................... 173 Apoptosis........................................................176, 303, 304 Argand plot ................................................................... 134 Ascites. .................................................................. 269, 273 Association constant .......................................... 58, 89–100 Association frequency factor (AFF) .................... 81–83, 85 Autoradiography..............162–163, 204, 289, 290, 293, 295

B Backbone conformation................................................... 56 Backbone tracking ................................................. 138, 139 Baseline determination .................................................... 33 Beer–Lambert law ..................................................... 42, 50 Berenil. ...................................................................... 76, 78 Biacore................................................ 5, 8, 9, 12, 14, 17–21 Bijvoet pair ..................................... 134, 138, 139, 142, 149 Binding constant .................14, 17, 19, 21, 44, 53, 164, 240 Binding curve ......................................... 19, 45, 80, 90, 167 Biosensor ..................................................................... 1–21 Biotin........................................................ 5, 10, 12, 13, 259 Biotinylated TFO .................................................. 258, 260 Boundary conditions ............................................. 125, 129

BRACO19 ............................................................ 305, 310 Busulphan.............................................................. 267, 297

C Calorimetry ..................................................................... 57 Cambridge Structural Database .................................... 124 Capillary electrophoresis............................................ 71–88 Carboplatin ................................................................... 267 Cell culture .............................................106, 116, 305, 311 CHARMM ................................................................... 125 Chlorambucil......................................................... 267, 279 Chloroethyl-nitrosourea ................................................ 267 Chloroquine .................................................................. 252 Chromatin ...................... 174, 176, 178–180, 185–191, 223 Circular dichroism ..........................................26, 31, 37–45 Cisplatin ..........................176, 267, 278, 285, 287, 288, 299 C-myc.............................................................................. 29 Combinatorial selection................................................. 194 Comet assay ........................................................... 267–281 Competition assay ......................................................... 307 Competition equilibrium dialysis .................................... 57 Configurational entropy .................................123, 128, 130 Cooperativity ....................................................... 14–16, 26 Copper phenanthroline ................................................. 154 Coumarin antibiotics ............................................. 262, 265 Crosslinking ..........................................174–178, 180–183, 186, 267–281, 283–301 Cryptolepine.......................................................... 240, 241 Crystal structure .............................................124, 142, 155 Cy3......... ......................................................................... 28 Cy5......... ......................................................................... 28 Cyclic amplification and selection of targets (CASTing) ........................................................ 195 Cyclophosphamide ........................................................ 267 Cytotoxicity assay .......................................................... 309

D Dabcyl. ............................................................................ 28 DB293. .................................................................. 6, 12–17 Densitometry..................................................163, 285, 295 Dephosphorylation ................................................ 285, 292 Differential cleavage plot ............................................... 163 Dimethylsulphate (DMS) ............................................. 230 Directed molecular evolution......................................... 193 Dissociation constant ......................... 71, 86, 164, 165, 203

315

DRUG-DNA INTERACTION PROTOCOLS 316 Index Dissociation kinetics ...................................................... 219 Distamycin ...................................................76, 78, 84, 194 DNA concentration determination............................... 64, 76, 111, 164, 165, 247, 301, 311 DNA gyrase..................................................... 257–264 DNA-platinum complex ......................................... 134 DNA triplex .............................................. 55, 257–265 extraction ..................................................106, 109–110 hairpins ................................................................ 11–14 purification ............................... 107, 110, 116, 211, 246 relaxation .................. 125–127, 235–252, 258, 264, 265 repair.................................................235, 268, 279, 283 replication ...........................................56, 235, 268, 304 secondary structure ...........................223, 225, 227, 228 supercoiling...............................................258, 260–265 DNA·RNA hybrids ................................................... 55–68 DNase I .......................... 153–170, 207, 223, 225, 227–231 DNase II........................................................................ 154 Doxorubicin............................................103, 208, 214, 215 Duocarmycin ......................................................... 174–176 Dynamics ................................... 2, 120, 121, 124, 224, 225

E Echinomycin ......................................................... 208, 240 Egr-1 transcription factor .............................................. 224 Electropherogram ...................................................... 75, 77 Electrophoresis ..............................................158, 162–163, 169, 179, 184, 186–188, 199, 200, 208, 211, 213, 217, 218, 229, 230, 244, 245, 247–249, 251, 258, 268, 270, 276, 280, 281, 284, 293, 295, 297 Electrospray mass spectrometry............................... 89–100 Electrostatic forces......................................................... 142 Elinafide ........................................................................ 240 Ellipticine ................................................................ 59, 241 Ellipticity ................................................................... 27, 43 Elongation ............................................. 209, 211, 212, 214, 216–217, 219, 220, 307 3’-End labelling ..................................................... 159–161 5’-End labelling ..............................................161, 284, 292 Energy-minimisation ............................................ 126, 130 Enzyme inhibition......................................................... 309 Equilibrium constant ......................................2, 6, 7, 14, 72 Ethidium ............................................. 51, 57–59, 188, 199, 211, 212, 220, 240–252, 259, 265, 281, 297, 311 Extinction coefficient ........................ 29, 43, 64, 76, 91, 92, 198, 200, 247

F FAM..... ..............................................................28, 33, 306 Film LD .......................................................................... 46 FK317.....................................................174, 177, 181, 182 Fluorescein ................................................................ 28, 33 Fluorescence detection .......................................................82, 83, 105

donor ................................................................... 27, 33 quencher .............................................................. 27, 58 Fluorescence resonance energy transfer (FRET)....................... 27, 28, 31, 33, 304, 306–307 Footprinting ............................. 87, 153–170, 208, 223–231 Force-field ......................................................123, 125, 128 Formaldehyde ..................103–105, 114, 115, 211, 214, 216 Fourier coefficients ........................................................ 134 Free energy ...............................................73, 120, 127, 142

G b-Galactosidase activity ......................................... 310–311 Gaussian distribution..................................................... 129 Gel electrophoresis ..........................................29, 169, 177, 199, 217, 245, 247, 289–291 Gel purification ..................................................... 158, 168 Gene expression........................................................... 1, 56 Generalized Born .................................................. 121, 128 Gibbs fee energy ................................................................ 2 Global fitting ................................................................. 241 G-quadruplex .......................................... 26, 91, 94, 97, 98, 225, 227, 230, 231, 303–312 G-quartet .................................................................. 25, 26 Growth inhibition assay ........................................ 309–310

H Hairpin polyamide .........................................154, 170, 194 Hayflick limit ................................................................ 303 High-throughput screening ................................... 262–263 Histones ..........................176–178, 181, 185, 186, 189, 190 Hoechst 33258 .............................................51, 76, 78, 127 HPLC. ......................................... 29, 48, 76, 105, 137, 306 HTert..................................................................... 304, 305 Hybridization .................................................................... 7 Hydrophobic interactions ................................................ 37 Hydroxyl radical .............................................154, 155, 207

I IC50....... .........................62, 63, 68, 262–263, 265, 304, 309 Ifosfamide...................................................................... 267 I-motif. ............................................................................ 64 Implicit solvent simulations ........................................... 128 Induced CD (ICD) ..............................................38, 44, 45 Initiation of transcription ...............................208, 213, 216 Intercalation .............................................56, 173, 235–252 Intercalator ........................45, 51, 56, 58, 59, 164, 241, 251 Intermolecular triplex .................................................... 258 Interstrand crosslink ............... 173, 176, 267–281, 283–301 In vitro chromatin assembly ...........176, 178–180, 185–190 In vitro transcription ......................................178, 207–221 Ionic strength ................................................29, 44, 52, 87, 96, 97, 128, 169 Isomorphous replacement...............................139–141, 147 Isotropic absorbance ........................................................ 45

DRUG-DNA INTERACTION PROTOCOLS 317 Index K

P

Kinetics...................................................................2, 3, 6, 7 Klenow fragment ........................................................... 159 KM.........................................................................62, 63, 68

Patterson map ................................................................ 134 Phosphorimaging ...........................................163, 219, 299 Ping-pong kinetics .......................................................... 62 Pixantrone ...................................... 208, 211, 214–216, 219 Plasmid footprinting ......................156–160, 168, 223–231 Plasmid preparation........................................158, 159, 178 Poisson-Boltzmann ....................................................... 121 Poly(U) ............................................................................ 64 Polyelectrolyte ......................................................... 29, 142 Polymerase chain reaction (PCR) ....................31, 195–204, 220, 227, 229, 231, 304, 306–308, 312 Polynucleotide kinase (PNK) ................................159, 161, 178, 183, 225, 228, 289, 292, 294, 297, 311 Poly(A)·poly(dT) ............................................57, 62, 64, 66 Poly(A)·poly(U) ......................................................... 64, 66 Poly(dA)·poly(dT) ..................................................... 64, 66 Positive supercoils ...........................................242, 249, 250 Pot1..... .................................................................. 304, 305 Principal component analysis .........................125, 126, 130 Promoters .................................................. 4, 156, 208, 209, 220, 223–231 Protein data bank (PDB) ............................................... 124 Psoralen ......................................................................... 176 pUC vectors ........................................................... 157, 168

L Lac uv5 promoter ...................................208–214, 216, 220 Law of mass action .......................................................... 72 Lexitropsins ................................................................... 119 LIG-TRAP telomerase assay................................. 307–309 Linear dichroism (LD) .............................................. 37–54 Liquid scintillation counting .................................104, 105, 108, 111, 113, 114, 117 Luciferase ...................................................................... 231 Lymphocytes .......................... 269, 271–272, 276, 279, 280

M Mass spectrometry..........................................29, 87, 89, 96 Mass transfer effect ........................................17, 18, 20, 21 Maxam–Gilbert ............................................................. 161 Mechloroethamine ........................................................ 267 Melphalan ..............................................176, 267, 276–279 Methidiumpropyl-EDA.Fe(II)...................................... 154 Micrococcal nuclease ..............................154, 179, 185–188 Minor-groove-binding ligand ..................................................124, 154, 165 Mithramycin.................................................................. 154 Mitomycin (MMC)........................................174–176, 267 Mitosene................................................................ 174, 175 Mitoxantrone ..................................................208, 214, 215 Molecular dynamics simulation .............................120, 121, 125, 126, 128 Molecular modelling ............................................. 119–130 Monoalkylation ......................................176, 178, 183–185 Multidrug resistance ...................................................... 116

N Negative ion mode..................................................... 92, 97 Negative supercoils ......................... 223–225, 242, 250, 257 Netropsin ............................................................. 76–78, 81 Nitrogen mustards ..........................................176, 208, 267 NMR.... ................................................................. 124, 125 Nogalamycin.................................................................. 154 Non-covalent interaction ................................................. 37 Normal mode analysis (NMA) .......................122, 128, 130 Nucleosomal DNA ................................................ 173–191 Nucleosome ...................................................173, 176–178, 180, 181, 183, 185, 186, 188–191

O Oligonucleotide annealing............................................. 294 Oncogene .................................................................. 4, 224 Oxaliplatin..................................................................... 267

Q Quadruplex .................. 3, 4, 25–30, 32, 55, 56, 64, 136, 304 Quantitative footprinting ...................................... 164–165 Quinoxaline antibiotic ................................................... 154

R Radiolabel.................................................. 3, 104, 105, 154, 159, 168, 169, 183, 190, 294 Random collisions ........................................................... 73 Rate constant .................................... 2, 6, 14, 16, 17, 21, 73 Real time PCR ................................................................ 31 Refractive index ..............................................3–5, 7, 12, 20 Repressor protein........................................................... 146 Restriction endonuclease protection assay (REPA) ...............................................200–202, 204 Restriction Endonuclease Protection Selection and Amplification (REPSA) ..................... 193–204 Reverse transcriptase ........................ 56, 158–160, 168, 304 Rhodamine ...................................................................... 28 RNA polymerase .............................................56, 208–210, 212, 213, 218–220, 223 RNA secondary structures ............................................... 55 RNase H...................................................56, 57, 60–63, 65 Rubidium .......................................................134, 136, 146

S S1 nuclease .....................................................223, 225–230 Scatchard plot .................................................................. 71

DRUG-DNA INTERACTION PROTOCOLS 318 Index SELEX .......................................................................... 193 Senescence ......................................................303, 304, 310 Sensorchip ....................................................5, 8–12, 18, 19 Sensorgram .................................................5–15, 17, 20, 21 Sequence recognition..................................................... 157 Sequence specificity ................................142, 194, 220, 284 Sequencing ............................................ 197, 201, 210, 211, 213, 217, 226, 228, 231, 290, 291, 294 Single cell gel electrophoresis (Comet) assay ............................................ 267–281 Single hit kinetics .................................................. 154, 170 Sodium adducts ................................................. 94, 98–100 Solid tumour tissue ................................................ 269, 272 Southern blotting .......................................................... 304 Sp1 transcription factor ......................................... 223, 224 Spectropolarimeter .................................................... 39, 40 Spectroscopy .........................................................37, 45, 53 SPR angle ...................................................................... 5, 6 Spreadsheet ............................................................... 81, 84 Stacking ..............................................................76, 84, 238 Steady state .............................................5–7, 14–18, 20, 21 Stoichiometry ....................................................2, 7, 12, 14, 18, 84, 90, 165, 236 Streptavidin ......................................................5, 8–10, 260 Sugar pucker .................................................................... 56 Sulforhodamine B (SRB) ...................................... 309, 312 Supercoiled DNA ................................................. 235–252, 257, 258, 260, 276 Surface plasmon resonance (SPR) ............................... 1–21 Suspension cell line ............................................... 269, 270 SYBR gold.....................................................178, 179, 181, 182, 188, 190, 252, 260, 261, 264 Synchrotron ................................................................... 137

T T1/2........... .................................................................. 31–33 TAMRA .............................................................28, 33, 306 Telomerase.......................................... 56, 58, 304, 307–309 Telomere ............................................................ 4, 303–312 Telomere length determination ............................. 304, 311 Telomeric repeat amplification protocol (TRAP) assay .............................304, 306–309, 312

Telomestatin ...........................................226–228, 230, 231 TFIID............................................................................ 194 Thallium ..........................134–136, 139, 142, 144, 146, 148 Thermal denaturation...................................27, 57, 60, 298 Thermal melting.............................................25–33, 62, 67 Thermodynamics....................................................... 3, 142 Thermodynamic stability................................................. 56 Thiazole orange ............................................................... 59 Tm........... ...............................6, 28–31, 33, 60, 62, 299, 307 Topoisomerase .................................. 59, 236, 238, 257–265 Topoisomerase I ............................. 235–252, 258, 259, 261 Topoisomerase II ............................................142, 236, 252 Trajectory validation .............................................. 125–127 Transcriptional footprinting .......................................... 208 Transition moment polarization ................................ 39, 45 Triplex. ........................................................ 25, 56, 64, 165, 166, 258, 260, 262, 264 Triplex forming oligonucleotide (TFO) ................154, 155, 158, 162, 164–167, 169, 170, 258 Type IIS restriction endonuclease.......................... 194, 197

U Uranyl photoclevage ...................................................... 154 UV spectrophotometry .....................................92, 198, 200

V Vascular endothelial growth factor (VEGF) ......................................223–227, 230, 231 Vibrational frequencies .................................................. 122 Vibrational modes ......................................................... 122

W Water molecules ...................................... 73, 121, 126, 128, 129, 135, 142–144, 146, 147

X X-ray scattering ............................................................. 133 X-ray structure....................................................... 144, 176

Z Z-DNA ................................................................... 55, 137