Discovery Engineering in Biology : Case Studies for Grades 6-12 [1 ed.] 9781681406152, 9781681406145

Citation preview

REBECCA HITE • GINA CHILDERS MEGAN ENNES • M. GAIL JONES Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

REBECCA HITE • GINA CHILDERS MEGAN ENNES • M. GAIL JONES

Arlington, Virginia Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

Claire Reinburg, Director Rachel Ledbetter, Managing Editor Andrea Silen, Associate Editor Jennifer Thompson, Associate Editor Donna Yudkin, Book Acquisitions Manager

Art and Design

Will Thomas Jr., Director Himabindu Bichali, Graphic Designer, cover Joe Butera, Senior Graphic Designer, interior design

Printing and Production Catherine Lorrain, Director

National Science Teaching Association David L. Evans, Executive Director

1840 Wilson Blvd., Arlington, VA 22201 www.nsta.org/store For customer service inquiries, please call 800-277-5300. Copyright © 2020 by the National Science Teaching Association. All rights reserved. Printed in the United States of America. 23 22 21 20   4 3 2 1 NSTA is committed to publishing material that promotes the best in inquiry-based science education. However, conditions of actual use may vary, and the safety procedures and practices described in this book are intended to serve only as a guide. Additional precautionary measures may be required. NSTA and the authors do not warrant or represent that the procedures and practices in this book meet any safety code or standard of federal, state, or local regulations. NSTA and the authors disclaim any liability for personal injury or damage to property arising out of or relating to the use of this book, including any of the recommendations, instructions, or materials contained therein.

Permissions

Book purchasers may photocopy, print, or e-mail up to five copies of an NSTA book chapter for personal use only; this does not include display or promotional use. Elementary, middle, and high school teachers may reproduce forms, sample documents, and single NSTA book chapters needed for classroom or noncommercial, professional-development use only. E-book buyers may download files to multiple personal devices but are prohibited from posting the files to third-party servers or websites, or from passing files to non-buyers. For additional permission to photocopy or use material electronically from this NSTA Press book, please contact the Copyright Clearance Center (CCC) (www.copyright.com; 978-750-8400). Please access www.nsta.org/permissions for further information about NSTA’s rights and permissions policies. Library of Congress Cataloging-in-Publication Data Names: Hite, Rebecca, 1979- author. Title: Discovery engineering in biology : case studies for grades 6-12 / Rebecca Hite, Gina Childers, Megan Ennes, M. Gail Jones. Description: Arlington, VA: National Science Teaching Association, [2020] | Includes bibliographical references and index. | Identifiers: LCCN 2019028752 (print) | LCCN 2019028753 (ebook) | ISBN 9781681406145 (paperback) | ISBN 9781681406152 (adobe pdf ) Subjects: LCSH: Biotechnology--Study and teaching (Secondary) | Bioengineering--Study and teaching (Secondary) | Discoveries in science--Study and teaching (Secondary) Classification: LCC TP248.22 .H58 2020 (print) | LCC TP248.22 (ebook) | DDC 660.607--dc23 LC record available at https://lccn.loc.gov/2019028752 LC ebook record available at https://lccn.loc.gov/2019028753

Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

This book is dedicated to all teachers and students who share a love of science and engineering.

Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

Contents About the Authors................................................................................................................................................... ix Acknowledgments.................................................................................................................................................. xi Introduction..................................................................................................................................................................1

1 2 3 4 5 6 7 8 9 10

Quit Bugging Me Controlling Mosquitoes to Stem Malaria Infection

13

11

31

12

49

13

69

14

Game of Knowns John Snow’s Research Into the Cause and Spread of Cholera

Thalidomide Hidden Tragedy and Second Chances

Vindicating Venom Using Biological Mechanisms to Treat Diseases and Disorders

Forbidden Fruit The Discovery of Dangerous Drug Interactions

Listen to Your Heart The Accidental Discovery of the Pacemaker

Overexposure Treating Anaphylaxis Due to Allergies

Crashing the Party Combating Chronic Alcohol Abuse

89

15

117

16

135

17

157

18

179

19

205

20

The Triumph of the Pika Understanding Environmental Impacts on Species

Seeing the Earth Glow From Space Plants That Glow

Power Plants Algal Biofuels

A “Sixth Sense” Using Sensors for Monitoring and Communication

In Hot Water The Discovery of Taq Polymerase

Cows and Milkmaids The Discovery of Vaccines

221

239

257

277

2X or Not 2X “Y” Should Mixed-Sex Test Subjects Be Used in Medical Research?

Revealing Repeats

299

The Accidental Discovery of DNA Fingerprinting

325

Mr. Antibiotic, Tear Down This (Cell) Wall

349

The Prokaryotic Resistance of Penicillin

Hidden in Plain Sight Darwin’s Observations in the Galápagos Islands

More Bark Than Bite Using Bioprospecting to Find Cures for Disease

373

395

Cutting It Close Using CRISPR to Microedit the Genome

Image Credits........................................................................................................................................................439 Index..........................................................................................................................................................................445

Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

415

Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

About the Authors Rebecca Hite is a former high school science and geography teacher and is currently an assistant professor of science education at Texas Tech University. Gina Childers is a former middle and high school science teacher and is currently an assistant professor of science education at Texas Tech University. Megan Ennes is a former museum educator and is currently the assistant curator of museum education at the University of Florida. M. Gail Jones is a former middle and high school biology teacher and is currently a professor of science education at North Carolina State University. She leads the STEM Education Research Group investigating effective ways to teach science.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

ix

Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

Acknowledgments

T

he authors wish to thank the many people who inspired, reviewed, and helped craft Discovery Engineering in Biology. Our special gratitude goes to Sabrina Monserate, Laurel McCarthy, and Kendall Rease. We also thank the teachers who piloted the activities and provided us with important feedback to refine the cases.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

xi

Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

Introduction

A

number of amazing innovations have resulted from someone making a careful observation, a mistake, or even just trying an experiment to see what will happen. In 1854, for example, Dr. John Snow wanted to know what was causing an outbreak of cholera in his home city of London. Dr. Snow had noticed that areas with filtered drinking water had fewer deaths and guessed that contaminated water had something to do with the cholera outbreak. To test his theory, he created a map showing the reported cases of the illness in the neighborhood of Soho, as well as the locations of Soho’s water pumps. This allowed him to pinpoint a contaminated pump. He went on to share his findings and become “the father of epidemiology” (MPH Online Learning Modules 2015). Dr. Snow addressed a societal need of the 1850s, namely the necessity for a means to stop cholera outbreaks. Since his work more than 150 years ago, the field of epidemiology has grown exponentially and still uses the principles of careful observation and ideation to tackle modern concerns. The case of Dr. Snow demonstrates that careful observations and discovery-based research can be sourced from or inspired by the natural world and one’s own imagination, leading to new ideas and applications sourced from biology itself. The key to harnessing this potential is a careful and imaginative eye, along with a mindful process of engineering to address and solve everyday problems. This book focuses on the intersection of science and engineering through an examination of real-world discoveries that, as in the case of Dr. Snow, led to innovations and solutions to contemporary real-world problems. We call the process of developing an innovation based on an observation of phenomena or a deeper exploration of accidental findings “discovery engineering.”

What Is Discovery Engineering? Each chapter in Discovery Engineering in Biology begins with the examination of an observation, discovery, or phenomenon. Students review historical observations or discoveries to connect these revelations to their original context. Then, they place themselves in the role of discoverer by thinking about how

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

1

innovations and insights can be used to create and design new products or applications to solve problems. Authentic details from original studies and data sets make the book’s case studies realistic and interesting. With each case study, students explore physical materials, design studies, analyze data, or create models of phenomena before considering further applications for a given discovery. Students are tasked to think creatively about science from serendipity, using research and their own personal insight to create and design new products or applications to solve problems. Throughout the process, students become increasingly knowledgeable about how scientific discoveries often unfold and how engineers apply a design process for creative applications. The cases in this book engage the learner at multiple levels and scaffold the learning process through observations, an examination of data, and the evaluation and synthesizing of information, followed by an application of the engineering design process (EDP) to address an everyday problem. The reason for including the EDP is to help students understand and apply fundamental science processes while also exploring new ideas for applications. At the same time, the primary documents or historical accounts in the case studies engage students in the authentic contexts of science. By combining these elements, this book addresses the call by the National Academies of Sciences, Engineering, and Medicine in “engaging all students in learning science and engineering through investigation and design  … [with] instructional approaches that (1) situate phenomena in culturally and locally relevant contexts, (2) provide a platform for developing meaningful understanding of three-dimensional science and engineering knowledge, and (3) provide an opportunity for the use of evidence to make sense of the natural and engineered world beyond the classroom” (NASEM 2018, p. S-2).

How Is Discovery Engineering Different From Other Engineering Designs? Engineers identify real-world problems and scan the available knowledge resources to identify those that can be deployed to generate solutions; that include areas within the science, technology, engineering, and mathematics (STEM) disciplines as well as social sciences and humanities. As part of their work, engineers use some version of the EDP as steps to find a solution to a problem, specifically utilizing aspects of designing, building, and testing. In the authentic work of engineers, this process is complex and includes concepts such as constraints, requirements, tradeoffs, optimization, prototyping, and more. However, as engineers conduct their work of addressing problems, it so happens that new applications, products, and ideas are also discovered, calling into question new ways to apply these observations and knowledge to life-science contexts. Discovery Engineering in Biology starts with a unique or accidental discovery or observation, followed by the consideration of a new application or problem to

2

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

INTRODUCTION

be solved. As documented by the case studies within this book, this is a realistic process that leverages engineering in the often-unrelated context of biological science. The case studies show that not all discoveries or inventions are a product of controlled experiments or engineering prototypes. Some innovations simply begin with an observation, followed by creative thinking and consideration of how that process or phenomenon might be used for a new application or to solve a problem. To scaffold the EDP, we have established a six-step formula: asking questions; brainstorming and imagining; creating a plan; designing; testing and evaluating; and improving and revising. It is important to note that this book is not intended to replicate the work of engineers. Instead, its purpose is to provide students with an introduction to engineering design principles anchored to concepts within biological science. This book shows students that their everyday observations of the natural world can provide unique insight into the challenges facing modern society. Furthermore, Discovery Engineering in Biology seeks to empower students to leverage their natural curiosity in order to innovate and design new applications or create new products for tomorrow.

The Case Study Approach At the heart of each case study is a true story, one that describes how someone made a casual observation or did a simple experiment that led to new insight or a discovery. Case studies are designed to get students actively engaged in the process of problem solving and applying ideas to design new products and processes. The narrative of the case supplies authentic details that help place the student in the role of the inventor and provides scaffolds for critical thinking and deep reflection. A case is more than a paragraph to read or a story to analyze; rather, it is a way of framing problems, synthesizing information, and thinking creatively about new applications and solutions. According to the National Center for Case Study Teaching in Science, the use of cases as an instructional strategy has had a long history of success in schools of business, law, and medicine. For example, cases are effectively integrated into health care–related education programs to increase student understanding of the profession, especially for situation-dependent knowledge needed in clinical settings (Dowd and Davidhizar 1999). Cases are also an appropriate instructional strategy for the secondary science classroom as they can be used to develop students’ critical thinking skills, teach science process skills, help students think about the nature of science, and more (Gallucci 2006). Research specifically credits using real-world scenarios in fostering relatable and purpose-driven contexts that can yield improvement in student attitudes and academic achievement, specifically in the areas of mathematics and science (Akınog˘lu and Tandog˘an 2007). Cases are an instructional method that can engender the development of science reasoning skills during nonlaboratory classroom time. Cases guide students to think expertly about problems. They also provide teachers

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

3

with the opportunity to coach students to use metacognitive strategies in order to monitor and take control of their own learning. This process reduces rote learning and promotes active engagement. What’s more, case studies often enhance student interest by making the topic more relevant to real-life activities. The case studies provided in this book are designed to supplement instruction by motivating students to apply what they have learned to new contexts and applications. Cases are especially effective for discussing complex scenarios in which there is no single solution to a problem; they are best integrated into the curriculum when learners can benefit from applying their ideas to a real-world situation. Teaching with case studies provides students with a vicarious experience and casts them in roles that require taking a different perspective, thinking differently about science, and taking ownership over a decision. Each case activity highlights a career in or related to STEM so students can envision themselves engaging in real STEM work. This form of instruction is valuable as it teaches students to think critically about a problem and develop possible solutions, which approximates the problem-solving environment of many professions in science, technology, engineering, and mathematics. This book is of value to middle and high school science and engineering teachers as each case includes multiple components that teachers can tailor to specific classroom environments. Case studies may be used during the “engage” component of a learning cycle to elicit student interest and provide formative evaluation information about students’ preconceptions. A case can also become part of the “extend and apply” component of a lesson. When used at the end of the lesson, the cases may help teachers judge whether their students understand the science of the case sufficiently enough to apply their knowledge to new contexts. Case studies contextualize student learning and prompt students to use their knowledge to problem-solve in a “real” situation, consider a topic from a new and different perspective, and reflect deeply about their learning. With these texts, students are encouraged to increase their understanding of STEM and improve their critical reasoning skills.

Science, Engineering, and the Next Generation Science Standards The Next Generation Science Standards (NGSS) challenge science teachers to facilitate learning experiences for students that emulate the practices of scientists and engineers (NGSS Lead States 2013). A Framework for K–12 Science Education (NRC 2012; the Framework), which established the NGSS, recommends that K–12 science education include these dimensions: science and engineering practices (SEPs); crosscutting concepts; and disciplinary core ideas (NRC 2012, p. 2). Engineering stresses that technologies are driven by human effort and influenced by societal needs and values. One of the goals identified in the NGSS is for students to understand that “(s)cientists

4

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

INTRODUCTION

and engineers are guided by habits of mind, such as intellectual honesty, tolerance of ambiguity, skepticism, and openness to new ideas” (NGSS Lead States 2013, p. 69). Hence, one of the central goals of the NGSS is to better situate inquiry in the kinds of work (social, cognitive, and physical) that are authentic to both science and engineering. The NGSS recommend that K–12 science instruction should: 1. Have broad importance across multiple sciences or engineering disciplines or be a key organizing principle of a single discipline. 2. Provide a key tool for solving problems and understanding or investigating more complex ideas. 3. Relate to the interests and life experiences of students or be connected to societal or personal concerns that require scientific or technological knowledge. 4. Be teachable and learnable over multiple grades at increasing levels of depth and sophistication. That is, the idea can be made accessible to younger students but is broad enough to sustain continued investigation over years (NGSS Lead States 2013, p. xvi). According to the Framework, engineering and technology are featured alongside the life sciences (physical and Earth and space science) for two important reasons: to aid students in understanding the human-built world and to emphasize the value of integrating science, engineering, and technology within K–12 science curriculum and instruction (NRC 2012, p. 8). SEPs bind science, engineering, and technology together, and they include the following: asking questions and defining problems; developing and using models; planning and carrying out investigations; analyzing and interpreting data; using mathematics and computational thinking; constructing explanations and designing solutions; engaging in argument from evidence; and obtaining, evaluating, and communicating information. Through the incorporation of these SEPs, students should not only demonstrate knowledge of science concepts but also apply these understandings using scientific inquiry and the practices of engineering design (NGSS Lead States 2013, Appendix F). The NGSS specifically state that students should “learn how to engage in engineering design practices to solve problems” (NGSS Lead States 2013, p. 104). Furthermore, it states that both middle and high school students are expected to know how to define problems, develop solutions, and test and optimize their designs, such that students can be “expected to engage with major global issues at the interface of science, technology, society and the environment, and to bring to bear the kinds of analytical and strategic thinking that prior training and increased maturity make possible” (NGSS Lead States 2013, p. 128). Although the NGSS do not clearly delineate how teachers are to integrate engineering into science, it makes recommendations about specific engineering practices for students across grade levels.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

5

TABLE 1 NGSS Recommendations for Teaching Engineering Practices GRADE LEVEL

ENGINEERING PRACTICES Define

Early Elementary K–2

Upper Elementary 3–5 Middle Grades 6–8 High School 9–12

Develop Solutions

Optimize

Identify situations/ problems that can be solved through engineering

Convey solutions through visual or physical representations

Compare solutions, test, and evaluate

Specify criteria and constraints for a solution to a problem

Research multiple possible solutions

Improve a solution based on results of tests, including failure points

Attend to precision, criteria, and constraints that may limit solutions

Combine parts of different solutions to create new solutions

Iteratively test and systematically refine a solution

Attend to a range of criteria and constraints for problems of social and global significance

Break a problem into smaller problems that can be solved separately

Prioritize criteria, take into account tradeoffs, and assess social and environmental impacts as complex solutions are tested and refined

Source: Adapted from NGSS Lead States 2013, pp. 105–106.

The recommendations for teaching engineering practices (Table 1) indicate that students should progress from proposing and testing single solutions to a more complex process of prioritizing and systematically assessing complex solutions to problems. As students explore science and engineering practices, the NGSS raise questions about the classical interpretation of the scientific method. Figure 1 shows the traditional model of the scientific method that has historically been taught in science education. The scientific method is typically represented as beginning with a question. This is followed by an examination of what is known (research), the construction of a hypothesis, the design of an experiment, data collection and analysis, and the drawing of a conclusion and communication of the result. In actual practice, the methods of science are much more iterative and flexible than are often represented in models of the scientific method. That means that, just as with engineering design, these methods can be nonlinear and not confined to a step-by-step process. This has resulted in a change of language, reframing the “scientific method” into “methods of science” to incorporate the iterative nature of scientific endeavor. For example, some fields and areas of science (such as geology

6

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

INTRODUCTION

or astrophysics) do not lend themFIGURE 1 selves to controlled experiments; rather, advancements in these fields Traditional Model of the Scientific Method and areas are made through observations and data analysis without Ask a Question / Identify a Problem the classically controlled experiment. The inclusion of engineering in this book allows students to compare these processes and consider how Research What Is Known both science and engineering follow or bypass the methodologies typically presented within their fields. The engineering design process may start with identifying a problem Construct a Hypothesis in need of a solution by asking questions to define the problem, imagining a solution (brainstorming ideas), planning a solution (designing diaDesign an Experiment grams and obtaining materials), creating a product, process, or prototype (following the plan), evaluating the product (testing or analyzing it), and Collect and Analyze Data then improving the design based on evaluation results. It is a cyclic process in which each iteration leads to a more effective product. Like the sciDraw Conclusions entific method, the EDP is often more fluid than many models represent. Today, science educators recommend that teachers no longer teach Communicate Results the scientific method as a linear process. Instead, they advocate for the use of the integrated SEP model recommended by the NGSS, focusing on teaching students problem-solving skills where science and engineering are blended (NGSS Lead States 2013). The goal is to have students focus on framing questions, developing hypotheses that can be investigated, and then engaging students in systematically analyzing and using data that can form evidence for scientific claims. Lachapelle and Cunningham (2014) suggested that due to the interdisciplinary nature of the EDP, it innately involves scientific reasoning with mathematical problem solving grounded in realworld scenarios.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

7

Using the NGSS to Inform Engineering Design

FIGURE 2 The Six-Step Engineering Design Process

The case study approach described in in This Book this book is designed to help teachers meet these NGSS goals by focusing on real-world problems of interest 1 to the student, employing different Ask Questions levels of depth and sophistication in and Define the the problem solving, and integrating Problem thinking across science and engineer6 2 ing. Each case encourages students to Revise Brainstorm and Improve and Imagine use a simplified six-step engineering The design model (Figure 2) based on the Engineering SEPs and the three central engineerDesign ing design stages (i.e., define probProcess lems, develop solutions, and test/ 3 5 3 optimize designs) from the NGSS Test Plan (NGSS Lead States 2013, Appendix I). and Evaluate By broadening the process from three 4 to six steps, with guidance at each Design carefully sequenced step, secondary and Create students will be able to engage in a one form of scaffolded engineering design. Broadening students’ understandings of the nature of science is key to teaching students SEPs and to helping them compare the work of scientists to that of engineers. A fundamental component of the nature of science is developing an understanding of science as a human endeavor that is embedded in previous findings and yet is open to new interpretations as new evidence is uncovered.

Overview of the Discovery Engineering Case Study Books This series includes two books. In addition to Discovery Engineering in Biology, there is also Discovery Engineering in Physical Science (NSTA 2019). Each case in these books is flexibly designed for use at either the middle or high school level. Investigations are designed to teach one or more science concepts, provide students with background information that teaches the nature of science, and push students to think about new and creative engineering applications. For example, the case “Thalidomide: Hidden Tragedy and Second Chances” (pp. 49–67) could be used when teaching students about human disease. This case illustrates the evaluation of drug treatment for human cancers and the careful steps needed for drug development in human trials.

8

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

INTRODUCTION

In Discovery Engineering in Biology, each case is intended to enhance, illustrate, and extend traditional instruction in ways that promote divergent thinking, which is paramount to success in STEM. Each chapter begins with an introduction to provide an overview of the case study to follow. Then, learning goals are listed in the Lesson Objectives section. Next comes a section called “The Case,” which provides the history behind the discovery of a phenomenon and includes questions to support reading comprehension. The three activities that follow (Investigate and Explain, Activity, and Apply and Analyze) focus on expanding student knowledge of the featured phenomenon. They prompt students to analyze and graph data, make data-driven decisions for simulated situations, and use internet resources to dig deeper. Finally, during the Design Challenge, students use the EDP to create new products and processes based on the case. Cases may be grouped together based on your instructional needs. For example, several chapters focus on the development of new or different medical treatments, like “Thalidomide: Hidden Tragedy and Second Chances” and “Overexposure: Treating Anaphylaxis Due to Allergies” (pp. 135–155), which may be taught sequentially to teach this content area. Also, case studies include both middle and high school disciplinary core ideas, so they are adaptable to different learning levels. Middle school learners may be able to complete the first segment of the cases unassisted but will require teacher support for later segments. Many of the chapters include graphic organizers, which would be especially helpful for middle school students. In the teacher guide, you may further differentiate instruction by tasking students to complete certain segments or entire chapters in the classroom or at home based on your instructional needs and student demographics.

Grand Challenges of Engineering The cases in this book provide teachers with the opportunity to teach about the Grand Challenges for Engineering in the 21st century. These include: advance personalized learning, make solar energy economical, enhance virtual reality, reverse engineer the brain, engineer better medicines, advance health informatics, restore and improve urban infrastructure, secure cyberspace, provide access to clean water, provide energy from fusion, prevent nuclear terror, manage the nitrogen cycle, develop carbon sequestration methods, and engineer the tools of scientific discovery (National Academy of Engineering 2016). The last challenge, engineering the tools of scientific discovery, allows students to think about how advancements in engineering and science occur and consider how new discoveries could solve problems and advance science. This challenge is made evident within several cases in this book. For example, students consider new uses for biological processes (enzymatic reactions), natural phenomena (animal resilience, drug resistance), and technologies (sensors, vaccines). In addressing these issues, students can consider how new materials can solve the challenges that face our society today.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

9

Science and Engineering for All The cases in this book can help teachers address the needs of every student in the classroom. The NGSS highlight the need to serve all students in the classroom, including underserved groups such as students who are economically disadvantaged, minorities, students with disabilities, and English language learners (NGSS Lead States 2013). “From a pedagogical perspective, the focus on engineering is inclusive of students who may have traditionally been marginalized in the science classroom or experienced science as not being relevant to their lives or future” (NGSS Lead States 2013, p. 104). Researchers have suggested that including engineering practices in the early grades can help keep students interested in engineering and science (Capobianco, Yu, and French 2015). The cases in this book provide teachers with the tools needed to successfully integrate the EDP into their curriculum. “When students engage with engineering, they are equipped with the capacity to analyze solutions to design problems in their everyday life” (Miller, Januszyk, and Lee 2015, p. 30). As students learn to solve problems, they will be better prepared for the workforce of tomorrow.

References Akınog˘lu, O., and R. Ö. Tandog˘an. 2007. The effects of problem-based active learning in science education on students’ academic achievement, attitude and concept learning. Eurasia Journal of Mathematics, Science & Technology Education 3 (1): 71–81. Capobianco, B., J. Yu, and B. French. 2015. Effects of engineering design-based science on elementary school science students’ engineering identity development across gender and grade. Research in Science Education 45 (2): 275–292. Dowd, S. B., and R. Davidhizar. 1999. Using case studies to teach clinical problem‐solving. Nurse Educator 24 (5): 42–46. Gallucci, K. 2006. Learning concepts with cases. Journal of College Science Teaching 36 (2): 16–20. Jones, G. M., E. Corin, M. Ennes, E. Cayton, G. Childers. 2019. Discovery engineering in physical science: Case studies for grades 6–12. Arlington, VA: NSTA Press. Lachapelle, C. P., and C. M. Cunningham. 2014. Engineering in elementary schools. In Engineering in pre-college settings: Synthesizing research, policy, and practices, ed. S. Purzer, J. Strobel, and M. Cardella, 61–88. Lafayette, IN: Purdue University Press. Miller, E. C., R. Januszyk, and O. Lee. 2015. Engineering progressions in the NGSS diversity and equity case studies. Science Scope 38 (9): 27–30. MPH Online Learning Modules. 2015. A brief history of public health: John Snow, the father of epidemiology. Boston University of Public Health. http://sphweb.bumc.bu.edu/ otlt/MPH-Modules/PH/PublicHealthHistory/publichealthhistory6.html. National Academies of Sciences, Engineering, and Medicine (NASEM). 2018. Science and engineering for grades 6–12: Investigation and design at the center. Washington, DC: National Academies Press.

10

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

INTRODUCTION

National Academy of Engineering. 2016. Grand challenges for engineering: Imperatives, prospects, and priorities. Washington, DC: National Academies Press. National Academy of Engineering and National Research Council. 2009. Engineering in K–12 education: Understanding the status and improving the prospects. Washington, DC: National Academies Press. National Center for Case Study Teaching in Science. About. http://sciencecases.lib.buffalo.edu/ cs/about. National Research Council (NRC). 2012. A framework for K–12 science education: Practices, crosscutting concepts, and core ideas. Washington, DC: National Academies Press. NGSS Lead States. 2013. Next Generation Science Standards: For states, by states. Washington, DC: National Academies Press.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

11

Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

QUIT BUGGING ME Controlling Mosquitoes to Stem Malaria Infection

1

A Case Study Using the Discovery Engineering Process Introduction Malaria is an infectious disease caused by a parasite that is transmitted to humans by mosquitoes (Figure 1.1). Humans with malaria get very sick with flu-like symptoms such as high fever, muscle aches, chills, vomiting, and diarrhea. The disease can be fatal and is the leading cause of death in many developFIGURE 1.1 ing countries. The Centers for Disease Control and Prevention The Anopheles Mosquito (CDC) estimates that 3.2 billion people are at risk of getting malaria, and the World Health Organization (WHO) reports that approximately 438,000 malaria deaths occurred in 2015. While drugs, insecticides, and bed nets help fight against malaria transmission (being bit by a malariacarrying mosquito), scientists are attempting to develop an effective vaccine. However, this

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

13

1 effort is difficult because the malaria parasite is a complex pathogen that reproduces quickly. For now, careful observations and creative ingenuity is generating a new generation of materials and tools to control or eliminate mosquitoes and the malaria-causing parasites they carry.

Lesson Objectives By the end of this case study, you will be able to • explain the life cycle of the malaria parasite, including transmission to humans; • analyze data trends of malaria transmission and change in global temperatures; and • create a proposal for a program to aid in the reduction or elimination of malaria transmission and infections.

The Case The account below outlines the discovery of the cause of malaria. Once you have finished reading, answer the questions that follow. Cases of malaria infecting humans have been reported for thousands of years. For a long time, people believed that the flu-like symptoms of malaria were caused by miasmas, or poisonous clouds of vapor, from swamps. In the late 1800s, a French army offiFIGURE 1.2 cer named Charles Louis Alphonse Laveran decided to observe what physically happened to people sick with malaria in order to find out Plasmodium what was causing this disease. He observed that the spleens of malaria patients would get bigger when they were sick. So, he took blood cells from the spleens of 200 patients and looked at them under a microscope. He saw that in 148 of these patients, blood cells had little tails sticking out of them. The tails were flagella, which was known to be a part of parasitic cells. Laveran’s studies revealed that malaria was caused by the Plasmodium parasite (Figure 1.2). Laveran’s observations led to the discovery of what caused malaria, but still he did not know how humans came in contact with the Plasmodium parasite.

14

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

QUIT BUGGING ME

| Controlling Mosquitoes to Stem Malaria Infection

1

After Laveran’s discovery, scientists began suspecting that mosquitoes were responsible for transmitting Plasmodium to humans. But they were unsure how the insects did this. Some scientists argued that humans became infected with Plasmodium by drinking water contaminated by infected mosquitoes. Others believed that a mosquito could carry the parasite on its proboscis (its tubular mouthpart used for feeding). Scientists discovered through a series of experiments that if mosquitoes fed on humans infected with malaria, the insects transmitted the disease to uninfected individuals. To further support this finding, an experiment was conducted in 1898 in Italy with two groups of people. One group included 112 individuals who were protected against mosquitoes; the other group included 415 people who were not protected. All members of the unprotected group contracted malaria while only 5 people in the protected group were infected. This led to further research identifying mosquitoes as the transmitters of malaria.

Recognize, Recall, and Reflect 1. What was the reason that Charles Louis Alphonse Laveran chose to examine blood cells from the spleen to look for the cause of malaria? What did he see under the microscope that made him think he identified the cause of the disease? 2. Why do you think some scientists once believed that humans became infected with Plasmodium from drinking contaminated water? 3. The experiment in Italy involved infecting healthy humans to see if Plasmodium was passed from mosquito to human. Do you think it was right or wrong to involve healthy humans in an experiment that could kill them? Why?

Investigate and Explain We now know that only female mosquitoes of the genus Anopheles transmit malaria. If this type of mosquito ingests infected blood, the Plasmodium parasite reproduces inside the insect and contaminates its saliva, which is injected into the mosquito’s next bite victim. When the Plasmodium parasite carried by this mosquito enters the human body, it moves into the bloodstream. It then migrates to the liver and multiplies within liver cells. Afterwards, the parasite leaves the liver and invades red blood cells. Figure 1.3 (p. 16) shows the malaria parasite’s life cycle as it travels between a human host and the vector (the mosquito carrying the Plasmodium). Malaria is typically found in tropical and subtropical areas, such as Africa, South Asia, Central America, and the Caribbean. This is because the Plasmodium needs warm temperatures to grow and mature in mosquitoes before being transmitted to humans. Scientists are reporting that the geographic range of malaria transmission

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

15

1 FIGURE 1.3 Life Cycle of the Malaria Parasite

will increase due to global warming, putting more people at risk of being infected. Some scientists predict that if global temperatures continue to rise, infected female Anopheles mosquitoes will spread malaria to new locations at higher altitudes that were once cooler. Examine the data on malaria infection rates by altitude in Figure 1.4. It shows the rate of reported malaria infections in the countries of Ethiopia and Colombia at different altitudes during years that are warmer or colder on average. After examining the data, answer the questions that follow. 1. What does the graph tell you about how altitude and temperature affect reported malaria cases? 2. How do the data in this graph support the hypothesis that malaria will likely spread to more geographic areas due to global warming?

16

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

QUIT BUGGING ME

| Controlling Mosquitoes to Stem Malaria Infection

1

FIGURE 1.4 Reported Cases of Malaria by Altitude During Cold Years and Warm Years

Source: Adapted from Siraj et al. (2014).

Activity Imagine you are an epidemiologist (a scientist who studies the effect of diseases on human populations) with an interest in learning more about the spread of malaria. The World Health Organization has instructed you to study trends from reported malaria cases over a five-year period in Central Africa. Look at the information in Table 1.1 (p. 18), which includes reported cases of malaria over five years. (Note: This is simulated data based on actual estimates and trends from WHO.) Plot out the data points from Table 1.1 onto the graph that appears right below, using a different color of pencil or pen for each country. Then connect each country’s data points to create a line. After completing the activity, answer the questions that follow.

Activity Questions 1. Describe the general trend of reported cases of malaria for each country over the five-year period. 2. Come up with a hypothesis as to why the malaria rates are decreasing in some of these countries and increasing in the others.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

17

1 TABLE 1.1 Reported Cases of Malaria Country

Year 1

Year 2

Year 3

Year 4

Year 5

Democratic Republic of the Congo

3,074

3,136

3,199

3,263

3,328

Angola

2,597

2,532

2,469

2,407

2,347

Nigeria

3,323

3,457

3,595

3,738

3,888

Chad

3,210

3,130

3,052

2,976

2,972

Ethiopia

1,382

1,396

1,410

1,424

1,438

Central African Republic

2,784

2,714

2,646

2,580

2,515

Source: Simulated data based on WHO estimates and trends (2017).

Graph of Malaria Trends Over Five Years 4,000 Reported Cases of Malaria Per Country

3,500 3,000 2,500 2,000 1,500 1,000

500 0

Year 1

Year 2

Year 3

Year 4

Year 5

Apply and Analyze Eliminating the vector of a disease is one of many strategies to eliminate or reduce infectious diseases. Read this article from the British Broadcasting Corporation on the issue of eradicating mosquitoes: www.bbc.com/news/magazine-35408835. Then, answer the questions that follow.

18

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

QUIT BUGGING ME

| Controlling Mosquitoes to Stem Malaria Infection

1

1. How would removing mosquitoes from the ecosystem affect the environment? 2. What can humans do to protect themselves from infected mosquitoes?

Design Challenge The case study in this lesson illustrates how a scientific observation led to deeper understanding of a problem. Observations and discoveries often provide useful knowledge. They also spark ideas for innovations. This is especially true in the field of engineering. Engineering is the application of scientific observations and new understandings using creativity, imagination, and the designing and building of new materials to address and solve problems in the real world. You will now be asked to take the science you have learned in this case and design a process or product to address a real-world issue. Engineers use the engineering design process (Figure 1.5, p. 20) as steps to address a real-world problem. You will now use this process as you come up with a strategy to reduce or eliminate malaria transmission. In this case, you are asking the question (Step 1) of how you can help reduce or eliminate malaria transmission and infections. Drawing on outside research and your creativity, you will then brainstorm (Step 2) a specific way to control or stop the spread of the disease. Afterward, you will come up with a plan (Step 3) for your malaria prevention program. Next, you will create a proposal for the CDC that outlines the design (Step 4) of your idea (i.e., how you will implement it). Then, you will work with your classmates to think about how you would test your strategy (Step 5). Finally, you will think of improvements (Step 6) you could make your strategy.

1. Ask Questions Ask questions about malaria prevention. For instance, what are some ways you might reduce or eliminate the spread of the disease? What are practices people can follow to avoid infection? What products might be useful in helping to stop malaria transmission?

2. Brainstorm and Imagine Currently, there are malaria treatment programs that focus on different methods to reduce malaria transmission and infections. You can read more about these programs here: www.cdc.gov/malaria/malaria_worldwide/reduction/index.html. Once you’ve finished reading, brainstorm a new specific method for reducing or eliminating malaria transmission and infections. For instance, placing insecticide-treated nets over water sources where mosquitoes breed could disrupt the reproductive cycle of mosquitoes, thereby preventing disease transmission. Think creatively about the life cycle of malaria, how it is transmitted, and current treatment programs as you brainstorm your idea.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

19

1 FIGURE 1.5 The Engineering Design Process

1 Ask Questions and Define the Problem 6

2

Revise and Improve

Brainstorm and Imagine

3 5

The Engineering Design Process

3

Test and Evaluate

Plan 4 Design and Create

3. Create a Plan Create a plan for your malaria prevention method. In your plan, you will (1) summarize how your method will reduce or eliminate cases of malaria, (2) detail materials or information you would need in order to turn your idea into a reality, (3) describe who or what is affected by your strategy to reduce malaria cases, and (4) explain the advantages and disadvantages of your idea. Use the Create a Plan worksheet (p. 22) for guidance.

4. Design and Create Create a program proposal for the CDC describing your malaria prevention strategy.

20

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

QUIT BUGGING ME

| Controlling Mosquitoes to Stem Malaria Infection

1

5. Test and Evaluate Think about how you would test the safety and efficacy of your plan. Consider these questions: • Phase 1—What would you do for laboratory testing? • Phase 2—What would you do for animal-based testing? • Phase 3—What would you do for clinical trials? • Surveillance—What would you do to ensure ongoing evaluation of the plan? Add this information to your Evaluation Plan graphic organizer (p. 23), and then add this plan to your proposal.

6. Revise and Improve Give your Create a Plan and Evaluation Plan graphic organizers to one or more of your peers for review. Listen to your peers’ feedback and take some time to revise and make improvements. What are some ways you can use their input to refine your strategy? You may choose to accept all or only some of the feedback. Be sure to justify the reasoning for your choices.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

21

1 Create a Plan

22

1

Describe how your new plan will reduce or eliminate cases of malaria.

2

Detail materials or information you would need in order to turn your idea into a reality.

3

Describe who or what is affected by your plan to reduce malaria cases.

4

What are the advantages of your new idea?

5

What are the disadvantages of your new idea?

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

QUIT BUGGING ME

| Controlling Mosquitoes to Stem Malaria Infection

1

Evaluation Plan

Step #1:

_____________________________________________________________________ Step #2:

_____________________________________________________________________ Step #3:

_____________________________________________________________________ Step #4:

_____________________________________________________________________

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

23

1 TEACHER NOTES

QUIT BUGGING ME

CONTROLLING MOSQUITOES TO STEM MALARIA INFECTION A Case Study Using the Discovery Engineering Process

Lesson Overview In this lesson, students learn how scientists discovered the way in which malaria spreads. The discovery of malaria transmission and subsequent human infection has led to attempts in controlling or eliminating malaria or transmission of malaria, however, billions of individuals are still at risk for malaria infection. Students will review malaria infection data and reported cases. Last, students will create a plan that outlines a means to help reduce or eliminate malaria transmission and infections.

Lesson Objectives By the end of this case study, students will be able to • explain the life cycle of the malaria parasite, including transmission to humans; • analyze data trends of malaria transmission and change in global temperatures; and • create a proposal for a program to aid in the reduction or elimination of malaria transmission and infections.

Use of the Case Due to the nature of these case studies, teachers may elect to use any section of each case for their instructional needs. The sections are sequenced in order (scaffolded) so students think more deeply about the science involved in the case and develop an understanding of engineering in the context of science.

24

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

QUIT BUGGING ME

| Controlling Mosquitoes to Stem Malaria Infection TEACHER NOTES

1

Curriculum Connections Lesson Integration This lesson may be taught during a unit on bacterial characteristics, infectious disease, transmission of disease, or epidemiology. It also fits well into a lesson on data interpretation.

Related Next Generation Science Standards PERFORMANCE EXPECTATIONS • MS-LS1-3. Use argument supported by evidence for how the body is a system of interacting subsystems composed of groups of cells. • MS-ETS1-1. Define the criteria and constraints of a design problem with sufficient precision to ensure a successful solution, taking into account relevant scientific principles and potential impacts on people and the natural environment that may limit possible solutions. • MS-ETS1-2. Evaluate competing design solutions using a systematic process to determine how well they meet the criteria and constraints of the problem. • MS-ETS1-3. Analyze data from tests to determine similarities and differences among several design solutions to identify the best characteristics of each that can be combined into a new solution to better meet the criteria for success. • HS-ETS1-2. Design a solution to a complex real-world problem by breaking it down into smaller, more manageable problems that can be solved through engineering.

SCIENCE AND ENGINEERING PRACTICES • Asking Questions and Defining Problems • Developing and Using Models • Planning and Carrying Out Investigations • Analyzing and Interpreting Data • Constructing Explanations and Designing Solutions

CROSSCUTTING CONCEPTS • Patterns • Cause and Effect • Structure and Function

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

25

1 Related National Academy of Engineering Grand Challenges • Engineer Better Medicines • Advance Health Informatics • Engineer the Tools of Scientific Discovery

Lesson Preparation It is helpful for students to have some understanding of prokaryotes, infectious disease, and disease transmission before starting the lesson. Review the concepts of infectious disease (like the life cycle of Plasmodium) so students can understand the various mechanisms by which diseases spread to humans. You will need to make copies of the entire student section for the class. Students will need internet access at various points in the lesson. Alternatively, you can project videos or print and distribute copies of online content for the class. Look at the Teaching Organizer (Table 1.2) for suggestions on how to organize the lesson.

Time Needed Up to 150 minutes

TABLE 1.2 Teaching Organizer Section

26

Time Suggested

Materials Needed

Additional Considerations

The Case

10 minutes

Student pages

Individual in-class activity or homework prior to start of lesson

Investigate and Explain

30 minutes

Student pages

In-class activity done individually or in pairs

Activity

30 minutes

Student pages, internet access

Small-group or individual activity

Apply and Analyze

20 minutes

Student pages, internet access

Small-group or individual activity

Design Challenge

45–60 minutes

Student pages, internet access

Small-group activity

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

QUIT BUGGING ME

| Controlling Mosquitoes to Stem Malaria Infection TEACHER NOTES

1

Vocabulary • epidemiologist

• parasite

• fatal

• pathogen

• host

• Plasmodium

• insecticides

• proboscis

• malaria

• transmission

• miasmas

• vaccine

• mosquito nets

• vector

Extension You could follow this lesson with a discussion on the importance of community engagement in addressing public health issues.

Assessment Use the Teacher Answer Key to check the answers to section questions. You can evaluate the students’ research proposals to assess the Design Challenge. Proposals should include a description of a new strategy to prevent malaria transmission, how the strategy will reduce or eliminate malaria transmission, materials needed for implementation, the makeup and number of people affected by the strategy, and how problems with the strategy will be addressed. Proposals should also describe how students would collect data to test and evaluate their strategy. Students should be able to report or state any constraints or drawbacks they can foresee with implementing this design.

Teacher Answer Key Recognize, Recall, and Reflect 1. What was the reason that Charles Louis Alphonse Laveran chose to examine blood cells from the spleen to look for the cause of malaria? What did he see under the microscope that made him think he identified the cause of the disease? He had observed that people with malaria had enlarged spleens. So, he thought something in their spleens might be reacting to the disease. When he saw flagella, which are known to be a body part of parasites, he thought he had found the cause.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

27

1 2. Why do you think some scientists once believed that humans became infected with Plasmodium from drinking contaminated water? Answers will vary. But students might guess that scientists knew mosquitoes lay eggs in water and perhaps thought drinking water with contaminated eggs was an easy way for humans to make contact with the disease. They might also say that humans contract other diseases from tainted water so scientists may have assumed the same was true of malaria. 3. The malaria experiment in Italy involved infecting healthy humans to see if Plasmodium was passed from mosquito to human. Do you think it was right or wrong to involve healthy humans in an experiment that could kill them? Why? Answers will vary.

Investigate and Explain 1. What does the graph tell you about how altitude and temperature affect reported malaria cases? The graph shows that reported cases of malaria decrease as altitude increases. It also shows that no matter the altitude, there are more cases reported in warm years as compared to cold years. 2. How do the data in this graph support the hypothesis that malaria will likely spread to more geographic areas due to global warming? During warmer years, malaria appears at higher altitudes where it isn’t usually found. The data indicate that a warmer climate caused by global warming could create the conditions necessary for malaria to appear in places where it normally doesn’t occur.

Activity Questions 1. Describe the general trend of reported cases of malaria for each country over the five-year period. Reported cases in the Democratic Republic of the Congo, Nigeria, and Ethiopia are increasing over time; Reported cases in Angola, Chad, and the Central African Republic are decreasing over time; Nigeria accounts for most malaria cases, followed by the Democratic Republic of the Congo.

28

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

QUIT BUGGING ME

| Controlling Mosquitoes to Stem Malaria Infection TEACHER NOTES

1

2. Come up with a hypothesis as to why the malaria rates are decreasing in some of these countries and increasing in the others. Answers will vary. Students might guess that the countries experiencing decreased rates have taken steps toward malaria control and elimination. The others may lack the resources or infrastructure to take preventative measures. Also, climate change may be exacerbating the problem of malaria transmission in these countries.

Apply and Analyze 1. How would removing mosquitoes from the ecosystem affect the environment? Some plants may not be able to be pollinated and will eventually die. Some birds and other living organisms feed on mosquitoes and may die due to lack of a food source. 2. What can humans do to protect themselves from infected mosquitoes? Student responses may vary but could include the use of chemical barriers (mosquito repellents) and physical barriers (masks or nets).

Resources and References Bates, C. “Would It Be Wrong to Eradicate Mosquitoes?” BBC News Magazine, January 2016. www.bbc.com/news/magazine-35408835. Centers for Disease Control and Prevention (CDC). 2018. Malaria. CDC. www.cdc.gov/ malaria. Centers for Disease Control and Prevention (CDC). 2015. How can malaria cases and deaths be reduced? CDC. www.cdc.gov/malaria/malaria_worldwide/reduction/index.html. Cox, F. E. 2010. History of the discovery of the malaria parasites and their vectors. Parasites & vectors 3 (1). https://doi.org/10.1186/1756-3305-3-5. Siraj, A. S., M. Santos-Vega, M. J. Bouma, D. Yadeta, D. Ruiz Carrascal, and M. Pascual. 2014. Altitudinal changes in malaria incidence in highlands of Ethiopia and Colombia. Science 343 (6175): 1154–1158. https://doi.org/10.1126/science.1244325. World Health Organization (WHO). 2017. Global Health Observatory data: Number of malaria cases. WHO. www.who.int/gho/malaria/epidemic/reportedcases/en.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

29

Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

GAME OF KNOWNS John Snow’s Research Into the Cause and Spread of Cholera

2

A Case Study Using the Discovery Engineering Process Introduction Less than 200 years ago, society had little idea what made people sick. A prevalent theory was that diseases were caused by miasma, or bad air that emanated from decomposing organic matter like rotting meat. This was known as miasma theory. In the 1880s, scientists found that specific microorganisms called germs were the agents of disease, not miasma (Figure 2.1). One of the major advances that led to this finding occurred in 1854 when an English doctor named John Snow  mapped a  cholera outbreak on a city block in London. Using purposeful sampling and expert observations, he was able to identify the outbreak’s actual source and prevent further spread of the disease in the neighborhood. With his work, Dr. Snow

FIGURE 2.1 Scanning Electron Microscope Image of Cholera Bacteria

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

31

2 helped usher in a field of science called epidemiology, which deals with the cause, spread, and control of disease.

Lesson Objectives By the end of this case study, you will be able to • compare miasma theory to the germ theory of disease and explain how the latter is used to understand epidemiology; • describe the process Dr. Snow used to identify the source of the 1854 cholera outbreak; • analyze maps using geographic information systems (GIS) principles in epidemiology; and • design a technology to help prevent or reduce the spread of an infectious disease.

The Case Read about the 1854 cholera outbreak in London, England. Once you have finished reading, answer the questions that follow. By the mid-19th century, London was a growing global city. Rapid expansion had led to an overflow of garbage and waste in several London neighborhoods. This was especially true in the city’s west end, which had no sanitation system and was full of animals whose waste pooled in pits. As these cesspools filled, the government began dumping the waste into the River Thames, the city’s major supply of drinking water. In the 1850s, devastating cholera outbreaks struck the city. Cholera epidemics in 1832 and from 1848 to 1849 had already killed around 20,000 people in London. Scientists and doctors had two competing theories on how people became sick with the disease. The miasma theory posited that cholera was caused by filth in the air from decomposing animals. Dr. John Snow was not convinced of the widespread belief that bad air caused the cholera outbreak. He noticed that neighborhoods that used water sources other than the River Thames or that filtered their drinking water had fewer deaths. He also observed that the drinking water from the River Thames had visible contaminants. Lastly, he found that prisons that switched their water supply to cleaner sources had fewer cases of cholera. Based on the pattern of residents who became sick, he hypothesized that cholera was spread by water contaminated with germs. To test his hypothesis, he needed to conduct an investigation.

32

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

GAME OF KNOWNS

| John Snow’s Research Into the Cause and Spread of Cholera

Over the course of about three days in the late summer of 1854, 127 people died of cholera on or near Broad Street in London’s Soho neighborhood. Within the next two weeks, 500 more people died. To understand how cholera spread, Dr. Snow conducted a study, interviewing the residents of Soho to determine where the individuals who were sickened or killed by cholera had lived. Dr. Snow was aware that a majority of people got their drinking water from water pumps scattered around the city (Figure 2.2). Most people drew their water from the pump closest to their home. Snow mapped the locations of 13 Soho pumps and plotted out the neighborhood’s reported cholera cases. His map showed a large cluster of cases near one of the pumps. After authorities prevented use of this pump, reports of cholera in the neighborhood dropped dramatically, and soon the outbreak came to an end.

2

FIGURE 2.2 Old-Fashion Water Pump in England

Recognize, Recall, and Reflect • What were some reasons for the poor sanitation conditions in 19th-century London? • How does miasma theory differ from the germ theory of disease? • What were at least two observations that made Dr. Snow think germs in tainted water caused the cholera outbreak?

Investigate and Explain Examine the map created by Dr. Snow during his investigation (Figure 2.3, p. 34). The water pumps are circled and labeled A through M. The cholera cases are marked with black bars jutting off the streets. (The longer the bar, the more cholera cases there were in that living space.) 1. According the map Dr. Snow created, which pump is most likely the source of cholera in this outbreak? 2. Why do you think a map like this is effective in communicating data?

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

33

2 FIGURE 2.3 Snow’s Cholera Outbreak Map

Activity Imagine you are a medical geographer who works for the World Health Organization (WHO), an international nonprofit that aids in global health responses. Your job is to site, or place, tube wells (which are like water pumps) in areas where people struggle to access clean drinking water. Today, you are tasked with finding the location for a new tube well in a village that has been struggling with cholera outbreaks. Cholera is a waterborne disease that comes from infected fecal matter and is spread by drinking contaminated water or eating food that has been washed in contaminated water. Therefore, placing a tube well in a contamination-free spot is important to preventing the spread of disease. You will conduct an epidemiological investigation in two parts to assess the cholera outbreak and site the best location for the new tube well.

34

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

GAME OF KNOWNS

| John Snow’s Research Into the Cause and Spread of Cholera

Part I To begin your epidemiological study, you need maps that will help you understand the nature and cause of the outbreak. Your teacher will provide you with the following maps.

2

FIGURE 2.4 Sample Contour Map

• Map 1 shows cholera cases reported in the village. • Map 2 shows the village’s water resources (freshwater, or drinkable, rivers and lakes). • Note that water flows from upstream to downstream (or from higher elevations to lower elevations). • Map 3 shows contour lines to indicate the flow of water in the village. (A contour map shows areas of equal elevation [see Figure 2.4]. Smaller, circular areas indicate peaks and larger, irregular-shaped areas indicate valleys.) This map also shows potential tube well locations, labeled A through E. To better understand map data, epidemiologists and geographers will examine different maps separately and then together, layering the information to form a more comprehensive picture (which is called a Geographic Information System, or GIS). This allows scientists to visualize, analyze, and interpret data in order to understand relationships, patterns, and trends among the data sets (Figure 2.4). Inspect each map (1, 2, and 3) separately, making notes of patterns in the data. Then, overlay the three maps to see if additional information emerges. Based on your map analysis, rank your choices for the tube well location (spots A through E on Map 3) on the Geography Ranking Chart. Then, provide a short justification for each ranking, referencing information from the maps.

Geography Ranking Chart Ranking

Location

Justification

1st choice 2nd choice 3rd choice 4th choice 5th choice

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

35

2 Part II Maps can tell part of the story but usually not all of it. Dr. Snow not only mapped out reported cholera cases but also interviewed citizens to better understand how the cholera spread. As part of your assignment with WHO, you decide to interview community members to understand how water is collected and to learn the community’s rules on fecal waste disposal. From your outreach efforts, you discover three key facts: • Women rarely travel farther than 1.5 km to gather water, preferring to collect water located closest to their homes. • Women alone collect the water and prepare all meals in this village. • For a toilet area to be sustainable (and not overflow), there needs to be one toilet for every four homes in the village. A toilet area that serves more than four homes will overflow with waste and cause a contamination risk. Based on your interview analysis and maps, rank your choices for the tube well location (spots A through E on Map 3) in the Interview Ranking Chart. Then, provide a short justification for each ranking, using your collected information.

Interview Ranking Chart Ranking

Location

Justification

1st choice 2nd choice 3rd choice 4th choice 5th choice

Use the Epidemiologist Field Report form to write out your final recommendation for WHO on where to place the new tube well. Justify in detail your reasoning for choosing location A, B, C, D, or E. Refer to your map and interview analyses as you write out this final report.

36

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

GAME OF KNOWNS

| John Snow’s Research Into the Cause and Spread of Cholera

2

Epidemiologist Field Report

Apply and Analyze Determining the best place to locate a tube well is a good start to reducing cholera. Other measures can be taken as well. The Centers for Disease Control and Prevention (CDC) states that people who have inadequate water treatment, poor sanitation, and inadequate hygiene are at greater risk for contracting cholera. Read this fact sheet from the CDC on the disease: www.cdc.gov/cholera/pdf/five-basic-choleraprevention-messages.pdf. Once done, use what you’ve learned to brainstorm interventions you would recommend for the village for each aspect of cholera risk: Inadequate water treatment: _________________________________________________________________ Poor sanitation: _________________________________________________________________ Inadequate hygiene: _________________________________________________________________

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

37

2 Design Challenge

FIGURE 2.5

The case study in this lesson illustrates The Engineering Design Process how a scientific observation led to the solution to a problem. Observations and discoveries often spark ideas for 1 innovations. This is especially true in Ask Questions and Define the the field of engineering. Engineering is Problem the application of scientific understand6 2 ing through creativity, imagination, Revise Brainstorm and the designing and building of new and Improve and Imagine The materials to address and solve problems Engineering in the real world. You will now be asked Design to take the science you have learned in Process this case and design a process or prod3 5 3 uct to address a real-world issue. Test Plan Engineers use the engineering design and Evaluate process (Figure 2.5) as steps to address 4 a real-world problem. You will now use Design this process as you come up with a techand Create nology to reduce or eliminate the spread of an infectious and communicable disease. In this case, you are asking questions (Step 1) about what is involved in reducing the spread of an infectious disease like cholera. Using outside research and your own creativity, you will brainstorm (Step 2) a specific technology designed to prevent the spread of that disease. Then, you will create a plan (Step 3) for your proposed technology. Afterward you will develop a design for your technology (Step 4) and come up with a way to test it (Step 5). Finally, you will consider improvements (Step 6) to your product.

1. Ask Questions Cholera is only one form of infectious and communicable disease that threatens human health worldwide. Visit the following link to find out about other infectious diseases, such as tuberculosis and dengue fever: wwwn.cdc.gov/nndss/conditions/ notifiable/2018. Pick a disease and ask questions about it. For example, how does the disease spread? What are some ways of treating and preventing the disease? What types of technology could help prevent the spread of the disease?

2. Brainstorm and Imagine Use online sources to learn more about the disease you chose, finding answers to the questions you posed in Step 1. Then, brainstorm a specific technology you could design or adapt to help stop or reduce the spread of the disease. For example,

38

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

GAME OF KNOWNS

| John Snow’s Research Into the Cause and Spread of Cholera

2

boiling water kills the cholera bacteria. Yet, accessing the wood or electricity needed to boil water can be difficult in certain places. The invention of solar-powered kettles has allowed people to boil water using only energy from the Sun. This has expanded access to clean drinking water across the world.

3. Create a Plan Create a plan for your product. In the plan, describe the disease you chose to focus on and the technology you brainstormed to fight the disease. Keep in mind geographic factors—neighborhood layout, topography, housing types, water resources, energy resources, air quality, etc.—that might affect your product and how it works. For instance, how would you power a device designed to prevent diseases in rural areas without reliable electricity? Also consider cultural factors— government regulations, local habits, traditions, etc.—that could impact your product. For example, if it’s customary in a society to carry water around in heavy containers, you might want to make a lightweight product to prevent people from feeling overloaded. Finally, discuss the benefits and limitations of your product. Use the Create a Plan graphic organizer (p. 40) for guidance.

4. Design and Create Sketch a design of your product. As you work on your design, consider these questions: • What will your technology look like and how will it be used? • How does your design interact with the disease you have chosen? (Does it block the agent [e.g., bacteria, virus, fungi] that causes the disease? Does it eliminate the entity [e.g., vector, water, air] that spreads the disease? Does it disrupt the way in which the disease spreads?) • How does your proposed technology address geographic factors? • How does your proposed technology address cultural factors?

5. Test and Evaluate Come up with a method for testing and evaluating your new technology. How might you test it in a lab? How might you test it in the field with humans who are actually at risk of contracting infectious diseases? Add your evaluation plans to your sketch.

6. Revise and Improve Present your plans to your peers. Listen to their feedback on your design and take some time to revise and make improvements. What are some ways you can use their input to refine your design? You may choose to accept all or only some of the suggestions. Be sure to justify your reasons for accepting or not using peer feedback.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

39

2 Create a Plan What infectious disease did you choose and how does it spread?

________________________________________________________________________ ________________________________________________________________________ _______________________________________________________________________ Describe your idea for a technology that could prevent or reduce your chosen disease.

________________________________________________________________________ ________________________________________________________________________ _______________________________________________________________________

40

Geographic Considerations for Product

Cultural Considerations for Product

What are the advantages of your new idea?

What are the disadvantages of your new idea?

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

GAME OF KNOWNS

| John Snow’s Research Into the Cause and Spread of Cholera

2

TEACHER NOTES

GAME OF KNOWNS

JOHN SNOW’S RESEARCH INTO THE CAUSE AND SPREAD OF CHOLERA A Case Study Using the Discovery Engineering Process

Lesson Overview In this lesson, students explore the 1854 cholera outbreak in London and analyze the work done by Dr. John Snow to understand the cause and spread of the disease. Students will look at data and maps to see how Dr. Snow drew his conclusions. They will also site a tube well (water pump) for a hypothetical village struggling with a cholera outbreak. Finally, students will use what they’ve learned along with online research to design or adapt technology to help prevent or lessen the spread of the disease.

Lesson Objectives By the end of this case study, students will be able to • compare miasma theory to the germ theory of disease and explain how the latter is used to understand epidemiology; • describe the process Dr. Snow used to identify the source of the 1854 cholera outbreak; • analyze maps using geographic information systems (GIS) principles in epidemiology; and • design a technology to help prevent or reduce the spread of an infectious disease.

Use of the Case Due to the nature of these case studies, teachers may elect to use any section for their instructional needs. They are sequenced in order (scaffolded) so students think more deeply about the science involved in the case and develop an understanding of engineering in the context of science.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

41

2 Curriculum Connections Lesson Integration This lesson may be taught in beginner biology courses during a unit on understanding disease or epidemiology. It also fits well with topics related to data interpretation or the use of various types of quantitative and qualitative data to assess patterns and make decisions.

Related Next Generation Science Standards PERFORMANCE EXPECTATIONS • MS-ETS1-1. Define the criteria and constraints of a design problem with sufficient precision to ensure a successful solution, taking into account relevant scientific principles and potential impacts on people and the natural environment that may limit possible solutions. • MS-ETS1-2. Evaluate competing design solutions using a systematic process to determine how well they meet the criteria and constraints of the problem. • MS-ETS1-3. Analyze data from tests to determine similarities and differences among several design solutions to identify the best characteristics of each that can be combined into a new solution to better meet the criteria for success. • HS-ETS1-3. Evaluate a solution to a complex real-world problem based on prioritized criteria and trade-offs that account for a range of constraints, including cost, safety, reliability, and aesthetics, as well as possible social, cultural, and environmental impacts.

SCIENCE AND ENGINEERING PRACTICES • Asking Questions and Defining Problems • Developing and Using Models • Planning and Carrying out Investigations • Analyzing and Interpreting Data • Constructing Explanations and Designing Solutions • Engaging in Argument From Evidence

42

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

GAME OF KNOWNS

| John Snow’s Research Into the Cause and Spread of Cholera TEACHER NOTES

2

CROSSCUTTING CONCEPTS • Patterns • Cause and Effect • Systems and System Models

Related National Academy of Engineering Grand Challenges • Provide Access to Clean Water • Advance Health Informatics • Engineer the Tools of Scientific Discovery

Lesson Preparation Before teaching the lesson, review the concepts of infectious disease so students can understand the various mechanisms that cause and spread diseases. You will need to make copies of the entire student section for the class. Students will need internet access at various points in the lesson. Alternatively, you can project videos or print and distribute copies of online content for the class. Students will need copies of Maps 1, 2, and 3 (pp. 43–44), each printed onto transparency paper so they can overlay the information for a GIS analysis. Look at the Teaching Organizer (Table 2.1, p. 45) for suggestions on how to organize the lesson.

N

0

1km

Map # 1 - Reported Cholera Cases KEY: Toilets

Homes

Cholera-Infected Homes

Community Center

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

43

2

N

0

1km

Map # 2 - Water Resources KEY:

Body of Fresh Water

44

Freshwater River

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

GAME OF KNOWNS

| John Snow’s Research Into the Cause and Spread of Cholera TEACHER NOTES

2

Time Needed Up to 115 minutes

TABLE 2.1 Teaching Organizer Section

Time Suggested

Materials Needed

Additional Considerations

The Case

10 minutes

Student pages

Activity done individually in class or as homework prior to class

Investigate and Explain

10 minutes

Student pages

Activity done individually or in pairs

Activity

20 minutes

Student pages, maps copied onto transparency paper

Activity done individually or in pairs

Apply and Analyze

10–15 minutes

Student pages, online access

Individual activity

Design Challenge

45–60 minutes

Student pages, online access

Small-group activity

Vocabulary • agent

• germs

• cesspools

• infectious

• cholera

• miasma theory

• communicable

• outbreak

• diseases

• sanitation

• epidemiology

• water pumps

• germ theory of disease

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

45

2 Extension This lesson can be used as an opportunity to collaborate with an actual epidemiologist (perhaps over Skype) to get real-time feedback on their designs.

Assessment Use the Teacher Answer Key to check the answers to section questions. To assess the Design Challenge, you can evaluate the students’ product designs. The designs should adhere to the etiology of the students’ chosen diseases. Student products should also clearly take into account geographic and cultural constraints.

Teacher Answer Key Recognize, Recall, and Reflect 1. What were some reasons for the poor sanitation conditions in 19th-century London? London experienced a large influx of new residents; the city had no sanitation system to keep things clean; some neighborhoods were full of animals that created a lot of waste; the government dumped waste into the River Thames, the city’s primary supply of drinking water. 2. How does miasma theory differ from the germ theory of disease? Miasma theory stated that disease spread through air that was contaminated by rotting matter; the germ theory of disease states that microorganisms spread disease. 3. What were at least two observations that made Dr. Snow think germs in tainted water caused the cholera outbreak? Neighborhoods that used water sources other than the River Thames or that filtered their drinking water had fewer deaths; the River Thames had visible contaminants; prisons that switched their water supply to cleaner sources had fewer cases of cholera.

Investigate and Explain 1. According the map Dr. Snow created, which pump is most likely the source of cholera in this outbreak? Water Pump G is the most likely source; this is where the highest number of reported cases are.

46

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

GAME OF KNOWNS

| John Snow’s Research Into the Cause and Spread of Cholera TEACHER NOTES

2

2. Why do you think a map like this is effective in communicating data? Answers will vary. Students might point out that displaying data in such a way allows people to visualize the problem in a way that merely looking at numbers can’t do.

Activity, Parts I and II Tube well location rankings and field reports with final recommendations: Students’ rankings may vary. After evaluating locations based on the maps in Part I, students might give a high ranking to spots that are upstream from houses and toilets, as these are less likely to become contaminated. After reading the finds from the interview in Part II, rankings may be adjusted to favor locations that are away from overused toilets and within 1.5 km to villages. In their field reports, students should be able to recommend a location for the new tube well and justify their choice using evidence from the maps and interview. Well B may be the best choice as it is centrally located for most towns (1.5 km away or less), upstream, and too far away from human settlements to be contaminated by cholera due to human activities.

Apply and Analyze Interventions for each aspect of cholera risk: Students’ answers will vary but may include some of the following ideas: 1. Inadequate water treatment: Spread awareness about the importance of boiling water and cooking food (versus eating it raw) 2. Poor sanitation: Have enough toilets for each group of houses; locate toilets in an area where waste cannot travel downhill into a freshwater body or stream 3. Inadequate hygiene: Provide hand sanitizer or washing stations near toilets and homes

Resources and References Centers for Disease Control and Prevention (CDC). 2016. Cholera prevention and control. CDC. www.cdc.gov/cholera/pdf/five-basic-cholera-prevention-messages.pdf. Centers for Disease Control and Prevention (CDC). 2018. 2018 notifiable conditions. CDC. wwwn.cdc.gov/nndss/conditions/notifiable/2018. Mackenzie, J. GIS analyses of Snow’s map. University of Delaware. www1.udel.edu/ johnmack/frec682/cholera/cholera2.html. Tuthill, K. “John Snow and the Broad Street Pump.” Cricket Magazine, November 2003. www.ph.ucla.edu/epi/snow/snowcricketarticle.html. World Health Organization (WHO). About. www.who.int/about/en.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

47

Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

THALIDOMIDE

3

Hidden Tragedy and Second Chances

A Case Study Using the Discovery Engineering Process Introduction Developed by a German drug company in the 1950s, thalidomide (Figure 3.1) was initially hailed as a wonder drug. It was marketed for the treatment of respiratory infections, insomnia, and FIGURE 3.1 morning sickness (nausea and vomiting during pregnancy). Thalidomide became a very pop- Thalidomide Tablets Circa 1960 ular medication in some countries. However, the medication had not been thoroughly tested to determine if it would harm a pregnant woman or her unborn child. That’s because scientists at the time believed that medication taken by pregnant women could not move through the placenta (a structure on the wall of a woman’s uterus) to affect the developing baby. Unfortunately, this theory was incorrect, and the

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

49

3 medication caused widespread harm. Yet, scientists later found an unexpected use for the drug.

Lesson Objectives By the end of this case study, you will be able to • explain how the Food and Drug Administration (FDA) tests medications before human use; • analyze data to explore the safety and efficacy of new and repurposed drugs to treat medical conditions; and • create a research proposal to justify and test a withdrawn drug for medical research.

The Case Read about the history of thalidomide and the discovery of the drug’s side effects. Once you have finished reading, answer the questions that follow. Thalidomide became available to patients in 1957 and was advertised as safe for everyone to take, including pregnant women. During the late 1950s, thalidomide became popular because it could be taken to treat a variety of medical issues, including sleeplessness, morning sickness, colds, and headaches. During the late 1950s and early 1960s, numerous reports emerged of children being born without arms and legs in many countries, especially in Europe where use of thalidomide was widespread. It turned out that thalidomide interfered with the development of the human embryo, resulting in at least 10,000 babies being born with disabilities. The severity and location of the deformities depended on when during the pregnancy the mother began using the drug. For instance, taken on approximately day 20, thalidomide caused brain damage. Taken from around day 24 to day 28, the drug caused phocomelia, a condition in which the arms and legs may be underdeveloped or absent. The impact of thalidomide on developing babies in the United States during the 1950s and 1960s was low thanks in large part to Dr. Frances Oldham Kelsey (Figure 3.2), who worked at the federal Food and Drug Administration (FDA). While reviewing the data and research on the effects of thalidomide, Dr. Kelsey realized that the pharmaceutical company manufacturing the drug did not have sufficient evidence of its safety. Although thalidomide was tested for a time on patients in the United States, it was never approved by the FDA or sold commercially. And after people became aware of its dangers, it was banned in many countries. The tragedy eventually led to tighter regulations for drug testing. (See the FDA Approval Process sidebar, p. 52.)

50

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

THALIDOMIDE

| Hidden Tragedy and Second Chances

3

Despite its history, thalidomide did FIGURE 3.2 not disappear from medical research. Over the years, it was studied as a Dr. Frances Oldham Kelsey With President potential treatment for such illnesses John F. Kennedy in 1962 as leprosy and HIV. In the early 1990s, scientists working at Harvard Medical School discovered that thalidomide prevented the growth of new blood vessels in rabbits. Then, in 1996, the wife of a cancer patient happened to call Harvard Medical School to discuss her husband’s case. The cancer patient had multiple myeloma, which forms in and spreads through bone tissue by creating new blood vessels to feed tumor cells. When the Harvard scientists learned about this patient, it sparked an idea: Because thalidomide targets blood vessels, the scientists realized that it might be an effective treatment for multiple myeloma. Later, the University of Arkansas conducted a study to test this hypothesis. Of the 84 patients who volunteered for the study, one-third responded to the thalidomide therapy. The results of the study showed that thalidomide was a promising new treatment for this type of cancer. The way thalidomide prevents cancerous cells from growing is by stopping overactive transcription factors—that is, proteins that drive how fast cells grow and multiply. Thalidomide is still used today to treat multiple myeloma and other forms of cancer.

Recognize, Recall, and Reflect 1. Why was thalidomide initially popular? 2. Why is it important for doctors to review all the test data on drugs that the public may use, as Frances Oldham Kelsey did in the case of thalidomide? 3. How does thalidomide affect cancer cells?

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

51

3 Investigate and Explain To determine if thalidomide is an effective drug, scientists are testing how cancer patients react to it. Now, you’ll take a look at data from a mock study, similar to one done by scientists investigating thalidomide’s effect on cancer patients. After examining the data, answer the questions that follow. • Type of Cancer: Multiple myeloma (a cancer usually located in bone tissue) • Total Number of Cancer Patients in Study: 98 • Research Methodology: All cancer patients in the study received a 200 mg dose of thalidomide once a day for six weeks. Then the cancerous tumors were measured to see if one of the following events occurred as a result of taking thalidomide: (1) complete remission, (2) reduction of the tumor, or (3) no change.

FDA Approval Process The FDA’s Center for Drug Evaluation and Research reviews new drugs before they are made available to the public. The process begins when a company wants to sell a drug in the United States. The company first must test the drug themselves and with an outside laboratory for safety and effectiveness. After laboratory testing, the company conducts animal testing. Clinical trials with humans may follow if preliminary results indicate that the drug is safe. Then, the drug company must send all of that data to the FDA. Data are then compiled and reviewed by FDA officials, who determine if the drug is approved or not approved for sale.

• Data: The cancer response data were collected at the end of the six-week period (Table 3.1). Additionally, the cancer patients that responded positively to thalidomide treatments (meaning their cancer was reduced or gone) were evaluated 10 months after the research period to document changes in cancer or patient status (Table 3.2).

TABLE 3.1 Cancer Response Data at Six Weeks Type of Cancer Response Remission (cancer is 100% gone)

5

Cancer reduced by at least 90%

13

Cancer reduced by at least 75%

14

Cancer reduced by at least 50%

9

Cancer reduced by at least 25%

7

Cancer did not respond or reduce

52

Number of Patients

50

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

THALIDOMIDE

| Hidden Tragedy and Second Chances

3

TABLE 3.2 Cancer Response Data at 10 Months Number of Original Patients

Number of Patients Whose Cancer Relapsed

Number of Patients Who Died

Remission (cancer is 100% gone)

5

0

0

Cancer reduced by at least 90%

13

2

1

Cancer reduced by at least 75%

14

3

0

Cancer reduced by at least 50%

9

4

2

Cancer reduced by at least 25%

7

4

2

Type of Cancer Response

1. According to Table 3.1, what percentage of all the cancer patients in the study experienced a reduction or complete remission of cancer due to the thalidomide treatment? 2. Ten months after the treatment, scientists revisited the cancer patients who responded positively to thalidomide. What is the importance of following up with patients several months after treatment? 3. If you worked for the FDA and reviewed the data shown here, would you recommend this drug for treating multiple myeloma? Why or why not? Reference specific data in Tables 3.1 and 3.2 in your response.

Activity Imagine you are a pharmacologist (a scientist who studies drug interactions) and you work for Superior Drug Company. Your company asked you to test three new drugs (Drug F, Drug B, and Drug Z) to see how well they fight against breast cancer. A total of 225 cancer patients signed up to participate in your clinical trials. They were divided into three groups of 75. Each group was assigned one of the three drugs to take. They received 300 mg of their drug once a week for 12 weeks. After the 12-week testing period, you collected information on how the cancer responded to the drug (whether it went into remission, was reduced, or was not affected). Now that your clinical trials are over, you will analyze this data (Table 3.3, p. 54).

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

53

3 TABLE 3.3 Percent Effectiveness of Reducing Cancerous Tumors of the Breast by Drug Type (F, B, and Z) Type of Cancer Response

Drug F

Drug B

Drug Z

Remission (cancer is 100% gone)

9

26

0

Cancer reduced by at least 90%

11

18

3

Cancer reduced by at least 75%

7

14

5

Cancer reduced by at least 50%

9

13

8

Cancer reduced by at least 25%

11

4

17

Cancer not affected

28

0

42

Total number of patients in group

75

75

75

Create a bar graph by plotting out the data listed in Table 3.3 for drug trials F, B, and Z. Use a different pencil or pen color for each trial. During the clinical trial, you also recorded the side effects experienced by the patients on each drug (Table 3.4). Remember that patients can report multiple side effects.

TABLE 3.4 Number of Patients Who Reported Various Side Effects for Each Drug Type (F, B, and Z) Side Effect Reported

Drug F

Drug B

Drug Z

69

72

59

11

17

6

Diarrhea

45

56

39

Nausea and vomiting

55

44

63

Headaches

23

37

19

Constipation

16

8

28

Appetite loss

58

49

52

Seizures

0

10

0

Loss of muscle control

2

11

1

Swelling of brain tissue

0

5

0

Fatigue Mouth and throat sores

54

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

THALIDOMIDE

| Hidden Tragedy and Second Chances

3

Activity Questions 1. Which of the three drugs would you recommend as the best one to treat breast cancer? Why? Are there any cases in which you’d recommend one of the less effective drugs to a patient? Refer to your collected data in your answer. 2. What additional measures or tests should be done before recommending any of these drugs to the FDA for sale? 3. How would you improve your research design for the next set of clinical trials?

Apply and Analyze Multiple companies are working to repurpose, or find new uses for, existing drugs, as in the case of thalidomide. Read this article from The Scientist about repurposing drugs, and then answer the questions that follow: www.the-scientist.com/features/ repurposing-existing-drugs-for-new-indications-32285. 1. Why is the partnership between drug companies and academic institutions beneficial in finding new purposes for old drugs? 2. According to this article, most successful cases of drug repurposing have been largely serendipitous (due to chance). Why do you think that is?

Design Challenge Engineering is the application of scientific understanding through creativity, imagination, and the designing and building of new materials to address and solve problems in the real world. You will be asked to take the science you have learned in this case and design a process or product to address a real-world issue. Engineers use the engineering design process (Figure 3.3, p. 56) as steps to address a real-world problem. You will now use this process as you come up with a way to repurpose a withdrawn drug. In this case, you are asking questions (Step 1) about how banned drugs can be used for new medical purposes. Using outside research and your own creativity, you will brainstorm (Step 2) a specific medication to reissue as a new treatment. Then, you will create a plan (Step 3) for this drug. Afterward you will design (Step 4) a proposal for the FDA that describes how you would go about repurposing your medication. You will also come up with a way to test (Step 5) and improve (Step 6) your product.

1. Ask Questions Thalidomide isn’t the only drug that has been banned for sale in the United States or in other parts of the world. A list of withdrawn drugs is available here: https:// en.wikipedia.org/wiki/List_of_withdrawn_drugs. Consider the following questions as

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

55

3 you begin to think about repurposing old drugs for new applications: Why should we consider banned drugs for new forms of treatment? How would you go about investigating new uses for banned drugs? Are there any situations in which it might be especially beneficial to reuse banned drugs, which have already been heavily researched?

2. Brainstorm and Imagine

FIGURE 3.3 The Engineering Design Process

1 Ask Questions and Define the Problem 6

2

Revise and Improve

Brainstorm and Imagine

The

Research a drug that has been Engineering banned, and brainstorm potential Design alternative uses for it. One way to do Process 3 5 this is by looking at the side effects of the medication and considering if any Test and Evaluate of them would make the drug usable for other conditions. For example, 4 scientists realized that a heart mediDesign and cation called minoxidil caused hair Create growth during testing. The drug was eventually reformulated into a product used to reverse thinning hair and baldness. What conditions could you treat with the medicine you chose?

3 Plan

3. Create a Plan Create a plan for your medication. Outline which drug you want to use and its original purpose. Describe how the drug works (its effects). Then, write down how these effects can be used to treat other conditions or diseases. Use the Create a Plan graphic organizer (p. 58) for guidance. Select one of your ideas to “pitch” as a new treatment to the FDA.

4. Design and Create Write a letter to the FDA that makes a convincing argument for repurposing your banned drug for a different disease or condition. Consider the following questions as you come up with your letter:

56

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

THALIDOMIDE

| Hidden Tragedy and Second Chances

3

• What was your drug originally used for, and why was it banned? • What other disease or condition do you want to treat with this drug? • How is your new treatment created? (That is, how does your drug work to combat the condition or illness?) • How would you protect patients from negative side effects? (For instance, would you restrict use of the drug for certain populations, such as pregnant women?) Fill out the Letter to the FDA worksheet (p. 59).

5. Test and Evaluate Think about how you would test the safety and efficacy of your plan. Consider these questions: • Phase 1—What would you do for laboratory testing? • Phase 2—What would you do for animal-based testing? • Phase 3—What would you do for clinical trials? • Surveillance—What would you do to ensure ongoing evaluation of the drug on the market? Use the Evaluation Plan graphic organizer (p. 60) for guidance, and then add this organizer to your letter to the FDA.

6. Revise and Improve Present your proposal to your peers. Listen to their feedback on your proposal and take some time to revise it and make improvements. What are some ways you can use their input to refine your proposal? You may choose to accept all or only some of the suggestions. Be sure to justify your reasons for accepting or not using the peer feedback.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

57

3 Create a Plan Describe the banned drug you chose.

________________________________________________________________________ ________________________________________________________________________ _______________________________________________________________________ What are the drug’s effects? Drug Effect #1



Drug Effect #2



Diseases/Disorders That Can Be Treated With Effect

Drug Effect #3

Diseases/Disorders That Can Be Treated With Effect

Diseases/Disorders That Can Be Treated With Effect

Which effect would you ultimately use as a treatment and why?

________________________________________________________________________ ________________________________________________________________________ _______________________________________________________________________

58

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

THALIDOMIDE

| Hidden Tragedy and Second Chances

3

Letter to the FDA Dear FDA review committee: I hope this letter finds you well. I write with regard to_____________ , which was originally used name of drug for the treatment of ________________________ . It was removed from the market in______ due to

original drug use

year

__________________________ . Another side effect of the drug is ____________________________

reason for ban

chosen side effect

______________________________________ . I wish to leverage this side effect in the treatment of

____________________________________________________ .

chosen disease

My proposed treatment will work by _________________________________________________ ____________________________________________________________________________________ ____________________________________________________________________________________ ____________________________________________________________________________________ ___________________________________________________________________________________. I believe this drug should be repurposed for the treatment of this disease for the following two reasons: • Reason 1: _______________________________________________________________________ _______________________________________________________________________________ _______________________________________________________________________________ • Reason 2: ______________________________________________________________________ _______________________________________________________________________________ _______________________________________________________________________________ Thank you,

__________________________________________

your name

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

59

3 Evaluation Plan

Step #1:

_____________________________________________________________________ Step #2:

_____________________________________________________________________ Step #3:

_____________________________________________________________________ Step #4:

_____________________________________________________________________

60

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

THALIDOMIDE

| Hidden Tragedy and Second Chances

3

TEACHER NOTES

THALIDOMIDE

HIDDEN TRAGEDY AND SECOND CHANCES A Case Study Using the Discovery Engineering Process

Lesson Overview In this lesson, students explore the history of thalidomide, a drug with side effects that caused serious congenital deformities in the 1950s and 1960s. They also learn how scientists discovered new medical uses for the drug through serendipity and additional research. Students will use sample data to determine the efficacy and safety of using previously banned drugs like thalidomide to treat cancer. They will then devise a plan to repurpose another banned drug to treat a new medical condition.

Lesson Objectives By the end of this case study, students will be able to • explain how the Food and Drug Administration (FDA) tests medications before human use; • analyze data to explore the safety and efficacy of new and repurposed drugs to treat medical conditions; and • create a research proposal to justify and test a withdrawn drug for medical research.

Use of the Case Due to the nature of these case studies, teachers may elect to use any section for their instructional needs. They are sequenced in order (scaffolded) so students think more deeply about the science involved in the case and develop an understanding of engineering in the context of science.

Curriculum Connections Lesson Integration This lesson may be taught during a biology unit on pharmacology or human development. It also fits well into a lesson on data interpretation or discussions about federal oversight in the realm of public health issues.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

61

3 Related Next Generation Science Standards PERFORMANCE EXPECTATIONS • MS-LS1-5. Construct a scientific explanation based on evidence for how environmental and genetic factors influence the growth of organisms. • MS-ETS1-1. Define the criteria and constraints of a design problem with sufficient precision to ensure a successful solution, taking into account relevant scientific principles and potential impacts on people and the natural environment that may limit possible solutions. • MS-ETS1-3. Analyze data from tests to determine similarities and differences among several design solutions to identify the best characteristics of each that can be combined into a new solution to better meet the criteria for success. • HS-PS2-6. Communicate scientific and technical information about why the molecular-level structure is important in the functioning of designed materials. • HS-ETS1-3. Evaluate a solution to a complex real-world problem based on prioritized criteria and trade-offs that account for a range of constraints, including cost, safety, reliability, and aesthetics, as well as possible social, cultural, and environmental impacts.

SCIENCE AND ENGINEERING PRACTICES • Asking Questions and Defining Problems • Developing and Using Models • Planning and Carrying out Investigations • Analyzing and Interpreting Data • Constructing Explanations and Designing Solutions • Engaging in Argument From Evidence

CROSSCUTTING CONCEPTS • Cause and Effect • Scale, Proportion, and Quantity • Systems and System Models

62

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

THALIDOMIDE

| Hidden Tragedy and Second Chances TEACHER NOTES

3

Related National Academy of Engineering Grand Challenges • Engineer Better Medicines • Advance Health Informatics • Engineer the Tools of Scientific Discovery

Lesson Preparation It might be helpful to review the concepts of cell growth (DNA, transcription, cancer) and human fetal development before you begin so students can understand the biological mechanisms by which thalidomide causes specific birth deformities. You will need to make copies of the entire student section for the class. Students will need internet access at various points in the lesson. Alternatively, you can project videos or print and distribute copies of online content for the class. Look at the Teaching Organizer (Table 3.5) for suggestions on how to organize the lesson.

Time Needed Up to 115 minutes

TABLE 3.5 Teaching Organizer Section

Time Suggested

Materials Needed

Additional Considerations

The Case

10 minutes

Student pages

Activity done individually in class or as homework prior to class

Investigate and Explain

10 minutes

Student pages

Activity done individually or in pairs

Activity

20 minutes

Student pages

Activity done individually or in pairs

Apply and Analyze

10–15 minutes

Student pages, internet access

Individual activity

Design Challenge

45–60 minutes

Student pages

Small-group activity

Vocabulary • banned drug

• pharmaceutical

• clinical trials

• phocomelia

• multiple myeloma

• transcription factors

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

63

3 Extension Share with students the story of a woman born with thalidomide-related disabilities, who discusses the idea of compensation for victims of the thalidomide tragedy in a HuffPost article. Students may read the article (www.huffpost.com/entry/ thalidomide_b_5669839#) and discuss these open-ended prompts: • Do you believe that the drug company that manufactured and sold thalidomide should compensate affected families? Why? • What suggestions do you have to prevent another tragedy due to the consumption of medications?

Assessment Use the Teacher Answer Key to check the answers to section questions. You can evaluate the students’ FDA proposals to assess the Design Challenge. Proposals should provide a coherent, research-based explanation for why a banned drug should be repurposed. They should reflect an understanding of how the drug works, its potential benefits for treatment, and its dangers. Students should be able to articulate how they would evaluate the drug by collecting data through laboratory testing and clinical trials. They should also be able to explain how they would keep users safe from harmful side effects of the drug.

Teacher Answer Key Recognize, Recall, and Reflect 1. Why was thalidomide initially popular? The drug became popular because it could be used to treat a range of medical conditions and the manufacturer of the drug advertised it as safe. 2. Why is it important for doctors to review all the test data on drugs that the public may use, as Frances Oldham Kelsey did in the case of thalidomide? It is important in case a potential drug for market has unintended consequences in certain individuals or populations. Providing a thorough review can help prevent widespread health disasters like the one caused by thalidomide. 3. How does thalidomide affect cancer cells? The drug kills cancerous cells by stopping overactive transcription factors, or proteins that control how fast cells grow and multiply.

64

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

THALIDOMIDE

| Hidden Tragedy and Second Chances TEACHER NOTES

3

Investigate and Explain 1. According to Table 3.1, what percentage of all the cancer patients in the study experienced a reduction or complete remission of cancer due to the thalidomide treatment? 49% 2. Ten months after the treatment, scientists revisited the cancer patients who responded positively to thalidomide. What is the importance of following up with patients several months after treatment? It’s important to follow up with patients to make sure that the treatment they received remains effective and that they haven’t developed any problems as a consequence of taking the medication. 3. If you worked for the FDA and reviewed the data shown here, would you recommend this drug for treating multiple myeloma? Why or why not? Reference specific data in Tables 3.1 and 3.2 in your response. Student responses may vary. Some sample responses are listed below. Yes: As shown in Table 3.1, 48 patients who took the drug saw improvement in their symptoms, and five of them even went into remission. Table 3.2 shows that the five patients in remission were still cancer-free even after 10 months. Moreover, the relapse rate for the other patients who responded well to the drug was low at this time. Drugs with this much promise need to come to market to help multiple myeloma sufferers. No: According to Table 3.1, 50 patients had no response to the drug. That’s more than the 48 patients with some reduction of their cancer. The data in Table 3.2 indicate that thalidomide is sometimes effective, but scientists should investigate whether it could be combined with another drug to work better. There is also no data provided on the drug’s side effects in these patients. So more research should be done before this drug can go to market.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

65

3 Activity Questions 1. Which of the three drugs would you recommend as the best one to treat breast cancer? Why? Are there any cases in which you’d recommend one of the less effective drugs to a patient? Refer to your collected data in your answer. Sample answer: Drug B was the most effective overall, with the highest number of people going into remission and the most people experiencing reductions at the 90%, 75%, and 50% levels. It should be given to the most patients as long as they can tolerate the drug’s many side effects. Most patients on Drug F who experienced a reduction did so at the 25% level, however this drug did not cause seizures or brain swelling as Drug B did in some patients. Therefore, Drug F might be recommended as a safer alternative for people with underlying neurological conditions. Drug Z was least effective overall and should not be recommended. 2. What additional measures or tests should be done before recommending any of these drugs to the FDA for sale? Additional tests include expanded clinical trials and coupling with other drugs to increase the drug’s effectiveness while mitigating harmful side effects. 3. How would you improve your research design for the next set of clinical trials? Students’ answers may vary. However, they might suggest analyzing the data at more regular intervals in order to gain deeper insight into how each drug works. They might also advise adding a scale to the side effects analysis so patients can measure the intensity of the effects. Additionally, students might want to ensure the diversity of patients in the trials and also use a control group to test for placebo effects.

Apply and Analyze 1. Why is the partnership between drug companies and academic institutions beneficial in finding new purposes for old drugs? Answers may vary. But students might point out that universities can help companies in their research and clinical trials. 2. According to this article, most successful cases of drug repurposing have been largely serendipitous (due to chance). Why do you think that is? Students’ answers may vary, but may acknowledge the fact that careful observations of what the drugs do (even if badly in one patient) may be useful in treating the etiology of a specific disease in another patient.

66

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

THALIDOMIDE

| Hidden Tragedy and Second Chances TEACHER NOTES

3

Resources and References Azvolinsky, A. “Repurposing Existing Drugs for New Indications.” The Scientist, January 2017. www.the-scientist.com/features/repurposing-existing-drugs-for-newindications-32285. CDER Division of Drug Information. Drugs. Food and Drug Administration. www.fda.gov/ Drugs/default.htm. Cronin, E., and M. B. Raphael. 2014. “Born Without Arms or Legs: The Secret Legacy of Thalidomide.” HuffPost, August 21. www.huffpost.com/entry/thalidomide_b_5669839#. Peritz, I. 2017. “Canadian Doctor Averted Disaster by Keeping Thalidomide Out of the U.S.” The Globe and Mail, November 24. www.theglobeandmail.com/news/national/canadiandoctor-averted-disaster-by-keeping-thalidomide-out-of-the-us/article21721337. Singhal, S., J. Mehta, R. Desikan, D. Ayers, P. Roberson, P. Eddlemon, N. Munshi, et al. 1999. Antitumor activity of thalidomide in refractory multiple myeloma. New England Journal of Medicine 341 (21): 1565–1571. www.nejm.org/doi/full/10.1056/ NEJM199911183412102?fyear=1998&tmonth=O&#t=article. Wikipedia. List of withdrawn drugs. https://en.wikipedia.org/wiki/List_of_withdrawn_drugs.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

67

Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

VINDICATING VENOM Using Biological Mechanisms to Treat Diseases and Disorders

4

A Case Study Using the Discovery Engineering Process Introduction Venomous animals like cobras (Figure  4.1) and scorpions have long been feared for their powerful bites and stings, which deliver toxins that can irritate, incapacitate, or even kill their victims. Venom can be harmful. But it can also be helpful—and even life-saving! Scientists are exploring the chemical structures of different venoms to see how they might be transformed into new medicines. They hope to use these toxic substances to combat health problems such as blood clots and heart attacks and to treat chronic diseases like arthritis and autoimmune disorders. Many of these venoms have brought new understanding about biological pathways in the human body.

FIGURE 4.1 The Indian Cobra, a Venomous Snake That Dwells in Asia

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

69

4 Lesson Objectives By the end of this case study, you will be able to • discover the biochemical pathway of acetylcholine and its importance to homeostasis; • model the mechanism of competitive inhibition of acetylcholine by cobra venom; and • research a type of venom and design a drug that may treat a disease or disorder based on the mechanism of competitive inhibition.

The Case This account details the discovery of how snake venom causes illness and death. Once you are finished reading, answer the questions that follow. In the 1950s and 1960s, Taiwanese scientists C. C. Chang and C. Y. Lee conducted research into the venom of a banded krait snake to figure out how the venom affected the human nervous system. They had come to a hypothesis based on a common observation: Because many snakebite victims experience paralysis, the scientists suspected venom interfered in some way with a protein called acetylcholine. Acetylcholine is a neurotransmitter, or chemical messenger, released by nerve cells to activate muscles. When acetylcholine binds to and releases from acetylcholine receptors (proteins that receive chemical messages) in muscle tissue, the muscles are able to contract and relax. In order to study the banded krait venom, Chang and Lee used paper electrophoresis, an early method of dividing large proteins into their components. This allowed them to examine the individual molecules that made up the venom. The scientists found that the venom was mostly composed of proteins they had never seen before, which they named bungarotoxins. Further research revealed that these proteins work by permanently binding to acetylcholine receptors. In doing so, they block acetylcholine from connecting to the receptors. And if the acetylcholine cannot bind to and release from acetylcholine receptors, muscles are unable to move. Chang and Lee concluded that the bungarotoxins in certain venoms blocked receptors in the diaphragm (Figure 4.2), a muscle essential for breathing, causing snakebite victims to suffocate. More research occurred over the next two decades. In the 1970s, scientists at Johns Hopkins University were studying a mysterious disease called myasthenia gravis, which causes muscle weakness. They used radioactive bungarotoxins on muscle tissue from people with the disease and examined the number of acetylcholine receptors the toxins occupied. This experiment allowed the scientists to

70

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

VINDICATING VENOM

| Using Biological Mechanisms to Treat Diseases and Disorders

4

FIGURE 4.2 Respiratory System

The respiratory system is made up of many components. The diaphragm is a muscle in the system that pulls air into and pushes air out of the lungs.

see that people with myasthenia gravis have fewer receptors than a healthy person. Eventually, this discovery led to a treatment for the condition. Since then, scientists have studied additional medical applications for venom. Certain types of venom are used in blood pressure medications and blood-thinning drugs. And researchers are testing the effects of venom on types of cancer.

Recognize, Recall, and Reflect 1. Based on the passage, what do acetylcholine and acetylcholine receptors do? 2. What is the major protein that comprises cobra venom? What does it do?

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

71

4 Investigate and Explain Read the following account of a worker who was bitten by a cobra, published in 1884 in the book Poisons: Their Effects and Detection (Blyth 1884). By far the best account hitherto published of the effects of the cobra poison is a paper by Dr. Wall, in which he points out the very close similarity between the symptoms produced and those of glosso-pharyngeal paralysis. This is well shown in the following typical case:—A [worker] was bitten on the shoulder about twelve at midnight by a cobra; he immediately felt burning pain at the spot bitten, which increased. In fifteen minutes afterwards he began, he said, to feel intoxicated, but he seemed rational, and answered questions intelligently. The pupils were natural, and the pulse normal; the respirations were also not accelerated. He next began to lose power over his legs, and staggered. In thirty minutes after the bite his lower jaw began to fall, and frothy viscid mucous saliva ran from his mouth; he spoke indistinctly, like a man under the influence of liquor, and the paralysis of the legs increased. Forty minutes after the bite, he began to moan and shake his head from side to side, and the pulse and respirations were somewhat accelerated; but he was still able to answer questions, and seemed conscious. There was no paralysis of the arms. The breathing became slower and slower, and at length ceased one hour and ten minutes after the bite, the heart beating for about one minute after the respiration had stopped. Now you’ll learn how cobra venom causes the symptoms described in the account. First, consider how neurotransmitters normally work in muscle movement. Acetylcholine neurotransmitters are released from nerve cells across gaps between the neurons known as synapses. The acetylcholine molecule binds to specific receptor sites on other neurons and then releases. It is this binding and release that helps you move muscles, including muscles needed for breathing. Look at Figure 4.3, which shows (a) the biochemical mechanism of the toxin in cobra venom and (b) the biochemical mechanism of acetylcholine. You’ll see that the cobra toxin and acetylcholine have a similar chemical structure, with a positively charged nitrogen (N1) atom that binds to a negatively charged acetylcholine receptor site. Thus, cobra toxin is able to compete with acetylcholine for receptor sites on muscular neurons. This is called competitive inhibition. Cobra toxin is a large molecule compared to acetylcholine. And unlike acetylcholine, it does not release after it binds to the receptor site. If a molecule of cobra toxin is occupying an acetylcholine receptor site, acetylcholine neurotransmitters are permanently blocked. Think of it as a parking spot: If the snake toxin is already parked and won’t leave,

72

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

VINDICATING VENOM

| Using Biological Mechanisms to Treat Diseases and Disorders

4

FIGURE 4.3 Mechanisms by Which Cobra Venom and Acetylcholine Bind to Same Receptor (a)

Acetylcholine Receptor

(b)

Acetylcholine Receptor

H O H N O H H H3C 2 2 C C N+ C C O H3C CH3 H3 CH

H H H

N+

H

Neuron

O H

N

H3C H3C

O H2 H2 C C N+ C C O CH3

H3 CH

Acetylcholine

Acetylcholine

H3C H3C

O H2 H2 C C N+ C C O CH3

H3 CH

H3C H3C

Acetylcholine

Cobratoxin

O H2 H2 C C N+ C C O CH3

H3 CH

Acetylcholine

Acetylcholine Receptor Acetylcholine Receptor

Acetylcholine Receptor

Muscle (Diaphragm)

Source: Adapted from Stagg-Williams et al. (1994).

acetylcholine can’t pull into the spot. As more and more acetylcholine receptors are bound by cobra toxin, the affected muscle cannot contract, rendering it paralyzed. Depending on how much venom a cobra injects, a bite can cause death in under 60 minutes. Figure 4.4 illustrates the percentage of receptor sites that can be occupied by venom in the hour after one bite. Notice how quickly the venom takes over most of the receptors. Once done with your analysis, answer the questions that follow.

FIGURE 4.4

Percent of Receptor Sites

Percentage of Receptor Sites Occupied by Cobra Venom and Acetylcholine Over 60 Minutes 100% 90% 80% 70% 60% 50% 40% 30% 20% 10% 0% 0 10 Moment of snake bite and injection of venom

Percent of receptor sites bound by cobra venom

Percent of receptor sites available for acetylcholine 20 30 40 Time (minutes)

50

60

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

73

4 1. What are the similarities between acetylcholine and cobra venom? 2. The man profiled in the historical account died about an hour after he was bitten. Based on this graph, what percent of his receptor sites were bound by venom at this point? What percent were available? 3. Based on the graph, what do you think was the timeframe for administering antivenom? Explain.

Activity As previously mentioned, the diaphragm is the muscle that pulls air into and pushes air out of the lungs for respiration. Cobra venom paralyzes the diaphragm through competitive inhibition, causing death. You will now model this process using pennies. The heads side of the penny will represent acetylcholine; the tails side will represent the cobra toxin. This activity will illustrate how venom molecules can occupy acetylcholine receptors over a 60-minute period, which prevents acetylcholine from binding and allowing the muscles to contract. After completing the activity, answer the questions that follow.

Materials 99 Model diaphragm (mason jar lid covered on one side with sticky tape, see directions on p. 75) 99 1 roll of pennies (50 pennies in all) Before starting the activity, you will need to create a model diaphragm out of a jar lid with double-sided tape. The tape on the model represents receptor sites. You will be using this model to simulate the action of breathing. (See Figure 4.5 for instructions.) Recall that acetylcholine molecules bind to and release from sites on the receptors as you breathe, meaning that under normal circumstances these sites regularly become occupied and then available (like a metered parking spot). The pennies represent the acetylcholine molecules and venom molecules that are vying for the acetylcholine receptors (the tape) on your diaphragm.

74

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

VINDICATING VENOM

| Using Biological Mechanisms to Treat Diseases and Disorders

4

FIGURE 4.5 Creating the Model Diaphragm and Simulating Breathing 1. Take the lid from any standard Mason jar.

2. Cover the flat side with double-sided tape.

3. For each trial, you will press down and capture pennies. Count heads and tails from each trial, returning heads and keeping tails stuck to the diaphragm.

Directions 1. You have 50 pennies in your roll. Randomly scatter the 50 pennies onto your lab table. 2. Using your model diaphragm, press the sticky side down onto a random group of pennies. This is your first trial, and it represents 10 minutes of breathing. After you do this, flip the diaphragm over to reveal the pennies stuck to the tape. 3. Count the pennies. Record the number of heads you see on the diaphragm in column B of the Venom Demonstration Chart (p. 76). Then, return these coins to the table (heads-side up). Record the number of tails in column C, but leave these pennies stuck to your diaphragm. 4. Repeat “breathing” five more times. For each trial, record your data in the appropriate columns of the Venom Demonstration Chart.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

75

4 Venom Demonstration Chart A

B

Trial #

Number of Heads

C

Number of Tails

D

E

F

Total (B 1 C) 5 D

% of Active Sites Occupied by Acetylcholine (Heads) (B / D) 3 100% 5 E in %

% of Active Sites Occupied by Cobra Venom (Tails) (C / D) 3 100% 5 F in %

1 (10 mins) 2 (20 mins) 3 (30 mins) 4 (40 mins) 5 (50 mins) 6 (60 mins)

Calculate columns D, E, and F from your collected data in columns B and C. Then, graph the information using two line graphs: one line graph for column E data and one line graph for column F data.

Apply and Analyze Snake venom is now finding new applications in medical treatments. Read this article from National Geographic (www.nationalgeographic.com/magazine/2013/02/ venom) on the medical potential of venom. After reading, answer the questions that follow. 1. What are some of the ways that different types of venom disrupt normal bodily function? 2. In ancient history, how were “venom-based cures” used? What were the major issues in using them? 3. What discovery about pit viper venom occurred in the 1960s? What innovation emerged as a result of the discovery?

Design Challenge Engineering is the  application of scientific  understanding through creativity, imagination, problem solving, and the designing and building of new materials to address and solve problems in the real world. You will be asked to take the science you have learned in this case and design a process or product to address a realworld issue.

76

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

VINDICATING VENOM

Engineers use the engineering design process (Figure 4.6) as steps to address a real-world problem. In this case, you are asking questions (Step  1) about how various types of venom react in the human body and, based on these reactions, what diseases or conditions the venoms might be able to treat. Next, you will research venom and brainstorm (Step  2) a specific venombased drug to treat a medical problem. You will create a plan (Step 3) for your venombased medication and consider how you would design (Step 4) it, creating a proposal to outline your ideas. Afterward, you will come up with a way to test (Step 5) the drug and consider how you might improve (Step 6) on your product.

| Using Biological Mechanisms to Treat Diseases and Disorders

4

FIGURE 4.6 The Engineering Design Process

1 Ask Questions and Define the Problem 6

2

Revise and Improve

Brainstorm and Imagine

3 5

The Engineering Design Process

3

Test and Evaluate

Plan 4 Design and Create

1. Ask Questions Venom is produced by a variety of other animals besides snakes, including certain kinds of spiders, jellyfish, and lizards. Even some mammals, such as the platypus, are venomous! (Note that venom is different from poison. Venoms are toxins that are injected into a victim; poisons are toxins that enter the body by being eaten, inhaled, or absorbed into skin.) Ask questions about the venoms of various animals. For instance, how strong are they? What symptoms do they cause? Would any of these symptoms help in the treatment of diseases?

2. Brainstorm and Imagine Conduct library or online research to get background information on medical uses for venoms. Then, brainstorm a disease you will treat using venom-based medicine that employs competitive inhibition.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

77

4 • Consider what diseases are treatable through competitive inhibition: Examples: nervous and blood disorders, infectious diseases, cancer, and hypertension • Consider which type of venom to use: Cytotoxic venoms (proteolytic toxins) act by breaking down cells and protein. Hemotoxic venoms act on the heart and cardiovascular system. Neurotoxic venoms act on the nervous system and brain.

3. Create a Plan Create a plan to help you develop your new venom-based medication. Include (1) the disease you want to treat, (2) the different venoms you could use as medication, and (3) the pros and cons of each venom. Then choose one specific venom. Use the Create a Plan graphic organizer (p. 80) for guidance.

4. Design and Create Consider how you would design your medication. Create a proposal to outline your ideas. (Use the Venom-Based Medication Proposal worksheet on p. 81.) In the proposal, explain what type of venom you chose and where it comes from, how your medication will treat the disease (refer to the process of competitive inhibition), what form it will come in (e.g., pill, topical), and how you will keep patients safe from dangerous side effects. For example, skin cancer is the uncontrolled growth of abnormal skin cells. Damage to skin cells can trigger DNA mutations that cause the damaged cells to quickly multiply, forming malignant tumors. Because this occurs on the skin, topical drugs may be useful in destroying these cells. Also, because most snake venom works on specific cells, the drug should be targeted to only destroy malignant cells, not healthy cells in the body.

5. Test and Evaluate Think about how you would test the safety and efficacy of your plan. Consider these questions: • Phase 1—What would you do for laboratory testing? • Phase 2—What would you do for animal-based testing? • Phase 3—What would you do for clinical trials? • Surveillance—What would you do to ensure ongoing evaluation of the drug on the market?

78

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

VINDICATING VENOM

| Using Biological Mechanisms to Treat Diseases and Disorders

4

Add this information to your Evaluation Plan graphic organizer (p. 82), and then add this graphic organizer to your proposal.

6. Revise and Improve Present your proposal to your peers. Listen to their feedback on your proposal and take some time to revise it and make improvements. What are some ways you can use their input to refine your proposal? You may choose to accept all or only some of the suggestions. Be sure to justify your reasons for accepting or not using the peer feedback.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

79

4 Create a Plan Describe the disease you chose.

________________________________________________________________________ _______________________________________________________________________ _______________________________________________________________________. Detail the effects of the venoms you might use as treatment. Cytotoxic Venom



Hemotoxic Venom

Pros and Cons

Neurotoxic Venom

Pros and Cons

Pros and Cons

What is the best venom type to treat your chosen disease and why?

_______________________________________________________________________________ _______________________________________________________________________________ _______________________________________________________________________________

80

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

VINDICATING VENOM

| Using Biological Mechanisms to Treat Diseases and Disorders

4

Venom-Based Medication Proposal 1

What type of venom do you want to use and where does it come from?

2

How will your medication treat your chosen disease through competitive inhibition?

3

What form will the venom-based medication come in (e.g., pill, topical)?

4

How will you keep patients safe from dangerous side effects?

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

81

4 Evaluation Plan

Step #1:

_____________________________________________________________________ Step #2:

_____________________________________________________________________ Step #3:

_____________________________________________________________________ Step #4:

_____________________________________________________________________

82

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

VINDICATING VENOM

| Using Biological Mechanisms to Treat Diseases and Disorders

4

TEACHER NOTES

VINDICATING VENOM

USING BIOLOGICAL MECHANISMS TO TREAT DISEASES AND DISORDERS A Case Study Using the Discovery Engineering Process

Lesson Overview In this lesson, students read a case study about scientists who discovered a way to use snake venom in the diagnosis of an autoimmune disease called myasthenia gravis. They also learn the biochemical pathway of cobra venom and model the mechanism of competitive inhibition for acetylcholine receptors. Last, students research avenues in which venom can be used to treat a disease and design their own venom-based medication.

Lesson Objectives By the end of this case study, students will be able to • discover the biochemical pathway of acetylcholine and its importance to homeostasis; • model the mechanism of competitive inhibition of acetylcholine by cobra venom; and • research a type of venom and design a drug that may treat a disease or disorder based on the mechanism of competitive inhibition.

Use of the Case Due to the nature of these case studies, teachers may elect to use any section of each case for their instructional needs. They are sequenced in order (scaffolded) so students think more deeply about the science involved in the case and develop an understanding of engineering in the context of science.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

83

4 Curriculum Connections Lesson Integration This lesson may be taught in intermediate and advanced biology courses during a unit on cell regulation. It also fits well into a lesson on new ways in which animals and plants are being used for human health.

Related Next Generation Science Standards PERFORMANCE EXPECTATIONS • MS-ETS1-2. Evaluate competing design solutions using a systematic process to determine how well they meet the criteria and constraints of the problem. • HS-LS1-2. Develop and use a model to illustrate the hierarchical organization of interacting systems that provide specific functions within multicellular organisms. • HS-LS1-3. Plan and conduct an investigation to provide evidence that feedback mechanisms maintain homeostasis. • HS-ETS1-2. Design a solution to a complex real-world problem by breaking it down into smaller, more manageable problems that can be solved through engineering. • HS-ETS1-3. Evaluate a solution to a complex real-world problem based on prioritized criteria and trade-offs that account for a range of constraints, including cost, safety, reliability, and aesthetics, as well as possible social, cultural, and environmental impacts.

SCIENCE AND ENGINEERING PRACTICES • Asking Questions and Defining Problems • Developing and Using Models • Planning and Carrying out Investigations • Analyzing and Interpreting Data • Constructing Explanations and Designing Solutions • Engaging in Argument From Evidence

84

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

VINDICATING VENOM

| Using Biological Mechanisms to Treat Diseases and Disorders TEACHER NOTES

4

CROSSCUTTING CONCEPTS • Cause and Effect • Structure and Function • Systems and System Models

Related National Academy of Engineering Grand Challenges • Engineer Better Medicines • Advance Health Informatics • Engineer the Tools of Scientific Discovery

Lesson Preparation This lesson requires students to have some understanding of cells, proteins (enzymes), and molecules. You may want to practice the modeling activity prior to instruction with students. You will also need to make copies of the entire student section for the class. Students will need internet access at various points in the lesson. Alternatively, you can project videos or print and distribute copies of online content for the class. Look at the Teaching Organizer (Table 4.1, p. 86) for suggestions on how to organize the lesson.

Materials 99 Model diaphragm (mason jar lid covered on one side with sticky tape) 99 1 roll of pennies (50 pennies in all)

Time Needed Up to 135 minutes

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

85

4 TABLE 4.1 Teaching Organizer Section

Time Suggested

Materials Needed

Additional Considerations

The Case

10 minutes

Student pages

Activity done individually in class or as homework prior to class

Investigate and Explain

10 minutes

Student pages

Activity done individually or in pairs

Activity

30–40 minutes

Student pages, model diaphragm, 1 roll of pennies

Activity done individually or in pairs

Apply and Analyze

10–15 minutes

Student pages, internet access

Individual activity

Design Challenge

45–60 minutes

Student pages, internet access

Small-group activity

Vocabulary • acetylcholine

• hemotoxic

• autoimmune disease

• myasthenia gravis

• competitive inhibition

• neurotoxic

• cytotoxic

• neurotransmitter

• diaphragm

• receptors

Extensions Have students look more into the difference between venoms and poisons. Ask students to research medical uses for poisons.

Assessment Use the Teacher Answer Key to check the answers to section questions. You can evaluate the students’ venom-based medication proposals to assess the Design Challenge. Student proposals should describe the source of the venom and how it will treat a human disease/disorder. They should explain how the drug leverages competitive inhibition for therapeutic use. Students should describe the form that the medication will come in (pill, topical, injection, etc.) Additionally, their proposals should include a plan to test and evaluate the effectiveness of their drug.

86

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

VINDICATING VENOM

| Using Biological Mechanisms to Treat Diseases and Disorders TEACHER NOTES

4

Teacher Answer Key Recognize, Recall, and Reflect 1. Based on the passage, what do acetylcholine and acetylcholine receptors do? Acetylcholine is a neurotransmitter that allows for muscle contraction and relaxation when it binds to and releases from acetylcholine receptors on muscle tissue. 2. What is the major protein that comprises cobra venom? What does it do? The protein is known as an alpha toxin. If injected into a body, it permanently binds to acetylcholine receptors in muscle tissues, blocking acetylcholine molecules and causing paralysis and death.

Investigate and Explain 1. What are the similarities between acetylcholine and cobra venom? The molecules are similar in shape and chemical composition, each featuring a positively charged nitrogen atom (N1) that binds to the negatively charged acetylcholine receptor site. 2. The man profiled in the historical account on page 72 died about an hour after he was bitten. Based on this graph, what percent of his receptor sites were bound by venom at this point? What percent were available? Based on the graph, 90% of his receptor sites were bound by venom and only 10% were available. 3. Based on the graph, what do you think was the timeframe for administering antivenom? Explain. Ideally, the antivenom would’ve been given within 10 minutes, before the percent of acetylcholine sites occupied by venom became greater than those not occupied by venom.

Apply and Analyze 1. What are some of the ways that different types of venom disrupt normal bodily function? Certain venoms can interfere with the nervous system, causing paralysis; others can disrupt molecular mechanisms, causing tissue or cell decay; and yet others can interfere with processes involving blood, such as clotting.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

87

4 2. In ancient history, how were “venom-based cures” used? What were the major issues in using them? They were used for injuries sustained on the battlefield and for pain relief. The patient was equally or more likely to die from the venom medicine than to be cured. 3. What discovery about pit viper venom occurred in the 1960s? What innovation emerged as a result of the discovery? A scientist discovered that pit viper venom could be used to prevent a type of blood clot called deep-vein thrombosis. This led to the creation of a clot-busting drug called Arvin.

Resources and References Blyth, A. W. 1884. Poisons: Their effects and detection. London: Charles Griffin and Company. Chang C. C., and C. Y. Lee. 1963. Isolation of neurotoxins from the venom of Bungarus multicinctus and their modes of neuromuscular blocking action. Archives Internationales de Pharmacodynamie et de Therapie 144: 241–257. Holland, J. S. “The Bite That Heals.” National Geographic, February 2013. www. nationalgeographic.com/magazine/2013/02/venom. Patrick, J., and J. Lindstrom. 1973. Autoimmune response to acetylcholine receptor. Science 180 (4088): 871–872. Stagg-Williams, S., D. A. Schweiss, G. Sy, and H. S. Fogler. 1994. Pharmacokinetics of snake bites. University of Michigan. www.umich.edu/~elements/5e/web_mod/cobra/venom2.htm.

88

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

FORBIDDEN FRUIT The Discovery of Dangerous Drug Interactions

5

A Case Study Using the Discovery Engineering Process Introduction Grapefruit is a type of citrus plant that produces a bittersweet fruit, which is also called grapefruit (Figure 5.1, p. 90). The plant results from the crossbreeding of two different fruit tree species, the pomelo and the sweet orange. Grapefruit was first documented in Barbados in 1750 by Reverend Griffith Hughes. Originally, people called it the “forbidden fruit.” The plant was later named grapefruit, possibly because its fruit tends to grow in clusters, like grapes. Many varieties of grapefruit are grown around the world, including ruby red grapefruit and pink grapefruit. Grapefruit trees are living organisms that have defense mechanisms to protect themselves from being eaten or destroyed by predators such as insects. The plants are able to create toxic chemicals that can sicken or kill the animals that consume them. Predators that get sick from tasting these chemicals are deterred (or discouraged) from eating the same plant again. Found in the tree’s fruit as well, the chemicals can also have some adverse (or negative) effects in humans who take certain medications.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

89

5 FIGURE 5.1 Grapefruit Tree

Lesson Objectives By the end of this case study, you will be able to • investigate food and drug interactions; • analyze data to examine a food/drink drug interaction; and • create a research proposal to justify a new way for a food/drink drug interaction to solve a current problem.

The Case This account outlines the discovery of the negative interaction between grapefruit and certain drugs. Once you have finished reading, answer the questions that follow. In 1989, Canadian scientists were researching the effects of drinking alcohol while taking a blood pressure drug. As part of their study, they recruited individuals who were willing to participate in the research and divided them into two groups. One group would take the medicine without alcohol (the control group), and the other group would take the medicine with alcohol (the treatment group).

90

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

FORBIDDEN FRUIT

| The Discovery of Dangerous Drug Interactions

5

Before beginning the experiment, the researchers had a problem to solve. They had to figure out how to hide the taste of the alcohol given to the treatment group so that the group members didn’t realize they were consuming it. That way, the group members wouldn’t form a bias judgement, or a reaction to the experiment that was influenced by their prior knowledge. This is known as a blind experiment. The researchers decided that the best way to mask the bitter-tasting alcohol was with a bittersweet liquid: grapefruit juice. They gave the treatment group a blend of grapefruit juice and alcohol with the blood pressure medication. Meanwhile the control group received plain grapefruit juice with their medication. Individuals in each group had their blood drawn over several days to document the effects of the blood pressure drug with and without alcohol. The scientists expected no changes to the control group since they were not ingesting alcohol with the medicine. But when the researchers tested these individuals, they saw that the medication levels in their blood were extremely high and potentially dangerous. Scientists wanted to find out why grapefruit affected drug interactions in humans, so they conducted additional research. They discovered that for some drugs the answer had to do with human enzymes, or proteins that increase the rate of chemical reactions. Humans have a special group of enzymes that help metabolize (or break down) drugs into smaller pieces in the small intestine. These pieces then pass through the intestinal wall and are absorbed into the bloodstream. Scientists who develop medication in pill form rely on these enzymes to break down the drugs. However, a chemical in grapefruit known as furanocoumarin prevents the enzymes from breaking down certain drugs in the small intestine. As a result, the drugs may stay too long or build up too much in a patient’s system, which may cause effects similar to an overdose. In other cases, grapefruit might affect proteins that are known as drug transporters, which help move a drug into cells for absorption. If this happens, less of the drug will enter the blood, and the drug cannot have its intended effect on the patient (Figure 5.2, p. 92). The discovery of the interactions between certain medications and grapefruit led to changes in drug use instructions. Now, drugs that should not be taken with grapefruit come with warning labels to alert patients about the risks associated with combining the two.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

91

5 FIGURE 5.2 How Grapefruit Juice Affects Some Drugs

Recognize, Recall, and Reflect 1. What happened during the study into alcohol’s effect on blood pressure medication that surprised the team of scientists running the research? 2. How did the scientists know that the grapefruit juice was the cause of the unexpected problem they encountered during the experiment? 3. How did this discovery change the way instructions are given to patients taking drugs that might interact with grapefruit juice?

Investigate and Explain The Food and Drug Administration (FDA) has published a guide about food and drug interactions. The guide is available online (www.fda.gov/media/79360/download). Review the guide. Then choose five drugs listed in the Drug Interaction Chart and fill in the requested information. The first row has been completed as an example. You may need to go online and find credible resources for details on what the drugs do and how they work.

92

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

FORBIDDEN FRUIT

| The Discovery of Dangerous Drug Interactions

5

Drug Interaction Chart

Name of Drug

Type of Drug and How It Works

NSAID (NonSteroidal AntiInflammatory Drugs)

Pain reliever and anti-inflammatory drug used for short-term relief of fevers and minor aches and pains from headaches, muscle aches, toothaches, back aches, menstrual cramps, and arthritis. Drug works by blocking COX enzymes, which reduces the production of prostaglandins that cause inflammation symptoms, including aches.

Directions Regarding Food or Drink Interactions Take with food or milk.

Avoid alcohol.

Description of the Interaction Taking the drug with food or milk can prevent an upset stomach.

Alcohol use could cause stomach bleeding.

Bronchodilators

ACE (AngiotensinConverting Enzyme) Inhibitors Beta Blockers

Diuretics

Glycosides

Lipid-Altering Agents (Statins)

Vitamin K Agonists or Anticoagulants

(Continued)

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

93

5 Drug Interaction Chart (continued)

Name of Drug

Type of Drug and How It Works

Directions Regarding Food or Drink Interactions

Description of the Interaction

Thyroid Medications

Quinolone Antibacterials

Tetracycline Antibacterials

Oxazolidinone Antibacterials

Antifungals

Antimycobacterials

Monoamine Oxidase Inhibitors (MAOIs)

Bipolar Disorder Medicines

Bisphosphonates (Bone Calcium Phosphorus Metabolism)

94

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

FORBIDDEN FRUIT

| The Discovery of Dangerous Drug Interactions

5

Activity Imagine you are a medical scientist investigating food and drug interactions for the FDA. You have been notified that a recently approved medication named Zazlee is thought to be creating adverse reactions in patients. You suspect the negative reactions have to do with the patients’ food and drink consumption. Your team has collected data about the food and drink consumption of the patients over the past four weeks. You will need to narrow down the potential causes of the adverse reactions, conduct a controlled test to determine the actual cause, and decide what information doctors and pharmacists need to know about the problem.

Part I Recently, a new medication named Zazlee was approved to treat patients with severe muscle pain caused by spasms in the lower back region. Zazlee relaxes muscle spasms by controlling the amount of calcium in the muscle system. Calcium is needed enable muscle movement, and low calcium levels could cause severe muscle cramps. Zazlee helps by bonding to calcium in the body and transporting it to muscle regions. Once the calcium is transferred to the muscle, Zazlee breaks down and is filtered out of the body through the liver. High doses of Zazlee have caused severe kidney damage and death in lab-tested mice. Recently, some patients taking Zazlee have been experiencing kidney damage. Furthermore, they’re seeing no reduction in their muscle spasms. This indicates that the medication isn’t working properly, and you and your colleagues believe that a food or drink interaction is to blame. Your team launches an investigation to get answers. Read the description of the investigation, and then answer the questions that follow. • Investigation Question: Which food and/or drink is causing a drug interaction with Zazlee? • Investigation Methodology: Patients who were suffering from kidney damage were advised to stop taking Zazlee immediately and record everything they ate or drank in a food journal for the next four weeks. The patients were directed to keep their diets the same as when they were taking the drug. Your team has now collected all the food and drink consumption data of the patients. You notice that many of them had consumed these items: red wine, chocolate, and sweet potatoes. Your team designs a series of experiments to test which of these items is causing a dangerous drug interaction with Zazlee. • Experiment 1 Description: There are two groups of 50 patients each (100 patients in total). All 100 patients are taking 10 mg of Zazlee once a day for a total of seven days (one week).

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

95

5 The treatment group is instructed to drink one glass of red wine a day. The control group is instructed not to drink red wine. • Experiment 2 Description: There are two groups of 75 patients each (150 patients in total). All 150 patients are taking 10 mg of Zazlee once a day for a total of seven days (one week). The treatment group is instructed to eat one chocolate bar a day. The control group is instructed not to eat chocolate. • Experiment 3 Description: There are two groups of patients, one group with 42 and the other group with 98 (140 patients in total). All 140 patients are taking 10 mg of Zazlee once a day for a total of seven days (one week). The treatment group (group with 42 patients) is instructed to eat one sweet potato a day. The control group (group with 98 patients) is instructed not to eat sweet potatoes.

ACTIVITY QUESTIONS, PART I 1. Explain why your experiments need a treatment group and a control group. How did the control group and the treatment group differ in each of the three experiments? 2. Medical researchers are asking human subjects to participate in these experiments knowing other patients developed kidney damage due to taking Zazlee. What are the benefits in using humans for these experiments? What are the challenges or dangers for humans in these experiments? 3. Review the number of people participating in Experiments 1, 2, and 3 (both the overall number of people in each experiment and the number of people in each experimental and control group). What are the benefits and challenges to having this number of people in the experiments? 4. Explain why the researchers instructed all patients in the three experiments to take the same amount of the drug (10 mg) for the same amount of time (once a day for a week). 5. How would you change the design of the experiments to ensure the data you are collecting will help answer your investigation question?

Part II You and your team enroll the patients into one of the three experiments. Before the experiments begin, you take a baseline blood sample from each patient to measure the level of Zazlee (to make sure it is at zero) and the level of calcium in the blood.

96

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

FORBIDDEN FRUIT

| The Discovery of Dangerous Drug Interactions

5

After the patients participate in the experiments for one week, you take a second blood sample to measure the amount of Zazlee and calcium in each patient. You know that Zazlee is working if the patients do not have muscle spasms and if little or no trace of the drug remains in their bodies. (Remember: Once Zazlee binds and transports the calcium to the muscle, the drug is broken down and removed by the liver.) Read the results from the experiment (see Tables 5.1, 5.2, and 5.3, pp. 97–98) and complete this part of the activity. Then answer the questions that follow.

TABLE 5.1 Results for Experiment 1: Red Wine Control Group: Day One

Control Group: Day Seven

Treatment Group: Day One

Treatment Group: Day Seven

Average Level of Calcium in the Body (mg/dL)

9.6 mg/dL

9.5 mg/dL

9.4 mg/dL

8.6 mg/dL

Normal blood calcium levels for adults (18 years or older) is in the 8.5 to 10.5 milligrams per deciliter (mg/dL) range.

Average Level of Zazlee in the Body (mg/L)

0.0 mg/L

1.3 mg/L

0.0 mg/L

1.75 mg/L

Normal blood levels of Zazlee for adults (18 years or older) without kidney damage is in the 1.2 to 1.7 milligrams per liters (mg/L) range. Adults with kidney damage have a range of 5.6 to 23.4 milligrams per liter (mg/L).

Blood Sample Levels

Medical Researchers’ Notes

TABLE 5.2 Results for Experiment 2: Chocolate Control Group: Day One

Control Group: Day Seven

Treatment Group: Day One

Treatment Group: Day Seven

Average Level of Calcium in the Body (mg/dL)

9.4 mg/dL

9.6 mg/dL

9.5 mg/dL

9.3 mg/dL

Normal blood calcium levels for adults (18 years or older) is in the 8.5 to 10.5 milligrams per deciliter (mg/dL) range.

Average Level of Zazlee in the Body (mg/L)

0.0 mg/L

1.4 mg/L

0.0 mg/L

1.55 mg/L

Normal blood levels of Zazlee for adults (18 years or older) without kidney damage is in the 1.2 to 1.7 milligrams per liters (mg/L) range. Adults with kidney damage have a range of 5.6 to 23.4 milligrams per liter (mg/L).

Blood Sample Levels

Medical Researchers’ Notes

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

97

5 TABLE 5.3 Results for Experiment 3: Sweet Potatoes Control Group: Day One

Control Group: Day Seven

Treatment Group: Day One

Treatment Group: Day Seven

Average Level of Calcium in the Body (mg/dL)

9.3 mg/dL

9.4 mg/dL

9.4 mg/dL

6.7 mg/dL

Normal blood calcium levels for adults (18 years or older) is in the 8.5 to 10.5 milligrams per deciliter (mg/dL) range.

Average Level of Zazlee in the Body (mg/L)

0.0 mg/L

1.35 mg/L

0.0 mg/L

7.23 mg/L

Normal blood levels of Zazlee for adults (18 years or older) without kidney damage is in the 1.2 to 1.7 milligrams per liters (mg/L) range. Adults with kidney damage have a range of 5.6 to 23.4 milligrams per liter (mg/L).

Blood Sample Levels

Medical Researchers’ Notes

Now that you have the results of the experiments, create a graph displaying the data for calcium levels in the patients’ blood. • On the left side of the chart, graph the data from day one in this order: a. Control (Wine) b. Treatment (Wine) c. Control (Chocolate) d. Treatment (Chocolate) e. Control (Sweet Potatoes) f. Treatment (Sweet Potatoes) • On the right side of the chart, graph the data from day seven in this order: a. Control (Wine) b. Treatment (Wine) c. Control (Chocolate) d. Treatment (Chocolate) e. Control (Sweet Potatoes) f. Treatment (Sweet Potatoes)

98

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

FORBIDDEN FRUIT

| The Discovery of Dangerous Drug Interactions

5

Create a graph displaying the data for Zazlee levels in the patients’ blood. • On the left side of the chart, graph the data from day one in this order: a. Control (Wine) b. Treatment (Wine) c. Control (Chocolate) d. Treatment (Chocolate) e. Control (Sweet Potatoes) f. Treatment (Sweet Potatoes) • On the right side of the chart, graph the data from day seven in this order: a. Control (Wine) b. Treatment (Wine) c. Control (Chocolate) d. Treatment (Chocolate) e. Control (Sweet Potatoes) f. Treatment (Sweet Potatoes)

ACTIVITY QUESTIONS, PART II 1. Based on the data from the experiments, which food or drink item might cause a significant drug interaction with Zazlee? What is the evidence for your choice? 2. Briefly research this food or drink item’s relationship with calcium. How might this food or drink item be causing a significant drug interaction with Zazlee? 3. Based on your experiments, what is your recommendation to the FDA? What should the public know about the food or drink item and Zazlee? 4. What other recommendation(s) might you suggest to the FDA that may need additional research or experimentation? Why?

Apply and Analyze Pairing drugs with certain foods and drinks is not the only thing that can cause dangerous interactions. Combining certain drugs with other drugs can also have lifethreatening effects. Doctors and pharmacists should review these interactions with

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

99

5 patients if they are taking different types of medications. Read this article from the Chicago Tribune on what happens when warnings about drug interactions do not work: www.chicagotribune.com/news/watchdog/druginteractions/ct-drug-­i nteractionspharmacy-met-20161214-story.html. Then, answer the questions that follow. 1. What did the researchers find in the article? Why were they worried about how the medicine and drugs were being dispensed to patients? 2. How might clinics and pharmacists change to ensure that patients learn about dangerous drug interactions?

Design Challenge The case study in this lesson illustrates how a scientific observation led to the solution to a problem. Observations and discoveries often spark ideas for innovations. This is especially true in the field of engineering. Engineering is the  application of scientific understanding through creativity, imagination, and the designing and building of new materials to address and solve problems in the real world. You will be asked to take the science you have learned in this case and design a process or product to address a real-world issue. For this activity, you will be focusing on using drug interactions to treat medical conditions. Researchers have investigated drug and food or drink interactions to ensure that patients do not experience adverse effects. For example, you learned in the case study that the grapefruit chemical does not allow an enzyme to break down certain blood pressure drugs in the small intestine. This causes the drug to stay longer in a patient’s system, potentially triggering a drug overdose. Knowledge of this interaction is important for patient safety, but it could also help in other areas. That is, scientists might be able to figure out a way for the grapefruit chemical to help people under certain circumstances. For instance, if you accidentally swallow poison, the grapefruit chemical might interact with the body’s enzymes, preventing the body from breaking down the poison into smaller pieces that could be absorbed. This could be a future method of poison control. You will now use the engineering design process to come up with your own applications for drug interactions. Engineers use the engineering design process (Figure 5.3) as steps to address a real-world problem. In this case, you are asking the question (Step 1) of how drug and food or drink interactions can be used to solve problems. Using outside research, you will brainstorm (Step 2) a specific new purpose for a drug based on its interaction with a food or drink. Then, you will create a plan (Step 3) for your idea. Next, you will consider how you might design (Step 4) your application, creating a research proposal to outline your thoughts. Afterward, you will come up

100

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

| The Discovery of Dangerous Drug Interactions

FORBIDDEN FRUIT

with a way to test (Step 5) your idea and consider how you might improve (Step 6) on it.

5

FIGURE 5.3 The Engineering Design Process

1. Ask Questions Ask questions about drug interactions. For instance, what happens as a result of interactions between different drugs and foods or drinks? How could a known drug interaction be used to solve a problem? What types of diseases or conditions might be treated by the mechanism of a drug interaction?

2. Brainstorm and Imagine

1 Ask Questions and Define the Problem 6

2

Revise and Improve

Brainstorm and Imagine

3 5

The Engineering Design Process

3

Test and Evaluate

Look over these FDA guides on food and drug interactions: www.fda.gov/media/79360/down load and www.fda.gov/media/ 76562/download. Then, review how drug interactions can occur here: www.ncbi.nlm.nih.gov/pmc/ articles/PMC1884601. Using what you’ve learned, brainstorm interaction to solve current health problem.

Plan 4 Design and Create

a new way for a drug

3. Create a Plan Create a plan for your idea. Summarize (1) the drug you chose to use and the type of interaction that occurs, (2) what this interaction could treat, (3) who or what is helped by your new idea, and (4) the advantages and disadvantages to your new idea. Complete this step using the Create a Plan worksheet (p. 103).

4. Design and Create Develop a research proposal for the FDA describing your new idea. In the research proposal, explain how you would go about creating a new use for this drug interaction. Include the following in your proposal: • A detailed description of your new idea: How your selected drug interaction is created Why using this drug interaction is a good idea

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

101

5 How patients will be affected by the interaction • A description of how you would go about developing your idea (Who would you work with? Where would you develop the product?) • Information on how the patients’ health will be protected from negative side effects • An explanation of how you would market the product to users Fill in the Drug Interaction Treatment Proposal worksheet (p. 104) with this information.

5. Test and Evaluate Think about how you would test the safety and efficacy of your plan. Consider these questions: • Phase 1—What would you do for laboratory testing? • Phase 2—What would you do for animal-based testing? • Phase 3—What would you do for clinical trials? • Surveillance—What would you do to ensure ongoing evaluation of the drug on the market? Add this information to your Evaluation Plan graphic organizer (p. 105), and then add the evaluation plan to your Drug Interaction Treatment Proposal.

6. Revise and Improve Present your proposal to your peers. Listen to their feedback on your proposal and take some time to revise it and make improvements. What are some ways you can use their input to refine your proposal? You may choose to accept all or only some of the suggestions. Be sure to justify your reasons for accepting or not using the peer feedback.

102

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

FORBIDDEN FRUIT

| The Discovery of Dangerous Drug Interactions

5

Create a Plan 1

What drug do you wish to repurpose? What are its interactions?

2

Describe a treatment that can be created from this interaction. What condition or disease does it treat?

3

Who is helped by your idea?

4

What are the advantages of your idea?

5

What are the disadvantages of your idea?

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

103

5 Drug Interaction Treatment Proposal

104

1

Describe your idea.

2

How would the idea be developed?

3

How would patients’ health be protected from negative side effects?

4

How would you market the product to users?

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

FORBIDDEN FRUIT

| The Discovery of Dangerous Drug Interactions

5

Evaluation Plan

Step #1:

_____________________________________________________________________ Step #2:

_____________________________________________________________________ Step #3:

_____________________________________________________________________ Step #4:

_____________________________________________________________________

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

105

5 TEACHER NOTES

FORBIDDEN FRUIT

THE DISCOVERY OF DANGEROUS DRUG INTERACTIONS A Case Study Using the Discovery Engineering Process

Lesson Overview In this lesson, students explore the interactions of drugs with food and drinks. Some food and drinks can alter the effects of drugs in humans. They can stay too long or build up in the body, causing adverse effects similar to overdosing. Interactions might also prevent a drug from breaking down into smaller, absorbable pieces. This can render the drug ineffective. Students will read a case study on the discovery of the adverse effect of combining grapefruit with certain medicines. Playing the role of a medical scientist, they will then use sample data to investigate an adverse reaction connected to a food or drink interaction. Last, students will develop an application for a known food or drink drug interaction that solves a problem.

Lesson Objectives By the end of this case study, students will be able to • investigate food and drug interactions; • analyze data to examine a food/drink drug interaction; and • create a research proposal to justify a new way for a food/drink drug interaction to solve a current problem.

Use of the Case Due to the nature of these case studies, teachers may elect to use any section of each case for their instructional needs. They are sequenced in order (scaffolded) so students think more deeply about the science involved in the case and develop an understanding of engineering in the context of science.

106

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

FORBIDDEN FRUIT

| The Discovery of Dangerous Drug Interactions TEACHER NOTES

5

Curriculum Connections Lesson Integration This lesson may be taught during a unit on chemical reactions or human biology. It also fits well into a lesson on data interpretation or discussions of enzymes, chemical reactions, agriculture, botany, medical treatments and effects, human biology and interaction of drugs, and STEM careers involving medical research and pharmacology.

Related Next Generation Science Standards PERFORMANCE EXPECTATIONS • MS-ETS1-1. Define the criteria and constraints of a design problem with sufficient precision to ensure a successful solution, taking into account relevant scientific principles and potential impacts on people and the natural environment that may limit possible solutions. • MS-ETS1-2. Evaluate competing design solutions using a systematic process to determine how well they meet the criteria and constraints of the problem. • MS-ETS1-3. Analyze data from tests to determine similarities and differences among several design solutions to identify the best characteristics of each that can be combined into a new solution to better meet the criteria for success. • HS-LS1-3. Plan and conduct an investigation to provide evidence that feedback mechanisms maintain homeostasis. • HS-ETS1-3. Evaluate a solution to a complex real-world problem based on prioritized criteria and trade-offs that account for a range of constraints, including cost, safety, reliability, and aesthetics, as well as possible social, cultural, and environmental impacts.

SCIENCE AND ENGINEERING PRACTICES • Asking Questions and Defining Problems • Developing and Using Models • Planning and Carrying out Investigations • Analyzing and Interpreting Data • Constructing Explanations and Designing Solutions • Engaging in Argument From Evidence

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

107

5 CROSSCUTTING CONCEPTS • Cause and Effect • Systems and System Modeling • Structure and Function

Related National Academy of Engineering Grand Challenges • Engineer Better Medicines • Advance Health Informatics • Engineer the Tools of Scientific Discovery

Lesson Preparation Before beginning the lesson, it is helpful for students to have some understanding of the importance of enzymes and chemical reactions. You may also want to review how to enter and interpret data from charts and how to create graphs. You will need to make copies of the entire student section for the class. Students will need internet access at various points in the lesson. Alternatively, you can project videos or print and distribute copies of online content for the class. Look at the Teaching Organizer (Table 5.4) for suggestions on how to organize the lesson.

Time Needed Up to 115 minutes

TABLE 5.4 Teaching Organizer

108

Section

Time Suggested

Materials Needed

Additional Considerations

The Case

10 minutes

Student pages

Activity done individually in class or as homework prior to class

Investigate and Explain

10 minutes

Student pages, internet access

Activity done individually or in pairs

Activity

20 minutes

Student pages

Activity done individually or in pairs

Apply and Analyze

10–15 minutes

Student pages, internet access

Individual activity

Design Challenge

45–60 minutes

Student pages, internet access

Small-group activity

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

FORBIDDEN FRUIT

| The Discovery of Dangerous Drug Interactions TEACHER NOTES

5

Vocabulary • adverse

• experimental group

• bias judgement

• food journal

• blind experiment

• furanocoumarin

• control group

• metabolize

• deterred

• predators

• dispensed

• toxic chemicals

• enzymes

• treatment group

• varieties

Extensions This lesson can be extended to discuss the FDA’s effects on medical research as well as tangential topics such as food allergies, genetically modified foods, and the debate on homeopathy treatments.

Assessment Use the Teacher Answer Key to check the answers to section questions. You can evaluate the students’ drug interaction proposals to assess the Design Challenge. Students’ proposals should provide a coherent conceptualization of what their new idea is, who it helps, and why it is needed (what problem does it help solve?). In the proposals, students should be able to explain how their interaction works and ways in which they would protect users from adverse side effects. The proposals should describe how students would test and evaluate the efficacy of their ideas. More specifically, they should include a section on how they would collect data through laboratory, animal, and/or human trials. Students should be able to report or state any constraints or drawbacks they can foresee with implementing their design.

Teacher Answer Key Recognize, Recall, and Reflect 1. What happened during the study into alcohol’s effect on blood pressure medication that surprised the team of scientists running the research? The researchers had assumed that the experiment’s control group would not experience changes to their levels of blood pressure medication because they did not drink any alcohol, the variable that was expected to cause a change. However, participants in the experiment’s control group tested for high levels of the blood pressure medication.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

109

5 2. How did the scientists know that the grapefruit juice was the cause of the unexpected problem they encountered during the experiment? Because researchers had designed the experiment so that participants drank grapefruit juice with their medication, and no other common variable was included for the control group, they hypothesized that this factor was causing the problem. 3. How did this discovery change the way instructions are given to patients taking drugs that might interact with grapefruit juice? There are now warning labels on medications sharing potential side effects of inter­ actions between drugs and food or drinks.

Investigate and Explain The five drugs students chose may vary, but their answers should resemble the answer key below.

Drug Interaction Chart Name of Drug NSAID (Non-Steroidal Anti-Inflammatory Drugs)

Type of Drug and How It Works Pain reliever and antiinflammatory drug used for short-term relief of fevers and minor aches and pains from headaches, muscle aches, toothaches, back aches, menstrual cramps, and arthritis.

Directions Regarding Food or Drink Interactions Take with food or milk. Avoid alcohol.

Description of the Interaction Taking the drug with food or milk can prevent an upset stomach. Alcohol use could cause stomach bleeding.

Drug works by blocking COX enzymes, which reduces the production of prostaglandins that cause inflammation symptoms, including aches. Bronchodilators

They treat and prevent breathing problems from bronchial asthma, chronic bronchitis, emphysema, and chronic obstructive pulmonary disease (COPD). They help to relieve wheezing, shortness of breath, troubled breathing, and chest tightness.

Avoid certain foods, including caffeine and alcohol.

Caffeine can increase the chance of side effects, such as excitability, nervousness, and rapid heartbeat. Alcohol can increase the chance of side effects, such as nausea, vomiting, headache, and irritability.

They work by relaxing and opening the air passages to the lungs. (Continued)

110

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

FORBIDDEN FRUIT

| The Discovery of Dangerous Drug Interactions TEACHER NOTES

5

Drug Interaction Chart (continued)

Name of Drug

Type of Drug and How It Works

Directions Regarding Food or Drink Interactions

Description of the Interaction

ACE (AngiotensinConverting Enzyme) Inhibitors

They lower blood pressure or treat heart failure. They relax blood vessels so blood flows more smoothly and the heart can pump blood better.

Avoid eating large amounts of foods high in potassium, such as bananas, oranges, green leafy vegetables, and salt substitutes.

The interaction can raise the level of potassium higher causing an irregular heartbeat and heart palpitations (rapid heartbeats).

Beta Blockers

They treat high blood pressure. They are also used to prevent angina (chest pain) and treat heart attacks.

Take with food.

This decreases the chances of a drop in blood pressure.

Take with food and avoid eating large amounts of foods high in potassium, such as bananas, oranges, green leafy vegetables, and salt substitutes.

Taking the drug with food can prevent an upset stomach.

Take one hour before eating and two hours before eating foods high in fiber.

Foods high in fiber, senna, and St. John’s wort may decrease the digoxin in your body.

Avoid senna, St. John’s wort, and black licorice.

Black licorice contains glycyrrhizin, which can cause irregular heartbeats and heart attack.

Avoid grapefruit juice and alcohol.

Large amounts of grapefruit juice can raise the levels of statins in your body and increase the chance of side effects.

They work by slowing the heart rate and relaxing the blood vessels so the heart doesn’t have to work as hard to pump blood. Diuretics

They help remove water, sodium, and chloride from the body. Diuretics reduce sodium and the swelling and excess fluid caused by some medical problems such as heart or liver disease. Diuretics can also treat high blood pressure. They work by causing your kidneys to increase urine production.

Glycosides

They treat heart failure and abnormal heart rhythms. They work by controlling the heart rate and help the heart work better.

Lipid-Altering Agents (Statins)

They lower cholesterol. They work by lowering the rate of production of LDL (or bad cholesterol), decreasing the chance of heart attack, stroke, or small strokes.

The drugs can raise potassium levels. Eating potassium-rich foods in addition could make levels too high, causing an irregular heartbeat and heart palpitations (rapid heartbeats).

Avoid alcohol because it can increase the chance of liver damage. (Continued)

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

111

5 Drug Interaction Chart (continued)

Name of Drug Vitamin K Agonists or Anticoagulants

Type of Drug and How It Works

Directions Regarding Food or Drink Interactions

Description of the Interaction

They lower the chance of blood clots forming or growing larger in your blood or blood vessels. Anticoagulants are used to treat people with certain types of irregular heartbeats, people with prosthetic (replacement or mechanical) heart valves, and people who have had a heart attack. And they treat blood clots that have formed in the veins of the legs or lungs.

Avoid foods with Vitamin K like broccoli, cabbage, collard greens, spinach, kale, turnip greens, and brussels sprouts. Also avoid cranberry juice or cranberry products. Don’t use with dietary supplements and vitamins. Last, avoid garlic, ginger, glucosamine, ginseng, and ginkgo.

Vitamin K in food can make the medicine less effective. Cranberry can change the effects of warfarin. And dietary supplements and vitamins can interact with anticoagulants and can reduce the benefit or increase the risk of warfarin.

Avoid eating soybean flour (also found in soybean infant formula), cottonseed meal, walnuts, and dietary fiber.

Eating foods that mimic synthetic thyroid hormones will cause too much thyroidlike hormones to build in the system, causing hyperthyroidism.

Don’t take with dairy products (like milk and yogurt) or calcium-fortified juices alone.

Dairy may make the quinolone less effective and caffeine could build up in your body while taking the medicine.

Last, garlic, ginger, glucosamine, ginseng, and ginkgo can increase the chance of bleeding.

They work by destroying or reducing white or red blood cells. Thyroid Medications

Controls and reverses the symptoms of hypothyroidism. Used to treat congenital hypothyroidism (cretinism), autoimmune hypothyroidism, other causes of hypothyroidism (such as after thyroid surgery), and goiter (enlarged thyroid gland). They work as synthetic thyroid hormones.

Quinolone Antibacterials

Antibiotics or antibacterials are used to treat infections caused by bacteria. They work by killing the bacteria.

Tetracycline Antibacterials

Antibiotics or antibacterials are used to treat infections caused by bacteria. They work by killing the bacteria.

Note your caffeine intake. Take these medicines one hour before a meal or two hours after a meal, with a full glass of water.

Tetracycline may upset your stomach and dairy may make the tetracycline less effective.

Don’t take with dairy products (like milk and yogurt). (Continued)

112

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

FORBIDDEN FRUIT

| The Discovery of Dangerous Drug Interactions TEACHER NOTES

5

Drug Interaction Chart (continued)

Name of Drug Oxazolidinone Antibacterials

Type of Drug and How It Works Antibiotics or antibacterials are used to treat infections caused by bacteria. They work by killing the bacteria.

Antifungals

Medicines that treat or prevent fungal infections. Antifungals work by slowing or stopping the growth of fungi that cause infection.

Directions Regarding Food or Drink Interactions

Description of the Interaction

Avoid large amounts of foods and drinks high in tyramine. This includes foods that are fermented, pickled, or spoiled. Avoid lots of chocolate, caffeine, and alcohol.

High levels of tyramine can cause a sudden, dangerous increase in your blood pressure.

Depending on type, take on empty stomach or after a meal. Take with fatty foods.

Food enhances or reduces effectiveness.

Don’t mix with any other medicines, water, or liquids. Avoid alcohol.

All of the foods to avoid contain tyramine.

The drug can make the side effects of alcohol worse, causing fast heartbeat and flushing.

They work by killing the fungi. Antimycobacterials

They treat infections caused by mycobacteria, a type of bacteria that causes tuberculosis (TB) and other kinds of infections.

Avoid foods and drinks with tyramine and foods with histamine.

Foods with histamine can cause headache, sweating, palpitations (rapid heartbeats), flushing, and hypotension (low blood pressure).

They work by killing the mycobacteria.

Monoamine Oxidase Inhibitors (MAOIs)

They treat depression in people who haven’t been helped by other medicines.

Avoid foods and drinks that contain tyramine.

They work by increasing the amounts of certain natural substances that are needed for mental balance. Bipolar Disorder Medicines

Helps people who have mood swings by helping to balance their moods. They work by providing the body with mood stabilizing substances.

High levels of tyramine can cause a sudden, dangerous increase in your blood pressure.

High levels of tyramine can cause a sudden, dangerous increase in your blood pressure. Caffeine contains tyramine and alcohol may increase side effects.

Take with food or milk. Drinks lots of fluids and don’t try to avoid salt.

May cause upset stomach if taken without food or milk. Lithium, one type of bipolar disorder drugs, can cause you to lose sodium. Alcohol may increase side effects and drowsiness. (Continued)

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

113

5 Drug Interaction Chart (continued)

Name of Drug Bisphosphonates (Bone Calcium Phosphorus Metabolism)

Type of Drug and How It Works Prevents and treats osteoporosis, a condition in which the bones become thin and weak and break easily. They work by preventing bone breakdown and increasing bone thickness.

Directions Regarding Food or Drink Interactions Take only on an empty stomach. Don’t take with mineral water, antacids, or other medicines, foods, drinks, or vitamins with calcium.

Description of the Interaction Foods (especially with calcium) may interact with effectiveness or enhance side effects. May cause drop in blood pressure.

Take when sitting or standing up.

Activity Questions, Part I 1. Explain why your experiments need a treatment group and a control group. How did the control group and the treatment group differ in each of the three experiments? The treatment group receives the treatment that’s being tested. The control group provides a baseline for comparison. Each of the treatment groups in the experiments received a different food/drink item to determine which item may be affecting how the drug Zazlee functions in the human body. The control group did not receive a food or drink item so that it could serve as a baseline comparison for the treatment group. 2. Medical researchers are asking humans subjects to participate in these experiments knowing other patients developed kidney damage due to taking Zazlee. What are the benefits in using humans for these experiments? What are the challenges or dangers for humans in these experiments? Students’ answers may vary. One benefit to using human test subjects is that the researchers will know exactly how the drug interacts with the specific food item in the human body. Participants are also able to tell the researchers how they feel, which is additional data scientists could not collect from cell or animal trials. Challenges include keeping the patients safe, and preventing long-term health damage. 3. Review the number of people participating in Experiments 1, 2, and 3 (both the overall number of people in each experiment and the number of people in each experimental and control group). What are the benefits and challenges to having this number of people in the experiments? Students’ answers may vary. But they might point out that the sizes of the experimental and control groups in Experiments 1 and 2 are equal, which makes the experimental and control groups of these experiments easier to compare. They might note that scientists will have a harder time comparing the experimental and control groups

114

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

FORBIDDEN FRUIT

| The Discovery of Dangerous Drug Interactions TEACHER NOTES

5

in Experiment 3 due to the differences in group sizes. Moreover, students might point out that the differences in the number of participants overall in each experiment might make it harder to draw comparative data between Experiments 1, 2, and 3. 4. Explain why the researchers instructed all patients in the three experiments to take the same amount of the drug (10 mg) for the same amount of time (once a day for a week). The same amount of drug during the same amount of time helps control these variables so that every experimental group is the same. If the amount or time is different, then it is difficult to examine the comparisons in each of the groups. 5. How would you change the design of the experiments to ensure the data you are collecting will help answer your investigation question? Students’ answers may vary, but may include retesting, a review of the challenges of keeping food journals and bias, and define how the selection of foods/drinks were conducted.

Activity Questions, Part II 1. Based on the data from the experiments, which food or drink item might cause a significant drug interaction with Zazlee? What is the evidence for your choice? Sweet potatoes cause a significant drug interaction; the evidence is a significantly low calcium level in the blood with a high level of Zazlee. 2. Briefly research this food or drink item’s relationship with calcium. How might this food or drink item be causing a significant drug interaction with Zazlee? Sweet potatoes have high levels of oxalic acid that may impede calcium absorption in the body. If this is occurring, Zazlee does not have the opportunity to bind with calcium, resulting in high levels of unbound Zazlee. 3. Based on your experiments, what is your recommendation to the FDA? What should the public know about the food or drink item and Zazlee? Students’ answers may vary but could include recommendations for further testing/ experimentation of sweet potatoes, Zazlee, and calcium absorption. Additionally, the FDA should include a warning label to doctors, pharmacists, and patients about the potential drug interaction.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

115

5 4. What other recommendation(s) might you suggest to the FDA that may need additional research or experimentation? Why? There may be an increased risk of a drug interaction of Zazlee with red wine based on the average blood tests being borderline. There should be recommendations for future testing.

Apply and Analyze 1. What did the researchers find in the article? Why were they worried about how the medicine and drugs were being dispensed to patients? The researchers found that when they ordered two medications that were known to have significant drug interaction, a majority of the pharmacies did not instruct nor inform the patient of this issue. The researchers were worried that people ordering medications may not have access to drug interaction information. 2. How might clinics and pharmacists change to ensure that patients learn about dangerous drug interactions? Students’ answers may vary, but they might suggest educating lab technicians, pharmacists, and doctors on how to best share this information with patient, using an effective database alert system to warn pharmacists when a patient has ordered drugs that shouldn’t be combined, and providing clear warning labels.

Resources and References Aronson, A. 2004. Classifying drug interactions. British Journal of Clinical Pharmacology 58 (4): 343–344. www.ncbi.nlm.nih.gov/pmc/articles/PMC1884601. Begun, R. 2014. 5 common food-drug interactions. Eatright.org. www.eatright.org/resource/ health/wellness/preventing-illness/common-food-drug-interactions. European Patients’ Academy (EUPATI). 2015. The concept of blinding in clinical trials. EUPATI. www.eupati.eu/clinical-development-and-trials/concept-blinding-clinical-trials. Food and Drug Administration (FDA). Avoid food-drug interactions. www.fda.gov/ media/79360/download. Roe, S., R. Long, and K. King. 2016. Pharmacies miss half of dangerous drug combinations. ChicagoTribune.com. www.chicagotribune.com/news/watchdog/druginteractions/ct-druginteractions-pharmacy-met-20161214-story.html.

116

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

LISTEN TO YOUR HEART

6

The Accidental Discovery of the Pacemaker

A Case Study Using the Discovery Engineering Process Introduction

FIGURE 6.1

A healthy, beating heart is important for maintaining homeostasis within the body. Certain health issues can lead to an irregularity in the way the heart beats. The heart can beat too fast, too slow, or with an irregular beat. This is called an arrhythmia. Sometimes arrhythmias are caused by blockages that affect the electrical pathways of the heart. For people with this condition, it may be necessary to have a pacemaker implanted. A pacemaker stimulates heart muscle to contract in order to regulate heart rate. When pacemakers were first developed, they were large and had to be plugged into a wall (Figure 6.1), making it hard for patients to live a normal life. So, scientists worked to develop an implantable pacemaker that could be inserted into the patient’s chest cavity. An accidental discovery led the way to creating the first implantable pacemaker.

An Early Electronic Pacemaker

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

117

6 Lesson Objectives By the end of this case study, you will be able to • describe how the implanted pacemaker was developed; • analyze data to explore the safety and efficacy of implanted pacemakers in the 1960s; and • design a new treatment for a current disease using electrical currents.

The Case Read about the accidental discovery of the implantable pacemaker. Once you have finished reading, answer the questions that follow. Electricity has been used to treat human ailments as far back as the ancient Romans, who would use electric rays to treat pain. The human heart has also been a subject of interest for thousands of years. Philosophers in early China and ancient Rome studied the heart and the rate at which it beats and found that people died when their hearts stopped beating. In the late 1800s, researchers were able to record the electrical activity of the heart. They developed the electrocardiograph, a machine that graphs the heart’s electrical impulses, similar to a modern-day electrocardiogram (ECG/EKG). Once researchers learned they could graph the electrical impulses of the heart, they began to study the heart’s cardiac cycle. The cardiac cycle involves the two phases of the heartbeat. In the diastole phase, the ventricles (the heart’s bottom two chambers) are relaxed, and they fill with blood from the atria (the heart’s top two chambers). In the systole phase, the ventricles contract and pump blood out of the heart. During this contraction, oxygen-poor blood goes to the lungs to become oxygenated, and oxygen-rich blood is pumped out to the body. One cardiac cycle is completed as the heart fills with blood and then pumps blood out. (See Figure 6.2.) Pacemakers work by sending electrical signals to the heart to reset the pacing of the heartbeat (Figure 6.3). The first pacemakers that were developed were large and could only be moved as far as their cord would allow them. Eventually wearable pacemakers were developed but they remained the size of a small shoebox. Scientists began to race to see who could develop the first implantable pacemaker. In the 1950s, Wilson Greatbatch was employed as a medical researcher. He was working on an oscillator, an electrical circuit that creates a repetitive current. The device would allow him to record heart sounds. As he was building the oscillator, he reached into a box for a resistor—an electrical component that slows down electrical currents. He wanted to use a 10 KΩ resistor, but he misread the piece and installed a 1 MΩ resistor instead. When Greatbatch plugged in his oscillator, it pulsed once and then stopped for one second before pulsing again. He was ready to take it apart and install the correct piece when he realized that the device had

118

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

LISTEN TO YOUR HEART

| The Accidental Discovery of the Pacemaker

6

FIGURE 6.2 Cardiac Cycle

FIGURE 6.3 Heart With Pacemaker

mimicked the timing of the human heartbeat. He also recalled that electricity could influence the heartbeat, something he learned as an undergraduate student in an animal behavior lab. He spent two years modifying his oscillator design to make it smaller and safer for the human body. By 1960, his device had been implanted in

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

119

6 10 cardiac patients. The first patient was a 77-year-old man who lived for 18 months with the pacemaker. However, Greatbatch was not satisfied with his design. He found that the batteries could run out of energy within two years. It would require surgery to replace them. He was able to redesign the battery so that it could last for more than a decade in a pacemaker. His batteries are now used in pacemakers all over the world.

Recognize, Recall, and Reflect 1. How does a pacemaker work? 2. What mistake led Dr. Greatbatch to develop the implantable pacemaker? 3. What other items did Dr. Greatbatch have to design to improve his invention?

Investigate and Explain When implanted pacemakers were first invented, it was important to develop a method for testing the devices’ effectiveness. Examine a study done in 1965 to learn more about early implanted pacemakers. After examining the data, answer the questions that follow. • Type of Health Issue: Complete heart block (the heart beats too slowly because the electrical signal from the top of the heart to the bottom is blocked); Stokes-Adams attacks (fainting due to irregularity in the heartbeat and a lack of blood to the brain). • Total Number of Patients in Study: 10 • Research Methodology: Ten patients who had received a pacemaker were examined from two to eight weeks after their implantation. The patients were monitored with an electrocardiograph. The pacemaker pulse was measured as the patient breathed normally, held their breath in, and held their breath after an exhale. • Data: The data in Figure 6.4 were collected over the course of eight weeks to examine the effectiveness of the pacemakers over time. Note that the totals add up to more than 10 patients due to multiple outcomes of pacemaker function for any one patient. 1. According to Figure 6.4, what percentage of the patients had successful pacemaker operations? 2. The researchers tested the patients several times over the course of eight weeks. Why would it be important to monitor the pacemaker over time? 3. If you worked for the American College of Cardiology in 1965 and reviewed this data, what would be your concerns with continuing pacemaker surgeries? What research still needed to be done?

120

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

LISTEN TO YOUR HEART

| The Accidental Discovery of the Pacemaker

6

FIGURE 6.4 Outcomes of Patients With Pacemakers in 1965 Research Study 6 5 4 3 2 1 0

Unit still operating Unit removed due Unit removed due Unit removed due successfully to battery failure to changes in to infection pulse rate

Death of patient

Source: Adapted from Knuckey, McDonald, and Sloman (1965).

Activity Imagine you are a medical doctor helping to counsel patients who want to learn more about getting a pacemaker. First, you will learn the various reasons that may lead to someone needing a pacemaker. Next, you will read the brief case histories of four individuals who wish to discuss their options for having a pacemaker implanted. Last, you will consult with other doctors (your classmates) and draft your recommendations to the patients.

Part I Visit the website of the National Heart, Lung, and Blood Institute to learn about pacemakers (www.nhlbi.nih.gov/health-topics/pacemakers). Also visit the University of Michigan’s Health Library (www.uofmhealth.org/health-library/abk4063) to review the Should I Get a Pacemaker? decision matrix. After reading these sources, answer the questions that follow.

ACTIVITY QUESTIONS, PART I 1. What is an arrhythmia? What are the two types of arrhythmia? 2. How can doctors detect an arrhythmia? 3. Who might need a pacemaker?

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

121

6 Part II Review each of the four patient profiles in Table 6.1.

TABLE 6.1 Patient Medical Histories Patient’s Name

Patient’s History

Patient’s Health Concerns

Patient’s Feelings on Pacemakers

Tommy W.

53-year-old white male. Has an extensive family history of cardiac issues.

Has never had irregular heartbeat, not presently taking any medications.

Tommy is interested in having a pacemaker in case he has a heart attack.

Jasmine P.

34-year-old black female. Has no family history of cardiac issues.

Often has irregular heartbeat even though presently taking heart medications.

Jasmine is interested in a pacemaker to get off her heart medication.

Anoki F.

16-year-old Native American male. Was born with a congenital heart defect.

Sometimes has irregular heartbeat, not presently taking any medications.

Anoki is scared to undergo surgery and has concerns about long-term use of a pacemaker.

Mariana Z.

68-year-old Hispanic female. Has an unknown family history of cardiac issues.

Always has irregular heartbeat, not presently taking heart medications due to concerns of drug interactions.

Mariana is nervous about the surgery, but does not want to be on more medications.

Now that you’re familiar with these medical histories, gather in small groups with other doctors (i.e., your classmates) to consult on the four patients. Consider and discuss the following questions based on each patient’s medical history. At the end, you should be ready to make a recommendation for treatment. Some questions to consider as you consult with your classmates: • Would you recommend a pacemaker for someone with these conditions? • Why or why not? • What factors may influence your decision? • What are the benefits and risks of having a pacemaker implanted? • Do the benefits outweigh the risks? Why or why not?

122

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

LISTEN TO YOUR HEART

| The Accidental Discovery of the Pacemaker

6

ACTIVITY QUESTIONS, PART II 1. What would you recommend for Tommy? Why? 2. What would you recommend for Jasmine? Why? 3. What would you recommend for Anoki? Why? 4. What would you recommend for Mariana? Why?

Apply and Analyze Michigan Medicine at the University of Michigan provides information on how the heartbeat is controlled by specific electrical impulses from special cells called nodes. Read this web page on the heart and its electrical system: www.uofmhealth. org/health-library/zm2272#zm2272-sec. Then, sketch the heart and its electrical system. Label all the major parts of the heart (nodes, veins, arteries, and chambers). Use additional credible online resources to help you.

Design Challenge Engineering is the application of scientific understanding through creativity, imagination, and the designing and building of new materials to address and solve problems in the real world. You will be asked to take the science you have learned in this case and design a process or product to address a real-world issue. Engineers use the engineering design process (Figure 6.5, p.  124) as steps to address a real-world problem. In this case, you are asking the question (Step 1) of how electricity can be used to treat diseases and conditions other than cardiac irregularities. Using outside research, you will then brainstorm (Step 2) a specific way for electricity to treat a disease. Next, you will create a plan (Step 3) for your electricity-based treatment. You will consider the design (Step 4) of your treatment (that is, how your treatment would work), creating a poster to illustrate your thoughts. Last, you will evaluate (Step 5) your plan with your peers and think of improvements (Step 6).

1. Ask Questions Ask questions about treating diseases with electricity. For instance, why should we consider treating diseases or conditions other than heart irregularities using electricity? What diseases might be most responsive to an electricity-based treatment? What is the best way to deliver the electricity to the patient?

2. Brainstorm and Imagine Pacemakers are not the only tool for treating diseases through electricity. Watch this video on how electricity is used to treat Parkinson’s disease:

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

123

6 FIGURE 6.5 The Engineering Design Process 1 Ask Questions and Define the Problem 6

2

Revise and Improve

Brainstorm and Imagine

3 5

The Engineering Design Process

3

Test and Evaluate

Plan 4 Design and Create

www.parkinson.org/pd-library/videos/how-does-a-dbs-device-work. A summary of using electricity for therapy is available here: https://en.wikipedia.org/wiki/Electrotherapy. And a video showing how electricity can be part of medical treatment can be seen here: www.statnews.com/2015/09/28/electricity-may-spark-medical-treatment. Create a list of other diseases you think may be treated using electrical impulses. Then, think of a specific way to use an electrical treatment for a human or animal disease.

3. Create a Plan Create a plan for your idea to treat a disease with electricity or electrical impulses. Clearly outline (1) which disease you chose, (2) what the effects of this disease are, (3) how electricity might treat the disease, (4) what potential side effects might occur and (5) how to treat those potential side effects. Use the Create a Plan worksheet (p. 126) for guidance.

4. Design and Create Create a poster explaining your proposed treatment. The poster should appropriately and clearly describe the disease you chose, the plan for treatment, and

124

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

LISTEN TO YOUR HEART

| The Accidental Discovery of the Pacemaker

6

the rationale for choosing this plan. Use both text and images to communicate the information. This poster will be used to inform audiences as well as persuade them to support your proposal. Make sure you include the information from your graphic organizer as you develop your poster. After you have finished, hang your poster on the wall of your classroom.

5. Test and Evaluate You will now evaluate your classmates’ proposals using the Treatment Plan Evaluation Form (p. 127). Your teacher will assign your group three posters to review. You will evaluate peers’ work based on the clarity, organization, and effectiveness of their proposed treatment plans.

6. Revise and Improve Using the feedback, you gained from the evaluation form, re-create your poster to reflect the improvements suggested by your peers. What are some ways you can use their input to refine your plan? You may choose to accept all or only some of the suggestions. Be sure to justify your reasons for accepting or not using the peer feedback.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

125

6 Create a Plan

126

1

What is the disease you chose?

2

What are the effects of this disease?

3

How might electricity treat this disease?

4

What might the potential side effects of this treatment include?

5

How would you treat these potential side effects?

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

LISTEN TO YOUR HEART

| The Accidental Discovery of the Pacemaker

6

Treatment Plan Evaluation Form Name of Evaluator: ________________________________ Name on Poster: _________________________________ Yes, Somewhat, or No

Comments

Does the poster appropriately and clearly describe the disease and the plan for treatment?

Does the poster explain the rationale for the treatment plan?

Does the poster provide a convincing argument that the treatment would be effective?

Does this poster give you a visual sense of how the treatment works?

Overall impression of the treatment plan:

List what you liked about the plan:

List improvements students could make to their plan:

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

127

6 TEACHER NOTES

LISTEN TO YOUR HEART

THE ACCIDENTAL DISCOVERY OF THE PACEMAKER A Case Study Using the Discovery Engineering Process

Lesson Overview In this lesson, students explore the development of the pacemaker. Although the invention has a clear function, its discovery was more serendipitous. Students will discover that some heart conditions (but not all) are controlled with the assistance of a pacemaker. Students learn about different types of heart conditions and consider how an electrical device such as the pacemaker can be used to treat cardiac conditions. Students will review patient histories, so they can counsel different patients interested in having a pacemaker implanted. Last, students will create a plan to use an electrical device to address a different human health issue.

Lesson Objectives By the end of this case study, students will be able to • describe how the implanted pacemaker was developed; • analyze data to explore the safety and efficacy of implanted pacemakers in the 1960s; and • design a new treatment for a current disease using electrical currents.

Use of the Case Due to the nature of these case studies, teachers may elect to use any section of each case for their instructional needs. They are sequenced in order (scaffolded) so students think more deeply about the science involved in the case and develop an understanding of engineering in the context of science.

Curriculum Connections Lesson Integration This lesson may be taught during a unit on body systems or a unit on how the body maintains homeostasis.

128

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

LISTEN TO YOUR HEART

| The Accidental Discovery of the Pacemaker TEACHER NOTES

6

Related Next Generation Science Standards PERFORMANCE EXPECTATIONS • MS-LS1-2. Develop and use a model to describe the function of a cell as a whole and ways parts of cells contribute to the function. • MS-ETS1-2. Evaluate competing design solutions using a systematic process to determine how well they meet the criteria and constraints of the problem. • HS-LS1-2. Develop and use a model to illustrate the hierarchical organization of interacting systems that provide specific functions within multicellular organisms. • HS-ETS1-2. Design a solution to a complex real-world problem by breaking it down into smaller, more manageable problems that can be solved through engineering. • HS-ETS1-3. Evaluate a solution to a complex real-world problem based on prioritized criteria and trade-offs that account for a range of constraints, including cost, safety, reliability, and aesthetics, as well as possible social, cultural, and environmental impacts.

SCIENCE AND ENGINEERING PRACTICES • Asking Questions and Defining Problems • Developing and Using Models • Planning and Carrying out Investigations • Analyzing and Interpreting Data • Constructing Explanations and Designing Solutions • Engaging in Argument From Evidence

CROSSCUTTING CONCEPTS • Patterns • Cause and Effect • Systems and System Modeling

Related National Academy of Engineering Grand Challenges • Engineer Better Medicines • Advance Health Informatics

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

129

6 Lesson Preparation Before starting the lesson, it is helpful for students to have some understanding of tissues and the importance of homeostasis. You may also wish to review the concepts of homeostasis and circuits so students understand how pacemakers use the heart’s electrical system to keep it in balance. You will need to make copies of the entire student section for the class. Students will need internet access at various points in the lesson. Alternatively, you can project videos or print and distribute copies of online content for the class. Before students carry out Step 5 of the Design Challenge, consider how to divide up the work so that each student group looks at three posters. Look at the Teaching Organizer (Table 6.2) for suggestions on how to organize the lesson.

Time Needed Up to 195 minutes

TABLE 6.2 Teaching Organizer

130

Section

Time Suggested

Materials Needed

Additional Considerations

The Case

10 minutes

Student pages

Activity done individually in class or as homework prior to class

Investigate and Explain

10 minutes

Student pages

Activity done individually or in pairs

Activity

40 minutes

Student pages, internet access

Activity done individually or in pairs

Apply and Analyze

10–15 minutes

Student pages, internet access

Individual activity

Design Challenge

120 minutes

Student pages, internet access

Small-group activity

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

LISTEN TO YOUR HEART

| The Accidental Discovery of the Pacemaker TEACHER NOTES

6

Vocabulary • arrhythmia

• implantable

• atria

• nodes

• cardiac cycle

• oscillator

• diastole

• oxygenated

• electrocardiogram

• pacemaker

• electrocardiograph

• resistor

• heart rate

• systole

• homeostasis

• ventricles

Extensions An additional series of lessons related to the heart and heart diseases can be found on the Life Science Teaching Resource Community website: www.lifescitrc.org. Particularly useful might be the lesson titled “Having a Change of Heart: A Lesson on Cardiovascular Anatomy”: www.lifescitrc.org/resource.cfm?submissionID=3722.

Assessment Use the Teacher Answer Key to check the answers to section questions. You can evaluate the students’ posters to assess the Design Challenge. Students’ posters should provide a coherent explanation of their disease and how they feel electricity might address the issue. They should also outline how they plan to treat the disease with electricity. Students should be able to report or state any constraints or drawbacks they can foresee with implementing this design.

Teacher Answer Key Recognize, Recall, and Reflect 1. How does a pacemaker work? Pacemakers work by sending electrical signals to the heart to tell the organ to contract, which can help pace the heartbeat. 2. What mistake led Dr. Greatbatch to develop the implantable pacemaker? He accidentally added the wrong-size resistor. 3. What other items did Dr. Greatbatch have to design to improve his invention?

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

131

6 He had to create longer-lasting batteries for the pacemaker as well.

Investigate and Explain 1. According to Figure 6.4, what percentage of the patients had successful pacemaker operations? 50% 2. The researchers tested the patients several times over the course of eight weeks. Why would it be important to monitor the pacemaker over time? Answers will vary but could include that it’s important to see if there are variations in the device’s effectiveness or if any parts of the pacemaker are failing. 3. If you worked for the American College of Cardiology in 1965 and reviewed this data, what would be your concerns with continuing pacemaker surgeries? What research still needed to be done? Answers will vary but could include concerns over risk of infection and failure of parts. Research would be needed to decrease the rate of infection when implanting the pacemaker. Other research would need to be done to improve the individual parts of the pacemaker, including the battery that Dr. Greatbatch later invented.

Activity Questions, Part I 1. What is an arrhythmia? What are the two types of arrhythmia? Arrhythmias are problems with the rate or rhythm of the heartbeat. During an arrhythmia, the heart can beat too fast, too slow, or with an irregular rhythm. A heartbeat that’s too fast is called tachycardia. A heartbeat that’s too slow is called bradycardia. 2. How can doctors detect an arrhythmia? Doctors can detect arrhythmias through tests like an echocardiogram (ECG or EKG), electrophysiology studies, monitors, or stress tests. 3. Who might need a pacemaker? People with bradycardia, heart block, aging hearts, heart disease; people on certain medications; etc.

132

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

LISTEN TO YOUR HEART

| The Accidental Discovery of the Pacemaker TEACHER NOTES

6

Activity Questions, Part II 1. What would you recommend for Tommy? Why? Answers may vary. Students might say that although pacemakers can help someone who has had a heart attack, it may not be a good option for Tommy because he doesn’t yet show signs of heart irregularity. First, doctors would need to test him to see if he actually has a heart problem. Students might recommend an ECG/EKG, stress test, or other measure to determine if there is an underlying cardiac issue. If there is an issue, they might suggest trying medication before a pacemaker. 2. What would you recommend for Jasmine? Why? Answers may vary. Students might say that although Jasmine’s medication is not fully functional, she may wish to try different medication prior to receiving a pacemaker. Students may recommend an ECG/EKG, stress test, or other measure to determine the specific underlying cardiac issue and if a pacemaker can help with that cardiac condition. 3. What would you recommend for Anoki? Why? Answers may vary. But they might say that Anoki’s age and condition make him a good candidate for pacemaker testing. Students may recommend an ECG/EKG to determine the specific underlying cardiac issue to see if a pacemaker can help with that cardiac condition. To alleviate Anoki’s concerns about pacemakers, students might suggest discussing long-term effects of pacemaker implementation with him and explaining to Anoki that complications from surgery are uncommon. 4. What would you recommend for Mariana? Why? Answers may vary. Students might say Mariana could benefit from a pacemaker, but as an older patient she must be strong enough for surgery. To alleviate Mariana’s concerns about the procedure, students may suggest telling her that as long as a patient is strong enough for surgery, complications are rare.

Apply and Analyze Student sketches of the heart and its electrical system should be properly labeled.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

133

6 Resources and References Begley, S. 2015. Watch: Electricity may spark medical treatment. STAT. www.statnews. com/2015/09/28/electricity-may-spark-medical-treatment. Healthwise Staff. Heart rate problems: Should I get a pacemaker? University of Michigan. www.uofmhealth.org/health-library/abk4063. Pfirrmann, C. Having a change of heart: A lesson on cardiovascular anatomy. Life Science Teaching Resource Community. www.lifescitrc.org/resource.cfm?submissionID=3722. Knuckey, L., R. McDonald, and G. Sloman. 1965. A method of testing implanted cardiac pacemakers. British Heart Journal 27 (4): 483–489. Lee, T. 2008. “Eye Disease Cure: Electric Therapy?” Star Tribune, January 24. www. startribune.com/eye-disease-cure-electric-therapy/14297181. National Academy of Engineering (NAE). Wilson Greatbatch. www.nae.edu/55244.aspx. National Heart, Lung, and Blood Institute. Pacemakers. NIH. www.nhlbi.nih.gov/healthtopics/pacemakers. Parkinson’s Foundation. How does the DBS device work? www.parkinson.org/pd-library/ videos/how-does-a-dbs-device-work. Wikipedia. Electrotherapy. https://en.wikipedia.org/wiki/Electrotherapy.

134

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

OVEREXPOSURE

7

Treating Anaphylaxis Due to Allergies

A Case Study Using the Discovery Engineering Process Introduction When the human immune system is triggered into activation due to something in the environment, an allergic reaction may occur. This can cause sneezing, rashes, and swelling. Pollen, insect bites and stings, and some foods (like peanut butter) and medications (such as penicillin) usually do not cause an allergic reaction. That’s because the immune system recognizes that these are not threats like bacteria and viruses. However, some humans have major reactions, ranging from a slight discomfort (sneezing) to a serious, life-threatening response known as anaphylaxis (swelling of the throat, difficulty breathing) which can often be fatal without medical attention. One of the most common allergic reactions is allergic rhinitis, or hay fever, which is caused by plant pollen (Figure 7.1, p. 136). Once pollen enters the body (usually through the nose or mouth), the body recognizes it as an antigen—an unwanted, foreign substance. The body’s immune system launches an attack on this type of antigen (also called an allergen). To start the attack, the immune system releases a type of protein called antibodies. These attach to the antigens and transport them to mast cells. Mast cells are found in areas of the body that have mucus, or slippery membranes (usually the nose). The mast cells’ function is to remove the antigens from the body by producing chemicals such as histamines (which cause throat and tissue swelling). Sometimes the human body severely overreacts to specific

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

135

7 types of antigens and the production of histamines can trigger anaphylaxis. Anaphylaxis is a life-threatening allergic reaction in which swelling of the throat and shortness of breath occur. Other allergens, such as foods, plants, or medications, may cause different physical responses, like rashes on the skin or swelling of the eyes and face. To avoid allergic reactions, some individuals must avoid contact with the allergen, take medications (antihistamines), or participate in allergen therapy.

FIGURE 7.1 Plant Pollen Under a Microscope

Lesson Objectives By the end of this case study, you will be able to • describe various types of allergic reactions and known treatments; • analyze an allergic response and create a treatment plan; and • design a medical treatment proposal based on the knowledge of allergies to treat an illness or disease.

The Case This account outlines the discovery of allergy-induced anaphylaxis. Once you have finished reading, answer the questions that follow. Charles Richet was a physiologist (an individual who studies the functions of a body system) with a focus in immunology (the study of the immune system). In 1902, Richet and his colleague Paul Portier conducted experiments to learn more about the human immune system. Richet had wanted to study the effects of toxic chemicals from sea anemones on dogs. He believed that dogs would develop a tolerance (or an immunity) to the sea anemone from repeated exposure to the toxic chemical. To test his theory, Richet exposed dogs to the anemone toxin. During this first round of testing, some of the dogs survived and recovered from the initial allergic reaction. Richet assumed that the surviving dogs had developed a tolerance to the toxin. A few weeks later, he exposed the surviving dogs to the toxin again, believing they would not react or have only a minor reaction due to

136

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

OVEREXPOSURE

| Treating Anaphylaxis Due to Allergies

7

heightened immunity. However, following the second exposure to the toxin, the dogs immediately suffered severe allergic reactions. This time, the allergic effects happened much more quickly and were more severe than after the first exposure. Richet called this immediate and more severe reaction anaphylaxis (Figure 7.2). The dogs did not develop a tolerance to the toxin. Instead the opposite happened—they became sensitized to the toxin. Before Richet’s finding, scientists thought the immune system only provided protection to the body. Richet’s experiments proved that, when allergens are present, the immune system could damage the body as well, revolutionalising understanding of what allergies are and how they can be treated. In 1913, Richet received the Nobel Prize based on his work. Medical researchers are still investigating allergies to food, medication, and plants to understand how best to treat allergic symptoms. Because anaphylaxis can be severe and lead to death, primary treatment is injection of epinephrine (a hormone that can increase airflow and relaxes muscles). You may have seen such an injection device, common to many schools and hospitals.

FIGURE 7.2 Symptoms of Anaphylaxis

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

137

7 Recognize, Recall, and Reflect 1. What did Charles Richet and Paul Portier discover during the first and second rounds of experiments on dogs? 2. Why did Richet and Portier expose the surviving dogs to the toxin a second time? 3. What is the treatment for anaphylaxis? Why should an individual with symptoms of anaphylaxis be immediately treated?

Investigate and Explain Millions of American children and adults have food allergies. There are eight major food allergens responsible for most allergic reactions in the United States. The allergens come from milk, eggs, peanuts, tree nuts, wheat, soy, fish, and shellfish. Analyze the graph from the Centers for Disease Control and Prevention (CDC) in Figure 7.3. The graph shows the average number of hospital discharges per year among children under the age of 18 with any diagnosis related to food allergies in the United States from 1998–2006. After examining the data, answer the questions that follow.

FIGURE 7.3 Allergy-Related Hospital Visits in the United States

Source: Branum and Lukacs (2008).

138

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

OVEREXPOSURE

| Treating Anaphylaxis Due to Allergies

7

1. What is the trend in the data on allergy-related diagnoses? 2. What do you think are some reasons that there are more reported cases from 2004–2006 compared to both previous time periods combined?

Activity Imagine you are an allergist. As part of your work, you study and treat patients when they come into contact with food that causes them to have allergic reactions. Today, you have an emergency appointment with a new patient who may have a food allergy. You will review the patient’s symptoms and administer an allergy test to determine the patient’s type of allergy. After determining the allergy, you will design a treatment plan for your patient. Before you read about the case below, read the Mayo Clinic’s guide on the diagnosis and treatment of food allergies located here: www.mayoclinic.org/diseasesconditions/food-allergy/diagnosis-treatment/drc-20355101. Review each step of your appointment plan below and consider each of the four guiding questions. • Patient’s Background: Your patient is a 12-year-old girl named Anna Maria who recently was hospitalized after eating a lunch consisting of whole milk and a peanut butter sandwich (made of wheat bread, peanut butter, and strawberry jam). Her symptoms included a swollen mouth and throat restricting or limiting her breathing. Anna has been able to eat peanut butter sandwiches and drink milk in the past without a swollen mouth or throat. The doctor at the hospital believes Anna Maria’s previous exposures to the unknown allergen must have led to anaphylaxis. Guiding Question 1: When you meet Anna Maria during her appointment, what questions might you want to ask her about her history with allergic reactions or food? • Patient’s Appointment—Initial Questions: You ask Anna Maria and her parents questions about her medical and allergy history. Anna Maria shares that when she would eat peanut butter sandwiches, her hands would sometimes tingle, and the skin on her hands would have a red, itchy rash. She stated that these symptoms were annoying but never life threatening. Guiding Question 2: What follow-up questions would you ask Anna Maria about her earlier symptoms? What should you, as an allergist doctor, know about Anna Maria before you continue? Guiding Question 3: Based on your knowledge of allergies and the patient’s background, what are the possible allergens in this scenario? • Patient’s Appointment—Testing: You share with Anna Maria that the next step of the doctor’s appointment is to conduct a test to diagnose her specific food allergy and develop a treatment plan. You tell Anna Maria that a blood

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

139

7 allergy test will help determine which food may be causing her allergic reactions. You also share that it might take more than a week to obtain the results from the laboratory and ask Anna Maria and her parents to schedule an appointment in 10 days to review the blood test results. You take a sample of Anna Maria’s blood and send it to the laboratory to test for four allergens: milk, wheat (from the bread), peanuts, and strawberry. The results come back to your office a week later. The report shows the allergens tested, the immunoglobulin E (IgE) levels in the blood (IgE is released when there is a reaction to an allergen), and laboratory guidance about the blood test results. The results of the test are below in Table 7.1.

TABLE 7.1 Anna Maria’s Blood Allergy Test Results Immunoglobulin E (IgE) Level in Patient’s Blood

Allergen Tested

Laboratory Blood Test Interpretation Guidance

Milk (Cow)

0.28 kU/L

Levels lower than 0.35 kU/L suggest that an individual may not have an allergen sensitivity.

Wheat

0.26 kU/L

Levels lower than 0.35 kU/L suggest that an individual may not have an allergen sensitivity.

Strawberry

0.29 kU/L

Levels lower than 0.35 kU/L suggest that an individual may not have an allergen sensitivity.

Peanuts

0.44 kU/L

Levels higher than 0.35 kU/L suggest that an individual may have an allergic response to the allergen.

Guiding Question 4: Review the results of the blood allergy test. When Anna Maria returns for her next appointment, think about what information you will share with her. • Patient’s Appointment—Treatment: Anna Maria returns to your office. You share the blood allergy test results with Anna Maria and her parents. Next, you will have to develop a treatment plan for Anna Maria and her parents to follow so that Anna Maria does not suffer from anaphylaxis. You will now fill in the Allergist’s Report, describing a treatment plan that is easy for Anna Maria and her parents to understand. You may use the Mayo Clinic’s guide on the diagnosis and treatment of food allergies and other electronic resources

140

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

OVEREXPOSURE

| Treating Anaphylaxis Due to Allergies

7

to help you. Make sure to reference Anna Maria’s blood allergy test results as you fill out the report. After completing the activity, answer the questions that follow.

Allergist’s Report Question

Allergist’s Answer

Anna Maria’s reaction to the allergen was anaphylaxis. Explain if her treatment should be based on minor or severe symptoms. What should Anna Maria know about the epinephrine auto injector? When Anna Maria is at home, what should she do to decrease the chance of coming into contact with the allergen? What should Anna Maria do when she returns to school to prevent coming into contact with allergens? If Anna Maria has a severe reaction to the allergen in the future, what are the steps in her treatment plan? Anna Maria may have to visit an allergist many more times in her life. What should she do to prepare for her future doctor’s appointments? What additional resources should Anna Maria read about her condition?

Activity Questions 1. Describe how Anna Maria’s reaction to the allergen changed over time. 2. Why would the allergist suggest a blood test over a skin test to determine which allergen caused the allergic reaction in Anna Maria? 3. What are the challenges Anna Maria and her parents face during the weeklong wait for the blood test results? What advice might her doctor give her during this time?

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

141

7 Apply and Analyze Many flu vaccines are created using chicken eggs. Individuals who have egg allergies have regularly been advised by doctors to get flu vaccines not made with chicken eggs. However, there have been changes about this recommendation in recent years. Read this article from CNN on chicken egg allergies and the flu vaccine: www.cnn.com/2017/12/19/health/flu-vaccine-egg-allergy-study/index.html. After reading, answer the questions that follow. 1. Why do doctors advise people to get the flu shot? 2. Why do people with chicken egg allergies worry about getting the flu shot? 3. What are the best ways to avoid the flu?

Design Challenge The case study in this lesson illustrates how a scientific observation led to deeper understanding of a problem. Observations and discoveries often provide useful knowledge. They also spark ideas for innovations. This is especially true in the field of engineering. Engineering is the application of scientific understanding through creativity, imagination, and the designing and building of new materials to address and solve problems in the real world. You will be asked to take the science you have learned in this case and design a process or product to address a real-world issue. For this activity, you will be focusing on using allergic reactions (activity of the immune system) or allergy treatments (inactivity of the immune system) to treat other medical conditions. Here are some examples: • Using allergic reactions: One way to treat cancer is to activate the body’s immune system to attack and kill cancerous cells. This could involve binding histamines to certain types of tumors, which would cause antibodies to target and try to destroy the histamines and cancer cells. • Using allergy treatments: Another way to treat cancer is to inactivate the body’s immune system. New research has revealed evidence suggesting that histamines might hide certain types of tumors from the immune system and allow cancer to grow. Knowing this, antihistamines (drugs used to suppress histamine production) may one day be a treatment against these kinds of cancer. You can learn more about the link between histamines and cancer here: www.massey.vcu.edu/about/blog/2014/researchers-uncover-allergy-cancerconnection. You will use the engineering design process (Figure 7.4) to come up with your own new applications for an allergy reaction or treatment. Engineers use the engineering design process as steps to address a real-world problem. In this case, you are asking the question (Step 1) of how allergic reactions or allergy treatments

142

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

OVEREXPOSURE

can be used for a new purpose. Using outside research, you will brainstorm (Step 2) a specific new way for allergic reactions or allergy medicines to solve a problem. Then, you will create a plan (Step 3) for your idea. Next, you will consider how you might design (Step 4) your application, creating a medical treatment proposal to describe your thoughts. Afterward, you will come up with a way to test (Step 5) your idea and consider how you might improve (Step 6) on it.

7

FIGURE 7.4 The Engineering Design Process

1 Ask Questions and Define the Problem 6

2

Revise and Improve

Brainstorm and Imagine

3 5 Test and Evaluate

1. Ask Questions

| Treating Anaphylaxis Due to Allergies

The Engineering Design Process

3 Plan

Ask questions about allergic 4 reactions and allergy medicine. Design and For instance, how does the body Create react during an allergic reaction? How could allergic reactions be used to solve a problem? What types of diseases or conditions might be treated through allergic reactions? What types of diseases or conditions might be treated with allergy medicine?

2. Brainstorm and Imagine Conduct some research to answer the questions you asked in Step 1. Then, brainstorm a specific new treatment that uses an allergic reaction or an allergy medicine to treat a condition or disease. Can you think of a new treatment to solve a current problem?

3. Create a Plan Create a plan to develop your new treatment for a condition or disease. Summarize (1) the disease or condition you want to treat, (2) identify an allergic reaction or allergy medicine that will be used to treat the disease or condition, (3) describe how your new medical treatment relates back to your knowledge of allergies, (4) explain what materials or tools you might need to make your idea a reality, and (5) list advantages and disadvantages to your new idea. Use the Create a Plan worksheet (p. 145) for guidance.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

143

7 4. Design and Create Develop a medical treatment proposal to describe your new idea. In the proposal, explain how you would go about creating a new use for an allergic reaction or allergy medicine. Include the following in your proposal: • A detailed description of your new idea How your proposed allergic reaction/allergy medicine is created How patients will be affected by the treatment Why using this reaction or medicine is a good idea • A description of how you would go about developing your idea (Who would you work with? Where would you develop the product?) • Information on how the patients’ health will be protected from negative side effects • An explanation of how you would market the product to users Add this information to your Medical Treatment Proposal worksheet (p. 146).

5. Test and Evaluate Think about how you would test the safety and efficacy of your plan. Consider these questions: • Phase 1—What would you do for laboratory testing? • Phase 2—What would you do for animal-based testing? • Phase 3—What would you do for clinical trials? • Surveillance—What would you do to ensure ongoing evaluation of the product on the market? Add this information to the Evaluation Plan graphic organizer (p. 147), and then attach it to your Medical Treatment Proposal.

6. Revise and Improve Present your proposal to your peers. Listen to their feedback on your proposal and take some time to revise it and make improvements. What are some ways you can use their input to refine your proposal? You may choose to accept all or only some of the suggestions. Be sure to justify your reasons for accepting or not using the peer feedback.

144

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

OVEREXPOSURE

| Treating Anaphylaxis Due to Allergies

7

Create a Plan 1

What is the disease or condition you want to treat?

2

Identify an allergic reaction or allergy medicine that will be used to treat the disease or condition.

3

Describe how your new medical treatment relates back to your knowledge of allergies.

4

What materials or tools might you need to make your idea a reality?

5

What are the advantages of your new idea?

6

What are the disadvantages of your new idea?

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

145

7 Medical Treatment Proposal

146

1

Describe your idea.

2

How would the idea be developed?

3

How would patients’ health be protected from negative side effects?

4

How would you market the product to users?

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

OVEREXPOSURE

| Treating Anaphylaxis Due to Allergies

7

Evaluation Plan

Step #1:

_____________________________________________________________________ Step #2:

_____________________________________________________________________ Step #3:

_____________________________________________________________________ Step #4:

_____________________________________________________________________

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

147

7 TEACHER NOTES

OVEREXPOSURE

TREATING ANAPHYLAXIS DUE TO ALLERGIES A Case Study Using the Discovery Engineering Process

Lesson Overview In this lesson, students explore the discovery of anaphylaxis response due to overexposure of allergens. The discovery of this phenomenon led to a revolution in understanding what allergies are and how they are treated. After reading the case study, students will use sample blood test data to determine the allergen in a food and propose a treatment plan. Students will then use their understanding of allergies to propose a medical treatment for a condition or disease.

Lesson Objectives By the end of this case study, students will be able to • describe various types of allergic reactions and known treatments; • analyze an allergic response and create a treatment plan; and • design a medical treatment proposal based on the knowledge of allergies to treat an illness or disease.

Use of the Case Due to the nature of these case studies, teachers may elect to use any section of each case for their instructional needs. They are sequenced in order (scaffolded) so students think more deeply about the science involved in the case and develop an understanding of engineering in the context of science.

Curriculum Connections Lesson Integration This lesson may be taught during a unit on chemical reactions or human biology. It also fits well into a lesson on data interpretation, antigens and antibodies, the structure and function of body systems (e.g., the immune system), and medical treatments and effects.

148

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

OVEREXPOSURE

| Treating Anaphylaxis Due to Allergies TEACHER NOTES

7

Related Next Generation Science Standards PERFORMANCE EXPECTATIONS • MS-ETS1-1. Define the criteria and constraints of a design problem with sufficient precision to ensure a successful solution, taking into account relevant scientific principles and potential impacts on people and the natural environment that may limit possible solutions. • MS-ETS1-2. Evaluate competing design solutions using a systematic process to determine how well they meet the criteria and constraints of the problem. • HS-LS1-3. Plan and conduct an investigation to provide evidence that feedback mechanisms maintain homeostasis. • HS-ETS1-2. Design a solution to a complex real-world problem by breaking it down into smaller, more manageable problems that can be solved through engineering. • HS-ETS1-3. Evaluate a solution to a complex real-world problem based on prioritized criteria and trade-offs that account for a range of constraints, including cost, safety, reliability, and aesthetics, as well as possible social, cultural, and environmental impacts.

SCIENCE AND ENGINEERING PRACTICES • Asking Questions and Defining Problems • Developing and Using Models • Planning and Carrying Out Investigations • Analyzing and Interpreting Data • Constructing Explanations and Designing Solutions • Engaging in Argument From Evidence

CROSSCUTTING CONCEPTS • Structure and Function • Cause and Effect • Systems and System Modeling

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

149

7 Related National Academy of Engineering Grand Challenges • Advance Health Informatics • Engineer Better Medicines • Engineer the Tools of Scientific Discovery

Lesson Preparation Before starting the lesson, it is helpful for the students to have some understanding of the importance the immune system and the interrelatedness of other body systems. Review the structure and function of the immune system, focusing on the role of antigens and antibodies so students can understand the mechanism of anaphylaxis. You will need to make copies of the entire student section for the class. Students will need internet access at various points in the lesson. Alternatively, you can project videos or print and distribute copies of online content for the class. Look at the Teaching Organizer (Table 7.2) for suggestions on how to organize the lesson.

Time Needed Up to 145 minutes

TABLE 7.2 Teaching Organizer Section

150

Time Suggested

Materials Needed

Additional Considerations

The Case

10 minutes

Student pages

Activity done individually in class or as homework prior to class

Investigate and Explain

30 minutes

Student pages

Activity done individually or in pairs

Activity

30 minutes

Student pages, internet access

Activity done individually or in pairs

Apply and Analyze

10–15 minutes

Student pages, internet access

Individual activity

Design Challenge

45–60 minutes

Student pages, internet access

Small-group activity

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

OVEREXPOSURE

| Treating Anaphylaxis Due to Allergies TEACHER NOTES

7

Vocabulary • allergic reaction

• immune system

• allergist

• immunoglobulin E (IgE)

• anaphylaxis

• immunology

• antibodies

• mast cell

• antigen

• physiologist

• antihistamines

• pollen

• epinephrine

• sensitized

• histamines

• tolerance

Extensions This lesson can be extended with discussions about the role of the Food and Drug Administration and CDC in researching and creating warning labels of allergens. It could also be extended with discussions about genetically modified foods and the debate on homeopathy treatments.

Assessment Use the Teacher Answer Key to check the answers to section questions. The key includes a rubric for the allergist’s report (pp. 152–153). You can evaluate the students’ Medical Treatment Proposals to assess the Design Challenge. Proposals should provide a coherent conceptualization of what the new treatment idea is, who it helps, and why it is needed (what problem does it help solve?). The proposal should also include an explanation of how the treatment is created and how the patients’ health will be protected from negative side effects. The proposals should describe how students would test and evaluate the efficacy of their ideas. More specifically, they should include a section on how they would collect data through laboratory, animal, and/or human trials. Students should be able to report or state any constraints or drawbacks they can foresee with implementing their design.

Teacher Answer Key Recognize, Recall, and Reflect 1. What did Charles Richet and Paul Portier discover during the first and second rounds of experiments on dogs? During the first round, some of the dogs were able to overcome their allergic reaction. In the second round, the allergic reaction became more immediate and severe.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

151

7 2. Why did Richet and Portier expose the surviving dogs to the toxin a second time? They believed that the dogs that survived the first round developed a tolerance or immunity to the toxin. They wanted to test this theory. They assumed that if the dogs were tested for a second time, they would survive with little to no allergic reaction. 3. What is the treatment for anaphylaxis? Why should an individual with symptoms of anaphylaxis be immediately treated? Epinephrine. The treatment must be given quickly to relieve severe reactions that can result in death.

Investigate and Explain 1. What is the trend in the data on allergy-related diagnoses? There is a significant and increasing trend of reported cases. 2. What do you think are some reasons that there are more reported cases from 2004–2006 compared to both previous time periods combined? Answers will vary but could include ideas about children being exposed more often to different foods, especially packaged foods (versus home-cooked foods).

Allergist’s Report Scoring Rubric Question Anna Maria’s reaction to the allergen was anaphylaxis. Explain if her treatment should be based on minor or severe symptoms.

Not Meeting Mastery Report gives no explanation as to whether symptoms should be based on minor or severe symptoms; or an explanation is provided, but it doesn’t recognize that the treatment should be based on severe symptoms.

Approaching Mastery Report acknowledges that treatment should be based on severe symptoms, but no explanation is given as to why this is so or explanation that is given is unclear.

Meeting or Exceeding Mastery Report recognizes that the treatment should be based on severe symptoms and provides a comprehensive and easy-to-understand explanation for why this is so.

(Continued)

152

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

OVEREXPOSURE

| Treating Anaphylaxis Due to Allergies TEACHER NOTES

7

Allergist’s Report Scoring Rubric (continued)

Not Meeting Mastery

Question

Approaching Mastery

Meeting or Exceeding Mastery

What should Anna Maria know about the epinephrine auto injector?

No description of the epinephrine auto injector is provided, or the description is inaccurate.

A description of the epinephrine auto injector is provided, but it is difficult to understand or only covers some of the relevant information Anna Maria should know.

A detailed, accurate, and clear description of the epinephrine auto injector is provided.

When Anna Maria is at home, what should she do to decrease the chance of coming into contact with the allergen?

No information is provided on how to reduce contact with allergens at home.

Incomplete information is provided on how to reduce contact with allergens at home.

Detailed information is provided on how to reduce contact with allergens at home.

What should Anna Maria do when she returns to school to prevent coming into contact with allergens?

No information is provided on how to reduce contact with allergens at school.

Incomplete information is provided on how to reduce contact with allergens at school.

Detailed information is provided on how to reduce contact with allergens at school.

If Anna Maria has a severe reaction to the allergen in the future, what are the steps in her treatment plan?

No plan is provided to respond to a future severe reaction.

An incomplete plan is provided to respond to a future severe reaction.

A complete plan is provided to respond to a future severe reaction.

Anna Maria may have to visit an allergist many more times in her life. What should she do to prepare for her future doctor’s appointments?

No information is provided about preparations to see allergists in the future.

Incomplete information is provided about preparations to see allergists in the future.

Complete information is provided about preparations to see allergists in the future.

What additional resources should Anna Maria read about her condition?

No identification of additional resources is provided.

Additional resources are provided, but their credibility is questionable.

Credible resources are provided.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

153

7 Activity Questions 1. Describe how Anna Maria’s reaction to the allergen changed over time. Anna Maria described her reactions as a minor inconvenience—sneezing and some rashes. Over time, Anna Maria’s reaction became severe—anaphylaxis. 2. Why would the allergist suggest a blood test over a skin test to determine which allergen caused the allergic reaction in Anna Maria? Anna Maria’s last allergic reaction was anaphylactic shock, which is very severe. A skin test would further expose her to allergens, which could be dangerous. A blood test, however, would prevent her from coming into contact with allergens. 3. What are the challenges Anna Maria and her parents face during the weeklong wait for the blood test results? What advice might her doctor give her during this time? There may be another significant allergic reaction while Anna Maria is in her home or at school. Her doctor should recommend eliminating any possible allergens from her environment during this time.

Apply and Analyze 1. Why do doctors advise people to get the flu shot? Flu shots help protect individuals against acquiring the flu (influenza). 2. Why do people with chicken egg allergies worry about getting the flu shot? Most flu shots are manufactured in chicken eggs. The chicken egg allergen may induce allergic reaction in individuals who are allergic to eggs. 3. What are the best ways to avoid the flu? Answer will vary but may include frequently washing hands, getting a flu shot, and avoiding close contact with people who are sick.

154

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

OVEREXPOSURE

| Treating Anaphylaxis Due to Allergies TEACHER NOTES

7

Resources and References Branum, A. M., and S. L. Lukacs. 2008. Food allergy among U.S. children: Trends in prevalence and hospitalizations. National Center for Health Statistics data brief. www. cdc.gov/nchs/data/databriefs/db10.pdf. Mayo Clinic. 2018. Food allergy. www.mayoclinic.org/diseases-conditions/food-allergy/diagnosistreatment/drc-20355101. Ring, J., M. Grosber, K. Brockow, and K. C. Bergmann. 2014. Anaphylaxis. Chemical Immunology and Allergy 100: 54–61. Schneider, A. 2014. Researchers uncover allergy-cancer connection. Massey Cancer Center. www.massey.vcu.edu/about/blog/2014/researchers-uncover-allergy-cancer-connection. Tinker, B. 2017. Allergic to eggs? You can now get the flu shot, new guidelines say. CNN, December 19. www.cnn.com/2017/12/19/health/flu-vaccine-egg-allergy-study/index.html.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

155

Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

CRASHING THE PARTY

8

Combating Chronic Alcohol Abuse

A Case Study Using the Discovery Engineering Process Introduction There are many uses for alcohol, including medical applications (e.g., disinfectant, hand sanitizers), as fuel for vehicles, and as a solvent to dissolve solutes in order to create solutions (e.g., perfumes, vanilla extract). However, alcohol may be most well known as a beverage. People in different cultures consume alcohol in social gatherings, such as celebrations. Alcoholic beverages are created through the fermentation process by enabling yeast (that is, unicellular fungi) to metabolize (or breakdown) sugar into carbon dioxide and alcohol. Most often, plant sugars (grapes, barley, potatoes, rice, and sugarcane) are used in the fermentation process to create drinkable alcohols like wine and beer. However, consuming alcohol can have severe effects that can differ from person to person, and some individuals become addicted to it. Drinking alcohol has almost immediate effects once it enters the bloodstream. These effects include slurred speech, loss of memory, reduced inhibition, and impaired movement. Alcohol intoxication can lead to risky activities, such as fighting. In addition to the immediate effects, abusing alcohol over a long period may result in chronic alcoholism (Figure 8.1, p.  158). Individuals who abuse alcohol may become dependent, suffering extreme health issues that could lead to cancer, heart disease, stroke, and liver damage. These health issues can be fatal. According to an estimate from the National Center for Health Statistics, approximately

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

157

8 FIGURE 8.1 Symptoms and Effects of Alcoholism

22,000  deaths from alcoholic liver disease and more than 35,000 other alcoholinduced deaths occurred in 2017 (Kochanek et al. 2019). Medical scientists and public health researchers are concerned about alcohol abuse, but many treatments (such as counseling and medications) are available to individuals who suffer with chronic alcoholism.

Lesson Objectives By the end of this case study, students will be able to • describe the effects of alcoholism and treatments for chronic alcoholism; • analyze data to detect trends of binge and underage drinking statistics; and • design a public service announcement (PSA) based on the knowledge of chronic alcoholism and treatments.

158

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

CRASHING THE PARTY

| Combating Chronic Alcohol Abuse

8

The Case Read about the discovery of Antabuse as a drug treatment for individuals who suffer from chronic alcoholism. Once you have finished reading, answer the questions that follow. Antabuse is the brand name of a drug known as disulfiram. The drug was used for different reasons before it became a treatment for chronic alcoholism. Historically, disulfiram was used to vulcanize rubber (that is, convert rubber into durable materials for human use by adding sulfur). It was also used to treat scabies—itchy, red rashes caused by mites. In the 1940s, scientists Erik Jacobsen and Jens Hald hypothesized that if disulfiram could treat scabies caused by mites, perhaps it could also treat humans infected by intestinal parasites, such as worms. Jacobsen and Hald wanted to document the side effects of disulfiram in the human body. They decided to take the drug themselves in order to test its effects. Upon consuming the drug, the pair noticed that drinking any amount of alcohol made them feel immediately ill. This gave them an idea: to use the drug to treat alcoholism. From the late 1940s to the early 1950s, the Food and Drug Administration (FDA) tested and approved disulfiram to be used as treatment for individuals suffering from chronic alcoholism. Once approved, the drug began selling under the name Antabuse. Antabuse works by preventing an enzyme called acetaldehyde dehydrogenase from breaking down alcohol in the liver. Normally, this enzyme reduces ethanol (drinkable alcohol) into acetaldehyde and again into acetic acid (vinegar), which is harmless. Without the enzyme and its ability to break down the ethanol molecules, a person will suffer from headaches, vomiting, weakness, blurred vision, increased heartbeat, and chest pain. By causing these symptoms, Antabuse helps people develop an automatic association between drinking alcohol and feeling violently ill. This can lead to an aversion, or very strong dislike, of alcohol. Researchers suggest that individuals using Antabuse to treat alcoholism should also participate in psychological therapy. Currently, Antabuse and its effects are being researched as potential drug treatments for cocaine dependency and certain types of cancer.

Recognize, Recall, and Reflect 1. What did the scientists find when studying the effects of Antabuse on intestinal worm parasites? 2. Why did the scientists personally ingest Antabuse? Why do you believe this self-testing practice is no longer done in medical research laboratories today? 3. Why do you think researchers advise people who take Antabuse to also participate in therapy?

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

159

8 Investigate and Explain Chronic alcoholism has devastating effects. Excessive alcohol use, either in the form of binge drinking (having 5 or more drinks on a single occasion for men or 4 or more drinks on a single occasion for women) or heavy drinking (having 15 or more drinks per week for men or 8 or more drinks per week for women) is dangerous. As noted in the case study above, alcohol abuse has contributed to thousands of deaths. Public health researchers are individuals who investigate and study various issues that may affect human life, such as alcohol use, disease and illness, and food and drink availability and consumption. Some public health researchers work for the Centers for Disease Control and Prevention (CDC) where they study issues like alcohol abuse, binge drinking, and accidents associated with alcohol consumption. After completing research, they share their findings with the public. Examine the CDC data in Figure 8.2 and Figure 8.3. Then, answer the questions that follow. 1. Define the term binge drinking. Define the term heavy drinking. Can you sum up the difference between the two? 2. Examine Figure 8.2.

a.

What does the word prevalence mean in this context?

FIGURE 8.2 Prevalence of Binge Drinking Among U.S. Adults, 2015

160

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

CRASHING THE PARTY

| Combating Chronic Alcohol Abuse

8

FIGURE 8.3 Intensity of Binge Drinking Among U.S. Adults, 2015



b.

Review the map key in Figure 8.2. What do the different shades (light, medium, dark) mean on the map? Which shade is considered the highest prevalence?



c.

Describe trends you notice or see on the map. Why do you believe these trends exist?

3. Examine Figure 8.3. a. What does the word intensity mean in this context? b. Review the map key in Figure 8.3. What do the different shades (light, medium, dark) mean on the map regarding binge drinking? Which shade is considered the highest intensity? c. Describe trends you notice or see on the map. Why do you believe these trends exist?

Activity Imagine you are a health worker who works with the public on health issues specific to certain communities. As part of your work, you focus on alcoholism among

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

161

8 young people in the United States and disseminate your findings to the public (e.g., schools, government, and communities). In this activity, you will come up with an idea for a public service announcement to share the effects and dangers of chronic alcoholism. Generally, PSAs are short and engaging videos sharing information with communities about a health issue. You will first research the statistics on chronic alcoholism and the effects of the disease on young people. Then, you will create a storyboard script that could be used to film your PSA.

Part I To begin, you must conduct some background research on chronic alcoholism. Fill out the chart below, using print or online resources to help you. Question

Response

What is chronic alcoholism?

What are the effects of chronic alcoholism on the human body? What are the effects of chronic alcoholism on the individual’s family and community? Other than health-related risks, what are concerns regarding chronic alcoholism? Who should avoid drinking alcohol? Why?

What important statistics or numbers should you share with your community about chronic alcoholism? What additional resources should you share with your community related to chronic alcoholism?

Adults are not alone in consuming alcohol. Underage drinking is a public health focus as well. Review this fact sheet on underage drinking from the CDC to understand the demographics of alcohol consumption in the United States: www.cdc.gov/ alcohol/fact-sheets/underage-drinking.htm. Then, answer the questions that follow.

ACTIVITY QUESTIONS, PART I 1. According to the CDC’s fact sheet, what is the most commonly abused drug among young people in the United States?

162

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

CRASHING THE PARTY

| Combating Chronic Alcohol Abuse

8

2. Which age group consumed 11% of all alcohol in the United States? 3. What are the concerns of underage drinking?

Part II Use the Storyboard Script template below to sketch out your PSA. Each block in the storyboard script should have engaging, thoughtful, and evidence-based words or pictures that could be used as an outline for your PSA video.

Storyboard Script Scene 1—Description

Scene 2—Description

Scene 3—Description

Scene 1—Drawing

Scene 2—Drawing

Scene 3—Drawing

Scene 4—Description

Scene 5—Description

Scene 6—Description

Scene 4—Drawing

Scene 5—Drawing

Scene 6—Drawing

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

163

8 Ask a partner to review your storyboard. Then, incorporate relevant feedback. Once you’re done, answer the questions that follow. If time allows, film the storyboard script to produce a video-based PSA.

ACTIVITY QUESTIONS, PART II 1. Who is the audience for your storyboard script? 2. Will the target audience want to watch the PSA? How do you know? 3. Does the storyboard script make sense? Why or why not? 4. What about the storyboard script makes it a strong PSA? 5. What would you change about the storyboard script to make it a better PSA for the target audience?

Apply and Analyze Antabuse (also known as disulfiram) is a drug treatment that can be used by individuals suffering from chronic alcoholism. It can also be used to fight cancer. Read this article from the Miami Herald newspaper on using Antabuse as a cancerfighting drug: www.miamiherald.com/news/nation-world/world/article188462784.html. After you’re done, answer the questions that follow. 1. What did the researchers find when one group of cancer patients who consumed Antabuse was compared to the other group of cancer patients who did not consume Antabuse? 2. What are the challenges in repurposing a drug, or using it in a different way?

Design Challenge The case study in this lesson illustrates how a scientific observation led to the solution to a problem. Observations and discoveries often spark ideas for innovations. This is especially true in the field of engineering. Engineering is the  application of scientific  understanding through creativity, imagination, and the designing and building of new materials to address and solve problems in the real world. You will be asked to take the science you have learned in this case and design a process or product to address a real-world issue. Engineers use the engineering design process (Figure 8.4) as steps to address a real-world problem. In this case, you are asking questions (Step 1) about how you can use your knowledge of chronic alcoholism and treatments to develop a new alcoholism treatment plan. Using outside research, you will brainstorm (Step 2) a specific treatment plan for chronic alcoholism. Then, you will create a plan (Step 3) for your idea. Next, you will consider how you would design (Step 4) your treatment,

164

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

CRASHING THE PARTY

creating a treatment proposal to describe your thoughts. Afterward, you will come up with a way to test (Step  5) your idea and consider how you might improve (Step 6) on it.

8

FIGURE 8.4 The Engineering Design Process

1 Ask Questions and Define the Problem

1. Ask Questions Ask questions about how you could use your knowledge of chronic alcoholism and treatments to develop a new treatment plan for chronic alcoholism. For instance, you read in the case study about the discovery of a treatment that makes people sick when they drink alcohol. Are there other treatments you can think of that could deter alcohol users in such a way? How might other treatments be used to discourage a person from drinking?

| Combating Chronic Alcohol Abuse

6

2

Revise and Improve

Brainstorm and Imagine

3 5

The Engineering Design Process

3

Test and Evaluate

Plan 4 Design and Create

2. Brainstorm and Imagine The National Institute on Alcohol Abuse and Alcoholism shared information on the variety of treatments that can be used for individuals with chronic alcoholism. Learn more here: https://pubs.niaaa.nih.gov/publications/treatment/treatment.htm. Using this information and what you previously learned, brainstorm your own new treatment for chronic alcoholism.

3. Create a Plan Create a plan for developing your new treatment. In the plan, summarize (1) how your new treatment idea relates back to your knowledge of chronic alcoholism, (2) who benefits from this treatment idea, and (3) the advantages and disadvantages to your new idea. Use the Create a Plan worksheet (p. 167) for guidance.

4. Design and Create Develop a medical treatment proposal to describe your new idea. In the proposal, explain how you would go about creating a new treatment for chronic alcoholism. Include the following in your proposal: • A detailed description of your new idea

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

165

8 How your proposed treatment is created How patients will be affected by the treatment Why using this treatment is a good idea • A description of how you would go about developing your idea (Who would you work with? Where would you develop the product?) • Information on how the patients’ health will be protected from negative side effects • An explanation of how you would market the product to users Add this information to your Chronic Alcoholism Treatment Proposal worksheet (p. 168).

5. Test and Evaluate Think about how you would test the safety and efficacy of your plan. Consider these questions: • Phase 1—What would you do for laboratory testing? • Phase 2—What would you do for animal-based testing? • Phase 3—What would you do for clinical trials? • Surveillance—What would you do to ensure ongoing evaluation of the treatment on the market? Add this information to your Evaluation Plan graphic organizer (p. 169), and then attach the organizer to your Chronic Alcoholism Treatment Proposal.

6. Revise and Improve Present your proposal to your peers. Listen to their feedback on your proposal and take some time to revise it and make improvements. What are some ways you can use their input to refine your proposal? You may choose to accept all or only some of the suggestions. Be sure to justify your reasons for accepting or not using the peer feedback.

166

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

CRASHING THE PARTY

| Combating Chronic Alcohol Abuse

8

Create a Plan 1

Describe how your new treatment idea relates back to your knowledge of chronic alcoholism.

2

Who is helped by your new treatment? Why?

3

What are the advantages of your new idea?

4

What are the disadvantages of your new idea?

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

167

8 Chronic Alcoholism Treatment Proposal

168

1

Describe your idea.

2

How would the idea be developed?

3

How would patients’ health be protected from negative side effects?

4

How would you market the product to users?

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

CRASHING THE PARTY

| Combating Chronic Alcohol Abuse

8

Evaluation Plan

Step #1:

_____________________________________________________________________ Step #2:

_____________________________________________________________________ Step #3:

_____________________________________________________________________ Step #4:

_____________________________________________________________________

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

169

8 TEACHER NOTES

CRASHING THE PARTY

COMBATING CHRONIC ALCOHOL ABUSE A Case Study Using the Discovery Engineering Process

Lesson Overview In this lesson, students explore the discovery of Antabuse as a drug treatment for individuals with chronic alcoholism. Antabuse is also being studied as a treatment for other diseases and illness, such as cancer. In this lesson students review Centers for Disease Control (CDC) data to analyze alcohol consumption in the United States as well as for underage consumers of alcohol. Students will create a storyboard script for a Public Service Announcement (PSA) to educate community youth on the dangers of alcoholism. Last, students design a novel treatment plan for individuals who suffer from chronic alcoholism (or other forms of addiction and substance abuse).

Lesson Objectives By the end of this case study, students will be able to • describe the effects of alcoholism and treatments for chronic alcoholism; • analyze data to detect trends of binge and underage drinking statistics; and • design a PSA based on the knowledge of chronic alcoholism and treatments.

Use of the Case Due to the nature of these case studies, teachers may elect to use any section of each case for their instructional needs. They are sequenced in order (scaffolded) so students think more deeply about the science involved in the case and develop an understanding of engineering in the context of science.

170

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

CRASHING THE PARTY

| Combating Chronic Alcohol Abuse TEACHER NOTES

8

Curriculum Connections Lesson Integration This lesson may be taught during a unit on fermentation and cellular respiration. It also fits well into a lesson on chemical reactions, enzymes, drug effects on body systems, and medical treatments and effects.

Related Next Generation Science Standards PERFORMANCE EXPECTATIONS • MS-LS1-2. Within cells, special structures are responsible for particular functions, and the cell membrane forms the boundary that controls what enters and leaves the cell. • MS-LS1-3. In multicellular organisms, the body is a system of multiple interacting subsystems. These subsystems are groups of cells that work together to form tissues and organs that are specialized for particular body functions. • MS-ETS1-1. Define the criteria and constraints of a design problem with sufficient precision to ensure a successful solution, taking into account relevant scientific principles and potential impacts on people and the natural environment that may limit possible solutions. • HS-LS1-3. Plan and conduct an investigation to provide evidence that feedback mechanisms maintain homeostasis. • HS-ETS1-3. Evaluate a solution to a complex real-world problem based on prioritized criteria and trade-offs that account for a range of constraints, including cost, safety, reliability, and aesthetics, as well as possible social, cultural, and environmental impacts.

SCIENCE AND ENGINEERING PRACTICES • Asking Questions and Defining Problems • Developing and Using Models • Planning and Carrying out Investigations • Analyzing and Interpreting Data • Constructing Explanations and Designing Solutions • Engaging in Argument From Evidence

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

171

8 CROSSCUTTING CONCEPTS • Patterns • Cause and Effect • Stability and Change

Related National Academy of Engineering Grand Challenges • Engineer Better Medicines • Advance Health Informatics • Engineer the Tools of Scientific Discovery

Lesson Preparation Before starting the lesson, it is helpful for the students to have some understanding of the importance chemical reactions and enzymes so they understand how alcohol is metabolized by the body, and additionally how Antabuse prevents that reaction. You will need to make copies of the entire student section for the class. Students will need internet access at various points in the lesson. Alternatively, you can project videos or print and distribute copies of online content for the class. Students will be creating storyboard scripts for PSAs. If possible, provide additional time for students who want to film their PSAs. Look at the Teaching Organizer (Table 8.1) for suggestions on how to organize the lesson.

Time Needed Up to 155 minutes; more if filming PSA

172

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

CRASHING THE PARTY

| Combating Chronic Alcohol Abuse TEACHER NOTES

8

TABLE 8.1 Teaching Organizer Section

Time Suggested

Materials Needed

Additional Considerations

The Case

10 minutes

Student pages

Activity done individually in class or as homework prior to class

Investigate and Explain

10 minutes

Student pages

Activity done individually or in pairs

Activity

60 minutes (without creating video PSA)

Student pages, internet access

Activity done individually or in pairs

Apply and Analyze

10–15 minutes

Student pages, internet access

Individual activity

Design Challenge

45–60 minutes

Student pages, internet access

Small-group activity

Vocabulary • acetaldehyde dehydrogenase

• fermentation

• acetaldehyde

• heavy drinking

• acetic acid

• inhibition

• addicted

• intoxication

• alcohol

• metabolize

• Antabuse

• scabies

• binge drinking

• solutes

• chronic alcoholism

• solutions

• dependent

• solvent

• enzyme

• vulcanize

• ethanol

• yeast

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

173

8 Extension This lesson can be extended with a discussion on the importance of community engagement in addressing public health issues, including addiction and substance abuse.

Assessment Use the Teacher Answer Key to check the answers to section questions. You can evaluate the students’ treatment proposals to assess the Design Challenge. Proposals should provide a coherent conceptualization of what the new treatment idea is, who it helps, and why it is needed (what problem does it help solve?). The proposal should also include an explanation of how the treatment is created and how the patients’ health will be protected from negative side effects. The proposals should describe how students would test and evaluate the efficacy of their ideas. More specifically, they should include a section on how they would collect data through laboratory, animal, and/or human trials. Students should be able to report or state any constraints or drawbacks they can foresee with implementing their design.

Teacher Answer Key Recognize, Recall, and Reflect 1. What did the scientists find when studying the effects of Antabuse on intestinal worm parasites? When the scientists consumed alcohol after taking Antabuse, they experienced extremely unpleasant side effects, such as nausea and vomiting. 2. Why did the scientists personally ingest Antabuse? Why do you believe this self-testing practice is no longer done in medical research laboratories today? The scientists wanted to test the side effects of Antabuse on the human body. Answers to the second part of the question may vary, but students might point out that today we understand that a researcher can’t be an objective observer if he or she is a test subject. It’s also unsafe for a person to ingest a new drug without first running trials with model organisms in a laboratory. 3. Why do you think researchers advise people who take Antabuse to also participate in therapy? Answers may vary. Students might point out that alcoholism can be connected to mental health issues. So engaging in therapy along with physical treatments to address the psychological aspects of the disease is ideal.

174

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

CRASHING THE PARTY

| Combating Chronic Alcohol Abuse TEACHER NOTES

8

Investigate and Explain 1. Define the term binge drinking. Define the term heavy drinking. Can you sum up the difference between the two? Binge drinking: drinking 5 or more drinks on an occasion for men or 4 or more drinks on an occasion for women; heavy drinking: drinking 15 or more drinks per week for men or 8 or more drinks per week for women. Binge drinking occurs over a short period of time in comparison to heavy drinking, which occurs over a longer length of time. 2. Examine Figure 8.2. a.

What does the word prevalence mean in this context? How often something (in this case alcoholism) occurs for a specific population

b. Review the map key in Figure 8.2. What do the different shades (dark, medium, light) mean on the map? Which shade is considered the highest prevalence? Different variations of alcoholism prevalence; the darkest shade c.

Describe trends you notice or see on the map. Why do you believe these trends exist? General trends indicate high prevalence (18.2–24.9) in the north and northeastern United States, Alaska, and Hawaii; medium prevalence (16.2–18.1) occurs along the West Coast, along parts of the East Coast, and in parts of the Midwest; the least prevalence (10.9–16.1) occurs the southern United States and in the Mountain States region. Answers to the second part of the question may vary but could include information about access to alcohol (e.g., laws regarding purchase or drinking age) or cultural/demographic relationships with alcohol use.

3. Examine Figure 8.3. a.

What does the word intensity mean in this context? The average largest number of drinks consumed by binge drinkers on any occasion in the past 30 days

b. Review the map key in Figure 8.3. What do the different shades (light, medium, dark) mean on the map regarding binge drinking? Which shade is considered the highest intensity? Different variations on intensity of number of drinks consumed by binge drinkers; darkest shade

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

175

8 c.

Describe trends you notice or see on the map. Why do you believe these trends exist? General trends indicate high numbers of drinks consumed by binge drinking (7.3–8.3) occuring in some southern states and the Midwest (Iowa, Missouri, Arkansas, Louisiana), as well as in the Mid-Atlantic (Ohio, Kentucky, West Virginia). There are other states with high consumption, including Alaska, Hawaii, Idaho, Utah, Maine, and South Carolina. Most other states are areas of medium consumption (7.0–7.2). Areas of low consumption (6.2–6.9) include the West Coast and states along the East Coast like North Carolina, Georgia, Florida, New York, Massachusetts, and Vermont. Colorado is an outlier in this category. Answers to the second part of the question may vary but could include information about access to alcohol or cultural/demographic relationships with alcohol use.

Activity Questions, Part I 1. According to the CDC’s fact sheet, what is the most commonly abused drug among young people in the United States? Alcohol 2. Which age group consumed 11% of all alcohol in the United States? 12- to 20-year-olds. 3. What are the concerns of underage drinking? Students’ answers may vary but could include mention of health problems, accident risks, and death.

Activity Questions, Part II 1. Who is the audience for your storyboard script? Young people 2. Will the target audience want to watch the PSA? How do you know? Students’ answers will vary. Students might say that their PSAs are fun, funny, relevant, engaging, relatable, etc. 3. Does the storyboard script make sense? Why or why not? Students’ answers will vary but could include that the narration or dialogue is clear and concise, the information included is easy to understand, the PSA storyboard follows a logical progression, etc.

176

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

CRASHING THE PARTY

| Combating Chronic Alcohol Abuse

8

4. What about the storyboard script makes it a strong PSA? Students’ answers will vary but could include that the PSA is engaging, logical, balanced, thought-provoking, etc. 5. What would you change about the storyboard script to make it a better PSA for the target audience? Students’ answers will vary.

Apply and Analyze 1. What did the researchers find when one group of cancer patients who consumed Antabuse was compared to the other group of cancer patients who did not consume Antabuse? The cancer death rate for the group that took Antabuse was 34% less than that of the group that didn’t take the drug. 2. What are the challenges in repurposing a drug, or using it in a different way? Time and money needed for additional clinical trials and research.

Resources and References Centers for Disease Control and Prevention (CDC). 2017. Alcohol use. www.cdc.gov/nchs/ fastats/alcohol.htm. Centers for Disease Control and Prevention (CDC). 2018. Excessive drinking. www.cdc.gov/ alcohol/data-stats.htm. Gilmour, J. 2017. “It’s Long Been Used to Fight Alcoholism. But This Drug Kills Cancer Too, Study Finds.” Miami Herald, December 6. www.miamiherald.com/news/nation-world/ world/article188462784.html. Kochanek, K. D., S. L. Murphy, J. Xu, and E. Arias. 2019. Deaths: Final data for 2017. National Vital Statistics Reports 68 (9). Hyattsville, MD: National Center for Health Statistics. www.cdc.gov/nchs/data/nvsr/nvsr68/nvsr68_09-508.pdf. Kragh, H. 2008. From disulfiram to Antabuse: The invention of a drug. Bulletin for the History of Chemistry 33 (2): 82–88. National Institute on Alcohol Abuse and Alcoholism. 2014. Treatment for alcohol problems: Finding and getting help. NIH. https://pubs.niaaa.nih.gov/publications/treatment/treatment. htm.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

177

Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

THE TRIUMPH OF THE PIKA Understanding Environmental Impacts on Species

9

A Case Study Using the Discovery Engineering Process Introduction Climate change threatens the survival of many species, especially those that overheat in higher temperatures. This is particularly true of the pika (Figure 9.1, p. 180), an animal related to rabbits. This small, herbivorous (plant-eating) mammal lives in the mountains of the American West. Pika are known for being habitat specialists, meaning they can only survive in a narrow range of environmental conditions. (This is opposite from species that are generalists, which can survive in a wide range of environmental conditions.) Pika can easily overheat and are sensitive to changes in the environment. So, when a wildfire destroyed an entire forest, scientists were surprised to find that the pika population had survived. In uncovering the mystery of the pika’s survival, the scientists learned valuable information about protecting wildlife in the face of climate change.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

179

9 FIGURE 9.1 The American Pika

Lesson Objectives By the end of this case study, you will be able to • explore how species are impacted by human-influenced changes in the environment; • examine and then model how change in the environment can alter species populations; and • create an environmental assessment (EA) to evaluate the ecological impact of (proposed) human activity on a specific species in a specific location.

The Case Read about research on the pika conducted by Dr. Johanna Varner and her colleagues. Their accidental observation of a wildfire while studying pika populations

180

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

THE TRIUMPH OF THE PIKA

| Understanding Environmental Impacts on Species

9

is helping to construct a better understanding of how wildfires affect species. This is extremely important, because scientists believe that wildfires will grow in both frequency and severity due to climate change. Once you are finished reading, answer the questions that follow. In August 2011, ecologist Johanna Varner was conducting a field study on a pika population living in an Oregon gorge. Pika typically live in the mountains, not in gorges where the elevation is near sea level. Dr. Varner wanted to understand this unique population. They served as her experimental group. To have a basis of comparison, she also observed a second pika site at Mount Hood. This was her control group. Like most other pika, the Mount Hood population made dens in mountainside rock fields. As part of her observation, Dr. Varner installed temperaturerecording devices in the pika’s dens. In September, a sudden wildfire broke out at the Mount Hood site, seemingly ruining the experiment. However, the wildfire led to a novel research opportunity. Natural disasters are on the rise, yet they remain hard to predict and, therefore, study. Science is based on careful and thoughtful design and observation, making investigating natural disasters as they are occurring very rare. But because Dr. Varner and her team already had an experiment set up at the wildfire site, they were in a unique position to study the disaster. And they realized that the wildfire could provide insight into the way such events affect wildlife. The researchers reconsidered their original plan and decided to focus their study on how the pika fared during the wildfire. It soon became clear that the pika were still abundant at Mount Hood despite the fire. Dr. Varner and her team collected more data on the animals. They looked at the number of dens and the number of pika in each den, both before and after the fire. They also looked at temperature (or thermal) data from the temperature recorders, which had remained intact during the blaze. This gave them an idea of how hot the dens were before, during, and after the fire. They found the temperature in the dens did not rise above 64.4°F (18.5°C), although the fire outside exceeded 932°F (500°C). Varner and her research team found that the rock face provided a way to buffer the temperature, insulating the pika from the extreme heat. Also, the rock face provided a natural barrier to prevent the fire from moving throughout the forest, acting as a fire break. Another factor that allowed for pika survival is that, although these animals are habitat specialists, they are dietary generalists, meaning they can eat a variety of plants to survive. After a fire, the first plants that grow are mosses, which the pika are able to eat. The results of Dr. Varner’s study highlight the importance of maintaining natural features (like rock faces for pika dens) to provide refuges for sensitive species during natural disasters like wildfires. Also, it is important to maintain local, indigenous wildlife, so that after such events animal and plant species may rebound.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

181

9 Recognize, Recall, and Reflect 1. In Dr. Varner’s experiment, which pika population was the experimental group? Why? Which pika population was the control? Why? 2. Pika are described as habitat specialists, yet dietary generalists. What does this mean? 3. What were two recommendations made by the researchers to help sensitive species after natural disasters?

Investigate and Explain Climate change poses a threat to many species. To better understand how wildlife populations like the pika may be affected by future warming trends, scientists make models that depict various outcomes. Figure 9.2 includes four maps. The first one, labeled Map A, shows current pika populations and the amount of suitable habitats available to them. The pika are shown as black spots; the suitable habitats are shown in light gray. Each consecutive map shows the amount of suitable pika habitats at different levels of warming: Map B shows low warming, Map C shows medium warming, and Map D shows high warming. For these maps, the suitable habitats are shown in dark gray. Current suitable habitat areas still appear on these maps in light gray for comparison. After examining the data, answer the questions that follow. 1. Look at Map A. In which two states do most of the observed pika (black spots) live? Why are there suitable pika habitat areas (light-gray areas) that don’t actually have any pika? 2. As temperatures increase from low (Map B), to medium (Map C), to high (Map D), what is the general trend of the American pika’s habitat (darkgray areas)? 3. Look at Map D. In this scenario, what state would have the largest habitat range for the pika? Why do you think that geographic location would be the last refuge for the pika in the highest temperatures?

Activity Imagine you work as a wildlife ecologist, researching how environmental changes can influence the entire population of a single species. You are studying one famous case that illustrates this phenomenon. In the second half of the 18th century, Europe was engaged in the Industrial Revolution, when factories began to dot the countryside. These factories churned out black dust (soot) that blanketed the nearby villages and forests, covering both trees and rocks. Prior to the Industrial Revolution, the peppered moth population in England was mostly composed of a light-colored variety; a smaller number of the moths

182

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

THE TRIUMPH OF THE PIKA

| Understanding Environmental Impacts on Species

9

FIGURE 9.2 Pika Habitats in Scenarios of Climate Change Map A (current)

Map B (low warming)

Map C (medium warming)

Map D (high warming)

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

183

9 were a darker-colored (melanic) variety (Figure 9.3). The FIGURE 9.3 lighter moth’s coloration worked as camouflage, allowing it to blend in with surroundings like trees and lichens in order Two Types of Peppered Moth to hide from predators such as birds. In the mid-1800s, several decades after the Industrial Revolution began, people noted that the light-colored moths had become fewer and fewer in number. Instead, people saw more of the darker variety resting on the trees and rocks. In the 1950s, Bernard Kettlewell conducted experiments to understand what had happened to these moths. He found that the change in the environment caused by the Industrial Revolution had influenced moth predation. During the Industrial Revolution, soot from factories darkened the forests. The darker surroundings caused the light-colored moths to stand out to predators. Because they were easier to hunt, light-colored moths often didn’t live long enough to reproduce. Meanwhile, the darker-colored moths were able to camouflage themselves better in the now-dark environment, which allowed them to live longer, mate, and pass on their genes for dark color to their offspring. This, in turn, shifted the peppered moth populations from the lighter phenotype, or appearance, to the darker phenotype. To understand how this occurs, you will explore data on phenotypes of peppered moth populations in 19th-century England. You will conduct a two-part ecological investigation in which you explore the change in the physical appearance of peppered moths, and then create a model to examine how environmental changes can influence populations of species.

Part I To begin your ecological study, you analyze data from 1860 (several decades after the start of the Industrial Revolution), which was collected during a random sampling of peppered moths from all over England. The summary of that data is in Table 9.1. After completing this part of the activity, answer the questions that follow. (Note: These are mock statistics that reflect the type of frequency differences you might have found in areas of England affected by pollution from the Industrial Revolution. These are not data points that were actually collected.)

184

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

| Understanding Environmental Impacts on Species

THE TRIUMPH OF THE PIKA

9

TABLE 9.1 Ecological Survey Data of Light and Dark Peppered Moths in 1860s England Sampling Location #

Location in England

Distance to Closest Factory

Number of Light-Colored Moths Observed

Number of Dark-Colored Moths Observed

Total Number of Moths Observed

1

Northwest England and Ireland

8 km to 10 km

698

228

926

2

Northeast England and Scotland

More than 20 km

923

22

945

3

Central England

Less than 1 km

18

928

946

4

Southwest England

More than 10 km

840

92

932

5

Southeast England

2 km to 5 km

280

641

921

ACTIVITY QUESTIONS, PART I 1. You will now create a pie chart map of your data. Follow the steps below. a. Calculate the percentage of each moth per sampling area in the chart below. (The first one has been done for you.) b. Use the calculations to create a pie chart for each sampling area. (The first one has been done for you.)

Sampling Location # 1

Percent LightColored Moths

Percent DarkColored Moths

698 / 926 5 0.754

228 / 926 5 0.246

0.75 3 100 5 75%

0.25 3 100 5 25%

Pie Chart

Geographic Location Northwest England and Ireland

2

3

4

5

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

185

9 c. Plot your data to the correct geographic area on this outline map of England. 2. In which regions are light-colored moths most prevalent? In which regions are dark-colored moths most prevalent? How does distance from a factory affect the prevalence of each moth variety?

Part II Next, you will model how a sudden change in the environment can indirectly influence wildlife populations. Once you’re done, answer the questions that follow.

MATERIALS 99 5 pieces of 8.5 3 11 in. construction paper, one of each color: green, black, yellow, white, and red 99 2 pieces of 8.5 3 11 in. patterned paper or fabric 99 1 bag of green, black, yellow, white, and red paper dots (at least 50 in all, 10 of each color) 99 1 pair of tweezers (to capture dots) In this modeling activity, you will be a predator that is hunting paper dots for food. The dots are your prey, the sheets of paper are different environments. Follow these steps: 1. First, place down a piece of green construction paper (Trial 1). 2. Then, dump the dots from the bag onto the paper and spread them out. 3. Close your eyes. When you open them, quickly pick up the dot that stands out the most. 4. Once you have picked up your dot, put it back into the bag. 5. Repeat Steps 2 through 4 until about half (25 or so) of the dots are left. 6. Count up the number of dots that you snagged by color, recording the data in the Paper Dot Hunting Chart. Then, add up the data in each row. 7. Put all 50 of the dots back into the bag. 8. Repeat Steps 1 to 7 but with the next “environment,” or sheet of paper (Trials 2 through 7).

186

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

THE TRIUMPH OF THE PIKA

| Understanding Environmental Impacts on Species

9

Paper Dot Hunting Chart Environment (Paper Color)

Prey A (Green Dots)

Prey B (Black Dots)

Prey C (Yellow Dots)

Prey D (White Dots)

Prey E (Red Dots)

Total Caught

Trial 1: Green Trial 2: Black Trial 3: Yellow Trial 4: White Trial 5: Red Trial 6: Pattern 1 Trial 7: Pattern 2

ACTIVITY QUESTIONS, PART II 1. In this modeling activity, what were the relationships between totals (frequencies) of prey (dot colors) to their environment (paper colors)? a. When was the prey the easiest to see? b. When was the prey most difficult to see? c. How does the environment affect the traits that are common in a population?

Apply and Analyze Read this short article from Carolina Biological about using a technique called markrelease-recapture (MRR) to determine populations of freshwater turtles: http://classroom.jc-schools.net/coleytech/climate/Carolina%20Tips.pdf. After reading, answer the questions that follow. 1. Imagine you were conducting an MRR study of the Mexican spider monkey, a critically endangered species. (According to the International Union for Conservation of Nature, a  critically endangered  species  is  defined  as having an extreme risk of  extinction  in the wild.) You are able to mark 75  monkeys (categorized as Marked, or M) and release them back into their habitat. When you return, you capture 75 monkeys and note that 45 are recaptures (categorized as Recaptures, or R) and 30 are not marked (­categorized as Unmarked, or U). Using this equation (X 5 [(U 1 R)/R]M),

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

187

9 what is the total number (X) of monkeys you estimate to be in the wild population? Show your work: X 5 ______________ 2. The Mexican spider monkey is one of five subspecies of the Geoffroy’s spider monkey species. The other subspecies are the Nicaraguan spider monkey, the hooded spider monkey, the ornate spider monkey, and the Yucatán spider monkey. It is important during MRR studies that the correct species or subspecies is captured, marked, recaptured, and counted. What are three ways you would ensure that you and your research team are marking and recapturing the correct monkeys? 1. ____________________________________________________________ 2. ____________________________________________________________ 3. ____________________________________________________________

Design Challenge The case study in this lesson illustrates how scientific observations can lead to potential solutions to problems. Observations and discoveries often spark innovations, especially in the field of engineering. Engineering is the appliFIGURE 9.4 cation of scientific  understanding through creativity, imagination, and The Engineering Design Process the designing and  building of new materials to address and solve problems in the real world. You will be 1 asked to take the science you have Ask Questions learned in this case and design a and Define the Problem process or product to address a real6 2 world issue. Revise Brainstorm Engineers use the engineering and Improve and Imagine design process (Figure 9.4) as steps to The address a real-world problem. EnviEngineering ronmental engineers provide informaDesign tion for environmental assessments Process 3 (EAs). Now, you will use the engi5 3 neering design process to create your Test Plan and Evaluate own EA. In this case, you are asking questions (Step 1) about species that 4 are threatened or endangered by cliDesign and mate change or other environmental Create changes. You will then learn about the components of an EA and brainstorm

188

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

THE TRIUMPH OF THE PIKA

| Understanding Environmental Impacts on Species

9

(Step 2) a topic for your own EA—a proposed activity in your community that may affect threatened or endangered local species. After gathering research, you will make a plan (Step 3) for your EA. Then, you will create (Step 4) your EA. Afterward, a peer will evaluate (Step 5) your EA and provide feedback. Finally, you will consider improvements (Step 6) to your EA based on the feedback.

1. Ask Questions The pika is just one animal species that is threatened by climate change and other environmental issues. What are some other plants and animals that are threatened or endangered? What actions and activities are harming them?

2. Brainstorm and Imagine An EA outlines the positive and negative environmental effects of a proposed action (usually, an action taken to benefit people). The EA is supposed to (1) demonstrate the need for a human action, (2) consider how that human action would impact the environment, and (3) develop ways to mitigate (or reduce) unintended impacts to endangered or threatened animal or plant species. Examples of proposed actions may include the following: • Industry: siting and constructing a new factory, farm, business, etc. • Energy: siting and constructing a new energy source (wind farm, nuclear power plant, etc.) • Transportation Infrastructure: siting and constructing a new road, bridge, railroad, airport, etc. • Development: siting and developing land for a subdivision, park, nature refuge, etc. Think about something your town, city, or county might need to do in order to grow or recover economically or environmentally. Which of the examples listed above are the most relevant in your local context? Conduct some research on your town, city, and county websites to find out what the needs are in your community. Discuss your thoughts and ideas with your classmates. Choose one action that your city, town, or county might take in order to meet a need. Look at the Environmental Assessment Components section. Think about what information you’ll need to create your EA. Keep this in mind (and refer back to the EA description) as you conduct research on your chosen action in Step 3.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

189

9 Environmental Assessment Components EAs contain the following five parts: introduction, purpose, need, alternatives, and environmental impacts. 1. Introduction. The introduction should include a brief, one-paragraph description of the project background. Include a summary of the need for human action. 2. Purpose. The purpose is a statement of the proposed human action and two to three of its objectives. The purpose should be general in nature, whereas objectives are more specific to the actual location of the project. For example, a purpose could be to “put a new park in town.” One objective could then be to “find what lots are available for that park.” 3. Need. Identifying and explaining the need is critical in an EA. The need is the specific problem the project is intended to address. The need should be specific and stated as a problem, not a solution. The need should be described in a manner that allows for multiple ways of addressing the problem. The need should not be defined by the proposed action. Example 1: The need is not “to build a dam” but rather “to control flooding and prevent future flood damages and losses.” Example 2: The need is not “to build a 300-foot communications tower” but rather “to improve public safety and interoperable communications among first responders during an emergency event.” 4. Alternatives. There should be some discussion of various alternatives to justify the EA. No Action Alternative: This is what will happen if no action is taken or this proposed idea does not happen. Action Alternatives: If this course of action is not taken, what are other courses of action? If the proposed project cannot happen, how else could the need be met? 5. Affected Environment and Potential Impacts on a Single Animal or Plant Species. In this section, describe the physical setting where the action will take place and give information on the existing environment for a species of concern. Then, discuss how that species may be affected by the proposed action and alternatives. (Continued)

190

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

THE TRIUMPH OF THE PIKA

| Understanding Environmental Impacts on Species

9

Potential effects to the environment (e.g., ecosystem, climate) Describe how that environmental change may have potential impacts to your chosen plant and/or animal species (e.g., impacts on threatened or endangered status, habitat, food resources)

Example of an EA Topic Texas is a very large state. With a land area of 268,597 square miles and almost 30 million people, transporting people from town to town is a serious need. Several times a week, more than 50,000 Texans travel back and forth between Houston and Dallas/Fort Worth. A high-speed rail system could help connect people from the southern part of the state (Houston) to northern parts of the state (Dallas/Fort Worth) in 90 minutes, helping to reduce road traffic and conserving gasoline and productive time lost to commuting. However, where to locate the rail is important, as the 240-mile route may impact ecosystems and wildlife. Therefore, an ecological study was conducted to determine how wildlife may be affected. One concern is for the whooping crane, an endangered bird that migrates along the proposed high-speed rail route. The rail system may take away needed habitat and resources for the crane, driving it toward extinction. Therefore, the rail will avoid locating near or along major bodies of water (salt marshes and wetlands) where whooping cranes live and travel. Alternatives are too costly (air travel) or take too long (automobile). Highspeed rail also produces less carbon dioxide (CO2) than airplanes and cars. It will also reduce cars on the road, which could reduce deaths by motor vehicles. If there is no action, Texans will lose jobs and economic gains.

3. Create a Plan Conduct research on your chosen action in order to gather the information you will need to write your EA. Then create a plan for your EA. In your plan, make sure to (1) identify the community you want to work with, (2) describe one need of that community (either in industry, energy, transportation, or development), (3) identify the action that could be taken to meet that need, and (4) summarize the effects of that action on the environment. Use the Create a Plan graphic organizer (p. 193) for guidance.

4. Design and Create Write your EA in these five parts: introduction, purpose, need, alternatives, and environmental impacts. Remember to reflect on the following questions:

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

191

9 • How does this action potentially affect the environment? • What is an endangered or threatened species that would be affected? • What are alternatives to this action? • What happens if no action is taken?

5. Test and Evaluate Share your EA with a peer for feedback. Ask for an evaluation of your work and consider ways your EA could be clearer. Have you made the best case for your EA?

6. Revise and Improve Revise and make improvements to your EA based on feedback from your classmate. What are some ways you can use the input to refine your plan? You may choose to accept all or only some of the feedback. Be sure to justify your reasoning for using or not taking suggestions.

192

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

THE TRIUMPH OF THE PIKA

| Understanding Environmental Impacts on Species

9

Create a Plan What is the community you chose?

________________________________________________________________________ ________________________________________________________________________ _______________________________________________________________________ Describe one need of this community. Then summarize an action that could be taken to address this need. Industry Need



Energy Need



Action to Meet Need

Transportation Need

Action to Meet Need

Development Need

Action to Meet Need

Action to Meet Need

Summarize the environmental effects of your chosen action.

________________________________________________________________________ ________________________________________________________________________ _______________________________________________________________________

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

193

9 TEACHER NOTES

THE TRIUMPH OF THE PIKA UNDERSTANDING ENVIRONMENTAL IMPACTS ON SPECIES

A Case Study Using the Discovery Engineering Process

Lesson Overview In this lesson, students explore the impact of environmental change on wildlife. The case study focuses on the pika, a mammal related to the rabbit. Although pika are very sensitive to heat, a group of them were able to survive a wildfire. A team of ecologists who happened to be using the animals as a control group in an experiment were able to figure out that they survived by using available natural resources as a buffer against the fire. Students will use data and maps to understand how environmental changes (including climate change) impact endangered and threatened species. They will also create a model to illustrate the effects of environmental change, using data on peppered moths from 19th-century England. Last, students will create environmental assessments (EAs) to evaluate an action taken in their community to meet a human need. In their EAs, they will evaluate the potential impacts of the action on local endangered or threatened species.

Lesson Objectives By the end of this case study, students will be able to • explore how species are impacted by human-influenced changes in the environment; • examine and then model how change in the environment can alter species populations; and • create an EA to evaluate the ecological impact of (proposed) human activity on a specific species in a specific location.

Use of the Case Due to the nature of these case studies, teachers may elect to use any section of each case for their instructional needs. They are sequenced in order (scaffolded) so

194

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

THE TRIUMPH OF THE PIKA

| Understanding Environmental Impacts on Species TEACHER NOTES

9

students think more deeply about the science involved in the case and develop an understanding of engineering in the context of science.

Curriculum Connections Lesson Integration This lesson may be taught during a unit on ecology and population dynamics for beginner biology courses. This lesson fits well into topics related to natural selection and human impacts on the environment.

Related Next Generation Science Standards PERFORMANCE EXPECTATIONS • MS-LS2-4. Construct an argument supported by empirical evidence that changes to physical or biological components of an ecosystem affect populations. • MS-LS2-5. Evaluate competing design solutions for maintaining biodiversity and ecosystem services. • MS-ESS3-3. Apply scientific principles to design a method for monitoring and minimizing a human impact on the environment. • MS-ETS1-1. Define the criteria and constraints of a design problem with sufficient precision to ensure a successful solution, taking into account relevant scientific principles and potential impacts on people and the natural environment that may limit possible solutions. • HS-ESS3-1. Construct an explanation based on evidence for how the availability of natural resources, occurrence of natural hazards, and changes in climate have influenced human activity

SCIENCE AND ENGINEERING PRACTICES • Asking Questions and Defining Problems • Developing and Using Models • Planning and Carrying out Investigations • Analyzing and Interpreting Data • Constructing Explanations and Designing Solutions • Engaging in Argument From Evidence

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

195

9 CROSSCUTTING CONCEPTS • Cause and Effect • Systems and System Models • Stability and Change

Related National Academy of Engineering Grand Challenges • Restore and Improve Urban Infrastructure • Develop Carbon Sequestration Methods • Engineer the Tools of Scientific Discovery

Lesson Preparation Before starting the lesson, it is helpful for students to have some understanding of human impacts on the environment, climate, and natural selection. Review the concepts of a controlled experiment and ecological succession before beginning the lesson so students can understand how scientists support what they know about climate change. Also review how to interpret data from maps and analyze layered data. You will need to make copies of the entire student section for the class. Students will need internet access at various points in the lesson. Alternatively, you can project videos or print and distribute copies of online content for the class. Look at the Teaching Organizer (Table 9.2) for suggestions on how to organize the lesson. For the Activity section, we suggest using green, black, yellow, white, and red construction paper. For the patterned pieces of paper or fabric, choose ones that have many of the same colors as the construction paper. Students can work in pairs. Each group will need five sheets of construction paper (one of each color), two patterned sheets of paper or fabric, and one bag of green, black, yellow, white, and red dots. Use a hole punch to create the dots. Groups will need 10 dots of each color. So for a class of 30 in which you would have 15 groups of two, punch out 150 dots per color. Place 10 dots of each color into a resealable bag for each group.

196

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

THE TRIUMPH OF THE PIKA

| Understanding Environmental Impacts on Species TEACHER NOTES

9

Materials Per group 99 5 pieces of 8.5 3 11 in. construction paper, one of each color: green, black, yellow, white, and red 99 2 pieces of 8.5 3 11 in. patterned paper or fabric 99 1 bag of green, black, yellow, white, and red paper dots (at least 50 in all, 10 of each color) 99 1 pair of tweezers (to capture dots)

Time Needed Up to 115 minutes

TABLE 9.2 Teaching Organizer Section

Time Suggested

Materials Needed

Additional Considerations

The Case

10 minutes

Student pages

Activity done individually in class or as homework prior to class

Investigate and Explain

10 minutes

Student pages

Activity done individually or in pairs

Activity

20 minutes

Student pages; 5 pieces of 8.5 3 11 in. construction paper (one of each color: green, black, yellow, white, and red); 2 pieces of 8.5 3 11 in. patterned paper or fabric; 1 bag of green, black, yellow, white, and red paper dots (at least 50 in all, 10 of each color); 1 pair of tweezers (to capture dots)

Activity done individually or in pairs

Apply and Analyze

10–15 minutes

Student pages, internet access

Individual activity

Design Challenge

45–60 minutes

Student pages, internet access

Small-group activity

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

197

9 Vocabulary • camouflage

• herbivorous

• climate change

• indigenous

• control group

• insulated

• dens

• introduced

• ecologist

• invasive

• endangered

• mammal

• environmental assessment

• mark-release-recapture

• experimental group

• melanic (melanin)

• extinct

• phenotype

• dietary generalists

• pika

• dietary specialists

• population

• habitat specialists

• species

• habitat generalists

• wildlife

Extensions • The Activity section can be expanded to further explore population dynamics. Tell students that when they “prey” on their dots, the dots that “survive” can go on to “reproduce.” After each round in a trial, students can add three more dots of the same colors that have survived to represent the offspring with the same traits as the surviving parent. You can elect to have students time their rounds with a stopwatch to keep up the pace of the activity. • The Apply and Analyze section can be extended by modeling population size estimation (www.learner.org/jnorth/tm/monarch/EstimateMRR.html). This activity requires minimal materials, and students will garner a better understanding of the MRR method. • The Design Challenge can be extended into an environmental impact assessment, or EIA (https://link.springer.com/referenceworkentry/10.1007% 2F1-4020-4494-1_117). The EIA expands upon an EA with more information into the mitigation strategies discussed in the EA.

198

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

THE TRIUMPH OF THE PIKA

| Understanding Environmental Impacts on Species TEACHER NOTES

9

Assessment Use the Teacher Answer Key to check the answers to section questions. You can evaluate the students’ EAs to assess the Design Challenge. Their EAs should be divided into five parts: introduction, purpose, need, alternatives, and environmental impacts. The students should include all the information requested in the Environmental Assessment Components template on page 190. In their EAs, students should identify an action that might be taken in their community to address a human need. They should include research on how that specific action may impact a threatened or endangered species within an environmental context. During the Design Challenge, students should also be able to provide constructive peer reviews on classmates’ EAs and incorporate the feedback of others into their own EAs.

Teacher Answer Key Recognize, Recall, and Reflect 1. In Dr. Varner’s experiment, which pika population was the experimental group? Why? Which pika population was the control? Why? Experimental Group: Pika living in the gorge. Pika normally only live in the mountains, so it is strange to find a pika population at sea level. Control Group: Pika living on Mount Hood. This is because Pika normally only live in the mountains, so it is a “normal” group for comparison. 2. Pika are described as habitat specialists, yet dietary generalists. What does this mean? Pika can only live in a narrow range of environmental conditions (i.e., only in mountain areas, cool temperatures). This makes them habitat specialists. However, they can eat a wide variety of plants, making them dietary generalists. 3. What were two recommendations made by the researchers to help sensitive species after natural disasters? First recommendation: Maintain natural features like rock faces to provide refuges for sensitive species during natural disasters like wildfires. Second recommendation: Maintain local, indigenous wildlife so that after a natural disaster, animal and plant species may rebound.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

199

9 Investigate and Explain 1. Look at Map A. In which two states do most of the observed pika (black spots) live? Why are there suitable pika habitat areas (light-gray areas) that don’t actually have any pika? Utah and Wyoming. The black spots represent locations where pika populations have been observed in the wild. Habitat areas are places that could support the pika, but that does not mean pika actually live there. 2. What is the general trend of the American pika’s habitat (dark-gray areas) as temperature increases from low (Map B), to medium (Map C), to high (Map D)? As temperature increases, the habitats available for the pika decrease. 3. As temperatures increase from low (Map B), to medium (Map C), to high (Map D), what is the general trend of the American pika’s habitat (darkgray areas)? California. Student answers may vary. They could hypothesize that California has more protected areas or rock faces that provide thermal buffers (mentioned in the case study) to protect the pika. California also has stricter government regulations that may help protect vulnerable species.

Activity Questions, Part I 1. Visualize the data so you can begin to draw conclusions. Create a pie chart using the outline of England. The first location has been done for you.

a.

Calculate the percentage of each moth per sampling area.

b. Use the calculations to create a pie chart for each sampling area. c.

Plot your data to the correct geographic area on the map of England provided. The key to the chart and map are shown on the following page.

200

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

THE TRIUMPH OF THE PIKA

| Understanding Environmental Impacts on Species TEACHER NOTES

Sampling Location #

Percent LightColored moths

Percent DarkColored Moths

1

698/926 5 0.754

228/926 5 0.246

0.75 3 100 5 75%

0.25 3 100 5 25%

923/945 5 0.977

22/945 5 0.023

0.98 3 100 5 98%

0.02 3 100 5 2%

18/946 5 0.019

928/946 5 0.981

0.02 3 100 5 2%

0.98 3 100 5 98%

840/932 5 0.901

92/932 5 0.098

0.90 3 100 5 90%

0.10 3 100 5 10%

280/921 5 0.304

641/921 5 0.695

0.30 3 100 5 30%

0.70 3 100 5 70%

2

3

4

5

Pie Chart

9

Geographic Location Northwest England and Ireland

Northeast England and Scotland

Central England

Southwest England

Southeast England

2. In which regions are light-colored moths most prevalent? In which regions are darkcolored moths most prevalent? How does distance from a factory affect the prevalence of each moth variety? Student answers may vary but should relate these concepts from the data: The melanic moth phenotype is most prevalent in Central and Southeastern England. The prevalence of melanic moths increases with proximity to a factory.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

201

9 Activity Questions, Part II 1. In this modeling activity, what were the relationships between totals (frequencies) of prey (dot colors) to their environment (paper colors)? Students’ answers may vary but should relate the following concepts from the data. a.

When was the prey the easiest to see? When the color of the prey contrasted with the environment, meaning the prey was not camouflaged.

b. When was the prey most difficult to see? When the color of the prey was the same as the environment, meaning the prey was camouflaged. c.

How does the environment affect the traits that are common in a population? Individuals in the population that are most noticeable to predators (not camouflaged to the environment) are eaten. Those that are eaten do not reproduce and pass on their traits (demonstrated as phenotypes) to the next generation. Therefore, the population’s traits will shift to those that can survive predation (and reproduce) by being best to the environment adapted (camouflaged, and therefore able to avoid predators).

Apply and Analyze 1. Imagine you were conducting an MRR study of the Mexican spider monkey, a critically endangered species. (According to the International Union for Conservation of Nature, a critically endangered  species  is defined as having an extreme risk of extinction in the wild. You are able to mark 75 monkeys (categorized as Marked, or M) and release them back into their habitat. When you return, you capture 75 monkeys and note that 45 are recaptures (categorized as Recaptures, or R) and 30 are not marked (categorized as Unmarked, or U). Using this equation (X 5 [(U 1 R)/R]M), what is the total number (X) of monkeys you estimate to be in the wild population? Show your work: X 5 125 5 [(30 1 45)/45]75) 2. The Mexican spider monkey is one of five subspecies of the Geoffroy’s spider monkey species. The other subspecies are the Nicaraguan spider monkey, the hooded spider monkey, the ornate spider monkey, and the Yucatán spider monkey. It is important that during MRR studies that the correct species or subspecies is being captured, marked, recaptured, and counted.

202

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

THE TRIUMPH OF THE PIKA

| Understanding Environmental Impacts on Species TEACHER NOTES

9

What are three ways you would ensure that you and your research team are marking and recapturing the correct monkeys? Students’ answers may vary but should be aligned to methods delineated in the article to reduce human sampling error in ecological fieldwork. Here are some examples: Making a close examination of field marks to ensure the animal is the correct subspecies Ensuring that the MMR occurs in the exact habitat of the subspecies Using appropriate trapping techniques Differentiating between adults and juveniles Accounting for male and female sex differences

Resources and References Journey North. Counting all butterflies: Estimating population size. University of MadisonWisconsin. https://journeynorth.org/tm/monarch/EstimateMRR.html. Federal Emergency Management Agency (FEMA). 2011. Guidelines for preparing an environmental assessment for FEMA. www.fema.gov/media-library-data/ 20130726-1758-25045-3460/guidelines_for_preparing_an_environmental_assessment_for_fema. pdf. Gibbons, J. W. 1988. Turtle population studies. Carolina Tips 51 (12): 45–47. Hollick, M. 1999. “Environmental Impact Assessment (EIA), Statement (EIS).” In Encyclopedia of Earth Science. Springer, Dordrecht. Online ed. https://link.springer.com/refer enceworkentry/10.1007%2F1-4020-4494-1_117. Office of NEPA Policy and Compliance. DOE environmental assessments. U.S. Department of Energy. www.energy.gov/nepa/listings/environmental-assessments-ea. U.S. Department of the Interior (DOI). 2010. Effects of climate change on the distribution of pika (Ochotona princeps) in the western United States. https://gapanalysis.usgs.gov/blog/ effects-of-climate-change-on-the-distribution-of-pika-ochotona-princeps-in-the-western-unitedstates. Varner, J., M. S. Lambert, J. J. Horns, S. Laverty, L. Dizney, E. A. Beever, and M. D. Dearing. 2015. Too hot to trot? Evaluating the effects of wildfire on patterns of occupancy and abundance for a climate-sensitive habitat specialist. International Journal of Wildland Fire 24 (7): 921–932. http://dearing.biology.utah.edu/Lab/pdf/2015_varner_too_hot_trot.pdf. Wildlife Medical Clinic. Adaptations: Specialist and generalist. College of Veterinary Medicine, University of Illinois at Urbana-Champagne. http://vetmed.illinois.edu/ wildlifeencounters/grade9_12/lesson2/adapt_info/specialist.html.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

203

Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

SEEING THE EARTH GLOW FROM SPACE

10

Plants That Glow

A Case Study Using the Discovery Engineering Process Introduction Monitoring the health of the Earth is a difficult task because it is hard to view and study large-scale changes. However, this process has been made easier due to an accidental discovery by scientists about fluorescence. In this case study, you will learn about fluorescence and view this process by extracting chlorophyll from spinach. You will also learn how different organisms use biofluorescence and bioluminescence, and how these processes differ. Finally, you get to take on the role of an engineer and design a new fluorescence-based monitoring system to monitor the health of plants or animals.

Lesson Objectives By the end of this case study, you will be able to • define fluorescence; • differentiate biofluorescence from bioluminescence; • extract chlorophyll from spinach and observe the process of fluorescence; and • design a test that uses fluorescence to monitor photosynthesis or other processes.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

205

10 The Case Read the passage below on the discovery of plant-fluorescence sensing from space. Once you have finished reading, answer the questions that follow. Sometimes scientists learn new things and make new discoveries through chance. This happened in 2009 when a special satellite known as the Japanese Greenhouse Gases Observing Satellite (GOSAT) was launched into space with the goal of measuring carbon dioxide (CO2) levels in the Earth’s atmosphere. The data collected by the satellite revealed the presence of fluorescence from plant chlorophyll. Chlorophyll is found in structures within the leaf called chloroplasts. When the sunlight, which contains radiation, hits chlorophyll, some of the solar or light energy is reemitted from the plant as fluorescence (light). Therefore, fluorescence results when a substance absorbs radiation and then gives off light. You may have a fluorescent light bulb in your home or school. The discovery of fluorescence in the atmosphere allows scientists to monitor solar-induced chlorophyll fluorescence globally. The amount of fluorescence in the atmosphere indicates how much photosynthesis is taking place in plants on Earth. By measuring and monitoring photosynthesis in large scales over great distances, scientists can monitor the how carbon is absorbed from the atmosphere. Recent studies of plants in the Amazon using fluorescence data show how photosynthesis varies between the wet and dry seasons. And researchers may look more closely at the impact of climate change by examining the uptake of carbon dioxide by plants. This has other applications in making better measurements of agricultural, or food, production. Recall that fluorescence occurs when radiation is absorbed by a substance and light is emitted. There are many different examples in nature where fluorescence can be found. There are gemstones and minerals that have distinctive fluorescence when they are placed under ultraviolet light. These minerals have an amazing range of colors, from bright pinks to brilliant blues. Other materials that fluoresce include Vitamin B2, which fluoresces yellow, and tonic water with quinine, which fluoresces blue. Some paper money, stamps, and credit cards are fluorescent as a way of marking them for security purposes. There are several examples of animals that can biofluoresce. Biofluorescence happens when light is absorbed by special proteins in an animal and re-emitted as a different color. Some coral show biofluorescence because of their symbiotic (or interlinked) relationship with algae that live in the coral. These coral rely on the algae for energy. In turn, the coral have evolved to fluoresce when hit by light that has filtered down through the water. This creates more light for the algae, which need it for photosynthesis. Researchers have also found that some squid have a fluorescent spot above their eyes that they use to signal other squid as they travel

206

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

SEEING THE EARTH GLOW FROM SPACE

| Plants That Glow

10

in schools. Sharks, scorpionfish, and lizardfish can see biofluorescence given off by other fish. It is important to note some animals use bioluminescence, but that process is different from fluorescence. Bioluminescence results from the production of light through chemical reactions, such as the reaction that produces light in fireflies (Figure 10.1).

Recognize, Recall, and Reflect 1. What is fluorescence? 2. What are two applications of solar-induced chlorophyll fluorescence? 3. What is the difference between biofluorescence and bioluminescence?

Investigate and Explain Absorbance is measured by how much a wavelength of light gets absorbed by a tissue sample. If the light is not absorbed, it is instead reflected as fluorescence. For efficient photosynthesis in plant leaves (Figure 10.2, p. 208), the chlorophyll must capture light energy and take in sufficient levels of carbon dioxide (CO2). These two factors can be used to measure the efficiency of chlorophyll in a leaf.

FIGURE 10.1 Bioluminescence in a Firefly

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

207

10 FIGURE 10.2 Photosynthesis in a Leaf

An experiment was performed using a leaf tissue sample. The leaf’s chlorophyll was dissolved in 80% acetone and irradiated with light. Fluorescence profiles were made in a chlorophyll solution and graphed in Figure 10.3. Using Figure 10.3, notice the trends between fluorescence (light reflected) and depth (inside the leaf) as well as absorbance (light absorbed). After examining the data, answer the questions that follow. 1. What is the relationship between chlorophyll fluorescence and depth (inside the leaf)? 2. What is the relationship between chlorophyll fluorescence and absorbance? 3. Based on the data, where are the majority of chlorophyll cells located: in the top, middle, or bottom of the leaf? How do you know?

208

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

SEEING THE EARTH GLOW FROM SPACE

| Plants That Glow

10

FIGURE 10.3 Fluorescence Profiles by Absorbance and Depth

Source: Vogelmann and Evans (2002).

Activity Imagine you are a plant chemist investigating fluorescence in spinach leaves. By using isopropyl alcohol, you will be able to separate the chloroplasts from the leaves. A second step will further separate the leaf components from the chlorophyll. By using an ultraviolet (UV) light, you will observe how light waves are being absorbed and some light is being emitted, or fluoresced. After completing the activity, answer the questions that follow.

Materials 99 Handful of boiled spinach leaves 99 Isopropyl alcohol (91%) 99 2 plastic or glass containers (test tubes will work) 99 Funnel 99 Filter paper 99 Graduated cylinder 99 UV light Safety Note: Wear indirectly vented chemical splash safety goggles, a nonlatex apron, and nitrile gloves during the setup, hands-on, and takedown segments of the activity. Do not ingest isopropyl alcohol or spinach. Immediately clean up

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

209

10 any liquid spilled on the floor so it does not become a slip/fall hazard. Dispose of materials according to your teacher’s instructions. Wash your hands with soap and water immediately after completing this activity. Day 1— Chlorophyll Extraction: • Obtain a handful of boiled spinach leaves from your teacher. Tear the leaves into small pieces and place them into one of the containers. • Add 15 ml of isopropyl alcohol to the container with the leaves. • Label the container with your name(s). Leave this overnight. Day 2— Chlorophyll Purification: • Prepare the funnel by adding the filter paper to it. Then, set the funnel over the clean container. • Pour the spinach solution over the filter paper in the funnel. • Examine the color of the spinach solution that has been filtered. • Examine the solution under UV light. What color is visible?

Activity Questions 1. What do you think was the purpose of using boiled versus fresh spinach? 2. Why does the spinach solution look (fluoresce) red? 3. What colors of light are being absorbed?

Apply and Analyze Animals that can see UV light have advantages in attracting a mate and finding food or prey. Read this article from PBS on how power lines (emitting UV) affect various animals: www.pbs.org/wgbh/nova/next/nature/power-lines-look-like-terrifyingbursts-of-light-to-animals. After reading, answer the questions that follow. 1. How many mammalian species can see in the UV spectrum? Why, unlike humans, are they able to see this light? 2. UV light from power lines is distracting to animals. But why is it particularly harmful to reindeer in the Arctic?

Design Challenge The case study in this lesson illustrates how a scientific observation led to potential solutions to a problem. Observations and discoveries often spark ideas for innovations. This is especially true in the field of engineering. Engineering is the application

210

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

SEEING THE EARTH GLOW FROM SPACE

| Plants That Glow

10

of scientific  understanding FIGURE 10.4 through creativity, imagination, and the designing and  build- The Engineering Design Process ing of materials to address and solve problems in the real world. You will be asked to take 1 the science you have learned in Ask Questions this case and design a process and Define the Problem or product to address a real6 2 world issue. Revise Brainstorm Engineers use the engineerand Improve and Imagine ing design process (Figure 10.4) The as steps to address a real-world Engineering problem. In this case, you are Design asking the question (Step 1) of Process 3 how fluorescence can be used 5 3 to monitor or measure some Test Plan and Evaluate process in science. Using outside research, you will brain4 storm (Step 2) a specific new Design and way for fluorescence to be used. Create Then, you will create a plan (Step 3) for collecting fluorescence data. Next, you will create (Step 4) a proposal outlining your new fluorescence idea. Finally, you will come up with a way to test (Step 5) your fluorescence monitoring idea and consider how to improve (Step 6) on it.

1. Ask Questions Ask questions about fluorescence. For example, scientists know that plants give off fluorescence when they are undergoing photosynthesis. When is it important to know whether or not photosynthesis is occurring? What are other things that are easier to measure if they are glowing? How could fluorescence-based monitoring help scientists carry out important studies?

2. Brainstorm and Imagine Many organisms use biofluorescence and bioluminescence. Moreover, organisms use biofluorescence and bioluminescence for many different reasons. Conduct some research to learn more about biofluorescence. You can read more on biofluorescence here: www.pbslearningmedia.org/resource/nvcol-sci-biofluore/wgbh-novacreatures-of-light-how-biofluorescence-works/#.WtwbhojwZdg.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

211

10 Based on your investigation and research, think of a new application that uses fluorescence to measure something useful to scientists or society. For example, honeybee population decline is a serious issue. Perhaps one way to help is by using fluorescence-based monitoring to measure the amount of flowering plants that are available to these insects in a specific area. That could inform you as to whether bees in this habitat have a stable food source.

3. Create a Plan Create a plan for using your fluorescence-based monitoring idea to investigate or monitor the important issue you chose. In your plan, provide details about how you would use fluorescence to obtain more information about the issue. For example, say you chose to address the issue of declining bee populations. You could plan to measure the amount of flowering plants available to bees in a certain area over one summer. You might target certain species of bee-friendly flowers, measure their fluorescence each day for three months, and then correlate your findings with data on the number of honeybees in the area. Explain what materials or information you would need in order to put your idea into motion and the outcomes you hope to achieve.

4. Design and Create Create a proposal to patent and market your new fluorescence test kit. Include relevant details from the plan you created in Step 3. Think about the following questions as you write your proposal and use the New Product/Process for Plant Fluorescence worksheet (p. 214) for guidance. 1. What problem do you plan to monitor? 2. How will you use fluorescence as a tool for this project? 3. How is this use of fluorescence new and different? 4. What are benefits and drawbacks to your idea? 5. How will the information gathered by your monitoring tool be used? 6. How would you go about marketing your idea to scientists or the public?

5. Test and Evaluate How might you test your fluorescence-based monitoring tool to make sure it’s working properly? Think of a way that you could run a test, whether through trials, lab experiments, or some other method. What are possible sources of error that might influence the fluorescence data you collect or your interpretations the data? How could you avoid these errors?

212

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

SEEING THE EARTH GLOW FROM SPACE

| Plants That Glow

10

6. Revise and Improve Present or give your plan to one or more of your peers to review. Listen to your peers’ feedback on your design and take some time to revise and make improvements. What are some ways you can use their input to refine your design? You may choose to accept all or only some of the feedback. Be sure to justify your reasons for accepting or not using the peer feedback.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

213

10 New Product/Process for Plant Fluorescence

214

1

What problem do you plan to monitor?

2

How will you use fluorescence as a tool for this project?

3

How is this use of fluorescence new and different?

4

What are benefits and drawbacks of your idea?

5

How will the information gathered by your monitoring tool be used?

6

How would you go about marketing your idea to scientists or the public?

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

SEEING THE EARTH GLOW FROM SPACE

| Plants That Glow

10

TEACHER NOTES

SEEING THE EARTH GLOW FROM SPACE PLANTS THAT GLOW

A Case Study Using the Discovery Engineering Process

Lesson Overview In this lesson, students explore the process of fluorescence and learn how this light can be used to monitor the health of large numbers of plants. Students learn how different organisms use fluorescence and bioluminescence. They also learn how these processes differ. Students complete a laboratory investigating fluorescence in spinach leaves. Last, students take on the role of an engineer and design a new monitoring system that is based on fluorescence to monitor the health of plants or animals.

Lesson Objectives By the end of this case study, students will be able to • define fluorescence; • differentiate biofluorescence from bioluminescence; • extract chlorophyll from spinach and observe the process of fluorescence; and • design a test that uses fluorescence to monitor photosynthesis or other processes.

Use of the Case Due to the nature of these case studies, teachers may elect to use any section of each case for their instructional needs. They are sequenced in order (scaffolded) so students think more deeply about the science involved in the case and develop an understanding of engineering in the context of science.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

215

10 Curriculum Connections Lesson Integration This lesson may be taught during a unit on photosynthesis and botany for beginner biology courses. This lesson also fits well into a lesson on fluorescence, biofluorescence, and bioluminescence.

Related Next Generation Science Standards PERFORMANCE EXPECTATIONS • MS-ETS1-1. Define the criteria and constraints of a design problem with sufficient precision to ensure a successful solution, taking into account relevant scientific principles and potential impacts on people and the natural environment that may limit possible solutions. • HS-LS1-5. Use a model to illustrate how photosynthesis transforms light energy into stored chemical energy. • HS-ETS1-2. Design a solution to a complex real-world problem by breaking it down into smaller, more manageable problems that can be solved through engineering.

SCIENCE AND ENGINEERING PRACTICES • Asking Questions and Defining Problems • Developing and Using Models • Planning and Carrying out Investigations • Analyzing and Interpreting Data • Constructing Explanations and Designing Solutions • Engaging in Argument From Evidence

CROSSCUTTING CONCEPTS • Scale, Proportion, and Quantity • Systems and System Models • Energy and Matter: Flows, Cycles, and Conservation

Related National Academy of Engineering Grand Challenges • Advance Health Informatics • Engineer the Tools of Scientific Discovery

216

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

SEEING THE EARTH GLOW FROM SPACE

| Plants That Glow

TEACHER NOTES

10

Lesson Preparation Before starting the lesson, it is helpful for students to have some understanding of the general purpose of photosynthesis and chlorophyll (plant cells). You may also wish to review bioluminescence and fluorescence so students can understand the relevance of the chlorophyll extraction activity. For the lab in the Activity section, obtain the materials listed below. Make sure to boil the spinach before giving it to students to denature enzymes and break chloroplasts in order to promote chlorophyll degradation for easier chlorophyll extraction. You will need to boil the spinach leaves for one to two minutes only. Note that you will need two days to complete this activity because the spinach and alcohol mixture must sit overnight. You will need to make copies of the entire student section for the class. Students will need internet access at various points in the lesson. Alternatively, you can project videos or print and distribute copies of online content for the class. Look at the Teaching Organizer (Table 10.1, p. 218) for suggestions on how to organize the lesson. Safety Note for Students: Wear indirectly vented chemical splash safety goggles, a nonlatex apron, and nitrile gloves during the setup, hands-on, and takedown segments of the activity. Do not ingest isopropyl alcohol or spinach. Immediately clean up any liquid spilled on the floor so it does not become a slip/fall hazard. Dispose of materials according to your teacher’s instructions. Wash your hands with soap and water immediately after completing this activity. Please see the National Science Teaching Association’s guidance on Lab Safety in the Classroom: www.nsta. org/safety/?amp;print=true.

Materials 99 1 lb of boiled spinach leaves (a handful is needed for each individual or pair) 99 Isopropyl alcohol (91%) 99 2 plastic or glass containers (test tubes will work) 99 Funnel 99 Filter paper 99 Graduated cylinder 99 UV light

Time Needed Up to 125 minutes (Note that lesson must be done over two class periods.)

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

217

10 TABLE 10.1 Teaching Organizer Section

Time Suggested

Materials Needed

Additional Considerations

The Case

10 minutes

Student pages

Activity done individually in class or as homework prior to class

Investigate and Explain

10 minutes

Student pages

Activity done individually or in pairs

Activity

30 minutes

Student pages, boiled spinach leaves, isopropyl alcohol (91%), 2 plastic or glass containers (test tubes will work), funnel, filter paper, graduated cylinder, UV light

Activity done individually or in pairs

Apply and Analyze

10–15 minutes

Student pages, internet access

Individual activity

Design Challenge

45–60 minutes

Student pages, internet access

Small-group activity

Vocabulary • agricultural

• climate change

• biofluorescence

• fluorescence

• bioluminescence

• photosynthesis

• carbon dioxide

• solar-induced chlorophyll fluorescence

• chlorophyll • chloroplast

Extensions Extend this lesson with a discussion of the electromagnetic spectrum. Students may want to explore in more depth how animals use fluorescence and bioluminescence for survival.

218

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

SEEING THE EARTH GLOW FROM SPACE

| Plants That Glow

TEACHER NOTES

10

Assessment Use the Teacher Answer Key to check the answers to section questions. To assess the Design Challenge, you can evaluate the students’ patent and marketing proposals for their fluorescence-based measurement tool. In the proposals, students should describe the design of their monitoring system and explain the phenomenon the tool is measuring. Students may consider using their system as a way to examine and monitor such things as the productivity of agricultural fields, algae blooms in a pond or river, the loss of trees in a large rainforest, etc. Students should also be able to explain how their uses of fluorescence are new and different, what the benefits and drawbacks are to their ideas, how the information gathered by their monitoring tools will be used, and how they would go about marketing their ideas to scientists or the public.

Teacher Answer Key Recognize, Recall, and Reflect 1. What is fluorescence? Fluorescence results when a substance absorbs radiation and then gives off light. 2. What are two applications of solar-induced chlorophyll fluorescence? Measuring the impact of climate change and monitoring agricultural food production 3. What is the difference between biofluorescence and bioluminescence? Biofluorescence happens when light is absorbed and re-emitted. Bioluminescence results from the production of light through chemical reactions.

Investigate and Explain 1. What is the relationship between chlorophyll fluorescence and depth (inside the leaf)? The amount of chlorophyll fluorescence decreases exponentially with depth. 2. What is the relationship between chlorophyll fluorescence and absorbance? The amount of chlorophyll fluorescence increases linearly with absorbance. 3. Based on the data, where are the majority of chlorophyll cells located: in the top, middle, or bottom of the leaf? How do you know? The top, because chlorophyll fluorescence decreases exponentially with depth. Also, chlorophyll traps light energy, so it would need to be near the surface (or top) of the leaf.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

219

10 Activity Questions 1. What do you think was the purpose of using boiled versus fresh spinach? To break down the leaf in order to release the chlorophyll from the chloroplasts. 2. Why does the spinach solution look (fluoresce) red? The red light is fluorescent radiation emitted from the spinach. 3. What colors of light are being absorbed? The other wavelengths of light are being absorbed (other than red).

Apply and Analyze 1. How many mammalian species can see in the UV spectrum? Why, unlike humans, are they able to see this light? Approximately 38 different mammalian species can see UV light. Unlike humans, these mammals have lenses in their eyes that allow UV light through so it is visible. 2. UV light from power lines is distracting to animals. But why is it particularly harmful to reindeer in the Arctic? In the dark winters of the Arctic, UV light from power lines reflecting off the snow can be blinding to reindeer.

Resources and References Gundermann, K. D., and the Editors of Encyclopaedia Britannica. 2011. “Luminescence.” In Encyclopaedia Britannica. Encyclopaedia Britannica, Inc.; online ed. www.britannica.com/ science/luminescence/Luminescence-physics. Ocean Portal Team. 2017. Bioluminescence. Smithsonian Institution. http://ocean.si.edu/ bioluminescence. PBS Learning Media. 2016. Creatures of light, how biofluorescence works. PBS. www.pbslearningmedia.org/resource/nvcol-sci-biofluore/wgbh-nova-creatures-of-light-howbiofluorescence-works/#.WtwbhojwZdg. PBS Learning Media. 2018. Leaf anatomy, plants and animals. PBS. https://kttz.pbslearning media.org/resource/480848277-plants-animals/leaf-anatomy-plants-and-animals/#.Wtwc KIjwZdg. Vogelmann, T. C., and J. R. Evans. 2002. Profiles of light absorption and chlorophyll within spinach leaves from chlorophyll fluorescence. Plant, Cell & Environment 25 (10): 1313–1323.

220

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

POWER PLANTS

11

Algal Biofuels

A Case Study Using the Discovery Engineering Process Introduction With growing public interest in renewable green energy, scientists have been looking for alternatives to fossil fuels. Algae (Figure 11.1, p. 222), once studied for its potential as a food source, is now being examined for its use as a fuel, or biofuel. Algae is a plantlike protist. Protists are microscopic (cannot be seen with the naked eye) and unicellular (made up of a one cell). Although they don’t have tissues (many cells) like plants, they do have chlorophyll. That means they are able to make their own food (energy) through the process of photosynthesis. Scientists are currently studying different species of algae as well as different methods for developing them into biofuel.

Lesson Objectives By the end of this case study, you will be able to • explain why algae is being studied as an alternative to fossil fuels; • determine, using data, which species of algae are more efficient as fuel than others; • examine algae under a microscope; and • develop a plan for a new biofuel farm.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

221

11 The Case This account details the discovery of algae as a fuel for airplanes. Once you have finished reading, answer the questions that follow.

FIGURE 11.1 Green Algae

Algae has been used throughout human history as a source of medicine and fertilizer to help crops grow. People have long explored algae as a food source in times of scarcity. After the devastation of World War  II, people around the world were starving. Scientists looked to algae for a solution. Algae was considered a practical food source as it is highly nutritious and does not need clean water or farmland to grow. Unfortunately, scientists realized there was a problem: Humans cannot digest much of the algae they eat, meaning they cannot convert it into fuel for their bodies. When growing algae as a major food source did not work out, some scientists realized that algae might be able to be used as fuel instead. Scientists found that some species of microalgae (microscopic algae) produce up to 50% of their biomass as lipids (fats and oil), which are one of the four major organic compounds (made of carbon). Just as your body burns lipids or fat for energy, lipids are the main source of fuel-based energy. In the early 2000s, many companies began competing to see which one could develop the first algal biofuel for planes. Several began with using traditional fuels mixed with algal biofuel. In 2010, a company called EADS had the first successful flight on fuel composed of 100% algal biofuel. They sent up a twin-engine plane at an exhibition in Germany. The fuel was much more efficient than traditional petroleum-based fuel, and the plane required about 1.5 liters less fuel per 100 kilometers than normal. The plane’s exhaust was also much lower in nitrogen, sulphur, and hydrocarbons. Only a few minor changes had to be made for the engine to be able to accommodate the new fuel. The team at EADS was very excited about the success of their flight. In an article for Aviation International News, EADS chief technical officer Jean Botti noted that the achievement increased the possibility of carbon-neutral flights and could change the entire future of propulsion. While algae can be mass-produced, it is currently more expensive than fossil fuels. Yet, scientists believe biofuels may reduce carbon dioxide (CO2) emissions by

222

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

POWER PLANTS

| Algal Biofuels

11

taking carbon out of the air for photosynthesis. The technologies needed to grow and process algae for biofuels exist, but more research is needed to be able to use algae as a fuel on a large or commercial scale. In particular, more research needs to be done to determine how to grow algae under optimal growth conditions for efficiency so the algae may produce more lipids, more quickly, to maximize their lipid (energy) output.

Recognize, Recall, and Reflect 1. What type of organic compound does algae produce to make energy for fuel? 2. What are the benefits to using algal biofuels over other types of fuels? 3. What is one challenge that would have to be overcome for algae to become useful on a large, commercial scale?

Investigate and Explain Researchers are studying biofuels as an alternative to fossil fuels. Different organisms produce different amounts of oil that can be turned into biofuel. These organisms include the castor bean plant, the coconut plant, and microalgae. As many of these organisms also provide food for people, it is difficult to argue for them to be used as fuel instead. Therefore, microalgae are often considered the more ethical option. Review the data in Figure 11.2 to explore the oil output of different organisms per hectare of land. Then, answer the questions that follow.

FIGURE 11.2 Amount of Oil Made by Organisms Per Hectare of Land

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

223

11 1. According to Figure 11.2, which organism produces the most oil per hectare? 2. Why would algal biofuel be considered more ethical than other types of biofuels? 3. What if another plant was found to make 100,500 of oil per hectare, although it was a type of plant that people could eat as food? Would you recommend using algae or this new plant for fuel? Why or why not?

Activity Imagine that you are a microbiologist examining algae. You need to collect algae, which is found in many ponds and lakes, and place it under a microscope. To examine the algae on a slide, you will need to create an algae net (skimmer) to collect it (Figure 11.3). Or, your teacher may provide you a sample. After completing the activity, answer the questions that follow.

Materials For algae collection (per group) • 1 wire coat hanger to make frame of algae skimmer • 1 pair of pantyhose (nylons) or a single knee-high stocking for algae skimmer • 1 jar with a screw-top lid or plastic sealable bag • 1 plastic wash bottle For observing the algae (per group) • 1 dropper • 1 microscope slide and coverslip • 1 compound light microscope Safety Note: Use extreme care when assembling algae skimmers as the hook of the hanger can be sharp and cause scratches. If the class visits a pond, wear closed-toed shoes with good traction, long pants, and long-sleeve shirts. Use bug spray and sunscreen as necessary. Be very careful when walking near the pond and collecting samples so as not to slip. Also watch out for wildlife at the pond site. As you spray water on your skimmer, be sure to drain it into the plastic bag or jar; take care not to spill it. While working with the microscope, use the fine adjustment on high magnification objective lenses to prevent cracking or damaging the slide or microscope.

224

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

POWER PLANTS

| Algal Biofuels

11

FIGURE 11.3 Instructions on How to Make a Skimmer

1. Pull on the long flat part of the wire hanger so it forms a diamond shape seen here. 2. Place the open end of the nylon over the part labeled A until it reaches the base of the hook labeled B. 3. Secure nylon to part B.

To use the skimmer, take it to a pond near your school. Skim along the top of the pond to get the algae. To collect the contents of your skimmer, gently spray water onto it using the wash bottle. Let the water and algae contents drain into the jar or bag you brought. Make sure you return any fish or other live organisms you may have caught back to the pond. Once you have obtained your algae and returned to your classroom, follow the steps in Figure 11.4 to prepare the algae sample for observation.

FIGURE 11.4 Instructions on How to Make a Wet Mount Slide of the Algae Sample

1. Using a dropper, place some of the algae and water from your container onto a clean microscope slide.

2. Gently cover the algae and water with a coverslip. Your wet mount slide is complete. You may now place it under the compound light microscope for viewing.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

225

11 Once your slide is ready for viewing, follow the steps below. 1. Place your sample on the microscope stage on the lowest objective lens and use course adjustment to bring your sample into focus. Then, use the fine adjustment. 2. Sketch what you see under the microscope for Observation 1. 3. Record your total magnification for Observation 1. 4. Adjust your objective lens to a higher magnification, using the fine adjustment only. 5. Sketch what you see under the microscope for Observation 2. 6. Record your total magnification for Observation 2. 7. When finished, return samples to your jar or bag and clean your microscope equipment. Observation Sketches Draw your sketches of algae under the compound light microscope here:



Observation 1

Observation 2

sample at _______ magnification

sample at __________ magnification

There are many species of microorganisms in pond water. To help us know which ones are algae, and which types of algae these are, you will use a dichotomous key. A dichotomous key uses “yes” or “no” statements to help identify species. It is like a game of “Guess Who?” in which you observe the traits of species to classify them. 8. Identify your species using the “yes” and “no” statement chart on the following page. Tally the number of each different species you found.

226

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

POWER PLANTS

Statement

| Algal Biofuels

11

How Many?

1. It is green. ..................................................................................................................... Go to 2.

It is not green. .............................................................................. It is not green algae.

_____________

2. It has a circle or oval shape. ............................................................................. Go to 3.

It has some other shape than a single circle or oval. ..................... Go to 4.

3. It is circle with little circles inside. ........................................................ It is Volvox.

_____________



It is an oval with two little tails (flagella). .............. It is Chlamydomonas.

_____________



It is many circles joined together. .......................................... It is Pediastrum.

_____________

4. It has long branching strands with spirals inside. ............. It is Spirogyra.

_____________



_____________

It has long branching strands with squares inside. ......... It is Zygnema.

Activity Questions 1. How many different kinds of organisms did you find? How many appeared to be algae versus other microorganisms? Why do you think that was? 2. What were the common features of the algae you found in your sample? Why do you think that was? 3. If you sampled deeper into the pond (not on the surface), do you think you would have found more or less green algae? Why or why not?

Apply and Analyze Research has been conducted on the uses of algae oil and fuel. Read the article “Algae Oil: A Sustainable Renewable Fuel of Future” (http://dx.doi.org/10.1155/2014/272814). After reading, answer the questions that follow. 1. After reading about the pros and cons of algal biofuels, do you think they are a viable source of fuel? Should research continue to develop more efficient biofuels? 2. What alternative uses could you see for algal biofuels? For algae?

Design Challenge The case study in this lesson illustrates how a scientific observation led to potential solutions to a problem. Observations and discoveries often spark ideas for innovations. This is especially true in the field of engineering. Engineering is the application of scientific understanding through creativity, imagination, and the designing and building of new materials to address and solve problems in the real world. You

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

227

11 will be asked to take the science you have learned in this case and design a process or product to address a real-world issue. Engineers use the engineering design process (Figure 11.5) as steps to address a real-world problem. In this case, you are asking the question (Step 1) of what are the optimal growth conditions to maximize productivity of algal FIGURE 11.5 oil production for algal biofuels. Using additional resources, you will The Engineering Design Process brainstorm (Step 2) the type of algae that you can raise on a biofuel farm. 1 Then you will create a plan (Step 3) Ask Questions for designing your farm. Next, you and Define the will create (Step 4) a diagram and Problem model of your farm. You will evalu6 2 ate your farm (Step 5) by presenting Revise Brainstorm your farm design to the class. Last, and Improve and Imagine with your peers, you will examine The potential improvements (Step 6) for Engineering your farm’s design. Design

1. Ask Questions

3 5

Process

3

Test Algae farming is a booming indusPlan and Evaluate try. Watch a video on algae oil pro4 duction and algae farming here: Design https://energy.gov/eere/videos/energyand 101-algae-fuel. To create oil, algae Create undergo photosynthesis, which requires water and carbon dioxide. In order to get the most oil from this process, algae need a specific range of temperatures, light, and population sizes. Based on this information, ask yourself questions about building algae farms as a way to get thinking about the factors involved in creating your own farm. For instance, what will you need on your farm to grow algae? What is the best environment in which to build the farm? What type of algae would you grow? What types of challenges might you have to plan for in building such an enterprise?

2. Brainstorm and Imagine In order to figure out what types of algae to farm, scientists have been examining different species of microalgae to determine which would be the best source of biofuels. Studies have found that some species can produce up to 60% of their dry weight in oil that can be used for biofuels. Look again at the article “Algae Oil: A Sustainable Renewable Fuel of Future” (http://dx.doi.org/10.1155/2014/272814) from

228

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

POWER PLANTS

| Algal Biofuels

11

the Apply and Analyze section. Examine Table 2 in the article, which compares the oil production of different algae. What would be the most efficient species to produce the most biofuel? Brainstorm four potential types of algae you could grow on your farm. .

3. Create a Plan Create a plan for developing your algal biofuel farm. To do this, you’ll need to determine the optimal growth conditions for maximum oil output. First, look at the four species you chose in Step 2. Consider which of these seems the most appropriate for the weather and climate conditions where you live. (You may need to do online research to determine this.) After picking the algae that will grow best, figure out the details of how your farm will work. Use the Create a Plan graphic organizer (p. 231) to assess your ideas and flesh out your plan. In the organizer, clearly outline what algae you chose, considering the climate and weather of your area; where the water for your farm will be sourced; and how you will maintain your algal farm (optimal temperature, light exposure, pH, and population size). Think creatively about how you can make the most efficient farm with the constraints of space and resources. For example, a lot of land is dedicated to agricultural production. Therefore, rooftop farming is an excellent strategy for algae farming, which doesn’t require soil to grow. Also, rooftops have ready access to sunlight and rainfall in geographic areas that have lots of sunshine and rain. One species of algae, Botryococcus braunii, can produce a lot of oil in these types of environmental conditions. Use of clear tubes is one strategy to grow algae on rooftops. But this will require technicians to maintain the tubes as well as water pH to ensure the health of the algal colony. In creating your idea, try to visualize the different features of your farm. If you get stuck at any point in the planning process, you may visit this website to see how different algal farms look: www.e-education.psu.edu/egee439/node/695.

4. Design and Create Create a diagram of your farm. You can draw it using digital media, paper, or multimedia. Use your imagination to develop the best design for your farm. Make sure you include all the necessary parts of the farm based on your research and graphic organizers.

5. Test and Evaluate Develop a presentation to share your farm proposal with the class. Give an overview of the different algae species you considered farming and why. Then describe how you went about planning your farm. Share your diagram from Step 4 as part of your presentation. Ask for feedback from the class. Listen to their evaluations of your idea. They will explain what they think will work about your plan and what might need to be improved.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

229

11 6. Revise and Improve Think about ways that you can use your classmates’ input to refine your farm. Return to your plan in Step 3 and your diagram in Step 4, and make necessary revisions. You may choose to accept all or only some of the feedback. Be sure to justify your reasons for incorporating or not taking your classmates’ suggestions.

230

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

POWER PLANTS

| Algal Biofuels

11

Create a Plan Algal Biofuel Farm Plan

Graphic Organizer Reason for This Algae Type

Type of Algae Benefits to This Algae Type

Facts About This Algae Type

Reason for This Farm Type

Type of Farm Benefits to This Farm Type Algal Farm Components

Facts About This Farm Type

Resource 1 Benefits

Resources Needed Resource 2 Benefits

Resource 3 Benefits

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

231

11 TEACHER NOTES

POWER PLANTS ALGAL BIOFUELS

A Case Study Using the Discovery Engineering Process

Lesson Overview In this lesson, students learn about the discovery of algae as a biofuel. Students will build algae skimmers to capture algae. Then, they will analyze it under a microscope. Afterward, they will examine a variety of biofuels and different species of algae being tested as sources of biofuel. Last, students will produce their own designs for developing algal biofuels and present the designs to the class.

Lesson Objectives By the end of this case study, students will be able to • explain why algae is being studied as an alternative to fossil fuels; • determine, using data, which species of algae are more efficient as fuel than others; • examine algae under a microscope; and • develop a plan for a new biofuel farm.

Use of the Case Due to the nature of these case studies, teachers may elect to use any section of each case for their instructional needs. They are sequenced in order (scaffolded) so students think more deeply about the science involved in the case and develop an understanding of engineering in the context of science.

Curriculum Connections Lesson Integration This lesson may be taught in a unit on energy and ecosystems. This is also an interdisciplinary subject that could be used to review energy use in a physical science course or human sustainability in an environmental course.

232

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

POWER PLANTS

| Algal Biofuels

TEACHER NOTES

11

Related Next Generation Science Standards PERFORMANCE EXPECTATIONS • MS-ETS1-1. Define the criteria and constraints of a design problem with sufficient precision to ensure a successful solution, taking into account relevant scientific principles and potential impacts on people and the natural environment that may limit possible solutions. • MS-ETS1-2. Evaluate competing design solutions using a systematic process to determine how well they meet the criteria and constraints of the problem. • HS-PS3-3. Design, build, and refine a device that works within given constraints to convert one form of energy into another form of energy. • HS-ETS1-2. Design a solution to a complex real-world problem by breaking it down into smaller, more manageable problems that can be solved through engineering.

SCIENCE AND ENGINEERING PRACTICES • Asking Questions and Defining Problems • Developing and Using Models • Planning and Carrying out Investigations • Analyzing and Interpreting Data • Constructing Explanations and Designing Solutions

CROSSCUTTING CONCEPTS • Systems and System Models • Energy and Matter: Flows, Cycles, and Conservation

Related National Academy of Engineering Grand Challenge • Engineer the Tools of Scientific Discovery

Lesson Preparation Before starting the lesson, it is helpful for students to have some understanding of the general equation (process) of photosynthesis and protists. You may want to review the topics of photosynthesis and organic compounds as they relate to the mechanism by which algae can produce oil. Finally, you’ll want to review topics related to microscope use and creating dichotomous keys.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

233

11 You will need to make copies of the entire student section for the class. Students will need internet access at various points in the lesson. Alternatively, you can project videos or print and distribute copies of online content for the class. Look at the Teaching Organizer (Table 11.1) for suggestions on how to organize the lesson. Prior to the Activity section, collect the materials needed to prepare the algae skimmers and wet mount slides (see Materials section). Have students build the skimmers in the classroom before visiting a pond. Carefully read over the safety information and share it with students prior to bringing them to a pond area. Students should work in pairs or groups and must be supervised at all times while at the pond. You may need another adult or two to help chaperone this excursion. If you do not wish to bring students to a pond or if a pond is not easily accessible, you may order algae from places such as Carolina Biological Supply Company to arrive the day prior to the lab activity. You can also collect pond water to bring into class (a sealed 32 oz. Mason jar should cover several classes) or grow algae in a classroom aquarium in the weeks prior to the activity. Make sure to store your algae in sunlight to ensure the algae’s survival. You may also use preserved algae or live algae to examine under the microscope. These can be ordered from any science supply company. While working with the microscope, have students use the fine adjustment on high-magnification objective lenses to prevent cracking or damaging the slide or microscope. Tell students to take care with pond water that contains living things in order to minimize stress and harm: • Have students turn off the light on the compound light microscope to prevent excessive heating of the samples. • Have students return used and unused samples back to the pond. Safety Note for Students: Use extreme care when assembling algae skimmers as the hook of the hanger can be sharp and cause scratches. If the class visits a pond, wear closed-toed shoes with good traction, long pants, and long-sleeve shirts. Use bug spray and sunscreen as necessary. Be very careful when walking near the pond and collecting samples so as not to slip. Also watch out for wildlife at the pond site. As you spray water on your skimmer, be sure to drain it into the plastic bag or jar; take care not to spill it. While working with the microscope, use the fine adjustment on high-magnification objective lenses to prevent cracking or damaging the slide or microscope. For more information, please see the National Science Teaching Association’s guidance on lab safety in the classroom: www.nsta.org/safety.

234

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

POWER PLANTS

| Algal Biofuels

TEACHER NOTES

11

Materials For algae collection (per group of students) • 1 wire coat hanger to make frame of algae skimmer • 1 pair of pantyhose (nylons) or a single knee-high stocking for algae skimmer • 1 jar with a screw-top lid or plastic sealable bag • 1 plastic wash bottle For observing the algae (per group of students) • 1 dropper • 1 microscope slides and coverslip • 1 compound light microscope

Time Needed Up to 215 minutes

TABLE 11.1 Teaching Organizer Section

Time Suggested

Materials Needed

Additional Considerations

The Case

10 minutes

Student pages

Activity done individually in class or as homework prior to class

Investigate and Explain

10 minutes

Student pages

Activity done individually or in pairs

Activity

120 minutes (over two class periods)

Student pages, materials for algae collection and observation

Activity done in pairs or small groups

Apply and Analyze

10–15 minutes

Students pages, internet access

Individual activity

Design Challenge

45–60 minutes

Student pages, internet access

Small-group activity

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

235

11 Vocabulary • biofuel

• lipids

• biomass

• microalgae

• carbon dioxide

• microscopic

• chlorophyll

• optimal growth conditions

• efficiency

• organic compounds

• fertilizer

• photosynthesis

• fossil fuels

• protist

• green energy

• unicellular

Extensions Note that liters and kilometers are used in the case rather than gallons and miles. Consider asking students to make the conversion and compare how the United States measures fuel consumption compared to other countries that use the metric system. You can also encourage students to use the engineering design process to build or refine the current design of an algae skimmer. Students can brainstorm ways to build a device to capture algae without all the water. More information and activities can be found here: www.bbsrc.ac.uk/engagement/schools/keystage5/practicalbiofuel-activities/#current.

Assessment Use the Teacher Answer Key to check the answers to section questions. To assess the Design Challenge, you can evaluate the students’ algae farm plans and designs. It should be clear from the students’ work that they conducted research on various algae species to create an algae biofuel farm. Students’ farm plans should focus on one algae species that will grow well in their local area and outline how that species could be farmed with a specific strategy. Students should account for the farm’s water source and explain how the farm will be maintained (optimal temperature, light exposure, pH, and population size). Students should create a diagram of their farm that reflects the information in their plan. They should be able to present their designs and state any constraints or drawbacks they can foresee with implementation.

236

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

POWER PLANTS

| Algal Biofuels

TEACHER NOTES

11

Teacher Answer Key Recognize, Recall, and Reflect 1. What type of organic compound does algae produce to make energy for fuel? Algae makes lipids, which are fats and oils. 2. What are the benefits to using algal biofuels over other types of fuels? Some examples include: Farming them uses less space, resources, and freshwater than farming other biofuels; they are more efficient than other biofuels; they remove CO2 from the atmosphere. 3. What is one challenge that would have to be overcome for algae to become useful on a large, commercial scale? More research must be done to find optimal growth conditions to produce more lipids, more quickly.

Investigate and Explain 1. According to Figure 11.2, which organism produces the most oil per hectare? Algae 2. Why would algal biofuel be considered more ethical than other types of biofuels? It is more efficiency, meaning it produces more fuel output with less resource input. 3. What if another plant was found to make 100,500 of oil per hectare, although it was a type of plant that people could eat as food? Would you recommend using algae or this new plant for fuel? Why or why not? Students’ answers may vary but should include some argument that arable land should be used for food or crop production, not fuel production based on a cost-benefit ratio.

Activity Questions 1. How many different kinds of organisms did you find? How many appeared to be algae versus other microorganisms? Why do you think that was? Students’ answers may vary depending on algae samples.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

237

11 2. What were the common features of the algae you found in your sample? Why do you think that was? Students’ answers may vary, but they could explain commonalities by referencing water quality, temperature, Sun exposure, etc. 3. If you sampled deeper into the pond (not on the surface), do you think you would have found more or less green algae? Why or why not? Less because these are green algae, meaning they are photosynthetic which requires sunlight. Deeper depths of the pond would have less light than the pond surface.

Apply and Analyze 1. After reading about the pros and cons of algal biofuels, do you think they are a viable source of fuel? Should research continue to develop more efficient biofuels? Students’ answers may vary but should provide a balanced argument including both pros and cons of biofuels. They should indicate that seeking out optimal growth conditions is important for large-scale, commercial algal fuel production. 2. What alternative uses could you see for algal biofuels? For algae? Students’ answers may vary but should be supported by relevant data sources.

Resources and References Abishek, M. P., J. Patel, and A. P. Rajan. 2014. Algae oil: A sustainable renewable fuel of future. Biotechnology Research International. 272814. http://dx.doi.org/10.1155/ 2014/272814. Biotechnology and Biological Sciences Research Council (BBSRC). Practical biofuel activities. https://bbsrc.ukri.org/engagement/schools/keystage5/practical-biofuelactivities/#current. Edwards, M. 2010. Algae 101: Algae history and politics. AlgaeIndustryMagazine.com. www.algaeindustrymagazine.com/part-3-algae-history-and-politics. Epstein, C. 2010. First algae-powered airplane takes to the skies. Aviation International News Online. www.ainonline.com/aviation-news/business-aviation/2010-06-08/first-algaepowered-airplane-takes-skies. Heinen, J. M., G. C. Fornshell, and P. J. Foley. 1988. Removal of floating filamentous algae from ponds with a shallow seine. North American Journal of Aquaculture 50 (3): 187–187. United States Department of Energy: Office of Energy Efficiency and Renewable Energy. 2012. “Energy 101: Algae-to-fuel” video. https://energy.gov/eere/videos/energy-101-algaefuel.

238

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

A “SIXTH SENSE” Using Sensors for Monitoring and Communication

12

A Case Study Using the Discovery Engineering Process Introduction If you have ever carefully observed dogs, you may have noticed that they communicate in different ways. Dogs bark, growl, and wag their tails to express their emotions and “talk” to other dogs (Figure 12.1). Dogs seem to understand each other, but how do we FIGURE 12.1 know what they are saying? If we could converse with dogs, what would you say? How could a Dog in a Play Position conversation between humans and dogs be helpful to both humans and dogs? Sensor technologies can collect or record data from a biological organism and the physical environment. These can include detailed observations or measurements of an input of interest. Humans then make inferences from these observations to interpret and translate the meaning of the data. New sensors are currently in development to aid in the communication with (and the transfer of data from) dogs and humans.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

239

12 Lesson Objectives By the end of this case study, you will be able to • describe the purpose and use of sensor technologies; • read and interpret sensor data from a sample data set of a dog training program for a search-and-rescue mission; and • design a new use for sensor technology using current measurement technologies.

The Case Read the passage below about an accidental discovery of microsize sensors. Once you have finished reading, answer the questions that follow. In 2003, Jamie Link—a University of California, San Diego, graduate student—was working in a lab that was researching multiple integrated circuits called silicon chips (Figure  12.2). (The chips are built on circular disks called wafers.) She accidentally dropped a silicon chip, and the chip shattered. She noticed that the shattered pieces worked FIGURE 12.2 just as well as the larger chip. The chip’s fragments were operating as their own tiny sensors, sending Silicon Wafer Holding Chips out signals that could be monitored and interpreted. Called smart dust, these microsize sensors can go where other larger sensors have never gone before. The new, smaller sensors are now being used for water- and air-quality monitoring as well as in medical communications. North Carolina State University scientists and engineers are developing ways to use sensor technologies in order for humans to communicate with dogs and for dogs to communicate back. Because dogs mainly communicate through nonverbal communication, or body language, the tiny sensors have been adapted to record and interpret canine behavior. This includes sensors to capture a dog’s body posture (relaxed stance, stress posture, and play bowing) and movements (running, swimming, and sniffing). Satellites (like Global Positioning System, or GPS), audio speakers, and vibrating motors allow the scientists and engineers to give feedback to a dog. That is, they send the dogs verbal or sensory cues (like spoken commands or a vibrating

240

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

A “SIXTH SENSE”

| Using Sensors for Monitoring and Communication

12

sensation) that prompt the animals to respond in a certain way. These sensors can also monitor the dog’s physiology, like its heart rate, body temperature, and stress levels. This is important as many dogs work in the field and in extreme environments, and sensors can help humans keep the dogs safe in these situations. Potential applications of these sensors include helping search-and-rescue dogs in disaster responses and guide dogs for individuals with disabilities. The sensors can also be used to monitor the well-being of animals in shelters and hospitals.

Recognize, Recall, and Reflect 1. Using information from the introduction and the case, how would you define a sensor in your own words? 2. Describe how dogs communicate through their body language. 3. What could sensors be used to monitor in dogs?

Investigate and Explain Various sensors are used to collect motion-based data, including gyroscopes (for direction/orientation), accelerometers (for speed), and passive infrared detectors (which use light to detect changes in motion). The sensors require a baseline of data for accuracy and reliability. Scientists first program the sensors’ computer by creating an algorithm—or directions or instructions the computer uses to make decisions—to determine what a dog is doing based on the sensor data. Sensors are calibrated (tested) by having the dog complete actions observed directly by scientists and engineers. Those data are graphed on a computer to create a model showing the sensors’ readings of the dog’s behavior. The scientists then compare the actions they observed to the outputs from the sensors to calibrate their algorithm. The chart on the following page has data from average accelerometer readings (ranging values from –2.0 to 2.0) indicating the intensity of the dogs’ movement. If a dog isn’t moving much or at all, it is called static activity. If the dog is moving a lot, it is called dynamic activity. From the data, a computer used an algorithm to predict the dogs’ behaviors. To ensure accuracy and reliability, those predictions were confirmed by the observations made by the scientists and engineers. Examine Table 12.1 (p. 242), which features the sensor readings and computerpredicted behavior. Static activity was predicted when values  1/2 1.00 and dynamic activity was predicted when values  1/2 1.00. After examining the data, answer the questions that follow.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

241

12 TABLE 12.1 Accelerometer Readings and Computer-Predicted Behavior for Dog Sensor Calibration Average Accelerometer Reading: Sensor 1

Average Accelerometer Reading: Sensor 2

Type of Activity

Computer-Predicted Dog Behavior

–0.80

0.55

Static

Standing on hind legs

0.10

0.40

Static

Standing

–0.20

0.70

Static

Lying down

–0.50

0.90

Static

Sitting

0.20

1.80

Dynamic

Barking

0.19

1.20

Dynamic

Walking

–1.8

1.8

Dynamic

Running

Source: Adapted from Bozkurt et al. (2014).

1. Which four behaviors are static? According to the sensor data, what does static behavior mean? 2. Many search-and-rescue dogs lie down when they find a person in distress. According to Table 12.1, what would be the average accelerometer readings (from Sensors 1 and 2) that you would expect of a dog that has found someone? 3. Why do you think dynamic activity is harder for the sensors to record? Why is the dynamic information useful?

Activity Imagine you are a search-and-rescue geographer for the National Park Service. You have been asked to graph data of a dog’s journey through a rescue-and-recovery training. During the training, six rangers were posted at different points across a park, pretending to be injured hikers. The dog’s mission was to find them. Before the exercise, the dog had been trained to execute a dynamic action (a bark) when it found an injured person. The data from the dog’s journey is in Table 12.2. It includes measurements taken at points when the dog did something to set off the sensors it was wearing. Using the information from the Elevation Data and GPS Coordinates columns, you will plot out the eight data points on the map below the table. Note that the lettered dots (A–F) on the Dog Training Map indicate the location of the “injured” park rangers. The dog started at point D where scientists involved in the training could directly observe it. This was done for calibration purposes, so as to ensure the dog knew to bark to indicate it had found an injured hiker.

242

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

A “SIXTH SENSE”

| Using Sensors for Monitoring and Communication

12

After plotting the eight data points on the map, use the Computer-Predicted Dog Behavior data to infer the reasons for the dog’s behavior. Write your interpretation of what the dog is doing in training in the Human-Inferred Dog Behavior column of the table. Once done, answer the questions that follow.

TABLE 12.2 Dog Training Data Elevation Data (in Feet)

GPS Coordinates (North/West)

Sensor Data Activity Recorded

Computer-Predicted Dog Behavior

Human-Inferred Dog Behavior (Record Here)

Start

1,050

37.9 N, 103.2 W

Dynamic

Barking

Alert for injured person

Data Point 1

1,250

37.8 N, 103.4 W

Static

Standing

Data Point 2

1,550

37.5 N, 103.5 W

Dynamic

Barking

Data Point 3

1,450

37.3 N, 103.9 W

Dynamic

Barking

Data Point 4

1,250

37.2 N, 103.7 W

Dynamic

Barking

Data Point 5

1,000

37.3 N, 103.5 W

Dynamic

Standing on Hind Legs

Data Point 6

1,250

37.0 N, 103.4 W

Dynamic

Barking

Data Point 7

1,250

37.4 N, 103.4 W

Static

Lying Down

Data Point 8

1,100

37.7 N, 103.0 W

Static

Standing

Measured Readings

Dog Training Map

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

243

12 Activity Questions 1. Did the dog find all injured individuals? Which individuals do you believe it did not find? 2. What do you believe happened at data point 4? 3. Based on your data, what recommendations would you give for this dog’s future training?

Apply and Analyze Sensor technology is being used to communicate with a wide variety of animal species, including elephants. Read this article from North Carolina State University on how elephant collars are helping protect people and elephants: https://news.ncsu. edu/2014/10/elephant-collar. After reading, answer the questions that follow. 1. What problem are these elephant collars addressing? 2. How did scientists know that the collar was working? 3. What were some of the design challenges of fitting an elephant with a collar? What are your design ideas to make the collar fit an elephant?

Design Challenge The case study in this lesson illustrates how a scientific observation led to potential solutions to a problem. Observations and discoveries often spark ideas for innovations. This is especially true in the field of engineering. Engineering is the  application of scientific  understanding through creativity, imagination, and the designing and  building of materials to address and solve problems in the real world. You will be asked to take the science you have learned in this case and design a process or product to address a real-world issue. Engineers use the engineering design process (Figure  12.3) as steps to address a real-world

244

FIGURE 12.3 The Engineering Design Process 1 Ask Questions and Define the Problem 6

2

Revise and Improve

Brainstorm and Imagine

3 5

The Engineering Design Process

3

Test and Evaluate

Plan 4 Design and Create

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

A “SIXTH SENSE”

| Using Sensors for Monitoring and Communication

12

problem. In this case, you are asking the question (Step 1) of what are some new uses for sensor technologies. Using outside research, you will brainstorm (Step 2) a new application for microsize or portable sensor technology. Then, you will make a plan (Step 3) for the product. Next, you will create (Step 4) a sketch of your sensor and describe its purpose. Finally, you will come up with a way to test (Step 5) your design and think of how to make improvements (Step 6) to it.

1. Ask Questions Ask questions about sensor technologies. For instance, why should we incorporate sensor technologies into current and new products? In what types of products would sensors be most beneficial? How could sensor technologies be used to solve various problems?

2. Brainstorm and Imagine Sensor technologies are growing in utility in many areas, including science, business, and health. Some ideas for future sensor technologies for you to consider are available here: www.electrochem.org/world-of-sensors. Based on this information and your prior knowledge, brainstorm a new application for microsize or portable sensor technology. For example, perhaps scientists could place sensors in bald eagle nests to monitor them and make sure they are stable for fledglings.

3. Create a Plan Create a plan for your sensor technology, determining what type of sensor you’d need. You can choose to use gyroscopes (to detect direction/orientation), accelerometers (to detect speed), or passive infrared detectors (to detect changes in movement). Use the Create a Plan graphic organizer (p. 247) for guidance. In the organizer, clearly outline (1) the purpose of your sensor-based technology, (2) ideas for how you might use each of the three sensor types in the technology, and (3) the pros and cons of using each sensor. Use that information to make your final choice of what sensor to use. Then (4) briefly describe how your final product would work. For example, if you decided to create a sensor device to monitor bald eagle nests, you might consider using a gyroscopic sensor. It could detect changes in the orientation of nests, which would help scientists to know if they are stable. Unstable nests could then be reinforced or relocated.

4. Design and Create Consider the following questions and considerations for your sensor design. • What type of data are you hoping to collect? • How would the sensors record and report the data?

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

245

12 • What level of human interpretation is needed for your data? • What technologies need to be developed to create or manufacture this design? • What are any constraints or drawbacks you can foresee with implementing this design? • Would there be any environmental or human health concerns to this design? How would you overcome them? Create a sketch of your sensor design. Make sure it incorporates your prior research and exploration.

5. Test and Evaluate How would you test your sensors to make sure the computers are interpreting the data correctly? Think about how you would calibrate the sensors to ensure accuracy and reliability of the collected data.

6. Revise and Improve Present or give your plans to one or more of your peers to review. Listen to their feedback on your design and take some time to revise and make improvements. What are some ways you can use their input to refine your design? You may choose to accept all or only some of the feedback. Be sure to justify your reasons for using or not taking the suggestions.

246

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

A “SIXTH SENSE”

| Using Sensors for Monitoring and Communication

12

Create a Plan What is the purpose of your technology?

________________________________________________________________________ ________________________________________________________________________ _______________________________________________________________________ Gyroscopic Sensor Idea



Accelerometer Sensor Idea



Passive Infrared Sensor Idea



Pros and Cons

Pros and Cons

Pros and Cons

Briefly describe how your final product would work.

_______________________________________________________________________________ _______________________________________________________________________________ _______________________________________________________________________________

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

247

12 TEACHER NOTES

A “SIXTH SENSE”

USING SENSORS FOR MONITORING AND COMMUNICATION A Case Study Using the Discovery Engineering Process

Lesson Overview In this lesson, students learn about the accidental discovery of microsensors. They also read about contemporary research on sensor-based communication technologies for dogs. Students learn how sensors work using inputs (measurements) and outputs (computer or human interpretation). After reading the case study, students plot and interpret sensor data from a sample data set collected during a dog’s search-and-rescue training. Last, students use case information to research a particular type of sensor technology (e.g., gyroscopes [for direction/orientation], accelerometers [for speed], or passive infrared detectors [for motion]) and describe a new way for this sensor technology to be used.

Lesson Objectives By the end of this case study, students will be able to • describe the purpose and use of sensor technologies; • read and interpret sensor data from a sample data set of a dog training program for a search-and-rescue mission; and • design a new use for sensor technology using current measurement technologies.

Use of the Case Due to the nature of these case studies, teachers may elect to use any section of each case for their instructional needs. They are sequenced in order (scaffolded) so students think more deeply about the science involved in the case and develop an understanding of engineering in the context of science.

248

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

A “SIXTH SENSE”

| Using Sensors for Monitoring and Communication TEACHER NOTES

12

Curriculum Connections Lesson Integration This lesson may be taught during a unit on animal behavior for beginner biology courses or mapping for beginner geography. It also fits well into a lesson on sensor technology (communication, location, and interpretation of data).

Related Next Generation Science Standards PERFORMANCE EXPECTATIONS • MS-LS1-8. Gather and synthesize information that sensory receptors respond to stimuli by sending messages to the brain for immediate behavior or storage as memories. • MS-ETS1-1. Define the criteria and constraints of a design problem with sufficient precision to ensure a successful solution, taking into account relevant scientific principles and potential impacts on people and the natural environment that may limit possible solutions. • HS-PS4-2. Evaluate questions about the advantages of using a digital transmission and storage of information. • HS-PS4-5. Communicate technical information about how some technological devices use the principles of wave behavior and wave interactions with matter to transmit and capture information and energy. • HS-ETS1-3. Evaluate a solution to a complex real-world problem based on prioritized criteria and trade-offs that account for a range of constraints, including cost, safety, reliability, and aesthetics, as well as possible social, cultural, and environmental impacts.

SCIENCE AND ENGINEERING PRACTICES • Asking Questions and Defining Problems • Developing and Using Models • Planning and Carrying out Investigations • Analyzing and Interpreting Data • Constructing Explanations and Designing Solutions • Engaging in Argument From Evidence

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

249

12 CROSSCUTTING CONCEPTS • Patterns • Cause and Effect • Systems and System Modeling

Related National Academy of Engineering Grand Challenges • Reverse Engineering the Brain • Engineer Better Medicines • Engineer the Tools of Scientific Discovery

Lesson Preparation This lesson requires students to have some understanding of map skills (i.e., latitude, longitude, and topographic data). You may wish to review latitude and longitude coordinates, isolines, and fundamentals of mapping. Additionally, you may wish to review observation versus inference and why each are important to scientific understanding. It may also be helpful to review using technology-based measurements. You will need to make copies of the entire student section for the class. Students will need internet access at various points in the lesson. Alternatively, you can project videos or print and distribute copies of online content for the class. Look at the Teaching Organizer (Table 12.3) for suggestions on how to organize the lesson.

Time Needed Up to 145 minutes

250

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

A “SIXTH SENSE”

| Using Sensors for Monitoring and Communication TEACHER NOTES

12

TABLE 12.3 Teaching Organizer Section

Time Suggested

Materials Needed

Additional Considerations

The Case

10 minutes

Student pages

Activity done individually in class or as homework prior to class

Investigate and Explain

30 minutes

Student pages

Activity done individually or in pairs

Activity

30 minutes

Student pages

Activity done individually or in pairs

Apply and Analyze

10–15 minutes

Student pages, internet access

Individual activity

Design Challenge

45–60 minutes

Student pages, internet access

Small-group activity

Vocabulary • accelerometers

• model

• accuracy

• observations

• alert

• passive infrared motion detectors

• algorithm

• physiology calibration

• body language

• reliability

• dynamic activity

• sensor technologies

• Global Positioning System (GPS)

• sensors

• gyroscopes

• silicon chips

• inferences

• smart dust

• input

• static activity

• measurements

• wafer

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

251

12 Extensions One way to extend the lesson is to have students build and test the sensors from the Design Challenge. The case can be followed with lessons on circuits. It can also be followed with discussions about sensor use in medical and environmental settings or in other settings where monitoring is needed. For example, sensors are now being used to prevent rhino poaching.

Assessment Use the Teacher Answer Key to check the answers to section questions. To assess the Design Challenge, you can evaluate the plans and designs for the students’ sensors. In their plans, students should have evaluated the three different sensor options and picked a sensor that best meets their needs. Sensor designs should include plans for recording and reporting data. They should also include methods for calibration to ensure accuracy and reliability of collected data for human interpretation. Students should be able to report what technologies need to be developed to create or manufacture their designs. They should also be able to report any constraints, drawbacks, or potential environmental or health concerns they can foresee with implementing the designs.

Teacher Answer Key Recognize, Recall, and Reflect 1. Using information from the introduction and the case, how would you define a sensor in your own words? Students’ answers may vary. Students should show an understanding that sensors are integrated circuits that send out signals that can be monitored and interpreted. Sensors produce detailed observations (observational data or measurements) of an input (e.g., behavior, physical property), but they also require inferences by humans to interpret and translate what that data means. 2. Describe how dogs communicate through their body language. Dogs communicate through body posture (relaxed stance, stress posture, and play bow) and movements (running, swimming, and sniffing). 3. What could sensors be used to monitor in dogs? The sensors can monitor the not only a dog’s body posture and movements (communication), but also its heart rate, body temperature, and levels of stress.

252

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

A “SIXTH SENSE”

| Using Sensors for Monitoring and Communication TEACHER NOTES

12

Investigate and Explain 1. Which four behaviors are static? According sensor data, what does static behavior mean? The static behaviors are standing, lying down, and sitting. It means the dog is not moving and is relatively still. 2. Many search-and-rescue dogs lie down when they find a person in distress. According to Table 12.1, what would be the average accelerometer readings (from Sensors 1 and 2) that you would expect of a dog that has found someone? The accelerometer reading (i.e., x, y coordinate) would be between –0.20 for Sensor 1 and 0.70 for Sensor 2. 3. Why do you think dynamic activity is harder for the sensors to record? Why is the dynamic information useful? Answers will vary. Students might say that dynamic activity is harder for the sensors to record because the dog is in motion and makes noise or disruptions (by creating random peaks) in the sensor data. This information is still useful since you can pair it with observational evidence during calibration to interpret the activity.

Activity Plot the location of the eight data points on the map using the map data. Students’ maps should resemble the key below.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

253

12 Activity Questions 1. Did the dog find all injured individuals? Which individuals do you believe it did not find? No, it is likely the dog did not find all individuals. It did not get close to person C, and it’s not clear if it located person E. 2. What do you believe happened at data point 4? The dog may have barked for a different reason than as an alert to an injured person. It may have barked at the train, a passerby, or some other animal. 3. Based on your data, what recommendations would you give for this dog’s future training? Students’ answers may vary but could include ideas related to training the dogs to not be distracted by other animals and pay more attention to the people calling for help.

Apply and Analyze 1. What problem are these elephant collars addressing? They’re helping find a way to limit elephant rampages and damage caused by elephants wandering into populated areas. 2. How did scientists know that the collar was working? The elephant wearing the collar would hear a sound and feel a buzz on the side of the neck, prompting it to turn away from the object. 3. What were some of the design challenges of fitting an elephant with a collar? What are your design ideas to make the collar fit an elephant? Students’ answers may vary. But they could mention the challenge of finding parts to fit a collar so large and making a collar sturdy enough to endure the wear and tear by an elephant.

254

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

A “SIXTH SENSE”

| Using Sensors for Monitoring and Communication TEACHER NOTES

12

Resources and References Bozkurt, A., D. L. Roberts, B. L. Sherman, R. Brugarolas, S. Mealin, J. Majikes, P. Yang, and R. Loftin. 2014. Toward cyber-enhanced working dogs for search and rescue. IEEE Intelligent Systems 29 (6): 32–39. https://ciigar.csc.ncsu.edu/files/bib/Bozkurt2014CyberEnhancedDogs.pdf. Center for Shelter Dogs. Dog communication and body language. Tufts University Cummings School of Veterinary Medicine. http://centerforshelterdogs.tufts.edu/dogbehavior/dog-communication-and-body-language. The Electrochemical Society. The world of sensors. www.electrochem.org/world-of-sensors. Electronics Hub. 2017. Different types of sensors. www.electronicshub.org/different-typessensors. Ford, D. 2014. Red-collar research. North Carolina State University News. https://news.ncsu. edu/2014/10/elephant-collar.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

255

Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

IN HOT WATER

13

The Discovery of Taq Polymerase

A Case Study Using the Discovery Engineering Process Introduction In the 1960s, scientists believed nothing could live in water above 73°C (163.4°F) and that most bacteria liked it around 55°C (131°F). The reason was that most proteins change shape, or are denatured, when they are heated (Figure 13.1, p. 258). Have you ever fried an egg? When the clear part of the egg turns white, the process of denaturation is taking place. However, thanks to exploration of the hot springs in Yellowstone National Park, researchers were able to discover bacteria that could survive at high temperatures. This discovery led to many great achievements in science.

Lesson Objectives By the end of this case study, you will be able to • explain the process of polymerase chain reactions; • analyze data and graph it in a new format to be able to better understand the results; and • create a research proposal to study organisms in extreme environments to solve engineering problems.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

257

13 The Case Read about the discovery and eventual use of Taq polymerase. This account discusses the series of events that eventually led to the improvement of polymerase chain reactions. Once you have finished reading, answer the questions that follow.

FIGURE 13.1 Denaturing Proteins

Thomas Brock was a biologist at the University of Indiana. In the 1960s, he started researching microbial biology. Because he also enjoyed travel, Dr. Brock decided to set up a research station in Yellowstone National Park. His work included taking samples of bacteria from lakes, springs, and geysers. During his collection, he found pink strands of bacteria living in one of the hot springs he was sampling. It was the first organism ever found living in temperatures above 80°C (176°F). Dr. Brock decided to name the bacteria Thermus aquaticus and nicknamed it Taq. As he began experimenting with the bacteria, he learned that it could survive in hot water almost up to boiling (100°C or 212°F) without any problems. Unfortunately, no one at the time was interested in bacteria that could survive high temperatures. In 1975, Dr. Brock closed his research station but left samples of Taq in a research bank for the future. Taq sat and waited until the 1980s when a researcher named Kary Mullis discovered a way to copy DNA. Dr. Mullis had found a way to make lots of copies of small pieces of DNA so that they were easier to study or combine. He called the process the polymerase chain reaction (PCR) because it uses an enzyme known as DNA polymerase to make the copies (Figure 13.2). After the DNA is duplicated, the materials must be heated up to 95°C (203°F) for the polymerase to release the new copy. Then both the original DNA polymerase and the copy of DNA can be used to make more copies. This creates an exponential system that can make millions of copies of DNA in a short time. But Dr. Mullis had a problem related to the heating step of the process. When he first developed PCR, he used DNA polymerase from E. coli—a type of bacteria found in the environment, intestines of many animals, and food. While E. coli can survive warm environments, they are damaged by near-boiling temperatures. Because of this, each time a cycle of PCR was run, more polymerase had to be added. Adding more polymerase is costly and time consuming.

258

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

IN HOT WATER

| The Discovery of Taq Polymerase

13

FIGURE 13.2 The Polymerase Chain Reaction Process

Eventually, Dr. Mullis and his colleagues realized they could use the DNA polymerase from Taq. By using a polymerase from an organism that lives in hightemperature environments, the entire PCR process could be heated to 95°C (203°F) without damaging the enzymes. This made the process more efficient and quicker. Now PCR is used commercially for many reasons. It can be used for DNA “fingerprinting,” which allows for the identification of criminals or paternity and maternity testing. It can also be used to test for viral infections or even faulty genes. In 1989, Taq polymerase was named by the journal Science as its first “Molecule of the Year.”

Recognize, Recall, and Reflect 1. Why did scientists believe organisms could not live in near-boiling temperatures? 2. What is the purpose of a polymerase chain reaction? 3. How was Taq polymerase able to improve the PCR? Why?

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

259

13 Investigate and Explain To determine bacteria from which to extract DNA polymerase for PCR, it is important to know two characteristics. The first characteristic is the bacteria’s optimum temperature. The optimum temperature is the temperature at which an organism functions at its best. Because bacteria live in a variety of habitats, from hot springs to the Arctic, their optimum temperatures can vary quite a bit. The second characteristic researchers need to know is the length of time it takes to generate a new generation. That is, how long it takes the bacteria to reproduce. Figure 13.3 shows the optimum temperature and generation time for several species of bacteria, including E. coli and Taq. After examining the data, answer the questions that follow. Create a scatter plot using the data from Figure 13.3. Time will go on the x-axis and temperature will go on the y-axis. Make sure to include all labels and create a key.

FIGURE 13.3 Optimum Temperature for Growth and Generation Times for Various Bacteria

Source: Adapted from Abishek, Patel, and Rajan (2014).

260

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

IN HOT WATER

| The Discovery of Taq Polymerase

13

Scatter Plot of Optimum Temperature for Growth and Generation Times for Various Bacteria

1. PCR involves high temperatures above 95°C (203°F). Which of the bacteria listed in Figure 13.3 would most likely be able to survive the high temperatures? 2. PCR also needs to occur quickly. Which of the bacteria included in Figure 13.3 would have the shortest time to grow a new generation of bacteria? 3. If you were going to choose a new type of bacteria to use for PCR based on your scatter plot, which would you select and why? Your answer should include specific numbers from the scatterplot.

Activity Imagine that you work as a graphic artist for Extremophile Bioprospecting Incorporated, a company that aids people in finding and harvesting extremophiles. (Extremophiles are microorganisms that can live in extreme conditions.) Your work is to provide information on extremophiles to bioprospectors—people who search for living things with medicinal or commercial value. To do this, you create

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

261

13 informational images, like wanted posters, but for extremophiles! These wanted posters show bioprospectors what specific extremophile they should be looking for, where the extremophile lives, and why it’s important. Your next assignment has just come in. Read on to find out more.

Part I You are tasked today with creating a wanted poster for an extremophile of your choosing to help educate bioprospectors about this extremophile. First, read about the historical importance of extremophiles in an article by Dr. Thomas Brock: www. ncbi.nlm.nih.gov/pmc/articles/PMC1208068/pdf/ge14641207.pdf. After you have finished reading, answer the questions that follow.

ACTIVITY QUESTIONS, PART I 1. What was Dr. Brock initially studying at Yellowstone? Why was this important? 2. In addition to Yellowstone, where was Thermus aquaticus found? 3. What method did Dr. Brock use to search for bacteria in hot springs where there were no visible bacteria growing? Go to this link and read about different extremophiles: https://en.wikipedia.org/ wiki/Extremophile. Choose an extremophile from this list. Using online and print resources, read and take notes about your chosen extremophile. Make sure to record your notes and at least three resources you used in the space provided. Notes on my extremophile: _______________________________________________ name of extremophile ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ Resource 1: __________________________________________________ Resource 2: __________________________________________________ Resource 3: __________________________________________________ Others: ______________________________________________________

262

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

IN HOT WATER

| The Discovery of Taq Polymerase

13

Part II Make a wanted poster for your chosen extremophile. Be sure to include the following on the poster: • Photo (Electron micrograph or microscopic picture/diagram) • Identifying characteristics (Does it have any unique color or structure that helps identify or tell this extremophile apart from other similar extremophiles?) • Description (Identify the extremophile’s classification and describe what the classification means.) • Hideout (Where is this extremophile found in the world? Make sure to show this on a map.) • How is it considered extreme? (What is the unique range that it is able to survive?) • Why is it “wanted”? (How could it be used in bioprospecting?) • Reward (What is the economic benefit of using this extremophile in bioprospecting?)

Apply and Analyze Extremophiles hold many possibilities in research. Bioprospectors have the important job of finding these organisms so they can be studied. Read this web page from the National Park Service (www.nps.gov/yell/learn/nature/bioprospecting.htm) on bioprospecting. After reading, answer the questions that follow. 1. What types of discoveries have been made from Yellowstone research? 2. What is “benefits-sharing”? Do you believe the park should receive benefits-sharing for discoveries made there? Why or why not?

Design Challenge The case study in this lesson illustrates how a scientific observation led to potential solutions to a problem. Observations and discoveries often spark ideas for innovations. This is especially true in the field of engineering. Engineering is the application of scientific understanding through creativity, imagination, and the designing and building of materials to address and solve problems in the real world. You will be asked to take the science you have learned in this case and design a process or product to address a real-world issue.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

263

13 Engineers use the engineering design process (Figure 13.4) as steps to address a real-world problem. In this case, you are asking the question (Step 1) of what other extreme organisms might have characteristics that could be used to solve problems. Using outside research, you will brainstorm (Step 2) different extremophiles that you could study to come up with solutions to problems. Then, you will create a plan (Step 3) to narrow down the adaptations of organisms you want to use to create a useful product. Next, you will create (Step 4) a visual presentation explaining your research and proposed products. You will think of ways to test (Step 5) your products and add those to the presentation. Finally, you will share your presentation and work with your peers to come up with improvements (Step 6) to your ideas.

FIGURE 13.4 The Engineering Design Process 1 Ask Questions and Define the Problem 6

2

Revise and Improve

Brainstorm and Imagine

3 5

The Engineering Design Process

3

Test and Evaluate

Plan 4 Design and Create

1. Ask Questions Ask questions about extreme habitats and organisms. For instance, what habitats on the planet might be considered extreme? Deserts are one example. They are very hot and dry. Yet, many animals and plants call these extreme environments home. How are living things able to survive and thrive in these and other extreme habitats? And how can organisms that live in extreme environments help solve problems that currently exist? For example, could we study how desert plants live in extreme heat to then develop crops that tolerate heat and drought?

2. Brainstorm and Imagine Come up with a list of extreme environments. Then, research the organisms (plants, animals, bacteria, etc.) that live in each of these places. List characteristics that the organisms must have to survive. (Extremophiles are able survive and thrive in their habitats because of their unique adaptations. An outline of extremophile adaptations is available here: https://lco.global/spacebook/astrobiology/what-are-extremophiles.) As you create your list, brainstorm problems that need extreme solutions (for

264

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

IN HOT WATER

| The Discovery of Taq Polymerase

13

instance, keeping cool in very hot climates). Think about how the organisms might inspire solutions to these problems. Use the Extreme Habitats Research graphic organizer (p. 267) for guidance. (You may need to do some additional internet research during your brainstorm.) Finally, pick one problem from the last column of the graphic organizer that you find most interesting.

3. Create a Plan Once you have selected your problem, carefully examine the organisms that have adapted to living in the corresponding extreme environment and consider how their adaptations provide clues to developing a solution to your identified problem. For example, one of the most difficult environments to survive in is the desert. Little water and high year-round temperatures can make it hard to find food, stay cool, and care for offspring. However, desert plants and animals have various adaptations that allow them to survive, and even thrive, in this environment. One such animal is the desert hare. With a fur coat, the hare must be able to dissipate body heat; otherwise its temperature will rise to lethal levels. Research suggests that the hare’s ears are uniquely adapted to be thin and allow blood to cool as it circulates through them. Products or processes based on this adaptation may have applications in engineering. For instance, the adaptation could inspire ways to help reduce temperatures of machinery or other appliances in hot climates. Make a plan for how you would develop a product to address your selected problem based up the adaptations found within your researched environments.

4. Design and Create Make a video presentation using a video software of your choice (e.g., Microsoft Sway, Animoto, PowToon). The video should communicate your idea for your product or process. You will want to include information on the problem you chose, the extreme environment where you might find solutions, the organisms that live in this habitat, and how you believe the organisms will be able to help solve your problem. As you plan for your video, think about graphics you might be able to include or using different camera angles to make the video more dynamic. Use the Research Presentation Planner (p. 268) for guidance.

5. Test and Evaluate Once you finish the video, consider ways you could test your product or process to see if it is able to perform the “extreme” task for which it was designed. Consider the following: • What would be your experimental design? • What would be your controls? • How many trials would you need to understand the efficacy of your project?

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

265

13 6. Revise and Improve Share your video presentation with the class. Once your presentation is finished, your peers will brainstorm ways to improve the proposal. Listen to their feedback and take some time to revise and make improvements. What are some ways you can use their input to refine your plan? You may choose to accept all or only some of the feedback. Be sure to justify your reasons for accepting or not using the peer feedback.

266

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

IN HOT WATER

| The Discovery of Taq Polymerase

13

Extreme Habitats Research Habitat

Organisms That Live Here

Adaptations Needed to Survive

How Adaptations Could Solve Problems

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

267

13 Research Presentation Planner Title of Presentation: ___________________________________________________________________

Name of Creators: _____________________________________________________________________

Shot

Images, Art, Videos, or Description

Script (Who Is Saying What?)

Time

1

2

3

4

268

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

IN HOT WATER

| The Discovery of Taq Polymerase

13

TEACHER NOTES

IN HOT WATER

THE DISCOVERY OF TAQ POLYMERASE A Case Study Using the Discovery Engineering Process

Lesson Overview In this lesson, students explore the discovery and subsequent use of Taq polymerase. Taq polymerase is an enzyme from the bacteria Thermus aquaticus. It was discovered in Yellowstone National Park in the 1960s and changed what scientists knew about the upper limit of temperatures in which life can survive. In the 1980s, Taq polymerase was used to improve the polymerase chain reaction (PCR) process. It allowed the process to become more efficient and less expensive. After reading the case study, students will research in depth an extremophile to create a wanted poster for bioprospectors. Finally, they will come up with a helpful product inspired by adaptations of animals in extreme environments and create a video presentation of their idea.

Lesson Objectives By the end of this case study, students will be able to • explain the process of polymerase chain reactions; • analyze data and graph it in a new format to be able to better understand the results; and • create a research proposal to study organisms in extreme environments to solve engineering problems.

Use of the Case Due to the nature of these case studies, teachers may elect to use any section of each case for their instructional needs. They are sequenced in order (scaffolded) so students think more deeply about the science involved in the case and develop an understanding of engineering in the context of science.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

269

13 Curriculum Connections Lesson Integration This lesson may be taught during a unit on biotechnology or bacteria for beginner biology courses. It also fits well into a lesson on leveraging microorganisms for health and economic benefits.

Related Next Generation Science Standards PERFORMANCE EXPECTATIONS • MS-LS1-5. Construct a scientific explanation based on evidence for how environmental and genetic factors influence the growth of organisms. • MS-ETS1-1. Define the criteria and constraints of a design problem with sufficient precision to ensure a successful solution, taking into account relevant scientific principles and potential impacts on people and the natural environment that may limit possible solutions. • MS-ETS1-3. Analyze data from tests to determine similarities and differences among several design solutions to identify the best characteristics of each that can be combined into a new solution to better meet the criteria for success. • HS-ETS1-2. Design a solution to a complex real-world problem by breaking it down into smaller, more manageable problems that can be solved through engineering. • HS-ETS1-3. Evaluate a solution to a complex real-world problem based on prioritized criteria and trade-offs that account for a range of constraints, including cost, safety, reliability, and aesthetics, as well as possible social, cultural, and environmental impacts.

SCIENCE AND ENGINEERING PRACTICES • Asking Questions and Defining Problems • Developing and Using Models • Planning and Carrying out Investigations • Analyzing and Interpreting Data • Constructing Explanations and Designing Solutions • Engaging in Argument From Evidence

270

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

IN HOT WATER

| The Discovery of Taq Polymerase TEACHER NOTES

13

CROSSCUTTING CONCEPTS • Scale, Proportion, and Quantity • Systems and System Modeling • Structure and Function

Related National Academy of Engineering Grand Challenge • Engineer the Tools of Scientific Discovery

Lesson Preparation Before starting the lesson, it is helpful for students to have some understanding of bacteria and the basic role of enzymes to catalyze chemical reactions. You may wish to review the concepts of DNA structure and cell replication to understand the mechanism by which Taq polymerase functions. For students with visual impairments, they may listen to the history of Taq polymerase on this podcast from Chemistry World: www.chemistryworld.com/podcasts/taq-polymerase/9266.article. You will need to make copies of the entire student section for the class. Students will need internet access at various points in the lesson. Alternatively, you can project videos or print and distribute copies of online content for the class. Look at the Teaching Organizer (Table 13.1) for suggestions on how to organize the lesson.

Time Needed Up to 335 minutes

TABLE 13.1 Teaching Organizer Section

Time Suggested

Materials Needed

Additional Considerations

The Case

10 minutes

Student pages

Activity done individually in class or as homework prior to class

Investigate and Explain

10 minutes

Student pages

Activity done individually or in pairs

Activity

180 minutes (2–3 class periods)

Student pages, 8.5 x 11 in. paper to create wanted posters (individual or group)

Activity done individually or in pairs

Apply and Analyze

10–15 minutes

Student pages, internet access

Individual activity

Design Challenge

60–120 minutes

Student pages, internet access

Small-group activity

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

271

13 Vocabulary • denature

• extremophiles

• DNA fingerprinting

• optimum

• DNA polymerase

• polymerase chain reaction (PCR)

• enzymes

• proteins

• exponential

• Taq polymerase

Extension This lesson can be followed up with a lab experiment using PCR. You can find an online PCR lab from the University of Utah: http://learn.genetics.utah.edu/content/ labs/pcr.

Assessment Use the Teacher Answer Key to check the answers to section questions. To assess the Design Challenge, you can evaluate the students’ video proposals. Student video proposals should be well researched. They should describe an extreme environment and the current engineering problems they hope to address. The proposals should explain how students would go about researching extremophiles to determine whether their adaptations could be used to solve the chosen problem.

Teacher Answer Key Recognize, Recall, and Reflect 1. Why did scientists believe organisms could not live in near-boiling temperatures? No one had ever found anything living in that type of habitat, and they believed it would denature the proteins in organisms. 2. What is the purpose of a polymerase chain reaction? To make multiple copies of DNA pieces. 3. How was Taq polymerase able to improve the PCR? Why? It was able to reduce the cost and time to complete PCR because Taq polymerase was not destroyed by the high temperatures needed to release the DNA molecules.

272

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

IN HOT WATER

| The Discovery of Taq Polymerase TEACHER NOTES

13

Investigate and Explain 1. PCR involves high temperatures above 95°C (203°F). Which of the bacteria listed in Figure 13.3 would most likely be able to survive the high temperatures? Bacillus coagulans, Bacillus circulans, and Thermus aquaticus 2. PCR also needs to occur quickly. Which of the bacteria included in Figure 13.3 would have the shortest time to grow a new generation of bacteria? Bacillus stearothermophilus 3. If you were going to choose a new type of bacteria to use for PCR based on your scatter plot, which would you select and why? Your answer should include specific numbers from the scatter plot. Students’ answers may vary but should include specific numbers from the graph below.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

273

13 Activity Questions 1. What was Dr. Brock initially studying at Yellowstone? Why was this important? He was studying the temperatures at which photosynthesis can take place. His studies showed that there was an upper limit for the temperature at which photosynthesis can take place but that life can survive above that limit. 2. In addition to Yellowstone, where was Thermus aquaticus found? Other hot springs, hot tap water, a hot-water system at Indiana University 3. What method did Dr. Brock use to search for bacteria in hot springs where there were no visible bacteria growing? He tied slides to a string and left them in the pool. He later retrieved them to see what was growing on the slides.

Apply and Analyze 1. What types of discoveries have been made from Yellowstone research? Some discoveries include that enzymes that can increase efficiency in manufacturing, decrease the use of toxic chemicals, and even improve biofuels or heat tolerant crops. 2. What is “benefits-sharing”? Do you believe the park should receive benefits-sharing for discoveries made there? Why or why not? Benefits-sharing is an agreement between researchers, their institutions, and the National Park Service that returns benefits to the parks when results of research have potential for commercial development. Students may vary on their beliefs about benefits-sharing. Those who support benefits-sharing might say that it can help support the park’s mission and provide the resources needed to run programs. Those who do not support benefits-sharing might say that it would create economic incentives for the park to engage in practices that could harm the ecosystem (meaning, there is no cost better than preservation).

274

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

IN HOT WATER

| The Discovery of Taq Polymerase TEACHER NOTES

13

Resources and References Abishek, M. P., J. Patel, and A.P. Rajan. 2014. Algae Oil: A sustainable renewable fuel of future. Biotechnology Research International 272814. http://dx.doi.org/10.1155/2014/272814. Arney, K. 2015. Taq polymerase. Chemistry World. www.chemistryworld.com/podcasts/taqpolymerase/9266.article. Brock, T. D. 1997. The value of basic research: Discovery of Thermus aquaticus and other extreme thermophiles. Genetics 146 (4): 1207–1210. Genetic Science Learning Center. 2018. PCR. Learn.Genetics. https://learn.genetics.utah.edu/ content/labs/pcr. Hlodan, O. 2010. Evolution in extreme environments. BioScience 60 (6): 414–418. National Geographic Resource Library. Adaptation. National Geographic Society. www. nationalgeographic.org/encyclopedia/adaptation. National Oceanic and Atmospheric Administration (NOAA). What is an extremophile? NOAA. https://oceanservice.noaa.gov/facts/extremophile.html. National Park Service (NPS). Bioprospecting. www.nps.gov/yell/learn/nature/bioprospecting. htm. Porterfield, A. 2009. The Taq behind PCR. Bitesize Bio. https://bitesizebio.com/1953/the-taqbehind-pcr. Wikipedia. Extremophile. https://en.wikipedia.org/wiki/Extremophile.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

275

Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

COWS AND MILKMAIDS

14

The Discovery of Vaccines

A Case Study Using the Discovery Engineering Process Introduction Smallpox is a viral disease that has for centuries caused many deaths. There is even evidence that smallpox affected ancient Egypt—scientists found Egyptian mummies with disfigurements, possibly due to the disease. Smallpox is thought to have developed around 10,000 BC in Africa, and later spread to Europe. It was brought to the Americas by Spanish and Portuguese explorers, where it killed many Native Americans. Like the other viruses in Poxviridae family, smallpox has symptoms like a cold (fever, headaches, fatigue, and muscle pain), but these are followed by a rash and sores. These rashes and sores appear all over the skin, including inside the mouth, nose, and throat. Smallpox was often lethal, and those who survived were often covered with scars from the rash. Some smallpox-infected people went blind or lost parts of their lips, noses, or ears. Around the turn of the 19th century, a smallpox vaccine was discovered. Later, scientists and doctors around the world collaborated and launched campaigns to vaccinate all people against the disease (Figure 14.1, p. 278), eventually leading to its eradication (or elimination).

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

277

14 Lesson Objectives By the end of this case study, you will be able to

FIGURE 14.1 Smallpox Vaccine Poster From 1941

• explain how vaccines were discovered; • describe how vaccines can protect against disease; and • develop a research proposal to create a new vaccine to combat a specific disease.

The Case Read this account about Edward Jenner and the discovery of vaccines. Once you have finished reading, answer the questions that follow. The cow saves the day! With help from cows and milkmaids, we now have vaccines that prevent many diseases and save millions of lives. It all started with an observation by a country doctor, Edward Jenner. Dr. Jenner lived in Gloucestershire, England. In 1796, Jenner noticed that milkmaids who had gotten cowpox (a disease like smallpox, mostly affecting cows) did not seem to catch smallpox. He wondered if there was something about being sick with cowpox that protected these women from getting smallpox. Cowpox is a much milder disease and tended not to affect the milkmaids much at all. Smallpox on the other hand was an often-fatal disease. Dr. Jenner decided to test his idea out by infecting a young boy with cowpox. He scraped fluid from the blister of a milkmaid named Sarah Nelms, who had gotten cowpox from a cow named Blossom. Dr. Jenner then scratched the arm of eight-year-old James Phipps and added Sarah’s cowpox fluid to the boy’s scratch (Figure 14.2). James developed a mild fever, but he recovered quickly. Two months later, Dr. Jenner scratched James again but this time infected him with smallpox. Amazingly, the boy did not develop the smallpox disease. Today, we know that the immune system of the infected person “learns” to recognize the infection and fights off the disease by developing antibodies, and therefore immunity, to the infection. The antibodies produced for one virus can also be effective at fighting off similar viruses, as was the case with cowpox and smallpox. Dr. Jenner went on to inoculate many children with cowpox and found the protection from smallpox continued. This procedure of inoculating people with

278

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

COWS AND MILKMAIDS

| The Discovery of Vaccines

14

FIGURE 14.2 Dr. Jenner Inoculating James Phipps With Cowpox

a vaccine to prevent infection is now known as vaccination or immunization. Dr. Jenner is thought to be the first person to scientifically control an infectious disease with vaccination. Throughout the years, more and more people have been vaccinated for smallpox. From this work, the World Health Assembly declared that the world was free of smallpox in 1980. The type of vaccination that Dr. Jenner used is known as a live-attenuated vaccine. Many current viruses such as measles and mumps are treated similarly. To create these vaccines, scientists first infect an organism (a live animal or an egg) with the virus they wish to protect people against. Then, the virus becomes weakened over time. The virus is still active but cannot cause disease. These weakened forms of the virus are then used in the vaccine. When injected into humans, the weakened virus is attacked by the immune system, which can develop an immunity to the virus in its weakened state. A vaccinated person’s body “remembers” the virus and attacks it, which protects the person from getting sick if he or she contracts the virus in the future. The live-attenuated vaccine is just one way to develop a vaccine. Also, vaccinations not only work in people but also in dogs, cats, and many other animals. That simple observation that Dr. Jenner made among the cows and milkmaids has contributed to the development of modern vaccines, saving millions of lives.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

279

14 Recognize, Recall, and Reflect 1. How are smallpox and cowpox symptoms different and similar? 2. Why did Dr. Jenner think cowpox might protect someone from getting smallpox? 3. How might getting one disease (like cowpox) help prevent you from getting a similar disease (like smallpox) in the future?

Investigate and Explain Review various disease-causing viruses and the availability of a vaccine (Table 14.1). After examining the data, answer the questions that follow. 1. According to Table 14.1, which viral diseases do not have a vaccine to help prevent their spread? 2. Why do you think people can get the flu even if they have had a flu vaccine? 3. Which of these diseases is the most serious disease? Explain your answer.

TABLE 14.1 Diseases, Viruses, and Vaccines Disease

280

Virus

Symptoms

Vaccine Available?

Shingles and chickenpox

Varicella-zoster virus

Chickenpox: blisters, fatigue, and high fever; shingles: painful blisters along one side of the body or face

Yes

Cold sores

Herpes simplex virus 1

Blistering sores

No

Gastrointestinal illness (stomach flu)

Norovirus

Vomiting and diarrhea

No

Genital warts and cervical cancer

Human papillomavirus (HPV)

Genital warts and cervical cancer

Yes

Acquired immunodeficiency syndrome (AIDS)

Human immunodeficiency virus (HIV)

Impaired immune system

No, but vaccine is under development

Flu

Influenza viruses (various types and subtypes)

Fever, sore throat, fatigue

Yes

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

COWS AND MILKMAIDS

| The Discovery of Vaccines

14

Activity Imagine that you work as a public health analyst at the Centers for Disease Control and Prevention (CDC) in Atlanta, Georgia. Your job is to determine which vaccines should be developed in the next five years to address the disease challenges of the near future. First, you will research and take notes on various diseases for which you may wish to develop a vaccine. Second, you will rank the necessity of vaccine development on a scale from 1 (most important) to 5 (least important). Then you will review your findings with others in a group. Last, you will agree as a group, or come to a consensus, prioritizing a list of diseases that need a vaccine developed. After completing the activity in each part, answer the questions that follow.

Part I Review this resource from the CDC: www.cdc.gov/diseasesconditions/index.html. Then, select five diseases for which you believe a vaccine needs to be developed (or improved upon). Record information on your diseases in the Diseases and Vaccines Chart.

Diseases and Vaccines Chart How Serious Is This Disease?

Disease

Virus

(Symptoms, type of people affected, number of people affected, etc.)

Is There a Current Vaccine Available? (If yes, are there improvements that could make the vaccine more effective?)

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

281

14 Now, rank these diseases in order from 1 (most important to find a vaccine) to 5 (least important to find a vaccine). Make sure to rely on your notes from your background research to make your assessment. Individual Ranking of Diseases to Research for a Vaccine: 1st (Most Important)

__________________________________

2nd

__________________________________

3rd

__________________________________

4th

__________________________________

5th (Least Important)

__________________________________

ACTIVITY QUESTIONS, PART I 1. Is there a pattern that explains why some diseases have vaccines and others do not? 2. What criteria did you use to decide which disease to choose for a new vaccine? 3. Why are many of the diseases without vaccines found in areas outside of the United States?

Part II Get into a group of three to four students. Each of you should have your list of five diseases. Your group will discuss the diseases and come to a consensus on a ranking of their importance in terms of vaccine development. There are many ways to reach a consensus. However, each way builds on the principles that (1) everyone has a chance to speak and assert their case using facts, and (2) the process is repeated until a plan is developed that everyone can “live with.” This means that you consent to using the final ranking created by the group even if the ranking does not reflect your original or final preferences. Steps to Reach Consensus: 1. Discussion. Discuss with your group the purpose of coming to consensus on this topic. 2. Proposal. Go around the group and share rankings. 3. Check for Consensus. Compare the diseases you selected and your rankings. a. Are there diseases that you all agree need research for a vaccine? b. Is there a ranking (1–5) that you agree on for diseases most in need of research for a vaccine?

282

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

COWS AND MILKMAIDS

| The Discovery of Vaccines

14

4. If there is not consensus in the group on diseases, share your thoughts on which diseases should be ranked, using data you collected. a. Take a group vote on which five diseases to research for a vaccine. b. Remember, you can consent and not agree. c. Modify your proposal until you reach consensus for the diseases. 5. Once you have reached consensus in the group on five diseases, consider their rank, by making a case for a specific disease at a specific rank (1–5). a. Take a group vote to rank your diseases to research for a vaccine. b. Remember, you can consent and not agree. c. Modify your proposal until you reach consensus for the ranking. d. Record your group’s final ranking. Group Ranking of Diseases to Research for a Vaccine: 1st (Most Important) _______________________________ 2nd

_______________________________

3rd

_______________________________

4th

_______________________________

5th (Least Important) _______________________________

ACTIVITY QUESTIONS, PART II 1. What were some of the challenges of reaching consensus in this activity? 2. What were some of the benefits of reaching consensus in this activity?

Apply and Analyze One of the challenges of disease control and spread is getting people to voluntarily choose to vaccinate themselves and their families. There are always safety concerns about vaccines, and yet history has shown that vaccines can prevent deaths and severe illnesses. Examine this simulation from the University of Pittsburgh to model happens when people opt out of getting a vaccine: https://fred.public health.pitt.edu/measles. This scenario is built on an artificial population that represents your home area and reflects the household and demographic characteristics of the area where you live. The simulation starts with the infection of a single (unvaccinated) child that

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

283

14 contracts measles. As people interact and move around town, the disease spreads to homes, neighborhoods, schools, and workplaces. This is represented in the simulation as red dots that appear when people become infected with measles. Blue dots represent people who have recovered from the disease. Examine what could happen in your state (and city) if 80% of children 6 months to 15 years of age have been immunized against measles and if 95% of these children have been immunized. Run the simulations several times. Observe both red (infected persons) and blue (recovered persons). After the simulation finishes, answer the questions that follow. 1. After 238 days in both scenarios (one in which 80% of children are immunized and the other in which 95% of children are immunized), report on the outbreaks, answering the four following questions. Where did the outbreak (red dots) occur? How did the infection spread? (Randomly, through roads, urban areas?) How many people recovered (blue dots)? From your estimation, how many people (red and blue dots) contracted measles in total? (Remember, you don’t have to count each and every dot. Just estimate.) 2. How did 80% vaccination coverage compare to 95% vaccination coverage? Do you think people should be required to be vaccinated? Why or why not?

Design Challenge The case study in this lesson illustrates how a scientific observation led to a solution to a problem. Observations and discoveries often spark ideas for innovations. This is especially true in the field of engineering. Engineering is the  application of scientific  understanding through creativity, imagination, and the designing and  building of new materials to address and solve problems in the real world. You will be asked to take what you have learned in this case and design a process or product to address a real-world issue. Engineers use the engineering design process (Figure 14.3) as steps to address a real-world problem. In this case, you are asking questions (Step  1) about diseases that need vaccines. Using the information you have gathered in Part I of the Activity section (p. 281), you will choose a specific viral disease that you believe needs a vaccine and brainstorm (Step  2) a vaccination process. You will make a plan (Step 3) for the development of the vaccine. Then, you will create (Step 4) a

284

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

COWS AND MILKMAIDS

| The Discovery of Vaccines

14

FIGURE 14.3 The Engineering Design Process

1 Ask Questions and Define the Problem 6

2

Revise and Improve

Brainstorm and Imagine

3 5

The Engineering Design Process

3

Test and Evaluate

Plan 4 Design and Create

pamphlet about how the vaccine works. Finally, you will come up with a way to test (Step 5) the vaccine and consider making improvements (Step 6) to your plan.

1. Ask Questions Ask questions about diseases and vaccines. For instance, what diseases need a vaccine? How can new vaccine-development processes create new and improved vaccines? How can we encourage people to get vaccinated? Using the information you gathered from Part I of the Activity section (and additional research if needed), choose one disease in need of a vaccine that you will focus on.

2. Brainstorm and Imagine Dr. Jenner used a live-attenuated virus to create a vaccine for smallpox. This is only one of several ways to develop a new vaccine for a disease-causing virus. A summary of different types of vaccination can be found here: www.vaccines.gov/basics/ types. Each is used to attack a different part of the virus. Figure 14.4 (p. 286) shows one type of virus structure. Now research the structure of the virus that causes the

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

285

14 FIGURE 14.4 Parts of a Virus

Note: Viruses can come in different shapes, but they all have a protein shell that covers either DNA or RNA.

disease you chose. Brainstorm how different methods might be used to attack this virus. As an example, look at Figure  14.5, which illustrates the various ways to attack HIV. Think creatively about the parts of your virus and how you might use the vaccine to attack different viral components. Use the Developing a New Vaccine graphic organizer (p. 288) for guidance.

FIGURE 14.5 Various Approaches for HIV Vaccine Development

3. Create a Plan Pick an approach from the Developing a New Vaccine graphic organizer that you think will be highly effective. You should be able to explain how this method works and why you chose it. Create a plan for how and when you would administer the vaccine. Also think about how you would market it.

286

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

COWS AND MILKMAIDS

| The Discovery of Vaccines

14

4. Design and Create Create a pamphlet on your vaccine. You can also include images and graphics. Make sure to be culturally sensitive in your recommendations for getting people vaccinated. Your pamphlet should include the following information: • What disease does your vaccine prevent? • How does the vaccine work (against the virus)? • When and where should people get vaccinated? • Provide details in a Frequently Asked Questions section, or FAQ: How is the vaccine delivered (e.g., through a shot, through nasal spray)? Are there any restrictions for who can take the vaccine (e.g., people with certain allergic reactions)? What are the concerns (if any) that people may have about getting the vaccine? What could happen if people are not vaccinated? Anything else someone should know?

5. Test and Evaluate Think about how you would test the safety and efficacy of your vaccine. Consider these questions: • Phase 1—What would you do for laboratory testing? • Phase 2—What would you do for animal-based testing? • Phase 3—What would you do for clinical trials? • Surveillance—What would you do to ensure ongoing evaluation of the vaccine on the market? Add this information to your Evaluation Plan graphic organizer (p. 289), and then attach the organizer to your pamphlet.

6. Revise and Improve Present or give your pamphlet and plans to one or more of your peers for review. Listen to their feedback and take some time to revise and make improvements. What are some ways you can use their input to refine your plan? You may choose to accept all or only some of the feedback. Be sure to justify your reasons for using or not taking suggestions.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

287

14 Developing a New Vaccine Use this graphic organizer to brainstorm different approaches for attacking the disease-causing virus you chose. Not all approaches might work. Fill in the information for as many approaches as you can.

How it would attack the

How it would attack the virus:

virus:

288

Drawing of Chosen Virus

Live-Attenuated Vaccine

Subunit, Recombinant, Polysaccharide, and Conjugate Vaccines

How it would attack the

How it would attack the

virus:

virus:

Inactivated Vaccine

Toxoid Vaccine

How it would attack the

How it would attack the

virus:

virus:

Recombinant Vector Vaccine

DNA Vaccine

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

COWS AND MILKMAIDS

| The Discovery of Vaccines

14

Evaluation Plan

Step #1:

_____________________________________________________________________

Step #2:

_____________________________________________________________________

Step #3:

_____________________________________________________________________

Step #4:

_____________________________________________________________________

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

289

14 TEACHER NOTES

COWS AND MILKMAIDS THE DISCOVERY OF VACCINES

A Case Study Using the Discovery Engineering Process

Lesson Overview In this lesson, students read about Dr. Edward Jenner’s use of cowpox to vaccinate people against smallpox. Students have a chance to review different viral diseases and determine what vaccines are available to combat them. Students use that information to research and identify common viral diseases. Then they discuss which of these need vaccine development. Students simulate an outbreak of measles and examine the impact of high versus low vaccination rates on the spread of this infectious disease. Finally, students select one disease and consider the steps that are needed to develop, test, and/or improve a vaccine.

Lesson Objectives By the end of this case study, students will be able to • explain how vaccines were discovered; • describe how vaccines can protect against disease; and • develop a research proposal to create a new vaccine to combat a specific disease.

Use of the Case Due to the nature of these case studies, teachers may elect to use any section of each case for their instructional needs. They are sequenced in order (scaffolded) so students think more deeply about the science involved in the case and develop an understanding of engineering in the context of science.

Curriculum Connections Lesson Integration This lesson may be taught during a unit on viruses or disease for beginner biology courses. It also fits well into a lesson on how public health officials make decisions on disease prevention issues.

290

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

COWS AND MILKMAIDS

| The Discovery of Vaccines TEACHER NOTES

14

Related Next Generation Science Standards PERFORMANCE EXPECTATIONS • MS-LS1-5. Construct a scientific explanation based on evidence for how environmental and genetic factors influence the growth of organisms. • MS-LS2-4. Construct an argument supported by empirical evidence that changes to physical or biological components of an ecosystem affect populations. • HS-LS1-1. Construct an explanation based on evidence for how the structure of DNA determines the structure of proteins which carry out the essential functions of life through systems of specialized cells. • HS-ETS1-3. Evaluate a solution to a complex real-world problem based on prioritized criteria and trade-offs that account for a range of constraints, including cost, safety, reliability, and aesthetics, as well as possible social, cultural, and environmental impacts.

SCIENCE AND ENGINEERING PRACTICES • Asking Questions and Defining Problems • Developing and Using Models • Planning and Carrying out Investigations • Analyzing and Interpreting Data • Constructing Explanations and Designing Solutions • Engaging in Argument From Evidence

CROSSCUTTING CONCEPTS • Scale, Proportion, and Quantity • Systems and System Modeling • Structure and Function

Related National Academy of Engineering Grand Challenges • Engineer Better Medicines • Advance Health Informatics • Engineer the Tools of Scientific Discovery

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

291

14 Lesson Preparation Before starting the lesson, it is helpful for students to have some understanding of virus structures and the general differences between viruses and bacteria. You may wish to review the different morphologies of viruses and the mechanisms by which viruses are spread so students can understand the ongoing process of vaccine development. You will need to make copies of the entire student section for the class. Students will need internet access at various points in the lesson. Alternatively, you can project videos or print and distribute copies of online content for the class. To save time in the Activity section, copy and distribute a filled-out version of the Diseases and Vaccines Chart (pp. 295–296) to students. Then, students can review the list of diseases and select one that needs a vaccine. Look at the Teaching Organizer (Table 14.2) for suggestions on how to organize the lesson.

Time Needed Up to 135 minutes

TABLE 14.2 Teaching Organizer Section

292

Time Suggested

Materials Needed

Additional Considerations

The Case

10 minutes

Student pages

Activity done individually in class or as homework prior to class

Investigate and Explain

30 minutes

Student pages

Activity done individually or in pairs

Activity

30 minutes

Student pages, internet access

Activity done individually or in pairs

Apply and Analyze

20 minutes

Student pages, internet access

Individual activity

Design Challenge

30–45 minutes

Student pages, internet access

Small-group activity

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

COWS AND MILKMAIDS

| The Discovery of Vaccines TEACHER NOTES

14

Vocabulary • antibodies

• immunity

• consensus

• immunization

• cowpox

• lethal

• eradicated

• live-attenuated

• fatal

• smallpox

• immune system

Extension This lesson can be used to launch a discussion about increased government control versus less government control in regard to issues of public health.

Assessment Use the Teacher Answer Key to check the answers to section questions. To assess the Design Challenge, you can evaluate the pamphlets students made for their vaccines. In the pamphlets, students should describe the disease that their vaccine is supposed to prevent as well as how the vaccine works. They should include the method in which the vaccine is delivered (e.g., through a shot, through nasal spray). Students should also be able to list any restrictions for who can take their vaccines. They should explain when and where people should get vaccinated. Finally, they should detail any concerns that people may have about getting the vaccine and what could happen if people are not vaccinated.

Teacher Answer Key Recognize, Recall, and Reflect 1. How are smallpox and cowpox symptoms different and similar? Smallpox is more severe than cowpox. With smallpox, people get serious scars and fever. The disease can result in the loss of tissue from the mouth, nose, or ears. By contrast, the symptoms of cowpox are mild. 2. Why did Dr. Jenner think cowpox might protect someone from getting smallpox? Dr. Jenner noticed that milkmaids who had cowpox did not seem to catch smallpox.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

293

14 3. How might getting one disease (like cowpox) help prevent you from getting a similar disease (like smallpox) in the future? Some viruses are similar in structure. So antibodies that are produced to fight against one virus also recognize and fight off the similar virus.

Investigate and Explain 1. According to Table 14.1, which viral diseases do not have a vaccine to help prevent their spread? Flu, AIDS, cold sores 2. Why do you think people can get the flu even if they have had a flu vaccine? Flu viruses come in many variations and mutate rapidly. (Students may not infer this from the chart but may encounter this information in their research.) 3. Which of these diseases is the most serious disease? Explain your answer. Students’ answers may vary. But they should discuss diseases that have no vaccines (HIV/AIDS) or only seasonal vaccines (flu).

Activity Questions, Part I 1. Is there a pattern that explains why some diseases have vaccines and others do not? Students’ answers may vary. But they might note that many of the diseases without a vaccine also have insect vectors. 2. What criteria did you use to decide which disease to choose for a new vaccine? Students’ answers may vary. But their criteria could have been based on the severity of the diseases’ symptoms, the amount of people the diseases affected, or whether diseases disproportionately affected certain populations. 3. Why are many of the diseases without vaccines found in areas outside of the United States? Students’ answers may vary. But they could mention that the United States has substantial resources to support the development and distribution of vaccines. Not all countries have these resources.

294

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

COWS AND MILKMAIDS

| The Discovery of Vaccines TEACHER NOTES

14

Diseases and Vaccines Chart Students’ individual rankings (1–5) should include researched viruses in their chart.

How Serious Is This Disease? Disease

Virus

(Symptoms, type of people affected, number of people affected, etc.)

Is There a Current Vaccine Available? (If yes, are there improvements to be made for it to be more effective?)

Zika

Flavivirus

Fever, rash, muscle and joint pain, headache. Most negatively affects pregnant women and their unborn babies as it can cause severe birth defects. Zika is often found in Africa, Southeast Asia, and the Pacific Islands.

No

Measles

Morbillivirus

Fever, rash, runny nose, cough. Measles are found in many developing countries around the world.

Yes; improvement suggestions will vary

Yellow fever

Flavivirus

Fever, chills, loss of appetite, nausea. Can be lethal to unvaccinated young children. Yellow fever is typically found in subtropical areas of Africa and South America.

Yes; improvement suggestions will vary

Mumps

Rubulavirus

Fever, swelling of salivary glands, muscle pain. Affects adults more than children. Mumps affects people around the world.

Yes; improvement suggestions will vary

Rabies

Rabies

Fever, fear of water, confusion, coma. Affects individuals who come into contact with rabid animals. Almost always lethal. Rabies is commonly found in Asia, Africa, and Central and South America.

Yes; improvement suggestions will vary

Cold

Adenoassociated virus

Coughing, sore throat, runny nose. Affects the very young and the very old more than children and young adults. Colds are found in people all over the globe.

No

Rift Valley fever

Phlebovirus

Fever, muscle pains, headaches. Affects people who live and work with domesticated livestock. Rift Valley fever is found in sub-Saharan Africa, Yemen, and Saudi Arabia.

Under development

(Continued)

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

295

14 Diseases and Vaccines Chart (continued)

How Serious Is This Disease? Disease

(Symptoms, type of people affected, number of people affected, etc.)

Virus

Is There a Current Vaccine Available? (If yes, are there improvements to be made for it to be more effective?)

Pneumonia (viral)

Influenza virus, rhinovirus, coronavirus, adenovirus, parainfluenza

Chest pain, fever, trouble breathing. Affects the elderly and those who are in poor health worldwide.

Yes (influenza)

Hepatitis B

HBV (hepatitis B virus)

Vomiting, yellow skin, tiredness, dark urine. Affects those with suppressed immune systems throughout the world.

Yes

Dengue fever

DENV (dengue virus)

High fever, headache, muscle and joint pain, vomiting. Affects those in Asia and the Caribbean who come into contact with infected mosquitoes.

Under development

West Nile virus

Flavivirus

Fever, vomiting, rash, headache.

No

Yes (for bacterial pneumonia) (Note: This investigation focuses on viral diseases, but students may be aware of bacterial pneumonia and should know there is a vaccine.)

West Nile virus affects people in Europe, Africa, Asia, Australia, and North America.

Activity Questions, Part II 1. What were some of the challenges of reaching consensus in this activity? Students’ answers may vary. But they could mention the challenge of addressing disagreements among the group as to what was the most significant disease. Students may also report that some arguments were based on opinions or value judgements instead of facts. 2. What were some of the benefits of reaching consensus in this activity? Students’ answers may vary. But they could discuss how reaching consensus allows multiple people to make a decision rather than relegating decision-making power to one person. Students may also mention that the process of coming to a consensus allows people to share information and different viewpoints on an issue.

296

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

COWS AND MILKMAIDS

| The Discovery of Vaccines TEACHER NOTES

14

Apply and Analyze 1. After 238 days in both scenarios (one in which 80% of children are immunized and the other in which 95% of children are immunized), report on the outbreaks, answering the four following questions. •

Where did the outbreak (red dots) occur?

•

How did the infection spread? (Randomly, through roads, urban areas?)

•

How many people recovered (blue dots)?

•

From your estimation, how many people (red and blue dots) contracted measles in total? (Remember, you don’t have to count each and every dot. Just estimate.)

Students’ answers for each bulleted question will vary because the simulator allows for students to select states and cities of their choice. 2. How did 80% vaccination coverage compare to 95% vaccination coverage? Students’ answers may vary, but they should report how fewer vaccinations resulted in a larger, more expansive outbreak. 3. Do you think people should be required to be vaccinated? Why or why not? Students’ answers may vary. However, they should be able to back up their ideas with evidence.

Resources and References Allen, A., and M. Fitzpatrick. 2007. Vaccine: The controversial story of medicine’s greatest lifesaver. Journal of the Royal Society of Medicine 100 (5): 241–241. British Broadcasting Company (BBC). 2013. How does the body fight off a virus? www.bbc. co.uk/science/0/22028517. Centers for Disease Control and Prevention (CDC). Diseases and conditions. www.cdc.gov/ diseasesconditions/index.html. Centers for Disease Control and Prevention (CDC). Vaccine types. www.vaccines.gov/basics/ types. The Editors of Scientific American. 2019. The U.S. needs to tighten vaccination mandates ScientificAmerican.com. www.scientificamerican.com/article/the-u-s-needs-to-tightenvaccination-mandates1. Plotkin, S. 2014. The history of vaccination. Proceedings of the National Academy of Sciences of the USA 111 (34): 12283–12287. Public Health Dynamics Laboratory. FRED U.S. measles simulator. University of Pittsburgh. https://fred.publichealth.pitt.edu/measles.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

297

Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

2X OR NOT 2X “Y” Should Mixed-Sex Test Subjects Be Used in Medical Research?

15

A Case Study Using the Discovery Engineering Process Introduction There are more than 200 different types of human genetic disorders (sometimes called diseases). These are health conditions caused by abnormalities in chromosomes (e.g., extra chromosomes or missing or damaged chromosomes) or changes to DNA in genes (deletion, repeats, or single modifications [point mutations]). Reaching a better understanding of genetic disorders and treatment requires study of individuals with the disorder of interest. However, doing this research on humans is unethical, and models are used instead. Initial models are often in vitro, which is the study of cells in glass test tubes. But as the research advances, scientists need an in vivo model, or a living animal model. In animal models, you can breed the disorder into a model organism and watch how the disorder progresses over time and between generations. Because humans share similar anatomy (the same organs and organ systems) and genes (99% similarity) with mice, they make an ideal animal model. In most preclinical research (done prior to using human subjects), only singlesex (male) mice models are used to study human genetic disorders. Only recently has the National Institutes of Health (NIH) recommended use of both male and female animal models, but this practice is uncommon. Some scientists contend that lack of female representation in research studies is not providing a full picture of the differences men and women experience with the same genetic disorder.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

299

15 Lesson Objectives By the end of this case study, you will be able to • describe the importance of using mixed-sex animals in studying genetic disorders; • explain sex differences in sex-linked genetic disorders using pedigree analysis; and • design assistive technology to help people with a specific genetic disorder with consideration for differences in men and women.

The Case Read the story of one graduate student’s accidental discovery while conducting research on multiple sclerosis (MS). Once you are finished reading, answer the questions that follow. Multiple sclerosis is an autoimmune disease that affects the brain and spinal cord. People who suffer from MS can exhibit mild to severe neurological issues, in addition to fatigue and weakness (Figure 15.1). This is largely caused by damage to the coating around nerve fibers (myelin) that disrupts the transmission of nerve signals throughout the body. Scientists think the disorder is triggered by some unknown environmental factor within individuals who are genetically predisposed to MS. Most people diagnosed with MS are between the ages of 20 and 50. Women are three times as likely to develop MS compared to men. In 2017, Dr. Melissa Brown was studying multiple sclerosis in a research laboratory at Northwestern University’s Feinberg School of Medicine. Because women are much more likely to develop the disorder, Dr. Brown and her team were using a single-sex (female) mouse model for their research. As with humans, female mice are more susceptible to MS than males. Past studies had shown that wild-type female mice induced with MS almost always got sick, whereas wild-type males rarely got

300

FIGURE 15.1 Main Symptoms of Multiple Sclerosis

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

2X OR NOT 2X

| “Y” Should Mixed-Sex Test Subjects Be Used in Medical Research?

15

the disorder. (The term wild type refers to animals whose genetic profile is common among natural populations.) As part of their research, Dr. Brown’s team conducted one experiment that called for breeding mice with a unique mutation (c-kit). This would produce mice that could not make a certain type of immune cell (type 2 innate lymphoid cells). The research group wanted to understand how missing this cell would affect the health of their female mice test subjects. To begin the experiment, a graduate student went to get mice bred for the c-kit knockout. (A knockout refers to an animal that is specifically missing a gene of interest; see Figure 15.2, p. 302.) In selecting the mouse models for this study, the student had intended to only bring female mice back to the lab. However, she accidentally selected males from the litter as well. After conducting the experiment, the researchers realized something strange: Both females and males became sick with MS. This result was surprising because males normally didn’t get the disease. They repeated (or reproduced) the experiment, again with male mice, and found the same result. Without the immune cells, male mice became ill with MS. Because male mice without innate lymphoid cells became sick, scientists determined that these cells were what shielded them from MS. Further studies showed that innate lymphoid cells activate in males to provide protection. Wild-type female mice have the same cells, but they do not activate to protect them from MS. Now, the researchers are exploring how these cells activate in males differently than in females. This information may be valuable in developing therapies for women with MS. Using mixed-sex models may also help provide a deeper understanding of other disorders that disproportionately affect women, like rheumatoid arthritis and lupus.

Recognize, Recall, and Reflect 1. What is multiple sclerosis, or MS? What is believed to cause MS? 2. Why were female mice models mostly used in MS research? 3. What did scientists find out when they used the male c-kit knockout mice? How was this different than when they used wild-type male mice in previous MS research studies?

Investigate and Explain In 1993, the NIH mandated that women must be included in all human clinical trials. Yet, there is little preclinical research using female (or mixed-sex) animal models. Even studies of using both sexes of animal models have failed to analyze their results by sex and potential sex differences. Examine the following graphs. They come from a review of the research literature exploring the distribution of studies that used male, female, and mixed-sex

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

301

15 models by scientific field in 2009. Figure 15.2a shows the percent of articles describing nonhuman animal research that used male subjects, female subjects, both male and female subjects, or did not specify. Figure 15.2b shows the percent of articles describing human research in the same categories. After examining the data, answer the questions that follow.

FIGURE 15.2 Distribution of Studies Using Male, Female, and Mixed-Sex Models (a) Percentage of Journal Articles on Studies Using Animals as Models in Various Science Journals

(b) Percentage of Journal Articles on Studies Using Humans as Models in Various Science Journals

Source: Beery and Zucker (2011).

302

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

2X OR NOT 2X

| “Y” Should Mixed-Sex Test Subjects Be Used in Medical Research?

15

1. In which category (scientific discipline) for animal studies (Figure 15.2a) were female models preferred to male models? Why do you think that is? 2. In which categories (scientific disciplines) for human studies (Figure 15.2b) were only female models excluded? Why do you think that is? 3. The NIH mandates that human studies employ both sexes. Based on the case and these graphs, what argument can you make for animal studies to have a similar mixed-sex model policy?

Activity Imagine that you work as a genetics counselor who interprets the results of genetic testing for families and individuals. You know the following: • Of your 46 total chromosomes, 44 are autosomes and last two are the sex chromosomes. • Females are homozygous for X chromosomes (XX). • Males are heterozygous for the X chromosome (XY). • If a disorder is carried on the autosomes, it has autosomal inheritance. • If a disorder is carried on the X or Y sex chromosome, it has sex-linked inheritance. That means it may affect males (who only have one copy of an X chromosome) and females (with two X chromosomes) differently. Females tend to carry the gene (trait) and pass the gene to their sons. Females receive the gene (trait) from an affected father or carrier/affected mother. Affected males receive the gene from their mother and pass it to their daughters to carry. • Some disorders need only one copy of a the abnormal or nonfunctional gene to be expressed (dominant); others need both bad copies to be expressed, and thus could be carried by a carrier to the next generation (recessive). Your job is to assess whether a disorder is carried on the autosomes (autosomal) or the sex chromosomes (sex-linked) and whether the disorder is dominant or recessive. To determine this, you conduct pedigree analyses using a pedigree chart. (See Figure  15.3, p.  304.) By assigning genotypes to phenotypes, you are able to determine the genetic inheritance patterns of a disorder through many generations. You will now conduct an investigation in two parts: First, you will assess the inheritance of a sex-linked disorder (hemophilia) through a royal family’s pedigree, and

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

303

15 then you will determine the probability of inheritance for other disorders (autosomal/sex-linked and dominant/recessive). How to Read a Pedigree: Shapes: Squares are males (XY). Circles are females (XX).

FIGURE 15.3 Pedigree Chart

Lines: A diagonal line means deceased. Horizontal lines connect couples. Vertical lines connect parents to children. Filling: Shading means the individual has the trait. Half shading or a dot means they carry the gene; individual is called a carrier. No shading means the individual does not have the trait.

Key Male

Affected male

Deceased male

Female

Affected female

Deceased female

Identifying Individuals: Roman numerals show generations from top to bottom (I, II, III, IV, etc.). Numbers assign an individual to a birth order; they are paired with roman numerals showing the individual’s generation and birth order from left to right (I.2, III.6, etc.). How to Interpret a Pedigree: 1. Determine if the trait is dominant or recessive. a. If it affects individuals every other generation, it is most likely recessive. b. If it affects individuals every generation, it is most likely dominant. 2. Determine if the trait is autosomal or sex-linked. a. If it affects males and females equally, it is most likely autosomal inheritance. b. If it affects one sex more (like males), it is most likely sex-linked inheritance.

304

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

2X OR NOT 2X

| “Y” Should Mixed-Sex Test Subjects Be Used in Medical Research?

15

3. Assign genotypes to affected (shaded) individuals first. a. If autosomal, use two alleles to show inheritance (AA, Aa, or aa). b. If sex-linked, use one allele for males, two for females (XaY or XaXa). i. The shaded males will carry the gene and be affected (XaY). ii. The shaded females can be affected with two copies of the gene (XaXa). 4. Assign remaining genotypes to unaffected (unshaded) individuals. a. If sex-linked: i. The unshaded males will not carry the gene (XAY) and not be affected. ii. Unaffected female carriers remain unshaded but are marked with a dot (XAXa). iii. Unaffected females who are not carriers remain unshaded and without a dot (XAXA). 5. Double check your work—does the pedigree make sense?

Part I

FIGURE 15.4

In 19th- and 20th-century Europe, kings and queens had to document their royal lineage. This is a detailed family tree going back several generations to individuals who are members of other royal families. So, when a devastating genetic disorder like hemophilia is passed through a royal family, it is well documented. One such example is Britain’s Queen Victoria (1819–1901) and her royal lineage. Many of her male descendants in the royal families of Spain, Germany, and Russia had hemophilia, or “the royal disease.” Examine Queen Victoria’s pedigree to determine the inheritance pattern of hemophilia. Then, answer the questions that follow.

Queen Victoria Hemophilia Family Lineage

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

305

15 ACTIVITY QUESTIONS, PART I 1. Based on the pedigree in Figure 15.4 (p. 305), what is the inheritance pattern of hemophilia? a. Dominant or recessive? How do you know? b. Autosomal or sex-linked? How do you know? c. The first son of Queen Victoria, Edward VII, and his son (George V) were not affected by hemophilia. Why?

Part II Examine the following two pedigrees (Figures 15.5a and 15.5b). Then, answer the questions that follow to determine the inheritance pattern. Using the uppercase letter A for dominant genes and the lowercase letter a for recessive genes (XX for females and XY for males), assign the appropriate genotypes to each phenotype.

FIGURES 15.5 Sample Pedigrees (a) Sample Pedigree 1

306

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

2X OR NOT 2X

| “Y” Should Mixed-Sex Test Subjects Be Used in Medical Research?

15

(b) Sample Pedigree 2

ACTIVITY QUESTIONS, PART II 1. Based on the pedigree in Figure 15.5a, what is the inheritance pattern? a. Is it dominant or recessive? How do you know? b. Is it autosomal or sex-linked? How do you know? c. Write the genotypes on the lines under each represented individual in the pedigree. 2. Based on the pedigree in Figure 15.5b, what is the inheritance pattern? a. Is it dominant or recessive? How do you know? b. Is it autosomal or sex-linked? How do you know? c. Write the genotypes on the lines under each represented individual in the pedigree.

Apply and Analyze Based on a family’s history, you can recreate their pedigree. Read the following story to create a family’s pedigree. Make sure to note the type of inheritance and assign genotypes to phenotypes. You may need to construct a Punnett square to determine genotypes. After reading, answer the questions that follow.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

307

15 Juan (male) married Rachel (female) and they had three children, Gyles (male), Roxana (female), and Denzel (male). Gyles married Sonja (female) and had two children, Murat (male) and Gina (female). Roxana married Randell (male) and had two boys, Khalid and Caleb. Denzel married Catherine (female) and had two daughters, Tasha and Michelle. At a recent family reunion, Gyles and Roxana were talking about how Khalid and Caleb were each having trouble remembering their colors in their kindergarten classes. In overhearing the conversation, their mother, Rachel, reminded them that their father, Juan, needed help with his wardrobe as he struggled with color matching of his clothes each day.

1. Create the family pedigree. a. Is the inheritance pattern dominant or recessive? b. Is the inheritance pattern autosomal or sex-linked? 2. What is the percent chance that Denzel’s and Catherine’s children have or carry colorblindness? a. Complete the Punnett square. b. What information would you need to know to be sure?

Design Challenge The case study in this lesson illustrates how a scientific discovery led to potential solutions to a problem. Observations and discoveries often spark ideas for innovations. This is especially true in the field of engineering. Engineering is the application of scientific understanding through creativity, imagination, and the designing and building of new materials to address and solve problems in the real world. You will be asked to take the science you have learned in this case and design a process or product to address a real-world issue. Engineers use the engineering design process (Figure 15.6) as steps to address a real-world problem. In this case, you are asking the question (Step 1) of what types of assistive technology may be helpful to someone with a specific genetic disorder. Using outside research, you will explore various genetic disorders and imagine (Step 2) an assistive technology that can help someone living with that genetic disorder. Then, you will create a plan (Step 3) for your proposed assistive technology. Next, you will think of a design (Step 4) for your technology, considering how it will account for differences between men and women who are living with the

308

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

2X OR NOT 2X

| “Y” Should Mixed-Sex Test Subjects Be Used in Medical Research?

same genetic disorder. Finally, you will think of ways to test (Step  5) the technology and consider improvements (Step 6) to your product.

FIGURE 15.6 The Engineering Design Process 1

1. Ask Questions Ask questions about genetic disorders and technology. For example, what are some genetic disorders you have heard of that impact human health? What are types of technology that may help people cope with genetic disorders?

2. Brainstorm and Imagine

15

Ask Questions and Define the Problem 6

2

Revise and Improve

Brainstorm and Imagine

3 5 Test and Evaluate

The Engineering Design Process

3 Plan

Multiple sclerosis, Hunting4 ton’s disease, and colorblindDesign ness are only a few genetic and Create disorders/diseases that people live with worldwide. Visit this website to read about various genetic disorders/diseases: https://en.wikipedia.org/wiki/List_of_genetic_disorders. Afterward, (1) choose a genetic disorder/disease that affects both men and women, and (2) think of ways to design or adapt a technology to aid individuals living with the disorder in order to enhance their quality of life. Visit this site for more information about assistive technology: www.atia.org/at-resources/what-is-at. For example, colorblindness is a sex-linked recessive genetic disorder. It is caused by an inherited defect in the color-sensing areas of the eye. Males are more likely to be colorblind than females, as the genes responsible for most forms of colorblindness are on the X chromosome. Some women can still have a mild form of colorblindness. However, when a female inherits a defected copy of an X chromosome, the other X chromosome can often compensate. Males, on the other hand, only have one copy of the X chromosome and genes for color vision. This is why men tend to experience more colorblindness and exhibit the most severe form of the disorder. This presents challenges for people with colorblindness, from dressing, cooking meals, and interpreting traffic lights. No cure exists for colorblindness, but there are assistive technologies to help people with this condition. One type of technology is an app that uses filters on

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

309

15 smartphones to help the user discern colors. This can help people with mild forms of the disorder (mostly females) and severe forms of the disorder (mostly males). You can read more about the app here: www.nytimes.com/2019/02/05/magazine/letterof-recommendation-color-blind-pal.html.

3. Create a Plan Create a plan for your technology. In your plan, summarize (1) the disorder you chose, (2) how it is inherited, (3) whether there are environmental factors, (4) information on how the disease or disorder affects the body, (5) challenges faced by those with the disorder, and (6) the assistive technology that you want to create to help people with the disorder, and why. Think creatively about how men and women experience this disorder differently and how assistive technology would be most useful for each. Use the Assistive Technology Intervention for a Genetic Disease or Disorder worksheet (p. 312) for guidance.

4. Design and Create Consider the design for your technology. Use the Assistive Technology Design for Men and Women graphic organizer (p. 313) for guidance, and think about the following questions. • What will your technology look like and how will it be used? • How does your technology address the disorder/disease you have chosen? How does the disorder impact people’s lives? What kind of help would people need who live with this disorder? • How does your proposed technology take into account sex differences? How does the disorder impact men? How would the technology account for this? How does the disorder impact women? How would the technology account for this? • Are there any drawbacks to your plan, and how would you mitigate these? Using the information from your graphic organizers, create a sales pitch to promote your technology to a major organization that generates awareness and research for your chosen genetic disorder. The goal of your pitch is to communicate the purpose of your technology, provide details as to how it works, and describe

310

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

2X OR NOT 2X

| “Y” Should Mixed-Sex Test Subjects Be Used in Medical Research?

15

how the technology will account for differences in the way men and women experience the disorder. Your pitch should informative, engaging, and convincing.

5. Test and Evaluate Think about how you would test the safety and efficacy of your device. Consider these questions: • Phase 1—What would you do for laboratory testing? • Phase 2—What would you do for animal-based testing? • Phase 3—What would you do for clinical trials? • Surveillance—What would you do to ensure ongoing evaluation of the device on the market? Add this information to your Evaluation Plan graphic organizer (p. 314), and include this information in your sales pitch.

6. Revise and Improve Present your plan to your peers for review. Listen to their feedback and take some time to revise and make improvements. What are some ways you can use their input to refine your design? You may choose to accept all or only some of the feedback. Be sure to justify your reasons for using or not taking their suggestions.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

311

15 Assistive Technology Intervention for a Genetic Disease or Disorder 1

What is the genetic disease or disorder?

2

How is it inherited?

Circle your answers. • Dominant or recessive • Autosomal or sex-linked

312

3

Are there environmental factors?

4

How does this disorder affect the body?

5

What are some specific challenges people with this disorder face?

6

What type of technology would be best for preventing or reducing effects of this disease? Why?

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

2X OR NOT 2X

| “Y” Should Mixed-Sex Test Subjects Be Used in Medical Research?

15

Assistive Technology Design for Men and Women Create a sketch of your technology in the space provided.

The design addresses the needs of people with this disorder by …

The design incorporates the needs of men with this disorder by …

The design incorporates the needs of women with this disorder by …

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

313

15 Evaluation Plan

Step #1:

_____________________________________________________________________ Step #2:

_____________________________________________________________________ Step #3:

_____________________________________________________________________ Step #4:

_____________________________________________________________________

314

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

2X OR NOT 2X

| “Y” Should Mixed-Sex Test Subjects Be Used in Medical Research?

15

TEACHER NOTES

2X OR NOT 2X

“Y” SHOULD MIXED-SEX TEST SUBJECTS BE USED IN MEDICAL RESEARCH? A Case Study Using the Discovery Engineering Process

Lesson Overview In this lesson, students explore the importance of mixed-sex animal models in preclinical research. Students learn about a laboratory mix-up in which male mice subjects were used for multiple sclerosis (MS) research instead of a single-sex (female) mouse model as planned. The mistake led scientists to find a set of genes that express themselves differently in male and female mice and play a role in whether MS develops. After reading the case, students will use data and pedigree analysis to understand the different inheritance patterns of genetic disorders. Finally, students will use this information to research a genetic disorder and design (or adapt) assistive technology for individuals with that disorder.

Lesson Objectives By the end of this case study, students will be able to • describe the importance of using mixed-sex animals in studying genetic disorders; • explain sex differences in sex-linked genetic disorders using pedigree analysis; and • design assistive technology to help people with a specific genetic disorder with consideration for differences in men and women.

Use of the Case Due to the nature of these case studies, teachers may elect to use any section of each case for their instructional needs. They are sequenced in order (scaffolded) so students think more deeply about the science involved in the case and develop an understanding of engineering in the context of science.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

315

15 Curriculum Connections Lesson Integration This lesson may be taught during a unit on genetic disorders and heredity for beginner biology courses. It also fits well with topics related to data interpretation or discussions regarding visualizing data (in pedigrees) to assess inheritance patterns.

Related Next Generation Science Standards PERFORMANCE EXPECTATIONS • MS-LS3-1. Develop and use a model to describe why structural changes to genes (mutations) located on chromosomes may affect proteins and may result in harmful, beneficial, or neutral effects to the structure and function of the organism. • MS-ETS1-2. Evaluate competing design solutions using a systematic process to determine how well they meet the criteria and constraints of the problem. • MS-ETS1-4. Develop a model to generate data for iterative testing and modification of a proposed object, tool, or process such that an optimal design can be achieved. • HS-LS3-1. Ask questions to clarify relationships about the role of DNA and chromosomes in coding the instructions for characteristic traits passed from parents to offspring. • HS-ETS1-3. Evaluate a solution to a complex real-world problem based on prioritized criteria and trade-offs that account for a range of constraints, including cost, safety, reliability, and aesthetics, as well as possible social, cultural, and environmental impacts.

SCIENCE AND ENGINEERING PRACTICES • Asking Questions and Defining Problems • Developing and Using Models • Planning and Carrying out Investigations • Analyzing and Interpreting Data • Constructing Explanations and Designing Solutions • Engaging in Argument From Evidence

316

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

2X OR NOT 2X

| “Y” Should Mixed-Sex Test Subjects Be Used in Medical Research? TEACHER NOTES

15

CROSSCUTTING CONCEPTS • Patterns • Scale, Proportion, and Quantity • Systems and System Models

Related National Academy of Engineering Grand Challenges • Engineer Better Medicines • Advance Health Informatics • Engineer the Tools of Scientific Discovery

Lesson Preparation Before starting the lesson, it is helpful for students to have some understanding of basic genetics concepts, including genotypes and phenotypes. Also, review Punnett squares and how to use them. You will need to make copies of the entire student section for the class. Students will need internet access at various points in the lesson. Alternatively, you can project videos or print and distribute copies of online content. Look at the Teaching Organizer (Table 15.1) for suggestions on how to organize the lesson.

Time Needed Up to 125 minutes

TABLE 15.1 Teaching Organizer Section

Time Suggested

Materials Needed

Additional Considerations

The Case

10 minutes

Student pages

Activity done individually in class or as homework prior to class

Investigate and Explain

10 minutes

Student pages

Activity done individually or in pairs

Activity

20 minutes

Student pages

Activity done individually or in pairs

Apply and Analyze

25 minutes

Student pages

Individual activity

Design Challenge

45–60 minutes

Student pages, internet access

Small-group activity

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

317

15 Vocabulary • allele

• in vitro

• animal model

• in vivo

• autoimmune disorder

• inflammation

• autosomal inheritance

• knockout

• autosomes

• models

• carrier

• multiple sclerosis

• chromosomes

• mutation

• disease

• myelin

• dominant

• pedigree analysis

• environmental factor

• phenotype

• genes

• preclinical

• genetic disorder

• Punnett square

• genetically predisposed

• recessive

• genotype

• reproduced (reproducibility)

• heterozygous

• sex chromosomes

• homozygous

• sex-linked inheritance

• immune cell

• testosterone

• immunity

• wild-type

Extensions This lesson can be used as an opportunity for students to explore more topics on genomics. Please see this teacher resource for additional activities: www.genome. gov/about-genomics/teaching-tools.

Assessment Use the Teacher Answer Key to check the answers to section questions. To assess the Design Challenge, you can evaluate the students’ sales pitches for their assistive technology. Each sales pitch should include a description of what the students’ technology will look like and how it will be used, an explanation of how the technology will address the disorder/disease they chose, and details on how the technology will take into account sex differences. Pitches should be informative,

318

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

2X OR NOT 2X

| “Y” Should Mixed-Sex Test Subjects Be Used in Medical Research? TEACHER NOTES

15

engaging, and convincing. The students’ plans should be creative yet realistic. Students should be able to communicate any constraints or drawbacks to their technology as well as how they would mitigate these issues.

Teacher Answer Key Recognize, Recall, and Reflect 1. What is multiple sclerosis, or MS? What is believed to cause MS? Multiple sclerosis is a disease that affects the brain and spinal cord. People who suffer from MS can exhibit mild to severe neurological issues, in addition to fatigue and weakness. This is largely caused by damage to the coating around nerve fibers (myelin) that disrupt the transmission of nerve signals throughout the body. Scientists think MS is triggered by some unknown environmental factor in individuals who are genetically predisposed to it. 2. Why were female mice models mostly used in MS research? MS is three times as likely to affect women as it is men. To understand why, female mice models were used to best approximate the genetics and physiology of human females. 3. What did scientists find out when they used the male c-kit knockout mice? How was this different than when they used wild-type male mice in previous MS research studies? Both sexes of the c-kit knockout mice became ill with MS. Since wild-type males never got sick, scientists were able to determine that the immune cells blocked by the c-kit mutation provided the males with some protection. The scientists went on to figure out that the immune cells activate in wild-type male mice but not in wild-type female mice.

Investigate and Explain 1. In which category (scientific discipline) for animal studies (Figure 15.2a) were female models preferred to male models? Why do you think that is? Reproduction. This is because the largest difference between male and female anatomy is the reproductive organs. Since females gestate (experience pregnancy) and give birth, they have a larger role in reproduction and reproduction studies. 2. In which categories (scientific disciplines) for human studies (Figure 15.2b) were only female models excluded? Why do you think that is?

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

319

15 Neuroscience, physiology, and behavior. Answers theorizing the lack of female models may vary. Students may guess that there’s an assumption in these disciplines that no differences exist between male and females. 3. The NIH mandates that human studies employ both sexes. Based on the case and these graphs, what argument can you make for animal studies to have a similar mixed-sex model policy? Students’ answers may vary. Students might argue that despite males and females having a similar anatomy and physiology, the expression of that anatomy and physiology can differ between the sexes, as illustrated in the case study. Preclinical trials form a basis of information about human biology in general. And they also influence human trials. So if information about female biology is compromised or lost at the preclinical level due to focus on males, this could also impact human trials. Ultimately, this could lead to the development of treatments or therapies that are based on an incomplete picture of human biology—and that’s not good for males or females.

Activity Questions, Part I 1. Based on the pedigree in Figure 15.4 (p. 305), what is the inheritance pattern of hemophilia? a.

Dominant or recessive? How do you know? Recessive. Because it affects individuals every other generation.

b. Autosomal or sex-linked? How do you know? Sex-Linked. Because it disproportionally affects males more than females. c.

The first son of Queen Victoria, Edward VII, and his son (George V) were not affected by hemophilia. Why? For a male to be affected by hemophilia, he must inherit the gene on the X chromosome from his mother. His father can only donate a Y chromosome. Since Edward VII did not inherit the abnormal X chromosome from his carrier mother, he was not affected. His wife (not shown) would have to be a hemophiliac or a carrier to pass hemophilia onto their son.

Activity Questions, Part II 1. Based on the pedigree in Figure 15.5a, what is the inheritance pattern?

320

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

2X OR NOT 2X

| “Y” Should Mixed-Sex Test Subjects Be Used in Medical Research? TEACHER NOTES

a.

15

Is it dominant or recessive? How do you know? Dominant. Because it affects individuals in each generation it occurs.

b. Is it autosomal or sex-linked? How do you know? Autosomal. It affects both males and females equally. c.

Write the genotypes on the lines under each represented individual in the pedigree. Figure 15.5a should be filled out as follows:

2. Based on the pedigree in Figure 15.5b, what is the inheritance pattern? a.

Is it dominant or recessive? How do you know? Recessive. Because it affects individuals every other generation.

b. Is it autosomal or sex-linked? How do you know? Autosomal. Although males are affected in this pedigree, it does not follow a typical sex-linked inheritance where males receive the defective gene from their mother’s X chromosome. For a person to be affected, he or she would have to inherit both copies of the gene. c.

Write the genotypes on the lines under each represented individual in the pedigree.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

321

15 Figure 15.5b should be filled out as follows:

Apply and Analyze 1. Create the family pedigree. a.

Is the inheritance pattern dominant or recessive? Recessive

b. Is the inheritance pattern autosomal or sex-linked? Sex-linked 2. What is the percent chance that Denzel’s and Catherine’s children have or carry colorblindness? There is a 0% chance for daughters with colorblindness and a 50% chance that the daughters are carriers for colorblindness. a.

Complete the Punnett square. See Punnett square.

b. What information would you need to know to be sure? To know the status of Catherine’s other X chromosome, we would need to know her family history of colorblindness.

322

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

2X OR NOT 2X

| “Y” Should Mixed-Sex Test Subjects Be Used in Medical Research? TEACHER NOTES

15

Resources and References Assistive Technology Industry Association. What is AT? www.atia.org/at-resources/what-is-at. Beery, A. K., and I. Zucker. 2011. Sex bias in neuroscience and biomedical research. Neuroscience & Biobehavioral Reviews 35 (3): 565–572. www.sciencedirect.com/science/article/ pii/S0149763410001156. The Carnegie Mellon Genetics Cognitive Tutor. 2015. Pedigree analysis. Carnegie Mellon University. www.cs.cmu.edu/~genetics/units/instructions/instructions-PBA.pdf. Dubno, Z. 2019. “Letter of Recommendation: Color Blind Pal.” New York Times, February 5. National Human Genome Research Institute. Genomics teaching tools. National Institutes of Health. www.genome.gov/about-genomics/teaching-tools. Spain, E. 2015. Protecting women from multiple sclerosis: Step closer to understanding why men are better protected from MS than women. Northwestern Now. https://news. northwestern.edu/stories/2015/05/protecting-women-from-multiple-sclerosis. Wikipedia. List of genetic disorders. https://en.wikipedia.org/wiki/List_of_genetic_disorders.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

323

Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

REVEALING REPEATS The Accidental Discovery of DNA Fingerprinting

16

A Case Study Using the Discovery Engineering Process Introduction All living things (organisms) have a code that carries genetic information from parent to offspring (heredity). What carries that code are four types of nitrogenous bases that pair together. When bases pair into long strands, it is called deoxyribonucleic acid (DNA) (Figure 16.1, p. 326). In humans, DNA is packed into 46 structures called chromosomes. Children receive half (23) of their chromosomes from their mother and half (23) of their chromosomes from their father. Because humans get genetic information from both parents, combined in uniquely different ways, the genetic code of a child is unique from all other people on Earth, just like a fingerprint. A process known as DNA fingerprinting (or DNA profiling) can separate out DNA to show differences in the genetic code between people. As with fingerprinting a person’s fingers, DNA fingerprinting can determine someone’s identity. This can be useful in such things as identifying parentage and tracking down the person responsible for a crime.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

325

16 Lesson Objectives By the end of this case study, you will be able to

FIGURE 16.1 The DNA Helix

• compare DNA base pairs in cows to see their genetic differences; • analyze DNA fingerprints (through DNA profiles) to compare a known DNA sample to unknown DNA samples; and • create a research proposal to justify a new use of DNA fingerprinting to solve a current problem.

The Case This account outlines the discovery of DNA fingerprinting. Once you are finished reading, answer the questions that follow. Dr. Alec Jeffreys is a genetics scientist (or a geneticist), who discovered the process of DNA fingerprinting. While looking at x-rays of DNA in his laboratory in 1984, he happened to notice that people who are related to one another have similar repeats in their DNA base pairs (repetitive DNA segments). He wondered what he could do with this discovery and if similarities or differences (which are called variations) in the genetic code (DNA) could identify individuals. Dr. Jeffreys was soon able to test out this idea. In 1985, investigators in England were trying to determine if a boy was related a woman who said she was his mother. The case was resolved when Dr. Jeffreys used DNA fingerprinting to create a DNA profile of the woman and child. In comparing the boy’s DNA to the woman’s, Dr. Jeffreys found that they shared similar genetic markers, demonstrating they were closely related. DNA fingerprinting is also used to identify individuals who commit crimes. In 1987, Dr. Jeffreys’s laboratory was asked to identify an individual who murdered two people in England. At each crime scene, the investigators collected body fluid they believed belonged to the criminal. This body fluid had DNA. So, the laboratory was able to compare the body fluid samples from the crime scenes to the body fluids (and DNA) of suspects. Using the information gathered by the scientists,

326

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

REVEALING REPEATS

| The Accidental Discovery of DNA Fingerprinting

16

investigators were able to identify the individual who committed the murders and exclude others who had been under suspicion for the crime. Since its accidental discovery in 1984, DNA fingerprinting technology has improved to use less DNA and identify individuals with a greater percent of certainty. How does the process work? While over 99% of the DNA sequences are the same in all people, small portions of DNA are highly variable (different or irregular) and can be used to distinguish one person from another (except for identical siblings). The first step is to obtain or gather a sample of an individual’s DNA. The samples can be collected using a clean cotton swab scraped along the cheek inside the mouth. Samples can also be collected from body fluid that has DNA (such as blood, urine, or saliva). Once they have a DNA sample, geneticists make multiple copies of it. They do this through a process called polymerase chain reaction, or PCR. PCR mimics DNA replication (the process cells use to copy DNA) and makes a copy of the DNA using free (unpaired) nucleotides. Once many copies of the DNA are generated, the sample is placed in a gel and undergoes a process called gel electrophoresis (Figure 16.2). The ability for DNA to move in the gel is based on the size of the fragments. An electric current is sent through the gel to create a positive charge on one end. Because DNA has a negative charge, it is attracted FIGURE 16.2 to positive charge. This attraction causes the negatively charged DNA in the gel to separate. Because different segments are different sizes (larger and Loading DNA Samples Into an smaller), they migrate toward the positive end Agarose Gel for Electrophoresis of the gel at different speeds (faster and slower). The geneticists are then able to analyze each DNA segment in order to look for variations. This helps them create a DNA profile they can use to identify an individual. From the discovery of DNA fingerprinting to the process of DNA profiling used presently in laboratories around the world, using the similarities and differences in the genetic code to identify specific individuals has extended into many fields. This includes forensics (using science to solve crimes), animal and plant population studies, and determining who a child’s parents are (paternity, maternity) through DNA testing.

Recognize, Recall, and Reflect 1. What did Dr. Jeffreys accidentally find when examining DNA in 1984?

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

327

16 2. How did Dr. Jeffreys know from creating a DNA profile that a child was indeed related to a woman claiming to be his mother? 3. In what ways has DNA fingerprinting improved over the years?

Investigate and Explain Two farmers (Farmer A and Farmer B) are fighting in court to take ownership of a prize-winning cow that was found between Farmer A and Farmer B’s pastures. To solve the case, both farmers agree to a DNA test to determine if the cow is related to Farmer A’s herd or Farmer B’s herd. Geneticists obtain body fluid samples that contain DNA from the mystery cow and five random cows each selected from Farmer A’s herd and Farmer B’s herd. Review the DNA profiling data below. After examining the data, answer the questions that follow. Investigation Question: Which herd does the prize-winning cow belong to: Farmer A’s herd or Farmer B’s herd? • Farmer A took body fluid samples from five random cows in his total herd of 76. • Farmer B also took body fluid samples from five random cows in his total herd of 98. Study Methodology: The randomly selected cows from each herd and the prizewinning mystery cow had mouth swabs done to collect cells with DNA. Each cow’s swab was labeled and sent to the laboratory. The geneticists in the laboratory made copies of each cow’s DNA sample using the PCR process and then separated the DNA segments using gel electrophoresis. This was done to match the similarities of DNA markers in order to determine which herd the cow was related to. Data: The results of the DNA profiling test for the prize-winning cow and the cows from the two herds are in Table 16.1. They show the strands of DNA that were used to compare the similarities and differences between cows. The more similar one DNA strand is to another, the greater the possibility that the two cows are related. DNA is similar in cows and humans. As with human DNA, cow DNA has four nitrogenous bases: adenine (A), guanine (G), cytosine (C), and thymine (T). These chemicals pair together to form a genetic code, with A always linking to T and G always linking to C. Due to specific base pairing and DNA being double stranded, DNA can make an exact copy of its sequence when it replicates (Figure 16.3). Each cow tested has a strand of DNA that is represented by these nitrogenous bases. Look the data and see if you can identify the prize-winning cow’s herd.

328

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

REVEALING REPEATS

| The Accidental Discovery of DNA Fingerprinting

16

TABLE 16.1 Cow DNA Profile Data Cow Tested

DNA Segment

Prize-Winning Cow

AAACATTACCAGTCCTGAAAAATTCATCGT

Farmer A Cow #1

AAATACCATTTGCTCTAATCGGGGGTAAAT

Farmer A Cow #2

AAATAACATGGTCACTTATCGCCCGTTCAT

Farmer A Cow #3

AAACAAAATGTAATCTAATCGCGTGTACAT

Farmer A Cow #4

AAATACCATTTGCTCTAATCGGGGGTAAAT

Farmer A Cow #5

AAACACTAATGGATCTATTCGCCGGTCCAT

Farmer B Cow #1

AAATATCATGGTCTCTTATCGCCCGTACAT

Farmer B Cow #2

AAACAATACCACTACTGATAAATTCAACGT

Farmer B Cow #3

AAATATCATCCTCTCATATCGCGCGTACAT

Farmer B Cow #4

AAACAATACCACTAATGATATGTTCAACGT

Farmer B Cow #5

AAATAAGATGGTCTCTAATCGCCCGAACAA

FIGURE 16.3 DNA Replication

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

329

16 1. To which herd (and farmer) does the prize-winning cow belong based on the similarity of the DNA segments? Explain how you developed your conclusion. 2. The investigators collected only five random samples from each herd. a. What are the advantages of obtaining only five random samples from each herd? b. What are the disadvantages of obtaining only five random samples from each herd? 3. If you were a geneticist working on this case, how would you improve the design of the study, data collection procedure, and data analysis?

Activity Imagine you are a forensic science investigator and geneticist. You solve crimes by studying the genetic code of DNA left at crime scenes. Detectives have just briefed you on your next case: The night before, the Hope Diamond (Figure 16.4) was stolen from the Smithsonian National Museum of ­Natural History. Investigators have shared with you that the individual responsible for stealing the Hope Diamond (with an estimated FIGURE 16.4 value of $250 million in 2017) broke the glass case that stored the diamond. Blood was found on the The Hope Diamond broken glass, which was collected, labeled, and sent to your laboratory. The investigators shared that the crime was done professionally (other than the blood, there was no other evidence left by the thief). Because of the nature of the crime, the investigators believe the thief has done similar thefts of jewelry. Knowing this information, you will compare the DNA fingerprints of known criminals that have been involved in high-value jewel heists in the past. You know that you can retrieve their DNA from the National DNA Index System. This database contains collected DNA sequences from people who have been incarcerated in the United States. The database is often used to compare the DNA sequences of known criminals to DNA from body fluid found at crime scenes. Review each part below. Record how you plan to test and compare the blood (DNA) sample of the unknown Hope Diamond thief to DNA samples from known criminals. After you create your procedure for DNA comparison, you will be ready to analyze your DNA sequences. Once done, answer the questions that follow.

330

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

REVEALING REPEATS

| The Accidental Discovery of DNA Fingerprinting

16

Part I Using what you have learned from this case study, come up with a plan for obtaining a segment of DNA and developing a DNA profile of this thief. Summarize what you will be looking for once you are able to compare the thief’s profile to other DNA samples. My plan is …

Part II Your teacher will give you eight samples from known criminals and the sample from your unknown individual. Label and record the DNA sequences in the DNA Profile Comparison Chart (p. 332).

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

331

16 DNA Profile Comparison Chart Case Number: #345A7B Individual Tested Unknown Sample (thief’s DNA from blood at scene)

DNA Profile

Notes/Observations

GCCATACGCAA

There are 4 As, 1 T, 2 Gs, and 4 Cs. There are 2 repeats (CC and AA).

ACTIVITY QUESTIONS Based on the data presented in the DNA Profile Comparison Chart, what would you conclude about this case in your report to the investigators? Explain how you came to your findings for the investigators. 1. What are some potential disadvantages of the blood collection process at the crime scene? 2. How would you improve the data collection procedure and data analysis for the next forensic case?

Apply and Analyze DNA profiling has applications beyond forensic science. Read this article from the Australian Broadcasting Corporation on how missing children are being reunited with their families through a worldwide DNA testing program: www.abc.net.au/ radionational/programs/scienceshow/dna-finds-missing-children/6573694. After reading, answer the questions that follow. 1. The worldwide DNA database helps reunite missing children with their families. Parents submit their DNA profile to the database and wait to see if there is a match to identify their missing child. Privacy issues (keeping your DNA information confidential) is a major concern.

332

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

REVEALING REPEATS

| The Accidental Discovery of DNA Fingerprinting

16

a. What are the advantages of having a worldwide DNA database? b. What are the disadvantages of a worldwide DNA database? 2. Other than reuniting missing children with their families, how might geneticists use a worldwide DNA database? When should geneticists not use a worldwide DNA database?

Design Challenge The case study in this lesson illustrates how a scientific observation led to potential solutions to a problem. Observations and discoveries often spark ideas for innovations. This is especially true in the field of engineering. Engineering is the application of scientific understanding through creativity, imagination, and the designing and  building of materials to address and solve problems in the real world. You will be asked to take the science you have learned in this case to design a process or product to address a real-world issue. FIGURE 16.5 Engineers use the engineering design process (Fig- The Engineering Design Process ure  16.5) as steps to address a real-world problem. In this case, you are asking the 1 question (Step  1) of how Ask Questions DNA fingerprinting (or and Define the Problem DNA profiling) can be used 6 2 for new purposes. Using outRevise Brainstorm side research, you will brainand Improve and Imagine storm (Step 2) a specific new The application for DNA fingerEngineering printing. Next, you will creDesign ate a plan (Step 3) for your Process 3 idea. Then, you will consider 5 3 a design (Step  4) for your Test Plan application, which you will and Evaluate describe in a research pro4 posal. Finally, you will think Design of a way to test (Step 5) your and Create application and consider improvements (Step 6) to your design.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

333

16 1. Ask Questions DNA fingerprinting has been used to solve crimes, reunite children with families, determine parentage, and monitor animal and plant populations. Ask questions about other uses for DNA fingerprinting. For instance, in what other situations do you need to figure out an individual’s identity? Would DNA be available to you in any of these situations? What are problems that DNA fingerprinting could help solve?

2. Brainstorm and Imagine A review of DNA fingerprinting and a description of additional uses are available here: http://genetics.thetech.org/original_news/news16. Read the background information and brainstorm a new application for DNA fingerprinting. For example, many people do not pick up their dogs’ waste when taking them for a walk. This could cause health issues if the waste ends up in a community’s water supply. Communities might provide incentives for people to get their dogs’ DNA recorded in a database. Then DNA fingerprinting could be used to test leftbehind animal waste in order to link it to a specific dog. The dog’s owners could be fined for not cleaning up after their pet. This would help keep communities clean.

3. Create a Plan Create a plan for your new idea. Summarize (1) the problem you want to address using DNA fingerprinting technology, (2) how you want to use DNA fingerprinting in a new way, (3) who or what is helped by your idea, and the (4) advantages and disadvantages to putting your new idea in motion. Use the Choosing a New Use for DNA Fingerprinting Technology worksheet (p. 336) for guidance.

4. Design and Create Create a pamphlet on your new idea for DNA fingerprinting. You can include images and graphics. Make sure to be culturally sensitive in your recommendations on use of your proposed idea. Include the following in your pamphlet: • A detailed description of your new idea and how it works What problem your DNA fingerprinting application would solve Who or what would undergo DNA fingerprinting Why using DNA fingerprinting in this way is a good idea

334

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

REVEALING REPEATS

| The Accidental Discovery of DNA Fingerprinting

16

• Provide details in a Frequently Asked Questions section, or FAQ: How would individuals be protected? (How is the individual’s identity protected? How is information about an individual’s DNA kept from other people, organizations, companies, and governments?) How would you go about getting the DNA for the product?

5. Test and Evaluate Think about how you would test the safety and efficacy of your plan. Consider these questions: • Phase 1—What would you do for laboratory testing? • Phase 2—What would you do for animal-based testing? • Phase 3—What would you do for clinical trials? • Surveillance—What would you do to ensure ongoing evaluation of the product on the market? Add this information to your Evaluation Plan graphic organizer (p. 337), and then attach it to your pamphlet.

6. Revise and Improve Present your proposal to your peers. Listen to their feedback on your proposal and take some time to revise it and make improvements. What are some ways you can use their input to refine your proposal? You may choose to accept all or only some of the suggestions. Be sure to justify your reasons for accepting or not using the peer feedback.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

335

16 Choosing a New Use for DNA Fingerprinting Technology

336

1

What problem do you want to address using DNA fingerprinting?

2

How will you use DNA fingerprinting to solve the problem?

3

Who is helped by your idea?

4

What are the advantages of your new idea?

5

What are the disadvantages of your new idea?

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

REVEALING REPEATS

| The Accidental Discovery of DNA Fingerprinting

16

Evaluation Plan

Step #1:

_____________________________________________________________________ Step #2:

_____________________________________________________________________ Step #3:

_____________________________________________________________________ Step #4:

_____________________________________________________________________

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

337

16 Eight DNA Profiles for the Hope Diamond Activity Case Number: #345A7B Suspect’s Name: Unknown Thief Case Information: DNA blood sample collected at scene. Sample collected from broken glass that housed the Hope Diamond. DNA blood sample was collected, labeled, and sent to the lab for further analysis. #345A7B Update: DNA profile has been determined and added to the case. See below for DNA profile. DNA Profile: G C C A T A C G C A A

Case Number: #345A7B Suspect’s Name: Ginger S. Case Information: Suspect was identified by the investigators as having a motive in stealing the Hope Diamond. Suspect’s DNA profile was retrieved from the National DNA Index System. DNA Profile: C A T A C T C T A C C

Case Number: #345A7B Suspect’s Name: Sean B. Case Information: Suspect was identified by the investigators as having a motive in stealing the Hope Diamond. Suspect’s DNA profile was retrieved from the National DNA Index System. DNA Profile: G A T A G T C T A T C

338

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

REVEALING REPEATS

| The Accidental Discovery of DNA Fingerprinting

16

Case Number: #345A7B Suspect’s Name: Jeff K. Case Information: Suspect was identified by the investigators as having a motive in stealing the Hope Diamond. Suspect’s DNA profile was retrieved from the National DNA Index System. DNA Profile: G C C T T A C G C A A

Case Number: #345A7B Suspect’s Name: Kevin C. Case Information: Suspect was identified by the investigators as having a motive in stealing the Hope Diamond. Suspect’s DNA profile was retrieved from the National DNA Index System. DNA Profile: A A T G C C C T A T T

Case Number: #345A7B Suspect’s Name: Robin B. Case Information: Suspect was identified by the investigators as having a motive in stealing the Hope Diamond. Suspect’s DNA profile was retrieved from the National DNA Index System. DNA Profile: T T T G C C A C A C T

Case Number: #345A7B Suspect’s Name: Mike C. Case Information: Suspect was identified by the investigators as having a motive in stealing the Hope Diamond. Suspect’s DNA profile was retrieved from the National DNA Index System. DNA Profile: T C A G T T C A C A C

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

339

16 Case Number: #345A7B Suspect’s Name: Jessica G. Case Information: Suspect was identified by the investigators as having a motive in stealing the Hope Diamond. Suspect’s DNA profile was retrieved from the National DNA Index System. DNA Profile: A T C G G G A T C T A

Case Number: #345A7B Suspect’s Name: Leo L. Case Information: Suspect was identified by the investigators as having a motive in stealing the Hope Diamond. Suspect’s DNA profile was retrieved from the National DNA Index System. DNA Profile: C C T G T T A A C A C

340

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

REVEALING REPEATS

| The Accidental Discovery of DNA Fingerprinting

16

TEACHER NOTES

REVEALING REPEATS

THE ACCIDENTAL DISCOVERY OF DNA FINGERPRINTING A Case Study Using the Discovery Engineering Process

Lesson Overview In this lesson, students read about the accidental discovery of DNA fingerprinting and explore how the process has been used to solve crimes, establish parentage, and more. Students will use sample DNA data to create a DNA profile of a cow. They will then compare this profile to those of other cows to determine relatedness. Students will also act as forensic investigators, using mock DNA evidence to solve a theft. Finally, students will use the information they learned to develop a novel use for the DNA fingerprinting process.

Lesson Objectives By the end of this case study, students will be able to • compare DNA base pairs in cows to see their genetic differences; • analyze DNA fingerprints (through DNA profiles) to compare a known DNA sample to unknown DNA samples; and • create a research proposal to justify a new use of DNA fingerprinting to solve a current problem.

Use of the Case Due of the nature of these case studies, teachers may elect to use any section of each case for their instructional needs. They are sequenced in order (scaffolded) so students think more deeply about the science involved in the case and develop an understanding of engineering in the context of science.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

341

16 Curriculum Connections Lesson Integration This lesson may be taught during a unit on genetics or forensic science. It also fits well into a lesson on data interpretation and into discussions on genetics, heredity, DNA/RNA, sexual reproduction, and forensic case studies.

Related Next Generation Science Standards PERFORMANCE EXPECTATIONS • MS-LS1-2. Develop and use a model to describe the function of a cell as a whole and ways parts of cells contribute to the function. • HS-LS1-1. Construct an explanation based on evidence for how the structure of DNA determines the structure of proteins which carry out the essential functions of life through systems of specialized cells. • HS-LS3-1. Ask questions to clarify relationships about the role of DNA and chromosomes in coding the instructions for characteristic traits passed from parents to offspring. • HS-ETS1-2. Design a solution to a complex real-world problem by breaking it down into smaller, more manageable problems that can be solved through engineering. • HS-ETS1-3. Evaluate a solution to a complex real-world problem based on prioritized criteria and trade-offs that account for a range of constraints, including cost, safety, reliability, and aesthetics, as well as possible social, cultural, and environmental impacts.

SCIENCE AND ENGINEERING PRACTICES • Asking Questions and Defining Problems • Developing and Using Models • Planning and Carrying out Investigations • Analyzing and Interpreting Data • Constructing Explanations and Designing Solutions • Engaging in Argument From Evidence

CROSSCUTTING CONCEPTS • Cause and Effect • Systems and System Models

342

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

REVEALING REPEATS

| The Accidental Discovery of DNA Fingerprinting TEACHER NOTES

16

Related National Academy of Engineering Grand Challenges • Engineer Better Medicines • Advance Health Informatics • Secure Cyberspace • Engineer the Tools of Scientific Discovery

Lesson Preparation Before starting the lesson, it is helpful for the students to have some understanding of the importance and structure of DNA and heredity. Review the concepts of genetics and heredity as well as the structure of DNA (including nitrogenous bases and base pairing) so students can complete the DNA fingerprinting activity. You will need to make copies of the entire student section for the class. Students will need internet access at various points in the lesson. Alternatively, you can project videos or print and distribute copies of online content for the class. Look at the Teaching Organizer (Table 16.2) for suggestions on how to organize the lesson.

Time Needed Up to 115 minutes

TABLE 16.2 Teaching Organizer Section

Time Suggested

Materials Needed

Additional Considerations

The Case

10 minutes

Student pages

Activity done individually in class or as homework prior to class

Investigate and Explain

10 minutes

Student pages

Activity done individually or in pairs

Activity

20 minutes

Student pages

Activity done individually or in pairs

Apply and Analyze

10–15 minutes

Student pages, internet access

Individual activity

Design Challenge

45–60 minutes

Student pages, internet access

Small-group activity

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

343

16 Vocabulary • adenine

• guanine

• chromosomes

• heredity

• cytosine

• nitrogen

• DNA fingerprinting

• nitrogenous bases

• DNA profiling

• organisms

• DNA replication

• polymerase chain reaction (PCR)

• DNA

• thymine

• forensics

• variable

• gel electrophoresis

• variation(s)

• geneticist

Extension This lesson can be used in a discussion about privacy concerns regarding DNA databases that house the genetic information of citizens.

Assessment Use the Teacher Answer Key to check the answers to section questions. The key includes a filled-out version of the DNA Profile Comparison Chart. You can evaluate the students’ DNA fingerprinting proposals to assess the Design Challenge. Proposals should provide a coherent conceptualization of what the new DNA fingerprinting application is, who it helps, and why it is needed (what problem does it help solve?). Students should be able to explain how they would go about developing their idea. They should also discuss how the privacy of individuals involved in their DNA fingerprinting will be protected. Students should detail how they might market the product to users. They should also address how they would test the efficacy of their process and the potential positive and negative outcomes of their idea.

Teacher Answer Key Recognize, Recall, and Reflect 1. What did Dr. Jeffreys accidentally find when examining DNA in 1984? Dr. Jeffreys unexpectedly found that people who are related to one another had similar repeats in their DNA base pairs (repetitive DNA segments).

344

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

REVEALING REPEATS

| The Accidental Discovery of DNA Fingerprinting TEACHER NOTES

16

2. How did Dr. Jeffreys know from creating a DNA profile that a child was indeed related to a woman claiming to be his mother? The boy had multiple (3) DNA markers that were the same as the woman’s. This suggests he inherited this DNA from the woman, making her his mother. 3. In what ways has DNA fingerprinting improved over the years? DNA fingerprinting technology now allows geneticists and forensic scientists to use less DNA and have greater precision (a greater percent of certainty in identifying individuals).

Investigate and Explain 1. To which herd (and farmer) does the prize-winning cow belong based on the similarity of the DNA segments? Explain how you developed your conclusion. Herd B. The DNA sequence of the prize-winning cow has the closest genetic relationships with the cows in herd B. 2. The investigators collected only five random samples from each herd. a. What are the advantages of obtaining only five random samples from each herd? Advantages: Only selecting five cows could keep costs down for the court case. It also takes less time than testing the entire herd. b. What are the disadvantages of obtaining only five random samples from each herd? Disadvantages: Five samples may not be enough to get an accurate measurement of the DNA profiles in each herd, especially since one herd had more cows than the other. Choosing cows at random may not be an appropriate method in selecting which cows to test; maybe choosing cows that resembled the mystery cow could have helped. 3. If you were a geneticist working on this case, how would you improve the design of the study, data collection procedure, and data analysis? Students’ answers may vary but could include the idea that the farmers were probably not trained in DNA collection techniques, and they may also be biased since they have a stake in the outcome of the testing. Therefore, third-party experts should be employed to collect samples to ensure that they were handled properly. Students

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

345

16 might say that they would determine the appropriate amount of cows to test before collecting samples, assess if random sampling is an appropriate method or if a different sampling method is better, figure out if buccal swabs are the best way to sample cow DNA versus another method, etc.

DNA Profile Comparison Chart Case Number: #345A7B Individual Tested

DNA Profile

Notes/Observations

Unknown sample Hope Diamond thief DNA

GCCATACGCAA

There are 4 As, 1 T, 2 Gs, and 4 Cs. There are 2 repeats (CC and AA).

Ginger S.

CATACTCTACC

There are 3 As, 3 Ts, 0 Gs, and 5 Cs. There is 1 repeat (CC only).

Sean B.

GATAGTCTATC

There are 3 As, 4 Ts, 2 Gs, and 2 Cs. There are no repeats.

Jeff K.

GCCTTACGCAA

There are 3 As, 2 Ts, 2 Gs, and 4 Cs. There are 3 repeats (CC, TT, and AA).

Kevin C.

AATGCCCTATT

There are 3 As, 4 Ts, 1 G, and 3 Cs. There are 3 repeats (AA, CCC, and TT).

Robin B.

TTTGCCACACT

There are 2 As, 4 Ts, 1 G, and 4 Cs. There is 1 repeat (TTT only).

Mike C.

TCAGTTCACAC

There are 3 As, 3 Ts, 1 G, and 4 Cs. There is 1 repeat (TT only).

Jessica G.

ATCGGGATCTA

There are 3 As, 3 Ts, 3 Gs, and 2 Cs. There is 1 repeat (GGG only).

Leo L.

CCTGTTAACAC

There are 3 As, 3 Ts, 1 G, and 4 Cs. There are 2 repeats (TT and AA).

Activity Questions 1. Based on the data presented in the DNA Profile Comparison Chart, what would you conclude about this case in your report to the investigators? Explain how you came to your findings for the investigators. Students should narrow down suspects to those with similar segments (Ginger S., Jeff K., Kevin C., and Leo L.). There were no matches; however, one known sample, Jeff K., had the most similar DNA to the thief. This suggests he may be a close relative to the unknown thief.

346

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

REVEALING REPEATS

| The Accidental Discovery of DNA Fingerprinting TEACHER NOTES

16

2. What are some potential disadvantages of the blood collection process at the crime scene? Students’ answers may vary, but they may discuss the potential for using poor techniques (e.g., neglecting to label blood samples, having individuals without adequate training collect the blood samples, neglecting to establish a chain of evidence, providing inadequate storage, not wearing gloves (to mitigate contamination), among other things). 3. How would you improve the data collection procedure and data analysis for the next forensic case? Students’ answers may vary but may include discussion to collect multiple blood samples and test the samples multiple times. Also, collecting blood samples from the individual(s) who were first on the scene of the crime to rule them out, etc.

Apply and Analyze 1. The worldwide DNA database helps reunite missing children with their families. Parents submit their DNA profile to the database and wait to see if there is a match to identify their missing child. Privacy issues (keeping your DNA information confidential) is a major concern. a.

What are the advantages of having a worldwide DNA database? One of the advantages is that the information is housed in one central location. That could make it easier to identify missing persons. Crimes could also be solved more quickly.

b. What are the disadvantages of a worldwide DNA database? Some disadvantages are that DNA databases could pose a threat to privacy, people/authorities could misuse the data for their own personal gain, etc. 2. Other than reuniting missing children with their families, how might geneticists use a worldwide DNA database? When should geneticists not use a worldwide DNA database? Students’ answers may vary. But they could say that such a database could be used to track genetic diseases globally. They might also say that geneticists shouldn’t use genetic material without consent or knowledge, particularly for profit or unethical (unapproved) research. One example may be geneticists releasing DNA information to health insurance companies so they can use one’s DNA as a way to deny health coverage.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

347

16 Resources and References McKie, R. 2009. Eureka moment that led to the discovery of DNA fingerprinting. TheGuardian.com. www.theguardian.com/science/2009/may/24/dna-fingerprinting-alecjeffreys. Shrivastava, P., T. Jain, and V. Trivedi. 2016. DNA fingerprinting: A substantial and imperative aid to forensic investigation. European Journal of Forensic Science 3 (3): 23–30. https://pdfs.semanticscholar.org/b549/0cae00f3fc1da437838bb62a9b565bb9f2da.pdf. The Tech Museum of Innovation. DNA fingerprinting is everywhere! http://genetics.thetech. org/original_news/news16. Yourgenome. 2016. What is a DNA fingerprint? www.yourgenome.org/facts/what-is-a-dnafingerprint. Zukerman, W. 2015. DNA helps reunite hundreds of missing children with their families. Australian Broadcasting Network. www.abc.net.au/radionational/programs/scienceshow/dnafinds-missing-children/6573694.

348

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

MR. ANTIBIOTIC, TEAR DOWN THIS (CELL) WALL

17

The Prokaryotic Resistance of Penicillin

A Case Study Using the Discovery Engineering Process Introduction Bacteria are living organisms classified as prokaryotes (meaning they are small and made of one cell with a cell wall but no nucleus). (See Figure 17.1.) Most bacteria are not harmful to humans. Some bacteria are used in making food, like cheese; and some bacteria are helpful, such as those that digest food in the human body. However, some bacteria can make you sick by attacking healthy tissues or releasing toxic chemicals that harm the body. Well-known disease-causing bacteria are Escherichia coli (also known as E. coli), Streptococcal (strep), and Staphylococcus (staph). Powerful medications called antibiotics fight against infections by killing the bacteria cells or preventing the growth of bacteria. These bacterial infections, if not treated with antibiotics, can cause severe medical problems, such as a high fever or

FIGURE 17.1 Prokaryotic Cell Structure

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

349

17 diarrhea, possibly leading to death. Before the development of antibiotics, there were few medical treatments for bacterial infections. Many individuals had to wait for the body to naturally fight the bacterial infection and hope not to die.

Lesson Objectives By the end of this case study, you will be able to • describe the history of penicillin development and antibiotic resistance; • analyze data to explore the efficacy (effectiveness) of bacteria and fungi to treat medical conditions or environmental issues; and • create a research proposal to justify a new use for bacterial species.

The Case This account outlines the discovery of the antibiotic penicillin. Once you have finished reading, answer the questions that follow. Dr. Alexander Fleming was a bacteriologist (a scientist who studies bacteria) who worked at St. Mary’s Hospital in London, England. He studied Staphylococcus aureus, a type of bacteria commonly found on the skin of humans. Dr. Fleming grew the bacteria in petri dishes (circular dishes that help protect bacteria as they develop) so he could observe their growth. Staphylococcus aureus is usually harmless. However, if this bacteria gets into the body through a cut or open wound, some individuals will develop a staph infection that can be deadly. In 1928, Dr. Fleming noticed that a mold called Penicillium (Figure 17.2) had accidentally mixed into the petri dishes he only used to study StaphyFIGURE 17.2 lococcus aureus. The mold was later identified as a rare strain of Penicil- Penicillium Mold Growing in a Petri Dish lium that became known as Penicillium notatum (now reclassified as Penicillium chrysogenum). In the area where this Penicillium mold was located, Staphylococcus aureus bacteria did not appear. It seemed when the mold was there, it inhibited (or prevented) the bacteria from growing. Dr. Fleming was intrigued. To make sure this wasn’t happening by accident, he decided to grow the

350

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

MR. ANTIBIOTIC, TEAR DOWN THIS (CELL) WALL

| The Prokaryotic Resistance of Penicillin

17

Penicillium mold on purpose to test its effects on Staphylococcus and other types of bacteria. Over several weeks, he documented how the Penicillium mold inhibited the growth of Staphylococcus aureus and other types of bacteria too. Dr. Fleming knew that the Penicillium mold could kill harmful bacteria, but it was difficult to make a pure solution (or medicine) that formed from the mold to help people. Dr. Fleming published his findings in 1929, but it would be another decade before the mold could help treat infections. In the late 1930s, chemists Dr. Howard Florey and Dr. Ernst Chain at Oxford University in England were able to isolate and purify the Penicillium mold fluid so that it could be used to fight bacterial infections. Before the chemists tested their mold fluid on humans, they tested it on mice. During the test, which occurred in 1940, the chemists separated mice into two groups. Both groups were infected with the deadly bacteria Streptococcus. One group of mice received an injection of Penicillium mold fluid (now called penicillin) and survived. The other group of mice did not receive a penicillin injection and died from the infection. Because of the success with the mice experiment, Dr. Florey started to test the penicillin injection with people. In 1941, a police officer named Albert Alexander cut his face and developed a severe bacterial infection. PenicilFIGURE 17.3 lin injections were given to Mr. Alexander, and he started to get Medicine Pills Made From Penicillium better. However, the amount of penicillin made was not enough to kill all the bacteria in Mr. Alexander’s body, and he died a few days later. This told scientists that the Penicillium notatum mold that Dr. Fleming discovered in his petri dishes many years ago could not make enough penicillin to treat people with bacterial infections. Now, the medical engineering problem was how to make enough penicillin in order to successfully treat people with bacterial infections. Since then, drug companies have made huge supplies of penicillin to treat bacterial infections (Figure 17.3). While the use of penicillin and other antibiotics has saved millions of human lives, there is the growing concern of antibiotic resistance. This occurs when not all bacteria are killed from an antibiotic treatment. These “survivors” begin to adapt so they are not affected by the antibiotic. Antibiotic

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

351

17 resistance can happen from the overuse and misuse (not taking the full course) of antibiotics.

Recognize, Recall, and Reflect 1. Dr. Fleming tested the effects of the Penicillium mold on bacteria several times before he published his findings. Why did he test his initial observation? 2. What did Dr. Howard Florey and Dr. Ernst Chain find when they used the penicillin injection in the sick mice? What happened to the mice that didn’t receive the penicillin? 3. Antibiotic resistance is a growing concern for the doctors and researchers. What two reasons are contributing to antibiotic resistance?

Investigate and Explain To determine if Penicillium chrysogenum (formerly Penicillium notatum) is better at killing Staphylococcus aureus than the mold known as Penicillium citrinum, scientists must test the effectiveness of each. Review an investigation of these molds. Then, answer the questions that follow. • Type of Molds: Penicillium chrysogenum and Penicillium citrinum (Both have been documented to kill harmful bacteria.) • Research Methodology: Scientists grow bacteria on an agar plate (a petri dish that has food for the bacteria to grow). Once the bacteria have had an opportunity to grow on the agar plate in an incubation unit, the scientists count the number of bacterial colonies (groups of bacteria growing together in clumps that can be seen with the naked eye). In this experiment, the scientists have three agar plates. The scientists will spread a diluted solution of Staphylococcus aureus to each of the three plates. (If the solution is not diluted, there will be too many bacteria colonies, and they will blend. This makes it hard to count the bacterial colonies.) After all the plates have a spread of Staphylococcus aureus solution, the scientists must treat two of the plates with the two different molds to determine if the molds inhibit the growth of the bacteria. Below is the description of each plate. • Plate 1: Agar plate with a solution of Staphylococcus aureus. • Plate 2: Agar plate with a solution of Staphylococcus aureus and Penicillium chrysogenum. • Plate 3: Agar plate with a solution of Staphylococcus aureus and Penicillium citrinum. • Data: The Staphylococcus aureus colony–count data were collected at the end of a seven-day incubation period on agar plates and recorded in Table 17.1.

352

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

MR. ANTIBIOTIC, TEAR DOWN THIS (CELL) WALL

| The Prokaryotic Resistance of Penicillin

17

TABLE 17.1 Staphylococcus Aureus Colony Count After a Seven-Day Growth Period Agar Plate Description

Colonies of Staphylococcus aureus

Agar plate with a solution of Staphylococcus aureus

157 colonies

Agar plate with a solution of Staphylococcus aureus and Penicillium chrysogenum

3 colonies

Agar plate with a solution of Staphylococcus aureus and Penicillium citrinum

2 colonies

1. According to Table 17.1, which agar plate was the most effective at inhibiting Staphylococcus aureus? Explain your reasoning. 2. The scientists only added Staphylococcus aureus solution to the first agar plate. What was the importance of only having an agar plate with Staphylococcus aureus growth? 3. If you worked as a bacteriologist in this lab, what would you do next in your experiment? How would you improve the design of the experiment? 4. Describe why there were colonies of Staphylococcus aureus growing in the Penicillium chrysogenum and Penicillium citrinum agar plates. What are the implications (or problems) of treating humans with penicillin knowing that not all Staphylococcus aureus colonies were destroyed?

Activity Imagine that you work as a biochemist (a scientist who studies the effects of chemicals on living things) for a national drug company. You are tasked to test three new substances (Substance K, Substance C, and Substance V) to see how well they fight against Escherichia coli (E. coli).

Part I You know that E. coli is a bacterium that lives in the digestive system of humans and other organisms. However, if an individual is exposed to E. coli from contaminated food or water, life-threatening symptoms can occur, such as intestinal cramps, bloody diarrhea, vomiting, and failure of organs leading to death. Because these substances are new, you are unable to start human clinical trials (testing on humans). However, you have permission to test the new substances on 360 hamsters. Your 360 hamsters are divided into three groups of 120 and are exposed to

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

353

17 E. coli. After 24 hours of being exposed to E. coli, each group will be assigned one of the three new substances to take. Each group will receive one injection of the substance once a day for five days. You will collect information (body temperature, blood samples, hamster activity, and heart rate) to assess how the hamsters infected with E. coli respond to the substances after the five-day testing period. (See Table 17.2.) After completing this part of the activity, answer the questions that follow.

TABLE 17.2 Hamster Response to Substances Data Collected on Day 5 of Injections (Data is the AVERAGE of all hamsters in each group.)

Substance K (120 hamsters)

Substance C (120 hamsters)

Substance V (120 hamsters)

Body Temperature (Note: The temperature range of a healthy hamster is 97°F–100°F.)

98.2°F (normal)

101.4°F (fever)

103.7°F (fever)

Blood Sample (Note: The presence of sepsis indicates a bacterial infection.)

Negative for sepsis

Negative for sepsis

Positive for sepsis

Hamster Activity (Note: Normal amounts of activity generally indicate a healthy hamster).

Normal, healthy activity

Lethargic (slow/ tired) activity

Lethargic (slow/ tired) activity

Heart Rate (Note: The normal heart rate for a healthy hamster is 300–400 beats per minute.)

410 beats/ minute

340 beats/ minute

455 beats/ minute

ACTIVITY QUESTIONS, PART I 1. Describe how E. coli reacted to each substance during the hamster test trials. 2. Which substance would you recommend as the best for treating E. coli in hamsters? Why? What are the possible negative consequences of using your recommended substance? 3. What additional measures or tests should be completed before recommending this substance for human clinical trials? 4. How would you improve your research design for the next set of tests?

354

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

MR. ANTIBIOTIC, TEAR DOWN THIS (CELL) WALL

| The Prokaryotic Resistance of Penicillin

17

Part II As a biochemist, you have successfully completed your first round of animal testing trials to determine if your substances fought against bacterial infection. You have also completed additional research about the dangers of antibiotic resistance. You want to continue to learn about the spread of antibiotic resistance. The top biochemist (your teacher) will help you model antibiotic resistance and will guide you through this activity. You will model antibiotic resistance and reproduction of bacteria using pom-poms and a die. After completing this part of the activity, answer the questions that follow. Materials 99 Container (of 245 green, red, and blue “live” pom-poms) labeled “Live Bacterial Colonies” 99 Container (that starts empty for “new” pom-poms) labeled “­Reproduced Bacterial Colonies” 99 Container (that starts empty for “dead” pom-poms) labeled “Dead­­Bacterial Colonies” 99 6-sided die (that acts as your antibiotic injection) 99 1 calculator (optional) Activity Background You will be modeling and collecting data on how antibiotic-resistant bacteria can spread due to the misuse or abuse of antibiotics. Each pom-pom represents one million bacteria or a bacterial colony. Some bacterial colonies are highly resistant, some moderately resistant, and some are not resistant to antibiotics. The level of resistance to antibiotics depends on the pom-pom’s color. Color Key: • Green pom-poms represent bacterial colonies that are not resistant to antibiotics. • Red pom-poms represent bacterial colonies that are moderately resistant to antibiotics. • Blue pom-poms represent bacterial colonies that are highly resistant to antibiotics. Activity Instructions 1. Randomly select three pom-poms from the teacher’s container labeled “Live Bacterial Colonies.”

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

355

17 2. At your desk or table, roll your 6-sided die for each of the three bacterial colonies you chose. This will determine if each bacterial colony will survive or die from an injection of antibiotics. This is determined based on the information in Table 17.3. Bacteria that survive the die roll will “live” to “reproduce.” Otherwise the colony “dies.” Document the survivability and reproduction of your bacterial colonies in the Round 1 chart. 3. After Round 1, you will complete the following steps with your three pompoms with your teacher: Place the pom-poms that are “dead” in the container labeled “Dead Bacterial Colonies.” Place the pom-poms that “lived” in the container labeled “Reproduced Bacterial Colonies.” This means that the pom-poms that “lived” went on to reproduce. 4. Repeat Step 1 by randomly selecting three pom-poms from the “Live Bacterial Colony” container. 5. Repeat the activity instructions for four more rounds (or more, as directed by your teacher). 6. Record all your data for subsequent rounds in the appropriate chart. (The Round 2, Round 3, Round 4, and Round 5 charts appear on pp. 357–358.)

356

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

MR. ANTIBIOTIC, TEAR DOWN THIS (CELL) WALL

| The Prokaryotic Resistance of Penicillin

17

TABLE 17.3 Bacteria Colony Survivability Chart Bacterial Colony Resistance Level

Die Roll: Colony SURVIVES!

Die Roll: Colony DIES!

NOT Resistant

1

2, 3, 4, 5, 6

Red

MODERATELY Resistant

1, 2, 3

4, 5, 6

Blue

HIGHLY Resistant

1, 2, 3, 4, 5

6

Pom-Pom Color Green

Round 1

Pom-Pom

Color of Pom-Pom

Die Roll (number on the die)

Bacteria: Survived or Died?

Reproduction? (died—no reproduction; lived—produces one more)

Pom-pom 1

Pom-pom 2

Pom-pom 3

Round 2

Pom-Pom

Color of Pom-Pom

Die Roll (number on the die)

Bacteria: Survived or Died?

Reproduction? (died—no reproduction; lived—produces one more)

Pom-pom 1

Pom-pom 2

Pom-pom 3

(Continued)

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

357

17 Table 17.3 (continued)

Round 3

Pom-Pom

Color of Pom-Pom

Die Roll (number on the die)

Bacteria: Survived or Died?

Reproduction? (died—no reproduction; lived—produces one more)

Pom-pom 1

Pom-pom 2

Pom-pom 3

Round 4

Pom-Pom

Color of Pom-Pom

Die Roll (number on the die)

Bacteria: Survived or Died?

Reproduction? (died—no reproduction; lived—produces one more)

Pom-pom 1

Pom-pom 2

Pom-pom 3

Round 5

Pom-Pom

Color of Pom-Pom

Die Roll (number on the die)

Bacteria: Survived or Died?

Reproduction? (died—no reproduction; lived—produces one more)

Pom-pom 1

Pom-pom 2

Pom-pom 3

358

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

MR. ANTIBIOTIC, TEAR DOWN THIS (CELL) WALL

| The Prokaryotic Resistance of Penicillin

17

ACTIVITY QUESTIONS, PART II 1. What did you notice about the numbers of the different resistance levels before and after the activity? 2. What could be done to help prevent the spread of antibiotic-resistant bacteria? 3. Why is it important to learn about the spread of antibiotic-resistant bacteria?

Apply and Analyze The World Health Organization stated that antibiotic resistance is a significant threat to everyone because of the misuse of antibiotics in humans and animals. Because of antibiotic resistance, bacterial infections such as pneumonia and tuberculosis are harder to treat. Read this article from the Washington Post (www.washingtonpost.com/ news/to-your-health/wp/2016/05/26/the-superbug-that-doctors-have-been-dreading-justreached-the-u-s/?utm_term=.8df439764f2b) about the dangers of antibiotic resistance. Then, answer the questions that follow. 1. Describe why there has been an increase in antibiotic resistance. 2. Why do you think doctors were using colistin (a type of antibiotic) as a last-line defense against antibiotic-resistant bacteria?

Design Challenge The case study in this lesson illustrates how a scientific observation led to a solution to a problem. Observations and discoveries often spark ideas for innovations. This is especially true in the field of engineering. Engineering is the application of scientific understanding through creativity, imagination, problem solving, and the designing and building of new materials to address and solve problems in the real world. You will be asked to take the science you have learned in this case to design a process or product to address a real-world issue. Engineers use the engineering design process (see Figure 17.4, p. 360) as steps to address a real-world problem. You will now use this process as you come up with a way to treat a medical or environmental issue with bacteria or fungi. In this case, you are asking the question (Step 1) of how bacteria and fungi might be used to treat or control an illness or solve an environmental problem. Using outside research, you will brainstorm (Step 2) a specific way for a known bacteria or fungi to solve a problem. Next, you will create a plan (Step 3) for your idea. Then, you will create (Step 4) a research proposal to a medical research university that describes how your idea will work. Finally, you will think about how you would test your bacteria- or fungi-based treatment and consider improvements (Step 6) to your idea.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

359

17 FIGURE 17.4 The Engineering Design Process

1 Ask Questions and Define the Problem 6

2

Revise and Improve

Brainstorm and Imagine

3 5

The Engineering Design Process

3

Test and Evaluate

Plan 4 Design and Create

1. Ask Questions Ask questions about how people could use bacteria or fungi to solve a problem. For example, why should we consider using bacteria and fungi to treat or control illnesses or solve an environmental issue? In what types of situations could bacteria or fungi be successfully used as a treatment?

2. Brainstorm and Imagine Penicillin from Penicillium chrysogenum (formerly known as Penicillium notatum) is not the only antibiotic that has been produced for medicinal applications. Many forms of bacteria and other organisms (such as fungi, which includes mushrooms) could potentially be used to treat illness or solve other problems. You can find more information on medicinal bacteria and fungi here: https://owlcation.com/stem/Medications-From-Molds-Fungi-and-Health. Based on this information and your research, think of a new way bacteria and fungi can be used to solve a problem. Can you design a new way for bacteria and fungi to effectively treat or control a disease or help the environment?

360

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

MR. ANTIBIOTIC, TEAR DOWN THIS (CELL) WALL

| The Prokaryotic Resistance of Penicillin

17

For example, Rothia are a bacteria typically found living in the mouth that can cause heart infections. They are known for breaking down nitrates, which is a substance in the nitrogen cycle. What could you use this bacteria for that is helpful to humans? Could the bacteria break down fertilizer in the soil to reduce farm pollution?

3. Create a Plan Create a plan for your new bacteria- or fungi-based treatment for an illness or to solve an environmental problem. In your plan, (1) identify which organism (bacteria or fungi) you want to use, (2) two ways your treatment with the bacteria or fungi will work, and (3) what two issues the bacteria or fungi treatment will solve. Use the Create a Plan worksheet (p. 363) for guidance.

4. Design and Create Create a proposal to a university research program to ask for funding for research into your idea for a new bacteria- or fungi-based treatment. Include the following in your proposal: • A description of your new idea: What is your idea? What makes it a new idea? • The purpose of your new idea: Why should we use this bacteria or fungi in this new way? What is the importance of this new idea? • Who will be affected: Who or what would benefit from this idea? What type of reaction (both positive and negative) do you expect from recipients of the treatment? • How will the individuals be protected? • How will you share the results with the individuals involved in your new idea? • What are potential disadvantages of using the bacteria or fungi in the new way? • What would you do if your new idea was not working well?

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

361

17 5. Test and Evaluate Think of a way to test the efficacy of your new idea. Consider the following questions as you come up with an evaluation strategy. • What data will you collect to test the efficacy and safety of the new use of your bacteria? Phase 1—What would you do for laboratory testing? Phase 2—What would you do for animal-based testing? Phase 3—What would you do for clinical trials? Surveillance—What would you do to ensure ongoing evaluation of the product on the market? • How will you monitor the use of the bacteria or fungi to prevent further infections, side effects, and resistance to drugs in recipients? • If the new use of the bacteria or fungi were not successful, how would you redesign the use to help humans or the environment? • How would you collaborate with the Centers for Disease Control and Prevention and the World Health Organization to ensure that your bacteria or fungi would not spread, causing medical problems across the world? Fill out the Evaluation Plan graphic organizer (p. 364), and then add it to your proposal.

6. Revise and Improve Present your proposal to your peers. Listen to their feedback on your proposal and take some time to revise it and make improvements. What are some ways you can use their input to refine your proposal? You may choose to accept all or only some of the suggestions. Be sure to justify your reasons for accepting or not using the peer feedback.

362

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

MR. ANTIBIOTIC, TEAR DOWN THIS (CELL) WALL

| The Prokaryotic Resistance of Penicillin

17

Create a Plan 1

What bacteria or fungi do you want to use?

2

How does your treatment work? (Describe two effects.) Effect #1:

Effect #2:

3

What problem will this help solve? (Describe two problems.) Problem #1:

Problem #2:

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

363

17 Evaluation Plan

Step #1:

_____________________________________________________________________ Step #2:

_____________________________________________________________________ Step #3:

_____________________________________________________________________ Step #4:

_____________________________________________________________________

364

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

MR. ANTIBIOTIC, TEAR DOWN THIS (CELL) WALL

| The Prokaryotic Resistance of Penicillin

17

TEACHER NOTES

MR. ANTIBIOTIC, TEAR DOWN THIS (CELL) WALL

THE PROKARYOTIC RESISTANCE OF PENICILLIN A Case Study Using the Discovery Engineering Process

Lesson Overview In this lesson, students explore the history and discovery of penicillin. The accidental discovery of penicillin revolutionized the treatment of bacterial infections. Newly discovered species of bacteria and newly discovered uses of bacteria are providing the foundation for wondrous medical advancements. However, antibiotic resistance has become a serious issue due to the of misuse or abuse of antibiotics. Students will model antibiotic resistance through a hands-on activity and use sample data to determine the efficacy and safety of using bacteria for a medical treatment with animal trials. Finally, students will use case information to design a new use for a specific species of bacteria or fungi.

Lesson Objectives By the end of this case study, students will be able to • describe history of penicillin development and antibiotic resistance; • analyze data to explore the efficacy (effectiveness) of bacteria and fungi to treat medical conditions or environmental issues; and • create a research proposal to justify a new use for bacterial species.

Use of the Case Due to the nature of these case studies, teachers may elect to use any section of each case for their instructional needs. They are sequenced in order (scaffolded) so students think more deeply about the science involved in the case and develop an understanding of engineering in the context of science.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

365

17 Curriculum Connections Lesson Integration This lesson may be taught during a unit on bacteria or fungi characteristics, infectious disease, antibiotic resistance, or genetics. It also fits well into a lesson on data interpretation or discussions of prokaryote and eukaryote differences, asexual and sexual reproduction of bacteria and fungi, treatment of infectious disease, application of bacterial growth in a laboratory, and epidemiology.

Related Next Generation Science Standards PERFORMANCE EXPECTATIONS • MS-LS2-2. Construct an explanation that predicts patterns of interactions among organisms across multiple ecosystems. • HS-LS2-2. Use mathematical representations to support and revise explanations based on evidence about factors affecting biodiversity and populations in ecosystems of different scales. • HS-LS3-3. Apply concepts of statistics and probability to explain the variation and distribution of expressed traits in a population. • HS-ETS1-2. Design a solution to a complex real-world problem by breaking it down into smaller, more manageable problems that can be solved through engineering. • HS-ETS1-3. Evaluate a solution to a complex real-world problem based on prioritized criteria and trade-offs that account for a range of constraints, including cost, safety, reliability, and aesthetics, as well as possible social, cultural, and environmental impacts.

SCIENCE AND ENGINEERING PRACTICES • Asking Questions and Defining Problems • Developing and Using Models • Planning and Carrying out Investigations • Analyzing and Interpreting Data • Constructing Explanations and Designing Solutions • Engaging in Argument From Evidence

366

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

MR. ANTIBIOTIC, TEAR DOWN THIS (CELL) WALL

| The Prokaryotic Resistance of Penicillin TEACHER NOTES

17

CROSSCUTTING CONCEPTS • Patterns • Cause and Effect • Systems and Systems Modeling

Related National Academy of Engineering Grand Challenges • Engineer Better Medicines • Engineer the Tools of Scientific Discovery

Lesson Preparation Before starting the lesson, it is helpful for the students to have some understanding of prokaryotes, differences in bacteria and fungi, and antibiotic resistance. Review the concepts of prokaryotic structure and antibiotic resistance so students may understand the relevance of the modeling activity. You will need to make copies of the entire student section for the class. Students will need internet access at various points in the lesson. Alternatively, you can project videos or print and distribute copies of online content for the class. Look at the Teaching Organizer (Table 17.4, p. 368) for suggestions on how to organize the lesson. For the Activity section, you may ask students the following guiding questions: • What did you notice about the numbers of the different resistance levels before and after the activity? • What could be done to help prevent the spread of antibiotic resistant bacteria? • Why is it important to learn about the spread of antibiotic resistant bacteria?

Materials For class 99 200 green pom-poms 99 40 red pom-poms 99 5 blue pom-poms 99 Container (of 245 green, red, and blue “live” pom-poms) labeled “Live Bacterial Colonies” 99 Container (that starts empty for “new” pom-poms) labeled “­Reproduced Bacterial Colonies” 99 Container (that starts empty for “dead” pom-poms) labeled “Dead B ­ acterial Colonies”

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

367

17 (Note: Instead of pom-poms, you may also use cotton balls. Pom-poms or cotton balls can be any three different colors as long as the amount of each color is consistent with the directions.) For each student or student group 99 6-sided die 99 1 calculator (optional)

Time Needed Up to 155 minutes

TABLE 17.4 Teaching Organizer Section

Time Suggested

Materials Needed

Additional Considerations

The Case

10 minutes

Student pages

Activity done individually in class or as homework prior to class

Investigate and Explain

10 minutes

Student pages

Activity done individually or in pairs

Activity

45–60 minutes

Student pages, materials for pom-pom activity

Activity done individually or in pairs

Apply and Analyze

10–15 minutes

Student pages, internet access

Individual activity

Design Challenge

45–60 minutes

Student pages, internet access

Small-group activity

Vocabulary

368

• antibiotic resistance

• contaminated

• penicillin

• antibiotics

• inhibited

• petri dishes

• bacteria

• isolate

• prokaryotes

• bacteriologist

• misuse

• purify

• chemist

• overuse

• species

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

MR. ANTIBIOTIC, TEAR DOWN THIS (CELL) WALL

| The Prokaryotic Resistance of Penicillin TEACHER NOTES

17

Extensions This lesson can lead into brainstorming sessions with the following guiding questions: (1) What rights should animals have when involved in laboratory testing? (2) What new protocols or procedures should be in place before doctors can administer or prescribe antibiotics to patients who are sick to help prevent the spread of the resistance of antibiotics?

Assessment Use the Teacher Answer Key to check the answers to section questions. You can evaluate the students’ proposals to assess the Design Challenge. Students’ proposals should provide a coherent conceptualization of a new bacteria- or fungi-based treatment. Each proposal should describe the students’ idea, explain who or what will be affected by the treatment, detail how recipients of the treatment will be protected, and determine the potential disadvantages of using this bacteria or fungi. Students should include ideas for collecting data through laboratory, animal, environmental, and/or human trials to measure the efficacy of their idea. They should also be able to report or state any constraints or drawbacks they can foresee with implementing this design.

Teacher Answer Key Recognize, Recall, and Reflect 1. Dr. Fleming tested the effects of the Penicillium mold on bacteria several times before he published his findings. Why did he test his initial observation? To ensure the accuracy (that is, the validity and reliability) of the results. He wanted to find out if his results were due to his specific intervention with the mold or other factors and if could he repeat his experiment and garner similar results. 2. What did Dr. Howard Florey and Dr. Ernst Chain find when they used the penicillin injection in the sick mice? What happened to the mice that didn’t receive the penicillin? Mice that received the penicillin shot survived their infection; the mice that did not receive the shot died. 3. Antibiotic resistance is a growing concern for the doctors and researchers. What two reasons are contributing to antibiotic resistance? Antibiotic resistance arises from the overuse (using when not needed) and misuse (not taking the full course) of antibiotics.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

369

17 Investigate and Explain 1. According to Table 17.1, which agar plate was the most effective at inhibiting Staphylococcus aureus? Explain your reasoning. The agar plate with a solution of Staphylococcus aureus and Penicillium citrinum was most effective. However, Penicillium chrysogenum killed one less colony than Penicillium citrinum. So, a case could be made by the student that both are nearly as effective. 2. The scientists only added Staphylococcus aureus solution to the first agar plate. What was the importance of only having an agar plate with Staphylococcus aureus growth? It was added as a control group to ensure that the bacteria were growing properly on the agar plate. 3. If you worked as a bacteriologist in this lab, what would you do next in your experiment? How would you improve the design of the experiment? The first step is to retest. Ideas for design improvement could include creating control groups for each test and using different bacteria as a measure. 4. Describe why there were colonies of Staphylococcus aureus growing in the Penicillium chrysogenum and Penicillium citrinum agar plates. What are the implications (or problems) of treating humans with penicillin knowing that not all Staphylococcus aureus colonies were destroyed? It is possible that the bacteria strain already carried a resistance or was not in contact with the mold. If the colonies are resistant, new medical procedures or drugs will have to be developed to kill the new colonies.

Activity Questions, Part I 1. Describe how E. coli reacted to each substance during the hamster test trials. Based on the data in the table, the E. coli’s infection was drastically reduced in Substance K, somewhat effective in Substance C, and not effective in Substance V. 2. Which substance would you recommend as the best for treating E. coli in hamsters? Why? What are the possible negative consequences of using your recommended substance? Substance K appeared to be the most effective—it reduced temperature, had no evidence of causing sepsis, and the hamsters treated with it appeared to be active. Side effects could include the increase in heart rate, causing cardiovascular complications.

370

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

MR. ANTIBIOTIC, TEAR DOWN THIS (CELL) WALL

| The Prokaryotic Resistance of Penicillin TEACHER NOTES

17

3. What additional measures or tests should be completed before recommending this substance for human clinical trials? Students’ answers may vary and may include retesting and using a different animal or other medical procedure. 4. How would you improve your research design for the next set of tests? Students’ answers may vary but may include reviewing each hamster as the current data are only showing the average of all 120 hamsters in each group; developing a control group; collecting other types of data that may indicate the presence of the bacteria in the hamster’s body.

Activity Questions, Part II 1. What did you notice about the numbers of the different resistance levels before and after the activity? Students’ answers may vary but may include a point to a shift in population level resistance. Specifically, in completing the activity, students should note that resistance levels in the pom-pom population increased over time. 2. What could be done to help prevent the spread of antibiotic-resistant bacteria? Students’ answers may vary but could include a discussion about over-prescription of antibiotics by doctors and issues of people using antibiotics without a proper prescription. They may also state that people should take their entire course of antibiotics as prescribed, even if they are feeling better. 3. Why is it important to learn about the spread of antibiotic-resistant bacteria? Students’ answers may vary but may include suggestions for continued research into antibiotic-resistant bacteria is important in keeping the public safe from outbreaks of antibiotic-resistant bacterial infections and in developing new types of antibiotics.

Apply and Analyze 1. Describe why there has been an increase in antibiotic resistance. Misuse and overprescribing of antibiotics and the overuse/misuse of antibiotics in the farming industry; any other well-thought-out answer.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

371

17 2. Why do you think doctors were using colistin (a type of antibiotic) as a lastline defense against antibiotic-resistant bacteria? According to the article, colistin is only used if the other medications/drugs do not kill the bacteria. Because it is a powerful antibiotic, it would be used sparingly to ensure there is a stock of antibiotics that is not antibiotic-resistant.

Resources and References Crampton, L. 2017. Medicines from fungi: Penicillin, lovastatin, and cyclosporine. Owlcation. https://owlcation.com/stem/Medications-From-Molds-Fungi-and-Health. Nobel Media AB. Ernst B. Chain – biographical. NobelPrize.org. www.nobelprize.org/prizes/ medicine/1945/chain/facts. Nobel Media AB. Sir Alexander Fleming – biographical. NobelPrize.org. www.nobelprize. org/nobel_prizes/medicine/laureates/1945/fleming-bio.html. Nobel Media AB. Sir Howard Florey – biographical. NobelPrize.org. www.nobelprize.org/ prizes/medicine/1945/florey/facts. Sun, L. H., and B. Dennis. 2016. “The Superbug That Doctors Have Been Dreading Just Reached the U.S.” The Washington Post, May 27. www.washingtonpost.com/news/to-yourhealth/wp/2016/05/26/the-superbug-that-doctors-have-been-dreading-just-reached-the-us/?utm_term=.8df439764f2b.

372

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

HIDDEN IN PLAIN SIGHT Darwin’s Observations in the Galápagos Islands

18

A Case Study Using the Discovery Engineering Process Introduction Charles Darwin is known as the “father of evolution” due to his research in the Galápagos Islands, an archipelago (or a set of islands) located off the coast of Ecuador in the Pacific Ocean (Figure 18.1, p. 374). The Galápagos Islands were formed by volcanic eruptions three million years ago, making them quite new compared to most of Earth’s land, which is billions of years old. Because of its volcanic terrain, which is bad for farming, no people ever settled on this archipelago. That meant that the area’s flora (plants) and fauna (animals) were untouched by humans for millions of years. During his travels, Darwin noticed certain animals living on different islands that were very similar to one another but had some key differences. One such animal was the finch, a type of small bird. Darwin found that finches on the Galápagos Islands were largely alike. But through careful, detailed, and sustained observations, he also noted that the finches’ beaks were differently sized depending on where they lived. Furthermore, a finch’s particular type of beak gave it the ability to eat the different types of food (seeds, fruit, insects, etc.) unique to that bird’s home island. Darwin concluded that as the original finch populations began to live on the newly formed and different islands, differences among individuals’ beak sizes emerged. This allowed for those individuals to consume different-size foods. In

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

373

18 FIGURE 18.1 A Map of the Galápagos Islands

this environment, a different beak size was an adaptation. The finch populations that were able to adapt could eat to survive and reproduce, passing their beak type trait (or physical feature) to the next generation. Those without an adaptive trait in beak size died and did not reproduce. Over time, this resulted in a diversity of finches. Scientists still use these types of observations to understand animal behavior, population growth, and diversity today.

Lesson Objectives By the end of this case study, you will be able to • describe the mechanism of variability through natural selection; • develop models of change over time using cladistics; • differentiate between analog observations and naturalistic observations; and • design a naturalistic experiment to observe a specific animal behavior.

374

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

HIDDEN IN PLAIN SIGHT

| Darwin’s Observations in the Galápagos Islands

18

The Case Read this except from Darwin’s 1859 book, On the Origin of Species. Consider how he used his observations to arrive at his conclusions about life on Earth. Once you have finished reading, answer the questions that follow. “It is interesting to contemplate a tangled bank, clothed with many plants of many kinds, with birds singing on the bushes, with various insects flitting about, and with worms crawling through the damp earth, and to reflect that these elaborately constructed forms, so different from each other, and dependent upon each other in so complex a manner, have all been produced by laws acting around us. These laws, taken in the largest sense, being Growth with Reproduction; Inheritance which is almost implied by reproduction; Variability from the indirect and direct action of the external conditions of life, and from use and disuse; a Ratio of Increase so high as to lead to a Struggle for Life, and as a consequence to Natural Selection, entailing Divergence of Character and the Extinction of less-improved forms. Thus, from the war of nature, from famine and death, the most exalted object which we are capable of conceiving, namely, the production of the higher animals, directly follows. There is grandeur in this view of life ... whilst this planet has gone circling on according to the fixed law of gravity, from so simple a beginning endless forms most beautiful and most wonderful have been, and are being evolved” (p. 529).

Recognize, Recall, and Reflect 1. What did Darwin mean when he wrote “inheritance which is almost implied by reproduction”? 2. Darwin wrote that there is “extinction of less-improved forms.” What is a less-improved form as it relates to natural selection? 3. Darwin uses the word evolved. Based on his writing, what do you think that word means?

Investigate and Explain Darwin observed that most finches were similar except for beak size. This observation led him to consider the location and diet of each type of finch. He saw that there were patterns in where finches lived and what finches ate, which is known as a niche. If more than one type of animal occupies the same niche, they must compete for resources. The ability for a single species, such as the ancestral finch, to speciate (wherein one species develops into different species) is known as adaptive radiation. Examine the data about adaptive radiation in finches in Figure 18.2 (p. 376), and then answer the questions that follow.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

375

18 FIGURE 18.2 Ten Species of Finches on the Galápagos Islands by Food Type

1. What is the relationship between where a bird lives (tree or ground) to the food they eat? 2. Which species of finch has the most specialized beak type? What evidence can you provide from the data to support your answer? 3. Which finches do you think compete most often for resources? Why?

Activity In this activity, you will first be shown a diagram called a cladogram in which species are grouped by their common traits. Your job will be to interpret the species’ development over time. Then, you will imagine you are a data scientist whose work involves viewing trends in data to create new products. As part of your work, you look through the history of technology to infer trends in consumer needs and wants for better marketing and product development. You will examine three types of technology in computers and telephones. Using two card sets of various technologies, you will sequence their development into different cladograms. Then, you will label the derived characteristics by writing the consumer need or want that pushed the market to create a new type of technology to replace it.

376

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

HIDDEN IN PLAIN SIGHT

| Darwin’s Observations in the Galápagos Islands

18

Part I Cladistics is a method of classifying species according to the proportion of measurable characteristics or traits they have in common, typically from a common ancestor. The species are organized into a cladogram, with the species most related to the common ancestor at the left or bottom of the diagram. This provides a visual representation of the relationships among species and change over time. This grouping is separated by shared derived characteristics, or a trait that is different between the species. Note that each species right of the shared derived characteristic (or on the same line) must possess that characteristic. View the cladogram in Figure 18.3 of dinosaurs. Then, answer the questions that follow.

ACTIVITY QUESTIONS, PART I 1. Which species is the most closely related to the Iguanodon? 2. Which animal is most closely related to the common ancestor of the ornithischian dinosaurs? How can you tell? 3. What derived characteristics do Stegosaurus and the Ankylosaurus share that separates them from the other dinosaur species?

FIGURE 18.3 Cladogram of Ornithischian Dinosaurs

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

377

18 Part II You will now receive two sets of cards, one for computers and the next for telephones. Take the computer cards and lay the cards out and discuss which card is the “common ancestor,” or original technology used in the set. Then lay out the other cards in order from least to most complex. Consider what “shared derived characteristic” separates each card in that set. Instead of environmenFIGURE 18.4 tal pressures, which facilitate animal adaptation, consider market pressures Evolution of Cartridge Bit Size from consumers that would facilitate an advancement in the technology. Record a “shared derived characteristic” between each card. For example, if you were comparing the Nintendo video game systems between the Nintendo Entertainment System, Super Nintendo, and Nintendo 64, you may note that the shared derived characteristics are changes in cartridge bit size (from 8 to 16 to 64; see Figure 18.4) or changes in controller button numbers (from 4 to 8 to 10; see Figure 18.5). Remember that each card right FIGURE 18.5 of the shared derived characteristic must also possess that characteris- Evolution of Controller Button Numbers tic. Sort your pictures on your desk into a cladogram. Then, record your cladograms by writing the names in the spaces below and drawing lines to show relationships. Last, label the shared derived characteristic between each technology.

378

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

HIDDEN IN PLAIN SIGHT

| Darwin’s Observations in the Galápagos Islands

18

Card Set Completed: Computers

Draw your cladogram with shared derived characteristics labeled between each card.

Card Set Completed: Telephones

Draw your cladogram with shared derived characteristics labeled between each card.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

379

18 Once you’ve completed your cladograms, ask a partner or another group to review your work. Then, answer the questions that follow.

ACTIVITY QUESTIONS, PART II 1. Were your cladograms similar to or different from those of your peers? Why or why not? 2. What was the most difficult part of this activity? 3. How are these cladograms different from cladograms of living species? 4. Thinking as a data scientist, use the information from your cladograms to predict a new trend in technology for both of the card sets.

Apply and Analyze How does a changing environment due to climate change affect animal populations? Use a simulation from the Lawrence Hall of Science (http://sepuplhs.org/ high/sgi/teachers/evolution_act11_sim.html) that models how environmental changes influence three populations of birds that you select. Run the simulation up until the 500,000-year mark. After using the simulation, answer the questions that follow. 1. Of the three birds you selected, how fit (or able to survive and reproduce) do you think each phenotype will be before you run the simulation? 2. As you ran the simulation to 500,000 years, what happened to each bird, and why? Describe any mutations or extinctions that occurred and final population numbers. Bird 1? Bird 2? Bird 3?

Design Challenge Engineering is the  application of scientific  understanding through creativity, imagination, problem solving, and the designing and building of new materials to address and solve problems in the real world. You will be asked to take the science you have learned in this case and design a process or product to address a realworld issue. For this activity, you will be focusing on finding new ways to observe wildlife or humans in natural settings in order to address a problem. The case study you read focused on the observations Darwin made of the finches in the Galápagos Islands. Darwin engaged in naturalistic observations—that is, observing animals without interacting with them in their natural environment. Analysis of animals in

380

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

HIDDEN IN PLAIN SIGHT

artificial settings, like zoos, are called analog observations. You will use the engineering design process (Figure 18.6) to come up with a new way to use naturalistic observation. Engineers use the engineering design process as steps to address a real-world problem. In this case, you are asking questions (Step 1) about situations that call for naturalistic observations. Using outside research, you will brainstorm (Step 2) a way to employ naturalistic observation in order to solve a problem. You will create a plan (Step 3) for your idea. Then, you will design (Step 4) a naturalistic research study to address your issue. Finally, you will have your peers evaluate (Step 5) your idea, and then you will consider improvements (Step 6) you can make.

| Darwin’s Observations in the Galápagos Islands

18

FIGURE 18.6 The Engineering Design Process

1 Ask Questions and Define the Problem 6

2

Revise and Improve

Brainstorm and Imagine

3 5

The Engineering Design Process

3

Test and Evaluate

Plan 4 Design and Create

1. Ask Questions Ask questions about naturalistic observation. For instance, how does naturalistic observation work? How is it different from other forms of observation, including analog observation? In what situations is naturalistic observation the best way to study an issue? Why might naturalistic observation be beneficial when studying wildlife?

2. Brainstorm and Imagine Naturalistic observation helps humans learn about wildlife so we can solve problems and figure out how to coexist with nature. Find out more about conducting a naturalistic observation here: www.radford.edu/~tpierce/201%20files/201%20handouts/ Naturalistic%20Observationl%20ecture%20notes.pdf. Using your background knowledge, think of a problem and a way to use naturalistic observation in order to help solve that problem. For example, wolf-coyote hybrids are starting to infiltrate urban and heavily populated areas. Because new

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

381

18 housing developments are overtaking their habitats and food sources, these animals are showing up into cities and suburbs. This is causing problems with people as these animals prey on pets and create litter by digging through people’s trash. Because this is a new, unstudied subspecies, their habits are not yet understood. Observing their behaviors can help reduce the hybrid animal’s impact on homes and communities. Can you think of an issue where naturalistic observation can help humans better understand the behavior or population growth of a species?

3. Create a Plan Create a plan for your idea to use naturalistic observation to address a problem. In your plan, summarize (1) the issue you want to address through observation, (2) what species you will study, (3) what you hope to accomplish or learn from your naturalistic observation, and (4) what tools or information you’d need to get your research study underway. Use the Create a Plan worksheet (p. 384) for guidance.

4. Design and Create Design a research study that uses naturalistic observation to help solve the problem you chose. Include the following information in your proposal: • When will the observation occur? • Where will the observation occur? • How long will you observe your subjects? • How will you observe the wildlife? Watching animals in person? Using motion-sensor cameras? With night-vision goggles? Using drones? • What specific behaviors will you look for to address the issue at hand? • How will you avoid disturbing the habitat where the research is taking place? • How do you plan to communicate your findings? Think creatively about how your naturalistic observation could be generalized to the greater population of species you are interested in studying. Use the Developing an Observation Plan worksheet (p. 385) for guidance.

382

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

HIDDEN IN PLAIN SIGHT

| Darwin’s Observations in the Galápagos Islands

18

5. Test and Evaluate Ask your peers to review your naturalistic research plan. Reviewers will evaluate the plan, asking themselves the following questions: • Is this a good idea? Does this address a current need for a naturalistic study? • Does the plan fit the parameters of a naturalistic observation (as compared to an analog observation)? • Does the plan provide a schedule and location for the research? • Does it explain how the observation will occur? • Does the plan detail how the researchers will avoid interacting with the species?

6. Revise and Improve Listen to your peers’ feedback on your plan and take some time to revise and make improvements. What are some ways you can use their input to refine your plan? You may choose to accept all or only some of the feedback. Be sure to justify your reasons for using or not taking suggestions.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

383

18 Create a Plan

384

1

What is the issue you wish to address through observation?

2

What species will you study?

3

What do you hope to accomplish or learn from your naturalistic observation?

4

What tools or information will you need to get your research underway?

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

HIDDEN IN PLAIN SIGHT

| Darwin’s Observations in the Galápagos Islands

18

Developing an Observation Plan When will the observation occur? __________________________________________________________________________________ Where will the observation occur? __________________________________________________________________________________ How long will the observation be? __________________________________________________________________________________ How will the observation occur? __________________________________________________________________________________ What specific behaviors will you look for? 1._____________________________________________________________________________ 2.____________________________________________________________________________ 3.____________________________________________________________________________ How will you avoid disturbing the habitat where the research is taking place? 1._____________________________________________________________________________ 2.____________________________________________________________________________ 3.____________________________________________________________________________ How will you communicate your findings? __________________________________________________________________________________

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

385

18 TEACHER NOTES

HIDDEN IN PLAIN SIGHT DARWIN’S OBSERVATIONS IN THE GALÁPAGOS ISLANDS

A Case Study Using the Discovery Engineering Process

Lesson Overview In this lesson, students explore the observations Charles Darwin made in the Galápagos Islands, which contributed to his writing of On the Origin of Species. His careful naturalistic observations led to the ideas of evolution through natural selection. Students will learn about cladistics and shared derived characteristics, using that information to explore relationships among various technological advancements. Students will use a simulation to understand how traits are more or less adapted to a changing environment. Finally, students will develop a naturalistic study to address an issue of concern regarding wildlife populations.

Lesson Objectives By the end of this case study, students will be able to • describe the mechanism of variability through natural selection; • develop models of change over time using cladistics; • differentiate between analog observations and naturalistic observations; and • design a naturalistic experiment to observe a specific animal behavior.

Use of the Case Due to the nature of these case studies, teachers may elect to use any section of each case for their instructional needs. They are sequenced in order (scaffolded) so students think more deeply about the science involved in the case and develop an understanding of engineering in the context of science.

386

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

HIDDEN IN PLAIN SIGHT

| Darwin’s Observations in the Galápagos Islands TEACHER NOTES

18

Curriculum Connections Lesson Integration This lesson may be taught during a unit on evolution. It also fits well into a lesson on natural selection and changes in the environment.

Related Next Generation Science Standards PERFORMANCE EXPECTATIONS • MS-LS4-2. Apply scientific ideas to construct an explanation for the anatomical similarities and differences among modern organisms and between modern and fossil organisms to infer evolutionary relationships. • MS-ETS1-4. Develop a model to generate data for iterative testing and modification of a proposed object, tool, or process such that an optimal design can be achieved. • HS-LS4-1. Communicate scientific information that common ancestry and biological evolution are supported by multiple lines of empirical evidence. • HS-LS4-4. Construct an explanation based on evidence for how natural selection leads to adaptation of populations. • HS-LS4-5. Evaluate the evidence supporting claims that changes in environmental conditions may result in: (1) increases in the number of individuals of some species, (2) the emergence of new species over time, and (3) the extinction of other species. • HS-ETS1-2. Design a solution to a complex real-world problem by breaking it down into smaller, more manageable problems that can be solved through engineering.

SCIENCE AND ENGINEERING PRACTICES • Asking Questions and Defining Problems • Developing and Using Models • Planning and Carrying out Investigations • Analyzing and Interpreting Data • Constructing Explanations and Designing Solutions • Engaging in Argument From Evidence

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

387

18 CROSSCUTTING CONCEPTS • Patterns • Cause and Effect • Stability and Change

Related National Academy of Engineering Grand Challenges • Advance Health Informatics • Engineer the Tools of Scientific Discovery

Lesson Preparation Before starting the lesson, it is helpful for the students to have some understanding of basic heredity and experimental design. Review the concepts of natural selection and Darwinian evolution. Ensure students do not develop the misconception that animals are engineered to their environments, rather natural factors shape populations and not individuals. You will need to make copies of the entire student section for the class. This includes making copies of the two card sorts (computers and telephones). Students will need internet access at various points in the lesson. Alternatively, you can project videos or print and distribute copies of online content for the class. Look at the Teaching Organizer (Table 18.1, p. 390) for suggestions on how to organize the lesson.

388

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

HIDDEN IN PLAIN SIGHT

| Darwin’s Observations in the Galápagos Islands TEACHER NOTES

18

Computers Card Sort (Print and cut out one set per student group.)

Computer 1

Computer 2

Computer 3

Computer 4

Computer 5

Computer 6

Computer 7

Computer 8

Computer 9

Computer 10

Telephones Card Sort (Print and cut out one set per student group.)

Telephone 1

Telephone 2

Telephone 3

Telephone 4

Telephone 5

Telephone 6

Telephone 7

Telephone 8

Telephone 9

Telephone 10

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

389

18 Time Needed Up to 155 minutes

TABLE 18.1 Teaching Organizer Section

Time Suggested

Materials Needed

Additional Considerations

The Case

10 minutes

Student pages

Activity done individually in class or as homework prior to class

Investigate and Explain

10 minutes

Student pages

Activity done individually or in pairs

Activity

60 minutes

Student pages, activity card sets

Activity done individually or in pairs

Apply and Analyze

10–15 minutes

Student pages, internet access

Individual activity

Design Challenge

45–60 minutes

Student pages, internet access

Small-group activity

Vocabulary • adaptation

• fitness

• adaptive radiation

• inheritance

• analog observation

• natural selection

• archipelago

• naturalistic observation

• cladistics

• niche

• cladogram

• observations

• common ancestor

• reproduction

• competition

• shared derived characteristics

• divergence

• speciate

• evolved

• species

• extinction

• trait • variability

390

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

HIDDEN IN PLAIN SIGHT

| Darwin’s Observations in the Galápagos Islands TEACHER NOTES

18

Extensions This lesson can be extended in two ways. First, you may wish to extend the Activity section by providing card sets of different examples of progression for such things as music, cameras, cooking, models of cars, and ways of generating light. This will provide students with more opportunities to understand how small changes over time foster different representations. Second, you may use the simulation from the Apply and Analyze section (http://sepuplhs.org/high/sgi/teachers/evolution_act11_sim. html). After 500,000 years of evolution, a hurricane hits the island in the simulation. This event models how rapid changes in the environment can lead to extinction or speciation. Other extensions include a discussion of advanced principles in evolution, including but not limited to population genetics and Hardy-Weinberg equilibrium. Also check out the resources listed below for ideas about lesson extensions: • Howard Hughes Medical Institute video on finch evolution (in English and Spanish) www.hhmi.org/biointeractive/the-origin-of-species-the-beak-of-the-finch • National Center for Case Study Teaching in Science PowerPoint on Darwin’s finches and natural selection) http://sciencecases.lib.buffalo.edu/cs/collection/ detail.asp?case_id=550&id=550 • Suggestions of live-feed wildlife cameras for naturalistic observation. Here a few suggestions: www.montereybayaquarium.org/animals-and-experiences/live-web-cams https://explore.org/livecams/brown-bears/brown-bear-salmon-cam-brooks-falls https://nationalzoo.si.edu/webcams/panda-cam http://cams.allaboutbirds.org

Assessment Use the Teacher Answer Key to check the answers to section questions.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

391

18 Teacher Answer Key Recognize, Recall, and Reflect 1. What did Darwin mean when he wrote “inheritance which is almost implied by reproduction”? Students’ answers may vary but they may surmise that Darwin meant that species’ traits are passed through reproduction, from generation to generation. 2. Darwin wrote that there is “extinction of less-improved forms.” What is a less-improved form as it relates to natural selection? It is a species or population that does not possess adaptive traits to be able to survive a changing environment. Thus, they are not able to reproduce. 3. Darwin uses the word evolved. Based on his writing, what do you think that word means? Students’ answers may vary, but may discuss the idea of a species whose traits change over time.

Investigate and Explain 1. What is the relationship between where a bird lives (tree or ground) to the food they eat? The finches that live on the ground eat mostly seeds (one eats cactus). The finches that live in the trees eat mostly insects (one eats buds). 2. Which species of finch has the most specialized beak type? What evidence can you provide from the data to support your answer? The vegetarian tree finch or the cactus ground finch have the most specialized beak type. This is because they are the only type of finch that eats a very specific food: buds for the vegetarian tree finch and cactus for the cactus ground finch. 3. Which finches do you think compete most often for resources? Why? Finches that live in the same place (ground or tree) and eat the same food (seeds or insects) compete the most. Because they occupy the same niche, they must compete for the same resources.

392

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

HIDDEN IN PLAIN SIGHT

| Darwin’s Observations in the Galápagos Islands TEACHER NOTES

18

Activity Questions, Part I 1. Which species is the most closely related to the Iguanodon? The Hypsilophodon, because it shares a common branch of the cladogram. 2. Which animal is most closely related to the common ancestor of the ornithischian dinosaurs? How can you tell? The Heterodontosaurus is most closely related to the common ancestor because it is in the far left of the diagram and is first listed. 3. What derived characteristics do Stegosaurus and the Ankylosaurus share that separates them from the other dinosaur species? Students’ answers may vary, but may include a weaponized (spiked, armored) tail or large plates (not spines) on their backs, etc.

Activity Questions, Part II 1. Were your cladograms similar to or different from those of your peers? Why or why not? Students’ answers will vary, but may discuss similarities and differences in their selection of different shared derived characteristics or cladogram design. 2. What was the most difficult part of this activity? Students’ answers will vary, but they could discuss that more than one “trait” changed between technologies (derived characteristics), so there could be multiple relationships made and drawn. 3. How are these cladograms different from cladograms of living species? Students should mention that natural processes (environmental changes) shape evolution, which is not prescribed in any direction and can often be due to random chance. By contrast, their cladograms show how non-natural factors (market pressure) facilitate changes in technology, which are prescribed in a specific direction and not due to random chance. 4. Thinking as a data scientist, use the information from your cladograms to predict a new trend in technology for each of the card sets. Students’ answers may vary, but their predicted advancements should reflect the “shared derived characteristics” trend noted in the cladograms. This can include

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

393

18 aspects of becoming smaller, more portable, wearable, safer, using less energy, using renewable energy, etc.

Apply and Analyze 1. Of the three birds you selected, how fit (or able to survive and reproduce) do you think each phenotype will be before you run the simulation? Students’ answers may vary depending on the bird(s) they selected. The simulation states that a short and straight beak is best to eat seeds, a long and straight beak is best for eating insects, and a long and curved beak is best for eating nectar. Larger-size birds are best suited to avoid predators and birds with plumage that best matches the colors of the foliage will avoid predation. Generally speaking, birds with beaks that can eat a wide variety of foods and those best able to avoid predation are most fit. 2. As you ran the simulation to 500,000 years, what happened to each bird, and why? Describe any mutations or extinctions that occurred and final population numbers. • Bird 1: Students’ answers will vary depending on the initial traits selected. • Bird 2: Students’ answers will vary depending on the initial traits selected. • Bird 3: Students’ answers will vary depending on the initial traits selected.

Resources and References Lawrence Hall of Science. Natural selection (simulation). University of California, Berkeley. http://sepuplhs.org/high/sgi/teachers/evolution_act11_sim.html. O’Neil, D. 2013. Darwin and natural selection. Palomar College. www2.palomar.edu/anthro/ evolve/evolve_2.htm. Pierce, T. Naturalistic observation. Radford University. www.radford.edu/~tpierce/201%20 files/201%20handouts/Naturalistic%20Observationl%20ecture%20notes.pdf. Sulloway, F. J. 2005. The evolution of Charles Darwin. Smithsonian Magazine. www. smithsonianmag.com/science-nature/the-evolution-of-charles-darwin-110234034. Wikipedia. Naturalistic observation. https://en.wikipedia.org/wiki/Naturalistic_observation.

394

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

MORE BARK THAN BITE

19

Using Bioprospecting to Find Cures for Disease

A Case Study Using the Discovery Engineering Process Introduction Bioprospecting is the process of investigating and identifying living organisms in nature that create specific chemicals, genetic material, or other bioresources that can be used for the research of medicines to cure diseases (like cancer) or for the development other economic goods (like cosmetics). Some researchers document the uses of bioresources from animals and plants by observing how people use the ingredients in their traditional medicines and foods. In general, plants tend to be the objects of desire when investigating resources for medical or economic gain. The chemicals and structures of plants have been used for medicinal treatments (Figure 19.1, p. 396) and economic tools since the dawn of humankind. Aspirin, a drug used to relieve pain, is manufactured from related chemicals found in different types of willow trees. Some species of poppy (a flowering plant) help create chemical compounds used in another painkiller, morphine. Once a chemical or bioresource has been identified, drug companies isolate (remove or separate) the chemical from its natural environment. The chemical is then manufactured and tested for medicinal or economic properties. If the chemical is useful based on the medical research in laboratory and clinical trials, the chemical is marketed as a medication.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

395

19 FIGURE 19.1 Various Medicinal Plants

Unfortunately, bioprospecting has been linked to biopiracy. Biopiracy occurs when the bioresource and the indigenous people who use the bioresource are exploited by drug and research companies. This can include stealing a bioresource and profiting without compensating. Protecting natural resources and the traditions of indigenous peoples are concerns being addressed worldwide as bioprospecting continues as a method in identifying new medicines and uses of bioresources.

Lesson Objectives By the end of this case study, you will be able to • investigate bioprospecting, plant-based medicinal treatments, and phylogenetic trees; • analyze a phylogenetic tree and create a guide for plant-based medicine research; and • design a medical treatment proposal based on the knowledge of bioprospecting, phylogenetic trees, and plant-based medicines.

396

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

MORE BARK THAN BITE

| Using Bioprospecting to Find Cures for Disease

19

The Case This account outlines the discovery of Taxol in the Pacific yew tree that may have the potential to treat cancer by stopping cell growth. Once you have finished reading, answer the questions that follow. Cancer is a disease caused by the abnormal growth of cells that may spread to other body parts. The most common types include breast cancer, melanoma (skin cancer), lung cancer, and leukemia (cancer of the blood). Cancer treatments are often done by surgery (removal of cancer cells), chemotherapy (using chemicals to kill cancer cells), and radiation (using high energy to kill cancer cells). Because there are many different types of cancers that can lead to death, governments, medical treatment centers, and drug companies have all invested time, money, and research in developing cancer treatments. The cancer-fighting chemical paclitaxel was discovered in the bark of the Pacific yew tree (Figure 19.2). Sold under the name Taxol, it is used to treat breast and ovarian cancers. Paclitaxel was originally found in the 1960s. The discovery of the chemical occurred as the result of the National Cancer Institute (NCI) funding research for the prevention, early diagnosis, and treatment of cancer. In 1962, a botanist collaborating with NCI was randomly collecting bark from a Pacific yew tree in Washington state. It was later examined by two scientists, Monroe Wall and Mansukh Wani. The scientists discovered that some of the chemicals, including paclitaxel, were surprisingly toxic. Later, laboratory research using mice showed that paclitaxel halted the growth of cancer by preventing cell division (the process of one cell dividing into two or more cells). This caused the cells to die. Medical researchers were intrigued and began testing the effects of the chemical on ovarian cancer. Early clinical trial results on FIGURE 19.2 humans suggested that it might successfully treat cancer in peoHarvesting Pacific Yew Tree Bark ple. However, it was difficult to harvest the massive amounts of paclitaxel needed for the clinical trials from the Pacific yew trees’ bark, and collecting the bark resulted in the death of the trees (Figure 19.2). In fact, extracting the amount of Taxol needed on a worldwide scale could cause the tree to go extinct. It seemed that the cancer treatment research involving paclitaxel would be too expensive to continue.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

397

19 Instead of getting the chemical from trees, researchers and scientists focused on developing a synthetic (manmade) paclitaxel chemical. During the early to mid1990s, the Food and Drug Administration (FDA) approved paclitaxel, now branded as Taxol, for breast and ovarian cancer treatments. Recently, Taxol has been used in a series of investigations to treat other forms of cancer because of its ability to stop cancer cells from dividing.

Recognize, Recall, and Reflect 1. What did the scientists who first tested the Pacific yew tree bark find during their investigations? 2. Why was it difficult for researchers to make enough paclitaxel to use in clinical trials? 3. What is the importance of clinical trials to test a medication before the medication is released to the public?

1. Which species is most closely related to the Araucaria? How can you tell?

3. What number is the common ancestor between plum yews and yews? How can you tell?

398

Araucaria

Podocarpus

plum yews

5 4 time

2. Which species has remained unchanged from the root ancestor? How can you tell?

yews

cypresses

Japanese umbrella pine

Phylogenetic trees are diagrams used to show the evolutionary relationships among organisms, sort of like a family tree. The top branches show the descendants (or current species); the ancestors of these species (often extinct) are at the bottom (or root). Each fork in the tree shows a speciation event (where a species split and became two FIGURE 19.3 new species). Determining the phylogeny of related species shows inherited traits. Read the A Phylogeny of Evergreen Plants phylogenetic tree of different evergreen plants, including yew tree species (Figure 19.3). Note that the numbers represent ancestors. After examining the data, answer the questions that follow.

pines

Investigate and Explain

3 2 1

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

MORE BARK THAN BITE

| Using Bioprospecting to Find Cures for Disease

19

Activity Imagine you are an evolutionary biologist who studies the relationship of diverse living organisms starting from a common ancestor. As part of your work, you research the relationships of Panax quinquefolius (American ginseng), a plant that is popular in traditional medicine as well as medical research involving the immune system, diabetes, and cancer. A biochemist who studies the chemicals of plants has notified you that a new type of ginsenoside (a chemical in ginseng) has been found and may be effective in treating mental health issues like depression. Unfortunately, you know that American ginseng has been overharvested and could be placed on the endangered species list soon. The specific type of ginsenoside identified by the biochemist might be found in other ginseng species. You will review the phylogenetic tree of ginseng species (Figure 19.4) and provide information to the biochemist about your findings. After completing the activity, answer the questions that follow. Phylogenetic Tree: Examine the ginseng phylogenetic tree and locate Panax quinquefolius (American ginseng). Consider the two guiding questions below. • Guiding Question 1: Why are you examining the phylogenetic tree for the closest evolutionary relationships to Panax quinquefolius (American ginseng)? • Guiding Question 2: Which species of ginseng is most closely related to Panax quinquefolius (American ginseng)? What is the evidence for your answer?

FIGURE 19.4 The Phylogeny of Ginseng

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

399

19 Meeting With Biochemist: You share with the biochemist that American ginseng is overharvested and obtaining large amounts of ginseng to extract ginsenoside chemicals will be difficult. You suggest that the biochemist try to identify the ginsenoside chemicals in closely related species of Panax quinquefolius (American ginseng). • Guiding Question 3: Which species of ginseng do you suggest the biochemist investigate? Why? Biochemist Test Results: The biochemist returns to your research laboratory after testing for the specific ginsenoside chemical in the species you suggested. The biochemist shares that the specific ginsenoside chemical was not identified during the testing. You review the phylogenetic tree once more to determine which species of ginseng should be tested next. • Guiding Question 4: Because the previous suggestion did not yield the specific ginsenoside chemical needed for testing by the biochemist, you review the phylogenetic tree for a possible related species. Which species of ginseng do you suggest the biochemist investigate next? Why? Biochemist Test Results: The results of the next test are revealed a month later. The biochemist’s report shows that the newly suggested species of ginseng you suggested had trace (very small) amounts of the specific ginsenoside chemical. Unfortunately, this amount of the ginsenoside chemical is less than Panax quinquefolius (American ginseng). • Guiding Question 5: What might be your next step to help the biochemist find a ginseng plant with a higher concentration of the ginsenoside chemical? Final Test Methodology and Results: You suggest that the biochemist test all known ginseng species on your phylogenetic tree for the ginsenoside chemical. Once completed, the biochemist prepares a report (Table 19.1) of the tested ginseng species. The report shows the species of ginseng tested, the concentration of ginsenoside chemical levels in the plants, and laboratory test notes. • Guiding Question 6: Review the results of the test. Based on this data, what is your suggestion to the biochemist regarding the collection of ginsenoside? • Guiding Question 7: What are the benefits and challenges of testing all ginseng species listed on the phylogenetic tree?

400

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

MORE BARK THAN BITE

| Using Bioprospecting to Find Cures for Disease

19

TABLE 19.1 Ginsenoside Chemical Test Results Ginseng Species Tested

Ginsenoside Chemical Level in the Plant (mg/mL)

Panax bipinnatifidus

0.00 mg/mL

Panax ginseng (Chinese)

0.00 mg/mL

Panax ginseng (Korea)

0.00 mg/mL

Panax japonicus

0.07 mg/mL

Panax major

0.08 mg/mL

Panax notoginseng

0.04 mg/mL

Panax pseudoginseng

0.00 mg/mL

Panax quinquefolius

0.12 mg/mL

Panax stipuleanatus

0.00 mg/mL

Panax trifolius

0.15 mg/mL

Panax vietnamensis

0.08 mg/mL

Panax wangianus

0.09 mg/mL

Panax zingiberensis

0.14 mg/mL

Laboratory Test Notes •• Note 1: A level of 0.00 mg/ mL indicates no detection of the ginsenoside chemical. •• Note 2: A level of 0.01 mg/mL to 0.05 mg/ mL indicates low level of detection of the ginsenoside chemical. •• Note 3: A level of 0.06 mg/mL to 0.10 mg/mL indicates a moderate level of detection of the ginsenoside chemical. •• Note 4: A level of 0.11 mg/mL to 0.15 mg/mL indicates a high level of detection of the ginsenoside chemical.

Creating a Ginseng Information Guide: Now that the biochemist has the information needed to begin additional testing, you will need to create a guide describing ginseng species, where they are located, and environmental measures to protect ginseng from becoming endangered. The purpose is to educate the biochemist on ginseng. There are two steps in this process: (1) complete the Guide Chart on Ginseng on the following page, and (2) design your Ginseng Information Guide using the information you collected in the guide chart. Materials: 99 Computer paper or construction paper 99 Markers or colored pencils 99 Ruler (if needed) 99 Access to the internet for research

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

401

19 Guide Chart on Ginseng Questions

Record Your Answers Below

What is ginseng? Why is it being harvested? Describe Panax quinquefolius (American ginseng): •• Where is it found? •• What does it look like? •• What are the medicinal uses of American ginseng? Draw a picture of Panax quinquefolius (American ginseng).

What protective measures should be in place to ensure that American ginseng does not go extinct? How could someone protect the ginseng from biopiracy? What should the biochemist’s next steps be once the chemical is isolated from ginseng? What additional resources should the biochemist read about ginseng?

Activity Questions 1. Why is bioprospecting or biopiracy a concern for American ginseng? 2. Write the concentrations of ginsenoside chemicals for each species of ginseng in the spaces provided in the phylogenetic tree diagram (Figure 19.4, p.  399). What do you notice about the evolutionary relationships of the ginseng related to the concentration of chemicals? 3. What are the challenges in reading phylogenetic trees to investigate inherited traits?

402

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

MORE BARK THAN BITE

| Using Bioprospecting to Find Cures for Disease

19

Apply and Analyze Plants, animals, and fungi are not the only ones bioprospected for important bioresources for medicinal and economic uses—algae are also hunted for valuable chemicals. Read this article from Discover Magazine on bioprospecting algae: http:// blogs.discovermagazine.com/imageo/2014/01/22/arctic-prospectors-search-bio-goldwaters/#.WkVmI9IrK00. Then, answer the questions that follow. 1. What is biological gold? 2. What are bioprospectors finding in marine environments?

Design Challenge Engineering is the  application of scientific  understanding through creativity, imagination, problem solving, and the designing and building of new materials to address and solve problems in the real world. You will be asked to take the science you have learned in this case and design a process or product to address a realworld issue. Engineers use the engineerFIGURE 19.5 ing design process (Figure 19.5) as steps to address a real-world The Engineering Design Process problem. In this case, you are asking questions (Step 1) about using plant bioprospecting to 1 develop a new medication. Ask Questions and Define the Using outside research, you will Problem brainstorm (Step 2) a specific 6 2 way to use plant bioprospectRevise Brainstorm ing to develop a new medicaand Improve and Imagine tion. Then, you will create a The plan (Step 3) for a new medical Engineering treatment that uses chemical(s) Design from your plant. Next, you will Process 3 5 create (Step 4) a medical treat3 ment proposal in which you Test Plan and Evaluate describe the new treatment. 4 Finally, you will think of a way to test (Step 5) your product and Design and make improvements (Step 6) to Create your idea.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

403

19 1. Ask Questions Ask questions about using plant bioprospecting to find a new or improved medical treatment. For example, where is the best place to look for plants with medicinal properties? What plants are most likely to have chemicals that could be turned into treatments? If there are currently plants being used for treatments, how can we improve on the process to ensure that plant species aren’t endangered by bioprospecting?

2. Brainstorm and Imagine Read this article about the link between plants and medicine development: wwwtc.pbs.org/wgbh/nova/julian/media/lrk-disp-plantmedicines.pdf. For more guidance on medicinal uses of plants, browse these sources: www.nlm.nih.gov/about/herbgarden/ list.html and www.who.int/medicines/areas/traditional/SelectMonoVol4.pdf. You may also want to conduct additional internet or library research. One example of using bioprospecting to create medicine involves a potential treatment for infection. Eliminating infection has been an issue in human health throughout recorded history. With the rise of antibiotic-resistant bacteria and the concern over side effects from antibiotics, a plant-based solution is of great interest. Garlic, a close relative to onions, is a readily available food that has been used in traditional medicine and perhaps may be a potential medicinal plant. Garlic has long thought to be a potential antibiotic to combat a wide range of infectious bacteria in people and in nature. Based on your research, brainstorm a way to use plant bioprospecting to extract chemicals for a potential new medical treatment. Can you think of a new treatment that might solve a current problem?

3. Create a Plan Create a plan to develop your new or revised idea for bioprospecting. Summarize (1) the plant you want to explore for either a new or revised treatment, (2) suggest what illness or condition you think extracts from this plant might be able to treat, (3) identify what materials or tools you might need to make your idea a reality, and (4) list advantages and disadvantages to your new idea. Use the Create a Plan worksheet (p. 406) for guidance.

404

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

MORE BARK THAN BITE

| Using Bioprospecting to Find Cures for Disease

19

4. Design and Create Write a letter to the FDA that makes a convincing argument for bioprospecting your plant for a new or improved use for treating a disease or illness. Consider the following questions as you come up with your proposal: • What are some reasons why this plant should be bioprospected? • What measures need to be taken for responsible bioprospecting to minimize damages to the environment? Fill out the Letter to the FDA worksheet (p. 407).

5. Test and Evaluate Think about how you would test the safety and efficacy of your new plant-based medication. Consider these questions: • Phase 1—What would you do for laboratory testing? • Phase 2—What would you do for animal-based testing? • Phase 3—What would you do for clinical trials? • Surveillance—What would you do to ensure ongoing evaluation of the drug on the market? Add this information to your Letter to the FDA.

6. Revise and Improve Present or give your Create a Plan and Letter to the FDA worksheets to one or more of your peers to review. Listen to your peers’ feedback on your plan and take some time to revise and make improvements. What are some ways you can use their input to refine your plan? You may choose to accept all or only some of the feedback. Be sure to justify your reasons for using or not taking their suggestions.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

405

19 Create a Plan

406

1

What is the plant you want to explore for either a new or revised treatment?

2

What illness or condition do you think extracts from this plant might be able to treat?

3

What materials or tools might you need to make your idea a reality?

4

What are the advantages of your new idea?

5

What are the disadvantages of your new idea?

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

MORE BARK THAN BITE

| Using Bioprospecting to Find Cures for Disease

19

Letter to the FDA Dear FDA review committee: I hope this letter finds you well. I write in regard to using __________________________ for the

name of plant

new/improved treatment of____________________________________________________________ circle one

chosen disease/illness

________________________________________________________________________________________ I believe this plant should be bioprospected for the following two reasons: • Reason 1: ______________________________________________________________________

_______________________________________________________________________________ • Reason 2: ______________________________________________________________________



_______________________________________________________________________________

I realize due to issues with unsustainable biopospecting in the past that preservation of the environment (and people who may live in that environment) is very important. I plan to take the following two measures to ensure responsible bioprospecting practices: • Measure 1:_____________________________________________________________________

_______________________________________________________________________________ • Measure 2: _____________________________________________________________________



_______________________________________________________________________________

I plan to test the efficacy of the bioprospected medication by doing the following: ________________________________________________________________________________________ ________________________________________________________________________________________ ________________________________________________________________________________________ ________________________________________________________________________________________ Thank you,

__________________________________________

your name

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

407

19 TEACHER NOTES

MORE BARK THAN BITE

USING BIOPROSPECTING TO FIND CURES FOR DISEASE A Case Study Using the Discovery Engineering Process

Lesson Overview In this lesson, students explore paclitaxel, a chemical in the bark of Pacific yew trees that was discovered through bioprospecting. The discovery was a breakthrough in cancer research due to paclitaxel’s ability to halt cell division. Researchers and scientists still use bioprospecting to identify specific chemical compounds from bioresources, such as plants, algae, and animals. However, there are notable problems with bioprospecting, including impacts on indigenous peoples. After investigating bioprospecting, students learn that some evolutionary scientists trace inherited traits of organisms like paclitaxel through phylogenetic tree diagrams. Students review phylogenetic and chemical data to determine the level of a specific chemical in a plant species. Finally, students use their understanding of bioprospecting to create a proposal for a new or improved medical treatment with a plant-based chemical.

Lesson Objectives By the end of this case study, students will be able to • investigate bioprospecting, plant-based medicinal treatments, and phylogenetic trees; • analyze a phylogenetic tree and create a guide for plant-based medicine research; and • design a medical treatment proposal based on the knowledge of bioprospecting, phylogenetic trees, and plant-based medicines.

408

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

MORE BARK THAN BITE

| Using Bioprospecting to Find Cures for Disease TEACHER NOTES

19

Use of the Case Due to the nature of these case studies, teachers may elect to use any section of each case for their instructional needs. They are sequenced in order (scaffolded) so students think more deeply about the science involved in the case and develop an understanding of engineering in the context of science.

Curriculum Connections Lesson Integration This lesson may be taught during a unit on evolutionary relationships, genetics, or the interconnectedness of organisms in ecosystems. It also fits well into a lesson on data interpretation or discussions of evolutionary relationships, phylogenetic trees, inheritable traits and genetics, cancer and uncontrollable cell division, and medical treatments and effects.

Related Next Generation Science Standards PERFORMANCE EXPECTATIONS • MS-LS4-2. Anatomical similarities and differences between various organisms living today and between them and organisms in the fossil record, enable the reconstruction of evolutionary history and the inference of lines of evolutionary descent. • MS-ETS1-1. Define the criteria and constraints of a design problem with sufficient precision to ensure a successful solution, taking into account relevant scientific principles and potential impacts on people and the natural environment that may limit possible solutions. • MS-ETS1-2. Evaluate competing design solutions using a systematic process to determine how well they meet the criteria and constraints of the problem. • HS-LS4-6. Create or revise a simulation to test a solution to mitigate adverse impacts of human activity on biodiversity. • HS-ETS1-2. Design a solution to a complex real-world problem by breaking it down into smaller, more manageable problems that can be solved through engineering. • HS-ETS1-3. Evaluate a solution to a complex real-world problem based on prioritized criteria and trade-offs that account for a range of constraints, including cost, safety, reliability, and aesthetics, as well as possible social, cultural, and environmental impacts.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

409

19 SCIENCE AND ENGINEERING PRACTICES • Asking Questions and Defining Problems • Developing and Using Models • Planning and Carrying out Investigations • Analyzing and Interpreting Data • Constructing Explanations and Designing Solutions • Engaging in Argument From Evidence

CROSSCUTTING CONCEPTS • Patterns • Cause and Effect • Systems and System Modeling

Related National Academy of Engineering Grand Challenges • Engineer Better Medicines • Advance Health Informatics • Engineer the Tools of Scientific Discovery

Lesson Preparation Before starting the lesson, it is helpful for the students to have some understanding of the importance of evolution and the interconnectedness of organisms in ecosystems. Review the concepts of genetics and inheritable traits, focusing on cancer and cell division so students can understand the diversity of cancers and treatment. Review the concepts of evolution and phylogenetic trees so students can understand and complete the activity. Look at the Teaching Organizer (Table 19.2) for suggestions on how to organize the lesson.

Materials 99 Computer paper or construction paper 99 Markers or colored pencils 99 Ruler (if needed) 99 Access to the internet for research

410

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

MORE BARK THAN BITE

| Using Bioprospecting to Find Cures for Disease TEACHER NOTES

19

Time Needed Up to 115 minutes

TABLE 19.2 Teaching Organizer Section

Time Suggested

Materials Needed

Additional Considerations

The Case

10 minutes

Student pages

Activity done individually in class or as homework prior to class

Investigate and Explain

10 minutes

Student pages

Activity done individually or in pairs

Activity

20 minutes

Student pages, activity materials

Activity done individually or in pairs

Apply and Analyze

10–15 minutes

Student pages, internet access

Individual activity

Design Challenge

45–60 minutes

Student pages, internet access

Small-group activity

Vocabulary • bark

• indigenous

• biopiracy

• isolate

• bioprospecting

• phylogenetic trees

• cancer

• speciation event

• cell division

• synthetic

• endangered species

• Taxol

• extinct

• toxic

Extension This lesson can be extended into a discussion on the environmental dangers associated with bioprospecting/biopiracy or a discussion regarding the steps drug companies take in securing a patent for chemicals and treatments.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

411

19 Assessment Use the Teacher Answer Key to check the answers to section questions. You can evaluate the students’ treatment proposals to assess the Design Challenge. Students’ proposals should provide a coherent conceptualization of what their new idea is, who it helps, and why it is needed. Students should be able to explain how they derived their idea from the knowledge they gained on plants and bioprospecting. They should discuss how patients using the treatment would be protected from side effects. They should also be able to explain how they would ensure that their idea didn’t harm plant life. The proposals should include designs for laboratory, animal, and/or human trials. They should also report potential positive or negative outcomes to their idea.

Teacher Answer Key Recognize, Recall, and Reflect 1. What did the scientists who first tested the Pacific yew tree bark find during their investigations? They found that the chemical paclitaxel eliminated cells’ ability to divide. 2. Why was it difficult for researchers to make enough paclitaxel to use in clinical trials? At the time, they could only find this specific chemical in the bark of the Pacific yew tree. The process of removing the bark from the Pacific yew tree killed the tree. Scientists knew that the trees would go extinct if they continued to derive paclitaxel from them. 3. What is the importance of clinical trials to test a medication before the medication is released to the public? To determine what the effects of the medication are on a target population.

Investigate and Explain 1. Which species is the most closely related to the Araucaria? How can you tell? The Podocarpus. Because they are branches from the same fork (speciation event). 2. Which species has remained unchanged from the root ancestor? How can you tell? The pines. Because their branch has not forked from the last common ancestor (1) in the phylogenetic tree.

412

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

MORE BARK THAN BITE

| Using Bioprospecting to Find Cures for Disease TEACHER NOTES

19

3. What number is the common ancestor between plum yews and yews? How can you tell? Number 4. Because that is the last common ancestor from their divergence.

Activity Questions 1. Why is bioprospecting or biopiracy a concern for American ginseng? American ginseng plants are being overharvested for commercial and research purposes, which may drive the species to extinction. 2. Write the concentrations of ginsenoside chemicals for each species of ginseng in the space provided in the phylogenetic tree diagram (Figure 19.4, p. 399). What do you notice about the evolutionary relationships of the ginseng related to the concentration of chemicals? Students’ answers may vary, but should trace the relationship of the plants with the ability to produce the chemical. They may notice that some branches have no ability to produce the chemical while some do—this could help determine which species might have the ability to produce other chemicals. 3. What are the challenges in reading phylogenetic trees to investigate inherited traits? Phylogenetic trees provide limited information. Therefore, additional information may be needed (knowledge of specific genes, how traits are inherited among species, ecological information, etc.) to truly understand the mechanisms of some species being able to produce the chemical while others do not.

Apply and Analyze 1. What is biological gold? Some living organisms produce chemicals or other bioresources that are needed for medical or economical purposes. Finding these bioresources could result in the finder selling the bioresource for monetary gain. 2. What are bioprospectors finding in marine environments? They are finding living organisms producing needed bioresources. Students may decide to specifically list findings from the article.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

413

19 Resources and References Ginseng the Miracle Plant. Classification. University of Wisconsin La Crosse. http://bioweb. uwlax.edu/bio203/2011/zolondek_rose/classification.htm. National Cancer Institute. 2015. A story of discovery: Natural compound helps treat breast and ovarian cancers. www.cancer.gov/research/progress/discovery/taxol. NOVA. Plant medicines. PBS. www-tc.pbs.org/wgbh/nova/julian/media/lrk-disp-plantmedicines. pdf. Understanding Evolution. Drug discovery. University of California Museum of Paleontology. https://evolution.berkeley.edu/evolibrary/article/0_0_0/evotrees_treesmatter_05. U.S. National Library of Medicine. List of herbs in the NLM herb garden. National Institutes of Health. www.nlm.nih.gov/about/herbgarden/list.html. Yulsman, T. 2014. Arctic prospectors search for bio-gold in them thar waters. Discover Magazine. http://blogs.discovermagazine.com/imageo/2014/01/22/arctic-prospectors-search-biogold-waters/#.WunwPKQvxhF. World Health Organization. 2009. WHO monographs on selected medicinal plants. Vol. 4. Geneva, Switzerland: WHO Press.

414

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

CUTTING IT CLOSE

20

Using CRISPR to Microedit the Genome

A Case Study Using the Discovery Engineering Process Introduction All living organisms are made up of one or more cells that contain genetic information in the form of DNA. DNA contains genes—areas made up of coded information for building proteins and other processes (Figure 20.1, p. 416). Some lengths of DNA, including genes, code for specific proteins to make hair, skin, and other organs. Other lengths of DNA have other purposes we have yet to discover. Additionally, there are lengths of DNA that appear to provide spaces between genes. Scientists are examining DNA and looking for ways to edit these segments of repeating DNA at the gene level. This process for editing genes is called CRISPR. It is being explored as a solution for a variety of issues, including the repair of human genetic mutations.

Lesson Objectives By the end of this case study, you will be able to • explain how CRISPR is used to edit genes; • analyze data to explore how CRISPR is used to control mosquito populations; and • create a grant proposal to solve a global issue using CRISPR technologies.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

415

20 FIGURE 20.1 DNA to Protein

The Case This account outlines the discovery of CRISPR, how the process works, and potential uses of CRISPR. Once you have finished reading, answer the questions that follow. CRISPR stands for “clusters of regularly interspaced short palindromic repeats.” It is a special section of DNA made up of repeated base pairs (adenine [A] to thymine  [T] and cytosine  [C] to guanine [G]) and spacers, or regions of noncoding DNA between genes (Figure 20.2). In bacteria, these spacers come from the DNA of viruses that have attempted to attack the bacteria. The spacers are then able to help the bacteria remember how to destroy the same type of virus in the future.

416

FIGURE 20.2 Base Pairing in DNA

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

CUTTING IT CLOSE

| Using CRISPR to Microedit the Genome

20

CRISPR was first discovered in the 1990s in Spain. Several researchers began examining CRISPR and its properties. The researchers were able to experimentally show that bacteria were modifying their DNA by adding spacers from a virus that attacked them. They found that the spacer DNA sequences were identical to that of the particular virus that had once attacked the bacteria. Once a spacer is inserted, a strand of CRISPR RNA called crRNA is created. When bound with another type of RNA to a protein called Cas9, a DNA editing tool is created. Unlike restriction enzymes, which cut DNA at specific segments, Cas9 is able to find the spacer within the DNA and make a cut at that location. This allows for the insertion or deletion of genetic code (Figure 20.3). FIGURE 20.3 Researchers have been examining the possibility Cas9 and CRISPR Editing of using crRNA to edit any piece of DNA. By changing the base pairs in the crRNA, scientists can create a tool to cut any part of a DNA strand. Once the strand of DNA is cut, the cell may repair it by connecting the two ends of the strand together. This may cause mutations in the DNA. The other option would be to insert new genetic information into the split. This allows scientists to repair DNA or add beneficial information. One way this has been used is in the dairy industry. With the help of CRISPR technology, scientists have tried to develop probiotics to vaccinate commercial cultures (such as those used to create yogurt) from viruses. Dr. Rodolphe Barrangou and his colleagues were attempting to make a better bacterial starter for cheese and yogurt, and so they sequenced the genome for a bacterium called Streptococcus thermophilus. That particular bacterium is important for producing cheese and yogurt because it creates lactic acid by breaking down lactose, a sugar found in milk. As the team attempted to sequence the bacterium’s DNA, the process kept having difficulties when it would reach the spacers. These spacers were made up of DNA from viruses that

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

417

20 had previously attacked the bacteria. However, the scientists did not know this until they began to look at different spacers more closely and realized they matched the DNA of different types of viruses. This gave them the clue they needed to improve the bacterium’s viral immunity to a variety of viruses. Research on CRISPR is still ongoing. CRISPR gene-editing technology has many potential applications. It could be used in genomic therapy for people with genetic disorders. Antibiotic-resistant bacteria can be treated with CRISPR. The technology may also give rise to improvements in food production, food safety, and the breeding of plants and animals. Further research will be needed to examine all the potential uses of CRISPR technology as well as to make the gene-editing process more efficient.

Recognize, Recall, and Reflect 1. What are CRISPR strands? Where do CRISPR strands come from in bacterial DNA? 2. Describe the process that allows CRISPR to edit DNA. 3. In your opinion, which potential uses of CRISPR seem the most important to study?

Investigate and Explain Malaria is a disease often spread by mosquitoes in many parts of the world. To determine if CRISPR is an effective way to control malaria, scientists examined whether they could use a process called gene drive to decrease the number of offspring in a given mosquito population. Gene driving is a way of adding, deleting, disrupting, or modifying genes to “drive” a particular trait into a population of organisms (Figure 20.4). This is different than typical inheritance FIGURE 20.4 where genes passed to the next generation have some advantages and Example of Gene Drive are selected for, providing the population a gain in fitness as a result of passing those genes onto their offspring. Examine the data from the gene drive study, and then answer the questions that follow. • Type of Disease: Malaria, a blood-borne disease typically transmitted by mosquitoes.

418

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

CUTTING IT CLOSE

| Using CRISPR to Microedit the Genome

20

• Type of Mosquitoes in Study: Anopheles gambiae, the main carrier of malaria. • Understanding Gene Drive: In organisms that undergo sexual reproduction, most genes occur in two copies that may or may not be the same allele. Typically, these alleles each have a 50% chance of being passed on to offspring. When gene drive occurs, the selected allele has a better than 50% chance of being passed on to offspring. This makes an allele more common in a population. Using CRISPR, researchers can create an artificial gene drive so that organisms pass on a desired trait. In this process, when an organism is heterozygous for a gene, the gene will “repair” the other strand of DNA to make the organism homozygous for that preferred trait, even if the trait is recessive. • Research Methodology: Researchers used CRISPR to insert into mosquito DNA a recessive gene that would cause the females to be infertile. The gene was tested in three different genes to see which would be the most effective to decrease mosquito breeding. This would help to control mosquito populations and decrease the spread of malaria. Here is what you know: Generation 1 included one mosquito carrying the wild-type (or most prevelant in the wild) allele for the infertility gene and one mosquito carrying the edited version of the allele. Each cross was done twice, once with the male carrying the edited gene and once with the female carrying the gene. The number of offspring for each generation were counted to determine what percentage carried the edited gene. No larvae were found for the female carrying the edited Gene 2 and so data for her was therefore not included in the data table.

FIGURE 20.5 Percentage of Offspring With Modified CRISPR Infertility Gene

Source: Adapted from Hammond et al. (2016).

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

419

20 • Data: The data from this experiment were graphed (see Figure 20.5, p. 419). 1. According to Figure 20.4 (p. 418), how are genes be passed on through gene drive? 2. According to Figure 20.5, what is the percentage of offspring carrying the CRISPR-modified gene for each of the five test subjects (Gene 1 Male, Gene 1 Female, Gene 2 Male, Gene 3 Male, Gene 3 Female)? 3. Why would the researchers test the transmission of the gene over multiple generations? 4. After examining the data, which gene modification would you recommend in order to decrease malaria transmission (Gene 1, 2, or 3)? Why? 5. What issues would a researcher need to take into consideration when modifying genes in organisms that may escape, such as mosquitoes?

Activity Imagine that you are a citizen of Main Town, a city in southern Florida. Cases of Zika, a blood-borne disease spread by mosquitoes, have been identified in other parts of Florida. Zika can cause a fever, rash, headaches, joint pain, miscarriages, or even severe brain defects in babies born to women who contract Zika while pregnant. To control the spread of the disease, the Florida Keys Mosquito Control District (FKMCD) is considering introducing mosquitos that have been genetically edited with CRISPR. To better understand the issue, a town hall meeting has been scheduled to discuss and debate this plan. Complete the activity below, and then answer the questions that follow. Town Hall Meeting:

a. Get into groups of five people. Review and select a role to play in the town: Roles: An epidemiologist (a scientist who studies the spread of infectious diseases) The town mayor (an elected official) The head nurse at the local hospital’s pediatric unit The leader of a nongenetically modified organism advocacy group

420

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

CUTTING IT CLOSE

| Using CRISPR to Microedit the Genome

20

A Florida wildlife biologist/ecologist (a scientist who studies the balance of plants and animals in an ecosystem)

b. Individually or as a group, read this press release on the potential release of genetically modified mosquitoes: www.sciencemag.org/news/2016/11/ update-florida-voters-split-releasing-gm-mosquitoes. Consider as you read: What is this press release about? What are the main ideas and facts presented? Why are these ideas relevant or important?



c. Get into the same small groups and think about the information you read from the perspective of your chosen role. Then, spend 10 minutes going around your group and explaining your role’s position on the town’s plan to introduce mosquitos that have been genetically edited with CRISPR. Each student in your group should think about the following: What were the facts from the article that you find pertinent and want to highlight at the town hall based on your selected role? What are the potential benefits of this proposed plan? What are the potential drawbacks or concerns of this proposed plan?



d.

Individually or as a group, write your final recommendation to the FKMCD regarding the town’s plan. Make sure to incorporate multiple perspectives into the piece, even if you do not agree with all of them. Try to counter arguments from others who may disagree with your recommendation using facts and information from the article.

Record Your Recommendation to the FKMCD Here:

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

421

20 Activity Questions 1. After reading the press release and conducting your town hall, what additional questions do you have about the possibility of using genetically modified mosquitoes in Main Town, Florida? 2. Who would you want to speak with (beyond the others at the town hall) about the possibility of using genetically modified mosquitoes in Main Town, Florida?

Apply and Analyze There are many issues surrounding using CRISPR and other genetic-editing tools. Read the chart in Table 20.1 and the information summarized from BioExplorer (www.bioexplorer.net/genetic-engineering-pros-and-cons.html) on the advantages and disadvantages of genetic editing. After reading, answer the questions that follow. 1. After reading about the advantages and disadvantages of genetic editing, do you believe the advantages outweigh the disadvantages? Why? Try to reference specific examples (you may wish to consult additional print or electronic resources). 2. What suggestions do you have to address disadvantages of genetic editing?

422

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

CUTTING IT CLOSE

| Using CRISPR to Microedit the Genome

20

TABLE 20.1 Advantages and Disadvantages of Genetic Editing Advantages of Genetic Editing

Disadvantages of Genetic Editing

Production of nutrient-rich foods: Some foods, such as rice, have been modified to be healthier. Golden rice has been genetically modified to produce more vitamin A in order to prevent vitamin deficiency in parts of the world that rely on rice as their main source of food.

Potential for unwanted transfer of genes: Sometimes inserted genes can transfer from one species to another and produce unintended effects.

Improved plant resistance to pests and spoilage: Researchers have inserted genes into crops to make them toxic to pests. They have also edited the genes that cause fruits and vegetables to rot in order to increase shelf life.

Allergic reactions and other health issues: Sometimes adding genes from other organisms can cause unexpected reactions. There is concern that the gene editing will insert an allergen rather than the desired trait.

Improved production of meat: Animals can be modified to be bigger and more muscular, which leads to more meat production per animal.

Development of antibiotic-resistant organisms: Genetically modified diseases may eventually develop resistance to antibiotics and cause greater harm.

Development of new vaccines and drugs: Vaccines can be developed by editing the genes in viruses to make them inactive, which allows them to be injected into a person so that he or she can develop immunity. Drugs, such as insulin, can be produced through genetic engineering, which can lead to greater amounts of drugs available to patients, such as diabetics.

Decrease in biodiversity: If genes are inserted with the desire to cause gene drive, it could change populations enough to cause a loss of biodiversity.

Development of new and favorable characteristics: Humans can gain more strength by using nontherapeutic genes to produce more muscle.

Potential rise in invasive species: As genetically modified species may be better suited to the environment where they are placed, they can outcompete the native populations.

Improved human health: Individuals may be able select the genes of their babies to provide them protection against certain diseases and disorders. This technology is not currently available.

Economic consequences: Since private companies trademark their edited genes, they can choose not to share them to the public at a reasonable cost. Social and ethical concerns: Some people fear that genetic editing will not be used in an ethical manner. They also believe that genetic editing messes with the natural order of the world. Additionally, some people believe that genetic editing will lead to discrimination against people with genetic traits that parts of society may consider undesirable.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

423

20 Design Challenge Engineering is the  application of scientific  understanding through creativity, imagination, problem solving, and the designing and building of new materials to address and solve problems in the real world. You will be asked to take the science you have learned in this case and design a process or product to address a realworld issue. Engineers use the engineerFIGURE 20.6 ing design process (Figure 20.6) as steps to address a real-world The Engineering Design Process problem. You will now use this process as you come up with a new way to use CRISPR. In this 1 case, you are asking questions Ask Questions (Step 1) about how CRISPR and and Define the Problem genetic engineering can be used to 6 2 address complex, real-world chalRevise Brainstorm lenges. Using outside research, and Improve and Imagine you will brainstorm (Step 2) a The specific new way to use CRISPR Engineering to solve a problem. Then you will Design create a plan (Step 3) for your Process 3 idea. Next, you will create (Step 4) 5 3 a grant proposal to describe how Test Plan and Evaluate your idea works. Afterward, you will test (Step 5) your proposal 4 by presenting it to peers. Finally, Design and you will consider how you might Create improve (Step 6) on your idea.

1. Ask Questions Ask questions about using CRISPR and genetic engineering to solve problems. For example, why should we consider using CRISPR to address certain global issues? What are ways in which this technology can improve lives? In what types of situations would this technology be most effective? In what situations would using CRISPR and genetic engineering be inappropriate?

424

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

CUTTING IT CLOSE

| Using CRISPR to Microedit the Genome

20

2. Brainstorm and Imagine CRISPR has many potential benefits as a gene-editing tool. You can learn more about the history and proposed applications of CRISPR here: www.nature.com/news/ crispr-the-disruptor-1.17673. After you finish reading, create a list of potential issues that might be solved using CRISPR. This may include improving food production, creating better biofuels, increasing weed control, curing diseases, and more. You may want to use the internet to assist you in this process. Then choose one issue from this list that you’d like to tackle using CRISPR. For example, the world’s supply of fresh (not ocean or salty) drinking water is dwindling. Yet, in arid lands without lots of rainfall, this water is also needed to cultivate crops to feed hungry populations. One way to address this issue may be to use CRISPR to create saltwater-tolerant crops with genes from other organisms that have adapted to growing in salt water. By using salt water in crop production, we could reserve our limited supply of fresh water for drinking water.

3. Create a Plan Create a plan for your idea to use CRISPR to solve a global issue. Real-world issues are very complex. Using the Potential Global Issues graphic organizer (p.  427), you will figure out how to make your issue easier to address. First, brainstorm ways to break your global issue into smaller, more manageable issues. List these in the graphic organizer. Of those smaller issues, which might possibly be solved using CRISPR technology? Describe how CRISPR might be used in these cases. Make sure to use evidence from the previous activities. Next, brainstorm any issues that need to be considered when using CRISPR to solve this problem. Issues may include cost, safety, reliability, and social, cultural, or environmental impacts. Finally, include any questions that your team still has and where you might search for answers. You may want to use print or internet resources to assist you in this process.

4. Design and Create Now that you have your plan, you will need to design a grant proposal for the Rosalind Franklin Institute for Genomics. The Franklin Institute is a nonprofit organization focused on improving the planet through genetic engineering. It is offering funding for up to three proposals seeking to solve global issues through techniques using CRISPR. Create a written grant proposal for the institute, using the Planning a Grant Proposal worksheet (p. 428) as an outline.

5. Test and Evaluate To test your proposal, you will create a presentation for the Franklin Institute. Your presentation should make a persuasive argument to get your lab funding in order to test your proposed idea. Your class will act as the Franklin Institute’s board of

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

425

20 directors. Make sure you include the major sections from your written proposal in your digital presentation. When it is your turn to act as the board of directors, you will use the Evaluating a Grant Proposal worksheet (p. 429) to evaluate your peers’ presentations.

6. Revise and Improve Review the feedback from your peers on your digital presentation. What are some ways you can use their input to refine your plan? You may choose to accept all or only some of the feedback. Be sure to justify your reasons for using or not taking the suggestions.

426

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

CUTTING IT CLOSE

| Using CRISPR to Microedit the Genome

20

Potential Global Issues Choose one of the above issues.

Break the issue into smaller, more manageable issues.

Which subproblem could be potentially solved with CRISPR?

How?

What are the issues you need to think about when solving this problem? (Cost, safety, social or environmental impacts)

What additional questions do you have and where might you look for answers?

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

427

20 Planning a Grant Proposal

428

1

Who is your audience? What do you need to know about them?

2

Introduction: What is the problem you are trying to solve? Why? You must cite your sources in this section to support your claim.

3

What is your proposal?

4

Will it work? How do you know?

5

What is your plan of action?

6

What are your desired outcomes and how will you evaluate them?

7

How will you plan for any potential problems associated with your solution?

8

What resources (time, money, space, etc.) do you need?

9

Conclusion: Why should your group get the money over other proposals?

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

CUTTING IT CLOSE

| Using CRISPR to Microedit the Genome

20

Evaluating a Grant Proposal 1.

What is the problem the presenters are trying to solve?

2. What is their proposed solution? 3. Based on their explanation, will it work? 4. On a scale of 1 to 5, how feasible is their plan of action?

1—Not possible



2—Slightly possible



3—Possible with some changes



4—Somewhat possible



5—Very possible

5. What are their desired outcomes? 6. On a scale of 1 to 5, how effective is their evaluation plan?

1—Not effective



2—Slightly effective



3—Effective with some changes



4—Somewhat effective



5—Very effective

7. On a scale of 1 to 5, how well did they plan for potential problems?

1—No plan for problems (0 problems identified)



2—Brief plan for problems (1 problem identified, but not a clear plan)



3—Planned for half of the problems (1 problem identified, with a clear plan)



4—Planned for most problems (2–3 problems identified, with a clear plan)



5—Planned for all known problems (4 or more problems identified, with a clear plan)

8. On a scale of 1 to 5, how was the overall proposal?

1—Very poor

2—Poor 3—Fair 4—Good

5—Very good

9. Comments for improving the proposal (give at least two constructive pieces of feedback):

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

429

20 TEACHER NOTES

CUTTING IT CLOSE 

USING CRISPR TO MICROEDIT THE GENOME A Case Study Using the Discovery Engineering Process

Lesson Overview In this lesson, students explore the process of CRISPR. CRISPR is a gene-editing tool used to insert beneficial genes or delete damaging genes from DNA. Researchers are experimenting with using CRISPR for various issues, from population control to gene repair to food scarcity. Students use sample data to explore the current applications of CRISPR. They also engage in a mock town hall meeting to debate the use of CRISPR in a mosquito population control plan. Finally, students choose a global issue to tackle using CRISPR and create a grant proposal and presentation to seek funding for their idea.

Lesson Objectives By the end of this case study, students will be able to • explain how CRISPR is used to edit genes; • analyze data to explore how CRISPR is used to control mosquito populations; and • create a grant proposal to solve a global issue using CRISPR technologies.

Use of the Case Due to the nature of these case studies, teachers may elect to use any section of each case for their instructional needs. They are sequenced in order (scaffolded) so students think more deeply about the science involved in the case and develop an understanding of engineering in the context of science.

Curriculum Connections Lesson Integration This lesson may be taught during a unit on genetics in biology courses. It also fits well into a lesson on chromosomes and gene transfer.

430

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

CUTTING IT CLOSE

| Using CRISPR to Microedit the Genome TEACHER NOTES

20

Related Next Generation Science Standards PERFORMANCE EXPECTATIONS • MS-LS2-4. Construct an argument supported by empirical evidence that changes to physical or biological components of an ecosystem affect populations. • MS-LS3-1. Develop and use a model to describe why structural changes to genes (mutations) located on chromosomes may affect proteins and may result in harmful, beneficial, or neutral effects to the structure and function of the organism. • MS-LS4-5. Gather and synthesize information about the technologies that have changed the way humans influence the inheritance of desired traits in organisms. • HS-LS3-1. Ask questions to clarify relationships about the role of DNA and chromosomes in coding the instructions for characteristic traits passed from parents to offspring. • HS-LS4-6. Create or revise a simulation to test a solution to mitigate adverse impacts of human activity on biodiversity.

SCIENCE AND ENGINEERING PRACTICES • Asking Questions and Defining Problems • Developing and Using Models • Planning and Carrying out Investigations • Analyzing and Interpreting Data • Constructing Explanations and Designing Solutions • Engaging in Argument From Evidence

CROSSCUTTING CONCEPTS • Patterns • Scale, Proportion, and Quantity • Systems and System Models

Related National Academy of Engineering Grand Challenge • Engineer Better Medicines

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

431

20 Lesson Preparation Before starting the lesson, it is helpful for students to have some understanding of DNA and how DNA can be modified by enzymes. Review the concepts of DNA (chromosomes, genes, meiosis, and mitosis) and genetic inheritance so students can imagine new applications for CRISPR technology. Look at the Teaching Organizer (Table 20.2) for suggestions on how to organize the lesson.

Time Needed Up to 175 minutes

TABLE 20.2 Teaching Organizer Section

Time Suggested

Materials Needed

Additional Considerations

The Case

10 minutes

Student pages

Activity done individually in class or as homework prior to class

Investigate and Explain

10 minutes

Student pages

Activity done individually or in pairs

Activity

20 minutes

Student pages

Activity done individually or in pairs

Apply and Analyze

10–15 minutes

Student pages, internet access

Individual activity

Design Challenge

60–120 minutes

Student pages, internet access

Small-group activity

Vocabulary

432

• allele

• heterozygous

• base pairs

• homozygous

• CRISPR

• insertion

• deletion

• organism

• DNA

• proteins

• fitness

• recessive

• gene drive

• restriction enzymes

• genes

• RNA

• genome

• spacers

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

CUTTING IT CLOSE

| Using CRISPR to Microedit the Genome TEACHER NOTES

20

Extensions This case could be used along with activities that help students understand genetics. You might consider using resources from the Genetics Home Reference website, which is part of the U.S. National Library of Medicine (https://ghr.nlm.nih.gov/ resources). The Genetics Home Reference website includes a web page with classroom activities (e.g., tutorials, labs, and lessons) on a variety of topics including DNA structure, DNA function, inheritance, evolution, gene therapy, gene editing, and more.

Assessment Use the Teacher Answer Key to check the answers to section questions. The key includes a scoring rubric for the student grant proposals (p. 436). For the Design Challenge, students may also peer evaluate using the provided grant proposal evaluation (p. 429).

Teacher Answer Key Recognize, Recall, and Reflect 1. What are CRISPR strands? Where do CRISPR strands come from in bacterial DNA? They are a special section of DNA made up of repeated base pairs and spacers, where the DNA repeats in short segments. In bacteria, CRISPR strands come from viral DNA. 2. Describe the process that allows CRISPR to edit DNA. Once a spacer is inserted, a strand of CRISPR RNA, crRNA, is created. When bound with another type of RNA to a protein called Cas9, a DNA-editing tool is created. Cas9 is able to find the spacer within the DNA and make a cut at that location. This allows for the insertion or deletion of genetic code. 3. In your opinion, which potential uses of CRISPR seem the most important to study? Students’ answers may vary but might discuss the potential uses of CRISPR in genomic therapy for people with genetic disorders or as treatments for antibioticresistant bacteria. They might also point to using CRISPR as a way to improve food production, food safety, and the breeding of plants and animals.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

433

20 Investigate and Explain 1. According to Figure 20.4, how are genes passed on through gene drive? When a gene drive occurs, it makes an allele have a better than 50% chance of being passed, which can be seen in the future generations in the graph. This makes an allele more common in a population. Using CRISPR, researchers can create an artificial gene drive so that organisms pass on a desired trait. In this process, when an organism is heterozygous for a gene, the gene will “repair” the other strand of DNA in order to make the organism homozygous for that preferred trait, even if the trait is recessive. 2. According to Figure 20.5, what is the percentage of offspring carrying the CRISPR-modified gene for each of the five test subjects (Gene 1 Male, Gene 1 Female, Gene 2 Male, Gene 3 Male, Gene 3 Female)? Gene 1 male 5 89.9%, gene 1 female 5 83.9%, gene 2 male 5 97.15%, gene 3 male 5 99%, gene 3 female 5 99.2% 3. Why would the researchers test the transmission of the gene over multiple generations? To get the average number of gene transfers for a particular gene change. More tests give more accurate results. 4. After examining the data, which gene modification would you recommend in order to decrease malaria transmission (Gene 1, 2, or 3)? Why? Gene 3 had the highest percentage of transfer over each trial and for both male and female. 5. What issues would a researcher need to take into consideration when modifying genes in organisms that may escape, such as mosquitoes? Students’ answers may vary, but they might discuss issues of escaping mosquitoes causing a gene drive in wild populations, the transfer of the gene into other populations, etc.

434

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

CUTTING IT CLOSE

| Using CRISPR to Microedit the Genome TEACHER NOTES

20

Activity Questions 1. After reading the press release and conducting your town hall, what additional questions do you have about the possibility of using genetically modified mosquitoes in Main Town, Florida? Students’ answers may vary. 2. Who would you want to speak with (beyond the others at the town hall) about the possibility of using genetically modified mosquitoes in Main Town, Florida? Students’ answers may vary but might include geneticists who work on CRISPR, advocates or legal experts who deal with the topic, and individuals from the Centers for Disease Control and Prevention or the National Institutes of Health.

Apply and Analyze 1. After reading about the advantages and disadvantages of genetic editing, do you believe the advantages outweigh the disadvantages? Why? Try to reference specific examples (you may wish to consult additional print or electronic resources). Students’ answers may vary, but students should back up any statements with evidence from their readings and research. 2. What suggestions do you have to address disadvantages of genetic editing? Students’ answers may vary, but students should be able to explain why they think their methods to address disadvantages are a good idea.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

435

20 Grant Proposal Rubric Meeting or Exceeding Standard (3 Points)

436

Approaching Standard (2 Points)

Below Standard (1 Point)

Organization

The proposal begins with a strong introduction and closes with a strong conclusion. Group clearly used the outline from the Planning a Grant Proposal graphic organizer to write their proposal. The proposal included all of the recommended pieces of the proposal. The writing is clear, concise, and easy to follow.

Introduction and conclusion are present. Group included most of the elements outlined in the Planning a Grant Proposal graphic organizer. Writing is mostly clear and easy to follow, though one or more sections may appear out of place.

Introduction or conclusion are weak and/or missing. Many of the elements outlined in the Planning a Grant Proposal graphic organizer are missing. Two or more sections appear out of place. Writing is not clear and is difficult to follow.

Presentation of Problem and Solution

The proposal clearly describes the problem and why it is important. The solution is clearly explained and relevant to the problem. The solution is feasible.

The problem and solution are present but somewhat confusing. The solution may not directly tie into the problem but is closely related. The solution seems to be feasible with some revision.

The problem or solution are missing or not clearly explained. The solution is not related to the problem or does not seem doable.

Elements of Persuasion

The group supports their problem and solution with facts, statistics, and examples. The proposal builds a strong case for the proposed solution, while maintaining a committed, reasonable tone. Arguments are tailored to a particular audience.

The group supports their problem and a solution with a mix of facts and opinions. The proposal builds a fair case for the solution. The argument is tailored to a general audience.

The group uses only opinion to support their proposed problem or solution. There is a weak case for the proposed solution. The argument is not tailored to any audience.

Conventions: Grammar, Mechanics, and Spelling

There are few or no errors in grammar, mechanics, or spelling. Word choice is appropriate for the audience.

There are some errors in grammar, mechanics, or spelling. Word choice is mostly appropriate for the audience.

There are numerous errors in grammar, mechanics, or spelling. Word choice is inappropriate for the audience.

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

CUTTING IT CLOSE

| Using CRISPR to Microedit the Genome TEACHER NOTES

20

Resources and References Batten, J. 2014. Exploring genetics across the middle school science and math curricula. North Carolina State University. www.greenomes.org/pdf/NCState_Exploring_Genetics.pdf. Bioexplorer. 2018. 13 important genetic engineering pros and cons. www.bioexplorer.net/ genetic-engineering-pros-and-cons.html. Hammond, A. R. Galizi, K. Kyrou, A. Simoni, C. Siniscalchi, D. Katsanos, M. Gribble, D. Baker, E. Marois, S. Russell, A. Burt, N. Windbichler, A. Crisanti, and T. Nolan. 2016. A CRISPR-Cas9 gene drive system targeting female reproduction in the malaria mosquito vector Anopheles gambiae. Nature Biotechnology 34 (1): 78–83. www.nature.com/articles/ nbt.3439.epdf. Ledford, H. 2015. CRISPR, the disruptor. Nature 522: 20–24. www.nature.com/news/crispr-thedisruptor-1.17673. Servick, K. 2016. Update: Florida voters split on releasing GM mosquitoes. Sciencemag.org. www.sciencemag.org/news/2016/11/update-florida-voters-split-releasing-gm-mosquitoes. U.S. National Library of Medicine. Genetics home reference: Your guide to understanding genetic conditions. NIH. https://ghr.nlm.nih.gov/resources.

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

437

Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

Image Credits Art by NSTA Press unless otherwise noted.

Chapter 1 Figure 1.1: Jim Gathany, Wikimedia Commons, Public Domain, https://commons. wikimedia.org/wiki/File:Anopheles_stephensi.jpeg Figure 1.2: Shutterstock Figure 1.3: NIAID, Wikimedia Commons, CC BY 2.0, https://commons.wikimedia.org/wiki/ File:Life_Cycle_of_the_Malaria_Parasite_(20771605491).jpg Figure 1.4: Authors (Adapted from Siraj, A. S. et al. 2014. Altitudinal changes in malaria incidence in highlands of Ethiopia and Colombia. Science 343 (6175), 1154–1158. Retrieved from https://doi.org/10.1126/science.1244325)

Chapter 2 Figure 2.1: T. J. Kirn, M. J. Lafferty, C. M. P Sandoe, and R. K. Taylor, Wikimedia Commons, Public Domain, https://commons.wikimedia.org/wiki/File:Cholera_bacteria_SEM.jpg Figure 2.2: Shutterstock Figure 2.3: John Snow, Wikimedia Commons, Public Domain, https://commons.wikimedia. org/wiki/File:Snow-cholera-map-1.jpg Figure 2.4: Pearson Scott Foresman, Wikimedia Commons, Public Domain, https:// commons.wikimedia.org/wiki/File:Contour_map_(PSF).png

Chapter 3 Figure 3.1: Stephencdickson, Wikimedia Commons, CC BY-SA 4.0, https://commons. wikimedia.org/w/index.php?curid=41632795 Figure 3.2: From the National Institutes of Health (author unknown), Wikimedia Commons, Public Domain, https://commons.wikimedia.org/w/index.php?curid=6424741

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

439

Chapter 4 Figure 4.1: Kamalnv, Wikimedia Commons, CC BY 3.0, https://commons.wikimedia.org/wiki/ File:Indiancobra.jpg Figure 4.2: Blausen.com staff (2014). “Medical gallery of Blausen Medical 2014.” WikiJournal of Medicine 1 (2). DOI:10.15347/wjm/2014.010. ISSN 2002-4436, Wikimedia Commons, CC BY 3.0, https://commons.wikimedia.org/wiki/Category:Anatomy_of_the_human_respiratory_ system#/media/File:Blausen_0770_RespiratorySystem_02.png Figure 4.3: Authors; Jawahar Swaminathan and MSD staff at the European Bioinformatics Institute, Wikimedia Commons, Public Domain, https://commons.wikimedia.org/wiki/ File:PDB_1ctx_EBI.jpg Figure 4.4: Authors Figure 4.5 (Mason Jar): Dwight Burdette, Wikimedia Commons, CC BY 3.0, https:// commons.wikimedia.org/wiki/File:Mason_Jar_with_Screw_Top.JPG Figure 4.5 (Tape): Marie-Lan Nguyen, Wikimedia Commons, CC-BY 2.5, https://commons. wikimedia.org/wiki/File:Black_gaffer_tape.jpg Figure 4.5 (Penny): Shutterstock

Chapter 5 Figure 5.1: Shutterstock Figure 5.2: The U.S. Food and Drug Administration, Wikimedia Commons, Public Domain, https://commons.wikimedia.org/wiki/File:How_Grapefruit_Juice_Affects_Some_Drugs_ (6774935740).jpg

Chapter 6 Figure 6.1: Images in Paediatric Cardiology (Retrieved From the National Center for Biotechnology Information), CC BY-SA 3.0, https://www.ncbi.nlm.nih.gov/pmc/articles/ PMC3232561/figure/F49 Figure 6.2: BruceBlaus, Wikimedia Commons, CC BY-SA 4.0, https://commons.wikimedia.org/ wiki/Category:Cardiac_cycle#/media/File:Systolevs_Diastole.png Figure 6.3: Shutterstock Figure 6.4: Authors (Adapted from Knuckey, L., R. McDonald, and G. Sloman. 1965. A method of testing implanted cardiac pacemakers. British Heart Journal 27 (4): 483–489. www.ncbi.nlm.nih.gov/pmc/articles/PMC503336/pdf/brheartj00339-0015.pdf)

Chapter 7 Figure 7.1: Shutterstock Figure 7.2: Mikael Häggström, Wikimedia Commons, Public Domain, https://commons. wikimedia.org/wiki/File:Signs_and_symptoms_of_anaphylaxis.svg

440

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

IMAGE CREDITS

Figure 7.3: Branum, A. M., and S. L. Lukacs, S. L. 2008. Food allergy among U.S. children: Trends in prevalence and hospitalizations. NCHS Data Brief Number 10. www.cdc.gov/nchs/ data/databriefs/db10.pdf (reprinted with permission)

Chapter 8 Figure 8.1: Shutterstock Figure 8.2: Centers for Disease Control and Prevention, Public Domain Figure 8.3: Centers for Disease Control and Prevention, Public Domain

Chapter 9 Figure 9.1: John Forbes Royle, Wikimedia Commons, Public Domain, https://commons. wikimedia.org/wiki/File:LagomysAlpinusRoyle.jpg Figure 9.2: Jason Trook (reprinted with permission) Figure 9.3: Richard South, Wikimedia Commons, Public Domain, https://commons.wikimedia. org/wiki/File:Moths_of_the_British_Isles_Series2_Plate129.jpg United Kingdom Outline Map: Shutterstock

Chapter 10 Figure 10.1: Terry Priest/Art Farmer, Wikimedia Commons, CC BY-SA 2.0, https://commons. wikimedia.org/wiki/File:Photinus_pyralis_Firefly_glowing.jpg Figure 10.2: Shutterstock Figure 10.3: Vogelmann, T. C., and J. R. Evans. 2002. Profiles of light absorption and chlorophyll within spinach leaves from chlorophyll fluorescence. Plant, Cell & Environment 25 (10): 1313–1323 (reprinted with permission)

Chapter 11 Figure 11.1: GLERL, Wikimedia Commons, Public Domain, https://commons.wikimedia.org/ wiki/File:Scenedesmus_GLERL.jpg Figure 11.2: Authors Figure 11.4: Shutterstock

Chapter 12 Figure 12.1: Shutterstock Figure 12.2: Inductiveload, Wikimedia Commons, Public Domain, https://commons. wikimedia.org/wiki/File:Silicon_wafer.jpg Dog Training Map: Authors

Chapter 13 Figure 13.1: Shutterstock

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

441

Figure 13.2: Shutterstock Figure 13.3: Authors Scatter Plot Graph: Authors

Chapter 14 Figure 14.1: Chicago Department of Health - Library of Congress Prints and Photographs Division, Wikimedia Commons, Public Domain, https://commons.wikimedia.org/wiki/File:Is_ your_child_vaccinated_Vaccination_prevents_smallpox.jpg Figure 14.2: images.wellcome.ac.uk, Wikimedia Commons, Public Domain, https:// commons.wikimedia.org/wiki/File:Jenner_phipps_01.jpg Figure 14.4: Shutterstock Figure 14.5: Gorry and Others, Wikimedia Commons, CC BY 2.0, https://commons.wikimedia. org/wiki/File:Various_approaches_for_HIV_vaccine_development.jpg

Chapter 15 Figure 15.1: Mikael Häggström, Wikimedia Commons, Public Domain, https://commons. wikimedia.org/wiki/File:Symptoms_of_multiple_sclerosis.png Figure 15.2: Beery, A. K., and I. Zucker. 2011. Sex bias in neuroscience and biomedical research. Neuroscience & Biobehavioral Reviews 35 (3): 565–572. www.sciencedirect.com/science/ article/pii/S0149763410001156 (reprinted with permission) Figure 15.3: From the National Institutes of Health (author unknown),Wikimedia Commons, Public Domain, https://commons.wikimedia.org/wiki/File:Pedigree-chart-example.png

Chapter 16 Figure 16.1: Shutterstock Figure 16.2: U.S. Department of Agriculture, Wikimedia Commons, CC BY 2.0, https://commons.wikimedia.org/wiki/File:Loading_DNA_samples_into_an_agarose_gel_for_ electrophoresis_-_CPHST_-_USDA_photo.jpg Figure 16.3: Shutterstock Figure 16.4: David Bjorgen, Wikimedia Commons, CC BY-SA 3.0, https://commons.wikimedia. org/wiki/File:Hope_Diamond.jpg

Chapter 17 Figure 17.1: Ali Zifan, Wikimedia Commons, CC BY-SA 4.0, https://commons.wikimedia.org/ wiki/File:Prokaryote_cell.svg Figure 17.2: Shutterstock Figure 17.3: Shutterstock

442

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

IMAGE CREDITS

Chapter 18 Figure 18.1: Eric Gaba (Translated by NordNordWest, Modifications by Matthew Stevens), Wikimedia Commons, CC BY-SA 3.0, https://commons.wikimedia.org/wiki/ File:Galapagos_Islands_topographic_map-en.svg Figure 18.2: Shutterstock Figure 18.3: Shutterstock Figure 18.4: Shutterstock Figure 18.5: Shutterstock Computers Card Sort, Photos 1–10: Shutterstock Telephones Card Sort, Photos 1–10: Shutterstock

Chapter 19 Figure 19.1: Shutterstock Figure 19.2: From the National Institutes of Health (author unknown),Wikimedia Commons, Public Domain, https://commons.wikimedia.org/wiki/File:Yew_bark_Taxol_PD.jpg

Chapter 20 Figure 20.1: Robinson R, Wikimedia Commons, CC BY 2.5, https://commons.wikimedia. org/wiki/File:Antisense_DNA_oligonucleotide.png Figure 20.2: Shutterstock Figure 20.3: Shutterstock Figure 20.4: Mariuswalter, Wikimedia Commons, CC BY-SA 4.0, https://commons. wikimedia.org/w/index.php?curid=62766590 Figure 20.5: Authors (Adapted from Hammond, A. R. Galizi, K. Kyrou, A. Simoni, C. Siniscalchi, D. Katsanos, M. Gribble, D. Baker, E. Marois, S. Russell, A. Burt, N. Windbichler, A. Crisanti, and T. Nolan. 2016. A CRISPR-Cas9 gene drive system targeting female reproduction in the malaria mosquito vector Anopheles gambiae. Nature Biotechnology 34 (1): 78–83. www.nature.com/articles/nbt.3439.epdf)

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

443

Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

Index Note: Page references in boldface indicate information contained in figures or tables. A absorbance, 207–208, 209, 219 accelerometer, 241–242, 242, 245, 253 acetaldehyde dehydrogenase, 159 acetylcholine, 70–74, 73, 83, 87 adaptive radiation, 375, 376 airplanes, algal biofuel for, 222 alcohol abuse (case study), 157–177 activity, 161–164 apply and analyze, 164 assessment, 174 case, 159 Chronic Alcoholism Treatment Proposal (worksheet), 166, 168 Create a Plan (graphic organizer), 165, 167 curriculum connections, 171–172 design challenge, 164–169, 165 Evaluation Plan (graphic organizer), 166, 169 extensions, 174 introduction, 157–158, 158 investigate and explain, 160–161, 160–161 lesson integration, 171 lesson objectives, 158, 170 lesson overview, 170 lesson preparation, 172–173 Public Service Announcement (PSA), 158, 162–164, 170, 172, 176–177 related National Academy of Engineering Grand Challenge, 172 related Next Generation Science Standards, 171–172 resources and references, 177 storyboard script, 162–164, 170, 176–177 teacher answer key, 174–177 teacher notes, 170–177 teaching organizer, 173 use of case, 170 vocabulary, 173 alcoholism, symptoms and effects of, 158

Alexander, Albert, 351 algae, 221–223, 222 bioprospecting, 403 collecting, 224–225, 225, 234–236 wet mount for observation, 225, 225–227, 234–235 algae farming, 228–231, 236 algae skimmer, 224–225, 225, 234–236 algal biofuels (case study), 221–238 activity, 224–227, 225 apply and analyze, 227 assessment, 236 case, 221–222 Create a Plan (graphic organizer), 229, 231 curriculum connections, 232–233 design challenge, 227–231, 228 extensions, 236 introduction, 221, 222 investigate and explain, 223, 223–224 lesson integration, 232 lesson objectives, 221, 232 lesson overview, 232 lesson preparation, 233–236, 235 related National Academy of Engineering Grand Challenge, 233 related Next Generation Science Standards, 233 resources and references, 238 teacher answer key, 237–238 teacher notes, 232–238 teaching organizer, 235 use of case, 232 vocabulary, 236 allergic reaction, 135–155. See also anaphylaxis (case study) allergy testing, 139–141, 140, 154 American ginseng. See ginseng analog observation, 381 anaphylaxis (case study), 135–155 activity, 139–141, 140 apply and analyze, 142 assessment, 151

case, 136–138, 137 Create a Plan (graphic organizer), 143, 145 curriculum connections, 148–150 design challenge, 142–147, 143 Evaluation Plan (graphic organizer), 144, 147 extensions, 151 introduction, 135–136, 136 investigate and explain, 138, 138–139 lesson integration, 148 lesson objectives, 136, 148 lesson overview, 148 lesson preparation, 150–151 Medical Treatment Proposal (worksheet), 144, 146 related National Academy of Engineering Grand Challenge, 150 related Next Generation Science Standards, 149 resources and references, 155 symptoms of anaphylaxis, 137 teacher answer key, 151–154 teacher notes, 148–155 teaching organizer, 150 use of case, 148 vocabulary, 151 anemone toxin, 136–137, 152 animal models, 299–301 Anopheles mosquito, 13, 15–16, 419 Antabuse, 159, 164, 170, 172, 174 antibiotic resistance (case study), 349–372 activity, 353–359, 354, 357–358 apply and analyze, 359 assessment, 369 Bacteria Colony Survivability Chart, 357–358 case, 350–351, 350–352 Create a Plan (graphic organizer), 361, 363 curriculum connections, 366–367 design challenge, 359–364, 360

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

445

Evaluation Plan (graphic organizer), 362, 364 extensions, 369 introduction, 349, 349–350 investigate and explain, 352–353, 353 lesson integration, 366 lesson objectives, 350, 365 lesson overview, 365 lesson preparation, 367–368, 368 related National Academy of Engineering Grand Challenge, 367 related Next Generation Science Standards, 366–367 resources and references, 372 teacher answer key, 369–372 teacher notes, 365–372 teaching organizer, 368 use of case, 365 vocabulary, 368 antibiotics, 349–350. See also antibiotic resistance (case study) antigens, 135–136, 148, 150 antihistamines, 136, 142 arrhythmia, 117, 121, 132 aspirin, 395 assistive technology, 308–314 Assistive Technology Design for Men and Women (graphic organizer), 310, 313 Assistive Technology Intervention for a Genetic Disease or Disorder (worksheet), 310, 312 autosomal trait, 303–305, 321 autosomes, 303 B bacteria antibiotic resistance (case study), 349–372 optimum temperature for, 260, 260–261 spacers of DNA in, 416–418, 433 structure, 349 Taq polymerase (case study), 257–275 Bacteria Colony Survivability Chart, 357–358 banded krait venom, 70 Barrangou, Rodolphe, 417 base pairing, DNA, 46, 416 benefits-sharing, 263, 274 binge drinking, 160–161, 160–161, 175–176 biofluorescence, 205–207, 211, 215–219 biofuels. See algal biofuels (case study) biological gold, 403, 413 bioluminescence, 205, 207, 207, 211, 215–219

446

biopiracy, 396, 413 bioprospecting, 261–263, 269 algae, 403 biopiracy and, 396, 413 overview of, 395 bioprospecting (case study), 395–414 activity, 399, 399–402, 401 apply and analyze, 403 assessment, 412 case, 397, 397–398 Create a Plan (graphic organizer), 404, 406 curriculum connections, 409–410 design challenge, 403, 403–407 extensions, 411 introduction, 395–396, 396 investigate and explain, 398, 398 lesson integration, 409 lesson objectives, 396, 408 lesson overview, 408 lesson preparation, 410–411, 411 Letter to the FDA (worksheet), 405, 407 related National Academy of Engineering Grand Challenge, 410 related Next Generation Science Standards, 409–410 resources and references, 414 teacher answer key, 412–413 teacher notes, 408–414 teaching organizer, 411 use of case, 409 vocabulary, 411 blood clot, 88 blood pressure medications, effect of grapefruit juice on, 91–92, 100, 109–110 Botryococcus braunii, 229 Botti, Jean, 222 Brock, Thomas, 258, 262, 274 Brown, Melissa, 300–301 bungarotoxins, 70 C cancer treatment allergy treatments and, 142 Antabuse, 164, 177 immune system and, 142 Taxol, 397–398 thalidomide, 51–55, 52–54, 61, 65–66 venom, 71 cardiac cycle, 118, 119 Cas9, 417, 417, 433 case study approach, 3–4 Centers for Disease Control and Prevention (CDC) alcohol abuse, 160, 162, 170 allergic reactions, 138, 151

cholera fact sheet, 37 malaria, 13, 19–20 Chain, Ernst, 351–352, 369 Chang, C. C., 70 cheese, CRISPR and, 415, 417 chlorophyll extraction from spinach, 205, 209–210, 217 fluorescence, 205–208, 209, 219 in algae, 221 cholera (case study), 31–47 activity, 34–37, 35 apply and analyze, 37 assessment, 46 case, 32–33, 33 Create a Plan (graphic organizer), 39, 40 curriculum connections, 42–43 design challenge, 38–40 extensions, 46 introduction, 31, 31–32 investigate and explain, 33, 34 lesson integration, 42 lesson objective, 32, 41 lesson overview, 41 lesson preparation, 43–45, 45 related National Academy of Engineering Grand Challenge, 43 related Next Generation Science Standards, 42–43 resources and references, 47 teacher answer key, 46–47 teacher notes, 41–47 teaching organizer, 45 use of case, 41 vocabulary, 45 Choosing a New Use for DNA Fingerprinting Technology (worksheet), 334, 336 chronic alcohol abuse. See alcohol abuse (case study) Chronic Alcoholism Treatment Proposal (worksheet), 166, 168 cladogram, 376–380, 377, 393 climate change, 29, 179–182, 183, 188– 189, 194, 196, 206, 219, 380 cobra/cobra venom, 69, 69–74, 83, 87. See also venom (case study) colistin, 359, 372 colorblindness, 309–310 competitive inhibition, 72–74, 73, 78, 83, 86 complete heart block, 120 congenital deformations, thalidomide and, 50, 61, 63–64 contour map, 35, 35, 44 coral, biofluorescence and, 206 cowpox, 278–280, 279, 290, 293–294

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

INDEX cows, DNA profiling and, 328–330, 329, 345 Create a Plan (graphic organizer) alcohol abuse, 165, 167 algal biofuels, 229, 231 anaphylaxis, 143, 145 antibiotic resistance, 361, 363 bioprospecting, 404, 406 cholera, 39, 40 Darwin’s observations in the Galápagos Islands, 382, 384 drug interactions, 101, 103 environmental impact on species, 191, 193 malaria, 20, 22 pacemaker, 124, 126 sensors, 245, 247 thalidomide, 56, 58 venom, 78, 80 CRISPR (case study), 415–437 activity, 420–422 apply and analyze, 422, 423, 424 assessment, 433 case, 416–417, 416–418 curriculum connections, 430–431 design challenge, 424, 424–429 Evaluating a Grant Proposal (worksheet), 426, 429 extensions, 433 Grant Proposal Rubric, 436 introduction, 415, 416 investigate and explain, 418–419, 418–420 lesson integration, 430 lesson objectives, 415, 430 lesson overview, 430 lesson preparation, 432 Planning a Grant Proposal (worksheet), 425, 428 Potential Global Issues (graphic organizer), 425, 427 related National Academy of Engineering Grand Challenge, 431 related Next Generation Science Standards, 431 resources and references, 437 teacher answer key, 433–436 teacher notes, 430–437 teaching organizer, 432 use of case, 430 vocabulary, 432 CRISPR RNA (crRNA), 416, 433 crosscutting concepts alcohol abuse, 171 algal biofuels, 233 anaphylaxis, 149 antibiotic resistance, 367 bioprospecting (case study), 410 cholera, 42

CRISPR, 431 Darwin’s observations in the Galápagos Islands, 388 DNA fingerprinting, 342 drug interactions, 108 environmental impact on species, 196 fluorescence, 216 genetic disorders, 317 malaria (case study), 25 pacemaker, 129 sensors, 250 Taq polymerase, 271 thalidomide, 62 vaccines, 291 venom, 85 D Darwin’s observations in the Galápagos Islands (case study), 373–394 activity, 376–380, 377–378 apply and analyze, 381 assessment, 391 case, 375 Create a Plan (graphic organizer), 382, 384 curriculum connections, 387–388 design challenge, 380–385, 381 Developing an Observation Plan (worksheet), 382, 385 extensions, 391 introduction, 373–374, 374 investigate and explain, 375–376, 376 lesson integration, 387 lesson objectives, 374, 386 lesson overview, 386 lesson preparation, 388–390, 390 related National Academy of Engineering Grand Challenge, 388 related Next Generation Science Standards, 387–388 resources and references, 393 teacher answer key, 391–393 teacher notes, 386–394 teaching organizer, 390 use of case, 386 vocabulary, 390 Darwin, Charles, 373–375, 386 deep-vein thrombosis, 69, 88 denaturing proteins, 257, 258 Developing a New Vaccine (graphic organizer), 286, 288 Developing an Observation Plan (worksheet), 382, 385 diaphragm cobra venom and, 70, 71 model, 74–75, 75 dichotomous key, 226–227

dinosaurs, cladogram of, 377, 377, 393 discovery engineering description of, 1–2 difference from other engineering designs, 2–3 Diseases and Vaccines Chart, 281, 292, 295–296 disulfiram, 159, 164 DNA (deoxyribonucleic acid) base pairing, 46, 416 gel electrophoresis, 327, 327 information in, 415 sample collection, 327 spacer sequences, 416–418, 433 structure of, 325, 326 to protein, 416 DNA database, 332–333, 347 DNA fingerprinting discovery of, 326–327, 344 PCR and, 259, 327 uses of, 325, 326–327 DNA fingerprinting (case study), 325–348 activity, 330, 330–332, 338–340 apply and analyze, 332–333 assessment, 344 case, 326–328, 327 Choosing a New Use for DNA Fingerprinting Technology (worksheet), 334, 336 curriculum connections, 342–343 design challenge, 333, 333–340 DNA Profile Comparison Chart, 331–332, 346 Evaluation Plan (graphic organizer), 335, 337 extensions, 344 introduction, 325, 326 investigate and explain, 328–330, 329 lesson integration, 342 lesson objectives, 326, 341 lesson overview, 341 lesson preparation, 343, 343–344 related National Academy of Engineering Grand Challenge, 343 related Next Generation Science Standards, 342 resources and references, 348 teacher answer key, 344–347 teacher notes, 341–348 teaching organizer, 343 use of case, 341 vocabulary, 344 DNA polymerase, 258–260, 269. See also Taq polymerase (case study) DNA Profile Comparison Chart, 331– 332, 346

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

447

DNA profiling, 325, 327–333, 329, 338– 341, 345. See also DNA fingerprinting DNA replication, 329 dogs communication, 239, 239, 252 rescue-and-recovery training, 242–244, 243, 253–254 sensor technology use with, 241– 244, 242–243, 252–254 dominant trait, 304, 321 Drug Interaction Treatment Proposal (worksheet), 102, 104 drug interactions (case study), 89–116 activity, 95–99, 97–98 apply and analyze, 99–100 assessment, 109 case, 90–92, 92 Create a Plan (graphic organizer), 101, 103 curriculum connections, 107–108 design challenge, 100–102, 101 Drug Interaction Chart, 92–94, 110–114 Drug Interaction Treatment Proposal (worksheet), 102, 104 Evaluation Plan (graphic organizer), 102, 105 extensions, 109 introduction, 89, 90 investigate and explain, 92 lesson integration, 107 lesson objectives, 90, 106 lesson overview, 106 lesson preparation, 108, 108–109 related National Academy of Engineering Grand Challenge, 108 related Next Generation Science Standards, 107–108 resources and references, 116 teacher answer key, 109–116 teacher notes, 106–116 teaching organizer, 108 use of case, 106 vocabulary, 109 drug transporters, 91, 92 E EADS, 222 egg allergies, flu vaccines and, 142, 154 electrical system/activity of the heart, 118, 120, 123 electricity, treating diseases through, 123–127 electrocardiogram (ECG/EKG), 118, 120, 132–133 elephants, sensor technology to communicate with, 244, 254 engineering design process (EDP), 2, 3 alcohol abuse, 164–169, 165

448

algal biofuels, 228, 228–231 anaphylaxis, 142–147, 143 antibiotic resistance, 359–364, 360 bioprospecting, 403, 403–407 cholera, 38, 38–39 CRISPR, 424, 424–429 Darwin’s observations in the Galápagos Islands, 381, 381–385 DNA fingerprinting, 333, 333–340 drug interactions (case study), 100–102, 101 environmental impact on species, 188, 188–193 fluorescence, 210–214, 211 genetic disorders, 308–314, 309 malaria, 19–21, 20 pacemaker, 123–125, 124 sensors, 244, 244–247 six-step approach, 8, 8 Taq polymerase, 263–268, 264 thalidomide, 55–57, 56 vaccines (case study), 284–289, 285–286 venom, 77, 77–79 environmental assessment (EA), 180, 188–194, 199 components of, 190–191 example of EA topic, 191 environmental impact assessment (EIA), 198 environmental impact on species (case study), 179–203 activity, 182, 184–185, 184–187 apply and analyze, 187–188 assessment, 199 case, 180–182 Create a Plan (graphic organizer), 191, 193 curriculum connections, 195–196 design challenge, 188, 188–193 extensions, 198 introduction, 179, 180 investigate and explain, 182, 183 lesson integration, 195 lesson objectives, 14, 180 lesson overview, 194 lesson preparation, 196–198, 197 related National Academy of Engineering Grand Challenge, 196 related Next Generation Science Standards, 195–196 resources and references, 203 teacher answer key, 199–203 teacher notes, 194–203 teaching organizer, 197 use of case, 194–195 vocabulary, 198 enzymes, 91, 92, 100, 108–109 acetaldehyde dehydrogenase, 159

Epidemiologist Field Report (worksheet), 36–37 epidemiology, 33. See also cholera (case study) Escherichia coil (E. coli), 349, 353–354, 370 Evaluating a Grant Proposal (worksheet), 426, 429 Evaluation Plan (graphic organizer) alcohol abuse, 166, 169 anaphylaxis, 144, 147 antibiotic resistance, 362, 364 DNA fingerprinting, 335, 337 drug interactions, 102, 105 genetic disorders, 311, 314 malaria, 21, 23 thalidomide, 57, 60 vaccines, 287, 289 venom, 79, 82 evolution, 373, 378, 386–388, 391, 393, 410 extreme environments, 264–268 Extreme Habitats Research (graphic organizer), 265, 267 extremophiles, 261–265, 269 F FDA. See Food and Drug Administration (FDA) fermentation, 157 finches, Galápagos, 373–376, 376 firefly, bioluminescence in, 207, 207 Fleming, Alexander, 350–352, 369 Florey, Howard, 351–352, 369 flu vaccine, 280, 294 egg allergies and, 142, 154 fluorescence (case study), 205–220 activity, 209–210 apply and analyze, 210 assessment, 219 case, 206–207, 207 curriculum connections, 216 design challenge, 210–214, 211 extensions, 218 introduction, 205 investigate and explain, 207–208, 208–209 lesson integration, 216 lesson objectives, 205, 215 lesson overview, 215 lesson preparation, 217–218, 218 New Product/Process for Plant Fluorescence (worksheet), 212, 214 related National Academy of Engineering Grand Challenge, 216 related Next Generation Science Standards, 216 resources and references, 220 teacher answer key, 219–220

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

INDEX teacher notes, 215–220 teaching organizer, 218 use of case, 215 vocabulary, 218 fluorescence-based monitoring tool, designing, 211–214, 219 food allergies, 138–140 Food and Drug Administration (FDA) allergens, 151 approval process, 52 disulfiram, 159 food and drug interactions, 92, 101 letter to review committee (worksheet), 56–57, 59 Letter to the FDA (worksheet), 405, 407 paclitaxel approval, 398 thalidomide and, 50 food and drug interactions. See drug interactions (case study) forensics, DNA and, 327, 330–332, 346–347 Framework for K–12 Science Education, 4–5 furanocoumarin, 91 G Galápagos Islands, 373–374, 374, 376 garlic, 404 gel electrophoresis, 327, 327 gene drive, 419, 419–420, 434 gene editing, 415, 417–418, 433. See also CRISPR (case study) advantages and disadvantages of, 422, 423, 424 genetic code, 326 genetic disorders (case study), 299–323 activity, 303–307, 304–307 apply and analyze, 307–308 assessment, 318–319 Assistive Technology Design for Men and Women (graphic organizer), 310, 313 Assistive Technology Intervention for a Genetic Disease or Disorder (worksheet), 310, 312 case, 300, 300–301 curriculum connections, 316–317 design challenge, 308–314, 309 Evaluation Plan (graphic organizer), 311, 314 extensions, 318 introduction, 299 investigate and explain, 302, 302–303 lesson integration, 316 lesson objectives, 300, 315 lesson overview, 315 lesson preparation, 317, 317–318 related National Academy of Engineering Grand Challenge, 317

related Next Generation Science Standards, 316–317 resources and references, 323 teacher answer key, 319–322 teacher notes, 314–323 teaching organizer, 317 use of case, 315 vocabulary, 318 Genetics Home Reference website, 433 genotypes, 303, 305–307, 317, 321 geographic information system (GIS), 32, 35, 41, 43 germ theory of disease, 31, 32, 46 ginseng, 399, 399–402, 401, 413 Global Positioning System (GPS), 240 global warming, malaria and, 16, 28 Grand Challenges for Engineering in the 21st century, 0 grant proposal designing, 425 Evaluating a Grant Proposal (worksheet), 426, 429 Grant Proposal Rubric, 436 Planning a Grant Proposal (worksheet), 425, 428 grapefruit/ grapefruit juice, 89–92, 90, 92, 100, 106, 110 graphic organizers, 9 Greatbatch, Wilson, 118–120, 131 Greenhouse Gases Observing Satellite (GOSAT), 206 gyroscopes, 241, 245 H Hald, Jens, 159 heart. See also pacemaker (case study) cardiac cycle, 118, 119 electrical system/activity, 118, 120, 123 hemophilia, 303, 305, 305–306, 320 histamines, 135–136, 142 HIV vaccine development, approaches for, 286 homeostasis, 70, 83–84, 107, 117, 128, 130–131, 149, 171 Hope Diamond (activity), 330, 330–332, 338–340, 346–347 Hughes, Reverend Griffith, 89 I immunization, 279. See also vaccines; vaccines (case study) implantable pacemaker. See pacemaker (case study) Industrial Revolution, 182, 184 inheritance Darwin and, 375, 392 of hemophilia, 303, 305, 305–306, 320 pedigree analysis, 303–308, 304– 307, 320–322

intensity of binge drinking, 161, 161, 175 interview, in cholera case study, 36 J Jacobsen, Erik, 159 Jeffreys, Alec, 326, 328, 344–345 Jenner, Edward, 278–280, 279, 285, 290, 293 K Kelsey, Dr. Frances Oldham, 50, 51 Kettlewell, Bernard, 182 knockout, 301 L Laveran, Charles Louis Alphonse, 14–15, 27 Lawrence Hal of Science, 380 Lee, C. Y., 70 Letter to the FDA (worksheet), 405, 407 Link, Jamie, 240 live-attenuated vaccine, 279, 285 London, cholera outbreaks in, 1, 31–33, 34, 41, 46 M malaria (case study), 13–29 activity, 17–18, 18 apply and analyze, 18–19 assessment, 27 case, 14, 14–15 Create a Plan (graphic organizer), 20, 22 curriculum connections, 25–26 design challenge, 19–21, 20 Evaluation Plan, 21, 23 extensions, 27 introduction, 13, 13–14 investigate and explain, 15–16, 16–17 lesson integration, 25 lesson objectives, 14, 24 lesson overview, 24 lesson preparation, 26–27 related National Academy of Engineering Grand Challenge, 26 related Next Generation Science Standards, 25 resources and references, 29 teacher answer key, 27–29 teacher notes, 24–29 teaching organizer, 26 use of case, 24 vocabulary, 27 malaria, CRISPR use for control of, 418–420, 419, 434 mark-release-recapture (MRR), 187–188, 198, 202–203 mast cells, 135 measles, 284, 290

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

449

Medical Treatment Proposal (worksheet), 144, 146 medicinal bacteria and fungi, 360 Mexican spider monkey, 187–188, 202–203 miasma theory, 31, 32, 46 mice, as animal model, 299–301 microsensors, accidental discovery of, 240, 248 milkmaids, 278–279 minoxidil, 56 missing children, DNA testing and, 332–333, 347 mixed-sex test subjects, 299–303, 315, 320 mosquitoes, 13, 13–16, 16, 18–19, 28–29. See also malaria (case study) genetic modification of, 418–422, 434–435 moth, peppered, 182, 184–185, 184–186, 194, 200–201 motion-based data, sensors to collect, 241 MRR (mark-release-recapture), 187–188, 198, 202–203 Mullis, Kary, 258–259 multiple myeloma, 51, 65 multiple sclerosis (MS), 300–301, 301, 315, 319 myasthenia gravis, 70–71, 83 N National Academy of Engineering Grand Challenge, 9 alcohol abuse, 172 algal biofuels, 233 anaphylaxis, 150 antibiotic resistance, 367 bioprospecting, 410 cholera, 43 CRISPR, 431 Darwin’s observations in the Galápagos Islands, 388 DNA fingerprinting, 343 drug interactions, 108 environmental impact on species, 196 fluorescence, 216 genetic disorders, 317 malaria, 26 pacemaker, 129 sensors, 250 Taq polymerase, 271 vaccines, 291 venom, 85 National DNA Index System, 330 National Institute on Alcohol Abuse and Alcoholism, 165 National Institutes of Health (NIH), 299, 301, 320 National Park Service, 263, 274

450

natural selection, 375, 386, 388, 392 naturalistic observation, 380–385, 386 neurotransmitters, 70, 72, 87. See also acetylcholine New Product/Process for Plant Fluorescence (worksheet), 212, 214 Next Generation Science Standards (NGSS) alcohol abuse, 171–172 algal biofuels, 233 anaphylaxis, 149 antibiotic resistance, 366–367 bioprospecting, 409–410 cholera, 42–43 CRISPR, 431 Darwin’s observations in the Galápagos Islands, 387–388 DNA fingerprinting, 342 drug interactions, 107–108 environmental impact on species, 195–196 fluorescence, 216 genetic disorders, 316–317 malaria, 25 pacemaker, 129 recommendations for teaching engineering practices, 4–8, 6, 10 sensors, 249–250 Taq polymerase, 270–271 vaccines, 291 venom, 84–85 O observation, naturalistic, 380–385, 386 oil, produced by organisms, 222–224, 223, 228–229, 237 On the Origin Species (Darwin), 375, 386 optimum temperature for bacterial growth, 260, 260–261 oscillator, 118–119 P pacemaker (case study), 117–134 activity, 121–123, 122 apply and analyze, 123 assessment, 131 case, 118–120, 119 Create a Plan (graphic organizer), 124, 126 curriculum connections, 128–129 design challenge, 123–125, 124 extensions, 131 introduction, 117, 117 investigate and explain, 120, 121 lesson integration, 128 lesson objective, 118, 128 lesson overview, 128 lesson preparation, 130–131 related National Academy of Engineering Grand Challenge, 129

related Next Generation Science Standards, 129 resources and references, 133 teacher answer key, 131–133 teacher notes, 128–134 teaching organizer, 130 Treatment Plan Evaluation Form, 125, 127 use of case, 128 vocabulary, 131 Pacific yew tree, 397, 397, 408, 412 paclitaxel, 397–398, 408, 412 Panax quinquefolius, 399, 399–402, 401 passive infrared detectors, 241, 245 PCR. See polymerase chain reaction (PCR) pedigree analysis, 303–308, 304–307, 320–322 penicillin, 350–352, 360, 365 Penicillium, 350–351, 350–352, 360, 369–370 peppered moth, 182, 184–185, 184–186, 194, 200–201 performance expectations, NGSS alcohol abuse, 171 algal biofuels, 233 anaphylaxis, 149 antibiotic resistance, 366 bioprospecting (case study), 409 cholera, 42 CRISPR, 431 Darwin’s observations in the Galápagos Islands, 387 DNA fingerprinting, 342 drug interactions, 107 environmental impact on species, 195 fluorescence, 216 genetic disorders, 316 malaria (case study), 25 pacemaker, 129 sensors, 249 Taq polymerase, 270 thalidomide, 62 vaccines, 291 venom, 84 phenotypes, 303, 305–307, 317, 321 photosynthesis fluorescence to monitor, 205–206 in algae, 221 in leaves, 208 phylogenetic trees, 398–399, 398–399 pika, 179–182, 180, 183, 189, 194, 199–200 pit viper venom, 76, 88 Planning a Grant Proposal (worksheet), 425, 428 plant fluorescence. See fluorescence (case study) plants

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

INDEX bioprospecting, 395 (see also bioprospecting (case study)) medicinal, 395, 396 phylogenetic trees, 398–399, 398–399 Plasmodium, 14, 14–15, 26, 28 Poisons: Their Effects and Detection (Blyth), 72 pollen, 135, 136 polymerase chain reaction (PCR), 258– 261, 259, 272–273, 327 poppy, 395 Portier, Paul, 136, 138, 151–152 Potential Global Issues (graphic organizer), 425, 427 power lines, UV light from, 210, 220 pregnancy, thalidomide use during, 49–50 prevalence of binge drinking, 160, 160, 175 prey–environment relationship, modeling, 186–187, 202 probiotics, 417 prokaryotes antibiotic resistance (case study), 349–372 structure, 349 proteins denaturing, 257, 258 DNA to, 416 protists, 221 Public Service Announcement (PSA), 158, 162–164, 170, 172, 176–177 Punnett square, 307–308, 322 R rail system, environmental assessment and, 191 recessive trait, 304, 309, 321–322 repurposing drugs Antabuse, 164, 177 thalidomide, 55–60, 66 (See also thalidomide (case study)) rescue-and-recovery dog training, 242– 244, 243, 253–254 Research Presentation Planner, 265, 268 respiratory system, 71 Richet, Charles, 136–138, 151–152 rooftop farming, 229 Rosalind Franklin Institute for Genomics, 425–426 Rothia, 361 S science and engineering practices (SEPs), 4–5, 7–8 alcohol abuse, 171 algal biofuels, 233 anaphylaxis, 149 antibiotic resistance, 366

bioprospecting (case study), 410 cholera, 42 CRISPR, 431 Darwin’s observations in the Galápagos Islands, 387 DNA fingerprinting, 342 drug interactions, 107 environmental impact on species, 195 fluorescence, 216 genetic disorders, 316 malaria (case study), 25 pacemaker, 129 sensors, 249 Taq polymerase, 270 thalidomide, 62 vaccines, 291 venom, 84 scientific method, 6–7, 7 sensors (case study), 239–255 activity, 242–244, 243 apply and analyze, 244 assessment, 252 case, 240, 240–241 Create a Plan (graphic organizer), 245, 247 curriculum connections, 248–249 design challenge, 244, 244–247 extensions, 252 introduction, 239, 239 investigate and explain, 241–242, 242 lesson integration, 249 lesson objectives, 240, 248 lesson overview, 248 lesson preparation, 250–251, 251 related National Academy of Engineering Grand Challenge, 250 related Next Generation Science Standards, 249–250 resources and references, 255 teacher answer key, 252–254 teacher notes, 248–255 teaching organizer, 251 use of case, 248 vocabulary, 251 SEPs. See science and engineering practices (SEPs) sex chromosomes, 303 sex-linked trait, 303–305, 309, 320–322 silicon chip, 240, 240 skin cancer, 78 smallpox, 277–280, 278, 290, 293–294 snake venom. See venom (case study) Snow, John, 1, 31–33, 41, 46 solar-induced chlorophyll fluorescence, 206–207 Staphylococcus aureus, 350–353, 353, 370 Stokes-Adams attacks, 120

storyboard script, 162–164, 170, 176–177 Streptococcus thermophilus, 417 T Taq polymerase (case study), 257–275 activity, 261–263 apply and analyze, 263 assessment, 272 case, 258–259, 259 curriculum connections, 270–271 design challenge, 263–268, 264 extensions, 272 Extreme Habitats Research (graphic organizer), 265, 267 introduction, 257, 258 investigate and explain, 260, 260–261 lesson integration, 270 lesson objectives, 257, 269 lesson overview, 269 lesson preparation, 271, 271–272 related National Academy of Engineering Grand Challenge, 271 related Next Generation Science Standards, 270–271 Research Presentation Planner, 265, 268 resources and references, 275 teacher answer key, 272–274 teacher notes, 269–275 teaching organizer, 271 use of case, 269 vocabulary, 272 Taxol, 397–398 teaching engineering practices, NGSS recommendations for, 4–8, 6, 10 teaching organizer algal biofuels, 235 anaphylaxis, 150 antibiotic resistance, 368 bioprospecting, 411 cholera, 45 CRISPR, 432 Darwin’s observations in the Galápagos Islands, 390 DNA fingerprinting, 343 drug interactions, 108 environmental impact on species, 197 fluorescence, 218 genetic disorders, 317 malaria, 26 pacemaker, 130 sensors, 251 Taq polymerase, 271 thalidomide, 63 vaccines, 292 venom, 86 thalidomide (case study), 49–67

BIOLOGY Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

451

activity, 53–55, 54 apply and analyze, 55 assessment, 64 case, 50–51, 51 Create a Plan (graphic organizer), 56, 58 curriculum connections, 61–63 design challenge, 55–57, 56, 58–60 Evaluation Plan (graphic organizer), 57, 60 extensions, 64 introduction, 49, 49–50 investigate and explain, 52–53, 52–53 lesson integration, 61 lesson objectives, 50, 61 lesson overview, 61 lesson preparation, 63, 63 Letter to the FDA (worksheet), 56–57, 59 resources and references, 67 teacher answer key, 64–66 teacher notes, 61–66 teacher organizer, 63 use of case, 61 vocabulary, 63 Thermus aquaticus, 258, 269, 274 toxins, 77, 136–137, 152 Treatment Plan Evaluation Form (pacemaker case study), 125, 127 tube wells, 34–37, 41, 47 turtles, freshwater, 187 U UV light, visible to animals, 210, 220 V vaccines diseases, viruses and, 280, 280–282, 292, 294 HIV vaccine development, approaches for, 286 live-attenuated, 279, 285 vaccination coverage, 283–284, 297 vaccines (case study), 277–297 activity, 281–283 apply and analyze, 283–284 assessment, 293 case, 278–280, 279 curriculum connections, 290–291 design challenge, 284–289, 285–286 Developing a New Vaccine (graphic organizer), 286, 288 Diseases and Vaccines Chart, 281, 292, 295–296

452

Evaluation Plan (graphic organizer), 287, 289 extensions, 293 introduction, 277, 278 investigate and explain, 280, 280 lesson integration, 290 lesson objectives, 278, 290 lesson overview, 290 lesson preparation, 292, 292–293 related National Academy of Engineering Grand Challenge, 291 related Next Generation Science Standards, 291 resources and references, 297 teacher answer key, 293–297 teacher notes, 290–297 teaching organizer, 292 use of case, 290 vocabulary, 293 Varner, Johanna, 180–182, 199 venom (case study), 69–88 activity, 74–76, 75 apply and analyze, 76 assessment, 86 case, 70–71, 71 Create a Plan (graphic organizer), 78, 80 curriculum connections, 84–85 design challenge, 76–79, 77 Evaluation Plan (graphic organizer), 79, 82 extensions, 86 introduction, 69, 69 investigate and explain, 72–74, 73 lesson integration, 84 lesson objectives, 70, 83 lesson overview, 83 lesson preparation, 85–86 model diaphragm, 74–75, 75 related National Academy of Engineering Grand Challenge, 85 related Next Generation Science Standards, 84–85 resources and references, 88 teacher answer key, 87–88 teacher notes, 83–88 teaching organizer, 86 use of case, 83 Venom-Based Medication Proposal, 78, 81 vocabulary, 86 venom, types of, 78 venom-based drugs, developing, 77–82, 86

Venom-Based Medication Proposal (worksheet), 78, 81 Victoria, Queen, 305, 305–306, 320 video presentation, 265, 268 virus diseases and vaccines, 280, 280–282, 292, 294 smallpox, 277–280, 278, 290, 293–294 spacer DNA sequences in bacteria and, 416–418, 433 structure, 286 vocabulary alcohol abuse, 173 algal biofuels, 236 antibiotic resistance, 368 bioprospecting, 411 cholera, 45 CRISPR, 432 Darwin’s observations in the Galápagos Islands, 390 DNA fingerprinting, 344 drug interactions, 109 environmental impact on species, 198 fluorescence, 218 genetic disorders, 318 malaria, 27 pacemaker, 131 sensors, 251 Taq polymerase, 272 thalidomide, 63 vaccines, 293 venom, 86 W Wall, Monroe, 397 Wani, Mansukh, 397 water contamination. See cholera (case study) wet mount for algae observation, 225, 225–227, 234–235 wild type, 301 wildfires, 179–181, 194 World Health Organization (WHO), 34, 36 antibiotic resistance, 359 malaria, 13, 17 Y Yellowstone National Park, 257–258, 269, 274 yogurt, CRISPR and, 415, 417 Z Zika, 420

NATIONAL SCIENCE TEACHING ASSOCIATION Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145

“Careful observations and discovery-based research can be inspired by the natural world, leading to new ideas and applications sourced from biology itself. The key to harnessing this potential is a careful and imaginative eye, along with a mindful process of engineering to address and solve everyday problems.” —From the introduction to Discovery Engineering in Biology

S

how your students how amazing it can be to just “see what will happen” when they blend biology, engineering, and serendipity. Focusing on innovations sparked by accidental or unexpected observations, the case studies in this resource are a lively way to integrate engineering and experimentation into your biology classes. Middle and high school students will learn fundamental science processes while using their natural curiosity to explore ideas for new applications and products. They’ll also find out that small, plant-eating mammals called pikas helped scientists find new ways to survive extreme weather events and that algae can be used as airplane fuel.

Grades 6–12

The book’s 20 easy-to-use investigations help you do the following: • Use real-world case studies to bring accidental inspiration to life. Each investigation starts with an actual scientific discovery that students explore through primary documents or historical accounts. • Let students be the innovators. The investigations task your classes to investigate biological concepts, do research, examine data, create models, and use their own personal ideas to design new products or problem-solving applications. • Apply the content in flexible, interesting ways. You can implement the investigations in part or as a whole, and you can use them to teach one or more science concepts while exposing students to the unpredictable nature of science. Students will be intrigued by investigations with titles such as “Vindicating Venom: Using Biological Mechanisms to Treat Diseases and Disorders” and “Revealing Repeats: The Accidental Discovery of DNA Fingerprinting.” Discovery Engineering in Biology is not only ideal for the classroom. It’s also perfect for informal education at STEM camps, science centers, and more. You’ll help your students see that just as there is no one way to do science, there are many paths that lead to innovations in engineering. And who knows what might happen? Maybe your students will engineer the next amazing survival product inspired by pikas!

PB444X2

ISBN: 978-1-68140-614-5

9 781681 406145 Copyright © 2020 NSTA. All rights reserved. For more information, go to www.nsta.org/permissions. TO PURCHASE THIS BOOK, please visit http://www.nsta.org/store/product_detail.aspx?id=10.2505/9781681406145