Cytotoxic Drug Resistance Mechanisms (Methods in Molecular Medicine, 28) 0896036030, 9780896036031

Citation preview

Hemostasis and Thrombosis Protocols

METHODS IN MOLECULAR MEDICINE

TM

John M. Walker, SERIES EDITOR 35. Gene Therapy of Cancer: Methods and Protocols, edited by Wolfgang Walther and Ulrike Stein, 2000

22. Neurodegeneration Methods and Protocols, edited by Jean Harry and Hugh A. Tilson, 1999

34. Rotovirus Methods and Protocols, edited by James Gray and Ulrich Desselberger, 2000

21. Adenovirus Methods and Protocols, edited by William S. M. Wold, 1998

33. Cytomegalovirus Protocols, edited by John Sinclair, 2000 32. Alzheimer’s Disease: Methods and Protocols, edited by Nigel M. Hooper, 1999 31. Hemostasis and Thrombosis Protocols: Methods in Molecular Medicine, edited by David J. Perry and K. John Pasi, 1999 30. Vascular Disease: Molecular Biology and Gene Therapy Protocols, edited by Andrew H. Baker, 1999 29. DNA Vaccines: Methods and Protocols, edited by Douglas B. Lowrie and Robert Whalen, 1999 28. Cytotoxic Drug Resistance Mechanisms, edited by Robert Brown and Uta Böger-Brown, 1999 27. Clinical Applications of Capillary Electrophoresis, edited by Stephen M. Palfrey, 1999 26. Quantitative PCR Protocols, edited by Bernd Kochanowski and Udo Reischl, 1999 25. Drug Targeting, edited by G. E. Francis and Cristina Delgado, 1999 24. Antiviral Methods and Protocols, edited by Derek Kinchington and Raymond F. Schinazi, 1999 23. Peptidomimetics Protocols, edited by Wieslaw M. Kazmierski, 1999

20. Sexually Transmitted Diseases: Methods and Protocols, edited by Rosanna Peeling and P. Frederick Sparling, 1999 19. Hepatitis C Protocols, edited by Johnson Yiu-Nam Lau, 1998 18. Tissue Engineering, edited by Jeffrey R. Morgan and Martin L. Yarmush, 1999 17. HIV Protocols, edited by Nelson Michael and Jerome H. Kim, 1999 16. Clinical Applications of PCR, edited by Y. M. Dennis Lo, 1998 15. Molecular Bacteriology: Protocols and Clinical Applications, edited by Neil Woodford and Alan Johnson, 1998 14. Tumor Marker Protocols, edited by Margaret Hanausek and Zbigniew Walaszek, 1998 13. Molecular Diagnosis of Infectious Diseases, edited by Udo Reischl, 1998 12. Diagnostic Virology Protocols, edited by John R. Stephenson and Alan Warnes, 1998 11. Therapeutic Application of Ribozymes, edited by Kevin J. Scanlon, 1998 10. Herpes Simplex Virus Protocols, edited by S. Moira Brown and Alasdair MacLean, 1998 9. Lectin Methods and Protocols, edited by Jonathan M. Rhodes

METHODS IN MOLECULAR MEDICINE

Hemostasis and Thrombosis Protocols Edited by

David J. Perry Royal Free Hospital, London, UK

and

K. John Pasi Royal Free Hospital, London, UK

Humana Press

Totowa, New Jersey

TM

© 1999 Humana Press Inc. 999 Riverview Drive, Suite 208 Totowa, New Jersey 07512 All rights reserved. No part of this book may be reproduced, stored in a retrieval system, or transmitted in any form or by any means, electronic, mechanical, photocopying, microfilming, recording, or otherwise without written permission from the Publisher. Methods in Molecular Medicine™ is a trademark of The Humana Press Inc. All authored papers, comments, opinions, conclusions, or recommendations are those of the author(s), and do not necessarily reflect the views of the publisher. This publication is printed on acid-free paper. ∞ ANSI Z39.48-1984 (American Standards Institute) Permanence of Paper for Printed Library Materials. Cover illustration: Fig. x from Ch x by . Cover design by Patricia F. Cleary. For additional copies, pricing for bulk purchases, and/or information about other Humana titles, contact Humana at the above address or at any of the following numbers: Tel.:973-256-1699; Fax: 973-256-8341; E-mail: [email protected]; Website: http://humanapress.com Photocopy Authorization Policy: Authorization to photocopy items for internal or personal use, or the internal or personal use of specific clients, is granted by Humana Press Inc., provided that the base fee of US $10.00 per copy, plus US $00.25 per page, is paid directly to the Copyright Clearance Center at 222 Rosewood Drive, Danvers, MA 01923. For those organizations that have been granted a photocopy license from the CCC, a separate system of payment has been arranged and is acceptable to Humana Press Inc. The fee code for users of the Transactional Reporting Service is: [0-89603-603-0/99 $10.00 + $00.25]. Printed in the United States of America. 10 9 8 7 6 5 4 3 2 1 Library of Congress Cataloging in Publication Data Main entry under title: Methods in molecular medicine™. Hemostasis and thrombosis protocols / edited by David Perry and K. John Pasi. p. cm. — (Methods in molecular medicine™ ; 31) Includes index. ISBN 0-89603-419-4 (alk. paper) 1. Blood coagulation disorders—Molecular aspects—Laboratory manuals. 2. Blood—Coagulation—Laboratory manuals. 3. Thrombosis—Laboratory manuals. I. Perry, David (David J.). II. Pasi, K. John. III. Series. [DNLM: 1. Blood Coagulation Disorders—genetics. 2. Hemostasis—genetics. 3. Thrombosis—genetics. 4. DNA Mutational Analysis. 5. Sequence Analysis, DNA. WH 322 H4885 1999] RC647.C55H458 1999 616.1'57—dc21 DNLM/DLC for Library of Congress 99-10466 CIP

Preface Laboratory studies in hemostasis have traditionally focused on abnormalities of platelet function or the quantitative and qualitative disorders that affect the proteins involved in blood coagulation. However, over the last 10 years there has been an explosion in our understanding of the molecular bases that underlie many of the inherited and acquired disorders of hemostasis. Many of these disorders are now routinely diagnosed and assessed by methods that involve genotypic analysis. Indeed in the late 1990s the distinction between molecular methods for research and for routine diagnosis is becoming increasingly blurred. The techniques and approaches that are used in hemostasis are manifold and published in isolation in a variety of publications. The aim, therefore, of this volume Hemostasis and Thrombosis Protocols is to pull together, into a single volume, the variety of techniques that are frequently used in the field of hemostasis. We have targeted this volume at laboratories who wish to move into the field of molecular hemostasis or who may already have some experience in this area but wish to develop new areas of research and diagnosis. The chapters are wide-ranging and hopefully provide a broad overview of the differing applications in which these standard techniques can be used. Though the articles may appear relatively specific, the techniques contained within them are applicable to the study of many different disorders and we hope that they provide a series of ideas and concepts well-suited to problem solving. Hemostasis and Thrombosis Protocols is divided into a series of discrete sections than can be consulted according to individual interests. A broad overview of hemostasis is provided and though not intended to be comprehensive provides a framework for the rest of the volume. Part II provides the basic techniques that are frequently referred to in later chapters. Part III provides a series of approaches to mutational analysis, although additional methods are included in some of the chapters that address specific disorders. Parts IV and V cover specific disorders reviewing the major approaches used in their study. Although the majority of this section is DNA- or RNA-based, we have included some basic techniques in protein analysis and cellular expression since these are often referred to in the literature in the context of the study of

v

vi

Preface

a range of hemostatic disorders. These latter chapters are not intended to be comprehensive, since there are other volumes in the Methods in Molecular Medicine series that address these areas. Hemostasis and Thrombosis Protocols does not provide comprehensive coverage of the analyses of all disorders of hemostasis, but the authors have addressed all the common hemostatic and thrombotic problems. Using the techniques described here, the reader should find it possible to analyze any gene. The chapters in Hemostasis and Thrombosis Protocols adhere to a common format, one that has been used throughout this series. Each chapter is presented as a series of recipes that we would hope provide something akin to a laboratory manual. Each chapter also discusses the common problems that one might encounter using these techniques, and their likely solutions. Finally, we would like to thank our colleagues for their contributions to this volume and for their patience during the editing of the final volume. David J. Perry K. John Pasi

Contents Preface ............................................................................................................. v Contributors ..................................................................................................... xi PART I. INTRODUCTION 1 Hemostasis: Components and Processes K. John Pasi .......................................................................................... 3 PART II. BASIC TECHNIQUES 2 Isolation of DNA and RNA David J. Perry ...................................................................................... 3 Amplification of DNA and RNA by PCR David J. Perry ...................................................................................... 4 Direct Sequencing of PCR Products David J. Perry ...................................................................................... 5 Solid-Phase Sequencing of Biotinylated PCR Products with Streptavidin-Coated Magnetic Beads David J. Perry ...................................................................................... 6 Automated DNA Sequencing Helen L. Devereux ............................................................................... 7 Detection of DNA by Silver Staining David J. Perry and Flora Peyvandi ................................................... 8 Promoter Studies in Hemostasis Peter R. Winship and Jonathan R. K. Spray ................................... PART III. METHODS

OF

25 31 39

49 55 63 65

MUTATIONAL ANALYSIS

9 Detection of Mutations and Polymorphisms in Clotting Factors by Denaturing Gradient Gel Electrophoresis Rainer Schwaab and Winfried Schmidt ........................................... 85 10 Screening for Mutations in DNA by Single-Stranded Conformation Polymorphism (SSCP) Analysis David J. Perry .................................................................................... 105

vii

viii

Contents

11 Screening for DNA Heteroduplexes in the Factor VII Gene Using Ethylene Glycol Gel Electrophoresis of Solvent-Treated 32 P-Labeled PCR Products Peter Baker ........................................................................................ 111 12 Detection of Mutations Causing Hemophilia A Using an In Vitro Coupled Transcription and Translation System Chike Ononye .................................................................................... 117 13 Screening for Mutations in the Human Antithrombin Gene by Hydrolink D-5000™ and MDE™ Gel Electrophoresis David J. Perry .................................................................................... 125 PART IV. METHODS OF HEMOSTASIS

FOR

ANALYZING INHERITED/ACQUIRED DISORDERS

14 Detection of Mutations In Hemophilia A Patients by Chemical Cleavage of Mismatch Method Naushin H. Waseem, Richard Bagnall, Peter M. Green, and Francesco Giannelli .............................................................. 133 15 Inversion Mutation Analysis in Hemophilia A by Restriction Enzyme Analysis and Southern Blotting Chike Ononye .................................................................................... 151 16 Hemophilia B Mutational Analysis Peter M. Green .................................................................................. 159 17 Screening for Candidate Mutations Causing von Willebrand’s Disease (vWD) P. Vince Jenkins ............................................................................... 169 18 Use of Intron 40 VNTR I in vWD Gene Tracking Mohammed S. Enayat and G. J. Surdhar ...................................... 179 19 Multimeric Analysis of von Willebrand Factor (vWF) Mohammed S. Enayat ...................................................................... 187 20 Identification of Mutations in the Human Factor VII Gene Peter M. Baker ................................................................................... 201 21 Molecular Analysis in Factor XI Deficiency Karen M. Johnson and John H. McVey .......................................... 211 22 Mutational Analysis in Antithrombin Deficiency David J. Perry .................................................................................... 223 23 Ectopic Transcript Analysis in Human Antithrombin Deficiency David J. Perry .................................................................................... 231

Contents

ix

24 Mutational Analysis of the Human Protein C Gene Roger Luddington ............................................................................. 25 Analysis of the Protein S Gene in Protein S Deficiency Núria Sala and Yolanda Espinosa-Parrilla .................................... 26 Screening for the G to A Transition at Position 20210 in the 3'-Untranslated Region (UTR) of the Prothrombin Gene Karen P. Brown ................................................................................. 27 Screening for the Factor V Leiden Mutation Karen P. Brown .................................................................................

239 249

269 275

28 Multiplex PCR for Detection of the Prothrombin 3' UTR (C20210A) Polymorphism and the Factor V Leiden Mutation Gill Mellars, P. Vince Jenkins, and David J. Perry ....................... 287 29 Isoelectric Focusing and Immunodetection of Plasma Antithrombin Martina Daly ....................................................................................... 291 30 Characterization of Heparin Binding Variants of Antithrombin by Crossed Immunoelectrophoresis in the Presence of Heparin Martina Daly ....................................................................................... 297 31 The Determination of Amino Acid Sequence Abnormalities in Proteins by HPLC Peptide Analysis David Williamson .............................................................................. 303 PART V. PLATELET

AND

MEGAKARYOCYTE ANALYSIS

32 Molecular Biological Identification and Characterization of Inherited Platelet Receptor Disorders Ramesh B. Basani, Mark Richberg, and Mortimer Poncz ........... 313 33 In Vitro Expansion of Megakaryocytes from Peripheral Blood Hematopoietic Progenitors Michael A. Thornton and Mortimer Poncz ..................................... 337 34 Molecular Biology Studies with Primary Megakaryocytes Yaping Shou and Mortimer Poncz .................................................. 347 Index ............................................................................................................ 355

Contributors RICHARD BAGNALL • Paediatric Research Unit, Division of Medical and Molecular Genetics, Prince Philip Research Laboratories, United Medical and Dental Schools of Guy’s and St. Thomas’s Hospitals, Guy’s Hospital,University of London, London, UK PETER M. BAKER • Department of Haematology, Addenbrooke’s NHS Trust, Cambridge, UK RAMESH B. BASANI • Division of Hematology, The Children’s Hospital of Philadelphia, Philadelphia, PA KAREN BROWN • Department of Haematology, Addenbrooke's NHS Trust, Cambridge, UK MARTINA DALY • Department of Medicine and Pharmacology, Section of Molecular Genetics, University of Sheffield, The Royal Hallamshire Hospital, Sheffield, UK HELEN L. DEVEREUX • Department of Retrovirology, Royal Free Hospital School of Medicine, London, UK MOHAMMED SAID ENAYAT • Molecular Haemostasis Laboratory, Department of Haematology, Laboratory Medicine Block, The Birmingham Children’s Hospital NHS Trust, Birmingham, West Midlands, UK YOLANDA ESPINOSA-PARILLA • Institut de Recerca Oncològica (I.R.O.), Department Genètica Molecular, Hospital Duran i Reynals, Autovia de Castelldefels, Hospitalet de Llobregat Barcelona, Spain FRANCESCO GIANNELLI • Paediatric Research Unit, Division of Medical and Molecular Genetics, Prince Philip Research Laboratories, United Medical and Dental Schools of Guy’s and St. Thomas’s Hospitals, Guy’s Hospital,University of London, London, UK PETER M. GREEN • Paediatric Research Unit, Division of Medical and Molecular Genetics, Prince Philip Research Laboratories, United Medical and Dental Schools of Guy’s and St. Thomas’s Hospitals, Guy’s Hospital,University of London, London, UK P. VINCENT JENKINS • Department of Haematology, Haemophilia Centre and Haemostasis Unit, Royal Free Hospital School of Medicine, London, UK

xi

xii

Contributors

KAREN M. JOHNSON • Haemostasis Research Group, MRC Clinical Sciences Centre, Royal Postgraduate Medical School, Hammersmith Hospital, London, UK ROGER LUDDINGTON • Department of Haematology, Addenbrooke’s NHS Trust, Cambridge, UK JOHN MCVEY • Haemostasis Research Group, MRC Clinical Sciences Centre, Royal Postgraduate Medical School, Hammersmith Hospital, London, UK GILL MELLORS • Department of Haematology, Haemophilia Centre and Haemostasis Unit, Royal Free Hospital School of Medicine, London, UK CHIKE ONONYE • Department of Haematology, Haemophilia Centre and Haemostasis Unit, Royal Free Hospital School of Medicine, London, UK K. JOHN PASI • Department of Haematology, Haemophilia Centre and Haemostasis Unit, Royal Free Hospital School of Medicine, London, UK DAVID J. PERRY • Department of Haematology, Haemophilia Centre and Haemostasis Unit, Royal Free Hospital School of Medicine, London, UK FLORA PEYVANDI • Department of Haematology, Haemophilia Centre and Haemostasis Unit, Royal Free Hospital School of Medicine, London, UK MORTIMER PONCZ • Division of Hematology, The Children’s Hospital of Philadelphia, Philadelphia, PA MARK RICHBERG • Division of Hematology, The Children’s Hospital of Philadelphia, Philadelphia, PA NURIA SALA • Institut de Recerca Oncològica (I.R.O.), Department Genètica Molecular, Hospital Duran i Reynals, Autovia de Castelldefels, Hospitalet de Llobregat Barcelona, Spain W. SCHMIDT • Institut für Experimentelle Hämatologie und Transfusions, Medizin der Universität Bonn, Bonn, Germany REINER SCHWAAB • Institut für Experimentelle Hämatologie und Transfusions, Medizin der Universität Bonn, Bonn, Germany YAPING SHOU • Division of Hematology, The Children’s Hospital of Philadelphia, Philadelphia, PA JONATHAN R. K. SPRAY • Department of Medicine and Pharmacology, Section of Molecular Genetics, University of Sheffield, The Royal Hallamshire Hospital, Sheffield, UK G. K. SURDHAR • Molecular Haemostasis Laboratory, Department of Haematology, Laboratory Medicine Block, The Birmingham Children’s Hospital NHS Trust, Birmingham, West Midlands, UK MICHAEL A. THORNTON • Division of Hematology, The Children’s Hospital of

Contributors

xiii

Philadelphia, Philadelphia, PA NAUSHIN H. WASEEM • Paediatric Research Unit, Division of Medical and Molecular Genetics, Prince Philip Research Laboratories, United Medical and Dental Schools of Guy’s and St. Thomas’s Hospitals, Guy’s Hospital,University of London, London, UK DAVID WILLIAMSON • Department of Haematology, University of Cambridge, MRC Centre, Cambridge, UK PETER WINSHIP • Department of Medicine and Pharmacology, Section of Molecular Genetics, University of Sheffield, The Royal Hallamshire Hospital, Sheffield, UK

Hemostasis

I INTRODUCTION

1

Hemostasis

3

1 Hemostasis Components and Processes K. John Pasi 1. Introduction Hemostasis is a host defense mechanism that protects the integrity of the vascular system after tissue injury. It works in conjunction with other inflammatory, immune, and repair mechanisms to produce a coordinated response. Hemostatic systems are generally quiescent, but following tissue injury or damage these systems are rapidly activated. Hemostasis has evolved to accommodate the conflicting needs of maintaining vascular integrity and free flow of blood in the vascular tree. Given the high pressures that exists in arterial circulation, it is clearly important that procoagulant mechanisms exist that can minimize blood loss from a site of vascular damage as rapidly as possible. However, this powerful procoagulant response must be localized to prevent unwanted thrombosis and controlled to prevent thrombosis in the slower low-pressure venous circulation. As a result of these competing needs, hemostasis has evolved as a patchwork of interrelated activating and inhibiting pathways that can either promote or suppress other elements of the overall process. Hemostasis has therefore evolved to integrate five major components: vascular endothelium, platelets, coagulant proteins, anticoagulant proteins, and fibrinolytic proteins. The coordinated hemostatic response ultimately produces a platelet plug, fibrin-based clot, deposition of white cells at the point of injury and activation of inflammatory, and repair processes, maintenance of blood flow, and vascular integrity. 2. Overview of Hemostasis All components of the hemostatic mechanism exist under resting conditions in an inactive form. A diagrammatic representation of the overall hemostatic From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ

3

4

Pasi

response is shown in Fig. 1. Following injury, there is immediate vasoconstriction and reflex constriction of adjacent small arteries. This slows blood flow into the damaged area. The reduced blood flow allows contact activation of platelets. On activation by tissue injury (or other agonists), platelets undergo a series of physical, biochemical, and morphological changes. Platelets adhere to exposed connective tissue, mediated in part by the von Willebrand factor (vWF). Collagen exposure and local thrombin generation (see Subheading 6.) lead to the release of platelet granule contents. Release of platelet granule contents, which include adenosine diphosphate (ADP), serotonin, and fibrinogen, further enhances platelet activation, formation of platelet aggregates, and interaction with other platelets and leukocytes. This process leads to the formation of the initial platelet plug. The vascular endothelium also undergoes a series of changes moving from its resting phase (with predominantly anticoagulant properties) to a more active procoagulant and repair phase. In concert with these cellular changes, inactive plasma coagulation factors are converted to their respective active species by cleavage of one or two internal peptide bonds. In sequence, these active factors generate thrombin, which leads to formation of fibrin from fibrinogen (to stabilize the platelet plug), crosslinking of the fibrin formed (via activation of factor XIII), further activation of platelets, and also activation of fibrinolytic pathways (to enable plasmin to dissolve fibrin strands in the course of wound healing). Additionally, thrombin interacts with other nonhemostatic systems to promote cellular chemotaxis, fibroblast growth, and wound repair. 3. Components of the Hemostatic System

3.1. Vascular Endothelium Vascular endothelium is the monolayer of cells that line the inner surface of blood vessels. Since an uninterrupted vascular tree is necessary for survival, the ability of the vasculature to maintain a nonleaking system is essential. If a vessel is disrupted and leakage occurs, the coagulation system and platelets close the defect temporarily until cellular repair of the defect takes place. If a vessel is occluded by thrombus, blood flow may be re-established by lysing the clot or recanalizing the occluded vessel. These properties are the main functional characteristics of the vascular endothelial cell. Endothelial cells are attached to and rest on the subendothelium, an extracelluar matrix secreted by the endothelial cells. Subendothelium is composed of collagen, elastin, mucopolysaccharides (including heparan sulfate, dermatan sulfate, chrondroitin sulfate), laminin, fibronectin, vWF, vitronectin, thrombospondin, and occasionally fibrin. All these components are synthesized by the endothelial cells. Together, endothelium and subendothelium form a

Hemostasis

5

Fig. 1. A flow diagram representing the major events in the process of overall hemostasis.

selectively impermeable layer, resistant to the passive transfer of fluid and cellular elements of blood, but permeable to gases. Cells may pass through the endothelium at sites of inflammation by a process of adherence and then migration between endothelial cells. Subendothelium can act as a physical barrier in the absence of endothelial cells. Endothelial cells have multiple functions as outlined below (1).

3.1.1. Maintenance of Blood Flow Endothelial cells influence vascular tone, blood pressure, and blood flow by induction of vasoconstriction and vasodilatation. This is achieved by secretion of renin, endothelin, endothelial-derived relaxing factor (EDRF) or nitrous oxide, adenosine, prostacyclin, and surface enzymes that convert or inactivate other vasoactive peptides, such as angiotensin and bradykinin.

3.1.2. Antiplatelet and Anticoagulant Properties Intact endothelial cells are intrinsically nonthrombogenic, exerting a powerful inhibitory influence on hemostasis by a range of factors that they either

6

Pasi

synthesize or express on their surface. For example, platelets adhere to subendothelium rather than endothelial cells. This is due to endothelial production of components that inhibit platelet aggregation, such as prostacylin, EDRF, and adenosine. Cell-surface heparan sulfate enhances the effect of antithrombin in forming thrombin–antithrombin complexes. Perhaps the major anticoagulant properties of endothelium are via the endothelial expression of thrombomodulin and tissue factor pathway inhibitor (TFPI). Thrombomodulin enhances the ability of thrombin to activate protein C. Enhancement of protein C activation leads to increased inactivation of factor Va and factor VIIIa. Endothelium also secretes protease nexin 1. This inactivates thrombin by covalent binding to the thrombin active site. This complex formation is enhanced by heparan sulfate.

3.1.3. Coagulant Properties In contrast to the above, in the setting of damage to blood vessels, the endothelium functions as an important component to coagulation pathways. Central to this role is endothelial cells production of tissue factor in response to injury. In addition, they bind factors IX, X, V, high-mol-wt kininogen (HMWK), contain factor XIII activity, and produce endothelin to induce vasoconstriction. Importantly, endothelial cells also produce the natural inhibitor of tissue factor mediated coagulation, TFPI.

3.1.4. Fibrinolytic Properties Endothelial cells secrete several components active in fibrinolysis. These include plasminogen activators and plasminogen activator inhibitor. These components are bound to the endothelial cell surface to enable assembly of active complexes.

3.1.5. Repair Properties Endothelial cells are capable of significant repair of blood vessels. Simple minor injuries are repaired by migration of adjacent cells and subsequent endothelial cell proliferation. More severe vessel wall injuries require migration and proliferation of smooth muscle cells and fibroblasts. Endothelium secretes components that are active in the repair process by enhancing smooth muscle migration and fibroblast function. These include a protein resembling platelet-derived growth factor, vascular permeability factor, and fibroblast growth factor. Endothelial cells are also responsive to platelet-derived endothelial growth factor and transforming growth factor β.

3.1.6. Interactive Properties The endothelium interacts with leukocytes. This is critical in the migration of leukocytes into area of inflammation. Adhesion molecules present on both endothelial cells and leukocytes mediate this interaction.

Hemostasis

7

4. Platelets Platelets are nonnucleated fragments of cytoplasm that have a crucial role in primary hemostasis. They are derived from bone marrow megakaryocytes and are smooth biconvex disks of approx 1–4 mm diameter. Normal circulating numbers are approx 140–400 × 109/L.

4.1. Production In the production of platelets, megakaryocytes undergo specialized cellular division. The megakaryocyte nucleus divides, but the cell itself does not divide (endomitosis) (2), although there is formation of new membrane and cytoplasmic maturation. This cytoplasmic maturation includes development of platelet-specific granules, membrane glycoproteins, and lysosomes. Mature megakaryocytes are therefore variably polyploid, with up to 64 N. They are large at approx 60 μm diameter. As a part of the endomitosis process, there is increased membrane. This excess membrane is accommodated by invagination. The invagination process continues, thereby clipping off individual platelets (cytoplasmic fragmentation) from the main megakaryocyte body. It is suggested that circulating megakaryocytes undergo cytoplasmic fragmentation in the pulmonary capillary bed. Megakaryocyte maturation is controlled in a simple negative feedback loop, under the influence of the growth factor thrombopoietin and cytokines, such as interleukin-3 (IL-3) and interleukin-11 (IL-11). When platelet production is increased, megakaryocytes undergo a more rapid cytoplasmic maturation than nuclear maturation. Under such circumstances, platelets may be produced from octaploid or even tetraploid cell megakaryocytes. Such platelets are often larger than normal and more metabolically active. Once released from the bone marrow, platelets are sequestered in the spleen for 24–48 h. The spleen may contain upto 30% of the normal circulating mass of platelets. Significant platelet pools may also exist in the lungs. The normal life-span of platelets is approx 8–14 d. Platelets are removed from the circulation by the reticuloendothelial system on the basis of senescence rather than by random utilization. However, there is a small fixed component that exists owing to random utilization of platelets that maintain vascular integrity.

4.2. Structure Stylized structural features are shown diagrammatically in Fig. 2. A range of glycoproteins molecules partially or completely penetrate cell-membrane lipid bilayer. These glycoprotein molecules function as receptors for different agonists, adhesive proteins, coagulation factors, and for other platelets. Important membrane glycoproteins are listed in Table 1 with their associated functions.

8

Pasi

Fig. 2. Stylized structural features of the platelet. See text for decription of individual components. Table 1 Important Platelet Membrane Glycoproteins Glycoprotein Ia IIa Ic Ib/IX IIb/IIIa IV V

103 copies/platelet

Receptors

2–4 5–10 3–6 25–30 40–50

Collagen Fibronectin, laminin Fibronectin, laminin vWF, thrombin Fibrinogen, vWF, Fibronectin, vitronectin Collagen, thrombospondin Thrombin

The most abundant glycoproteins on the platelet surface are glycoproteins IIb and IIIa. These two glycoproteins form a heterodimer and carry receptors for adhesive proteins (fibrinogen, vWF, fibronectin). The IIb-IIIa complex is a member of the integrin family of adhesion receptors. Glycoprotein Ib contains a receptor for vWF and thrombin. This receptor is essential in the platelet vessel wall interaction. The cell membrane also has importance as a source of phospholipid (prostaglandin synthesis), site of calcium mobilization, and localization of coagulant activity to the platelet surface.

Hemostasis

9

Platelet structure is complex (3). Below the plasma membrane lies a peripheral band of microtubules, which function as the cellular cytoskeleton. The microtubules maintain the discoid shape in the resting platelet, but disappear temporally (disassemble?) on platelet aggregation. The surface-connected canalicular system is an extensive system of plasma membrane invaginations. This system vastly increases the surface area across which membrane transport occurs and through which platelet granules discharge their contents during the secretory phase of platelet aggregation. The dense tubular system probably represents the smooth endoplasmic reticulum. It is thought to be the site of prostaglandin synthesis and sequestration/release of calcium ions. Platelets contain many organelles (mitochondria, glycogen granules, lysosomes, peroximsomes) and two types of platelet-specific storage granules: dense bodies (d-granules) or a-granules. The contents of the platelet-specific granules are released when platelets aggregate. Dense bodies contain 60% of the platelet storage pool of adenine nucleotides (such as adenosine diphosphate) and serotonin. Dense body adenine nucleotides do not readily exchange with other adenine nucleotides in the platelet metabolic pool. α-Granules contain multiple different proteins. These proteins may be platelet specific or proteins that are found in the plasma or other cell types (such as coagulation factors). The major contents of α-granules are vWF, platelet factor 4, β-thromboglobulin, thrombospondin, factor V, fibrinogen, fibronectin, platelet derived growth factor, high-mol-wt kininogen, and tissue plasminogen activator inhibitor-1.

4.3. Function Platelets are crucial components of the hemostatic system. When a vessel wall is damaged, platelets escaping from the circulation immediately come into contact with and adhere to collagen and subendothelial bound vWF (through glycoprotein Ib). Glycoprotein IIb-IIIa is then exposed, via the binding of vWF. This forms a second binding site for vWF. In addition with glycoprotein IIb– IIIa exposure, fibrinogen may be bound promoting platelet aggregation. Within seconds of adhesion to the vessel wall, platelets undergo a shape change, owing to ADP released from the damaged cells or other platelets exposed to the subendothelium. Platelets become more spherical and put out pseudopods, which enable platelet–platelet interaction. The peripheral microtubules become centrally apposed forcing the granules toward the surface and the surface-connected canalicular system. Platelets then undergo a specific release reaction of their granules, the intensity of the release reaction being dependent on the intensity of the stimulus. With the shape change, there is also further exposure of the glycoprotein IIb–IIIa complex and further fibrinogen binding. Since fi-

10

Pasi

brinogen is a dimer, it can form a direct bridge between platelets or act as a substrate for the lectin-like protein thrombospondin. With the enhancement of platelet–platelet interaction, platelet aggregation ensues. Platelet aggregation causes activation, secretion, and release from other platelets, so leading to a self-sustaining cycle that results in the formation of a platelet plug. The binding of agonists to also leads to a series of signal transduction events that mediate the platelet release reaction (see Fig. 3) (4). Agonist receptor interaction activates guanine nucleotide binding proteins (G-protein) and hydrolysis of plasma membrane phospholipids (phosphotidyl inositides) by phospholipase C (PLC). Inositol triphosphates that are formed act as ionophores, and mobilize calcium ions into the cytosol from the dense tubular system, and lead to an influx of calcium from outside. Diacylglycerol, also formed within the G-protein/PLC pathway, activates protein kinase C, which in turn phosphorylates a 47-kDa contractile protein. Together with the calciumdependent phosphorylation of myosin light chain, these reactions induce contraction and secretion of granule contents. Cyclic AMP/adenyl cyclase exert regulatory control over these reactions (high levels of cAMP reduce cytosol calcium concentration) and are in turn regulated by G-protein activity. In addition, prostaglandin (cyclic endoperoxides and thromboxane A2) synthesized from membrane phospholipids may bind to specific receptors and further stimulate these processes. Platelet α-granules contain several coagulation factors (such as factor V, fibrinogen, and high-mol-wt kininogen). On secretion from the α-granule, these factors reach high local concentrations. Platelets provide a local phospholipid surface for these factors to work on, particularly factor V. This procoagulant activity of platelets is not seen in resting platelets.

4.4. Antigens Platelets have a number of antigens on their surface specific to platelets. Many of the platelet-specific antigens are associated with platelet membrane glycoproteins (HPA IA—glycoprotein IIIa). Platelets also express HLA class I antigens and ABO blood group antigens. 5. Coagulation Factors 5.1. Thrombin Thrombin is the cornerstone of hemostasis. Prothrombin, its precursor, is a vitamin K dependent plasma of mol wt 71 kDa (579 amino acids). Thrombin is crucial to the conversion of fibrinogen to fibrin. It is the most potent physiological activator of platelets causing shape change, the generation of thromboxane A2, ADP release, and ultimately platelet aggregation. Thrombin also activates the cofactors of coagulation factor V, factor VIII, and factor XIII.

Hemostasis

11

Fig. 3. Signal transduction events that mediate the platelet-release reaction. The intermediate processes lead to the phosphorylation of 47kD protein and myosin light chain, which together contract and lead to secretion of platelet granule contents.

Thrombin bound to thrombomodulin is a potent activator of protein C. In addition to its procoagulant and anticoagulant activities, thrombin also has important roles in cellular growth, cellular activation, and the regulation of cellular migration.

5.2. Tissue Factor This is an integral transmembrane protein of mol wt 45 kDa (263 amino acids) coded for by a short gene of 12.4 kb on chromosome 1. It is found on the surface of vascular cells, but is also constitutively expressed by many nonvascular tissues. It can be upregulated on monocytes and vascular endothelium by inflammatory cytokines or endotoxin. Tissue factor (thromboplastin) binds and promotes activation of factor VII, and is required for the initiation of blood coagulation. It acts as a cofactor enhancing the proteolytic activity of factor VIIa toward factor IX and factor X. It binds factor VII via calcium ions.

5.3. Factor V This is a plasma glycoprotein of mol wt 330 kDa (2224 amino acids) coded for by a complex 25 exon 80-kb gene on chromosome 1. It is a critical cofactor

12

Pasi

in coagulation, which in its activated form facilities the conversion of prothrombin to thrombin. In Factor V, the rate of conversion of prothrombin to thrombin is 200,000- to 300,000-fold. Factor V circulates as a single-chain protein in a precursor inactive form. It is converted into an active two-chain form by thrombin or factor Xa. Thrombin cleaves factor V at three separate sites. Following cleavage, the two chains are linked via a divalent metal ion bridge. Binding to phospholipid surfaces occurs via the light chain. Factor V is inactivated by activated protein C and its cofactor protein S. Although it is predominantly synthesized in the liver (plasma factor V), megakaryocytes also synthesize factor V, which is stored in platelet α-granules (platelet factor V). Platelet factor V, which is released on platelet activation, accounts for approx 20% of total factor V. Factor V has a binding protein in platelets (multimerin), which is analogous to vWF for factor VIII. Plasma concentration of factor V is about 7–10 μg/mL with a half-life of approx 12 h.

5.4. Factor VII This is a vitamin K dependent plasma glycoprotein and serine protease of mol wt 50 kDa (406 amino acids) coded for by a 13-kb gene on chromosome 13. It has 10 N-terminal glutamic acid residues that are terminal γ carboxylated to form the Gla domain. Calcium binding properties of factor VII are crucial to its normal function and biological activity. Factor VII is involved in the initiation of blood coagulation, forming a complex with tissue factor to generate an enzyme complex that activates factor X and factor IX. Factor VII is activated by cleavage of the Arg153–Ile153 peptide bond. Activators include thrombin, activated factor X, and activated factor IX. Activated factor VII has no catalytic activity until bound to tissue factor. It circulates at a concentration of 0.5 μg/mL and half-life of 4–6 h.

5.5. Factor VIII This is a plasma glycoprotein of approx mol wt 360 kDa (2351 amino acids) coded for by a complex 26 exon 186-kb gene on the X chromosome. It has a domain structure that is very similar to that of factor V and is related to the copper protein ceruloplamsin. However, unlike factor V, the large B domain is not required for coagulant activity. Factor VIII is one of the largest and least stable coagulation factors with a complex polypeptide composition, circulating in plasma in a noncovalent complex with vWF. vWF functions to protect factor VIII from premature proteolytic degradation and concentrate factor VIII at sites of vascular injury. Factor VIII functions as a cofactor for factor IX, facilitating the conversion of factor X to factor Xa. Factor VIII increases the rate of conversion of factor X to Xa by factor IX by 200,000-fold.

Hemostasis

13

Liver synthesized single-chain molecule factor VIII is cleaved shortly after synthesis, circulates as a heterodimer, and comprises an 80-kDa light chain linked through a divalent metal cation bridge to a heavy chain (90–200 kDa). Variable amounts of the B domain remain after this initial cleavage. On activation by thrombin (or factor Xa), factor VIII is cleaved at Arg372, Arg740, and Arg1689, the Arg740 cleavage removing residual B domain remnants. This cleavage yields a 90-kDa heavy chain. A rate-limiting Arg372 cleavage yields two smaller 50 and 40 kDa fragments, both of which are essential for factor VIII clotting activity. At the same time, a small fragment is cleaved that removes vWF from factor VIII. Activated factor VIII is very unstable and rapidly loses cofactor function, owing to subunit disassociation. Inactivation of factor VIII also occurs via activated protein C and its cofactor protein S, by cleavage at Arg336 and Arg562. Plasma concentration of factor VIII is about 100–200 ng/mL and half-life of approx 12 h.

5.6. Factor X This is a vitamin K-dependent plasma glycoprotein and serine protease of mol wt 59,000 coded for by a 22-kb gene on chromosome 13. It has 11 N-terminal glutamic acid residues that are terminal γ carboxylated to form the Gla domain. Calcium binding properties of factor X are crucial to its normal function and biological activity. It is a central component in the common pathway of blood coagulation. Factor X is synthesized as a single chain, but exists in plasma as a heavy and light chain linked by a single disulfide bond. It is activated by cleavage of the Arg51–Ile52 peptide bond. Activators include activated factor VII/tissue factor complex and activated factor IX/factor VIII complex in the presence of calcium ions. Factor Xa, in conjunction forms a complex on phospholipid surfaces with factor V to form the prothrombinase complex. This complex converts prothrombin to thrombin. Factor X is inhibited by antithrombin and α2macroglobulin. Factor X circulates at a concentration of 8–10 μg/mL and has a half-life of approx 36 h.

5.7. Factor IX This is a vitamin K-dependent plasma glycoprotein and serine protease of mol wt 57,000 (415 amino acids) coded by a 34-kb gene on the long arm of the X chromosome. It is the largest of the family of vitamin K dependent proteins. Twelve N-terminal glutamic acid residues are terminal γ carboxylated to form the Gla domain. Calcium binding properties of factor IX are crucial to its normal function and biological activity.

14

Pasi

Factor IX circulates as a single-chain polypeptide. Activation occurs via cleavage of two peptide bonds, Arg145–Ala146 and Arg180–Val181, by either activated factor XI or activated factor VII, complexed to tissue factor. Arg180–Val181 cleavage is rate-limiting. Cleavage into factor IXa generates a heavy and light chain bound together via a single disulfide bond. A 24 amino acid activation peptide is removed during cleavage. Together with factor VIII, factor IXa can then proceed to activate factor X. In addition, factor IXa may also activate factor VII. The plasma factor IX concentration is about 5 μg/mL with a half-life of approx 24 h.

5.8. Factor XI This is plasma glycoprotein and serine protease of mol wt 160 kDa coded by a 23-kb gene on chromosome 4. Factor XI is a homodimer, comprising two identical subunits bound together by disulfide bond, that circulates bound to high-mol-wt kininogen. The plasma factor XI concentration is about 5 μg/mL with a half-life of approx 72 h. Factor XI is cleaved to active factor XIa by activated factor XII in the presence of high-mol-wt kininogen. Activation cleavage occurs within each subunit at Arg369–Ile370 in a region bounded by a disulfide linkage, so yielding two heavy chains and two light chains in the active molecule. Only the light chains possess catalytic activity. Factor XIa activates factor IX in the presence of calcium. No specific additional cofactors are required for this reaction. Both factor XI and factor XIa bind to platelets.

5.9. Factor XII This is a plasma glycoprotein and serine protease of mol wt 80 kDa (596 amino acids) coded for by a 12-kb gene located on chromosome 5. Factor XII has a half-life of approx 2 d and a plasma concentration of approx 30 μg/mL. In the process of contact activation factor XII is absorbed on to negatively charged surfaces and undergoes limited proteolysis at specific sites to yield active factor XII'. This slowly converts prekallikrein to kallikrein, which specifically cleaves factor XII to yield fully active factor XIIa. In addition, factor XIIa can autoactivate factor XII. Factor XIIa can activate factor XI to promote downstream activation of the coagulation cascade.

5.10. Factor XIII This is a tetramer of two a and b chains. The b chains function as the carrier for the a chains. On activation by thrombin, factor XIII crosslinks fibrin and other proteins involved in the clot via a transglutamase reaction. The factor XIIIa subunit has a plasma concentration of 15 μg/mL and the b subunit a concentration of 14 μg/mL.

Hemostasis

15

5.11. von Willebrand Factor (vWF) This is a multimeric glycoprotein of basic subunit of 400 kDa mol wt (2813 amino acids) coded for by a large complex gene of 178-kb on the short arm of chromosome 12. vWF is an important component in primary platelet hemostasis. Following translation, it undergoes extensive intracellular processing and exists as a series of multimers of the basic subunit, ranging from mol wt 800 to 20,000 kDa. It is produced in both endothelium and megakaryocytes. Endothelial cells secrete a vWF into the plasma constitutively, but store the majority of vWF synthesized (in Wieble Palade bodies) for regulated secretion. Platelet vWF is released from α-granules locally when they aggregate. vWF functions: as a carrier protein for coagulation factor VIII and as an adhesive protein involved in endothelial-platelet interaction, via platelet surface membrane glycoprotein Ib and IIb–IIIa complex. Its function as an adhesive protein is particularly important in situations of high shear stress. 6. Coagulation Cascade The classic “waterfall” hypothesis for coagulation proposes the intrinsic and extrinsic pathways (see Fig. 4) (5,6). The intrinsic system assumes that exposure of contact factors (factor XII, high-mol-wt kininogens, prekallikrein) to an abnormal/injured vascular surface leads to activation of factor XI, which in turn activates factor IX. Activated factor IX, in the presence of its cofactor factor VIII, then activates factor X to factor Xa in the presence of phospholipid. In turn, factor Xa, with its cofactor factor V, together form the prothrombinase complex, which converts prothrombin to thrombin. Thrombin then converts fibrinogen to fibrin. The extrinsic system assumes that factor VII and tissue factor, released from damaged vessels, directly activate factor X, and coagulation factor lying below factor X in the final common pathway. The division into extrinsic and intrinsic systems and the ability to test these two systems in the laboratory (the prothrombin time and activated partial thromboplastin time, respectively) have been valuable in understanding clinical bleeding problems, but fail to represent accurately what happens in in vivo hemostasis. This may be shown by considering the following points. First, patients who have an inherited deficiency of factor XII, prekallikrein or highmol-wt kininogen have no clinical bleeding problems, yet have extremely prolonged activated partial thromboplastin times. This clinical observation demonstrates that these proteins are probably not important components of blood coagulation in vivo and, therefore, should not be included in an in vivo consideration of blood coagulation. Similarly, factor XI deficiency is not always associated with bleeding and its role is therefore unclear, whereas patients with factor VII deficiency bleed abnormally, although they have an intact intrinsic system. Third, factor VII–tissue factor is known to activate not

16

Pasi

Fig. 4. Classic “waterfall” hypothesis for coagulation with the intrinsic, extrinsic, and final common pathways. Although useful in understanding coagulation pathways in in vitro clotting assays this schema does not accurately represent in vivo coagulation processes.

only factor X, but also factor IX. In the classic waterfall, this activation is not required. Fourth, tissue factor is a natural constituent of many nonvascular cells. Tissue factor on such cells is able to initiate blood coagulation. These points suggest a more central role for the tissue factor–factor VII complex. Additionally, the identification of an endogenous inhibitor of tissue factor-induced coagulation (tissue factor pathway inhibitor; TFRI) and an increased understanding of its properties have led to a questioning of traditional dogmas (7). The revised cascade is outlined in Fig. 5. This revised cascade is believed to represent more accurately the processes that occur in vivo (7–9). Coagulation is initiated when tissue damage at the site of the wound exposes blood to tissue factor, produced constitutively by cells beneath the endothelium. Factor VII binds tissue factor forming the tissue factor–factor VII complex. This complex directly activates factor X to factor Xa and some factor IX to factor IXa. It is not clear what proteases initially activate factor VII in this complex, but once coagulation is activated, other proteins are able in turn to activate factor VII, including factor Xa and VIIa. This provides a mechanism for further amplification and acceleration of coagulation.

Hemostasis

17

Fig. 5. The revised coagulation pathway. See text for details. Note the central role of TFPI and absence of contact factors.

Once formed, the complex of the factor VIIa, tissue factor, and factor Xa binds TFPI forming a quaternary complex. This TFPI binding inhibits further generation of factor Xa and factor IXa by tissue factor–factor VIIa complex. Under these conditions, further factor Xa can only be generated by the factor IXa, factor VIIIa pathway. By this point in coagulation activation, enough thrombin usually exists to be able to activate factor VIII to factor VIIIa (generated by direct activation of factor Xa by factor VII–tissue factor). With activation of factor VIIIa and using the initial generation of factor IXa (by tissue factor–factor VIIa), the factor IXa, factor VIIIa route is able to move forward and allow further factor Xa generation to proceed. Further augmentation of factor IX activation is produced via thrombin activation of the factor XI pathway. This is proposed to be a process that occurs later in coagulation. The revised cascade assumes that tissue factor–factor VIIa is responsible for the initial generation of factor Xa and thrombin, sufficient to activate factor V, factor VIII, and platelet aggregation locally. Following inhibition by TFPI, the

18

Pasi

amount of factor Xa produced is insufficient to maintain coagulation, and therefore, factor Xa generation must be amplified using factor IXa and factor VIIIa to allow hemostasis to progress to completion. Unlike the waterfall hypothesis, the revised hypothesis does not assume that initial generation of factor Xa and thrombin is the end of the hemostatic process. Rather it assumes that following initial generation the hemostatic response must be reinforced and/or consolidated by a further progressive generation of factor Xa and thrombin. This allows the hypothesis to encompass the competing influences of inhibitors of coagulation, blood flow washing away activated coagulation factors, and also thrombin-activated fibrinolysis. Additionally, it does not all factor known to be involved in blood coagulation. The revised hypothesis also allows a better explanation of bleeding seen in hemophilia A and hemophilia B. In these two conditions, bleeding occurs both spontaneously (intrinsic system) and after trauma (extrinsic system), which cannot easily be reconciled on the classical waterfall hypothesis. Using the revised schema, it is clear that without factor VIII or factor IX, bleeding will ensue because the amplification and consolidating generation of factor Xa is insufficient to sustain hemostasis. 7. Anticoagulant Pathways Natural, physiological anticoagulants fall into two broad categories, serine protease inhibitors (SERPINS) and those that neutralize specific activated coagulation factors (protein C system). These systems are of major physiological significance. They are active from the very outset of the coagulation process and often brought fully into play before fibrin deposition has occurred.

7.1. Serine Protease Inhibitors (SERPINS) Serpins include many of the key inhibitors of coagulation, such as antithrombin, heparin cofactor II, protein C inhibitor, plasminogen inactivators, and α2antiplasmin. Of these, antithrombin is perhaps the most important (10). AT is a single-chain glycoprotein of mol wt 58,000 (432 amino acids) coded for on chromosome 1. It will inhibit all the coagulation serine proteases (II, VII, IX, X, XI, XII), but it is its antithrombin and anti-Xa activity that are physiologically important. AT activity/inhibition is increased 5- to 10,000-fold in the presence of heparin and other sulfated glycosaminoglycans. Heparin is not normally found in the circulation, and physiologically, antithrombin probably binds to heparan sulfate on the vascular endothelial cells.

7.2. Protein C System Factors Va and VIIIa are powerful cofactors in coagulation-enhancing activity of serine proteases. Both Va and VIIIa are specifically inactivated by

Hemostasis

19

components of the protein C pathway. Protein C is the key inactivating enzyme (11). It is a single-chain vitamin K-dependent protein synthesized by the liver. Together with its cofactor, protein S it inactivates factors Va and VIIIa. Thrombin generated during coagulation binds to thrombomodulin (Tm) on the surface of vascular endothelial cells. Thrombin/Tm complex is a potent activator of Protein C, Tm accelerating Protein C activation approx 20,000fold. Protein C is activated by cleavage at Arg169–Leu170. Activated protein C (APC) is inhibited by the specific inhibitor, protein C Inhibitor (PCI) and since it is a serine protease, it is inhibited by antithrombin. Protein S, the cofactor for protein C, is vitamin K-dependent. It circulates in plasma as a single-chain glycoprotein of mol wt 60,000 and is synthesized by the liver, endothelial cells, and megakaryocytes. Approximately 60% of protein S is complexed to C4b binding protein, Only the unbound or “free” protein S is physiologically active. 8. Fibrinolysis Fibrinolysis principally exists to ensure that fibrin deposition in excess of that which is required to prevent blood loss from damaged vessels is either prevented or degraded and removed (12). Plasminogen, the inactive form of the enzyme plasmin, has a mol wt of 92 kDa (790 amino acids), and is synthesized in the liver and coded on chromosome 6. Plasminogen contains five homologous looped structures called “kringles,” four of which contain lysine binding sites through which the molecule interacts with its substrates and its inhibitors. Internal autocatalytic cleavage occurs during activation of plasminogen with the release of an activation peptide. This changes the N-terminus from containing a glutamic acid residue (Glu-plasminogen) to a form that contains a lysine residue (Lys-plasminogen). Conversion of plasminogen to plasmin can occur via two routes. Most activators cleave plasminogen at Arg560 to generate a two-chain protein Glu-plasmin, the two chains linked by a single disulfide bridge. The light chain is derived from the C-terminus of the protein and contains the active serine catalytic site, whereas the heavy chain is derived from the N-terminus and contains the kringle domains. Glu-plasmin is functionally inactive, since its lysine binding sites are masked. It is activated when it is converted to Lys-plasmin by autocatalytic cleavage between Lys76–Lys77. This cleavage exposes the lysine binding sites on the kringle domains, dramatically increasing the affinity of the protease for fibrin. Both Glu-plasmin and Lys-plasmin attack the Lys76-Lys77 bond to form Lys-plasminogen. This is capable of binding to the fibrin clot before it develops protease activity, and it is, therefore brought into close proximity with the physiological activators. Plasminogen is activated by a number of endogenous proteins. Of these, tissue plasminogen activator (t-PA) is perhaps the most important. t-PA is synthe-

20

Pasi

sized primarily by vascular endothelial cells although many other cells, are capable of its synthesis. t-PA is synthesized as a single-chain glycoprotein (sctPA) and contains two kringle domains through which it binds fibrin. Although sct-PA has significant proteolytic activity, its biological activity is low until bound to fibrin. When bound, its affinity for plasminogen is increased approx 400-fold. Plasmin generated is capable of cleaving sct-PA into a two-chain tPA. Two-chain t-PA has more exposed binding sites and a significantly increased activity through increased binding of fibrin and plasminogen. t-PA has a short half-life (5 min) and is rapidly cleared from the circulation. sct-PA and tct-PA are inhibited by the SERPIN plasminogen activator inhibitor type 1 (PAI-1). A second inhibitor of t-PA, plasminogen activator inhibitor type 2 (PAI-2) is found in plasma in significant amounts during pregnancy. Normally free t-PA is rapidly inactivated because of an excess of PAI1 and any free plasmin generated is rapidly inactivated by α2-antiplasmin. A second endogenous activator of fibrinolysis is urokinase. Urokinase is synthesized as an essentially inactive single-chain protein (scu-PA/pro-urokinase). It must be converted to the two-chain form (tcu-PA or U-PA) before it is functionally active. scu-PA is converted to tcu-PA (U-PA) by plasmin and kallikrein. tcu-PA activates plasminogen to plasmin by a cleaving at Arg560– Val561. Inhibition of the active enzyme occurs via PAI-1, PAI-2, and also by protease nexin 1. Although urokinase can activate plasminogen in plasma it is thought that its major role is an extravascular activator of plasminogen, especially where tissue destruction or cell migration occurs. 9. Summary Hemostasis is clearly a complex interactive system involving numerous components. The revised hypothesis of coagulation has helped to unify the whole process. The recent improved understanding has in part been brought about by improved knowledge of the individual components of the different elements of the overall process of hemostasis and cellular repair. Although increasing by appreciated to be complex, attempts have been made to model and reproduce this system in vitro to validate research findings and increase understanding of the interactions. For all its complexity, many of these models of hemostasis, both laboratory and mathematical, have proven to be useful, and show that for all the interactions and complexity of different systems combined with flow and cellular interaction, we do have a considerable understanding of the processes of hemostasis. Suggested Reading Bloom, A. L., Forbes, C. D., Thomas, D. P., and Tuddenham, E. G. D. (1994) Haemostasis and Thrombosis, 3rd ed. Churchill Livingstone, Edinburgh, UK. Tuddenham, E. G. D. and Cooper, D. N. The Molecular Genetics of Haemostasis and its Inherited Disorders. Oxford Medical Publications, Oxford, UK.

Hemostasis

21

References 1. Cines, D. B., Pollak, E. S., Buck, C. A., Loscalzo, J., Zimmerman, G. A., McEver, R. P., Pober, J. S., Wick, T. M., Konkle, B. A., Schwartz, B. S., Barnathan, E. S., McCrae, E. R., Hug, B. A., Schmidt, A. S., and Stern, D. M. (1998) Endothelial cells in physiology and in the pathophysiology of vascular disorders. Blood 91, 3527–3561. 2. Gerwitz, A. (1995) Megakaryocytopoiesis: the state of the art. Thomb. Haemostasis 74, 204–209. 3. White, J. G. (1994) Anatomy and structural organisation of the platelet, in Hemostasis and Thrombosis: Basic Principles and Clinical Practice (Coleman, R. W., et al., eds.), 3rd ed., J. B. Lippencott Co., Philadelphia, PA. 4. Levy-Toledano, S., Gallet, C., Nadel, F., Bryckaert, M., Macloug, J., and Rosa, J.-P. (1997) Phosphorylation and dephosporylation mechanisms in platelet function: a tightly regulated balance. Thromb. Haemostasis 78, 226–233. 5. Macfarlane, R. G. (1964) An enzyme cascade in the blood clotting mechanism and its function as a biochemical amplifier. Nature 202, 498,499. 6. Davie, E. W. and Ratnoff, O. D. (1964) Waterfall sequence for intrinsic blood clotting. Science 145, 1310–1312. 7. Broze, G. J. Jr., Warren, L. A., Novotny, W. F., Higuchi, D. A., Girrad, J. J., and Miletich, J. P. (1988) The lipoprotein associated coagulation inhibitor that inhibits the factor VII-tissue factor complex also inhibits factor Xa: insight into its possible mechanism of action. Blood 71, 335–343. 8. Furie, B. and Furie, B. C. (1992) Molecular and cellular biology of blood coagualtion. N. Engl. J. Med. 326, 800–806. 9. Rapaport, S. I. and Rao, L. V. (1995) The tissue factor pathway: how it has bevome a “prima ballerina.” Thromb. Haemostasis 74, 7–17. 10. Perry, D. J. (1994) Antithrombin and its inherited deficiencies. Blood Rev. 8, 35–37. 11. Dadhlback, B. (1995) New molecular insights into the genetivcs of thrombophilia: resistance to activated Protein C caused by the Arg506 to Gln mutation in factor V as a pathogenic risk factor for venous thrombosis. Thromb. Haemostasis 74, 139–148. 12. Collen, D. and Lijen, H. R. (1991) Basic and clinical aspects of fibrinolysis and thrombolysis. Blood 78, 3114–3124.

Isolation of DNA and RNA

II BASIC TECHNIQUES

23

Isolation of DNA and RNA

25

2 Isolation of DNA and RNA David J. Perry 1. Introduction Blood samples for most coagulation tests are collected into 3.8% trisodium citrate in a ratio of 1 part anticoagulant to 9 parts blood. Whole-blood samples for DNA isolation can be stored at –50°C and the DNA prepared at a later stage. A more convenient method requiring less freezer space is to store buffy coats—the interface between the red cells and the plasma that is seen following centrifugation of whole blood. This latter method also allows isolation of the plasma fraction. There are numerous methods for isolating DNA. The methods described in this Chapter are routinely used to prepare high molecular weight DNA for Southern blot analysis or for amplification by the polymerase chain reaction (PCR) technique. The first method employs a phenol/chloroform step to denature proteins, whereas the second employs a salt precipitation step to precipitate proteins. Both methods can be readily adapted to processing small-volume samples (e.g., 100 μL). The first method has been successfully used to isolate DNA from a wide variety of cells, including whole blood, buffy coats, platelets, various cell lines, spleen, lymph nodes, and bone marrow. As with the isolation of DNA, there are many techniques for isolating RNA from a wide variety of cells, some of which can be adapted to allow the simultaneous isolation of both RNA and DNA. Many of the methods in current use employ strong chaotropic agents (e.g., guanidinium thiocyanate) to disrupt cellular membranes and inactivate intracellular RNases. The method described has been in routine use for several years and generates high-quality RNA suitable for a wide variety of uses. A number of commercial kits are now available for rapid RNA isolation, e.g, RNeasy™ kit (Qiagen Ltd, UK). Although often more expensive than “in-house” methods, these kits are capable of isolating highFrom: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ

25

26

Perry

quality RNA from a wide variety of cells, including whole-blood, leukocyte buffy coats, platelets, and tissue-culture cells. Methods are also included in this chapter for the isolation of lymphocytes and platelets from whole blood. 2. Materials Molecular-grade reagents should be used whenever possible. Sterile disposable polypropylene is used for most steps, but if glassware is used, it should be baked at 280°C for at least 3 h to inactivate any RNases.

2.1. Isolation of Mononuclear Cells from Whole Blood 1. Phosphate-buffered saline: 120 mM NaCl, 2.7 mM KCl, 10 mM phosphate buffer, pH 7.4. Autoclave before use and store at 4°C. 2. Density gradient medium, e.g., Histopaque 1077 (Sigma).

2.2. Isolation of Platelets from Whole Blood 1. Phosphate-buffered saline: 120 mM NaCl, 2.7 mM KCl, 10 mM phosphate buffer, pH 7.4. Autoclave before use and store at 4°C. 2. 38–40% Bovine serum albumin (BSA).

2.3. DNA Isolation Using the Phenol/Chloroform Method (1) 1. Sucrose lysis buffer: sucrose 0.32 M, 1% (v/v) Triton X-100, 5 mM MgCl2, 10 mM Tris-HCl, pH 7.5. Store at 4°C. 2. TE: 10 mM Tris-HCl, pH 8.0, 1 mM EDTA, pH 8.0. Autoclave before use. 3. Nuclear lysis buffer: 0.32 M lithium acetate, 2% (w/v) lithium dodecyl sulfate (LiDS), 10 mM Tris-HCl, pH 8.0, 1 mM EDTA, pH 8.0. Store at room temperature. 4. Phenol: Equilibrated phenol for both DNA and RNA isolation can be purchased commercially (e.g., CamLabs, Cambridge, UK) and avoids many of the potential risks associated with its use. If crystalline phenol is used, 0.1% hydroxyquinoline should be added as an antioxidant and it should be extracted initially with 1 M Tris-HCl, pH 8.0, and then repeatedly with 0.1 M Tris-HCl, pH 8.0, until the pH of the aqueous phase is 8.0 (2). Phenol should be stored at 4°C. 5. Phenol:chloroform: A 1:1 mixture phenol and chloroform is made by mixing equal volumes of chloroform and equilibrated phenol. This may be purchased ready prepared from a number of manufacturers (e.g., CamLabs). Store at 4°C.

2.4. DNA Isolation Using the Salt-Precipitation Method (3) 1. Sucrose lysis buffer–see Subheading 2.3.1. 2. TKM 1: low-salt buffer–10 mM Tris-HCl, pH 7.6, 10 mM KCl, 10 mM MgCl2, 2 mM EDTA. 3. TKM 2: high-salt buffer–10 mM Tris-HCl, pH 7.6, 10 mM KCl, 10 mM MgCl2, 0.4 M NaCl, 2 mM EDTA. 4. 6 M NaCl: This is a supersaturated solution.

Isolation of DNA and RNA

27

5. 20% SDS: Dissolve 20 g SDS in 100 mL distilled water at 65°C. Store at room temperature.

2.5. Isolation of Total Cellular RNA (4) 1. Solution D: 50 g guanidinium thiocyanate (GTC), 58.6 mL of distilled water, 3.52 mL 0.75 M trisodium citrate, 5.28 mL 10% sarkosyl NL30. Incubate at 65°C to dissolve the GTC. Store at room temperature for up to 3 mo. Immediately before use, add 3 5 μL of β-mercaptoethanol to 5 mL of solution D. 2. 2 M NaOAC, pH 4.0. Store at 4°C. 3. Phenol:chloroform (4:1): water-saturated phenol, pH 4.0 chloroform (4:1). This can be purchased commercially (e.g., CamLabs). Store at 4° C.

3. Methods 3.1. Isolation of Mononuclear Cells from Whole Blood 1. Dilute 10–20 mL of whole blood 1:1 with ice-cold PBS. 2. Carefully layer onto an equal volume of the appropriate density gradient medium, e.g., Histopaque 1077, in a 30-mL sterile tube. 3. Centrifuge at 600g for 30 min at 22°C. 4. Carefully collect the cellular interface using a sterile Pasteur pipet and re-suspend the cells in 50 mL of ice-cold PBS. 5. Centrifuge at 800g for 30 min at 22°C to pellet the cells. 6. Re-suspend the cells in 1 mL of ice-cold PBS and store on ice until use.

3.2. Isolation of Platelets from Whole Blood (see Note 8) 1. Platelet rich plasma (PRP) is prepared from whole blood by centrifuging 10 mL of whole blood at 600g for 10 min at 22°C. (The leukocyte count of PRP is generally CAG) within exon 8 results in the loss of an MspI restriction enzyme recognition site. When run on 2.5% agarose gels the DNA fragments can be separated to distinguish the relevant genotypes. PCR products from the amplification of exon 8 are used. 1. Add 18 μL of PCR product DNA (exon 8) to 1 μL spermidine, 1 μL BSA, and 1 μL MspI. 2. Incubate for 12–16 h at 37°C. 3. Run the digested products on a 2.5% agarose gel with 2 μL of gel loading buffer at 60 V for 25 min. Include a control of undigested DNA and molecular weight markers. 4. Visualize under UV light. Fragments (bp) generated are: Normal (Arg 304/Arg304, Arg353/Arg353): 274, 242, 203, 80, 47, and 40 bp 283, 274, 242, 67, and 40 bp Gln304/Gln304: Gln353/Gln353: 3341, 242, 203, 80, and 40 bp

3.5. DNA Purification Double-stranded PCR products amplified with biotinylated primers are bound to paramagnetic beads coated with streptavidin. Twenty microliters of streptavidin coated beads used with 50 μL of PCR product provides sufficient template for 3–5 sequencing reactions. 1. Vortex the stock of beads and remove 20 μL into a 1.5-mL Eppendorf tube. 2. Place in the magnetic separation unit for 30 s. 3. Remove the supernatant and add 50 μL of 1X BWB. Vortex briefly to mix (2–3 s) and place in the magnetic separation unit for 30 s. Remove the supernatant and replace with 50 μL of 2X BWB. Vortex to mix. 4. Add 50 μL of the PCR product to the beads. Incubate with continual mixing (to keep the beads in suspension) for 15–20 min at room temperature. 5. Place the Eppendorf in the magnetic separation unit for 30 s and remove the supernatant. Add 10 μL of 0.15 N NaOH and vortex briefly to mix. Incubate at room temperature for 15 min. 6. Place the Eppendorf in the magnetic separation unit for 30 s. Remove the supernatant into a sterile Eppendorf tube and keep (this contains the nonbiotinylated strand of DNA and can be sequenced with a reverse sense primer).

208

Baker

7. Add 100 μL of 0.15 N NaOH to the beads, vortex briefly and place in the separation unit for 30 s. Remove and pool the supernatant with that already collected. 8. Add 100 μL of 1X BWB to the beads, vortex briefly and place in the separation unit for 30 s. Remove the supernatant and discard. 9. Repeat step 8 twice. The second time washing the beads in 100 μL of TE, pH 8.0. 10. Resuspend the beads in 20 μL of distilled H2O. Store at 4°C.

3.6. DNA Sequencing Direct sequencing of the PCR products is performed using the dideoxy chain termination method and T7 DNA polymerase. The method described is based upon the commercially available system Sequenase. 1. Add 5–7 μL of the purified biotinylated PCR product to 1 μL (8–12 pmol) of the appropriate sequencing primer (see Table 2) and 2 μL of 5X sequence reaction buffer. Incubate at 65°C for 5 min, then cool to 30°C at a rate of 2°C per (see Note 6). 2. Dispense 2.5 μL of each termination mix into a microtiter sequencing tray and place at 4°C. Prewarm at 37°C for at least 5 min prior to use. 3. Prepare a master extension mix for the number of templates to be sequenced +1. For example, for six templates combine: 7 μL of 0.1 M dithiothreitol, 3.5 μL [α-35S]dATP, 14 μL of dGTP labeling mix (diluted 1+5 in distilled H2O), 14 μL of Sequenase v2 (T7 DNA polymerase (diluted 1+7 in enzyme dilution buffer). Add diluted Sequenase last ensuring the enzyme dilution buffer is ice-cold before adding the enzyme. 4. Add 6 μL of the master mix to the annealed template primers on ice. Immediately add 3.5 μL to the termination mixes (prewarmed at 37°C) and place at 37°C for 5 min. Add 4 μL of the formamide stop solution to terminate the reaction. 5. Reaction mixes can be used immediately or stored at –20°C. 6. Prepare a 100 mL 6% denaturing polyacrylamide gel by mixing of 42 g of urea, 15 mL of 40% acrylamide/bisacrylamide (19:1 acrylamide:bisacrylamide), 10 mL 10X TBE buffer and distilled water to 100 mL. 7. Assemble the gel sequencing plates (see Subheading 3.3.). 8. Initiate polymerization by adding 130 μL of TEMED and 130 μL of fresh 25% ammonium persulfate. Insert a 20-well comb and allow to polymerise for at least 60 min prior to use. 9. Assemble the gel apparatus, fill the buffer reservoirs with 1X TBE and pre-run the gel at 45 W for 15 min. 10. Denature the samples at 80°C for 10 min and then place onto ice before loading. Load 3–5 μL of each sample. Running time will depend on the exon being sequenced. This will range between 1–3+ h. 11. After electrophoresis is complete, separate the gel plates, and place the gel (adherent to one plate) in fixative for 15 min. 12. Transfer the gel to 3MM chromatography paper, cover with cling film and dry under vacuum at 80°C for 2 h. 13. Transfer to X-ray cassette with film. Develop after 2–3 d.

Mutations in Factor VII Gene

209

4. Notes 1. PCR reactions depend on clean conditions to prevent contamination. This includes the use of aerosol tips, autoclaved glassware, and sterile or UV-treated distilled H2O. 2. Negative controls for PCR amplification should be used, i.e., all reagents except DNA. 3. Where possible, master mixes of reagents should be employed to prevent pipetting errors in small volumes and standardize contents of each tube. 4. Care must be taken in the use of radioisotopes. Recognized guidelines depending on the nature of the isotope being used must be adhered to. This includes perspex shielding, film dosimeters, regular checking of background levels, disposal facilities, log book of usage, and adequate storage facilities. 5. Electrophoresis times will depend on the size of the fragment being loaded. 6. This is conveniently carried out in the PCR block with an adjusted ramp time.

References 1. Thakrah, C. T. (1819) An inquiry into the nature and properties of the blood. Cox, London. 2. Alexander, B., Goldstein, R., Landmehr, G., et al. (1951) Congenital SPCA deficiency: a hitherto unrecognised coagulation defect with haemorrhage rectified by serum and serum fractions. J. Clin. Invest. 30, 596–608. 3. Macfarlane, R. G. (1964) An enzyme cascade in the blood clotting mechanism, and its’ function as a biochemical amplifier. Nature 202, 498–499. 4. Davie, E. W. and Ratnoff, O. D. (1964) Waterfall sequence for intrinsic blood clotting. Science 145, 1310–1312. 5. Broze, G. J. Jr, Girard, T. J., and Novotny, W. F. (1990) Regulation of coagulation by a multivalent Kunitz-type inhibitor. Biochemistry 29, 7539–7546. 6. O’Hara, P. J., Grant, F. J., Halderman, B. A., Gray, C. L., Insley, M. Y., Hagen, F. S., and Murray, M. J. (1987) Nucleotide sequence of the gene coding for human Factor VII, a vitamin-K dependent protein participating in blood coagulation. Proc. Natl. Acad. Sci. USA 84, 5158–5162. 7. de Grouchy, J., Zautzenberg, M.D, Turleau, C., Beguin, S., and Chauin-colin, F. (1984) Regional mapping of clotting factors VII and X to 13q34. Expression of factor VII through chromosome 8. Human Genetics 66, 230–233. 8. Miao, C.H., Leytus, S. P., Chung, D. W., and Davie, E. W. (1992) Liver specific expression of the gene coding for human factor X, a blood coagulation factor. J. Biol. Chem. 267, 7395–7401. 9. Furie, B. and Furie, B. C. (1990) Molecular bases of vitamin-K dependent γ-carboxylation. Blood 75, 1753–1762. 10. Neurath, H. (1984) Evaluation of proteolytic enzymes. Science 224, 350–357. 11. Marakava, M., O’Kamura, T., Kamura, T., Kuroiwa, M., Harada, M., and Niho, Y. (1994) Analysis of the partial nucleotide sequences and deduced primary structures of the protease domains of mammalian blood coagulation factors VII and X. Eur. J. Haematol. 52, 162–168.

210

Baker

12. Regni, M. V., Lewis, J. H., Spero, J. A., and Hasiba, U. (1981) Factor VII deficiency. Am. J. Haematol. 10, 79. 13. Tripplett, D. A., Brandt, J. T., McGann Batard, M.A., Shaeffer Dixon, J. L., and Fair, D. S. (1985) Heterogeneity defined by combined functional and immunochemical analysis. Blood 66, 1284. 14. Berkner, K., Busby, S., Davie, E., et al. (1986) Isolation and expression of cDNA encoding human factor VII. Cold Spring Harb. Symp. Quant. Biol. 51, 531–541. 15. Broze, J. Jr. (1982) Binding of human factor VII and VIIa to moncytes. J. Clin. Invest. 70, 526–535. 16. Kumar, A., Blumenthal, D. K., and Fair, D. S. (1991) Identification of molecular sites on factor VII which mediate its assembly and function in the extrinsic pathway activation complex. J. Biol. Chem. 226, 915–921. 17. Green, F., Kelleher,C., Wilkes, H., Temple, A., Meade, T., and Humpries, S. (1991) A common genetic polymorphism associated with lower coagulation factor VII in healthy individuals. Arterioscler. Thromb. 11, 540–546. 18. Tuddenham, E. G. D, Pemberton, S., and Cooper, D. N. (1995) Inherited factor VII deficiency: genetics and molecular pathology. Thromb. Haemostasis 74(1), 313–321.

Factor XI Deficiency

211

21 Molecular Analysis in Factor XI Deficiency Karen M. Johnson and John H. McVey 1. Introduction Factor XI (FXI) is the zymogen precursor of an active serine protease that participates in the contact phase of coagulation. Synthesized in the liver, it circulates in the plasma in a noncovalent complex with high molecular weight kininogen (1) at a normal concentration of 5 μg/mL. (For clinical purposes, the normal range is defined as 50–150 U/dL) (2). FXI circulates as a homodimeric glycoprotein with a mass of 160 kDa. Each subunit of the FXI molecule consists of a tandem repeat of four “apple” domains, designated A1–A4, which are followed by a typical serine protease catalytic domain (3). Each apple domain has several internal disulphide links: A2 and A3 have an even number of cysteine residues, whereas A1 and A4 have seven cysteine residues. Dimerization of the molecule is mediated through a disulphide bridge between cysteine 321 in the A4 domain of each subunit (4). The Apple 4 domain also contains a binding site for Factor XIIa (FXIIa). Of the other apple domains, A1 contains a site for binding high-mol-wt kininogen, and A2 contains a substrate binding site for Factor IX (FIX) (5–8). FXI is activated by FXIIa by proteolytic cleavage at Arg 379-Ile 380 in each constituent monomer. This cleavage generates two chains, which are held together by three disulphide bonds. The heavy chain comprises the four apple domains, and the light chain contains the catalytic domain. The cleavage of FXI by FXIIa generates two active site serines per dimer. Activated Factor XI (FXIa) recognizes FIX as a substrate, and activates FIX by cleaving it at two sites: Arg145-Ala146 and Arg180-Val181 (2). The gene encoding Factor XI has been localized to the tip of the long arm of chromosome 4 (4q35), and consists of 15 exons spread over 23 kb (9,10). The gene is transcribed to give a mRNA of approx 2 kb, which in turn encodes for a mature protein consisting of 607 amino acids. From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ

211

212

Johnson and McVey

Hereditary Factor XI deficiency is rare. It occurs as an autosomal incompletely recessive disorder with an incidence of 1 in 105-106. Deficiency of FXI was first discovered in a Jewish individual, who presented with a mild bleeding tendency and prolonged partial thromboplastin times (11,12). The majority of cases since described have been among Ashkenazi Jews, in whom three common mutations (designated Types I, II, and III) have been found (13,14). Type I is a splice junction mutation at the start of intron N, in which the invariant 5'-splice donor dinucleotide GT is mutated to AT. Type II is a nonsense mutation in exon 5, in which the GAA encoding Glu177 becomes TAA, a stop codon. Type III is an amino acid substitution in exon 9, in which the TTC encoding Phe283 becomes CTC, coding for Leucine. Type II and Type III mutations account for approx 50 and 40%, respectively of all mutations found in Jewish patients. Increasing numbers of non-Jewish patients have now being identified (15– 17). Among these, the type II and type III mutations account for just 12% of the molecular defects. The majority are patients with low Factor XI antigen levels (18), although more recently some patients with normal antigen levels but reduced activity have been recorded (19,20). A rapid, relatively simple screening method is required to identify the causative mutations in Factor XI deficient patients. As with many genes coding for proteins involved in coagulation, the methods of choice are PCR based. Primary analysis to establish the presence or absence of types I, II, and III mutations is performed by PCR of three specific genomic fragments, followed by restriction enzyme digestion of the PCR products. If these three mutations are absent, subsequent screening of the gene is by means of single strand conformational polymorphism (SSCP) and direct sequencing of individual exons. 2. Materials (see Note 1) 2.1. Isolation of Genomic DNA

2.1.1. Isolation of Genomic DNA from Whole Blood Samples 1. 10 mL EDTA blood samples should be collected into a vessel that can withstand temperatures of –70°C because the sample is frozen before use (preferably not a vacutainer or glass tube!). 2. Lysis buffer: 0.32 M sucrose, 10 mM Tris-HCl, pH 7.5, 1% Triton X-100, 5 mM MgCl2. Prepare with sterile distilled water. Store at 4°C. 3. NaCl/EDTA stock solution: 7.5 mM NaCl and 24 mM EDTA, pH 8.0. Prepare with sterile distilled water. 4. SDS/Proteinase K: 5% SDS and 2 mg/mL Proteinase K. Prepare with sterile distilled water. 5. 3 M NaOAc pH 5.2. Dissolve 123 g of Sodium acetate in approx 200 mL H2O. Adjust pH to 5.2 with glacial acetic acid. Add H2O for final volume of 500 mL. Autoclave to sterilize.

Factor XI Deficiency

213

6. DNA Phenol. 1 kg Ultrapure Phenol (Gibco BRL, #15509-029). Equilibrate overnight with 500 mL of 50 mM Tris-HCl, pH 7.6, 1 mM EDTA, and 0.3 M NaOAc, pH 7.0. Add 50 mL of M-Cresol, 2 mL of 2-mercaptoethanol, and 1 g of β-hydroxyquinolone. Store at 4°C away from light. 7. Phenol/chloroform. Prepare a 50:50 mix of DNA phenol:chloroform 8. Chloroform. 9. 100% Ethanol. 10. Sterile distilled water.

2.1.2. Isolation of Genomic DNA from Tissue Culture cells This method is useful if, for example, patient samples have been obtained as immortalized lymphocytes. 1. Lysing solution: 50 mM Tris-HCl, pH 8.5, 50 mM NaCl, 25 mM EDTA, pH 8.0, 0.5% SDS. Prepare in sterile distilled water and filter-sterilize. Add Proteinase K to 300 μg/mL before use. 2. PBS “A”: 8 g NaCl, 0.2 g KCl, 1.15 g Na2HPO4, 12H2O, 0.2 g KH2PO4. Adjust pH to 7.4 with HCl.

2.2. Polymerase Chain Reaction (PCR) 1. Primer sequences for the detection of Types I-III Factor XI deficiency (see Table 1). 2. Primer sequences for the amplification of exons (see Table 2). 3. DNA polymerase enzyme and 1X PCR buffer. Commercially available polymerase enzymes are supplied with concentrated buffer, with or without magnesium added. This buffer should be diluted with sterile distilled water, and deoxynucleotides and magnesium added as required. For example, to prepare 750 μL of a 10X PCR buffer (with MgCl2) combine: 450 μL of 25 mM MgCl2 (final concentration = 1.5 mM), 15 μL of each dNTP at 100 mM (final concentration = 200 μM) and 6240 μL of sterile water. Filter through 0.2 μm filter. Store as 1 mL aliquots at –20°C. 4. 100 mM dNTPs (e.g., Pharmacia, #27-2035-01). 5. Genomic DNA at a concentration of 150 ng/μL.

2.3. Single Stranded Conformation Polymorphism (SSCP) Analysis 1. 40% Acrylamide: Mix 35.1 g of acrylamide with 0.9 g of N,N’ methylene bisacrylamide and add sterile water to give a final volume of 90 mL. Store at 4°C. 2. 10X TBE pH 8.0: 108 g trizma base (Sigma, #T1503), 55g boric acid, 7.4 g EDTA, and water to 1 L. (These quantities should give the exact pH!) 3. SSCP gel mix: 40% acrylamide (90 mL), 10X TBE (80 mL) and H2O (630 mL). Store at 4°C. Degas just before use. 4. To pour the SSCP gel: Combine the SSCP gel mix (70 mL, degassed) with 10% ammonium persulfate (402 μL) and TEMED (52.5 μL) immediately before pouring the gel. 5. Sample running buffers (see Table 3).

214

Johnson and McVey

Table 1 Primer Sequences for the Detection of the Mutations in Factor XI Deficiency Types I–III Primer

Primer sequence, 5'→3'

I-f I-r II-f II-r III-f III-r

AGT GAC CAA CGA AGA GTG CCA TTG CAT ATA TTC CAT TGG CTA AGA GAA TCT GGA AGG TAC TCA TGT C ATC GAC CAC TCG AAT GTC CTG ACT TTA CTT TCT CTA GGT GCT GT ACA GTC TTG ATT GTG ATG TAT GAA

Product size

Digest with

132 bp

MaeIII

223 bp

BsmI

706 bp

Sau3AI

Table 2 Primer Sequences for the Amplification of the Exons of the FXI Gene Exon 1 2 3 4 5 6 7 8–10 11 12 13 14 15

Primer sequence, 5'→3' F = forward/R = reverse F: AGC AAT TCT CTC AAG G R: GCG GAA CAT CTC TAC AAA GC F: AGC TGT AAG AGT TGA ATG CC R: CAC ATG TGT GGA GAT TGC AG F: ACA TAA CGC ATG CCA TGT AC R: AAA AAT CTG TCT CCT CGA TG F: GCT TTC TGT GTG CTG ACT TT R: CAG CTG GTA TTT GTT GAT TC F: CCC CTA GAA TCT GGA AGG TA R: CGA TTC TGT TTT TCA TCG AC F: CTT AGC AAC ACT GCT GGG AC R: CGT GAG CAT AAG CTG GTA TC F: TCC TGA TAG CTG GTG AAT TG R: GAA GAT AAC AAA TTA TCC TTA CTT G F: CTG ACT TTA CTT TCT CTA GGT GC R: GTT CTC CCT TCT GTG GCT AT F: AAT GCT TCT GTT GCA GAG TG R: TTA TAA ATG TGT GAA GAA GAT GAA C F: GCC ACA CAC TTC ACA ATG TC R: GGT CAG GCC GTA AGT CTA GT F: AAA ATA CAC GAC AAC AAG GC R: TCT AGG ATG GAG CAC ATA TAA C F: ATG GTT ATT CTA CAA ACG AAC C R: CAA CAG AGC GAG ACT CTG TC F: TCT GAG TTG ATC TGT GCA CC R: TAC AAC GAT CAT AGA ACG GG

Product length (bp) 381 333 232 226 253 363 247 752 235 332 270 300 398

Factor XI Deficiency

215

Table 3 Sample Running Buffers Single-stranded buffer

Double-stranded buffer

Stock solution

800 μL 100 μL 100 μL 1 μL

800 μL 100 μL 100 μL —

— 10 mg/mL 10 mg/mL 10 M

80% Formamide 0.1% Bromophenol blue 0.1% Xylene cyanol 10 mM NaOH

6. Redivue [α-33P]dCTP, 10 mCi/ mL; 1000–3000 Ci/mMol (Amersham International). 7. Reagents as for PCR (see Subheading 2.2.).

2.4. Direct Sequencing 1. Microcon 100 columns (Amicon #42413). 2. Automated sequencing kit (e.g., Perkin Elmer ABI Prism Dye Terminator Cycle Sequencing Ready Reaction Kit (#402079 for 100 reactions). 3. Formamide stock: Formamide (10 mL), Amberlite MB-150 (0.75 g) (Sigma, #A5710). Mix for 10 min. Filter. Store at –20°C in 1-mL aliquots. 4. Dextran blue stock: 50 mM EDTA, pH 8.0, dextran blue (30 mg/ mL). 5. Formamide/EDTA/dextran blue: Mix formamide and dextran blue stocks in a ratio of 5:1.

3. Methods (see Note 2) 3.1. Isolation of Genomic DNA

3.1.1. Extraction of DNA from Whole Blood Timing: 3 d minimum. NB: Any blood should be treated as a high-risk sample. The following procedure should be performed in a Class II Containment Cabinet, and the operator should be well protected with laboratory coat, safety glasses, two pairs of gloves, and if possible apron and protective sleeves. Any spills should be cleared immediately; gloves should be changed regularly especially if contaminated. Day 1: 1. The EDTA blood sample should have been stored at –70°C before it is required. Thaw the sample on ice. 2. In a 50-mL tube mix: 10 mL whole blood sample with 40 mL lysis buffer. Leave on ice for 20 min. 3. Spin the sample 1000g at 4°C for 10 min. 4. Remove the supernatant into a fresh tube, cap, and discard. 5. Resuspend the pellet in 5 mL NaCl/EDTA. Use a plastic disposable pipet and as violently as possible resuspend the pellet. The pellet will remain virtually solid.

216

Johnson and McVey

6. In a 13-mL centrifuge tube, add 0.5 mL SDS/Proteinase K. 7. Transfer the blood pellet to the 13 mL tube. 8. Incubate at 37°C overnight.

Day 2: 9. Add: 500 μL 3 M NaOAc, pH 5.2, and 5 mL DNA phenol. Place tube on a rotating mixer and mix at room temperature for 20 min. 10. Spin at 1000g at room temperature for 20 min. 11. Remove and discard the lower layer with a pastette. This will be very thick and a dark brown color. It is easier to remove the interface first followed by the phenol layer, otherwise the aqueous layer containing the DNA tends to be drawn off instead. For the same reason, do not try to remove all of the lower layer. 12. To the remaining aqueous layer, add: 5 mL Phenol/Chloroform and mix at room temperature for 20 min. Spin at 1000g at room temperature for 20 min. 13. Remove and discard the lower layer. This should be a yellow color. 14. To the remaining aqueous layer add: 5 mL chloroform and mix at room temperature for 20 min. Spin at 1000g at room temperature for 20 min. 15. In a sterile 30-mL tube add: 11 mL 100% ethanol, 16. In a sterile microcentrifuge tube, add 200 μL sterile H2O. 17. Carefully transfer 5 mL of the upper aqueous layer from the centrifuge tube to the ethanol-containing tube. The solution tends to turn cloudy then clear as the SDS precipitates slightly. Roll the tube gently. Strands of DNA will slowly begin to appear! 18. Carefully pick up the DNA using a disposable sterile plastic inoculating loop. Dry the pellet slightly by tapping it gently on the side of the tube. 19. Transfer the DNA from the inoculating loop to the tube containing sterile water. 20. Leave the tube at 4°C overnight to several days to allow the DNA to dissolve. The length of time will depend on the amount of DNA extracted from the blood sample. 21. Check the OD260 of a 1:100 dilution of the DNA and determine the concentration (1OD260 = 50 μg/mL). Store the stock DNA at –20°C until required.

3.1.2. Extraction of Genomic DNA from Immortalized Lymphocytes Timing: 3 d minimum. Day 1: 1. Harvest approx 50 mL of media containing the immortalized lymphocytes. Spin the cells at 250g for 5 min at room temperature. Wash the cell pellet twice in PBS “A”; spin cells at 250g for 5 min, removing the supernatant between washes. 2. Resuspend the cell pellet in 5 mL lysing solution, remembering to add the proteinase K. Transfer to a 13-mL sterile centrifuge tube. 3. Incubate at 37°C overnight.

Day 2: 4. Add 500 μL 3 M NaOAc, pH 5.2, and 5 mL phenol chloroform.

Factor XI Deficiency 5. 6. 7. 8. 9. 10. 11. 12. 13. 14.

217

Rotate to mix for 20 min. Centrifuge at 1000g for 20 min at room temperature. To a 30-mL tube add: 11 mL 100% ethanol. To a sterile 1.5-mL microcentrifuge tube add: 200 μL sterile distilled water. Transfer 5 mL of the upper aqueous layer from the sample tube to the ethanol. Roll the tube gently. Strands of DNA should gradually appear. Pick up the DNA using a sterile plastic inoculating loop. Transfer the DNA from the loop to a sterile microfuge tube containing 200 μL H2O. Leave at 4°C for 2 d to allow the DNA to dissolve. Check OD260 to determine the DNA concentration (1OD260 = 50 μg/ mL). Store at –20°C.

3.2. Polymerase Chain Reaction (PCR) This is a very powerful method that can be used to rapidly amplify individual exons from genomic DNA.

3.2.1. PCR to Screen for Type I, II, and III Mutations (17) 1. (See Note 3) In a 500-μL microcentrifuge tube, add the following reagents: 2 μL of genomic DNA (150 ng/μL), 2 μL forward primer (150 ng/μL), 2 μL reverse primer (150 ng/ μL), 95 μl of 1X polymerase buffer, and X U of a thermostable DNA Polymerase enzyme according to the manufacturer’s instructions. 2. Add one or two drops of mineral oil to the top of each tube. Spin briefly before placing the tubes in the thermal cycler. 3. Amplification conditions: Type I FXI deficiency: 94°C for 4 min then 40 cycles of: 94°C for 30 s; 55°C for 15 s, and 72°C for 5 min followed by a final extension at 72°C for 10 min. Type II FXI deficiency: 94°C for 4 min then 40 cycles of: 94°C for 30 s; 60°C for 15 s, and 72°C for 5 min followed by a final extension at 72°C for 10 min. Type III FXI deficiency: 94°C for 4 min then 40 cycles of: 94°C for 30 s; 60°C for 15 s, and 72°C for 5 min followed by a final extension at 72°C for 10 min. 4. Run 10 μL of the PCR product on an agarose gel to check for efficient amplification. 5. Restriction enzyme digest. The appropriate 10X buffers should be provided by the manufacturers of the restriction enzymes. In a sterile microcentrifuge tube add: Type I mutation: 17 μL PCR product, 2 μL of 10X buffer and 1 μL (5–10 U) of MaeIII. Type I mutation I: 17 μL PCR product, 2 μL of 10X buffer and 1 μL (5–10 U) of BsmI 1. Type III mutation: : 17 μL PCR product, 2 μL of 10X buffer and 1 μL (5–10 U) of Sau3A I. In all cases, incubate at 37°C for 2 h. Check the products on a 2.5% agarose gel (see Table 4).

3.2.2. PCR of Exons for Direct Sequencing 1. (See Note 3) In a 500-μL microcentrifuge tube, add: 2 μL of genomic DNA (150 ng/μL), 2 μL of the forward primer (150 ng/μL), 2 μL of the reverse primer (150

218

Johnson and McVey

Table 4 Expected Product Sizes for FXI Mutations Types I–III Mutation PCR product size

Digest with

Digestion product sizes, bp Normal: 99 + 33 Type I: Uncut Normal: 113 + 110 Type II: Uncut Normal: 578 + 128 Type III: 328 + 251 + 128

Type I

132 bp

MaeIII

Type II

223 bp

BsmI

Type III

706 bp

Sau3AI

ng/μL), 95 μL of 1X polymerase buffer, and X units of a thermostable DNA polymerase enzyme according to the manufacturer’s instructions. 2. Add one or two drops of mineral oil to the top of each tube. Spin briefly before placing the tubes in the thermal cycler. 3. Amplification conditions: 94°C for 4 min then 30 cycles of: 94°C for 30 s; 57°C for 60 s, and 72°C for 1 min followed by a final extension at 72°C for 10 min. 4. Run 10 μL of the PCR product on an agarose gel to check for efficient amplification.

3.3. Single-Strand Conformational Polymorphism (SSCP) Analysis (see Note 4) Timing: Day 1: PCR overnight. Day 2: Check PCR, pour SSCP gel and leave to set (2 h), prepare samples (15 min), load and run gel (2–3 h), dry gel (40 min), autoradiograph overnight. 1. Amplify the test DNA as follows: In a 500-μL microcentrifuge tube, add: 1 μL of genomic DNA (150 ng/μL), 1 μL of the forward primer (150 ng/μL), 1 μL of the reverse primer (150 ng/μL), 45 μL of 1X polymerase buffer, 0.25 μL of [α33P]dCTP, and X units of a thermostable DNA Polymerase enzyme according to the manufacturer’s instructions. Add a drop of mineral oil to each tube to prevent evaporation of the samples. (Amplification conditions as described in Subheading 3.2.2.) 2. Run 10 μL of the PCR product on a 1–2% agarose gel to check for efficient amplification. 3. (See Note 5) Take 6 μL of the PCR product and add 6 μL of sample running buffer. Heat to 95°C for 5 min then cool on ice for 5 min. 4. Load 3 μL/lane onto the SSCP gel. 5. Run the gel in a cold room at 4°C at 40 W constant power. Depending on the size of the PCR fragment, it may be necessary to run a second set of samples approx 30 min after the first set. The gel will take 2–3 h to run. It should be stopped just as the bromophenol blue from the shorter runs has reached the bottom of the gel. 6. Dry the gel in a gel dryer (approx 30 min). 7. Autoradiograph the gel overnight, and then for longer if necessary.

Factor XI Deficiency

219

3.4. Direct Sequencing (see Note 6) This method is based on the Perkin Elmer ABI PRISM™ Dye Terminator Cycle Sequencing Ready Reaction Kit. For this method to give good results, both the PCR template and sequencing primer must be of a high quality. 1. PCR the region of interest (see Subheading 3.2.). 2. Run 10 μL of the PCR product on a 1–2% agarose gel to check for efficient amplification. 3. Pool PCR reactions from the same sample as necessary. Make up volume to 500 μL with sterile distilled H2O. 4. Add sample to the top of a Microcon 100 column placed in the microfuge tube supplied with the column. 5. Spin at 500g, for 10–15 min, until all but 10 μL of the fluid has passed through the column. 6. Invert the column into a clean tube. Spin at 1000g for 2 min to collect the sample at the bottom of the tube. 7. Increase the volume to 350 μL with sterile distilled H2O. Check OD260 and determine the DNA concentration. 8. Prepare the sequencing reaction as described in the manual supplied with the kit: In a total volume of 20 μL combine DNA 100 ng, sequencing primer 40 ng and premix 8 μL. 9. (See Note 7.) The sequencing reaction is carried out in a thermal cycler and comprises 25 cycles of: 96°C for 30 s and 50°C for 15 s, followed by a single incubation at 60°C for 4 min. 10. Precipitate the sequenced product: Transfer the 20 μL product to a clean tube and add 3 μL tRNA (10 mg/mL), 80 μL H2O, 10 μL 3 M NaOAc, pH 5.2, and 250 μL EtOH. 11. Leave on ice for no more than 10 min. 12. Spin at 16,000g for 15 min. 13. Remove and discard the supernatant. 14. Add 500 μL 70% EtOH. Spin for 5 min. Remove supernatant. 15. Dry the pellet. 16. Resuspend the pellet in 4 μL formamide/EDTA/dextran blue. 17. Heat sample to 90°C, for 2 min to denature. 18. Place on ice until ready to load.

4. Notes 1. All reagents should be made with sterile distilled water and sterilized by filtration or autoclaving unless otherwise stated. 2. All methods described are those used routinely in the authors laboratory, because they consistently give good results. It should be noted, however, that there are a number of commercially available kits that could alternatively be used. 3. PCR: there are many suppliers of thermal stable polymerases and of thermal cyclers. The conditions described here have been used successfully in the authors’ laboratory using Red Hot DNA polymerase (Advanced Biotechnologies) and a

220

4.

5.

6.

7.

Johnson and McVey Biometral Trio Block thermal cycler. Conditions may vary slightly depending on the source of the polymerase and thermal cycler. Remember to include at least one tube with no added genomic DNA to control for contamination. PCR for SSCP: Where several samples are to be examined, it is easier to make up a “Master Mix” containing buffer, oligonucleotides, enzyme and isotope. Only one pipeting step is then needed, reducing the risk of possible contamination. Remember to include two controls: (a) A “no DNA control”: if an amplified band is obtained in this sample, cross-contamination will have occurred, and these samples should NOT be used in the SSCP. (b) A “Normal control”: The patient samples are compared to this control. SSCP samples: At least one sample of nondenatured normal sample should be prepared, so that the running position of the double stranded PCR fragment can be determined. When the samples are denatured, there will still be some doublestranded material in the sample. Occasionally, a shift can be detected in this, when there is no obvious shift in any of the bands representing the single-stranded material. There are many different polyacrylamide gel apparatus on the market, we have used a 40 cm BRL S2 sequencing gel electrophoresis system. Past experience has shown us that it is better to set up 2 or 3 PCR reactions for the same patient; this will generate sufficient quantities of the DNA required, which can then be purified by the method of choice. The method that we have found to be most successful is the use of Microcon 100 columns. Direct sequencing: The annealing temperature can be altered depending on the Tm of the primer used.

References 1. Thompson, R. E., Mandle, R. Jr., and Kaplan, A. P. (1977) Association of factor XI and high molecular weight kininogen in human plasma. J. Clin. Invest. 60, 1376–1380. 2. Tuddenham, E. G. D. and Cooper, D. N. (1994) The molecular genetics of haemostasis and its inherited disorders. Oxford University Press, Cambridge, UK, pp. 212–220. 3. McMullen, B. A., Fujikawa, K., and Davie, E. W. (1991) Location of the disulphide bonds in human coagulation factor XI: the presence of tandem apple domains. Biochemistry 30, 2056–2060. 4. Meijers, J. C. M., Mulvihill, E. R., Davie, E. W., and Chung, D. W.,(1992) Apple four in human blood coagulation factor XI mediates dimer formation. Biochemistry 31, 4680–4684. 5. Baglia, F. A., Sinha, D., and Walsh, P. N. (1989) Functional domains in the heavy chain region of factor XI: a high molecular weight kininogen-binding site and a substrate-binding site for factor XI. Blood 74, 244–251. 6. Baglia, F. A., Jameson, B. A., and Walsh, P. N. (1990) Localization of the high molecular weight kininogen binding site in the heavy chain of human factor XI to amino acids Phe56 through Ser86. J. Biol. Chem. 265, 4149–4154. 7. Baglia, F. A., Jameson, B. A., and Walsh, P. N. (1992) Fine mapping of the high molecular weight kininogen binding site on blood coagulation factor XI through the use of rationally designed synthetic analogs. J. Biol. Chem. 267, 4247–4252.

Factor XI Deficiency

221

8. Baglia, F. A., Jameson, B. A., and Walsh, P. N. (1991) Identification and chemical synthesis of a substrate binding site for factor IX on coagulation factor XIa. J. Biol. Chem. 266, 24,190–24,197. 9. Asakai, R., Davie, E. W., and Chung, D. W. (1987) Organization of the gene for human factor XI. Biochemistry 26, 7221–7228. 10. Kato, A., Asakai, R., Davie, E. W., and Aoki, N., (1989) Factor XI gene (F11) is located on the distal end of the long arm of human chromosome 4. Cytogenet. Cell Genet. 52, 77–78. 11. Rosenthal, R. L., Dreskin, O. H., and Rosenthal, N. (1953); New haemophilialike disease caused by deficiency of a third plasma thromboplastin factor. Proc. Soc. Exp. Biol. Med. 82, 171–174. 12. Rosenthal, R. L., Dreskin, O. H., and Rosenthal N. (1955) Plasma thromboplastin antecedent (PTA) deficiency; clinical, coagulation, therapeutic and hereditary aspects of a new haemophilia-like disease. Blood 10, 120–131. 13. Asakai, R., Chung, D. W., Davie, E. W., and Seligsohn, U. (1991) Factor XI deficiency in Ashkenazi Jews in Israel. New. Engl. J. Med. 325, 153–158. 14. Asakai, R., Chung, D. W., Ratnoff, O. D., and Davie, E. W. (1989) Factor XI (plasma thromboplastin antecedent) deficiency in Ashkenazi Jews is a bleeding disorder that can result from three types of point mutations. PNAS 86, 7667–7671. 15. Imanaka, Y., Lal, K., Nishimura, T., Bolton-Maggs, P. H. B., Tuddenham, E. G. D., and McVey, J. H. (1995) Identification of two novel mutations in non-Jewish factor XI deficiency. Br. J. Haematol. 90, 916–920. 16. Pugh, R. E., McVey, J. H., Tuddenham, E. G. D., and Hancock, J. F. (1995) Six point mutations that cause factor XI deficiency. Blood 85, 1509–1516. 17. Hancock, J. F., Wieland, K., Pugh, R. E., Martinowitz, U., Schulman, S., Kakkar, V. V., Kernoff, P. B. A., and Cooper, D. N. (1991) A molecular genetic study of factor XI deficiency. Blood 77, 1942–1948. 18. Saito, H., Ratnoff, O., Bouma, B. N., and Seligsohn, U. (1985) Failure to detect variant(CRM)+ plasma thromboplastin antecedent (Factor XI) molecules in hereditary PTA deficiency: A study of 125 patients of several ethnic backgrounds. J. Lab. Clin. Med. 106, 718–721. 19. Ragni, M. V., Sinha, D., Seaman, F., Lewis, J. H., Spero, J. A., and Walsh, P. N. (1985) Comparison of bleeding tendency, factor XI coagulant activity, and factor XI antigen in 25 factor XI-deficient kindreds. Blood 65, 719–725. 20. Mannhalter, C., Hellstern, P., and Deutsch, E., (1987) Identification of a defective factor XI cross-reacting material in a factor XI deficient patient. Blood 70, 31–37.

Antithrombin Deficiency

223

22 Mutational Analysis in Antithrombin Deficiency David J. Perry 1. Introduction Human antithrombin is a single-chain glycoprotein of MW 58 kDa and the most important plasma inhibitor of the coagulation serine proteases. It is a member of the serine protease inhibitor (SERPIN) family of proteins and in common with several other members of this family, its inhibitory activity is increased many thousand-fold in the presence of heparin and other sulphated glycosaminoglycans. Type I antithrombin deficiency, i.e., a 50% reduction in the total amount of plasma antithrombin is estimated to affect approx 1 in 4200 of the general population, whereas Type II deficiency–characterized by the presence of a dysfunctional protein in the plasma of affected individuals, which may be present in normal or reduced amounts–may affect as many as 1 in 600. Approximately 4–6% of individuals with thromboembolic disease will have antithrombin deficiency. A deficiency of antithrombin or a functional abnormality is a recognized cause of recurrent thromboembolic disease, although the risk is dependent upon the precise molecular abnormality. Individuals with Type I antithrombin deficiency or with mutations affecting the reactive site of the molecule or with multiple (pleiotropic) functional abnormalities are at high risk of venous thromboembolic disease, while those with mutations affecting the heparin binding domain are at relatively low risk from thrombosis. The first antithrombin mutations were identified by means of protein sequencing, but as with many areas of mutation analysis, the development of the polymerase chain reaction has revolutionized the characterization of antithrombin mutation. There are several reviews in the literature on antithrombin and its deficiency states that provide a starting point for further reading (1,2). In addition, a database of antithrombin mutations has been published (3). From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ

223

224

Perry

2. Materials 2.1. Enzymatic Amplification of the Antithrombin Gene 1. Oligonucleotide primers (see Table 1) at 50 pmols/μL. Downstream amplification primers are biotinylated at their 5' end to allow rapid purification for solid phase sequencing. 2. Genomic DNA (see Note 1). 100–500 ng of DNA are required for each amplification reaction. 3. 20 mM dNTPs. 100 mM stock solutions of each of the 4 dNTPs (dATP, dCTP, dGTP, and dTTP) are available for many manufacturers, e.g., Pharmacia 4. 10X PCR buffer: PCR buffers ± magnesium are commonly supplied with the thermostable DNA polymerase. The buffer used with “Amplitaq” comprises: 15 mM MgCl2, 500 mM KCl, 100 mM Tris-HCl pH 8.4, and 1% Triton X-100. 5. 25 mM MgCl2. If not included in the PCR buffer. 6. Sterile water. 7. Thermostable DNA polymerase, e.g., Amplitaq at 5 U/μL. 8. 1.5% agarose gel containing ethidium bromide 0.5 μg/mL in 1X Tris-BorateEDTA (TBE).

2.2. Purification of Biotinylated PCR Products and Preparation of Single-Stranded DNA Template 1. Biotinylated PCR product. 2. 1X/2X Binding and washing buffer (BWB): 2X BWB 10 mM Tris-HCl, pH 7.5, 1 mM EDTA, 2 M NaCl. 3. TE pH 8.0: 10 mM Tris-HCl, pH 8.0, 1 mM EDTA. 4. Streptavidin-coated magnetic beads, e.g.,Dynal. 5. Magnetic separation unit, e.g., Dynal MPC® magnet. 6. Sterile water. 7. 0.1 M NaOH: Freshly prepared immediately before use.

2.3. Solid-Phase Sequencing of Single-Stranded DNA Sequencing of PCR products is based on Sequenase v2 (modified T7 DNA polymerase) and the reagents contained within the kit. 1. 2. 3. 4. 5. 6. 7.

Single-stranded DNA (see Subheading 2.2.). 10–20 pmoles of a “nested” sequencing primer (see Table 1). 5X reaction buffer: 200 mM Tris-HCl, pH 7.5, 100 mM MgCl2, 250 mM NaCl. 0.1 M DTT. [α-35S]-dATP 1000–1500 Ci/mmol, e.g., Amersham. Sequenase v2.0 14 U/μL. Store at –20°C (see Note 2). Enzyme dilution buffer: 100 mM Tris-HCl, pH 7.5, 5 mM DTT, 0.5 mg/mL bovine serum albumin. Store at –20°C. Thaw before use and keep on ice. 8. dGTP labeling mix: 5X 7.5 μM dGTP, 7.5 μM dCTP, 7.5 μM dTTP diluted “1 + 5” in distilled water prior to use (see Note 3). 9. ddA, ddC, ddG, and ddT termination mixes (see Note 4).

3

Annealing: 60°C/1 s Extension: 74°C/30 s Denaturation: 94°C/5 s 35 Cycles Annealing: 60°C/1 s Extension: 74°C/5 s Denaturation: 94°C/5 s 35 Cycles Annealing: 60°C/1 s Extension: 74°C/5 s Denaturation: 94°C/5 s 35 Cycles

GACTGACCAGCATGTGCTCACCACCC CAGTGTGAATTTGGATGCTGTTTCTC TAACTAGGCAGCCCACCAAA CACCTCCTCAATCTCTGAGT GCTGCCTGGGAAAATGGAGAAGCCAA GTAAGCTGAAGAGCAAGAGGAAGTCC TTGAATAGCACAGGTGAGTA TGGGGCTCTCAGGGCCGTTCTGAGTAC

Annealing: 62°C/1 s Extension: 74°C/30 s Denaturation: 94°C/5 s 35 Cycles

Annealing: 62°C/1 s Extension: 74°C/30 se Denaturation: 94°C/5 s 35 Cycles

225 (continued)

262 bp

385 bp

1433 bp

535 bp

218 bp

Amplification parametersa Fragment size

GACTGACCAGCATGTGCTCACCACCC GTAAGCTGAAGAGCAAGAGGAAGTCC TAACTAGGCAGCCCACCAAA TGGGGCTCTCAGGGCCGTTCTGAGTAC

CCAGGTGGGCTGGAATCCTCTGCTTT CTTGGGCCTATGGAAGGCCCAAAGGT GGGTTGCATCCTAGCTTAAC CCATCAGTTGCTGGAGGGTGTCATTAC

GAACCTCTGCGAGATTTAGA GGACTCACAGGAATGACCTCCAA

Exon 1b Upstream amplification primer Downstream amplification primer

Exon 2 Upstream amplification primer Downstream amplification primer Forward sequencing primer Reverse sequencing primer Exon 3c Upstream amplification primer Downstream amplification primer Forward sequencing primer Reverse sequencing primer Exon 3a Upstream amplification primer Downstream amplification primer Forward sequencing primer Reverse sequencing primer Exon 3b Upstream amplification primer Downstream amplification primer Forward sequencing primer Reverse sequencing primer

Sequence data (5'–3')

Oligonucleotide

Table 1 Oligonucleotide and PCR Data for Amplification of the Human Antithrombin Gene

Antithrombin Deficiency

4

Annealing: 60°C/1 s Extension: 74°C/35 s Denaturation: 94°C/5 s 35 Cycles Annealing: 60°C/1 s Extension: 74°C/5 s Denaturation: 94°C/5 s 35 Cycles Annealing: 60°C/1 s Extension: 74°C/5 s Denaturation: 94°C/5 s 35 Cycles

GAATTCCCATCTGTGGATTGAAGCCA TGCATGCCTTAACACTGGAAACAGGC TCTCCCATCTCACAAAGACT TGCATGCCTTAACACTGGAAACAGGC AAGCATTGAGGAATTGCTGTGTCTGT TTACTTCTGTTCACAAACCAAAAATA CTGCAGGTAAATGAAGAAGGCAGTGA TTACTTCTGTTCACAAACCAAAAATA

bAmplification

356 bp

230 bp

515 bp

Amplification parametersa Fragment size

GGATATGTCTGTGTCAATAACTATCC CTTTTGGTCAGACTACCTTGCGGGTG ATGAATGTTTGTGTTCTTAC GAGAAGGGAGGAAACTCCTT

Sequence data (5'–3')

represent the time for which the samples remain at a particular temperature. primers are used as sequencing primer. c Exon 3 is amplified with the upstream primer of Exon 3a and the downstream primer of Exon 3b.

a Times

Exon 4 Upstream amplification primer Downstream amplification primer Forward sequencing primer Reverse sequencing primer Exon 5 Upstream amplification primer Downstream amplification primer Forward sequencing primer Reverse sequencing primer Exon 6 Upstream amplification primer Downstream amplification primer Forward sequencing primer Reverse sequencing primer

Oligonucleotide

Table 1 (Continued)

226 Perry

Antithrombin Deficiency

227

10. Microtiter sequencing trays, e.g., Pharmacia. 11. Stop solution: 95% (v/v) formamide, 20 mM EDTA, pH 8.0, 0.05% (w/v) bromophenol blue, 0.05% (w/v) xylene cyanol. 12. 40% Premixed acrylamide/bisacrylamide in a ratio of 19:1 (available from many manufacturers). 13. Sequencing grade urea. 14. 25% Ammonium persulfate freshly prepared. 15. N,N,N',N'-tetramethylethylenediamine (TEMED). 16. 10X Tris-Borate-EDTA. 17. Sequencing plates (40–50 cm × 20 cm). 18. 0.2–0.4-mm spacers. 19. Silanizing solution, e.g., dimethylchlorosilane. 20. 2 L of 5% methanol (v/v) 5% acetic acid (v/v) in water. 21. Whatman 3MM chromatography paper. 22. SaranWrap™. 23. Autoradiograph film, e.g., Kodak. 24. Power supply unit and sequencing apparatus, e.g., Bio-Rad.

3. Methods 3.1. Enzymatic Amplification of the Antithrombin Gene 1. Amplification reactions are carried out in 100 μL volumes and comprise: 10 μL 10X PCR buffer, 6 μL 25 mM MgCl2 (final concentration of Mg 1.5 mM; see Note 5), 1 μL 20 mM dNTPs (final concentration 200 μM), 100–500 ng DNA, 2 μL amplification primers (100 pmoles of each primer) and water to 100 μL. Add 2 U of Amplitaq to each tube (0.4 μL) and overlay with 100 μL of mineral oil. 2. Place the samples in a programable heating block and denature at 94°C for 5 min and then carry out the amplification reaction using the parameters shown in Table 1. 3. At the end of the amplification reaction, remove the mineral oil and run 5–10 μL of the PCR product in a 1.5% agarose gel containing ethidium bromide 0.5 μg/mL in 1X TBE to check the efficiency and specificity of the reaction.

3.2. Purification of Biotinylated PCR Products and Preparation of Single-Stranded DNA Template 1. Resuspend the magnetic beads by vortexing, remove 20 μL into a 1.5-mL Eppendorf and place in the magnetic separation unit for 30 s. Scale up the volumes depending on how many templates are to be prepared. 2. Carefully remove the supernatant and add 50 μL of 1X BWB to the beads. Vortex for 2–3 s to mix and then place in the magnet for 30 s. Remove the supernatant and add 50 μL of 2X BWB. Vortex briefly to mix. 3. Add the resuspended beads to 50 μL of the PCR reaction and place on an orbital rotator for 15–20 min at room temperature. 4. Place the Eppendorf in the magnet for 30 s and remove the supernatant. 5. Add 10 μL of freshly made 0.1 M NaOH and vortex briefly to mix, then leave on the bench for 15 min without shaking.

228

Perry

6. Place the Eppendorf in the magnet for 30 s, remove the supernatant and transfer to a clean tube. 7. Add 100 μL of 0.1 M NaOH to the beads, vortex briefly, place in the magnetic separation unit for 30 s. 8. Add 100 μL of 1X BWB to the beads. Vortex briefly to mix and then place the Eppendorf in the magnet for 30 s. Carefully remove the supernatant and discard. 9. Repeat the step 8 but using 100 μL of TE, pH 8.0. 10. Finally resuspend the beads in 20 μL of sterile water. Store at 4° C. Do not freeze. Use 4–7μL for each sequencing reaction.

3.3. Solid-Phase Sequencing of Single-Stranded DNA 1. Mix 4–7 μL of the single-stranded DNA template, 2 μL of 5X reaction buffer, 1 μL (5–10 pmoles) of the sequencing primer and distilled water to 10 μL. 2. Heat to 60°C for 5 min and then cool to 30°C at 2°C/min to allow the primer to anneal to the template DNA. Briefly spin in a microcentrifuge to pellet any condensation and place on ice. 3. Aliquot 2.5 μL of each termination-reaction mix into a microtitre sequencing tray and store at 4°C until required. Pre-warm at 37°C for 5 min before use. 4. Prepare a “Master Mix” on ice for the number of templates to be sequenced and store on ice. The master mix comprises for 1 reaction: 1 μL 0.1 M DTT, 0.5 μL [α-35S]-dATP, 2 μL diluted dGTP labeling mix, and 2 μL of Sequenase v2 diluted “1 + 7” in ice-cold dilution buffer. 5. Add 5.5 μL of the master mix to each of the annealed template-primers on ice. Incubate at room temperature for 3–5 min. 6. Add 3.5 μL from step 3 to each of the termination mixes and place at 37°C for 5 min. 7. Add 4 μL of the formamide-dye stop mix to each well. 8. Denature the samples at 95°C for 3–5 min and then place on ice. Load 2–4 μL of each reaction from ice into the wells of a 6% denaturing polyacrylamide gel. Load lanes 1 and 2 with the same reaction to allow subsequent orientation of the gel. Electrophorese at 35 W constant power until the bromophenol dye has reached the end of the gel (or longer to obtain sequence data far from the sequencing primer). 9. Separate the gel plates, fix the gel in 2 L of fixing solution for 30 min and then transfer the gel to 3MM paper, cover with SaranWrap™ and dry under vacuum at 80°C. 10. Autoradiograph overnight.

4. Notes 1. DNA can be isolated from peripheral blood leukocytes using a wide variety of methods. 2. Do not remove Sequenase from the freezer; aliquots should be removed as required directly into the pre-chilled sequencing master mix. 3. The precise dilution varies upon how close to, or how far from the sequencing primer sequence data is required. To read close to the primer increase the dilution, e.g., 1 + 9 or 1 + 14, 1 + 19. To read further from the primer, use the labeling mix undiluted.

Antithrombin Deficiency

229

4. The termination mixes are supplied with kit and contain each deoxynucleotide at a concentration of 80 μM and each dideoxynucleotide (which terminates the extension reaction) at a concentration of 8 μM. There is, therefore a 1 in 10 chance of incorporating a dideoxynucleotide nucleotide and terminating the extension reaction. The termination mixes comprise: ddA: 80 μM dGTP, 80 μM dATP, 80 μM dCTP, 80 μM dTTP, 8 μM ddATP, 50 mM NaCl. ddC: 80 μM dGTP, 80 μM dATP, 80 μM dCTP, 80 μM dTTP, 8 μM ddCTP, 50 mM NaCl. ddG: 80 μM dGTP, 80 μM dATP, 80 μM dCTP, 80 μM dTTP, 8 μM ddGTP, 50 mM NaCl ddT 80 μM dGTP, 80 μM dATP, 80 μM dCTP, 80 μM dTTP, 8 μM ddTTP, 50 mM NaCl. 5. The concentration of Mg in the PCR reaction may vary and titration may be necessary to find the optimal concentration for a particular set of primers and template. In practise a final concentration of 1.5 mM Mg will amplify the majority of templates.

References 1. Perry, D. J. (1994) Antithrombin and its inherited deficiencies. Blood Rev. 8, 37–55. 2. Perry, D. J. and Carrell, R. W. (1996) Molecular genetics of human antithrombin deficiency. Human Mutation 7, 7–22. 3. Lane, D. A., Olds, R. J., Boisclair, V., Chowdhury, V., Thein, S. L., Cooper, D. N., Blajchman, M., Perry, D. J., Emmerich, J., and Aiach, M. (1993) Antithrombin III mutation database: first update. Thromb. Haemostasis 70(2), 361–369.

Ectopic Transcript Analysis

231

23 Ectopic Transcript Analysis in Human Antithrombin Deficiency David J. Perry 1. Introduction A number of reports have demonstrated that it is possible to identify correctly spliced low-level transcripts for tissue-specific genes in a number of non-specific tissues (1–3). The number of transcripts is low (approx 1 copy every 500–1000 cells) (2), but as they are initiated at the normal mRNA start site this suggests that the normal promoters are used. Although ectopic transcript analysis has been used primarily in the study of large and complex genes, e.g., factor VIII, or for the study of splice-site mutations, the relative ease with which the technique can be adapted to the study of a variety of smaller genes and their mutations makes its use attractive for the study of a variety of inherited disorders. A limitation of the described method is that it will not detect mutations in the 3' and 5' untranslated regions of the gene and these areas will require analysis by conventional DNA-based techniques. The methods described in this chapter are used to identify ectopic transcripts of the human antithrombin gene, a gene normally expressed only in the liver. These transcripts can then be screened for mutations by a variety of techniques, cloned, or directly sequenced. The technique is, however, applicable to the study of many other genes, the only changes required are in the sequences of the oligonucleotide primers. To achieve maximum amplification, the technique requires two pairs of nested amplification primers although the primers may overlap. This may be useful when the amount of sequence data that is available is limited. Because the of small amount of the starting template and the two rounds of PCR, the technique is extremely sensitive to any contamination and it is vital to include appropriate negative controls. Similarly, it is wise to avoid clones or libraries that From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ

231

232

Perry

contain the sequence of interest from areas of the laboratory that are be used to make up the amplification reactions, to use only dedicated reagents and pipets and aerosol resistant pipet tips. In addition, in the early parts of the procedure that employ RNA, it is vital to avoid contamination with RNases. 2. Materials 2.1. Isolation of Mononuclear Cells from Peripheral Blood 1. 3.5% Trisodium citrate. 2. Histopaque 1077 (Sigma). 3. PBS: Phosphate-buffered saline.

2.2. Isolation of Total Cellular RNA A number of methods are available for the isolation of total cellular RNA from peripheral blood mononuclear cells. Great success has been achieved using the method of Chomczynski et al. (4), but there are now a number of commercially available kits which considerably simplify the isolation of RNA, e.g., the RNeasy™ kit (Qiagen Ltd. UK). 2.3. Reverse Transcription and Amplification 1. Total cellular RNA: 150–500 ng. 2. 20 mM dNTPs; Prepared from 100 mM stocks and kept exclusively for reverse transcription work. 3. 10X PCR buffer: 100 mM Tris-HCl, pH 8.3 and 500 mM KCl. 4. 25 mM MgCl2. 5. DEPC-treated water (see Note 1). 6. RNAsin: 20 U/μL (Promega Biotechnology, Southampton, UK). 7. AMV reverse transcriptase, e.g., Super RT® HT Biotechnology, Cambridge. 8. Downstream amplification primer at 50 pmoles/μL (see Note 2). 9. Sterile, aerosol resistant pipette tips, e.g., ART® (Molecular Bio-Products Inc., San Diego, CA).

3. Methods 3.1. Isolation of Mononuclear Cells from Peripheral Blood 1. Collect blood into 3.8% trisodium citrate in a ratio of 1 part anticoagulant to nine parts blood. 2. Dilute 10 mL of whole blood with an equal column of PBS and carefully layer onto 10 mL of histopaque 1077 in a 30-mL sterile conical tube. 3. Centrifuge at 2000g for 10 min at 20°C and then carefully remove the tubes from the centrifuge without disturbing the cellular interface. The interface should be clearly visible. 4. Carefully collect the interface, which comprises the mononuclear fraction, using a 5-mL Pasteur pipet. Transfer to a clean 30-mL tube.

Ectopic Transcript Analysis

233

5. Make up to 30 mL with ice-cold PBS. Mix briefly and spin at 2000g for 10 min at 20°C. 6. Carefully pour off the supernatant. Store the pellet on ice if RNA isolation is to be carried out immediately. Alternatively snap freeze and store at –80°C until required.

3.2. Isolation of Total Cellular RNA Depending on which method is used to isolate RNA, the final volume may vary. With the method of Chomczynski et al., the total cellular RNA pellet is resuspended in 200 μL of DEPC-treated water containing 20 U of an RNA inhibitor, RNAsin. For long-term storage, RNA samples are precipitated with ethanol and stored at –70°C. If RNA is isolated using the RNeasy Kit, the RNA is eluted into a final volume of 50 μL.

3.3. Reverse Transcription and Amplification Nested oligonucleotide primers are designed to amplify the whole of the antithrombin cDNA in two overlapping fragments (see Fig. 1, Table 1). For each reverse transcription reaction mix the final volume should be 20 μL. The reaction volumes should, therefore, be calculated before setting up the reactions. 1. Prepare a “Master Mix” comprising appropriate volumes of 20 mM dNTPs, 10X PCR buffer and 25 mM MgCl2 on ice. UV irradiate (254 nm) for 10 min to eliminate any contaminating DNA. For a single reverse transcription reaction the volumes are: 4 μL 25 mM MgCl2, 1 μL 20 mM dNTPs, and 2 μL 10X PCR buffer. 2. Mix 100–500 ng of total cellular with 50 pmoles of the appropriate downstream amplification primer (AT2 or AT4: see Fig. 1, Table 1), 7 μL of the UV-irradiated master mix on ice and DEPC-treated sterile water to 18 μL. 3. Incubate at 65°C for 10 min, place on ice and add 1 μL (20 U) of RNAsin and 20 U of AMV reverse transcriptase. 4. Incubate at 20°C for 10 min, 37°C for 60 min, and then terminate the reaction by heating to 95°C for 10 min. Store sample on ice until required or frozen at –30°C. 5. A positive control should be included in the reverse transcription reaction (see Note 3). 6. To each 20 μL reverse transcription reaction, add an 80 μL reaction mix comprising: 8 μL 10X PCR buffer, 2 μL 25 mM MgCl2, 1 μL 20 mM dNTPs, 100 pmoles of each of the first pair of amplification primers (pairs AT1 + AT2 or AT3 + AT4: Fig. 1, Table 1) and sterile water to 80 μL. 7. Incubate at 100°C for 5 min and then allow to cool to 30°C for 2 min to allow the primers to anneal. 8. Add 2.5 U (0.5 μL) of Thermus aquaticus. DNA polymerase (“Amplitaq”) to each tube and overlay the samples with 100 μL of mineral oil. 9. Incubate the samples at 70°C for 10 min followed by 40 cycles of PCR comprising 94°C for 20 s, 50°C for 20 s, and 72°C for 60 s using a programmable heating block. On the last cycle the extension time should be increased to 10 min.

234

Perry

Fig. 1. Schematic representation of the antithrombin cDNA showing the position and orientation of the amplification primers. 10. After the first PCR is completed, run 10 μL of each amplification on a 1.5% agarose gel in 1X Tris-Borate-EDTA (TBE) containing ethidium bromide (0.5 μg/mL) to check the efficiency and specificity of the reaction. It is probable that only the GAP-DH positive controls will amplify (see Fig. 2). 11. If the amplification reaction is satisfactory, add 1 μL of the PCR reaction to a 98.5 μL mix comprising 10 μL 10X PCR buffer, 6 μL 25 mM MgCl2, 100 pmoles of each of the second set of amplification primers (pairs AT5 + AT6 or AT7 + AT8: Fig. 1, Table 1; see Note 4), 1 μL 20 mM dNTPs and water to 98.5 μL. We do not use a positive control at this step but a negative control, i.e., a water blank must be included in the amplification reaction. 12. Denature the DNA by heating to 100°C for 5 min and then cool to 94°C. Briefly spin to pellet any condensation and return to the PCR block. 13. Add 2.5 U of Amplitaq to each tube, overlay the samples with 100 μL of mineral oil and carry out 40 cycles of amplification using an identical programme to that used for the first round of PCR. 14. Following the second round of amplification run 7–10 μL of each amplification reaction on a 1.5% agarose gel containing ethidium bromide 0.5 μg/mL in 1X TBE to check the efficiency and specificity of the reaction (see Fig. 2).

4. Notes 1. To make DEPC-treated water add 1 mL of DEPC to 1 L of distilled water. Incubate at 37°C overnight and then autoclave. Store at room temperature.

235

TTCAGGCGGATTGCCTCAGATCACAC AAGTAAATGGTGTTAACCAG

ACCGAAGGCCGAATCACCGAT AATGTGAGATGGAAGTAGTT CAGCCCTGTGGAAGATTAGC Biotin-TGTTAACCAGCACCAGAACA ACCGATGTCATTCCCTCG Biotin-TTACTTCTGTTCACAAACCAAAAATA ATGGGGATGGTGAAGGTCGGTGTCAA GGGGCCATCCACAGTCTTCTGGGTGG

Forward primer Reverse primer Forward primer Reverse primer Forward primer Reverse primer Forward primer Reverse primer

Primer sequences (5'→3')

Forward primer Reverse primer

Orientation

bmRNA

antithrombin cDNA is amplified in two overlapping fragments. start site = +1. cAlso used as the reverse transcription primer.

aThe

AT cDNA I PCR–1 AT1 AT2c AT cDNA II PCR–1 AT3 AT4c AT cDNA I PCR–2 AT5 AT6 AT cDNA II PCR-2 AT7 AT8 GAP-DH cDNA PCR–1 GAP-1 GAP-2b

Primers

316–341 3091–3116

7030–7047 13,979–1400

581–600 7068–7087

7015–7035 14,016–14,035

541–566 7078–7097

540 bp

758 bp

772 bp

804 bp

822 bp

Sequence positionb Product length

Table 1 Primer Sequences for Reverse Transcription and Amplification of the Antithrombin/GAP-DH cDNAsa

Ectopic Transcript Analysis

235

236

Perry

Fig. 2. 1% agarose gel showing the antithrombin cDNA and glyceraldehyde-3-phosphate dehydrogenase cDNA amplification products. Lanes 1–3 are amplifications of a normal control RNA, lanes 4–6 represent the amplified cDNA derived from a patient with a 6 bp deletion (codons 76/77) of exon 2 of the antithrombin gene and lanes 7–9 the amplified cDNA from a patient with a dysfunctional antithrombin variant (Ile284Asn). Lanes 1, 4, and 7 are positive controls (part of the GAP-DH cDNA); lanes 2, 5, and 8 are amplifications of the antithrombin cDNA I and lanes 3, 6, and 9 are amplifications of the antithrombin cDNA II. PCR-1 represents the amplification products after the first round of PCR and PCR-2, the products after the second round of PCR using a separate set of nested primers. M; 1-kb ladder.

2. Reverse transcription of RNA using the downstream amplification primer used subsequently for the PCR is routinely used and generates excellent results for a wide variety of templates. However, Oligo(dT)15–17 (50 pmoles) can also be used with similar results. 3. A positive control for the RNA isolation, reverse transcription and amplification reactions should be included. The glyceraldehyde-3-phosphate dehydrogenase (GAP-DH) gene, a common housekeeping gene is frequently used. Oligonucleotides are designed to amplify a 540-bp fragment of the GAP-DH cDNA spanning 6 introns and representing approx 2.8-kb of genomic sequence (5). The downstream primer is used to prime the reverse transcription reaction (see Table 1). 4. Primers AT6 and AT8 can biotinylated at their 5' ends to allow the subsequent generation of high-quality single-stranded DNA suitable for sequencing.

References 1. Chelly, J., Concordet, J. P., Kaplan, J. C., and Kahn, A. (1989) Illegitimate transcription: transcription of any gene in any cell type. Proc. Natl. Acad. Sci. USA 86, 2617–21.

Ectopic Transcript Analysis

237

2. Kaplan, J. C., Kahn, A., and Chelly, J. (1992) Illegitimate transcription: its use in the study of inherited disease. Human Mutation 1, 357–360. 3. Sarkar, G. and Sommer, S. S. (1989) Access to a messenger RNA sequence or its protein product is not limited by tissue or species specificity. Science 244, 331–334. 4. Chomczynski, P. and Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156–159. 5. Ercolani, L., Florence, B., Denaro, M., and Alexander, M. (1988) Isolation and complete sequence of a functional human glyceraldehyde-3-phosphate dehydrogenase gene. J. Biologic. Chem. 263, 15,335–15,341.

Human Protein C Gene

239

24 Mutational Analysis of the Human Protein C Gene Roger Luddington 1. Introduction The single gene for protein C is located at position q13-q14 on chromosome 2 (1). Two groups have described human genomic clones of protein C isolated from phage l charon libraries using cDNA for human protein C as hybridization probes (2,3). The gene is approximately 11 kb long and is composed of 9 exons and 8 introns. In common with factors VII, IX and X the exons encode specific structural domains of the protein C molecule. Exon 1 encodes the 5' untranslated region, exon 2 encodes the signal peptide and 6 amino acids of the propeptide, exon 3 encodes the remainder of the propeptide and the Gla domain (residues 1–45), exon 4 encodes the connecting segment between the Gla domain and the first EGF-like domain, exons 5 and 6 encode for the EGF-like domains (residues 49–91 and 92–137), exon 7 encodes the activation peptide (residues 157–169), the C-terminus of the light chain and the first 29 amino acids of the heavy chain. Exons 8 and 9 encode the remaining heavy chain sequence. Following the first description of the polymerase chain reaction at the 51st Symposium on Quantitative Biology, Cold Spring Harbor (1986) it has become a fundamental part of molecular biology and has moved from the research field into routine clinical laboratory investigation. PCR amplification allows us to produce a large quantity of a specific region of DNA. Single-stranded DNA templates are produced by heating double-stranded DNA to near boiling (see Note 1). Oligonucleotide primer pairs are designed such that they anneal to areas of the separated strands of DNA flanking the required region (see Note 2). DNA Polymerase will synthesize new complementary strands of DNA starting from From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ

239

240

Luddington

the “primed” region (see Note 3). Each new strand is synthesized such that it extends beyond the position of the primer on the opposite strand, thus generating new primer binding sites. The reaction mixture is again heated and the process repeated. Theoretically following n cycles of PCR 2n copies of the original area of double-stranded DNA will be produced. DNA synthesis like other biochemical processes in nature is not perfect. It is reasonable to assume that up to 1/1000 nucleotides could be mis-incorporated by DNA polymerase. However, with an abundance of template the impact of this upon the final product can be considered negligible. The use of PCR amplification offers an alternative to cloned product as a basis for DNA sequencing. This approach has been applied here to protein C. Oligonucleotide primer pairs were selected to enable the amplification of the coding regions of the PROC gene. This PCR product then being used as the template for DNA sequencing reactions. A database of mutations within the PROC gene is regularly updated (4). 2. Materials 2.1. DNA Extraction 1. Cell lysis buffer: 0.3 2 M sucrose, 1% Triton X100 (w/v), 5 mM magnesium chloride, 10 mM Tris-HCl, pH 8.0. 2. TE buffer: 10 mM Tris-HCl, pH 8.0, 1 mM EDTA. 3. Nuclear lysis buffer: 2% lithium dodecyl sulfate (w/v), 0.32 M lithium acetate, 10 mM Tris-HCl, 1 mM disodium EDTA, pH 8.0. 4. Buffered phenol: store under 0.1 M Tris-HCl, pH 8.0. 5. Chloroform. 6. Absolute alcohol.

2.2. PCR Reactions 1. PCR primers (see Table 1). 2. 10X PCR buffer A: 0.1 M Tris-HCl, pH 8.3, 0.5 M KCl, 1% Triton X100 (w/v), 15 mM MgCl2. Store at –20°C. 3. 10X PCR buffer B: 166 mM (NH4)2SO4, 0.67 M Tris-HCl, pH 8.8, 0.67 mM Na2EDTA, 25 mM MgCl2 (see Note 4). 4. DMSO. 5. β Mercaptoethanol. 6. Bovine serum albumin (BSA). 7. dNTP mix: A mixture containing 200 mmoles of each dNTP. 8. Mineral oil. (If not using thermocycler with heated lid). 9. Thermostable DNA polymerase. 10. Agarose gels: 1% electrophoresis grade agarose in TBE (10X TBE: 121 g Tris, 55 g orthoboric acid, 7.4 g EDTA/L).

TAGCACTGCCCGGAGCTCAGAAGT GCAGATGCCACCAGGGCCTTGTAG CTCATGGCCCCAGCCCCTCTTAGGCC CTGGTTACCAGCTCGCCCCTGAGCCT CTGGTGCTGGTGCCGCGCCCCCAA TCCGCACACCGGCTGCAGGAGCCTGA CGGCATCGGCAGCTTCAGCTGCGA CTCCCTAGAAACCCTCCTGAGCCC GACCAAGACAGGAGGGCAGTCTCGGG CTGCCAGGATGGACTCAGTGATCCCG AAACCCAGGTGCCCTGGACTGGAGGC AGCCTCTGGCAGCCCCCTTCTGCCTG AAACCCAGGTGCCCTGGACTGGAGGC GCCGGTGTGCTTGTTACATGTCCCTT GGCCTCAGGAAAGTGCCACT (5) GCCGGTGTGCTTGTTACATGTCCCTT

2

241

9

8/9

8

7

6

4/5

3

Primer sequences (5'–3')

Exon

Promega

Promega

Promega

Promega

Amplitaq

Amplitaq

Promega

Promega

DNA polymerase

A

A

A

A

B

B

A

A

Reaction buffer

735

1978

229

277

393

358

279

165

GeneClean®

GeneClean®

Sodium acetate

Sodium acetate

Sodium acetate

Sodium acetate

Sodium acetate

Sodium acetate

Product size (bp) Purification method

Table 1 Protein C Primer Sequences, DNA Polymerase, and Method of Product Purification

Human Protein C Gene

241

242

Luddington

2.3. Purification of PCR Products The method of purification is dependent upon the size of the exon being studied (see Table 1). 1. 2. 3. 4.

7.5 M sodium acetate. Absolute alcohol. 80% Alcohol. Geneclean II® kit (BIO 101 Inc., CA).

2.4. 32P Sequencing The sequencing protocol is used Sequenase v2 and the various reagents supplied with the sequencing kit. 1. 10X T4 polynucleotide kinase buffer (PNK) buffer: 0.5 M Tris-HCl, pH 7.6, 0.1 M MgCl2, 50 mM dithiothreitol, 1 mM spermidine, 1 mM EDTA. 2. 5X Sequenase buffer: 200 mM Tris-HCl, pH 7.5, 100 mM MgCl2, 250 mM NaCl. 3. BSA: 0.5 mg/mL. 4. Enzyme dilution buffer: 10 mM Tris-HCl, pH 7.5, 5 mM DTT, 0.5 mg/mL BSA. 5. Sequencing primers 6. T4 polynucleotide kinase 7. [γ-32P]dATP 8. Termination mixtures (ddATP, ddCTP, ddGTP, ddTTP) 9. Stop mixture: 95% formamide, 20 mM EDTA, 0.05% bromophenol blue, 0.05% xylene cyanol FF. 10. Urea. 11. 10X TBE. 12. 40% Acrylamide/bisacrylamide (ratio 19:1). 13. TEMED. 14. 25% Ammonium persulfate: prepare immediately before use.

3. Methods 3.1. DNA Extraction 1. To the buffy coat from a 5 mL citrated blood sample add 45 mL of cell lysis buffer and incubate on ice for 20 min. 2. Centrifuge the lysed cells at 4°C for 15 min at 1000g. Carefully remove the supernatant and resuspend the pellet in 5 mL of sterile TE buffer. 3. Add 10 mL of nuclear lysis buffer to each tube and rotate on an orbital mixer for 30 min until no cellular clumps are visible (see Note 5). 4. Add 5 mL of buffered phenol and rotate for 5 min. Add 5 mLof chloroform rotate for a further 5 min. Centrifuge at 1000g for 10 min at 4°C to separate the phases. Remove the upper aqueous layer to a clean tube and add another 5 mL of chloroform. Repeat the rotation and centrifugation steps and remove the aqueous phase again to a clean tube. 5. Precipitate the DNA by adding of 2.5 vol of absolute alcohol and gradually rotate the tubes. As the phases mix the DNA becomes visible. Collect the DNA onto a

Human Protein C Gene

243

sealed sterile Pasteur pipet and gently remove the excess alcohol. Transfer the DNA in to 500 μL of distilled water and leave at 4°C for 48 h to go into solution 6. Calculate the DNA concentration by measuring the optical density of the DNA containing solution at 260 nm (OD260). For double-stranded DNA 1 OD260 = 50 mg DNA. Therefore [DNA]mg in 1 mL = OD260 × dilution × 50. In addition calculate the optical density at 280 nm (OD280) is measured to assess the purity of the sample. OD260/OD280 should be >1.8.

3.2. PCR Amplification 1. All reaction mixtures are made up in a final volume of 100 μL with sterile distilled water. 2. Depending upon the exon being amplified (see Note 6) one of two reaction buffers is used (see Table 2). Reaction buffer A: 1 μg DNA, 10 μL 10X PCR buffer A, 100 pmols of each amplification primer, 200 μmols of each dNTP 2 U of Promega DNA polymerase (added immediately prior to amplification). Reaction buffer B: 1 μg DNA, 10 μL 10X PCR buffer B, 16 μg BSA, 10 mM β-mercaptoethanol, 10% DMSO, 100 pmols of each amplification primer, 200 μmols of each dNTP, 2 U Amplitaq® DNA polymerase (added immediately prior to PCR). 3. Overlay the reaction mixtures with light mineral oil to prevent evaporation. 4. Carry out 35 cycles using the conditions shown in Table 3. A final 10-min incubation at 74°C is incorporated to ensure maximum double-stranded product. 5. 10 μL of each reaction may be run on a submarine minigel containing 1% agarose gel incorporating 0.5 μL/mL ethidium bromide in TBE.

3.3. Purification of PCR Products 3.3.1. Sodium Acetate Precipitation Add 50 μL of 7.5 M sodium acetate to a single 100 μL PCR reaction. Follow this by 150 μL of absolute ethanol and incubate the mixture at 20°C for 5 min. Centrifuge the tube at 10,000g for 10 min and discard the supernatant. Wash the pellet (see Note 7) by adding 500 μL of 80% ethanol followed by a vortex mix and centrifugation at 10,000g for 10 min. 5. Remove the supernatant and allow the pellet to dry at 37°C. The pellet is then resuspended in 20 μL of sterile distilled water. 1. 2. 3. 4.

3.3.2. Geneclean II®(BIO 101 Inc., CA) The Geneclean II® kit is designed for the purification of DNA fragments of 500 bp and above. Thus, the use of this kit is only applicable to the purification of the exon 9 fragment 1. To a single 100 μL PCR reaction, 300 μL of 6 M sodium iodide and 10 μL of “Glassmilk®” (a suspension of silica matrix in water) is added. This is mixed by orbital rotation at 4°C for 20 min followed by centrifugation at 10,000g for 5 s.

244

Luddington

Table 2 Reaction Conditions for the Amplification of the Protein C Gene Exon 2 3 4/5 6 7 8 8/9 9 a5

Annealing temperature

Time

Extension temperature

Time

Denaturation temperature

Time

55°C 57°C 65°C 60°C 50°C 60°C 60°C 55°C

20 s 20 s 20 s 20 s 20 s 20 s 10 s 20 s

74°C 74°C 74°C 74°C 74°C 74°C 74°C 74°C

20 s 30 s 20 s 20 s 30 s 30 s 150 sa 20 s

94°C 94°C 94°C 94°C 94°C 94°C 94°C 94°C

20 s 20 s 20 s 20 s 20 s 20 s 20 s 20 s

s were added per cycle.

Table 3 Conditions Used for Sequencing of the Protein C Exons Exon

Sequencing primer (5'–3')

Gel type

Run time, V/h

2 3 4/5 6

GCTCAGAAGTCCTCCTCAGA CACCAAGGTGAGCTCCCC GACGCTGCCCGCTCTCTCCG CCACCCCGCACCCAGCGTGA (5) TTGGGGGCGCGGCACCAGCA (5) TGCCTGGCAGGCCCCTCACC GCAGCCCTGTGATGTCATCA CCGTGGAAGGAGGCGACCAT CCAGCCCGTCACGAGGGTCT TCCATTGCCATGCAAAAGCC

Standard Wedge Standard Standard Standard Wedge Standard Standard Standard Standard

3400 5100 3600 and 6200 3200 3300 5000 3800 3500 3200 3800

7 8 9

2. Discard the supernatant and wash the pellet twice with “New Wash®” (a Trisbuffered NaCl, ethanol, water solution, pH range 7.0–8.5). Each wash step consists of 750 μL “New Wash®”, a vortex mix and 5 s centrifugation at 10,000g. The supernatant is discarded each time. 3. Following the second wash, add 20 μL of distilled water to the pellet and vortex mix. 4. This is incubated at 55°C for 5 min, followed by centrifugation at 10,000g for 60 s. The supernatant containing the eluted DNA is retained. 5. Repeat the elution step and pool the two aliquots. A 5-μL aliquot of the genecleaned product is then checked for purity on a submarine minigel containing 1% agarose gel incorporating 0.5 μg/mL ethidium bromide in 1X TBE.

Human Protein C Gene

245

3.4. DNA Sequencing 3.4.1. End-Labeling Sequencing Primer 32P 25 pmoles sequencing primer are required for each end-labeling reaction. 1. Combine 1.5 μL 10X T4 PNK buffer, 0.5 μL BSA, 25 pmols of the sequencing primer (see Note 8), 1.0 μL (10 U) T4 polynucleotide kinase, 7.5 μL [γ-32P]dATP (370 MBq/mL), distilled water to 15 μL. Incubate at 37°C for 60 min and then for 15 min at 85°C. The labeled primer is then briefly spun at 10,000g and stored at –20°C or below.

3.4.2. Sequencing Reactions For each set of four sequencing lanes a single annealing and subsequent labeling reaction (the Sequenase reaction mixture) is required. 1. To a 1.5-mL Eppendorf tube add 1 μg of purified amplified DNA in a total volume of 7 μL, 2 μL of 5X Sequenase buffer and 1 μL of 32P-labeled primer. 2. Denature at 100°C for 5 min, followed by a pulse centrifugation at 10,000g to pellet any condensation. Incubate for a further 2 min at 100°C, then immediately transfer to liquid nitrogen. 3. Remove the samples from the liquid nitrogen and allow to thaw at 20°C. Place on ice. 4. Following a pulse centrifugation at 10,000g, to each annealed template-primer, add 1 μL 0.1 M DTT and 2.5 μL distilled water, 2 μL of Sequenase® (diluted 1 + 7 in enzyme dilution buffer on ice. 5. Termination reactions are carried out in microtiter sequencing plates. Add 2.5 μL of each termination mix (ddATP, ddCTP, ddGTP, and ddTTP) to wells labeled “A, C, G, and T”. 6. Add 3.5 μL of template-primer-Sequenase mixture to each of the four lanes and incubate the plate for 5 min at 37°C. 7. Stop the reaction by the adding 4 μL of stop mixture to each well. 8. Heat the plate to 80°C for 5 min to denature the DNA (see Note 9) and then place on ice prior to loading samples onto the sequencing gel.

3.4.3. Denaturing Polyacrylamide Gel Electrophoresis. 1. Clean two 20 × 50 cm glass plates using detergent followed by a rinse in deionised water and an alcohol wipe. 2. Apply a silicone coating to one plate to prevent gel adhesion. 3. Place spacers of 0.2 mm (0.2 mm increasing to 0.5 mm for wedge gels) thickness between the plates and seal the sides and base with Scotch™ electrical tape. 4. Prepare a gel mix using; 42 g of Urea, 10 mL of 10X TBE, 15 mL of 40% acrylamide/bisacrylamide (Ratio 19:1) and make up to 100 mL with sterile distilled water. Microwave on high power for 10 s and then stir at 20°C until the urea is completely dissolved. 5. Filter the mixture through a 0.45-mm syringe-end filter.

246

Luddington

6. Add 135 μL of TEMED and 135 μL of fresh 25% ammonium persulfate. The gel mix is then poured immediately between the assembled plates suing a 50-mL syringe. 7. Clamp a 20-well comb into the open end of the assembly and leave the gel for at least 2 h or overnight to polymerize. 8. Remove the tape from the base of the assembly and fix the gel into the vertical electrophoresis apparatus. Fill the buffer reservoirs with 1X TBE. 9. Pre-run the gel at 35W for 30 min prior to the loading 3 μL of the denatured sequencing reactions. Carry out electrophoresis for the appropriate period of time (see Table 3). 10. Following electrophoresis, separate the gel plates and fix the gel in 5% methanol/ 5% acetic acid. Transfer to a sheet of 3MM paper and dry the gel under vacuum at 80°C for 1–2 h. Expose with X-ray film for 24–48 h.

4. Notes 1. It is important to ensure complete strand separation during the denaturation cycle of PCR. This requires a minimum denaturation temperature of 94°C. As the polymerase activity of the enzyme is lost during prolonged exposure to these temperatures it was important to ensure complete denaturation, but retain sufficient polymerase activity within the reaction mixture. 2. The primers for the PCR reactions were carefully selected. Where possible a random base distribution with a CG content similar to that of the target fragment was selected. Primers pairs that were capable of forming “primer-dimers” were avoided. 3. Polymerase mediated DNA synthesis occurs maximally between 65°C and 75°C. With the activity of Taq polymerase approximately doubling between 65°C and 74°C an extension temperature of 74°C was used. 4. Variations in Mg2+ concentration within a PCR reaction mix will affect the specificity and yield. Excess Mg2+ results in the production of nonspecific amplification whereas insufficient Mg2+ will reduce the product yield. 5. At this stage a successful extraction could be predicted by a marked increase in viscosity 6. Problems were encountered with the amplification of exons 4/5 and 6. These were resolved by the incorporation of β-mercaptoethanol and Dimethylsulfoxide to reduce secondary structure of the target DNA. 7. The term “pellet” should not cause concern when you see only a spec at the base of your Eppendorf tube. Dry and resuspend as described, run a 2-μL aliquot on a minigel to check product. 8. The concentration of the sequencing primer is calculated using the formula. Conc μM = [OD260 × diln. × 40(1 OD260 = 40 μg single-stranded DNA) × 10-3 309 (mean weight of nucleotides) × 20 (mer)] 9. To heat the microtiter plate, use an incubator or place the plate on the head of the PCR thermocycler rather than risk loosing your reaction mixtures in a water bath.

Human Protein C Gene

247

References 1. Patracchini, P., Aiello, V., Palazzi, P., Calzolari, E., and Bernardi, F. (1989) Sublocalization of the human protein C gene on chromosome 2q13-1q14. Human Genetics 81, 191–195. 2. Beckmann, R. J., Schmidt, R. J., Sonterre, R. F., Plutzky, J., Crabtree, G. R., and Long, G. L. (1985) The structure and evolution of a 461 amino acid human protein C precursor and its messenger RNA, based upon the DNA sequence of cloned human liver cDNAs. Nucleic Acids Res. 13, 5233–5247. 3. Foster, D. C., Yoshitake, S., and Davie, E. W. (1984) Characterisation of cDNA coding for human protein C. Proc. Natl. Acad. Sci USA 81, 4766–4770. 4. Reitsma, P. H., Bernardi, F., Doig, R. G., Gandrille, S., Greengard, J. S., Ireland, H., et al. (1995) Protein C deficiency: a database of mutations, 1995 update. On behalf of the Subcommittee on Plasma Coagulation Inhibitors of the Scientific and Standardisation Committee of the ISTH. Thromb. Haemostasis 73, 876–889. 5. Reitsma, P. H., Poort, S. R., Allaart, C. F., Briet, E., and Bertina, R. M. (1991) The spectrum of genetic defects in a panel of 40 Dutch families with the symptomatic protein C deficiency type I: heterogeneity and founder effects. Blood 78, 890–894.

Protein S Gene

249

25 Analysis of the Protein S Gene in Protein S Deficiency Núria Sala and Yolanda Espinosa-Parrilla 1. Introduction Protein S (PS) is a 71-kDa vitamin K-dependent glycoprotein first identified in human plasma by DiScipio and colleagues in 1977 (1), a year after the discovery of the anticoagulant protein C (PC) (2,3). A few years later, Walker demonstrated that PS acts as a cofactor for activated protein C (APC) in the proteolytic inactivation of the procoagulant factors Va and VIIIa (4,5) and in 1984, the first families with hereditary PS deficiency and venous thrombotic disease were identified (6,7). This demonstrated the physiological importance of PS as an antithrombotic protein, which has been further confirmed by the identification of many other families in which the heterozygotes for PS deficiency have an increased risk of developing venous thrombosis in early adulthood (8–10). PS deficient homozygotes with severe thrombotic events and purpura fulminans in the neonatal period have also been described (11,12). Although the molecular mechanism by which PS enhances APC activity has not yet been completely elucidated (2,3), it has been proposed that PS increases the affinity of APC for the phospholipid membranes where the inactivation complex will form and the inactivation reactions take place (13). PS might also have APC independent anticoagulant properties through direct inhibition of prothrombin and factor X activation (14–16). PS is synthesized by the hepatocytes (17), endothelial cells (18,19), megacaryocytes (20), Leydig cells of human testis (21), and brain (22). Two highly homologous PS genes, approx 4 cM apart, have been characterized and mapped near the centromere of chromosome 3, at 3p11.1–3q11.2 (23–28). These are the active gene, PROS1 or PSα and a transcriptionally inactive pseudogene, PROS2 or PSβ (26–28). The PROS1 gene spans about 80 kb of From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ

249

250

Sala and Espinosa-Parrilla

genomic DNA and contains 15 exons that are transcribed in about 3.5 kb of mRNA. PROS2 spans about 50 kb of DNA and shares 96.5% homology with PROS1 in exon sequences and 95.4% in the intronic ones. It lacks exon 1 and contains several detrimental mutations. As deduced from the cDNA sequence (29,30), the precursor PS molecule contains 676 amino acids in 7 structural/ functional domains encoded by the different PROS1 exons (26–28,31). The signal peptide (residues –41 to –18) is encoded by the 3' end of exon 1. The propeptide (residues –17 to –1) is encoded by the 5' end of exon 2 and the amino-terminal γ-carboxyglutamic acid (Gla)-domain of the mature protein is encoded by the 3' end of exon 2. This domain is followed by a short helical stack (residues 38-45), encoded by exon 3, the thrombin sensitive region (residues 46-72), encoded by exon 4 and four epidermal growth factor (EGF)-like domains (residues 76–242), encoded by exons 5 to 8. The carboxy-terminal half of protein S (residues 243-635) is encoded by exons 9 to 14 and the 5'-end of exon 15. This domain is completely different from that of the other vitamin K-dependent proteins, being homologous to the sex hormone binding globulin (SHBG) though it does not bind steroid hormones (21). It contains two small disulphide loops, three potential N-linked glycosylation sites and two potential sites (residues 420-433 and 583-635) for interaction with the C4b-binding protein (C4BP) of human complement (32–34). The plasma concentration of PS is 20–25 mg/mL (260–330 nM) with a half life of 42 h (2). About 40% of PS circulates as free protein, whereas the remaining 60% forms a noncovalent 1:1 stoichiometric complex with the ßchain of the complement C4b-binding protein (C4BPβ+) (2,3). This interaction is of high affinity and abolishes the anticoagulant properties of PS. Therefore, in vivo, all C4BPß+ molecules circulate bound to PS and only the molar excess of PS over C4BPß+ circulates in a free form and is active as a cofactor of APC (35). PS deficiency is inherited as an autosomal dominant disorder present in approx 2–8% of families with hereditary thrombophilia (9,10,36). According to the plasma phenotype, three types of PS deficiency have been described (37). Type I or quantitative PS deficiency is characterized by reduced plasma levels of total and free PS antigen together with reduced anticoagulant activity. Type II PS deficiency, or type IIb according to Comp’s classification (38), is quite uncommon and is characterized by normal concentrations of both, total and free PS antigen, but low cofactor activity. Finally, in type III PS deficiency (or type IIa, according to Comp’s classification) free PS antigen and PS activity levels are reduced whereas total PS antigen levels are normal. The main problem with this classification and with the accurate diagnosis of PS deficiency is that biological variability, environmental factors, and the fairly poor reproducibility of the PS plasma assays (39,40), influence the plasma concen-

Protein S Gene

251

tration of PS causing diagnostic uncertainty due to the overlap existing between low normal PS levels and those present in confirmed heterozygotes for PS deficiency (8). In the last few years, more than 100 PROS1 mutations, most of them point mutations or short deletions or insertions, have been found associated with the PS deficient phenotype and are considered detrimental (31). However, most of these mutations have been published associated to type I or quantitative PS deficient pedigrees and only a few of them have been published to be associated to type III or free PS deficiency (41–43). In at least two families (43), the same mutation cosegregated with type I and type III PS deficient phenotypes coexisting in the same pedigree, which confirms that type I and type III PS deficiency may be phenotypic variants of the same genetic disease (44). On the other hand, Duchemin et al. in a French population (45) and our own group in a Spanish population (46), have found the Proline or PS Heerlen allele of the rare, and apparently neutral, S/P460 polymorphism in exon 13 of PROS1 (47), as the only sequence abnormality detected in several type III deficient probands. Nevertheless, despite this clear linkage disequilibrium between type III PS deficiency and the PS Heerlen allele, our group found absence of linkage between the type III deficient phenotype and the PROS1 and C4BP genes in some families carrying the PS Heerlen allele (46). From all these results it follows that while type I PS deficiency is essentially due to PROS1 allelic heterogeneity, the molecular basis of type III PS deficiency is still unclear. The analysis of the PS gene in patients suffering from inherited PS deficiency is necessary to identify the disease causing mutation. Once the mutation has been identified, it is generally a simple task to screen for its presence in the proband’s relatives in order to offer them an unambiguous diagnosis of their PS status. PROS1 gene analysis is also needed for a better understanding of the relationships between gene and protein structure and function, as well as for a better and more definite classification of the different types of PS deficiencies, based on their molecular basis. The protocols that follow are those we routinely use in our laboratory for the molecular analysis of PS deficiency. Two different approaches, depending on the deficiency type and the size and informativity of the family pedigree, are used. In the case of families with type III PS deficiency we have found it particularly useful to start with the analysis of the segregation patterns of two well known diallelic PROS1 intragenic polymorphisms, in order to confirm or exclude linkage of the deficient phenotype with PROS1 (46,48,49). The polymorphisms analysed are the uncommon serine to proline substitution at codon 460 (S/P460) in exon 13, which results in the PS Heerlen variant (47) and the presence of adenine or guanine at the codon for proline 626 (P626A/G), in exon 15 (50). The main problem with this analysis is that most families are

252

Sala and Espinosa-Parrilla

uninformative for the polymorphisms analysed. The recent description of two new diallelic polymorphisms, one in intron K or 11 and the other in the 3'-end of exon 15 (51), will most likely improve the informativity of this indirect genetic analysis (48,49). The description of multiallelic polymorphic markers of PROS1 would also be very helpful (49). The other approach used in all type I and type II deficient families and in those with type III PS deficiency where the PROS1 gene has not been excluded, is the direct analysis of all coding and intron flanking regions of the gene, by polymerase chain reaction (PCR) amplification of genomic DNA (52), single-strand conformation polymorphism (SSCP) analysis (53–55) and DNA sequencing (56). Other methods for PROS1 analysis, based on similar or different approaches, such us platelet mRNA analysis of the active gene or genomic DNA analysis through denaturing gradient gel electrophoresis, can be found elsewhere (41–43,57–60). 2. Materials Unless otherwise stated, all reagents are prepared in sterile double-distilled water.

2.1. PROS1 Amplification by PCR 1. Genomic DNA. Isolate by any well-standardized method. Dilute to 50 μg/mL in TE buffer 10/0.2 (10 mM Tris-HCl, 0.2 mM Na2EDTA-2H2O, pH 7.5). Store at 4°C. 2. 10 μM oligonucleotide amplification primers. Synthetic oligonucleotides of 20– 24 bases in length are diluted to 10 μM in sterile dH2O.Store frozen at –20°C in aliquots of 0.5-mL for PCR primers and 0.25 mL for sequencing primers (see Note 1; Table 1). Thawed aliquots are kept at 4°C if used in a short time. 3. 2 mM dNTP mix. Prepare a mixed deoxyribonucleoside triphosphate (dNTPs) solution from liquid stocks of 100 mM each dNTP (dATP, dTTP, dCTP, and dGTP, Pharmacia, Uppsala, Sweden). Dilute to 2 mM with sterile dH2O. Keep at –20°C in 0.5-mL aliquots. Thawed aliquots are kept at 4°C if used in a short time (10–15 d). 4. 10X PCR amplification buffer: 100 mM Tris-HCl pH 8.3, 500 mM KCl, 0.1% (w/v) gelatin (Sigma G-2500). Sterilize by autoclaving and store in 1-mL aliquots at –20°C. Thawed aliquots are kept at 4°C if used in a short time. 5. 0.1 M MgCl2. 6. Dimethyl sulfoxide (DMSO, Merck). 7. Taq DNA polymerase at 5 U/μL (we usually use that of Boehringer Mannheim, GmbH, Germany). 8. Mineral oil (Sigma M-3516). 9. Thermal cycler (we usually use Perkin-Elmer Cetus, model 480). 10. Agarose (Seakem Le, FMC BioProducts, Rockland, ME, USA). 11. TBE buffer 5X: 450 mM Tris-HCl, 440 mM boric acid, 9.5 mM Na2EDTA, pH 8.0. Store at room temperature.

Protein S Gene

253

Table 1 Nucleotide Sequences of the Primers used for the Amplification and Sequencing of PROS1 Exons and Intron-Flanking Regions, As Well As the 5' Upstream Region (5'up)a Oligo

Exon

Sequence

Position

Use

PS-Pro1a PS-Pro2a PS-1.1a PS-1.2 PS-2.1 PS-2.2 PS-3.1b PS-3.2a PS-3.2 PS-4.1a PS-4.2a PS-4.2b PS-5/6.1 PS-5/6.2 PS-7.1 PS-7.2 PS-8.1a PS-8.2b PS-8.1b PS-9.1 PS-9.2 PS-10.1 PS-10.2 PS-11.1 PS-11.2 PS-12.1 PS-12.2 PS-13.1a PS-13.2a PS-14.1 PS-14.2a PS-14.2c PS-15.1 PS-15.2

5'up 5'up 1 1 2 2 3 3 3 4 4 4 5 and 6 5 and 6 7 7 8 8 8 9 9 10 10 11 11 12 12 13 13 14 14 14 15 15

CAACTGAAGTCTTTATCGGAGC GCGAGCCTCGGCGGAACAGC TGTTATCACTTCCCCTCTCG TAGGAGCTGCAGCTCTAGAG GTCATACAATTCATAGGCAG CAGAAGGAAGTACAGGCTGG ACATTATAAAATTAAGTTTTAAC TCCCAAGGATAATGAAATTA AGGTGGAGAGTTAGACAGGA TTGGGACAGTTCCTACCATG CTTTACCTACAGAGTTTTTG TCAATTGATGGTAGAAGTGC GGCTTCAGGATTTTTATTATAGTA CTAACTGGGATTATTCTCACAT CACAAATCAAGGGTTCTTTGG GATCAGTAATGATACCACCA GATGTCATAGTATTCTTCCC TCTGTATTTTCCTGACTTAGC CGTGTGTTTTTTTTACCTCAG TAGTAACCAAACAAAAATGC CCCTTATCTGCTTAACCTCT AGCTTTCTGTATTTCTTACTC TACAGACTGCATCAAAGTGGG GTAATACTTGGTTATTTGGTAAT CACACATATTCAAATCTATTAC CCTATACTCATAATCGAGCC TGGGCACACAGTAGATACTC ATCATTGAGAAAGGGAATGG GTAAATACTGCTATGTATAC GCTTATATTGAATCTTTGCTCTG AAATGTCGGTACTAGCCCTAG AAAACTGAAGAAAAAGTAAGC CAAGATGCTAAAAGTCTTGG GATAGCAAGAGAAGTAAGAATTTC

–668 to –647 –131 to –150 –208 to –189 +98 to +79 –108 to –89 +83 to +64 –76 to –54 +115 to +96 +78 to +59 –78 to –59 +54 to +35 +24 to +5 –87 to –64 +58 to +37 –75 to –55 +29 to +10 –134 to –115 +94 to +74 –21 to –1 –97 to –78 +50 to +31 –50 to –30 +49 to +29 –41 to –19 +71 to +50 –69 to –50 +110 to +91 –134 to –115 +74 to +55 –31 to –9 +147 to +127 +27 to +7 –49 to –30 +205 to +182

PCR-Seq PCR-Seq PCR-Seq PCR-Seq PCR-Seq PCR-Seq PCR-Seq PCR Seq PCR-Seq PCR Seq PCR-Seq PCR-Seq PCR-Seq PCR-Seq PCR PCR-Seq Seq PCR-Seq PCR-Seq PCR-Seq PCR-Seq PCR-Seq PCR-Seq PCR-Seq PCR-Seq PCR-Seq PCR-Seq PCR-Seq PCR Seq PCR-Seq PCR-Seq

aNumbering

of the position of the primers in introns is relative to either the 5' (–) or 3' (+) boundaries of the amplified coding sequences. Underlining of oligonucleotides denotes known differences between PROS1 and PROS2.

254

Sala and Espinosa-Parrilla

12. Gel loading buffer 6X: 30% (v/v) glycerol and 0.1% (w/v) bromophenol blue in 1X TBE buffer. Store at 4°C. 13. 10 mg/mL Ethidium bromide solution. 14. DNA molecular size marker: 1 kb DNA ladder at 0.05 μg/mL, 0.04% (w/v) Orange G and 6.8% (w/v) sucrose in TE buffer 10/1 (10 mM Tris-HCl, 1 mM EDTA, pH 8.0). Keep frozen at –20°C in 1-mL aliquots. Thawed aliquots are kept at 4°C. 15. Submarine gel electrophoresis equipment.

2.2. Polymorphism Analysis 1. PCR reaction products containing PROS1 exon 13 and exon 15. 2. RsaI and BstXI restriction enzymes with their corresponding buffer, provided by the manufacturer (Boehringer Mannheim, GmbH, Germany). The enzyme used for each polymorphism to be analyzed is stated in Table 2. 3. Agarose gel electrophoresis materials and equipment (see steps 10–15, above).

2.3. Single-Strand Conformation Polymorphism (SSCP) Analysis 1. 2. 3. 4.

PCR reaction products from the PROS1 amplified fragments. CleanGel 10% and ExcelGel 12.5% DNA Analysis Kits (Pharmacia). Glycerol. Denaturing solution: 95% (v/v) formamide, 20 mM EDTA pH 8.0, 0.05% (w/v) bromophenol blue, 0.05% (w/v) xylene cyanol FF, and 10 mM NaOH. Store at 4°C. 5. DNA Silver Staining Kit, (Pharmacia) or its reagents: glacial acetic acid, 1% (w/v) silver nitrate solution, 37% formaldehyde, sodium carbonate, 2% (w/v) sodium thiosulphate, Na2EDTA-2H2O, and 87% (v/v) glycerol. 6. Multiphor II Electrophoresis Unit with refrigerated bath circulator (MultiTemp Thermostatic Circulator, Pharmacia). 7. Benzin or kerosene (insulating fluid).

2.4. PCR Product Purification 1. PCR reaction products from the PROS1 amplified fragments. 2. QIAquick PCR purification kit (Qiagen, Hilden, Germay). 3. 10 mM Tris-HCl, pH 8.5.

2.5. DNA Sequencing 1. Purified PCR product. 2. Dye Terminator Cycle Sequencing kit, ready reaction (Applied Biosystems, Foster City, CA). 3. DNA sequencing primer 1 μM in sterile dH2O. Keep frozen in 0.25-mL aliquots. Primers used for PROS1 sequencing are shown in Table 1. 4. Dimethyl sulfoxide (DMSO). 5. Mineral oil. 6. Thermal cycler. 7. Sephadex G-50 prepared in TE buffer 10/1 (10 mM Tris-HCl, pH 7.8, 1 mM EDTA). Resuspend 30 g Sephadex G-50 in 250 mL TE 10/1. Stir gently for 30 min

Protein S Gene

255

Table 2 PROS1 Fragments to be Amplified and Restriction Endonucleases Used to Genotype the PROS1 Polymorphisms S/P460 and P626A/G RFLP S/P460 P626A/G

8. 9. 10. 11. 12. 13. 14. 15. 16.

PCR fragment

Enzyme

Allele fragments, bp

Exon 13 Exon 15

RsaI BstXI

S: 360; P: 219, 141 A: 230, 185; G: 415

at 65°C. Remove the excess buffer several times and replace with fresh TE buffer and finally with dH2O. Sterilize by autoclaving. Store at room temperature. 1-mL disposable syringes plugged with cotton wool. Na2EDTA-2H2O 50 mM, pH8.0. Deionised formamide. Sequencing mix (Gibco, BRL Life Technologies): 6% (w/v) acrylamide/ visacrylamide (19:1), 7 M urea, 1X TBE (see Note 2). Keep in the dark at 4°C. 10% (w/v) Ammonium persulfate (APS) in dH2O. TEMED. Alconox detergent (Aldrich Chemical Company, Inc., Milwaukee, WI) 1X TBE buffer Applied biosystems 373 or 373A DNA sequencer.

3. Methods 3.1. Numbering System for Amino Acids and Nucelotides Protein S amino acids and PROS1 nucleotides are numbered according to Schmidel et al. (26). Exons and introns are numbered 1 to 15 and 1 to 14, respectively. Mutations and polymorphisms are designated according to Beaudet and Tsui (61).

3.2. PROS1 Amplifications by PCR All fifteen exons and intron flanking regions of the PROS1 gene, as well as 537 bp of the 5' regulatory sequence, are amplified by the polymerase chain reaction (PCR) in a final volume of 50 or 100 μL depending, respectively, on whether the amplified product is going to be used for restriction or SSCP analysis (VF = 50 μL) or if it will be purified for DNA sequencing (VF = 100 μL). For a final volume of 100 μL, the reaction is prepared as follows. If 50 μL volumes are needed, scale down all reagents. 1. Prepare as many 0.5-mL microcentrifuge tubes as DNA samples to be amplified and to each tube add 10 μL of genomic DNA at 50 ng/μL and one drop of mineral oil. Substitute sterile dH2O for genomic DNA in one of the reaction tubes as a contamination control. 2. In an ice bath, prepare a reaction mix that, per reaction tube, contains: 10 μL of 10X PCR buffer, 0–10 μL DMSO (see Table 3), 1.5–3 μL of 0.1 M MgCl2 (see

256

Pro1a–Pro2a 1.1a–1.2 2.1–2.2 3.1b–3.2a 4.1a–4.2a 5/6.1–5/6.2 7.1–7.2 8.1a–8.2b 9.1–9.2 10.1–10.2 11.1–11.2 12.1–12.2 13.1a–13.2a 14.1–14.2a 15.1–15.2

5'up E-1 E-2 E-3 E-4 E-5/6 E-7 E-8 E-9 E-10 E-11 E-12 E-13 E-14 E-15

aAdjust

b“Hot

537 382 349 216 219 505 230 350 261 289 280 348 360 404 415

bp 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10

10X PCR buffer, μL — 10 — — — — — — — — — — — — — 1 2 1.5 2.5 3 1.5 1.5 3 1.5 1.5 1.5 1.5 1.8 2 1.5 10 15 10 10 15 10 10 10 10 10 10 10 10 15 10

with dH2O to 90 or to 88 μL if the reaction is to be “hot started.” start” PCR reaction; Taq-polymerase is added after initial denaturation.

Primers

Exon 0.2 0.3 0.2 0.2 0.3 0.2 0.2 0.2 0.2 0.2 0.2 0.2 0.2 0.3 0.2 4 5 5 6 4 5 4 5 5 5 5 5 3.5 5 3.5

Reaction conditions (100-μL final volume)a DMSO, 0.1 M MgCl2 2 mM dNTPs, 10 μM μL μL μL mM μL 0.5 0.5 0.5 0.6 0.4 0.5 0.4 0.5 0.5 0.5 0.5 0.5 0.35 0.5 0.35

0.4b —b 0.4 —b —b 0.4 —b —b 0.4 0.4 —b 0.4 0.4 0.4 0.4

2 2 2 2

2 2

2

2

2

Primers Taq 5 U/μL μM μL U

Table 3 Specific Reaction Conditions Used to Amplify PROS1 Exons with Intron-Flanking Regions (E-1 to E-15) As Well As the 5' Upstream Region (5'up)a

256 Sala and Espinosa-Parrilla

Protein S Gene

257

Table 3), 10–15 μL of 2 mM 4dNTP mix (see Table 3), 3–6 μL of 10 μM each primer (forward and reverse, Tables 1 and 3), 0.4 μL of Taq-polymerase at 5 U/ μL (if no hot start is needed, see Table 3) and sterile dH2O to 90 μL. If the reaction is to be “hot started” (see Table 3), do not add the Taq-polymerase in the reaction mix and adjust final volume to 88 μL with dH2O. Mix and microcentrifuge briefly at top speed (13–14,000 rpm). 3. Add 90 μL of the reaction mix (or 88 μL if the reaction is to be “hot started”) to the DNA containing and control tubes and microcentrifuge briefly at top speed. 4. Transfer the tubes to the thermal cycler, denature for 5 min at 95°C and carry out the PCR reaction using the amplification cycles shown in Table 4 (see Note 3). If the reaction is to be “hot started” (see Table 4), denature for 6 min at 98°C, reduce the cycler temperature to 90°C, add 2 μL of Taq-polymerase diluted to 2 U/μL in dH2O just before use and carry out the PCR reaction using the amplification cycles stated in Table 4. Once the reaction is finished, keep the tubes at 4°C until use. 5. Visualize the results by electrophoresing 5 μL of the PCR reaction plus 1 μL of gel loading buffer in a 1% agarose gel and staining with ethidium bromide. Include a lane containing 5 μL of the DNA molecular weight marker.

3.3 Polymorphism Analysis The genotypes for the P626A/G and the S/P460 PROS1 polymorphisms are respectively determined by restriction analysis. 1. 2. 3. 4.

Add 5 U of BstXI to 8 μL of the exon 15 PCR product in a final volume of 30 μL. Add 2.5 U of RsaI to 15 mL of the exon 13 PCR product in a final volume of 50 μL. Incubate as recommended by the enzyme suppliers. Add loading buffer and electrophorese the digestion products (see Table 2) on 2.5% agarose gels in 1X TBE.

3.4. SSCPs Analysis In order to obtain a mutation detection efficiency close to 100%, SSCP analysis of the amplified PROS1 fragments is performed at two different acrylamide concentrations (see Table 5). 1. Rehydrate pre-cast gels exactly as stated in the instructions of the CleanGel DNA analysis kit. 2. Dilute the PCR fragment to be analyzed 1:2 — 1:12 in dH2O, depending on the concentration of the PCR product (see Table 5) (see Note 4). Mix with the same final volume (4–15 μL) of denaturing solution. Keep at room temperature until use (but less than 30 min). 3. Connect the Multiphor II Electrophoresis Unit to the MultiTemp Thermostatic Circulator set to the desired temperature (5–15°C, Table 5). 4. Add 3–4 mL benzin (insulating fluid) to the center of the cooling plate and position the gel onto it, taking care that no air bubbles remain under the gel (see Note 5). 5. Soak the electrode strips with electrode buffer in PaperPool (only for CleanGels) and place them on to the edges of the gel. Be very careful that no air bubbles

258

5a 6a 5 6a 6a 5 6a 6a 5 5 6a 5 5 5 5 Yes Yes No Yes Yes No Yes Yes No No Yes No No No No

Hold 90°C — 2 — 2 2 — 2 2 — — 2 — — — —

Taq 2 U/μL μL 35 35 30 35 35 30 30 35 30 30 30 30 30 35 30

Cycles n 95 95 95 95 95 95 95 95 95 95 95 95 95 95 95 45 60 30 45 45 45 30 45 45 30 60 30 30 45 30

Denat. °C s 62 56 55 49 56 58 54 56 50 55 53 55 52 62 54 45 60 30 45 45 45 30 45 45 30 60 30 30 45 30

Anneal. °C s

Cycling parameters

start” PCR reaction; Taq is added at 90°C after initial denaturation.

95 98 95 98 98 95 98 98 95 95 98 95 95 95 95

a“Hot

5'up E-1 E-2 E-3 E-4 E-5/6 E-7 E-8 E-9 E-10 E-11 E-12 E-13 E-14 E-15

Exon

Initial denat. °C Min 74 74 74 74 74 74 74 74 74 74 74 74 74 74 74 60 120 60 60 120 60 60 60 60 45 60 45 60 60 60

Extens. °C s 74 74 74 74 74 74 74 74 74 74 74 74 74 74 74

5 5 5 5 5 5 5 5 5 5 5 5 5 5 5

extens. °C Min

Final

Table 4 Cycling Parameters Used to Amplify PROS1 Exons With Intron-Flanking Regions (E-1–E-15) As Well As the 5' Upstream Region (5'up)

258 Sala and Espinosa-Parrilla

Protein S Gene

259

Table 5 Sample Dilutions and Electrophoresis Conditions Used to Analyze PROS1 Fragments by SSCP Electrophoresis Exona

Gel Type

5'up 5'up 1 1 2 2 3 3 4 4 5&6 5&6 7 7 8 8 9 9 10 10 11 11 12 12 13 13 14 14 15 15

12.5% ExcelGel 10% CleanGel 10% CleanGel 12.5% ExcelGel 12.5% ExcelGel 10% CleanGel 12.5% ExcelGel 10% CleanGel 12.5% ExcelGel 10% CleanGel 10% CleanGel 12.5% ExcelGel 12.5% ExcelGel 10% CleanGel 12.5% ExcelGel 10% CleanGel 12.5% ExcelGel 10% CleanGel 12.5% ExcelGel 10% CleanGel 12.5% ExcelGel 10% CleanGel 10% CleanGel 12.5% ExcelGel 12.5% ExcelGel 10% CleanGel 12.5% ExcelGel 10% CleanGel 10% CleanGel 12.5% ExcelGel

Sample dilutionb

Temp. ºC

Prerun V min

V

1/6 1/6 1/2 1/2 1/10 1/10 1/4 1/4 1/4 1/4 1/8 1/8 1/8 1/8 1/4 1/4 1/8 1/8 1/6 1/6 1/6 1/6 1/12 1/12 1/12 1/12 1/8 1/8 1/5 1/5

5 15 5 5 5 15 15 15 5 15 15 5 5 15 5 15 5 15 5 15 5 15 5 5 15 15 5 15 15 15

100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100

600 600 600 600 600 600 600 600 600 600 600 600 600 600 600 600 600 600 600 600 600 600 600 600 600 600 600 600 600 600

20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20

Run h 4.5 2.5 2 3.5 3.5 1.5 2 1 2.25 1 2 4.5 2.25 1.5 2.5 1.75 3.5 1.5 3.5 1.5 2.5 1.5 2 3.5 2.25 1.5 3.5 1.5 1.5 2.5

aOf the two electrophoretic conditions stated for all fragments, the ones reported first are those that give best results in our hands. bSample dilution refers to the dilution of the PCR product with dH O, before the 2 addition of the same final volume of stop solution.

remain trapped under the gel and that the strips overlap the gel by a minimum of 3 mm and remain separated from the sample wells by about 5 mm.

260

Sala and Espinosa-Parrilla

6. Denature the diluted samples at 98°C for 2 min and immediately place them on ice. 7. Apply 6.5 μL of each denatured sample to the sample wells. A minimum of two samples from healthy controls are loaded approx 12-wells after the first and before the last well. 8. Connect the electrophoresis unit according to the instruction manual, prerun samples for 20 min at 100 V and then run under the conditions specified in Table 6. 9. Silver stain the gel according to the Silver Staining Protocol for nucleic acids provided by Pharmacia Biotech with the Multhiphor II Unit (see Notes 6 and 7). 10. Allow the gel to dry a little at room temperature and wrap the gel with cling film. 11. Compare single-strand and heteroduplex banding patterns of patients with those of controls.

3.5. PCR Product Purification 1. PCR fragments from 100 bp to 10 kb are separated from oligonucleotide primers, dNTPs and other reaction components by anion-exchange chromatography. 90 μL of the amplified product is purified on QIAquick spin columns following the protocol provided with the QIAquick Purification kit (see Note 8). Elute into 10 mM Tris-HCl, pH 8.5. 2. Visualize 2 μL of the purified product on a 1% agarose gel.

3.6. DNA Sequencing PROS1 purified fragments are directly sequenced using the Applied Biosystems protocol for Taq cycle-sequencing with dye terminators and an Applied Biosystems 373 DNA sequencer. Both the sense and the antisense DNA strands are sequenced using the same primers as those used for amplification with the exception of exons 3, 4, and 14, for which a new antisense primer was synthesised and exon 8, for which a new sense primer was synthesised (see Table 1).

3.6.1. Thermal Cycle Sequencing Reaction 1. In a 0.5-mL microcentrifuge tube add 2–4 μL of the purified DNA fragment, (depending on the concentration of the visualized fragment), 1.5 μL of 1 mM sequencing primer, 0.5 μL DMSO, dH2O up to 6 μL and a drop of mineral oil. Mix and microcentrifuge briefly at top speed. 2. Place tubes in the thermal cycler and incubate for 6 min at 98°C then reduce the temperature to 90°C and maintain it at this temperature. 3. At 90°C add 4 μL of the ready reaction mix (provided with the Dye Terminator Cycle Sequencing kit) and start thermal cycling as follows: 28 cycles of 30 s at 96°C (denaturation), 30 s at 52°C (annealing) and 4 min at 60°C (extension). Immediately after, store tubes at 4°C until use.

3.6.2. Sephadex G-50 Gel Filtration 1. Plug the neck of a 1-mL disposable syringe with cotton wool and fill the syringe up to 1 mL with Sephadex G-50. Keep the liquid level at 1 mL by adding water several times and then let it drip for approx 1 min.

Protein S Gene

261

Table 6 Restriction Endonucleases Used to Distinguish Between PROS1 and PROS2 Amplified Sequences Exon

Enzyme

PROS1 fragments, bp

PROS2 fragments, bp

2 2 4 5 and 6 5 and 6 7 7 8 8 9 10 10 11 11 12 12 13 13 14 14 15 15

MspI Fnu4HI DdeI PstI RsaI FokI MaeI AluI HhaI NsiI RsaI MspI MboI MspI MnlI BstuI SfaNI MspI DdeI BclI SfaNI NlaIV

258-92 350 99-73-47 267-238 295-189-21 79-74-51-26 230 167-161-22 350 246-16 139-101-49 218-71 214-66 131-75-74 273-75 348 278-82 360 325-79 404 208-206-48 462

350 231-119 147-73 505 505 100-78-51 209-20 369a 237-130-2a 211-51 238-49 287 280 280 243-97a 225-115a 360 280-80 404 310-94 414-48 255-257

aPROS2

contains a small insertion or deletion.

2. Centrifuge for 2 min at 1000g at 4°C (see Note 9). 3. Immediately place the bottom of the syringe in a 1.5-mL Eppendorf tube without a cap and pipet 10 μL of the PCR reaction, avoiding oil, onto the top of the Sephadex. 4. Centrifuge for 2 min at 1000g at 4°C. 5. Dry the eluates in a Speedvac evaporator for approx 30 min and keep frozen if the sequencing gel is not to be run the same day.

3.6.3. Preparation of the Sequencing Gel This step is performed essentially as described in the 373 DNA Sequencing System user’s manual: 1. Wash the glass sequencing plates very carefully with Alconox detergent, rinse thoroughly first with tap water, then with dH2O to eliminate any detergent residues and air dry.

262

Sala and Espinosa-Parrilla

2. Assemble gel plates with two 0.4-mm uniform spacers and four large book-binder clamps on each side. Make certain that the outside faces remain outside. 3. To 40 mL of sequencing mix add 300 μL of 10% APS and 28 μL of TEMED. With the help of a syringe, pour this gel solution immediately into the gel plate sandwich, taking care that no air bubbles are formed. Insert the single well gel casting comb and place two large book-binder clamps over it. Leave the gel to polymerise for a minimum of 2 h. 4. Remove the gel casting comb and any extraneous polyacrilamide and rinse the outside faces of the polymerized gel sandwich as well as the gel casting comb well with dH2O to clean any spilled polyacrylamide and urea. 5. Place the gel sandwich into the electrophoresis chamber and without pouring the electrophoresis buffer into its reservoir, scan the plates for dust or dirt by pressing main menu, pre-run, and plate check. Check also the PMT setting. 6. If correct, abort run and pour 1X TBE initially into the upper buffer reservoir and then into the lower one (see Note 10). 7. Set up electrophoresis conditions at 2500 V, 40 mA, 30 W for 10 h at 40°C, and prerun gel for a minimum of 5 min.

3.6.4. Sample Preparation 1. Prepare a mix of 1 μL of 50 mM EDTA, pH 8.0 and 5 μL of deionized formamide per sample to be loaded. 2. Add 4.5 μL of this denaturing mix to each dried sequencing reaction sample (see Subheading 3.6.2.). Vortex and microcentrifuge briefly. 3. Denature samples by incubating at 98°C, 2 min and then placing immediately on ice for a minimum of 2 min.

3.6.5. Sample Loading and Running the Gel 1. Abort sequencer run. 2. With the help of a syringe wash the top of the gel with 1X TBE before inserting the 24-well sharkstooth comb. 3. Load 4.5 μL of each reaction sample per well and start the electrophoresis run. 4. Fill in the sample sheet of the data collection program and start collect, according to the user’s manual.

3.6.6. Sequence Analysis 1. Analyse all sample sequences with help of the data analysis program of the sequencer software and print the sequences. 2. Compare printed sequences of patients with those of controls. Not only the nucleotide sequences, but also the chromatogram shape and the presence of more than a single base peak per position, should be compared (see Note 11).

4. Notes 1. The primers used for each fragment to be amplified are shown in Table 1 and are the same as those described by Reitsma et al. (59) with the exception of the forward

Protein S Gene

263

primers for exons 1 and 13, the reverse primer for exon 14 and the forward and reverse primers for exons 3 (48), 4 and 8. Primers’ concentration is calculated spectrophotometrically by reading at A260 and applying the following formula: (A260) (dilution factor)/(Y × 10-6) = pmols/μL

2.

3.

4. 5. 6. 7.

8.

9. 10. 11.

where Y = (number of A x 15,200) + (number of C x 7050) + (number of G x 12,010) + (number of T x 8400). The denaturing 6% acrylamide solution can be prepared by mixing 30 mL of 40% stock acrylamide solution (19:1), 40 mL water and 100 g of urea. Disolve for 30 min at 65°C. Add 3 g Amberlite (Sigma #MB-1A), protect from light and leave gently stirring (100–400 rpm) for 1 h at 50°C. Vacuum filter. Finally add 40 mL of 5X TBE and dH2O to 200 mL. The reaction conditions stated in Tables 3 and 4 are the ones that gave the best results in our laboratory, allowing for the amplification of only PROS1 gene sequences as confirmed by restriction analysis with endonucleases that specifically cleaved either PROS1 or PROS2 sequences (Table 6). We recommend this confirmation when standardizing the PROS1 amplifications for the first time in the laboratory. Slight modifications of the reaction conditions (i.e., MgCl2 concentration) and cycling parameters (which may vary depending on the thermal cycler used), may be necessary to optimize the reaction in different laboratories. The best results are obtained, with high sample dilutions. According to our experience this is best acomplished by leaving the insulating fluid to spread uniformly over the gel plate by effect of the gel pressure. All solutions are prepared immediately before use and the developing solution has to be vigorously stirred to dissolve the sodium carbonate. Fix the gel by soaking for 30 min in 250 mL of a 10% solution of glacial acetic acid. Wash 3 times by soaking for 2 min in dH2O. Silver stain the gel by soaking for 20 min in 250 mL of 0.1% (w/v) silver nitrate (25 mL of 1% solution) and 0.037% (w/v) formaldehyde (0.25 mL of a 37% solution) in dH2O. Wash the gel for 30 s in dH2O. To develop the gel soak for 2–5 min in 250 mL of 2.5% (w/v) sodium carbonate, 0.037% (w/v) formaldehyde (0.25 mL of a 37% solution), and 0.002% (w/v) sodium thiosulphate (0.25 mL of a 2% solution) in dH2O. When development is complete, stop the reacion by placing the gel in 250 mL of 1.46% (w/v) Na2EDTA-2H2O in dH2O for 10 min. The gels can be preserved by soaking for 20 min in 250 mL of 8.7% glycerol in dH2O. All centrifugations are carried out for 60 s at 13–14000 rpm, in a conventional microcentrifuge. We recommend the use of 10 mM Tris-HCl, pH 8.5 instead of dH2O as elution buffer. The Sephadex level should remain at approx 0.7 mL. Take great care that no buffer is spilled, particularly in the laser reading area. To discard the presence of unspecific errors, confirm that any base change or sequence alteration observed in a patient sample is present in both the sense and the antisense DNA strands and that it is not present in control samples. Further confirmation of the sequence alteration observed should be obtained from a newly

264

Sala and Espinosa-Parrilla synthesised PCR fragment, by either restriction analysis (in the case that it creates or destroys a restriction site) or repeated sequencing. Once the alteration has been confirmed in the patient, screen for its presence in the relatives and confirm that it cosegregates with the deficient phenotype before associating it to the disease causing mutation. Furthermore, and depending very much on the type of mutation identified, the possibility of it being a polymorphism should be excluded by screening for its presence in a minimum group of 50 healthy controls (100 chromosomes).

Acknowledgments We thank Marta Morell for her invaluable technical assistance. Helena Kruyer for her assistance with the manuscript. The project is supported by Dirección General de Investigación Científica y Técnica (DGICYT, PB941233), Fondo de Investigación Sanitaria (FIS-94/0039), and Servei Català de la Salut, Generalitat de Catalunya. Y. Espinosa-Parrilla is supported by a fellowship from the I.R.O Institute. References 1. DiScipio, R. G., Hermondson, M. A., Yates, W. G., and Davie, E. W. (1977) A comparison of human prothrombin, factor IX (Christmas factor), factor X (Stuart factor) and protein S. Biochemistry 16, 698–706. 2. Dahlbäck, B. (1991) Protein S and C4b–binding protein: components involved in the regulation of the protein C anticoagulant system. Thromb. Haemostasis 66, 49–61. 3. Dahlbäck, B. and Stenflo, J. (1994) A natural anticoagulant pathway: proteins C, S, C4b–binding protein and thrombomodulin, in Haemostasis and Thrombosis, 3rd. ed. (Bloom, A. L., Forbes, C. D., Thomas, D. P., and Tuddenham, E. D. G., eds.), Churchill Livingstone, London, pp. 671–698. 4. Walker, F. J. (1981) Regulation of activated protein C by protein S: the role of phospholipid in factor Va inactivation. J. Biol. Chem. 256, 11128–11131. 5. Walker, F. J., Chavin, S. I., and Fay, P. J. (1987) Inactivation of factor VIII by activated protein C and protein S. Arch. Biochem. Biophys. 252, 322–328. 6. Comp, P. C., Nixon, R. R., Cooper, M. R., and Esmon, C. T. (1984) Familial protein S deficiency is associated with recurrent thrombosis. J. Clin. Invest. 74, 2082–2088. 7. Schwarz, H. P., Fischer, M., Hopmeier, P., Batard, M. A., and Griffin, J. H. (1984) Plasma protein S deficiency in familial thrombotic disease. Blood 64, 1297–1300. 8. Engesser, L., Broekmans, A. W., Briët, E., Brommer, E. P., and Bertina, R. M. (1987) Hereditary protein S deficiency: clinical manifestations. Ann. Intern. Med. 106, 677–682. 9. De Stefano, V., Finazzi, G., and Mannucci, P. M. (1996) Inherited thrombophilia: Pathogenesis, clinical syndromes and management. Blood 87, 3531–3544. 10. Lane, D. A., Mannucci, P. M., Bauer, K. A., Bertina, R. M., Bochkov, N. P., Boulyjenkov, V., Chandy ,M., Dahlbäck, B., Ginter, E. K., Miletich, J. P.,

Protein S Gene

11.

12. 13. 14.

15. 16.

17.

18. 19.

20.

21. 22.

23.

24.

25.

265

Rosendaal, F. R., and Seligsohn, U. (1996) Inherited thrombophilia: Part I. Thromb. Haemostasis 76, 651–662. Mahasandana, C., Suvatte, V., Marlar, R. A., Manco–Johnson, M. J., Jacobson, L. J., and Hathaway, W. E. (1990) Neonatal purpura fulminans associated with homozygous protein S deficiency. Lancet 335, 61–62. Pegelow, C. H., Ledford, M., Young, J., and Zilleruelo, G. (1992) Severe protein S deficiency in a newborn. Pediatrics 89, 674–676. Walker, F. J. (1988) Interactions of protein S with membranes. Seminars Thromb. Hemostasis 14, 216–221. Heeb, M. J., Mesters, R. M., Tans, G., Rosing, J., and Griffin, J. H. (1993) Binding of protein S to factor Va associated with inhibition of prothrombinase that is independent of activated protein C. J . Biol. Chem. 268, 2872–2877. Heeb, M. J., Rosing, J., Bakker, H. M., Fernández, J. A., Tans, G., and Griffin, J. H (1994) Protein S binds to and inhibits factor Xa. Proc. Natl. Acad. Sci. USA 91, 2728–2732. Koppelman, S. J., Hackeng, T. M., Sixma, J. J., and Bouma, B. N. (1995) Inhibition of the intrinsic factor X activating complex by protein S: evidence for a specific binding of protein S to factor VIII. Blood 86, 1062–1071. Fair, D. S. and Marlar, R. A. (1986) Biosynthesis and secretion of factor VII, protein C, protein S and the protein C inhibitor from a human hepatoma cell line. Blood 67, 64–70. Fair, D. S., Marlar, R. A., and Levin, E. G. (1986) Human endothelial cells synthesize protein S. Blood 67, 1168–1171. Stern, D. M, Brett, J., Harris, K., and Nawroth, P. P. (1986) Participation of endothelial cells in the protein C–protein S anticoagulant pathway: the synthesis and release of protein S. J. Cell. Biol. 102, 1971–1978. Ogura, M., Tanabe, N., Nishioka, J., Suzuki, K., and Saito, H. (1987) Biosynthesis and secretion of funcional protein S by a human megakaryoblastic cell line (MEG–01). Blood 70, 301–306. Malm, J., He, X., Bjartell, A., Shen, L., Abrahamsson, P. A., and Dahlbäck, B. (1994) Vitamin K–dependent protein S in Leydig cells of human testis. Biochem. J. 302, 845–850. He, X., Shen, L., Bjartell, A., Dahlbäck, B. (1995) The gene encoding vitamin K-dependent anticoagulant protein S is expressed in multiple rabbit organs as demonstrated by Northern blotting, in situ hybridization and immunohistochemistry. J. Histochem. Cytochem. 43, 85–96. Ploos van Amstel, H. K., Reitsma, P. H., Hamulyak, K., de Die Smulders, C. E., Mannucci, P. M., and Bertina, R. M. (1989) A mutation in the protein S pseudogene is linked to protein S deficiency in a thrombophilic family. Thromb. Haemostasis 62, 897–901. Ploos Van Amstel, J. K., van der Zanden, A. L., Bakker, E., Reitsma, P. H., and Bertina, R. M. (1987) Two genes homologous with human protein S cDNA are located on chromosome 3. Thromb. Haemostasis 58, 982–987. Watkins, P. C., Eddy, R., Fukushima, Y., Byers, M. G., Cohen, E. H., Dackowski, W. R., Wydro, R. M., and Shows, T. B. (1988) The gene for protein S maps near the centromere of human chromosome 3. Blood 71, 238–241.

266

Sala and Espinosa-Parrilla

26. Schmidel, D. K., Tatro, A. V., Phelps, L. G., Tomczak, J. A., and Long, G. L. (1990) Organization of the human protein S genes. Biochemistry 29, 7845–7852. 27. Ploos Van Amstel, H. K., Reitsma, P. H., van der Logt, C. P. E., and Bertina, R. M. (1990) Intron–Exon organization of the active human protein S gene PS a and its pseudogene PS b: duplication and silencing during primate evolution. Biochemistry 29, 7853–7861. 28. Edenbrandt, C. M., Lundwall, A., Wydro, R., and Stenflo, J. (1990) Molecular analysis of the gene for vitamin K-dependent protein S and its pseudogene. Cloning and partial gene organization. Biochemistry 29, 7861–7868. 29. Lundwall, A., Dackowski, W. R., Cohen, E. H., Shaffer, M., Mahr, A., Dahlbäck, B., Stenflo, J., and Wydro, R. M. (1986) Isolation and sequence of the cDNA of human protein S, a regulator of blood coagulation. Proc. Natl. Acad. Sci. USA 83, 6716–6720. 30. Hoskins, J., Norman, D. K., Beckmann, R. J., and Long, G. L. (1987) Cloning and characterization of human liver cDNA encoding a protein S precursor. Proc. Natl. Acad. Sci. USA 84, 349–353. 31. Gandrille, S., Borgel, D., Ireland, H., Lane, D. A., Simmonds, R., Reitsma, P. H., Mannhalter, C., Pabinger, I., Saito, H., Suzuki, K., Formstone, C., Cooper, D. N., Espinosa, Y., Sala, N., Bernardi, F., and Aiach, M. (1997) Protein S deficiency: a database of mutations. Thromb. Haemostasis 77, 1201–1214. 32. Nelson, R. M. and Long, G. L. (1992) Binding of protein S to C4b–binding protein. Mutagenesis of protein S. J. Biol. Chem. 267, 8140–8145. 33. Fernández, J. A., Heeb, M. J., and Griffin, J. H. (1993) Identification of residues 413–433 of plasma protein S are essential for binding to C4b–binding protein. J. Biol. Chem. 268, 16,788–16,794. 34. Chang, T. G. T., Maas, B. H. A., Ploos van Amstel, H. K., Reitsma, P. H., Bertina, R. M., and Bouma, B. N. (1994) Studies of the interaction between human protein S and human C4b–binding protein using deletion variants of human protein S. Thromb. Haemostasis 71, 461–467. 35. Griffin, J. H., Gruber, A., Fernández, J. A. (1992) Reevaluation of total, free and bound protein S and C4b–binding protein levels in plasma anticoagulated with citrate or hirudin. Blood 79, 3203–3211. 36. Mateo, J., Oliver, A., Borrell, M., Sala, N., Fontcuberta, J., and the EMET Group. (1997) Laboratory evaluation and clinical characteristics of 2132 consecutive unselected patients with venous thromboembolism. Results of the Spanish multicentric study on thrombophilia (EMET Study). Thromb. Haemost. 77, 444–451. 37. Bertina, R. M. (1990) Nomenclature proposal for protein S deficiency. XXXVI Annual meeting of the Scientific and Standardization Committee of the ISTH, Barcelona (Spain). 38. Comp, P. C. (1990) Laboratory evaluation of protein S status. Seminars Thromb. Haemostasis 16, 177–181. 39. Tripodi, A., Bertina, R. M., Conard, J., Pabinger, I., Sala, N., and Mannucci, P. M. (1992) Multicenter evaluation of three commercial methods for measuring protein S antigen. Thromb. Haemostasis 68, 149–154.

Protein S Gene

267

40. Boyer–Neumann, C., Bertina, R. M., Tripodi, A., D’Angelo, A., Wolf, M., Vigano D’Angelo, S., Mannucci, P. M., Meyer, D., and Larrieu, M. J. (1993) Comparision of functional assays for protein S: European collaborative study of patients with congenital and acquired deficiency. Thromb. Haemostasis 70, 946–950. 41. Gandrille, S., Borgel, D., Eschwege–Gufflet, V., Aillaud, M. F., Dreyfus, M., Matheron, C., Gaussem, P., Abgrall, JF., Jude, B., Sie, P., Toulon, P., and Aiach, M. (1995) Identification of 15 different candidate causal point mutations and three polymorphisms in 19 patients with protein S deficiency using a scanning method for the analysis of the protein S active gene. Blood 85, 130–138. 42. Formstone, C. J., Wacey, A. I., Berg, L. P., Rahman, S., Bevan, D., Rowley, M., Voke, J., Bernardi, F., Legnani, C., Simioni, P., Girolami, A., Tuddenham, E. G. D., Kakkar, V., and Cooper, D. N. (1995) Detection and characterization of seven novel protein S (PROS) gene lesions: evaluation of reverse transcript–polymerase chain reaction as a mutation screening strategy. Blood 86, 2632–2641. 43. Andersen, B. D., Lind, B., Philips, M., Hansen, A. B., Ingerslev, J, and Thorsen, S. (1996) Two mutations in exon XII of the protein S a gene in four thrombophilic families resulting in premature stop codons and depressed levels of mutated mRNA. Thromb. Haemostasis 76, 143–150. 44. Zöller, B., García de Frutos, P., and Dahlbäck, B (1995) Evaluation of the relationship between protein S and C4b–Binding protein isoforms in hereditary protein S deficiency demonstrating type I and type III deficiencies to be phenotypic variants of the same genetic disease. Blood 85, 3524–3531. 45. Duchemin, J., Gandrille, S., Borgel, D., Feugard, P., Alhenc–Gelas, M., Matheron, C., Dreyfus, M., Dupuy, E., Juhan–Vague, I., and Aiach, M. (1995) The Ser 460 to Pro substitution of the Protein Sα (PROS1) gene is a frequent mutation associated with free protein S (type IIa) deficiency. Blood 86, 3436–3443. 46. Espinosa–Parrilla, Y., Morell, M., Souto, J. C., Borrell, M., Heine–Suñer, D., Tirado, I., Volpini, V., Estivill, X., and Sala, N. (1997) Absence of linkage between type III protein S deficiency and the PROS1 and C4BP genes in families carrying the PS Heerlen allele. Blood 89, 2799–2806. 47. Bertina, R. M., Ploos Van Amstel, H. K., van Wijngaarden, A., Coenen, J., Leemhuis, M. P., Deutz Terlouw, P. P., van der Linden, I. K., and Reitsma, P. H. (1990) Heerlen polymorphism of protein S, an immunologic polymorphism due to dimorphism of residue 460. Blood 76, 538–548. 48. Cooper, D. N. and Krawczak, M. (1993) Indirect analysis of human genetic disease. In Human Gene Mutation (Cooper DN and Krawczak M, eds. ), BIOS Scientific Publishers Limited, Oxford, UK, pp 85–108. 49. Pericak–Vance, M. A. (1996) Analysis of genetic linkage data for mendelian traits, in Current Protocols in Human Genetics 1 (Dracopol, N. C. et al., eds. ), Wiley, NY, pp. 1.4.1–1.4.31. 50. Diepstraten, C. M., Ploos van Amstel, J. K., Reitsma, P. H., and Bertina, R. M. (1991) A CCA/CCG neutral dimorphism in the codon for Pro 626 of the human protein S gene PSα (PROS1). Nucleic Acids Res. 19, 5091.

268

Sala and Espinosa-Parrilla

51. Mustafa, S., Pabinger, I., and Mannhalter, C. (1996) Two new frequent dimorphisms in the protein S (PROS1) gene. Thromb. Haemostasis 76, 393–396. 52. Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, R., Horn, G. T., Mullis, K. B., and Erlich, H. A. (1988) Primer–directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239, 487–491. 53. Orita, M., Suzuki, Y., Sekiya, T., and Hayashi, K. (1989) Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics 5, 874–879. 54. Orita, M., Iwahana, H., Kanazawa, H., Hayashi, K., and Sekiya, T. (1989) Detection of polymorphisms of human DNA by gel electrophoresis as single strand conformation polymorphisms. Proc. Natl. Acad. Sci. USA 86, 2766–2770. 55. Hongyo, T., Buzard, G. S., Calvert, R., and Weghorst, C. M. (1993) “Cold SSCP”: a simple rapid and non–radioactive method for opimized single–strand conformation polymorphism analyses. Nucleic Acids Res. 21, 3637–3642. 56. Murray, V. (1989) Improved double–stranded DNA sequencing using the linear polymerase chain reaction. Nucleic Acids Res. 17, 8889. 57. Ploos Van Amstel, H. K., Huisman, M. V., Reitsma, P. H., Wouter ten Cate, J., and Bertina, R. M. (1989) Partial protein S gene deletion in a family with hereditary thrombophilia. Blood 73, 479–483. 58. Schmidel, D. K., Nelson, R. M., Broxson, E. H. Jr, Comp, P. C., Marlar, R. A., and Long, G. L. (1991) A 5. 3-kb deletion including exon XIII of the protein Sα gene occurs in two protein S-deficient families. Blood 77, 551–559. 59. Reitsma, P. H., Ploos Van Amstel, H. K., and Bertina, R. M. (1994) Three novel mutations in five unrelated subjects with hereditary protein S deficiency type I. J. Clin. Invest. 93, 486–492. 60. Mustafa, S., Pabinger, I., and Mannhalter, C. (1995) Protein S deficiency type I: Identification of point mutations in 9 of 10 families. Blood 86, 3444–3451. 61. Beaudet, A. L. and Tsui, L. C. (1993) A suggested nomenclature for designating mutations. Human Mutation 2, 245–248.

Screening for the G to A Transition

269

26 Screening for the G to A Transition at Position 20210 in the 3'-Untranslated Region (UTR) of the Prothrombin Gene Karen P. Brown 1. Introduction The prothrombin gene has recently been investigated as a candidate gene for venous thrombosis risk in selected individuals with a history of venous thrombosis (1). A genetic variation in the 3'-untranslated region (UTR) of the prothrombin gene, a G to A transition at nucleotide position 20210, was found in 18% of selected patients with a personal and family history of venous thrombosis, in 6.2% of unselected consecutive patients with a first episode of deep vein thrombosis, and in 2.3% of healthy control subjects (1). Plasma prothrombin levels have been investigated in individuals with the 20210 A allele and in normal individuals with the 20210 GG genotype and an association was found between the presence of the 20210 A allele and elevated plasma prothrombin levels. Prothrombin activation leads to the generation of the serine protease thrombin which exhibits procoagulant, anticoagulant, and antifibrinolytic activities. Elevation of plasma prothrombin levels in carriers of the 20210 A allele is associated with a 2.8-fold increased risk of venous thrombosis. The prothrombin 20210 A allele is detected by polymerase chain reaction amplification of a 345-bp fragment of the 3'-UTR of the prothrombin gene using a downstream mutagenic primer which introduces a HindIII recognition site in the presence of the A allele. The normal allele lacks the new recognition site and therefore remains at 345-bp after digestion with HindIII, whereas the mutant allele yields two fragments of 322 and 23 bp after enzyme digestion.

From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ

269

270

Brown

2. Materials All reagents must be prepared using sterile distilled water. Unless specified, all chemicals are obtained from either BDH Laboratory Supplies (Poole, UK), or from the Sigma Corporation (Poole, UK) and are AnalaR grade or reagent grade.

2.1. DNA Extraction (see Note 1) 1. Cell lysis buffer: 0.32 M sucrose, 1% triton X-100 (v/v), 5 mM MgCl2, 10 mM Tris-HCl, pH 7.5. Store at 4°C. 2. TE buffer, pH 8.0: 10 mM Tris-HCl, pH 8.0, 1 mM EDTA. Store at room temperature. 3. Nuclear lysis buffer: 0.32 M lithium acetate, 2% (w/v) lithium dodecyl sulphate, 10 mM Tris-HCl, pH 8.0, 1 mM EDTA. Store at room temperature. 4. Biophenol/chloroform/ISA: Stabilized. Biotechnology grade (Camlab, Cambridge, UK). Store above 4°C. 5. 3 M sodium acetate, pH 5.5. Store at room temperature. 6. Absolute ethanol. Store at –20°C. 7. 70% Ethanol. Store at room temperature. 8. Sterile distilled water.

2.2. Polymerase Chain Reaction (PCR) Amplification of the Prothrombin Gene and Product Detection (see Note 3) 1. DNA polymerase: Thermus aquaticus DNA polymerase “Amplitaq” 5 U/mL PerkinElmer Corporation, Roche Molecular Systems, Warrington, UK). Store at –20°C. 2. 10X PCR buffer: 100 mM Tris-HCl, 500 mM KCl This buffer may vary depending upon the precise thermostable DNA polymerase). Store at –20°C. 3. 25 mM MgCl2. MgCl2 is frequently included in the PCR buffer or supplied with the DNA polymerase. Store at –20°C. 4. 20 mM dNTP working solution: 100 mM deoxynucleotide tri-phosphate stock solutions are available from many manufacturers, e.g., Pharmacia LKB Biotechnology (Milton Keynes, UK). A 20 mM working solution of dNTPs is prepared prior to use. Store at –20°C. 5. PCR primers: Oligonucleotide primers can be obtained from a number of molecular biology suppliers. The primers are used at a working solution at 50 pmols/μL. Store at –20°C. The primer sequences for amplifying the prothrombin 3'-UTR polymorphism are: Forward primer 5' -TCT AGA AAC AGT TGC CTG GC (nucleotides 19889–19908) and reverse primer 5'-ATA GCA CTG GGA GCA TTG AA*G C (nucleotides 20233–20212). A* is not present in the normal sequence and is introduced so that the combination of a nucleotide substitution and the genetic abnormality creates a new restriction enzyme cleavage site for HindIII (5'...A/GCTT...3'). 6. Positive DNA control (see Note 4). 7. Programmable thermal cycler, e.g., MJ-Research PTC-200 peltier programmable thermal cycler. Genetic Research Instrumentation Ltd (Essex, UK).

Screening for the G to A Transition

271

8. Electrophoresis equipment. Submarine gel and power pack apparatus, e.g., BioRad Laboratories Ltd (Hemel Hempstead, UK). 9. Loading buffer: 20% sucrose (w/v), 0.25% bromophenol blue (w/v), 0.25% xylene cyanol (w/v). Store at room temperature. 10. Molecular weight markers, e.g., ØX174/HaeIII markers. Store at –20°C. 11. Agarose: Agarose (ultra pure, electrophoresis grade) obtained from Gibco-BRL (Paisley, UK). A 1% agarose gel containing ethidium bromide 0.5 μg/mL is prepapred in 1X TBE buffer (0.09 M Tris-borate, 0.002 M EDTA).

2.3. Restriction Enzyme Digest of PCR Products 1. HindIII: Available from many manufacturers, e.g., New England Biolabs Inc. (Hitchin, UK). Supplied at 20,000 U/mL. Store at –20°C. 2. Spermidine: Obtained from Calbiochem Corporation (La Jolla, CA). A 1 M stock solution should be prepared and then diluted to give a 10 mM working solution. Store at room temperature. 3. Agarose: 2.5% agarose gel containing 0.5 mg/mL ethidium bromide in 1X TBE buffer (0.09 M Tris-borate, 0.002 M EDTA). 4. Loading buffer: 20% sucrose (w/v), 0.25% bromophenol blue (w/v), 0.25% xylene cyanole (w/v). Store at room temperature. 5. Molecular weight markers, e.g., ØX174 RF DNA/HaeIII markers. Store at –20°C.

3. Methods 3.1. DNA Extraction Genomic DNA is extracted from buffy coat preparations from venous samples collected into 3.8% trisodium citrate (1:9 ratio of anticoagulant to blood). The buffy coats may be stored at –20°C in order to batch tests. High molecular weight DNA is extracted from peripheral blood leukocytes using a modified version of a method published by Bell (2) (see Note 1). 1. Defrost frozen buffy coat specimens at 37°C. Transfer defrosted buffy coat to a 17 × 100 mm polypropylene tube and rinse the storage vial with cold cell lysis buffer. Make the total volume up to 10 mL with cold cell lysis buffer and mix gently by inversion. 2. Incubate on ice 15 min. 3. Centrifuge at 1000g for 10 min at 4°C to pellet the leukocytes. 4. Discard the supernatant carefully. Add 200 μL of TE buffer and vortex to resuspend the pellet. 5. Add 400 μL of nuclear lysis buffer and mix gently until the solution goes clear. 6. Add 600 μL of phenol/chloroform and mix gently. 7. Centrifuge at 1000g for 10 min at 4°C. 8. Carefully remove the supernatant in to a clean 1.5-mL tube. 9. Add 20 μL 3 M sodium acetate. 10. Add 1 mL ice cold ethanol and mix vigorously until the DNA can be seen as a white filamentous precipitate.

272

Brown

11. Centrifuge at full speed in a benchtop microfuge for 2 min to pellet the DNA. 12. Gently remove the supernatant and then add 500 μL 70% ethanol and centrifuge again at full speed for 1 min. 13. Remove as much of the ethanol as possible and allow the DNA pellet to dry. 14. Resuspend the DNA pellet in 40 μL of sterile distilled water. The solution should be clear.

3.2. Amplification of the Prothrombin Gene Genomic DNA is amplified using the polymerase chain reaction based on the method of Saiki et al. (3). Optimal PCR amplification of the target sequence may need to be varied when using different thermal cyclers. 1. Each PCR is performed in a total volume of 100 μL, which is set up on ice. (see Note 5). Combine the following: 80.5 μL sterile water, 10 μL 10X PCR buffer, 6 μL 25 mM MgCl2 (final concentration 1.5 mM), 1 μL 20 mM dNTPs (final concentration 200 μmols of each dNTP), 1 μL of amplification primers (containing 50 pmols of each primer), 0.5 μL (2 U) of the DNA polymerase (e.g., Amplitaq), and 2 μL template DNA (0.5–1.0 μg). 2. Vortex the PCR reaction mix and then transfer to a thermal cycler (see Note 6) and heat at 94°C for 5 min to denature the DNA followed immediately by: 52°C for 20 s, 74°C for 20 s, and 94°C for 20 s. A total of 40 cycles of amplification should be performed. On the final cycle the extension time should be increased to 10 min. 3. Check the efficiency and specificity of the PCR reaction by running 8 μL of the product on a 1% agarose gel containing ethidium bromide in 1X TBE buffer, including a DNA size marker in the first lane. 4. Visualize on a UV transilluminator and check the size of the PCR products. The predicted size is 345 bp.

3.3. Restriction Enzyme Digest of the PCR Product The engineered oligonucleotides plus the G to A transition at position 20210 of the prothrombin gene create a recognition site for the restriction enzyme HindIII, which can be detected following an incubation step and visualization of the DNA fragments on agarose gel (see Note 9). 1. Transfer 18 μL the of PCR product in to a clean tube. 2. Add 1 μL of 10 mM spermidine and 1 μL (20 U) of HindIII enzyme. Mix well and incubate overnight at 37°C (see Note 8). 3. Add 4 μL of loading buffer to the digest and load the samples onto a 2.5% agarose gel containing ethidium bromide in 1X TBE buffer including DNA size markers in the first lane. 4. Visualize the DNA fragments on a UV transilluminator.

3.4. Interpretation of Results (see Fig. 1) If G/G is present at position 20210, HindIII digestion will result in a 345-bp (uncut) fragment. This represents a normal genotype. If A/A is present at posi-

Screening for the G to A Transition

273

Fig. 1. HindIII digest of 345-bp fragment of the prothrombin gene. The arrow at 322 bp denotes the fragment produced when the G to A transition at position 20210 results in the creation of a HindIII recognition site. Lane 1, ØX174/HaeIII markers; lane 2, normal genotype; lane 3, heterozygous genotype; lane 4, heterozygous genotype; lane 5, normal genotype; lane 6, normal genotype.

tion 20210, then HindIII digestion will produce fragments of size 23 and 322 bp. This represents a homozygous genotype. If A/G are present at position 20210, HindIII digestion will produce fragments of size 23, 322, and 345 bp. This represents a heterozygous genotype. 4. Notes 1. DNA extraction kits that do not use phenol chloroform are available from a number of molecular biology suppliers. 2. Store all DNA specimens as it is useful to have a comprehensive DNA collection to study as and when new thrombophilia states are identified. 3. It is very important to use working procedures which will minimize the risk of contamination, e.g., designated pre- and post-PCR areas, positive displacement pipets, aerosol resistant tips, sterile water. 4. Positive and negative controls should be included with each set of reactions. A heterozygote is appropriate as a positive control. Negative controls consist of the total PCR reaction mixture, without template DNA, amplified together with the test DNA samples to ensure that no contamination of reagents has occurred. 5. 50 μL (or less) can be used as a PCR reaction volume. Adjust the components volumes accordingly. 6. It may be necessary to overlay PCR reactions with 100 μL of mineral oil depending on the type of thermal cycler used. 7. When a number of patients are being tested it may be appropriate to make a master mix of the PCR reagents and aliquot 98 μL to each test.

274

Brown

8. The overnight incubation step in the enzyme digest technique can be shortened, but times less than 4 h may produce undigested fragments. Only completely digested PCR products should be interpreted. 9. Digest products may be run on 6% nondenaturing polyacrylamide gels for enhanced resolution. 10. The prothrombin 20210 mutation analysis described produces a distinct result with no borderline values. The patient is normal, heterozygous or homozygous for the mutation.

References 1. Poort, S. R., Rosendaal, F. R., Reitsma, P. H., and Bertina, R. M. (1996) A common genetic variation in the 3'-untranslated region of the prothrombin gene is associated with elevated plasma prothrombin levels and an increase in venous thrombosis. Blood 88(10), 3698–3703. 2. Bell, G. I., Karman, J. H., and Rutter, W. J. (1981) Polymorphic DNA region adjacent to the 5' end of the human insulin gene. Proc. Natl. Acad. Sci. USA 78(9), 5759–5763. 3. Saiki, R. K., Scharf, S., Faloona, F., Mullis, K. B., Horn, J. T., Erlich, H. A., and Arnheim, N. (1985) Enzymatic amplification of the b-globin genomic sequences and restriction site analysis for the diagnosis of sickle cell anaemia. Science 230, 1350–1354.

Factor V Leiden Mutation

275

27 Screening for the Factor V Leiden Mutation Karen P. Brown 1. Introduction Familial clustering of thrombosis suggests that genetic risk factors are important in the pathogenesis of venous thromboembolism. However, until recently, well defined genetic defects such as antithrombin, protein C and protein S deficiencies accounted for less than 10% of patients with thrombosis. Resistance to the anticoagulant effect of activated protein C (APC) was first described as a cause of familial thrombophilia by Dahlback et al. (1). Resistance to APC has since emerged as the most common hereditary defect found in patients with venous thrombosis (1), and may account for more than one fifth of all cases of thrombophilia (2). Bertina et al. demonstrated that the APC phenotype was associated with a specific mutation in the factor V gene (3). APC resistance in more than 90% of cases is caused by a single point mutation in the gene for factor V (G to A transition at nucleotide position 1691), which predicts the replacement of Arginine (R) 506 in the APC cleavage site with a Glutamine (Q). The mutation is named Factor V Leiden, and occurs at a CpG dinucleotide, a mutation hotspot in the human genome. Inactivation of membrane bound factor Va by APC occurs through a series of three sequential proteolytic events in the heavy chain of factor V. APC cleavage at Arg 506 is the first event and is required for the subsequent exposure of APC cleavage sites at Arg 306 and Arg 679. The factor V Leiden mutation leads to a loss of positive charge at the APC cleavage site at Arg 506 resulting in an inefficient inactivation of factor Va. Reduced sensitivity to APC degradation, and increased thrombin generation, is the molecular basis for a hypercoagulable, state which constitutes a risk factor for thrombosis (4).

From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ

275

276

Brown

APC resistance has recently become the most prevalent coagulation abnormality associated with venous thrombosis and has been reported to occur in 20–65% of patients with a history of venous thromboembolism (5). However, the abnormality has also been described in the asymptomatic general population at a prevalence of 3–11% (6). The absence of thrombotic disease in normal heterozygote carriers suggests that symptomatic thrombosis requires the simultaneous presence of both factor V Leiden and additional synergistic factors (inherited or acquired). Data suggests a higher risk of thrombosis in patients who have additional thrombophilic genetic defects (7). There is evidence that APC resistance combined with exogenous factors, may play an important role in the early manifestations of thromboembolism during infancy and childhood (8). Allelic frequency has been found to differ around the world. Allele frequency in Europeans has been reported at 4.4% with a high prevalence among Greeks (7%). The factor V Leiden mutation has not been reported in significant numbers in populations from Africa, Southeast Asia, Australasia and the Americas, and may partly explain the rarity of thromboembolic disease in these populations (9). Heterozygosity for the factor V Leiden mutation is associated with a five- to tenfold increased risk of thrombosis, whereas homozygous cases have a 50- to 100-fold increase in the risk of thrombosis (10). Factor V Leiden has also been associated with a four- to fivefold increased risk of recurrent thrombosis. Data suggests that patients with venous thromboembolism affected by factor V Leiden may require more prolonged anticoagulation than those without the mutation (11). However, several homozygotes are reported to remain asymptomatic even in the presence of triggering conditions (12). It is important to attempt to diagnose a thrombophilia state in patients with a thrombotic tendency in order to provide appropriate management, especially during at risk situations, and to prevent secondary episodes both in the patients themselves and in asymptomatic relatives identified through family studies. Heterozygous and homozygous phenotypes for APC resistance can be distinguished on the basis of a normalised APC sensitivity ratio, but the functional assay alone is insufficient for a definitive diagnosis as a range of functional test values in patients with and without the factor V Leiden mutation occasionally overlap. DNA analysis confirms the diagnosis of heterozygosity or homozygosity for the factor V Leiden mutation made by functional coagulation tests. DNA-based testing is not affected by the therapeutic use of anticoagulants, or the presence of coagulation factor abnormalities or inhibitors. A number of methods for detecting the factor V Leiden mutation have been reported (13–16). Direct sequencing is the most accurate method for genotyping, but is complicated and time consuming, and not suitable when large numbers of individuals require testing within a short “turn-round” time.

Factor V Leiden Mutation

277

The G to A transition at nucleotide position 1691 is associated with the loss of a recognition site for the restriction enzyme MnlI. This provides a rapid means of screening individuals for the factor V Leiden mutation. The APC cleavage site is located between Arg 506 and Gly 507 which are encoded by nucleotides 1690–1695 in exon 10 of the factor V gene. In the following method this area of exon 10 is amplified using the polymerase chain reaction (PCR) from genomic DNA using primers derived from a paper by Beauchamp et al. (6). The PCR product is then incubated with MnlI restriction enzyme and the fragments generated separated by agarose gel electrophoresis. The MnlI factor V Leiden detection method is a useful screening method which is ‘robust’ and requires only basic PCR experience to perform. Four base pairs create the MnlI recognition site (GAGG). An alternative code for Arg at this site (CGC or CGG) would also abolish the MnlI recognition site indicating the presence of a factor V Leiden mutation, but the individual would not exhibit APC resistance since the amino acid at position 506 would still be an Arg, preserving the APC cleavage site. An alternative method for detecting the G to A transition is also described using allele-specific primers. This approach is specific for the G to A base mutation. The basis for allele discrimination using allele specific primers is that a primer mismatched at its 3'-end with a DNA template will be less effectively used in the PCR reaction than one which is entirely complementary. Using intron sequence derived from Cripe et al. (19) two downstream oligonucleotide primers were designed (IVS 10 position 8 to position 1691 in exon 10, the 3'-terminal nucleotide of which was either complementary to the mutant sequence (mutation specific primer) or to the wildtype A sequence. Amplification using a common upstream primer and either the normal or mutant specific downstream primer generates a fragment when either the G or A or both are present. The specificity of the allele specific primers is improved by incorporating an additional mismatch at the penultimate position (T to A). As an internal amplification control a β globin fragment is coamplified. Using two reactions per patient, including either the normal or mutant primer in each, allele specific amplification is carried out and the results directly visualised by agarose gel electrophoresis. The specificity is incorporated in to the amplification reaction itself so no additional steps are required. Stringent PCR conditions are critical to the success with which sequence specific reactions discriminate between two different alleles. Variation in cycling protocols may be necessary. 2. Materials All reagents must be prepared using sterile distilled water. Unless specified, all chemicals were obtained from either BDH Laboratory Supplies (Poole, UK), or from the Sigma Corporation (Poole, UK) and were AnalaR or reagent grade.

278

Brown

2.1. DNA Extraction 1. Cell lysis buffer: 0.32 M sucrose, 1% triton X-100 (v/v), 5 mM MgCl2, 10 mM Tris-HCl, pH 7.5. Store at 4°C. 2. TE buffer, pH 8.0: 10 mM Tris-HCl, pH 8.0, 1 mM EDTA. Store at room temperature. 3. Nuclear lysis buffer: 0.32 M lithium acetate, 2% (w/v) lithium dodecyl sulphate, 10 mM Tris-HCl, pH 8.0, 1 mM EDTA. Store at room temperature. 4. Biophenol/Chloroform/ISA: Available from many suppliers (e.g., Camlab, Cambridge, UK). Store above 4°C. 5. 3 M sodium acetate, pH 5.5. Store at room temperature. 6. Absolute ethanol. Store at –20°C. 7. 70% Ethanol. Store at room temperature. 8. Sterile distilled water.

2.2. PCR Amplification of the Factor V Gene and Product Detection 1. DNA polymerase: Thermus aquaticus DNA polymerase, e.g., AmpliTaq 5 U/mL (Perkin-Elmer Corporation, Roche Molecular Systems Warrington, UK). Store at –20°C. 2. 10X PCR buffer: 100 mM Tris-HCl, pH 8.3, 500 mM KCl. Usually supplied with the DNA polymerase. Store at –20°C. 3. 25 mM MgCl2: Frequently included in the PCR buffer or supplied as an additional reagent with the DNA polymerase. Store at –20°C. 4. 20 mM dNTPs: 100 mM stock solutions are available from many manufacturers, e.g., Pharmacia LKB Biotechnology, Milton Keynes, UK. Store at –20°C. 5. PCR primers: Synthetic oligonucleotide primers can be obtained from a number of molecular biology suppliers. The primers are used at a concentration of 50 pmols/μL. Store at –20°C. Primers for the Mnl I-based method are based on the paper of Beauchamp et al. (6). Upstream primer (nucleotides 1623-1642) 5'-CAT GAG AGA CAT CGC CTC TG and downstream primer (Intron 10: nucleotides 45–68) 5'-GAC CTA ACA TGT TCT AGC CAG AAG. 6. Thermal cycler, e.g., MJ-Research PTC-200 peltier programable thermal cycler supplied by Genetic Research Instrumentation Ltd (Essex, UK). 7. Loading buffer: 20% sucrose (w/v), 0.25% bromophenol blue (w/v), 0.25% xylene cyanole (w/v). Store at room temperature. 8. ØX174 RF DNA/HaeIII size markers. Store at –20°C. 9. Agarose gels: 1% agarose containing 0.5 μg/mL ethidium bromide in 1X TBE buffer (0.09 M Tris-borate, 0.002 M EDTA).

2.3. Restriction Enzyme Digestion of PCR Products 1. MnlI: Obtained from New England Biolabs Inc., UK. Supplied at 5000 U/mL. Store at –20°C. 2. Spermidine: Obtained from Calbiochem Corporation (La Jolla, CA). Prepare a 1 M stock solution and dilute this to a 10 mM working solution. Store at room temperature.

Factor V Leiden Mutation

279

3. Agarose: 2% agarose gel containing 0.5 μg/mL ethidium bromide in 1X TBE buffer (0.09 M Tris-borate, 0.002 M EDTA). 4. Loading buffer: 20% sucrose (w/v), 0.25% bromophenol blue (w/v), 0.25% xylene cyanol (w/v). Store at room temperature. 5. ØX174 RF DNA/HaeIII size markers.

2.4. Allele-Specific Amplification of the Factor V Leiden Mutation This approach uses an identical method to the Mnl-I method but different primers. A single common upstream primer is employed: 5'-ACC ATG ATC AGA GCA GTT CA but two different downstream primers one of which is complementary to the wild type factor V sequence: 5'-ACA AAA TAC CTG TAT TCA TC and the other to the factor V Leiden sequence: 5'-ACA AAA TAC CTG TAT TCA TT. Primers for part of the β globin chain are used as amplification control primers: Upstream 5'-GGG CAT AAA AGT CAG GGC AGA GCC ATC and downstream: 5'-TGT GAC TAC GTT AGT AAG CAG ACA AAG. 3. Methods 3.1. DNA Extraction (see Note 1) The part of exon 10, which encodes the APC cleavage site at Arg 506 in the factor V gene is amplified from genomic DNA. Genomic DNA is extracted from buffy coat preparations from venous samples collected in to 3.8% trisodium citrate (1:9 ratio of anticoagulant to blood). The buffy coats may be stored at –20°C in order to batch tests. High molecular weight DNA is extracted from peripheral blood leukocytes using a modified version of a method published by Bell (17). 1. Defrost frozen buffy coat specimens at 37°C. Transfer defrosted buffy coat to a 17 × 100 mm polypropylene tube and rinse the storage vial with cold cell lysis buffer. Make the total volume up to 10 mL with cold cell lysis buffer and mix gently by inversion. 2. Incubate on ice 15 min. 3. Centrifuge at 1000g for 10 min at 4°C to pellet the leukocytes. 4. Discard the supernatant carefully. Add 200 μL of TE buffer and vortex to resuspend the pellet. 5. Add 400 μL of nuclear lysis buffer and mix gently until the solution goes clear. 6. Add 600 μL of phenol/chloroform and mix gently. 7. Centrifuge at 1000g for 10 min at 4°C. 8. Carefully remove the supernatant in to a clean 1.5-mL tube. 9. Add 20 μL 3 M sodium acetate. 10. Add 1 μL ice cold ethanol and mix vigorously until the DNA can be seen as a white filamentous precipitate. 11. Centrifuge at full speed in a benchtop minifuge for 2 min to pellet the DNA.

280

Brown

12. Gently remove the supernatant and then add 500 μL 70% ethanol and centrifuge again at full speed for 1 min. 13. Remove as much of the ethanol as possible and allow the DNA pellet to dry. 14. Resuspend the DNA pellet in 40 μL of sterile distilled water. The solution should be clear.

3.2. Amplification of the Factor V Gene Genomic DNA is amplified using the polymerase chain reaction based on a method by Saiki et al. (18). Optimal PCR amplification of the target sequence may need to be varied when using different thermal cyclers. 1. A 100-μL amplification reaction is set up and comprises: 80.5 μL sterile water, 10 μL of 10X PCR buffer, 6 μL 25 mM MgCl2, 1 μL 20 mM dNTPs, 1 μL containing 50 pmols of each amplification primer, 0.5 μL (2 U) of the thermostable DNA polymerase, e.g., AmpliTaq, and 2 μL of template DNA (0.5–1.0μg) (see Notes 2–5). 2. Vortex the PCR reaction mix briefly and then transfer to a thermal cycler (see Note 4) and heat at 94°C for 5 min immediately followed by a biphasic amplification protocol comprising: 55°C 30 s, 94°C 20 s for 40 cycles. On the last cycle the extension time should be increased to 10 min. 3. Transfer 8 μL of the PCR product into a clean tube and add 2 μL loading buffer. 4. Electrophorese the PCR product in 1% agarose gel containing ethidium bromide in 1X TBE buffer, including a DNA size marker in the first lane. 5. Visualize the digest products on a UV transilluminator and photograph. The predicted fragment size is 147 bp.

3.3. Restriction Enzyme Digest of the PCR Product The G to A transition results in the loss of a recognition site for the restriction enzyme MnlI, which can be detected following an incubation step and visualization of the DNA fragments on agarose gel. 1. Transfer 18 μL of PCR product in to a clean tube. 2. Add 1 μL 10 mM spermidine, 1 μL BSA, and 1 μL (5 U) of the MnlI enzyme. Mix well and incubate overnight at 37°C (see Note 6). 3. Add 4 μL loading buffer to the digested products. 4. Electrophorese the DNA fragments in 2% agarose gel containing ethidium bromide in 1X TBE buffer including DNA size markers in the first lane (see Note 7). 5. Visualize the DNA fragments on a UV transilluminator and photograph (see Fig. 1).

3.4. Allele-Specific Amplification for the Detection of the Factor V Leiden Mutation 1. For each patient sample to be tested two reaction tubes are required. Each PCR is performed in a total volume of 100 μL. 2. For the “normal allele-specific reaction” combine 78.5 μL of sterile water with 10 μL of 10X PCR buffer, 6 μL of 25 mM MgCl2, 1 μL of 20 mM dNTPs, and 1μL

Factor V Leiden Mutation

281

Fig. 1. MnlI digest of 147-bp fragment of factor V gene. The arrow at 122-bp denotes the fragment produced when the G to A transition at position 1691 results in the loss of an Mnl I recognition site. Lane 1, ØX174 DNA/HaeIII markers; lane 2, normal genotype; lane 3, heterozygous genotype; lanes 4–7, normal genotype; lane 8, heterozygous genotype; lane 9, homozygous genotype; lanes 10,11, normal genotype.

3.

4.

5. 6. 7.

(50 pmols) β globin primers. 1 μL (50 pmols) of the common upstream primer and 1μL (50 pmols) of the wildtype (normal) downstream primer. Mix and add 2 μL of template DNA and 0.5 μL (2 U) of a thermostable DNA polymerase, e.g., AmpliTaq. For the “mutant allele-specific reaction” combine 78.5 μL of sterile water with 10 μL of 10X PCR buffer, 6 μL of 25 mM MgCl2, 1 μL of 20 mM dNTPs, and 1μL (50 pmols) β globin primers. 1 μL (50 pmols) of the common upstream primer and 1 μL (50 pmols) of the mutant downstream primer. Mix and add 2 μL of template DNA and 0.5 μL (2 U) of a thermostable DNA polymerase, e.g., AmpliTaq. Vortex the PCR mix then transfer to a thermal cycler and heat at 94°C for 5 min, immediately followed by: 94°C for 20 s, 45°C for 20 s, and 72°C for 20 s. 40 cycles of amplification should be performed and on the last cycle the extension time should be increased to 10 min. Transfer 8 μL of the PCR product in to a clean tube and add 2 μL of loading buffer. Electrophorese the PCR product in a 1% agarose gel containing ethidium bromide in 1X TBE. Include a size marker in the first lane. Visualize the gel on a UV transilluminator and photograph (see Fig. 2).

282

Brown

Fig. 2. Allele-specific PCR for the Factor V Leidien mutation. Amplification patterns for five individuals with the the possible factor V 1691 genotypes are shown. DNA from a normal individual (FV 1691 G/G) only produces a PCR product of 222bp with the normal primer (patients 2–4).

3.5. Interpretation of Results If A/A is present at position 1691, MnlI digestion will produce fragments of sizes 25, 37, and 85 bp (Fig. 1). This represents a normal genotype. If G/G is present at position 1691, MnlI digest will produce fragments of size 25 and 122 bp. This represents a homozygous genotype. If A/G is present at position 1691, MnlI digest will produce fragments of size 25, 37, 85, and 122 bp. This represents a heterozygous genotype. In the case of allele-specific amplification, if an individual is heterozygous for the factor V 1691 G/A mutation, then a PCR product is seen with both the normal and the mutant specific primer reactions (Fig. 2: patient 1). DNA from an individual who is homozygous for this mutation (FV 1691 A/A) produces a PCR product in the reaction with the mutant specific primer only (patient 5). When a 222-bp fragment is absent, the 657-bp β globin product must be present to determine that a successful PCR reaction has taken place. 4. Notes 1. Store all DNA specimens because although the factor V Leiden mutation accounts for a significant proportion of thrombophilia cases, a predisposing cause for

Factor V Leiden Mutation

2.

3.

4. 5. 6.

7.

283

thrombosis remains unidentifiable in a number of patients. It is likely that in the future new thrombophilia states will be identified, and it may be useful to already have a comprehensive DNA collection. One of the APC cleavage sites in factor VIII is encoded by a sequence of nucleotides, which also involves a CpG dinucleotide and so it may be possible that a similar defect in APC mediated inactivation of factor VIIIa may also be associated with a predisposition to thrombosis (20). It is very important to use working procedures which will minimise the risk of contamination, e.g., designated pre- and post-PCR areas, positive displacement pipets, aerosol resistant tips, sterile water. Positive and negative controls should be included with each set of reactions. A factor V Leiden heterozygote is appropriate as a positive control. Negative controls consist of the total PCR reaction mixture without template DNA cycled along with the tests to confirm that no contamination of reagents has occurred. It may be necessary to overlay PCR reactions with 100 μL of mineral oil depending on the type of thermal cycler used. When a number of patients are being tested it may be appropriate to make a master mix of the PCR reagents and aliquot 98 μL to each test. The overnight incubation step in the MnlI enzyme digest technique can be shortened, but times less than 4 hours may produce undigested fragments. It may be useful when electrophoresing the MnlI digest products to run a sample of undigested PCR product in the last lane. This makes it easier to detect undigested fragments in the test digests. Only completely digested PCR products should be interpreted. MnlI digest products may be run on 6% polyacrylamide gels for better resolution. The 25- and 37-bp fragments are not clear on 2% agarose gels but they are not as important as the 85- and 122-bp fragments for genotype interpretation.

References 1. Dahlback, B., Carlsson, M., and Svensson, P. J. (1993) Familial thrombophilia due to a previously unrecognised mechanism characterised by poor anticoagulant response to activated protein C: prediction of a cofactor to activated protein C. Proc. Natl. Acad. Sci. USA 90, 1004–1008. 2. Koster, T., Rosendaal, F.R., de Ronde, H., Briet, F., Vandenbroucke, J.P., and Bertina, R.M. (1993) Venous thrombosis due to poor anticoagulant response to activated protein C:Leiden thrombophilia study. Lancet 342, 1503–1506. 3. Bertina, R. M., Koeleman, B. P. C., Koster, T., Rosendaal, F. R., Dirven, R. J., de Ronde, H., van der Velden, P., A., and Reitsma, P. H. (1994) Mutation in blood coagulation factor V associated with resistance to activated protein C. Nature 369, 64–67. 4. Kalafatis, M., Bertina, R. M., Rand, M. D., and Mann, K. G. (1995) Characterisation of the molecular defect in factor V R506Q. J. Biologic. Chem. 270, 4053–4057. 5. Halbmeyer, W-M., Haushofer, A., Schon, R., and Fischer, M. (1994) The prevalence of poor anticoagulant response to activated protein C resistance (APC resis-

284

6.

7. 8.

9.

10.

11.

12.

13.

14.

15.

16. 17.

18.

Brown

tance) among patients suffering from stroke or venous thrombosis and among healthy subjects. Blood Coagul. Fibrinolysis 5, 51–57. Beauchamp, N. J., Daly, M. E., Hampton, K. K., Cooper, P. C., Preston, F. E., and Peake, I. R. (1994) High prevalence of a mutation in the factor V gene within the UK population: relationship to activated protein C resistance and familial thrombosis. Br. J. Haematol. 88, 219–222. Rees, D. C., Cox, M., and Clegg, J. B. (1995) World distribution of factor V Leiden. Lancet Oct 28;346,(8983), 1133–1134. De-Stefano, V. and Leone, G. (1995) Resistance to activated protein C due to mutated factor V as a novel cause of inherited thrombophilia. Haematologica 80 (4), 344–356. Nowak-Gottl, U., Koch, H.G., Aschka, I., Kohlhase, B., Vielhaber, H., Kurlemann, G., Oleszcuk-Raschke, K., Kehl, H. K., Jurgens, H., and Schneppenheim, R. (1996) Resistance to activated protein C (APCR) in children with venous or arterial thromboembolism. Br. J. Haematol. Mar;92(4), 992–998. Dahlback, B. (1995) New molecular insights in to the genetics of thrombophilia. Resistance to activated protein C caused by Arg 506 to Gln mutation in factor V as a pathogenic risk factor for venous thrombosis. Thromb. Haemostasis Jul;74(1), 139–148. Ridker, P. M., Miletich, J. P., Stampfer, M. J., Goldhaber, S. Z., Lindpaintner, K., and Hennekens, C. H. (1995) Factor V Leiden and risks of recurrent idiopathic venous thromboembolism. Circulation Nov 15;92(10), 2800–2802. Greengard, J. S., Eichinger, S., Griffin, J.H., and Bauer, K. A. (1994) Brief report: variability of thrombosis among homozygous siblings with resistance to activated protein C due to an Arg to Gln mutation in the gene of factor V. N. Engl. J. Med. 331, 1559–1562. Beauchamp, N. J., Daly, M. E., Cooper, P. C., Preston, F. E., and Peake, I. R. (1994) Rapid two-stage PCR for detecting factor V G1691A mutation. Lancet 344, 694–695. Rabes, J. P., Trossaert, M., Conard, J., Samama, M., Giraudet, P., and Boileau, C. (1995) Single point mutation at Arg 506 of factor V associated with APC resistance and venous thromboembolism: improved detection by PCR-mediated sitedirected mutagenesis. Thromb. Haemostasis Nov;74(5), 1379-1380. van-de-Locht, L. T., Kuypers, A. W., Verbruggen, B. W., Linssen, P. C., Novakova, I. R., and Mensink, E. J. (1995) Semi-automated detection of the factor V mutation by allele specific amplification and capillary electrophoresis. Thromb. Haemostasis Nov;74(5), 1276–1279. Gandrille, S., Alhenc-Gelas, M., and Aiach, M. (1995) A rapid screening method for the factor V Arg 506 to Gln mutation. Blood Coagul. Fibrinolysis 6, 245–248. Bell, G. I., Karman, J. H., and Rutter, W. J. (1981) Polymorphic DNA region adjacent to the 5' end of the human insulin gene. Proc. Natl. Acad. Sci. USA 78(9), 5759–5763. Saiki, R. K., Scharf, S., Faloona, F., Mullis, K. B., Horn, J. T., Erlich, H. A., and Arnheim, N. (1985) Enzymatic amplification of the β-globin genomic sequences

Factor V Leiden Mutation

285

and restriction site analysis for the diagnosis of sickle cell anaemia. Science 230, 1350–1354. 19. Cripe, L. D., Moore, K. D., and Kane, W. H. (1992) Structure of the gene for human coagulation factor V. Biochemistry 31, 3777–3785. 20. Gitschier, J., and Wood, W. I. (1992) Sequence of exon-containing regions of the human factor V gene. Human Mol. Genet. 1, 199,200.

Multiple PCR

287

28 Multiplex PCR for Detection of the Prothrombin 3'-UTR (G20210A) Polymorphism and the Factor V Leiden Mutation Gillian Mellars, P. Vincent Jenkins, and David J. Perry 1. Introduction Prothrombotic evaluation of patients with a history—and in particular a family history—of venous thromboembolic disease is becoming increasingly important as our understanding of the molecular abnormalities that underlie this clinical disorder increases. A recently described G→A polymorphism at position 20210 in the 3'-untranslated region of the prothrombin gene (F2 3'UTR) has been found to be associated with an increased risk of venous thrombotic disease. In the Leiden Thrombophilia Study (LETS), the prevalence of carriers of the 20210 A allele in the healthy population was 2.3%, among patients with a single objectively proven DVT 6.2% and in a selected group of patients with a personal and family history of venous thrombosis 18%. In order to simplify detection of the F2 3'-UTR polymorphism and the Factor V Leiden mutation (Arg506Gln), a simplified multiplex method has been developed in our laboratory, using previously described primers (1,2), that, in the presence of either mutation, create a novel HindIII site. While the F2 3'-UTR variant represents a common but relatively low risk factor for venous thrombosis, it may not warrant an introduction of a specific PCR test. The multiplex method allows the detection of the F2 3'-UTR variant alongside factor V genotyping at no significant extra cost in time or resources.

From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ

287

288

Mellars, Jenkins, and Perry

2. Materials 2.1. Amplification of the Factor V Leiden Mutation and the F2 3'-UTR Polymorphism Amplification reactions are carried out in 50-μL reaction volumes comprising: 1. 16 mM (NH4)2SO4, 67 mM Tris-HCl, pH 8.8, 0.01% Tween 20, 0.125 mM dNTPs, 1.5 mM MgCl2, and 1.25 U a thermostable DNA polymerase. 2. 25 pmol of the F2 3'-UTR upstream primer 5'-TCTAGAAACAGTTGCCT-GGC and 25 pmol of the downstream primer 5'-ATACCACTGGGAGCATTGAA*GC (where A* is a foreign nucleotide). 3. 100 pmol of the factor V gene upstream primer 5'-TCAGGCAGGAACAACACCAT primer and 100 pmol of the downstream primer 5'-GGTTACTTCAAGGACAAAATACCTGTA-A*A*G*CT (where A*A*G* are foreign nucleotides). 4. Thermal cycler. 5. Light mineral oil (e.g., Sigma). 6. 0.5-mL sterile PCR tubes (e.g., Advanced Biotechnologies, Epsom, Surrey, UK). 7. Loading buffer: 40% sucrose, 0.05% bromophenol blue, 0.05% xylene cyanole.

2.2. HindIII Digestion of the Amplified PCR Product 1. 2. 3. 4.

Amplified PCR product from Subheading 2.1. Hind III restriction enzyme at 10 U/μL. U-shaped microtiter plates (e.g., Nunc immunoplate). 1% Seakem® LE agarose + 1% NuSieve® GTG® agarose (Flowgen, Lichfield, UK) gel in 1X Tris-Borate-EDTA (TBE). 5. Loading buffer: 40% Sucrose (w/v), 0.05% bromophenol blue (w/v), 0.05% xylene cyanol (w/v).

3. Methods 3.1. Amplification of the Factor V Leiden Mutation and the F2 3'-UTR Polymorphism 1. Prepare a “Master Mix” comprising all the reagents minus the DNA polymerase and the DNA in a “clean area” using aerosol resistant tips. Irradiate the master mix on a UV transilluminator for 10 min. Add the DNA polymerase, vortex briefly, and place on ice until required. 2. Add 49 μL of the master mix to a sterile 0.5-mL sample tube, 1.5 μL of DNA and overlay with 20–30 μL of light mineral oil. A negative control should be included in each batch of amplifications together with a heterozygous control for the factor V Leiden and Prothrombin 3'-UTR Polymorphism. 3. Carry out 40 cycles of amplification consisting of an initial denaturation at 94°C for 4 min then 94°C for 30 s, 56°C for 60 s, and 72°C for 30 s. On the final cycle, the extension time was increased to 10 min. 4. Following amplification mix 5 μL of each PCR product with 2 μL of loading buffer and electrophorese in a 2% agarose gel to check the efficiency and specificity of the amplification reaction.

Multiple PCR

289

3.2. HindIII Digestion of the PCR Product 1. Place a U-well microtiter place on ice and mark the required number of wells. Using a repeating pipet, dispense 2 μL of HindIII into all the wells required. 2. Add 40 μL of the PCR product to each well, mix gently, and seal the plate. 3. Incubate at 37°C overnight (12–16 h). 4. Add 10 μL of loading buffer to each well and load 45 μL onto a 1% agarose/1% Nuseive GTG gel (in 1X TBE). Lane 1 should contain a size marker, e.g., ØX174/ HaeIII. 5. Electrophorese until the xylene cyanol marker is almost at the end of the gel. Visualize under UV light and photograph.

3.3. Amplification Generates: 1. A 345-bp fragment that spans the region of the prothrombin gene encompassing the F2 3'-UTR polymorphism 2. A 241-bp fragment that spans the region of the factor V gene encoding the factor V Leiden mutation.

The use of the mutant primers creates a restriction site for the enzyme HindIII in both cases when either or both of the substituted nucleotides are present. The F2 3'-UTR allele containing the G→A mutation generates two fragments of 322-bp and 23-bp following digestion with HindIII and a factor V allele with the Leiden mutation generates fragments of 209-bp and 32-bp following digestion with HindIII. References 1. Poort, S. W., Rosendaal, F. R., Retisma, P. H., and Bertina, R. M. (1996) A common genetic variation in the 3'-untranslated region of the prothrombin gene is associated with elevated plasma prothrombin levels and an increase in venous thrombosis. Blood 88, 3698–3703. 2. Gandrille, S., Alhenc-Gelas, M., and Aiach, M. (1995) A rapid screening method for the Factor V Leiden Arg 506→Gln mutation. Blood Coag. Fibrinol. 6, 245–248. 3. Brown, K., Luddington, R., Williamson, D., Baker, P., and Baglin, T. (1997) Risk of venous thromboembolism associated with a G to A transition at position 20210 in the 3'-untranslated region of the prothrombin gene. Br. J. Haematol. 98, 907–909.

Isoelectric Focusing

291

29 Isoelectric Focusing and Immunodetection of Plasma Antithrombin Martina Daly 1. Introduction The first studies of plasma protein variation relied predominantly on conventional electrophoretic methods in media such as starch, agar, or cellulose acetate, which separated molecules on the basis of their relative differences in net charge and size. The introduction of isoelectric focusing in polyacrylamide gels (IEF/PA) led to the discovery of additional variability previously undetected by conventional electrophoretic techniques. IEF/PA separates molecules on the basis of their isoelectric points (pI) in a pH gradient generated by the application of an electric field to a mixture of buffer components, known as carrier ampholytes, which are present within a polyacrylamide matrix. Thus, it is possible to discriminate between molecules having a difference in pI as little as 0.01 pH units. The exact composition of isolectric focusing gels may be varied depending on the protein under investigation. In particular, alternative pH gradients may be generated by mixing ampholytes in the appropriate pH range. When used in combination with a simple “native” blotting procedure (1), the basic IEF/PA protocol described below has proven successful in our hands for studying microheterogeneity of plasma antithrombin and, with minor modifications to optimize results, it may be used to analyze any acidic protein of interest, provided a specific antiserum is available. 2. Materials 2.1. Preparation of the Gel/Application of Samples and Electrofocusing The following solutions should be prepared using deionized water. 1. Solution A: 11.64% acrylamide, 0.36% bisacrylamide. Store in a dark bottle at 4°C for up to 2 mo (see Note 1). From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ

291

292

Daly

2. Solution B: 40% sucrose. Prepare fresh when required. 3. Stock acrylamide solution: 100 mL solution A, 50.8 mL solution B, 37.4 mL water. Filter and store in a dark bottle at 4°C for up to 2 mo. 4. pH 4.0–6.0 Ampholines (Pharmacia Biotech, Uppsala, Sweden). The various commercial carrier ampholytes are available in 25-mL bottles that are stored at 4°C. 5. 5% solution of N,N,N´,N´-tetramethylethylenediamine (TEMED). Store at room temperature. 6. 10% Ammonium persulfate, prepare fresh daily. 7. Glass plates: two measuring 125 × 260 × 3 mm and a third measuring 125 × 260 × 1 mm. 8. Ethanol. 9. Electrode strips, e.g., Pharmacia. 10. Sample application strip, e.g., Pharmacia. 11. 1 M H3PO4. Store at room temperature for up to 2 mo. 12. 1 M NaOH. Store at room temperature for up to 2 mo. 13. Electrophoresis unit (e.g., Pharmacia Multiphor II) connected to a thermostatic circulator capable of cooling to 4°C.

2.2. Transfer of Focused Proteins to Nitrocellulose 1. 0.15 M NaCl. Store at room temperature for up to 2 mo. 2. Nitrocellulose membranes, e.g., Schleicher and Schuell (Dassel, West Germany). 3. Whatman 3MM chromatography paper.

2.3. Immunodetection of Antithrombin 1. Blocking buffer: 2% BSA, 0.15 M NaCl, 0.05 M Tris-HCl, pH 7.4. Store at 4°C for up to 1 wk. 2. Wash buffer: 0.15 M NaCl, 0.05 M Tris-HCl, pH 7.4. Store at room temperature for up to 2 mo. 3. Sheep anti-human antithrombin immunoglobulins, e.g., Serotec, Oxford, England. 4. Horseradish peroxidase conjugated rabbit anti-sheep immunoglobulins, e.g., Dako, High Wycombe, England. 5. Peroxidase substrate is prepared fresh as required by dissolving 60 mg 3-amino9-ethylcarbazole (AEC) (Sigma, Dorset, England) in 16 mL dimethyl sulfoxide and diluting to 200 mL using 0.02 M acetate buffer, pH 5.0. 400 μL of 30% H2O2 is then added immediately before use.

3. Methods 3.1. Isoelectric Focusing

3.1.1. Preparation of the Gel 1. Before preparing the gel, thoroughly clean three glass plates, two with dimensions 125 × 260 × 3 mm and a third measuring 125 × 260 × 1 mm, in warm water with detergent, rinse well in deionized water, and swab with ethanol. 2. Allow the plates to dry and arrange them so that the thin plate is separated from one of the thick plates by a 0.8-mm U-shaped polystyrene gasket 5 mm in width

Isoelectric Focusing

3. 4.

5. 6.

293

and shaped so that the open end of the U-frame corresponds with the shorter side of the glass plates (see Note 2). Place the second thick plate behind the thin plate and then clamp the mould on the three sides corresponding to the gasket with bulldog clips. To prepare 25 mL of gel, sufficient for one cassette, add the following to a 250 mL side arm flask: Stock acrylamide solution 23.525 mL, 1.25 mL ampholytes (pH range of 4.0–6.0), and 0.125 mL of 5% TEMED. Degas the solution by connection to a water pump and then add 0.1 mL of 10% ammonium persufate. Immediately pipet the gel solution into the cassette, filling it to capacity and then lie the cassette horizontally on the work surface to allow polymerisation to take place. Gels can be used immediately following polymerisation or they may be sealed in Saran wrap and stored for up to 5 d at 4°C prior to use.

3.1.2. Application of Samples and Electrofocusing 1. When the gel has polymerized, remove the bulldog clips and thick backing plate and lay the cassette on the work surface. Using a thin spatula or blade, carefully prise the second thick plate away from the gel. Remove the gasket and straighten any rough edges using a blade and ruler (see Notes 3 and 4). 2. Trim two electrode strips to slightly shorter than the length of the gel. Soak one strip in 1 M H3PO4 (anode) and lay it lengthwise on the gel approximately 3mm from the edge. Soak the second strip in 1 M NaOH (cathode) and lay it along the opposite edge. Lay a sample application strip approx 10 mm from the cathode (see Note 5). 3. Place the glass plate, supporting the prepared gel, on the cooling plate of an electrophoresis unit connected to a thermostatic circulator set at 4°C. 4. Pipet control and test plasma samples into the wells of the sample application strip, leaving approximately 1 cm of the gel free of sample for analysis of the pH gradient after focusing. Apply 4–10 μL of undiluted citrated or EDTA anticoagulated plasma depending on the capacity of the well (see Note 6). 5. When all the samples have been loaded, connect the electrodes to a high voltage power supply and, maintaining the power at 20 W throughout, focus samples by increasing the voltage at intervals over 2 h as follows: 200 V × 15 min, 400 V × 15 min, 600 V × 15 min, 800 V × 15 min, 1080 V × 30 min, 2000 V × 30 min. The power usually becomes limiting in the final 30 min and samples are usually focused for a total of approx 1850 Vh (see Note 7). 6. The pH gradient may be analysed by elution of ampholytes from 5-mm segments of gel into 4 -mL aliquots of hot distilled water and measurement of pH.

3.2. Transfer of Focused Proteins to Nitrocellulose 1. Remove and discard the electrode pads from the gel. Using a scalpel and ruler, cut and discard the edges of the gel which had been beneath the electrodes. 2. Slowly, immerse the gel, on its supporting glass plate, in 0.15 M NaCl and leave it for 5 min without shaking (see Note 8).

294

Daly

3. Meanwhile, cut a piece of nitrocellulose membrane and two pieces of 3MM chromatography paper to the same size as the trimmed gel. Wear gloves and use a forceps while handling nitrocellulose to avoid protein contamination of the transfer. Equilibrate the nitrocellulose membrane in 0.15 M NaCl for at least 5 min before blotting (see Note 9). 4. Carefully remove the gel, still on its supporting glass plate, from the saline and place it on the work surface. Remove any excess liquid from the edges of the plate and gel by gently dabbing with tissue paper. 5. Lay the presoaked nitrocellulose membrane on top of the gel, taking care to exclude air bubbles. Using a scalpel or pin, make a mark in the nitrocellulose to assist in orientating it with respect to the gel after protein transfer. Place the two pieces of 3MM paper on top of the nitrocellulose and then overlay the gel sandwich with a wad of paper towels. Place a glass plate and weight on top of the towels and leave for 1 h before removing the paper towels and filter paper. The nitrocellulose replica binds strongly to the gel and can be easily separated by wetting the blot with saline or distilled water. 6. Antithrombin may either be detected immediately following blotting or the blot may be stored dry at –20˚C until required (see Note 10).

3.3. Immunodetection of Antithrombin Unless otherwise stated, all of the following steps should be carried out at room temperature with gentle rocking. 1. 2. 3. 4. 5. 6. 7. 8.

Incubate the nitrocellulose blot in blocking buffer for 30 min (see Note 11). Decant the blocking buffer and replace with wash buffer for 10 min (see Note 11). Repeat step 2 giving the blot 3 10-min washes in total. Incubate the blot in sheep anti-human antithrombin immunoglobulins diluted 1/1500 in blocking buffer for 30 min (see Note 12). Repeat steps 2 and 3. Incubate the blot in horseradish peroxidase conjugated rabbit anti-sheep immunoglobulins diluted 1/1500 in blocking buffer for 30 min (see Note 12). Repeat steps 2 and 3. Incubate, without shaking, in freshly prepared peroxidase substrate. A red colored precipitate should develop within 10–30 min. Stop the reaction by washing the membrane in deionised water and then press it dry between sheets of filter paper. The blot should be photographed for record purposes as the substrate color fades with time, particularly when exposed to light (see Note 13).

4. Notes 1. Acrylamide is a neurotoxin with cumulative effects. Wear gloves and a mask when weighing out the acrylamide and bisacrylamide powders and always wear gloves when handling acrylamide solutions. 2. In most flat bed IEF systems, the gel is cast between two glass plates. The plates are usually separated by a gasket which, should leakage be a problem, may be lightly coated with silicone grease.

Isoelectric Focusing

295

3. Ideally, for most efficient cooling during focusing, the gel should be on the thin plate after dismantling the cassette. To facilitate this, the surface of the thick plate that is in contact with the polymerization mixture may be silanized before use. This can be done by pouring a small volume of silanizing solution onto the surface of the plate and wiping with tissues before swabbing with ethanol. Gloves should be worn during the procedure which should be carried out in a fume hood. 4. It is important when separating the thick glass plate from the gel surface not to disturb the gel attached to the lower plate as this may affect electrical conductivity in the gel and cause distortion of the pH gradient during focusing. 5. It is important to lay the electrode strips straight and parallel to one another and in such a way that the platinum wire electrodes of the electrophoresis apparatus lie centred along the strips. This can be ensured by laying a graph paper grid beneath the gel plate when positioning the electrode strips. 6. Samples may be applied using a variety of methods. Perhaps the simplest is to use an application strip made of silicone rubber which contains either slots or circular holes. These strips can be washed afterwards and used repeatedly. Alternatively, samples may be applied on 10 × 5-mm pieces of 3MM chromatography paper. However, due to uncontrolled adsorption of the sample by the paper this is not ideal when the volume of sample available for analysis is limited. 7. Following electrofocusing, it is possible to see focused ampholyte zones on the gel as a series of parallel bands perpendicular to the direction of the electric field. Distorted or wavy bands may be indicative of high salt concentrations in certain samples. Alternatively, inefficient cooling of the gel during electrophoresis may have caused local heating and distortion of the pH gradient. This may be overcome by wetting the cooling block of the electrophoresis apparatus with light paraffin oil before lowering the gel plate onto the block taking care to exclude air bubbles. 8. This step is included in order to remove the carrier ampholytes from the gel before protein transfer. Although not essential, it appears to result in less background staining on the blot after immunodetection. 9. As protein transfer relies only upon the liquid present in the gel to transfer the proteins by capillary action to the nitrocellulose, it is essential that the nitrocellulose and the 3MM paper pieces are cut to the same size as the gel. 10. Nitrocellulose becomes brittle when stored at –20˚C and must therefore be allowed to thaw at room temperature for approx 5 min before incubation in blocking solution. 11. The intensity of nonspecific background staining can be reduced by including this blocking step in which any protein binding sites remaining on the nitrocellulose membrane can be blocked by albumin. The 2% BSA may be replaced by the less expensive alternative of 5% nonfat dried milk if desired. Where the level of nonspecific staining is unacceptable, this may be reduced by the inclusion of 0.02% Tween-20 in the blocking and washing solutions. 12. Appropriate dilutions of alternative antisera should be determined experimentally. 13. Plasma antithrombin is present as a series of eight isoforms varying in isoelectric point from 4.7 to 5.2 (2). This microheterogeneity may be explained entirely by differential sialylation of antithrombin since exhaustive neuraminidase treatment

296

Daly of plasma prior to IEF results in a reduction of heterogeneity to one major antithrombin isoform of pI 6.1, reflecting the removal of sialic acid. Pretreatment of plasma with varying amounts of heparin leads to an anodal shift in the antithrombin isoforms due to the formation of negatively charged complexes having more acidic pI values. These methods may therefore be adapted to investigate antithrombin variants suspected of having altered affinity for heparin (e.g., antithrombin Basel) (3).

References 1. Reinhart, M. P. and Malamud, D. (1982) Protein transfer from isoelectric focusing gels: the native blot. Anal. Biochem. 123, 229–235. 2. Daly, M. and Hallinan, F. (1985) Analysis of antithrombin III microheterogeneity by isoelectric focusing in polyacrylamide gels and immunoblotting. Thromb. Res. 40, 207–214. 3. Daly, M., Ball, R., O’Meara, A., and Hallinan, F. (1989) Identification and characterisation of an antithrombin III mutant (AT Dublin 2) with marginally decreased heparin reactivity. Thromb. Res. 56, 503–513.

Characterization of Heparin Binding Variants

297

30 Characterization of Heparin Binding Variants of Antithrombin by Crossed Immunoelectrophoresis in the Presence of Heparin Martina Daly 1. Introduction The first update of the antithrombin mutation database published in 1993 used a revised classification for antithrombin variants (1). Currently, two deficiency states are recognized: type 1 deficiency is characterized by a parallel reduction in immunological and functional plasma antithrombin levels, whereas type 2 is characterized by the presence of a dysfunctional protein and a discrepancy between normal antigenic and reduced functional activity levels of antithrombin. Type 2 variants are further subtyped into three categories depending on whether the mutation has its effect on the reactive site (RS), the heparin binding site (HBS) or has multiple or pleiotropic effects (PE). Thus, the last update of the antithrombin database listed 11 distinct molecular defects causing heparin binding abnormalities and nine defects having pleiotropic effects interfering with both thrombin inhibitory activity and heparin binding. The majority of PE variants are also associated with reduced immunological concentrations of plasma antithrombin and have mutations affecting amino acid residues belonging to the C-terminal strand 1C (e.g., antithrombin Utah, 407 Pro to Leu) a finding which has led to the suggestion that the integrity of the carboxy-terminal 30 amino acids of antithrombin is essential for maintaining normal circulating antithrombin levels (2). Although type 1 deficiency is readily diagnosed by measuring antigenic and functional activity levels of antithrombin, phenotypic characterization of type 2 subtypes requires some investigation of the heparin binding properties of the abnormal antithrombin. The technique that has been of most value in this respect has been crossed immunoelectrophoresis (CIE) of plasma antithrombin From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ

297

298

Daly

following incorporation of heparin in the first dimension gel. Originally adopted by Sas et al. (3) to study heterogeneity of normal antithrombin in plasma and serum, this method has been widely used for the phenotypic characterisation of physiological variants of antithrombin. Although the method described below is intended for detection of heparin binding variants of antithrombin, with appropriate modifications, it may be adapted to investigate the heparin binding properties of other haemostatic plasma proteins and their variants (e.g., heparin cofactor II). Alternatively, by replacing the heparin in the first dimension gel with other ligands, the binding properties of specific plasma proteins may be examined. 2. Materials 1. Glass plates measuring 100 × 100 × 1 mm. 2. Ethanol. 3. Agarose, type I, low EEO (Sigma, Dorset, England) or Agarose L (Pharmacia Biotech, Uppsala, Sweden) (see Note 1). 4. 0.05 M barbitone buffer, pH 8.6. Dissolve 20.6 g sodium barbitone in 1900 mL water, adjust to pH 8.6 with 0.05 M hydrochloric acid and dilute to a final volume of 2000 mL. 5. 0.15 M NaCl, store at room temperature for up to 2 mo. 6. Heparin. Available as a 5000 U/mL stock solution from CP Pharmaceuticals Ltd. (Wrexham, Clwyd). A 30 U/mL solution is also required and is prepared by dilution of the stock preparation in 0.15 M NaCl (see Note 2). 7. Flat bed electrophoresis apparatus e.g. Multiphor II, Pharmacia Biotech, with thermostatic cooling unit capable of 10°C. 8. Whatman 3MM chromatography paper. 9. Whatman No. 1 filter paper. 10. Saranwrap™. 11. 10% Bromophenol blue (w/v) in 0.15 M NaCl. Store at room temperature. 12. Rabbit anti-human antithrombin immunoglobulins, e.g., Dako, High Wycombe, UK. 13. Destaining solution: 40% methanol (v/v), 10% acetic acid (v/v) in distilled water. 14. Staining solution: Dissolve 2.5 g of Coomassie Brilliant Blue R-250 in 1000 mL of destaining solution. The solution is filtered before use and is stable for at least 2 mo at room temperature.

3. Methods The crossed immunoelectrophoretic pattern of antithrombin is examined in each test plasma sample both in the presence, and absence, of heparin in parallel with a normal or control sample. Thus, for each sample tested two gels must be prepared, one with and one without heparin.

3.1. Preparation of First Dimension Gels 1. Weigh 0.18 g of agarose into each of two glass universal containers, labelled A, and add 18 mL of 0.05 M barbitone buffer, pH 8.6. Similarly, weigh 0.14 g into

Characterization of Heparin Binding Variants

2. 3.

4.

5.

6. 7.

8.

9.

299

each of two containers, labeled B, and add 14 mL 0.05 M barbitone buffer, pH 8.6. Screw the lids loosely on all four containers and heat in a boiling waterbath until the agarose is fully dissolved. Remove to a waterbath preheated to 56°C and allow to cool for at least 30 min. Thoroughly clean two glass plates. Rinse well in deionised water and swab with ethanol. Allow the plates to dry and then place them onto a levelling table, ensuring that it is absolutely level. When the agarose has cooled, pour the contents of one of the containers labeled A onto one of the plates ensuring an even covering of the plate and no overflow of the agarose onto the leveling table (see Notes 3 and 4). Add 54 μL of heparin (5000 U/mL) to the second A container, mix, and pour onto the second plate as described in step 4 (see Note 5). Leave the remaining containers of molten agarose at 56°C for preparation of the second dimension gels. When the agarose has solidified, place both gels in a humid chamber at 4°C before use. Gels should be used on the day of preparation. Carefully, make a circular well, 3 mm in diameter, in the corner of each gel, 10 mm from both edges. Make a second well 10 mm from the edge and 50 mm from the first. This is most easily achieved by placing the gel on a template on which the positions of the wells are already marked (see Note 6). Place both gels, with the wells nearest the negative electrode, on the cooling plate of a flat bed electrophoresis apparatus connected to a thermostatic circulator set at, and precooled to, 10°C (see Note 7). Pour 1L of electrophoresis buffer into each of the electrophoresis tanks. For each of the wicks, soak four pieces of Whatman 3MM chromatography paper (200 × 190 mm) in electrophoresis buffer and place them straight along the gels overlapping the edges by 5 mm at each side. To prevent dehydration during electrophoresis, cover each wick with a piece of SaranWrap™ doubled over at the gel end in order to give a straight edge (see Note 8).

3.2. Application of Samples and Electrophoresis 1. Prepare the test and control citrated plasma samples for electrophoresis as follows: For electrophoresis in the absence of heparin, dilute 100 μL of test/control plasma with 100 μL 0.15 M NaCl. Where heparin is included in the first dimension gel, dilute 100 μL of test/control plasma with 100 μL 0.15 M NaCl containing 30 U/mL heparin. 2. Apply 10 μL of each sample to the appropriate well, ensuring that each gel contains a control and test sample and that heparinised samples are added to the gel containing heparin. 3. Add 1 μL of 10% bromophenol blue in 0.15 M NaCl to each well for use as a tracker dye. 4. Electrophorese samples at 200 V until the bromophenol blue has just reached the opposite wick.

3.3. Preparation and Electrophoresis of Second Dimension Gels 1. When the first dimension separation is complete pipet some molten 1% agarose (at 56°C) into the sample wells and allow it to solidify.

300

Daly

2. Remove the gels one by one from the electrophoresis chamber and place on the template. 3. With the edge of the gel containing the wells nearest you, carefully cut the gel at three positions 15, 50, and 65 mm from the right hand edge, in the direction of the first electrophoresis. Retain the two smaller sections containing the proteins separated by the first dimension electrophoresis and discard the remainder. 4. Place the plate on an absolutely level surface ready for pouring the second dimension gel. 5. Pour 6.3 mL of the 1% agarose (at 56°C) from one of the B containers into a calibrated tube and add 70 μL of rabbit anti-human antithrombin antiserum. Quickly mix, and then pour, the molten agarose into one of the two sections on the plate ensuring that contact is made with the first dimension gel (see Note 9). 6. Repeat step 5 for the second section of the plate. 7. Repeat steps 1–6 for the second gel. Allow the agarose to solidify and then immediately continue with the second dimension electrophoresis. 8. Return the plates to the electrophoresis chamber with the position of both plates rotated through 90°C so that the direction of electrophoresis is from the first dimension gel into the second dimension antiserum-containing gel. 9. Prepare wicks as described in step 9. 10. Electrophorese samples at 200 V for 4 h or overnight at 110 V at 10°C.

3.4. Detection of Immunoprecipitated Antithrombin 1. Wash the gels for 2 h in three changes of 0.15 M NaCl. 2. Overlay the plates with two pieces of Whatman No.1 filter paper followed by a thick stack of paper towels and a glass plate. Place a heavy weight on top and press the gel for 30–60 min or overnight if desired. 3. Carefully, remove the paper towels and filter paper and dry the gel completely with a hair dryer. 4. Stain the gel for 30 min at room temperature in a solution of 0.25% coomassie brilliant blue R-250. 5. Remove excess stain by washing for approx 5 min in 40% methanol, 10% acetic acid (see Note 10).

4. Notes 1. High concentrations of dissociable cations, present in certain preparations of agarose, migrate toward the cathode during electrophoresis. This process, termed electroendosmosis (EEO), results in a movement of liquid in the opposite direction to acidic proteins such as antithrombin reducing discrimination between different protein species by internal convection. For this reason, an agarose with low EEO is recommended. 2. Unfractionated sodium heparin is marketed as a solution known as “Multiparin” by CP Pharmaceuticals Ltd. Where obtained as a dried sodium salt of unfractionated heparin, it can be resuspended in an appropriate volume of water prior to use.

Characterization of Heparin Binding Variants

301

3. At low room temperatures, the agarose may be inclined to solidify before the plate is evenly covered. This may be prevented if, instead of using a leveling table, the plate is placed on the level cooling platform of a flat bed electrophoresis chamber. Warm tap water may then be circulated through the platform to warm the plate before pouring the gel. However, immediately before the gel is poured, the connection to the cooling platform should be changed from the hot to the cold tap to accelerate gel formation. 4. If overflowing of the agarose solution is a problem, prior to pouring the gel put 2–3 drops of molten agarose on the plate. Smear the agarose over the plate and dry with a hair dryer. This helps the gel to bond to the glass. 5. The final concentration of heparin in the gel is 15 U/mL. This is similar to the heparin concentration reported by Sas et al. (3) to be optimal for separation of the heparin binding fraction of normal antithrombin in plasma. 6. Sample wells can be made using a commercially available telescopic gel puncher (Pharmacia Biotech, Uppsala, Sweden) attached to a filter pump. Alternatively, wells can be made using a wide bore Pasteur pipet or a blue pipet tip which has been cut at the narrow end to give an external diameter of approx 3 mm. 7. In some laboratories, it may be possible to achieve sufficient cooling by circulating cold tap water beneath the gel plates during electrophoresis. 8. To ensure an even current during electrophoresis, the paper wicks should be cut to the size of the gels and not allowed to touch the cooling plate beneath the gel at either end. 9. Appropriate concentrations of alternative antisera should be determined experimentally. 10. Plasma antithrombin migrates in agarose predominantly as a single species which can be visualized as a uniform peak following CIE. Binding of negatively charged heparin leads to an overall increase in negative charge and hence greater electrophoretic mobility. Thus, in the presence of heparin, a single antithrombin peak which migrates more rapidly is observed. The can be readily observed by superimposing the two gels electrophoresed in the presence and absence of heparin. Antithrombin mutations which cause a reduction in heparin binding are characterized by the presence of two peaks similar in height: the normal peak and a second peak of reduced mobility. Pleiotropic defects are usually associated with the presence, at low concentrations, of an abnormal antithrombin having reduced affinity for heparin and are characterized by the presence of a normal peak, plus a much smaller second peak of reduced mobility.

Acknowledgments The advice of P. Cooper is gratefully acknowledged. References 1. Lane, D. A., Olds, R. J., Boisclair, M., Chowdhury, V., Thein, S. L., Cooper, D. N., Blajchman, M., Perry, D., Emmerich, J., and Aiach, M. (1993) Antithrombin III mutation database: first update. Thromb. Haemostasis 70, 361–369.

302

Daly

2. Lane, D. A., Olds, R. J., Conard, J., Boisclair, M., Bock, S. C., Hultin, M., Abildgaard, U., Ireland, H., Thompson, E., Sas, G., Horellou, H. H., Tamponi, G., and Thein, S. L. (1992) Pleiotropic effects of antithrombin strand 1C substitution mutations. J. Clin. Invest. 90, 2422–2433. 3. Sas, G., Pepper, D. S., and Cash, J. D. (1975) Investigations on antithrombin III in normal plasma and serum. Brit. J. Haematol. 30, 265–272.

HPLC Peptide Analysis

303

31 The Determination of Amino Acid Sequence Abnormalities in Proteins by HPLC Peptide Analysis David Williamson 1. Introduction Current techniques for DNA amplification and sequencing have greatly simplified the identification of genetic mutations underlying disorders of abnormal protein production. The need, however, for the direct characterization of an amino acid abnormality in a defective protein still arises in particular situations. The normal approach to this problem relies on the specific fragmentation of the protein and subsequent analysis of the resultant mixture of peptides. The techniques currently available for peptide analysis offer very high sensitivity and so require relatively small amounts of protein. Automated peptide sequencing or mass spectrometry can be achieved with subnanomole quantities of peptide. Consequently, sufficient material can be isolated from tryptic digests beginning with as little as a milligram or so of a pure protein. The protein of interest must first be purified from its source, which in most cases will be plasma. As most genetic abnormalities occur in the heterozygous state, only a proportion of the protein is defective, and where possible this should be purified from the normal form of the protein in order to simplify subsequent peptide analyses. For example, if a difference in the overall charge of the protein has been shown by protein electrophoresis, the two components may be purified by ion exchange chromatography. A functional change, such as the affinity for a ligand may be exploited, as with changes in the heparin affinity of some antithrombin variants that enables their separation by affinity chromatography on heparin-sepharose (see Fig. 1). For the production of comparative peptide maps of proteins and the isolation of peptides for further amino acid compositional or sequence analysis, an From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ

303

304

Williamson

Fig. 1. Separation of tryptic peptides of a heparin-affinity variant of antithrombin by reverse-phase HPLC. Two milligrams of human plasma antithrombin, isolated by heparin-affinity chromatography (inset), was modified by reduction and carboxymethylation prior to digestion with TPCK-treated trypsin for 2 h at 37˚C at a protein concentration of 2 mg/mL and a ratio of protease: antithrombin of 1:30 on a weight basis. One hundred microliters of the tryptic digest supernatant was chromatographed on a μBondapak C18 reverse-phase column (3.9 mm × 300 mm, Waters division of Millipore) using a linear gradient of acetonitrile (0–50%) in 0.05% TFA, eluting at 1.0 mL/min. The arrow indicates the abnormal peptide that was not present in the tryptic digest of the normal antithrombin fraction. The collected peak was subjected to automated N-terminal sequence analysis, which yielded the amino acid sequence of residues 40-46 of the antithrombin sequence (I-L-E-A-T-N-R) with the substitution Pro→Leu at position 41 (Antithrombin Basel) originally described by Chang and Tran (5).

HPLC Peptide Analysis

305

enzymatic digest of the protein is most commonly separated by reverse phase high-performance liquid chromatography (HPLC). Cleavage of proteins with proteolytic enzymes is favoured over chemical methods because of the high degree of specificity. The preferred enzyme is usually trypsin, which is highly specific for lysine and arginine, cleaving on the carboxy terminal side of these amino acid residues. With most proteins, it is usually advisable to carry out reduction and modification of sulfhydryl residues prior to digestion with trypsin. Conversion of cysteine residues to more stable derivatives will prevent their oxidation and the random formation of disulphide bonds between cysteine-containing peptides. This procedure also helps with denaturation of the protein to enable more complete proteolytic digestion. A tryptic digest must be prepared under the same conditions from both the normal and abnormal protein species, which can then be analysed and compared. Of the various chromatographic procedures available for the analysis of tryptic digests, reverse phase chromatography is the most widely adopted. The separation in this system is based on the size and relative hydrophobic properties of each peptide, and it is capable of resolving peptides with only slight differences in hydrophobicity. Consequently, peptides differing by a single amino acid may often be resolved (Fig. 1), as well as peptides with modifications to amino acid residues, such as oxidation, glycosylation or acetylation. Described below is a basic approach to sulfhydryl modification by carboxymethylation, tryptic digestion and the reverse phase HPLC separation of tryptic peptides. This will enable the production of peptide chromatograms that can be compared and the isolation of any abnormally behaving peptides. Isolated peptides can be submitted to a specialist facility for amino acid composition analysis, N-terminal amino acid sequencing or further characterisation by mass spectrometry to precisely determine the amino acid abnormality. 2. Materials 2.1. Reduction and Carboxymethylation of Protein Sulfhydryls The method described is for the reduction and modification of sulfhydryls by their conversion to carboxymethylcysteine using the reagent iodoacetic acid. Depending on the reagent used, an acidic, neutral, or basic modifying group can be added, altering the properties of the protein accordingly (see Notes 1 and 2). To minimize undesirable modifications to amino acid residues and other nonspecific reactions, high-purity chemicals and reagents should be used at all stages of protein purification, modification, digestion, and peptide analysis. 1. 8.0 M urea in 0.3 M Tris-HCl, pH 8.3 buffer. Urea solutions should be freshly prepared. Alternatively, 6.0 M guanidine hydrochloride may be used in the same Tris buffer.

306

Williamson

2. Dithiothreitol (DTT, Cleland’s Reagent) 10 mg/mL solution dissolved in deionized water. May be stored in aliquots at –20°C. 3. Iodoacetic acid, 10 mg/mL solution dissolved in deionised water and neutralized with NaOH. The solution should be colorless. Any yellow color is an indication of the presence of iodine that may cause oxidation of thiols and other amino acid modifications.

2.2. Proteolytic Digestion with Trypsin Trypsin is a highly specific protease that cleaves on the carboxy-terminal side of arginine, lysine and S-aminoethylcysteine residues. It is the most preferred enzyme for protein digestion. Cleavage is inhibited at Arg-Pro and LysPro bonds or by the presence of an adjacent acidic amino acid residue. Occasional anomalous cleavages may occur particularly at hydrophobic residues, owing possibly to contaminating chymotryptic activity. These can be minimized by the use of a highly pure trypsin preparation that has been treated with L-(tosylamido-2-phenyl) ethyl chloromethyl ketone (TPCK) to inhibit chymotryptic activity. 1. A suitable trypsin preparation is TPCK-treated bovine pancreatic trypsin, 3x crystallized (Worthington Biochemical Corporation, NJ, USA). Dissolve at 2 mg/mL in deionised water and store frozen in aliquots at –20°C. 2. Stock solution of 0.5 M NH4HCO3. Store at room temperature.

2.3. Separation of Tryptic Peptides by Reverse-Phase HPLC 1. Hardware: The high resolution and reproducibility of HPLC separations requires precise control over flow rates and solvent composition. This depends on the availability of an HPLC system consisting of a gradient controller, a solvent delivery system (dual pump or a single pump with proportioning valves for buffer mixing), sample injector, one or more detectors and a chart recorder output or computer with printer. Most systems are now computer-interfaced combining the functions of gradient control with data collection and analysis. 2. Column: The chromatographic performance of any column is determined by a large number of factors which includes the physical dimensions and construction of the column as well as the nature of the packing material, its particle size, pore size and carbon load (1). For peptide separations, reverse phase columns with C18 or C8 ligands and 5 μm or 10 μm particles are most commonly used. A wide range of suitable columns and radial compression cartridges is available. The column used here is a μBondapak C18 10μm, 3.9 mm i.d. × 300 mm (Waters division of Millipore). 3. Solvents: Two solvent systems are suggested (see Note 7). 4. Trifluoroacetic acid (TFA)/Acetonitrile (CH3CN) Buffers: Prepare a solution of 0.1% TFA in HPLC-grade water. TFA is available in convenient 1-mL ampoules (protein sequencing grade, Sigma).

HPLC Peptide Analysis

307

Buffer A (0.05% TFA): prepare a 1:1 dilution of 0.1% TFA with water. Buffer B (0.05% TFA, 50% acetonitrile): prepare a 1:1 dilution of 0.1% TFA with acetonitrile (BDH, HiperSolv “Far UV” grade for HPLC). Vacuum filter both buffer solutions through a 0.45-μm filter apparatus, which will simultaneously degas the buffers. 5. Ammonium acetate/acetonitrile buffers: Prepare a stock solution of 0.02 M ammonium acetate (CH3COONH4) adjusted to pH 6.0 with a little acetic acid. This stock buffer may be filtered and stored at 4°C for up to 1 wk. Buffer A (0.01 M CH3COONH4, pH 6.0): Prepare a 1:1 dilution of the 0.02 M stock buffer with water. Buffer B (0.01 M CH3COONH4, pH 6.0, 50% acetonitrile): Prepare a 1:1 dilution of the 0.02 M stock buffer with acetonitrile. Vacuum filter and degas the buffer solutions through a 0.45-μm filter apparatus.

3. Methods 3.1. Reduction and Carboxymethylation of Protein Sulfhydryls 1. Dissolve the protein, up to 10 mg, in 1 mL of a solution of 0.3 M Tris-HCl, pH 8.3, 8.0 M deionized urea (or 6.0 M guanidine hydrochloride) to denature the protein. 2. Add a solution of dithiothreitol (DTT) sufficient to give a twofold molar excess over protein thiol groups. Flush the reaction tube with nitrogen, seal and incubate at room temperature for 3–5 h to allow reduction of the sulfhydryls (see Note 3). 3. Add the solution of iodoacetic acid to a final concentration that gives a threefold excess over thiol groups. Flush the solution again with nitrogen, seal the tube, and incubate in the dark at room temperature for a further 1 h. 4. Transfer the protein solution to dialysis tubing and dialyse extensively against 2 × 5 L deionized water over 16 h. Some proteins may precipitate during dialysis in which case a final short dialysis against 0.005 M formic acid may help to resolubilize the protein. 5. The protein may be lyophilized at this stage or proceed directly with proteolytic digestion.

3.2. Proteolytic Digestion with Trypsin 1. Weigh a quantity of the lyophilized protein into a reaction tube and dissolve completely in deionized water at a concentration of up to 10 mg/mL. If the protein solution has not been lyophilized following reduction and carboxymethylation proceed to step 2. 2. Add trypsin to the protein solution at a 1:30 ratio of trypsin:protein based on weight (see Note 4). Mix by vortexing briefly. 3. Add 0.2 mL of 0.5 M NH4HCO3 per ml of protein solution. Mix again by vortexing briefly. Check the pH of the reaction mixture, which should be close to 8.5, by testing a few microliters on a pH indicator strip. If required, adjust the pH further until it is within the range 8.0–9.0 (see Note 5).

308

Williamson

Table 1 Example of a Gradient for the Separation of Tryptic Peptides by Reverse-Phase HPLC Time

Flow rate

%A

%B

Curve type

0 5.0 65.0 75.0 80.0

1.0 1.0 1.0 1.0 1.0

100 100 0 0 100

0 0 100 100 0

— Linear Linear Linear Linear

4. Seal the tube and incubate at 37°C for 2 h (see Note 6). 5. At the end of the incubation period, place the reaction tube in a boiling water bath or heating block at 100°C for 5 min. 6. Centrifuge the sample for 5 min at full speed in a bench top microcentrifuge to remove any precipitate of incompletely digested protein. Remove the supernatant, containing the tryptic peptides, into a clean tube. The tryptic digest supernatant may be lyophilised or stored at –20°C for HPLC analysis.

3.3. Separation of Tryptic Peptides by Reverse-Phase HPLC The optimal gradient conditions will always have to be determined experimentally for each individual protein and for the type of column and buffers being used. The following procedure provides a starting point for peptide separations. 1. The column should be installed on the HPLC instrument, then washed and equilibrated according to the manufacturer’s instructions to remove the shipping solvent and UV absorbing substances (see Note 8). 2. Equilibrate the column ready for analysis by pumping 100% Buffer A at a flow rate of 1.0 mL/min. 3. Set up a gradient program for peptide elution, employing a linear gradient from 100% Buffer A to 100% Buffer B over 60 min with a flow rate of 1.0 mL/min. Allow a short isocratic step before the initiation of the gradient and at the end of the gradient to ensure complete elution of peptides from the column before returning to the initial conditions. Such a gradient table will look as follows (Table 1). 4. Centrifuge the tryptic digest for 5 min at full speed in a bench-top microcentrifuge (13,000 rpm) to ensure a clear supernatant (Note 9). 5. Inject an aliquot of the tryptic digest (for example 20 μL out of 1 mL of a 10 mg/mL tryptic digest) and run the gradient elution program. 6. Depending on the chromatographic separation achieved, changes may be made to the gradient program to improve the separation in particular areas of the chromatogram. 7. Any peptides with altered retention characteristics (see Note 10) by comparison with the normal protein tryptic digest should be manually collected into clean

HPLC Peptide Analysis

309

polypropylene reaction tubes (see Note 11) and stored at –20°C for further characterisation by amino acid analysis, N-terminal peptide sequencing or mass spectrometry. Alternatively, peptides may be dried in a centrifugal vacuum concentrator or by freeze drying.

4. Notes 1. The use of iodoacetic acid will transfer a new negative charge to the protein. If this is undesirable, iodoacetamide may be substituted, which adds an uncharged group (S-carboxamidomethyl cysteine). 2. Cysteines may also be modified to S-aminoethyl cysteine by reacting with the reagent N-iodoethyl-trifluroacetamide (2), adding a basic group that is recognized and cleaved by trypsin. Modification with this reagent therefore increases the number of peptides generated. The reagent previously available for aminoethylation, ethyleneimine, is no longer recommended because of its extreme toxicity. 3. These conditions should be sufficient for reduction of most protein sulfhydryls but some proteins may need longer incubation times, up to 18 h and at 37°C rather than room temperature. 4. The amount of protease and incubation time can be varied depending on the susceptibility of the protein to tryptic digestion. Ratios from 1:25 to 1:100 are commonly used. Sufficient protease is required to give effective digestion whilst keeping to a minimum the peptide products that result from enzyme autodigestion. The use of excessive amounts of protease will therefore interfere with interpretation of the peptide separations. 5. A light protein precipitate may form after the addition of the bicarbonate buffer. With gentle vortexing, this will usually redissolve within several minutes to give a clear solution. If the precipitate does not redissolve completely, check the pH and adjust if necessary. Continue with the incubation at 37°C, mixing periodically by gentle vortexing. 6. Little tryptic activity remains after two hours due to enzyme autolysis and extended incubation periods are therefore of minimal advantage. If longer digestion is required, such as in the case of a particularly resistant protein, it will be necessary to add the enzyme to the reaction in stages. It has also been reported that an autolysis product of trypsin itself is responsible for chymotryptic-like cleavages at hydrophobic residues (3) and these will increase with longer incubation times. 7. The chromatographic separation of peptides varies between buffer systems (4) and in some cases it may therefore be necessary to try more than one system. TFA buffers are commonly used and are convenient because of their high volatility when peptides are dried for subsequent analyses. The TFA/acetonitrile buffers, therefore, are a good first option. Particularly large or very hydrophobic peptides may require a higher concentration of acetonitrile to be used in buffer B. 8. It is recommended that a guard column of the same packing material be used in front of the separation column. When resolution deteriorates or high back-pressure problems occur, the guard column should first be replaced.

310

Williamson

9. The digest may also be filtered through a 0.45-μm microfilter unit. These are available with minimal hold-up volume and low protein binding membranes. This is particularly recommended if no guard column is being used to prolong column life. 10. A single peptide may show a difference in its retention time due to an amino acid substitution or modification. However, more complex differences in the peptide pattern may occur owing to amino acid substitutions that influence the cleavage of the protein by trypsin. For example, an amino acid substitution that results in the removal or introduction of an arginine or lysine, and some substitutions immediately adjacent to arginine or lysine residues that may affect the tryptic fragmentation pattern. 11. Wear gloves when collecting peptides for analysis to avoid contamination. It is also advisable to set aside a supply of tubes for peptide collection that are handled only with gloves. 12. A number of alternative proteases with individual specificities are available if trypsin does not produce the desired pattern of cleavage. These include argininespecific and lysine-specific proteases that may be useful in limiting the number of peptides generated, staphylococcal protease (SAV8) which targets acidic residues, and a number with wider specificities such as α-chymotrypsin, pepsin, and thermolysin (3).

References 1. Wilson, K. J. and Yuan, P. M. (1989) Protein and peptide purification, in Protein Sequencing: A Practical Approach (Findlay, J. B. C. and Geisow, M. J., eds.). IRL, Oxford, pp. 1–41. 2. Schwartz, W. E., Smith, P. K., and Royer, G. P. (1980) N-(ß-Iodoethyl) trifluroacetamide: a new reagent for the aminoethylation of thiol groups in proteins. Anal. Biochem 106, 43–48. 3. Allen, G. (1989) Sequencing of proteins and peptides, in Laboratory Techniques in Biochemistry and Molecular Biology, vol 9, Elsevier Science Publishers, Amsterdam, New York, and Oxford. 4. Wilson, K. J., Honegger, A., and Hughes, G. J. (1981) Comparison of buffers and detection systems for high pressure liquid chromatography of peptide mixtures. Biochem. J. 199, 43–51. 5. Chang, J. and Tran, T. (1986) Antithrombin III Basel. Identification of a Pro-Leu substitution in a hereditary abnormal antithrombin with impaired heparin cofactor activity. J. Biol. Chem. 261, 1174–1176.

Inherited Platelet Receptor Disorder

V PLATELET AND MEGAKARYOCYTE ANALYSIS

311

Inherited Platelet Receptor Disorder

313

32 Molecular Biological Identification and Characterization of Inherited Platelet Receptor Disorders Ramesh B. Basani, Mark Richberg, and Mortimer Poncz 1. Introduction Platelets are derived from megakaryocytic and have a critical role in thrombus formation. Megakaryocytes are terminally differentiated marrow cells that are derived from the pluripotent hematopoietic stem cell (1). These extremely large, polyploid cells demarcate their cytoplasm, giving rise to circulating platelets. Following vascular injury, platelets adhere to the site of injury through von Willebrand factor (vWF) and the platelet membrane glycoprotein (GP) Ib/IX complex. The platelets become activated, and aggregate with other activated platelets through fibrinogen and the platelet membrane αIIb/β3 (GPIIb/IIIa) integrin complex. In addition, platelets contain unique granules called α-granules that contain important factors involved in normal coagulation. These factors include factor VIII, vWF, factor V, Multimerin, fibrinogen, factor XIII, factor XI, thrombospondin, fibronectin, ß-thromboglobulin (ßTG) and platelet factor 4 (PF4). Some of these factors are actively synthesized in megakaryocytes, some are actively transported through clatherin pits, and some are endocytosed (2,3,9). The biological relevance of platelets, the unusual differentiation pathway of the megakaryocyte and the richness of important proteins related to coagulation found within these cells have made them the target of active scientific pursuit. Unfortunately, platelets are anucleate and were thought to have little residual RNA. Furthermore, megakaryocytes, although being large and polyploid, are rare within the bone marrow. In humans, only 1:10,000 nucleated marrow cells are identifiable megakaryocytes. Because of these limitations, progress towards understanding the molecular biology of the platelet and megaFrom: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ

313

314

Basani, Richberg, and Poncz

karyocyte was hindered until the mid-1980s. Since then, three major advances occurred that were critical to the study of the molecular biology of the platelet and megakaryocyte. The first was the discovery that an erythroid cell line HEL actually exhibited a number of megakaryocytic-like features (6). This lead to the rapid establishment of expression cDNA λ libraries from these cells and the isolation of the cDNAs for such platelet-related genes as αIIb, β3, βTG, and PF4 (4,5,7,8,11). The next major advance in the field was the recognition that platelets contain sufficient RNA to allow one to PCR-amplify and analyze the message of a number of platelet-specific genes (12). This allowed the rapid characterization of the message for a number of platelet-specific genes including the determination of the molecular defect in a number of patients with Glanzmann thrombasthenia and Bernard-Soulier syndrome as well as allowing the characterization of the molecular basis of platelet alloantigens. The third advance has yet to fully reach its full potential impact and that is the availability of the megakaryocyte-specific cytokine thrombopoietin (TPO) (13). This cytokine stimulates megakaryocyte development 10- to 100-fold. It has allowed the in vitro stimulation of sufficient numbers of megakaryocytes to permit studies on gene regulation of the developing megakaryocyte as has never been possible before. Below, we discuss how to define and study the molecular basis of an inherited defect in platelet biology. The focus of these studies is on the analysis of patients with Glanzmann thrombasthenia. However, similar such studies have been done for Bernard-Soulier syndrome and other cloned genes that are expressed in megakaryocytes.

1.1. Platelet Reverse Transcription-Polymerase Chain Reaction (RT-PCR) The determination that a patient has an inherited platelet defect depends on clinical suspicion and standard clinical coagulation laboratory studies. The next step often involves protein chemistry studies to demonstrate the level of the suspected protein. These studies will not be discussed here, but it is clear that a careful analysis of such studies is critical prior to launching on the molecular biology techniques described below (see Fig. 1). One of the most important observations in the study of proteins expressed in platelets was the recognition that sufficient residual RNA is present in platelets for RT/PCR amplification of this material, allowing its direct analysis (12). However, the described technique is often difficult to perform since the amount of residual RNA present in platelets is small and activation of platelets in vitro leads to RNA degradation. Easy access to the patient of interest is required. Platelet RT-PCR consists of four steps: isolation of platelet RNA, reverse transcription of mRNA into a single-stranded cDNA transcript, PCR amplifi-

Inherited Platelet Receptor Disorder

315

Fig. 1. Flow chart for molecular biology analysis of an inherited platelet defect beginning either with platelets or white blood cells.

cation of the cDNA transcript, and screening the PCR products for the mutation.

1.2. Genomic DNA Analysis Often obtaining platelet RNA from a patient may be difficult. Therefore, the analysis of the inherited defect would then rely on isolating and characterizing the gene within isolated DNA. We describe below the steps required for the analysis of mutations affecting the αIIb or β3 genes. Both genes have been previously characterized. The αIIb gene contains 30 exons and spans 18 kb (14). Its 5' flanking region contains a transcription start site located 32 bp upstream from the beginning of the αIIb coding region. The β3 gene contains 15 exons and spans at least 46 kb (15,16). The first step in detecting the mutation is to PCR amplify the exons for αIIb and β3, resulting in 32 different PCR products for αIIb and 17 PCR products

316

Basani, Richberg, and Poncz

for β3. These PCR products not only cover all of the exons, but also 500 bp of the 5'-flanking region. The rationale for our genomic PCR strategy is to create PCR fragments of ~300 bp, allowing optimal analysis by single-stranded conformational polymorphism (SSCP) (17–19). While a number of laboratories would prefer to sequence these products directly, we have utilized the sensitive SSCP technique for the screening of our patients. This approach is especially effective if one has a number of patients with the same inherited disease so that one can appreciate a subtle difference in one of the lanes (see Fig. 2). Alternative screening techniques such as denaturing gradient gel electrophoresis (DGGE) (20), have also been successfully used, but we believe that such techniques are often more cumbersome to establish in the laboratory, especially for the analysis of so many different exons. Once a candidate PCR band is defined for a particular patient, the involved mutation needs to be determined. One direct method of doing this is to perform direct PCR sequencing of the purified PCR product. PCR cycle sequencing is a strategy which makes use of thermal cycling to obtain sequence information from very small amounts of template DNA using a thermostable DNA polymerase and dideoxynucleotide triphosphates. Using this method, it is possible to sequence PCR product directly without subcloning. We use the fmol DNA cycle sequencing Kit (Promega, Madison, WI) to sequence the PCR fragments that showed abnormal mobility on SSCP. There are several different ways of using this technique. We use end-labeled primers. Other techniques for automated sequencing or for internal labeling can also be followed. To optimize sequence quality, we recommend using a new set of primers for this sequencing, slightly internal to the original primers used for the PCR amplification.

1.3. Functional Analysis of the Mutation: COS-1 Cells Once a mutation is defined by the above techniques, it is important to show that it is relevant to the patient’s clinical illness. This can be done in a number of ways. One can demonstrate that the particular mutation is not found in the general population and that it is inherited coincidental with the clinical manifestation. The most direct route is to reproduce the defect in an experimental system. We describe the mutagenesis technique and the ex vivo expression systems used in our laboratory to define the biological implication of mutations in the αIIb or β3 cDNAs. Expression studies of the mutation require the introduction of the altered nucleotide into the wild-type cDNA. We utilize a PCR-based site-directed mutagenesis technique involving overlapped PCR products (18,21) (see Fig. 3). In this method, two overlapping complementary oligonucleotide primers are synthesized, incorporating the mutation to be introduced. As shown in Fig. 3, from wild type template cDNA, two overlapping PCR fragments are gener-

Inherited Platelet Receptor Disorder

317

Fig. 2. SSCP analysis results for exon 4 of β3 from a normal control (lane 1) and from a series of Glanzmann thrombasthenic patients (lanes 2-11), demonstrating an abnormal migrating band in lane 6. This patient had an exon splice donor mutation in this exon.

Fig. 3. Overlap PCR strategy for the preparation of a desired mutation. “A” and “B” refer to convenient unique restriction sites. “X” refers to the created mutation in the final cDNA.

317

318

Basani, Richberg, and Poncz

ated using a primer containing the single base pair substitution and a flanking primer. The PCR fragments are then gel purified and analysed on agarose gel to determine the approximate concentration. In the overlap PCR reaction, a combined PCR fragment is generated using the two shorter overlapping PCR fragments along with the flanking primers. The amplified overlap PCR fragment is then gel purified and digested with appropriate restriction enzymes for subcloning into the wild-type cDNA, similarly digested. The constructs are sequenced to confirm the presence of the desired mutation and to ensure that there are no PCR-induced artefacts. Typically, the first- and second-stage PCR amplification is done using Vent DNA polymerase enzyme since this has proofreading capabilities, giving a lower rate of PCR-induced mutations compared to Taq polymerase. To define the biological importance of the introduced overlap PCR mutation described above (which is naturally occurring in the patient), we clone these mutant cDNAs into expression vectors and transiently express the protein product in a selected cell line. For studies of the platelet integrin αIIb/β3 receptor, we have focused on COS-1 cells. COS-1 cells are appropriate for transient expression studies of the high-level expression of αIIb and β3 genes as these cells do not endogenously express these genes (see Fig. 4A).

1.4. Functional Analysis of the Mutation: 1500F B-Lymphocytes Although the analysis of the cDNA constructs in COS-1 cells provides information concerning the intercellular processing and surface expression of αIIb/β3, the inability of the COS-1 cells to activate the receptor and the transient nature of expression prohibits further functional analysis of both the wild type and mutant forms of the receptor. In an attempt to identify alternative cell systems to further investigate the functionality of the αIIb/β3, the 1500F B-lymphocytic cell line was chosen to establish transfected cell lines as it had been shown that phorbol ester (PMA) treatment of these cells result in activation of the related β2 integrin receptors (26). 2. Materials 2.1. Platelet RT-PCR

2.1.1. Isolation of Platelet RNA (see Notes 1 and 2). 1. Acid-citrate-dextrose: 38 mM citric acid, 61 mM Na3citrate, and 136 mM glucose. Adjust pH to 6.5. 2. 50-mL conical tubes. 3. RNA STAT-60™ (a high molar guanidinium thiocyanate solution) (Tel-Test “B” Inc., Friendswood, TX). 4. Chloroform.

Inherited Platelet Receptor Disorder

319

5. Isopropanol. 6. 100% Ethanol.

2.1.2. RT-PCR of Platelet mRNA 1. 2. 3. 4. 5. 6. 7. 8.

RT Buffer: 250 mM Tris-HCl, pH 8.3, 30 mM MgCl2, 375 mM KCl. 10 mM dNTP mix. DEPC-treated water. 80% Ethanol. cDNA synthesis primer at 100 ng/μL (see Note 3). MMLV reverse transcriptase (100 U/L) (Clontech, Palo Alto, CA). Tris-HCl, pH 8.0. Centricon 100 columns (Amicon, Beverly, MA).

2.2. Genomic DNA Analysis 2.2.1. Isolation of Genomic DNA 1. 2. 3. 4. 5. 6.

Anticoagulated whole blood. Isotonic saline: 0.9 g NaCl in 100 mL distilled water. Red cell lysis solution: 0.144 M NH4Cl, 1 mM NH4CO3 (mix together just before use). Chambon buffer A: 10 mM Tris-HCl, pH 8.0, 10 mM EDTA, 10 mM NaCl, 0.5% SDS. 0.75 mL (10 mg/mL) Proteinase K (predigested at 37°C for 1–2 h). Phenol:chloroform:buffer 1:1:1 (v/v/v): Redistilled phenol, chloroform, buffer (500 mM Tris-HCl, pH 8.0, 10 mM EDTA, 10 mM NaCl, 0.5% SDS, 0.1%(w/v) 8-hydroxyquinolone). 7. 100% Ethanol. 8. TE Buffer: 10 mM Tris HCl, pH 7.5, 1 mM EDTA.

2.2.2. Radiolabeled PCR Amplification of Genomic DNA 1. 10X thermophilic buffer (Promega, Madison, WI): 100 mM Tris-HCl, pH 9.0, 500 mM KCl, 1% Triton X-100. 2. DNA oligonucleotides: 200 ng of each primer. 3. 1.25 mM dNTP mix. 4. 25 mM MgCl2. 5. Genomic DNA: 500 ng/μL. 6. [α-32P]dCTP: 10 mCi/mL (Dupont, NEN Research Products, Boston, MA). 7. Taq polymerase (Promega, Madison, WI). 8. Distilled water. 9. 0.25-mL thin-walled PCR tubes.

2.2.3. SSCP Analysis of PCR Products 1. 2. 3. 4.

Siliconizing solution. 95% Ethanol. Ethidium bromide. Agarose.

320

Basani, Richberg, and Poncz

Fig. 4. Transient expression strategy is shown in (A), demonstrating the introduction of a G→C mutation. The mutated DNA in either pMT2ADA or pcDNA3 is transfected into COS-1 cells and after 35S-methionine labeling of the cells, the total cell proteins are immunoprecipitated with an appropriate antibody to the αIIb/β3 receptor. A typical result with wild-type constructs is shown in (B). Lane 1, Cells transfected only with the αIIb cDNA and immunoprecipitated with an anti-αIIb monoclonal antibody B1B5. Lane 2, Cells transfected with β3 alone and immunoprecipitated with an anti-β3 monoclonal antibody SSA6. Lane 3, Cells cotransfected with both vectors and immunoprecipitated with A2A9, a complex dependent monoclonal antibody.

Inherited Platelet Receptor Disorder

321

Fig. 4B 5. 10X TBE: 216 g of Tris base, 110 g boric acid, 80 mL of 0.5 M EDTA, pH 8.0. Make up to 2 L with distilled water. 6. 0.4-mm spacers. 7. Loading buffer: 30% Ficoll 400, 0.25% bromophenol blue, 0.25% xylene cyanol. 8. N,N,N’,N’,-Tetramethyl ethylenediamine (TEMED). 9. Whatman 3MM filter paper. 10. X-OMAT AR autoradiographic film (E. Kodak, Rochester, NY).

2.2.4. Direct PCR Sequencing 1. [γ-32P] ATP (10 mCi/mL) (Dupont, NEN Research Products, Boston, MA). 2. DNA oligonucleotides. 3. 10X T4 PNK buffer (Promega, Madison, WI): 500 mM Tris-HCl, pH 7.5, 100 mM MgCl2, 50 mM DTT, and 1 mM spermidine. 4. T4 polynucleotide kinase (Promega, Madison, WI). 5. PCR sequencing kit. 6. 5X sequencing buffer: 250 mM Tris-HCl, pH 9.0, and 10 mM MgCl2. 7. Sequencing grade Taq polymerase (Promega, Madison, WI). 8. Mineral oil. 9. Sequencing stop buffer: 10 mM NaOH, 95% formamide, 0.05% bromophenol blue and 0.05% xylene cyanol. 10. Acrylamide:bis-acrylamide (19:1). 11. Whatman 3MM filter paper. 12. X-OMAT AR autoradiographic film (E. Kodak, Rochester, NY).

2.2.5. Site-Directed Mutagenesis 1. 2. 3. 4.

250-μL thin walled PCR tubes. Wild-type cDNA. 10 mM dNTPs. DNA oligonucleotides.

322

Basani, Richberg, and Poncz

5. 10X VENT buffer: (200 mM Tris-HCl, pH 8.8, 100 mM KCl, 100 mM (NH4)SO4, 20 mM MgSO4, 1% Triton X-100 (New England Bio labs, Beverly, MA). 6. 100 mM MgSO4. 7. 10X VENT polymerase (New England Bio Labs, Beverly, MA). 8. GENECLEAN kit (Bio 101, Vista, CA). 9. Distilled water.

2.3. Transient Expression 1. COS-1 cells (American Type Culture Collection, Rockville, MD). 2. Dulbeco’s modified Eagle medium (high glucose) (DMEM) (Gibco BRL, Bethesda, MD) supplemented with 10% (V/V) heat-inactivated fetal calf serum (Gibco BRL). 3. 100 U/mL penicillin (Gibco BRL). 4. 100 μg/mL streptomycin (Gibco BRL). 5. 0.3 mg/mL L-glutamine (Gibco BRL). 6. 75 cm2 flasks (Corning Glass Works, Corning, NY). 7. Tris-buffered saline (TBS)-Dextrose: 100 mL of TBS pH 7.4 and 0.5 mL of 20% dextrose). 8. TBS-Dextran: 9.8 mL of Dextran-DEAE (Pharmacia Biotech Inc., Piscataway, NJ), 50 mg/mL of TBS, pH 7.4, 0.2 mL of 20% Dextrose in TBS, pH 7.4. 9. DMEM-chloroquine: 100 mL of DMEM and 100 μL of 100 mM chloroquine. 10. Methionine-free media: ICN Biomedical Inc., Costa Mesa, CA. 11. 35S-methionine 200–400 mCi/mL: Dupont, NEN Research Products, Boston, MA. 12. 0.02 M Tris HCl, pH 7.2, containing 1% Triton X-100, along with the protease inhibitors (all from Sigma Chemicals, St. Louis, MO) 10 μL/mL PMSF (phenyl methylsulfonyl fluoride, 17.4 mg/mL), N-carbobenzoxyl-L-glutamyl-L-tyrosine (44.4 mg/mL in ethanol), 1 μL/mL Aprotinin (2 mg/mL), and 1 μL/mL Leupeptin (2 mg/mL). 13. Fixed Staphylococci: Pansorbin, Calbiochem, San Diego, CA. 14. Antibodies. 15. Affi-Gel A: Bio-Rad Laboratories, Hercules, CA. 16. Resin wash buffer: 50 mM Tris HCl, pH 7.5, containing 0.01 M NaCl, 0.1% (w/ v) SDS, 1% Triton X-100, and 0.5% (w/v) deoxycholic acid. 17. Resin wash buffer + 0.3 M NaCl. 18. Elution buffer: 0.01 M Tris-HCl buffer, pH 6.8, containing 0.3% SDS and 0.2% dithiothreitol (DTT). 19. 0.1% SDS-7.5% polyacrylamide slab gels. 20. Fix solution: 10% (v/v) acetic acid-30% (v/v) methanol. 21. Phosphate-buffered saline (PBS): 140 mM NaCl, 2.7 mM KCl, 8.1 mM Na2HPO4·7H2O, and 1.2 mM KH2PO4; pH 7.1). 22. Lactoperoxidase 0.5 mg/mL (Sigma). 23. 125I: Dupont, NEN Research Products, Boston, MA. 24. H2O2. 25. Autofluor: National Diagnostics, Manville, NJ.

Inherited Platelet Receptor Disorder

323

2.4. Functional Analysis of the Mutation: 1500F B-Lymphocytes 2.4.1. Stable Expression System into Lymphocytes 1. pREP4 and pREP 9. 2. 1500F, EBV immortalized lymphocytes: A gift from Dr. Joel S. Bennett, University of Pennsylvania, Philadelphia, PA. 3. RPMI 1640: GIBCO BRL. 4. 10% (v/v) heat- inactivated fetal calf serum: GIBCO BRL. 5. 100 U/mL penicillin: GIBCO BRL. 6. 100 μg/mL streptomycin: GIBCO BRL. 7. 0.3 mg/mL L-glutamine: GIBCO BRL. 8. Physiological-buffered saline (PBS) (with Ca2+ and Mg2+). 9. Electroporation buffer: 20 mM HEPES, pH 7.05, 137 mM NaCl, 5 mM KCl, 0.7 mM Na2HPO4, and 6 mM dextrose. 10. Geneticin containing 750 μg/mL: GIBCO BRL. 11. Hygromycin B 200 μg/mL: Boehringer Mannheim, Germany.

2.4.2. Flow Cytometric Analysis A2A9 monoclonal antibody (A gift from Dr. Joel S Bennett, University of Pennsylvannia, Philadelphia, PA).

2.4.3. B-Lymphocyte Binding Assay 1. Purified fibrinogen is obtained from Enzyme Research Labs, South Bend, IN. 2. Buffer solution: solution: 50 mM NaHC03 pH 8.0, 150 mM NaCl, and 0.02% sodium azide. 3. 96-well microtiter plate, e.g., VWR, West Chester, PA. 4. Blocking solution: 50 mM NaHCO3, pH 8.0, 150 mM NaCl, 0.02% sodium azide, and 5 mg/mL BSA. 5. Translational grade 35S-methionine. 6. Solution 1: 50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1% BSA, 0.1% glucose, and 0.5 mM CaCl2. 7. Trypan blue. 8. Solution 2: TBS, pH 7.4, 0.5 mM CaCl2. 9. 10 mM PMA. 10. Ethanol. 11. Distilled water at 4°C. 12. 2% SDS.

3. Methods 3.1. Platelet RT-PCR

3.1.1. Isolation of Platelet RNA 1. Collect 10–50 mL of the patient’s blood directly into a syringe containing 1/6th vol of acid-citrate-dextrose and gently mix.

324

Basani, Richberg, and Poncz

2. Transfer the sample to a 50-mL conical tube and spin at 400g for 20 min at RT. Remove the top two-thirds of the platelet-rich plasma (PRP) phase on top, carefully avoiding the white cell interphase and transfer it to a fresh 50-mL conical tube. 3. Spin the sample at 1000g for 10 min to pellet the platelets. Aspirate off the plasma supernatant, leaving 200–400 μL of plasma on top of the platelet pellet. Gently resuspend the pellet in the remaining plasma by stirring with a pipette tip to create a thick slurry. DO NOT resuspend pellet by pipetting up and down as this activates the platelet and destroys the RNA. 4. Resuspend the platelets in the appropriate amount of RNA STAT-60™ (see Note 2). Vigorously pipet the solution up and down several times to ensure cell lysis. 5. Incubate at room temperature for 5 min to allow dissociation of nucleoprotein complexes, then add 0.2 mL of chloroform per 1 mL of RNA STAT-60. Cover sample and shake vigorously for 15–20 s. 6. Incubate at room temperature for another 5 min and then recentrifuge the sample at 12,000g for 15 min at 4°C. Transfer the aqueous phase to a fresh tube. Add 0.5 mL of isopropanol per 1 mL of RNA STAT-60 used initially. 7. Store the sample at room temperature for 5–10 min and again centrifuge at 12,000g for 10 min at 4°C. The RNA precipitate forms a translucent pellet at the bottom of the tube. 8. Wash pellet with 90% ethanol by vortexing and centrifuge at 7500g for 5 min. Use at least 1 mL of 90% ethanol per 1 mL of RNA STAT-60. Remove the supernatant and resuspend the RNA pellet in 1 mL of 50% ethanol at –70°C. 9. Quantify the yield of RNA by obtaining an OD reading at 260/280nm. Often the yield from platelets can be so low that one cannot quantify the yield. In which case, we recommend that a fourth of the RNA be used for the subsequent RT step.

3.1.2. RT-PCR of Platelet mRNA The next two steps are to convert the template RNA to first-strand cDNA followed by PCR amplification. 1. Spin down 5 μg of total RNA from the ethanol precipitate stock. Wash with 80% ethanol and air dry for 5 min. Dissolve in 4 μL of DEPC-treated H2O. 2. Add 1 μL of the cDNA synthesis primer (100 ng/μL). Heat sample at 70°C for 3 min (to remove secondary folding within the RNA) and allow to cool to room temperature for 10 min. Place sample on ice. 3. Add to the reaction mix: 2 μL RT buffer, 1 μL 10 mM dNTP mix, 1 μL MMLV reverse transcriptase (100 U/L), 2 μL H20. Total volume is 10 μL. 4. Incubate at 42°C for 1 h, and then stop the reaction by heat inactivation at 100°C for 10 min. 5. Dilute the reaction to 1 mL with Tris HCl, pH 8.0, and concentrate in a Centricon 100 to 50 μL. Readjust volume to 1 mL with Tris-HCl, pH 8.0, and concentrate again to 20 μL, using Centricon columns. 6. The sample now represents a stock of single-stranded cDNA template ready for amplification by standard PCR techniques. Each optimal set of PCR conditions

Inherited Platelet Receptor Disorder

325

must be worked out for individual laboratories. The amount of this first strand cDNA stock needed for PCR amplification varies between laboratories, but can often be as little as 1/1,000th of the platelet preparation, assuring a ready resource for the multiple amplifications.

3.2. Genomic DNA Analysis 3.2.1. Isolation of Genomic DNA (see Note 4) 1. Collect 10–50 mL of either citrated or heparinized peripheral blood into a 50-mL conical tube. Centrifuge the sample at 3000 rpm for 20 min and carefully remove the plasma. 2. Wash the cellular pellet twice with isotonic saline and then selectively lyse the red cells with 25 mL of 0.144 M NH4Cl and 2.5 mL of 1 mM NH4CO3. Mix well and leave at room temperature for 30 min. The sample will turn black with complete lysis. Spin down the white cell pellet at 3000 rpm for 10 min. Carefully remove the lysed red cell solution. 3. Wash the white cell pellet twice with isotonic saline. 4. Resuspend the pellet in 1 mL of isotonic saline. Slowly add the suspension dropby-drop to 75 mL of 1X Chambon buffer A and 0.75 mL Proteinase K in a 500– 1000-mL flask. Swirl the buffer gently as you add the cells. Leave the flask at 37°C overnight or longer until the white cells are completely digested. 5. The next day, add 20 mL buffered phenol:chloroform and agitate for several minutes so that the viscous DNA solution mixes with the phenol layer. Centrifuge at 3000 rpm for 10 min. Carefully transfer the aqueous layer into a clean flask and repeat until the phenol layer is clear. 6. Decant the aqueous phase slowly into a clean one liter flask which contains 150 mL of 100% ethanol so that the aqueous phase underlies below the ethanol. Occasional, gentle rocking of the flask back and forth will lead to high molecular DNA strands slowly forming over one day. 7. With a glass pipette, gently remove the DNA by swirling it onto the tip of the pipet and transfer the DNA to an Eppendorf tube. 8. Wash twice with 75% ethanol and lyophilize dry for a few minutes. Resuspend the DNA in 0.5 mL of TE and by gentle inversion, the DNA should go into solution (see Note 3).

3.2.2. Radiolabeled PCR Amplification of Genomic DNA It is very difficult to define a single set of PCR conditions that will ensure optimal specific amplification of the target DNA sequence. We describe the basic protocol that has been successful in our laboratory for most of the exons of both αIIb and β3 genes. 1. All reagents used in the polymerase chain reaction should be prepared with sterile distilled water and stored at –20°C. 2. Using 0.25-mL thin-walled PCR tubes, add 200 ng of the paired sense and antisense primers (~20-mers), 10 μL of 10X thermophilic buffer, 10 μL of 1.25 mM dNTPs,

326

Basani, Richberg, and Poncz

10 μL of 25 mM MgCl2, 500 ng of genomic DNA, 1 μL of [α-32P]dCTP and make up to a final volume of 100 μL adding distilled water (see Note 5). 3. Mix the tubes well and quick spin to make sure that nothing stick to the walls of the tubes. Transfer the tubes to a thermal cycler and heat at 94°C for 5 min. Then add 2 U of Taq polymerase and initiate the following program for 30 cycles: Denaturation at 94°C for 15 s, primer annealing at 55–60°C for 30 s, and primer extension at 72°C for 40 s. After the final cycle, carry out an additional step of 72°C for 5 min to ensure that primer extension is completed, giving a full-length product. 4. After thermal cycling, the samples are analysed on agarose gel to determine the amount of DNA per PCR product. Near identical amounts of PCR products are then subjected to SSCP analysis.

3.2.3. SSCP Analysis of the PCR Products SSCP is a very rapid and sensitive technique in identifying disease causing mutations and also polymorphisms (17,19). The method involves the amplification by PCR of a discreet segment of genomic DNA in the presence of radiolabelled nucleotides, denaturing of the PCR products in formamide, and analysing the single strands on a nondenaturing polyacrylamide gel. Under these conditions single stranded DNAs refold into stable conformations by intrastrand interactions of nucleotides. Because of the intrastrand nucleotide pairing, each single strand DNAs attain a signature conformation that may migrate differently on a nondenaturing polyacrylamide gel electrophoresis (Fig. 2). Based on the intensity of the PCR products on an ethidium bromidestained agarose gel, equal amounts of each PCR samples are added to a final volume of 10 μL, including loading dye. The protocol for SSCP analysis is very similar to manual DNA sequencing except that after the initial denaturation of the sample, the sample is allowed to renature and run in the gel under renaturing conditions, including not having urea in the gel, lower wattage to avoid heating up the sample and running the gel in the cold room. 1. Glass plates must be clean and free of dried gel or soap residue. To remove these residues, wash both plates with 95% ethanol. Set up the plates. One of the two glass plates, preferably the smaller plate, must be siliconized. We use 0.4-mm spacers to make a thin gel. 2. To pour a 0.4-mm gel, combine 9 mL of 10X TBE with 13 mL of 19:1 acrylamide:bisacrylamide and make up the volume up to 90 mL with distilled water. 3. When ready to pour, add 0.1 g of ammonium persulphate, swirl the contents to completely dissolve. Add 30 μL of TEMED, swirl and immediately pour the solution between the glass plates, making sure not to trap any air bubbles. Insert a comb and clamp it. Allow the gel to polymerize for at least 60 min at room temperature.

Inherited Platelet Receptor Disorder

327

4. Run the gel in 1X TBE buffer. Always run the gel at 4°C to avoid artefacts bands (see Note 6). Prerun the gel for 20 min. 5. Denature the samples in formamide at 100°C for 5–10 min and then placed on ice for several minutes. 6. Load the samples on the gel and run for 4–5 h at 16–20 W. 7. Transfer the gel on to Whatman 3MM filter paper, dry, and expose to radiographic film overnight at –70°C. From the autoradiography compare the mobility of the fragments of the patients’ DNAs with a concurrently run normal control (Fig. 2) (see Note 7).

3.2.4. Direct PCR sequencing (see Note 8) 1. The first step is primer labeling. a. In a 0.5-mL Eppendorf tube add 10 pmol of sequencing primer, 3 μL of [γ- 32P] ATP, 1 μL of 10X T4 PNK buffer, 5–10 U of T4 polynucleotide kinase, and make up to a final volume of 10 μL with distilled water. b. Mix the contents, quick spin and incubate at 37°C for 30 min. Then inactivate the enzyme at 90°C for 2 min. 2. The second step in direct sequencing is the extension/termination reaction a. For each set of sequencing reaction, label four 0.5-mL Eppendorf tubes as A, C, G, and T. b. Add 4 μL of appropriate d/ddNTP mix to each tube and leave on ice until use. c. For each set of sequencing reaction, mix 4–40 fmols of template DNA, 10 μL of 5X buffer of 3 μL of [γ-32P]d ATP labeled primer and makeup to a final volume of 32 μL with distilled water in a separate Eppendorf tube. d. Add 10 U of sequencing grade Taq DNA polymerase to the reaction and briefly mix by pipeting. e. Add 8 μL of enzyme/primer/template mix to each of the d/ddNTP (A, C, G, T) mixes and overlay with approx three drops of mineral oil to ~100 μL and briefly spin in a microcentrifuge. f. Place the tubes in a thermal cycler and heat the samples at 95°C for 2 min and initiate the cycling program for 30 cycles (see Note 9). The following conditions for sequencing for a primer