Counseling About Cancer: Strategies for Genetic Counseling [4 ed.] 1119466466, 9781119466468

Citation preview

Counseling About Cancer

Counseling About Cancer Strategies for Genetic Counseling Fourth Edition

Katherine A. Schneider, MPH, CGC Dana-Farber Cancer Institute, Boston, MA

Anu Chittenden, MS, CGC Dana-Farber Cancer Institute, Boston, MA

Kristen Mahoney Shannon, MS, CGC Massachusetts General Hospital Cancer Center, Boston, MA

This fourth edition first published 2023 © 2023 by John Wiley & Sons Ltd Edition History John Wiley & Sons, Inc. (3e, 2012); John Wiley & Sons, Inc. (2e, 2001) All rights reserved. No part of this publication may be reproduced, stored in a retrieval system, or transmitted, in any form or by any means, electronic, mechanical, photocopying, recording or otherwise, except as permitted by law. Advice on how to obtain permission to reuse material from this title is available at http://www.wiley.com/go/permissions. The right of Katherine A. Schneider, Anu Chittenden, and Kristen Mahoney Shannon to be identified as the authors of this work has been asserted in accordance with law. Registered Offices John Wiley & Sons, Inc., 111 River Street, Hoboken, NJ 07030, USA John Wiley & Sons Ltd, The Atrium, Southern Gate, Chichester, West Sussex, PO19 8SQ, UK For details of our global editorial offices, customer services, and more information about Wiley products visit us at www.wiley.com. Wiley also publishes its books in a variety of electronic formats and by print-­on-­demand. Some content that appears in standard print versions of this book may not be available in other formats. Trademarks: Wiley and the Wiley logo are trademarks or registered trademarks of John Wiley & Sons, Inc. and/or its affiliates in the United States and other countries and may not be used without written permission. All other trademarks are the property of their ­respective owners. John Wiley & Sons, Inc. is not associated with any product or vendor mentioned in this book. Limit of Liability/Disclaimer of Warranty The contents of this work are intended to further general scientific research, understanding, and discussion only and are not intended and should not be relied upon as recommending or promoting scientific method, diagnosis, or treatment by physicians for any particular patient. In view of ongoing research, equipment modifications, changes in governmental regulations, and the constant flow of information relating to the use of medicines, equipment, and devices, the reader is urged to review and evaluate the information provided in the package insert or instructions for each medicine, equipment, or device for, among other things, any changes in the instructions or ­indication of usage and for added warnings and precautions. While the publisher and authors have used their best efforts in preparing this work, they make no representations or warranties with respect to the accuracy or completeness of the contents of this work and ­specifically disclaim all warranties, including without limitation any implied warranties of merchantability or fitness for a particular purpose. No warranty may be created or extended by sales representatives, written sales materials or promotional statements for this work. This work is sold with the understanding that the publisher is not engaged in rendering professional services. The advice and strategies contained herein may not be suitable for your situation. You should consult with a specialist where appropriate. The fact that an organization, website, or product is referred to in this work as a citation and/or potential source of further information does not mean that the publisher and authors endorse the information or services the organization, website, or product may provide or recommendations it may make. Further, readers should be aware that websites listed in this work may have changed or disappeared between when this work was written and when it is read. Neither the publisher nor authors shall be liable for any loss of profit or any other commercial damages, including but not limited to special, incidental, consequential, or other damages. Library of Congress Cataloging-­in-­Publication Data Names: Schneider, Katherine A, author. | Chittenden, Anu, author. |   Shannon, Kristen Mahoney, author. Title: Counseling about cancer : strategies for genetic counseling /   Katherine A Schneider, Anu Chittenden, Kristen Mahoney Shannon. Description: Fourth edition. | Hoboken, NJ : Wiley-Blackwell, 2023. |   Includes bibliographical references and index. Identifiers: LCCN 2022030098 (print) | LCCN 2022030099 (ebook) | ISBN   9781119466468 (paperback) | ISBN 9781119466482 (adobe pdf) | ISBN   9781119466475 (epub) Subjects: MESH: Neoplasms–genetics | Genetic Counseling Classification: LCC RC268.4 (print) | LCC RC268.4 (ebook) | NLM QZ 210 |   DDC 616.99/4042–dc23/eng/20220819 LC record available at https://lccn.loc.gov/2022030098 LC ebook record available at https://lccn.loc.gov/2022030099 Cover Design by Wiley Cover Image: Lindwa/Shutterstock, PASIEKA/Getty Images Set in 10/12pt and PalatinoLTStd by Straive, Pondicherry, India

We dedicate this book with appreciation and love to our wonderful, supportive parents: Donald and Patricia Daviau Ambat and Prema Bhaskar Donald and Karen Mahoney

Contents

Foreword, xi Preface, xiii Acknowledgments, xv CHAPTER 1: CANCER DIAGNOSIS AND TREATMENT,  1

1.1. 1.2. 1.3. 1.4. 1.5. 1.6. 1.7.

The Diagnosis of Cancer,  1 Tumor Classification,  8 Cancer Treatment,  14 Risk Factors for Cancer,  28 Case Examples,  30 Discussion Questions,  33 Further Reading,  33

CHAPTER 2: GASTROINTESTINAL CANCER SYNDROMES,  35

2.1. 2.2. 2.3. 2.4. 2.5. 2.6.

Anatomy, 36 Colorectal Cancer,  45 Gastric (Stomach) Cancer,  47 Pancreatic Cancer,  49 Lynch Syndrome,  51 Familial Adenomatous Polyposis/Attenuated Familial Adenomatous Polyposis, 62 2.7. MUTYH-­Associated Polyposis,  68 2.8. NTHL1 Tumor Syndrome,  73

vii

viii Contents

2.9. Polymerase Proofreading-­Associated Polyposis Syndrome,  75 2.10. Juvenile Polyposis Syndrome,  79 2.11. Peutz-­Jeghers Syndrome,  84 2.12. PTEN Hamartoma Tumor Syndromes,  88 2.13. Hereditary Mixed Polyposis Syndrome,  90 2.14. Serrated Polyposis Syndrome,  92 2.15. Hereditary Diffuse Gastric Cancer Syndrome,  96 2.16. Familial Atypical Multiple Mole Melanoma Syndrome,  101 2.17. Hereditary Pancreatitis/Familial Pancreatitis,  105 2.18. Short Reviews,  111 2.19. Further Reading,  114 CHAPTER 3: BREAST AND GYNECOLOGICAL CANCER SYNDROMES,  129

3.1. 3.2. 3.3. 3.4. 3.5. 3.6.

Anatomy, 129 Overview of Counseling Issues,  131 Selected Breast and Gynecologic Syndromes,  133 Case Examples,  157 Discussion Questions,  160 Further Reading,  160

CHAPTER 4: RARE TUMOR PREDISPOSITION SYNDROMES,  163

4.1. 4.2. 4.3. 4.4. 4.5. 4.6.

Overview of Rare Tumor Syndromes,  163 Overview of Counseling Issues with Rare Tumor Syndromes,  171 Clinical Features of Selected Rare Tumor Syndromes,  173 Case Examples,  204 Discussion Questions,  207 Further Reading,  207

CHAPTER 5: PEDIATRIC TUMOR PREDISPOSITION SYNDROMES,  209

5.1. 5.2. 5.3. 5.4. 5.5.

Counseling Issues,  209 Pediatric Tumor Predisposition Syndromes,  213 Case Examples,  262 Discussion Questions,  265 Further Reading,  266

ix

Contents

CHAPTER 6: CANCER FAMILY HISTORIES (COLLECTION AND INTERPRETATION), 269

6.1. 6.2. 6.3. 6.4. 6.5. 6.6.

Collecting a Cancer History,  269 Challenges to Collecting an Accurate History,  289 Interpreting a Cancer History,  293 Case Examples,  299 Discussion Questions,  303 Further Reading,  304

CHAPTER 7: CANCER RISK ASSESSMENT AND RISK MODELS,  307

7.1. 7.2. 7.3. 7.4. 7.5. 7.6. 7.7. 7.8.

Risk Definitions,  308 Risk Perception and Cancer Risk,  310 Risk Factors,  312 Risk Modeling,  318 Genetics Criteria,  330 Case Examples,  333 Discussion Questions,  334 Further Reading,  335

CHAPTER 8: GENETIC TESTING TECHNOLOGIES,  337

8.1. 8.2. 8.3. 8.4. 8.5. 8.6.

Older Technologies,  338 Newer Technologies,  348 Clinical Issues,  357 Case Examples,  363 Discussion Questions,  365 Further Reading,  366

CHAPTER 9: PRE-­AND POST-­TEST GENETIC COUNSELING,  369

9.1. 9.2. 9.3. 9.4. 9.5.

Traditional Pre-­Test Genetic Counseling Session,  371 Pre-­Test Strategies for Genetic Counselors,  384 Other Pre-­Test Genetic Counseling Considerations,  387 Alternative Service Delivery Models for Pre-­Test Education,  388 Traditional Post-­Test Genetic Counseling,  390

x Contents

9.6. Post-­Test Genetic Counseling When the Genetic Counselor Was Not Involved in Pre-­Test Education,  396 9.7. Possible Patient Reactions to Results,  397 9.8. Follow-­Up Genetic Counseling,  399 9.9. Psychological Assessment Throughout the Genetic Testing Process (see also Chapter 11),  401 9.10. Summary and Future Directions,  403 9.11. Case Examples,  404 9.12. Discussion Questions,  405 9.13. Further Reading,  406 CHAPTER 10: SPECIAL POPULATIONS AND SPECIAL SITUATIONS,  409

10.1. Counseling for Special Populations,  409 10.2. Counseling About Unanticipated Results,  417 10.3. Case Examples,  421 10.4. Discussion Questions,  425 10.5. Further Reading,  425 CHAPTER 11: PSYCHOSOCIAL ASPECTS OF CANCER GENETIC COUNSELING,  429

11.1. Contextual Information About Patients,  430 11.2. Patient Reactions, Coping Responses, and Risk Perception,  442 11.3. Strategies for Providing Psychosocial Counseling,  446 11.4. Strategies for Effective Psychosocial Genetic Counseling,  454 11.5. Providing Additional Emotional Support,  461 11.6. Case Examples,  468 11.7. Discussion Questions,  473 11.8. Further Reading,  473 CHAPTER 12: E  THICAL ISSUES IN CANCER GENETIC COUNSELING AND TESTING, 475

12.1. Bioethical Principles and Framework,  476 12.2. Putting Ethics into Practice,  484 12.3. Types of Ethical Dilemmas in Cancer Genetic Counseling,  492 12.4. Case Examples,  501 12.5. Discussion Questions,  504 12.6. Further Reading,  504 Index, 507

Foreword

I was so surprised and pleased when Kathy Schneider asked me to write a foreword to this latest edition of her now iconic cancer genetic counseling text, Counseling About Cancer. Kathy and I have been colleagues and friends since collaborating on the very first National Society of Genetic Counselors (NSGC) Short Course on Cancer Genetics in 1993 and joining with other pioneering counselors to form the Familial Cancer Special Interest Group in 1997. Over the decades, through presentations, publications, and other professional activities I have come to know and admire Kristen Shannon and Anu Chittenden for their caring manner and superb cancer genetic counseling expertise. Their recruitment as co-­authors adds special breadth and depth to the text. Genetic counselors are only as good as their sources of information. Families come to us for accurate information about the condition in their family, and to help them process complex information in order to make difficult personal decisions. Trusted resources include reliable research and clinical laboratories, medical genetics, oncology and genetic counseling colleagues, and well-­worn texts. From the beginning of the cancer genetic counseling specialty, Counseling About Cancer has been a unique trusted resource to guide our practice, for both novices and experienced counselors alike. Each edition has added to the growing body of information. In the almost a decade since the third edition, breathtaking changes have occurred in cancer diagnosis and treatment, recognition of new inherited cancer susceptibility syndromes, and refinement of familiar diagnoses. Genome-­wide association studies and applied biostatistical methods have refined risk modeling and risk assessment. Genetic testing has expanded to include discovery of new cancer predisposing genes, common use of multigene panels, exome, and whole-­genome analyses. Relationships are as essential to the process of genetic counseling as they are to life itself. Our relationships to those who seek our services or who participate in groundbreaking research must be built on mutual trust and respect. Greater consciousness of diversity has led to modifying genetic counseling in addressing communities with unique qualities and particular needs. The chapters on psychosocial and ethical issues provide a critical framework for cancer genetic counselors to build mutually enriching relationships with individuals, couples, and families who seek our care and expertise.



xi

xii Foreword

In summary, you can rely on the authors to provide you with the essentials of cancer genetic counseling for a rewarding lifetime practice. June A. Peters, MS, CGC, LMFT Retired Genetic Counselor, National Cancer Institute Recipient of 2021 Natalie Weissberger Paul Award May 2022

Preface

It may seem hard to believe, but there was a time when cancer was not considered a major genetic counseling specialty. Genetic counselors have now become fully integrated into clinical oncology clinics by providing care to at-­risk patients, newly diagnosed and advanced cancer patients, and cancer survivors. Somatic and germline genetic test results are routinely requested by oncologists with the expectation that results will help guide surgical and treatment decisions, including clinical trial options. The expanded utility of genetic test results and assessments of family history have given new options and hope to individuals and their medical providers—­ and has greatly increased the demand for cancer genetic counselors. In a small way, the various editions of this textbook have marked the exponential growth and sophistication of cancer genetic counseling from the slim self-­published first edition sponsored by the Jane Engelberg Fellowship Award in 1992 to the larger second edition and even larger third edition, published by John Wiley & Sons, which included a greater number of cancer syndromes and genetic testing options. This fourth edition reflects how far (and fast) the specialty continues to grow, by offering a treasure trove of new and updated information about tumor predisposition syndromes, testing options, and the genetic counseling processes and discussion points. Given the large number of publications to cull through and summarize, I wisely enlisted two experienced cancer genetic counselors, Anu Chittenden, MS, CGC, and Kristen Shannon, MS, CGC, to co-­author this book with me. Chapter 1 provides an overview of cancer diagnosis and treatment, including the ways in which many cancers are diagnosed and the various types of treatment plans, from watchful surveillance to stem cell transplants. Becoming familiarized with the medical aspects of the patient’s cancer journey may be useful in terms of practical considerations and when fostering connections with patients. Chapters 2 through 5 provide detailed information about the currently known hereditary cancer syndromes and includes sections on clinical criteria, associated cancer risks, genetic testing considerations, and screening recommendations. Chapter 2 discusses gastrointestinal cancer syndromes, Chapter  3 discusses breast and gynecological cancers, Chapter  4 discusses rare tumor predisposition syndromes, and Chapter 5 discusses pediatric cancer syndromes. Chapter 5

xiii

xiv Preface

also includes a discussion of counseling strategies and challenges, which may be unique or intensified in pediatric cancer counseling. Chapters 6 through 9 shift the focus to the genetic counseling and testing process. The evolving needs of patients and the referring providers, the increased reliance on technology, and the wider availability of multigene panel testing have all contributed to changes in how genetic counselors interact with patients. Strategies for collecting and assessing family histories are covered in Chapter 6, while Chapter 7 focuses on the available risk models with their varying benefits and limitations. Chapters 8 and 9 provide detailed information about the genetic testing process, including descriptions of the various testing technologies and possible types of results (Chapter 8) and and the important components of pre-­and post-­test discussions (Chapter 9). And because there may be special counseling challenges with certain situations or types of patients, Chapter  10 highlights some of the special populations that cancer counselors may encounter and highlights helpful tips and suggestions to providing effective care. Chapter 11 continues the focus on the counseling aspect of patient interactions by discussing the relevant psychosocial factors that allow counselors to better “see” their patients and providing strategies to help foster more meaningful connections with patients. There is also a new section on how to recognize and avoid signs of provider burnout, which seems especially relevant as the world emerges from the COVID-­19 pandemic. Chapter 12 provides an overview of the types of ethical dilemmas that counselors may come across and offers strategies for how to resolve them. Tables, figures, and case examples are included throughout the book to further illustrate the points made in the text. In addition, at the end of each chapter, possible discussion questions and additional reading suggestions are included. Anu, Kristen, and I sincerely hope that this textbook proves to be a comprehensive and valuable resource for practicing genetic counselors and other health care providers as well as for genetic counselors in training. Happy reading! Katherine A. Schneider, MPH, CGC Dana-­Farber Cancer Institute

Acknowledgments

We want to thank the many people who helped and supported us through the process of writing this book, including our wonderful and exceedingly patient editor and publishing staff at Wiley. First, we are extremely grateful to the colleagues who reviewed one or more chapters of the book. Your feedback was invaluable! Specifically, we want to thank Janice Berliner, Leah Biller, Kasia Bloch, Gayun Chan-­Smutko, Tom Chittenden, Dillon Davis, Kayla Hamilton, Elaine Hiller, Diane Koeller, Brandie Leach, Lisa Madlensky, Ellen Matloff, Wendy McKinnon, Bita Nehora, Beth Peshkin, June Peters, Robert Resta, Irene Rainville, Jaclyn Schienda, Sarah Scollon, Morgan Similuk, Jilliane Sotelo, Scott Weismann, and Matt Yurgelin. In addition, each of us has specific individuals in our lives who we wish to acknowledge. Katherine Schneider: I want to thank all of my amazing friends and family who have helped out in so many different ways over the past few years: ••

••

••

••



To my three wonderful sons, Nicholas Schneider, Christopher Schneider, and Jordan Schneider, who were young children when I wrote the first edition of this book; my two awesome daughters-­in-­law, Rachel Schneider and Kayla Schneider, and my incredibly talented grandson, Oliver Schneider. I am so proud of all of you as you follow your dreams. To my sister, Julia Daviau, for happily adapting to life here in Boston and for our shared love of puzzles and old movies, with a special shoutout to my sister’s fabulous companion care provider, Jeannie McEleney; and to my two awesome brothers, Thomas Daviau and Robert Daviau. To my amazing co-authors, Anu and Kristen - I am so grateful for your friendship. And to Audrey D’Atri, Jill Stopfer, Carmen Tso, Dr. Huma Rana, Dr. Judy Garber, Dr. Lisa Diller, Dr. Junne Kamihara, Dr. Sapna Syngal, Dr. Matthew Yurgelun and all my other wonderful colleagues at the Dana Farber. —­thanks for all you do. To my dearest friend and hiking/theater companion, Vickie Venne, who is the hardest-­ working person I know—­even after retirement! xv

xvi Acknowledgments

••

•• ••

••

To Daniel Hulub & Dee Towne and Frank & Carolyn Walker—­thanks for all your support, laughter, and fun; you truly are my Boston “family.” To all my spiritual friends and sisters, especially Brenda Vigue and Kacey O’Donnell. And a huge thank you to others who have provided friendship and connection over the years, including Rhoda Berlin, Karen Fassett, Kelly Hatfield, Janine Kakishita, Debbie Lewis, and Rebecca Porter. Lastly, in memoriam to my beloved parents and partner, Bradford Kinne—­we never truly lose the ones we love.

Anu Chittenden: ••

••

••

••

••

••

••

•• ••

••

A huge thank you to my good friends and co-­authors. Kathy, I am so grateful for all that you have done for me. (However, if you ever want to do this again, I am running in the other direction.) Kristen, thank you for always bringing the laughter into everything we do. Both of you are my role models and amazing people. To my husband and favorite human, Tom Chittenden, who put up with me during this (seemingly endless) process. You really are the most patient and supportive person I have ever known, and all of my friends agree. To my daughters, Amara and Abby Chittenden, two strong, independent, interesting, caring, and funny young women. I am so lucky and so proud of both of you. I hope you both find the kind of fulfillment in your careers that I have. To my two families: To my brothers, Rohit and Ranjit, sisters-­in-­law, Sunu and Lauren, nieces (Nitya, Divya, and Sandhya), nephews (Morgan and Rilen), cousins (Ramesh, Rahul, and all), and extended family, especially my two aunts, Leela and Krishna (matriarchy rules). And to Kathy, Doug, Johnny, Katherine, Beth, Jim, and the rest of this crazy family—­I know you don’t know what I do but thank you for listening. To the many genetic counselors I have had the privilege of working with over the years at DFCI. You have left pieces of yourselves and remain unforgettable to me, especially Elaine, Shelley, Kelly, Irene, Emily, and Monica. To my Dana-­Farber family and Dr. Judy Garber—­not many people get to spend their entire careers in one place with such dedicated and wonderful people. And a special thanks to my DFCI BFF, Chinedu Ukaegbu, and the make-­it-­happen team of Audrey D’Atri, Huma Rana, Sarfaraz Shaikh, and Jill Stopfer. To my classmates, Deedy Hamer, Judy Jackson, Susan Estabrooks Hahn, and Kristin Clemenz—­you are all incredible people! Who knew that getting off the wait list would lead to a lifelong friendship? I look forward to celebrating another 25 years with all of you. Thank you to Judith and the Brandeis program for bringing us together. To Patrick Chittenden—­your love of life, personality, and smile will never be forgotten. To my in-­laws, Ted and Diana Chittenden, who accepted me without checking my citizenship status, made me feel welcome, and respected me for my career. And to Prema and Ambat Bhaskar—­you gave up everything for a better life for us. We were so lucky to have you as parents.

Acknowledgments

xvii

Kristen Shannon: ••

••

••

••

••

••

••

••

To my incredible husband, Sam. Thank you for dealing with me and all my idiosyncrasies. Your love, support, encouragement, and humor have carried me through. I could not possibly be the woman I am without you by my side. I love you very much and am so grateful to travel through this crazy fun life with you. To my four amazing kids, Kevin, Luke, Molly, and Matthew. I’m blessed to have such loving, supportive, and absolutely hilarious children. I’m incredibly proud of each of you and am privileged that you call me Mom. To my terrific parents, Karen and Don Mahoney. Your unconditional love, support, and sacrifice have helped make me the person I am today. To my awesome sister, Deanna McLaughlin, who is always there for me, and my terrific brother, Don Mahoney. Thanks for being such great friends and always having my back. I’m so thankful we are so close (emotionally and geographically!) and get to raise our families together. To my best and dearest friend, Amy Foohey. Our friendship has truly stood the test of time! Your generosity, love, and support are unparalleled. I am honored to call you my best friend and can’t imagine life without you by my side. To my “Carlin Girls”: Christine Bryson, Kathleen Eaton, Madeleine Friend, Donna McAndrews, and Jennifer Tschirch Phillips. Your love and support throughout the years have been endless. I’m truly grateful. To Devanshi Patel and Meredith Seidel, who make my work life manageable and (more importantly) fun, and all my amazing coworkers at the Mass General Cancer Center Genetics Program. Our team is truly a family, and I am very grateful for each of you. Thank you for all your tireless work over the years to make our program so successful. And lastly, to my inspirational co-­authors, Kathy Schneider and Anu Chittenden. We certainly have had lots of fun over the past decades. I’m humbled to be involved in this project. Thank you for being such wonderful mentors and friends.

Finally, we are so appreciative and grateful for the wonderful patients and families who have taught us so much over the years.

CHAPTER

1 Cancer Diagnosis and Treatment

Doctors have always recognized that every patient is unique, and doctors have always tried to tailor their ­treatments as best they can to individuals. You can match a blood transfusion to a blood type. That was an important discovery. What if matching a cancer cure to our genetic code was just as easy, just as standard? —­President Barack Obama (January 30, 2015; Precision Medicine Initiative)

A cancer genetic counseling session often begins with hearing the patient’s cancer story: the symptoms that led to the suspicion of cancer, the way in which the diagnosis was made, and the subsequent treatment regimen. This chapter describes the process of making a cancer diagnosis, the systems used to classify tumors, and the current strategies for cancer treatment. The chapter will also briefly touch on the risk factors for cancer as context for a genetic counseling session.

1.1.  The Diagnosis of Cancer This section provides the information necessary to understanding a cancer diagnosis, from how cancer is diagnosed to the nomenclature used to describe the tumor and the treatment options that are available. 1.1.1.  Cancer Detection A diagnosis of cancer often begins with a worrisome symptom or problem on a medical intake or screening test. For example, a physical exam may reveal swollen lymph glands or unusual tenderness. A routine screening test, such as a colonoscopy, cervical Pap smear, or blood test,

Counseling About Cancer: Strategies for Genetic Counseling, Fourth Edition. Katherine A. Schneider, Anu Chittenden, and Kristen Mahoney Shannon. © 2023 John Wiley & Sons Ltd. Published 2023 by John Wiley & Sons Ltd.

1

2

Counseling About Cancer

may identify the presence of atypical cells or an unusually high number of cells. A blood specimen that shows a dramatically high count of “blasts” (immature white blood cells) in a young child may point to the presence of acute lymphoblastic leukemia. In many cases, patients have noticed warning signs of cancer (see Table 1.1). They may note a new physical finding, such as a breast lump, or they have health problems that are not abating over time (such as a persistent cough) or even getting worse (such as bleeding after a bowel movement). People are more likely to experience symptoms or warning signs if their tumor: •• •• •• ••

Is pressing on neighboring tissue and causes pain Is interfering with the functioning of normal tissue Has invaded the blood vessels to cause abnormal bleeding Has grown large enough to be palpated

A malignant tumor can be present for months, even years, before it is detected. The reasons why cancer detection can be so difficult are presented in the following sections. 1.1.1.1.  Lack of Warning Signs There may be no physical symptoms that signal the presence of early-­stage cancer. Observable signs of cancer are more likely to be noticed as the cancer progresses. Sometimes, this means that the hallmarks of cancer, such as a lump, bleeding, or pain, indicate a malignancy that is already in an intermediate or advanced stage. However, most of the time, common symptoms are unrelated to cancer. If symptoms persist, they should be evaluated. TABLE 1.1.  General Signs and Symptoms of Cancer •• •• •• •• •• •• •• •• •• •• •• •• •• •• ••

Fatigue or extreme tiredness that doesn’t get better with rest Weight loss or gain of 10 pounds or more for no known reason Eating problems such as not feeling hungry, trouble swallowing, belly pain, or nausea and vomiting Swelling or lumps anywhere in the body Thickening or lump in the breast or other part of the body Pain, especially new or with no known reason, that doesn’t go away or gets worse Skin changes such as a lump that bleeds or turns scaly, a new mole or a change in a mole, a sore that does not heal, or a yellowish color to the skin or eyes (jaundice) Cough or hoarseness that does not go away Unusual bleeding or bruising for no known reason Change in bowel habits, such as constipation or diarrhea, that doesn’t go away or a change in how stools look Bladder changes such as pain when passing urine, blood in the urine, or needing to pass urine more or less often Fever or night sweats Headaches Vision or hearing problems Mouth changes such as sores, bleeding, pain, or numbness

Source: American Cancer Society (accessed 2021).

1. Cancer Diagnosis and Treatment

3

1.1.1.2.  Imperfect or Lack of Screening Methods To be effective, screening tests need to be easily performed, affordable, and accurate in d ­ etecting disease cases while limiting the number of false positive tests. The cancers must be detectable at earlier, more curable, stages and must occur at a frequency that justifies population screening. For example, a Pap smear is an effective screening test for cervical cancer, because it is a fairly common disease and early diagnosis has been shown to make a significant difference in survival. Cancers such as ovarian cancer have no known effective screening methods in detecting cancer reliably, although much work is being done in this area. Screening tests for less common forms of cancer are generally offered only to those known to be at high risk. 1.1.1.3.  Elusive Premalignant Cells Few organs can be readily and repeatedly sampled, which makes it difficult to monitor the organs for malignant or (even better) premalignant cells. At this point, only a few screening tests reliably detect premalignant cells, with colonoscopies being one of the best examples. Cutting edge research is looking into the development of tests for very early markers of cancer through blood tests (see Chapter 8). 1.1.2.  Making the Diagnosis of Cancer The workup for cancer typically begins when other more likely explanations have been ruled out. For example, the differential diagnosis of frequent headaches includes vision problems, allergies, and stress. More serious possibilities, such as a brain tumor or neurological problem, are less likely to be entertained at the outset because of their relative rarity. Because of this, a common theme among members of families with hereditary cancer syndromes is that signs of cancer were initially ignored or downplayed by their providers. The method by which the cancer will be identified depends on the tumor type (see Table 1.2). The presence of cancer may be suggested by physical exam, imaging studies, specialized blood TABLE 1.2.  How Cancer is Diagnosed •• ••

••

Lab tests •• Blood, urine, body fluid Imaging tests •• CT scan •• MRI •• Nuclear scan •• PET scan •• Ultrasound •• X-­rays Biopsy •• With a needle •• With endoscopy •• With surgery

Source: Adapted from National Cancer Institute, How Cancer Is Diagnosed.

4

Counseling About Cancer

TABLE 1.3.  Some Common Tumor Markers Used in Diagnosis and Assessment of cancer Tumor Marker

Type of Sample

CA 19-­9 CA-­125 Calcitonin CEA Chromogranin A Prostate-­specific antigen (PSA)

Blood Blood Blood Blood Blood Blood

Cancer Pancreatic, gallbladder, bile duct, and gastric cancers Ovarian cancers Medullary thyroid cancer Colorectal and other cancers Neuroendocrine tumor Prostate cancer

Source: Adapted from National Cancer Institute, Tumor Markers in Common Use.

tests (see Table  1.3 for some common tumor markers detected in blood), or invasive procedures. Except in rare cases, biopsy is required to make a definitive diagnosis. For example, the diagnosis of pancreatic cancer may start with a symptom of weight loss and subsequent imaging, but it is the biopsy and subsequent pathologic analysis that will confirm the diagnosis. Individuals will be referred to a medical oncologist either when the suspicion of cancer has been raised or following the initial diagnosis. As with most medical specialties, clinical oncology is divided into many subspecialties. Other members of the cancer care team include surgeons, radiologists, radiation oncologists, pathologists, and mental health professionals; the care of individuals with cancer requires a multidisciplinary team. Cancer can be a high-­burden disease on both patients and their families. Learning that one has cancer can engender feelings of shock, anger, intense sadness, and extreme anxiety. As patients enter cancer treatment, they may need to make major adjustments in their family responsibilities and workload. At many cancer centers, patients and their families have the opportunity to meet with a social worker or psychologist. Patient support groups may also be helpful.

1.1.3.  Cancer Terminology Hippocrates named the hard gray tumor tissue that extends into normal tissue “Carcinoma” for its crablike appearance. The Latin word for crab is cancer. The terminology used to describe specific tumors can be daunting and it may be helpful to consider how these names are derived. Tumor nomenclature provides information about where in the body and in what type of tissue and cell the cancer originated. Cancer is currently still classified by the type of tissue and the primary site it originates in. However, with the advent of genomic analysis of tumors, classification systems may rely more heavily on mutational signatures.

5

1. Cancer Diagnosis and Treatment

1.1.3.1.  Site of Origin The medical term for a tumor is a neoplasm, which literally means new growth. Neoplasms can develop in almost every tissue of the body. The name of a neoplasm will usually first indicate the site in the body where the tumor has originated. As examples, a hepatocellular carcinoma is a liver cancer, and a rhabdomyosarcoma is a tumor of the striated muscle. Cancers of unknown primary are tumors that are metastatic at diagnosis and have unidentifiable sites of origin. 1.1.3.2.  Tissue Type The rationale underlying the name and classification of tumors can be found in embryology (see Table 1.4). In the early embryo there are three layers of germ cells: the ectoderm, the mesoderm, and the endoderm. The type of tissue in which the neoplasm has occurred—­as well as its embryological origin—­ will typically be indicated within the name of the tumor. There are several major categories of cancers: carcinoma, sarcoma, hematologic malignancies, mixed types, neuroectodermal. ••

••

Carcinomas—­Carcinomas occur in the epithelial cells covering the surface of the body and lining the internal organs. Carcinomas account for about 80–90% of all cancers. Carcinomas are divided into two major types: adenocarcinomas and squamous cell carcinomas. Adenocarcinomas arise mostly in organs with glands and occur in mucus membranes, and squamous cell carcinomas arise from cells lining body cavities. The most common sites of carcinomas are in the skin, lungs, female breast, prostate, colon and rectum, cervix, and uterus. Sarcomas—­Sarcomas occur in tissues of mesodermal origin and are the rarest form of neoplasm. Sarcomas are solid tumors occurring in connective and supporting tissues, such as muscle, bone, or fat (see Table 1.5). Roughly, they can be classified into soft-­tissue

TABLE 1.4.  Derivation of Tissue Types Embryonic Tissue Ectoderm Endoderm Mesoderm

Tissue Some epithelial (skin, lining for most hollow organs), nerve tissue, salivary glands, and mucous glands Some epithelial, including the lining of the digestive tract (except at open ends) as well as the epithelial lining of hollow structures formed as outpockets in the digestive tract Endothelium, bone and cartilage, muscle, fat, blood and lymph vessels, blood cells, also epithelial lining of uterus (endometrium), vaginal epithelium, and mucosa of the bladder

Source: Adapted from SEER Training Modules.

6

Counseling About Cancer

TABLE 1.5.  Soft Tissue Sarcomas by Tissue Type Name of Sarcoma Angiosarcoma Desmoid tumor, also called deep fibromatosis Ewing family of tumors Fibrosarcoma Gastrointestinal stromal tumor (GIST) Kaposi sarcoma Leiomyosarcoma Liposarcoma Myxofibrosarcoma Malignant peripheral nerve sheath tumor (MPNST), also known as neurofibrosarcoma Rhabdomyosarcoma Synovial sarcoma Undifferentiated pleomorphic sarcoma (UPS), previously called malignant fibrous histiocytoma (MFH)

Related Normal Tissue Type Blood or lymph vessels Fibroblasts, which are the most common type of cells in connective tissue No obvious related normal tissue; may be a tumor of stem cells Fibroblasts, which are the most common type of cells in connective tissue Specialized neuromuscular cells of the digestive tract Blood vessels Smooth muscle Fat tissue Connective tissue Cells that wrap around nerve endings, similar to the way insulation wraps around a wire Skeletal muscle No obvious related normal tissue; may be a tumor of stem cells No obvious related normal tissue; may be a tumor of stem cells or a distant relative of rhabdomyosarcoma

Source: Cancer.net (ASCO) (2020).

••

••

••

tumors and bone tumors (chondrogenic and osteogenic). There are other rare categories of sarcomas as well. Leukemias, lymphomas, and myeloma—­Leukemia, lymphomas, and myeloma are cancers occurring in the lymph glands or bone marrow, which generates all of the cells of the circulatory system (see Figure 1.1 for an illustration of the complex blood cell lineage). Leukemias and lymphomas comprise about 10% of all cancers. Leukemias (which literally mean “white blood”) and lymphomas are sometimes referred to as liquid tumors in order to differentiate them from carcinomas, sarcomas, and melanomas, which are ­collectively termed solid tumors. Myeloma is a disorder of plasma cells that are a normal part of the immune system. Myeloproliferative neoplasms constitute a category of ­conditions that vary in severity (see Table 1.6). Mixed types—­The presence of more than one category of cancer can be reflected by the name such as carcinosarcoma. Neuroectodermal tumors—­As the name implies, neuroectodermal tumors arise from ectodermal cells in the central and peripheral nervous system. Examples include gliomas, neuroblastomas, and schwannomas.

7

1. Cancer Diagnosis and Treatment

Blood stem cell Myeloid stem cell

Lymphoid stem cell

Myeloblast

Lymphoblast

Granulocytes Eosinophil

Red blood cells

Neutrophil

Platelets

Basophil

B lymphocyte Natural T lymphocyte killer cell White blood cells

FIGURE 1.1.  Blood cell development. Source: Terese Winslow.

TABLE 1.6.  List of Some Myeloproliferative Neoplasms Disorder Polycythemia vera Essential thrombocythemia Primary myelofibrosis

Cells Affected Red blood cells mainly, white blood cells, platelets Platelets Red blood cells, white blood cells, platelets

1.1.3.3.  Cell Type The name of a tumor will often describe the type of cell that has transformed into a cancer cell. Solid tumors can arise from adenomatous cells that are glandular or ductal, or from squamous cells that are flat. Tumors containing cells with features of both glandular and squamous cells may be called adeno-­squamous carcinomas. Leukemias can arise from any of the various cells derived from myeloid or lymphoid lineages. Organs of the body are generally composed of more than one type of cell. Therefore, it is important to realize that more than one type of tumor can arise within the same organ. 1.1.3.4. Exceptions Not all tumors are classified by these cell and tissue types. For example, cancers that resemble embryonic tissue are called blastomas; examples include neuroblastomas and retinoblastomas. Another exception are teratomas, which arise in tissues derived from all three germ cell layers.

8

Counseling About Cancer

To further complicate matters, some tumors have been named after the physicians who first described them. These include Ewing sarcoma, Hodgkin lymphoma, Kaposi sarcoma, and Wilms tumor. 1.1.4.  Primary Cancer or Recurrence Your patient explains that her mother was successfully treated for osteosarcoma at age 9 and was well until age 53 when she was diagnosed and treated for invasive breast cancer. Two years later she was found to have brain cancer and died at 56. In deciphering a pattern of cancer in the family, it is important to determine whether a malignancy represents a primary cancer or a recurrence of the initial tumor. In this scenario, the mother’s primary cancer is osteosarcoma, her breast cancer is a second primary, and the brain cancer may represent metastatic breast cancer. 1.1.4.1.  Primary Cancer A newly arisen tumor from a specific organ is considered a primary tumor. Individuals can develop more than one primary cancer, although this is uncommon. These second (or third) primaries may occur as a consequence of treating the initial cancer. As an example of this, women with Hodgkin lymphoma (previously called Hodgkin disease) who are treated with radiation to the chest have higher rates of breast cancer. Multiple primary cancers are also more likely in those with hereditary cancer syndromes. 1.1.4.2. Recurrence A recurrence is the reappearance of cancer cells, either in the site of origin (local recurrence) or elsewhere in the body (systemic recurrence or distant metastasis). Recurrent cancer cells will demonstrate features that are consistent with the original tumor.

1.2.  Tumor Classification The tumor classification system helps dictate treatment regimens, predict prognosis, and provide a systematic approach that can be universally recognized and understood. Tumors are assessed for malignant properties or potential and, if malignant, are graded and staged. However, while benign tumors do not undergo the same classification process, properties of the tumor are still important. 1.2.1.  Benign Tumors The word “tumor” conjures up an image of cancer, yet not all tumors are cancerous. Thus, a lipoma (benign tumor of fat cells) may not be clinically significant, while a liposarcoma (malignant tumor of fat cells) represents a serious cancerous tumor. One of the initial steps in cancer

1. Cancer Diagnosis and Treatment

9

­ iagnosis is to send a tumor specimen to a pathologist, who will determine if the tumor has any d malignant properties. There are several differences between benign and malignant tumors. The most significant difference is that benign tumors do not spread to other sites of the body, whereas all malignant tumors have at least some metastatic potential. Benign tumors tend to be slow-growing. They are usually enclosed in a fibrous capsule and do not metastasize. Malignant tumors, in contrast, can proliferate rapidly and will, over time, spread to neighboring or distant tissues. Despite the name, “benign” tumors are not always innocuous and can in fact cause significant risks of morbidity and mortality due to the following factors presented in the succeeding sections. 1.2.1.1.  Location and Size As a benign tumor grows, it may press against the normal surrounding tissue. This compression of the normal cell parenchyma can cause the normal cells to atrophy due to insufficient blood supply. In some sites of the body, there is sufficient space to tolerate a benign tumor. One example is the female uterus, in which fibroid tumors can grow to be quite large. In other sites, notably the brain and spine, there is little room for expansion and even moderately sized tumors can cause significant morbidity and mortality. Another example of a slow-­growing tumor that can cause problems because of location is an abdominal desmoid tumor, which is a type of sarcoma. These types of tumors can lead to complications and even death due to sepsis, obstruction, ischemia, pulmonary embolism, and other factors. One part of diagnosis is determining the site of origin. 1.2.1.2.  Excretion of Hormones Benign tumors typically resemble their normal cell counterparts, which can be problematic if the cell type is hormone-­secreting. The benign tumor, not constrained by normal cell regulatory systems, may begin to produce additional amounts of hormones. Although benign tumors are generally less efficient at hormone production than normal cells, the sheer volume of tumor cells can result in massive—­and toxic—­levels of hormone being produced. For example, most pheochromocytomas are benign tumors of the adrenal gland that produce the hormone epinephrine, which triggers the “fight or flight” response. Excess levels of epinephrine caused by the pheochromocytoma can result in alarmingly high blood pressure and, if untreated, can increase the risk of stroke or myocardial infarction. In some cases, a benign tumor can be considered a precancerous tumor, that is, a tumor with malignant potential. Cells proceed through multiple steps before reaching a malignant state and some benign tumors may actually be malignant precursors. This has been shown to be the case for several types of cancer, such as certain pigmented moles (nevi) that can evolve into malignant melanoma, and adenomas of the colon, which can eventually transform into adenocarcinomas. Note that benign tumors typically end in the suffix -­oma, which means “a tumor of” without the preceding “carcin” or “sarc.” Examples are meningioma and glioma (two types of brain tumors). There are exceptions to this nomenclature, notably melanoma, which is a highly malignant skin cancer. In situ tumors are early-­stage malignant tumors. The following sections address the classification of malignant tumors.

10

Counseling About Cancer

1.2.2.  Tumor Grading Tumor grading involves analyzing the histological appearances and biological properties of the tumor in order to determine the extent to which the tumor resembles normal tissue. Histology is the study of the structure and composition of cells, tissues, and organs. A tumor that shows only subtle differences from normal tissue will be considered low grade (well-­differentiated), while a tumor that bears little or no resemblance to its normal counterpart is of high grade (poorly differentiated). (See Table 1.7.) Tumor grading is also based on the degree of cell differentiation that is present. Cell differentiation is the process by which newly formed (immature) cells evolve into different kinds of mature cells. Tumors are graded on whether their cells appear well differentiated, moderately differentiated, or poorly differentiated. (See example in Figure 1.2.)

TABLE 1.7.  Histological Grades of Tumors GX Grade cannot be assessed G1 Well differentiated (low grade) G2 Moderately differentiated (intermediate grade) G3 Poorly differentiated (high grade) G4 Undifferentiated (high grade) Source: National Cancer Institute, FactSheet: Tumor Grade. Public domain.

Well Differentiated

Moderately Differentiated

Poorly Differentiated

FIGURE  1.2.  Cellular differentiation. The differences between a well-­differentiated tumor cell (left), a moderately differentiated cell (middle), and a poorly differentiated cell (right) are shown. Adapted from Pfeifer and Wick (1991), John Wiley & Sons.

1. Cancer Diagnosis and Treatment

11

Tumors containing a few atypical cells are considered to be dysplastic, which is a premalignant state. Low-­grade (well-­differentiated) tumors tend to be slow-­growing and less aggressive, while higher-­grade (moderately or poorly differentiated) tumors tend to be fast-­growing and more aggressive with a greater potential to metastasize. Tumors with a complete loss of normal differentiation are described as being anaplastic. It is important to realize that the specific criteria used to grade a tumor are far from exact. Accurately grading a tumor depends on the pathologist’s skills and expertise. In cases of rare and/or unusual tumors, it may be useful to have the tumor slides reviewed by a second pathologist.

1.2.3. Staging The natural course of a malignancy is to grow and spread to other organs of the body. The purpose of staging is to determine the extent of disease progression in a specific patient, to estimate prognosis, and help determine the best treatment plan. Staging also provides a common set of criteria for oncologists and other medical specialists and provides a system for grouping patients in research treatment trials. Staging includes pathology examination of the tissue, biopsy of the lymph nodes, tumor markers, and imaging of surrounding areas for sites of ­possible metastases. Staging can occur at different time points during the course of diagnosis and treatment. Initial staging, also called clinical staging, occurs on the basis of the workup of the cancer, prior to any definitive treatment. Pathological staging occurs after surgical resection and analysis of the tumor and regional lymph nodes. Post-­therapy or post-­neoadjuvant therapy staging occurs after the cancer has been treated (radiation, chemotherapy, or hormone therapy). Restaging occurs if there is recurrence of the cancer. The clinical staging system most commonly used worldwide is the TNM system. The TNM system was developed by the American Joint Committee on Cancer Staging (AJCCS) and the International Union Against Cancer (IUAC) in an effort to standardize the staging criterion. The premise of staging is that cancers of the same site and histology will follow similar patterns of disease progression and will respond similarly to the same treatment regimens. Staging occurs after the initial assessment of the tumor and serves as a snapshot of the tumor prior to treatment. As treatment progresses, the tumor may be restaged as necessary. The current form of the IUAC is the Union for International Cancer Control (UICC). The TNM system classifies cancer into Stages 0–IV, with Stage IV disease being the most advanced. Staging is made by assessing the size of the primary lesion, degree of invasion, and presence or absence of lymph node involvement or distant metastases. The more advanced the cancer, the higher each variable is graded. The three variables are specifically defined as: ••

T—­The extent of the primary tumor. This category considers the overall size and appearance of the tumor. Tumors are classified as being Tis (in situ), T1, T2, T3, or T4. In situ tumors are those that are confined to the cells lining the organ. Carcinomas and melanomas are the only cancers with an in situ stage. T4 tumors have invaded into tissues around the organ of origin.

12

Counseling About Cancer

••

••

••

N—­The extent of lymph node involvement. This is a strong predictor of systemic involvement. The lymph nodes are the gateway to the lymphatic or circulatory systems. Nodes can be classified as N0, N1, N2, or N3. M—­The extent of distant metastases. Distant metastases are either absent (M0) or p ­ resent (M1). The presence of distant metastases indicates an advanced stage of cancer. The specific criteria used to define each variable in the TNM system depend upon the organ involved. Table 1.8 describes the TNM system for medullary thyroid carcinoma. Note that a particular stage of cancer can be composed of different TNM combinations.

Staging is an integral part of diagnosis and is performed for every tumor type. Because malignancies vary greatly across different organs and tissues, not all cancers are staged using the TNM system alone (https://training.seer.cancer.gov/staging/systems/schemes/). In these cases, other classification systems have been developed. Examples include: •• •• ••

FIGO staging of gynecological tumors Gleason scores for prostate cancers Ann Arbor classification of lymphoma

1.2.4.  Genetic Analysis of the Tumor Cancer is a disease of uncontrolled cell growth caused by genetic changes. Tumor histology is sometimes supplemented with different types of genetic analysis to further characterize the tumor and perhaps suggest additional therapies. These have become increasingly sophisticated over time.

TABLE 1.8.  TNM Cancer Staging of Medullary Thyroid Carcinoma Stage I Stage II Stage III Stage IVA Stage IVB Stage IVC

T1 N0 M0 T2 N0 M0 or T3 N0 M0 T1 N1a M0 or T2 N1a M0 or T3 N1a M0 T4a N0 M0 or T4a N1a M0 or T1 N1b M0 or T2 N1b M0 or T3 N1b M0 or T4a N1b M0 T4b Any N M0 Any T Any N M1

T (Primary tumor): T1 = Tumor ≤2 cm; T2 = Tumor >1 cm but not >2 cm; T3 = Tumor >4 cm limited to thyroid or any tumor with minimal extrathyroid extension; T4a = tumor of any size extending beyond thyroid capsule to invade subcutaneous soft tissues, larynx, trachea, esophagus, or recurrent laryngeal nerve; T4b = tumor invades prevertebral fascia or encases carotid artery or mediastinal vessels. N (Regional lymph nodes): N0 = no regional lymph node metastasis; N1 = Regional lymph node metastasis; N1a = Metastasis to Level VI (pretracheal, paratracheal, and prelaryngeal/Delphian lymph nodes); N1b = Metastasis to unilateral, bilateral, or contralateral cervical (Levels I, II, III, IV, or V) or retropharyngeal or superior mediastinal lymph nodes (Level VII). M (Distant metastases): M0 = No distant metastases; M1 = Distant metastases. Source: American Joint Committee on Cancer (2010), pp. 114–115. Springer Nature.

13

1. Cancer Diagnosis and Treatment

1.2.4.1.  Molecular Studies Molecular studies provide a closer analysis of tumor cells that further classify these cells into molecular subtypes. This allows more individualized treatment options and better prognostic predictions. (See Figure 1.3.) Here are examples of molecular studies that are important in this process: •• •• •• •• •• •• ••

Whole-­exome or whole-­genome DNA sequencing Microsatellite instability DNA copy number variation DNA methylation Genome wide mRNA levels MicroRNA levels Protein levels CRC patients

Molecular subtyping

Subtype 1

Subtype 2

Subtype 3

Subtype-specific biomarkers

Good

Poor

Good

Poor

Good

Poor

FIGURE 1.3.  Molecular subtypes of colorectal cancer: Improved prognostication of CRC by molecular-­ subtype-­specific biomarkers. Schematic illustration of the principle of CRC patient prognostication by combining molecular subtyping with subtype-­specific prognostic biomarkers. Molecular subtyping is employed to reduce the major inter-­tumor molecular diversity of CRC and allows patient prognosis to be more accurately predicted within each subtype by application of subtype-­specific prognostic biomarker panels. Patients with good or poor prognosis are indicated. Source: Bramsen et al. (2017). With permission of Elsevier.

14

Counseling About Cancer

Genomic analysis has yielded a tremendous amount of information about shared genetic variation in cancer cells. Testing of tumors (somatic analysis) yields the sum of mutations from the fertilized egg to the time of tumor development. The result has been the classification of cancers through somatic “mutational signatures” (common within and among different cancer types). There are currently 30  mutational signatures that have been characterized (https:// cancer.sanger.ac.uk/signatures/signatures_v2/). Prior to genomic analysis, one of the clearest examples of a somatic signature was in DNA mismatch repair. Microsatellite instability, a marker for defective DNA mismatch repair, had been used to screen patients who may have Lynch syndrome. Currently, mutational signatures are helpful in determining likelihood of response to specific treatments. One example of this is with BRCA1 and BRCA2. Tumors with homologous recombination deficiency (HRD), typical of BRCA-­mutated tumors, identified by common mutational signatures are more likely to respond to a specific type of treatment, PARP inhibitors, than those with low HRD scores. 1.2.4.2.  Malignant Cells Play Tricks There are special properties of malignant cells that differentiate them from normal cells. Knowledge of how cancer cells differ from normal cells can be helpful for diagnosis, staging, and treatment. On a cellular level, malignant cells share specific common abilities. They can: ••

•• ••

••

•• ••

Initiate signal transduction pathways leading to mitosis (giving cells the ability to grow and divide outside of the normal signaling pathways). Resist normal signals that inhibit growth or cause programmed cell death (apoptosis). Acquire genetic instability, which can be divided into two major types: 1. Chromosomal level (e.g., gains, losses, translocations, duplications, deletions, etc.) 2. Nucleotide level (e.g., mutations in DNA repair genes) Induce angiogenesis (the growth and proliferation of blood vessels towards them). This allows them to obtain nutrients and energy and shed waste. Invade nearby normal tissue and spread to other areas through the circulatory system. Hide from the immune system (adaptive immune resistance) by: •• Presenting antigens (substances on the outside of a cell that can elicit an immune response) that make them look more like normal cells •• Removing or reducing antigens that would identify them as abnormal •• Producing substances that suppress the body’s immune response •• Producing an environment of chronic inflammation (which promotes tumor growth) rather than acute inflammation (which suppresses tumor growth)

1.3.  Cancer Treatment With a diagnosis of cancer, patients and their families are thrust into a world with its own vocabulary and complicated treatment decisions. There are two overall aims of cancer treatment: to prolong life with curative intent and to relieve suffering with palliative care.

1. Cancer Diagnosis and Treatment

15

A tumor is composed of a patchwork of cell populations. It is important to recognize that clinical cure from cancer is defined as the absence of any detectable evidence of disease rather than the elimination of every single cancer cell. Oncologists hope to reduce the number of cancer cells to a negligible amount that will not cause any significant symptoms or problems over the person’s remaining life span. The treatment of cancer is a delicate balancing act to eradicate the tumor while limiting the amount of harm to the patient. The treatment of cancer is divided into local therapies and systemic therapies. Local therapies include surgery, radiation, cryotherapy, and laser therapy. Systemic therapies include chemotherapy, hormonal therapy, and biologic agents. The succeeding sections present ­ information on the major types of cancer treatments.

1.3.1. Surgery Surgical resection (removal) is the most effective strategy for treating localized disease and is the preferred strategy for eradicating solid tumors. The aim of surgery is to remove the entire tumor, which generally also requires removing a margin of surrounding healthy tissue. Surgical resection is most successful if the tumor is slow-growing, confined to a single organ, and can be removed without compromising any vital organs. Surgical risks include the small possibility of death related to the procedure or anesthesia, infection, short-­or long-­term disabilities, and ­disfigurement. The possible adverse effects of surgery are influenced by many factors, including the location of the tumor, extent of the surgery, and general health and age of the patient. Patients may be given radiation treatments and/or chemotherapy either prior to surgery (neoadjuvant therapy) or following surgery (adjuvant therapy). There are seven major types of surgery used in oncology, presented in the succeeding ­sections (adapted from ASCO cancer.net and American Cancer Society). 1.3.1.1. Diagnostic The main purpose of the surgical procedure is to confirm the diagnosis of cancer. This is t­ ypically done through a biopsy or aspiration of the cells. The type of procedure may depend on the organ and the accessibility of the area of concern. 1.3.1.2. Staging Staging surgery involves assessing the extent of the tumor and may involve removing all or part of the tumor, removing lymph nodes around the tumor, and examining the area for spread of the cancer. 1.3.1.3.  Curative/Tumor Removal Curative surgery may be done when the tumor is localized to one organ and has not spread. This involves trying to remove the tumor completely. Chemotherapy and radiation may be given before or after surgery if needed.

16

Counseling About Cancer

1.3.1.4. Debulking Debulking involves removing as much of the tumor as is possible without causing harm. If a tumor is large or has spread locally, it may not be possible to remove all of the tumor without causing damage to surrounding tissue. Because the tumor cannot be removed completely, additional treatment is often required before or after surgery. 1.3.1.5. Palliative The purpose of palliative surgery is to reduce pain or symptoms caused by advanced disease rather than trying to eradicate the cancer. For example, a spinal cord tumor can cause difficulty walking and severe pain; surgery may alleviate symptoms. In most cases, the relief of pain or other symptoms from palliative surgery is only temporary. 1.3.1.6.  Risk-­reducing Risk-­reducing surgeries are often done in the high-­risk setting to reduce or eliminate the risk for certain cancers. For instance, women who have a BRCA1 pathogenic variant may elect to have bilateral salpingo-­oophorectomies to reduce the risk for ovarian cancer. 1.3.1.7. Reconstructive Reconstructive surgery can be done to help restore the appearance or function of an organ after therapy. Women having a mastectomy for breast cancer may choose to have reconstructive surgery at the same time as or after surgery for treatment. Additional surgical procedures include the placement of a port catheter or pump to administer chemotherapy more easily. 1.3.2.  Radiation Therapy The aim of radiation therapy is to destroy tumor cells within the field being radiated. Radiation therapy can be used prior to or instead of surgery to shrink tumors or after surgery to destroy remaining local cancer cells. Radiation can also be used to shrink inoperable tumors or for palliative care to relieve symptoms. Radiation therapy involves targeting selected doses of ionizing radiation to the tumor site. The field of radiation can be compared to the beam of a flashlight. The radiation beam will be strongest at the center of the targeted site, but the “scatter“ beam can also inflict damage to cells. This may be a benefit of radiation therapy because it can destroy cancer cells that have begun to spread locally but can also lead to side effects. Tumor cells outside the field of radiation will not be affected, so radiation therapy is not an effective strategy for cancers that have metastasized. How does radiation therapy work? The ionizing radiation deposits packets of energy into the cell, which (1) directly damages DNA and (2) generates reactive oxygen species that also damage DNA and results in programmed cell death (apoptosis) and/or blocked proliferation. Cells will either die immediately upon exposure or when they later attempt to undergo mitosis.

1. Cancer Diagnosis and Treatment

17

Cancer cells that are actively dividing at the time of the radiation exposure are most vulnerable to radiation; higher doses of radiation are needed to destroy quiescent cells (ones that are not actively dividing) and slow-­growing tumors with infrequent cell divisions. In addition, radiation kills cells by generating reactive oxygen species. Thus, oxygen-­poor tumors have some ­protection against radiation and require higher doses of radiation. Radiation doses used to be measured in rads but are currently measured in units of Gray (Gy); a centiGray (cGy) is equivalent to a rad. Radiation therapy varies based on intent and cancer type. The dosages and total radiation exposure will differ depending on the tumor’s location and size and the patient’s tolerance of the treatments. The effectiveness of radiation therapy depends largely on the tumor type and the sensitivity to radiation. One large dose of radiation may be more effective than multiple small doses, which give cancer cells a chance to regrow, but it is also more toxic to normal tissue. Typically, only a proportion of cancer cells are destroyed by a single dose of radiation. Unfortunately, a proportion of normal cells within the field of radiation are also destroyed by the exposure to radiation. This is the major downside of radiation therapy, and the toxicity must be monitored throughout the course of treatment. To determine the optimal radiation dose, radiation oncologists will consider the radiation sensitivity of the tumor, the bulk of disease, and the maximum amount of radiation that will be tolerated by the normal tissue. Normal cells generally recover faster than their malignant counterparts. Since normal stem cells infrequently divide, they are generally less vulnerable to radiation damage. 1.3.2.1.  Types of Radiation Therapy There are two main types of radiation therapy: external beam radiation therapy and internal radiation therapy. Most types of therapy involve external therapy where a patient is in a machine that directs radiation towards the tumor. By contrast, internal therapy involves putting a source of radiation directly inside the body. External beam therapy involves the use of three different particles: photons, protons, and electrons. Photon particles are used commonly for most standard radiation treatments. This type of therapy can damage normal tissue adjacent to the tumor because photons scatter radiation as they are traveling through the body. Proton beam therapy (using high-­energy positively charged protons) does not scatter in the same manner and will stop within the tumor, so this type of therapy is typically used when tumors are close to very important areas of the body, such as the brain. Because of the precise targeting of the tumor, there may be fewer side effects with this type of radiation. However, it requires the use of very expensive large machinery and special expertise of the operator. Electron therapy uses negatively charged electrons that are limited in the area that they can reach, so the use of this therapy is limited to skin or tumors under the ­surface of the skin. Types of external beam radiation therapy (EBRT) include 3-­ D conformal, intensity-­ modulated, image-­guided, tomotherapy, stereotactic radiosurgery, or stereotactic body. All of these use imaging to try to map the precise location of the tumor, either prior to administration and/or during the course of treatment. For most forms of EBRT, patients undergo treatment once a day, 5  days a week, for 3–9  weeks. People who undergo external beam radiation are ­generally not “radioactive” after treatment.

18

Counseling About Cancer

Internal radiation therapy can be divided up into two types: solid source (brachytherapy) and liquid source (systemic therapy). Brachytherapy can be given through three different methods which include interstitial (placed directly within the tumor itself), intracavity (placed within a body cavity), and episcleral (used specifically for certain tumors of the eye). Radiation can also be given systemically through intravenous or oral administration, although this is less common. Brachytherapy is typically given as low-­dose or high-­dose. The most common example of brachytherapy is the use of radiation seeds for early-­stage prostate cancer. This involves implanting dozens of seeds directly into the prostate. Radiation is given off at a low dose, and the seeds may be removed after 1–7  days or may remain implanted for life. High-­dose implants can provide a greater level of control of the dose but requires multiple treatments and, therefore, hospitalizations over time. The time for high-­dose implants is usually 10–20  minutes per treatment for 2–5 days or once a week for 2–5 weeks. Another example of brachytherapy is called selective internal radiation therapy (SIRT) or radioembolization, where tiny beads of radioactive material are put into a blood vessel that feeds the liver. These beads are trapped in the smaller blood vessels that surround the tumor and will hopefully destroy the cancer cells. The procedure requires careful mapping of the arteries around the liver, with a planning angiogram done 1 to 2 weeks prior. While the procedure itself only takes about an hour, patients may have to lay flat for a number of hours to ensure that any bleeding has stopped, since a catheter is inserted into an artery in the groin for delivery of the beads. An example of oral systemic therapy is I-­131 radioiodine therapy used for the most common types of thyroid cancers (papillary and follicular), which is typically given by mouth through a capsule. In order to ensure that the radioactive iodine is most effective, patients must have high levels of thyroid-­stimulating hormone (TSH), which helps direct the iodine to the thyroid gland. The treatment is given through iodine because its only use for our bodies is to make thyroid hormones. A patient swallows the dose of radioactive iodine, which is absorbed quickly and helps kill tumor cells safely and effectively. For this internal therapy, patients may be asked to avoid contact with other people for a short period of time, since they can excrete or give off radiation. The side effects of radiation depend on the anatomic site being radiated. These side effects include hair loss if the radiation is to the head, or diarrhea and cystitis if it is to the pelvic area. Radiation may also cause fatigue, redness of the skin, or scarring of the tissues. Long-­term effects can include cataracts (irradiated eyes) and sterility (irradiated sex glands). The lungs, liver, kidneys, and heart are also sensitive to radiation damage. These late responses can manifest months or years after the conclusion of treatment. Radiation therapy in children can cause damage to bone and soft tissues, leading to reduced growth or deformity. Radiation therapy can also cause a second cancer, most commonly leukemia, or lymphoma, or, if in the field of radiation, breast cancer, thyroid cancer, or sarcomas. 1.3.3. Chemotherapy The first clinical use of chemotherapy was in 1942, when highly toxic nitrogen mustard was used to treat lymphoma. Chemotherapy is systemic therapy that has the capability of destroying cancer cells throughout the body. Most drugs are given intravenously, but some are administered orally, even in pill form. The aims of chemotherapy are to further increase the chance that the

1. Cancer Diagnosis and Treatment

19

tumor is eradicated, to prevent or delay metastases, or to palliate symptoms. Current chemotherapy is mainly conducted in an outpatient setting. Chemotherapy can effectively destroy actively dividing cells but is much less effective against quiescent (nondividing) cells. A course of chemotherapy can consist of a single drug, but often involves a combination of drugs with different mechanisms of action. The efficacy of a particular drug depends on the inherent tumor sensitivity and its absorption, metabolism, distribution through the tumor, and excretion out of the body. If chemotherapy is being given for advanced stage cancer, then the regimen of drugs may need to be altered during the course of treatment, because the remaining tumor cells may have become resistant to the agents that have previously been used. The properties of the tumor will determine the chemotherapeutic regimen. Chemotherapy can also be given for pain relief or to stabilize bodily functions. The total number of chemotherapy courses administered will depend on the goal of therapy as well as the drug’s effectiveness and toxicity. Typically, each course is spaced out in 1-­to 3-­week intervals in order to give the normal cell population a chance to recover. Common side effects of chemotherapy include the loss of all body hair and the erosion of the mucosa of the gastrointestinal tract, leading to mouth sores, ulcers, and other digestive problems. Most types of chemotherapy cause bone marrow toxicity, leading to a decrease in white cells, platelets, or red cells. A drop in white blood cells temporarily increases the risk of infection. Chemotherapy drugs can also cause permanent damage to nonrenewing tissues, including the heart and nervous system, and can cause sterility and, in women, temporary or permanent ­premature menopause. Classes of chemotherapy drugs include alkylating agents, antimetabolites, plant alkaloids, topoisomerase inhibitors, antitumor antibiotics, mitotic inhibitors, and others. Chemotherapy is still an integral part of current cancer therapies for many tumor types. However, much of the focus in drug development is on more targeted therapies based on the molecular characteristics of cancer. Examples of combination chemotherapy drugs for common cancers Breast cancer AC (doxorubicin, cyclosphosphamide) Colon cancer FOLFOX (5-­fluorouracil, leucovorin, oxaliplatin) Pancreatic cancer Gem/Abraxane (Gemcitabine/albumin-­bound paclitaxel) 1.3.4.  Targeted Therapy Targeted therapies are treatments that target specific molecules or pathways to block the growth, progression, and spread of cancers (National Cancer Institute, Targeted therapies). Targeted therapies differ from traditional chemotherapies in that they are chosen based on the properties of the cancer cells themselves rather than killing all rapidly dividing cells. Some of these types of therapies are cytostatic (inhibiting cell growth and division) rather than cytotoxic. Targeted therapies include: ••

Hormonal agents

••

Signal transduction inhibitors (including PARP inhibitors)

20

Counseling About Cancer

•• •• ••

Immunotherapy Angiogenesis inhibitors Antibody drug conjugates

1.3.4.1.  Hormonal Agents Hormonal agents have been used for many years to treat or prevent recurrence of cancers. Steroid and nonsteroid hormones are actively involved in cellular proliferation and differentiation. Many tumors are hormone-­driven, including cancers of the prostate and breast. These types of tumors have hormone receptors that can be targeted by hormonal therapy. Hormone (or trophic) therapy aims to shrink tumors by reducing the amount of available hormone and/or by inhibiting the binding of the hormone to the receptor. These agents can be used to treat advanced cancer or can increase the likelihood of cure if given after surgery or other treatment. Tamoxifen is an example of an antihormonal agent that successfully reduces breast cancer recurrence by ­targeting estrogen receptors. One advantage to hormonal agents is that they are generally less toxic than conventional chemotherapy. 1.3.4.2.  Signal Transduction Inhibitors (including PARP inhibitors) There are many different examples of signal transduction inhibitors in clinical use, including EGFR-­related tyrosine kinase inhibitors, such as erlotinib for the treatment of lung cancer. Genetic counselors will most often see the use of PARP (poly ADP-­ribose polymerase or PARPi) inhibitors for treatment of BRCA-­related breast or ovarian cancer. PARP inhibitors block single-­ strand DNA damage repair in cells with non-­functioning BRCA1 or BRCA2 (and possibly other DNA damage repair genes) harboring homologous repair deficiency (HRD). Tumor cells require this repair system in order to avoid programmed cell death (apoptosis) as illustrated in Figure 1.4. Tumor cells can regain DNA repair deficiency through reversion mutation that restores the tumor cells’ ability to undergo homologous repair (HR) and upregulating other DNA repair pathways. Resistance to PARP inhibitors can also occur with mutations in the PARP gene itself that prevent interaction with the inhibitor. The use of combination therapies (PARPi plus immunotherapy) may be more effective in treating cancers by targeting more than one pathway. Side effects of PARPis can include an increased risk for infection, bleeding, fatigue, shortness of breath, diarrhea, changes in digestion and taste, headache, and others. 1.3.4.3. Immunotherapy The immune system may not always recognize a tumor as a threat because its cells are native to the body rather than seen as a foreign substance. Immunotherapy seeks to re-­engage the body’s immune system to recognize and fight tumors. It has become a major focus of experimental treatments because of its possible use in many different types of cancers. Types of cancer immunotherapy include: ••

Immune checkpoint blockade therapy

••

Adoptive cell transfer (in particular, CAR-­T)

21

1. Cancer Diagnosis and Treatment

PARP PARP

PARP inhibitors

SSB

SSB

repaired by BER

SSB repaired

Survival

SSB converted to DSB

BER

HR proficient (DSB repaired)

Survival

DSB HR deficient (DSB not repaired)

Apoptosis

FIGURE 1.4.  There are several mechanisms by which the tumor cells can reverse their “BRCA-­ness,” one of which is through reversion mutation that restores the tumor cells’ ability to undergo homologous repair (HR). Source: Zheng et al. (2020). With permission by Elsevier. Licensed under CC BY 4.0.

•• •• ••

••

Bispecific antibody T-cell engagers Oncolytic virus therapy Vaccines •• Therapeutic •• Cancer preventive—­Lynch syndrome Gene therapy

1.3.4.3.1.  Immune Checkpoint Blockade Immune checkpoint blockade (ICB) therapy is a therapeutic approach to release the brakes on the immune system and promote anti-­tumor immunity. Tumor cells often express inhibitory receptors that block binding by other molecules that would otherwise escalate the immune response by stimulating the growth of T-­cells and increasing the production of cytokines and other factors.

22

Counseling About Cancer

Cytotoxic T-­Lymphocyte Associated Protein 4 (CTLA-­4/CTLA4) CTLA-­4 was the first target of immune checkpoint blockade therapy successfully developed as a treatment for cancer patients. It is an inhibitory receptor that downregulates the initial T-­cell activation response by competing with CD28 for B7  ligands. It also inhibits proliferation of T-­cells and decreases IL-­2 secretion. It is currently used clinically in melanoma and in combination therapy for other solid tumors. Programmed Death 1 (PD-­1/PD1 or PD-L1/PDL1) PD-­1 has a similar inhibitory effect on the immune response by binding PD-­L1 (ligand to this receptor). PD-­1/PD-­L1 antibodies have shown broad clinical benefit across solid tumors and are currently used for treating multiple cancers, including any tumor with microsatellite instability. Limitations of ICBs include that they can cause severe immune-­related adverse events, responses can take months to develop, and they may only be effective in a small percentage of tumors with specific characteristics. Current examples of ICB therapies include: •• ••

••

CTLA-­4: ipilimumab (advanced melanoma) PD-­1: nivolumab (multiple cancers); pembrolizumab (multiple cancers), cemiplimab (advanced squamous cell, basal cell, non-­small-­cell lung cancers) PD-­L1: atezolizumab (advanced lung and urothelial cancers); durvalumab (advanced urothelial cancer); avelumab (advanced urothelial, Merkell cell, renal cell carcinoma)

(See Figure 1.5). 1.3.4.3.2.  Adoptive Cell Transfer (ACT) Therapy Adoptive cell transfer exploits the antitumor properties of lymphocytes directly. This therapy involves isolating lymphocytes from peripheral blood, lymph nodes, or tumor tissue, growing these in culture, and reinfusing them back to the patient. The principle behind the process is to break the tolerance to tumor antigens and produce high avidity effector T-cells to fight the tumor. There are three types of ACT therapy that are under study: 1. ACT with tumor-­infiltrating lymphocytes (TIL) 2. ACT with T-­cell receptor antigens (TCR) 3. ACT with chimeric antigen receptors T-­cell (CAR-­T) Of these, CAR-­T is probably the most widely studied and used clinically (see Figure 1.6). ACT with CAR-­T uses T-­cells that have been genetically modified to directly recognize a specific tumor antigen. Here, a sequence for a particular antibody that targets a specific tumor antigen is added to a viral vector, along with the sequence for other necessary elements for T-­cell activation. These are called chimeric antigen receptors and consist of a variable Ig domain (designed to ­recognize the tumor antigen of interest) fused to a constant T-­cell receptor (TCR) domain.

23

1. Cancer Diagnosis and Treatment

PD-L1 binds to PD-1 and inhibits T cell killing of tumor cell

Blocking PD-L1 or PD-1 allows T cell killing of tumor cell

Tumor cell death

Tumor cell

PD-L1

PD-L1 Antigen Anti-PD-L1 T cell receptor

PD-1

AntiPD-1 PD-1

T cell

T cell

FIGURE 1.5.  Mechanism of anti-­PD-­L1/PD-­1 therapy. Source: Terese Winslow; National Cancer Institute.

The expression of this tumor antigen on the tumor cell itself is what drives the immune response in this situation. ACT with CAR-­T has limitations due to a lack of highly specific target antigens, lack of durable responses, and the possibility of serious adverse side effects, including cytokine release syndrome. Cytokine release syndrome or cytokine storm is a severe reaction to CAR-­T cell therapy that includes high fever, extreme fatigue, difficulty breathing, and a sharp drop in blood pressure. Secondary effects can involve the nervous system. Most often these will subside in patients but treatment with steroids is sometimes needed. Another limitation of CAR-­T therapy is that the process of obtaining and manipulating these T-­cells is technically challenging and labor-­intensive, thus requiring a highly skilled team. This can make it difficult for eligible patients to access this type of treatment. At present, there are six FDA-­approved drugs for CAR-­T therapy (https://hillman.upmc. com/mario-­lemieux-­center/treatment/car-­t-­cell-­therapy/fda-­approved-­therapies).

24

Counseling About Cancer

Host condition chemotherapy

CAR Tumor binding domain

Harvest PBMCs by apheresis

T cell activation

CAR T cells

Signaling domains ζ

Transduction

TCR α β CDC3

TCR T cells

γε ε δ

Excise tumor mass

ζζ

Cancer patient Infusion TIL cell isolation

TIL cell expansion

Lymphodepleted cancer patient

FIGURE 1.6.  ACT therapy. Adoptive cell therapy is currently represented by three general approaches. TILs are produced after surgical excision of tumor and enrichment and expansion of TILs from a disaggregated tumor biopsy sample. TCR-­and CAR-­modified T-cells are produced from peripheral blood ­lymphocytes in a manufacturing step that includes introduction of the desired receptor through viral or nonviral methods in order to engineer cells. Patients often receive a lymphodepleting chemotherapy ­regimen before infusion. PBMCs are peripheral blood mononuclear cells. Source: June et al. (2015). With permission of the American Association for the Advancement of Science.

1.3.4.3.3.  Bispecific Antibody T-­Cell Engagers Bispecific antibody T-­cell engagers usually target CD3 on a T-­cell and a tumor antigen together. Since CD3 helps mediate T-­cell activation, this type of treatment helps recruit and promote T-­cell response to tumors. One example of this type of therapy is blinatumomab in the treatment of B-­ALL. 1.3.4.3.4.  Oncolytic Virus Therapy Oncolytic virus (OV) therapy involves the use of native or engineered viruses that selectively replicate in and destroy cancer cells. One of the major difficulties of OV therapy is the ability to deliver enough virus effectively into tumor cells, especially for metastatic disease. Consequently, these are not widely used clinically. 1.3.4.3.5.  Cancer Vaccines Cancer cells create an environment that suppresses the immune response. The effectiveness of a therapeutic vaccine depends on breaking the “immune tolerance” to tumor. Challenges to this

1. Cancer Diagnosis and Treatment

25

include antigen selection and eliciting a robust anti-­tumor immune response. Cancer vaccines are considered experimental at this time. In principle, cancer vaccines might also be able to prevent cancer in high-­risk individuals. One area that has quietly been gaining steam is that of a cancer-­preventive vaccine for Lynch syndrome. Groups in Europe have been studying neoantigen peptide vaccines for a number of years, and the first clinical trials for a preventive vaccine are planned in the United States in 2022 (https://prevention.cancer.gov/news-­and-­events/blog/vaccine-­prevent-­ hereditary). Examples of more traditionally based cancer preventive vaccines include HPV and Hepatitis B vaccines, which indirectly help prevent cervical and liver cancer respectively. 1.3.4.3.6.  Gene Therapy Gene therapy for cancer involves introducing genes back into the tumor cells through a viral vector to help regain control of growth regulation. Examples of this would be to introduce a functioning TP53 back into tumor cells to reproduce p53’s tumor suppressor effect. Other types of gene therapy reintroduce wild-­type oncogenes or genes that make the tumor cells more susceptible to the immune response or to chemotherapy/radiation. Another method involves the introduction of a “suicide gene” into the cancer to destroy these cells. Side effects of gene therapy can include severe immune responses and liver toxicities, and other consequences have also been reported. Therapeutic applications of this are experimental. 1.3.4.4.  Angiogenesis Inhibitors Angiogenesis inhibitors (AGIs) are drugs that target blood vessel formation to tumor cells. Tumor cells generally cannot grow without a nutrient supply and send out signals that stimulate blood vessel growth. One of the best examples of an AGI is a monoclonal antibody that targets vascular endothelial growth factor (VEGF), bevacizumab, which was first approved in 2004. 1.3.4.5.  Antibody Drug Conjugates The premise of antibody drug conjugates (ADCs) is that tumor cells express specific antigens that can be targeted by an antibody coupled with a cytotoxic payload. Examples of ADCs in cancer treatment include: trastuzumab emtansine for Her2 positive breast cancers with an antibody that targets Her2 attached to a microtubule disrupting agent and gemtuzumab ozogamicin for AML with an antibody that targets CD33 attached to a DNA-­damaging agent.

1.3.5.  Stem Cell Transplantation Hematologic stem cells have the ability to differentiate into all the different types of mature cells in the circulatory and lymphatic systems. Since the major dose-­limiting toxicity of chemotherapy is bone marrow suppression, obtaining stem cells prior to chemotherapy can permit the

26

Counseling About Cancer

administration of higher doses of chemotherapy than would otherwise be possible. Stem cells can then be given back to regenerate the bone marrow and potentially rejuvenate a compromised immune system. Bone marrow transplantation can be performed for curative or palliative purposes. There are many potential complications of transplantation, including infection, bleeding, mouth sores, hair loss, and, rarely, a complete rejection of the transplanted cells (graft rejection). In allogeneic transplants, there is also the risk of an exuberant immune response mounted against the ­person’s own body cells by the foreign donor stem cells, which is termed “graft versus host disease.” The three main sources of stem cells are the bone marrow, peripheral blood, and the umbilical cord. Most transplants performed today use peripheral blood because the cells are easier to obtain, and the immune system recovers faster than with the more conventional bone marrow transplant. Stem cells are obtained from peripheral blood by artificially stimulating stem cell growth in the bone marrow by the use of growth factors. This causes the crowded bone marrow to release some of the stem cells into the bloodstream. These cells are then removed from the bloodstream through a process called apheresis. The stem cells are  then returned to the patient following high-­ dose chemotherapy and/or radiation treatments. The umbilical cord is rich with stem cells and may be used for transplant. A family at high risk for childhood cancers may want to store or use their unaffected newborn’s cord blood in case a sibling develops cancer. The two major types of bone marrow transplants are described as follows. ••

••

Allogeneic transplant—­In an allogeneic transplant, the transplanted stem cells are from a donor who shares similar human leukocyte antigens (HLAs). The HLA-­matched donor is typically a sibling or parent. If there are no matches among family members, donor registries can be searched. Such registries have increased the number of potential matched donors, although minority ethnic groups remain underrepresented. Cancer patients who undergo allogeneic transplants face problems with rejection of the stem cells and either acute or chronic graft-­versus-­host disease. Allogeneic transplants have been successfully used to treat leukemias and lymphomas. As an aside, allogeneic transplants are also used to treat other genetic conditions, including severe combined immune deficiency syndrome and sickle cell disease. In families with hereditary hematologic malignancies, it is important to determine carrier status before transplant occurs for the patient and potential donors. Autologous transplant—­In an autologous transplant, the patient’s own stem cells are removed and then returned to the patient after they have been given chemotherapy and/or radiation. The transplanted stem cells have been spared the exposure to the toxic treatments and can be returned to the patient without risk of graft-­versus-­host disease. Autologous transplants are performed for many types of hematologic and solid tumors, especially in children, although its efficacy in treating solid tumors in adults remains unproven.

1. Cancer Diagnosis and Treatment

27

1.3.6.  Additional Cancer Therapies Other cancer therapies include cryotherapy, retinoid agents, and thermal therapy. 1.3.6.1.  Cryotherapy (also called cryoablation or cryosurgery) Cryoablation uses extreme cold to freeze the tumor and interrupt its growth process. It is also useful in relieving pain and reducing swelling. In cryoablation, liquid nitrogen is poured or forced into probes that have been inserted into the tumor, killing the cells. This can be used in skin cancers and cervical cancers instead of surgery or for tumors where surgery would be difficult (prostate cancers, bone cancers). 1.3.6.2.  Retinoid Agents All-­trans retinoic acid (ATRA) induces differentiation of epithelial cells, thus impairing the tumor’s ability to grow. Retinoic acid has been found to be quite effective in treating acute promyelocytic leukemia (APML or APL). Isotretinoin (13-­cis retinoic acid) is also used to treat ­neuroblastoma. Other types of retinoid acids are being studied for treatment uses as well. Side effects can include headache, fever, dry skin and mouth, skin rash, nail changes, nosebleeds, swollen feet, sores in the mouth or throat, itching, irritated eyes, muscle and joint pains, ­hyperlipidemia, and liver toxicity. 1.3.6.3.  Thermal Therapy Thermal therapy involves the use of superheating to kill cancer cells. One example of thermal therapy includes HIPEC therapy below. Other forms of thermal therapy can use lasers, radio waves, ultrasound, or heated chambers. Side effects can include burns, blisters, and pain if ­treating skin. Perfusion therapy (such as HIPEC) side effects include swelling, blood clots, bleeding, and damage to normal tissues. Whole-­body hyperthermia treatment can cause diarrhea, nausea, and vomiting, as well as more serious side effects such as damage to the heart and blood vessels. 1.3.6.3.1.  Hyperthermic Intraperitoneal Chemotherapy Hyperthermic intraperitoneal chemotherapy (HIPEC) is a type of chemotherapy used to treat cancers that have spread into the peritoneum or abdominal lining. These include mesothelioma, appendiceal (including appendiceal mucinous neoplasm), colorectal, gastric, ovarian, or primary peritoneal carcinoma. Surgeons typically remove the primary tumor as much as possible (cytoreductive surgery) and then flush the peritoneum with saline to remove any particulate matter. Superheated chemotherapy drugs such as cisplatin are given into and removed from the peritoneum through inflow and outflow catheters. This can be done through an open or closed technique. While HIPEC is associated with fewer side effects than systemic chemotherapy, there is controversy about whether it provides a survival benefit for any cancer except ovarian cancers that meet certain criteria.

28

Counseling About Cancer

1.4.  Risk Factors for Cancer One of the most common questions in a cancer genetic counseling session is “Why did I get this cancer?” For genetic counselors, it is important to be able to provide some context for patients about this. All cancers are due to a complex interaction of genetic, environmental, and stochastic effects, and the contribution of each of these factors in the development of cancer is different for every person. When considering risk factors, one type is intrinsic and that is the mutation rate of cells, which should be similar for all people. Beyond that, nonintrinsic risk factors are made up of endogenous (biological) and exogenous (external) types. Modifiable risk factors are comprised of exposures that are controllable such as cigarette smoking and UV-­exposure from the sun. Nonmodifiable risk factors may include age and genetics. There may also be partially modifiable risk factors such as workplace exposures to chemicals (e.g., for firefighters) and geographical location (e.g., pollution). Even biological factors such as rate of inflammation in the body might be partially modifiable. For instance, the use of low-­dose aspirin as an anti-­inflammatory has been shown to reduce the risk of colorectal cancer for certain people. In the assessment of cancer risk, it is important to determine what risk factors, outside of genetics, may be contributing to cancers in the family. Patients often ask about what kind of substances cause cancer. Carcinogens are well-­studied cancer-­causing agents, which can be chemical, physical, or viral. Examples of physical carcinogens include fibrous materials such as asbestos or particulate matter found in the air from pollution, both of which are linked to an increased risk for lung cancer. Ultraviolet radiation found in sunlight is another example of a physical carcinogen. Chemical carcinogens are substances, natural or man-­made, that consist of a discrete molecular structure. Most chemical carcinogens are indirect-­acting and require metabolic activation to cause cancer, although some are carcinogenic on their own. Examples of direct-­acting carcinogens are formaldehye and sulfur mustard, whereas examples of indirect-­acting chemical carcinogens are polyaromatic hydrocarbons (PAH) and benzene. Please see the link from the 15th report on carcinogens as determined by the National Toxicology Program for a complete list: (https://ntp.niehs.nih.gov/ntp/roc/content/listed_substances_508.pdf) Age, which is nonmodifiable, is the most common risk factor for cancer, with the average age of all cancers combined occurring at age 66. However, the World Health Organization estimates that 30–50% of cancers are preventable. The most common carcinogen is tobacco through cigarette smoking, although any use of tobacco (cigar, snuff, chew) and even secondhand or passive smoke exposure increases the risk for cancer. Other common carcinogens include alcohol, UV exposure (including using tanning beds), and the human papilloma virus (HPV). Workplace exposure to carcinogens is another important area for preventive measures. Occupational exposures to carcinogens in general industry, maritime, and construction are regulated by the occupational health and safety administration (OSHA). For more information on cancer prevention, please see the American Cancer Society’s (https://cancer.org/healthy. html) as well as the National Cancer Institute’s (https://www.cancer.gov/about-­cancer/ causes-­prevention) websites. See Table 1.9 for common risk factors and cancer types. See Table 1.10 for selected carcinogens and the increase in specific cancer risks.

29

1. Cancer Diagnosis and Treatment

TABLE 1.9.  Factors Associated with Increased Cancer Risk by Type Risk Factor

Cancer Type

Smoking

Oral cavity, pharynx; stomach; colorectum; liver; pancreas; nasal cavity/paranasal sinus; larynx; lung, bronchus, trachea; cervix; kidney, renal pelvis, ureter; urinary bladder; acute myeloid leukemia Lung, bronchus, trachea Esophagus (adenocarcinoma); stomach (cardia), colorectum; liver; gall bladder; pancreas; female breast; corpus uteri; ovary; kidney, renal pelvis; thyroid; multiple myeloma

Exposure to secondhand smoke Excess body weight

Alcohol intake

Lip, oral cavity, pharynx, esophagus (squamous cell carcinoma); colorectum; liver; female breast

Poor diet Red meat consumption Processed meat consumption Low fruit/vegetable consumption Low dietary fiber consumption Low dietary calcium Physical inactivity Ultraviolet radiation Infections Helicobacter pylori Hepatitis B virus Hepatitis C virus Human herpes virus type 8; Kaposi sarcoma herpes virus Human immunodeficiency virus Human papilloma virus

Colorectum Colorectum; stomach (noncardia) Colorectum Colorectum Colorectum Colon, excluding rectum; female breast Melanoma of the skin Stomach Liver Liver Kaposi sarcoma Anus, Kaposi sarcoma, cervix; Hodgkin lymphoma; non-­Hodgkin lymphoma Oral cavity; oropharynx tonsils and base of tongue; anus; cervix; vulva; vagina; penis

Source: Adapted from Islami et al. (2018).

TABLE 1.10.  Cancers Associated with Various Occupations or Occupational Exposure Cancer Lung Bladder

Substances or Processes Arsenic, asbestos, cadmium, coke oven fumes, chromium compounds, coal gasification, nickel refining, foundry substances, radon, soot, tars, oils, silica Aluminium production, rubber industry, leather industry, 4-­aminobiphenyl, benzidine Continued 

30

Counseling About Cancer

TABLE 1.10.  Cancers Associated with Various Occupations or Occupational Exposure—Continued Cancer Nasal cavity and sinuses Larynx Pharynx Mesothelioma Lymphatic and hematopoietic Skin Soft-­tissue sarcoma Liver Lip

Substances or Processes Formaldehyde, isopropyl alcohol manufacture, mustard gas, nickel refining, leather dust, wood dust Asbestos, isopropyl alcohol, mustard gas Formaldehyde, mustard gas Asbestos Benzene, ethylene oxide, herbicides, x-­radiation system Arsenic, coal tars, mineral oils, sunlight Chlorophenols, chlorophenoxyl herbicides Arsenic, vinyl chloride Sunlight

Sources: American Cancer Society Fact Sheet "Occupation and Cancer": International Agency for Research on Cancer. Source: Agency for Toxic Substances and Disease Registry (ATSDR).

1.5.  Case Examples 1.5.1.  Case 1 Case Presentation: The genetic counselor is scheduled to see Joe, age 42, for genetic counseling due to a family history of cancer. There is little information about the exact types of cancers that were found in the family ahead of time. When the genetic counselor meets Joe, he tells the counselor that his father died of cancer a few months ago at age 68, and he is very anxious about the possibility that he will get cancer too. Joe tells the counselor that his father had liver cancer and then goes on to say that “he was a heavy drinker, though, and I only drink a lot on the weekends.” As the genetic counselor starts to take the family history, Joe describes that he has two uncles who also died of cancer in their 50s, both of whom were also heavy drinkers. He then reports that he has a cousin on his father’s side who recently developed “a female cancer” at age 35. Joe goes on to state that his grandparents on his father’s side both died in their 50s in a car accident, and his father, as the oldest child, was responsible for taking care of his younger siblings as young adults. While Joe is an only child, he does worry about his three young children and what would happen to them if he should die of cancer at a young age. The genetic counselor begins to discuss the family history with him and asks whether Joe knows if the liver cancer was the primary tumor or whether the cancer had spread to the liver from somewhere else. Joe considers this and says that he believes his father may have had colon cancer before but that he had surgery so “it was taken care of.” The counselor gently probes about whether his dad might have had a recurrence of the colon cancer and that it might have spread to the liver. Joe says he can ask his mother about this, although he is not sure about bringing up his father’s cancer again so soon after his death. The counselor also asks whether it would be possible to talk to his cousins to see if there is more information about his uncles’ and living

1. Cancer Diagnosis and Treatment

31

cousins’ diagnoses. Joe states that he has one cousin he is very close to who could probably tell him about the family cancer history. The genetic counselor reviews the possible scenarios based on the pattern of cancer in the family. Unfortunately, without knowing the types of cancers, it is difficult to assess the family history. It is possible that Joe is right and that if his father and uncles had liver cancer, alcohol may have played a significant role in the development of their cancers. If his paternal first cousin’s diagnosis of cancer was actually cervical cancer, this is less likely to be related to a strong inherited susceptibility. However, it is also possible that his father and two uncles may have had a primary colon or other gastrointestinal cancer and that his cousin had an early uterine or ovarian cancer, which would raise the question of Lynch syndrome. The genetic counselor asks Joe if he would be willing to do some legwork in trying to sort through the diagnoses. Joe states that he would be willing to do that. Follow-­Up: Joe calls the genetic counselor within a couple of weeks to let her know that his dad indeed had colon cancer that spread to the liver. He had been treated at a different hospital when he was younger, and he died so quickly after being diagnosed with the liver cancer that the hospital hadn’t had a chance to do any biopsies for molecular studies on the tumor. After a discussion with the cousin he was close to, he found out that his female cousin had been diagnosed with uterine cancer. She was undergoing genetic testing with her providers locally, but her doctors had mentioned Lynch syndrome to her as well. About a month later, Joe called the genetic counselor back and said that his cousin shared her test report with him. She was found to have a pathogenic variant in the MLH1 gene. The genetic counselor arranged for Joe to have genetic testing through a multi-­gene cancer panel, and he was found to be negative for the MLH1 pathogenic variant as well as for other mutations. Joe was very happy to hear that he did not have the familial pathogenic variant. The counselor also gave him information about steps to be healthy and prevent cancer outside of hereditary risk, and he was more than willing to work with his doctor to reduce his risk and stay on top of screening. Case Discussion: This case illustrates the importance of obtaining accurate family cancer h ­ istory information, especially regarding primary cancer versus metastatic disease. While it is likely that Joe’s father had the MLH1 pathogenic variant, since there is no way of verifying this, Joe’s testing included other genes to rule out common cancer syndromes. The contribution of alcohol use to the risk of cancer in this family may still be an important risk factor even in the context of a hereditary syndrome. Joe’s drinking, while not as heavy as his father’s, is still relevant for him as a risk factor for cancer in general, and encouraging a healthy lifestyle is a responsibility for all of his providers. The genetic counselor was also able to be reassuring about the risks of hereditary cancer for his children. 1.5.2.  Case 2 Case Presentation: A 35-­year-­old patient, Claudia, is seen for genetic counseling to discuss her family history of blood cancers. The genetic counselor begins by reviewing what will happen during the course of the session. They outline that they will be taking a family history of cancer,

32

Counseling About Cancer

going over her personal medical history, assessing for genetic risk, and discussing genetic testing options if relevant. They start out by asking if she has any questions or concerns about the session. Claudia states that she is not too worried about the family history and that her sister’s doctor has recommended that she be seen in genetics but was unsure why. The genetic counselor takes the family history and learns that Claudia’s sister was diagnosed with some kind of precancerous blood condition at age 35 and that her doctors are concerned that she now has a type of blood cancer at age 37. Her sister is being treated across the country in California, and her doctors are looking for a potential donor for a stem cell transplant. It was determined that Claudia and one of her brothers could possibly be donors. The only other cancer that Claudia knows of is of a cousin who died at age 32 of leukemia. Claudia’s mother and father did not have cancer and died in their 70s of heart-­related issues. She knows that her mother as well as several aunts in Brazil had bleeding problems, and her father had two brothers who died of heart disease. She is not in touch with her relatives there. She and her brother are younger than her sister with cancer. The genetic counselor explains to Claudia that there may be concern for hereditary risk due to her sister’s cancer. The first step in trying to understand the risk for Claudia is to obtain more information about her sister’s diagnosis. Claudia is able to call her sister during the session and learns that her sister was diagnosed with myelodysplastic syndrome at age 35 and now the doctors think that she has acute myeloid leukemia (AML). The genetic counselor discusses that it would first be better to try to test her sister for pathogenic variants in genes that predisposed to AML if possible. Claudia learns that her sister underwent a skin biopsy for genetic testing when she was going in for a bone marrow biopsy a couple of weeks ago. Results of the genetic testing on her sister are not back yet. Since it can take some time for these results to come back and figuring out Claudia’s own risk was essential to determining whether she could be a possible donor, the counselor suggests that Claudia have her blood drawn and sent off to the laboratory for testing of a broad panel of genes related to susceptibility for AML; the laboratory would allow the counselor to order specific site testing at a later date if her sister’s testing indicated that she had a pathogenic variant in a gene that had not been tested. The counselor suggests that her brother, Carlos, who could also be a potential donor, come in for genetic counseling soon. Claudia calls him, and he is scheduled to be seen the next day. The counselor has a good conversation with Claudia about the possibility of finding out that she has risk for hematologic malignancies and the uncertainties of how best to follow and treat patients in this situation. Additionally, the counselor takes a detailed history related to other conditions that can sometimes be seen with AML. Follow-­Up: Claudia’s test results come back negative for pathogenic variants in the genes for which she was tested. Her brother’s results take a few days longer and, in that time, her sister’s testing comes back showing that she has a pathogenic variant in the RUNX1 gene. Claudia finds out through her brother that two maternal aunts had bleeding disorders and one maternal aunt died of leukemia in Brazil. Her brother’s testing eventually comes back showing that he also has the same RUNX1 pathogenic variant as their sister. Claudia’s testing included the RUNX1 gene, and, since she tested negative, she is able to donate stem cells for her sister shortly after this. Because she is a matched related donor, her sister did well after transplant. The family is evaluated for platelet disorders and other issues related to the RUNX1 mutation.

1. Cancer Diagnosis and Treatment

33

Case Discussion: In this case, it was very important for the genetic counselor to have accurate information about the diagnosis and testing information so that appropriate testing could be done. Rapid testing was essential to determine whether Claudia was an eligible donor for her sister. The knowledge of other conditions in the family such as the report of bleeding disorders was also important for assessment.

1.6.  Discussion Questions Question 1: You are seeing a 45-­year-­old assigned female at birth patient who has a family history of pancreatic cancer. She has a mother and maternal aunt who were both diagnosed with pancreatic cancer, her mother at age 60 and maternal aunt at age 65. Her mother passed away shortly after diagnosis, but her aunt has been put on a targeted therapy that seems to be working. a. If the patient asks about what the main warning signs are for this cancer, what would you say? b. What are the risk factors for pancreatic cancer that might be relevant for her? c. What kinds of targeted therapy could her aunt be on? Question 2: A patient is added to your schedule on the same day she is having radiation treatment for breast cancer. She has completed 2 weeks of treatment. a. How might the side effects of treatment affect your interaction with the patient during a genetic counseling session? b. She has already undergone surgery to remove the primary tumor. What terminology would you use to describe the treatment she is having now? c. What would you look for her in pathology report that could help you in assessing hereditary risk?

1.7.  Further Reading Agency for Toxic Substances and Disease Registry (ATSDR). Chemicals, cancer, and you. https://www. atsdr.cdc.gov/emes/public/docs/Chemicals,%20Cancer,%20and%20You%20FS.pdf American Cancer Society. Signs and symptoms of cancer. Last revised 2020 Nov 6. https://www.cancer. org/treatment/understanding-­your-­diagnosis/signs-­and-­symptoms-­of-­cancer.html American Joint Committee on Cancer. Cancer Staging Handbook, 7th edition. Springer, New York, 2010. Bramsen J, Rasmussen MH, Ongen H, et al. Molecular-­subtype-­specific biomarkers improve prediction of prognosis in colorectal cancer. Cell Reports 2017;19(6):1268–1280. Cancer.net (ASCO). Sarcomas, soft tissue: introduction. 2020 Nov. https://www.cancer.net/cancer-­types/ sarcomas-­soft-­tissue/introduction Farkona S, Diamandis EP, Blasutig IM. Cancer immunotherapy: the beginning of the end of cancer? BMC Med. 2016 May 5;14:73. doi: 10.1186/s12916-­016-­0623-­5. PMID: 27151159; PMCID: PMC4858828. Islami F, Goding Sauer A, Miller KD, et al. Proportion and number of cancer cases and deaths attributable to potentially modifiable risk factors in the United States. CA Cancer J Clin. 2018;68(1):31–54. Jacob JA. Cancer immunotherapy researchers focus on refining checkpoint blockade therapies. JAMA. 2015;314(20):2117–2119. doi:10.1001/jama.2015.10795.

34

Counseling About Cancer

June CH, Riddell SR, Schumacher TN. Adoptive cellular therapy: a race to the finish line. Sci Transl Med. 2015;7(280):280ps7. doi: 10.1126/scitranslmed.aaa3643. Ma J, Setton J, Lee NY, et al. The therapeutic significance of mutational signatures from DNA repair deficiency in cancer. Nat Commun. 2018 Aug 17;9(1):3292. doi: 10.1038/s41467-­018-­05228-­y. PMID: 30120226; PMCID: PMC6098043. Mishra M, Singh N, Ghatage P. Past, present, and future of hyperthermic intraperitoneal chemotherapy (HIPEC) in ovarian cancer. Cureus. 2021 Jun 10;13(6):e15563. doi: 10.7759/cureus.15563. PMID: 34277186; PMCID: PMC8272440. National Cancer Institute. Brachytherapy. Updated 29  January 2019. https://www.cancer.gov/about-­ cancer/treatment/types/radiation-­therapy/brachytherapy National Cancer Institute. Environmental carcinogens and cancer risk. Reviewed 26 June 2019. https:// www.cancer.gov/about-­cancer/causes-­prevention/risk/substances/carcinogens National Cancer Institute. External beam radiation therapy for cancers. Posted 2018 May 1. https://www. cancer.gov/about-­cancer/treatment/types/radiation-­therapy/external-­beam National Cancer Institute. How cancer is diagnosed. Last updated 2019 July 17. https://www.cancer.gov/ about-­cancer/diagnosis-­staging/diagnosis National Cancer Institute. Lasers to treat cancers. Updated 2021 Jun 16. https://www.cancer.gov/about-­ cancer/treatment/types/surgery/lasers National Cancer Institute. Targeted therapies. Updated 2021 December 6. https://www.cancer.gov/about-­ cancer/treatment/types/targeted-­therapies/targeted-­therapies-­fact-­sheet National Cancer Institute. Tumor grade. Reviewed 2013 May 3. https://www.cancer.gov/about-­cancer/ diagnosis-­staging/prognosis/tumor-­grade-­fact-­sheet National Cancer Institute. Tumor markers in common use. Last reviewed 2021 May 11. https://www. cancer.gov/about-­cancer/diagnosis-­staging/diagnosis/tumor-­markers-­list National Cancer Institute. What is cancer? Last updated 2021 May 5. https://www.cancer.gov/about-­ cancer/understanding/what-­is-­cancerOk CY, Woda BA, Kurian E. 2018. The pathology of cancer. In Cancer Concepts: A Guidebook for the Non-­Oncologist. https://doi.org/10.7191/cancer_concepts.1023. Retrieved from https://escholarship.umassmed.edu/cancer_concepts/26 Pfeifer J, Wick M. The pathologic evaluation of neoplastic diseases. In Amer. Cancer Society Textbook of Clinical Oncology. Holleb A, Fink D, Murphy G. (eds.). ACS, Atlanta, GA, 1991. Quintini, C, Ward, G, Shatnawei A, et al. Mortality of intra-­abdominal desmoid tumors in patients with familial adenomatous polyposis: a single center review of 154 patients. Ann Surg. 2012 Mar;255(3): 511–516. doi: 10.1097/SLA.0b013e31824682d4. PMID: 22323009. Rigakos G, Razis E. BRCAness: finding the Achilles heel in ovarian cancer. Oncologist. 2012 Jun;17(7):956–962. doi: 10.1634/theoncologist.2012-0028. PMID: 22673632; PMCID: PMC3399652. SEER Training Modules. 2021. Cancer as a disease. U.S. National Institutes of Health, National Cancer Institute. https://training.seer.cancer.gov/. Tian Z, Liu M, Zhang Y, et al. Bispecific T cell engagers: an emerging therapy for management of hematologic malignancies. J Hematol Oncol. 2021 May 3;14(1):75. doi: 10.1186/s13045-­021-­01084-­4. PMID: 33941237; PMCID: PMC8091790. Wu S, Zhu W, Thompson P, Hannun YA. Evaluating intrinsic and non-­intrinsic cancer risk factors. Nat Commun. 2018 Aug 28;9(1):3490. doi: 10.1038/s41467-­018-­05467-­z. PMID: 30154431; PMCID: PMC6113228. Zheng F, Zhang Y, Chen S, et al. Mechanism and current progress of Poly ADP-­ribose polymerase (PARP) inhibitors in the treatment of ovarian cancer. Biomed Pharmacother. 2020 Mar;123:109661. doi: 10.1016/j.biopha.2019.109661. Epub 2020 Jan 10. PMID: 31931287.

CHAPTER

2 Gastrointestinal Cancer Syndromes

“Don’t put it off any longer, please get screened. This disease is beatable if you catch it in its early stages, so you don’t have any time to waste even if you have no family history and even if you think nothing is wrong. And if you are younger than 45, please be proactive about your health. Know the signs, know the science, listen to your body…Please, you are so needed and you are so loved. Please take your health into your own hands.” —Simone Ledward Boseman (NAACP Image Awards, 27 March 2021)

Hereditary gastrointestinal cancers represent common referral reasons for genetic counseling. This chapter will begin with a review of the anatomy of the gastrointestinal system. Initial sections will review background information on colorectal, gastric (stomach), and pancreatic cancer. The majority of hereditary gastrointestinal cancer syndromes, focusing on colorectal, gastric, and pancreatic ductal cancer syndromes, will be discussed, including: •• •• •• •• •• ••

Lynch syndrome Familial adenomatous polyposis/attenuated familial adenomatous polyposis MUTYH-­associated polyposis NTHL1 tumor syndrome Polymerase proofreading associated polyposis Hamartomatous polyposis syndromes: •• Juvenile polyposis •• ••

Peutz-­Jeghers syndrome PTEN hamartomatous tumor syndromes

Counseling About Cancer: Strategies for Genetic Counseling, Fourth Edition. Katherine A. Schneider, Anu Chittenden, and Kristen Mahoney Shannon. © 2023 John Wiley & Sons Ltd. Published 2023 by John Wiley & Sons Ltd.

35

36

Counseling About Cancer

•• •• •• •• ••

Hereditary mixed polyposis syndrome Serrated polyposis syndrome Hereditary diffuse gastric cancer/diffuse gastric lobular breast cancer syndrome Familial atypical multiple mole melanoma syndrome Hereditary pancreatitis

Following these major reviews, there will also be short reviews of: •• •• •• •• •• •• ••

Li-­Fraumeni syndrome – GI cancers Gastric adenocarcinoma and proximal polyposis of the stomach Familial intestinal gastric cancer Pancreatic neuroendocrine tumor syndromes Liver (hepato-­)/biliary tract (cholangio-­) cancer syndromes Esophageal cancer syndromes Other rare non-­hereditary gastrointestinal cancer syndromes

Finally, there will be two case examples and discussion questions.

2.1. Anatomy This section discusses the anatomy of the gastrointestinal system. The gastrointestinal tract ­generally has four layers: mucosa, submucosa, muscularis, and serosa. Please see Figure 2.1 for an overview of the anatomy of the digestive tract. 2.1.1.  Mouth and Pharynx (Throat) The mouth or oral cavity is the beginning of the digestive system and serves to begin the breakdown of food through mastication (chewing) with the addition of saliva. The oral cavity consists of: •• •• •• ••

••

Lips and cheeks Palate Tongue and teeth Salivary glands •• Parotid (in front of and below each ear) •• Submandibular (below the jaw) •• Sublingual (under the tongue) Other structures •• Tonsils (made up of lymphoid tissue, also part of nose and pharynx) •• ••

Gingiva (gums) Buccal mucosa (lining of the cheeks)

37

2. Gastrointestinal Cancer Syndromes

Esophagus Liver

Gallbladder Colon

Stomach Pancreas Small intestine

Rectum

FIGURE 2.1.  Anatomy of the digestive tract. Source: American Cancer Society. What is bile duct cancer? (Last revised 2  March 2021) https://www.cancer.org/cancer/bile-­duct-­cancer/about/what-­is-­bile-­duct-­ cancer.html

Retromolar trigone (small area behind wisdom teeth) •• Floor of the mouth The lips and cheeks are used to hold food and for speech. The palate is the roof of the mouth that separates the oral cavity from the nasal cavity, with the front portion consisting of the hard palate, made of bone, and the back section consisting of the soft palate, made up of skeletal muscle and connective tissue. The soft palate ends in a protruding section known as the uvula. The soft palate, along with the uvula, lifts up to cover the nasal cavity when food is in the mouth, preventing food from entering the throat. The tongue moves food, is involved in speech, and has papillae that contain taste buds. The salivary glands are responsible for adding moisture and producing an enzyme that helps to break down starches in food. The salivary glands are considered accessory organs since they are not part of the digestive tract but play a role in digestion. The pharynx (throat) is a funnel-­shaped structure that starts at the base of the skull and ends at about the 6th cervical vertebra. At that point, it connects to the larynx (voicebox) on the front side and esophagus on the back side. The pharynx consists mainly of muscle tissue and a mucous membrane. It is about 4–5 inches long and consists of three main sections: ••

•• •• •• ••

Nasopharynx Oropharynx Hypopharynx (also called laryngopharynx) Other structures •• Pharyngeal tonsils

38

Counseling About Cancer

The pharynx is also part of the respiratory system, as it delivers air to the larynx. The nasopharynx only has a role in the respiratory system, passing air from the nasal cavity through the other sections down to the windpipe. The oropharynx receives food from the mouth and pushes it to the hypopharynx through the use of sensory receptors, which cause an involuntary swallowing reflex. The hypopharynx in turn moves food and liquid to the esophagus through peristalsis (wavelike muscle contractions that propel material forward). The epiglottis is a flap at the top of the larynx that prevents food from going into the respiratory tract. Almost all cancers of the oral cavity and oropharynx are squamous cell cancers. Rare types include salivary gland cancer and lymphoma. Please see Figure 2.2 for the anatomy of the oral cavity and pharynx.

Nasopharynx Uvula Palatine Tonsils Oropharynx Base of Tongue Posterior Pharyngeal Wall Lingual Tonsils Hypopharynx

Soft Palate Hard Palate Anterior Tongue Lips Floor of Mouth Gum Salivary Glands

HPV-associated Oropharyngeal Sites

Salivary glands are located throughout the oral cavity. These are identified for illustrative purposes only. Not all sites, such as cheek, are included in this figure.

FIGURE 2.2.  Anatomy of the oral cavity and pharynx. Source: Centers for Disease Control and Prevention. Head and neck cancers. (Last reviewed 7 October 2020). https://www.cdc.gov/cancer/headneck/index.htm

2. Gastrointestinal Cancer Syndromes

39

2.1.2. Esophagus The esophagus is a collapsible muscular tube about 10 inches long, stretching from the hypopharynx to the stomach. It also contains a mucosal layer that helps to keep food moist and easy to pass. Located between the trachea and the spinal column, it passes behind the heart and consists of segments that can be defined differently. One definition includes the following: •• ••

Cervical from C6 vertebra to the suprasternal notch Thoracic (upper 18–23 cm, mid 24–32 cm, and lower 32–40 cm)

The second definition divides the esophagus into: •• •• ••

Upper third (includes the cervical section from above; muscle layer is all skeletal) Mid third (muscle layer is mixed smooth and skeletal) Lower third (muscle layer is all smooth)

It is covered by a layer called adventitia, which is made up of connective tissue.

2.1.3. Stomach The stomach is a large muscular hollow organ that is responsible for the major digestion of food. It is located just below the diaphragm, behind part of the liver, and suspended by the lesser omentum (a fold of the upper part of the peritoneal lining that attaches to other abdominal organs). The area of transition from the end of the esophagus to the beginning of the stomach is called the gastroesophageal junction (GEJ). The stomach has four main regions: cardia, fundus, body, and pylorus. The pylorus has a wider area closer to the body that is called the antrum, whereas the narrower area has a sphincter. The cardia, fundus, and body are considered the upper or proximal portion of the stomach, while the pylorus is the lower or distal portion. The greater curvature is the larger side of the stomach wall, and the lesser curvature is the smaller side. The upper part of the stomach can dilate to allow storage of food as it enters. The lower portion contracts to begin mechanical digestion as well as chemical digestion with stomach juices. The mixture of food with chemicals in the stomach is called chyme. The major components of stomach juices are hydrochloric acid and the pepsin enzyme. The parietal cells of the stomach also produce intrinsic factor, a protein that helps to absorb vitamin B12. Mechanical waves that occur about every 20 seconds contribute to mixing and also cause the pyloric sphincter to open to let small amounts of chyme through into the upper part of the small intestine, the duodenum. The process of digestion in the stomach takes about 2–4 hours. Types of cancer that can be seen in the stomach include adenocarcinoma (both intestinal type, which is most common, and diffuse type), neuroendocrine tumor or cancer, gastrointestinal stromal tumors (GISTs), and other rare types such as leiomyosarcoma, squamous cell, and small cell cancer. Please see Figure 2.3 for the anatomy of the stomach.

40

Counseling About Cancer

Stomach Fundus Cardia Body Pylorus Antrum Fran Milner 2017

FIGURE 2.3. Anatomy of the stomach. Source: American Cancer Society. What is stomach cancer? (Last revised 22 January 2021) https://www.cancer.org/cancer/stomach-­cancer/about/what-­is-­stomach-­ cancer.html; RH holds the copyright.

2.1.4.  Small Intestine The small intestine is a very long narrow tube with the critical function of breaking down and absorbing nutrients from food, as well as removing unusable material. It is about 3–5 meters in length and consists of three parts: duodenum, jejunum, and ileum. It is connected to a network of blood vessels, nerves, and muscles and is anchored to the abdominal wall by the mesentery (folds of the peritoneum that hold the abdominal organs to the posterior wall of the abdomen). Peristalsis continues in the small intestine. The duodenum is the shortest part of the small intestine, about 20–25  cm in length, connecting the pylorus to the jejunum. Chyme from the stomach mixes with pancreatic enzymes and bile from the liver. These substances enter the duodenum through two papillae (round projections called the major papilla [papilla of Vater] and minor papilla). The duodenum also contains Brunner glands, which secrete a mucous-­like bicarbonate to neutralize stomach acids in chyme. The jejunum is up to 2 meters long and is the middle portion of the small intestine that does the bulk of the absorption process of sugars, amino acids, and fatty acids. It has special structures called plicae circularis (muscular flaps) and villi (thousands of frond-­like structures projecting into the intestinal cavity) that absorb nutrients and water from digestive products. The ileum is the final section of the small intestine; it ends in the cecum, which is the first part of the colon. It absorbs any remaining nutrients, including vitamin B12 and bile acid. Cancer types seen in the small intestine include adenocarcinoma, leiomyosarcoma, ­carcinoid, gastrointestinal stromal tumor, and lymphoma. Please see Figure 2.4 for the anatomy of the small intestine.

41

2. Gastrointestinal Cancer Syndromes

Parts of the Small Intestine

Stomach Duodenum Small intestine

Jejunum Colon Ileum

Appendix Rectum

© 2013 Terese Winslow LLC U.S. Govt. has certain rights

FIGURE 2.4.  Anatomy of the small intestine. Source: National Cancer Institute. Definition of small intestine. https://www.cancer.gov/publications/dictionaries/cancer-­terms/def/small-­intestine; RH holds the copyright.

2.1.5. Pancreas The pancreas is a curved leaf-­shaped accessory digestive organ consisting of four parts: head, neck, body, and tail. It is located under the liver, behind the stomach, and in the “C” shape of the duodenum. The function of the pancreas is to provide important enzymes for digestion. The head of the pancreas is the widest part, located on the right side within the “C” shape of the duodenum. It is divided into the uncinate process (“hooked” area that bends beneath the pancreas) and the head proper. The uncinate process is located at the intersection of the superior mesenteric artery and superior mesenteric vein. The distal end of the common bile duct travels through the head of the pancreas and joins the pancreatic duct before the duodenum. Any swelling or scarring of the pancreas here can lead to biliary obstruction. Of note, the ampulla of Vater is an enlargement of the ducts of the liver and pancreas as they join before they enter the ­duodenum through the major papilla (also called the papilla of Vater). The small neck is the section between the head and the body and is about 2.5  cm long, stretching upward and frontward. It is in front of the superior mesenteric vein, splenic vein, and portal vein junction. The body is the region of the pancreas that passes over the aorta and contacts the superior mesenteric artery, suprarenal gland, left kidney, and renal vessels.

42

Counseling About Cancer

The tail is the final section of the pancreas in front of the left kidney, near the spleen and splenic flexure of the colon. The pancreas contains exocrine and endocrine glands. The exocrine glands comprise about 85% of its mass and are in a tree-­like structure of lobules and duct. The lobules are composed of acinar cells (clustered in structures called acini) and duct tissue. The acini are responsible for the secretion of digestive enzymes such as amylases, lipases, and proteases. The duct cells secrete water and sodium bicarbonate. The ducts receive the digestive enzymes and push them through, along with the watery bicarbonate mixture, to the duodenum. The endocrine glands are composed of islet cells, known as islets of Langerhans, and are located throughout the pancreas. They produce crucial hormones such as insulin and glucagon, which regulate glucose levels in the blood, as well as others. The types of islet cells include: •• •• •• •• ••

Alpha (glucagon production) Beta (insulin) Delta (somatostatin) Gamma (pancreatic polypeptide). Epsilon (ghrelin)

Exocrine pancreatic cancers are typically adenocarcinomas but can also be acinar cell, a­ denosquamous, squamous cell, giant cell, and small cell. Endocrine pancreatic cancers or pancreatic neuroendocrine tumors are referred to by the hormones that are secreted, including: •• •• •• •• •• ••

Nonsecreting Insulinoma (insulin) Glucagonoma (glucagon) Gastrinoma (gastrin) Somatostatinoma (somatostatin) VIPoma (vasoactive intestinal peptide)

Please see Figure 2.5 for the anatomy of the pancreas and biliary tract.

2.1.6.  Biliary Tract The biliary tract is an accessory organ system that consists of the liver, gallbladder, and bile ducts. The function of the biliary tract is to make and store bile, a digestive juice made up of bile salts, phospholipids, cholesterol, conjugated bilirubin, electrolytes, and water. Bile breaks down fat, carries away waste, and can absorb some vitamins. The liver is in the upper right part of the abdomen, under the diaphragm and above the stomach. It is a larger organ that weighs about 1.36 kg (3 lbs). It consists of two lobes, the right and left lobe, which can further be broken down into eight segments. Each of these segments is made up of hundreds of small lobules containing hepatocytes which connect to ducts, similar to

43

2. Gastrointestinal Cancer Syndromes

Pancreatic duct

Pancreas Endocrine cells secrete hormones into blood vessels

Liver Gallbladder

Common bile duct Ampulla Duodenum of Vater

Exocrine cells secrete pancreatic enzymes into the pancreatic duct

Duct to pancreatic duct

FIGURE 2.5.  Anatomy of the pancreas and biliary tract. Source: American Cancer Society. What is pancreatic cancer? https://www.cancer.org/cancer/pancreatic-­cancer/about/what-­is-­pancreatic-­cancer.html

the pancreas. These smaller ducts join into the common hepatic duct, which transports bile to the gallbladder and the duodenum. The common hepatic duct joins the major duct of the ­gallbladder to form the common bile duct. The liver is supplied by blood from the hepatic artery and the hepatic portal vein. Liver functions include: •• •• •• •• ••

•• ••

••

Producing bile Producing proteins for blood plasma, cholesterol, and proteins that transport fats Storing and releasing glucose in response to energy requirements Processing hemoglobin to store iron Detoxifying blood, including conversion of ammonia to urea and clearing medicines and other substances Regulating blood clotting through the absorption of Vitamin K, which requires bile Is involved in immunity by removing harmful pathogens from the blood and gut and fighting infections by producing immune factors Processing bilirubin created by the breakdown of blood cells

The gallbladder is a small pear-­shaped organ located underneath the liver. It is made up of three parts called the fundus, body, and neck (infundibulum). The fundus is the widest part of the pear, the body is in the middle, and the neck is the narrower section. The neck connects to

44

Counseling About Cancer

the cystic duct, which eventually connects to the common hepatic duct to form the common bile duct. The function of the gallbladder is to store bile produced by the liver in between meals. Bile is received through the cystic duct where the gallbladder removes 90% of the water content, resulting in a concentrated form. When food (especially fatty food) enters the stomach, a hormone called cholecystokinin is produced that causes the gallbladder to contract and release bile through the cystic duct, where it eventually reaches the duodenum to aid in digestion. A common problem in the gallbladder is the formation of gallstones (cholelithiasis) caused by an imbalance in the content, usually in cholesterol, but also bilirubin, or salts in the bile. The bile ducts are the series of tubes that carry bile from the liver and gallbladder to the small intestine, as described above. Primary cancers of the liver include hepatocellular carcinoma, intrahepatic cholangiocarcinoma (in the bile ducts of the liver), angiosarcoma, hemangiosarcoma, and hepatoblastoma. Many types of cancer also metastasize to the liver (secondary liver cancer). Cancers of the ­gallbladder are generally adenocarcinomas and can be nonpapillary, papillary, or mucinous. Rarely, adenosquamous, squamous cell, and carcinosarcomas can be seen. Bile duct cancers are called cholangiocarcinomas and can be intra-­or extrahepatic. Types of extrahepatic bile duct cancers include perihilar/Klatskin tumor (located in the common hepatic duct) or distal (located in the common bile duct). 2.1.7.  Colon and Rectum The colon and rectum are together known as the large intestine and are about 150 cm or 5 feet long. The large intestine is a long hollow tube that connects to the small intestine on one end and ends in the anus on the other end. It is divided into the following sections: •• •• •• ••

•• •• ••

••

••

••

Cecum (begins at the terminal ileum, is about 6 cm or 2.3 inches) Ascending (~20–25 cm or 8 inches long, traveling upward) Hepatic flexure (also called the right colic flexure, located under the right lobe of the liver) Transverse (~50 cm or 20 inches long, going from right to left between the hepatic and splenic flexure) Splenic flexure (located near the spleen and tail of the pancreas) Descending (10–15 cm or 4–6 inches long, traveling downward) Sigmoid (S-­ shaped loop at the bottom of the descending colon, ~25–40  cm or 10–15.75 inches) Rectosigmoid (area of the colon at the bottom of the sigmoid, which enlarges to form the rectum) Rectum (~12–15  cm long or 4.7–6  inches long, straight, holds stool, signals brain for bowel movements) Anal canal (~4–5 cm long or 1–2 inches, beginning in the dentate line and ending in the anal verge)

2. Gastrointestinal Cancer Syndromes

45

The right (proximal) side of the colon is made up of the cecum and ascending and transverse colon sections; the left (distal) side of the colon is the descending colon, sigmoid, and rectum. The colon is comprised of all four major cell layers with sublayers: ••

Mucosa Epithelium •• Connective tissue •• Thin muscle layer (muscularis mucosae) Submucosa Thick muscle layer (muscularis propria) Serosa/subserosa ••

•• •• ••

The basic function of the colon is to remove water from food and break down any residual solid material that remains. What is left over is formed into stool, where it is held by the rectum and by peristalsis moves out of the body through the anus. The rectum is the most distal part of the large intestine and is about 12-­15  cm in length. It begins at the end of the sigmoid and ends at the dentate line where the anal canal starts. The most common types of cancers or neoplasms seen in the colorectum are adenocarcinomas. Other types can include neuroendocrine tumors/cancer, leiomyosarcoma, non-­Hodgkin lymphoma, melanoma, gastrointestinal stromal tumors, and other rare types. Although anal cancers are generally not considered colorectal, there are rare cancers in the anus that are adenocarcinomas. Anal cancers are mostly squamous cell cancers which can be divided into cancers found above the anal verge or below, considered cancers of the perianal skin. Rarely, anal c­ ancers can be adenocarcinomas, basal cell, melanoma, or GIST. Please see Figures 2.6 and 2.7 for the anatomy of the colon and rectum and cross-­section of the colon and rectum.

2.2.  Colorectal Cancer Colorectal cancer is the third most common cancer and the third leading cause of cancer mortality in both men and women in the United States. The lifetime risk for colorectal cancer is currently estimated to be approximately 4.1% in the general population (Surveillance, Epidemiology, and End Results [SEER] Program, 2021). About 5–10% of colorectal cancer cases can be attributed to a strong hereditary component and another 15% of cases may have a more moderate genetic factor associated with them. Due to an upswing in the number of cases of colorectal cancer in younger individuals, the American Cancer Society has lowered the age at which to begin screening in the general population to age 45 instead of age 50. The U.S. Preventive Services Task Force (USPSTF) recently followed suit, in a sea change for this group, which is typically very conservative in their approach to screening (USPSTF, 2021). The recommendation for Blacks/African Americans had been lowered to age 45 several years earlier.

46

Counseling About Cancer

Transverse Colon Splenic Flexure

Hepatic Flexure

Descending Colon

Ascending Colon

Cecum Appendix

Sigmoid Colon Rectum

FIGURE 2.6.  Anatomy of the colon and rectum. Source: American Society of Colon and Rectal Surgeons. The colon: What it is, what it does and why it is important. https://fascrs.org/patients/diseases-­and-­ conditions/a-­z/the-­colon-­what-­it-­is,-­what-­it-­does

Normal intestinal tissue (cross section of digestive tract)

THE LAYERS OF THE COLON WALL Epithelium

Mucosa

Connective tissue Thin muscle layer Submucosa Thick muslce layers Subserosa Serosa

FIGURE 2.7.  Cross-­section of the colorectum. Source: American Cancer Society: What is colorectal cancer? (Last reviewed: 29 June 2020).

2. Gastrointestinal Cancer Syndromes

47

A strong point in favor of earlier screening is that colonoscopies are one of the few screening tests that not only detect early cancers but prevent them by the removal of precancerous lesions (specific types of polyps). American Cancer Society Screening Recommendations 2018 include: •• ••

••

••

People at average risk of colorectal cancer should start regular screening at age 45. People who are in good health and with a life expectancy of more than 10 years should continue regular colorectal cancer screening through the age of 75. People ages 76 through 85 should make a decision with their medical provider about whether to be screened, based on their own personal preferences, life expectancy, overall health, and prior screening history. People over 85 should no longer get colorectal cancer screening.

Tests include: ••

••

Stool-­based tests: •• Highly sensitive fecal immunochemical test (FIT) every year •• Highly sensitive guaiac-­based fecal occult blood test (gFOBT) every year •• Multi-­targeted stool DNA test (MT-­sDNA) every 3 years Visual exams: •• Colonoscopy every 10 years •• CT colonography (virtual colonoscopy) every 5 years •• Flexible sigmoidoscopy (FSIG) every 5 years

It is important to note that individuals considered to be at high risk for colorectal cancer, including those with defined germline susceptibility, should undergo colonoscopies (or flexible sigmoidoscopies if they have already undergone removal of most of their colon) as screening tests, as they are the gold standard for detecting and removing polyps and other lesions, and stool-­based testing has been largely untested in high-­risk populations. Please see Table 2.1 for types of colorectal polyps, how common they are, cancer risk, and their associated syndromes.

2.3.  Gastric (Stomach) Cancer The lifetime risk for gastric cancer is about 0.8% in the United States. Diagnoses of gastric (stomach) cancer have steadily decreased here over the past 10 years (ACS 2018); while the ­reasons are not completely clear, antibiotic treatment for H. pylori infection as well as better preservation of food may have played a role. Gastric cancer is much more frequent in other parts of the world, and almost half of all cases are seen in East Asia, specifically China. Risk factors for  stomach ­cancer include the following (adapted from World Cancer Research Fund, www.wcrf.org):

48

Counseling About Cancer

TABLE 2.1.  Types of Colorectal Polyps Types of Colorectal Polyps Inflammatory

Hyperplastic

Adenomatous

Tubular Tubulovillous/ villous Serrated

Sessile serrated/ serrated Traditional serrated adenoma Hamartomatous

Juvenile

Peutz-­Jeghers Ganglioneuromas

How Common Common in people with inflammatory bowel disease (Crohn’s disease or ulcerative colitis) Common (7–40%, depending on age); usually small and located at the end of colon and the rectum Common (up to 70%); usually found in colon

Most common type of adenoma Less common type of adenoma Up to 15% of polyps (usually found in the sigmoid colon and rectum) 5–15% of polyps

Cancer Risk Low; growths generally benign Considered low risk

Associated Cancer Syndrome Sometimes hard to distinguish from juvenile polyps; Cronkhite-­Canada Serrated polyposis; hereditary mixed polyposis

Most do not develop into cancer but are considered pre-­cancerous (larger=higher risk)

Lynch; familial adenomatous polyposis; MUTYH-­associated polyposis; hereditary mixed polyposis; polymerase proofreading associated polyposis

Cause about 20–30% of colon cancers

Sessile serrated polyposis; hereditary mixed polyposis

Rarely malignant but can transform into cancer

Hereditary mixed polyposis; PTEN hamartoma tumor; juvenile polyposis; Peutz-­Jeghers; Cronkhite-­Canada Juvenile polyposis; hereditary mixed polyposis; PTEN hamartoma tumor Peutz-­Jeghers PTEN hamartoma tumor syndromes

95 % of malignant neoplasms of the pancreas. Tumors arising from the endocrine pancreas such as islet cell tumors (also called neuroendocrine tumors or cancers) are made up of less than 5% of pancreatic tumors. Similar to colorectal cancer, about 10% of individuals with a diagnosis of pancreatic cancer have a hereditary form of the disease and another 15% may have a more moderate predisposition or familial risk. The definition of a “high-­risk” individual in the context of pancreatic cancer may be different than other cancers due to the high mortality rate associated with this type of cancer. In other words, a lifetime risk of 5% may be considered high-­ risk and warrant consideration of screening, given the implications of a diagnosis. Hereditary pancreatic cancer can be defined by the presence of a relevant gene pathogenic variant as below along with the diagnosis of pancreatic cancer in a close relative: ••

Proband or a first-­degree relative (if unaffected) and a known pancreatic cancer gene pathogenic variant.

Familial pancreatic cancer is defined more by the presence of specific family history as below: •• ••

Two first-­degree relatives with pancreatic cancer (Hruban et al., 1999) Three relatives on the same side of the family with pancreatic cancer (Lynch et al., 2002)

See Figure 2.8 for a Venn diagram of hereditary/familial pancreatic cancer. Recent research has revealed that there are multiple genes associated with high risk for pancreatic cancer, including BRCA2, CDKN2A, ATM, PALB2, MLH1, MSH2, MSH6, TP53, STK11, and others. Syndromes that are classically associated with pancreatic cancer include familial

Hereditary

Familial

Pancreatic Cancer

FIGURE 2.8.  Venn diagram of hereditary/familial pancreatic cancer. A small portion of pancreatic cancer is hereditary, 5–10%. Family history of pancreatic cancer is seen in 10–15% of pancreatic cancer probands. Source: Llach et al., 2020.

2. Gastrointestinal Cancer Syndromes

51

atypical multiple mole melanoma, Peutz-­Jeghers, hereditary pancreatitis, and, more recently, hereditary breast and ovarian cancer as well as Lynch syndrome.

2.5.  Lynch Syndrome Genes:

Inheritance:

MLH1 at 3p22.2 MSH2 at 2p21-­p16.3 MSH6 at 2p16.3 PMS2 at 7p22.1 EPCAM at 2p21 AD (colorectal, endometrial, ovarian, renal pelvis/ureter, bladder, gastric, small intestinal, pancreas, biliary tract, prostate, brain cancer risk; possibly breast cancer risk) AR (constitutional mismatch repair deficiency)

Lynch syndrome is due to pathogenic variants in the mismatch repair genes MLH1, MSH2, MSH6, and PMS2. EPCAM, which is not involved in mismatch repair, is also implicated in Lynch syndrome due to its proximity to the MSH2 gene. Deletions at the 3′ end of the EPCAM gene cause methylation of the MSH2 promoter, which silences gene expression, and are an indirect cause of mismatch repair deficiency. Another uncommon cause of Lynch syndrome is through germline or constitutional methylation of the MLH1 gene promoter. There are two different mechanisms for germline methylation, (1) through primary epimutation, which is likely to be an event that is reversed in the germline, and (2) through secondary epimutation due to heritable pathogenic variants in the MLH1 promoter and other areas of the gene. Please see Figure 2.9 for an image of primary versus secondary epimutation. The prevalence of Lynch syndrome is estimated to be about 1 in 279 in the general population. However, the advent of NGS technologies and the discovery of frequent PMS2 pathogenic variants in large tested cohorts mean that this may be an underestimate. The proportion/percentage of pathogenic variants in the various genes is estimated to be 0.051% (1:1946) for MLH1 pathogenic variants, 0.035% (1:2841) for MSH2 pathogenic variants, 0.132% (1:758) for MSH6 pathogenic variants, and 0.140% (1:714) for PMS2 pathogenic variants, resulting in an aggregate carrier ­frequency of 0.359% (1:279) for any MMR gene pathogenic variant. 2.5.1. Background Lynch syndrome (formerly known as hereditary non-­polyposis colorectal cancer syndrome) is the most common inherited form of colorectal cancer. The first family noted to have Lynch syndrome was documented in 1913 by Aldred Warthin, a pathologist living in Michigan (Warthin, 1913). A seamstress told him a remarkable story about her cancer-­prone family, which became Family G in a series of families presented in his work. He was one of the first researchers to propose the idea that cancer could be hereditary. Descendants of the first family described were eventually found to have an MSH2 pathogenic variant.

52

Counseling About Cancer

NORMAL

(a) PRIMARY EPIMUTATION

Gene A

Gene B

(b) SECONDARY EPIMUTATION

(i) cis acting

(ii) trans acting Current Opinion in Genetics & Development

FIGURE 2.9.  Primary versus secondary epimutations. (a) An epimutation, in the form of aberrant CpG methylation, is the first molecular event that has led to disruption of gene A in the absence of gene sequence changes elsewhere, and so is a primary epimutation. (b) Epimutations can also be a secondary event, where an initial genetic changes causes the epigenetic alteration to gene A. The genetic mutations can act in trans, for example, by mutation to an epigenetic modifier or in cis where local events such as repeat expansions can create regions of methylated DNA. Source: Whitelaw and Whitelaw (2008).

It is estimated that about 3–5% of individuals with colorectal cancer have Lynch syndrome. In the landmark Ohio colorectal cancer prevention initiative, which studied both the tumor and germline for individuals with colorectal cancer statewide, the prevalence of Lynch syndrome was 8.4% in those diagnosed with colorectal cancer before the age of 50. It is important to note that the second most common cancer in Lynch syndrome is endometrial or uterine cancer. Approximately 3–5% of endometrial cancers can be attributed to Lynch syndrome, and, in women, this cancer may be the first cancer diagnosed, as well as the sentinel cancer in the family. Please see Section 3.3.7. 2.5.2. Mechanism The hallmark of Lynch syndrome is DNA mismatch repair (MMR) deficiency. The DNA ­mismatch repair system is complex and to this day is still not completely understood. In its most basic form, the MMR system acts as a proofreader for cells. The MMR system as it relates to DNA repair consists of multiple processes including recognition of mismatched bases, excision, resynthesis, and ligation. In a review of mismatch repair, Kunkel and Erie state that “MMR proteins also modulate cellular responses to environmental stress, prevent recombination between

53

2. Gastrointestinal Cancer Syndromes

diverged sequences, modulate development of the immune system, influence the stability of trinucleotide repeat sequences associated with degenerative diseases, and participate in m ­ eiosis” (Kunkel and Erie, 2015), showing their importance in the day-­to-­day stability of the genome. The major complexes in DNA mismatch repair include heterodimers consisting of MSH2 and MSH6 (MutS) and MLH1 and PMS2 (MutL) homologues. See Table 2.2 for their components and functions. Mismatches are generated through the incorrect incorporation of bases by the DNA polymerases involved in replication of normal DNA, including polymerases α, δ, and ε (other DNA polymerases are involved in replication of damaged DNA). Polymerases δ and ε have their own proofreading abilities through their 3’-­ exonuclease activities (as described in Section  2.9 on PPAP). The most common errors are single base indels through strand slippage in long repetitive sequences. The mechanism of action of mismatch repair, on a basic level, occurs through the following: ••

•• ••

•• ••

••

•• ••

Signal (possibly through incorporation of ribonucleotides) in the nascent strand that attracts the MMR machinery Recognition of the mismatch by the MutSα complex (creates a clamp at the mismatch) Conversion of ATP to ADP through two ATPase binding sites on this complex, which allows the clamp to become mobile (“sliding clamp”) Recruitment of the MutLα complex PCNA (proliferating cell nuclear antigen) activation of MutLα to nick the daughter strand Error removal done through three different processes depending on whether the strand is leading or lagging and other factors (MutSα-­ promoted EXO1 digestion, strand ­displacement synthesis, or Pol δ or Pol ε 3 ′-­5′ exonuclease activity) Resynthesis of the correct DNA by the DNA polymerases Ligation of the DNA

TABLE 2.2.  Components and Functions of the DNA Mismatch Repair Complexes Complex

Components

Function

MutSα MutSβ MutLα

MSH2, MSH6 MSH2, MSH3 MLH1, PMS2

MutLβ MutLγ

MLH1, PMS1 MLH1, MLH3

Recognition of base-­base mismatches and small IDLs Recognition of IDLs Forms a ternary complex with mismatch DNA and MutSα; increases discrimination between heteroduplexes and homoduplexes; also functions in meiotic recombination Largely unknown Primary function in meiotic recombination; backup for MutLα in the repair of base-­base mismatches and small IDLs

IDL: insertion/deletion loop; MLH: MutL homologue; MSH: MutS homologue; PMS: post-­meiotic segregation protein Adapted from Jiricny (2006).

54

Counseling About Cancer

Additional complexes exist to provide some redundancy in the mismatch repair process, including MutSβ, MutLβ, and MutLγ. However, defects in the partner genes in these complexes (MSH3, MLH3, PMS1) are not currently associated with Lynch syndrome (with the exception that biallelic pathogenic variants in the MSH3 and MLH3 genes have been associated with attenuated polyposis and colorectal cancer, with or without other cancer risks). As with other dominant cancer predisposition syndromes, the two-­hit hypothesis would underlie the lack of functional available protein for use in the MMR complexes. The mechanism of the second hit can occur through different pathways including mutation of the other allele, loss of heterozygosity, or methylation. Mismatch repair deficiency leads to the development of a mutator phenotype. The simplest definition of this is an increased rate of mutation in the cell. The impact of this deficiency can be seen in two major ways: ••

••

Carcinogenesis through direct mutation of coding microsatellites (cMS) and inactivation of tumor suppressor genes. The generation of frameshift peptides by altering the reading frame of genes with microsatellites leading to a highly immunogenic response (explaining the tumor-­infiltrating lymphocyte response). These peptides are the basis for potential treatment of Lynch syndrome-­associated cancers including the concept of a vaccine which has been under study for many years.

It has been shown that low levels of microsatellite instability can be seen in the blood of MMR pathogenic variant carriers. Recent research has theorized that haploinsufficiency (having only one working copy) may be another mechanism for tumor development in Lynch syndrome. This would turn the notion of the two-­hit hypothesis in Lynch syndrome upside down and may explain tumors with apparently normal IHC showing evidence of mismatch repair. Further research can help elucidate the role of this pathway. Colorectal cancers that are MMR-­deficient have about a 10-­fold higher mutation rate than those that are MMR-­proficient, indicating a specific mutational signature for these types of ­cancers. Assessing for tumor mutational burden (TMB) is now commonplace among laboratories performing exome sequencing of tumors for therapeutic reasons. Hypermutated tumors show a mutation rate of >10Mut/Mb.

2.5.3.  Diagnostic Criteria There are no standard diagnostic criteria for Lynch syndrome. The presence of a pathogenic variant in an associated gene establishes the diagnosis. The identification of individuals and families with Lynch syndrome was previously driven by the presence of certain family history or tumor characteristics. These are presented for historical reference and may be used by insurance companies in the determination of coverage for genetic testing; they include Amsterdam I (limited to CRC alone) and II criteria and Bethesda guidelines (https://www.orpha.net/data/patho/Pro/en/Lynch_DiagnosticCriteria_En.pdf). However, these criteria are not sensitive enough to detect all cases of Lynch syndrome and therefore the use of risk models based on actual clinical testing experience (prevalence,

2. Gastrointestinal Cancer Syndromes

55

­ enetrance) may be more useful in determining appropriateness for genetic testing. Risk p models include Leiden, MMRPro, MMRPredict, and PREMM. These models take into account family history and tumor types in order to present a risk calculation for likelihood of mutation in a Lynch ­syndrome gene. Of these, the PREMM model is the easiest to use and has been incorporated into NCCN guidelines (risk score of ≥ 5%); the latest version of this model (PREMM5) suggests ­genetic evaluation with a risk score of ≥ 2.5%. Please see Section 7.3.4.4. for links to these models. 2.5.4.  Cancer Risks The two most common cancers seen in Lynch syndrome are colorectal and endometrial (uterine) cancer. CRCs associated with Lynch syndrome tend to be found on the right side of the colon (proximal) versus the left side (distal), with a ratio of about 70 proximal/30 distal. Histologically, LS-­associated CRCs tend to have certain characteristics, including tumor-­ infiltrating lymphocytes, Crohn’s-­like lymphoid reaction, mucinous features, medullary features, signet ring cell histology, and others (Shia et al., 2013). The major precursor lesion to colorectal cancer in Lynch syndrome is the adenomatous polyp, or adenoma. While adenomas in the general population may take 10 or more years to progress to cancer, they can evolve much more quickly in the background of Lynch syndrome, which is why frequent colonoscopies are recommended. L ­S-­ associated endometrial and ovarian cancers are classically endometrioid-­type histology but appear to have a higher frequency of non-­endometrioid types than in the general population. It is unclear whether lower uterine segment tumors are seen more often in females with LS. It appears that LS-­associated CRCs tend to have a better prognosis stage for stage than in the general population, but there is debate about whether this is true for endometrial cancers. In addition to colorectal and endometrial cancers, Lynch syndrome can predispose individuals to a number of different tumor types, including gastric (stomach), ovarian, urothelial/ upper urinary tract, small bowel, pancreatic, hepatobiliary tract, sebaceous tumors, and, rarely, brain tumors (gliomas being most common) and sarcomas. It appears that these other tumors also have a better prognosis than sporadic cancers, although there is much less data about this for each specific tumor type. As with many hereditary cancer syndromes, as more families with pathogenic or likely pathogenic variants in the MLH1, MSH2, MSH6, and PMS2 genes have been studied, the risk associated with pathogenic variants in specific genes falls within a range. Because MLH1 and MSH2 are the “anchors” in the MutL and MutS complexes, pathogenic variants in the associated genes are associated with the highest risks for cancer. The average age of diagnosis of these tumors, especially for patients with MLH1 and MSH2 pathogenic variants, is earlier than in the general population. MSH2 gene pathogenic variants are likely associated with the widest variety of cancers, and surveillance for extracolonic cancers may more often be warranted. However, MSH6 gene pathogenic variants were associated with a significant risk for gynecological cancers and even in families with PMS2 gene pathogenic variants where cancer risk is lowest, early-­ onset risk for colorectal cancer has been reported in retrospective cohorts. For instance, approximately 8% of CRCs in one PMS2 cohort were diagnosed before the age of 30. In addition, there have been more recent papers stating that MSH6 and PMS2 pathogenic variants are seen more

56

Counseling About Cancer

often in breast cancer patients, as well as data arguing against this. Whether or not there is truly an increased risk of breast cancer in Lynch syndrome patients has been the subject of debate for many years. It does appear that there is an increased risk in certain families and perhaps with certain genes and/or specific pathogenic variants (see Kohlmann and colleagues for a thoughtful review of the data). Prostate cancer also falls in the category of common cancers that may be increased in men with Lynch syndrome, again perhaps with specific genes. One study (IMPACT) looked at prospective use of PSA testing in men and did find increased risk in carriers of MSH2 and MSH6 pathogenic variants. As discussed previously, EPCAM gene deletions are thought to cause methylation of the MSH2 gene and are therefore thought to be equivalent to MSH2 pathogenic variants in terms of colorectal cancer risk; they are, however, rare in Lynch syndrome and may not have the same extracolonic risks as MSH2 pathogenic variants. There is some research that indicates that the location of the EPCAM pathogenic variant, whether within EPCAM or spanning the end of EPCAM and beginning of MSH2, may make a difference in the extracolonic cancer risk. As the numbers of families with EPCAM pathogenic variants that have been studied are small, more information will likely be available about this over time. Beyond the core cancers seen in Lynch syndrome, many other cancers have been reported in individuals with Lynch syndrome, including sarcoma, adrenocortical carcinoma, cervical cancer, choroid plexus carcinoma, and ovarian carcinosarcoma (MMMT). While concordant IHC testing has been proven in some of these cases, it is difficult to know if most cases are true, true, and unrelated. It is widely known that there is differential expression of the genes involved in MMR in different tissue types. The cancer risk estimates for the core cancers to age 80 are in Table 2.3 (adapted from NCCN guidelines V1.2022).

2.5.5.  Other Clinical Features Sebaceous neoplasms 2.5.6.  Syndrome Subtypes •• •• ••

CMMRD Muir-­Torre Turcot

2.5.6.1. CMMRD Constitutional mismatch repair deficiency (CMMRD) is a rare childhood cancer predisposition syndrome characterized by biallelic pathogenic variants in the mismatch repair genes (in  descending order): PMS2, MSH6, MLH1, MSH2. Biallelic EPCAM pathogenic variants have not been published but are possible. Please see Section  5.2.5 for a full description of CMMRD.

57

2. Gastrointestinal Cancer Syndromes

TABLE 2.3.  Lynch Syndrome Cancer Risk Estimates Cancer

General Population Risk

Colorectal Endometrial (uterine) Stomach (Gastric) Ovarian Biliary tract Bladder, renal pelvis and/or ureter

4.2% 3.1%

46–61% 34–54%

33–52% 21–57%

10–44% 16–49%

8.7–20% 13–26%

0.9%

5–7%

0.2–9%

≤1–7.9%

1.3% 0.2% [~4.1% combined including kidney cancer based on SEER data]* 0.3% 0.6% Rare

4–20% 1.9–3.7% 2.2–12% combined

8–38% 0.2–1.7% 6.6–40.8% combined

≤1–13% 0.2–≤1% 1. –13.7 % combined

Inadequate data 1.3–3% 0.2–≤1% ≤ –6.1% combined

0.4–11% 0.7–1.7% Elevated

1.1–10% 2.5–7.7% Elevated

≤1–4% 0.8–1.8% Elevated

0.1 – 0.3% 0.6–≤1% Elevated

1.6% 11.6% [12.9% by SEER data]*

6.2% 4.4–13.8% Not elevated

0.5 –1.6% 3.9–23.8% Not elevated

1.4–1.6% 2.5 – 11.6% Not elevated

≤1–1.6% 4.6–11.6% Not elevated

Small bowel Brain (CNS) Sebaceous tumors Pancreatic Prostate Breast

MLH1

MSH2/ EPCAM

MSH6

PMS2

* https://seer.cancer.gov/statfacts/ Breast cancer risk has not been established to be elevated in Lynch syndrome; use personal and family history as guide. Source: Adapted from NCCN guidelines v.1.2022. https://www.nccn.org/guidelines/guidelines-­detail? category=2&id=1436

The first sign of CMMRD may be the presence of café au lait spots. Children may be misdiagnosed with neurofibromatosis (NF) Type I due to this, although the CALs seen in CMMRD are different than those associated with NF Type 1. The spectrum of cancers seen in CMMRD include intestinal cancers, but many other types of tumors can be seen, such as brain tumors, hematological malignancies, sarcomas, and other tumor types. The presence of multiple childhood or early adulthood tumors is often seen in patients with CMMRD. There is a high mortality rate in children and young adults with this condition due to the refractory nature of the disease. Mismatch repair may not be completely abrogated in patients with CMMRD due to some redundancy in MMR function as discussed above in Lynch syndrome, especially in individuals with biallelic PMS2 and MSH6 pathogenic variants. CMMR-­D pathogenic variants reported in MLH1 and MSH2 are likely to be “milder” given the severity of phenotype, with complete loss of the anchor proteins in MMR. Even given this, the molecular signature of tumors in children and young adults with CMMRD is one of a hypermutator phenotype, meaning that tumor cells show

58

Counseling About Cancer

a level of mutation that is among the highest of any tumor type seen. One hope for patients is that immunotherapy may be more effective in this setting than in many other DNA repair deficiencies, especially use of immune checkpoint inhibitors. There is a strong call for more research in the treatment of this condition, comparable to the most severe forms of Li-­Fraumeni syndrome. 2.5.6.2.  Muir-­Torre Muir-­Torre syndrome (MTS) is the combination of a sebaceous (sweat gland) neoplasm with an internal malignancy. Roberts and colleagues from the Mayo Clinic developed a clinical scoring system to determine how likely an individual with a history of sebaceous neoplasms would have MTS/Lynch syndrome. While MTS is still used in dermatological literature, Lynch ­syndrome is the preferred term. 2.5.6.3. Turcot Turcot (in the context of LS) is usually the combination of glioma/glioblastoma and colorectal polyps. Turcot syndrome can also be used in the context of familial adenomatous polyposis (FAP) with a combination of the presence of polyposis and medulloblastoma. Due to this ­confusing nomenclature, use of the term Turcot syndrome has largely fallen out of favor.

2.5.7.  Genetic Testing In oncology patients, tumor testing is often the first step in determining the likelihood of Lynch syndrome. MMR status in tumors is most commonly assessed by immunohistochemistry (IHC) testing or microsatellite instability (MSI). Many centers have implemented universal tumor screening protocols (meaning all tumors are tested in the initial pathology review) through one of these methods in both colorectal and endometrial cancers. About 15–20% of both types of cancers will screen positive for deficient MMR through loss of one or more proteins on IHC or MSI testing. Of these tumors, only about one in five will actually be associated with Lynch syndrome. The remainder are likely due to somatic changes (somatic promoter hypermethylation of the MLH1 gene; double somatic hits). Figure 2.10 shows the most likely gene affected given the pattern of protein loss on IHC if Lynch syndrome is the underlying cause of tumor development. Since most sporadic MMR deficient tumors are attributed to promoter hypermethylation of the MLH1 gene (epigenetic silencing) and then a second hit on the other allele, many centers have implemented a second test to assess for promoter hypermethylation either through direct methylation analysis or through BRAF V600E testing for patients whose tumor show loss of MLH1 and PMS2. For patients diagnosed with MMR-­deficient tumors, the best test would be a paired germline-­ somatic test, where both the tumor and a normal sample are tested for pathogenic variants in all of the Lynch syndrome genes with additional germline evaluation. For all patients being evaluated for Lynch syndrome, a broad panel test with a reasonable list of actionable genes and/or genes that may be consistent with the patient’s personal and family history is preferable.

59

2. Gastrointestinal Cancer Syndromes

Loss of MSH2/MSH6

Loss of MSH6

MSH2

MSH6

PMS2

MLH1

Loss of PMS2

Loss of MLH1/PMS2

FIGURE 2.10.  Patterns of IHC loss for mutations in different Lynch syndrome genes.

Germline testing for Lynch syndrome genes including sequencing and deletion/duplication analysis is generally highly sensitive for the detection of pathogenic variants. However, a clinical diagnosis of Lynch syndrome can be given with negative genetic testing if the suspicion is high, with multiple tumors in individuals in a family showing defective mismatch repair and other factors, such as biallelic somatic inactivation, are ruled out. Germline methylation or constitutional epimutation should be evaluated in certain cases where MLH1 hypermethylation is present. Secondary epimutation (methylation caused by a detectable variant in MLH1) is more common than primary epimutation, occurring in up to 3% of individuals with family histories suspicious for LS with MLH1 loss through IHC. See Table 2.4

TABLE 2.4.  List of MLH1 Variants Associated with Secondary Epimutation (Germline Methylation) Variant c.-­27C>A, c.85G>T (common haplotype) 6.4 kb del encompassing exons 1 and 2 c.-­168_116+713del (997bp del) Alu insertion of 345 bp: NC_000003.11:g.37035148_ 37035149ins [NC_000006.11:g.7717384_7717467;7717491_ 7717705; AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA; NC_000003.11:g.37035135_37035148] Alu insertion of 29.54 kb: NC_000003.11:g.37021898_37051437 dup (GRCh37/hg19) MLH1 inversion MLH1 whole gene duplication

Ancestry Identified Caucasian Finnish Italian French (Leclerc et al., 2018)

French (Leclerc et al., 2018) German (Morak et al., 2011) German (Morak et al., 2011)

60

Counseling About Cancer

Hospital-based diagnosis of incidental CRC or EC Tumor undergoes universal testing for MMR defect by IHC or MSI MLH1 protein loss and/or MSI detected MLH1 methylation testing of tumor

Or for CRC only: BRAF V600E mutation testing of tumor

MLH1 methylated

MLH1 unmethylated

BRAF wild-type CRC

Age A transversions. (b) NTHL1 recognizes and removes oxidized pyrimidines, including 5-­hydroxycytosine (5-­OHC). Upon replication, 5-­OHC can mispair with adenine, which probably explains why NTHL1 ­deficiency results in accumulation of C > T transitions. Source: Weren et al. (2018). John Wiley & Sons.

2.7.4.  Cancer Risks MAP is characterized by the presence of 10–100 adenomas through the colon (similar to attenuated FAP) with an average number of about 20 adenomas. The mean age of presentation is approximately 50 years old. Hyperplastic/serrated polyps and mixed polyps also seem to be

71

2. Gastrointestinal Cancer Syndromes

more common in individuals with MAP. MAP has been identified in individuals with CRC in the absence of polyposis, especially when the diagnosis occurs before age 50. The lifetime risk for CRC is 43–100% without surveillance. Second CRCs have been reported in about 25% of patients with MAP. There does not seem to be a predilection for location of the tumor in MAP patients. MAP patients who develop CRCs may have a better prognosis than individuals with CRC who do not have a hereditary predisposition. Duodenal polyps are seen in approximately 17–25% of individuals with MAP. The lifetime risk for duodenal cancer is thought to be approximately 4%. Fundic gland polyps are seen more often in MAP, and gastric cancer risk may be increased but not well-­quantified. Extra-­intestinal tumors reported in MAP include desmoid tumors, ovarian, bladder, breast, thyroid, endometrial cancers, and sebaceous neoplasms. Ovarian and bladder cancer risk do seem to be increased in individuals with biallelic pathogenic variants and the other risks are not as well-­defined. Table 2.6 from GeneReviews summarizes estimated cancer risks from multiple studies. 2.7.5.  Other Clinical Features Benign findings that have been reported include thyroid nodules, adrenal adenomas, dental abnormalities (jawbone cysts), and congenital hypertrophy of the retinal pigment epithelium (CHRPE).

TABLE 2.6.  Cancer Risks in Individuals with MUTYH Polyposis Compared to the General Population Cancer Type

General Population Risk1

Colorectal

5.5%

Duodenal Ovarian Bladder Breast Endometrial Gastric Pancreatic Skin Thyroid

G c.1187G>A c.933+3A>C c.1227_1228dup c.270C>A c.494A>G c.892-­2A>G

W. and N. European W. and N. European W. and N. European North African/Tunisian Pakistani Indian Asian

p.Glu410Glyfs*43 p.Tyr90Ter p.Glu466Ter

Individuals with MAP who have homozygous p.Y179C pathogenic variants seem to have a more severe phenotype than individuals who are homozygous for p.G396D or compound heterozygotes having p.Y179C and p.G396D. Siblings of an individual with MAP should be tested to determine whether they are noncarriers, monoallelic pathogenic variant carriers, or have MAP. There is a low risk for offspring of an individual with MAP to have the condition; while they will inherit one altered copy from their parent with MAP, children of individuals with MAP are unlikely to inherit an altered copy of the gene from their other parent. However, the carrier frequency in certain populations is higher, so it is important to consider partner testing in anyone who has one MUTYH pathogenic variant. Family member testing may also be warranted to clarify MAP risks in related individuals. 2.7.8.  Medical Management Age to begin and frequency of screening recommendations may vary among different groups. Individuals with MAP are generally recommended to begin screening with colonoscopies every 1–2 years beginning at age 20–25 or earlier, based on family history. If the polyp burden becomes too difficult to manage endoscopically, colectomy may be considered (similar to attenuated FAP). Upper endoscopies (EGDs) with a side-­viewing scope are recommended to begin at about age 30 and continue every 2–3 years. Individuals with MAP should also consider annual physical examination, thyroid ultrasound, and skin examination by a dermatologist.

2.8.  NTHL1 Tumor Syndrome Gene: Inheritance:

NTHL1 at 16p13.3 AR (colorectal polyps and cancer, breast cancer; possibly other cancer risks)

2.8.1. Background Similar to the discovery of other polyposis genes, NTHL1 was found through exome analysis on cohorts of polyposis patients. In 2015, a Dutch group published the discovery of NTHL1 as a colorectal polyposis gene. They applied whole exome sequencing to families with multiple

74

Counseling About Cancer

colonic adenomas, most of whom were diagnosed with CRC or had a first-­degree relative with polyposis or CRC. They found a homozygous NTHL1 mutation (now called pathogenic variant) in seven individuals from three families. They were able to show that NTHL1 was the causative factor. Subsequent studies have shown that breast cancer risk is increased in women, and reports of other cancers have led to renaming the condition to NTHL1 tumor syndrome. 2.8.2. Mechanism NTHL1 stands for nth-­like DNA glycosylase 1. It is a base excision repair gene similar to MUTYH. While biallelic MUTYH pathogenic variants lead to an increase in G:C to T:A transversions, biallelic NTHL1 pathogenic variants lead to an increase in C:G to T:A transitions. Tumors associated with NTHL1 are generally not hypermutated as with MMR deficiency but do show mutations in common driver genes (APC, TP53, KRAS, PIK3CA). NTHL1 has a different mutational signature (signature 30) than MUTYH and other base excision repair genes. 2.8.3.  Diagnostic Criteria There are no standard diagnostic criteria for NTHL1 tumor syndrome. The diagnosis is established in an individual with the finding of biallelic germline pathogenic variants. 2.8.4.  Cancer Risks As there have only been 20 families described in the literature to date, the cancer risk estimates for individuals with NTHL1 tumor syndrome are not well-­established. Please see GeneReviews for further information. Colorectal polyp and CRC risk is thought to be high: all individuals with biallelic NTHL1 pathogenic variants have had at least one adenoma (range 1–100). Other types of polyps such as hyperplastic and serrated have been seen. The mean age of CRC diagnosis was 61 years (range 33–73). Breast cancer was seen in over half of the women with NTHL1 tumor syndrome, with a mean age of diagnosis of 49 (range 38–63). No specific subtype of breast cancer was more common. Other cancers reported in individuals with this syndrome include duodenal, endometrial, cervical, basal cell, head and neck squamous cell cancers, hematologic malignancies, and ­urothelial cancer of the bladder. Brain tumors included meningiomas and unspecified types. 2.8.5.  Other Clinical Features It is unclear whether these benign conditions are part of the syndrome, but features reported in individuals to date include:

••

Skin findings such as hemangiomas, seborrheic keratosis, and intradermal nevi Ovarian cysts Hepatic cysts

••

Breast papillomas.

•• ••

2. Gastrointestinal Cancer Syndromes

75

2.8.6.  Syndrome Subtypes None To date, there are no established increased cancer risks associated with monoallelic pathogenic variants.

2.8.7.  Genetic Testing NTHL1 testing should be considered in individuals with: •• ••

•• •• •• ••

CRC diagnosed G) causes FILS syndrome (mild facial dysmorphism, mainly malar hypoplasia, livedo on the skin since birth, immunodeficiency resulting in recurrent infections, and short stature) and specific pathogenic variants in POLD1 are associated with the rare childhood-­onset autosomal dominant syndrome MDPL (mandibular hypoplasia, deafness, progeroid features, and lipodystrophy). 2.9.7.  Genetic Testing The exonuclease domains are located in the following (approximate) areas: POLE: residues 268–471 POLD1: residues 304–533 The original mutations that were reported in POLE, c.1270C>G (p.Leu424Val) and POLD1, c.1433G>A (p.Ser478Asn) have appeared multiple times although are still relatively rare (5 mm should be performed if possible. Colonoscopies should continue every 1–3 years based on findings. If a large (>20 mm) polyp is removed by endoscopic mucosal resection (EMR), colonoscopy to review the site of polypectomy should be done within 2–6 months. Surgery should be considered when endoscopic resection is not possible. First-­degree relatives are recommended to consider colonoscopies beginning at either age 40, the earliest diagnosis of SPS, or 10 years prior to the earliest diagnosis of CRC, whichever is

96

Counseling About Cancer

earlier. If no polyps are found, colonoscopy can be repeated every 5 years. If multiple adenomas or serrated polyps are found in the proximal colon, consider colonoscopy every 1–3 years.

2.15.  Hereditary Diffuse Gastric Cancer Syndrome Gene: Inheritance:

CDH1 at 16q22.1 CTNNA1 at 5q31.2 AD

2.15.1. Background Please see also Section 3.3.5. Diffuse gastric cancer can manifest as “linitis plastica,” meaning that the cancer begins in the lining of the stomach and spreads to the muscles, causing a thickening of the stomach walls rather than a discrete mass. Hereditary diffuse gastric cancer syndrome was first described in the 1990s in families with multiple cases of diffuse gastric cancer. The description of a large Maori family in New Zealand with an autosomal dominant diffuse gastric cancer phenotype with incomplete penetrance had been noted dating back to 1964. Linkage analysis on this Maori kindred from the Aotearoa region of New Zealand with a striking history of diffuse gastric ­cancer was used to identify CDH1 (also known as E-­cadherin). The name of the syndrome is evolving and may change to diffuse gastric and lobular breast cancer syndrome (DGLBC). Other genes have recently been identified that may play a role in families with diffuse gastric cancer. In particular, CTNNA1 (catenin alpha 1) has been linked to a smaller fraction of individuals and families with inherited diffuse gastric cancer. Other genes include PALB2, MAP3K6, and others, although these individuals and families may have had a mixture of intestinal and diffuse gastric cancer types. Diffuse gastric cancer is also known as signet ring cell or poorly cohesive (WHO classification) gastric cancer. Signet ring cells are not a normal finding in healthy stomach lining. The presence of these cells with crescent-­appearing nuclei pushed to the periphery by intracytoplasmic mucin is an indication of an abnormal process. Due to lack of E-­cadherin, these cells do not adhere to each other, which typically leads to migration and invasion of surrounding tissues. Foci of intramucosal signet ring cell cancers are seen often in individuals undergoing prophylactic total gastrectomy for HDGC; however, it is unclear what the risk and/or rate of progression to ­invasive adenocarcinoma is in all of these cases.

2.15.2. Mechanism CDH1 is a gene that codes for the calcium-­dependent cell adhesion protein E-­cadherin. This ­protein is a critical part of tissue morphogenesis and homeostasis, as well as other important ­cellular activities such as cell differentiation, survival, and migration through the control of gene expression and activation of signaling pathways. E-­cadherin loss is seen somatically in approximately 40–70% of diffuse gastric cancers, reinforcing CDH1’s central tumor suppressor role in

2. Gastrointestinal Cancer Syndromes

97

these cancers. Interestingly, methylation, rather than a second mutation, appears to be the most common second hit of the CDH1 gene in families with HDGC. The protein product of CTNNA1, α-­E-­catenin, interacts with E-­cadherin, through β-­catenin. Pathogenic variants in the binding domain of E-­cadherin may lead to susceptibility to diffuse gastric cancer.

2.15.3.  Diagnostic Criteria The most recent version of the diagnostic criteria was published by the International Gastric Cancer Linkage Consortium in 2020 (Blair et al., 2020). Of note, these are guidelines for testing. A diagnosis is confirmed if a pathogenic variant is found in CDH1 or CTNNA1. Family Criteria 1. Two or more cases of gastric cancer in family regardless of age, with at least one DGC 2. One or more cases of DGC at any age and one or more cases of LBC 75, management should be considered on an individual basis No proven benefit to screening For patients who have not had risk-­reducing ovarian surgery, consider transvaginal ultrasound and CA-­125 blood test, beginning at age 30–35 Breast self-­exam training and education starting at age 35 Clinical breast exam, every 12 months, starting at age 35 Consider annual mammogram screening in men with gynecomastia starting at age 50 or 10 years before the earliest known male breast cancer in the family (whichever comes first) Starting at age 40 •• Recommend prostate cancer screening for BRCA2 carriers •• Consider prostate cancer screening for BRCA1 carriers If there is a family history of pancreatic cancer on the same side of the family as the BRCA1/2 PV, discuss pancreatic cancer screening guidelines with health care provider

Ovarian cancer Male breast cancer

Prostate cancer Pancreatic cancer

Adapted from NCCN guidelines v. 1.2022.

Risk-­reducing bilateral salpingo-­oophorectomy (RRBSO) should be discussed with all individuals with BRCA1 and BRCA2 pathogenic variants and ovaries intact. This surgery removes the ovaries and fallopian tubes to lower the risk of ovarian cancer. RRBSO is recommended for individuals with a BRCA1 or BRCA2 pathogenic variant when they have reached age 35 to 40, and have completed childbearing. Post-­RRBSO, a small (1–5%) risk of primary peritoneal cancer continues to exist. Risk-­reducing bilateral mastectomy (RRBM) should also be discussed with every individual with a BRCA1/2 pathogenic variant. This surgery removes the healthy breast tissue and lowers the chance for breast cancer by more than 90%. Individuals considering RRBM may have questions about their options for breast reconstruction (the rebuilding of the breast mounds through implants or other fat tissue), which can be discussed with a specially trained plastic surgeon. Because there are effective breast cancer surveillance tools, individuals who carry BRCA1/2 pathogenic variants may choose surveillance (see Table  3.1) as an acceptable alternative to RRBM. Deciding between RRBM and surveillance is a very personal decision, so it is important

3. Breast and Gynecological Cancer Syndromes

139

to carefully consider the benefits and drawbacks of each option by discussing them with s­ pecially trained medical providers. Another option for individuals with BRCA1/2 pathogenic variants includes taking medication (such as tamoxifen and raloxifene, and aromatase inhibitors) to lower the chance of developing breast or ovarian cancer. Studies have shown that oral contraceptive (OC) birth control pill use in individuals with BRCA1/2 pathogenic variants is generally acceptable and may decrease the risk of ovarian cancer. 3.3.3.  BRIP1 Heterozygous Carriers Gene: Inheritance:

BRIP1 at 17q23.2 AD (ovarian cancer risk) AR (Fanconi anemia; see also Section 5.2.9)

3.3.3.1.  Diagnostic Criteria There are no accepted diagnostic criteria for BRIP1 pathogenic variant carriers. Families with BRIP1 pathogenic variants tend to exhibit patterns of cancer that include ovarian cancer. 3.3.3.2.  Cancer Risks Women with BRIP1 pathogenic variants have an up to 9% risk of developing ovarian cancer, compared to a 1–2% chance for women in the general population. There may be an increased risk of triple negative breast cancer in BRIP1 heterozygous carriers. Cancer risk estimates for male BRIP1 pathogenic variant carriers are not currently available. 3.3.3.3.  Other Clinical Features None 3.3.3.4.  Syndrome Subtypes None 3.3.3.5.  Genetic Testing Individuals should be offered BRIP1 gene testing if they have a child or relative with Fanconi anemia (see Section  5.2.9). Individuals should be offered BRIP1 gene testing if they have a personal or family history of ovarian cancer. 3.3.3.6.  Clinical Recommendations Based on estimates from available studies, the lifetime risk of ovarian cancer in BRIP1 pathogenic variant carriers is thought to be high enough to justify consideration of risk-­reducing

140

Counseling About Cancer

salpingo-­oophorectomy (RRSO). Unfortunately, due to insufficient data, the ideal timing for RRSO is unknown. Based on the current limited evidence, a discussion about surgery should be held around age 45–50 years or earlier based on a specific family history of an earlier-­onset ovarian cancer. 3.3.4.  CHEK2 Pathogenic Variant Carriers Gene: CHEK2 at 22q12.1 Inheritance: AD 3.3.4.1.  Diagnostic Criteria There are no accepted diagnostic criteria for CHEK2 pathogenic variant carriers. Families with CHEK2 pathogenic variants tend to exhibit patterns of cancer that include breast cancer. 3.3.4.2.  Cancer Risks Female CHEK2 pathogenic variant carriers have an up to 40% lifetime risk of developing breast cancer. Men and women have an increased risk of colon cancer, but that risk is not well defined. CHEK2 pathogenic variants may also be linked to other cancer risks. Some that are under study include ovarian, male breast, endometrial, thyroid, prostate, and melanoma. 3.3.4.3.  Other Clinical Features None 3.3.4.4.  Syndrome Subtypes The missense pathogenic variant CHEK2 c.470T>C (p.IIe157Thr) is often called a low-­penetrance variant as the risk for breast cancer appears to be lower than with the classic CHEK2 c.1100delC frameshift pathogenic variant. 3.3.4.5.  Genetic Testing Individuals should consider CHEK2 gene testing if they have a personal or family history of breast cancer. 3.3.4.6.  Medical Management Women with CHEK2 pathogenic variants should undergo mammograms yearly and consider tomosynthesis and breast MRI with contrast beginning at age 40. Men and women with CHEK2 pathogenic variants should undergo colonoscopy screening every 5 years, beginning at age 40, or 10 years prior to the youngest age at colorectal cancer diagnosis in a first-­degree relative.

3. Breast and Gynecological Cancer Syndromes

141

3.3.5.  Hereditary Diffuse Gastric Cancer (HDGC) (see also Section 2.15) Gene: Inheritance:

CDH1 at 16q22.1 AD

3.3.5.1.  Diagnostic Criteria Individuals meet clinical criteria for HDGC if they have at least one of the following features: ••

••

Two or more documented cases of diffuse gastric cancer in first-­or second-­degree relatives with at least one diagnosis under age 50. Three or more cases of documented diffuse gastric cancer in first-­or second-­degree relatives regardless of age.

3.3.5.2.  Cancer Risks The lifetime risk of diffuse gastric cancer in an individual with HDGC is about 67% and 83% for  men and women, respectively. The average age of diagnosis is 38 years, with a range of 14–69 years. Diffuse gastric cancers (also termed signet ring carcinomas) are poorly differentiated adenocarcinomas that infiltrate the stomach wall, causing a thickening or bulging of the stomach wall (linitis plastica) rather than a more distinct tumor mass. Individuals with diffuse gastric cancer tend to be younger and have a poorer prognosis than individuals with the more common intestinal type of gastric adenocarcinomas. Intestinal gastric adenocarcinomas, which do not appear in HDGC, are more likely to be caused by ulcers or a treatable Helicobacter pylori bacterial infection. Women with HDGC also have an estimated 39% lifetime risk of developing lobular breast cancer. Cases of ductal breast cancers, signet ring colon cancers, and islet cell pancreatic cancers have also been reported in people with HDGC and may be part of the syndrome. 3.3.5.3.  Other Clinical Features None 3.3.5.4.  Syndrome Subtypes ••

••

Hereditary lobular breast cancer (HLBC) is defined by the presence of a CDH1 ­pathogenic variant in an individual or family where there is no known DGC in the kindred. HLBC families can be recategorized to HDGC if a DGC is diagnosed in a family member at a later time. Clinical management of HLBC kindreds is not straightforward. Hereditary diffuse gastric cancer–like (HDGC-­like) families are those families that meet the genetic testing criteria but have no CDH1/CTNNA1 pathogenic variant identified.

142

Counseling About Cancer

3.3.5.5.  Genetic Testing Approximately one-­third of families meeting the clinical criteria for HDGC (Section 3.3.5.1) will have a detectable pathogenic variant in the CDH1 gene. Most individuals with HDGC will have positive family histories, as de novo pathogenic variants in the CDH1 gene have not been reported and are assumed to be rare. In addition, the following individuals may consider genetic testing for CDH1 and CTNNA1 pathogenic variants: •• •• ••

••

••

••

••

••

••

Individuals with diffuse gastric cancer (DGC) at age 2 standard deviations above the mean Facial nevus simplex Polyhydramnios and/or placentomegaly Ear creases and/or pits Transient hypoglycemia (lasting < 1 week) Typical BWS tumor (neuroblastoma, rhabdomyosarcoma, unilateral Wilms tumor, ­hepatoblastoma, adrenal carcinoma, pheochromocytoma)

Children meet clinical criteria of BWSp if they score > 4 points on the above list of features and they meet genetic testing criteria if they score > 2 points. 5.2.3.2.  Tumor Risks Children with BWS (or BWSp) are estimated to have an 8% risk of malignancy. The cancers ­associated with BWS are Wilms tumor, hepatoblastoma, neuroblastoma, rhabdomyosarcoma, adrenocortical carcinomas, and malignant pheochromocytomas. Benign tumors include benign pheochromocytomas and multiple nephrogenic rests (nephroblastomatosis). Malignancies associated with BWS typically occur by age 7 (highest risk is before age 2) and tend to be tumors of embryonal origin. The most common malignancy is Wilms tumor (WT), which accounts for about half of the cancer diagnoses in BWS. These renal tumors tend to be bilateral and/or multifocal. Children with CDKN1C pathogenic variants appear to have higher risks of neuroblastoma compared to other children with BWS. 5.2.3.3.  Other Clinical Features Although BWS is considered to be an overgrowth syndrome, not all affected children display features of overgrowth, which can include macrosomia, visceromegaly, adrenocortical cytomegaly, macroglossia, hemihypertrophy, lateral overgrowth, placentamegaly, or increased birth weight. Other features of BWS include umbilical hernia, omphalocele, neonatal hypoglycemia, ear creases or pits, and renal anomalies, such as nephrocalcinosis and medullary sponge kidney ­disease. Less common features also include hearing loss and cleft palate. Maternal pregnancy complications involving a fetus with BWS include premature birth, gestational diabetes, preeclampsia, and HELLP syndrome (hemolysis, elevated liver enzymes, and low platelet count).

5. Pediatric Tumor Predisposition Syndromes

223

5.2.3.4.  Syndrome Subtypes None. 5.2.3.5.  Genetic Testing It is estimated that most cases of BWS are sporadic and/or mosaic. There appears to be an increased risk of BWS associated with in vitro fertilization (IVF). The risk of BWS to offspring depends on the specific genetic defect and, in many cases, also the parent of origin. The genetic causes of BWS or BWSp are as follows: ••

••

••

••

••

••

Loss of methylation on the maternal chromosome at imprinting center 2 (IC2), which accounts for about 50% of cases. There is a low risk to offspring as the fetal germline should reset the imprinting. Paternal uniparental disomy (UPD) for chromosome 11p15, which accounts for about 20% of cases. There is likely to be a low risk to offspring. Gain of methylation on maternal chromosome at imprinting center 1 (IC1), which accounts for about 5% of cases. There is likely to be a low risk to offspring as the fetal germline should reset the imprinting. Microdeletion or microduplication involving the 11p15 region, which accounts for a small number of cases. The risk to offspring is 50% either for BWS (if inherited from the father) or Russell-­Silver syndrome (if inherited from the mother). Pathogenic variants in the CDKN1C gene, which accounts for about 5% of sporadic cases and the majority of cases that have been inherited from a parent. The risk to offspring is considered to be 50%, regardless of parent of origin. Balanced chromosomal translocation involving the critical 11p15 region, which accounts for less than 1% of cases. For fathers carrying the balanced translocation, the risk to ­offspring is increased.

5.2.3.6.  Medical Management Some children with BWS or BWSp have mosaic genetic testing results, which should theoretically lower their risks of developing BWS features. However, determining their exact risks will be difficult. For this reason, it is typically recommended that children with mosaic results follow the same screening recommendations as children with classic BWS. The AACR recommendations for cancer screening are as follows:

••

Abdominal ultrasound (including the kidney) from birth to age 4 (extend to age 6 if patient has a CDKN1C pathogenic variant) Serum alphafetoprotein (AFP) every 3 months from birth to age 4 Renal ultrasound every 3 months from age 4 to 7 years

••

Physical exam every 6 months from birth

••

••

224

••

Counseling About Cancer

If patient has a CDKN1C pathogenic variant, add the following screening: •• Urine VMA and HVA •• Chest X-­ray every 3 months until age 6, then every 6 months until age 10

5.2.4.  Bloom Syndrome Gene: Inheritance:

BLM at 15q26.1 Autosomal recessive

5.2.4.1.  Diagnostic Criteria There are no diagnostic criteria for Bloom syndrome (BSyn). BSyn should be suspected in an individual who has the following features: •• ••

••

Unexplained, severe prenatal and postnatal growth deficiency Significant growth deficiency and an erythematous skin lesion in a “butterfly shape” on the face after sun exposure Significant growth deficiency and a diagnosis of cancer

BSyn is characterized by growth deficiency, an increased susceptibility to infection, and an increased susceptibility to cancer. The diagnosis of BSyn is confirmed based on the identification of biallelic BLM pathogenic variants. If the molecular studies are not definitive, then the diagnosis is made by identifying an increased rate of sister chromatid exchanges (SCE). Individuals with BSyn typically have SCE rates that are 10-­fold greater than the normal population. 5.2.4.2.  Tumor Risks The risk of cancer among individuals with BSyn is about 20% and is one of the most common causes of death for individuals with this syndrome. The most common cancers seen in BSyn are leukemias, lymphomas, and skin cancers. Additional cancers include myelodysplasias and small bowel, stomach, esophagus, larynx, lung, and breast cancers. Cases of Wilms tumor, osteosarcoma, and primitive neuroectodermal tumor (PNET) have also been reported. Germ cell tumors may also be a feature of BSyn. Individuals with BS are at increased risk for developing multiple primary neoplasms and they also tend to develop cancer at earlier than typical ages. In the Bloom Syndrome Registry (https://pediatrics.weill.cornell.edu/bloom-­ syndrome-­ registry), the average age of cancer diagnosis was 26 years (range: T). Given the advent of multigene panel testing in prenatal centers and high-­risk cancer clinics, the number of individuals diagnosed with BRCA2, BRIP1, or RAD51C pathogenic variants has

238

Counseling About Cancer

increased. Many practices are beginning to recommend that the partners of individuals found to carry a FA gene also undergo genetic testing to determine the couple’s risk for having a child with Fanconi anemia. 5.2.9.6.  Medical Management The cancer screening guidelines for children with FA can include: •• •• •• •• ••

•• ••

CBC at diagnosis, and then repeated frequently as symptoms warrant Bone marrow aspirate and biopsy at diagnosis, and then repeated annually. Oral self-­exam (or with parent’s assistance) every month Dental exam (without X-­rays unless indicated) every 6 months Head and neck SCC exam by an otolaryngologist every year beginning in early adolescence Gynecological exam with Pap smear every 6–12 months starting in adolescence HPV vaccine administered for both boys and girls in adolescence

The main treatment for individuals with FA who develop severe BMF is to undergo an a­llogenic hematopoetic stem cell transplant, a form of bone marrow transplant (BMT). (See Section 5.1.8 for a discussion of counseling issues for BMT patients.)

5.2.10.  Juvenile Polyposis Genes: Inheritance:

BMPR1A at 10q23.2 SMAD4 at 18q21.2 Autosomal dominant

5.2.10.1.  Diagnostic Criteria Individuals meet clinical criteria for juvenile polyposis syndrome (JPS) if they meet at least one of the following criteria: •• •• ••

More than five juvenile polyps of the colon or rectum Juvenile polyps in other parts of the gastrointestinal (GI) tract Any number of juvenile polyps and one or more affected family members

The diagnosis of JPS is confirmed by the identification of a pathogenic variant in the BMPR1A or SMAD4 gene. Rarely, individuals with JPS have been found to have a pathogenic variant in the PTEN gene.

5. Pediatric Tumor Predisposition Syndromes

239

5.2.10.2.  Tumor Risks The risk of cancer with JPS ranges from 9 to 50%. The malignant tumors associated with JPS include colorectal, duodenal, gastric, esophageal, and pancreatic cancers. The benign tumors include juvenile polyps as well as other types of polyps, such as adenomas and hyperplastic polyps. The pathognomonic feature of JPS is the presence of “juvenile” polyps. These characteristic hamartomatous polyps can be sessile (flat) or pedunculated (stalk) and typically occur in the stomach, small intestine, colon, and/or rectum. Although juvenile polyps can occur in childhood, the term “juvenile” refers to the specific histopathology of the polyps, not the age of onset. People with JPS can develop juvenile polyps throughout their lives, although most develop at least one juvenile polyp by age 20. The number of juvenile polyps ranges from five or six to over 100. In one series of individuals with SMAD4 pathogenic variants, 97% of the cohort developed colorectal polyps and 68% developed gastric polyps. These polyps can cause bleeding and anemia and also have a potential for malignant transformation. 5.2.10.3.  Other Clinical Features The majority of individuals with SMAD4 pathogenic variants will also develop symptoms consistent with hereditary hemorrhagic telangiectasia (HHT). Individuals with combined JPS/HHT syndrome are at risk for developing features of both syndromes. (See the following Syndrome Subtypes section.) The main features of HHT syndrome are telangiectasias, epistaxis, digital clubbing, arteriovenous malformations (abnormal blood vessel formation), and other forms of thoracic aortic disease, including an increased risk of aneurysm. 5.2.10.4.  Syndrome Subtypes ••

••

••

••

Juvenile polyposis of infancy—­Children who develop juvenile polyps within the first 2 years of life are considered to have juvenile polyposis of infancy. The syndrome is typically characterized by numerous juvenile polyps throughout the GI tract that have occurred at a very young age. This condition is considered the most severe form of JPS and affected children often have a poor prognosis due to severe diarrhea, failure to thrive, and anemia. Some children with this severe phenotype often have a contiguous gene deletion syndrome of 10q22–q23 involving both the PTEN and BMPR1A genes. JPS/HHT syndrome—­ Most individuals with SMAD4 pathogenic variants will also develop symptoms consistent with HHT. The main features of HHT are telangiectasias, epistaxis, digital clubbing, arteriovenous malformations (abnormal blood vessel ­formation), and other forms of thoracic aortic disease, including an increased risk of aneurysm. Generalized juvenile polyposis—­Individuals with this JPS subtype develop juvenile polyps throughout their GI tract. Juvenile polyposis coli—­ Individuals with this JPS subtype develop juvenile polyps ­confined to the colon and rectum.

240

Counseling About Cancer

5.2.10.5.  Genetic Testing For individuals with JPS, about 28% have a BMPR1A pathogenic variant or large rearrangement and about 27% have a SMAD4 pathogenic variant or large rearrangement. This means that a fair number of individuals who meet clinical criteria of JPS will not have an identifiable pathogenic variant. In addition, about two-­thirds of individuals with JPS have de novo pathogenic variants. BMPR1A, SMAD4, and possibly PTEN genetic testing is recommended for individuals who have either: •• ••

Developed more than one juvenile polyp or Developed one juvenile polyp and have a family history of juvenile polyps

5.2.10.6.  Medical Management Medical management recommendations for JPS are as follows: •• ••

•• ••

CBC and physical exam annually Colonoscopy starting at age 12 to 15 years, annually until no polyps are found, then every 3 years Upper endoscopy starting at age 15 years, every 1 to 2 years Capsule endoscopy starting at age 15, every 1 to 2 years

5.2.11.  Leukemia Predisposition Syndromes Genes:

Inheritance:

ANKRD26 at 10p12.1 CEBPA at 19q13.11 DDX41 at 5q35.3 ETV6 at 12p13.2 GATA2 at 3q21.3 GATA3 at 10p.14 IKZF1 at 7p12.2 PAX5 at 9p13.2 RUNX1 at 21q22.12 SAMD9 and SAMD9L at 7q21 Autosomal dominant

5.2.11.1.  Diagnostic Criteria Currently, there are no agreed-­upon diagnostic criteria for the leukemia predisposition syndromes. Diagnosis of a leukemia predisposition syndrome is made on the basis of identifying a heterozygous germline pathogenic variant in one of the leukemia predisposition genes just listed.

5. Pediatric Tumor Predisposition Syndromes

241

5.2.11.2.  Tumor Risks The leukemia predisposition genes are newly described with only a small number of families identified to date; thus, the associated cancer risks are still emerging. Germline pathogenic ­variants in the ANKRD26, CEBPA, GATA2, and RUNX1 gene confer increased risks of MDS and acute myeloid leukemia (AML). Germline pathogenic variants in the ETV6 and PAX5 genes confer increased risks of acute lymphoblastic leukemia (ALL). Other forms of leukemia as well as bone marrow failure have also been reported. Additional possible cancers include lymphomas. Current information on the associated cancers for pathogenic variants each gene are as follows: ••

•• •• ••

•• •• •• •• •• ••

ANKRD26—­MDS, AML, thrombocytopenia, chronic myelogenous leukemia (CML), and chronic lymphocytic leukemia (CLL) CEBPA—­MDS, AML, and secondary leukemia DDX41—­MDS, AML, and possibly lymphoma and other cancers ETV6—­ALL, thrombocytopenia, myeloid mixed phenotype acute leukemia (MPAL), chronic myelomonocytic leukemia (CMML), and secondary MDS and AML GATA2—­MDS, AML, and CMML GATA3—­ALL IKZF1—­ALL PAX5—­ALL, especially B-­cell ALL RUNX1—­MDS, AML, thrombocytopenia, and T-­cell ALL SAMD9 and SAMD9L—­MDS and AML; MIRAGE syndrome, and ataxia-­pancytopenia syndrome

5.2.11.3.  Other Clinical Features Individuals with leukemia predisposition syndrome also often display bone marrow failure, with abnormal platelets, white blood cells, and/or red blood cells. This can increase the risks of fatigue, infection, or bleeding. 5.2.11.4.  Syndrome Subtypes None. 5.2.11.5.  Genetic Testing Few commercial laboratories currently offer panel testing options for the liquid tumor ­syndromes. However, this is likely to change as more data becomes available regarding the leukemia predisposition genes. There are many molecular tests available, which are designed to detect somatic mutations seen in hematologic malignancies for the purposes of diagnosis, prognosis, and management. Although these panels often include genes that are known to also be associated with germline

242

Counseling About Cancer

predisposition, this type of testing does not always cover all exons or intronic regions. Thus, the sensitivity to detect a germline pathogenic variant is often lower than a test designed specifically for germline analysis. In addition, somatic mutations are common within genes known to cause predisposition to MDS or leukemia (such as DDX41, ETV6, GATA2, PAX5, RUNX1, and others) and variants detected in blood or marrow cannot be distinguished as germline or somatic. Therefore, these tests should not be used as replacements for germline genetic tests. For individuals with active leukemia or in recent remission, genetic testing should be performed on DNA isolated from skin fibroblasts since blood and saliva specimens may detect somatic pathogenic variants. 5.2.11.6.  Medical Management There is no consensus for how best to monitor individuals with a leukemia predisposition syndrome; however, they will need to be monitored carefully for symptoms of bone marrow failure, MDS, or leukemia. Individuals who have inherited predisposition to leukemia are often candidates for allogeneic bone marrow transplants (BMT) or stem cell transplants, a form of BMT. (See Section 5.1.8 for a discussion of counseling issues for BMT patients.) 5.2.12.  Li-­Fraumeni Syndrome Gene: Inheritance:

TP53 at 17p13.1 Autosomal dominant

5.2.12.1.  Diagnostic Criteria Clinical criteria for classic LFS and LFL syndrome are listed in Table 5.3. The diagnosis of LFS is confirmed by the presence of a TP53 pathogenic variant or deletion.

TABLE 5.3.  Diagnostic Criteria for Classic Li-­Fraumeni Syndrome (LFS) and Li-­Fraumeni-­ Like (LFL) Syndromes Criteria for LFS syndrome Proband with sarcoma 2)

Minor features •• •• •• •• •• ••

“Confetti” skin lesions Dental enamel pits (>3) Intraoral fibromas (>2) Retinal achromic patch Multiple renal cysts Nonrenal hamartomas

Definite TSC: Two major features or one major feature with > 2 minor features Possible TSC: One major feature or > 2 minor features Individuals are also considered to have definite TSC if they test positive for pathogenic variant in the TSC1 or TSC2 gene, regardless of clinical features. 5.2.18.2.  Tumor Risks TSC is characterized by multiple, rare lesions, most of which are benign (but potentially still serious). The main cancer associated with TSC is renal cell carcinoma. The risk of RCC is about 2–4% and the average age of onset is age 28 to 30. The renal tumors typically have distinctive

5. Pediatric Tumor Predisposition Syndromes

255

features including TSC-­associated papillary RCC tumors and hybrid oncocytic/chromophobe tumors. Additional cancers seen in TSC include subependymal giant cell astrocytomas (SEGA) and malignant pancreatic neuroendocrine tumors. Many benign tumors and other lesions are seen in TSC2 including the following: ••

•• •• ••

••

•• ••

CNS—­cortical tubers, subependymal nodules, cerebral white matter radial migration lines, and cortical dysplasia. Eye—­retinal hamartoma and retinal achromic patch. Face/mouth—­facial angiofibroma, oral fibroma, gingival harmartoma, and dental pits. Neuroendocrine tumors (benign)—­ pituitary adenomas, parathyroid adenomas and hyperplasia, and pancreatic neuroendocrine tumors (NETs) previously termed insulinomas and islet cell tumors. Skin/nails/bone—­hypomelanotic macules, Shagreen patch, “confetti” hypopigmented skin lesions, achromic patch, acrochordons, ungual or periungual fibromas, and bone cysts. Heart/lung—­cardiac rhabdomyoma, LAM, and LAM-­related lung cysts Kidney—­angiomyolipoma, renal cysts, and polycystic kidney disease (see Section 5.2.18.4, Syndrome Subtypes).

5.2.18.3.  Other Clinical Features Almost all children with TSC develop some type of lesions involving their skin, brain, skin, and/or kidneys (see the previous section). Other non-­tumor-­related issues seen in TSC include: ••

••

••

••

••

Seizures—­Over 80% of children have seizures, usually by age 2. The most common types of seizures associated with TSC are focal seizures and infantile spasms, which may also be accompanied by hypsarrhythmia. Cognitive and learning problems—­about half of individuals have intellectual deficits, learning disabilities, and/or attention deficit hyperactivity disorder (ADHD). TSC-­ associated neuropsychiatric disorder (TAND)—­Examples of TAND concerns include behavioral, psychiatric, intellectual, academic, neuropsychological, and/or ­psychosocial difficulties. Autism spectrum disorder—­The risk of autism spectrum disorder is higher for individuals with TSC if they had a SEGA tumor. Behavioral and emotional problems—­Individuals with TSC have been reported to have a range of behavioral/emotional issues, including aggression, anxiety, depression, and self-­injurious behavior.

5.2.18.4.  Syndrome Subtypes ••

Tuberous sclerosis (TS)/polycystic kidney disease (PKD) contiguous gene syndrome—­A small subset of children with TSC will also be found to have infantile severe polycystic

256

Counseling About Cancer

­ idney disease. These children have a contiguous gene syndrome involving the TSC2 k and PKD1 genes, which lie next to each other on chromosome 16. To date, all cases of TS/PKD c­ ontiguous gene syndrome have been caused by de novo large deletions. 5.2.18.5.  Genetic Testing About 80–90% of individuals who meet clinical criteria for TSC are found to have pathogenic variants in the TSC1 or TSC2 gene, with pathogenic variants in the TSC2 gene far more prevalent. In cases where a pathogenic variant is detected, about 69% are in the TSC2 gene and 31% are in the TSC1 gene. About two-­thirds of the germline pathogenic variants detected are de novo. It is worth noting that up to one-­quarter of TSC cases represent cases of somatic mosaicism, which appears to be associated with a milder phenotype. 5.2.18.6.  Medical Management Suggestions for tumor management in TSC are as follows: Children •• •• ••

••

Abdominal MRI every 1–3 years Brain MRI every 1–3 years until age 25 Echocardiogram every 1–3 years if no signs of rhabdomyoma or in asymptomatic ­individuals with rhabdomyoma until the tumor has regressed Routine EEG if known or suspected seizures

Children and Adults •• •• ••

Dermatologic and ophthalmologic exams annually Renal function labs and blood pressure annually Dental exam every 6 months with panoramic X-­ray by age 7 years

In adulthood only: ••

Lung CT exams every 5–10 years. If lung cysts are present, then perform pulmonary function tests annually and lung CT scans every 2–3 years.

5.2.19.  WT1-­Related Syndrome (Includes Denys-­Drash Syndrome, Frasier Syndrome, WAGR Syndrome) Genes: Inheritance:

WT1 at 11p13 Autosomal dominant

5. Pediatric Tumor Predisposition Syndromes

257

5.2.19.1.  Diagnostic Criteria WT1-­related Wilms tumor should be suspected in cases of multifocal or bilateral Wilms tumor or if there is also a family history of Wilms tumor and is confirmed with the identification of a pathogenic variant or deletion in the WT1 gene. 5.2.19.2.  Tumor Risks The main cancer associated with WT1 pathogenic variants is Wilms tumor (previously termed nephroblastoma). Additional tumors include a rare form of Wilms tumor called fetal rhabdomyomatous nephroblastoma; nephrogenic rests, which are Wilms tumor precursors; and gonadoblatomas, which are benign tumors with a potential for malignant transformation. Wilms tumor is an embryonal malignancy of the kidney and it is the most common kidney tumor of childhood. Most cases of Wilms tumor occur prior to age 5, and often occur prior to age 3. On average, more bilateral cases occur at younger ages than unilateral cases. The risk of Wilms tumor with most WT1 pathogenic variants is 40% or more. WT1 pathogenic variants are linked with increased risks of multifocal and bilateral tumors and with earlier ages of onset. Nephrogenic rests are often observed together with WT1-­related Wilms tumors; however, nephrogenic rests can also be seen with sporadic cases of Wilms tumor. Gonadoblastoma tumors occur within the context of gonadal dysgenesis. Therefore, male children with WT1 pathogenic variants, who are born with genitalia that do not match their XY karyotypes, have 40% or higher risks of gonadoblastoma. Gonadoblastomas typically occur in adolescence or young adulthood; however, cases have been reported in childhood and even infancy. The risk of gonadoblastoma does not seem to be increased in children who do not have gonadal dysgenesis. 5.2.19.3.  Other Clinical Features Other clinical features associated to WT1 pathogenic variants include the following: ••

••

•• ••

••

Intersex disorders—­including ambiguous genitalia, female genitalia in a child with a 46XY karyotype, gonadal dysgenesis, and testicular feminization. Renal disorders—­including urinary tract anomalies, glomerulosclerosis (scar tissue in renal blood vessels), renal insufficiency, and early onset renal failure, often in adolescence or early adulthood. Eye disorders—­including aniridia, cataracts, glaucoma, and nystagmus. Reproductive risks—­including infertility, especially in males, and increased risks of ­gestational high blood pressure and diabetes for female Wilms tumor survivors who had abdominal irradiation. Other issues—­ including intellectual disabilities (also see the following Syndrome Subtypes section).

258

Counseling About Cancer

5.2.19.4.  Syndrome Subtypes Although this section distinguishes between Denys-­Drash syndrome and Frasier syndrome, they may represent a phenotypic spectrum of WT1 pathogenic variants rather than being d ­ istinct entities. ••

••

••

Denys-­Drash syndrome (DDS)—­characterized by an intersex disorder in a chromosomally male (46,XY) child. Additional features include diffuse glomerulosclerosis, urinary tract malformations, and early onset renal failure. Females usually have normal genitalia and may be said to have isolated nephrotic syndrome rather than DDS. Children with DDS have greater than 90% risks of developing WT and the average age of diagnosis is 12 months, with most cases diagnosed by age 3. The risk of gonadoblastoma may be 40% or higher. Many cases of DDS have point pathogenic variants in the zinc finger domain (exons 8 or 9) of the WT1 gene. Frasier syndrome (FS)—­characterized by an intersex disorder in a chromosomally male (46, XY) child. Additional features include glomerulosclerosis and early onset renal failure. In Frasier syndrome, the risk of Wilms tumor is lower (possibly 5–10%) compared to other WT1 related syndromes and the risk of gonadoblastoma may be 40% or higher. Many cases have an intron 9 splice site pathogenic variant in the WT1 gene. WAGR syndrome—­The following features are associated with WAGR syndrome: WT, aniridia (absence of the iris), genitourinary abnormalities, and intellectual disabilities. WAGR syndrome, an example of a microdeletion or contiguous gene syndrome, is caused by a large 11p13 deletion that encompasses at least the WT1 and PAX6 genes. Children with WAGR syndrome have a 40–60% risk of developing Wilms tumor. There is a higher risk for developing fetal rhadomyomatous nephroblastoma, which is a rare form of Wilms tumor. There is also an increased risk of renal disease or failure.

5.2.19.5.  Genetic Testing Children with bilateral Wilms tumor have an increased likelihood of testing positive for a germline WT1 pathogenic variant or deletion. Children with unilateral Wilms tumor and no other associated features have a low likelihood of having a WT1 pathogenic variant. About two-­thirds of germline WT1 pathogenic variants represent de novo cases. The risk of bilateral tumors seems to be higher with truncating WT1 pathogenic variants than with missense WT1 pathogenic variants. 5.2.19.6.  Medical Management Tumor surveillance recommendations for children with WT1 pathogenic variants are: •• ••

••

Renal ultrasound including the adrenal glands every 3 months until age 7. Physical examination by a specialist (pediatric geneticist or oncologist) twice yearly until age 7. Wilms tumor nephron-­sparing surgery is recommended given the increased risk of bilateral disease.

5. Pediatric Tumor Predisposition Syndromes

259

5.2.20.  Xeroderma Pigmentosum (Includes XP/CS Complex, XP Variant) Genes:

Inheritance:

ERCC1 at 19q13.32 XPA at 9q22.3 XPB (ERCC3) at 2q21 XPC at 3p25.1 XPD (ERCC2) at 19q13.2 XPE (DDB2) at 11p12-­p11 XPF (ERCC4) at 16p13.3-­p13.13 XPG (ERCC5) at 13q33 XP-­V (POLH) at 6p21.1-­p12 Autosomal recessive

5.2.20.1.  Diagnostic Criteria Xeroderma pigmentosum (XP) should be strongly suspected in individuals with the following clinical findings: Skin findings ••

•• ••

Acute sun sensitivity (severe sunburn or persistent erythema on minimal sun exposure) Marked freckle-­like pigmentation (lentigos) on the face before age 2 years Skin cancer within the first decade of life

Eye findings •• •• ••

Photophobia Severe keratitis Hyperpigmentation or atrophy of the skin of the eyelids

Nervous system findings •• •• •• ••

Diminished or absent deep tendon stretch reflexes Progressive sensorineural hearing loss Acquired microcephaly Progressive cognitive impairment

The diagnosis of XP is confirmed by the identification of a pathogenic variant in one of the nine genes listed previously.

260

Counseling About Cancer

5.2.20.2.  Tumor Risks Individuals with xeroderma pigmentosum (XP) have close to 100% risks of skin cancer, which include BCCs, squamous cell carcinomas (SCCs), and melanomas. XP is also associated with high risks of ocular melanoma, SCC of the eye, malignant epitheliomas of the eye and eyelid, and SCCs of the lips, mouth, and tongue. Individuals with XP who smoke cigarettes have increased risks of lung cancer. Additional cancers that may be associated with XP include leukemia, brain and spinal cord gliomas, and thyroid, breast, uterine, pancreatic, gastric, renal, and testicular ­cancers. Benign tumors associated with XP include conjunctival papilloma, actinic keratosis, keratoacanthoma, angioma, facial angiofibroma, telangiectasia, and benign epithelioma of the eyelid. Affected individuals are estimated to have a 10,000-­fold increased risk for developing a BCC or SCC skin cancer by age 20 and the average age of the first skin cancer is age 9. Individuals with XP typically develop multiple skin cancers over their lifetime. There is also a 2,000-­fold increased risk for developing a melanoma skin cancer and the average age of diagnosis is age 22. 5.2.20.3.  Other Clinical Features The other clinical features of XP include: ••

••

••

Skin findings—­ include xerosis, lentigos, poikiloderma, hyper-­or hypopigmentation, severe sunburns with blistering, telangiectasia, and skin atrophy. About 60% of people with XP have histories of acute sunburn reactions, often with minimal sun exposure. The XP-­related skin problems are often evident early, median age 1–2 years, and with increased sun exposure, the skin typically becomes dry and parchment-­like. Eye manifestations—­include cataracts, photophobia, keratitis, loss of eyelashes, and ­atrophy of the eyelids. The ocular problems occur in the portion of the eye that is exposed to ultraviolet light (i.e., the conjunctiva, cornea, and sclera) rather than the retina, which is protected from ultraviolet light. The eye problems may occur before age 10 and may be more severe in people with darker toned skin. Neurologic problems—­About 25–30% of individuals with XP have some type of neurologic problem, including acquired microcephaly, progressive cognitive impairment, seizures, progressive high frequency sensorineural hearing loss, diminished or absent deep tendon reflexes, ataxia, spasticity, dysphagia, and vocal cord paralysis.

5.2.20.4.  Syndrome Subtypes There is variable expressivity in XP and there are also genotype/phenotype correlations that are still being clarified. Two XP subtypes are the following: ••

••

XP with neurologic abnormalities—­It is estimated that 25–30% of individuals with XP have progressive neurologic abnormalities (see the previous Other Clinical Features section). These individuals may be considered to have a subtype of XP. XP Variant subtype—­Children with the XP Variant subtype have an attenuated form of XP. They are still at increased risk for developing skin, eye, and other cancers, but they

261

5. Pediatric Tumor Predisposition Syndromes

tend to develop fewer cancers and the onset of disease typically occurs at older ages (e.g., the third decade of life rather than childhood) and neurological abnormalities are rare. Individuals with XP Variant have a pathogenic variant in the XPV (POLH) gene. This condition was once termed pigmented xerodermoid. In addition, pathogenic variants in the XP genes can also lead to other NER pathway disorders or an overlapping combination of XP and another NER pathway disorder, primarily Cockayne syndrome or trichothiodystrophy (also see Table 5.4): ••

XP and Cockayne syndrome (XP/CS complex)—­Children with XP/CS complex have the skin and eye manifestations and cancer risks of XP and the progressive neurologic abnormalities of Cockayne syndrome (CS). Affected children have the increased risks of skin and ocular cancer associated with XP as well as many of the features associated with CS, including short stature, intellectual disabilities, hypogonadism, progeria, and progressive neurologic problems.

TABLE 5.4.  Phenotype Correlations by Gene in Xeroderma Pigmentosum and Related Disorders Gene DDB2 ERCC1 ERCC2

ERCC3 ERCC4 ERCC5 POLH XPA XPC •• •• •• ••

Phenotype XP with no neurologic abnormalities COFS syndrome XP with neurologic abnormalities ranging from none to severe XP/CS XP/TTD TTD COFS syndrome XP/CS TTD XP with mild neurologic abnormalities XP with no neurologic abnormalities or severe late-­onset neurologic abnormalities; Fanconi anemia (FA); one individual with features of XP, CS, and FA, and two individuals with CS. XP with no neurologic abnormalities or severe neurologic abnormalities XP/CS XP with no neurologic abnormalities XP with no neurologic abnormalities ranging from mild to severe XP with no neurologic abnormalities

COFS = cerebrooculofacioskeletal XP/CS = xeroderma pigmentosum-­Cockayne syndrome complex XP/TTD = trichothiodystrophy with XP TTD = trichothiodystrophy (without XP)

Source: Adapted from Kraemer et al. (2003).

262

••

Counseling About Cancer

XP and trichothiodystrophy (XP/TDD) syndrome—­Children with XP/TDD syndrome have the increased risks of skin, eye, and oral abnormalities and cancer and may also have some of the features of TDD syndrome, including developmental delay, congenital cataracts, progressive neurologic abnormalities, short stature, and hypogonadism. Children with TDD or XP/TDD syndrome typically have sulfur-­deficient brittle hair that displays a characteristic “tiger tail” pattern of light and dark under a polarizing microscope.

5.2.20.5.  Genetic Testing The XP genes are involved in nucleotide excision repair (NER), which is the primary mechanism for repairing genetic damage caused by exposure to ultraviolet radiation. Table  5.4 lists the genotype phenotype correlations observed for the XP genes. There is a higher incidence of XP in Japan, North Africa, and the Middle East compared to Europe or the United States. Most cases of XP in the United States or Europe involve pathogenic variants in the XPC, ERRC2, and XPA genes, whereas most cases of XP in Japan involve pathogenic variants in the XPA and POLH genes. Founder pathogenic variants have been identified in several of the XP genes. As with other recessive conditions, there is a higher incidence of consanguinity in affected cases. 5.2.20.6.  Medical Management The following surveillance is suggested for individuals with XP: •• •• •• ••

Careful skin exams by a dermatologist every 3 to 6 months Regular eye exams by an ophthalmologist Regular oral exams by a dentist Regular neurologic exams by a medical provider

Individuals with XP should also: ••

••

Maintain sun protection strategies, including the use of sunblock, protective clothing, and UV-­absorbing sunglasses Avoid cigarette smoking

5.3.  Case Examples 5.3.1.  Case 1: Counseling About an Eye Tumor Case Presentation: At Koji’s 6-­month well-­child visit, his mother mentioned to the pediatrician that sometimes one eye seemed to pull to one side. The pediatrician noted a possible mass in the back of the eye and made an urgent referral to an ophthalmologist, who identified the presence of a retinal lesion in the right eye. The left eye appeared normal upon exam. A follow-­up brain

5. Pediatric Tumor Predisposition Syndromes

263

MRI confirmed the retinal lesion and also detected possible lesions in the brain. Koji was then referred to pediatric oncology. At his initial oncology visit, the oncology team explained the implications of the MRI findings and the possible courses of action. The differential diagnosis included unilateral retinoblastoma (RB) with possible brain metastasis or tuberous sclerosis complex (TSC), which is associated with retinal hamartomas and cortical tubers. A diagnosis of RB would require an immediate and aggressive treatment plan, while a diagnosis of TSC would likely lead to a watch and wait response. Therefore, an urgent genetic consultation was requested. The genetic counselor met with Koji and his parents the next day. While Koji slept peacefully on his mother’s shoulder, the counselor discussed the need for genetic testing to clarify the diagnosis. The child’s parents were in their early 30s and there was no history of cancer on either side of the family. Both parents are from Tokyo, Japan and they plan to be in the United States for at least 2 years due to the father’s work contract at a technology start-­up firm. They have a daughter, age 3, who is healthy. The parents were very quiet during the counselor’s explanation of the ­testing process and description of the three genes (RB1, TSC1, and TSC2) that would be analyzed. They asked only one question: “When will the results be back?” The counselor promised to mark the test as urgent and that the results should be back in 7–10 days. The counselor felt as though the parents were barely able to focus on the conversation; however, they agreed to the genetic tests and signed the consent form. The counselor also spoke to the oncology team, who were debating whether to start chemotherapy at that time based on concerns about waiting even 1 week if the diagnosis turned out to be retinoblastoma. They ultimately decided to do follow­up imaging studies to determine the rate of tumor growth. Follow-­Up: One week later the counselor met with Koji’s parents to disclose the genetic testing results and told them that the testing had revealed a pathogenic variant in the TSC2 gene. The  TSC1 and RB1 results were negative. The counselor discussed the features of tuberous ­sclerosis complex with the parents and stressed the importance of maintaining vigilant surveillance over  time. Although the parents remained concerned about the diagnosis of TSC and further tumor risks, their main reaction was relief that the eye tumor did not require immediate treatment or surgery. The counselor also checked in with the oncology team regarding Koji’s recent imaging studies, which had not detected significant changes in the lesions, and described the baseline screening recommendations for children with TSC. The parents and the patient’s older sister all tested negative for the TSC2 pathogenic variant; however, the counselor mentioned the small risk of gonadal mosaicism in terms of risks for future offspring. The counselor has stayed in close contact with the family and will see them when Koji returns for his next cancer genetics clinic appointment. Case Discussion: Parents may react in very different ways to the onslaught of information that comes with a possible cancer diagnosis. However, most parents describe feeling overwhelmed at times, especially in the first few weeks when so much is uncertain. The diagnostic workup may require multiple tests and medical appointments, and the final diagnosis (and ensuing treatment plan) may change rapidly depending on the latest set of lab results. In this case example, the counselor found the parents unable to fully focus on the discussion about the ­genetic test and possible genetic syndromes, which is not surprising given what was going on with their son. However, they did understand the potential importance of the genetic test in

264

Counseling About Cancer

helping clarify the diagnosis and the counselor deemed this to be sufficient for the initial encounter. Alternatively, in cases where genetic testing results are less likely to impact the cancer diagnosis or treatment plan, it may be more appropriate for counselors to remind parents that they can defer testing decisions until they are more emotionally able to sift through the information. In this particular case, the counselor knew that there was a high likelihood of identifying a relevant pathogenic variant and that there would be additional opportunities to ­provide the family with the necessary information. 5.3.2.  Case 2: Counseling About a Pulmonary Lesion Case Presentation: The genetic counselor was asked to meet with Amaal, an 6-­year-­old female child, who was recently diagnosed with a lung sarcoma like-­tumor, to discuss the option of the genetic testing. The counselor entered the consult room and was surprised to see an entire group of people of different ages, some sitting and some standing. Introductions were made and she learned that those present included the child’s parents, the maternal grandparents, a family friend, the patient’s two young siblings, and an Arabic interpreter—­the only one missing was Amaal. She was currently in the hospital receiving high-­dose chemotherapy. The counselor explained the purpose of the genetics referral and asked if anyone had questions. The family asked many questions, most of which centered on the treatment regimen and prognosis. Gently, the counselor explained that these questions were best answered by the child’s oncology team. However, she attempted to provide general answers when she could and she promised to relay the questions to Amaal’s oncology team while also reminding the family that sometimes there were no satisfying answers to the questions they were asking. The counselor then steered the conversation back to the purpose of the genetics visit and collected the family history information. The parents were in their mid 30s and had three children, ages 6, 3, and 2. A maternal aunt had undergone a thyroidectomy at age 18 due to thyroid nodules and a maternal great-­aunt had died from leukemia in her 20s. There was no history of cancer on the father’s side of the family. The parents are distant cousins (second cousins once removed). They are from Saudi Arabia. The family recently moved to the United States so that the patient’s father could complete his biochemistry post-­doc at the local university. The patient’s father spoke English while the others did not. With the assistance of the Arabic interpreter, the counselor discussed the option of multigene panel testing and why the results might be useful, both in terms of treatment options and future surveillance. She specifically discussed the DICER1 and TP53 genes and their associated syndromes. She also discussed the limitations and risks of testing, including the likelihood of identifying variants of uncertain significance (VUS). The parents were eager to pursue testing and expressed the view that they wanted as much information as possible about their daughter’s tumor risks. They signed consent for the panel test and the counselor arranged for the blood to be drawn prior to her next chemotherapy treatment. Follow-­Up: The counselor disclosed the results to the patient’s father by telephone per the family’s request. The panel testing revealed a pathogenic variant in the DICER1 gene. Amaal and her family came in to the pediatric cancer genetics clinic a few weeks later to discuss the DICER1 result. The counselor reviewed the actual test result and arranged testing for the parents and their other children. The program oncologist discussed the current surveillance protocol for

5. Pediatric Tumor Predisposition Syndromes

265

c­ hildren with DICER1 syndrome, which begins soon after birth, but deferred questions about active treatment to the child’s primary oncology team. The patient’s mother tested positive for the DICER1 pathogenic variant. The patient’s 2-­year-­old sister also carries the familial DICER1 pathogenic variant and her initial lung C ­ T-­exam revealed a stage 1 PPB, which was successfully resected. Case Discussion: Discussions about genetic testing add a layer of complexity to an already confusing diagnostic and treatment process. This process may be especially challenging for families who do not have experiences in American medical centers and/or do not speak English as their primary language. It is also challenging to provide genetic testing information to multiple individuals, all of whom may have varying levels of understanding about genetics. In this scenario, the counselor tried to focus most of her attention on the two parents, although the mother was often distracted by the two young children in the room and many of the questions came from the others in the room. It was helpful for the genetic counselor to recognize that there would be additional opportunities to discuss the genetic testing results in regard to the patient and also other family members. The counselor was initially uncertain about whether this family would be interested in ­pursuing genetic testing, since they seemed understandably overwhelmed and anxious about the child’s initial chemotherapy treatment and because sometimes Middle Eastern religions seem to clash with genetic testing options. However, this family was eager to pursue genetic testing both for the proband and also for other relatives.

5.4.  Discussion Questions Question 1: Your patient, age 12, emigrated from Haiti with her parents and siblings last year. At age 8, she had been diagnosed with a glioma, which was successfully resected. Her family history consists of an older brother, age 15, who was diagnosed with T-­cell lymphoma at age 14, and a younger brother, age 6, who has four café au lait macules. a. Name the gene(s) and syndrome(s) that are most likely given this patient’s personal and family history. b. What genetic tests would you recommend for this patient and/or family? c. The parents request that you order the genetic testing without discussing it with the patient, because they are concerned that the information will be very distressing to her. How would you handle this request and how would you explain your reasoning to the parents? Question 2: Your patient, age 2, is referred to your clinic because of chronic anemia, failure to thrive, multiple hospitalizations for infections, and pancreatic insufficiency. a. Which syndrome is most likely given this child’s constellation of features? What additional questions would you ask about the patient’s personal and family history? b. To confirm the diagnosis, what genetic test(s) would you order? c. The genetic testing results are positive. How would you disclose the results to the family? What are the implications for this child’s treatment plan and also for other relatives?

266

Counseling About Cancer

Question 3: Your patient, age 4, was recently diagnosed with a rhabdomyosarcoma of the bladder. You meet the patient with his foster parents who have been caring for the child for the past 3  months. There is limited information about the child’s biological relatives, although the biological mother reportedly had a sibling who died in childhood from some type of cancer. The patient has two maternal half-­siblings, ages 3 months and 2 years, who are also in foster care. a. Which genes and syndromes would you consider given this patient’s cancer diagnosis? In what ways would the genetic testing results alter the treatment plan and/or future cancer surveillance for this child? b. You agree to arrange genetic testing for this patient. Are the foster parents able to provide testing consent for this child? If not, then who would need to sign the consent form? If it is not clear, how would you go about determining the legal guardianship of this child? c. The genetic testing reveals a pathogenic variant. Pick one of the likely genes/ syndromes and explain them to the foster parents (and/or other guardians). What strategies would you employ to disseminate the genetic test results to the patient’s biological mother and half siblings? Question 4: You meet with a patient, age 28, who had bilateral Wilms tumor, which was diagnosed at age 6 months. He has not had genetic testing. He and his partner are interested in starting a family and want to know the risk of a future child developing cancer. a. How would you explain to this couple about the possible genetic causes of Wilms tumor and the possible risks to their future offspring? b. What is the likelihood that this patient carries a WT1 pathogenic variant? What other “red flags” would you look for in the patient’s personal or family history? c. Explain the reproductive genetic testing options if the patient tests positive for a WT1 pathogenic variant. Also describe the recommended surveillance plan for future children if the couple do not pursue prior reproductive testing.

5.5.  Further Reading Adam MP, Everman DB, Mirzaa GM, et  al. editors. GeneReviews® [Internet]. Seattle (WA): University of Washington, Seattle; 1993–2022. Available from: https://www.ncbi.nlm.nih.gov/books/NBK1116/. American Association for Cancer Research (AACR) pediatric oncology series on the management of children with pediatric tumor predisposition syndromes. Clinical Cancer Research. 2017;23(11). Amirifar P, Ranjouri MR, Yazdani R, Abolhassani H, Aghamohammadi A. Ataxia-telangiectasia: A review of clinical features and molecular pathology. Pediatr Allergy Immunol. 2019 May;30(3):277–288. doi: 10.1111/pai.13020. Epub 2019 Mar 20. PMID: 30685876. Black JO. Xeroderma Pigmentosum. Head Neck Pathol. 2016 Jun;10(2):139–44. doi: 10.1007/s12105-016-07078. Epub 2016 Mar 14. PMID: 26975629; PMCID: PMC4838978.B. Bougeard G, Renaux-­Petel M, Flaman J-­M et al. Revisiting Li-­Fraumeni syndrome from TP53 mutation carriers. Journal of Clinical Oncology. 2015;33:2345–2352. Brioude F, Kalish JM, Mussa A. Expert consensus document: Clinical and molecular diagnosis, screening and management of Beckwith-­Wiedemann syndrome: an international consensus statement. Nature Reviews Endocrinology. 2018;14(4):229–249.

5. Pediatric Tumor Predisposition Syndromes

267

Cunniff C, Bassetti JA, and Ellis NA. Bloom’s syndrome: Clinical spectrum, molecular pathogenesis and cancer predisposition. Molecular Syndromology. 217;8(1):4–23. Da Costa L, Leblanc T, Mohandas N. Diamond-Blackfan anemia. Blood. 2020 Sep;136(11):1262–1273. doi: 10.1182/blood.2019000947. PMID: 32702755; PMCID: PMC7483438. Del Baldo G, Carta R, Alessi I, et al. Rhabdoid Tumor Predisposition Syndrome: From Clinical Suspicion to General Management. Front Oncol. 2021 Feb;11:586288. doi: 10.3389/fonc.2021.586288. PMID: 33692948; PMCID: PMC7937887. Fiesco-Roa MO, Giri N, McReynolds LJ, Best AF, Alter BP. Genotype-phenotype associations in Fanconi anemia: A literature review. Blood Rev. 2019 Sep;37:100589. doi: 10.1016/j.blre.2019.100589. Epub 2019 Jul 16. PMID: 31351673; PMCID: PMC6730648. Frebourg T, Lagercrantz SB. Guidelines for the Li-­Fraumeni and heritable TP53-­related cancer syndromes. European Journal of Human Genetics. 2020;28:1379–1386. Hamadou WS, Bouali N, Besbes S, et al. An overview of genetic predisposition to familial hematological malignancies. Bull Cancer. 2021 Jul–Aug;108(7–8):718–724. doi: 10.1016/j.bulcan.2021.03.013. Epub 2021 May 26. PMID: 34052033. Hamosh A, Scott AF, Amberger J, Valle D, McKusick VA. Online Mendelian Inheritance in Man (OMIM). Hum Mutat. 2000;15(1):57–61. doi: 10.1002/(SICI)1098-1004(200001)15:13.0.CO;2-G. PMID: 10612823. Hol JA, Jongmans MCJ, Sudour-Bonnange H, et al. Retinoblastoma and Neuroblastoma Predisposition and Surveillance. Clin Cancer Res. 2017 Jul;23(13):e98–e106. doi: 10.1158/1078-0432.CCR-17-0652. PMID: 28674118; PMCID: PMC7266051. Hol JA, Jongmans MCJ, Sudour-Bonnange H, et al. Clinical characteristics and outcomes of children with WAGR syndrome and Wilms tumor and/or nephroblastomatosis: The 30-year SIOP-RTSG experience. Cancer. 2021 Feb;127(4):628–638. doi: 10.1002/cncr.33304. Epub 2020 Nov 4. PMID: 33146894; PMCID: PMC7894534. Matson DR, Yang DT. Autoimmune Lymphoproliferative Syndrome: An Overview. Arch Pathol Lab Med. 2020 Feb;144(2):245–251. doi: 10.5858/arpa.2018-0190-RS. Epub 2019 Apr 8. PMID: 30958694. Niewisch MR, Savage SA. An update on the biology and management of dyskeratosis congenita and related telomere biology disorders. Expert Rev Hematol. 2019 Dec;12(12):1037–1052. doi: 10.1080/ 17474086.2019.1662720. Epub 2019 Sep 10. PMID: 31478401; PMCID: PMC9400112. Notaro K, Pierce B. Tuberous sclerosiscomplex: A multisystem disorder. JAAPA. 2021 Mar;34(3):28–33. doi: 10.1097/01.JAA.0000733220.26720.62. PMID: 33528170. Ripperger T, Bielack SS, Borkhardt A, et al. Childhood cancer predisposition syndromes—­a concise review and recommendations by the Cancer Predisposition working group for the Society for Pediatric Oncology and Hematology. American Journal of Medical Genetics. 2017;173:1017–1037. Schultz KAP, Williams GM, Kamihara J, et al. DICER1 and Associated Conditions: Identification of At-risk Individuals and Recommended Surveillance Strategies. Clin Cancer Res. 2018 May;24(10):2251–2261. doi: 10.1158/1078-0432.CCR-17-3089. Epub 2018 Jan 17. PMID: 29343557; PMCID: PMC6260592. Scollon S, Anglin AK, Thomas, M, et al. A comprehensive review of pediatric tumors and associated cancer predisposition syndromes. Journal of Genetic Counseling. 2017;26:387–434. Wimmer K, Kratz CP, Vasen HF. Diagnostic criteria for constitutional mismatch repair deficiency syndrome: suggestions of the European consortium “care for CMMRD” (C4CMMRD). Journal of Medical Genetics. 2014;51(6):355–365.

CHAPTER

6 Cancer Family Histories (Collection and Interpretation)

The more you know your history, the more liberated you are. —­Maya Angelou (Huffington Post Black Voices, 2/2012)

The careful collection and interpretation of the patient’s personal and family history of cancer is an essential element of the cancer genetic counseling session. Traditionally, the family history has been collected at the beginning of the genetic counseling session to help in risk assessment and establishing rapport. With changes in genetic counseling service delivery models, h ­ owever, the family history placement in the genetic counseling session has evolved. This chapter provides current strategies for collecting a comprehensive cancer history and describes challenges that can arise in the process. This chapter also discusses ways to assess and classify cancer histories and ends with two case examples.

6.1.  Collecting a Cancer History Taking a comprehensive cancer history involves asking patients a systematic series of questions to gather relevant personal and family medical information. Being able to take an accurate and complete family history is considered one of the most important skills acquired by genetic counselors. This section begins with the definition and purpose of a cancer pedigree, describes the key elements of taking a cancer history, including helpful tips for gathering this information (see Table 6.1), and ends with ways to confirm the cancer diagnoses. Counseling About Cancer: Strategies for Genetic Counseling, Fourth Edition. Katherine A. Schneider, Anu Chittenden, and Kristen Mahoney Shannon. © 2023 John Wiley & Sons Ltd. Published 2023 by John Wiley & Sons Ltd.

269

270

Counseling About Cancer

TABLE 6.1.  Helpful Hints for Collecting a Family Cancer History •• •• •• •• •• •• •• •• •• •• •• ••

Keep your questions simple and specific Ask one question at a time in a systematic fashion Watch your terminology; avoid medical jargon Know the purpose of each question in case the patient wants to know why you are asking Adapt your questions to the patient’s needs, gender identity, and cultural background Avoid “why” questions that may be viewed as judgmental Know when it is appropriate—­and not appropriate—­to use shortcuts Gently control or guide the process; manage the time effectively Listen to the patient’s answers and ask them to clarify their responses if you are not sure what they are talking about Avoid interrupting patient answers, but allow the patient to interrupt you Allow for moments of silence during the process particularly during sensitive moments; don’t fill with unnecessary questions Acknowledge recent events that have occurred in the patient’s family; this will humanize the patient’s story

Sources: Veach et al. (2003, pp. 75–78); Schuette and Bennett (2009, p. 53).

6.1.1. Inclusivity In order for the genetic counselor to provide culturally effective, patient-­centered genetic care, it is imperative that the entire genetic counseling session promote inclusivity. This is especially important during the collection of the personal and family medical history, when the genetic counselor is establishing rapport with the patient. The genetic counselor should always use preferred pronouns for all individuals in the family and ensure that the pedigree includes the best representation of gender identity and sex. Understanding and accurately representing an individual’s gender identity have important health implications from a psychosocial perspective. It is important to recognize that the organs and hormones an individual has are more relevant to a cancer risk assessment than their sex assigned at birth, and thus should be recorded as well when taking the family history. The terms sex and gender are not interchangeable. Sex refers to biological attributes whereas gender is a social and cultural construct that ascribes different roles, characteristics, and values in relation to the sex assigned at birth. The term gender identity is used to describe an individual’s personal concept of their gender, such as identifying as male, female, both male and female, neither male or female, or something else. The term transgender can be used to describe individuals whose gender identity does not align with their sex assigned at birth. Individuals who do not identify with either male or female gender identities may use terms like nonbinary or gender nonconforming to reflect that they do not identify with the binary nature of male and female gender identities. At this time, there are inconsistent practices with regard to pedigree symbol representation when it comes to gender identity. The National Society of Genetic Counselors (NSGC), however, has recently agreed on the notation shown in Figure 6.1 as the most appropriate way to denote a person’s gender identity while taking a pedigree.

271

6. Cancer Family Histories (Collection and Interpretation)

Gender

Sex Male

Female

Unassigned at Birth

Man/Boy 56y

AFAB 34y

UAAB 28y

AMAB 56y

34y

UAAB 28y

AMAB 56y

AFAB 34y

UAAB 28y

Woman/Girl

Non-binary/Gender Diverse

FIGURE 6.1.  Sex and Gender in Pedigree Nomenclature. Source: Bennett et al. J Genet Couns. 2022;00:1–11.

6.1.2.  The Definition and Purpose of the Pedigree Genetic counselors collect relevant family history information from their patients and convert the information into pictorial form by the construction of a pedigree. A pedigree is a diagram of standardized lines and symbols that demonstrates the biological relationships, medical conditions, and other pertinent information within a family. Please refer to the National Society of Genetic Counselors (NSGC) Practice Resource for current pedigree nomenclature. Many clinical cancer genetics programs have developed shorthand for representing tumor types by shading the symbols using a “quadrant” system. Figure 6.2 shows one example that is used in the Cancer Genetics and Prevention Center at the Dana-­Farber Cancer Institute as well as the Center for Cancer Risk Assessment at Massachusetts General Hospital. Family history collection involves asking a series of both open-­ended and targeted questions (see Table 6.2) and then carefully listening to and recording the patient’s responses. Creating a family pedigree serves many purposes for genetic counselors as presented in the succeeding sections. 6.1.2.1.  Identify a Cancer Syndrome One significant aim of gathering personal and family history information during a cancer counseling session is to determine whether a patient could have a specific hereditary cancer syndrome. Clinical criteria have been established for a number of hereditary cancer syndromes such as familial adenomatous polyposis (FAP), Lynch syndrome, and Cowden syndrome, which can be useful in formulating targeted questions to ask patients for the purposes of risk assessment. An example of breast cancer questions is provided in Table 6.2 and additional questions should be formulated from the syndrome-­specific entries in Chapters 2–5.

272

Counseling About Cancer

NAME: Diagnosis: Date obtained: Clinic: Ethnicity:

MED RECORD#:

CNS 80

LG65

78

80 CO 50

80 BR 55

KID 60

OV 45 CO polyp-A 40 Quadrant system

Breast cancer

Miscellaneous cancer

Genitourinary Gastrointestinal cancer cancer

Female with confirmed cancer Male with unconfirmed cancer Female with precancerous condition Legend of cancer abbreviations: BR – breast cancer, invasive KID – kidney cancer CNS – brain tumor, unspecified type LG – lung cancer CO – colon cancer OV – ovarian cancer CO polyp A – colorectal adenoma

FIGURE 6.2.  An example of the cancer pedigree quadrant system. This template form has been provided courtesy of Dr. Judy Garber, Director of the Cancer Genetics and Prevention Center, Dana-­Farber Cancer Institute, Boston, MA.

6. Cancer Family Histories (Collection and Interpretation)

273

TABLE 6.2.  Sample Questions to Ask During Pedigree Construction ELICITING GENERAL CANCER HISTORY Is your relative still living or are they deceased? •• If alive: How old is your relative now? •• If deceased: At what age did your relative die? What did your relative die of? •• Did your relative ever have cancer? •• Do you know what type of cancer your relative had? •• Do you know where (in what organ) the cancer started? •• Do you know the exact name of the cancer? •• How old was your relative when diagnosed with cancer? OR •• How long ago/how long before their death was your relative diagnosed with cancer? •• Do you know what kind of cancer treatments your relative had? •• Did your relative ever have genetic testing? •• If yes: Do you know what type of genetic testing your relative had? Do you know what the results were? Would it be possible for you to ask your relative for a copy of the genetic test results? •• If no: Do you know if your relative was ever offered genetic testing? Did your relative ever meet with a genetic counselor? •• Was your relative exposed to any harmful agents that might have caused the cancer? •• Did your relative smoke cigarettes? •• What did your relative do for work? •• Did your relative’s physician ever say what might have caused the cancer? ••

FOLLOW-­UP QUESTIONS WHEN A PATIENT HAS BREAST CANCER Transition: “You mentioned that several people in your family have had breast cancer. Let’s focus on your sister’s recent diagnosis of breast cancer.” •• Is the cancer in one breast or both breasts? •• Where in the breast did the cancer originate—­in the ducts or the lobules? •• How was the breast cancer staged? •• Is the tumor estrogen-­or progesterone-­receptor positive or is it triple negative? •• Does the tumor have the growth factor called Her2/neu? •• Did your relative’s physician mention that there was anything unusual about the tumor? •• How was your sister’s breast cancer found? Did she have any symptoms? •• What is the plan for treating your sister’s cancer? •• How is your sister doing? How is the rest of the family dealing with it? How are you doing? •• Had your sister ever had any prior problems with her breasts? •• Does your sister have any other major health problems? •• Was your sister ever exposed to a lot of radiation? Does she smoke cigarettes or drink a lot of alcohol? Could she have been exposed to any harmful agents (carcinogens) at work or at home? FOLLOW-­UP QUESTIONS WHEN HBOC IS IN DIFFERENTIAL Transition: “Some families have an inherited predisposition to breast cancer. This series of questions will help me figure out if your family could have one of the hereditary breast cancer conditions.” Continued 

274

Counseling About Cancer

TABLE 6.2.  Sample Questions to Ask During Pedigree Construction—Continued •• •• •• •• •• •• •• •• •• •• •• •• •• •• •• •• •• •• ••

Has anyone in your family had ovarian cancer? Has anyone in your family had pancreatic cancer? Has anyone in your family had prostate cancer? Has anyone in your family had two separate cancer diagnoses, like bilateral breast cancer or breast and ovarian cancer? Have any men in your family been diagnosed with breast cancer? Does anyone in your family have any unusual skin lesions? Any birthmarks? Any moles that had to be removed? Does anyone in your family have a large-­sized head or have difficulty buying hats? Has anyone in your family had any fatty tumors (lipomas) removed? Has anyone in your family had thyroid cancer? Has anyone had a goiter? Has anyone had thyroid surgery? Has anyone in your family been diagnosed with autism? Does anyone in your family have high blood pressure that has been difficult to control by medication? Has anyone in your family died unexpectedly from a stroke? On the operating table? In childbirth? Are there any children in your family who have been diagnosed with cancer? Were there any children in your family who died at young ages? Do you know what they died of? Has anyone in your family had cancer of the bone or soft tissue (muscle)? Has anyone in your family had a brain tumor? Has anyone in your family had cancer that was diagnosed under age 45? Has anyone in your family had colon cancer? Does anyone have cancer of the rectum, small intestine, or stomach? Has anyone in your family been found to have a noncancerous growth (a polyp) in their colon or rectum? Any polyps found elsewhere in the digestive tract? •• If yes: Do you know what types of polyps were found? Would you be able to obtain a copy of the pathology report on the polyps? When was your relative told to have another colonoscopy? •• If no: Has anyone in the family had colon cancer screening with a sigmoidoscopy or colonoscopy?

ENDING THE FAMILY HISTORY COLLECTION •• Are there any other relatives who had cancer that I did not ask about? •• Are there any children in the family who were born with serious birth defects or who died young? •• Are you having any type of cancer screening? •• If yes: What types of tests were performed? What were the dates of your most recent screening tests? What were the results of these screening tests? Can you obtain copies of these results and send them to me? When are you scheduled to have these tests performed again? •• If no: Have you spoken to your physician about being screened? At what age are you planning to initiate screening? •• What is the ethnicity of your mother’s family? What is the ethnicity of your father’s family? •• Are you of Eastern European (Ashkenazi) Jewish ancestry? •• Is there any chance that you and your husband might be related to each other? •• Is there any chance that your parents or grandparents might be cousins (or other types of relations) who married? •• Is there anything I did not ask about that you think I should include in the family tree?

6. Cancer Family Histories (Collection and Interpretation)

275

6.1.2.2.  Determine the Need for and Type of Genetic Testing If collected prior to the individual’s genetic testing, the patient’s family history can help guide the risk assessment portion of a genetic counseling session (see Chapter 7) and identify the most informative member(s) of the family to test. The family history can also help determine whether an individual meets criteria for a clinical diagnosis of a given syndrome (see Chapters 2–5) and provides information on whether an individual meets criteria for insurance coverage of the ­genetic test. In addition, the cancer family history often will guide the genetic counselor as to what type of genetic testing (i.e., single syndrome, panel, exome) should be ordered (see Chapter 8). 6.1.2.3.  Assist with Management Recommendations When managing individuals at high risk for inherited cancers, clinicians need to be guided not only by the genetic test results but also by the person’s family history. Even in highly penetrant hereditary cancer syndromes with established medical management guidelines, clinicians must consider the specific pattern of cancer in the patient’s family. For example, an individual with a BRCA2 pathogenic variant is often only offered pancreatic cancer screening if there is a diagnosis of pancreatic cancer in the family. For patients who have a pathogenic variant in a moderately penetrant gene, the family history helps guide clinical management as well. For example, the evidence regarding the utility of risk-­reducing mastectomy (RRM) in an individual with a CHEK2 pathogenic variant is insufficient and guidelines recommend using the family history to help guide this discussion. In an individual with a CHEK2 pathogenic variant whose family history shows multiple early onset, lethal breast cancers, for example, the consideration of RRM might be more heavily weighted. Finally, and perhaps most importantly, the family history is essential in discussing management options with individuals who test negative for pathogenic variants. Consider the example of a patient with a paternal family history of an MSH2 pathogenic variant and a mother who was diagnosed with colon cancer at age 50. Even if this patient tests negative for a colon cancer gene panel (that includes the MSH2 pathogenic variant), they should not be given standard colon cancer screening recommendations. Although they are considered a true negative for the MSH2 pathogenic variant, their mother’s diagnosis indicates that they should start colonoscopic screening at age 40 (not age 45, which is the general population guideline). 6.1.2.4.  Uncover Other Syndromes Almost all cancer genetic counselors have had the experience of patients (or their physicians) indicating a specific syndrome on the initial intake form only to find out upon taking the family history that the patient has an entirely different genetic condition. For example, a patient who has been referred for BRCA testing because of a family history of ovarian cancer may turn out to have Lynch syndrome after careful inquiry of the family history reveals cases of colon cancer. In addition, collecting the family history information may reveal features of other non-cancer

276

Counseling About Cancer

genetic disorders, which would benefit from further discussions or referrals. Examples include striking histories of miscarriages, birth defects, mental illness, cardiac or respiratory problems, or Alzheimer disease. Guidelines for referral for further risk assessment for many conditions have been published by professional societies such as NSGC and the American College of Obstetricians and Gynecologists (ACOG). 6.1.2.5.  Identify the Disorder’s Inheritance Pattern and Other Relatives at Risk A cancer pedigree should contain available information about individuals with and without cancer over three or more generations on both the paternal and maternal sides of the family. Thus, the pattern of the disorder—­as well as the biological relationships—­in a family can be quickly and accurately assessed by glancing at a single page. This information may be useful in determining the likelihood of a dominant or recessive single-­gene disorder. For example, three siblings with multiple colon adenomas are more likely to have an autosomal recessive polyposis syndrome than a family with colon adenomas in a grandfather, father, and child lineage. A complete pedigree can also delineate the blood relatives who are potentially at risk for inheriting a pathogenic variant in a cancer predisposition gene and should be offered genetic counseling and testing. 6.1.2.6.  Develop a Useful Counseling Aid Reviewing the completed pedigree with the patient is an important counseling technique in that it can be used to illustrate various points during the discussions about risk and testing, including: •• •• •• ••

The inheritance pattern of a hereditary cancer syndrome The associated malignancies and other features of a cancer syndrome The specific relatives who are potentially at risk for having the condition The individual who is the most informative person to test initially

6.1.2.7.  Create an Important Clinical Record and Research Tool A pedigree is a valuable record of family history information that can be reviewed and updated over time. The use of the pedigree’s standardized format and symbols makes the information easily viewed and accessible to other clinicians. Many clinical genetic counseling programs utilize pedigree software or databases that store all their clinical information. In these cases, programs can search their pedigree database for the number of families who have pancreatic cancer and have been found to carry BRCA pathogenic variants, for example. Aggregate pedigree data can help guide clinical policies and formulate ideas for clinical research. Pedigrees are essential in this era of gene panel testing as clinicians learn more and more about the phenotype of specific syndromes. Patients whose family histories are not consistent with Li-­Fraumeni syndrome (LFS), for example, are testing positive for TP53 pathogenic variants. It is important that these patients’ family histories are collated, compared, and shared to develop a more robust phenotypic description of LFS.

6. Cancer Family Histories (Collection and Interpretation)

277

6.1.2.8.  Become Aware of Family Dynamics and Level of Support A pedigree indicates important relationship information, including the patient’s degree of relatedness to relatives with cancer, the number and gender of relatives in each generation, and whether relatives are living or deceased. The process of gathering this information can lay the foundation for obtaining a psychosocial assessment and learning more about the patient’s emotional relationships with their relatives. There are tools that can help with this assessment, such as a genogram or colored eco-­genetic relationship map (CEGRM). 6.1.2.9.  Hear the Patient’s Family Stories Most families have a story to tell about a loved one’s cancer experience. Hearing the details about the death of a relative with advanced cancer may not have relevance for the identification of a cancer syndrome, but provides important context when counseling the patient. Listening to the family stories may provide genetic counselors with a great deal of information about their patients regarding: •• •• •• •• •• •• •• ••

Their purpose for seeking genetic counseling or testing Their thoughts about what is important or relevant Their use of “magical thinking” or family myths to explain the cancer in the family Their knowledge of the cancer history and awareness of a genetic link Their readiness to hear that they are at risk Their reactions and emotions brought up by telling the stories Their level of trust in the medical system and in cancer screening regimens Their attitudes toward genetic testing

Aspects of these personal experiences can raise the genetic counselor’s awareness of what information might be meaningful to the patient and enable the genetic counselor to tailor the discussions of genetic risk and testing by keeping the patient’s own concerns in mind. 6.1.2.10.  Assess the Patient’s Emotional State Patients may present to the cancer genetic counseling session with a variety of different emotions, including fear, confusion, anger, determination, or eagerness. The emotions and reactions observed during the recounting of family stories are helpful to the genetic counselor in ascertaining the patient’s level of distress and any potential vulnerability. This awareness will help the genetic counselor to determine how best to broach or discuss certain issues during the ensuing discussion. 6.1.2.11.  Set the Tone for the Session Patients are frequently nervous or tense at the beginning of the cancer genetic counseling session. The systematic—­yet friendly—­question-­and-­answer format of the family history interview can help put people at ease. In addition, listening with interest and empathy to the patient’s responses can establish a level of trust and rapport that is critical to the work that goes on later in the session.

278

Counseling About Cancer

6.1.3.  Key Elements of a Comprehensive Cancer History Collection of the family history information historically occurs near the beginning of a cancer genetic counseling session. Most genetic counselors open the discussion by briefly describing the overall nature and purpose of the family history questions. It is important to reassure the patient that it is not a ‘test’ and that any amount of information about the family history they know is enough for the initial session. The genetic counselor then gathers information about the patient’s cancer diagnosis or current health status, and continues by asking a similar set of questions regarding each of the patient’s first-­, second-­, and third-­degree relatives. A good rule of thumb is to collect information on all first-­degree relatives of an individual in the family with a cancer diagnosis. The exact order in which information is collected differs from provider to provider. However, it is best to ask questions in a systematic manner (e.g., siblings and their children, then parents, then relatives on one side before proceeding to the other side of the family) rather than skipping around to different relatives. Sometimes patients will report the information in an erratic fashion, and it is important that the genetic counselor try and refocus so as not to forget individuals in the family or their diagnoses. The major pieces of information to collect during a cancer family history intake are described in the following sections. (Also see Table 6.2.) 6.1.3.1.  Cancer Diagnosis The focus of the family history intake is to learn which individuals in the family have had cancer. Since hereditary cancer syndromes tend to be associated with specific tumor types or histology, the more specific the information, the better. Ideally, a patient would be able to provide precise information, such as, “My mother was diagnosed with a neuroendocrine tumor of the pancreas at age 51.” Realistically, a patient is more likely to provide less specific information, for example, “My mother died of pancreatic cancer in her 50s.” Sometimes the patient has only vague information about the diagnosis, such as: “My mother had some type of abdominal cancer and died in her 50s.” Patients should be encouraged to bring in written documentation of the cancer diagnoses in their family, if available. (Section 6.1.5 discusses strategies for confirming pedigree information.) If a patient mentions that a relative had two or more types of cancer, it is important to determine whether the malignancies represent separate primaries or metastatic disease. Lastly, depending on the type of cancer mentioned, other features may be important as well. For example, it would be important to document if a relative had triple negative (ER/PR/HER2 negative) breast cancer as opposed to a receptor positive tumor as it may impact risk assessment of a gene pathogenic variant probability. 6.1.3.2.  Ages and Dates The age at which an individual was diagnosed with cancer is one of the key elements in determining the likelihood of a hereditary cancer syndrome. The convention is to note the age that the cancer was formally diagnosed, not the age at which symptoms began. Other useful ages and dates to obtain include: ••

The approximate date (year) that the cancer was diagnosed

••

The current age of the patient

6. Cancer Family Histories (Collection and Interpretation)

•• ••

279

The current ages of living relatives The age of death for deceased relatives

The age at which an individual was diagnosed with cancer is also an important factor in determining appropriate medical management once the risk assessment has been completed. For example, even with many well-­ characterized hereditary colon cancer syndromes, the management criteria will advise that colonoscopies begin at a specific age “or 10 years younger than the earliest cancer diagnosis in the family.” Patients may be more likely to remember a relative’s current age or age at the time of death than the relative’s age at the time of diagnosis. If this is the case, it may be helpful to ask if the relative was diagnosed within a few years of their death or was diagnosed many years earlier. The dates of cancer diagnoses or death may be helpful in efforts to obtain a pathology report or death certificate, as well as in investigating the possibility of obtaining tumor specimen blocks for individuals who died within the past 10–20 years for tumor confirmation or genetic studies. 6.1.3.3.  Cancer Treatment and Follow-­Up Standard methods of treating cancer include surgery, chemotherapy, and radiation. In some instances, inquiring about treatment may be helpful in assessing the risks of subsequent treatment-­related cancers. For example, children with hereditary retinoblastoma have increased risks of sarcoma; these risks are magnified if they underwent radiation treatments. It may also be helpful to learn whether recommendations have been made regarding future cancer monitoring. Inquiring about cancer screening history, particularly screening intervals, can help the ­genetic counselor narrow down the patient’s risk for a particular cancer based on physical findings, such as colonoscopy intervals and colon polyps history. If a patient reports being diagnosed with “colon polyps” and reports that their doctor recommended screening colonoscopy every 10 years, for example, it is not likely that the colon polyps are adenomatous, as the screening interval for patients with adenomatous polyps is far shorter than every 10 years. The same principle may apply to the frequency and findings on dermatology exams. If the patient is unsure about a particular cancer diagnosis or is using unusual terminology, then learning some details about the treatment and follow-­up may help clarify the nature of the diagnosis. For example, if a patient reports that that their mother had ovarian cancer at age 30 but did not require full hysterectomy, it is unlikely that the ovarian cancer was in fact an epithelial ovarian cancer. 6.1.3.4.  Status and Prognosis While taking the family history, it is very important to be aware of the current cancer status and short-­term prognosis if the patient has a diagnosis of cancer. Individuals in active treatment will likely have different motivations and concerns than those who are long-­term survivors or those with recurrent disease. Patients who are seeking genetic testing prior to surgery will often view genetic testing as one of the urgent pieces of information needed to make a surgical plan and may gloss over the importance of the impact on relatives. Patients near end of life will often be

280

Counseling About Cancer

focused on the impact of genetic testing on their family members, and in these cases the genetic counselor should identify an individual who will be receiving the genetic test results if the patient has died by the time they become available. Understanding the current cancer status in a relative with cancer (who might be the most informative person to test first) is also important. If the relative with cancer is overwhelmed with the current treatment regimen or is terminally ill, then it might be helpful to ask the patient to identify another family member who might be able to help coordinate obtaining documentation or specimens for genetic studies. The genetic counselor can also consider whether it would be better to hold off on genetic testing until the family expresses that they are ready to continue with these efforts. 6.1.3.5.  Current Surveillance Practices In many families, patients and relatives will have had some type of baseline cancer screening. In fact, they may even be following a high-­risk surveillance regimen. For patients who have had specific monitoring tests (e.g., colonoscopy), it is useful to obtain the following information: •• •• •• ••

Types of screening tests performed Dates of the screening tests or the person’s age Results of the screening tests including pathology reports (if available) Planned frequency of the screening tests

Whenever possible, the genetic counselor should obtain a written copy of the patient’s screening test results. If the family turns out to have a hereditary cancer syndrome, this information may be useful in determining the patient’s risk status. In addition, these screening tests can be used as baseline practices that may need to be altered, depending on the genetic test results, pattern of cancer in the family, and the patient’s other risk factors. It may also be helpful to obtain information about the patient’s close relatives and their screening regimens, especially if any of the tests yielded abnormal results.

6.1.3.6.  Surgical Procedures There are many surgical procedures that can impact the likelihood that an individual will develop cancer, and thus can impact the interpretation of a family history. When a patient with a BRCA pathogenic variant has their ovaries removed premenopausally, the individual has significantly reduced the likelihood they will develop not only ovarian cancer but also breast cancer. Hormone use/therapy after a surgical procedure could have an impact on cancer risk. For example, a younger age at breast cancer diagnosis has been observed in transgender people compared with cisgender women, and many believe this is due to hormone use after surgical procedure. Identifying at-­risk members within a family identified as having a BRCA pathogenic variant is not always clear due to reduced penetrance, high-­population risk for breast cancer, and sex-­influenced differences in cancer risk. To further complicate matters, surgical history

6. Cancer Family Histories (Collection and Interpretation)

281

may limit clinical interpretation. For example, if a patient is identified as carrying a BRCA1 ­pathogenic variant and reports that their mother died at age 62 without any known history of cancer, the genetic counselor may assume that the mother did not carry the familial pathogenic variant. If, however, the mother had bilateral salpingo-­oophorectomy for a benign condition at age 40, the mother’s risk of carrying the pathogenic variant is higher.

6.1.3.7.  Presence of Noncancerous Features During the family history intake, genetic counselors should ask about other medical conditions and benign lesions. Some hereditary cancer syndromes are associated with observable physical features or other conditions. Examples include: ••

•• •• •• ••

Associated benign lesions—­such as congenital hypertrophy of the retinal pigmented epithelium (CHRPE) in familial adenomatous polyposis (FAP) Physical features—­such as café au lait spots with neurofibromatosis Medical conditions—­such as high blood pressure with pheochromocytomas Behavioral or learning problems—­such as autism with PTEN hamartoma syndrome Birth defects—­such as aniridia with familial Wilms tumor

It is important to record other significant medical conditions and benign lesions when ­collecting the family history, especially if the features appear to be tracking with the cancer occurrences in the family. If the condition in question hinges on a careful physical exam or diagnostic tests, then patients should be referred to a physician who specializes in cancer genetic syndromes. 6.1.3.8.  Relatives without a Diagnosis of Cancer Looking for evidence of an inherited cancer syndrome relies on assessing the number of at-­risk relatives who have gone on to develop cancer. However, a completed pedigree should also include information about the relatives who have not had cancer. A family that includes two siblings with cancer may seem significant until learning that they are part of a sibship of 12. In addition, it is important to document both sides of the family even if it seems obvious which side of the family has the cancer predisposition. Sometimes it turns out that the less compelling side of the family is the one that has the hereditary cancer syndrome. For relatives without cancer, it is useful to obtain the following information: ••

••

••

The relative’s current age or, if deceased, the relative’s age at the time of death and the cause of death Whether the relative has had any relevant cancer screening tests or surgeries that might impact risk Whether the relative might have had any significant, noncancerous features associated with the syndrome in question

282

Counseling About Cancer

6.1.3.9.  Other Cancer Risk Factors There are several established environmental risk factors and modifiable (i.e. lifestyle) risk factors that can increase the risks of specific forms of cancer (refer to Section 1.4). The main modifiable risk factors are sun exposure, alcohol, and tobacco use. Depending on the pattern of cancers in the family, it may be useful for the genetic counselor to ascertain whether an exposure to a specific carcinogen could have contributed to the development of cancer. Examples of environmental risk factors that may cause cancer include: ••

•• ••

••

••

Lifestyle habits—­such as cigarette smoking, which is linked with lung and head and neck cancer Medical conditions—­such as Crohn’s disease, which is linked with colorectal cancer Viruses—­ such as the human papillomavirus (HPV), which is linked with cervical cancer Job-­related carcinogens—­such as asbestos exposure in shipyards or carpentry, which is linked with mesothelioma Environmental carcinogens—­such as sprayed pesticides or toxic dumping, which are linked with clusters of cancer that occur in certain neighborhoods or towns

6.1.3.10.  Psychosocial Factors A patient’s interpretation of risk and decisions about genetic testing are greatly influenced by a variety of psychosocial factors. Therefore, genetic counselors might find it beneficial to gather information about family dynamics, the family’s communication style, and the amount of contact and supportiveness of various relatives. These factors often don’t have to be directly addressed, but an astute genetic counselor can learn a lot about family dynamics just by observing the patient’s behavior and demeanor when answering the family history questions. 6.1.3.11. Ancestry It is important to obtain the patient’s ethnicity (country of origin, nationality, and/or religious affiliation) for each side of the family. Many individuals have mixed ancestry and it may be useful to correlate the ethnicity with the pattern of cancer in the family. This information can, in some cases, help determine the most appropriate genetic tests to order. For example, individuals of Eastern European (Ashkenazi) Jewish ancestry who have any history of breast or ovarian cancer should at least be offered genetic testing for the three BRCA founder pathogenic variants. Individuals of Portuguese ancestry who undergo genetic testing for Lynch syndrome must have testing done at a laboratory whose assay can detect the MSH2 founder pathogenic variant (c.388_389del). Finally, some countries have increased incidence of specific cancers that are ­different than that in North America. For example, a genetic counselor may be slightly less ­suspicious of a family history that has several gastric cancers on one side of the family if they learn that the branch of the family lived in China, where gastric cancer is very common and is often caused by H. pylori infection.

6. Cancer Family Histories (Collection and Interpretation)

283

6.1.4.  Additional Strategies and Helpful Hints Genetic counselors will develop their own methods for collecting family history information. This section presents some additional strategies and helpful hints for counselors. These ­suggestions are geared toward newer genetic counseling colleagues and are not specific to the collection of cancer family histories per se. 6.1.4.1. Inclusivity It is important for the genetic counselor to be inclusive at every step of family history collection. For example, in preparing for the collection the genetic counselor may say, “I’m going to be asking you some questions about your family members. The main things that I’ll be asking are their age, gender, and history of cancer.” The genetic counselor may also choose to include language such as “I’ll be asking about the genders of your relatives. We draw men as squares, women as circles, and nonbinary people as diamonds.” At the end of the pedigree collection, the genetic counselor could ask overarching questions that are relevant to gender inclusivity but also other important information that is helpful for risk assessment. For example, the genetic counselor may ask “Has anyone in your family had multiple colon polyps?,” “Has anyone in your family had their ovaries or uterus removed?,” “Has anyone in your family had their breasts removed?,” or “Do you know if anyone in your family takes hormone therapy with estrogen or testosterone?” 6.1.4.2.  Learn the Art and Skill of Collecting a Family History There is both an art and a skill to effectively collecting a family history and creating an accurately drawn pedigree. The genetic counselor’s choice of words is important; tread gently with topics and terms that may be distressing to patients and whenever possible, listen for terms that the patient uses and try to use them as well. It is also a good idea to avoid medical jargon unless the patient is a health-­care professional and to start the family history intake by asking easy questions rather than going right to the hard ones. For example, if a relative was diagnosed with colon cancer and died, it may be easier to ask for the patient’s age at death first and then backtrack to the age at diagnosis of cancer. Shortcuts are permissible if there are time constraints and the patient either reports no history of benign or malignant tumors in that branch of the family or the patient has no information about those relatives. In these cases, it may be helpful to ask a sweeping question such as “Do any of your paternal first cousins have a history of cancer as far as you are aware?” However, shortcuts should be reserved for more seasoned genetic counselors and should be avoided by newer counselors. Most importantly, always treat patients in a respectful and kind manner. 6.1.4.3.  Respond to Patient Stories in an Empathetic Manner In the process of sharing their family history, patients may tell you about an important event that has occurred in their lives. In some cases, these events will be germane to the discussion, such as a distressing experience with a screening test, a recent cancer diagnosis, or a relative’s cancer-­ related death. In other cases, the events are completely unrelated to the cancer discussion.

284

Counseling About Cancer

Examples include a wedding, a new baby, a graduation, a divorce, or job changes. Upon hearing the patient’s news, counselors need to acknowledge the impact of the event for the patient with an empathetic comment or reaction. These empathetic verbal and nonverbal responses convey to the patient and their families that the counselor is seeing them as people rather than as a collection of diagnoses. Even if patients do not wish to delve further into the matter, they will usually appreciate the effort. It also makes the family history discussion appear less like a formal medical intake and more like the give and take of normal conversation. Sometimes this empathic response can be difficult if the counselor is feeling rushed in an encounter. Part of the art and skill of the developing genetic counselor is to practice and learn to be empathic and move the session along at the same time. 6.1.4.4.  Use Standardized Pedigree Nomenclature Constructing a cancer pedigree is like handwriting; there is a correct form to follow, but everyone has their own style. (Refer to the NSGC Practice Guideline for a review of the standardized pedigree nomenclature.) It is important to use standardized pedigree nomenclature, however, so that other healthcare professionals can quickly and easily gather the information they need. Some clinical cancer genetics programs use a specific quadrant system or different types of shading to denote different types of cancer (see Figure 6.2 for an example). Genetic counselors and cancer genetics clinics may want to utilize computerized pedigree-­drawing software, which uses a standard set of genetics nomenclature. 6.1.4.5.  Adhere to Confidentiality Practices A pedigree is a record of sensitive information and it needs to be treated accordingly. Clinical cancer risk programs will need to decide on the types of information that will or will not be included on the pedigree. This might include full names of relatives, genetic test results, and other potentially sensitive information (such as adoption status, mental illness, suicidality, or substance abuse history). If in doubt, ask patients whether certain ancillary information should be included on the finalized form of the pedigree. The pedigree should be placed in the patient’s medical record but names of relatives should not be included since they have not consented to the posting of their private information. It is imperative that the genetic counselor review the pedigree documentation practices with their employer to ensure that the documentation is compliant with institution practice and state law. 6.1.4.6.  Consider the Accuracy of the Historian Patients are more likely to accurately report a cancer diagnosis in first-­degree relatives than diagnoses that have occurred in more distant relatives. This is hardly surprising since patients are more apt to be directly involved in the care of a close family member. Another influencing factor is health literacy, as research has shown that health literacy in the general population is low and impacts not only understanding of one’s family medical history but also comprehension of the counselor’s questions. The site of cancer may also influence accuracy rates. While reports of breast cancer, prostate cancer, and melanoma tend to be quite accurate, reports of other forms of cancer have much lower rates of accuracy.

6. Cancer Family Histories (Collection and Interpretation)

285

Genetic counselors need to become savvy at determining when the cancer history information is less likely to be accurate. If the family history information may not be accurate, then the genetic counselor should encourage the patient to verify the facts by checking with other relatives or by obtaining written documentation. Obviously, this type of request needs to be made tactfully. It is especially important for genetic counselors to ask patients to confirm their personal or family histories of cancer in the following situations: ••

••

••

••

••

••

The patient provides different information to various providers. A patient may tell their physician that three relatives died from brain tumors but at the genetic counseling visit, they state that only one relative had a brain tumor (and two relatives died from strokes). Sometimes the altered information can reflect new or confirmed information that the patient has obtained and other times it means that the patient is confused or simply guessing. The patient provides different information than another family member has provided. A patient may relate that three relatives had kidney cancer, while the patient’s first cousin insists that these relatives had colorectal cancer or nonmalignant kidney disease. In this type of situation, the counselor’s task is to determine which of the two relatives is more likely to be the accurate historian. If it is not possible to confirm a diagnosis, it may be prudent to record both. The patient provides information about a cancer diagnosis that does not seem realistic in terms of the reported treatment or the survival time. As examples, genetic counselors may wish to question patients further if they relate that a family member had a solid tumor that required no surgical intervention or that a relative is a long-­term survivor of a particularly aggressive cancer (such as pancreatic or gastric cancer). The patient provides other information that suggests that the reported diagnosis is not ­accurate. For example, a patient might report that their cousin gave birth to a baby several years after being diagnosed with uterine cancer (which typically results in a hysterectomy). The patient provides family history information that includes the presence of less commonly occurring tumors on both sides of the family. Excluding situations of consanguinity, it would be unusual to see cases of rare tumors, such as gastrointestinal stromal tumors (GIST), in both a paternal uncle and a maternal grandparent. The patient provides family history information that includes multiple relatives who have developed cancer at exactly the same age. Patients may latch onto a specific age due to their own diagnosis or that of a close relative and then report that all other relatives were diagnosed at similar ages.

6.1.4.7.  Work within Existing Family Relationships The genetic counselor is dependent on the patient’s ability and willingness to obtain a comprehensive family history. But genetic counselors should recognize that obtaining this information can be quite time consuming, and, in some cases, can be emotionally difficult for patients. It may be helpful for counselors to suggest ways to obtain information with a minimum of effort or

286

Counseling About Cancer

involvement by other family members. For example, a patient may not feel comfortable contacting a distant cousin about their newly diagnosed cancer, but perhaps an aunt would either know the information or be willing to obtain it on behalf of the patient. 6.1.4.8.  Use Family History Intake as a Counseling Tool In addition to eliciting the pattern of cancer in the family, the family history discussion can provide information about relationships with other family members, the patient’s perceptions of risk, and even attitudes toward cancer monitoring or genetic testing. Genetic counselors should note the points at which the patient becomes emotional or quiet; these “triggers” may be important clues for how the patient is dealing with personal or family issues. If the genetic counselor notices that a patient seems distressed when talking about a specific issue, the counselor should respond in an empathic manner. Then, depending on the circumstances, the genetic counselor can proceed in one of the following ways: ••

•• ••

••

••

Maintain a few moments of silence to allow the patient to regroup and then resume the family history intake. Avoid references to the topic if it is not germane to the discussion at hand. Decide whether the issue needs to be addressed at this point or later in the session. Be especially tactful and gentle during the discussion since this seems to be an emotionally distressing issue for the patient. Collect more detailed information about the patient’s emotional well-­being. Depending on the assessment, it may be appropriate to refer the patient to a mental health provider. If the patient is already in the care of a therapist, then it may be helpful for the counselor to speak directly to the therapist. Determine that the topic is such a powerful emotional trigger for the patient that any further discussion of it would be beyond the scope of the average genetic counseling visit. Following the session, the genetic counselor could consult with a mental health provider regarding any concerns about the patient’s safety or for suggestions on how to proceed during future interactions with the patient.

6.1.4.9.  Consider the Use of a Family History Questionnaire Collecting the family history information can take up much of the allotted visit with the patient. Therefore, genetic counselors may find it beneficial to use a preliminary family history questionnaire. In addition to the many pen-­and-­paper family history intake forms that have been developed, there are also family history questionnaires that are computerized or web-­based. There exist some “toolkits” that compare these online and paper family history questionnaires that some clinical cancer programs might find helpful (e.g., NCCRT Family History Toolkit). While the existing questionnaires can be very helpful in streamlining the family history intake, genetic counselors should be cautioned to not rely on these methods entirely. It remains important for the genetic counselor to review the information, even briefly, to confirm that the information is accurate and there were no data entry errors. In addition, reviewing the family history is essential to gathering the psychosocial and family dynamics that a patient is experiencing.

6. Cancer Family Histories (Collection and Interpretation)

287

6.1.5.  Ways to Confirm Pedigrees It is crucial for pedigrees to reflect the most accurate information that is possible. However, even patients who are good historians can provide inaccurate or incomplete information. Therefore, obtaining confirmation of the diagnosis, in the form of a pathology report, remains the gold standard. Unfortunately, the process of obtaining the necessary documentation can be incredibly time-­consuming and frustrating for both the patient and the genetic counselor. And sometimes, even with the best of intentions, it is not possible to obtain the needed records. Thus, it may be more feasible to focus efforts on documenting the diagnoses that are germane to interpreting the cancer history rather than attempting to confirm every cancer diagnosis in the family. For example, to determine whether a patient’s family has a hereditary colorectal cancer, the ­genetic counselor can focus on documenting the cases of colorectal cancer or polyps and other related cancers, such as uterine cancer. Typically the patient is responsible for gathering these medical records. If the genetic counselor is planning to assist the patient in obtaining medical records documentation, then they should make sure to obtain the names of the hospitals where the patient has been treated. A lack of precise information can make the task of confirming information even more tedious, and much less likely to be successful. Sometimes, patients are stymied about how to go about obtaining documentation. The red tape involved in obtaining copies of a medical record can be daunting to individuals who are unfamiliar with hospital procedures, and they may be intimidated by the thought of contacting a ­physician’s office or hospital. Genetic counselors should provide the patient with general instructions for how to obtain documentation and they may even want to assist families with these efforts. The various ways to confirm a cancer history are described in the following subsections. 6.1.5.1.  Verbal Confirmation Collecting a comprehensive cancer history may require conversations with more than one family member. One strategy that is often used includes asking the patient if they are comfortable calling or texting the relative from the genetic counseling session. If this is not possible or desired, and the genetic counselor needs to confirm a specific diagnosis, the genetic counselor may wish to speak with another family member directly. In these cases, it is imperative that the genetic counselor obtain consent from the patient to discuss the family history with other relatives. In addition, given the stringent rules about patient privacy, it may work best to ask that the relative(s) be the ones to initiate the contact if they are willing to discuss these issues. 6.1.5.2.  Pathology Report Obtaining the pathology report is the most accurate way to document a tumor. The diagnosis of cancer almost always involves an analysis of the malignant cells, which results in a written pathology report. Even with benign tumors, the pathology report is essential and can reveal nuances like polyp histology. The pathology report generally includes: ••

The patient’s full name and hospital identification number

••

The patient’s date of birth and current age

288

•• •• •• ••

Counseling About Cancer

The date of the analysis The name of the tumor and site of origin The histology, pathology, and grade of the tumor The results of tumor tests such as immunohistochemistry, gene-­specific, or pathogenic variant specific analyses.

When reviewing pathology reports, genetic counselors should reach out to colleagues (preferably pathologists) as necessary to ensure appropriate interpretation. 6.1.5.3.  Genetic Test Results If the patient reports that someone in the family underwent genetic testing, the genetic c­ ounselor should request a copy of the test result. This is especially important if the patient is interested in having targeted genetic testing or is making medical decisions based on the verbally reported genetic test result. It may turn out that the positive result is a variant of uncertain significance or that a negative result is less than reassuring because the wrong test was ordered or the wrong person in the family was tested. It may also be possible to offer additional genetic testing options to the family since genetic testing technologies and the genes included on a multigene panel are constantly evolving. 6.1.5.4.  Hospital Summary Notes If the pathology report is not accessible, another option is to obtain and review other entries in the medical record, such as surgical records, hospitalization discharge notes, or summaries of outpatient visits. Genetic counselors should look for records close to the time of diagnosis, which may include the most accurate and detailed information. 6.1.5.5.  Autopsy Report If an autopsy has been performed, it may contain information regarding the presence of a malignancy or other syndromic features. This report is typically included in the deceased individual’s medical record. 6.1.5.6.  Death Certificate Another possible source of confirmation is the death certificate. The death certificate typically lists the individual’s cancer diagnosis if it is considered the primary cause of death. If the cancer is considered a contributing factor (secondary diagnosis), then it might also be included in the death certificate. However, family members who were long-­term cancer survivors and died of other causes are less likely to have the diagnosis listed on the death certificate. The death certificate usually indicates whether an autopsy has been performed (which is more likely to mention the prior cancer diagnosis). Death certificates are a matter of public record and the patient should be able to obtain one provided they have sufficient information to

6. Cancer Family Histories (Collection and Interpretation)

289

locate it. Required information typically includes where the person died (city and state) and date of death. It may also be helpful to have the individual’s date of birth, name of spouse, and name of parents.

6.2.  Challenges to Collecting an Accurate History Genetic counselors depend upon patients to provide accurate and complete family histories. Yet cancer family histories can be notoriously inaccurate. This can occur because patients have lost touch with some of their relatives or because they are confused about the actual diagnosis. Perhaps most challenging are the patients who report specific cancer diagnoses that later turn out to be false. This section discusses reasons why the cancer history might be inaccurate and offers strategies that counselors can use to elicit better histories. 6.2.1.  The Family History Information Is Incomplete Some patients are much better at recounting their family histories than others. In some cases, the problem lies in the patient’s skill as a historian. Patients may be poor historians for the reasons presented in the succeeding sections. 6.2.1.1.  Family Members Live Far Away It is rare these days to find an extended family that has remained in the same city or region. Much more frequently, members of a family have scattered to different parts of the country and may only get together on special family occasions, if at all. Thus, some patients may be unaware of the medical histories of entire branches of the family. Alternatively, they may have heard about the diagnosis from an indirect (and potentially unreliable) source. Also, patients may feel awkward about asking for more detailed family history information from relatives they barely know. Even among family members with solid relationships, patients may hesitate to ask too many questions. They may be concerned that raising the topic will cause their relatives to be sad, worried, or even angry. 6.2.1.2.  Patients Are Not Prepared to Answer Questions Patients may not be good at remembering dates and are hazy about who died from what. For this reason, it is helpful to have alerted patients beforehand about the types of questions they will be asked to provide during the genetic counseling visit. This can be accomplished by including this information in an appointment reminder letter. Some genetic counseling centers have created videos that they encourage their patients to view prior to the appointment so that the patient can be prepared. Genetic counseling programs have also used the family history questionnaire (see Section 6.1.4.9) as a way of preparing the patient to think about the family history prior to the appointment so they are more prepared. Even if patients are somewhat prepared to answer questions, the genetic counseling session itself can interfere with the memory recall. Questions about the family history may cause some patients to feel put on the spot or swamped with emotional memories; neither is conducive to providing accurate information.

290

Counseling About Cancer

6.2.1.3.  Cancer Is Not Discussed in the Family A generation ago cancer was seldom discussed. Although it is now more common for people to talk about their cancer diagnoses, some individuals remain fiercely private about their medical problems. Patients may have been rebuffed in their efforts to obtain family history information or they may want to honor their relatives’ wishes that they “don’t want to talk about it.” The lack of discussion about cancer may also reflect a lack of opportunity. If patients only see their relatives on festive occasions, it may be awkward to discuss details about their cancer diagnoses. It is also important to consider ethnocultural factors when collecting the family history, as health issues are often not discussed in certain cultures. In the scenarios just described, patients may not be aware of their family histories but probably do have access to the information. In collecting a cancer history, counselors may want to utilize the following strategies: •• •• ••

•• ••

Ask specific questions about each family member to help jog the patient’s memory. Link ages or dates with other family events or special occasions. Help the patient identify relatives who might have the needed information and help them think about how best to broach the topic with these relatives. Review with the patient exactly what information is needed. Be specific. Reassure patients that it is okay for them not to have all the family history information at the first visit.

6.2.2.  The Family History Information Is Not Available In certain situations, the family history information may simply be unobtainable. This can occur because of the situations presented in the succeeding sections. 6.2.2.1.  Relatives or Records Are Lost Family members who geographically live far apart may, over time, lose contact with one another. Patients may have little awareness of the current health status of certain relatives and may not even have current contact information for them. The death of key relatives can also lead to a loss of contact with entire branches of the family. This is especially true if a parent has died young and the other parent ended up remarrying. There are instances where the patient is in contact with the relative with cancer or the relative’s family, but confusion about the details of the diagnosis remains. Sometimes the confirmatory medical records/pathology reports that detail the information required may no longer be available: physicians retire, hospitals are closed, and stored records may be discarded or misplaced. Each state in the United States has specific laws that govern how long a hospital or medical office must hold onto medical records. These laws often have different expectations for hospitals and medical offices, but in general range from 7 to 10 years from last patient contact. After that period, hospitals are free to destroy medical records. For more information on state requirements, see State Medical Record Laws at HealthIT.gov.

6. Cancer Family Histories (Collection and Interpretation)

291

6.2.2.2.  Estrangement from Family Familial relationships may be full of conflict or practically nonexistent; in either case, patients may have less than complete information about their relatives’ cancer histories. Sometimes, even family members who live in the same city have not spoken to each other in years. There may be complicated reasons for the estrangement due to desertion, sexual or physical abuse, use of drugs or alcohol, or family rifts. Sometimes, it is not the patient who has broken off contact with others, but someone from a previous generation who has caused the estrangement. Individuals who are estranged from family members with cancer will have no way of obtaining documentation of their cancer diagnoses or genetic test results. In fact, the patients may be missing information about entire branches of the family. It is important to reassure these patients that estrangement from family members is a common issue, and not stigmatizing. The information they can provide is sufficient. 6.2.2.3.  Adoption or Donor Eggs/Sperm Individuals who were adopted as infants or young children generally have limited or no information about their biological relatives. The following information is typically included on birth certificates: •• •• •• ••

Name of the biological mother Name of the biological father (if available) Date and time of birth Race and age of the mother (and possibly father)

At the current time, most adoptions are arranged privately rather than through an adoption agency and the amount of shared personal information varies widely from case to case. As adults, some adoptees do reconnect with biological relatives, allowing them to obtain some medical information. Individuals or couples may also utilize donor eggs or sperm to become parents. Agencies that arrange these procedures generally collect some medical information about the donors, but this information is often limited. In the above listed situations, counselors can consider utilizing the following strategies: ••

••

••

••

Focus on the information that is currently available, which at a minimum includes the patient’s personal history. In cases of lost contact or estrangement, discuss alternative ways of obtaining this information, such as contacting other relatives or friends of the family who might have the needed information. In cases of adoption or donor eggs/sperm, explore whether the patient has any options—­ and any interest—­for trying to obtain information about biological relatives. Accept that there are situations in which it is not possible to obtain any more information and reassure patients that this is okay.

292

Counseling About Cancer

6.2.3.  The Reported History Is False The most challenging genetic counseling situations can occur when patients provide information about their family histories that turns out to be inaccurate. These types of situations can occur when patients are mistaken or confused about the cancer diagnosis, or are deliberately fabricating history. 6.2.3.1.  The Patient Is Mistaken About the Cancer Diagnosis Cancer diagnoses among relatives may turn out to be benign lesions that have been biopsied or removed. The relative may have undergone surgery for reasons that were unrelated to a cancer diagnosis. For example, the patient’s aunt may have had a hysterectomy because of a benign uterine fibroid, not uterine cancer. A common mistake for patients to make is reporting a relative has had bilateral breast cancer because she has had both breasts removed, when cancer was only detected in one side. Asking a clarifying question can yield useful information to further tease out important details. Relatives may also be assumed to have cancer if they have a medical condition that leads to invasive procedures or treatment. For example, a relative may have required a partial colectomy because of colitis and not a malignancy. 6.2.3.2.  The Patients Are Unclear About the Diagnosis Patients may be making assumptions about the site or type of cancer among relatives or may be confused about which relatives had which cancers. The patient may report, for example, that a relative has had ovarian cancer when in fact all they know is that it was a “female abdominal” cancer. To complicate matters, patients frequently do not distinguish between the primary site of cancer and sites of metastatic disease. Patients will often report that a patient died of lung or bone cancer, when in fact the lung or bone lesions were metastases. Patients also report that a relative had “cancer everywhere in their body” and have no information on the site or origin. Patients may also have little knowledge of anatomy or medical terminology. Thus, “stomach cancer” may mean any malignancy in the abdomen and “uterine cancer” may be a euphemism for any female reproductive cancer. Vague reports of a “brain tumor” can also be problematic, as the term can be used for anything from a benign cyst to a hemangioblastoma or malignant astrocytoma. 6.2.3.3.  The Patient Is Deliberately Fabricating History It is rare that patients deliberately falsify their family histories of cancer, but when it occurs, it creates a difficult and awkward genetic counseling dilemma. Patients might provide fabricated histories because they want to ensure that they will be monitored closely or have access to prevention options, such as risk-reducing surgery. In addition to providing fabricated cancer histories, patients may falsely claim that there is a positive genetic test result in the family. Sometimes, it is not the patient who has fabricated the history, but rather another relative. Patients or relatives may also fabricate their cancer histories because they are seeking sympathy or attention. This type of behavior can also indicate the presence of an emotional disorder termed Münchausen syndrome. Individuals with Münchausen syndrome, which has been observed

6. Cancer Family Histories (Collection and Interpretation)

293

more frequently among women, are hypochondriacal and may actually seek out painful, invasive procedures. Falsely provided information, whether deliberate or not, can wreak havoc on the interpretation of the family history. Genetic counselors can employ the following strategies to help ensure that the recounted history is correct: ••

••

••

••

Encourage patients to confirm the history with other family members rather than making assumptions about the diagnoses. Obtain documentation of cancer diagnoses, especially if key to the interpretation of the family history. Diagnoses that appear questionable should be explored further, but in a respectful and gentle manner. If there is evidence that the history has been fabricated, carefully consider the potential ramifications if this information is shared with the patient. Unless the corrected information is germane to the risk assessment, it might be best not to challenge the claims of the relative or patient.

When taking a family history, genetic counselors are doing their best to document the most accurate information. It may be helpful to explain to the patient why certain aspects of the family are important to risk assessment, and other aspects may not require a lot of details (such as nonmelanoma skin cancer). However, while both the genetic counselor and the patient are doing their best, ultimately we have to take some of the family history at face value.

6.3.  Interpreting a Cancer History Once the cancer history information has been collected and the pedigree has been drawn, it is time to assess the pattern of cancer in the family for the likelihood that the patient could have a hereditary cancer syndrome. This section describes the major features of hereditary cancer syndromes and discusses possible ways to classify the patterns of cancer within families. 6.3.1.  Features of Inherited Cancers This section describes eight pedigree features that, if present, raise the likelihood that the patient’s family has a hereditary cancer syndrome. A pedigree that is suggestive of a hereditary cancer syndrome tends to display at least some of the features presented in the succeeding sections. 6.3.1.1.  Several Relatives with the Same or Related Cancers The first and foremost feature of a family with hereditary cancer is the presence of multiple individuals with cancer. It is important to recognize, however, that one in three individuals will develop cancer at some point in their life. Thus, the ratio of family members with cancer to family members without cancer should be considered.

294

Counseling About Cancer

In general, families in which three or more blood relatives on the same side of the family have developed similar or related cancers may have a hereditary cancer syndrome. This is especially true if the patient is closely related to the relatives with cancer. Thus, patients who have a sibling, mother, and maternal aunt with similar cancers are at greater risk for having an inherited predisposition to cancer than patients who have three maternal great-­aunts with a specific type of cancer. Because cancer susceptibility genes are typically associated with specific forms of cancer, the presence of the same type of cancer in a few relatives is more striking than multiple family members with a variety of unrelated cancers. An important part of assessing the pattern of cancer in the patient’s family is to determine which diagnoses could be due to the same underlying gene pathogenic variant. It is important for genetic counselors to become familiar with the spectrum of cancers that could be linked to the same underlying genetic factor. For example, hereditary ovarian cancer can be associated with: ••

••

Cancers of the peritoneum, fallopian tube, breast, pancreas, and prostate (which are all features of hereditary breast and ovarian cancer syndrome). Cancers of the uterus, colon, rectum, small intestine, stomach, kidney, and ureter (which are all features of Lynch syndrome).

6.3.1.2.  Younger Age of Onset Than Is Typical Inherited forms of cancer typically have earlier ages of onset than sporadic tumors. In fact, younger than usual age at diagnosis is one of the strongest predictors of inherited risk. Inherited childhood cancers are more likely to occur months or years earlier than sporadic cases and are also more likely to occur during the first 12 months of life. In adult-­onset cancer syndromes, the associated malignancies can occur years or decades earlier than is seen in the general population. Therefore, the occurrence of early-­onset cancer in one or more family members is often suggestive of an inherited form of cancer. However, malignancies occurring at later ages should not be completely dismissed; it is the overall pattern of cancer that is important to assess. Also, there are certain tumors that are significant regardless of the age of onset, such as ovarian cancer and male breast cancer as well as other rare neoplasms like adrenal cortical carcinoma. 6.3.1.3.  Autosomal Dominant Pattern of Cancer Most hereditary cancer syndromes identified to date follow autosomal dominant inheritance patterns. Thus, the cancer in the family should present as a vertical pattern, occurring over two or more generations in certain branches of the family. In other words, the presence of cancer in a grandparent, parent, and child is more compelling evidence of an inherited syndrome than cancer among cousins in the same generation. However, a dominant pattern of inheritance is sometimes subtle due to variable penetrance, small family size, or young ages of the majority of family members. Cancers that are sex limited (e.g., ovarian or prostate) or sex influenced (e.g., breast) may also be more difficult to track through a family.

6. Cancer Family Histories (Collection and Interpretation)

295

6.3.1.4.  Presence of Rare Cancers A cluster of tumors that occur rarely in the general population is more difficult to explain by chance alone and provides evidence for an inherited predisposition. While two siblings with colorectal cancer may have been caused by shared multifactorial factors or random chance, two siblings with cancer of the duodenum are more likely to have some type of underlying genetic predisposition. Pedigrees suggestive of inherited forms of cancer may also include malignancies that have developed in an unusual subgroup. Examples include men with breast cancer, teenagers with colorectal cancer, and non-­White individuals with melanoma. 6.3.1.5.  Excess of Multifocal or Bilateral Cancers Most tumors are monoclonal, meaning that the population of malignant cells has arisen from a single cancer cell. Individuals with inherited forms of cancer more frequently present with malignancies that are multifocal (more than one tumor within the same organ) or bilateral (tumors that have occurred in both paired organs). Keep in mind, however, that patients can often report bilateral breast cancer inaccurately (see Section 6.2.3). 6.3.1.6.  Excess of Multiple Primary Cancers Cancer survivors who have an inherited susceptibility to cancer are at substantially increased risk for developing additional malignancies. These second primaries may be synchronous (diagnosed at the same time as the initial cancer) or metachronous (diagnosed at a different time). Although all cancer survivors have small increased risks for developing a second cancer, the risk is higher for people with hereditary cancer syndromes. For example, the risk of contralateral breast cancer may be as high as 65% for female breast cancer survivors who carry BRCA pathogenic variants, which is a much higher risk than for those who have sporadic breast cancers. 6.3.1.7.  Presence of Other Nonmalignant Features Certain hereditary cancer syndromes are associated with benign tumors or other physical characteristics. Examples include the very large head size associated with PTEN hamartoma syndrome, and the rare types of polyps found in juvenile polyposis and Peutz–Jeghers syndrome. 6.3.1.8.  Absence of Environmental Risk Factors It is important to ask about potential environmental causes of tumors. This is especially true for cancers commonly associated with carcinogenic exposures, such as mesothelioma (asbestos) and lung cancer (tobacco), or viral exposures, such as cervical cancer (HPV) or stomach cancer (Helicobacter pylori). In addition, some forms of cancer are associated with preexisting medical conditions. Examples include colon cancer in those with ulcerative colitis and testicular cancer in men born with undescended testes. Although there are specific geographic areas that have been documented to have higher cancer rates due to contaminated well water, paper-­making mills, or manufacturing plants, true cancer clusters of this kind are uncommon, or at least they are difficult to prove.

296

Counseling About Cancer

6.3.2.  Ways to Classify Family Histories of Cancer Cancer can cluster in families due to a variety of factors, including inherited factors, shared exposures to carcinogens, or simply random chance (“bad luck”). Even if the family does not have a hereditary cancer syndrome, family members might still have some level of increased risk. Once the family history has been collected and reviewed, genetic counselors will determine how best to classify the cancer history. The pattern of cancer in a family can be classified in the following ways, which are presented in the succeeding sections. 6.3.2.1.  Hereditary Cancer Syndrome In simplistic terms, families with dominantly inherited hereditary cancer syndrome are more likely to have patterns of cancer that follow the 3–2–1 rule: •• •• ••

3 individuals with similar or related cancers on the same side of the family, 2 generations of cancer cases, and 1 person diagnosed at an unusually young age (e.g., < age 50 for adult-­onset cancers).

In addition, the pedigree should display distinctive features that are consistent with or highly suggestive of a specific hereditary cancer syndrome. Patients who are found to have a hereditary cancer syndrome are typically at increased risk for developing the associated malignancies even if these cancers have not occurred in the family. 6.3.2.2.  Familial Cluster of Cancer Patients may have a familial cluster of cancer if they have two or more relatives who have developed similar cancers but the family does not have any other features suggestive of a hereditary cancer syndrome. Familial clustering of cancer is more likely multifactorial (i.e., caused by a combination of genetic factors and environmental agents). Patients with a familial cluster of cancer may have increased risks for developing similar types of cancer, but the ­associated cancer risks tend to be lower (and less predictable) than in families with hereditary cancer syndromes. 6.3.2.3.  Environmentally Caused Cluster of Cancer In some families, members have developed similar cancers because of exposures to the same carcinogenic agent. If an exposure is shared by several members of a family, then the incidences of cancer may resemble a familial pattern. Examples include:

••

Carcinogenic agents in a family business—­such as dry cleaners, mill workers, farmers, and construction workers Lifestyle habits—­such as dietary preferences and the use of tobacco or alcohol

••

Broad exposures to carcinogens—­such as excessive sun exposure or toxic well water

••

6. Cancer Family Histories (Collection and Interpretation)

297

Individuals in families with environmentally caused clusters of cancer are at increased risk for developing cancer if they share the carcinogenic exposure. For example, a patient might report that several of their relatives developed lung cancer after being long-­term ­cigarette smokers. Some nonsmokers in the family may have developed lung cancer as well, given the fact that they live in a household where secondhand smoke is prevalent. This patient’s risk of lung cancer is increased if they smoke cigarettes or is exposed to secondhand smoke. 6.3.2.4.  Sporadic Forms of Cancer It is important to keep in mind that most cases of cancer occur randomly without an obvious underlying risk factor. In fact, it is seldom possible to identify the main cause for why a specific person developed cancer. Thus, a pattern of cancer in a family may very well represent multiple sporadic cases that have happened to occur in the same family. This is especially true if family members have developed commonly occurring cancers at standard ages or if the cancer types are diverse and are not typically linked by a common gene pathogenic variant or carcinogenic agent.

6.3.3.  High, Moderate, Low, and Uncertain Risk Categories Another way to classify cancer histories is by the likelihood that the family could have a hereditary predisposition to cancer. Distinguishing between “high-­risk” and “low-­risk” families will impact the genetic counseling discussion significantly. If the family history is collected as part of a pre-­test encounter, the classification will impact the discussion of genetic testing options. The classification of a family is also essential when it comes to determining medical management recommendations. The classifications of risk, in terms of the likelihood of having a hereditary cancer syndrome, are presented in the succeeding sections. 6.3.3.1.  Family at High Risk The pedigree of a family at high risk shows strong evidence for having an inherited predisposition. The pattern of cancer in the family is consistent with or highly suggestive of a specific hereditary cancer syndrome. Family members should be counseled that they fit clinical criteria for the syndrome, even if genetic testing is not informative. Thus, an indeterminate negative test result will not change the fact that the family meets clinical criteria for the syndrome. 6.3.3.2.  Family at Moderate Risk A family at moderate risk for having a hereditary predisposition has some features suggestive of a cancer syndrome. However, the family may not quite meet the criteria for the syndrome or the family may have certain features that are inconsistent with the syndrome. As an example, see Figure 6.3. In this pedigree, the patient has a finding (two renal cysts) that can be associated with von Hippel–Lindau (VHL) syndrome. Although her first-­degree relatives show no signs of VHL,

298

Counseling About Cancer

English, Irish d. 52 Diabetes

French Canadian d. 65

d. 70s

Stroke

d. 61

Prostate Heart cancer, disease 70s d. 78

Renal cell carcinoma, 60

35

75

70s

42

40

70s

Heart disease

45 Two renal cysts, 44

20

d. 70s

Symbol definitions Unaffected Cancer diagnosis

17

No signs No signs of VHL of VHL

3

4

FIGURE 6.3.  A pedigree depicting a patient at moderate risk for having VHL syndrome.

she has a paternal uncle with renal cell carcinoma, a cardinal feature of VHL. So, in assessing this family, the genetic counselor might list those features that are and are not suggestive of VHL. ••

Features in pedigree suggestive of VHL: Patient has two renal cysts •• Uncle with renal cell carcinoma Features not suggestive of VHL: •• Patient does not have other manifestations of VHL •• Father (presumed obligate carrier) had no signs of VHL ••

••

6.3.3.3.  Family at Low Risk A family at low risk for having a hereditary cancer syndrome has a negative or noncontributory history of cancer. Figure 6.4 shows an example of a low-­risk pedigree. Although there are several cases of cancer in the family, the cancer types are ones that frequently occur among older individuals. This pattern of cancer is therefore unlikely to be due to a common inherited factor. Low-­ risk families typically include the following features: •• •• ••

Few, if any, first-­or second-­degree relatives with cancer Cancers that are not usually associated with a hereditary syndrome Cancers that have occurred at typical ages

299

6. Cancer Family Histories (Collection and Interpretation)

African American

African American

Symbol definitions Unaffected Cancer diagnosis

d. 83

d. 79

Prostate cancer, 81

Breast cancer, 75

d. 53 Liver cancer 52 (alcoholic)

d. 72 Colon cancer, 72

61 Lung cancer, 52 (smoker)

35

33

d. 39 Breast cancer, 35

22

FIGURE 6.4.  A pedigree depicting a patient at low risk for having a hereditary cancer syndrome.

•• •• ••

Cancers that occur commonly in the general population No cancers among sibling pairs or parent–child pairs No unusual tumor characteristics or other physical findings

6.4.  Case Examples The following case examples illustrate some of these challenges involved in collecting and interpreting cancer family histories. 6.4.1.  Case 1 Case Presentation: Maria, age 38, was just diagnosed with triple negative breast cancer. She presented to a multidisciplinary breast cancer visit with her husband, Bob. The surgeon paged the genetic counselor to facilitate genetic testing because Maria indicated that she might decide to pursue bilateral mastectomies (as opposed to a lumpectomy) if she had a pathogenic variant in BRCA1 or BRCA2. Maria was obviously overwhelmed when the genetic counselor started the consultation. She was frustrated by the fact that she had to answer questions again about her family history.

300

Counseling About Cancer

2

3

2 64

39 BR 38

2

63

38

35

FIGURE 6.5.  Maria’s initial pedigree

She had answered them “at least 10 times” before she even got to the surgeon’s office. The genetic counselor empathically replied, and continued, “I know there is a lot of family history information that I’ve already read about you—­but I need to fill in some information. I’m interested in the complete family history that will include all individuals in the family—­including those without cancer—­so I can best advise you on the type of testing we should consider.” Maria softened and the counselor continued. Maria reported that her father had “something found on colonoscopy that wasn’t cancer,” but she didn’t know too much more than that. Her mother, siblings, nieces, and nephews were all healthy and without cancer diagnoses. It became clear that Maria’s knowledge of her extended family was limited once the genetic counselor started asking information on relatives outside of her nuclear family. Maria became more and more frustrated, and Bob intervened, “Listen—­she just doesn’t know all these details! Can’t we do this later?” The genetic counselor gently replied that at this point, she just needed to know general information. The genetic counselor completed the preliminary family history with only the number of brothers and sisters for each of the patient’s parents (Figure 6.5). The genetic counselor then provided pre-­test education about a gene panel that included high-­risk breast cancer genes, as those genes might have implications for Maria’s surgical management. The genetic counselor was explicit that additional genes might be ­warranted, but that she would revisit this information when Maria’s test results were available. Follow-­Up: Maria’s test results came back negative—­no pathogenic variant identified in any of the genes tested. The test results were relayed over the phone, and the genetic counselor explained that she would meet with Maria to review the test results in person during her post­op visit with the surgeon. She reminded Maria that any and all information on her relatives’ cancer histories would be important to bring to her appointment.

301

6. Cancer Family Histories (Collection and Interpretation)

CO 50

2 UT 48

CO 52

39 BR 38

64 CO polyp-A 60

38

2

63

35

FIGURE 6.6.  Maria’s final pedigree

Maria’s follow-­up appointment was much more focused and Maria was much more amenable to discussing family history. She had the chance to ask her parents more detailed information about their brothers, sisters, and parents. She learned that her father’s sister was diagnosed with uterine cancer at age 48 and underwent hysterectomy. One of her father’s three brothers had colon cancer at age 52. Her paternal grandfather had colon cancer at age 50. Maria also found that her father had a large adenomatous polyp removed at age 60 and was currently screened with colonoscopies every 2 years. Maria’s complete family history can be found in Figure 6.6. The genetic counselor recognized immediately that Maria’s paternal family history was consistent with Lynch syndrome. The genetic counselor reminded Maria that her “high-­risk breast cancer gene” panel test was negative and given that information and the lack of others in the family with breast cancer, her decision to have lumpectomy seemed appropriate. After answering Maria’s questions about the genes that were included, the genetic counselor gently focused on the paternal family history of colon and uterine cancer. The genetic counselor described Lynch syndrome and advised Maria that while she could certainly pursue genetic testing, a relative who had colon or uterine cancer would be the ideal candidate for informative genetic testing. Maria’s anxiety prompted the genetic counselor to “reflex” order a larger gene panel that included the Lynch genes as well as other colon cancer susceptibility genes. Maria’s test results came back negative, and when the genetic counselor called her to disclose them, the genetic counselor reminded Maria that one of her paternal relatives who had been diagnosed with cancer should consider genetic testing. Maria relayed that her paternal uncle had just gotten his genetic test results back, and that he carried a pathogenic variant in the MSH2 gene. The genetic counselor requested that Maria obtain a copy of the test results to review. When Maria’s email arrived with a scanned copy of her uncle’s test results, the genetic

302

Counseling About Cancer

counselor was able to call Maria and confirm that while her family had Lynch syndrome due to a pathogenic variant in MSH2, Maria did not require heightened surveillance for colon, uterine, or other Lynch-­associated cancers. Case Discussion: This case illustrates the nuances of dealing with anxious patients at the time of a genetic counseling session, and the need for genetic counselors to focus on the minimal information necessary at the time. This case also shows the importance of collecting the complete family history so that a full risk assessment can be performed. 6.4.2.  Case 2 Case Presentation: Tom presented for genetic counseling with his wife, Amanda. When the genetic counselor began the session, and asked Tom the reason for his referral he pointed at Amanda and replied, “Ask her.” Amanda launched into a description of Tom’s family that was “full of breast cancer.” Tom and Amanda had two daughters (ages 30 and 32) and Amanda was incredibly concerned about them and their risk of developing breast cancer. During the family history collection, the genetic counselor learned that Tom’s two sisters died of breast cancer in their early 50s. Tom’s mother had breast cancer in her late 40s, and lived until age 81. Tom’s mother had a sister that died of a “cancer in her abdomen” and died incredibly quickly. She had not even received additional treatment for the cancer because she died so quickly after the doctor had performed the cancer surgery. The aunt just recently died and the family was not coping very well. Tom’s family history can be seen in Figure 6.7. The genetic counselor recognized that Tom’s family history was concerning for a hereditary breast cancer syndrome. She discussed genetic testing via a gene panel test, and Tom was interested in pursuing testing. Tom’s genetic testing revealed that he had a pathogenic variant in BRCA2. The genetic counselor reviewed the medical implications of carrying a BRCA2 pathogenic variant, and ­commented that Tom’s maternal aunt’s diagnosis was possibly ovarian cancer. The genetic counselor,

81 80 BR 47 ?CA

63

51 BR

53 BR

55

30

FIGURE 6.7.  Tom’s family history

52

32

6. Cancer Family Histories (Collection and Interpretation)

303

­ owever, thought it best to research that a bit more, and asked Tom if he would be willing to h work with her to obtain the medical records on that diagnosis. Tom agreed, and said he would be in touch with the genetic counselor shortly. Follow-­Up: It took Tom weeks to follow up with the genetic counselor. Tom explained that he had really “opened up a can of worms” when he reached out to his cousins (his maternal aunt’s children) to discuss his genetic test results and the implication for their medical care. His cousins were very angry that he “thrust this information” on them. They were still coping with the loss of their mother, and did not welcome any information that involved the word “cancer.” Tom decided to give them their space to grieve and left them alone. After a few weeks, Tom’s wife took control of the situation and reached out again to the ­genetic counselor asking how much she should “push” the cousins to find out the type of cancer their mother had. The genetic counselor offered to be a direct point of contact for the cousins if they had questions about this or about genetic testing for the familial BRCA2 pathogenic variant. Eventually the aunt’s daughter (her healthcare proxy) called the genetic counselor and agreed to obtain medical records. Tom called the genetic counselor a week later and told the genetic counselor that the pathology report revealed that the aunt had died of pancreatic cancer, and not ovarian cancer, as had been originally thought. The genetic counselor gently explained that some families with BRCA2 pathogenic variants have an increased risk of pancreatic cancer. This documentation helped clarify that Tom’s family was one of those families. In light of this information, Tom’s clinical management would include screening for pancreatic cancer. Case Discussion: This case shows the complexities of dealing with families and the importance of allowing families to cope with cancer diagnoses and the issues of genetic testing in their own way. It also shows the importance of gathering medical records on key cancer diagnoses as they can have significant implications for medical management.

6.5.  Discussion Questions Question 1: Your 28-­year-­old male patient presents for genetic counseling. He explains that he was adopted out of the family and had no contact with his birth relatives as a child. Six months ago, he bought a DTC genetic testing kit because he was interested in his ancestry and submitted a sample. He was amused to find that he was mostly German. Two weeks ago, he received a phone call from a woman claiming to be his cousin based on this DTC testing company’s information. This woman explained that she felt compelled to call him and tell him that their family had von Hippel–Lindau syndrome and harbored a pathogenic variant in the VHL gene. a. What issue do you tackle first in this session? b. Do you need to obtain a full family history in this case? How do you get at that information?

304

Counseling About Cancer

c. The patient is reluctant to reach back out to this woman to obtain a copy of the VHL test report. Do you test him for VHL pathogenic variants anyway? d. The patient tests negative for VHL pathogenic variants. How do you manage him clinically? Question 2: Your patient, a 40-­year-­old female, presents to discuss medical management in light of an MSH2 pathogenic variant and her family history. It is unclear which parent she inherited the MSH2 pathogenic variant from. Both parents died of colon cancer. Her maternal aunt had colon cancer and her maternal cousin was just diagnosed with pancreas cancer. Two of her paternal uncles had colon cancer, and her paternal grandmother had uterine cancer. a. For your patient’s medical management, is it important to determine which parent she inherited the pathogenic variant from? Why or why not? b. Which individuals in the family are appropriate or most informative to test first? Question 3: Two sisters (ages 55 and 57) present for genetic counseling due to their family history of breast cancer. During the family history collection, they argue incessantly about which individuals in the family were diagnosed with cancer, the type of cancer diagnosed, and the age at diagnosis. Once you’ve constructed the pedigree, there really is no clarity about any of the diagnoses. a. How do you handle the competing agendas between the sisters? b. Do you encourage them to gather medical records on the cancer diagnoses? All of them or specific ones? c. Do you offer genetic testing to either of these women in the absence of a clear family history?

6.6.  Further Reading Armel SR, McCuaig J, Finch A, et al. The effectiveness of family history questionnaires in cancer genetic counseling. J Genet Couns. 2009;18:366–378. Bennett R. The language of the pedigree. In The Practical Guide to the Genetic Family History, 2nd edition. Hoboken, NJ: Wiley-­Blackwell, 2010, 1–17. Bennett R. Using a pedigree to recognize individuals with an increased susceptibility to cancer. In The Practical Guide to the Genetic Family History, 2nd edition. Hoboken, NJ: Wiley-­Blackwell, 2010, 177–219. Bennett R. Medical verification of family history, and resources for patients to record their genetic family histories. In The Practical Guide to the Genetic Family History, 2nd edition. Hoboken, NJ: Wiley-­ Blackwell, 2010, 220–229. Bennett RL, French KS, Resta RG, Austin J. Practice resource-focused revision: Standardized pedigree nomenclature update centered on sex and gender inclusivity: A practice resource of the National Society of Genetic Counselors. J Genet Couns. 2022;00:1–11. Dominguez FJ, Lawrence C, Halpern EF, et al. Accuracy of self-­reported personal history of cancer in an outpatient breast cancer. J Genet Couns. 2007;16:341–345.

6. Cancer Family Histories (Collection and Interpretation)

305

Lindor NM, McMaster ML, Lindor CJ, et al. Concise handbook of familial cancer susceptibility syndromes, 2nd edition. J Natl Cancer Inst Monographs 2008;38:1–93. NCCRT Family History Toolkit. http://nccrt.org/what-­we-­do/resources-­for-­professionals/. 2018. Schuette JL, Bennett RL. The ultimate genetic tool: the family history. In Uhlmann WR, Schuette JL, Yashar BM (eds), A Guide to Genetic Counseling. Wiley-­Blackwell, Hoboken NJ, 2009. Veach PM, LeRoy BS, Bartels DM. Gathering information: asking questions and taking patient genetic ­history. In Facilitating the Genetic Counseling Process: A Practice Manual. Springer, New York, 2003, 73–92.

CHAPTER

7 Cancer Risk Assessment and Risk Models

“Opportunity and risk come in pairs”. —Bangambiki Habyarimana, The Great Pearl of Wisdom

An essential part of a cancer genetic counseling encounter is providing personalized risk assessment. Risk assessment tools often use models that combine personal health history information, family history information, non-­disease indicators of risk, and genetic/genomic data. All predictive models have strengths, weaknesses, and limitations based on the methodology, sample size, and/or population used to create the model. These models are evolving constantly. Cancer genetic counselors often provide two different risk estimates: the likelihood of carrying a pathogenic variant in a cancer susceptibility gene and the risk of developing a specific form of cancer. A detailed and accurate personal and family history (see Chapter  6) is necessary when providing individuals with their probability of harboring a pathogenic variant in a cancer susceptibility gene as well as the likelihood of developing a specific cancer. Models that assess the likelihood of a pathogenic variant often include the use of empiric data, statistical models, population prevalence data, Mendel’s laws, Bayesian analysis, and specific health information, such as tumor-­specific features. These pathogenic variant prediction models can be combined with gene penetrance data to estimate the likelihood that an individual will develop a specific type of cancer.

Counseling About Cancer: Strategies for Genetic Counseling, Fourth Edition. Katherine A. Schneider, Anu Chittenden, and Kristen Mahoney Shannon. © 2023 John Wiley & Sons Ltd. Published 2023 by John Wiley & Sons Ltd.

307

308

Counseling About Cancer

It is imperative that the genetic counselor understands the nuances of risk assessment in order to effectively communicate these two different risk figures with individuals and collaborating providers. This chapter defines the concept of risk, discusses the concept of risk perception, describes cancer risk factors, provides an overview of various cancer risk assessment models, and distinguishes “risk” from “criteria.” It concludes with case examples and discussion questions.

7.1.  Risk Definitions It is important to understand the concept of risk and the various ways risk can be categorized. The following sections define absolute risk, relative risk, odds ratios, genetic risk, and absolute risk. 7.1.1.  Absolute Risk Absolute risk is the risk of developing a specific disease (e.g., breast cancer, colon cancer) over a specific time period. Some examples of absolute breast cancer risk prediction tools can be found in Table 7.1. Short-­term risk calculations (e.g., risk of breast cancer in the next 5 years) are often helpful to patients and clinicians when making decisions about screening decisions, for example, when deciding how frequently to perform screening colonoscopy. Lifetime cancer risk calculations help make decisions about other prevention options, for example, when deciding whether a patient should undergo risk-­reducing surgery. 7.1.2.  Relative Risk Relative risk (RR), also known as risk ratio, compares the risk of an event (e.g., diagnosis of cancer) in one group to the risk of the same event occurring in another group. Most often when discussing cancer outcomes, the RR compares the risk of cancer in one group to the risk of cancer in the general population. In general, the values of relative risk are interpreted as: •• ••

••

RR = 1 means that two groups have the same risk of developing cancer. RR < 1 means that the risk of developing cancer in the group is less than the risk in the general population. RR > 1 means that the risk of developing cancer in the group is greater than the risk in the general population.

TABLE 7.1.  Absolute Breast Cancer Risk Prediction Tools Tool Gail BRisk/Claus Tyrer-­Cuzick (IBIS) CRAHealth FRA-­BOC

Access www.cancer.gov/bcrisktool Apple App store www.ems-­trials.org/riskevaluator https://www.crahealth.com/risk-­assessment-­platform https://canceraustralia.gov.au/clinical-­best-­practice/gynaecological-­cancers/ familial-­risk-­assessment-­fra-­boc

309

7. Cancer Risk Assessment and Risk Models

7.1.3.  Odds Ratio Odds ratio (OR) is not the same as relative risk (RR). An OR is a statistic that quantifies the strength of the association between two events. It refers to the probability of occurrence of an event/probability of the event not occurring. When there is no association between the two events, both OR and RR are equal to 1.0. When there is an association between the two groups, OR exaggerates the estimate of their relationship (is farther from 1.0 than RR). 7.1.4.  Genetic Risk Genetic risk is the probability that something will occur (e.g., diagnosis of cancer) based on the knowledge of its inheritance pattern and disease penetrance. Genetic risk typically refers to the probability of an individual carrying a specific disease-­associated pathogenic variant, or of being affected with a specific genetic disorder. 7.1.5.  Empiric Risk Empiric risk is the probability that something will occur (e.g., diagnosis of cancer) based on experience rather than on the knowledge of the causative mechanism. When an inherited ­susceptibility to cancer is unlikely, the use of empiric risk data can be helpful (see Table 7.2).

TABLE 7.2.  Empiric Risks of Specific Cancers Lifetime Risk (%) Cancer Type

Females

Males

Increased Risk with a First-­Degree Relative

Bladder Brain and CNS

1.8 0.55

3.86 0.69

Esophagus Hodgkin lymphoma Kidney and renal pelvis Liver and bile duct Lung and bronchus Melanoma of the skin Multiple myeloma Non-­Hodgkin lymphoma Prostate Stomach Testicles

0.24 0.20 1.23 0.62 6.05 1.79 0.71 1.93 – 0.66 –

0.80 0.24 2.16 1.44 6.70 2.77 0.93 2.43 11.60 1.07 0.4

Cervix Uterus

0.63 3.07

– –

2.34 Varies by type ~2 1.91 3.1 4.3 4.1 1.27–2.08 1.74 2–4 1.7 2–3 1.5–3.5 1.75–4.0 (father) 5–14 (brother) 1.5–2.5 1.3

Source: Adapted from American Cancer Society, Inc.

310

Counseling About Cancer

7.2.  Risk Perception and Cancer Risk Risk can be defined as (1) the probability of harm and (2) the magnitude of harm. In the context of cancer risk assessment, “harm” is typically the likelihood of having an inherited cancer syndrome and/or the likelihood of developing cancer. Risk perception is the subjective assessment of the probability and magnitude of harm. It is these perceptions of risk—­not the actual numerical risk—­that often have the greatest impact on people’s responses and actions. For example, individuals who are convinced that they will develop cancer someday may demand the risk-­reducing surgical options provided to those at highest risk even if their actual estimates of cancer risk do not support these practices. A heightened perception of risk may lead to needless anxiety or counterproductive coping strategies and can impact screening behaviors. This section discusses factors that contribute to one’s perception of risk.

7.2.1.  Factors That Contribute to Risk Perception According to risk expert, David Ropeik, (https://nieman.harvard.edu/articles/understandingfactors-of-risk-perception/), the perception of danger (risk) is influenced by the following 14 factors: 1. Trust—­People tend to be less fearful about their risks when they trust the individuals providing the information as well as the process used to assess the risk. 2. Origin—­People tend to be less fearful about the risks they incur themselves compared to the ones that others impose on them. 3. Control—­People tend to be less fearful if they perceive that they have some control over the outcomes. 4. Nature—­People tend to find man-­made dangers to be more menacing than dangers found in nature. 5. Scope—­People tend to view cataclysmic events as more frightening than chronic conditions. 6. Awareness—­People’s level of fear can be impacted by media coverage of the danger, with events occurring locally or to people with whom they can relate evoking more fear. 7. Imagination—­People may become confused about the nature of the risk if the threats are invisible or hard to understand, and this can engender more fear. 8. Dread—­People may have more fear of events that invoke dread than events that do not. 9. Age affected—­People tend to be more fearful of events/dangers that can impact children. 10. Uncertainty—­People tend to be more fearful when individuals fail to communicate what is known about the event/danger or when the risks are simply unknown. 11. Familiarity—­People tend to be more fearful of novel dangers compared to more familiar ones.

7. Cancer Risk Assessment and Risk Models

311

12. Specificity—­People who hear about specific victims described in the media may have a greater emotional reaction to the event, which in turn may lead to heightened senses of risk and danger. 13. Personal impact—­Risks that affect people personally are more frightening than those that affect strangers. 14. Fun factor—­The risk involved in certain activities may be downplayed if the activities are pleasurable. Examples include tanning booths and tobacco use.

7.2.2.  Changes in Risk Perception Risk perception can change over time, depending on the individual’s life experiences and the specific situations that arise. Multiple factors go into the personal formulation of how risks are perceived and handled. Important factors in cancer risk perception include the following: ••

••

••

Affective factors—­Affective factors include an individual’s overall mental health status, fear of cancer, and the number of intrusive thoughts about their risks. Affective emotions are extremely important, as they are the filter through which all situations are evaluated. This allows individuals to search for and focus on the information necessary for the situation, to compare and contrast different situations, and to motivate their behavior going forward. In general, two dimensions of emotion are triggered by being confronted by risk: (1) the immediate emotions caused by initially learning about the risk and (2) the anticipated emotions that are expected to be experienced in the future. The stronger the emotional response, the higher the risk will be perceived and learned coping strategies will be employed (for better or worse) see Section  11.2.2. For chronic risk situations, such as those experienced by individuals who are cancer patients or at risk for cancer due to a positive genetic test result, this cycle of risk and facing danger is continually repeated, which can be both mentally and emotionally draining. Clinical factors—­Clinical factors include an individual’s objective estimates of cancer risk based on genetic testing results and/or cancer risk models, the person’s personal and family cancer experiences including the type of cancer involved, and the nature and outcome (or projected outcome) of treatment. Other factors that can impact the risk of disease and possible treatment options include the person’s overall level of health, the presence of other acute or chronic medical conditions, such as ulcerative colitis or diabetes, and certain lifestyle behaviors, such as smoking or excessive alcohol use. Cognitive factors—­Cognitive factors include the individual’s knowledge about cancer, familiarity with medical terminology, and ability to process numerical information (numeracy skills). Individuals, especially those who are low in numeracy, may view statistical risk estimates as higher than the actual numbers suggest and their understanding of risk may vary depending on how the information is presented (e.g., gain or loss; ­percentage or frequency). One important factor in risk perception is the way in which individuals mentally interpret, encode, store, and retrieve risk information. There are the “verbatim” representations of risk (i.e., the actual percentages and numbers), and there

312

••

••

Counseling About Cancer

are the “gist” representations of risk, which are based on a conglomeration of all the factors mentioned in this section. People, especially as they become older and gain expertise, tend to rely more heavily on gist representations of risk than on verbatim ones. The reliance on gist is generally associated with more advanced decision-­making skills and fewer unhealthy risk-­taking behaviors. Coping and personality factors—­Coping strategies and other personality factors refer to how well an individual manages and adapts to challenging or uncertain situations. This includes the types of coping strategies that the individual employs or has employed in the past (see Section 11.2.2) and personality factors such as locus of control, tendency toward optimism or pessimism, and having a reward/punishment mindset. Demographic and other important factors—­These include demographic factors such as education level, age, and possibly also marital status, employment, ethnicity/race, gender; geographic location, including proximity to oncology and genetics services; and other factors, such as an individual’s worldview, community, values, and spirituality.

7.3.  Risk Factors In order to understand the nuances of risk modeling, the genetic counselor must understand the various factors that are included in the risk models. The most common risk factors for cancer include aging, family history of cancer, benign disease, nondisease clinical findings, and exposures. It is important to note that risk factors change over time. For example, as an individual ages, their sporadic risk of developing a malignancy increases but their risk of having a gene pathogenic variant decreases. The details of collecting a family history are discussed at length in Chapter 6. The following section discusses other disease and nondisease risk factors that can influence cancer risk, some of which may be included in specific risk models. This section also reviews some common exposures that can increase cancer risk. 7.3.1. Exposures Some commonly discussed risk factors, along with the cancer type that individuals exposed to those risk factors are at increased risk for, are listed in the following subsections (also see Table 7.3). 7.3.1.1. Hormones Hormone exposure (specifically to estrogen) is sometimes used in calculation of risk. ••

Oral contraceptives (OCs) vary in content. Most commonly prescribed OCs include estrogen and progestin, but the “mini-­pill” contains only progestin. Studies of the ­relationship between OC use and cancer are most often observational, which limits their

313

7. Cancer Risk Assessment and Risk Models

TABLE 7.3.  Exposures and Associated Cancer Risk Risk Factor Alcohol Tobacco UV radiation* Obesity Infectious agents Epstein-­Barr virus (EBV) Hepatitis B virus (HBV) and hepatitis C virus (HPC) Human immunodeficiency virus (HIV) Human papillomaviruses (HPV) Human T-­cell leukemia/lymphoma virus type 1 (HTLV-­1) Kaposi sarcoma-­associated herpesvirus (KSHV) Merkel cell polyomavirus (MCPyV) Helicobacter pylori (H. pylori) Opisthorchis viverrini Schistosoma hematobium

Cancer Type Mouth, throat, esophagus, larynx, liver, breast Lung, larynx, mouth, esophagus, throat, bladder, kidney, liver, stomach, pancreas, colon and rectum, cervix and AML Melanoma, nonmelanoma skin cancer Breast (postmenopausal women), colon, rectum, endometrium, esophagus, kidney, pancreas, gallbladder Lymphoma, nose and throat Liver cancer Kaposi sarcoma, lymphomas, cervix, anus, lung, liver, and throat Cervical, anal, oropharyngeal, vaginal, vulvar, and penile Adult T-­cell leukemia/lymphoma Kaposi sarcoma, lymphoma Skin (Merkel cell carcinoma) Stomach (noncardia gastric cancer), lymphoma of stomach lining (gastric MALT lymphoma) Bile duct (cholangiocarinoma) Bladder

* UV exposures include exposure to sun, sunlamps, and tanning booths. UV risk can be influenced by geographic regions, because rates of melanoma are higher in areas of high ultraviolet B radiation (e.g., high altitude or areas with bright sunlight year-­round).

••

••

applicability. However, it is most widely agreed that the risk of breast and cervical cancer increases with OC use but the risk of endometrial, ovarian, and colon cancer is reduced. Menopausal hormone therapy also varies, with some therapy including estrogen and progestin and other therapy including only progestin. Studies suggest that women who take estrogen alone have a lower risk of breast cancer, and women who take estrogen plus progestin have a higher risk of breast cancer. Reproductive history factors have been associated with risk of breast cancer: •• Increased risk of breast cancer •• Older age at first childbirth •• Recent childbirth •• Diethylstilbestrol (DES) •• Decreased risk of breast cancer •• Early age (≤35) at first pregnancy •• Increase in number of births

314

Counseling About Cancer

History of preeclampsia •• Longer duration of breastfeeding The risk of cancer with fertility treatment is often questioned by patients. Most evidence shows that there is no increased risk of breast or endometrial cancer. The risk of ovarian cancer associated with fertility treatment remains uncertain. Diethylstilbestrol (DES) is a synthetic form of estrogen that was prescribed to pregnant women between 1940 and 1971 to prevent miscarriage, premature labor, and other related complications of pregnancy. Males exposed to DES in utero have an increased risk of testicular abnormalities, including undescended testicles or development of cysts in the epididymis. Females exposed to DES in utero have increased risks of reproductive tract anomalies, premature birth, miscarriage, and ectopic pregnancy. In addition, daughters of women who used DES while pregnant are at increased risk of: •• Clear cell adenocarcinoma •• Breast cancer •• Pancreatic cancer •• Cervical and vaginal precancers and cancers ••

••

••

7.3.2.  Benign Disease Various nonmalignant diseases can be indicators of increased risk of specific cancers. The following subsections describe, by tissue type, diagnoses that can be used by health care providers when calculating the risk of developing cancer. It is important to recognize that this is not a comprehensive list. 7.3.2.1. Breast ••

••

Atypia Hyperplasia of breast tissue is an overgrowth of cells that line the milk ducts or lobules of the breast. Hyperplasia can be “usual” (normal) or “atypical.” Although atypical hyperplasia typically does not result in a lump that can be palpated, changes in the breast as a result of hyperplasia can often be seen on a mammogram. The diagnosis is made after a biopsy of the tissue is obtained and pathologically examined. Typically there are two layers of cells lining the ducts and breasts. Hyperplasia describes tissue in which there are more cells, resulting in more than two layers of cells in the lining. ADH/ ALH is not cancer but can affect the risk for developing breast cancer. The risk of breast cancer in a woman who has a diagnosis of ADH or ALH is about four to five times higher than for a woman in the general population. ADH or ALH is typically not associated with a hereditary risk of breast cancer. Lobular carcinoma in situ (LCIS) LCIS is a diagnosis of abnormal (carcinoma) cells that are confined to the layer of cells inside the lobule of the breast and have not spread to any surrounding tissue in the

7. Cancer Risk Assessment and Risk Models

315

breast. It can be neither viewed on mammogram nor felt on clinical breast exam and is most often diagnosed when a breast biopsy is done for another breast problem. Although the diagnosis includes the term “carcinoma,” it is not considered breast cancer because it rarely develops into invasive cancer if left untreated. Women with LCIS are as likely to develop breast cancer in the contralateral breast as they are in the breast where the LCIS is found. LCIS is therefore considered a risk factor for the development of breast cancer and this elevated risk is lifelong. Most commonly women with LCIS are estimated to have up to a 30–40% lifetime risk of developing breast cancer. LCIS is typically not associated with a hereditary risk of breast cancer. 7.3.2.2. Colon ••

••

Polyps Polyps are abnormal growths in the lining of the colon. They are most often benign and characterized as either adenomatous (adenomas) or hyperplastic. Other less common but important polyps include serrated and juvenile polyps. Most hyperplastic polyps are benign and not associated with increased cancer risk. Adenomatous polyps are indeed benign but can develop into colorectal cancer if they are not removed. An individual’s risk of developing cancer increases with the number and size of colon polyps. The risk for colon cancer is thought to be about 2.5 times higher in individuals who are found to have advanced (high-­grade or severely dysplastic) adenomatous polyps but is not as high for those individuals whose polyps are low grade (mild or moderately dysplastic). Inflammatory bowel disease (IBD) IBD (including ulcerative colitis or Crohn’s disease) increases an individual’s risk of developing colorectal cancer. Individuals with IBD can develop dysplasia in their colon. Dysplasia itself is not cancer, but the dysplastic cells can change into cancer over time. The risk of colorectal cancer is higher with a greater extent of disease and length of time of active disease (as opposed to well-­controlled disease). The risk of colon cancer in an individual with IBD is estimated to be 2% after 10 years of disease, 8% after 20 years of disease, and 18% after 30 years of disease.

7.3.2.3. Skin ••

Moles Moles (also known as nevi) are benign pigmented skin tumors. Individuals with many moles are more likely to develop melanoma. Individuals with atypical moles (also known as dysplastic nevi) are at risk for melanoma because on occasion the atypical mole can develop into a melanoma. Individuals who were born with moles (also known as congenital melanocytic nevi) are at increased risk for developing melanoma. The estimated lifetime risk of a melanoma developing in a congenital melanocytic nevi can be up to 5%.

316

Counseling About Cancer

7.3.2.4. Ovary There is no obvious causal link between gynecologic benign disease and the risk of developing ovarian cancer. There is no data that suggests polycystic ovarian syndrome increases the risk of ovarian cancer. Some studies have suggested that women with endometriosis have an increased risk for developing certain types of ovarian cancer, but the data is limited. 7.3.2.5. Pancreas ••

••

••

••

Chronic pancreatitis Pancreatitis is a disease in which the pancreas becomes inflamed. With acute pancreatitis the onset is sudden and lasts only a short amount of time. Chronic pancreatitis is defined as long-­term inflammation of the pancreas. Chronic pancreatitis is associated with an approximately two-­to threefold increased risk of pancreatic cancer. It is important to note that there are inherited forms of chronic pancreatitis. Intraductal papillary mucinous neoplasms (IPMNs) of the pancreas IPMNs are nonmalignant tumors that grow within the pancreatic ducts and are characterized by the production of thick, mucinous fluid. They are typically diagnosed incidentally on imaging as they are most often asymptomatic. These benign tumors are typically classified into main duct type IPMNs or branch duct type IPMNs. Some IPMNs progress to invasive cancer if left untreated, and data suggest that the risk is much higher for main duct type IPMNs than for branch duct type IPMNs. As many as 70% of main duct type intraductal papillary mucinous neoplasms harbor high-­grade dysplasia or an invasive cancer. Pancreatic intraepithelial neoplasia (PanIN) PanIN is considered a precursor to invasive pancreatic cancer. PanIN is defined as a microscopic papillary or flat and noninvasive epithelial neoplasm arising from the pancreatic ductal epithelium. There have not been good studies of individuals with PanINs who later developed an invasive pancreatic cancer. Based on estimates of the prevalence of PanINs and the known prevalence of invasive pancreatic cancer, some have estimated a 1% probability of a single PanIN lesion progressing to invasive cancer. Other noncancer disease, such as diabetes and cirrhosis of the liver, can increase the risk of pancreatic cancer.

7.3.2.6. Prostate ••

••

Benign prostatic hyperplasia (BPH) is a nonmalignant enlargement of the prostate caused by cellular hyperplasia. It is a common age-­associated disease that affects 70% of men aged 70 years or over. The data on the association between BPH and prostate cancer is incredibly inconsistent and has sparked a great deal of debate within the oncology community. Prostatic intraepithelial neoplasia (PIN) is a condition defined by a neoplastic growth of epithelial cells within preexisting benign prostatic acini or ducts. Because PIN satisfies

7. Cancer Risk Assessment and Risk Models

317

almost all the requirements for a premalignant condition, high-­grade PIN (HGPIN) is widely accepted as a precursor to prostate cancer. Although HGPIN is thought to increase the risk of prostate cancer, recent studies have found that the risk is not as great as once believed. 7.3.2.7. Uterine ••

Endometrial intraepithelial neoplasia (EIN), also known as complex atypical hyperplasia, is a premalignant lesion of the uterine lining that predisposes to endometrioid endometrial adenocarcinoma. EIN is associated with a 40% risk of concurrent endometrial cancer at the time of hysterectomy.

7.3.3.  Nondisease Indicators of Risk There are other indicators of risk that are not diseases or diagnoses. For example, aging is a risk factor of many types of cancer (see Section  1.4). The following subsections review some the important indicators of risk and their effect on disease risk calculation. 7.3.3.1.  Breast density can indicate breast cancer risk Breast tissue is described as dense if the tissue has very little fat tissue. It is a characteristic most often described on mammography and is very common. There are various ways to measure breast density, including visual analogue scale (VAS), thresholding (Cumulus), and fully automated methods (Densitas, Quantra, Volpara). Breast density in the United States is most often classified into four categories according to the Breast Imaging Reporting and Data System (BI-­RADS), with category 1 being where the breasts are almost all fatty tissue and category 4 being where the breasts are mostly glandular and fibrous tissue. Dense breast tissue can make diagnosing cancer on mammography more difficult but is also an independent risk factor for breast cancer. Some studies indicate that women with dense breasts are at a slightly elevated risk of developing breast cancer, although there is little understanding as to why this phenomenon occurs. Most women’s breasts become less dense as they age. 7.3.3.2.  Single nucleotide polymorphisms (SNPs) can indicate the relative risks of different types of cancer SNPs act as biological markers for complex diseases, like cancer. Most studies of cancer risk based on SNP technology have been normalized in individuals of White European ethnicity and should not be used to predict risk in individuals of other ethnicities. Common SNPs have recently been found to confer relative risks of breast cancer ranging from 1.03 to 1.57. A personalized risk score (PRS) combines the risk contribution of multiple SNPs to generate a single risk estimate that is more comprehensive than the risk estimate that can be obtained from any of the individual SNPs. A PRS can include combinations of over 100 SNPs. The average

318

Counseling About Cancer

PRS should be 1.0, but it has been noted that many individuals are below this (the lowest being 0.3). Most women will have a PRS between 0.4 and 2.0. The mathematical strategies for combining information from multiple SNPs are not straightforward, and more study is needed to determine the utility of PRS in individuals and populations. 7.3.3.3.  Skin complexion can give insight into the level of risk of melanoma. The risk of melanoma is much higher for White individuals than for non-White individuals. White individuals with red or blond hair, blue or green eyes, or fair skin that freckles or burns easily are at increased risk of melanoma.

7.4.  Risk Modeling There are two distinct risk classifications facing the genetic counselor in the cancer genetics clinic: the risk that an individual will develop cancer and the risk that an individual harbors a pathogenic variant (PV) in a cancer susceptibility gene. Risk-­prediction models are based on combinations of risk factors, many of which were described earlier in this chapter. Some risk assessment models are aimed primarily at providing one classification of risk (i.e., disease risk or PV risk) whereas others provide both risk classifications. It is important to note that no risk assessment model to date is absolutely accurate as to which family has a PV and which individual will develop cancer. It is imperative to understand how a risk model was developed, the purpose for its development, and the underlying statistical methods used to calculate risk. Recognizing these nuances can help assess how appropriate the model is to a particular population or individual. It is important to be aware of the difference between developing a model to project risks and developing a model from a cohort for which follow-­up data already exists. The Gail model, for example, was developed using a case-­control study. In this type of model, the risk for developing cancer is calculated assuming no other competing mortality factors (e.g., death). For that reason, a specific adjustment needs to be made to ensure that the risk calculation is appropriate. The Breast Cancer Surveillance Consortium (BCSC) model, on the other hand, was created by fitting the model to a cohort of women for which outcomes (e.g. deaths) were already known. In this type of model the competing mortality can be included in the calculations. Understanding the purpose for model development is also important. The Tyrer Cusick model, for example, was developed to determine eligibility for the International Breast Cancer Intervention Study. The Gail model was developed to determine eligibility for tamoxifen trials. The Gail determined a cutoff (a 5-­year risk of 1.66%, which is the risk of a woman 65 years old and older of developing cancer) for a woman to be eligible for such a trial. This is why the “1.66%” datapoint is so important as an outcome of this model. Some risk models are based on segregation prediction and calculate cancer risk based solely on estimating the likelihood of carrying major genes based on a personal and family history of cancers related to these genes. The main aim of these models is to estimate the risk of being a gene PV carrier. They are mostly used for individuals with a strong family history in order to determine eligibility for genetic testing. Segregation models are less suitable for risk assessment of breast cancer in the general population. Other models use regression analysis to estimate the

7. Cancer Risk Assessment and Risk Models

319

relationships between a dependent variable and one or more independent variables. The risk factors (variables) included, the prevalence of risk factors, and the use of interaction terms vary widely between the regression analysis models. These regression type models are not good at predicting an individual woman’s risk but are used to give the average risk for a group of women with similar risk factors. 7.4.1.  Risk of Developing Cancer (Cancer Risk) The likelihood that an individual will develop a specific type of cancer is often an important datapoint when managing patients. Many clinical decisions will be based on this risk figure and it is important to understand the different ways this can be calculated. The following subsections describe models that are often used to predict risk of developing a specific type of cancer. 7.4.1.1.  Breast Cancer Risk ••

••

Gail (Breast Cancer Risk Assessment Tool) The Gail model, also known as the Breast Cancer Risk Assessment Tool, is an interactive tool developed by scientists and maintained by the National Cancer Institute (NCI). The Gail model uses personal medical factors (previous breast biopsy history, age at menarche, age at first childbirth) as well as family history information (number of first-­ degree relatives with breast cancer) to calculate the absolute 5-­year risk and lifetime risk (up to age 90) of developing invasive breast cancer. The model has been validated for use in individuals of various ethnic backgrounds in the United States, including White women, Black/African American women, Latinx women, and Asian and Pacific Islander women. It is not an appropriate model to use in women with BRCA1/2 pathogenic variants, women who have had previous radiation therapy to the chest, women who are less than age 35 or over age 85, women who have a paternal family history of cancer, women who have family histories with other cancers (e.g. ovarian cancer) that contribute to hereditary breast cancer risk, or women with a previous diagnosis of breast cancer, DCIS, or LCIS. Breast Cancer Surveillance Consortium (BCSC) Risk Calculator The BCSC Risk Calculator is an online (application) interactive tool designed to estimate a woman’s risk of developing invasive breast cancer. Five-­and 10-­year breast cancer risk calculations are based on age, race/ethnicity, family history of breast cancer in a first-­ degree relative (mother, sister, or daughter), history of a breast biopsy (core biopsy, ­excisional biopsy, or fine-­needle aspiration) with benign breast disease diagnoses if known, BI-­RADS® breast density (radiologic assessment of the density of breast tissue by a radiologist who interprets mammograms). The tool calculates risk only when information on all five of these factors are entered into the calculator, but unknown values are allowed for race/ethnicity and family history. It is not appropriate to use for women younger than age 35 or older than age 74, women with a previous diagnosis of breast cancer, women with a previous diagnosis of DCIS, women who have had previous breast augmentation, or women who have had previous mastectomy.

320

••

••

Counseling About Cancer

Tyrer-­Cuzick model The Tyrer-­Cuzick model is an online calculator that predicts an individual woman’s absolute 10-­year and lifetime risk for developing cancer. It takes into account both personal history factors (age at menarche, height, weight, childbearing history, menopausal status, use of hormone replacement therapy, breast density, Ashkenazi Jewish ancestry, history of breast biopsy, history of ADH or LCIS) as well as family history of breast cancer including first-­and second-­degree relatives, first cousins, and male breast cancer. The model assumes that breast cancer is inherited in an autosomal dominant fashion and that there is a gene that predisposes to breast cancer in addition to BRCA1/2 with an assumed penetrance of ~22%. The program calculates the risk of a woman carrying a pathogenic variant in a cancer predisposition gene, takes other health history factors into consideration, and finally provides an absolute risk of breast cancer. It has not been widely used outside the White population. Claus (BRisk) The Claus model calculates a woman’s lifetime risk of breast cancer based on family history only. It was developed based on a population-­based, case-­control study and assumes that breast cancer is transmitted as an autosomal dominant trait. The model uses the number of first-­and second-­degree relatives with breast cancer and the age at diagnosis of the cancer, and calculates risk based on the familial relationships between the affected women and the individual at risk. It does not include other personal medical risk factors for breast cancer. The model distinguishes between maternal and paternal relatives but only can use up to two relatives with breast cancer in the calculation. Also, it does not account for all possible relationships (e.g., grandmother and mother). It is not appropriate to use in individuals with no family history of breast cancer and may underestimate the risk of breast cancer in individuals with more significant family histories of breast and other cancers (e.g., ovarian cancer).

7.4.1.2.  Colon Cancer Risk ••

Colorectal Cancer Risk Assessment Tool (NCI) (https://ccrisktool.cancer.gov/) The Colorectal Cancer Risk Assessment Tool is an interactive tool developed by scientists and maintained by the National Cancer Institute (NCI). It uses personal medical factors (age, sex, height, weight, diet, and physical activity factors, colonoscopy history, and aspirin and NSAID use) as well as family history information (number of first-­ degree relatives with breast cancer) to calculate the absolute 5-­year risk and lifetime risk of developing colorectal cancer. It has been validated for use in individuals of various ethnic backgrounds in the United States, including White men and women, Black/ African American men and women, Latinx men and women, and Asian and Pacific Islander men and women. It is not an appropriate model to use in individuals of Native American descent. In addition, it should not be used if an individual is known to have ulcerative colitis, Crohn’s disease, familial adenomatous polyposis (FAP), Lynch syndrome, or a personal history of colorectal cancer.

7. Cancer Risk Assessment and Risk Models

321

7.4.1.3.  Melanoma Risk ••

Melanoma Risk Calculator (www.cancer.gov/melanomarisktool/) This online tool was designed by scientists at the National Cancer Institute (NCI), the University of Pennsylvania, and the University of California, San Francisco to estimate a person’s absolute risk of developing invasive melanoma. It is not applicable for individuals who have already been diagnosed with melanoma or nonmelanoma skin cancer or those individuals who have a family history of melanoma. It is based on non-­Latinx White individuals and thus its applicability to individuals of other ethnicities is limited.

7.4.1.4.  Ovarian Cancer Risk ••

••

CRA Health Risk Assessment Platform The CRA Health Risk Assessment Platform offers a wide range of cancer risk assessment software and services. The risk assessment software tool includes many models, including Tyrer-­Cuzick, BRCAPRO, Claus, Myriad, and Gail, and provides a single tool that runs all the models and provides output. This software platform offers many additional services such as letter generation. FRA-­BOC (https://canceraustralia.gov.au/clinical-­best-­practice/gynaecological-­cancers/ familial-­risk-­assessment-­fra-­boc) FRA-­BOC is an online tool developed and maintained by the Australian government. It provides advice on who should be referred for further genetic evaluation based on family history only. It accounts for maternal and paternal lineages, Ashkenazi Jewish ancestry, and first-­and second-­degree relatives, and includes diagnoses of both breast and ovarian cancer, age at diagnosis of breast cancer, and bilateral breast cancer. The advice is provided in the context of a much larger analysis of personal and family history, and no direct links to genetics programs are provided.

7.4.1.5.  Pancreatic Cancer Risk ••

••

An absolute risk model to identify individuals at elevated risk for pancreatic cancer in the general population was developed at Johns Hopkins University. The risk model includes known risk factors (current smoking, heavy alcohol use (>3 drinks/day), obesity (body mass index >30 kg/m(2)), diabetes >3 years, family history of pancreatic cancer, non-­O ABO genotype (AO vs. OO genotype), and a specific genetic marker called rs9543325(13q22.1). The Pancreatic Cancer Action Network has an online tool (https://www.pancan.org/ facing-­pancreatic-­cancer/about-­pancreatic-­cancer/risk-­factors/risk-­assessment-­test/) that takes into consideration gender, age, obesity, smoking status, Jewish ethnicity, race, personal cancer history, family history of cancer, diabetes history, and family history of pancreatitis. The model differentiates between average and high risk for developing pancreatic cancer. It is unclear whether this model has been validated for use.

322

••

Counseling About Cancer

PancPro was built by extending the Bayesian modeling framework developed for BRCAPRO (see Section 7.4.2.2). It was validated using independent prospective data on families enrolled in the National Familial Pancreas Tumor Registry. It assumes a hypothetical autosomal dominant pancreas cancer gene and calculates the risk that the individual has the hypothetical gene. It also calculates the lifetime risk of pancreatic cancer using this a priori gene risk and estimated data of penetrance.

7.4.2.  Risk of Hereditary Cancer (Gene Pathogenic Variant Risk) This section describes models that are used to determine the likelihood that an individual has hereditary cancer. This differs from the models in the previous section that predict the likelihood an individual will develop cancer. It is important to recognize that each of these modalities listed in this section takes into consideration different factors and calculates risk in various ways. None is the gold standard and most risk assessment programs use a number of these modalities and will quote the patient’s risk in the form of a range. 7.4.2.1.  Clinical Diagnostic Criteria Clinical diagnostic criteria exist for many of the known hereditary cancer susceptibility syndromes. In many cases, if an individual meets the criteria for diagnosis, the person is said to have the disease even if they do not carry an identifiable pathogenic variant in a gene. Individuals who meet diagnostic criteria should be counseled that they should follow established management guidelines for the disease in question. In many cases, these criteria can give the genetic counselor a better idea of how likely that person is to carry a pathogenic variant. ••

••

••

Hereditary Breast and Ovarian Cancer Syndrome (HBOC) (see also Section 3.3.2) There is no widely accepted definition of HBOC, and thus estimating the likelihood that an individual will carry a pathogenic variant in the BRCA1/2 gene is typically assessed using other modeling techniques (see the Risk Modeling section later in this chapter). (Classic) Li-­Fraumeni Syndrome (LFS) (See also 3.3.6) Individuals who meet the classic LFS criteria have a ~70% chance of carrying a pathogenic variant in TP53.Indivduals who have Li-­Fraumeni-­like syndrome (LFL) by definition 1 have a ~20% chance of carrying a pathogenic variant in TP53 and by definition 2  have an 8% chance of carrying a TP53 pathogenic variant (see full definitions in Section 3.3.6). PTEN Hamartoma Tumor Syndrome (PHTS) (see also Section 3.3.11) Individuals who meet clinical criteria for Cowden syndrome (CS), Bannayan–Riley– Ruvalcaba syndrome (BRRS), proteus syndrome (PS), or proteus-­like syndrome (PLS) have varying risks of carrying a pathogenic variant in PTEN. Table 7.4 lists the phenotypes and the likelihood of identifying a pathogenic variant in PTEN using various ­testing methodologies.

323

7. Cancer Risk Assessment and Risk Models

TABLE 7.4.  Likelihood of detecting a PTEN PV by PHTS phenotype Proportion of Probands by Phenotype with a PV detectable by test method Test Method Sequencing of coding region Deletion/duplication analysis Sequence analysis of promoter region

CS

BRRS

PLS

PS

25-­50% Unknown but cases exist 10%

60% 11% Unknown but cases exist

50% Unknown Unknown

20% Unknown Unknown

CS = Cowden syndrome BRRS = Bannayan-­Riley-­Ruvalcaba syndrome PLS = Proteus-­like syndrome PS = PTEN-­related Proteus syndrome Adapted from: Lamis Yehia et al. (2021)/University of Washington. https://www.ncbi.nlm.nih.gov/books/NBK1488/ ••

••

••

••

••

Lynch Syndrome (see also Section 2.5) Individuals who meet Amsterdam criteria for a diagnosis of Lynch syndrome have a ~50% chance of having an identifiable pathogenic variant in MLH1, MSH2, MSH6, EPCAM, or PMS2. Familial Adenomatous Polyposis (FAP) (see Section 2.6) Approximately 80% of individuals who meet a clinical diagnosis of classic FAP have a detectable pathogenic variant in APC. Fewer than 30% of individuals with the attenuated phenotype have a detectable pathogenic variant in APC. Individuals with attenuated polyposis who are APC negative should be tested for MUTYH-­associated polyposis (see Section 2.7) and other polyposis syndromes. Familial Atypical Multiple Mole Melanoma Syndrome (FAMMM) (see also Section 4.3.3) An individual with a clinical diagnosis of FAMMM has a 40% or higher chance of carrying a pathogenic variant in the CDKN2A gene. Hereditary Prostate Cancer In the Genetic Evaluation of Men study, researchers used multigene sequencing in 200 men who had prostate cancer or were at increased risk of developing it and found that ~5% of the overall cohort had detectable pathogenic variants. Individuals whose families met criteria for hereditary prostate cancer syndrome had the highest rate of germline pathogenic variants (10.5%). In this study, these genes involved the DNA repair genes BRCA1, BRCA2, ATM, BRIP1, and MSH6—­none of which are considered solely hereditary prostate cancer genes. Hereditary Pancreatic Cancer The genes responsible for most hereditary pancreatic cancer families have not yet been discovered. Only 10–20% of families with hereditary pancreatic cancer will have an identifiable pathogenic variant in a known predisposition gene (BRCA1, BRCA2, PALB2, CDKN2A, ATM, STK11, MLH1, MSH2, MSH6, PMS2, and EPCAM).

324

Counseling About Cancer

7.4.2.2.  Models That Predict Gene Pathogenic Variant Status There are various online tools that can provide a risk figure to describe the likelihood a patient carries a pathogenic variant in a gene. This risk is quite different than the risk that an individual has an inherited condition. Some of these tools are cumbersome and require a great deal of time and effort to complete. Others are much more nimble and can be used more easily in clinic. Some software developers have created programs that combine these models into one program to allow for simpler use of multiple models at once. These models can provide the genetic counselor with very different estimates, and none is truly considered the gold standard. Typically, a genetic counseling program will use a few of these models and will carefully provide the patient with a range of risk. The genetic counselor must understand these models, including their known limitations. It is important to note that given the advent of multigene cancer panels, many of these models are not routinely used because they predict a specific gene (e.g., BRCA1/2) only and it is rare to order that specific gene (e.g., BRCA1/2) testing only in current practice. Hereditary Breast and Ovarian Cancer Syndrome (HBOC) The models to predict BRCA1/2 pathogenic variants are the most widely used models in the cancer genetic counseling community and are often available online. These models were built using data in White populations and may not be as applicable in other populations. These models can be used in women both affected and unaffected by cancer. •• Cancer Gene (CaGene) (www4.utsouthwestern.edu/breasthealth/cage/) CancerGene Connect is software based on the Cancer Gene program developed by Dr. David Euhus in 1998. CaGene is a software program that brings together many different risk assessment models as described below. Many of the following models can also be accessed outside of the CancerGene Connect software. •• BRCAPRO (http://bcb.dfci.harvard.edu/bayesmendel/brcapro.php) The original BRCAPRO model developed by Dr. David Euhus in 1998 determined the probability of carrying a BRCA1 pathogenic variant only. The BRCAPRO model has evolved significantly over the past two decades and now includes risk information for BRCA2 as well. The model estimates the probability that an individual is a carrier of a pathogenic variant in BRCA1 or BRCA2 using family history (including both affected and unaffected individuals, ages at diagnosis, and type of cancer) and Bayes’ theorem. It requires completed pedigree data be entered on both affected and unaffected individuals to give an accurate assessment. The model incorporates relevant family history only up to second-­degree relatives, potentially underestimating the probability of BRCA pathogenic variants in individuals with extended family history (e.g. early onset breast cancer or ovarian cancer in cousins). This model is only available via the CAGene software. •• Myriad II (https://www.hereditarycancerquiz.com/) The Myriad II model is based on data collected by Myriad Genetics Laboratories (MGL) based on the personal and family history information obtained from the test request

7. Cancer Risk Assessment and Risk Models

••

••

••

325

forms provided by ordering clinicians as well as gene testing results as performed by MGL. It takes into consideration first-­and second-­degree relatives and tumor type (male breast, female breast or ovarian cancer) and age at diagnosis and provides a probability of a BRCA1/2 pathogenic variant. This model is also available online (outside of CAGene) or via tables available online. A significant limitation of this model is that it relies on the ordering clinician’s reporting of the clinical information on the test request form. It is well known that clinician practices vary widely in this regard, with some clinicians providing comprehensive data on the test request form and others only providing enough information to meet insurance coverage criteria. Couch (http://apps.afcri/upenn.edu/itacc/penn2/) The Couch model (also known as the PENN model) is based on the dataset from University of Pennsylvania (UPenn), whose family histories were obtained from their own clinic population and the BRCA testing done at their facility. The original Couch is for BRCA1 only and averages the age at which breast cancers occur but does not account for the number of breast cancers. Three categories of families with ovarian cancer are included: families with both breast and ovarian cancer, families with breast cancer in addition to a double primary breast and ovarian cancer, and a single-­ case double-­primary individual. In each case the average age at breast cancer is the determinant. This model is also available online (outside of CAGene) or via tables available online. The PENN II model is software based on the Couch model as described in 1997. It is used to predict the prior probability that a patient has a BRCA1 or BRCA2 pathogenic variant. It provides different estimates for maternal and paternal lineages, but it is unclear how, or if, these two estimates could be combined to determine an individual’s overall risk. It takes into consideration first-­, second-­, and third-­degree relatives, cancer type (male and female breast cancer, ovarian cancer, prostate cancer, and pancreatic cancer), and age at diagnosis of breast cancer (only). It excludes probands from families with no breast cancer cases. Ontario Family History Assessment Tool (FHAT) (https://www.timeofcare.com/ ontario-­family-­history-­assessment-­tool/) The FHAT is based on a form originally developed in Canada to select women at risk for breast or ovarian cancer for referral to a genetics center. It is a clinical scoring tool that takes into consideration first-­, second-­, and third-­degree relatives, age at diagnosis of cancer, bilateral breast cancer, breast and ovarian cancer in the same person, and male breast cancer; it also includes colon and prostate cancers. The model produces a referral threshold, which at 10 is equivalent to a twofold relative risk for developing breast or ovarian cancer. This model is also available online (outside of CAGene) or via tables available online. Tyrer-­Cuzick (IBIS) (http://www.ems-­trials.org/riskevaluator/) The IBIS model is downloadable software. It takes into consideration female breast and ovarian cancer and includes only females unaffected by breast cancer. First-­, second-­, and certain third-­degree relatives (cousins only) are included in the analysis. In addition

326

Counseling About Cancer

to providing risk of breast cancer (see Section 7.3.1.1), it provides a proband’s likelihood of carrying a pathogenic variant in BRCA1/2. •• Breast and Ovarian Analysis of Disease Incidence and Carrier Estimation Algorithm (BOADICEA) / CanRisk (https://www.canrisk.org/) BOADICEA is a comprehensive model that can be used to calculate the future risks of developing breast or ovarian cancer as well as calculate the likelihood of carrying ­mutations in the BRCA1, BRCA2, PALB2, ATM, CHEK2, BARD1, RAD51C and RAD51D genes. BOADICEA is based on and validated in a large series of families from the UK. The model uses information on family history, lifestyle/hormonal risk factors, rare ­pathogenic variants in moderate and high risk breast/ovarian cancer susceptibility genes, s­ingle nucleotide polymorphisms (SNPs)/personalized risk scores (PRSs), and mammographic density. The model requires complete pedigree data be entered for both affected and unaffected individuals. It takes into consideration breast, ovarian, prostate, and pancreatic cancer in first-­, second-­, and third-­degree relatives of the proband. BOADICEA was a web-­based application that has been replaced with the CanRisk Web Tool (https:// www.canrisk.org/). PTEN Hamartoma Tumor Syndrome (PHTS) Cleveland Clinic PTEN Risk Calculator (https://www.lerner.ccf.org/gmi/ccscore/) The PTEN Risk Calculator developed by the Cleveland Clinic is an online questionnaire tool that provides an estimation of a person’s risk for having a PTEN pathogenic variant. It takes into consideration the patient’s age, gender, history of cancer, and history of other clinical stigmata associated with PHTS. The risk calculator presents the healthcare professional with an estimated risk, and contextualizes this by including a range of risk. It recommends genetic testing for individuals with an estimated probability of 3% or more. Li-­Fraumeni Syndrome

••

••

LFSPro (https://bioinformatics.mdanderson.org/public-­software/lfspro/) LFSPro is downloadable software available through MD Anderson Cancer Center. The model takes into consideration first-­, second-­, and third-­degree relatives, cancer type, and age at diagnosis. It classifies the cancer type as an LFS tumor (sarcoma, breast, brain, lung, leukemia) or a non-­LFS tumor. It does require complete pedigree information to be entered on all unaffected and affected relatives as it uses a Bayesian algorithm to calculate risk. This model estimates not only that probability that the patient has a TP53 germline pathogenic variant, but also provides the risk that the individual will develop any cancer in the future, the risk that the individual will develop breast cancer, sarcoma, or any other cancers in the future, and the risk that the patient will develop a first or second primary cancer in the future.

7. Cancer Risk Assessment and Risk Models

327

Lynch syndrome/Hereditary Colon Cancer ••

••

Cancer Gene (CaGene) (www4.utsouthwestern.edu/breasthealth/cage/) CancerGene Connect is software based on the Cancer Gene program developed by Dr. David Euhus in 1998. The CaGene software is a singular software program that brings together many different risk assessment models. Many of the models can also be accessed outside of the CancerGene Connect software. MMRPredict (http://hnpccpredict.hgu.mrc.ac.uk) MMRPredict was developed using data from a population-­based cohort of individuals diagnosed with colorectal cancer under age 55 and was validated in a population-­based series of individuals with colorectal cancer diagnosed under age 45. It calculates the probability of pathogenic variants in MLH1, MSH2, or MSH6 and does not include EPCAM or PMS2. Information included in the model includes data on the proband (age at diagnosis with colorectal cancer, gender, location of tumor, multiple tumors) and ­family history information (presence of colorectal or endometrial cancer and age at d ­ iagnosis) in first-­ degree relatives only. The model calculates risk scores in two stages: a multivariate logistic regression analysis is performed and then refined using MSI/IHC data.

MMRPro (http://bcb.dfci.harvard.edu/bayesmendel/mmrpro.php) The MMRPro model calculates the likelihood of pathogenic variants in MLH1, MSH2, and MSH6 using Mendelian and Bayesian analysis. It was developed and validated in clinic-­based cohorts. It collects data for the proband and for each first-­and second-­degree relative (age at diagnosis, cancer type, current age for unaffecteds). It is limited to colorectal and endometrial cancers and does not include any other Lynch-­associated tumors or skin findings. It includes molecular tumor data (MSI/IHC) and provides separate data for each of the genes. •• PREMM5 (http://premm.dfci.harvard.edu) The PREMM5 model uses logistic regression analysis to provide gene-­specific estimates of pathogenic variants in MLH1, MSH2, MSH6, PMS2, and EPCAM. It was developed using a clinic-­based cohort and then validated in both population-­and clinic-­based cohorts. Data is collected on probands (gender, age at diagnosis of CRC diagnosis, presence of multiple CRCs, endometrial and other Lynch syndrome-­associated cancers). Information on first-­and second-­degree relatives included the presence or absence of Lynch-­associated tumor and the age at diagnosis (if applicable). CDKN2A Pathogenic Variant ••

••

MelaPRO (https://projects.iq.harvard.edu/bayesmendel/melapro) MelaPRO is a statistical model for assessing the probability that an individual carries a germline pathogenic variant in CDKN2A (p16). The online tool takes into consideration personal history of melanoma as well as family history of single primary and multiple primary melanomas. It is predominantly based on studies from the United States, Europe, and Australia, so its applicability to individuals of other ethnicities is limited.

328

••

Counseling About Cancer

MELPREDICT MELPREDICT a logistic regression model to estimate CDKN2A PV carrier probability. It  incorporates personal history of melanoma, family history, and age at diagnosis to calculate risk. A recent update to the model incorporates personal and family history of pancreatic cancer, which has improved the discriminatory ability of the model. Originally developed in a cohort from Boston, Massachusetts, it has been recently validated in a larger international consortium cohort.

7.4.3.  Models That Combine PV Risk and Penetrance Information When predicting an individual’s risk of developing cancer, there are some models that integrate both the risk of the individual having a pathogenic variant in a known cancer predisposition gene and the penetrance information associated with that specific gene to determine cancer risk. ••

••

Breast and Ovarian Analysis of Disease Incidence and Carrier Estimation Algorithm (BOADICEA) BOADICEA is a web-­based application based and validated in a large series of families from the UK. The tool computes not only the likelihood that an individual has a BRCA1 or BRCA2 pathogenic variant and other breast cancer susceptibility genes but also provides age-­specific risks of breast and ovarian cancer. It was developed using a complex segregation analysis of breast and ovarian cancer based on families identified through population-­ based studies of breast cancer, and families with multiple affected individuals who had been screened for BRCA1 and BRCA2 pathogenic variants. According to the company website, “The application models the simultaneous effects of BRCA1 and BRCA2 pathogenic variants and assumes that the residual familial clustering of breast cancer is explained by a polygenic component with a variance that decreases linearly with age.” CancerGene CancerGene is software based on the Cancer Gene program developed by Dr. David Euhus in 1998. CaGene is a singular software program that brings together many ­different risk assessment models. The software calculates the likelihood that an i­ ndividual has a pathogenic variant in BRCA1 or BRCA2, and then uses that probability to calculate the age-­ specific risks of developing breast and ovarian cancer for that individual. Caution should be used in using cancer risks from CancerGene. Instead of saying IF you have a pathogenic variant, risk is X, and IF you don’t have a pathogenic variant, risk is Y, CancerGene says “Overall risk of cancer is Z” where Z is a weighted average of X and Y. Because of this, it is not very helpful for individual risk estimation but it is quite useful for population studies.

7.4.4.  Other Online Risk Assessment Tools and Calculators for Clinicians The following are online risk tools that are available to guide clinicians through the risk assessment process. Note that some of these may not be validated for clinical use.

7. Cancer Risk Assessment and Risk Models

••

••

••

329

CRA Health Risk Assessment Platform The CRA Health Risk Assessment Platform offers a wide range of cancer risk assessment software and services. The risk assessment software tool includes many models, including Tyrer-­Cuzick, BRCAPRO, Claus, Myriad, and Gail, and provides a single tool that runs all the models and provides output. This software platform offers many additional services, such as generating a summary letter. Familial Risk Assessment—­Breast and Ovarian Cancer (FRA-­BOC) FRA-­BOC is an online tool developed and maintained by the Australian government. It provides an individualized risk for developing breast cancer (and ovarian cancer) based on family history only. It accounts for maternal and paternal lineages, Ashkenazi Jewish ancestry, first-­and second-­degree relatives, and includes diagnoses of both breast and ovarian cancer, age at diagnosis of breast cancer, and bilateral breast cancer. It does not take into consideration other medical risk factors. It categorizes women into one of three risk categories. Category 1 includes women at or slightly above the average risk of breast and ovarian cancer, which covers more than 95% of the female population. Category 2 includes women who are at moderately increased risk for breast cancer and then distinguishes between those women who are also at average or moderately increased risk of ovarian cancer. Category 2 covers less than 4% of the female population. Category 3 is for women at a potentially high risk of breast cancer and potentially high risk of ovarian cancer and covers less than 1% of the female population. It is unclear how well, or if at all, this model has been validated. Other mobile applications There are a variety of apps available for clinician use on mobile devices that can be helpful for busy clinicians while in the clinic, including the following. •• BCSC Risk Calculator •• BRisk Breast Cancer Risk Calculation (based on the Claus model) •• BCRA Breast Cancer Risk Assessment

7.4.5.  Patient-­Friendly Risk Assessment Tools Individuals are often interested in calculating their own risk of developing cancer and/or having a pathogenic variant. The following resources can be helpful to provide to individuals. Genetic counselors may also encounter them as their patients may present to the genetic counseling consultation having already completed these online tools. ••

••

Families SHARE (NHGRI) (https://www.genome.gov/27549052/families-­share) has a printable worksheet for individuals to use to stratify their risk of breast cancer and determine whether they are at increased risk. The NIH Breast Cancer Risk Assessment Tool (https://bcrisktool.cancer.gov/#eq) can be used by patients as well as clinicians.

330

••

Counseling About Cancer

The CDC houses a website that can help patients determine whether they have an average, moderate, or strong family history of breast and ovarian cancer (https://www.cdc. gov/genomics/disease/breast_ovarian_cancer/risk_categories.htm).

7.5.  Genetics Criteria Risk assessment is an essential element of the genetic counseling session, as it provides quantifiable/numerical information to both the patient and the genetic counselor. The genetic counselor must distinguish between risk assessment, which is often a numerical risk figure, and genetics criteria, which are typically not numerical. Historically, numerical risk information was used by professional organizations and insurance companies to help define appropriate candidates for genetic testing. For example, decades ago organizations and insurance companies would suggest genetic testing only for those individuals who had a high (e.g., ≥10%) risk of carrying a PV in a gene. In many cases these organizations have evolved their criteria, which are now less restrictive, and suggest genetic testing for those individuals who could potentially benefit from treatment based on genetic test results. 7.5.1.  Clinical Genetic Testing Criteria Clinical genetic testing criteria exist to help the genetic counselor determine which individuals should be offered genetic testing. These criteria are constantly evolving and the genetic counselor must be current in their knowledge. The criteria most often do not provide or ask for a numerical risk, but rely on a host of other factors that determine eligibility for genetic testing. These criteria have evolved significantly over time. 7.5.1.1.  National Comprehensive Cancer Network (NCCN) Guidelines The National Comprehensive Cancer Network (NCCN), an alliance of leading cancer centers, developed a comprehensive set of clinical practice guidelines to assist practitioners in the management of care for oncology patients. The NCCN annually publishes guidelines that provide oncology clinicians with suggestions as to how and when individuals should be tested. Genetic testing for a specific cancer type is often addressed in a few of the guidelines. Sometimes, these guidelines can differ in their recommendations. For example, genetic testing for pancreatic cancer patients is addressed in the Genetic/Familial High-­Risk Assessment: Breast and Ovarian, the Pancreatic Adenocarcinoma guideline as well as in the Genetic/Familial High-­ Risk Assessment: Colorectal, and Pancreatic Adenocarcinoma guideline. All three of these guidelines agree that all individuals with pancreatic carcinoma should be tested for germline pathogenic variants and the Pancreatic Adenocarcinoma Guidelines go a bit further and specify using comprehensive gene panels for hereditary cancer. However, the two High-­Risk Assessment guidelines differ on unaffected members of families who have familial pancreatic cancer. It is important for the cancer genetic counselor to keep up to date with the NCCN guidelines as they are often considered authoritative in terms of guidance. In addition, most insurance companies will look to these criteria to determine eligibility for testing.

7. Cancer Risk Assessment and Risk Models

331

7.5.1.2.  American Society of Breast Cancer Surgeons (ASBrS) Position Statement The ASBrS in 2019 became the first national group to formally state that genetic testing should be made available to all individuals with a personal history of breast cancer. The position statement suggests that genetic testing include BRCA1/2 and PALB2 with other genes as appropriate for the clinical scenario and family history. This group commented that the NCCN guidelines should be used for determining whether or not a woman with a family history only of breast cancer should be tested. This statement was considered somewhat controversial in the field at the time and does not mean that all individuals with breast cancer will be covered by their insurance companies for genetic testing (see Section 7.5.2).

7.5.1.3.  American Gastrointestinal Association The American Gastroenterological Association (AGA) suggests that genetic testing for familial pancreas cancer should be considered for relatives who are eligible for pancreatic cancer screening. The AGA considers individuals eligible for screening to be those determined to be at high risk, including first-­degree relatives of individuals with pancreatic cancer with at least two affected genetically related relatives. In addition, candidates for screening include individuals with genetic syndromes associated with an increased risk of pancreatic cancer, including all individuals with Peutz–Jeghers syndrome, hereditary pancreatitis, individuals with CDKN2A gene pathogenic variant, and individuals with one or more first-­ degree relatives with pancreatic cancer with Lynch syndrome, and pathogenic variants in BRCA1, BRCA2, PALB2, and ATM genes. 7.5.2.  Insurance-­Specific Genetic Testing Criteria Insurance-­specific genetic testing criteria exist so that insurance companies have clear guidance regarding which of their policyholders will be covered for the cost of genetic testing. Many of these policies mimic the NCCN guideline recommendations (see Section 7.5.1.1). Some policies rely on the healthcare provider to calculate an a priori risk of carrying a pathogenic variant and will base the coverage decision on that level of risk. It is important to note that in many cases insurance-­specific policies will be at odds with other criteria for testing and/or the clinical judgment of the genetic counselor. In these cases, the genetic counselor and patient are encouraged to appeal the denial of coverage in the hope that the policy will be updated and changed to reflect current practice. Although this process can be arduous for the genetic counselor, these appeals are tracked by the insurance companies and used in determining which policies require updating.

7.5.3.  Criteria for Referral for Genetics Consultation Access to genetic testing for cancer predisposition has historically been through risk assessment programs and has involved a genetic counselor, medical geneticist, oncologist, surgeon,

332

Counseling About Cancer

oncology nurse, or other health professional with expertise and experience in cancer genetics to participate early in the counseling of individuals. For that reason, consensus guidelines were often developed that advised nonspecialists on who should be referred for this risk assessment service. 7.5.3.1.  NCCN Guidelines The NCCN previously provided guidelines with criteria for individuals who should be referred for genetic evaluation and separate criteria for individuals who should consider ­genetic testing (e.g., Genetic/Familial High-­Risk Assessment: Breast and Ovarian). Genetic testing in the United States has evolved in recent years and many nongenetics specialists are now providing the testing. The NCCN guidelines have changed to include guidance on how to provide risk assessment and genetic testing and now focus on the criteria for genetic testing only. 7.5.3.2.  Cancer Genetics (UBQO Limited)—­in Apple Store The Cancer Genetics app provides clinicians with guidance on who to refer for hereditary risk assessment. It was developed by the Clinical Genetics department at Guy’s and St Thomas’ NHS Foundation and Trust in London, UK, and produced by the technology company UBQO. The app provides clinicians with a framework of questions that can be used when managing individuals. It is an easy-­to-­use app that walks the clinician through a decision tree with very simple, straightforward questions. It provides context for referral or no referral, and links to genetics services if a referral is warranted. 7.5.3.3.  FRA-­BOC (https://canceraustralia.gov.au/clinical-­best-­practice/ gynaecological-­cancers/familial-­risk-­assessment-­fra-­boc) FRA-­BOC is an online tool developed and maintained by the Australian government. It provides advice on who should be referred for further genetic evaluation based on family history only. It accounts for maternal and paternal lineages, Ashkenazi Jewish ancestry, first-­and second-­degree relatives, and includes diagnoses of both breast and ovarian cancer, age at diagnosis of breast cancer, and bilateral breast cancer. The advice is provided in the context of a much larger analysis of personal and family history, and no direct links to genetics programs are provided. 7.5.3.4.  Genetics referral when testing ordered by a non-­genetics professional As the practice of cancer genetic testing evolves, cancer genetic testing is more often being performed by nongenetics professionals (see Section 9.2.3 for more elaborate discussion). It is important to note that genetic testing is not synonymous with genetic risk assessment. There are many reasons that individuals should be referred to a genetic risk assessment program after their genetic test results are available.

7. Cancer Risk Assessment and Risk Models

••

••

••

••

333

Individuals with pathogenic variants in cancer predisposition genes. These individuals can benefit from receiving personalized guidance on cancer screening and management, assistance with cascade testing, education about reproductive issues, and counseling on the emotional and psychological aspects of learning they carry a pathogenic variant. Cancer patients without pathogenic variants who have a significant family history of cancer. These individuals may have questions about additional genetic testing that might be available to them (e.g., larger gene panel tests) to further assist in their cancer risk assessment. Individuals without pathogenic variants who have a significant family history of cancer. These individuals may still be at increased risk for malignancy based on their family history and can benefit from receiving personalized cancer risk management guidance. Individuals without pathogenic variants who do not have a significant family history. These individuals may benefit from more education about genetic testing and may need reassurance from a genetic expert about cancer risk.

7.6.  Case Examples 7.6.1.  Case 1 Wendy, a patient who was assigned female at birth and is age 28, comes to clinic for genetic risk assessment. Wendy’s physician calculated a Gail score that indicated she was at average risk of developing breast cancer and recommended she consider standard breast cancer screening at age 40. Wendy’s mother was diagnosed with ductal carcinoma in situ (DCIS) at age 55 and was very concerned, however, that Wendy was at an elevated risk for breast ­cancer. In taking the family history, the genetic counselor noted that other than Wendy’s mother’s diagnosis of DCIS, there were no other individuals with cancer in the large maternal lineage. Wendy’s father had a sister who was diagnosed with breast cancer at 40 and he also had two paternal aunts with early onset breast cancer. The genetic counselor easily recognized that the Gail model was not the appropriate model to assess Wendy’s risk of breast cancer. The paternal lineage suggested that HBOC should be considered and the Gail model does not account for this type of family history of cancer. The genetic counselor used the BRCAPRO model to calculate Wendy’s risk and found that her risk of carrying a BRCA1/2 pathogenic variant was 4%. Wendy was reassured by this low number, but the genetic counselor was quick to point out that Wendy’s paternal aunt had a 20% chance of carrying a pathogenic variant in BRCA1/2 based on the BRCAPRO model. The genetic counselor encouraged Wendy to discuss genetic testing with her aunt. Wendy’s aunt did undergo genetic testing and was found to carry a BRCA2 pathogenic variant. This now put Wendy at 25% risk for carrying the PV based on her familial relationship. Wendy decided to undergo genetic testing and indeed did carry the BRCA2 PV. Her risk of developing breast cancer was now significantly above the average population risk, and high-­ risk screening starting was now clinically indicated.

334

Counseling About Cancer

Discussion: This case shows the importance of understanding the nuances of breast cancer risk modeling and ensuring that the model used is the most appropriate for the individual and family. It also illustrates the importance of taking a detailed family history to assess risk. Finally, it demonstrates the importance of recognizing the most appropriate individual in the family to proceed with genetic testing.

7.6.2.  Case 2 Yong Li, a patient assigned female at birth who is 40 years old, presents for genetic risk assessment. She recently had a mammogram at a mammography center that uses an online risk prediction tool for all individuals. She was told that she had a 35% risk of developing breast cancer based on BRCAPRO modeling and was extremely anxious. The genetic counselor established rapport, contracted with the patient, and was able to gather a family history. Through the conversation, the genetic counselor was able to compare the information the patient provided with what was entered into the risk model at the mammography center. The genetic counselor realized that Yong Li had inadvertently reported to the mammography center that her mother had both breast and ovarian cancer and had two maternal aunts with breast cancer. In truth, Yong Li’s mother had breast cancer at age 65 and cervical cancer, one aunt had breast cancer at age 70, and another aunt had a breast biopsy at age 30. This incorrect information used in the BRCAPRO model resulted in a very high probability of a BRCA1/2 pathogenic variant, which in turn resulted in a high lifetime risk of developing breast cancer per the model. The genetic counselor was successful in explaining this incorrect calculation to Yong Li and was very reassuring. The genetic counselor was also able to offer genetic testing to Yong Li’s mother, who was negative for pathogenic variants on a cancer panel test. This further reassured Yong Li that her risk of developing breast cancer was only slightly increased over a woman in the general population. Discussion: This case illustrates how incorrect information can dramatically affect risk calculations. It also shows how these risk calculations can cause significant psychological reactions in individuals when they are not accurate and/or explained correctly.

7.7.  Discussion Questions Question 1: A 38-­year-­old patient, assigned female at birth, with a new breast cancer diagnosis presents for genetic risk assessment. They report that their maternal aunt was diagnosed with breast cancer at age 55 and their maternal cousin was diagnosed with breast cancer at age 50. The CaGene tool reports that the patient’s risk of harboring a BRCA1/2 pathogenic variant is a mere 5%. a. What factors can you think of that might give this patient such a low a priori risk? b. Are there other models that should be used for calculating this patient’s risk of carrying a BRCA1/2 pathogenic variant? c. How might you explain the difference in a priori risk to this patient?

7. Cancer Risk Assessment and Risk Models

335

Question 2: A 47-­year-­old assigned male at birth patient presents for genetic risk assessment due to their family history of colorectal cancer. Their father, paternal aunt, and two paternal cousins all have Lynch syndrome and a known pathogenic variant in MSH2. Your patient’s mother has a diagnosis of colorectal cancer at age 61 and denies any additional cancers on that side of the family. Your patient tests negative for the paternally inherited MSH2 pathogenic variant. a. Your patient wants to know how likely it is that they will develop colon cancer in their lifetime. What do you tell the patient? b. Is there any additional genetic testing that you would recommend for this patient and their family?

7.8.  Further Reading American Cancer Society, Inc. https://www.cancer.org/cancer/cancer-­ basics/lifetime-­ probability-­ of-­ developing-­or-­dying-­from-­cancer.html. Accessed May 26, 2020. Brentnall AR, Cuzick J. Risk models for breast cancer and their Validation. Statist. Sci. 2020 Feb;35(1):14–30. https://doi.org/10.1214/19-­STS729 Evans DG, Howell A. Breast cancer risk-­assessment models. Breast Cancer Res. 2007;9(5):213. doi: 10.1186/ bcr1750. PMID: 17888188; PMCID: PMC2242652. Forman A, Schwartz S. Guidelines-­based cancer risk assessment. Semin Oncol Nurs. 2019 Feb;35(1):34–46. doi: 10.1016/j.soncn.2018.12.010. Epub 2019 Jan 22. PMID: 30683549. Jacobs EJ, Chanock SJ, Fuchs CS, et  al. Family history of cancer and risk of pancreatic cancer: a pooled analysis from the Pancreatic Cancer Cohort Consortium (PanScan). Int J Cancer. 2010;127:1421Y1428. Kastrinos F, Samadder NJ, Burt RW. Use of family history and genetic testing to determine risk of colorectal cancer. Gastroenterology. 2020 Jan;158(2):389–403. doi: 10.1053/j.gastro.2019.11.029. Epub 2019 Nov 21. PMID: 31759928. Klein AP, Lindström S, Mendelsohn JB, et al. An absolute risk model to identify individuals at elevated risk for pancreatic cancer in the general population. PLOS ONE 2013;8(9): e72311. https://doi.org/10.1371/ journal.pone.0072311. Yehia L, Eng C. PTEN hamartoma tumor syndrome. 2001 Nov 29 [Updated 2021 Feb 11]. In: Adam MP, Ardinger HH, Pagon RA, et  al., editors. GeneReviews® [Internet]. Seattle (WA): University of Washington, Seattle; 1993–2022. Available from: https://www.ncbi.nlm.nih.gov/books/NBK1488/. National Comprehensive Cancer Network. Genetic/Familial High-­Risk Assessment: Breast, Ovarian and Pancreatic. https://www.nccn.org/professionals/physician_gls/pdf/genetics_bop.pdf. Accessed January 15, 2022. Ozanne EM, Drohan B, Bosinoff P, et al. Which risk model to use? Clinical implications of the ACS MRI Screening Guidelines. Cancer Epidemiol Biomarkers Prev. Jan;22(1):146–149. doi: 10.1158/1055-­9965. EPI-­12-­0570. PDQ Cancer Genetics Editorial Board. Cancer genetics risk assessment and counseling (PDQ). Published May 20, 2021. https://www.ncbi.nlm.nih.gov/books/NBK65817/. Accessed January 15, 2022. Ropeik D. The Perception Gap: Recognizing and managing the risks that arise when we get risk wrong. Food Chem Toxicol. 2012 May;50(5):1222–5. doi: 10.1016/j.fct.2012.02.015. Epub 2012 Feb 21. PMID: 22381258. Yanes T, Young M, Meiser B, et al. Clinical applications of polygenic breast cancer risk: a critical review and perspectives of an emerging field. Breast Cancer Res. 2020;22(21). https://doi.org/10.1186/ s13058-­020-­01260-­3.

CHAPTER

8 Genetic Testing Technologies

The capacity to blunder slightly is the real marvel of DNA. —­Lewis Thomas, The Medusa and the Snail, More Notes of a Biology Watcher, 1979, p.23

Genetic testing has changed dramatically since the discovery of the first cancer predisposition genes. The process of finding and elucidating genes which previously took years can now be done in a matter of days. This revolution in efficiency and cost has driven the field forward in the discovery of new disease-­associated genes as well as the number of companies offering genetic testing. This chapter includes descriptions of both older technologies, some of which are still in use today, and newer technologies, which have transformed clinical genetic testing. Older technologies include: •• •• •• •• •• •• •• ••

Linkage analysis Sanger and Maxam Gilbert sequencing Southern blotting Protein truncation testing Single strand conformation polymorphism Denaturing gradient gel electrophoresis Single nucleotide polymorphism technology Allele-­specific oligonucleotides

Counseling About Cancer: Strategies for Genetic Counseling, Fourth Edition. Katherine A. Schneider, Anu Chittenden, and Kristen Mahoney Shannon. © 2023 John Wiley & Sons Ltd. Published 2023 by John Wiley & Sons Ltd.

337

338

Counseling About Cancer

Newer technologies include: •• •• ••

Next-­generation sequencing Multiplex ligation-­dependent probe amplification Array technology

While not sequence interrogation technologies per se, this chapter also includes a section on liquid biopsy and paired tumor-­germline analysis, tools that have become increasingly important and widely utilized in clinical cancer genetics. A summary of current clinical issues related to technologies will also be addressed.

8.1.  Older Technologies This section describes older technologies. Seminal articles on cancer genetics may refer to  these technologies, and families may still have older test results using these types of analyses.

8.1.1. Linkage Linkage studies were the backbone for the discovery of the genes associated with the most common inherited cancer syndromes, as well as some of the most clinically striking ones. APC, BRCA1 and BRCA2, TP53, and the Lynch syndrome genes were all discovered using linkage analysis. Academic medical centers were able to drive this research by studying entire families and pooling information together. No single entity was responsible for gene discovery. Instead, it took years and even decades of painstaking family history collection and research participation by hundreds of families for the breakthroughs that led to the knowledge of these core cancer susceptibility genes. Linkage analysis involved the study of known markers that could be pinpointed to specific areas of chromosomes. Large families participated with striking histories of cancer and specimen collection occurred in multiple family members. First, researchers analyzed markers in both affected and unaffected family members to narrow down the chromosomal regions where culprit genes were potentially located, with a specific syndrome in mind. From there, it was a race to sift through the genes of interest and discover the underlying cause of the syndrome. In fact, the initial clinical testing determining which family members were at increased risk was done by linkage; rather than knowing the specific causal mutation in the gene, researchers could use markers surrounding the gene of interest to determine who had most likely inherited the mutated copy of the gene and who had not. The accuracy of testing was less than 100% due to the possibility of genetic recombination between the unknown causal variant and the known marker(s). The timeframe for a given family to get answers was quite long, sometimes years. Sanger sequencing or “first-­ generation sequencing” eventually provided more definitive answers to the inherited cancer susceptibility puzzle.

8. Genetic Testing Technologies

339

8.1.2.  Sanger and Maxam Gilbert Sequencing 8.1.2.1.  Sanger Sequencing This methodology was first developed by Frederick Sanger in 1975 and published in 1977. Other names for this method are sequencing by synthesis (SBS) or dideoxy sequencing. The technique involves using the DNA of interest as a template for DNA synthesis in an artificial environment (in vitro). DNA and primer are placed in four separate tubes, all of which include the four normal DNA deoxynucleotide triphosphates (dATP, dTTP, dGTP, and dCTP). In each reaction, a small percentage of one of the four dideoxy nucleotides (ddATP, ddTTP, ddGTP, or ddCTP) is added. Once a dideoxy nucleotide is incorporated, DNA synthesis terminates, because the next nucleotide needs a 3’ hydroxyl group to attach, which is not present. Since dideoxynucleotides are incorporated in a random manner, synthesis terminates at different bases. Products of each of the four reactions are loaded onto a gel and separated through electrophoresis by size. 8.1.2.2.  Maxam–Gilbert Sequencing The difference between Sanger and Maxam–Gilbert sequencing is the use of radiolabeled DNA treated with chemicals that cleave DNA at somewhat specific bases (e.g., C, C+T, G, A+G) (see Figure 8.1). Maxam–Gilbert sequencing required an extra analysis step due to some non-­specificity in the chemical cleavage process. Ts and As can be seen respectively in the C+T and A+G lanes, but Gs need to be seen in both the G and A+G lanes and Cs from the C and C+T lanes, respectively. Maxam–Gilbert (chemical cleavage) was more widely used initially but Sanger sequencing became the method of choice for many years and is still utilized for orthogonal confirmation of results from other sequencing methods. Initially, Sanger sequencing reactions were done with radiolabeled nucleotides, but these were eventually replaced by fluorescently-­tagged nucleotides. Commercialization of the technique led to additional improvements (e.g., capillary electrophoresis, DNA polymerase refinements), and, along with advancements in other areas of molecular biology (recombinant DNA, polymerase chain reaction), was instrumental in the sequencing of the human genome. One of the major limitations of Sanger sequencing is the fact that four separate reactions must be performed in order to obtain a complete sequence. The initial steps of fragmenting DNA, cloning it into vectors, and extracting clones are extremely expensive in both labor and materials, making the first attempt at sequencing a human genome slow and costly. With advances such as polymerase chain reaction (PCR), the cost was brought down significantly. However, the advent of next-­generation sequencing (NGS) was a sea change in the scientific world. NGS technology revolutionized the process of sequencing and has virtually replaced the use of Sanger sequencing because of its remarkable efficiency. 8.1.3.  Southern Blotting Southern blotting is a technique named for Edward Southern, the molecular biologist who created the method in the 1970s. The technique involves the following: ••

DNA is digested with restriction enzymes (proteins isolated from bacteria that cleave DNA at a specific sequence, called a restriction site).

340

Counseling About Cancer

(c) A TGCAGCGTTACCATG . . .

G

P P P P

AT A TG CA A TGC AGC A T GC A G C G T T A CC A T

A +G

P P P P P P P P

AT A TGC A TGC A A TGC AGC A T GC A G C G T T A T GC A G C G T T A CC A T GC A G C G T T A CC A T

C

P P P P P

A TG A TGC AG A T GC A G C G T T A A T GC A G C G T T A C A T GC A GCG T T A CC A T G

C+T

P P P P P P P P P

A A TG A TGC AG A TGC A G C G A T GC A G C G T A T GC A GCG T T A A T GC A GCG T T A C A T GC A GCG T T A CC A A T GC A GCG T T A CC A T G

(b)

Increasing size band

(d)

A

A A TGCA A TGC AGC G T T A A T GC A G C G T T A CC A

C

A TGC A TGC AGC A TGC AGC G T T A C A T GC A G C G T T A C C

G

A TG A TGC AG A TGC AGC G A T GC A GCG T T A CC A T G

T

AT A TGC AG CGT A TGC AGC G T T A T GC A GCG T T A CC A T

A

C

G

T

Inferred sequence G T A C C A T T G C G A C G T A

G

A+G

C

A C G T

C+T

Direction of migration

(a)

FIGURE 8.1.  First-­generation DNA sequencing technologies. Example DNA to be sequenced (a) is illustrated undergoing either Sanger (b) or Maxam–Gilbert (c) sequencing. (b): Sanger’s chain-­termination sequencing. ddNTP nucleotides, once incorporated, prevent further extension. Fragments are generated with 3′ truncations as a ddNTP is randomly incorporated at a particular instance of that base (underlined characters). (c): Maxam–Gilbert chemical sequencing method. DNA is labeled with radioactive P32 in its 5′ phosphate moiety (Ⓟ). Different chemical treatments are used to selectively remove the base from a small proportion of DNA sites (acid – A+G; dimethyl sulfate – G; hydrazine – C+T; hydrazine plus high salt – C). (d): Fragments are visualized via electrophoresis on a high-­ resolution polyacrylamide gel. Sanger sequencing (left) can be read directly. Maxam–Gilbert sequencing (right) requires a small additional logical step: Ts and As can be directly inferred from a band in the pyrimidine or purine lanes, respectively. G and C are indicated by the presence of dual bands in the G/A+G lanes, or C/C+T lanes, respectively. Source: Heather and Chain (2016). With permission of Elsevier.

8. Genetic Testing Technologies

••

••

••

••

341

The resulting fragments are separated by size in a gel through electrophoresis, similar to sequencing. These fragments are then transferred onto a solid membrane such as a nitrocellulose filter and fixed by baking or UV cross-­linking. The DNA on the membrane is then exposed to a radioactive, chemical, or fluorescently tagged probe that contains a complementary sequence to the DNA area of interest. The membrane is subsequently exposed to film or read by a phosphor imaging instrument in order to visualize the resulting fragments.

The main clinical application for Southern blotting in clinical testing for hereditary cancer was to detect copy number variants (CNVs) such as larger deletions and duplications of genes (e.g., whole exons of up to 10 kb). For example, it was used in the detection of rearrangements in the BRCA1 and BRCA2 genes in the early 2000s in many research studies. The limitations of this technique include the following: •• •• ••

A substantial amount of DNA is needed. It is time-­and labor-­intensive. It may not be useful for the detection of bigger CNVs.

This technique has largely been replaced by multiplex-­ ligation-­ dependent probe amplification (MLPA) in hereditary cancer testing (see Section 8.2.2). 8.1.4.  Protein Truncation Testing Protein truncation testing (PTT) came into favor in the 1990s in an attempt to quickly identify sequence changes leading to a truncated protein product. PTT was used as a partial proxy for functional assays of gene variants. Testing for a truncated protein would be an effective method for finding a subset of disease-­causing variants in genes for which loss of function is the mechanism of pathogenicity. PTT works by translating the protein from the gene of interest in vitro. There are four steps to the process: 1. 2. 3. 4.

Isolation of the nucleic acid (genomic DNA, total RNA, or poly A+ RNA Amplification of the targeted area In vitro transcription and translation of the amplified area Detection of the translated products (see Figure 8.2)

The length of the products is analyzed using a specific gel type and those that are determined to be shorter than full-­length are considered to be abnormal. This testing can be done to analyze full genes or full exons. Among its significant limitations is the inability to detect missense variants and others that do not alter the length of the protein product but may still be associated with disease.

342

Counseling About Cancer

Cells from blood or tissue sample

RNA

Genomic DNA 1

Exons 2 3 4

5

1

Exons 2 3 4 5 Reverse Transcription PCR

mRNA cDNA dsDNA

Forward Primer T7

ATG

Reverse Primer dsDNA

ATG

PCR

T7 in vitro Transcription/ Translation Agarose gel electrophoresis of PCR products

RNA AUG Protein

SDS-PAGE plus autoradiography Full-length protein Truncated protein

FIGURE 8.2.  Schematic diagram of the protein truncation test. Source: ProMega.com.

An example of a gene that was first tested through PTT was the APC gene. Genetic testing for individuals in families with familial adenomatous polyposis was performed with PTT to determine whether they had the mutated APC gene. We now recognize that virtually all pathogenic variants in APC are truncating, making PTT more successful for this gene than it would be for most. As with other techniques, determining the exact mutation present still requires sequencing of the exon or gene of interest.

343

8. Genetic Testing Technologies

8.1.5.  Single-­Strand Conformation Polymorphism Single-­strand conformation polymorphism (SSCP) is an historical method of detecting point mutations in genes. The method is based on the principle that single-­strand DNA has a defined structure under set conditions; mutations that cause a change to this shape can be visualized by analysis of mobility of the DNA through a gel. There are four steps to the process: 1. 2. 3. 4.

Polymerase chain reaction (PCR) amplification of the DNA sequence of interest. Denaturation of the double-­stranded sequence. Cooling of the denatured DNA under conditions that result in self-­annealing. Detection of mobility differences in the DNA using nondenaturing electrophoresis (see Figure 8.3).

This technique detects about 80–90% of point mutations. Sequencing of the mutated DNA is required to determine the exact gene mutation present. 8.1.6.  Denaturing Gradient Gel Electrophoresis Denaturing gradient gel electrophoresis (DGGE) is a technique used to separate shorter-­to medium-­length DNA fragments (generally 50–500 bp, but it can detect point mutations up to 1.5  kb) based on their melting properties. During DGGE, PCR products travel through increasing concentrations of denaturing chemicals in a polyacrylamide gel. The denaturing

A T

A T

T

A

Amplify region of interest

G

Heat denature in Hi-Di Formamide

G

C

Rapidly chill and electrophorese under non-denaturing conditions

C

G

C

Wild Type

rfu

WT MUT

Mutant

mobility

FIGURE 8.3.  Schematic overview of the SSCP technique. Source: Life Technologies Corporation.

344

Counseling About Cancer

100%

Wild Type

Electrophoresis

*

40%

Partially melted “mutant” Partially melted “wild type” Single strands

*

Double strand

0%

Mutant

Denaturant

Denaturant

0%

Mut

WT

65%

70%

1 2 3 40%

65% A

B

FIGURE 8.4.  Denaturing gradient gel electrophoresis—­overview. A. Perpendicular gradient. B. Parallel gradient. Source: Bio-Rad Laboratories, Inc.

gradient can run either perpendicular or parallel to the electrophoresis such that DNA species are separated on the basis of both size and melting point. DNA migrates into distinct domains as shown in Figure 8.4. 8.1.7.  Single Nucleotide Polymorphism Technology Single nucleotide polymorphisms (SNPs) are nucleotides in which more than one allele is present in the population. The majority of SNPs occur between genes. In most cases where SNPs were used in familial testing, the SNP itself was not causative of disease but traveled closely with the disease gene allele and could be used as a marker to determine affected status, a more precise form of linkage analysis. In some cases, SNPs within genes or in regulatory regions of these genes can have a direct effect on function.

8. Genetic Testing Technologies

345

The definition of a SNP versus a mutation has traditionally been delineated by allele frequency; SNPs were variants that had a frequency of 1% or more in the general population, whereas mutations had a frequency of less than 1%. However, it is now clear that there are variants with a minor allele frequency of >1% that are disease-­associated mutations (for instance, in sickle cell disease). Conversely, there are SNPs that may have a direct functional effect on a gene (for example, in drug metabolism). Therefore, frequency has become less useful in defining the differences, and the term polymorphism, which has the connotation of a benign phenotype, is now used in the truest sense (poly = many, morph = form, shape) to mean many forms without a disease label. Current recommended nomenclature uses the term “variant” and then adds a classifier to indicate clinical significance when applicable. Single nucleotide polymorphisms (SNPs) are now called single nucleotide variants (SNVs) to reflect this shift. SNVs have been used most widely in ancestry testing and in genome-­wide association studies (GWAS) for population-­based assessment of disease risk. They have also been used in the analysis of tumors to detect loss of heterozygosity and to aid in the detection of copy number variation prior to development and refinement of next-­generation sequencing (NGS), multiplex ligation-­dependent probe amplification (MLPA), and array technologies. An interesting and clinically important application of GWAS is in the calculation of polygenic risk scores (PRS). A PRS is a single-­value estimate of an individual’s risk to develop a certain phenotype based on genome-­wide genotypes for multiple relatively common SNVs. The idea behind PRS in cancer is that each SNV may be associated with a small increase or decrease in the risk of a certain cancer in large population studies. First, a discovery cohort is selected to determine which SNVs should be used in a PRS using GWAS information. Then, these variants are validated in a separate cohort, which should ideally be large, scalable, and include many different ancestries. Assuming that these SNVs are not linked, weighted risks based on multiple (dozens, hundreds, or even thousands) of different SNVs can be combined and integrated into a score for an individual. (see Figure 8.5 for an overview of PRS development). While PRS is most often used to calculate individual risk in the absence of Mendelian inherited cancer susceptibility, it can also be used to refine risk in individuals with established hereditary risk, particularly for breast cancer. There is considerable controversy about the applicability of PRS for individuals of varying ancestral backgrounds. Fully implementing PRS in clinical practice has been impeded by a lack of ancestral diversity in SNV validation cohorts, although these barriers are being removed over time. SNP array technology (also called targeted genotyping) was first developed in the 1990s and has improved over time, with the possibility of testing entire genomes on a single chip. It is still used today for population studies because it is cheaper and faster than NGS. The methodology involves the following steps: 1. Utilize a manufactured chip (a small glass plate encased in plastic); thousands of short synthetic, single-­stranded DNA sequences of interest (probes), representing regions up to the entire genome, are bound to the glass in an identifiable pattern of spots. 2. Denature sample DNA into single strands and cut the long strands into more manageable fragments. 3. Label the fragments, generally with a fluorescent dye.

346

Counseling About Cancer

GWAS summary selection

Discovery cohort Genome-wide genotyping data n > 10 K

External validation of PRS

Target cohort Genome-wide genotyping data n > 10K

PRS development

Quality control PRS validated LD adjustment

p-valve thresholding

0.4

Density

0.3 0.2 0.1 0 –4 –2

No sample overlap Population stratification Reweighting effect sizes

0 2 PRS

4

FIGURE 8.5.  Development of a PRS is a multistage process that proceeds from initial variant selection to validation and testing of various possible PRSs to determine the most successful mode. Source: Illumina Inc. (https://www.illumina.com/areas-­of-­interest/complex-­disease-­genomics/polygenic-­risk-­scores.html).

4. Hybridize and wash. 5. Scan the chip to quantify the relative amount of sample bound to each probe (see Figure 8.6).

8.1.8.  Allele-­Specific Oligonucleotides Allele-­specific oligonucleotide (ASO) hybridization identifies the presence or absence of a known allele of interest in sample DNA. This has been especially useful for detection of common/ founder mutations in various diseases. Oligonucleotide probes are made from a sequence that is exactly complementary to the known disease allele and to the normal control. The region of

347

8. Genetic Testing Technologies

Nsp I

Nsp I

Nsp I

Sty I

Sty I

Sty I

RE digestion

RE digestion

Nsp adaptor ligation

Sty adaptor ligation

PCR:One primer amplification

PCR: One primer amplification

Complexity reduction cleanup

Fragmentation and end-labeling

Hybridization and wash

AA BB

AB

FIGURE 8.6.  Affymetrix genome-­wide human SNP array 6.0. RE restriction enzyme.

DNA with the mutation is digested and amplified with PCR. Using either Southern blotting or dot blot (direct transfer), the sample is transferred to a membrane. The ASO probes are labeled, typically with a radioactive tag, and hybridized to the filter. An autoradiograph is created showing the hybridization pattern to normal versus variant probe. This technique works well for common mutations but since an ASO probe has to be created for each specific alteration, it is not an efficient way of detecting most mutations. For the same reason, this technique has no role in the discovery of disease-­associated variants. Some of these technologies have been refined and are still in use today; others are rarely used. The development of NGS has revolutionized the ability to identify and query disease-­ associated genes and variants in the research setting. From the clinical perspective, it has allowed the rapid development of multi-­gene panel testing and beyond to whole exomes and genomes.

348

Counseling About Cancer

8.2.  Newer Technologies 8.2.1.  Next-­Generation Sequencing NGS is now the most frequently used technology to sequence DNA in both the research and clinical realms. The early NGS technology involved clonal template approaches for short sequence reads. These approaches used sequencing by synthesis (SBS) and sequencing by ligation (SBL). Pyrosequencing through SBS is an example of this approach. This method utilized iteratively complementing single strands with a simultaneous readout of the nucleotide being incorporated, thereby eliminating the need for electrophoresis. The nucleotides used for incorporation are dATPαS (deoxyadenosine 5’alpha thio triphosphate) and then typical dTTP, dCTP, and dGTP, in the presence of DNA polymerase and other enzymes. Once the nucleotide has been incorporated, an inorganic phosphate (PPi) is released, which causes a set of chain reactions. The phosphate then reacts with ATP sulfurylase in the presence of adenylyl sulfate to create an ATP molecule. The resulting ATP molecule will react with luciferin in the presence of luciferase and oxygen to create light (bioluminescence) and other byproducts. The emitted light signal is measured and corresponds to the number of bases of that specific nucleotide that are incorporated. The idea of “parallelizing” sequencing (having the capacity to analyze multiple different target sequences at once) pushed this technique forward for high-­throughput applications. NGS involves the following steps: •• •• •• ••

Library preparation Clonal/cluster amplification Sequencing Data analysis

Library preparation involves generating a collection of DNA fragments for sequencing. NGS libraries are typically prepared by fragmenting a genomic DNA or cDNA sample and ligating specialized adapters to both fragment ends. This can be done in one or two steps. Adapter-­ligated fragments are then PCR-­amplified and gel-­purified. To save resources, multiple libraries can be pooled together in the same run, known as multiplexing. During adapter ligation, unique index sequences (or “barcodes”) are added to each library. These barcodes are used to distinguish between the libraries during data analysis. Amplification involves loading the library onto a solid surface such as beads, ion surfaces, or flow cells and clonally amplifying it to increase the signal that can be detected from the DNA of interest through sequencing. The clusters of DNA fragments can be amplified in a process called cluster generation, resulting in millions of copies of single-­stranded DNA. Then, through sequencing by synthesis (SBS), chemically modified nucleotides bind to the DNA template strand through natural complementarity. Each nucleotide contains a fluorescent tag and a reversible terminator that blocks incorporation of the next base. The fluorescent signal indicates which nucleotide has been added, and the terminator is cleaved so the next base can bind. After reading the forward strand, the reads are washed away, and the process repeats for the reverse strand (called paired-­end sequencing).

349

8. Genetic Testing Technologies

Data analysis involves a dedicated instrument with specialized software that identifies nucleotides (base calling) and the predicted accuracy of those base calls. The analysis can be divided into three parts: primary (raw data with quality metrics), secondary (alignment and variant calls), or tertiary (interpretation and application specific analysis). Please see Figure 8.7 for a schematic of NGS. A. Library Preparation

B. Cluster Amplification

Genomic DNA Fragmentation Flow Cell Adapters Bridge Amplification Cycles Ligation

Sequencing Library 1

2

3

4

Clusters

NGS library is prepared by fragmenting a gDNA sample and ligating specialized adapters to both fragment ends.

Library is loaded into a flow cell and the fragments are hybridized to the flow cell surface. Each bound fragment is amplified into a clonal cluster through bridge amplification.

C. Sequencing

D. Alignment and Data Analysis

2

1

A T C G

4

3

Sequencing Cycles

T G

Reads

ATGGCATTGCAATTTGACAT TGGCATTGCAA TTTG AGATGGTATTG GATGGCATTGCAA GCATTGCAA TT TGAC ATGGCATTGCAA TT AGATGGCATTGCAA TT TG

Reference Genome

AGATGGTATTGCAATTTGACAT

A C

Digital Image Data is exported to an output file Cluster 1 > Read 1: GAGT... Cluster 2 > Read 2: TTGA... Cluster 3 > Read 3: CTAG... Cluster 4 > Read 4: ATAC...

Text File

Sequencing reagents, including fluorescently labeled nucleotides, are added and the first base is incorporated. The flow call is imaged and the emission from each cluster is recorded. The emission wavelength and intensity are used to identify the base. This cycle is repeated “n” times to create a read length of “n” bases.

Reads are aligned to a reference sequence with bioinformatics software. After alignment, differences between the reference genome and the newly sequenced reads can be identified.

FIGURE  8.7.  Next-­generation sequencing. Source: Illumina. An introduction to next-­ generation sequencing technology (https://www.illumina.com/content/dam/illumina-­ marketing/documents/ products/illumina_sequencing_introduction.pdf).

350

Counseling About Cancer

For more information, there are several videos and tutorials about next-­ generation sequencing online, including the following: https://www.illumina.com/science/technology/next-­generation-­sequencing/beginners.html (Illumina) https://www.youtube.com/watch?v=nIfeguaZqO0 (National Human Genome Research Institute) https://www.youtube.com/watch?v=jFCD8Q6qSTM (Applied Biological Materials) https://www.thermofisher.com/us/en/home/life-­s cience/sequencing/sequencing-­ education/next-­generation-­sequencing-­basics/what-­is-­next-­generation-­sequencing.html (Thermo-­Fisher) Benefits NGS •• •• •• ••

Expanded discovery power through comprehensive genomic coverage More data from smaller DNA amounts Higher throughput with sample multiplexing Automation, overall speed, and low cost

Sanger •• ••

Cost effective for small stretches of DNA Quick and simple workflow

Limitations NGS •• ••

May be less cost effective with a small number of samples Requires a dedicated data-­handling workflow

Sanger •• •• ••

Low discovery power Not cost effective for large stretches of DNA Low scalability

8.2.2.  Multiplex Ligase Probe Amplification Multiplex ligase probe amplification (MLPA) is a technique that was developed by Jan Schouten and colleagues in response to the necessity of detecting smaller-­size copy number variants (Schouten et al., 2002; MRC Holland). The basis of this technique is that, rather than amplifying

8. Genetic Testing Technologies

351

the DNA target sequences, the probes that are designed to bind to the target sequences are amplified instead. The reaction requires only a small amount (~20 ng) of DNA in comparison to Southern blotting, which can require up to 5 to 10 μg. The technique is comprised of the following steps: •• •• •• •• •• ••

DNA denaturation Hybridization of the MLPA probes Ligation reaction Amplification of the ligated probes Fragment separation Data analysis

The MLPA probe sets (left probe and right probe) are pairs of oligonucleotides that each contain a PCR primer sequence that is complementary to the target DNA sequence. The forward PCR primer is fluorescently labeled. The paired set of probes hybridize to adjacent sequences and must be hybridized correctly to the target sequence in order to be ligated into a single probe. Even single nucleotide changes will prevent the ligation step from occurring. The ligated probes are then amplified with PCR while the individual probes will not be amplified. Therefore, the number of probe ligation products corresponds to the number of target sequences in the reaction. After amplification, the fragments associated with each probe set have a unique length of between ~120 and 500 nt, designed in a stepwise fashion. All fragments (including a standard set with known sizes) pass through a detector, with fluorescence measured as a peak and read as an electropherogram. Probe ratios 1.3 can be read as heterozygous deletions or duplications, respectively. Up to 60 probe sets can be used in a single reaction. Please see Figure 8.8 for a schematic of MLPA.

8.2.3.  Array Technology Comparative genomic hybridization (CGH) is a method of analysis used to scan the genome for variations in DNA copy number. The genomic DNA of a test sample and reference sample are labeled with different fluorescent colors and hybridized to fixed metaphase chromosomes. The differences in color indicate gain or loss of copy number for a specific area of the genome (Pinkel and Albertson 2005). This type of analysis, however, can detect copy number variation only at the level of 5–10 megabases (Mb) and is unable to identify balanced chromosomal rearrangements that may be clinically significant. The use of DNA microarrays (aCGH) made the analysis much more sensitive, faster, and cheaper (see Figure  8.9). In this technique, metaphase chromosomes are replaced by cloned DNA fragments of 100 to 200 bp in length. The remainder of the methodology is similar, with equal amounts of test DNA sample and reference DNA sample being loaded onto a microarray. The hybridization signals are read and analyzed by computer software to detect dosage loss and gain. This technology represents at least a 1,000-­fold refinement in resolution over CGH, reliably detecting changes of 5–10 kb and, in high-­resolution form, as small as 200 bp.

352

Counseling About Cancer

Hybridization Target A

Target B 3ʹ Primer site

5ʹ Primer site

Target A LPO

Target A RPO

Stuffer Sequence

5ʹ Primer site

Target B LPO

Target B RPO

3ʹ Primer site Stuffer Sequence

Ligation

PCR amplification

Capillary electrophoresis and data analysis

FIGURE 8.8.  MLPA technique. Source: Willis, van den Veyver, and Eng (2012).

8.2.4.  Methylation Analysis DNA methylation is a key part of epigenetic regulation. According to the Oxford English Dictionary, epigenetics is the study of changes in organisms caused by modification of gene expression rather than alteration of the genetic code itself. Methylation involves the addition of a methyl group or hydroxymethyl group to specific cytosines. CpG refers to a 5’ cytosine next to a guanine with a phosphodiester bond between them. Dinucleotide CpGs are quite frequent in the human genome and may be methylated, creating

353

8. Genetic Testing Technologies

Step 1

Patient DNA

Control Step 2 DNA

Array CGH: The Complete Process Steps 1-3 Patient and control DNA are labeled with fluorescent dyes and applied to the microarray. Step 4

Patient and control DNA compete to attach, or hybridize, to the microarray.

Step 5

The microarray scanner measures the fluorescent signals.

Step 6

Computer software analyzes the data and generates a plot.

Step 3

Step 5 Step 4

Step 6

HYBRIDIZATION DNA dosage loss

Equal DNA DNA hybridization dosage loss dosage gain

COMPUTER SOFTWARE

DATA PLOT (Chromosome 7)

FIGURE  8.9.  Diagram of the microarray-­based comparative genomic hybridization (aCGH) process. Source: Theisen (2008)/Nature Education.

5-­methyl cytosine. CpG islands are much less common; these are generally spans of ~200-­3000 bp that are rich in GCs (>50%) with a high ratio of CpG sites (>60%). In human genetics, analysis is often assessing methylation in the context of CpG islands in the promoter regions of disease-­ related genes. Promoter areas with CpG islands are typically unmethylated to allow gene expression. Promoter regions of specific genes can be assessed for methylation status against what is expected for a given tissue type, stage of development, and other factors. Hypermethylation or hypomethylation may indicate relative silencing or overexpression of a gene, respectively, that could contribute to a disease state. Genome-­ wide differences in methylation are a hallmark of cancer cells. As would be expected, genes in cancer cells that promote growth (proto-­oncogenes) often show hypomethylation, and genes that suppress growth (tumor suppressor genes) often show hypermethylation versus the same genes in normal cells of the same tissue type. Methylation levels of various genes may be correlated with the efficacy of certain therapies and may thereby be incorporated into pathology reports and clinical decision making. The most common method of assessing methylation is through bisulfite sequencing. This involves treating DNA with bisulfite to deaminate cytosine to uracil. 5-­methyl cytosine is

354

Counseling About Cancer

resistant to this process, so sequencing DNA after treatment will reveal the areas of methylation. There are challenges to this method: ••

••

••

Assessment of complete conversion of the DNA is needed by the use of internal controls and verifying conversion of non-­CpG sites. Bisulfite sequencing reduces the DNA to three nucleotides, so post-­treatment sequencing alignment is more difficult. DNA methylation levels can vary within the same sample.

The study of methylation leads to consideration of gene expression or the transcriptome.

8.2.5.  Transcriptome Analysis The transcriptome is the full range of messenger RNAs expressed by an organism, tissue type, tumor, or set of cells. When analyzing the transcriptome, the result is typically a transient snapshot of the expression of genes at that time. Studies of the transcriptome between and among cancer cells and normal cells have led to a better understanding of carcinogenesis, classification of tumors, useful biomarkers, and potential therapies. Older methods of quantifying individual transcripts include Northern blotting, nylon membrane array, and reverse transcription (RT)-­PCR. Serial analysis of gene expression (SAGE) began in the mid-­1990s and involves sequencing of long concatemers of small tags (approximately 10 bps) uniquely identifying mRNAs. Currently there are two major ways to study the transcriptome: microarrays and RNA sequencing (RNA-­Seq). Microarrays are used when studying the RNA expression of genes that are already known since the technique involves measuring the hybridization of the labeled target cDNA strands to the defined probes on a chip. The advent of high-­throughput sequencing allowed for the development of techniques that do not rely on reference sequences as a base. Therefore, RNA-­Seq is useful for both discovery and quantification of transcripts. A reference sequence can be used for alignment but if one is not known, it can be built from the transcripts that are discovered. For clinical purposes, the study of the mRNA from a given gene can tell us about the impact of specific variants in the gene, particularly splice variants. One caveat is that the study of RNA within this in  vitro “snapshot” may not always reflect what is happening in  vivo. RNA-­Seq paired with NGS of DNA is now a commercially available combined test for multi-­gene cancer panels. This testing may help clarify variants of uncertain significance by providing additional evidence for or against pathogenicity. It can also identify rare deep intronic variants which would not have been detected by typical exonic NGS alone.

8.2.6.  Paired Tumor Germline Analysis While not a separate technology, the used of NGS in both tumor and germline DNA has revolutionized cancer care. Paired tumor-­germline (or paired tumor-­normal) analysis has been in use since about 2010 by commercial laboratories for subtraction of normal variation from DNA

8. Genetic Testing Technologies

355

variants found in the tumor. This takes away the “background noise” from the germline to reveal important drivers of tumor formation that could provide targets for therapy. Major academic centers have incorporated paired testing into their own programs. These programs have shown the value in obtaining both tumor and normal cells for NGS analysis to identify not only targetable tumor variants but also hereditary cancer susceptibility. Paired analysis can help to: ••

••

••

Clarify germline variants of uncertain significance in cancer susceptibility genes by showing concomitant inactivation of the second allele (e.g., through loss of heterozygosity of tumor suppressor genes) Explain deficient DNA mismatch repair (dMMR) in tumors when germline mutations are not found by identification of biallelic somatic inactivation of MMR genes Demonstrate that cancers that are not traditionally associated with a specific hereditary syndrome can have driver mutations in relevant tumor suppressor genes

8.2.6.1.  Liquid Biopsies A liquid biopsy is a test done typically on a sample of blood to look for circulating tumor cells (CTCs), pieces of circulating tumor DNA (ctDNA), and other potentially informative components that may be shed by tumor cells. Cell-­free DNA (cfDNA) can include DNA from normal as well as tumor cells, so it relies on the ability to separate signals of interest against background. Liquid biopsies are minimally invasive and can be serially repeated, providing a fast and easy way to assess cancers over time. Liquid biopsy can be used to monitor both the response to treatment and the progression of cancer. In this way, it can be used for all stages of cancer, from detecting early-­stage cancer to targeting treatment based on somatic mutations in the tumor to assessing resistance to chemotherapy in advanced cancers. Figure 8.10 is a schematic of the different types of information that can be derived from components of the tumor found in blood. Advantages of liquid biopsies •• •• •• •• ••

••

Minimally invasive Can be done serially Theoretically cheaper than tumor biopsy Can detect tumor heterogeneity Currently very useful in advanced cancers for assessment of tumor progression and response to therapy Can see possible germline mutations based on variant allele frequency (VAF)

Disadvantages ••

Low circulating tumor DNA ratio to non-­tumor-­related DNA

••

Low amount of circulating tumor DNA in early-­stage cancers

356

Counseling About Cancer

CTCs Protein expression Gene expression DNA abnormalities miRNAs Epigenetic alterations Functional studies Single cell analysis Tumor heterogeneity

ctDNA Tumor mutational burden Amplifications/deletions Translocations Point mutations Chromosomal abnormalities Tumor heterogeneity

ctDNA/methylation Epigenetic alterations DNA methylation Tumor heterogeneity

Liquid biopsy Main technologies CTC CTC enumeration CTC isolation CTC imaging Single cell analysis Tumor heterogeneity RT-qPCR ddPCR NGS FISH

ctDNA ARMS-PCR Methylation specific PCR ddPCR NGS

miRNAs

Circulating miRNAs

RT-qPCR ddPCR NGS

Extracellular vesicles FIGURE 8.10.  Liquid biopsies. Source: Lianidou E. et al. (2019), John Wiley & Sons.

•• ••

Requires specialized processing and transport Narrow detection spectrum

As stated previously, liquid biopsies can detect possible germline mutations based on variant allele frequency (VAF), since they are often blood-­based. A VAF approximating 50% may represent a germline variant, as VAFs of tumor DNA are generally lower. Genetic counselors in the cancer field need to have a working knowledge of how to interpret somatic analysis in the absence of testing on a normal sample, but paired tumor germline is likely to become much more common given the advantages of doing both together. For more information on interpretation of somatic analysis, please see work by genetic counselors in the field, including: ••

Forman A, Sotelo J. Tumor-­based genetic testing and familial cancer risk. Cold Spring Harb Perspect Med. 2020 Aug 3;10(8):a036590. doi: 10.1101/cshperspect.a036590. PMID: 31570381; PMCID: PMC7397843.

8. Genetic Testing Technologies

••

357

DeLeonardis K, Hogan L, Cannistra SA, et  al. When should tumor genomic profiling prompt consideration of germline testing? J Oncol Pract. 2019 Sep;15(9):465–473. doi: 10.1200/JOP.19.00201. PMID: 31509718.

8.3.  Clinical Issues In this section, common clinical issues will be described including: •• •• ••

How to assess the quality of NGS testing What types of tests to order in varying circumstances How to handle variant classification, reclassification, and conflicting interpretations

8.3.1.  How to Assess the Quality of NGS Testing The most common type of testing in clinical cancer genetics is multi-­gene cancer panel testing, which utilizes NGS technologies. There are important parameters to consider when ordering and assessing genetic tests including validity and utility. The first set includes the broader ideas of: •• •• ••

Clinical validity (are the genes on the panel associated with disease?) Clinical utility (will results be clinically actionable?) Balancing clinical specificity and sensitivity (is the assay comprehensive but not unwieldy?)

The second set includes: ••

Analytical validity (how good is the test at detecting pathogenic variants, both read-­ through and copy number?)

Many multi-­cancer multi-­gene panel analyses include genes that are considered preliminary evidence, that is where limited information is available about association with disease. The laboratory may have a high level of analytical validity for a gene, but the clinical validity and clinical utility may be lower. Inclusion of genes that are newly discovered can be driven by competition among commercial laboratories. Given the number of tests that they perform, these laboratories may also be the source of much of the emerging research on disease associations. It is important to understand this context when ordering testing. According to the American College of Medical Genetics and Genomics (ACMG) technical standard on diagnostic gene panels, a well-­designed panel should: •• ••

Be cost-­effective for a particular clinical indication. Maximize clinical sensitivity by, to the extent possible, including all genes associated with a Mendelian disorder, thereby allowing disorders with clinical heterogeneity and overlapping features to be molecularly diagnosed.

358

••

••

••

Counseling About Cancer

Include genes of uncertain significance with limited but emerging evidence if additional criteria are met. Maximize clinical specificity by limiting or excluding genes of uncertain significance, thereby minimizing detection of VUS. Employ auxiliary assays for genes or regions that cannot be interrogated with standard sequencing techniques to maximize the clinical utility.

The Clinical Genome Resource (ClinGen) is an NIH-­funded centralized resource dedicated to defining the clinical relevance of genes and variants for use in precision medicine and research (see Figure 8.11 for information about ClinGen’s key goals). ClinGen is an excellent source of information for genetic counselors on both gene and variant-­level curation. Information on gene-­disease validity is located on the ClinGen website (https://clinicalgenome.org/curation-­ activities/gene-­disease-­validity/). Gene-­disease validity is based both on case-­level evidence (phenotype, segregation, case-­control studies) and experimental evidence (functional studies, evidence that important pathways in disease are involved). In assessing analytical validity, technical completeness is important. This includes consideration of pseudogenes and gene families, mosaicism, transcript choices, copy-­number variants, and repetitive DNA such as Alu regions. For NGS, it should include depth of coverage (the number of reads for a location) and base quality (correctness of the reads). The Association for Molecular Pathology (AMP) and the College of American Pathologists (CAP) state that for germline testing, a minimum depth of coverage should be 30x with balanced reads, both forward Patients

Clinicians

Laboratories

Researchers

Aggregate Genomic and Health Data

Curate Based on ClinGen’s Critical Questions Gene Disease Validity

Evaluate & Improve

Variant Pathogenicity

Dosage Sensitivity

Clinical Actionability

Disseminate Expert Curated Knowledge

Evaluate & Improve

Improve Patient Care Through Genomic Medicine

FIGURE 8.11.  ClinGen key goals. Source: ClinGen (https://clinicalgenome.org/about/_).

8. Genetic Testing Technologies

359

and backward, equally represented. For somatic variants, this depth of coverage should be much higher, as high as 1000x. There are many other important factors in the development, monitoring, and reporting of an NGS panel, which are beyond the scope of this chapter. However, each laboratory should be transparent about the quality of the panel and the limitations of each test. 8.3.2.  What Type of Test to Order in Varying Circumstances When deciding what type of test to order, a number of factors may be important, including the following: •• ••

•• ••

•• ••

How quickly does the patient need results for treatment decisions? What testing has already been done in the family (for instance, is there a known familial pathogenic variant or not)? Is there family history of disease on both sides of the family? What are the patient’s preferences (for instance, does the patient want to minimize variants of uncertain significance)? What does the testing cost? How likely is it to give this particular patient an answer?

This section discusses the most common sequencing tests in hereditary cancer assessment. See Table 8.1 for information about how to choose a sequencing test. As described above, RNA analysis has also become more widely available as an addendum to DNA-­based genetic testing. While it does not significantly change the sensitivity of results, it may help to clarify variants of uncertain significance. In rare circumstances, deep intronic variants that would not have been detected with NGS are found, but this is unusual. 8.3.3.  How to Handle Variant Classification, Reclassification, and Conflicting Interpretations One of the more difficult concepts in genetic testing to explain to patients is the classification of variants, especially as multi-­gene panels become more commonly utilized. Conflicting variant interpretations by different laboratories and variant reclassifications over time are difficult issues for providers and patients alike, as clinical implications and recommendations may shift. Classification of variants is a complex topic and what follows is intended as an overview. For more in-­depth information about variant classification, there are resources available online: ••

••

Richards et al., 2015. Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology: https://www.nature.com/ articles/gim201530 https://clinicalgenome.org/tools/h3africa-­rdwg-­workshop/variant-­classification­using-­acmg-­amp-­interpreting-­sequence-­guidelines/

TABLE 8.1.  Comparison of Test Characteristics for Tests that Assess Sequence Variants Scope

Sensitivity

Uncertain findings

Secondary findings

Unexpected findings

Cost

Turnaround time

Use

Target pathogenic variant analysis

x

xxxxx

x

n/a

x

x

x

Known mutation in family—­ unilineal cancer history

Condition-­specific

xx

xxxx

xx

x

xx

x

x

Tumor characteristics and family history consistent with one condition

Broad multigene tests

xxx

xxx

xxx

xx

xxx

xx

x

In most hereditary cancer testing, multiple genes could explain personal and/or family history of cancer

Exome testing

xxxx

xx

xxxx

xxx

xxxx

xxx

xxx

Not useful for most hereditary cancer testing, may be useful for patient with specific findings that are syndromic, multiple family members with features

Whole-­genome sequencing

xxxxx

x

xxxxx

xxx

xxxxx

xxxx

xxxx

Not useful for most hereditary cancer testing, may be useful for patient with specific findings that are syndromic, multiple family members with features

Scope: The specific subset of genetic material the test assesses. Sensitivity: Includes both whether certain types of variants are detected and, for sequence variants, the read depth (the number of times a particular base is assessed). Read depth can be an important factor impacting the interpretation of wide-­scale tests such as exome and whole genome testing, as it indicates the likelihood that the test would have identified a variant if it was present. Uncertain findings: Occur when a test detects variants for which their impact and/or specific function remain unknown or unclear. Secondary findings: Identification of variants in genes unrelated to the presenting condition. These findings may or may not be reported, depending on lab policies and procedures and patient preferences. Unexpected findings: Identification of variants that indicate misattributed family relationships (e.g., nonpaternity), or variants in genes not previously suspected, but related to the presenting findings. Turnaround time: Amount of time it takes for tests results to be returned to the ordering provider. Source: Adapted from Jackson Laboratory, https://www.jax.org/education-­and-­learning/clinical-­and-­continuing-­education/cancer-­resources/genetic-­testing-­ technology-­comparison

8. Genetic Testing Technologies

361

8.3.3.1.  Variant Classification The most widely accepted standard for variant classification is that of the joint ACMG/AMP consensus recommendation (link in Section 8.1.3). This provided the framework for clinical genetic testing laboratories around the world to perform sequence interpretation that would be reasonably comparable. A five-­tier classification system is used for variants: 1. Pathogenic—­disease-­causing 2. Likely pathogenic—­theoretically >90% certainty of being disease-­causing 3. Uncertain significance—­conflicting or insufficient information to establish pathogenicity or benignity 4. Likely benign—­theoretically >90% certainty of being benign 5. Benign —­not associated with disease The classification system takes multiple lines of evidence into account, including: •• •• •• •• •• •• ••

The nature of the variant (e.g., nonsense, missense, canonical splice site, synonymous) The frequency of the variant in the general population and ethnic sub-­populations Reports of the variant in affected individuals Segregation or nonsegregation of the variant with disease within families Computational or “in silico” approaches to predicting variant effects Studies of expression, RNA splicing, and/or protein function Other findings may variously include de novo occurrence of a variant, co-­occurrence of a variant with a known pathogenic variant, and information from reputable sources.

There are two sets of criteria: one to support pathogenicity and one to support benignity. Pathogenicity: ••

Very strong (PVS), strong (PS1-­4), moderate (PM1-­6), or supporting (PP1-­5)

Benignity: ••

Stand-­alone (BA1), strong (BS1-­4), or supporting (BP1-­6)

Numbering does not represent weight but rather different lines of evidence. These criteria are then combined to come up with a score for classification. It is important to note that there is some judgment in the use of the criteria, as well as internal laboratory data that may shift the classification up or down. In addition, many laboratories have developed refinements and detailed sets of rules around the ACMG/AMP framework in order to standardize implementation of the guidelines in real case scenarios. The National Institutes of Health (NIH) has provided a publicly supported database for laboratories and other expert groups to submit their classifications on variants found through

362

Counseling About Cancer

clinical testing, research, and literature. This free searchable database, ClinVar, is invaluable to all members of the scientific and genetics community who are interested in the clinical validity of human genetic variants. Please see the ClinVar website (https://www.ncbi.nlm.nih.gov/ clinvar/intro/) for more information. 8.3.3.2.  Variant Reclassification Variants of uncertain significance (VUS) are frequently detected in broad panel testing. While there have been great strides in reducing the number of VUS through the efforts to sequence large populations and the widespread submission of variants by laboratories into ClinVar, VUS rates are still relatively high. Even among genes that have been studied for 30 years, such as BRCA1 and BRCA2, the VUS rate can vary depending on ancestry and laboratory, with rates as high as 15%. Reclassification of variants of uncertain significance is a helpful process, although it can be daunting from a practical perspective, as many labs will send out mass reclassifications on specific genes and/or variants in a short period. Generally, downgrading or changing the classification towards likely benign or benign supports the initial recommendation to set aside this information for use in clinical management, relying instead on personal and family history. However, upgrading or changing the classification towards likely pathogenic or pathogenic may require more time and effort on the part of the genetic counselor and clinical team. If the patient has a strong personal and/or family history, close clinical follow-­up would have been recommended anyway. On the other hand, without other indicators of risk, these upgrades may be unexpected and distressing for patients. It is helpful to have a standard process for addressing variants of uncertain significance upfront as well as reclassification of these variants over time. Pathogenic and likely pathogenic variants can also be downgraded to VUS or even likely benign, as laboratories recalibrate their threshold for pathogenicity on a per variant or per gene basis. In recent years, there has also been a push to classify “carrier” variants or genes in which dominant cancer susceptibility has been called into question, but variants in these genes are clearly associated with recessive risk. In rare circumstances, benign variants can be upgraded to variants of uncertain significance or even likely pathogenic/pathogenic variants. For example, a variant that has an effect on splicing may be recognized with the addition of RNA analysis that was not previously flagged. These are the most difficult types of reclassifications, as patients may interpret this as a “missed pathogenic variant” rather than reinterpretation of the data. 8.3.3.3.  Conflicting Interpretations Sometimes laboratories will reclassify genes or variants at a different rate or use internal data that other labs may not have access to. This can lead to conflicting interpretations which may be seen in ClinVar or when family members are tested at different laboratories. Fewer than 5% of variants in ClinVar have conflicting interpretations that would affect clinical management. Large, published data sharing and classification reconciliation efforts by major labs, as well as the ClinGen variant curation expert panels (VCEPS), have helped to harmonize variant classification. In practice, it is important to utilize ClinVar and leverage clinical experience with

8. Genetic Testing Technologies

363

a particular variant to contribute to knowledge and help standardize clinical management for individuals and families. The following guidelines about when to check ClinVar or go beyond the laboratory’s classification may help in addressing conflicting interpretations in real time: ••

••

••

If a variant is classified as uncertain significance, it is appropriate to check ClinVar for different interpretations and the reasoning behind any conflicting interpretations. In addition, if a variant of uncertain significance is in a gene that is consistent with the patient’s phenotype (tumor presentation, family history), it may be appropriate to: •• Review whether loss of heterozygosity for the gene is present in somatic testing •• Consider family studies for segregation of the variant •• Contact multiple laboratories about their classifications, as they may be on the brink of changing them, or any clinical/functional information that may be relevant, and encourage laboratories to share If a variant is classified as pathogenic or likely pathogenic and the variant is missense and rare or otherwise not straightforward, it is appropriate to review ClinVar to see if there are any other classifications by reputable laboratories. •• In cases where the variant is inconsistent with the patient’s phenotype, it may be valuable to send for additional testing such as RNA to see whether alternative splicing could lead to functional transcripts.

8.4.  Case Examples 8.4.1.  Case 1 Case Presentation: Rafaella, age 32, meets with a genetic counselor in clinic at the request of her doctor. She reports that her father’s extended family was found to have von Hippel–Lindau (VHL) disease through a study many years ago. In discussing family history questions with her mother, the patient had learned that her father, who died at age 50 of a stroke 5 years ago, was told that he did not have VHL in the study. However, Rafaella had described what she knew of the study to her doctor, who was concerned that whatever testing her father had done 25 years ago at age 30  may not have been as comprehensive as it is now. The genetic counselor asks Rafaella about signs of VHL in herself. She noted that the only unusual finding in her medical history was higher than normal blood pressure. Rafaella was able to tell the counselor that the study took place at a large academic center in the United Kingdom. Her father was an only child, but from what she knew of her extended family as reported by her mother, there was a strong family history of VHL-­related disease, including kidney cancer and other tumors. The counselor recommended that she undergo testing directly for VHL as well as a medical genetics evaluation, and Rafaella consented to testing. While waiting for results to return, the counselor did some digging into the study that her father participated in, and though she could not obtain a copy of Rafaella’s father’s results, she learned that the study was based on linkage to genetic markers close to the VHL locus.

364

Counseling About Cancer

Rafaella’s testing came back within a few weeks, and she was found to have a pathogenic variant in the VHL gene. The counselor had contracted that they would review these results by phone, and Rafaella was shocked at the revelation that she, in fact, had VHL. She went through a series of tests which included abdominal imaging and was found to have a pheochromocytoma that was secreting hormones, leading to her diagnosis of high blood pressure. Rafaella immediately underwent surgery for this, and the tumor was successfully removed. Follow-­Up: Rafaella continues to be monitored for signs and symptoms of VHL and was very thankful that her doctor had referred her, despite the report that the family’s understanding was that her father did not have VHL. The suspicion is that he also may have had a pheochromocytoma that had gone undetected and eventually caused his stroke. The counselor did recontact the center that had done the original linkage for the family and, as a result, a letter went out to study participants recommending current clinical testing for VHL since linkage analysis was not without limitations in the diagnosis. Of note, the study consent clearly stated that false negative results were possible and individuals who were not linked to the disease-­causing locus should still be evaluated and monitored for VHL. However, as family members were all located in different areas, many, like Rafaella’s father, were lost to follow-­up. Discussion: This case highlights the challenges in research on families from the early days of testing. Families who underwent alternative methods of testing in the past should consider updated NGS testing to ensure that a more accurate and thorough analysis is performed, and family members are counseled appropriately.

8.4.2.  Case 2 Case Presentation: The genetics clinic is busy this afternoon, and a patient appears on the schedule 10  minutes before the genetic counselor is scheduled to meet with her. The only information that the genetic counselor has before the patient is seen is that she was recently diagnosed with breast cancer at age 45. Preethi shows up at the appointment and begins by saying that she just wants the testing done, as she knows that her cousin had genetic testing and was found to have a BRCA mutation. The genetic counselor asks more questions about her cousin: how she was related to her, had she also had a cancer diagnosis, what did the structure of the family look like on that side of the family? The counselor finds out that, the cousin, Nitya, did not have cancer and is related to Preethi through her father’s only sibling, a brother. Their shared grandmother was diagnosed with breast cancer at age 55. The counselor asks Preethi whether she has a copy of the test results with her. Preethi states that she does not but that she knows her cousin’s mother told her mother that it was a BRCA mutation. She wants to have bilateral mastectomies for this early-­stage cancer, and her surgeon told her that she should pursue testing now so that she could obtain this surgery. The counselor reassures Preethi that she can have testing right away, but that it would be helpful to have her cousin’s result in hand so that the two results could be compared. Preethi relaxes after learning that she will be having the testing done. She states that she can contact her cousin through WhatsApp and find out more information. The counselor completes the session, reviews testing options and possible results, including the chance of a variant of uncertain

8. Genetic Testing Technologies

365

significance. Preethi consents to testing and has blood drawn for testing of a breast cancer gene panel with a rapid turnaround time. Preethi gets back to the genetic counselor the next day and tells her that her cousin replied to her to let her know that she was found to have a BRCA2 mutation. Nitya did not have a copy of the results with her to share but was willing to contact her doctor’s office to have them send it to the genetic counselor. It took about a week for her cousin’s results to be faxed over to the office. The genetic counselor saw that the laboratory overseas classified this variant in the BRCA2 gene as pathogenic; however, the variant was a missense variant and, when checking ClinVar, the counselor found that multiple reputable laboratories classified this as a variant of uncertain significance (VUS) with the overseas laboratory being the only one classifying this as pathogenic. Preethi’s test results came back a few days later showing the same variant in BRCA2, but the U.S. lab classified it as a VUS. The counselor called Preethi to discuss these results with her and the uncertainty of the BRCA2 finding. Preethi was frustrated by this information and questioned why her cousin was told that this was a mutation. The counselor went through the reasons why the U.S. lab had classified this as a VUS, explaining that there wasn’t sufficient information to be able to put this variant in the pathogenic or likely pathogenic category. However, the laboratory could ultimately reclassify this as either benign or pathogenic. After discussing this uncertainty further, the counselor suggested that Preethi discuss the information in more detail with her doctor so that she could make an informed decision about surgery. The counselor reached out to Preethi’s oncology team to inform them of the results and answer any questions they had. The oncologist and surgeon scheduled in-­depth discussions with Preethi about the uncertainty of these results and the pros and cons of pursuing a larger surgery in this situation. They discussed a plan for treatment that would involve lumpectomy and radiation with close follow-­up that would include breast MRI and mammograms, as well as ovarian suppression. Preethi felt better about the fact that she would be followed closely. Follow-­Up: The genetic counselor checked in with Preethi after she had completed her treatment. Preethi reported that she felt more like herself now that there had been some time since her surgery and radiation. The counselor also reassured her that she would be informed if there was a change in the classification of the BRCA2 VUS. She encouraged Preethi to let her cousin know about the difference in interpretation and suggested that her cousin also discuss this with her own doctor. Preethi agreed. Discussion: This case raises the issues surrounding discordant variant classifications and the importance of following up on familial testing.

8.5.  Discussion Questions Question 1: Your patient reports that his mother was diagnosed with familial adenomatous polyposis at age 30 and was found to have about 100 polyps at the time. His mother gave him a copy of her protein truncation testing that showed a shortened APC protein product. a. What type of testing would you recommend for your patient? b. If his testing is negative, would you be comfortable treating him as a true negative? c. What information would help you make that decision?

366

Counseling About Cancer

Question 2: You are seeing a family that has familial melanoma. A brother, sister and mother are together for the genetic counseling session. All were diagnosed with cutaneous melanoma before the age of 40, and they all state that they have been careful in the sun. The sister was diagnosed with an ocular melanoma last year. a. Is this a family that you would want to run an exome on? b. If an exome was run on this family and testing was negative, could you be reassuring about the possibility of inherited risk? c. What information would help you interpret the exome results?

8.6.  Further Reading Adams, J. DNA sequencing technologies. Nature Education. 2008;1(1):193. Benefits and limitations of next-­ generation sequencing versus Sanger sequencing (Illumina PUB 770-­2019-­018). Bean LJH, Funke B, Carlston CM, et al. ACMG Laboratory Quality Assurance Committee. Diagnostic gene sequencing panels: from design to report—­a technical standard of the American College of Medical Genetics and Genomics (ACMG). Genet Med. 2020 Mar;22(3):453–461. doi: 10.1038/s41436-­019-­0666-­z. Epub 2019 Nov 16. PMID: 31732716. Bio-­Rad Laboratories, Inc. Denaturing gradient gel electrophoresis (DGGE). Retrieved from https://www. bio-­rad.com/webroot/web/html/lsr/products/electrophoresis/product_overlay/global/electro_ dgge.html Cheng DT, Prasad M, Chekaluk Y, et al. Comprehensive detection of germline variants by MSK-­IMPACT, a clinical diagnostic platform for solid tumor molecular oncology and concurrent cancer predisposition testing. BMC Med Genomics. 2017 May 19;10(1):33. doi: 10.1186/s12920-­ 017-­ 0271-­ 4. PMID: 28526081; PMCID: PMC5437632. Cheng ML, Solit DB. Opportunities and challenges in genomic sequencing for precision cancer care. Ann Intern Med. 2018 Feb 6;168(3):221–222. doi: 10.7326/M17-­2940. Epub 2018  Jan 9. PMID: 29310131; PMCID: PMC6659420. ClinVar. What is ClinVar? https://www.ncbi.nlm.nih.gov/clinvar/intro/ Heather JM, Chain B. The sequence of sequencers: The history of sequencing DNA. Genomics. 2016;107(1):1–8. Illumina. Illumina sequencing methods. https://www.illumina.com/techniques/sequencing.html. Accessed January 22, 2022. Jennings LJ, Arcila ME, Corless C, et  al. Guidelines for validation of next-­generation sequencing-­based oncology panels: A joint consensus recommendation of the Association for Molecular Pathology and College of American Pathologists. J Mol Diagn. 2017 May;19(3):341–365. doi: 10.1016/j.jmoldx.2017.01.011. Epub 2017 Mar 21. PMID: 28341590; PMCID: PMC6941185. Karam R, Conner B, LaDuca H, et al. Assessment of diagnostic outcomes of RNA genetic testing for hereditary cancer. JAMA Netw Open. 2019 Oct 2;2(10):e1913900. doi: 10.1001/jamanetworkopen.2019.13900. PMID: 31642931; PMCID: PMC6820040. Karki R, Pandya D, Elston RC, et  al. Defining “mutation” and “polymorphism” in the era of personal genomics. BMC Med Genomics. 2015 Jul 15;8:37. doi: 10.1186/s12920-­015-­0115-­z. PMID: 26173390; PMCID: PMC4502642. Kurdyukov S, Bullock M. DNA methylation analysis: choosing the right method. Biology (Basel). 2016;5(1):3. doi:10.3390/biology5010003

8. Genetic Testing Technologies

367

Lianidou E, Pantel K. Liquid biopsies. Genes Chromosomes Cancer. 2019 Apr;58(4):219–232. doi: 10.1002/ gcc.22695. Review. PMID: 30382599. Life Technologies Corporation. Single strand conformation polymorphism (SSCP) analysis on Applied Biosystems® 3130 and 3130xl capillary electrophoresis systems. Accessed at http://tools.thermofisher. com/content/sfs/brochures/cms:083566.pdf Lowe R, Shirley N, Bleackley M, et al. Transcriptomics technologies. PLoS Comput Biol. 207;13(5) e1005457. https://doi.org/10.1371/journal.pcbi.1005457 Mahamdallie S, Ruark E, Yost S, et al. The Quality Sequencing Minimum (QSM): Providing comprehensive, consistent, transparent next generation sequencing data quality assurance. Wellcome Open Res. 2018 Apr 4;3:37. doi: 10.12688/wellcomeopenres.14307.1. PMID: 29992192; PMCID: PMC6020721. Maxam AM, Gilbert W. A new method for sequencing DNA. Proc. Natl Acad. Sci. USA. 1977;74:560–564. MRC Holland: Principle of MLPA: https://www.mrcholland.com/technology/mlpa/technique Pinkel D, Albertson DG. Array comparative genomic hybridization and its application in cancer. Nature Genet. 2005;37(Suppl):S11–S17. Sanger F, Nicklen S, Coulson AR. DNA sequencing with chain-­terminating inhibitors. Proc. Natl Acad. Sci. USA. 1977;74:5463–5467. Schouten JP, McElgunn CJ, Waaijer R, et al. Relative quantification of 40 nucleic acid sequences by multiplex ligation-­dependent probe amplification. Nucleic Acids Res. 2002 Jun 15;30(12):e57. doi: 10.1093/ nar/gnf056. PMID: 12060695; PMCID: PMC117299. Schienda J, Church AJ, Corson LB, et al. Germline sequencing improves tumor-­only sequencing interpretation in a precision genomic study of patients with pediatric solid tumor. JCO Precis Oncol. 2021 Dec 22;5:PO.21.00281. doi: 10.1200/PO.21.00281. PMID: 34964003; PMCID: PMC8710335. Slavin TP, Banks KC, Chudova D, et al. Identification of incidental germline mutations in patients with advanced solid tumors who underwent cell-­free circulating tumor DNA sequencing. J Clin Oncol. 2018 Oct 19;36(35):JCO1800328. doi: 10.1200/JCO.18.00328. Epub ahead of print. PMID: 30339520; PMCID: PMC6286162. Theisen, A. Microarray-­based comparative genomic hybridization (aCGH). Nature Education. 2008;1(1):45. Thermo Fisher Scientific, Inc. Genome-­wide human SNP Array 6.0. Accessed from http://www.affymetrix. com/support/technical/byproduct.affx?product=genomewidesnp_6_cyto Thermo Fisher Scientific, Inc. What is next-­generation sequencing? https://www.thermofisher.com/us/ en/home/life-­science/sequencing/sequencing-­education/next-­generation-­sequencing-­basics/what-­ is-­next-­generation-­sequencing.html. Accessed January 22, 2022. Wang B, Kumar V, Olson A, et al. Reviving the transcriptome studies: an insight into the emergence of single-­ molecule transcriptome sequencing. Front Genet. 2019 Apr 26;10:384. doi: 10.3389/fgene.2019.00384. eCollection 2019. Review. PMID: 31105749; PMCID: PMC6498185. Willis AS, van den Veyver I, Eng CM. Multiplex ligation-­dependent probe amplification (MLPA) and prenatal diagnosis. Prenat Diagn. 2012 Apr;32(4):315–320. doi: 10.1002/pd.3860. PMID: 22467161.

CHAPTER

9 Pre-­ and Post-­Test Genetic Counseling

I’m a very strong believer in listening and learning from others. —­Ruth Bader Ginsberg (Egypt TV, 2012)

Cancer genetic counseling has evolved greatly over the past three decades. Its early roots extend back to the classic genetic counseling and testing model for Huntington disease. In this three-­ step, in-­person model, a patient was seen for the purpose of discussing the disease symptoms and variability at an initial visit. During the initial visit, a significant amount of time was spent considering risk and the specific psychosocial impact that learning the test results would have on the person’s life. The patient was then sent home to consider this over a period of weeks or months. At the second in-­person visit, the patient returned to the clinic, provided informed consent for genetic testing, and had their blood drawn if they elected for testing. When results became available, the patient returned for a clinic visit (often with a support person) to review the results and implications in a well-­controlled, psychologically safe environment. This type of environment promoted a feeling whereby the patient could feel valued and comfortable yet still speak up and take risks without fear of retribution, embarrassment, judgment, or consequences either to themselves or others. This intensive, multistep model was developed specifically for predictive genetic testing when it involves a highly penetrant, lethal disease with no options for prevention or treatment. Genetic testing for hereditary cancer in the 1990s mimicked this three-­visit, in-­person ­genetic testing model. Most cancer predisposition testing was performed under the auspices of a research study, in part because testing was very expensive, not covered by healthcare insurance, not available in a commercial (CLIA) approved lab, and considered investigational. There was Counseling About Cancer: Strategies for Genetic Counseling, Fourth Edition. Katherine A. Schneider, Anu Chittenden, and Kristen Mahoney Shannon. © 2023 John Wiley & Sons Ltd. Published 2023 by John Wiley & Sons Ltd.

369

370

Counseling About Cancer

no data to support the efficacy of cancer prevention, risk-­reducing surgery was not well studied and seemed incredibly dramatic as an option, and the psychological impact of genetic test results was felt to be significant. The original model of cancer genetic testing supported the notion that this type of predictive testing was emotionally and psychologically risky and warranted significant pause before execution. The research performed in the early days of predisposition testing proved to be fruitful. Most studies supported the fact that the psychological effects of cancer predictive testing were minimal and that patients’ coping strategies over the long term were successful. In addition, the data regarding early detection and prevention of cancer (e.g., screening for breast cancer with breast MRI, risk-­reducing oophorectomy) were promising, and suggested that medical interventions were successful at reducing illness and death in those individuals found to be at significant risk. These studies slowly convinced insurance companies to cover the cost of predictive genetic testing for high-­risk patients. All this movement made the option of genetic testing for hereditary cancer much more appealing to patients and providers. The early 2000s challenged the traditional three-­visit model for cancer genetic testing. Physicians were relying on genetic test results to help guide cancer patients’ surgical treatment. Members of high-­risk families who had not been diagnosed with cancer wanted the test results to help them reduce their cancer risk. In the early part of the decade, it was not uncommon to not test these patients without cancer and tell them to have their family members with cancer tested first. As the early 2000s proceeded, guidelines and insurance coverage became broader and more and more patients without cancer were presenting for genetic testing. The volume of patients who needed access to the genetic testing information, coupled with the data suggesting that patients coped well with this information, led genetic counselors to relinquish the time-­intensive three-­visit model. Two separate pre-­test visits were no longer required, and patients soon were able to undergo pre-­test counseling and get their blood sample drawn for analysis during one in-­person visit. Most genetic counseling programs continued to require patients to come back to clinic for the results disclosure session but that, too, fell by the wayside for the sake of patient and provider convenience and by 2010 many patients were receiving their cancer genetic test results via telephone call. In the 2010s, the number of patients looking to access genetic testing continued to skyrocket. Professional organizations like the National Comprehensive Cancer Network (NCCN) broadened their criteria for whom genetic testing was indicated. In June 2013, the U.S Supreme Court ruled that “naturally occurring” human genes could not be patented, which allowed for commercial genetic testing laboratories to enter the previously monopolized clinical genetic testing space. The advent of gene panel testing in the middle of the decade made genetic testing more informative and efficient, because suddenly all the genes of interest could be analyzed simultaneously for a single lab charge. The overwhelming volume of patients seeking genetic testing and the limited genetic counseling workforce further challenged the traditional model. Patients and providers were anxious for access to this potentially life-­saving information, and the genetic counseling field needed to consider ways of making the model scalable. The model of cancer predisposition testing continues to evolve. The success and acceptance of pre-­test counseling and informed consent by a genetic counselor via telephone and/or video is being studied, and preliminary data suggest that these telehealth modalities are not inferior to in-­person genetic counseling. Patients have embraced direct access/patient-­initiated testing modalities through commercial laboratories and the major medical centers began to offer them

9. Pre-­and Post-­Test Genetic Counseling

371

as well. In some centers, the pre-­test informed consent process is being done by other providers or staff members, with genetic counselors being more on the “back end” in the interpretation and follow-­up of genetic test results. Pre-­test informed consent via technology (e.g., educational video, chat-­bot, etc.) is also being performed and studied, with initial favorable responses in populations that are comfortable with the technology. This chapter provides a discussion of the elements of pre-­ test and post-­ test genetic counseling. It reviews the traditional components and explores nontraditional modifications to the genetic counseling process.

9.1.  Traditional Pre-­Test Genetic Counseling Session Historically, genetic counselors have been an integral part of the pre-­ test counseling and informed consent process and in many centers, this still remains the case. The informed consent process includes many steps, typically culminating in the signing of an informed consent document. Informed consent shows respect for personal autonomy and is legally required for genetic testing by many states in the United States. The following sections describe the elements of and strategies for providing a traditional pre-­test genetic counseling session. 9.1.1.  The Basis for Decision Making The pre-­test genetic counseling session historically involves obtaining or reviewing a detailed medical and family history and providing patients with risk assessments unique to their situations (see Chapters  6 and  7). After the risk assessment has been communicated, a genetic counseling session transitions to educating the patient. The education portion of the visit includes providing information about genetics, test options, risks and benefits of genetic testing, and what options/medical management strategies the patient might face, depending on the results. Once the information has been communicated with the patient, the genetic counselor facilitates decision making. If the patient decides to proceed with genetic testing, all this work typically culminates in the signing of an informed consent document. Finally, the pre-­test session ends with a discussion of how the patient will be getting their test results (e.g., in-­person, video, phone, email, letter) and the timing of this results disclosure. Historically, genetic counselors have been an integral part of each of these steps. This is changing, however, as the traditional model is not scalable to the large number of patients who need access to genetic counseling and testing services. The goal of these changes in the genetic counseling model is to take some of the repetitive, time-­consuming, and scriptable components of the genetic counseling session and delegate them to other staff members or artificial intelligence. This would leave genetic counselors more time to spend on valuable and highly skilled patient care. 9.1.1.1.  Data Collection and Risk Assessment The previous chapters have discussed the principles of gathering a full family cancer history and a detailed personal and medical history, and generating a differential diagnosis. In the traditional pre-­test genetic counseling session, these are performed by a genetic counselor or

372

Counseling About Cancer

other healthcare provider with expertise in genetics and risk assessment, who typically clarifies a patient’s individual risk status so that the patient can use it in the decision-­making process. However, this element of the pre-­test counseling session is sometimes automated. Electronic family history collection tools (see also Section 6.4.1.9) and incorporated risk models gather the data and provide individualized risk assessment (see also Section 7.4) in an effort to streamline the genetic counselor’s role in the pre-­test counseling session. 9.1.1.2.  Genetics Education Once the risk assessment has been communicated, educating the patient on inheritance patterns, penetrance, variable expressivity, and the possibility of genetic heterogeneity is essential. Discussing the possible management options for individuals who choose to test (including those who have positive, negative, and VUS results), as well as those who choose not to test, is important. This discussion should include data on the efficacy of methods of cancer prevention and early detection. In the historic model of pre-­test education, each syndrome/gene and their corresponding screening/prevention measures would be reviewed in detail with the patient. With the advent of gene panel testing, there is less of a focus on the specifics of each gene/syndrome and more generalizations are made. For example, when counseling a patient for a high-­risk breast cancer gene panel, the counselor may describe “earlier, more frequent screening for breast cancer” rather than stating the specifics (e.g., “BRCA1 pathogenic variant carriers begin with annual MRI screening at age 25 and then at age 30 beginning with alternating MRI and mammogram”). In the traditional pre-­test genetic counseling session, this educational component is performed by a genetic counselor. There is a movement, however, to change the one-­on-­one nature of the educational portion of the session and use different delivery models to impart the genetics information to the patient. Group counseling, for example, has been used to educate patients on a larger scale. Technology options, like chatbots and educational videos, have also been used to impart the genetics information essential to the informed consent process. While these are incredibly interesting options given the scalability and access implications for genetic testing, these methods must be studied to ensure that the patient experience and ability to provide informed consent are not compromised. 9.1.1.3.  Psychological/Emotional Education The psychological and emotional burden of genetic testing cannot be underestimated, despite the lack of long-­term sequelae. Part of the informed consent process must include a discussion of possible psychological, social, economic, and family dynamic ramifications of testing or not testing. Patients must be informed of the alternatives to genetic testing (e.g., tissue banking, DNA banking, etc.) as well. This information can be incredibly personal, and should include discussion of a person’s expectations, beliefs, goals, and motivations. Genetic counselors are uniquely trained to facilitate this component, and in the traditional pre-­test genetic counseling session, the genetic counseling provider plays an important role.

9. Pre-­and Post-­Test Genetic Counseling

373

9.1.2.  Obtaining Informed Consent Within the United States, many states have legislation that clearly outlines specific elements of the informed consent process that must be acknowledged by both patient and provider. Most of the legislation requires that a patient be educated regarding the specific test being performed; the possible results of the tests; the risk, benefits, and limitations of testing; and a signed informed consent document that is placed in the patient’s health record. The National Conference of State Legislatures maintains an online resource that presents a state genetic summary table on privacy laws that can be a good resource for the practicing genetic counselor (http://pierce.wesleyancollege.edu/faculty/hboettger-­tong/docs/hbt%20public%20 folder/FYS/State%20Genetic%20Summary%20Table%20on%20Privacy%20Laws.htm). Elements of informed consent and informed consent practices may be different in other countries throughout the world. 9.1.2.1.  Specific Test Being Performed Currently, there is a wide variety of testing modalities available for cancer predisposition genetic testing. Prior to 2013, when genes were patentable, genetic testing was ordered on a single-­gene basis. Once gene patenting was ruled invalid and technology advanced, it became possible to perform multigene panel genetic testing. It is important for the patient to understand what type of testing is being performed (see also Chapter  8), because the possible outcomes of genetic ­testing are directly linked to the type of test ordered. The following sections discuss the most common types of tests ordered in the cancer genetics space. 9.1.2.1.1.  DNA Sequencing This type of test involves an analysis of the entire coding sequence of the gene, plus a certain number of DNA nucleotides at each splicing junction. Comprehensive analysis is generally recommended for a patient who is either the first person in the family to be tested, or the member of a family for whom testing, so far, has revealed only negative results. Possible test results include positive, indeterminant negative, variant of uncertain significance (VUS), and true negative (if there is a known familial variant to provide context). 9.1.2.1.2.  Genomic Rearrangement Testing A subset of individuals with hereditary cancer syndromes will have large deletions rather than nucleotide errors. In rare cases, the entire gene may be deleted. Standard DNA sequencing will not detect these genomic rearrangements. For example, in the Dutch population, there are two BRCA1 founder deletions that are not detected on DNA sequencing but detected by MLPA or Southern blot analysis. In some cases, the molecular laboratory will perform the deletion studies together with the DNA sequencing analysis, but most of the time, the deletion studies must be ordered separately. Possible test results include positive, indeterminant negative, variant of uncertain significance (VUS), and true negative (if there is a known familial rearrangement variant).

374

Counseling About Cancer

9.1.2.1.3.  Single-­Site Analysis Patients can be offered single-­site analysis when a specific gene pathogenic variant has previously been identified in the family. As the name suggests, this type of genetic testing focuses on a specific variant (e.g. specific nucleotides, gene rearrangement) and reports only one of two outcomes. Possible test results include positive and true negative (for the known familial variant). It is important to note that individuals who undergo single-­site variant testing may benefit from or require more expansive testing. 9.1.2.1.4.  Founder Pathogenic Variant Testing In this type of testing, an individual is tested for one or more specific pathogenic variants that are more prevalent in the individual’s ethnic group or geographic region. For example, people of Ashkenazi Jewish heritage who undergo BRCA1 and BRCA2 testing were historically tested for three specific founder pathogenic variants: BRCA1 c.68_69delAG (historically called 185delAG or 187delAG), the BRCA1 c.5266dupC (historically called 5382insC or 5385insC) pathogenic variants, and the BRCA2 c.5946delT (historically called 6174delT) pathogenic variant. It is estimated that people of Ashkenazi Jewish heritage have a 2% probability of carrying one of the three BRCA founder pathogenic variants. For this reason, all Ashkenazi Jewish patients who are tested for a familial BRCA pathogenic variant should be tested for all three founder pathogenic variants rather than single-­site analysis because of the small chance they could have inherited a pathogenic variant from the other parent simply due to ethnicity and the high carrier frequency. This presupposes that the other parent is also of Ashkenazi Jewish descent, which should be verified with the patient. Possible test results include positive, indeterminant negative, and true negative (if there is a known familial variant). It is important to note that individuals who undergo founder variant testing may benefit from or require more expansive testing. 9.1.2.1.5.  Multigene Panel Testing (MGPT) Next-­generation sequencing (NGS) technology made multigene panel testing (MGPT) more accessible and cost effective in the early twenty-­first century. MGPT was introduced in the United States in 2013 and changed the landscape of genetic testing by enabling laboratories to simultaneously examine dozens of cancer genes at a cost that is similar to those of single-­gene tests. The specific genes included in each MGP vary by laboratory. Many laboratories offer a variety of MGPs for specific types of cancers, such as a breast cancer panel or colon cancer panel, as well as broad cancer panels that include genes associated with many different types of cancer. In addition to well-­vetted, clinically actionable genes, many labs will include genes on their panels that are not well studied and have no clinical significance at this time. Possible test results include positive, indeterminate negative, variant of uncertain significance (VUS), and true negative (if there is a known familial variant). 9.1.2.1.6.  Exome/Genome Testing Whole-­genome sequencing (WGS) is used to sequence the complete DNA of an individual. This includes sequencing all coding (exons) and noncoding (introns) nuclear DNA as well as mitochondrial DNA. Although the exome makes up only 1.5% of the whole human genome, it

9. Pre-­and Post-­Test Genetic Counseling

375

contains all of the protein-­coding genes. Since most genetic disorders are correlated with ­pathogenic variants in protein-­coding genes, performing an exome test (whole-­exome sequencing, WES) is often preferred, as it is far cheaper and less complex than whole-­genome sequencing. Possible test results include positive, indeterminate negative, variant of uncertain significance (VUS), and true negative (if there is a known familial variant). 9.1.2.1.7.  Polygenic Risk Score Testing A polygenic risk score (PRS) is an assessment of the risk of a specific condition based on the collective influence of many genetic variants. These can include variants associated with genes of known function and variants not known to be associated with genes relevant to the condition. Results of PRS are not positive or negative but represent the relative risk of developing a specific disease. 9.1.2.1.8.  RNA Testing Some DNA testing laboratories are offering concurrent RNA analysis for certain genes. RNA analysis can help classify DNA variants by providing functional RNA information. This functional information can help identify and interpret DNA variants, including deep intronic variants not detected by a DNA-­only approach. Results are typically not presented as a separate item but are included in the DNA analysis results. 9.1.2.1.9.  Paired Tumor/Germline Testing Tumor genomic testing has become an essential component of oncology practice. Gene pathogenic variants found in a patient’s tumor can give physicians keen insight into how the cancer is growing and will behave. Reasons for tumor genomic testing include: •• •• •• •• ••

To match a treatment to a specific tumor To determine whether the specific cancer is resistant to treatment To determine whether more treatment is needed for a patient To reduce the risk of side effects in a patient To find a clinical trial for a patient

Some pathogenic variants (PVs) do not have such a central role in all cancer diagnoses, but their presence or absence might change how each person’s cancer is described. Through tumor-­normal whole-­genome sequencing, researchers can compare tumor pathogenic variants to a matched normal sample. Tumor-­normal comparisons are crucial for identifying the somatic variants that act as driver pathogenic variants in cancer progression. When including normal tissue in the analysis, however, there is always the possibility of detecting a PV that is germline in nature. Results of tumor testing are typically reviewed by medical oncologists who interpret the tumor-­normal testing and change the treatment of the patient accordingly. Genetic counselors are often called upon to assist with the interpretation of these variants. Often obtaining a blood or saliva sample is needed to confirm that the PV is germline.

376

Counseling About Cancer

9.1.2.1.10.  Other Somatic Testing It is not uncommon for cancer patients (especially individuals with gastrointestinal cancer) to undergo somatic/tumor testing to help guide clinical management. Most often, patients will undergo somatic testing to look for the presence of DNA mismatch repair (MMR), which is often associated with Lynch syndrome (see also Section 2.5.7). MMR status in tumors is most commonly assessed by immunohistochemistry (IHC) testing or microsatellite instability (MSI). Many centers have implemented universal tumor screening protocols (meaning all tumors are tested in the initial pathology review) through one of these methods for both colorectal and endometrial cancers. About 15–20% of both types of cancers will screen positive for deficient MMR through loss of one or more proteins on IHC or microsatellite instability. Of these tumors, only about 1 in 5 will actually be associated with Lynch syndrome. The remainder are likely due to somatic changes (somatic promoter hypermethylation of the MLH1 gene; double somatic hits). Since most sporadic MMR deficient tumors are attributed to promoter hypermethylation of the MLH1 gene (epigenetic silencing) and then a second hit on the other allele, many centers have implemented a second test to assess for promoter hypermethylation. This can be done either through direct methylation analysis or through BRAF V600E testing, which is highly associated with hypermethylation of the MLH1 gene. In many cancer centers, tumor sequencing has become another way to assess for microsatellite instability and may eventually replace the use of universal tumor screening. Tumor sequencing can assess for mutational burden and potentially identify germline mutations when paired with germline analysis. It can also identify other markers that may have therapeutic implications, in addition to other forms of inherited susceptibility. Tumor sequencing for the MMR genes has also become critical in differentiating between patients with Lynch syndrome and those who have developed an MMR phenotype based on somatic biallelic MMR gene inactivation. It is important that the genetic counselor understand that results of somatic/tumor testing are for the most part not diagnostic for inherited cancer susceptibility, but screening. The genetic counselor may be called upon to assist with the follow-­up diagnostic testing in this setting. 9.1.2.2.  Possible Genetic Test Results Patients should be aware of the various results they might receive from genetic testing. The possible test results will be different based on the test performed. Also, the probability of each result is impacted by the type of test performed and an individual’s a priori risk for a hereditary cancer syndrome. 9.1.2.2.1. Positive A positive result is one in which a specific germline pathogenic variant (PV) has been identified in one copy of a gene. The germline PV will either be a frameshift pathogenic variant or a missense pathogenic variant that has been shown to affect the function of the gene. A positive result will often explain the pattern of cancer in the family and means that the patient has increased risks of specific malignancies.

9. Pre-­and Post-­Test Genetic Counseling

377

Sometimes, a PV will be identified in a gene that is not associated with the personal and/or family history of cancer. This is called an incidental finding and can often be surprising to the genetic counselor and patient. Whenever a PV is identified, the patient’s relatives will also be at increased risk for carrying the variant and have the option of undergoing definitive genetic testing. The process of familial testing for a known PV is often called cascade testing. 9.1.2.2.2.  Indeterminate Negative (Sometimes Called an Uninformative Negative) An indeterminate negative result is one in which no pathogenic variant has been identified. This result may decrease the likelihood that the patient has an inherited predisposition to cancer but does not eliminate the possibility. The individual could have a pathogenic variant in the analyzed gene that cannot be detected by current technologies or could have a pathogenic variant in another gene that was not tested for or has not yet been identified. In families at high risk for a hereditary cancer syndrome, an indeterminate negative test result should not be viewed as reassuring news. The patient may have increased cancer risks and it may still be appropriate to discuss additional monitoring options. Sometimes it is helpful to offer testing to other relatives to try and identify a positive result in the family. 9.1.2.2.3.  Variant of Uncertain Significance (VUS) Patients need to be aware that not all genetic test results will yield definitive results. Whenever genetic analyses are performed, there is a chance that a novel DNA change will be identified. The American College of Medical Genetics and Genomics (ACMGG) has established criteria for interpreting those novel variants as pathogenic, likely pathogenic, uncertain, likely benign, or benign. Those variants that are uncertain in terms of pathogenicity are called variants of uncertain significance (VUSs). A common example of a VUS is a missense variant (i.e., a change in a single DNA nucleotide) that cannot be definitely characterized as either a functional, pathogenic variant (i.e., a positive result) or a polymorphism of no clinical significance (i.e., a negative result). VUSs also can be seen in the intron/exon boundary or can be gains/duplications of exons. Receiving a VUS result should not alter estimates of risk or recommendations about screening. At the current time, it can take months or years for a VUS to be formally reclassified. The testing laboratory may request blood samples from additional family members as part of their efforts to clarify the VUS, but these results should be interpreted with caution. Family members asked to donate samples for such a study need to be aware that these efforts may still not yield a definitive answer. The testing laboratory will often reclassify the result when they have sufficient information. It is important for the genetic counselor to confirm the reclassification process with the laboratory because most clinical genetic testing labs will issue an updated genetic test report when the VUS is reclassified, but not all of them do. Genetic counselors must also be aware that the classification of variants is not uniform across laboratories. A variant may be classified as a VUS at one lab and a PV at another. This can cause confusion in patients and their families, as some members of a family may believe the variant is uncertain and others may believe it is pathogenic.

378

Counseling About Cancer

9.1.2.2.4.  True Negative A true negative result is the absence of a familial PV in either copy of the gene. The patient’s descendants are not at risk for carrying the familial PV and will not need to be tested for this familial PV. A true negative result does not alter the likelihood that the patient’s siblings could carry the PV. When a person has a true negative result, they can generally be reassured of not being at increased risk for the cancers running in the family. Caution must be used, however, when the PV is in a moderate penetrance genes, such as CHEK2 or ATM. In a family with a moderate penetrance PV, a person who tests negative may still have some residual familial based risk as the moderate penetrance gene may not fully account for all the cancers in the family. 9.1.2.2.5.  Discordant Results Interpretation of classification guidelines by laboratories and providers may differ and lead to misclassification and/or conflicting reporting of variants. Variant misclassification is problematic in either direction: it can lead either to inappropriate prophylactic surgery or to a failure to pursue appropriate surveillance or risk-­reducing medication or surgery. Conflicting reports of pathogenicity are also a significant problem as different labs have different thresholds for classification. Conflicting interpretations of the same variant, when one lab classifies the variant as pathogenic/likely pathogenic and another lab classifies the variant as VUS, can lead to significant difficulty for patients and providers, as these interpretations have significant implications on medical management recommendation. In addition to affecting medical management for the individual pursuing testing, incorrect variant knowledge affects family members and can lead to inaccurate risk stratification, leading to both inappropriate and economically wasteful enhanced screening or lost opportunities for risk reduction. 9.1.2.2.6.  Mosaic Results Mosaicism, especially with the TP53 gene, is not uncommonly detected with current genetic testing technology. When mosaicism is detected, there could be a few different explanations: ••

••

Somatic mosaicism: Over the course of a person’s life, a pathogenic variant can develop in a portion of cells, such as blood cells, but not in other tissues. The clinical significance of this finding is currently unclear. In rare instances, this may represent a blood cancer. Constitutional mosaicism: When a pathogenic variant arises during early fetal development, it is possible that the pathogenic variant may only be present in some tissues/ organs, and not in others. The children of an individual with constitutional mosaicism are at a low risk of having inherited the pathogenic variant; however, siblings, parents, and extended relatives are not typically at risk.

It is important to realize that it is quite difficult to determine whether a mosaic pathogenic variant is somatic or constitutional. In some cases, it might be helpful to test a different tissue type. For example, if the mosaic result was detected on a blood specimen it might be helpful to

9. Pre-­and Post-­Test Genetic Counseling

379

test the patient again using a skin biopsy. Most often, mosaic results represent somatic ­mosaicism. However, while a blood cancer is unlikely, patients should discuss this possibility with their healthcare providers. In addition, because constitutional mosaicism cannot be ruled out, out of an abundance of caution, genetic testing for the patient’s children should be recommended. 9.1.2.3.  Potential Risks, Benefits, and Limitations of Testing For most genetic tests, detailing the pros and cons of testing is a key part of the pretest session. (See Table 9.1.) 9.1.2.3.1.  Benefits of Testing The potential benefits of learning one’s genetic test results include the following: ••

••

May end uncertainty about one’s gene status—­Patients who undergo testing may have lived with their cancer worries for a long time. The burden of not knowing whether one is at increased risk may add to the difficulties of the situation, especially within a family in which cancer is so prevalent. Learning one’s gene status may provide a sense of control over the cancer syndrome—­and one’s destiny. There has also been some research to suggest that family members who elect not to be tested actually have higher anxiety than those who were tested and found to carry the genetic predisposition. For some people, it is the “not knowing” that is hardest to live with. May be a negative (normal) result—­Patients with true negative results are not at increased risk for developing syndrome-­related cancers and their offspring cannot inherit the familial pathogenic variant. Thus, learning a true negative result may have both a psychological and a medical benefit. Patients who receive indeterminate negative results may also be relieved by their results, although they need to be cautioned that the test has not ruled out the possibility of an inherited predisposition to cancer or indicate that they do not have an elevated risk for certain types of cancer. TABLE 9.1.  Potential Benefits and Risks of Cancer Genetic Testing Benefits May end uncertainty about one’s gene status •• May be a negative (normal) result •• May impact medical management decisions •• May clarify cancer risks for other relatives Risks •• May increase cancer worry and sadness •• May be of questionable medical benefit •• May lead to genetic discrimination •• May strain family relationships ••

380

••

••

Counseling About Cancer

May impact medical management decisions—­One of the purposes of genetic testing is to identify individuals who are at high risk for developing cancer. Individuals who do have an inherited susceptibility to cancer will often be advised to undergo specialized surveillance tests and/or to undergo monitoring at earlier ages and/or more frequent intervals than is customary. There may also be risk-­reduction strategies available, such as chemoprevention or risk-reducing surgery. For those individuals with a cancer diagnosis, genetic test results can help determine the best plan of treatment for that person. There are chemotherapeutic implications, for example, when an individual has a PV in a BRCA gene and has metastatic breast cancer (see Chapter 3). May clarify risks for other family members—­A positive result can directly impact the cancer risks of other relatives, especially the patient’s children. Inherited gene pathogenic variants (as opposed to de novo pathogenic variants) confer increased risks to the patient’s siblings and parents as well as other more distant relatives, including aunts, uncles, and cousins. A positive result also allows other at-­risk relatives the opportunity to have a targeted genetic test. For some patients with cancer, the main motivation for testing may be to clarify the risks for their relatives. A true negative result also clarifies the (lack of) risk for the patient’s current or future children. In addition, genetic test results can help with family planning for genes that also have recessive implications. Specifically, the results can help indicate when a partner might consider testing.

9.1.2.3.2.  Risks of Testing The potential risks of learning one’s genetic test results are as follows: ••

••

••

May increase cancer worry and sadness—­For some patients, the most anxiety-­producing aspect of genetic testing may be facing the possibility that they have an inherited susceptibility to cancer. Patients should be told that they may experience increased sadness and/or cancer worry if they test positive, although these emotions tend to be of short duration. More serious emotional sequelae are uncommon unless there is an underlying mental health disorder (See Section 11.1.2). May be of questionable medical benefit—­For some of the inherited cancer syndromes, there are no proven strategies to reliably detect the cancers at an early stage. Even in syndromes that do offer some strategies for reducing one’s risks of cancer through riskreducing surgery, lifestyle changes, or chemoprevention, the prevention of cancer is not possible. Some patients become less interested in genetic testing when they are told that there is no way to guarantee the prevention of the associated cancers. But the information could one day be helpful for family members, so it may still be worth considering. May lead to genetic discrimination—­Some people decide against having genetic testing because they are concerned about possible genetic discrimination. Despite the protective legislation (such as GINA, see Table 9.2) and the lack of documented cases, patients continue to express concerns about insurability if they receive positive results. Genetic counselors should be informed about available protections and limitations of anti-­ genetic discrimination legislation and should identify resources within their state and

9. Pre-­and Post-­Test Genetic Counseling

381

TABLE 9.2.  Genetic Information Nondiscrimination Act (GINA) of 2008 GINA provides protections to people who seek genetic counseling and testing.a Specifically, this legislation: •• Prohibits health insurers from requesting or requiring genetic information of an individual or the individual’s family members •• Prohibits health insurers from using genetic information of an individual or the individual’s family members for decisions regarding coverage, rates, or preexisting conditionsb •• Prohibits employers from using genetic information for hiring, firing, or promotion decisions •• Prohibits employers from using genetic information for any decisions regarding terms of employment a  The insurance provisions do not apply to life, disability, and long-­term care insurance plans. The employment provisions do not apply to employers with fewer than 15 employees. b  The Health Information Portability Amendment of 1998 also disallows health insurers from using preexisting conditions for decisions regarding coverage or rates. Source: Adapted from National Human Genome Research Institute (2009).

••

••

nationally for patients who are interested in more information. It may be helpful to describe the Genetic Insurance Nondiscrimination Act (GINA), which was signed into law in 2008 (see Table 9.2). Patients may also be concerned about the impact of a positive genetic test result on other types of insurance policies for which there are no legislative protections, including life, short-­term disability, and long-­term care insurance policies. Military service eligibility may also be impacted. May strain family relationships—­Some patients shy away from testing because they do not want to deal with the familial ramifications of a positive result. A positive genetic test result can send a ripple effect through the family and may strain familial relationships. While some people enter testing with the sole intent of sharing the results with their relatives, others see the task of informing their at-­risk relatives as an unwelcome burden. Whether patients decide to share their results with all relatives or to keep the results secret, there are potential ramifications to familial relationships. Cost—­“Genesurance counseling” is the part of a genetic counseling session that is devoted to the topic of costs and insurance/third-­party coverage (particularly for genetic testing). Costs are different according to the specific gene(s) analyzed and the type of test to be performed. The patient’s health insurance may cover all, part, or none of the cost of the test. Currently, most genetic counselors consider genesurance counseling to be one of their responsibilities, but many genetic testing companies have customer service departments that can help the genetic counselor and patient determine the out-­of-­pocket costs for cancer genetic testing.

9.1.2.3.3. Limitations Genetic tests are never 100% accurate due to the parameters of testing and the potential for human or technical error. Patients should be informed of the test’s sensitivity and specificity rates and the mechanisms in place to prevent or minimize errors, such as careful labeling of the

382

Counseling About Cancer

specimen tubes and meticulous record keeping. In addition, patients should be reminded that family histories are dynamic and genetic testing technology is constantly changing. Therefore, all patients should be encouraged to check in periodically with their genetic counselor to learn about updates and also to inform their provider of personal or family history updates that can impact cancer risk management recommendations. It is also important that patients understand the inherent limitations of cancer genetic test results. For a positive result, these include the following concepts: ••

••

A positive result is not synonymous with cancer—­Penetrance is high for many of the hereditary cancer syndromes but is rarely 100%. Patients need to understand that positive results are not a guarantee that cancer will develop, especially with currently available detection and prevention strategies. In addition, the absence of cancer does not mean the test results are wrong. Uncertainties about cancer remain—­Patients may overestimate the power of DNA testing, so they need to be cautioned that results may still leave many unanswered questions. A positive result confers an increased risk of cancer but does not resolve which type of cancer (if any) will develop, at what age the cancer will be diagnosed, or how amenable the cancer will be to treatment.

Negative test results carry the following limitations: ••

••

They do not rule out an inherited susceptibility—­In the cases of indeterminate negative results, families need to be counseled that the absence of a PV does not exclude an inherited predisposition to cancer. For example, about 25% of classic LFS families do not carry a detectable germline TP53 PV. In these cases, the likelihood of a hereditary cancer syndrome should also factor in the patient’s clinical features and the pattern of cancer in the family. Some patients with indeterminate negative results may have PVs that are undetectable by current technologies or they may have PVs in a different gene for which they were not tested. They do not guarantee that cancer will not occur—­Individuals with indeterminate negative results should be made aware that they may still have increased risks of cancer. Individuals with true negative results can be reassured that their risks of developing cancer are similar to the average person—­which are not insignificant risks. In addition, individuals with true negative tests results may still have elevated cancer risks based on personal clinical factors and/or family history that is not accounted for by the pathogenic variant.

9.1.3.  Documentation of Informed Consent Documenting informed consent for genetic testing occurs after explaining the genetic test and assessing participant comprehension. The informed consent document itself typically consists of two parts: the information sheet and the consent certificate (signature of attestation). The ­signature section must include the signatures of both the patient undergoing testing and the

9. Pre-­and Post-­Test Genetic Counseling

383

person obtaining the consent. By signing the document, the person obtaining consent indicates they have explained the testing to the patient, ensured that the participant understands the ­testing, and that the patient is proceeding with testing voluntarily. The patient should be given a copy of the consent form, and a copy of the signed form should be present in the patient’s ­medical record. The necessity of and specific components of an informed consent document for genetic testing is often governed on a state-­by-­state basis. In addition, individual institutions may have policies and procedures that address the specifics of informed consent for genetic testing. Finally, most genetic testing laboratories require some form of documentation that informed consent has been obtained from the patient before they will initiate the genetic testing. Even if consent is not legally required, clinicians should consider the best way to engage patients who are considering genetic testing in order to respect their autonomy.

9.1.4.  Discussion of Genetic Test Results Disclosure At the end of the pre-­test genetic counseling session, it is imperative that the patients understand the results disclosure process. This includes, but is not limited to, the timing of the disclosure, who will be providing the information, and the manner in which the result will be disclosed. 9.1.4.1. Timing Patients will often not have any idea how long the genetic analysis takes. For many sequencing and panel tests, the test will be completed in weeks. For other analyses, like WGS, it may take months. It is important for patients to understand the timeline for results so they can set their expectations. It may be helpful for the genetic counselor to note any major life events that will occur around the time the results will be available (e.g., a birthday, a holiday, vacation plans), as patients may wish to hold off on learning the test results during those times. One other consideration for those patients who are extremely ill at the time of the testing is to consider whether the individuals will be available for results disclosure. If there is concern that the individuals will not be able to receive the results themselves (e.g., if death occurs), the genetic counselor should consider getting specific instructions as to how the patients want the results to be communicated and to whom. In these cases, it is important to consult with a legal expert to ensure compliance in genetic information disclosure. Addressing the fact that a patient may not be alive when the test results become available can be emotionally difficult for both genetic counselor and patients but is very important so that the genetic counselor can disclose the results to the patient’s designee appropriately. 9.1.4.2.  Manner of Disclosure Patients will need to know if the results will be communicated in person, via video visit, via telephone, or electronically. In some cases, the patient will desire a scheduled time to discuss the results. Other patients and providers would prefer that the results be communicated as soon as they are available. The genetic counselor may want to explore patient preferences for this.

384

Counseling About Cancer

For example, if the patient works 9 a.m.–5 p.m. they may want a phone call during a lunch break or perhaps later in the afternoon. It is also important for the patient to know who will be ­disclosing the results. In many cases, the genetic counselor communicates directly with the patient, but it is becoming more common for a genetic counselor assistant (GCA) to play a role in this discussion.

9.2.  Pre-­Test Strategies for Genetic Counselors The following section describes strategies that the genetic counselor can use when the patient is seen for a pre-­test genetic counseling session. 9.2.1.  Facilitating Decision Making In this era of multigene panel testing, there are several decisions a patient needs to make before proceeding with genetic testing. One important role of the genetic counselor is in assisting patients with making decisions about whether to proceed with genetic testing. Although some patients come to the genetic counseling session with their minds made up to either proceed or decline testing, a number of patients will be undecided about whether or not they wish to be tested. Of course, many who have already decided to decline genetic testing may not pursue genetic counseling in the first place. Once the decision to proceed with testing has been made, the genetic counselor can be important in helping the patient decide which type of gene panel they desire. Experts in the field of medical decision making often will talk about the benefits of shared decision making (SDM), which is a communication process by which patients and clinicians work together to make optimal health care decisions that align with what matters most to patients. According to the Mass General Hospital Health Decision Sciences Center, SDM requires three components: ••

•• ••

Clear, accurate, and unbiased medical evidence about the reasonable options and the risks, benefits, and burdens of each alternative, including no intervention Clinician expertise in communication and tailoring that evidence for individual patients Patient goals, informed preferences, and concerns, including treatment burden

The genetic counselor should strive to provide the patient with the information needed to make an informed decision and support and implement the patient’s decision. Genetic counselors can employ the strategies presented in the succeeding sections to assist patients in making decisions about cancer genetic testing (also see Table 9.3). 9.2.1.1.  Present the Relevant Facts It is important to provide as much of the pertinent information about genetic testing as possible. Of course, this is difficult when discussing multigene panel testing. There are too many genes and possible syndromes to fully review all of them with every patient prior to initiating testing.

9. Pre-­and Post-­Test Genetic Counseling

385

TABLE 9.3.  Strategies to Assist Clients in Making Decisions About Cancer Genetic Testing •• •• •• •• •• •• •• ••

Present all the relevant facts Offer assistance, not advice Provide encouragement and support Help clients to structure the discussion in a way that is useful and value-­neutral Consider brainstorming or using best-­case/worst-­case scenarios Explore how clients have dealt with other health-­related decisions Identify other people (e.g., partner, relative, friend, physician) whose input might be helpful to the client Encourage the client to reflect and deliberate before reaching a decision

Sources: Adapted from Weil (2000); Baty (2009).

Many genetic counselors are using a more global pre-­test education approach and a more tailored post-­test discussion focusing on the actual results once they are available. Genetic counselors must use their judgment and provide the facts that are most relevant to the individual patient, given the patient’s personal and family history and lived experience. 9.2.1.2.  Offer Assistance, Not Advice The genetic counselor’s role in the decision-­making process is to assist patients as they make their own decisions about testing. This follows the tenet of nondirective counseling, which places the emphasis on providing information and support, rather than on advice or personal opinions. Some genetic counselors worry that they will influence patients’ decisions about testing. This does not seem to be the case. Even patients who pointedly ask for advice seem to weigh the answers against their personal filters of preferences and experiences. 9.2.1.3.  Provide Encouragement and Support Some patients may need to work through their emotional reactions to the situation. This may include feelings of grief and fear. Counselors can help empower patients to make appropriate decisions about testing and can then support them in these decisions. For example, if the patient defers testing to a later time, the counselor can inform the referring physician and other program staff and explain the reasons why the patient has made this decision. 9.2.1.4.  Help Patients to Structure the Discussion in a Way That Is Useful and Value-­Neutral Some patients struggle with even knowing how to think about making this type of decision and are not sure what questions to ask. It may be helpful for genetic counselors to frame or structure the discussion by helping patients to focus on the factors that are most important to their heath, families, and value systems.

386

Counseling About Cancer

9.2.1.5.  Consider Brainstorming or Using Best-­Case/Worst-­Case Scenarios It might be helpful for patients to brainstorm the different alternatives or outcomes associated with a specific course of action. Genetic counselors can also consider exploring different hypothetical situations with patients. For example, genetic counselors can ask patients to imagine the best-­case or worst-­case scenario relating to a certain decision. 9.2.1.6.  Explore How Patients Have Dealt with Making Other Health-­Related Decisions Some patients have difficulty making the decision about testing, because it is such a novel situation. It may be helpful for counselors to ask patients how they have made other types of health-­related decisions. Perhaps the patients will be able to use similar strategies to make the decision about testing. 9.2.1.7.  Identify Other People Whose Input Might Be Helpful to the Patient Patients may want to talk over the option of testing with certain people in their lives before making a final decision. Many patients will seek input from a spouse/partner, relatives, close friends, or personal physicians. These conversations may take place before or after the genetic counseling session. Counselors can also encourage patients to speak to specific relatives, such as their parents, siblings, and adult children, whose cancer risks may be impacted by the genetic test result. 9.2.1.8.  Encourage the Patient to Reflect and Deliberate before Reaching a Decision Patients may feel pressured to make a decision about testing during the initial counseling visit. Counselors can remind patients that this type of testing is usually not a matter of urgency. Patients should be counseled to take as much time as they need to make the decision that is right for them.

9.2.2.  Measuring Success in Informed Consent Some clinicians will consider informed consent successful if the patient signs the document. There has been great debate regarding how to measure the degree to which a patient makes an informed decision about a medical procedure or test. There are a few validated measures that can help assess the degree to which informed decisions were made. The principle of shared decision making is one that has gained momentum in recent years. There is a measure that has been approved by the National Quality Forum (NQF) that can help assess the degree to which shared decision making (SDM) is met. The SDM-­NQF measure is based on a four-­item patient-­reported survey called the Shared Decision Making Process Survey (SDM Process_4). The purpose of the survey is to assess the extent to which shared decision making happens in conversations between patients and health care ­providers.  The items cover four core behaviors that are necessary for SDM: discussion of

9. Pre-­and Post-­Test Genetic Counseling

387

options, the pros of each option, the cons of each option, and patient preferences. Although the items do not cover all possible SDM behaviors, these four elements are foundational components in widely accepted definitions. The survey has been tested extensively in common medical decisions including cancer screening tests, medication decision making, and surgical decision making. The multidimensional measure of informed choice (MMIC) is another way of quantifying the success of informed consent. The original MMIC was comprised of an eight-­item knowledge scale, scored as good or poor knowledge, and a four-­item attitude scale, scored as positive or negative attitude. These two scales were combined with test behavior to determine whether an informed choice had been made. A deliberation scale has been included alongside the original MMIC in a few studies. The MMIC has been tested in a wide variety of genetic counseling settings.

9.3.  Other Pre-­Test Genetic Counseling Considerations 9.3.1.  Confidentiality (Privacy, Data Security, and Placement of Results) Confidentiality of genetic test results remains a significant concern for many patients. In the era of electronic health records (EHR), media attention about how direct-­to-­consumer companies are sharing DNA sequencing information, and an increase in IT security breaches and identity theft, this is understandable. It is important, therefore, to be transparent with patients regarding the details of sharing any information gained by their pursuit of genetic testing. Patients may wish to know, for example, that when ordering a genetic test, the provider is often required to share detailed health information (whether the patient has had cancer, the type of cancer and age at onset, etc.) with the testing laboratory to help the lab interpret results. This could be considered a release of health information, as the provider is sharing personal health Information (PHI) with an outside vendor. The placement of genetic testing lab reports in the electronic health record, just like other medical tests, is important so that patients understand that these results may be shared now or in the future with healthcare providers involved in their care. It is important for the patient to understand that the hospital may need to share information about the genetic test and the results with health insurance companies for payment purposes. Finally, it is important to inform patients about how their samples and the genetic testing results may be shared outside of the genetic testing company itself (see the next section). 9.3.2.  Use of Samples for Research Clinical genetic testing companies typically rely on specific regulations as governed by their ­certifying body, state requirements, or other internal guidance for the retention/destruction of samples. Examples of laboratory certifying bodies include the College of American Pathologists (CAP) Laboratory Accreditation program and the Clinical Laboratory Improvement Amendments of 1988 (CLIA) certification program. In general, samples may be held for no more than 6 months or, according to New York requirements, a maximum of 60 days. Generally, primary specimens

388

Counseling About Cancer

are marked for destruction before 30 days post-­test completion. Special cases do arise such as when additional clinical testing is required (e.g., RNA studies). Many clinical testing companies, however, will offer participation in research when a clinical sample is obtained. Some laboratories will have a specific checkbox or signature line for a patient to authorize consent for this additional research. In general, samples for clinical research are de-­ identified and coded according to associated protocols, including limited access to the key. New  York samples are not included in clinical research without specific instructions because state-­specific laws exist that govern this practice. In addition to clinical research, some laboratories will perform systematic research (e.g., aggregate publications). Most genetic testing companies will review any research that is proposed, whether it involves existing samples or data, by a multidisciplinary committee that weighs in on whether the research can proceed with or without Institutional Review Board (IRB) review and patient consent. Prospective collection of samples for research projects is also reviewed and approved (or rejected) by the company’s committee.

9.3.3.  Whether the Genetic Health Care Professional Is Employed by the Testing Company Conflict of interest (COI) and competing roles (see Sections 12.3.1 and 12.3.3) are concerns for all genetic counselors, especially industry-­employed genetic counselors providing direct patient care. An industry-­employed genetic counselor is responsible not only for following practice guidelines, but also for promoting the company. These two responsibilities can, at times, conflict with one another. Often, patients may not even realize that they are receiving genetic counseling from an employee of a genetic testing company. Although genetic counselors employed by laboratories likely provide a similar quality of care as genetic counselors employed in other environments, the reality is that COI exists and should be recognized and addressed. It is important for genetic counselors to be transparent with their patients because if they recognize the apparent COI after the genetic counseling encounter, it can undermine patients’ trust.

9.4.  Alternative Service Delivery Models for Pre-­Test Education The advent of multigene panel testing and the rapidly evolving area of personalized cancer therapy has significantly increased the demand for cancer genetic testing services. Although the field of genetic counseling is expanding, the current genetic counseling workforce is struggling to keep up using the traditional one-­on-­one pre-­test genetic counseling model. This has resulted in opportunities to explore various service delivery models (SDMs) to improve access for patients. The following are some models that can be considered by genetic counselors when providing pre-­test services. It is important that genetic counselors be involved in the development and implementation of these alternative service delivery models so that patients are afforded the best care possible.

389

9. Pre-­and Post-­Test Genetic Counseling

9.4.1.  Group Pre-­Test Counseling Group pre-­test education has been used to reduce the time required to provide hereditary cancer genetic counseling. Patients receiving group education followed by individual counseling have been shown to have no difference in knowledge, psychological distress, uptake of genetic ­testing, or satisfaction from those patients receiving individual genetic counseling. Table 9.4 presents an example of the content of a group genetic counseling appointment. It is important to recognize the need for individual informed consent after the group education session and prior to test initiation.

TABLE 9.4.  Sample Content of Group Genetic Counseling Appointment Format Genetic Counselor Genetic Counselor Video

Facilitated Group Discussion

Genetic Counselor Genetic Counselor Slide Presentation

Facilitated Group Discussion Genetic Counselor

Letter

Content Individual greeting of participants as they arrive and giving copies of pedigrees constructed from the family history questionnaire Introduction outlining what to expect from the session and an opportunity to address potential concerns Incidence of breast and ovarian cancer; genes and chromosomes; how cancer starts; how genes are involved in cancer; what hereditary cancer is; how to identify familial patterns of cancer using sample pedigrees Family histories and their interpretation; the importance of documenting, confirming, and updating family history; explanation of how to use provided release of information forms to collect medical records on appropriate family members How to interpret risk of cancer within a family history and the screening recommendations for individuals at increased risk Genetic testing for BRCA1 and BRCA2 to include eligibility criteria; probability of mutation detection; risk of cancer associated with germline mutation; availability of preventive measures; potential consequences such as insurance discrimination and effects on family dynamics Questions; concerns; reactions to information presented Thanking of participants; invitation to contact the genetic counselor by telephone after the session to discuss personal issues; encouragement to book a follow-­up appointment if they are considering genetic testing or feel they need more help with interpretation of their family history Follow-­up letter sent to each participant’s referring physician outlining the patient’s risk of developing cancer based on their family history, recommendations for screening, and eligibility for testing

Source: From Ridge et al. (2009)/Springer Nature.

390

Counseling About Cancer

9.4.2.  Decision Aids Decision aids are interventions designed to help people make choices among options by providing information on the options and outcomes relevant to them individually. Decision aids are widely used in health care and can be printed or computerized material. Computerized decision aids offer interactive opportunities to clarify complex choices, harms, and benefits in a personalized manner, and are more flexible than printed material by allowing patients to explore information for their own needs at their own pace. Decision aids have been shown to facilitate shared decision making and lead to greater informed patient choice. According to the Ottawa Decision Aid Inventory (https://decisionaid.ohri.ca/), there are a number of decision aids developed for use in hereditary cancer settings. These decision aids have been studied and show great promise in providing assistance to patients as they consider genetic testing. Experts caution, however, about the use of decision aids as a stand-­alone tool and recommend that decision aids accompany ongoing patient-­clinician communications. Thus, decision aids may augment pre-­test genetic counseling, but likely will not replace it entirely. 9.4.3. Chatbots Chatbots are a technology-­based tool used in scaling communications. A chatbot acts as a virtual assistant designed to simulate human conversation, typically via text or computer voice generation. Chatbots use natural language processing (NLP) to gather patient data, anticipate questions, and predict responses. Chatbots can be accessed through a downloadable application or directly by hyperlink, and are compatible with smartphones, tablets, and laptop or desktop computers. These tools are gaining more acceptance in healthcare and are an attractive option for adaptation in cancer genetic counseling and testing. Clear Genetics, a health care technology company based in San Francisco, California, has collaborated with genetic counselors to develop a chatbot named GIA (Genetic Information Assistant). GIA is a clinical-­grade, Health Insurance Portability and Accountability Act (HIPAA)-­ compliant chatbot designed to assist patients pursuing genetic counseling, risk assessment, and testing. Chatbot initiatives within the field of genetics are occurring worldwide. In Norway, an artificial intelligence (AI)-powered chatbot, Rosa, has been developed as an information and support tool for patients undergoing genetic testing for breast and ovarian cancer. Some genetic counselors are fearful that chatbots and other technology-­based tools will replace them. On the other hand, genetic counselors who use technology to provide education-­ based concepts to educate patients can focus on understanding their patients’ values and beliefs, and help their patients integrate genetic information into their lived experience. This allows genetic counselors to practice at the top of their scope. In addition, genetic counselors are in a position to directly shape the evolution of AI in patient care—­to ensure that it is utilized responsibly, researched in diverse populations, and implemented effectively.

9.5.  Traditional Post-­Test Genetic Counseling The goals of post-­test interactions are to disclose and discuss the genetic test results, as well as to help patients contextualize the results into their lived experience. This section describes the preparation and logistics involved with results disclosure in a traditional model when the

9. Pre-­and Post-­Test Genetic Counseling

391

genetic counselor had a role in the pre-­test interaction. It also offers guidance for genetic counselors who become involved in patient care only after the pre-­test discussions. 9.5.1.  Mode of Results Disclosure Cancer genetic test results are typically disclosed by telephone, video, or at an in-­person visit. Results are not often communicated solely by mail, fax, or letter, in part due to confidentiality concerns with these modes of communication. However, electronic medical record portals are becoming more secure and thus may be a reasonable mechanism for communicating results with patients. As stated in the Pre-­Test section, it is important for patients to understand how, by whom, and when the test results will be communicated. Genetic counselors should also consider the following issues in terms of the results disclosure: ••

••

••

In-­person disclosures—­It is important to consider the setting in which the results will be disclosed. Counselors should pay attention to the layout of the room by making sure there are sufficient chairs, and that the seating arrangement will allow everyone to feel included in the conversation. If possible, avoid having the patient seated on an exam table or the counselor seated behind a desk. The room should have a door that can be completely shut to ensure privacy. Patients are also encouraged to bring a support ­person with them, such as their spouse/partner, family member, or close friend. Some patients bring an entire entourage with them; others prefer to come alone. Telephone disclosures—­Prior to disclosing the results by phone, the genetic counselor should confirm that the patient has the privacy and ability to speak freely. They should also confirm that the patient is interested in discussing the test results at that moment. Genetic counselors are encouraged to schedule the disclosure phone calls in advance or at least to determine the best time of day to contact patients. This is the best way of avoiding disclosure to patients who are in a traffic jam, grocery store, busy office, or their child’s day care—­none of which is conducive to a meaningful discussion. Unless prior arrangements have been made, all results should be given directly to the patient. If the patient is not available, then the counselor should leave a message for the patient to call back. What the genetic counselor needs to know—­Genetic counselors should have a list of topics that they plan to cover at the disclosure, although they need to be flexible in case the patient has alternative questions or concerns (or needs time to process the news before holding an in-­depth discussion). Prior to any disclosure of results, genetic counselors should: •• Know how the result will be disclosed and make the appropriate arrangements (e.g., set up an appointment or conference call, alert other providers if appropriate) •• Review the lab report, resolve any questions about the result, and confirm that it is the patient’s result •• Compose a set list of topics to cover during the results disclosure, focusing on items of immediate importance to patients ••

Anticipate some likely counseling challenges (an unexpected result, complex family dynamics, a vulnerable patient)

392

Counseling About Cancer

Prepare materials to give to the patient (lab report, summary letter, fact sheet, support group information) What the patient needs to know—­Patients need to know what to expect from the results disclosure interaction, by knowing in advance: •• How the result will be disclosed •• The type of result that will be disclosed •• Who will be present at the results disclosure phone call/session •• Approximately when they can expect to receive results ••

••

9.5.2.  Content of Disclosure Session Following the disclosure of a cancer genetic test result, there are several topics that genetic counselors will want to discuss with patients. These discussions may take place directly after the result has been given or during later follow-­up visits or telephone calls. The nature of these interactions will vary from patient to patient, depending on the test result, the patient’s cancer status, and the relevance of each topic to the patient’s situation. Patients should always be encouraged to recontact the genetic counselor at a later date if they have any further questions about their results. Topics to discuss with patients following results disclosure are presented in the succeeding sections (also see Table 9.5). 9.5.2.1.  Results and Associated Medical Risks Genetic counselors may want to open the discussion by asking patients what their understanding is of the results. Patients are often aware of what the results mean in terms of their cancer risks. Despite this, patients often ask for clarification once they learn their own results. It is important for genetic counselors to remind patients, when appropriate, of the uncertainty and variability

TABLE 9.5.  Components of a disclosure session (adapted from NCCN guidelines v. 1.2022) •• •• •• •• •• ••

Discussion of results and associated medical risks Interpretation of results in the context of personal and family history of cancer Discussion of recommended medical management options Discussion and offer of assistance with informing and testing at-­risk family members Discussion of available resources, such as high-­risk clinics, disease-­specific support groups, and research studies For patients of reproductive age, advise about options for prenatal diagnosis and assisted reproductive technologies such as preimplantation diagnosis

9. Pre-­and Post-­Test Genetic Counseling

393

9.5.2.2.  Interpretation in Context of Personal and Family History of Cancer Genetic counselors should focus on the information that is most relevant to the patient’s specific situation. The interpretation of a negative test result will be very different, for example, when the patient has a diagnosis of cancer. Discussions about a positive BRCA2 result will vary depending on the patient’s assigned sex at birth and at-­risk tissue, age, and cancer status. It is important for the genetic counselor to make the test result meaningful to the patient and put it into context so that the knowledge may be incorporated. 9.5.2.3.  Medical Management Options Patients with positive test results are usually provided with syndrome-­specific monitoring guidelines and referred to the appropriate medical specialists. Patients should also be encouraged to seek advice from their primary care physicians. In addition, there may be other options, such as chemoprevention or risk-reducing surgery, for patients with positive results to consider. Patients may feel an urgency to make certain medical management decisions (such as riskreducing surgery), but should be reminded that they generally have time in which to carefully consider these options. Some patients find it difficult or overwhelming to be faced with making decisions about their medical management. For patients with positive results, the recommendations and options for medical management tend to be the major focus of the post-­disclosure discussions. Patients with indeterminate negative or VUS results can consider screening options based on their uncertain or potentially increased cancer risks. Patients with true negative results may benefit from a general discussion of cancer monitoring and living a healthy lifestyle. 9.5.2.4.  Implication of the Result on the Patient’s Family A cancer genetic test result has potential implications for the patient’s biological relatives. Patients with positive test results should be encouraged to share the information with their close relatives. Disseminating this information to the family can prove to be emotionally difficult, especially if the relationships are already strained or if the news is unexpected. Most patients with a positive result do end up sharing the information with at least some of their relatives. It may be helpful for counselors to identify the existing communication patterns within the family and also to remind patients about the confidentiality practices of the testing program. Some families operate in secrecy regarding who is being tested; others are much more open. The genetic counselor may also want to explore possible barriers for communicating the results to at-­risk relatives. As examples, patients may be reluctant to share the results with relatives who are estranged from the family, or with relatives who are likely to become unduly upset by the news. The patient should be the one to decide how to disclose the result to other family members, but counselors can offer to help patients figure out how best to disseminate the information through the family. Counselors can also provide assistance in other ways, such as helping write a family letter, fielding questions from other family members, or making referrals to local genetic counseling services. In the case of patients who test positive for APC pathogenic variants (which cause a syndrome known as familial adenomatous polyposis, or FAP) or RET pathogenic

394

Counseling About Cancer

variants (which cause a syndrome known as multiple endocrine neoplasia type 2, or MEN2), health care providers may have a legal obligation to ensure that first-­degree relatives are aware of their risks. However, this is the exception, not the rule. 9.5.2.5.  Resource Identification Genetic counselors should provide patients with available resources such as high-­risk clinics, disease-­specific support groups, and research studies. Genetic counselors can also help make sure that patients are referred to the appropriate medical specialists. Patients with positive results will likely need to meet with various medical specialists to arrange the appropriate monitoring tests and follow-­up. Patients with indeterminate negative or VUS results may also benefit from referrals to medical or mental health specialists. It is important for genetic counselors to have a network of physicians, surgeons, and mental health providers for whom to refer patients.

9.5.3.  Disclosure Session Genetic Counseling Strategies Results disclosure can be the most difficult aspect of the testing process for the patient—­and the genetic counselor. This section discusses useful strategies for disclosing a cancer genetic test result in a professional yet empathetic manner. 9.5.3.1.  Disclose the Result Early in Conversation The few minutes prior to the results disclosure may be among the most anxiety-­provoking for patients. Thus, it is best to disclose the result early in the conversation, unless the patient has requested otherwise. It is also important that the disclosure visit or phone call occur at the time it has been scheduled; delays will only enhance patient worry. 9.5.3.2.  Use Direct and Clear Language When disclosing the result, genetic counselors should state the result in simple, straightforward language. Genetic counselors should choose an approach with which they are comfortable and that seems to be appropriate for the individual patient. For example, the genetic counselor can say, “The lab found that you do have the FH pathogenic variant that is in your family.” Genetic counselors may wish to alert patients that they are about to learn their result and/or offer some expression of empathy: “Are you ready to learn your result? Okay. The test showed that you are positive—­that means that you have a pathogenic variant in the PTEN gene.” Other counselors may prefer to give the result in a bit more formal manner: “The genetics laboratory looked for variants in the genes associated with Lynch syndrome. The DNA analysis did identify a pathogenic variant in the MSH2 gene. This result explains why you developed colon cancer.” Some patients may not recall what a positive or negative result means, so genetic counselors should be prepared with multiple direct ways of communicating the information. For example, “You don’t have the familial pathogenic variant,” may need to be rephrased, “You don’t have the high risk of cancer that some members of your family have.”

9. Pre-­and Post-­Test Genetic Counseling

395

9.5.3.3.  Allow Patient Time to React After disclosing the result, pause and give the patient some space. This gives the patient a chance to consider the news and react to it. Don’t launch into detailed explanations or even encouragement that a positive result is not that bad. At that moment, the news may be emotionally jarring, and patients might need time to react and regroup. Genetic counselors should hold off from providing information or offering statements of encouragement until the initial reactions subside, and may wish to ask direct questions, such as “Are you ready for me to explain further?” or “What questions can I answer for you right away?” 9.5.3.4.  Be Empathetic but Professional Genetic counselors will want to acknowledge the patient’s emotional reactions by being appropriately empathetic. For some patients, especially those who have never had cancer, a positive genetic test result may be the worst news they have ever received. It is natural for counselors to be affected by a patient’s distress, but they need to retain a professional manner. Genetic counselors will not be effective providers if they become emotionally distraught themselves. Some patients will accept and even seek demonstrations of comfort from the counselor (such as a gentle touch on the arm), but others will be uncomfortable with these gestures. Genetic counselors need to learn to read patient signals and respect the counselor–patient boundaries. Further discussion on this topic can be found in Chapter 11. 9.5.3.5.  Let the Patient Set the Remaining Agenda The remainder of the results disclosure discussion should be tailored to the patient’s needs. Upon hearing their results, some patients will have dozens of questions, while others may need more time to process the news. In the event of a positive, VUS, or unexpected result, it may be best to schedule a follow-­up appointment to review the information rather than expecting to cover all the topics during the initial disclosure conversation. Genetic counselors may also wish to remind patients with positive results that the most important thing for them to do is simply adjust to the news. They do not need to rush out and inform all their relatives nor do they need to schedule immediate appointments, especially if they are feeling overwhelmed by the news. 9.5.3.6.  What Happens Next It is important for patients to have a good understanding about what happens next. This might include providing answers to the following questions: ••

••

••

Does the patient need a follow-­up genetic counseling appointment? How will it be scheduled? How will referrals to other specialists be made? Does the patient need to call them, or will the genetic counselor facilitate these appointments? Will a copy of the genetic test result go in the medical record? How does the patient access this?

396

••

•• ••

Counseling About Cancer

Will the patient be given a summary letter? How will that be communicated? When can they expect to receive it? Who will inform the referring provider of the result—­the genetic counselor or the patient? If the patient’s relatives have questions or want testing appointments, whom should they contact?

9.6.  Post-­Test Genetic Counseling When the Genetic Counselor Was Not Involved in Pre-­Test Education Genetic testing for cancer predisposition genes is becoming part of routine clinical care, and in many instances nongenetic health providers are ordering this type of genetic testing. When genetic testing for inherited cancer is conducted by providers with limited expertise in genetics and/or without pre-­test counseling, NCCN guidelines suggest referral to a genetic health provider in the following situations: •• •• •• •• •• ••

••

A pathogenic variant/likely pathogenic variant is identified Negative results, yet family history remains suggestive of inherited disease Any VUS result a provider considers using to guide management A mosaic or possibly mosaic result Discrepant interpretation of variants, including discordant results across laboratories Interpretation of polygenic risk scores, particularly in instances in which it may impact patient care Interpretation of pathogenic/likely pathogenic variants for patients tested through direct-­to-­consumer or consumer-­initiated models

Genetic counselors who provide post-­test genetic counseling in these circumstances can rely on the techniques previously described in this chapter. The following should be considered in preparation for these encounters. 9.6.1. Contracting Genetic counselors will not have established a rapport with the patient in the pre-­test environment. Thus, establishing rapport through the classic genetic counseling technique of contracting is essential. The counselor should clearly state the necessary information needed to interpret the test results appropriately (e.g., complete personal and family history) so that the patient is aware that they will be expected to provide some information. The counselor should also invite the patients to share the key questions they have, so that the agenda for the session can be set. 9.6.2.  Establish Knowledge Base Some patients will have received limited information from their ordering provider during the informed consent process, and may have limited information on the test results. Others will have done an exhaustive internet and/or literature search to gather information about their test

9. Pre-­and Post-­Test Genetic Counseling

397

results. Still others will have discussed the testing with friends and family who may have educated them on their experiences with genetic testing. It is important for the genetic counselor to establish how much information the patient has at baseline, the source(s) of that knowledge, and potential misinformation. This will allow the counselor to meet the patient where they are and clarify any questions.

9.7.  Possible Patient Reactions to Results The majority of patients who receive positive test results cope satisfactorily with the news. In fact, one of the consistent findings of clinical research studies has been the lack of people who have significant distress upon learning their results. Yet having said this, most cancer genetic counselors have dealt with one or more patients who have experienced a more intense reaction or required greater programmatic support. This section describes the types of emotions and reactions that may occur among individuals who receive different types of cancer genetic test results. The majority are minor or transient; however, counselors should be prepared for the rare patient who has a more intense reaction.

9.7.1.  Immediate Reactions to Results When a genetic counselor discloses the test results to a patient, there are a wide variety of reactions that can occur and are often dependent on the specific result type. 9.7.1.1.  Positive Result Patients who are told they have a pathogenic variant that predisposes them to cancer may experience a variety of emotions, including sadness, disappointment, shock, fear, anger, and disbelief. For the most part, patients with positive results adjust well to the news; only rarely are therapeutic or medicinal interventions necessary for patients with positive cancer genetic test results. However, a positive test result can trigger delayed grief reactions, feelings of isolation or vulnerability, or strained family relationships. Alternatively, patients with positive results may experience feelings of relief or closure that they have an explanation for the cancer in their family or because they finally know their genetic status. Positive results can also lead to increased feelings of control, greater motivation to pursue cancer monitoring, and closer ties to some of their relatives. 9.7.1.2.  An Indeterminate Negative Result Patients are typically relieved to hear that they do not have a genetic pathogenic variant. The degree of reassurance afforded by an indeterminate negative result depends on the prior likelihood that the family has a cancer syndrome. Patients who are at low risk for having a certain cancer syndrome may be told that the negative result lowers the likelihood that they have the syndrome. Patients who are at high risk for having a certain cancer syndrome need to be carefully counseled that it is still likely that they have the syndrome despite the negative results (see Section 9.1.4.3).

398

Counseling About Cancer

9.7.1.3.  A True Negative Result Patients who receive true negative results generally react with relief, joy, and decreased cancer worry. Patients may also experience survivor guilt regarding other affected relatives, and may have regrets about major life decisions they have made, such as choosing a spouse based on their caretaking abilities rather than other factors. Patients with true negative results may also feel excluded when relatives with positive results get together and share their concerns or plans. Patients who have lived with their cancer fears for a long time may find it disconcerting to adjust to their altered risk status and may find it difficult to completely believe the news or to let go of their monitoring practices. Some may even remain convinced that they need extra surveillance and/or risk-­reducing surgeries despite counseling to the contrary. 9.7.1.4.  A VUS result Patients who receive VUS results may be confused by this finding. In most cases, genetic counselors downplay VUS test results and stress the fact that they are not clinically significant and should not affect medical management. Patients should be explicitly told that a VUS result is not a positive genetic test result. Their doctors may also need to be reminded of the nuance in interpretation so that they don’t recommend inappropriate surveillance or risk-­reducing surgeries. The genetic counselor should explain the process of reclassification to the patient (see also Section 8.1.3), because it can be confusing months or years later for a patient to receive a call about a reclassification report being issued. Patients should be informed about how they will receive this reclassification information as well (e.g., via telephone or letter). 9.7.2.  Patients Presenting to Genetic Counseling Session after Already Having Results When a genetic counselor meets a patient for the first time when they receive their test results, the patient can be experiencing a number of emotions. Often this is dependent on how the individual received their test results, from whom they received their test results, and how knowledgeable the person was who disclosed the test results. 9.7.2.1.  Positive Results Patients with pathogenic variant results can present with high levels of stress because they have read too much information, or misinformation, or because the family is putting pressure on them. Other patients with pathogenic variant results will be much calmer and matter-­of-­ fact, having coped with the information on some level already. It is important for the genetic counselor to normalize all of these reactions for patients and help them through the coping process. 9.7.2.2.  Negative Results Patients with negative results can often not understand the distinction between “true negative” results and “indeterminate negative” results. Patients may present believing that they are true negative and be confused and upset when a genetic counselor explains that they are indeed indeterminate negative.

9. Pre-­and Post-­Test Genetic Counseling

399

9.7.2.3.  VUS Results Patients with VUS results present most often with confusion. Some non-­genetic providers will mistakenly consider VUS results as pathogenic results and communicate them as such to the patient. This can lead to extreme distress and sometimes distrust when the genetic counselor explains that the VUS is, in fact, inconclusive and in many cases will be reclassified to a benign polymorphism.

9.8.  Follow-­Up Genetic Counseling Genetic counseling services do not usually end with the disclosure of the genetic test result. Genetic counselors may want to provide one or more follow-­up telephone calls and to send summary letters to patients. It may also be appropriate to offer patients additional follow-­up appointments to further discuss the information. Patients with positive test results may find it useful to have a follow-­up appointment to review the information once the initial reaction to the news has subsided. For some patients with indeterminate negative or VUS results, it might be appropriate to discuss further genetic testing options. Testing programs can make follow-­up telephone calls or visits a standard part of the testing process or can offer such services to the subset of patients who request or seem to need additional information or support. The following are some specific issues that genetic counselors may want to consider when designing the ­follow-­up plan with patients.

9.8.1.  Adjustment to the Result It is important to continue assessing how well patients are coping during the weeks and months following the results disclosure. Some patients may benefit from meeting with a mental health professional. The emotional response to testing seems to be the most intense in the first few weeks or months after learning the results but tends to dissipate over time. However, specific issues and concerns may arise in the future, as the patient’s children become older, or when another relative is diagnosed with cancer. It is important for patients to be aware of resources that are available to them if and when they need additional information or support in the future, and to know that they can always reach out to their genetic counselor or a colleague.

9.8.2.  Review of Genetics Patients may be confused about the risks of cancer or passing the gene pathogenic variant to offspring, especially as time passes. Patients who remain cancer free may begin to question their positive results. Patients with true negative results may request predictive testing for their not-­ at-­risk children. Thus, genetic counselors may find themselves reviewing basic information about genetics, inheritance, and variable expressivity. Even patients who seem to have a good grasp of these concepts may not remember the information over time or may not be able to relate the information to their own situation or explain it to others.

400

Counseling About Cancer

9.8.3.  Cascade Testing Cascade testing starts with the identification of a pathogenic variant in an individual, and then extends genetic testing to that individual’s at-­risk biologic relatives. This process is necessary for families and individuals to realize the preventive benefits of genetic testing. Unfortunately, most believe cascade testing in families is significantly underutilized. Many factors contribute to this, including the fact that family members receive care in different health care settings and insurance systems. In addition, providers cannot directly reach out to a patient’s relatives due to privacy regulations. This leaves patients with pathogenic variants responsible for communicating the genetic information and encouraging their relatives to consider genetic testing. Patients will often need assistance and support while navigating this complex situation. Genetic counselors can serve as excellent resources and encourage patients to move through this cascade testing process.

9.8.4.  Life Changes It is important to recognize that life changes over time present different opportunities and considerations for patients. As a young patient with a pathogenic variant gets older, for example, reproductive decisions may become more significant. Follow-­up consultation with a genetic counselor can reinforce genetics concepts and offer the patient assistive reproductive options before moving ahead with a pregnancy.

9.8.5.  Updating Personal and Family History Information Additional cancer diagnoses in the family can lead to changes in medical management. Take, for example, a patient identified with a BRCA2 pathogenic variant whose family history is only significant for breast and ovarian cancer. Current guidelines would not suggest that individual consider pancreatic cancer screening. If, however, two years after the patient has testing, a pancreatic cancer is diagnosed in the family, pancreatic cancer screening should be considered for that patient. Follow-­up genetic counseling can ensure that changes in medical management dictated by family history are adjusted as necessary.

9.8.6.  Keeping Current It is important for patients to understand that recommendations provided at the time of genetic testing can change. Future advances in genetics and cancer knowledge may change risk assessment, genetic testing options, and/or cancer screening recommendations. Some genetic counseling programs will offer to update patients with changes in recommendations, but this can be cumbersome. It can also be unwieldy to keep up with patient changes in contact information. For these reasons, many programs will recommend that patients recontact them periodically and/or update their website regularly for information on advances in the field and to determine whether a VUS has been reclassified.

9. Pre-­and Post-­Test Genetic Counseling

401

9.9.  Psychological Assessment Throughout the Genetic Testing Process (see also Chapter 11) Genetic testing for cancer susceptibility can be a major event in a person’s life. Although research has shown that most people undergoing genetic testing cope well with their results, some individuals will have difficulty in the short term after learning them. For this reason, it is important for genetic counselors to discuss the potential emotional ramifications of testing, and to assess the patient’s emotional vulnerability throughout the genetic counseling and testing process. It is important for genetics programs to have safeguards in place to assess and support the subset of patients who experience some type of serious emotional distress. 9.9.1.  Assessing Psychological Readiness for Genetic Testing Topics to discuss with patients undergoing cancer genetic testing are presented in the following sections. 9.9.1.1.  Current Emotional Well-­Being Because the testing process can exacerbate psychological problems, genetic counselors should assess the patient’s current emotional well-­being. This line of questioning can include queries about the patient’s mood and any changes in eating or sleeping habits. Patients with a new diagnosis of cancer are often experiencing extreme stress and anxiety. The genetic counselor should acknowledge these feelings and attempt to normalize them for the patient. For these newly diagnosed patients, genetic testing may impact their treatment, and thus it is not helpful to add to their stress. Taking a calm, measured approach with these patients is essential. 9.9.1.2.  Anticipated Impact of Results In a pre-­test genetic counseling session, it may be helpful for patients to verbalize what it might be like to learn they have positive or negative genetic test results. This exercise may be a way of assessing the potential of a severe adverse reaction. It may also help initiate discussions about possible medical management decisions and communicating the result to other family members. It may also be useful to ask patients if they expect to receive a particular result. Some patients will be convinced that they carry a pathogenic variant in a gene, while others will be convinced that the result will be negative. For some patients, there is a certain rationale to their expectations (the patient with adenomatous polyposis should expect a positive APC result), but in other cases, their expectations may be due to intuition or wishful thinking. Learning whether patients anticipate certain results and why they expect these results may be helpful in providing support when the result is disclosed. 9.9.1.3.  Coping Resources Everyone develops their own ways of coping with difficult situations, although some strategies are healthier than others. Genetic counselors can explore with patients how they plan to cope with their results. It may also be helpful to learn how they have handled other stressful events in their

402

Counseling About Cancer

lives. While some people cope with stressful events by reaching out to friends or going to the gym, others may isolate themselves or numb their feelings through the use of alcohol or drugs. 9.9.1.4.  Support Network Patients who do not seem to have any close friends or family members may need some extra psychological support. This may also be the case when the patient’s choice of support seems questionable (such as a clinically depressed sister or a 13-­year-­old son). Some people may have other more introspective ways of coping with worry or sadness rather than turning to other people. It is also possible that patients do have support people in their lives but prefer not to discuss them during the counseling session. 9.9.1.5.  Other Major Life Stressors Any number of stressful life events could be present at the time a patient decides to be tested. These events may be cancer related (e.g., a terminally ill relative) or may be completely unrelated (e.g., job stress or family problems). Cancer-­related stressors should be considered carefully, as they might cause a more intense reaction to the genetic test result. Non-­cancer-­related stressors should not be ignored, because a positive test result could add another potentially overwhelming stressor. This is because patients who are in the midst of some type of upheaval are unlikely to have the same reservoir of emotional resources as patients who are not dealing with this type of situation. Genetic counselors can explore with patients whether this is the right time for them to be tested in light of the other events going on in their lives. It is also important for genetic counselors to have a protocol in place to deal with patients who require additional psychological support. A patient should be referred to a mental health professional if there is any concern about the person’s ability to cope with the results due to previous cancer experiences, lack of support, or other major life stressors. A decision to defer or deny genetic testing should only be considered if providers have evidence that disclosing a test result could lead to suicidal ideation or could cause incapacitating depression or anxiety. Prior to making this type of decision, it is important for the genetic counselor to consult the institutional Ethics Board and/or the NSGC Ethics Committee. 9.9.2.  Recognizing Psychologically At-­Risk Patients It is rarely possible to predict the patients who will experience greater levels of distress. However, general factors that might contribute to greater distress among patients are described in the succeeding sections. 9.9.2.1.  The Patient Has Significant Baseline Depression or Anxiety (see also Section 11.1.2) Patients who have underlying depressive or anxiety disorders may find their symptoms exacerbated by the news of a positive result. This is especially true if the mental health condition is not being adequately managed.

9. Pre-­and Post-­Test Genetic Counseling

403

9.9.2.2.  The Patient Has Other Major Stressors in Their Life Patients who are dealing with other stressful situations may have fewer emotional reserves to cope with the impact of a positive genetic test result. Patients may be surprised by the intensity of their reactions, but it is more likely to be a function of the cumulative stresses in their lives. 9.9.2.3.  The Patient Has Never Had Cancer (see also Section 11.1.1) As noted earlier, for patients who have never had cancer, receiving a positive test result may be the most difficult (or frightening) news they have ever experienced, and may cause intense feelings of sadness, vulnerability, or cancer worry. 9.9.2.4.  The Patient Has a First-­Degree Relative Who Died of Cancer Having one or more close relatives who have died of cancer may intensify the meaning of a positive genetic test result. Upon hearing their results, patients may identify more strongly with their affected relatives, or may experience delayed grief reactions, both of which may magnify the patient’s reactions to their test results. 9.9.2.5.  The Patient Did Not Expect the Result Patients may have a more difficult time adjusting to their gene status if the result they received was unexpected. This includes patients who unexpectedly receive positive results as well as those who are surprised by negative results. The unexpected results may be disorienting to patients and may make it more difficult for them to believe the news or to adjust their practices accordingly. 9.9.2.6.  The Patient Has Children For patients who have children, one of the most distressing aspects of a positive result is the realization that their children could also be at risk. Even individuals who are sanguine about their own risks of cancer may have a difficult time sharing the news with their offspring or watching them undergo genetic testing or cancer screening. Positive test results may lead to intense feelings of parental sadness and guilt.

9.10.  Summary and Future Directions Genetic counselors will remain essential providers to ensure high-­quality, effective genetic testing services. Maintaining the personalized nature of genetic testing is essential for patients to fully benefit from the genetic information, and genetic counselors are the uniquely trained providers to ensure this personalized medicine. It is known that educating individuals about their personal risk factors, tailoring screening recommendations according to individual level of risk, and attending to individual psychological needs improve adherence to early detection. In addition, research shows that efforts to educate about cancer risks are not likely to be effective

404

Counseling About Cancer

unless patients’ cancer anxieties are also addressed. It is important that genetic counselors and the genetic counseling field study and shape the genetic testing space so that patients can benefit from the testing in a meaningful way.

9.11.  Case Examples 9.11.1.  Case 1 William, a 50-­year-­old male patient, presents with his husband, Carl, for genetic counseling. William’s mother died at age 60 of colon cancer and over the years he had learned that multiple maternal relatives were being diagnosed with colon cancer. In fact, one of his maternal cousins was recently diagnosed with an MSH2 pathogenic variant (PV). William was extremely anxious at the time of the appointment and Carl did much of the speaking for him while William nodded in agreement with everything Carl said. The genetic counselor calmly and informatively explained that William had as high as a 50% risk of carrying the MSH2 PV based on his relationship to his cousin, his aunt’s diagnoses with endometrial and colon cancer, and his mother’s colon cancer diagnosis. The genetic counselor explained the nuances of single-­site testing and discussed the availability of gene panel testing. William declared that all he could handle at the time was to undergo genetic testing for the MSH2 PV. He didn’t want to even think about any additional risks. William consented to single-­site MSH2 testing and was told that his results would be available in approximately 2–3 weeks. At the end of the session, the genetic counselor initiated a discussion with William about the disclosure of his test results. William requested that the genetic counselor call him on the phone immediately when the test results were available but only if the results were negative. He wanted to come in person to discuss the results if they were positive and asked that the genetic counselor call and set up an in-­person appointment if the results were positive. The genetic counselor astutely explained that if she called William to set up an appointment, he would immediately know that the results were positive because she was setting up an in-­person visit. Thus, that method of disclosure would not work the way he wanted it to. The genetic counselor suggested that perhaps a scheduled phone call would be best, but offered the opportunity to have the phone call while both William and Carl were available. That way, Carl could be there to support William as he learned the test results. An appointment was scheduled for 3 weeks out at 4:00 p.m. so that William and Carl could both be present. At the time of disclosure, William was thrilled to learn not only that he was negative for the familial MSH2 PV but also that Carl was there with him to celebrate the news. Discussion: This case highlights the importance of working with the patient during the pre-­test counseling session to determine the most appropriate way to disclose genetic test results. It illustrates the importance of the genetic counselor recognizing when patients need additional support and suggesting structured disclosures when appropriate. 9.11.2.  Case 2 A 52-­year-­old, assigned female at birth patient, Sally, calls her genetic counselor, Trey, 4 years after she was found to have a BRCA2 pathogenic variant to obtain a copy of her test results, because she had misplaced them in a big move. One of her siblings was interested in undergoing

9. Pre-­and Post-­Test Genetic Counseling

405

genetic testing and needed them for his genetic counselor to interpret the results. Trey explained how Sally could access her test results via an online portal offered through the hospital. Trey decided to take this opportunity to engage Sally in a follow-­up discussion and learned that her children and sisters had undergone genetic testing and were being followed accordingly. Sally’s brother was the only relative in her nuclear family who had not been tested and she was very happy that he was finally doing it. Sally reported that she had been coping well with the information and relied on her therapist and an online support network to help her with the adjustment to the news of her high-­risk status. Sally was cared for in her local community after she had her risk-­ reducing bilateral prophylactic mastectomy and risk-­ reducing bilateral salpingo-­oophorectomy. She reported that she was feeling healthy and grateful that she had the opportunity to pursue these surgeries. Trey asked more questions about her family’s cancer history, asking if there was any updated information on cancer diagnoses. Sally denied any changes, but Trey offered to confirm the information he had on record. In reviewing the family history information, Sally reported that a paternal uncle, who also carried the familial BRCA2 PV, died of pancreatic cancer the previous year. Sally didn’t think to mention it because “it wasn’t breast or ovarian cancer, which we worry about.” Trey calmly educated Sally that pancreatic cancer was indeed part of the tumor spectrum in some BRCA2 PV families. He explained that while it wasn’t routine to screen for pancreatic cancer in all families with BRCA2 PVs, pancreatic screening would be considered if a BRCA2 PV family had an individual with pancreatic cancer in it. Thus, Sally was now a candidate for pancreatic cancer screening. Trey offered to help set up an appointment with a specialist at the hospital who would be able to talk to her about the pros and cons of pancreatic screening and perform the testing if Sally desired. Sally was grateful for this updated information and assured Trey that she would update the family as well so they could benefit from the knowledge. Discussion: This case illustrates the importance of follow-­ up in all PV carriers. Updated information regarding cancer risk and screening options is often available, as information regarding cancer genetics is rapidly evolving. In addition, changes in cancer family history are inevitable in families with PVs and new diagnoses that occur in the family can dramatically change a patient’s management.

9.12.  Discussion Questions Question 1: Your 30-­year-­old patient presents with genetic test results in-­hand. The patient had Lynch syndrome genetic testing ordered through Laboratory A by their oncologist and reports minimal (if any) pre-­test counseling. The result shows that the patient has a VUS in MSH2. You counsel them about the implications of a VUS, and after obtaining a full family history and performing risk assessment, astutely offer them more expansive gene panel testing that includes genes such as APC and MUTYH. The patient provides informed consent and you send the gene panel test to Laboratory B. Test results from Laboratory B report that the variant in MSH2 (classified as a VUS at Laboratory A) is classified a pathogenic variant (PV).

406

Counseling About Cancer

a. What are your next steps in order to clarify the pathogenicity of the variant? b. How do you explain the difference in interpretations to your patient? c. What type of reaction might you expect from the patient? d. Do you offer predictive testing to family members? Question 2: A 45-­year-­old patient with metastatic breast cancer had declined germline genetic testing when they were initially diagnosed at age 40 and explained that the information would not have changed their surgical decision making at the time. Now that their cancer is metastatic, their oncologist requested they undergo BRCA1 and BRCA2 genetic testing because if they are found to have a PV in one of those genes, the medical oncologist will treat them with a PARPP inhibitor. The patient has declined genetic testing again, citing concerns about health and life insurance discrimination. The medical oncologist is hoping you can persuade the patient to move ahead with genetic testing. a. What are some of the issues you will discuss with the medical oncologist prior to meeting with your patient? b. Are there other testing options that you could consider? c. What are some of the issues you will discuss with your patient? Question 3: Your patient was tested 10 years ago and was found to carry a MSH2 PV. She has been undergoing annual colonoscopy and has never had a polyp detected. At age 45 the patient proceeded with a total abdominal hysterectomy and bilateral salpingo-­oophorectomy for risk reduction. You recently received a reclassification test report from the genetic testing lab. Recent studies indicate that the MSH2 variant is a VUS. a. How will you prepare for discussion with the patient? b. What is some of the language you will use to describe this change in interpretation? c. What reactions might you expect from the patient? d. What will you advise she do about her family members who may/may not have been tested for the variant?

9.13.  Further Reading Baty BJ. Risk communication and decision-­making. In Uhlmann WR, Schuette JL, Yashar BM (eds.), A Guide to Genetic Counseling, 2nd edition. Wiley-­Blackwell, Hoboken, NJ, 2009, 207–250. Brown S, Puumala S, Leonhard J, et al. Genesurance counseling: genetic counselors’ roles and responsibilities in regards to genetic insurance and financial topics. J Genet Couns. 2018 Aug;27(4):800–813. doi: 10.1007/s10897-­017-­0180-­x. Epub 2017 Dec 4. PMID: 29204809.001/amajethics.2019.865. Centers for Disease Control and Prevention. Examples of state-­required components of informed consent for genetic testing—­ selected states. https://www.cdc.gov/mmwr/preview/mmwrhtml/rr5806a3. htm (accessed August 25, 2022). Elwyn G, Frosch D, Thomson R, et al. Shared decision making: a model for clinical practice. J Gen Intern Med. 2012 Oct;27(10):1361–1367. doi: 10.1007/s11606-­012-­2077-­6. Epub 2012 May 23. PMID: 22618581; PMCID: PMC3445676.

9. Pre-­and Post-­Test Genetic Counseling

407

Evans N, Metselaar S, van El C, et al. How should decision aids be used during counseling to help patients who are “genetically at risk”? AMA J Ethics. 2019;21(10):E865–E872. Geller G, Botkin JR, Green MJ, et al. Genetic testing for susceptibility to adult-­onset cancer. The process and content of informed consent. JAMA. 1997 May 14;277(18):1467–1474. PMID: 9145720. Lolkema MP, Gadellaa-­van Hooijdonk CG, Bredenoord AL, et al. Ethical, legal, and counseling challenges surrounding the return of genetic results in oncology. J Clin Oncol. 2013 May 20;31(15):1842–1848. doi: 10.1200/JCO.2012.45.2789. Epub 2013 Apr 15. PMID: 23589552. MGH Health Decision Sciences Center. What is shared decision making? https://mghdecisionsciences. org/about-­us-­home/shared-­decision-­making/ (accessed August 25, 2022). National Comprehensive Cancer Network. Genetic/familial high-­risk assessment: breast, ovarian and pancreatic. https://www.nccn.org/professionals/physician_gls/pdf/genetics_bop.pdf. Accessed January 15, 2022. National Human Genome Research Institute (2009). https://www.genome.gov/genetics-­ glossary/ Genetic-­Information-­Nondiscrimination-­ (accessed August 25, 2022). Ridge Y, Panabaker K, McCullum M, et al. Evaluation of group genetic counseling for hereditary breast and ovarian cancer. J Genet Counsel. 2009;18:87–100. https://doi.org/10.1007/s10897-­008-­9189-­5. Riley BD, Culver JO, Skrzynia C, et al. Essential elements of genetic cancer risk assessment, counseling, and testing: updated recommendations of the National Society of Genetic Counselors. J Genet Counsel. 2012;21:151–161. https://doi.org/10.1007/s10897-­011v9462-­x Schienda J, Stopfer J. Cancer genetic counseling—­current practice and future challenges. Cold Spring Harb Perspect Med. 2020 Jun 1;10(6):a036541. doi: 10.1101/cshperspect.a036541. PMID: 31548230; PMCID: PMC7263095. Schmidlen T, Schwartz M, DiLoreto K, et  al. Patient assessment of chatbots for the scalable delivery of genetic counseling. J Genet Couns. 2019;28:1166–1177. https://doi.org/10.1002/jgc4.1169. Weil J. Decision making. In Psychosocial Genetic Counseling. Oxford University Press, New  York, 2000, 137–152.

CHAPTER

10 Special Populations and Special Situations

It is not our differences that divide us. It is our inability to recognize, accept, and celebrate those differences. —­Attributed to Audre Lorde in Tang and Joiner (2006), p. 5

This chapter focuses on some of the special populations of patients that genetic counselors may encounter. This includes populations such as those at end of life, with mental health challenges, and with intellectual disability. This chapter also provides information on working with populations with health disparities, including those whose primary language is different from the genetic counselor’s as well as transgender and gender diverse people. Lastly, this chapter discusses several scenarios regarding results disclosure that address findings that are unanticipated, such as identifying unexpected high-­penetrance pathogenic variants and pathogenic variants in genes with unknown cancer risk. This section also reviews results discussions when initial testing was done without upfront genetic counseling.

10.1.  Counseling for Special Populations Genetic counselors are well aware of the concept of “vulnerable populations” when it comes to human subjects research. Vulnerable populations include those with physical vulnerability, psychological vulnerability, and social vulnerability (Manti and Licari, 2018). This section reviews the possible counseling challenges when dealing with some of these special populations. Counseling About Cancer: Strategies for Genetic Counseling, Fourth Edition. Katherine A. Schneider, Anu Chittenden, and Kristen Mahoney Shannon. © 2023 John Wiley & Sons Ltd. Published 2023 by John Wiley & Sons Ltd.

409

410

Counseling About Cancer

10.1.1.  Patients at End of Life Genetic counseling for dying patients is one of the most difficult scenarios that counselors face in their profession. Many times, in the cancer setting, they are asked to see patients who are unlikely to survive their inpatient stay. Patients may be conscious and able to carry on a conversation or they may be unconscious or barely conscious, and the health care proxy or another family member is asking for the testing to be done. The decision to test a patient who is barely conscious, or unconscious, is not a straightforward one. While the consent of a health care proxy is typically required, it may be insufficient to carry out genetic testing. There may be legal requirements specific to each state to address concerns about genetic testing in this scenario. In most cases, in addition to the health care proxy, the health care provider who knows the patient should weigh in on the decision to obtain a sample for genetic testing. Questions for the genetic counselor, provider, and health care proxy to consider include: •• ••

••

Was the intent of the patient to pursue this testing? If not discussed directly with the patient prior to entering an unconscious state, did the patient express a preference or wish about wanting their family to have as much information as possible for their own health care? Did the patient make previous decisions that showed consistency with the pursuit of genetic testing for inherited cancer susceptibility (e.g., pursuit of other types of genetic testing in the past)?

In the end, testing an individual in this scenario requires careful consideration and discussion with the patient’s health care proxy and providers to determine whether this option reflects the patient’s own wishes. Patients who are conscious and able to provide consent should be involved in the decision-­ making process. Although the vast majority of people in this scenario will choose to undergo testing, it is important to document this decision through consent (written, if possible, or verbal) or, sometimes more importantly, a patient’s refusal of genetic testing. In this manner, the intentions of the patient are clearly stated and will help the patient’s health care proxy and care team in decision making later if needed. If a patient does decline genetic testing, it is the genetic counselor’s responsibility to advocate for the patient’s wishes in this scenario; the counselor can let relatives know that the option of genetic testing is available for them directly. The directive of a health care proxy is not to take choice away from the patient after the patient loses the ability to make their own decisions but to act in a manner that reflects the patient’s values and intent. If a patient consents to genetic testing at end of life, it is important to attempt to document who the patient would like results to be released to. In many cases, the legal precedent is that, once an individual passes away, the release of health care information is controlled by the administrator of the estate. Therefore, recording the patient’s wishes for the release of genetic results clarifies the disclosure process. Whenever possible it is, of course, better if patients receive information about genetic testing well before an end-­of-­life stay in the hospital. The oncology team, including palliative care, should be encouraged to refer the patient for genetic evaluation earlier in the treatment process.

10. Special Populations and Special Situations

411

For some patients and their families, pursuing genetic testing during end-­of-­life care when they are going through high levels of mental and physical stressors is not in their best interest. An alternative is to offer them DNA banking. This may be an appealing option to families who are not yet ready to learn the genetic information, as it allows them more time to consider and discuss the testing options and provides flexibility in terms of when testing is pursued. In this situation, it is still important to understand the wishes of the patient, if possible, and to clearly document their wishes in the medical record.

10.1.2.  Patients with Mental Health Challenges Providing genetic counseling to people with mental illness (e.g., depression, bipolar disease, schizophrenia) may or may not be different from counseling sessions with other patients. Many patients with mental illness face the same considerations as anyone undergoing genetic counseling and, particularly if the illness is well-­controlled with treatment, the same formats for counseling can be applied. However, it is optimal to make sure that the patient’s psychotherapy and/or psychiatric team is aware of the testing when possible. If the providers are part of the institution’s team, then explicit consent from the patient to discuss the testing may not be necessary. Permission from the patient to initiate contact with their mental health providers may be required if these providers are not a part of their routine care at the counselor’s workplace. In either case, the need for communication with the treatment team should be discussed with the patient. More time may be needed to check in with these patients during the session to gauge their reactions and share information accordingly. If the genetic counselor assesses that a patient’s mental illness is not well-­controlled and that this is affecting the individual’s ability to provide informed consent, the counselor can and should try to ask for more information from the patient’s providers before arranging genetic testing. Providers of care for patients with mental illness should be able to help a counselor assess a patient’s capacity to provide consent (Amer,  2013; Palmer and Harmell,  2016). In a situation where a patient has a health care proxy, the genetic counselor may need to have them involved in the session or make them aware of the concerns around the testing. It is important to note that competency is generally assessed through a formal legal process, whereas decisional capacity is typically done by clinicians. Decisional capacity can be assessed through different instruments and generally involves looking at four components: understanding, reasoning, appreciation, and expression of a choice (Palmer and Harmell, 2016). See Section  12.1.2.1 on ethics for more discussion on decisional capacity and informed consent. Even if a patient has the capacity to provide consent, it is important to consider how the results, whether positive or negative, might impact their mental health and whether they currently have adequate support in place to cope with results. If the genetic counselor has significant concerns about how the results will impact a patient’s mental health, it is essential that they discuss this with the patient and their mental health provider before ordering the testing. If testing is pursued, the counselor should have a strategy for how best to deliver the results. Points to consider include who should be present for the results disclosure, whether the results should be delivered in person or over the phone, and who the patient will turn to for support if needed.

412

Counseling About Cancer

If the results disclosure is done without a therapist present, it is helpful to have a plan if the patient expresses the wish to harm themselves. In this case, having the ability to reach their therapist or on-­call care team urgently is critical. See Section 11.5.1 for more information about making mental health referrals.

10.1.3.  Patients with Intellectual Disability As defined by the American Association of Intellectual and Developmental Disabilities, intellectual disability is a condition characterized by significant limitations in both intellectual functioning and adaptive behavior that originates before the age of 22. According to the American Psychiatric Association, about 1% of the U.S. population is intellectually disabled, with 85% of those individuals having mild intellectual disability. Intellectual disability (ID) does not inherently lead to impaired ability to make healthcare decisions, including decisions about genetic testing. In the United States, an adult is typically considered competent unless legally declared incompetent by a court of law following evaluations by a physician and psychologist. One of the important areas to consider is the individual’s capacity for decision-­making, which may be assessed by evaluating the following abilities (Wong et al., 1999): •• •• •• •• ••

Communicating a choice Understanding information relevant to the treatment (or in this case, the genetic test) Retaining relevant information Manipulating information rationally Appreciating the situation and its likely consequences

Children with ID will typically be cared for by their parents, who are their natural guardians. Adults with severe ID will generally be assigned a guardian (often a parent or another family member) who can make decisions for them regarding support, care, education, health, and welfare. There are two types of guardianship, one that is plenary (complete) and one that is limited (only in specific circumstances). As an example, Massachusetts state law states that: A guardian shall exercise authority only as necessitated by the incapacitated person’s mental and adaptive limitations, and, to the extent possible, shall encourage the incapacitated person to participate in decisions, to act on his own behalf, and to develop or regain the capacity to manage personal affairs. A guardian, to the extent known, shall consider the expressed desires and personal values of the incapacitated person when making decisions, and shall otherwise act in the incapacitated person’s best interest and exercise reasonable care, diligence, and prudence. (https://malegislature.gov/laws/generallaws/partii/titleii/ chapter190b/articlev/section5-­309)

10. Special Populations and Special Situations

413

People with mild forms of ID may or may not have a guardian appointed for them. If a guardian has been appointed, they should reasonably encourage the person with ID to be involved in decision making. In some cases, the person with ID will have a support person (family member or designee) or caregiver who knows them and can help in the decision-­making process. The Cultural Competency Toolkit developed by Jane Engelberg Memorial Fund award winner Nancy Steinberg Warren is an excellent and more in-­depth look at cultural competency (Warren, 2010) across different populations. In this toolkit, Brenda Finucane writes that counselors should ask about the client’s competence to provide informed consent before the session and involve caregivers, guardians, and the family as appropriate. She also discusses how to approach these situations: ••

••

Decide what information is essential to communicate. Use simple terminology accentuated by visual aids. Check for acceptance of your educational strategies and modify your communications as needed. Focus the counseling session on the client’s concerns and abilities. (https://www.geneticcounselingtoolkit.com/cases/ case_prep/caseprep10.htm)

In these circumstances, the best approach may be to simplify explanations of genetics and utilize the patient’s own experience in the family with cancer to help illustrate heredity. Abstract concepts may not be understandable, and metaphors may be too complex, depending on the level of ID. One way of explaining genetic testing for cancer risk for an individual with intellectual disability may look like the following: Genetic counselor: “Some people in the family got sick and they had to take medicine to get better. Some people never got sick. This test might help us figure out if you might get sick like your sister and help us try to keep you healthy. If the test comes back showing that you might get sick, you may have to go for more special tests, but you will have your mom with you any time you need to go for these tests. You also might not get sick even if the test says that you will.” Patient: GC: Patient: GC:

“What kind of test is it?” “It can be a blood test, or, if you don’t want that, you can spit into a cup.” “I don’t want to do a blood test; can I do the spit test?” “Yes, you can do the spit test. I just want to make sure that I did a good job explaining the test to you. If I didn’t, you can tell me. You won’t hurt my feelings. Do you know what this test can tell you?” Patient: “Yes, the test can tell me if I am going to be sick or not. If the doctors know that, they can try to keep me from getting sick or make me better. But I might not get sick.” GC: “That’s right, you might get sick, or you might not.” Some patients will be able to understand more about numeracy, and visual aids might be helpful. Others may be able to comprehend even more. For example, some individuals on the autism spectrum are exceptionally good with numbers and statistics. It is important to tailor the genetic counseling session to the individual.

414

Counseling About Cancer

For further information on how to communicate with individuals with intellectual disabilities and work with a guardian, see the following resources: https://www.cfsny.org/12-­tips-­to-­communicate-­effectively-­with-­adults-­with-­intellectual­disabilities/ https://www.mass.gov/info-­details/learn-­about-­the-­responsibilities-­of-­a-­guardian-­of-­an-­ incapacitated-­person

10.1.4.  Patients Whose Primary Language Is Not That of the Genetic Counselor Genetic counseling for patients whose primary language does not match that of the genetic counselor should still revolve around client-­centered care. Approximately 8.3% of the U.S. population (more than 25 million people) self-­identified as having limited English proficiency (U.S. Census Bureau, last revised 8 October 2021). Ideally, the patient would be meeting with a genetic counselor who is fluent (and certified) in the language that the patient is most comfortable with for healthcare discussions. In reality, this may not be possible. In the United States, Title VI of the Civil Rights Act of 1964 requires hospitals and hospital-­based clinics to provide patients who are not proficient in English with the ability to use the services of an interpreter. Even if a family member is present who is multilingual and can translate, patients should be offered the opportunity to use an official medical interpreter. Family members may translate topics, whether knowingly or unknowingly, through the lens of their own views and understanding of the information. Patients do have the right to refuse the services of an interpreter because they do not feel that they need one or because they prefer that a family member translate. However, written acknowledgment of this decision is typically required. These genetic counseling sessions may take more time because the information has to be relayed back and forth between a third party. Medical interpreters who are familiar with cancer genetics are generally more knowledgeable about translating genetics terms into comprehensible language, which may not equate to a literal translation. Several companies also provide interpreter services through telemedicine for healthcare institutions if in-­house services are not available. Online translation tools or apps can help in a limited way but should not be a replacement for a qualified interpreter. It’s important to consider that some languages may not have specific terms for body parts. Working with patients who speak a different language may also mean that they have different cultural norms. For instance, patients from certain cultures may prefer that a provider (especially for physical examination) be of the same gender. This could also extend to interpreters and genetic counselors who are hearing private details of a patient’s medical and family history; the scheduling team may take this into consideration when setting up an appointment. While, in general, having providers and interpreters who are culturally similar to patients is preferable, some patients may worry about working with interpreters who are connected to a neighborhood or culture that has a close social network in their area for fear that there will be lack of privacy. Gaining the trust of individuals who are undergoing genetic counseling can begin with the scheduling team asking about their preferences with an interpreter, showing acceptance of

10. Special Populations and Special Situations

415

different languages in posted forms in waiting areas, providing qualified interpreters for visits, and supplying materials that are translated into their preferred language. Individuals from the Deaf community may require an American Sign Language interpreter, so it is important to have the capability of video in the room if the appointment is in person and an interpreter is not on staff. Many individuals may be able to lip-­read. The National Deaf Center provides the following tips for communicating: ••

••

•• •• •• ••

••

••

•• ••

Get the attention of the deaf individual before speaking. If the individual does not respond to the spoken name, a tap on shoulder or another visual signal is appropriate. Provide a written outline of the main topics to be discussed. This is especially helpful for individuals who depend on speech reading to pick up on keywords in a conversation. Speak clearly and at a normal pace; do not yell or overenunciate. Look directly at the individual while speaking. Do not cover your mouth or look around while speaking. Avoid standing in front of a light source, which can make it difficult to see your face clearly. If you need to repeat, rephrase the thought. Some words are harder to understand than others; rephrasing allows for opportunities to understand what was previously missed. Use visual aids, gestures, and body language when appropriate. The old saying that “a picture is worth a thousand words” is very true. Do not be afraid to use pen and pencil or texting as a tool. Use open-­ended questions to allow for more opportunities for both parties to check each other’s understanding of a topic. (National Deaf Center, 2019)

For further information on how to communicate with individuals with hearing or language difficulties or working with an interpreter, please see the following resources: https://www.albertahealthservices.ca/cmac/Page17537.aspx

10.1.5.  Transgender and Gender Diverse People Transgender and gender diverse (TGD) people are people whose gender identity is different from that assigned at birth. It is estimated that about 1.6 million adults and youth in the United States identify as transgender (Herman et al., 2022). Transgender and gender diverse people face multiple challenges in comparison to cisgender people, including: •• •• ••

Lack of legal protection Poverty Stigma, harassment, and discrimination

416

•• •• ••

Counseling About Cancer

Violence Lack of healthcare coverage Inaccurate identity documents (Human Rights Campaign)

These challenges have led to socioeconomic disparities in healthcare, housing, jobs, and other areas. Cancer genetic counselors have expressed confusion and a lack of knowledge about how to counsel TGD people. Berro and colleagues noted that over one third of cancer genetic counselors surveyed did not feel confident in genetic counseling for transgender patients and more than 90% wanted more education on transgender health implications on cancer risks (Berro et al., 2020). Zayhowski published on cancer genetic counselors’ experiences with transgender patients and noted the following themes (Zayhowski et al., 2019). Comments about each of these themes are provided as well. ••

••

Documentation systems are not inclusive or clear. •• While this is changing, electronic health systems may still not give many TGD people the option of identifying gender identity and preferred pronouns. •• Barnes and colleagues published on trans-­inclusive genetic counseling services and provide suggestions for safety and clarity by first validating gender identity and secondly using inclusive and well-­defined pedigree symbols for both sex assigned at birth and gender identity (Barnes et al., 2020). •• NSGC has changed pedigree symbols to reflect TGD people’s general preferences about symbols (please see Section 6.1.1 for further details). Genetic counselors feel unprepared for these sessions. •• There are several publications referenced in this section and others in the Journal of Genetic Counseling to help prepare genetic counselors for counseling TGD people. In particular, von Vaupel-­Klein and Walsh discuss transgender cultural competency as a basis for providing genetic counseling care (von Vaupel-­Klein and Walsh, 2020). •• For examples, Sacca and colleagues present three cases to illustrate important issues that arose, including: disclosure of gender identity during a session, parental influence for or against testing, TOP surgery vs. risk-­reducing mastectomies, and coordination of care with other providers such as endocrinologists (Sacca et al., 2019). •• Rolle and colleagues describe the perspective of transgender people who have gone through genetic counseling in a qualitative study published in 2021 (Rolle et  al., 2021). While this is not meant to be representative of all TGD people, there were several themes that patients described, including anticipatory anxiety, disruption of familial relationships and emotional support systems, use of inclusive language during sessions, impact on gender-­affirmation journey, and lack of appropriate cancer-­ risk information for trans patients.

10. Special Populations and Special Situations

417

For additional information, please see the UCSF Transgender Care Guidelines site: https://transcare.ucsf.edu/guidelines. Gender-­affirming hormones impact risk assessment. •• While there is believed to be some influence of gender-­affirming hormones on risk assessment, there is a dearth of studies addressing this information. Genetic testing affects gender-­affirming surgical decisions. •• This may be a motivation for transgender and gender-­diverse people to consider genetic testing. Transgender patients often present at younger ages to clinic. •• When making decisions about gender-­affirming care, adolescents may wish to consider genetic testing for adult-­onset hereditary cancer syndromes, which is earlier than genetic counselors typically expect. Pathogenic variants allow for insurance coverage for gender-­affirming surgeries. •• Financial barriers to gender-­affirming care may influence decision making about testing. ••

••

••

••

••

As with other groups who are underserved, the provision of inclusive care involves education, research, and effort on the part of the genetic counselor and the facility where patients are being seen. Two-­step gender identity questions about gender identity and sex assigned at birth should be promoted and documented in electronic medical record systems. Staff training on transgender health and terminology and inclusive waiting areas with gender-­neutral bathrooms and TGD materials provide a more welcoming atmosphere (UCSF Transgender Care Guidelines, 2016). For all underserved patients, approaching these sessions with cultural humility is an important step in providing good care. This is defined as the “ability to maintain an interpersonal stance that is other-­oriented (or open to the other) in relation to aspects of cultural identity that are most important to the [person]” (Hook et al., 2013, p. 2). As described by Waters and Asbill, three factors guide the journey to cultural humility: a lifelong commitment to self-­evaluation and self-­critique, a desire to fix power imbalances, and aspiring to develop partnerships with people and groups who advocate for others (Waters and Asbill, 2013).

10.2.  Counseling About Unanticipated Results Unanticipated findings bring a different level of complexity into the disclosure of genetic test results. This section addresses two common circumstances for genetic counselors.

10.2.1.  Unexpected High-­Penetrance Pathogenic Variants With the increase in multigene panel testing, the finding of unexpected high-­penetrance pathogenic variants has become, if not common, then more frequent. Chapter 9 on pre-­and post-­test counseling shows how important it is to counsel for this possibility.

418

Counseling About Cancer

Discussing the results of genetic testing in any situation where the result is positive for a high-­penetrance pathogenic variant can be challenging, but it is especially challenging in the situation where this type of result is unanticipated. While even seasoned genetic counselors may feel ill-­prepared to address these issues with patients, their skills and training can help to make this a smoother process. As always, there is no single approach that works best in every case. Tailoring the information and counseling is key. One specific example of this is the finding of a CDH1 pathogenic variant in a patient who does not have a family history of stomach cancer or even a personal history of lobular breast cancer. Several laboratories have published their experience with unexpected CDH1 pathogenic variant findings, indicating that up to one quarter of patients who are found to have CDH1 pathogenic variants do not meet clinical criteria for hereditary diffuse gastric cancer. In an article highlighting a recent case of unexpected CDH1 pathogenic variant, Katona and colleagues state this about the presence of CDH1 in multigene panels: In the age of MGPT, where numerous genes may be tested quickly and at low cost, we believe that CDH1 should be singled out during pretest genetic counseling and the sequela of finding a CDH1 mutation should be addressed with all individuals undergoing CDH1 testing. This is especially important when finding a CDH1 variant would be inconsistent with the family’s cancer phenotype. This process will ensure that all individuals undergoing CDH1 testing are aware of the implications of a positive finding for themselves as well as their families. Furthermore, if after extensive pretest genetic counseling, individuals want to proceed with MGPT for cancer risk assessment but do not want to undergo CDH1 testing, then the option to send MGPT without inclusion of CDH1 should be offered by the provider, regardless of how broad or cancer specific the intended panel is. Although as medical professionals we often strive to obtain the most information, in the case of genetic testing for CDH1, especially in the absence of a history of gastric cancer, we must provide patients with the appropriate autonomy to direct and feel comfortable with this part of their medical care. (Katona et al., 2020, p. 333) If the patient has been provided the appropriate pre-­test counseling, the hope is that post-­ test counseling on this topic will be easier. In the real world, counselors do not always do this—­ highlighting the consequences of different types of positive results may be part of their practice, but it may be impractical to single out every gene that is unexpected. So how do counselors address the issue of unexpected results in this example? Again, in Nancy Steinberg Warren’s excellent review of cultural competency, she presents the following (Warren 2010): Why Is Breaking Bad News Difficult? ••

Concern for how the news will affect client

••

Client’s fears of social stigma and impact of disability and illness

10. Special Populations and Special Situations

•• •• •• •• •• ••

419

Fear of client’s reaction to the news Uncertainty in dealing with intense emotional response Fear of being blamed Fear of how this affects you/expressing emotion Challenge of delivering the news appropriately and sensitively for this client Not wanting to take away hope

In cancer genetic counseling there may be the added impact from a new diagnosis of a life-­ threatening illness. Breaking bad news involves educating about the information while also addressing the emotional state of the patient (Witt and Jankowska, 2018). Patients should be involved in the decision-­making process about the impact of the result and be offered a constructive plan. The authors go on to describe two tools for breaking bad news: SPIKES (setting, perception, invitation, knowledge, empathy/emotion, strategy/summarize) and EMPATHY (emotions, meeting, patient’s perception, adequate language, truth and hope, yes for empowerment). Using a SPIKES model in this situation would ideally be done in a quiet setting that was in-­ person with privacy. However, this may be done by phone or through a video visit. A video visit would be preferable to be able to gauge the patient’s reactions in the conversation. However, if a phone visit is the contracted setting, then asking the patient if it is a good time for them to review results is a good first step. Stating the result clearly and calmly but with empathy and brevity is important. Invitation involves asking the patient about how much they would like to know regarding the specifics of having this pathogenic variant during the conversation. Giving the patient the opportunity to ask as few or as many questions as needed can often depend on the counselor’s knowledge of the subject. As genetic counselors, the ability to show empathy is particularly important in this setting. Finally, closing the session with a summary and plan, even a short-­term plan, is preferable. In the legislation mandating that patients have access to their test results upon completion (21st Century Cures Act, 2020), the patient may see the result before the genetic counselor can reach out to them. It may be preferable to set up a time in advance to review these results or call with a brief conversation and then schedule a time as soon as possible to have a more in-­depth discussion.

10.2.2.  Addressing Unknown Cancer Risk In academic institutions, multigene panel testing is often the default test for patients. As discussed previously, this can lead to the finding of unexpected results, including pathogenic variants in genes with high risks for cancer. On the other end of the spectrum are results in genes for which little is known but perhaps an association is emerging with different cancer types or an initial association remains unproven. Why are there genes included on multigene panels without definitive evidence of clinical significance? A substantial fraction of familial (if not hereditary) cancer remains undefined. Genes associated with other genes that are known hereditary cancer genes and/or that play a

420

Counseling About Cancer

critical role in genomic stability are often good candidates for studies of pathogenic variant prevalence and association. Some of these associations evolve into a significant cancer susceptibility, and sometimes they do not. An example of a gene that did evolve into a tumor predisposition syndrome-­associated gene is POT1 (Protection of Telomeres 1), which regulates telomere length. POT1 first emerged on the scene as having a possible association with cancer predisposition in the context of hereditary melanoma in 2014 and later that same year with glioma. Over time, POT1 pathogenic variants have been implicated in families with chronic lymphocytic leukemia (CLL), angiosarcoma, and other cancers. Now, POT1 tumor predisposition (POT1-­ TPD) has its own designated GeneReviews page. While there are no published guidelines for individuals with POT1-­TPD yet, there is a growing body of literature on this syndrome. In contrast, pathogenic variants in the MRE11A gene (also referred to as MRE11 in the literature) seem to have gone from an initial association with breast cancer to a much more tenuous link. MRE11A is part of the MRN complex (together with RAD50 and NBN), which plays a key role in maintaining genomic stability through DNA damage response. MRE11A was first described in the context of a cancer predisposition gene in 2008 in eight breast cancer patients who were BRCA1/2 negative whose tumors showed reduction or loss of all three MRN proteins and found two patients with MRE11 variants, one missense and one truncating. Some functional assays of the mutant MRE11 protein indicated destabilization of the MRN complex, leading to the proposal that MRE11 was a novel breast cancer susceptibility gene. More recent work has downplayed the clinical significance of pathogenic or likely  pathogenic variants in MRE11A as conferring even a moderate increase in breast cancer risk. Looking at these two examples, the question for many cancer genetic counselors is “Why are we testing for genes that are not well-­described?” As previously, in the paper by Katona and colleagues on unexpected CDH1 findings, it is worth considering the ramifications of finding a pathogenic variant in a gene for which there is little or less information. What are the implications for patients? Are counselors doing more harm than good in finding pathogenic variants in these types of genes unexpectedly? Genetic counselors have little control over what genes are offered on multigene panels, as these decisions are generally made by clinical laboratories. Although multigene panel testing is not for every patient, there may be value in knowing this information for people who are well-­ informed. While pathogenic variants in genes that are not fully characterized can lead to uncertainty about management and questions about cascade testing, the premise is that most patients seeking information about their risks can understand the nuances of “new” information at a basic or higher level. A clear explanation that knowledge of these genes will increase over time and that additional research will give us tailored information about cancer risk, as well as having the expertise to help address questions about screening and prevention, will help the patient feel more comfortable with the results. Genetic counselors recognize that there is a fine balance between empowering patients with information and not causing harm by overusing costly screening, promoting anxiety, and creating confusion among family members about potential risks. However, as genetic testing is offered more widely and more is learned about penetrance and inherited susceptibility, even risks and recommendations associated with classic high-­risk genes have evolved over time. Genetic counselors can acknowledge the limitations of understanding and still work to give

10. Special Populations and Special Situations

421

patients the best care possible, taking a measured and careful view of the information and research that is available. 10.2.3.  Initial Encounter as Post-­Test Counseling Having discussed approaches to counseling these patients, upfront testing is gradually moving to a back-­end approach (see Section  9.6 for further information). “Mainstreaming” testing to oncology providers, while not yet the norm at many places, is becoming far more common (Hamilton et  al.,  2021; Wright et  al.,  2018; Beard et  al.,  2021; Scheinberg et  al.,  2021). Genetic counselors have already seen the addition of videos, chatbots, virtual agents, and other forms of nonhuman interactions providing upfront education for people making decisions about genetic testing. Genetic counselors are an adaptable group who have always risen to the challenges that have been put in front of them. Laboratory genetic counselors have been providing these types of services for many years, and clinical genetic counselors may be moving towards back-­end counseling much more regularly. The personal touch and thought behind genetic counselors’ interactions with patients cannot be reduced to an algorithm. Technology can help genetic counselors become more efficient and allow counselors to spend more time on aspects of the job that attracted people to the field initially. This shift in care to mainly post-­test counseling ultimately calls for trust in the belief that patients do have the capability of decision making, a central tenet of genetic counseling. For those people who need more discussion and conversation prior to testing, genetic counselors will be there as a partner, and, for those who are comfortable going forward with testing, counselors will help to address their questions about results. It is important to distinguish the use of technology in helping people make informed choices about their care and the lack of any attempt at informed decision making. Patients still need to have an informed consent process, but genetic counselors may not be directly involved in this. However, genetic counselors can create, refine, and safeguard that process for providers and the public at large.

10.3.  Case Examples 10.3.1.  Case 1 The genetic counselor, Arya, is scheduled to meet the next day with patient Than Sopheary, who was recently diagnosed with ovarian cancer. The patient is 53 years old and is of Cambodian ancestry. The counselor sees that she is required to use a Khmer interpreter when speaking with the patient. Since the hospital does not have an interpreter qualified in Khmer, a telehealth interpreter service has been assigned to this appointment. Upon reviewing notes and demographic information, Arya sees that the patient’s daughter is listed as her health care proxy and was the main contact person for scheduling the appointment, which is listed as a video visit. While Arya has not counseled many patients of Cambodian descent, she seemed to recall that the order of naming is typically the surname rather than the given or first name. In doing more research on the Cambodian culture, she learns that addressing individuals in a professional setting is typically done with a title and then using both surname and first name or using the

422

Counseling About Cancer

title and first name alone. The genetic counselor also knows that Cambodia has been devastated by the genocide of the Khmer Rouge. One in four people were murdered or died from disease, starvation, or exhaustion in the mid-­late 1970s and their terrorism affected the country well into the 1990s, essentially wiping out a generation of people. When Arya enters the video visit, the interpreter joins and the counselor and interpreter are able to spend a few minutes reviewing some of the concepts that will be discussed during the video visit. Once the patient joins the video visit, the patient, her daughter, Phan Rotha, and the interpreter are visible on video. Arya opens the session by introducing herself and formally welcoming the patient and daughter to the virtual visit. She then asks the patient for her understanding of the visit and what her doctor has told her about it. The patient’s daughter responds in English to Arya that her mother’s doctor referred them to Genetics because of her cancer diagnosis but did not explain why. Arya pauses the session to determine whether the patient wishes to have a medical interpreter present. While at first the daughter indicates a preference to act as the interpreter, Than Sopheary states that she understands some English but that she feels more comfortable with an interpreter. Her daughter, Phan Rotha, quickly agrees that it would be better to have a translator, especially since they do not know much about genetics. Arya discusses contracting for the session, which is relayed to the family through the interpreter. The patient had no significant medical history prior to her diagnosis. Than Sopheary’s husband died five years ago from a heart attack. She has no further information about her own family. Her family died during the genocide, and she was adopted by a local couple. Than Sopheary and her husband moved from Cambodia about 10 years ago and had previously lived with her husband’s family there. Phan Rotha had been helping to support Than Sopheary financially since her husband’s death and currently worked two jobs. Phan Rotha had to take significant time off to take Than Sopheary to her treatments and doctor’s appointments and was only available for a short time this morning before having to go to work. Than Sopheary had no knowledge of genetics, and Phan Rotha, her daughter, had limited knowledge. The idea of inherited risk was not a concept that Than Sopheary had considered previously, never having known her own family. After going through genetics in simple terms with the interpreter helping to accurately convey the main points of the session to them, the counselor asks Than Sopheary and her daughter about any thoughts or questions. Than Sopheary expresses that she is most apprehensive about what will happen to her daughter, since there is no family here for her and only a small community of friends, who do not yet know about Than Sopheary’s diagnosis. Would this lead to stigma for her daughter? Phan Rotha discusses her anxiety for her mother and how she is concerned that the genetic test results will cause her mother more worry. There are many difficult issues that are touched on briefly in the session, including the tremendous losses that both mother and daughter have experienced. The counselor gently suggests that the family may benefit from meeting with a social worker and therapist, as well as consider applying for aid from financial counselors and other resources. Arya knows that there is a patient support panel at her hospital representing different underserved populations and asks if it would be helpful for Than Sopheary and Phan Rotha to connect with someone from this panel. Than Sopheary and Phan Rotha agree to consider these resources. After discussing genetic testing, both agree that understanding more about inherited risk could help each of them. They also request that another video visit be set up in 3–4 weeks when Phan Rotha is available so that both of them can be there to listen to the results with an interpreter.

10. Special Populations and Special Situations

423

A video visit was set up for 4 weeks after the initial appointment. The genetic counselor was able to touch base with the interpreter a few minutes before the visit to let them know that the testing had come back positive for a BRCA1 pathogenic variant. Arya clearly and briefly explains the positive test result to Than Sopheary and Phan Rotha. While they are quite shocked by the news, they state that they have been talking to a community advocate who they feel connected to. The advocate has been helping them with various resources that they were unaware of when the patient was first diagnosed. In addition, they have also talked to a social worker, who has been working with the community advocate on getting them set up with a therapist, arranging for leave for Phan Rotha so that she can help her mother, and helping them apply for financial aid. The counselor is able to send information about inherited cancer risk due to BRCA1 translated into Khmer for Than Sopheary. Follow-­up: The genetic counselor, with the aid of an interpreter, follows up with the family by phone in a couple of weeks to see how they are doing. Than Sopheary’s infusions have been difficult, but she has discussed the finding of a BRCA1 pathogenic variant with her oncologist, who has told her that this could be helpful for her treatment. Phan Rotha is also eager to get tested, knowing that breast cancer risk could be quite high and that she would be recommended to start screening now. The counselor is able to arrange for genetic testing quickly, and Phan Rotha tests negative for the familial BRCA1 pathogenic variant. Both she and her mother are on the call when they learn that Phan Rotha is negative, and both are able to celebrate the news. Discussion: This case illustrates some of the issues that can arise in patients who often face stark health disparities. Giving the interpreter some background information in advance about key concepts of the genetic counseling session allowed the session to progress more smoothly. Understanding more about the history of the culture also created an environment of trust for the patient and her daughter, which led them to open up to the counselor and made the session and follow-­up more productive.

10.3.2.  Case 2 Jerome, a 35-­year-­old man, and his wife, Lucia, are pregnant with their first child and met with a genetic counselor to discuss prenatal testing. During the course of taking Jerome’s family history, their prenatal genetic counselor learned that Jerome had two paternal uncles in their 60s who both had children who died from some type of childhood eye cancer. Jerome did not have details of the family history and had lost touch with his father’s side of the family. The prenatal genetic counselor had referred Jerome to cancer genetics. Jerome had postponed the visit for some months and seemed reluctant to be there, while Lucia did much of the talking. After learning about the two eye cancers, the genetic counselor asked if there was any possibility for Jerome to obtain more information about the diagnoses in the two cousins. Unfortunately, he had not had any contact with the family since he was a t­ eenager and did not know how he could reconnect with them. He was not active on social media and was estranged from his mother. He had one brother who was 30, living overseas at the time. Lucia expressed much concern about the cancers in the cousins. She had mentioned it to her primary care doctor who stated that their baby was not at risk for eye cancer given that Jerome’s

424

Counseling About Cancer

uncle, father, and Jerome himself had no history of cancer. The genetic counselor reframed some of the issues surrounding this conversation, stating that, in general, risk for eye cancers in childhood are inherited in a dominant pattern. Most of the time, individuals who have inherited risk for eye cancers are diagnosed with these cancers in childhood but that there were some types of pathogenic variants that, when inherited, had a lower risk for cancer than others, so not everyone who had the variant would develop a cancer. The genetic counselor discussed the possibility of a pathogenic variant in the RB1 gene. The counselor asked for each of them to discuss their thoughts about genetic testing for this gene. Jerome stated that he was fine with testing but that Lucia was more eager to obtain the results than he was. Lucia agreed that she was more of an information-­seeker than Jerome was and wanted to rule out as much genetic risk as possible. Since no further information was available about the eye cancers, the counselor also discussed inherited predisposition to other eye cancers such as ocular melanoma. Jerome consented to genetic testing, and it was agreed that the counselor would call Lucia with the test results as soon as they were available and follow up with a phone call with both of them if needed. Jerome’s result came back in about three weeks. He was found to have an RB1 pathogenic variant, c.1981C>T (p.Arg661Trp), a known low-­penetrance variant with parent of origin effects. The genetic counselor discussed the results with Lucia and then arranged to have a phone call with her and Jerome the following day. Jerome had a very flat reaction to the news while Lucia expressed concern for their baby girl. Because Lucia was due shortly, the plan was that the child would undergo genetic evaluation at birth through cord blood testing. The counselor connected the family with the pediatric genetics team who would follow up and arrange for testing their daughter. The pediatric team also arranged for the couple to meet with the staff psychologist prior to the birth of their child. The baby, Anna, was tested at birth and found to have the RB1 pathogenic variant. She was subsequently seen by the ophthalmology team at 2 months and was found to have an early-­ stage unilateral retinoblastoma and underwent chemotherapy for disease. Her oncology team was able to preserve her vision. Follow-­up: The genetic counselor called the family shortly after Anna had been diagnosed with retinoblastoma. On this call, both Jerome and Lucia spoke about how they were overwhelmed by Anna’s birth and had such a short time to be able to enjoy her being healthy before they learned of her diagnosis. While they were grateful to know about the RB1 variant in Jerome prior to her birth, it was still shocking to them that Anna had developed retinoblastoma. Jerome expressed feeling guilty about passing this on to his daughter, and the counselor acknowledged Jerome’s feelings but also discussed how Jerome did not have control of whether or not Anna inherited this variant. Both Jerome and Lucia stated that it would not have changed their decision to have her. They continue to see a therapist, which has been helpful for their relationship and for dealing with their daughter’s diagnosis. Discussion: This case illustrates some of the difficulties of counseling for unanticipated results, especially in the context of a family history where past lived experience may be discordant with the genetic finding. In this case, the genetic counselor was able to help the family make a plan for screening their newborn daughter and connecting them to the appropriate resources. The counselor’s continued interactions also built trust with the family.

10. Special Populations and Special Situations

425

10.4.  Discussion Questions Question 1: You are meeting with a patient with a history of schizophrenia who has a strong family history of cancer suspicious for Lynch syndrome. What kind of information would you like to have prior to the session? What can you evaluate during the session? Question 2: One of the oncologists at your institution emails you at 5 p.m. on a Friday asking if you can test a patient in the hospital who is dying and is not expected to survive the weekend. What questions do you ask? Is it appropriate for you to see this patient?

10.5.  Further Reading 21st Century Cures Act: Interoperability, Information Blocking, and the ONC Health IT Certification Program. 1 May 2020. https://www.federalregister.gov/documents/2020/05/01/2020-­07419/21st-­ century-­cures-­act-­interoperability-­information-­blocking-­and-­the-­onc-­health-­it-­certification Amer AB. Informed consent in adult psychiatry. Oman Med J. 2013 Jul;28(4):228–231. doi: 10.5001/ omj.2013.67. PMID: 23904913; PMCID: PMC3725243. American Association on Intellectual and Developmental Disabilities. Defining criteria for intellectual disability. (2022 August). https://www.aaidd.org/intellectual-­disability/definition American Cancer Society. Survival rates for pancreatic cancer. https://www.cancer.org/cancer/pancreatic-­ cancer/detection-­diagnosis-­staging/survival-­rates.html American Psychiatric Association. What is intellectual disability. (2022 August). https://www.psychiatry. org/patients-­families/intellectual-­disability/what-­is-­intellectual-­disability# Bainbridge MN, et al. Gliogene Consortium. Germline mutations in shelterin complex genes are associated with familial glioma. J Natl Cancer Inst. 2014 Dec 7;107(1):384. doi: 10.1093/jnci/dju384. PMID: 25482530; PMCID: PMC4296199. Barnes H, Morris E, Austin J. Trans-­inclusive genetic counseling services: Recommendations from members of the transgender and non-­binary community. J Genet Couns. 2020 Jun;29(3):423–434. doi: 10.1002/jgc4.1187. Epub 2019 Nov 11. PMID: 31710150. Bartkova J, Tommiska J, Oplustilova L, et al. Aberrations of the MRE11-­RAD50-­NBS1 DNA damage sensor complex in human breast cancer: MRE11 as a candidate familial cancer-­predisposing gene. Mol Oncol. 2008 Dec;2(4):296–316. doi: 10.1016/j.molonc.2008.09.007. Epub 2008 Oct 7. PMID: 19383352; PMCID: PMC5527773. Beard C, Monohan K, Cicciarelli L, et al. Mainstream genetic testing for breast cancer patients: early experiences from the Parkville Familial Cancer Centre. Eur J Hum Genet. 2021 May;29(5):872–880. doi: 10.1038/s41431-­021-­00848-­3. Epub 2021 Mar 15. PMID: 33723355; PMCID: PMC8111023. Berro T, Zayhowski K, Field T, et al. Genetic counselors’ comfort and knowledge of cancer risk assessment for transgender patients. J Genet Couns. 2020 Jun;29(3):342–351. doi: 10.1002/jgc4.1172. Epub 2019 Sep 27. PMID: 31562693. Couch FJ, Shimelis H, Hu C, et  al. Associations between cancer predisposition testing panel genes and breast cancer. JAMA Oncol. 2017 Sep  1;3(9):1190–1196. doi: 10.1001/jamaoncol.2017.0424. PMID: 28418444; PMCID: PMC5599323. Elkholi IE, Di Iorio M, Fahiminiya S, et al. Investigating the causal role of MRE11A p.E506* in breast and ovarian cancer. Sci Rep. 2021 Jan 28;11(1):2409. doi: 10.1038/s41598-­021-­81106-­w. PMID: 33510186; PMCID: PMC7844268. Hamilton JG, Symecko H, Spielman K, et  al. Uptake and acceptability of a mainstreaming model of hereditary cancer multigene panel testing among patients with ovarian, pancreatic, and prostate cancer.

426

Counseling About Cancer

Genet Med. 2021 Nov;23(11):2105–2113. doi: 10.1038/s41436-­021-­01262-­2. Epub 2021  Jul 13. PMID: 34257420; PMCID: PMC8556289. Henry ML, Osborne J, Else T. POT1 tumor predisposition. 2020 Oct 29. In: Adam MP, Ardinger HH, Pagon RA, et al., editors. GeneReviews® [Internet]. Seattle (WA): University of Washington, Seattle; 1993–2022. Available from: https://www.ncbi.nlm.nih.gov/books/NBK563529/ Herman JL, Flores AR, and O’Neill KK. How many adults and youth identify as transgender in the United States? Williams Institute UCLA School of Law, updated June 2022. https://williamsinstitute.law.ucla. edu/subpopulations/transgender-­people/ Hollestelle A, Wasielewski M, Martens JW, et  al. Discovering moderate-­risk breast cancer susceptibility genes. Curr Opin Genet Dev. 2010 Jun;20(3):268–276. doi: 10.1016/j.gde.2010.02.009. Epub 2010 Mar 24. PMID: 20346647. Hook JN, Davis DE, Owen J, et  al. Cultural humility: measuring openness to culturally diverse clients. J Couns Psychol. 2013 Jul;60(3):353–366. doi: 10.1037/a0032595. Epub 2013 May 6. Erratum in: J Couns Psychol. 2015 Jan;62(1):iii–v. PMID: 23647387. Human Rights Campaign. Understanding the transgender community. https://www.hrc.org/resources/ understanding-­the-­transgender-­community Katona BW, Clark DF, Domchek SM. CDH1 on multigene panel testing: look before you leap. J Natl Cancer Inst. 2020 Apr 1;112(4):330–334. doi: 10.1093/jnci/djz229. PMID: 31841163; PMCID: PMC7156936. Manti S, Licari A. How to obtain informed consent for research. Breathe (Sheff). 2018;14(2):145–152. doi:10.1183/20734735.001918 National Deaf Center. Communication with Deaf individuals tip sheet. 2019. https://www. nationaldeafcenter.org/resource/communicating-­deaf-­individuals Palmer BW, Harmell AL. Assessment of healthcare decision-­making capacity. Arch Clin Neuropsychol. 2016 Sep;31(6):530–540. doi: 10.1093/arclin/acw051. Epub 2016 Aug 22. PMID: 27551024; PMCID: PMC5007079. Robles-­Espinoza CD, Harland M, Ramsay AJ, et al. POT1 loss-­of-­function variants predispose to familial melanoma. Nat Genet. 2014 May;46(5):478–481. doi: 10.1038/ng.2947. Epub 2014  Mar 30. PMID: 24686849; PMCID: PMC4266105. Rolle L, Zayhowski K, Koeller D, et al. Transgender patients’ perspectives on their cancer genetic counseling experiences. J Genet Couns. 2022 Jun;31(3):781–791. doi: 10.1002/jgc4.1544. Epub 2021 Dec 28. PMID: 34964220. Sacca RE, Koeller DR, Rana HQ, et al. Trans-­counseling: A case series of transgender individuals at high risk for BRCA1 pathogenic variants. J Genet Couns. 2019 Jun;28(3):708–716. doi: 10.1002/jgc4.1046. Epub 2019 Jan 24. PMID: 30680866. Scheinberg T, Goodwin A, Ip E, et al. Evaluation of a mainstream model of genetic testing for men with prostate cancer. JCO Oncol Pract. 2021 Feb;17(2):e204–e216. doi: 10.1200/OP.20.00399. Epub 2020 Sep 24. PMID: 32970524. Shay JW, Wright WE. Telomeres and telomerase: three decades of progress. Nat Rev Genet. 2019 May;20(5):299–309. doi: 10.1038/s41576-­019-­0099-­1. PMID: 30760854. Shi J, Yan XR, Ballew B, et al. Rare missense variants in POT1 predispose to familial cutaneous malignant melanoma. Nat Genet. 2014 May;46(5):482–486. doi: 10.1038/ng.2941. Epub 2014  Mar 30. PMID: 24686846; PMCID: PMC4056593. Tang Y and Joiner CW. Synergic inquiry: A collaborative action methodology. Thousand Oaks, CA: SAGE Publications. U.S. Census Bureau (2021). People that speak English less than “very well.” Retrieved from https://www. census.gov/library/visualizations/interactive/people-­that-­speak-­english-­less-­than-­very-­well.html#. Last revised 8 October 2021. Title VI, 42 U.S.C. § 2000d et seq. (1964).

10. Special Populations and Special Situations

427

UCSF Gender Affirming Health Program, Department of Family and Community Medicine, University of California San Francisco. Guidelines for the primary and gender-­affirming care of transgender and gender nonbinary people; 2nd edition. Deutsch MB, ed. June 2016. Available at transcare.ucsf.edu/ guidelines. von Vaupel-­Klein AM, Walsh RJ. Considerations in genetic counseling of transgender patients: Cultural competencies and altered disease risk profiles. J Genet Couns. 2021 Feb;30(1):98–109. doi: 10.1002/ jgc4.1372. Epub 2020 Dec 26. PMID: 33368789; PMCID: PMC7898523. Warren, NS. 2010. Cultural Competency Toolkit. https://geneticcounselingtoolkit.com/ Witt MM, Jankowska KA. Breaking bad news in genetic counseling—­problems and communication tools. J Appl Genet. 2018 Nov;59(4):449–452. doi: 10.1007/s13353-­018-­0469-­y. Epub 2018 Sep  25. PMID: 30255485. Waters A, Asbill L. Reflections on cultural humility. CYF News. August 2013. American Psychological Association. https://www.apa.org/pi/families/resources/newsletter/2013/08/cultural-­humility Wong JG, Clare ICH, Gunn MJ et al. Capacity to make health care decisions: its importance in clinical practice. Psychological Medicine. 1999;29(2):437–446. Wright S, Porteous M, Stirling D, et al. Patients’ views of treatment-­focused genetic testing (TFGT): some lessons for the mainstreaming of BRCA1 and BRCA2 testing. J Genet Couns. 2018 May 11;27(6):1459–1472. doi: 10.1007/s10897-­018-­0261-­5. Epub ahead of print. PMID: 29752676; PMCID: PMC6209051. Zayhowski K, Park J, Boehmer U, et al. Cancer genetic counselors’ experiences with transgender patients: A qualitative study. J Genet Couns. 2019 Jun;28(3):641–653. doi: 10.1002/jgc4.1092. Epub 2019 Feb 5. PMID: 30720922.

CHAPTER

11 Psychosocial Aspects of Cancer Genetic Counseling

The true test of whether genetic information actually generates the revolution in medicine that has been predicted rests, in large measure, on the psychological factors that determine the meanings ­people give to it and the plans they make based on their new knowledge. —Andrea Farkas Patenaude (2005), p. 6 This chapter focuses on the “counseling” elements of the genetic counseling session. Each patient is an individual, with varying contextual experiences, values, and family relationships, all of which can dramatically impact the genetic counseling interactions. Assessing these emotional, cultural, and familial factors and incorporating psychosocial counseling strategies into the sessions will provide nuance to the counselor’s discussions of the family history, cancer risk, genetic testing process, and positive test results. Genetic counselors also need to know how to recognize and handle situations in which the emotional issues, such as anxiety or depression, are the overriding concern, and lastly, as with all providers in caring professions, genetic counselors should develop good habits of self-­care to help avoid issues of burnout and compassion fatigue. This chapter discusses possible salient features of patients, including their physical and mental health, ancestry, and gender identification, the types of psychosocial issues that can arise in cancer genetic counseling, and the strategies for being effective cancer genetic counselors, from conducting psychosocial assessments to preventing provider burnout. This chapter ends with two case examples.

Counseling About Cancer: Strategies for Genetic Counseling, Fourth Edition. Katherine A. Schneider, Anu Chittenden, and Kristen Mahoney Shannon. © 2023 John Wiley & Sons Ltd. Published 2023 by John Wiley & Sons Ltd.

429

430

Counseling About Cancer

11.1.  Contextual Information About Patients Cancer genetic counselors will meet with patients who have varying degrees of physical and mental health, have different family structures and experiences, and come from diverse backgrounds and cultures. Recognizing the potential importance of these various factors can be helpful in providing more personalized and empathetic counseling. 11.1.1.  Physical Health/Cancer Status There are many types of serious physical and/or medical conditions that require special management and may affect patients’ day-­to-­day activities, sense of self, and even life choices. This section focuses on the potential issues to consider regarding the patient’s cancer status. Patients’ needs may differ depending on whether they are cancer-­ free, newly diagnosed, relapsed, or have been in remission for several years. The nature of the cancer in terms of disease burden and prognosis are also important factors to consider. 11.1.1.1.  High-­Risk Patients Who Have Not Had Cancer Individuals who are cancer-­free yet deemed high risk based on their family history (or other factors) may feel empowered about the screening protocols they are following or they may feel that cancer is inevitable regardless of what they do. In fact, it is not unusual for individuals to inflate their risks, which can lead to unnecessary screening practices and/or risk-­reducing surgeries. Conversely, high-­risk individuals may be trying to ignore their increased cancer risks by delaying recommended surveillance and even avoiding physician appointments. It is not unusual for close relatives, such as two siblings, to react and respond in completely different fashions to essentially the same risk status. As shown in Table 11.1, a cancer diagnosis impacts the entire family in multiple ways. Two important factors in shaping a high-­risk patient’s response to cancer risk are the family’s prior experiences with cancer and the specific type of cancer running in the family. Other important factors include the person’s level of attachment to the affected relative, the age when the relative was diagnosed, the amount of involvement with the relative’s care, and whether the relative survived the cancer or succumbed to the disease.

TABLE 11.1.  Potential Ways in Which a Cancer Diagnosis Can Impact Other Family Members Restricted social interactions Heightened tensions Fractured relationships Strained finances Emotional conflicts or awkwardness Unresolved grief Source: Patenaude (2005). With permission of the American Psychological Association.

11. Psychosocial Aspects of Cancer Genetic Counseling

431

Being at increased risk of cancer, any type of cancer, is anxiety producing; however, certain cancers inspire greater fear than others. The prospect of developing a malignancy that is uniformly fatal is undoubtedly more frightening than the possibility of developing a cancer that is very treatable. Thus, patients who are at risk for cancers with uniformly poor detection rates and prognoses, such as pancreatic or stomach cancer, are more likely to be more anxious than those at risk for cancers such as papillary thyroid cancer or colon cancer, which have more encouraging rates of early detection and treatment. 11.1.1.2.  Newly Diagnosed Cancer Patients Given the increasing relevance of germline test results in terms of options for cancer treatment and surgery, it is becoming more common for genetic counselors to meet with newly diagnosed cancer patients. Individuals or parents of children who have received new diagnoses of cancer are dealing with an acute crisis situation in which they are likely experiencing fear and anxiety regarding the upcoming treatment plan and the ultimate prognosis. In the midst of this often “deer in the headlights” fear, the newly diagnosed cancer patients are meeting with their oncology team whom they may not yet trust, may be learning a new medicalized vocabulary, and may be called upon to make a host of decisions right away. Thus, patients may seem numb, overwhelmed, or in action mode (and deliberately emotionally shut down). Alternatively, patients may feel optimistic about their initial prognosis, and/or, if the diagnostic odyssey took a while, even relieved to have a definitive diagnosis. 11.1.1.3.  Cancer Patients in Active Treatment Cancer patients who are in active treatment are in a new state of normal, where they are often juggling multiple medical appointments and dealing with potential side effects from treatment as well as the logistics of managing their other daily responsibilities of career and family. Patients may feel optimistic and focused on their action plan or they may feel increasingly tired from the ongoing grind of treatment. They may be experiencing major mood swings depending on how they are feeling physically, whether they are experiencing any adverse side effects, and/or based on the results of their most recent set of lab results or imaging studies. Major issues that cancer patients often deal with during treatment are: ••

••

Physical symptoms—­Cancer treatments, especially chemotherapy and radiation therapy, can cause a variety of side effects, including fatigue, pain, nausea, weakness, and infections. The tumor itself may also be causing or exacerbating physical symptoms. For example, most leukemia patients complain about chronic fatigue during and after treatment. Studies have shown that patients with more physical problems (termed a higher symptom burden) have lower rates of “normal” (defined by the person) day-­to-­day functioning and higher rates of distress and depression. Activity limitations—­Cancer patients may be spending hours in the hospital each week or month receiving medical or radiation treatments and evaluations from different members of the oncology team. This level of time commitment can substantially interfere with other work and leisure activities, such as hobbies, exercising, or outings with friends.

432

••

Counseling About Cancer

Even sedentary activities, such as reading or watching television, can be negatively impacted by physical discomfort and mental fogginess. This can also contribute to a lower quality of life and higher rates of depression. Social isolation—­Cancer patients often speak about having reduced interactions with family and friends despite the increased use of social media to stay connected. Patients may withdraw from social interactions due to physical symptoms, concerns about infection risk, or because they prefer not to share information about their cancer diagnosis and treatment. Social isolation, whether necessary or voluntary, can increase sadness and loneliness and is a major factor in a lower quality of life for patients with cancer. This is especially true for adolescents and young adults being treated for cancer.

11.1.1.4.  Cancer Patients in Remission Cancer patients who have completed treatment and achieved remission may continue to deal with high symptom burden from the tumor or the treatment, including digestive problems, cardiovascular issues, and chronic fatigue or pain. There may be symptoms that are more prevalent in certain cancers, such as lymphedema with breast cancer patients, or with certain treatments, such as loss of mental sharpness (“chemobrain”) with intensive chemotherapy. Patients may become increasingly distressed or depressed when their symptoms do not resolve following treatment or surgery, or when new issues arise because of the treatments they have undergone. It is not uncommon for cancer patients to have one or more lingering physical symptoms even 5 years post-­treatment. Prior cancer patients may also be dealing with the emotional aftermath of the cancer diagnosis and processing feelings about the cancer experiences long after the treatment has ended. Understandably, worries about recurrence or metastatic disease are often prevalent, especially if the cancer occurred recently. For some patients, the shift from active treatment to “watchful waiting” can trigger increased cancer worry. Some patients achieve remission and are essentially cured of their cancers, while others deal with episodes of recurrent disease or secondary cancers Although cancer can be initially viewed as an acute illness, over time it can more closely resemble a chronic condition. Individuals also often speak about shifted priorities or other life changes that this type of experience has brought, including job or relationship changes, having a new purpose in life with advocacy or volunteer work, and being less focused on minor annoyances or squabbles. 11.1.1.5.  Cancer Patients with Metastatic Disease The intent of treatment changes from curative to palliative for patients with metastatic cancer. Patients may actively seek out other treatment options, including experimental drugs and protocols. Patients (or their partners and relatives) may disagree with the oncology team who recommend stopping treatments that are no longer working or have no further treatment options to suggest. These types of disagreements may create dissension or miscommunication between the oncology team and the patient and their caregivers and is a commonly requested issue for hospital ethics committees to mediate. Metastatic cancer patients are typically dealing with a high symptom burden and, understandably, they may be depressed and (realistically)

11. Psychosocial Aspects of Cancer Genetic Counseling

433

pessimistic about their prognosis. Common fears among metastatic cancer patients include fears about pain, being a burden on their partners and family, and the dying process. 11.1.2.  Mental Health Status Patients who have prior histories of mental health disorders or episodes are at higher risk for having increased depression or anxiety due to a cancer diagnosis and perhaps also for being at increased risk of cancer. Genetic counselors should be prepared to deal with patients who have mental health challenges and should become comfortable with discussing these issues directly with patients when appropriate. 11.1.2.1.  Depressive Disorders The National Institutes of Mental Health (NIMH) estimates that almost 7% of the adult population in the United States have had at least one major depressive episode with major impairment. This translates to over 10 million individuals age 18 years or older who have dealt with depression. The risk of depression is higher among female adults than male adults; however, women are also more likely to seek mental health support, so the prevalence of depression in men may be underestimated. The highest rates of depression in US adults were reported among young adults aged 18–25 years and adults reporting two races/ethnicities. The main symptom of depression is a feeling of despondency that is more serious (and typically lasts longer) than the occasional bouts of sadness that most people experience at some point in their lives. Clinical depression often involves having a depressed mood for most of the day, a loss of interest in most activities, interrupted eating and sleep patterns, and thoughts of suicide. See Table 11.2 for the list of the symptoms of clinical depression. Clinical depression may be situational (acute) or chronic and is often seen in conjunction with attention deficit hyperactivity disorder (ADHD), anxiety, eating disorders, sleep disorders, and substance abuse. Clinical depression is typically treated with a combination of antidepressants and psychotherapy.

TABLE 11.2.  Clinical Diagnosis of Depression (the Presence of Five or More Symptoms) Depressed mood most of the day Loss of interest in almost all activities Significant weight loss or decrease in appetite Insomnia or hypersomnia Feelings of restlessness Fatigue or loss of energy Feeling worthless or guilty (sometimes for no good reason) Trouble thinking or concentrating Recurring thoughts of death or of committing suicide (without a specific plan) Source: American Psychiatric Association (2022).

434

Counseling About Cancer

11.1.2.2.  Anxiety Disorders The NIMH estimates that almost 20% of adults in the United States have an anxiety disorder, with around half of the cases being in the moderate or severe range. About one-­third of US adults have experienced some type of anxiety disorder at least once over their lifetime. Anxiety disorders are more common in women than men. Anxiety disorders are correlated with depression, other mental health conditions, childhood shyness, and exposure to stressful and negative events in early childhood or adulthood. Excessive anxiety can have a paralyzing effect on patients, leading to a cancellation of medical appointments, an avoidance of screening practices, and/or a denial of symptoms. Severe anxiety may be manifested in a number of ways, including insomnia, hypochondria, phobias, eating disorders, or a general withdrawal from daily activities. For cancer patients or survivors, anxiety can exacerbate physical symptoms and depression and can lower their quality of life. For unaffected high-­risk patients, anxiety disorders can cause them to have pervasive and constant worries about cancer to the point that these thoughts seem to take over their lives. There are many different types of anxiety disorders, with four of the main types described below: ••

••

Generalized anxiety disorder—­Individuals with generalized anxiety disorder (GAD) exhibit excessive anxiety or worry regarding their heath, work, social interactions, and/ or every day routine situations for at least 6 months. See Table 11.3 for the major symptoms of GAD. Discussions about cancer risk may trigger excessive worry among individuals with GAD regarding their fears about developing cancer or any possible cancer warning signs they may be experiencing. Phobia-­related disorders—­Individuals with phobia-­related disorders have an intense fear of (or aversion to) specific objects or situations. The most common phobias are flying, heights, specific animals (like spiders), receiving injections, and blood. Many people have a fear of donating blood or even seeing blood, which may play into their decision not to have a genetic blood test. (Thankfully, saliva testing is typically an alternative option.) Fear of enclosed spaces (claustrophobia) may also make it difficult for at-­risk individuals to undergo MRI exams.

TABLE 11.3.  Symptoms of Generalized Anxiety Disorder A diagnosis of generalized anxiety disorder is made if one or more of the following symptoms are present for most days for at least 6 months: Feeling restless, wound up, or on edge Being easily fatigued Having difficulty concentrating; mind going blank Being irritable Having muscle tension Difficulty controlling feelings of worry Having sleep problem such as difficulty falling or staying asleep, restlessness, or unsatisfying sleep Source: Adapted from National Institutes of Mental Health (NIMH), https://www.ncbi.nlm.nih.gov/books/NBK441870/.

435

11. Psychosocial Aspects of Cancer Genetic Counseling

••

••

Social anxiety disorders—­Individuals with social anxiety disorder have an intense fear of social interactions or performance situations and may have exaggerated worries about being viewed negatively by others. Due to these worries, people with social anxiety tend to avoid social situations and any type of public speaking (even in front of a small group). This may inhibit individuals from asking questions or sharing their true feelings about testing or cancer screening because they want to avoid being “judged” by their genetic counselors, referring medical providers, or even other family members. Panic disorders—­Individuals who have panic disorders experience sudden periods of intense fear termed panic attacks, which can occur unexpectedly or are brought on by a specific trigger. Symptoms of panic attacks include heart palpitations, an accelerated heart rate, sweating, trembling or shaking, sensations of shortness of breath, and feelings of impending doom. Individuals with panic disorders may avoid hospitals or cancer genetics programs in particular because of their fears about bringing on a panic episode.

11.1.2.3.  Bipolar Disease NIMH estimates that almost 3% of adults in the United States have bipolar disease, which translates to almost 6 million people. Bipolar disease is also known as manic-­depressive illness. Individuals with bipolar disease have major shifts in mood, energy, and activity level, from being elated and energized (manic episodes) to having sadness and low energy (depressive episodes). See Table 11.4 for common symptoms of bipolar disease. The depressive episodes typically last about 2  weeks and the manic episodes can last from several days to several weeks. This cycle can occur rarely to several times a year. Other conditions that can be seen in conjunction with bipolar disease include thyroid disease, obesity, anxiety disorders, and migraines. TABLE 11.4.  Common Symptoms Experienced by Individuals with Bipolar Disease (Manic Depression) Symptoms of Mania Feeling very “up” or elated Having a lot of energy Having increased activity levels Feeling jumpy or wired Having trouble sleeping Talking really fast about a lot of different things Being agitated, irritable, or touchy Feeling like their thoughts are going very fast Thinking they can do a lot of things at once Doing risky things such as excessive spending, unprotected sex, drug use

Symptoms of Depression Having decreased activity levels Having trouble sleeping (too little or too much) Feeling like they can’t enjoy anything Feeling worried and empty Having trouble concentrating Forgetting things a lot Eating too much or too little Feeling tired or slowed down Thinking about death or suicide

Source: Adapted from National Institutes of Mental Health (NIMH) (https://www.nimh.nih.gov/health/topics/ bipolar-­disorder).

436

Counseling About Cancer

There are three major types of bipolar disease: ••

••

••

Bipolar I disease—­Characterized by manic episodes that last at least 7 days or by manic symptoms that are so severe that immediate hospital care is required. Depressive episodes occur as well, typically lasting at least 2 weeks. Mixed episodes, in which a person experiences symptoms of both mania and depression, can also occur. Bipolar II disease—­Characterized by a pattern of depressive episodes and hypomanic episodes that are not as severe as the full-­blown manic episodes described above. Hypomania is a milder form of mania, but is also characterized by mood elevation, hyperactivity, and disinhibition. Individuals with bipolar II disease experience at least one major depressive episode that lasts 2 weeks and one hypomanic episode that lasts at least 4 days. Cyclothymia—­Characterized by a pattern of hypomania and depression with symptoms that are less severe and of shorter duration compared to the symptoms of bipolar I or II disease.

11.1.2.4.  Acute Stress Disorder/Post-­Traumatic Stress Disorder Individuals with acute stress disorder (ASD) or post-­traumatic stress disorder (PTSD) experience an intense fear response long after the traumatic event has occurred. Symptoms of ASD and PTSD include having flashbacks of the traumatic event, sleep disturbances, angry outbursts, and avoiding places or things that are reminders of the event. See Tables 11.5 and 11.6 for a more complete list of major symptoms of ASD and PTSD. These symptoms may interfere with relationships, work, and daily life tasks. In ASD, the symptoms are present for 3 days to 1 month, and in PTSD, the symptoms are present for 1 month or longer. TABLE 11.5.  Clinical Diagnosis of Acute Stress Disorder A diagnosis of ASD is made if more than nine symptoms are present for at least 3 days up to 1 month: Recurrent, involuntary, and intrusive distressing memories of the event Recurrent distressing dreams of the event Dissociative reactions (e.g., flashbacks) in which the patient feels as if the traumatic event is recurring Intense psychologic or physiologic distress when reminded of the event Persistent inability to experience positive emotions An altered sense of reality An inability to remember an important part of the traumatic event Efforts to avoid distressing memories, thoughts, or feelings associated with the event Efforts to avoid external reminders associated with the event Sleep disturbance Irritability or angry outbursts Hypervigilance Difficulty concentrating Exaggerated startle response Source: American Psychiatric Association (2022).

11. Psychosocial Aspects of Cancer Genetic Counseling

437

TABLE 11.6.  Clinical Diagnosis of Post-­Traumatic Stress Disorder (PTSD) An adult with PTSD must have all of the following four symptoms for at least 1 month: 1. At least one re-­experiencing symptom—­flashbacks, bad dreams, frightening thoughts 2. At least one avoidance symptom—­staying away from places, events, or objects that are reminders of the traumatic experience 3. At least two arousal and reactivity symptoms—­being easily startled, feeling tense or on edge, having difficulty sleeping, having angry outbursts 4. At least two cognition and mood symptoms—­trouble remembering key features of the traumatic event, negative thoughts about oneself or the world, distorted feelings like guilt or blame, loss of interest in enjoyable activities Source: Adapted from National Institutes of Mental Health (NIMH), https://www.nimh.nih.gov/health/topics/ post-­traumatic-­stress-­disorder-­ptsd

Many cancer patients and cancer survivors meet the criteria of ASD and the rate of ASD seems to be high—­if not higher—­among their support persons. PTSD can also be observed among individuals with hereditary cancer syndromes due to the possible number of cancer-­ related events and traumatic losses in the family. 11.1.2.5.  Borderline Personality Disorder Individuals with borderline personality disorder (BPD) typically experience intense episodes of anger, depression, and/or anxiety that can last for brief periods (hours) to days. Borderline personality disorder is characterized by an ongoing pattern of mood shifts and changes in how individuals perceive themselves and their role in the world, often stemming from a fear of abandonment. These shifts in mood and self-­image typically result in a pattern of impulsive actions and can also lead to paranoia, dissociation, and harm to themselves or others. Individuals with BPD tend to view circumstances and people in extremes, such as all bad or all good, and these opinions can change quickly from one extreme to the other. This can lead to very intense and unstable relationships with family, friends, and others, including medical providers. See Table 11.7 for symptoms of BPD. Some people with BPD experience only a few of these symptoms while others experience most of them. Individuals with BPD are more likely to have one or more relatives who also have BPD and/or have experienced a traumatic event during childhood, such as abuse, adversity, or abandonment. 11.1.3.  Family Context Genetic information affects patients and their families. A family can be defined as a social system consisting of a group of individuals who are bound together by blood, marital contract, social obligation, or sharing a household. Families typically include individuals who are of different generations and who interact with each other over time. A family may include people of different ethnic backgrounds, religious beliefs, financial means, sexual orientations, or political views. Broadening the definition of family even further, individuals and couples can currently become parents through the use of sperm donors, egg donors, frozen embryos, surrogate mothers, or adoption.

438

Counseling About Cancer

TABLE 11.7.  Diagnosis of Borderline Personality Disorder Borderline personality disorder is diagnosed if five or more of the following features are present, beginning by early adulthood: Fear of abandonment Unstable or changing relationships Unstable self-­image; struggles with identity or sense of self Impulsive or self-­damaging behaviors Suicidal behavior or self-­injury Varied or random mood swings Constant feelings of worthlessness or sadness Problems with anger, including frequent loss of temper or physical fights Stress-­related paranoia or loss of contact with reality Source: American Psychiatric Association (2022).

Certain family characteristics may help shape a patient’s attitudes and fears regarding health practices and may impact how (or whether) a genetic test result will be disseminated through the family. These family characteristics include family flexibility, attachment, roles, obligations, and stories. 11.1.3.1.  Family Flexibility Family flexibility refers to a family’s ability to cope and adapt to an adverse event, such as a cancer diagnosis. Families that are overly flexible or overly rigid may have difficulty handling stressful events and adapting to new circumstances. Families with a style that is overly flexible may have difficulty in adhering to the set schedule of diagnostic or treatment appointments and may be less likely to plan and assign family members to provide the support that is needed. Conversely, families with a style that is overly rigid may have difficulty accepting the changed circumstances and may either tend to ignore the situation or feel uncertain about what to do to help, resulting in nonaction. It may take time, but the hope is that individuals and their relatives learn how to cope and adapt to the cancer diagnosis or other stressful life events with the right balance of flexibility and rigidity that fits best with their specific family situation. 11.1.3.2.  Family Attachment All family relationships are not created equal; certain relationships may be especially close and loving, while others may be fraught with discord or drama. Adverse events, such as a cancer diagnosis, seems to bring some families closer together yet causes other families to fall further apart. This can be explained, at least partially, by the level of attachment that exists in the family prior to the adverse event. Families may be described as having either secure or insecure attachments. Attachment refers to how well or poorly a family handles emotions, supportiveness, conflict, and autonomy. For example, in some families, individuals who are being treated for cancer may feel well supported by their relatives when assistance is needed, while in other families, cancer patients may feel neglected or smothered by their relatives.

11. Psychosocial Aspects of Cancer Genetic Counseling

439

Family Roles. A person may have set roles within the family system: they may be the designated responsible one, the adventurous one, the peacemaker, or the clown. These roles may be entrenched in their relatives’ minds regardless of how the individuals have changed over the years. For example, to her relatives, the successful chief executive officer (CEO) of a marketing firm may still be viewed as the annoying little sister or the rebellious teenager. These roles (or the family perceptions of roles) may affect family relationships and communication patterns even throughout adulthood. For example, individuals who are the gatherers of genealogical or medical information in the family may be considered more reliable sources of information than the relatives who are viewed as attention seekers or hypochondriacs. Family Obligations. Most people feel some form of ethical responsibility to provide emotional, physical, or material support to members of their family. How much obligation individuals feel regarding their relatives depends on several factors, especially: ••

••

••

The degree of the relationship—­Individuals typically feel more obligated to offer support to members of their immediate family. Thus, they are likely feel more obligated to share their genetic test results with their siblings, parents, and children than with more distant relatives, such as their cousins. The extent of the favor—­Individuals are more likely to provide small measures of support than large gestures. For example, they are more likely to provide meals or rides to a family member undergoing cancer treatments than agreeing to donate a kidney or be a surrogate parent. Individuals who are willing to provide a large favor, such as donating an organ, are more likely to do so for close relatives, such as a child or a sibling. (Rare individuals who are willing to donate a kidney to strangers do exist, and clearly have a highly attuned ethical code of obligation.) The emotional closeness of the relationship—­Individuals are more likely to have a sense of obligation to relatives with whom they share close emotional ties and have frequent contact. Thus, people are more likely to grant favors, even large favors, to their beloved younger sister than to their estranged father with whom they have not been in contact for years.

Family Stories. Patients often relate stories about past events within the family. These family stories may recount a specific tragedy or triumph and may focus on a certain event or individual in the family. Even if the family stories are not helpful from a diagnostic standpoint, they may provide information about a patient’s motivations about seeking genetic counseling and attitudes about the effectiveness of cancer surveillance. The family stories may also shed light on the family’s level of attachment, flexibility, and pattern of communication, all of which may become important elements to consider in pre-­and post-­test counseling sessions. 11.1.4.  Ethnocultural/Social Context Other contextual information, including ethnicity, religion, gender, and age, may be important to consider when forming positive connections with individuals undergoing genetic counseling and testing. This type of information can help form a starting point; it is important

440

Counseling About Cancer

not to make sweeping generalizations about any specific groups of people. Yet it is also important not to ignore the fact that all of these aspects go into creating one’s views and attitudes and, therefore, may be useful in providers truly “seeing” the person in front of them. Pretending that differences do not exist is no more helpful than making faulty assumptions and generalizations. 11.1.4.1.  Ancestry and Culture of Origin Individuals’ attitudes and behaviors may be shaped by their culture of origin whether they identify strongly with this culture or have rejected it and may contribute to their views of health and illness. Individuals may have more of a family-­oriented focus than the individual-­oriented focus that is common in the United States. In addition, they may come from a culture where it is considered an act of kindness to not burden the patient with information about the cancer diagnosis or prognosis, and thus, their partner or family will make the majority of treatment decisions. This is in direct contrast to how medical care is conducted in the United States and the differences in valuing self-­autonomy versus the family as a unit can cause friction between providers and their patients and caregivers. Navigating the medical system from making an appointment to dealing with insurance issues may also be complex tasks for those who are not familiar with it. Individuals whose primary language differs from that of the counselor may also have difficulty understanding the nuances of the information, especially if they are not familiar with science or statistics. People of different cultures may perceive the risk information differently than what the counselor intended or they may be concerned about aspects of the risk information that the counselor has not addressed (and may not feel comfortable asking about). There may be a level of shame associated with a possible genetic finding that is not typically seen in Western cultures and thus may not be considered. For example, in certain ethnic groups, the finding of a specific genetic pathogenic variant may impact an individual’s status within their community and their marriageability. Lastly, there may be other important ancestral or cultural factors that influence the ways in which individuals interact with genetic counselors and how the information and testing options are perceived. For example, individuals within certain communities, such as Black Americans, may be understandably reluctant to trust medical providers or researchers based on their own experiences or prior experiences of other family and community members. 11.1.4.2. Religion/Spirituality Individuals may be strongly influenced by their religious or spiritual beliefs in terms of their attitudes about health, illness, reproduction, and death and dying. These beliefs and the sense of community from their church, temple, or mosque might form an important form of emotional and practical support for individuals who are dealing with cancer diagnoses in themselves or close family members. Religious tenets may also inform people’s opinions or attitudes regarding treatment protocols, genetic testing options, and/or reproductive choices such as preimplantation genetic diagnosis. Within the United States, participation in an organized religion has declined over recent years and many young adults do not identify with their parents’ religion,

11. Psychosocial Aspects of Cancer Genetic Counseling

441

which is in contrast to prior generations. However, outside of the United States, participation in organized religions remains common and even within the United States, religious and spiritual beliefs remain important to many people. 11.1.4.3. Gender/Sexuality Women are more likely to seek medical information, to maintain family history information, and to adhere to medical surveillance regimens when compared to men. In terms of cancer risk, men may be less likely to seek out testing for genes linked with breast and/or ovarian cancer because they may assume (often erroneously) that positive test results would not directly impact their care. According to the 2018 Gallup poll, 4.5% of individuals in the United States identify as lesbian, gay, bisexual, or transgender, with an increased percentage (8.2%) among individuals born between 1980 and 2000. Transgender individuals are people whose gender identity does not conform to the sex that they were assigned at birth. Individuals who identify as part of the lesbian, gay, bisexual, transgender, queer and/or questioning, intersex, asexual, two-­spirit, and others (LGBTQIA2S+) community may have had varying positive and negative experiences with medical care providers. Personal history questions and discussions about reproductive risks and sex-­specific cancer risks may be unintentionally distressing and they may be sensitive to the use of certain word choices that suggest a heteronormative bias. Individuals in the LGBTQIA2S+ community may have a strong support system, although some do not, and they may vary in terms of their level of contact with their family of origin. 11.1.4.4.  Age/Generational Cohort There are several ways in which the age of patients may influence their levels of cancer-­related worry. Individuals may have increased fears about cancer if they are nearing the age at which other relatives were diagnosed or if they are in the high-­risk age range for the syndrome being discussed. For example, the risk of eye malignancies in a child with an RB1 gene pathogenic variant is highest between the ages of birth and 5 years. Therefore, a discussion of hereditary retinoblastoma with parents of an infant is bound to be more anxiety provoking than a similar discussion with parents of a 12-­year-­old child. Individuals’ ages may also play a role in how well or poorly they handle adverse situations or process distressing risk information. Thus, teenagers may feel invulnerable despite their high estimated risks of cancer while people in their 50s may fail to be reassured by their average cancer risks, because they may have already faced health challenges and they may have relatives or friends who have had cancer. Attitudes and behaviors are also affected by one’s generational cohort. A generational cohort refers to individuals born within a particular 20-­to 30-­year span of time. It makes the case that individuals who experience similar historical experiences such as the Vietnam War and hippie movement (i.e., baby boomers), Watergate and personal computers (i.e., generation X), or September 11 terrorist attacks and the rise of social media and smartphones (i.e., millennials) will have shared values and attitudes compared to those born either before or after this time period. See Table 11.8 for some of the differences and similarities noted for the different generational cohorts.

442

Counseling About Cancer

TABLE 11.8.  Generational Cohorts: Differences in Values and Work Styles

Born: Descriptor: Defining events: Tech events: Family structure: Values: Current #1 value: Work attitude: Work style: Adaptability: Technology: Views authority: Views career ladder: Employer loyalty:

Baby Boomers

Generation X

Millennials

1944–1964 Sandwich generation Vietnam war, Hippie movement Television Traditional family Idealistic Health Workaholic Competitive Okay with change Tech conservatives Wary of authority Entitled, “earned it”

1965–1979 Latchkey kids Cold war, government/ corporate scandals Personal computers Divorced family Reactive Family security Work/life balance Entrepreneurial Adaptable Computer savvy Self-­reliant Cynical, skeptical

1980–1994 Trophy generation 9/11, recession, student debt crisis Internet, smartphone Many family forms Civic-­minded Family security Multi-­taskers Serial entrepreneurs Thrives on change Tech/media experts Craves feedback Ignores; easily bored

Very loyal

Not loyal

“Contract” mindset

Source: Adapted from Gibson et al. (2009).

11.1.4.5.  Social Identity and Intersectionality Intersectionality is the recognition that social categorizations such as race, class, gender, or disability create additional, overlapping systems of discrimination or privilege. Kimberle Crenshaw coined the term “intersectionality” in 1989 and this framework has continued to gain momentum in understanding the additional pressures and disadvantages faced by individuals who identify with more than one marginalized group. It is important to be aware that certain situations, such as a cancer diagnosis, may lead to interactions that contain subtle (or not so subtle) triggers of racism, sexism, ageism, and so on.

11.2.  Patient Reactions, Coping Responses, and Risk Perception Individuals who have increased risks of cancer (or another cancer) may exhibit a range of emotional reactions and coping responses as they learn about their heightened cancer risks and options for genetic testing or cancer surveillance (see Table 11.9). This section provides examples of affective and cognitive reactions and coping responses that cancer genetic counselors may encounter in their interactions with patients. Patients can experience and display multiple even conflicting emotions throughout the genetic counseling and testing process. The extent to which these emotional responses impact the counseling interactions depends on several factors, including:

11. Psychosocial Aspects of Cancer Genetic Counseling

443

TABLE 11.9.  Anxiety-­Producing Aspects of Cancer Genetic Counseling Being referred to a cancer genetic counselor Setting up the cancer genetic counseling appointment Rehashing all the cancer diagnoses in the family Hearing about the increased risks of cancer Making decisions about genetic testing Awaiting the genetic test results Learning the genetic test results Considering how to tell relatives about the genetic test results Undergoing the cancer screening tests and awaiting the results

•• •• ••

The intensity of the patient’s emotions The extent to which the patient feels threatened The types of coping strategies that are triggered by the emotional reactions

11.2.1.  Possible Emotional Reactions During the Counseling Session When faced with a stressor or trigger, individuals may react with a variety of emotions. These emotional responses can be classified as affective responses or cognitive responses. 11.2.1.1.  Affective Responses Affective responses include unpleasant reactions of anger, anxiety, sadness, and guilt (including survivor guilt), as well as pleasant reactions of comfort, hope, empowerment, or relief. The genetic counseling interaction may elicit more than one emotional response, sometimes at the same time. Some patients openly display their emotions or are willing to talk about them when invited to do so by the genetic counselor. However, some patients may prefer not to discuss their emotional reactions, perhaps due to a desire for privacy or because feelings can be complicated. It is important to recognize that everything elicits some type of emotional response; this is what the brain is designed to do as it processes new information, especially if the information is complex, unexpected, or stress-­inducing. Two types of affective responses often encountered in cancer genetic counseling sessions are anticipated loss and grief. Anticipated loss—­The genetic counseling and testing discussions provide information about the current and future risks of cancer for individuals and their close relatives. The inherent uncertainty of these cancer risks may be deeply unsettling to patients, which can cause them to feel a loss of normalcy. Patients who experience a loss of normalcy may feel less healthy and safe within their bodies, less in control over their circumstances, less secure about their future, and more alone and different when they compare themselves to others. Individuals may also experience similar feelings of anticipated loss on behalf of their children and other close relatives.

444

Counseling About Cancer

Grief—­Although grief is most acute in the period of time directly following the loss of a loved one, it is not unusual for patients to become emotional when recounting family history information, even when the losses occurred long ago. As described by Terry Martin and Kenneth Doka, grief can be categorized as intuitive, instrumental, or, more commonly, a blend of the two. ••

••

Intuitive grief—­Characterized by feeling extreme sadness and pain, which manifests in outward expressions of grief, such as tears or frequent reminiscences. Instrumental grief—­Characterized by mentally separating from the loss, which manifests in a lack of outward expressions of grief. Individuals may set aside or avoid the grief in order to take care of things that need to be done or because of concerns that experiencing it would be emotionally overwhelming.

Individuals may also have had incomplete cycles of grieving for their relatives, especially if they have experienced several cancer-­related deaths in the family. Incomplete grieving is more likely to occur in certain situations, such as when a loss has occurred suddenly or unexpectedly. (See Table 11.10.) Unresolved grief reactions can, over time, lead to chronic sorrow, which causes feelings of sadness that overshadow all other activities. Individuals may also experience grief regarding their own situation, potentially grieving their prior good health following a diagnosis of cancer or grieving the loss of their ability to bear children following risk-­ reducing oophorectomy. 11.2.1.2.  Cognitive Reactions Cognitive responses include fears about dying, disfigurement, and loss of control and identity. These fears are common and understandable among patients with cancer or at increased risk of cancer and can be triggered by genetic counseling discussions about cancer risk and options for screening or risk reduction. The level of one’s fear, which often deals with some type of loss (or anticipated loss), can vary widely in terms of intensity and intrusiveness, which is the degree to which a particular fear intrudes on one’s thoughts during daily activities. Loss of control—­A cancer diagnosis typically causes a disruption to a person’s usual life. Suddenly their weekly schedule is filled with medical appointments and treatment regimens. This disruption may be short-­term and manageable or it may require a more long-­term shift in activities or expectations. Patients have described their cancer journey as a roller-­coaster ride TABLE 11.10.  Types of Losses That Are More Likely to Cause Incomplete Grieving The loss was sudden or unexpected. The loss was of a significant relative (e.g., parent, sibling, or child). The loss occurred when they were too young to process it. The loss has been compounded by other losses, which cause the grief process to begin again. The loss was of an individual with whom the client had emotional difficulties or some type of unfinished business. The loss was not discussed in the family either during or after the experience. Source: Gettig (2010), p. 112.

11. Psychosocial Aspects of Cancer Genetic Counseling

445

with many highs, lows, and unexpected curves. Individuals at high risk of cancer also have little to no control over whether or when a malignancy will occur and living long-­term with this type of uncertainty can cause feelings of distress and vulnerability. This in turn may cause lowered self-­esteem and an inability to cope with day-­to-­day activities.

11.2.2.  Possible Coping Strategies Individuals rely on coping strategies to help them deal with adverse (anxiety-­provoking) situations. Adverse situations will trigger specific emotional responses in people, which they handle by using learned coping strategies. Thus, genetic counseling patients’ responses that seem to occur out of the blue or make little sense may indicate that they are invoking the use of a coping strategy to manage their intense emotional reactions. Adverse situations can invoke mild, moderate, or severe levels of anxiety. For example, misplacing the car in a large shopping mall parking lot is mildly anxiety-­provoking while being involved in a major motor vehicle accident is extremely anxiety-­provoking. The level of anxiety invoked by a specific situation helps determine which of the person’s coping strategies will be utilized. Mild anxiety levels may actually enhance a person’s ability to handle adverse situations whereas severe anxiety levels tend to trigger feelings of overwhelming fear and stress, which are not conducive to thinking logically or clearly. Coping strategies, therefore, contain both an emotional aspect and a cognitive aspect. The emotional aspect of coping is responsible for assessing, containing, and reducing the distress caused by an anxiety-­provoking situation. Examples of emotion-­focused strategies include reaching out to a friend, listening to music, or working out at the gym. The cognitive aspect of coping is responsible for analyzing the situation, sorting through possible solutions, and deciding how best to resolve the situation. These cognitive-­focused strategies will only kick in once the person’s emotional distress is at a manageable level. Examples of cognitive-­focused strategies include seeking advice, doing research on the internet, and writing out possible plans. Individuals develop their cadre of coping strategies based on past experiences and the success (or failure) of previously tried coping strategies. Coping strategies are continually evolving and are an important part of normal functioning. It is worth noting that the success of a coping strategy is usually based on its ability to provide immediate emotional relief rather than its ability to resolve problems successfully. Strategies can be considered adaptive, maladaptive, or noncoping, depending on the circumstances. This section discusses three major types of coping strategies: adaptive cognitive, adaptive behavioral, and emotion focused. 11.2.2.1.  Adaptive Cognitive Coping Strategies Individuals who employ adaptive cognitive strategies (also termed appraisal-­focused strategies) seek to modify how they think about a situation or stressor. They may attempt to distance themselves from the issue or reject it outright (denial). Alternatively, they may work to shift their perspective regarding the situation in order to have a more positive outlook. This can include injecting humor into the situation or focusing on gratitude or “the bright side” of the situation.

446

Counseling About Cancer

11.2.2.2.  Adaptive Behavioral Coping Strategies Individuals who utilize adaptive behavioral strategies (also termed problem-­focused strategies) seek to deal with or eliminate the source of a stressful situation. They may actively seek out more information and be interested in considering the pros and cons of any courses of action that are discussed. Information seekers are interested in gaining a sense of control and mastery of the situation. This can include asking for scientific data and other resources, requesting second opinions from other providers, and asking for advice from a variety of individuals. 11.2.2.3.  Emotion-­Focused Coping Strategies Individuals who utilize emotion-­focused coping strategies are seeking ways to reduce or eliminate the levels of distress caused by a situation or problem. They may try calming strategies such as meditation, music, or relaxation techniques, or seek out places or things, including food and drink, that are comforting, or look for ways to release their pent-­up feelings about the situation, either privately, such as with journaling, or socially, by talking about it with friends, family, or a trained mental health provider. Identifying ways to reduce levels of distress related to ongoing stressful situations is important for learning how to accept and adapt to them. Conversely, these types of strategies may also allow individuals to avoid or distance themselves from the actual issues that need to be resolved, which in the short term may be useful, but may prove to be less useful over time.

11.3.  Strategies for Providing Psychosocial Counseling In a genetic counseling session, the psychosocial assessment actually begins with the initial greeting and contracting process. This initial conversation, as well as the review of family history information, allows counselors to not only develop a sense of the individual’s understanding of the genetic information presented, but also their emotional responses to the discussion. And, as has been discussed earlier in this chapter, it is the emotional reactions and responses that motivate subsequent health behaviors and adherence to cancer surveillance. This section discusses features to assess and questions to ask in terms of a patient’s psychosocial well-­being. Genetic counselors should become comfortable in performing a psychosocial assessment, although they can use their judgment as to whether to delve more deeply in this type of assessment or discussion as warranted. Psychosocial questions can be incorporated into a routine series of questions or asked only when concerns are raised about a specific individual’s emotional well-­being. 11.3.1.  Current Emotional Well-­Being Assessing an individual’s current emotional well-­being can involve reviewing the individual’s medical record and directly asking the patient one or more psychosocial questions. See Table 11.11.

11. Psychosocial Aspects of Cancer Genetic Counseling

447

TABLE 11.11.  Sample Questions Regarding Current Emotional Well-­Being Over the past few weeks: Have you had any problems sleeping? Have you had any change of appetite? Have you felt unusually anxious about anything? Have you felt sad or depressed? Are you crying more easily or more often? Are you having a harder time getting things done at home or at work? Are you thinking about cancer/cancer risk more often than usual? Are your cancer worries affecting your ability to focus on other things? Are your cancer worries affecting your relationships with your partner or family?

As examples, changes in eating and sleeping habits can be indicative of underlying mental health stressors. In addition, counselors can take note of the individual’s: ••

••

••

••

General appearance—­Two aspects of appearance to consider are grooming and motor activity (i.e., whether patients appear quiet or agitated). Patients who are poorly groomed may be feeling depressed or overwhelmed, while constant fidgeting or arms crossed over the chest may signal an increased level of anxiety or tension. Attention and concentration—­Throughout the session, counselors should pay attention to the patient’s level of attentiveness and concentration. Poor attentiveness and concentration may be indicators of increased distress or worry. Mood—­Mood is defined as a temporary state of mind or feeling. Moods tend to be less specific and less intense compared to emotions or affect and are less likely to be triggered or impacted by specific events. In psychology, a mood may be described as depressed, euphoric, or neutral. Affect—­Affect describes the experience of emotions or feelings, specifically how these emotions or feelings are expressed. (See Section  11.1.1 for examples of emotional responses.) In addition to registering the individual’s questions and answers, the counselor can note their appropriateness given the circumstances. For example, it is natural for individuals to become emotional as they relate stories about close relatives who died from cancer or when considering that their children could also have increased risks of cancer. However, individuals may burst into tears or an angry tirade at the outset of the visit—­both of which would warrant further exploration before proceeding with the session.

11.3.2.  Baseline Mental Health Issues It may be helpful for genetic counselors to ask general questions about the individual’s current mental health status and, if relevant, to ascertain whether the individual is currently meeting with a mental health professional, such as a therapist, psychologist, social worker, or psychiatrist. See Table  11.12. This line of questioning allows patients to share information about any

448

Counseling About Cancer

TABLE 11.12.  Sample Questions for Cancer Genetic Counselors to Ask About the Client’s Mental Health History Is there anything particularly stressful going on in your life right now? Have you ever been diagnosed with clinical depression or anxiety or another mental health disorder? Do you feel as though your mental health issues are being well managed at this time? Are you currently seeing a psychologist or therapist? Are you currently taking any medications for your mental health? Have you had any recent thoughts about harming yourself or harming others?

potentially relevant mental health issues as well as their attitudes toward psychological counseling. The individual’s answers may alert the counselor as to whether the risk discussion or genetic test results might trigger any adverse emotional sequelae. In addition, the counselor can begin to assess whether the individual might benefit from meeting with a mental health professional (and whether the person might be amenable to such a suggestion). Genetic counselors might also find it reassuring to learn that individuals who appear depressed or anxious are already in ongoing therapeutic relationships. Counselors should use their best judgment regarding when or whether to ask these types of questions and, naturally, all questions about an individual’s mental health issues should be asked with sensitivity and tact. 11.3.3.  Emotional Reactions and Coping Strategies Genetic counselors may wish to ask questions regarding how the individual is emotionally reacting to the discussion of topics (Table  11.13). Individuals who have been referred for cancer genetic counseling often have one or more close family members who have been diagnosed with (and perhaps died of) cancer. The individuals themselves may be short-­term or long-­term cancer survivors. Genetic counselors need to assess the significance of the personal and family history from a genetics standpoint, but should also recognize the potential psychological impact to the individual of recounting the information. In addition, the discussion of cancer risk for the individuals and their relatives can also be emotionally charged for a variety of reasons. Counselors should take note of how the individual seems to be responding to the information being presented so that they can determine whether to halt the discussion of a specific topic or to delve further into the issue that seemed to trigger the specific reaction. Individuals can also be asked to describe their own fears about cancer or potential barriers to genetic testing, screening, or disclosure of results to relatives.

TABLE 11.13.  Sample Questions to assess Reactions During the Counseling Session How are you feeling about the information we have covered so far? Is any of the information confusing or upsetting to you? Is the information I am telling you what you expected to hear? Is it better or worse than you expected? You seem to be concerned about something; did I say something that upset you? You seem to have a lot going on right now. Would it be better to continue this discussion at another time?

11. Psychosocial Aspects of Cancer Genetic Counseling

449

TABLE 11.14.  Sample Questions to Assess Coping Strategies Is it difficult or easy for you to stay optimistic or have a positive attitude? It’s not unusual to feel overwhelmed and helpless about having cancer/being at risk for cancer. How are you dealing with this situation? Some people feel they want to leave everything in their physicians’ hands. Is that how you feel? It sounds like you have been seeking a lot of information about your cancer risks. Has this helped you or do you think it makes you worry more? Are you the sort of person who tends to accept things as they are or do you question what goes on? Some people find it helps to avoid thinking about their risks of cancer. Are you that sort of person? When you are feeling worried, what do you usually do to feel better? What strategies seem to work the best for you when you are feeling sad or worried? Do you have people in your life that you can talk to about your worries about cancer?

Individuals will have developed a variety of ways to cope with their cancer diagnosis or cancer risk. (Refer to Section 11.1.2.) It may be helpful to ask individuals a few questions about their coping strategies (see Table 11.14). This can include asking questions about what individuals have done in the past when faced with a stressful situation (e.g., an illness or hospitalization) and exploring how well these strategies worked for them. An individual’s coping strategies may also become evident during the counseling session depending on how much anxiety is triggered by the discussion. For example, a minor fear reaction might cause patients to perseverate over a specific point or to make a joke to ease the tension, while more extreme fear might cause patients to lash out at the counselor or to shut down completely. 11.3.4.  Timing Issues and Major Life Transitions and Timing Issues It is important for genetic counselors to ask whether individuals are currently dealing with any unduly stressful or anxiety-­provoking issues (even if these issues have nothing to do with the cancer). It is important to remind individuals that they have the choice of whether to be tested at any particular time. While there are some situations where the genetic test results are required in a time-­sensitive manner, this is not typically the case. Individuals who are in the midst of an especially challenging or difficult time in their life may have fewer emotional reserves to help them cope with discussions of cancer risk or positive genetic test results. Major life transitions constitute challenging periods of life for most people and can include job changes, moves, and marriage or divorce. (See Table 11.15.) Learning about other current or impending life events can help counselors determine whether this is an optimal time for individuals to undergo genetic testing, and whether they might need any additional support services if the results are positive. In addition, individuals may not want to receive their genetic test results at certain times due to other events in their life, including, for example, college finals or a special vacation trip. It may also be helpful to talk through any possible cancer-­related anniversary dates and whether this time of year brings up reactions of grief or PTSD. Some individuals may become more emotional on the anniversary of the date they were diagnosed with cancer or when their mother died from cancer. Some individuals will be aware of the emotional impact of certain

450

Counseling About Cancer

TABLE 11.15.  Examples of Major Life Transitions Growing up and moving away from home Adjusting to college or the workplace Questioning sexual or gender identity Experiencing a career change or job loss Relocating the household Having major financial gain or loss Becoming married, divorced, or separated Being pregnant or having a new baby Parenting an infant, child, or adolescent Empty nesting Dealing with serious illness or disability of self or loved one Experiencing death or loss of a loved one Dealing with issues of aging and retirement Source: Drew Adelman, PhD, Adelman Psychological Services (https://drewadelman.com).

dates or times of the year while others will be much less conscious of it. Raising the option of deferring the test or receiving the results at least gives individuals the chance to consider whether they wish to defer testing or to seek additional support. 11.3.5.  Family Communication Although the genetic counseling visit focuses on the individual (proband), the risk assessment and genetic testing results will have relevance for other biological relatives. In fact, an argument can be made that the biological family co-­owns the genetic information. The complexities of family dynamics and relationships can impact individuals’ willingness to share the genetic information with their relatives as well as the relatives’ potential reactions to learning this information. Many individuals are willing, even eager, to share the genetic information with their family members. However, not infrequently, situations do arise in which individuals are not planning to disclose the genetic information with their potentially at-­risk relatives. It is important to distinguish between active and passive forms of nondisclosure. Active nondisclosure is when individuals refuse to pass on genetic information to certain relatives (or, less commonly, all relatives). In these situations, individuals will generally be open about why they are not willing or are not able to pass on the information to their relatives. In contrast, passive nondisclosure is when individuals state that they do plan to share the test results or risk information with their relatives but do not follow through with the disclosure. In these situations, individuals may agree with their providers as to the importance of informing their relatives, but over time they may have multiple reasons or excuses for why they have not done it yet. Individuals are more likely to share genetic information with their relatives if one or more of these criteria are met: •• ••

The individual and relative are closely related (i.e., first-­or second-­degree relatives). The individual feels emotionally close to the relative.

11. Psychosocial Aspects of Cancer Genetic Counseling

•• •• ••

451

The individual and relative live in the same geographic region. The individual is in frequent contact with the relative. The individual feels a sense of obligation to tell the relative.

Potential barriers to individuals’ disseminating genetic risk information, especially genetic test results, to their relatives include the following: ••

••

••

••

The family does not discuss cancer/cancer risk—­In some families, medical issues, including cancer, are openly discussed topics, whereas in others these topics are seldom mentioned. Individuals in families with open communication styles generally find it easier to disclose their genetic test results to their relatives compared to those in families who avoid discussions about cancer. A family’s communication style may also be influenced by other factors, including ethnicity, culture, and health beliefs. A generation ago, cancer was referred to as “the big C” as if just saying the word “cancer” was too distressing for people to hear. With over 18 million cancer survivors and an increasing number of people discussing their experiences in popular media, it is clear that there is less stigma in discussing cancer than was previously the case. However, some people will want to maintain their privacy regarding their own cancer diagnosis and/or test results. And if the individuals or their relatives have not disclosed their own cancer histories, then they may be unwilling to share (or hear) the information about a positive genetic test result. Individuals and their relatives may be geographically distant—­Individuals may have family members who live in different states or countries, making it unlikely they will be able to discuss the results in person. Individuals may have limited contact with their relatives and thus may feel awkward about reconnecting with their relatives to share the (potentially distressing) test results. Individuals may feel they need additional time to consider how best to share the information, especially if they live far away from their relatives and they have not been in recent contact. And lastly, given our mobile society, the individuals may not have current contact information for all of their relatives. The individual and their relatives may be emotionally distant—­Individuals will have different kinds of relationships with the various members of their family and this will impact how and with whom they share the genetic test results. An individual may feel reluctant to share the news if the only point of contact with the relative is at large family gatherings or the once-­a-­year holiday cards. Individuals may also have tense or challenging relationships with family members with whom they have frequent contact. Family rifts and estrangements may result in losing contact with one relative or with entire branches of the family. These family rifts may be short-­standing or of long duration and may be due to a specific precipitating event or simply because people drifted apart over time. Worry about the relatives’ reactions—­Individuals may feel overly protective regarding specific relatives and are reluctant to burden them with the genetic risk information or test results. This is especially true if certain relatives are perceived as being especially vulnerable or

452

••

••

••

••

Counseling About Cancer

challenging. This can be an issue that parents grapple with in regard to their children and also can be an issue regarding relatives who are themselves dealing with significant mental health issues. Or the individual may feel that this is an especially challenging time in the relative’s life due to a health scare, a job change, or an impending wedding or baby. Individuals may also worry that their relatives will be upset or angry with them and that disclosure of this information may be a “burden” to them as it could lead to increased surveillance or even a cancer diagnosis. Some of the individuals’ feelings of worry stem from internal feelings of guilt and shame; naturally, they did not “cause” this chain of events but they may feel that they are the ones who set it in motion. The age of the patient and/or the relative may create a barrier—­Individuals may feel protective (and even overly protective) of relatives who are very young or very old. They may feel that young children do not need to know they are at risk for carrying a tumor predisposition gene and thus they may plan to defer disclosure until the children reach a certain age, often adolescence or early adulthood. Individuals may also feel that elderly relatives, who are less likely to alter surveillance or undergo risk-­reducing surgery, would be potentially distressed by the news without the medical benefits to make it worth the distress. Making the decision to withhold disclosure from young children and/or elderly relatives may be both loving and wise. However, individuals should consider that keeping secrets (or being perceived as keeping secrets) can also be damaging to relationships in the long term. The nature of the individual’s relationship with their relatives may create a barrier—­Parents may be accustomed to dispensing information and advice to their children. However, the converse is often not the case; parents may be less willing to listen to information and advice dispensed by their children. Individuals may also be less willing to listen to information about cancer risk or a test result that comes from their irresponsible younger siblings or goofy uncles, or the distant cousins they barely know. Individuals are more likely to believe information that has come from reliable sources, and some of the “roles” or shared past history may impact their decisions about whether to share the information and how this information is likely to be received. The individual may not feel comfortable explaining the results—­Individuals may not know exactly how to explain the genetic risk information and their potentially complicated or unexpected test results. This can make it more challenging for individuals to know what to tell their relatives. And a less-­than-­clear explanation may make it harder for their relatives to understand the significance of the results and why they should be tested themselves. Individuals may also worry that their relatives will ask them difficult questions or will challenge the accuracy of the information, which could make the exchange embarrassing or exasperating. People do tend to put off conversations that are likely to be awkward or difficult. No contact with relatives due to adoption or other situations—­Cancer genetic counselors may also meet with individuals who have limited to no information about their biological relatives due to adoption, foster care, nonpaternity, or sperm or egg donors. The individuals may have known all their lives about their biological parentage, or the information may have been only recently discovered. Individuals may have no contact at all with their biological relatives or they may have reconnected with some or all of them.

11. Psychosocial Aspects of Cancer Genetic Counseling

453

However, these newly forged relationships may be quite tenuous or fragile. Thus, in some cases it may be difficult (or impossible) for individuals to share cancer risk information or genetic test results with their relatives. 11.3.6.  Level of Family Support and Communication (Using the CEGRM Tool) The colored eco-­genetic relationship map (CEGRM) is a psychosocial tool designed specifically for use during a genetic counseling session. The CEGRM is a blend of the genetic pedigree, a genogram, and an eco-­map. The purposes of the CEGRM are to increase understanding of the individuals’ social milieu, bolster their awareness and insight, foster their active participation and mutuality in the counseling session, encourage them to share stories about close friends and relatives, and encourage discussion of any outstanding emotional issues. Sample questions and instructions for creating a CEGRM are listed in Table  11.16. An example of a CEGRM can be found in Figure 11.1. To create a CEGRM, the counselor hands the pedigree to the patient along with packets of small stickers and instructs the individual to place specific small stickers near the relevant relatives listed on the pedigree. For example, the counselor will instruct the individual to put a small yellow circle sticker near each relative who provides them with emotional support. The CEGRM generates an illustrated view of the individual’s social networks, information exchange patterns, and sources of support within the family that can then be viewed and discussed during the genetic counseling session. This exercise can lead to “aha” moments from patients as they notice unexpected positive or negative patterns, and it can also give counselors a more complete picture of their patients. Creating a CEGRM takes an average of 30 minutes (the range is 13–60 minutes). Individuals seem to enjoy creating a CEGRM, viewing it as a welcome break from the informational portions of the sessions.

TABLE 11.16.  Sample Questions and Instructions for Creating a CEGRM Hand the client the copy of the pedigree along with some small stickers or colored pencils. Ask the individual a series of questions, such as: Which of your relatives provides you with tangible services? Can be monetary, child care, transportation, and so on. (Tell the individual to place a green circle near each person.) Which of your relatives provides you with emotional support? (Tell the individual to place a yellow circle near each person.) Which of your relatives do you have a spiritual connection with? (Tell the individual to place a red circle near each person.) Which of your relatives like to research or gather information about cancer and genetics? (Tell the individual to place a silver star near each person.) Which of your relatives likes to pass on information about cancer or genetics? (Tell the individual to place a green star near each person.) Which of your relatives tends to block information about cancer or genetics? (Tell the individual to place a red star near each person.) Source: Adapted from Peters et al. (2004).

454

Counseling About Cancer

Coworker

Friend

Best Friend

Legend Blue Circle = Information Exchange *Silver Star = Researcher/Gatherer of Cancer/Genetics Information Green Star = Disseminator of Cancer/Genetics Information Red Star = Blocks Cancer/Genetics Information Green Circle = Tangible Exchange Yellow Circle = Emotional Exchange *Red Circle = Spiritual Exchange

FIGURE  11.1.  An example of a colored eco-­genetic relationship map (CEGRM). The client is asked to place specific small stickers near the appropriate individuals on the pedigree. (The original reference contains a multicolored version of the genogram, which makes it easier to appreciate the final product.) *Domains added in 2005. Adapted from Hansford and Mulligan (2000).

11.4.  Strategies for Effective Psychosocial Genetic Counseling Cancer genetic counselors need to be able to balance the session’s informational goals with the counseling needs of their patients. This section describes some specific strategies for providing effective psychosocial cancer genetic counseling (see Table 11.17). The underlying psychological counseling theories that provide the foundation for the tips mentioned in this section are beyond the scope of this chapter; however, please see the references listed at the end of this chapter if this is a specific area of interest. 11.4.1.  Convey Empathy Empathy is a central tenet of genetic counseling. In order to convey empathy, the counselor needs to pay close attention to the individual’s verbal and nonverbal responses and must acknowledge these responses in a way that builds trust and rapport.

11. Psychosocial Aspects of Cancer Genetic Counseling

455

TABLE 11.17.  Strategies for Providing Effective Psychosocial Cancer Genetic Counseling Convey empathy Stay attuned to verbal and nonverbal cues Employ active listening Ask rather than assume Ascertain the rationale behind questions and reactions Allow clients to express emotions Respect client boundaries Monitor client reactions Have strategies to deal with resistant clients Remain professional Help client with decisions and actions Source: Djurdjinovic (2009).With permission of John Wiley & Sons.

It is important to recognize the difference between responding to an individual with sympathy versus with empathy. Sympathetic responses are based on the counselor’s perspective of the issue, whereas empathic responses are based on listening to the patient’s perspective of the issue. A sympathetic genetic counselor might think, “I bet she is nervous about her upcoming surgery because it is a major procedure with risks.” In contrast, an empathetic genetic counselor might think, “She seems nervous about her upcoming surgery because whenever she mentions it her voice trembles and then she quickly changes the subject.” An individual’s rejection of a counselor’s empathetic response can cause strain or awkwardness (hopefully temporarily) during the counseling interaction. This is termed an empathic break. If a person does not welcome a particular empathetic response from the counselor, it could be because: •• ••

••

••

The genetic counselor is off-­target in reading the individual’s emotional needs. The genetic counselor is on-­target in reading the individual’s emotional needs, but has not chosen the right empathetic response (for example, verbal versus nonverbal response). The genetic counselor is on-­target in reading the individual’s emotional needs, but it is too early in the counseling session for the individual to feel comfortable discussing emotional issues. The genetic counselor is on-­target, but the individual does not wish to explore the issue further.

Cancer genetic counselors also need to learn to assess the individual’s emotional reactions without experiencing empathic distress, that is, the phenomenon of taking on another person’s pain. Counselors who overly identify with an individual’s story may find themselves caught up in the emotions of the experience. This makes it difficult to see the individual as a separate person and may cause counselors to provide the individual with false reassurances that everything will be okay so as to reduce their own levels of distress.

456

Counseling About Cancer

11.4.2.  Stay Attuned to Verbal and Nonverbal Cues Throughout the session, the genetic counselor should pay close attention to the individual’s linguistic, paralinguistic, and nonverbal cues. Linguistic cues include the individual’s vocabulary and specific questions asked. One counseling technique suggests that counselors adopt the individual’s language choices and internally monitor the discussion’s level of sophistication. For example, describing the carcinogenic process in detail may confuse (or bore) individuals who have little interest in science as much as simplistic analogies will annoy those who have strong backgrounds in science. Paralinguistic cues refer to the volume, tone, and timing of the individual’s responses. To help promote empathy, counselors can subtly model the individual’s body position and can modulate the volume, tone, and timing of their responses. It is also important for counselors to pay attention to the nonverbal aspects of conversation, including the individual’s facial expressions, gestures, body position, and eye contact. In addition, nothing is more frustrating to individuals who are hard of hearing to have to keep asking the counselor to repeat what was just said. For individuals who are elderly or known to be hard of hearing, counselors should make sure to speak up and perhaps even slow down their speech a little. 11.4.3.  Employ Active Listening This technique lets individuals know that the counselor is listening to them and understands what they are is saying (or trying to say). Active listening techniques (listed in Table 11.18) can be as simple as nodding the head or making brief vocalizations (such as “uh huh”) to encourage the patient to continue talking. Genetic counselor responses should be sincere and honest; counselors should not pretend to understand a patient’s answer; rather, counselors should ask them to clarify their statements. Options include saying, “Help me to understand that last statement you made” or “Could you say more about that?” 11.4.4.  Ask Rather Than Assume Individuals will come to the genetic counseling session with different cancer experiences, backgrounds, and coping strategies. Asking questions about psychosocial issues should be a routine part of cancer counseling sessions (refer to Tables 11.13 and 11.14), although the extent to which TABLE 11.18.  Tools for Active and Empathic Listening Use minimal encouragers—­head nods, “uh huhs” Repeat key words Summarize what the client has said Use own words to repeat what client said React to nonverbal cues Listen for words that indicate the client’s emotions Adopt client’s word choices Mirror client’s tone and manner of speech Source: Veach (2003), pp. 53–55. With permission of Springer Nature.

11. Psychosocial Aspects of Cancer Genetic Counseling

457

these issues need to be explored will vary from person to person. Genetic counselors need to be careful not to questions that are emotionally laden, value laden, or could be viewed as confrontational. For example, asking the question, “So why didn’t you schedule your colonoscopy like we recommended?” is likely to lead to defensive responses (and perhaps anger). A better strategy is to say, “It looks like it is time to schedule your next colonoscopy. Let’s spend a few minutes talking about this.” This tactic paves the way for individuals to discuss any potential barriers to screening so that the counselor and patient can work together to resolve these concerns. Counselors can also summarize patient statements by saying, “This is what I am hearing you say, is this correct?” For individuals who search for words or do not answer right away, it is important to allow time for them to respond. Counselors should not try to fill the pause with more speech or try to complete individuals’ sentences for them. However, with overly chatty individuals, it may be necessary to interrupt or curtail the person’s speech in order to redirect and refocus the conversation. 11.4.5.  Ascertain the Rationale Behind Questions and Reactions Some individuals ask questions that seem trivial or irrelevant to the discussion at hand. In these situations, determining the rationale behind the questions might be more useful than continuing the discussion. Sometimes individuals do not feel comfortable asking direct questions so they may ask roundabout or seeming unrelated questions to try to obtain the answer they are seeking. Asking questions can be a way for individuals to express their feelings, indicate what is important to them, try to clarify a point of confusion, or redirect the conversation away from an emotionally painful topic. In order to know how best to respond, counselors may find it useful to determine what lies behind the question being asked. For example, a person with a BRCA1 pathogenic variant might ask “Is thyroid cancer linked with the BRCA1 gene?” The question could stem from general curiosity, or because a neighbor has recently been diagnosed with thyroid cancer, or because the individual was recently found to have multiple thyroid nodules. The counselor’s response may differ depending on the specific type of information the individual is hoping to obtain. 11.4.6.  Allow Patients to Express Emotions Cancer genetic counselors should encourage individuals to express their emotions freely, whether grief, fear, frustration, or anger. For some individuals, the simple act of walking into a cancer clinic may invoke strong emotional reactions. Allowing individuals to verbalize their emotions may help them to reduce their fears and may also help the counselor to better understand the individual’s concerns and motivations. Some individuals are reluctant to share their emotions and counselors may need to listen carefully for clues about the individual’s emotions during the session. For example, an individual who denies any cancer-­related anxiety might end up sharing information about their feelings when recounting recent screening tests or accompanying their father to the hospital for his cancer treatments. In fact, individuals may end up verbalizing emotions that have been bottled up for a long time. Counselors may be tempted to change the subject if the conversation becomes too emotionally charged but a few moments of

458

Counseling About Cancer

empathetic silence may be more effective. Counselors can also reassure individuals that it is normal to experience a range of emotions during this process. Counselors should try to be careful not to open up intense emotional issues that are beyond their scope or the allotted time frame; however, if this occurs, then it may be important to stay with the individual until they or feeling more calm and “put back together” and/or have a plan in place to obtain assistance from a mental health provider or to make a referral.

11.4.7.  Respect Patient Boundaries Respecting and maintaining appropriate boundaries with individuals is an important part of a counselor–patient relationship. Some individuals will freely discuss their fears and anxieties, whereas others will be much less forthcoming. Some individuals may feel that a certain topic is too distressing or personal for them to discuss. By the use of verbal or nonverbal cues, individuals will generally indicate when their boundaries have been reached and it is important for counselors to respect these boundaries. Although the counselor may feel that it would be helpful for a person to “talk it out,” a wiser course of action is to shelve the discussion; genetic counselors can consider gently reintroducing the topic at a later time.

11.4.8.  Monitor Patient Reactions Throughout the interaction, cancer genetic counselors should continue to assess whether individuals are feeling overwhelmed, confused, or distressed by the discussion. For example, during the cancer risk assessment, individuals may ignore or refute the risk estimates given to them or they may concentrate on the facts and figures as a way of avoiding the emotional implications of risk. In addition, some individuals will pretend to understand (because it may be easier than admitting confusion) or will focus on the cancer risks of other relatives (because it may be less daunting than focusing on their own risks). Counselors should always try to ascertain the probable emotion driving the individual’s response or question in order to help guide them how best to proceed. Sometimes simply acknowledging the individual’s reaction is helpful in starting a productive dialogue about these issues.

11.4.9.  Have Strategies to Deal with Resistant Patients So-­called resistant patients behave in ways that prevent meaningful counselor–patient connections and can also derail the genetic counseling interaction. Resistant patients may manifest a variety of poor coping strategies to deal with their triggered feelings of distress (usually fear) and may appear apathetic, guarded, or openly hostile. Unless their high levels of distress are adequately dealt with, these individuals are unlikely to be able to attend to the informational part of the genetic counseling session. Genetic counselors will need to find ways to actively engage individuals who are withdrawn as well as to find ways to calm individuals who are agitated. It may be helpful to make a general statement that many individuals find the genetic counseling process to be anxiety-­producing or challenging. Gently acknowledging “the elephant in the room”

11. Psychosocial Aspects of Cancer Genetic Counseling

459

(i.e., the true underlying trigger) may be the first step toward a more meaningful connection or discussion. Another approach is for counselors to try and resolve (or at least acknowledge) the surface issue that has triggered the patient’s resistance. Although it is not always easy, counselors should do their best to remain empathetic and professional even with individuals who have unfriendly or hostile demeanors. 11.4.10.  Remain Professional Cancer genetic counselors should maintain an empathetic yet professional demeanor throughout the counseling interactions. Welling up with tears in response to a sad story is a very natural human emotion—­and cancer counseling is chock-­full of sad stories. However, crying in front of individuals may make it difficult for counselors to regain the focus of the discussion and is not generally helpful to individuals who already know how tragic their circumstances are. (But debriefing afterwards with empathetic colleagues is very helpful!) When dealing with angry patients, the genetic counselor’s first impulse might be to defend the source of the anger, whether it is aimed at program logistics, certain staff members, or the medical profession in general. However, this tactic will only further entangle the counselor in the conflict and could result in escalating anger on the part of the individual. A better counseling strategy is to allow the individual to vent for a short time, acknowledge the person’s anger (which is different from agreeing with it), and then shift the discussion back to the genetic counseling discussion. By adopting this approach, the individual is more likely to view the counselor as an ally rather than an adversary. When the individual has become calmer, the counselor may be able to explore the underlying emotions that might have triggered the outburst. Genetic counselors who notice that a particular patient interaction has become intense or strained (especially if it is not clear why this has occurred) might want to consider the possibility that the session has been impacted by one of the following psychological phenomena: ••

••

Transference—­Transference is a set of expectations and emotional responses that an individual brings to a provider–patient relationship, which are based not on the provider’s traits, but rather on the patient’s experiences with prior authority figures. Individuals who display positive transference may be overly affectionate or idolizing, while individuals who display negative transference may be mistrustful or hostile. Transference reactions often reveal unresolved conflicts from childhood due to abuse or trauma. However, some psychologists believe that all of us display transference reactions of sorts when entering into relationships. Genetic counselors need to recognize transference reactions, because they can interfere with building true rapport with individuals. Counselors should maintain a neutral professionalism to engage individuals appropriately and should also seek advice from mental health colleagues. Countertransference—­Genetic counselors who do not recognize that the individual is reacting to their (faulty) first impressions may begin to react to the individual’s actions or words in a way that actually reinforces the patient’s impressions. For example, in the

460

••

Counseling About Cancer

wake of an individual’s hostility due to transference (because the counselor reminds the person of his ex-­wife) a counselor might become defensive or abrupt in manner. This type of counselor response might be exactly how the individual’s ex-­wife used to react, hence reinforcing the individual’s first impression. By continuing this faulty dynamic, the counselor decreases the likelihood of forming a true connection with the individual. Projection—­A genetic counselor might say something that triggers a memory or emotion within an individual that then affects the person’s response (often to the puzzlement of the counselor). Thus, an individual who feels guilty about not staying in touch with relatives may become defensive when the counselor asks for basic family history information, or an individual whose relatives continually harp on the importance of cancer screening may snap at the counselor who mentions the screening guidelines. In both cases, it is the individuals’ past experiences (and their strong emotional reactions to these experiences) that have triggered their responses. Projection can also occur when the individual shares a story with which the genetic counselor strongly identifies. For example, an individual may talk about the stress of dealing with a child who has been diagnosed with ADHD and anxiety. A counselor, who has a child with similar issues, may unwittingly make responses that are personally relevant rather than formulating responses based on the individual’s own experiences or feelings.

11.4.11.  Help Patient with Decisions and Next Action Steps During the cancer counseling sessions, patients may be asked to consider certain actions or decisions. These can include decisions about whether to have genetic testing, how best to tell relatives about their increased cancer risks, or whether to pursue whole-­body MRI exams or risk-­reducing surgery. However, these conversations may touch upon psychosocial counseling issues, such as the fear engendered by the annual cancer screening tests, the stresses of a new cancer diagnosis, and how to talk about these issues to family members, especially children. To help individuals with the decision-­making process, cancer genetic counselors are encouraged to utilize the following strategies: •• •• ••

••

••

••

Allow the individual to talk through the issue without jumping to possible solutions. Ask how the individual has dealt with other difficult situations or decisions. Ask if the individual has one or more support person(s) to help make these types of decisions. Seek to understand the individual’s motivations and concerns that are likely to be driving the decision-­making process. Remind the individual that decisions rarely have to be made urgently; there is usually plenty of time to consider all of the ramifications and alternatives. Provide the individual with additional resources for information and support.

11. Psychosocial Aspects of Cancer Genetic Counseling

461

11.5.  Providing Additional Emotional Support For some patients, exploring psychosocial issues within the genetic counseling session will be sufficient. However, certain individuals would benefit from in-­depth psychological counseling that is beyond the scope of the genetic counselor. It may also be helpful for counselors to suggest other resources to patients and families, including web-­based and in-­person patient conferences and support organizations. Lastly, it is important for genetic counselors to maintain a practice of self-­care in order to reduce the risk of compassion fatigue and burnout. 11.5.1.  Making a Mental Health Referral Individuals may benefit from meeting with a mental health professional to discuss their reactions to positive genetic test results or to reduce their fears about being screened. Others may have reached a crisis point in their lives and could use short-­term counseling to help them through a difficult time. Still others may need counseling on a long-­term basis to help resolve issues surrounding the death of a family member, an underlying mental health disorder, or their general unhappiness about life. It is important for genetic counselors to recognize patients who are in need of additional psychological support or intervention. Genetic counselors should have a plan in place for how to assess an individual’s level of distress, how to determine whether the level of distress warrants immediate attention, and what to do if this is the case. It is also helpful to determine whether the individual is already receiving psychosocial support and may also be helpful to determine whether the distress is related to the cancer history or due to other issues. Psychological counseling services can be offered to individuals who appear to have high levels of anxiety regarding their cancer risks, have adopted poor coping responses to their risks, or seem to be having significant difficulties in other aspects of their lives. Table 11.19 lists examples of cancer genetic counseling patients who may benefit from a psychological referral. TABLE 11.19.  When to Make a Mental Health Referral The individual expresses feelings of hopelessness or suicidal ideation.* The individual has significant depression, anxiety, or another mood disorders and is not currently receiving mental health services. The individual indicates that the genetic counseling and testing process has caused an intense delayed grief reaction, exacerbated anxiety or depression, or triggered PTSD. The individual has a history of practicing maladaptive coping methods (alcohol, cutting, eating disorder) and is not currently receiving any mental health or support group services. The individual has an adverse and/or intense reaction upon learning the genetic test result. The individual does not seem to be adjusting to the genetic test result over time. The individual seems to need additional emotional support beyond what they currently have. The individual seems to be in an acute crisis situation due to one or more major life stressors. The individual has a history of practicing maladaptive coping methods (alcohol, cutting, eating disorder) and is not currently receiving any mental health or support group services.  Requires immediate response and assistance or referral

*

462

Counseling About Cancer

In general, genetic counselors should refer any patient who has emotional needs that are beyond what the counselor feels comfortable handling. Common motivations for seeking psychological counseling are listed in Table  11.20. Cancer genetic counselors should have an established system of referral in place so that they are not scrambling to identify a mental health provider when the need arises. Cancer genetic counselors are encouraged to establish alliances with mental health professionals who can review challenging cases, suggest strategies for dealing with fragile patients, and assist in the referral process. Ideally, the mental health professional will have experience dealing with families around chronic or acute illnesses and will possess fundamental knowledge about hereditary cancer syndromes or is willing to learn about them. Individuals may be surprised or offended by the suggestion that they consider further psychological counseling and they may even brush aside the suggestion the first time it is brought up. Genetic counselors need to handle these discussions with great sensitivity and tact. The actual referral process can consist of contacting a specific mental health provider and scheduling an appointment on behalf of the individual or by providing the individual with the provider’s telephone number and encouraging the individual to call and make an appointment. Major medical centers may have psychologists, psychiatrists, and social workers on staff, although this is not always the case. TABLE 11.20.  Reasons Why People Might Seek Therapy Depression or anxiety that does not go away in a reasonable time Panic attacks, phobias, or severe fears that interfere with daily living Personality disorders and mental illness Stress at work, home, or school that feels overwhelming Trouble getting to sleep or staying asleep Relationship and partner issues Eating disorders and weight management Trouble with drugs, alcohol, or other addictive behaviors Feeling chronically lonely or sad Chronic worry, preoccupation, confusion, or disorientation Excessive anger, frustration, or problems with physical abuse Self-­destructive or self-­defeating behaviors Suicidal thoughts and self-­harm Trouble making or keeping satisfying relationships Job and career issues Coping with life-­threatening illnesses Children’s educational and emotional problems Domestic violence, traumatic events, or posttraumatic stress disorder Issues arising due to sexuality, sexual identity, or sexual orientation Dealing with difficult life issues: for example, death, divorce, birth of a child, and so on Family issues: for example, parent–child communication, problems with teenagers, and so on Life cycle challenges: for example, aging parents, changed sexual needs, retirement, and so on Personal growth: for example, career changes, dissatisfaction with life Source: Psychlinks Psychology.

11. Psychosocial Aspects of Cancer Genetic Counseling

463

Depending on the individual’s level of distress, cancer genetic counselors may want to set up a series of follow-­up phone calls or page a mental health provider at the hospital for consultation. Individuals who are in crisis (especially if suicidal) should be provided with immediate assistance. Individuals should be encouraged to go to the local hospital emergency room, which typically has the resources to assess and assist people in emotional crisis. Genetic counselors are also encouraged to alert the patient’s oncologist, primary health care provider, and/or emergency contact person with any serious concerns. When making a referral, genetic counselors should consider the type of mental health provider that would be most beneficial to the patient. There are many types of mental health providers, including psychiatrists, psychologists, family therapists, social workers, and grief counselors. Other important factors in making a mental health referral include the provider’s expertise and availability, geographic proximity, patient preferences, and the patient’s health insurance coverage. Also keep in mind that individuals may need to obtain referrals from their primary care physicians. If individuals are already in a therapeutic relationship, then it may be helpful for counselors to obtain permission to speak directly with their mental health providers. The genetic counselor can provide them with information about the hereditary cancer syndrome, including the associated risks of cancer and the implications to the individual and family. In turn, the mental health provider can tell the counselor about any additional emotional or family issues that might be relevant and can also suggest ways in which the genetic counselor might be of assistance.

11.5.2.  Cancer Syndrome Support Groups Individuals may also find it beneficial to speak with others who have the same inherited cancer syndrome. There may be great value in having cancer patients and at-­risk individuals speak to people who have “been there” themselves. Support groups, if available, can be a valuable way for people to connect with others in similar situations. Support group organizations exist for many of the hereditary cancer syndromes. These organizations can provide a variety of support and resources to families. Increasingly, people are turning to the internet for information and support. Many online patient and family support organizations may offer a detailed description of the genetic condition, a list of additional links and resources, personal accounts of individuals and families dealing with the condition, a forum to seek advice, answers, support, and encouragement, and, increasingly, the option of regional or national conferences. Even if individuals are not interested in joining a patient support organization or online chat forums, they may be interested in speaking to someone on a one-­to-­one basis. A number of individuals are willing to act as resources for people who are facing a new cancer diagnosis or positive genetic test result. Genetic counselors can facilitate these connections by recontacting prior patients and asking whether they would be willing to speak to a person who is facing similar issues. For example, an individual who tests positive for a CDH1 pathogenic variant may find it helpful to speak to someone who has had a risk-­reducing gastrectomy. Cancer genetic counselors can also consider hosting or speaking at a conference or lecture panel event geared towards people with a specific hereditary cancer syndrome. This is a way of

464

Counseling About Cancer

helping individuals meet with people and families who may be facing similar issues and providing them with updated medical and genetic information in a lecture or question-­and-­ answer format. 11.5.3.  Compassion Satisfaction and Compassion Fatigue Cancer genetic counselors should develop practices that increase compassion satisfaction and reduce the risk of compassion fatigue. Compassion satisfaction is the level of pleasure that providers derive from their work of assisting patients and families during traumatizing situations. Compassion fatigue is the physical and emotional exhaustion that can come from working with patients and families who are dealing with the emotional and physical trauma of cancer. Compassion fatigue is a form of secondary stress syndrome, which is caused by being exposed to other people’s traumatic events. Cancer genetic counselors are at risk for developing compassion fatigue due to their repeated interactions with individuals and families who are in crisis due to a cancer workup, diagnosis, treatment, or relapse. Sometimes referred to as the “cost of caring” since health care providers with the most empathy are at the highest risk of developing it, compassion fatigue can cause lower productivity, lower quality of care for patients, poor clinical judgment, and, ultimately, cynicism, hopelessness, and frustration (burnout) with the job and perhaps the profession. The symptoms of compassion fatigue vary from person to person and can consist of physical symptoms, such as muscle spasms or headaches, and/or emotional symptoms, such as temper flare-­ups at co-­workers or perseverating over less than ideal patient encounters. Table  11.21 ­provides a list of the symptoms suggestive of compassion fatigue.

TABLE 11.21.  Warning Signs of Compassion Fatigue Feeling overwhelmed, hopeless, or powerless when hearing of others’ suffering Feelings of anger, irritability, sadness, and anxiety Feeling detached from surroundings or from physical or emotional experience Feeling emotionally, psychologically, or physically exhausted, burned out, or numb Physical symptoms such as nausea, dizziness, headaches Reduced empathy Feeling hypersensitive or insensitive to stories we hear Limited tolerance for stress Self-­isolation and withdrawal Relationship conflict Feeling less efficient or productive at work Reduced pleasure in activities we used to enjoy Difficulty sleeping and nightmares Difficulty concentrating, focusing, or making decisions Self-­medicating and increase in substance use Sources: Adapted from Canadian Medical Association (CMA) physician wellness hub (www.cma.ca); Centre for Addiction and Mental Health (CAMH) (www.camh.ca).

11. Psychosocial Aspects of Cancer Genetic Counseling

465

For counselors interested in assessing their own levels of burnout, please see Table 11.22 for the self-­rated Professional QOL scale (also available in multiple languages at www.ProQOL. org). All health care providers can have a bad day (or a bad week); physical or emotional symptoms that are long-­standing and/or more intense than usual are more concerning for potential compassion fatigue. Cancer genetic counselors are encouraged to develop practices that increase the likelihood of compassion satisfaction and reduce the likelihood of compassion fatigue. This includes utilizing one or more of the following eight strategies (also see Table 11.23): 1. Practice self-­care including healthy habits and ways to reduce stress—­The practice of self-­care includes maintaining healthy habits in terms of diet, exercise, and sleep, as these have all been found to affect how individuals process and react to stressful situations. It is also helpful to identify strategies to reduce work-­related stress, such as meditation, breathing exercises, and spirituality-­based practices. 2. Set emotional boundaries and honor your emotional needs—­It is important to set emotional boundaries with patients and families that allow a connection to be made while honoring the fact that counselors are separate individuals with their own needs. If the encounters are draining or contentious, it may be that the family’s needs are beyond what the counselor can realistically provide. In these cases, the counselor can refer the family to other providers or resources (rather than trying to do everything themselves). Counselors who feel as though they are starting to struggle with compassion fatigue (refer to Tables 11.21 and 11.22) should take short mental breaks during the day, or even take a mental health day to decompress and recharge their emotional batteries. 3. Use positive coping strategies and boost resiliency—­Examples of positive coping strategies including taking mini-­breaks, reaching out to supportive friends or colleagues, using humor to lighten the mood, and journaling. Resiliency is the capacity to recover quickly from difficult situations. Over time, counselors will develop strategies that allow them to have productive and meaningful interactions with patients on a long clinic day even if the initial case was an especially poignant one. 4. Identify ways to debrief with colleagues—­One of the ways to combat compassion fatigue is to have the opportunity to talk through emotionally challenging cases with understanding colleagues. Although cancer genetic counselors may feel vulnerable talking about these cases or their reactions to these cases, it is extremely helpful to debrief after challenging cases. This type of debriefing can help bring closure and can assure counselors that others have had similar situations and that they are not being “judged,” it can also provide useful feedback to help counselors consider how they can handle similar situations in the future. This type of supportive debriefing can occur on an informal basis (“curbside consult”) or as part of a standing meeting or a genetic counselor supervision group. 5. Foster a supportive work environment—­It is important for all cancer genetic counselors to feel as though their efforts and hard work are being recognized. One of the hallmarks of burnout is for providers to feel as though none of their efforts matter and that the leadership does not value them as an employee and an individual. Ways to foster a

466

Counseling About Cancer

TABLE 11.22.  Compassion Satisfaction and Compassion Fatigue (PROQOL) Version 5 (2009) When you [help] people you have direct contact with their lives. As you may have found, your compassion for those you [help] can affect you in positive and negative ways. Below are some questions about your experiences, both positive and negative, as a [helper]. Consider each of the following questions about you and your current work situation. Select the number that honestly reflects how frequently you experienced these things in the last 30 days.

1 = Never _________1.  _________2.  _________3.  _________4.  _________5.  _________6.  _________7.  _________8.  _________9.  ________10.  ________11.  ________12.  ________13.  ________14.  ________15.  ________16.  ________17.  ________18.  ________19.  ________20.  ________21.  ________22.  ________23.  ________24.  ________25.  ________26.  ________27.  ________28.  ________29.  ________30. 

2 = Rarely

3 = Sometimes

4 = Often

5 = Very Often

I am happy. I am preoccupied with more than one person I [help]. I get satisfaction from being able to [help] people. I feel connected to others. I jump or am startled by unexpected sounds. I feel invigorated after working with those I [help]. I find it difficult to separate my personal life from my life as a [helper]. I am not as productive at work because I am losing sleep over traumatic experiences of a person I [help]. I think that I might have been affected by the traumatic stress of those I [help]. I feel trapped by my job as a [helper]. Because of my [helping], I have felt “on edge” about various things. I like my work as a [helper]. I feel depressed because of the traumatic experiences of the people I [help]. I feel as though I am experiencing the trauma of someone I have [helped]. I have beliefs that sustain me. I am pleased with how I am able to keep up with [helping] techniques and protocols. I am the person I always wanted to be. My work makes me feel satisfied. I feel worn out because of my work as a [helper]. I have happy thoughts and feelings about those I [help] and how I could help them. I feel overwhelmed because my case [work] load seems endless. I believe I can make a difference through my work. I avoid certain activities or situations because they remind me of frightening experiences of the people I [help]. I am proud of what I can do to [help]. As a result of my [helping], I have intrusive, frightening thoughts. I feel “bogged down” by the system. I have thoughts that I am a “success” as a [helper]. I can’t recall important parts of my work with trauma victims. I am a very caring person. I am happy that I chose to do this work.

Based on your responses, place your personal scores below. If you have any concerns, you should discuss them with a physical or mental health care professional. Continued

11. Psychosocial Aspects of Cancer Genetic Counseling

467

TABLE 11.22.  Compassion Satisfaction and Compassion Fatigue (PROQOL) Version 5 (2009)—Continued Compassion Satisfaction _____________ Compassion satisfaction is about the pleasure you derive from being able to do your work well. For example, you may feel like it is a pleasure to help others through your work. You may feel positively about your colleagues or your ability to contribute to the work setting or even the greater good of society. Higher scores on this scale represent a greater satisfaction related to your ability to be an effective caregiver in your job. If you are in the higher range, you probably derive a good deal of professional satisfaction from your position. If your scores are below 23, you may either find problems with your job, or there may be some other reason—­for example, you might derive your satisfaction from activities other than your job. (Alpha scale reliability 0.88) Burnout_____________ Most people have an intuitive idea of what burnout is. From the research perspective, burnout is one of the elements of compassion fatigue (CF). It is associated with feelings of hopelessness and difficulties in dealing with work or in doing your job effectively. These negative feelings usually have a gradual onset. They can reflect the feeling that your efforts make no difference, or they can be associated with a very high workload or a nonsupportive work environment. Higher scores on this scale mean that you are at higher risk for burnout. If your score is below 23, this probably reflects positive feelings about your ability to be effective in your work. If you score above 41, you may wish to think about what at work makes you feel like you are not effective in your position. Your score may reflect your mood; perhaps you were having a “bad day” or are in need of some time off. If the high score persists or if it is reflective of other worries, it may be a cause for concern. (Alpha scale reliability 0.75) Secondary Traumatic Stress_____________ The second component of compassion fatigue (CF) is secondary traumatic stress (STS). It is about your work-­related, secondary exposure to extremely or traumatically stressful events. Developing problems due to exposure to other’s trauma is somewhat rare but does happen to many people who care for those who have experienced extremely or traumatically stressful events. For example, you may repeatedly hear stories about the traumatic things that happen to other people, commonly called vicarious traumatization. If your work puts you directly in the path of danger, for example, field work in a war or area of civil violence, this is not secondary exposure; your exposure is primary. However, if you are exposed to others’ traumatic events as a result of your work, for example, as a therapist or an emergency worker, this is secondary exposure. The symptoms of STS are usually rapid in onset and associated with a particular event. They may include being afraid, having difficulty sleeping, having images of the upsetting event pop into your mind, or avoiding things that remind you of the event. If your score is above 41, you may want to take some time to think about what at work may be frightening to you or if there is some other reason for the elevated score. While higher scores do not mean that you do have a problem, they are an indication that you may want to examine how you feel about your work and your work environment. You may wish to discuss this with your supervisor, a colleague, or a health care professional. (Alpha scale reliability 0.81) Source: © B. Hudnall Stamm, 2009–2012. Professional Quality of Life: Compassion Satisfaction and Fatigue Version 5 (ProQOL). www.proqol.org.

468

Counseling About Cancer

TABLE 11.23.  Strategies to Avoid or Reduce Compassion Fatigue Practice self-­care, including healthy habits and ways to reduce stress Set emotional boundaries and honor your emotional needs Use positive coping strategies and boost resiliency Identify ways to debrief with colleagues Foster a supportive work environment Engage in outside hobbies and activities Cultivate healthy friendships outside of work Seek personal therapy Sources: Adapted from GoodTherapy and the Canadian Medical Association.

supportive work environment include building a supportive leadership, encouraging regular check-­ins with staff members, and creating opportunities to recognize and praise individual providers. 6. Engage in outside hobbies and activities—­Cancer genetic counselors work long, hard hours and frequently engage in research, teaching, and writing projects on top of their clinical responsibilities. Counselors are encouraged to engage in hobbies and activities outside of work as a way of maintaining a healthy work/life balance. Having a fulfilling life outside of work has been shown to decrease the risk of compassion fatigue and burnout. 7. Cultivate healthy friendships outside of work—­ Social support is a key component to emotional well-­being. Although it is good to have friendships among work colleagues, having friendships outside of work has been shown to be even more important in reducing the risk of compassion fatigue and burnout. Sometimes it is helpful to take a break from talking and thinking about work-­related situations or issues. 8. Seek personal therapy—­If the professional and/or personal stressors continue to rise, then genetic counselors should consider seeking some form of mental health therapy for themselves. Even short-­term counseling can help counselors to process their feelings in a safe environment and identify strategies to cope with the work challenges and build resiliency.

11.6.  Case Examples 11.6.1.  Case #1: Counseling About Reactions to a Positive CDH1 Result Case Presentation: The genetic counselor was asked to meet with Laura, age 60, who had a new diagnosis of invasive lobular carcinoma and was referred for genetic testing to help guide her surgical decisions. Laura reported that two of her relatives had died from breast cancer: her mother was diagnosed at age 65 and her maternal aunt was diagnosed at age 42. Laura had a sister who was cancer-­free at age 52 and had one daughter and two sons who were in their 30s. The results from the multigene panel test revealed a pathogenic variant in the CDH1 gene. The counselor disclosed the results to Laura over the phone and briefly provided some information

11. Psychosocial Aspects of Cancer Genetic Counseling

469

about the associated cancers. The patient seemed stunned to hear that the results were positive—­ she had previously had negative BRCA1 and BRCA2 testing and admitted that she assumed these results would also be negative. The counselor focused on the implications for her breast cancer surgery since this was the imminent decision to make but mentioned that risk-­reducing gastrectomy was often recommended. The patient did not ask any questions nor did she seem to have any noticeable reactions to the information, which the counselor attributed to the shock of the unexpected results. In addition to scheduling a follow-­up clinic visit with the program physician and counselor, the counselor said she would call her in a few days to check in with her. During this second call, the counselor repeated the information about the CDH1 result, but Laura’s only response was to say that she was not sure what to do about this information, yet she would not elaborate on this. The counselor could not determine whether Laura was confused or overwhelmed, or whether there was something else going on. The counselor explained that the next step was for Laura to come back into clinic to talk about the gene and the recommended action steps. The counselor also encouraged the patient to bring someone with her to this follow-­up appointment and mentioned the option of meeting with the program psychologist at this visit. Two months later, Laura came in by herself to meet with the genetic counselor and the program physician. She had declined an appointment with the program psychologist. Again at this visit, the patient seemed indecisive and unsure of the information and her next action steps. Once the physician’s visit ended, the counselor remained in the room with the patient. She asked how Laura was doing. Laura immediately spoke about her physical recovery from her recent breast cancer surgery (a double mastectomy). The counselor gently steered the conversation to ask about her adjustment to learning about the CDH1 result and Laura admitted to having a hard time. She became tearful when sharing that her daughter had immediately chosen to be tested and also carries the CDH1 pathogenic variant and that her sons were in the process of being tested. She talked about feeling enormous guilt about passing on the altered gene to her daughter and was scared that her sons would have it as well and would need to consider this “awful” stomach surgery. She also related a story about a close friend who had multiple health issues stemming from gastric bypass surgery, which seemed to be exacerbating her fears about having stomach surgery. Laura said that the main reason she didn’t want her family with her at this visit was because she did not want to break down in front of them. It was clear that she did not find it easy to show her emotions or to discuss her feelings. When asked, she said that in her family, no one talked about how they felt about things; “you just got on with it.” She was also afraid that her children must be blaming her and probably hate her for this. In between each statement, Laura apologized for her tears and her breakdown. The counselor kept assuring her it was okay and otherwise simply listened. Laura ended by saying that she wished that her children had not chosen to be tested and wondered aloud if it would have been better to have not told them. At this point, the counselor asked what Laura’s children had said to her about the result. Laura said that they were initially upset, but now all seemed eager to be tested and to find out what they should do to protect themselves. She admitted that she had not asked them straight out if they blamed her for the situation, because she was afraid of hearing their answers. The counselor then talked about other ways that Laura could look at this situation—­that actually she was being a good mother to share these results with her children and that the news could potentially help her

470

Counseling About Cancer

children avoid developing diffuse gastric cancer. The counselor also reminded Laura that she had no control over which genes she passed on to her children, and there was no control over which genes Laura inherited from her own parents. Follow-­Up: When Laura returned to clinic 3 months later to meet with a GI surgeon, the genetic counselor had a chance to touch base with her. Laura came in with her daughter, who had undergone risk-­reducing gastrectomy, and the pathology had revealed diffuse gastric cancer cells in the tissue. This information had galvanized the family into action. The patient’s sons had been tested—­one carried the pathogenic variant and the other did not. Laura had also informed her sister and cousins about the result. Laura had healed from her breast cancer surgery and had recently scheduled risk-­reducing gastrectomy. She appeared much calmer and engaged when discussing the surgery, the cancer risks, and the gene result. The counselor also reminded Laura of the option of meeting with the program psychologist and asked if she would like to make an appointment with her. Laura thought about it and said “maybe.” The genetic counselor saw that as a win. Case Discussion: Individuals can feel many strong emotions upon hearing that they carry a high-­penetrance cancer susceptibility gene. Since this patient was already dealing with a cancer diagnosis, it is not surprising that she felt emotionally overwhelmed by this added information, especially since it impacted not only herself but also her children. With the family history and her own history, the patient knew that her daughter had higher risks of breast cancer. However, the additional risk of gastric cancer, for herself and all three of her children, was understandably difficult to process. Feelings of fear and guilt may be overt or subconscious, but both can interfere with cognitive processing and decision making. For individuals who are not accustomed to sharing or managing their emotions, this can create real inner turmoil. Encouraging and listening to this patient express her sadness and fears about the result was an important counseling strategy for helping her to begin adjusting to and coping with her genetic test results.

11.6.2.  Case #2: Counseling About Reactions to a Positive TP53 Result Case Presentation: The genetic counselor met with Yolanda, a 12-­year-­old with osteosarcoma (femur) and her parents. The family was originally from Guatemala and had moved to the United States for about 2 years due to the father’s job in computer engineering. Yolanda’s parents were cancer-­free at age 40 and they had no other children. There was no history of cancer on the mother’s side of the family, but the father’s sister had died at age 33 from breast cancer, the father’s aunt had died at age 14 from a soft tissue sarcoma (hip), and the father’s father had died at age 54 after developing three cancer primaries in his 40s—­prostate cancer, sarcoma (knee), and colon cancer. The counselor discussed the option of TP53 testing and explained that the pattern of cancer in the family did meet criteria for classic Li-­Fraumeni syndrome, making it highly likely that Yolanda (and her father) would test positive for a TP53 pathogenic variant.

11. Psychosocial Aspects of Cancer Genetic Counseling

471

As the counselor gathered the family history information, she was struck by the father’s sad affect. He answered questions that were directed to him, but otherwise, he seemed quiet and withdrawn and stared at the floor. At first the counselor was concerned about a possible language barrier, but this did not seem to be an issue, so she began to wonder if the father had clinical depression or another issue. Yolanda, a curious and talkative pre-­teen, and her mother asked many questions about LFS and the possible impact the TP53 result would have for the patient and her father. Yolanda had already had surgery and was receiving adjuvant chemotherapy so it was not clear that her immediate treatment would change, so the counselor focused on future screening options, including annual whole-­body MRI, and when she was older, breast MRI and clinical breast exams. The genetic testing was ordered that day. When reviewing the case with Yolanda’s oncology team, they commented that it was the first time the patient’s father had come to one of her appointments. Not surprisingly, the panel test results revealed a pathogenic variant in the TP53 gene. As requested, the test results were conveyed to the patient’s mother. The patient’s father underwent testing for the single-­site TP53 pathogenic variant and was also tested positive for the TP53 pathogenic variant. (The family had been offered but declined multigene panel testing.) The family came back to the clinic for a more in-­depth discussion of these results and met with the program oncologist, nurse practitioner, and genetic counselor. Again, the patient’s father seemed sad and withdrawn and contributed very little to the discussion. At this visit, the counselor observed that Yolanda and her mother sat next to each other on the couch and that the mother often hugged or spoke to her daughter while the father sat on the other side of the room and seemed to have limited interactions with his family. The counselor began to wonder if there was some type of tension going on within the family or whether this was just another indicator of his sad affect. Following the genetics visits, Yolanda had a radiology appointment to obtain an MRI as part of her cancer care and the mother went with her. The counselor took the opportunity to speak privately with the patient’s father. She acknowledged that it must be difficult for him to talk about the increased cancer risks given all of the losses he had had in his family. The father did not seem to want to talk until the counselor asked about his sister. He talked about what a special person his sister had been and that they had been very close; in fact, she had been Yolanda’s godmother. He showed the counselor a picture of his sister holding baby Yolanda that he still carried in his wallet. He then began to cry when he talked about his sister’s diagnosis of breast cancer, explaining that by the time the cancer was found it was too late to do anything except palliative care and she had died 4 months later. He admitted that it was hard for him to accept that his daughter would recover from this cancer and then somewhat angrily asked what was the point of curing the sarcoma if she was just going to get breast cancer and die. It became much clearer to the counselor why it was so difficult for him to watch his daughter go through the cancer treatment process. Although his daughter had an excellent prognosis for a full recovery, this had not been this man’s experiences with cancer. Given the father’s level of emotional pain, the genetic counselor asked if he would be willing to meet with his daughter’s psychologist, who was in clinic that day. The father, who was still teary after these recollections, agreed, and the counselor paged the psychologist to come

472

Counseling About Cancer

join her. The patient, with prompts from the counselor, reiterated his concerns and story to the psychologist, who acknowledged the pain of the losses the father had experienced and that, given these experiences, it was understandable that he had a pessimistic view of his daughter’s prognosis (and his own future prognosis). To help the father think of his daughter beyond being a cancer patient, the counselor also praised his daughter’s engaging personality and smart questions and the father beamed with pride as he spoke about his daughter and how she was always good-­natured and smiling no matter what was going on. As the impromptu session wrapped up, the psychologist made arrangements to meet again at his daughter’s next visit and asked to refer him to a therapist in his local community where the father could receive more long-­standing services and support. The father agreed with these plans and seemed relieved following this discussion, as if a burden had been lifted from him. Lastly, the counselor helped facilitate an appointment in the adult clinic to discuss his own screening plan, which could also help with his cancer-­related anxieties. Follow-­Up: The next time the counselor saw the patient’s father, he was playing a video game with his daughter during her final infusion appointment while the mother looked on shaking her head and smiling. All of them looked happy and engaged as they joked around with each other. The family was thrilled that it was Yolanda’s final chemotherapy appointment and that the port was being removed the following week. The patient’s father spoke proudly of his daughter’s courage through the process and said they were looking forward to a summer without any doctor’s appointments. “For either of us,” chimed in his daughter. The father had undergone his baseline whole-­body MRI exam, which was negative, and as he hugged his daughter, he said he was feeling much more confident about the future—­whatever happened he knew they would be able to handle it together as a family. Case Discussion: As this case illustrates, sometimes it is not the proband who is in need of psychosocial counseling services, but the caregiver, in this case the patient’s father. This individual displayed isolating behaviors not because he did not care, but because his emotions were too intense. For families who have suffered significant cancer losses, a new cancer diagnosis and/or cancer treatments can trigger delayed grief responses and PTSD reactions. In this case, the father’s experiences with cancer led to a pessimistic view of surviving the cancer and he may have been subconsciously distancing himself from his daughter as a way to protect himself from anticipated loss. Providing the father a space in which to talk about his grief about his deceased sister and his fears about his daughter helped him recognize that he did feel better after sharing these fears and stories. Some people feel that bringing it all up again will make things worse; however, past traumas that are not dealt with can definitely make things worse, especially in a family with known LFS, which will likely bring additional dealings with cancer. It is also important for genetic counselors to recognize when the individual needs more support and help than they can provide and to know how to get the person the help that is needed (even if it is not always possible for this to happen as a same-­ day consult). Lastly, this level of emotional pain can take a toll on the counselor, and it is important for the counselor to practice self-­care and to talk over the case in a supervision group or with supportive colleagues.

11. Psychosocial Aspects of Cancer Genetic Counseling

473

11.7.  Discussion Questions Question 1: You are asked to meet with a patient who has three close relatives who have died from diffuse gastric cancer. As you discuss the possible test results and pros and cons of genetic testing, you notice that the patient seems upset about something you said. a. What would you suggest doing or saying next to check in with this patient? b. The patient tells you that talking about cancer is a trigger for anxiety. What are some suggestions for how to proceed with the genetic counseling discussion? Question 2: You are meeting with a patient who has tested positive for a ATM pathogenic variant. There is a family history of pancreatic cancer. You mention the importance of sharing this result with the patient’s two siblings. The patient says this will be challenging. a. The patient wants to know why it is important for the siblings to be told this information. How would you respond? b. The patient is looking for tips for how to disclose the information and what to say to the siblings. What suggestions and assistance could you provide?

11.8.  Further Reading Abittan B, Pachman S, Herman S, et al. Perception of breast cancer risk in over 11,000 patients during routine mammography exam. J Cancer Education. 2020 Aug; 35(4):782–787. American Psychiatric Association. Diagnostic and statistical manual of mental disorders, fifth ed., text rev. (DSM-­5-­TRTM). American Psychiatric Association Publishing, Washington, DC, 2022. Barnes H, Morris, E, Austin J. Trans-­inclusive genetic counseling services: Recommendations from members of the transgender and non-­binary community. J Genet Couns. 2020 Jun;29(3):423–434. Biesecker BB, Peters, KF, Resta, R. Psychological counseling theories. In Advanced Genetic Counseling: Theory and Practice. Oxford University Press. New York, 2019, 143–170. Canadian Medical Association (CMA). Compassion fatigue: signs, symptoms and how to cope. 2020 Dec 8. https://www.cma.ca/physician-­wellness-­hub/content/compassion-­fatigue Centre for Addiction and Mental Health (CAMH). Is there a cost to protecting, caring for and saving others? Beware of compassion fatigue. https://www.camh.ca/en/camh-­news-­and-­stories/is-­there-­a-­cost­to-­protecting-­caring-­for-­and-­saving-­others-­beware-­of-­compassion-­fatigue Doka KJ. Grief: the constant companion of illness. Anesthesiol Clin. 2006 Mar;24(1):205–212, x. doi: 10.1016/j.atc.2005.12.005. PMID: 16487903. Djurdjinovic L. Psychosocial counseling. In A Guide to Genetic Counseling. Uhlmann, WR, Schuette, JL, Yashar, BM (eds.). Wiley-­Blackwell, Hoboken, NJ, 2009, 133–175. Gettig B. Grieving: an inevitable journey. In Genetic Counseling Practice. LeRoy BS, McCarthy Veach, P, and Bartels, DM (eds.). Wiley-­Blackwell, Hoboken, NJ, 2010, 15–124. Gibson J, Greenwood RA, Murphy EF Jr. Generational differences in the workplace: personal values, behaviors, and popular beliefs. Journal of Diversity Management (JDM). 2009;4(3):1–8. https://doi. org/10.19030/jdm.v4i3.4959 GoodTherapy. The cost of caring: 10 ways to prevent compassion fatigue. 2020 March 26. https://www. goodtherapy.org/for-­p rofessionals/business-­m anagement/human-­r esources/article/ cost-­of-­caring-­10-­ways-­to-­prevent-­compassion-­fatigue

474

Counseling About Cancer

Hansford JR, Mulligan L. Multiple endocrine neoplasia type 2 and RET: from neoplasia to neurogenesis. J Medical Genet. 2000;37(11):817–827. National Institutes of Mental Health (NIMH). Bipolar disorder. Retrieved from https://www.nimh.nih. gov/health/topics/bipolar-­disorder National Institutes of Mental Health (NIMH). Generalized anxiety disorder. Retrieved from https://www. ncbi.nlm.nih.gov/books/NBK441870/ National Institutes of Mental Health (NIMH). Post-­traumatic stress disorder. Retrieved from https:// www.nimh.nih.gov/health/topics/post-­traumatic-­stress-­disorder-­ptsd Palmer Kelly E, McGee J, Obeng-Gyasi S, Herbert C, Azap R, Abbas A, Pawlik TM. Marginalized patient identities and the patient-physician relationship in the cancer care context: a systematic scoping review. Support Care Cancer. 2021 Dec;29(12):7195–7207. doi: 10.1007/s00520-021-06382-8. Epub 2021 Jul 1. PMID: 34195857. Patenaude AF. Emotional baggage, emotional distress, risk perception, and health belief and behaviors. In Genetic Testing for Cancer: Psychological Approaches for Helping Patients and Families. American Psychological Association, Washington, DC, 2004, 109–140. Peters JA, Kenen R, Giusti R, et al. Exploratory study of the feasibility and utility of the colored eco-­genetic relationship map (CEGRM) in women at high genetic risk of developing breast cancer. Am J Medical Genet. 2009;130A:258–264. Psychlinks Psychology and Mental Health Support Forum. Psychlinks Online. http://forum.psychlinks.ca Southwick SV, Esch R, Gasser R, et al. Racial and ethnic differences in genetic counseling experiences and outcomes in the United States: a systematic review. J Genet. Couns. 2020 Apr;29(2):147–165. Veach PM, et al. Listening to clients: primary empathy skills. In Facilitating the Genetic Counseling Process: A Practice Manual. Springer, NY, 2003, 51–72. Voorwinden JS, Jaspers JPC. (2016): Prognostic factors for distress after genetic testing for hereditary cancer. Jo Genet. Couns. 2016 Jun;25(3):495–503. Wu S, Singh-­Carlson S, Odell A, et al. Compassion fatigue, burnout and compassion satisfaction among oncology nurses in the United States and Canada. Oncol. Nurs. Forum. 2016 Jul 1:43(4):E161–E169.

CHAPTER

12 Ethical Issues in Cancer Genetic Counseling and Testing

What is needed to address the ethical issues is a full engagement of the professional as a person on every level: the rational and intellectual, indeed, but also the interpersonal awareness needed to understand the perspectives of others and to recognise the subtleties of meaning that may be expressed obliquely in communication, and the creative imagination to consider likely emotional responses in different scenarios and to generate a range of ­possible solutions. —­Angus J. Clarke and Carina Wallgren-­Pettersson (2019), p. 3

Cancer genetic counselors routinely discuss personal and family history information and ­genetic test results with patients, families, and providers who may have varying and even conflicting opinions, motivations, and degrees of interest. Thus, it is not surprising that genetic counselors frequently face issues of an ethical nature that do not have a straightforward ­solution. This chapter provides an overview of the major bioethical principles and tenets that are relevant to clinical cancer genetic counseling; it also provides strategies for approaching and resolving ethical dilemmas, and discusses the types of ethical dilemmas that cancer genetic counselors may encounter.

Counseling About Cancer: Strategies for Genetic Counseling, Fourth Edition. Katherine A. Schneider, Anu Chittenden, and Kristen Mahoney Shannon. © 2023 John Wiley & Sons Ltd. Published 2023 by John Wiley & Sons Ltd.

475

476

Counseling About Cancer

12.1.  Bioethical Principles and Framework 12.1.1.  Introduction to Ethics Ethical norms form the basic foundation of moral behavior and deal with universally acknowledged definitions of right and wrong. Examples include statements against stealing, lying, or killing another human being. Although these norms are, by definition, ones that are recognized across cultures, they are not absolute. There may be times when a person has to make a choice between upholding one principle at the sacrifice of another. For example, a person may deliberately tell a lie in order to prevent someone from committing a murder. Most people would agree that under these circumstances it would be acceptable to tell a lie because it saves a human life. However, is it acceptable for a person to tell a lie in order to prevent someone from stealing something? This becomes a less clear-­cut situation and the acceptability of lying or stealing will depend on the specific circumstances. Taken together, basic ethical principles form the common morality. (Although “morality” may conjure images of conservative religious organizations, in this context “moral” and “­ethical” are interchangeable terms.) The common morality is formally defined as the group of ethical norms that are accepted by all morally serious individuals regardless of their ethnic, cultural, or religious affiliations. Although individuals tend to believe that their ethical views are representative of the common morality, more often than not, their beliefs are shaped by their experiences, values, and communities. Individuals who are amoral deliberately reject all of the ethical ­principles, and individuals who are selectively moral follow some but not all of these principles. Using the tenets of the common morality as the foundation, a governing body then creates the rules, rights, and standards of conduct for its constituents or members. As an example, one broad ethical principle is that a person should not steal from others. A governing body will take this broad principle and create the following: ••

••

••

A statement of what is meant by the term “stealing,” which is specific to the organization, institution, or community A description of the various categories of stealing (e.g., shoplifting, copyright infringement, identity theft, or armed robbery) A detailed list of the probable consequences if caught stealing (e.g., immediate dismissal, fines, restitution, or jail time)

Therefore, the regulatory information provided by a governing body is much more detailed and germane to the individuals within a specific community compared to the overarching ­ethical principles. See Table 12.1 for brief definitions of principles, values, and other bioethical terms. The field of bioethics was born out of the recognition that medicine and other life sciences have a responsibility to conduct clinical care and research with both scientific integrity and humaneness. Unfortunately, the history of genetics research in the United States and elsewhere is rife with stories of mistreatment (or lack of treatment), abuses, omissions, and experimentation on unwitting participants. The establishment of informed consent, patient rights, and

12. Ethical Issues in Cancer Genetic Counseling and Testing

477

TABLE 12.1.  The Definition of Principles and Other Terms Used in Bioethics Principles—­Sources or guides for values, rules, duties, and rights Values—­Priorities that are thought to be important and desirable Rules—­Specific guidelines of what should (or should not) be done Ideals—­Goals to which a moral person aspires Duties—­Behaviors that are defined by a person’s professional or social role Virtues—­Morally and socially desirable characteristics Rights—­Justified claims that a person (or group) can make on others or on society Source: Schmerler (2009), p. 365/John Wiley & Sons.

i­ nstitutional review board oversight are all relatively recent layers of protection for patients and research participants. Bioethics helps ensure that there are policies and guidelines woven into all medical and relevant scientific disciplines. Given the complexity of issues, such as direct-­to-­consumer testing, conflict of interest, and the promises and perils of germline gene editing, it is more important than ever for bioethical and genetics leaders to work together to set medical and scientific guidelines and standards. 12.1.2.  Principle-­Based Bioethics Four principle-­based tenets form the foundation of bioethics; autonomy, nonmaleficence, beneficence, and justice. When confronted with bioethical dilemmas, providers in cancer genetic counseling and testing programs should apply and weigh these four principles, which are described at length in this section. 12.1.2.1. Autonomy The principle of autonomy states that a person has the right to choose or decline a specific activity and also has the right to privacy. The principle of autonomy includes four important concepts: ••

••

Capacity—­Individuals must be deemed capable of making autonomous decisions in order to be awarded the rights of decision making and privacy. Individuals are deemed competent if they have the capacity to think rationally and reflectively about an issue and then make a reasonable decision about it. Nonautonomous individuals include minor children, people with cognitive impairments, mental disability or illness, and prisoners. A person may also be deemed temporarily incompetent due to illness, substance abuse, or emotional distress. Freedom to decide—­Individuals who have the capacity to do so have the right to make their own decisions free from any controlling influences. These controlling influences can range from subtle manipulation to outright coercion. Coercion is defined as the intentional use of force or threats of harm to control another person. Other types of

478

Counseling About Cancer

i­nfluence include persuasion, which is an appeal to a person’s intellect and good sense; manipulation, which is an appeal to a person’s emotions; and bribery, which is the offer of some type of incentive, often financial. For example, a woman with colon polyposis may decide to have APC testing because her gastroenterologist explains that it is an important test to do (persuasion) or because her parents have pleaded with her to “look at your beautiful children and do it for their sake” (guilt trip manipulation), or because her brother has offered to pay all of her medical bills if she agrees to be tested (bribery). Even if the woman believes her relatives or her providers would be upset with her if she ultimately decides not to be tested, these types of influence do not rise to the level of coercion because she has likely not been threatened or harmed in any way. It should also be acknowledged that the importance of autonomy in medical decision making differs from culture to culture. In some cultures, medical decisions are typically made by the entire family or by key family decision-­makers. Western medicine places great emphasis on individual autonomy. However, in reality, one’s insurance coverage, financial means, and access to health care may also impact which medical options are available or feasible. •• Informed consent—­Informed consent is a competent person’s autonomous authorization of a clinical test, procedure, or intervention, and also participation in a research study. The main purpose of informed consent is to protect individuals from possible exploitation or harm. A consent discussion ensures that the person has received sufficient information to make an informed decision about the specific clinical care or research under ­consideration. Medical informed consent has five main elements: 1. The competence of the patient 2. The provider’s disclosure of the information to the patient 3. The patient’s understanding of the information 4. Voluntariness (absence of controlling influences) as the patient makes a decision 5. The patient’s authorization regarding the procedure or study Underdisclosure or nondisclosure of the risks, limitations, or implications of a procedure or study prevents an individual from making a well-­informed decision, thus restricting the ­person’s autonomy. ••

Privacy and confidentiality—­As in other medical specialties, the edicts of privacy and confidentiality are important in cancer genetics. Privacy is defined as a person’s right to allow or disallow access to their personal data or protected health information (PHI), which includes personal identifiers, medical record notes, and laboratory test results. A breach of privacy occurs when an unauthorized person has gained access to an individual’s personal information, such as when providers walk past a workstation c­ omputer screen that is displaying a patient’s PHI. Individuals who share sensitive or private information with their health care providers trust that this information will remain ­confidential. Confidentiality, a subset of privacy, refers to information that one person has disclosed to another with the understanding that the information will not be divulged to anyone else. Cancer genetics programs need to develop policies for how to handle sensitive information such as positive genetic test results, nonpaternity, or other family

12. Ethical Issues in Cancer Genetic Counseling and Testing

479

secrets. A breach of confidentiality occurs if the person to whom information was ­disclosed in confidence fails to protect the information and either inadvertently or deliberately discloses it to a third party without the initial person’s consent to do so. There are rare instances in which health care providers are allowed to breach patient confidentiality, one example being to prevent immediate, unavoidable harm in the client’s ­first-­degree relatives and only after attempts to elicit voluntary disclosure have failed. 12.1.2.2. Nonmaleficence The phrase in medicine primum non nocere (first, do no harm) summarizes the main principle of nonmaleficence. A maleficent act is one that causes physical, emotional, or material harm to a person. Health care providers, including genetic counselors, have the responsibility to avoid causing harm or injury to patients. Do no harm is an important concept in all stages of clinical oncology, from recommending treatments with the best chance of cure despite potential adverse side effects to recognizing when to compassionately stop treatment for patients with advanced disease. For every medical action, the potential adverse consequences (risks) should have equal or greater potential benefits. Medical providers need to provide informed consent documents and discussions that allow patients to make fully informed decisions regarding the potential risks, benefits, and consequences of a procedure, treatment, or study. Medical malpractice suits focus on a provider’s alleged negligence, which is defined as the intentional or unintentional infliction of harm (or risk of harm) to a patient. Malpractice suits brought against genetic counselors are rare, but have happened. 12.1.2.3. Beneficence Beneficent acts are ones that aid an individual or family either by improving their situation or by lowering their risks of an adverse event. Beneficence includes acts of kindness, charity, and heroism. In keeping with this principle, health care providers have an obligation to help patients or, at the least, to make sure things do not become worse for them. This means that genetic counselors, along with other health care providers, are obligated to provide patients with care that is both accurate and appropriate. Health care providers who take it upon themselves to make medical decisions on behalf of their patients are considered paternalistic, being comparable to a parent who makes unilateral decisions about the child’s welfare but is assumed to have the child’s best interests at heart. Since paternalism restricts a person’s autonomous choices, it should be avoided by genetic counselors and other health care providers. Although it is important for providers to share their expertise and even their opinions regarding the options, the actual decision making should be the patients’ responsibility or, at the least, should be a shared decision-­making process. 12.1.2.4. Justice The principle of justice is how bioethics gets translated into public policy. This includes dealing with issues such as equality, liberty, quality care, and quality control. Issues of justice generally apply to population groups or policies rather than to individual patients. Examples can include

480

Counseling About Cancer

genomic/genetic data sharing and ownership, the costs of genetic testing and gene-­targeted therapies, and access to reproductive technologies. Health care systems are expected to provide care that is equitable, appropriate, and of high quality regardless of a patient’s race, ethnicity, religion, gender, or sexual orientation. An injustice is defined as a wrongful act or omission that denies certain people their deserved benefits. The principle of justice also requires that burdens be distributed fairly; thus, policies should not worsen the plight of those who are already disadvantaged. For this reason, many hospital emergency rooms have policies that they will not turn away any indigent patients who are seriously ill or injured. The principle of justice also contains the following important points: ••

••

••

••

Equals should be treated equally—­Patients who are capable of autonomous decision making should be given sufficient information and similar options regarding genetic testing and cancer surveillance. This should be the case regardless of whether the patient speaks a different language or is in a difficult phase of treatment, or whether the discussion is done in person or remotely via the telephone or video conference. Autonomous individuals should also have freedom of choice regarding the providers or services they utilize. The authority to make and enforce rules of equitability—­Institutions and community groups typically have rules regarding issues of fairness and accessibility. In the creation of these rules, it is important to answer the following questions: •• Who has the authority to set up these rules? (e.g., elected officials, special appointed committee) •• How will these rules be set up? (e.g., open forum, closed committee meetings, group vote) •• Who will have the authority to enforce these rules? (board of directors, licensing board) •• How will these rules be enforced? (e.g., honor system, random checks) Distribution of rare resources—­Issues of fairness arise in the allocation of rare resources such as vaccines, platelets, or donated organs. The allocation of these rare resources may require an algorithm that takes into account several factors, including a person’s immediate need, overall prognosis, and risk of worsening without the resource. The allocation process must be a fair one for everyone but should also allow those who are most in need to have precedence. For this reason, the most seriously ill patients will jump to the top of an organ transplant list regardless of how long other (more stable) patients have been waiting for an organ donation. Distribution of risks—­When making decisions regarding population-­based screening programs or the approval of new drugs, policymakers will consider the potential risks of implementation versus the risks of nonimplementation. Potential costs and benefits are also important to consider.

12.1.3.  Virtue Ethics Virtue ethics focus on a person’s moral character that influences both viewpoints and behaviors. Moral character is a combination of personally held principles, obligations, ideals, beliefs, motives, and emotions. Individuals who behave in ethical ways do so because they have a strong

12. Ethical Issues in Cancer Genetic Counseling and Testing

481

inner moral code. Therefore, virtue ethics is about doing the right thing for the right reason. A person who performs a good deed in hopes of receiving a reward or recognition is not considered to be a morally virtuous person (even if the act is a moral one). Ordinary moral standards can be defined as the common standards that apply to everyone. In a way, these standards are the “moral minimum” that is acceptable to moral individuals. In contrast, extraordinary moral standards exemplify behavior and attitudes that are above and beyond the ordinary moral standard. People who display extraordinary moral behavior can (and should) be admired, but people who do not live up to this ideal of behavior should not be criticized for it. For example, a toddler slips and falls into a shallow wading pool as an adult is walking by. Rescuing this young child would be the expected action of any moral adult even if the adult cannot swim and does not know the child. Thus, it can be considered to be an ordinary act of virtue. In contrast, the average person visiting the seashore would not be expected to attempt a rescue of a surfer trapped in dangerous ocean currents, because of the danger involved in doing so. Anyone who does attempt to rescue the surfer would be praised for the act of heroism because the actions were above and beyond what is reasonably expected. Thus, it would be an extraordinary act of virtue. Of course, the definition of an extraordinary act depends in part on one’s professional expertise. If the person who witnessed the troubled surfer happened to be a certified lifeguard, then that person would likely be held to a higher standard of obligation in terms of mounting a rescue. Health care providers have certain professional obligations regarding the care of patients who are seeking their help regarding specific health-­related concerns. Patients who feel as though their health care providers did not take good care of them may lodge complaints with the hospital or may even take the providers to court to sue for damages. A provider who commits a so-­called honest mistake (i.e., an error that is clearly inadvertent or accidental and is therefore somewhat understandable given the set of circumstances) is more likely to be forgiven than a provider who commit errors that have resulted in personal gain or that demonstrate a pattern of deception. Medical mistakes often involve providers making errors in skill, technique, or judgment. Examples include failing to make the correct diagnosis, misinterpreting or ignoring key test  results, delaying diagnosis or treatment, or performing a medical procedure poorly. These types of mistakes are examples of normative errors because the provider is being ­measured against the generally accepted standards of care at that time. These standards of care are continually evolving, which is why providers need to stay up-­to-­date in their field of practice. Faulty procedures or policies (systems errors) can also culminate in medical errors, including misplaced orders, unflagged results, or protected health information (PHI) privacy incidents. Cancer genetics programs need to build in systems that ensure that patients do not “fall between the cracks” and that abnormal results will be flagged so that they can be dealt with in a timely manner. Focusing on inadequate built-­in safety systems rather than the specific incident or provider at fault may be the best approach for preventing similar errors in the future—­and makes it more likely that providers will own up to their medical errors. Health care providers are expected to be of “good moral character,” and this language continues to be used by licensing boards. As described in the following sections, there are several character traits that are relevant for cancer genetic counselors.

482

Counseling About Cancer

12.1.3.1. Compassion Counselors need to treat their patients with compassion, which means treating them as individuals, not cases. It also means that genetic counselors need to maintain a professional and empathetic manner with all patients, including those who are challenging or difficult. 12.1.3.2. Conscientiousness Genetic counselors should have a strong inner moral compass that allows them to determine whether certain courses of action are right or wrong. Counselors should also have an ability to self-­reflect on their prior actions or decisions. 12.1.3.3. Discernment Discernment has to do with recognizing and understanding the nuances of a specific situation. Discerning health care providers have excellent clinical skills and finely honed instincts based on their knowledge and expertise. For example, the discerning cancer counselor who is familiar with the genes and syndromes that could explain the patient’s history and is aware of the nuances and differences of the various tests and labs will be able to synthesize the information and present the best testing option(s) to the patient. In addition, the discerning counselor has the acumen to recognize whether a confused client would benefit from a review of the testing information or would be better served by exploring the emotional impact of the topic. 12.1.3.4. Fidelity Fidelity is about acting in good faith and keeping one’s promises. Cancer genetic counselors have certain professional obligations to their patients, who in turn trust that the counselors will meet these obligations. For example, genetic counselors who promise to follow up with patients within a certain time frame should make every effort to do so. Failure to do so can be considered a breach of fidelity, which can seriously impair the counselor–patient relationship. (Also see Section 12.1.3.8, on trustworthiness.) 12.1.3.5. Integrity Integrity is about making sound choices that are morally affirming and honorable. It is also about adhering to one’s personal moral code. This might involve reminding patients that participation in a clinical research study is voluntary or informing them of the availability of additional genetic testing options. A genetic counselor who has concerns about the level of care that individuals are receiving should also strive to advocate on their behalf by taking a lead role in getting state, federal, and private insurers to broaden their coverage of genetic testing and/or the hospitals or testing laboratories to increase their financial assistance programs. Advocacy can also include speaking up when certain marginalized populations do not seem to have the same access to care or services as other population groups. Individuals who act (or fail to act) in contrast to their inner moral values have likely compromised their integrity.

12. Ethical Issues in Cancer Genetic Counseling and Testing

483

12.1.3.6. Kindness Genetic counselors need to treat their patients with a kind, caring manner. This involves the use of empathy and compassion. Counselors should also demonstrate sensitivity and tact with their word choices and explanations so as to not unduly upset or offend their patients. 12.1.3.7. Respectfulness Genetic counselors should regard their patients, colleagues, and staff members with respect. Counselors may not always agree with their patients’ decisions and actions, but they should remain supportive and respectful toward their patients. Counselors should also be respectful and professional in their dealings with their colleagues and other staff members. 12.1.3.8. Trustworthiness Genetic counselors who are trustworthy have shown that they are worthy of the level of trust that others have placed on them. Patients trust that their genetic counselors will provide them with accurate information and will help facilitate the decision-­making process in a way that is supportive and nonjudgmental. Lack of trust is one of the main reasons patients switch to different medical care providers and why some providers feel compelled to practice defensive medicine. 12.1.3.9. Veracity Veracity has to do with telling the truth and taking care not to deceive people. It implies a pattern of communicating with honesty, integrity, and credibility. Genetic counselors have an obligation to disclose accurate, comprehensive, and timely information to their clients. 12.1.3.10. Wisdom Genetic counselors should have a solid foundation of knowledge regarding cancer genetic syndromes, available genetic tests, relevant counseling issues, and available referral sources. In addition to knowing the facts, counselors need to have the skills and knowledge to know how best to relay this information to patients. Genetic counselors who are wise also know when not to say something and also feel comfortable admitting when they do not know the answer to a patient’s question. 12.1.4.  Ethics of Caring The ethics of caring theory states that the moral actions of one person toward another person will differ depending on whether the two people are friends, relatives, strangers, or providers/ patients. In other words, it is the relationship of the two people that defines the level of care, trust, and obligation between them. Individuals who seek pre-­test cancer genetic counseling expect to receive information about their risk for having a cancer syndrome and discuss genetic testing

484

Counseling About Cancer

options and strategies. Therefore, cancer genetic counselors have an obligation to answer the client’s questions and provide information that is up-­to-­date and accurate. The ethics of caring theory grew out of observations from Carol Gilligan, a feminist researcher who suggested that there were gender differences in how children viewed ethical dilemmas. While boys tended to focus on aspects of justice and impartial rights, girls tended to focus on their sense of obligation and desire to care for others. This observation led others to study the importance of attachments and obligations in one’s moral actions. Proponents of caring theory also stress the importance of receptivity, responsiveness, and context when facing ethical decisions. Caring theorists encourage health care providers to have “attached attentiveness” (e.g., to be attentive, helpful, kind, and caring) to patients who are vulnerable and dependent. Therefore, it is important for genetic counselors to be attentive to their patients, but not to become overly involved (enmeshed). Caring theory also places emphasis on how actions are performed by health care providers—­for example, willingly, grudgingly, kindly, or carelessly—­and considers how a provider’s actions may promote or prevent a meaningful provider–client relationship.

12.2.  Putting Ethics into Practice Now that there is an understanding of basic bioethics, it is time to consider how best to apply these principles and ideas within clinical practice. This section describes professional guidelines that are relevant to cancer genetic counselors and discusses strategies for being an ethically minded cancer genetic counselor and for resolving ethical dilemmas.

12.2.1.  Standards of Conduct for Genetic Counselors Professional ethics (or morality) refers to the standards of conduct that are acknowledged by the members of a specific profession. Individuals who provide cancer genetic counseling are expected to follow the rules and guidelines set forth by the following groups or institutions presented in the succeeding sections. ••

••

Certification and licensing boards—­Within the United States, many states require licensure for genetic counselors, which means that counselors must follow the state’s mandated rules for continuing education and clinical competence in order to retain their license. This includes following the rules set forth by the American Board of Genetic Counseling (ABGC) regarding certification eligibility and renewal. Other countries have also ­developed (or are in the process of developing) similar governing boards for genetic counselors and genetic nurses. Professional genetic counseling organizations—­Cancer genetic counselors are expected to follow the ethical guidelines developed by the National Society of Genetic Counselors (NSGC), which is their main professional organization, especially for genetic counselors practicing within the United States. The NSGC has created a code of ethics that describes appropriate ethical conduct in dealings with clients as well as other colleagues.

12. Ethical Issues in Cancer Genetic Counseling and Testing

485

TABLE 12.2.  Excerpt from the National Society of Genetic Counselors (NSGC) Code of Ethics The counselor–client relationship is based on values of care and respect for the client’s autonomy, individuality, welfare, and freedom in clinical and research interactions. Therefore, genetic counselors work to: 1. Provide genetic counseling services to their clients within their scope of practice regardless of personal interests or biases, and refer clients, as needed, to appropriately qualified professionals. 2. Clarify and define their professional role(s) and relationships with clients, disclose any real or perceived conflict of interest, and provide an accurate description of their services. 3. Provide genetic counseling services to their clients regardless of their clients’ abilities, age, culture, religion, ethnicity, language, sexual orientation, and gender identity. 4. Enable their clients to make informed decisions, free of coercion, by providing or illuminating the necessary facts, and clarifying the alternatives and anticipated consequences. 5. Respect their clients’ beliefs, inclinations, circumstances, feelings, family relationships, sexual orientation, religion, gender identity, and cultural traditions. 6. Maintain the privacy and security of their client’s confidential information and individually identifiable health information, unless released by the client or disclosure is required by law. 7. Avoid the exploitation of their clients for personal, professional, or institutional advantage, profit, or interest. Source: National Society of Genetic Counselors (2017).

••

••

••

The Code of Ethics can be found on the NSGC website (http://www.nsgc.org). Table 12.2 lists the  portion of the NSGC Code of Ethics that pertains to patient care. Additional important genetic counseling associations now span much of the globe, with professional organizations formed in Asia, Canada, Cuba, Europe, Great Britain, India, and the Middle East. Professional genetic societies and other medical organizations—­As practitioners within the intersection of genetics and oncology, genetic counselors should also be guided by the ethical guidelines developed by other relevant professional organizations. For counselors within the United States, this can include the American Society of Human Genetics, the American College of Medical Genetics, the American Medical Association, the American Society of Clinical Oncology, and the International Society of Nurses in Genetics. Medicine—­As allied health professionals, cancer genetic counselors are bound by the same ethical standards as all health care providers. Thus, counselors need to follow the strict rules regarding patient confidentiality, informed consent, and conflict of interest. Hospital or other place of employment—­Cancer genetic counselors need to adhere to the specific rules and regulations of the hospital, laboratory, or agency where they work. For example, cancer counselors who work in governmental agencies may have very different policies regarding their ability to accept consulting work or honoraria compared to counselors who work in a university medical center or clinical laboratory. In terms of clinical care, genetic counselors who work in religiously affiliated hospitals may need to navigate additional rules regarding discussions about reproductive technologies and options.

486

Counseling About Cancer

12.2.2.  Strategies for Being an Ethical Counselor This section discusses strategies that are appropriate for the ethically minded cancer genetic counselor. It is important to recognize that bioethical tenets are not only important when faced with certain situations or dilemmas, but rather they should inform the counselor’s daily work practices. 12.2.2.1.  Keep Accurate and Complete Records Genetic counselors are required to document information in the patient’s permanent medical record. This generally includes information about all patient encounters, the genetic pedigree, testing decisions and lab test results, and plans for follow-­up. Hospitals typically have set guidelines regarding the necessary documentation needed for in-­person, video, or telephone encounters, especially for billable services. Patients are best served when the case documentation is accurate and complete and completed in a timely manner. This is especially true now that patients have increased access to their medical record information. 12.2.2.2.  Keep Up to Date with the Latest Advances in Cancer Genetics The landscape of cancer genetics is constantly changing. In order to provide quality care to ­individuals and families, it is important for counselors to remain current themselves regarding scientific, medical, psychological, and counseling advances. Continuing education is also required for certification and state licensure. 12.2.2.3.  Know How to Ascertain Patient Autonomy Genetic counselors may encounter patients who are not considered autonomous and therefore cannot legally consent to medical procedures such as genetic testing. Genetic counselors should have strategies in place for ascertaining a patient’s ability to sign a medical informed consent. Counselors will also need to ensure that the patient’s designated guardian or representative is included in the informed consent discussion. And, in the case of pediatric patients (often age 10–12 or older), it is important to obtain patient assent along with the parental consent. (Also see Section 5.1.3.) 12.2.2.4.  Be an Empathetic and Caring Provider Genetic counselors should forge empathetic relationships with their patients. Even in the midst of explaining facts and figures to patients, counselors need to pay attention to the patients’ emotional reactions and concerns. Counselors should strive to practice “attached attentiveness,” which means being fully present in the clinical encounter, really listening to what the patient is saying, and treating the patient as a unique individual. (See Chapter 11 for more information about empathic counseling.) 12.2.2.5.  Respect Patient Confidentiality Genetic counselors need to respect patient confidentiality by not releasing any of their protected health information (PHI), especially genetic information, to an unauthorized third party unless explicit consent has been obtained. Examples of third parties include other medical providers,

12. Ethical Issues in Cancer Genetic Counseling and Testing

487

insurance agents, or relatives of the patient. Thus, case information sent to an outside physician or genetic counselor for “curbside review” should not contain any identifiers unless patient permission has been obtained. In addition, unless there are extenuating circumstances, counselors need to respect the patient’s preferences in terms of how (or whether) the genetic test results are shared within the family. 12.2.2.6.  Respect Patient Privacy Genetic counselors should ensure that their patients’ genetic information and other PHI are kept private. This means following the set policies about the types of information collected about individuals and their relatives, as well as determining which staff members will have access to their pedigrees, medical histories, and genetic test results. At times, patients may request that certain personal information be kept “off the record” or request that they undergo genetic testing under a pseudonym. In these situations, genetic counselors may need to explain to patients that they must comply with hospital or organizational regulations and programmatic policies. In these instances, it may be helpful to explain the policies in place that protect patient privacy and confidentiality as well as any broader guidelines or legislation that may help to alleviate the patient’s concerns. It may also be helpful to discuss the potential benefits, risks, and limitations to alternative approaches, such as direct-­to-­consumer testing or deferring testing until a later time, for example, when life insurance policies are in place. 12.2.2.7.  Respect the Patient’s Decisions At times, patients make decisions that differ widely from standard recommendations and may be puzzling to genetic counselors and other providers. Examples include the following: ••

••

••

A 45-­year-­old woman who recently learned that she carries a BRCA1 pathogenic variant decides not to undergo salpingo-­oophorectomy despite her increased risk of ovarian cancer. An individual who carries a lower-­penetrance RB1 pathogenic variant is unwilling to share the information with a sibling who is planning a pregnancy. A parent with Li-­Fraumeni syndrome whose young child carries the same TP53 pathogenic variant has declined the recommended surveillance for children with LFS.

These types of decisions run counter to the recommended guidelines and/or bioethical principles, and thus may elicit strong reactions in counselors. Even if the decision does not seem to make sense, counselors need to accept that clients have the right to their own decisions and actions. It may also be helpful for counselors to ask patients in a curious and nonjudgmental way what led them to make the decisions that they did. Counselors may learn that the woman with the BRCA1 pathogenic variant has serious cardiac issues that would complicate the surgery; the individual with the RB1 pathogenic variant feels strongly that the information should be shared in person and is waiting for the next family get-­together; and the parent whose child carries the TP53 pathogenic variant may be in the medical profession and after thoughtful reflection has decided that the data are not compelling enough to initiate surveillance at this time.

488

Counseling About Cancer

12.2.2.8.  Tell the Truth but Be Gentle It is obviously important for genetic counselors to be honest with their patients, but the dissemination of information should always be accompanied by gentleness, sensitivity, and compassion. Disclosing positive test results is not an easy task and patient reactions can vary widely. Genetic counselors should make themselves available to answer all the patient’s questions at that time while recognizing that some patients will be overwhelmed by too much information. Individuals may need space to react to the news and to adjust to their altered risk status before they can process more didactic information. It may be helpful to plan more than one follow-­up conversation or visit in which to discuss the many aspects of the positive result and cancer syndrome and recognize that certain topics, such as fertility options or risk-­reducing surgery, can be discussed in more detail as they become more immediate and relevant to the patient based on age or circumstance. 12.2.2.9.  Treat Informed Consent as a Process The purpose of informed consent is to provide sufficient information so that a patient can make an informed decision about a specific procedure, test, or study. (Also see Section 12.1.2.1 for the major elements of the consent process.) The consent form and discussion should describe the procedure or study as well as its risks, benefits, alternative options, and confidentiality practices. Having an informed consent dialogue allows patients to ask questions and gain a better understanding of what they are expected to do regarding the procedure, test, or study and what it will (and will not) tell them. 12.2.2.10.  Have Strategies for Dealing with Ethical Dilemmas There are a variety of ethical dilemmas that can occur in cancer genetic counseling. Genetic counselors need to develop strategies for assessing and resolving ethical dilemmas. Please refer to the following two sections (12.2.3 and 12.2.4) for discussion of the four-­box method and other strategies and tips. 12.2.3.  The Four-­Box Method The four-­box method is a practical way to approach and resolve ethical dilemmas for medical professionals. To employ this method, start by writing out the details of the case by sorting them into the four boxes as described next. (See Table 12.3.) The first step is to obtain the relevant information about the case and divide it into the following four sections (boxes): ••

First box (upper left), “Medical Indications.” This section contains the medical facts of the case, including the patient’s diagnosis, current medical issues and treatment plan, and overall prognosis. In a cancer genetics case, this would also include gathering information about the patient’s genetic testing options or results, family history of  cancer, and information on the cancer syndrome in question and guidelines for

12. Ethical Issues in Cancer Genetic Counseling and Testing

489

TABLE 12.3.  The Four-­Box Method for Resolving Ethical Dilemmas Medical Indications Examples: Cancer diagnosis, treatment, and prognosis Surveillance history, benign tumors, or other relevant features Family history (pedigree) Genetic testing results

Patient Preferences Examples: Interest and motivations for genetic testing Has decisional capacity for consent or assent; understands risks and benefits Preferences about testing or disclosures Plans to share or not share results with relatives

Quality of Life Physical, mental, and emotional well-­being Current lifestyle and functionality; any expected side effects from treatment or disease Family relationships and involvement Other sources of support

Contextual Features Timing issues; is case time-­sensitive? Opinions of other stakeholders in the case; any legal or psychosocial ramifications Potential conflicts of interest Any other issues having relevance

Source: Adapted from Jonsen et al. (2015), p. 24.

••

••

••

medical management if available and relevant. Counselors should ask themselves, “Are the facts of the case clear? Do I have all the information I need to assess this case?” Having incomplete facts could introduce a source of bias and make it less likely that a satisfactory decision will be reached. Not infrequently, counselors may discover that the perceived dilemma is due to confusion or misinformation rather than a clash of ethical values. Second box (upper right), “Patient Preferences”. This section describes what the patient is requesting or wants/does not want regarding the current issue or long-­term goals. This section can include issues of consent, including the patient’s understanding of risks and benefits and whether the patient has the capacity to make decisions or has an assigned guardian. Third box (lower left), “Quality of Life.” This section focuses on the patient’s ­current physical and mental health as well as the level of satisfaction with relationships, job, daily activities, and leisure time. This section can also include information about the expected time of recovery from surgery or treatment, or anticipated ­secondary effects. Fourth box (lower right), “Contextual Features.” This section pertains to the other potentially relevant details of the case. These can include additional aspects of the case that may be useful in considering approaches for resolving the dilemma, the opinions or wishes of other stakeholders in the case as well as any potential conflicts of interest.

The next step is to review the information in each of these boxes and apply them to the major bioethical principles of autonomy, beneficence, nonmaleficence, and justice. Doing this should clarify which courses of action or recommendations to make (or not make).

490

Counseling About Cancer

12.2.4.  Additional Suggestions for Resolving Ethical Dilemmas It is important to realize that ethical dilemmas often do not have a resolution that will be satisfying to all parties despite the best intentions and efforts of the genetic counselor. All that the counselor can do is to make the best decision possible based on the information at hand. This section discusses additional tips for how to assess the gathered information and to consider possible resolutions or options. ••

••

••

Ascertain the ethical question being asked and the two (or more) principles involved. Before seeking an answer to an ethical dilemma, it is important to know the exact question that is being asked. It is often useful to write out the question or concern that is at the crux of the ethical dilemma. For example, a patient’s spouse has declined to share the deceased patient’s positive Lynch syndrome genetic test results with the patient’s sibling (autonomy versus beneficience). Stating the dilemma is not always as straightforward as it sounds. If it seems difficult to phrase the issue or to identify which ethical principles are at stake, then perhaps the facts of the case are incomplete or the situation does not qualify as a true ethical dilemma. Genetic counselors should also pay attention as to why this particular question is being asked at this particular time. Determining what (or who) is driving the question and whether this is a new issue or a long-­standing one may also be important elements to consider. Determine how and by whom the decision will be made. It is important to know whether the ethical decision-­making process will involve informal discussions or formal consultations and whether the counselor will be taking the lead role in this process. Genetic counselors should also be aware of any time constraints or urgency to resolving the case. In addition, it is helpful to recognize who has the final say on a specific ethical dilemma. Is it up to the counselor, the team of providers, or a colleague at a different hospital? Perhaps the final decision rests with the patient or the family. Even if counselors do not have the final say in the outcome of the case, they may benefit from conducting this type of ethical case analysis. Consider and balance the opposing ethical principles. Genetic counselors should develop strategies to evaluate the opposing ethical principles in the case. There are a number of approaches that can be utilized when assessing the opposing principles in an ethical dilemma. One strategy involves assigning values (weights) to each of the ethical principles as a way of comparing and contrasting them. Another strategy involves evaluating the pros and cons of each course of action to identify which is either the most beneficial or the least harmful. Regardless of which strategy is used to assess an ethical case, strive to adopt a “reason over emotion” approach while remaining empathetic and compassionate toward the individuals involved in the dilemma. Genetic counselors can structure their assessment around one or more of the ethical theories by asking themselves the following types of questions: •• What course of action would promote the greatest amount of happiness for the greatest number of people? (consequence-­based utilitarianism) •• What are the key ethical principles at stake in this case? How would I prioritize the importance of each ethical principle in this case? (principle-­based ethics) •• How would most responsible counselors act in this case? Which course of action is consistent with my inner moral character? (virtue ethics) •• What is the most caring and compassionate course of action I could take? What are my obligations to this client? (caring ethics)

12. Ethical Issues in Cancer Genetic Counseling and Testing

••

••

••

••

••

••

491

There may not be one perfect solution to an ethical dilemma, but the genetic counselor’s course of action does need to be ethically justifiable for both the patient and the counselor. Brainstorm the possible ways to resolve the dilemma. Consider all of the possible ways to resolve the dilemma. The counselor can start by listing the two main ways to resolve most ethical dilemmas, which can be summarized as “action” versus “no action.” Then, the counselor can go on to consider all of the additional possibilities, including partial action, action on the part of someone else, compromise, or referral. Even if a certain strategy is not realistic, it may be helpful to write it down during this phase of the analysis. Consider the ramifications of each possible course of action. Ultimately, it is important that the resolution of the ethical case be one that all the primary stakeholders (including the genetic counselor) can live with. Genetic counselors should consider the potential consequences for each possible course of action or nonaction. Sometimes a certain course of action has unintended (or undesirable) effects. Remember that the resolution of an ethical dilemma often involves choosing the option that is the lesser of two unpleasant options. The counselor can also look for ways to mediate a resolution in the case. For example, if the case involves an ethical dilemma between patients and their relatives or medical providers, is it possible for everyone to come to some type of agreement or compromise? Use all available resources to help make decisions. As genetic counselors consider the various options for resolving an ethical dilemma, it is important to determine whether there are any rules or regulations that prohibit or require certain actions. For example, it may be important to consult the hospital lawyer to determine which options are legally feasible. Genetic counselors should also consult their colleagues, published ethical guidelines, and other available resources. Decide on a course of action. The case analysis culminates with deciding on a specific recommendation or course of action/nonaction and then carrying out that decision. This may involve making suggestions to the patient regarding the possible choices or explaining what the program or providers are willing or able to do regarding the issue. For example, many cancer genetics programs have a policy that they will not order clinical genetic testing under a fabricated name despite patient requests based on their privacy concerns. Most patients will ultimately understand the reasons for this policy and proceed with testing; however, some have chosen not to be tested or to pursue testing elsewhere. Genetic counselors will also need to consider whether there are any logistical issues or obstacles that need to be addressed before proceeding with the decided-­upon action (or nonaction). Lastly, genetic counselors should always document the ethical case carefully in the event that there are any questions about it at a later time. Take time to reflect on the case afterward. After the case has concluded, it is important for counselors to take the time to reflect on it. Genetic counselors can consider whether their reasoning of the case and ultimate course of action brought about the desired outcome. Genetic counselors can also reflect on whether anything could or should have been done differently and whether any systems changes need to be made in order to avoid similar situations in the future. Counselors are encouraged to share their insights and lessons learned with other colleagues so that all may benefit from the experience.

492

Counseling About Cancer

12.2.4.1.  Resources to Help with Ethical Dilemmas Struggling with ethical dilemmas can be difficult and counselors may feel somewhat alone as they wrestle with these types of cases. Yet there are several resources that may be helpful in the evaluation and resolution of ethical dilemmas. ••

••

••

••

Ethical codes and professional guidelines—­When considering possible ways to resolve ethical dilemmas, counselors should be guided by the NSGC Code of Ethics (refer to Table 11.2 for an excerpt). Counselors should also seek out the clinical standards of care and ethical guidelines that have been developed by other medical organizations, such as the National Institutes of Health, the American Society of Human Genetics, the American College of Medical Genetics, the American Medical Association, and the American Society of Clinical Oncology, as well as the World Health Organization and other international professional groups. Colleagues and other professionals—­There may be great benefit to discussing an ethical case with other genetic counselors and colleagues. These colleagues can help reason through the case, provide much-­needed emotional support, suggest additional resources or experts, and point out alternative ways to resolve the case. One suggestion is to participate in a peer supervision group, which can be an excellent forum in which to talk through challenging cases and obtain valuable input as well as to hear from other genetic counselors regarding their ethical cases, actions, and outcomes. Some ethical cases raise questions that are best answered by outside providers or other types of professionals. Genetic counselors may also find it helpful to discuss the elements of ethical cases with other medical specialists, nurses, lawyers, clinical bioethicists, psychologists, or members of the clergy. Hospital Ethical Review Boards—­Most major medical centers have standing or ad hoc Ethical Review Boards (EABs). Genetic counselors can request formal, and sometimes informal, ethical consultations from these hospital EABs. The genetic counselor would provide the EAB with details of the case (orally or in writing) and then the EAB would conduct its own case analysis and render recommendations accordingly. Recommendations made by the EAB are seldom binding, but the written reports are generally quite thoughtful and useful. Counselors are encouraged to seek EAB consultations for ongoing cases as well as completed cases that had less than optimal outcomes. Other types of ethics committees—­Many professional organizations have ad hoc or standing ethics committees that are available to their membership for consultation. For example, members of the NSGC can request an ethics consult through its Ethics Inquiry Review Program. The advantage to utilizing this type of ethics committee is that its scope of understanding in regard to the nuances of the issues may be greater than the average hospital EAB’s. And sometimes, asking advice outside the hospital may be preferable, especially regarding any sensitive ethical dilemmas regarding colleagues or programmatic policies.

12.3.  Types of Ethical Dilemmas in Cancer Genetic Counseling Cancer genetic counselors are well versed in dealing with ethical dilemmas, which is fortunate, since these types of situations are not uncommon in clinical cancer genetics. This section discusses 10 ethical issues that cancer genetic counselors may encounter.

12. Ethical Issues in Cancer Genetic Counseling and Testing

493

12.3.1.  Competing Rights and Roles In the context of cancer genetic counseling, the potential stakeholders include all individuals who have a vested interest in the genetic counseling and testing discussions and outcomes. This can include the patient, the patient’s partner, spouse, or caregiver, the patient’s relatives, the referring provider, the oncologic and surgical team, clinical researchers, and the testing laboratory. These stakeholders may have different priorities, obligations, and desired outcomes and it is these differences that can create conflict (i.e., an ethical dilemma). Most commonly, this conflict involves differing opinions about the importance of obtaining or sharing the genetic test results. The referring provider may want the results to inform clinical recommendations or for eligibility for a clinical trial. The patient and/or family may be reluctant to pursue testing or have strong reactions to the test results (or anticipated results). Patients may decline or defer sharing the results with other at-­risk relatives, which may hold potential medical consequences and create dilemmas for providers (see Section 12.3.6). In addition, the act of sharing or not sharing the test results may affect family dynamics or relationship. Genetic counselors are the de facto mediators and liaisons in these situations and are tasked with balancing the needs of the patient, the family, the patient’s clinicians, and study investigators. Thus, genetic counselors often have to juggle competing roles during and after the counseling and testing process as they educate and advocate for patients while striving to meet the referring provider’s expectations, and accomplish professional goals (also see Section 12.3.3). Issues of competing rights may also arise in terms of the dispensation and ownership of the results regarding patients who are incapacitated or deceased. Ideally, these are issues that have been discussed prior to the patient’s death, although this is not always feasible. It is important to identify the patient’s health proxy and next of kin; however, this does not eliminate the possibility of an ethical issue arising. 12.3.2.  Confidentiality and Privacy Genetic test results and pedigrees should be handled with the same confidentiality and privacy practices as other medical information. According to the American Medical Association, patient privacy encompasses several aspects, including physical privacy, personal data, cultural and religious affiliations (decisional privacy), and personal relationships (associational privacy). Patient confidentiality, which is a keystone of medicine, refers to the requirement that the patient’s PHI is kept private and is not disclosed to a third party unless agreed to or instructed by the patient. The United States and other countries have developed laws and policies regarding PHI. Both clinical and research cancer genetics programs need to have safeguards in place to ensure the safeguarding of patient/study participant PHI. Within the United States, genetic counselors must follow the practices outlined by the Health Information Portability and Accountability Act (HIPAA). The Genetic Information Non-­Discrimination Act (GINA) passed in 2008 provides protection against genetic discrimination by health insurers and employers with more than 15 employees. In addition, the Affordable Care Act (ACA) makes it illegal for health insurers to deny insurance based on preexisting conditions. However, in terms of life insurance and long-­term disability insurance, state regulations may allow the use of genetic information if actuarially justified. Overall, the risk of genetic discrimination for people with hereditary cancer risks appears to be low.

494

Counseling About Cancer

For some patients, concerns about confidentiality and privacy are paramount and they may request extra safeguards to their information or ultimately decline to be tested by the clinical provider. In addition to the genetic test results and pedigree, genetic counselors may be privy to other sensitive information or family secrets and should use their discretion as to how (or if) they are documented. (Also see Section 12.3.10.) Testing programs need to develop policies for how to handle requests for anonymous testing or requests to keep the results or certain information “off the record.” Ethical dilemmas in the arena of confidentiality and privacy often involve breaches of a patient’s genetic information, either inadvertently or, in rare cases, deliberately. There may be situations in which patients undergo testing but then elect not to receive their results—­honoring this request may be very difficult, especially if the result has been placed in their medical record. In addition to the confidentiality and privacy safeguards that are within the provider’s control, there are other potential breaches or hacking events that may involve the entire medical center or clinical testing laboratory. Given the increased number of cybersecurity events, it is important for testing programs to develop protocols for informing patients of such an incident and the measures being taken to resolve it and prevent it from reoccurring. 12.3.3.  Conflict of Interest A conflict of interest (COI) is defined as a set of circumstances that creates a risk that a provider’s professional judgment or action will be unduly influenced by a secondary interest. The focus is on the appearance of COI and potential for risk regardless of whether any harm has actually occurred. The goals of monitoring and regulating COI are to protect patients and research participants from potential harm and to maintain public trust in the recommendations given by their providers or in the integrity of the research study. However, it is also true that COI relationships are important in the development and production of new products to improve health outcomes. The answer is to increase awareness (many cases of COI are unintentional), to destigmatize the term (COI is not necessarily bad), and to increase transparency with peers, patients, and other providers. As a profession, this should include the implementation of policies to minimize and manage COI. Even with increased awareness and education about COI, individual providers seem to have a very difficult time recognizing their own unethical behaviors or actions. For this reason, having systems that include some type of professional or peer supervision and accountability can be helpful. Ethical dilemmas with COI include scenarios in which the genetic counselor serves on an advisory committee, does consulting work, or accepts honoraria or grants from any commercial entity that provides products or services that may be utilized by or recommended to the c­ ounselor’s patients. Although many of these relationships provide mutually beneficial o ­ pportunities for genetic counselors that will ultimately further the field and benefit patients, counselors and other providers need to recognize the potential risk of COI and take appropriate precautions and actions. 12.3.4.  Consent and Patient Autonomy Written or verbal patient consent is typically required for clinical genetic testing. The consenting process is one of the goals of the pre-­test counseling session. Obtaining consent helps ensure that

12. Ethical Issues in Cancer Genetic Counseling and Testing

495

patient autonomy is respected and that patient preferences have been acknowledged. Older children and adolescents are also often asked to assent to the test or procedure, which takes into account their understanding and preferences. An important aspect of consent is clarifying whether the individual (patient) is legally recognized as having the capacity to make health-­ related decisions. The lack of autonomy can be temporary or permanent and can be broad or limited in scope. The elements of consent include a description of the test or procedure being performed, types of results to be obtained, the risks and benefits, the alternative options, and the privacy safeguards. If the testing is being performed as part of a research study, then the consent will typically also include the goals of the study, other tasks within the study (e.g., questionnaires, additional specimen collection), duration of the study, and contact information for the principal investigator and other study personnel. Ethical dilemmas involving issues of consent are often situations in which it is not clear who has the authority to provide consent for genetic testing and/or when there are dissenting opinions about proceeding with the genetic test. In some situations, the genetic counselor may be receiving conflicting information regarding the individual(s) who can act as the authorized guardian or health proxy. (Also see Section 12.3.9.) Additional dilemmas can occur when a patient consents to the genetic test despite the counselor’s concerns that it is not actually an informed choice due to concerns about the patient’s current capacity for decision-­making or their possible lack of comprehension regarding the genetic test. This includes situations in which the discussion has been interrupted or cut short or when the patient is hard of hearing, seems to have short-­term memory lapses, or appears to be in emotional or physical pain. Genetic counselors, with the goal of doing no harm, may also have reservations about the timing of testing for patients who seem to be emotionally vulnerable, overwhelmed, or in crisis. Lastly, there may be situations in which patients themselves would prefer not to have genetic testing, but have agreed to be tested due to the preferences and possible subtle pressure from their family members or medical team.

12.3.5.  Duty to Recontact Cancer genetic programs will need to determine whether, when, and how they should inform their relevant patient populations regarding new gene discoveries and major updates about known cancer syndromes. The American Society of Human Genetics strongly recommends attempting to recontact previously tested patients if the reclassified genetic test results are reasonably expected to affect the medical management of patients and their relatives. This would include variants of uncertain significance (VUS) being upgraded to pathogenic/likely pathogenic (P/LP) variants or P/ LP results being downgraded to VUS or likely benign/benign results. Testing programs should also consider recontacting patients if there are new genetic tests to offer them or if there are new associated medical implications or management recommendations for individuals with P/LP results. The reanalysis of research genetic/genomic data may also lead to new or reclassified results that need to be conveyed to study participants.

496

Counseling About Cancer

While reaching out to patients or study participants regarding all relevant new information would be ideal, it is not realistic to expect programs to do this. High priority should be given to recontacting patients or study participants with new information or updates regarding highly penetrant pathogenic variants in which effective surveillance or treatment is available. For other gene discoveries and updates, programs need to balance the importance of informing patients about the potentially useful information with the feasibility and sustainability of contacting prior and current patients. Strategies can include recommending that patients provide updated contact information to the clinic or hospital, that patients with cancer syndromes come back to the clinic for annual visits, and that patients with striking personal and/or family histories who received negative or VUS genetic test results check back in with the program every few years. Genetic counselors should document these types of recommendations in their patient correspondences and encounter notes. If the genetic counselor learns that the patient is deceased, it is important to document this as well so that the family will not continue to receive communications (which may be emotionally painful) from the cancer genetics program. 12.3.6.  Duty to Warn Genetic counselors are bound by the same strict confidentiality rules that govern all medical provider–patient relationships. Thus, there is an expectation that counselors will maintain patient privacy and confidentiality. Deciding to break this rule should only be done in rare instances in which the cancer risks to unaware at-­risk relatives outweigh the patient’s right to privacy. There are very few instances that justify a breach of patient confidentiality. For the most part, duty to warn obligations have to do with the notification of risk to first-­degree relatives in cases where the hereditary cancer syndrome has a close to 100% risk of cancer and there are medical interventions that could ameliorate these risks and the provider has the means of contacting these relatives. Counselors who believe that a particular situation might warrant disclosure of patients’ test results to their relatives are encouraged to seek input from the clinical directors, other colleagues, the hospital lawyer or privacy officer, and/or an Ethical Advisory Board. Of course, if counselors cannot identify or obtain contact information for the patients’ relatives, then this issue may be moot. There may also be additional options for genetic counselors to consider. For example, there are some instances in which the patient’s treating physician is allowed to disclose the results (kept to a minimum necessary standard) to the relative’s treating physician. There are only two major legal precedents regarding duty to warn within the United States: ••

••

Pate v. Threlkel (661 So.2d 278 (Fla. 1995))—­In this case, the Florida court considered whether the surgeon who operated on a patient for medullary thyroid carcinoma (MTC) should have done more than inform the patient that her daughter was also at risk. The patient’s daughter was not told of her risks and subsequently developed MTC. The court ruled that the surgeon—­who was not the patient’s regular physician—­had sufficiently notified the family by informing the patient of the risks to her offspring. Safer v. Estate of Pack (677 A. 2d 1188 (N.J. 1996))—­In this case, the Appellate Court debated whether the physician who treated a man with colorectal polyposis should have informed the patient that his daughter could also be at risk for developing polyposis.

12. Ethical Issues in Cancer Genetic Counseling and Testing

497

Twenty-­six years after the patient died, his daughter presented with colorectal cancer and polyposis. The court ruled that the physician should have warned the patient regarding the heritable nature of polyposis. Since the patient’s daughter was a minor at the time, notifying the patient (her father) would have been deemed sufficient. The court further stated that physicians have an obligation to take “reasonable steps” to warn at-­ risk relatives regarding cancers that are potentially preventable. Genetic counselors’ primary obligations are to their patients and respecting patient wishes regarding family communication is an important aspect of this. However, the issue of data ownership and gate-­keeping is more complicated in genetics since it could be argued that DNA results impact both the patient and the family. Counselors need to make sure that patients understand that their pathogenic variant results have health-­related ramifications for other family members. Genetic counselors can explore with patients the potential barriers to sharing the information with other relatives and can offer to help them in these efforts by providing written resources or offering to write a family letter or hold a family meeting. Sometimes, patients simply need time in which to become accustomed to the news before they are emotionally ready to share it. The timing and methods by which patients notify their relatives should be theirs to decide. Even if patients ultimately decide not to share their genetic test results with relatives, counselors generally need to honor these decisions. This section has focused on situations in which patients elect not to share pathogenic variant results with other at-­risk relatives. Additional scenarios that can arise include clinical or research genetic test results that become available after the patient has died. To avoid these types of ethically challenging situations, many genetics providers will ask the patient (or study participant) to designate upfront at least one other person who would have access to the patient’s genetic test results.

12.3.7.  Inequality and Access Genetic counseling and testing services remain sparse in less populated and rural areas. Even within large cities, access may be disproportionate for certain individuals or neighborhoods. Individuals who have limited or no health insurance may not have access to genetic evaluations and recommended strategies for cancer detection or risk reduction. In the United States, there continue to be disturbing differences in cancer-­related morbidity and mortality for White and non-­White individuals. Although this is part of a much larger issue of overt and structural racial discrimination, it is important for genetic counselors to advocate for equal care for all patients and to avoid preferential services. Increasing the diversity within the genetic counseling profession will also provide new important voices to these hard discussions and will help patients feel more included and welcomed. Given the past history of eugenics and mistreatment of disadvantaged populations, genetic providers need to be even more diligent regarding transparency and inclusion. In addition to providing ethical genetic counseling to patients and families, genetic counselors are encouraged to advocate on issues that affect the genetic counseling profession (such as state licensure and increasing genetic counseling opportunities worldwide) and issues that

498

Counseling About Cancer

may benefit their patient population, such as assisting in efforts to reduce health service disparities and barriers. These efforts can include broadening opportunities for research regarding VUS results, which are more prevalent in people who are non-­White. Advocacy efforts can include making presentations to lawmakers and others, writing newspaper editorials, correcting misinformation portrayed in the media, sending letters of concern to biomedical companies, insurance companies, or governmental officials, and volunteering in cancer awareness campaigns or fundraising efforts. These efforts can be done as an individual genetic counselor as part of a large effort through their employer or through professional organizations, such as the National Society of Genetic Counselors, or non-­profit consumer organizations. However, genetic counselors should always obtain permission from their respective employers or organizations prior to speaking on their behalf.

12.3.8.  Prenatal/Preimplantation Genetic Testing One potential downstream effect of identifying a P/PL cancer genetic test result is that individuals and couples may wish to utilize in  vitro fertilization (IVF) and preimplantation genetic testing (PGT) or other family planning options, such as prenatal testing or using an egg or sperm donor. One of the possible outcomes of prenatal testing is the consideration of pregnancy termination, which is one of the most heartbreaking decisions that pregnant mothers or couples may have to make. In addition to religious tenets, which may be important considerations for the couple, the issue of pregnancy termination is, by its very nature, a conflicting bioethical issue (parental autonomy and right to decide versus fetal autonomy or future autonomy). At this time, within the United States, the ability to choose pregnancy termination is no longer a federally protected right. Decisions about allowing or disallowing pregnancy terminations are being made at the state level, which is leading to a patchwork of differing state laws regarding the timing and circumstances for which access to abortion is granted. Unfortunately, for couples who have fetuses with congenital defects or genetic predispositions to disease, this has further complicated a challenging and emotionally charged situation. It should also be noted that some couples who request prenatal testing “just want to know” and plan to continue the pregnancy regardless of the results. In addition, various ethical issues may be raised, including the use of PGT for individuals with the following types of cancer genetic syndromes and pathogenic variant test results: •• •• •• ••

••

Adult-­onset cancer syndromes Syndromes with low or moderate increased risks of cancer Syndromes with treatable cancers with high survival rates Variants or genes for which there is limited data available regarding the associated cancer risks Carrier testing for an autosomal recessive syndrome, which confers either modest or no increased cancer risk for heterozygote carriers

12. Ethical Issues in Cancer Genetic Counseling and Testing

499

12.3.9.  Testing Children Parents routinely make medical decisions on behalf of their underage children (typically age 17 or younger unless they are emancipated). This policy is made with the assumptions that parents want what is best for their child and that they are in the position of knowing their child best. These testing requests also need to make sense from a clinical standpoint. Professional genetics organizations agree with the benefits of genetic testing for both children who are symptomatic and for asymptomatic children who are at risk for childhood-­onset conditions. However, as shown in Table 12.4, the NSGC, American Society of Human Genetics, American Association of Pediatrics, and American College of Medical Genetics have issued policy statements discouraging the provision of genetic testing for asymptomatic children who are at risk for adult-­onset conditions. With the increased utilization of multigene panels, exome testing, and tumor testing, many programs feel comfortable including genes linked with adult-­onset cancers when testing a child who has cancer. However, the threshold for testing unaffected children and adolescents remains higher and programs tend to either defer testing until adulthood or agree to very limited cancer gene testing. Ethical situations can arise in which there are disagreements regarding whether and what type of genetic testing should be offered to a child or adolescent. Genetic counselors may be asked to arrange testing for a child who is at risk for an adult-­onset cancer syndrome that is known to be in the family. Or the parents may decline testing for a child for whom the test results would impact recommendations for treatment, surgery, or surveillance options. TABLE 12.4.  Testing Children for Adult-­Onset Conditions: Three Policy Statements from Professional Genetics Organizations Excerpt from the 2018 policy statement from the National Society of Genetic Counselors: The National Society of Genetic Counselors (NSGC) encourages deferring predictive genetic testing of minors for adult-­onset conditions when results will not impact childhood medical managements or significantly benefit the child. Predictive testing should optimally be deferred until the individual has the capacity to weigh the associated risks, benefits, and limitations of this information, taking his/her circumstances, preferences, and beliefs into account to preserve his/her autonomy and right to an open future. Excerpt from the 2015 policy statement from the American Society of Human Genetics: Unless there is a clinical intervention appropriate in childhood, parents should be encouraged to defer predictive or predispositional testing for adult-­onset conditions until adulthood or at least until the child is an older adolescent who can participate in decision-­making in a relatively mature manner. Excerpt from the 2013 joint policy statement from the American Academy of Pediatrics and the American College of Medical Genetics and Genomics: Predictive genetic testing for adult-­onset conditions generally should be deferred unless an intervention initiated in childhood may reduce morbidity or mortality. An exception might be made for families for whom diagnostic uncertainty poses a significant psychosocial burden, particularly when an adolescent and his or her parents concur in their interest in predictive testing. Sources: Adapted from NSGC (2018), ASHG (2015), AAP/ACMG (2013).

500

Counseling About Cancer

Genetic counseling approaches may differ depending on the child’s cancer status and age, and the family dynamics and communication style. It may also be important to clarify whether the child’s parents are together or are legally separated or divorced. Deferring testing until the family reaches agreement may be the best approach, although this is not always practical. Genetic counselors should also consider the possible psychological impact of testing, especially if the parents and older child or adolescent disagree about proceeding with testing. Children’s ages help dictate their involvement in the testing process. Older children and adolescents should be included in the testing discussions and can also be asked to provide assent to testing, which is a nonbinding agreement. The assenting process ensures that the child, who has reached a certain level of maturity, has a voice in the discussions and decisions. Parents may have concerns about involving their child in the conversation and decision-­making process and may wish to speak to the pediatric cancer counselor beforehand to suggest certain words or phrases to use or to avoid during the visit. In some instances, obtaining assent may not be feasible due to intellectual, emotional, or medical reasons, although these situations are not always clear-­cut and require counselors to use their best clinical judgment. 12.3.10.  Unintended Results With multigene tests, it is possible for patients to receive “unexpected” genetic testing results, including somatic tumor variants that increase the likelihood of a germline variant and germline pathogenic results that are not consistent with the patient’s personal or family history of cancer. Positive cancer gene test results may also come from testing that was done for other purposes. As examples, prenatal carrier panels and exome testing for developmental delay may inadvertently discover pathogenic variants associated with increased cancer risk. Possible ethical dilemmas (and logistical problems) can occur in the following scenarios: ••

••

A variant of uncertain significance in a high-­risk cancer gene has been upgraded to a pathogenic variant result months or years after the patient has been tested and updated contact information is not readily available. A genetics research study reanalyzes the genetic data at a later date and identifies a pathogenic variant result; however, participants had been told that they would not be receiving results from the study.

Genetic testing results may also reveal findings that raise suspicion of relapse or a hematologic or other malignancy. This includes the identification of clonal hematopoiesis of indeterminate potential (CHIP) or possible chromothripsis (catastrophic genetic rearrangements). Although not the goal of germline DNA analysis, this is potentially important information to convey to patients and their providers. And whenever there are unexpected results, the possibility of conflict or strained communications is raised. These types of scenarios need to balance the duty to warn patients of genetic testing results that have potential medical implications with the patient’s right not to know. Issues regarding unexpected test results are especially challenging if the type of result obtained was

12. Ethical Issues in Cancer Genetic Counseling and Testing

501

not discussed in the initial consenting process and thus is unexpected, or (in the case of research studies) individuals have specifically requested not to receive their results. Whenever possible, the decisions about the number of genes analyzed should be a shared decision-­ making process between the providers and the patients. Patients should be informed about the possibility of receiving results on cancer risk genes that are not specifically indicated by their personal and family histories or are less clear-­cut in terms of cancer risks or medical recommendations. At times, the family history information or genetic testing results will reveal unexpected information regarding family relationships, including cases of misassigned paternity or adoptions either within or outside the family. While this information may impact the level of cancer risk for these patients (or their offspring), the disclosure of these “family secrets” may have serious repercussions on patients’ lives and their familial relationships. For this reason, genetic counselors and other providers should consider not disclosing this type of information unless there is a compelling reason to do so. These types of disclosures, if performed, should be conducted with great tact and gentleness and should include the chance that other conclusions might also be possible. In addition, the testing consent form should include a statement regarding the possibility that genetic testing can sometimes reveal this type of sensitive information.

12.4.  Case Examples 12.4.1.  Case 1: The medical provider’s need to know the patient’s TP53 status versus the patient’s right to decline testing Case Presentation: The genetic counselor was asked to meet with Carole, a 45-­year-­old with a recent diagnosis of Stage 1 estrogen positive, HER2 negative invasive breast cancer. Carole had undergone a lumpectomy with the tumor genetic analysis revealing a TP53 variant in 42% of cells analyzed, raising concerns about a possible diagnosis of Li-­Fraumeni syndrome (LFS). Carole has one daughter, age 21, and two older siblings who are cancer-­free. Carole’s parents had died in their 70s from smoking-­related diseases. The only history of cancer in the family was a maternal first cousin, who had been diagnosed with breast cancer at age 36. The genetic counselor reviewed the somatic TP53 variant with its possible association with LFS and discussed the option of having germline genetic testing to clarify the somatic finding. The counselor explained that the germline genetic test could potentially alter the oncology team’s treatment recommendations as well as future recommendations for cancer screening. The patient listened carefully to the information, but decided not to proceed with the germline genetic testing, because it was “too much” to deal with right now. The counselor followed up with the patient’s oncology team and participated in the discussion of the case at the weekly breast oncology tumor board. There was a lively discussion regarding whether it was prudent to advise radiation treatments for this patient. The genetic counselor provided information about the patient’s breast cancer (not HER2 or triple positive) and family history (one third-­degree relative with young breast cancer) and reminded the group that TP53 variants are frequently seen in breast tumors. The genetic counselor did acknowledge that this TP53 variant would be considered pathogenic if present in the germline and that

502

Counseling About Cancer

positive TP53 results can occur in individuals whose personal and family histories do not meet clinical criteria for LFS. One provider asked if it were possible to test the patient “off the record” with or without their consent. Another provider asked if the patient would agree to be tested if the results were reported only to the oncology team. The genetic counselor explained that, as a clinical test, prior informed consent and medical records documentation of the result were required. In addition, if the result were positive, then the patient would need to be counseled about the other LFS-­related cancer risks and surveillance recommendations. It was ultimately decided that the patient would be approached one more time to discuss germline testing and that the oncotype dx breast recurrence score, which was still pending, would help determine the need for adjuvant radiation. The genetic counselor, with the radiation oncologist in attendance, held a follow-­up visit with Carole to review the risks and benefits of genetic testing, with the main benefit being that the germline test would help guide the recommendations about radiation therapy. The patient said that while she might want to have genetic testing “at some point,” she was simply not ready to “take on one more thing” right now. Due to the patient’s high oncotype score and the lack of a firm diagnosis of LFS, the oncology team ultimately (and reluctantly) recommended a course of radiation treatments, which the patient completed without issue. Follow-­Up: Two years later, Carole did elect to have germline testing, mainly at the urging of her daughter, who wished to clarify her own risks of breast cancer. No pathogenic variants were identified in the TP53 gene or any of the other breast cancer genes analyzed. The radiation oncologist was even more relieved than Carole and her daughter to hear the news. Case Discussion: At times, the needs and goals of medical providers and their patients may seem to be at cross-­purposes. Ethical dilemmas can arise in these situations, potentially leading to a breakdown in communication and trust between medical providers and their patients. Having direct (and transparent) conversations can help clear up any misunderstandings or miscommunications that may have occurred. In addition, these conversations may lead to a better understanding of the other person’s point of view, which can be helpful in reaching a compromise or consensus. As with any bioethical dilemma, the goal in this case was to find the best possible resolution (or at least a resolution that both parties could live with) based on the patient’s circumstances and the needs and goals of the primary stakeholders. In this case, the medical team ultimately accepted the patient’s decision not to be tested and made the recommendations about radiation therapy based on the information that was currently available.

12.4.2.  Case 2: A positive RET research result: The researcher’s duty to warn versus the study participant’s right to decline results Case Presentation: As a genetic counselor and member of the medical center’s institutional review board (IRB), you were especially interested in the presentation from a study principal investigator (PI) who was looking for guidance. The PI was conducting a large-­scale research study looking for possible genetic risk factors related to cardiovascular risk. Buccal samples and

12. Ethical Issues in Cancer Genetic Counseling and Testing

503

brief personal and family history surveys were collected on 5,000 healthy college students. The genetic analyses looked at the known cardiovascular genes and other genes of interest as well as the non-­cardiac genes deemed important by the American College of Medical Genetics (ACMG). Upon enrollment, individuals were asked to check off a box stating whether they wished to receive results from the study with the understanding that they would only be contacted if a significant disease causing result were identified. The reason for the PI’s current visit to the IRB was that a pathogenic variant in the RET gene had been identified in one of the study participants. The PI recognized the potential significance of this genetic test result; however, this study participant had indicated that they did not want to receive results from the study. Upon entry into the study, each participant had also been asked to provide their name and email address with the understanding that only the PI would have access to this information. The PI did have this information for the individual with the positive RET result, who had enrolled in the study 5 years earlier. The PI asked the IRB if this RET result warranted breaking protocol in order to disclose the result to the individual. When asked to provide input, the genetic counselor explained that individuals who carry RET pathogenic variants have high risks for developing an aggressive form of thyroid cancer and that risk-reducing thyroidectomy was an established and effective strategy for reducing this cancer risk. The genetic counselor also reminded the group about the difference between research and clinical genetic test results. Before discussions about risk-reducing surgery, it would be important for this individual to be retested through a clinically approved laboratory. The genetic counselor indicated that the PI likely did have a duty to warn the individual that a positive RET study result had been identified. After further discussion, the IRB agreed as a group that it was important to share the results with the study participant despite the protocol violation. The PI agreed to reach out to the participant regarding the RET research result and to refer them to genetics for pre-­test counseling, clinical RET testing, and follow-­up. Follow-­Up: Two weeks later, the genetic counselor received a telephone call from a very confused individual who had received an email from the study PI. The genetic counselor explained the possible implications of the study finding and the individual scheduled a formal genetic counseling visit. Clinical testing did confirm the positive RET result and the subsequent ­prophylactic thyroidectomy revealed no cancer but did show C-­cell hyperplasia. The individual’s siblings and parents are currently pursuing RET testing. Case Discussion: It is not uncommon for large genetic research studies to identify unexpected yet clinically significant results. This can lead to difficult decisions, often made on a case-­by-­case basis, regarding whether a particular research result warrants disclosure. Since this case involved the RET gene, which is a high-­risk cancer predisposition gene with a potentially preventable cancer, the importance of sharing the result with the study participant was fairly clear to all involved. However, this is often not the case with other cancer risk genes. The gene or syndrome in question may be associated with moderate or uncertain cancer risks and/or the strategies for early detection and prevention may be nonexistent or have unproven utility. Most genetic research consent forms now routinely include language that allows researchers to contact individuals with major clinically relevant results. However, these types of quandaries can still occur. When these types of situations do arise, it is important for clinical and research

504

Counseling About Cancer

genetic providers to work together to resolve them and to appropriately provide study participants with genetic information that may have important health implications for themselves and their families.

12.5.  Discussion Questions Identify the ethical dilemma and use the four-­box method to discuss and decide upon a course of action for each the following scenarios: Question 1: You counsel a patient with lobular breast cancer at age 40 who tests positive for a CDH1 pathogenic variant. The patient chooses not to share the results with her sister, age 42, or brother, age 35. The genetics team considers breaking confidentiality and notifying the siblings, especially when they learn that one of them is being worked up for “GI issues.” Question 2: You meet with the parents of a 6-­month-­old child with newly diagnosed unilateral retinoblastoma and offer RB1 genetic testing. One parent wants the child to be tested but the other parent does not. The parents are legally divorced. The oncology team states that the recommendations for enucleation versus treatment depend on the RB1 results and request immediate testing. Question 3: You meet with three siblings whose father has MAP syndrome and whose mother carries one MUTYH pathogenic variant. You counsel the siblings regarding their risks of having one MUTYH pathogenic variant (carrier) or two MUTYH pathogenic variants (MAP syndrome). Two siblings test positive for MAP syndrome and one sibling tests completely negative. The three siblings have requested a joint results disclosure visit and the genetic counselor needs to decide how to proceed. Question 4: You are a co-­ investigator on a research exome study. Rerunning a study participant’s genetic analysis reveals a pathogenic variant in the FH gene associated with hereditary leiomyomatosis and renal cell cancer (HLRCC). This study participant, who has children and siblings, had indicated that he does not wish to receive results unless they are relevant to his prostate cancer diagnosis. You and your co-­investigators meet with the research team to discuss whether to disclose the results.

12.6.  Further Reading American Academy of Pediatrics and the American College of Medical Genetics and Genomics. Ethical and policy issues in genetic testing and screening of children. Pediatrics. 2013;131(3):620–622. American Society of Human Genetics. 2015. Retrieved from https://doi.org/10.2016/j.ajhg.2015.05.022 Botkin JR, Belmont JW, Berg JS, et  al. Points to Consider: Ethical, Legal, and Psychosocial Implications of Genetic Testing in Children and Adolescents. Am J Hum Genet. 2015 Jul;97(1):6–­21. doi: 10.1016/j. ajhg.2015.05.022. Erratum in: Am J Hum Genet. 2015 Sep;97(3):501. PMID: 26140447; PMCID: PMC4570999. Burke W, Press N. Ethical obligations and counseling challenges in cancer genetics. J Natl Compr Canc Netw. 2006 Feb;4(2):185–­91. doi: 10.6004/jnccn.2006.0018. PMID: 16451774. Clarke A, Wallgren-­Pettersson C. Ethics in genetic counseling. J Community Genet. 2019;10(1):3–33.

12. Ethical Issues in Cancer Genetic Counseling and Testing

505

Cowley L. What can we learn from patients’ ethical thinking about the right “not to know” in genomics? Lessons from cancer genetic testing for genetic counselling. Bioethics 2016;30(8):628–635. Dillon J, Ademuyiwa FO, Barrett M, et  al. Disparities in Genetic Testing for Heritable Solid-­ Tumor Malignancies. Surg Oncol Clin N Am. 2022  Jan;31(1):109–­126. doi: 10.1016/j.soc.2021.08.004. Epub 2021 Oct 19. PMID: 34776060. Fenwick A, Plantinga M, Dheensa S, Lucassen A. Predictive Genetic Testing of Children for Adult-­Onset Conditions: Negotiating Requests with Parents. J Genet Couns. 2017 Apr;26(2):244–­250. doi: 10.1007/ s10897-­016-­0018-­y. Epub 2016 Sep 28. PMID: 27680566; PMCID: PMC5382176. Foster MW, Royal CD, Sharp RR. The routinisation of genomics and genetics: implications for ethical practices. J Med Ethics. 2006 Nov;32(11):635–­8. doi: 10.1136/jme.2005.013532. PMID: 17074820; PMCID: PMC2563298. Gallagher M. The intersection of relational autonomy and narrative ethics for the patient unwilling to disclose genetic diagnosis information. Life Sci Soc Policy. 2014 Dec;10:7. doi: 10.1186/s40504-­014-­0007-­6. Epub 2014 Mar 18. PMID: 26085443; PMCID: PMC4686457. Ghasemi E, Majdzadeh R, Rajabi F, Vedadhir A, Negarandeh R, Jamshidi E, Takian A, Faraji Z. Applying Intersectionality in designing and implementing health interventions: a scoping review. BMC Public Health. 2021  Jul;21(1):1407. doi: 10.1186/s12889-­021-­11449-­6. PMID: 34271905; PMCID: PMC8283959. Hammerstad GT, Sarangi S, Bjornevoll. Diagnostic uncertainties, ethical tensions, and accounts of role responsibilities in genetic counseling communication. JGenet Couns. 2020 Dec;29(6):1159–1172. Jamal L, Schupmann W, Berkman BE. An ethical framework for genetic counseling in the genomic era. J Genet Couns. 2020 Oct;29(5):718–­727. doi: 10.1002/jgc4.1207. Epub 2019 Dec 19. PMID: 31856388; PMCID: PMC7302959. Jonsen AR, Sieger M, Winslade WJ. Clinical Ethics: A Practical Approach to Ethical Decisions in Clinic Medicine. 8th ed. McGraw-­Hill, New York, 2015. Juth N. The Right Not to Know and the Duty to Tell: The Case of Relatives. J Law Med Ethics. 2014 Spring;42(1):38–­52. doi: 10.1111/jlme.12117. PMID: 26767475. Londra L, Wallach E, Zhao Y. Assisted reproduction: Ethical and legal issues. Semin Fetal Neonatal Med. 2014 Oct;19(5):264–­71. doi: 10.1016/j.siny.2014.07.003. Epub 2014 Aug 15. PMID: 25131898. National Society of Genetic Counselors. Genetic testing of minors for adult-­ onset conditions. 2018 Apr 4. Retrieved from https://www.nsgc.org/Policy-­Research-­and-­Publications/Position-­Statements/ Position-­Statements/Post/genetic-­testing-­of-­minors-­for-­adult-­onset-­conditions National Society of Genetic Counselors. NSGC code of ethics. Revised 2017 Apr. Retrieved from https:// www.nsgc.org/Policy-­Research-­and-­Publications/Code-­of-­Ethics-­Conflict-­of-­Interest/Code-­of-Ethics Perry TJ, Patton SI, Farmer MB, Hurst CB, McGwin G, Robin NH. The duty to warn at-­risk relatives-­The experience of genetic counselors and medical geneticists. Am J Med Genet A. 2020 Feb;182(2):314–­321. doi: 10.1002/ajmg.a.61425. Epub 2019 Dec 8. PMID: 31814270. Quinn GP, Vadaparampil ST, Bower B, Friedman S, Keefe DL. Decisions and ethical issues among BRCA carriers and the use of preimplantation genetic diagnosis. Minerva Med. 2009 Oct;100(5):371–­83. PMID: 19910890. Schmerler S. Ethical and legal issues. In Uhlmann WR, Schuette JL, Yashar BM (eds.), A Guide to Genetic Counseling. John Wiley & Sons, Hoboken, NJ, 2009, 363–400. Stoll KA, Mackison A, Allyse MA, Michie M. Conflicts of interest in genetic counseling: acknowledging and accepting. Genet Med. 2017 Aug;19(8):864–­866. doi: 10.1038/gim.2016.216. Epub 2017  Jan 26. PMID: 28125084; PMCID: PMC5529257. Suter S. Legal Challenges in Genetics, Including Duty to Warn and Genetic Discrimination. Cold Spring Harb Perspect Med. 2020 Apr;10(4):a036665. doi: 10.1101/cshperspect.a036665. PMID: 31548231; PMCID: PMC7117950.

506

Counseling About Cancer

Wang S, Jiang X, Singh S, Marmor R, Bonomi L, Fox D, Dow M, Ohno-­Machado L. Genome privacy: challenges, technical approaches to mitigate risk, and ethical considerations in the United States. Ann N Y Acad Sci. 2017 Jan;1387(1):73–­83. doi: 10.1111/nyas.13259. Epub 2016 Sep 28. PMID: 27681358; PMCID: PMC5266631. Wolf SM, Annas GJ, Elias S. Point-­counterpoint. Patient autonomy and incidental findings in clinical genomics. Science. 2013 May;340(6136):1049–­50. doi: 10.1126/science.1239119. Epub 2013  May 16. PMID: 23686341; PMCID: PMC3721305. Yang JJ, Zabaleta J, Ziv E, Fejerman L. Cancer health disparities in racial/ethnic minorities in the United States. Br J Cancer. 2021 Jan;124(2):315–­332. doi: 10.1038/s41416-­020-­01038-­6. Epub 2020 Sep 9. PMID: 32901135; PMCID: PMC7852513.

Index

Note: Page number followed by ‘f’ refer to figures and ‘t’ refer to tables. absolute breast cancer risk prediction tools, 308t absolute risk, 308 accurate history, challenges to collecting adoption or donor eggs/sperm, 291 estrangement from family, 291 incomplete family history information, 289–290 relatives or records are lost, 290 reported history is false, 292–293 active and empathic listening, tools for, 456t active treatment, cancer patients in, 431–432 activity limitations, 431–432 acute myelogenous leukemia (AML), 253 acute myeloid leukemia (AML), 32 acute stress disorder/post‐traumatic stress disorder, 436–437, 436t adaptive behavioral coping strategies, 446 adaptive cognitive coping strategies, 445 additional cancer therapies, 27 additional emotional support cancer syndrome support groups, 463–464 compassion satisfaction and compassion fatigue, 464–468 mental health referral, 461–463 adoption or donor eggs/sperm, 291 adoptive cell transfer (ACT) therapy, 22–24, 24f affective factors, 311

affective responses, 443–444 Affordable Care Act (ACA), 493 affymetrix genome‐wide human SNP array 6.0, 347f age/generational cohort, 441 allele‐specific oligonucleotide (ASO), 346–347 allogeneic bone marrow transplants (BMTs), 212 allogeneic transplant, 26 all‐trans retinoic acid (ATRA), 27 alternative service delivery models for pre‐test education, 388 chatbots, 390 decision aids, 390 group pre‐test counseling, 389 American Association of Intellectual and Developmental Disabilities, 412 American Cancer Society Screening Recommendations 2018, 47 American College of Medical Genetics and Genomics (ACMGG), 357, 377 American Gastroenterological Association (AGA), 331 American Society of Breast Cancer Surgeons (ASBrS) position statement, 331 American Society of Human Genetics, 499 ancestry, 282 and culture of origin, 440

Counseling About Cancer: Strategies for Genetic Counseling, Fourth Edition. Katherine A. Schneider, Anu Chittenden, and Kristen Mahoney Shannon. © 2023 John Wiley & Sons Ltd. Published 2023 by John Wiley & Sons Ltd.

507

508 index

angiogenesis inhibitors (AGIs), 25 antibody drug conjugates (ADCs), 25 anticipated impact of results, 401 anti‐PD‐L1/PD‐1 therapy, 23 anxiety disorders, 434–435 anxiety‐producing aspects of cancer genetic counseling, 443t apheresis, 26 array technology, 351–352 ataxia telangiectasia (AT) clinical features, 218–219 diagnostic criteria, 218 genetic testing, 219 medical management, 219 syndrome subtypes, 219 tumor risks, 218 ATM heterozygous carriers cancer risks, 134 clinical features, 134 diagnostic criteria, 134 genetic testing, 134 medical management, 135 syndrome subtypes, 134 autoimmune lymphoproliferative syndrome (ALPS), 220 clinical features, 220–221 diagnostic criteria, 220 genetic testing, 221 medical management, 221 syndrome subtypes, 221 tumor risks, 220 autologous transplant, 26 autonomy, 477–479 autopsy report, 288 autosomal dominant pattern of cancer, 294 autosomal dominant with incomplete penetrance, 171 Bannayan–Riley–Ruvalcaba syndrome (BRRS), 90, 154 BAP1 tumor predisposition syndrome clinical features, 175 diagnostic criteria, 174 genetic testing, 175 medical management, 175–176 syndrome subtypes, 175 tumor risks, 174–175 baseline depression or anxiety, 402

baseline mental health issues, 447–448 Beckwith‐Wiedemann syndrome clinical features, 222 diagnostic criteria, 221–222 genetic testing, 223 medical management, 223–224 syndrome subtypes, 223 tumor risks, 222 beneficence, 479 benign dermatologic tumors, 177 benign disease, 314–317 benign prostatic hyperplasia (BPH), 316 benign tumors, 8–9, 222, 260 associated with childhood cancer syndromes, 216–217t excretion of hormones, 9 location and size, 9 and nontumor, 166, 167–170t in rare tumor predisposition syndromes, 167–168t biallelic BRCA1 pathogenic variants, 136 biallelic BRCA2 pathogenic variants, 136 bilateral tumors or multiple tumor primaries occur more frequently, 171 biliary tract, 42–44 bioethical principles and framework, 476 ethics of caring, 483–484 principle‐based bioethics, 477–480 virtue ethics, 480–483 bioethics, 477, 477t bipolar disease, 435–436, 435t bipolar I disease, 436 bipolar II disease, 436 Birt–Hogg–Dubé syndrome clinical features, 177 diagnostic criteria, 176 genetic testing, 177–178 syndrome subtypes, 177 tumor risks, 176–177 bispecific antibody T‐cell engagers, 24 blood cell development, 7f Bloom syndrome (BSyn) clinical features, 225 diagnostic criteria, 224 genetic testing, 225 medical management, 226 syndrome subtypes, 225 tumor risks, 224–225

509

index

bone marrow dysfunction, 253 bone marrow transplant (BMT), 26, 235 bone morphogenetic protein (BMP) pathway, 81f borderline personality disorder (BPD), 437, 438t brachytherapy, 18 Brazilian founder pathogenic variant, 144 BRCA1/2 carriers, 138 BRCA1/2 genetic testing, 137 BRCA2‐associated gastric cancer, 113 BRCAPRO model, 324 breast, 314–315 anatomy, 130f cancer risk, 319–320 breast and gynecological cancer syndromes anatomy, 129–131 ATM heterozygous carriers, 134–135 BRIP1 heterozygous carriers, 139–140 case examples, 158–161 CHEK2 pathogenic variant carriers, 140 clinical management issues, 131–132 documentation of exact tumor type, 132–133 hereditary breast and ovarian cancer syndrome (HBOC), 135–139 hereditary diffuse gastric cancer (HDGC), 141–142 Li‐Fraumeni syndrome (LFS), 143–146 Lynch syndrome, 146–149 neurofibromatosis (NF1), 149–150 PALB2 heterozygous carriers, 150–151 Peutz‐Jeghers syndrome (PJS), 151–152 PTEN hamartoma tumor syndrome (PHTS), 153–156 RAD51C heterozygous carriers, 156–157 RAD51D pathogenic variant carriers, 157–158 syndrome overlap, 133 timing of testing, 132 Breast and Ovarian Analysis of Disease Incidence and Carrier Estimation Algorithm (BOADICEA), 326, 328 breast and ovarian cancer syndrome (HBOC), 135 Breast Cancer Risk Assessment Tool, 319 Breast Cancer Surveillance Consortium (BCSC), 318 risk calculator, 319 breast density, 317 BRIP1 heterozygous carriers cancer risks, 139 clinical features, 139

clinical recommendations, 139–140 diagnostic criteria, 139 genetic testing, 139 cafe au lait (CALs), 191 cancer, general signs and symptoms of, 2t cancer detection, 1–2, 3t elusive premalignant cells, 3 imperfect or lack of screening methods, 3 lack of warning signs, 2 cancer diagnosis, 278 cancer family histories, 269, 270t additional strategies and helpful hints, 283–286 case examples, 299–303 challenges to collecting accurate history adoption or donor eggs/sperm, 291 estrangement from family, 291 incomplete family history information, 289–290 relatives or records are lost, 290 reported history is false, 292–293 definition and purpose of the pedigree assist with management recommendations, 275 clinical record and research tool, 276 determine need for and type of genetic testing, 275 disorder’s inheritance pattern and other relatives at risk, 276 family dynamics and level of support, 277 identify cancer syndrome, 271–275 patient’s emotional state, 277 patient’s family stories, 277 uncover other syndromes, 275–276 inclusivity, 270 interpreting features of inherited cancers, 293–295 high, moderate, low, and uncertain risk categories, 297–299 ways to classify family histories of cancer, 296–297 key elements of comprehensive cancer history ages and dates, 278–279 ancestry, 282 cancer diagnosis, 278 cancer risk factors, 282 cancer treatment and follow‐up, 279 current surveillance practices, 280

510 index

cancer family histories (cont’d) presence of noncancerous features, 281 psychosocial factors, 282 relatives without diagnosis of cancer, 281 status and prognosis, 279–280 surgical procedures, 280–281 ways to confirm pedigrees, 287–289 Cancer Gene (CaGene), 324, 327, 328 CancerGene Connect, 324, 327 cancer genetic counseling, 164t, 369, 429 additional suggestions for resolving ethical dilemmas, 490–491 anxiety‐producing aspects of, 443t bioethical principles and framework, 476 ethics of caring, 483–484 principle‐based bioethics, 477–480 virtue ethics, 480–483 case examples, 468–472, 501–504 contextual information about patients ethnocultural/social context, 439–442 family context, 437–439 mental health status, 433–437 physical health/cancer status, 430–433 four‐box method, 488–489, 489t patient reactions, coping responses, and risk perception, 442–446 providing additional emotional support cancer syndrome support groups, 463–464 compassion satisfaction and compassion fatigue, 464–468 mental health referral, 461–463 standards of conduct for genetic counselors, 484–485 strategies for being an ethical counselor, 486–488 strategies for effective psychosocial genetic counseling allow patients to express emotions, 457–458 ascertain the rationale behind questions and reactions, 457 ask rather than assume, 456–457 convey empathy, 454–455 deal with resistant patients, 458–459 employ active listening, 456 help patient with decisions and next action steps, 460 monitor patient reactions, 458 remain professional, 459–460

respect patient boundaries, 458 verbal and nonverbal cues, 456 strategies for providing psychosocial counseling baseline mental health issues, 447–448 current emotional well‐being, 446–447, 447t emotional reactions and coping strategies, 448–449 family communication, 450–453 level of family support and communication, 453–454 timing issues and major life transitions and timing issues, 449–450 types of ethical dilemmas in competing rights and roles, 493 confidentiality and privacy, 493–494 conflict of interest (COI), 494 consent and patient autonomy, 494–495 duty to recontact, 495–496 duty to warn, 496–497 inequality and access, 497–498 prenatal/preimplantation genetic testing, 498 testing children, 499 unintended results, 500–501 cancer genetic counselors, 307, 455, 457, 459, 462–465 sample questions for, 448t cancer genetic programs, 495 Cancer Genetics app, 332 cancer genetic testing, 385t, 391 potential benefits and risks of, 379t cancer immunotherapy, types of, 20–21 cancer patients in active treatment, 431–432 with metastatic disease, 432–433 in remission, 432 cancer pedigree quadrant system, 272f cancer risk assessment and risk models, 307 case examples, 333–335 genetics criteria clinical genetic testing criteria, 330–331 criteria for referral for genetics consultation, 331–332 insurance‐specific genetic testing criteria, 331 risk definitions absolute risk, 308 empiric risk, 309, 309t

index

genetic risk, 309 odds ratio, 309 relative risk, 308 risk factors benign disease, 314–317 exposures, 312–314 nondisease indicators of risk, 317–318 risk modeling, 318 models that combine PV risk and penetrance information, 328 online risk assessment tools and calculators for clinicians, 328-329 patient‐friendly risk assessment tools, 329-330 risk of developing cancer, 319–322 risk of hereditary disease, 322–328 risk perception changes in, 311–312 factors that contribute to, 310–311 cancer risk factors, 282 cancer syndrome identifying, 271–275 support groups, 463–464 cancer terminology, 4 cell type, 7 exceptions, 7–8 site of origin, 5 tissue type, 5–7 cancer treatment, 14 additional cancer therapies, 27 chemotherapy, 18–19 and follow‐up, 279 radiation therapy, 16–18 stem cell transplantation, 25–26 surgery, 15–16 targeted therapy, 19–25 cancer vaccines, 24–25 carcinomas, 5 Carney–Stratakis syndrome, 196 cascade testing, 400 case examples, 158–161 cancer family histories, 299–303 cancer genetic counseling, 468–472 cancer genetic counseling and testing, 501–504 cancer risk assessment and risk models, 333–335 genetic testing technologies, 363–365 pediatric tumor predisposition syndromes, 262–265 pre‐and post‐test genetic counseling, 404–405

511

rare tumor predisposition syndromes, 204–207 special populations and special situations, 421–424 case study, 30–33 C‐cell hyperplasia, 188 CDKN2A pathogenic variant, 327 cell type, 7 cellular differentiation, 10f chatbots, 390 CHEK2 pathogenic variant carriers cancer risks, 140 clinical features, 140 diagnostic criteria, 140 genetic testing, 140 medical management, 140 syndrome subtypes, 140 chemical carcinogens, 28 chemoprevention, 68, 84 chemotherapy, 18–19 childhood cancer syndromes, 214–216t benign tumors associated with, 216–217t cholecystokinin (CCK), 110 chronic pancreatitis, 110, 316 Claus model, 320 Clear Genetics, 390 clinical diagnosis of depression, 433t clinical diagnostic criteria, 322–323 clinical factors, 311 clinical genetic counseling programs, 276 clinical genetic testing companies, 387 Clinical Genome Resource (ClinGen), 358, 358f clinical management issues, 131–132 clinical record and research tool, 276 ClinVar, 362, 363 clonal hematopoiesis of indeterminate potential (CHIP), 500 Cockayne syndrome (CS), 154 Coffin Siris syndrome, 249–250 cognitive factors, 311 cognitive reactions, 444–445 colon, 315 cancer risk, 320 and rectum, 44–45, 46f colonoscopies, 95 colorectal cancer, 45–47 Colorectal Cancer Risk Assessment Tool, 320 colorectal polyps, types of, 48t

512 index

colorectum, 46f colored eco‐genetic relationship map (CEGRM), 453, 453t, 454f comparative genomic hybridization (CGH), 351 compassion fatigue, warning signs of, 464t patients with, 482 compassion satisfaction and compassion fatigue, 464–468 comprehensive cancer history, key elements of ages and dates, 278–279 ancestry, 282 cancer diagnosis, 278 cancer risk factors, 282 cancer treatment and follow‐up, 279 current surveillance practices, 280 presence of noncancerous features, 281 psychosocial factors, 282 relatives without diagnosis of cancer, 281 status and prognosis, 279–280 surgical procedures, 280–281 confidentiality, 387 and privacy, 493–494 conflict of interest (COI), 388, 494 congenital anomalies, 237 congenital central hypoventilation syndrome (CCHS), 246 congenital hypertrophy of the retinal pigment epithelium (CHRPE), 65, 71 conscientiousness, 482 consent and patient autonomy, 494–495 constitutional epimutation, 59 constitutional mismatch repair deficiency (CMMRD) syndrome, 56–58, 148, 226 clinical features, 227 diagnostic criteria, 226–227 genetic testing, 228 medical management, 228 syndrome subtypes, 227 tumor risks, 227 constitutional mosaicism, 378 contextual information about patients ethnocultural/social context, 439–442 family context, 437–439 mental health status, 433–437 physical health/cancer status, 430–433 contiguous gene deletion syndrome, 244 convey empathy, 454–455

coping and personality factors, 311 coping resources, 401–402 coping strategies, sample questions to assess, 449t copy number variants (CNVs), 341f Couch model, 325 countertransference, 459 Cowden syndrome (CS), 88 CRA Health Risk Assessment Platform, 321, 329 cryotherapy, 27 Cultural Competency Toolkit, 413 cumulative cancer risks, 86t curative/tumor removal surgery, 15 current emotional well‐being, 401, 446–447, 447t cyclothymia, 436 cytoskeletal defects, 253 Cytotoxic T‐Lymphocyte Associated Protein 4 (CTLA‐4/CTLA4), 22 data collection and risk assessment, 371–372 death certificate, 288–289 debulking surgery, 16 decision aids, 390 denaturing gradient gel electrophoresis (DGGE), 343–344 dental anomalies in FAP, 65 Denys‐Drash syndrome (DDS), 258 desmoid tumors, 64 diagnosis and assessment of cancer, 4t diagnostic surgery, 15 Diamond‐Blackfan anemia (DBA), 228, 229 clinical features, 230 diagnostic criteria, 229 genetic testing, 230 medical management, 230 syndrome subtypes, 230 tumor risks, 229 DICER1 tumor predisposition syndrome, 230 clinical features, 231 diagnostic criteria, 231 genetic testing, 232 medical management, 232 syndrome subtypes, 232 tumor risks, 231 diethylstilbestrol (DES), 314 diffuse gastric cancer, 96 digestive tract, 37f discernment, 482

513

index

disclosure session content of, 392–393 genetic counseling strategies, 394–396 disorder’s inheritance pattern and other relatives at risk, 276 DNA sequencing, 373 ductal carcinomas, 130 duodenal adenomatous polyps, 64 duodenal polyps, 71 duty to recontact, 495–496 duty to warn, 496–497 dyskeratosis congenita (DKC), 232, 234 clinical features, 234 diagnostic criteria, 234 genetic testing, 234 medical management, 235 syndrome subtypes, 234 tumor risks, 234 effective psychosocial cancer genetic counseling, 455t effective psychosocial genetic counseling, strategies for allow patients to express emotions, 457–458 ascertain the rationale behind questions and reactions, 457 ask rather than assume, 456–457 convey empathy, 454–455 deal with resistant patients, 458–459 employ active listening, 456 help patient with decisions and next action steps, 460 monitor patient reactions, 458 remain professional, 459–460 respect patient boundaries, 458 verbal and nonverbal cues, 456 elusive premalignant cells, 3 emotional closeness of the relationship, 439 emotional reactions and coping strategies, 448–449 emotion‐focused coping strategies, 446 empiric risk, 309, 309t employ active listening, 456 endocrine glands, 42 endometrial intraepithelial neoplasia (EIN), 317 environmentally caused cluster of cancer, 296–297

environmental risk factors, absence of, 295 epidermoid cysts, 65 epithelial ovarian cancer, 130 esophageal cancer syndromes, 113 esophagogastroduodenoscopy (EGD), 68 esophagus, 39 estrangement from family, 291 ethical counselor, strategies for being, 486–488 ethical dilemmas in cancer genetic counseling, types of competing rights and roles, 493 confidentiality and privacy, 493–494 conflict of interest (COI), 494 consent and patient autonomy, 494–495 duty to recontact, 495–496 duty to warn, 496–497 inequality and access, 497–498 prenatal/preimplantation genetic testing, 498 testing children, 499 unintended results, 500–501 ethics of caring, 483–484 ethnocultural/social context, 439–442 European consortium, 226 exact tumor type, documentation of, 132–133 excessive anxiety, 434 exocrine pancreatic cancers, 42 exome/genome testing, 374–375 exposures, 312–314 and associated cancer risk, 313t express emotions, allow patients to, 457–458 external beam radiation therapy (EBRT), 17 extracolonic cancer in FAP, 65t eye disorders, 257 eye manifestations, 260 eye tumor, counseling about, 262–264 facial/head anomalies, 237 familial adenomatous polyposis (FAP), 62, 63, 67, 323 cancer risks, 64–65 diagnostic criteria, 63–64 extracolonic cancer in, 65t genetic testing, 66–67 mechanism, 63 medical management, 68 other clinical features, 65 syndrome subtypes, 66

514 index

familial atypical multiple mole melanoma syndrome (FAMMM), 102f, 166, 178, 323 cancer risks, 103 clinical features, 103, 179 diagnostic criteria, 101–102, 178 genetic testing, 103–104, 179 mechanism, 101 medical management, 104, 179–180 syndrome subtypes, 103, 179 tumor risks, 178–179 familial cluster of cancer, 296 familial intestinal gastric cancer, 112 familial lung cancer clinical features, 180 diagnostic criteria, 180 genetic testing, 181 medical management, 181 syndrome subtypes, 180 tumor risks, 180 familial medullary thyroid carcinoma (FMTC), 189 Familial Risk Assessment—­Breast and Ovarian Cancer (FRA‐BOC), 329, 332 family attachment, 438–439 family communication, 450–453 family context, 437–439 family dynamics and level of support, 277 family flexibility, 438 family history questionnaire, use of, 286 family obligations, 439 family roles, 439 family stories, 439 FANCD1/BRCA2 Fanconi anemia, 237 Fanconi anemia (FA), 235, 236 clinical features, 236–237 diagnostic criteria, 236 genetic testing, 237 heterozygotes, 237 medical management, 237–238 syndrome subtypes, 237 tumor risks, 236 “female cancer,” 132 female reproductive system/gynecological system, 131f fidelity, 482 follow‐up genetic counseling, 399–400 founder pathogenic variant testing, 374 four‐box method, 488–489, 489t Frasier syndrome (FS), 258 fumarate hydratase deficiency (FHD), 185

Gail model, 319 ganglioneuromas, 89 gastric adenocarcinoma and proximal polyposis of the stomach (GAPPS), 64, 66, 112 gastric (stomach) cancer, 47–49 gastroesophageal junction (GEJ), 39 gastrointestinal cancer syndromes anatomy biliary tract, 42–44 colon and rectum, 44–45 esophagus, 39 mouth and pharynx, 36–38 pancreas, 41–42 small intestine, 40 stomach, 39–40 BRCA2‐associated gastric cancer, 113 colorectal cancer, 45–47 esophageal cancer syndromes, 113 familial adenomatous polyposis/ attenuated familial adenomatous polyposis, 62 cancer risks, 64–65 diagnostic criteria, 63–64 genetic testing, 66–67 mechanism, 63 medical management, 68 other clinical features, 65 syndrome subtypes, 66 familial atypical multiple mole melanoma syndrome cancer risks, 103 diagnostic criteria, 101–102 genetic testing, 103–104 mechanism, 101 medical management, 104 other clinical features, 103 syndrome subtypes, 103 familial intestinal gastric cancer, 112 gastric adenocarcinoma and proximal polyposis of the stomach, 112 gastric (stomach) cancer, 47–49 hereditary diffuse gastric cancer syndrome, 96 cancer risks, 98 diagnostic criteria, 97–98 genetic testing, 99 mechanism, 96–97 medical management, 99–101 other clinical features, 98 syndrome subtypes, 99

index

hereditary mixed polyposis syndrome, 90 cancer risks, 92 diagnostic criteria, 91 genetic testing, 92 mechanism, 91 medical management, 92 other clinical features, 92 syndrome subtypes, 92 hereditary pancreatitis/familial pancreatitis, 105 cancer risks, 109 diagnostic criteria, 109 genetic testing, 109 mechanism, 105–106 medical management, 110–111 other clinical features, 109 syndrome subtypes, 110 juvenile polyposis syndrome (JPS), 79 cancer risks, 82 diagnostic criteria, 80–81 genetic testing, 83 mechanism, 80 medical management, 83–84 other clinical features, 82 syndrome subtypes, 83 Li‐Fraumeni syndrome, 111–112 liver (hepato‐)/gallbladder (cholangio‐) cancer syndromes, 113 lynch syndrome, 51 cancer risks, 55–56 diagnostic criteria, 54–55 genetic testing, 58–60 mechanism, 52–54 medical management, 60–62 other clinical features, 56 syndrome subtypes, 56–58 MUTYH‐associated polyposis, 68 cancer risks, 70–71 diagnostic criteria, 69–70 genetic testing, 72–73 mechanism, 69 medical management, 73 other clinical features, 71 syndrome subtypes, 72 NTHL1 tumor syndrome, 73 cancer risks, 74 diagnostic criteria, 74 genetic testing, 75 mechanism, 74

515

medical management, 75 other clinical features, 74 syndrome subtypes, 75 other rare noninherited gastrointestinal tract syndromes, 113–114 pancreatic cancer, 49–51 pancreatic neuroendocrine tumor (NET) syndromes, 113 Peutz‐Jeghers syndrome (PJS), 84 cancer risks, 85–86 diagnostic criteria, 85 genetic testing, 87 mechanism, 85 medical management, 87–88t other clinical features, 86 syndrome subtypes, 87 polymerase proofreading‐associated polyposis syndrome, 75 cancer risks, 77 diagnostic criteria, 76–77 genetic testing, 78–79 mechanism, 76 medical management, 79 other clinical features, 78 syndrome subtypes, 78 PTEN hamartoma tumor syndromes, 88 cancer risks, 89 diagnostic criteria, 89 genetic testing, 90 mechanism, 89 medical management, 90 other clinical features, 89 syndrome subtypes, 90 serrated polyposis syndrome, 92 cancer risks, 94–95 diagnostic criteria, 94 genetic testing, 95 mechanism, 93 medical management, 95–96 other clinical features, 95 syndrome subtypes, 95 gender identity, 270 gender/sexuality, 441 gene‐disease validity, 358 gene panel testing, 370 gene pathogenic variant status, 324–328 generalized anxiety disorder, 434 symptoms of, 434t generalized juvenile polyposis, 239

516 index

genesurance counseling, 381 gene therapy, 25 genetic analysis of tumor, 12–14 genetic counseling approaches, 500 and testing services, 497 genetic counselors, 459 contracting, 396 establishing knowledge base, 396–397 patients primary language, 414–415 pre‐test strategies for facilitating decision making, 384–386 measuring success in informed consent, 386–387 standards of conduct for, 484–485 genetic health care professionals, 388 Genetic Information Non‐Discrimination Act (GINA), 381, 381t, 493 genetic risk, 309 genetics, review of, 399 genetics criteria clinical genetic testing criteria, 330–331 criteria for referral for genetics consultation, 331–332 insurance‐specific genetic testing criteria, 331 genetics education, 372 genetics information, 132 genetic testing technologies, 249, 337, 500 allele‐specific oligonucleotide (ASO), 346–347 array technology, 351–352 ataxia telangiectasia (AT), 219 ATM heterozygous carriers, 134 autoimmune lymphoproliferative syndrome, 221 BAP1 tumor predisposition syndrome, 175 Beckwith‐Wiedemann syndrome, 223 Birt–Hogg–Dubé syndrome, 177–178 Bloom syndrome (BSyn), 225 BRIP1 heterozygous carriers, 139 case examples, 363–365 CHEK2 pathogenic variant carriers, 140 clinical issues, 357–360 conflicting interpretations, 362–363 variant classification, 361–362 variant reclassification, 362 denaturing gradient gel electrophoresis (DGGE), 343–344

determine need for and type of, 275 Diamond‐Blackfan anemia, 230 DICER1 tumor predisposition syndrome, 232 Dyskeratosis congenita, 234 familial adenomatous polyposis/attenuated familial adenomatous polyposis, 66–67 familial atypical multiple mole melanoma syndrome, 103–104, 179 familial lung cancer, 181 Fanconi anemia, 237 Gorlin syndrome, 183 hereditary breast and ovarian cancer syndrome (HBOC), 137 hereditary diffuse gastric cancer (HDGC), 99, 142 hereditary leiomyomatosis renal cell cancer, 185 hereditary mixed polyposis syndrome, 92 hereditary pancreatitis/familial pancreatitis, 109 juvenile polyposis, 240 juvenile polyposis syndrome (JPS), 83 leukemia predisposition syndromes, 241–242 Li‐Fraumeni syndrome (LFS), 144–145, 244 Lynch syndrome, 58–60, 148–149 methylation analysis, 352–354 multiple endocrine neoplasia, type 1, 187 multiple endocrine neoplasia, type 2, 189 multiplex ligase probe amplification (MLPA), 350–351 MUTYH‐associated polyposis, 72–73 neuroblastoma, familial, 246 neurofibromatosis, type 1, 192 neurofibromatosis, type 2, 194–195 next‐generation sequencing (NGS), 348–350 NTHL1 tumor syndrome, 75 older technologies linkage, 338 Maxam‐Gilbert sequencing, 339 Sanger sequencing, 339 paired tumor germline analysis, 354–357 PALB2 heterozygous carriers, 151 paraganglioma–pheochromocytoma syndrome, 197–198 Peutz‐Jeghers syndrome (PJS), 87, 152 polymerase proofreading‐associated polyposis syndrome, 78–79 POT1 tumor predisposition syndrome, 198 prenatal/preimplantation, 498 protein truncation testing (PTT), 341–342

index

psychological assessment throughout, 401–403 PTEN hamartoma tumor syndrome (PHTS), 90, 155–156 RAD51C heterozygous carriers, 157 RAD51D pathogenic variant carriers, 158 renal cell carcinoma papillary type 1, 200 retinoblastoma, hereditary, 247–248 rhabdoid tumor predisposition syndrome, 250 Rothmund‐Thomson syndrome, 252 schwannomatosis, familial, 201 serrated polyposis syndrome, 95 Shwachman‐Diamond syndrome, 253 single nucleotide polymorphisms (SNPs), 344–346 single‐strand conformation polymorphism (SSCP), 343 Southern blotting, 339–341 transcriptome analysis, 354 tuberous sclerosis complex (TSC), 256 Von Hippel‐Lindau syndrome, 203 WT1‐related syndrome, 258 xeroderma pigmentosum, 262 genetic test results, 288 genome‐wide association studies (GWAS), 345 genomic rearrangement testing, 373 germline methylation, 59 germline pathogenic variants, 180 glycosylases, 70 gonadoblastoma tumors, 257 Gorlin syndrome, 182 clinical features, 182–183 diagnostic criteria, 181–182 genetic testing, 183 medical management, 183 syndrome subtypes, 183 tumor risks, 182 gradient gel electrophoresis, 344f group genetic counseling appointment, sample content of, 389t group pre‐test counseling, 389 group pre‐test education, 389 growth deficiency, 225 guanine, 69 gynecological cancer syndromes breast and (see breast and gynecological cancer syndromes) gynecological malignancy risk in Lynch syndrome, 147t

517

head and neck features, 225 health care systems, 480 Health Information Portability and Accountability Act (HIPAA), 493 health‐related decisions, 386 hematologic and solid tumor, 214–216t malignancies associated with childhood cancer syndromes, 214–216t hematopoietic cell transplants, 235 hepatoblastoma, 64 hepatocellular carcinoma and cholangiocarcinoma syndromes, 114t hereditary breast and ovarian cancer syndrome (HBOC), 322 cancer risks, 135–136 clinical features, 136 diagnostic criteria, 135 genetic testing, 137 medical management, 137–139 syndrome subtypes, 136 hereditary cancer genetic testing for, 369 syndrome, 296, 299f hereditary diffuse gastric cancer (HDGC) syndrome, 96, 100f cancer risks, 98, 141 clinical features, 141 diagnostic criteria, 97–98, 141 genetic testing, 99, 142 mechanism, 96–97 medical management, 99–101, 142 other clinical features, 98 syndrome subtypes, 99, 141 hereditary disease, risk of, 322–328 hereditary/familial pancreatic cancer, 50f hereditary gastrointestinal cancers, 35 hereditary hemorrhagic telangiectasia (HHT), 84t, 239 hereditary leiomyomatosis renal cell cancer clinical features, 184–185 diagnostic criteria, 184 genetic testing, 185 medical management, 185 tumor risks, 184 hereditary mixed polyposis syndrome, 90 cancer risks, 92 diagnostic criteria, 91 genetic testing, 92

518 index

hereditary mixed polyposis syndrome (cont’d) mechanism, 91 medical management, 92 other clinical features, 92 syndrome subtypes, 92 hereditary pancreatic cancer, 323 hereditary pancreatitis/familial pancreatitis, 105 cancer risks, 109 diagnostic criteria, 109 genetic testing, 109 mechanism, 105–106 medical management, 110–111 other clinical features, 109 syndrome subtypes, 110 hereditary prostate cancer, 323 heterozygous CDKN1B pathogenic variants, 186 high categories, family at, 297 high‐risk patients, 430–431 histological grades of tumors, 10t hormonal agents, 20 hormones, 312–314 excretion of, 9 use/therapy, 280 Hospital Ethical Review Boards, 492 hospital summary notes, 288 Hoyeraal Hreidarsson syndrome, 234 human leukocyte antigens (HLAs), 26 Huntington disease, 369 hyperplastic/serrated polyps and mixed polyps, 70 hyperthermic intraperitoneal chemotherapy (HIPEC), 27 IBIS model, 325–326 immune checkpoint blockade (ICB) therapy, 21–22 immunodeficiency, 225 immunohistochemistry (IHC) testing, 376 immunotherapy, 20–25 imperfect or lack of screening methods, 3 indeterminate negative result, 377, 397 inequality and access, 497–498 inflammatory bowel disease (IBD), 315 informed consent, 373–382, 488 documentation of, 382–383 measuring success in, 386–387 initial encounter as post‐test counseling, 421 in‐person disclosures, 391 instrumental grief, 444

integrity, 482 intellectual disability (ID), patients with, 412–414 internal radiation therapy, 18 International Cancer of the Pancreas Screening Consortium (CAPS), 104 intersex disorders, 257 intraductal papillary mucinous neoplasms (IPMNs), 316 intuitive grief, 444 in vitro fertilization (IVF), 498 juvenile polyposis syndrome (JPS), 79, 82t, 238–240 cancer risks, 82 clinical features, 239 coli, 239 diagnostic criteria, 80–81, 238 genetic testing, 83, 240 of infancy, 239 mechanism, 80 medical management, 83–84, 240 other clinical features, 82 syndrome subtypes, 83, 239 tumor risks, 239 kindness, 483 KLLN pathogenic variants, 154 learning disabilities, 225 Leigh syndrome, 196–197 leukemia predisposition syndromes clinical features, 241 diagnostic criteria, 240 genetic testing, 241–242 medical management, 242 syndrome subtypes, 241 tumor risks, 241 leukemias, 6 level of family support and communication, 453–454 Lhermitte‐Duclos disease (LDD), 90, 154 Li‐Fraumeni‐like (LFL) syndromes, 143t, 242t Li‐Fraumeni syndrome (LFS), 111–112, 143t, 172, 242t, 276, 322, 326 cancer risks, 143–144 clinical features, 144, 244 diagnostic criteria, 143, 242–243 genetic testing, 144–145, 244 medical management, 145–146, 244–245

index

syndrome subtypes, 144, 244 tumor risks, 243 liquid biopsies, 355–357, 356f liver functions, 43 liver (hepato‐)/gallbladder (cholangio‐) cancer syndromes, 113 lobular carcinoma in situ (LCIS), 314–315 loss of control, 444 low‐penetrance pathogenic variants, 244 low penetrant RB, 247 low risk categories, family at, 298–299 lymph nodes and vessels, 130 lymphomas, 6 Lynch/hereditary colon cancer, 326–327 Lynch syndrome, 51, 323 cancer risks, 55–56, 57t, 146, 147t clinical features, 148 diagnostic criteria, 54–55, 146 genes, 226 genetic testing, 58–60, 148–149 gynecological malignancy risk in, 147t mechanism, 52–54 medical management, 60–62, 149 other clinical features, 56 syndrome subtypes, 56–58, 148 major life transitions, 450t malignant cells play tricks, 14 malignant melanoma, 101 lifetime risk of, 179 malignant peripheral nerve sheath tumors (MPNSTs), 191 maternal imprinting, cases of, 247 Maxam‐Gilbert sequencing, 339 medical management options, 392–393 melanomas, 178 counseling about, 204–205 risk, 318, 321 MelaPRO model, 327 MELPREDICT model, 328 MEN2B, 188, 189 menopausal hormone therapy, 313 mental health challenges, patients with, 411–412 mental health referral, 461–463, 461t mental health status acute stress disorder/post‐traumatic stress disorder, 436–437 anxiety disorders, 434–435

519

bipolar disease, 435–436 borderline personality disorder (BPD), 437 depressive disorders, 433 mesothelioma, counseling about, 204–205 metastatic disease, cancer patients with, 432–433 metastatic uveal melanoma, 175 methylation analysis, 352–354 microarray‐based comparative genomic hybridization, 353f microsatellite instability (MSI), 376 mixed types, 6 MMRPredict, 327 MMRPro model, 327 mode of results disclosure, 391–392 moderate categories, family at, 297–298 molecular studies, 13–14 molecular subtypes of colorectal cancer, 13f moles, 315 monitor patient reactions, 458 mosaicism, 378 mosaic results, 378–379 mouth and pharynx, 36–38 mucocutaneous lesions, 86 Muir‐Torre syndrome (MTS), 58, 148 multidimensional measure of informed choice (MMIC), 387 multifocal or bilateral cancers, 295 multigene panel testing (MGPT), 374 multiple endocrine neoplasia type 1 clinical features, 186 diagnostic criteria, 185 genetic testing, 187 medical management, 187 syndrome subtypes, 186–187 tumor risks, 186 type 2, 187–190 clinical features, 188 diagnostic criteria, 188 genetic testing, 189 medical management, 189–190 syndrome subtypes, 188–189 tumor risks, 188 multiple primary cancers, 295 multiplex ligase probe amplification (MLPA), 350–351, 352f multiplex‐ligation‐dependent probe amplification (MLPA), 341

520 index

Münchausen syndrome, 293 MUTYH‐associated polyposis, 68 cancer risks, 70–71 diagnostic criteria, 69–70 genetic testing, 72–73 mechanism, 69 medical management, 73 other clinical features, 71 syndrome subtypes, 72 MUTYH polyposis, 71t–73t myelodysplastic syndrome (MDS), 212, 229, 236 myeloma, 6 myeloproliferative neoplasms, 7t Myriad II, 324–325 nasopharynx, 38 National Cancer Institute (NCI), 319 National Comprehensive Cancer Network (NCCN), 330–332, 370 National Institutes of Health (NIH), 361 National Institutes of Mental Health (NIMH), 433 National Quality Forum (NQF), 386 National Society of Genetic Counselors (NSGC), 270, 271 code of ethics, 485t negative results, 398 neoplasm, 5 neuroblastic tumors, 245 neuroblastoma, familial clinical features, 246 diagnostic criteria, 245 genetic testing, 246 medical management, 246 syndrome subtypes, 246 tumor risks, 245 neuroblastomas, 245 neuroectodermal tumors, 6 neurofibromatosis (NF1), 149–150 cancer risks, 150 diagnosis, 149 medical management, 150 type 1 clinical features, 191 diagnostic criteria, 190 genetic testing, 192 medical management, 192 syndrome subtypes, 191–192 tumor risks, 190–191

type 2, 192–195 clinical features, 194 diagnostic criteria, 192–193 genetic testing, 194–195 medical management, 195 syndrome subtypes, 194 tumor risks, 194 neurologic problems, 260 newly diagnosed cancer patients, 431 next‐generation sequencing (NGS), 348–350, 349f methods, 244 technology, 374 Nicolaides Baraitser syndrome, 250 NIH Breast Cancer Risk Assessment Tool, 329 noncancerous features, presence of, 281 nondisease indicators of risk, 317–318 non‐genetics professional, 332–333 non‐Hodgkin lymphoma, 227 nonmaleficence, 479 nonmalignant features, 295 NTHL1 tumor syndrome, 73 cancer risks, 74 diagnostic criteria, 74 genetic testing, 75 mechanism, 74 medical management, 75 other clinical features, 74 syndrome subtypes, 75 occupations or occupational exposure, 29–30t odds ratio (OR), 309 oligonucleotide probes, 346 oncolytic virus (OV) therapy, 24 online risk assessment tools and calculators for clinicians, 328–329 Ontario Family History Assessment Tool (FHAT), 325 oral cavity and pharynx, 38, 38f oral contraceptives (OCs), 312–313 oral systemic therapy, 18 ordinary moral standards, 481 ovarian cancer risk, 321 ovary, 316 paired tumor germline analysis, 354–357 paired tumor/germline testing, 375

index

PALB2 heterozygous carriers cancer risks, 150 clinical features, 150 diagnostic criteria, 150 genetic testing, 151 medical management, 151 syndrome subtypes, 150 palliative surgery, 16 PancPro, 322 pancreas, 41–42, 316 pancreatic cancer, 49–51 Pancreatic Cancer Action Network, 321 pancreatic cancer risk, 321–322 pancreatic dysfunction, 253 pancreatic exocrine function, 110 pancreatic intraepithelial neoplasia (PanIN), 316 pancreatic neuroendocrine tumor (NET) syndromes, 113 pancreatitis, 105 panic disorders, 435 paraganglioma–pheochromocytoma syndrome clinical features, 196 diagnostic criteria, 195 genetic testing, 197 medical management, 197–198 syndrome subtypes, 196–197 tumor risks, 195–196 paragangliomas, 150 subtype 1, 197 subtype 2, 197 subtype 3, 197 subtype 4, 197 paraganglioma syndrome (PGL), 194, 195 Pate v. Threlkel, 496 pathogenic variant (PV), 318, 376 pathology report, 287–288 patient confidentiality, respecting, 486–487 patient‐friendly risk assessment tools, 329–330 patient privacy, respecting, 487 patient reactions coping responses, and risk perception, 442–446 to results, 397–398 patients decisions, respecting, 487 emotional state, 277 at end of life, 410–411 family stories, 277 with intellectual disability, 412–414

521

with mental health challenges, 411–412 primary language, 414–415 pediatric cancer genetic counseling, 209, 210 pediatric tumor predisposition syndromes, 213 ataxia telangiectasia (AT), 218–219 autoimmune lymphoproliferative syndrome, 219–221 Beckwith‐Wiedemann syndrome, 221–224 benign tumors associated with childhood cancer syndromes, 216–217t Bloom syndrome (BSyn), 224–226 case examples, 262–265 constitutional mismatch repair deficiency syndrome, 226–228 counseling issues, 209–213 Diamond‐Blackfan anemia (DBA), 228–230 DICER1 tumor predisposition syndrome, 230–232 dyskeratosis congenita, 232–235 Fanconi anemia, 235–238 hematologic and solid tumor malignancies associated with childhood cancer syndromes, 214–216t juvenile polyposis syndrome (JPS), 238–240 leukemia predisposition syndromes, 240–242 Li‐Fraumeni syndrome, 242–245 neuroblastoma, familial, 245–246 retinoblastoma, hereditary, 246–248 rhabdoid tumor predisposition syndrome, 248–250 Rothmund‐Thomson syndrome, 250–252 Shwachman‐Diamond syndrome, 252–253 tuberous sclerosis complex (TSC), 254–256 WT1‐related syndrome, 256–258 xeroderma pigmentosum, 259–262 pedigree, definition and purpose of assist with management recommendations, 275 clinical record and research tool, 276 determine need for and type of genetic testing, 275 disorder’s inheritance pattern and other relatives at risk, 276 family dynamics and level of support, 277 identify cancer syndrome, 271–275 patient’s emotional state, 277 patient’s family stories, 277 uncover other syndromes, 275–276 pedigree construction, questions during, 273–274t

522 index

PENN II model, 325 personal and family history information, updating, 400 personalized cancer therapy, 388 Peutz‐Jeghers syndrome (PJS), 84, 151–152 cancer risks, 85–86, 151–152 clinical features, 152 diagnostic criteria, 85, 151 genetic testing, 87, 152 mechanism, 85 medical management, 87–88t, 153 other clinical features, 86 syndrome subtypes, 87, 152 pheochromocytoma syndrome (PCC), 194, 195 phobia‐related disorders, 434 photon particles, 17 physical health/cancer status, 430–433 physical symptoms, 431 polyaromatic hydrocarbons (PAH), 28 polygenic risk score (PRS) testing, 317, 345, 346, 375 polymerase proofreading‐associated polyposis syndrome, 75 cancer risks, 77 diagnostic criteria, 76–77 genetic testing, 78–79 mechanism, 76 medical management, 79 other clinical features, 78 syndrome subtypes, 78 polyps, 315 positive CDH1 result, counseling about reactions to, 468–470 positive results, 376–377, 397, 398 positive TP53 result, counseling about reactions to, 470–472 post‐traumatic stress disorder (PTSD), 437t POT1 tumor predisposition syndrome clinical features, 198 diagnostic criteria, 198 genetic testing, 198 medical management, 198–199 syndrome subtypes, 198 tumor risks, 198 pre‐and post‐test genetic counseling, 369–370 alternative service delivery models for pre‐test education, 388 chatbots, 390

decision aids, 390 group pre‐test counseling, 389 case examples, 404–405 confidentiality, 387 follow‐up genetic counseling, 399–400 genetic counselors contracting, 396 establishing knowledge base, 396–397 genetic health care professionals, 388 negative results, 398 patient reactions to results, 397–398 positive results, 398 pre‐test strategies for genetic counselors facilitating decision making, 384–386 measuring success in informed consent, 386–387 psychological assessment throughout genetic testing process, 401–403 traditional post‐test genetic counseling, 390 content of disclosure session, 392–393 disclosure session genetic counseling strategies, 394–396 mode of results disclosure, 391–392 traditional pre‐test genetic counseling session basis for decision making, 371–372 documentation of informed consent, 382–383 genetic test results disclosure, 383–384 informed consent, 373–382 use of samples for research, 387–388 VUS results, 399 preimplantation genetic testing (PGT), 498 PREMM5 model, 327 prenatal/preimplantation genetic testing, 498 pre‐test education, alternative service delivery models for, 388 chatbots, 390 decision aids, 390 group pre‐test counseling, 389 pre‐test genetic counseling session, 371 pre‐test informed consent, 371 pre‐test strategies for genetic counselors facilitating decision making, 384–386 measuring success in informed consent, 386–387 primary cancer or recurrence, 8 primitive neuroectodermal tumors (PNETs), 190 principle‐based bioethics autonomy, 477–479 beneficence, 479

index

nonmaleficence, 479 principle of justice, 479–480 principle of justice, 479–480 professional genetics organizations, 499t Programmed Death 1 (PD‐1/PD1), 22 prolactinomas, 186 prophylactic total gastrectomy (PTG), 142 prostate, 316–317 prostatic intraepithelial neoplasia (PIN), 316 protein truncation testing (PTT), 341–342 Proteus syndrome, 154 proton beam therapy, 17 psychological assessment throughout genetic testing process, 401–403 psychological counseling services, 461 psychological/emotional education, 372 psychosocial counseling, strategies for providing baseline mental health issues, 447–448 current emotional well‐being, 446–447, 447t emotional reactions and coping strategies, 448–449 family communication, 450–453 level of family support and communication, 453–454 timing issues and major life transitions and timing issues, 449–450 PTEN hamartoma tumor syndrome (PHTS), 155–156t, 322, 323t cancer risks, 154 clinical features, 154 diagnostic criteria, 153 genetic testing, 155–156 syndrome subtypes, 154 PTEN hamartoma tumor syndromes, 88, 326 cancer risks, 89 diagnostic criteria, 89 genetic testing, 90 mechanism, 89 medical management, 90 other clinical features, 89 syndrome subtypes, 90 PTEN risk calculator, 326 pulmonary lesion, counseling about, 264–265 RAD51C heterozygous carriers cancer risks, 157 clinical features, 157 clinical recommendations, 157

523

diagnostic criteria, 156 genetic testing, 157 syndrome subtypes, 157 RAD51D pathogenic variant carriers cancer risks, 157 clinical features, 158 diagnostic criteria, 157 genetic testing, 158 medical management, 158 syndrome subtypes, 158 radial ray anomalies, 236–237 radiation therapy, 16 types of, 17–18 rare noninherited gastrointestinal tract syndromes, 113–114 rare tumor predisposition syndromes, 165–166t, 167–168t autosomal dominant with incomplete penetrance, 171 BAP1 tumor predisposition syndrome, 174–176 benign tumors and nontumor, 166, 167–170t bilateral tumors or multiple tumor primaries occur more frequently, 171 Birt–Hogg–Dubé syndrome, 176–178 case examples, 204–207 clinical features of selected, 173 counseling issues with, 171–173 familial atypical multiple mole melanoma syndrome, 178–180 familial lung cancer, 180–181 Gorlin syndrome, 181–183 hereditary leiomyomatosis renal cell cancer, 183–185 multiple endocrine neoplasia, Type 1, 185–187 multiple endocrine neoplasia, Type 2, 187–190 neurofibromatosis, Type 1, 190–192 neurofibromatosis, Type 2, 192–195 nontumor features in, 168–170t paraganglioma–pheochromocytoma syndrome, 195–198 POT1 tumor predisposition syndrome, 198–199 presence of tumor in proband, 164–166 renal cell carcinoma papillary type 1, 199–200 schwannomatosis, familial, 200–202 unusual and/or uncommon cancers, 163–164 Von Hippel‐Lindau syndrome, 202–204 rationale behind questions and reactions, 457 reconstructive surgery, 16

524 index

recurrent acute pancreatitis/chronic pancreatitis genetic risk factors, 107–108t reduced fertility, 225, 237 relative risk (RR), 308 religion/spirituality, 440–441 renal cell carcinoma papillary type 1 clinical features, 199 diagnostic criteria, 199 genetic testing, 200 medical management, 200 syndrome subtypes, 199 tumor risks, 199 renal disorders, 257 reproductive risks, 257 resistant patients, deal with, 458–459 resource identification, 393 respectfulness, 483 respect patient boundaries, 458 retinoblastoma, hereditary clinical features, 247 diagnostic criteria, 246–247 genetic testing, 247–248 medical management, 248 syndrome subtypes, 247 tumor risks, 247 retinoblastoma protein (pRB), 101 retinoid agents, 27 Revesz syndrome, 234 rhabdoid tumor predisposition syndrome (RTPS) clinical features, 249 diagnostic criteria, 249 genetic testing, 250 medical management, 250 syndrome subtypes, 249–250 tumor risks, 249 risk factors for cancer, 28, 29t risk modeling, 318 models that combine PV risk and penetrance information, 328 online risk assessment tools and calculators for clinicians, 328–329 patient‐friendly risk assessment tools, 329–330 risk of developing cancer, 319–322 risk of hereditary disease, 322–328 risk perception changes in, 311–312 factors that contribute to, 310–311

risk‐reducing bilateral mastectomy (RRBM), 138, 146 risk‐reducing bilateral salpingo‐oophorectomy (RRBSO), 138 risk‐reducing surgery, 16, 156 RNA testing, 375 Rothmund‐Thomson syndrome (RTS), 250 clinical features, 251–252 diagnostic criteria, 250–251 genetic testing, 252 medical management, 252 syndrome subtypes, 252 tumor risks, 251 Safer v. Estate of Pack, 496–497 Sanger sequencing, 339 sarcomas, 5–6 schwannomatosis, familial, 200 clinical features, 201 diagnostic criteria, 200 genetic testing, 201 medical management, 201–202 syndrome subtypes, 201 tumor risks, 200–201 secretin‐stimulated pancreatic bicarbonate secretion testing, 110 segmental neurofibromatosis, 191, 194 segmental schwannomatosis, 201 selective internal radiation therapy (SIRT), 18 sequencing by synthesis (SBS), 348 serrated polyposis syndrome, 92 cancer risks, 94–95 diagnostic criteria, 94 genetic testing, 95 mechanism, 93 medical management, 95–96 other clinical features, 95 syndrome subtypes, 95 serrated polyps, 93, 94t serum trypsinogen, 110 service delivery models (SDMs), 388 sex cord tumors with annular tubules (SCTAT), 152 shared decision making (SDM), 384, 386, 387 Shwachman‐Diamond syndrome (SDS), 252 clinical features, 253 diagnostic criteria, 252 genetic testing, 253

525

index

medical management, 253 syndrome subtypes, 253 tumor risks, 253 signal transduction inhibitors, 20 signet ring cell cancer (SRCC), 101 single nucleotide polymorphisms (SNPs), 317–318, 344–346 single nucleotide variants (SNVs), 345 single‐site analysis, 374 single‐strand conformation polymorphism (SSCP), 343 site of origin, 5 Skeletal anomalies, 251 skin, 315 changes, 225 complexion, 318 pigmentation, 237 small cell lung cancer, counseling about, 205–207 small intestine, 40, 41f social anxiety disorders, 435 social identity and intersectionality, 442 social isolation, 432 somatic mosaicism, 378 somatic testing, 376 Southern blotting, 339–341 special populations, counseling for, 409 patients at end of life, 410–411 patients primary language, 414–415 patients with intellectual disability, 412–414 patients with mental health challenges, 411–412 transgender and gender diverse (TGD), 415–417 SPIKES model, 419 sporadic forms of cancer, 297 sporadic juvenile polyps, 81 staging, 11–12 surgery, 15 standardized pedigree nomenclature, 284 stem cells, 26 transplantation, 25–26 stomach, 39–40 surgery of cancer treatment curative/tumor removal surgery, 15 debulking surgery, 16 diagnostic surgery, 15 reconstructive surgery, 16 risk‐reducing surgery, 16 staging surgery, 15

surgical procedures, 280–281 syndrome overlap, 133 tamoxifen, 20 targeted therapy, 19–25 T‐cell receptor (TCR), 22 telephone disclosures, 391 testing benefits of, 379–380 children, 499 risks of, 380–381 timing of, 132 thermal therapy, 27 13q deletion syndrome, 247 thyroid cancer, 64 thyroid‐stimulating hormone (TSH), 18 timing issues and major life transitions and timing issues, 449–450 timing of testing, 132 tissue type, 5–7 Title VI of the Civil Rights Act of 1964, 414 TNM cancer staging of medullary thyroid carcinoma, 12t traditional post‐test genetic counseling, 390 content of disclosure session, 392–393 disclosure session genetic counseling strategies, 394–396 mode of results disclosure, 391–392 traditional pre‐test genetic counseling session, 372 basis for decision making, 371–372 documentation of informed consent, 382–383 genetic test results disclosure, 383–384 informed consent, 373–382 transcriptome analysis, 354 transference, 459 transgender and gender diverse (TGD), 415–417 true negative result, 378, 398 trustworthiness, 483 tuberous sclerosis (TS), 255 tuberous sclerosis complex (TSC) clinical features, 255 diagnostic criteria, 254 genetic testing, 256 medical management, 256 syndrome subtypes, 255–256 tumor risks, 254–255

526 index

tumor classification benign tumors, 8–9 genetic analysis of the tumor, 12–14 staging, 11–12 tumor grading, 10–11 tumor genomic testing, 375 tumor grading, 10–11 tumor mutational burden (TMB), 54 tumor sequencing, 376 Turcot syndrome, 58, 148 type 1 papillary renal tumors, 199 Tyrer‐Cuzick model, 319, 325–326 unanticipated results, counseling about addressing unknown cancer risk, 419–421 initial encounter as post‐test counseling, 421 transgender and gender diverse (TGD), 415–417 unexpected high‐penetrance pathogenic variants, 417–419 unexpected high‐penetrance pathogenic variants, 417–419 unintended results, 500–501 unknown cancer risk, addressing, 419–421 unusual and/or uncommon cancers, 163–164 uterine, 317 variant classification, 361–362 variant curation expert panels (VCEPS), 362 variant reclassification, 362 variants of uncertain significance (VUS), 264, 362, 377, 398, 399 veracity, 483 verbal and nonverbal cues, 456

verbal confirmation, 287 vestibular schwannoma, 194 virtue ethics, 480–483 Von Hippel‐Lindau (VHL) syndrome, 166, 172, 297 clinical features, 203 diagnostic criteria, 202 genetic testing, 203 medical management, 204 syndrome subtypes, 203 tumor risks, 202–203 WAGR syndrome, 258 warning signs, lack of, 2 whole‐genome sequencing (WGS), 374 wisdom, 483 WT1‐related syndrome clinical features, 257 diagnostic criteria, 257 genetic testing, 258 medical management, 258 syndrome subtypes, 258 tumor risks, 257 xeroderma pigmentosum (XP), 259, 260 clinical features, 260 diagnostic criteria, 259 genetic testing, 262 medical management, 262 and related disorders, 261t syndrome subtypes, 260–262 and trichothiodystrophy, 262 tumor risks, 260

WILEY END USER LICENSE AGREEMENT Go to www.wiley.com/go/eula to access Wiley’s ebook EULA.