Cell Reprogramming: Methods and Protocols 1493928473, 9781493928477

Citation preview

Methods in Molecular Biology 1330

Paul J. Verma Huseyin Sumer Editors

Cell Reprogramming Methods and Protocols

METHODS

IN

MOLECULAR BIOLOGY

Series Editor John M. Walker School of Life and Medical Sciences University of Hertfordshire Hatfield, Hertfordshire, AL10 9AB, UK

For further volumes: http://www.springer.com/series/7651

Cell Reprogramming Methods and Protocols

Edited by

Paul J. Verma Stem Cell and Genetic Engineering Group, Department of Materials Engineering, Faculty of Engineering, Monash University, Clayton, VIC, Australia; South Australian Research & Development Institute (SARDI), Turretfield Research Centre, Rosedale, SA, Australia

Huseyin Sumer Swinburne University of Technology, Hawthorn, VIC, Australia

Editors Paul J. Verma Stem Cell and Genetic Engineering Group Department of Materials Engineering Faculty of Engineering Monash University Clayton, VIC, Australia South Australian Research & Development Institute (SARDI) Turretfield Research Centre Rosedale, SA, Australia

Huseyin Sumer Swinburne University of Technology Hawthorn, VIC, Australia

ISSN 1064-3745 ISSN 1940-6029 (electronic) Methods in Molecular Biology ISBN 978-1-4939-2847-7 ISBN 978-1-4939-2848-4 (eBook) DOI 10.1007/978-1-4939-2848-4 Library of Congress Control Number: 2015955417 Springer New York Heidelberg Dordrecht London © Springer Science+Business Media New York 2015 This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, express or implied, with respect to the material contained herein or for any errors or omissions that may have been made. Printed on acid-free paper Humana Press is a brand of Springer Springer Science+Business Media LLC New York is part of Springer Science+Business Media (www.springer.com)

Preface Cell Reprogramming: Methods and Protocols is a comprehensive review of cellular reprogramming technology in vertebrates, aimed at reprogramming differentiated cells and germ line transmission of pluripotent stem cells. The emphasis here is on providing readily reproducible techniques for inducing pluripotency in somatic cells for disease modeling and the generation of cloned embryos and animals in a number of key research and commercially important species. Additional chapters dealing with such reprogramming-related issues such as analysis of mitochondrial DNA in reprogrammed cells and the isolation of reprogramming intermediates are also included. A section providing alternative cutting-edge methods for nuclear transfer, as well as techniques for the production of germ line chimeras from embryonic stem cells and induced pluripotent stem cells is also incorporated. This is complimented with the neonatal care and management of somatic cell nuclear transfer derived offspring. Cell Reprogramming also provides an understanding of the factors involved in nuclear reprogramming, which is imperative for the success of reprogramming. This volume will prove beneficial to molecular biologists, stem cell biologists, clinicians, biotechnologists, students, veterinarians, and animal care technicians involved with reprogramming, nuclear transfer, and transgenesis. Clayton, VIC, Australia Hawthorn, VIC, Australia

Paul J. Verma Huseyin Sumer

v

Contents Preface. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

PART I

BACKGROUND

1 Cellular Reprogramming in Basic and Applied Biomedicine: The Dawn of Regenerative Medicine. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Wendy Dean

PART II

3

DE NOVO REPROGRAMMING

2 Synthetic mRNA Reprogramming of Human Fibroblast Cells . . . . . . . . . . . . . Jun Liu and Paul J. Verma 3 MicroRNA-Mediated Reprogramming of Somatic Cells into Induced Pluripotent Stem Cells. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Shelley E.S. Sandmaier and Bhanu Prakash V.L. Telugu 4 Generation of Footprint-Free Induced Pluripotent Stem Cells from Human Fibroblasts Using Episomal Plasmid Vectors. . . . . . . . . . . . . . . . Dmitry A. Ovchinnikov, Jane Sun, and Ernst J. Wolvetang 5 Reprogramming of Human Fibroblasts with Non-integrating RNA Virus on Feeder-Free or Xeno-Free Conditions . . . . . . . . . . . . . . . . . . . . . . . . Pauline T. Lieu

PART III

v ix

17

29

37

47

LIVESTOCK, DOMESTIC AND ENDANGERED SPECIES

6 Inducing Pluripotency in Cattle . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Luis F. Malaver-Ortega, Amir Taheri-Ghahfarokhi, and Huseyin Sumer 7 Generation of Induced Pluripotent Stem Cells (iPSCs) from Adult Canine Fibroblasts . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Sehwon Koh and Jorge A. Piedrahita 8 Derivation of Equine-Induced Pluripotent Stem Cell Lines Using a piggyBac Transposon Delivery System and Temporal Control of Transgene Expression . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Kristina Nagy and Andras Nagy 9 Generation of Avian Induced Pluripotent Stem Cells . . . . . . . . . . . . . . . . . . . . Yangqing Lu, Franklin D. West, Brian J. Jordan, Robert B. Beckstead, Erin T. Jordan, and Steven L. Stice

vii

57

69

79 89

viii

Contents

10 Generation of Induced Pluripotent Stem Cells from Mammalian Endangered Species . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Inbar Friedrich Ben-Nun, Susanne C. Montague, Marlys L. Houck, Oliver Ryder, and Jeanne F. Loring

PART IV

GERM-LINE TRANSMISSION OF PLURIPOTENT STEM CELLS

11 Generation of Efficient Germ-Line Chimeras Using Embryonic Stem Cell Injection . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . William A. Ritchie 12 Generation of Viable Mice from Induced Pluripotent Stem Cells (iPSCs) Through Tetraploid Complementation . . . . . . . . . . . . . . . Lan Kang and Shaorong Gao 13 Cloning Endangered Felids by Interspecies Somatic Cell Nuclear Transfer. . . . Martha C. Gómez and C. Earle Pope 14 Generation of Chimeras from Porcine Induced Pluripotent Stem Cells . . . . . . Franklin D. West, Steve L. Terlouw, John R. Dobrinsky, Yangqing Lu, Erin T. Jordan, and Steven L. Stice 15 A Novel Method of Somatic Cell Nuclear Transfer with Minimum Equipment . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . S.M. Hosseini, F. Moulavi, and M.H. Nasr-Esfahani 16 Neonatal Care and Management of Foals Derived by Somatic Cell Nuclear Transfer . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Aime K. Johnson and Katrin Hinrichs

PART V

101

113

125 133 153

169

189

INFLUENCING REPROGRAMMING AND GENOME EDITING

17 Isolation of Reprogramming Intermediates During Generation of Induced Pluripotent Stem Cells from Mouse Embryonic Fibroblasts . . . . . . Christian M. Nefzger, Sara Alaei, and Jose M. Polo 18 Analysis of Mitochondrial DNA in Induced Pluripotent and Embryonic Stem Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . William Lee, Richard D.W. Kelly, Ka Yu Yeung, Gael Cagnone, Matthew McKenzie, and Justin C. St. John 19 Genome Modification of Pluripotent Cells by Using Transcription Activator-Like Effector Nucleases (TALENs). . . . . . . . . . . . . . . . . . . . . . . . . . Amir Taheri-Ghahfarokhi, Luis F. Malaver-Ortega, and Huseyin Sumer Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

205

219

253

269

Contributors SARA ALAEI • Department of Anatomy and Developmental Biology, Australian Regenerative Medicine Institute, Monash University, Clayton, VIC, Australia ROBERT B. BECKSTEAD • Department of Animal and Dairy Science, Regenerative Bioscience Center, University of Georgia, Athens, GA, USA INBAR FRIEDRICH BEN-NUN • Department of Chemical Physiology, Center for Regenerative Medicine, The Scripps Research Institute, La Jolla, CA, USA GAEL CAGNONE • The Mitochondrial Genetics Group, Centre for Genetic Diseases, Hudson Institute of Medical Research, Monash University, Clayton, VIC, Australia WENDY DEAN • Epigenetics Programme, The Babraham Institute, Cambridgeshire, UK JOHN R. DOBRINSKY • JRD Biotechnology, Oregon, WI, USA SHAORONG GAO • National Institute of Biological Sciences, NIBS, Beijing, People’s Republic of China; School of Life Sciences and Technology, Tongji University, Shanghai, People’s Republic of China MARTHA C. GÓMEZ • Audubon Nature Center for Research of Endangered Species, New Orleans, LA, USA KATRIN HINRICHS • Department of Veterinary Physiology and Pharmacology, College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, TX, USA S.M. HOSSEINI • Department of Reproductive Biotechnology at Reproductive Biomedicine Research Center, Royan Institute for Biotechnology, ACECR, Isfahan, Iran MARLYS L. HOUCK • San Diego Zoo Institute for Conservation Research, Escondido, CA, USA JUSTIN C. ST. JOHN • The Mitochondrial Genetics Group, Centre for Genetic Diseases, Hudson Institute of Medical Research, Monash University, Clayton, VIC, Australia AIME K. JOHNSON • JT Vaughn Large Animal Teaching Hospital, College of Veterinary Medicine, Auburn University, Auburn, AL, USA BRIAN J. JORDAN • Department of Animal and Dairy Science, Regenerative Bioscience Center, University of Georgia, Athens, GA, USA ERIN T. JORDAN • Department of Animal and Dairy Science, Regenerative Bioscience Center, University of Georgia, Athens, GA, USA LAN KANG • Institute of Cancer Stem Cell, Dalian Medical University, Dalian, People’s Republic of China; National Institute of Biological Sciences, NIBS, Beijing, People’s Republic of China RICHARD D.W. KELLY • The Mitochondrial Genetics Group, Centre for Genetic Diseases, Hudson Institute of Medical Research, Monash University, Clayton, VIC, Australia SEHWON KOH • Department of Cell Biology, Duke University, Durham, NC, USA; Duke University Medical Center, Duke University, Durham, NC, USA WILLIAM LEE • The Mitochondrial Genetics Group, Centre for Genetic Diseases, Hudson Institute of Medical Research, Monash University, Clayton, VIC, Australia

ix

x

Contributors

PAULINE T. LIEU • Global R&D, Life Technologies Corporation, Carlsbad, CA, USA JUN LIU • Stem Cell and Genetic Engineering Group, Department of Materials Engineering, Faculty of Engineering, Monash University—Clayton Campus, Clayton, VIC, Australia JEANNE F. LORING • Department of Chemical Physiology, Center for Regenerative Medicine, The Scripps Research Institute, La Jolla, CA, USA; Department of Reproductive Medicine, University of California, San Diego, La Jolla, CA, USA YANGQING LU • Department of Animal and Dairy Science, Regenerative Bioscience Center, University of Georgia, Athens, GA, USA; JRD Biotechnology, Oregon, WI, USA; State Key Laboratory for Conservation and Utilization of Subtropical Agro-bioresources, Guangxi University, Nanning, China LUIS F. MALAVER-ORTEGA • Monash Institute for Medical Research, Monash University, Clayton, VIC, Australia; Australian Animal Health Laboratories, CSIRO Biosecurity Flagship, East Geelong, VIC, Australia MATTHEW MCKENZIE • The Molecular Basis of Mitochondrial Disease Group, Centre for Genetic Diseases, Hudson Institute of Medical Research, Monash University, Clayton, VIC, Australia SUSANNE C. MONTAGUE • Department of Chemical Physiology, Center for Regenerative Medicine, The Scripps Research Institute, La Jolla, CA, USA F. MOULAVI • Department of Reproductive Biotechnology at Reproductive Biomedicine Research Center, Royan Institute for Biotechnology, ACECR, Isfahan, Iran ANDRAS NAGY • Lunenfeld-Tanenbaum Research Institute, Mount Sinai Hospital, Toronto, ON, Canada; Department of Obstetrics and Gynecology, University of Toronto, Toronto, ON, Canada KRISTINA NAGY • Lunenfeld-Tanenbaum Research Institute, Mount Sinai Hospital, Toronto, ON, Canada M.H. NASR-ESFAHANI • Department of Reproductive Biotechnology at Reproductive Biomedicine Research Center, Royan Institute for Biotechnology, ACECR, Isfahan, Iran CHRISTIAN M. NEFZGER • Department of Anatomy and Developmental Biology, Australian Regenerative Medicine Institute, Monash University, Clayton, VIC, Australia DMITRY A. OVCHINNIKOV • Stem Cell Engineering Group, Australian Institute for Bioengineering and Nanotechnology, University of Queensland, Brisbane, QLD, Australia JORGE A. PIEDRAHITA • Department of Molecular Biomedical Sciences, College of Veterinary Medicine, North Carolina State University, Raleigh, NC, USA; Genomics Program, North Carolina State University, Raleigh, NC, USA; Center for Comparative Medicine and Translational Research, North Carolina State University, Raleigh, NC, USA JOSE M. POLO • Department of Anatomy and Developmental Biology, Australian Regenerative Medicine Institute, Monash University, Clayton, VIC, Australia C. EARLE POPE • Audubon Nature Center for Research of Endangered Species, New Orleans, LA, USA WILLIAM A. RITCHIE • Roslin Embryology Ltd., Macmerry, Tranent, Scotland, UK; Monash Biomed Private Limited, Delhi, India OLIVER RYDER • San Diego Zoo Institute for Conservation Research, Escondido, CA, USA STEVEN L. STICE • Department of Animal and Dairy Science, Regenerative Bioscience Center, University of Georgia, Athens, GA, USA

Contributors

xi

HUSEYIN SUMER • Department of Chemistry and Biotechnology, Faculty of Science, Engineering and Technology, Swinburne University of Technology, Hawthorn, VIC, Australia JANE SUN • Stem Cell Engineering Group, Australian Institute for Bioengineering and Nanotechnology, University of Queensland, Brisbane, QLD, Australia SHELLEY E.S. SANDMAIER • Department of Animal and Avian Sciences, University of Maryland, College Park, MD, USA; Animal Bioscience and Biotechnology Laboratory, USDA-ARS, Beltsville, MD, USA AMIR TAHERI-GHAHFAROKHI • Department of Animal Science, Ferdowsi University of Mashhad, Mashhad, Iran BHANU PRAKASH V.L. TELUGU • Department of Animal and Avian Sciences, University of Maryland, College Park, MD, USA; Animal Bioscience and Biotechnology Laboratory, USDA-ARS, Beltsville, MD, USA STEVE L. TERLOUW • Minitube of America, Mt. Horeb, WI, USA PAUL J. VERMA • Stem Cell and Genetic Engineering Group, Department of Materials Engineering, Monash University, Clayton, VIC, Australia; South Australian Research and Development Institute, Turretfield Research Centre, Rosedale, SA, Australia FRANKLIN D. WEST • Department of Animal and Dairy Science, Regenerative Bioscience Center, University of Georgia, Athens, GA, USA ERNST J. WOLVETANG • Stem Cell Engineering Group, Australian Institute for Bioengineering and Nanotechnology, University of Queensland, Brisbane, QLD, Australia KA YU YEUNG • The Mitochondrial Genetics Group, Centre for Genetic Diseases, Hudson Institute of Medical Research, Monash University, Clayton, VIC, Australia; Molecular Basis of Metabolic Disease, Division of Metabolic and Vascular Health, Warwick Medical School, The University of Warwick, Coventry, UK

Part I Background

Chapter 1 Cellular Reprogramming in Basic and Applied Biomedicine: The Dawn of Regenerative Medicine Wendy Dean Abstract Fertilization triggers a cascade of cellular and molecular events restoring the totipotent state and the potential for all cell types. However, the program quickly directs differentiation and cellular commitment. Under the genetic and epigenetic control of this process, Waddington likened this to a three-dimensional landscape where cells could not ascend the slope or traverse once canalized thus leading to cell fate decisions and the progressive restriction of cellular potency. But this is not the only possible outcome at least experimentally. Somatic cell nuclear transfer and overexpression of key transcription factors to generate induced pluripotent cells have challenged this notion. The return to pluripotency and the reinstatement of plasticity and heterogeneity once thought to be the exclusive remit of the developing embryo can now be replicated in vitro. The following chapter introduces some of these ideas and suggests that the fundamental principles learned may constitute the first step toward the opportunity for specific tissue renewal and replacement in healthy aging and the treatment of chronic diseases—the age of regenerative medicine. Key words Cellular reprogramming, Regenerative medicine, Induced pluripotent cells, Healthy aging

1

Introduction—Filling in Waddington’s Canal Cellular reprogramming entered the realm of our imagination in 2006 when Shinya Yamamaka announced that a “four-factor cocktail” could transform differentiated fibroblasts into induced, pluripotent stem cells [1]. This inspired a more prescriptive and defined way of achieving the alchemic transmogrification of defined cellular states. The significance of the breakthrough discovery of reprogramming fully differentiated cells back to a pluripotent state in what developmentally constitutes a retrograde cellular transition was quickly acknowledged with the joint awarding of a Nobel Prize in Physiology or Medicine in 2012 to Profs Shinya Yamanaka and Sir John Gurdon for their complementary work in nuclear reprogramming. Their discoveries had laid much of the groundwork for the concept of experimentally induced retrograde progression to induced pluripotent stem (iPS) cells.

Paul J. Verma and Huseyin Sumer (eds.), Cell Reprogramming: Methods and Protocols, Methods in Molecular Biology, vol. 1330, DOI 10.1007/978-1-4939-2848-4_1, © Springer Science+Business Media New York 2015

3

4

Wendy Dean

But exactly how does the forced overexpression of a handful of transcription factors and chromatin-binding molecules transform the defined cellular state of a differentiated cell and progress it back up Waddington’s ascending landscape to assume a pluripotent phenotype—in essence, a stem cell? The simple answer is, at present, that we do not know. However, the full impact of modern genome-wide investigation and the sheer force of numbers of researchers worldwide leading this investigation make the prospect of significant mechanistic understanding only a matter of time and the translation to patientspecific regenerative medicine a reality in our lifetime. In the course of these studies there is a real prospect of collateral benefit; much will be learned about the potential to identify and manipulate endogenous stem cell populations that function in tissue repair and replacement throughout life. Indeed the intense study of the processes of cellular regression may well hold the key to understanding healthy aging and offer an explanation for the growing number of centenarians in our societies, which has seen a fivefold rise over the last 30 years (Office for National Statistics UK; BBC news, 27th Sept 2013). Cellular reprogramming is the conversion of one specific cell type to another. Arguably, we could well consider that development in its usual forward-only direction could constitute a form of cellular reprogramming. Here, the highly specialized and fully differentiated oocyte is reprogrammed on fertilization to restore an ephemeral totipotent state that is quickly followed by a series of progressively more differentiated cellular decisions passing through ever more restricted multipotent junctures to give rise to the fully formed neonatal animal. In the 1940s Conrad Waddington described this process in his classical model of the epigenetic landscape where one genotype allowed for the generation of multiple cellular phenotypes [2]. Waddington illustrated the hierarchical progression of the undifferentiated state by a series of channels which were progressively more restricted and increasingly separated; thus once the cellular state was “fated” thereafter the lineage was restricted and incapable of either returning to a more undifferentiated state or a different germ cell layer [3]. In the postgenomic era, these ideas together with classical developmental and cellular biology have formed the basis of our understanding of the field of epigenetics. However, today cellular reprogramming more often refers to those landmark methods which included transdifferentiation or direct cell conversion, somatic cell nuclear transfer (SCNT) and experimental reprogramming, the basis of the generation of iPS cells [4]. The chapters which follow outline the details of how to establish these various models of developmental and cellular processes that set the experimental scene for understanding the mechanisms underpinning these transitions and serve to allow us

Cellular Reprogramming for Biomedicine

5

unprecedented opportunities in basic, agricultural and biomedical science to improve health and wellbeing, to enhance food security, and offer therapeutic solutions to the treatment of chronic disorders in humans. By way of an introduction to these methods I will outline some of the origins and common themes which these methods share and contrast points where they differ. These experimental approaches have certainly been instrumental in driving a deeper and more comprehensive understanding of mammalian development and stem cell biology in general and will undoubtedly continue to drive fundamental and applied questions in these areas. Perhaps most exciting, as a result of these experimental systems, fundamentally held beliefs about the prescriptive nature of developmental processes and tissue regeneration upon damage are now being challenged. The prospect of significant improvement of health span, on a patient specific basis, is now within sight. While the focus of this book is the experimental details that facilitate cellular reprogramming, before embarking on an outline of these techniques it may be worth touching, if only briefly, on some processes that occur naturally which are capable of achieving the same end. Transdifferentiation and cell fusion, much like that of experimental heterokaryons, do occur naturally [5, 6]. Transdifferentiation constitutes a change in cellular fate, which can facilitate the transit between lineages in the most extreme case and between a differentiated cell type and its less differentiated forerunner within a given lineage. Here, one distinction that is often applied is that both of these processes take place by a direct cell conversion and not via a pluripotent intermediate. In mammals transdifferentiation can be achieved experimentally by both gain of function through overexpression and loss of function mechanisms of one or a few factors and in this way bears some resemblance to iPS production. Interestingly, these induced transitions can be studied in vitro using stem cell models such as an ES cell, a proxy for the inner cell mass of the blastocyst stage in mammals. In what seems a reversion of the very first cellular decision in development, ES cells can be driven to acquire trophoblast stem (TS) cell-like fates [7–9] which implies that the experimental manipulation endows the cell with permission, and capacity, for the lowering of the epigenetic barrier that ordinarily separates and defines these first two cell lineages. Cell fusion and transdifferentiation have shared a common past. In 2002 two significant papers identified the potential of ES cells co-cultured with either neural stem cells or bone marrow cells to subsequently undergo differentiation to a variety of cell types. However, this occurred not by dedifferentiation, which was the first explanation, but by transdifferentiation via spontaneous cell fusion [10, 11]. At the time this caused a significant rethink in the field but supplied positive benefit in the greater degrees of vigor

6

Wendy Dean

that were thereafter required of these types of experiments [12]. Perhaps more importantly, this did highlight the fact that these processes could occur, albeit at a low frequency, establishing the proof of principle that similar cell–cell fusion events that allow cell fate transitions may take place in vivo. Thinking along these experimental lines may well be of benefit in particular to the adult stem cell field. While SCNT and iPS cell reprogramming are seemingly diametrically opposed they share interesting common origins in the ferment of mammalian experimental embryology and cell biology in the 1980s. The premise of SCNT had been based on classical developmental experiments carried out by Spemann in the 1920s answering the question of totipotency of nuclei at least early in development [13]. This was extended by the seminal work of Briggs and King in the 1950s [14] followed closely by John Gurdon [15] illustrating that in amphibian models differentiated nuclei could be transplanted to the enucleated oocyte and give rise to an adult organism. While this confirmed nuclear conservation, they also showed that the regenerative potency with nuclear donors isolated from more advanced, and hence more differentiated tissues, was progressively restricted [16]. As a whole this progressive restriction, i.e., the very idea that Waddington described as canalization, seemed to be holding up. In 1983, McGrath and Solter published a method of nuclear transplantation in mammals using a fusogenic virus [17]. This laid the ground work for the flurry of reports of “cloning” in mammals from embryonic cells in the sheep by Steen Willadsen [18] to the landmark achievement of Campbell and Wilmut in 1996 of the generation of a live cloned sheep, Dolly, from an adult, fully differentiated, mammary cell nucleus [19]. To date cloning has been successful in more than 15 mammalian species including the extinct Pyrenean ibex and a handful of other endangered species [20]. While cloning in most species has been a success, among endangered species cloning has been more difficult. Of these only the mouflon sheep survived for more than a few days after birth [21]. Clearly the oocyte, in conjunction with modulation of widespread chromatin remodeling, can reinstruct a terminal program to relive its developmental past; something once thought to be unachievable under any circumstance [22]. The induction of stem cells starting from differentiated fibroblasts is an extreme form of cell fate conversion and hence may constitute an extreme form of transdifferentiation. Here, the contrast to the reprogramming in SCNT is stark. The cellular as well as the nuclear status of the fibroblast must be dedifferentiated and ultimately progressed to the pinnacle of the canalized landscape in order to form pluripotent stem cells. In this form of reprogramming the cell is a most unsuitable environment with little of its own capacity to direct retrograde dedifferentiation unto pluripotency.

Cellular Reprogramming for Biomedicine

7

The earliest incarnations of this process were first described in Lasser et al. [23] where overexpression of a defined transcription factor (TF), MyoD, was able to drive fibroblasts toward a muscle cell fate. While this worked best in mesodermally derived cells, similar results were also obtained in ectodermal and endodermal derivatives hinting at the now familiar concept that forced overexpression of TFs, defining for a given cell type, greatly assists in the transdifferentiation toward that cell type [24]. In practice this is but a short step away in taking this idea forward toward a destination in stem cell populations—in essence the seed of the “four-factor cocktail” had been planted. Over the intervening years intra-germ layer conversion was demonstrated for a vast number of TF combinations. Interestingly, the dynamics of the transition were highly variable with both the starting cell type and the order of expression of the TF cocktail able to influence the cellular outcome. In fact, only relatively recently has this approach succeeded in “long distance” direct conversion; starting with fibroblasts a “three-factor” cocktail was able to generate functional neurons [25]. Induced pluripotent stems cells have changed the way we think about cellular differentiation, cell fate commitment, and the unidirectional nature of development [26]. Beyond that, the very nature of the stably differentiated cell has been challenged along with the ideas of the epigenome that serve to reinforce and fix that state. While remarkable in the insights that derived from conversion of cell types both within and across germ layer boundaries, direct cell conversion has significant limitations. Ideally, and in keeping with the need to be able to supply adequate numbers of any cell type in any lineage, stem cells seem like the best option and those equivalent to embryonic stem cells would allow unrestricted and ethically uncomplicated extension to therapeutic applications in the treatment of disease. Applying the lessons of intra-lineage conversion, Takahashi and Yamanaka focused their attention on transcription factor networks associated with pluripotency and self-renewal, both hallmarks of pluripotent embryonic stem (ES) cells. Distilling the list to the now well known “four-factor cocktail,” of Oct3/4, Sox2, Klf4 and c-Myc (OSKM), and transfecting them into either fetal or adult mouse, and later human, fibroblasts lead eventually to the generation of the first iPS cells [1]. Remarkably, in mouse and human, expression from the delivery systems is eventually taken over by the endogenous loci thereby supplying a continuous source of the essential factors characteristic of the target ES cells. Although highly inefficient, these cells fulfilled their potential being able to differentiate into all three germ layers and in the generation of both chimeric animals and entirely iPS-derived mice by tetraploid complementation, the gold standard for demonstrating pluripotency. Interestingly, a large proportion of the domestic animal iPS

8

Wendy Dean

systems fail to either activate the endogenous loci or silence the transgenes in the course of iPS reprogramming. Better and more efficacious delivery systems that did not involve viral vectors, requisite for use in humans, have now been achieved. Many iterations and reiterations of the “essential factors” have also taken place with replacements now in common use. In this respect it is remarkable that the “four factors” have been found to be so broadly able to direct iPS cell generation across such a wide cross section of mammalian species. In a few cases, in bovine [27] and the endangered class of Felids [28] is an additional factor, namely Nanog, required for iPS cell reprogramming. In the goat and sheep, eight factors have been reported to be required to reprogram primary ear fibroblasts [29, 30]. Second- and third-generation reprogramming approaches to iPS cells now exist which employ either small molecule inhibitors or transfection of families of microRNAs alone or in combination with the Yamanaka factors [31, 32]. MicroRNAs are particularly abundant in pluripotent ES cells; among the most abundant, the miR301/367 in humans and the miR290 cluster in the mouse, are themselves up-regulated by the OSKM quartet and mutually reinforce the pluripotent state thereby driving cells toward this terminus. Coupled to their ability to down-regulate de novo methylation the up-regulation of the miR290 cluster also enhances, among other functions, the kinetics of the mesenchymal to epithelial transition (MET) requisite for reprogramming to iPS status [33–35]. Incidentally, alteration of the culture environment has also proven to enhance iPS cell reprogramming. The ability to generate ES cells in mouse and human has been a breakthrough in pioneering the idea of replacement therapies for faulty genes together with functional and mechanistic studies in all biological disciplines, which ultimately underpin applied research. In domestic species of agricultural and veterinary importance, while some species have been amenable to the generation of embryonic-like stem cells especially in light of improvements translated from the mouse, many have yet to achieve the same unrestricted claims to pluripotency. Here, iPS cell generation may prove to be the solution as is the case in the equine system. Equine ES-like cells possess only some of the full repertoire of the pluripotent spectrum while equine iPS cells seem to be fully functional and able to contribute to teratomas in engraftment experiments [36]. Targeting of iPS cells once established may not prove universally simple. For example, human ES cells are refractory to conventional genome editing via homologous recombination achieving only very low efficiencies compared to the mouse and hence other targeted methodologies such as zinc finger proteins, TALENs and CRISPR are required [37]. The development of SNCT has long been regarded as a means by which rare and endangered species might be rescued from

Cellular Reprogramming for Biomedicine

9

impending extinction. Indeed, even some now extinct species have been reanimated by NT where appropriate recipient species hybrids still survive. It would now seem possible that iPS generation may provide additional avenues to help in supporting efforts to save endangered species offering prospects of generation of gametes in vitro from iPS cells as has been achieved with ES cells [38–40]. Despite the relative ease in which the iPS generation has been successful across a very wide swath of mammalian species, the generation of gametes may not prove as simple; nonetheless, there is reason for great optimism that the species variation among germ cell maturation can be overcome and functional gametes generated across the diverse class of Mammalia. Failing the ability to generate full maturation of gametes, iPS cells may well allow for unprecedented mechanistic studies into germ cell development across a wide selection of species many of whom may offer better and closer physiological comparisons to humans without serious ethical limitations [38, 41].

2

The Epigenome and Life in Culture With the unparalleled promise of personalized medicine and generation of patient-specific tissue by stem cell therapies, replacement and renewal no longer seems like a distant prospect. Less ambitious but potentially more beneficial is the ability to test patientspecific matching of drug treatment by using iPS cells either directly or on tissue-specific differentiation. Veterinary drug testing and biopharmaceutical companies may well screen and develop treatments tailored by genetically typing patient groups to offer the best fit for regulation of metabolic disorders using iPS cells derived from specifically defined allelic profiling. However, the question remains about the role of the epigenome and the influence of culture-based rearing of cells and tissues especially where tissue engraftment is required. Here, lessons from ES cells as a proxy for iPS cells will be highly informative. It has long been recognized that cells in culture, including embryonic stem cells acquire increasing levels of DNA methylation, as a function of the duration of life in culture, a significant barrier to both dedifferentiation via SCNT and iPS reprogramming. Recent evaluation of the DNA methylation profile of primed vs naïve ES cells has shed light on this question. Small molecule inhibitors (aka 2i) that both enhance ES cell derivation and reduce their heterogeneity in culture have focused attention on the role of the composition of the culture media and the DNA methylome in mouse [42–45] and in human ES cells [46]. Thus the presence of conventional serum can affect the pluripotential capacity of ES cells by significant modulation of DNA methylation, notably by increasing methylation and decreasing naïve pluripotency. In as

10

Wendy Dean

much as microRNA families that are associated with iPS cell reprogramming negatively regulate DNA methyltransferases and hence DNA methylation, these two common components (i.e., serum and microRNAs) seem to be at odds with one another for the reprogramming process. Loss of DNA methylation, especially tied to natural reprogramming, has been a dominant interest in the field of epigenetics. The discovery of another significant pathway able to down-regulate DNA methylation by methylcytosine oxidation-coupled to repair pathways may be able to offer some answers [47, 48]. A family of three enzymes, the ten-eleventranslocation or TETS, iteratively oxidizing the methyl group on cytosine to hydroxymethyl cytosine (5hmC) eventually leads to this loss of DNA methylation via the return to the cytosine group. Enzymatically, this reaction requires reduced Fe2+ and α-ketoglutarate as cofactors and is hence very sensitive to the media conditions and gaseous environment during culture. Ascorbic acid, Vitamin C (VitC), has been known to enhance iPS generation in mouse and humans for some time. Here acting not via the 2i pathway but rather by alleviating the senescence roadblock, in the presence of VitC the histone demethylases Jhdm1a/1b are stimulated [49]. Interestingly, TET1 is involved via its functional domain in the formation of 5hmc at loci critical for MET in a VitC-dependent manner [50]. In a systematic screen, the absence of all H3K9me2 and me3 histone methylases, which include Suv39H1 and 2, G9A and SetDB1, were found to work synergistically with VitC to enhance iPS cell reprogramming [50]. The modulation of H3K9me2/me3 is mechanistically linked to loss of DNA methylation [51]. As such the presence of VitC in somatic cell reprogramming is tied to loss of DNA methylation likely via replication-dependent passive mechanisms that involve loss of H3K9 methylation as well. Whether or not the acquisition of DNA methylation during culture of iPS cells will constitute a barrier to their widespread application is not yet clear. In mouse ES cells maintained in standard serum-based culture conditions CpG methylation is high. However, what happens to this hypermethylation once it is introduced into a cellular context in vivo or upon tissue derivation has not been systematically explored. In a simple but elegant test of this question the results of a recent experiment gives us cause for optimism. ES cells carrying a GFP reporter were used to make chimeric animals by the classical blastocyst injection method. These chimeric embryos were collected at E17.5 and the GFP-positive cells isolated by flow cytometry and subsequently evaluated for levels of DNA methylation. While the original ES cells were heavily methylated, those GFP-positive cells isolated from tissues of these embryos showed reduced levels of DNA methylation that were not significantly different from the GFP-negative host cells. In essence, in dividing cells within an in vivo environment, the DNA

Cellular Reprogramming for Biomedicine

11

methylation levels had been returned to normal [52]. Whether this is universally true in other species needs to be proven. Collectively, we are closing in on solutions to overcome many of the barriers that currently limit unbridled enthusiasm and realistic optimism for the promise of iPS cell-based application to regenerative medicine. The regulation of the epigenome is amongst one of the most complicated barriers which unify the challenges of both SCNT and iPS cell reprogramming irrespective of the application [53]. At present the incredible rate of research output in this area is rivaled only by that of the stem cell biology (which is overlapping with iPS cells). Lessons learned in driving the program back to the top of the Waddington landscape have revealed that pathways at intermediate heights may well provide equally good or better vantage points for obtaining multipotent stem cell populations both in vitro and that are resident in vivo, that might offer solutions to contemporary obstacles. Indeed, direct cell conversion has challenged our belief about the distance between differentiated lineages and the depth of the canalization. Late in 2014, the direct conversion of fibroblasts into thymic epithelial-like cells giving rise to a functional thymus-like organ on transplantation of aggregates together with T-cell precursors and support cells was reported [54]. The chapters that follow offer practical solutions and guidelines on how to overcome the obstacles that currently impede our progress in experimental reprogramming. Innovation will come when we challenge the dogma and invite fresh eyes to use our methods and supply their own new questions. The 2012 Nobel Prize for Medicine and Physiology to Dr. Shinya Yamananka and Sir John Gurdon acknowledged the start of exciting and indeed remarkable discoveries in reprogramming. No doubt the first of very many! References 1. Takahashi K, Yamanaka S (2006) Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126:663–676 2. Waddington CH (1942) Canalization of development and the inheritance of acquired characters. Nature 150:563–565 3. Waddington CH (1957) The strategy of the genes. George Allen & Unwin, London, UK 4. Jopling C, Boue S, Izpisua Belmonte JC (2011) Dedifferentiation, transdifferentiation and reprogramming: three routes to regeneration. Nat Rev Mol Cell Biol 12:79–89 5. Nygren JM, Jovinge S, Breitbach M et al (2004) Bone marrow-derived hematopoietic cells generate cardiomyocytes at a low frequency through cell fusion, but not transdifferentiation. Nat Med 10:494–501

6. Orlic D, Kajstura J, Chimenti S et al (2001) Bone marrow cells regenerate infarcted myocardium. Nature 410:701–705 7. Niwa H, Miyazaki J, Smith AG (2000) Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or selfrenewal of ES cells. Nat Genet 24:372–376 8. Niwa H, Toyooka Y, Shimosato D et al (2005) Interaction between Oct3/4 and Cdx2 determines trophectoderm differentiation. Cell 123:917–929 9. Lu CW, Yabuuchi A, Chen L et al (2008) RasMAPK signaling promotes trophectoderm formation from embryonic stem cells and mouse embryos. Nat Genet 40:921–926 10. Ying QL, Nichols J, Evans EP et al (2002) Changing potency by spontaneous fusion. Nature 416:545–548

12

Wendy Dean

11. Terada N, Hamazaki T, Oka M et al (2002) Bone marrow cells adopt the phenotype of other cells by spontaneous cell fusion. Nature 416:542–545 12. Wells WA (2002) Is transdifferentiation in trouble? J Cell Biol 157:15–18 13. Spemann H (1938) Embryonic development and induction. Hafner, New York, NY 14. Briggs R, King TJ (1952) Transplantation of living nuclei from blastula cells into enucleated frogs’ eggs. Proc Natl Acad Sci U S A 38:455–463 15. Gurdon JB (1962) Adult frogs derived from the nuclei of single somatic cells. Dev Biol 4:256–273 16. Gurdon JB (1962) The developmental capacity of nuclei taken from intestinal epithelium cells of feeding tadpoles. J Embryol Exp Morphol 10:622–640 17. McGrath J, Solter D (1983) Nuclear transplantation in the mouse embryo by microsurgery and cell fusion. Science 220:1300–1302 18. Willadsen SM (1986) Nuclear transplantation in sheep embryos. Nature 320:63–65 19. Wilmut I, Schnieke AE, McWhir J et al (1997) Viable offspring derived from fetal and adult mammalian cells. Nature 385:810–813 20. Lanza RP, Cibelli JB, Diaz F et al (2000) Cloning of an endangered species (Bos gaurus) using interspecies nuclear transfer. Cloning 2:79–90 21. Loi P, Ptak G, Barboni B et al (2001) Genetic rescue of an endangered mammal by crossspecies nuclear transfer using post-mortem somatic cells. Nat Biotechnol 19:962–964 22. McGrath J, Solter D (1984) Inability of mouse blastomere nuclei transferred to enucleated zygotes to support development in vitro. Science 226:1317–1319 23. Lassar AB, Paterson BM, Weintraub H (1986) Transfection of a DNA locus that mediates the conversion of 10 T1/2 fibroblasts to myoblasts. Cell 47:649–656 24. Weintraub H, Tapscott SJ, Davis RL et al (1989) Activation of muscle-specific genes in pigment, nerve, fat, liver, and fibroblast cell lines by forced expression of MyoD. Proc Natl Acad Sci U S A 86:5434–5438 25. Lujan E, Chanda S, Ahlenius H et al (2012) Direct conversion of mouse fibroblasts to selfrenewing, tripotent neural precursor cells. Proc Natl Acad Sci U S A 109:2527–2532 26. Ladewig J, Koch P, Brustle O (2013) Leveling Waddington: the emergence of direct programming and the loss of cell fate hierarchies. Nat Rev Mol Cell Biol 14:225–236

27. Sumer H, Liu J, Malaver-Ortega LF et al (2011) NANOG is a key factor for induction of pluripotency in bovine adult fibroblasts. J Anim Sci 89:2708–2716 28. Verma R, Liu J, Holland MK et al (2013) Nanog is an essential factor for induction of pluripotency in somatic cells from endangered felids. Biores Open Access 2:72–76 29. Ren J, Pak Y, He L et al (2011) Generation of hircine-induced pluripotent stem cells by somatic cell reprogramming. Cell Res 21:849–853 30. Sartori C, DiDomenico AI, Thomson AJ et al (2012) Ovine-induced pluripotent stem cells can contribute to chimeric lambs. Cell Reprogram 14:8–19 31. Judson RL, Babiarz JE, Venere M et al (2009) Embryonic stem cell-specific microRNAs promote induced pluripotency. Nat Biotechnol 27:459–461 32. Mikkelsen TS, Hanna J, Zhang X et al (2008) Dissecting direct reprogramming through integrative genomic analysis. Nature 454:49–55 33. Benetti R, Gonzalo S, Jaco I et al (2008) A mammalian microRNA cluster controls DNA methylation and telomere recombination via Rbl2-dependent regulation of DNA methyltransferases. Nat Struct Mol Biol 15:268–279 34. Sinkkonen L, Hugenschmidt T, Berninger P et al (2008) MicroRNAs control de novo DNA methylation through regulation of transcriptional repressors in mouse embryonic stem cells. Nat Struct Mol Biol 15:259–267 35. Subramanyam D, Lamouille S, Judson RL et al (2011) Multiple targets of miR-302 and miR372 promote reprogramming of human fibroblasts to induced pluripotent stem cells. Nat Biotechnol 29:443–448 36. Nagy K, Sung HK, Zhang P et al (2011) Induced pluripotent stem cell lines derived from equine fibroblasts. Stem Cell Rev 7:693–702 37. Liu Y, Rao M (2011) Gene targeting in human pluripotent stem cells. Methods Mol Biol 767:355–367 38. Hayashi K, Ohta H, Kurimoto K et al (2011) Reconstitution of the mouse germ cell specification pathway in culture by pluripotent stem cells. Cell 146:519–532 39. Hayashi K, Saitou M (2013) Generation of eggs from mouse embryonic stem cells and induced pluripotent stem cells. Nat Protoc 8:1513–1524 40. Nayernia K, Nolte J, Michelmann HW et al (2006) In vitro-differentiated embryonic stem cells give rise to male gametes that can generate offspring mice. Dev Cell 11:125–132

Cellular Reprogramming for Biomedicine 41. Imamura M, Hikabe O, Lin ZY et al (2014) Generation of germ cells in vitro in the era of induced pluripotent stem cells. Mol Reprod Dev 81:2–19 42. Ficz G, Hore TA, Santos F et al (2013) FGF signaling inhibition in ESCs drives rapid genome-wide demethylation to the epigenetic ground state of pluripotency. Cell Stem Cell 13:351–359 43. Habibi E, Brinkman AB, Arand J et al (2013) Whole-genome bisulfite sequencing of two distinct interconvertible DNA methylomes of mouse embryonic stem cells. Cell Stem Cell 13:360–369 44. Leitch HG, McEwen KR, Turp A et al (2013) Naive pluripotency is associated with global DNA hypomethylation. Nat Struct Mol Biol 20:311–316 45. Yamaji M, Ueda J, Hayashi K et al (2013) PRDM14 ensures naive pluripotency through dual regulation of signaling and epigenetic pathways in mouse embryonic stem cells. Cell Stem Cell 12:368–382 46. Takashima Y, Guo G, Loos R et al (2014) Resetting transcription factor control circuitry toward ground-state pluripotency in human. Cell 158:1254–1269 47. Kriaucionis S, Heintz N (2009) The nuclear DNA base 5-hydroxymethylcytosine is present

48.

49.

50.

51.

52.

53.

54.

13

in Purkinje neurons and the brain. Science 324:929–930 Tahiliani M, Koh KP, Shen Y et al (2009) Conversion of 5-methylcytosine to 5-hydroxymethylcytosine in mammalian DNA by MLL partner TET1. Science 324:930–935 Wang T, Chen K, Zeng X et al (2011) The histone demethylases Jhdm1a/1b enhance somatic cell reprogramming in a vitamin-Cdependent manner. Cell Stem Cell 9:575–587 Chen J, Guo L, Zhang L et al (2013) Vitamin C modulates TET1 function during somatic cell reprogramming. Nat Genet 45:1504–1509 Lehnertz B, Ueda Y, Derijck AA et al (2003) Suv39h-mediated histone H3 lysine 9 methylation directs DNA methylation to major satellite repeats at pericentric heterochromatin. Curr Biol 13:1192–1200 Ludwig G, Nejman D, Hecht M et al (2014) Aberrant DNA methylation in ES cells. PLoS One 9:e96090 Hemberger M, Dean W, Reik W (2009) Epigenetic dynamics of stem cells and cell lineage commitment: digging Waddington’s canal. Nat Rev Mol Cell Biol 10:526–537 Bredenkamp N, Ulyanchenko S, O’Neill KE et al (2014) An organized and functional thymus generated from FOXN1-reprogrammed fibroblasts. Nat Cell Biol 16:902–908

Part II De Novo Reprogramming

Chapter 2 Synthetic mRNA Reprogramming of Human Fibroblast Cells Jun Liu and Paul J. Verma Abstract Reprogramming of somatic cells, such as skin fibroblasts, to pluripotency was first achieved by forced expression of four transcription factors using integrating retroviral or lentiviral vectors, which result in integration of exogenous DNA into cellular genome and present a formidable barrier to therapeutic application of induced pluripotent stem cells (iPSCs). To facilitate the translation of iPSC technology to clinical practice, mRNA reprogramming method that generates transgene-free iPSCs is a safe and efficient method, eliminating bio-containment concerns associated with viral vectors, as well as the need for weeks of screening of cells to confirm that viral material has been completely eliminated during cell passaging. Key words Reprogramming, Transgene-free, Induced pluripotent stem cells, Modified mRNA, Transfection

1

Introduction The discovery that induced pluripotent stem cells (iPSCs) can be generated from differentiated cell types, e.g., skin fibroblasts, through the overexpression of a set of defined transcription factors holds the promise for regenerative medicine and cell-based autologous therapies [1, 2]. The initial approach utilized retroviral vectors to deliver OCT4, KLF4, SOX2, and c-MYC to reprogram mouse and human fibroblasts to iPSCs. However, this approach carries the risk associated with integration of exotic transgene sequences into the genome and therefore is precluded for cell-based therapeutic applications in patients. A variety of technologies have been developed for transgene integration-free pluripotency reprogramming, such as using adenoviral vectors [3, 4], non-integrating DNA plasmid-based vectors [5–9], protein transduction [10, 11], Sendai viral vectors [12, 13], microRNAbased reprogramming [14, 15], and modified mRNA-based reprogramming approach [16, 17]. The modified mRNA technology is a non-viral, non-integrating, clinically relevant reprogramming method, and completely eliminates the risk of genomic

Paul J. Verma and Huseyin Sumer (eds.), Cell Reprogramming: Methods and Protocols, Methods in Molecular Biology, vol. 1330, DOI 10.1007/978-1-4939-2848-4_2, © Springer Science+Business Media New York 2015

17

18

Jun Liu and Paul J. Verma

integration and mutagenesis inherent to DNA and viral-based technologies. Moreover, the mRNA reprogramming approach offers a robust and dose-titratable of multiple different mRNA expression, which allows for stoichiometry control of individual factors required during reprogramming. We have efficiently generated iPSCs from the skin fibroblasts of a type 1 diabetes patient using a Stemgent® mRNA reprogramming system. Here, we describe a stepwise protocol for the generation of mRNA-derived iPSCs from primary human fibroblasts using a Stemgent® synthetic modified mRNA, focusing on material preparation (including primary human fibroblasts, feeder cells, inducing medium, and conditioned medium), plating cells, transfecting cells, identifying iPSC colonies, picking and passaging iPSC colonies. The protocol described here is for reprogramming of human fibroblasts to pluripotency, however, which has broad applicability in other species.

2

Materials This protocol describes the use of the Stemgent® mRNA reprogramming system to reprogram four wells of human skin dermal fibroblasts at one time in a 6-well plate format. Material preparation should begin 1 week prior to starting the experiment. All materials should be prepared under sterile conditions in a biological safety cabinet.

2.1 Tissue and Cell Culture Reagents

1. Pluriton medium. Thaw the 500 mL bottle of Pluriton medium completely at 4 °C (see Note 1). Once the medium bottle has thawed completely, add 5 mL of penicillin/streptomycin (100×) to the bottle. Pipet thoroughly to mix. Pipet 40 mL aliquots of the medium into seven 50 mL conical tubes (280 mL total). Freeze the seven medium aliquots at −20 °C. Store the remaining 220 mL of medium at 4 °C for use during the first week for generating NuFF-conditioned Pluriton medium. 2. Pluriton supplement. Thaw the 200 μL vial of supplement on ice (see Note 2). Pipet 4 μL of supplement directly into the bottom of 50 sterile, low protein-binding microcentrifuge tubes. Freeze and store the supplement aliquots at −70 °C for up to 3 months. 3. B18R Recombinant protein. Thaw the 40 μg vial of B18R protein (eBioscience, #34-8185-85; 0.5 mg/mL stock concentration, 80 μL total volume) on ice (see Note 3). Pipet 4 μL of the B18R protein directly into the bottom of 20 sterile, low protein-binding microcentrifuge tubes. Freeze and store the protein aliquots at −70 °C for up to 3 months.

Synthetic mRNA Reprogramming of Human Fibroblast Cells

19

4. mRNA cocktail. Thaw the individual vials containing each mRNA reprogramming factor on ice. Keep mRNA vials on ice at all times (see Note 4). Using RNase-free aerosol-barrier tips, combine the mRNA factors according to the table below in a sterile, 1.5 mL RNase-free microcentrifuge tube on ice. Oct4 mRNA

385.1 μl

Sox2 mRNA

119.2 μl

Klf4 mRNA

155.9 μl

c-Myc mRNA

147.7 μl

Lin28 mRNA

82.5 μl

nGFP mRNA

110.6 μl

mRNA cocktail mix

1000 μl

Pipet the contents of the tube to mix thoroughly. Aliquot 50 μL of the mRNA cocktail into 20 individual sterile, 1.5 mL RNase-free microcentrifuge tubes. Freeze and store the aliquots at −70 °C. 5. Human fibroblast medium: 10 % serum (fetal bovine/calf serum), DMEM—high glucose with sodium pyruvate and L-glutamine added and 1 % penicillin–streptomycin. Filtersterilize medium using a 0.22 μm pore size, low proteinbinding filter. Store at 4 °C for up to 2 weeks. 6. Human iPSC culture medium: 20 % Knockout serum replacement, DMEM/F-12, 1 % Non-essential amino acids, 1 % L-glutamine, 0.1 % β-mercaptoethanol, 8 ng/mL basic fibroblast growth factor, and 1 % penicillin-streptomycin. Filtersterilize medium using a 0.22 μm pore size, low protein-binding filter. Store at 4 °C for up to 2 weeks. 7. MEF culture medium: 10 % serum (fetal bovine/calf serum), DMEM—high glucose with sodium pyruvate and L-glutamine added and 1 % penicillin–streptomycin. Filter-sterilize medium using a 0.22 μm pore size, low protein-binding filter. Store at 4 °C for up to 2 weeks.

3

Methods

3.1 Generating NuFF-Conditioned Pluriton Medium

1. Thaw one vial of inactivated NuFF cells containing approximately 4 × 106 cells. 2. Incubate the cells in the T75 flask using human fibroblast medium at 37 °C and 5 % CO2 for overnight. 3. Aspirate the NuFF culture medium from the T75 tissue culture flask.

20

Jun Liu and Paul J. Verma

4. Add 10 mL of PBS to the cells to wash. 5. Add 25 mL of Pluriton medium supplemented with 25 μL of bFGF (to a final bFGF concentration of 4 ng/mL) to the T75 flask (see Note 5). 6. Incubate the cells overnight at 37 °C and 5 % CO2. 7. After 24 h incubation, the medium in the T75 flask can be collected as NuFF-conditioned Pluriton medium and be frozen at −20 °C, and replaced with 25 mL fresh Pluriton medium supplemented with bFGF to a final concentration of 4 ng/mL. 8. Repeat the collection and exchange of medium daily through day 6. 9. Thaw all aliquots of previously collected NuFF-conditioned Plurito medium at 4 °C. 10. Collect final 25 mL of NuFF-conditioned Pluriton medium from the NuFF cells in the T75 flask. 11. Pool all thawed NuFF-conditioned Pluriton medium and filter using a 0.22 μm pore size, low protein-binding filter. 12. Dispense filtered NuFF-conditioned Pluriton medium into 40 mL aliquots and re-freeze at −20 °C until use. 3.2 Human Dermal Fibroblast Isolation

1. Punch biopsies are obtained from volunteer’s non-sun exposed buttock skin with ethics approval and patient consent (see Note 6). Punch biopsy size is about 6–8 mm in diameter. 2. In sterile hood transfer the skin sample to a 100-mm sterile dish containing 10 mL of PBS. 3. Dissect the dermis from the rest of the skin (epidermis and subcutaneous tissue) using scalpel and forceps. 4. Mince the dermis into small pieces (~1 mm3) and place about three or four fragments on the bottom of a well of 6-well plates, separated from one another. 5. Allow explants to air-dry for 15 min. 6. Gently add 2 mL of fibroblast medium to cover each tissue piece. Place the plates in the 5 % CO2 incubator at 37 °C. 7. Incubate for 7 days without touching the flask to allow cells to migrate out of tissue fragments. 8. Change the medium once per week, until substantial number of fibroblasts is observed. 9. When 80 % confluent, passage 1:3 using 0.25 % trypsin/ EDTA. A small aliquot should be taken for mycoplasma testing by PCR. 10. Begin reprogramming at passage 3 and freeze down backup vials in liquid nitrogen for storage.

Synthetic mRNA Reprogramming of Human Fibroblast Cells

3.3 NuFF Feeder Cells Plating

21

1. Add 1 mL of sterile 0.2 % gelatin (in ddH2O) in each of 4 wells of a 6-well tissue culture plate. Incubate the plate for a minimum of 30 min at 37 °C and 5 % CO2. 2. Thaw 1 × 106 inactivated NuFF cells in a 37 °C waterbath until only a small ice crystal remains (see Note 7). 3. Transfer the NuFF cells to a 15 mL conical tube and add 5 mL of human fibroblast medium to the cells while gently agitating the contents of the tube. 4. Centrifuge the cells for 4 min at 200 × g. 5. Aspirate the supernatant and resuspend the cell pellet in 8 mL of human fibroblast medium. 6. Aspirate the gelatin solution from the four wells of the prepared 6-well plate and add 2 mL of NuFF cell suspension to each of the four wells. 7. Incubate the cells overnight at 37 °C and 5 % CO2.

3.4 Target Cell Plating

The procedure is appropriate for dermal fibroblasts in culture in a T75 flask and may not be applicable to all target cell types. For target cells other than fibroblasts, harvest the cells according to an appropriate protocol and plate in the format described below. 1. Remove the culture medium from the T75 flask of cells to be harvested. 2. Wash the cells with 10 mL of PBS in the flask. 3. Add 3 mL of 0.05 % Trypsin/EDTA to the flask and incubate for 5 min at 37 °C and 5 % CO2. 4. Add 6 mL of human fibroblast medium (or appropriate target cell medium containing serum) to the flask to neutralize the Trypsin/EDTA. 5. Transfer the cell suspension to a 15 mL conical tube and centrifuge for 5 min at 200 × g. 6. Remove the supernatant and resuspend the pellet in 5 mL of human fibroblast medium. 7. Count the cells in solution and calculate the live cell density. 8. Aspirate the culture medium from NuFF feeder cells and plate the target cells in three independent wells of the NuFF feeder plate at densities of 5 × 103, 1 × 104, 2.5 × 104 cells per well in 2 mL total volume per well. Plate human BJ fibroblasts in a well with NuFF feeder cells at density of 1 × 104 as control. 9. Incubate the cells at 37 °C and 5 % CO2.

3.5

Transfection

3.5.1 Day 1 Transfection

At day 1 of transfection, the cells must be cultured in the medium with 200 ng/mL B18R for 2 h before the first transfection with mRNA.

22

Jun Liu and Paul J. Verma

1. Add 10 mL of Pluriton medium to a sterile 100 mm dish. 2. Incubate the medium for 2 h at 37 °C and 5 % CO2 to equilibrate the medium (see Note 8). 3. Thaw one vial of Pluriton supplement and one vial of B18R protein on ice. 4. Add 4 μl of the supplement and 4 μl of the B18R protein to the medium to generate Pluriton reprogramming medium (with B18R protein). 5. Aspirate the target cell medium from each of the 4 wells to be transfected. 6. Add 2 mL of Pluriton reprogramming medium (with B18R protein) to each of the four wells. 7. Incubate the cells for 2 h at 37 °C and 5 % CO2 prior to transfecting. 8. Thaw one 50 μL aliquot of the mRNA cocktail on ice (Tube 1). 9. Using RNase-free, aerosol-barrier pipette tips, add 200 μL of Opti-MEM to the tube containing the mRNA cocktail and pipet gently to mix (Tube 1). 10. In a second sterile, RNase-free 1.5 mL microcentrifuge tube, add 225 μl of Opti-MEM and 25 μL of RNAiMAX, mix gently (Tube 2). 11. Transfer the entire contents of Tube 2 to the mRNA cocktail solution in Tube 1 to generate the mRNA transfection complex and pipet gently 3–5 times. 12. Incubate the mRNA transfection complex at room temperature for 15 min to allow the mRNA to properly complex with the transfection reagent. 13. In a dropwise manner, add 120 μL of the mRNA transfection complex to each of the four wells to be transfected. 14. Gently rock the 6-well plate from side to side and front back to distribute the mRNA transfection complex evenly across the wells. 15. Incubate the cells for 4 h at 37 °C and 5 % CO2. 16. Add 10 mL of medium to a sterile 100 mm dish and incubate the medium for at least 2 h at 37 °C and 5 % CO2 to equilibrate the medium. 17. Just prior to use, add 4 μL of supplement and 4 μL of the B18R protein to the equilibrated medium to generate Pluriton reprogramming medium (with B18R protein). 18. After the target cells have been transfected for 4 h, aspirate the medium containing the mRNA transfection complex from each well (see Note 9).

Synthetic mRNA Reprogramming of Human Fibroblast Cells

23

Fig. 1 Observation of target cells during day 1 to day 5. Transfected cells will begin to appear in small clusters with a more compacted morphology compared with the fibroblasts at day 5. The nGFP expression should appear in the transfected cells

19. Add 2 mL of the equilibrated Pluriton reprogramming medium (with B18R protein) to each well. 20. Incubate the cells overnight at 37 °C and 5 % CO2. 3.5.2 Day 2–6 Transfection

The transfection procedure must be repeated each day from Day 2 to Day 6 exactly as done on Day 1. Monitor the cell cultures daily, observing cell proliferation rates, morphology changes, and nGFP expression in each well (Fig. 1). 1. Prepare the mRNA transfection complex as described for Day 1 (see Note 10). 2. Transfect cells as described for Day 1. 3. Equilibrate Pluriton medium and prepare Pluriton reprogramming medium (with B18R protein) as described for Day 1. 4. Change medium after 4 h of transfection and incubate the cells overnight at 37 °C and 5 % CO2.

3.5.3 Day 7–18 Transfection

Starting at Day 7, NuFF-conditioned Pluriton reprogramming medium must be used in place of Pluriton reprogramming medium. Transfection of the target cells must be continued as done previously from Day 1 to Day 6. The protocol for generating and preparing NuFF-conditioned Pluriton reprogramming medium is detailed in Subheading 3.1. Continue to monitor the cell cultures

24

Jun Liu and Paul J. Verma

Fig. 2 Morphological changes of an emerging colony and colony pickup. (a, b, c) Morphological changes characteristic of an iPSC cluster marked with a yellow dashed circles. (c) The iPSC colony was manually cut into eight pieces, which should be transferred to an individual well of a 12-well plate with a newly pated feeder layer. (d, e, f) Health human iPSC colonies with defined colony edges and the uniform and compact iPSC within the colonies

daily, as morphological changes become more pronounced between Day 7 and Day 18 (Fig. 2). 1. Prepare the mRNA transfection complex as described for Day 1 (see Note 10). 2. Transfect cells as described for Day 1. 3. Equilibrate NuFF-conditioned Pluriton medium and prepare NuFF-conditioned Pluriton reprogramming medium (with B18R protein) as described for Day 1. 4. After 4 h of transfection, remove the medium containing the transfection reagent and add 2 mL of equilibrated NuFFconditioned Pluriton reprogramming medium (with B18R protein) to each well, as described for Day 1. 5. Incubate the cells overnight at 37 °C and 5 % CO2. 3.6 Pickup and Culture of iPSC Colonies

1. Prepare MEF feeder cells in 12-well plates 1 day before iPSC colony pickup. 2. Thaw one aliquot of Pluriton supplement on ice and add 4 μL of the supplement to 10 mL of Pluriton medium to generate Pluriton reprogramming medium. 3. Aspirate the MEF culture medium from 12-well MEF feeder plates. 4. Add 1 mL of PBS to each well to rinse and aspirate the PBS.

Synthetic mRNA Reprogramming of Human Fibroblast Cells

25

5. Add 1 mL of human iPSC culture medium to each of the rinsed wells. 6. Aspirate the medium from the well of the 6-well plate that the primary iPSCs will be picked from. 7. Add 2 mL of Pluriton reprogramming medium to the well of iPSCs to be picked. 8. Using a stereo microscope, locate iPSC colonies based on morphology. Using a glass picking tool or 1 mL insulin syringe, gently divide the colony into approximately 4–9 pieces (see Note 11). 9. Using a pipettor with a sterile 10 μL pipet tip, transfer the detached colony pieces out of the reprogramming well and into an individual well of the prepared 12-well plate (see Note 12). 10. Repeat the picking and replating process for the next iPSC colonies. Pick one colony at a time and transfer the cell aggregates of each to a new well of the prepared 12-well inactivated MEF feeder plate. 11. After six iPSC colonies have been picked and replated, return both the 12-well plate and the primary reprogrammed colonies on the 6-well plate to the incubator at 37 °C and 5 % CO2. After allowing the cells to incubate for at least 30 min, an additional six primary iPSC colonies can be picked and replated on a new prepared 12-well MEF feeder plate. Repeat this process (steps 10–12) in increments of six iPSC colonies at a time until a sufficient number of colonies have been picked. 12. The iPSCs are cultured in human iPSC culture medium, or adapted to other proven ESC culture conditions. The cell culture medium must be changed every day to provide necessary nutrients and growth factors for the maintenance of human iPSCs (see Note 13).

4

Notes 1. The 500 mL bottle of Pluriton medium may take up to 2 days to thaw completely at 4 °C. Approximately 220 mL of Pluriton medium will be used during the first week of the protocol and for generating NuFF-conditioned Pluriton medium. The remaining medium should be aliquoted and stored at −20 °C until use. After thawing, the shelf-life of Pluriton medium is 2 weeks when stored at 4 °C. 2. The 200 μL vial of Pluriton supplement must be aliquoted in single-use vials and frozen at −70 °C until use in order to minimize degradation of components in the supplement. One 4 μL aliquot will be used for each daily 10 mL medium preparation.

26

Jun Liu and Paul J. Verma

Once the single-use aliquots have been thawed they must be used immediately and cannot be re-frozen. 3. The B18R protein must be aliquoted into single-use vials and frozen at −70 °C until use. All vials of the B18R protein must be kept on ice at all times in order to minimize degradation of the protein. One aliquot will be used for each day of transfection. Once the single-use aliquots have been thawed they must be used immediately and cannot be re-frozen. 4. Create a master mRNA cocktail and aliquot the mix into single-use volumes. This can be done up prior to beginning the reprogramming experiment. Combine all mRNA factors according to the volumes in the table below. When reprogramming 4 wells at a time, aliquot the mRNA cocktail into 20 single-use vials, one of which will be used for each day of transfection. The mRNA cocktail, as prepared below, has a molar stoichiometry of 3:1:1:1:1:1 for the Oct4, Sox2, Klf4, c-Myc, Lin28 and nGFP mRNAs, respectively. Each mRNA factor is supplied at a concentration of 100 ng/L. Once the single-use aliquots have been thawed they cannot be re-frozen. 5. The total number of cells plated in the flask will determine the volume of Pluriton medium that can be effectively conditioned each day. If 3 × 106 to 4 × 106 NuFF cells have been plated in the T75 flask, 25 mL of Pluriton medium can be conditioned each day. If less than 3 × 106 cells were plated in the flask, add 2 mL of Pluriton medium per 2.5 × 105 cells plated. A minimum of 2.25 × 106 NuFF cells (18 mL medium) should be used in one T75 flask. 6. Before any material can be collected from a human volunteer, ethical approval for the research must be obtained form the local institutional ethics committee. Only trained and authorized personnel should perform skin biopsies, and every subject for whom skin is taken must give written informed consent. It is essential that the designation of the cell strain is unambiguous. It should be unique and maintain donor anonymity. 7. Inactivated NuFF cells should be evenly plated at a density of 2.5 × 105 cells per well of a 6-well plate in a total volume of 2 mL of human fibroblast medium per well. If one vial of NuFF cells contains more than 1 × 106 cells, the remainder of the NuFF cells should be plated in a separate T75 flask to be used to generate NuFF-conditioned Pluriton medium (see Subheading 3.1 “Generating conditioned Pluriton medium”). 8. If reprogramming under low oxygen conditions, the medium should be equilibrated at low O2 tensions. 9. Do not leave the mRNA transfection complex in the culture medium for longer than 4 h, as prolonged exposure to the

Synthetic mRNA Reprogramming of Human Fibroblast Cells

27

RNAiMAX transfection reagent will result in increased cellular toxicity. 10. Cells undergoing reprogramming must be transfected with the mRNA reprogramming factor cocktail every day. It is important to transfect the cells at the same time each day in order to maintain sufficient levels of mRNA transcripts to allow for continual expression of the mRNA factors. 11. It is important to break up the colony into smaller cell aggregates, but not into single cells. 12. Transfer all of the pieces from one colony into a single well of the 12-well plate. 13. For the first few passages after a picking from the reprogrammed cultures, the cells should be passaged manually (without enzymes or centrifugation) at low split ratios to build robust, dense cultures. The cells can be split using an enzymatic protocol for routine culture once there are a large number of human iPSC colonies in the well(s). Human iPSCs are generally passaged every 4–7 days in culture, but the actual passaging schedule and split ratio for each passage will vary depending on the cell culture’s quality and growth. It is important to passage the cells before the culture becomes overgrown.

Acknowledgement This work was supported by the Victorian Government’s Infrastructure Operational Program and collaboration with Stemgent, Inc. References 1. Takahashi K, Yamanaka S (2006) Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126:663–676 2. Takahashi K, Tanabe K, Ohnuki M et al (2007) Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131:861–872 3. Stadtfeld M, Nagaya M, Utikal J et al (2008) Induced pluripotent stem cells generated without viral integration. Science 322:945–949 4. Yu J, Hu K, Smuga-Otto K et al (2009) Human induced pluripotent stem cells free of vector and transgene sequences. Science 324:797–801 5. Jia F, Wilson KD, Sun N et al (2010) A nonviral minicircle vector for deriving human iPS cells. Nat Methods 7:197–199

6. Okita K, Matsumura Y, Sato Y et al (2011) A more efficient method to generate integrationfree human iPS cells. Nat Methods 8:409–412 7. Okita K, Nakagawa M, Hyenjong H et al (2008) Generation of mouse induced pluripotent stem cells without viral vectors. Science 322:949–953 8. Woltjen K, Michael IP, Mohseni P et al (2009) piggyBac transposition reprograms fibroblasts to induced pluripotent stem cells. Nature 458:766–770 9. Yusa K, Rad R, Takeda J et al (2009) Generation of transgene-free induced pluripotent mouse stem cells by the piggyBac transposon. Nat Methods 6:363–369 10. Kim D, Kim CH, Moon JI et al (2009) Generation of human induced pluripotent

28

Jun Liu and Paul J. Verma

stem cells by direct delivery of reprogramming proteins. Cell Stem Cell 4:472–476 11. Zhou H, Wu S, Joo JY et al (2009) Generation of induced pluripotent stem cells using recombinant proteins. Cell Stem Cell 4:381–384 12. Fusaki N, Ban H, Nishiyama A et al (2009) Efficient induction of transgene-free human pluripotent stem cells using a vector based on Sendai virus, an RNA virus that does not integrate into the host genome. Proc Jpn Acad Ser B Phys Biol Sci 85:348–362 13. Ban H, Nishishita N, Fusaki N et al (2011) Efficient generation of transgene-free human induced pluripotent stem cells (iPSCs) by temperature-sensitive Sendai virus vectors. Proc Natl Acad Sci U S A 108:14234–14239

14. Judson RL, Babiarz JE, Venere M et al (2009) Embryonic stem cell-specific microRNAs promote induced pluripotency. Nat Biotechnol 27:459–461 15. Miyoshi N, Ishii H, Nagano H et al (2011) Reprogramming of mouse and human cells to pluripotency using mature microRNAs. Cell Stem Cell 8:633–638 16. Warren L, Manos PD, Ahfeldt T et al (2010) Highly efficient reprogramming to pluripotency and directed differentiation of human cells with synthetic modified mRNA. Cell Stem Cell 7:618–630 17. Mandal PK, Rossi DJ (2013) Reprogramming human fibroblasts to pluripotency using modified mRNA. Nat Protoc 8:568–582

Chapter 3 MicroRNA-Mediated Reprogramming of Somatic Cells into Induced Pluripotent Stem Cells Shelley E.S. Sandmaier and Bhanu Prakash V.L. Telugu Abstract MicroRNAs or miRNAs belong to a class of small noncoding RNAs that play a crucial role in posttranscriptional regulation of gene expression. Nascent miRNAs are expressed as a longer transcript, which are then processed into a smaller 18–23-nucleotide mature miRNAs that bind to the target transcripts and induce cleavage or inhibit translation. MiRNAs therefore represent another key regulator of gene expression in establishing and maintaining unique cellular fate. Several classes of miRNAs have been identified to be uniquely expressed in embryonic stem cells (ESC) and regulated by the core transcription factors Oct4, Sox2, and Klf4. One such class of miRNAs is the mir-302/367 cluster that is enriched in pluripotent cells in vivo and in vitro. Using the mir-302/367 either by themselves or in combination with the Yamanaka reprogramming factors (Oct4, Sox2, c-Myc, and Klf4) has resulted in the establishment of induced pluripotent stem cells (iPSC) with high efficiencies. In this chapter, we outline the methodologies for establishing and utilizing the miRNA-based tools for reprogramming somatic cells into iPSC. Key words ESC, IPSC, miRNA, Pluripotency, Reprogramming

Abbreviations iPSC ESC TALENS CRISPR ZFN

1

Induced pluripotent stem cells Embryonic stem cells Transcription activator-like effector nucleases Clustered regularly interspaced short palindromic repeat Zinc finger nucleases

Introduction MicroRNAs (miRNAs) are short noncoding RNAs that bind target mRNAs via complete or incomplete sequence complementarity and regulate stability and translatability of the message [1–3]. Nascent miRNAs are transcribed from endogenous loci via Pol II RNA polymerase as 85–100 base pair nascent transcripts, which are then

Paul J. Verma and Huseyin Sumer (eds.), Cell Reprogramming: Methods and Protocols, Methods in Molecular Biology, vol. 1330, DOI 10.1007/978-1-4939-2848-4_3, © Springer Science+Business Media New York 2015

29

30

Shelley E.S. Sandmaier and Bhanu Prakash V.L. Telugu

processed by Drosha and Dicer into mature miRNAs of 18–23 nucleotides in length [3, 4]. The mature miRNAs are characterized by a “seed sequence” at the 5′-end between nucleotides 2–8, exhibiting perfect complementarity with the target gene [2]. After a miRNA recognizes and binds to the target mRNA, it inhibits translation in either of the two ways: (1) targeting the mRNA for cleavage if the miRNA shares perfect complementarity with the sequence or (2) in the case of partial complementarity prevents assembly of a ribosome initiation complex and initiation of translation [3]. Due to the ability of miRNAs to bind to target sequences, albeit with poor complementarity, one miRNA is often capable of binding to a cohort of mRNAs and inhibiting translation. Accordingly, many genes can often be regulated by a candidate miRNA [1, 2]. In embryonic stem cells (ESC), several classes of miRNAs have been identified to be specifically enriched, indicating a possible role in maintaining pluripotency [5]. Potentially several more exist based on the putative ability of certain transcripts to form hairpin miRNA precursors [5]. A much stronger evidence for the role of miRNAs in maintaining pluripotency comes from the discovery that several of the miRNA genes have binding sites for core pluripotency genes Oct4, Sox2, and Nanog in their promoters [6]. In ESC, miRNAs specifically target genes which affect varying properties of pluripotency such as transcription factors, cell cycle genes, and genes involved in epigenetic regulation. Regulation of pluripotency by such diverse cellular mechanisms is necessary to ensure greater stability of ESC [2]. Considering the abundance of miRNAs in ESC, and their putative role in regulating pluripotency, the ability of miRNAs to aid in the production and maintenance of induced pluripotent stem cells (iPSCs) has been increasingly studied. iPSCs have traditionally been generated from somatic cells via retroviral delivery of Oct4, Sox2, Klf4, and c-myc (OSKM) reprogramming factors, as was first reported by Takahashi and Yamanaka [7]. However, the induction of pluripotency by OSKM is rather inefficient (0.001–0.01 %), yielding very few colonies per million cells infected with retrovirus [7, 8]. Recently, iPSCs have been produced with greater efficiency by incorporating specific miRNA clusters shown to be involved in regulating the pluripotent state [9, 10]. Specifically, a well-studied mir-302/367 cluster, which has been shown to play a role in regulating cell cycle, and is regulated by the core pluripotency factors Oct4, Sox2, Nanog, and Tcf3, has been utilized in the reprogramming efforts [6, 11]. Mir-302/367 cluster comprises of five miRNAs, mir-302a, -b, -c, -d, and mir-367, expressed as a polycistronic construct and located within intron 8 of the LARP7 gene in humans, with homologs in several species including cattle, pigs, and mice [6, 9]. Interestingly, the seed sequences of the four miRNAs (302a/b/c/d) are identical, and share high degree of conservation across species. When used in combination with the traditional OSKM factors in

miRNA Mediated Reprogramming of Somatic Cells

31

reprogramming experiments, the number of iPSC colonies has been shown to be enhanced by at least two orders of magnitude (0.1–0.8 %) [9, 10]. In fact, cells can be reprogrammed to pluripotency with mir-302/367 and a histone deacetylase (HDAC) inhibitor, valproic acid, alone, and show ESC-like morphology sooner than cells reprogrammed with OSKM. Moreover, these iPSCs are capable of contributing to all three germ layers as well as giving rise to germ-line chimeras in mice [9]. Human iPSCs have also been generated using miRNAs with or without the addition of OSKM into the genome [9, 12–14]. Therefore, our and several other laboratories have adopted miRNAs as a standard factor in reprogramming iPSC (Manuscript in preparation). The use of miRNA is especially important in reprogramming somatic cells from livestock species, where the efficiencies of reprogramming are even lower, and the conditions for optimal culture not completely understood. In this manuscript, the procedures for making and using miRNA-based vectors for reprogramming somatic cells from the domestic animal species, pig, are discussed. However, the methods discussed below can easily be adopted for other model organisms.

2

Materials Store all reagents and media at 4 °C unless otherwise noted.

2.1

Cell Culture

1. Complete media: 440 mL HyClone High Glucose DMEM (ThermoScientific), 50 mL 10 % fetal calf serum (FCS), 2.5 mL 100× GlutaMAX (Gibco), 5 mL 100× nonessential amino acids, and 5 mL 100× sodium pyruvate (see Note 1). 2. iPSC media: 382.5 mL HyClone DMEM F12 (ThermoScientific), 100 mL knockout serum replacer (KSR) (Gibco), 2.5 mL GlutaMAX, 5 mL nonessential amino acids, 10 mL sodium bicarbonate solution 7.5 %, and 8 ng/mL FGF2 (R&D Systems). 3. 0.25 % trypsin–EDTA for dissociation and harvesting of cells. 4. Dimethyl sulfoxide (DMSO) for cryopreservation. 5. CF-1 mice OR irradiated mouse embryonic fibroblasts (MEFs). 6. Phosphate-buffered saline (PBS). 7. T-75 flasks. 8. Cryovial freezing container filled with 2-propanol.

2.2 Lentivirus Production

1. 293-FT cells (Life Technologies) viral packaging cells. 2. Geneticin (G418). 3. Gelatin. 4. Polyjet (Signagen).

32

Shelley E.S. Sandmaier and Bhanu Prakash V.L. Telugu

5. Polybrene. 6. Packaging plasmids and vectors with genes of interest, maxiprepped. 7. Valproic acid (Stemgent), store at −20 °C.

3

Methods Cells should always be incubated at 37 °C in 5 % CO2 unless otherwise noted. Passaging of cells is always done with 0.25 % trypsin–EDTA unless otherwise noted.

3.1 Production of Mouse Embryonic Fibroblasts

As an alternative to generating your own MEFs for use as feeder cells, irradiated MEFs from this mouse strain are available for purchase. 1. Set up a mating by placing one 8-week-old CF-1 female in a cage with one CF-1 male. Check daily in the morning to determine the presence of a copulatory plug. The first sighting of a plug will be considered day 0.5 of gestation. 2. On day 13.5 of gestation, sacrifice pregnant females by cervical dislocation. Remove the uterus, isolate the embryos, and perform the following steps in a laminar flow hood. Remove limbs and internal organs of the fetuses, and mince the remainder of the fetuses in 3 mL of 0.25 % trypsin–EDTA using a sterile scalpel blade (see Note 2). Allow cells to digest for 30–60 min in a 37 °C incubator with 5 % CO2. Halt the reaction with 6 mL of complete media. 3. Centrifuge cells at 800 × g for 10 min and aspirate supernatant. Wash cells twice more with 6 mL complete media and centrifugation. Plate cells in 150 mm dishes. 4. After 1–2 days of culture, trypsinize cells and freeze in 92 % complete media + 8 % DMSO in liquid nitrogen (see Notes 3 and 4). In order to irradiate, thaw the frozen vials and grow in T-75 flasks (see Note 5). Passage cells 2–5 times at a ratio of 1:5. Remove media and add PBS to irradiate. After irradiation, count cells and freeze as before with a density of 5–10 ×106 cells per vial.

3.2 Production of Lentivirus for Transduction

1. Thaw one vial of 293-FT cells and put into a T-75 flask with 17 mL complete media. On day 2, feed cells with complete media containing 500 μg/mL of G418. 2. On day 3, passage cells using 3 mL of 0.25 % trypsin–EDTA at 1:4 using complete media + G418. Keep the passaged cells in a T-75 flask. 3. On day 4, passage cells as before and count using a hemocytometer. Seed 4 × 106 cells per 100 mm dish (see Note 6) in complete media which does not contain G418.

miRNA Mediated Reprogramming of Somatic Cells

33

4. The next day (day 0), transfect cells. Two hours before transfection, refresh the media with 5 mL of complete media per 100 mm dish. Because the lentivirus is divided into multiple parts to ensure safety, each plasmid will be infected into an individual 100 mm dish to produce lentivirus of one type only. Mix the following amounts of DNA in 250 μL of plain DMEM per single reaction (see Note 7): (a) pMD2.G (VSV-G): 3.15 μg per dish. (b) psPAX2: 5.85 μg per dish. (c) Plasmid containing OSK: 6 μg per dish. (d) Plasmid containing MLN: 6 μg per dish. (e) Plasmid containing miR-302/367: 6 μg per dish. 5. In a separate mixture, add 30 μL of Polyjet to 220 μL of plain DMEM per single reaction. Mix gently. Add 250 μL Polyjet mixture to each DNA solution dropwise and gently finger flick to mix. Incubate for 15 min at room temperature (see Note 8). 6. Add mixture dropwise to prepared 293-FT cells. Gently shake dish left and right, and then forward and backward to mix, and incubate. 3.3 Preparation of Porcine Fibroblasts

1. On day 0 (the same day you transfect 293-FT cells), thaw the frozen porcine fibroblasts and seed one vial per T-75 flask (see Note 9). One day later, trypsinize the cells and count; each well of a 6-well plate will need 1 × 105 cells.

3.4 Transduction of Porcine Fibroblasts

1. 18 h post-transfection (day 1), aspirate and discard the supernatant and feed 293-FT cells with 9 mL per 100 mm dish of complete media containing only 2 % FCS (see Note 1). 2. On day 2 (48 h post-transfection) collect the supernatant and centrifuge at 200 × g for 10 min to separate any cells collected. Add 1.2 μL Polybrene per 0.5 mL of complete media per well of a 6-well plate containing porcine fibroblasts. Then add 1.5 mL per well of combined transfected supernate. Incubate cells with lentivirus for 6 h only, then aspirate, and feed with 2 % FCS media. Repeat transduction of target cells as above 24 h later, on day 3.

3.5 Reprogramming of Fibroblasts to iPSCs

1. Feed each well of the 6-well plate with 1.5 mL of complete media. When cells become confluent, passage with .05 % trypsin at a ratio of 1:6 onto two 100 mm dishes containing MEF feeder cells. Feed each dish with 7.5 mL of complete media for 1 more day. 2. The next day, switch to feeding with iPSC media which contains 0.5 μM valproic acid. Feed daily with 7.5 mL for 7 days. 3. After the 7 days on valproic acid, continue to feed daily with iPSC media alone. When fibroblasts begin to overgrow, split

34

Shelley E.S. Sandmaier and Bhanu Prakash V.L. Telugu

plates with trypsin and plate on fresh MEFs at a ratio of 1:4 or greater once or twice during the initial reprogramming period (see Note 10). Continue feeding cells with 7.5 mL iPSC media and check for colonies daily. 4. After colonies begin to appear, they are manually picked with pulled Pasteur pipettes and moved individually to a single well of a 24-well plate, with a layer of MEFs (see Note 11). 5. As necessary, colonies can gradually be moved up to a 12-well and then a 6-well plate. 6. Once colonies have appeared, there are several things to do right away to establish good (or eliminate poor) cell lines. These include AP staining (see Note 12), PCR amplification for pluripotency genes (Oct4, Nanog), and analysis of morphological characteristics of iPSCs.

4

Notes 1. FCS should be stored at −20 °C. Avoid multiple freeze-thaw cycles by aliquoting serum and thawing single aliquots for storage at 4 °C. GlutaMAX can be stored at room temperature or 4 °C. Even though several of these reagents are shipped sterile, filter sterilize the complete mixture to ensure sterility. For complete media containing only 2 % FCS, add 10 mL FCS to 480 mL DMEM. Keep all other additive amounts the same. 2. Use each fetus as a separate replicate. That is, each fetus should require 3 mL trypsin and should be performed in a separate tube. 3. We use a dry trypsinization throughout. To do this, add the appropriate amount of trypsin solution to the flask or well and immediately remove the excess. Allow cells to incubate for 5 min, and then add complete media back to the well for passaging. This minimizes the amount of stress on cells by providing a bare minimum of trypsin while also allowing for single-cell passage. 4. Freezing should be done slowly (−1 °C/min); we use Mr. Frosty freezing containers filled with 2-propanol that allow for slow freezing. Put vials of cells into freezing container, and place into −80 °C freezer. Keep in freezer overnight and transfer to liquid nitrogen the next day for long-term storage. 5. When thawing cells, do so quickly to avoid damage. Thaw at 37 °C, and immediately add 1 mL complete media drop by drop. Pipette gently up and down a few times and transfer to 15 mL tube containing 3 mL media. Centrifuge cells at 200 × g for 5 min. Remove supernatant, and add complete media to resuspend cells.

miRNA Mediated Reprogramming of Somatic Cells

35

6. 100 mm dishes should be pretreated with gelatin. Add 5 mL gelatin and incubate for 3–5 h. After this time, aspirate gelatin and seed cells as indicated. 7. Because you will most likely be performing multiple replicates of transfections, make a master mix of DNA and DMEM. Remember to keep different plasmids in separate master mixes. 8. Again, make a master mix of Polyjet and DMEM to account for the multiple dishes you will be transfecting. Do not add DNA to Polyjet solution—always add Polyjet to DNA. 9. If cells are sparsely populated, thaw the cells a few days earlier and passage them once using trypsin and complete media. 10. Usually, passaging during this period is done around day 10 and again around day 20. Be vigilant about noticing any changes in cell population as soon as they occur, as overgrowth of feeders can inhibit generation of iPSCs. 11. Pulled Pasteur pipettes are made by heating the glass over a flame near the end of the pipette and, once warm, bending the glass to create an L-shape at the end. When manually passaging, use the bent end of the pipette to scrape colonies off the plate, then collect the media containing cells, and transfer or split onto the new plate. 12. When performing an AP stain, always move cells to a different plate from those you want to continue culturing. The fixative used in AP staining can kill cells in adjacent wells if you decide to stain in the same plate you are keeping colonies you want to maintain.

Acknowledgements This work was supported in part by funds from Maryland Agriculture Experimental Station (MAES) Seed Grant, Maryland Stem Cell Research Fund (MSCRF) Exploratory Grant, and the Department of Animal and Avian Sciences, University of Maryland. References 1. Ying SY, Chang DC, Lin SL (2008) The microRNA (miRNA): overview of the RNA genes that modulate gene function. Mol Biotechnol 38:257–268 2. Huang XA, Lin H (2012) The miRNA regulation of stem cells. Wiley Interdiscip Rev Membr Transp Signal 1:83–95 3. Cullen BR (2013) MicroRNAs as mediators of viral evasion of the immune system. Nat Immunol 14:205–210

4. Lee Y, Kim M, Han J, Yeom KH, Lee S, Baek SH, Kim VN (2004) MicroRNA genes are transcribedbyRNApolymeraseII.EMBOJ23:4051– 4060 5. Houbaviy HB, Murray MF, Sharp PA (2003) Embryonic stem cell-specific MicroRNAs. Dev Cell 5:351–358 6. Card DA, Hebbar PB, Li L, Trotter KW, Komatsu Y, Mishina Y, Archer TK (2008) Oct4/Sox2-regulated miR-302 targets cyclin

36

7.

8.

9.

10.

11.

Shelley E.S. Sandmaier and Bhanu Prakash V.L. Telugu D1 in human embryonic stem cells. Mol Cell Biol 28:6426–6438 Takahashi K, Yamanaka S (2006) Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126:663–676 Di Stefano B, Maffioletti SM, Gentner B, Ungaro F, Schira G, Naldini L, Broccoli V (2011) A microRNA-based system for selecting and maintaining the pluripotent state in human induced pluripotent stem cells. Stem Cells 29:1684–1695 Anokye-Danso F, Trivedi CM, Juhr D, Gupta M, Cui Z, Tian Y, Zhang Y, Yang W, Gruber PJ, Epstein JA, Morrisey EE (2011) Highly efficient miRNA-mediated reprogramming of mouse and human somatic cells to pluripotency. Cell Stem Cell 8:376–388 Judson RL, Babiarz JE, Venere M, Blelloch R (2009) Embryonic stem cell-specific microRNAs promote induced pluripotency. Nat Biotechnol 27:459–461 Marson A, Levine SS, Cole MF, Frampton GM, Brambrink T, Johnstone S, Guenther

MG, Johnston WK, Wernig M, Newman J, Calabrese JM, Dennis LM, Volkert TL, Gupta S, Love J, Hannett N, Sharp PA, Bartel DP, Jaenisch R, Young RA (2008) Connecting microRNA genes to the core transcriptional regulatory circuitry of embryonic stem cells. Cell 134:521–533 12. Miyoshi N, Ishii H, Nagano H, Haraguchi N, Dewi DL, Kano Y, Nishikawa S, Tanemura M, Mimori K, Tanaka F, Saito T, Nishimura J, Takemasa I, Mizushima T, Ikeda M, Yamamoto H, Sekimoto M, Doki Y, Mori M (2011) Reprogramming of mouse and human cells to pluripotency using mature microRNAs. Cell Stem Cell 8:633–638 13. Zhang Z, Wu WS (2013) Sodium butyrate promotes generation of human iPS cells through induction of the miR302/367 cluster. Stem Cells Dev 22(16):2268–2277 14. Lin SL, Chang DC, Chang-Lin S, Lin CH, Wu DT, Chen DT, Ying SY (2008) Mir-302 reprograms human skin cancer cells into a pluripotent ES-cell-like state. RNA 14:2115–2124

Chapter 4 Generation of Footprint-Free Induced Pluripotent Stem Cells from Human Fibroblasts Using Episomal Plasmid Vectors Dmitry A. Ovchinnikov, Jane Sun, and Ernst J. Wolvetang Abstract Human induced pluripotent stem cells (hiPSCs) have provided novel insights into the etiology of disease and are set to transform regenerative medicine and drug screening over the next decade. The generation of human iPSCs free of a genetic footprint of the reprogramming process is crucial for the realization of these potential uses. Here we describe in detail the generation of human iPSC from control and diseasecarrying individuals’ fibroblasts using episomal plasmids. Key words Human induced pluripotent stem cells, Reprogramming, Episomal plasmid vectors, Fibroblasts, Transfection, Genomic integration

1

Introduction Lentiviral or retroviral delivery of reprogramming factors has been a powerful tool in pioneering the field of cell reprogramming. However, the concerns associated with the disruption of the genome at the viral integration sites, number and position and the unpredictable nature of transgene silencing, as well as their potential reactivation following differentiation have made integration-dependent methods unsuitable for clinical applications. Indeed, with the wealth of currently available alternative technologies there is really no need to modify the genomic DNA of the target cell when generating induced pluripotent stem cells. Researchers have a number of options ranging from piggybac or sleeping beauty transposon-based or Cre recombinase-aided methods to excise integrated reprogramming cassettes, or to avoid DNA-integrating methods altogether and use mRNA, helperdependent adenoviral, Sendai virus-derived or episomal vectorbased methods [1–6]. Here we describe a protocol for the generation of human iPSCs from fibroblasts using episomal plasmid

Paul J. Verma and Huseyin Sumer (eds.), Cell Reprogramming: Methods and Protocols, Methods in Molecular Biology, vol. 1330, DOI 10.1007/978-1-4939-2848-4_4, © Springer Science+Business Media New York 2015

37

38

Dmitry A. Ovchinnikov et al.

vectors encoding the reprogramming factors. Episomal generation of human iPSCs was originally pioneered by Yu et al. [7] on fibroblasts, and has subsequently been adapted for the generation of iPSC from cord blood [8], PBMCs [9, 10], as well as feeder-free generation of footprint-free iPSCs [11]. The method involves a single transfection of the target cells with one or more oriP/ EBNA-1 (Epstein-Barr nuclear antigen-1) episomal vectors carrying OCT4, SOX2, NANOG, LIN28, c-MYC, KLF4, and SV40LT constitutive expression cassettes. Because the oriP/EBNA-1 vectors, which can be readily delivered to almost any human cell type by simple transfection, are maintained at a low copy number for only a limited number of passages before being gradually lost over time, this method has been widely adopted by many laboratories worldwide [7, 12, 13]. While the efficiency of the method is perhaps lower than other non-integrating methods, it usually generates a sufficient number of clones of high-quality fully reprogrammed iPS cells for downstream applications. Here we further outline a culture medium adaptation protocol that was successfully used to aid in generation of iPSCs from difficult-to-reprogram disease model cells such as the ones with the Down syndrome (trisomy 21) karyotype [12].

2

Materials

2.1 Media and Buffers

1. MEF culture medium (500 ml): DMEM 440 ml, FBS 50 ml, MEM-NEAA(100×) 5 ml, GlutaMAX (200 mM L-alanylL-glutamine dipeptide in 0.85 % NaCl, 100×) 5 ml. 2. hiPSC KSR culture medium (500 ml): DMEM/F12 390 ml, KO-SR100ml, glutamine/GlutaMAX (100×) 5 ml, MEMNEAA(100×) 5 ml, and 2-mercaptoethanol (55 mM) 900 μl (typically added before use). 3. Direct cell lysis buffer for PCR (1×): 50 mM Tris–HCl, pH 9.5, 0.1 %(v/v) Triton-X100. 4. Basic PCR buffer (10×): 500 mM Tris–HCl, pH 9.2, 500 mM KCl, 0.05 % (v/v) Triton-X100, 20 mM MgCl2 (optional, could be added during the assembly of the PCR reaction to a desired concentration). 5. Transfection buffers: Nucleofection buffer NHDF—VPD1001 from Lonza (Miltenyi Biosciences). 6. Plasmid vectors: oriP/EBNA1-based pCEP4 episomal vectors pEP4EO2SCK2MEN2L (7.3 μg) (Addgene plasmid 20924) and pEP4EO2SET2K (3.2 μg) (Addgene plasmid 20927) outlined in condition 4 of experiment 4 of Supplementary Table 2 by Yu et al. [7].

Generation of Footprint-Free Induced Pluripotent Stem Cells from Human…

3

39

Methods Overview: The oriP/EBNA1-based pCEP4 episomal vectors pEP4EO2SCK2MEN2L (7.3 μg) (Addgene plasmid 20924) and pEP4EO2SET2K (3.2 μg) (Addgene plasmid 20927) as outlined in condition 4 of experiment 4 of Supplementary Table 2 by Yu et al. [7] are transfected into 106 human fibroblasts using nucleofection (NHDF—VPD-1001 with U-020 program, Amaxa). Transfected fibroblasts (106 cells per nucleofection) are then directly plated onto 3 × 10 cm MEF-seeded (36,000/cm2) Petri dishes in fibroblast culture medium for 4 days. Culture medium has to be changed every second day. Next, cultures are adapted to KOSR medium containing 100 ng/ml bFGF over a course of 3 days. After 3–4 weeks 20 colonies of each line are manually picked and cultured on fresh MEF feeder plates for 4 weeks before bulk expansion by Collagenase IV (Gibco) passaging (as described in Ref. 14). Step-by-step protocol:

3.1 Plating MEFs for Conditioned Medium on Day–11

1. Prepare 1× T175 flask for each sample to be reprogrammed. 2. Add 0.1 % gelatine to cover the surface (~5 ml) of the T175 flask. 3. Leave the plate at room temperature for 20–30 min. 4. Remove gelatine. 5. Plate irradiated MEFs at 60,000 MEFS/cm2 in fibroblast medium. 6. Next day replace fibroblast medium with KSR with 4 ng/ml bFGF. 7. Collect MEF-conditioned medium every day for 10 days and store at −80 °C.

3.2 Plating MEFs, on Day 1

1. Prepare 3 × 10 cm plates for each sample. 2. Add 0.1 % gelatine on each plate to cover the surface (~4 ml). 3. Leave the plate at room temperature for 20–30 min. 4. Remove gelatine. 5. Plate irradiated MEFs at 36,000 MEFS/cm2 in fibroblast medium.

3.3 Preparing the Target Fibroblasts (See Notes 1 and 2)

1. Spray a vial of frozen human fibroblasts with 70 % ethanol to sterilize. 2. Thaw at RT and before all ice has disappeared add 1 ml of room-temperature fibroblast medium. 3. Transfer contents of vial to 15 ml tube and slowly add 9 ml of fibroblast medium.

40

Dmitry A. Ovchinnikov et al.

4. Spin at 300 × g for 4 min. 5. Aspirate the medium and gently resuspend the pellet in 7.5 ml of fibroblast medium. 6. Count the cells and seed fibroblasts at 40–50 % confluence in an appropriate size flask (e.g., T75). 7. Change the medium the following day. 8. When cells are 70 % confluent remove fibroblast medium. 9. Wash once with PBS. 10. Add sufficient TrypLE or trypsin/EDTA to cover the surface area with 0.5 mm. 11. Place in the incubator for 4 min. 12. Detach the cells by tapping the flask. 13. Add fibroblast medium to make a total volume of 15 ml to inhibit the trypsin and transfer into one 15 ml tube. 14. Spin at 300 × g for 4 min. 15. Aspirate the medium from the spun-down tube, and gently resuspend the pellet with 5 ml of fibroblast medium. 16. Count cells. 3.4 Fibroblast Nucleofection (Transfection by Electroporation Using the Amaxa Nucleofector)

1. For each sample to be transfected, transfer 1,000,000 human dermal fibroblast cells to a 1.5 ml microcentrifuge tube. 2. Spin down the tube for 30 s at 200 × g. 3. Aspirate the supernatant. 4. Resuspend gently in 100 μl (freshly prepared by mixing of 82 μl of buffer solution + 18 μl of supplement) NHDF–VPD1001 buffer. 5. Add the oriP/EBNA1-based pCEP4 episomal vectors pEP4EO2SCK2MEN2L (7.3 μg) (Addgene plasmid 20924) and pEP4EO2SET2K (3.2 μg) (Addgene plasmid 20927) (see Notes 3 and 4). 6. Immediately transfer to the AMAXA nucleofector cuvette. 7. Nucleofect using the U-020 program. 8. Collect the cells using a transfer pipette (provided in the transfection kit) and gently add 1 and then 4.9 ml of fibroblast medium at room temperature. 9. Divide cells equally (2 ml/plate) over 3 × 10 cm dishes seeded with 36,000 MEFs/cm2 prepared on day–1. 10. Gently shake the plate to distribute the cells evenly.

3.5

Reprogramming

1. The next day change to fresh fibroblast medium. 2. At day +3 after transfection change medium to 25–75 %, on day +4 to 50–50 %, on day +5 to 75–25 %, and on day +6 to 100 % iPSC medium with 100 ng/ml bFGF (see Note 5).

Generation of Footprint-Free Induced Pluripotent Stem Cells from Human…

41

3. On day 7: Substitute iPSC medium with MEF-conditioned KSR medium supplemented with 100 ng/ml bFGF. 4. Change medium every day with MEF-conditioned medium supplemented with 100 ng/ml bFGF until colonies appear (see Fig. 1). 5. If no clearly pluripotent colonies are apparent harvest the cells at 3 weeks and replate on fresh MEF feeders and continue to culture for an additional 1 week in iPSC medium (weeks 3–4) and in MEF-conditioned medium with 100 ng/ml bFGF from week 4 onwards (see Note 5). 6. Perform a live stain with anti-TRA-1-60 antibody (add directly FITC- or Alexa 488-conjugated TRA-1-60 antibodies (1:100– 1:200) in MEF-conditioned medium (filter-sterilized), incubate cells for 2 h with antibodies, wash with MEF-conditioned medium, replace medium with MEF-conditioned medium with 100 ng/ml bFGF, and observe under fluorescent microscope) (see Fig. 1). 7. Score TRA-1-60-positive colonies, label on the underside of the culture vessel, and manually pick TRA-1-60-expressing colonies with pluripotent morphology (see Notes 6–8). 8. Plate colonies on organ culture dishes with 20,000 MEFs/cm2 in iPSC medium. ROCK inhibitor (Y27632) at 10 μM can be added to the medium for 1 day when passaging. 9. Expand the individually picked iPSC colonies on organ culture dishes until passage 7 with morphology selection to establish stable iPSC lines. Enzymatic passaging with collagenase is now feasible (into 3–4 organ culture dishes). 3.6 Verifying the Transgene-Free Status of the iPS Clones

3.6.1 Direct Lysis of iPS Cells for PCR Screening

To verify the absence of transgene integration or persistence of the episomal plasmids perform a whole-cell PCR with the plasmidspecific primer pairs (Table 1). To ensure that genomic insertion of the reprogramming factor-encoding vector DNA did not occur, we utilize two sets of PCRs amplifying common elements in both episomal vectors used in reprogramming (situated in EBNA and OCT4 coding regions), as well as PCRs specific for each of the vectors. 1. Using the high-pH detergent-containing buffer (see Subheading 2) pre-warmed to 65 °C to quickly lyse cells (~100 μL/104 cells, preferably in single-cell suspension’s pellet), mix well by pipetting, and incubate at 90 °C for 5 min (see Note 9). 2. Take 1–2 μL as a template for PCR reaction for transgene detection using the following conditions: 95 °C for 3 min;

42

Dmitry A. Ovchinnikov et al.

Fig. 1 Bright-field images of human fibroblasts over the time course of reprogramming utilizing the episomal method described herein. Note the robust TRA-1-60 expression in fully reprogrammed iPSC colonies and the absence of TRA-1-60 expression in incompletely reprogrammed cell colonies

Generation of Footprint-Free Induced Pluripotent Stem Cells from Human…

43

Table 1 Primer sets used for detection of the persistence of episomal reprogramming vectors in the genomic DNA of transgene-free iPS clones by PCR

Reverse primer

Product size (bp)

PCR target

Forward primer

OCT4-IRES2

AGTGAGAGGCAACCTGGAGA AGGAACTGCTTCCTTCACGA

567

EBNA1

TCCACAATGTCGTCTTACACC CAAAGCTGCACACAGTCACCC

182

IRES2-cMYC

TGGCTCTCCTCAAGCGTATT

CTGGTAGAAGTTCTCCTCCTCG 346

SV40 LgT-IRES2 TGGGGAGAAGAACATGGAAG AGGAACTGCTTCCTTCACGA GAPDH (gDNA)

CCTGACCTGCCGTCTAGAAA

CAAAGGTGGAGGAGTGGGTG

491 153

Fig. 2 An example of the whole-cell PCR product separation on agarose gels. A,B-episomal transgene-free iPS clones, C+ episomally transfected fibroblasts used as a positive control. M = 100 bp DNA ladder (NEB)

35–40 cycles of 95 °C for 15 s, 56 °C for 20 s, and 72 °C for 40 s; and final extension for 5 min at 72 °C. 3. The resulting PCR bands can be analyzed by agarose gel electrophoresis; cells transfected and not transfected with the episomal vector(s) should be used as positive and negative PCR controls, respectively (Fig. 2) (see Note 10). 3.7 Characterization of iPSC

To confirm a fully reprogrammed status of generated clones, we recommend karyotypic analysis, teratoma formation assay, tri-lineage differentiation in EBs, methylation analysis of OCT4 and NANOG promoters, FACS analysis, immunofluorescent detection of pluripotency markers, and DNA testing of iPSC and donor cell to establish provenance as the minimum characterization standard, e.g., [12, 15]. Preferably Pluritest following Illumina microarray analysis is performed. Description of these protocols falls outside the scope of this chapter.

44

4

Dmitry A. Ovchinnikov et al.

Notes 1. Test any cell batch destined for reprogramming (step 3) for the absence of a mycoplasma infection by culturing the target cells for 6 weeks in medium without antibiotics. We routinely use the Lonza kit (Myco Alert). Make an early freeze that can be used for reprogramming once it is shown that the cells are mycoplasma free. Do not use late-passage cells for reprogramming if possible. 2. Fibroblast cells should be healthy, and should not be over 70 % confluency before reprogramming (step 3). 3. Use Endofree plasmid kit for episomal vector extraction (used in step 4) following Maxi/Midi preps. 4. Verify the integrity of the episomal plasmids before transfection (step 4) using gel electrophoresis and perform restriction digests. Recombination of vectors can occur in certain bacterial strains and plasmid preparations containing linearized or fragmented plasmids increase the chance of unwanted genomic integration. 5. Add bFGF to the medium (step 5) just before feeding the cells (80–100 ng/ml for iPS cells depending on iPS type and bFGF supplier). 6. We frequently see cases with only a section of the colony showing TRA-1-60 staining (step 5). Such colonies benefit greatly from passaging and usually generate healthy iPSCs. 7. To increase reprogramming efficiency (step 5) reprogram for the first 10 days under low-oxygen (5 %) conditions with daily medium changes. 8. Pick up to ten clones (step 5) to make sure that at least three karyotypically normal iPSC lines of good-quality, i.e., “fully reprogrammed,” iPS cell clones are obtained that consistently express all of the pluripotency markers and propagate with expected efficiency. Vitrify more colonies if possible. 9. It is important to use correct number of cells for direct cell PCR (step 6), as excess might cause inhibition of PCR, while insufficient number of target genome equivalents might lead to a failure to detect low-copy-number integration of the transgene. It is also important to ensure that cell (pellet) lysis occurs instantaneously to minimize DNA degradation, as detergent presence and heat denaturation tend are needed to inactivate endogenous DNases efficiently. 10. It is advisable to perform the test for transgene loss at the early passage (passages 4–8), to eliminate clones carrying integrated or abnormally persistent reprogramming factor-encoding episomal vectors.

Generation of Footprint-Free Induced Pluripotent Stem Cells from Human…

45

References 1. Di Matteo M, Matrai J, Belay E et al (2012) PiggyBac toolbox. Methods Mol Biol 859: 241–254 2. Papapetrou EP, Sadelain M (2011) Generation of transgene-free human induced pluripotent stem cells with an excisable single polycistronic vector. Nat Protoc 6:1251–1273 3. Parameswaran S, Balasubramanian S, Rao MS et al (2011) Concise review: non-cell autonomous reprogramming: a nucleic acid-free approach to induction of pluripotency. Stem Cells 29:1013–1020 4. O'malley J, Woltjen K, Kaji K (2009) New strategies to generate induced pluripotent stem cells. Curr Opin Biotechnol 20:516–521 5. Seki T, Yuasa S, Fukuda K (2012) Generation of induced pluripotent stem cells from a small amount of human peripheral blood using a combination of activated T cells and Sendai virus. Nat Protoc 7:718–728 6. Ban H, Nishishita N, Fusaki N et al (2011) Efficient generation of transgene-free human induced pluripotent stem cells (iPSCs) by temperature-sensitive Sendai virus vectors. Proc Natl Acad Sci U S A 108: 14234–14239 7. Yu J, Hu K, Smuga-Otto K et al (2009) Human induced pluripotent stem cells free of vector and transgene sequences. Science 324: 797–801 8. Hu K, Yu J, Suknuntha K et al (2011) Efficient generation of transgene-free induced pluripotent stem cells from normal and neo-

9.

10.

11.

12.

13.

14.

15.

plastic bone marrow and cord blood mononuclear cells. Blood 117:e109–e119 Hu K, Slukvin I (2013) Generation of transgene-free iPSC lines from human normal and neoplastic blood cells using episomal vectors. Methods Mol Biol 997:163–176 Mack AA, Kroboth S, Rajesh D et al (2011) Generation of induced pluripotent stem cells from CD34+ cells across blood drawn from multiple donors with non-integrating episomal vectors. PLoS One 6:e27956 Chen G, Gulbranson DR, Hou Z et al (2011) Chemically defined conditions for human iPSC derivation and culture. Nat Methods 8:424–429 Briggs JA, Sun J, Shepherd J et al (2012) Integration-free induced pluripotent stem cells model genetic and neural developmental features of down syndrome etiology. Stem Cells 31:467–478 Fontes A, Macarthur CC, Lieu PT et al (2013) Generation of human-induced pluripotent stem cells (hiPSCs) using episomal vectors on defined Essential 8™ Medium conditions. Methods Mol Biol 997:57–72 Xu RH, Peck RM, Li DS et al (2005) Basic FGF and suppression of BMP signaling sustain undifferentiated proliferation of human ES cells. Nat Methods 2:185–190 Ovchinnikov DA, Turner JP, Titmarsh DM et al (2012) Generation of a human embryonic stem cell line stably expressing high levels of the fluorescent protein mCherry. World J Stem Cells 4:71–79

Chapter 5 Reprogramming of Human Fibroblasts with Non-integrating RNA Virus on Feeder-Free or Xeno-Free Conditions Pauline T. Lieu Abstract Recent advances in generating induced pluripotent stem cells have radically advanced the field of regenerative medicine by making possible the production of patient-specific pluripotent stem cells from somatic cells. However, a major obstacle to the use of iPSC for therapeutic applications is the potential genomic modifications resulted from viral insertion of transgenes in the cellular genome. Second, the culture of iPSCs and adult cells often requires the use of animal products, which hinder the generation of clinicalgrade iPSCs. We report here the generation of iPSCs by an RNA Sendai virus vector that does not integrate transgenes into the cell’s genome. In addition, reprogramming can be performed on a feeder-free or xeno-free condition without containing animal products. Generation of an integrant-free iPSCs in these conditions will facilitate the studies of iPSCs in cell-based therapies. Key words Reprogramming, iPSC, RNA virus, Non-integrating, Feeder-free, Xeno-free conditions

1

Introduction Induced pluripotent stem cells (iPSCs) are similar to embryonic stem cells (ESCs) in that they have the unlimited proliferation capacity and differentiation potential in various lineages that raised great interest in both the scientific community and the public in hopes for the future prospects of regenerative medicine. In 2006, Takahashi and Yamanaka [1] successfully demonstrated the conversion of adult somatic cells into ES-like cells via the forced expression of four transcription factors: Oct3/4, Sox2, Klf4, and c-Myc. One of the major obstacles in generating induced pluripotent stem cells for research or downstream applications is the potential modifications of the cellular genome as a result of using integrating viruses during reprogramming [2]. Another major disadvantage of reprogramming cells with integrating vectors is that

Paul J. Verma and Huseyin Sumer (eds.), Cell Reprogramming: Methods and Protocols, Methods in Molecular Biology, vol. 1330, DOI 10.1007/978-1-4939-2848-4_5, © Springer Science+Business Media New York 2015

47

48

Pauline T. Lieu

silencing and activation of transgenes is unpredictable, which may affect terminal differentiation potential and increase the risk of using iPSC-derived cells [3, 4]. To circumvent such risks which are deemed incompatible with therapeutic prospects, significant progress have been made with transgene-free reprogramming methods, such as Sendai virus to achieve conversion of adult cells into iPSCs [5]. A Sendai virus (SeV) vector with reprogramming factors is a powerful tool for generating iPS cells because of the high infection efficiency without the risk of integration into host chromosomes [6, 7]. Sendai virus is a negative-strand RNA virus that belongs to the Paramyxoviridae family [8]. Unlike other RNA viruses, it replicates in the cytoplasm of infected cells and does not go through a DNA phase that can integrate into the host genome [9]. In addition, Sendai virus can infect a broad host range and is nonpathogenic to humans [10]. Recent papers also demonstrated that Sendai virus can reprogram somatic cells with higher efficiency than other reprogramming methods [6, 7]. Thus, the nature of Sendai virus makes it an ideal tool for cell reprogramming and stem cell research. Another obstacle in generating iPSCs for clinical applications is the use of animal-derived products during the culture and the derivation of iPSCs. Exposure of human cells to animal origin products may increase the risk of nonhuman pathogen transmission and immune rejection [11], making them unsuitable for the generation of clinicalgrade iPSCs [2]. Here we demonstrate the derivation of transgenefree iPSCs with Sendai virus vector on a feeder-free condition, in the absence of mitotically inactivated mouse embryonic fibroblasts. In addition, we also demonstrate reprogramming in a xeno-free condition which contains no animal-derived products. Generation of transgene-free iPSCs under these conditions will be important to facilitate downstream applications of iPSC-based therapies.

2 2.1

Materials Cells and Vectors

1. CytoTune®-iPS Reprogramming Kit, containing the four reprogramming virus particles with Oct3/4, Sox 2, Klf4, and cMyc (Life Technologies). 2. Human neonatal foreskin fibroblast cells (strain BJ; ATCC no. CRL2522) as a positive reprogramming control (optional). 3. Inactivated human feeders (NuFF, Global Stem; Cat# GSC-3001G).

2.2 Media Components and Reagents

All Reagents are from Life Technologies unless otherwise specified. 1. StemPro® hESC SFM. 2. Recombinant human basic FGF.

Reprogramming of Human Fibroblasts with Non-integrating…

49

3. hESC-Qualified GelTrex™. 4. Nonessential Amino Acids (NEAA). 5. KnockOut™-DMEM/F-12. 6. KnockOut™-SR XenoFree CTS™. 7. KnockOut™ SR Xenofree Growth Factor Cocktail. 8. β-mercaptoethanol. 9. StemPro® EZPassage™ Disposable Stem Cell Passaging Tool. 10. StemPro® MSC SFM Xeno-free medium. 11. GlutaMAX™-I CTS™ supplement. 12. TrypLE Select. 13. Anti-SeV (anti-Sendai Virus antibodies) (MBL, Cat#PD029). 2.2.1 Preparation of Medium

To prepare complete medium, aseptically mix the components listed in the table below. 1. StemPro®MSC SFM Xeno-free medium. StemPro® MSC SFM basal medium ®

500 mL

StemPro MSC SFM Xeno-free supplement

5 mL

GlutaMAX™-I CTS™ supplement

5 mL

Optional gentamicin (50 mg/mL)

50 μL

2. Feeder-free iPSC medium—StemPro® hESC SFM D-MEM with GlutaMAX™-I 1× ®

90.8 mL

StemPro HESC SFM Growth 50× Supplement

2 mL

BSA 25 %

7.2 mL

β-Mercaptoethanol 55 mM

182 μL

10 μg/mL human basic FGF

80 μL

3. Xeno-free iPSC medium KnockOut™-DMEM/F-12

83.0 mL

KnockOut™-SR XenoFree CTS™

15.0 mL

GlutaMAX™

1.0 mL

KnockOut™ SR Xenofree Growth Factor Cocktail 1.0 mL β-Mercaptoethanol 55 mM a

Basic human FGF 100 μg/mL a

182 μL 20 μL

Prepare the iPSC medium without bFGF, and then supplement with fresh bFGF when the medium is used.

50

3

Pauline T. Lieu

Methods

3.1 Preparation of Coated Dishes

Geltrex™ matrix-coated dishes to be used with StemPro® hESC SFM. 1. Geltrex™ matrix gels rapidly at temperatures above 2–8 °C. When working with Geltrex™ matrix, keep solutions on ice at all times. 2. Thaw one tube of Geltrex™ matrix (1 mL) slowly at 2–8 °C and dilute it 1:100 in 99 mL of D-MEM with GlutaMAX™-I. Mix the solution gently. 3. Cover the whole surface of each culture dish with the Geltrex™ matrix solution (e.g., 1.5 mL for a 35-mm dish, 3 mL for a 60-mm dish, 9 mL for a 100-mm dish). 4. Incubate the coated dishes for 1 h at 37 °C. At this point you may store the Geltrex™ matrix-coated culture dishes at 2–8 °C for up to 1 month. Seal each dish with Parafilm® sealing film to prevent the Geltrex™ matrix from drying out. 5. If plates have been stored at 2–8 °C, transfer the Geltrex™ matrix-coated dishes to a laminar flow hood and allow them to equilibrate to room temperature (about 1 h) prior to using. Aspirate Geltrex™ solution immediately prior to use (do not allow plates to dry out).

3.2 Transduction Human Fibroblasts with CytoTune®-iPS Reprogramming Kit

1. Two days before transduction, plate human fibroblast cells onto two 6-well Geltrex matrix-coated dishes at the appropriate density of 100,000 cells per well in human fibroblast medium (or StemPro ® MSC SFM Xeno-free medium) ( see Note 1 ). 2. Culture the cells for 2 more days, ensuring that the cells have fully adhered and are healthy (see Note 2). 3. On the day of transduction, determine the total cell number on one of the 6-well plates. Add 0.5 mL of TrypLE™ Select reagent to treat one well of the 6-well plates. When the cells have rounded up (1–3 min later), add 2 mL of fibroblast medium into each well, and count cells using the desired method. 4. Add the Sendai virus, OCT3/4, SOX2, KLF4, and c-MYC, to 1 mL of the human fibroblast medium (StemPro® MSC SFM Xeno-free medium), at the MOI of three based on the cell count (see Note 3). 5. Aspirate the virus fibroblast medium from the other well of the 6-well plate, and add the virus solution. Place the cells in a 37 °C, 5 % CO2 incubator and incubate for 24 h. 6. 24 h after transduction, remove the virus and replace with the fresh human fibroblast medium (or StemPro® MSC SFM Xeno-free medium).

Reprogramming of Human Fibroblasts with Non-integrating…

51

7. Remove medium and replenish with fresh human fibroblast medium or StemPro® MSC SFM Xeno-free medium every day thereafter for the next 7 days (see Note 4). Replate transduced cells onto feeder-free or xeno-free condition. 8. For feeder-free condition, 6 days after transduction, prepare 10 cm Geltrex™ matrix-coated dishes (see Note 5). 9. For xeno-free condition, 6 days after transduction, plate 2 × 105 of inactivated human feeders (NuFF) onto a 10 cm tissue culture dishes in StemPro® MSC SFM Xeno-free medium. 10. Seven days post-transduction, the fibroblast cells are ready to be harvested and replated onto Geltrex™ matrix-coated dishes or xeno-free condition. Remove the medium from the fibroblasts and wash cells once with D-PBS (without Ca2+ and Mg2+) (see Note 6). 11. To harvest the cells from the 6-well plate, use 0.5 mL of TrypLE™ Select reagent for 3–4 min or until the cells have rounded up. Add 2 mL of fibroblasts medium (or StemPro® MSC SFM Xeno-free medium) into each well and collect the cells in 15-mL conical centrifuge tube (see Note 7). 12. Centrifuge the cells at 200 × g for 4 min, aspirate the medium, and resuspend the cells in 2 mL of human fibroblast medium or StemPro® MSC SFM Xeno-free medium. 13. Count the cells using the desired method and seed approximately 500,000 cells onto each 10 cm plate of Geltrex™ matrix-coated dishes or on inactivated human feeders and xeno-free condition (see Note 8). 14. On the following day, change the medium and culture cells in the appropriate medium (feeder free with Feeder Free iPSC Medium —StemPro® hESC SFM or Xeno-free iPSC Medium). Replace the spent medium every day thereafter (see Note 9). 15. Observe the plates every other day under the microscope for the emergence of cell clumps indicative of transformed cells. 16. Three to four weeks after transduction, colonies should have grown to an appropriate size for transfer (see Note 10). See Fig. 1 for feeder-free conditions. 17. When colonies are ready to transfer, perform live staining using Tra 1-60 or Tra 1-81 for selecting reprogrammed colonies (see Note 11). See Fig. 2 for xeno-free conditions. 18. Colonies can be transferred directly onto Geltrex™ matrixcoated dishes or on inactivated human feeders and culture in appropriate medium condition. 19. We recommend performing single-colony passaging for the first few passages (minimum 5) to obtain virus-free clones (see Note 12).

52

Pauline T. Lieu

Fig. 1 Generation of iPSC on feeder-free condition. BJ fibroblasts were transduced with Sendai virus overnight and incubated in standard fibroblast media for 7 days. Seven days post-transduction, cells were transferred to feeder-free condition. Colonies were stained with Tra1-60 antibody on the 28th day post-transduction

Fig. 2 Generation of iPSCs on xeno-free condition. BJ fibroblasts were transduced with Sendai virus overnight and incubated in standard fibroblast media for 7 days. Seven days post-transduction, cells were transferred to xeno-free conditions. Colonies were stained with Tra1-81 antibody on the 28th day post-transduction

4

Notes 1. Maintain human fibroblasts in defined or xeno-free fibroblast medium of your choice. In our experiment, we culture human fibroblasts in StemPro®MSC SFM Xeno-free medium. 2. Cells to be used for reprogramming should be less than 5 passages and proliferating at normal rate. 3. We do not recommend to refreeze-thaw the virus since the titers will not maintain upon thawed.

Reprogramming of Human Fibroblasts with Non-integrating…

53

4. For certain cell types, you may observe high cytotoxicity (can be greater than 50 %) after viral transduction. Continue to culture cells and allow them to recover before transferring to feeders or feeder free condition. 5. If plates have been stored at 2–8 °C, transfer the Geltrex™ matrix coated dishes to a laminar flow hood and allow them to equilibrate to room temperature (about 1 h) prior to using. Aspirate Geltrex™ solution immediately prior to use (do not allow the plates to dry out). 6. Depending on the growth of your cell type, you may observe high cell density before day 5. We do not recommend passaging your cells until 7 days post-transduction. 7. Cells are very sensitive and fragile at this point. We recommend working quickly and minimize trypsin exposure time. 8. Culture cells in StemPro®MSC SFM Xeno-free medium following the transfer of cells. 9. For Geltrex™ matrix coated dishes, culture cells with 10 mL StemPro® hESC SFM. For xeno-free conditions, culture cells with Xeno-free iPSC Medium. 10. Depending on your cell type, you may observe colony formation between days 12 and 15. However, some may require a longer culture up to 4 weeks before seeing colonies. 11. If you do not obtain iPS colony in a culture dish after 4 weeks, you may need to increase the MOI of the virus to two- to threefold from the starting MOI. Normally, we observe drastic morphology change after 3–4 days post-transduction which indicates good uptake of the virus. 12. To obtain a virus free clone, clones can be immunostained with anti-SeV antibodies to determine the presence of the Sendai virus. In addition, RNA can be extracted from each clone and perform RT-PCR with Sendai virus primers [7] to detect virusfree clone.

Acknowledgments This work was supported by Life Technologies Corporation. References 1. Takahashi K, Yamanaka S (2006) Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126:663–676

2. Ahrlund-Richter L, De Luca M, Marshak DR, Munsie M, Veiga A et al (2009) Isolation and production of cells suitable for human therapy: challenges ahead. Cell Stem Cell 4:20–26

54

Pauline T. Lieu

3. Muller LU, Daley GQ, Williams DA (2009) Upping the ante: recent advances in direct reprogramming. Mol Ther 17:947–953 4. Okita K, Matsumura Y, Sato Y, Okada A, Morizane A et al (2011) A more efficient method to generate integration-free human iPS cells. Nat Methods 8:409–412 5. Fusaki N, Ban H, Nishiyama A, Saeki K, Hasegawa M (2009) Efficient induction of transgene-free human pluripotent stem cells using a vector based on Sendai virus, an RNA virus that does not integrate into the host genome. Proc Jpn Acad Ser B Phys Biol Sci 85:348–362 6. Ban H, Nishishita N, Fusaki N, Tabata T, Saeki K et al (2011) Efficient generation of transgenefree human induced pluripotent stem cells (iPSCs) by temperature-sensitive Sendai virus vectors. Proc Natl Acad Sci U S A 108(34): 14234–14239 7. Macarthur CC, Fontes A, Ravinder N, Kuninger D, Kaur J, Bailey M, Taliana A, Vemuri MC, Lieu PT (2012) Generation of

8.

9.

10.

11.

human-induced pluripotent stem cells by a nonintegrating RNA Sendai virus vector in feeder-free or xeno-free conditions. Stem Cells Int 2012:564612 Li HO, Zhu YF, Asakawa M, Kuma H, Hirata T et al (2000) A cytoplasmic RNA vector derived from nontransmissible Sendai virus with efficient gene transfer and expression. J Virol 74:6564–6569 Masaki I, Yonemitsu Y, Komori K, Ueno H, Nakashima Y et al (2001) Recombinant Sendai virus-mediated gene transfer to vasculature: a new class of efficient gene transfer vector to the vascular system. FASEB J 15:1294–1296 Ferrari S, Griesenback U, Iida A et al (2007) Sendai virus-mediated CFTR gene transfer to the airway epithelium. Gene Ther 14(19): 1371–1379 Martin MJ, Muotri A, Gage F, Varki A (2005) Human embryonic stem cells express an immunogenic nonhuman sialic acid. Nat Med 11:228–232

Part III Livestock, Domestic and Endangered Species

Chapter 6 Inducing Pluripotency in Cattle Luis F. Malaver-Ortega, Amir Taheri-Ghahfarokhi, and Huseyin Sumer Abstract Nuclear reprogramming technologies in general and induced pluripotent stem cells (iPSCs) in particular have opened the door to a vast number of practical applications in regenerative medicine and biotechnology. It also represents a possible alternative to the still evasive achievement of embryonic stem cells (ESCs) isolation from refractory species such as Bos. taurus. Herein, we described a protocol for bovine iPSCs (biPSCs) generation and characterization. The protocol is based on the overexpression of the exogenous transcription factors NANOG, OCT4, SOX2, KLF4 and c-MYC, using a pantropic retroviral system. Key words Bos. taurus, Bovine, Nuclear reprogramming, Pluripotency, Stem cells, iPSCs, Retrovirus, Transduction

1

Introduction Since the ground-breaking achievement of Professor Shunji Yamanaka in 2006 [1, 2], there was an explosion in publications exploring all the possible applications of his novel approach to induce pluripotency. His remarkable contribution demonstrates, with elegant simplicity, how malleable the cellular commitment to a specific lineage is and how it is possible to reverse those processes leading cells to an undifferentiated stage. His work not only has implications for regenerative medicine; it also opens new avenues to explore in fields such as the animal production industry. Soon after the generation of the first embryonic stem cell line in mouse, numerous groups around the world have tried to isolate the bovine equivalent [3]. However, so far truly cell lines have been an elusive goal. It explains the importance of these new approaches to obtain pluripotent stem cells (PSCs) from difficult species such as Bos Taurus. Nevertheless, it is important to take into account that there are subtle differences on the reprogramming process among species [3]. For example NANOG and Lin28, although dispensable in other species, are critical for bovine reprogramming [4, 5]. In this chapter, we outline a routine protocol to be followed in the

Paul J. Verma and Huseyin Sumer (eds.), Cell Reprogramming: Methods and Protocols, Methods in Molecular Biology, vol. 1330, DOI 10.1007/978-1-4939-2848-4_6, © Springer Science+Business Media New York 2015

57

58

Luis F. Malaver-Ortega et al.

production and initial characterization of putative biPSCs. Further characterization (e.g. chimera formation, germ cell lineage contribution) is let to the researcher discretion as it is time-consuming, due the lifespan and particularities of the species, not to mention highly expensive compared with the mouse counterpart.

2

Materials

2.1 Isolation and Culture of Bovine Adult Fibroblast (bAF) and Bovine-Induced Pluripotent Stem Cells (biPSCs)

1. Basic media (BM); Dulbecco’s Modified Eagle Medium (DMEM) (Invitrogen™) and 10 % Foetal Bovine Serum (JRH Bioproducts) enriched with 2 mM GlutaMAX™, 10 μM NonEssential Amino Acids (NEAA) (Gibco®), and PenicillinStreptomycin (25 units and 25 μg respectively; Invitrogen™) (see Note 1). 2. biPSCs media (iPSM); Minimum Essential Medium Alpha (MEM-α) with L-glutamine ribonucleosides and deoxyribonucleosides, 20 % Fetal Calf Serum (FCS) (JRH™ Bioproducts), 2 mM GlutaMAX™, 10 μM Non-Essential Amino Acids (NEAA) (Gibco™), 5 ng/ml Human recombinant leukaemia inhibitor factor (LIF) (Sigma™), 10 ng/ml recombinant human Basic Fibroblast Growth Factor (bFGF) (Invitrogen™), 55 μM 2-Mercaptoethanol, and Penicillin-Streptomycin (25 units and 25 μg, respectively; Invitrogen™) (see Note 2). 3. Mitotically inactivated murine fibroblasts (feeders) are plated at a density of 2.5 × 104 cells per cm2. 4. Gelatine solution for coated dishes consists in gelatine 0.1 % in DPBS without calcium or magnesium. Place enough solution to cover the surface, and incubate for at least one hour before plate feeders. 5. The most convenient dish format for the initial manual passages is the 60 mm × 15 mm Organ Culture Dish (BD Falcon™ 353037). Once enzymatic passaging is established the format could be chosen according to the planned experiment.

2.2 Retroviral System

Safety statement: This protocol involves the generation of viral vectors. It is necessary to consult and follow the local and institutional guidelines applicable to the use of recombinant viruses and animal experimentation. 1. GP2-293 packaging cell line (Clontech), alternatively the Retro-X™ Universal Packaging System which includes the packaging cell lines and four viral envelope expression vectors including p-VSV-G. 2. pMX-based plasmid encoding human genes and VSV-G protein (Addgene); pMXs-hOCT4 (ID 17964), pMXs-hSOX2 (ID 17965), pMXs-hcMYC (ID 17966), pMXs-hKLF4

Inducing Pluripotency in Cattle

59

(ID 17967), pMXs-hNANOG (ID 18115), pCMV-VSV-G (ID 8454). The pMX-GFP (Cell Biolabs, Inc. RTV-050) is used as a control for transfection. 3. Millex® Syringe Filter Units, Sterile, 33 mm, 0.45 μm, PVDF (Merk, Millipore) sterilized. 4. FuGENE® HD Transfection Reagent (Promega). 5. Polybrene stock solution at 80 mg/ml (in water), working solution is diluted 1/10. 6. Opti-MEM® media (Gibco®). 7. 100 mm TC-Treated Culture Dish. 2.3

Characterization

1. Primary antibodies are: anti-SSEA-1 (MC 480, Millipore), anti-SEEA-3 (MAB4303 Millipore), anti-SSEA-4 (MC-81370, Millipore), anti-Tra-1-60 (MBA4360, Millipore), antiTra-1-60 (MBA4381, Millipore), anti-Oct4 (N-19, Santa Cruz), anti-Oct4 (C-10, Santa Cruz), and anti-Nanog (Abcam ab80892). 2. Secondary antibodies are: goat anti-mouse IgM AlexaFluor-488, goat anti-rabbit IgG Alexa-Fluor-594, and goat anti-mouse IgG Alexa-Fluor-594. 3. Washing media consist in 1 % BSA fraction V in DPBS containing calcium and magnesium. 4. Blocking buffer A consists of 5 % goat serum and 1 % BSA in DPBS. 5. Blocking buffer B consists of 0.1 % Triton X-100, 5 % goat serum, and 1 % BSA in DPBS. 6. Alkaline phosphatase activity is determined using an Alkaline Phosphatase Detection Kit (Millipore®, SCR004) following the manufacturer’s instructions. 7. RNA isolation is performed using: QIAshredder™ (Qiagen: 79654), RNeasy® Mini kit (Qiagen 74106), and Turbo DNA free™ Kit (Ambion AB; AM1906) following the manufacturer’s instructions. 8. First-strand synthesis is done using a SuperScript™ III System (Invitrogen: 18080-051). 9. Standard PCR reactions are performed using a GoTaq® Green Master Mix (Promega) (reaction volume 25 μl) using between 20 and 250 ng of cDNA as a template. Primers were of PCR/ Sequencing grade. A comprehensive list of primer sequences is given in Table 1. 10. 100 % Ice-cold ethanol. 11. 8–10-Weeks-old female severe combined immunodeficient (SCID) mice.

60

Luis F. Malaver-Ortega et al.

Table 1 Primer list (Sumer et al. [5]) Primer

Sequence

Product size

pMx hOCT4 forward pMx hOCT4 reverse

CTAGTTAATTAAGAATCCCAGTG CACTAGCCCCACTCCAACCT

300

pMx hSOX2 forward pMx hSOX2 reverse

CTAGTTAATTAAGGATCCCAGG TGTTGTGCATCTTGGGGTTCT

300

pMx hKLF4 forward pMx hKLF4 reverse

ACAAAGAGTTCCCATCTCAAGGTG TCCAAGCTAGCTTGCCAAACCTACAGG

250

pMx hc-MYC forward pMx hc-MYC reverse

CTAGTTAATTAAGGATCCCAGTG CAGCAGCTCGAATTTCTTCC

500

pMX-hNanog forward pMX-hNanog reverse

CTAGTTAATTAAGAATCCCAGTG GGGTAGGTAGGTGCTGAGGC

550

SOX2 forward SOX2 reverse

CATCCACAGCAAATGACAGC TTTCTGCAAAGCTCCTACCG

251

POU5F1 forward POU5F1 reverse

GTTCTCTTTGGAAAGGTGTTC ACACTCGGACCACGTCTTTC

313

NANOG forward NANOG reverse

GTGTTTGGTGAACTCTCCTG GGGAATTGAAATACTTGACAG

308

KLF4 forward KLF4 reverse

GCCCCTAGAGGCCCACTT CACAACCATCCCAGTCACAG

455

c-MYC forward c-MYC reverse

CGCGGTCGCCTCCTTCTCGCCCAGG GTCCGGGGAAGCGCAGGGC

412

Alkaline phosphatase forward Alkaline phosphatase reverse

TTCAAACCGAAACACAAGCAC GGTAAAGACGTGGGAGTGGTC

378

α-feto-protein forward α-feto-protein reverse

AAGGCACCCTGTCCTGTATG AGACACTCCAGCACGTTTCC

330

Somatostatin forward Somatostatin reverse

CCTGGAGCCTGAAGATTTGTC GTGAGAAGGGGTTTGGAGAAG

213

Albumin forward Albumin reverse

ACCAGGAAAGTACCCCAAGTG GTTTCAACAGCTCAACAAGTGC

370

Nestin forward Nestin reverse

CACCTCAAGATGTCCCTCAGC TCTTCAGAAAGGTTGGCACAG

253

Vimentin forward Vimentin reverse

GATGTTTCCAAGCCTGACCTC GGCGTTCCAGAGACTCGTTAG

253

β-3-tubulin forward β-3-tubulin reverse

CATCCAGAGCAAGAACAGCAG GATTCCTCCTCATCGTCTTCG

336

Zeta globin forward Zeta globin reverse

TCAAGTTCCTGTCCCATTGC CATTCTCTCCCGTCACTCTCC

293 (continued)

Inducing Pluripotency in Cattle

61

Table 1 (continued) Primer

Sequence

Product size

BMP4 forward BMP4 reverse

TCGTTACCTCAAGGGAGTGG GGCTTTGGGGATACTGGAAT

345

Uncoupling protein 2 forward Uncoupling protein 2 reverse

CCGACAGAACTGCCTATACCC TTGAACCCAACCATAATGACG

311

REX1 forward REX1 reverse

GCAGAATGTGGGAAAGCCT GACTGAATAAACTTCTTGC

220

β-actin forward β-actin reverse

GGAATCCTGTGGCATCCATGAAAC AAAACGCAGCTCAGTAACAGTCCG

220

All primers are to be used with an annealing temperature of 58 °C. Product sizes are given in p.b.

3 3.1

Methods bAF Isolation

1. Wash the samples from punched ears three times with PBS (see Note 3). Under microscope, carefully dissect the connective tissue between the epithelia and the cartilage. 2. Place small pieces of tissue (around three per well) in a six-well plate and let the tissue dry at room temperature for 5 min. 3. Once the tissue adhered to the plastic, carefully place BM without disrupting the explant. Culture at 39 °C, 5 % CO2 in air. Change media at day 1 and then twice per week until adherence cell grown from the tissue becomes apparent. 4. Once the adherent fibroblasts reach confluence, harvest the cells with TrypLE™ Express (Invitrogen), expand the cells for no more than three passages and cryopreserve following the standard procedure of the laboratory.

3.2 Viral Production and Transfection

The protocol is described assuming day zero as the first day of infection. This gives you an idea of the time for reprogramming and make easy to have prepared the material necessary for picking up and expansion of the colonies. 1. (Day-4) Culture overnight 3.5 × 106 GP2293 cells in 100 mm cell culture dishes with AFB media. 2. (Day-3) Replace the media of GP2293 cells with 11 ml of BAF fresh media. 3. Prepare six 1.5 ml eppendorf tubes containing 300 μl of OPTIMEM media at room temperature. Add 54 μl of FuGENE® HD Transfection Reagent without touching the walls of the tube and mix by tip tapping and incubate for 5 min.

62

Luis F. Malaver-Ortega et al.

4. Add 9 μl of the corresponding DNA (one for each factor plus one for GFP) plus 9 μl of pCMV-VSV-G mix and incubate for 20 min. 5. After incubation add drop-wise the transfection mix into the GP2293 cells all over the plate. Rock the plate gently to mix transfection mix with the media and return the cells back to the incubator. 6. Incubate the cells with the reagent overnight. 7. (Day-2) Replace the media for the GP2293 cells with fresh media. 8. (Day-1) Culture 1 BAF 105× cells in a 100 mm cell culture dishes with AFB media. 9. (Day 0) Collect the media from the packaging cells, mix the media (10 ml approx. form each factor) in a 50 ml tube. 10. Filter the media containing the viral vector through a Millex® Syringe Filter and collect the media in a new tube. 11. Mix the filtered solution (50 ml total) with 50 μl of Polybrene working solution. 12. Transfer the solution to the plate. 25 ml can be dispensed easily so there is enough media for duplicates. 13. Collect media from the packaging cells transfected with the pMX-GFP vector and filter through a Millex® Syringe Filter. Collect the media in a new tube. 14. Mix the filtered solution (10 ml total) with 40 ml of fresh media and 50 μl of Polybrene working solution. 15. Transfer the solution to the plate. 25 ml can be dispensed easily so there is enough media for duplicates. 16. (Day 1) Repeat steps 9–15. 17. (Day 2) Change media of the cells transfected with the five factor cocktail and replace with biPSc media. 18. Detach the transfected fibroblasts with pMX-GFP and analyse by FACS. A percentage at least of 90 % is expected. Calculate the transfection efficiency (see Note 4). 19. Change media every second day. Do not discard any plate as negative before at least 30 days. 3.3 Colony Isolation, Passaging, and Cryopreservation

1. The first colonies appear after roughly 20 days post-infection (see Note 5). However, check periodically (at least three times a week) for any changes in morphology suggestive of reprogramming. Times could vary according to the levels of expression of the transgenes. 2. Once you have identified candidate outgrowths (Fig. 1a, b), remove media and replace with fresh one.

Inducing Pluripotency in Cattle

63

3. Cut the colony using the sharp edge of the insulin syringe. Cut across the colony to make small pieces and make as many as possible according to the area of the colony. Carefully, collect the pieces using a 1 ml tip avoiding the pieces from the edges of the colony. 4. Transfer the pieces into a feeder plate, each colony correspond to a presumably unique clone. 5. Culture at 39 °C, 5 % CO2 in air. Change media the day after and then, every second day. 6. Once the new colonies reach a size equivalent to the original colony or before they become confluent, expand into three new plates manually following steps 3, 4, and 5. Two of the plates can be used for RT-PCR analysis, karyotyping EB formation, etc. Maintain manual passaging for at least the first five to ten passages. From passage 10 you can start enzymatic passaging in parallel (see Note 6). 7. For enzymatic passaging, remove the media and wash the plate once with PBS, add 0.5 ml of Dispase per well in a six-well plate. Incubate for 5 min at 37 °C. 8. Stop the reaction with 0.5 ml of fresh media. 9. Collect the cells and spin down at 400 × g for 3 min. Remove the supernatant very carefully. Resuspend in an adequate amount of media and split in a ratio of 1:5 into new feeder dishes (see Note 7). 3.4 Embryo Bodies (EBs) and RT-PCR

1. Culture 5 × 106 million biPSCs on feeders. This corresponds roughly to five sub-confluent wells from a six-well plate. 2. Detach the cells enzymatically (see Subheading 3.3) and adjusted them to 5 × 105 cells/ml in biPSc media without LIF or bFGF. 3. Culture 2 ml per well of the cell suspension in low attachment six-well plates for 2 days. 4. At day 2, transfer the EB formed and transfer to new plates and culture for another 10 days with media change twice a week. 5. At day 10, collect the EB and extract the RNA accordingly to Subheading 2.3.

3.5

Immunostaining

1. Culture the putative biPSCs in four-chamber glass slides (BD®) on feeder layers, for at least 4 days. 2. At day 5, remove media and wash the chamber slides with washing buffer: for 5 min three times. Fix with 100 % ice-cold ethanol for 10 min. 3. Wash again with washing buffer for 5 min three times.

Fig. 1 Simplified protocol overview. (a) The reprogramming process starts at day zero (After viral transfection). Characterization starts at passage 10, the circle in the bar denotes the visualization of the first recognizable colonies. Morphology of the colonies: Colonies at initial passages (b and c). Colony expanded manually at early passage (d and e). Colony expanded enzymatically at late passage (f and g)

Inducing Pluripotency in Cattle

65

4. For surface antigens, block with blocking buffer A for 30 min. For nuclear antigens, use blocking buffer B. 5. Dilute the primary antibody 1/40 in the corresponding blocking solution and incubate overnight at 4 °C. 6. After incubation, wash with washing buffer for 10 min three times. 7. Incubate with secondary antibody diluted at 1:100 for 1 h in dark; covered with foil. After incubation, add a nuclear stain (DAPI/Hoechst) for 3 min; wash away three times with washing buffer and visualized under microscope. 3.6 Teratoma Formation

1. Culture 5 × 106 million biPSCs on feeders. This corresponds roughly to five sub-confluent wells from a six-well plate. 2. Wash the cells once with DPBS 1× without calcium or magnesium and detach the cells using TrypLE™. Spin down and resuspend in 50 μl of the same buffer. 3. Keep the cells at 4 °C for no more of 1 h. 4. Inject the 50 μl entirely intramuscularly into the thigh muscle of the rear leg of 8–10-weeks-old female severe combined immunodeficient (SCID) mice. 5. After 8 weeks or 2 cm large, sacrifice the mice following the corresponding guidelines from the institution and recover the teratomas. 6. Wash the teratomas once with DPBS (Gibco) without magnesium or calcium and fixed in Histochoice® (Amresco). 7. Embed in paraffin and section. At least four slides need to be prepared from each block, each section with a thickness of 5 and 60 μm apart from each other. Stain slides with H&E, identify structures under microscope.

4

Notes 1. Use all media only after sterilization through a 0.22 μm filter. Store at 4 °C for less than 2 weeks. Warm working aliquots at 37 °C prior to use. 2. Selection of the FCS is critical for culture of pluripotent stem cells. We recommend use a BFS proved to sustain mouse iPSCs or ESCs when generating biPSCs for the first time. They should be assessed by morphology, immunostaining of pluripotent markers in established cell lines. The requirement of either LIF or bFGF is related to the two stages naïve or primed on ESCs. For practical purposes both factors are included in the initial media. Specific requirements for the cell lineage can

66

Luis F. Malaver-Ortega et al.

be assessed in further characterisation based on levels of expression of genes such as REX1 or the triumvirate: OCT4, NANOG, and SOX2. 3. Alternatively, bovine embryonic fibroblast can be used. However, bAF is a more practical source of target cells. Isolation of the cells usually takes only 2 weeks. However, there is high variability between individuals and factors such as the age, gender, and breed could also affect the grow rate. For transductions, cells are plated at a low cellular density in order to avoid rolling over due to the long culture time without passaging. Usually fibroblasts isolated from ear punch are highly proliferative but if it has been decided to use a slower growing source of fibroblast higher densities could be evaluated to get a higher number of colonies. 4. Transfection efficiency (TE) refers to the estimate percentage of cells receiving all reprogramming factors and it is calculated using the formula: TE% = % ´ f n -1 where % is the percentage of GFP-positive cells, f is that percentage expressed as a fraction, and n is the number of transcription factor utilized during reprogramming, in this case five factors. This is not to be confused with the reprogramming efficiency (RE) calculated by the formula: RE% =

biPSCs colonies ´ 100 initial cells ´ TE

where TE is expressed as a fraction and not as percentage. 5. This is the most critical step during biPSCs production. Morphology varies considerably among true colonies especially during the first passages. This could be due to variability on the levels of expression for the transgenes or intermediatetransient reprogramming for some colonies. It is a good practice to pick up as many colonies as possible to identify and cryopreserve a number while expanding and characterizing an initial few. 6. We recommend expanding the initial colonies manually during at least the first passages (five to ten passages). From passage 10 it is possible to try enzymatic passaging in parallel with manual passaging. It is also important to crypopreserve colonies in each passage. It is common to see differentiation during the first passages due to transient or incomplete reprogramming (Table 2).

Inducing Pluripotency in Cattle

67

Table 2 Expected results and troubleshooting Parameter

Expected result

Comments

Transfection efficiency (TE)

50% ≤ TE

A 50 % TE assure you with an approximate of 10 colonies per plate. Alternatively you can increase the number of cells transfected to get higher number of colonies

Reprogramming efficiency (RE)

0.02 % approx

High viral titters are fundamental to assure reprogramming. Increase the number of viral particles by adding more GP2293 conditioned media to improve lower RE

Immunostaining and gene expression

Positive for SSEA-1, SSEA-4, Some endogenous factors can appear after several passages Tra1/60, NANOG and OCT4 endogenous expression of OCT4 NANOG SOX2 and REX1

In vitro differentiation

Positive for markers from the As an alternative to RT-PCR expression, EBs can three germ cell layers be plated down and used for immunostaining

In vivo differentiation

Differentiation toward tissues In our hands biPSCs differentiate mainly toward adipose-like cells, muscle cells, immature representative of the three cartilage corresponding to Mesoderm Epitheliagerm layers like cells corresponding to Endoderm and neuro-rosettes from the Endoderm

7. Cell pellets resulting after enzymatic detaching of biPSCs are quite sticky. Be aware to not disrupt the pellet after spinning down the cells and while removing the media. Also it is important to resuspend the cells.

Acknowledgement Luis Fernando Malaver-Ortega was the recipient of an Australian Postgraduate Award (APA) and was supported by a DAIRY FUTURES CRC scholarship. The Victorian Government’s Operational Infrastructure Support Program also supported this research.

68

Luis F. Malaver-Ortega et al.

References 1. Takahashi K, Yamanaka S (2006) Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126:663–676 2. Takahashi K, Okita K, Nakagawa M, Yamanaka S (2007) Induction of pluripotent stem cells from fibroblast cultures. Nat Protoc 2:3081–3089 3. Malaver-Ortega LF, Sumer H, Liu J, Verma PJ (2012) The state of the art for pluripotent stem cells derivation in domestic ungulates. Theriogenology 78:1749–1762

4. Han X, Han J, Ding F, Cao S, Lim SS, Dai Y, Zhang R, Zhang Y, Lim B, Li N (2011) Generation of induced pluripotent stem cells from bovine embryonic fibroblast cells. Cell Res 21:1509–1512 5. Sumer H, Liu J, Malaver-Ortega LF, Lim ML, Khodadadi K, Verma PJ (2011) NANOG is a key factor for induction of pluripotency in bovine adult fibroblasts. J Anim Sci 89:2708–2716

Chapter 7 Generation of Induced Pluripotent Stem Cells (iPSCs) from Adult Canine Fibroblasts Sehwon Koh and Jorge A. Piedrahita Abstract Induced pluripotent stem cells hold great potential in regenerative medicine as it enables to generate pluripotent stem cells from any available cell types. Ectopic expression of four transcription factors (Oct4, Sox2, Klf4, and c-Myc) can reprogram fibroblasts directly to pluripotency as shown in multiple species. Here, we describe detailed protocols for generation of iPSCs from adult canine fibroblasts. Robust canine iPSCs will provide powerful tools not only to study human diseases, but also for the development of therapeutic approaches. Key words Induced pluripotent stem cells, iPS cells, Canine

1

Introduction Pluripotent stem cells such as embryonic stem cells (ESCs) and iPSCs can give rise to derivatives of all three germ layers and thus have great potential for clinical applications related to regenerative medicine [1]. In 2006, it was first shown that ectopic expression of four transcription factors, Oct4, Klf4, Sox2, and c-Myc (OKSM), could reprogram murine somatic cells into a pluripotent state. iPSCs have now been generated in mice, humans [2–6], and other species such as rhesus monkey [7], rat [8], pig [9, 10], and horse [11]. In our previous study [12], we reported the derivation of canine-induced pluripotent stem cells using retroviral transduction of the same Yamanaka’s factors (OKSM). We evaluated their ability to differentiate in vitro and in vivo, their co-dependency on both growth factors (FGF2 and LIF), and their karyotypic instability during extended passages. Our results confirmed that ciPSCs require both FGF2 and LIF along with inhibition of MAP2K1 and GSK3B to maintain pluripotency after initial induction. However, as it was the first detailed report of chromosomal instability in ciPSC, we cannot yet determine whether the observed aneuplodies

Paul J. Verma and Huseyin Sumer (eds.), Cell Reprogramming: Methods and Protocols, Methods in Molecular Biology, vol. 1330, DOI 10.1007/978-1-4939-2848-4_7, © Springer Science+Business Media New York 2015

69

70

Sehwon Koh and Jorge A. Piedrahita

are unique to these cell lines and method of induction, or like humans and mice, is a characteristic pattern seen in induced iPSCs from a particular species. Thus, it requires establishment of a welloptimized protocol to generate canine iPSCs to extend our observations and establish novel cellular models. To date, the methodology of generating iPSCs using retroviral transduction of Yamanka’s factors has been well established in humans [13] and mice [3]. Here, we describe further optimized protocol and culture conditions to produce induced pluripotent stem cells from canine adult fibroblasts (Fig. 1). This optimized protocol will

Fig. 1 Overview of procedures to isolate canine-induced pluripotent stem cells described in this protocol. MEFs, Plat-GP, and canine fibroblasts are prepared prior to retroviral production. Fibroblasts are reprogrammed by transduction of retrovirus expressing Oct4, Sox2, Klf4, and c-Myc. Infected fibroblasts are initially incubated with fibroblasts medium and medium is subsequently switched to canine iPSCs induction and expansion medium. MEFs, mouse embryonic fibroblasts; iPSC, induced pluripotent stem cell

Generation of Canine iPSCs

71

provide efficient method to generate canine iPSCs to create a novel approaches in regenerative medicine as well as useful model systems to elucidate unique cellular mechanisms in dogs.

2

Materials

2.1 Retroviral Production and Infection

1. pMXs containing Oct4, Sox2, Klf4, c-Myc, and mRFP1 are available from Addgene (plasmid 13366, 13367, 13370, 13372, and 21315, respectively). pCI-VSV-G (plasmid 1733) is available from Addgene. 2. Platinum-GP (Plat-GP) cells. 3. FuGENE 6 transfection reagent (Promega). 4. Polybrene: Prepare 4 mg/ml (wt/vol, 1,000×) stock in PBS and sterile filter by passing it through a 0.22 μm filter and store at −20 °C.

2.2 Media and Solutions

1. Fibroblasts medium: DMEM (high glucose) containing 10 % FBS (vol/vol), 2 mM L-Glutamine, and 0.1 % Gentamycin (vol/vol). The same medium is used to culture Plat-GP, MEFs, and canine fibroblasts. Filter the medium with a bottle-top 0.22 μm filter and store at 4 °C up to a month. 2. Dog iPSCs induction medium: mTeSR™ 1 complete medium (Stem Cells). 3. Dog iPSCs medium: DMEM/F12 (Cellgro) containing 20 % Knockout Serum Replacement (vol/vol, KSR, Invitrogen), 2 mM L-Alanyl-L-Glutamine, 0.1 mM non-essential amino acids (NEAA), 0.1 mM β-mercaptoethanol (BME), FGF2 (10 ng/ml, Stemgent), hLIF (103 unit/ml, GenScript), PD0325901 (0.5 μM), and CHIR99021 (3 μM). Filter the medium with a bottle-top 0.22 μm filter and store at 4 °C up to 2 weeks (see Note 1). 4. 2× iPS cell-freezing medium: ProFreeze™-CDM (Lonza). To prepare 10 ml of the 2× medium, mix 1.5 ml of DMSO and 8.5 ml of ProFreeze™-CDM. Make fresh for each time. 5. 2× Fibroblasts freezing medium: 20 % DMSO (vol/vol), 40 % FBS (vol/vol), and 40 % fibroblasts medium (vol/vol). Sterile filter with a 0.22-μm filter and store at 4 °C for 2 weeks. 6. Wash solution: PBS containing 1 % antibiotic-antimycotic solution (vol/vol, Invitrogen). 7. 0.1 % gelatin solution: Prepare 0.1 % gelatin solution (wt/vol) in PBS. Sterile filter the solution with 0.22-μm filter and store at 4 °C. 8. 0.25 % Trypsin/EDTA. 9. 0.05 % Trypsin/EDTA.

72

Sehwon Koh and Jorge A. Piedrahita

2.3

Mouse Embryo

1. Day E13.5 embryo. E0.5 is the day detecting a copulation plug (see Note 2).

2.4

Dog Skin Biopsy

1. Dog skin specimen. All biopsy procedure must be described in the IACUC-approved protocol. We routinely take multiple pieces of 1 cm2 skin fragment from abdominal skin from dogs between 1 and 5 years old.

2.5 Tissue Culture Plastic and Other Equipment

1. 75 cm2 (T-75) flasks with vented caps. 2. 100 mm tissue culture dishes. 3. 24-Well, 6-well tissue culture. 4. Gelatin-coated tissue culture plates: Add 0.1 % gelatin solution to cover surface area and incubate at room temperature for 1 h. Remove gelatin solution and wash twice with PBS prior to use. 5. 50 ml syringes. 6. Cell strainer, 70 μm.

3

Methods

3.1 Preparation of Dog Dermal Fibroblasts

1. Obtain a skin biopsy from a dog (see Note 3). 2. Wash skin specimen in wash solution by gently shaking in a 50-ml tube. 3. Place the skin biopsy in wash solution to transport to the laboratory. All subsequent steps are performed in a sterile tissue culture hood. 4. Place the specimen in the 50 ml tube and incubate with 0.25 % trypsin/EDTA for 1–3 h at 37 °C. 5. Place the sample on a 100 mm tissue culture dish and scrape off the epidermis mechanically using forceps and scalpel blades. 6. Wash the dermal tissue in wash solution by gently shaking in a 50 ml tube. 7. Using the scalpel blades and dissecting scissors, mince the dermal tissue into 0.5–1 mm size pieces. 8. Place the dermal pieces in a new 100 mm tissue culture dish with 4 ml dog fibroblasts medium (enough to cover the bottom of the culture dish) and incubate at 37 °C, 5 % CO2. 9. Outgrowth of fibroblasts can be observed in 3–4 days. Replace with 8 ml fresh dog fibroblasts medium every 3–4 days until fibroblasts reach confluent. 10. Upon confluency, add 0.05 % trypsin/EDTA to collect fibroblast in suspension and pass the cell suspension through a 70 μm cell strainer to remove tissue chunks.

Generation of Canine iPSCs

73

11. Passage the fibroblasts at a ratio of 1:3–5 every 4–6 days using 100 mm tissue culture dishes for expansion, or freeze the cells using 2 × 2× fibroblasts freezing medium. 3.2 Preparing MEFs Feeder Cells

1. Sacrifice mice on day 13.5 of pregnancy to obtain E13.5 embryos. Dissect out individual fetus, remove extraembryonic tissues, and wash the fetuses in wash solution to remove blood. 2. Place individual fetus in a 100 mm tissue culture dish containing wash solutions. 3. Decapitate each embryo and remove as much internal organs, brain, and skeletal tissues as possible. 4. Transfer the remainder into a new 100 mm tissue culture dish and finely mince with scalpel blades. Further homogenize the tissue with a 1 ml syringe by aspirating up and down until tissues are completely disaggregated. 5. Transfer the homogenized tissue into 15 ml tube containing 0.05 % trypsin/EDTA and incubate at 37 °C for 30 min. 6. Pass the cell suspension through a 70 μm cell strainer to remove tissue chunks. 7. Centrifuge the cells at 200 × g (1,000 rpm) for 4 min and resuspend the cell pellet in 3 ml MEFs medium. 8. Plate the cells into 100 mm tissue culture dish and passage the fibroblasts at a ratio of 1:6–10 every 5–7 days using 100 mm tissue culture dishes for expansion, or freeze the cells using 2 × 2× fibroblasts freezing medium. 9. For gamma-irradiation, trypsinize the fibroblasts with 0.05 % trypsin/EDTA, centrifuge the cell suspension at 200 × g (1,000 rpm) for 4 min and resuspend the cell pellet with MEFs medium. 10. Bring the tubes containing MEFs to irradiation facility, and expose cells to 4000–5000 rads for mitotic inactivation (see Note 4). 11. Inactivated MEFs can be stored at 4 °C for a week, or alternatively, can be frozen using 2× fibroblasts freezing medium and thawed for subsequent use. We recommend to make and use fresh MEFs for feeders every week.

3.3 Preparing Plat-GP Cell

1. Quickly thaw a frozen vial of Plat-GP cells by immediately putting it into 37 °C water bath until small piece of ice remaining in the vial. 2. Transfer the cell suspension into a 15 ml tube, and gently add pre-warmed Plat-GP medium. 3. Centrifuge the cells at 200 × g (1,000 rpm) for 4 min and resuspend the cell pellet with appropriate amount of Plat-GP medium.

74

Sehwon Koh and Jorge A. Piedrahita

4. Seed 1 × 106 cells per T-75 tissue culture flasks for cell expansion. 5. Passage Plat-GP cells before they reach 80 % confluency. It normally takes 3–4 days to reach 70–80 % confluency. 6. For retroviral production, we recommend to seed 8 × 106 Plat-GP cells per T-75 flask and three T-75 flasks per retrovirus. To produce five retroviruses, 15 × T-75 flasks and 120 × 106 Plat-GP cells are required. 3.4 Retroviral Production

1. Day-3: 1 Day prior to transfection, plate 8 × 106 Plat-GP cells into T-75 flasks with fibroblasts medium and incubate at 37 °C, 5 % CO2 overnight. Cells should be 70–80 % confluent and start dividing. 2. Day-2: For each T-75 flask, make 2 ml of FuGENE master mix by mixing 60 μl of FuGENE6 transfection solution and 1940 μl of serum-free DMEM (see Note 5). 3. Incubate the FuGENE master mix for 5 min at room temperature. 4. Add 12 μg of viral vector (one of the pMXs containing Oct4, Sox2, Klf4, c-Myc, and mRFP1) with 8 μg of envelope vector (pCI-VSV-G) into 2 ml FuGENE master mix. 5. Mix the FuGENE:DNA complex and incubate for 30 min at room temperature. 6. Add the FuGENE:DNA complex drop by drop to the cells (2 ml/T-75 flask). Gently swirl the flasks to ensure the complex is evenly distributed. 7. Incubate at 37 °C, 5 % CO2 for 18–24 h. 8. Day-1: Replace the medium containing transfection reagents with 9 ml of fresh fibroblasts medium. 9. Day 0: Use epifluorescence microscope to confirm mRFP1 expression and record transfection efficiency. We recommend to optimize the transfection protocol to achieve higher than 80 % transfection efficiency (Fig. 2). 10. After 48 h post-transfection, collect medium containing retrovirus and filter through 0.45 μm filter. Feed 9 ml of fresh fibroblasts medium. 11. Retroviruses can be used for immediate infection or frozen stored at −80 °C until use for several months. 12. (Optional) Centrifuge retrovirus containing medium at 70,000 × g at 4 °C for 2 h to pellet retrovirus. Remove supernatant and resuspend the viral pellet with desired amount of serum-free DMEM. 13. Day 1: After 72 h post-transfection, collect medium containing retrovirus and filter through 0.45 μm filter. 14. Repeat steps 11–12.

Generation of Canine iPSCs

75

Fig. 2 Representative pictures demonstrate recommended transfection and infection efficiency. Plat-GP cells are co-transfected with pMX-mRFP1 and pCI-VSV-G to monitor transfection efficiency (top). The produced retrovirus-expressing mRFP1 was used to infect canine fibroblasts in the presence (middle) and absence (bottom) of polybrene. Pictures were taken after 48 h post-transfection (Day 0, top) and 72 h post-infection (Day 3, middle and bottom), respectively

3.5 Retrovirus Infection of Dog Dermal Fibroblasts

1. Day-1: Plate 8 × 105 dog skin fibroblasts in a 100 mm dish with fibroblasts medium and incubate at 37 °C, 5 % CO2 overnight. Cells should be replated when cells have reached 70–80 % confluence. 2. Day 0: (First infection) Mix 3 ml of each Oct4, Sox2, Klf4, and c-Myc retrovirus to make 12 ml total of medium containing retrovirus. 3. Add 4 μg/ml polybrene to the medium with retrovirus (see Note 6). 4. Replace fibroblast medium with retrovirus infection medium and incubate at 37 °C, 5 % CO2 for 18–24 h. 5. (Optional) Infect one additional dish with retrovirus containing mRFP1 following the same procedure as an infection efficiency control.

76

Sehwon Koh and Jorge A. Piedrahita

6. Day 1: (Second infection) Aspirate medium containing retrovirus, wash three times with PBS. Add freshly prepared medium with retrovirus and incubate at 37 °C, 5 % CO2 for 18–24 h. 7. Day 2: Aspirate medium containing retrovirus, wash three times with PBS. Add freshly prepared fibroblasts medium and incubate at 37 °C, 5 % CO2 for 72 h (until Day 5). 8. (Optional) Day 3: Use epifluorescence microscope to confirm mRFP1 expression and record infection efficiency (Fig. 2). 9. Day 4: Plate 8 × 105 gamma-irradiated MEFs per well of gelatinized 6-well plates with fibroblasts medium and incubate at 37 °C, 5 % CO2 overnight. 10. Day 5: Trypsinize and count the infected fibroblasts using hemacytometer. Re-plate 1.3 × 105 infected cells per well of 6-well plate with MEFs using fibroblasts medium. Incubate at 37 °C, 5 % CO2 for 48 h. 11. Day 7: Aspirate fibroblasts medium and replace with freshly prepared iPSC induction medium (2 ml/well). 3.6 Isolation and Expansion of Dog iPSCs

1. Replace 50 % medium everyday with freshly prepared induction medium until ES cell-like colonies appear and are ready to pick. Cells start showing morphological changes around day 12–14 post-infection, and ES-like colonies are ready to pick around day 30–40. 2. A day prior to colony picking, prepare 24-well plates with gamma-MEFs. To prepare the feeder plates, seed 1.3 × 105 gamma-MEFs per well of 24-well plate with fibroblasts medium and incubate at 37 °C, 5 % CO2 overnight. 3. Next day, aspirate fibroblasts medium, wash three times with PBS and replace with 400 μl dog iPSCs medium. Incubate at 37 °C, 5 % CO2 for 4–6 h. 4. Using a 21-gauge needle or a pulled Pasteur pipette, cut each iPSC colonies into 5–10 pieces (20–30 cells per clump) depending on the colony size under the microscope. 5. Transfer pieces from individual colonies into a pre-equilibrated 24-well plate with gamma-MEFs using a 20 μl pipettor. 6. Gently agitate the plate from side to side, backward and forward to ensure the iPSCs are evenly distributed on the MEFs layer. Incubate at 37 °C, 5 % CO2 for 48 h without being disturbed. 7. After cell clumps are adherent, replace the culture medium everyday with 400 μl iPSCs medium until colonies are large enough to be passaged. 8. Mechanically passage single well into a 12-well (or 6-well) plate with freshly prepared gamma-MEFs (see Note 7).

Generation of Canine iPSCs

77

9. Once iPSC lines are derived, they should be fed every day with freshly prepared iPSCs medium. Established dog iPSC lines are routinely passaged in 1:5 every 4 days. 10. Dog iPSCs can be frozen stored using 2 × 2× iPS cell-freezing medium and thawed for subsequent use.

4

Notes 1. bFGF and hLIF are reconstituted with PBS containing 0.1 % BSA to prepare 1,000× (10 μg/ml), and stored frozen at −80 °C. PD (5 mM) and CH (30 mM) are reconstituted with DMSO to prepare as 10,000× stock and stored at −80 °C. To make 500 ml of basal iPSC medium, add 393 ml of DMEM/ F12, 90 ml of KSR, 2.5 ml of L-Alanyl-L-Glutamine, 5 ml of NEAA, 3.6 μl of BME. Make 25 ml aliquots and store at −80 °C until use. Freshly prepare dog iPSCs complete medium by adding 20 μl each of bFGF and hLIF, and 2 μl each of PD and CH before use. 2. Any mouse strain can be used to generate MEFs. We routinely used NIH Swiss as an embryo source. 3. Remove as much hair as possible using a clipper or scalpel blades before taking skin tissue. Clean the skin with the Povidone-Iodine scrub followed by three times 70 % ethanol wash to prevent any bacterial or fungal contamination. 4. We normally scale-up accordingly depending on required number of flasks, and make master mix in a 50 ml tube. Add FuGENE 6 transfection reagent directly into DMEM drop by drop to prevent any contact of undiluted FuGENE 6 with plastic surface other than pipette tips. 5. When access to irradiator is not available, MEFs can be inactivated by mitomycin C treatments, alternatively. Feed MEFs with fibroblasts medium containing 10 μg/ml of mitomycin C, and incubate at 37 °C, 5 % CO2 for 2–3 h to inactivate. 6. Polybrene is used to enhance the efficiency of retroviral infection (Fig. 2). Polybrene is also known to have cytotoxicity and some cells are highly sensitive to polybrene. The concentration of polybrene can be adjusted (1–10 μg/ml) or protamine sulfate can be used as an alternative. 7. Dog iPSCs are very sensitive to enzyme treatments such as collagenase and dispase. Single-cell dissociation using enzymatic methods induces cell death and decreased integrity of iPSC colonies. For replating, mechanically detach iPSC colonies and disaggregate into small clumps (20–30 cells) by pipetting up and down with a P1000 pipettor.

78

Sehwon Koh and Jorge A. Piedrahita

References 1. Wu SM, Hochedlinger K (2011) Harnessing the potential of induced pluripotent stem cells for regenerative medicine. Nat Cell Biol 13:497–505 2. Takahashi K, Yamanaka S (2006) Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126:663–676 3. Takahashi K, Okita K, Nakagawa M et al (2007) Induction of pluripotent stem cells from fibroblast cultures. Nat Protocol 2:3081–3089 4. Okita K, Ichisaka T, Yamanaka S (2007) Generation of germline-competent induced pluripotent stem cells. Nature 448:313–317 5. Wernig M, Meissner A, Foreman R et al (2007) In vitro reprogramming of fibroblasts into a pluripotent ES-cell-like state. Nature 448:318–324 6. Yu J, Vodyanik MA, Smuga-Otto K et al (2007) Induced pluripotent stem cell lines derived from human somatic cells. Science 318: 1917–1920 7. Liu H, Zhu F, Yong J et al (2008) Generation of induced pluripotent stem cells from adult

8.

9.

10.

11.

12.

13.

rhesus monkey fibroblasts. Cell Stem Cell 3:587–590 Liao J, Cui C, Chen S et al (2009) Generation of induced pluripotent stem cell lines from adult rat cells. Cell Stem Cell 4:11–15 Esteban MA, Xu J, Yang J et al (2009) Generation of induced pluripotent stem cell lines from Tibetan miniature pig. J Biol Chem 284:17634–17640 Ezashi T, Telugu BP, Alexenko AP et al (2009) Derivation of induced pluripotent stem cells from pig somatic cells. Proc Natl Acad Sci U S A 106:10993–10998 Nagy K, Sung HK, Zhang P et al (2011) Induced pluripotent stem cell lines derived from equine fibroblasts. Stem Cell Rev 7:693–702 Koh S, Thomas R, Tsai S et al (2013) Growth requirements and chromosomal instability of induced pluripotent stem cells generated from adult canine fibroblasts. Stem Cells Dev 22:951–963 Park IH, Lerou PH, Zhao R et al (2008) Generation of human-induced pluripotent stem cells. Nat Protocol 3:1180–1186

Chapter 8 Derivation of Equine-Induced Pluripotent Stem Cell Lines Using a piggyBac Transposon Delivery System and Temporal Control of Transgene Expression Kristina Nagy and Andras Nagy Abstract The discovery of induced pluripotent stem cells (iPSCs) has had a transforming effect on our understanding of biology and has brought an enormous promise to regenerative medicine. It has opened up a magnitude of unprecedented possibilities to study disease processes in vitro, model them in animal systems, and develop patient-specific cell-based regenerative therapies. iPSCs derived from other than the human species will be instrumental for bringing these prospects to fruition by providing preclinical models and novel treatments for veterinary medicine. In this chapter, we describe the derivation of iPSCs from equine embryonic fibroblasts using a non-viral method developed in our laboratory and originally applied to the murine and human systems (Woltjen et al., Nature 458:766–770, 2009). We will detail the procedures involved and discuss potential pitfalls as well as elaborate on possible variations and future improvements of this technique. Key words Equine, Horse, Induced pluripotent stem cells, iPSC, Reprogramming, piggyBac transposon, Tetracycline-inducible transgene, Non-viral

1

Introduction Shinya Yamanaka’s discovery of the means to induce terminally differentiated somatic cells into a pluripotent (embryonic stem celllike) state was such a major breakthrough that just 6 years later, in 2012, it was awarded the Nobel Prize in Physiology or Medicine. Yamanaka and his student Takahashi showed that the expression of just four transcription factors—Oct4, Klf4, Sox2, and cMyc—is sufficient to carry out this amazing cell state change and generate induced pluripotent stem cells (iPSCs)—initially in mice [1] and a year later in the human [2]. This paradigm-shifting discovery sparked tremendous hopes for not only the development of therapies based on patient-specific regenerative medicine but also for modeling disease processes in vitro as well as in vivo using animal models. Not surprisingly, a large effort was soon launched to derive iPSCs from

Paul J. Verma and Huseyin Sumer (eds.), Cell Reprogramming: Methods and Protocols, Methods in Molecular Biology, vol. 1330, DOI 10.1007/978-1-4939-2848-4_8, © Springer Science+Business Media New York 2015

79

80

Kristina Nagy and Andras Nagy

other species. Indeed, these have now been isolated from a broad range of animals such as rhesus monkey [3], rat [4], pig [5–8], marmoset [9], rabbit [10], dog [11], cattle [12], sheep [13], horse [14, 15], and most recently in cynomolgus monkey [16]. The horse represents a considerable commercial and emotional value as race, dressage, and show-jumping athletes, and as recreational companions. There are close to a million horses in Canada alone and the industry is estimated to contribute $19 billion annually to the Canadian economy (Equine Canada 2010, The 2010 Equine Industry Study). Horses are also an invaluable therapeutic aid for children with neurological impairments in general [17, 18] and cerebral palsy in particular [19]. Equine therapy has also proven successful as a tool for the treatment of autism [20] and schizophrenia [21]. It is therefore not surprising that the prospect of reprogramming and therapeutic applications that may result thereof has gained considerable interest among those engaged in these areas of equine relationships. The horse is ideally suited as a model for injuries to muscles, tendons, ligaments, and joints as these lesions are not only frequently encountered in this species but also pose substantial difficulties to treat with currently available options. Although autologous mesenchymal stem cells (MSCs) have been used to treat bone fractures, cartilage damage, and lesions on tendons in horses [22, 23] this approach does not result in long-term tissue repair [24]. iPSCs with their capacity of unlimited self-renewal and ability to differentiate into any cell type found in the body are likely to provide a far superior alternative. The initial publications describing the reprogramming technique relied on a viral delivery system for insertion of the required transgenes [1, 25]. Although this method offers sufficient efficiency, virally delivered transgene expression is unpredictable and prone to uncontrollable silencing. For this reason, we have chosen to use the piggyBac (PB) transposon and a tetracyclineinducible system to activate the reprogramming factor expressions [26]. The tetracycline-inducible system contributes with an important property: it allows for the exact temporal control of transgene expression. This feature is crucial since shutdown of the reprogramming factors beyond the point of iPSC generation is essential for proper differentiation. Once putative iPSC lines have been established, it is imperative to characterize these for their true pluripotent nature. Unfortunately, reliable antibodies for core pluripotency markers such as Oct4, Nanog, SSEA1, SSEA4, TRA-1-60, and TRA-1-81 specific to equine cells are not readily available [27]. However, many antibodies raised against mouse or human cells do cross-react with horse and alkaline phosphatase staining is also a viable option. Nevertheless, a more convincing proof of pluripotency is the formation of teratomas containing tissues derived from all three

Derivation of Equine iPS Cells

81

embryonic germ layers when putative iPSCs are injected into immunocompromised mice. In this chapter, we provide protocols for all the steps in the process of generating iPSC lines from equine embryonic fibroblasts. In the future, these methods will no doubt be further refined and adapted.

2

Materials Derivation of iPS cell lines from equine fibroblasts using the methods outlined in these protocols requires access to both molecular biology equipment for preparation of plasmids and sterile tissue culture hoods and incubators. A dissecting and phase-contrast inverted microscope for preparing and monitoring cell cultures and equipment for transfection are also needed. Since these modalities are likely already available in the laboratory, we do not recommend specific manufacturers. We describe and refer to equipment successfully used in our hands but the reader should not feel restricted to these specifics.

2.1 Primary Culture of Equine Fibroblasts (See Note 1)

1. Fibroblast culture media: DMEM High Glucose (Invitrogen 11960-044) supplemented with 2 mM GlutaMax™ (Invitrogen # 35050), 0.1 mM Non-essential amino acids (Invitrogen # 11140), 0.1 mM Betamercaptoethanol (Sigma M7522), 1 mM Sodium Pyruvate (Invitrogen #11360-070), 50 U/ml Penicillin/Streptomycin (Invitrogen #15070), and 15 % fetal bovine serum (HyClone).

2.2 Reprogramming and Picking Primary Colonies

1. Step one eiPS culture media: Same as fibroblast culture media with the addition of 1000 U/ml leukemia inhibitory factor (LIF; Millipore #ESGRO), 10 ng/ml bFGF (Peprotech #10018B), 1.5 μg/ml Doxycycline (Sigma #D9891) (unless otherwise stated), 3 μM GSK inhibitor (StemGent #CHIR99021), 0.5 M MEK inhibitor (StemGent #PD0325901), 2.5 μM TGF inhibitor (StemGent #A83-01), Thiazovivin (StemGent #Thiazovivin). 2. Step two eiPS culture media: Same as step one eiPS culture media with the addition of 25 μM ALK receptor inhibitor (StemGent #SB431542). 3. Plasmids containing the piggyBac transposon embedded reprogramming factor expression vectors for Oct4, Klf4, cMyc, and Sox2 (see Note 2). 4. Neon electroporation device, reagents buffer E and R, cuvettes, and 10 μl tips (Invitrogen) (see Note 3). 5. TrypLE Select (Invitrogen).

82

Kristina Nagy and Andras Nagy

6. Mitomycin-inactivated mouse embryonic fibroblasts to be used as feeder layers [28]. 7. Drawn-out glass Pasteur pipettes and mouth-pipetting device (see Note 4). 2.3 Propagation and Cryopreservation of eiPS Cell Lines

1. Step three eiPS culture media: Same as step two eiPS culture media but with one inhibitor removed at a time at each passage. 2. TrypLE Select (Invitrogen). 3. Mitomycin-inactivated mouse embryonic fibroblasts to be used as feeder layers. 4. Cryopreservation media: 60 % serum, 10 % DMSO, 30 % step three eiPS culture media (see Note 5).

3

Methods The methods described here are based on our experiences [15]. Although other methods have been used for the derivation of iPSC cell both from horse and other species, the main advantage of our approach is the high efficiency of transfection and the ability to closely control the reprogramming process by the addition or withdrawal of doxycycline. The timeline of reprogramming events is depicted in Fig. 1.

3.1 Preparation of Plasmid DNA

1. Prepare plasmid DNA at a concentration of 1–2 μg/μl. 2 μg will be needed for every electroporation. For a standard experiment, at least 6 μg plasmid DNA is usually required. 2. Take great care when purifying the plasmid DNA so that no endotoxins, salts, or other impurities remain.

3.2 Primary Culture of Equine Fibroblast Culture

1. Prepare 6-well tissue culture dishes by coating them with gelatin: Add 2 ml 0.1 % gelatin to each well, aspirate, and leave the dishes with their lids removed in a sterile laminar flow hood for 30 min. Cover the dishes with their lids. 2. Thaw fibroblasts: (see Note 6)

Fig. 1 Timeline for eiPS cell derivation. Day 1 is counted as the day of transfection. The addition of SB431542 to the culture media on day 10 is essential. Although the timing of reprogramming will vary from experiment to experiment, in general, colonies will be ready to pick at around day 14

Derivation of Equine iPS Cells

83

(a) Remove the cryo-vial containing equine fibroblasts from the liquid nitrogen or ultralow freezer. (b) Thaw the vial quickly at 37 °C. (c) Gently pipette the cell suspension into a conical tube containing 5 ml of fibroblast media. (d) Centrifuge at 18 × g for 2 min. (e) Discard the supernatant and resuspend the cells in fibroblast media. (f ) Plate the fibroblasts on an appropriate surface of tissue culture dish. (g) Replace the culture media (“feed the culture”) the following day with fibroblast media. 3. Culture fibroblasts: (a) Feed the cultures with fibroblast media every day. (b) Passage the fibroblasts when they are semi-confluent. i. Remove the culture media. ii. Wash once with same volume as the amount of culture media using sterile PBS. iii. Trypsinize the cells: Add ¼ volume of trypsin/EDTA and place in the incubator for 2 min. iv. Add ¾ volume of fibroblast culture media. Pipette vigorously six times, and then add to a 15 ml conical tube. v. Centrifuge at 18 × g for 2 min. vi. Remove the supernatant and resuspend the cells in 3× the volume they grew in before passaging. vii. Plate the fibroblasts on 3× the culture surface they grew on before passaging. 3.3

Transfection

1. Let the fibroblasts grow to semi-confluency on a 100 mm plate. If needed, passage them from smaller surfaces every 2–3 days until they reach this stage. 2. The day before transfection, remove the antibiotics from the culture media. 3. At the same time, prepare mitotically inactivated mouse embryonic fibroblast feeders. You will need one 100 mm plate with feeders for every electroporation. A typical experiment would require three electroporations. It is advisable to have at least three 100 mm plates with feeders that are no older than 2–3 days available on the day of transfection. Just prior to transfection, change the media on the MEFs to stage one eiPS media. 4. Trypsinize the cells as described in the above step 3.iii–v.

84

Kristina Nagy and Andras Nagy

5. Resuspend the cells in 5 ml fibroblast culture media. Use a hemato-cytometer or cell counter to determine the cell number. Determine how many electroporations will be done: you will need 5 × 104 cells per electroporation. 6. Centrifuge the cells again, remove the supernatant, and resuspend in 10 ml PBS. 7. Centrifuge the cells again, remove the supernatant, and resuspend in 10 μl buffer R per electroporation. 8. Add 2 μg plasmid DNA per electroporation to the cells and mix well without causing bubbles. 9. Set the Neon electroporator program 14: 1200 V, 30 ms, and 2 pulses. 10. Place a 10 μl tip onto the electroporation pipettor. Press the plunger completely through, aspirate cell suspension to completely fill the tip, and make sure that there are no bubbles in the tip. 11. Seed the transfected cells by adding the transfected suspension directly from the tip to a plate containing MEFs and step one eiPS culture media. 3.4 Culture During Reprogramming and Picking Colonies

1. Change the culture media the day after electroporation, and then every other day until colonies become visible. 2. On day 10 and onwards, change the media to step two eiPS culture media. 3. At around days 10–14, distinct colonies should be apparent in the cultures (Fig. 2). These must be picked at the ideal time point—not too early as this will lead to the demise of the clone and not too late as that will cause the colony to start to differentiate. Aim at picking colonies that are the size just about barely visible to the naked eye. 4. Prepare a 4-well plate with mitotically inactivated MEFs. 5. Using finely drawn-out glass Pasteur pipettes and a mouthpipetting device, carefully dislodge each colony and place it in an individual well of the 4-well plate. 6. Change the media the following day and make sure that the picked colonies have firmly attached to the feeder layer. 7. Continue picking further colonies over the coming several days as they grow to the appropriate size. 8. Change the media (feed) on the clones in the 4-well plate every day and inspect them for their growth. In most cases, the picked colony will reattach to the feeder layer and start growing rapidly. 9. Using finely drawn-out glass Pasteur pipettes and a mouthpipetting device, carefully cut the colony into 4–8 pieces and distribute them into a new well of a 4-well plate with MEFs.

Derivation of Equine iPS Cells

85

Fig. 2 Morphology of equine fibroblasts and iPS cell colonies. Around day 10 of reprogramming, focal areas will be seen where the morphology of the fibroblasts becomes rounded. These areas morph into colonies within a few days

3.5

Culture of eiPSCs

1. Once the 4-well area for each clone is semi-confluent, it is usually possible to switch to enzymatic passaging. 2. Remove the media and wash the cultures once with PBS. 3. Add 100 μl TrypLE and place the dishes/plates in the incubator for 2–5 min. Check the cultures frequently and stop the dissociation as soon as the colonies are starting to lift off the culture surface. 4. Add 500 μl culture medium and pipette up and down three times. 5. Add the cell suspension to a 15 ml conical tube containing 5 ml of culture medium. 6. Centrifuge at 18 × g for 2 min. 7. Discard the supernatant and resuspend the cells with 2 ml of step three culture medium.

86

Kristina Nagy and Andras Nagy

8. Add the cell suspension to a 30 mm cell culture surface area that has been prepared with fresh MEFs. 9. Once the 30 mm dish is semi-confluent, it is time to cryopreserve “passage 1” cells: (a) Passage the cells as described in steps 2–4. (b) Divide the cell suspension into two conical tubes: (a) 1/3 into (this will be kept in culture) and (b) 2/3 into the other (this will be frozen). 10. Centrifuge at 18 × g for 2 min. 11. Discard the supernatant and resuspend the cells with (a) 5 ml step three eiPS culture media, and (b) 2 ml cryopreservation media. 12. Plate “a” onto a 60 mm surface with MEFs, and add “b” to two 1.5 ml cryo-tubes. Wrap the vials in insulating pads or use a styrofoam box. 13. Place the plated cells in the incubator for further culturing and the cryo-vials in an −80 °C freezer (the vials should be placed in liquid nitrogen storage within a few days of freezing). 3.6 Removal of Inhibitors and Doxycycline

4

Once the eiPS cell lines are well established, it is possible to “wean” off the inhibitors. To do this, remove one inhibitor at a time each time the cells are passaged. Anticipate some cell death as the cultures are adapting to the new conditions.

Notes 1. All materials should be of highest possible cell culture grade. Inhibitors should be kept frozen in small aliquots and only added to the culture media prior to use. Since fibroblasts come from a primary source, they pose a higher risk than established cell lines for the introduction of pathogens. Therefore, establishment of iPSCs should ideally be performed using dedicated hoods and incubators. 2. There are a variety of plasmids containing reprogramming factors. We recommend those based on the PB recombinase technology as they have proven successful in our hands. Virusand episome-based system may be used as well but in this case, the above protocol will have to be significantly modified to accommodate the particular requirements for those systems. 3. Although in our experience the Neon electroporation device can successfully be used for this application, there are many other options available—many that may well result in equal or even higher transfection efficiencies. 4. Drawn-out glass Pasteur pipettes: Heat the thin part of a long glass Pasteur pipette over a gas flame just until it starts to melt.

Derivation of Equine iPS Cells

87

Give it a sharp pull while simultaneously removing it from the heat. Break the glass 2–3 cm from the widening of the pipette. Quickly move the tip through the flame again to smoothen the edges. Mouth-pipetting is the most precisely controlled system for moving minute volumes of liquid or cells from one position to another. However, it is not allowed in many institutions. If this is the case, Flexipet pipettes from Cook Medical Inc or other similar devices from other producers can be used instead. 5. Thawing of early passages of eiPSCs should be done with great care as the cells are sensitive to mechanical manipulation. Thawing should take place at 37 °C and temporally limited until the ice crystals have just about thawed. Extended exposure to 10 % DMSO (freezing media) to thawed cells is detrimental. 6. When thawing a vial of frozen eiPSCs, it is important to choose the right surface area to plate them on. If the plating is too dense, the culture will be overly dense the next day and if the plating areas is too large, it will take several days for the culture to become confluent. As a general rule, cells should be plated on 1/3 of the surface area they were originally frozen from. References 1. Takahashi K, Yamanaka S (2006) Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126:663–676 2. Takahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, Tomoda K, Yamanaka S (2007) Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131:861–872 3. Liu H, Zhu F, Yong J, Zhang P, Hou P, Li H, Jiang W, Cai J, Liu M, Cui K et al (2008) Generation of induced pluripotent stem cells from adult rhesus monkey fibroblasts. Cell Stem Cell 3:587–590 4. Liao J, Cui C, Chen S, Ren J, Chen J, Gao Y, Li H, Jia N, Cheng L, Xiao H et al (2009) Generation of induced pluripotent stem cell lines from adult rat cells. Cell Stem Cell 4:11–15 5. Esteban MA, Xu J, Yang J, Peng M, Qin D, Li W, Jiang Z, Chen J, Deng K, Zhong M et al (2009) Generation of induced pluripotent stem cell lines from Tibetan miniature pig. J Biol Chem 284:17634–17640 6. Ezashi T, Telugu BP, Alexenko AP, Sachdev S, Sinha S, Roberts RM (2009) Derivation of induced pluripotent stem cells from pig somatic cells. Proc Natl Acad Sci U S A 106:10993– 10998 7. West FD, Terlouw SL, Kwon DJ, Mumaw JL, Dhara SK, Hasneen K, Dobrinsky JR, Stice SL

8.

9.

10.

11.

12.

13.

(2010) Porcine induced pluripotent stem cells produce chimeric offspring. Stem Cells Dev 19:1211–1220 Wu Z, Chen J, Ren J, Bao L, Liao J, Cui C, Rao L, Li H, Gu Y, Dai H et al (2009) Generation of pig induced pluripotent stem cells with a drug-inducible system. J Mol Cell Biol 1:46–54 Wu Y, Zhang Y, Mishra A, Tardif SD, Hornsby PJ (2010) Generation of induced pluripotent stem cells from newborn marmoset skin fibroblasts. Stem Cell Res 4:180–188 Honda A, Hirose M, Hatori M, Matoba S, Miyoshi H, Inoue K, Ogura A (2010) Generation of induced pluripotent stem cells in rabbits: potential experimental models for humanregenerativemedicine.JBiolChem285:31362– 31369 Shimada H, Nakada A, Hashimoto Y, Shigeno K, Shionoya Y, Nakamura T (2010) Generation of canine induced pluripotent stem cells by retroviral transduction and chemical inhibitors. Mol Reprod Dev 77:2 Sumer H, Liu J, Malaver-Ortega LF, Lim ML, Khodadadi K, Verma PJ (2011) NANOG is a key factor for induction of pluripotency in bovine adult fibroblasts. J Anim Sci 89:2708– 2716 Liu J, Balehosur D, Murray B, Kelly JM, Sumer H, Verma PJ (2012) Generation and

88

14.

15.

16.

17.

18.

19.

20.

Kristina Nagy and Andras Nagy characterization of reprogrammed sheep induced pluripotent stem cells. Theriogenology 77:338–346.e1 Khodadadi K, Sumer H, Pashaiasl M, Lim S, Williamson M, Verma PJ (2012) Induction of pluripotency in adult equine fibroblasts without c-MYC. Stem Cells Int 2012:429160 Nagy K, Sung H-K, Zhang P, Laflamme S, Vincent P, Agha-Mohammadi S, Woltjen K, Monetti C, Michael IP, Smith LC et al (2011) Induced pluripotent stem cell lines derived from equine fibroblasts. Stem Cell Rev 7:693–702 Shimozawa N, Ono R, Shimada M, Shibata H, Takahashi I, Inada H, Takada T, Nosaka T, Yasutomi Y (2013) Cynomolgus monkey induced pluripotent stem cells established by using exogenous genes derived from the same monkey species. Differentiation 85:131–139 Encheff JL, Armstrong C, Masterson M, Fox C, Gribble P (2012) Hippotherapy effects on trunk, pelvic, and hip motion during ambulation in children with neurological impairments. Pediatr Phys Ther 24:242–250 Hession CE, Eastwood B, Watterson D, Lehane CM, Oxley N, Murphy BA (2014) Therapeutic horse riding improves cognition, mood arousal, and ambulation in children with dyspraxia. J Altern Complement Med 20:19–23 Kwon J-Y, Chang HJ, Lee JY, Ha Y, Lee PK, Kim Y-H (2011) Effects of hippotherapy on gait parameters in children with bilateral spastic cerebral palsy. Arch Phys Med Rehabil 92:774– 779 Ward SC, Whalon K, Rusnak K, Wendell K, Paschall N (2013) The association between therapeutic horseback riding and the social communication and sensory reactions of

21.

22.

23.

24.

25.

26.

27.

28.

children with autism. J Autism Dev Disord 43:2190–2198 Corring D, Lundberg E, Rudnick A (2013) Therapeutic horseback riding for ACT patients with schizophrenia. Community Ment Health J 49:121–126 Nathan S, De Das S, Thambyah A, Fen C, Goh J, Lee EH (2003) Cell-based therapy in the repair of osteochondral defects: a novel use for adipose tissue. Tissue Eng 9:733–744 Taylor SE, Smith RKW, Clegg PD (2007) Mesenchymal stem cell therapy in equine musculoskeletal disease: scientific fact or clinical fiction? Equine Vet J 39:172–180 Wilke MM, Nydam DV, Nixon AJ (2007) Enhanced early chondrogenesis in articular defects following arthroscopic mesenchymal stem cell implantation in an equine model. J Orthop Res 25:913–925 Okita K, Ichisaka T, Yamanaka S (2007) Generation of germline-competent induced pluripotent stem cells. Nature 448:313–317 Woltjen K, Michael IP, Mohseni P, Desai R, Mileikovsky M, Hämäläinen R, Cowling R, Wang W, Liu P, Gertsenstein M et al (2009) piggyBac transposition reprograms fibroblasts to induced pluripotent stem cells. Nature 458:766–770 Paris DB, Stout TA (2010) Equine embryos and embryonic stem cells: defining reliable markers of pluripotency. Theriogenology 74:516–524 Behringer R, Gerstenstein M, Vintersten Nagy K, Nagy A (2014) Manipulating the Mouse Embryo: A Laboratory Manual, Fourth Edition.Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York

Chapter 9 Generation of Avian Induced Pluripotent Stem Cells Yangqing Lu, Franklin D. West, Brian J. Jordan, Robert B. Beckstead, Erin T. Jordan, and Steven L. Stice Abstract Avian species are among the most diverse vertebrates on our planet and significantly contribute to the balance of the ecology. They are also important food source and serve as a central animal model to decipher developmental biology and disease principles. Derivation of induced pluripotent stem cells (iPSCs) from avian species would enable conservation of genetic diversity as well as offer a valuable cell source that facilitates the use of avian models in many areas of basic and applied research. In this chapter, we describe methods used to successfully reprogram quail fibroblasts into iPSCs by using human transcription factors and the techniques critical to the characterization of their pluripotency. Key words Avian, Quail, Induced pluripotent stem cell

1

Introduction The development of induced pluripotent stem cells (iPSCs) by Yamanaka and the refinement of this process by many others have shown that most somatic cell types, if not all, can be reprogrammed back to a naïve pluripotent state with the help of only a few exogenous factors [1, 2]. iPSCs are capable of giving rise to all lineages in vitro and in vivo and can even contribute to whole animal development through tetraploid complementation [3]. Previous publications demonstrated that the core regulatory network of pluripotency is widely conserved in vertebrates [4], and the work in our lab demonstrated that cellular reprogramming is conserved and iPSCs could be derived from domestic animals [5, 6]. iPSCs have significant potential to advance our knowledge in developmental biology and are a useful tool for basic and applied research. Avian species are widely distributed on earth and play an important role in balancing the ecosystem. However, according to the IUCN 2012 red list, 1313 of the avian species or 13 % of the total avian population are threatened by extinction (these animals are categorized as critically endangered, endangered, or vulnerable)

Paul J. Verma and Huseyin Sumer (eds.), Cell Reprogramming: Methods and Protocols, Methods in Molecular Biology, vol. 1330, DOI 10.1007/978-1-4939-2848-4_9, © Springer Science+Business Media New York 2015

89

90

Yangqing Lu et al.

[7]. It was reported that avian germ cells transplanted into the xenogeneic embryo could colonize the gonads and produce functional sperm, and could be used as a new strategy in wild bird conservation [8, 9]; however the limited source of embryos from endangered birds limits the practical application of this technique. In contrast, iPSCs can be generated from any cell type (e.g., feathers, post-hatch eggshells, or even frozen samples of extinct birds), and it has been demonstrated, at least in the mouse, that iPSCs are capable of differentiation into germ cells, giving rise to live offspring [10]. Thus iPSCs may eventually be a feasible strategy for conserving genetic diversity and repopulating endangered birds. Avian models have been used in developmental biology and disease research, providing critical insights into organ function and disease progression [11]. The most significant advantage of using avian species in research is the ease of access to the embryo, which enables a variety of experimental applications from investigating the function of molecules to cell–cell or tissue–tissue interactions in developing embryos [12]. Derivation of avian iPSCs may facilitate complex genetic modifications and would significantly advance the use of this model in the above mentioned research. Moreover, the chicken is one of the most important domesticated animals, and the availability of iPSC lines that are capable of unlimited expansion and genetic modification would also facilitate the production of transgenic chickens that carry specific traits with agricultural or pharmaceutical importance. Here in this chapter we describe the derivation of iPSCs from quail by using human transcription factors. We provide a detailed description from the point of isolating quail fibroblast cells to lentiviral delivery of reprogramming transcription factors to selection of reprogrammed colonies. We then describe the key pluripotency marker characterization assays for putative iPSCs and the functional test of chimera formation, which indicates bona fide pluripotency.

2

Materials

2.1 Cell Culture and Transduction Components

1. Lentiviral vectors: Human transcriptional factors POU5F1, SOX2, NANOG, LIN28, C-MYC, KLF4, and GFP each packaged in individual lentiviral vectors (Thermo Scientific). 2. Fibroblast cell medium: DMEM high glucose (Hyclone) supplemented with 10 % FBS (Hyclone), 4 mM L-Glutamine (Life Technologies), and 50 U/mL penicillin and 50 μg/mL streptomycin (Life Technologies). 3. Stem cell derivation medium: DMEM/F12 (Life Technologies) supplemented with 20 % knockout serum replacement (KSR; Life Technologies), 2 mM L-glutamine (Life Technologies),

Generation of Avian Induced Pluripotent Stem Cells

91

0.1 mM non-essential amino acids (Life Technologies), 50 U/ mL penicillin and 50 μg/mL streptomycin (Life Technologies), 0.1 mM β-mercaptoethanol (Sigma-Aldrich), and 10 ng/mL FGF-2 (R&D Systems). 4. Stem cell culture medium: mTeSR1 (Stemcell Technologies). 5. Transduction reagent: 200× Transdux (System Biosciences). 6. Basement Membrane Matrix: Growth Factor Reduced Matrigel (BD Biosciences). 7. Fibroblast cell detachment solution: 0.05 % Trypsin (Life Technologies). 8. Stem cell detachment solution: Accutase (Innovative Cell Technologies). 9. Phosphate buffered saline with calcium and magnesium (PBS++) (Hyclone). 10. Phosphate buffered saline without calcium and magnesium (PBS−−) (Hyclone). 11. Inactivated mouse embryonic fibroblast (MEF): Mi-T-MEF™ Mouse Feeder Cells (ArunA). 2.2 AP Staining Components

1. Tris–HCl, 100 mM, pH 8.2–8.5.

2.3 Immunocytochemistry Components

1. Fixing Solution: 4 % paraformaldehyde (PFA) prepared in PBS++.

2. VECTOR Red Alkaline Phosphatase Substrate Kit (Vector Laboratories).

2. Mounting solution: Technologies).

Prolong

Gold

with

DAPI

(Life

3. Extracellular Blocking Solution: PBS++ supplemented with 6 % horse serum. Store at 4 °C and use within 48 h. 4. High Salt Buffer. (a) Add 7.3 g NaCl into 200 mL distilled water in a 500 mL bottle. (b) Add 25 mL of 1 M Tris-base, adjust to pH 7.4 by adding 1 M HCl. (c) Bring volume up to 500 mL with distilled water. (d) Store at room temperature. 5. Intracellular Blocking Solution: (e) Add 0.5 g Polyvinylpyrrolidone (PVP) into a 50 mL tube. (f) Add 48 mL High Salt Buffer. (g) Add 1.5 mL serum (serum should be compatible with antibodies). (h) Add 150 μL Triton X-100.

92

Yangqing Lu et al.

(i) Mix by inversion until dissolved. Store at 4 °C, use within 48 h. 6. Primary antibodies: (j) SSEA1 (Mouse IgM, Hybridoma Bank). (k) POU5F1 (Rabbit IgG, Santa Cruz Biotech). 7. Secondary antibodies. (l) Alexa Fluor 594, Goat anti-Mouse IgM (Life Technologies). (m) Alexa Fluor 488, Goat anti-Rabbit IgG (Life Technologies). 2.4 Chimera Injection Equipments and Materials

1. Glass needle: Sutter Instrument, O.D.:1.0 mm, I.D.:0.75 mm, 15 cm length. 2. Micropipette puller: Sutter Instrument P9-7. 3. Micro grinder: Narishige EG 400. 4. Micro-injector: Picospritzer III, Parker Hannifin Corporation. 5. Egg shell driller: DREMEL 400XPR. 6. Glue gun: Arrow Fastener TR400DT. 7. Scalpel blades: Ted Pella 549-4S-26. 8. Tweezers: Ted Pella 5665.

3

Methods

3.1 Isolation and Culture of Quail Embryonic Fibroblast (QEF)

1. Open a day 11 quail embryo, remove the yolk and extraembryonic tissue, and place the embryo in a clean Petri dish. 2. Decapitate the embryo, remove the visceral organs, and transfer embryo to a new Petri dish. 3. Mince the embryos with a curved, sterile, surgical scissor. 4. Add a total of 2.5 mL of 0.25 % Trypsin/EDTA to the minced embryo and transfer the embryo/trypsin solution to a conical tube. 5. Incubate the tissue suspension for 15 min at 37 °C, mixing briefly every 5 min. 6. Add an equal volume of fibroblast cell medium to neutralize the trypsin. 7. Pellet the cells by centrifugation at 200 × g for 4 min. 8. Resuspend cells with fresh medium and seed cells from each embryo into two 175 cm2 tissue culture flask. 9. Incubate the cells at 37 °C with 5 % CO2 and subculture upon confluence every 3–4 days.

3.2 Transduction of QEF

1. One day before transduction, seed a total of 1.5 × 105 QEF cells in a single well of a 12-well plate, feed with fibroblast cell medium (see Note 1).

Generation of Avian Induced Pluripotent Stem Cells

93

2. On the day of transduction, prepare the transduction mixture by adding 250 μL fibroblast cell medium in a 1.5 mL centrifuge tube and add lentiviral transcription factors POU5F1, NANOG, SOX2, LIN28, KLF4, and C-MYC, each at a multiplicity of infection (MOI) of 10. Finally add 1.25 μL 200× TransDux and mix thoroughly by gently pipetting. 3. Remove medium from QEF cell culture and add 250 μL transduction mixture into each well. Incubate the cells at 37 °C, 5 % CO2 at maximal humidity for 24 h (see Note 2). 4. At the end of incubation, remove the medium containing the viral particles, wash two times with PBS−−, and trypsinize the cells and replate onto a 100 mm inactivated MEF plate, feed with fresh stem cell derivation medium. 3.3 Isolation and Culture of Quail iPSC

1. At approximately 3 weeks after transduction manually harvest the iPSC-like colonies by using a hook generated from a pasteurized glass pipette under stereomicroscope. Each colony will be cut into 10–15 pieces, around 100 cells per piece (see Note 3). 2. Replate 5–10 colonies into a 35 mm plate precoated with Matrigel and feed with mTeSR1 medium. 3. Subculture the quail iPSC every 4–6 days by using glass pipette and manual technique. Split at a 1:3 ratio into 35 mm Matrigelcoated plates (see Note 4) (Fig. 1).

3.4

AP Staining

1. Prepare the substrate solution using VECTOR Red Alkaline Phosphatase Substrate Kit. Immediately before use, add two drops of Reagent 1, 2, and 3 into 5.0 mL of Tris–HCl solution in a 15 mL conical tube, mix well after adding each component. 2. Remove the medium from the iPSC culture and gently rinse with Tris–HCl solution once. 3. Apply the substrate solution to the cells at 1 mL per 35 mm plate and incubate at room temperature for 20 min. 4. Gently rinse the cells two times with PBS++. 5. Overlay the cells with 1.5 mL PBS++ and proceed to the microscope for observation and imaging.

3.5 Immunocyto chemistry

1. Plate the quail iPSCs in 4-chamber slide precoated with Matrigel and culture for 2 days. 2. Working in a fume hood, remove the medium and wash cells once with PBS++ (see Note 5). 3. Add sufficient 4 % PFA solution to cover the bottom of well and incubate at room temperature for 15 min. 4. Wash cells three times with PBS++. 5. Add 800 μL block solution (intracellular or extracellular) to each well and incubate at room temperature for 45 min.

94

Yangqing Lu et al.

Fig. 1 Derivation of quail iPSC. QEFs grown to 50 % confluence are used for transduction (a). At approximately 7 days after transduction with stem cell factors and replating on MEF, incomplete or incorrectly reprogrammed QEFs with irregular colony shape are observed (b). iPSC-like cells with typical stem cell characteristics (high nuclear to cytoplasm ratio and prominent nucleoli, shown in arrow inset) in 3-D colony are observed after 2–3 weeks of culture (c). These quail iPSCs can be maintained in mTeSR1 and Matrigel-coated plates, a feeder-free and serum-free system (d). Scale bar: 200 μm

6. Prepare primary antibody in block solution (intracellular or extracellular) at recommended dilution. 7. Aspirate block solution from cells, and add 300 μL of primary antibody solution to each well and incubate at room temperature for 1 h. 8. Wash cells four times in PBS++ for 5 min each wash. 9. Prepare secondary antibody in block solution (intracellular or extracellular) at recommended dilution. 10. Aspirate last PBS++ wash from cells, and add 300 μL of secondary antibody solution and incubate at room temperature for 1 h. (During incubation cover sample with foil to prevent fluorescence from bleaching.) 11. Wash cells four times in PBS++ for 5 min each wash. 12. Mount slides with Prolong Gold with DAPI. 13. Seal edges with nail varnish and keep in dark storage until observed and documented (Fig. 2).

Generation of Avian Induced Pluripotent Stem Cells

95

Fig. 2 Characterization of the pluripotent markers in quail iPSCs. Quail iPSCs are positive for alkaline phosphatase (a) and pluripotent markers POU5F1 (b) and SSEA1 (c). Scale bar (a): 200 μm, (b) and (c): 50 μm

3.6 In Vitro Differentiation of iPSCs Through Embryoid Body Formation

1. Culture the quail iPSC in 100 mm dish until 80 % confluence in mTeSR1 medium. 2. Remove the medium and wash with PBS−− two times. 3. Add 3 mL of accutase to cells and incubate for 5 min to dissociate cells. 4. Add equal amounts of mTeSR1 medium to neutralize the accutase. 5. Pellet the cells by centrifugation at 200 × g for 4 min and resuspend the cells in 1 mL of mTeSR1 medium. 6. Determine the cell density and add 2 × 106 cells in each well of the AggreWell plate (Stemcell Technologies). Bring the volume to 2 mL with additional mTeSR1 medium. 7. Centrifuge the AggreWell plate at 200 × g for 4 min to capture the cells in microwells and then place in incubator at 37 °C and 5 % CO2. 8. After 24 h, gently pipette and transfer the aggregates to a Petri dish using a 1 mL pipette. 9. Place the dish on the rocker at 50 rpm inside the incubator and continue the culture for 7 days. 10. Harvest the embryoid bodies (EBs) for RNA isolation using QIAGEN RNeasy kit and then synthesize cDNA using iScript™ cDNA Synthesis Kit (see Note 6) (Fig. 3). 11. Perform PCR to detect the differentiation of quail iPSC using primers listed in Table 1 with annealing temperature at 60 °C.

3.7 Production of Chimeras

1. Micropipette preparation: Pull a glass needle to make a micropipette by using a micropipette puller. Correct the gauge of the needle to 5 μm by cutting the tip under a stereomicroscope and then sharpen the tip by using a micro grinder. 2. Embryo preparation: Set Stage X chicken embryos horizontally in 15 °C refrigerator overnight to allow the embryo to rotate to the dorsal surface.

96

Yangqing Lu et al.

Fig. 3 Generation of iPSCs embryoid bodies. A total of 2 × 106 quail iPSCs are plated in each well of the AggreWell plate; each micro-well contains around 1600 cells (a). Quail iPSCs form round and compact EBs 4 days after transfer of the aggregates into the suspension culture (b). Scale bar: 200 μm Table 1 Primers for detection of the differentiation of quail iPSCs Gene name GAPDH

PAX6

TUJ1

Brachyury

Vimentin

Primer sequence

Product length (bp)

Forward

TGCCCAGAACATCATCCCA

295

Reverse

GCCAGCACCCGCATCAAAG

Forward

CAGAAGATCGTGGAACTCGC

Reverse

CACTGGGTATGTTATCGTTGGTA

Forward

CAGCGATGAGCATGGCATAGAC

Reverse

CGGAAGCAGATGTCGTACAGG

Forward

TCTGGATACTCGCAGTTAGGT

Reverse

ATGGTGCTGTTACTCACGGAC

Forward

GTCTGGATACTCGCAGTTAGG

Reverse

GGTGTAGGGATTGGGGTAG

280

576

365

175

3. Cell preparation: Prepare the quail iPSCs (see Note 7) at density of 1 × 105 per mL in mTeSR1 medium and add trypan blue to the cell suspension at 10 % of total volume. Prepare cell droplets in a 100 mm Petri dish by transferring 100 μL/drop cell suspension to the dish. Then overlay the droplets with 10 mL mineral oil to prevent evaporation. 4. Egg windowing: Disinfect the surface by wiping the shell with 70 % ethanol. Then make an injection window of 0.5 cm diameter using a Dremel rotary tool. Cut and remove the membrane using a fine blade and tweezers (see Note 8).

Generation of Avian Induced Pluripotent Stem Cells

97

Fig. 4 Injection of quail iPSCs into stage X chicken embryo. A window with a diameter of 0.5 cm is opened on the top of the stage X chicken embryo (a). Quail iPSCs loaded in micropipette are injected into the subgerminal cavity of the embryo (b) and the window is sealed by hot glue (c)

5. Cell injection: Load most of the cells from each droplet into a micropipette controlled by micro-injector or foot pipette. Slightly tilt the egg to move the embryo to the center of the window. Inject the loaded cells, approximately 1 × 104 cells per each load, into the subgerminal cavity of the embryo [13] and then seal the window using a hot glue gun (Fig. 4b) (see Note 9). 6. Embryo incubation and hatch: Transfer the injected embryos to an incubator set to 37.5 °C with 60 % humidity and a 60 min turning interval. For the final hatching stage (day 18–21), place the eggs in a hatch basket in an incubator set at 37.0 °C, 60 % humidity until hatch.

4

Notes 1. Seed the appropriate number of cells so that the confluency of the culture is 50–70 % at the time of transduction on the next day. The number of cells to be seeded will vary depending on the cell type used, as there are differences in cell size and morphology. The number of cells to seed should be determined prior to initiating the transduction. 2. Gently tilt the plate back and forth 2–3 times to make sure all the cells are covered by the transduction solution. Reduced amounts of medium may increase the transduction efficiency, but the amount of medium should be a level sufficient to cover the cells. There may be evaporation that may occur in the middle of the wells at the end of incubation. The incubation should be no more than 24 h. 3. One week after transduction, a few colonies with irregular shapes and fibroblast-like cells on the MEF feeders are typically observed. These cells are likely partially reprogrammed cells (Fig. 1b). iPSC-like colonies with 3-D shape are first observed around 2 weeks post-transduction, but optimal isolation is at 3 weeks after transduction (Fig. 1c). Morphologically, these cells

98

Yangqing Lu et al.

are highly reflective and have a high nuclear to cytoplasm ratio and prominent nucleoli (Fig. 1c arrow inset). 4. Spontaneous differentiation is often seen in the feeder free culture (Fig. 1d). Manual isolation of the iPSC-like colonies helps to maintain the pluripotent characteristics of the quail iPSC. 5. Be very gentle when washing the cells to prevent undesired cell detachment. Use of PBS++, instead of PBS−−, can significantly increase the cell adherence. 6. To further assess differentiation by immunocytochemistry, the recovered EBs should be replated on 4-chamber slides in 20 % KSR media without bFGF, and allowed to further differentiate for 2 days and then fixed for immunostaining. 7. To facilitate the tracking of the cells in embryos, derive a GFP+ quail iPSC line by using a GFP lentiviral vector. This was accomplished by following the transduction protocol used in iPSC derivation. A pure population of GFP positive cells was obtained by FACS sorting. 8. Since the chicken embryo at stage X is very delicate, a smaller window (