Bacterial Transcriptional Control: Methods and Protocols [1 ed.] 1493923919, 9781493923915

Citation preview

Methods in Molecular Biology 1276

Irina Artsimovitch Thomas J. Santangelo Editors

Bacterial Transcriptional Control Methods and Protocols

METHODS

IN

M O L E C U L A R B I O LO G Y

Series Editor John M. Walker School of Life and Medical Sciences University of Hertfordshire Hatfield, Hertfordshire, AL10 9AB, UK

For further volumes: http://www.springer.com/series/7651

Bacterial Transcriptional Control Methods and Protocols

Edited by

Irina Artsimovitch Department of Microbiology, The Ohio State University, Columbus, OH, USA

Thomas J. Santangelo Department of Biochemistry and Molecular Biology, Colorado State University, Fort Collins, CO, USA

Editors Irina Artsimovitch Department of Microbiology The Ohio State University Columbus, OH, USA

Thomas J. Santangelo Department of Biochemistry and Molecular Biology Colorado State University Fort Collins, CO, USA

ISSN 1064-3745 ISSN 1940-6029 (electronic) Methods in Molecular Biology ISBN 978-1-4939-2391-5 ISBN 978-1-4939-2392-2 (eBook) DOI 10.1007/978-1-4939-2392-2 Library of Congress Control Number: 2015931214 Springer New York Heidelberg Dordrecht London © Springer Science+Business Media New York 2015 This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, express or implied, with respect to the material contained herein or for any errors or omissions that may have been made. Printed on acid-free paper Humana Press is a brand of Springer Springer Science+Business Media LLC New York is part of Springer Science+Business Media (www.springer.com)

Preface Cellular multisubunit RNA polymerases are essential for all extant life, share a common ancestry, and utilize similar mechanisms to regulate their biochemical activities, molecular movements, and recruitment to specific loci that is critical to timely and accurate gene expression. This book is designed to provide a resource of proven techniques and approaches to probe the activities of bacterial, eukaryotic, and archaeal RNA polymerases. The volume is by no means an all-inclusive collection of techniques available to the field; instead, we intended to highlight the breadth and depth of techniques that are likely to continue to shape the transcription community in the future. We have collected a multitude of in vitro and in vivo technologies that permit researchers to purify and probe the position and stability of RNA polymerase complexes on different templates and at different points of the transcription cycle, analyze the various translocations and intermolecular movements associated with catalysis, define recruitment strategies, probe the binding and roles of transcription factors in each stage of the transcription cycle, highlight conserved and disparate fidelity mechanisms, analyze the resultant transcripts, and study coordination of the nascent mRNA synthesis by the RNA polymerase and mRNA translation by the ribosome. This book contains domain- and species-specific assays; however, most procedures and methods can be easily modified to study the commonalities and important differences that RNA polymerases within and from each domain present. The rapidly emerging structural information on RNA polymerases—alone, and in combination with DNA templates, nascent transcripts, and complexed with conserved transcription factors—highlights the conserved core structure of the enzyme and permits evaluation of evolutionary differences in phenotypes and biochemical activities observed using the methodologies described in this book. We would like to thank all of the contributing authors for their contributions that were essential to putting together this collection of excellent protocols. Columbus, OH, USA Fort Collins, CO, USA

Irina Artsimovitch Thomas J. Santangelo

v

Contents Preface. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Contributors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 Mapping the Escherichia coli Transcription Elongation Complex with Exonuclease III . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Zhaokun Liu and Irina Artsimovitch 2 Purification of Bacterial RNA Polymerase: Tools and Protocols . . . . . . . . . . . . Vladimir Svetlov and Irina Artsimovitch 3 Monitoring Translocation of Multisubunit RNA Polymerase Along the DNA with Fluorescent Base Analogues . . . . . . . . . . . . . . . . . . . . . . Anssi M. Malinen, Matti Turtola, and Georgiy A. Belogurov 4 In Vitro and In Vivo Methodologies for Studying the Sigma 54-Dependent Transcription . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Martin Buck, Christoph Engl, Nicolas Joly, Goran Jovanovic, Milija Jovanovic, Edward Lawton, Christopher McDonald, Jörg Schumacher, Christopher Waite, and Nan Zhang 5 Methods for the Assembly and Analysis of In Vitro Transcription-Coupled-to-Translation Systems . . . . . . . . . . . . . . . . . . . . . . . . Daniel Castro-Roa and Nikolay Zenkin 6 Site-Specific Incorporation of Probes into RNA Polymerase by Unnatural-Amino-Acid Mutagenesis and Staudinger–Bertozzi Ligation . . . . . Anirban Chakraborty, Abhishek Mazumder, Miaoxin Lin, Adam Hasemeyer, Qumiao Xu, Dongye Wang, Yon W. Ebright, and Richard H. Ebright 7 Reconstitution of Factor-Dependent, Promoter Proximal Pausing in Drosophila Nuclear Extracts. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Jian Li and David S. Gilmour 8 Direct Competition Assay for Transcription Fidelity . . . . . . . . . . . . . . . . . . . . Lucyna Lubkowska and Maria L. Kireeva 9 Single-Stranded DNA Aptamers for Functional Probing of Bacterial RNA Polymerase. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Danil Pupov and Andrey Kulbachinskiy 10 Biochemical Analysis of Transcription Termination by RNA Polymerase III from Yeast Saccharomyces cerevisiae . . . . . . . . . . . . . . . Aneeshkumar G. Arimbasseri and Richard J. Maraia 11 Use of RNA Polymerase Molecular Beacon Assay to Measure RNA Polymerase Interactions with Model Promoter Fragments . . . . . . . . . . . Vladimir Mekler and Konstantin Severinov

vii

v ix 1 13

31

53

81

101

133 153

165

185

199

viii

Contents

12 Preparation of cDNA Libraries for High-Throughput RNA Sequencing Analysis of RNA 5′ Ends . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Irina O. Vvedenskaya, Seth R. Goldman, and Bryce E. Nickels 13 In Situ Footprinting of E. coli Transcription Elongation Complex with Chloroacetaldehyde . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A. Rachid Rahmouni and Christine Mosrin-Huaman 14 Using Solutes and Kinetics to Probe Large Conformational Changes in the Steps of Transcription Initiation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Emily F. Ruff, Wayne S. Kontur, and M. Thomas Record Jr. 15 Manipulating Archaeal Systems to Permit Analyses of Transcription Elongation-Termination Decisions In Vitro. . . . . . . . . . . . . . . . . . . . . . . . . . . Alexandra M. Gehring and Thomas J. Santangelo 16 Purification of Active RNA Polymerase I from Yeast . . . . . . . . . . . . . . . . . . . . Francis Dean Appling and David Alan Schneider 17 Transcription in Archaea: Preparation of Methanocaldococcus jannaschii Transcription Machinery . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Katherine Smollett, Fabian Blombach, and Finn Werner 18 Transcription in Archaea: In Vitro Transcription Assays for mjRNAP . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Katherine Smollett, Fabian Blombach, and Finn Werner 19 Experimental Analysis of hFACT Action During Pol II Transcription In Vitro . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Fu-Kai Hsieh, Olga I. Kulaeva, and Vasily M. Studitsky 20 ChIP-Seq for Genome-Scale Analysis of Bacterial DNA-Binding Proteins . . . . Richard P. Bonocora and Joseph T. Wade Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

211

229

241

263 281

291

305

315 327 341

Contributors FRANCIS DEAN APPLING • Department of Biochemistry and Molecular Genetics, University of Alabama at Birmingham, Birmingham, AL, USA ANEESHKUMAR G. ARIMBASSERI • Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD, USA IRINA ARTSIMOVITCH • Department of Microbiology, The Center for RNA Biology, The Ohio State University, Columbus, OH, USA GEORGIY A. BELOGUROV • Department of Biochemistry, University of Turku, Turku, Finland FABIAN BLOMBACH • Institute of Structural and Molecular Biology, University College London, London, UK RICHARD P. BONOCORA • Division of Genetics, Wadsworth Center, New York State Department of Health, Albany, NY, USA MARTIN BUCK • Department of Life Sciences, Imperial College London, London, UK DANIEL CASTRO-ROA • Centre for Bacterial Cell Biology, Institute for Cell and Molecular Biosciences, Newcastle University, Newcastle upon Tyne, UK ANIRBAN CHAKRABORTY • Waksman Institute and Department of Chemistry and Chemical Biology, Rutgers University, Piscataway, NJ, USA RICHARD H. EBRIGHT • Waksman Institute and Department of Chemistry and Chemical Biology, Rutgers University, Piscataway, NJ, USA YON W. EBRIGHT • Waksman Institute and Department of Chemistry and Chemical Biology, Rutgers University, Piscataway, NJ, USA CHRISTOPH ENGL • Department of Life Sciences, Imperial College London, London, UK ALEXANDRA M. GEHRING • Department of Biochemistry and Molecular Biology, Colorado State University, Fort Collins, CO, USA DAVID S. GILMOUR • Department of Biochemistry and Molecular Biology, Center for Eukaryotic Gene Regulation, Pennsylvania State University, University Park, PA, USA SETH R. GOLDMAN • Department of Genetics, Waksman Institute of Microbiology, Rutgers University, Piscataway, NJ, USA ADAM HASEMEYER • Waksman Institute and Department of Chemistry and Chemical Biology, Rutgers University, Piscataway, NJ, USA FU-KAI HSIEH • Department of Pharmacology, Rutgers University-Robert Wood Johnson Medical School, Piscataway, NJ, USA; Department of Molecular Biology, Harvard Medical School, Massachusetts General Hospital, Boston, MA, USA NICOLAS JOLY • Equipe Nanomanipulation de biomolecules, Institut Jacques Monod, Universite Paris, Paris, France GORAN JOVANOVIC • Department of Life Sciences, Imperial College London, London, UK MILIJA JOVANOVIC • Department of Life Sciences, Imperial College London, London, UK MARIA L. KIREEVA • NCI Center for Cancer Research, Frederick, MD, USA WAYNE S. KONTUR • Department of Bacteriology, University of Wisconsin-Madison, Madison, WI, USA OLGA I. KULAEVA • Lomonosov Moscow State University, Moscow, Russia ANDREY KULBACHINSKIY • Institute of Molecular Genetics, Russian Academy of Sciences, Moscow, Russia

ix

x

Contributors

EDWARD LAWTON • Department of Life Sciences, Imperial College London, London, UK JIAN LI • Department of Molecular Biosciences, Northwestern University, Evanston, IL, USA; Department of Biochemistry and Molecular Biology, Center for Eukaryotic Gene Regulation, Pennsylvania State University, University Park, PA, USA MIAOXIN LIN • Waksman Institute and Department of Chemistry and Chemical Biology, Rutgers University, Piscataway, NJ, USA ZHAOKUN LIU • Department of Microbiology, The Center for RNA Biology, The Ohio State University, Columbus, OH, USA LUCYNA LUBKOWSKA • NCI Center for Cancer Research, Frederick, MD, USA ANSSI M. MALINEN • Department of Biochemistry, University of Turku, Turku, Finland RICHARD J. MARAIA • Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD, USA ABHISHEK MAZUMDER • Waksman Institute and Department of Chemistry and Chemical Biology, Rutgers University, Piscataway, NJ, USA CHRISTOPHER MCDONALD • Department of Life Sciences, Imperial College London, London, UK VLADIMIR MEKLER • Waksman Institute of Microbiology, Rutgers University, Piscataway, NJ, USA CHRISTINE MOSRIN-HUAMAN • Centre de Biophysique Moléculaire, Centre National de la Recherche Scientifique, Orléans, France BRYCE E. NICKELS • Department of Genetics and Waksman Institute, Rutgers University, Piscataway, NJ, USA DANIL PUPOV • Institute of Molecular Genetics, Russian Academy of Sciences, Moscow, Russia A. RACHID RAHMOUNI • Centre de Biophysique Moléculaire, Centre National de la Recherche Scientifique, Orléans, France M. THOMAS RECORD JR • Department of Chemistry, University of Wisconsin-Madison, Madison, WI, USA; Department of Biochemistry, University of Wisconsin-Madison, Madison, WI, USA EMILY F. RUFF • Department of Chemistry, University of Wisconsin-Madison, Madison, WI, USA THOMAS J. SANTANGELO • Department of Biochemistry and Molecular Biology, Colorado State University, Fort Collins, CO, USA DAVID ALAN SCHNEIDER • Department of Biochemistry and Molecular Genetics, University of Alabama at Birmingham, Birmingham, AL, USA JÖRG SCHUMACHER • Department of Life Sciences, Imperial College London, London, UK KONSTANTIN SEVERINOV • Waksman Institute of Microbiology, Rutgers University, Piscataway, NJ, USA; Russian Academy of Sciences, Institutes of Gene Biology and Molecular Genetics, Moscow, Russia; Skolkovo Institute of Science and Technology, Skolkovo, Russia KATHERINE SMOLLETT • Institute of Structural and Molecular Biology, University College London, London, UK VASILY M. STUDITSKY • Department of Pharmacology, Rutgers University-Robert Wood Johnson Medical School, Piscataway, NJ, USA; Biology Faculty, Lomonosov Moscow State University, Moscow, Russia; Cancer Epigenetics Program, Fox Chase Cancer Center, Philadelphia, PA, USA VLADIMIR SVETLOV • Department of Biochemistry and Molecular Pharmacology, New York University School of Medicine, New York, NY, USA MATTI TURTOLA • Department of Biochemistry, University of Turku, Turku, Finland

Contributors

xi

IRINA O. VVEDENSKAYA • Department of Genetics, Waksman Institute of Microbiology, Rutgers University, Piscataway, NJ, USA JOSEPH T. WADE • Division of Genetics, Wadsworth Center, New York State Department of Health, Albany, NY, USA; Department of Biomedical Sciences, Wadsworth Center, New York State Department of Health, Albany, NY, USA; Department of Biomedical Sciences, University at Albany, Albany, NY, USA CHRISTOPHER WAITE • Department of Life Sciences, Imperial College London, London, UK DONGYE WANG • Waksman Institute and Department of Chemistry and Chemical Biology, Rutgers University, Piscataway, NJ, USA FINN WERNER • Institute of Structural and Molecular Biology, University College London, London, UK QUMIAO XU • Waksman Institute and Department of Chemistry and Chemical Biology, Rutgers University, Piscataway, NJ, USA NIKOLAY ZENKIN • Centre for Bacterial Cell Biology, Institute for Cell and Molecular Biosciences, Newcastle University, Newcastle upon Tyne, UK NAN ZHANG • Department of Life Sciences, Imperial College London, London, UK

Chapter 1 Mapping the Escherichia coli Transcription Elongation Complex with Exonuclease III Zhaokun Liu and Irina Artsimovitch Abstract RNA polymerase interactions with the nucleic acids control every step of the transcription cycle. These contacts mediate RNA polymerase recruitment to promoters, induce pausing during RNA chain synthesis, and control transcription termination. These interactions are dissected using footprinting assays, in which a bound protein protects nucleic acids from the digestion by nucleases or modification by chemical probes. Exonuclease III is frequently employed to study protein–DNA interactions owing to relatively simple procedures and low background. Exonuclease III has been used to determine RNA polymerase position in transcription initiation and elongation complexes and to infer the translocation register of the enzyme. In this chapter, we describe probing the location and the conformation of transcription elongation complexes formed by walking of the RNA polymerase along an immobilized template. Key words Transcription, RNA polymerase, Footprinting, Translocation

1

Introduction Footprinting (FP) techniques have been widely employed in studies of protein–nucleic acid interactions and nucleic acid structures. The basic concept is that protein binding or formation of a secondary structure will protect an affected nucleic acid region from attack by a protein nuclease or a chemical probe, generating a footprint. Exonuclease III (Exo III) is one of the most frequently employed enzymes to probe protein interactions with the doublestranded DNA. Exo III catalyzes the processive removal of the mononucleotides from the 3′-hydroxyl termini of duplex DNA [1]. The free DNA is fully digested by Exo III, eliminating potential background problems caused by the presence of unbound DNA molecules. This is especially important when the protein binding to its DNA target does not proceed to saturation [2]. When a protein binds to the DNA, the advance of Exo III is blocked. The lengths of the resultant DNA fragments indicate the boundaries of the DNA region protected by the protein of interest.

Irina Artsimovitch and Thomas J. Santangelo (eds.), Bacterial Transcriptional Control: Methods and Protocols, Methods in Molecular Biology, vol. 1276, DOI 10.1007/978-1-4939-2392-2_1, © Springer Science+Business Media New York 2015

1

2

Zhaokun Liu and Irina Artsimovitch

If one of the DNA strands is labeled (radioactively or fluorescently), the protected region can be visualized after electrophoresis in a denaturing sequencing gel. The RNA synthesis by the DNA-dependent RNA polymerase (RNAP) is a crucial step in the flow of genetic information. Among the transcription systems, the one mediated by the Escherichia coli RNAP has been most thoroughly studied. The precise control of the RNAP location along the DNA is essential for the proper regulation of every step of transcription and may contribute to RNA folding and protein synthesis. In some instances, it is imperative to map RNAP location on DNA template with a single nucleotide precision as well as to monitor changes in its conformation. Exo III FP has been broadly applied to analyze diverse E. coli transcription complexes. Straney and Crothers carried out Exo III FP to study the conformation of promoter complexes during transcription initiation [3]. Heumann and colleagues first observed a dramatic reduction of the RNAP-protected region upon transition from initiation to elongation, whereas the RNAP conformation appeared to remain largely constant during elongation [4]. Interestingly, the authors found that Exo III performed better in mapping the upstream boundary of the RNAP footprint than the downstream one. In the 1990s, several groundbreaking insights into the mechanism of transcription can be attributed in part to the Exo III FP. During mapping of transcription elongation complexes (TECs) halted at different positions along the template, Goldfarb and Landick groups observed RNAP footprints of different sizes, suggesting that the enzyme advances discontinuously when approaching a pause or a termination signal [5, 6]. Subsequent studies demonstrated that these apparently non-monotonous movements were due to different propensities of RNAP to backtrack along the nucleic acid chains [7, 8], a movement that can be favored by the processive action of Exo III advancing from the downstream direction, emphasizing the importance of the experimental conditions [7]. Exo III FP can also be applied to visualize other conformational changes in transcription complexes. For example, Kulbachinskiy and colleagues observed “scrunching” during σ-induced pausing, wherein the upstream protection boundary remained unchanged while the downstream protection boundary advanced upon addition of nucleotides to the nascent RNA [9]. Finally, Exo III is sufficiently precise to study subtle movements of the enzyme, such as between a pre-translocation and a post-translocation states of RNAP in the course of a nucleotide addition cycle [10, 11], and to elucidate the molecular mechanisms of RNAP inhibitors that affect the RNAP translocation [12, 13]. Besides the characterization of bacterial RNAP, Exo III FP has been used in studies of RNAP from other domains of life [14, 15]. The technique of immobilizing TECs is crucial to the studies of transcript elongation as it allows stepwise synchronized movements

Exo III Footprinting of Elongation Complexes

3

of RNAP along the DNA until the RNAP reaches a chosen position. DNA or RNAP is first immobilized on a suitable resin (the nickel– histidine and streptavidin–biotin interactions are most frequently employed, but other approaches can also be used). Following the formation of a stable halted TEC, the resin is washed extensively to remove the unincorporated NTPs, and a subset of NTPs required to advance the RNAP to the next position, in single- or multiplenucleotide steps dictated by the DNA template sequence, is added [16]. Selected TECs can be analyzed by a method of choice, including Exo III FP to monitor the RNAP position and evaluate changes in its conformation. Simultaneously, the position of the RNAP active site is monitored by labeling the nascent RNA [7, 17]. In this chapter, we describe a protocol for using Exo III to map the E. coli RNAP walked through a short regulatory sequence on an immobilized template.

2

Materials This section lists proteins, reagents, buffers, and equipment necessary for these experiments. In some cases, as noted, the source of the reagent is critical; in most, many commercial sources should prove adequate even though we did not test them.

2.1

Supplies

1. 1.7 mL siliconized microcentrifuge tubes. 2. PCR purification kit. We use QIAquick PCR purification kit (Qiagen) and while other kits should also be suitable, templates purified by kits from some suppliers (e.g., Promega) inhibit in vitro transcription reactions with E. coli RNAP. 3. G-50 spin columns. We use Illustra MicroSpin (GE Healthcare). 4. A standard kit for DNA sequencing. We use SequiTherm II Excel kit (Epicentre). 5. Low retention, sterile, RNase/DNase free micropipette tips. 6. Magnetic streptavidin-coated resin. We use Invitrogen Dynabeads M-280.

2.2

Nucleotides

1. FPLC-purified rNTPs (we use rNTPs from GE Healthcare; see Note 1). 2. Adenylyl (3′–5′) uridine (ApU) RNA dinucleotide (see Note 2). 3.

32

P labeled nucleotides.

4. dNTPs. 5. DNA oligonucleotides for template preparation. 2.3

Proteins

1. T4 polynucleotide kinase supplied with 10× buffer. 2. Taq DNA polymerase supplied with 10× buffer.

4

Zhaokun Liu and Irina Artsimovitch

3. RNAP core enzyme and σ factor purified as in [18]; see also Chapter 2. 4. Exonuclease III. 2.4 Transcription and Footprinting Solutions 2.4.1 Stock Solutions

Solutions are treated with DEPC (solutions 1–4) or prepared with DEPC-treated ultrapure H2O (resistivity of 18.2 MΩ, Milli-Q); (solutions 5–7), unless otherwise indicated, and filtered through a 0.45 μm filter. Following DEPC treatment (0.1 %, 1 mL/L solution) overnight with stirring, autoclave the solution (for solutions 1–4 only, to remove traces of DEPC) and store at room temperature. 1. 1 M Tris–HCl (pH 7.9). 2. 1 M KCl. 3. 4 M NaCl. 4. 1 M MgCl2. 5. 2 M Tris-acetate (pH 8.0). 6. 2 M Na acetate. 7. 1 M Mg acetate. 8. 1 mg/mL heparin. 9. 0.5 M EDTA: Weigh 93.06 g EDTA disodium salt dihydrate, add 350 mL DEPC-treated H2O and NaOH pellets. When the solution pH is close to 8.0 and all EDTA is dissolved, adjust pH with 10 M NaOH solution to pH 8, filter. 10. 10× TBE: Weigh 216 g Trizma base, 110 g boric acid, dissolve in 1,750 mL ultrapure H2O, add 80 mL 0.5 M EDTA, adjust the final volume to 2 L, filter. 11. 1 M DTT: Weigh 1.5425 g DTT; dissolve in 10 mL ultrapure H2O, filter through a syringe microfilter (0.22 μm), aliquot 100 μL/tube, and freeze at −20oC.

2.4.2 Working Solutions

The buffers and water for in vitro transcription are prepared with DEPC-treated ultrapure H2O. All pipette tips, falcon tubes, and microcentrifuge tubes used in buffer preparation and in vitro transcription are RNase-free. The RNAP storage buffer, 10× TGA2 buffer and 2× stop buffer are aliquoted and stored at −20 °C. The wash buffers are stored at 4 °C. 1. RNAP storage buffer: 10 mM Tris–HCl (pH 7.9), 100 mM NaCl, 1 mM DTT, 0.1 mM EDTA, 50 % glycerol. 2. 10× TGA2: 200 mM Tris-acetate (pH 8.0), 200 mM Na acetate, 20 mM Mg acetate, 140 mM β-ME, 1 mM EDTA, 50 % glycerol. 3. High-salt wash buffer: 500 mM KCl, 5 mM MgCl2, 50 mM Tris–HCl (pH 7.9), 1 mM β-ME. 4. Low-salt wash buffer: 20 mM KCl, 5 mM MgCl2, 50 mM Tris–HCl (pH 7.9), 1 mM β-ME.

Exo III Footprinting of Elongation Complexes

5

5. 2× stop buffer: 24 g urea, 20 mL H2O, 0.1 g bromophenol blue, 0.1 g xylene cyanol, 100 μL 0.5 M EDTA, 5 mL 10× TBE buffer. Heat at 65 °C to dissolve the urea. Heat for 15 min at 65 °C before use. 2.5 Gel Electrophoresis

We prepare two stock acrylamide solutions, 15 and 0 %, to pour denaturing gels ranging from 4 to 15 %. Above 15 %, gels are difficult to dry. We store the stock solutions at 4 °C for up to 3 months and mix them at the desired ratio just before use (see Note 3). 1. To make 0 % solution, weigh 420.42 g urea and slowly add it to 500 mL ultrapure H2O on a magnetic stirrer hot plate. Stir at 65 °C until urea is dissolved. Adjust the volume to 1 L with H2O. Add 12 g TMD-8 mixed bed resin hydrogen and hydroxide form (we purchase it from Sigma) and continue stirring for 30 min. Filter through a bottle top filter (0.45 μm) and degas using a vacuum pump for at least 30 min. Store at 4 °C (see Note 4). 2. Prepare 15 % solution as above, substituting 500 mL 30 % (w/v) acrylamide–bis-acrylamide (19:1) for 500 mL ultrapure H2O. 3. N,N,N′,N′-Tetramethylethylenediamine (TEMED). 4. Ammonium persulfate: prepare 10 % (w/v) solution in H2O. Aliquot 200 μL/tube, store at −20 °C.

2.6

Equipment

1. Plastic pipettes and micropipettes of various volumes. 2. Tabletop centrifuge. 3. PCR cycler. 4. Heating blocks set at 37, 90, and 65 °C (optional); (see Note 5). 5. Hot plate/stirrer. 6. Vacuum pump. 7. Vertical gel electrophoresis system and power supply. 8. Matching sets of glass plates and spacers (see Note 6). 9. Gel dryer. 10. Phosphor screen and cassette. 11. Phosphorimaging system (we use FLA 9000; GE Healthcare).

3

Methods

3.1 Preparation of Transcription Templates

The DNA template is generated by PCR amplification of an appropriate plasmid using two oligonucleotides, one of which is 5′ labeled with biotin for immobilization and the other—with [32P] phosphate for visualization. Primers can be obtained from many

6

Zhaokun Liu and Irina Artsimovitch

Fig. 1 The linear template for in vitro transcription. A schematic representation of a linear template pIA349 with a T7A1 promoter, the transcription start site (red arrow, +1) and a U-less transcribed region (+3 to +37; gray) followed by the ops element (underlined). The TEC halted at G37 is formed as described in Subheading 3.3. By adding subsets of NTPs (shaded in different colors), the RNAP is walked to G40, G42, and U43 positions

sources; standard desalting is sufficient. In the experiment described here, we used pIA349 vector [19] that encodes a T7A1 promoter followed by a U-less initial transcribed region and an ops pause signal (see Fig. 1). In this chapter, we use a 211 bp template (transcribed region 119 bp) for the FP assay (see Note 7). The template was generated with two primers: Top: 5′-GGAGAGACAACTTAAAGAGACT-3′. Bottom: 5′-CCACCATCATCACCATCATCCT-3′. The choice of primer labeling is dictated by the identity of the strand probed. 3.1.1 Radiolabeling Primer

1. Mix 2 μL, 100 μM primer with 2 μL H2O, 1.5 μL T4 polynucleotide kinase, 1.5 μL 10× T4 polynucleotide kinase buffer and 8 μL [γ-32P]ATP (10 mCi/mL, 6,000 Ci/mmol). 2. Incubate for 45 min at 37 °C. 3. Terminate the labeling reaction by heating for 3 min at 95 °C. 4. Add 10 μL H2O to the mixture in order to fit the minimum loading volume of G-50 column (see Note 8). 5. Prepare the G-50 column by gently vortexing it and centrifugation at 735 × g for 1 min. 6. Place the column into a new microcentrifuge tube. 7. Load the sample onto the column and elute the DNA by centrifugation at 735 × g for 2 min.

3.1.2 PCR Amplification

1. Assemble a reaction mixture from the following components: ●

H2O to 200 μL.

●

2 μL biotin labeled primer (100 μM).

●

All of the radiolabeled primer (about 30 μL) prepared in Subheading 3.1.1.

●

20 μL 10× Taq polymerase standard buffer.

●

16 μL dNTP mix (2.5 mM of each dNTP).

●

2 μL pIA349 vector (10 ng/μL).

●

1 μL Taq DNA polymerase (5 U/μL).

Exo III Footprinting of Elongation Complexes

7

2. Amplify using a standard cycle, e.g., ●

Initial incubation at 94 °C for 2 min.

●

30 cycles: 10 s at 94 °C, 10 s at 58 °C, 10 s at 72 °C.

●

Final extension: 2 min at 72 °C.

3. Purify the PCR product using a kit. 4. Measure the DNA concentration on a 1 % agarose gel (see Note 9). 3.2 Immobilization of the DNA Template

1. For a 100 μL reaction with about 60 nM DNA template, 15 μL of magnetic streptavidin-coated beads is required (see Note 10). 2. Place the tube on the magnetic particle separator to pellet beads and remove the supernatant (usually, 20–40 s is enough to separate the supernatant from the beads). 3. Wash the beads with 200 μL H2O; repeat at least twice. 4. Wash the beads with 200 μL 1× TGA buffer; repeat three times. 5. Resuspend the washed beads in 100 μL of 1× TGA buffer. 6. Add DNA template and mix with the beads. Incubate for 25–30 min at 37 °C. Every 5 min, resuspend the mixture to prevent the beads from settling at the bottom of tubes. 7. Wash the beads with 200 μL 1× TGA buffer three times. Estimate the DNA concentration using Geiger counter (see Note 11).

3.3 The Formation of the Halted TEC

The analysis of post-initiation events in transcription requires the synchronization of TECs—if initiated from a promoter, RNAP molecules will move along the DNA template at different rates. The TECs are synchronized by halting the elongating RNAP 20 nts or further downstream from the promoter, which is achieved by omitting one or more NTPs from the starting reaction, as determined by the initial transcribed region. In the template used here, a 37 nts long RNA can be synthesized if transcription is initiated with the ApU primer in the absence of UTP. 1. Assemble a 100 μL reaction mixture from the following components: ● H2O to 100 μL. ●

●

●

●

●

10 μL 10× TGA2 buffer. 10 μL 10× initiation NTP mixture (25 μM ATP and GTP, 10 μM CTP) (see Note 12). 1.5 μL 10 mM ApU. 3 μL RNAP holoenzyme (if using 4 μM stock; the volume depends on the activity of the RNAP preparation, which is usually 50–70 %). If transcription product at each step is to be observed, add 1.5 μL [α-32P]CTP (3,000 Ci/mmol).

8

Zhaokun Liu and Irina Artsimovitch

2. Incubate for 15 min at 37 °C (see Note 13). 3. Add heparin to 15 μg/mL and incubate for 3 min at 37 °C (see Note 14). 3.4 Stepwise Walking of Immobilized TECs

1. After forming the halted TEC, remove the aliquots for Exo III FP. Usually, 10–15 μL aliquot from the aforementioned mixture is adequate for one FP reaction. 2. Place the magnetic particle separator on ice and the tubes containing the halted TEC on the separator; remove the supernatant completely without disturbing the beads. 3. Resuspend the beads in 300 μL of high-salt wash buffer, wait for all beads to pellet, and remove the supernatant. Repeat three times. 4. Wash the beads with 300 μL low-salt wash buffer as above. Repeat three times. 5. Resuspend the beads in NTP mixture (10 μM of each NTP required in the next step, e.g., in the first step, from G37 to G40, the mixture is ATP/GTP/UTP; NTPs are diluted in 1× TGA2 buffer). 6. Incubate for 2 min at 37 °C to allow for nucleotide incorporation. 7. Repeat steps 1–6 for the next walking step.

3.5

Exo III Digestion

1. Add 100 U of Exo III to each TEC sample. Mix thoroughly and incubate at 37 °C. 2. Remove aliquots after 0 (before adding Exo III), 30, 60, and 90 s (see Note 15). 3. Quench the reaction by adding an equal volume of 2× stop buffer.

3.6

Electrophoresis

1. Assemble the gel cassette using two side spacers and a strip of Whatman filter paper as a bottom spacer (see Note 16). Clamp the plates tightly to ensure watertightness. To make a 45 cm 6 % polyacrylamide sequencing gel, mix 31 mL of 15 % gel solution and 40 mL of 0 % gel solution. Add 3.75 mL of 10× TBE (to the final 0.5× concentration), 200 μL 10 % ammonium persulfate, and 40 μL TEMED. Mix well. 2. Slightly raise one side of the gel cassette; slowly load the mixture into the cassette with a syringe (without needle). Insert the comb and cover the gel with plastic wrap. 3. Allow 1 h for polymerization, attach the cassette to the vertical electrophoresis system. If the system is not equipped with an aluminum plate, attach one to the cassette to allow for uniform heat distribution. Remove the comb and wash the wells with 0.5× TBE immediately.

Exo III Footprinting of Elongation Complexes

9

4. Preheat the gel to 55 °C by running in 0.5× TBE at 130 W (~2,750 V) for 30 min. 5. Heat the samples for 2 min at 95 °C, then centrifuge for 1 min at top speed. 6. Wash the wells again and load the samples on the sequencing gel along with DNA sequencing ladders (see Notes 17 and 18). 7. Run the gel at 120 W for 10 min, increase the power to 130 W, and run for about 1 h (see Note 19). 8. After electrophoresis, separate the gel plates, transfer the gel to Whatman filter paper, and cover it with plastic wrap. 9. Dry the gel on a gel dryer for 1 h. 10. Expose the gel to a phosphor screen overnight. 11. Visualize the footprints with phosphor imaging system and analyze the data with chosen software; we use ImageQuant 5.0 (Molecular Dynamics). A representative result is shown in Fig. 2.

4

Notes 1. In our hands, FPLC-purified NTPs from GE Healthcare (formerly Pharmacia) work best for step-wise walking of RNAP. 2. Although RNAP can initiate using single NTPs, their Km values are relatively high. Using a dinucleotide primer allows one to initiate transcription at low [NTPs], a condition essential for limiting readthrough during formation of a halted TEC. 3. The gel for footprinting should be made freshly (less than 24 h) before electrophoresis. 4. We find that de-ionizing and degassing the gel solutions improve the footprint resolution. 5. We prefer using heating blocks (e.g., filled with sand) with radiolabeled samples over a water bath. 6. To facilitate the separation of the plates after electrophoresis, the shorter plate may be siliconized after 15–20 electrophoreses. 7. When designing a template, it is imperative to predict the region of protection. DNA fragments shorter than 100 nucleotides provide the best resolution. 8. Based on our experience, the minimum loading volume of G-50 column is 25 μL, not the 12 μL recommended by the manufacturer. 9. To measure the concentration of the radiolabeled template, several dilutions of an unlabeled PCR product at a known concentration are loaded on an agarose gel alongside the radiolabeled product, stained with an intercalating dye, visualized, and analyzed by densitometry.

10

Zhaokun Liu and Irina Artsimovitch

Fig. 2 Exo III footprints of halted TECs. (Top) Schematic of the RNAP (a gray oval) walking along the template, in which the bottom (template) strand is radiolabeled. The RNAP active center (indicated by small white circles) denotes the position of the last added nucleotide. (Bottom) Exo III FP analysis of the halted TEC carried out as described in Subheading 3.5. Samples were loaded alongside a pBR322 DNA digested with MspI and radiolabeled with [γ-32P]ATP using T4 polynucleotide kinase (M); the fragment lengths are shown. The dashed lines indicate the rear edge of the RNAP in the corresponding TEC. The black triangles point to two representative nonspecific blocks to Exo III digestion

10. Although the 15 μL beads in 100 μL of 60 nM DNA far exceeds the volume recommended by the manufacturer, we found that this amount is the minimum for this assay (three walking cycles) because of the beads loss during washing. The more washing cycles, the larger starting volume of beads is required. 11. The binding efficiency is far less than 100 %, between 33 and 60 % in our hands.

Exo III Footprinting of Elongation Complexes

11

12. The 10× initiation NTP mixture should be frozen at −20 °C in single-use aliquots. The CTP is subject to deamination and the resultant trace UTP allows RNAP to read thorough the G37 position. This also applies to the “walking” NTP subsets (Subheading 3.4). Using a template that requires a different subset of starting NTPs can alleviate this problem. 13. This time is sufficient for all the active RNAP to form the halted complex. After 15 min, the mixture can be transferred to ice. The halted complex usually retains its activity for at least 3–4 h on ice. 14. The heparin treatment is crucial to eliminate nonspecifically bound RNAP, which will compound the analysis of the footprint patterns. 15. The Exo III amount and digestion time should be carefully adjusted to avoid “pushing” RNAP backwards [7]. 16. Using a paper spacer eliminates the need of removing the bottom spacer and air bubbles that arise in the process. 17. Load the sequencing ladders as close to the sample lanes as possible to minimize the “smiling effect.” Loading several ladder lanes can be helpful. 18. The Exo III activity varies with the sequence. The DNA structure and the identity of nucleotides have been reported to affect the cleavage [20, 21]. A control sample using the same DNA template in the absence of RNAP should be analyzed in parallel to take Exo III specificity into account. 19. 1 h of electrophoresis on a 6 % gel is good for separating DNA fragments between 40 and 110 nucleotides. The electrophoresis time should be adjusted according to the position of the predicted protected region. References 1. Rogers SG, Weiss B (1980) Exonuclease III of Escherichia coli K-12, an AP endonuclease. Methods Enzymol 65:201–211 2. Metzger W, Heumann H (2001) Footprinting with exonuclease III. Methods Mol Biol 148:39–47 3. Straney DC, Crothers DM (1987) Comparison of the open complexes formed by RNA polymerase at the Escherichia coli lac UV5 promoter. J Mol Biol 193:279–292 4. Metzger W, Schickor P, Heumann H (1989) A cinematographic view of Escherichia coli RNA polymerase translocation. EMBO J 8:2745–2754 5. Nudler E, Goldfarb A, Kashlev M (1994) Discontinuous mechanism of transcription elongation. Science 265:793–796

6. Wang D, Meier TI, Chan CL et al (1995) Discontinuous movements of DNA and RNA in RNA polymerase accompany formation of a paused transcription complex. Cell 81:341–350 7. Komissarova N, Kashlev M (1997) RNA polymerase switches between inactivated and activated states by translocating back and forth along the DNA and the RNA. J Biol Chem 272:15329–15338 8. Nudler E, Mustaev A, Lukhtanov E et al (1997) The RNA-DNA hybrid maintains the register of transcription by preventing backtracking of RNA polymerase. Cell 89:33–41 9. Zhilina E, Esyunina D, Brodolin K et al (2012) Structural transitions in the transcription elongation complexes of bacterial RNA polymerase

12

10.

11.

12.

13.

14.

15.

Zhaokun Liu and Irina Artsimovitch during sigma-dependent pausing. Nucleic Acids Res 40:3078–3091 Nedialkov YA, Nudler E, Burton ZF (2012) RNA polymerase stalls in a post-translocated register and can hyper-translocate. Transcription 3:260–269 Bar-Nahum G, Epshtein V, Ruckenstein AE et al (2005) A ratchet mechanism of transcription elongation and its control. Cell 120:183–193 Artsimovitch I, Svetlov V, Nemetski SM et al (2011) Tagetitoxin inhibits RNA polymerase through trapping of the trigger loop. J Biol Chem 286:40395–40400 Temiakov D, Zenkin N, Vassylyeva MN et al (2005) Structural basis of transcription inhibition by antibiotic streptolydigin. Mol Cell 19:655–666 Samkurashvili I, Luse DS (1998) Structural changes in the RNA polymerase II transcription complex during transition from initiation to elongation. Mol Cell Biol 18:5343–5354 Spitalny P, Thomm M (2003) Analysis of the open region and of DNA-protein contacts of archaeal RNA polymerase transcription complexes during transition from initiation to elongation. J Biol Chem 278:30497–30505

16. Kashlev M, Martin E, Polyakov A et al (1993) Histidine-tagged RNA polymerase: dissection of the transcription cycle using immobilized enzyme. Gene 130:9–14 17. Komissarova N, Kashlev M (1997) Transcriptional arrest: Escherichia coli RNA polymerase translocates backward, leaving the 3′ end of the RNA intact and extruded. Proc Natl Acad Sci U S A 94:1755–1760 18. Belogurov GA, Vassylyeva MN, Svetlov V et al (2007) Structural basis for converting a general transcription factor into an operon-specific virulence regulator. Mol Cell 26:117–129 19. Artsimovitch I, Landick R (2002) The transcriptional regulator RfaH stimulates RNA chain synthesis after recruitment to elongation complexes by the exposed nontemplate DNA strand. Cell 109:193–203 20. Richardson CC, Lehman IR, Kornberg A (1964) A deoxyribonucleic acid phosphataseexonuclease from Escherichia Coli. II. Characterization of the exonuclease activity. J Biol Chem 239:251–258 21. Linxweiler W, Horz W (1982) Sequence specificity of exonuclease III from E. coli. Nucleic Acids Res 10:4845–4859

Chapter 2 Purification of Bacterial RNA Polymerase: Tools and Protocols Vladimir Svetlov and Irina Artsimovitch Abstract Bacterial RNA polymerase is the first point of gene expression and a validated target for antibiotics. Studied for several decades, the Escherichia coli transcriptional apparatus is by far the best characterized, with numerous RNA polymerase mutants and auxiliary factors isolated and analyzed in great detail. Since the E. coli enzyme was refractory to crystallization, structural studies have been focused on Thermus RNA polymerases, revealing atomic details of the catalytic center and RNA polymerase interactions with nucleic acids, antibiotics, and regulatory proteins. However, numerous differences between these enzymes, including resistance of Thermus RNA polymerases to some antibiotics, underscored the importance of the E. coli enzyme structures. Three groups published these long awaited structures in 2013, enabling functional and structural studies of the same model system. This progress was made possible, in large part, by the use of multicistronic vectors for expression of the E. coli enzyme in large quantities and in a highly active form. Here we describe the commonly used vectors and procedures for purification of the E. coli RNA polymerase. Key words Transcription, RNA polymerase, Expression, Purification

1

Introduction In bacteria, a single multisubunit RNA polymerase (RNAP) transcribes all genes. The holoenzyme is composed of a (most commonly) α2ββ′ω core, which carries out all types of catalysis but cannot specifically bind to or melt the DNA, and one of σ factors, which recognize distinct promoter elements and facilitate DNA strand separation near the transcription start site. Understanding the regulation of gene expression requires studies of the basic molecular mechanism of RNAP and the ways accessory factors interact with the enzyme during all stages of transcription. Bacterial RNAP is also a validated target for antibiotic therapies, but only two RNAP inhibitors are currently used in clinical practice. Among many methods that have been applied to study transcription, structural analysis is indispensable in providing the

Irina Artsimovitch and Thomas J. Santangelo (eds.), Bacterial Transcriptional Control: Methods and Protocols, Methods in Molecular Biology, vol. 1276, DOI 10.1007/978-1-4939-2392-2_2, © Springer Science+Business Media New York 2015

13

14

Vladimir Svetlov and Irina Artsimovitch

atomic level of detail required for understanding of catalysis and design of antibiotics targeting the transcription apparatus. After the first structure of T. aquaticus RNAP was solved by the Darst lab in 1999 [1], Thermus enzymes became the structural model of choice. Many key features have been characterized using these thermophilic RNAPs, including the active site geometry and conformational transitions during the nucleotide addition cycle [2], RNAP interactions with the nucleic acids in initiation [3] and elongation complexes [4], and binding sites for σ [5], elongation factors [6], and antibiotics [2, 7–9]. However, the gap between the structural analysis and the functional studies of bacterial transcription, carried out predominantly with mesophilic enzymes, was expanding. Thermus enzymes are an excellent model for the dissection of the catalytic mechanism, which is highly conserved among multisubunit RNAPs. In contrast, RNAP regions distant from the active site are quite divergent, and many species-specific insertions are located in the β and β′ subunits [10], complicating sequence alignments. Regulatory strategies and auxiliary factors, which in many cases bind to divergent sites, appear to be quite distinct, with Thermus species lacking many of the accessory proteins characterized in E. coli. Thermus RNAPs are resistant to several inhibitors of the E. coli enzyme, including fidaxomycin, a recently approved by the FDA antibiotic for treatment of Clostridium difficile infections. Finally, even when a ligand binds to both RNAPs, the binding sites could be far apart; for example, the regulator of stringent response ppGpp binds to different sites, and has different effects, on the E. coli and T. thermophilus enzymes [11–13]. Ideally, functional and structural studies should be carried out on the same model system. By obtaining the structure of the E. coli RNAP, the Murakami [14], Steitz [13], and Darst [15] labs have made this possible. This breakthrough will facilitate mechanistic analysis of transcriptional machinery, aid in improvement of existing RNAP inhibitors, and may lead to development of novel antibiotics which are urgently needed to treat all infections, and those caused by Gram-negative pathogens in particular. The success in obtaining these structures came from purification of a recombinant E. coli RNAP core assembled in vivo from co-expressed subunits. The first multicistronic vector (Fig. 1) contained rpoA, rpoB, and rpoC genes (encoding the α, β, and β′ subunits, respectively) expressed from the T7 gene 10 promoter [16]. The wild-type spacer between the rpoB and rpoC genes, which are likely assembled co-translationally in vivo, was maintained and a purification tag was placed at the C-terminus of β′ to purify the complete core, which is assembled in the order of α2 → α2β → α2ββ′. Using this vector, it was possible to purify active RNAP, yet no well-diffracting crystals could be obtained. Surprisingly, a nonessential 91-residue ω subunit proved to be the

Expression and Purification of E. coli RNA Polymerase

15

Fig. 1 Polycistronic vectors for expression of E. coli core RNAP. Representative examples of plasmids used most often are shown, other variants may be more suitable for a particular application. (a) pIA423 contains rpoA, B, and C genes. An intein-chitin binding protein tag (IMPACT-CN™, NEB) allows for easy, one-step purification of the core RNAP on chitin matrix. (b) pVS10 (rpoA, B, C, and Z) encodes a C-terminally His-tagged β′. (c) pIA900 (rpoA, B, C, and Z) encodes a C-terminally His-tagged β′ which can be removed using TEV protease. (d) pIA1000 (rpoA, B, C, and Z) encodes an N-terminally His-tagged β. (e) pIA1198 (rpoA, B, C, and Z) encodes a β′ with C-terminal HA and His tags. (f) pIA1202 (rpoA, B, C, and Z) encodes a β′ with a C-terminal minimal biotin tag (AVI tag) followed by a His tag; the latter can be removed using TEV protease, leaving the AVI tag intact

16

Vladimir Svetlov and Irina Artsimovitch

key missing factor. After it became clear that ω is essential for RNAP regulation by ppGpp [17], we added rpoZ to the rpoABC cassette to yield pVS10 [18], a version that was used by the Steitz lab [13], a similar construct was used by Darst and coworkers [15, 19], co-expressing ω from a compatible plasmid in the Murakami lab [14] worked equally well. These structures will provide a framework for the analysis of the basic mechanism of catalysis and its regulation. In the course of this analysis, construction of many variant RNAPs with substitutions at chosen locations will be indispensable to test molecular models, design enzymes for specific applications, and perhaps to improve the resolution of the structures. Here we describe the commonly used vectors and procedures for purification of the E. coli RNAP that will facilitate these studies. 1.1 Vectors for RNAP Expression and Mutagenesis

Many vectors are available for mutagenesis, subcloning, and expression of the E. coli RNAP subunits. Here, we provide examples of the vectors we are used routinely in several laboratories. Some of these have been published, and all are available upon request.

1.1.1 Polycistronic Vectors

These vectors (see Table 1) allow for efficient expression of the RNAP core enzyme, α2ββ′ω, either from a single vector or from two compatible vectors, one of which carries the rpoZ gene encoding the ω subunit. All rpo genes are expressed from T7 gene 10 promoter in a “standard” pET vector background, with T7 terminator downstream from rpoZ. The levels of expression follow the order ω > α2 > β > β′, and thus only the fully assembled, ω-saturated core is purified when a purification tag is located at the C-terminus of the β′ subunit. Other advantages of the co-overexpression system are (1) a streamlined purification protocol; (2) relatively high yields; (3) ability to purify the core enzyme that contains toxic and assembly-defective mutations, such as the deletions of “dispensable regions” [16]; and (4) a “crystallizable” protein [13, 14]. The purified core enzyme is catalytically active on nucleic acid scaffolds but not in promoter-dependent initiation, which requires an initiation factor σ (typically σ70) added in trans; see Chapter 11 for an example of (a variant) E. coli σ70 purification protocol..

1.1.2 Single-Subunit Vectors

However, these vectors are large (15+ kb) and have very few remaining restriction sites that can be used for subcloning of the altered fragments. Therefore, we carry out mutagenesis in smaller vectors, encoding single subunits or their fragments (see Table 2 and Fig. 2). In these vectors, an rpo gene is expressed under control of T7 gene 10 promoter (rpoA and rpoD), IPTG-inducible Ptrc promoter (rpoB and rpoC), or arabinose-inducible PBAD promoter (rpoZ).

Expression and Purification of E. coli RNA Polymerase

17

Table 1 Polycistronic E. coli RNAP expression vectors

Plasmid

Tag and AbR allele

Features

Origin and resistance

Vectors without the rpoZ gene pIA581

His6:β

T7P–α–His6:β–β′; the His6 tag at the N-terminus of rpoB

pMB1 Ampicillin

pIA299

β′:His6

T7P–α–β–β′:His6; the His6 tag at the C-terminus of rpoC

pMB1 Ampicillin

pIA423

β′:CBP

T7P–α–β–β′:CBP; a chitin-binding protein/intein tag (CBP; Impact-CNTM, NEB) fused to the C-terminus of rpoC

pMB1 Ampicillin

pIA468

β′:BCCP

T7P–α–β–β′:BCCP; residues 71–156 of the biotin carboxyl carrier protein (BCCP) fused to the C-terminus of rpoC

pMB1 Ampicillin

pIA439

His6:β RifR β′:CBP

T7P–α–His6:βS531F–β′:CBP; His6 tag at the N-terminus of rpoB; RifR S531F allele; CBP tag at the C-terminus of rpoC

pMB1 Ampicillin

pIA358

α:His6 β′:CBP

T7P–α:His6–β–β′:CBP; the His6 tag at the C-terminus of rpoA; CBP tag at the C-terminus of rpoC

pMB1 Ampicillin

pIA477

His6:β RifR β′:BCCP

T7P–α–His6:βH526Y–β′:BCCP: His6 tag at the N-terminus of rpoB; RifR H526Y allele; BCCP tag at the C-terminus of rpoC

pMB1 Ampicillin

pIA570

His6:β RifR

T7P–α–His6:βS531F–β′; the His6 tag at the N-terminus of rpoB; RifR S531F allele

pMB1 Ampicillin

pIA639

β′:His6 StlR

T7P–α–β–β′S793F:His6; the His6 tag at the C-terminus of rpoC; StlR S793F allele

pMB1 Ampicillin

Vectors with the rpoZ gene pIA1158

α:His6

T7P–α:His6–β–β′–ω; the His6 tag at the C-terminus of rpoA

pMB1 Kanamycin

pIA1000

His6:β

T7P–α–His6:β–β′–ω; the His6 tag at the rpoB N-terminus; unique silent AvrII and MfeI sites at β residues 477 and 555

pMB1 Kanamycin

pIA1070

His6:β RifR

T7P–α–His6:βD516V–β′–ω; the His6 tag at the N-terminus of rpoB; RifR D516V allele

pMB1 Ampicillin

pVS10

β′:His6

T7P–α–β–β′:His6–ω; the His6 tag at the C-terminus of rpoC

pMB1 Ampicillin

pIA787

β′:His6 β′:PKA

T7P–α–β–β′:RRASV:His6–ω; the His6 tag and a protein kinase A (PKA) site at the C-terminus of rpoC

pMB1 Ampicillin (continued)

18

Vladimir Svetlov and Irina Artsimovitch

Table 1 (continued) Tag and AbR allele

Features

pIA821

His6:β PKA:β RifR

T7P–α–His6:RRASV:βS531F–β′–ω; His6 tag and PKA site at the N-terminus of rpoB; RifR S531F allele eliminates an internal kinase site

pMB1 Kanamycin

pIA900

β′:TEV:His10

T7P–α–β–β′:TEV:His10–ω; a removable via TEV protease cleavage His10 tag at the C-terminus of rpoC

pMB1 Ampicillin

pIA999

β′:biotin

T7P–α–β–β′:GLNDIFEAQKIEWH–ω; a minimal biotin (AVI) substrate at the C-terminus of rpoC

pMB1 Ampicillin

pIA1198

β′:HA:His7

T7P–α–β–β′:YPYDVPDYA:His7–ω; the HA and His7 tags at the C-terminus of rpoC

pMB1 Ampicillin

pIA1202

β′:biotin:TEV :His7

T7P–α–β–β′:GLNDIFEAQKIEWH:TEV: His7–ω; an AVItag followed by a removable via TEV protease cleavage His7 tag at the C-terminus of rpoC at the C-terminus of rpoC

pMB1 Ampicillin

Plasmid

Origin and resistance

All vectors have the rpoA, rpoB, and rpoC genes expressed under the control of the phage T7 gene 10 promoter. A subset of vectors also has the rpoZ gene; for the rest, the ω subunit can be co-expressed from a compatible pIA839 plasmid

The single-subunit vectors can be used to express altered subunits alone, most commonly to test their ability to complement defects conferred by temperature-sensitive chromosomal rpo alleles [20] or to confer resistance to an antibiotic [21].

2

Materials All solutions are prepared using ultrapure water (resistivity of 18 MΩ, e.g., Milli-Q) and analytical/molecular biology grade reagents and filtered through bottle-top 0.2 μm PES filter to remove particulate contaminations (unless indicated otherwise). Bacterial growth media are made using purified (by deionization or reverse osmosis to resistivity of >5 MΩ, e.g., Elix) water and biotechnology grade media components and sterilized by autoclaving. All sterilized media can be stored at room temperature (unless indicated otherwise); all protein purification and chromatographic solutions are stored at 4 °C (unless indicated otherwise). We list the manufacturers for supplies and reagents that we currently use; alternative sources can be tried but we cannot guarantee that they will work identically.

Expression and Purification of E. coli RNA Polymerase

19

Table 2 Vectors for site-directed mutagenesis or expression of single E. coli RNAP subunits

Plasmid

Subunit and AbR

Features

Origin and resistance

pIA281

αWT –

T7P–rpoA; α subunit under control of the bacteriophage T7 gene 10 promoter; HindIII site in rpoA is removed

pMB1 Ampicillin

pIA545

βWT –

Ptrc–His6-rpoB WT; N-terminally tagged β under control of IPTG-inducible Ptrc promoter; a silent MfeI at 555

pMB1 Ampicillin

pIA178

βS531F RifR

Ptrc–His6-rpoB S531F; a rifampicin-resistant (RifR) S531F allele in the Ptrc–rpoB construct

pMB1 Ampicillin

pIA223

βD516V RifR

Ptrc–His6-rpoB D516V; a RifR D516V (marked with a silent BsgI site) allele in the Ptrc–rpoB construct

pMB1 Ampicillin

pIA661

β′WT –

Ptrc–rpoC WT-His6; C-terminally tagged β′ under control of an IPTG-inducible Ptrc promoter; a silent EagI at 675

pMB1 Ampicillin

pIA635

β′S793F StlR

Ptrc–rpoCS793F-His6; a streptolydigin-resistant S793F (marked with a silent EcoRV site) allele in the Ptrc–rpoC construct

pMB1 Ampicillin

pIA388

β′I774S CBRR

Ptrc–rpoCI774S-His6; a CBR-resistant I774S (marked with a silent EarI site) allele in the Ptrc–rpoC construct

pMB1 Ampicillin

pIA839

ωWT –

PBAD–rpoZ; ω subunit under control of arabinoseinducible PBAD promoter

P15A Chloramphenicol

pIA586

σWT –

T7P–His6-rpoD; N-terminally tagged σ70 subunit under control of the T7 gene 10 promoter

pMB1 Kanamycin

pIA1127

σWT –

T7P–His6-rpoD; N-terminally tagged σ70 under control of the T7 gene 10 promoter; removable His6 tag

pMB1 Kanamycin

pIA458

βC and β′N –

A fragment encompassing the C-terminal part of rpoB, the linker with an SpeI site, and the N-terminal part of rpoC

pUC Ampicillin

2.1 Bacterial Growth Media and Supplements

1. LB growth medium for liquid culture: weigh 125 g of Difco LB Miller (Luria–Bertani) dry premix, dissolve in 4.5 L of water, add water to 5 L total volume, and mix. Dispense 600 mL of prepared LB per 2 L Erlenmeyer flask (total of 8), cover with heavy duty aluminum foil, and secure the foil to the flask with the autoclave tape. Dispense the remaining LB (~200 mL) into an autoclavable media bottle. Autoclave media and store at room temperature.

Fig. 2 Plasmids for rpoB and rpoC mutagenesis; mutant versions of shorter rpoA and rpoZ can be obtained synthetically from commercial sources. We introduce a desired substitution by site-directed mutagenesis (e.g., QuikChange), adding a silent restriction site (if possible) for easy screening. We sequence the mutant fragment between two closest convenient restriction sites and then clone this fragment back into the original plasmid

Expression and Purification of E. coli RNA Polymerase

21

2. 100 mg/mL stock carbenicillin solution: weigh 0.5 g carbenicillin, dissolve in 4 mL of water, add water to 5 mL total, filter through 0.2 μm PES syringe filter, aliquot 1 mL per 1.5 mL microcentrifuge tube, and store at −20 °C (see Note 1). 3. LB + carbenicillin agar plates: weigh 40 of Difco LB Agar, place into 1 L bottle, add magnetic stir bar and water to 1 L total, cover with foil, secure the heavy duty aluminum foil to the flask with the autoclave tape. Bring the mix to boiling on the hot stirring, and sterilize by autoclaving. Cool autoclaved medium to 50–60 °C while stirring, add 1 mL of 100 mg/mL carbenicillin stock solution, continue stirring for another 5 min, and pour the plates. Store plates at 4 °C. 4. 1 M stock solution of IPTG: weigh 1.19 g of IPTG, dissolve in 4 mL of water, add water to 5 mL total, filter through 0.2 μm PES syringe filter, make immediately before use or aliquot 1 mL per 1.5 mL microcentrifuge tube, and store at −20 °C. 2.2 Protein Purification and Chromatographic Solutions

1. 1.1 M stock solution of Tris–HCl (pH 6.9): weigh 121.14 g of Tris base (e.g., Trizma base), dissolve in 900 mL of water, adjust pH to 6.9 with concentrated HCl (~80 mL), add water to 1 L total. 2. Cell lysis buffer (50 mM Tris–HCl (pH 6.9), 500 mM NaCl, 5 % glycerol): weigh 29.22 g of NaCl, dissolve in 500 mL of water, add 50 mL of 1 M Tris–HCl (pH 6.9), add 50 mL of glycerol, add water to 1 L total.

Fig. 2 (continued) (to make sure there are no mutations elsewhere). Finally, we reclone a fragment flanked by two sites that are unique in pVS10 (or another similar vector). (a) Mutagenesis of the β subunit. We use three vectors that encode the N-terminally His6-tagged β subunit under control of Ptrc promoter most frequently. The wild-type plasmid pIA545 (shown) encodes the wild-type rpoB except a silent MfeI site at β residue 555; it complements a temperature sensitive defect in the rpoB gene. Two other plasmids have the same structure but lack the MfeI site; instead, they encode rifampicin-resistant rpoB alleles: βD516V in pIA223 and βS531F in pIA178. The activity of altered RNAPs can be monitored in the presence of rifampicin, to eliminate concerns of contamination with the wild-type core. Following mutagenesis, we reclone the NcoI-SbfI fragment, which encompasses almost entire rpoB into a desired vector (e.g., pIA821). (b) Mutagenesis of the C-terminus of β and the N-terminal half of β′. pIA458 is a Litmus-based plasmid that does not encode any complete RNAP subunit. Mutagenized fragments can be transferred into a vector of choice (e.g., pIA900 for β′ mutants) on the SbfI-BsmI fragment. pIA458 has as an SpeI site in the intergenic region separating the rpoB and rpoC genes that can be used for screening. (c) Mutagenesis of the C-terminal half of the β subunit. We use pIA661, which encodes the wild-type rpoC except for a silent EagI site at β′ residue 675, most frequently. Two variants carrying antibiotic-resistant alleles, pIA388 and pIA635 (see Table 2) can be used instead. These plasmids encode the C-terminally His6 tagged β′ subunit under control of Ptrc promoter. The wild-type plasmid complements a temperature-sensitive defect in the rpoC gene. Following mutagenesis, we reclone the BsmI-HindIII fragment into a desired vector (e.g., pVS10)

22

Vladimir Svetlov and Irina Artsimovitch

3. 4 M stock solution of imidazole: weigh 68.08 g of imidazole, dissolve in 200 mL of water, adjust pH to 7.4 with HCl, add water to 250 mL total. 4. 0.5 M stock solution of EDTA (pH 8.0): weigh 186.12 g of Na2EDTA·2H2O, dissolve in 800 mL of water, adjust pH to 8.0 by adding NaOH (~20 g of pellets), add water to 1 L total. 5. 1 M stock solution of DTT: weigh 1.54 g of DL-DTT, dissolve in 8 mL of water, add water to 10 mL total, filter through 0.2 μm PES syringe filter, aliquot 1 mL per 1.5 mL microcentrifuge tube, and store at −20 °C. 6. 50 mg/mL stock solution of lysozyme: weigh 0.25 g of lysozyme (e.g., human recombinant lysozyme, Sigma-Aldrich), dissolve in 4 mL of water, add water to 5 mL total. Make immediately before use, do not store. 7. Buffer A (50 mM Tris–HCl (pH 6.9), 5 % glycerol, 0.5 mM EDTA, 1 mM DTT): combine 500 mL water, 50 mL of 1 M Tris–HCl (pH 6.9), 50 mL of glycerol, 1 mL of 0.5 M EDTA (pH 8.0), 1 mL of 1 M DTT, 1 tablet of complete EDTA-free protease inhibitors cocktail (Roche Applied Science). Add water to 1 L total. 8. Buffer B (50 mM Tris–HCl (pH 6.9), 1.5 M NaCl, 5 % glycerol, 0.5 mM EDTA, 1 mM DTT): weigh 87.66 g of NaCl, dissolve in 500 mL water, add 50 mL of 1 M Tris–HCl (pH 6.9), 50 mL of glycerol, 1 mL of 0.5 M EDTA (pH 8.0), 1 mL of 1 M DTT, 1 tablet of complete EDTA-free protease inhibitors cocktail (Roche Applied Science). Add water to 1 L total. 9. 1 M stock solution of Tris–HCl (pH 7.5): weigh 121.14 g of Tris base (e.g., Trizma base), dissolve in 900 mL of water, adjust pH to 7.5 with concentrated HCl (~65 mL), add water to 1 L total. 10. Ni binding buffer (cell lysis buffer +20 mM imidazole): combine 0.25 mL of 4 M imidazole solution and 49.75 mL of cell lysis buffer in a 50 mL conical tube (e.g., BD Falcon), mix by vortexing and keep on ice. Make immediately prior to use, do not store. 11. Ni elution buffer (cell lysis buffer +250 mM imidazole): combine 0.625 mL of 4 M imidazole solution and 9.375 mL of cell lysis buffer, mix by vortexing and keep on ice. Make immediately prior to use, do not store. 12. Dialysis buffer AB5 (50 mM Tris–HCl (pH 6.9), 75 mM NaCl, 5 % glycerol, 0.5 mM EDTA, 1 mM DTT): weigh 4.38 g of NaCl, dissolve in 500 mL water, add 50 mL of 1 M Tris–HCl (pH 6.9), 50 mL of glycerol, 1 mL of 0.5 M EDTA (pH 8.0), 1 mL of 1 M DTT. Add water to 1 L total.

Expression and Purification of E. coli RNA Polymerase

23

13. RNAP storage buffer (10 mM Tris–HCl (pH 7.5), 50 % glycerol, 100 mM NaCl, 0.1 mM EDTA, 0.1 mM DTT): weigh 5.85 g of NaCl, dissolve in 300 mL of water, add 10 mL 1 M Tris– HCl (pH 7.5), 0.2 mL 500 mM EDTA (pH 8.0), 0.1 mL 1 M DTT, 500 mL glycerol. Add water to 1 L total. 14. Commercial ready-made materials for running and staining gels. We use NuPAGE MES SDS Running Buffer, NuPAGE LDS Loading Buffer, NuPAGE 4–12 % Bis-Tris Gel (all—Life Technologies), Precision Plus Protein Dual Color Standards (Bio-Rad), and GelCode Blue Stain Reagent (Thermo).

3

Methods All protein purification procedures are performed with refrigeration (on ice, in cold room or in a chromatographic refrigerator, as indicated). All time estimates are given only as a general guidance.

3.1 Overexpression of E. coli RNAP Core

1. Transform T7-based overexpression strain of E. coli (e.g., BL21 (λDE3)) with pVS10 plasmid by electroporation or using chemically competent cells, plate on LB + carbenicillin agar, incubate overnight at 37 °C. Remove plate to 4 °C to suppress growth of satellite colonies. 2. Inoculate single colony of pVS10-transformed overexpression strain into 100 mL of LB supplemented with 0.1 mL 100 mg/ mL carbenicillin solution (0.1 mg/L final concentration) in 250 mL Erlenmeyer flask. Incubate with agitation (250 rpm) overnight at 37 °C. 3. Inoculate each of the 2 L Erlenmeyer flasks (600 mL LB) with overnight culture (1:100, v:v), supplement with 0.6 mL carbenicillin stock solution, and incubate with agitation (250 rpm) at 37 °C. Monitor culture growth periodically by measuring OD600. 4. Induce RNAP core expression by adding 0.6 mL of 1 M IPTG (to final concentration of 1 mM) once OD600 reaches 0.75 (~4 h after inoculation). Continue incubation for another 3 h (see Note 2). 5. Harvest cells by centrifugation (6,000 × g, 10 min at 4 °C, e.g., using 1 L bottles in F10S-4X1000 LEX rotor and Sorvall RC6+ centrifuge). Decant and discard the supernatant. Proceed to RNAP core purification or store cell pellets at −80 °C (thaw pellets on ice before proceeding with protein purification).

3.2 Cell Lysis and Clearing of the Cell Lysate

1. Place centrifuge bottles with cell pellets on ice. 2. Dispense 100 mL of cell lysis buffer into two 50 mL conical tubes, add 1 tablet of complete EDTA-free protease inhibitors

24

Vladimir Svetlov and Irina Artsimovitch

cocktail (Roche Applied Science) into each tube, dissolve by vortexing. Incubate tubes on ice for 15 min. 3. Resuspend cell pellets in cell lysis buffer on ice, using wide tip 10 mL pipette. Estimate final volume (e.g., using graduations on the tubes) and supplement cell suspension with freshly made 50 mg/mL solution of lysozyme to final concentration of 1 mg/mL. Incubate suspension on ice for 30 min (see Note 3). 4. Disrupt cells by ultrasonication on ice; e.g., using Tapped Bio Horn and Branson Sonifier Digital 450 at 60 % power output, 8 × 30 s continuous applications with 2 min cooling intermissions (see Note 4). 5. Remove cell debris by centrifugation (29,000 × g, 30 min at 4 °C, e.g., using 50 mL Oak Ridge Tubes (Nalgene) in F21S8X50y BioSEAL rotor and Sorvall RC6+ centrifuge). Transfer supernatants into clean tubes (e.g., Oak Ridge) by aspiration, discard the pellets, and repeat centrifugation (29,000 × g, 45 min at 4 °C; see Note 5). Discard the pelleted debris, transfer supernatants into 50 mL conical tubes, keep on ice. 3.3 Ni-Affinity Chromatography of His6-Tagged RNAP Core

All steps take place in the cold room or in a chromatographic refrigerator. 1. Estimate volume of cleared cell lysate using volumetric graduation of conical tubes. Add 4 M imidazole stock solution to each tube to final concentration of 20 mM. 2. Set a His GraviTrap column (GE Healthcare Life Science) into a vertical rack (e.g., Bio-Rad Poly Column Rack) with flowthrough collection reservoir for each 50 mL of lysate (see Note 6). Attach Labmate (GE Healthcare Life Science) buffer extension reservoir to each column. The rest of the instructions apply to each column. 3. Wash column by gravity flow with 10 mL of ultrapure water. 4. Wash column with 10 mL of Ni binding buffer. 5. Apply 50 mL of cleared extract (supplemented with 20 mM imidazole) to the column, drain completely. 6. Wash column with 40 mL of Ni binding buffer. 7. Replace collection reservoir with microcentrifuge tube rack. Label eight 1.5 mL microcentrifuge tubes (e.g., Eppendorf Protein LoBind) 1 through 8 for fraction collection, and place them under the column. 8. Apply 0.5 mL of Ni Elution buffer to the column. Collect flow-through into tube 1. 9. Sequentially apply seven 1 mL aliquots of Ni Elution buffer to the column. Collect flow-through into tubes 2–8. Place tubes on ice.

Expression and Purification of E. coli RNA Polymerase

25

10. Confirm the presence of RNAP core in fractions 2–8 by SDSPAGE; use 10–20 μL of each fraction. 11. Combine all RNAP core-containing fractions and dialyze them (e.g., using 3.5K MWCO Slide-A-Lyzer Dialysis Cassette, Thermo) overnight against 100 volumes of dialysis buffer AB5. 3.4 Heparin-Affinity Chromatography of RNAP Core

All the following steps can be implemented in instrument-specific fashion on any medium-pressure liquid chromatography system, the method as written is realized on AKTA FPLC (GE Healthcare Life Science); see Note 7. 1. Place pump inlet tubing A and B into buffers A and B, respectively. Run the pump (4 mL/min) at 100 % B until conductivity stabilizes at ~95 mS/cm (~10–15 min). Switch the pump to 0 % B and continue running until conductivity stabilizes at ~4 mS/cm (~10–15 min). Lower the rate to 1 mL/min and connect HiPrep Heparin FF 16/10 column (GE Healthcare Life Science); see Note 8. 2. To equilibrate the column set the pump at 2 mL/min and 5 % B, run until conductivity stabilizes at ~9.5 mS/cm. 3. Load dialyzed sample onto the column at 1 mL/min, wash the column by 20 mL of 5 % B at the same rate. 4. Apply gradient 5 % B to 100 % B over 200 mL at 1 mL/min, monitor protein elution from the column by UV absorbance at 280 or 215 nm. Begin collecting 1.5 mL fractions when conductivity reaches 20 mS/cm. RNAP core usually elutes from heparin column at conductivity between 30 and 45 mS/cm. Stop collecting fractions once conductivity reaches 60 mS/cm. At this time switch the pump to 100 % B and 2 mL/min, continue running for 20 min, switch the pump to 5 % B, run for another 20 min and end the run. 5. Based on UV absorbance and conductivity profiles identify RNAP core peak between 30 and 45 mS/cm. Select fractions with UV absorbance within 20 % of the maximum value, confirm presence of RNAP core there by SDS-PAGE (use 30–45 μL of each fraction). 6. Combine selected fractions and dialyze them overnight against 100 volumes of dialysis buffer AB5.

3.5 Ion-Exchange Chromatography of RNAP Core

1. Start the pump at 1 mL/min and 5 % B, replace heparin column with MonoQ 10/100 GL (GE Healthcare Life Science); see Note 9. Continue running till conductivity stabilizes at ~9.5 mS/cm (~15 min). 2. Load dialyzed sample onto the column at 1 mL/min, wash the column by 20 mL of 5 % B at the same rate. 3. Apply gradient 5 % B to 100 % B over 200 mL at 1 mL/min, monitor protein elution from the column by UV absorbance at

26

Vladimir Svetlov and Irina Artsimovitch

Fig. 3 Same purification of the E. coli RNAP. A variant with a deletion in the β′ jaw (β′ residues 1,149–1,190) was used. Samples of the cell lysate (L), Ni-NTA eluate (N; see Subheading 3.3), heparin peak fractions (H; see Subheading 3.4), and MonoQ peak fractions (H; see Subheading 3.5) were analyzed by SDS-PAGE using a 4–12 % NuPAGE® Bis-Tris pre-cast polyacrylamide gel (Life Technologies). Chromatography through the MonoQ column separates the core enzyme (left) from the holoenzyme (right). The lane marked M was loaded with the molecular weight markers; the positions of the RNAP subunits are indicated on the right

280 or 215 nm. Begin collecting 0.8 mL fractions when conductivity reaches 15 mS/cm. RNAP core usually elutes from MonoQ column at conductivity between 20 and 30 mS/cm. Stop collecting fractions once conductivity reaches 50 mS/cm. At this time switch the pump to 100 % B, continue running for 20 min, switch the pump to 5 % B, run for another 20 min and end the run. 4. Based on UV absorbance and conductivity profiles identify RNAP core peak between 20 and 30 mS/cm. Select fractions with UV absorbance within 20 % of the maximum value, confirm presence of RNAP core therein and their purity by SDSPAGE (use 20 μL of each fraction); see Fig. 3 for an example. 5. Combine the fractions with highest concentration and purity of RNAP core, change the buffer as per downstream application (see Note 10). For storage, dialyze overnight against 500 volumes of RNAP storage buffer, aliquot as needed into screwtop gasketed microcentrifuge tubes, flash-freeze aliquots in liquid nitrogen, and store at −80 °C.

4

Notes 1. Carbenicillin can be substituted by ampicillin, but the former performs better due to its higher stability. 2. Wild-type E. coli RNAP core expresses well when induced from pVS10 plasmid by IPTG at 37 °C, whereas some “mutant” forms (such as large indels) express better at lower

Expression and Purification of E. coli RNA Polymerase

27

temperatures (e.g., 30 °C). Use longer induction times if the cultures are grown at temperatures below 37 °C (e.g., induce for 5 h at 30 °C as opposed to 3 h at 37 °C). As an alternative to improve yield and solubility of expressed proteins, use autoinduction protocol, which utilizes expression induction in the stationary phase [22]. We have used it extensively with pVS10 and derivative plasmids and a variety of expression strains with great success. 3. Lysozyme activity varies greatly with source and preparation. We find human recombinant lysozyme presently to be the best value for large scale preparations, based on price and specific activity. 4. As alternative for cell disruption use French press. We would not recommend any of the commercially available cell lysis formulations as they didn’t perform on par with sonication or the French press. Cell disruptors such as EmulsiFlex (Avestin) used in lieu of sonication tend to produce less active preparations of RNAP core. 5. Clearing extract by high-speed centrifugation is essential for efficient gravity flow chromatography, as cell debris when not removed clogs the columns filters and bed, interfering with the flow rate and uniformity, even if when column is advertised as capable of handling “uncleared” cell extracts. If you do not have access to centrifuge capable of delivering 29,000 × g acceleration, perform batch-binding of His6-tagged RNAP core to NiSepharose Fast Flow and pack it into PD-10 gravity column (both GE Healthcare Life Science) per manufacturer’s instructions. 6. His Gravitrap column is packed with Ni Sepharose Fast Flow beads (GE Healthcare Life Science), a medium density (15 μM of Ni2+ per mL of beads) affinity resin for purification of His6tagged proteins. As alternative for purification of His6-tagged RNAP core a number of Ni2+ or Co2+ resins can be used without significant changes in protocol or drastic drop in efficiency; note that Co2+ affinity media usually have lower proteinbinding capacity than Ni2+ ones. Of interest is high density Ni Agarose from Gold Biotechnology, which features 20–40 μM of Ni2+ per mL of beads. 7. Heparin-affinity chromatography removes most of the nucleic acid contaminations present in RNAP preparation after the Ni-affinity step. Performing it prior to ion-exchange chromatography is thus very important since nucleic acids have higher affinity to the MonoQ column than does RNAP and if not removed they will interfere with core binding. 8. Pre-packed HiTrap Heparin FF 16/10 is the preferred column for preparative scale heparin-affinity chromatography, both in terms of capacity and reproducibility. It can be substituted with similar size column packed in-house with Heparin

28

Vladimir Svetlov and Irina Artsimovitch

Sepharose 6 Fast Flow (GE Healthcare Life Science); another pre-packed heparin-affinity column from GE, 5 mL HiTrap Heparin HP has much lower capacity and reduced resolution. Connecting several HiTrap columns head-to-tail may approach 16/10 in protein-binding capacity but compromises resolution even further. 9. MonoQ columns provide the best resolution for RNAP core purification. Q Sepharose is not a recommended substitute due to its significantly reduced resolution. With some success, SOURCE 15Q 4.6/100 PE (GE Healthcare Life Science) can replace MonoQ 10/100 GL, albeit with lower resolution which may require additional polishing steps. 10. E. coli RNAP core purified according to the preceding streamlined protocol is as a rule 95+ % pure and 80+ % active in in vitro transcription applications. For additional polishing steps, repeat ion-exchange chromatographic step or perform sizeexclusion chromatography (e.g., using Superdex 200 10/300 GL (GE Healthcare Life Science) in 50 % buffer B).

Acknowledgements This work was supported by the National Institutes of Health GM67153 grant. References 1. Zhang G, Campbell EA, Minakhin L et al (1999) Crystal structure of Thermus aquaticus core RNA polymerase at 3.3 A resolution. Cell 98:811–824 2. Vassylyev DG, Vassylyeva MN, Zhang J et al (2007) Structural basis for substrate loading in bacterial RNA polymerase. Nature 448:163–168 3. Zhang Y, Feng Y, Chatterjee S et al (2012) Structural basis of transcription initiation. Science 338:1076–1080 4. Vassylyev DG, Vassylyeva MN, Perederina A et al (2007) Structural basis for transcription elongation by bacterial RNA polymerase. Nature 448:157–162 5. Vassylyev DG, Sekine S, Laptenko O et al (2002) Crystal structure of a bacterial RNA polymerase holoenzyme at 2.6 A resolution. Nature 417:712–719 6. Tagami S, Sekine S, Kumarevel T et al (2010) Crystal structure of bacterial RNA polymerase bound with a transcription inhibitor protein. Nature 468:978–982

7. Belogurov GA, Vassylyeva MN, Sevostyanova A et al (2009) Transcription inactivation through local refolding of the RNA polymerase structure. Nature 457:332–335 8. Campbell EA, Korzheva N, Mustaev A et al (2001) Structural mechanism for rifampicin inhibition of bacterial RNA polymerase. Cell 104:901–912 9. Vassylyev DG, Svetlov V, Vassylyeva MN et al (2005) Structural basis for transcription inhibition by tagetitoxin. Nat Struct Mol Biol 12:1086–1093 10. Lane WJ, Darst SA (2010) Molecular evolution of multisubunit RNA polymerases: structural analysis. J Mol Biol 395:686–704 11. Artsimovitch I, Patlan V, Sekine S et al (2004) Structural basis for transcription regulation by alarmone ppGpp. Cell 117:299–310 12. Ross W, Vrentas CE, Sanchez-Vazquez P et al (2013) The magic spot: a ppGpp binding site on E. coli RNA polymerase responsible for regulation of transcription initiation. Mol Cell 50:420–429

Expression and Purification of E. coli RNA Polymerase 13. Zuo Y, Wang Y, Steitz TA (2013) The mechanism of E. coli RNA polymerase regulation by ppGpp is suggested by the structure of their complex. Mol Cell 50:430–436 14. Murakami KS (2013) X-ray crystal structure of Escherichia coli RNA polymerase sigma70 holoenzyme. J Biol Chem 288:9126–9134 15. Bae B, Davis E, Brown D et al (2013) Phage T7 Gp2 inhibition of Escherichia coli RNA polymerase involves misappropriation of sigma70 domain 1.1. Proc Natl Acad Sci U S A 110:19772–19777 16. Artsimovitch I, Svetlov V, Murakami KS et al (2003) Co-overexpression of Escherichia coli RNA polymerase subunits allows isolation and analysis of mutant enzymes lacking lineagespecific sequence insertions. J Biol Chem 278:12344–12355 17. Vrentas CE, Gaal T, Ross W et al (2005) Response of RNA polymerase to ppGpp: requirement for the omega subunit and relief of this requirement by DksA. Genes Dev 19:2378–2387

29

18. Belogurov GA, Vassylyeva MN, Svetlov V et al (2007) Structural basis for converting a general transcription factor into an operonspecific virulence regulator. Mol Cell 26: 117–129 19. Twist KA, Husnain SI, Franke JD et al (2011) A novel method for the production of in vivoassembled, recombinant Escherichia coli RNA polymerase lacking the alpha C-terminal domain. Protein Sci 20:986–995 20. Weilbaecher R, Hebron C, Feng G et al (1994) Termination-altering amino acid substitutions in the beta′ subunit of Escherichia coli RNA polymerase identify regions involved in RNA chain elongation. Genes Dev 8: 2913–2927 21. Yuzenkova J, Delgado M, Nechaev S et al (2002) Mutations of bacterial RNA polymerase leading to resistance to microcin j25. J Biol Chem 277:50867–50875 22. Studier FW (2005) Protein production by auto-induction in high density shaking cultures. Protein Expr Purif 41:207–234

Chapter 3 Monitoring Translocation of Multisubunit RNA Polymerase Along the DNA with Fluorescent Base Analogues Anssi M. Malinen, Matti Turtola, and Georgiy A. Belogurov Abstract Here we describe a direct fluorescence method that reports real-time occupancies of the pre- and post-translocated state of multisubunit RNA polymerase. In a stopped-flow setup, this method is capable of resolving a single base-pair translocation motion of RNA polymerase in real time. In a conventional spectrofluorometer, this method can be employed for studies of the time-averaged distribution of RNA polymerase on the DNA template. This method utilizes commercially available base analogue fluorophores integrated into template DNA strand in place of natural bases. We describe two template DNA strand designs where translocation of RNA polymerase from a pre-translocation to a post-translocation state results in disruption of stacking interactions of fluorophore with neighboring bases, with a concomitant large increase in fluorescence intensity. Key words Transcription, RNA polymerase, Translocation, Fluorescence, Base analogue, Stoppedflow, Rapid quench-flow

1

Introduction RNA polymerase (RNAP) mediates the synthesis of an RNA copy of template DNA—the first and often the decisive step in gene expression. All cellular RNAPs are multisubunit enzymes that share homologous catalytic cores. Bacterial RNAP, a five subunit complex ααββ′ω, represents the simplest model system for studies of fundamental mechanistic properties of all multisubunit RNAPs. During transcription, RNAP catalyzes incorporation of ribonucleoside monophosphates (NMP) into the nascent RNA and moves along the DNA in single base-pair steps [1–6]. The 3′ terminal nucleotide of the nascent RNA can occupy two distinct positions within the RNAP active site: the nucleophilic site (a.k.a. i site) where the RNA 3′ OH group is activated for an attack on substrate NTPs, and the substrate site (a.k.a. i + 1 site) where the new RNA 3′ end is generated after the NMP is joined to the nascent RNA. The former corresponds to the post-translocated state and the latter—to

Irina Artsimovitch and Thomas J. Santangelo (eds.), Bacterial Transcriptional Control: Methods and Protocols, Methods in Molecular Biology, vol. 1276, DOI 10.1007/978-1-4939-2392-2_3, © Springer Science+Business Media New York 2015

31

Anssi M. Malinen et al.

32

the pre-translocated state. Upon translocation, the RNA 3′ nucleotide migrates into the nucleophilic site, whereas the substrate site captures a new DNA-template position. Here we describe the method for monitoring RNAP translocation over a single base-pair step in real-time. The method utilizes fluorescent bases 2-aminopurine (2-AP) and 6-methylisoxanthopterin (6-MI), which closely mimic natural DNA bases (Fig. 1) and participate in Watson–Crick interactions, and therefore can be incorporated into nucleic acids with minimal disruption [7]. When fluorescent base is incorporated into the template strand in

O NH O

N

N

NH2

O

N

NH2

N

NH N

NH2

Guanine

N N

N

N N

NH2

2-aminopurine (2-AP)

N

N N

Adenine

pre-translocated state dim fluorescence

6-methyl-isoxanthopterin (6-MI)

N

post-translocated state bright fluorescence

Forward translocation

Fig. 1 A conceptual overview of translocation assay. Top: The fluorophores 6-MI and 2-AP mimic the structure of natural bases and participate in Watson-Crick interactions. Middle: When incorporated in template DNA strand base analogue fluorophores are quenched by stacking interactions with neighboring bases. Bottom: Fluorescence of 6-MI and 2-AP increases several fold when fluorophores reach upstream edge of RNA–DNA hybrid (i − 8 register, left ) or enter active site acceptor base position (i + 1 register, right ). Figure reproduced from [8] with permission

Translocation of RNA Polymerase in Real Time

33

positions i + 2 or i − 7, changes in stacking interactions with neighboring bases result in twofold to fivefold increase in fluorescence upon forward translocation, whereas fluorescence reverts to the initial level upon backward translocation. In the presence of Mg2+, Escherichia coli RNAP transcription elongation complexes (TECs) assembled on chemically synthesized nucleic acid scaffolds occur predominantly in the posttranslocated state and translocate forward unidirectionally at a milliseconds timescale following nucleotide incorporation [8]. Forward translocation rate can be inferred in such system from a delay between a nucleotide addition curve (discrete measurements of RNA length using a rapid chemical quench-flow instrument followed by a denaturing polyacrylamide gel electrophoresis (PAGE) analysis) and a translocation curve (continuous measurement of base analogue fluorescence in a stopped-flow instrument). In the absence of RNA synthesis, the equilibrium levels of fluorescence and the effects of RNA and DNA sequences, RNAP mutations, protein factors, and small molecules on translocation equilibrium can be determined using a conventional spectrofluorometer. The completeness of translocation can be evaluated by forward-biasing RNAP with a nonhydrolyzable analogue of the substrate NTP. In addition, TECs extended with a 2′dNMP are less prone to translocate backward than the NMP-extended TECs [8] and therefore can often serve as a fully post-translocated reference. E. coli RNAP, and presumably most of bacterial RNAPs, can be backward-biased by micromolar concentrations of tagetitoxin [8, 9] though at the time of writing this compound is no longer commercially available.

2

Materials Consumables

Use low protein binding, RNAse/DNAase-free microcentrifuge tubes for all assays. Use all plastic two-part syringes for all procedures. 1 ml syringes with low dead stop volume are particularly recommended to minimize sample losses. Aerosol-resistant (barrier) racked RNAse/DNAase-free tips are also strongly recommended. Comparable high-quality consumables are available from many manufacturers.

2.2 RNA and DNA Oligonucleotides (Oligos)

6-MI oligos are available from Fidelity Systems (Gaithersburg, MD, USA). 2-AP oligos can be purchased from IBA GmbH (Goettingen, Germany), Fidelity Systems, and Integrated DNA Technologies (Coralville, IA, USA). The preferred purification method is PAGE, though HPLC purification is often sufficient. The recommended synthesis scale is 0.2 μmol and the expected yields are 20–30 nmol of a 50-nt oligo.

2.1

34

Anssi M. Malinen et al.

Standard unlabeled DNA oligos, available from many manufacturers, are ordered HPLC-purified at 0.2 μmol scale and yields of 20–40 nmol are anticipated. We purchase unlabeled and Atto 680-labeled RNA oligos from IBA GmbH and Fidelity Systems. The strongly preferred purification method is PAGE, the recommended synthesis scale is 0.2 μmol, and the expected yields are 20–30 nmol of a 16-nt RNA. DNA and RNA oligos are dissolved at 100 μM in DEPC-treated 10 mM HEPES-K pH 7.5 and stored at −80 °C. 2.3 RNAP Core Enzyme

Methods described in this chapter consume a large amount of E. coli RNAP, thus the purification of the enzyme should be set up in house as commercial preparations are prohibitively expensive. E. coli RNAP core enzyme is expressed in E. coli BL21 (DE3) or T7 express (New England Biolabs) from a polycistronic vector encoding all subunits [10] and purified using Ni-immobilized metal affinity, heparin, and anion exchange chromatography. RNAP is dialyzed against storage buffer and stored at −20 °C. Large batches can be aliquoted and stored at −80 °C. A detailed protocol for purification of RNAP from an overproducing E. coli strain is described in Chapter 2.

2.4

The following stocks (1–6) are treated with 0.1 % DEPC for 24–48 h at room temperature and stored at ambient temperature, or treated with 0.1 % DEPC for 3 h at room temperature and autoclaved.

Stock Solutions

1. 1 M HEPES-K, pH 7.5. 2. 2 M KCl. 3. 80 % glycerol. 4. 1 M MgCl2. 5. 0.5 M Na2 EDTA. 6. Milli-Q (mQ) water. The following stocks (7–9) are not treated with DEPC and stored at −20 °C: 7. 1 M DTT. 8. Ultrapure ribo- and 2′ deoxyribonucleoside triphosphates (ATP, CTP, GTP, UTP, dATP, dCTP, dGTP, dUTP) purchased as 100 mM solutions from Bioline, Jena Bioscience or GE healthcare (see Note 1). 9. AMPCPP, CMPCPP, GMPCPP purchased Bioscience as 10 mM stocks (see Note 2).

from

Other reagents and stocks stored at ambient temperature: 10. Methanol. 11. Deionized formamide.

Jena

Translocation of RNA Polymerase in Real Time

35

12. 0.5 M HCl. 13. 0.3 M Li2 EDTA. 14. 7.5 % Orange G. 15. 1 M Tris–HCl, pH 8.0. 2.5

Buffers

1. RNAP storage buffer: 50 % glycerol, 10 mM Tris–HCl pH 8, 100 mM KCl, 0.1 mM DTT, 0.1 mM EDTA. Prepare 500 ml for dialysis after the final stage of RNAP purification and discard after use. 2. Scaffold annealing buffer: 10 mM HEPES-K pH 7.5, 0.1 mM Na2 EDTA. Prepare 10 ml using high purity DEPC-treated reagent stocks and store at ambient temperature. 3. 10× transcription (10× TB10) buffer: 0.4 M HEPES-K pH 7.5, 0.8 M KCl, 50 % glycerol, 0.1 M MgCl2, 1 mM Na2 EDTA, and 1 mM DTT. Prepare 10–50 ml using high purity, DEPC treated (except for DTT) reagent stocks and store at −20 °C. 4. Neutralization buffer for quench-flow experiments (4.5 ml): 4.2 ml deionized formamide, 160 mg solid Trizma base, 200 μl 0.3 M Li2 EDTA pH 7.5, 130 μl 7.5 % Orange G. Prepare fresh, 4.5 ml per experiment.

2.6

3

Instrumentation

At the time of writing, our laboratory uses Perkin-Elmer LS-55 spectrofluorometer (PerkinElmer, Waltham, MA, USA), SX18MV-R stopped-flow system (Applied Photophysics, Leatherhead, UK), and RQF 3 quench-flow instrument (KinTek Corporation, Austin, TX, USA). For detection of Atto 680-labeled RNA by PAGE, we use Odyssey Infrared Imager (Li-Cor Biosciences, Lincoln, NE, USA). We purchase long-pass filters for the stopped-flow instrument from UQG Ltd, Cambridge, UK. For equilibrium fluorescent measurements, we found the following cuvettes to be particularly useful: 16.50-F (100 μl) and 16.160-F (200 μl) from Starna (Starna Scientific Ltd, Essex, UK) and Quartz SUPRASIL Macro/Semi-micro Cell (500 μl; cat# B0631132) from Perkin Elmer.

Methods Unless otherwise noted, all assays are performed at 25 °C. For consistent and temporally stable readings, use a thermostated cuvette holder for spectrofluorometer and refrigerated circulating water baths for spectrofluorometer, stopped-flow and quench-flow systems. Heating-only circulators cannot maintain 25 °C at typical laboratory conditions.

36

Anssi M. Malinen et al.

3.1 Design of RNA Primer-Template DNA Strand Scaffold and the Non-template DNA Strand

The template DNA strand oligo consists of 20 nt of downstream DNA, 1 nt acceptor base for incoming NTP, 9 nt of sequence that pairs with an RNA primer and 20 nt of upstream DNA (see Note 3). First, design complementary parts of an RNA primer and its DNAbinding site (i.e., RNA–DNA hybrid) by manually altering the sequence of existing template strand oligo such as S041M or S033A (Fig. 2) using text editing software (see Note 4). For the upstream detection system (Fig. 1, left), the complementary part of the RNA primer must be 3′-NNNNNNACC-5′, where N is any nt; the complement of ACC in template DNA strand must be 5′-TXG-3′, where X = 6-MI. For the downstream detection system (Fig. 1, right), there are no limitations on the RNA primer sequence. Next, select the desired acceptor base (i + 1 register), e.g., when designing TEC intended to incorporate GMP select C as an acceptor base. The downstream transcribed sequence is then designed to minimize read-through due to misincorporation and/ or allow for walking of TEC by up to three nucleotides (see Note 5). For the downstream detection system, the first four transcribed nucleotides must be 5′-GTX(C)-3′ for a TEC adding GMP and 5′-CGX(T)-3′ for a TEC adding AMP (X = 2-AP, parentheses designate the acceptor base). For the upstream detection system there are no limitations on downstream DNA sequence. The oligo secondary structure is evaluated using UNAFold [11] and the downstream and upstream DNA segments are manually reshuffled to prevent formation of strong hairpins (Tm > 30 °C). The 16-nt RNA primer oligo is designed by extending 5′ end of the 9-nt RNA segment complementary to the template DNA with ribonucleotides ensuring the lack of strong secondary structures and complementarity to the template DNA outside the RNA–DNA hybrid sequence (see Notes 6 and 7). The non-template DNA strand oligo is designed as a full complement of the template strand assuming that 6-MI pairs with C and 2-AP pairs with T.

3.2 Scaffold Annealing

Scaffolds are prepared at 10 μM (see Note 8) using a 1.4-fold excess of either RNA primer (for translocation measurements) or the template DNA strand (for nucleotide addition measurements) in scaffold annealing (SA) buffer. For translocation measurements, mix 76 μl SA buffer, 10 μl 100 μM template DNA and 14 μl of 100 μM RNA primer. For nucleotide addition measurements, mix 76 μl SA buffer, 14 μl 100 μM template DNA and 10 μl of 100 μM RNA primer. Incubate the mix at 70 °C for 5 min in a heating block or beaker with water and let to cool down to room temperature while protecting the solution from light (see Note 9). If using equipment with active cooling capacity, adjust the cooling speed not to exceed 5 °C/min. Store the scaffold at −20 or −80 °C.

3.3

TECs are assembled at 1 μM (see Note 8) on the pre-annealed scaffold in transcription buffer containing 10 mM Mg2+ (TB10) (see Note 10). For translocation and nucleotide addition measurements,

TEC Assembly

Translocation of RNA Polymerase in Real Time

37

S041M-R024-S042 3’-CGATGAGATGACTGTACTACGGAGGAGACCTTGGAATCTAGCGATGTTCA-5’

non-template DNA, 50 nt

5’-GCTACTCTACTGACATGATGCCTCCTCTXGAACCTTAGATCGCTACAAGT-3’

template DNA, 50 nt

G

GAGGAGACCAACACUC-5’ RNA, 16 nt

X = 6-MI fluorophore TXG= 3 nt “sensor”

S048M-R024-S049 3’-CGATGAGATGACTGTACTGGCGAGGAGACCTTGGAATCTAGCGATGTTCA-5’

non-template DNA, 50 nt

5’-GCTACTCTACTGACATGACCGCTCCTCTXGAACCTTAGATCGCTACAAGT-3’

template DNA, 50 nt

C

GAGGAGACCAACACUC-5’ RNA, 16 nt

X = 6-MI fluorophore TXG= 3 nt “sensor”

S056M-R024-S057 3’-CGATGAGATGACGTTACTGCAGAGGAGACCTTGGAATCTAGCGATGTTCA-5’

non-template DNA, 50 nt

5’-GCTACTCTACTGCAATGACGTCTCCTCTXGAACCTTAGATCGCTACAAGT-3’

template DNA, 50 nt

A

GAGGAGACCAACACUC-5’ RNA, 16 nt

X = 6-MI fluorophore TXG= 3 nt “sensor”

S056-R024-S059 3’-CGATGAGATGACGTTACAGCTGAGGAGACCTTGGAATCTAGCGATGTTCA-5’

non-template DNA, 50 nt

5’-GCTACTCTACTGCAATGTCGACTCCTCTXGAACCTTAGATCGCTACAAGT-3’

template DNA, 50 nt

U

GAGGAGACCAACACUC-5’ RNA, 16 nt

X = 6-MI fluorophore TXG= 3 nt “sensor”

S001A-R002-S005 3’-CAGAGTAGACCGTAACATGGAGGAGAATTTGGAATCTAGCGATGTCAG-5’

non-template DNA, 48 nt

5’-GTCTCATCTGGCATTGTXCCTCCTCTTAAACCTTAGATCGCTACAGTC-3’

template DNA, 48 nt

GAGGAGAAUCAAUCAC-5’ RNA, 16 nt

G

X = 2-AP fluorophore TXC= 3 nt “sensor”

S033A-R002-S034 3’-TACAGAGTAGACCGTAAGCTAGAGGAGAATTTGGAAGTAGACTGTTGCAC-5’

non-template DNA, 50 nt

5’-ATGTCTCATCTGGCATTCGXTCTCCTCTTAAACCTTCATCTGACAACGTG-3’

template DNA, 50 nt

A

GAGGAGAAUCAAUCAC-5’ RNA, 16 nt

X = 2-AP fluorophore GXT= 3 nt “sensor”

Fig. 2 Sequences of six nucleic acid scaffolds extensively validated for use in translocation studies of E. coli RNAP. These scaffolds have been shown to (1) incorporate cognate NMP and dNMP with efficiency of >80 %, (2) translocate unidirectionally forward upon nucleotide addition, (3) display >2 fold increase in fluorescence upon translocation, (4) maintain stable fluorescent levels for >10 min under illumination with excitation light, (5) display nucleotide incorporation and translocation kinetics adequately described by the model presented in data analysis section

38

Anssi M. Malinen et al.

use scaffolds with excess of RNA and template strand, respectively. The non-template DNA strand is always added at 2 μM. To prepare 100 μl TEC, mix 78 − x μl mQ water, 10 μl 10× TB10 buffer, 10 μl of 10 μM annealed scaffold, and x μl of purified RNAP core enzyme to achieve the final concentration of 1.5 μM RNAP. Our RNAP stock solutions are typically 20–60 μM so x = 2.5–7.5 μl. Incubate 10 min. Add 2 μl of 100 μM non-template DNA oligo. Incubate 20 min. Use the assembled TEC within 1–2 h. 3.4 Equilibrium Translocation Measurements

Equilibrium levels of fluorescence of base analogues are determined by recording emission spectra (see Note 11) of 6-MI (0.05–0.2 μM TEC; excitation at 340 nm, emission spectrum 400–500 nm) or 2-AP (0.3–1 μM TEC; excitation at 330 nm, emission spectrum 350–450 nm) with a spectrofluorometer (see Notes 12 and 13). The fluorescence at peak emission wavelength (420 and 375 nm for 6-MI and 2-AP, respectively) is used for data analysis and presentation (see Note 13). Slit widths of 5–10 nm for both excitation and emission monochromators give an optimal compromise between spectral resolution and sensitivity in LS-55 spectrofluorometer. Two different setups may be employed. In a discrete setup (Fig. 3a), mix individual 100–200 μl reactions in 1.5 ml microcentrifuge tubes and subsequently measure fluorescence of each reaction using a microcuvette (see Notes 14 and 15). In a sequential setup, dilute the assembled TEC into a 0.5 ml cuvette, measure initial fluorescence, add NTP and other reagents from concentrated stocks (e.g., 100×) directly into the cuvette in the desired order while monitoring fluorescence (see Note 16). In the sequential setup, it is sometimes advantageous to perform continuous recording at a single wavelength (excitation/emission at 340/420 nm for 6-MI and 330/375 nm for 2-AP; Fig. 3d) instead of the commonly recommended spectral measurements. Example: For characterization of a TEC with a new sequence, RNAP variant or new buffer conditions, measure fluorescences of initial (assembled) TEC (F0), rNMP extended TEC (FNTP), 2′dNMP extended TEC (FdNTP) and rNMP extended TEC supplemented with 200 μM of a nonhydrolyzable analogue of the next substrate NTP (e.g., CMPCPP, FNTP_CMPCPP). FdNTP ≈ 2 × F0 to 5 × F0 and FNTP ≈ FdNTP ≈ 1.1 × FNTP_CMPCPP suggests that the extended TEC is fully post-translocated (see Note 17). If FNTP < FdNTP, the fraction of the post-translocated TEC is estimated as (FNTP − F0)/ (FdNTP − F0) and the fraction of the pre-translocated TEC as (FdNTP − FNTP)/(FdNTP − F0) (see Notes 18 and 19). For the TEC assembled with wild-type RNAP, FdNTP < 1.5 × F0 suggests a suboptimal setup. Interpretable data can often still be obtained, but such TECs and/or buffer conditions are not recommended for routine measurements (see Note 20). For a previously uncharacterized TEC it is recommended to perform time-resolved measurement in the stopped-flow setup (see Subheading 3.5) to

Translocation of RNA Polymerase in Real Time

b normalized fluorescence and RNA17 fraction

a

initial

100

+GTP

150 fluorescence, a.u.

39

TEC17 TEC16

50

1.0 0.8

translocation 0.6 0.4

time RNA17

0.2

RNA16

0.0 1E-3

0.01

0.1

1

10

time, s

0 400

420

440

460

480

c nucleotide

500

wavelength, nm

translocation trace 0

d

10 20 half-life, ms

30

120 + 5µM GTP

fluorescence, a.u.

translocation

addition

+ 100µM PPi

+ 100µM PPi

100

80

60

40 assembled TEC16

0

500

1000 time, s

Fig. 3 Example graphs depicting RNAP translocation experiments. (a) Emission spectra of assembled and extended TECs (0.5 μM, S041M-R024-S042, Fig. 2) are recorded in separately setup 100 μl reactions using 16.50-F cuvette. Denaturing PAGE gel in inset demonstrates that >80 % of RNA is extended by 1 nt. (b) Nucleotide addition and translocation along the DNA are resolved in time in separately setup quench-flow and stopped-flow experiments. Nucleotide addition curve is derived from quantifications of RNA bands in denaturing PAGE (inset). (c) Half-life of translocation process is estimated as the difference between the half-lives of translocation trace and the nucleotide addition curve. (d) Continuous measurements of time-averaged distribution of RNAP on the template DNA in 500 μl Perkin Elmer cuvette with continuous mixing. Assembled TEC undergoes unidirectional forward translocation upon reaction with substrate GTP followed by partial backward translocation upon addition of pyrophosphate

ensure that fluorescence increase upon nucleotide addition follows mono- or bi-exponential kinetics and that the extended TEC fluorescence is temporally stable for at least 100 s. It is also important to monitor the state of RNA under the conditions of the

40

Anssi M. Malinen et al.

experiment by denaturing PAGE (see Subheading 3.7) to ensure that (1) a reasonable fraction of the assembled TEC adds nucleotide; (2) there is no significant read-through due to misincorporation; and (3) there is no significant cleavage of RNA by RNAP. 3.5 Time-Resolved Measurements of Translocation in the Stopped-Flow Instrument

This section describes measurement of translocation that occurs following the incorporation of a single nucleotide into the nascent RNA and completes the nucleotide addition cycle. For TECs assembled with wild-type E. coli RNAP both nucleotide addition and translocation occur at millisecond timescale and are typically completed by 1 s. The principal goal of the stopped-flow experiment is to rapidly mix the TEC solution with the NTP solution in a cuvette illuminated with a light band that efficiently excites the fluorescent base while continuously recording fluorescence with a sensitive photomultiplier detector. This allows real-time monitoring of translocation triggered by incorporation of a single nucleotide into the nascent RNA. Fluorescence traces obtained in this assay (Fig. 3b) characterize accumulation of a product of a two-step sequential reaction, nucleotide addition and translocation (Fig. 3c). To infer the rate of translocation it is therefore necessary to determine the nucleotide addition rate in a rapid chemical quench-flow experiment, as outlined in Subheading 3.6. The procedures below are for the Applied Photophysics SX.18MV stopped-flow instrument equipped with 150 W ozone-free xenon bulb. Preparation of the stopped-flow instrument for measurements (1–2 h prior to starting the experiment)

1. Turn on a refrigerated water bath circulator to equilibrate the stopped-flow instrument water jacket at 25 °C. 2. Ignite the stopped-flow instrument lamp; let the lamp warmup for 1 h before the first measurement. 3. Install a long-pass filter (400 nm for 6-MI, 375 nm for 2-AP) between the photomultiplier tube (PMT) and the mixing cell. Caution! Ensure that no voltage is applied to PMT when performing this operation. Refer to the instrument manual for details. 4. Adjust the excitation monochromator slits to 2 nm. 5. Switch on (in this order) the computer, the photometric unit, the sample handling unit, and the monochromator. 6. In the stopped-flow control software, set: Time 10 s (see Note 21), Filter 150 μs (see Note 22), Detector Emission, Excitation wavelength 340 nm for 6-MI and 320 nm for 2-AP, Time scale Log, Oversample On, Trigger External trigger. 7. Wash loading ports, drive syringes and flow lines thoroughly with mQ. Use 10 ml syringes to load mQ to the drive syringes. Remove air bubbles carefully (see Note 23) before passing the solutions through the flow lines.

Translocation of RNA Polymerase in Real Time

41

8. Adjust the stop syringe volume to 120–150 μl. Increasing the volume may improve signal stability but will also increase sample consumption. Prepare reagents required for the stopped-flow instrument priming (see Note 24) and a typical 9–10 time curves experiment (given that several curves often need to be discarded, this corresponds to a single averaged curve of ~6 individual traces): 800 μl of 0.4 μM TEC (assemble 320 μl of 1 μM TEC and dilute with 480 μl of 1× TB10. Also see Note 25) and 1 ml of 0.4 mM NTP in 1× TB10 (see Note 26). Required plasticware and other consumables: 4 × 10 ml twopart plastic syringes for filling and washing system drive syringes and flow lines, 2 × 1 ml low dead volume two-part plastic syringes for loading TEC and NTP solutions, blunt 18 G needle to maximize recovery of the TEC solution into loading syringe. Sample loading and data collection

1. Load the TEC and NTP solutions into separate 1 ml plastic syringes using blunt needle. Insert NTP syringe into the left and TEC syringe—into the right loading port (see Note 27). 2. Load both the TEC and NTP solutions into the drive syringes. Leave some solution in the loading syringes to avoid transferring air bubbles into the drive syringes. Carefully remove air bubbles from drive syringes by repeatedly pushing solution between the loading and drive syringes. Repeat until no air bubbles are visible in drive syringes. 3. Open the gas valves of the N2 bottle and adjust the pressure to 8 bars. 4. Fill the flow lines from the drive syringes to the mixing cell by priming the left drive syringe two times and the right syringe once. Priming is performed by freeing space in the stop syringe (press Empty) and then manually pushing the drive syringe. Ensure that the syringe valve directs solution into the mixing cell rather than the loading syringe (adjust the knob atop of the drive syringe). Continue by priming simultaneously both drive syringes twice. Wait until the reaction has proceeded to estimated completion (>10 s). At this point the mixing cell is filled with reaction products. 5. Open the light shutter. Adjust PMT Set PMT/Target PMT and V-offset Set PMT/Set Offset automatically (see Note 28). 6. Start the reaction and data collection by pressing Acquire. 7. Save the data after each run. Average 6–10 individual traces using the stopped-flow software (see Note 29). Some traces, particularly the first acquired curve, may deviate significantly from the bulk of traces and can be excluded from averaging.

42

Anssi M. Malinen et al.

8. After the experiment, remove the sample syringes and wash the drive syringes and the flow lines thoroughly with mQ. Switch off the devices in reverse order: the monochromator, the sample handling unit, the photometric unit, the computer and, finally, the lamp. Shut off the N2 supply and the thermostat bath. 3.6 Determination of Nucleotide Addition Rate Using the Rapid Chemical QuenchFlow Instrument

In an ensemble experiment, oscillations of individual TECs between pre- and post-translocated states cannot be monitored so the conditions must be created for the bulk of TECs to translocate into either direction. The simplest way to trigger synchronized forward translocation is to mix the TEC with the substrate nucleotide, thereby initiating rapid synthesis of a (typically metastable) pre-translocated TEC. Such an approach lies behind the time-resolved studies of forward translocation described in Subheading 3.5. As stated above, knowledge of the nucleotide addition rate is essential for the quantitative analysis of the forward translocation rate in such experiments. Incorporation of a single nucleotide into the nascent RNA by E. coli RNAP at 25 °C occurs at millisecond timescale and is typically complete by 1 s. The principal goal of a quench-flow experiment is to rapidly mix the TEC solution with the NTP solution, push the resulting mixture through a delay loop following by rapid mixing with a quencher solution (0.5 M HCl). The quenched reactions corresponding to reaction times from few milliseconds to seconds are then analyzed by denaturing PAGE and the fractions of initial and extended RNAs are individually quantified (Fig. 3b). Fitting the RNA fraction data to a rate equation (typically mono-or bi-exponential) allows for inference of nucleotide addition rate. Ultimately, the nucleotide addition rate, in conjunction with fluorescence traces measured in the stopped-flow experiment, is used to infer the intrinsic translocation rate as described in Subheading 3.8. The rapid chemical quench-flow analysis of nucleotide incorporation by multisubunit RNAP has been described elsewhere [12, 13]. The protocol described here is adapted to mimic the conditions of stopped-flow experiment described in Subheading 3.5 and to use Atto 680 in place of 32P for detection of RNA in denaturing gels. A typical assay uses 0.5 μM TEC in the sample syringe that translates to 250, 60, and 25 nM Atto 680-labeled RNA in the reaction mixture, quenched and neutralized samples respectively. The neutralized samples are loaded directly onto the 20 cm long 0.4 mm thick 16 % TBE-Urea PA gel (3 μl per well) resulting in excellent sensitivity when scanned with Odyssey infrared imager (see Note 30). The procedures below are for the RQF 3 quench-flow instrument (KinTek Corporation). Caution! Refer to instrument manual to learn the correct positioning of 4-way valves that control the sample flow path because in correct valve positions may result in the loss of precious sample and/or damage the instrument.

Translocation of RNA Polymerase in Real Time

43

Required plasticware and other consumables: 4 × 10 ml twopart plastic syringes for filling and washing system drive syringes and flow lines, 2 × 1 ml low dead volume two-part plastic syringes for loading TEC and NTP solutions, blunt 18 G needle to maximize recovery of the TEC solution into loading syringe, 24× microcentrifuge tubes to collect quenched reactions. Additional hardware: water aspirator or vacuum pump with a liquid trap. Preparation of the quench-flow instrument for measurements 1. Turn on refrigerated water bath circulator to equilibrate the quench-flow water jacket to 25 °C. 2. Wash drive syringes and connection lines of quench-flow instrument with sterile mQ and then with methanol. Load the wash solutions first to the drive syringes (keep valves in LOAD position) and then push the liquids through the flow lines using quench-flow instrument computer controlled drive plate (valves in FIRE position). Dry by applying suction to the exit loop with water aspirator. 3. Load 1× TB10 to the left and right drive syringes using 10 ml all-plastic syringes. Load 0.5 M HCl to the middle drive syringe. Carefully remove air bubbles from drive syringes by repeatedly pushing solution between the loading and drive syringes. 4. Use quench-flow instrument computer to position drive plate so that buffer and quench connection lines are filled with 1× TB10 and 0.5 M HCl. 5. Wash sample ports thoroughly by injecting sterile mQ and then methanol with 10 ml all-plastic syringe. Dry by applying suction to the exit loop with water aspirator. Prepare reagents required for a typical 24 time-points experiment (12 time points in semi-logarithmic progression are required for a reliable estimate of nucleotide addition rate and should be measured in duplicate): 5 ml 0.5 M HCl, 15 ml 1× TB10, 5 ml neutralization buffer, 500 μl 0.5 μM TEC assembled on scaffold with excess of template strand over RNA (assemble TEC at 1 μM using Atto 680 5′ labeled RNA and dilute with 1× TB10), 600 μl 400 μM NTP solution in 1× TB10, 250 ml mQ, 100 ml methanol. Prepare two zero time-point samples: mix 12 μl NTP solution and 86 μl of 0.5 M HCl in a microcentrifuge tube. Add 12 μl of TEC solution and mix by pipetting the mixture back and forth. Immediately, add 171 μl of neutralization buffer and vortex briefly (see Note 31). Store the samples at −20 °C until you run the gel. Sample loading and data collection 1. Load the TEC and NTP solutions into separate 1 ml plastic syringes using blunt needle. Insert TEC syringe into the left

44

Anssi M. Malinen et al.

and NTP syringe—into the right sample port. Do not fill the sample lines yet. 2. Enter appropriate time point in seconds into quench-flow instrument computer. Select the suggested reaction loop from the 8-way valve wheel. Typical time-points for wild-type E. coli RNAP at 25 °C are 0.004, 0.007, 0.012, 0.020, 0.035, 0.064, 0.1, 0.3, 1, 3, 10 s. 3. Wash and dry the reaction loop by applying suction to the exit loop with water aspirator: aspirate first water, then methanol and finally air through the instrument wash ports. 4. Inject NTP solution precisely to point of connection to 8-way valve. 5. Inject TEC solution precisely to point of connection to 8-way valve. 6. Hold a labeled microcentrifuge tube below the instrument exit loop. Press G in the keyboard or fire button in the central unit to perform the reaction. Avoid spills. 7. Immediately after mixing, add 171 μl neutralization buffer to the quenched reaction and vortex briefly (see Note 31). Store the neutralized reactions at −20 °C until you run the gel. For the duration of the experiment neutralized reactions can be kept on ice. 8. Proceed to step 2 to measure the next time-point. If switching the reaction loop, wash the loop as described in step 3 before turning the 8-way valve to the new position. Finishing the experiment 1. Remove all loading syringes from the system and empty the drive syringes. 2. Wash sample ports thoroughly with sterile mQ and then methanol. Dry by injecting air with 10 ml syringes. 3. Wash middle drive syringe, port and flow line with excess of 1× TB10 buffer to neutralize the residual acid. 4. Wash drive syringes and connection lines with sterile mQ and then with methanol. Dry by applying suction to the exit loop with water aspirator. 3.7 Separation and Detection of RNA Products by Denaturing PAGE

Fluorescence translocation assays should best be accompanied by monitoring of the nascent RNA length whether or not it is expected to change throughout the experiment. For this purpose, the TECs are assembled using an excess of DNA template strands over RNA primers 5′ labeled with Atto 680 infrared fluorescent dye. These TECs are subjected to the conditions used for the fluorescent experiment, samples are taken at points of interest, and the

Translocation of RNA Polymerase in Real Time

45

nascent RNAs are released by exposure to 80 % formamide at 70 °C. Dissociated TECs are then separated on 20 cm 0.4 mm thick 16 % PA gels and the RNA species are visualized with Odyssey Infrared Imager. RNA band intensities are quantified using a dedicated software. We recommend freeware package ImageJ [14]. 32P can be used instead of Atto 680 for 5′ labeling of RNAs but the latter is ultimately cheaper, more convenient to work with, and offers a similar sensitivity. The protocol for separating RNAs by denaturing PAGE has been described elsewhere (Protocol 76 in [15, 16]) and is outside the scope of this chapter. 3.8

4

Data Analysis

A quick estimate of the translocation process half-life can be obtained trace addition = t 1translocation - t 1nucleotide using a relationship: t 1translocation /2 /2 /2 (Fig. 3c). Here, the fraction of extended RNA and translocation traces are approximated by monoexponential functions F (t ) = A + B × (1 - e-k ×t ) and half-lives are calculated as t 1/ 2 = ln 2 / k , where A is initial/background value, B is the signal amplitude, and k is the rate constant. However, translocation curves are only approximately described by the monoexponential function because (1) they represent a two-step sequential reaction and therefore feature a lag at early time points and (2) the assembled TECs contain a 5–30 % fraction of a slow/paused TEC (see Note 32). Accordingly, we recommend determining the translocation rate by global fitting of nucleotide addition time points and translocation traces to a set of rate equations (Fig. 4) using data fitting software with numerical integration capabilities; we use Scientist (Micromath, Saint Louis, MO, USA) and KinTek Explorer [17] (see Notes 33 and 34). Figure 4 contains all the information necessary to define a kinetic model, whereas the exact syntax will depend on the fitting software used (see Note 35). To ensure consistent and balanced weighting during fitting procedure it is recommended to pre-normalize the nucleotide addition time points to change from approximately 0 to 1, translocation trace data to change from approximately 1 to 2 and assign nucleotide addition time points weight of 50. The latter adjustment is needed to bring the weight of 24 points nucleotide addition dataset to the same scale as that of 1,000 points translocation trace.

Notes 1. Jena Bioscience 2′ dGTP contains trace amounts of GTP. We suggest buying 2′ dGTP from other suppliers. 2. Jena Bioscience GMPCPP (or impurities in its preparations) displays measurable fluorescence that needs to be taken into account. 3. Sequence that pairs with RNA primer can be extended to 10 or 11 nt at the expense of upstream DNA. TECs assembled on a

Anssi M. Malinen et al. ----------------------------------------------------------Reaction scheme: TEC16pause

A

TEC16post

ki ---> isomerization of paused TEC

B

TEC17post

TEC17pre

kc --->

C

nucleotide addition

kt ---> translocation

D

Initial conditions: T=0

A=p(≈0.2)

B=1-p(≈0.8)

C=0

D=0

-------------

----------------------------------------------------------Rate Initial Equations determining equations: conditions: dependent variables: -------------

46

T=0 RNA17=F1*(C+D) A’=-A*ki A=p FSF=F2*(A+B+C)+F3*D B’=-B*kc + A*ki B=1-p C’=-C*kt + B*kc C=0 D’=C*kt D=0 ----------------------------------------------------------Independent variables: T -time ----------------------------------------------------------Dependent variables: RNA17 -RNA17 band intensities from quench flow experiment FSF -Fluorescent trace from stopped-flow experiment ----------------------------------------------------------Parameters: ki -rate of isomerization of paused TEC into active TEC kc -rate of nucleotide incorporation kt -rate of translocation F1 -normalization coefficient for quench flow data F2 -normalization coefficient for stopped-flow data F3 -normalization coefficient for stopped-flow data p -fraction of paused TEC -----------------------------------------------------------

Fig. 4 Kinetic model for global analysis of translocation and nucleotide addition data. See Note 36

scaffold with 10- and 11-nt RNA–DNA hybrid are predictably more sensitive to pyrophosphorolysis and intrinsic RNA cleavage, respectively, than TECs assembled on scaffolds with a 9-nt RNA–DNA hybrid [18–20]. 4. Scaffolds containing purine-rich RNAs with G at the 3′ end produce the most stable and homogeneous TECs. If possible, avoid stretches of U. 5. To minimize read-through due to misincorporation, a purine acceptor base (i + 1 register) should be followed by a pyrimidine at i + 2 register and vice versa. 6. If P32/P33 detection is used in place of infrared fluorescence detection with Atto 680, RNAs as short as 12 nt can be used. There is no good reason to use RNA shorter than 12 nt because losses during the removal of unincorporated P32/P33 label using gel filtration spin columns are significantly higher for shorter RNA. 7. 5′ end of a 9 nt RNA can be extended with deoxyribonucleotides instead of ribonucleotides with considerable cost savings and

Translocation of RNA Polymerase in Real Time

47

improved stability. Such option is typically branded as a “chimeric oligo” by oligonucleotide synthesis companies. 8. Scaffold annealing and TEC assembly processes are bimolecular reactions and therefore can become very slow if reactant concentrations are reduced. Always carry out these procedures at the recommended reactant concentrations and dilute the assembled complex to the desired final concentration. 9. Work with 6-MI, 2-AP, and Atto 680 labeled oligos at normal laboratory light conditions but protect them from light whenever possible (i.e., when not actually pipetting them). Also avoid direct sunlight and unusually bright light sources. 10. For TECs with high intrinsic cleavage activity, MgCl2 concentration may need to be reduced to 1 or 0 mM. 11. Distorted spectra indicate the presence of microscopic air bubbles. Withdraw the solution from the cuvette and slowly pipette it back into the cuvette. Record the spectrum again. 12. The method has been developed and tested in spectrofluorometers equipped with excitation and emission monochromators but may also work in other types of devices. 13. Many compounds (or impurities in their commercial preparations) are intrinsically fluorescent, with excitation and emission spectra overlapping that of 2-AP and 6-MI. Check reagents for intrinsic fluorescence and take it into account when processing the data. 14. For the upstream detection, use buffer containing 10 mM Mg2+ because fluorescence of 6-MI at i − 8 is dependent on Mg2+ with KD of 5–10 mM. This effect is distinct from the effect of RNAP active site Mg2+ on translocation equilibrium that is characterized by KD in submillimolar range [8]. In contrast, the sensitivity of the downstream 2-AP system is not dependent on Mg2+ concentration. 15. Use low [NTP] (typically 5 μM) to prevent read through due to misincorporation. 16. Incubation times of 3–5 min after the reagent addition are usually sufficient to achieve equilibrium. Complete all desired additions in no longer than 20 min. Setup several separate experiments if many additions are desired. Note that TECs may undergo slow transitions, such as intrinsic RNA cleavage, during the experiment and also are eventually bleached and damaged by prolonged exposure to UV excitation light (330–340 nm). 17. For unknown reasons, FNTP_CMPCPP is usually ≈0.9 × FNTP for fully post-translocated TECs. 18. The inference assumes that the same fraction of TEC gets extended with rNMP and dNMP. This is typically the case but

48

Anssi M. Malinen et al.

is best verified by running samples from fluorescence measurements on a denaturing PA gel or performing a separate nucleotide addition experiment using the TEC assembled on the scaffold with an excess of template DNA. 19. While it is safe to assume that both rNMP and dNMP extended TECs are fully post-translocated when FNTP ≈ FdNTP, it is not guaranteed that dNMP extended TEC is fully post-translocated when FNTP < FdNTP so use the estimate with caution. The effects of a nonhydrolyzable NTP analogue on both rNMP and dNMP extended TECs may reveal if more TEC can move forward. 20. A low relative increase in fluorescence upon RNA extension may be due to suboptimal scaffold design, such as a strong propensity to backtrack, insufficient purity of the fluorescent oligo and/or unsuitable buffer conditions (such as high fluorescent background or low Mg2+ concentration; see Note 14). 21. It advisable to measure at least one trace with a longer time scale (100 or 1,000 s) to determine the temporal stability of the fluorescent signal and to detect possible slow phases of fluorescence change. 22. Averaging time per data point should be less than 5 % of the reaction half-life. 23. Air bubbles are the most common cause for artifacts in fluorescent traces. During loading of mQ or samples into the drive syringes, air bubbles easily get stuck within the loading port. To remove air bubbles, fill the drive syringes with mQ/sample, rapidly push the drive syringes up and wait until the released bubbles rise to liquid surface. Repeat this procedure until no more air bubbles appear. You may also gently tap the loading syringes to detach air bubbles from the syringe walls. 24. Stopped-flow priming and PMT adjustment consume approximately 240 and 360 μl of TEC and NTP solutions, respectively. 25. If signal intensities are low and/or signal-to-noise ratio is poor, use a higher TEC concentration. 26. Dust particles and/or precipitated proteins cause light scattering and create a noisy fluorescent signal. Before assembling the TEC, filter mQ and 1× TB10 using 0.45 μm syringe driven filter units. If a particulate matter is observed after TEC assembly, the sample can be filtered using low protein binding centrifugal filter devices (0.1–0.45 μm pores, e.g., Ultrafree-MC from Merck Millipore, Billerica, MA, USA). Filter the NTP solution in TB10 as well. 27. A more precious sample should be loaded into the right drive syringe because it has a shorter flow tubing to the mixing cell, and thus consumes less sample during priming.

Translocation of RNA Polymerase in Real Time

49

28. PMT voltage and V-offset should be kept the same throughout the experiment in order to collect data with comparable intensities. If the forward translocation assay fluorescence intensity increases in the course of the reaction, PMT voltage is adjusted so that the reaction product fluorescence constitutes 80 % of the dynamic range of the PMT. If measuring backward translocation (not described in this chapter), the PMT voltage is best set using solution of initial reactants under conditions where reaction is not allowed to proceed. 29. Averaging can also be performed with Origin data analysis software (Origin Labs, Northampton, MA, USA). 30. Scan gel directly in the glass sandwich using 3–4 mm focus offset. 31. Avoid prolonged exposure of RNA to acid; neutralize quenched reaction as soon as possible. 32. At the time of writing it is unclear whether heterogeneity is a natural property of TECs or an artifact of the assembly procedure. The slow/paused TEC can be modeled in a number of kinetically indistinguishable ways, out of which we favor to represent it as an inactive off-pathway state that slowly isomerizes into an active TEC. 33. At the time of writing KinTekExplorer cannot treat initial condition values as parameters and therefore cannot directly estimate the initial fractions of active and paused TEC from the data. Instead, one can model isomerization of the paused complex into the active complex as a slow equilibrium and introduce a 100 s mixing step without NTP into the virtual experiment setup (see Note 36). 34. Ensure that translocation curve is delayed relatively to nucleotide addition curve before using two-step model by plotting uniformly normalized curves on the same log-timescale graph. If translocation curve falls within the error margin of the nucleotide addition curve the translocation rate contributes too little to the total reaction half-live and cannot be determined from the data. For the measurably reversible systems the actual equilibrium fractions of the extended and non-extended RNA (the latter is not to be confused with the fraction of RNA that does not get extended under any conditions and is treated as background) as well as post- and pre-translocated product TEC need to be taken into account. For example nucleotide addition curve may need to be normalized to spread from 0 to 0.8 and translocation curve from 0 to 0.3. Also see Note 36. 35. A number of other kinetic data analysis packages have numerical integration capabilities but we have not tested them for global fitting of the nucleotide addition and translocation data: Berkeley Madonna (© 2000 by R. Macey, G. Oster, T. Zahley);

50

Anssi M. Malinen et al.

DynaFit (BioKin ltd., Watertown, MA, USA); IgorPro (WaveMetrics, Portland, OR, USA) and Tenua (Freeware; © 2007 by Daniel Wachsstock, based on KINSIM [21]). 36. (In Fig. 4): All steps in the model can be modeled as reversible by incorporating three more rate constants, ki−1, kc−1, kt−1. Moreover, non-zero ki−1 is always included into the model when fitting data with KinTek Explorer (see Note 33).

Acknowledgements This work was supported by the Academy of Finland grants 130581 and 263713 to G.A.B. Essential equipment was contributed by Walter and Lisi Wahl Foundation. References 1. von Hippel PH (1998) An integrated model of the transcription complex in elongation, termination, and editing. Science 281:660–665 2. Svetlov V, Nudler E (2009) Macromolecular micromovements: how RNA polymerase translocates. Curr Opin Struct Biol 19:701–707 3. Zhang J, Landick R (2009) Substrate Loading, Nucleotide Addition, and Translocation by RNA Polymerase. In: Buc H, Strick T (eds) RNA polymerases as molecular motors. Royal Society of Chemistry, Cambridge, pp 206–234 4. Erie DA, Kennedy SR (2009) Forks, pincers, and triggers: the tools for nucleotide incorporation and translocation in multi-subunit RNA polymerases. Curr Opin Struct Biol 19:708–714 5. Kireeva M, Kashlev M, Burton ZF (2010) Translocation by multi-subunit RNA polymerases. Biochim Biophys Acta Gene Regul Mech 1799:389–401 6. Cheung ACM, Cramer P (2012) A movie of RNA polymerase II transcription. Cell 149: 1431–1437 7. Hawkins ME (2007) Synthesis, purification and sample experiment for fluorescent pteridinecontaining DNA: tools for studying DNA interactive systems. Nat Protoc 2:1013–1021 8. Malinen AM, Turtola M, Parthiban M et al (2012) Active site opening and closure control translocation of multisubunit RNA polymerase. Nucleic Acids Res 40:7442–7451 9. Artsimovitch I, Svetlov V, Nemetski SM et al (2011) Tagetitoxin inhibits RNA polymerase through trapping of the trigger loop. J Biol Chem 286:40395–40400

10. Belogurov GA, Vassylyeva MN, Sevostyanova A et al (2009) Transcription inactivation through local refolding of the RNA polymerase structure. Nature 457: 332–335 11. Zuker M (2003) Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res 31:3406–3415 12. Holmes SF, Foster JE, Erie DA (2003) Kinetics of multisubunit RNA polymerases: experimental methods and data analysis. Methods Enzymol 371:71–81 13. Nedialkov YA, Gong XQ, Yamaguchi Y et al (2003) Assay of transient state kinetics of RNA polymerase II elongation. Methods Enzymol 371:252–264 14. Abramoff MD, Magalhaes PJ, Ram SJ (2004) Image processing with ImageJ. Biophotonics Int 11:36–42 15. Green MR, Sambrook J (2012) Separation of RNA according to Size: Electrophoresis of RNA through Denaturing Urea Polyacrylamide Gels. In: Green MR, Sambrook J (eds) Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, New York, pp 393–400 16. Summer H, Grämer R, Dröge P (2009) Denaturing urea polyacrylamide gel electrophoresis (Urea PAGE). J Vis Exp 32:1485 17. Johnson KA (2009) Fitting enzyme kinetic data with KinTek global kinetic explorer. Methods Enzymol 467:601–626 18. Yuzenkova Y, Zenkin N (2010) Central role of the RNA polymerase trigger loop in intrinsic

Translocation of RNA Polymerase in Real Time RNA hydrolysis. Proc Natl Acad Sci U S A 107: 10878–10883 19. Zhang J, Palangat M, Landick R (2010) Role of the RNA polymerase trigger loop in catalysis and pausing. Nat Struct Mol Biol 17:99–104 20. Hein PP, Palangat M, Landick R (2011) RNA transcript 3′-proximal sequence affects translo-

51

cation bias of RNA polymerase. Biochemistry 50:7002–7014 21. Barshop BA, Wrenn RF, Frieden C (1983) Analysis of numerical methods for computer simulation of kinetic processes: development of KINSIM – a flexible, portable system. Anal Biochem 130:134–145

Chapter 4 In Vitro and In Vivo Methodologies for Studying the Sigma 54-Dependent Transcription Martin Buck, Christoph Engl, Nicolas Joly, Goran Jovanovic, Milija Jovanovic, Edward Lawton, Christopher McDonald, Jörg Schumacher, Christopher Waite, and Nan Zhang Abstract Here we describe approaches and methods to assaying in vitro the major variant bacterial sigma factor, Sigma 54 (σ54), in a purified system. We include the complete transcription system, binding interactions between σ54 and its activators, as well as the self-assembly and the critical ATPase activity of the cognate activators which serve to remodel the closed promoter complexes. We also present in vivo methodologies that are used to study the impact of physiological processes, metabolic states, global signalling networks, and cellular architecture on the control of σ54-dependent gene expression. Key words Transcription activation, RNA polymerase, σ54, Open and closed promoter complexes, AAA+ proteins, Bacterial enhancer binding proteins, ATPase

1

Introduction The σ54 transcription system is distinctive amongst bacterial gene regulation systems in that the RNA polymerase (RNAP) closed promoter complex (RPC) fully forms, and then remains stably associated with promoter DNA until remodelled by its cognate AAA+ activator proteins in an ATP hydrolyzing reaction (Fig. 1). The ATP-dependent remodelling of σ54 within RPC yields the open promoter complex RPO, from which transcripts can be made [1] (Fig. 1). Since the activators work from remote upstream enhancerlike sites, they are called bacterial enhancer binding proteins (bEBPs). This property together with the involvement of ATP in the DNA melting process draws obvious comparison with the more complex eukaryotic transcription control of Pol II. Most in vitro studies of σ54-dependent transcription have been conducted with components from Escherichia coli, Salmonella, Aquifex aeolicus, Rhizobium sp., or Pseudomonas sp. bacteria (not

Irina Artsimovitch and Thomas J. Santangelo (eds.), Bacterial Transcriptional Control: Methods and Protocols, Methods in Molecular Biology, vol. 1276, DOI 10.1007/978-1-4939-2392-2_4, © Springer Science+Business Media New York 2015

53

54

Martin Buck et al.

Fig. 1 The gene transcription activation by σ54-holoenzyme (Eσ54). The enzyme RNA polymerase containing σ54 factor binds to −12 and −24 promoter sites forming a closed complex (RPc) due to a transient fork junction located at the −12 site. A bEBP complex bound to an Upstream Activation Sequence (UAS) ~150 bp upstream of the start site contacts σ54 via a DNA looping event facilitated by for example the Integration Host Factor (IHF), thereby forming the intermediate complex (RPi). Energy derived from the ATPase activity of the bEBP is used to remodel the promoter complex into an open complex (RPo)

an exhaustive list), and often heterologous systems have been used to evaluate activities of individual components. Below we describe one E. coli system employing the bEBP Phage Shock Protein F (PspF) [2], and one employing the Pseudomonas syringae codependent HrpRS bEBPs [3]. For PspF, its AAA+ domain (here we use amino acids 1–275) is sufficient for stimulating formation of RPOs, whereas the full-length HrpR and HrpS need to be coexpressed to form an active HrpRS assembly. When studying bEBPs with conventional receiver domains of the 2CR family, deleting these domains, phosphorylating them using either e.g., carbomyl phosphate or their cognate histidine protein kinase, or introducing a phosphor-mimic amino acid substitution would be necessary for obtaining active self-assemblies.

Revealing the σ54-RNAP Controlled Gene Expression

55

Although we describe approaches with purified components that can yield important inroads into using structural biology to help establish mechanism [4–7], much can also be gained using in vivo methods such as promoter fusions, two hybrid approaches [3] and single molecule imaging [8] for establishing determinants of component interactions and assembly, and localizations and dynamics of protein or protein–DNA complexes. In vivo methods not only allow for recapitulating biochemical data in the context of the living cell but may also reveal new regulatory features which cannot be obtained through in vitro experimentation. The methods presented here are transferable to many AAA+ bEBP proteins.

2 2.1

Materials Equipment

1. Protein purification system. 2. High-speed centrifuge, such as Beckman Avanti with JA-14 and JA-25.50 rotors (or comparable). 3. Sonicator. 4. Tabletop centrifuge. 5. SDS polyacrylamide gel electrophoresis (PAGE) apparatus. 6. Sequencing gel apparatus. 7. Power supplies. 8. Thin-layer chromatography (TLC) chamber. 9. A 4 °C cooled flat surface. 10. A short wavelength UV light source (e.g., 254 nm, e.g., UVG54, UVP Inc., CA). 11. Phosphor-Image reader, screens, and suitable quantification software; we use Fuji-Bas 1500 and Aida, respectively. 12. Facilities and training for safe working with 32P isotopes.

2.2 E. coli Cell Growth, Lysis, and Purification of Core RNAP and Klebsiella pneumoniae σ54

1. LB medium, Luria–Bertani broth per 1 l dH2O: 10 g peptone (or tryptone), 5 g yeast extract, 5 g NaCl. 2. 1 M isopropyl-beta-D-thiogalactopyranoside (IPTG) in dH2O. 3. Lysis Buffer: 20 mM Tris–HCl pH 8.0, 500 mM NaCl, 5 % glycerol. 4. Buffer A-1: 20 mM Tris–HCl pH 8.0, 250 mM NaCl, 5 % glycerol. 5. Buffer B-1: 20 mM Tris–HCl pH 8.0, 250 mM NaCl, 1 M imidazole, 5 % glycerol. 6. Dialysis Buffer-1: 50 mM Tris–HCl pH 8.0, 50 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 5 % glycerol. 7. Buffer A-2: 50 mM Tris–HCl pH 8.0, 50 mM NaCl, 10 mM MgCl2, 0.1 mM EDTA, 1 mM DTT, 5 % glycerol.

56

Martin Buck et al.

8. Buffer B-2: 50 mM Tris–HCl pH 8.0, 1 M NaCl, 10 mM MgCl2, 0.1 mM EDTA, 1 mM DTT, 5 % glycerol. 9. Dialysis Buffer-2: 20 mM Tris–HCl pH 8.0, 200 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 50 % glycerol. 2.3 Purification of E. coli PspF1–275

1. Buffer A: 25 mM NaH2PO4 pH 7.0, 500 mM NaCl, 5 % glycerol. 2. Buffer B: 25 mM NaH2PO4 pH 7.0, 500 mM NaCl, 1 M imidazole, 5 % glycerol. 3. Dialysis Buffer: 20 mM Tris–HCl pH 8.0, 200 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 5 % glycerol.

2.4 Purification of Pseudomonas sp. HrpR and HrpS

1. Buffer A: 50 mM sodium phosphate buffer pH 7.0, 50 mM NaCl, 0.1 mM EDTA, 5 % glycerol. 2. Buffer B: 50 mM sodium phosphate buffer pH 7.0, 50 mM NaCl, 0.1 mM EDTA, 1 M imidazole, 5 % glycerol. 3. Dialysis Buffer: 20 mM Tris pH 8.0, 50 mM NaCl, 0.1 mM EDTA, and 5 % glycerol.

2.5 In Vitro FullLength and Abortive Transcription Assays

1. 1× TM Buffer: 10 mM Tris–HCl pH 8.0, 10 mM MgCl2. 2. 1× STA Buffer: 2.5 mM Tris-Acetate pH 8.0, 8 mM Mg-Acetate, 10 mM KCl, 1 mM DTT, 3.5 % PEG 8000. 3. 1× TTH Buffer: 10 mM Tris–HCl, pH 7.5, 70 mM KCl, 5 mM MgCl2, 1 mM dithiothreitol, 1 mM EDTA, 12.5 % glycerol, and 0.1 % w/v Triton X-100. 4. Nucleotide mixture: 0.2 mM ATP, 0.1 mM GTP, 0.1 mM CTP, 0.05 mM UTP. 5. 3× Formamide Stop Dye: 3 mg xylene cyanol, 3 mg bromophenol blue, 0.8 ml 250 mM EDTA, 10 ml deionized formamide for a final volume of 10 ml. 6. 4 % sequencing gel: 8 ml commercial UreaGel Concentrate, 37 ml commercial SequaGel Diluent, 5 ml 10× TBE Buffer, 500 μl 10 % APS, and 40 μl TEMED. 7. 1× TBE Buffer: 0.089 M Tris base, 0.089 M boric acid pH 8.3, 2 mM Na2 EDTA. 8. 20 % sequencing gel: 20 ml commercial UreaGel Concentrate, 2.5 ml commercial SequaGel Diluent, 2.5 ml 10× TBE, 200 μl 10 % APS, 20 μl TEMED.

2.6 Trapping Assay with Nucleotide Analogues

1. 5× Native Loading Dye: 10 % glycerol, 0.5 mg bromophenol blue. 2. 4.5 % native gel: 0.75 ml acrylamide 37.5:1 (30 % acrylamide–0.8 % bis-acrylamide), 0.5 ml 10× TG, 3.75 ml H2O, 50 μl 10 % APS. 3. 1× TG Buffer: 0.025 M Tris base, 0.192 M glycine pH 8.4.

Revealing the σ54-RNAP Controlled Gene Expression

2.7 ATPase Assay Using TLC

57

1. 5× ATPase Buffer (e.g., for PspF and HrpRS): 20 mM Tris– HCl pH 8.0, 50 mM NaCl, 15 mM MgCl2, 0.1 mM EDTA, 10 μM DTT. (e.g., for NtrC bEBP as well as for PspF, one can use the buffer: 35 mM Tris-acetate, pH 8.0, 70 mM potassiumacetate, 15 mM magnesium acetate, 19 mM ammonium acetate, 0.7 mM DTT.) 2. ATP mixture: Unlabelled ATP and [α-32P] radiolabelled ATP with sufficiently high specific activity (e.g., 0.6 μCi/μl). 3. TLC running buffer: 0.4 M K2HPO4, 0.7 M boric acid.

2.8 UV Cross-Linking of Bound Nucleotides to Estimate ATP Binding

1. UV cross-linking buffer: 35 mM Tris-acetate, pH 8.0, 70 mM potassium-acetate, 15 mM magnesium acetate, 19 mM ammonium acetate, 0.7 mM DTT.

2.9 UV Cross-Linking Using the APAB Cross-Linker

1. Cross-linking dye: 0.25 M Tris–HCl pH 6.8, 25 % glycerol, 5 % SDS, 5 % β-mercaptoethanol, 0.5 g bromophenol blue, 5 M deionized urea.

2. [α-32P] and/or [γ-32P] radiolabelled ATP must be of high specific activity (e.g., 0.6 μCi/μl and 3,000 Ci/mmol).

2. 7.5 % SDS gel: 2.5 ml acrylamide 37.5:1 (30 % acrylamide–0.8 % bis-acrylamide), 2.5 ml Solution II, 5 ml H2O for the resolving gel. 2.10 Determining Proteins Oligomeric State by Gel Filtration

1. Gel filtration buffer: 20 mM Tris–HCl (pH 8), 50 mM NaCl and 15 mM MgCl2.

2.11 Transcriptional Reporter

1. Z buffer: 60 mM Na2HPO4, 40 mM NaH2PO4, 10 mM KCl, 1 mM MgSO4, 50 mM β-mercaptoethanol.

2.12 In Vivo Footprinting

1. TMD: 500 mM Tris–HCl pH 7.2, 100 mM MgSO4, 2 mM DTT. 2. Primer extension mix: 5 mM MgCl2, 5 mM Tris–HCl (pH 8.0), 1 mM of each dNTP, and 0.5 unit of Klenow fragment of DNA polymerase I.

2.13 Analysis of Protein Dynamics

3

1. Minimal growth medium: 50 mM MOPS, 2 mM MgSO4, 0.7 mM Na2SO4, 1.2 mM NH4NO3, 0.5 mM KH2PO4, 10 mM NH4Cl, 0.4 % w/v glucose (filter sterilized), 1× trace elements.

Methods

3.1 Preparation of E. coli Core RNAP

It is convenient to use the pVS10 plasmid (rpoA-proB-rpoC [Histag]-rpoZ) [9] to obtain overexpressed core RNAP; see also Chapter 2 in this volume.

58

Martin Buck et al.

1. Freshly transformed E. coli NovaBlue cells harboring the pVS10 plasmid are used to set up a 25 ml overnight culture in LB medium at 37 °C supplemented with ampicillin (100 μg/ml). 2. For overexpression, 20 ml of the overnight culture are used to inoculate 1 L of LB medium at 37 °C with ampicillin (100 μg/ ml) with vigorous shaking. 3. At OD600nm = 0.4, the culture is cold-shocked on ice for 20 min and then induced with 1 mM IPTG at 37 °C for 3 h. Cells are harvested by centrifugation (5,000 rpm or 4,420 × g, 15 min at 4 °C in a Beckman JA-14 rotor). 4. The cell pellet is resuspended in cold Lysis Buffer (20 ml Lysis Buffer per 1 l cell pellet) and disrupted by two rounds of sonication on ice (40 % energy, 2 s on/off pulse for 10 min in a SONICS Ultra Cell). 5. The lysate is centrifuged (14,000 rpm or 20,617 × g, 30 min at 4 °C in a Beckman JA-25.50 rotor) and half a tablet of the protease inhibitor cocktail (Roche) is added to the supernatant. 6. The supernatant is immediately loaded onto two preequilibrated HiTrap 5 ml NiNTA chelating columns on an AKTA or equivalent chromatography system at a flow rate of 0.5 ml/min. Prior to sample loading, the two chelating columns are washed with three volumes of filtered water and equilibrated with two volumes of Buffer A-1. 7. The protein-bound columns are washed with three volumes of 0 % Buffer B-1 at a 2 ml/min rate, followed by another three volumes of 3 % Buffer B-1 at 2 ml/min. 8. Proteins are eluted in 1 ml fraction size with a linear Buffer B-1 gradient up to 100 % in 40 min at 1 ml/min. 9. After analyzing on SDS-PAGE, fractions containing core RNAP are exchanged overnight at 4 °C with Dialysis Buffer-1 in a dialysis tube (MWCO 30 kDa) and stored at −80 °C. 10. Core RNAP is then subjected to a second round of purification. 10 ml of MgCl2 are added to the dialyzed protein sample before being loaded onto two HiTrap 5 ml Heparin columns pre-equilibrated with Buffer A-2 on an AKTA or equivalent chromatography system (see Note 1). 11. The protein-bound columns are washed with 0 % Buffer B-2 for three volumes and eluted in 1 ml fraction size at a linear Buffer B-2 gradient to 100 % in 60 min at 1 ml/min. 12. The SDS-PAGE analyzed fractions are dialyzed overnight at 4 °C in Dialysis Buffer-2 and stored at −80 °C.

Revealing the σ54-RNAP Controlled Gene Expression

3.2 Preparation of Klebsiella pneumoniae σ54

59

For historical reasons, we used the σ54 protein from K. pneumoniae which is essentially interchangeable in functionality with the E. coli σ54 [10]. The K. pneumonia σ54 can be expressed in high yields using the T7 promoter-controlled pET28b+ vector in E. coli BL21 (DE3) cells. 1. Freshly transformed cells are used to inoculate 1 l of LB medium supplemented with kanamycin (50 μg/ml) at 37 °C with vigorous shaking. 2. At OD600nm = 0.4, the cell culture is cold-shocked on ice for 20 min before induced with 1 mM IPTG at 37 °C for 3 h. 3. Cells are harvested by centrifugation (5,000 rpm or 4,420 × g, at 4 °C in a Beckman JA-14 rotor) and resuspended in cold Lysis Buffer (20 ml Lysis Buffer per 1 l of cell pellet). 4. Cells are disrupted by two rounds of sonication on ice (40 % energy, 2 s on/off pulse for 10 min). 5. Cell debris is removed by centrifugation (14,000 rpm or 20,617 × g, 30 min at 4 °C in a Beckman JA-25.50 rotor) and the supernatant is supplemented with half a tablet of protease inhibitor cocktail. 6. The soluble protein is loaded onto two HiTrap 5 ml NiNTA chelating columns pre-equilibrated with Buffer A-1. 7. After three volumes of 0 % Buffer B-1 wash followed by three volumes of 3 % Buffer B-1 wash, proteins are eluted in 1 ml fraction size at 1 ml/min under a linear Buffer B-1 gradient to 100 % in 40 min. 8. Fractions containing proteins are dialyzed in Dialysis Buffer-1 in a dialysis tube (MWCO 12–14 kDa) and stored at −80 °C. 9. The NiNTA-purified K. pneumoniae σ54 is cleaved free of Histag using a Thrombin Cleavage Capture Kit and subject to Heparin purification. 10. The dialyzed samples are loaded onto two HiTrap 5 ml Heparin columns pre-equilibrated with Buffer A-2 on an AKTA or equivalent chromatography system. 11. The protein-bound columns are washed with 0 % Buffer B-2 for three volumes and eluted in 1 ml fraction size at a linear Buffer B-2 gradient to 100 % in 60 min at 1 ml/min. 12. Proteins are dialyzed in Dialysis Buffer-2 and stored at −80 °C.

3.3 Preparation of E. coli PspF1–275

1. The E. coli bEBP PspF1–275 [11] is cloned into pET28b+ vector plasmid and overexpressed in an identical procedure to that used for σ54 (see above). 2. The PspF1–275 protein is subject only to NiNTA affinity chromatography using Buffer A and 7 % Buffer B for washing and

60

Martin Buck et al.

a 100 % Buffer B linear gradient (in 40 min at a 1 ml/min flow rate) for elution. 3. The fractions containing PspF1–275 are cleaved free of His-tag, dialyzed in Dialysis Buffer and stored at −80 °C. 3.4 Preparation of Pseudomonas sp. HrpR and HrpS

HrpRS proteins are expressed in high yields using the pQE70 highly expression vector in E. coli B834 cells. The hrpRS genes are cloned as operon under the strong T5 (IPTG inducible) promoter. HrpS has a 6×His tag at the C-terminus and HrpR is co-expressed and co-purified with HrpS6×His. The high transcription rate initiated at the T5 promoter is efficiently repressed by the presence of the lac repressor protein expressed from pREP4 vector (originally kanamycin resistance, our vector pREP4-Spc has inserted spectinomycin (Spc) cassette and therefore is Spc resistant). 1. Freshly transformed cells are used to inoculate 0.5 l of LB medium supplemented with Amp (100 μg/ml) and spectinomycin (50 μg/ml) at 25 °C with vigorous shaking. a. At OD600nm = 0.4–0.6, the cell culture is cold-shocked on ice for 20 min before induced with 0.3 mM IPTG at 16 °C for 16 h. 2. Cells are harvested by centrifugation (5,000 rpm or 4,420 × g, at 4 °C in a Beckman JA-14 rotor) and resuspended in cold Buffer A supplemented with protease inhibitor cocktail (20 ml Buffer A per 0.5 l cell pellet). 3. The resuspended cell pellets are disrupted by two rounds of sonication on ice (40 % energy, 2 s on/off pulse for 10 min). 4. Cell debris is removed by centrifugation (14,000 rpm or 20,617 × g, 30 min at 4 °C in a Beckman JA-25.50 rotor) and the soluble protein is loaded onto HiTrap 5 ml NiNTA chelating columns pre-equilibrated with Buffer A. 5. After 6–10 volumes of 0 % Buffer B wash, followed by 6–10 volumes of 7 % Buffer B wash, proteins are eluted in 1 ml fraction size at 1 ml/min under a linear Buffer B gradient to 100 % in 40 min. 6. Fractions containing proteins are dialyzed in Dialysis Buffer in a dialysis tube (MWCO 12–14 kDa) and stored at −80 °C.

3.5 Preparation of Promoter Templates for In Vitro Transcription

These are either plasmids based on pLA4 [12] or linear synthetic DNA duplexes used to allow the incorporation of photoreactive probes, unpaired regions or changes to start site sequences. Our usual test promoter is the Sinorhizobium meliloti nifH promoter. The sequence for the nifH non-template strand from −60 to +28 is: 5′-GAAAGAAAGCCGAGTAGTTTTATTTCAGACGGCTGG CACGACTTTTGCACGATCAGCCCTGGGCGCGCATGC TGTTGCGCATTCATGT-3′ (the consensus −24 “GG” and −12 “GC” elements are underlined).

Revealing the σ54-RNAP Controlled Gene Expression

61

A minimal scaffold contains an 8 bp RNA/DNA hybrid, an 18 bp downstream duplex and a gap immediately after the i + 1 site to accommodate the kink. Such organization mimics the DNA/ RNA in the crystal structure of the elongation complex [13] and is particularly suitable for studying σ-independent RNA polymerization. The oligonucleotide sequences for the minimal scaffold are: RNA, 8 nt: 5′-GUAGCGGA-3′. Template strand DNA, 28 nt: 5′-GGTCCTGTCTGAAATTG TTATCCGCTAC-3′. The non-template strand DNA, 18 nt: 5′-ACAATTTCAGA CAGGACC-3′. 1. DNA end-labelling reactions are carried out in 20 μl volumes, containing: 1 μM single-stranded linear DNA, 1 μl of [γ-32P] ATP, and 1 unit of T4 nucleotide kinase at 37 °C for 30 min. Then the T4 nucleotide kinase is heat-deactivated at 65 °C for 10 min. 2. To form stable DNA duplexes, 32P-labelled (or unlabelled) linear DNA is mixed with its unlabelled complementary strand in 1× TM Buffer (see Subheading 2.5), heated at 95 °C for 5 min and cooled gradually at room temperature. The DNA/RNA minimal scaffold is formed by the same procedure. These linear probes are used in transcription and trapping assays described below. 3.6 In Vitro FullLength Transcription Assay

This assay measures a full-length RNA synthesis from a target promoter using the full complement of rNTPs and α-32P labelled UTP. 1. The reactions are performed in 10 μl volumes, containing: 1× STA Buffer, 4 μM PspF1–275, 100 nM RNAP holoenzyme (1:4 ratio of E:σ54), 20 units of RNase Inhibitor (e.g., from Promega), 5 % glycerol, 4 mM dATP, and 20 nM DNA at 37 °C. [For HrpR-HrpS dependent transcription (0.8 μM HrpRS for the hrpL promoter or 2 μM HrpRS for the nifH promoter with addition of 20 nM IHF purified as described in ref. 14 reactions are performed as above but in 1× TTH Buffer and at room temperature (RT); HrpRS are temperature sensitive.] 2. Transcription with PspF1–275 is typically activated for 10 min at 37 °C [or for HrpR-HrpS at RT for 20 min (hrpL) or 1 h (nifH)]. To allow elongation to take place and to prevent further activation, a nucleotide mixture, 0.07 μCi/μl [α-32P]UTP (3,000 Ci/mmol) and 0.1 mg/ml heparin are added to the reaction for 10 min at 37 °C (or for HrpR-HrpS for 15–20 min at RT). 3. Reactions are quenched by 4 μl of 3× formamide stop dye and heated at 95 °C for 5 min.

62

Martin Buck et al.

4. 7 μl of each sample is loaded on a 4 % 35 × 43 cm sequencing gel. 5. The gel is run at 50 W for 1.5–2 h in 1× TBE Buffer in a BioRad Sequi-Gen system until the dye reaches the bottom of the gel, transferred to filter paper, and dried. 6. The dried gel is exposed to an IP imaging plate overnight and visualized; we use a Fuji Base-1500 PhosphorImager. 3.7 In Vitro Abortive Assay

This assay measures the synthesis of short primed RNA (spRNA) created with a −1 + 1 (UpG) or +1 + 2 (GpG) dinucleotide RNA primer and an appropriate (e.g., +2) α-32P labelled rNTP to yield a 3–4-mer for the nifH promoter (UpGpGpG or GpGpG). 1. The reactions are typically carried out in a similar manner to the full-length transcription assay. In a 10 μl volume, 1× STA Buffer, 4 μM PspF1–275, 100 nM holoenzyme (1:4 ratio of E:σ54), 20 units of RNase Inhibitor, 5 % glycerol, 4 mM dATP, and 20 nM DNA are incubated at 37 °C. 2. After a 10 min activation, elongation mixture containing 0.5 mM initiating dinucleotide primers, 0.2 μCi/μl [α-32P] GTP (3,000 Ci/mmol), and 0.2 mg/ml heparin is added. 3. After incubation for 10 min at 37 °C, the elongation is quenched by 4 μl of 3× formamide stop dye and heated at 95 °C for 5 min. 4. 7 μl of each sample is loaded on a 20 % sequencing gel. 5. The denaturing gel is run under 300 V for 35 min, directly exposed to an IP plate for 10 min. Transcripts are visualized and quantified.

3.8 In Vitro spRNA Assay Using HrpR-HrpS bEBPs

1. This assay is performed with a −1 + 1 UpA dinucleotide RNA primer and an α-32P labelled rNTP to yield a 3 mer for the hrpL promoter UpApC. In a 10 μl volume, 1× TTH Buffer, 0.8 μM HrpR-HrpS, 100 nM holoenzyme (1:4 ratio of E:σ54), 20 units of RNase Inhibitor, 4 mM dATP, and 20 nM DNA are incubated at RT. 2. After a 40 min activation, elongation mixture containing 0.5 mM initiating dinucleotide primers, 0.2 μCi/μl [α-32P] GTP (3,000 Ci/mmol), and 0.2 mg/ml heparin is added. 3. After incubation for 15 min at RT, the elongation is quenched by 4 μl of 3× formamide stop dye and heated at 95 °C for 5 min. 4. 7 μl of each sample is loaded on a 20 % sequencing gel. The denaturing gel is run under 300 V for 35 min, directly exposed to an IP plate for 10 min. Transcripts are visualized and quantified.

Revealing the σ54-RNAP Controlled Gene Expression

3.9 Trapping Assay with Nucleotide Analogues

63

To visualize stable interactions between the holoenzyme (±DNA) and PspF1–275 on a native gel, various nucleotide analogues mimicking different hydrolyzing states of ATP are used (e.g., AMP-AlFx for the ground state and ADP-AlFx for the transition state). 1. In 10 μl volumes, 2.35 μM σ54, 0.3 μM core RNAP, and (±) 50 nM radiolabelled DNA were pre-incubated with 1× STA Buffer (see Subheading 2.5), 5 mM NaF and nucleotides (4 mM ADP or AMP) at 37 °C for 5 min to allow RPC formation. 2. 10 μl of PspF1–275 is added to the reaction to allow contact between bEBP and Eσ54-DNA for 5 min at 37 °C. 3. Subsequently, 0.4 mM AlCl3 is added to allow the in situ formation of nucleotide analogues for 20 min at 37 °C. 4. Samples are mixed with 2.5 μl of 5× Native Loading Dye, loaded on a 4.5 % native gel and run at 150 V for 30 min in 1× TG Buffer. 5. Non-radiolabelled protein complexes are visualized using Sypro Ruby Stain (e.g., from Invitrogen) according to the manufacturer’s protocol. 6. When radiolabelled DNA is used, native gels are dried, developed for 1 h and analyzed.

3.10 Supershift σ54-DNA Isomerization Assay

In the presence of a hydrolysable nucleotide (ATP or dATP), PspF1–275 is able to isomerize a binary σ54-DNA complex (the early melted linear DNA probe harboring a −12−11 mismatch on the non-template strand to mimic the fork junction DNA) to a conformation with an extended DNase I protection [15]. This isomerization process is thought to proceed the full DNA melting seen in RPo and can generate a super-shifted band on a native gel. 1. In a 10 μl reaction volume, 10 μM PspF1–275, 4 mM dATP, 2.35 μM σ54, and 50 nM radiolabelled DNA are incubated in 1× STA Buffer (see Subheading 2.5) at 37 °C for 15 min. 2. Samples are mixed with 2.5 μl of 5× Native Loading Dye before loaded on a 4.5 % native gel (see Subheading 2.6). 3. Gels are dried, developed for 1 h, and scanned by PhosphorImager.

3.11 ATPase Assay Using TLC

The ATPase catalytic function of bEBPs resides in the AAA+ domain although GTP can also be hydrolyzed and supports transcriptional activation, at least in vitro [16]. bEBPs seem to exclusively hydrolyze ATP to ADP and Pi, since the apparent ADP hydrolysis of the AAA+ domain of NtrC1 from the thermophilic bacterium is attributable to a contaminating adenylate kinase [17]. Triphosphate nucleotide hydrolysis and binding can be measured using 32P labelled nucleotides, described here (and see Subheading 3.13), respectively.

64

Martin Buck et al.

Following incubation of bEBPs with a mixture of ATP and 32P labelled ATP, hydrolysis can be directly measured by separating Pi, AMP, ADP, ATP using thin-layer chromatography (TLC) followed by the quantification of resulting 32P labelled species by PhosphorImaging (Fig. 2). [α-32P]ATP and [γ-32P]ATP have both been used as nucleotide tracers to determine kinetic parameters of bEBPs,

Fig. 2 Thin-layer chromatograph and quantification following [α-32P]ATP hydrolysis by PspF1–275. (a) Chromatograph showing migration pattern of ATP and ADP after ATP hydrolysis by PspF1–275 for 0, 2, 5, 15, and 60 min (lanes 2–6 ) at 37 °C, and in the absence of PspF1–275 (lane 1). The numbered blue ovals indicate evaluation areas used for quantification of phospho-stimulated luminescence (PSL). (b) Table of intensity levels (in PSL) obtained for evaluation areas shown in (a)

Revealing the σ54-RNAP Controlled Gene Expression

65

although given good resolution between ATP and ADP during TLC, the use of [α-32P]ATP as substrate may offer the advantage of more accurate quantification of [α-32P]ATP and [α-32P]ADP during Phosphor-Imaging compared with [γ-32P]ATP and 32Pi (Fig. 2). The procedure described here was adapted from Babst et al. [18] to account for the specific buffer requirements for transcription activity of PspF and its relatively low ATPase activity [19]. Special considerations have to be taken into account when determining kinetic parameters for PspF and presumably other bEBPs, whose ATP hydrolysis rates depend on nucleotide binding stimulated assembly into ATPase competent higher order oligomers and nucleotide dependent allosteric subunit hydrolysis effects ([20] and see Note 2). Typically, an ATPase assay is performed in the lower micromolar range of protein (monomer) in ATPase buffer and the reaction started by the addition of the mixture ATP in the millimolar range (the cellular concentration of ATP is estimated to be between 1 and 3 mM [21]. 3.11.1 Hydrolysis Reaction

This example procedure allows for determining ATP hydrolysis rates during a time course experiment (maximally five time points) at a protein concentration of 20 μM with a starting ATP concentration of 1 mM. Preparation of ATP mix (for 50 samples): mix 50 μl of 10 mM ATP, 47 μl of H2O, and 3 μl of [α-32P]ATP (10 μCi/μl, 3,000 Ci/ mmol; see Note 3). 1. Add 5 μl of 40 μM protein to microtube, add 2 μl of 5× ATPase buffer, add 1 μl of H2O, start reaction by adding 2 μl of ATP mix, record time (see Note 4). 2. Remove 2 μl of the reaction at desired time points into 10 μl 2 M formic acid, stopping the reaction.

3.11.2 Thin-Layer Chromatography

TLC plate preparation: polyethyleneimine impregnated cellulose absorbant on polyester sheets (20 cm × 20 cm) separate ATP, ADP, AMP, and Pi, following the below procedure. On the absorbant surface of the TLC sheet, with a soft pencil as to not damage the absorbant, draw equal width vertical lane demarcation lines and one horizontal line 3 cm above the edge of the sheet to guide spotting of samples (see Note 5). 1. Spot 2 μl of the above stopped reactions on the vertical line, side by side for each sample. Samples are loaded approximately 3 cm above the bottom edge of the TLC plate (Polyethyleneimine, PEI, cellulose plate) (see Note 6). 2. Let air-dry for about 20 min (see Note 7). 3. Fill a TLC tank or any other suitable transparent glass container (e.g., beaker) with TLC running buffer (eluent), so that eluent depth does not exceed 2 cm.

66

Martin Buck et al.

4. Bend the sheet with the absorbant inwards so that the vertical edges nearly touch and use adhesive strips on the polyester sheet to fix this semi-roll. 5. Stand the semi-roll in the eluent with the spotted samples on the bottom, making sure the spotted samples are about 1 cm above the eluent. 6. Close the container to allow eluent vapors to saturate in the container (otherwise separation is poor). 7. Allow the eluent to migrate upwards by capillary flow until it reaches the top of the sheet (visibly wet, migration takes 2–3 h). The eluent should drive the complete separation of radiolabelled ADP from radiolabelled ATP (see Note 8). 8. Dry sheet (TLC plate) in air at RT (see also Note 7). 9. Cover TLC sheet in cling film (to protect the imaging plate). 10. Expose TLC sheet to imaging plate for 1–14 h (see Note 9). 3.11.3 Experimental Design and Data Analysis

The ATPase assay using TLC in conjunction with 32P labelled NTPs is highly sensitive and accurate. Highly purified proteins should be used since any contaminating ATPase activities will generate misleading results, especially for bEBPs with a low kcat (99 %. 3.3.2 Preparation of β, β′ and ω

1. Transform chemically competent E. coli strain BL21(DE3) per instructions of vendor with plasmid pET21d-rpoB-CH6, pET21a-rpoC-CH6, or pT7ω. Plate transformants to TYE agar containing 100 μg/mL ampicillin and incubate for 16 h at 37 °C. 2. Inoculate single colony into 10 mL LB containing 100 μg/mL ampicillin in 50 mL autoclave-sterilized Erlenmeyer flask, and shake vigorously for 12 h at 37 °C. 3. Inoculate culture from step 2 into 1 L LB containing 100 μg/ mL ampicillin in 2.8 L Fernbach flask, and shake vigorously at 37 °C until OD600 = 0.6. Add 1 mL 1 M IPTG, and shake vigorously for 3 h at 37 °C. 4. Transfer culture to 1 L polypropylene copolymer centrifuge bottle. Harvest cells by centrifugation for 30 min at 4,000 × g at 4 °C. 5. Resuspend cell pellet in 50 mL Buffer D containing 0.2 % sodium desoxycholate and one protease inhibitor cocktail tablet at 4 °C. Transfer suspension into a 50 mL polypropylene centrifuge tube and place tube on ice. 6. Lyse cells in using Avestin EmulsiFlex-C5 cell disrupter, passing suspension through cell disruptor at pressure of 10,000 psi, collecting lysate in 100 mL glass beaker on ice. Repeat three times.

Site-Specific Incorporation of Probes into RNA Polymerase…

121

7. Transfer lysate to a 50 mL polypropylene centrifuge tube. Centrifuge for 20 min at 15,000 × g at 4 °C. Discard supernatant. 8. Resuspend pellet in 10 mL Buffer D containing 0.2 % n-octylβ-D-glucopyranoside at 4 °C. Sonicate with five 30 s sonication pulses at 25 % maximum sonicator output (2 min pause between each pulse). Centrifuge for 20 min at 15,000 × g at 4 °C. Discard supernatant. 9. Resuspend pellet in 10 mL Buffer D containing 0.2 % n-octylβ-D-glucopyranoside at 4 °C. Sonicate as in step 8. Centrifuge for 20 min at 15,000 × g at 4 °C. Discard supernatant. 10. Resuspend pellet in 6 mL Buffer D at 4 °C. Place tube on ice, and sonicate 10 s at 25 % maximum sonicator output. Divide into 1.5 mL aliquots, and transfer to 1.7 mL polypropylene microcentrifuge tubes. Centrifuge for 5 min at 13,000 × g at 4 °C. Discard supernatant. 11. Add 100 μL ice-cold Buffer D containing 10 % glycerol. Store at −80 °C (stable for at least 1 year). Expected yield: 50–100 mg (12.5–25 mg/aliquot). Expected purity: 50–90 %. 3.3.3

Preparation of σ70

1. Transform chemically competent E. coli strain BL21(DE3) per instructions of vendor with plasmid pGEMD. Plate transformants to TYE agar containing 200 μg/mL ampicillin and incubate for 16 h at 37 °C. 2. Inoculate single colony into 10 mL LB containing 200 μg/mL ampicillin in 50 mL Erlenmeyer flask, and shake vigorously for 12 h at 37 °C. 3. Inoculate culture from step 2 into 1 L LB containing 200 μg/ mL ampicillin in 2.8 L Fernbach flask, and shake vigorously at 37 °C until OD600 = 0.6. Add 1 mL 1 M IPTG, and shake vigorously for an additional 3 h at 37 °C. 4. Transfer culture to 1 L polypropylene copolymer centrifuge bottle, and collect cells by centrifugation for 20 min at 5,000 × g at 4 °C. Discard supernatant. 5. Resuspend cell pellet in 40 mL Buffer E containing 0.2 % sodium desoxycholate and one protease inhibitor cocktail tablet at 4 °C. 6. Lyse cells in using Avestin EmulsiFlex-C5 cell disrupter, passing suspension through cell disruptor at pressure of 10,000 psi, collecting lysate in 100 mL glass beaker on ice. Repeat three times. 7. Transfer lysate to 50 mL polypropylene centrifuge tube. Centrifuge for 20 min at 15,000 × g at 4 °C. Discard supernatant.

122

Anirban Chakraborty et al.

8. Resuspend pellet in 20 mL Buffer E containing 0.2 % sodium desoxycholate, 0.2 % n-octyl-β-D-glucopyranoside, and 0.02 % lysozyme, and sonicate 2 min at 40 % duty cycle and 40 % maximum output. Centrifuge for 20 min at 15,000 × g at 4 °C. Discard supernatant. 9. Resuspend the pellet in 20 mL Buffer E containing 0.2 % sodium desoxycholate and 0.5 % Triton X-100, and sonicate as in step 7. Centrifuge for 20 min at 15,000 × g at 4 °C. Discard supernatant. 10. Solubilize pellet in 40 mL Buffer F. Break pellet by pipetting gently. Incubate for 20 min at 4 °C. 11. Centrifuge for 20 min at 15,000 × g at 4 °C. Transfer supernatant to a new 50 mL polypropylene centrifuge tube. 12. Dialyze using 3.5 kDa molecular-weight-cutoff dialysis tubing against two 2 L changes of Buffer TGEβ containing 0.2 M NaCl for 16 h at 4 °C. 13. Remove particulates by centrifugation for 20 min at 15,000 × g at 4 °C. Apply supernatant at 1 mL/min flow-rate to Mono-Q HR 10/10 column pre-equilibrated in 40 mL Buffer TGED containing 0.2 M NaCl. Wash column with 16 mL Buffer TGED containing 0.2 M NaCl. Elute column at 1 mL/min flow-rate with 160 mL linear gradient of 0.2–0.6 M NaCl in Buffer TGED. Collect 2 mL fractions. 14. Transfer 10 μL aliquot of each fraction to 1.7 mL polypropylene microcentrifuge tube, and add 2 μL 6× SDS-loading buffer, heat for 5 min at 100 °C, and apply to 10 % polyacrylamide (37.5:1 acrylamide–bisacrylamide), 0.1 % SDS, slab gel (10 × 7 × 0.075 cm). As marker, load into adjacent lane 5 μL prestained protein molecular-weight markers. Electrophorese in SDS-running buffer at 25 V/cm until bromophenol blue reaches bottom of gel. Stain gel by gently shaking for 10 min in 50 mL 0.2 % Coomassie Brilliant Blue R-250 in destaining solution. Destain by gently shaking for 1 h in 100 mL destaining solution. 15. Pool fractions containing σ70 (typically fractions near 0.36 M NaCl in Buffer TGED), and concentrate ~6-fold using 30 kDa molecular-weight-cutoff Amicon Ultra centrifugal filter unit. 16. Determine protein concentration using Bradford Protein Assay Kit per procedure of vendor. 17. Dialyze pooled fractions using 3.5 kDa molecular-weightcutoff dialysis tubing against 500 mL buffer G for 8 h at 4 °C (or, as simpler alternative, mix pooled fractions with equal volume of glycerol), and store in 1 mL aliquots at −80 °C (stable for at least 1 year). Expected yield: 50–80 mg (5–8 mg/ aliquot). Expected purity: >95 %.

Site-Specific Incorporation of Probes into RNA Polymerase…

3.4 UnnaturalAmino-Acid Mutagenesis of RNAP Subunits and σ70 3.4.1 Unnatural-AminoAcid Mutagenesis of FLAG-αNTDI-GSGGSG-­ αNTD II, β, β′ and ω

123

1. Introduce amber codon (TAG) at site of interest in plasmid pET28a-NF-αNTDI-αNTDII, pET21d-rpoB-CH6, pET21arpoC-CH6, or pT7ω by site-directed mutagenesis using QuikChange II Site-Directed Mutagenesis Kit per instructions of vendor. 2. Transform chemically competent E. coli strain BL21(DE3) per instructions of vendor with plasmid pEVOL-pAzF. Plate transformants to TYE agar plates containing 50 μg/mL chloramphenicol and incubate for 16 h at 37 °C. 3. Pick single colony and inoculate into 5 mL LB broth containing 50 μg/mL chloramphenicol in 14 mL polypropylene culture tube. Shake vigorously for 16 h at 37 °C. 4. Inoculate 50 μL into 5 mL LB broth containing 50 μg/mL chloramphenicol in 14 mL polypropylene culture tube. Shake vigorously at 37 °C until OD600 = 0.3–0.4. 5. Transfer 1 mL aliquot to a 1.7 mL microcentrifuge tube. Centrifuge for 10 min at 1,000 × g at 4 °C, and discard supernatant. 6. Resuspend pellet gently in 300 μL of Buffer H. Incubate for 20 min on ice. Centrifuge for 10 min at 1,000 × g at 4 °C and discard supernatant. 7. Resuspend pellet gently in 100 μL Buffer H. Freeze in dry-ice/ ethanol bath and store at −70 °C. 8. Transform chemically competent BL21(DE3) pEVOL-pAzF cells from step 7 with amber-codon-containing plasmid from step 1. Plate transformants onto TYE agar containing 50 μg/ mL chloramphenicol and either 40 μg/mL kanamycin (for pET28a-NF-αNTDI-αNTDII derivatives) or 100 μg/mL ampicillin (for pET21d-rpoB-CH6, pET21a-rpoC-CH6, or pT7ω derivatives). Incubate for 16 h at 37 °C. 9. Pick single colony and inoculate into 10 mL LB broth containing 50 μg/mL chloramphenicol and either 40 μg/mL kanamycin (for pET28a-NF-αNTDI-αNTDII derivatives) or 100 μg/mL ampicillin (for pET21d-rpoB-CH6, pET21arpoC-CH6, or pT7ω derivatives) in 50 mL autoclave-sterilized Erlenmeyer flask, and shake vigorously for 12 h at 37 °C. 10. Inoculate culture from step 10 into 1 L LB broth containing 50 μg/mL chloramphenicol and either 40 μg/mL kanamycin (for pET28a-NF-αNTDI-αNTDII derivatives) or 100 μg/mL ampicillin (for pET21d-rpoB-CH6, pET21a-rpoC-CH6, or pT7ω derivatives) in 2.8 L Fernbach flask, and shake vigorously at 37 °C until OD600 = 0.6. Add 4-azido-L-phenylalanine to final concentration of 1 mM, add 1 mL 20 % arabinose and 1 mL 1 M IPTG, and shake vigorously for 4 h at 37 °C in the dark.

124

Anirban Chakraborty et al.

11. Follow steps 5–15 from Subheading 3.3.1 (for pET28aNF-αNTDI-αNTDII derivatives) or steps 4–11 from Subheading 3.3.2 (for pET21d-rpoB-CH6, pET21a-rpoCCH6, or pT7ω derivatives) to purify the resulting 4-azidophenylalanine-labelled proteins. 3.4.2 Unnatural-AminoAcid Mutagenesis of σ70

1. Introduce amber codon (TAG) at site of interest in plasmid pGEMD by site-directed mutagenesis using QuikChange II Site-Directed Mutagenesis Kit per instructions of vendor. 2. Perform steps 2–7 from Subheading 3.4.1. 3. Transform chemically competent BL21(DE3) pEVOL-pAzF cells from step 2 with amber-codon-containing plasmid from step 1. Plate transformants onto TYE agar containing 35 μg/mL chloramphenicol and 200 μg/mL ampicillin. Incubate for 16 h at 37 °C. 4. Pick single colony and inoculate into 50 mL LB broth containing 35 μg/mL chloramphenicol and 200 μg/mL ampicillin in 250 mL autoclave-sterilized Erlenmeyer flask, and shake vigorously for 16 h at 37 °C. 5. Transfer to a 50 mL polypropylene tube, and centrifuge for 5 min at 3,000 × g at room temperature. Discard supernatant. 6. Resuspend pellet in 10 mL M9+ medium, inoculate into 1 L M9+ medium containing 35 μg/mL chloramphenicol, 200 μg/mL ampicillin, and 1 mM 4-azido-L-phenylalanine in 2.8 L Fernbach flask, and shake vigorously at 37 °C in the dark until OD600 = 0.5. Add 1 mL 20 % L-arabinose, and shake vigorously at 37 °C in the dark until OD600 = 0.6. Add 1 mL 1 M IPTG, and shake vigorously for 3 h at 37 °C in the dark. 7. Follow steps 4–9 from Subheading 3.3.3 to purify the resulting 4-azidophenylalanine-labelled protein. 8. Resuspend pellet in 10 mL Buffer E containing 10 % glycerol. Store in 1.5 mL aliquots at −80 °C (stable for at least 1 year). Expected yield: 30–50 mg (4.5–7.5 mg/aliquot).

3.5 Staudinger– Bertozzi Ligation of Unnatural-AminoAcid-Containing RNAP Subunits and σ70 3.5.1 Staudinger– Bertozzi Ligation of Unnatural-Amino-AcidContaining FLAG-αNTDIGSGGSG-αNTDII,β, β′, or ω

1. Thaw aliquot of 4-azidophenylalanine-labelled FLAG-αNTDIGSGGSG-αNTDII, β, β′, or ω from Subheading 3.4.1 by placing on ice for 10 min. Centrifuge for 1 min at 13,000 × g. Discard supernatant. 2. Solubilize pellet in 1 mL Buffer J. Mix with pipette. Centrifuge for 2 min at 13,000 × g. Transfer supernatant to a new 1.7 mL polypropylene microcentrifuge tube. Determine protein concentration using Bradford Protein Assay Kit per procedures of vendor (typically 9–12 mg/mL). 3. Prepare 2.55 mL solution containing 30 μM solubilized 4-azidophenylalanine-labelled protein in Buffer J in a 15 mL polypropylene centrifuge tube.

Site-Specific Incorporation of Probes into RNA Polymerase…

125

4. Prepare 0.45 mL solution containing 2 mM probe-phosphine from Subheading 3.1 in DMF. 5. Add solution of step 4 to solution of step 3. Incubate for 16 h at 37 °C, rocking gently. 6. Apply 1 mL aliquot of reaction mixture of step 5 to each of three 10 mL Bio-Gel P30 columns (prepared by adding 20 mL BioGel P30 to 20 mL Econo Pac column, removing snap-off tip at bottom, and allowing liquid to drain; pre-equilibrated in Buffer J by application of 30 mL Buffer J to top of column bed). Wash each column with 3 mL Buffer J. Elute each column with 4 mL buffer J. Collect 1 mL fractions. 7. Identify fractions containing probe-labelled protein by removing 20 μL aliquots, diluting with 80 μL Buffer J, and measuring UV/Vis absorbance using spectrophotometer (559 nm for Cy3B-labelled protein; 650 nm for Alexa 647-labelled protein). 8. Pool fractions containing probe-labelled protein, add glycerol to a final concentration of 5 %, and store in 1 mL aliquots at −80 °C (not stable to prolonged storage; use within 48 h). Expected yield: 0.5–10 mg (0.15–3 mg per aliquot). 3.5.2 Staudinger– Bertozzi Ligation of Unnatural-Amino-AcidContaining σ70

1. Thaw aliquot of 4-azidophenylalanine-labelled σ70 from Subheading 3.4.2 by placing on ice for 10 min. 2. Perform steps 2–8 from Subheading 3.5.1. 3. Pool fractions containing probe-labelled protein. Centrifuge for 20 min at 15,000 × g at 4 °C. Transfer supernatant to a 15 mL polypropylene centrifuge tube. 4. Dialyze using 3.5 kDa molecular-weight-cutoff dialysis tubing against two 1 L changes of Buffer TGEβ containing 0.2 M NaCl for 16 h at 4 °C. 5. Remove particulates by centrifugation for 20 min at 15,000 × g at 4 °C. Apply supernatant at 1 mL/min flow-rate to Mono-Q HR 10/10 column pre-equilibrated in 40 mL Buffer TGED containing 0.2 M NaCl. Wash column with 16 mL Buffer TGED containing 0.2 M NaCl. Elute column at 1 mL/min flow-rate with 160 mL linear gradient of 0.2–0.6 M NaCl in Buffer TGED. Collect 2 mL fractions. 6. Identify fractions containing probe-labelled protein by removing 20 μL aliquots, diluting with 80 μL Buffer TGED, and measuring UV/Vis absorbance using spectrophotometer (559 nm for Cy3B-labelled protein; 650 nm for Alexa 647-labelled protein). 7. Mix pooled fractions with an equal volume of glycerol, and store in 1 mL aliquots at −80 °C (stable for at least 1 year). Expected yield: 0.5–1 mg (50–100 μg per aliquot).

126

Anirban Chakraborty et al.

3.6 Quantitation of Labelling Efficiency and Specificity 3.6.1 Quantitation of Labelling Efficiency and Specificity for FLAG-αNTD IGSGGSG-αNTDII, β, or β′

1. Apply 0.5–1.0 mg of probe-labelled FLAG-αNTDI-GSGGSG-­ αNTDII, β, or β′ from Subheading 3.5.1 to 1 mL Ni:NTA agarose column pre-equilibrated in Buffer J containing 5 mM imidazole. Wash column with 5 mL buffer J containing 20 mM imidazole. Elute column with 3 mL buffer J containing 300 mM imidazole. Collect 0.5 mL fractions. 2. Identify fractions containing probe-labelled protein by removing 20 μL aliquots, diluting with 80 μL Buffer J, and measuring UV/Vis absorbance using spectrophotometer. 3. Pool fractions containing probe-labelled protein, and dialyze using 3.5 kDa molecular-weight-cutoff dialysis tubing against 500 mL buffer D for 16 h at 4 °C. 4. Remove 20 μL aliquot, dilute with 80 μL Buffer J, and measure UV/Vis absorbance using spectrophotometer. 5. Calculate the concentration of probe-labelled protein and the labelling efficiency, as:

concentration of probe-labelled protein = éë A280 - e F, 280 ( Amax / e F,max )ùû / eP, 280

(

)

efficiency = 100 % é Amax / e F, max / ( concentration of probe-labelled protein ) ù , ë û where A280 is the measured absorbance at 280 nm, Amax is the measured absorbance at the long-wavelength absorbance maximum of fluorescent probe F (559 and 652 nm for Cy3B and Alexa 647, respectively), εP,280 is the molar extinction coefficient of protein P at 280 nm (13,410, 86,070, and 100,060 M−1 cm−1 for FLAG-αNTDI-GSGGSG-αNTDII, β, and β′, respectively), εF,280 is the molar extinction coefficient of fluorescent probe F at 280 nm (10,400 and 7,350 M−1 cm−1 for Cy3B and Alexa 647, respectively), and εF,max is the extinction coefficient of fluorescent probe F at its long-wavelength absorbance maximum (130,000 and 240,000 M−1 cm−1 for Cy3B and Alexa 647, respectively). 6. In order to quantify labelling specificity for probe-labelled FLAG-αNTDI-GSGGSG-αNTDII, β, or β′, perform parallel Staudinger–Bertozzi ligation using non-4-azido-phenylalanine-labelled FLAG-αNTDI-GSGGSG-αNTDII, β, or β′, respectively, analyze product as in steps 1–6 above, and calculate labelling specificity as: specificity = 100 % éë1 - ( efficiency P / efficiency P-azide ) ùû , where efficiencyP-azide is the labelling efficiency with the 4-azidophenylalanine-containing protein and efficiencyP is the labelling efficiency with the corresponding non-4-azidophenylalaninecontaining protein.

Site-Specific Incorporation of Probes into RNA Polymerase… 3.6.2 Quantitation of Labelling Efficiency and Specificity for σ70

127

1. Thaw aliquot of probe-labelled from Subheading 3.5.2 by placing on ice for 10 min. 2. Remove 20 μL aliquot, dilute with 80 μL Buffer TGED, and measure UV/Vis absorbance using spectrophotometer. 3. Calculate the concentration of probe-labelled protein and the labelling efficiency, as:

concentration of probe-labelled protein = éë A280 - e F, 280 ( Amax / e F,max )ùû / eP, 280 efficiency = 100 % éë( Amax / eF ,max ) / ( concentration of probe-labelled protein ) ùû , where A280 is the measured absorbance at 280 nm, Amax is the measured absorbance at the long-wavelength absorbance maximum of fluorescent probe F (559 and 652 nm for Cy3B and Alexa 647, respectively), εP,280 is the molar extinction coefficient of protein P at 280 nm (41,370 M−1 cm−1 for σ70), εF,280 is the molar extinction coefficient of fluorescent probe F at 280 nm (10,400 and 7,350 M−1 cm−1 for Cy3B and Alexa 647, respectively), and εF,max is the extinction coefficient of fluorescent probe F at its long-wavelength absorbance maximum (130,000 and 240,000 M−1 cm−1 for Cy3B and Alexa 647, respectively). 4. In order to quantify the labelling specificity of probe-labelled σ70, perform parallel Staudinger–Bertozzi ligation using non4-azido-phenylalanine-labelled σ70, respectively, analyze product as in steps 1–3 above, and calculate labelling specificity as: specificity = 100 % éë1 - ( efficiency P / efficiency P-azide ) ùû , where efficiencyP-azide is the labelling efficiency with the 4-azidophenylalanine-containing protein and efficiencyP is the labelling efficiency with the corresponding non-4-azidophenylalaninecontaining protein. 3.7 Reconstitution of Labelled RNAP Core and Labelled RNAP Holoenzyme

1. For RNAP derivatives containing unlabelled FLAG-αNTDIGSGGSG-αNTDII, unlabelled β, unlabelled β′, and/or unlabelled ω, thaw aliquots of unlabelled FLAG-αNTDIGSGGSG-αNTDII, unlabelled β or β′, and/or unlabelled ω by placing on ice for 10 min. Centrifuge each aliquot for 1 min at 13,000 × g. Discard each supernatant. Solubilize each pellet in 1 mL buffer J. If protein concentrations have not been determined previously, determine protein concentration using Bradford Protein Assay Kit per procedure of vendor. 2. For RNAP derivatives containing labelled FLAG-αNTDIGSGGSG-αNTDII, labelled β, labelled β′, labelled ω, and/or unlabelled or labelled σ70, thaw aliquots of labelled FLAGαNTDI-GSGGSG-αNTDII, labelled β, labelled β′, labelled ω,

128

Anirban Chakraborty et al.

and/or unlabelled or labelled σ70 by placing on ice for 10 min. If protein concentrations have not been determined previously, determine protein concentration using Bradford Protein Assay Kit per procedure of vendor. 3. Prepare RNAP core reconstitution mixture by combining 4.2 mg (80 nmol) FLAG-α-NTDI-GSGGGSG-NTDII, 3 mg (20 nmol) β, 7.8 mg (50 nmol) β′, and 200 mg (200 nmol) ω, in 60 mL buffer F in a 100 mL polypropylene tube. 4. Dialyze RNAP core reconstitution mixture in regeneratedcellulose dialysis bag against two 2 L changes of buffer K for 16 h at 4 °C. 5. Transfer RNAP core reconstitution mixture to 50 mL polypropylene centrifuge tubes. Centrifuge for 30 min at 20,000 × g at 4 °C. 6. Transfer supernatant to a new 50 mL polypropylene centrifuge tubes. For preparation of RNAP core, incubate tubes 45 min at 30 °C. For preparation of RNAP holoenzyme, supplement each tube with 0.35 mg (5 nmol) σ70, and incubate 45 min at 30 °C. 7. Centrifuge for 30 min at 20,000 × g. Transfer supernatant to a new 100 mL polypropylene centrifuge tubes at 4 °C. 8. During incubation in step 6, prepare 3 mL ANTI-FLAG M2 column by pouring 6 mL ANTI-FLAG M2 suspension into 20 mL Econo-Pac column, removing snap-off tip at bottom of column, and allowing liquid to drain; wash column with 9 mL 0.1 M glycine–HCl, pH 3.5; and wash column with 15 mL buffer B (see Note 10). 9. Apply supernatant from step 7 to ANTI-FLAG M2 column. Collect and reload flow-through. Wash column with 30 mL buffer B. Elute column with buffer B containing 0.1 mg/mL FLAG peptide. Collect 1 mL fractions. 10. Identify fractions containing protein using Bradford Protein Assay Kit. 11. Dialyze pooled protein-containing fractions in regeneratedcellulose dialysis bag against 1 L buffer L for 16 h at 4 °C. 12. Centrifuge for 20 min at 20,000 × g. Transfer supernatant to a new 50 mL polypropylene centrifuge tube. 13. Apply sample to Mono-Q HR 10/10 column pre-equilibrated in buffer M. Wash column with 24 mL buffer M. Elute column with 160 mL linear gradient of 300–500 mM NaCl. Collect 2 mL fractions. 14. Identify fractions by SDS-PAGE and Coomassie staining. Pool fractions containing RNAP.

Site-Specific Incorporation of Probes into RNA Polymerase…

129

15. Concentrate pooled fractions to ~125 μL using 100 kDa molecular-weight-cutoff Amicon Ultra-4 centrifugal filter unit. 16. Transfer sample into a 1.7 mL polypropylene microcentrifuge tubes. Add 2-mercaptoethanol to final concentration of 1 mM and glycerol to final concentration of 50 %. Mix and store at −20 °C. Typical yields are ~0.2 mg per 60 mL reconstitution mixture.

4

Notes 1. We have listed suppliers for key reagents in our protocol. Sufficiently pure reagents from alternative suppliers likely will suffice. 2. Cy3B has excitation and emission maxima of 559 and 570 nm, respectively. Alexa 647 has excitation and emission maxima of 650 and 668 nm, respectively. Cy3B and Alexa 647 have been used as a donor–acceptor pair for determination of distances by measurement of fluorescence resonance energy transfer (FRET; [16]). When Cy3B and Alexa 647 are used as a donor– acceptor pair, Ro, the distance at which donor–acceptor FRET efficiency is half-maximal, is ~60 Å [16]. 3. NHS esters are moisture-sensitive. Store NHS-ester containing compounds dry in desiccator containing Drierite desiccant at −20 °C. Equilibrate vials to room temperature before opening. Prepare stock solutions immediately before use. 4. Fluorescent compounds are light-sensitive. Minimize exposure to light. 5. MDPT can be synthesized by procedures in ref. 31. 6. Solvents for HPLC should be de-gassed by bubbling argon for 15 min. A Pasteur pipette is used to direct argon to bottom of solvent container, allowing bubbling from bottom of solvent container. De-gassing is particularly important for solvents for HPLC of phosphine derivatives, since dissolved oxygen in non-de-gassed solvents oxidizes phosphines to non-reactive phosphine oxides. 7. Reaction mixtures and HPLC fractions for preparation are dried under vacuum in a SpeedVac without heating. It typically takes several hours to dry microliter-scale reaction mixtures and ≥12 h to dry milliliter-scale HPLC fractions. 8. When analyzing trityl-containing compounds by mass spectrometry with CHCA as MALDI matrix, acid-catalyzed detritylation may occur, resulting in non-detection of the m/z signal for the trityl-containing compound and detection instead of the m/z signal for the corresponding detritylated compound.

130

Anirban Chakraborty et al.

9. FLAG-αNTDI-GSGGSG-αNTDII is a fusion protein comprising an N-terminally FLAG-tagged first E. coli RNAP α subunit N-terminal domain (α residues 1–235; αNTDI), followed by a GlySerGlyGlySerGly linker, followed by a second E. coli RNAP α subunit N-terminal domain (α residues 1–235; αNTDII) [16]. The use in this procedure of FLAG-αNTDI-GSGGSG-­αNTDII instead of N-terminally FLAG-tagged wild-type RNAP α subunit results in higher yields and equal or higher specific activities [16]. RNAP derivatives containing FLAG-αNTDIGSGGSG-αNTDII behave indistinguishably from RNAP derivatives containing wild-type α subunit in transcription initiation and elongation [16]. 10. ANTI-FLAG M2 columns should be activated with glycine– HCl no more than 20 min before application of samples.

Acknowledgements We thank Peter Schultz and Ryan Mehl for plasmids. This work was supported by National Institutes of Health grant GM041376 and a Howard Hughes Medical Institute Investigatorship to R.H.E. References 1. Miyake R, Murakami K, Owens J, Greiner D, Ozoline O, Ishihama A, Meares C (1998) Dimeric association of Escherichia coli RNA polymerase α subunits, studied by cleavage of single-cysteine alpha subunits conjugated to iron-(S)-1-[p(bromoacetamido)benzyl]ethylenediaminetetraacetate. Biochemistry 37:1344–1349 2. Owens J, Chmura A, Murakami K, Fujita N, Ishihama A (1998) Mapping the promoter DNA sites proximal to conserved regions of σ70 in an Escherichia coli RNA polymerase-lacUV5 open promoter complex. Biochemistry 37: 7670–7675 3. Chen Y, Ebright Y, Ebright RH (1994) Identification of the target of a transcription activator protein by protein-protein photocrosslinking. Science 265:90–92 4. Miller A, Wood D, Ebright RH, RothmanDenes L (2004) RNA polymerase beta′ subunit: a target of DNA binding-independent activation. Science 75:1655–1657 5. Callaci S, Heyduk E, Heyduk T (1998) Conformational changes of Escherichia coli RNA polymerase σ70 factor induced by binding to the core enzyme. J Biol Chem 273: 32995–33001

6. Callaci S, Heyduk E, Heyduk T (1999) Core RNA polymerase from E. coli induces a major change in the domain arrangement of the σ70 subunit. Mol Cell 3:229–238 7. Heyduk E, Heyduk T (1999) Architecture of a complex between the σ70 subunit of Escherichia coli RNA polymerase and the nontemplate strand oligonucleotide. J Biol Chem 274: 3315–3322 8. Mukhopadhyay J, Kapanidis A, Mekler V, Kortkhonjia E, Ebright YW, Ebright RH (2001) Translocation of σ70 with RNA polymerase during transcription: fluorescence resonance energy transfer assay for movement relative to DNA. Cell 106:453–463 9. Mekler V, Kortkhonjia E, Mukhopadhyay J, Knight J, Revyakin A, Kapanidis A, Niu W, Ebright YW, Levy R, Ebright RH (2002) Structural organization of bacterial RNA polymerase holoenzyme and the RNA polymerasepromoter open complex. Cell 108:599–614 10. Mukhopadhyay J, Mekler V, Kortkhonjia E, Kapanidis A, Ebright YW, Ebright RH (2003) Fluorescence resonance energy transfer (FRET) in analysis of transcription-complex structure and function. Methods Enzymol 371:144–159

Site-Specific Incorporation of Probes into RNA Polymerase… 11. Mukhopadhyay J, Sineva E, Knight J, Levy R, Ebright RH (2004) Antibacterial peptide microcin J25 inhibits transcription by binding within, and obstructing, the RNA polymerase secondary channel. Mol Cell 14:739–751 12. Knight J, Mekler V, Mukhopadhyay J, Ebright RH, Levy R (2005) Distance-restrained docking of rifampicin and rifamycin SV to RNA polymerase using systematic FRET measurements: developing benchmarks of model quality and reliability. Biophys J 88:925–938 13. Kapanidis A, Margeat E, Laurence T, Doose S, Ho S, Mukhopadhyay J, Kortkhonjia E, Mekler V, Ebright RH, Weiss S (2005) Retention of transcription Initiation factor σ70 in transcription elongation: single-molecule analysis. Mol Cell 20:347–356 14. Margeat E, Kapanidis A, Tinnefeld P, Wang Y, Mukhopadhyay J, Ebright RH, Weiss S (2006) Direct observation of abortive initiation and promoter escape within single immobilized transcription complexes. Biophys J 90:1419–1431 15. Kapanidis A, Margeat E, Ho S, Kortkhonjia E, Weiss S, Ebright RH (2006) Initial transcription by RNA polymerase proceeds through a DNA-scrunching mechanism. Science 314: 1144–1147 16. Chakraborty A, Wang D, Ebright YW, Korlann Y, Kortkhonjia E, Kim T, Chowdhury S, Wigneshweraraj S, Irschik H, Jansen R, Nixon BT, Knight J, Weiss S, Ebright RH (2012) Opening and closing of the bacterial RNA polymerase clamp. Science 337:591–595 17. Ebright Y, Chen Y, Pendergrast PS, Ebright R (1992) Incorporation of an EDTA-metal complex at a rationally selected site within a protein: application to EDTA-iron DNA affinity cleaving with catabolite gene activator protein (CAP) and Cro. Biochemistry 31: 10664–10670 18. Igarashi K, Ishihama A (1991) Bipartite functional map of the E. coli RNA polymerase α subunit: involvement of the C-terminal region in transcription activation by cAMP-CRP. Cell 65:1015–1022 19. Kashlev M, Martin E, Polyakov A, Severinov K, Nikiforov V, Goldfarb A (1993) Histidinetagged RNA polymerase: dissection of the transcription cycle using immobilized enzyme. Gene 130:9–14 20. Tang H, Severinov K, Goldfarb A, Ebright RH (1995) Rapid RNA polymerase genetics: oneday, no-column preparation of reconstituted recombinant Escherichia coli RNA polymerase. Proc Natl Acad Sci U S A 92:4902–4906 21. Tang H, Kim Y, Severinov K, Goldfarb A, Ebright RH (1996) Escherichia coli RNA polymerase holoenzyme: rapid reconstitution from

22.

23.

24.

25.

26.

27.

28.

29.

30. 31.

32.

131

recombinant α, β, β′, and σ subunits. Methods Enzymol 273:130–134 Naryshkin N, Kim Y, Dong Q, Ebright RH (2001) Site-specific protein-DNA photocrosslinking: analysis of bacterial transcription initiation complexes. Methods Mol Biol 148: 337–361 Naryshkin N, Druzhinin S, Revyakin A, Kim Y, Mekler V, Ebright RH (2009) Static and kinetic site-specific protein-DNA photocrosslinking: analysis of bacterial transcription initiation complexes. Methods Mol Biol 543: 403–437 Severinov K, Muir T (1998) Expressed protein ligation, a novel method for studying proteinprotein interactions in transcription. J Biol Chem 273:16205–16209 Severinov K, Mustaev A, Severinova E, Bass I, Kashlev M, Landick R, Nikiforov V, Goldfarb A, Darst S (1995) Assembly of functional Escherichia coli RNA polymerase containing β subunit fragments. Proc Natl Acad Sci U S A 92:4591–4595 Severinov K, Mustaev A, Kukarin A, Muzzin O, Bass I, Darst S, Goldfarb A (1996) Structural modules of the large subunits of RNA polymerase. Introducing archaebacterial and chloroplast split sites in the β and β′ subunits of Escherichia coli RNA polymerase. J Biol Chem 271:27969–27974 Grohmann D, Nagy J, Chakraborty A, Klose D, Fielden D, Ebright RH, Michaelis J, Werner F (2011) The initiation factor TFE and the elongation factor Spt4/5 compete for the RNAP clamp during transcription initiation and elongation. Mol Cell 43:263–274 Chin J, Santoro S, Martin A, King D, Wang L, Schultz P (2002) Addition of p-azido-Lphenylalanine to the genetic code of Escherichia coli. J Am Chem Soc 124:9026–9027 Young T, Ahmad I, Yin J, Schultz P (2009) An enhanced system for unnatural amino acid mutagenesis in E. coli. J Mol Biol 395: 361–374 Saxon E, Bertozzi C (2000) Cell surface engineering by a modified Staudinger reaction. Science 287:2007–2010 Kiick K, Saxon E, Tirrell D, Bertozzi C (2002) Incorporation of azides into recombinant proteins for chemoselective modification by the Staudinger ligation. Proc Natl Acad Sci U S A 99:19–24 Chakraborty A, Wang D, Ebright Y, Ebright RH (2010) Azide-specific labeling of biomolecules by Staudinger-Bertozzi ligation: phosphine derivatives of fluorescent probes suitable for single-molecule fluorescence spectroscopy. Methods Enzymol 472:19–30

Chapter 7 Reconstitution of Factor-Dependent, Promoter Proximal Pausing in Drosophila Nuclear Extracts Jian Li and David S. Gilmour Abstract Genomic analyses reveal that RNA polymerase II initiates transcription but pauses shortly downstream on thousands of promoters in Drosophila and mammalian cells. Here, we describe the reconstitution of this promoter proximal pausing in nuclear extracts from Drosophila embryos. This approach is useful for dissecting the role(s) of transcription factors in promoter proximal pausing. Most of our studies employ the hsp70 heat shock gene promoter; however, this technique has successfully reconstituted RNA polymerase II pausing downstream of several other Drosophila promoters. A pulse/chase method is employed to restrict incorporation of radiolabel to the 5′ portion of the RNA such that the specific activity of most transcripts are nearly identical and the intensity of radioactive RNA bands detected on gels reflects the molar ratios and quantities of each RNA product, regardless of length. The radiolabeled RNAs are isolated by hybridization to a biotinylated oligonucleotide and captured on magnetic beads. We also describe the use of antibodies to investigate mechanistic aspects of promoter proximal pausing. Key words In vitro transcription, Promoter proximal pausing, RNA polymerase II, Drosophila nuclear extract, RNA capture

1

Introduction Genomic analyses of RNA polymerase II (Pol II) in Drosophila and mammalian cells reveals that Pol II is concentrated in the promoter proximal regions of thousands of genes, irrespective of the level of mRNA synthesis [1, 2]. The majority of these genes contain Pol II that has initiated transcription but paused following elongation of the nascent transcript to lengths of 20–50 nucleotides. This pause is directed, at least in part by the known pausing factors NELF and DSIF, and the reactivation of the paused polymerase involves the kinase P-TEFb [2, 3]. The complexity of the eukaryotic transcription apparatus and its known associated factors is immense, and many efforts have been made to recapitulate aspects of this system—including promoter-proximal pausing—in vitro to better understand the

Irina Artsimovitch and Thomas J. Santangelo (eds.), Bacterial Transcriptional Control: Methods and Protocols, Methods in Molecular Biology, vol. 1276, DOI 10.1007/978-1-4939-2392-2_7, © Springer Science+Business Media New York 2015

133

134

Jian Li and David S. Gilmour

role(s) of individual factors and sequences in directing pausing of Pol II. Previously, we had detected NELF and DSIF-dependent pausing in vitro using potassium permanganate footprinting [4]. However, the requirement for a large fraction of templates to be transcribed in vitro limited the utility of this approach; unfortunately, typical in vitro transcription reactions only utilize less than 10 % of the available template in the reaction [5]. To analyze mechanisms that direct and regulate promoter proximal pausing using a more robust methodology, we describe an in vitro transcription system that recapitulates NELF and DSIF-dependent pausing on the hsp70 promoter in Drosophila nuclear extracts that does not require abundant template utilization. Our in vitro system also allowed us to investigate the function of a sequence specific DNA binding protein, GAGA factor, in establishing the paused state [6]. This was achieved by inhibiting the activity of GAGA factor at different stages of the transcription reaction with GAGA factor antibody. Our approach utilizes circular templates that counter potent 3′–5′ exonuclease activities present in the Drosophila nuclear extract, which rapidly degrade linear templates, and combines innovations from the Price and Lis laboratories into a single streamlined strategy [7, 8]. In brief, a pulse/chase strategy labels and permits monitoring the length of promoter specific transcripts (Fig. 1). A subsequent hybridization of these labeled nascent transcripts to biotinylated complementary oligonucleotides linked to a solid support facilitates their purification from spuriously labeled RNAs. Finally sequencing gel electrophoresis permits high resolution monitoring of specific transcripts. In addition, we describe the use of immobilized antibodies to immunodeplete specific proteins from the nuclear extracts so their contributions to pausing can be evaluated.

2

Materials

2.1 Antibody Purification

1. Protein A beads: Protein A sepharose CL-4B (GE Healthcare). 2. ddH2O: double distilled water. 3. Poly-prep chromatography columns; empty gravity flow column, 10 ml reservoir (Bio-Rad). 4. 15 ml Falcon tube. 5. 50 mM Tris–HCl (pH 7.4). 6. 0.1 M glycine (pH 2.5). 7. Dialysis tubing (Spectra/Por Membrane, 6–8,000 MWCO). 8. HEMG buffer: 25 mM HEPES pH 7.6, 12.5 mM MgCl2, 0.1 mM EDTA, 10 % glycerol. 9. 0.1 M HEMG buffer: HEMG buffer containing 0.1 M KCl.

Reconstitution of Factor-Dependent, Promoter Proximal Pausing in Drosophila…

135

In vitro transcription & RNA capture Pol II

+1 pulse:ATP, UTP and α-32P-CTP

pulse-labelled early elongation complex

spuriously labelled RNA chase: CTP and GTP

Paused Pol II

Read-through Pol II.

Fig. 1 Overview of the in vitro pausing reaction. Preinitiation complexes are formed by incubating nuclear extract with plasmid DNA containing a promoter. Transcription is initiated in the presence of radioactive CTP and in the absence of one nucleotide to incorporate radiolabel into the initial region of the transcript. Spurious labeling of RNAs in the extract also occurs. The reactions are chased with cold nucleotides and then transcripts originating from the promoter are isolated by hybridization to biotinylated oligonucleotides and captured on streptavidin magnetic beads

10. 1 M Tris–HCl (pH 9.0). 11. 10 % sodium azide dissolved in ddH2O. 12. Bio-Rad protein assay dye reagent. 13. 2 mg/ml BSA. 14. Centrifugal concentrator (Vivaspin, 4 ml reservoir, 30,000– 100,000 MWCO). 15. Bio-Rad protein assay. 2.2 Immunodepletion of Nuclear Extract

1. Protein A beads: Protein A sepharose CL-4B (GE Healthcare). 2. DMP: Dimethyl pimelimidate dihydrochloride powder. Freshly prepare a 40 mM DMP solution in 0.2 M sodium borate (pH 9.0) before using this buffer to couple the antibody to protein A sepharose.

136

Jian Li and David S. Gilmour

3. Pierce spin column (Thermo Scientific): The capacity of the column is 1 ml (see Note 1). 4. 0.2 M ethanolamine (pH 8.0): dilute from liquid ethanolamine and adjust the pH with concentrated HCl. 5. 0.2 M sodium borate (pH 9.0): sodium borate precipitates when it is cold. Heat the solution briefly at 37 °C and vortex to redissolve any precipitate. 6. 0.15 M HEMG buffer: HEMG buffer containing 0.15 M KCl. 7. 10 % sodium azide. 8. Nuclear extract: prepare from 0 to 12 h Drosophila embryos as described in Subheading 3.7. 9. 0.1 M glycine (pH 2.5). 2.3 Biotinylation of Oligonucleotides

1. Oligonucleotides for RNA capture: The oligonucleotides are complementary to the 5′ end of the transcripts and are usually 40–50 nt long [6]. For example, the oligonucleotides complementary to the transcript of hsp70 are from +1 to +44. 2. 20 U/μl terminal deoxynucleotidyl transferase (TdT). 3. 0.4 mM biotin-14-dATP. 4. Micro Bio-Spin P-6 columns (Bio-Rad).

2.4 In Vitro Transcription

1. HEMG buffer. 2. 0.15 M HEMG buffer. 3. 0.1 M dithiothreitol (DTT). 4. Nucleoside triphosphate stocks: 4 mM ATP, 4 mM UTP, 4 mM CTP, and 4 mM GTP. 5. TE: 10 mM Tris–HCl (pH 8.0), 1 mM Na2 EDTA. 6. Complete or immunodepleted nuclear extract: Immunodepletions of transcription factors and mock-depletions are performed as described in Subheading 3.2. 7. Purified transcription factors that function in pausing: DSIF complex is purified from a baculovirus expression system [9]. NELF complex and GAGA factor are purified from embryo nuclear extracts of transgenic fly lines expressing flag tagged proteins [6, 10]. All affinity-purified factors are eluted or dialyzed into 0.15 M HEMG. The amount or each transcription factor added back to reactions was chosen to match the amount depleted as judged by Western blotting. 8. Plasmids containing paused promoters: The construct containing the wild type hsp70 promoter spanning from −194 to +84 in the pUC13 plasmid was previously described [11]. Constructs containing other paused promoters or the hsp70 promoter with certain DNA elements deleted or mutated have been used suc-

Reconstitution of Factor-Dependent, Promoter Proximal Pausing in Drosophila…

137

cessfully in place of the wild type hsp70 construct [6]. Since all of these constructs are of similar size, the amount of DNA used for the wild type hsp70 construct is suitable for other constructs. 9. HaeIII-digested E. coli DNA: E. coli genomic DNA is dissolved in TE at 2 mg/ml and then digested with HaeIII at 37 °C overnight (see Note 2). 10. RNasin: recombinant ribonuclease inhibitor (Promega). 11. α-32P CTP: 6,000 Ci/mmol, 10 mCi/ml (MP Biomedicals). 12. Torula yeast RNA: dissolve Torula yeast RNA (Type VI, Sigma-Aldrich) at 10 mg/ml in ddH2O. Aliquot 5 ml of RNA into ten Eppendorf tubes (1.5 ml). For each tube, extract the RNA two times with 500 μl of phenol, two times with 500 μl of phenol–chloroform–isoamyl alcohol, and two times with 500 μl of chloroform. For each extraction, mix RNA and organic solvent thoroughly by vortex, spin the tubes for 5 min at 20,000 × g at 4 °C and transfer the upper phase to new tubes. Finally, precipitate the RNA with ethanol to remove traces of chloroform. Dissolve the RNA in TE and determine the concentration by measuring the absorbance at 260 nm. 13. Biotinylated oligonucleotides are prepared as described in Subheading 3.3. 14. Stop buffer: 20 mM EDTA (pH 8), 0.2 M NaCl, 1 % SDS, 0.25 mg/ml Torula yeast RNA, 0.1 mg/ml of Proteinase K 2.5 Purification of Nascent Transcripts

1. 10 mg/ml Dynabeads M-280 Streptavidin (Life Technologies). 2. 2× B&W buffer: 10 mM Tris (pH 7.5), 1 mM EDTA, 2 M NaCl. 3. yeast tRNA: dissolve lyophilized powder of tRNA from Baker’s yeast and purify as described for the Torula yeast RNA (see item 12 of Subheading 2.4). 4. Dynal magnetic particle concentrator for 1.5 ml microtubes (Life Technologies). 5. Sequencing gel loading buffer: 98 % deionized formamide, 10 mM EDTA (pH 8.0), 0.025 % xylene cyanol FF, and 0.025 % bromophenol blue.

2.6 Antibody Inhibition During In Vitro Transcription Reactions

1. 0.1 M HEMG buffer. 2. 0.15 M HEMG buffer. 3. 0.1 M DTT. 4. 4 mM ATP, 4 mM UTP, 4 mM CTP, and 4 mM GTP. 5. Nuclear extract as described in Subheading 3.7. 6. Purified antibody against the transcription factor of interest or control IgG at 8 mg/ml in 0.1 M HEMG as described in Subheading 3.1.

138

Jian Li and David S. Gilmour

7. Plasmids containing promoter sequences. 8. HaeIII-cut E. coli DNA as described in item 9 of Subheading 2.4. 9. RNasin. 10. α-32P CTP: 6,000 Ci/mmol; 10 mCi/ml (MP Biomedicals). 11. Torula yeast RNA as described in item 12 of Subheading 2.4. 12. Biotinylated oligonucleotides: as described in Subheading 3.3. 2.7 Preparation of Drosophila Nuclear Extracts

1. Buffer I: 15 mM HEPES (pH 7.6), 10 mM KCl, 5 mM MgCl2, 0.1 mM EDTA, 0.5 mM EGTA, 350 mM Sucrose (store at 4 °C). 2. 1 M DTT (store at −20 °C). 3. Sodium bisulfite. 4. 0.2 M PMSF dissolved in ethanol (store at −20 °C). 5. Buffer AB: 15 mM HEPES (pH 7.6), 110 mM KCl, 5 mM MgCl2, 0.1 mM EDTA (store at 4 °C). 6. Buffer C: 25 mM HEPES (pH 7.6), 40 mM KCl, 12.5 mM MgCl2, 0.1 mM EDTA, 10 % glycerol (store at 4 °C). 7. 4 M ammonium sulfate pH 7.9: dissolve 52.8 g ammonium sulfate in 80 ml of water. Adjust the pH to 7.9 with NaOH. Bring the final volume to 100 ml and store at room temperature. This solution is nearly saturated and a few small crystals may come out of solution. The solution can be stored indefinitely. 8. 0.7 % NaCl, 0.04 % Triton X-100. Made fresh by adding NaCl and 10 % Triton X-100 to ddH2O. 9. Household bleach diluted 1:1 with water (final concentration of sodium hypochlorite is 3 %). 10. Chilled ultracentrifuge, chilled Ti70 rotor and six 26.3 ml polycarbonate ultracentrifuge tubes with caps (Beckman). 11. Chilled Sorvall centrifuge, chilled SLA-1500 rotor and four 250 ml centrifuge bottles; chilled SS34 rotor and six 40 ml centrifuge tubes. 12. Chilled Yamato LH-21 homogenizer or chilled 40 ml homogenizer with Teflon pestle. 13. Chilled 40 ml glass Dounce with B pestle (loose fitting pestle). 14. Three funnels (14 cm diameter across the top) each lined with a single layer of Miracloth. Rinse the Miracloth with distilled water and drain. Mount each funnel in a 500 ml flask and chill in a cold room. 15. Paint brush, trays, and embryo collection apparatus. The embryo collection apparatus consists of two Nitex screens mounted between interlocking cylinders as described by Shaffer et al. [12]. Our interlocking cylinders are machined from 4.5 in. PVC pipe.

Reconstitution of Factor-Dependent, Promoter Proximal Pausing in Drosophila…

3

139

Methods

3.1 Antibody Purification (See Note 3)

Affinity purification of antibodies against transcription factors of interest from the crude antisera is performed to remove nucleases and other components that potentially interfere with the in vitro transcription reaction. The purified antibodies can be added at different stages of the transcription reaction to dissect the role(s) of transcription factors in pausing. 1. Preparation of 50 % protein A sepharose slurry: hydrate 1 g of dry protein A sepharose in a 15 ml Falcon tube with 10 ml of ddH2O for at least 15 min on a rotating platform at 4 °C. Collect beads at 1,000 × g for 3 min and discard supernatant. Resuspend sepharose beads in 10 ml of ddH2O, mix for 5 min, and recover sepharose. Wash sepharose once with 50 mM Tris–HCl (pH 7.4). Estimate the packed volume of beads (approximately 4–5 ml) and add an equal volume of 50 mM Tris–HCl (pH 7.4). This protein A sepharose slurry can be stored at 4 °C for several months in 0.03 % sodium azide. 2. Transfer 4 ml of 50 % protein A sepharose slurry to a new 15 ml Falcon tube for antibody binding. Collect beads at 1,000 × g for 3 min and discard the supernatant. If sodium azide is present, wash the beads once with 50 mM Tris–HCl (pH 7.4). Add 4 ml of crude antiserum or control serum, and incubate on a rotator at 4 °C for 2 h. 3. Transfer the sepharose suspension to a Poly-prep chromatography column. Snap off the tip to start gravity flow. After the liquid has drained, wash the column with 20 ml of 50 mM Tris–HCl (pH 7.4). 4. Elute antibody with 4 ml 0.1 M glycine (pH 2.5) (see Note 4 for reusing the protein A sepharose). 5. Immediately add 400 μl of 1 M Tris–HCl (pH 9.0) to the eluate to neutralize the glycine. 6. Dialyze the eluate against 1 l of 0.1 M HEMG at 4 °C overnight. 7. Quantify the antibodies with the Bio-Rad protein assay. Use BSA to generate a standard curve for calculating the concentration of purified antibodies. 8. Concentrate the antibodies to approximately 10 mg/ml with a centrifugal concentrator (see Note 5). Quantify the concentrated antibodies and adjust the final concentration to 8 mg/ ml with 0.1 M HEMG buffer. Aliquot the concentrated antibodies into 25 μl portions and flash freeze in liquid nitrogen. For purified GAGA factor antibodies, 25 μl is sufficient to challenge five transcription reactions.

140

Jian Li and David S. Gilmour

3.2 Immunodepletion of Nuclear Extract (See Note 6)

A transcription factor of interest is depleted from the nuclear extract by specific antibodies that have been crosslinked to protein A sepharose beads. Control antibodies (pre-immune sera or an irrelevant IgG) are also crosslinked to protein A sepharose to generate beads that serve as negative controls in mock depletions. Nuclear extract is incubated with antibody beads and the factor of interest is retained on the beads and removed. After the initial incubation, nuclear extract is collected and mixed with another batch of antibody beads for further depletion. We usually perform four rounds of depletion to ensure efficient removal of a transcription factor. The specificity and efficiency of immunodepletion is tested by Western blot analysis. 1. Prepare 50 % protein A sepharose slurry as described in Subheading 3.1 except scale the preparation based on the number of depletions to be done. Each immunodepletion requires 250 μl of wet, packed beads. 2. Transfer 500 μl of 50 % protein A sepharose slurry to each Pierce spin column. Centrifuge the column at 1,000 × g for 1 min at 4 °C to remove the Tris buffer, and resuspend the beads in 500 μl of 0.15 M HEMG buffer. For all steps, make certain to put on the press-on bottom cap before adding the slurry of beads to the column and remove the bottom cap before centrifugation. 3. Centrifuge the column at 1,000 × g for 1 min at 4 °C to remove the 0.15 M HEMG buffer. Add 500 μl antisera to the protein A beads, cap both ends of the column, and incubate the column on a rotator at 4 °C for 2 h. 4. Wash the beads twice at room temperature with 750 μl 0.2 M sodium borate (pH 9.0). Each time, remove the buffer by spinning the column at 1,000 × g for 1 min at room temperature (see Note 7). 5. Resuspend the beads in 0.2 M sodium borate (pH 9.0) to make the final volume 500 μl. Set aside 10 μl of bead suspension for later testing of the coupling efficiency. Add 500 μl freshly prepared 40 mM DMP solution to start the crosslinking reaction. 6. Cap both ends of the column and incubate for 30 min at room temperature on a rotator. At the end of the incubation, set aside 20 μl of the suspension of coupled beads. This is equivalent to the 10 μl bead suspension taken before crosslinking. 7. Centrifuge the column at 1,000 × g for 1 min at room temperature to remove DMP solution and wash the beads once with 750 μl 0.2 M ethanolamine (pH 8.0). 8. Resuspend the beads in 750 μl of 0.2 M ethanolamine (pH 8.0) and incubate at room temperature for 1 h.

Reconstitution of Factor-Dependent, Promoter Proximal Pausing in Drosophila…

141

9. Wash the beads twice with 750 μl 0.15 M HEMG buffer and resuspend the beads in 750 μl 0.15 M HEMG buffer containing 0.03 % Sodium Azide. The beads can be stored in the spin column at 4 °C for at least several months. 10. Check the efficiency of coupling by boiling samples of the beads taken before and after coupling in SDS-PAGE loading buffer. Run equivalent amounts of both samples on a 10 % SDS-PAGE gel and stain with Coomassie blue. If the coupling reaction is efficient, the IgG heavy chain band (~55 kDa) should only be visible (or be much stronger) in the sample taken before the DMP reaction. 11. After coupling, there should be about 250 μl of wet, packed antibody beads in each spin column. Resuspend the beads and transfer half of the beads to a new spin column. These two columns will be used alternately in multiple cycles of immunodepletion. 12. Pre-block the beads with nuclear extract: Wash the beads twice with 750 μl 0.15 M HEMG buffer to remove sodium azide. Add 500 μl of nuclear extract to each spin column and incubate at 4 °C for 2 h on a rotator. 13. Wash the beads extensively with 750 μl of the following: 3 times with 0.15 M HEMG buffer, two times with 0.1 M glycine (pH 2.5), and three times with 0.15 M HEMG. For each wash, the spin column was kept on a rotator at 4 °C for 5 min. 14. Add 500 μl of nuclear extract to one of the pair of spin columns corresponding to one antibody. After incubation at 4 °C for 2 h, spin the column and transfer the eluate to the other spin column for a second round of depletion. 15. While the nuclear extract is incubated with the antibody beads in the second spin column, wash the first spin column as described in step 13 so that it can be used for a third round of depletion. 16. After four rounds of depletion, collect the immunodepleted nuclear extract by centrifuging the column at 1,000 × g for 3 min. Aliquot the extract into 50 μl portions, flash freeze the aliquots in liquid nitrogen, and store at −80 °C. 50 μl portions are sufficient for three transcription reactions. 17. Wash the antibody columns with 0.15 M HEMG and store at 4 °C in 0.15 M HEMG supplemented 0.03 % sodium azide. 18. Test the efficiency of immunodepletion by Western blot analysis (see Note 8). 3.3 Biotinylation of Oligonucleotides for RNA Capture (See Note 9)

Oligonucleotides complementary to transcripts of interest are biotinylated so that they can be rapidly isolated along with the hybridized transcript using streptavidin beads (see Subheading 3.5). 1. Mix 71 μl of H2O, 10 μl 10× New England Biolabs buffer 4, 10 μl 2.5 mM CoCl2, 2 μl 10 μM oligonucleotide, 5 μl 0.4 mM

142

Jian Li and David S. Gilmour

biotin-14-dATP, and 2 μl 20 U/μl TdT. Incubate the reaction at 37 °C for 30 min and then inactivate the reaction by heating to 70 °C for 10 min. 2. Prepare two Micro Bio-Spin P-6 columns according to the manufacturer’s instructions. Apply 50 μl of the reaction mixture to each column and spin at 1,000 × g for four minutes to remove the free biotin-14-dATP. 3. The biotinylated oligonucleotides are in the flow-through and can be stored at −20 °C for at least several months. 3.4 In Vitro Transcription Reaction with Immunodepleted Nuclear Extract (See Note 10)

Transcription reactions are performed in nuclear extracts with a certain transcription factor depleted or mock depleted (Fig. 2). To confirm that the changes in the profiles of nascent transcripts are due to the depletion of a particular transcription factor, separate reactions are supplemented with a purified version of the depleted transcription factor to test if it restores pausing. Since the salt concentration can have a significant impact on transcription efficiency, it is critical to adjust the salt concentration in all reactions so they are equal and so the total KCl concentration does not exceed 80 mM. 1. Prepare premix 1 (14 μl/reaction) containing the DNA template by combining the following solutions in order: 10 μl H2O, 0.8 μl 1 M HEPES (pH 7.6), 1 μl 100 ng/μl plasmid containing the paused promoter, 1 μl 2 μg/μl HaeIII-cut E. coli DNA, 0.4 μl 0.1 M DTT, and 0.8 μl 40 U/μl RNasin. Mix well by pipetting up and down. 2. Prepare premix 2 (20 μl/reaction) containing transcription factors by combining: 15 μl nuclear extract (mock- or transcription factor-depleted), up to 3 μl purified transcription factors (such as GAGA factor, NELF or DSIF) supplemented with 0.15 M HEMG to a final volume of 3 μl, 2 μl HEMG buffer without KCl (see Note 11). 3. Add premix 2 to premix 1, mix by pipetting up and down, and incubate the reaction at 25 °C for 20 min to allow the assembly of pre-initiation complexes. 4. During the 20 min incubation, prepare premix 3 (4 μl/reaction) by combining: 1 μl 4 mM ATP, 1 μl 4 mM UTP ,and 2 μl 6,000 Ci/mmol, 10 mCi/ml α-32P CTP. Also prepare premix 4 (2 μl/reaction) by combining 1 μl 4 mM CTP and 1 μl 4 mM GTP. 5. Add premix 3 to the reaction to start transcription and incubate for 3 min to pulse-label the nascent transcripts (see Note 12). 6. Add premix 4 to the reaction to chase the labeling with nonradioactive CTP and incubate for 10 min to allow extension of the nascent transcripts (see Note 13). 7. Stop the reaction by adding 200 μl stop buffer and incubate at room temperature for 5 min.

Reconstitution of Factor-Dependent, Promoter Proximal Pausing in Drosophila…

b

100 90 80 70 -

Read-through Transcripts

Read-through Transcripts

150 -

100 90 80 70 -

60 60 -

Spt5 depl.

150 -

Mock depl.

c

NELF-D depl.

Mock Depl. DSIF Depl. DSIF Depl.+1 µl DSIF DSIF Depl.+ 3 µl DSIF

Mock Depl. NELF Depl. NELF Depl.+1 µl NELF NELF Depl.+ 2 µl NELF

a

143

Spt5 NELF-B NELF-D Rpb3

50 -

Paused Transcripts

40 -

30 -

20 -

Paused Transcripts

50 -

40 -

30 -

20 -

1 2 3 4

1 2 3 4

Fig. 2 Promoter proximal pausing in vitro is dependent on NELF and DSIF. (a) Radiolabeled transcripts isolated from transcription reactions performed with nuclear extracts treated as follows: lane 1, nuclear extract mock depleted with preimmune antibody; lane 2, nuclear extract depleted of NELF with NELF-D antibody; lanes 3 and 4, NELF depleted extracts supplemented with purified NELF. (b) Radiolabeled transcripts isolated from transcription reactions performed with nuclear extracts treated similar to panel (a) except for the depletion and addition of DSIF instead of NELF. DSIF was depleted with Spt5 antibody. (c) Western blot analysis for the largest subunit of DSIF (Spt5), two subunits of NELF (NELF-B and D), or a subunit of Pol II nRpb3). In NELF-D Western blots, the upper band represents a protein that NELF-D antibody recognizes nonspecifically

144

Jian Li and David S. Gilmour

8. Extract the sample one time with an equal volume of phenol– chloroform–isoamyl alcohol (25:24:1) and transfer the aqueous phase to a fresh tube. Avoid transferring cloudy material that may accumulate at the interface. 9. Adjust the salt concentration by adding 100 μl of 30 mM Tris– HCl (pH 7.5), 0.5 M NaCl. 10. Add 8 μl biotinylated oligonucleotide (approximately 1.6 pmol per sample) and incubate at room temperature overnight for hybridization with the nascent transcripts. 3.5 Purification of Nascent Transcripts

During the transcription reaction, RNAs contained in the nuclear extract (such as tRNAs) are also labeled depending on the type of radioactive nucleotide used [13]. To separate transcripts derived from a specific promoter from other labeled RNAs, a biotinylated oligonucleotide is hybridized to the 5′ region of the desired transcripts (see Subheading 3.4). Magnetic streptavidin beads are added to capture the transcript-oligonucleotide hybrids and beads are washed with buffer containing non-labeled tRNA to remove other labeled RNAs. Purified nascent transcripts are then analyzed on a denaturing gel. 1. Prepare 15 μl Dynabead M-280 streptavidin for each transcription reaction following the manufacturer’s instructions. In brief, pool up to 90 μl of beads in each 1.5 ml Eppendorf tube, place the tubes on a magnet for 1 min and remove the supernatant. Wash the beads twice with ten volumes of 0.1 M NaCl and once with ten volumes of 2× B&W buffer. For each wash, the beads are mixed well by pipetting up and down and then the tube is placed on a magnet to separate the beads from the solution. Finally, the beads for each reaction are resuspended in 120 μl of 2× B&W buffer. 2. Add beads to the hybridization reaction mixture (from Subheading 3.4.), mix well by pipetting up and down and incubate for 15 min at room temperature. The efficiency of pull-down is improved by resuspending the beads once by pipetting up and down during the incubation. 3. Wash the beads twice with 300 μl of 10 mM Tris–HCl (pH 7.5), 10 mM NaCl, 5 mM EDTA, 100 μg/ml yeast tRNA. 4. Add 15 μl of sequencing gel loading buffer, thoroughly suspend the beads by pipetting up and down and incubate the beads at 95 °C for 5 min to elute the transcripts. Briefly spin the tube to pellet the beads and load the supernatant on a 10 % acrylamide/8 M urea sequencing gel to analyze the transcripts.

Reconstitution of Factor-Dependent, Promoter Proximal Pausing in Drosophila…

3.6 In Vitro Transcription with Antibody Inhibition

145

The in vitro transcription reaction can be separated into distinct steps by controlling when various components are added to the transcription reaction. This provides the opportunity to explore the function of a protein by disrupting its activity with antibodies at specific steps during the transcription reaction. Using this approach, we were able to determine that GAGA factor functions in pausing by facilitating formation of the preinitiation complex and by facilitating some step early during elongation before the Pol II has paused [6]. Of course, the effectiveness of this approach is contingent on the ability of the antibody to inhibit the function of its target protein. Four pairs of reactions can be performed. Each pair consists of reactions treated with antibody against a factor of interest or with an irrelevant control antibody. One pair of reactions will have antibody added to the nuclear extract before adding DNA to test for function in preinitiation complex formation. Another pair will have antibody added after preinitiation complex formation but before the pulse-labeling step with ATP, UTP, and α-32P CTP to test for function during initiation and early elongation. A third pair will have antibody added after the pulse labeling but before the CTP and GTP chase to test for function as the Pol II elongates into the paused state. The last pair will have antibody added after pausing has occurred to test if the factor affects the stability of the pause. 1. Prepare premix 1 (14 μl/reaction) containing the DNA template as described in step 1 of Subheading 3.4. 2. Prepare premix 2 (20 μl/reaction) containing transcription factors. For a reaction to test the function of a transcription factor in preinitiation complex formation, combine 15 μl nuclear extract and 5 μl purified antibody against this factor or control IgG, mix by pipetting up and down, and incubate on ice for 12 min. For the three reactions to test the function of the transcription factor at later stages, combine 15 μl nuclear extract and 5 μl of 0.1 M HEMG buffer. 3. Add premix 2 to premix 1, mix by pipetting up and down, and incubate the reaction at 25 °C for 20 min to allow the assembly of pre-initiation complexes. 4. For reactions to test the function of a transcription factor during initiation, add 5 μl purified antibody against the factor or control IgG, mix by pipetting up and down and incubate at 25 °C for 12 min. For reactions to test the function of the transcription factor at other stages of transcription, skip this step. 5. Prepare premix 3 (4 μl/reaction) and premix 4 (2 μl/reaction) as described in step 4 of Subheading 3.4. 6. Add premix 3 to the reaction to start transcription and incubate for 3 min to pulse-label the nascent transcripts.

146

Jian Li and David S. Gilmour

7. For reactions to test the function of the transcription factor during early elongation, add 5 μl purified antibody against this factor or control IgG, mix by pipetting up and down and incubate for 12 min. For reactions to test the function of the transcription factor at other stages of transcription, skip this step. 8. Add premix 4 to the reaction to chase the labeling with nonradioactive CTP and incubate for 3 min to allow extension of the nascent transcripts (see Note 13). 9. For reactions to test the function of the transcription factor after pausing, add 5 μl purified antibody against this factor or control IgG, mix by pipetting up and down and incubate for 12 min. For reactions to test the function of the transcription factor at other stages of transcription, incubate for another 12 min for a total 15 min chase. 10. Follow steps 7–10 of Subheading 3.4, and isolate RNA as described in Subheading 3.5. 3.7 Preparation of Nuclear Extracts from 100 g of 0–12 h Drosophila Embryos

0–12 h old Drosophila embryos are an excellent source for preparing transcriptionally active nuclear extracts and for purifying transcription factors. Large populations of flies are maintained essentially as described by Elgin and colleagues [12]. Four large cages of adult flies are set up and trays of embryos are collected at 12 h intervals. The trays are placed in a cold room for a maximum of 3 days as described by Biggin and Tjian [14]. The embryos are collected and then dechorionated with 50 % bleach, followed by extensive washing to remove the bleach. The embryos are then homogenized with a Yamato LH-21 homogenizer [15] or a motorized Dounce with a Teflon pestle [16]. Nuclei are collected from the lysate and then extracted with 0.4 M ammonium sulfate. Following ultracentrifugation, proteins are ammonium sulfate precipitated from the straw-colored nuclear extract. The ammonium sulfate precipitate is dissolved in buffer and dialyzed to a conductivity matching that of 0.15 M HEMG, aliquoted, flash-frozen in liquid nitrogen, and stored at −80 °C. 1. Establish four population cages of Oregon R flies following the procedure described by Elgin and colleagues [12] with two notable exceptions. First, our fly cages are cut from 1 ft diameter PVC pipe, which is substantially more durable and cheaper than plexiglass. Second, rather than collecting the inoculum of flies for each cage by anesthetizing them with CO2, simply release the adults from the tubs directly into the large population cages. This avoids loosing flies in the food and on the moist sides of the tubs. Typically, 15 tubs of flies are used per fly cage. 2. Collect the eggs on grape/agar trays over a period of 3 days at 12 h intervals and store in the cold room.

Reconstitution of Factor-Dependent, Promoter Proximal Pausing in Drosophila…

147

3. On the third day, just before starting the nuclear extract, prepare 2 l of 0.7 % NaCl, 0.04 % Triton X-100 and 500 ml of 50 % bleach. Store at room temperature. 4. In a sink, set up two embryo collection apparatuses with interlocking PVC pipe and Nitex screens as described by Shaffer et al. [12]. A course screen of Nitex (H630) filters out adult flies and the fine screen of Nitex (H116) collects the embryos. Each apparatus collects approximately 50 g of embryos. 5. Collect embryos by wetting them with distilled water and sweeping them into a tub of water with a wet paint brush. Pour suspensions of embryos from 4 trays at a time through the collection apparatuses. Evenly distribute the embryos between the two collection apparatuses and continue until all the embryos have been collected. 6. Remove the course Nitex screen and the trapped adult flies. Wash the embryos extensively with a forceful stream of cold tap water. 7. Carefully remove the fine Nitex screen with the layer of embryos from each collection apparatus. Fold the Nitex screen so it sandwiches the embryos and blot the embryos into a moist paddy with paper towels. Weigh the embryos so you can adjust the amount of embryos to 100 ± 20 g (see Note 14). 8. Transfer both paddies of embryos from the Nitex screen into 500 ml of 50 % bleach in a 1 l beaker and stir with a stir bar for 90 s. The embryos will disperse. If necessary, aid the dispersion by stirring with a metal spatula. 9. While the embryos are stirring in the bleach, rinse the fine Nitex screens with tap water and assemble each into a collection apparatus without the course Nitex screen. 10. Following the 90 s bleach treatment, distribute the embryo suspension evenly between the two collection apparatuses. As the bleach solution passes through the Nitex, rinse the embryos with 0.7 % NaCl, 0.04 % Triton X-100. 11. Wash the embryos with a forceful stream of water until the there are no bubbles and the scent of bleach is gone. 12. Wash the embryos with 1 l of distilled water. Blot the embryos dry with paper towels while they are sandwiched in the Nitex screen, weigh, and place on ice. Following this step, maintain the embryos and lysates at 4 °C. 13. Add 0.6 ml of 1 M DTT, 0.114 g of sodium bisulfite, and 0.6 ml of 0.2 M PMSF to 600 ml of Buffer I and place on ice. Add 0.1 ml of 1 M DTT, 0.019 g of sodium bisulfite, and 0.1 ml 0.2 M PMSF to 100 ml of Buffer AB and place on ice. 14. Suspend 100 g of embryos in 300 ml of Buffer I by stirring with a spatula. Pass the suspension of embryos two times

148

Jian Li and David S. Gilmour

through a chilled Yamato LH-21 homogenizer running at 1,000 rpm. Alternative, disrupt the embryos with six strokes of a motorized Dounce and Teflon pestle. 15. Distribute the embryo lysate evenly among three funnels lined with Miracloth. After the lysate has drained through the Miracloth, rinse the retained sludge in each funnel with 100 ml of Buffer I. 16. Evenly distribute the lysate among three 250 ml centrifuge bottles and centrifuge the lysate at 4 °C (15 min; 12,296 × g, max) in a Superlite SLA-1500 rotor. 17. Slowly pour off the supernatants and resuspend the crude nuclear pellets in 1 ml of Buffer AB per g of embryos. The buffer AB should already contain DTT and PMSF (see above). 18. Resuspend the nuclei using a glass Dounce and a B pestle and distribute the suspension evenly among six polycarbonate ultracentrifuge tubes. 19. Add 1/10 volume of 4 M ammonium sulfate pH 7.9 to each tube. The 4 M ammonium sulfate is added quickly to an individual tube, the tube is capped and then mixed rapidly by inverting the tube. This is repeated for each of the tubes. The samples will become very viscous. 20. Mix the tubes end over end in the cold for 20 min. 21. Centrifuge the tubes in a precooled Type 70 Ti rotor at 125,750 × g (max) for 1 h (be certain the ultracentrifuge is also prechilled). 22. Immediately after the centrifugation is completed, carefully remove the tubes from the rotor. There will be a gelatinous pellet at the bottom and a white cloudy layer at the top. In the middle will be a clear brownish yellow fluid. Collect this layer with a 10 ml pipette by plunging the tip of the pipette well below the white layer and sucking steadily. Leave behind the bulk of the lipid layer (a few ml). Combine the cleared lysates in one graduated cylinder and determine the total volume of extract. 23. Place a beaker with a stir bar in a tray of ice and place the tray on a stirrer. Add the lysate and start the stirrer. Steadily add 0.3 g of finely ground ammonium sulfate per ml of lysate over a period of 5 min. Leave the solution stirring for an additional 10 min. 24. Pour the solution into 40 ml Sorvall tubes and centrifuge 20 min (26,900 × g, max) in a precooled SS34 rotor. 25. Pour off the supernatant, drain well and then dry the sides of the tubes with a Kimwipe. The ammonium sulfate pellets can be stored at 4 °C for up to 1 week but we typically do not leave them for more than a day or 2. Cover the tubes with Parafilm during storage.

Reconstitution of Factor-Dependent, Promoter Proximal Pausing in Drosophila…

149

26. Add 2 ml of 1 M DTT, 0.19 g of sodium bisulfite, and 1 ml of 0.2 M PMSF to 2 l of Buffer C. Resuspend pellets by adding 0.2 ml of Buffer C per g of embryos. Disperse the pellet using the glass pestle from a Dounce. Fully resuspend the pellet using several strokes of the Dounce with a tight fitting pestle. 27. Dialyze the extract in 2 l of cold Buffer C. The lysate is dialyzed in Spectra/Por Membrane 1 (cut-off: 6–8,000). The dialysis membrane is hydrated for several minutes in distilled water. One end of the tubing is folded over and sealed with a clip. The tubing is rinsed several times with distilled water and once with a small amount of Buffer C. Add the lysate, fold over the open end and seal with another clip. Place the dialysis bag in 2 l of Buffer C and set the solution stirring in a cold room. 28. Dialyze the extract until the conductivity is equal to that of between 0.15 and 0.18 M HEMG. Begin checking the conductivity after about 2 h of dialysis. Mix the contents of the dialysis bag before removing a small portion of extract for each measurement. The dialysis usually takes from 2 to 4 h. A cloudy white precipitate forms during the dialysis. 29. Once the dialysis is complete, transfer the extract to clean 40 ml Sorvall centrifuge tubes. Centrifuge at 4 °C for 5 min (9,700 × g, max) in a Sorvall SS-34 rotor. Transfer the clear supernatant to new tubes and discard the precipitate. 30. Distribute into aliquots of 100–1,000 μl, flash freeze in liquid nitrogen and store at −80 °C. Reserve at least on small aliquot of extract to determine the protein concentration. The concentration of protein in the cleared extract will be approximately 15 mg/ml.

4

Notes 1. This type of column uses a polyethylene filter (30 μm pore size) that can efficiently retain protein A beads (sizes ranging from 45 to 165 μm) while allowing protein aggregates that may form during the immunodepletion to flow though. The columns come with a cap attached to the top and a cap for outlet so the columns can be closed while suspending the resin in the column. 2. Typically, the reaction is set up in a total volume of 1 ml containing 500 μg of DNA, 500 U HaeIII (50 μl), 1× New England Biolabs buffer 2 and 100 μg of BSA total. The digested DNA ranges in size from 200 to 1,000 bp, and is purified by phenol–chloroform extraction and ethanol precipitation [17]. Avoid using sonicated DNA or vertebrate DNA (salmon sperm or calf thymus) as these inhibit the in vitro transcription reaction.

150

Jian Li and David S. Gilmour

3. At least two types of antibodies need to be purified. One antibody is against the transcription factor to be tested in the transcription assay (such as GAGA factor, or subunits of NELF or DSIF), and the other is a control IgG (either from the corresponding pre-immune serum or some irrelevant serum). 4. Wash the beads with another 4 ml of 0.1 M glycine (pH 2.5) and then extensively with 50 mM Tris–HCl (pH 7.4). The beads can be reused for purifying the same antibody in the future. Store the beads in 50 mM Tris–HCl (pH 7.4) with 0.03 % sodium azide. 5. The antibody concentration after dialysis is usually 1–2 mg/ ml so the antibody is concentrated with a centrifugal concentrator. We use concentrators with molecular weight cutoffs between 30K and 100K. After removing the concentrated antibody from the centrifugal concentrator, rinse the surface of the filter with a small amount of 0.1 M HEMG buffer to recover remaining antibody. 6. Both the antibody against the desired transcription factor and the control IgG need to be coupled to protein A sepharose to generate one batch of beads for depleting the desired protein and the other batch of beads for mock depletion. 7. The pH must be above 8.3 to allow coupling with DMP. Wash the beads at room temperature to avoid precipitation of sodium borate. 8. If a protein complex such as NELF is depleted, in addition to the subunit targeted in the immunodepletion, the other subunits should also be evaluated by Western blotting. Western blotting for a subunit of Pol II should also be done to control for the specificity of the immunodepletion. The mock-depleted nuclear extract treated with protein A sepharose coupled with pre-immune sera or normal IgG serves as a negative control. 9. This reaction can be scaled up according to the number of transcription reactions. A 100 μl biotinylation reaction will provide sufficient oligonucleotide for 12 RNA captures. 10. The protocol describes how to set up a transcription reaction that produces sufficient radiolabeled nascent transcripts to be analyzed on a denaturing gel. If multiple reactions need to be set up, one should scale up the reaction premixes accordingly. 11. This setup provides the flexibility to add different amounts of transcription factors and also maintain an optimized KCl concentration of approximately 70 mM for efficient transcription [18]. 12. The first “G” in the hsp70 mRNA sequence appears at +16 while multiple A, U and C are present in the first 15 nucleotides. The mixture of ATP, UTP, and α-32P CTP efficiently labels the 5′ end of hsp70 transcript while limiting the length

Reconstitution of Factor-Dependent, Promoter Proximal Pausing in Drosophila…

151

of nascent transcripts synthesized during the pulse step. This labeling method has been successfully applied to other genes including ones that have the first “G” appearing upstream from the first “C” in the mRNA sequence [6]. Apparently, trace amounts of GTP in the nuclear extract allow transcription by the early elongation complexes. However, for different genes, it may be appropriate to use different combinations of nucleotide triphosphates according to the mRNA sequence in order to achieve optimal labeling efficiency. 13. Paused Pol II will resume elongation if treated with high salt or sarkosyl. To test whether the short transcripts are associated with transcriptionally engaged Pol II, at the end of the 10 min chase, add 10 μl of 4 M KCl or 5 μl of 5 % sarkosyl to the reaction and incubate for another 10 min. If the short transcripts are nascent RNAs associated with paused Pol II, they should be lengthened by the KCl/sarkosyl treatment since sarkosyl or KCl reactivate the paused Pol II [19]. If the transcripts do not lengthen, they could be associated with an arrested Pol II or released from the template by a termination factor such as TTF2 [20]. 14. If the total amount of embryos is between 80 and 120 g, it is not necessary to make any adjustments to the volumes of solutions. Otherwise, the procedure can be scaled to accommodate different amounts of embryos. The procedure becomes unwieldy if attempting to process more than 120 g of embryos.

Acknowledgements Support provided by NIH grant GM47477. References 1. Li J, Gilmour DS (2011) Promoter proximal pausing and the control of gene expression. Curr Opin Genet Dev 21:231–235 2. Adelman K, Lis JT (2012) Promoter-proximal pausing of RNA polymerase II: emerging roles in metazoans. Nat Rev Genet 13:720–731 3. Peterlin BM, Price DH (2006) Controlling the elongation phase of transcription with P-TEFb. Mol Cell 23:297–305 4. Li B, Weber JA, Chen Y, Greenleaf AL, Gilmour DS (1996) Analyses of promoterproximal pausing by RNA polymerase II on the hsp70 heat shock gene promoter in a Drosophila nuclear extract. Mol Cell Biol 16:5433–5443 5. Hawley DK, Roeder RG (1987) Functional steps in transcription initiation and reinitiation

6.

7.

8.

9.

from the major late promoter in a HeLa nuclear extract. J Biol Chem 262:3452–3461 Li J, Liu Y, Rhee HS, Ghosh SK, Bai L, Pugh BF, Gilmour DS (2013) Kinetic competition between elongation rate and binding of NELF controls promoter-proximal pausing. Mol Cell 50:711–722 Rasmussen EB, Lis JT (1993) In vivo transcriptional pausing and cap formation on three Drosophila heat shock genes. Proc Natl Acad Sci U S A 90:7923–7927 Marshall NF, Peng J, Xie Z, Price DH (1996) Control of RNA polymerase II elongation potential by a novel carboxyl- terminal domain kinase. J Biol Chem 271:27176–27183 Wu CH, Yamaguchi Y, Benjamin LR, HorvatGordon M, Washinsky J, Enerly E, Larsson J,

152

10.

11.

12.

13.

14.

Jian Li and David S. Gilmour Lambertsson A, Handa H, Gilmour D (2003) NELF and DSIF cause promoter proximal pausing on the hsp70 promoter in Drosophila. Genes Dev 17:1402–1414 Missra A, Gilmour DS (2010) Interactions between DSIF (DRB sensitivity inducing factor), NELF (negative elongation factor), and the Drosophila RNA polymerase II transcription elongation complex. Proc Natl Acad Sci U S A 107:11301–11306 Gilmour DS, Dietz TJ, Elgin SC (1988) TATA box-dependent protein-DNA interactions are detected on heat shock and histone gene promoters in nuclear extracts derived from Drosophila melanogaster embryos. Mol Cell Biol 8:3204–3214 Shaffer CD, Wuller JM, Elgin SC (1994) Raising large quantities of Drosophila for biochemical experiments. Methods Cell Biol 44:99–108 Adamson TE, Shore SM, Price DH (2003) Analysis of RNA polymerase II elongation in vitro. Methods Enzymol 371:264–275 Biggin MD, Tjian R (1988) Transcription factors that activate the Ultrabithorax promoter

15.

16.

17.

18.

19.

20.

in developmentally staged extracts. Cell 53: 699–711 Wampler SL, Tyree CM, Kadonaga JT (1990) Fractionation of the general RNA polymerase II transcription factors from Drosophila embryos. J Biol Chem 265:21223–21231 Soeller WC, Poole SJ, Kornberg T (1988) In vitro transcription of the Drosophila engrailed gene. Genes Dev 2:68–81 Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY Heiermann R, Pongs O (1985) In vitro transcription with extracts of nuclei of Drosophila embryos. Nucleic Acids Res 13:2709–2730 Rougvie AE, Lis JT (1988) The RNA polymerase II molecule at the 5′ end of the uninduced hsp70 gene of D. melanogaster is transcriptionally engaged. Cell 54:795–804 Cheng B, Li T, Rahl PB, Adamson TE, Loudas NB, Guo J, Varzavand K, Cooper JJ, Hu X, Gnatt A, Young RA, Price DH (2012) Functional association of Gdown1 with RNA polymerase II poised on human genes. Mol Cell 45:38–50

Chapter 8 Direct Competition Assay for Transcription Fidelity Lucyna Lubkowska and Maria L. Kireeva Abstract Accurate transcription is essential for faithful information flow from DNA to RNA and to the protein. Mechanisms of cognate substrate selection by RNA polymerases are currently elucidated by structural, genetic, and biochemical approaches. Here, we describe a fast and reliable approach to quantitative analyses of transcription fidelity, applicable to analyses of RNA polymerase selectivity against misincorporation, incorporation of dNMPs, and chemically modified rNMP analogues. The method is based on different electrophoretic mobility of RNA oligomers of the same length but differing in sequence. Key words Transcription, Fidelity, Misincorporation, RNA, Electrophoretic mobility, Cognate NTP, Non-cognate NTP, Substrate selectivity, Transcription error

1 Introduction Accurate transcription is essential for the proper transfer of biological information in the cell. Frequency of misincorporation varying from 10−3 to 10−5 has been reported based on bulk observations of transcription in vitro and in vivo; ([1] and references therein). Subsequent biochemical studies of transcription fidelity performed with a singlenucleotide resolution at defined positions on the transcribed templates mostly focused on kinetics of misincorporation and mismatch extension [2–6]. The most recent quantitative investigations of NTP selection mechanisms of Saccharomyces cerevisiae RNA polymerase (RNAP) II [7] and Escherichia coli RNAP [8] relied on the experimental approaches analogous to those used for the analyses of DNA replication fidelity, taking into full account characteristics of both the cognate and non-cognate NMP incorporation. Replication fidelity is defined as the ratio of right to wrong nucleotide incorporations when these substrates compete at equal concentrations for primer extension. In the pre-steady-state setup fidelity is quantified as the ratio of maximum polymerization rate to substrate dissociation constant (kpol/Kd, also defined as the selectivity parameter) for the cognate substrate and non-cognate substrates ([9] and Irina Artsimovitch and Thomas J. Santangelo (eds.), Bacterial Transcriptional Control: Methods and Protocols, Methods in Molecular Biology, vol. 1276, DOI 10.1007/978-1-4939-2392-2_8, © Springer Science+Business Media New York 2015

153

154

Lucyna Lubkowska and Maria L. Kireeva

references therein). However, although reliable and validated, this approach has a few disadvantages when applied to systematic analysis of transcription fidelity. To determine the kpol/Kd parameter, time courses of cognate substrate incorporation and misincorporation should be obtained at various concentrations of the cognate and noncognate substrates, and the reaction rates are estimated by nonlinear function fits of the time courses. However, kinetics of some NMP incorporation is biphasic, making calculation of a single rate imprecise [10]. When the resulting rates are plotted versus the substrate concentration, another round of nonlinear function fitting using the Michaelis–Menten formalism produces estimates for the kpol and Kd parameters. Thus, a significant error is often accumulated during the nonlinear function fits of the data. In addition, the time courses for the cognate substrate incorporation have to be carried out on a millisecond time scale, which requires a rapid quench or a rapid stopped flow instruments, and is significantly more time-consuming than conventional benchtop in vitro transcription experiments. Here, we describe an alternative transcription fidelity assay, which is based on direct competition of the cognate and non-cognate NTP substrates in the RNAP active site for incorporation into the nascent RNA. This approach is similar to the direct competition assay for fidelity of the exonuclease-deficient Klenow fragment [9]. We use the direct competition fidelity assay for the transcription elongation complex (TEC) assembled with RNAP II and synthetic RNA and DNA oligonucleotides [11]. The products of misincorporation are separated from the products of the cognate NMP incorporation by a highresolution denaturing polyacrylamide gel electrophoresis. To obtain comparable amounts of the correct products and misincorporation products, the non-cognate NTP substrate is added in significant excess over the cognate NTP substrate. The relative amounts of the correct NMP incorporation product and misincorporation product are normalized to the corresponding substrate concentration to obtain the fidelity parameter (the ratio of right to wrong nucleotide incorporations when these substrates compete at equal concentrations). To ensure that the resulting fidelity parameter is independent from the concentration of the NTPs, the reaction is set up using 3–4 different cognate–non-cognate substrate ratios, and the fidelities calculated from these conditions are averaged. This approach has been recently applied to characterization of RNAP II variants carrying substitutions in the two largest subunits [12] and to analyses of different pathways of DNA lesion bypass during transcription [13]. It can be adapted to analyses of RNAP selectivity against dNTPs and chemically modified NTPs, and investigations of the effects of different sequence contexts, transcription factors, or reaction conditions on transcription fidelity.

Competition Assay for Transcription Fidelity

155

2 Materials 2.1 Transcription Elongation Complex (TEC) Assembly and Purification

1. Transcription buffer (TB): 20 mM Tris–HCl, pH 7.9, 40 mM KCl, 5 mM MgCl2, 10 μM ZnSO4, 3 mM 2-mercaptoethanol (see Note 1). 2. RNA and DNA oligonucleotides (see Notes 2 and 3). RNA9: 5′ AUC GAG AGG 3′; nontemplate DNA strand (NDS45): 5′ CCT ATA GGA TAC TTA CAG CCA TCG AGA GGG ACA AGG CGA AAA GAG 3′; template DNA strand (TDS45) is an exact complement of NDS45. The 15 μM working stocks of the oligonucleotides are prepared in TB and stored at −20 °C. 3. T4 polynucleotide kinase. 4. γ-[32P] ATP (7,000 Ci/mmol, MP Biomedicals #3502005) (see Note 4). 5. S. cerevisiae RNAP II carrying a hexahistidine tag at the N-terminus of Rpb3, purified as described in ref. 14 (see Note 5). 6. Acetylated BSA (20 mg/ml). 7. Centrifugal filter devices for volumes up to 500 μl with a 100 kDa molecular weight cutoff.

2.2

Fidelity Assay

1. Purified (see Note 6) NTP dilutions (2× working concentration) in TB: 40 nM GTP, 2 mM ATP, 40 nM GTP + 200 μM ATP, 40 nM GTP + 400 μM ATP, 40 nM GTP + 1 mM ATP, 40 nM GTP + 2 mM ATP. 2. Gel-loading solution: 7 M urea, 50 mM EDTA, 0.001 % bromophenol blue and 0.001 % xylene cyanol (see Note 7). 3. 0.5 M EDTA, pH 7.9 (adjust pH with NaOH to completely dissolve EDTA). 4. Tris-borate-EDTA buffer (TBE): Dissolve 220 g of boric acid, 432 g of Trizma base, 160 ml 0.5 M EDTA in 8 l of water to obtain 5× TBE stock. 5. 20 % denaturing gel mix: Combine 500 ml of 40 % acrylamide/ Bis-acrylamide (19:1) solution, 420 g of urea and 200 ml 5× TBE; add water to 1 l. Filter using a disposable nylon filter unit with 0.22 μm pore size. Store at 4 °C. 6. 10 % ammonium persulfate. 7. TEMED. 8. 40 × 20 cm electrophoretic glass plates (see Note 8). 9. 0.4 mm comb and spacers. 10. Vertical electrophoretic unit (Thermo Scientific or similar). 11. Storage Phosphor screen and a Phosphorimager.

156

2.3

Lucyna Lubkowska and Maria L. Kireeva

NTP Purification

1. Dowex 1 × 2, 400 mesh. 2. Glass filter with a 500 ml reservoir or a disposable 500 ml vacuum filter unit with a 0.45 μm nylon filter. 3. 50 ml chromatography column (1.6 × 25 cm or similar dimensions). 4. 2 ml chromatography column (0.7 × 5 cm) or empty disposable chromatography column. 5. Chromatography system with gradient maker, UV detector and fraction collector. 6. Low speed centrifuge with a bucket rotor accommodating 50 ml tubes (Eppendorf 5804 R or similar). 7. 1 M HCl solution in water (1 l). 8. 1 M NaOH solution in water (1 l). 9. 1.5 mM HCl solution in water (2 l). 10. 1 M LiCl solution in 1.5 mM HCl (2 l). 11. 1 M LiOH solution in water (50 ml). 12. 2 M LiOH solution in water (10 ml). 13. 100 mM NTP solution. 14. 15 ml polypropylene tubes. 15. 50 ml polypropylene tubes. 16. Methanol. 17. Acetone.

3 Methods This protocol describes analyses of misincorporation frequency of AMP at the template position encoding GMP. It can be adapted for any non-cognate (or chemically modified) substrate that upon incorporation to the RNA renders its electrophoretic mobility distinct from the mobility of the product of the cognate substrate incorporation. 3.1 Preparation of the Elongation Complex

All steps are performed at room temperature unless indicated otherwise. 1. RNA primer labeling and annealing to the template DNA strand. Combine 24 μl TB, 3 μl 15 μM RNA stock, 1 μl T4 polynucleotide kinase, and 2 μl γ-[32P] ATP. Mix by careful pipetting. Incubate at 37 °C for 30 min and at 65 °C for 20 min. 2. To anneal RNA to the DNA template strand, add 3 μl of 15 μM template DNA to the labeling mix. Heat up to 45 °C, incubate for 5 min, and cool down slowly (over 20–30 min) to room temperature (see Note 9).

Competition Assay for Transcription Fidelity

157

3. Add 1–2 pmol of RNAP II to 7–15 pmol (5–10 μl) of the RNA– DNA hybrid diluted in 50–100 μl of TB. Incubate for 10 min. Add 15–30 pmol (1–2 μl of 15 μM stock) of the non-template DNA strand. Incubate for 10 min. The typical TEC yield is 100–200 fmol. 4. Purification using membrane filtration (see Notes 10 and 11). Add 400 μl of TB containing 0.2 mg/ml BSA to the TEC, and transfer to a filter chamber. Spin for 8–10 min at 20,000 × g. Transfer the chamber to a fresh collection tube, and discard the used collection tube with the radioactive flow-through. Repeat two more times. Insert the chamber upside down into the fresh collection tube, and spin down briefly on the tabletop centrifuge to collect the TEC. Dilute the TECs with TB. The final concentration of the TEC should not exceed 1–2 nM so that the concentration of the cognate substrate NTP is at least ten times higher than the [TEC]. 3.2 Transcription Fidelity Assay

1. Take out seven 5 μl aliquots from the TEC solution. Add 5 μl of TB (for the negative control) or NTP dilutions from Subheading 2.2, item 1 (see Note 12). Mix by pipetting up and down 2–3 times. Incubate for 5 min (see Note 13). Stop the reaction by adding 10 μl of the gel-loading buffer. 2. Cast a denaturing gel using 50 ml acrylamide solution (pre-warm the solution to room temperature before the addition of ammonium persulfate and TEMED), 450 μl 10 % ammonium persulfate and 30 μl of TEMED. Let polymerization proceed for at least 30 min. 3. Heat the samples for 1–2 min at 90 °C. Load 5–8 μl per well and perform the electrophoresis in 1× TBE for 2–2.5 h at 60 W constant power. The bromophenol blue dye should migrate to the bottom of the gel. 4. Transfer the gel to a sheet of the developed X-ray film (or leave it on the glass plate) and wrap with a plastic film. Expose to a Phosphor screen and scan using Phosphorimager (see Note 14). 5. Identify the products of the cognate and non-cognate NMP incorporation on the gel. Note that, dependent on the sequence context and the concentrations of the two NTPs, the correct and incorrect misincorporation products can be fully or partially extended, so the reaction products may be distributed among several bands (Fig. 1a). Quantify the band intensity in each lane using the “graph” function in the ImageQuant Software, or an analogous function. An example of quantification is shown Fig. 1b. 6. Add up intensities of the bands representing the correct incorporation and misincorporation separately. Calculate the ratio of the correct product(s) to misincorporation product(s) using Excel

Lucyna Lubkowska and Maria L. Kireeva

a

0.5 mM MnCl2

5 mM MgCl2 0 0 10 100 200 500 1000

ATP, μM

0 0.02 10

GTP, μM

0.02

0

0

20 50 100

200

0.02

0 0 0

12-nt (G10 A11 Â12) 11-nt (G10 A11) -nt (Â A ) 10-nt (G10 ) -nt (Â ) 9-nt RNA9 primer

b Intensity, arbitrary units

158

Cognate GMP incorporation products: 52%

AMP misincorporation products : 48%

6000 11-nt (G10 A11)

-nt (Â A )

4000 12-nt (G10 A11 Â12)

2000

-nt (Â )

15%

0 0

37% 42% 10

6%

20

30

mm

Fig. 1 Assay of RNAP II fidelity in the presence of Mg2+ and Mn2+. (a) The TEC was assembled with a 9-nt RNA primer as described in the text; purification of the TEC shown in the right panel was done in TB, in which 5 mM MgCl2 was substituted with 0.5 mM MnCl2. The TECs were incubated with the indicated concentrations of GTP and ATP for 5 min (left panel) or for 2 min (right panel). Note that all cognate G10 and most of misincorporated A10 are extended by incorporation of ATP (A11). A fraction of the correct G10A11 product, but not A11A12 product is further extended by misincorporation of ATP in place of CMP. (b) Example of the reaction product quantification. The vertical down arrow in panel A shows the lane analyzed using the Graph tool in the ImageQuant software. The four separate peaks are identified and their relative intensities are indicated. The quantification of all lanes and the resulting fidelity and misincorporation frequency parameters are summarized in Table 1

(Table 1). Normalize to the [GTP]:[ATP] ratio (cognate and noncognate substrates, respectively). Note that the [GTP]:[ATP] ratio is different for each lane. The resulting numbers reflect fidelity of GTP selection (see Note 15) and should be similar for all [ATP]:[GTP] ratios used in the experiment (see Note 16). Determine the average and standard deviation for the fidelity parameter using all four values obtained from the samples with different [ATP]:[GTP] ratios. An example of fidelity quantification is shown in Table 1.

5.2E+04 ±

1.9E−05 ±

90.5

9.5

9.5

2.0E−04

4.8E+04

5.3E+04

1.1E−01

5.0E+03

2.1E−05

1.9E−05

Cognate GMP incorporation products (%)

AMP misincorporation products (%)

Cognate:misincorporation

[GTP]:[ATP]

Fidelity

Fidelity (average ± s.d.)

Misincorporation:cognate

[ATP]:[GTP]

Misincorporation frequency

Misincorporation frequency (average ± s.d.)

1.0E+04

1.9E−01

1.0E−04

5.2

16.2

83.8

200

100

[ATP] (μM)

0.02

0.02

[GTP] (μM)

5 mM MgCl2

1.5E−06

1.8E−05

2.5E+04

4.4E−01

4.08E+03

5.7E+04

4.0E−05

2.3

30.6

69.4

500

0.02

Table 1 Quantification of fidelity and misincorporation frequencies (from Fig. 1)

1.8E−05

5.0E+04

9.1E−01

5.5E+04

2.0E−05

1.1

47.5

52.5

1,000

0.02

1.9E−04

1.9E−04

1.00E+03

1.9E−01

5.4E+03

5.3E+03

1.00E−03

5.3

14.3

75.7

20

0.02

0.5 mM MnCl2

±

2.1E−04

2.50E+03

5.3E−01

±

4.7E+03

4.00E−04

1.9

34.7

65.3

50

0.02

2.1E−05

1.9E−04

5.00E+03

9.4E−01

6.3E+02

5.3E+03

2.00E−04

1.1

48.5

51.5

100

0.02

1.6E−04

1.00E+04

1.6E+00

6.2E+03

1.00E−04

0.6

61.6

38.4

200

0.02

Competition Assay for Transcription Fidelity 159

160

3.3

Lucyna Lubkowska and Maria L. Kireeva

NTP Purification

1. Soak 50–60 ml of Dowex resin in 0.4 l of 1 M HCl for 10 min. 2. Wash 3–5 times with 500 ml of water to reach neutral pH (5–7). 3. Soak the resin in 0.4 l of 1 M NaOH for 10 min. 4. Wash with water to achieve pH 7 (see Note 17). 5. Fill a 1.6 × 25 cm column with the resin, let the resin settle. Pack 1 ml of the resin into a small column, set aside (it is used later to concentrate the purified NTP). 6. Wash with 5–10 column volumes of 1 M LiCl in 1.5 mM HCl with the flow rate 2 ml/min. 7. Wash with 5–10 column volumes of 1.5 mM HCl; make sure the UV baseline is stable. 8. Dilute 75–100 μmol (0.75–1 ml) of commercial NTP stock with 5 volumes of 3 mM HCl (for a 50 ml column). Load the NTP to the column. Pre-wash with 1.5 mM HCl and then elute with a 450 ml gradient of LiCl in 1.5 mM HCl (see Note 18). The suggested flow rate is 0.5–1 ml/min, the fraction size is typically 5 ml, collect in the 15 ml disposable tubes with caps removed. The small peaks of impurities and the large peak of the purified NTP are detected by UV absorption at 260 nm. 9. Combine the fractions containing the NTP in a 50 ml polypropylene Falcon tube; bring the pH to 7–8 with 1 M LiOH (4–8 drops) (see Note 19). 10. To concentrate the purified NTPs, wash the small column with water. Dilute the purified NTP 3–4 times with water and load to the small column. Wash the column with 10 ml of water (10 volumes). Elute the bound NTP with 3–4 ml of 2 M LiCl collecting 0.5 ml fractions. Detect the NTP peak by UV monitoring or using a spectrophotometer (see Note 20). The peak should be very narrow (1–2 ml). 11. Transfer the concentrated NTP solution to a 50 ml polypropylene tube and add equal volume of methanol and 40 ml of acetone. Mix well and incubate for 30 min at −70 °C. Spin down in the same tube using a bucket rotor with an appropriate insert (Eppendorf centrifuge 5804 R or similar) at 4,500 × g. Discard the supernatant and allow the remaining acetone to evaporate. Dissolve in 0.5 ml of water. 12. Prepare a 1:100 dilution and determine the NTP concentration by absorption at 260 nm using the appropriately diluted commercial NTP stock as a standard. 13. Adjust the NTP concentration to 10 mM, and store at −70 °C in 20–100 μl aliquots. The purified NTPs do not change their properties for at least 3 years.

161

Competition Assay for Transcription Fidelity

4

Notes 1. Do not store the 2-mercaptoethanol-containing TB for more than 2 days. 2. Transcription within various sequence contexts can be tested in this assay. In addition to the promoter-proximal sequence of bacteriophage T7A1 promoter, we successfully assembled the TECs in three additional unrelated sequence contexts. However, an attempt to assembly the TEC on an artificial G-less sequence was unsuccessful, suggesting that an RNA primer should contain a few GMP residues to present a good substrate for RNAP binding. 15–20 bp of DNA upstream from the RNA–DNA hybrid ensures proper formation of the downstream edge of the transcription bubble. 3. A fluorescent label at the RNA 5′ end represents a safe and convenient alternative to radioactive labeling. RNA17FL 5′/56FAM/UUC AUU CCC GAG AGG GA 3′ contains a fluorescein label at the 5′-end, 8 nt non-complementary to the DNA at the 5′-end and 9 nt complementary to the template DNA. This primer is used in the NTP purity test shown in Fig. 2. 4. Use of this particular brand of γ-[32P] ATP, which is supplied as 24 μM stock of ATP, ensures the highest efficiency of RNA labeling. It can be substituted with γ-[32P] ATP (3,000 Ci/mmol);

Purified on Dowex ATP

CTP GTP

Commercial (no additional purification) UTP

ATP CTP

GTP UTP

[NTP], µM  -nt (Â A A Â ) -nt (Â ) U 21 A 20 A 19 G 18

-nt (AĜ )

G24 C23 G22 U 21 A 20 A 19 G 18

Fig. 2 NTP quality test. The TEC was assembled with RNAP II using a RNA17Fl primer using NDS45G 5′ CCT ATA GGA TAC TTA CAG CCA TCG AGA GGG AGA ATG CGA AAA GAG 3′ and its exact complement TDS45G. Note that ATP and UTP purified using chromatography on Dowex misincorporate in place of the next cognate GMP; mismatch extension with the next cognate AMP occurs only in the presence of 1,000 μM ATP. GMP is misincorporated in place of AMP, and the mismatch is not extended. CMP does not incorporate in place of GMP even at high concentrations of CTP. On the contrary, all NTPs that did not undergo additional purification support primer extension by several NMPs due to trace contamination by other NTPs

162

Lucyna Lubkowska and Maria L. Kireeva

however, the ATP concentration in these stocks is 3.3 μM, which significantly decreases the labeling efficiency and hence the assay sensitivity. 5. Preparations of S. cerevisiae RNAP II mutant variants with TAP-tagged Rpb1 or Rpb2 (purified as described in ref. 15) and calf thymus RNAP II (purified as described in ref. 16) were successfully used in this assay as well. 6. Most currently available commercial NTP preparations contain trace amounts of other NTPs that interfere with quantitative misincorporation and fidelity assays. An example illustrating the necessity of NTP purification is shown in Fig. 2. However, most dNTP preparations do not contain detectable rNTP contamination and can be used in this assay without additional purification. 7. If RNA oligonucleotides are labeled with Cy3 or fluorescein, omit xylene cyanol from the gel loading buffer since it interferes with the detection. 8. Use 3 mm low-fluorescence glass plates (available from GE Healthcare Life Sciences, catalog number 63-0028-92) if fluorescently labeled RNA is used as alternative to radioactive labeling (see Note 3). 9. It is convenient to program a thermocycler to perform the annealing reaction: 5 min at 45 °C, then decrease the temperature in 2 °C increments down to 25 °C, incubating 2 min at each temperature. 10. Purification is required when radioactively labeled RNA primer is used to remove the unincorporated ATP. Purification step is optional when the fluorescently labeled primer is used. 11. The TEC purification method described here can be used for the TECs formed with RNAPs lacking the histidine tag. An additional advantage of the purification using the centrifugal filter devices, as opposed to immobilization on Ni-NTA agarose (and subsequent elution with imidazole) is the small volume of the resulting TEC solution. However, the fidelity assay described here can be performed with the TECs formed with histidinetagged RNAPs [11, 17] and immobilized on Ni-NTA agarose. 12. The concentrations of cognate (GTP) and non-cognate (ATP) substrates suggested here are optimal for the analyses of yeast RNAP II selectivity in TB within a given sequence context. The NTP concentrations and cognate–non-cognate substrate ratios may be modified, dependent on the reaction conditions. For instance, to analyze fidelity in the presence of Mn2+, which decreases transcription fidelity, the final concentrations of ATP was decreased fivefold compared to transcription in the presence of Mg2+, from 20 to 200 μM, while the final concentration of GTP remained 20 nM (Fig. 1, compare left and right panels).

Competition Assay for Transcription Fidelity

163

To determine the selectivity against 3′dGTP, which is a relatively good substrate for RNAP II, 200 nM GTP was mixed with 0.5–5 μM 3′dGTP (MK, unpublished observation). 13. The incubation time of the TEC with the substrate depends on catalytic activity of the RNAP used in the assay. It can be increased several fold for the slow mutants or decreased to avoid significant mismatch extension by the fast mutants. 14. While scanning, make sure that none of the bands was overexposed (repeat the exposure to the Phosphor screen, reducing the exposure time, if they are). If fluorescently labeled RNA has been used, scan the gel still positioned between the glass plates using the appropriate laser wavelength (e.g., 580 nm for Cy3). 15. Fidelity of GMP incorporation is a reverse of the frequency of AMP misincorporation at equal concentrations of ATP and GTP. The frequency of misincorporation is sometimes a more intuitive (and, therefore, preferred) parameter that reflects NTP selection and transcription fidelity. To determine the misincorporation frequency, calculate the ratio of the misincorporation product(s) to correct product(s), and normalize to the [ATP]:[GTP] ratio (noncognate and cognate substrates, respectively) (Table 1, last four rows). 16. If fidelity (or misincorporation frequency) values obtained at different cognate–non-cognate substrate ratios vary significantly, make sure that all the (mis)incorporation and (mismatch) extension products were accounted for. Note that quantification of faint (0.5 mg/mL pure σ70. Expected yield: ~3–10 mg from 1 L of cell culture. Expected purity: >90 %. 2.3 Labeling of 211Cys-σ70 with TMR-Maleimide

1. To ensure that the modified 211Cys residue is in a reduced form, TCEP is added to a final concentration of 1 mM to 1 mL of the freshly purified 211Cys-σ70 solution (3–4 mg/ mL) and incubated on ice for 30 min. 2. After reduction, the protein sample is buffer-exchanged into labeling buffer using Econo-Pac 10DG desalting column and chilled on ice.

RNA Polymerase Molecular Beacon Assay

205

3. A fivefold molar excess of TMR-maleimide is rapidly added to the protein solution, while stirring the solution. From this step on, protect the sample from exposure to bright light. Incubate the sample on ice for 1 h. At the end of the reaction, DTT is added to 1 mM final concentration (see Note 3). 4. The excess unreacted dye is removed and the protein sample is buffer-exchanged into 2× storage buffer without glycerol using an Econo-Pac 10DG desalting column. Determine TMR concentration in the sample spectrophotometrically using an extinction coefficient ε560 = 8 × 104 M−1 cm−1 in a pH 8 buffer containing 0.1 % SDS. Determine protein concentration using the Bio-Rad Protein assay. Expected TMR/protein ratio (the efficiency of labeling) should be about 0.8. 5. Add glycerol to the (211Cys-TMR)σ70 solution to a final concentration of 50 %. Keep the sample at −20 °C if used within 6 months or at −70 °C for long-term storage.

3

DNA Probes The beacon assay allows one to rapidly investigate RNAP–DNA interaction with a large number of promoter DNA probes since no DNA labeling required. The assay also allows to quantitatively measure both strong and weak interactions, which is particularly useful for comparative analysis of RNAP interactions with promoters of varying strength. Such measurements allow one to quantitatively dissect RNAP–promoter interactions [19]. Structures of representative promoter fragment DNA probes are shown in Fig. 3. The fork junction and double-stranded DNA probes are formed by mixing equimolar amounts of synthetic complementary strands in a buffer containing 40 mM Tris–HCl, pH 7.9, 100 mM NaCl, heating for 2 min at 95 °C, and slowly cooling down to 25 °C. The probes can be further purified by non-denaturing gel electrophoresis, if necessary.

4

Fluorometric Measurements

4.1 Materials and Equipment

1. Fluorescence spectrophotometer. We use a QuantaMaster QM4 spectrofluorometer (PTI). 2. Quartz or plastic cuvettes. We use plastic cuvettes for binding titrations (see Note 4). 3. (211Cys-TMR)σ70 prepared as described in Subheadings 2.2 and 2.3. 4. Core E. coli RNAP. We use commercial core E. coli RNAP (Epicentre Biotechnologies); see Chapter 2 for purification of the recombinant enzyme.

206

Vladimir Mekler and Konstantin Severinov

Double-stranded probes

Single-stranded probes

-50 +10 TCATAAAAAATTTATTTGACATCAGGAAAATTTTTTGGTATAATAGATTCATAAATTTGA AGTATTTTTTAAATAAACTGTAGTCCTTTTAAAAAACCATATTATCTAAGTATTTAAACT

+2

-12

TATAATAGATTCAT -3 ATAATAGAT

-11

-12 TATTTGACATCAGGAAAATTTTTTGGT ATAAACTGTAGTCCTTTTAAAAAACCA

-38

Downstream fork junctions -12

Upstream fork junctions

+20

TATAATAGATTCATAAATTTGAGAGAGGAGTT TTTAAACTCTCTCCTCAA -12

-38 -7 TATTTGCTTTCAGGAAAATTTTTCTGTATAT ATAAACGAAAGTCCTTTTAAAAAGACA

+20

TATAATAGATTCATAAATTTGAGAGAGGAGTT TTAAACTCTCTCCTCAA CGGTCGC

-26 -3 ATGCTTCCGGCTCGTATAATGTGT TACGAAGGCCGAGCA

Fig. 3 Structure of representative promoter fragment probes. Conserved promoter elements are highlighted in bold. The DNA probes are based on T5 N25 promoter sequence

5. RNAP–DNA binding buffer: transcription buffer [40 mM Tris–HCl (pH 8.0), 100 mM NaCl, 5 % glycerol, 0.1 mM DTT, and 10 mM MgCl2] containing 0.02 % Tween 20 at 25 °C (see Note 5). 4.2 Spectrofluorometer Settings

4.3 Determination of Equilibrium Dissociation Constants for RNAP–DNA Complexes

The TMR fluorescence intensities were recorded in time-based mode with an excitation wavelength of 550 nm and an emission wavelength of 578 nm. Excitation and emission slit widths were set to 5 nm each. To eliminate background signal caused by the scattered excitation light, fluorescence emission was passed through a 10 nM bandpass interference filter. 1. The measurement is initiated by recording background fluorescence of protein–DNA binding buffer in the absence of fluorescently labeled RNAP. In our experiments, the background signal caused by transcription buffer in a plastic cuvette (see Subheading 4.1, item 2) was about threefold lower than signal generated by 1 nM (211Cys-TMR)σ70. 2. Prepare assay mixtures (800 μL) containing 1 nM labeled (211Cys-TMR)σ70, 1–1.5 nM core RNAP, and a DNA probe at various concentrations and measure fluorescence signal intensities in the samples. Verify that signals reach equilibrium values; Fig. 4 shows representative experimental data (see Note 6).

RNA Polymerase Molecular Beacon Assay -38 -11 1. TATTTGACATCAGGAAAATTTTTCTGTA ATAAACTGTAGTCCTTTTAAAAAGACA

-38 -9 2. TATTTGACATCAGGAAAATTTTTCTGTATA ATAAACTGTAGTCCTTTTAAAAAGACA

-38 -7 3. TATTTGACATCAGGAAAATTTTTCTGTATAT ATAAACTGTAGTCCTTTTAAAAAGACA

-8 -38 4. TATTTGACATCAGGAAAATTTTTCTGTTTAA ATAAACTGTAGTCCTTTTAAAAAGACA

207

3.5 3.0

F/F0- 1

2.5 2.0 1.5

Probe 1

1.0

Probe 2 Probe 3

0.5

Probe 4

0.0 1

10

100

1000

Upstream fork junction (nM)

Fig. 4 Representative experimental data on titration of the RNAP beacon with upstream fork junction probes. Structures of the probes are shown in the top part of the figure. Continuous lines correspond to nonlinear regression fit of the data. Data shown in this figure were originally published in ref. [8]

3. To obtain equilibrium dissociation constants (Kd), the experimental dependence of the fluorescent signal amplitude (F) on DNA probe concentration was fit to Eq. 1

(1 - X ) ([DNA ] - [RNAP] X ) = K d X

(1)

where X = (F − F0)/(Fmax − F0), F0 is the initial value of the amplitude, and Fmax is the limiting value of the amplitude at [DNA] = ∞. We analyze the data using SigmaPlot software (see Note 7). 4. If the equilibrium probe binding is reached in a short time, the dependence of fluorescent signal amplitude on DNA probe concentration can be measured in one cuvette. In this case, DNA probe is added in aliquots to the same sample to incrementally increase the total probe concentration from 0 to saturation value. After each addition, the reaction mixture in the cuvette is thoroughly mixed and signal intensity is recorded after the equilibrium binding is reached.

208

5

Vladimir Mekler and Konstantin Severinov

Notes 1. Alternatively, cells can be lysed using a sonicator; see ref. 33. 2. DEAE cellulose chromatography can be used instead; see ref. 33. 3. Labeling at low temperature is important since it improves the selectivity of labeling. 4. Quartz cuvettes typically have much better optical characteristics than plastic cuvettes. A drawback of using quartz cuvettes is that RNAP significantly adsorbs on the walls of quartz cuvettes upon sample mixing, which results in losing RNAP from solution and, consequently, in decrease of the measured fluorescence intensity. Therefore, we recommend using plastic cuvettes for binding titrations. We use disposable methacrylate cuvettes, which have low affinity for RNAP. Use of a mild nonionic surfactant Tween 20 helps to further diminish the RNAP adsorption. 5. The experiments can be performed at various buffer solutions. We observed high fluorescence signals upon RNAP binding to DNA probes at pH in the range of 6.5–8.5, various salt compositions and in the presence of mild non-denaturing detergents. 6. Since the signal amplitude is temperature-dependent, unintended changes in sample temperature should be avoided. 7. Kd for very tight RNAP–DNA complexes (Kd 1,000 ChIP-seq experiments for >100 factors and cell types in four eukaryotic organisms. Several guidelines have been derived from this work regarding data generation and reporting, to maximize experimental consistency [16]. Briefly, these studies recommend that the antibody quality and specificity be evaluated by two methods prior to immunoprecipitation, including a deletion of the gene encoding the target protein or, if an epitope tag is used, an untagged control strain. Two biological replicates should be performed for both the experimental and control conditions. The library should be sequenced to a sufficient depth, which is typically not an issue for bacterial genomes. Finally, all data should be made available on public servers such as the NIH Short Read Archive or European Nucleotide Archive. ChIP-seq datasets are large, and analysis requires a high level of computational power. This analysis is one of the main challenges in the field. There are three basic steps to analyzing ChIP-seq data: (1) alignment of the sequencing reads to a reference genome, (2) determining sequence read coverage for all genomic positions, and (3) determining positions of significant

338

Richard P. Bonocora and Joseph T. Wade

enrichment (peak calling) across the genome. The first two steps can be completed using the Galaxy web server (https:// usegalaxy.org/), which provides a free, online suite of sequencing analysis tools including short read alignment programs such as Bowtie [19] and the Burrows–Wheeler Aligner (BWA) [20]. There are several ChIP-seq peak calling algorithms designed to analyze eukaryotic data, most notably MACS [21]. Since the field of bacterial ChIP-seq is still in its infancy, no time-tested prokaryotic peak caller exists and custom scripts are often used. However, one published method, dPEAK [22], has been used for E. coli σ70, FNR [23] and ArcA [24]. 5. This protocol is optimized for growth to mid-exponential phase (for E. coli OD600 ≈ 0.5; ~2 × 109 cells/mL or ~3 × 108 cells/mL in LB or M9 media, respectively). The number of cells harvested should be scaled accordingly based on the measured optical density. As long as the protein of interest is expressed and binds DNA (directly or indirectly), the protocol should work for any growth conditions. 6. Shearing of the DNA is a critical step that has a profound effect on the resolution of the experiment and must be determined empirically. We have determined the conditions for the Bioruptor sonicator that result in an average DNA fragment size of approximately 300 – 500 bp, which results in suitable resolution. 7. The appropriate amount of antibody will need to be determined empirically. We have used 8 μg M2 monoclonal antiFLAG (Sigma) for factors that have been tagged with a 3× FLAG epitope and are expressed from their native chromosomal locus [25]. We have also used 1 μL of either anti-σ70 (NeoClone) [26] or anti-RNAP β subunit (NeoClone). 8. We have had great success with these incubation conditions. However, many groups suggest an overnight incubation at 4 °C. As with most protocols this should be empirically determined for each protein/antibody combination. 9. All the wash and enzymatic steps are performed in Spin-X columns while the chromatin is still bound to the Protein A-Sepharose beads. We find that this significantly increases the signal-to-noise ratio for ChIP experiments [27]. 10. The number of cycles required for PCR amplification of the library (Subheading 3.13) is determined by calculating the number of cycles required to reach 5 % of saturation in the realtime PCR. A value of “X” cycles is added to this number to determine the optimal number of PCR cycles for library amplification. X must be determined empirically for each Real-Time Master Mix/thermocycler combination since, in addition to the amount of template DNA in a sample, PCR efficiency is

ChIP-Seq for Genome-Scale Analysis of Bacterial DNA-Binding Proteins

339

dependent upon both the components of the 2x Real-Time Master Mixes and the thermocycler. In a test experiment, values of X between −5 and +5 are used for standard PCR and products are visualized on an agarose gel. The optimal value of X is that which results in near-saturation of the PCR. 11. Save the remaining 2 μL of ChIP DNA for trouble-shooting or reamplification. 12. The library appears as a smear >200 bp and can extend to the well, but often only visibly reaches between 600 and 1,000 bp. Electrophoresis must result in a distinct and sizable separation of the smaller library fragments from the 120 bp adapter contaminant (Figure 1g). This product can bind to the flow-cell platform and will be sequenced and can result in a significant reduction of the number of sequencing reads originating from the actual library material. 13. The expected concentration of a typical library can vary considerably. We have had success with as low as 10 ng per library to be multiplexed. Equivalent amounts of each library being multiplexed should be pooled to ensure similar read coverage.

Acknowledgments We thank Anne Stringer and Caren Stark for critical reading of the manuscript. This work is supported by NIH New Innovator Award DP2OD007188 (JTW). References 1. Aparicio OM, Weinstein DM, Bell SP (1997) Cell 91:59–69 2. Aparcio O, Geisberg JV, Sekinger E, Yang A, Moqtaderi Z, Struhl K (2005) In: Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K (eds) Current protocols in molecular biology. Wiley, Hoboken, NJ, pp 21.3.1–21.3.33 3. Solomon MJ, Larsen PL, Varshavsky A (1988) Cell 53:937–947 4. Reid JL, Iyer VR, Brown PO, Struhl K (2000) Mol Cell 6:1297–1307 5. Hanlon SE, Lieb JD (2004) Curr Opin Genet Dev 14:697–705 6. Iyer VR, Horak CE, Scafe CS, Botstein D, Snyder M, Brown PO (2001) Nature 409: 533–538

7. Ren B, Robert F, Wyrick JJ, Aparicio O, Jennings EG, Simon I, Zeitlinger J, Schreiber J, Hannett N, Kanin E, Volkert TL, Wilson CJ, Bell SP, Young RA (2000) Science 290: 2306–2309 8. Lieb JD, Liu X, Botstein D, Brown PO (2001) Nat Genet 28:327–334 9. Robertson G, Hirst M, Bainbridge M, Bilenky M, Zhao Y, Zeng T, Euskirchen G, Bernier B, Varhol R, Delaney A, Thiessen N, Griffith OL, He A, Marra M, Snyder M, Jones S (2007) Nat Methods 4:651–657 10. Park PJ (2009) Nat Rev Genet 10:669–680 11. Lee TI, Rinaldi NJ, Robert F, Odom DT, BarJoseph Z, Gerber GK, Hannett NM, Harbison CT, Thompson CM, Simon I, Zeitlinger J, Jennings EG, Murray HL, Gordon DB, Ren B,

340

12. 13. 14.

15. 16.

Richard P. Bonocora and Joseph T. Wade Wyrick JJ, Tagne JB, Volkert TL, Fraenkel E, Gifford DK, Young RA (2002) Science 298:799–804 Wade JT, Struhl K, Busby SJ, Grainger DC (2007) Mol Microbiol 65:21–26 Galagan J, Lyubetskaya A, Gomes A (2013) Curr Top Microbiol Immunol 363:43–68 Galagan JE, Minch K, Peterson M, Lyubetskaya A, Azizi E, Sweet L, Gomes A, Rustad T, Dolganov G, Glotova I, Abeel T, Mahwinney C, Kennedy AD, Allard R, Brabant W, Krueger A, Jaini S, Honda B, Yu WH, Hickey MJ, Zucker J, Garay C, Weiner B, Sisk P, Stolte C, Winkler JK, Van de Peer Y, Iazzetti P, Camacho D, Dreyfuss J, Liu Y, Dorhoi A, Mollenkopf HJ, Drogaris P, Lamontagne J, Zhou Y, Piquenot J, Park ST, Raman S, Kaufmann SH, Mohney RP, Chelsky D, Moody DB, Sherman DR, Schoolnik GK (2013) Nature 499:178–183 Kharchenko PV, Tolstorukov MY, Park PJ (2008) Nat Biotech 26:1351–1359 Landt SG, Marinov GK, Kundaje A, Kheradpour P, Pauli F, Batzoglou S, Bernstein BE, Bickel P, Brown JB, Cayting P, Chen Y, DeSalvo G, Epstein C, Fisher-Aylor KI, Euskirchen G, Gerstein M, Gertz J, Hartemink AJ, Hoffman MM, Iyer VR, Jung YL, Karmakar S, Kellis M, Kharchenko PV, Li Q, Liu T, Liu XS, Ma L, Milosavljevic A, Myers RM, Park PJ, Pazin MJ, Perry MD, Raha D, Reddy TE, Rozowsky J, Shoresh N, Sidow A, Slattery M, Stamatoyannopoulos JA, Tolstorukov MY,

17.

18. 19. 20. 21.

22.

23.

24. 25.

26.

27.

White KP, Xi S, Farnham PJ, Lieb JD, Wold BJ, Snyder M (2012) Genome Res 22:1813–1831 Teytelman L, Thurtle DM, Rine J, van Oudenaarden A (2013) Proc Natl Acad Sci U S A 110:18602–18607 Park D, Lee Y, Bhupindersingh G, Iyer VR (2013) PLoS One 8:e83506 Langmead B, Trapnell C, Pop M, Salzberg SL (2009) Genome Biol 10:R25 Li H, Durbin R (2009) Bioinformatics 25: 1754–1760 Zhang Y, Liu T, Meyer CA, Eeckhoute J, Johnson DS, Bernstein BE, Nusbaum C, Myers RM, Brown M, Li W, Liu XS (2008) Genome Biol 9:R137 Chung D, Park D, Myers K, Grass J, Kiley P, Landick R, Keleş S (2013) PLoS Comput Biol 9:e1003246 Myers KS, Yan H, Ong IM, Chung D, Liang K, Tran F, Keles S, Landick R, Kiley PJ (2013) PLoS Genet 9:e1003565 Park DM, Akhtar MS, Ansari AZ, Landick R, Kiley PJ (2013) PLoS Genet 9:e1003839 Stringer AM, Currenti SA, Bonocora RP, Petrone BL, Palumbo MJ, Reilly AE, Zhang Z, Erill I, Wade JT (2014) J Bacteriol 196:660–671 Singh S, Singh N, Bonocora RP, Fitzgerald DM, Wade JT, Grainger DC (2014) Genes Dev 28:214–219 Bonocora RP, Fitzgerald DM, Stringer AM, Wade JT (2013) BMC Genomics 14:254

INDEX

A AAA+ proteins ................................................. 53–55, 63, 76 Aptamers ..................................................................165–181 Archaea..............................103, 263–277, 291–302, 305–313 ATPase ....................................................... 54, 57, 63–67, 76 4-Azido-phenylalanine ............................. 110, 111, 124–127

B Backtracking .......................... 2, 48, 82, 83, 97, 230, 233, 263 Bacterial Enhancer Binding Proteins (bEBPs) ............ 53–55, 57, 59, 62–66, 69–71, 73–76 Base analogue ...............................................................31–50

C C11 ........................................................... 186, 187, 196, 197 C37 ....................................................186, 187, 191–192, 196 C53 ....................................................186, 191–192, 196, 197 cDNA library............................................................211–227 Chemical probing chloroacetaldehyde (CAA) ...................................230–233, 236, 237, 239 Chromatin assembly .................................................315–317 Chromatin immunoprecipitation (ChIP) .................327–339 Conformational changes....................................... 2, 241–260

Fluorescent probes Alexa 647 .............................103, 115–118, 125–127, 129 Cy3B ...................................103, 113–116, 125–127, 129 Footprinting ...............1, 4–5, 9, 57, 73–74, 77, 134, 230, 243 in situ footprinting ..............................................229–239

H Histone chaperone.................................................... 315, 316 Histone cross-linking ............................................... 318, 324

I Initiation............................................. 2, 7, 11, 14, 16, 83, 85, 86, 90–91, 95, 102, 145, 169, 200, 201, 212, 232, 233, 241–260, 263, 271, 273, 275, 276, 283, 292, 306, 308 In vitro reconstitution .......................................................102

K Kinetics........................................... 37, 39, 45, 46, 49, 64, 65, 67, 76, 153, 154, 241–260

M

DNA binding protein ....................................... 134, 327–339 Drosophila nuclear extract .........................................133–151

Mechanism ...................................................2, 13, 14, 16, 55, 81, 82, 134, 153, 165, 185, 186, 201, 229, 242–243, 245, 246, 252, 256, 257, 291, 292, 306, 316, 317, 327 Methanocaldococcus jannaschii..................... 291–302, 305–313 Misincorporation ......................................36, 40, 46, 47, 153, 154, 156–159, 162, 163, 272

E

N

Electrophoretic mobility ...................................................156 Elongation .......................1–11, 14, 33, 61, 62, 82, 83, 85–87, 90–91, 94, 96, 130, 133, 145, 146, 151, 155–157, 166, 185, 186, 194, 196, 197, 229–239, 263–277, 283, 292, 306–308, 311–313, 317, 319 Expression ................................ 13, 15–17, 19, 23, 27, 31, 60, 74, 81, 97, 136, 165, 186, 200, 229, 239, 267, 268, 275, 284, 291, 292, 301, 305, 327, 328

Nascent transcript............................................ 133, 137, 142, 144–146, 150, 151, 233, 274 Next generation sequencing...................................... 328, 331 NTP cognate NTP ..............................................................154 non-cognate NTP ......................................................154

D

O Open promoter complexes.......................... 53, 199, 242–243 open complex formation .....................................247–249

F Fidelity ............................................................... 33, 153–164 Fluorescence quenching ........................................................... 201, 202 spectroscopy ................................................................201

P Pausing ................................ 2, 82, 86, 97, 133–151, 186, 230 Peptidyl transferase activity ..........................................92–93

Irina Artsimovitch and Thomas J. Santangelo (eds.), Bacterial Transcriptional Control: Methods and Protocols, Methods in Molecular Biology, vol. 1276, DOI 10.1007/978-1-4939-2392-2, © Springer Science+Business Media New York 2015

341

BACTERIAL TRANSCRIPTIONAL CONTROL: METHODS AND PROTOCOLS 342 Index Phosphines ....................................................... 103, 129, 203 PIC. See Promoter initiation complex (PIC) Post-transcriptional processing .........................................212 Promoter proximal pausing.................................................133–151 recognition .................................................. 168, 180, 199 Promoter initiation complex (PIC) .......................... 308, 309 Protein-DNA interactions................................................331 Protein purification ........... 18, 21–23, 55, 187, 191, 201, 284

R Rapid quench-flow ................................... 245–247, 249, 250 Ribosome...........................................82–95, 97, 98, 282, 283 Rifamycin ..........................................165, 166, 170, 171, 174 RNA capture .........................................135, 136, 141–142, 150 degradation .................................................................215 RNA-seq ............................................................211–227 rRNA............................................................ 82, 214, 282 RNAP closed promoter complexes (RPC) .............. 53, 54, 63 RNA polymerase α subunit ............................................................. 167, 169 β subunit ......................................................... 14, 21, 338 β′ subunit .................................. 14, 16, 21, 102, 171, 173, 175, 230, 233, 256 ω subunit ....................................................................106 recombinant RNAP ....................................................305 RNA polymerase I .............................................. 284, 285 RNA polymerase II .................................... 133, 264, 315 RNA polymerase III ...........................................185–197 RPC. See RNAP closed promoter complexes (RPC)

S Sigma 54 (σ54) ...............................................................53–78 Sigma 70 (σ70) ..............................16, 19, 102–104, 107–111, 119–125, 127, 128, 166–168, 171, 175, 199–206, 338

Solute effects .............................241–244, 248–251, 254–256 Stalled elongation complex ...............................................264 Staudinger–Bertozzi ligation .....102, 103, 110–111, 125–127 Stopped-flow .........................................33, 35, 38–42, 46, 48 Substrate selectivity ..........................................................163

T Termination ..................................................... 2, 42–44, 151, 185–197, 263–277, 306 intrinsic termination ...................................................276 Transcription activation ......................................................................54 elongation ................................... 1–11, 33, 82, 83, 87, 90, 94, 154, 155, 166, 185, 229, 263–277, 283 error ............................................................................154 factor........................... 103, 136, 137, 139, 140, 142, 145, 146, 150, 154, 266, 268, 271, 282, 283, 291, 293–295, 297–299, 305, 306, 308, 309, 311, 313, 327, 328 inhibition ....................................................................169 initiation .........................................2, 102, 130, 169, 200, 201, 212, 241–260, 271, 273, 275, 276, 308 in vitro transcription .............................3, 4, 6, 28, 60–61, 81–98, 134–139, 142–146, 149, 154, 197, 264–266, 272, 292, 294, 296, 300–302, 305–313 single-round transcription ..........................................264 start site ............................. 6, 13, 212, 235, 257, 271, 312 termination ..................................185–197, 263, 264, 306 Transcriptome .......................................................... 211, 212 Translocation .........................................31–50, 83, 89–92, 98

U Unnatural-amino-acid mutagenesis..........................101–130

W Walking ........................8, 9, 11, 36, 89, 95, 97, 264, 271, 273