Bacterial Diseases of Rice and Their Management 1774911914, 9781774911914

Citation preview

BACTERIAL DISEASES OF RICE

AND THEIR MANAGEMENT

BACTERIAL DISEASES OF RICE

AND THEIR MANAGEMENT

Edited by Deepti Srivastava, PhD

Md. Shamim, PhD

Malik Mobeen Ahmad, PhD

K. N. Singh, PhD

First edition published 2023 Apple Academic Press Inc. 1265 Goldenrod Circle, NE, Palm Bay, FL 32905 USA 760 Laurentian Drive, Unit 19, Burlington, ON L7N 0A4, CANADA

CRC Press 6000 Broken Sound Parkway NW, Suite 300, Boca Raton, FL 33487-2742 USA 4 Park Square, Milton Park, Abingdon, Oxon, OX14 4RN UK

© 2023 by Apple Academic Press, Inc. Apple Academic Press exclusively co-publishes with CRC Press, an imprint of Taylor & Francis Group, LLC Reasonable efforts have been made to publish reliable data and information, but the authors, editors, and publisher cannot assume responsibility for the validity of all materials or the consequences of their use. The authors, editors, and publishers have attempted to trace the copyright holders of all material reproduced in this publication and apologize to copyright holders if permission to publish in this form has not been obtained. If any copyright material has not been acknowledged, please write and let us know so we may rectify in any future reprint. Except as permitted under U.S. Copyright Law, no part of this book may be reprinted, reproduced, transmitted, or utilized in any form by any electronic, mechanical, or other means, now known or hereafter invented, including photocopying, microfilming, and recording, or in any information storage or retrieval system, without written permission from the publishers. For permission to photocopy or use material electronically from this work, access www.copyright.com or contact the Copyright Clearance Center, Inc. (CCC), 222 Rosewood Drive, Danvers, MA 01923, 978-750-8400. For works that are not available on CCC please contact [email protected] Trademark notice: Product or corporate names may be trademarks or registered trademarks and are used only for identification and explanation without intent to infringe. Library and Archives Canada Cataloguing in Publication Title: Bacterial diseases of rice and their management / edited by Deepti Srivastava, PhD, Md. Shamim, PhD, Malik Mobeen Ahmad, PhD, K.N. Singh, PhD Names: Srivastava, Deepti, editor. | Shamim, Md., 1985- editor. | Ahmad, Malik Mobeen, editor. | Singh, K. N. (Kapildeo Narayan), 1956- editor. Description: Includes bibliographical references and index. Identifiers: Canadiana (print) 20220479135 | Canadiana (ebook) 20220479216 | ISBN 9781774911914 (hardcover) | ISBN 9781774911945 (softcover) | ISBN 9781003331629 (ebook) Subjects: LCSH: Rice—Diseases and pests. | LCSH: Rice—Diseases and pests—Control. Classification: LCC SB608.R5 B33 2023 | DDC 633.1/893—dc23 Library of Congress Cataloging-in-Publication Data

CIP data on file with US Library of Congress

ISBN: 978-1-77491-191-4 (hbk) ISBN: 978-1-77491-194-5 (pbk) ISBN: 978-1-00333-162-9 (ebk)

About the Editors

Deepti Srivastava, PhD Assistant Professor, Department of Agriculture, Integral University, Lucknow, India Deepti Srivastava, PhD, is currently working as an Assistant Professor in the Department of Agriculture at Integral University, Lucknow, India. She is the author and co-author of 18 peer-reviewed research articles and nine chapters in reputed national and international journals. She has one authored book to her credit. Dr. Srivastava completed her graduation at Dr. Ram Manohar Lohia Avadh University, Faizabad, India, and earned MSc (Ag Biotechnology) and PhD (Agricultural Biotechnology) degrees at Narendra Deva University of Agriculture and Technology, Kumarganj, Faizabad, India. During her MSc, she assessed the diversity of various bottle gourd germplasm with DNA (deoxynucleotide acid) fingerprinting and protein profiling. Her major research area involves plant biotechnology and molecular breeding in rice. She did gene pyramiding of submergence, blast resistant, and dwarfing genes in one of the finest rice var. Kalanamak. Dr. Srivastava received Young Scientist Awards from national and international conferences for her research work in the field of molecular breeding. Before joining Integral University, Dr. Srivastava worked at the CSIRNational Botanical Research Institute, Lucknow, where she was engaged in the DBT-funded project, which involved the development of hybrids of cotton by using a novel male sterility-fertility restorer system, and DNA fingerprinting of different bottle gourd germplasms. Her current research work includes the development of drought and heat-tolerant rice varieties. Md. Shamim, PhD Assistant Professor cum Jr. Scientist, Dr. Kalam Agricultural College, Kishanganj, (Bihar Agricultural University, Sabour, Bhagalpur), Bihar–855107, India Md. Shamim, PhD, is working as an Assistant Professor cum Jr. Scientist in the Department of Molecular

vi

About the Editors

Biology and Genetic Engineering at Bihar Agricultural University, Sabour, India. He is the author or co-author of 25 peer-reviewed journal articles, as well as book chapters and conference papers. He has one authored book and one practical book to his credit. He is an editorial board member of several national and international journals. Recently, Dr. Shamim received the Young Scientist Award 2016 for his research work on biotechnology by the Bioved Research Institute of Agriculture, Technology, and Sciences, Allahabad, India. Dr. Shamim acquired a BSc (Biology) degree from Dr. Ram Manohar Lohia Avadh University, Faizabad, India, and MSc (Biotechnology) and PhD (Agricultural Biotechnology) degrees from Narendra Deva University of Agriculture and Technology, Kumarganj, Faizabad, India, with specialization in biotic stress management in rice through molecular and proteomics tools. Dr. Shamim was awarded a Maulana Azad National Fellowship Award from the University Grants Commission, New Delhi, India, during his PhD degree program. Before joining Bihar Agricultural University, Sabour, Dr. Shamim worked at the Indian Agricultural Research Institute, New Delhi, where he engaged in heat-responsive gene regulation in wheat. Dr. Shamim also has working experience at the Indian Institute of Pulses Research, Kanpur, India, on molecular and phylogeny analysis of several Fusarium fungi of pulses and also has done research at the Biochemistry Department of Dr. Ram Manohar Lohia Institute on plant protease inhibitor isolation and their characterization. He is a member of the soil microbiology core research group at Bihar Agricultural University (BAU), where he helps with providing appropriate direction and assisting in prioritizing the research work on polyglycerol polyricinoleates (PGPRs). He has proved himself as an active scientist in the area of biotic stress management in rice, especially in yellow stem borer management, by isolating protease inhibitors from jackfruit seeds and sheath blight resistance mechanisms in wild rice, cultivated rice, and other hosts. Malik Mobeen Ahmad, PhD Assistant Professor of Microbial Biotechnology, Department of Agriculture at Integral University, Lucknow, India Malik M. Ahmad, PhD, is an Assistant Professor of Microbial Biotechnology in the Department of Agri­ culture at Integral University, Lucknow, India, where he has been on the faculty since 2014. With his expertise in the area of microorganisms, he oversees the development of ready-to-use diagnostic

About the Editors

vii

kits for mycotoxins or other toxins produced in food crops of importance to developing countries. Dr. Malik received the Young Scientist Award from the Society of Biological Sciences and Rural Development, which recognizes outstanding achievement in biological research leading to the advancement of biotech­ nology. In 2013, he was given an International Travel Grant by the Depart­ ment of Science and Technology, Government of India, for attending the 35th Mycotoxin Workshop at Ghent University, Belgium, a program which was aimed at training eminent microbial biotech scientists to be more efficient in performing science and to discuss ideas with scientists working in the respective area at the international scientific forum. He was also awarded senior and junior Research Fellowships in Science for Meritorious Students (RFSMS), funded by the University Grants Commission (UGC), Govern­ ment of India, to carry out his doctoral studies. He has published 21 scientific papers and five chapters in national and international journals of repute. His current research focuses on the bioprospecting of novel bioactive metabolites from endophytic fungi and their biotransformation. K. N. Singh, PhD Professor and Head, Department of Plant Molecular Biology and Genetic Engineering, Narendra Deva University of Agriculture and Technology, Kumaranj, Faizabad, India K. N. Singh, PhD, is working as a Professor and Head in the Department of Plant Molecular Biology and Genetic Engineering at Narendra Deva University of Agriculture and Technology, Kumaranj, Faizabad, India, and is the author or co-author of 50 peer-reviewed journal articles, 10 chapters, and four conference papers. He has one authored book and one practical book to his credit. He is an editorial board member of many journals. Professor K. N. Singh matriculated from Bihar School Examination Board with a national scholarship. He did his BSc (Hons.) and MSc at Science College, Patna, and then did his MPhil at Jawaharlal Nehru University, New Delhi, in life sciences. He did his PhD from Cambridge University (UK) in the Government of India overseas fellowship program. He then joined The Energy and Resources Institute, TERI, New Delhi, for a year before joining Tamil Nadu Agricultural University as Assistant Professor and then an Associate Professor in the Center for Plant Molecular Biology (CPMB). He joined Narendra Deva University of Agriculture and Technology as

viii

About the Editors

Professor and has been heading the Biotechnology Department for the last 10 years. He was a visiting scientist under the Rockefeller Program at IRRI, Philippines. He is a fellow of the Indian Society of Agricultural Biochemists and a life member of many national and international societies. Dr. Singh has proved himself as an active scientist in the area of biotic stress management in rice, pigeon pea, and sesamum.

Contents

Contributors.............................................................................................................xi

Abbreviations ........................................................................................................ xvii

Preface .................................................................................................................xxiii

1.

Impact of Major Rice Bacterial Diseases on Agriculture and

Food Security...................................................................................................1

Deepak Kumar, Santosh K. Arya, Deepti Srivastava, Md. Shamim, L. J. Desai, and Manjusha Tyagi

2.

Current and Potential Methods for Bacterial Disease

Detection in Rice ...........................................................................................29

Karansher Sandhu, Balwinder Kaur, and Jagmohan Singh

3.

An Overview of the Biology of Rice Bacterial Blight Pathogens and

Prospects of Conventional Methods for Their Management ....................45

Mona F. A. Dawood, Yasser S. Moursi, Abdelrazek S. Abdelrhim, and

Amany A. Hassan

4.

Virulence Determinants and Host Defense Factors in

Xanthomonas-Rice Interaction ....................................................................73

Shashi Pandey, Prashant Mishra, Taku Monya, and Rhitu Rai

5.

Challenges and Opportunities of Recent Tools for

Bacterial Blight Resistance...........................................................................91

Anurag Mishra, Rajat Chaudhary, Vandana Sharma, and Prashant Yadav

6.

Reviews of Biological and Ecological Studies of

Bacterial Panicle Blight Pathogen .............................................................107

Faria Fatima and Arshya Hashim

7.

Insights from the Conventional Breeding and Molecular

Approaches for Rice Bacterial Panicle Blight Disease Resistance .........129

Rashmi Maurya, Munna Singh, Deepti Srivastava, and Shivi Rathor

8.

Understanding the Biology of Rice Bacterial Brown Stripe

Pathogen and Conventional Strategies for Its Management ..................143

Deepak Baboo, Mukul Kumar, A. K. Mishra, and Mohammed Said

Contents

x 9.

Advances and Prospects of Biotechnological Tools for the Management of Rice Bacterial Brown Stripe Disease .............................157 Tata Santosh Rama Bhadra Rao

10. Introduction to the Biological and Ecological Studies of Bacterial Leaf Streak Pathogen .................................................................171 Santosh Kumar, S. B. Sah, Tribhuwan Kumar, Gireesh Chand,

Md. Nadeem Akhtar, and M. K. Barnwal

11. Retrospective and Perspective Management of Rice Bacterial Leaf Streak Disease............................................................183 Daraksha Parween, Amber Gupta, Binod Bihari Sahu, and Birendra Prasad Shaw

12. Sheath Brown Rot of Rice: A Review on Introduction, Epidemiology, and Its Integrated Management.......................................203 Erayya, Md. Shamim, Subhashish Sarkhe and M. Kalmesh

13. The Emerging Role of New Molecular Technologies for the Development of Broad-Spectrum Resistance to Sheath Brown Rot Disease in Rice.............................................................219 Prashant Yadav, Sushma Yadav, Anurag Mishra, and Deepti Srivastava

14. Biological and Ecological Studies of Rice Bacterial Foot Rot Pathogen: An Update...........................................................................231 Ashwini Kumar, Bichhinna Maitri Rout, Shakshi Choudhary, and Vandana Sharma

15. Then and Now: Use of Conventional and Molecular Technologies for Bacterial Foot Rot Disease Resistance in Rice ...................................243 Archana Lalwani and Shuchi Gupta

16. Bioagents and Volatile Organic Compounds: An Emerging Control Measures for Rice Bacterial Diseases..........................................255 Nitesh Singh, Gitanjali Jiwani, Layza S. Rocha, and Rodin Mazaheri

17. Opportunities for Bioinformatics Tools for the Management of Rice Bacterial Diseases ...................................................275 Pooja Saini, Shikha Yashveer, Neeru Singh Redhu, Shalu Chaudhary,

Aarti Kamboj, Vivekanand Hembade, Kritika Sharma, and Sonali Sangwan

Index ..................................................................................................................... 311

Contributors

Abdelrazek S. Abdelrhim

Department of Plant Pathology, Faculty of Agriculture, Minya University, Al-Minya, Egypt

Md. Nadeem Akhtar

Krishi Vigyan Kendra, Agwanpur, Saharsa, Bihar, India

Santosh K. Arya

R&D Division, Nextnode Bioscience Pvt. Ltd., Opposite GEB Office, Kadi-Kalol Road, Kadi–384440, Gujarat, India

Deepak Baboo

Department of Plant Pathology, Chandra Shekhar Azad University of Agriculture and Technology, Kanpur, Uttar Pradesh–208002, India, E-mail: [email protected]; Present address: Faculty of Agriculture Science and Technology, Madhyanchal Professional University, Ratibad, Bhopal–462044, India

M. K. Barnwal

Department of Plant Pathology, Birsa Agricultural University, Kanke–834006, Ranchi, Jharkhand, India

Gireesh Chand

Department of Plant Pathology, College of Agriculture, Central Agricultural University, Pasighat–791102, East Siang, Arunachal Pradesh, India

Rajat Chaudhary

Division of Genetics, ICAR–Indian Agriculture Research Institute, New Delhi–110012, India

Shalu Chaudhary

Department of Molecular Biology, Biotechnology, and Bioinformatics, COBS&H, Chaudhary Charan Singh Haryana Agricultural University, Hisar–125001, Haryana, India

Shakshi Choudhary

Department of Bioscience and Biotechnology, Banasthali Vidyapith, Rajasthan–304022, India

Daraksha Parween

Department of Life Science, National Institute of Technology, Rourkela, Odisha–769008, India

Mona F. A. Dawood

Department of Botany and Microbiology, Faculty of Science, Assiut University, Assiut–71516, Egypt, E-mail: [email protected]

L. J. Desai

Center for Research on Integrated Farming System, S.D. Agricultural University, Sardarkrushinagar–385506, Banaskantha, Gujarat, India

Erayya

Department of Plant Pathology, Dr. Kalam Agricultural College, Kishanganj, (Bihar Agricultural University, Sabour, Bhagalpur), Bihar–855107, India, E-mail: [email protected]

xii

Contributors

Faria Fatima

Department of Agriculture, IIAST, Integral University, Kursi Road Lucknow, Uttar Pradesh, India, E-mail: [email protected]

Amber Gupta

Abiotic Stress and Agro Biotechnology Lab, Institute of Life Sciences, Bhubaneshwar, Odisha–751023, India, E-mail: [email protected]

Shuchi Gupta

Department of Botany and Biotechnology, Sadhu Vaswani Autonomous College, Sant Hirdaram Nagar, Bhopal, Madhya Pradesh–462030, India

Arshya Hashim

Department of Biotechnology, Abeda Inamdar Sr. College of Arts, Science, and Commerce, Pune, Maharashtra–411001, India

Amany A. Hassan

Botany and Microbiology Department, Faculty of Science, New Valley University, El-Kharja–72511, Egypt

Vivekanand Hembade

Department of Molecular Biology, Biotechnology, and Bioinformatics, COBS&H, Chaudhary Charan Singh Haryana Agricultural University, Hisar–125001, Haryana, India

Gitanjali Jiwani

National Institute for Plant Biotechnology (NIPB), New Delhi–110012, India

M. Kalmesh

Department of Entomology, Dr. Kalam Agricultural College, Kishanganj, (Bihar Agricultural University, Sabour, Bhagalpur), Bihar–855107, India

Aarti Kamboj

Department of Molecular Biology, Biotechnology, and Bioinformatics, COBS&H, Chaudhary Charan Singh Haryana Agricultural University, Hisar–125001, Haryana, India

Balwinder Kaur

Department of Entomology and Nematology, University of Florida, Gainesville, Florida–32608, USA

Ashwini Kumar

Division of Plant Pathology, ICAR–Indian Agricultural Research Institute, New Delhi–110012, India

Deepak Kumar

R&D Division, Nextnode Bioscience Pvt. Ltd., Opposite GEB Office, Kadi-Kalol Road, Kadi–384440, Gujarat, India, E-mail: [email protected]

Mukul Kumar

Department of Plant Pathology, Chandra Shekhar Azad University of Agriculture and Technology, Kanpur, Uttar Pradesh–208002, India

Santosh Kumar

Department of Plant Pathology, Mandan Bharti Agriculture College, Bihar Agricultural University, Sabour, Bhagalpur, Agwanpur, Saharsa–852201, Bihar, India, E-mail: [email protected]

Tribhuwan Kumar

Department of Plant Breeding and Genetics (Biotechnology), Mandan Bharti Agriculture College, Bihar Agricultural University, Sabour, Bhagalpur, Agwanpur, Saharsa–852201, Bihar, India

Contributors

xiii

Archana Lalwani

Department of Botany and Biotechnology, Sadhu Vaswani Autonomous College, Sant Hirdaram Nagar, Bhopal, Madhya Pradesh–462030, India, E-mail: [email protected]

Rashmi Maurya

Department of Botany, University of Lucknow, Lucknow, Uttar Pradesh–226007, India, E-mail: [email protected]

Rodin Mazaheri

Biological Sciences Department, Middle East Technical University (Orta Dogu Teknik Universitesi Middle East Technical University–06800), Turkey

A. K. Mishra

Department of Plant Pathology, Tirhut College of Agriculture, Dholi, (R. P. C. A. U.) Pusa, Samastipur, Bihar–848125, India

Anurag Mishra

Division of Genetics, ICAR–Indian Agriculture Research Institute, New Delhi–110012, India, E-mail: [email protected]

Prashant Mishra

ICAR–National Institute for Plant Biotechnology, Pusa Campus, New Delhi–110012, India

Taku Monya

ICAR–National Institute for Plant Biotechnology, Pusa Campus, New Delhi–110012, India

Yasser S. Moursi

Department of Botany, Faculty of Science, University of Fayoum, Fayoum–63514, Egypt, E-mail: [email protected]

Shashi Pandey

ICAR–National Institute for Plant Biotechnology, Pusa Campus, New Delhi–110012, India

Rhitu Rai

ICAR–National Institute for Plant Biotechnology, Pusa Campus, New Delhi–110012, India, E-mails: [email protected]; [email protected]

Tata Santosh Rama Bhadra Rao

Department of Biomedical Science, Latrobe University, Bendigo, Australia, E-mail: [email protected]

Shivi Rathor

Department of Material Science and Engineering, National Taiwan University of Science and Technology, No. 43, Keelung Road, Sec. 4, Da’an District, Taipei–10607, Taiwan

Neeru Singh Redhu

Department of Molecular Biology, Biotechnology, and Bioinformatics, COBS&H, Chaudhary Charan Singh Haryana Agricultural University, Hisar–125001, Haryana, India

Layza S. Rocha

Group of Spectroscopy and Bioinformatics Applied Biodiversity and Health (GEBABS), Federal University of Mato Grosso do Sul, 549, Campo Grande–790709-00, MS, School of Medicine of Federal University of Mato Grosso do Sul, Brazil

Bichhinna Maitri Rout

Division of Vegetable Science, ICAR–Indian Agricultural Research Institute, New Delhi–110012, India

xiv

Contributors

S. B. Sah

Department of Entomology, Mandan Bharti Agriculture College, Agwanpur, Saharsa–852201, Bihar, India

Binod Bihari Sahu

Department of Life Science, National Institute of Technology, Rourkela, Odisha–769008, India

Mohammed Said

Department of Agriculture Institute of Agricultural Sciences, Integral University, Lucknow, Uttar Pradesh, India

Pooja Saini

Department of Molecular Biology, Biotechnology, and Bioinformatics, COBS&H, Chaudhary Charan Singh Haryana Agricultural University, Hisar–125001, Haryana, India

Karansher Sandhu

Department of Crop and Soil Sciences, Washington State University, Pullman, WA–99163, USA, E-mail: [email protected]

Sonali Sangwan

Assistant Professor, Department of Biotechnology, Maharishi Markandeshwar University, Mullana-Ambala (133207), Haryana, India, E-mail: [email protected]

Subhashish Sarkhel

Department of Plant Pathology, Dr. Kalam Agricultural College, Kishanganj, (Bihar Agricultural University, Sabour, Bhagalpur), Bihar–855107, India

Md. Shamim

Dr. Kalam Agricultural College, Kishanganj, (Bihar Agricultural University, Sabour, Bhagalpur), Bihar–855107, India

Kritika Sharma

Department of Molecular Biology, Biotechnology, and Bioinformatics, COBS&H, Chaudhary Charan Singh Haryana Agricultural University, Hisar–125001, Haryana, India

Vandana Sharma

Division of Genetics, ICAR–Indian Agricultural Research Institute, New Delhi–110012, India

Birendra Prasad Shaw

Abiotic Stress and Agro Biotechnology Lab, Institute of Life Sciences, Bhubaneshwar, Odisha–751023, India

Jagmohan Singh

Division of Plant Pathology, Indian Agricultural Research Institute, New Delhi–110012, India; Institute of Molecular Plant Science, University of Edinburgh, Edinburgh, UK, EH9 3BF

Munna Singh

Department of Botany, University of Lucknow, Lucknow, Uttar Pradesh–226007, India

Nitesh Singh

Department of Bioscience, UIBT, Chandigarh University, 140413, Mohali, India, E-mail: [email protected]

Deepti Srivastava

Integral Institute of Agricultural Science and Technology (IIAST), Integral University, Kursi Road, Dasauli, Lucknow–226021, Uttar Pradesh, India

Contributors Manjusha Tyagi

Department of Microbiology, Shri Guru Ram Rai University, Patel Nagar, Dehradun–248001, Uttarakhand, India

Prashant Yadav

ICAR–Directorate of Rapeseed-Mustard Research, Bharatpur, Rajasthan–321303, India, E-mail: [email protected]

Sushma Yadav

ICAR–Directorate of Rapeseed-Mustard Research, Bharatpur, Rajasthan–321303, India

Shikha Yashveer

Department of Molecular Biology, Biotechnology, and Bioinformatics, COBS&H, Chaudhary Charan Singh Haryana Agricultural University, Hisar–125001, Haryana, India

xv

Abbreviations

% °C 2D-DIGE 2-DE AAD ABC AFLP AgNP AHL AI ALH-QS amiRNA AO APX ASM ATP BB BBS BBSR BCA BCC BIL BLAST BLB BLS BP BPB BSA CAT CDEs CFU/ml CLPs CNN CO2

percent degree Celsius two-dimensional difference gel electrophoresis two-dimensional electrophoresis acidic activation domain ATP binding cassette amplified fragment length polymorphism silver nanoparticles acyl homoserine lactone artificial intelligence N-acyl homoserine lactone quorum sensing artificial microRNA Acidovorax oryzae ascorbate peroxidase acibenzolar-S-methyl adenosine triphosphate bacterial blight bacterial brown stripe bacterial brown stripe of rice biocontrol agent Burkholderia cepacia backcross inbred line basic local alignment search tool bacterial leaf blight bacterial leaf streak breeding population bacterial panicle blight bulk segregation analysis catalase cell wall degrading enzymes colony forming unit cyclic lipopeptides convolutional neural network carbon dioxide

xviii

Abbreviations

COVID-19 coronavirus disease of 2019 CPG casamino acid peptone glucose CRISPER-Cas9 clustered regularly interspaced short palindromic repeatsCRISPER associated protein-9 CRISPR clustered regularly interspersed short palindromic repeats CSSLs chromosome segment substitution lines Cu(OH)2 copper(II) hydroxide CWP cell wall protein DAMPs damage-associated molecular patter DAPG 2,4-diacetylphloroglucinol DEGs differentially expressed genes DEPGs differentially expressed protein genes DL deep learning DNA deoxynucleotide acid dNTPs deoxynucleoside triphosphate DOM decomposition of organic matter DPIC diphenyleneiodonium chloride DPPH 2,2-diphenyl-1-picrylhydrazyl DR defense-related DSF diffusible signaling factor EBE effector binding element ELISA enzyme-linked immunosorbent assay EPS exopolysaccharides EPS extracellular polysaccharides ETI effector-triggered immunity FAO Food and Agriculture Organization FAOSTAT Food and Agriculture Organization of United Nations FC flow cytometry FC fold change FISH fluorescens in situ hybridization GA gibberellic acid GEBV genomic estimated breeding values GFP green fluorescent protein GPX glutathione peroxidase GS genomic selection GWAS genome-wide association study H2O2 hydrogen peroxide HHZ Huang-Hua-Zhan HR hypersensitive response

Abbreviations

HSP IAA IPCC IPM IRMA ITS JA kDa KSM LAMP LOX LPS LRR LRR MAGIC MAGP MAMP MAS MD MFP MgO MIC miRNA MLP MLSA MnO2 mPCR MS MTE MVDA NB NBS-LRR NCBI NGS NLR NMR OG ORF OUTs

xix

heat shock protein indole-3-acetic acid intergovernmental panel on climate change integrated pest management immuno-radiometric assay internal transcribed spacer jasmonic acid kilodalton kasugamycin loop-mediated isothermal amplification lipoxygenase lipopolysaccharide leucine repeat-rich leucine-rich repeat multi-parent advanced generation inter-cross population marker-assisted gene pyramiding microbe-associated molecular pattern marker-assisted selection molecular dynamics membrane fusion protein magnesium oxide minimal inhibitory concentration microRNA multilayer perceptron multilocus sequence analysis technique manganese dioxide multiplex PCR mass spectrometry metabolic theory of ecology multivariate data analysis nucleotide-binding nucleotide binding site and leucine-rich repeat National Center for Biotechnology Information next-generation sequencing NOD-like receptor nuclear magnetic resonance oligogalacturonide open reading frame operational taxonomic units

Abbreviations

xx

PAL PAMP PB-1 PCA PCD PCR PDB PDF PFU/ml PG PGIP PGN PGPR PHZ PIP PO POD ppm PPO PR PRN PRRs PSK PTI QS QTL RFLP RGs RILs RLK RM RNA RNN ROS rRNA RT-PCR RVD SA SEM

phenylalanine ammonia-lyase pathogen-associated molecular pattern Pusa Basmati-1 phenazine-1-carboxylic acid programmed cell death polymerase chain reaction protein data bank peptide deformylase plaque forming unit polyglactin polygalacturonase-inhibiting protein peptidoglycan plant growth promoting rhizobacteria phenazines plant-inducible promoter Pythium oligandrum peroxidase parts per million polyphenol oxidase pathogenesis-related pyrrolnitrin pattern recognition receptors phytosulfokine PAMP triggered immunity quorum sensing quantitative trait loci restriction fragment length polymorphism responsive genes recombinant inbred lines receptor-like kinase Malaysian Ringgit ribonucleic acid recurrent neural network reactive oxygen species ribosomal RNA reverse-transcription PCR repeat variable diresidue salicylic acid scanning electron microscopy

Abbreviations

SNP spp. SRA sRNAs ST SWEET T1SS T3S T3SS TAL TALE TALEN TFP ThDP TIIS TSS VIs WHO Xoo XVPs ZFN

xxi

single nucleotide polymorphisms species sequence read archive specific bacterial RNAs seed treatment sugar will eventually be exported transporter type 1 secretion system type 3 secretion type 3 secretion system transcription-activator-like transcription-activator-like effector transcription-activator-like effector nucleases type IV pili thiamin diphosphate type II secreted proteins type secretion systems vegetation indices World Health Organization Xanthomonas oryzae pv. oryzae extreme virulent pathotypes zinc finger nucleases

Preface

Rice is a major food crop for people around the world. Rice is a staple food and a source of calories for over 3.5 billion people worldwide. Nearly 90% of the world’s rice is produced and consumed in Asia, with less than 9% produced outside the region. Even though rice production has nearly doubled in recent decades due to various rice improvement programs such as introgression of semi-dwarfing genes, development of hybrids, and improved cultivation practices, it still needs to be significantly increased to meet the requirements of the world’s ever-expanding human population. The yield of rice is affected by various biotic and abiotic factors, the availability of farmland, etc. In this book, we have discussed the bacterial diseases of rice and their management. For the management of rice bacterial diseases, various methods are used, such as chemical control, biological control, conventional breeding methods, and molecular methods. Chemical control methods are widely used, but prolonged use of such chemicals is hazardous to the environment. Therefore, sustainable management of rice bacterial diseases can be done by biological control methods, conventional breeding methods, and molecular methods. Rice genetics analysis, supported by a full-genome sequence, has yielded findings that resolve a variety of bacterial pathogen-related issues. However, the key challenges are maintaining the resistance against various bacterial pathogens as well as identifying the genetic basis of resistance which is strongly affected by genotype-environment interactions. To combat these challenges, detailed knowledge of host-pathogen interactions will help in the designing of a predictive strategy for durable resistance by combining specific genes. Various QTLs related to rice bacterial diseases have been identified. Marker-aided introgression of the resistant gene into various popular rice varieties demonstrates the utility of gene discovery. Similarly, whole genome expression and mapping analysis will help in the understanding of QTL. Thus, with the help of advances in genomics and molecular biology, intractable problems of various rice bacterial diseases can be solved. Although, in recent years, significant progress has been made for a better understanding of the rice-bacterial pathogen system, defense mechanisms, and molecular methods for disease resistance, there is an urgent need to document all these available data on bacterial disease identification

xxiv

Preface

and management in a single book. A vast number of diagnostic tools have been developed for the identification of various rice bacterial diseases, and at the same time, management of rice bacterial disease is also very important, which is presently done through cultural practices, chemicals, and biocontrol methods. The agrochemicals used in plant protection are costly, hazardous to the environment as well as also affect the surrounding microbial population. On the other hand, various recent methods such as molecular breeding methods, biotechnological tools, and biocontrol methods are sustainable to the environment. Here, we tried to provide a comprehensive view to the reader of rice bacterial disease, starting from the identification of bacterial diseases, and their ecology to the management of bacterial disease, which includes conventional as well as recent methods. This volume contains 17 chapters. In Chapter 1, we have tried to show the impact of rice bacterial diseases on global food security that can lead to a food crisis worldwide. Chapter 2 describes potential methods for bacterial disease identification. Identification of disease is the first step in the management of the disease. Chapters 3–5 elaborate on the overview of the biology of rice bacterial blight (BB) pathogen, virulence determinants and various host defense factors of bacterial blight pathogen-rice interaction, and traditional and recent tools for bacterial blight disease management. Different resistance rice cultivars, their resistance loci, and quantitative trait loci (QTL) mapping in the important rice cultivars have also been discussed. Chapters 6 and 7 provide insights into the biological and ecological status of rice bacterial panicle blight (BPB) disease along with conventional, breeding, and molecular approaches for the management. Different examples of resistance genes are cited in the chapter for better understanding. Chapters 8 and 9 describe the biology of rice-bacterial brown stripe (BBS) disease and biotechnological tools for its management. Chapters 10 and 11 describe biological studies of bacterial leaf streak (BLS) disease along with the retrospective perspective of rice bacterial leaf streak disease management. Chapters 12 and 13 discuss the general introduction of sheath brown rot and scrutiny of its traditional and molecular technologies for bacterial sheath brown rot disease resistance. Chapters 14 and 15 describe the biological and ecological studies of rice bacterial foot rot pathogen and comparative analysis of conventional and molecular approaches for bacterial foot rot disease resistance in rice. Chapter 16 includes the current developments of biocontrol agents (BCAs) and the scope of volatile organic compounds for the sustainable management of rice bacterial diseases. Chapter 17 describes the opportunities for bioinformatics tools for the management of rice bacterial disease.

Preface

xxv

Re-evaluating and reviewing the previous research along with recent discoveries will provide up-to-date knowledge to the readers. We believe that this book will serve as a useful reference book for all students, academicians, scientists in plant pathology, molecular breeders, and biotechnologists working in the area of crop science. The editors would appreciate receiving useful comments from readers that may assist in the development and advancement of future editions of the book. —Editors

CHAPTER 1

Impact of Major Rice Bacterial Diseases on Agriculture and Food Security DEEPAK KUMAR,1 SANTOSH K. ARYA,1 DEEPTI SRIVASTAVA,2 MD. SHAMIM,3 L. J. DESAI,4 and MANJUSHA TYAGI5 R&D Division, Nextnode Bioscience Pvt. Ltd., Opposite GEB Office,

Kadi-Kalol Road, Kadi–384440, Gujarat, India,

E-mail: [email protected] (D. Kumar)

1

Integral Institute of Agricultural Science and Technology,

Integral University, Dasauli, Lucknow–226021, Uttar Pradesh, India

2

Dr. Kalam Agricultural College, Kishanganj, (Bihar Agricultural

University, Sabour, Bhagalpur), Bihar–855107, India

3

Center for Research on Integrated Farming System, S.D. Agricultural

University, Sardarkrushinagar–385506, Banaskantha, Gujarat, India

4

Department of Microbiology, Shri Guru Ram Rai University, Patel Nagar,

Dehradun–248001, Uttarakhand, India

5

ABSTRACT Bacterial diseases of rice have a great impact on the sizable scale as yield losses that become alarming affairs to major rice-producing countries of South Asia and Africa, where rice is the main food. Under favorable conditions, sometimes bacterial diseases become very devastating (viz. bacterial blight (BB) and bacterial leaf streak (BLS)) for susceptible rice cultivars and result in up to 70% crop losses. Different bacterial pathogens cause mild to severe diseases, viz. seedling blight (Pseudomonas plantarii or Burkholderia plantarii), bacterial Bacterial Diseases of Rice and Their Management. Deepti Srivastava, Md. Shamim, Malik Mobeen Ahmad, & K. N. Singh (Eds.) © 2023 Apple Academic Press, Inc. Co-published with CRC Press (Taylor & Francis)

2

Bacterial Diseases of Rice and Their Management

brown stripe (BBS) (Pseudomonas avenae and Pseudomonas syringae pv. Panici), BB (Xanthomonas oryzae pv. oryzae (Xoo)), BLS (Xanthomonas oryzae pv. oryzicola), bacterial foot rot (Erwinia chrysanthemi/Dickeya zeae), grain rot (Pseudomonas glumae/Burkholderia glumae), bacterial halo blight (Pseudomonas syringae pv. Oryzae), bacterial palea browning (Erwnia herbicola), and sheath brown rot (Pseudomonas fuscovaginae) in rice crop at different growth stages under favorable conditions. These diseases bring out sudden outbreaks and create problems of food scarcity that carry on negative impacts such as food and livelihood security in the concerned country. In the current scenario, COVID-19 (coronavirus disease of 2019) has a threatening impact on agriculture and allied sectors. Therefore, consolidated approaches (viz molecular breeding, gene pyramiding, antagonists rhizobacteria, resistance cultivars, and transgenic modifications) are required for combating emerging pathogens as well as related diseases. 1.1 INTRODUCTION The main food source of the daily caloric intake for people of Asian and African countries is rice (Oryza sativa). The production, consumption, and supply worldwide are contented by only 15 countries, and most of Asia and have a 90% share of the world’s rice supply (Muthayya et al., 2012; Firdaus et al., 2020). Therefore, to fulfill the demand, there is a need for more rice production. However, many biotic (phytopathogens including bacteria) and biotic stress (heat, temperature, drought, floods) that occur throughout the growing season of rice are responsible for the reduction of rice yield as well as quality aspects (Saha et al., 2015; Ngalimat et al., 2021). Out of these, bacterial diseases are the main restraint with regard to the sustainable production of rice. These phytopathogenic bacterial diseases can change the pattern of the global supply of rice and create ensuing food insecurity (Shew et al., 2019). Moreover, devastating environmental changes are also induced by the phytopathogens that badly affect human health, agricultural produc­ tion, and the natural system (Arunanondchai et al., 2018, Raza et al., 2019). Unexpected changes in environmental variables, and the severe impacts on rice productivity are proceeding directly and indirectly to human health through abiotic stresses (Raza et al., 2019). Currently, the pandemic COVID-19 outbreak is an example of the indirect environmental impacts of biotic variables and has become a new challenge worldwide. In the course of the years 2020–2021, the production, consumption, and food supply chains of rice were badly affected and threatened the food security of poor

Impact of Major Rice Bacterial Diseases on Agriculture

3

countries (Sers et al., 2020; Siche, 2020; Cariappa et al., 2021). Bacterial rice diseases are a crucial gridlock as regards sustainable productivity in parts of Asia and African countries. The losses in rice crops have reached beyond 60% annually in acute infection conditions (Wubneh and Bayu, 2016; Wonni et al., 2016; Ngalimat et al., 2021). The transmission of bacte­ rial pathogens from an infected host to neighboring plants is taken place easily by water, sucking insects, and spreads rapidly to the leaves and roots. Some bacterial Pathogens are outspread rapidly and intermittently under favorable climatic conditions and bring out enormous barriers to rice production (NiñoLiu et al., 2006; Nandakumar et al., 2009; Velasquez et al., 2018). Moreover, infected seeds with bacterial pathogens can also infect or transmit contamination to germinating seedlings (Zhou-Qi et al., 2016). Rice bacterial pathogens have the diversity to infect all parts of the plant (viz seed, leaves, root foliar, etc.). Diverse genera of bacterial pathogens (viz Xanthomonas, Erwinia, Pseudomonas, Dickeya, and Burkholderia) are identified and studied to cause different diseases in rice like bacterial leaf blight (BLB) (Xanthomonas oryzae pv. oryzae (Xoo)), seedling blight (Pseudomonas plantarii or Burkholderia plantarii), bacterial brown stripe (BBS) (Pseudomonas avenae and Pseudomonas syringae pv. Panici), bacterial leaf streak (BLS) (Xanthomonas oryzae pv. oryzicola), bacterial foot rot (Erwinia chrysanthemi/Dickeya zeae), grain rot (Pseudomonas glumae/Burkholderia glumae), Sheath brown rot (Pseudomonas fuscovaginae), bacterial palea browning (Erwnia herbicola), and bacterial halo blight (Pseudomonas syringae pv. oryzae), respectively (Shakya et al., 1985; Azegami et al., 1987; Saha et al., 2015; Ochi et al., 2017; Lv et al., 2018; Saxena et al., 2020; Aflaha et al., 2020; Musonerimana et al., 2020; Jiang et al., 2020; Ngalimat et al., 2021). For the management of these bacterial diseases, extensive work and promising strategies are executed in the last few decades that are briefly discussed in this chapter in contrast to climate change, food security, chal­ lenges, and futuristic technologies to combat invasive pathogens. 1.2 BACTERIAL RICE DISEASES AND COMBAT STRATEGIES FOR THEIR MANAGEMENT Bacterial diseases are varied from crop to crop and are generally categorized into four broad categories based on damage to the plant tissue and related symptoms (viz. necrosis, tumors, vascular wilt, and soft rot) (https://www. britannica.com). In the case of rice, bacterial diseases infect the crop throughout the developing stage (seedling to maturity) and can give rise to

4

Bacterial Diseases of Rice and Their Management

substantially lower yield. In this section, major bacterial rice diseases are discussed (Table 1.1). 1.2.1 SEEDLING BLIGHT Pseudomonas plantarii or Burkholderia plantarii is the main causal organism to induce seedling blight in rice crops. As the name suggests, this disease is associated with the seedling stage, first observed in Japan in nursery boxes (Azegami et al., 1987). The bacterium is ~1.0 × 1.4–1.9 µm in size, Gramnegative, and non-spore-forming, and infects the first to third leaves of rice seedlings (reddish-brown). Seedling blight retards the growth of leaves as well as roots of rice seedlings (Azegami et al., 1987; Saha et al., 2015). Talayoshi et al. (2002) isolated antimicrobial activity containing thionine genes from oat and expressed them in rice to combat necrotrophic bacterial pathogens Pseudomonas plantari and Burkholderia glumae. Transgenic rice seedlings accumulate a high level of oat thionine in cell walls and effectively task against bacterial infestation. Adachi et al. (2012) used bacteriophage (BGPP-Ar) to lyse the causative pathogens (Burkholderia glumae and B. plantarii) of seedling blight and seedling diseases of the rice seedling stage. The bacteriophage (BGPP-Ar) was found to be effective in suppressing the seedling rot at a very low concentration (1.0×105 PFU/ml). Atmospheric plasma irradiation was used to disinfect the rice seeds before sowing to the management of seedling blight caused by Burkholderia plantari and Fusarium fujikuroi. The bacterial seedling disease index was reduced by plasma-treated seeds to 38.6% of non-treated control (Ochi et al., 2017). 1.2.2 BACTERIAL BROWN STRIPE (BBS) Bacterial brown stripe (BBS) is widely dispersed in rice-producing countries but does not generate much economic loss to production (Shakya et al., 1985; Saha et al., 2015). This disease is caused by pathogenic Gram-negative, noncapsulated, rod-shaped bacteria (Pseudomonas avenae and Pseudomonas syringae pv. Panici) and infects upland and wetland nurseries (Shakya et al., 1985). Rice bacterial stripe is a seed-borne disease that inhibits germination and occurs as brown stripes on leaf margins or midrib. After transplanting of seedlings, disease symptoms are masked and not seen after tillering stage except where submergence or flood conditions are present (Kadota and Ohuchi, 1983; Saha et al., 2015). The management of bacterial stripe can be

Major Bacterial Diseases of Rice, Causal Organisms, Symptoms, and Management Practices

Bacterial Disease

Causal Organism

Symptoms

Seedling blight

Pseudomonas plantarii/ or Burkholderia plantarii

• Iron-based compounds (ex-ferrous sulfate) • Basal chlorosis of the initial inhibit phytotoxin tropolone that causes the leaves is characterized as early seedling blight. symptoms • Reddish brown and desiccated symptoms at a later stage of infected seedlings

Management

• Through biotechnological intervention, a thionine coding gene was transferred in rice to provide resistance against the pathogen

References Azegami et al. (1987); Takayoshi et al. (2002); Saha et al. (2015); Ochi et al. (2017); Jamaloddin et al. (2020)

• Use resistance cultivars for cropping system (viz mega rice variety “Tellahamsa”) Pseudomonas avenae and Pseudomonas syringae pv. panici

• Seed treatment before sowing with dry heat • Symptoms occur at the (65°C for 6 days) to eliminate this seed-borne seedling stage and are divided pathogen into four types, viz, affect the germination, brown stripe on • Spraying of aminoglycoside antibiotic leaf margins or along with Kasugamycin can control the pathogen at the midrib, uncontrolled elongation nursery stage of mesocotyl, curving of the sheath of seedlings

Kadota and Ohuchi (1983); Shakya et al. (1985); Zeigler and Alvarez (1987); Saha et al. (2015); Saxena et al. (2020)

Bacterial blight

Xanthomonas oryzae pv. Oryzae (Xoo)

• Pathogen infestation as disease • Management of bacterial blight is comprised of many approaches: symptoms occurs in three forms: wilt, Kresek, and leaf ▪ Use of chemicals for seed treatment blight with pale to yellow leaf. or foliar spray (many antibiotics like penicillin, streptomycin (0.3% w/v along • It starts as water-soaked with wettable ceresin 0.05% w/v), for 8 yellowish stripes on leaf blades hours for seed soaking), chloramphenicol, or increases at leaf tips and adriamycin (0.025% for 8 hours), etc., then increases in width with a alone or in combination with copper oxide) wavy margin.

Ou (1985); Gnanamanickam (1999); Madhiazhagan et al. (2002); Manmeet and Thind (2003); Khan et al. (2014); Saha et al. (2015); https://agritech.tnau.ac.in/; Ahmed et al. (2020); Jiang et al. (2020); Ngalimat et al. (2021)

5

Bacterial brown stripe

Impact of Major Rice Bacterial Diseases on Agriculture

TABLE 1.1

Bacterial Disease

(Continued) Causal Organism

6

TABLE 1.1

Symptoms • Young lesions with bacterial ooze look like a milky or opaque dewdrop early in the morning. Furthermore, lesions are converted from yellow to white when the disease increases.

• The most destructive manifestation of bacterial blight is wilt syndrome known as ‘Kresek’ and observed between the temperature of 28°C–34°C at the seedling to the early tillering stage.

References

▪ Application of natural or botanical extracts (neem products viz 0.03–5.0 Azadirachtin based EC, Neem Seed Kernals, etc., leaf or rhizome extract of Adhatoda vasica, Curcuma longa, Allium cepa, Prosophis julifora) ▪ Biological control with microbial inoculants (Application of rhizobacteria viz Pseudomonas flurorescens, Bacillus subtillus, Azatobacter sp., Azosprillum brasilense, Trichoderma harzanium, Aspergillus sp.) ▪ Varietal resistance (Cultivars TKM6, Sigadis, Kogyoku, IR 28, Tetap, Basmati 385, Basmati 2000, etc.) ▪ Changes in cultural practices (many practices like (a) avoidance of excessive nitrogenous fertilizers, especially at the tillering stage that helped in bacterial blight incidence; (b) Soil application of the right amount of phosphate and potassium have been reported to decrease the incidence of bacterial blight and increase the yield (50 kg/ha in two splits at 40 and 50 days after sowing).

Bacterial Diseases of Rice and Their Management

• If we kept the infected cut ends of leaf in water, it shows turbidity because of bacterial ooze.

Management

Bacterial Disease

(Continued) Causal Organism

Bacterial leaf Xanthomonas streak oryzae pv. oryzicola

Symptoms

Management

• The pathogen hibernated in glumes of mature seeds and reached aerial parts of primary and secondary leaves through stomata and wounds. The pathogen multiplies in parenchymatous tissue and expresses in the form of a bacterial leaf streak.

• Seed soaking treatment with 0.025% (w/v) streptocycline solution for overnight and hot water treatment (52°C for 30 minutes) are recommended to control seed infection.

• The mature leaves are more resistant to the pathogen compared to young leaves that show susceptibility against to the disease. Bacterial foot Erwinia rot chrysanthemi/ Dickeya zeae

• Dark brown decay is observed in leaf sheaths of infected plants • As a result of infection, crowns, nodes, culms, and tillers are rotted and easily detached from plants. Infected parts turn black and fall off.

References

Ou et al. (1970); Shekhawat and Srivastava (1971); Saha et al. (2015); Jiang et al. (2020); Hata et • Sprays of Vitavix@ 0.15–0.3% showed very al. (2020) prominent results in preventing infection and lesion development. • Resistant or tolerant varieties (viz, Krishna, Jagannath, and IR-20)

• Sprays of Oxilinic (20% w/v) can be used as an antibacterial chemical to control this disease in the field

Goto (1979); Pu et al. (2012); Saha et al. (2015); Ching-Yi et al. (2016); Lv et al. (2018); Jieling et al. (2020)

Impact of Major Rice Bacterial Diseases on Agriculture

TABLE 1.1

• Unpleasant odor from infected plants

7

(Continued)

8

TABLE 1.1 Bacterial Disease

Causal Organism

Symptoms

Management

Grain rot

Pseudomonas glumae/ Burkholderia glumae

• Symptoms consist of brown patches on leaf sheaths accompanied through wilting of the leaves

• Dry heat treatment (65°C for 6 days) of small Chien et al. (1983); seed samples can be used for the eradicated Zeigler and Alvarez (1990); Saha et al. (2015); pathogen. Aflaha et al. (2020); 10 • A high concentration (10 CFU/ml) Mizobuchi et al. (2020) or equivalent of an avirulent strain of

• Panicle grains become shrunken, yellow to brown, dry, and dirty

References

Pseudomonas glumae is a potent method for reducing the population of the pathogen and its incidence

• RBG1, a quantitative trait locus (QTL) for BSR resistance Sheath brown Pseudomonas rot fuscovaginae

• Dry heat treatment (64°C for 6 days) of • At the seedling stage of clean seed samples can be used for the pathogenic infection, the leaf management of pathogens. sheath shows a systematic discoloration which may spread • Application of Antibiotics like streptomycin to the midrib of the leaves. and oxytetracycline alone or in combination • Glumes of panicles that emerge can affectively control brown sheath rot at or after the panicle emergence stage. by Infected sheaths show light brown and water-soaked lesions. Furthermore, infected panicles may be converted into discolored, empty, and deformed seeds.

Tanii et al. (1976); Zeigler and Alvarez (1987, 1990); Razak et al. (2009); Saha et al. (2015); Kim et al. (2015); Musonerimana et al. (2020)

Bacterial Diseases of Rice and Their Management

• Resistant rice cultivars (‘Kujuu,’ ‘Aikoku,’ ‘Nona Bokra’ (indica)

(Continued)

Bacterial Disease

Causal Organism

Symptoms

Management

References

Bacterial palea browning

Erwnia herbicola

• Initially, symptoms occur on the palea or lemma (most frequently) as water-soaked and light brown lesions.

• Application of plant growth promoting rhizobacteria (PGPR) as seed treatment, soil application/or foliar application can be used to manage pathogens at different stages

Azegami et al. (1983); Saha et al. (2015); Ngalimat et al. (2021)

• Immature or lighter grains are developed from infected panicles and become brown after milling. Bacterial halo Pseudomonas blight syringae pv. oryzae

• Circular, yellowish brown to • Serious damage is not occurred in the crop pale green lesions (2–10 µm in by this disease to date diameter) on leaf blades. These • PGPR can be used for controlling the lesions are surrounded through pathogen infestation a distinct halo, a dark brown spot in the center, and further spread as large blotches.

Kuwata (1985); Ngalimat et al. (2021)

Impact of Major Rice Bacterial Diseases on Agriculture

TABLE 1.1

9

10

Bacterial Diseases of Rice and Their Management

carried out through heat treatment (65°C for 6 days) of seeds before sowing (Zeigler and Alvarez, 1988; Saxena et al., 2020). Additionally, a foliar spray of antibiotics Kasugamycin (KSM) may be used for controlling pathogenic bacteria at the nursery level of rice seedlings (Saha et al., 2015). 1.2.3 BACTERIAL BLIGHT (BB) Bacterial blight (BB) is the most noxious disease that occurs mainly in ricegrowing regions of Asian countries (Saha et al., 2015; Saxena et al., 2020). BB is induced by Gram-negative, rod-shaped, non-spore-forming, and having a size of 0.55×3.5–2.17 µm bacterium viz. Xoo. In the case of susceptible varieties, it causes a devastating loss in rice yield by more than 70% under favorable environmental conditions (Mew and Vera-Cruz, 2001; Saha et al., 2015). The symptoms of the disease incidence are varied from leaf blight to wilt and yellow leaf according to the virulence of the pathogen (Xoo) and susceptibility of the host cultivar (Ansari and Sridhar, 2001; Saxena et al., 2020). The most destructive type of infestation is wilt syndrome, namely ‘Kresek’ that occurs from seedlings to an early stage of rice at 28°C to 34°C (Saha et al., 2015). The management of BB is an integrative approach in which five methods comprise: (i) resistant varieties (host); (ii) Application of chemicals (antibiotics, copper oxide, etc.); (iii) biological control (uses of rhizobacteria, Pseudomonas sp., Bacillus sp., Trichoderma sp., etc.); (iv) changes in cultural practices; and (v) applications of natural botanical extracts. In all methods viz resistant varieties, biological control, and chemi­ cals (antibiotics) applications are most acceptable globally to control BBs in rice (Table 1.1; Khan et al., 2014; Ahmed et al., 2020; Saxena et al., 2020). Host or varietal resistance is the most practical approach to disease manage­ ment. In previous decades, many resistance genes are transferred in host rice cultivars against pathogenic isolates of Xoo to minimize the yield losses throughout the globe over the last 20 years. Still, now, 40 resistance (R) genes are identified from different hosts against various cognate genes (Avr) of Xoo, and out of them, 11 resistant genes were successfully cloned (Ji et al., 2018; Jiang et al., 2020). The resistant (R) genes have been widely used to control BB disease in Asian countries since the 1970s and are categorized into four classes depending on encoding proteins, namely executer genes (Xa27, Xa23, and Xa10), receptor-like kinase genes (Xa3/Xa26, Xa4, Xa21), SWEET (Sugar will eventually be exported transporter) genes (Xa41, Xa25, and Xa13) and other unknown encoding protein types of genes (Xa5, Xa1) (Jiang et al., 2020; Table 1.2).

Summary of the Cognate (Avr) Genes of Xanthomonas oryzae and Combating Cloned Resistant (R) Rice Genes to Control Disease

Cognate Avr Genes of Xanthomonas oryzae

Cloned Rice Resistance (R) Genes

References

Gene

Encoding protein

Gene

Encoding protein

AvrRxo1

TAL effector

Rxo1

NLR

Zhao et al. (2004a, b)

Avrxa5/PthXo7

TAL effector

xa5

TFIIA transcription factor

Zou et al. (2010); Sugio et al. (2007); Jiang et al. (2006)

PthXo1/Tal4/Tal9d

TAL effector

Xa1

NLR

Ji et al. (2016a); Yoshimura et al. (1998)

AvrXa27

TAL effector

Xa27

Executor R protein

Jiang et al. (2020); Gu et al. (2005)

AvrXa23

TAL effector

Xa23

Executor R protein

Wang et al. (2014, 2015)

AvrXa10

TAL effector

Xa10

Executor R protein

Tian et al. (2014)

AvrXa7/PthXo3/TalC/Tal5

TAL effector

xa41 (OsSWEET14)

SWEET-type protein

Hutin et al. (2015); Streubel et al. (2013); Yu et al. (2011); Antony et al. (2010)

PthXo2

TAL effector

xa25 (OsSWEET13)

SWEET-type protein

Zhou et al. (2015); Liu et al. (2011)

PthXo1

TAL effector

xa13 (OsSWEET11)

SWEET-type protein

Yuan et al. (2009); Chu et al. (2006); Yang et al. (2006)

Not determined

Unknown

Xa4

Wall-associated kinase/RLK

Jiang et al. (2020); Hu et al. (2017)

RaxX

Unknown

Xa21

LRR-RLK

Pruitt et al. (2015); Song et al. (1995)

AvrXa3

Unknown

Xa3/Xa26

LRR-RLK

Xiang et al. (2006); Sun et al. (2004); Li et al. (2004)

Impact of Major Rice Bacterial Diseases on Agriculture

TABLE 1.2 Incidence

Abbreviations: TAL: transcription activator-like, SWEET sugar will eventually be exported transporter; NLR: nucleotide-binding domain and leucine-rich repeat; TFIIA: transcription factor IIA; NLR: nucleotide-binding domain and leucine-rich repeat.

11

12

Bacterial Diseases of Rice and Their Management

Recently, Jamaloddin et al. (2020) used marker-assisted gene pyra­ miding (MAGP) for bacterial and blast resistance through introgress of two major BB genes (Xa12 and Xa21) and two major blast resistance genes (Pi1 and Pi54) in mega rice variety “Tellahamse” to combat both diseases. Through biological control, Ku-Asmah et al. (2020) applied antagonistic activity containing Bacillus subtilis isolate (UiTMB1) against Xoo and found that B. subtilis (UiTMB1) treated rice plant has low severity disease and symptoms (severity index 3.43) compared to without treated rice plants (severity index 8.4), respectively. Silver nanoparticles (AgNPs) synthesized by using Bacillus cereus SZT1 were found to be an effec­ tive weapon against rice pathogen Xoo in a pot. The experiment showed notable antimicrobial activity and significantly increased the plant biomass (Ahmed et al., 2020). 1.2.4 BACTERIAL LEAF STREAK (BLS) Bacterial leaf streak (BLS) is the second major disease of rice after BB that causes an estimated 17–20% yield loss subject to the type of culti­ vars and agro-climatic conditions (Opina and Exconde, 1971; Saha et al., 2015; Hata et al., 2019). The disease can occur in rice at any growth stage and mostly in areas with high humidity and high temperature. The disease is transmitted through contamination of seeds with Gram-negative, rod-shaped, non-spore-forming, and single polar flagellum containing bacterium Xanthomonas oryzae pv. oryzicola that hibernates under the glumes in mature seeds (Shekhawat and Srivastva, 1972; Saha et al., 2015). Initially, the symptoms are started with small, water-soaked lesions on the first leaves and between leaf veins through wounds and stomata and spread as dark green to later become light brown to yellowish gray. Browning and dying of leaves under severe conditions affect the photosynthetic area of plants and simultaneously yield loss (http://www.knowledgebank.irri.org/; Saha et al., 2015). The bacterial disease can be controlled by spraying the antibiotic streptomycin and tetracycline in combination (300 g/ha) along with copper oxychloride (1.25 kg/ha) (http://www.agritech.tnau.ac.in). Resistance (R) genes have been identified and cloned for dual resistance against BB (Xoo) and BLS (Xanthomonas oryzae pv. Oryzicola) for the last three-four decades because of similar pathogens (Jiang et al., 2020; Table 1.1).

Impact of Major Rice Bacterial Diseases on Agriculture

13

1.2.5 BACTERIAL FOOT ROT Bacterial foot rot is found in major rice-growing Asian countries (India, China, Taiwan, Japan, Bangladesh, Philippines, and Korea) (Goto, 1979; Saha et al., 2015). The disease spread through wounds of infected rice roots under high humidity and temperature by Gram-negative and rod-shaped bacterial pathogens Erwinia chrysanthemi/Dickeya zeae (Pu et al., 2012; Lv et al., 2018). Infected rice leaf sheath shows a dark brown decay, and linked leaves turn yellow and fall out. Additionally, infected culms and plants with bacterial ooze have an unpleasant odor in the field. Pathogenic bacteria Dickeya zeae-induced rice foot rot was firstly reported in Taiwan under high humidity and temperature conditions (Ching-Yi et al., 2016). Jialing et al. (2020) used antagonists bacterial strains of Pseudomonas fluorescens (SC3), Pseudomonas parafulva (SC11), and Bacillus velezensis (3–10) to control pathogenic soft rot causing pathogenic Dickeya zeae was a safer and effec­ tive biocontrol procedure. 1.2.6 BACTERIAL GRAIN ROT Bacterial grain rot (BGR), caused by the bacterial pathogen Burkholderia glumae, is one of the most lethal diseases of rice (Oryza sativa). Burkholderia glumae was first noticed in Japan in 1955 (Goto and Ohata, 1956), and then observed in other geographical areas like the United States (Nandakumar et al., 2009), East and South Asia (Ashfaq et al., 2017; Mondal et al., 2015), and Latin America (Zhou 2014). This bacterial grain rot in Latin America and the United States is also known as “bacterial panicle blight” (Ham et al., 2011). When Burkholderia glumae-tainted seeds are sown and then transplanted into fields, the primary infection takes place. In order to establish secondary infection, the pathogen attacks plants close to the primary-infected plants at their heads. BGR can be seen when the spikelets’ usual green colour turns to a reddish-brown hue (Mizobuchi et al., 2018; Saha et al., 2015; Zeigler and Alvarez, 1990; Chien et al., 1983). Different physiochemical and organic methods (viz., antibiotics, thermal treatment, and biocontrol agents) are used to control Burkholderia glumae through seed treatment during sowing and foliar sprays at the time of seed setting and maturation stages. Syahri et al. (2019) used oxolinic acid as a foliar spray to manage the disease incidence by eliminating the pathogen Burkholderia glumae. The genetic regulation

14

Bacterial Diseases of Rice and Their Management

of BGR resistance has been extensively studied in the field using syringe inoculation at booting or spray inoculation at heading (Mizobuchi et al., 2018). The application of Burkholderia glumae resistant rice cultivars is a prominent tool in the current scenario to tackle the bacterial grain rot disease incidence. Although there have been numerous attempts to increase rice’s BGR resistance in Japan and other Asian countries, BGR-resistant cultivars have not yet been introduced. The need to create BGR-resistant cultivars is urgent (Mizobuchi et al., 2018). 1.2.7 BACTERIAL PALEA BROWNING Bacterial palea browning disease symptoms and disease incidence occur when high humidity and temperature, mainly in the rainy season heading, coincide with a high level of nitrogen supplementation. The symptoms are reported as light brown, water-immerged lesions on the palea at the early growth stage. Further, these lesions turn brown and induce discoloration on the palea. As a result of infestation, emerged panicles materialize more immature grains at harvesting (Saha et al., 2015). The disease is mainly reported in Japan and sometimes engenders severe loss in rice yield by up to 32% (Azegami et al., 1983). This disease is caused by the Gram-negative and fermentative bacterium Erwnia herbicola. There is no proper management available; however, the application of plant growth-promoting rhizobacteria with ST/or foliar spraying can control the pathogen at different growth stages (Ngalimat et al., 2021). 1.2.8 BACTERIAL HALO BLIGHT Bacterial halo blight is a minor disease of rice that was first reported in Aomori Prefecture, Japan, in 1985 (Kuwata et al., 1985). The causal pathogen of this disease is Pseudomonas syringae pv. Oryzae makes circular, yellowishbrown to pale green lesions on leaf blades. These lesions on spreading turn into large blotches with a dark brown spot in the center. This disease does not cause any serious infestation to crops; however, usage of rhizobacterial bacterial formulations can be controlled the disease incidence through ST/ or foliar spraying at growth stages (Kuwata et al., 1985; Saha et al., 2015; Ngalimat et al., 2021).

Impact of Major Rice Bacterial Diseases on Agriculture

15

1.3 IMPACT OF BACTERIAL DISEASES ON FOOD SECURITY Climate change is considered to elevate the temperature and humidity in many regions of the world and lead to different devastating bacterial diseases in rice (Lenaerts et al., 2019; Shew et al., 2019; Raza et al., 2019). As a result, rice production is decreasing globally that alleviating hunger (both chronic and hidden) (Gödecke et al., 2018), malnutrition, and poverty (Dollar et al., 2013). However, the exact figure of these changes is impossible to estimate, but definitely associated with negative global crop production and quality attributes (Sreenivasulu et al., 2015). The impact of climate change on biotic (infestations, epidemics) and abiotic (droughts, floods, storms, CO2 concentrations, light, soil fertility, atmospheric ozone, methane, and extreme temperatures) conditions affect plant disease development (Velasquez et al., 2018). Among all environmental variables, temperature, humidity, and carbon concentrations are predicted to most likely change factors that affect the climate in this century (Hua, 2013; Velasquez et al., 2018; Figure 1.1).

FIGURE 1.1 incidence.

Impact of environmental variables on plant-pathogen interactions and disease

Source: Adapted from Velasquez et al. (2018); Open archive.

16

Bacterial Diseases of Rice and Their Management

There is an optimal temperature range for disease incidence through plant-pathogen interaction; For example, in the case of Xanthomonas oryzae bacteria to colonize rice and induce BB infection to require the most favor­ able nighttime temperature of 27°C and daytime temperatures of 35°C, and nighttime temperatures of 27°C, respectively (Horino et al., 1982; Webb et al., 2010). Similarly, rice foot rot disease caused by Dickeya zea could infect at a wide range of temperatures 10–40°C, with the optimal range in 30–35°C (Ching-Yi et al., 2016). These findings show important entanglement as increasing global temperature due to climate change to diseases’ incidence in rice crop. Many bacterial diseases of rice are favored by humidity, high soil moisture, and precipitation of rain. The virulence of bacterial pathogens is promoted by high humidity and rain that infect the aerial parts of the plant. Continuous heavy rain and strong wind instigate disease-inducing bacterial pathogen (Xanthomonas oryzae) to spread by ooze droplets on abrasion of infected plants in case of BB (Saha et al., 2015; Jiang et al., 2020). Similarly, Sakthivel (2001) observed that high relative humidity (range of 65–85%) and temperature (20–30°C) favor sheath rot development in rice. The rice sheath rot is a complex disease that may be induced by various bacterial (Pseudomonas fuscovaginae) and fungal pathogens (Sarocladium oryzae, Fusarium sp./Fusarium fujikuroi complex) in high humidity and tempera­ ture (Bigirimana et al., 2015). Furthermore, pathogenic Dickeya zea induced bacterial foot rot of rice at high temperature and relative humidity (32°C and 90% RH), respectively (Pu et al., 2012). Atmospheric carbon dioxide (CO2) concentration across the globe has increased dramatically due to the industrial revolution. In the current scenario, CO2 concentration has reached at 400 ppm (parts per million) threshold and surpassed the 285 ppm that was at the beginning of the 19th century because of anthropogenic interventions (Etheridge et al., 1996; Intergovernmental Panel on Climate Change (IPCC), 2014). It is also observed that CO2 concentrations (at 620 and 780 ppm) increase the disease severity in C3 crop plants (rice and wheat) while inversely can increase the yields (Kobayashi et al., 2006; Vary et al., 2015). There is not any study related to rice pathogen (bacterial or fungal) that is directly associated with CO2 concentration, but in the case of the wheat crop, the virulence of fungal pathogen Fusarium graminearum and susceptibility of wheat cultivars (both susceptible and resistant genotypes-overall more severe disease) increased by elevated CO2 levels (Vary et al., 2015; Velasquez et al., 2018). However, the effect of elevated CO2 concentration is indirectly associated with increased temperature and cannot separate the overall predicted effect on different biotic interacting factors of disease incidence (Trebicki et al., 2016).

Impact of Major Rice Bacterial Diseases on Agriculture

17

These stresses across commodity groups have relative importance and exhibit different crop produce mixes according to areas. Hence, a major loss in cereal production has been reported closely at USD 4 billion, and this cumulative stress-related production loss was high across all commodity groups in Asia. Over the past two decades, the cereal production cumulative loss of about USD 12 billion, and Rice and wheat were the most affected commodities (FAO, 2017). The vast majority of people who lives in Asian and African countries (nearly 70%) take a rice-based diet as staple food predominantly (Smil, 2000; Zeigler and Savary, 2010; Iqbal, 2020). The price of cereals, especially rice, was hiked in previous past decades because of less global rice production, increased population, and global demands (1.5% surpluses), respectively (Zeigler and Savary, 2010; Iqbal, 2020). Previous studies of plant diseases revealed that sometimes diseases might be very devastating that can completely demolish the crop. The infestation of BLBs on susceptible rice variety MR84 had caused a gigantic loss estimated at Malaysian Ringgit (RM) from 50 million during the years 1988 to 1994 (Saad et al., 2000). The disease infestation can be reduced of crop production by up to 50% at various levels that depend on many components like types of the cultivar (degree of resistance), rice planting technique, pathogen status, environmental variables, and growing crops’ stages (Gnanamanickam et al., 1999; Velasquez et al., 2018). The losses in rice yield were varied by BLB from 6–60% in different agro-climatic zones of states in India. The severity of the disease depends upon the virulence of the pathogen, severity of infec­ tion, and category of cultivars (Ou, 1985; Saha et al., 2015). Similarly, in the case of Xanthomonas oryzae pv. oryzicola-induced BLS disease caused yield loss of up to 1.5 to 17.1% depending on the climatic factors and culti­ vars type (Opina and Exconde, 1971; Saha et al., 2015; Jiang et al., 2020). Furthermore, bacterial rice grain rot disease caused by Burkholderia glumae induced a huge loss in yield ranging from 40% during years 1995–1998 in the southern United States, whereas even in some places, this yield loss increased up to 80% (Fang et al., 2009; Ham et al., 2011; Zhou et al., 2011; Syahri et al., 2019). Sew et al. (2019) studied the bacterial panicle blight (BPB) disease caused by Burkholderia glumae and its impact on rice yield, quality, and market price for consumers in the USA. The study revealed that yield losses for annual rice production were associated with BPB occurrences under the +1–3°C warming scenario during 2003–2013. The results from the study postulated that the mitigation of BPB would represent a $69 million USD increase in the surplus of consumers and an estimated requirement of the

18

Bacterial Diseases of Rice and Their Management

accompanying increase in rice production to feed an additional 1.46 million people annually. Under the elevation of 1°C warming, BPB would induce devastating rice production losses, and subsequently, results of this US have to increase the budget by $112 million USD for consumers annually. 1.4 CHALLENGES AND FUTURE DIRECTIONS The pace of ongoing changes in climatic conditions is very terrible and has already become vulnerable in many ways for global food security, including the emergence of devastating invasive new diseases not only for the cropping system as well for human health in food-producing regions (Velasquez et al., 2018). Currently, pandemic COVID-19 disease seriously affects the agriculture system, food supply chain, food demand, and food security and consequently has a great impact on the vulnerable population of poor countries (Siche et al., 2020). During COVID-19, the demand for staple foods has increased because of disease spreading, mortality, uncertainty, and a reduction in the spending capacity of people. This situation could be worse for people if this pandemic COVID-19 remains for a forthcoming time, because of job losses and reduced source of income (FAO, 2020b). In India, the survey revealed that the impact of COVID-19 on agricultural production and livelihood was very serious, and up to 60% of farmers suffered yield loss on their harvest (DownToEarth, 2020). This is an alarming time to execute global research efforts to understand how environmental conditions influence pathogen virulence, disease incidence, plant immunity, and combat strategies against emerging pathogens. Changes in environmental variables or factors reduce the plant immunity or increase the virulence of the pathogen. However, artificial intelligence (AI), digital intervention, and previous disease incidence data may be used to develop conceptual models to consolidate the differential impacts of climatic conditions on the incidence of plant diseases. These mathematical relations could apply in making a model based upon the metabolic theory of ecology (MTE) and plant-pathogen interactions. Moreover, this method could be used in assessing the effect of climatic variables on human diseases (Altizer et al., 2013). The MTE may be potentially applied to postulate the responding behavior of host plants and pathogens under changing environments (Brown et al., 2004). An Indian startup company AgNext has innovated and developed mathematically integrated full-stack algorithms, software, and hardware platform device that are used for quality assessment of crop production on the spot in just 30 seconds. The company integrated

Impact of Major Rice Bacterial Diseases on Agriculture

19

the data of quality-related variables with NMR data for quality assessment (The Hindu Business Line, 2021). The development of novel, improved cultivars that combat biotic and abiotic traits should be focused on futuristic breeding programs. These traits could be found in the germplasm of cultivated and wild relatives by which a novel crop variety is developed. There are many popular methods (viz gene pyramiding, backcross method, mutation breeding, QTL marker-assisted selection (MAS), genome-wide association mapping, or others) that may be applied for incorporating the biotic and abiotic traits in cultivated rice vari­ eties. Many attempts were executed to incorporate both biotic and abiotic traits from resistant or wild germplasm in cultivated varieties. Chen et al. (2020) identified the novel bacterial resistance gene Xa46(t) through mapping and expression analysis of the rice mutant H120. This mutant H120 was resistant to all Chinese Xoo races and derived from Japonica rice Lijiangx­ intuanheigu. The studies of sequence data revealed that Xa46(t) gene is not identical to the resistance gene Xa23 and hence, novel in nature. Jamaloddin et al. (2020) used MAGP for incorporating dual BB and blast resistance into the mega rice variety “Tellahamsa” to combat both pathogens. In their study, two major BB genes (Xa21 and Xa13) and two major blast resistance genes (Pi54 and Pi1) were transferred through a marker-assisted backcross breeding strategy. There are needed more efforts of this type to transfer dual pathogens resistance genes into high-yielding commercial varieties. Another strategy may be genetic manipulation or genetic engineering of resistant specific traits, but public acceptance and government policies are the big issues that could hinder the path of genetically modified crops in any country. Many countries have prominent restrictions on transgenic crop cultivation (Only 28 countries permit genetically modified organisms for use as up to 2016). However, in recent few years, a technology, namely CRISPR (clustered regularly interspersed short palindromic repeats) has become very famous among the scientific community that could reduce these regulatory concerns, but there are not any proper guidelines and regulations in countries still now (ISAAA, 2016; Velasquez et al., 2018). This technique is divergent for TALEN (transcription activator-like effector nucleases) and ZFN (zinc finger nucleases) in terms of the DNA binding site, a specific easily engineered 20 base pair RNA (ribonucleic acid) guide sequence target Cas9 through its DNA base pairing binding (Romero and Gatica-Arias, 2019). Zafar et al. (2020) established precise CRISPR-Cas9 mediated genome-edited through targeting 4EBFs (susceptibility gene) adjacent in the promoter of OsSWEET14 of super basmati rice for resistance against BB. The results of this study revealed that CRISPR-Cas9 achieved 9% editing

20

Bacterial Diseases of Rice and Their Management

efficacy and generated resistance against BB Xoo strains in local varieties. Similarly, BB resistance genes OsSWEET14 and OsSWEET11 were targeted to edit through designed sgRNAs for incorporating the resistance against Xoo strains of Xanthomonas oryzae (Jiang et al., 2013). Some technologies like nanosensors would also be used in the detection of more precise invasive pathogen epidemics and enable us to forecast disease incidence in the field (Kwak et al., 2017). In addition, phenotyping through a high-resolution sensor-based camera to detect the continuous changes in both environmental factors and pathogen incidence could benefit to draw an exact picture of the concerned field (Fahlgren et al., 2015). Another prominent area for futuristic research for disease management could be an enrichment of infected soils with growth-promoting bacterial inoculants that have the ability to control pathogens through plant–microbiome interac­ tions (Hacquard et al., 2017). These growth-promoting microbes create a community-defined microbiome that induces environmental tolerance and suppresses pathogens. 1.5 CONCLUSION Climate changes are frightening the globe by impeding agriculture and concerned food industries. These climate changes are happening in the form of biotic (phytopathogens), and abiotic (heat, temperature, floods, etc.) stress that direct associations with food safety and security. Increased tempera­ ture and precipitation bring out ambiance for the incidence of invasive phytopathogens that cause devastating diseases. These sudden outbreaks of diseases can pose instantly the livelihood of millions of people at risk through a systematic weakening of yield losses in rice, especially in Africa and South Asian countries where rice is the main staple crop. Currently, pandemic COVID-19 has indirectly affected agriculture and allied sectors worldwide, and poor countries face problems of food scarcity and livelihoods security. Some novel technologies like CRISPR-Cas9 for resistance genes transfer, gene pyramiding by molecular backcrossing method, and applica­ tion of antagonists’ rhizobacteria-based biofertilizers and biopesticides can be hope for the futuristic management of emerging rice diseases. Therefore, there is an urgent requirement for sustainable and eco-friendly approaches to combat emerging diseases and invasive pathogens. Moreover, agriculturists, policymakers, scientists, and economists should plan for a buoyant future of rice production and consumption worldwide.

Impact of Major Rice Bacterial Diseases on Agriculture

21

KEYWORDS • • • • • •

artificial intelligence bacterial diseases bacterial leaf blight environmental conditions food security Oryza sativa

REFERENCES Adachi, N., Tsukamoto, S., Inoue, Y., & Azegami, K., (2012). Control of bacterial seedling rot and seedling blight of rice by bacteriophage. Plant Disease, 96(7), 1033–1036. Aflaha, I., Chairul, J., Baharuddin, A., & Kuswinanti, T., (2020). Molecular identification of bacteria causing grain rot disease on rice. IOP Conf. Series: Earth and Environmental Science, 486, 012165. doi: 10.1088/1755-1315/486/1/012165. Ahmed, T., Shahid, M., Noman, M., Niazi, M. B. K., Mahmood, F., Manzoor, I., Zhang, Y., et al., (2020). Silver nanoparticles synthesized by using Bacillus cereus SZT1 ameliorated the damage of bacterial leaf blight pathogen in rice. Pathogens, 9, 160. doi: 10.3390/ pathogens9030160. Altizer, S., Ostfeld, R. S., Johnson, P. T., Kutz, S., & Harvell, C. D., (2013). Climate change and infectious diseases: From evidence to a predictive framework. Science, 341, 514–519. Ansari, M. M., & Sridhar, R., (2001). Iron nutrition and virulence in Xanthomonas oryzae pv. oryzae. Ind. Phytopath., 54, 179–183. Antony, G., Zhou, J., Huang, S., Li, T., Liu, B., White, F., & Yang, B., (2010). Rice xa13 recessive resistance to bacterial blight is defeated by induction of the disease susceptibility gene Os-11N3. Plant Cell, 22, 3864–3876. Arunanondchai, P., Fei, C., Fisher, A., McCarl, B. A., Wang, W., & Yang, Y., (2018). How does climate change affect agriculture. In: The Routledge Handbook of Agricultural Economics. Routledge: Abingdon-on-Thames, UK. Ashfaq, M., Mubashar, U., Haider, M. S., Ali, M., Ali, A., & Sajjad, M. (2017). Grain discoloration: an emerging threat to rice crop in Pakistan. J. Anim. Plant Sci. 27, 696–707. Azegami, K., Nishiyama, K., Watanabe, Y., Kadota, I., Ohuchi, A., & Chikafusa, F., (1987). Pseudomonas plantarii sp. nov., the causal agent of rice seedling blight. International Journal of Systematic Biotechnology, 37(2), 144–152. Azegami, K., Ozaki, K., Matsuda, A., & Ohata, K., (1983). Bacterial palea browning, a new disease of rice caused by Erwinia herbicola (In Japanese, English Abstr.) Bull. Natl. Inst. Agric. Sci. fer. C., 27, 1–12. Bigirimana, V. P., Hua, G. K. H., Obedi, I. N., & Höfte, M., (2015). Rice sheath rot: An emerging ubiquitous destructive disease complex. Front. Plant Sci., 6, Article 1066. https:// doi.org/10.3389/fpls.2015.01066.

22

Bacterial Diseases of Rice and Their Management

Brown, J. H., Gillooly, J. F., Allen, A. P., Savage, V. M., & West, G. B., (2004). Toward a metabolic theory of ecology. Ecology, 85, 1771–1789. Cariappa, A. G. A., Acharya, K. K., Adhav, C. A., Sendhil, R., & Ramasundaram, P., (2021). Impact of COVID-19 on the Indian agricultural system: A 10-point strategy for postpandemic recovery. Outlook on Agriculture, 50(1), 26–33. Chen, S., Wang, C., Yang, J., Chen, B., Wang, W., Su, J., Feng, A., Zeng, L., & Zhu, X., (2020). Identification of the novel bacterial blight resistance gene Xa46(t) by mapping and expression analysis of the rice mutant H120. Scientific Reports, 10, 12642. ChingYi, L., ChiaoWen, H., HongRen, Y., Chiahsin, T., SuiLi, H., & Hui, F. N., (2016). Rice bacterial foot rot disease caused by Dickeya zeae in Taiwan. Journal of Taiwan Agricultural Research, 65(2), 207–217. Chu, Z., Yuan, M., Yao, J., Ge, X., Yuan, B., Xu, C., Li, X., et al., (2006). Promoter mutations of an essential gene for pollen development result in disease resistance in rice. Genes Dev., 20, 1250–1255. Dollar, D., Kleineberg, T., & Kraay, A., (2013). Growth Still is Good for the Poor. The World Bank. DownToEarth (2020). In: Shagun, K., (ed.), COVID-19: 60% Farmers Suffered Yield Loss on Their Harvest, Shows Survey. Published: 2020. https://www.downtoearth.org.in/news/ agriculture/covid-19-60-farmers-suffered-yield-loss-on-their-harvest-shows-survey-71270 (accessed on 16 August 2022). Etheridge, D. M., Steele, L. P., Langenfelds, R. L., Francey, R. J., Barnola, J. M., & Morgan, V. I., (1996). Natural and anthropogenic changes in atmospheric CO2 over the last 1000 years from air in Antarctic ice and firn. J. Geophys. Res., 101, 4115–4128. Fahlgren, N., Gehan, M. A., & Baxter, I., (2015). Lights, camera, action: High-throughput plant phenotyping is ready for a close-up. Curr. Opin. Plant Biol., 24, 93–99. Fang, Y., Xu, L., Tian, W., Huai, Y., Yu, S., Lou, M., & Xie, G., (2009). Real-time fluorescens PCR method for detection of Burkholderia glumae from rice. Rice Science, 16, 157–160. FAO, (2017). The Impact of Disasters and Crises on Agriculture and Food Security. ISBN: 978-92-5-130359-7. www.fao.org/publications (accessed on 16 August 2022). FAO-Food and Agriculture Organization, (2020b). FAO Director-General Urges G20 to Ensure that Food Value Chains are not Disrupted During COVID-19 Pandemic. Available in: http://www.fao.org/news/story/en/item/1268254/icode/ (accessed on 16 August 2022). Firdaus, R. B. R., Leong, T. M., Rahmat, S. R., & Senevi, G. M., (2020). Paddy, rice, and food security in Malaysia: A review of climate change impacts. Cogent Soc. Sci., 6, 1818373. Gnanamanickam, S., Brindha, P. V., Narayanan, N., Vasudevan, P., & Kavitha, S., (1999). An overview of bacterial blight disease of rice and strategies for its management. Curr. Sci.; 77, 1435–1443. Gödecke, T., Stein, A. J., & Qaim, M., (2018). The global burden of chronic and hidden hunger: Trends and determinants. Glob. Food Secur., 17, 21–29. Goto, K., & Ohata, K. (1956) New bacterial diseases of rice (brown stripe and grain rot). Ann. Phytopathol. Soc. Jpn. 21: 46–47. Goto, M., (1979). Dissemination of Erwinia chrysanthemi, the causal organism of bacterial foot rot of rice. Pl. Dis. Rep., 63, 100–103. Gu, K., Yang, B., Tian, D., Wu, L., Wang, D., Sreekala, C., Yang, F., et al., (2005). R gene expression induced by a type-III effector triggers disease resistance in rice. Nature, 435, 1122–1125. Hacquard, S., Spaepen, S., Garrido-Oter, R., & Schulze-Lefert, P., (2017). Interplay between innate immunity and the plant microbiota. Annu. Rev. Phytopathol. 55, 565–589.

Impact of Major Rice Bacterial Diseases on Agriculture

23

Ham, J. H., Melanson, R. A., & Rush, M. C. (2011). Burkholderia glumae: next major pathogen of rice? Mol. Plant Pathol. 12, 329–339. Hata, E. M., Sijam, K., Yusof, M. T., & Zulperi, D., (2019). Occurrence of Xanthomonas oryzae pv. oryzicola causing bacterial leaf streak disease of rice in different state of Malaysia. J. Plant Pathol., 101, 785, 786. Horino, O., Mew, T. W., & Yamada, T., (1982). The effect of temperature on the development of bacterial leaf blight on rice. Ann. Phytopath. Soc. Japan, 48, 72–75. https://agritech.tnau.ac.in/crop_protection/rice_diseases/rice_3.html (accessed on 16 August 2022). https://www.britannica.com/science/plant-disease/Symptoms-and-signs (accessed on 16 August 2022). Hu, K., Cao, J., Zhang, J., Xia, F., Ke, Y., Zhang, H., Xie, W., et al., (2017). Improvement of multiple agronomic traits by a disease resistance gene via cell wall reinforcement. Nat Plants, 3, 17009. Hua, J., (2013). Modulation of plant immunity by light, circadian rhythm, and temperature. Curr. Opin. Plant Biol., 16, 406–413. Hutin, M., Sabot, F., Ghesquière, A., Koebnik, R., & Szurek, B., (2015). A knowledge-based molecular screen uncovers a broad spectrum OsSWEET14 resistance allele to bacterial blight from wild rice. Plant J., 84, 694–703. Intergovernmental Panel on Climate Change, (2014). In: Pachauri, R. K., & Meyer, L. A., (eds.), Climate Change 2014: Synthesis Report. Contribution of working groups I, II, and III to the Fifth Assessment Report of the Intergovernmental Panel on Climate Change. (Geneva: IPCC). Iqbal, S., (2020). Insect, pest, and disease management in rice. In: Book: Rice Production Knowledge and Practices for Ensuring Food Security (pp. 1–25). Publisher: Austin publishing group. ISAAA, (2016). ISAAA Annual Report 2016. International Service for the Acquisition of Agri-biotech Applications. Jamaloddin, M., Rani, C. V. D., Swathi, G., Anuradha, C., Vanisri, S., Rajan, C. P. D., Raju, S. K., et al., (2020). Marker assisted gene pyramiding (MAGP) for bacterial blight and blast resistance into mega rice variety “Tellahamsa”. PLOS One, 1–19, 0234088. Ji, Z., Ji, C., Liu, B., Zou, L., Chen, G., & Yang, B., (2016a). Interfering TAL effectors of Xanthomonas oryzae neutralize R-gene-mediated plant disease resistance. Nat. Commun., 7, 13435. Ji, Z., Wang, C., & Zhao, K., (2018). Rice routes of countering Xanthomonas oryzae. Int J. Mol. Sci., 19, 3008. Jiang, G. H., Xia, Z. H., Zhou, Y. L., Wan, J., Li, D. Y., Chen, R. S., Zhai, W. X., & Zhu, L. H., (2006). Testifying the rice bacterial blight resistance gene xa5 by genetic complementation and further analyzing xa5(Xa5) in comparison with its homolog TFIIAγ1. Mol. Gen. Genomics, 275, 354–366. Jiang, N., Yan, J., Liang, Y., Shi, Y., He, Z., Wu, Y., Zeng, Q., et al., (2020). Resistance genes and their interactions with bacterial blight/leaf streak pathogens (Xanthomonas oryzae) in rice (Oryza sativa L.)—An updated review. Rice, 13, 3. Jiang, W. Y., Bikard, D., Cox, D., Zhang, F., & Marraffini, L. A., (2013). RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Nat. Biotechnol., 31(3), 233–239. Jieling, L. J., Hu, M., Xue, Y., Chen, X., Lu, G., Zhang, L., & Zhou, J., (2020). Screening, identification, and efficacy evaluation of antagonistic bacteria for biocontrol of soft rot disease caused by Dickeya zeae. Microorganisms, 8, 697. doi: 10.3390/microorganisms8050697.

24

Bacterial Diseases of Rice and Their Management

Kadota, I., & Ohuchi, A., (1983). Symptoms of bacterial brown stripe of rice seedlings in nursery boxes. Ann. Phytopathol. Soc. Jpn., 49, 561–564. Khan, J. A., Afroz, S., Arshad, H. M. I., Sarwar, N., Anwar, H. S., Saleem, K., Babar, M. M., & Jamil, F. F., (2014). Biochemical basis of resistance in rice against bacterial leaf blight disease caused by Xanthomonas oryzae pv. oryzae. Adv. Life Sci., 1(3), 181–190. Kim, J., Choi, O., & Kim, W. I. (2015). First report of sheath brown rot of rice caused by Pseudomonas fuscovaginae in Korea. Plant Disease 99(7), 1033. https://doi.org/10.1094/ PDIS-11-14-1219-PDN. Kobayashi, T., Ishiguro, K., Nakajima, T., Kim, H. Y., Okada, M., & Kobayashi, K., (2006). Effects of elevated atmospheric CO2 concentration on the infection of rice blast and sheath blight. Phytopathology, 96, 425–431. Kwak, S. Y., Wong, M. H., Lew, T. T. S., Bisker, G., Lee, M. A., Kaplan, A., Dong, J., et al., (2017). Nanosensor technology applied to living plant systems. Annu. Rev. Anal. Chem., 10, 113–140. Lenaerts, B., Collard, B. C. Y., & Demont, M., (2019). Review: Improving global food security through accelerated plant breeding. Plant Science, 287, 110207. Li, P., Long, J. Y., Huang, Y. C., Zhang, Y., & Wang, J. S., (2004). AvrXa3: A novel member of avrBs3 gene family from Xanthomonas oryzae pv. oryzae has a dual function. Prog. Nat. Sci., 14, 767–773. Liu, Q., Yuan, M., Zhou, Y., Li, X., Xiao, J., & Wang, S., (2011). A paralog of the MtN3/saliva family recessively confers race-specific resistance to Xanthomonas oryzae in rice. Plant Cell Environ., 34, 1958–1969. Lv, M., Chen, Y., Liao, L., Liang, Z., Shi, Z., Tang, Y., Ye, S., et al., (2018). Fis is a global regulator critical for modulation of virulence factor production and pathogenicity of Dickeya zeae. Sci Rep., 8, 341. Madhiazhagan, K., Ramadoss, N., & Anuradha, R. (2002). Effect of botanicals on bacterial blight of rice. J. Mycol. Pl. Pathol. 32, 68–69. Manmeet, M., & Thind, B. S., (2002). Management of bacterial blight of rice with bioagents. Pl. Dis. Res., 17, 21–28. Mew, T. W., & Vera, C. C. M., (2001). Bacterial blight of rice. In: Maloy, O. C., & Murray, T. D., (eds.), Encyclopaedia of Plant Pathology (pp. 71–74). John Wiley and Sons, New York. Mizobuchi, R., Fukuoka, S., Tsuiki, C., Tsushima, S., & Sato, H. (2018). Evaluation of major Japanese rice cultivars for resistance to bacterial grain rot caused by Burkholderia glumae and identification of standard cultivars for resistance. Breed Sci. 68(4), 413–419. Mizobuchi, R., Fukuoka, S., Tsuiki, L., Tsushima, S., & Sato, H., (2020). Evaluation of major rice cultivars for resistance to bacterial seedling rot caused by Burkholderia glumae and identification of Japanese standard cultivars for resistance assessments. Breeding Science, 70, 221–230. doi: 10.1270/jsbbs.19117. Mondal, K. K., Mani, C., & Verma, G. (2015). Emergence of bacterial panicle blight caused by Burkholderia glumae in North India. Plant Dis. 99, 1268. Musonerimana, S., Bez, C., Licastro, D., Habarugira, G., Bigirimana, J., & Venturi, V., (2020). Pathobiomes revealed that Pseudomonas fuscovaginae and Sarocladium oryzae are independently associated with rice sheath rot. Microb. Ecol., 80, 627–642. Muthayya, S., Hall, J., Bagriansky, J., Sugimoto, J., Gundry, D., Matthias, D., et al., (2012). Rice fortification: An emerging opportunity to contribute to the elimination of vitamin and mineral deficiency worldwide. Food Nutr. Bull., 33, 296–307. https://doi.org/10.1177/1564 82651203300410PMID: 23424896.

Impact of Major Rice Bacterial Diseases on Agriculture

25

Nandakumar, R., Shahjahan, A. K. M., Yuan, X. L., Dickstein, E. R., Groth, D. E., Clark, C. A., Cartwright, R. D., & Rush, M. C., (2009). Burkholderia glumae and B. gladioli cause bacterial panicle blight in rice in the southern United States. Plant. Dis., 93, 896–905. Ngalimat, M. S., Hata, E. M., Zulperi, D., Ismail, S. I., Ismail, M. R., Zainudin, N. A. I. M., Saidi, N. B., & Yusof, M. T., (2021). Plant growth-promoting bacteria as an emerging tool to manage bacterial rice pathogens. Microorganisms, 9, 682. NiñoLiu, D. O., Ronald, P. C., & Bogdanove, A. J., (2006). Xanthomonas oryzae pathovars: Model pathogens of a model crop. Mol. Plant. Pathol., 7, 303–324. Ochi, A., Konishi, H., Ando, S., Sato, K., Yokoyama, K., Tsushima, S., Yoshida, S., & Morikawa, T. H., (2017). Management of bakanae and bacterial seedling blight diseases in nurseries by irradiating rice seeds with atmospheric plasma. Plant Pathology, 66, 67–76. doi: 10.1111/ppa.12555. Opina, O. S., & Exconde, O. R., (1971). Assessment of yield loss due to bacterial leaf streak of rice. Phil. Phytopath., 7, 35–39. Ou, S. H., (1985). Rice diseases (2nd edn., p. 370). Commonwealth Mycological Institute, New England. Ou, S. H., Frank, P. G., & Merca, S. D., (1970). Varietal resistance to bacterial leaf steak disease in the Philippines. Philippines Agric., 54, 8–32. Pruitt, R. N., Schwessinger, B., Joe, A., Thomas, N., Liu, F., Albert, M., Robinson, M. R., et al., (2015). The rice immune receptor XA21 recognizes a tyrosine sulfated protein from a gram-negative bacterium. Sci Adv., 1, e1500245. Pu, X. M., Zhou, J. N., Lin, B. R., & Shen, H. F., (2012). First report of bacterial foot rot of rice caused by Dickeya zeae in China. Plant Disease, 96(12), 1818. doi: 10.1094/ PDIS-03-12-0315-PDN. Raza, A., Razzaq, A., Mehmood, S. S., Zou, X., Zhang, X., Lv, Y., & Xu, J., (2019). Impact of climate change on crops adaptation and strategies to tackle its outcome: A review. Plants, 8, 34. doi: 10.3390/plants8020034. Razak, A. A., Zainuddin, N. A. I. M., Sidiqe, S. N. M., Ismail, N. A., Mohamad, N. M. I. N., & Salleh, B., (2009). Sheath brown rot disease of rice caused by Pseudomonas fuscovaginae in Peninsular Malaysia. Journal of Plant Protection Research, 49(3), 244–249. Romero, F. M., & Gatica-Arias, A., (2019). CRISPR/Cas9: Development and application in rice breeding. Rice Science, 26(5), 265–281. Saad, A., Habibuddin, H., Alias, I., Othman, O., Azlan, S., & Zulkifli, R., (2000). Resistance Status of Released Varieties after MR 84 Against Bacterial Blight and the Incidence on the Disease in Muda Irrigation Scheme Presented at the Proceedings of the Conference of Plant Resources Management. Kuching, Sarawak, Malaysia. Saha, S., Garg, R., Biswas, A., & Rai, A. B., (2015). Bacterial diseases of rice: An overview. Journal of Pure and Applied Microbiology, 9(1), 725–736. Sakthivel, N., (2001). Sheath rot disease of rice: Current status and control strategies. In: Sreenivasaprasad, S., & Johnson, R., (eds.), Major Fungal Diseases of Rice: Recent Advances (pp. 271–283). (Dordrecht: Springer). Saxena, A., Rai, D., Kalra, A., & Saxena, M., (2020). Bacterial diseases of crops, epidemiology, symptoms, and management. Int. J. Curr. Microbiol. App. Sci., 9(6), 1483–1499. Sers, C. F., & Mazhar, M. M., (2020). Covid-19 outbreak and the need for rice self-sufficiency in West Africa. World Dev., 135, 105071. Shakya, D., Vinther, F., & Mathur, S., (1985). Worldwide distribution of bacterial stripe pathogen of rice identified as Pseudomonas avenae. Phytopathol. Z., 114, 256–259.

26

Bacterial Diseases of Rice and Their Management

Shekhawat, G. S., & Srivastava, D. N., (1971). Control of bacterial leaf streak of rice. Ind. J. Agric. Sci., 41, 1098–1101. Shew, A. M., Durand-Morat, A., Nalley, L. L., Zhou, X., Roja, C., & Thoma, G., (2019). Warming increases bacterial panicle blight (Burkholderia glumae) occurrences and impacts on USA rice production. PLOS One. Siche, R., (2020). What is the impact of COVID-19 disease on agriculture?. Scientia Agropecuaria, 11(1), 3–6. Smil, V., (2000). Feeding the World: A Challenge for the Twentieth Century (p. 360). The MIT Press, Cambridge, MA. Song, W. Y., Wang, G. L., Chen, L. L., Kim, H. S., Pi, L. Y., Holsten, T., Gardner, J., et al., (1995). A receptor kinase-like protein encoded by the rice disease resistance gene, Xa21. Science, 270, 1804–1806. Sreenivasulu, N., Butardo, V. M., Misra, G., Cuevas, R. P., Anacleto, R., & Kishor, P. B. K., (2015). Designing climate-resilient rice with ideal grain quality suited for high-temperature stress. J. Exp. Bot., 66, 1737–1748. Streubel, J., Pesce, C., Hutin, M., Koebnik, R., Boch, J., & Szurek, B., (2013). Five phylogenetically close rice SWEET genes confer TAL effector-mediated susceptibility to Xanthomonas oryzae pv. oryzae. New Phytol., 200, 808–819. Sugio, A., Yang, B., Zhu, T., & White, F. F., (2007). Two type III effector genes of Xanthomonas oryzae pv. oryzae control the induction of the host genes OsTFIIAγ1 and OsTFX1 during bacterial blight of rice. Proc Natl. Acad. Sci. USA., 104, 10720–10725. Sun, X., Cao, Y., Yang, Z., Xu, C., Li, X., Wang, S., & Zhang, Q., (2004). Xa26, a gene conferring resistance to Xanthomonas oryzae pv. oryzae in rice, encodes an LRR receptor kinase-like protein. Plant J., 37, 517–527. Syahri, Somantri, R. U., & Sasmita, P., (2019). Detection and control bacteria cause grain rot Burkholderia glumae on rice. Jurnal Perlindungan Tanaman Indonesia, 23(2), 163–170. doi: 10.22146/jpti.37755. Takayoshi, I., Kaku, H., Honkura, R., Nakamura, S., Ochiai, H., Sasaki, T., & Ohashi, Y., (2002). Enhanced resistance to seed transmitted bacterial diseases in transgenic rice plants overproducing on oat cell bound thionin. MPMI, 15(6), 515–521. Tanii, A., Miyajima, K., & Akita, T., (1976). The sheath brown disease of rice plant and its causal bacterium, Pseudomonas fuscovaginae. Ann. Phytopathol. Soc. Jpn., 42, 540–548. The Hindu Business Line, (2021). Ag Next-Cultivating Tech to Analyze Farm Produce Quality in 30 Second. TR Vivek, Published: https://www.thehindubusinessline.com/economy/ agri-business/agnext-cultivating-tech-to-analyse-farm-produce-quality-in-30-seconds/ article33650935.ece (accessed on 16 August 2022). Tian, D., Wang, J., Zheng, X., Gu, K., Qiu, C., Yang, X., Zhou, Z., et al., (2014). The rice TAL effector-dependent resistance protein Xa10 triggers cell death and calcium depletion in the endoplasmic reticulum. Plant Cell, 26, 497–515. Trebicki, P., Vandegeer, R. K., Bosque-Perez, N. A., Powell, K. S., Dader, B., Freeman, A. J., Yen, A. L., et al., (2016). Virus infection mediates the effects of elevated CO2 on plants and vectors. Sci. Rep., 6, 22785. Vary, Z., Mullins, E., McElwain, J. C., & Doohan, F. M., (2015). The severity of wheat diseases increases when plants and pathogens are acclimatized to elevated carbon dioxide. Glob. Chang. Biol., 21, 2661–2669. Velasquez, A. C., Castroverde, C. D. M., & Yang, H. S. H., (2018). Plant–pathogen warfare under changing climate conditions. Current Biology, 28, R619–R634.

Impact of Major Rice Bacterial Diseases on Agriculture

27

Wang, C. L., Qin, T. F., Yu, H. M., Zhang, X. P., Che, J. Y., Gao, Y., Zheng, C. K., et al., (2014). The broad bacterial blight resistance of rice line CBB23 is triggered by a novel transcription activator-like (TAL) effector of Xanthomonas oryzae pv. oryzae. Mol. Plant Pathol., 15, 333–341. Wang, C. L., Zhang, X. P., Fan, Y. L., Gao, Y., Zhu, Q. L., Zheng, C. K., Qin, T. F., et al., (2015). XA23 is an executor R protein and confers broad-spectrum disease resistance in rice. Mol. Plant, 8, 290–302. Webb, K. M., Oña, I., Bai, J., Garrett, K. A., Mew, T., Cruz, C. M. V., & Leach, J. E., (2010). A benefit of high temperature: Increased effectiveness of a rice bacterial blight disease resistance gene. New Phytologist., 185(2), 568–576. Wonni, I., Hutin, M., Ouedrago, L., Somda, I., Verdier, V., & Szure, B., (2016). Evaluation of elite rice varieties unmasks new sources of bacterial blight and leaf streak resistance for Africa. Rice Res. Open Access, 4, 162. Wubneh, W. Y., & Bayu, F. A., (2016). Assessment of diseases on rice (Oryza sativa L.) in major growing fields of Pawe district, northwestern Ethiopia. World Sci. News, 42, 13–23. Xiang, Y., Cao, Y. L., Xu, C. Q., Li, X., & Wang, S., (2006). Xa3, conferring resistance for rice bacterial blight and encoding a receptor kinase-like protein, is the same as Xa26. Theor. Appl. Genet., 113, 1347–1355. Yang, B., Sugio, A., & White, F. F., (2006). Os8N3 is a host disease-susceptibility gene for bacterial blight of rice. Proc. Natl. Acad. Sci. USA., 103, 10503–10508. Yoshimura, S., Yamanouchi, U., Katayose, Y., Toki, S., Wang, Z. X., Kono, I., Kurata, N., et al., (1998). Expression of Xa1, a bacterial blight resistance gene in rice, is induced by bacterial inoculation. Proc. Nat. Acad. Sci. USA., 95, 1663–1668. Yu, Y., Streubel, J., Balzergue, S., Champion, A., Boch, J., Koebnik, R., Feng, J., Verdier, V., & Szurek, B., (2011). Colonization of rice leaf blades by an African strain of Xanthomonas oryzae pv. oryzae depends on a new TAL effector that induces the rice nodulin-3 Os11N3 gene. Mol Plant-Microbe Interact., 24, 1102–1113. Yuan, M., Chu, Z., Li, X., Xu, C., & Wang, S., (2009). Pathogen-induced expressional loss of function is the key factor in race-specific bacterial resistance conferred by a recessive R gene xa13 in rice. Plant Cell Physiol., 50, 947–955. Zafar, K., Khan, M. Z., Amin, I., Mukhtar, Z., Yasmin, S., Arif, M., Ejaz, K., & Mansoor, S., (2020). Precise CRISPR-Cas9 mediated genome editing in super basmati rice for resistance against bacterial blight by targeting the major susceptibility gene. Front. Plant Sci. Zeigler, R. S., & Alvarez, E., (1987). Bacterial sheath of rice caused by Pseudomonas fuscovaginae in Latin America. Plant. Dis., 71, 592–597. Zeigler, R. S., & Alvarez, E., (1990). Characteristics of Pseudomonas spp. Causing grain discoloration and sheath rot of rice and associated pseudomonad epiphytes. Plant Dis., 74, 917–922. Zeigler, R. S., & Savary, S., (2010). Plant diseases and the world’s dependence on rice. In: Strange, R. N., & Gullino, M. L., (eds.), The Role of Plant Pathology in Food Safety and Food Security: Plant Pathology in the 21st Century (Vol. 3). doi: 10.1007/978-1-4020-8932-9_1. Zhao, B. Y., Ardales, E., Brasset, E., Claflin, L. E., Leach, J. E., & Hulbert, S. H., (2004b). The Rxo1/ Rba1 locus of maize controls resistance reaction to pathogenic and non-host bacteria. Theor Appl Genet., 109, 71–79. Zhao, B., Ardales, E. Y., Raymundo, A., Bai, J., Trick, H. N., Leach, J. E., & Hulbert, S. H., (2004a). The avrRxo1 gene from the rice pathogen Xanthomonas oryzae pv. oryzicola

28

Bacterial Diseases of Rice and Their Management

confers a non-host defense reaction on maize with resistance gene Rxo1. Mol. PlantMicrobe. Interact., 17, 771–779. Zhou-Qi, C., Bo, Z., Guan-lin, X., Bin, L., & Shi-Wen, H., (2016). Research status and prospect of Burkholderia glumae, the pathogen causing bacterial panicle blight. Rice Sci., 23, 111–118. Zhou, J., Peng, Z., Long, J., Sosso, D., Liu, B., Eom, J. S., Huang, S., et al., (2015). Gene targeting by the TAL effector PthXo2 reveals cryptic resistance gene for bacterial blight of rice. Plant J., 82, 632–643. Zhou, X. G. (2014). First report of bacterial panicle blight of rice caused by Burkholderia glumae in South Africa. Plant Dis. 98, 566. Zhou, X. G., McClung, A. M., Way, M. O., Jo, Y., Tabien, R. E., & Wilson, L. T., (2011). Severe outbreak of bacterial panicle blight across Texas rice belt in 2010. Phytopathology, 10, S205. Zou, H., Zhao, W., Zhang, X., Han, Y., Zou, L., & Chen, G., (2010). Identification of an avirulence gene, avrxa5, from the rice pathogen Xanthomonas oryzae pv. oryzae. Sci China Life Sci., 53, 1440–1449.

CHAPTER 2

Current and Potential Methods for Bacterial Disease Detection in Rice KARANSHER SANDHU,1 BALWINDER KAUR,2 and JAGMOHAN SINGH3,4 Department of Crop and Soil Sciences, Washington State University, Pullman, WA–99163, USA, E-mail: [email protected] (K. Sandhu) 1

Department of Entomology and Nematology, University of Florida, Gainesville, Florida–32608, USA

2

Division of Plant Pathology, Indian Agricultural Research Institute, New Delhi–110012, India

3

Institute of Molecular Plant Science, University of Edinburgh, Edinburgh, UK, EH9 3BF

4

ABSTRACT Accurate and timely detection of diseases is essential for crop plants, as it aids in the application of preventive measures. Rice is the staple food crop in India and is attacked by 70 diseases, from which 11 are bacterial in origin. Most of the bacterial diseases are present throughout the growth cycle and can be grouped into a seedling, foliar, leaf sheath, grain, and root diseases. Some of these diseases have their characteristic visible symptoms, while for others, it is difficult to distinguish them from other diseases, insect damages or nutritional deficiencies. Furthermore, identification of pathogen strain(s) causing the diseases are mostly conducted in lab conditions with the isola­ tion of DNA or RNA information and comparing them with the Gene bank’s database. All these conventional approaches are tedious and allow little time for preventive measures. With the advent of artificial intelligence (AI) and deep learning (DL) approaches, agricultural practices have shifted from Bacterial Diseases of Rice and Their Management. Deepti Srivastava, Md. Shamim, Malik Mobeen Ahmad, & K. N. Singh (Eds.) © 2023 Apple Academic Press, Inc. Co-published with CRC Press (Taylor & Francis)

30

Bacterial Diseases of Rice and Their Management

classical to smarter farming enterprises. Amalgamating the knowledge of image processing, DL, and genomic selection (GS) results in the detection and classification of plant diseases in the field. In situations where manual inspection of the crop is not possible, these tools come in very handy. Image processing and DL tools are useful for the farmers enabling fast and efficient recognition of plant diseases. This could facilitate early preventive measures for plant diseases and improve productivity. This chapter provides a compre­ hensive overview of current approaches used for detecting bacterial diseases and opens the potential for integrating new tools for disease detection. 2.1 INTRODUCTION Rice is the staple food crop for India and for about half of the world’s population (Khush, 2005). Billions of dollars worth of rice crops are lost annually due to different diseases. However, among 70 diseases associated with rice, 11 are bacterial in origin and constitute an important constraint in crop production. Most of these bacterial diseases are present throughout the growth cycle and these include bacterial blight (BB), bacterial leaf stripe, foot rot, sheath rot, grain rot, etc. (Table 2.1). Some of these diseases have their characteristic visible symptoms, while for others, it is difficult to distinguish them from other pathogen infections, insect damages, or nutritional deficiencies. Severe crop losses occur not only due to the severity of diseases but also due to the unavailability of efficient disease diagnostic methods at the early stages. Thus, the availability of suitable diagnostic tools is critical for the deployment of disease management strategies. Previous plant disease diagnostic tools for identification of bacterial diseases of rice solely based on colony morphology or disease symptoms are complex and time-consuming. These conventional approaches allow little time for preventive measures. Current disease diagnostic techniques based on polymerase chain reaction (PCR), fluorescens in-situ hybridization (FISH), enzyme-linked immunosorbent assay (ELISA), and flow cytometry (FC) enable the rapid identification of threatening pathogens of crops when analyzing large numbers of samples (Fang and Ramasamy, 2015; Singh et al., 2018). In these techniques, the identification of pathogen strain(s) causing the diseases is conducted with the isolation of DNA or RNA information, identifying, and comparing them with the Gene bank’s database. In addition, technologies such as hyperspectral plant imaging, thermography, fluorescens imaging, mass spectrometry (MS), deep learning (DL), and genomic selection (GS) are emerging technologies for the diagnosis of bacterial infections in rice.

Current and Potential Methods for Bacterial Disease TABLE 2.1

31

Different PCR Assays Deployed for Detection of Bacterial Diseases in Rice

SL. Detection No. Technique

Disease

Causal Organism

1. PCR

Bacterial panicle Burkholderia blight glumae

2. Real-time PCR Bacterial panicle Burkholderia (RT-PCR) blight glumae

Loci Used for References Primer Design gyrB and rpoD Maeda et al. (2006) gyrB

Wei et al. (2010)

3. Loop-mediated isothermal amplification (LAMP) PCR

Bacterial panicle blight and bacte­ rial leaf streak disease (BLS)

Lang et al. PXO_00080 Burkholderia and Xoryp_ (2014) glumae and 010100019045 Xanthomonas oryzae pv. oryzicola

4. Bio-PCR

Bacterial leaf blight

Xanthomonas oryzae pv. oryzae

DXoo_hrp1 F and DXoo_ hrp1R

Wei et al. (2010)

Xanthomonas oryzae pv. oryzae, Burkholderia glumae, and Acidovorax avenae subsp. avenae

AE013598.1, REGION: 466077.47102

Kang et al. (2016)

5. Multiplex PCR Bacterial leaf (mPCR) blight, bacterial grain rot, and bacterial brown stripe

Pathogen strains can differ in their genome and virulence in different rice-producing regions (Zhou-Qi et al., 2016). Therefore, it is important to consider both local and reference pathogen strains when developing disease diagnostic methods. Furthermore, several bacterial pathogens can invade a plant inducing latent or active infections, which can predominate depending on environmental conditions (Zhou-Qi et al., 2016). Knowledge of appro­ priate diagnostic tools for specific diseases is useful to initiate suitable management practices for disease control. Besides field crop disease detec­ tion, these molecular techniques are reliable and valuable diagnostic tools for phytosanitary labs to restrict plant pathogens in rice-growing countries. 2.2 CURRENT METHODS FOR BACTERIAL DISEASE DETECTION IN RICE 2.2.1 POLYMERASE CHAIN REACTION (PCR) To date, most research on the identification and detection of bacterial diseases in rice is mainly focused on the use of conventional biochemical and molecular methods (Table 2.2). Currently, PCR in different formats has

Bacterial Diseases of Rice and Their Management

32

been widely used for plant pathogen identification and detection, especially for bacteria and viruses (Li, 1995). In addition to the conventional PCR technology, advanced PCR methods such as reverse-transcription PCR (RT-PCR) have been developed for detecting bacterial isolates using the specific primers designed for the internal transcribed spacer (ITS) sequence (López et al., 2003). These molecular techniques, including RT-PCR are highly sensitive and can provide on-site, rapid identification and quantifica­ tion of plant pathogens (Singh et al., 2020). TABLE 2.2 Important Bacterial Diseases of Rice Present Throughout the World with Their Associated Causal Organisms SL. No. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10.

Rice Diseases Seedling blight Bacterial brown stripe Bacterial blight Halo blight Sheath brown rot Sheath rot Grain rot Bacteria palea browning Bacterial foot rot Bacterial panicle blight

Pathogen Burkholderia plantarii Acidovorax avenae Xanthomonas oryzae Pseudomonas syringae Pseudomonas fuscovaginae Pseudomonas syringae Burkholderia glumae Pantoea ananatis Dickeya zeae Burkholderia glumae

References Adachi et al. (2012) Kakar et al. (2014) He et al. (2010) Barta and Willis (2005) Kim et al. (2015) Bigirimana et al. (2015) Ura et al. (2006) Azegami (2013) Pu et al. (2012) Nandakumar et al. (2007)

Another PCR assay called loop-mediated isothermal amplification (LAMP), based on the rapid and specific amplification of target DNA sequences at a single temperature, is an ideal tool for field-level plant disease diagnosis (Bühlmann et al., 2013). In LAMP–PCR, the previously designed specific conventional PCR primers can be utilized for the development of unique primers, thus highlighting the adaptation of conventional PCR to LAMP (Notomi et al., 2000). These LAMP assays produce a reliable, sensitive, and robust test for detecting bacterial pathogens in rice and can be readily utilized for epidemiological purposes, quarantine offices, and seed certification programs (Lang et al., 2014). Another highly sensitive and rapid technique for bacterial pathogen detection is Bio-PCR (Anon, n.d.). This technique is based on biological and enzymatic amplification of PCR targets, such as an increase in pathogen isolates to detectable levels in asymptomatic plant material (Schaad et al., 1995). Other methods, such as multiplex PCR (mPCR), are time-saving and cost-effective tools that can facilitate the detection of multiple bacterial

Current and Potential Methods for Bacterial Disease

33

pathogens in a single reaction (Kang et al., 2016). mPCR can utilize both DNA or RNA extracts and is also sensitive in the detection of asymptomatic diseases facilitating early diagnosis (Asano et al., 2010). Although PCR methods provide high sensitivity, specificity, and rapidity, its performance is limited by lack of operational robustness (Van der Wolf et al., 2001). Efficiency of PCR depends on polymerase type, amount of DNA to be amplified, inhibitors in sample assay, buffer composition and stability, concentration of deoxynucleoside triphosphate (dNTPs) and parameters of the initiation template (López et al., 2003). Moreover, the optimal design of primers or probes is required to initiate a DNA replication process which could hamper the practical feasibility of this technique for pathogen detec­ tion during field sampling (Schaad and Frederick, 2002). 2.2.2 ENZYME-LINKED IMMUNOSORBENT ASSAY (ELISA) Another molecular advancement for disease detection is enzyme-linked immunosorbent assay (ELISA) method for screening large numbers (Clark and Adams, 1977). It is based on the binding of specific target epitopes (antigens) from viruses, bacteria, and fungi to antibodies conjugated to an enzyme. In ELISA, the interaction between antigen and antibody corre­ sponds to color change signifying the detection of target epitopes, such as the detection of bacterial pathogens at low concentrations (maximally 105–106 CFU/ml) (López et al., 2003). Detection of bacterial plant diseases using commercial polyclonal or monoclonal antibody kits based on ELISA is available, but their use is still limited. Enrichment-ELISA protocols that utilize specific monoclonal antibodies have been produced to improve the detection of bacterial pathogens (López et al., 2001). The enrichment step in these protocols is specific and optimized for the multiplication of target plant pathogenic bacterium for disease detection (Caruso et al., 2002). The enrichment-ELISA has improved detection sensitivity and can also help to detect latent bacterial infections in plants. For example, highly sensitive indirect competitive (icELISA) has been used to detect ustiloxin B toxins in rice false smut disease caused by Villosiclava virens (Fu et al., 2015). 2.2.3 FLUORESCENCE IN SITU HYBRIDIZATION (FISH) This technique of bacterial detection is based on visual microscopy and hybridization of DNA probes and target genes from plant samples

34

Bacterial Diseases of Rice and Their Management

(Kempf et al., 2000). It has been recently used for the detection of plant pathogenic bacteria but can also be used in the detection of fungi and viruses, and other endosymbiotic bacteria infecting the plant (Kliot et al., 2014). This technique involves recognizing and hybridization of DNA probes to the bacterial specific ribosomal (rRNA) sequences in plants (Moter and Göbel, 2000). The RNA used in this technique contains sequences that are universal to all species and also contains sequences that are specific to individual species. In FISH, there is high affinity and specificity of DNA probes and hence these specific sequences are recognized. This technique provides high single-cell sensitivity while maintaining the structural integrity of the microorganism. However, the practical limit of detection lies around 103 CFU/mL. FISH can detect pathogen-specific ribosomal RNA (rRNA) sequences in plants and is hence used in diagnosing the plant pathogenic infections (López et al., 2003). Previous literature documents the use of FISH for detecting the bacterial ring rot disease caused by Clavibacter michiganensis subsp. sepedonicus in potatoes (Li et al., 1997). FISH is a cheap and fast technique and can be used for detection of fastidious or uncultured organisms for microbiome studies, besides the culturable plant pathogenic microorganisms (Moter and Göbel, 2000). In addition, FISH has been used for understanding rice genomes (Ohmido et al., 2010), but its use for the detection of bacterial diseases in rice is limited. Besides the advantage and its usage, there are some limitations of this technique, such as false positive results with autofluorescens materials which reduce its specificity (Moter and Göbel, 2000). Thus, the reliability and accu­ racy of this technique depend on the specificity of oligonucleotide probes which can be achieved by carefully evaluating newly designed probes. In addition, insufficient probe penetration into the bacterial cell can reduce the intensity of the signal. In these scenarios, special fixation and pretreatment may be necessary for reliable and detectable results in FISH. Other factors such as the structure of the target or probe (e.g., loop and hairpin formation, three-dimensional rRNA), photobleaching, and low rRNA content could generate false negative results and hence compromise the detection (Moter and Göbel, 2000). 2.2.4 FLOW CYTOMETRY (FC) Flow cytometry (FC) is a laser-based technique for counting and measure­ ment of the small particles in liquid fluid. Each cell is excited by a light

Current and Potential Methods for Bacterial Disease

35

source, and the results are displayed on a screen. This technology uses the incident laser beam, and the reflected light from the sample is measured for obtaining fluorescens, and scattering FC provides us with information about the size, shape, and complexity of the cell. This technique was developed by Wolfgang Gohde in the 1970s and has been later adopted for the detection of various diseases in humans, such as cancer, malaria, HIV, and bacteria. FC has a rapid detection rate with the capacity of detecting over 10,000 cells per second in a clinical diagnostic laboratory (D’Hondt et al., 2011). FC is used in plant pathology for the detection of different diseases by looking at genome size, detection of different variants, and physiological assessment. The FC is used to measure the amount of light emitted by particles depending upon the intercalating fluorochrome present in the genome, and this is compared to a reference size genome for size assessment. FC is used for detection by using the nonspecific target binding of nucleotides and later looking at scattering and fluorescens patterns. This helps us in the detection of the presence of a particular pathogen present, but unable to differentiate between the morphologically similar organisms. The physiological and metabolic assessment is performed by measuring the fluorescens intensity of different wavelengths emitted. Although there is huge potential for this technique for detecting different diseases in humans, its application in rice pathology is limited and getting attention these days. Diaper and Edwards (1994) applied the FC for the detection of Bacillus subtilis strain in the compost using the rhodamine, carboxyfluorescein diacetate, and chemchrome fluorophore dyes. Similarly, (Chitarra and van den Bulk, 2003) applied the FC for the detection of viable and non-viable bacteria in veterinary, food microbial, and medical research. These studies suggest that the use of FC opens up new avenues for bacterial disease detection in rice. 2.3 POTENTIAL METHODS FOR BACTERIAL DISEASE DETECTION IN RICE 2.3.1 HYPERSPECTRAL IMAGING The main objective of hyperspectral plant imaging is to collect sequential images for measuring physiological growth, biotic and abiotic stresses, and other phenotypic processes using reflectance data at different regions of the electromagnetic spectrum. Hyperspectral imaging is automatic, non-destructive, and rapid method of early plant disease detection. Being a

Bacterial Diseases of Rice and Their Management

36

new technology, hyperspectral imaging is gaining a lot of interest regarding quantifying the incidence, severity, intensity, prevalence of the disease. The collected hyperspectral images are later used for predicting the incidence of different diseases on the plants. There are two main approaches which are being used for predicting diseases using reflectance data, namely (i) extraction of various vegetation indices (VIs) using different regions of the electromagnetic spectrum and these VIs provide the information about whether a plant is diseased or healthy; (ii) using all the spectral reflectance information from the electromagnetic spectrum for predicting the incidence of plant diseases (Mishra et al., 2017). The use of hyperspectral imaging for plant diseases is rapidly increasing with the development of advanced and less costly hyperspectral cameras. Hyperspectral imaging is being used for detection of various plant diseases under field and controlled conditions. The detailed information about different studies using hyperspectral imaging for plant disease detections is provided (Table 2.3). The hyperspectral images went through different processing pipelines, including raw image data, image processing, image segmentation, feature extraction, feature processing, key feature selection, data mining, and data management (Mishra et al., 2017). The amount of data generated by hyperspectral imaging is huge and creates a problem in the storage and extraction of useful information. TABLE 2.3 Application of Potential Disease Detection Mechanisms in Some Crops During the Last Decade SL. Crop No.

Disease

Technique

References

1.

Wheat

Fusarium head blight Genomic selection

Arruda et al. (2015)

2.

Wheat

Fusarium head blight Multispectral imaging

Dammer et al. (2011)

3.

Tomato

Early blight

Hyperspectral imaging Xie et al. (2015)

4.

Cassava

Cassava mosaic

Deep learning

5.

Wheat

Powdery mildew

Hyperspectral imaging Zhang et al. (2012)

6.

Sugarbeet

Cercospora leaf spot

Hyperspectral imaging Rumpf et al. (2010)

7.

Tomato

Late blight

Deep learning

8.

Sugarbeet

Powdery mildew

Hyperspectral imaging Mahler et al. (2012)

9.

Wheat

Stem rust

Genomic selection

Rutkoski et al. (2011)

10.

Olive

Wilt

Thermography

Calderón et al. (2015)

11.

Tomato

Powdery mildew

Thermography

Raza et al. (2015)

Ramcharan et al. (2019)

Rangarajan et al. (2018)

Current and Potential Methods for Bacterial Disease

37

2.3.2 THERMOGRAPHY Thermography allows the study of the difference in temperature between two bodies emitting different intensities of radiation depending upon their temperatures. The radiations are emitted by an object in the range of 900–14,000 nm and this can be either visible or non-visible to the human eye (Mahlein et al., 2012). The emitted thermal radiations are captured by the thermal sensors and differences in temperature can be analyzed as the difference of color in the images. There are different types of calibration required for thermal sensors before putting them into actual use, namely factory calibration, flat field correction, and radiometric calibration. Radiometric calibration is most important as this provides us with the exact difference in temperature between two objects in centigrade values in spite of color differences. Thermal imaging is highly important to detect disease-induced changes in the plant’s transpiration and water status. There is a change in plant temperature under the disease conditions which can be easily separated from environmental induced conditions (Belin et al., 2013). Thermal imaging uses the passive sensor for measurement of plant temperature difference with the exclusion of all the external factors causing the temperature differences. Even thermal imaging is directly used to detect the plant or plant part which is affected in the field using unmanned aerial vehicles in the field. Local temperature differences due to plant pathogens have been reported under both controlled and field conditions by different studies (Table 2.3). The practical application of thermography is limited due to the change in temperature between two bodies due to different environment noises. Furthermore, diseases with no or negligible effect on transpiration, are not detected by thermal imaging. Lastly, most of the sensors provide informa­ tion about the presence of some plant disease only without any specific type or strain of pathogen. More advanced thermal sensors or combinations of sensors should be used for getting detailed information about the prevalent pathogen on the plant. 2.3.3 FLUORESCENCE IMAGING Each object emits a specific wavelength of light when they are excited by light energy and come back to the stable state. Fluorescence imaging uses this for measuring the chlorophyll fluorescens in plants when they are excited by the light energy. Plants absorb light in the blue and red region

38

Bacterial Diseases of Rice and Their Management

of the electromagnetic spectrum and have a characteristic emission pattern. Fluorescence measurement from plants directly provides information about chlorophyll content, photosynthesis, and information about various physiological processes in the plants. In the case of diseased plants, these photosynthetic apparatuses are disturbed due to alteration in enzymes of Calvin Benson cycle or plant pigments. The presence of plant pathogens alters the fluorescens pattern from the plant, and it helps in the identification of diseased regions of the plants. There are only a few studies which have been used for detecting plant diseases using fluorescens imaging and information about them is provided (Table 2.2). Detection of abnormalities in plants opens up the ample potential of this technology for rice disease detections. 2.4 DEEP LEARNING (DL)-BASED CLASSIFICATION AND ARTIFICIAL INTELLIGENCE (AI) FOR DISEASE DETECTION Rice is affected by several diseases and insect pests in India, namely BB, false smut, foot rot, brown spot, kernel smut, root rot, stem rot, aphids, bacterial leaf streak (BLS), and rice tungro virus. These insect pests are quite hazardous, affecting the green photosynthetic areas and ultimately reducing the wheat yield. In cases where their effect is severe, it results in complete leaf fall, poor grain filling, and reduction of grain yield by more than half. Therefore, it is particularly important to automatically recognize these insect pests on plant leaves. A number of high-quality image-based methods have been developed to recognize diseases, such as chlorophyll fluorescens, thermal imaging, hyperspectral imaging, and visible light imaging. Chlorophyll fluorescens emissions are invisible to the normal eye, but fluorescens imaging can be used to detect biotic and abiotic stresses. Thermal images detect the difference in temperature of healthy and diseased leaves, as most of the diseases affect the transpiration of leaves, resulting in a difference in leaf temperature. In addition, hyperspectral imaging is used to obtain the spectrum of each pixel information in the images and help in detecting biotic and abiotic factors causing changes in pixel values. All these imaging methods require expensive equipment and sophisticated analysis. In contrast, visible RGB images can be easily obtained using normal RGB cameras or good quality mobile phones, to gather data required for important feature extraction using different algorithms.

Current and Potential Methods for Bacterial Disease

39

There have been various studies using image classification approaches like K nearest neighbor, random forests, convolutional neural network (CNN) algorithms for disease identification (Table 2.3; Ramcharan et al., 2019; Bresilla et al., 2019). DL is a machine learning technique which uses multiple processing layers to learn the information from the data (plant images in this case) with the extraction of useful information. Typically, DL-based methods include multiple neural networks where input, hidden, and output layers are connected with multiple neurons using various nonlinear transformations. The output from the previous layer act as the input for the succeeding layer. There are various DL-based models which are being implemented, namely multilayer perceptron (MLP), CNN, and recurrent neural network (RNN) for plant disease detection. The working of these models is deferred to other texts (LeCun et al., 2015). For plant disease classification, DL models use a classification approach where a plant image is transformed using nonlinear transformation, and this information serves as an input layer for the DL models; and finally, the image class (disease type or healthy plant) acts as output. DL models get trained on this dataset by optimizing various hyperparameters such as number of neurons, activation function, learning rate, number of hidden layers, dropout, and regularization (LeCun et al., 2015). Once all these parameters are optimized for the model, later, these models could be automatically used for plant disease classification by taking the image of diseased classification. It is worth noting to talk about the potential limitations of this method. Firstly, a large dataset of images is required for training the models for each disease classification, which is usually not in an open-source database. Furthermore, most of the DL models optimized for various disease clas­ sification are performed under controlled growth conditions and detailed optimization is required for implementing the field-based classification of each disease. Lastly, training of DL models is computationally intensive and tedious, requiring optimizing of a large number of hyperparameters for each disease classification. 2.5 GENOME SELECTION FOR PLANT DISEASE IDENTIFICATION With the advent of marker technology in the 1980s, plant breeders have started using them for breeding for disease resistance. Most of the disease resistances in plants can be categorized into qualitative and quantitative traits. Qualitative disease resistance is controlled by one major or few genes in plants, and these could be easily bred by using marker-assisted breeding

40

Bacterial Diseases of Rice and Their Management

approaches. On the other hand, quantitative disease resistance is controlled by a large number of small effect quantitative trait loci (QTLs), where each QTL has a population-specific effect. These small effect QTLs are difficult to identify, and estimation of their effects is problematic. In this regard, a new technique called GS was developed, which simultaneously estimates the effects of all the markers for a particular trait (Meuwissen et al., 2001). Instead of identifying specific markers associated with a single large-effect QTL, GS enables simultaneous estimation of all marker effects to predict breeding values, also referred to as genomic estimated breeding values (GEBV) (Lorenz et al., 2011). The success of GS depends upon the prediction accuracy, which is measured as the correlation between the observed phenotypic values and GEBVs. Previous simulation and empirical studies have shown that high marker density and larger training population size improves the prediction accuracy as high marker density ensures a tight association between QTL and markers (Lorenz et al., 2011). The efficacy of GS also depends upon the quality of phenotypic data, as data collected from the training population is used to run GS prediction models. Several GS models have been developed to estimate GEBVs, and these models mainly differ in assumptions of contributing marker effects to the total variance (Meuwissen et al., 2001). The implementation of GS into the breeding program is still being explored, and with the reduction of genotyping costs, this technique is getting more attention. Disease resistance is a major goal of most of rice breeding programs due to its effects on grain yield and quality attributes. GS allows the estimation of the effect of all the markers for a particular disease present in the training population. Once the effect of each marker is quantified, the testing population, which is only genotyped with the same set of markers and prediction are made for the disease incidence. Furthermore, GS also enabled for the estimation of disease incidence in a season when there was no disease inoculum in the field. This allows the breeders to make the selection even in the season of no disease attack and ultimately saves a year. In this way, GS helps in the quantification of plant disease resistance and reduces the number of years required to breed for disease resistance, which will ultimately increase the genetic gain. 2.6 CONCLUSIONS There are a number of bacterial diseases in rice which has the potential to adversely affect the crop yield. Early and accurate disease detection is

Current and Potential Methods for Bacterial Disease

41

very important to prevent crop losses. The various diagnosis and detection techniques are used for bacterial disease detection rice starting from most common ooze test to advance molecular techniques. In an upcoming era, technologies such as hyperspectral plant imaging, thermography, fluorescens imaging, and DL have great potential for the diagnosis of bacterial infections in rice. Current approaches and integration of new tools for diseases detection will enhance the accuracy and timely detection of bacterial diseases in rice, giving ample amount of time for practicing disease management strategies. KEYWORDS • • • • • •

artificial intelligence bacterial diseases deep learning genomic selection hyperspectral imaging in situ hybridization

REFERENCES Adachi, N., Tsukamoto, S., Inoue, Y., & Azegami, K., (2012). Control of bacterial seedling rot and seedling blight of rice by bacteriophage. Plant Disease, 96(7), 1033–1036. Arruda, M. P., Brown, P. J., Lipka, A. E., Krill, A. M., Thurber, C., & Kolb, F. L., (2015). Genomic selection for predicting head blight resistance in a wheat breeding program. The Plant Genome, 8(3), 1–12. Asano, T., Senda, M., Suga, H., & Kageyama, K., (2010). Development of multiplex PCR to detect five Pythium species related to turfgrass diseases. Journal of Phytopathology. Azegami, K., (2013). Suppressive effect of bacteriophage on bacterial palea browning of rice caused by Pantoea ananatis. Journal of General Plant Pathology, 79(2), 145–154. Barta, T. M., & Willis, D. K., (2005). Biological and molecular evidence that Pseudomonas syringae pathovars coronafaciens, striafaciens, and garcae are likely the same pathovar. Journal of Phytopathology, 153(7, 8), 492–499. Belin, É., Rousseau, D., Boureau, T., & Caffier, V., (2013). Thermography versus chlorophyll fluorescens imaging for detection and quantification of apple scab. Computers and Electronics in Agriculture, 90, 159–163. Bigirimana De, V. P., Hua, G. K. H., Nyamangyoku, O. I., & Höfte, M., (2015). Rice sheath rot: An emerging ubiquitous destructive disease complex. Frontiers in Plant Science, 6, 1066.

42

Bacterial Diseases of Rice and Their Management

Bresilla, K., Perulli, G. D., Boini, A., Morandi, B., Corelli, G. L., & Manfrini, L., (2019). Single-shot convolution neural networks for real-time fruit detection within the tree. Frontiers in Plant Science, 10, 611. Bühlmann, A., Pothier, J. F., Rezzonico, F., et al., (2013). Erwinia amylovora loop-mediated isothermal amplification (LAMP) assay for rapid pathogen detection and on-site diagnosis of fire blight. Journal of Microbiological Methods, 92(3), 332–339. Calderón, R., Navas-Cortés, J., & Zarco-Tejada, P., (2015). Early detection and quantification of verticillium wilt in olive using hyperspectral and thermal imagery over large areas. Remote Sensing, 7(5), 5584–5610. Caruso, P., Gorris, M. T., Cambra, M., Palomo, J. L., Collar, J., & López, M. M., (2002). Enrichment double-antibody sandwich indirect enzyme-linked immunosorbent assay that uses a specific monoclonal antibody for sensitive detection of Ralstonia solanacearum in asymptomatic potato tubers. Applied and Environmental Microbiology, 68(7), 3634–3638. Chitarra, L. G., & Van, D. B. R. W., (2003). The application of flow cytometry and fluorescent probe technology for detection and assessment of viability of plant pathogenic bacteria. European Journal of Plant Pathology. Clark, M. F., & Adams, A. N., (1977). Characteristics of the microplate method of enzymelinked immunosorbent assay for the detection of plant viruses. The Journal of General Virology, 34(3), 475–483. D’Hondt, L., Höfte, M., Van, B. E., & Leus, L., (2011). Applications of flow cytometry in plant pathology for genome size determination, detection, and physiological status. Molecular Plant Pathology, 12(8), 815–828. Dammer, K. H., Möller, B., Rodemann, B., & Heppner, D., (2011). Detection of head blight (Fusarium ssp.) in winter wheat by color and multispectral image analyses. Crop Protection, 30(4), 420–428. Diaper, J. P., & Edwards, C., (1994). Flow cytometric detection of viable bacteria in compost. FEMS Microbiology Ecology, 14(3), 213–220. Fang, Y., & Ramasamy, R. P., (2015). Current and prospective methods for plant disease detection. Biosensors, 5(3), 537–561. Fu, X., Wang, A., Wang, X., et al., (2015). Development of a monoclonal antibody-based icELISA for the detection of ustiloxin B in rice false smut balls and rice grains. Toxins, 7(9), 3481–3496. He, Y. W., Wu, J., Cha, J. S., & Zhang, L. H., (2010). Rice bacterial blight pathogen Xanthomonas oryzae pv. oryzae produces multiple DSF-family signals in the regulation of virulence factor production. BMC Microbiology, 10, 187. Kakar, K. U., Nawaz, Z., Cui, Z., Almoneafy, A. A., Zhu, B., & Xie, G. L., (2014). Characterizing the mode of action of Brevibacillus laterosporus B4 for control of bacterial brown strip of rice caused by A. avenae subsp. avenae RS-1. World Journal of Microbiology & Biotechnology, 30(2), 469–478. Kang, I. J., Kang, M. H., Noh, T. H., Shim, H. K., Shin, D. B., & Heu, S., (2016). Simultaneous detection of three bacterial seed-borne diseases in rice using multiplex polymerase chain reaction. The Plant Pathology Journal, 32(6), 575–579. Kempf, V. A., Trebesius, K., & Autenrieth, I. B., (2000). Fluorescent in situ hybridization allows rapid identification of microorganisms in blood cultures. Journal of Clinical Microbiology, 38(2), 830–838. Khush, G. S., (2005). What it will take to feed 5.0 billion rice consumers in 2030. Plant Molecular Biology, 59(1), 1–6.

Current and Potential Methods for Bacterial Disease

43

Kim, J., Choi, O., & Kim, W. I., (2015). First report of sheath brown rot of rice caused by Pseudomonas fuscovaginae in Korea. Plant Disease, 99(7), 1033–1033. https://apsjournals. apsnet.org/doi/10.1094/PDIS-11-14-1219-PDN (accessed on 15 September 2022). Kliot, A., Kontsedalov, S., Lebedev, G., et al., (2014). Fluorescence in situ hybridizations (FISH) for the localization of viruses and endosymbiotic bacteria in plant and insect tissues. Journal of Visualized Experiments, (84), e51030. Lang, J. M., Langlois, P., Nguyen, M. H. R., et al., (2014). Sensitive detection of Xanthomonas oryzae pathovars oryzae and oryzicola by loop-mediated isothermal amplification. Applied and Environmental Microbiology, 80(15), 4519–4530. LeCun, Y., Bengio, Y., & Hinton, G., (2015). Deep learning. Nature, 521(7553), 436–444. Li, X., (1995). Selection of polymerase chain reaction primers from an RNA Intergenic spacer region for specific detection of Clavibacter michiganensis subsp. sepedonicus. Phytopathology, 85(8), 837. Li, X., De Boer, S. H., & Ward, L. J., (1997). Improved microscopic identification of Clavibacter michiganensis subsp. sepedonicus cells by combining in situ hybridization with immunofluorescens. Letters in Applied Microbiology, 24(6), 431–434. López, M. M., Bertolini, E., Olmos, A., et al., (2003). Innovative tools for detection of plant pathogenic viruses and bacteria. International Microbiology, 6(4), 233–243. López, M. M., Llop, P., Cubero, J., et al., (2001). Strategies for improving serological and molecular detection of plant pathogenic bacteria. In: De Boer, S. H., (ed.), Plant Pathogenic Bacteria (pp. pp. 83–86). Dordrecht: Springer Netherlands. Lorenz, A. J., Chao, S., Asoro, F. G., et al., (2011). Genomic selection in plant breeding. In: Advances in Agronomy (pp. 77–123). Elsevier. Maeda, Y., Shinohara, H., Kiba, A., et al., (2006). Phylogenetic study and multiplex PCR-based detection of Burkholderia plantarii, Burkholderia glumae and Burkholderia gladioli using gyrB and rpoD sequences. International Journal of Systematic and Evolutionary Microbiology, 56(Pt 5), 1031–1038. Mahlein, A. K., Oerke, E. C., Steiner, U., & Dehne, H. W., (2012). Recent advances in sensing plant diseases for precision crop protection. European Journal of Plant Pathology, 133(1), 197–209. Mahlein, A. K., Steiner, U., Hillnhütter, C., Dehne, H. W., & Oerke, E. C., (2012). Hyperspectral imaging for small-scale analysis of symptoms caused by different sugar beet diseases. Plant Methods, 8(1), 3. Meuwissen, T. H., Hayes, B. J., & Goddard, M. E., (2001). Prediction of total genetic value using genome-wide dense marker maps. Genetics, 157(4), 1819–1829. Mishra, P., Asaari, M. S. M., Herrero-Langreo, A., Lohumi, S., Diezma, B., & Scheunders, P., (2017). Close range hyperspectral imaging of plants: A review. Biosystems Engineering, 164, 49–67. Moter, A., & Göbel, U. B., (2000). Fluorescence in situ hybridization (FISH) for direct visualization of microorganisms. Journal of Microbiological Methods, 41(2), 85–112. Nandakumar, R., Rush, M. C., & Correa, F., (2007). Association of Burkholderia glumae and B. gladioli with panicle blight symptoms on rice in Panama. Plant Disease, 91(6), 767. Notomi, T., Okayama, H., Masubuchi, H., et al., (2000). Loop-mediated isothermal amplification of DNA. Nucleic Acids Research, 28(12), E63. Ohmido, N., Fukui, K., & Kinoshita, T., (2010). Recent advances in rice genome and chromosome structure research by fluorescens in situ hybridization (FISH). Proceedings of the Japan Academy: Series B, Physical and Biological Sciences, 86(2), 103–116.

44

Bacterial Diseases of Rice and Their Management

Pu, X. M., Zhou, J. N., Lin, B. R., & Shen, H. F., (2012). First report of bacterial foot rot of rice caused by a Dickeya zeae in China. Plant Disease, 96(12), 1818. Ramcharan, A., McCloskey, P., Baranowski, K., et al., (2019). A mobile-based deep learning model for cassava disease diagnosis. Frontiers in Plant Science, 10, 272. Rangarajan, A. K., Purushothaman, R., & Ramesh, A., (2018). Tomato crop disease classifica­ tion using pre-trained deep learning algorithm. Procedia Computer Science, 133, 1040–1047. Raza, S. A., Prince, G., Clarkson, J. P., & Rajpoot, N. M., (2015). Automatic detection of diseased tomato plants using thermal and stereo visible light images. Plos One, 10(4), e0123262. Rumpf, T., Mahlein, A. K., Steiner, U., Oerke, E. C., Dehne, H. W., & Plümer, L., (2010). Early detection and classification of plant diseases with support vector machines based on hyperspectral reflectance. Computers and Electronics in Agriculture, 74(1), 91–99. Rutkoski, J. E., Heffner, E. L., & Sorrells, M. E., (2011). Genomic selection for durable stem rust resistance in wheat. Euphytica; Netherlands Journal of Plant Breeding, 179(1), 161–173. Schaad, N. W., & Frederick, R. D., (2002). Real-time PCR and its application for rapid plant disease diagnostics. Canadian Journal of Plant Pathology, 24(3), 250–258. Schaad, N. W., Cheong, S. S., Tamaki, S., & Hatziloukas, E., (1995). A combined biological and enzymatic amplification (BIO-PCR) technique to detect Pseudomonas syringae pv. Phaseolicola in bean seed extracts. Phytopathology. Singh, J., Aggarwal, R., Gurjar, M. S., Sharma, S., & Saharan, M. S., (2019). Identification of putative carbohydrate-active enzymes from whole genome sequence of Tilletia indica and sporulation analysis. Indian J. Agr. Sci. 86012-220174-1-SM.DOCX. Singh, J., Aggarwal, R., Gurjar, M. S., Sharma, S., Jain, S., & Saharan, M. S., (2020). Identification and expression analysis of pathogenicity-related genes in Tilletia indica inciting Karnal bunt of wheat. Australasian Plant Pathol. https://doi.org/10.1007/s13313-020-00711-x. Ura, H., Furuya, N., Iiyama, K., Hidaka, M., Tsuchiya, K., & Matsuyama, N., (2006). Burkholderia gladioli is associated with symptoms of bacterial grain rot and leaf-sheath browning of rice plants. Journal of General Plant Pathology, 72(2), 98–103. Van, D. W. J. M., Van, B. J. R. C. M., Bonants, P. J. M., & Schoen, C. D., (2001). New technologies for sensitive and specific routine detection of plant pathogenic bacteria. In: De Boer, S. H., (ed.), Plant Pathogenic Bacteria (pp. 75–77). Dordrecht: Springer Netherlands. Wei, L., Jin, M., Zi, P., Jinlin, J., & Jinguo, Z., (2010). Using TaqMan probe for the detection of Burkholderia glumae. Plant Quarantine. Xie, C., Shao, Y., Li, X., & He, Y., (2015). Detection of early blight and late blight diseases on tomato leaves using hyperspectral imaging. Scientific Reports, 5, 16564. Zhang, J. C., Pu, R., Wang, J., Huang, W., Yuan, L., & Luo, J., (2012). Detecting powdery mildew of winter wheat using leaf level hyperspectral measurements. Computers and Electronics in Agriculture, 85, 13–23. Zhou-qi, C., Bo, Z., Guan-lin, X., Bin, L., & Shi-wen, H., (2016). Research status and prospect of Burkholderia glumae, the pathogen causing bacterial panicle blight. Rice Science, 23(3), 111–118.

CHAPTER 3

An Overview of the Biology of Rice Bacterial Blight Pathogens and Prospects of Conventional Methods for Their Management MONA F. A. DAWOOD,1 YASSER S. MOURSI,2 ABDELRAZEK S. ABDELRHIM,3 and AMANY A. HASSAN4 Department of Botany and Microbiology, Faculty of Science,

Assiut University, Assiut–71516, Egypt,

E-mail: [email protected] (M.F.A. DAWOOD)

1

Department of Botany, Faculty of Science, University of Fayoum,

Fayoum–63514, Egypt, E-mail: [email protected]

2

Department of Plant Pathology, Faculty of Agriculture, Minya University,

Al-Minya, Egypt

3

Botany and Microbiology Department, Faculty of Science,

New Valley University, El-Kharja–72511, Egypt

4

ABSTRACT Rice is the major food crop in the world. Bacterial blight (BB) is one of the most serious diseases, which reduces the yield of rice by 30%. Various management practices have been used to control BB disease, such as chemical control, biological control, etc. In the present chapter, we have discussed the biology of BB pathogen and its conventional management practices.

Bacterial Diseases of Rice and Their Management. Deepti Srivastava, Md. Shamim, Malik Mobeen Ahmad, & K. N. Singh (Eds.) © 2023 Apple Academic Press, Inc. Co-published with CRC Press (Taylor & Francis)

46

Bacterial Diseases of Rice and Their Management

3.1 INTRODUCTION Rice is the most important cereal crop in the world, and it feeds half of the world’s population (Slaton et al., 2003; Ben Hassen et al., 2017). It is also considered a strategic crop for food security as it is widely distributed in various types of climates as well as soils (International Rice Research Institute (IRRI), 2019; Fahad et al., 2019). In various countries, such as Egypt, the production of food by means of sustainable agricultural development by maintaining the ecosystem is a major challenge (Elbana et al., 2019). However, due to multiple biotic and abiotic stresses, rice yields are decreasing (Rejeb et al., 2014). Bacterial blight (BB) is the most serious biotic stress for rice, it reduces the yield of rice by 30%, and in severe cases, it can reduce the yield by 81% (Chien et al., 2019). The first observation of rice BB was in Japan during 1884 and later spread in various rice-growing parts of the world, such as India, the Philippines, Nepal, Indonesia, Sri Lanka, West Africa, Australia, America, etc. (Naqvi, 2019). Initially, this disease was not dangerous, but later, with the excess use of nitrogen fertilizer and the development of new hybrid rice, semidwarf rice varieties increased the severity of the disease (Nino-Liu et al., 2006; Zhang, 2009). Xanthomonas oryzae pv. oryzae (Xoo) is the main infecting microbe of rice causing BB (Angeles-Shim et al., 2020). Symptoms of BB appear as water-soaked streaks on the tips and margins of rice blades, and then these streaks extend along the veins, and their appearance changes into tannish gray to white lesions (Huerta et al., 2019). BLB infection at the tillering stages causes a 40% of yield reduction; however, at the early stages, it can cause a reduction of up to 50%. This disease can affect the rice at all the growth stages, i.e., seedling, vegetative, and reproductive stages. Generally, temperature between 25C and 34°C with 70% relative humidity favors the development of disease. Li et al. (2019) showed that isoleucine, valine, leucine, histidine, arginine, tryptophan, threonine, and cysteine are synthesized, which are essential for Xoo infection. In Xoo, the type 3 secretion system (T3SS), which is encoded by hrp genes plays an essential virulence factor (Xu et al., 2019). The type II secretion system also acts as a fatal factor for the secretion of secretion of other Xoo virulence factors, for example, xylanase enzyme (Xu and Gonzalez, 1989; Ray et al., 2000) and the gum gene cluster involved in exopolysaccharide synthesis functions as avirulence determinant (Dharmapuri and Sonti, 1999). BB disease can be controlled by the understanding of host resistance gene response in which resistant gene. Host resistant gene work on the principle of gene for gene interaction (Keen, 1990; Leach and White,

An Overview of the Biology of Rice Bacterial Blight

47

1996). In addition to this, presently, various conventional approaches such as cultural management practices, various chemicals, and biological control agents are used for the management of bacterial blight (BB)/bacterial leaf blight (BLB) disease. In addition to these, host-pathogen interaction between BB and rice can explore a better understanding of BB disease resistance in rice (Mundt, 2014; Pradhan et al., 2015; Li et al., 2019). 3.2 PLANT-PATHOGEN COMMUNICATION AND SYMPTOMATOLOGY Plants are characterized by walls of complicated structure, and microbes challenge to enter through this gate to feed on nutrients. The bacteria tended to disturb the cell wall obstruction via the production of cell wall degrading enzymes (CDEs) as lipase/esterase, cellulase, cellobiosidase, xylanase, etc. This is considered to be an effective virulence mechanism developed by pathogenic bacteria (Jha et al., 2007). In this regard, Xoo enters the tissue of rice through wounds or hydathodes. Thereafter, the bacteria reproduce and develop in the apoplast beneath the epidermal cells. Thus, they transfer via xylem vessels to other plant cells and tissues. Some days later, the bacteria and its exudates (exo-polysaccharides, EPS) accumulate in the xylem vessels. The bacteria and EPS could go out to the leaf surface through the natural opening as hydathodes serve as a source of secondary inoculum, and later, leaves turn necrotic and chlorotic (Lee et al., 2011; Kumar et al., 2020). Various pathogens, such as BB pathogen, use secretion mechanisms (type 3) to move virulence proteins and enzymes to interfere with the signaling of the host and carry off their metabolism in favor of their growth and flourish (Kumar et al., 2020). Type 3 secretion technique involved proteins, namely effector proteins which are of two types of transcription activators, the first effector proteins termed (TAL), and the second is non-TAL effector proteins (Scholze and Boch, 2011). The first type, TAL effector protein is responsible for the multiplication of Xoo and initiation of pathogenesis in the host plant via changing host transcription machinery by managing host genes expres­ sion in favor of pathogen proliferation. The second type, non-TAL effector protein stimulates virulence through lessening the immune system of host plants (Tian et al., 2014). Furthermore, another type II secreted proteins (TIIS) induce toxins and enzymes that work on the host defense system. In this regard, the type II secretion system produces different sugar-degrading enzymes, which help Xoo degrading plant cell wall, such as polygalacturonases, pectate lyases,

48

Bacterial Diseases of Rice and Their Management

cellulases, and xylanases (Cianciotto and White, 2017), which diminish the cell wall rigidity. Jha et al. (2005) reported the induction of hypersensitive reaction rice plants when type II proteins were secreted. Thus, Cianciotto and White (2017) deduced that the severity of Xoo reduced in host plants when genes encoding the type II secretion system is mutated. Xoo increases the host vulnerability by adjusting the host physiology via modifying host gene products and TAL effectors. The quick response of the host and high ability to determine the negative impacts of the pathogen, control the host’s fate. Navarro et al. (2006) displayed that host plants disrupt auxin content against bacterial attack for mitigating disease incidence. Moreover, Xu et al. (2013) deduced that high ABA content reduced rice resistance to Xoo by changing the SA defense mechanism. Xoo also releases hormone-like molecules (autoinducers) to reveal the population intensity (quorum sensing: QS) (Karatan and Watnick, 2009; Pradhan and Chatterjee, 2014). The QS of bacteria enables them to control the pattern of their gene expression, and effectively penetrate the cells of host plant (Karatan and Watnick, 2009). Several signaling molecules engage in QS as N-acylhomoserine lactones (AHLs), autoinducers-2 (AI-2), and oligopeptides (Deng et al., 2010). More­ over, the Xoo bacteria produce a considerable amount of exopolysaccharides (EPSs), which suffocate the xylem of the plant and cause wilting symptoms. Also, EPS protects the bacteria from secondary metabolites produced by host plants (Dharmapuri and Sonti, 1999). All of those mechanisms contribute together to enhance pathogenesis (Leigh and Coplin, 1992). BB pathogen produces a broad range of various virulence factors, such as type 3 secretion-dependent effectors, extracellular enzymes, exopolysaccha­ rides (EPS), iron-chelating siderophores (Ray et al., 2000; Jha et al., 2007; Liang et al., 2016). Xanthan, a type of exopolysaccharide is a vital virulence factor for this BB pathogen. The excretion of large amounts of xanthan is almost the important factor responsible for virulence in Xoo and other species (Köplin et al., 1992). Lipopolysaccharide (LPS) is produced in the outer membrane of bacterium and these molecules are important for the viability of the bacteria, belong to a gram-negative group, along with the virulence, symbiosis, and tolerance phases during the host-pathogen interaction (Di Lorenzo et al., 2016). As these LPS molecules act as a microbe-associated molecular pattern (MAMP) as it triggers defense-related (DR) responses in the plants (Di Lorenzo et al., 2016; Barel et al., 2015). Additionally, QS increases the virulence of various species of Xanthomonas with the help of motility regulation, chemotaxis, biofilm dispersal, and stress responses (Barel et al., 2015).

An Overview of the Biology of Rice Bacterial Blight

49

3.3 HOST-MEDIATED DISEASE RESISTANCE Any pathogen infects the plants by escaping the defense response of the host and to encounter this host also developed various kinds of receptors and sensors which can interact with the components of the microbe and thereby eradicate the effect of pathogen (Lacombe et al., 2010). Based in the recogni­ tion of microbial components, plant immunity is categorized into two levels; First, PAMP triggered immunity (PTI) which is also called basal immunity (quantitative resistance). Second, effector-triggered immunity (ETI) or gene-for-gene resistance (qualitative resistance) (Monaghan and Zipfel, 2012; Zhang and Wang, 2013). Both PTI and ETI are facilitated via receptor kinase proteins localized in the plasma membrane and nucleotide-binding (NB), leucine-rich repeat (LRR) proteins, and other factors localized in the cytoplasm (Macho and Zipfel, 2014). Interaction between BB pathogen and rice is governed by qualitative resistance, i.e., governed by a major gene, which may include ETI or PTI or any additional mechanism other than PTI or ETI (Hu et al., 2017). 3.4 PHYSIOLOGICAL RESPONSES OF RICE TO BACTERIAL BLIGHT (BB) DISEASE Plant-pathogen interactions are up-regulated by a plethora of molecular and cytological processes that assess the susceptibility and resistance of host plants. Many hosts’ response defense-related enzymes express host resis­ tance. In this regard, phenylalanine ammonia-lyase (PAL) is the gateway enzyme for the phenylpropanoid pathway that activates the production of trans-cinnamic acid from L-phenylalanine which is the precursor of various defense-related secondary metabolites as lignin, phenolic compounds, flavonoids, and other phytoalexins. Thus, the elicitation of PAL has been considered as a defense strategy in various host-pathogen interactions. Also, polyphenol oxidase (PPO) is widely documented in disease resistance that triggers quinine production via oxidation of phenolic compounds, which have toxicity against pathogens relative to phenolic compounds per se. Also, PPO participates in lignin biosynthesis; thus, PPO is a key factor of plant defenses against pathogens. Higher activities of PPO were observed in resis­ tant cultivars compared to susceptible ones. Further defense-related enzyme, chitinase, which able to hydrolyze the pathogen cell walls hence conferring resistance against pathogens. Several types of research declared increment

50

Bacterial Diseases of Rice and Their Management

of chitinase activity is associated with induction of resistance. Lipoxygenase (LOX) is a key enzyme that induces membrane’s lipid peroxidation, thus affecting the membrane structures via a non-enzymatic way. The high levels of oxidative stress markers (MDA) are used as indicators of increased cell damage (Bagy et al., 2019). Previous work deduced that a high level of H2O2 (hydrogen peroxide) was localized near the infection point, in the secondary wall, when detected 58 h after pathogen invasion. This H2O2 accumulation could directly affect the microorganisms as well as cause damage to plant cell membranes and subsequently accelerate dry spots formation. Moreover, catalase (CAT), peroxidases (POD), ascorbate peroxidase (APX), and glutathione peroxidase (GPX) are major enzymes existing in vivo that can decompose H2O2 and avoid oxidative stress of host cells. The causal agents of blight disease affect differentially the cellular metabolism of rice plants. The severity of infection varied with bacterial strain, genotypes, and growth stage. It is observed that BB disease led to a decrease in Chl (a + b), total chlorophyll, and carotenoids content in three rice genotypes due to lesion formation. During the progression of blight disease, the increment of phenolic, flavonoid, ferric reducing power, and total antioxidative capacity contents was observed in three rice genotypes during the initial stages of infection and attenuated at the late stage. On the other hand, total free amino acid content, DPPH (2,2-diphenyl-1-picrylhydrazyl) free radical scavenging activity, CAT, and POD increased throughout the stress period in all three genotypes particularly on the 15th day of infection (Kumar et al., 2013). After the Xoo infection various DR enzymes are induced and accumulates, which prevent the further spread of disease by inhibiting their proliferation and colonization (Bardin et al., 2015). These defense-related enzymes include glucanases, proteases, chitinases siderophores, etc. Various studies also supported the result (Yasmin et al., 2016). Also, reactive oxygen species (ROS) instigates and exacerbated due to disease infection, which can damage the infected host cells (Manhas and Kaur, 2016). Yasmin et al. (2017) reported that the percentage of rice diseased leaf area caused by Xoo was minimized where the defense-related enzymes were seriously affected. In this regard, POD did not affect after 24 and 48 h from infection, reduced after 72 h, and then increased after 6 days of infection compared to healthy plants. CAT activity was mainly reduced except for some activation after 48 h from infection. Also, the reduction of PPO was registered after 24 and 48 h from infection and then remained comparable to control. PAL showed up-regulation, especially after 48 h of infection. Rice leaves infected with Xoo showed an increment of percent diseased leaf area, which was associated with the reduction of defense-related enzymes such as CAT, and

An Overview of the Biology of Rice Bacterial Blight

51

1,3-gluoconase, while PAL did not alter and POD increased in rice plants (Rasul et al., 2019). Rhizoctonia solani causes rice sheath blight which adversely reduced vigor index, fresh, and dry weight of rice seedlings, with the decrement of chlorophyll content, whilst PAL, POD, and PPO activities were increased due to infection (Jamali et al., 2020). Ahmed et al. (2020) reported a reduction in root and shoot morphological traits such as length, fresh weight, and dry weight relative to non-infected control. The infected plants encountered oxidative stress where increased levels of malondialde­ hyde and H2O2 were detected compared to healthy rice plants, which were associated with the reduction of CAT and guaiacol peroxidase (POD). However, phenolics and the osmoticum, proline, were not affected by the infection. Kumar et al. (2020) stated that the field experiment of diseased rice showed that leaf blight disease caused by Xoo exhibited a reduction of fresh and dry biomass, number of tillers, total plant height, number of panicles/hill, panicle length, 1,000 filled grain weight (g), and yield/m2. In the net house experiment, the diseased plants exhibited high activity of CAT, POD, SOD, and PAL. Chloroplasts and mitochondria have been implicated in the immune system of the host during the infection (Caplan et al., 2015). In this regard, Yang et al. (2020) displayed more genetic copies of plantderived sequences in non-infected rice leaves compared to infected leaves by Xoo, which revealed that damage or degradation of plant organelles such as chloroplasts and mitochondria in discolored infected lesions where the genomic DNA was isolated from symptomatic leaf samples. 3.5 THE CORRELATION OF XANTHOMONAS ORYZAE PV. ORYZAE (XOO) AND MICROBIOTA Yang et al. (2020) identified six Xanthomonas operational taxonomic units (OUTs), and (OTU_2) was the highest available one in BB diseased leaves and acted as the BB causal agent. Furthermore, OTU_2 exhibited low occur­ rence in asymptomatic rice leaves, denoting a close relationship between the availability of disease-causing agents and the severity of symptoms of plant diseases also observed in another study (Blaustein et al., 2017). The other Xanthomonas OTUs were identified with 20 genes on several transcription units which encode structural components of T3SS, regulators for hrp gene expression, effector proteins or chaperone proteins to translocate effectors. The hrp gene cluster in Xanthomonads consists of six operons (hrpA to hrpF) and HrpG and HrpX are the key hrp regulators. HrpG, which is predicted to be a member of the two-component signal transduction OmpR regulator family, regulates the expression of hrpX, an AraC-type transcriptional activator and hrpA. HrpX then regulates the expression of other hrp genes on its operons by directly recognizing a cis consensus sequence for plant-inducible promoter (PIP) box (PIP) in most cases (Ikawa and Tsuge, 2016).

Virulence Determinants and Host Defense Factors

79

Type 3 effectors after having been translocated into host tissue, either elicit ETI in form of HR or suppress it by manipulating host transcriptional and physiological processes to facilitate self-proliferation, rendering the host susceptible. T3S effectors of Xoo can be broadly divided into two groups: transcription activator-like effectors (TALes) and non-TALes. TALEs form a very prevalent class amongst Xoo, with 15–25 TALes harbored in Asian Xoo strains. This class of T3SS effectors are remarkably similar in their structure with T3S signal at the N terminal, nuclear localization signal and transcriptional acidic activation domain (AAD) at the C terminal flanking central repeat domain composed of near identical 33–35 amino acid direct repeats. TALes are highly conserved, differing only at the 12th and 13th amino acid residues of each repeat in the central domain. This duo is referred to as repeat variable diresidue (RVD) (Moscou and Bogdanove, 2009) Xoo-rice interaction mediated by TALe is a protein-DNA interaction between RVD of each repeat and a specific base on host DNA (Moscou and Bogdanove, 2009; Boch et al., 2009; Boch and Bonas, 2010). Target specificity of each TALe is conferred by the number and sequence of RVDs. The AAD of TALe acts as a bonafide eukaryotic transcription factor and upregulates host genes by binding to their promoters. Xoo TALes such as AvrXa7, AvrXa23, AvrXa27, etc., activate their targets eliciting resistance and hence are classified as avirulent factors; whereas there are many other TALes like PthXo1, PthXo2, PthXo3, etc., whose interaction with host genes amounts to susceptibility thus designating them as virulence factors. Notably, inspite of being T3S effectors, TALes are not preceded by PIP box motifs and are neither regulated by HrpX. Non-TALes, on the other hand, bear no structural similarity amongst each other except common characteristics in the N terminal amino acid composi­ tions. Compared to TALes, mechanism of action of non-TALes, biochemical function and their targets have been lesser understood. Research indicates the non-TALes function by interfering with signaling events, thereby suppressing rice innate immunity. Xoo encodes 16–18 non-TALes, out of which Xanthomonas outer proteins (Xops) K, L, N, P, Q, X, Z, and AvrBs2 are classified as core effectors and present in all Xanthomonads. Efforts to characterize individual Xops have mostly utilized mutagenesis approach by screening for loss of virulence followed by studying underlying mechanisms. For instance, knockouts of Xops Z, N, Q, and X displayed reduced virulence and were studied to function by suppressing cell wall damage-induced defense response in rice (Sinha et al., 2013). Long et al. (2018) employed transient expression studies in rice protoplast and demonstrated Xop Z, R, K, N, and V to contribute to Xoo’s virulence by inhibiting the MAP kinase

80

Bacterial Diseases of Rice and Their Management

signaling of rice immunity genes as one of the mechanisms. The non-TAL effectors outside the core effector class, known as variable effectors, differ from one strain to another in terms of their presence in different species and strains, and also the extent of virulence of same protein in different genetic backgrounds (Ryan et al., 2011; Ji et al., 2018). All virulence factors contributing to pathogenicity discussed above are expressed in response to external stimuli under regulatory control of multiple coordinated systems, including cell-to-cell signaling mediated by diffusible signaling factor (DSF) via QS pathways, cyclic di-GMP-based two-component systems, and various transcriptional regulators (Buttner and Bonas, 2010). Iron uptake and metabolism also play a critical role in virulence and are coregulated with virulence-associated functions (Pandey et al., 2016). 4.4 RICE RESISTANCE GENES AND UNDERLYING MECHANISMS The interplay of attack and defense between Xoo-rice has evolved as a unique pathosystem showcasing diverse molecular mechanisms involved in a host-pathogen interaction. The R genes in rice conferring resistance to most of its other pathogens except viruses, are known to function dominantly, whereas about one-third of the identified R genes against Xoo are recessive in nature, which is one reason to classify this system as unique. To date, 46 BB resistance genes named with prefix Xa for Xanthomonas, have been identified (Chen et al., 2020). Out of these, only 11 genes, have been cloned and characterized as yet (Table 4.1). Mechanisms of action deployed by rice through these 11 genes, against this one pathogen, Xoo, displays huge diversity. We provide here a brief overview of diverse resistance strategies displayed by the cloned genes. 4.4.1 RLK (RECEPTOR-LIKE KINASE) Receptor-like kinases (RLK) represent the first tier of plant’s immune system known as PAMP-triggered immunity (PTI). The membrane-localized pattern recognition receptors (PRRs) in plants detect PAMPs produced by pathogens, in turn switching the PTI on. All known PRRs are RLKs, largely dominated by RLKs with an extracellular leucine repeat-rich (LRR) domain. Besides the extracellular domain which putatively functions to perceive the pathogen, RLKs have the transmembrane domain leading to cytoplasm

Cloned R Genes in Rice and Their Cognate Effectors

SL. R Gene No.

Class

Product Localization; Resistance Profile

Cognate Effector/ Elicitor

References

1.

Xa21

RLK

Extracellular, membrane, and Avrxa21 intracellular domains; broad spectrum

Song et al. (1995); DaSilva et al. (2004); Pruitt et al. (2015)

2.

Xa3/Xa26

LRR-RLK

Similar to Xa21; broad spectrum

AvrXa23

Sun et al. (2004); Xiang et al. (2006)

3.

xa5

Transcription factor Nuclear, broad spectrum

AvrXa5

Zou et al. (2010)

4.

Xa10

Executor

broad spectrum

AvrXa10

Tian et al. (2014)

5.

xa13

SWEET Sucrose transporter

Membrane; race specific

PthXo1

Chu et al. (2006); Yang et al. (2006); Yuan et al., 2009

6.

Xa1

NBS-LRR

Cytoplasm, race-specific

PthXo1/Tal4/Tal9d

Yoshimura et al. (1996); Ji et al. (2016)

7.

Xa23

Executor

Endoplasmic reticulum membrane, broad spectrum

AvrXa23

Wang et al. (2014b, 2015)

8.

xa25

SWEET sucrose transporter

Membrane; race specific

PthXo2

Liu et al. (2011); Zhou et al. (2015)

9.

Xa27

Executor

Membrane and cell wall

AvrXa27

Gu et al. (2005)

SWEET Sucrose transporter

Membrane; race specific

PthXo3, AvrXa7, TalC, Tal5

Antony et al. (2010); Yu et al. (2011); Streubel et al. (2013); Hutin et al. (2015)

WAK

Cell wall, race-specific

Unknown

Hu et al. (2017)

10. xa41 11.

Xa4

Virulence Determinants and Host Defense Factors

TABLE 4.1

Source: Adapted and updated from: White and Yang (2009).

81

82

Bacterial Diseases of Rice and Their Management

through an intracellular kinase domain initiate phosphorylation function in signaling cascade for immune response. Two BB resistance genes Xa21 and Xa3/26 have been characterized to encode LRR-RLKs. Xa21, notably, was the first RLK and also the first Xa gene cloned (Song et al., 1995). Xa21 was originally identified in Oryza longistaminata and has since been introgressed into many cultivated varieties. Activation of Xa21-mediated immune response has been shown to involve interaction of Xa21 with multiple other genes encoding ubiquitin ligase, ATPase, transcription factor, phosphatase, and HSPs. During the non-defense mode, juxta membrane domain which is flanked by transmembrane and kinase domains in Xa21 is phosphorylated by Xa21 binding protein 24 (XB24), an ATPase. However, when a sulfated peptide of Ax21 protein secreted from Xoo is detected by the LRR domain of Xa21, Xa21 gets dissociated from XB24 to activate the downstream defense signaling response. Interestingly, the kinase domain of Xa21 after having perceived the Ax21 signature on the surface, translocates to the nucleus where it directly interacts with WRKY62 transcriptional regulator (Park and Ronald, 2012). This indicated that Xa21 functions beyond being just a PRR. Xa26 and Xa3, identified from indica rice variety Minghui 63 and from japonica variety Wase Aaikoku 3, respectively, are the same gene, hence clubbed together and renamed as Xa3/Xa26 (Sun et al., 2004; Xiang et al., 2006). However, japonica background has been studied to be more effective for this gene’s expression than indica background. Characterization of genes involved in regulation of Xa3/Xa26 mediated resistance have identified 2 WRKYs (13 and 45-2) which positively regulated resistance response of rice against Xoo, Xoc, and a major fungal pathogen, Magnaporthe oryzae. This is the only mechanism in Xoo-rice which is shared in part with other pathosystems in rice. Xa21 and Xa3/Xa26 have many functional similarities, besides them being structurally RLKs. Overexpression of both the genes positively corre­ lates with the magnitude of resistance elicited by rice. Both being develop­ mentally regulated, mediate complete resistance at the adult stage (Jiang et al., 2020). Both mediate race-specific broad-spectrum resistance, although the spectrum of Xoo strains differs between the two. 4.4.2 CELL WALL ASSOCIATED KINASE Plants are posited to pose their cell wall as the first line of defense against pathogen attack. However, very few cell wall-associated kinase genes

Virulence Determinants and Host Defense Factors

83

(a subfamily of RLKs) have been shown to contribute against pathogens. Xa4, is one of the earliest identified race-specific R genes deployed extensively in breeding programs for its durability through all stages of rice growth. Very recently, Xa4 has been functionally characterized to be a cell wall-associated kinase protein that prevents bacterial entry into plant by promoting cellulose synthesis to strengthen cell wall, and by boosting defense hormones-jasmo­ nates leading to accumulation of defense-associated secondary metabolite phytoalexins (Hu et al., 2017). The target for kinase is yet not identified, thus not precluding a possibility of another mechanism also contributing towards Xa4. 4.4.3 NUCLEOTIDE BINDING SITE-LEUCINE RICH REPEAT (NBS-LRR) GENE FAMILY NBS-LRRs are a major class of effector-mediated plant defense genes encoding cytoplasmic receptor proteins with nucleotide binding site and leucine-rich repeat (NBS-LRR) domain. The majority of R genes cloned by far in plants including rice against fungal pathogens belong to NBS-LRR family (REFERENCE). However, out of the 11 R genes yet characterized in Xoo-rice interaction, Xa1 is the only NBS-LRR. Xa1 confers broad spectrum resistance as it gets activated by detecting any full-length canonical TAL effector, irrespective of its RVD composition and initiates resistance in the form of HR and cell death. This resistance, however, is suppressed by Xoo isolates harboring truncated versions of TAL effectors known as trunkTALes or iTALEs for interfering. These trunk-TALes in contrast to a normal TALe have a reduced N terminal region and no activation domain, but retain one or two of the three nuclear localization signals shown to be critical for their function (Read et al., 2016; Ji et al., 2016). Xa1 mediated resistance and its suppression function independent of promoter-specific binding and activation by TALes or trunkTALes, respectively. So, it is hypothesized that Xa1 elicits resistance by activating downstream defense-associated genes and the trunkTALes abolish or dampen this downstream activation resulting in susceptibility. 4.4.4 SUGAR EFFLUX TRANSPORTERS OR SWEET GENES Sucrose efflux by SWEETs is an essential process in plants for many physiological purposes like reproduction, senescence, etc. However, Xoo

84

Bacterial Diseases of Rice and Their Management

and few other phytopathogenic bacteria inhabiting the intercellular spaces in plants redirect the sugar for their own multiplication and virulence. Five genes, SWEET11–15, out of 22 in the rice SWEET gene family, have been implicated in contributing to BB disease (Streubel et al., 2013). All Xoo strains examined to date activate either SWEET11 (Os8N3/Xa13) or SWEET13 (Os12N3/Xa25) and/or SWEET14 (Os11N3/Xa41) to confer race-specific susceptibility, whereas the same role of SWEET12 and SWEET15 has yet been evidenced in experimental context only and not in nature. Therefore, unlike the R genes discussed in the above sections, SWEETs represent susceptibility genes whose interaction with cognate TAL effectors facilitates the disease. For example, SWEET11, which is crucial for pollen development in rice is directly bound by Xoo TAL effector PthXo1 in its promoter region activating its expression for more sugar efflux. As a counter strategy, rice evolved xa13, a recessive allele of SWEET11, which harbors mutations in the promoter binding region thus defying recognition by PthXo1 amounting to loss of susceptibility and hence resistance. Similarly, PthXo2-SWEET13 and PthXo3/AvrXa7/TalC-SWEET14 susceptible interactions are defeated by their respective recessive alleles xa25 and xa41 yielding resistance (Zhou et al., 2015). 4.4.5 TRANSCRIPTION MACHINERY TFIIAγ, the small subunit of basal transcription factor, functions in stabilizing the binding of TATA box-binding protein complex (TFIID) to the TATA box of Polymerase II transcribed gene promoters. TFIIAγ in rice appears on two loci which encode closely related non-identical proteins viz. TFIIAγ5/Xa5 on chromosome 5 and TFIIA1 on chromosome 1. TFIIAγ5, the predominant form is exploited by Xoo as an apparent contact point between its TAL effec­ tors and the rice transcription machinery so as to make TFIIA5 cooperate in TALe-induced host gene expression. Its recessive allele, xa5 (the only recessive resistance a gene which is not a SWEET allele) has glutamic acid instead of valine at position 39 and this missense mutation does not compro­ mise the general transcription but interferes with its interaction with TALEs and reduces TALE dependent host gene expression (Yuan et al., 2016). The general dampening effect of xa5 reduces the expression of S genes, thus conferring broad spectrum resistance (Huang et al., 2016). Unlike the protein-protein interaction exhibited by TFIIAγ5 with TALEs, its paralog TFIIAγ1 interacts with TAL effector PthXo7 through DNAprotein interaction to activate its own expression (Sugio et al., 2007).

Virulence Determinants and Host Defense Factors

85

4.4.6 EXECUTOR GENES This class is also TAL effector dependent like SWEET genes and xa5, but entails only dominant genes which are transcriptionally activated to elicit resistance in the form of HR. As a counter offensive strategy to the virulent Xoo TAL effectors driving host genes to confer susceptibility, rice evolved with executor genes which possess specific EBEs in their promoter region to trap cognate avrTAL effectors and thereby drive resistance. Xa10, Xa23 and Xa27 are the three executor genes cloned from rice, as yet; driven by their cognate TAL effectors AvrXa10, AvrX23 and AvrXa27, respectively (Gu et al., 2005; Tian et al., 2014; Wang et al., 2014). These are relatively small proteins with no sequence identity to the known R gene products. Xa27 confers broad resistance but is plant stage-dependent and exhibits dosage effect. Localization studies have shown that postbacterial infection Xa27 gets induced and secreted to apoplastic region eventually localizing to the cytoplasmic membrane. Xa10 post induction gets localized to endoplasmic reticulum membrane and mediates calcium depletion followed by PCD. Xa10 and Xa23 bear sequence and structural similarity, but Xa10 differs from Xa27 and Xa23 in not having a nearly identical coding sequence in its susceptible recessive allele and has relatively narrower spectrum of resistance. The dependence of executor genes on TAL effectors for their induction involves dependence upon TFIIAγ5 to assist in the transcription initiation, hence their resistance is attenuated in xa5 background. 4.5 RECENT DEVELOPMENTS TOWARD BB MANAGEMENT Genomics-assisted molecular breeding has come up as the most efficient, fast tool for breeders to develop genetically resistant rice varieties. More than 10 resistant rice varieties deploying single or pyramided combinations of Xa4, xa5, xa13, Xa21, Xa33, and Xa38 have been commercially released for cultivation, in rice growing regions (Chukwu et al., 2019). Availability of 3,000 sequenced rice genomes with the list increasing, has also accelerated allele mining for novel sources of resistance (Li et al., 2014). Real-time, region-specific monitoring of Xoo population is key for effective control, considering the fast pace at which Xoo evolves. Since SWEETs rule the Xoo-rice interaction studied yet, a diagnostic kit called SWEETR v 1.0 has been recently developed for qRT-PCR dependent

86

Bacterial Diseases of Rice and Their Management

monitoring of the Xoo strains on the basis of SWEET genes targeted by them, and thereby guiding the breeders to suggest farmers for deployment of resistant variety (Eom et al., 2019). The SWEET gene so identified is then validated by breeder on the 32-transgene free EBE-edited rice lines included in the kit to select optimal SWEET resistant line. The PathoTracer in the kit further recommends for region-specific deployment of SWEET resistant variants. Genome editing tools are being successfully utilized for targeted, precise modifications in Susceptible genes of BB to overcome the limitation of breeding recessive resistance genes. Han et al. (2019) employed TALEN to generate TFIIAγ5 knockout. The mutants so generated displayed reduced susceptibility to Xoo. This study also brought out the importance of amino acids around 32nd site in the functioning of TFIIAγ5 which was earlier known to be limited only to 39th amino acid. Given the fact, that disruption of TAL effector binding site of SWEET gene promoters yields resistance, CRISPR-Cas technology has enabled researchers to engineer broad spectrum resistant rice. Xu et al. (2019) mutated EBEs of SWEET11 and SWEET14 in rice cv. Kitaake which harbors resistant recessive allele of SWEET13. In the same year, Oliva et al. also utilized CRISPR-Cas to target all EBE polymorphisms identified for 63 Xoo strains from diverse regions worldwide and generated two mega indica rice varieties, IR64 and Ciherang-Sub1 with edits in SWEET11, 13 and 14. Deployment of these edited lines, however, will need extensive field trials for testing any impediment in agronomic traits as off-target effects. In conclusion, the diverse array of effectors used for attack by the pathogen Xoo and variety of resistance mechanisms with distinctive features employed for defense by the host rice, define Xoo-rice as a unique patho­ system. On the other hand, decades of research on this system have resulted in important advances in understanding the host-pathogen interplay, and generated an unprecedented amount of information and suite of resources, giving Xoo-rice the power of being a model system. ACKNOWLEDGMENTS SP and PM thank support by Department of Biotechnology (BT/ CEIB/12/1/01) and the Indian Council of Agricultural Research-Networking Project on Transgenic Crops, respectively.

Virulence Determinants and Host Defense Factors

87

KEYWORDS

• • • • • • •

ATP binding cassette bacterial blight effector-triggered immunity hypersensitive response pathosystem R genes Xanthomonas oryzae

REFERENCES An, S. Q., Potnis, N., Dow, M., Vorholter, F. J., He, Y. Q., Becker, A., Tepet, D., et al., (2020). Mechanistic insights into host adaptation, virulence, and epidemiology of the phytopathogen Xanthomonas. FEMS Microbiology Reviews, 44, 1–32. Antony, G., Zhou, J., Huang, S., Li, T., Liu, B., White, F., & Yang, B., (2010). Rice xa13 recessive resistance to bacterial blight is defeated by induction of the disease susceptibility gene Os-11N3. Plant Cell, 22, 3864–3876. Boch, J., & Bonas, U., (2010). Xanthomonas AvrBs3 family-type III effectors: Discovery and function. Annual Review of Phytopathology, 48(1), 419–436. Boch, J., Scholze, H., Schornack, S., Landgraf, A., Hahn, S., Kay, S., & Bonas, U., (2009). Breaking the code of DNA binding specificity of TAL-Type III effectors. Science, 326, 1509–1512. Burdman, S., Shen, Y., Lee, S. W., Xue, Q., & Ronald, P., (2004). RaxH/RaxR: A two component regulatory system in Xanthomonas oryzae pv. oryzae required for AvrXa21 activity. Molecular Plant-Microbe Interactions, 17, 602–612. Buttner, D., & Bonas, U., (2010). Regulation and secretion of Xanthomonas virulence factors. FEMS Microbiology Reviews, 34, 107–133. Chen, S., Wang, C., Yang, J., Chen, B., Wang, W., Su, J., Feng, A., et al., (2020). Identification of the novel bacterial blight resistance gene Xa46(t) by mapping and expression analysis of the rice mutant H120. Scientific Reports, 10, 12642. Choi, Y., Kim, N., Mannaa, M., Kim, H., Park, J., Jung, H., Han, G., et al., (2020). Characterization of type VI secretion system in Xanthomonas oryzae pv. oryzae and its role in virulence to rice. Plant Pathol. J., 36(3), 289–296. Chu, Z., Yuan, M., Yao, J., Ge, X., Yuan, B., Xu, C., Li, X., et al., (2006). Promoter mutations of an essential gene for pollen development result in disease resistance in rice. Genes Dev., 20, 1250–1255. Chukwu, S. C., Rafil, M. Y., Ramlee, S. I., Ismail, S. I., Hasan, M. M., Oladosu, Y. A., Magaji, U. G., et al., (2019). Bacterial leaf blight resistance in rice: A review of conventional breeding to molecular approach. Mol. Biol. Rep., 46, 1519–1532.

88

Bacterial Diseases of Rice and Their Management

Cianciotto, N. P., & White, R. C., (2017). Expanding role of type II secretion in bacterial pathogenesis and beyond. Infect. Immune., 85, 14–17. Da Silva, F. G., Shen, Y., Dardick, C., Burdman, S., Yadav, R. C., & De Leon, A. L., (2004). Bacterial genes involved in type I secretion and sulfation are required to elicit the rice Xa21­ mediated innate immune response. Molecular Plant-Microbe Interactions, 17, 593–601. Doni, F., Suhaimi, N. S. M., Mohamed, Z., Ishak, N., & Mispan, M. S., (2019). Pantoea: A newly identified causative agent for leaf blight disease in rice. Journal of Plant Disease and Protection, 126, 491–494. Eom, J., Luo, D., Grande, G., Yang, J., Ji, C., Luu, V., HuguetTapia, J. C., et al., (2019). Diagnostic kit for rice blight resistance. Nature Biotechnology, 37, 1372–1379. Gu, K., Yang, B., Tian, D., Wu, L., Wang, D., Sreekala, C., Yang, F., et al., (2005). R gene expression induced by a type-III effector triggers disease resistance in rice. Nature, 435, 1122–1125. Han, J., Xia, Z., Liu, P., Li, C., Wang, Y., Guo, L., Jiang, G., & Zhai, W., (2020). TALEN-based editing of TFIIAy5 changes rice response to Xanthomonas oryzae pv., oryzae. Scientific Report, Nature Research, 10, 2036. Hu, K., Cao, J., Zhang, J., Xia, F., Ke, Y., Zhang, H., Xie, W., et al., (2017). Improvement of multiple agronomic traits by a disease resistance gene via cell wall reinforcement. Nat. Plants, 3, 17009. Huang, S., Antony, G., Li, T., Liu, B., Obasa, K., Yang, B., & White, F. F., (2016). The broadly effective recessive resistance gene xa5 of rice is avirulence effector-dependent quantitative trait for bacterial blight. The Plant Journal, 86, 186–194. Hutin, M., Sabot, F., Ghesquière, A., Koebnik, R., & Szurek, B., (2015). A knowledge-based molecular screen uncovers a broad-spectrum Os SWEET 14 resistance allele to bacterial blight from wild rice. Plant J., 84, 694–703. Ikawa, Y., & Tsuge, S., (2016). The quantitative regulation of the hrp regulator HrpX is involved in sugar-source-dependent hrp gene expression in Xanthomonas oryzae pv. oryzae. FEMS Microbiology Letters, 363, 071. Ji, Z., Ji, C., Liu, B., Zou, L., Chen, G., & Yang, B., (2016). Interfering TAL effectors of Xanthomonas oryzae neutralize R-gene-mediated plant disease resistance. Nat. Commun., 7, 1–9. doi: 10.1038/ncomms13435. Ji, Z., Wang, C., & Zhao, K., (2018). Rice routes of countering Xanthomonas oryzae. Int. J. Mol. Sci., 19, 3008. Jiang, N., Yan, J., Shi, Y., He, Z., Wu, Y., Zang, Q., Liu, X., & Peng, J., (2020). Resistance Genes and their Interaction with Bacterial Blight/Leaf Streak Pathogen (Xanthomonas oryzae) in Rice (Oryza sativa L.) an Updated Review (Vol. 13, p. 3). Springer. Ke, Y., Deng, H., & Wang, S., (2017). Advances in understanding broad-spectrum resistance to pathogens in rice. Plant J., 90, 738–748. Lee, S. W., Han, S. W., Sririyanum, M., Park, C. J., Seo, Y. S., & Ronald, P. C., (2009). A type I–secreted, sulfated peptide triggers XA21-mediated innate immunity. Science, 326, 850–853. Li, J., Wang, J., & Zeigler, R., (2014). The 3,000 rice genomes project: New opportunities and challenges for future rice research. Giga Science, 3, 8. Li, Y., Yan, Y., Deng, S., Zhang, C., Haq, F., Chen, T., Li, Y., et al. (2020). The Xanthomonas oryzae pv. oryzae type IV pilus alignment subcomplex protein PilN contributes to regulation of bacterial surface-associated behaviors and T3SS system. Plant Pathology, 69, 744–755. Liu, Q., Yuan, M., Zhou, Y. A., Li, X., Xiao, J., & Wang, S., (2011). A paralog of the MtN3/ saliva family recessively confers race-specific resistance to Xanthomonas oryzae in rice. Plant Cell Environ., 34, 1958–1969.

Virulence Determinants and Host Defense Factors

89

Long, J., Song, C., Yan, F., Zhou, J., Zhou, H., & Yang, B., (2018). Non-TAL effectors from Xanthomonas oryzae pv. oryzae suppress peptidoglycan-triggered MAPK activation in rice. Frontiers in Plant Science, 9, 1857. Lorenzo, F. D., Palmigiano, A., Silipo, A., Desaki, Y., Garozzo, D., Lanzetta, R., Shibuya, N., & Molinaro, A., (2016). The structure of the lipooligosaccharide from Xanthomonas oryzae pv. oryzae: The causal agent of the bacterial leaf blight in rice. Carbohydrate Research, 427, 38–43. Elsevier. Moscou, M. J., & Bogdanove, A. J., (2009). A simple cipher governs DNA recognition by TAL effectors. Science, 326, 1501. Oliva, R., Ji, C., Atienza-Grande, G., Huguet-Tapia, J. C., Quintero, A. P., Li, T., et al., (2019). Broad spectrum resistance to bacterial blight in rice using genome editing. Nat. Biotech. J., doi.org/10.1038/s41587-019-0267-z. Pandey, S. S., Patnana, P. K., Lomada, S. K., Tomar, A., & Chatterjee, S., (2016). Co-regulation of iron metabolism and virulence-associated functions by iron and XibR, a novel iron binding transcription factor, in the plant pathogen Xanthomonas. PLOS Pathogens. https:// doi.org/10.1371/journal.ppat.1006019. Park, C. J., & Ronald, P. C., (2012). Cleavage and nuclear localization of the rice XA21 immune receptor. Nature Communication, 3, 920. Pruitt, R. N., Schwessinger, B., Joe, A., Thomas, N., Liu, F., Albert, M., Robinson, M. R., et al., (2015). The rice immune receptor XA21 recognizes a tyrosine sulfated protein from a gram-negative bacterium. Sci. Adv., 1, e, 1500245. Read, A. C., Rinaldi, F. C., Hutin, M., He, Y., Triplett, L. R., & Bogdanove, A. J., (2016). Frontiers in Plant Science (Vol. 7, p. 1516). Suppression of Xo1 mediated disease resistance in rice by a truncated, non-DNA-binding TAL effector of Xanthomonas oryzae. Ryan, R. P., Vorholter, F., Potnis, N., Jones, J. B., Sluys, A. V., Bogdanove, A. J., & Dow, J. M., (2011). Pathogenomics of Xanthomonas: Understanding Bacterium-Plant Interactions, 9, 344–355. Singh, A., Gupta, R., Tandon, S., & Pandey, R., (2017). Thyme oil reduces biofilm formation and impairs virulence of Xanthomonas oryzae. Frontiers in Microbiology, 8, 1074. Sinha, D., Gupta, M. K., Patel, H. K., Ranjan, A., & Sonti, R. V., (2013). Cell wall degrading enzyme induced rice innate immune responses are suppressed by the type 3 secretion system effectors XopN, XopQ, XopX, and XopZ of Xanthomonas oryzae pv. oryzae. Plos One, (2013).https://doi.org/10.1371/journal.pone.0075867. Song, W. Y., Wang, G. L., Chen, L. L., Kim, H. S., Pi, L. Y., Holsten, T., Gardner, J., et al., (1995). A receptor kinase-like protein encoded by the rice disease resistance gene, Xa21. Science, 270, 1804–1806. Streubel, J., Pesce, C., Hutin, M., Koebnik, R., Boch, J., & Szurek, B., (2013). Five phylogenetically close rice SWEET genes confer TAL effector-mediated susceptibility to Xanthomonas oryzae pv. oryzae. New Phytol., 200, 808–819. Sugio, A., Yang, B., Zhu, T., & White, F. F., (2007). Two type III effector genes of Xanthomonas oryzae pv. oryzae control the induction of the host genes OsTFIIAg1 and OsTFX1 during bacterial blight of rice. Proceedings of National Academy of Sciences, USA., 104, 10720–10725. Sun, X., Cao, Y., Yang, Z., Xu, C., Li, X., Wang, S., & Zhang, Q., (2004). Xa26, a gene conferring resistance to Xanthomonas oryzae pv. oryzae in rice, encodes an LRR receptor kinase-like protein. Plant J., 37, 517–527. Tian, D., Wang, J., Zheng, X., Gu, K., Qiu, C., Yang, X., Zhou, Z., et al., (2014). The rice TAL effector-dependent resistance protein Xa10 triggers cell death and calcium depletion in the endoplasmic reticulum. Plant Cell, 26, 497–515.

90

Bacterial Diseases of Rice and Their Management

Verma, R. K., Samal, B., & Chattergi, S., (2018). Xanthomonas oryzae pv. oryzae chemotaxis components and chemoreceptor Mcp2 are involved in the sensing of constituents of xylem sap and contribute to the regulation of virulence-associated functions and entry into rice. Molecular Plant Pathol., 19(11), 2397–2415. Wang, C. L., Qin, T. F., Yu, H. M., Zhang, X. P., Che, J. Y., Gao, Y., Zheng, C. K., et al., (2014). The broad bacterial blight resistance of rice line CBB23 is triggered by a novel transcription activator-like (TAL) effector of Xanthomonas oryzae pv. oryzae. Mol. Plant Pathol., 15, 333–341. Wang, C., Zhang, X., Fan, Y., Gao, Y., Zhu, Q., & Zheng, C., (2015). Xa23 is an executor R protein and confers broad-spectrum disease resistance in rice. Mol. Plant Pathol., 8, 290–302. White, F. F., & Yang, B., (2009). Host and pathogen factors controlling the rice-Xanthomonas oryzae interaction. Plant Physiol., 150, 1677–1686. Xiang, Y., Cao, Y. L., Xu, C. Q., Li, X., & Wang, S., (2006). Xa3, conferring resistance for rice bacterial blight and encoding a receptor kinase-like protein, is the same as Xa26. Theor. Appl. Genet., 113, 1347–1355. Xu, Z., Xu, X., Gong, Q., Li, Z., Li, Y., Wang, S., Yang, Y., et al., (2019). Engineering broadspectrum bacterial blight resistance by simultaneously disrupting variable TALE-binding elements of multiple susceptibility genes in rice. Molecular Plant, 1–13. Xue, D., Tian, F., Yang, F., Chen, H., Yuan, X., Yang, C. H., Chen, Y., et al., (2018). Phospho­ diesterase EdpX1 promotes Xanthomonas oryzae pv. oryzae virulence, exopolysaccharide production, and biofilm formation. Appl. Environ. Microbiol., 84, e:01717–18. Yang, B., Sugio, A., & White, F. F., (2006). Os8N3 is a host disease-susceptibility gene for bacterial blight of rice. Proceedings of National Academy of Sciences, USA., 103, 10503–10508. Yoshimura, S., Yamanouchi, U., Katayose, Y., Toki, S., Wang, Z. X., & Kono, I., (1998). Expression of Xa1, a bacterial blight-resistance gene in rice, is induced by bacterial inoculation. Proc. Natl. Acad. Sci., 95, 1663–1668. Yu, Y., Streubel, J., Balzergue, S., Champion, A., Boch, J., Koebnik, R., Feng, J., Verdier, V., & Szurek, B., (2011). Colonization of rice leaf blades by an African strain of Xanthomonas oryzae pv. oryzae depends on a new TAL effector that induces the rice nodulin-3 Os11N3 gene. Mol Plant Microbe Interact, 24, 1102–1113. Yuan, M., Chu, Z., Li, X., Xu, C., & Wang, S., (2009). Pathogen-induced expressional loss of function is the key factor in race-specific bacterial resistance conferred by a recessive R gene xa13 in rice. Plant Cell Physiol., 50, 947–955. Yuan, M., Ke, Y., Huang, R., Ma, L., Yang, Z., Chu, Z., Xiao, J., Li, X., & Wang, S., (2016). A host basal transcription factor is a key component for infection of rice by TALE- carrying bacteria. eLife, 5, e:19605. Zhou, J., Peng, P., Long, J., Sosso, N., Liu, B., Eom, J., Huang, S., et al., (2015). Gene targeting by the TAL effector PthXo2 reveals cryptic resistance gene for bacterial blight of rice. The Plant Journal., 82, 632–643. Zou, H., Zhao, W., Zhang, X., Han, Y., Zou, L., & Chen, G., (2010). Identification of an avirulence gene, avrxa5, from the rice pathogen Xanthomonas oryzae pv. oryzae. Sci. China Life Sci., 53, 1440–1449.

CHAPTER 5

Challenges and Opportunities of Recent Tools for Bacterial Blight Resistance ANURAG MISHRA,1 RAJAT CHAUDHARY,1 VANDANA SHARMA,1 and PRASHANT YADAV2 Division of Genetics, ICAR–Indian Agriculture Research Institute,

New Delhi–110012, India,

E-mail: [email protected] (A. Mishra)

1

2

Indian Institute of Mustard Research, Bharatpur, Rajasthan, India

ABSTRACT Bacteria blight is one of the worldwide devasting disease of rice, which is caused by Xanthomonas oryzae pv. oryzae (Xoo). Disease spreads more in irrigated and rainfed lowland regions and also occurs in both tropical and temperate environmental conditions. The disease spreading is higher mainly in irrigated and rainfed lowland areas, and it can occur in both tropical and temperate environments in areas where weeds and stubbles of infected plants are present. Typically, the disease prefers temperatures of 25–34°C and more than 70% relative humidity Leaf blades having yellowish stripes with a wavy margin beginning at the leaf tips, the key signs are leaves with undulating yellowish white or golden yellow, marginal necrosis, drying of the leaves from the tip and curling, leaving the mid-rib intact. Due to the severity of this disease yield can drastically reduce. Various screening protocols at different stages of rice are used for the identification of resistant plants against bacte­ rial blight (BB) disease, and identified resistant plants can be used donor in breeding programs and also used in QTL mapping, and identification of new genes. Many advanced techniques of Genomics like Genome-wide associa­ tion study, genomic selection (GS) is used in BB resistance rice program. Bacterial Diseases of Rice and Their Management. Deepti Srivastava, Md. Shamim, Malik Mobeen Ahmad, & K. N. Singh (Eds.) © 2023 Apple Academic Press, Inc. Co-published with CRC Press (Taylor & Francis)

92

Bacterial Diseases of Rice and Their Management

The marker-assisted selection also plays a very important role in the varietal improvement of rice using foreground and background selection on the basis of molecular markers. Many gene are cloned and characterized by the up and down-regulation of BB resistance in rice using gene silencing, CRISPERCase, and different other techniques of genome editing. 5.1 INTRODUCTION Bacterial blight (BB) is the oldest known rice disease, first discovered in Japan by a farmer and later identified in various parts of Japan (Nino-Liu et al., 2006), eventually spreading to all of that country’s rice-growing areas. Rice BB was first observed in China in the 1930s and had spread to 10 provinces in southern China by the end of the 19th century. The disease is most likely to spread in irrigated and rainfed lowland areas, but it can occur in both tropical and temperate environments in areas where infected plant weeds and stubbles are present. Temperatures between 25°C and 34°C, with relative humidity above 70%, are ideal for the disease. The disease manifested as water-soaked with yellowish stripes on the leaf blades or with a wavy margin beginning at the leaf tips, with the key signs becoming leaves with undulating yellowish white or golden yellow, marginal necrosis, drying of the leaves from the tip and curling, leaving the mid-rib intact. Badly infected leaves appear to dry up to 60 percent of the loss in grain yield quickly. BB disease is caused by gram-negative bacteria Xanthomonas oryzae pv. oryzae (Xoo). BLB infection of plants results in a 20–40% reduction in yield at the maximum tillering point, while early infection causes extreme yield loss up to 60%, depending on the developmental stage of the plants and on climatic conditions. Xoo can quickly spread across crops because bacteria from diseased plants migrate through the water to the roots and foliage of other rice plants. Wind and water could potentially aid in the spread of Xoo bacteria to other crops and rice fields. In rice BB and Xoo, various disease processes have been observed, including quorum sensing (QS) and biofilm development. The BB pathogen penetrates the leaves via hydathodes and grows in the epithelium’s intercellular gaps before reaching the xylem vessels. Bacteria spread across the plant by migrating through the leaf veins. To begin, water-soaked patches were discovered at the leaf tips and on the margins, which turned chlorotic and necrotic as they progressed through the leaf veins. To control the disease, a variety of physical and biochemical approaches are utilized, including pesticide spraying. These pesticides are dangerous to humans and have a detrimental impact on their health and

Challenges and Opportunities of Recent Tools

93

ecosystem, as well as being very expensive for farmers. Many QTLs and genes against BB resistance in rice have been identified and cloned at the molecular level, and many old varieties can be improved and resistant varieties developed with the help of BB resistance genes in rice that have been developed through molecular breeding and transgenic approaches for the farmer’s benefit. 5.2 DISEASE CYCLE Rice plants are usually infected with the BB pathogen by leftover rice parts after harvest. Seeds and decaying plants are food for X. oryzae. X. oryzae infection spreads from plant to plant by irrigation water or storms. Bacteria enter the plant via pores or fissures in the roots, as well as lesions on the leaves and roots. The BLB infection affects the veins and xylem of leaves, causing them to wilt. Bacteria oozes secrets from wound leaves’ sores and spreads by wind or rain (Figure 5.1). X. oryzae possesses a wide range of hosts, including Leersia hexandra, which serves as an alternative host and is considered the most important source of primary inoculums as well as a crucial survival mechanism (Ou, 1985; Kumar et al., 2020). 5.3 SCREENING METHODS OF BACTERIAL BLIGHT (BB) IN RICE 5.3.1 ARTIFICIAL INOCULATION Scissors or clippers are soaked with the bacterial suspension and then around 1–2 cm of leaf tip is cut with the same scissors or clippers or small plastic bottle having inoculum is attached to the clipper and can be used to inoculate multiple leaves in a slope (Kauffman et al., 1973). This approach works well for inoculating large quantities of breeding materials in the field. Inoculation clippers will inoculate around 2,000 plants per man-hour per day. IRRI and other research institutes are currently using this method. 5.3.2 SPRAYING METHOD Bacterial inoculum is sprayed onto the plants at a concentration of 108–109 bacterial cells/ml, but this system cannot be used during the dry season as humidity levels do not facilitate the bacterial cell growth.

94

Bacterial Diseases of Rice and Their Management

FIGURE 5.1 Disease cycle of bacterial blight in rice caused by Xoo-bacteria.

Sources: Reprinted from Kumar et al. (2020). https://creativecommons.org/licenses/by/4.0/

5.3.3 NEEDLE-PRICKING METHOD Countless bits, up to 100, are placed on a rubber stopper or other secondary materials. For inoculation of plants, needles soaked in bacterial suspension are gently pierced into the leaf’s vein. This approach is not feasible on largescale field inoculation. 5.3.4 DIPPING METHOD Rice seedling roots are dipped into the bacterial suspension culture for the inoculation. After inoculation seedlings were transplanted into the field. This method is used to check for seedling wilt or BB’s kresek process. 5.4 CHEMICAL PREVENTIVES Preventive methods for bacterial leaf blight (BLB) are minimized using seeds treatment techniques, seeds are treated with bleaching powder (100 g/l) and

Challenges and Opportunities of Recent Tools

95

zinc sulfate (2%). Crop treatment – 8 hours of seed soaking with Agrimycin (0.025 percent) and wettable ceresan (0.05 percent) followed by 30 minutes of hot water treatment at 52–54°C; 8 hours of seed soaking with ceresan (0.1 percent) and Streptocycline treatment (3 g in 1 liter). Neem oil 3 percent or NSKE 5 percent spray, Spray the fresh extract of cow dung for BB preven­ tion. In one liter of water, dissolve 20 g of cow dung; allow to settle and sieve. Using liquid supernatant (beginning with the first occurrence of the disease and continuing every two weeks). Using chemical spray of strepto­ mycin sulfate spray + combination of Tetracycline 300 g + 1.25 kg/ha copper oxychloride. If required, repeat it after 15 days. Spray of bleaching powder at a rate of 5 kg/ha in irrigation water is recommended. Foliar spray with copper fungicides or Strepto-cyclin (250 ppm) can prevent the secondary spread. 5.5 MOLECULAR BASIS BACTERIAL BLIGHT (BB) In rice, a total of 45 BLB resistance genes (R genes) were identified., including Xa1, Xa2, Xa3/Xa26, Xa4, xa5, Xa6, Xa7, xa8, xa9, Xa10, Xa11, Xa12, xa13, Xa14, xa15, Xa16, Xa17, Xa18, xa19, xa20, Xa21, Xa22(t), Xa23, xa24(t), xa25/Xa25(t), Xa25, xa26(t), Xa27, xa28(t), Xa29(t), Xa30 (t), xa31(t), Xa32(t), Xa33(t), xa34(t), Xa35(t), Xa36(t), Xa37, Xa38, Xa39, Xa40, xa41(t), Xa42, Xa43(t), Xa44(t) and Xa 45(t) and the rest is dominant (Chen et al., 2011); A total of nine genes have been cloned, of which six are dominant (Xa1, Xa3/Xa26, Xa10, Xa21, Xa23 and Xa27) and three are recessive (xa5, xa13 and xa25) Table 5.1 shows RM26985 and DM13 genes of BB and their markers are which is used in breeding program. In the Japan rice breeding program, for Xoo race 1 resistant variety, it was confirmed Y5212 clone having Xa1 locus with three linked markers XNpb235, XNpb264, and C600 RFLP-markers which is located on chromosome 4. Another BLB R-gene discovered in the Tetep rice cultivar is Xa2 (Vikal and Bhatia, 2017). The Xa2 gene was discovered to be located between two SSR-markers (HZR950-5 and HZR970-4) that span almost 190 kb. For BLB disease resistance, the Xa21 gene is commonly used in rice breeding programs. Leucine-rich repeat (LRR) kinase was discovered by the sequence analysis of Xa21. The Xa21 is derived from O. longistaminata, which was discovered at IRRI in the Philippines by Khush et al. in 1990. The Receptor Kinase (RLK) Class, which was cloned in the broad-spectrum resistance of Xa21, is the first major class of resistance gene in rice crops (Hulbert et al., 2001). It confirmed broad-spectrum resistance to all recognized Xoo races in India and six races in the Philippines (Sridhar et al., 2001). IR20 and IRBB60 varieties were

Bacterial Diseases of Rice and Their Management

96

TABLE 5.1 Major Genes and Their Markers of Bacterial Blight Which is Used in Varietal Improvement SL. No. Gene

Marker

References

1.

xa13

Xa13 Prom

Hajira et al. (2016)

2.

Xa21

pTA248

Ronald et al. (1992)

3.

Xa33

RMWR7.1 and RMWR7.6

Kumar et al. (2012)

4.

Xa38

Os04g53050-1

Bhasin et al. (2012)

5.

XA39

RM26985 and DM13

Zhang et al. (2014)

6.

Xa36(t)

RM114

Miao et al. (2010)

7.

Xa40(t)

RM27320 and ID55

Kim et al. (2015)

8.

Xa43(t)

IBb27os11_14 and S_BB11.ssr_9 Kim et al. (2019)

9.

Xa46(t)

RM26981 and RM26984

Chen et al. (2020)

10.

xa-45(t)

LOC_ Os08g42410

Neelam et al. (2020)

11.

Xa-42(t)

KGC3_16.1 and RM15189.

Busungu et al. (2018)

12.

xa5

RM603 and RM607

Iyer and McCouch (2004)

13.

Xa7

M5

Porter et al. (2003)

14.

Xa4

MP

Chen et al. (1997); Ma et al. (1999); Mc Couch et al. (2002)

15.

Xa2

HZR950-5 and HZR970-4

He et al. (2006)

16.

Xa3

BB3-RF and BB3-RR, BB3-SF and BB3-SR

Hur et al. (2013)

17.

Xa1

Xa1 specific primer

Yoshimura et al. (1998)

18.

Xa10

M491 and M419, S723 and M604 Gu et al. (2008)

19.

Xa11

RM347 and RM1350

Goto et al. (2009)

20.

Xa14

–

Bao et al. (2010)

21.

Xa15

–

Ogawa (1996)

established by introgression of Xa4 and confirming resistance to BLB IRRI. Xa4 was derived from TKM6, an Indian cultivar (Saha et al., 2015). Xa3/ Xa26 confers resistance to BLB at both seedling and flowering stage. Xa39 is a novel gene that was discovered by crossing Huang-Hua-Zhan (HHZ) and PSBRC66 (P66). The Xa39 gene is located within a 97.4-kb interval flanked by the RM26985 and DM13 markers, according to the mapping. Another resistance gene, Xa40(t), was discovered in the F2 generation of the ‘11325/ Anmi ’11,325/Ilpum’ cross (Kim et al., 2015). The RM27320 and ID55 markers were found to be co-segregating with the gene. The Xa40(t) gene was identified by the markers RM27320 and ID55. WA18-5 on the physical map of japonica rice ‘Nipponbare.’ It also revealed that the gene is found on

Challenges and Opportunities of Recent Tools

97

the BAC clone ‘OSJNBa0036K13,’ a nearly 80-kb area on rice chromosome 11. The Xa45(t) gene, which was recently identified as a BB resistance gene from Oryza glaberrima accession IRGC 102600B and transferred to O. sativa, was sequenced, and mapped on the long arm of chromosome 8 using the ddRAD (double digest restriction-site associated DNA) process. On the IRGSP-1.0 Nipponbare reference genome, the QTL area detected is 80 kb long and contains 9 candidate genes. Co-segregation was discovered to be an STS marker derived from the locus LOC Os08g42410, which co-segregates with the trait and is a useful marker in breeding programs for marker-assisted transfer of the recessive resistance gene. 5.5.1 SNP GENOTYPING Rice genomics research has now built a stable basis for the progress of a highthroughput genotyping method. This is important for gene identification and molecular breeding, and as related technologies have progressed, various SNP assay platforms have been developed for genotyping. SNP genotyping are very useful, advanced, and accurate techniques for genotyping, SNPs detection by PCR or Sanger sequencing is a very low throughput technique, while array-based SNPs detection-based techniques are high throughput and advanced. On Illumina’s rice network, several medium-density arrays have been developed and are being used in various genetic analysis and breeding projects (Nagasaki et al., 2010; Yamamoto et al., 2010; Zhao et al., 2010; Boualaphanh et al., 2011; Chen et al., 2011; Thomson et al., 2011; Yu et al., 2013). More recently, the introduction of high-density molecular marker platforms in combination with carefully curated diversity panels has allowed genome-wide association study (GWAS) and allele mining to be used to investigate agronomic traits (Zhu et al., 2008; Tung et al., 2010). Single nucleotide polymorphisms (SNPs) linked to differential resistance were identified through GWAS in the 198 indica accessions. These novel SNPs linked to identified BB resistance Xa genes leads to the development of high utility markers for monitoring and selection of resistance genes in breeding programs (Dilla-Ermita et al., 2017). 5.5.2 GENOME-WIDE ASSOCIATION STUDY Total 12 quantitative trait loci (QTLs) are identified on chromosomes 1, 2, 3, 4, 5, 8, 9, and 11, having resistance to against five Thai Xoo isolates.

98

Bacterial Diseases of Rice and Their Management

Of these, five QTLs showed resistance to more than one Xoo isolates. Two QTLs, qBLS5.1 and qBLS2.3 showed broad-spectrum resistance against BLS. Identified QTL qBLS5.1 region having Xa5 gene and three genes, encoding pectin esterase inhibitor (OsPEI), eukaryotic zinc-binding protein (OsRAR1), and NDP epimerase function, proposed as candidate genes for qBLS2.3 (Sattayachiti et al., 2020). Two major loci qBLB11.1 and qBLB5.1 identified for BLB resistance (Descalsota et al., 2018). In China, a GWAS study is conducted on different 3,000 rice panel on different strains for BLB, for strain C4, locus, qC4–11 having four significant SNPs are identified on chromosome 11. For strain C5, five QTL was found to be associated with BB resistance, located on chromosomes 4, 5, 11. Two QTL in chromosome No. 11, namely qC5–11.1 and qC5–11.2. For strain V, two QTLs was reported on chromosome 5, The qV-5.1 region harbored 272 significant SNPs and QTL, qV-5.2 having 98 significant SNPs. In case of strain P9a, total 1,173 significant SNPs are identified which associated with BB resistance on chromosome 12. Three QTLs qP9a-12.1, qP9a-12.2 and qP9a-12.3 are reported. Among them, qP9a-12.2 was located close to the reported race-specific resistance gene xa25 (Lu et al., 2021). A GWAS of BB resistance using a diverse panel of 285 rice accessions, SNPs associated with differential resistance in a subset of 198 indica accessions. Robust links were found for novel SNPs linked with known BB resistance Xa genes. A significant association of SNPs in chromosomes 6, 9, 11, and 12 was found and their haplotypes correlated with resistance lines and analysis of putative resistance alleles identified as resistant genotypes having new resistance gene (Dilla-Ermita et al., 2017). 5.5.3 GENOMIC SELECTION (GS) Genomic selection (GS) is used to design novel breeding programs by using molecular genetic marker and used for the development of marker-based models for genetic evaluation. In addition to these, GS also opens the door to increase the genetic gain of complex traits per unit time and cost. Based on the phenotypic and genotypic data of training population (TP), GS develops the prediction tool which can be used to derive genomic estimated breeding values (GEBVs) of all the individuals of breeding population (BP) from their genomic profile (Meuwissen et al., 2001). This method can be used in future breeding program.

Challenges and Opportunities of Recent Tools

99

5.5.4 MARKER-ASSISTED SELECTION (MAS) Molecular marker-assisted selection (MAS) is a highly efficient breeding tool which used for the precise selection of the desired genes (Tanksley et al., 1989). Introgression of target genes also involves chromosomal segments, resulting in unwanted traits known as linkage drag and favorable genes occasionally exhibited incomplete function due to variations in genetic backgrounds, making successful and accurate trait selection difficult. As a consequence, foreground selection is crucial for goal-oriented breeding. The usefulness of MAS in pyramiding many resistance genes to create a variety of broad-spectrum, long-lasting resistance has been demonstrated against a variety of pathotypes (Pradhan et al., 2015). For BB resistance many genes are transferred from resistant varieties to the susceptible variety through marker-assisted backcross breeding programs worldwide. Three BB resistance genes xa5, xa13 and Xa21 was transferred using MAS into indica rice cultivar PR106 (Singh et al., 2001). Five BB resistance genes Xa4, xa5, Xa7, xa13 and Xa21 using a donor parent, IRBB66 and transferred into TNG82 via marker-assisted backcrossing breeding (Hsu et al., 2020). Using MABB strategy introgression two major BB gene Xa21 and xa13 and two major blast resistance genes Pi54 and Pi1 into Tellahamsa (Jamaloddin et al., 2020). BB resistance genes Xa21, Xa13, and Xa5 were transferred via MAS from the BB-resistant donor variety IRBB-60 to the BB-susceptible Basmati variety CSR-30. A novel BB-resistant gene, Xa38 was introgressed in Improved Sambha Mahsuri through MABB to increase the spectrum and durability of BB resistance. The breeding line PR 114 (Xa38) was used as the donor for Xa38, whereas Improved Sambha Mahsuri was used as the recurrent parent (Yugander et al., 2018). The two BB resistance genes Xa13 and Xa21 present in IRBB55 were combined with the Basmati quality traits of Pusa Basmati-1 (PB-1) used as recurrent parent (Joseph et al., 2004). 5.5.5 USE OF TRANSGENICS To control the BB disease, the development of resistant varieties is a potential strategy. However, many conventional breeding methods are used for the development of resistant varieties, but they are time taking, and the problem of linkage drag occurs. On the other hand, genetic transformation is less time-consuming and ignores the problem of linkage drag. Xoo secretes

100

Bacterial Diseases of Rice and Their Management

one or more of six transcription-activator-like effectors (TALes) that bind unique promoter sequences and induce at least one of the three host sucrose transporter genes to introduce mutations in all three SWEET gene promoters. Sequence analyzes of TALe genes in 63 Xoo strains showed numerous TALe variants for SWEET13 alleles, which aided editing. SWEET14, which is also attacked by two TALes from an African Xoo lineage, has also been mutated. SWEET11, SWEET13, and SWEET14, whose expression is necessary for disease susceptibility. The rice line Kitaake, as well as the elite super vari­ eties IR64 and Ciherang-Sub1, were all given five promoter mutations at the same time. Paddy trials revealed that rice lines with genome-edited SWEET promoters have solid, broad-spectrum resistance (Olive et al., 2019; Yu et al., 2021). Gene silencing also makes it possible to make better use of these genes. Artificial microRNA (amiRNA) technology was created to silence the dominant allele of xa13, allowing the recessive allele to be unmasked and the resistant phenotype to be expressed, simulating a homozygous state. Gene silencing helps in the achievement of higher resistance without affecting other traits such as fertility (Li et al., 2012). In the presence of TALE released by the pathogen, several R genes are activated by binding to a particular effector binding element (EBE) and activating the resistance response. Upregulation of transcription activator-like 1 (UPT) effector box in the rice Xa13 gene promoter region is essential for Xoo pathogenicity. Rice resistance to bacteria can be improved by changing a main bacterial protein-binding site in the UPT box of Xa13 to prevent PXO99-induced Xa13 expression. Agrobacterium­ mediated transformation method was used to incorporate the antimicrobial peptide genes Np3 and Np5 from Chinese shrimp (Fenneropenaeus Chinensis) into Oryza sativa L. subsp. japonica cv. Aichi ashahi. Xanthomonas oryza pv. was inoculated into four Np3 and Np5 transgenic lines in the T1 genera­ tion. oryzae strain CR4, and all four transgenic lines were substantially more resistant to the strain’s BB. JS97-2, Zhe 173, and OS-225 strains induced BB, and the Np5 transgenic lines displayed higher resistance. Transgenic lines containing the Np5 gene have been suggested to have broad-spectrum resistance to rice BB (Wang et al., 2011). 5.6 CONCLUSION Recent researches have contributed to a better understanding of resistance mechanisms and pathways linked with susceptibility in rice against Xoo infection. Using numerous sets of well-chosen R-genes as gene-pyramids

Challenges and Opportunities of Recent Tools

101

to generate superior rice cultivars with long-lasting and broad-spectrum BB resistance shows promise, and MAS has become a viable method for developing persistent BB disease resistance in rice due to the mapping and characterization of several R-genes. Furthermore, genomics-based gene identification methodologies, as well as transgenic validation by genetic transformation, are progressively assisting us in understanding the functional characteristics of candidate genes. In our opinion, there is a need to use the best available information and resources not only in rice but also in other related crops to attain long-lasting resistance against BB disease. KEYWORDS • • • • • •

genome-wide association study genomic selection Huang-Hua-Zhan leucine-rich repeat quantitative trait loci single nucleotide polymorphisms

REFERENCES Baliyan, N., Malik, R., Rani, R., Mehta, K., Vashisth, U., Dhillon, S., & Boora, K. S., (2018). Integrating marker-assisted background analysis with foreground selection for pyramiding bacterial blight resistance genes into basmati rice. Comptes Rendus Biologies, 341, 1–8. Bao, S. Y., Tan, M. P., & Lin, X. H., (2010). Genetic mapping of a bacterial blight resistance gene Xa14 in rice. Acta Agron. Sin. 36, 422–427. Bhasin, H., Bhatia, D., Raghuvanshi, S., Lore, J. S., Sahi, G. K., Kaur, B., Vikal, Y., & Singh, K., (2012). New PCR-based sequence-tagged site marker for bacterial blight resistance gene Xa38 of rice. Mol. Breed, 30, 607–611. 10.1007/s11032-011-9646-y. Boualaphanh, C., Daygon, V. D., Calingacion, M. N., Sanitchon, J., Jothityangkoon, D., Mumm, R., Hall, R. D., & Fitzgerald, M. A., (2011). Use of new generation single nucleotide polymorphism genotyping for rapid development of near-isogenic lines in rice. Crop Sci., 51, 2067. Busungu, C., Taura, S., Sakagami, J. I., Anai, T., & Ichitani, K., (2018). High-resolution mapping and characterization of xa42, a resistance gene against multiple Xanthomonas oryzae pv. oryzae races in rice (Oryza sativa L.). Breeding Science, 68(2), 188–199. https:// doi.org/10.1270/jsbbs.17094.

102

Bacterial Diseases of Rice and Their Management

Chen, H., He, H., Zou, Y., Chen, W., Yu, R., Liu, X., Yang, Y., et al., (2011). Development and application of a set of breeder-friendly SNP markers for genetic analyses and molecular breeding of rice (Oryza sativa L.). Theor. Appl. Genet., 123, 869–879. Chen, N. X., Temnykh, S., Xu, Y., Cho, Y. G., & McCouch, S. R., (1997). Development of a microsatellite framework map providing genome-wide coverage in rice (Oryza sativa L.). Theoretical and Applied Genetics, 95(4), 553–567. Chen, S., Wang, C., Yang, J., Chen, B., Wang, W., Su, J., Feng, A., et al., (2020). Identification of the novel bacterial blight resistance gene Xa46(t) by mapping and expression analysis of the rice mutant H120. Sci. Rep., 10, 12642. Descalsota, G. I. L., Swamy, B. P., Mallikarjuna, Z. H., Inabangan-Asilo, M. A., Amparado, A., Mauleon, R., Chadha, M. P., et al., (2018). Genome-wide association mapping in a rice MAGIC plus population detects QTLs and genes useful for biofortification. Frontiers in Plant Science, 9, 1347. Dilla-Ermita, C. J., Tandayu, E., Juanillas, V. M., Detras, J., Lozada, D. N., Dwiyanti, M. S., Cruz, C. V., et al., (2017). Genome-wide association analysis tracks bacterial leaf blight resistance loci in rice diverse germplasm. Rice, 10(1), 1–8. https://doi.org/10.1186/s12284-017-0147-4. Goto, T., Matsumoto, T., Furuya, N., tsuchiya, K., & Yoshimura, A., (2009). Mapping of bacterial blight resistance gene Xa11 on rice chromosome 3. JARQ, 43(3), 221–225. Gu, K., Sangha, J. S., Li, Y., & Yin, Z., (2008). High-resolution genetic mapping of bacterial blight resistance gene Xa10. Theor Appl. Genet., 116(2), 155–163. doi: 10.1007/s00122­ 007-0655-5. Epub 2007 Oct 9. PMID: 17924090. Hajira, S. K., Sundaram, R. M., Laha, G. S., Yugander, A., Balachandran, S. M., Viraktamath, B. C., Sujatha, K., et al., (2016). A single-tube, functional marker-based multiplex PCR assay for simultaneous detection of major bacterial blight resistance genes Xa21, xa13 and xa5 in rice. Rice Science, 23(3), 144–151. He, Q., Li, D., Zhu, Y., Tan, M., Zhang, D., & Lin, X., (2006). Fine mapping of Xa2, a bacterial blight resistance gene in rice. Mol. Breeding, 17, 1–6. https://doi.org/10.1007/ s11032-005-8698-2. Hsu, Y. C., Chiu, C. H., Yap, R., Tseng, Y. C., & Wu, Y. P., (2020). Pyramiding bacterial blight resistance genes in tainung82 for broad-spectrum resistance using marker-assisted selection. Int. J. Mol. Sci., 21, 1281. https://doi.org/10.3390/ijms21041281. Hulbert, S. H., Webb, C. A., Smith, S. M., & Sun, Q., (2001). Resistance genes complexes: Evolution and utilization. Annu. Rev. Phytopathol., 39, 258–312. Hur, Y. J., Jeung, J. U., Kim, S. Y., Park, H. S., Cho, J. H., Lee, J. Y., Sohn, Y. B., et al., (2013). Functional markers for bacterial blight resistance gene Xa3 in rice. Mol. Breed., 31, 981–985. Iyer, A. S., & Mccouch, S. R., (2004). The rice bacterial blight resistance gene xa5 encodes a novel form of disease resistance. Mol. Plant-Microbe. Interact., 17, 1348–1354. https://doi. org/10.1094/MPMI.2004.17.12.1348. Jamaloddin, M., Durga, R. C. V., Swathi, G., Anuradha, C., Vanisri, S., Rajan, C., Krishnam, R. S., et al., (2020). Marker assisted gene pyramiding (MAGP) for bacterial blight and blast resistance into mega rice variety “Tellahamsa.” PloS One, 15(6), e0234088. https://doi. org/10.1371/journal.pone.0234088. Jona, I. R. P., Sureshkumar, C., & Venkatakrishnan, S., (2021). An implementation of SVM classifier for bacterial blight identification. European Journal of Molecular & Clinical Medicine, 7(11), 5586–5595. Joseph, M., Gopalakrishnan, S., Sharma, R. K., Singh, V. P., Singh, A. K., Singh, N. K., & Mohapatra, T., (2004). Combining bacterial blight resistance and basmati quality

Challenges and Opportunities of Recent Tools

103

characteristics by phenotypic and molecular marker-assisted selection in rice. Molecular Breeding, 13, 377–387. https://doi.org/10.1023/B:MOLB.0000034093.63593.4c. Kauffman, H. E., Reddy, A. P. K., Hsieh, S. P. Y., & Merca, S. D., (1973). An improved technique for evaluating resistance of rice varieties to Xanthomonas oryzae. Plant Dis. Rep., 56, 537–541. Khush, G. S., Bacalangco, E., & Sidhu, G. S., (1990). A new gene for resistance to bacterial blight from O. longistaminata. Rice Genet. Newsl., 7, 121, 122. Kim, S. M., & Reinke, R. F., (2019). A novel resistance gene for bacterial blight in rice, Xa43(t) identified by GWAS, confirmed by QTL mapping using a bi-parental population. PloS One, 14(2), e0211775. https://doi.org/10.1371/journal.pone.0211775. Kim, S. M., Suh, J. P., Qin, Y., Noh, T. H., Reinke, R. F., & Jena, K. K., (2015). Identification and fine-mapping of a new resistance gene, Xa40, conferring resistance to bacterial blight races in rice (Oryza sativa L.). Theor. Appl. Genet., 128(10), 1933–1943. doi: 10.1007/s00122-015-2557-2. Kumar, A., Kumar, R., Sengupta, D., Das, S. N., Pandey, M. K., Bohra, A., Sharma, N. K., et al., (2020). Deployment of genetic and genomic tools toward gaining a better understanding of rice-Xanthomonas oryzae pv. oryzae interactions for development of durable bacterial blight resistant rice. Frontiers in Plant Science, 11, 1152. doi=10.3389/fpls.2020.01152. Kumar, P. N., Sujatha, K., Laha, G., Rao, K. S., Mishra, B., Viraktamath, B. C., Hari, Y., et al., (2012). Identification and fine-mapping of Xa33, a novel gene for resistance to Xanthomonas oryzae pv. Oryzae. genetics and resistance. Phytopathology. 102(2), 223. Li, C., Wei, J., Lin, Y., & Chen, H., (2012). Gene silencing using the recessive rice bacterial resistance gene xa13 as a new paradigm in plant breeding. Plant Cell Reports, 21, 851–862. Li, T., Liu, B., Spalding, M. H., Weeks, D. P., & Yang, B., (2012). High-efficiency TALENbased gene editing produces disease-resistant rice. Nat. Biotechnol., 30, 390–392. doi: 10.1038/nbt.2199. Lu, J., Wang, C., Zeng, D., Li, J., Shi, X., Shi, Y., & Zhou, Y., (2021). Genome-wide association study dissects resistance loci against bacterial blight in a diverse rice panel from the 3000 rice genomes project. Rice, 14, 22. https://doi.org/10.1186/s12284-021-00462-3. Ma, B., Wang, W., Zhao, B., Zhou, Y., Zhu, L., & Zhai, W., (1999). Studies of PCR marker for the rice bacterial blight resistance gene Xa-4. Hereditas, 21(3), 9–12. McCouch, S. R., Teytelman, L., Xu, Y., Lobos, K. B., Clare, K., Walton, M., & Zhang, Q., (2002). Development and mapping of 2240 new SSR markers for rice (Oryza sativa L.). DNA Research, 9(6), 199–207. Meuwissen, T. H. E., Hayes, B. J., & Goddard, M. E., (2001). Prediction of total genetic value using genome-wide dense marker maps. Genetics, 157, 1819–1829. Miao, L., Wang, C., Zheng, C., Che, J., Gao, Y., Wen, Y., et al., (2010). Molecular mapping of a new gene for resistance to rice bacterial blight. Sci. Agric. Sin., 43, 3051–3058. Nagasaki, H., Ebana, K., Shibaya, T., Yonemaru, J., & Yano, M., (2010). Core singlenucleotide polymorphisms—a tool for genetic analysis of the Japanese rice population. Breed Sci., 60, 648–655. Neelam, K., Mahajan, R., Gupta, V., Bhatia, D., Gill, B. K., Komal, R., Lore, J. S., et al., (2020). High-resolution genetic mapping of a novel bacterial blight resistance gene xa-45(t) identified from Oryza glaberrima and transferred to Oryza sativa. Theor. Appl. Genet., 133, 689–705. doi: 10.1007/s00122-019-03501-2. Nino-Liu, D. O., Ronald, P. C., & Bogdanove, A. J., (2006). Xanthomonas oryzae pathovars: Model pathogens of a model crop. Mol. Plant Pathol., 7(5), 303–324. doi: 10.1111/j.1364­ 3703.2006.00344. x. PMID: 20507449.

104

Bacterial Diseases of Rice and Their Management

Ogawa, T., (1996). Monitoring race distribution and identification of genes for resistance to bacterial leaf blight. In: Rice Genetics III, Proceedings of the Third International Rice Genetics Symposium (pp. 456–459). Oliva, R., Ji, C., Atienza-Grande, G., Huguet-Tapia, J. C., Perez-Quintero, A., Li, T., Eom, J. S., Li, C., et al., (2019). Broad-spectrum resistance to bacterial blight in rice using genome editing. Nat. Biotechnol., 37(11), 1344–1350. doi: 10.1038/s41587-019-0267-z. Ou, S. H., (1985). Rice Diseases. IRRI. Porter, B. W., Chittoor, J. M., Yano, M., Sasaki, T., & White, F. F., (2003). Development and mapping linked to the rice bacterial blight resistance gene Xa7. Crop Sci., 43, 1484–1492. Pradhan, S. K., Nayak, D. K., Mohanty, S., Behera, L., Barik, S. R., Pandit, E., Lenka, S., & Anandan, A., (2015). Pyramiding of three bacterial blight resistance genes for broadspectrum resistance in deep water rice variety, Jalmagna. Rice, 8, 51. Ronald, P. C., Albano, B., Tabien, R., Abenes, L., Wu, K., McCouch, S., & Tanksley, S. D., (1992). Genetic and physical analysis of the rice bacterial blight disease resistance locus, Xa21. Molec. Gen. Genet., 236, 113–120. https://doi.org/10.1007/BF00279649. Saha, S., Garg, R., Biswas, A., & Rai, A. B., (2015). Bacterial diseases of rice: An overview. J. Pure Appl. Microbiol., 9(1), 725–736. Sattayachiti, W., Wanchana, S., Arikit, S., Nubankoh, P., Patarapuwadol, S., Vanavichit, A., Darwell, C. T., & Toojinda, T., (2020). Genome-wide association analysis identifies resistance loci for bacterial leaf streak resistance in rice (Oryza sativa L.). Plants, 9, 1673. doi: 10.3390/plants9121673. Singh, S., Sidhu, J., Huang, N., Vikal, Y., Li, Z., Brar, D. S., Dhaliwal, H. S., & Khush, G. S., (2001). Pyramiding three bacterial blight resistance genes (xa5, xa13 and Xa21) using marker-assisted selection into indica rice cultivar PR106. Theor. Appl. Genet., 102, 1011–1015. https://doi.org/10.1007/s001220000495. Sridhar, R., Redd, R. N., Shanti, M. L., & Singh, U. D., (2001). Characterization of rice bacterial blight pathogen isolates from eastern India and breeding for bacterial resistance by molecular tools. In: Nagarajan, S., & Singh, D. P., (eds.), Role of Resistance in Intensive Agriculture (pp. 183–194). Kalyani Publishers, India. Tanksley, S., Young, N., Paterson, N., & Bonierbale, M., (1989). RFLP mapping in plant breeding: New tools for an old science. Nat. Biotechnol., 7, 257–264. Thomson, M. J., Zhao, K., Wright, M., McNally, K. L., Rey, J., Tung, C. W., Reynolds, A., et al., (2012). High-throughput single nucleotide polymorphism genotyping for breeding applications in rice using the BeadXpress platform. Mol. Breed., 29, 875–886. Tung, C. W., Zhao, K., Wright, M. K., Ali, M. L., Jung, J., Kimball, J., Tyagi, W., Thomson, M. J., McNally, K., Leung, H., et al., (2010). Development of a research platform for dissecting phenotype-genotype. Rice, 4, 205–217. Tung, C., Zhao, K., Wright, M. H., Ali, M. L., Jung, J., Kimball, J., Scheffler, B., et al., (2010). Development of a research platform for dissecting phenotype-genotype associations in rice (Oryza spp.). Rice, 3, 205–217. Vikal, Y., & Bhatia, D., (2017). Genetics and genomics of bacterial blight resistance in rice. In: Advances in International Rice Research (pp. 175–213). Chap 10. Intech, London. Wang, T., Chen, L., Zhao, M., Tian, Q., & Zhang, W. H., (2011). Identification of droughtresponsive microRNAs in Medicago truncatula by genome-wide high throughput sequencing. BMC Genomics, 12, 3.

Challenges and Opportunities of Recent Tools

105

Wei, W., Chao, W. U., Mei, L., Xu-Ri, L., Guo-Cheng, H. U., Hua-Min, S. I., Zong-Xiu, S., et al., (2011). Resistance of antimicrobial peptide gene transgenic rice to bacterial blight. Rice Science, 18(1), 10–16. Yamamoto, T., Nagasaki, H., Yonemaru, J., Ebana, K., Nakajima, M., Shibaya, T., & Yano, M., (2010). Fine definition of the pedigree haplotypes of closely related rice cultivars by means of genome-wide discovery of single-nucleotide polymorphisms. BMC Genomics, 11, 267. Yoshimura, S., Kurata, N., Sasaki, T., & Yoshimura, A., (1994). Genetic analysis of bacterial blight resistance genes in rice by using molecular markers. Recent Adv. Breed, 36, 33–36. Yoshimura, S., Yamanouchi, U., Katayose, Y., Toki, S., Wang, Z. X., Kono, I., Kurata, N., et al., (1998). Expression of Xa1, a bacterial blight-resistance gene in rice, is induced by bacterial inoculation. Proc. Natl. Acad. Sci. U S A., 95(4), 1663–1668. doi: 10.1073/pnas.95.4.1663. Yoshimura, S., Yamanouchi, U., Katayose, Y., Toki, S., Wang, Z. X., Kono, I., Kurata, N., et al., (1998). Expression of Xa1, a bacterial blight resistance gene in rice, is induced by bacterial inoculation. Proceedings of the National Academy of Sciences of the United States of America, 95, 1663–1668. Yoshimura, S., Yamanouchi, U., Katayose, Y., Toki, S., Wang, Z. X., Kono, I., et al., (1998). Expression of Xa1, a bacterial blight-resistance gene in rice, is induced by bacterial inoculation. Proc. Natl. Acad. Sci., 95, 1663–1668. doi: 10.1073/pnas.95.4.1663. Yu, H., Xie, W., Li, J., Zhou, F., & Zhang, Q., (2013). A whole genome SNP array (RICE6K) for genomic breeding in rice. Plant Biotechnol. J. doi: 10.1111/pbi.12113. Yu, K., Liu, Z., Gui, H., Geng, L., Wei, J., Liang, D., Lv, J., Xu, J., & Chen, X., (2021). Highly efficient generation of bacterial leaf blight-resistant and transgene-free rice using a genome editing and multiplexed selection system. BMC Plant Biology, 21(1), 1–10. Yugander, A., Sundaram, R. M., Singh, K., Ladhalakshmi, D., Subba, R. L. V., Madhav, M. S., Badri, J., et al., (2018). Incorporation of the novel bacterial blight resistance gene Xa38 into the genetic background of elite rice variety improved Samba Mahsuri. PLoS One, 13(5) e0198260. https://doi: 10.1371/journal.pone.0198260. Zhang, F., Zhuoa, D. L., Zhang, F., Huang, L. Y., Wang, W. S., Xu, J. L., Cruz, C. V., et al., (2014). Xa39, a novel dominant gene conferring broad-spectrum resistance to Xanthomonas oryzae pv. oryzae in rice. Plant Pathol., 64, 568–575. doi: 10.1111/ppa.12283. Zhao, K., Wright, M., Kimball, J., Eizenga, G., McClung, A., Kovach, M., Tyagi, W., et al., (2010). Genomic diversity and introgression in O. sativa reveal the impact of domestication and breeding on the rice genome. PLoS One, 5, e10780. Zhu, C., Gore, M., Buckler, E. S., & Yu, J., (2008). Status and prospects of association mapping in plants. The Plant Genome, 1(1), 5–20.

CHAPTER 6

Reviews of Biological and Ecological Studies of Bacterial Panicle Blight Pathogen FARIA FATIMA1 and ARSHYA HASHIM2 Department of Agriculture, IIAST, Integral University,

Kursi Road Lucknow, Uttar Pradesh, India,

E-mail: [email protected] (F. Fatima)

1

Department of Biotechnology, Abeda Inamdar Sr. College of Arts, Science,

and Commerce, Pune, Maharashtra–411001, India

2

ABSTRACT The production of rice globally has been affected by panicle blight triggered by the bacterium Burkholderia glumae (B. glumae). Glumae, whose efficiency to grow at elevated temperatures, ensures that in an age of rising warming it could become a prevalent concern. The main virulence factors of this pathogen are considered to be toxoflavin and lipase, whose development is mainly dependent on the quorum-sensing mechanism TofI/TofR regulated by N-octanoyl homoserine lactone. For maximum virulence, type 3 secretion system (T3SS) and flagellar biogenesis are also necessary. In comparison, strategies for handling this disease are also absent. However, studies to define the pathways of pathogenicity, to gain insight into plant disease tolerance, and to establish methods for disease control has been prompted by the emerging importance of this pathogen. We consolidate existing knowledge on the virulence factors that are still needed to be identified. Here we include an update on the current research status related with biological and ecological study of B. glumae. Bacterial Diseases of Rice and Their Management. Deepti Srivastava, Md. Shamim, Malik Mobeen Ahmad, & K. N. Singh (Eds.) © 2023 Apple Academic Press, Inc. Co-published with CRC Press (Taylor & Francis)

108

Bacterial Diseases of Rice and Their Management

6.1 INTRODUCTION In the Kyushu region of Japan, bacterial blight (BB) had first been reported in 1956 (Mizobuchi et al., 2018) it was shown in Colombia in 1989, it was documented in Panama in 2007 and it appeared in Venezuela in 2011. In 2005, a reduction in yield of 45% was registered in Panama rice crops, where the loss was attributed due to Steneotarsonemus spinki mite. This was managed by reducing its population (Hummel et al., 2009). In 2006, the bacteria were again confirmed to be present again in the Municipality of Montería, Colombia, with losses of more than 50% in perhaps the most affected fields. These experimental tests were conducted during two successional stages of the plant (plantlets and panicles) while the symptoms found were similar to that observed in the evidence during controlled greenhouse inoculation. Burkholderia glumae-induced bacterial panicle blight (BPB) of rice targets field spikelet of rice crop (Shew et al., 2019). It decreases farmers’ rice production and quality and thus produces higher market prices for consumers. After the advent of nursery container transplanting machinery in Japan in the 1960s, this pathogen was however found to be affected by seedling rot disease. Grain rot disease caused major rice plant productivity losses in the 1980s. BPB is accompanied by excess minimum temperatures (~22°C) and relative humidity (RH~77%) occurring concurrently, that would intensify underneath the current global warming scenario (Doddaraju et al., 2019). Total production potential was quantified for BPB-resistant rice from the expected losses using a trade model to further evaluate changes in consumer welfare. Disease occurrences and output losses triggeredrates rises for rice under the 1°C warming scenario, resulting in an annual rise in per capita surplus in the US of $112 million USD as well as a reduced its productivity that will be equivalent to serving 2.15 million people (Zhou et al., 2019). Thus, panicle blight could have converted a more widespread and aggressive disease to fight as global warming worsens, and breeding for PB resistance will be the preferred mode of defense, as no successful chemical alternatives are presently available yet (Velásquez et al., 2018). The outcomes of the analysis enlighten growers, economists, and policymakers regarding the importance of blight tolerance within the global market for rice and helps to support initiatives to concentrate on future options on resilience to climate change impacts. However, the emerging significance of this bacterium has prompted us to do research and to identify the mechanisms of pathogenicity, to gain insight into plant disease resistance, and to develop methods for disease control. We aggregate current information about the

Reviews of Biological and Ecological Studies

109

causes of virulence that still need to be established. A review on the current state of the science related to the biological and ecological analysis of B. glumae is presented chapter. 6.2 BIOLOGICAL STUDIES B. glumae is a strain of bacteria with a gram-negative, polar flagellum, rod-shaped, plain elevation, creamy color, non-fluorescent (Ham et al., 2011; Riera-Ruiz et al., 2014). The optimum temperature growth is 30C, but can be expand at 41°C. This pathogen infects seeds by stomata and injuries and tries to invade plumules, and its seed germination proliferates in the parenchymatous intercellular spaces (Cuiet al., 2016). Via natural openings like hydathodes, abrasions caused by various insects, plant strains triggered by other conditions allow the pathogen to enter more effortlessly. The dissemination of B. glumae within plumules contributes toxic production like toxoflavin that results in seedling rot in rice (Lee et al., 2016) affecting rice grain and plantlet rotting. The fungus is also known to infect tomatoes, peppers, eggplants, sesame crops, Chinese basil and, as well as other rice field-related weeds (Jeong et al., 2003). 6.2.1 STRAIN DIVERSITY OF B. GLUMAE In the rice-production areas, more than 400 strains have been isolated, characterized, and verified as high virulent strains that can reduce yield by 50 to 75%. It was also noted that certain avirulent strains isolated in blighted stalks and sheath projections from infected rice grains do not develop toxoflavin and do not cause any noticeable symptoms or substantial reduction in yield. Based on the study of the of cell wall fatty acids composition, it was first isolated as Burkholderia cepacia. Further, while performing, 16S rRNA sequence analysis and polymerase chain reaction (PCR), it is recognized as Burkholderia gladioli. Finally, this causal agent is defined as B. glumae by studying its whole-cell specific protein nature (Weinberg et al., 2007). 6.2.2 SYMPTOMS On plantlets, sheath of the leaves of the flag, and on panicles, the symptoms appear in the form of straw-coloring, grain discoloration as well as decay

110

Bacterial Diseases of Rice and Their Management

and blanking of the stalks. When environments are optimum, the bacteria multiply rapidly (Pedraza et al., 2018). With the regular rise in affected panicles size, symptoms tend to emerge three days after inoculation. The bacterial pathogen cause damage in the form of sheath rotting seed germina­ tion inhibition, flower sterility, panicle blight, and grain abortion (Nandni et al., 2019). 6.2.3 PATHOGENESIS B. glumae incubate as endophytic bacteria in rice plant before the booting process. In several experiments, a GFP (green fluorescent protein)-labeled B. glumae were studied to explain the colonization using scanning electron microscopy (SEM) technique. New bacterial sites were found where the microbes were initially spread on the edge of the glumes and colonized in the sterile lemma, palea. The initial location for colonization was the base of glume hairs. The bacterial numbers increased around glume hairs, reached the innermost layer of the palea and lemma, and distributed through contact with the gynoecium and stamens (Li et al., 2016). The spreading between the panicles occurred primarily through touch or friction between the glumes or sheaths of the leaves, but the internal distribution of the stamens happened primarily through the anther tissue. The rising stage of B. glumae in spikelets cause signs of wilting. This research showed that in the initial colonization, glume hairs played a significant role (Kim et al., 2010; Jeong et al., 2003). 6.2.4 VIRULENT FACTORS ASSOCIATED WITH PATHOGENICITY The fundamental B. glumae pathogenesis is a dynamic approach involving several virulent variables. Phytotoxins and lipases are the most significant factors between them. Additional virulent variables that are known to lead to the maximum virulence are KatG catalase (CAT), PehA/PehB polygalactu­ ronases, and Hrp Type 3 segment (Table 6.1; Devescov et al., 2007; Knapp et al., 2016). The most significant phytotoxins that are produced are yellow polymers toxoflavin/fervenulin that are usually isomerides in nature (Fenwick et al., 2016). Much of the current research focused on toxoflavin that relies on elevated temperature and reaches a maximum of 37°C. These phytotoxins are important for grain and seedling rot pathogenicity, resulting in decreased growth and development of leaves and roots. The biosynthetic pathway and

Factors Associated with Virulence in B. glumae

SL. No. 1.

Factors Phytotoxins

Types of Biomolecules

Physiological Functions

Additional Activities

Toxoflavin Isomerides

Reduced leaf and root growth in rice seedlings, as well as contributing to chlorotic symptoms of rice panicles

Antifungal activity against Hussain et al. (2020); Lee Fusarium graminearum, et al. (2016); Collectotrichum orbiculare; Li et al. (2019) Aspergillus fumigatu

Fervenulin Isomerides

Induce chlorotic spots on detached rice leaves Cell wall decomposition

Nematicidal activity

Nyaku et al. (2017)

Food reserve tissues of growing seedling

Zhou-Qi et al. (2016); Subramoni et al. (2010); Chandra et al. (2020) Tayi et al. (2016); Liu et al. (2017); Ye et al. (2020) Wolfson et al. (2020)

Lipases

–

Enzyme

3.

Polygalacturonases Flagella

–

Enzyme

–

Microscopic appendage from bacterial cell wall Protein appendage Special virulence mechanism for gram-negative pathogens that helps them to specifically insert bacterial virulence factors into the cytoplasm of the host cell, bypassing the extracellular environment. Cell coordination Glucose absorption, substrate, in which complex and oxidative phosphorylation signals to organize and de-regulation can be pathogenic actions controlled are triggered

4.

5.

Type 3 secretion system

–

6.

Quorum sensing

–

Hydrolyze polygalacturonan present in cell wall Initial establishment phase of infection

Pollen development Adhesion, motility

Cytoskeleton attachment Sharma et al. (2013); De and invasion, interference Souzasantos et al. (2019) with cellular trafficking processes, cytotoxicity, and barrier dysfunction, and immune system subversion Production of toxoflavin

Kato et al. (2014); Chen et al. (2015); Jiang et al. (2019); Azimi et al. (2020)

111

2.

References

Reviews of Biological and Ecological Studies

TABLE 6.1

112

Bacterial Diseases of Rice and Their Management

transportation modes of toxoflavin are relatively well characterized. Tox operators involved in the biosynthesis and transportation of toxoflavin are polycistronic in nature, consisting of five genes (toxA, toxB, toxC, toxD, and toxE, toxF, toxH, and toxI). The regulator LysR-type ToxR controls operon expression of both operators (toxABCDE and toxFGHI). These results thus indicated that starting with the GTP precursor, the synthesis of toxoflavintakes place via a typical biosynthetic pathway (Joo et al., 2015). Furthermore, the expression of both the operons includes the transcriptional activator ToxJ, whose expression is further managed by quorum sensing (QS) (Karki et al., 2012). Synthesized toxoflavin is not only sufficient for blight pathophysiology, but also used in combating several fungal diseases caused by Aspergillus fumigatus (Li et al., 2019). Furthermore, some distinctive pigments developed by B. glumae can also prevent the production of certain fungal pathogens, such as C. orbiculare, or can serve as scavengers of reactive oxygen species (ROS) formed by host cell oxidative burse response. However, a tentative RNA-sequence analysis reported that the serine associated metalloprotease gene prtA is similarly regulate toxoflavin biosyn­ thesis. Null mutants of prtA of the B. glumae virulent strain displayed no apparent protease extracellular activity, suggesting that prtA is the only gene responsible for the protease action observed in this bacterium. Furthermore, while inoculation of rice panicles with prtA mutants resulted in a substantial decrease in the prevalence of the disease relative to the wild-type parent strain, meaning that prtA was needed for maximum virulence in B. glumae (Lelis et al., 2019). Moreover, the ability of lipases to oxidize a wide variety of triacylglycerols and to synthesize acylglycerol esters is found to be significant. It is suspected that a variety of secreted lipases from microbial pathogenic bacteria that are involved in the invasion of plant barriers structures such as waxes and cuticles by bacteria. On the other hand, inner bacterial lipases might play a role in stored lipid degradation and/or signaling via the release of signaling pathways (Senarath et al., 2018). Initial findings suggest that they may potentially be a crucial disease control target. The lipases produced during the past decade shows an enhancing overall detergency. PG1-B. glumae are considered to be effective and have been the focus of most severe studies. LipA, an effective extracellular lipase, is the most effective virulent-relative lipase and LipB, that is implicated in the synthesis of LipA and has a profound effect on the proteins reliability for protein cleavage. In the stabilization of these lipase, Ca2+ ion plays an active role in structural organization. Several

Reviews of Biological and Ecological Studies

113

reports documented that QS in B. glumae AU6208 usually regulates secreted LipA and toxoflavin (Alnoch et al., 2018). However, B. glumae lipA mutants have no longer been found to be rice-pathogenic, indicating that these lipase is a significant virulence factor. Several previous researchers found that toxoflavin and lipase really are not likely to trigger seed rot because the bacterial flagellar motility, secretion system and QS appears to be needed in infection the host tissue effectively (Nickzad et al., 2015; Pena et al., 2019). For pathogens, the motion guided by flagella is relevant. It enables them to enter a prospective host at the sites of infection and gives them a major survival advantage during the primary infection establishment process. In response to several environmental influences such as temperature, QS, pH, osmolarity, and global regulatory proteins, the flagellar role is coordinately regulated (such as HNS and cAMP-CAP complex) (Jang et al., 2014). During virulence of blight, the type 3 secretion system (T3SS) plays a crucial part, but the mechanism and the associated changes are still less specified. Proteomic study showed that B. glumae associated T3SS contains 34 proteins that aggregate in a manner based on HrpB-dependent manner (Gaytan et al., 2016). The most significant environmental factor could be QS in B. glumae because the QS regulation can manage multiple bacterial physiological processes, mainly the systems that are involved in the produc­ tion of secondary metabolites, virulence, and synergy (Hawver et al., 2016). However, toxoflavin metabolism, production of lipase, and the movement of bacteria are all regulated by the QS system (Li et al., 2012). QS has been found to be able to control uptake of glucose, substrate, and oxidative level phosphorylation and denovo biogenesis of nucleotides within B. glumae, that can act to modulate and regulate nutrients use and in maintenance of homeostasis in an individual cell. However, it is the only component that allows pathogenic bacteria to titrate and respond to various signals within an incredibly complex regulatory hierarchy. Endopolygalacturonase and exopolysaccharides (EPS) are known to be viable targets that may play an important role in B. glumae pathogenesis, but the process is still largely unidentified (Degrassi et al., 2008; Seo et al., 2015). Molecular genetics carried out by several researchers have identified the key pathogenic markers in which a global small RNA chaperone protein Hfq, interfaces with regulatory specific bacterial RNAs (sRNAs) and signifies an important function in post-transcriptional control in gene expression. The function of Hfq protein has been documented in the pathogenicity and virulence in multiple infectious bacterial species (Kim et al., 2018). Thus, microbial swarming motility, generation of toxoflavin, production

114

Bacterial Diseases of Rice and Their Management

of siderophores, H2O2 sensitivity, and assays of lipase production were the major virulence factors responsible for pathogenicity in rice. In the complete virulence, both genes were involved. 6.2.5 OMICS STUDY There is a growing inclination in investigating the pathogenic mechanism, signal transduction, and association between the advancement of highthroughput sequencing and bioinformatics analysis. The genome study of a typical strain has been already published that contain has two chromosomes and four plasmid DNA. Their findings indicate that almost all bacterial chemotaxis-related motility-mediated genes, metabolisms of trehalose and ascorbate molecules and sugar transporters (including L-arabinose and D-xylose) that are significantly upregulated in B. glumae in an in vivo state. These Tests of Omics will promote the explanation of the overall infection process and unidentified associations between plant-pathogenic bacteria. It comprises distinct classes of genes, transcriptional regulators, and membrane sensing components for expressing the secretion systems of type VI. The gene locus paradigm linked to rice resistance has also been enriched by many researchers (Magbanua et al., 2014). 6.2.6 EPIDEMIOLOGY B. glumae favors hot summer nights and conditions of high humidity that are often present during the rice growing period. During the heading level in rice, BPB occurs when it has high temperature during nights followed by heavy rains, which are the major environmental conditions that predispose rice during the epidemic outbreak (Syahri et al., 2019). The extreme epidemics will blowout and increase speedily under suitable environmental factors. B. glumae results in the infertility of spikelet, blemishes in emerging grains, decrease in harvest index, sterility of florets, suppression of germination percentage and depletion of rice seedling stands. The vascular bundles of infected stems and roots turn brown as they emerge from bacterial wilt and bacterial ooze runs in cross sections. The occurrence is solely dependent on weather conditions. To successfully control the disease, the reproduction mechanism in B. glumae and environmental factors such as temperature and drought are need to be researched.

Reviews of Biological and Ecological Studies

115

6.2.7 INTEGRATE DISEASE MANAGEMENT Multiple rice-growing countries, particularly the subtropical and tropical regions, are now making a significant contribution to restricting the introduc­ tion of seed-borne pathogens due to the gradually rising BPB disease during foreign trade into their agroecosystems. Therefore, the most critical need for successful and secure therapeutic approaches against B. glumae would be strengthened by phytosanitary control in these countries. Blight is seedborne disease and the main source of inoculum is contaminated seeds. The use of approved seeds devoid of pathogens is also a successful approach for disease removal. This method can be aided by various molecular-detection techniques, including PCR, which have been evolved to evaluate rice seed lots. 6.2.7.1 CULTURAL METHODS Several studies have been carried out to develop and learn cultural practices that decrease the frequency and severity of blight disease. Low fertility concentration of nitrates generally increases rice plants vulnerability to BPB disease (Zhou et al., 2019). Likewise, monoculture, seed movement from one field to another, bad methods of agrochemical management, and inop­ portune planting periods should be avoided. It is necessary to prevent the degradation and deterioration of our natural resources from a biodiversity point of view. Due to the extravagant of essential natural resources, including water, land, and nutrients, a rice field that loses 80% of its crop to Burkholderia remains unsustainable. Sustainability, thus, is specifically correlated with reducing those losses. The greatest contribution to achieving a balanced environment is a healthy crop that is well handled by good practices. 6.2.7.2 CHEMICAL METHODS The National Federation of Rice Farmers (FEDEARROZ) proposed in 2007 that Oxolinic Acid be introduced into Colombia as a tool for disease control (Lee et al., 2015). The application of a quinolone-derived bactericide has proven to be the best alternative for bacterial containment, according to some studies published in 2010. Oxolinic acid can also be used in seed

116

Bacterial Diseases of Rice and Their Management

treatment (ST) or foliar applications and is in turn, the only chemical that can control BPBB. In certain countries, though, it is not commercially viable. Furthermore, the presence of B. glumae species that are resistant to oxolinic acid, will inhibit the usage of this drug (Hikichi et al., 2001). B. glumae has also found to have multi-drug resistance to antibiotics (ampicillin and kanamycin) and has been shown to have antimicrobial property against both copper compounds and Cu2+ like Kocide® 2000, Badge® X2, Previsto®, Badge® SC, and Top Cop® (Cui et al., 2014). It can be spread either by seed spray or exposure, or it can be used at the time of panicle development. During soil treatment, the application of chemical substance methasulfocarb (S-(4-methylsulfonyloxyphenyl) N-methyl) thiocarbamate has also been reported to be successful when used in small quantities. In Japan, certain bacte­ ricides, such as pyroquilon, probenazole, and kasugamycin (KSM) have been used in addition to copper-based bactericides and oxolinic acid for the treat­ ment of rice seedling rot and grain rot. Diphenyleneiodonium chloride (DPIC), a superoxide-producing NADPH oxidase enzyme inhibitor, on bacterial and fungal pathogenic microorganisms suppress bacterial spore germination and their multiplication (Jung et al., 2019). When introduced during the initial flower initiation of the rice heads, treating with DPIC decreased BPB. 6.2.7.3 BIOLOGICAL METHOD An experimental study was conducted where potential inoculation in rice crops with Streptomyces having antagonistic as well as plant-growth-promoting abilities was assessed. Their ability to generate siderophores, extracellular enzymes, indoleacetic acid (IAA) and in phosphate solubilization was demonstrated under in vitro experiments (Betancur et al., 2019). Greenhouse observations were also done with two separate rice cultivars showed that Streptomyces is capable of colonizing in rice plants in both cultivars and encour­ aging their growth. Additionally, an eGFP tagged mutant was produced and experiments were carried out, suggesting that Streptomyces-GFP was closely correlated with root hairs, which may have been aligned with the enhancement of plant growth. Mass spectrometry (MS) tests were conducted to classify the antimicrobial compounds developed by Streptomyces strains that showed few antimicrobial agents with sizes below 3 kDa (kilodalton) were produced and these molecules were known as Streptotricins D, Streptotricins E and Streptotricins F (Kibret et al., 2018). In possible to correlate the metabolites, nuclear magnetic resonance (NMR)-metabolic profiling and multivariate data analysis (MVDA) were performed. Production of Streptomyces sp. Secondary

Reviews of Biological and Ecological Studies

117

metabolite 3-methyl-N-(2′-phenylethyl)-butanamide and 2-methyl-N-(2′phenylethyl)-butanamide have been identified as an active compound against the rice pathogenic bacteria B. glumae with a minimum inhibitory concentra­ tion (MIC) values of 2.5 mM and 1.3 mM, respectively. Bacillus amyloliquefaciens, B. methylotrophicus, B. subtilis, Lysinibacillus sphaericus, and Lysinibacillus macroides also showed the highest antimicrobial activities against B. glumae. In field conditions, these bacteria have been found to inhibit the growth of sheath blight disease and BPB, indicating them a possible biological control agents against these rice diseases. Siderophores were developed by the strains and at least 60.5% were toxoflavin immune (Shrestha et al., 2016). B. stratosphericus and Pseudomonas aeruginosa strains isolated from the mine soils revealed promising approaches to regulate bacterial pathogenic bacteria for biopesticide development. Both strains were found to be high producers of bioactive agents that have been selective against B. glumae that can generate biocatalysts of protease, amylase, and chitinase, along with increased development of siderophores and solubilization of phosphates that enhance the growth of the plant. Leaves of tomato plant when treated with co-inoculation of P. aeruginosa and B. stratosphericus showed significant PAL gene upregulation (Durairaj et al., 2017). Similarly, rice seed inoculation with oospore suspensions of Pythium oligandrum (PO), B. glumae decreased seedling rot incidence. Induction of defensive scheme gene expression and resistance, PO has been documented that activate defensive genes, OsPR10a/PBZ1 and triggered resistance against bacterial pathogen (Haase et al., 2013). The jasmonic acid (JA)-responsive OsPR10b and OsPR6 synthesis has also been induced in rice plants treated with PO-oospore suspension. In accordance to OsPR10b and OsPR6, a global gene expression study of the roots treated when treated with the cell wall protein (CWP) fraction isolated from PO, a resistance elicitor, suggested that CWP increased the genes expression involved in allene oxide synthase and lipoxygenase (LOX) that are key enzymes for JA synthesis. These results indicate that fungal species can also trigger a protective reaction mediated by JA-signaling and induces resistance in rice (Kumar et al., 2016). Bacteriophages have been shown to be helpful in combating rice seedling decay, in comparison to bacterial and fungal biological control agents. Bacte­ riophages were found to be in a position to lyse B. glumae which were highly successful when pre-treated with them in managing seeding rot (Adachi et al., 2012). Thus, BGPP-AR was found to be very efficient in the preven­ tion of rice seedling rot, even at the low concentration of 1.0 × 105 PFU/ml (plaque forming unit). In minimizing seedling rot, one of the bacteriophages

118

Bacterial Diseases of Rice and Their Management

tested was also more efficient than the bactericide ipconazole/copper (II) hydroxide (Rahimi-Midani et al., 2016). Increasing disease-resistant variants might be the best option, but only moderately resistant varieties are currently available and the desired commer­ cial functionality is lacking. Owing to the high resemblance of Burkholderia spp. the detection of microbial pathogens B. glumae based on morphological characteristics or infection symptoms is costly and time consuming. To deter­ mine the infections sequence, quick and precise identification of pathogens are crucially needed (Gwinn et al., 2019). Within plants, several bacterial species are known to survive, known as endophytes. Burkholderia sp. has several endophytic characteristics derived from surface-sterilized rice roots. Due to a lack of rice pathogenesis, antimicrobial properties, and existence of the nifH gene, (indicator for nitrogen fixation), a recombinant strain of Burkholderia KJ006 was selected. An N-acyl-homoserine lactonase (aiiA) gene from B. thuringiensis was inserted into Burkholderia sp. in an effort to regulate B. glumae. Since the main virulence factor of B. glumae is regulated in a population-dependent manner. B. glumae in vitro blocked the develop­ ment of quorum-sensing signaling by the engineered strain KJ006 (pKPE­ aiiA) and decreased the rot occurrence caused by B. glumae in situ (Cho et al., 2007). These results indicate the possibility of using a microbial endophyte manipulated as a possible biological weapon targeting pathogenic B. glumae with the aiiA gene and are considered to live in the same ecological niche. 6.3 ECOLOGICAL STUDIES Members of the Burkholderia genus are widespread, distributed ubiquitously and therefore are present in a wide variety of habitats. The main habitat of the Burkholder species, however, is the soil, where they engage in various environmental processes and encounters with fungi, animals, and plants (Suárez-Moreno et al., 2012). Walter Burkholder first identified microbes from the genus Burkholderia as phytopathogenic species affecting carnation and onions in 1942. He also identified a species in 1950, called Pseudomonas cepacia, which caused rot in onions and then became the current genus type strain. Much of the recently isolated bacteria is known to be part of nonfluorescent pseudomonads from the very first isolation and before their own genus was suggested. Whole analysis was done by adopting rRNA-DNA and DNA-DNA in the first 19 years. In order to suggest Burkholderia as a discussing new of different genera from Pseudomonas homology group II, hybridization strategies and fatty acid analysis provided adequate support.

Reviews of Biological and Ecological Studies

119

Burkholderia have gained a lot of research interest because of their pathogenic attributes. The results that nitrogen and nodular legumes can be fixed by B. brasilensis and B. kururiensis gave this genus a clear evolutionary significance. The Burkholderia genus currently receiving 86 distinct but closely linked organisms whose strains have been isolated from diverse environments. Taxonomic analyzes have shown that these opportunistic pathogens belong to five related species and are known as the complex Burkholderia cepacia (BCC). The BCC presently consists of 17 species that share their 16S rRNA gene with 98–100% resemblance and 94–95% in their recA gene sequences (Payne et al., 2005). The adaptability and physiological versatility of BCC organisms not only helps them to colonize and invade the human body, but also to induce animals and plants diseases. In addition, BCC species often have effects that encourage plant growth and have the potential to generate several antifungal residues. Members of this group were already found repeatedly in the ecosystem, specifically in the soil where a variety of essential processes are carried out and are involved in exo- and endosymbiotic interactions with plants, fungi, and invertebrates. Oddly, strains from the same species belonging to this Burkholderia environmental group have been retrieved from diverse geographical locations and from habitat (Francis et al., 2013). Several studies relating to the exposure of bacteria from decaying maple leaves to decomposition of organic matter (DOM) were reported where, use of artificial microbial rhizospheric bacteria assemblies, like B. cepacia, grew steadily within the first days of decay, indicating a significant role in the mineralization of soil organic matter. They were also one of the most abundant microbes that accumulated and potentially lead to the decomposition of carbon from cellulose. In addition, a recent report on wet lignocellulolytic bacteria from Puerto Rican tropical forest soils revealed that species belonging to the genus Burkholderia were among the dominant taxa leading to the process of decomposition debris (both cellulose and lignin). 6.3.1 INTERACTIONS OF B. GLUMAE SPECIES 6.3.1.1 INTERACTIONS OF B. GLUMAE SPECIES WITH BACTERIA Antagonistic activity and metabolite profiles of many rhizobacteria were measured Against B. glumae. Strains were identified on the basis of 16S rRNA gene sequences and their phylogenetic analyzes revealed their resemblance

120

Bacterial Diseases of Rice and Their Management

to the Enterobacter tabaci NR146667.227 strain (99%). Using the disc diffusion process, antagonistic activity was further tested by removing active fractions extracted from ethyl acetate (EtOAc). The fractionation of the glass column was performed to create an active fraction that usually inhibited 85–95% growth of B. glumae strains. In addition, GC-MS based metabolomic analysis were performed that indicated 3-phenylpropanoic acid (3-PPA) as main key compound in fraction of EtOAc (46.7%) and the BSB1 extract (28.6%) (Peñaloza et al., 2020). Against all the strains of B. glumae, this compound displayed antimicrobial property with a minimal inhibitory concentration (MIC) of 1,000 mg/L. Likewise, co-occurrence of B. glumae, B. plantarii, as well as B. Gladioli were reported by performing an in vitro assay that revealed antagonistic behavior between these species. Showing good inhibition of against B. gladioli, B. glumae and B. plantarii, plant bacterial quantification was done followed by rice plant assessments and qPCR assays. Thus, B. gladioli contribute to greatly decreased disease incidence and colonization of rice tissues (Carlos et al., 2018). 6.3.1.2 INTERACTIONS OF B. GLUMAE SPECIES WITH FUNGI A close interactive study with microbes, as well as with higher species like plants, maybe a potential survival method in acidic soils were demonstrated and recorded the relevance of associations between plants and species of Burkholderia. Although there are various reports on associations between Burkholderia and fungus. Fungi are pervasive species that are primarily concerned with the soil climate. Soil fungi constitute a significant proportion of the microbial population of the soil and their development and activity have been seen to decline with increasing pH (LaSarre et al., 2013). In addition, fungi reduce their affinity for acidic pH as bacterial species are removed by antibiotic therapy, indicating that there is a heavy rivalry in the soil between certain classes of organisms. In distinct environments, bacterial-fungal relationships are generally seen and lead to ecological processes. Previous observations of these associations were mainly performed in soils, and only small aerial plant tissue studies were conducted. A seed-borne plant pathogenic bacterium, B. glumae, and an air­ borne plant pathogenic fungus, F. graminearum association was studied to facilitate bacterial existence, microbial dispersal, and disease progression on rice seedlings. Assays related to toxoflavin sensitivity, RNA-seq tests, lipid staining, and triacyl glyceride composition measurements were performed

Reviews of Biological and Ecological Studies

121

to demonstrate that linolenic acid-containing triacylglycerides mediate toler­ ance to ROS (Jung et al., 2018). As a result, B. glumae is able to mechanically bind to the fungal wall to achieve quick and expansive dispersal to maximize disease incidence. Burkholderia’s antifungal action against several fungi, primarily phytophatogenic in nature, such as Alternaria sp. Rhizoctonia sp., Fusarium sp., Aspergillus sp., and Phytophthora sp. were documented. Numerous compounds such as rhizoxin, pyrrolnitrin (PRN), Burkholderia ornibactin, and occidiofungin generate antifungal behavior from the output (Wang et al., 2016). Recent research has been focused on finding particular ecological causes for these relationships to be identified. In addition, secondary metabolites (e.g., glycerol), which are produced by fungi, may be used by Burkholderia that can provide an essential food supply in a nutrientdepleted area such as soil. It has been shown that fungi continue providing hospitable conditions for Burkholderia in acidic soils by ameliorating the low pH (Chamam et al., 2015). In addition, by sticking to the hyphae and co-migrating with them throughout their development, Burkholderia takes advantage of the extensive mycelial channel that spreads in the soil. 6.3.1.3 INTERACTIONS OF B. GLUMAE SPECIES WITH RICE PLANT Several experiments have been performed to determine the colonization of rice plants by strains of B. glumae revealed that these bacterial colonies were found largely in the rhizosphere of primary and secondary roots, accompa­ nied by a major contribution of biological symbiotic nitrogen fixation. In contrast with the monitor, there was an increase in dry mass and nitrates of the inoculated plants. The bacteria have been seen inside the vessels of the roots in a few instances (Magbanua et al., 2014). In the root production zone, B. glumae colonization was observed were present in greater concen­ trations shortly after emergence, outside the base and facilitated epidermal cell detachment. This preferential colonization site may be connected to the optimal O2 or pH needed within the cells for the replication of bacteria. When rice seeds and seedlings were inoculated with B. glumae, root and coleoptile germination and growth were evaluated in rice plants, while seedlings were evaluated for progression of disease intensity. The germination of seeds was not impaired by strain therapies, thus greatly minimizing the growth of roots. It greatly affected coleoptile growth and created a related development of seedling rot disease (Carlos et al., 2018).

122

Bacterial Diseases of Rice and Their Management

Transcriptomics by next-generation sequencing (RNA-Seq) and bioin­ formatics were studied in order to distinguish differentially controlled transcripts between resistant and susceptible associations and to formulate a model for rice tolerance to the disease. Using inoculated young seedlings, specific transcripts involving bacterial resistance panicle blight including a PIF-like ORF1 (Alexandrov et al., 2009). No other pathosystems, including rice blast or BB, have documented which also include resistance genes, kinases, transcription factors, transporters, and expressed proteins whose function are still not known. In addition, functional annotation review shows an abundance of defense response and induction of apoptosis (biological processes); binding of protein and ATP (molecular functions); and transcripts linked to mitochondria (cell component) in the resistance interaction (Wang et al., 2020). Taken together a paradigm of rice resistance towards BPB involving activation on challenge with B. glumae of completely undiscovered resistance genes and their interaction partners. Certain significant outcomes are that these resistance transcripts were up-regulated after inoculation in the resistant association, where some of them were already seen in the water-inoculated resistant genotype control, but not in the water-inoculated and bacterium-inoculated susceptible genotype samples. An ORF which was historically part of a transposable genotype may have been co-opted by rice and resistance to disease may have occurred immediately prior to rice artificial selection. 6.3.2 UNDERSTANDING THE DIRECTION OF EVOLUTION IN B. GLUMAE THROUGH COMPARATIVE GENOMICS The B. glumae genome varies from ~6.81 to 8.89 Mbp in size. Unlike many other pathogenic bacteria in plants, a large variety of monocot and dicot plants can be infected with B. glumae. A study of the comparative genomics of B. glumae strains may give an insight into the heterogeneity between genomes related with entire pathways (Gnanasekaran et al., 2020). A comparative review of full genomes between B. glumae LMG 2196, B. glumae BGR1 and B. glumae PG1 revealed highest genes departmentalization on different replicons. Furthermore, the presence in the three large-scale developmental events such as reorganization, distortion, and the development of highly specialized structures was shown to be connected to virulence-associated characteristics in the strains of B. glumae. This relation can clarify why this bacterium extends its host range and enhances its relationship with hosts (Lee et al., 2016).

Reviews of Biological and Ecological Studies

123

ACKNOWLEDGMENT The authors thank Integral University, Lucknow to provide all the facilities which had facilitated the work. KEYWORDS • • • • • • •

B. glumae bacterial panicle blight blight cultivars diphenyleneiodonium chloride indoleacetic acid resistance variety

REFERENCES Adachi, N., Tsukamoto, S., Inoue, Y., & Azegami, K., (2012). Control of bacterial seedling rot and seedling blight of rice by bacteriophage. Plant Dis., 96,1033–1036. Alexandrov, N. N., Vyacheslav, V., Brover, V. V., Freidin, S., Troukhan, M. E., Tatarinova, T. V., Zhang, H., et al., (2009). Insights into corn genes derived from large-scale cDNA sequencing. Plant Mol. Biol., 69, 179–194. Alnoch, R. C., Stefanello, A. A., Paula, M. V., Richter, J. L., Mateo, C., Souza, E. M. D., Mitchell, D. A., et al., (2018). Co-expression, purification, and characterization of the lipase and foldase of Burkholderia contaminans LTEB11. Int. J. Biol. Macromol., 116, 1222–1231. Azimi, S., Klementiev, A. D., Whiteley, A., & Stephen, P., (2020). Diggle bacterial quorum sensing during infection. Annu. Rev. Microbiol, 74, 201–219. Betancur, L. A., Forero, A. M., Romero-Otero, A., Sepúlveda, L. Y., Moreno-Sarmiento, N. C., Castellanos, L., & Ramos, F. A., (2019). Cyclic tetrapeptides from the marine strain Streptomyces sp. PNM-161a with activity against rice and yam phytopathogens. J. Antibiot., 72, 744–751. Carlos, Riera-Ruiz., Castro-Lara, J., Jimenez-Feijoó, M. I., & Cevallos-Cevallos, J. M., (2018). Interactions of Burkholderia glumae and B. gladioli in symptom development in rice seeds and seedlings. Can. J. Plant Pathol., 40, 347–357. Chamam, A., Wisniewski-Dyé, F., Comte, G., Bertrand, C., & Prigent-Combaret, C., (2015). Differential responses of Oryza sativa secondary metabolism to biotic interactions with cooperative, commensal, and phytopathogenic bacteria. Planta, 242, 1439–1452.

124

Bacterial Diseases of Rice and Their Management

Chandra, P., & Enespa, S. R., (2020). Microbial lipases and their industrial applications: A comprehensive review. Microb Cell Fact, 19, 169. Chen, R., Barphagha, I. K., & Ham, J. H., (2015). Identification of potential genetic components involved in the deviant quorum-sensing signaling pathways of Burkholderia glumae through a functional genomics approach. Front. Cell. Infect. Microbiol., 5, 22. Cho, H. S., Park, S. Y., Ryu, C. M., Kim, J. F., Kim, J. G., & Park, S. H., (2007). Interference of quorum sensing and virulence of the rice pathogen Burkholderia glumae by an engineered endophytic bacterium. FEMS Microbiol Ecol., 60, 14–23. Cui, Z., Ibrahim, M., Yang, C., Fang, Y., Annam, H., Li, B., Wang, Y., Xie, G. L., & Sun, G., (2014). Susceptibility of opportunistic Burkholderia glumae to copper surfaces following wet or dry surface contact. Molecules, 19, 9975–9985. Cui, Zhou-Qi., Zhu, B., Guan-Lin, X., Li, B., & Shi-Wen, H., (2016). Research status and prospect of Burkholderia glumae, the pathogen causing bacterial panicle blight. Rice Sci., 23, 111–118. De Souza, S. M., & Orth, K., (2019). The role of the type III secretion system in the intracellular lifestyle of enteric pathogens. Microbiol. Spectr., 7. Degrassi, G., Devescovi, G., Kim, J., Hwang, I., & Venturi, V., (2008). Identification, characterization, and regulation of two secreted polygalacturonases of the emerging rice pathogen Burkholderia glumae. FEMS Microbiol Ecol., 65, 251–262. Devescovi, G., Bigirimana, G., Degrassi, G., Cabrio, L., LiPuma, J. J., Kim, J., Hwang, I., & Venturi, V., (2007). Involvement of a quorum-sensing-regulated lipase secreted by a clinical isolate of Burkholderia glumae in severe disease symptoms in rice. Appl. Environ. Microbiol., 73, 4950–4958. Doddaraju, P., Kumar, P., & Gunnaiah, R., (2019). Reliable and early diagnosis of bacterial blight in pomegranate caused by Xanthomonas axonopodis pv. punicae using sensitive PCR techniques. Sci. Rep., 9, 10097. Durairaj, K., Velmurugan, P., Park, J. K., Chang, W. S., Yool-Jin, P. Y. J., Senthilkumar, P., Choi, K. M., Lee, J. H., & Oh, B. T., (2017). Potential for plant biocontrol activity of isolated Pseudomonas aeruginosa and Bacillus stratosphericus strains against bacterial pathogens acting through both induced plant resistance and direct antagonism. FEMS Microbiol. Lett., 364, 225. Fenwick, M. K., Philmus, B., Begley, T. P., & Ealick, S. E., (2016). Burkholderia glumae ToxA Is a dual-specificity methyltransferase that catalyzes the last two steps of toxoflavin biosynthesis. Biochemistry, 55, 2748–2759. Francis, F., Kim, J., Ramaraj, T., Farmer, A., Rush, M. C., & Ham, J. H., (2013). Comparative genomic analysis of two Burkholderia glumae strains from different geographic origins reveals a high degree of plasticity in genome structure associated with genomic islands. Mol Genet Genomics, 288,195–203. Gaytan, M. O., Martinez-Santos, V. I., Soto, E., & Gonzalez-Pedrajo, B., (2016). Type three secretion system in attaching and effacing pathogens. Front. Cell. Infect. Microbiol., 6, 129. Gnanasekaran, G., Lim, J. Y., & Hwang, I., (2020). Disappearance of quorum sensing in Burkholderia glumae during experimental evolution. Microbial. Ecol., 79, 947–959. Gwinn, M., MacCannell, D., & Armstrong, G. L., (2019). Next-generation sequencing of infectious pathogens. JAMA, 321, 893, 894. Ham, J. H., Melanson, R. A., & Rush, M. C., (2011). Burkholderia glumae: Next major pathogen of rice? Mol. Plant Patho., 12, 329–339.

Reviews of Biological and Ecological Studies

125

Hase, S., Takenaka, S., Maeda, M., Hori, T., Tsushima, S., & Namai, T., (2013). Biocontrol agent Pythium oligandrum induces defense-related gene expression and suppresses bacterial seedling rot caused by Burkholderia glumae in rice. JPN J. Phyto Patholo., 79, 1–9. Hawver, L. A., Jung, S. A., & Ng, W. L., (2016). Specificity and complexity in bacterial quorum-sensing systems. FEMS Microbiol. Rev., 40, 738–752. Hikichi, Y., Tsujiguchi, K., & Maeda, Y., (2001). Development of increased oxolinic acidresistance in Burkholderia glumae. J. Gen. Plant Pathol., 67, 58–62. Hummel, N. A., Castro, B. A., Mcdonald, E. M., Pellarano, M. A., & Ochoa, R., (2009). The panicle rice mite, Steneotarsonemus spinki smiley, a re-discovered pest of rice in the United States. J. Crop Prot., 28, 47–560. Hussain, A., Shahbaz, M., Tariq, M., Ibrahim, M., Hong, X., Naeem, F., Khalid, Z., et al., (2020). Genome re-sequence and analysis of Burkholderia glumae strain AU6208 and evidence of toxoflavin: A potential bacterial toxin. Comput. Biol. Chem., 86, 107245. Jang, M. S., Goo, E., An, J. H., Kim, J., & Hwang, I., (2014). Quorum sensing controls flagellar morphogenesis in Burkholderia glumae. PLoS One, 9. Jeong, Y., Kim, J., Kim, S., Kang, Y., Nagamatsu, T., & Hwang, I., (2003). Causing rice grain rot is responsible for inducing bacterial wilt in many field crops. Plant Dis., 87, 890–895. Jeong, Y., Kim, J., Kim, S., Kang, Y., Nagamatsu, T., & Hwang, I., (2003). Toxoflavin produced by Burkholderia glumae causing rice grain rot is responsible for inducing bacterial wilt in many field crops. Plant Dis.,87, 890–895. Jiang, Q., Chen, J., Yang, C., Yin, Y., & Yao, K., (2019). Quorum sensing: A prospective therapeutic target for bacterial diseases. Biomed Res. Int., 2019, 1–15. Joo, M., Yoo, H. G., Kim, H. J., & Kwon, H. J., (2015). ToxB encodes a canonical GTP cyclo­ hydrolase II in toxoflavin biosynthesis and ribA expression restored toxoflavin production in a ΔtoxB mutant. J. Korean Society for Applied Biological Chemistry, 58, 877–885. Jung, B., Li, T., Ji, S., & Lee, J., (2019). Efficacy of diphenyleneiodonium chloride (DPIC) against diverse plant pathogens. Mycobiology, 47, 105–111. Jung, B., Park, J., Kim, N., Li, T., Kim, S., Bartley, L. E., Kim, J., et al., (2018). Cooperative interactions between seed-borne bacterial and air-borne fungal pathogens on rice. Nat Commun., 9, 31. Karki, H. S., Shrestha, B. K., Han, J. W., Groth, D. E., Barphagha, I. K., Rush, M. C., & Ham, J. H., (2012). Diversities in virulence, antifungal activity, pigmentation, and DNA fingerprint among strains of Burkholderia glumae. PLoS One, 7. Kato, T., Morohoshi, T., Tsushima, S., & Ikeda, T., (2014). Characterization of three types of quorum-sensing mutants in Burkholderia glumae strains isolated in Japan. J. Agric. Sci., 6. Kibret, M., Guerrero-Garzón, J. F., Urban, E., Zehl, M., Wronski, V. K., Rückert, C., Busche, T., et al., (2018). Streptomyces spp. from ethiopia producing antimicrobial compounds: Characterization via bioassays, genome analyses, and mass spectrometry. Frontiers in Microbiology, 9, 1270. Kim, J., Kang, Y., Kim, J. G., Choi, O., & Hwang, I., (2010). Occurrence of Burkholderia glumae on rice and field crops in Korea. Plant Pathol. J., 26, 271, 272. Kim, J., Mannaa, M., Kim, N., Lee, C., Kim, J., Park, J., Lee, H. H., & Seo, Y. S., (2018). The roles of two hfq genes in the virulence and stress resistance of Burkholderia glumae. Plant Pathol. J., 34, 412–425. Knapp, A., Voget, S., & Gao, R., (2016). Mutations improving production and secretion of extracellular lipase by Burkholderia glumae PG1. Appl. Microbiol. Biotechnol., 100, 1265–1273.

126

Bacterial Diseases of Rice and Their Management

Kumar, M., Karthikeyan, N., & Prasanna, R., (2016). Priming of plant defense and plant growth in disease-challenged crops using microbial consortia. In: Choudhary, D., & Varma, A., (eds.), Microbial-mediated Induced Systemic Resistance in Plants. Springer, Singapore. LaSarre, B., & Federle, M. J., (2013). Exploiting quorum sensing to confuse bacterial pathogens. Microbiol. Mol. Biol. Rev., 77, 73–111. Lee, H. H., Park, J., & Kim, J., (2016). Understanding the direction of evolution in Burkholderia glumae through comparative genomics. Curr. Genet., 62, 115–123. Lee, J., Park, J., Kim, S., Park, I., & Seo, Y. S., (2016). Differential regulation of toxoflavin production and its role in the enhanced virulence of Burkholderia gladioli. Mol. Plant Pathol., 17, 65–76. Lee, Y. H., Ko, S. J., Cha, K. H., & Park, E. W., (2015). A disease forecast model to support decision-making for chemical sprays to control bacterial grain rot of rice. Plant Pathol. J., 31, 350–362. Lelis, T., Peng, J., Barphagha, I., Chen, R., & Ham, J. H., (2019). The virulence function and regulation of the metalloprotease gene prtA in the plant-pathogenic bacterium Burkholderia glumae. Mol. Plant Microbe Interact., 32, 841–852. Li, L., Wang, L., Lian-Meng, L., Yu-Xuan, H., Qi-Qin, L., & Shi-Wen, H., (2016). Infection process of Burkholderia glumae before booting stage of rice. Phytopathol., 164, 825–832. Li, X., Li, Y., Wang, R., Wang, Q., & Lu, L., (2019). Toxoflavin produced by Burkholderia gladioli from Lycorisaurea is a new broad-spectrum fungicide. Appl. Environ. Microbiol., 85. Li, Z., & Nair, S. K., (2012). Quorum sensing: How bacteria can coordinate activity and synchronize their response to external signals? Protein science: A publication of the Protein Society, 21, 1403–1417. Liu, N., Zhang, X., & Sun, Y., (2017). Molecular evidence for the involvement of a polygalacturonase-inhibiting protein, GhPGIP1, in enhanced resistance to Verticillium and Fusarium wilts in cotton. Sci. Rep., 7, 39840. Magbanua, Z. V., Arick, M., & Buza, T., (2014). Transcriptomic dissection of the rice Burkholderia glumae interaction. BMC Genomics, 15, 755. Magbanua, Z. V., Arick, M., Buza, T., Hsu, C. Y., Showmaker, K. C., Chouvarine, P., Deng, P., et al., (2014). Transcriptomic dissection of the rice-Burkholderia glumae interaction. BMC Genomics, 15, 755. Mizobuchi, R., Fukuoka, S., Tsuiki, C., Tsushima, S., & Sato, H., (2018). Evaluation of major Japanese rice cultivars for resistance to bacterial grain rot caused by Burkholderia glumae and identification of standard cultivars for resistance. Breed. Sci., 68, 413–419. Nandni, S., & Vishunavat, K., (2019). Bacterial panicle blight of rice. Int. J. Pharmacogn. Phytochem, 8, 918–922. Nickzad, A., Lépine, F., & Déziel, E., (2015). Quorum sensing controls swarming motility of Burkholderia glumae through regulation of rhamnolipids. PloS One, 10, e0128509. Payne, G. W., Vandamme, P., Morgan, S. H., Lipuma, J. J., Coenye, T., Weightman, A. J., Jones, T. H., & Mahenthiralingam, E., (2005). Development of a recA gene-based identification approach for the entire Burkholderia genus. Appl Environ Microbiol., 71, 3917–3927. Pedraza, L. A., Bautista, J., & Uribe-Vélez, D., (2018). Seed-born Burkholderia glumae infects rice seedling and maintains bacterial population during vegetative and reproductive growth stage. Plant Pathol. J., 34, 393–402. Pena, R. T., Blasco, L., Ambroa, A., González-Pedrajo, B., Fernández-García, L., López, M., Bleriot, I., et al., (2019). Relationship between quorum sensing and secretion systems. Front Microbiol., 10, 1100.

Reviews of Biological and Ecological Studies

127

PeñalozaAtuesta, G. C., Murillo, A. W., Eras, J., Oliveros, D. F., & Méndez, A. J. J., (2020). Rice-associated rhizobacteria as a source of secondary metabolites against Burkholderia glumae. Molecules, 25, 2567. Rahimi-Midani, A., Kim, K. H., Lee, S. W., Jung, S. B., & Choi, T. J., (2016). Isolation and characterization of a bacteriophage preying an antifungal bacterium. Plant Pathol. J., 32, 584–588. Riera-Ruiz, C., Vargas, J., Cedeño, C., Quirola, P., Escobar, M., Cevallos-Cevallos, J. M., Ratti, M., & Peralta, E. L., (2014). First report of Burkholderia glumae causing bacterial panicle blight on rice in ecuador. Plant Dis., 98, 988. Senarath, K., Kankanamge, D., Samaradivakara, S., Ratnayake, K., Tennakoon, M., & Karunarathne, A., (2018). Regulation of G protein βγ signaling. Int. Rev. Cel. Mol. Bio., 339, 133–191. Seo, Y. S., Lim, J. Y., & Park, J., (2015). Comparative genome analysis of rice-pathogenic Burkholderia provides insight into the capacity to adapt to different environments and hosts. BMC Genomics, 16, 349. Sharma, S., Sharma, S., Hirabuchi, A., Yoshida, K., Fujisaki, K., Ito, A., Uemura, A., et al., (2013). Deployment of the Burkholderia glumae type III secretion system as an efficient tool for translocating pathogen effectors to monocot cells. Plant J., 74, 701–712. Shew, A. M., Durand-Morat, A., Nalley, L. L., Zhou, X. G., Rojas, C., & Thoma, G., (2019). Warming increases bacterial panicle blight (Burkholderia glumae) occurrences and impacts on USA rice production. PLoS One, 14, e0219199. Shrestha, B. K., Karki, H. S., Groth, D. E., Jungkhun, N., & Ham, J. H., (2016). Biological control activities of rice-associated Bacillus sp. strains against sheath blight and bacterial panicle blight of rice. PloS One, 11, e0146764. Suárez-Moreno, Z. R., Caballero-Mellado, J., & Coutinho, B. G., (2012). Common features of environmental and potentially beneficial plant-associated Burkholderia. Microb. Ecol., 63, 249–266. Suárez-Moreno, Z. R., Vinchira-Villarraga, D. M., Vergara-Morales, D. I., Castellanos, L., Ramos, F. A., Guarnaccia, C., Degrassi, G., et al., (2019). Plant-growth promotion and biocontrol properties of three Streptomyces spp. isolates to control bacterial rice pathogens. Front. Microbiol., 10, 290. Subramoni, S., Suárez-Moreno, Z. R., & Venturi, V., (2010). Lipases as pathogenicity factors of plant pathogens. In: Timmis, K. N., (eds.), Handbook of Hydrocarbon and Lipid Microbiology. Springer, Berlin, Heidelberg. Syahri, S., Somantri, R. U., & Sasmita, P., (2019). Detection and control bacteria cause grain rot Burkholderia glumae on rice. Jurnal Perlindungan Tanaman Indonesia, 23, 163. Tayi, L., Maku, R. V., Patel, H. K., & Sonti, R. V., (2016). Identification of pectin degrading enzymes secreted by Xanthomonas oryzae pv. oryzae and determination of their role in virulence on rice. PLoS One, 11, e0166396. Velásquez, A. C., Castroverde, C., & He, S. Y., (2018). Plant-pathogen warfare under changing climate conditions. Curr. Biol., 28, 619–634. Wang, T., Zhan-Hui, J., Ji-Yu, Z., Min, L., Zhong-Ren, G., & Gang, W., (2020). Identification and analysis of NBS-LRR genes in Actinidia chinensis. Genome Plants, 9, 1350. Wang, X. Q., Liu, A. X., Guerrero, A., Liu, J., Yu, X. Q., Deng, P., Ma, L., et al., (2016). Occidiofungin is an important component responsible for the antifungal activity of Burkholderia pyrrocinia strain Lyc2. J. Appl. Microbiol., 120, 607–618.

128

Bacterial Diseases of Rice and Their Management

Weinberg, J. B., Alexander, B. D., Majure, J. M., Williams, L. W., Kim, J. Y., & Vanda, P., (2007). Burkholderia glumae infection in an infant with chronic granulomatous disease. J Clin. Microbiol., 45, 662–665. Wolfson, E. B., Elvidge, J., Tahoun, A., Gillespie, T., Mantell, J., McAteer, S. P., Rossez, Y., et al., (2020). The interaction of Escherichia coli O157:H7 and Salmonella Typhimurium flagella with host cell membranes and cytoskeletal components. Microbiology., 166, 947–965. Ye, J., Yang, X., & Yang, Z., (2020). Comprehensive analysis of polygalacturonase gene family highlights candidate genes related to pollen development and male fertility in wheat (Triticum aestivum L.). Planta, 252, 31. Zhou, X. G., (2019). Sustainable strategies for managing bacterial panicle blight in rice. In: Yulin, J., (ed.), Protecting Rice Grains in the Post-Genomic Era. IntechOpen. Zhou-Qi, C., Bo, Z., Guan-Lin, X., Bin, L., & Shi-Wen, H., (2016). Research status and prospect of Burkholderia glumae, the pathogen causing bacterial panicle blight. Rice Sci. Elsevier B.V.

CHAPTER 7

Insights from the Conventional Breeding and Molecular Approaches for Rice Bacterial Panicle Blight Disease Resistance RASHMI MAURYA,1 MUNNA SINGH,1 DEEPTI SRIVASTAVA,2 and SHIVI RATHOR3 Department of Botany, University of Lucknow, Lucknow,

Uttar Pradesh–226007, India, E-mail: [email protected] (R. Maurya)

1

Integral Institute of Agricultural Science and Technology (IIAST),

Integral University, Kursi Road, Dashauli, Uttar Pradesh–226026, India

2

Department of Material Science and Engineering,

National Taiwan University of Science and Technology, No. 43,

Keelung Road, Sec. 4, Da’an District, Taipei–10607, Taiwan

3

ABSTRACT Burkholderia glumae emerged as a potential threat in rice cultivating areas of the world, which results in loss of productivity. Its rapid spread raised the attention of rice breeders and biotechnologists towards identifying genetic and molecular resources to fight bacterial panicle blight (BPB) of rice. Conventional strategies such as exclusion, ST, rice variety selection, time of sowing, and use of selective fertilizer have been employed to reduce disease occurrence. Recently, genotype screening and subsequent QTL mapping identified regions of BPB resistance using chromosome segment substitution lines (CSSLs), back cross inbred lines (BILs), and recombinant inbred lines (RILs) lines in rice. Simultaneously, dissection of Bacterial Diseases of Rice and Their Management. Deepti Srivastava, Md. Shamim, Malik Mobeen Ahmad, & K. N. Singh (Eds.) © 2023 Apple Academic Press, Inc. Co-published with CRC Press (Taylor & Francis)

130

Bacterial Diseases of Rice and Their Management

molecular targets responsible for resistance held in regulation of toxiflavin toxin, flagellar movement, and cell-to-cell communication abilities of Burkholderia glumae. Specific identification of Burkholderia glumae in the field is another challenge for breeders and farmers because of the presence of other pathogens. Genome sequencing of Burkholderia glumae assisted in designing genome-specific primers, and with optimized real-time PCR and mPCR, accurate identification of Burkholderia glumae was possible. An effective gene pyramiding or transgenic strategy could be utilized to develop BPB resistant variety in rice in the future. So far, identified resistant genetic and molecular targets have shown to provide only partial resistance, which suggests none of the available measures could provide absolute defense against BPB of rice. Presently, sustainable management of BPB of rice requires an integrated approach for delivering effective measures. 7.1 INTRODUCTION Rice is a major staple crop in the world and the need for increased productivity evoked over the current estimate of growing populations. Biotic stress seems to be one of the bottlenecks in rice productivity at worldwide. Among the biotic stresses, rice bacterial panicle blight (BPB) disease is a serious threat to rice cultivation across the world. Its casual pathogen is Burkholderia glumae, which causes seedling blight, sheath rot, floret sterility, aborted or empty grains in rice leading yield losses by up to 75% (Zhou, 2019; Zhou-Qi et al., 2016). Major rice-producing countries India, Japan, Thailand, Malaysia, Panama, Philippines, South Korea, Sri Lanka, United States, and Vietnam have impacted rice cultivation by its devastating and recurring disease pattern in the field. B. glumae have potential to infect vegetative and reproductive phases of rice cultivation (Safni and Lubis, 2019). At first, Burkholderia glumae was reported in 1950 in Japan and previously categorized as Pseudomonas glumae (Ham et al., 2011). Later in 1991, it was phylogenetically categorized under separate genus ‘Burkholderia’and so far, nearly 60 species have been reported (Ham et al., 2011). Burkholderia spp. is gram-negative, aerobic, rod-shaped, and motile bacteria, which can rapidly multiply and infect emerging rice panicles and flowers (Zarbafi and Ham, 2019). Primary infection of Burkholderia spp. occurs via leaf sheath without any disease symptoms, which ultimately infect the panicles. Pathogen is propagated through intercellular spaces of parenchymatous cells thereby infecting the healthy tissues (Zarbafi and Ham, 2019). At the reproductive stage of rice crop, pathogen infect emerging

Insights from the Conventional Breeding and Molecular Approaches

131

spikelet causing rot in the grains (Hikichi, 1993). BPB is characterized by a number of various symptoms, such as changes in panicle color, rice seed discoloration, and spikelet sterility. Interestingly, bacteria maintain an endophytic profile with a CFU count in rage of 101–105 /gm plant tissue; however, at panicle development stage, its CFU count increases to 106/gm plant tissue showing characteristic feature of BPB (Pedraza et al., 2018). Various strains of Burkholderia glumae have been isolated from rice with varied degree of pathogenesis (Mulaw et al., 2018). Some environmental conditions such as climate change have marked impact on disease severity and crop losses. Overlap of warm weather and rice heading timing aggravate the disease spread. Despite of severe crop losses, exact treatment and management strategy for BPB disease management is still unavailable. Recently, Burkholderia glumae life cycle, pathogenesis in rice, crop losses, genetic and molecular components for BPB resistance have been elucidated. Traditionally adopted management strategies such as cultural, exclusion, and chemical methods were actively utilized to overcome the crop losses. Here we discuss about the conventional, breeding, and molecular strategies for effective management of the BPB in rice. 7.2 CONVENTIONAL APPROACHES FOR RICE BACTERIAL PANICLE BLIGHT (BPB) DISEASE RESISTANCE Conventional management practices in field utilizes the use of selective fertilizer, planning of sowing time, selection of rice varieties, field exclusion and STs were applied to encounter the spread of BPB of rice. Studies have correlated the higher supplement of nitrogen with increase susceptibility of plants. Thus, avoiding the use of nitrogen fertilizer can help in reducing the disease severity in rice crop. Another factor that could help in reducing disease occurrence is timely sowing of rice crop. Early planting of rice. An early planting of rice crop will produce mature crop before the onset of warm season and thus reducing disease spread and crop damage. Another strategy is to choose an early maturing rice variety that would have a short life cycle. This will lead to heading and crop harvesting before warm seasonal condition thus, reducing crop damage. Reduction of excessive seeding rates are also helps in the reduction of disease incidence along with reduction in severity of disease. An effective exclusion strategy is also used to isolate the infected crop­ ping areas from the rest of the disease-free crop field. In USA and China, a

132

Bacterial Diseases of Rice and Their Management

plant quarantine procedure is followed to avoid the invasion of Burkholderia, insect, weeds, etc. (Zhou-Qi et al., 2016). Rice BPB disease is seedborne (Pedraza et al., 2018). A proper seed storage strategy and use of pathogen free seed would contribute as first aid in providing protective measure to rice crop. In addition to this farmer should avoid the seeds from the previously infected field. ST can also be used to reduce or eliminate the BPB pathogen. Protec­ tion against rice BPB disease can be achieved with dry heat treatment at 65°C of dry heat for 7 days without affecting seed germination (Lee et al., 2017). Additionally, ST with some antibiotics such as bactericide oxolinic acid, can also be used. Pseudomonas spp. Strain pretreated rice seeds help in reducing B. glumae populations in seed and suppress seedling rot due to its antagonistic nature (Zhou et al., 2019). A number of chemicals treatment are effective measure against BPB of rice such as oxolinic acid, a quinoline derivative, kasugamycin (KSM), probenazole, and pyroquilon (Zhou et al., 2019). Treatment of bactericide such as oxolinic acid at initial growing stages of rice development could effectively reduce the BPB (Shrestha et al., 2016). Also, Cu++ and coppercontaining bactericides are also effective BPB pathogen management. B. glumae cell exposed to copper surfaces losses cell wall integrity, copper accumulation and cell death, indicating the antibacterial effect of Copper on B. glumae (Cui et al., 2014). 7.3 GENOTYPE RESOURCES FOR BACTERIAL PANICLE BLIGHT (BPB) RESISTANCE Screening and identification of rice genetic resources is first step toward breeding and molecular tools-based management of BPB resistance. Plant breeding for superior agronomic traits largely depends on the amount of variation found in the plant germplasm thus recent focus of researchers and breeders was to identify contrasting genotypes. Various attempts have been made for the identification of resistant and susceptible rice varieties (Ishihara et al., 2014; Liu et al., 2015; Hayashi et al., 2010). So far, 28 rice cultivars have been reported to have partial resistance to BPB resistance (Zarbafi et al., 2019). However, no single gene or quantitative trait loci (QTL) having complete resistance to BPB pathogen has not been identified yet. Rice varieties CL 161 and CL 151 were identified as moderately resistant and susceptible, respectively. A differential expression profile for rice – B. glumae

Insights from the Conventional Breeding and Molecular Approaches

133

pathosystem revealed five genes including three RPM1-type transcripts and two NBS-LRR-type transcripts were only detected in resistant genotype (Magbanua et al., 2014). Two tropical japonica varieties namely Kale and Jaguary have shown high resistance and several others with moderate resistance towards BPB resistance (Yokoo et al., 1878). Rice cultivars such as Catahoula, Jupiter, Taggart, Rondo, and Hybrid cultivars showed moderate resistance to BPB resistance (Zhou, 2019). A gamma irradiationbased approach is also followed to develop and screen resistant varieties such as identification of Lemont variety (Zhou, 2019). The additional study recognized Limeira and Iguape Redondo as resistant and Damaris and BR-1 as susceptible varieties among 19 screened varieties for glume blight disease of rice (Prabhu and Bedendo, 1998). So far, BPB resistance was found to have only partial resistance as none of the identified QTLs is known to provide absolute measure against BPB. Screening of 55 rice cultivars using cut panicle method at different time point identified resistant and susceptible cultivars. Two significantly different groups appear; one is strong resistance category, including Kale and tropical japonica and second is medium to strong category, including ARC 11094, Jhona 2, Jarjan, Kasalath, and Khau Mac Kho cultivars (Mizobuchi et al., 2018). 7.4 QUANTITATIVE TRAIT LOCI (QTL) MAPPING FOR BACTERIAL PANICLE BLIGHT (BPB) DISEASE BPB disease resistance in plants could be understood by identifying Quan­ titative trait Locus (QTLs) mapping in RIL population from resistant and susceptible varieties. A cross of TeQing and Lemont varieties, followed by generation of RIL population was used to identify quantitative trait locus of rice-associated disease resistance to BPB. So far, 12 QTLs have been identified for BPB disease resistance in rice. Out of 12 identified OTLs, chromosome 1 carries 3 QTLs, chromosome 2 carries 2 QTLs, chromosome 3 carries 2 QTLs, chromosome 7 carries 1 QTLs, chromosome 8 carries 2 QTLs, chromosome 10 carries 1 QTLs, and chromosome 11 carries 1 QTLs. qBPB-3-1 was the most significant driving 14% of phenotypic variation in two-year performance with highest LOD score. Other significant QTLs were for resistance against BPB disease are qBPB-3-1, qBPB-3-2, and qBPB-1-3. Resistant alleles were contributed by both cultivars, i.e., eight QTLs from TeQing and four QTLs from Lemont cultivars. Previously, a number of QTLs have been identified for rice blast, sheath blight disease of rice, and bacterial

134

Bacterial Diseases of Rice and Their Management

leaf blight (BLB) disease in rice. Four QTLs have been characterized in regions of QTLs for rice blast, sheath blight disease of rice, and BLB disease (Pinson et al., 2005; Li et al., 1999; Tabien et al., 2002). QTL mapping of qBPB-3-1 interestingly showed mapping near to QTL responsible for days to heading (Li et al., 1995). A direct relationship between night temperature at grain filling stage and severity of BPB disease have been shown by Mcclung et al. (1996). A backcross inbred line (BIL) population of Kele (resistant, indica variety) and Hitomebore (susceptible, japonica variety) was used to iden­ tify QTL for rice BPB disease. Alleles contributed by Kele variety majorly provide resistance against BPB diseases. Diseased spikelet ratio and spikelet area were also reduced in presence of Kale allele (Mizobuchi et al., 2013). The QTL was mapped on to long arm of chromosome 1 which was later fine mapped by Mizobuchi et al. (2015) at RBG2. A Nona Bokra (resistant) and Koshihikari (susceptible) varieties of rice were crossed and chromosome segment substitution lines (CSSLs) were generated for QTL mapping. The QTLs for BPB resistance were identified at on the short arm of chromosome 10, known as qRBS1 (QTL Resistance to Burkholderia glumae 1). qRBS1 provides 22% of phenotypic changes associated to BPB resistance in rice (Mizobuchi et al., 2013). A number of efforts have been put to generate bacterial blight (BB) resistance via devel­ oping stable lines for cytoplasmic male sterile trait and combining QTLs for biotic and abiotic stress response in rice by using marker-assisted selection in rice (Ramalingam et al., 2017; Dixit et al., 2020). In developing resistant varieties against BPB disease, the gene pyramiding method can be used as the identified genetic resources have only partial resistance. 7.5 MOLECULAR TARGETS OF VIRULENCE OF B. GLUMAE GENOME The genome sequence of B. glumae BGR1 strain have been revealed by Lim et al. (2009). A comparative analysis of sequences of B. glumae BGR1 and B. glumae 336gr-1 identified unique elements in the region of mobile elements, phage-related genes, and some predicted genomic islands; however, more conserve pattern was seen in virulence genes (Francis et al., 2013). B. glumae BGR1 genome was represented in two chromosome each having 3,906,529 bp and 2,827,355 bp sequence and four plasmids (Plasmid bglu_1p contains 133,591 bp, plasmid bglu_2p contains 141,792 bp, plasmid bglu_3p contains 141,067 bp and plasmid bglu_4p contains 134,349 bp). Most of the

Insights from the Conventional Breeding and Molecular Approaches

135

pathogenesis-related genes, such as genes of type 3 protein secretion system, toxoflavin biosynthesis, and transport genes were present on chromosome-II indicating that chromosome-II plays a key role in determining pathogenesis of B. glumae (Lim et al., 2009). B. glumae-plants interaction was largely derived from its cell-to-cell communication mechanism, such as quorum sensing (QS). The role of QS phenomena has been reported in regulating gene expression and secretion of virulence factors in bacteria (Rutherford and Bassler, 2012). A LuxI homolog regulates production of N-hexanoyl homoserine lactone (C6-HSL), which further binds to TofR to act as autoinducer and produces Toxoflavin (Chen et al., 2015). Toxoflavin-deficient mutant strains were found nearly avirulent to rice (Devescovi et al., 2007; Kim et al., 2004). C8-HSL and TofR act as major regulator and regulate a number of genes involve in colonization and pathogenesis of B. glumae, such as tox gene clusters, toxFGHI, lipA, flagellar biogenesis genes, qsmR, IclR-type transcriptional regulator, and katG (Chen et al., 2015). In addition, genes for type 3 secretion system (T3SS) were demonstrated to be a part of the regulon of the tofI/tofR QS system (Kang et al., 2008). Bacterial enhancer binding protein, tepR have shown to negatively regulate biosynthesis of toxoflavin. A highly up regulated expression profile of biosynthesis and transport of toxoflavin genes were found in tepR mutant line (Peng et al., 2020). Toxoflavin plays a key role in B. glumae pathogenesis rice. Structurally similar toxins such as Fervenulin and reumycin toxins, are also produced by B. glumae. Mutation in oxABCDE operon also leads to reduction of synthesis of Fervenulin and reumycin, indicating that synthesis of these toxins is dependent on toxoflavin biosynthesis pathway (Kim et al., 2004). Multiple reports have shown less virulent behavior of various toxoflavindeficient strains but they still retain ability to induce necrotic symptoms on plants, which suggest there are multiple factors are involve in B. glumae led pathogenesis (Ham et al., 2011). Another virulence factor LipA lipase encoded by lipA help in the pathogenesis of B. glumae in rice (Devescovi et al., 2007). A defective lipA strain is found less virulent as compared to parental strain. Type II secretion system facilitates the secretion of lipases and disruption of type II secretion system showed less virulent behavior compared to virulent parent strain (Kang et al., 2008). B. glumae flagellar movement also contribute in pathogenesis and regulated by TofI/TofR quorum-sensing system mechanism. Interaction of TofR and C8-HSL subsequently activate qsmR and flhDC leading to flagellar biosynthesis (Kim et al., 2007). A tofI or tofR independent pathway

136

Bacterial Diseases of Rice and Their Management

of toxoflavin also exist as tofI or tofR mutant strain successfully produce toxoflavin upon growing on surface of solid medium. Recently, 15 and 3 genes are elucidated from tofI and tofR independent pathway of toxoflavin biosynthesis (Chen et al., 2015). Several other factors that contribute to the pathogenesis of B. glumae includes Type 3 effector, exopolysaccharides (EPS), and Polygalacturonases. A mutant strain carrying mutated waaC and wbiFGHI genes showed sensitivity to stress and compromised virulence indicating involvement of lipopolysaccharide (LPS) in determining virulence of B. glumae (Lee et al., 2019). A T3SS deficient B. glumae mutant strain showed significantly less virulence compared with the parental strain on rice panicles (Ham et al., 2011). In-vitro culture of B. glumae produces EPSs on CPG (casamino acid peptone glucose) agar medium (Schaad et al., 2001). Although, direct involvement of EPSs has not yet been explored but it is a key factor in regulating bacterial-plant interaction and thus its role in BPB disease could not be ignored. Interestingly, virulence protein, Putative Virulence Factor 11 from B. glumae interacts with seven WRKY transcription factors of rice thus could be modulating host machinery for tissue colonization (Kim et al., 2019). 7.6 MOLECULAR APPROACHES TO IDENTIFICATION OF B. GLUMAE In field, identification of B. glumae on basis of phenotypic observation is difficult for farmers due to high similarity with other strains of genus Burkholderia. An apt methodology to identify pathogen is crucial in timely response and stopping disease spread thus reducing crop losses (Zhou-Qi et al., 2016). To discriminate between Burkholderia species, PCR based approach was followed which targets gyrB and rpoD genes using specific primers (Maeda et al., 2006). Later, real time polymerase chain reaction (PCR) method was applied for B. glumae isolates using specific primers specific to internal transcribed spacer (ITS) sequence (Sayler et al., 2007). Other techniques such as the use of TeqMan probe and BioPCR methods have also been used in identifying B. glumae (Li et al., 2010; Kim et al., 2012). Another challenge in B. glumae infection is co-invasion along with other bacterial pathogen which make it a complex tissue to identify causal pathogen. For that, an efficient multiplex PCR (mPCR) have been also designed for simultaneous identification of multiple pathogens in one sample (Zhou-Qi et al., 2016). Conserved genetic targets such as gyrB, rpoD, ITS have been used for accurate identification of B. glumae (Zhou-Qi et al.,

Insights from the Conventional Breeding and Molecular Approaches

137

2016). Recently, 15 and 13 genome specific novel primers were reported for accurate identification of B. glumae and B. gladioli, respectively (Lee et al., 2018). 7.7 MOLECULAR APPROACHES FOR PANICLE BLIGHT DISEASE MANAGEMENT QS phenomena is critical in determining B. glumae pathogenesis in rice which are driven by signaling molecules. Inhibiting/degrading these molecules led to a counter mechanism also known as ‘quorum quenching.’ A number of reports have shown that AHL lactonase or AHL acylase were introduced in Pseudomonas fluorescens P3, which reduces the pathogenicity of Erwinia carotovora (Molina et al., 2003). A similar approach of transforming Bacillus thuringiensis gene N-acylhomoserine lactonase (aiiA) was transformed in Burkholderia sp. KJ006 (pKPE-aiiA), which reduces in situ pathogenesis of rice seedling rot by B. glumae. Thus, using genetically modified endophytes could be used as an efficient method to controlling the severity of B. glumae pathogenesis (Cho et al., 2007). Naturally occurring rice associated bacteria were identified and screened 26 rice associated bacteria showing antibacterial activity against B. glumae. This rice associated bacteria were further categorized to closest to Bacillus amyloliquefaciens, Bacillus methylotrophicus and Bacillus subtilis on the basis of 16S ribosomal DNA sequence (Shrestha et al., 2016). Two other gram-negative bacterial species Burkholderia cepacia and P. protegens have also shown antibacterial activity against B. glumae. Detailed analysis identified that cell free extract of P. protegens could be harnessed to reduce the BPB of rice (Ortega et al., 2020). Two isolates of Streptomyces spp. have antibacterial activity against B. glumae and antimicrobial compounds were identified as Streptotricins D, E, and F (Suárez-Moreno et al., 2019). A toxoflavin-degrading enzyme was identified from Paenibacillus polymyxa JH2 which could be a potential antivirulence agent for managing BPB in rice (Jung et al., 2011). Another toxoflavin-degrading enzyme gene TxeA was functionally characterized form metagenomic DNA library (Choi et al., 2018). Mutagenesis approach using gamma radiation was applied on Lemont germplasm to develop LM-1 and LMT-1 germplasm, which showed signifi­ cant resistant against BPB of rice (Groth et al., 2007). Apart from bacterial species, bacteriophages BGPP-Ar BGPP-Sa are highly specific to target B. glumae in seed rot of rice, thus serves as candidate biocontrol agent (BCA)

138

Bacterial Diseases of Rice and Their Management

for B. glumae infection (Adachi et al., 2012). A metabolomics analysis identified 3-phenylpropanoic acid (3-PPA) as main compound in extract of rhizobacteria genus Enterobacter that inhibit the growth of B. glumae thus illustrating importance of rhizosphere microorganisms in providing defense (Peñaloza et al., 2020). Another set of genes Hfq RNA chaperone; Hfq1 and Hfq2 were assessed for their involvement in virulence of B. glumae in rice plants. Hfq RNA chaperones are reported to regulate multiple functions, including regulator of gene expression. Mutant analysis identified that both Hfq1 and Hfq2 regulate the virulence of B. glumae (Kim et al., 2018). Another novel endophytic Bacillus spp. YC7007, applied was reported to effectively lower disease severity by 70.8% and 70.5% of panicle blight and BB in rice (Chung et al., 2015). A direct regulation of OsWRKY67 has been shown regulation of resistance against BPB. The overexpression and silenced line of OsWRKY67 in rice showed enhanced resistance and susceptibility towards BPB disease. OsWRKY67 have ability to directly bind on promoter of PR1a and PR10 to regulate their expression in rice (Liu et al., 2018). 7.8 FUTURE PROSPECT BPB has emerged as a challenge to rice cultivation at global scale. The ability of B. glumae to infect various tissues of rice crop cause severe losses in rice cultivation. Importantly, the occurrence of simultaneous onset of warm weather and rice heading has devastating impact due to environmental factors which favor pathogenesis. A sustainable management strategy is an urgent need to deliver full-proof and effective remedy to BPB of rice. Along with traditional measures, genetic resources such as resistant and susceptible cultivars have been identified that are used in breeding strategies to identify QTLs. These identified regions have potential genes that could be further characterized in providing BPB resistance. A mutagenesis-led approach in B. glumae has identified key targets of its pathogenicity that were utilized to generate biocontrol strain. The practice of biocontrol strains has a significant contribution to controlling BPB in rice globally. So far, various strategies have been employed to deliver measures against BPB, but unfortunately, none of the strategies came out as absolute measures against BPB in rice. A lot of research possibilities have come up with recent discoveries about its genetic and molecular understanding about B. glumae­ rice interactions. An integrative management strategy involving traditional, breeding, and molecular approaches could be adopted to provide efficient and sustainable management.

Insights from the Conventional Breeding and Molecular Approaches

139

KEYWORDS • • • • • •

backcross inbred line chromosome segment substitution lines exopolysaccharides integrative management strategy quantitative trait locus recombinant inbred lines

REFERENCES Adachi, N., Tsukamoto, S., Inoue, Y., & Azegami, K., (2012). Control of bacterial seedling rot and seedling blight of rice by bacteriophage. Plant Disease, 96(7), 1033–1036. Chen, R., Barphagha, I. K., & Ham, J. H., (2015). Identification of potential genetic components involved in the deviant quorum-sensing signaling pathways of Burkholderia glumae through a functional genomics approach. Frontiers in Cellular and Infection Microbiology, 5, 22. Cho, H. S., Park, S. Y., Ryu, C. M., Kim, J. F., Kim, J. G., & Park, S. H., (2007). Interference of quorum sensing and virulence of the rice pathogen Burkholderia glumae by an engineered endophytic bacterium. FEMS Microbiology Ecology, 60(1), 14–23. Choi, J. E., Nguyen, C. M., Lee, B., Park, J. H., Oh, J. Y., Choi, J. S., Kim, C. J. C., & Song, J. K., (2018). Isolation and characterization of a novel metagenomic enzyme capable of degrading bacterial phytotoxin toxoflavin. PloS One, 13(1), e0183893. Chung, E. J., Hossain, M. T., Khan, A., Kim, K. H., Jeon, C. O., & Chung, Y. R., (2015). Bacillus oryzicola sp. nov., an endophytic bacterium isolated from the roots of rice with antimicrobial, plant growth promoting, and systemic resistance inducing activities in rice. The Plant Pathology Journal, 31(2), 152. Cui, Z., Ibrahim, M., Yang, C., Fang, Y., Annam, H., Li, B., Wang, Y., Xie, G. L., & Sun, G., (2014). Susceptibility of opportunistic Burkholderia glumae to copper surfaces following wet or dry surface contact. Molecules, 19(7), 9975–9985. Devescovi, G., Bigirimana, J., Degrassi, G., Cabrio, L., LiPuma, J. J., Kim, J., Hwang, I., & Venturi, V., (2007). Involvement of a quorum sensing- regulated lipase secreted by a clinical isolate of Burkholderia glumae in severe disease symptoms in rice. Appl. Environ. Microbiol., 73, 4950–4958. Dixit, S., Singh, U. M., Singh, A. K., Alam, S., Venkateshwarlu, C., Nachimuthu, V. V., Yadav, S., et al., (2020). Marker-assisted forward breeding to combine multiple biotic-abiotic stress resistance/tolerance in rice. Rice, 13(1), 1–15. Francis, F., Kim, J., Ramaraj, T., Farmer, A., Rush, M. C., & Ham, J. H., (2013). Comparative genomic analysis of two Burkholderia glumaestrains from different geographic origins reveals a high degree of plasticity in genome structure associated with genomic islands. Mol. Genet. Genom., 288, 195–203.

140

Bacterial Diseases of Rice and Their Management

Groth, D. E., Linscombe, S. D., & Sha, X., (2007). Registration of two disease-resistant germplasm lines of rice. Journal of Plant Registrations, 1(1), 63–64. Ham, J. H., Melanson, R. A., & Rush, M. C., (2011). Burkholderia glumae: Next major pathogen of rice?. Molecular Plant Pathology, 12(4), 329–339. Hayashi, K., Yasuda, N., Fujita, Y., Koizumi, S., & Yoshida, H., (2010). Identification of the blast resistance gene pit in rice cultivars using functional markers. Theor. Appl. Genet., 121, 1357–1367. Hikichi, Y., (1993). Mode of action of oxolinic acid against bacterial seedling rot of rice caused by Pseudomonas glumae. I. Relationship between population dynamics of P. glumae on seedlings of rice and disease severity of bacterial seedling rot of rice. Ann. Phytopathol. Soc. Jpn., 59, 441–446. Ishihara, T., Hayano-Saito, Y., Oide, S., Ebana, K., La, N. T., Hayashi, K., Ashizawa, T., Suzuki, F., & Koizumi, S., (2014). Quantitative trait locus analysis of resistance to panicle blast in the rice variety Miyazakimochi. Rice, 7, 2. [CrossRef] [PubMed]. Jung, W. S., Lee, J., Kim, M. I., Ma, J., Nagamatsu, T., Goo, E., Kim, H., et al., (2011). Structural and functional analysis of phytotoxin toxoflavin-degrading enzyme. PLoS One, 6(7), e22443. Kang, Y., Kim, J., Kim, S., Kim, H., Lim, J. Y., Kim, M., Kwak, J., Moon, J. S., & Hwang, I., (2008). Proteomic analysis of the proteins regulated by HrpB from the plant pathogenic bacterium Burkholderia glumae. Proteomics, 8, 106–121. Kim, J., Kim, J. G., Kang, Y., Jang, J. Y., Jog, G. J., Lim, J. Y., Kim, S., et al., (2004). Quorum sensing and the LysR-type transcriptional activator ToxR regulate toxoflavin biosynthesis and transport in Burkholderia glumae. Molecular Microbiology, 54(4), 921–934. Kim, J., Kim, N., Mannaa, M., Lee, H. H., Jeon, J. S., & Seo, Y. S., (2019). Characterization of Burkholderia glumae putative virulence factor 11 (PVF11) via yeast two-hybrid interaction and phenotypic analysis. The Plant Pathology Journal, 35(3), 280. Kim, J., Mannaa, M., Kim, N., Lee, C., Kim, J., Park, J., Lee, H. H., & Seo, Y. S., (2018). The roles of two hfq genes in the virulence and stress resistance of Burkholderia glumae. The Plant Pathology Journal, 34(5), 412. Lee, C., Lee, H. H., Mannaa, M., Kim, N., Park, J., Kim, J., & Seo, Y. S., (2018). Genomicsbased sensitive and specific novel primers for simultaneous detection of Burkholderia glumae and Burkholderia gladioli in rice seeds. The Plant Pathology Journal, 34(6), 490. Lee, C., Mannaa, M., Kim, N., Kim, J., Choi, Y., Kim, S. H., Jung, B., et al., (2019). Stress tolerance and virulence-related roles of lipopolysaccharide in Burkholderia glumae. The Plant Pathology Journal, 35(5), 445. Lee, S. Y., Kim, Y. H., & Lee, G. S., (2017). Mapping QTLs associated with germination stability following dry-heat treatment in rice seed. 3 Biotech, 7(3), 220. Li, Z. K., Luo, L. J., Mei, H. W., Paterson, A. H., Zhao, X. H., Zhong, D. B., Wang, Y. P., Yu, X. Q., Zhu, L., Tabien, R., et al., (1999). A “defeated” rice resistance gene acts as a QTL against a virulent strain of Xanthomonas oryzae pv oryzae. Mol. Genet. Genom., 261, 58–63. [CrossRef]. Li, Z., Pinson, S. R. M., Marchetti, M. A., Stansel, J. W., & Park, W. D., (1995). Characterization of quantitative trait loci (QTLs) in cultivated rice contributing to field resistance to sheath blight (Rhizoctonia solani). Theoretical and Applied Genetics, 91(2), 382–388. Lim, J., Lee, T. H., Nahm, B. H., Choi, Y. D., Kim, M., & Hwang, I., (2009). Complete genome sequence of Burkholderia glumae BGR1. J. Bacteriol., 191(11), 3758, 3759.

Insights from the Conventional Breeding and Molecular Approaches

141

Liu, Q., Li, X., Yan, S., Yu, T., Yang, J., Dong, J., Zhang, S., et al., (2018). OsWRKY67 positively regulates blast and bacteria blight resistance by direct activation of PR genes in rice. BMC Plant Biology, 18(1), 1–13. Liu, Y., Qi, X., Young, N. D., Olsen, K. M., Caicedo, A. L., & Jia, Y., (2015). Characterization of resistance genes to rice blast fungus Magnaporthe oryzae in a “green revolution” rice variety. Mol. Breed., 35, 52. Magbanua, Z. V., Arick, M., Buza, T., Hsu, C. Y., Showmaker, K. C., Chouvarine, P., Deng, P., et al., (2014). Transcriptomic dissection of the rice–Burkholderia glumae interaction. BMC Genomics, 15(1), 755. Mcclung, A., Mcclung, A., Marchetti, M., Lai, X., & Tillman, B., (1996). Association of genetic and environmental factors with panicle blight. In: Rice Technical Working Group Meeting Proceedings. Mizobuchi, R., Fukuoka, S., Tsuiki, C., Tsushima, S., & Sato, H., (2018). Evaluation of major Japanese rice cultivars for resistance to bacterial grain rot caused by Burkholderia glumae and identification of standard cultivars for resistance. Breeding Science, 18018. Mizobuchi, R., Sato, H., Fukuoka, S., Tanabata, T., Tsushima, S., Imbe, T., & Yano, M., (2013). Mapping a quantitative trait locus for resistance to bacterial grain rot in rice. Rice, 6(1), 13. Mizobuchi, R., Sato, H., Fukuoka, S., Tsushima, S., Imbe, T., & Yano, M., (2013). Identification of qRBS1, a QTL involved in resistance to bacterial seedling rot in rice. Theoretical and Applied Genetics, 126(9), 2417–2425. Molina, L., Constantinescu, F., Michel, L., Reimmann, C., Duffy, B., & Defago, G., (2003). Degradation of pathogen ´ quorum-sensing molecules by soil bacteria: A preventive and curative biological control mechanism. FEMS Microbiol. Ecol., 45, 71–81. Mulaw, T., Wamishe, Y., & Jia, Y., (2018). Characterization and in plant detection of bacteria that cause bacterial panicle blight of rice. American Journal of Plant Sciences, 9(4), 667–684. Ortega, L., Walker, K. A., Patrick, C., Wamishe, Y., Rojas, A., & Rojas, C. M., (2020). Harnessing Pseudomonas protegens to control bacterial panicle blight of rice. Phytopathology®, PHYTO-02. Pedraza, L. A., Bautista, J., & Uribe-Vélez, D., (2018). Seed-born Burkholderia glumae infects rice seedling and maintains bacterial population during vegetative and reproductive growth stage. The Plant Pathology Journal, 34(5), 393. Peñaloza, A. G. C., Murillo, A. W., Eras, J., Oliveros, D. F., & Méndez, A. J. J., (2020). Rice-associated rhizobacteria as a source of secondary metabolites against Burkholderia glumae. Molecules, 25(11), 2567. Peng, J., Lelis, T., Chen, R., Barphagha, I., Osti, S., & Ham, J. H., (2020). tepR encoding a bacterial enhancer-binding protein orchestrates the virulence and interspecies competition of Burkholderia glumae through qsmR and a type VI secretion system. Molecular Plant Pathology, 21(8), 1042–1054. Pinson, S. R. M., Capdevielle, F. M., & Oard, J. H., (2005). Confirming QTLs and finding additional loci conditioning sheath blight resistance in rice using recombinant inbred lines. Crop Sci., 45, 503–510. Prabhu, A. S., & Bedendo, I. P., (1988). Glume blight of rice in Brazil: Etiology, varietal reaction and loss estimates. International Journal of Pest Management, 34(1), 85–88. Ramalingam, J., Savitha, P., Alagarasan, G., Saraswathi, R., & Chandrababu, R., (2017). Functional marker-assisted improvement of stable cytoplasmic male sterile lines of rice for bacterial blight resistance. Frontiers in Plant Science, 8, 1131.

142

Bacterial Diseases of Rice and Their Management

Rutherford, S. T., & Bassler, B. L., (2012). Bacterial quorum sensing: Its role in virulence and possibilities for its control. Cold Spring Harbor Perspectives in Medicine, 2(11), a012427. Safni, I., & Lubis, K., (2019). Screening for disease resistance in rice varieties against bacterial panicle blight disease (Burkholderia glumae) in Northern Sumatra of Indonesia. In: IOP Conference Series: Earth and Environmental Science (Vol. 260, No. 1, p. 012118). IOP Publishing. Schaad, N. W., Jones, J. B., & Chun, W., (2001). Laboratory Guide for Identification of Plant Pathogenic Bacteria (3rd edn.) St. Paul, MN, USA: The American Phytopathological Society Press. Sharma, T. R., Rai, A. K., Gupta, S. K., Vijayan, J., Devanna, B. N., & Ray, S., (2012). Rice blast management through host-plant resistance: Retrospect and prospects. Agricultural Research, 1(1), 37–52. Shrestha, B. K., Karki, H. S., Groth, D. E., Jungkhun, N., & Ham, J. H., (2016). Biological control activities of rice-associated Bacillus sp. strains against sheath blight and bacterial panicle blight of rice. PloS One, 11(1), e0146764. Suárez-Moreno, Z. R., Vinchira-Villarraga, D. M., Vergara-Morales, D. I., Castellanos, L., Ramos, F. A., Guarnaccia, C., Degrassi, G., et al., (2019). Plant-growth promotion and biocontrol properties of three Streptomyces spp. isolates to control bacterial rice pathogens. Frontiers in Microbiology, 10, 290. Tabien, R. E., Li, Z., Paterson, A. H., Marchetti, M. A., Stansel, J. W., & Pinson, S. R. M., (2002). Mapping QTL for field resistance to the rice blast pathogen and evaluating their individual and combined utility in improved varieties. Theor. Appl. Genet., 105, 313–324. Yokoo, M., Kikuchi, F., Fujimaki, H., & Nagai, K., (1978). Breeding of blast resistant lines (BLI to 7) from indica-japonica crosses of rice. Japanese Journal of Breeding, 28(4), 359–365. Zarbafi, S. S., & Ham, J. H., (2019). An overview of rice QTLs associated with disease resistance to three major rice diseases: Blast, sheath blight, and bacterial panicle blight. Agronomy, 9(4), 177. Zhou, X. G., (2019). Sustainable strategies for managing bacterial panicle blight in rice. In: Protecting Rice Grains in the Post-Genomic Era. IntechOpen. Zhou-Qi, C., Bo, Z., Guan-lin, X., Bin, L., & Shi-wen, H., (2016). Research status and prospect of Burkholderia glumae, the pathogen causing bacterial panicle blight. Rice Science, 23(3), 111–118.

CHAPTER 8

Understanding the Biology of Rice Bacterial Brown Stripe Pathogen and Conventional Strategies for Its Management DEEPAK BABOO,1 MUKUL KUMAR,1 A. K. MISHRA,2 and MOHAMMED SAID3 Department of Plant Pathology, Chandra Shekhar Azad University of Agriculture and Technology, Kanpur, Uttar Pradesh–208002, India, E-mail: [email protected] (D. Baboo)

1

Department of Plant Pathology, Tirhut College of Agriculture, Dholi, (R. P. C. A. U.) Pusa, Samastipur, Bihar–848125, India

2

Department of Agriculture Institute of Agricultural Sciences, Integral University, Lucknow, Uttar Pradesh, India

3

ABSTRACT Rice (Oryza sativa L.) is the most commonly cultivated food grain crop in India and throughout the world. Rice is susceptible to many destructive diseases, among them bacterial diseases reported to major constrain in their production, which causes significant yield loss. Major bacterial diseases affecting their viz., Xanthomons oryzae pv. oryzae, Xanthomonas oryaze pv. oryzacola, Burkholderia glumae, and Pseudomonas avenae are the most common occurring phytopathogens. On the basis of numerous studies, bacterial panicle blight (BPB), Bacterial leaf blight (BLB) and bacterial leaf streak (BLS) are the most devastating diseases in terms of disease severity and economic losses. It is difficult to Bacterial Diseases of Rice and Their Management. Deepti Srivastava, Md. Shamim, Malik Mobeen Ahmad, & K. N. Singh (Eds.) © 2023 Apple Academic Press, Inc. Co-published with CRC Press (Taylor & Francis)

144

Bacterial Diseases of Rice and Their Management

manage such a disease without endangering the environment or human health. Chemicals have a negative impact on the natural ecology and are not cost-effective. The management of such disorders using an environmentally friendly strategy is covered in this review. Adopting such techniques aids in the maintenance of the cost-benefit ratio by generating profit. These procedures can help to lessen the chemical’s hazardous residual effect. It also advises that appropriate cultural and physical methods be adopted. 8.1 INTRODUCTION According to rice is mentioned multiple times in ancient Hindu scriptures and literature, according to archaeological evidence and several references to rice in ancient Hindu scriptures and literature rice is supposed to be culti­ vated since ancient times in India. Carbonized grains of paddy were found at different excavation sites of Hastinapur (Uttar Pradesh) dated between 1000 and 750 B.C. This is the oldest specimen rice that has been known to the world. As per the De Candolle (1886); and Watt (1892) rice was originated in South India. Later, Vavilov in 1926 proposed that India and Burma can be the origin place of cultivated rice. Rice is one of the major important cereal crops and of great significance in India and world. The crop is grown on approx. 155 million hectares of land area with a total paddy production of about 596 million tons. Worldwide in terms of area and production, it ranks second to wheat but in India, it stands first in position in terms of both area and production. Of the total nutrition percentage, rice alone offers about 22% and 17% of calories and proteins, respectively. The maximum is of rice cultivation is in the Asia continent. Among all the rice-growing countries, India stands first in terms of area (44.8 million hectares), followed by China and Indonesia, while with respect to production, India bags the second position with 117.47 million metric tons of paddy with first being China (148.5 million metric tons). However, in terms of productivity (average yield per hectare), Egypt holds first position, which was followed by the USA, while that of India is only 2,929 kg per hectare. It is a primary staple food for a huge population in Asia, Africa, and Latin America. Consumption of rice accounts for over 90% of the world’s population in Asia, with China, India, and Indonesia producing 30.85%, 20.12% and 8.21%, respectively of total global rice production (USDA, 2012; Kadu et al., 2015). In India, rice plays an imperative role in the national food grain supply covering around 23.3% of the gross cropped area of the country. It puts up 43% out of total food grain production and for

Understanding the Biology of Rice Bacterial Brown Stripe

145

total cereal production 46% of nation. The success of the green revolution was attributed due to the use of high-yielding varieties, adequate irrigation facilities, fertilizers availability, and other complementary inputs. Over the last three decades, rice production has amplified at a rapid rate of 2.5% per year in Asian countries than any other crop and has kept the speed with growing population from the 1960s. The most important outcome of this is that it secures an adequate supply of the food grain, which decreases the prevent index. However, in recent years, with overwhelming growth in medicine areas, the population has outreached the production of rice due to an exponential rise in population and other constraints, i.e., pest and disease problems in rice cultivation (Hossain, 1999). Diseases have always proved a significant impact on rice supply. Historically, severe epidemics led to serious food shortages in different region of our country, such as Bihar and West Bengal. The Bengal famine in 1942 was attributed to brown spot disease, which was caused by Helminthosporium oryzae (Padmanabhan, 1973). Rice blast epidemics were responsible for a major food crisis in Korea in the 1970s (Ou, 1985). It was estimated that the yield losses range from 10–50%. Taking into consideration of the world’s largest rice production area, even a minimum annual loss of 1–5% would transform into thousands of tons of rice and loss of billion dollars. Thereby, reducing the incidence of disease epidemics are central way to sustain rice productivity and reducing year-to-year losses. To achieve this goal, it is important for us to recognize the amount of damage caused by these diseases. Two technological changes associated with the Green Revolution have an important impact on diseases. Firstly, the improvement of shorter period and agronomically well-suited varieties were allowed for rice intensification in time and space. Although these are necessary component to achieve greater rice productivity, intensification also increases the vulnerability of the rice crop to pests and diseases by continuously exposing them. Secondly, the use of genetically uniform varieties reduces buffering capacity in the cropping system and leads to easy adaptation of pathogen towards the crop. For decades, disease and pest management have completely relied on the use of new resistant varieties and on the application of synthetic chemical pesticides. This often results into familiar “boom and bust” cycles where a few disease-resistant varieties were available for cultivation. Ou (1985) reported 56 different diseases caused by fungi, among them 41 were of seed-borne (Richardson, 1979, 1981). Due to seed-borne diseases, the global losses are anticipated to be 12–15% of potential produc­ tion (Agarwal and Sinclair, 1987). When seeds are sown in the field without

Bacterial Diseases of Rice and Their Management

146

treating with biological antagonist or fungicide, the crop yield is reduced up to 15–90% (Zafar et al., 2014) due to the prevalence of seed-borne pathogens. Seeds are susceptible to a number of phytopathogenic diseases; of which bacterial diseases are the most destructive which can cause a yield loss in significant quantity. Prominent bacterial diseases such as bacterial blight (BB) of rice caused by Xanthomonas oryzae pv. oryzae, BLS caused by Xanthomonas oryaze pv. oryzacola, BPB caused by Burkholderia glume and bacterial brown stripe (BBS) caused by Pseudomonas avenae are all produces seedborne inoculum due to which they became important seedling diseases. Seed treatment (ST) by chemicals is already practiced in most of East Asian countries. BBS, also isknown as bacterial stripe reported to cause problem in upland, wetland, and nursery in boxes as well. Even though, it is extensively dispersed in most of the rice growing countries (Shakya et al., 1985). 8.2 LIST OF BACTERIAL DISEASE HAMPERING THE RICE PRODUCTION One of the main hindrances in rice production is the recurrent attack by different bacteria. There are three main important disease of bacteria which causes considerable financial loss in the production of rice are BLB caused by Xanthomonas oryzae pv. oryzae (Xoo), BLS caused by Xanthomonas oryaze pv. oryzacola followed by BBS which is caused by Acidovorax oryzae (AO). The application of bactericide is largely responsible for the current management of rice BLB and BBS. Present day our environment is continuously depleting due to indiscriminate use of chemical fungicide, insecticide, bactericide, and herbicides. So, we should pay more attention towards environment’s health to sustain our lives. In this regard, there is a requirement for a long-term sustainable approach to manage the disease instead of indiscriminate use of chemical pesticides. SL. No.

Common Name

Causal Organism

1.

Bacterial leaf blight

Xanthomonas oryzae

2.

Bacterial leaf streak

Xanthomonas oryaze pv. oryzacola

3.

Sheath brown rot

Pseudomonas fuscovaginae

4.

Grain rot/panicle blight

Burkholderia glumae

5.

Bacterial brown stripe

Pseudomonas avenae

Understanding the Biology of Rice Bacterial Brown Stripe

147

8.3 HISTORY OF BACTERIAL BROWN STRIPE PATHOGEN, ITS CLASSIFICATION • •

Acidovorax avenae subsp. avenae Pseudomonas syringae pv. panici     

Domain: Bacteria Phylum: Proteobacteria Class: Betaproteobacteria Order: Burkholderiales Family: Comamonadaceae

Bacterial brown stripe of rice (BBSR), known to be caused by Acidovorax avenae subsp. avenae, was reported first time in rice in Japan (Goto and Ohata, 1961). Later, it has been subsequently reported from many countries including continent such as Asia, Africa, USA, and Europe (Xie et al., 1998). In China, the causal organism of this disease was often reported as Pseudomonas syringae pv. panici or Pseudomonas panici, neither epithet, however, has been legally published (Duan et al., 1986). Initially, the disease was of minor importance and in past three decades, it had occurred infrequently in a very minute level in rice cropping areas particularly near Yangtze River basin and southern China. Recently, its presence also seen in northern colder region of rice growing area. 8.4 GEOGRAPHICAL DISTRIBUTION AND ECONOMIC LOSS HISTORY BBS disease is commonly found in areas having high temperature and humidity. Infected leaves or waters can provide a safe home to different bacteria or leftover plant part or debris of Acidovorax avenae subsp. avenae can serve as a source of infection in healthy crops or after harvest. This disease mainly arises in Asian and African countries such as Bangladesh, Cambodia, China, Comoro Islands, Egypt, Ethiopia, Ivory Coast, Kenya, Madagascar, Malawi, and Mauritius as well as some areas of South America and Australia where tropical and subtropical conditions are more prevalent. The progress of disease development was 20–25% in paddy fields. But there are reports of seedling mortality rate which could be more than 60%. Recently in a decade (2010–2020), two times serious outbreak occurred in China, first in 2010 and then in 2018. The outbreak of disease is reported in areas of Sichuan, Hunan, Hubei, Anhui, and Chongqing provinces and in the upper regions of Yangtze River, Liaoning, and Jilin provinces of northeast

148

Bacterial Diseases of Rice and Their Management

China. More than 1.0-million-hectare area of rice field was seriously infected or damaged by BBSR. Outbreak of this disease was observed on the varieties such as Y Liangyou 957 (hybrid rice) and Yanjing 47 (japonica) in China. 8.5 HOST PLANT Plant on which pathogen/microorganism live, survive, get nutrition and multiply to increase their population in nature is known as host plant. This bacterium mainly survives and multiply on member of Poaceae family, e.g., Rice (Oryza sativa), Sugarcane (Saccharum officinarum), Maize (Zea mays), Teosinte (Euchlaena mexicana) and other member of Poaceae family. 8.6 SIGNS AND SYMPTOMS BBS in rice, caused by P. avenae Manns, is a disease that has an effect mainly at seedlings stage of rice. The symptoms at seedling stage of rice can be divided into four different stages namely: (i) inhibition of germina­ tion; (ii) curving of a leaf sheath; (iii) abnormal elongation of a mesocotyl; and (iv) brown stripes on a leaf either along midribs of leaves or along the leaf margins. When the seed begins to germinate at the seedling stage, the initial inhibition of germination can be noticed. When the coleoptile length is approximately 1 cm long, it turns to pale yellow-brownish color accompa­ nied by a water-soaked lesion and stops growing further. Consequently, few seeds die even without germination. While those which are not dead at the germination stage, due to unfavorable circumstances for pathogen growth either presented by host or minor changes in micro and macro environment, later on had shown curvings of a leaf sheath and relatively poor growth in size than healthy ones can be observed. One side of the leaf sheath may grow more rapidly than the other, leading to the leaf sheath to curve. The degree of curving of leaf sheath varied among the seedlings of different varieties. Remarkable reduction in growth of seminal root could be observed in the case of curved seedling. Abnormal elongation of mesocotyl can be observed along with the crown root that grows at the node of the coleoptile. The majority of seedlings with these symptoms had died before reaching to the third or fourth leaf stage. Brown stripe first appears on a coleoptile as a water-soaked dark-brown patch with a width of less than 1 mm. The sheaths and blades of the first and second leaves were included in the regions. The symptom may also be seen on the curved and seedlings of elongated mesocotyl at the

Understanding the Biology of Rice Bacterial Brown Stripe

149

same time. With these symptoms, most of the seedlings died as they reach to the 2nd or 3rd leaf stage. When the symptom appears at or after the 4th leaf stage, it is generally observed only on the lower leaves and had very minute impact on the growth of the seedlings. In the mid-stage of crop growth, the symptoms after 5 days of emergence, start showing as brown stripes from the lower part of stems which commonly extend to sheaths, followed by leaf midrib and subsequently throughout the full seedling at one-leaf stage. When the infected seedlings are used for transplanting to the paddy fields, the symptoms are generally masked. Accordingly, natural incidence of the disease could be unnoticeable by farmer at this stage. However, it can be confirmed by needle prick inoculation on the leaf sheath. When leaf sheath is inoculated with needle prick, the brown stripe comes out with the inoculated spots at tillering stage (Kadota and Ohuchi, 1983). In light of the perception of the covered manifestations at the tillering stage as referenced above, it can be assumed that the manifestations of the illness may happen just at the seedling phase of rice plants. Symptom may develop at the panicle initiation stage when the paddy fields are flooded. Heavy rainfall at panicle formation stage leads to twisting of the panicles. It included: (1) anomalous stretching of the first and second internodes; (2) bending of rachis; (3) decrease of rachis-branch and turning earthy colored tone; (4) strange elongation of palea and lemma to the long pivot. At the heading stage, a dark green water-soaked lesion was faintly seen on the palea and lemma only. When the infected seeds were sown in nursery boxes, brown stripes disease emerged with infected seedlings of up to 80%. 8.7 PATHOGEN BIOLOGY BBS disease is caused by both P. avenae and P. syringae pv. panici bacterial species. While both P. avenae and P. syrinage pv. panici are Gram-negative, non-encapsulated rods of size 0.92–2.4 × 0.5–0.7 µm, with one or two flagella. P. syrinage pv. panici differs in spore formation while P. avenae is a non-spore forming bacteria (Shakya et al., 1985). 8.8 DISEASE CYCLE AND EPIDEMIOLOGY Both P. avenae and P. syrinage pv. panici are seedborne pathogens that commonly infect member of Poaceae family viz. barley (Hordeum vulgare), pearl millet (Pennisetum glaucum), sugarcane (Saccharum officinarum),

150

Bacterial Diseases of Rice and Their Management

proso millet (Panicum miliaceum), Foxtail millet (Setaria italica) and maize (Zea mays L.), etc. The disease cycle begins when seed borne inoculum are sown in the nursery and it transplanted in the main field of paddy. Pathogenic bacterial cells in found the harvested crop debris start colonizing the paddy cotyledons upon germination. The bacterium infects the host plants through natural openings such as stomata or wounds wherein they start multiplying inside or on the leaves. It has been believed that soil containing infested crop debris that is being scattered through wind can be an efficient method of dispersion the bacterium inoculum. Besides, these pathogens can also be disseminated from one field to another field by irrigation water, splashing rain, contaminated equipment, or workers of the field. 8.9 INTEGRATED APPROACH OF DISEASE MANAGEMENT The IDM program encompasses all the existing disease management measures, such as cultural, biological, and chemical management methods, with the aim of keeping disease incidence below economic threshold levels while maintaining the environmental safety. Cultural practices involve all the management practices that are being applied pre and post sowing but before the harvesting time. It is an important practice that helps in preven­ tion and management of plant disease. Cultural practices favor the plant growth over the harmful pathogen. Field sanitation by burning of infected crop residue. It is used to eradicate, eliminate the pathogen, and make the transplant-free from pathogen. Avoid soil movement from one field to another field by decontaminating the implement used on farm. Crop rotation should be adopted for 2–4 year so that the life cycle of the pathogen may be interrupted. Collection and destruction of harvested infected crop debris as well as removal of alternate and collateral weeds should be done in a proper way to remove the infection of pathogen for the next season crop. Inter­ cultural operations should be avoided in the early stage of the crop as the pathogens can directly enter the host through wounds. Proper use of organic amendments such as FYM and vermicompost should be done to minimize the soil infestation. Soil solarization and mulching with polyethylene may be effective in the management of this disease. Use of wider plant spacing (30 × 15 cm) for proper irrigation and drainage at the time of transplanting can be an efficient way to minimize the phytopathogen spread. Clipping of seedling tips should also be avoided at the time of transplanting. Use of healthy and resistance varieties such as IR-20, IRBB21, IR-36, Sasyasree, Govind, Pant

Understanding the Biology of Rice Bacterial Brown Stripe

151

Dhan-4, Pant Dhan-6, Saket-4, Rajendra Dhan 200, Pusa-2-21, Ratna CR-10, IR64, IR72, Minghui 63 BG 90-2 can be taken into consideration for sowing as it is the safest and most economical way for crop production. While mechanical control involves deep and summer plowing of the field so that bacteria surviving at depth of soil can be overturned and exposed to intense sunlight by which pathogen may kill due to desiccation, Physical control involves dry heat treatment at 65°C for 6 days that can eradicate the plant pathogens from seeds (Zeigler and Alvarez, 1988). As per the recom­ mendations of Tagami and Mizukami (1962), primary inoculum of seeds can also be eliminated by hot water treatment at 57 ºC for 10 min. Solar heat treatment should also be performed by soaking the seed for overnight and then dry the seed at pukka floor at high light intensity, i.e., at around 12:00 noon. In recent, trends due to rise in temperature day by day and environ­ ment hazard biological control are in huge demand. It occupies harnessing of disease suppressive microorganism for the betterment of plant health. To suppress the disease through biological agent is the sustained manifestation of interaction among the pathogen, the BCA (antagonist), the microbial population on and around the plant (host) and its physical environment. Chemical pesticides show quick action in plant disease management, i.e., it shows immediate action. Fungicide shows four different physical mode of action: (i) protective; (ii) after infection; (iii) pre-symptom; and (iv) anti­ sporulant (post-symptom) The word fungicide is derivative of two Latin words, viz., fungus and caedo. Fungus-means fungi and caedo-means to kill. Thus, the fungicide can be defined as any chemical which has the property of killing fungus. However, Anti-sporulants are those chemicals that have the property to restrain the spore production without affecting the growth of vegetative hyphae. Fumigants are the chemical substances that can act as a lethal agent at ambient temperatures and pressures and are generally used in gaseous forms. In gaseous form, it diffuses through air and penetrates inside the soil or farm products. This penetration interferes with the metabolic activity of organisms creating a lethal outcome. In plant disease management, fumigants are generally used to manage soil-borne pathogens. In nursery boxes, spraying of Kasugamycin (KSM) can manage the phytopathogens. Seed soaking overnight in 100 ppm Streptocycline solution (Devadath and Padmanabhan, 1970). The combined effect of 0.025% Streptocycline with hot water treatment at the temperature of 52°C for 30 min can be a successful method in eliminating the seed infection. Using of Streptocycline @ 100 g a.i./l or Agrimycin-100 @ 100 g a.i./l (Banerjee et al., 1984), Oxolinic acid @ 300 g a.i./l or streptomycin sulfate @ 100 g a.i./l, glycocide B @ 700 g

152

Bacterial Diseases of Rice and Their Management

a.i./l, KSM @ 80 g a.i./l (Shtienberg et al., 2001) recommended 3 sprays at the regular intervals of 10 days starting from the first manifestation of the disease (Banerjee et al., 1984). Bio-rationals can be defined as compounds originating from the plants, animals, and other microbes that have limited or no adverse effects on the environment or beneficial organisms. Spray fresh cow dung 20% extracts twice starting from the initial manifestation of the disease and after that at a regular fortnightly interval. Spray application of Neem oil 60 EC @3% or NSKE @5% for disease control can also be done. Commercially avail­ able BCAs are Trichoderma harzianum and Gliocladium virens of fungal origins, in Actinomycete group Streptomyces griseoviridis acts as BCA while Bacillus subtilis comes from bacterial group are being used for plant disease management practices. Application of P. fluorescens includes wet ST @ 10 g per kg of seed; Soil application (SA) @ 2.5 kg/ha basal along with 50 kg of well decomposed FYM and Foliar spray @ 0.2% on 60 and 75 DAS (Jeyalakshmi, 2010). For quick action we all and farmer have to be mainly relied on chemical control. In plant, major diseases are known to be caused by fungi>bacteria> virus. So, fungicide and bactericide are the important component in plant disease management. Application of Streptomyces toxytricini, Bacillus subtilis var. amyloliquefaciens, Pseudomonas fluorescens and Lysobacter antibioticus includes wet ST @ 10 g per kg of seed (Velusamy et al., 2006; Ji et al., 2008; Nagendran et al., 2013; Hop et al., 2014; Sharma et al., 2015). Viral disease can only be managed by controlling its insect vector. So, application of insecticide is the only way to manage viral disease among chemical control. Bacteriophages (phages) against bacterial spot-on tomato had been tested recently for their biocontrol activity. Phages are those viruses that specifically infect concerned bacteria. 8.10 CONCLUSION The major challenge in production/cultivation of crop is biotic and abiotic constraints. Abiotic constraints are the constraints that arise due to non­ living components of the environment. However, biotic constraints are due to living component of the nature. Among biotic constraints pest and disease produces major challenge. In plant, major losses are due to disease caused by Bacteria and fungi. Rice occupied maximum area under any crop and it also contributes maximum food grain production. In spite of leading in production, rice crop faces a lot of disease and pest problem which retard their productivity. Among all the disease now a day’s BBS are emerging

Understanding the Biology of Rice Bacterial Brown Stripe

153

as a major disease of rice which are previously of minor importance. BBS of rice first time reported from Japan in 1961. Acidovorax avenae subsp. avenae is reported as a causal organism. But later, Pseudomonas syringae pv. panici or Pseudomonas panici reported as a causal organism from China. Later on, Acidovorax avenae or Pseudomonas avenae was believed to be a causal organism of this disease. To overcome this challenge against pathogen farmers and growers started indiscriminate use of chemical pesticide as well as fertilizers due to which our environment gets deteriorated and health of human and animal came in danger. Due to indiscriminate use of pesticides and fertilizer, Resistance against such chemical pesticides has been reported. To conserve our natural ecosystem use of bio-agent becomes necessary. But, bio-agent show slow and steady action and farmers need immediate action, complete dependence on biological control is also not practically possible. So, by integrating all available possible combination disease management strategies should be applied. Integrated approaches to disease management are eco-friendly in nature and low-cost input. As an ecological point of integrated approach of disease management bring harmony between natural and artificial ecosystem. If it is adopted for the long term then a chance of development of Biotype depletion of diversity becomes very less. The integrated approach of disease management should be adapted right from plowing to marketing. Plant pathologists continue to be intrigued by bacterial infections of rice because chemical control is difficult to create. Specific bactericides are gradually making their way to the forefront, but they must be combined with cultural, breeding, and biotechnological strategies to usher in a polyphasic disease control approach. KEYWORDS • • • • • • •

Acidovorax oryzae bacterial brown stripe Burkholderia glumae eco-friendly practices Oryza sativa seed treatment Xanthomonas oryzae

154

Bacterial Diseases of Rice and Their Management

REFERENCES Adur-Okello, S. E., Alibu, S., Lamo, J., Ekobu, M., & Otim, M. H., (2020). Farmers’ knowledge and management of rice diseases in Uganda. Journal of Agricultural Science, 12(12), 78–89. Banerjee, A. K., Rai, M., Srivastava, S. S. L., & Singh, D. V., (1984). Suitable dose of streptocycline and agrimycin-100 for the control of bacterial leaf streak of paddy. Indian Phytopathology (India), 6(1), 37–51. Benedict, A. A., Alvarez, A. M., Berestecky, J., Imanaka, W., Mizumoto, C. Y., Pollard, L. W., & Gonzalez, C. F., (1989). Pathovar-specific monoclonal antibodies for Xanthomonas campestris pv. oryzae and for Xanthomonas campestris pv. oryzicola. Phytopathology, 79(3), 322–328. Bin, L., Baoping, L., Rongrong, Y., Zhongyun, T., Yanli, W., Guanlin, X., Hongye, L., & Guochang, S., (2011). Bacterial brown stripe of rice in soil-less culture system caused by Acidovorax avenae subsp. avenae in China. J. Gen. Plant Pathol., 77(3), 64–67. CGIAR (Consultative Group on International Agricultural Research), (1998). Integrated Pest Management at the International Agricultural Research Centers. System wide Program on Integrated Pest Management (SP-IPM) of the CGIAR. Chatterjee, S., Gangopadhyay, C., Bandyopadhyay, P., Bhowmick, M. K., Roy, S. K., Majumder, A., & Chattopadhyay, C., (2021). Input-based assessment on integrated pest management for transplanted rice (Oryza sativa) in India. Crop Protection, 141, 10–44. Chen, Z., Xu, Z., Gao, T., Ni, S., Yan, D., Lu, F., & Liu, Y., (2001). Biological control of rice diseases. In: Seed Health and Seed-associated Microorganisms for Rice Disease Management (pp. 61–63). Limited Proceedings No. 6. Cottyn, B., Cerez, M. T., Van, O. M. F., Barroga, J., Swings, J., & Mew, T. W., (1996). Bacterial diseases of rice. II. Pathogenic bacteria associated with sheath rot complex and grain discoloration of rice in the Philippines. Plant Disease, 4(2), 429–437. Dath, A. P., & Dath, S. D., (1983). Role of inoculum in irrigation water and soil in the incidence of bacterial blight of rice. Indian Phytopathology (India), 3(1), 44–54. Devadath, S., & Padmanabhan, S. Y., (1970). Approaches to control of bacterial blight and streak diseases of rice in India. Bulletin of the Indian Phytopathological Society, 4(6), 5–12. Duan, Y. P., (1986). Identification of the causal organism of bacterial stripe of cereal crops. Acta Phytopath. Sin., 16(1), 227–235. Duan, Y. P., Chen, Z., Wang, J. S., & Fang, Z. D., (1986). Identification of the causal organism of bacterial stripe of cereal crops. Acta Phytopath. Sin., 16(2), 227–235 (in Chinese). Goto, K., & Ohata, K., (1961). Bacterial stripe of rice. Spec Publ Coll Agric Nat Taiwan Univ, 10(4), 49–59. Goto, K., (1956). New bacterial diseases of rice-bacterial brown stripe and bacterial grain rot. Ann. Phytopathol. Soc. Jpn., 7(21), 46–47. Ham, J. H., Melanson, R. A., & Rush, M. C., (2011). Burkholderia glumae: Next major pathogen of rice?. Molecular Plant Pathology, 12(4), 329–339. Hikichi, Y., (1993a). Mode of action of oxolinic acid against bacterial seedling rot of rice caused by Pseudomonas glumae. Japanese Journal of Phytopathology, 59(4), 441–446. Hikichi, Y., (1993b). Relationship between population dynamics of Pseudomonas glumae on rice plants and disease severity of bacterial grain rot of rice. Journal of Pesticide Science, 18(4), 319–324.

Understanding the Biology of Rice Bacterial Brown Stripe

155

Ibrahim, E., Fouad, H., Zhang, M., Zhang, Y., Qiu, W., Yan, C., Li, B., et al., (2019). Biosynthesis of silver nanoparticles using endophytic bacteria and their role in inhibition of rice pathogenic bacteria and plant growth promotion. Royal Society of Chemistry, 9(2), 92, 93. IRRI, (1988). Bacterial Blight of Rice: Proceedings of the International Workshop on Bacterial Blight of Rice, 2(1), 1–235. Kadota, I., & Ohuchi, A., (1983). Symptoms of bacterial brown stripe of rice seedlings in nursery boxes. Japanese Journal of Phytopathology, 49(4), 561–564. Kadota, I., & Ohuchi, A., (1987). Seed-transmission of causal bacterium Pseudomonos avenae and its invasion period in rice plants. Proc. Assoc. Pl. Prot. Hokuriku, 35(2), 21–23. Kadota, I., & Ohuchi, A., (1987). Symptom of rice glume inoculated with Pseudomonas avenae. Proc. Assoc. Pl. Pro. Hokuriku, 35(2), 17–20 (In Japanese). Kadota, I., & Ohuchi, A., (1988). Symptoms of rice in tillering stage caused by Pseudomonas avenae. Proc. Assoc. Pl. Pro. Hokuriku, 36(1), 8–13. Kadota, I., & ohuchi, A., (1990). Symptoms and ecology of bacterial brown stripe of rice. Japan Agricultural Research Quarterly, 24(1), 15–21. Kadota, I., (1996). Studies on the pathogen of bacterial brown stripe of rice [Oryza sativa] and its ecology [in Japan]. Bulletin of the Hokuriku National Agricultural Experiment Station, 4(6), 72–77. Kadota, I., Ohuchi, A., & Nishiyama, K., (1991). Serological properties and specificity of Pseudomonas avenae manns 1909, the causal agent of bacterial brown stripe of rice. Japanese Journal of Phytopathology, 57(2), 268–273. Kumar, S., Meshram, S., & Sinha, A., (2017). Bacterial diseases in rice and their eco-friendly management. International Journal of Agricultural Science and Research (IJASR), 7(2), 31–42. Lee, Y. H., & Park, H. K., (2001). Forecasting of the development of rice bacterial grain rot with weather conditions at heading period of rice. The Plant Pathology Journal, 17(6), 373, 374. Leung, H., Nelson, R. J., & Leach, J. E., (1993). Population structure of plant pathogenic fungi and bacteria. Advances in Plant Pathology, 10(2), 157–205. Li, B., Yu, R. R., Yu, S. H., Qiu, W., Fang, Y., & Xie, G. L., (2009). First report on bacterial heart rot of garlic caused by Pseudomonas fluorescens in China. Plant Pathol. J., 25(1), 91–94. Manns, T. F., (1909). The Blade Blight of Oats: A Bacterial Disease (No. 210) (Vol. 7, No. 5, pp. 7–9). Ohio Agricultural Experiment Station. Ou, S. H., (1985). Rice Diseases (IRRI) (Vol. 9, No. 2, pp. 380, 381). CAB publication. Ou, S. H., (1985). Rice diseases (Vol. 6, No. 1, pp. 109–200). Commonwealth mycological Institute. Kew, Surrey, England. Prathuangwong, S., Juthawanthana, P., Ketsuwan, K., & Kasem, S., (2004). An outbreak of new bacterial diseases of corn in Thailand. In: Proc. 1st Kasetsart Univ. Corn and Sorghum Res. Program Workshop (Vol. 1, No. 2, pp. 19–21). Richardson, M. J., (1981). Supplement 1 to: An Annotated List of Seed-Borne Diseases (Vol. 41, No. 6, pp. 44–48). The International Seed Testing Association, Zurich (Switzerland). Saha, S., Garg, R., Biswas, A., & Rai, B. A., (2015). Bacterial diseases of rice. An overview. Journal of Pure and Applied Microbiology, 9(1), 725–736. Saleh, M. M., & El-Akshar, Y. S., (2020). Integration between arbuscular mycorrhizal fungi, bacterial, and fungal bioagents for controlling rice brown spot disease. Egyptian Journal of Phytopathology, 48(1), 81–93.

156

Bacterial Diseases of Rice and Their Management

Schaad, N. W., Postnikova, E., Sechler, A., Claflin, L. E., Vidaver, A. K., Jones, J. B., & Ramundo, B. A., (2008). Reclassification of subspecies of Acidovoraxavenae as A. Avenae (Manns 1905) emend., A. cattleyae (Pavarino, 1911) comb. nov., A. citrulli Schaad et al., 1978) comb. nov., and proposal of A. oryzae sp. nov. Systematic and Applied Microbiology, 31(6–8), 434–446. Shakya, D. D., Vinther, F., & Mathur, S. B., (1985). Worldwide distribution of a bacterial stripe pathogen of rice identified as Pseudomonas avenae. Journal of Phytopathology, 114(3), 256–259. Song, W. Y., Kang, M. H., & Kim, H. M., (2000). A new selective medium for detecting Acidovorax avenae subsp. Avenae in rice seeds. The Plant Pathology Journal, 16(4), 236–241. Tagami, Y., (1962). Historical review of the researchers on bacterial leaf blight of rice caused by Xanthomonas oryzae (Uyeda Ishiyama) Dowson; Special report. Plant Disease and Insect Pests Forecasting Service, 10(4), 112, 113. Tanii, A., Miyajima, K., & Akita, T., (1976). The sheath brown rot disease of rice plant and its causal bacterium, Pseudomonas fuscovaginae. Japanese Journal of Phytopathology, 42(5), 540–548. Tominaga, T., kimura, K., & Goh, N., (1983). Bacterial brown stripe of rice in nursery box, caused by Pseudomonas avenae. Japanese Journal of Phytopathology, 49(4), 463–466. Uematsu, T., yoshimura, D., nishiyama, K., Ibaragi, T., & fujii, H., (1976). Pathogenic bacterium causing seedling rot of rice. Japanese Journal of Phytopathology, 42(4), 464–471. Vu, N. T., & Oh, C. S., (2020). Bacteriophage usage for bacterial disease management and diagnosis in plants. The Plant Pathology Journal, 36(3), 204. Xie, G., Sun, X., & Mew, T. W., (1998). Characterization of Acidovorax avenae subsp. avenae from rice seeds. Chinese Journal of Rice Science, 12(3), 165–171. Yaoita, T., Fujimaki, Y., Abe, T., & Tsujimoto, K., (1984). Control of rice bacterial brown stripe disease [caused by Pseudomonas syringae pv. panici] multiplied in hatomune auto­ sproutor with kasugamycin. In: Proceedings of the Association for Plant Protection of Hokuriku (Japan), (Vol. 31, No. 9, pp. 45–55). Zeigler, R. S., & Alvarez, E., (1987). Bacterial sheath brown rot of rice caused by Pseudomonas fuscovaginae in Latin America. Plant Disease, 71(7), 592–597.

CHAPTER 9

Advances and Prospects of Biotechnological Tools for the Management of Rice Bacterial Brown Stripe Disease TATA SANTOSH RAMA BHADRA RAO Department of Biomedical Science, Latrobe University, Bendigo, Australia, E-mail: [email protected] (T. Santosh)

ABSTRACT Bacterial brown stripe of rice (BBSR), also called heart rot disease of rice caused by Pseudomonas syringae or Acidovorax avenae subsp. Acidovorax oryzae was firstly reported in 1989 in China. There are several methods intro­ duced to control the bacterial infections depending on diseases effected the crops throughout the period, however, biotechnological approaches played a crucial role in controlling the crop loss effectively without damaging the ecological environment. Plethora of conventional methods available and helped in controlling physiological transmission of the disease from crop to crop but not generation to generation. It is very important to stop the disease transmission to the next generation by eliminating it properly at the cellular level. These biotechnological approaches, such as nanoparticles, enzyme-substrate analogs, plant-based emulsion formulations, etc., are capable enough to eliminate the bacterial infection from inside the plant cell and seed, which interims stop the disease transmission to the next generation (crop). For example, thiamin diphosphate (ThDP) analogs inhibit the growth of bacterial biofilm by blocking bacterial metabolism, in another approach MgO and MnO2 nanoparticles used to stop the bacterial growth by leaking Bacterial Diseases of Rice and Their Management. Deepti Srivastava, Md. Shamim, Malik Mobeen Ahmad, & K. N. Singh (Eds.) © 2023 Apple Academic Press, Inc. Co-published with CRC Press (Taylor & Francis)

158

Bacterial Diseases of Rice and Their Management

the cytoplasmic content from the bacterial through penetrating the bacterial cells. On the other hand, rice genomics studies paved a path to understand the mechanism of rice-pathogen interaction at molecular level includes disease resistance genes which participate in pattern-triggered immunity signaling and defense-responsive genes (RGs) effector-triggered immunity signaling or quantitative resistance. This understanding helped in developing efficient methods to control bacterial infection. The present chapter explains advanced and reliable biotechnological methods for controlling the BBSR. 9.1 BIOTECHNOLOGICAL ADVANCES IN BBSR IDENTIFICATION AND CHARACTERIZATION Seed-borne plant pathogens are noticeably hard to detect before the spread of the disease and engender negative effect on the crop yield. This reason confronts the disease controlling during the germination and crop growth. It is very important to detect the disease before seeding the seeds; this needs a sensitive and simple screening methods to detect the pathogens. There are several methods have been generated to detect the bacterial infection in crops, however, selective species and subspecies detection in rice seeds can be possible through genomic sequence identification such as polymerase chain reaction (PCR) technology (Li and Boer, 1995). The advancement of mPCR made it reliable, fast, and inexpensive method helped in the identification of bacterial pathogens directly from infected seeds. Based on the 16S and 23S rDNA sequences of the bacteria can be identified and characterized, because of that, it is easy to design primers and proceed for PCR after isolating infection strains from the samples or seeds. According to that Oal-Forward primer TTGAACGCCCACACTTATCG, Oal-Reverse primer TATTG­ GTTGGTGGAGGATGA were used to detect Acidovorax oryzae with 290bp long amplified product (Kang et al., 2016). With one set of primers, it is possible to identify more than three strains at a time which interim better and more specific ways to identify disease. However, it is very important that the genetic information of the infected strain should be available. 9.2 NANOPARTICLE-BASED APPROACH IN DAMAGING ACIDOVORAX ORYZAE METABOLISM IN THE INFECTED RICE PLANTS One of the advanced biotechnological approaches for controlling crop diseases is biomaterial-based nanoparticles. Several studies have reported

Advances and Prospects of Biotechnological Tools

159

that nanoparticles made up of different noble metals like Ag, Cu, and Au, which can be applied to kill both resistant and non-resistant bacteria. Recent studies targeted Acidovorax oryzae (AO) – RS-2 strain shows that different nanoparticles synthesized with different plant and fruit extracts reduced the biofilm formation and swimming motility by leaking the cytoplasmic content through damaging the cell membrane of the bacteria. These nanopar­ ticles were analyzed and validated by spectroscopy profile of the UV-visible and Energy dispersive spectrophotometer, Fourier transform infrared, X-ray diffraction pattern, and electron microscopy images examination confirms their importance and reliability in disease control. The combination of plant extracts with Nanoparticles are proven to be a success full approach against disease and infection control. Various metal oxide has been successfully green synthesized using plant extracts, the green synthesis method gaining much interest due to its low cost producibility, eco-friendly, and biocompat­ ibility. Plant extracts are getting more attention in the leap of human-related disease treatments as a traditional medicine and now researchers are trying them on plant-related diseases. There is sufficient research that supports plant extracts are good to combat bacterial infections. For example, edible fruits of Pomelo a perennial plant has an anticancer, antidiabetic, antibacte­ rial, and antioxidant agent and leaves, seeds, peels, pulp, fruits, and roots crude extracts have effective phytochemicals which are considered to be pharmacologically important (Thavanapong et al., 2010; Jadhav et al., 2013). Silver nanoparticles (AgNPs), synthesized with plant materials, are an emerging field of agriculture for their eco-friendly and outstanding antibacterial attributes. In this regard 11.3–12.8 nm sized AgNPs were synthesized using pomelo (Citrus maxima) fruit extract showed remarkable antimicrobial activity in vitro by damaging the cell membrane and downregulating the expression of many types VI secretion system related genes of the bacteria at 25 μg/ml concentration (Ali et al., 2020). Similarly, Phyllanthaceae family adherent Phyllanthus emblica which is widely used in Southeast Asia due to its antioxidant activity, antiaging properties (Dang et al., 2011; Manikandan et al., 2017). AgNPs size ranged from 19.8 to 92.8 nm with 39 nm average diameter were synthesized using fresh fruit extract of Phyllanthus emblica showed remarkable antimicrobial activity in vitro by damaging the cell membrane of the bacteria at 20 mg/ml concentration (Masum et al., 2019). In a similar investigation Chamomile plant extracts synthesized Nanoparticles has been used against Acidovorax oryzae (AO). Compositae family member Chamomile is a perennial plant, its extracts comprise high levels of triterpenoids, phenols, tannins, flavonoids such as

160

Bacterial Diseases of Rice and Their Management

flavone, glycosides, and flavonols and widely used in traditional medicine as a sedative agent to facilitate digestion, headache, and toothache relief (Munir et al., 2014; Sharifi-Rad et al., 2018). Due to the low cost, eco-friendly nature magnesium oxide (MgO) nanoparticles got more attention in this particular field. Apart from that it MgO has been used as catalyst for organic dyes degradation, photocatalytic, anticancer, and antimicrobial activity due to its surface chemical activity (Zhang et al., 2010; Salehifar et al., 2016; Suresh et al., 2018). The combination of MgO and manganese dioxide (MnO2) nanoparticles sized 18.2 and 16.5 nm, respectively, were green synthesized using Matricaria chamomilla L. extract, at 16.0 mg/mL concentration both MgO, MnO2 nanoparticles reduced the growth and biofilm formation of the bacteria by 62.9 and 71.3%, respectively (Ogunyemi et al., 2019). Apart from plant-based extracts, there are some plants grown promoting bacteria which aids in plant defense against bacteria were combined and used in the synthesis of Nanoparticles. Bacillus siamensis (B. siamensis) strain C1 is an endophytic bacterium was isolated from medicinal health plant Coriandrum sativum (C. sativum) and used in synthesize of silver Nanoparticles. In this study (AO)-strain RS-1 targeted by AgNPs size ranged from 25 to 50 nm were synthesized using endophytic bacterium Bacillus siamensis strain C1 showed a strong antibacterial effect at 25 μg/ ml concentration (Ibrahim et al., 2019). The real challenge involves with not only producing successful Nanoparticles but also make it available for seed sterilization in bulk. The characteristics of the nanoparticle, such as biodegradability, bioavailability, and cost of production are very important to consider for a successful noncontaminating agent for crops at the seedling stage (Figure 9.1). 9.3 PLANT-BASED FORMULATIONS, ENZYME SUBSTRATE ANALOGS, AND BIOCONTROL AGENTS (BCAS) IN CONTROL OF BACTERIAL BROWN STRIPE OF RICE (BBSR) Ameliorating plant defense to combat a bacterial disease without harming nature and crop is an important task, due to their biodegradability and overall safety natural plant-based products are an alternative approach. However, it is very important to deliver them without fail. Acidovorax oryzae (AO) (gram negative bacteria) contains ABC transporter proteins plays an important role in translocation of toxic compounds across the cell membrane through Type 1 secretion pathway and Type II secretion system (Hung et al., 1998; Py et al., 2001). Type II secretion system in the bacteria forms pseudopilus which helps

FIGURE 9.1 A. oryzae bacterial infection and disease progression in the crop. The treatment (soaking) of the rice seeds with biocontrol agents, nanoparticles synthesized with biocontrol agents and plant extracts (green synthesis) before seeding helps in disease control.

Advances and Prospects of Biotechnological Tools 161

162

Bacterial Diseases of Rice and Their Management

in the transportation of virulence related factors across the host membrane (Lee et al., 2005; Baldi et al., 2012). Plant defense system activates during the infection of Acidovorax oryzae (AO) in order to counter the virulent compo­ nents, flow into the host plant. Several natural plant-based products analyzed chemically and revealed their bioactive compounds such as flavonoids, alkaloids, phenolic compounds, steroids, and propenylphenols specific for plant pathogens (Syed-Ab-Rahman et al., 2020). For example, Kasugamycin (KSM) or chitosan like a monoterpenoid indole alkaloid Camptothecin (CPT) treatment affected A. oryzae strain RS-2 growth and replication by causing membrane damage through differential expression of one topoisomerase­ related gene and eight secretion system-related genes (Yoshii et al., 2012; Yang et al., 2014; Dong et al., 2016). In another study, the effect of ß-lactam antibiotics especially Ampicillin (Amp) was tested on Acidovorax oryzae strain RS-1. The results mentioned that the Amp effected the virulence, colonization capacity, composition of extracellular polymeric substances and secretion of Type VI secretion system (T6SS) effector Hcp (Li et al., 2016). However, it does not affect the bacterial growth and biofilm formation. Interestingly the approach of enzyme-based analogs proved to disrupt the metabolism of pathogen and slow down or inhibit the pathogenicity. Thiamin diphosphate (ThDP) analogs were designed based on the ThDP binding site of the pyruvate dehydrogenase multienzyme complex E1 of Escherichia coli has shown inhibition of biofilm formation of A. oryzae strain RS-1, though no cell wall damage or cell lysis was observed (Wang et al., 2019). BCA usage is a promising strategy to control the plant diseases caused by insects, bacteria, etc. Rice rhizosphere contains a range of microorganisms under symbiotic relationship helps the host from several disease-causing pathogens. Apart from plant extracts using natural antagonistic microorganisms that are inhabitant in the rhizosphere will help in combating different plant diseases. They promote the plant growth by solubilizing phosphate, fixing nitrogen, producing siderophore and secondary metabolites against phytopathogens (Ongena and Jacques, 2008; Lugtenberg and Kamilova, 2009; Chowdhury et al., 2015; Patel et al., 2015; Fan et al., 2017). Here are some BCAs described for BBSR those severely disrupted cell membrane integrity of A. oryzae causes cytoplasmic leakage. One of the studies reported that based on bacteriological, physiological, and biochemical characters, fatty acid profiles and 16S rRNA, gyrA, and rpoB genes sequences analysis 136 halotolerant bacteria we isolated from the rhizosphere of plants cultivated in natural saline field. Among them K5-3 and PPB6 were significantly inhibited the growth of Acidovorax oryzae (AO) stains (Masum et al., 2018a). One of

Advances and Prospects of Biotechnological Tools

163

the studies shows that Brevibacillus laterosporus B4 used as a BCA inhibited the biofilm formation in A. oryzae (Kakar et al., 2014). Specially Brevibacillus laterosporus B4 completely ruptured the A. oryzae cell membrane and caused the leakage of intracellular fluid. Interestingly the only chitosan application did not affect the membranes of bacteria but effected the biofilm formation similar to Brevibacillus laterosporus B4. Similarly halotolerant bacteria isolate of Bacillus amyloliquefaciens such as K5-3 and PPB6 significantly inhibited the growth of A. oryzae (Masum et al., 2018b). It is very important BCAs should be used in controlled conditions though they are helping in the crop’s defense against other microorganisms. 9.4 GENETIC STUDIES REVEAL THE MECHANISM OF A. ORYZAE INTEGRATION INTO THE HOST PLANT Disease-causing microorganisms always challenge plants by infecting and developing the disease. Traditional breeding and transgenic approach are targeted to develop the disease-resistant cultivars. However, it is important for the pathogen to infect the host plant cell by overcoming the host defense, for the pathogens require weaponry which helps in host colonization, growth, and reproduction (Kondo et al., 2012, 2017). While translocating multiple effectors into the plant system from pathogenic bacteria, the plant immune system generates different types of immune responses. These responses mainly consist of two main arms, pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI) and effector-triggered immunity (ETI). Different type secretion systems (TSS) of pathogenic bacteria help in the integration of several effector proteins into the host cell and triggers ETI including hypersensitive response (HR) cell death. By disabling the pathogen weaponry particularly, the genes responsible for those mechanisms can control their growth and spread in the plant system. Type 3 secretion system (T3SS) in N1141 strain of Acidovorax avenae is regulated by hrp gene cluster (35.3 kb), according to the mutational studies HrpY gene from the gene cluster considered as an important effector of ETI in the interaction between A. avenae N1141 and rice (Kondo et al., 2012). The same group reported that A. avenae strain K1 leucine-rich repeat protein (Lrp) gene functions as an avirulence factor in rice. The Lrp interacts with oryzalin α, a pathogenesis-related (PR) protein of the cysteine protease family and triggers (Kondo et al., 2017). The specific virulence of different A. oryzae strain such as RS-1 and RS-2 was reported as different genes involved in

Bacterial Diseases of Rice and Their Management

164

virulence properties associated with the type six secretion system T6SS and secretion of Hcp protein. Mutational studies of gene cluster of T6SS from A. oryzae strain RS-2 explained that the pppA, clpB, icmF, impJ, and impM genes associated with biofilm formation while pppA, clpB, icmF, and hcp genes associated with motility in bacteria. Similarly, icmF, and dotU genes are associated in pathogenicity of A. oryzae strain RS-1 (Masum et al., 2017; Zhang et al., 2017; Li et al., 2018). However, there are several other important genes apart from TSS genes involved in host-pathogen interactions were listed and explained. Type IV pili (TFP) are hair-like appendages are involved in bacterial surface motility, surface adherence, colonization, biofilm formation, and virulence. Mutational studies of pilP gene of A. oryzae, which encodes TFP assembly protein clearly indicated its key role in plant pathogenicity (Liu et al., 2012). aac-IIa gene, encoding a KSM 2’-N-acetyltransferase enzyme which confers resistance against KSM, was identified in KSM-resistant A. oryzae spp. (Table 9.1) (Yoshii et al., 2015). TABLE 9.1

Genes Present in A. oryzae spp. and Their Association with Virulence

Name of the Gene Pathogenic Activity Associated

References

aac-IIa

Encodes KSM 2’-N-acetyltransferase, which confers resistance towards kasugamycin.

Yoshii et al. (2015)

pppA, clpB, icmF, impJ, and impM

Biofilm formation

Masum et al. (2017)

pppA, clpB, dotU, icmF, and hcp

Motility in bacteria

Zhang et al. (2017); Li et al. (2018)

Lrp

Interacts with oryzalin α and triggers effector-triggered immunity in the host.

Kondo et al. (2017)

HrpY

Activates effector-triggered immunity in host.

Kondo et al. (2012)

pilP

Type IV pili protein in surface motility, surface Liu et al. (2012) adherence, colonization, biofilm formation.

9.5 CONCLUSION AND DISCUSSION A. oryzae is a phytobacterium causes diseases in many plants with economic importance, including rice, corn, oats, sugarcane, millet, and foxtail (Song et al., 2004). Serious outbreak of rice bacterial brown stripe (BBS) in different regions of the world made researchers to develop strategies to combat the disease. During the last few years, marvelous development has been made

Advances and Prospects of Biotechnological Tools

165

in understanding the bacterial metabolism and its integration into the host system. Biotechnological advancements were helping the development of disease combating strategies through identifying the mode of infection and several genes responsible for virulence in A. oryzae spp. When we look into the mechanism of the infection of A. oryzae on the host plant, it’s totally host-species specific. There are several strains which infects other crops than rice can be a pathogenic to rice in future. Because they cause HR cell death, H2O2 generation, and the up-regulation of defense genes which is common for all plants (Che et al., 1999). It’s very important to control the bacterial infections by understanding their virulent mechanisms by considering whole species but not the specific strain. On the other hand, the plant should be able to generate sufficient immune responses to counter the infection by activating its defense genes. For that, it’s very important to make available the plant defense gene information for further experimental approach which in terms help in developing resistant varieties. The information about plant defense system and the genes involved can be channeled into developing resistant varieties via transgenic and traditional breeding approaches to improve plant immunity against A. oryzae spp. On the other hand, plant-based formulations are turning into alternative strategy to control the A. oryzae spp. infections in rice. Similarly, by understanding the TSS of the bacteria and the integration of effector molecules into the host system may help in developing alternative combating approaches to counter the bacteria infection on the host plant surface specially at the seeding stage. Recent advances in biochemical, microbial, and molecular technology, supported by genomics and transcriptomics paving a path towards complete understanding of plant defense and bacterial integration mechanisms. On the other hand, plant rhizosphere and other microorganisms which support plant growth and combat disease-causing agents are turning to be an arsenal in the plant defense. However, the usage of the BCAs should be under controlled conditions due to the spread and disease-causing problems for other crops. Due to its eco-friendly and biodegradable nature, plant-based natural products are the finest strategy during dreadful pollution conditions in the environment, which enhance plant growth and defense. Plant-based extract synthesized Nanoparticleparticles are also one of the advanced techniques to handle plant infections at extra and intracellular levels. However, the avail­ ability and reproducibility, and cost of the product decide the success of the strategy towards yield and economy.

Bacterial Diseases of Rice and Their Management

166

KEYWORDS • • • • • •

Acidovorax avenae bacterial brown stripe of rice biocontrol agent biofilm effector-triggered immunity nanoparticles

REFERENCES Ali, K. A., Yao, R., Wu, W., Masum, M. M. I., Luo, J., Wang, Y., Zhang, Y., An, Q., Sun, G., & Li, B., (2020). Biosynthesis of silver nanoparticles from pomelo (Citrus Maxima) and their antibacterial activity against Acidovorax oryzae RS-2. Materials Research Express, 7, 015097. Baldi, D. L., Higginson, E. E., Hocking, D. M., Praszkier, J., Cavaliere, R., James, C. E., Bennett-Wood, V., et al., (2012). The type II secretion system and its ubiquitous lipoprotein substrate, SslE, are required for biofilm formation and virulence of enteropathogenic Escherichia coli. Infection and Immunity, 80, 2042–2052. Che, F. S., Iwano, M., Tanaka, N., Takayama, S., Minami, E., Shibuya, N., Kadota, I., & Isogai, A., (1999). Biochemical and morphological features of rice cell death induced by Pseudomonas avenae. Plant and Cell Physiology, 40, 1036–1045. Chowdhury, S. P., Hartmann, A., Gao, X., & Borriss, R., (2015). Biocontrol mechanism by rootassociated Bacillus amyloliquefaciens FZB42: A review. Frontiers in Microbiology, 6, 780. Dang, G., Parekar, R., Kamat, S., Scindia, A., & Rege, N., (2011). Antiinflammatory activity of Phyllanthus emblica, Plumbago zeylanica and Cyperus rotundus in acute models of inflammation. Phytotherapy Research, 25, 904–908. Dong, Q., Luo, J., Qiu, W., Cai, L., Anjum, S. I., Li, B., Hou, M., Xie, G., & Sun, G., (2016). Inhibitory effect of camptothecin against rice bacterial brown stripe pathogen Acidovorax avenae subsp. avenae RS-2. Molecules, 21. Fan, H., Zhang, Z., Li, Y., Zhang, X., Duan, Y., & Wang, Q., (2017). Biocontrol of bacterial fruit blotch by Bacillus subtilis 9407 via surfactin-mediated antibacterial activity and colonization. Frontiers in Microbiology, 8, 1973. Hung, L. W., Wang, I. X., Nikaido, K., Liu, P. Q., Ames, G. F. L., & Kim, S. H., (1998). Crystal structure of the ATP-binding subunit of an ABC transporter. Nature, 396, 703–707. Ibrahim, E., Fouad, H., Zhang, M., Zhang, Y., Qiu, W., Yan, C., Li, B., et al., (2019). Biosynthesis of silver nanoparticles using endophytic bacteria and their role in inhibition of rice pathogenic bacteria and plant growth promotion. RSC Advances, 9, 29293–29299.

Advances and Prospects of Biotechnological Tools

167

Jadhav, A., Sathe, S., Sonawane, A., More, S., & Kadam, V., (2013). Extraction, isolation, and estimation of β-amyrin palmitate from Couroupita guianensis and Lobelia inflata by HPTLC. Indo American Journal of Pharmaceutical Research, 3, 6076–6083. Kakar, K. U., Nawaz, Z., Cui, Z., Almoneafy, A. A., Zhu, B., & Xie, G. L., (2014). Characterizing the mode of action of Brevibacillus laterosporus B4 for control of bacterial brown strip of rice caused by A. avenae subsp. avenae RS-1. World Journal of Microbiology and Biotechnology, 30, 469–478. Kang, I. J., Kang, M. H., Noh, T. H., Shim, H. K., Shin, D. B., & Heu, S., (2016). Simultaneous detection of three bacterial seed-borne diseases in rice using multiplex polymerase chain reaction. Plant Pathology Journal, 32, 575–579. Kondo, M., Hirai, H., Furukawa, T., Yoshida, Y., Suzuki, A., Kawaguchi, T., & Che, F. S., (2017). Frameshift mutation confers function as virulence factor to leucine-rich repeat protein from Acidovorax avenae. Frontiers in Plant Science, 7. Kondo, M., Yoshida, Y., Miyata, C., Fujiwara, S., Nakajima, Y., Hirai, H., Takayama, S., Isogai, A., Che, F. S., (2012). Genetic organization of the hrp gene cluster in Acidovorax avenae strain N1141 and a novel effector protein that elicits immune responses in rice (Oryza sativa L.). Biosci Biotechnol Biochem. 76(1), 129–138. doi: 10.1271/bbb.110597. Epub 2012 Jan 7. PMID: 22232252. Lee, B. M., Park, Y. J., Park, D. S., Kang, H. W., Kim, J. G., Song, E. S., Park, I. C., et al., (2005). The genome sequence of Xanthomonas oryzae pathovar oryzae KACC10331, the bacterial blight pathogen of rice. Nucleic Acids Research, 33, 577–586. Li, B., Ge, M., Zhang, Y., Wang, L., Ibrahim, M., Wang, Y., Sun, G., & Chen, G., (2016). New insights into virulence mechanisms of rice pathogen Acidovorax avenae subsp. Avenae strain RS-1 following exposure to ß-lactam antibiotics. Scientific Reports, 6, 22241. Li, B., Wang, X., Chen, J., Liu, H., Ali, K. A., Wang, Y., Qiu, W., & Sun, G., (2018). IcmF and DotU are required for the virulence of Acidovorax oryzae strain RS-1. Archives of Microbiology, 200, 897–910. Li, X., & Boer, S. H. D. J. C. J. O. M., (1995). Comparison of 16S Ribosomal RNA Genes in Clavibacter Michiganensis Subspecies with other Coryneform Bacteria, 41, 925–929. Liu, H., Tian, W. X., Ibrahim, M., Li, B., Zhang, G. Q., Zhu, B., & Xie, G. L., (2012). Characterization of pilP, a gene required for twitching motility, pathogenicity, and biofilm formation of Acidovorax avenae subsp. avenae RS-1. European Journal of Plant Pathology, 134, 551–560. Lugtenberg, B., & Kamilova, F., (2009). Plant-growth-promoting rhizobacteria. Annual Review of Microbiology, 63, 541–556. Manikandan, R., Beulaja, M., Thiagarajan, R., Palanisamy, S., Goutham, G., Koodalingam, A., Prabhu, N., et al., (2017). Biosynthesis of silver nanoparticles using aqueous extract of Phyllanthus acidus L. fruits and characterization of its anti-inflammatory effect against H2O2 exposed rat peritoneal macrophages. Process Biochemistry, 55, 172–181. Masum, M. I., Siddiqa, M. M., Ali, K. A., Zhang, Y., Abdallah, Y., Ibrahim, E., Qiu, W., et al., (2019). Biogenic synthesis of silver nanoparticles using Phyllanthus emblicafruit extract and its inhibitory action against the pathogen Acidovorax oryzae strain RS-2 of rice bacterial brown stripe. Frontiers in Microbiology, 10. Masum, M. M. I., Liu, L., Yang, M., Hossain, M. M., Siddiqa, M. M., Supty, M. E., Ogunyemi, S. O., et al., (2018b). Halotolerant bacteria belonging to operational group Bacillus amyloliquefaciens in biocontrol of the rice brown stripe pathogen Acidovorax oryzae. Journal of Applied Microbiology, 125, 1852–1867.

168

Bacterial Diseases of Rice and Their Management

Masum, M. M. I., Yang, Y., Li, B., Olaitan, O. S., Chen, J., Zhang, Y., Fang, Y., et al., (2017). Role of the genes of type VI secretion system in virulence of rice bacterial brown stripe pathogen Acidovorax avenae subsp. avenae strain RS-2. International Journal of Molecular Sciences, 18. Masum, M., Liu, L., Yang, M., Hossain, M., Siddiqa, M., Supty, M., Ogunyemi, S., et al., (2018a). Halotolerant bacteria belonging to operational group Bacillus amyloliquefaciens in biocontrol of the rice brown stripe pathogen Acidovorax oryzae. Journal of Applied Microbiology, 125, 1852–1867. Munir, N., Iqbal, A. S., Altaf, I., Bashir, R., Sharif, N., Saleem, F., & Naz, S., (2014). Evaluation of antioxidant and antimicrobial potential of two endangered plant species Atropa belladonna and Matricaria chamomilla. African Journal of Traditional, Complementary, and Alternative Medicines, 11, 111–117. Ogunyemi, S. O., Zhang, F., Abdallah, Y., Zhang, M., Wang, Y., Sun, G., Qiu, W., & Li, B., (2019). Biosynthesis and characterization of magnesium oxide and manganese dioxide nanoparticles using Matricaria chamomilla L. extract and its inhibitory effect on Acidovorax oryzae strain RS-2. Artificial Cells, Nanomedicine, and Biotechnology, 47, 2230–2239. Ongena, M., & Jacques, P., (2008). Bacillus lipopeptides: Versatile weapons for plant disease biocontrol. Trends in Microbiology, 16, 115–125. Patel, R. R., Patel, D. D., Thakor, P., Patel, B., & Thakkar, V. R., (2015). Alleviation of salt stress in germination of Vigna radiata L. by two halotolerant Bacilli sp. isolated from saline habitats of Gujarat. Plant Growth Regulation, 76, 51–60. Py, B., Loiseau, L., & Barras, F., (2001). An inner membrane platform in the type II secretion machinery of gram-negative bacteria. EMBO Reports, 2, 244–248. Salehifar, N., Zarghami, Z., & Ramezani, M., (2016). A facile, novel, and low-temperature synthesis of MgO nanorods via thermal decomposition using new starting reagent and its photocatalytic activity evaluation. Materials Letters, 167, 226–229. Sharifi-Rad, M., Nazaruk, J., Polito, L., Morais-Braga, M. F. B., Rocha, J. E., Coutinho, H. D. M., Salehi, B., et al., (2018). Matricaria genus as a source of antimicrobial agents: From farm to pharmacy and food applications. Microbiological Research, 215, 76–88. Song, W., Kim, H., Hwang, C., & Schaad, N. J. J. O. P., (2004). Detection of Acidovorax Avenae ssp. Avenae in Rice Seeds Using BIO‐PCR., 152, 667–676. Suresh, J., Pradheesh, G., Alexramani, V., Sundrarajan, M., & Hong, S. I., (2018). Green synthesis and characterization of hexagonal shaped MgO nanoparticles using insulin plant (Costus pictus D. Don) leave extract and its antimicrobial as well as anticancer activity. Advanced Powder Technology 29, 1685–1694. Syed-Ab-Rahman, S. F., Carvalhais, L. C., & Omar, D., (2020). Development of plant-based emulsion formulations to control bacterial leaf blight and sheath brown rot of rice. Heliyon, 6, e03151. Thavanapong, N., Wetwitayaklung, P., & Charoenteeraboon, J., (2010). Comparison of essential oils compositions of Citrus maxima Merr. peel obtained by cold press and vacuum stream distillation methods and of its peel and flower extract obtained by supercritical carbon dioxide extraction method and their antimicrobial activity. Journal of Essential Oil Research, 22, 71–77. Wang, X. X., Qi, H. Y., Chen, J., Yang, Y. Z., Qiu, W., Wang, W., Zou, P., et al., (2019). Antibacterial activity and mechanism of ThDP analogs against rice brown stripe pathogen Acidovorax avenae subsp. avenae RS-1. Journal of Plant Pathology, 101, 59–69.

Advances and Prospects of Biotechnological Tools

169

Yang, C., Li, B., Ge, M., Zhou, K., Wang, Y., Luo, J., Ibrahim, M., et al., (2014). Inhibitory effect and mode of action of chitosan solution against rice bacterial brown stripe pathogen Acidovorax avenae subsp. avenae RS-1. Carbohydrate Research, 391, 48–54. Yoshii, A., Moriyama, H., & Fukuhara, T., (2012). The novel kasugamycin 2’-N-acetyl­ transferase gene aac(2’)-IIa, carried by the IncP island, confers kasugamycin resistance to rice-pathogenic bacteria. Applied and Environmental Microbiology, 78, 5555–5564. Yoshii, A., Omatsu, T., Katayama, Y., Koyama, S., Mizutani, T., Moriyama, H., & Fukuhara, T., (2015). Two types of genetic carrier, the IncP genomic island and the novel IncP-1β plasmid, for the aac(2′)-IIa gene that confers kasugamycin resistance in Acidovorax avenae ssp. avenae. Molecular Plant Pathology, 16, 288–300. Zhang, W., Tay, H. L., Lim, S. S., Wang, Y., Zhong, Z., & Xu, R., (2010). Supported cobalt oxide on MgO: Highly efficient catalysts for degradation of organic dyes in dilute solutions. Applied Catalysis B: Environmental, 95, 93–99. Zhang, Y., Zhang, F., Li, B., Yang, Y. Z., Ibrahim, M., Fang, Y. S., Qiu, W., et al., (2017). Characterization and functional analysis of clpB gene from Acidovorax avenae subsp. avenae RS-1. Plant Pathology, 66, 1369–1379.

CHAPTER 10

Introduction to the Biological and Ecological Studies of Bacterial Leaf Streak Pathogen SANTOSH KUMAR,1 S. B. SAH,2 TRIBHUWAN KUMAR,3 GIREESH CHAND,4 MD. NADEEM AKHTAR,5 and M. K. BARNWAL6 Department of Plant Pathology, Mandan Bharti Agriculture College,

Agwanpur, Saharsa–852201, Bihar, India,

E-mail: [email protected] (S. Kumar)

1

Department of Entomology, Mandan Bharti Agriculture College,

Agwanpur, Saharsa–852201, Bihar, India

2

Department of Plant Breeding and Genetics (Biotechnology),

Mandan Bharti Agriculture College, Agwanpur, Saharsa–852201,

Bihar, India

3

Department of Plant Pathology, College of Agriculture,

Central Agricultural University, Pasighat–791102, East Siang,

Arunachal Pradesh, India

4

5

Krishi Vigyan Kendra, Agwanpur, Saharsa, Bihar, India

Department of Plant Pathology, Birsa Agricultural University, Kanke–834006, Ranchi, Jharkhand, India

6

ABSTRACT Rice (Oryza sativa L.) is the staple food crop of the world, the basis for the livelihood of 50% population. It is grown in about 44.5 m ha with an Bacterial Diseases of Rice and Their Management. Deepti Srivastava, Md. Shamim, Malik Mobeen Ahmad, & K. N. Singh (Eds.) © 2023 Apple Academic Press, Inc. Co-published with CRC Press (Taylor & Francis)

172

Bacterial Diseases of Rice and Their Management

estimated production of 120 million tons in India as per a report in the year 2020–2021. Bacterial leaf streak (BLS), is caused by a pathogen named Xanthomonas oryzae pv. oryzicola is a minor disease and occurs in tropical and subtropical regions, causing yield loss up to 30% in susceptible cultivars. High humidity and warm wet weather condition favors the development of this disease. The disease can occur at any growth stage and appears as small, narrow, dark greenish, and interveinal water-soaked streaks of various lengths. Xanthomonas oryzae pv. oryzicola transmit through seed, therefore, infested seed and infected crop residue (straw), volunteer plants and all wild rice species are main reservoir of this bacteria. There are various ways of management, but a spray of streptomycin sulfate with tetracycline and copper oxychloride @ 1.25 kg/ha is highly recommendable for the control of this disease. This chapter incorporates information pertaining to BLS disease of rice and preventive measures to manage the disease. 10.1 INTRODUCTION Rice is extensively cultivated in the Asian continent, and more than 80% of the rice produced in the world is consumed by the population of these coun­ tries (Che Omar et al., 2019). India has the largest area and holds second ranks next to China in total rice production. It feeds to two third population of India. Rice is cultivated in the 156.68 m ha of world, whose per year production is about 439.7 million tons with an average productivity of 4.15 tons per ha. Rice has been affected by biotic and abiotic constraints constantly. Fungi, bacteria, viruses, and nematodes, are major biotic factors which reduce the yields of rice to a great extent (Table 10.1). Xanthomonads bacteria particu­ larly Xanthomonas oryzae (Xo) is potential species, which affect the rice production. Xanthomonas oryzae pv. oryzae (Xoo) and Xanthomonas oryzae pv. oryzicola (Xoo) are most prevalent pathovars, responsible for BLB and BLS, respectively. 10.2 BACTERIAL LEAF STREAK (BLS) Bacterial leaf streak (BLS), caused by pathogen Xanthomonas oryzae pv. oryzicola (Xoo) (Commonwealth Mycological Institute, 1982; Fang et al., 1957) is not as important as BLB (X. oryzae pv. oryzae). It occurs in both lowland and upland rice-growing areas of tropical and subtropical regions of Asia, Africa, South America, and Australia (Webster and Gunnell, 1992;

Introduction to the Biological and Ecological Studies

173

Wonni et al., 2011). The disease has also been seen in extremely wet seasons and at the places, where a high dose of nitrogen fertilizer is used. These diseases are more common in tropical and subtropical Asian countries. China, Thailand, Malaysia, India, Vietnam, the Philippines, and Indonesia (Niño-Liu et al., 2006) are the predominant country, which faces reduction in yield up to 8% to 32% (Liu et al., 2014). However, Ou (1985) had reported that, yield loss due to this disease may go up to 30% in susceptible cultivars. Severe disease incidences are usually observed in the early stages of growth, as older plants are more resistant. Therefore, high grain losses in older plants are rare, because plants have enough time to recover after disease outbreak. TABLE 10.1 SL. No. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13.

Important Diseases of Rice and Their Causal Organism

Name of Disease

Causal Organism

Sheath blight Rice blast Brown spot Stem rot Sheath rot False smut Foot rot/Bakanae False smut Rice bacterial blight Bacterial leaf streak Grassy stunt Tungro White tip nematode

Rhizoctonia solani Magnaporthe grisea Cochliobolus miyabeanus Magnaporthe salvinii Sarocladium oryzea Ustilaginoidea virens Fusarium moniliforme Ustilaginoidea virens Xanthomonas oryzae pv. oryzae Xanthomonas oryzae pv. oryzicola Rice grassy stunt virus (RGSV) Rice tungro bacilliform virus (RTBV) Aphelenchoides besseyi

Categories of Pathogen Fungus Fungus Fungus Fungus Fungus Fungus Fungus Fungus Bacteria Bacteria Virus Virus Nematode

10.3 THE CAUSAL ORGANISM It was thought that leaf streak was first noticed in the Philippines in 1918, but identification of pathogen was ambiguous. It was the year 1957, when it was confirmed that leaf streak of rice is caused by bacteria (Ou, 1985). Eventually, it came to light that Xanthomonas oryzae pv. oryzicola (Xoo) cause BLS disease (Commonwealth Mycological Institute, 1982; Fang et al., 1957). The bacterium is gram-negative, aerobic, rod-shaped with an average dimension of 1.2 × 0.3 to 0.5 micrometer and a single polar flagellum. The bacteria have no spore and capsules. Colonies look pale yellow, circular,

174

Bacterial Diseases of Rice and Their Management

smooth, and convex with an entire margin on nutrient agar media (Webster and Gunnell, 1992). 10.4 DIAGNOSIS AND DETECTION OF XOO Disease diagnosis is one of the important components in the management of plant disease. It is difficult to isolate Xoo directly from seed owing to sluggish growth of bacterium and competitive inhibition by other microbes. The semi-selective medium, i.e., XOS, was developed by Yuan in 1990 for the isolation of bacteria from rice seed. The most effective way for the detection and differentiation of Xanthomonas oryzea isolates is the mPCR (Lang et al., 2010; Vera Cruz et al., 2017) and real time PCR (Lio et al., 2003). These tools are crucial to identify and recognize the pathogen in symptomatic and asymptomatic tissue. Specific PCR detection system has been developed by the Kang et al. (2008) (targets a membrane fusion protein (MFP) gene) for X. oryzae pv. oryzicola. Leach et al. (1990) has also made use of repetitive DNA sequence (pJEL 101) to identify Xoo. Genus and pathovar specific monoclonal antibodies can be exploited in an Enzymelinked immunosorbent assay (Alvarez et al., 1985; Benedict et al., 1989). 10.5 SYMPTOMATOLOGY BLS can occur at any stage during growth and development, i.e., from tillering to panicle initiation. Initially, symptoms appear as small, narrow, dark green and interveinal water-soaked streaks of various lengths primarily restricted to the leaf blades. Later the streaks enlarge, turn yellowish orange to light brown, and eventually coalesce. Whole leaves become brown and then grayish white and eventually die. Tiny amber droplets of bacterial exudates, which consist of colonies of bacteria, are often available on the lesions. This condition lowers the grain weight due to disruption of photosynthetic reaction. Lesions tend to be enclosed by veins and occur anywhere on the leaf. In advanced stages, leaves wither and turn brown, and it becomes difficult to discriminate the disease from BLB. However, lesion margins remain linear rather than becoming wavy, as is the case with leaf blight. There are no reports of symptoms on infected seeds with Xoo. The symptoms are very identical to thin brown leaf spot in the early stage of growth. But when the streak gets coalesced, symptoms of bacterial blight (BB) and BLS are not able to distinguish. However, the shape and size of the boundaries of

Introduction to the Biological and Ecological Studies

175

the lesions are different. Straight edge is found in leaf streak and undulating in leaf blight (Figures 10.1 and 10.2).

FIGURE 10.1 Initial symptom in the leaf as small, narrow, dark green, interveinal, watersoaked streaks.

FIGURE 10.2 Enlarged streaks, turned yellowish orange to light brown, and eventually coalesced in leaves.

176

Bacterial Diseases of Rice and Their Management

10.6 BIOLOGY AND ECOLOGY X. oryzae pv. oryzicola infects the host through leaf via stomata or wounds and multiply in parenchymatous tissue in the beginning and becomes piled in complex tissue (vascular regions) (Niño-Liu et al., 2006). Extensive multi­ plication takes place in parenchyma until the tissues are totally replaced by bacteria (Ou, 1985). The bacteria colonize the host mesophyll and render the vein-delimited streaks (Ou, 1985). As the disease progress and tissue gets deteriorated, Xoo may enter the host vasculature, due to probable spatial obstacle in the host tissue. Natural wounds created by agronomic practice, weather conditions such as high temperature, relative humidity and rain with wind also contribute Xoo epidemics significantly by giving straight access to bacteria. Damage is related to lepidopteran leaf rollers, leaf-folders, hispa, and beetles, since bacteria enter the damaged tissue caused by infestation of insect readily (CABI, 1992). Microscopic studies on plant physiology and Xanthomonas interactions at hydathodes reveal that xylem dwelling Xanthomonas have a natural tendency to react with specific signals arising from hydathodes (Cerutti et al., 2017). However, key signals and the underlying genetic elements that connect them to Xoo and Xoc tissue specialization are yet to be resolved. Extreme cases are prevalent in early growth and development of rice, because younger rice plant is more sensitive to the disease. Bacterial exudates are found on the surface of the leaf lesions during humid conditions however, in dry, yellow beads are found on the outer surface (Ou, 1985). The bacterial exudates pass quickly from plant to plant by irrigated water containing bacterial exudates, also by wind, rain, and direct contact. This allows bacteria to even spread from field to field. Seeds are also carrier of bacteria (Webster and Gunnell, 1992). 10.7 DISEASE CYCLE AND PRE-DISPOSING FACTORS Bacteria lie dormant or live as a reservoir in infested seed and infected crop residue (straw), volunteer plants and all wild rice species. In addition, bacteria may be able to survive in irrigated water for short duration. The pathogen is seed borne and transmitted through seed, therefore, rice seeds act as a source of primary inoculum (Xie and Mew, 1998). Bacteria also spread in fields by mechanical contact, rain, and irrigated water. Consistent rain induces the development of disease (Ou, 1985). Rain splash facilitate the dissemination of bacteria from infected source to the healthy one. Rainfall

Introduction to the Biological and Ecological Studies

177

with strong wind cause water soaking condition and wound formation, which facilitate the entry of bacteria. BLS is more severe, when excessive dose of nitrogen is applied to the rice crop (IRRI, 2004, 2010). It is thought that seed transmission occurs from one summer season to the next, however, if seed is sown during the winter season, pathogens are not able to settle in cool, dry, and winter weather. BLS occurs under high moist condition (95%) and medium to high temperatures (28–35°C) condition (Webster and Gunnell, 1992). Irrigated fields mediated through sprinkler, Poor management of rice residue, poor field hygiene and home saved rice seeds utilization is liable for the extensive occurrence of BLS disease since these factors lead to the building-up of primary inoculum. 10.8 PREVENTION AND MANAGEMENT The movement of seed must be regulated, and seed detection methods must be well established to restrict dissemination of pathogens in an effective manner (Goto, 1992; Mew, 1992; Wang et al., 1993). Detection methods of seedborne bacteria, such as the grow-out and plant injection or inoculation tests produce unpredictable results (Goto, 1992; Swings, 1990; Wang et al., 1993). Immuno-radiometric assay (IRMA; 19), enzyme-linked immunosorbent assay (ELISA), and monoclonal antibodies assay (CMI, 1982; Wang et al., 1993) have been developed to detect the presence of X. oryzae pv. oryzicola. However, there are shortcomings to the use of mentioned methods in normal seed-health testing of huge seed samples. These methods do not differentiate between living and non-living cells. Cross-reactions with X. oryzae pv. oryzae and other bacteria have also been observed in some cases (Wang et al., 1993; Xie, 1996). These techniques also need specific equipment and high processing cost. Therefore, none of these methods is suitable in routine rice seed health testing (Goto, 1992; Mew, 1994). Genetic studies of quantitative traits are tedious because of peculiar genetic organization. Recent advancements in molecular marker technologies such as restriction fragment length polymorphism (RFLP) and amplified frag­ ment length polymorphism (AFLP) are new technology for the elucidation of complex traits at the level of molecular genetics. Breeding resistance variety is the most important way to control BLS disease. BLS resistance seems to be quantitative in nature (Khush, 1977) and controlled by a number of QTLs (Tang et al., 1998, 2000). There are various ways that may be adopted in the management of bacterial streak disease of rice. Effective application

178

Bacterial Diseases of Rice and Their Management

of fertilizers, adoption of proper plant spacing patterns, use of resistant varieties, and treatment of seeds with hot water are some important ways. Ruining of left ratoons, straws, and volunteer seedlings after harvest are also one of the methods to lessen the initial inoculums in the early crop season. Well-drainage systems, particularly in seedbeds, can also help in the manage­ ment of this disease. A balanced dose of plant nutrients, especially nitrogen, is recommendable. Drying of field in the fallow period to kill microbes in the soil and in plant residues is also one of the common practices. Resistant varieties such as IR-20, TKM-6 should be cultivated to get rid of BLS (Khan et al., 2014). Nurseries of rice in isolated upland conditions are supposed to be good practice. Clipping of seedlings during transplantation and rotation along with barley and millet crops should be avoided. Insect control checks excess wound formation and opening of sores where bacteria could penetrate easily. Sometimes spray of fresh cow dung water extract or lemon grass or mint extract at 20% is also advised by some plant pathologist. If someone wants to use chemicals method then spray of streptomycin sulfate and tetracycline +copper oxychloride 1.25 kg/ha is widely accepted formulation in the manage­ ment of this disease. The application of only copper or chemical formulations as optional methods may also be used for bacterial disease control; however, an environmental concern is an issue (Yang, 2010). As far as bio-control is concerned, Streptomyces has vast capacity as a growth promoter and inducer of systemic resistance in rice plants against BLS disease (Hata et al., 2021). Application of Streptomyces is a safer and sustainable alternative to unsafe chemicals and may be incorporated into BLS disease management. 10.9 CONCLUSION More than half the population of world relies on Rice (Oryza sativa L.) for the livelihood. India has the largest area and holds second ranks next to China in total rice production. Diseases obviously are one of the main restraints to their proficient crop production. BLS is a minor disease and occurs in tropical and subtropical regions. Major emphasis has been given on economic importance, etiology, diagnosis, and identification, symptomatology, ecology, and biology, cycle of disease, pre-disposing factors, and prevention and management strategies of BLS disease in this chapter. Holistic approach helpful for the control of this disease is abhorrently effective. Resistance breeding strategies, chemical, and agronomic practices such as crop rotation, nutrient application, plant spacing, irrigation, etc., should be potential viable parts for integrated

Introduction to the Biological and Ecological Studies

179

management. Resistant varieties coupled with judicious use of chemicals and agronomic practices are the potential and novel options for integrated disease management of this disease. Besides these, correct and efficient disease diagnosis and detection is one of the most important components in the management of BLS disease. Molecular approaches such as mPCR and real time PCR are most effective way for the detection and differentiation of Xoo. These tools are crucial to detect the presence or absence of pathogenic agents in symptomatic and asymptomatic plant tissue. KEYWORDS • • • • • •

bacterial leaf blight bacterial leaf streak detection and diagnosis immuno-radiometric assay management strategies restriction fragment length polymorphism

REFERENCES Alvarez, A. M., Benedict, A. A., & Mizumoto, C. Y., (1985). Identification of xanthomonads and grouping of strains of Xanthomonas campestris pv. campestris with monoclonal antibodies. Phytopathol., 75, 722–728. Benedict, A. A., Alvarez, A. M., Berestecky, J., Imanaka, W., Mizumoto, C. Y., Pollard, L. W., Mew, T. W., & Gonzalez, C. F., (1989). Pathovar-specific monoclonal antibodies for Xanthomonas campestris pv. Oryzae and for Xanthomonas campestris pv. Oryzicola. Phytopathol., 79, 322–328. Cerutti, A., Jauneau, A., Auriac, M. C., Lauber, E., Martinez, Y., Chiarenza, S., Leonhardt, N., et al., (2017). Immunity at cauliflower hydathodes controls systemic infection by Xanthomonas campestris pv. campestris. Plant Physiol., 174, 700–716. Commonwealth Mycological Institute (CMI), (1982). Descriptions of Pathogenic Fungi and Bacteria. No. 515. Kew, Surrey, England. Fang, C. T., Ren, H. C., Chen, T. Y., Chu, Y. K., Fan, H. C., & Wu, S. C., (1957). A comparison of the rice leaf blight organism with the bacterial leaf streak organism of rice and Leersia hexandra Swartz. Acta Phytopathol., 3, 99–124. Goto, M., (1992). Fundamentals of Bacterial Plant Pathology (pp. 210–224). In: Academic Press, San Diego, CA.

180

Bacterial Diseases of Rice and Their Management

Hata, E. M., Yusof, M. T., & Zulperi, D., (2021). Induction of systemic resistance against bacterial leaf streak disease and growth promotion in rice plant by Streptomyces shenzhenesis TKSC3 and Streptomyces sp. SS8. Plant Pathol. Journal, 37(2), 173–181. IRRI, (2004). International Rice Research Institute. Rice Fact Sheet, Bacterial Leaf Streak. IRRI, (2010). International Rice Research Institute. Rice Fact Sheet, Bacterial Blight. Kang, M. J., Shim, J. K., Cho, M. S., Seol, Y. J., Hahn, J. H., Hwang, D. J., & Park, D. S., (2008). Specific detection of Xanthomonas oryzae pv. oryzicola in infected rice plant by use of PCR assay targeting a membrane fusion protein gene. J. Microbiol. Biotechnol., 18, 1492–1495. Khan, M. A., Naeem, M., & Iqbal, M., (2014). Breeding approaches for bacterial leaf blight resistance in rice (Oryza sativa L.), current status and future directions. Eur. J. Plant Pathol., 139, 27–37. Khush, G. S., (1977). Disease and insect resistance in rice. Adv Agron., 29, 265–341. Lang, J. M., Hamilton, J. P., Diaz, M. G. Q., Van, S. M. A., Burgos, M. R. G., Cruz, C. M. V., Buell, C. R., et al., (2010). Genomics-based diagnostic marker development for Xanthomonas oryzae pv. oryzae and X. oryzae pv. oryzicola. Plant Dis., 94, 311–319. Leach, J. F., White, F. F., Rhoads, M. L., & Leung, H., (1990). Repetitive DNA sequence differentiates Xanthomonas campestris pv. oryzae from other pathovars of X. campestris. Molecular Plant-Microbe Interactions., 3, 238–246. Liao, X., Zhu, S., Zhao, W., Luo, K., & Qi, Y., (2003). Detection and identification of Xanthomonas oryzae pv. oryzae and Xanthomonas oryzae pv. oryzicola by real-time fluorescent PCR. Wei Sheng Wu Xue Bao., 43(5), 626–634. Liu, W., Liu, J., Triplet, L., Leach, J. E., & Wang, G. L., (2014). Novel insights into rice innate immunity against bacterial and fungal pathogens. Annu. Rev. Phytopathol, 52, 213–241. Mew, T. W., & Misra, J. K., (1994). A Manual of Rice Seed Health Testing. International Rice Research Institute, Los Baños, Philippines. Mew, T. W., (1992). Management of rice diseases—A future perspective. In: Kadira, A. A., & Barlow, H. S., (eds.), Pest Management and the Environment in 2000 (p. 401). CAB International, UK. Niño-Liu, D. O., Darnielle, L., & Bogdanove, A. J., (2006). Xanthomonas oryzae pathovars: Model pathogens of a model crop. Mole. Pl. Pathol., 7, 303–324. Ou, S. H., (1985). Rice Diseases (2nd edn.). Association Applied Biology, Surrey, England. Swings, J., Van, D. M. M., Vauterin, L., Hoste, B., Gillis, M., Mew, T. W., & Kerster, K., (1990). Reclassification of causal agents of bacterial blight (Xanthomonas campestris pv. oryzae) and bacterial leaf streak (X. oryzae pv. oryzicola) of rice as pathovars of X. oryzae sp. nom. rev. Int. J. Syst. Bacteriol., 40, 309–311. Tang, D., Li, W., & Wu, W., (1998). Inheritance of the resistance to rice bacterial leaf streak (in Chinese). J. Fujian Agric Univ., 27, 133–137. Tang, D., Wu, W., Li, W., Lu, H., & Worland, A. J., (2000). Mapping of QTLs conferring resistance to bacterial leaf streak in rice. Theor. Appl. Genet., 101, 286–291. Vera, C. C. M., Nguyen, M., Lang, J., Verdier, V., Mew, T. M., & Leach, J. E., (2017). Detection of Xanthomonas oryzae pv. oryzae, and X. oryzae pv. oryzicola in rice seeds (Chapter 8). In: M’barek, F. W. R., & Schaad, N., (eds.), APS Manual on Detection of Plant Pathogenic Bacteria in Seed and Other Planting Material. APS Press, Minneapolis, MN. Wang, G. J., Zhu, X. D., Chen, Y. L., & Xie, G. L., (1993). A rapid ELISA method for the identification of rice seeds infected by Xanthomonas oryzae pv. Oryzicola. Jiangsu J. Agric. Sci., 9, 36–39.

Introduction to the Biological and Ecological Studies

181

Webster, R. K., & Gunnell, P. S., (1992). Compendium of Rice Diseases (p. 52). American Phytopathological Society, St. Paul, Minnesota. Wonni, I., Ouedraogo, L., & Verdier, V., (2011). First report of bacterial leaf streak caused by Xanthomonas oryzae pv. Oryzicola on rice in Burkina Faso. Plant Dis., 95, 72. Xie, G. L., & Mew, T. W., (1998). A leaf inoculation method for detection of Xanthomonas oryzae pv. oryzicola from rice seed. Plant Dis., 82, 1007–1011. Xie, G. L., (1996). Characterization of Pseudomonas sp. and Other Bacterial Species Associated with Rice Seeds. Ph.D. thesis. International Rice Research Institute-University of the Philippines at Los Baños, Los Baños, Philippines. Yang, C. M., (2010). Assessment of the severity of bacterial leaf blight in rice using canopy hyperspectral reflectance. Precis. Agric., 11, 61–81. Yuan, W. Q., (1990). Culture medium for Xanthomonas campestris pv. Oryzae. J. App. Bacteriol., 69, 798–805.

CHAPTER 11

Retrospective and Perspective Management of Rice Bacterial Leaf Streak Disease DARAKSHA PARWEEN,1 AMBER GUPTA,2,3 BINOD BIHARI SAHU,1 and BIRENDRA PRASAD SHAW2,3 Department of Life Science, National Institute of Technology, Rourkela,

Odisha–769008, India

1

Abiotic Stress and Agro Biotechnology Lab, Institute of Life Sciences,

Bhubaneshwar, Odisha–751023, India,

E-mail: [email protected] (A. Gupta)

2

3

Regional Centre for Biotechnology, Faridabad, Haryana, India.

ABSTRACT Rice is widely grown in the tropical and subtropical region, which is a staple food crop specifically in the Asian region. This highly valuable crop is greatly affected by bacterial and fungal diseases that make a significant loss in crop yield. Around 70 different diseases are widely known, which affect crop yield, 11 are bacterial-originated diseases. Among these 11 bacterial diseases, bacterial leaf streak (BLS) disease or black chaff disease caused by gram-negative bacteria, Xanthomonas oryzicola (Xoc) makes 20–30% yield loss in rice production. This pathogen often enters in plant system through stomata or wounds and multiplies itself in the apoplast of mesophyll tissue and later develops as water soaked yellow or orange brown lesion-symptom especially on the rice leaves. Xoc generally infects the plants grown in high temperature and high humid regions (climatic and subtropical environmental conditions). So far, the infection is widely reported from Africa, Asia, Africa, Bacterial Diseases of Rice and Their Management. Deepti Srivastava, Md. Shamim, Malik Mobeen Ahmad, & K. N. Singh (Eds.) © 2023 Apple Academic Press, Inc. Co-published with CRC Press (Taylor & Francis)

184

Bacterial Diseases of Rice and Their Management

Australia, Bangladesh, South America, India, and Bangladesh. It has been reported that the defense response in the plant system against Xoc is a quanti­ tative feature governed by polygenes. However, to manage the drastic effect of Xoc pathogen, several strategies and measurement are reported like rice breeding program via QTL mapping, modification in TAL effector binding sites, overexpression of heat shock protein (HSP), chitosan mediated defense response, chemical derivatives, etc., that become helpful to some extent for the survival of rice plant without affecting much of crop yield due to BLS infection in untreated or wild type rice cultivar. 11.1 INTRODUCTION Rice is one of the significant staple food crops for a large population of Asia, America, and the African region. Around 90% of rice consumers are reported from Asian Population while the production rate of rice is reported 30.85%, 8.21%, and 20.12%, respectively, from China, Indonesia, and India in terms of global rice production (Pradiprao et al., 2015; Childs, 2012). In India, around 23.3% of gross cropped area covers for rice production, rice is a grain crop that is utilized as an essential food for nutrients supplement. Out of total grain and cereal production from India rice covers around 43% and 46% part of grain and cereal production, respectively. India stands on the second position for rice production after China. The statistical data for the rice production in area wise accounted 162 Mha globally from India while the contribution at world level towards productivity and production has been estimated around 4.44 MT/ ha and 483.3 million tons, respectively (USDA, Rice Outlook, Economic Research Service /RCS-16J/October 14, 2016). Around 70 different kinds of pathogens are so far reported that infects to plant system as biotic stress. Out of the 70 different pathogens, 11 diseases are reported due to different kinds of bacteria (Saha et al., 2015). Rice is pressurized by various kinds of fungal and bacterial pathogen (Khan et al., 2009). There are 56 fungal are studied that mainly infects to rice plant (Richardson, 1981; Ou, 1985). Among these 41 diseases have been estimated as seed-borne (Richardson, 1979). In the case of pathogen-infected untreated seed get sown in the Field condition then it reduces the total 15–90% crop yield depends upon the severity of pathogenicity of causing disease (Zafar et al., 2014). In continuation of seed-borne disease, and bacterial disease is very much harmful that makes a significant yield of loss. The genus Xanthomonas covers the common group of gram-negative bacteria that infect the plant. Different kinds of Xanthomonas pathogen infect different kinds of plants as per specificity and develop diseases with

Retrospective and Perspective Management

185

diverse symptoms known as bacterial spots, and leaf blights (Xu et al., 2017; Ryan et al., 2011). Among the top 10 Xanthomonas species two of the bacterial disease: Bacterial leaf blight (BLB) caused by Xanthomonas oryzae pv. oryzae (Xoo) and bacterial leaf streak (BLS) of rice Xanthomonas oryaze pv. oryzacola (Xoc). Xoo and Xoc both of these organisms cause the disease to crop plants at the tillering stage (Nino-Liu et al., 2006; Kang et al., 2008). Xoo enters the rice plant through hydathodes or wounds and causes infection through the xylem tissue as a wide necrotic lesion at leaf margins and on veins downside the center of the leaves while Xoc enters through stomata and get colonize in intercellular spaces (apoplast) of the mesophyll or parenchyma tissue where it develops as water-soaked lesions on interveinal part of the leaves that finally remarked as necrotic lesion streak in advance stage of infection (Nino-Liu et al., 2006; White and Yang, 2009). Around 20% of crop yield loss has been reported due to Xoc infection (BLS) in rice as per climatic condition and variety sensitivity to Xoc pathogenicity. Plants have an amazing ability to detect and respond to the exposed poten­ tial pathogens which help the plants to defend themselves and survive against potential pathogenic microbes (Dodds and Rathjen, 2010). Plant immunity is generally recognized by pathogen- or microbe-associated molecular patterns (PAMPs/ MAMPs) which includes peptidoglycan (PGN), fungal chitin and bacterial flagellin, extracellular ATP, or plant-cell-wall-derived oligoga­ lacturonides (OGs). Plant innate immunity has two-tier perception system. The first layer of immunity includes recognition of PAMPs by patternrecognition receptors (PRRs) which triggers PAMP-triggered immunity (PTI). The second layer of immunity includes direct or indirect recognition of effector proteins secreted by pathogens inside host cell with the help of NOD-like receptor (NLR) type, which induce effector-triggered immunity (ETI) (Macho and Zipfel, 2014). Currently, only a few of the methods are in use for bacterial disease management through biological and chemical treatment (Huang et al., 1997). Henceforth, the present chapter highlighting and describing the detailed reported work for bacterial streak disease prevention in rice plant that can be accepted as a mitigating approach against BLS pathogenicity. 11.2 BACTERIAL LEAF STREAK (BLS) DISEASE: AN OVERVIEW Bacterial leaf streak or BLS was reported in the Philippines in the year 1918 and named as stripe disease. This disease was also known as black chaff when it infected on glumes (cereal crops), transmitted through infected seed,

186

Bacterial Diseases of Rice and Their Management

and getting spread through seed exchange program. The disease black chaff or stripe disease was well reported by Duveiller (1994). When this disease reported from China by Fang et al. (1957), it was again renamed as BLS. Later this disease was widely reported from lowland and upland areas of West Africa, tropical regions of Asia, including India, Thailand, Indonesia, Malaysia, Vietnam, Cambodia, and Bangladesh (Srivastava, 1969). The history of this disease was widely reported when it became rapidly spread in 11 provinces of China due to the use of BLS infected seed of hybrid rice in the year 1980. Nowadays, Bacterial Streak disease stands on the fourth position followed by rice blast, leaf blight, and rice sheath blight disease in China, which is controlled by quarantine regulations of China. The clas­ sification detail of Xanthomonas oryzae pv. oryzicola BLS causing disease is as in subsections. 11.2.1 CAUSAL ORGANISM AND ITS CLASSIFICATION Xanthomonas oryzae pv. oryzicola (Swings et al., 1990).        

Kingdom: Bacteria Phylum: Proteobacteria Class: Gammaproteobacteria Order: Xanthomonadale Family: Xanthomonadaceae Genus: Xanthomonas Species: Oryzae Pv (pathovar): Oryzicola

11.2.2 MORPHOLOGICAL CHARACTERISTICS OF THE XOC Gram negative, Rod-shaped, monotrichous, non-spore-forming with round, smooth, domed, entire, mucosal colony forming bacteria. It contains xantho­ monadin pigment that imparts a yellow color to the bacteria (Kumar et al., 2017). 11.2.3 GEOGRAPHICAL DISTRIBUTION OF XOC BLS causes infection mainly in high temperature and high humid area. It infects the crop plant mainly in the Asian region: South America, Bangladesh,

Retrospective and Perspective Management

187

India, Philippines, Nepal, Myanmar, Pakistan, Thailand, Viet Nam, Lao, Indonesia, Cambodia, and China because of prevailing the tropical and subtropical climate as a favorable condition for Xoc growth. In India, this disease is so far reported from Uttar Pradesh, Maharashtra, Madhya Pradesh, Bihar, Karnataka, etc. Other than the Asian region, this disease is also surveyed from Australia and African countries – Senegal, Nigeria. Estima­ tion of the average loss in rice yield due to BLS infection has been accounted for around 8–17% under wet season climatic conditions while 1–3% under dry season conditions (Kumar et al., 2017). 11.2.4 VISUAL IDENTIFICATION OF BACTERIAL LEAF STREAK (BLS) DISEASE BLS is a foliar disease. It can be identified by inter veinal translucent streak which is found in 1–10 cm size in length on leaves. Tiny amber or yellow color dry beads like the structure of bacteria exudates can be observed as streaked on veins of infected leaves. Under the advanced stage of disease development, these streaks mark get merge and form large patches on the entire leaf. Gradually the infected plant leaf resembles as blighted but in case of a susceptible plant variety to Xoc infection the streaks sign gets surrounded by a yellow color halo (Ou, 1985). 11.2.5 BACTERIAL LEAF STREAK (BLS) DISEASE CYCLE AND EPIDEMIOLOGY Streak disease is a seed-borne disease that can disperse through infected seed sowing and also this disease spreads to some extent through communicable transmission from one plant to another. The moist condition favors the bacteria to invade inside the tissue for its colonization. Generally, it enters the plant through the wound, stomata, or opened/-injured surface of leaves. These bacteria complete its generation cycle in the apoplast region of parenchyma or mesophyll tissue under 15°C to 30C temperature (Ou et al., 1970). This disease progresses its infection from the bottom to the top in the plant system. When the observed streak mark on leaves getting increased in size its remarks towards the progression of the streak disease in the plant. The primary infection of the disease generally occurs from the infected seed or infected crop debris to the healthy seed in the field condition (Tillman et al., 1996). In the case of severe pandemic infection, the disease can spread

188

Bacterial Diseases of Rice and Their Management

to other standing plants by bacterial ooze blown away by the wind, pollina­ tion process, or by the insect as a vector. Wet tropical climate (26–30°C with a humidity range of 74–94%) and a high dose of nitrogen supplement in the field favors the chance of infection by Xoc especially in young stage growing plants than the old or mature stage. The quarantine program for the seeds were used in practice before grown in the field to avoid the spread of this disease (Shekhawat and Srivastava, 1972; Mizukami, 1969). 11.3 PERSPECTIVE MANAGEMENT OF BACTERIAL LEAF STREAK (BLS) DISEASE IN RICE Due to the absence of the expected level of resistance in rice against BLS, the disease management depends on multiple strategies which can endeavor to lessen the disease severity and can produce enhanced disease resistance crop (Figure 11.1).

FIGURE 11.1 Schematic drawing representing the interaction of Rice – Xoc. On the left: shows a visual representation of yellow patches during infection occurred in rice due to Xoc; on the right: show possible multiple strategies including QTL mapping, overexpression of heat shock protein, modification in TAL effector binding sites, bio-product treatment and chemical derivatives which can lead to activation of defense response against the BLS in rice plants.

11.3.1 EFFECT OF CHEMICAL TREATMENT In the year 2014, Li et al. have introduced the sulfone derivative of 2,5-substituted-1,3,4-oxadiazole/thiadiazole chemical through turbidimetry

Retrospective and Perspective Management

189

bioassay that imparts inhibitory effect against Xoo and Xoc to prevent the disease of BLB and BLS, respectively. 1,3,4-Oxadiazole/thiadiazole is the chemical that is widely used in the area of medicinal chemistry because of its good pharmacological activities study. Even various derivative of 1,3,4-Oxadiazole/thiadiazole have been proven as antibacterial (Li et al., 2013) and antifungal (Zhang et al., 2013). Li et al. (2014) have made several sulfone derivatives of 1,3,4-Oxadiazole/ thiadiazole in the concentration range of 100 µg/ml that control the BLS pathogen by 100% efficiency through turbidimetric assay which is proven better than of Thiadiazole copper and Bismerthiazol. The EC-50 value for different sulfone derivatives of 1,3,4-Oxadiazole/thiadiazole has been estimated in the range of 10.08–25.61 µg/ml. In this study as summary the compound 6c sulfone derivative (R1-4-F and R2-CH3) of 1,3,4-Oxadiazole/ thiadiazole was found more effective against BLS disease and bacterial leaf blight (BLB) disease due to its EC50 value of 7.14 µg/mL and 1.07 µg/mL value, respectively (Li et al., 2014). Another study by Shaobo et al. (2019) has speculated the synthesis of new derivative of 1,3,4-oxadiazole containing a cinnamic acid molecule by replacement of methylene and vinyl group in the heterocyclic structure that has been reported for its potential bactericidal activity against X. oryzae pv. oryzicola (Xoc). In their study two different derivatives of 1,3,4-oxadiazole, 5r (R1 = 4-Cl and R2 = C2H5) and 5t (R1 = 4-Br and R2 = C2H5) were studied against Xoc growth through the estimation of its EC50 value of 0.44 and 0.20 µg/mL, which has been found much better than bismerthiazol and thiodia­ zole copper. 1,3,4-oxadiazole derivatives are the important nitrogen containing hetero­ cyclic compound widely used as pesticide (Li et al., 2018). Cinnamic acid has been studied for its excellent antibacterial activity in combination with fumaric acid (Anslow and Stratford, 2000). Inclusion of cinnamic acid moiety in 1,3,4-oxadiazole can be used as good antibacterial activity as it has been shown by Wang et al. (2019) that their formulated compound 5t is able to protective against Xoo and Xoc infection as proven through in vivo experiment. There are several other diseases managements have been reported through chemical treatment to the seed material. In 1971, Shekhawat and Srivastava introduced the strategy of disease control through seed soaking in 0.025% of streptocycline solution overnight followed by warm water soaking of the seed in 52°C warm water for 30 minutes become helpful to control the BLS infection. They have also shown that spray processes by 0.15–0.3% solution of Vitavax are supportive management strategy to prevent the BLS lesion development in plant.

190

Bacterial Diseases of Rice and Their Management

Banerjee et al. (1984) suggested the three-time spray by agrimycin 100 or streptocycline in 100 ppm concentration at every 10 days interval since the early appearance of BLS lesion become helpful to prevent the disease progression. Although usage of chemicals to prevent BLS is helpful strategy but it uses to make drastic effect on soil fertility and imbalance of natural system, which might be health hazardous to the animals and human, so eco-friendly approaches would be the best way to avoid the BLS disease. Eco friendly approach not only helps to reduce the cost of disease management but also give better yield in low-cost input. Eco friendly approach would be perfect to balance the harmony in between artificial and natural ecosystem along with disease prevention and minimization. Some of the strategy like seed sowing in wide space (30 × 15 cm), avoid to clipping the seedling tip at transplanting time, well management of water irrigation and drainage facility, practice of field sanitization like remove of rice straws, choice of alternation of collateral and volunteer plant, and avoid to excess use of nitrogen fertilizer, all these ways help to prevent and spread of the BLS disease (Kumar et al., 2017). Selection of resistant rice varieties like Blade, Knudson, Faller, Crom­ well, Howard, IR-20, Jagannath, Krishna, etc., are the best one that have been proven resistant to BLS infection and loss in yield due to infection as Ou et al. (1970) screened 1,118 rice cultivars through inoculation process to confirm the natural immune resistant variety against BLS. Out of 1,118 cultivars, only 140 varieties showed small lesion development or disease progression after infection. 11.3.2 TREATMENT THROUGH BIOPRODUCTS FOR DISEASE PREVENTION The study has been reported regarding antibacterial activity over the use of two kinds of chitosan treatment, differ in molecular weight and degree for its N-deacetylation as the most effective method to control the BLS and BLB disease (Li et al., 2013). Li et al. (2013) have shown the mode of action of chitosan treatment through membrane lysis (cell membrane disruption) as already reported by Chung and Chen (2008) and biofilm destruction by chitosan solution. Apart from the antibacterial activity the chitosan treatment for 48 hours treatment also increased the activity of peroxidase (POD), phenylalanine ammonia lyase, and polyphenol oxidase (PPO) by 10.4%, 27.7%, and 28.2% respectively in rice seedling after Xoc attack. So,

Retrospective and Perspective Management

191

in summary the chitosan treatment has dual property against BLS and BLB as giving resistance property and induced immunity in rice. Their study has shown the effective concentration of chitosan A and chitosan B solution used in 0.20 mg/L decrease the growth of X. oryzae pv. oryzicola by 3.96 log CFU/ml and 3.13 log CFU/ml, respectively in comparison to control. Even the study of effect of fixed concentration of 20 mg/L of chitosan A and chitosan B for 12 hours time point contact decrease the bacterial survival by 5.87 log CFU/ml and 3.41 CFU/ml in chitosan A solution and Chitosan solution B, respectively. The starting of cell lysis after treatment either by chitosan A or chitosan B was recorded post 4 hours by scanning electron microscope image analysis. In vivo study of rice plant Li et al. (2012) recorded the 29.6 mm size of lesion length after Xoc BLS-01 strain infection, but effect of chitosan A and chitosan B treatment reduce the lesion size by 56.3% and 35.8% respectively after infection. The prevention rate of disease incidence of BLS has been reported by 43.8% and 27.1% through Chitosan A and Chitosan B, respectively against Xoc. Although both chitosan A and chitosan B are found for its good antibacte­ rial property in respect to more for Xoc than Xoo but in terms of comparative outcome chitosan A has been accepted as more effective against Xoc survival and growth rate comparison to chitosan B. Plants generally defend against pathogen through the induced the enzyme activity of PAL, POD, and PPO which is supported by some other past reported work (Prapagdee et al., 2007; Manjunatha et al., 2008; Trotel-Aziz et al., 2006) as it has been observed through chitosan A and B treatment which supports the best efficiency through chitosan derivative treatment. Some other traditional bioproducts like spray of fresh cow dung extract (fortnight interval), application of neem oil 60 EC in 3% amount or neem seed kernel extract in 5% amount help to prevent the disease (Kumar et al., 2017). In spite of these methods wet seed treatment (ST) through beneficial microbes like Bacillus subtilis var. amyloliquefaciens, Streptomyces toxytricini, Lysobacter antibioticus, and Pseudomonas fluorescens proven as helpful approach to prevent and reduce the infectivity of BLS and BLB (Ji et al., 2008; Velusamy et al., 2006). 11.3.3 QUANTITATIVE TRAIT LOCUS (QTL) CONTROLLING DISEASE RESISTANCE IN RICE AGAINST BLS The major challenge in the cultivation of rice free from BLS disease is to indiscriminate the use of conventional methods, including chemical

192

Bacterial Diseases of Rice and Their Management

insecticides/pesticides, which not only have an adverse effect on the natural system but also enforce a threat to the healthiness of humans and animals. Therefore, identification of genes that can provide quantitative resistance and can develop durably resistant varieties is the best approach to control BLS which can also be eco-friendly (Adhikari et al., 2012). Advancement in biotechnological approaches especially with the intro­ duction of molecular markers such as AFLP and restriction fragment length polymorphism (RFLP) and also the rapidity of computational approach has facilitated mapping of economically important quantitative trait loci (QTLs) in various crops (Tang et al., 2000). To date, more than 20 BLS resistance gene have been identified (Chen et al., 2006) but no major genes have been reported to confer complete resistant to rice against BLS even though some cultivars are less susceptible than others (Kandel et al., 2015). Till now, numerous resistance genes/QTLs have been testified which showed BLS resistance in rice. At least 13 QTLs have been reported confer­ ring resistance to BLS mapped from indica rice variety Acc8558 and Dular (Tang et al., 2000; Chen et al., 2006; Sheng et al., 2005). Amongst them, 11 QTL were identified by Tang et al. (2000). Out of the them, 5 QTLs, i.e., qBlsr1, qBlsr3b, qBlsr3d, qBlsr5a and qBlsr5b were marked as most important (Tang et al., 2000). qBlsr5a, which is one of the major QTL was identified from chromosome 5. QTL qBlsr5a appears to contribute quantita­ tive resistance to Xoc which explains more than 10% (~14%) of phenotypic variation in the population and it is typically controlled by xa5, which is a major recessive R gene for bacterial blight (BB) (Xie et al., 2014). Later on, a polygalacturonase-inhibiting protein (PGIP), OsPGIP4, was found coinciding with qBlsr5a QTL on the short arm of chromosome 5 (Feng et al., 2016). Feng et al. (2016) found that the overexpression of OsPGIP4 can enhance defense response of rice to BLS, which also showed triggered expression of jasmonic acid (JA) pathway. PGIPs plays an important role in boosting the innate immunity of rice against various necrotrophic and hemibiotrophic fungal pathogens by inhibiting the hydrolytic activity of polygalacturonase. This inhibition causes a delay in the hydrolysis of a plant cell wall component named OGs. PGIPs belongs to the defense-related (DR) gene family (Feng et al., 2016). Few cases of the co-localization of DR genes with QTLs have conferred resistance to Xoc (Kou and Wang, 2010). For instance, the activation of OsMPK6, a mitogen-activated protein kinase, regulates disease resistance in rice against both Xoc and Xoo (Shen et al., 2010). Also, overexpression of OsGH3-2, the GH3 family gene encoding an indole-3-acetic acid (IAA)­ amido synthetase, confers broad-spectrum and partial resistance to rice

Retrospective and Perspective Management

193

against Xoc, Xoo, and M. grisea (Fu et al., 2011). Recently, Song Wang et al. (2020) qBlsr3d can improve resistance to BLS. Previously, Etienne et al. (1992) suggested five genes (Bls1, Bls2, Bls3, Bls4, and Bls5) for BLS resistance which were found to be localized in chromosomes 1A, 4A, 4B, 6B, and 7D of wheat germplasm. He et al. (2012) mapped the second recessive R gene, bls1, localized to chromosome 6 of the wild species Oryza rufipogon with an unknown spectrum of action. 11.3.4 BLS DISEASE MANAGEMENT THROUGH GENE EXPRESSION REGULATION There is a term “arm race” coined by Boller and He (2009) in view of defense between plant and pathogen battle as observed for the time of million years of coevolution. Natural phenotype feature of plant-like cell surface of plant cell similar to animal skin act as physical and chemical defense barrier against pathogen infection. Plant cuticles enriched with wax and secondary metabolites are the first defense layer that work as antimicrobial compo­ nents (Malinovsky et al., 2014; Jones and Dangl, 2006). However, there are various reports are shown where some of the target gene over expression or silencing help to minimize the BLS disease progression and give protection to the plant as biotic stress tolerance feature. 11.3.4.1 ROLE OF HEAT SHOCK PROTEIN (HSP) IN BLS RESISTANCE Ju et al. (2017) represented the role of small heat shock protein (HSP) (OsHsp18.0-CI) for protection against BLS in rice. They have shown the preventive role of the selected hsp molecule through post-infection of BLS strain RS105 in the over-expressed OsHsp18.0-CI, repressed line plant and wild type rice plant. They have concluded the outcome for the role of OsHsp18.0-CI that not only able to give resistance to the rice plant against BLS but also there is no negative effect of the overexpression of OsHsp18.0­ CI in prospect of plant height, grain weight (100 grain), grain thickness and grain width without any significant differences have been observed for tiller number/ plant, grain length and number of grain per panicle in comparison to Shengdao 806 rice cultivar to confirm any negative effect due to OsHsp18.0­ CI overexpression. This is the additional detail in terms of role of hsp against biotic stress (BLS resistance) tolerance reported by Ju et al. (2017) apart from the role of abiotic stress resistance cold, drought, and salt, etc. (Ham et al., 2013; Guan et al., 2004; Sarkar et al., 2009).

194

Bacterial Diseases of Rice and Their Management

11.3.4.2 ROLE OF POLYGALACTURONASE-INHIBITING PROTEINS (PGIPS) IN BLS RESISTANCE In 2019, Wu et al., introduced the role of polygalacturonase-inhibiting proteins (PGIPs) against the BLS infection in rice. The idea of selecting PGIP 1 was generated through the previously reported work by Feng et al. (2016) where first they observed the gene PGIP4 get up regulated due to bacterial pathogen attack, in their study, they have shown that overexpression of PGIP4 give resistance against BLS in rice. Feng et al. (2016) also reported the close gene linkage of PGIP 4 with PGIP 1 on chromosome 5. In continua­ tion of previously reported work, they have again introduced the efficiency of PGIP 1 as another candidate gene which overexpression and silencing (RNA silencing line) regulate BLS progression (Xoc strain RS105) and infectivity in rice. They found that PGIPs overexpression reduce the infection property by BLS in rice while gene silencing line have been shown susceptibility for BLS infection. The role of PGIP is reported through inhibitory action against polygalacturonase through forming a complex with polygalacturonase to enhance the production of OG fragments at rate of low degree polymeriza­ tion process (Benedetti et al., 2013). Oligalacturonide has been categorized as Damage associated molecular pattern that evokes the plant host immunity against pathogen through recognizing on wall-associated kinase 1 (WAK 1) (Brutus et al., 2010). Wu et al. (2019), firstly observed the transcript data of PGIP 1 expression post 24 h infections of Xoc strain RS105 in rice through that they hypoth­ esized the role of PGIP 1 role against BLS infection. Parallelly they found the up-regulated expression of JA bio-synthesis related gene in PGIP 1 overexpressed line compare to wild type rice plant ZH11 as similar observation reported in case of PGIP 4 overexpressed line which supports the work done by Shen et al. (2010); and Guo et al. (2012) where they have shown that defensive role of JA for against Xoc infection in rice. Through yeast two hybridization experiment, Wu et al. (2019) have proven that there is no direct interaction of protein PGIP1 with PG (poly­ glactin) that indicates the different mechanism of resistance against bacterial and fungal pathogen Xoc and R. solani, respectively. Overall PGIP 1 and PGIP 4 accepted as ideal defense-related (DR) gene contributes toward resistance against BLS infection. Wu et al. (2019), also did the study in terms of energy cost or negative prospect to confirm any negative effect of overexpression of PGIP1 gene. There is no harmful effect has been observed in terms of number of tillers and weight of 1,000

Retrospective and Perspective Management

195

seed grain in PGIP1 overexpressed transgenic plant compared to wild type cultivar ZH11 as background. Another study by Yang et al. (2019) reported the overexpression of the leucine rich receptor kinase gene. PSKR1 in Arabidopsis and rice through gate way cloning that recognize the phytosulfokine (PSK) molecule produced by Xoc mediates (Sauter, 2015; Matsubayashi and Sakagami, 1996). The signaling mechanism due to interaction of PSK with PSK1 produces good resistance against Xoc RS105 strain disease progression. They also observed the up regulation of SA (salicylic acid) pathway linked to pathogenesis related gene in the transgenic rice line post-Xoc inoculation while pretreatment of PSK without Xoc infection does not change the level of SA significantly. Apart from SA-related biosynthesis gene up-regulation, JA biosynthesis-related genes get down-regulated in OsPSKR1 transgenic plant, which remarks the only importance, and dependency of SA biosynthesis-related gene for PSKR1 gene action rather than JA synthesis gene against Xoc infection in rice plant. Guo et al. (2014) reported the suppression of NRBB (receptor-like cytoplasmic kinase), a kind of differentially expressed protein genes (DEPGs) in rice plant lowers down the infection by pathogen specially Xoc infection parallel regulating to other important gene expression. NRBB is normally expressed in leaf blades and leaf pathogen, which favors the bacterial multiplication and colony formation while suppression of NRBB, enhanced the resistance against Xoc in rice (Guo et al., 2012). It has also been observed that overexpression of SA-related biosynthesis gene (CHS, PAD4, ICS1), pathogenesis-related gene PR1α (pathogenesis-related protein), PR5, PR10, PBZ1, RSPR 10, DR NH1, and WRKY13 show inverse relation with expression pattern of NRBB gene expression (Qiu et al., 2007; Datta et al., 1999; Nakashita et al., 2001; Hashimoto et al., 2004; Yuan et al., 2007) that favors the resistance against BLS infection. The similar expected work outcome by Guo et al. (2014) confirmed the induced transcript abundance of NH1 and WRKY13 (categorized as DR gene), up-regulation of SA biosynthesis-related gene–CHS, PAD4 and ICS1 and pathogenesis-related gene in NRBB suppressed transgenic (R72 and R 62) rice line plant which gives the resistance feature against Xoc infection. 11.3.4.3 MODIFICATION IN TRANSCRIPTION-ACTIVATOR LIKE EFFECTOR (TALE) PROTEINS Xanthomonas delivers transcription-activator-like effector (TALE) proteins into the plant cells through type 3 secretion (T3S). The injection of TAL

196

Bacterial Diseases of Rice and Their Management

effectors proteins activates effector-specific host gene, which leads to the virulence of Xoc and promote disease. Strains of Xoc are maintained by many tal genes. Tal2g from Xoc activates a sulfate transporter gene OsSULTR3; 6 which causes an increase in lesion development and plays a key role in rice susceptibility (Cernadas et al., 2014). Activation of this sulfate transporter causes an increase in water-soaked lesion development, may be due to varia­ tion of osmotic equilibrium or in variation of antioxidant capacity (PerezQuintero and Szurek, 2019). Besides, Tal2g; Tal2f, Tal11a, and Tal11b are also identified through the mutational analysis (Cernadas et al., 2014). It was also found that Some TALEs trigger disease resistance. Till date, only Xo1 has been found to confer resistance against the African Xoc strains which is triggered by X. oryzae TAL effectors (Triplett et al., 2016). Modi­ fication of host TFIIAγ5 through RNAi-mediated suppression or mutation confers disease resistance against Xoo and Xoc. xa5 is an allele of TFIIA which is a eukaryotic transcription factor containing larger subunit TFIIAαβ and smaller subunit TFIIAγ. TFIIAγ5 act as a cofactor which allows TALEs to boost host gene expression (Yuan et al., 2016). As known, TALE Tal7 of Xoc strain RS105 targets Os09g29100. Thus, using TALEN editing technique, Cai et al. (2017) modified binding site in the Os09g29100 gene promoter to decrease Tal7 binding which could lead to lessen disease severity. Most recently, Hui et al. (2019) reported that suppression of OsTFIIAαβ in rice hindered TALEs-targeted S genes activation and resulted in enhanced disease resistance to both Xoo and Xoc. 11.4 HORMONAL REGULATION IN BLS RESISTANCE In aspect of SA and JA hormonal regulation and relation for pathogenesis a study was done by Nagel et al. (2017) where they have reported the operon system for GA4 (gibberellic acid) biosynthesis in Xoc that promotes its pathogenicity in plant system. The overproduction of GA4 in Xoc reduces the synthesis of JA in the plant system resultant plant lose its protection efficiency against BLS disease. So far, the investigation should move on to find a solution in relation to interference of GA4 biosynthesis in bacteria not in plant through producing the potent molecule as inhibitor by plant system as defense mechanism to avoid pathogenicity. Lots of other work has been reported where role of JA and SA is very important for biotic stress tolerance so the overexpression or induced expression provide the immunity to the plant against Xoc infection (Feng et al., 2016; Guo et al., 2012; Shen et al., 2010).

Retrospective and Perspective Management

197

11.5 FUTURE PROSPECTIVE AND CONCLUSION Biotic stresses reduce the quality and yielding of rice grains. Broad evalua­ tion of conventional and molecular methodologies provides an effective tool in disease management. Among the various control methods, host, and nonhost plant resistance, developed through genetic engineering, provides the most reliable, cost-effective, and eco-friendly crops (Singh et al., 2020; Zhou et al., 2009). Moreover, non-host R genes help in combating plant diseases controlled by multiple genes and provide an important source of resistance (Zhou et al., 2009). Also, the genes involved in NHR are engineered to provide broad and durable resistance in crop plants. Future research need emphasis on understanding the molecular mechanisms involved during the interaction of how Xoc and rice. Moreover, researchers can also adapt CRISPR/Cas9, genome-editing technique and; RenSeq, a low-cost mapping strategy to focus on if any broad-spectrum disease resistance genes impart enhance disease resistance which can be eco-friendly (Li et al., 2020). ACKNOWLEDGMENT We thank Director NIT Rourkela and for providing all facilities and the research funding support from both SERB, Government of India (sanction number: YSS2014/000142), and Science and Technology, Government of Odisha (Sanction number: 27552800232014/202808), to BBS. AG thanks to Director, ILS Bhubaneswar for research facilities and DST New Delhi for financial assistance in the form of DST INSPIRE Fellowship. KEYWORDS • • • • • •

bacterial leaf streak disease (BLS) effector-triggered immunity polygalacturonase-inhibiting proteins (PGIP) resistance transcription-activator-like effector (TALE) Xanthomonas oryzicola (Xoc)

198

Bacterial Diseases of Rice and Their Management

REFERENCES Adhikari, T. B., Gurung, S., Hansen, J. M., Jackson, E. W., & Bonman, J. M., (2012). Association mapping of quantitative trait loci in spring wheat landraces conferring resistance to bacterial leaf streak and spot blotch. The Plant Genome, 5, 1–16. Anslow, P. A., & Stratford, M., (2000). Preservative and Flavoring System. Google Patents. Banerjee, A., Rai, M., Srivastava, S., & Singh, D., (1984). Suitable dose of streptocycline and agrimycin-100 for the control of bacterial leaf streak of paddy. Indian Phytopathology (India). Benedetti, M., Andreani, F., Leggio, C., Galantini, L., Di Matteo, A., Pavel, N. V., De Lorenzo, G., et al., (2013). A single amino-acid substitution allows endo-polygalacturonase of Fusarium verticillioides to acquire recognition by PGIP2 from Phaseolus vulgaris. PLoS One, 8, e80610. Boller, T., & He, S. Y., (2009). Innate immunity in plants: An arms race between pattern recognition receptors in plants and effectors in microbial pathogens. Science, 324, 742–744. Brutus, A., Sicilia, F., Macone, A., Cervone, F., & De Lorenzo, G., (2010). A domain swap approach reveals a role of the plant wall-associated kinase 1 (WAK1) as a receptor of oligogalacturonides. Proceedings of the National Academy of Sciences, 107, 9452–9457. Cai, L., Cao, Y., Xu, Z., Ma, W., Zakria, M., Zou, L., Cheng, Z., & Chen, G., (2017). A transcription activator-like effector Tal7 of Xanthomonas oryzae pv. Oryzicola activates rice gene Os09g29100 to suppress rice immunity. Scientific Reports, 7, 1–13. Cernadas, R. A., Doyle, E. L., Niño-Liu, D. O., Wilkins, K. E., Bancroft, T., Wang, L., Schmidt, C. L., et al., (2014). Code-assisted discovery of TAL effector targets in bacterial leaf streak of rice reveals contrast with bacterial blight and a novel susceptibility gene. PLoS Pathog., 10, e1003972. Chen, C. H., Zheng, W., Huang, X. M., Zhang, D. P., & Lin, X. H., (2006). Major QTL conferring resistance to rice bacterial leaf streak. Agricultural Sciences in China, 5, 216–220. Childs, N., (2012). Rice Outlook (Vol. 2685). USDA Economic Research Service. RCS-181. Available online: https://www.ers.usda.gov/webdacs/outlooks/80259/rcs-16j.pdf?v=5664.7 (accessed on 16 August 2022). Chung, Y. C., & Chen, C. Y., (2008). Antibacterial characteristics and activity of acid-soluble chitosan. Bioresource Technology, 99, 2806–2814. Datta, K., Velazhahan, R., Oliva, N., Ona, I., Mew, T., Khush, G., Muthukrishnan, S., & Datta, S., (1999). Over-expression of the cloned rice thaumatin-like protein (PR-5) gene in transgenic rice plants enhances environmental friendly resistance to Rhizoctonia solani causing sheath blight disease. Theoretical and Applied Genetics, 98, 1138–1145. Dodds, P. N., & Rathjen, J. P., (2010). Plant immunity: Towards an integrated view of plantpathogen interactions. Nature Reviews Genetics, 11, 539–548. Duveiller, E., (1994). Bacterial leaf streak or black chaff of cereals. EPPO Bulletin, 24, 135–157. Duveiller, E., Van, G. M., & Thijssen, M., (1992). Genetic analysis of resistance to bacterial leaf streak caused by Xanthomonas campestris pv. undulosa in bread wheat. Euphytica, 66, 35–43. Fang, C. T., Ken, H. C., Chen, T. Y., Chu, Y. K., Faan, H. C., & Wu, S. C., (1957). A comparison of the rice bacterial leaf blight organism with the bacterial leaf streak organisms of rice and Leersia hexandra Swartz. Acta Phytopathologica Sinica, 3.

Retrospective and Perspective Management

199

Feng, C., Zhang, X., Wu, T., Yuan, B., Ding, X., Yao, F., & Chu, Z., (2016). The polygalacturonase-inhibiting protein 4 (OsPGIP4), a potential component of the qBlsr5a locus, confers resistance to bacterial leaf streak in rice. Planta, 243, 1297–1308. Fu, J., Liu, H., Li, Y., Yu, H., Li, X., Xiao, J., & Wang, S., (2011). Manipulating broadspectrum disease resistance by suppressing pathogen-induced auxin accumulation in rice. Plant Physiology, 155, 589–602. Guan, J. C., Jinn, T. L., Yeh, C. H., Feng, S. P., Chen, Y. M., & Lin, C. Y., (2004). Characterization of the genomic structures and selective expression profiles of nine class I small heat shock protein genes clustered on two chromosomes in rice (Oryza sativa L.). Plant Molecular Biology, 56, 795–809. Guo, L., Guo, C., Li, M., Wang, W., Luo, C., Zhang, Y., & Chen, L., (2014). Suppression of expression of the putative receptor-like kinase gene NRRB enhances resistance to bacterial leaf streak in rice. Molecular Biology Reports, 41, 2177–2187. Guo, L., Li, M., Wang, W., Wang, L., Hao, G., Guo, C., & Chen, L., (2012). Over-expression in the nucleotide-binding site-leucine rich repeat gene DEPG1 increases susceptibility to bacterial leaf streak disease in transgenic rice plants. Molecular Biology Reports, 39, 3491–3504. Ham, D. J., Moon, J. C., Hwang, S. G., & Jang, C. S., (2013). Molecular characterization of two small heat shock protein genes in rice: Their expression patterns, localizations, networks, and heterogeneous overexpression. Molecular Biology Reports, 40, 6709–6720. Hashimoto, M., Kisseleva, L., Sawa, S., Furukawa, T., Komatsu, S., & Koshiba, T., (2004). A novel rice PR10 protein, RSOsPR10, specifically induced in roots by biotic and abiotic stresses, possibly via the jasmonic acid signaling pathway. Plant and Cell Physiology, 45, 550–559. He, W. A., Huang, D. H., LI, R. B., Qiu, Y. F., Song, J. D., Yang, H. N., Zheng, J. X., et al., (2012). Identification of a resistance gene bls1 to bacterial leaf streak in wild rice Oryza rufipogon Griff. Journal of Integrative Agriculture, 11, 962–969. Huang, N., Angeles, E., Domingo, J., Magpantay, G., Singh, S., Zhang, G., Kumaravadivel, N., et al., (1997). Pyramiding of bacterial blight resistance genes in rice: Marker-assisted selection using RFLP and PCR. Theoretical and Applied Genetics, 95, 313–320. Hui, S., Liu, H., Zhang, M., Chen, D., Li, Q., Tian, J., Xiao, J., et al., (2019). The host basal transcription factor IIA subunits coordinate for facilitating infection of TALEs-carrying bacterial pathogens in rice. Plant Science, 284, 48–56. Ji, G. H., Wei, L. F., He, Y. Q., Wu, Y. P., & Bai, X. H., (2008). Biological control of rice bacterial blight by Lysobacter antibioticus strain 13-1. Biological Control, 45, 288–296. Jones, J. D., & Dangl, J. L., (2006). The plant immune system. Nature, 444, 323–329. Ju, Y., Tian, H., Zhang, R., Zuo, L., Jin, G., Xu, Q., Ding, X., et al., (2017). Overexpression of OsHSP18. 0-CI enhances resistance to bacterial leaf streak in rice. Rice, 10, 12. Kandel, Y. R., Glover, K. D., Osborne, L. E., & Gonzalez-Hernandez, J. L., (2015). Mapping quantitative resistance loci for bacterial leaf streak disease in hard red spring wheat using an identity by descent mapping approach. Euphytica, 201, 53–65. Kang, M. J., Shim, J. K., Cho, M. S., Seol, Y. J., Hahn, J. H., Hwang, D. J., & Park, D. S., (2008). Specific detection of Xanthomonas oryzae pv. oryzicola in infected rice plant by use of PCR assay targeting a membrane fusion protein gene. Journal of Microbiology and Biotechnology, 18, 1492–1495. Khan, J. A., Arshad, M., Jamil, F. F., & Hasnain, S., (2009). Evaluation of rice genotypes against bacterial leaf blight (BLB) disease. Pak. J. Phytopathol, 21, 26–30. Kou, Y., & Wang, S., (2010). Broad-spectrum and durability: Understanding of quantitative disease resistance. Current Opinion in Plant Biology, 13, 181–185.

200

Bacterial Diseases of Rice and Their Management

Kumar, S., Meshram, S., & Sinha, A., (2017). Bacterial diseases in rice and their eco-friendly management. Agricultural Science and Research, 7, 31–42. Li, B., Liu, B., Shan, C., Ibrahim, M., Lou, Y., Wang, Y., Xie, G., et al., (2013). Antibacterial activity of two chitosan solutions and their effect on rice bacterial leaf blight and leaf streak. Pest Management Science, 69, 312–320. Li, P., Hu, D., Xie, D., Chen, J., Jin, L., & Song, B., (2018). Design, synthesis, and evaluation of new sulfone derivatives containing a 1, 3, 4-oxadiazole moiety as active antibacterial agents. Journal of Agricultural and Food Chemistry, 66, 3093–3100. Li, P., Shi, L., Yang, X., Yang, L., Chen, X. W., Wu, F., Shi, Q. C., et al., (2014). Design, synthesis, and antibacterial activity against rice bacterial leaf blight and leaf streak of 2, 5-substituted-1, 3, 4-oxadiazole/thiadiazole sulfone derivative. Bioorganic & Medicinal Chemistry Letters, 24, 1677–1680. Li, P., Yin, J., Xu, W., Wu, J., He, M., Hu, D., Yang, S., & Song, B., (2013). Synthesis, antibacterial activities, and 3 D-QSAR of sulfone derivatives containing 1, 3, 4-oxadiazole moiety. Chemical Biology & Drug Design, 82, 546–556. Li, W., Deng, Y., Ning, Y., He, Z., & Wang, G. L., (2020). Exploiting broad-spectrum disease resistance in crops: From molecular dissection to breeding. Annual Review of Plant Biology, 71, 575–603. Macho, A. P., & Zipfel, C., (2014). Plant PRRs and the activation of innate immune signaling. Molecular Cell, 54, 263–272. Malinovsky, F. G., Fangel, J. U., & Willats, W. G., (2014). The role of the cell wall in plant immunity. Frontiers in Plant Science, 5, 178. Manjunatha, G., Roopa, K., Prashanth, G. N., & Shekar, S. H., (2008). Chitosan enhances disease resistance in pearl millet against downy mildew caused by Sclerospora graminicola and defense-related enzyme activation. Pest Management Science: Formerly Pesticide Science, 64, 1250–1257. Matsubayashi, Y., & Sakagami, Y., (1996). Phytosulfokine, sulfated peptides that induce the proliferation of single mesophyll cells of Asparagus officinalis L. Proceedings of the National Academy of Sciences, 93, 7623–7627. Mizukami, T., (1969). Epidemiology and control of bacterial leaf blight of rice. Annu. Rev. Phytopathol., 7, 51–72. Nagel, R., Turrini, P. C., Nett, R. S., Leach, J. E., Verdier, V., Van, S. M. A., & Peters, R. J., (2017). An operon for production of bioactive gibberellin A4 phytohormone with wide distribution in the bacterial rice leaf streak pathogen Xanthomonas oryzae pv. oryzicola. New Phytologist, 214, 1260–1266. Nakashita, H., Yoshioka, K., Takayama, M., Kuga, R., Midoh, N., Usami, R., Horikoshi, K., et al., (2001). Characterization of PBZ1, a probenazole-inducible gene, in suspensioncultured rice cells. Bioscience, Biotechnology, and Biochemistry, 65, 205–208. Nino-Liu, D. O., Ronald, P. C., & Bogdanove, A. J., (2006). Xanthomonas oryzae pathovars: Model pathogens of a model crop. Molecular Plant Pathology, 7, 303–324. Ou, S., Franck, P., & Merca, S., (1970). Varietal resistance to bacterial leaf streak disease of rice in the Philippines. Philippine Agriculturist, 54, 8–45. Perez-Quintero, A. L., & Szurek, B., (2019). A decade decoded: Spies and hackers in the history of TAL effectors research. Annual Review of Phytopathology, 57, 459–481. Pradiprao, K. T., Sureshrao, K., Chavan, N., Aggrawal, T., & Verulkar, S., (2015). Pyramiding of three bacterial blight resistance in Dubraj rice cultivar using marker-assisted selection. The Ecoscan, 07–12.

Retrospective and Perspective Management

201

Prapagdee, B., Kotchadat, K., Kumsopa, A., & Visarathanonth, N., (2007). The role of chitosan in protection of soybean from sudden death syndrome caused by Fusarium solani f. sp. glycines. Bioresource Technology, 98, 1353–1358. Qiu, D., Xiao, J., Ding, X., Xiong, M., Cai, M., Cao, Y., Li, X., et al., (2007). OsWRKY13 mediates rice disease resistance by regulating defense-related genes in salicylate-and jasmonate-dependent signaling. Molecular Plant-Microbe Interactions, 20, 492–499. Richardson, M. J., (1979). An Annotated List of Seed-Borne Diseases. 23, 320 pp. ISBN 9780851984292. Richardson, M. J., (1981). Supplement 1 to: An Annotated List of Seed-Borne Diseases. The International Seed Testing Association, Zurich (Switzerland). Ryan, R. P., Vorhölter, F. J., Potnis, N., Jones, J. B., Van, S. M. A., Bogdanove, A. J., & Dow, J. M., (2011). Pathogenomics of Xanthomonas: Understanding bacterium–plant interactions. Nature Reviews Microbiology, 9, 344–355. Saha, S., Garg, R., Biswas, A., & Rai, A., (2015). Bacterial diseases of rice: An overview. J. Pure Appl. Microbiol., 9, 725–736. Sarkar, N. K., Kim, Y. K., & Grover, A., (2009). Rice sHsp genes: Genomic organization and expression profiling under stress and development. BMC Genomics, 10, 393. Sauter, M., (2015). Phytosulfokine peptide signaling. Journal of Experimental Botany, 66, 5161–5169. Shekhawat, G., & Srivastava, D., (1972). Epidemiology of bacterial leaf streak of rice. Japanese Journal of Phytopathology, 38, 7–14. Shen, X., Yuan, B., Liu, H., Li, X., Xu, C., & Wang, S., (2010). Opposite functions of a rice mitogen-activated protein kinase during the process of resistance against Xanthomonas oryzae. The Plant Journal, 64, 86–99. Sheng, Z., Zhen, L., & Jun, F., (2005). Detection of QTL conferring resistance to bacterial leaf streak in rice chromosome 2 (O. sativa L. spp. indica). Scientia Agricultura Sinica, 38, 1923–1925. Singh, P., Verma, R. L., Singh, R. S., Singh, R. P., Singh, H., Arsode, P., Kumar, M., & Singh, P. K., (2020). Biotic stress management in rice (Oryza sativa L.) through conventional and molecular approaches. In New Frontiers in Stress Management for Durable Agriculture (pp. 609–644). Springer. Srivastava, D., (1969). Bacterial blight and leaf streak diseases of rice. Ind. Phytopath. Soc. Bull., 5, 64–66. Swings, J., Van, D. M. M., Vauterin, L., Hoste, B., Gillis, M., Mew, T., & Kersters, K., (1990). Reclassification of the causal agents of bacterial blight (Xanthomonas campestris pv. oryzae) and bacterial leaf streak (Xanthomonas campestris pv. oryzicola) of rice as pathovars of Xanthomonas oryzae (ex Ishiyama 1922) sp. nov., nom. rev. International Journal of Systematic and Evolutionary Microbiology, 40, 309–311. Tang, D., Wu, W., Li, W., Lu, H., & Worland, A., (2000). Mapping of QTLs conferring resistance to bacterial leaf streak in rice. Theoretical and Applied Genetics, 101, 286–291. Tillman, B., Harrison, S., Russin, J., & Clark, C., (1996). Relationship between bacterial streak and black chaff symptoms in winter wheat. Crop Science, 36, 74–78. Triplett, L. R., Cohen, S. P., Heffelfinger, C., Schmidt, C. L., Huerta, A. I., Tekete, C., Verdier, V., et al., (2016). A resistance locus in the American heirloom rice variety Carolina gold select is triggered by TAL effectors with diverse predicted targets and is effective against African strains of Xanthomonas oryzae pv. oryzicola. The Plant Journal, 87, 472–483.

202

Bacterial Diseases of Rice and Their Management

Trotel-Aziz, P., Couderchet, M., Vernet, G., & Aziz, A., (2006). Chitosan stimulates defense reactions in grapevine leaves and inhibits the development of botrytis cinerea. European Journal of Plant Pathology, 114, 405–413. Velusamy, P., Immanuel, J. E., Gnanamanickam, S. S., & Thomashow, L., (2006). Biological control of rice bacterial blight by plant-associated bacteria producing 2, 4-diacetylphloro­ glucinol. Canadian Journal of Microbiology, 52, 56–65. Wang, S., Gan, X., Wang, Y., Li, S., Yi, C., Chen, J., He, F., et al., (2019). Novel 1, 3, 4-oxadiazole derivatives containing a cinnamic acid moiety as potential bactericide for rice bacterial diseases. International Journal of Molecular Sciences, 20, 1020. Wang, S., Xie, X., Zhang, Z., Guan, H., Damei, M., Wu, W., & Chen, Z., (2020). Fine mapping qBlsr3d, a QTL conferring resistance to bacterial leaf streak, using overlapping CSSLs in rice. Crop Science. White, F. F., & Yang, B., (2009). Host and pathogen factors controlling the rice-Xanthomonas oryzae interaction. Plant Physiology, 150, 1677–1686. Wu, T., Peng, C., Li, B., Wu, W., Kong, L., Li, F., Chu, Z., et al., (2019). OsPGIP1-mediated resistance to bacterial leaf streak in rice is beyond responsive to the polygalacturonase of Xanthomonas oryzae pv. oryzicola. Rice, 12, 90. Xie, X., Chen, Z., Cao, J., Guan, H., Lin, D., Li, C., Lan, T., et al., (2014). Toward the positional cloning of qBlsr5a, a QTL underlying resistance to bacterial leaf streak, using overlapping sub-CSSLs in rice. PLoS One, 9, e95751. XU, Z. Y., Zou, L. F., Cai, L. L., Yang, Y. Y., & Chen, G. Y., (2017). Action modes of transcription activator-like effectors (TALEs) of Xanthomonas in plants. Journal of Integrative Agriculture, 16, 2736–2745. Yang, W., Zhang, B., Qi, G., Shang, L., Liu, H., Ding, X., & Chu, Z., (2019). Identification of the phytosulfokine receptor 1 (OsPSKR1) confers resistance to bacterial leaf streak in rice. Planta, 250, 1603–1612. Yuan, M., Ke, Y., Huang, R., Ma, L., Yang, Z., Chu, Z., Xiao, J., et al., (2016). A host basal transcription factor is a key component for infection of rice by TALE-carrying bacteria. eLife, 5, e19605. Yuan, Y., Zhong, S., Li, Q., Zhu, Z., Lou, Y., Wang, L., Wang, J., et al., (2007). Functional analysis of rice NPR1-like genes reveals that OsNPR1/NH1 is the rice orthologue conferring disease resistance with enhanced herbivore susceptibility. Plant Biotechnology Journal, 5, 313–324. Zafar, M., Jamal, A., Tahira, R., Zakria, M., & Naeemullah, M., (2014). Incidence of seedborne mycoflora in wheat and rice germplasm. International Journal of Agriculture Innovations and Research, 2, 720–722. Zhang, M. Z., Mulholland, N., Beattie, D., Irwin, D., Gu, Y. C., Chen, Q., Yang, G. F., & Clough, J., (2013). Synthesis and antifungal activity of 3-(1, 3, 4-oxadiazol-5-yl)-indoles and 3-(1, 3, 4-oxadiazol-5-yl) methyl-indoles. European Journal of Medicinal Chemistry, 63, 22–32. Zhou, Y. L., Xu, J. L., Zhou, S. C., Yu, J., Xie, X. W., Xu, M. R., Sun, Y., et al., (2009). Pyramiding Xa23 and Rxo1 for resistance to two bacterial diseases into an elite indica rice variety using molecular approaches. Molecular Breeding, 23, 279–287.

CHAPTER 12

Sheath Brown Rot of Rice: A Review on Introduction, Epidemiology, and Its Integrated Management ERAYYA,1 MD. SHAMIM,2 SUBHASHISH SARKHEL,1 and M. KALMESH3 Department of Plant Pathology, Dr. Kalam Agricultural College, Kishanganj, (Bihar Agricultural University, Sabour, Bhagalpur), Bihar–855107, India, E-mail: [email protected] (Erayya) 1

Dr. Kalam Agricultural College, Kishanganj, (Bihar Agricultural University, Sabour, Bhagalpur), Bihar–855107, India

2

Department of Entomology, Dr. Kalam Agricultural College, Kishanganj, (Bihar Agricultural University, Sabour, Bhagalpur), Bihar–855107, India

3

ABSTRACT The yield potential of the rice crop is mainly affected by many pests and diseases. Brown sheath rot disease (caused by Pseudomonas fuscovaginae) is one among the many production constraints of rice. The disease occurs at low temperatures, especially during the booting/ heading stage. The yield loss due to the disease ranges from 20 to 85%. The symptoms of brown sheath rot are brown/ black lesions on grain, hollow, and light­ weight panicles. Infected panicles produce small and shriveled grains. The disease causes qualitative and quantitative losses. The pathogen is seed-transmitted and causes seedling blight in the nursery. For effective management of disease, better knowledge about the disease is essential. The review is mainly focusing on symptoms, etiology, disease cycle,

Bacterial Diseases of Rice and Their Management. Deepti Srivastava, Md. Shamim, Malik Mobeen Ahmad, & K. N. Singh (Eds.) © 2023 Apple Academic Press, Inc. Co-published with CRC Press (Taylor & Francis)

204

Bacterial Diseases of Rice and Their Management

epidemiology, and management aspects. The IPM strategy is much more relevant now to feed and respond to the wishes of an increasing popula­ tion even as crop production is required to be in a sustainable way for eco-friendly disease management and must reduce the dependence on hazardous agrochemicals. 12.1 INTRODUCTION Rice (Oryza sativa L.) is the major cereal crop and staple food for nearly onethird of the population of the world. Rice crops are affected by various biotic and abiotic stresses due to which provokes severe economic yield losses. Blast disease, brown sheath rot, sheath blight, brown spot, and bacterial leaf blight (BLB) are major rice diseases that cause yield losses by 15–20 per cent. Brown sheath rot was reported to cause significant yield losses (Prabhu et al., 2012; Ashfaq et al., 2013; Chandramani and Awadhiya, 2014). Grains discoloration is becoming a serious problem and its incidence is increasing every year (Savary et al., 2000). The rice yield is mainly inhibited due to pests and diseases. One of the major rice diseases which is attaining credit as a major production limitation is brown sheath rot caused by Pseudomonas fuscovaginae (Miyajima et al., 1983). This rice disease was first reported in Hokkaido, Japan (Tanii et al., 1976). Now, the disease has been prevalent all over the world. Higher elevation, squat temperature, and higher relative humidity favor disease spread and severity (Crop Protection Compendium, 2008). 12.2 ECONOMIC IMPORTANCE OF BACTERIAL BROWN SHEATH ROT Bacterial sheath brown rot attacks both the mature rice plant and the seedling, causing substantial yield losses (Webster and Gunnell, 1992). P. fuscovaginae is the major limiting factor in irrigated rice cultivation at high altitudes (> 1,500 m) which causes losses up to 100%, especially above 1,800 m (Rott, 1987). In Indonesia, up to 72.2% yield losses have been reported (Razak et al., 2009). Grain discoloration reduces on an average yield loss up to 1.1% and in susceptible varieties more than 30% yield losses in earlier study in Italy (Cortesi et al., 2008). Severity of sheath rot also depends on the prevailing weather conditions (Reddy and Gosh, 1985; Phookan and

Sheath Brown Rot of Rice: A Review on Introduction

205

Hazarika, 1992). Naeimi et al. (2003) also reported that the Sheath rot causes yield losses varies from 20 to 85%. The symptoms of rice discoloration are brown/ black lesions on grains, hollow panicle, black/ brown stripes on grains and unfilled grains in the panicle. Grain discoloration is associated with small and shriveled grains. It affects grains both in terms of quality and quantity (Sumangata et al., 2009; Tariq et al., 2012; Rajappan et al., 2001; Shanmugam et al., 2006). 12.3 CAUSAL/PATHOBIOME OF SHEATH ROT DISEASE Rice sheath rot pathogen was first isolated in Japan (Miyajima et al., 1983) and later identified in Latin America (Zeigler and Alvarez, 1987). P. fuscovaginae was the main cause for rice sheath brown rot. Infection occurs on both the sheath and glumes (Cother et al., 2009). Zeigler and Alvarez (1987) characterized P. fuscovaginae (brown sheath rot) in Latin America, by the following attributes: longitudinal brown/ reddish brown necrotic lesions of 2–5 mm wide and may extend to whole leaf blade and sheath, exaggerated sheaths including the panicle may show necrosis with poorly defined margins; glume discoloration before emergence from the infected panicle; infected grains may completely discolor and become sterile. Cottyn et al. (1994) reported that the pathogen features: vary from translucent to brown spot/blotches to a totally brown sheath, and plain brown spots to totally black discolored grains. As mentioned above, rice sheath rot is a devastative disease associated to the bacterial pathogen P. fuscovaginae, the fungal pathogen S. oryzae and the fungal complex pathogen of Fusarium spp. (Bigirimana et al., 2015) and further investigations are necessary for deciphering their possible interkingdom interactions, potential effect on the microbiome and whether sheath rot is a complex disease involving the interaction/cooperation of different pathogens. In human diseases, there is much awareness about pathogens do not cause infection alone and multispecies synergistic interactions is becoming an important aspect to study microbial diseases (Da Silva et al., 2014). In contrast to human diseases, in plant diseases, the concept of monospecies infections is deep-rooted. Initial examples reveal the interac­ tions between plant pathogens and also the interactions between pathogens and the beneficial microbes. Pathobiome studies are gaining importance and in the future, highlighting microbial inter and intra species interactions in pathogenesis.

206

Bacterial Diseases of Rice and Their Management

12.4 PSEUDOMONAS OTHER SPECIES ASSOCIATED WITH THE DISEASE In spite of P. fuscovaginae, a group of other fluorescent pseudomonas also linked with rice sheath rot disease. The first studied sheath rot causing Pseudomonas was P. oryzicola (Klement, 1967). Further, it was described that this pathogen is similar to P. syringae pv. syringae (Young et al., 1978). In addition to P. Fuscovaginae and P. syringae many other pseudomonads have also been found in rice sheath rot disease (Cother et al., 2010; Saberi et al., 2013). Zeigler and Alvarez (1987) grouped the rice sheath rot causing pseudomonads and named them based on BIOLOG results. Saberi et al. (2013) also determined that sheath rot and grain discoloration of rice is caused by Pseudomonas sp. based on biochemical studies in Iran which are related to P. marginalis, P. putida, and P. syringae. A small number of Pseudomonad species have been appeared for the rice production. Zeigler and Alvarez (1987) reported minor sheath rot and grain discoloration caused by pseudomonads, P. fuscovaginae is being the primary causal agent. Gardan et al. (2002) isolated P. palleroniana from La Réunion (France). Cameroon, and Madagascar isolated from necrotic seeds and from infected tissue of leaf/ sheaths. In contrast, symptoms of sheath brown rot were induced by P. fuscovaginae strain CFBP3078. Among the pseudomo­ nads associated with rice sheath rot, there are is difference in virulence and P. palleroniana is one among the less virulent species. Though, the pathoge­ nicity stage of diverse species of pseudomonads connected with rice sheath rot varies. A pseudomonad associated with many diseases similar to sheath brown rot in Cambodia (Cother et al., 2010). Gomila et al. (2015) studied other bacteria related to P. parafulva belonging to the P. putida group. The classification of pseudomonads has made keen advancement due to molecular characterization tools. Recent studies on Pseudomonas classifica­ tion based on the multilocus sequence analysis technique (MLSA) method and classified 19 groups and subgroups (Gomila et al., 2015). Most of the sheath rot causing pseudomonads belong to P. chlororaphis, P. fluorescens, P. fusovaginae subgroup or P. putida group. The principle of “everything is everywhere, but the environment selects” (De Wit and Bouvier, 2006) also relates to rice sheath rot disease; microbes that can potentially cause sheath rot in rice, but the environment chooses the ones that can able to adapt to the prevailing weather/climatic circumstances of particular region. It effects in overlapping of disease symptoms in rice

Sheath Brown Rot of Rice: A Review on Introduction

207

sheath rot complex (Hu et al., 2008) particularly at the reproductive stage (Fageria, 2007). Most sheath rot causing pathogens are endophytic lifecycle, they attack stressed plants (Fisher and Petrini, 1992). The factors that govern virulence expression was studied hovers the pattern of virulence is not clear till now (Andrews and Harris, 2000). There is a need of association of genetic, molecular, and pathogenicity data to elucidate the role of endophytes in plant pathogenesis (Andrews and Harris, 2000). Huge difference in rice sheath brown rot associated with Pseudomonas and Fusarium species is intriguing was studied and reported (Silby et al., 2011). 12.5 PATHOGEN TAXONOMY P. fuscovaginae belongs to the Kingdom: Bacteria, Phylum: Proteobacteria, Class: Gamma Proteobacteria, Order: Pseudomonadales, Family: Pseudo­ monadaceae, Genus: Pseudomonas, Species: Pseudomonas fuscovaginae (Miyajima et al., 1983). It is a gram-negative bacterium and comprises 144 species. Based on multilocus sequence studies, P. fuscovaginae grouped together with Pseudomonas asplenii subgroup by Gomila et al. (2015). Two species, P. fuscovaginae and Pseudomonas asplenii are closely related and many taxonomists consider them as synonymous (Vancanneyt et al., 1996). The description of P. fuscovaginae in Miyajima et al. (1983) is as: rod-shaped with round ends, aerobic, gram-negative, non-spore-forming. Cells occur singly or in pairs and the cells are motile by one to four polar flagella and growth at 37°C. The distinguishing character of this species from other fluorescent pseudomonads are negative for arginine dihydrolase and oxidase (Miyajima et al., 1983). Sequencing of whole genome and their analysis of different P. Fuscovaginae strains has indicated that a single monophyletic group was not observed (Quibod et al., 2015). 12.6 DISEASE HISTORY Rice sheath rot is currently dominant in all over the world (CABI, 2018), however firstly it was reported in Japan in the year 1976 (Tanii et al., 1976). There are major countries which face this pathogen in rice are; Burundi (Duveiller et al., 1988), Madagascar (Rott et al., 1989), Latin America Zeigler and Alvarez (1987); Australia (Cother et al., 2009) and in

208

Bacterial Diseases of Rice and Their Management

South Korea (Kim et al., 2012). Rice plants exhibit sheath rot symptoms at all growth stages; seedlings show symptoms of yellowish to brown discoloration on the lower leaf sheath at the early stage of infection then turn to dark-brown and ultimately rot and die (Cottyn et al., 1994). On mature rice plants necrosis occurs without distinct lesions/spots. The causal organism is Pseudomonas fuscovaginae (Tanii et al., 1976). However, several other microbes have been connected with rice sheath rot disease (Bigirimana et al., 2015). P. fuscovaginae virulence depends on many factors including phytotoxins (Ballio et al., 1996), quorum sensing (QS) and exopolysaccharides (EPS) (Hitendra et al., 2014). Wide host range in P. fuscovaginae has reported and also isolated from important cereal crops like maize, sorghum, and wheat (Duveiller, 1989). Many fungi have also been associated with the disease which includes Sarocladium oryzae (Giraldo et al., 2015) and Fusarium fujikuroi (Quazi et al., 2013; Aoki et al., 2014). The role of these different pathogens which are associated with sheath rot is still under study. 12.7 DISTRIBUTION A few decades ago, in Hokkaido, Japan, this disease was first time observed and reported. Now it is the most important disease of rice. The disease has been relatively new in Asian countries, it is widespread and has been reported in all continents of the world. It occurs frequently at higher elevation, high relative humidity, low temperature tropical and sub-tropical climatic condi­ tions. The disease has been described in tropical countries where rice produc­ tion is limited by low temperatures: Nepal, Madagascar, Japan, Burundi, and Colombia (Duveiller et al., 1988; Shakya, 1997). In Japan, during 1976, 160,000 hectares of rice crop was affected by sheath brown rot (Miyajima et al., 1983). Crop yield loss of up to 58% has been reported in Japan, 72.2% in Indonesia, and up to 100% in Madagascar. CABI (2007) reports the presence of P. fuscovaginae in 31 countries: Former Yugoslavia, Russian Federation, China, Indonesia, Japan, Nepal, Philippines, Burundi, Democratic Republic of Congo, Madagascar, Rwanda, Tanzania, Costa Rica, Cuba, Dominican Republic, El Salvador, Guatemala, Jamaica, Nicaragua, Panama, Trinidad, and Tobago, Mexico, Brazil, Chile, Peru, Argentina, Bolivia, Uruguay, and Suriname and recently reported in Australia (Cother et al., 2009). P. fuscovaginae host range seems restricted to cultivated and wild Gramineae (Tanii et al., 1976; Miyajima et al., 1983).

Sheath Brown Rot of Rice: A Review on Introduction

209

12.8 SYMPTOMATOLOGY The symptoms of P. fuscovaginae appeared on the flag-leaf sheath (booting to heading), on leaf sheaths, and on the panicle. On mature plants, lesions are surrounded by dark-brown margin. The leaf sheath display necrosis without distinct lesions as disease advances, the entire leaf sheath become necrotic, dry, and infected panicle rot. Water-soaked lesions, later turning light-brown on glumes. Grain may be discolored, deformed, or empty. Severely affected plants often fail to emerge from the boot, producing completely discolored and poor-quality grain (Zeigler and Alvarez, 1987). Detry et al. (1991) observed that P. fuscovaginae inoculation at the booting stage or four-leaf stage of rice inhibits the panicle emergence. However, no correlation was observed between the size of necrotic lesions on sheaths and panicle emergence. In Mexico, Suriname, Colombia, Peru, Guatemala, Brazil, and Panama symptoms of brown sheath rot observed on sheaths, leaves, and grains Zeigler and Alvarez (1990). A fluorescent pseudomonad, P. fuscovaginae, was frequently isolated from infected samples collected in Suriname and Colombia. Seedling infection causes seedling blight and often infected seedlings die (Razak et al., 2009). If mature plants are infected, the infected plants become chlorotic and the leaf sheath turn light to dark brown. Advanced stages of infection lead to necrosis of whole leaf sheath. In severely infected plants panicles fail to emerge and results in poorly or unfilled grains along with discolored seeds (Cottyn et al., 1994; Cother et al., 2009a). A cytopathological study revealed the colonization process of flag leaf sheath by P. fuscovaginae (Miyajima et al., 1983). During the early stage of colonization, bacterial cells were present in the epiderm in the flag leaf sheath at the adaxial side. Bacterial cells penetrate the host tissues through open stomata, and increase their populations in the sub-stomatal cavity. During symptom appearance, bacterial cells are distributed in the intercel­ lular spaces of sub-stomatal parenchyma, and lisygenous aerenchyma. However, very few studies have been conducted on infection, pathogenicity, interaction among host, pathogen, and environmental factors and its inte­ grated management strategies. 12.9 EPIDEMIOLOGY First appearance of sheath rot causing P. fuscovaginae observed in the cold and humid tropical highlands of Japan facade (Miyajima et al., 1983). Later other country of the world, i.e., Burundi (Duveiller et al., 1988), Madagascar

210

Bacterial Diseases of Rice and Their Management

(Rott et al., 1989), and Nepal (Sharma et al., 1997) also showed this pathogen incidence. This disease was also reported even in lowlands (Cottyn et al., 1994). The disease is favored by high rainfall (Sharma et al., 1997). It causes loss both in terms of quantity and quality (Zeigler and Alvarez, 1987). Infected/discolored grains cannot have demand in seed certification chains, and have very poor marketability value. The pathogen is mainly seed-transmitted. The pathogenicity is expressed at seed germination stage, seedling, booting, and grain filling stages. The bacterium can colonize the plant as an endophyte (Adorada et al., 2015). P. fuscovaginae can grow as epiphyte until the boot leaf stage when infection occurs on inflorescences, results in the abortion of panicle. The bacterium is able to survive as an epiphyte on the host with a low population in the tissue, but may express symptoms at the boot leaf or panicle emergence stage (Batoko et al., 1997a). The boot leaf stage and grain filling stage are the most sensitive stage in the disease development (Fageria, 2007). 12.10 PATHOGENICITY DETERMINANTS Diverse toxins are involved in the pathogenesis process. Batoko et al. (1997a) reproduced sheath brown rot symptoms on rice seedlings by inoculating with bacterial toxins and concluded that toxins play a key role in plantpathogen interactions. Flamand et al. (1996) worked on cell-free extract of P. fuscovaginae and concluded that cell free extracts can induce the disease symptoms as P. fuscovaginae have five peptidic compounds (A, B, C, D, and E) and two other compounds (fuscopeptins A and B). Peptide D is similar to syringotoxin, a lipodepsinonapeptide contains nine amino acids acylated by 3-hydroxytetradecanoic acid is also present in P. syringae pv. syringae which infects citrus (Ballio et al., 1990). Ballio et al. (1996) elucidated the structure of fuscopeptins. Fuscopeptin A is acylated by 3-hydroxyoctanoate and fuscopeptin B is acylated by 3-hydroxydecanoate. These compounds act on the plasma membrane and inhibits H+-ATPase (Batoko et al., 1997b). P. fuscovagina toxins are non-host specific, the toxins able induce disease symptoms on plants of the family Poaceae (Miyajima et al., 1983), and cause detrimental effect on elongation of culm (Batoko et al., 1997a). Non-host specific nature of toxins was also justified by the symptoms production by P. fuscovaginae on Chenopodium (Mattiuzzo et al., 2011). These toxins are dissolved immediately in the plant (Batoko et al., 1997a). The phytotoxin level increases at the boot stage and which stimulate further production of toxin by the pathogen. The ability of the plant to degrade the toxins plays a

Sheath Brown Rot of Rice: A Review on Introduction

211

vital role and it’s a key attribute in resistance breeding against P. fuscovaginae. Patel et al. (2014) isolated nine P. fuscovaginae mutants via random Tn5 mutagenesis which exhibited difference in virulence on rice plants. Mutants also affected phytotoxin production, type VI secretion, sulfur metabolism and arginine biosynthesis which involved in pathogenicity on rice. 12.11 DISEASE MANAGEMENT STRATEGIES Many cultural and mechanical practices are known to be effective against brown sheath rot disease. These practices include burning crop remains/ ratoons, seed treatment (ST) by dipping seeds in hot water at 65°C before sowing (Zeigler and Alvarez, 1987), crop rotation, use of quality/ healthy seeds. Resistance breeding is also be considered as none of the best option. But there are limited sources for resistance against sheath rot of rice (Adorada et al., 2013). In chemical control, streptocyclin, alone or in combination with copper compounds may effectively use to manage the disease (CABI, 2007). 12.11.1 CULTURAL PRACTICES Burning of crop residues immediately after crop harvest and off-season culti­ vation of a crop like lupins or potatoes that are non-host to the bacterium may use to manage the disease (Rott, 1987). There is a need for cultivars disease tolerance and early maturity. Adjustment of sowing time to avoid co-inci­ dence of low temperatures with susceptible stage of crop. Encouragement of farmers to use seedlings of 20–30 days old than old seedlings (Macapuguay and Mnzaya, 1988). Provision of proper drainage to drain out excess water in the field as the disease is more prevalent in irrigated fields (Rott, 1987). 12.11.2 BOTANICALS Piper sarmentosum has been used conventionally in various parts of SouthEast-Asia for management of brown sheath rot of rice. P. sarmentosum contains bioactive compounds which are having detrimental effect on various plant pathogens. P. sarmentosum contains flavonoids, phenolic compounds, propenylphenols, and steroids. Many evidence that supports the use of natural products which have lower toxicity against non-target organisms, highly biodegradable and more economical and efficient compared to

212

Bacterial Diseases of Rice and Their Management

synthetic chemicals. Several formulated botanicals which inhibit the growth of P. fuscovaginae and suppress the brown sheath rot in rice. Management strategies for bacterial pathogens in plants are scarce and mainly rely on toxic agro-chemicals, antibiotics, and copper compounds. Formulations containing plant extracts are potential and environmentally friendly alternative components in integrated pest management (IPM) strategies. 12.11.3 MANURES AND COCONUT WATER Coconut (Cocos nucifera L.) wastewater used as an antimicrobial compound as it contains antimicrobial metabolites that inhibit the growth of many bacteria (Chongsiriwatana et al., 2011; Thirumavalavan et al., 2009). Coconut water contains catechin, which acts as antimicrobial, antioxidant, and anticancer agents (Prado et al., 2015). It can also use as a raw material/substrate for the multiplication of beneficial microbes in order to generate antimicrobial compounds that slow down various plant pathogens (Nurul, 2016). Chemical compositions like essential amino acids, carbohydrates, and organic acids present in mature coconut water can be utilized as substrates in the fermenta­ tion of beneficial microbes (Yong et al., 2009; Neela and Prasad, 2013). The metabolites could be used in bio-control to brown sheath rot of rice (Clark et al., 1981). The beneficial microorganisms include the predominant popula­ tions of yeast, lactic acid bacteria, actinomycetes, and other inhabitants of coconut (Njoki et al., 2015). 12.11.4 BIOLOGICAL CONTROL Sakthivel and Gnanamanikam (1987) reported that P. fluorescens clearly demonstrated substantial reduction (up to 42%) in severity of sheath rot and increased grain yield (up to 160%). Balgude et al. (2019) also reported the bioagent was found to be more effective for the management of blast and sheath rot diseases thus increased the paddy yield to 25.57 q/ha with 26.58% increase. 12.11.5 CHEMICAL CONTROL Chemical control is one of the most common practices adapted by the farmers to manage the plant diseases. Many antibiotics such as streptomycin sulfate, streptomycin, and tetracycline alone or in combination with other copper

Sheath Brown Rot of Rice: A Review on Introduction

213

compounds or bleaching powder is commonly used to manage the bacterial diseases in crop plants. Two foliar sprays with Azoxystrobin 23SC (0.1%) one week before boot stage and at 50% flowering was found effective in manage­ ment of sheath rot/ grain discoloration (Sakthivel and Gnanamanikam, 1987). 12.12 CONCLUSION Rice sheath brown rot is emerging as an extremely caustic rice disease and shows inconsistency reduction in yield ranging from 20 to 85%. An immense degree of progress has not been achieved in the management of the disease, however, due to lack of knowledge about the etiology and host-pathogen interaction still yield losses in rice reported. Rice sheath rot management strategy by the site-specific IPM approach resulted in less damage in rise. Limiting the pathogens, creating the plant environment (micro and macro) fewer advantageous to disease development, etc., should be the key rudiments in the IPM approach. The IPM approach is more applicable in the present scenario to reduce the yield loss as well as to feed and respond to the needs of an increasing population while the crop production must rely on sustainable and eco-friendly and scientific crop protection practices to overcome the hazards of toxic pesticide. KEYWORDS • • • • • •

abiotic stresses brown sheath rot epidemiology Oryza sativa rice and management symptomatology

REFERENCES Adorada, D. L., Stodart, B. J., Pangga, I. B., & Ash, G. J., (2015). Implications of bacterial contaminated seed lots and endophytic colonization by Pseudomonas fuscovaginae on rice establishment. Plant Pathol., 64, 43–50. doi: 10.1111/ppa.12243.

214

Bacterial Diseases of Rice and Their Management

Aoki, T., O’Donnell, K., & Geiser, D. M., (2014). Systematics of key phytopathogenic Fusarium species: Current status and future challenges. J. Gen. Plant Pathol., 80, 189–201. doi: 10.1007/s10327-014-0509-3. Ashfaq, M., Ali, A., Siddique, S., Haider, M. S., Ali, M., & Hussain, S. B., (2013). In vitro antibacterial activity of Parthenium hysterophorus against isolated bacterial species from discolored rice grains. J. Agric. Biol., 15(6), 1119–1125. Balgude, Y. S., Kshirsagar, C. R., & Gaikwad, A. P., (2019). Evaluation on the efficacy of modern fungicides against blast and sheath rot of rice. Int. J. Curr. Microbiol. App. Sci., 8(3), 83–88. Ballio, A., Bossa, F., Camoni, L., Di Giorgio, D., Flamand, M. C., Maraite, H., et al., (1996). Structure of fuscopeptins, phytotoxic metabolites of Pseudomonas fuscovaginae. FEBS Lett., 381, 213–216. doi: 10.1016/0014-5793(96)00043-9. Ballio, A., Bossa, F., Collina, A., Gallo, M., Iacobellis, N. S., Paci, M., et al., (1990). Structure of syringotoxin, a bioactive metabolite of Pseudomonas syringae pv. syringae. FEBS Lett., 269, 377–380. doi: 10.1016/0014-5793(90)81197-V. Batoko, H., Bouharmont, J., & Maraite, H., (1997b). Biological effects of toxins produced by Pseudomonas fuscovaginae on rice and in vitro selection for resistance. In: Poisson, C., & Rakotoarisoa, J., (eds.), Conference Rice for Highlands (pp. 113–118). Center Cooperation Int Rech. Agronomique Developement, 75116 Paris. Batoko, H., Bouharmont, J., Kinet, J. M., & Maraite, H., (1997a). Involvement of toxins produced by Pseudomonas fuscovaginae in aetiology of rice bacterial sheath brown rot. J. Phytopathol., 145, 525–531. Bigirimana De, V. P., Hua, G. K. H., Nyamangyoku, O. I., & Hòfte, M., (2015). Rice sheath rot: An emerging ubiquitous destructive disease complex. Frontiers in Plant Science, 6, 1066. https://doi.org/10.3389/fpls.2015.01066. CABI, (2007). Crop Protection Compendium. Wallingford: CAB International. CABI, (2018). Crop Protection Compendium. Wallingford: CAB International. Retrieved from https://www.cabi.org/isc/datasheet/44957 (accessed on 16 August 2022). Chandramani, B., & Awadhiya, G. K., (2014). Assessment of percent grain discoloration in important rice varieties. Int. J. Curr. Res. Biosci. Plant Biol., 1(4), 61–64. Chongsiriwatana, N. P., Wetzler, M., & Barron, A. E., (2011). Functional synergy between antimicrobial peptoids and peptides against gram-negative bacteria. Antimicrobial Agents Chemotherapy, 55(11), 5399–5402. Clark, A. M., El Feraly, A. S., & Li, W. S., (1981). Antimicrobial activity of phenolic constituents of Magnolia grandiflora L. J. Pharm. Sci., 70(8), 951–952. Cortesi, P., Bartoli, F., Pizzatti, C., Bertocchi, D., & Schaad, N. W., (2008). Panicle sterility and grain discoloration: New and emerging bacterial diseases of rice in Italy. In: Fatmi, M. B., Collmer, A., Iacobellis, N. S., Mansfield, J. W., Murillo, J., Schaad, N. W., & Ullrich, M., (eds.), Pseudomonas syringae Pathovars and Related Pathogens-Identification, Epidemiology, and Genomics (pp. 391–411). Springer, Netherlands, ISBN-13: 978-1-4020-6900-0. Cother, E. J., Noblea, D. H., Van De, V. R. J., Lanoiselet, V., Ashd, G., Vuthyc, N., & Stodartd, B., (2010). Bacterial pathogens of rice in the Kingdom of Cambodia and description of a new pathogen causing a serious sheath rot disease. Plant Pathol., 59, 944–953. Cother, E. J., Stodart, B., & Ash, G., (2009a). Improving Understanding and Management of rice Pathogens in Cambodia (pp. 1–46). Project Final Report. Australian Center for International Agricultural Research, ACIAR, Canberra ACT 2601 Australia.

Sheath Brown Rot of Rice: A Review on Introduction

215

Cother, E. J., Stodart, B., Noble, D. H., Reinke, R., & Van De, V. R. J., (2009). Polyphasic identification of Pseudomonas fuscovaginae causing sheath and glume lesions on rice in Australia. Aust. Plant Pathol., 38, 247–261. Cottyn, B., Cerez, M. T., & Mew, T. W., (1994). Bacteria. In: Mew, T. W., & Misra, J. K., (eds.), A Manual of Rice Seed Health Testing (pp. 29–46). International Rice Research Institute, Philippines. Crop Protection Compendium, (2008). Report—Pseudomonas Fuscovaginae. http://www. cabicompendium.org/cpc/report.asp?Criteria=T/NAM;T/TX1;TX2;t?H (accessed on 16 August 2022). Da Silva, D. P., Castañeda-Ojeda, M. P., Moretti, C., Buonaurio, R., Ramos, C., & Venturi, V., (2014). Bacterial multispecies studies and microbiome analysis of a plant disease. Microbiology (United Kingdom) 160(3), 556–566. https://doi.org/10.1099/mic.0.074468- 0. De Wit, R., & Bouvier, T., (2006). Everything is everywhere, but, the environment selects; what did baas becking and beijerinck really say? Environ. Microbiol., 8, 755–758. doi: 10.1111/j.1462-2920.2006.01017.x. Detry, J. F., Chapeaux, J. P., & Tilquin, J. P., (1991). Estimation of rice bacterial sheath brown rot (BSR) and rice blast (Bl) severity in five Burundi highland swamps. Int. Rice Res. Newsl., 16, 20, 21. Duveiller, E., (1989). First detection of Pseudomonas fuscovaginae on maize and sorghum in Burundi. Plant Disease, 73(6), 514–517. https://doi.org/10.1094/pd-73-0514. Duveiller, E., Miyajima, K., Snacken, F., Autrique, A., & Iviaraite, H., (1988). Characterization of Pseudomonas fuscovaginae and differentiation from other fluorescent pseudomonads on rice in Burundi. Journal of Phytopathology, 122, 97–107. Duveiller, E., Miyajima, K., Snacken, F., Autrique, A., & Maraite, H., (1988). Characterization of Pseudomonas fuscovaginae and differentiation from other fluorescent pseudomonads occurring on rice in Burundi. J. Phytopathol., 122, 97–107. doi: 10.1111/j.1439-0434.1988. tb00995.x. Duveiller, E., Ntibishimirwa, M., Ivaraite, H., & Perreaux, D., (1987). Brown rot of rice leaf sheath (Pseudomonas fuscovaginae) enriched-highland crop. In: Seminal on Diseases and Pests of Food Crops in Central Africa (pp. 145–154). Bujumbura (Wageningen; The Netherlands: Technical Center for Agricultural and Rural Cooperation, CTA). Duveilleri, E., Notteghem, J. L., Rott, P., Snackent, F., & Maraite, H., (1990). Bacterial sheath brown rot of rice caused by Pseudomonas fuscovaginae in Malagasy. Tropical Pest Management, 36(2), 151–153. Fageria, N. K., (2007). Yield physiology of rice. J. Plant Nutr., 30, 843–879. doi: 10.1080/ 15226510701374831. Fisher, P. J., & Petrini, O., (1992). Fungal saprobes and pathogens as endophytes of rice (Oryza sativa L.). New Phytol., 120, 137–143. doi: 10.1111/j.1469- 8137.1992.tb01066.x. Flamand, M. C., Pelsser, S., Ewbank, E., & Maraite, H., (1996). Production of syringotoxin and other bioactive peptides by Pseudomonas fuscovaginae. Physiol. Mol. Plant Pathol., 48, 217–231. doi: 10.1006/pmpp.1996.0019. Gardan, L., Bella, P., Meyer, J. M., Christen, R., Rott, P., Achouak, W., et al., (2002). Pseudomonas salomonii sp. nov., pathogenic on garlic, and Pseudomonas palleroniana sp. nov., isolated from rice. Int. J. Syst. Evol. Microbiol., 52, 2065–2074. doi: 10.1099/ijs.0.02225-0. Giraldo, A., Gené, J., Sutton, D. A., Madrid, H., De Hoog, G. S., Cano, J., et al., (2015). Phylogeny of Sarocladium (Hypocreales). Persoonia, 34, 10–24. doi: 10.3767/003158515X685364.

216

Bacterial Diseases of Rice and Their Management

Gomila, M., Peña, A., Mulet, M., & Lalucat, J., (2015). Phylogenomics and systematics in Pseudomonas. Front. Microbiol., 6, 214. doi: 10.3389/fmicb.2015.00214. Hitendra, K. P., Matiuzzo, M., Bertani, I., De Paul, B. V., Ash, G. J., Höfte, M., & Venturi, V., (2014). Identification of virulence associated loci in the emerging broad host range plant pathogen Pseudomonas fuscovaginae. BMC Microbiology, 14(1), 1–13. https://doi. org/10.1186/s12866-014-0274-7. Hu, C. J., Li, Y. R., Wei, Y. W., & Huang, S. L. (2008). A PCR-based method to detect Sclerotium hydrophilum in infected rice leaf sheaths. Australas. Plant Pathol. 37, 40–40. doi: 10.1071/AP07076. Kim, O. S., Cho, Y. J., Lee, K., Yoon, S. H., Kim, M., Na, H., Park, S. C., et al., (2012). Introducing EzTaxon-e:a prokaryotic 16S rRNA Gene sequence database with phylotypes that present uncultures species. Int. J. Syst. Evol. Microbiol., 62, 716– 721. Klement, Z., & Goodman, R. N., (1967). The hypersensitive reaction to infection by bacterial plant pathogens. Ann. Rev. Phytopathol., 5, 17–44. Macapuguay, F., & Mnzaya, M., (1988). Progress on irrigated rice agronomy at Usangu village—M’beya zone—Tanzania. Int. Rice Comm. Newsl., 37, 40–44. Mattiuzzo, M., Bertani, I., Ferluga, S., Cabrio, L., Bigirimana, J., Guarnaccia, C., & Venturi, V., (2011). The plant pathogen Pseudomonas fuscovaginae contains two conserved quorum sensing systems involved in virulence and negatively regulated by RsaL and the novel regulator RsaM. Environmental Microbiology, 13(1), 145–162. https://doi.org/10.1111/j. 1462-2920.2010.02316.x. Miyajima, K., Tanii, A., & Akita, T., (1983). Pseudomonas fuscovaginae sp. nov., nom. rev. Int. J. Syst. Bacteriol., 33, 656, 657. Mlyajllvla, K., (1983). Studies on Bacterial Sheath Brown Rot of Rice Plant Caused by Pseudomonas Fuscovaginae TANII, Lliyajimar, and Akita (Vol. 43, p. 74). Report of Hokkaido Prefectural Agricultural Experiment Station. Naeimi, S., Okhovvat, S. M., Hedjaroude, G. A., & Khosravi, V., (2003). Sheath rot of rice in Iran. Communications in Agricultural and Applied Biological Sciences, 68(4), 681–684. Neela, S., & Prasad, N. B. L., (2013). Production of fermented coconut water beverages. Asian Journal of Food and Agro-Industry, 6(5), 281–289. Njoki, W. J., Boga, H. I., Kutima, P. M., Maina, J. M., & Kadere, T. T., (2015). Probiotic potential of lactic acid bacteria isolated from coconut (Cocos Nucifera) wine (mnazi) in Kenya. International Journal of Life Sciences Research, 3(1), 113–120. Nurul, A. M. N., (2016). Potential of Beneficial Microorganisms from Fermented Coconut Water and Molasses as Biocontrol Agent Against Xanthomonas oryzae pv. oryzae In Vitro. Thesis, Faculty of Plantation and Agrotechnology, UiTM Melaka, Malaysia. Patel, H., Matiuzzo, M., Bertani, I., Bigirimana, V., Ash, G. J., Höfte, M., et al., (2014). Identification of virulence associated loci in the emerging broad host range plant pathogen Pseudomonas fuscovaginae. BMC Microbiol., 14, 274. doi: 10.1186/s12866-014-0274-7. Phookan, A. K., & Hazarika, D. K., (1992). Distribution of sheathrot (ShR) in sixagroclimatic zones of Assam, India. IRRN, 17, 16. Prabhu, A. S., Morel, P., Barbosa, F., Lawrence, E., Datnoff, S., Berni, G. H., Fabricio, R. F., et al., (2012). Silicon reduces brown spot severity and grain discoloration on several rice genotypes. Trop. Plant. Path., 37(6), 409–414. Quazi, S. A. J., Meon, S., Jaafar, H., & Ahmad, Z. A. B. M., (2013). Characterization of Fusarium proliferatum through species specific primers and its virulence on rice seeds. Int. J. Agric. Biol., 15, 649–656.

Sheath Brown Rot of Rice: A Review on Introduction

217

Quibod, I. L., Grande, G., Oreiro, E. G., Borja, F. N., Dossa, G. S., Mauleon, R., et al., (2015). Rice-infecting Pseudomonas genomes are highly accessorized and harbor multiple putative virulence mechanisms to cause sheath brown rot. PLoS One, 10, e0139256. doi: 10.1371/ journal.pone.0139256. Rajapan, K., Ushamalini, C., Subramanian, N., Narasimhan, V., & Karim, A. A., (2001). Management of grain discoloration of rice with solvent- free EC formulation of neem and pungam oils. Phytoparasitica, 29(2), 171–174. Razak, A., Zainudin, N., Sidiqe, S., Ismail, N., Mohamad, N., & Salleh, B., (2009). Sheath brown rot disease of rice caused by Pseudomonas fuscovaginae in the Peninsular Malaysia. J. Plant Protect. Res., 49, 244–249. Reddy, C. S., & Ghosh, A., (1985). Sheath rot incidence and yield losses in rice due to the joint infection of rice tungrovirus and sheath rot fungus. Indian Phytopath, 38(1), 165. Rott, P. (1987). Brown rot (Pseudomonas fuscovaginae) of the leaf sheath of rice in Madagascar, CABI Abstracts, Institute de recherches Agronomiques Tropicales et des Cultures Vivrieres. http://www.cababstractsplus.org/abstracts/Abstract.aspx?AcNo=19881157248 (accessed on 16 August 2022). Rott, P., Notteghem, J. L., & Forossand, P., (1989). Identification and characterization of Pseudomonas fuscovaginae, the causal agent of bacterial sheath brown rot of rice, from Madagascar and other countries. Plant Disease, 73, 133–137. Saberi, E., Safaie, N., & Rahimian, H., (2013). Characterization of bacterial strains associated with sheath rot complex and grain discoloration of rice in North of Iran (Mazandaran province). J. Bacteriol. Res., 5, 51–61. doi: 10.5897/JBR2013.0115. Sakthivel, N., & Gnanamanickam, S. S., (1987). Evaluation of Pseudomonas fluorescens for suppression of sheath rot disease and for enhancement of grain yields in rice (Oryza sativa L.). Appl. Environ. Microbiol., 53, 2056–2059. Savary, S., Willocquet, L., Elazegui, F. A., Castilla, N. P., & Teng, P. S., (2000). Rice pest constraints in tropical Asia: Quantification of yield losses due to rice pests in a range of production situations. Plant Dis., 84, 357–369. doi: 10.1094/PDIS.2000.84.3.357. Shakya, D. D., (1997). Rice diseases at high altitude. In: Poisson, C., & Rakotoarisoa, J., (eds.), Rice Cultivation in Highland Areas (pp. 105, 106). Proc. of the CIRAD conference, Antananarivo, Madagascar. Shanmugam, T. R., Sendhil, R., & Thirmalvalavan, V., (2006). Quantification and prioriti­ zation of constraints causing yield loss in rice (Oryza sativa) in India. Agricu. Tropi. et. Subtropi., 39(3), 194–204. Sharma, S., Sthapit, B., Pradhanang, P., & Joshi, K., (1997). Bacterial sheath brown rot of rice caused by Pseudomonas fuscovaginae in Nepal. In: Poisson, C., & Rakotoarisoa, J., (eds.), Rice Cultivation in Highland Areas (pp. 107–112), Proceedings of the CIRAD Conference, Antananarivo, Madagascar. Silby, M. W., Winstanley, C., Godfrey, S. A. C., Levy, S. B., & Jackson, R. W., (2011). Pseudomonas genomes: Diverse and adaptable. FEMS Microbiol. Rev., 35, 652–680. doi: 10.1111/j.1574-6976.2011.00269.x. Sumangata, K., Patil, M. B., Nargund, V. B., & Ramegowda, G., (2009). Effect of grain discoloration of quality parameters of rice. J. Plant. Dis. Sci., 4(1), 33–37. Tanii, A., Miyajima, K., & Akita, T., (1976). The sheath brown rot disease of rice plant and its causal bacterium, Pseudomonas fuscovaginae. Ann. Phytopathol. Soc. Jpn., 42, 540–548. Tariq, J. S., Ismail, M., Ahmed, N., Bughio, H. U. R., Arain, M. A., & Yasin, S. I., (2012). Evaluation of rice germplasm against brown spot caused by Helminthosporium oryzae in Sindh. Int. J. Agric. Appl. Sci., 4(2), 130–134.

218

Bacterial Diseases of Rice and Their Management

Thirumavalavan, K., Manikkadan, T. R., & Dhanasekar, R., (2009). Pollutant production from coconut by-products by Aureobasidium pullulans. African Journal of Biotechnology, 8(2), 254–258. Tilquin, J. P., & Detry, J. F., (1993). Efficiency of natural selection for bacterial sheath rot (BSR) in bulked families. Int. Rice Res. Notes, 18, 23, 24. Vancanneyt, M., Torck, U., Dewettinck, D., Vaerewijck, M., & Kersters, K., (1996). Grouping of pseudomonads by SDS-PAGE of whole-cell proteins. Syst. Appl. Microbiol., 19, 556–568. doi: 10.1016/S0723-2020(96)80027-0. Webster, R. K., & Gunnell, P. S., (1992). Compendium of rice diseases. Mycologia. https:// doi.org/10.2307/3760308. Woese, C., (1987). Bacterial evolution. Microbiol. Rev., 51, 221–271. Yong, J. W. H., Ge, L., Ng, Y. F., & Tan, S. N., (2009). The chemical composition and biological properties of coconut (Cocos nucifera L.) water. Molecules, 14(12), 5144–5164. Young, J. M., Dye, D. W., Bradbury, J. F., Panagopoulos, C. G., & Robbs, C. F., (1978). A proposed nomenclature and classification for plant pathogenic bacteria. N. Z. J. Agric. Res., 21, 153–177. doi: 10.1080/00288233.1978.104 27397. Zeigler, R. S., & Alvarez, E., (1987). Bacterial sheath brown rot of rice caused by Pseudomonas fuscovaginae in Latin America. Plant Disease, 71, 592–597. Zeigler, R. S., & Alvarez, E., (1990). Characteristics of Pseudomonas spp. causing grain discoloration and sheath rot of rice, and associated Pseudomonas epiphytes. Plant Dis., 74, 917–922. doi: 10.1094/PD-74-0917.

CHAPTER 13

The Emerging Role of New Molecular Technologies for the Development of Broad-Spectrum Resistance to Sheath Brown Rot Disease in Rice PRASHANT YADAV,1 SUSHMA YADAV,1 ANURAG MISHRA,2 and DEEPTI SRIVASTAVA3 ICAR–Directorate of Rapeseed-Mustard Research, Bharatpur, Rajasthan–321303, India, E-mail: [email protected] (P. Yadav) 1

2

ICAR–Indian Agricultural Research Institute, New Delhi–1100123, India

3

Integral University, Lucknow, Uttar Pradesh, India

ABSTRACT Sheath brown rot disease of rice (Oryza sativa L., 2n = 24) is becoming an important constrain and threatening the rice production around the world. It is recognized by discoloration and rotting of flag leaf sheath. Similar symptoms can be caused by many pathogens but two pathogens are predominant viz a bacteria called Pseudomonas fuscovaginae and a fungus called Sarocladium oryzae. Pseudomonas fuscovaginae virulence is dependent on the toxins (syringotoxin, fuscopeptin-A, and fuscopeptin-B) produced by it. The bacteria manipulate the host’s immune system by high jacking SA-JA hormone signaling pathway. More study is required to understand the molecular mechanism of host-pathogen interaction O. sativa-P. fuscovaginae system. There is no known source of resistance in rice for this pathogen. Although, new high throughput screening protocol with more sensitivity will pave the way to the robust screening of a vast number of rice accessions. This coupled Bacterial Diseases of Rice and Their Management. Deepti Srivastava, Md. Shamim,

Malik Mobeen Ahmad, & K. N. Singh (Eds.)

© 2023 Apple Academic Press, Inc. Co-published with CRC Press (Taylor & Francis)

220

Bacterial Diseases of Rice and Their Management

with genome editing and NGS techniques will provide the solutions to ensure the food security by protecting the rice crop from this rising disease around the world. 13.1 INTRODUCTION Rice (Oryza sativa) is one of the most important staple food crops essential for food security of the world. It is consumed around the world, from rural villages to mega-cities. Rice is the staple food of around half the population of the earth. The projection of population growth by various agencies revealed that by the mid-century (2050), the global population will increase from 7.5 billion to more than 10 billion people. Considering the current challenges of food security, hunger, and malnutrition, it will be a gigantic task to feed those many people. The high productivity and wide adaptability of rice makes it as one of the candidate future proof crops that will continue to satisfy the hunger of the mankind. To aim this, it is very important to develop high yielding varieties to produce more grains and reduce the losses due to various biotic and abiotic stresses by developing resistant/tolerant rice varieties. Apart from various biotic and abiotic stresses, each year, many bacterial and fungal diseases adversely affect rice production, including bacterial blight (BB) (Xanthomonas oryzae), sheath blight (Rhizoctonia solani), brown spot (Cochilobolus miyabeans), false smut (Ustilaginoidea virens) and sheath rot. Sheath brown rot disease of rice is used to be minor disease but now with increasing affected area around the world and severe losses it became one of the most dangerous diseases of this crop. Sheath brown rot is a complex disease caused by different pathogens, including bacteria (Pseudomonas fuscovaginae) as well as fungi (Sarocladium oryzae) (Bigirimana et al., 2015). Pseudomonas fuscovaginae is the most important bacteria causing sheath brown rot and mainly associated with this disease. This disease is found in all rice growing areas and severely infecting rice crop in more than 40 countries worldwide (CABI, 2021). It can cause up to 85% yield loss and becoming a major challenge in rice production. Sheath brown rot disease of rice was first characterized a century ago in Taiwan. A fungus (Sarocladium oryzae) was identified as the causal organism. Later, Pseudomonas fuscovaginae was found to be associate with the disease in Japan (Tanii et al., 1976). Musonerimana et al. (2020) proved by analyzing pathobiome of sheath brown rot infected rice plants from two different locations that this disease is caused by these two pathogens independently to each other. P. fuscovaginae can cause greater crop loses under favorable

The Emerging Role of New Molecular Technologies

221

climatic conditions (RH). Several other pathogens were observed causing similar symptoms (Table 13.1). All pathogens causing sheath rot diseases in rice are seed-born and necrotrophs in nature. However, Kraepiel and Marie (2016) argued that the bacteria should not be classified as biotrophs or necrotrophs. Bacteria in general are hemibiotroph in nature, but different bacteria have different length of initial biotrophic and later necrotrophic phases. The sheath brown rot disease causes discoloration and rotting of the sheath of flag leaf which resulted in chaffiness and seed sterility. The reddishbrown, water-soaked necrotic spot of 2–5 mm with poorly defined margins on sheath and blade area of the leaf is the characteristic of this bacterial rot. Panicle emerged from infected sheath area poses discolored malformed empty to normal grain with small brown spot (Razak et al., 2009). This resulted in quantitative and qualitative losses (Figure 13.1; Zeigler and Elizabeth, 1987). TABLE 13.1

Major Pathogens Causing Sheath Rot in Rice

Pathogen

Classification

Geographic Distribution References

Pseudomonas fuscovaginae

Gamma proteobacteria

>40 countries

Miyajima et al. (1982)

Pseudomonas syringae

Gamma proteobacteria

Hungary, Australia

Zeigler et al. (1990)

Pantoea ananatis

Gamma proteobacteria

Australia, Philippines, South Korea

Cottyn et al. (2001)

Burkholderia glumae

Beta proteobacteria

USA

Sayler et al. (2006)

Burkholderia gladioli

Beta proteobacteria

USA

Nandakumar et al. (2009)

Philippines

Cottyn et al. (1996)

Bacteria

Acidovorax oryzae Beta proteobacteria

Fungus Sarocladium oryzae

Ascomycota

>32 countries

Purukayastha et al. (1985)

Gibberella fujikuroi

Ascomycota

Ubiquitous

Desjardins et al. (1997)

Ascomycota Fusarium incarnatum-equiseti

Nepal, Italy

Fisher and Petrini (1992)

Cochliobolus lunatus

Ascomycota

India, Bangladesh, China

Lakshmanan (1992)

Sclerotium oryzae

Basidiomycota

USA, Japan

Oster (1992)

Source: Adapted from: Bigirimana et al. (2015).

Bacterial Diseases of Rice and Their Management

222

FIGURE 13.1

Global distribution of Pseudomonas fuscovaginae (CABI, 2021).

Classification of Pseudomonad fuscovaginae:       

Domain: Bacteria Phylum: Proteobacteria Class: Gammaproteobacteria Order: Pseudomonadales Family: Pseudomonadaceae Genus: Pseudomonas Species: Pseudomonas fuscovaginae

Pseudomonas fuscovaginae is a Gram-negative, non-spore-forming, rodshaped bacteria with polar flagella and classified as fluorescent pseudomonad. P. fuscovaginae is a broad host range pathogen and causes sheath brown rot disease in many cereal crops, including rice (Tanii et al., 1976), sorghum (Duveiller et al., 1989), wheat (Duveiller and Maraite, 1990) and maize (Arsenijević, 1991). It produces various phytotoxins and use it for disease establishment. It has one of the largest genomes among various pathogens of its genus. 13.2 REVIEW OF LITERATURE 13.2.1 IDENTIFICATION Accurate, rapid, and robust identification of the pathogen is the first step towards crop protection. Moreover, identification of the pathogen becomes

The Emerging Role of New Molecular Technologies

223

more important when different pathogens cause similar disease symptoms. In this direction, Rott et al. (1991) developed a combination of three identification techniques viz biochemical, serological, and pathogenicity tests to identify 136 isolates of P. fuscovaginae isolated from the rice fields of 5 different countries. However, any single technique failed to identify all the strains of the bacteria. Kim and Song (1996a) developed a PCR-based molecular technique for the rapid identification of P. fuscovaginae. They exploited the polymorphism available in the 16S and 23S ribosomal-DNA intergenic spacer region to identify the bacteria. Two primers R16-1 and R23-2R were used and 770 bp band was found specific to the P. fuscovaginae (Kim and Song, 1996b). Although, the technique was quick but could not differentiate between various strains of the bacteria. A loopmediated isothermal amplification (LAMP) protocol was developed for rapid and robust identification of P. fuscovaginae (Ash et al., 2014). A primer combination Pf8 was developed by analyzing the genomics information of P. fuscovaginae. The LAMP-based protocol was found less sensitive to inhibitors and impurities for PCR assay. This technique was suitable to lab and glasshouse identification but further standardization is required to use it robustly in the field. 13.2.2 GENOMICS Decent genomic resources for P. fuscovaginae are available especially with the availability of the genome sequence. Prior to genome sequencing of P. fuscovaginae, Mattiuzzo et al. (2011) discovered two conserved N-acyl homoserine lactone quorum sensing (ALH-QS) systems by studying knock-out mutants of P. fuscovaginae. Quorum sensing (QS) system is an intercellular communication system required for coordinated community actions to control ecologically and medically important traits, including virulence to hosts (Lerat and Nancy, 2004). Two strains of this pathogen vizP. Fuscovaginae UPB0736 (Patel et al., 2012) and P. fuscovaginae CB98818 (Xie metal, 2012) have been sequenced. The genome size of P. fuscovaginae is 6.7 Mb, larger than most of the members of the Pseudomonas family (Ramkumar et al., 2015). Mutational analysis of P. fuscovaginae revealed the virulence mechanism of the bacteria (Patel et al., 2014). Mutation in the phytotoxin genes and Type IV secretion system caused loss of virulence, indicating its vital role in disease establishment. Quibod et al. (2015) studied the virulence mechanism of a P. fuscovaginae-like

224

Bacterial Diseases of Rice and Their Management

rice infecting bacterium and found multiple virulence mechanisms in this pathogen. A whole genome-wide comparison study revealed that different strains of P. fuscovaginae collected from various countries viz Australia, China, Japan, Madagascar, and the Philippines, fall into a single monophyletic group. These strains were grouped into two different subgroups (Quibod Metal, 2015). The isolate from the Philippines was grouped separately and called P. fuscovaginae-like strain. These findings suggest the high complexity and variability of this pathogen. The information regarding the variability of different strains and its virulence is vital to develop disease resistance varieties. 13.2.3 VIRULENCE Plant pathogens try to overtake the host’s immune response by producing effectors and toxins. P. fuscovaginae produces three types of cyclic lipopeptides (CLPs) viz syringotoxin, fuscopeptin-A, and fuscopeptin-B, which play crucial role in disease establishment (Batoko et al., 1998). These toxins are non-host specific and help the bacteria to infect multiple crops. Syringotoxin has 9 amino acid residues whereas fuscopeptin-A and fuscopeptin-B has 19 amino acid residues. P. fuscovaginae produces these toxins simultaneously upon host recognition. These toxins act together and have synergistic effect. They attack plant membrane causing leakage of protons thus targeting H+/ATPase pump (Serra et al., 1999). This hampered the vital cellular activities and signaling processes and resulted in susceptibility of the host plant. Weeraratne et al. (2020) confirmed the role of syringotoxin in virulence mechanism of P. fuscovaginae in rice. The mutant P. fuscovaginae having site-specific mutation in syringopeptin synthetase (sypA) homolog showed reduced virulence thus confirming its role in disease establishment. Pathogens often manipulate the host’s immune response and host tries to fight back. All these processes require quick and efficient signaling mechanisms. Phytohormones play crucial role in the time of host-pathogen interaction and one who controls this mechanism has advantage over other (Yadav et al., 2020). Important phytohormones involved in the disease resistance/susceptibility mechanisms are salicylic acid (SA), jasmonic acid (JA), ethylene, abscisic acid, cytokinin, and auxin (Checker et al., 2018). For sheath brown rot disease, very little information is available regarding

The Emerging Role of New Molecular Technologies

225

hormonal cross-talk. In a study involving S. oryzae, it was observed the application of SA was not reducing the disease severity (Chauhan et al., 2017). Involvement of WRKY13 transcription factor which is responsible for SA-JA cross-talk in providing resistance against S. oryzae was studied by Lilly and Subramanian (2019). They found that over expression of WRKY13 TF provide resistance in rice against S. oryzae. Peeters et al. (2020) found elevated ABA level was causing reduction in disease symp­ toms against P. fuscovaginae but causes susceptibility against S. oryzae. However, role of JA was unclear in this study but accumulation of IAA correlated with disease severity. Production of auxin either by host or pathogen is known to cause disease susceptibility (De Vleesschauwer et al., 2013). 13.2.4 SCREENING PROTOCOL A robust, high-throughput screening protocol is necessary for the identification of the resistant source which is the primary requirement to development the disease resistant varieties. However, in case of P. fuscovaginae, there is a lack of an easy, effective, efficient, and reproducible screening protocol. In a study conducted by Vivekananthan et al. (2005), two wild species of rice with different rice germplasm were first field tested and then resistant/tolerant genotypes were further confirmed in vitro under laboratory conditions. Phytotoxins added in the medium showed increased susceptibility and therefore enhanced the sensitivity of the screening method. Adorada et al. (2013) has done a comparative study of 3 screening methods viz pin-prick, inoculum spray and seed soaking method. They found that the pin-prick method was suitable for the identification of the resistant source whereas inoculum spray and seed soaking method was suitable for large scale screening of different rice genotypes. However, no method was perfect and different methods of screening had provided different resistant sources. Therefore, multiplication and multi-year screening will be suitable for the identification of the resistant source against P. fuscovaginae. A unique infection method was developed for the screening of sheath brown rot caused by the fungus S. oryzae (Lakshmanan, 1993). In this method, an insect, rice mealy bug was chosen as a natural spreader of the pathogen. However, no such method is available for the screening of the resistant source against P. fuscovaginae.

226

Bacterial Diseases of Rice and Their Management

13.2.5 CONTROL MEASURES Kakar et al. (2014) isolated a strain of Bacillus amyloliquefaciens (BK-7) as a biocontrol of P. fuscovaginae. They screened 120 isolates of B. amyloliquefaciens from the rhizosphere of rice field and found the most inhibitory action (76%) of BK-7 isolate on P. fuscovaginae. This isolate was also found beneficial to the rice plant and showed growth promoting activities in the plant. Plant based extracts such as Calotropis procera, Azadirachta indica, Lantana camara, and Chenopodium sp. have been characterized and found effective in controlling the various diseases in rice (Saha et al., 2015). A plant (Piper sarmentosum) based extract was found effective against sheath brown rot and BB (Syed-Ab-Rahman et al., 2018) in glasshouse conditions. In another study, Syed-Ab-Rahman et al. (2020) increased the efficacy of P. sarmentosum extract by using different emulsifying agents. Use of disease-free clean seeds in combination with dry heat treatment at 56°C for 6 days is recommended for the control of sheath brown rot in rice (Saha et al., 2015). In a recent study, the application of fermented coconut water was found effective in controlling the spread of P. fuscovaginae (Wahab et al., 2020). Maximum inhibition of pathogen was obtained by the application of methanol extracted fermented coconut water. However, a large-scale field trial is needed to validate the effectiveness, sustainability, production effi­ ciency, and environmental safety of these methods to control sheath brown rot disease in rice. These are a huge research gap in molecular breeding studies for P. fuscovaginae. There is no credible resistance gene or QTL mapping/tagging study available for this pathogen. Although, few QTLs identification studies has been conducted for sheath brown rot caused by the fungus S. oryzae (Hittalmani et al., 2002; Mvuyekure et al., 2017; Mahadevaiah et al., 2017). Considering the increasing severity and coverage of this pathogen around the world, there is an urgent need to study the host-pathogen interaction, developing high throughput screening protocol, and identify genes/QTLs responsible for P. fuscovaginae resistance in rice. ACKNOWLEDGMENT The authors are highly grateful to the ICAR for providing the necessary facility to compile this document.

The Emerging Role of New Molecular Technologies

227

KEYWORDS • • • • • •

brown sheath rot cyclic lipopeptides host-pathogen interaction loop-mediated isothermal amplification N-acyl homoserine lactone quorum sensing Pseudomonad fuscovaginae

REFERENCES Adorada, D. L., Stodart, B. J., Vera, C. C., Gregorio, G., Pangga, I., & Ash, G. J., (2013). Standardizing resistance screening to Pseudomonas fuscovaginae and evaluation of rice germplasm at seedling and adult plant growth stages. Euphytica, 192(1), 1–16. Arsenijević, M., (1991). Bacterial sheath brown rot of rice, wheat, maize, and sorghum plants. Savremena Poljoprivreda, 39(1), 66–71. Ash, G. J., Jillian, M. L., Lindsay, R. T., Benjamin, J. S., Valerie, V., Casiana, V. C., Philippe, R., & Jan, E. L., (2014). Development of a genomics-based LAMP (loop-mediated isothermal amplification) assay for detection of Pseudomonas fuscovaginae from rice. Plant Disease, 98(7), 909–915. Batoko, H., Alban De, K. D., Jean-Marie, K., Jules, B., Richard, A. G., Henri, M., & Marc, B., (1998). Modulation of plant plasma membrane H+-ATPase by phytotoxic lipodepsipeptides produced by the plant pathogen Pseudomonas fuscovaginae. Biochimica et Biophysica Acta (BBA)-Biomembranes, 1372(2), 216–226. Bigirimana, V. D. P., Gia, K. H. H., Obedi, I. N., & Monica, H., (2015). Rice sheath rot: An emerging ubiquitous destructive disease complex. Frontiers in Plant Science, 6, 1066. CABI, (2021). Datasheet Pseudomonas Fuscovaginae (Rice Sheath Rot). https://www.cabi. org/isc/datasheet/44957 (accessed on 16 August 2022). Chauhan, R. S., Yadav, N. K., & Chauhan, R., (2017). Management of sheath rot of rice caused by Sarocladium oryzae (Sawada) gams and Hawksworth. Annals of Biology, 33(1), 108–112. Checker, V. G., Hemant, R. K., Pragati, K., & Saurabh, Y., (2018). Role of phytohormones in plant defense: Signaling and cross talk. In: Molecular Aspects of Plant-Pathogen Interaction (pp. 159–184). Springer, Singapore. Cottyn, B., Regalado, E., Benjamin, L., Marcel De, C., Mew, T. W., & Jean, S., (2001). Bacterial populations associated with rice seed in the tropical environment. Phytopathology, 91(3), 282–292. Cottyn, B., Van, O. M. F., Cerez, M. T., De Cleene, M., Jean, S., & Mew, T. W., (1996). Bacterial diseases of rice. II. Characterization of pathogenic bacteria associated with sheath rot complex and grain discoloration of rice in the Philippines. Plant Disease, 80(4), 438–445. De Vleesschauwer, D., Godelieve, G., & Monica, H., (2013). Hormone defense networking in rice: Tales from a different world. Trends in Plant Science 18(10), 555–565.

228

Bacterial Diseases of Rice and Their Management

Desjardins, A. E., Ronald, D. P., & Paul, E. N., (1997). Production of fumonisin B (inf1) and moniliformin by Gibberella fujikuroi from rice from various geographic areas. Applied and Environmental Microbiology, 63(5), 1838–1842. Duveiller, E., & Henri, M., (1990). Bacterial sheath rot of wheat caused by Pseudomonas fuscovaginae in the highlands of Mexico. Plant Disease, 74(11), 932–935. Duveiller, E., Snacken, F., Henri, M., & Autrique, A., (1989). First detection of Pseudomonas fuscovaginae on maize and sorghum in Burundi. Plant Disease, 73(6), 514–517. Fisher, P. J., & Petrini, O., (1992). Fungal saprobes and pathogens as endophytes of rice (Oryza sativa L.). New Phytologist, 120(1), 137–143. Hittalmani, S., Girish, K. K., Shashidhar, H. E., & Vaishali, M. G., (2002). Identification of quantitative trait loci associated with sheath rot resistance (Sarocladium oryzae) and panicle exsertion in rice (Oryza sativa L.). Current Science, 82(2), 133–135. Kakar, K. U., Duan, Y. P., Zarqa, N., Guochang, S., Abdlwareth, A., Almoneafy, M., Auwal, H., et al., (2014). A novel rhizobacterium Bk7 for biological control of brown sheath rot of rice caused by Pseudomonas fuscovaginae and its mode of action. European Journal of Plant Pathology, 138(4), 819–834. Kim, H. M., & Song, W. Y., (1996a). Characterization of ribosomal RNA intergenic spacer region of several seedborne bacterial pathogens of rice. Seed Science and Technology, 24(3), 571–580. Kim, H. M., & Wan, Y. S., (1996b). Differentiation of major rice-seedborne bacteria by PCR-amplified polymorphism of spacer region between 16S and 23S ribosomal DNA. The Plant Pathology Journal, 12(1), 11–20. Kraepiel, Y., & Marie-Anne, B., (2016). Gram-negative phytopathogenic bacteria, all hemibiotrophs after all?. Molecular Plant Pathology, 17(3), 313. Lakshmanan, P., (1992). Sheath rot of rice incited by Curvularia lunata in Tamil Nadu, India. Tropical Pest Management, 38(1). Lakshmanan, P., (1993). Efficient method of assessing resistance to sheath rot in rice. Crop Protection 12(3), 189–192. Lerat, E., & Nancy, A. M., (2004). The evolutionary history of quorum-sensing systems in bacteria. Molecular Biology and Evolution, 21(5), 903–913. Mahadevaiah, C., Shailaja, H., Uday, G., & Prasanna, K. M. K., (2017). Genetic studies and identification of QTLs for sheath rot disease resistance in rice (Oryza sativa L.). Indian J. Genet., 77(4), 485–492. Mattiuzzo, M., Iris, B., Sara, F., Laura, C., Joseph, B., Corrado, G., Sandor, P., Henri, M., & Vittorio, V., (2011). The plant pathogen Pseudomonas fuscovaginae contains two conserved quorum sensing systems involved in virulence and negatively regulated by RsaL and the novel regulator RsaM. Environmental Microbiology, 13(1), 145–162. Miyajima, K., Akio, T., & Tadahiko, A., (1983). Pseudomonas fuscovaginae sp. nov., nom. rev. International Journal of Systematic and Evolutionary Microbiology, 33(3), 656, 657. Musonerimana, S., Cristina, B., Danilo, L., Georges, H., Joseph, B., & Vittorio, V., (2020). Pathobiomes revealed that Pseudomonas fuscovaginae and Sarocladium oryzae are independently associated with rice sheath rot. Microbial. Ecology, 80, 627–642. Mvuyekure, S. M., Julia, S., John, D., John, N., & Germain, N., (2017). Genetic analysis of mechanisms associated with inheritance of resistance to sheath rot of rice. Plant Breeding, 136(4), 509–515. Nandakumar, R., Shahjahan, A. K. M., Yuan, X. L., Dickstein, E. R., Groth, D. E., Clark, C. A., Cartwright, R. D., & Rush, M. C., (2009). Burkholderia glumae and B. gladioli cause bacterial panicle blight in rice in the southern United States. Plant Disease, 93(9), 896–905.

The Emerging Role of New Molecular Technologies

229

Oster, J. J., (1992). Reaction of a resistant breeding line and susceptible California rice cultivars to Sclerotium oryzae. Plant Disease, 76(7), 740–744. Patel, H. K., Daniel Da, S. P., Giulia, D., Henri, M., Konrad, P., David, J. S., & Vittorio, V., (2012). Draft Genome Sequence of Pseudomonas Fuscovaginae, a Broad-Host-Range Pathogen of Plants, 2765, 2766. Patel, H. K., Maura, M., Iris, B., Vincent De, P. B., Gavin, J. A., Monica, H., & Vittorio, V., (2014). Identification of virulence associated loci in the emerging broad host range plant pathogen Pseudomonas fuscovaginae. BMC Microbiology, 14(1), 1–13. Peeters, K. J., Maarten, A., Kristof, D., Kris, A., & Monica, H., (2020). Auxin, abscisic acid and jasmonate are the central players in rice sheath rot caused by Sarocladium oryzae and Pseudomonas fuscovaginae. Rice, 13(1), 1–16. Purkayastha, R. P., & Ghosal, A., (1985). Analysis of cross-reactive antigens of Acrocylindrium oryzae and rice in relation to sheath rot disease. Physiological Plant Pathology, 27(2), 245–252. Quibod, I. L., Genelou, G., Eula, G. O., Frances, N. B., Gerbert, S. D., Ramil, M., Casiana, V. C., & Ricardo, O., (2015). Rice-infecting Pseudomonas genomes are highly accessorized and harbor multiple putative virulence mechanisms to cause sheath brown rot. PLoS One, 10(9), e0139256. Ramkumar, G., Lee, S. W., Weon, H. Y., Kim, B. Y., & Lee, Y. H., (2015). First report on the whole genome sequence of Pseudomonas cichorii strain JBC 1 and comparison with other Pseudomonas species. Plant Pathology, 64(1), 63–70. Razak, A. A., Nur, A. I. M. Z., Siti, N. M. S., Nor, A. I., Nik, M. I. N. M., & Baharuddin, S., (2009). Sheath brown rot disease of rice caused by Pseudomonas fuscovaginae in the Peninsular Malaysia. Journal of Plant Protection Research. Rott, P., Honegger, J., Jean-Loup, N., & Ranomenjanahary, S., (1991). Identification of Pseudomonas fuscovaginae with biochemical, serological, and pathogenicity tests. Plant Disease, 75(8), 843–846. Saha, S., Ruchi, G., Arunava, B., & Rai, A. B., (2015). Bacterial diseases of rice: An overview. J. Pure Appl. Microbiol., 9(1), 725–736. Sayler, R. J., Richard, D. C., & Yinong, Y., (2006). Genetic characterization and real-time PCR detection of Burkholderia glumae, a newly emerging bacterial pathogen of rice in the United States. Plant Disease, 90(5), 603–610. Serra, M. D., Giulia, F., Paola, N., Ivonne, B., Claudio, D. V., Domenico Di, G., Alessandro, B., & Gianfranco, M., (1999). The interaction of lipodepsipeptide toxins from Pseudomonas syringae pv. syringae with biological and model membranes: A comparison of syringotoxin, syringomycin, and two syringopeptins. Molecular Plant-Microbe Interactions, 12(5), 391–400. Syed-Ab-Rahman, S. F., & Dzolkhifli, O., (2018). Development of bio-formulations of piper sarmentosum extracts against bacterial rice diseases. Current Biotechnology, 7(6), 453–463. Syed-Ab-Rahman, S. F., Lilia, C. C., & Dzolkhifli, O., (2020). Development of plant-based emulsion formulations to control bacterial leaf blight and sheath brown rot of rice. Heliyon, 6(1), e03151. Tanii, A., Kuniyuki, M., & Tadahiko, A., (1976). The sheath brown rot disease of rice plant and its causal bacterium, Pseudomonas fuscovaginae A. Tanii, K. Miyajima et T. Akita sp. nov. Japanese Journal of Phytopathology, 42(5), 540–548. Vivekananthan, R., Sudhagar, R., Ravi, M., Ganapathy, T., Thiyagarajan, K., & Rabindran, R., (2005). Evaluation of relative resistance of rice against sheath rot through combined

230

Bacterial Diseases of Rice and Their Management

screening techniques. Acta Phytopathologica et Entomologica Hungarica, 40(3, 4), 279–287. Wahab, M. Z. A., Nurul, B. H., Fatin, A. B., Intan, S. M. A., & Zaiton, S., (2020). Effect of antimicrobial activity from fermented mature coconut water to sheath brown rot of rice disease. International Journal of Agricultural Resources, Governance, and Ecology, 16(2), 110–122. Weeraratne, N., Benjamin, J. S., Vittorio, V., Monica, H., Gia, K. H. H., Marc, O., Sandra, S., et al., (2020). Syringopeptin contributes to the virulence of Pseudomonas fuscovaginae, based on sypA biosynthesis mutant analysis. Phytopathology, 110(4), 780–789. Xie, G., Zhouqi, C., Zhongyun, T., Hui, Q., He, L., Muhammad, I., Bo, Z., et al., (2012). Genome sequence of the rice pathogen Pseudomonas fuscovaginae CB98818, 5479–5480. Yadav, P., Zahoor, A. M., Sajad, A., Pradeep, K. P., & Anita, G., (2020). A combined transcriptional, biochemical, and histopathological study unravels the complexity of Alternaria resistance and susceptibility in Brassica coenospecies. Fungal Biology, 124(1), 44–53. Zeigler, R. S., & Elizabeth, A., (1987). Bacterial sheath brown rot of rice caused by Pseudomonas fuscovaginae in Latin America. Plant Disease, 71(7), 592–597. Zeigler, R. S., & Elizabeth, A., (1990). Characteristics of Pseudomonas spp. causing grain discoloration and sheath rot of rice, and associated pseudomonad epiphytes. Plant Disease, 74(11), 917–922.

CHAPTER 14

Biological and Ecological Studies of Rice Bacterial Foot Rot Pathogen: An Update ASHWINI KUMAR,1 BICHHINNA MAITRI ROUT,2 SHAKSHI CHOUDHARY,3 and VANDANA SHARMA4 Division of Plant Pathology, ICAR–Indian Agricultural Research Institute, New Delhi–110012, India, Email: [email protected] (A.K.)

1

Division of Vegetable Science, ICAR–Indian Agricultural Research Institute, New Delhi–110012, India

2

Department of Bioscience and Biotechnology, Banasthali Vidyapith, Rajasthan–304022, India

3

Division of Genetics, ICAR–Indian Agricultural Research Institute, New Delhi–110012, India

4

ABSTRACT Rice bacterial foot root pathogen (Dickeya zeae) is one of the foremost important bacterial phytopathogens among Dickeya spp., which cause considerable yield loss in potato, rice, banana, etc. The pathogen is in a position to spread through water, survive on weeds and plant debris, increasing the problem of prevention and control of rot disease. The utilization of chemical agents, especially agricultural antibiotics, responsible for the development of drug-resistant pathogens which leads to the occurrence of disease. A collaborative approach by various researchers across the world paves how to develop different management strategies in an eco-friendly manner. Biological control is an ecologically sound, frugal, and viable alternative method. It comprises the utilization of bacterial antagonists, natural predators, Bacterial Diseases of Rice and Their Management. Deepti Srivastava, Md. Shamim, Malik Mobeen Ahmad, & K. N. Singh (Eds.) © 2023 Apple Academic Press, Inc. Co-published with CRC Press (Taylor & Francis)

232

Bacterial Diseases of Rice and Their Management

quorum-quenching bacterial stains, and systemic resistance of plants. A mixture of biocontrol strains might be a possible strategy to limit the disease. Crop rotation, tilling, use of organic matter, disease-resistant varieties, etc., are ecological methods, which can delay the initiation of disease and thus yield of the crop increases and crop allowed to mature completely, thus increasing the yield. However, integrated biological and ecological control approaches have yielded good leads to a sustainable manner. 14.1 INTRODUCTION Dickeya species (spp.) comes under the world’s top 10 bacterial phytopathogens (Mansfield et al., 2012). Presently this genus consists of total 8 species namely D. aquatic, D. chrysanthemi, D. dadantii, D. dianthicola, D. fangzhongdai, D. paradisiaca, D. solani, and D. zeae (Tian et al., 2016, Li et al., 2020). D. zeae bacteria infects a broad range of monocotyledonous and dicotyledonous plant hosts around the world. It has been reported from four dicotyledonous hosts, namely chrysanthemum, potato, philodendron, and tobacco. And total six natural monocotyledonous hosts, namely banana, brachiaria, hyacinth, maize, rice, and pineapple were also found infected (Kumar et al., 2016). In addition, 32 different plants have been identified as D. zeae artificial hosts (Liu et al., 2013). Some reports suggest that it is geographically originated from Asian countries. It had been found growing excessively in rice, maize, and banana in southeast of China. Rice foot rot is primarily found in South China, with approximately 10% to 30% yield loss. In some rice-growing regions it has been recorded up to 60% yield losses (Zhang et al., 2014). It also posed a threat to various rice-growing regions in Southeast Asia and Europe (Toth et al., 2011). The bacteria also isolated from rice plants in Japan, South Korea, North Korea, the Philippines, India, Indonesia, and Bangladesh (Zhang et al., 2018). Rice (Oryza sativa L.) comes in second position among the most important food crops in the world. D. zeae appears to have a tendency for latent infection. This pathogen is taken under consideration as economically important altogether the rice growing areas and should cause substantial yield loss under favorable environmental conditions (Zhang et al., 2017). The typical symptom of D. zeae infection is dark brown decay of the tillers. In the early stages of the disease, a brown sheath rot appeared to spread from the lingular region and lesions spread to the nodes, culms, and crowns. The systemic invasion of neighboring tillers of the same crown causes foot rot symptoms. Young tissues of infected tillers developed a disease with an

Biological and Ecological Studies of Rice Bacterial

233

unpleasant odor. Many tillers decomposed in the advanced stage, allowing entire diseased plants to be easily pulled from the soil (Pu et al., 2012). The symptoms were almost identical to those caused by the rice stem borer or the bacterial blight (BB) symptom known as “kresek.” Corn pathovar of Erwinia chrysanthemi’s phenotypic characters were almost the same as rice stains. Likewise, this can cause infection in other hosts, including carrot, potato, and maize. It could grow at a wide range of temperatures (10–40°C). However, the optimal temperature range is 30–35°C (Zhang et al., 2018). In the present days, agriculture is substantially hooked into continuous absence of crop rotation with an insistence on homogeneity. However, crop yield and quality are usually changed at the expense of genetic diversity. These practices ensure to supply ample amount of staple food across the world. This is an ecologically erratic situation and responsible for various plant diseases, pests, and weeds. There are some more affairs associated with modern agriculture like pollution, over-reliance on chemical pesticides and intervention of natural ecological nutrient cycles, which on the other hand, help crop production. Crop protection consists of the plant-wise objective to control pests and diseases to overcome crop losses. ‘Biological Control is a desirable component of ‘Integrated Pest and Disease Management.’ Biological control involves the processes to scale back pathogen density and control soil populations below disease threshold levels. Use of biological control lowers the loss to environment by very little intervention. Empha­ size of this method relies on the behavior and on the activity of microbes which supports the disease. This also speaks for the appealing approach for the plant disease management because it is economical, boundless, and is somewhat at the liberty from residual effects (Mukerji and Garg, 1988a, b; Mukerji et al., 1999). 14.2 BIOLOGICAL CONTROL 14.2.1 THE PHENOMENON Cook and Baker (1983) defined biocontrol agent (BCA) in their book “Nature and Practice of Biocontrol Agents of Plant Pathogens.” The phenomenon of biological control involves management of pathogen population or diseaseproducing through maintaining the population of one or more organisms. Maloney (1995) proposed a revised definition of biological control that includes agronomic practices having indirect affect on management of disease, and thus the necessity of human intervention within biological control,

234

Bacterial Diseases of Rice and Their Management

and defined as “the stimulation and enhancement for biological activity so as to scale back the quantity of pathogens.” Agronomic practices and/or microbial antagonism could also be used to achieve biological control. Some agronomic exercises prop up the exploitation of biological groups (Cook, 1993), which are used to create a favorable environment for antagonists, host plant resistance, or both. The microbe-microbe friction relationship includes the cautious use of specific antagonist organisms for disease avoidance and management. Easy isolation, quick growth on substrate, affects a wide range of pathogens, hardly pathogenic to host species, antibiotics production, and competition for the food and site are all characteristics of a perfect BCA. It will be developed using one of the three methods listed below: 1. Isolation of disease-fighting organisms already in the market. The most basic example is Agrobacterium radiobacter strain 84, which is an effective plant disease BCA. 2. Selection or isolation of improved strains of organisms containing gene splicing improvements and protective characteristics. For example, Pseudomonas syringae was developed as an impact agent against bacteria that cause frost damage to crops by deleting the icenucleation gene (Lindeman and Suslow, 1987). 3. Designing a BCA strain begins with harmlessly inserting a gene that codes for a toxin active against a pest or pathogen into the agents that colonize host plants. Agents are frequently created artificially using either live or non-viable strains (Twombly, 1990). 14.2.2 MECHANISM OF ACTION OF BIOCONTROL AGENTS (BCAS) The mechanism of antibiosis has gotten a lot of attention recently, and inter­ disciplinary approaches have helped us to understand the biological activi­ ties which are responsible for the protection of plants and enhancement of yield. Biological activities that are in consideration to play a role in disease control include the ability to colonize and supply antagonistic compounds such as antibiotics, siderophores (compounds that chelate biologically avail­ able iron), ammonia, cyanide, hydrolytic enzymes, and growth-promoting substances to the appropriate host plant (Loper, 1988; Schipper et al., 1987; Thomashow et al., 1998; Shetty and Kumar, 2012). Biological control may provide protection by inducing the host defense mechanism and structured restriction, such as the expulsion of plant signals that would otherwise cause pathogen spread or nutrient competition. Induced systemic resistance has

Biological and Ecological Studies of Rice Bacterial

235

been shown in recent studies to be a useful alternative to antagonism for achieving biological control of disease (Benhaumou et al., 1997). Systemic protection achieved through plant growth promoting rhizobacteria (PGPR) has been considered as a result of induced resistance and undue to possible bacterial metabolite translocation. Furthermore, protection obtained against one disease is also effective against other diseases (Hoffland et al., 1997). As a result, PGPR-mediated induced systemic resistance is basically like to acquire systemic resistance (Hoffland et al., 1996; Kloepper et al., 1997; Liu et al., 1995; Wei et al., 1991). 14.2.3 MONITORING OF BIOCONTROL AGENT (BCA) IN THE ENVIRONMENT BCA detection is necessary for: (i) reviewing the ecology of introduced organisms in the environment; (ii) observing a biocontrol product; (iii) risk assessment. A broad range of methods for detection of introduced organisms has increased intensely in recent years, and there is a diversity of other options for chasing organisms that have already surfaced as a result of the advances in recombinant DNA technology, microbial potential for isolate-specific macromolecule probes like probes to rRNA sequences, and other factors. These methods are frequently used for detecting things and the level of metabolic activity of the introduced microorganisms, in addition to detecting the population present. Combining selective and diagnostic markers along with markers used in other methods of detection showed better potential of pathogen identification. Combining methods provides more certainty about the unambiguous detection of the target strain: (i) easier detection; and (ii) higher sensitivity. However, we can achieve effective results by combining new and traditionally popular methods. Using more than one method to identify the introduced organism is a viable option because it allows for cross-checking of the results and give more confidence on the observation obtained by different diagnostic methods. 14.2.4 BIOLOGICAL CONTROL OF RICE BACTERIAL FOOT ROT PATHOGEN (DICKEYA ZEAE, FAMILY PECTOBACTERIACEAE) Unlike other Dickeya species D. zeae is capable of infecting both monocots and dicots, which indicates the presence of other virulence factors. The pathogen can spread via water and also survives on weeds growing in fields

236

Bacterial Diseases of Rice and Their Management

and on plant debris, making rot disease prevention and control more difficult (Ma et al., 2007). Synthetic bactericides and resistant cultivars are normally used to control plant bacterial infections. Large-scale use of toxic chemicals leads to various problems including environmental hazards, pathogen resistance, and damage to non-target organisms. In addition, continuous cultivation of resistant cultivar in a large area may lead to adaptive variation of D. zeae. These conditions favor the growth of pathogen and as a result this cause loss of resistance in cultivar. Biocontrol, on the other hand, might be a potent alternative to the use of synthetic chemicals, as well as an environmentally benign way to control plant diseases (Emmert and Handelsman, 1999). The most strategies used against this disease includes the bacterial antagonists and quorum quenching bacteria (Czajkowski et al., 2011). Bacillus amyloliquefaciens strain D2WM was also discovered to have good inhibitory activity against D. chrysanthemi, with macrolactin A was identified as the key antibacterial substance (Chen et al., 2019). In the case of D. zeae caused diseases on hyacinth bulbs, two bacterial species, namely Rahnella aquatilis and Erwinia persicinus showed a reduction in the severity of tissue maceration (Jaffra et al., 2009). B. subtilis strain A2 was also discovered to have a bacteriostatic effect against Guzmania denise caused plant disease (Wang et al., 2012). In case of D. zeae (rice isolate EC1) a quorum sensing (QS) system was discovered which regulates cell motility and biofilm formation (Hussain et al., 2008; Zhou et al., 2016). This QS system senses signal of AHL to control the expression of virulence-associated genes and a regulatory gene SlyA (MarR family). Strain EC1 also relies primarily on the Fis transcriptional regulator to control the expression of zms genes as well as the synthesis of cytomembrane degrading enzymes (Lv et al., 2018). In a study of Li et al. (2020) MLSA and phylogenetic analysis were performed to compare three strains, namely P. fluorescens (SC3), P. parafulva (SC11), and B. velezensis (3–10) and iden­ tified that SC3 and SC11 strains Pseudomonas were more efficient against Dickeya strains than Bacillus velezensis 3–10. Dickeya strains showing more sensitivity to Pseudomonas strains SC3 and SC11 in compression of Bacillus strain 3–10. The results show that each of the three strains, particularly strain SC3, was effective in controlling the D. zeae infection. All three strains inhibit the growth of D. zeae EC1, they had expected efficacy in controlling rice foot rot. Previously it has been discovered that the D. zeae strains (EC1 and MS2) could create antibiotic-like phytotoxins that inhibited the growth of a variety of harmful microbes (Hu et al., 2018; Zhou et al., 2011). Besides the above-mentioned factors, a good biocontrol strain must be appropriate for field application and should not be repressed by the targeted pathogen.

Biological and Ecological Studies of Rice Bacterial

237

Bacteriocins are a type of bactericidal protein or polypeptide synthesized by ribosomes in bacteria that are resistant to the secreted bacteriocin. Pioneer research recommended that bacteriocins are specific and work on equivalent or closely related species (Keswani et al., 2020). Recently various research uncovered that some bacteriocins can likewise kill other species. For example, P. fluorescens strain SC3 produces a metabolite that inhibits the growth of Dickeya species, namely X. campetris pv campetris Xcc1 and R. solanacearum EP1. But this strain was not effective against Pantoea species. The antibacterial metabolites action spectra aren’t related to the antagonistic strains’ genetic evolution relationship. However, the consistency of the biocontrol result is hard to assure, because strains may be sensitive to field conditions such as soil and weather (Keswani et al., 2020). It is hoped that further research in the near future may isolate the pure form of antibacterial substances found in those antagonistic strains, allowing them to be used more effectively and consistently in agricultural production. 14.3 ECOLOGICAL CONTROL Various practices are continuously used to overcome the risk of disease. Controlling the environment pathogens from the previous year can easily be carried over when saving seed. To minimize the risk of pathogen inoculum only healthy plants should be used for seed collection. Although pathogens may be introduced from an advertisement seed source on occasion, they are generally the most dependable source. The treatment of 0.5% hypochlorite and peroxide (12 times that of household bleach) is effective, but one must keep in mind that it requires complete rinsing out. Surface disinfectants can be neutralized by organic matter, rendering them ineffective. Inter-family crop rotation can decrease the incidence of disease. Many pathogens can survive in the winter session on debris. Plant residue that is tilled in at the peak of the season favors microorganisms present in soil for break down the material and potential pathogens could not survive without media. Drip irrigation and good air circulation helps in maintaining the conditions which inhibits the growth of pathogen. Various microorganisms present in soil get benefit from fertility of soil and appropriate drainage water. Mustards and Sudan grass have properties to inhibit the growth of some plant pathogens present in soil. Plant-pathogenic organisms compete with diverse microbial communities in the soil. One of the most cost-effective and good methods for disease management is to use disease-resistant varieties. The disease is rarely immune to resistant varieties. They are assisting in delaying the onset

Bacterial Diseases of Rice and Their Management

238

of disease, potentially increasing yields and allowing the crop to mature completely. 14.4 CONCLUSION Nowadays, various control measures are used for the management of diseases among them biological control measures are one of the most sustainable methods as it is environmental friendly. Chemical pesticides are bad for the environment, and a single gene based host-plant resistance host-plant may not be long-lasting within the sphere, resulting in frequent resistance break­ downs. It is critical to devise environment friendly and long-term control strategies. Biological control is an environment friendly, feasible, and long-term solution for disease management. In biological control measures various kinds of bacteria and fungus are used against pathogens. Repeated use of particular biological control agent causes the emergence of resistance in the target organism. To overcome these new approaches should be used for selecting BCAs. Use of genetically modified microorganisms could also be another option. On the other hand, there are two or three traits involved in biocontrol, such as antibiotic construction, siderophores, and anti-fungal volatiles that can be combined to make a good colonizer. It does, however, necessitate a thorough understanding of a BCA’s precise mode of action. Several effective BCAs have now been developed and tested in both the field and the laboratory. However, BCA’s full potential has yet to be explored and needs implementation in a coordinated effort from pathologists, microbiolo­ gists, agronomists, and extension scientists. KEYWORDS • • • • • • •

acyl homoserine lactone Dickeya species disease management long-term solution Oryza sativa plant growth promoting rhizobacteria quorum sensing

Biological and Ecological Studies of Rice Bacterial

239

REFERENCES Benhamou, N., Rey, P., Chérif, M., Hockenhull, J., & Tirilly, Y., (1997). Treatment with the mycoparasite Pythium oligandrum triggers induction of defense-related reactions in tomato roots when challenged with Fusarium oxysporum f. sp. radicis-lycopersici. Phytopathology, 87(1), 108–122. Chen, J., Liu, T., Wei, M., Zhu, Z., Liu, W., & Zhang, Z., (2019). Macrolactin a is the key antibacterial substance of Bacillus amyloliquefaciens D2WM against the pathogen Dickeya chrysanthemi. European Journal of Plant Pathology, 155(2), 393–404. Cook, R. J., & Baker, K. F., (1983). The Nature and Practice: Biological control of plant pathogens (p. 53). American Phytopathological Society. St. Paul, MN. Cook, R. J., (1993). Making greater use of introduced microorganisms for biological control of plant pathogens. Annual Review of Phytopathology, 31(1), 53–80. Czajkowski, R., Perombelon, M. C., Van, V. J. A., & Van, D. W. J. M., (2011). Control of blackleg and tuber soft rot of potato caused by Pectobacterium and Dickeya species: A review. Plant Pathology, 60(6), 999–1013. Emmert, E. A., & Handelsman, J., (1999). Biocontrol of plant disease: A (gram-) positive perspective. FEMS Microbiology Letters, 171(1), 1–9. Hoffland, E., Bakker, P. A., & Van, L. L. C., (1997). Multiple disease protection by rhizobacteria that induce systemic resistance reply. Phytopathology, 87(2), 138–138. https://pubmed. ncbi.nlm.nih.gov/18945132/ (accessed on 15 September 2022). Hoffland, E., Hakulinen, J., & Van, P. J. A., (1996). Comparison of systemic resistance induced by avirulent and nonpathogenic Pseudomonas species. Phytopathology, 86(7), 757–762. Hu, M., Li, J., Chen, R., Li, W., Feng, L., Shi, L., Xue, Y., et al., (2018). Dickeya zeae strains isolated from rice, banana, and clivia rot plants show great virulence differentials. BMC Microbiology, 18(1), 1–15. Hussain, M. B., Zhang, H. B., Xu, J. L., Liu, Q., Jiang, Z., & Zhang, L. H., (2008). The acyl­ homoserine lactone-type quorum-sensing system modulates cell motility and virulence of Erwinia chrysanthemi pv. zeae. Journal of Bacteriology, 190(3), 1045–1053. Jafra, S., Przysowa, J., Gwizdek-Wiśniewska, A., & Van, D. W. J. M., (2009). Potential of bulb-associated bacteria for biocontrol of hyacinth soft rot caused by Dickeya zeae. Journal of Applied Microbiology, 106(1), 268–277. Keswani, C., Singh, H. B., García-Estrada, C., Caradus, J., He, Y. W., Mezaache-Aichour, S., Glare, T. R., et al., (2020). Antimicrobial secondary metabolites from agriculturally important bacteria as next-generation pesticides. Applied Microbiology and Biotechnology, 104(3), 1013–1034. Kloepper, J. W., Tuzun, S., Zehnder, G. W., & Wei, G., (1997). Multiple disease protection by rhizobacteria that induce systemic resistance—Historical precedence. Phytopathology, 87(2), 136–137. Li, J., Hu, M., Xue, Y., Chen, X., Lu, G., Zhang, L., & Zhou, J., (2020). Screening, identification, and efficacy evaluation of antagonistic bacteria for biocontrol of soft rot disease caused by Dickeya zeae. Microorganisms, 8(5), 697. Lindemann, J., & Suslow, T. V., (1987). Competition between ice nucleation-active wild type and ice nucleation-deficient deletion mutant strains of Pseudomonas syringae and P. fluorescens biovar I and biological control of frost injury on strawberry blossoms. Phytopathology, 77(6), 882–886.

240

Bacterial Diseases of Rice and Their Management

Liu, H., Li, H., Bai, Y., Wang, J., Nie, M., Li, B., & Xiao, M., (1995). The use of Pseudomonas fluorescens P13 to control sclerotinia stem rot (Sclerotinia sclerotiorum) of oilseed rape. The Journal of Microbiology, 49(6), 884–889. Liu, Q. G., Zhang, Q., & Wei, C. D., (2013). Advances in research of rice bacterial foot rot. Sci. Agric. Sin., 46(14), 2923–2931. Loper, J. E., (1988). Role of fluorescent siderophore production in biological control of Pythium ultimum by a Pseudomonas fluorescens strain. Phytopathology, 78(2), 166–172. Lv, M., Chen, Y., Liao, L., Liang, Z., Shi, Z., Tang, Y., Ye, S., Zhou, J., & Zhang, L., (2018). Fis is a global regulator critical for modulation of virulence factor production and pathogenicity of Dickeya zeae. Scientific Reports, 8(1), 1–13. Ma, B., Hibbing, M. E., Kim, H. S., Reedy, R. M., Yedidia, I., Breuer, J., Glasner, J. D., et al., (2007). Host range and molecular phylogenies of the soft rot enterobacterial genera pectobacterium and Dickeya. Phytopathology, 97(9), 1150–1163. Maloney, A., (1995). 6 Three sources for non-chemical management of plant disease: Towards an ecological framework. In: Advances in Plant Pathology (Vol. 11, pp. 103–130). Academic Press. Mansfield, J., Genin, S., Magori, S., Citovsky, V., Sriariyanum, M., Ronald, P., & Foster, G. D., (2012). Top 10 plant pathogenic bacteria in molecular plant pathology. Molecular Plant Pathology, 13(6), 614–629. Mukerji, K. G., & Garg, K. L., (1988a). Biocontrol of Plant Diseases (Vol. I). CRC Press Inc., Florida, USA. Mukerji, K. G., Chamola, B. P., & Upadhyay, R. K., (1999). Biotechnological Approaches in Biocontrol of Plant Pathogens. XI, p. 255. Springer New York, NY, eBook ISBN 978-1­ 4615-4745-7. https://doi.org/10.1007/978-1-4615-4745-7. Pu, X. M., Zhou, J. N., Lin, B. R., & Shen, H. F., (2012). First report of bacterial foot rot of rice caused by a Dickeya zeae in China. Plant Disease, 96(12), 1818–1818. https://pubmed. ncbi.nlm.nih.gov/30727269/. Schippers, B., Lugtenberg, B., & Weisbeek, P. J., (1987). Plant growth control by fluorescent pseudomonads. Innovative Approaches to Plant Disease Control, 19, 30. Shetty, H. S., & Kumar, V. U., (2012). Downy mildew research laboratory department of applied botany and biotechnology. Biocontrol Potential and its Exploitation in Sustainable Agriculture: Crop Diseases, Weeds, and Nematodes, 251. Thomashow, L. S., & Weller, D. M., (1988). Role of a phenazine antibiotic from Pseudomonas fluorescens in biological control of Gaeumannomyces graminis var. tritici. Journal of Bacteriology, 170(8), 3499–3508. Tian, Y., Zhao, Y., Yuan, X., Yi, J., Fan, J., Xu, Z., & Li, X., (2016). Dickeya fangzhongdai sp. nov., a plant-pathogenic bacterium isolated from pear trees (Pyrus pyrifolia). International Journal of Systematic and Evolutionary Microbiology, 66(8), 2831–2835. Toth, I. K., Van, D. W. J. M., Saddler, G., Lojkowska, E., Hélias, V., Pirhonen, M., Tsror, L., & Elphinstone, J. G., (2011). Dickeya species: An emerging problem for potato production in Europe. Plant Pathology, 60(3), 385–399. Twombly, R., (1990). Genetic engineers at crop genetics and mycogen place hopes on two different strategies for pest control. The Scientist. Wang, Y. H., Tan, Z. Q., Liu, H., & Zhang, R. Y. (2012). Screening and identification of antagonistic bacteria against bacterial soft rot of Guzmania denise. Guangdong Academy of Agricultural Sciences, 39, 63, 64.

Biological and Ecological Studies of Rice Bacterial

241

Wei, G., Kloepper, J. W., & Tuzun, S., (1991). Induction of systemic resistance of cucumber to Colletotrichum orbiculare by select strains of plant growth-promoting rhizobacteria. Phytopathology, 81(11), 1508–1512. Zhang, J., Hu, J., Shen, H., Zhang, Y., Sun, D., Pu, X., Yang, Q., Fan, Q., & Lin, B., (2018). Genomic analysis of the phalaenopsis pathogen Dickeya sp. PA1, representing the emerging species Dickeya fangzhongdai. BMC Genomics, 19(1), 1–16. Zhang, S., Liang, M., Naqvi, N. I., Lin, C., Qian, W., Zhang, L. H., & Deng, Y. Z., (2017). Phototrophy and starvation-based induction of autophagy upon removal of Gcn5-catalyzed acetylation of Atg7 in Magnaporthe oryzae. Autophagy, 13(8), 1318–1330. Zhou, J. N., Zhang, H. B., Lv, M. F., Chen, Y. F., Liao, L. S., Cheng, Y. Y., Liu, S. Y., et al., (2016). SlyA regulates phytotoxin production and virulence in Dickeya zeae EC1. Molecular Plant Pathology, 17(9), 1398–1408. Zhou, J., Zhang, H., Wu, J., Liu, Q., Xi, P., Lee, J., Liao, J., Jiang, Z., & Zhang, L. H., (2011). A novel multidomain polyketide synthase is essential for zeamine production and the virulence of Dickeya zeae. Molecular Plant-Microbe Interactions, 24(10), 1156–1164.

CHAPTER 15

Then and Now: Use of Conventional and Molecular Technologies for Bacterial Foot Rot Disease Resistance in Rice ARCHANA LALWANI and SHUCHI GUPTA Department of Botany and Biotechnology, Sadhu Vaswani Autonomous College, Sant Hirdaram Nagar, Bhopal, Madhya Pradesh–462030, India, E-mail: [email protected] (A. Lalwani)

ABSTRACT Foot rot disease in rice is caused by Dickeya zeae and occurs almost all around the world, resulting in significant yield losses. The use of host resistance is the most efficient method of managing reduced crop yield. The use of traditional and molecular techniques for the improvement of rice resistant with improved quality can be a practical and environmentally friendly solution. Genomic tech­ nology is opening up new management options, such as better identification and bio-control approaches, which can also lead to effective disease manage­ ment. Recent technical advancements have improved DNA-based molecular technology linked to genes in the rice chromosome that confer bacterial disease resistance. Through the gene editing methods, the multiple genes with desired characters transferred into single genotype allowing for formation of resistant varieties in the short number of generations with high precision. 15.1 INTRODUCTION Rice is a major cereal crop in India and a main source of nutrition for a large number of people in Africa, Latin America, and Asia. About 90% of the Bacterial Diseases of Rice and Their Management. Deepti Srivastava, Md. Shamim, Malik Mobeen Ahmad, & K. N. Singh (Eds.) © 2023 Apple Academic Press, Inc. Co-published with CRC Press (Taylor & Francis)

244

Bacterial Diseases of Rice and Their Management

global population lives in Asia, with China, India, and Indonesia providing 30.85%, 20.12%, and 8.21% of overall worldwide production of rice, respectively (Kadu et al., 2015). Rice accounts for about 23.3 percent of India’s total land area Seed-borne diseases are estimated to be responsible for 12% of global production losses (Agarwal and Sinclair, 1987). Diseases are a major obstacle in rice production, resulting in losses in both quality and quantity. Major crop damage is caused by important diseases, necessitating the use of control measures. Depending on the disease, the stage of plant growth at infection, the resistance of the Variety, management, and weather. Estimated losses can range from 1% to 100%. Rice is susceptible to a variety of diseases, the most damaging of which are bacterial diseases, which result in substantial yield loss. Among the most popular bacterial diseases are rice blight, foot rot of rice, bacterial leaf streak (BLS) and bacterial panicle blight (BPB). Three factors make up the plant disease pyramid: a susceptible host plant, a virulent pathogen, and a favorable climate (Mueller et al., 2010). Since all three factors are required for the development of a plant disease, any one of them may have an impact. Diseases modify a plant’s normal physiological behavior, affecting one or more of its functions and potentially lowering its yield (John and Fielding, 2014). Since domestication, plant breeding has proven to be the most effective method for developing new crop varieties, allowing for significant advancements in global food security and societal growth. Plants are vulnerable to a variety of pathogens, such as bacteria, fungi, and viruses that inflict significant economic losses (FAO, 2017); increasing resistance of plant is important for enhancing production of crop that could meet with overall population demands. When used correctly, the control measures those are dependent upon the resistant crops and agrochemicals have significant effect. When it happens, disease prevention strategies will quickly become ineffective as novel genotypes become more common due to natural selection and it spread quickly to new areas, resulting in a loss of influence over vast geographic regions. Scientists have been attempting to understand how plants interact with populations of fungi, bacteria, as well as other microbes. Molecular technologies have enabled a more comprehensive inventory of pathogens associated with specific crops, as well as the impact of environmental factors which can influence these populations. Disease is occurred by the association of a pathogen and a host plant, and the crop resistance to the pathogen can be studied (Boyd and O’Toole, 2012; Dracatos et al., 2018).

Use of Conventional and Molecular Technologies

245

Both natural as well as induced mutations have the potential to alter the interaction between the crop and pathogen and it inhibit the specific steps of the infection. The emergence of new stresses requires the creation of innovative ways to improve the ability of Different varieties of rice to withstand multiple pathogen attacks at the same time enabling also to survive in opposite environment while maintaining good quality of grains. The complete genome sequence available has paved the way for a new era for plant resistance management program. In plant resistance management, genomic studies based upon the single nucleotide polymorphism and the different available molecular marker techniques are becoming more common, resulting in high throughput data that can be used to identify quantitative trait loci (QTL). 15.2 BACTERIAL FOOT ROT DISEASE Bacterial foot rot is a disease complex caused by several genera of gramnegative bacteria, with Dickeya being the well-studied. In Japan, a bacterial rice disease known as “bacterial foot rot” was discovered. In the beginning of the disease the Brown sheath rot was formed and it get spread by ligule regions. The lesions spread rapidly to nodes, culms, and eventually crowns. The systematic invasion of neighboring tillers of the same crown resulted in foot rot symptoms. Young tissues of contaminated tillers produced a soft rot with an unpleasant odor. Many tillers had decayed to the point that entire diseased plants could be easily removed with a slight pull in the advanced stage. The symptoms were similar to those caused by the rice stem borer or the bacterial leaf blight (BLB) symptom known as “kresek.” 15.2.1 PATHOGEN Dickeya species comes under the world’s 10 very important bacterial plant pathogen, in China from 2007, Dickeya species were specified as a plant Quarantine pest (Liu et al., 2007; Mansfield et al., 2012). The eight different species among these genera are D. dadbatuu, D. chrysanthemi, D. soani, D. aquatic, D. dianthicola, D. paradisiacal, D. fangzhongdai and D. zeae (Samson et al., 2005; Parminson et al., 2014). The growth of the bacteria takes place at the broad range of temperature, i.e., from 10°C to 40°C and the optimum temperature for the maximum growth is from 30–35°C.

246

Bacterial Diseases of Rice and Their Management

15.2.2 HISTORY AND DISTRIBUTION Dickeya zeae, earlier known as Erwinia chrysanthemi, is a pathogenic agent of foot rot disease of rice plants across various countries of the world. The agricultural economy was severely affected by this disease intemperate, subtropical as well as in tropical zones, specifically in the different regions of Asian countries where the production of rice is high, for example, India, Japan, Bangladesh, and Malaysia. 15.2.3 HOST RANGE The main dicotyledonous host infected by the D. zeae phytopathogen which were reported worldwide are (Philodendron, Potato, Chrysanthemum, and tobacco) and major monocotyledonous host are Rice, Pineapple, Banana, and Hyacinth (Zang et al., 2014; Sinha, 1977; Goto, 1979; Liu and Wan, 2004; Jafra et al., 2008). 15.2.4 MOLECULAR IDENTIFICATION Dickeya zeae was identified as the pathogen through Biology recognition and multi-gene (16S rDNA, gyrB, and dnaX) sequence analysis (Zhou et al., 2015). The pathogen has a 4,532,364-bp chromosome with 4,154 predicted protein-coding genes. 15.3 VIRULENCE FACTORS AND PHYTOTOXINS Genus Dickeya bacteria massively produce extracellular degradative enzymes, such as pectate lyases, cellulases, polygalacturonases, and proteases, as major virulence factors to rapidly destroy the cell tissues and invade host plants (Hugouvieux et al., 1996; Reverchon et al., 2010). The infection rate of the D. zeae species towards both dicotyledons and monocotyledons shows the presence of virulence factors. The Common virulence factors present in the pathogen responsible for the bacterial virulence are siderophores, indigoidine pigment, cell wall degrading enzymes (CDEs) and type 3 secretion system (T3SS) (Collomer et al., 1994; Reverchan et al., 2002; Yap et al., 2005). Apart from those extracellular polysaccharides (EPS), Phytotoxins are also found on a variety of host plants which were also considered as an important virulence

Use of Conventional and Molecular Technologies

247

factor. Two phytotoxins similar to antibiotics known as zeamine and zeamine II have been linked to the germination of rice seed, and genes involved in zeamine formation, zmsK, and zmsA, are completely characterized. Two phytotoxins, zeamine and zeamine II, have potent antimicrobial properties as well as a negative impact on the germination of rice seed (Liao et al., 2014; Zhou et al., 2011). In the D. zeae rice strain the presence of Azms gene cluster was found after a phylogenetic analysis and genome sequence comparison, which encodes the biosynthesis of zeamine phytotoxins that inhibit the growth and germination of rice seed (Zhou et al., 2011, 2016). The zms gene cluster encodes zeamine production, and knocking out zmsA, which encodes a polyketide synthase, eliminated zeamine production and bacterial virulence on seeds of rice (Cheng et al., 2013). Significantly, the cluster of zms gene, which is taking part in zeamine synthesis and has previously been identified as a key virulence determinant, is found in D. zeae strains which has been isolated from the rice. Earlier research associated with the virulence factors of D. zeae rice strains focused on the zeamine biosynthesis gene cluster (Wu et al., 2010; Zhou et al., 2011; Chaing et al., 2013), zeamine biosynthesis-related transcription factors SlyA (Zhoy et al., 2016) and Fis (Lv et al., 2018), as well as the acyl homoserine­ lactone regulated quorum-sensing system (Hussain et al., 2008), zeamine biosynthesis gene. 15.4 GENERAL METHOD TO CONTROL THE FOOT ROT DISEASE 15.4.1 CULTURAL METHOD Cultural methods and Phytosanitary are the techniques used from the historical time to combat the foot rot disease of rice. 15.4.2 CHEMICAL CONTROL The use of chemicals is usually not recommended for the eradication of the foot rot because of the high risk of harmful chemicals left in the environ­ ment and causing a threat to the health of human beings. As seed treatments (STs) and foliar sprays, this compound was very effective in controlling this rice disease. It had both protective as well as curative properties (Hikichi, 1993). Just 3% of seedlings treated with oxolinic acid showed measurable signs after treatment, compared to 92 percent of seedlings from untreated

248

Bacterial Diseases of Rice and Their Management

plants, according to a study using FITC-conjugated antibody and fluorescens microscopy (Hikichi, 1995). 15.4.3 BIOLOGICAL CONTROL The use of biological methods for the cure of foot rot disease is mostly recommended. The biological control technique is based on the utilization of the antagonistic microbes and pre or post infection is the important aspect of the biological control strategy for diseases of plants. To prevent crop from soil borne diseases the synthetic biological control agents were developed and STs and soil alterations are done. The most frequently used species in biological control are Bacillus subtilis and Pseudomonas spp., as well as Gliocladium virens fungi and Trichoderma spp. 15.5 DISEASE MANAGEMENT: CONVENTIONAL CONTROL OF PATHOGEN LEADING TO RESISTANCE IN RICE In spite of the limitations, conventional or traditional techniques are still useful for preserving germplasm, genetic variations, and mutations (Werner et al., 2005). The most commonly used traditional methods are mutation breeding method, backcrossing and repeated selection method. Earlier the conventional breeding program were based upon the identification of mutant alleles for the resistance as well as their injection into the genotype by breeding technique, But the drawback of this process is that it allows the insertion of complete genome rather than the single gene. Nonetheless conventional breeding was used for the production of novel crop verities from era and it was known that the breeding methods like mutation are very effective in enhancing the resistance power or crop against the diseased pathogen. Where a particular host gene allele confers resistance to a specific pathotype, the possibility of mutagenesis is a single among the desired gene sequence. 15.6 DISEASE MANAGEMENT: MOLECULAR APPROACH LEADING TO RESISTANCE IN RICE The quality and the yield of the rice is severely affected by the Footrot disease of rice caused by pathogenic bacteria D. zeae. It was first discovered in Japan

Use of Conventional and Molecular Technologies

249

as compared to Conventional approach the molecular marker associated with traits give better selection and to add the transfer of resistance to cultivars. New breeding Technology is center of attraction for plant research in various areas like plant pathogen resistance, abiotic stress tolerance and developmental plant biology (Nelson et al., 2018). 15.6.1 ROLE OF MIRNA miRNA is an important component of plant defense machinery and it plays key role in disease resistance (Navaro et al., 2006; Ombdbakhshfard et al., 2005). Plant micro-RNA have 21–24 nucleotide and it comes under non-protein coding RNAs. After the occurrence of bacterial infection, a large number of miRNA and its putative genes were found involved in the biosynthesis of hormones and signal transduction pathways in rice (Zhang et al., 2011; Hang et al., 2015). Plant immune system is divided into two main areas, the very first is the pathogen associated molecular pattern (PAMP) triggered immunity (PTI) and the second line of defense is pathogen effectortriggered immunity (ETI), which works basically through R-proteins consist of leucine-rich region and nucleotide binding sites (NLR). The identification of involvement of miRNA in plant immune system is made possible through sequencing techniques. The biological process and stress response in plants are controlled by mi RNA (Sunkar et al., 2005; Castillo et al., 2017). Pathogen infection is responsible for the variable expression of miRNA (Liu et al., 2014). The participation of miRNAs against the resistance towards the D. zeae was reported in rice (Wenqi-Li et al., 2019). 15.6.2 GENOME EDITING TECHNOLOGY One of the most important recent technologies for increasing the resistance power of the rice crop against pathogenic infection is genome editing (Mohanta et al., 2017). The main enzyme, Nucleases plays a vital role in the editing of the genome organization. The major important nucleases are Zinc finger nuclease, Meganucleases, transcription activator-like (TAL) effector nucleases and the clustered regularly interspaced short palindrome repeats (Virginia et al., 2018) Among them CRISPR/Cas 9 is a recent technique. For the specific gene insertion and homology directed recombination the RNAase activity of Cas9 plays a very important role. Polycistronic PTG

250

Bacterial Diseases of Rice and Their Management

tRNA–gRNA. In the rice crop Polycistronic PTG tRNA–gRNA based Mega genome editing was reported and the insertion of introns (Ding et al., 2018). Cas 9 sequences gives the cRNA transcription. In rice the Multiplex PTG /Cas9 systems can help with multigene family analysis as reported for the closely related mitogen activated protein kinases MPK1 and MPK6 (Minkenberg et al.). The possibility of programming the PTG /Cas 9 to delete chromosomal fragments could be adopted to remove genes and regulatory elements in order to produce transgenic free plants. 15.6.3 PLANT TRANSFORMATION The gene transfer method used for the insertion of gene sequence in rice is Agrobacterium-mediated transformation and biolistic methods (Baysal et al., 2016). For the CRISPR-mediated host resistance, the template DNA is injected through the biolistic method for the multiplication of copy number in the host. The CRISP/Cas is an emerging technology widely used to meet several agricultural challenges, like increasing the resistance against the biotic stress (Arora and Narula, 2017). 15.7 CONCLUSION Bacterial diseases lead to the loss of world productivity of about 20%–40%. Various biotic and abiotic factors responsible for the loss of rice produc­ tivity throughout the world. The proper measures are necessary to be done to eradicate the abiotic and biotic stress that leads to the reduction in the quality and yield of the rice. Conventional Breeding techniques for the resistance enhancement against the bacterial diseases take a long time. The presence of the Molecular Marker assisted techniques pawed the way towards the advancement of breeding of rice. Molecular techniques are the most appropriate methods used for the transfer of the gene of interest into the rice crop plant. Genome editing has introduced a new method for transferring a desired gene into a rice variety with the appropriate combination. Genome editing has also opened up new opportunities for improving crop resistance. Multiple resistant genes can be inserted into the genome of the rice which can give rice variety having the high yield, resistance power against biotic and abiotic stress and the rice with high nutritional value.

Use of Conventional and Molecular Technologies

251

ACKNOWLEDGMENT Authors are highly grateful to Dr. Rajendra Mehta, Dr. Shivampriya, Dr. A. K. Singh and Dr. Manuraj Pandey for their support to complete this chapter. KEYWORDS • • • • • • • •

bacterial foot rot CRISPR/Cas9 Dickeya zeae genome editing miRNA nucleotide binding sites quantitative trait loci virulence factors

REFERENCES Baldrich, P., & San, S. B., (2016). MicroRNAs in rice innate immunity. Rice, 9, 6. Baysal, C., Bortesi, L., Zhu, C., Farré, G., Schillberg, S., & Christou, P., (2016). CRISPR/Cas9 activity in the rice OsBEIIb gene does not induce off-target effects in the closely related paralog OsBEIIa. Mol. Breed., 36, 108. Cheng, Y. Y., Liu, X. L., An, S. W., Chang, C. Q., Zou, Y. Q., Huang, L. H., Zhong, J., et al., (2013). A nonribosomal peptide synthase containing a standalone condensation domain is essential for phytotoxin zeamine biosynthesis. Mol. Plant–Microbe Interact., 26, 1294–1301. Cheng, Y., Liu, X., An, S., Chang, C., Zou, Y., Huang, L., et al., (2013). A nonribosomal peptide synthase containing a stand-alone condensation domain is essential for phytotoxin zeamine biosynthesis. Molecular Plant-Microbe Interactions, 26(11), 1294–1301. Collmer, A., & Bauer, D. W., (1994). Erwinia chrysanthemi and Pseudomonas syringae: Plant pathogens trafficking in extracellular virulence proteins. Curr. Top. Microbiol. Immunol., 192, 43–78. Ding, D., Chen, K., Chen, Y., Li, H., & Xie, K., (2018). Engineering introns to express RNA guides forCas9- and Cpf1-mediated multiplex genome editing. Mol. Plant., 11, 542–552. Goto, M., (1979). Bacterial foot rot of rice caused by a strain of Erwinia-Chrysanthemi. Phytopathology, 69(3), 213–216. Hugouvieux-Cotte-Pattat, N., Condemine, G., Nasser, W., & Reverchon, S., (1996). Regulation of pectinolysis in Erwinia chrysanthemi. Annu. Rev. Microbiol., 50, 213–257.

252

Bacterial Diseases of Rice and Their Management

Jafra, S., Przysowa, J., Gwizdek-Wiśniewska, A., & Van, D. W. J. M., (2008). Potential of bulb-associated bacteria for biocontrol of hyacinth soft rot caused by Dickeya zeae. J. Appl. Microbiol., 106, 68–77. Li, S. J., Castillo-González, C., Yu, B., & Zhang, X. R., (2017). The functions of plant small RNAs in development and in stress responses. Plant J., 90, 654–670. Liao, L. S., Cheng, Y. Y., Liu, S. Y., Zhou, J. N., An, S. W., Lv, M. F., Chen, Y. F., et al., (2014). Production of novel antibiotics zeamines through optimizing Dickeya zeae fermentation conditions. PLoS One, 9. Liu, G., (2007). List of plant quarantine pests in the people’s republic of China. Pestic Mark Inf., 3, 40, 41. Liu, Q. G., & Wang, Z. Z., (2004). Infection characteristics of Erwinia chrysanthemi pv. zeae on rice. J. S. China Agric Univ., 25, 55–57. Liu, W. D., Liu, J., Triplett, L., Leach, J. E., & Wang, G. L., (2014). Novel insights into rice innate immunity against bacterial and fungal pathogens. Annu. Rev. Phytopathol., 52, 213–241. Lv, M. F., Chen, Y. F., Liao, L. S., Liang, Z. B., Shi, Z. R., & Tang, Y. X., (2018). Fis is a global regulator critical for modulation of virulence factor production and pathogenicity of Dickeya zeae. Scientific Reports., 8(1), 341. Mansfield, J., Genin, S., Magori, S., Citovsky, V., Sriariyanum, M., Ronald, P., Dow, M., et al., (2012). Top 10 plant pathogenic bacteria in molecular plant pathology. Mol Plant Pathol., 13, 614–29. Minkenberg, B., Xie, K., & Yang, Y., (2017). Discovery of rice essential genes by characterizing aCRISPR-edited mutation of closely related rice MAP kinase genes. Plant J., 89, 636–648. Mohanta, T. K., Bashir, T., Hashem, A., Allah, E., & Bae, H., (2017). Genome editing tools in plants. Genes, 8, 399. Navarro, L., Dunoyer, P., Jay, F., Arnold, B., Dharmasiri, N., Estelle, M., Voinnet, O., & Jones, J. D., (2006). A plant miRNA contributes to antibacterial resistance by repressing auxin signaling. Science, 312, 436–439. Nelson, R., Wiesner-Hanks, T., Wisser, R., & Balint-Kurti, P., (2018). Navigating complexity to breed disease-resistant crops. Nat. Rev. Genet., 19, 21–33. Omidbakhshfard, M. A., Proost, S., Fujikura, U., & Mueller-Roeber, B., (2015). GrowthRegulating Factors (GRFs): A small transcription factor family with important functions in plant biology. Mol. Plant., 16, 998–1010. Parkinson, N., Devos, P., Pirhonen, M., & Elphinstone, J., (2014). Dickeya aquatica spnov., isolated from waterways. Int J Syst Evol Microbiol., 64(7), 2264–2266. Reverchon, S., Rouanet, C., Expert, D., & Nasser, W., (2002). Characterization of indigoidine biosynthetic genes in Erwinia chrysanthemi. Mol Microbiol., 29, 1407–1418. Reverchon, S., Van, G. F., Effantin, G., Zghidi-Abouzid, O., & Nasser, W., (2010). Systematic targeted mutagenesis of the MarR/SlyA family members of Dickeya dadantii 3937 reveals a role for MfbR in the modulation of virulence gene expression in response to acidic pH. Mol. Microbiol., 78, 1018–1037. Samson, R., Legendre, J. B., Christen, R., Fischer-LeSaux, M., Achouak, W., & Gardan, L., (2005). Transfer of Pectobacterium chrysanthemi (Burkholder et al.1953) Brenner et al. 1973 and Brenneria paradisiaca to the genus Dickeya gen. nov. as Dickeya chrysanthemi comb. Nov. and Dickeya paradisiaca comb. nov. and delineation of four novel species, Dickeyadadantii sp. nov., Dickeyadianthicola sp. Nov., Dickeya dieffenbachiae sp. Nov. and Dickeya zeae sp. Nov. Int. J. Syst. Evol. Microbiol., 5(4), 1415–1427.

Use of Conventional and Molecular Technologies

253

Sinha, S. K., & Prasad, M., (1977). Bacterial stalk rot of maize, its symptoms and host-range. Zentralbl Bakteriol Parasitenkd Infektionskr Hyg., 132, 81–88. Sunkar, R., Girke, T., Jain, P. K., & Zhu, J. K., (2005). Cloning and characterization of microRNAs from rice. Plant Cell, 17, 1397–1411. Virginia, M. G. B., Vittoria, B., Peter, R., Adriano, M., & Alessandra, L., (2018). The enhancement of plant disease resistance using CRISPR/Cas9. Frontiers Plant Science. Wenqi, L., Yulin, J., Fengquan, L., Fangquan, W., Fangjun, F., Jun, W., Jinyan, Z., & et al., (2019). Integration analysis of small RNA and degradome sequencing reveals MicroRNAs responsive to Dickeya zeae in resistant rice. Int. J. Mol. Sci., 20(1), 222. Wu, J., Zhang, H. B., Xu, J. L., Cox, R. J., Simpson, T. J., & Zhang, L. H., (2010). (13)C labeling reveals multiple amination reactions in the biosynthesis of a novel polyketide polyamine antibiotic zeamine from Dickeya zeae. Chemical Communications, 46, 333. Yap, M. N., Yang, C. H., Barak, J. D., Jahn, C. E., & Charkowski, A. O., (2005). The Erwinia chrysanthemi typeIII secretion system is required for multicellular behavior. J. Bacteriol., 187, 639–648. Zhang, J. X., Lin, B. R., Shen, H. F., & Pu, X. M., (2013). Genome sequence of the banana pathogen Dickeya Zeae strain MS1, which causes bacterial soft rot. Genome Announc. 13, 1(3), e00317–13. Zhang, J. X., Shen, H. F., Pu, X. M., & Lin, B. R., (2014). Identification of Dickeya zeae as a casual-agent of bacterial soft rot in banana in China. Plant Dis., 98(4), 436–442. Zhou, J. N., Zhang, H. B., Lv, M. F., Chen, Y. F., Liao, L. S., & Cheng, Y. Y., (2016). SlyA regulates phytotoxin production and virulence in Dickeya zeae EC1. Molecular Plant Pathology, 17(9), 1398–1408. Zhou, J. N., Zhang, H. B., Lv, M. F., Chen, Y. F., Liao, L. S., Cheng, Y. Y., Liu, S. Y., et al., (2016). SlyA regulates phytotoxin production and virulence in Dickeya zeae EC1. Mol. Plant Pathol., 17(9), 1398–1408. Zhou, J. N., Zhang, H. B., Wu, J. E., Liu, Q. G., Xi, P. G., Lee, J., Liao, J. L., et al., (2011). A novel multidomain polyketide synthase is essential for zeamine production and the virulence of Dickeya zeae. Mol. Plant–Microbe Interact., 24, 1156–1164. Zhou, J., Zhang, H., Wu, J., Liu, Q., Xi, P., & Lee, J., (2011). A novel multidomain polyketide synthase is essential for zeamine production and the virulence of Dickeya zeae. Molecular Plant-Microbe Interactions, 24(10), 1156–1164.

CHAPTER 16

Bioagents and Volatile Organic Compounds: An Emerging Control Measures for Rice Bacterial Diseases NITESH SINGH,1 GITANJALI JIWANI,2 LAYZA S. ROCHA,3 and RODIN MAZAHERI4 Department of Bioscience, UIBT, Chandigarh University, 140413, Mohali, India E-mail: [email protected]

1

National Institute for Plant Biotechnology (NIPB), New Delhi–110012, India

2

Group of Spectroscopy and Bioinformatics Applied Biodiversity and Health (GEBABS), Federal University of Mato Grosso do Sul, 549, Campo Grande–790709-00, MS, School of Medicine of Federal University of Mato Grosso do Sul, Brazil

3

Biological Sciences Department, Middle East Technical University (Orta Dogu Teknik Universitesi Middle East Technical University–06800), Turkey

4

ABSTRACT Rice (Oryza sativa L.) is consumed by roughly half population of the world. In any case, rice efficiency has been influenced because of exhaustion of horticultural land, decrease in groundwater levels, different kinds of natural and abiotic stresses, environmental change, and a worldwide temperature alteration. Therefore, rice productivity should be helped by remembering the important aspects associated with the expansion of constant efforts toward new science. In case of metabolomics, efforts have focused on improving Bacterial Diseases of Rice and Their Management. Deepti Srivastava, Md. Shamim, Malik Mobeen Ahmad, & K. N. Singh (Eds.) © 2023 Apple Academic Press, Inc. Co-published with CRC Press (Taylor & Francis)

256

Bacterial Diseases of Rice and Their Management

quality and on yield-related characteristics of rice. On a global level, biopesticides are gaining wide popularity by their environmentally benign nature and target specificity. The harm caused mainly by the haphazard use of chemical fertilizers and insecticides in the rice field. Various forms of pesticides, in rice fields, are now considered to cause major problems. In such a circumstance where chemicals have caused or are causing irreparable impacts, the use of biopesticides or bioagents has emerged as a viable option that contributes to healthy organic agriculture. Owing to its effective role as bioactive compounds present in it, traditional medicinal use of plants has gained global recognition since ancient times. May be in many ways Bioac­ tive compounds improve plant resistance to phytopathogens. Rhizosphere micro-organism compounds and enzymes function as biocatalysts in impor­ tant metabolic reactions and are known for their ability to promote plant growth and regulate phytopathogens. Microbial enzymes like chitinase, lipase, laccase, antibiotics, and many others play an essential role in biocon­ trol activity against phytopathogens. Bioactive compounds can increase the resistance of plants to phytopathogens by various means. A compound produced by plants such as phenolic compounds, alkaloid compounds and others during secondary metabolism demonstrated high potential bioagents for antibacterial use. This chapter addresses the antibacterial potential of plants from different families and micro-organisms with their major phyto­ chemicals, active principles, and chemical structures are discussed. The analysis will be important in the management of rice bacterial diseases, and future work will concentrate on the technical perspectives needed in agricul­ ture for the long-term sustainability of biological control products utilizing conventional plant medicinal values. 16.1 INTRODUCTION Due to emergence of modern crop diseases, progress in advancement of bacterial pathogens insensitive to antibiotics. This has forced plant scientists to seek natural products for the secure growth to meet the future needs. Studies on medicinal natural products are desired to give the elementary knowledge for the global bacterial difference and dissemination assessment. Phyto­ pathogens have constantly hampered the production of crops, these include nematodes, viruses, bacteria, and fungi which leads to major economic losses (Velasquez, 2018; Cheng et al., 2019). Microbes damage average 20–25 percent of total global agricultural output, as per an estimate, which deprive 800 million population from sufficient food (Strange, Richard, and Peter,

Bioagents and Volatile Organic Compounds

257

2005; Grafton et al., 2015). Herbivory is responsible for disruption in plant tissue which reduce the yield. On interaction of plant and herbivore only few reports have been published till now (Uemura, Takuya, and Gen-Ichiro, 2019). The pathogen and damage-associated molecular pattern (PAMPs/ DAMPs) found on the surface with pathogens induce the defensive response or detection of effectors translocated to a host organism by the pathogen with leads to stop the spread of pathogen (Macho et al., 2012; Yu et al., 2017). In one of the studies, it has been stated that Niclosamide with molluscicide is significant in inhibiting the leaf blight caused in rice by Xanthomonas oryzae pv. orzae, it is also used to treat tapeworm infection (Kim et al., 2016). With varying degrees of effectiveness, various methods used for regu­ lating plant pathogens have been formulated for more than over a century. Attempting to prevent plant diseases from crops has always been challenging. Amongst many of them, chemical control on group of synthetic products have always been the cornerstone of crop defense. Synthetic biopesticides have become famous as an effective means of controlling crop pests because of its instant effectiveness and ease of application. The modern agriculture approach is to eradicate the crop disease with green approaches without destruction of ecosystem and human health. As phytopathogens result in human health damage and ecosystem destruction (Aktar, 2009; Zhang, Haitao, and Shiping, 2013). Exposure of Synthetic pesticides on ecosystem as well as on human health has been realized by the WHO (World Health Organization) and commented that millions of agriculture workers die every year due to poisoning by crop and pest pesticides, on the other hand loss of ecosystem, biodiversity, groundwater pollution and soil fertility are also affected (Ozkara et al., 2016; Gill, Harsimran, and Harsh, 2014). Rice production is majorly affected by bacterial blight (BB). Several diseases including BB contribute vastly in reducing the average productivity. Observing the threat level, several strategies have been adopted and tested to control bacterial rice diseases, such as agricultural practices, chemical treat­ ments, biological control, disease forecasting, and genetic resistance of host plant. “None of them have been able to control the disease entirely, however, host genetic improvement has shown greater potential. Therefore, there is a need to look for alternative strategies to combat BB. The use of plant extracts and biological agents (BCA) has been shown to be more effective than other methods of chemical control for eradication of phytopathogens. Plants are a major source of medicine with a variety of biological deliberations, including antioxidant, antibacterial, and antifungal activities. Natural product discovery has played a major role in the search for novel bioactive molecules. Natural product discovery of plants has opened

258

Bacterial Diseases of Rice and Their Management

a new avenue to find novel bioactive compounds which can be effective against phytopathogens, because plants are considered as an outstanding source of bioactive natural products. Almost 25% of conventional drugs and primary health care of the majority of the world population relies essentially on plants (Ekor, 2014; Mansoori et al., 2020). “Interestingly, plant-based biocides are non-phytotoxic, comparatively harmless, systemic, and easily biodegradable compared to chemotherapeutics. However, many plants avail­ able around the globe, specifically for phytopathogens, are not well studied for their antimicrobial properties. However, some interesting research has been carried out, and publications are also available in the public domain, which mainly describe the significance of the ethnomedicinal plants with regard to the conventional treatment method. Evidence suggests that plant based natural substances are more effective in controlling pathogens (Hadacek, 2002; Dixon, 2001; Mishra et al., 2020). In plant disease control against phytopathogens, detailed ethnomedicinal information has not been studied. Later studies on the use of microorganisms have shown to be more effec­ tive on plant-microbe interaction (Tsujibo et al., 2003; Lucy et al., 2004). There is substantial scope for control of plant pathogens by environmental friendly approaches to establish the sustainability of agricultural produc­ tion. Enormous studies have shown that use of microorganisms, plant extracts by producing enzymes, volatile organic compounds such as various allelochemicals, and other biological control agents for the management of phytopathogens effectively. Taking into account the environmental and gene regulation factors, it is essential to have information on the modes of action of these metabolic pathways. Hence the main objective of this chapter is to focus specially on the secondary metabolites produced by microbes and plant extract targeting their physiological activities, production of compounds, and structures in biological control of rice bacterial pathogen (Figure 16.1; Table 16.1). 16.2 MICROBIAL ENZYMES AS BIOCONTROL The cell wall of many phytopathogens can be degraded by the microbial enzymes. Apart from this, the microbial enzymes have certain roles in food industries for various food products since ancient times. Use of natural bio­ control agent is one of the best methods to control plant pathogens. Using these also reduces the risk of harmful synthetic chemicals, which is one of the major causes of infertility in soil. The use of microbial enzymes is totally

Bioagents and Volatile Organic Compounds

259

environment friendly and natural. Specially the use of hydrolytic enzymes like chitin/chitosan. These enzymes are able to degrade the bacterial cell wall and causes cell lysis of bacterial pathogens. These enzymes affect the structural integrity of the cell wall of bacterial pathogens. It has been found that most of the enzymes of bacteria and fungus can degrade or modify the synthesis of cell wall in the host or phytopathogens (Bateman and Basham, 1976; Jadhav, 2017). In this context, mechanisms of control by microbial bioenzymes are described.

FIGURE 16.1 Diagrammatic representation of plant defense system and production of secondary metabolites in response to attack by insects, herbivores, pests, and phytopathogens.

16.2.1 CHITINOLYTIC BIOPOLYMER Chitin is somewhat similar to cellulose in structure and function. “Chitin is (1→4) β-linked N-acetyl-D-glucosamine (GlcNAc) which is 2nd most abun­ dant compound. It is distributed in living beings and responsible for selfdefense.” It is one of the notable enzymes which plays an important role in phytopathogens biocontrol. Chitosan is one of the polysaccharides which is

Name of Enzyme/Compound

Source

References

Flavonoids Cinnamon Monoterpene-Limonene Eugenol Azadirachtin Capsicine Mentha Piperine Jambosine Moringine Flavonoids Catechin Mangiferin Alkaloids Tannin Daturilin and withanolide carrageenans Chitosan, chitin (MAMPs) Allicin (diallyl thiosulfinate) Chumacin-1 and Chumacin-2 2,4-DAPG Eicosapentaenoic acid and Salicylic acid methyl ester

Opuntia ficus-indica Cinnamomum zeylanicum Curcuma longa Syzygium aromaticum Azadirachta indica Capsicum annuum Mentha piperita Piper nigrum Syzygium cumini Moringa oleifera Prosopis juliflora Saraca asoca Mangifera indica Aloe vera Rhizophora apiculata Datura metel Seaweeds Marine crustaceans (Crustacea) Allium sativum Pseudomonas aeruginosa Pseudomonas fluorescens Lantana camerana

Dib et al. (2013) Ranasinghe et al. (2013) Li et al. (2011); Lee et al. (2016) Bhowmik et al. (2012) Kumar et al. (2010) Ahuja and Ball (2006) İşcan et al. (2002) Ahmad et al. (2012) Afify et al. (2011) Anwar et al. (2007) Ibrahim et al. (2013) Mukhopadhyay, Manas, and Debjani (2011) Zou et al. (2014) Patel et al. (2012) Lakshmanan et al. (2019) Kagale et al. (2004) Arun et al. (2002) El-Hadrami et al. (2010) Slusarenko et al. (2008) Sirisha et al. (2019) Velusamy and Gnanamanickam (2003) Mansoori et al. (2020)

Bacterial Diseases of Rice and Their Management

SL. No. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22.

Some Effective Bioactive Compounds Reported Against Xanthomonas oryzae pv. oryzae

260

TABLE 16.1

SL. No. 23. 24. 25. 26.

(Continued) Source

References

Citrus limon Thespesia lampas – –

Bansode et al. (2012); Padmavati et al. (2017) Nitesh et al. (2021) Li et al. (2015) Shi et al. (2015)

27. 28. 29. 30. 31.

Naringenin Squalene 2-mercapto-5-substituted-1,3,4-oxadiazole/thiadiazole 2-(methylsulfonyl)-5-(4-fluorobenzyl)-1,3,4oxadiazole 5-phenyl sulfonate methyl 1,3,4-oxadiazole Phenazines Not identified Not identified Not identified

Wang et al. (2020) Sekizawa et al. (1965) Sharifah et al. (2020) Bala et al. (2017) Yousefi et al. (2018)

32. 33. 34. 35. 36. 37. 38. 39. 40. 41. 42.

Not identified Purpleputtu O-coumaric acid Thiazollidin-2-cyanamide derivatives Bisdemethoxycurcumin Dihydrocurcumin 1-hydroxy-phenazine, Phenazines and pyochellin Rhamnolipids 4-hydroxy-2-alkylquinolines 2,3,4-trihydroxy-2-alkylquinolines 1,2,3,4-tetrahydroxy-2-alkylquinolines

– – Piper sarmentosum Calendula officinalis Pseudomonas putida and Enterobacter sp. Bacillus sp., B. subtilis, Oryza rufipogon – – – Curcuma longa Curcuma longa Pseudomonas aeruginosa BRp3 Pseudomonas aeruginosa BRp3 Pseudomonas aeruginosa BRp3 Pseudomonas aeruginosa BRp3 Pseudomonas aeruginosa BRp3

Ram et al. (2011) Padmavati et al. (2017) Susu et al. (2017) Zeng et al. (2020); Tao et al. (2019) Joshi et al. (2020) Joshi et al. (2020) Yasmin et al. (2016); Abdallah et al. (2019) Yasmin et al. (2016) Yasmin et al. (2016) Yasmin et al. (2016) Yasmin et al. (2016)

261

Name of Enzyme/Compound

Bioagents and Volatile Organic Compounds

TABLE 16.1

262

Bacterial Diseases of Rice and Their Management

obtained from chitin and plays a very major role in defensive mechanism by activating plant defense system by inducing phenolic compounds like phyto­ alexins, lignin, and many others.” The full mechanism and exact evidence of chitosan in reducing plant disease is not known till now (Nunes da Silva et al., 2014; Kulikov et al., 2006). It is known for the induction of systematic acquired resistance by signaling cascade activity, also by the accumulation and activation of proteins and compounds involved in antimicrobial activity of defense. Chitosan is having biopolymer property, so because of this it forms physical barriers on the outer side of pathogens penetration site. This helps to prevent them from spread on healthy tissues (Kulikov et al., 2016). The use of different Pseudomonas spp. crude extract is effective against the disease caused by Xanthomonas oryzae pv. oryzae (Xoo). In extract of Starin BRp3 of Pseudomonas aeruginosa in which number of phytochemi­ cals like 4-hydroxy-2-alkylquinolines, rhamnolipids, 2,3,4-trihydroxy­ 2-alkylquinolines, including siderophores (pyocyanin, pyochelin, and 1-hydroxy-phenazine) and 1,2,3,4-tetrahydroxy-2-alkylquinolines (Yasmin et al., 2016, 2017) are found. “It acts as enhancer of defense-related (DR) enzymes present in the rice by increasing the straw yield and grain growth.” Lysobacter and Bacillus spp. are reported to be effective against the bacterial leaf blight (BLB) suppression in rice due to their effective leaf colonization, rapid growth, and easy application (Ji et al., 2008; Van Hop et al., 2014; Perez-Montano et al., 2014). Pseudomonas fluorescens, Pseudomonas putida, and Enterobacter sp. has capacity to produce large number of metabolites which exhibit antibacterial activity against Xanthomonas oryzae pv. oryzyze pathogen” (Yousefi et al., 2018; Velusamy and Gnanamanickam, 2003). 2,4-DAPG (2,4-diacetylphlo­ roglucinol), Chumacin-1 and Chumacin-2 are capable to inhibit rice bacte­ rial pathogens (Velusamy and Gnanamanickam, 2003; Sirisha et al., 2019). Conservation of a common wild rice variety Oryza rufipogon and Oryza glaberrima is very important for the future because in many of the articles it has been reported that it plays a major role in inhibition against different strains of BB in rice (Ajitha et al., 2020; Ram et al., 2011). 16.3 VARIOUS CLASS OF BIOACTIVE COMPOUNDS INVOLVED IN PLANT DEFENSE RESPONSES Primary metabolites from plant and its metabolism have a link with defense response in plants. It also acts as source of energy as well as signaling pathway which indirectly or directly act as source defense response. Several

Bioagents and Volatile Organic Compounds

263

classes of secondary metabolites are produced by different groups of families for plant defense. These metabolites protect them from abiotic and biotic stress (Rojas et al., 2014; Heuberger et al., 2014). Microbes and plants which are associated with proteins, carbohydrates, and lipids cascades signal transduction which leads to defense response in plants (Rojas et al., 2014). Multiple crop diseases can be controlled by a single plant essential oil or extracts because of the presence of many useful bioactive compounds. One particular bioactive compound from different plant essential oil, plant extract and microbial extracts are having promising role to control the microbial pathogen attacks (Jimenez-Garcia et al., 2013; Oliveira et al., 2020). In Era of pre and post multiple-omics technologies have been used to identify various class of secondary metabolites like alkaloids, phenolics, lipids, and carbohydrates they are known collectively from different plant sources as possible bioactive compounds which act as a source of elicitors in plant defense (Pappas et al., 2020; Szajdek and Borowska, 2008). Various groups of active metabolites described from varieties of plants are provided and addressed in subsections. 16.3.1 ALKALOID COMPOUNDS Alkaloids are those organic compounds in which nitrogen group is attached. There is no specific definition which fits for all alkaloids. They are divided into various groups which is on the basis of their chemical structure. They are generally present in different class of families most importantly like Apocynaceae, Liliaceae, Menispermaceae, Rutaceae, etc., and form about 20% of metabolites with lower molecular weight (Boit, 1961; Kaur and Arora, 2015). Different form of alkaloids are – tryptophan derived, Arginine derived, Ornithine derived, Histidine derived, Nicotinic derived, Lysine derived, Anthranilic acid derived, Tyrosine derived from protoalkaloid, true alkaloid and pseudo alkaloid are used from various purposes like health issues in human, plants as well as animals (Aniszewski, 2015; Chini et al., 1992). It has been reported that in dicot orders like Oleales, Fagales, Salicales, and Cucurbitales not even a single report has been found about the alkaloid presence (Evans, 2009; Hussein and El-Anssary, 2018). Many of the alkaloids are very toxic in nature and can cause death to living organisms like humans and animals. Few alkaloids are used as pesticides to kill insects pests (Seigler and John, 1995). The extract from aloe vera is a potential source of piperidine alkaloids to be used as antibacterial against rice BB (Patel et al., 2012). It has been reported that active natural constituents from Prosopis

264

Bacterial Diseases of Rice and Their Management

juliflora leaves is active against Xanthomonas pathovars (Raghavendra et al., 2009). In one of the studies, it has been mentioned that alkaloids from Solanum indicum, Albizia amara, Acacia catechu, Adenanthera pavonina, A. ferruginea, A. saman, Senna spectabilis and Breynia vitis-idaea is have a significant effect against Xanthomonas spp. and it could help in management of bacterial disease (Venkatesh et al., 2015). 16.3.2 FLAVONOIDS Secondary metabolite synthesis including flavonoids is having one of those mechanism which deal with the unfavorable natural environmental conditions like ozone depletion, drought, heavy metals, UV rays, drought stress, etc., which causes stress on plant as triggered by free radicals (Treutter, 2005). In whole plant flavonoid is synthesized and because of its cytotoxic nature they interact in different enzymes complex which protect plant against pathogens and insect pests (Koes, 1994; Salah et al., 2002). Flavonoids are able to reduce and quench the production of free radicals due to their lower redox potential (Cotelle et al., 1996; Arora et al., 2000; Buettner, 1993). There are two pathways – shikimic and malonic pathway from where the flavonoid emerges and act as survival and defense compounds in plants (Lamb et al., 1992; Dakora, 1995). It has been stated that tissues from pericarp and leaf crude extracts from purpleputtu has shown growth inhibition against Xanthomonas. Dihydro-quercetin and Naringenin is a dihydroflavonol and flavanone, respectively was found to be a significant effect against X. oryzae (Padmavati et al., 2017). Flavonoids from plant extracts like Opuntia ficusindica, and Prosopis juliflora act as biocontrol by inducing resistance of host through enhancing the activity of enzymes which plays a major role (Dib et al., 2013; Ibrahim et al., 2013). 16.3.3 TANNINS Tannins which are water soluble and 4th most abundant metabolite present on earth in relation to cellulose, hemi-cellulose, and lignin (Chowdhury et al., 2004; Haslam, 1989). Tannins have dual functions as they play a role in protecting plants from insect pests and pathogens. It also attracts insects for cross pollination towards flowers (Barbehenn et al., 2005; Bovy et al., 2007). As it has been found that condensed tannin is having a better activity against many bacteria and yeast (Sulaiman et al., 2011). It has

Bioagents and Volatile Organic Compounds

265

been also observed that Rhizophora apiculata is having significant effect against rice BB and Methyl 4-O-methyl-d-arabinopyranoside followed by 1,6,10,14-Hexadecatetraen-3,7,11,15-tetramethyl-, (E,E)–are abundant and attributed to antibacterial activity (Lakshmanan et al., 2019). 16.3.4 PHENOLICS Among secondary metabolites phenolics are one of the important bioactive molecules in plants which are synthesized from Shikimic and Phenylpropanoid Pathways which act as removal of reactive oxygen species (ROS) (de Araujo et al., 2021). There are several ways of mode of action of phenolic compounds to suppress microbes disease-causing factors like inhibition of nucleic acid synthesis, neutralize bacterial toxins, reduce host ligand interaction, inhibit biofilm formation (Górniak et al., 2019). In present scenario because of increasing biotech approaches with the help of elicitors one can improve the production and quality of secondary metabolites (Gadzovska et al., 2014; García-Mier et al., 2015; Sathiyabama and Parthasarathy, 2016; Panzella, 2020). Many of the plant crude extract and essential oils from different families helps to produce and grow much even in the stressful conditions and they are environment-friendly and the alternative of chemical treatment which are having adverse impact on the environment in the management of agriculture crop diseases (Leontopoulos et al., 2020; Pappalardo, 2020; Karalija et al., 2020). Many phenolic compounds proved to be effective against the Xoo. In this regards, Thiazollidin-2-cyanamide derivatives (Zeng et al., 2020; Tao et al., 2019), 2-(methylsulfonyl)-5-(4-fluorobenzyl)-1,3,4­ oxadiazole, 2-mercapto-5-substituted-1,3,4-oxadiazole/thiadiazole (Li et al., 2015; Shi et al., 2015), 5-phenyl sulfonate methyl 1,3,4-oxadiazole (Wang et al., 2020), phenazines (PHZ) (Sekizawa et al., 1965). O-coumaric acid (Susu et al., 2017) have significant inhibitory response against rice BB. 16.4 OVERVIEW OF SECONDARY METABOLITES ACTIVE AGAINST RICE PATHOGEN It is a lipid-soluble metabolite of different class which biosynthesized via mevalonate 1-deoxy-d-xylulose-5-phosphate pathway (Jimenez-Garcia et al., 2013). They are classified on the basis of isoprene units. Many types of terpenoids are present in nature few of them the most important are catalpol, euparotin, eupachlorin, rubescensin, and a few others are having promising

266

Bacterial Diseases of Rice and Their Management

role in pharmacological activities (Wu et al., 2020). In essential oil, terpenes are the major constituent which helps in the inhibition of phytopathogens and insect pests (Raveau et al., 2020; Dudai et al., 1999). Another research group stated that terpenes play major role in abiotic stress (Lee et al., 2015). Monoterpene like Limonene were detected to have a direct response in suppression of Xoo of rice (Lee et al., 2016). The Cinnamon, Azadirachtin, Capsicine, Mentha, Piperine, Jambosine, Moringine, Catechin, Mangiferin, Daturilin, and with anolide, carrageenan, Allicin (diallyl thiosulfinate), Bisdemethoxycurcumin, Dihydrocurcumin, Eicosapentaenoic acid, and Squalene (triterpene) from Cinnamomum zeylanicum (Ranasinghe et al., 2013), Azadirachta indica (Kumar et al., 2010), Capsicum annuum (Ahuja and Ball, 2006), Mentha (İşcan et al., 2002), Piper nigrum (Ahmad et al., 2012), Syzygium cumini (Afify et al., 2011), Moringa oleifera (Anwar et al., 2007), Saraca asoca (Mukhopadhyay, Manas, and Debjani, 2011), Mangifera indica (Zou et al., 2014), Datura metel (Kagale et al., 2004), Seaweeds (Arun et al., 2002), Allium sativum (Slusarenko et al., 2008), Curcuma longa (Joshi et al., 2020), Lantana camera (Mansoori et al., 2020) and Thespesia lamaps (Singh et al., 2021), respectively, which has been reported as significant effect against Xoo. 16.5 CONCLUSION The current chapter summarizes the bioactive compounds from plants and microbes active against the rice BB pathogens in rice. In recent years, bioac­ tive compounds derived from plants and microbes have gained interest in the management of plant pathogens. The use of secondary metabolites has a vast potential to replace synthetic chemical pesticides in the agriculture fields. These bioactive compounds can enhance the crops defense system. More focused research is required in this field as natural products are less toxic in nature, more stable and has no side effects. There is no other conventional method found to be effective in controlling the plant pathogens in crops up until now. There is an urgent need to search for environment friendly bioac­ tive molecules. ACKNOWLEDGMENT Nitesh Sing designed and prepared the rough draft of the chapter, Dr. Gitan­ jali Jiwani and Layza S. Rocha edited and corrected the chapter, Authors

Bioagents and Volatile Organic Compounds

267

thanks to Dr. Rodin Mazaheri for assisting with English language correc­ tions. Finally, all authors read and approved the chapter. KEYWORDS • • • • • • •

bacterial blight bioactive compound biological agents damage-associated molecular patter medicinal plants microbes microbial enzymes

REFERENCES Abdallah, Y., Yang, M., Zhang, M., Masum, M. M., Ogunyemi, S. O., Hossain, A., & Li, B., (2019). Plant growth promotion and suppression of bacterial leaf blight in rice by Paenibacillus polymyxa Sx3. Letters in Applied Microbiology, 68(5), 423–429. Afify, A. E. M. M., Fayed, S. A., Shalaby, E. A., & El-Shemy, H. A., (2011). Syzygium cumini (pomposia) active principles exhibit potent anticancer and antioxidant activities. African Journal of Pharmacy and Pharmacology, 5(7), 948–956. Ahmad, N., Fazal, H., Abbasi, B. H., Farooq, S., Ali, M., & Khan, M. A., (2012). Biological role of Piper nigrum L. (Black pepper): A review. Asian Pacific Journal of Tropical Biomedicine, 2(3), S1945-S1953. Ahuja, K. D., & Ball, M. J., (2006). Effects of daily ingestion of chilli on serum lipoprotein oxidation in adult men and women. British Journal of Nutrition, 96(2), 239–242. Ajitha, V., Laha, G. S., Sundaram, R. M., Anantha, M. S., Senguttuvel, P., Muralidhara, B., & Channappa, G., (2020). Identification and Introgression of Novel Bacterial Blight Resistance from Oryza Glaberrima Steud. https://doi.org/10.21203/rs.3.rs-1246576/v1. Aktar, W., Sengupta, D., & Chowdhury, A., (2009). Impact of pesticides use in agriculture: Their benefits and hazards. Interdisciplinary Toxicology, 2(1), 1–12. Aniszewski, T., (2015). Alkaloids: Chemistry, Biology, Ecology, and Applications. Elsevier. Anwar, F., Latif, S., Ashraf, M., & Gilani, A. H., (2007). Moringa oleifera: A food plant with multiple medicinal uses. Phytotherapy Research: An International Journal Devoted to Pharmacological and Toxicological Evaluation of Natural Product Derivatives, 21(1), 17–25. Arora, A., Byrem, T. M., Nair, M. G., & Strasburg, G. M., (2000). Modulation of liposomal membrane fluidity by flavonoids and isoflavonoids. Archives of Biochemistry and Biophysics, 373(1), 102–109.

268

Bacterial Diseases of Rice and Their Management

Arun Kumar, K., & Rengasamy, R. (2000). Antibacterial Activities of Seaweed Extracts/ Fractions Obtained Through a TLC Profile Against the Phytopathogenic Bacterium Xanthomonas Oryzae pv. Oryzae. 43(5), 417–421. https://doi.org/10.1515/BOT.2000.043. Bala, A., Rai, B., Priya, S., & Kumar, R., (2017). In vitro evaluation of various fungicides and plant extracts against Xanthomonas oryazae pv. oryzae isolated from rice (Oryza sativa L.). Int. J. Curr. Microbiol. App. Sci., 6(5), 421–427. Bansode, D. S., & Chavan, M. D., (2012). Studies on antimicrobial activity and phytochemical analysis of citrus fruit juices against selected enteric pathogens. International Research Journal of Pharmacy, 3(11), 122–126. Barbehenn, R., Cheek, S., Gasperut, A., Lister, E., & Maben, R., (2005). Phenolic compounds in red oak and sugar maple leaves have prooxidant activities in the midgut fluids of Malacosoma disstria and Orgyia leucostigma caterpillars. Journal of Chemical Ecology, 31(5), 969–988. Bateman, D. F., & Basham, H. G., (1976). Degradation of plant cell walls and membranes by microbial enzymes. In: Physiological Plant Pathology (pp. 316–355). Springer, Berlin, Heidelberg. Bhowmik, D., Kumar, K. S., Yadav, A., Srivastava, S., Paswan, S., & Dutta, A. S., (2012). Recent trends in Indian traditional herbs Syzygium aromaticum and its health benefits. Journal of Pharmacognosy and Phytochemistry, 1(1), 13–22. Boit, H. G., (1961). Results of Alkaloid Chemistry up to 1960, with Special Reference to the Progress Since 1950. Akademie-Verlag. Bovy, A., Schijlen, E., & Hall, R. D., (2007). Metabolic engineering of flavonoids in tomato (Solanum lycopersicum): The potential for metabolomics. Metabolomics, 3(3), 399–412. Buettner, G. R., (1993). The pecking order of free radicals and antioxidants: Lipid peroxidation, α-tocopherol, and ascorbate. Archives of Biochemistry and Biophysics, 300(2), 535–543. Cheng, Y. T., Zhang, L., & He, S. Y., (2019). Plant-microbe interactions facing environmental challenge. Cell Host & Microbe, 26(2), 183–192. Chini, B., Clementi, F., Hukovic, N., & Sher, E., (1992). Neuronal-type alpha-bungarotoxin receptors and the alpha 5-nicotinic receptor subunit gene are expressed in neuronal and nonneuronal human cell lines. Proceedings of the National Academy of Sciences, 89(5), 1572–1576. Choudhary, P., Aggarwal, P. R., Rana, S., Nagarathnam, R., & Muthamilarasan, M. (2021). Molecular and metabolomic interventions for identifying potential bioactive molecules to mitigate diseases and their impacts on crop plants. Physiological and Molecular Plant Pathology, 114, 101624. Chowdhury, S. P., Khanna, S., Verma, S. C., & Tripathi, A. K., (2004). Molecular diversity of tannic acid degrading bacteria isolated from tannery soil. Journal of Applied Microbiology, 97(6), 1210–1219. Cotelle, N., Bernier, J. L., Catteau, J. P., Pommery, J., Wallet, J. C., & Gaydou, E. M., (1996). Antioxidant properties of hydroxy-flavones. Free Radical Biology and Medicine, 20(1), 35–43. Dakora, F. D., (1995). Plant flavonoids: Biological molecules for useful exploitation. Functional Plant Biology, 22(1), 87–99. De Araújo, F. F., De Paulo, F. D., Neri-Numa, I. A., Dias-Audibert, F. L., Delafiori, J., De Souza, F. G., & Pastore, G. M., (2021). Influence of high-intensity ultrasound on color, chemical composition and antioxidant properties of araçá-boi pulp. Food Chemistry, 338, 127747.

Bioagents and Volatile Organic Compounds

269

Dib, H., Beghdad, M. C., & Belarbi, M., (2013). Phytochemical study of Algerian Opuntia Ficus-indica. Annals of Biological Research, 4(2), 185–189. Dixon, R. A., (2001). Natural products and plant disease resistance. Nature, 411(6839), 843–847. Dudai, N., Poljakoff-Mayber, A., Mayer, A. M., Putievsky, E., & Lerner, H. R., (1999). Essential oils as allelochemicals and their potential use as bioherbicides. Journal of Chemical Ecology, 25(5), 1079–1089. Ekor, M., (2014). The growing use of herbal medicines: Issues relating to adverse reactions and challenges in monitoring safety. Frontiers in Pharmacology, 4, 177. El Hadrami, A., Adam, L. R., El Hadrami, I., & Daayf, F., (2010). Chitosan in plant protection. Marine Drugs, 8(4), 968–987. Evans, W. C., (2009). Trease and Evans’ Pharmacognosy E-Book. Elsevier Health Sciences. Fan, S., Tian, F., Li, J., Hutchins, W., Chen, H., Yang, F., & He, C., (2017). Identification of phenolic compounds that suppress the virulence of Xanthomonas oryzae on rice via the type III secretion system. Molecular Plant Pathology, 18(4), 555–568. Gadzovska, S. S., Tusevski, O., Maury, S., Delaunay, A., Joseph, C., & Hagège, D., (2014). Effects of polysaccharide elicitors on secondary metabolite production and antioxidant response in Hypericum perforatum L. shoot cultures. The Scientific World Journal, 2014. Garcia-Mier, L., Jimenez-Garcia, S. N., Guevara-González, R. G., Feregrino-Perez, A. A., Contreras-Medina, L. M., & Torres-Pacheco, I., (2015). Elicitor mixtures significantly increase bioactive compounds, antioxidant activity, and quality parameters in sweet bell pepper. Journal of Chemistry, 2015. Gill, H. K., & Garg, H., (2014). Pesticide: Environmental impacts and management strategies. Pesticides-Toxic aspects, 8, 187. Górniak, I., Bartoszewski, R., & Króliczewski, J., (2019). Comprehensive review of antimicrobial activities of plant flavonoids. Phytochemistry Reviews, 18(1), 241–272. Grafton, R. Q., Daugbjerg, C., & Qureshi, M. E., (2015). Towards food security by 2050. Food Security, 7(2), 179–183. Hadacek, F., (2002). Secondary metabolites as plant traits: Current assessment and future perspectives. Critical Reviews in Plant Sciences, 21(4), 273–322. Haslam, E., (1989). Plant Polyphenols: Vegetable Tannins Revisited. CUP Archive. Heuberger, A. L., Robison, F. M., Lyons, S. M. A., Broeckling, C. D., & Prenni, J. E., (2014). Evaluating plant immunity using mass spectrometry-based metabolomics workflows. Frontiers in Plant Science, 5, 291. HUSSEIN, R., & EL-ANSSARY, A. E., (2018). Herbal medicine. Plants Secondary Metabolites: The Key Drivers of the Pharmacological Actions of Medicinal Plants (pp. 11–30). London (United Kingdom): Intechopen Limited. Ibrahim, M., Nadir, M., Ali, A. M. A. N. A. T., Ahmad, V. U., & Rasheed, M. U. N. A. W. W. E. R., (2013). Phytochemical analyses of Prosopis juliflora Swartz DC. Pakistan Journal of Botany, 45(6), 2101–2104. İşcan, G., Ki̇ ri̇ mer, N., Kürkcüoǧlu, M., Başer, H. C., & Demirci, F., (2002). Antimicrobial screening of Mentha piperita essential oils. Journal of Agricultural and Food Chemistry, 50(14), 3943–3946. Jadhav, H. P., Shaikh, S. S., & Sayyed, R. Z., (2017). Role of hydrolytic enzymes of rhizoflora in biocontrol of fungal phytopathogens: An overview. Rhizotrophs: Plant Growth Promotion to Bioremediation, 183–203.

270

Bacterial Diseases of Rice and Their Management

Ji, G. H., Wei, L. F., He, Y. Q., Wu, Y. P., & Bai, X. H., (2008). Biological control of rice bacterial blight by Lysobacter antibioticus strain 13-1. Biological Control, 45(3), 288–296. Jimenez-Garcia, S. N., Guevara-Gonzalez, R. G., Miranda-Lopez, R., Feregrino-Perez, A. A., Torres-Pacheco, I., & Vazquez-Cruz, M. A., (2013). Functional properties and quality characteristics of bioactive compounds in berries: Biochemistry, biotechnology, and genomics. Food Research International, 54(1), 1195–1207. Jimenez-Garcia, S. N., Vazquez-Cruz, M. A., Guevara-Gonzalez, R. G., Torres-Pacheco, I., Cruz-Hernandez, A., & Feregrino-Perez, A. A., (2013). Current approaches for enhanced expression of secondary metabolites as bioactive compounds in plants for agronomic and human health purposes: A review. Polish Journal of Food and Nutrition Sciences, 63(2), 67–78. Joshi, T., Joshi, T., Sharma, P., Chandra, S., & Pande, V., (2020). Molecular docking and molecular dynamics simulation approach to screen natural compounds for inhibition of Xanthomonas oryzae pv. oryzae by targeting peptide deformylase. Journal of Biomolecular Structure and Dynamics, 1–18. Kagale, S., Marimuthu, T., Thayumanavan, B., Nandakumar, R., & Samiyappan, R., (2004). Antimicrobial activity and induction of systemic resistance in rice by leaf extract of datura metel against Rhizoctonia solani and Xanthomonas oryzae pv. oryzae. Physiological and Molecular Plant Pathology, 65(2), 91–100. Kanugala, S., Kumar, C. G., Rachamalla, H. K. R., Palakeeti, B., Kallaganti, V. S. R., Nimmu, N. V., & Thipparapu, G., (2019). Chumacin-1 and chumacin-2 from Pseudomonas aeruginosa strain CGK-KS-1 as novel quorum sensing signaling inhibitors for biocontrol of bacterial blight of rice. Microbiological Research, 228, 126301. Karalija, E., Dahija, S., Parić, A., & Zeljković, S. Ć., (2020). Phytotoxic potential of selected essential oils against Ailanthus altissima (Mill.) swingle, an invasive tree. Sustainable Chemistry and Pharmacy, 15, 100219. Kaur, R. A. J. B. I. R., & Arora, S. A. R. O. J., (2015). Alkaloids-important therapeutic secondary metabolites of plant origin. Journal of Critical Reviews, 2(3), 1–8. Kim, S. I., Song, J. T., Jeong, J. Y., & Seo, H. S., (2016). Niclosamide inhibits leaf blight caused by Xanthomonas oryzae in rice. Scientific Reports, 6(1), 1–13. Koes, R. E., Quattrocchio, F., & Mol, J. N., (1994). The flavonoid biosynthetic pathway in plants: Function and evolution. BioEssays, 16(2), 123–132. Kulikov, S. N., Bayazitova, L. T., Tyupkina, O. F., Zelenikhin, P. V., Salnikova, M. M., Bezrodnykh, E. A., & Tikhonov, V. E., (2016). Evaluation of a method for the determination of antibacterial activity of chitosan. Applied Biochemistry and Microbiology, 52(5), 502–507. Kulikov, S. N., Chirkov, S. N., Il’Ina, A. V., Lopatin, S. A., & Varlamov, V. P., (2006). Effect of the molecular weight of chitosan on its antiviral activity in plants. Applied Biochemistry and Microbiology, 42(2), 200–203. Kumar, P. S., Debasis, M., Goutam, G., & Panda, C. S., (2010). Biological action and medicinal properties of various constituent of Azadirachta indica (Meliaceae): An overview. Annals of Biological Research, 1(3), 24–34. Lamb, C. J., Ryals, J. A., Ward, E. R., & Dixon, R. A., (1992). Emerging strategies for enhancing crop resistance to microbial pathogens. Biotechnology, 10(11), 1436–1445. Lee, G. W., Chung, M. S., Kang, M., Chung, B. Y., & Lee, S., (2016). Direct suppression of a rice bacterial blight (Xanthomonas oryzae pv. oryzae) by monoterpene (S)-limonene. Protoplasma, 253(3), 683–690.

Bioagents and Volatile Organic Compounds

271

Lee, G. W., Lee, S., Chung, M. S., Jeong, Y. S., & Chung, B. Y., (2015). Rice terpene synthase 20 (OsTPS20) plays an important role in producing terpene volatiles in response to abiotic stresses. Protoplasma, 252(4), 997–1007. Leontopoulos, S., Skenderidis, P., & Skoufogianni, G., (2020). Potential use of medicinal plants as biological crop protection agents. Biomed. J. Sci. Tech. Res., 25, 19320–19324. Li, P., Shi, L., Gao, M. N., Yang, X., Xue, W., Jin, L. H., & Song, B. A., (2015). Antibacterial activities against rice bacterial leaf blight and tomato bacterial wilt of 2-mercapto-5­ substituted-1, 3, 4-oxadiazole/thiadiazole derivatives. Bioorganic & Medicinal Chemistry Letters, 25(3), 481–484. Li, S., Yuan, W., Deng, G., Wang, P., Yang, P., & Aggarwal, B. B., (2011). Chemical composition and product quality control of turmeric (Curcuma longa L.). Pharm. Crops, 2, 28–54. Lucy, M., Reed, E., & Glick, B. R., (2004). Applications of free living plant growth-promoting rhizobacteria. Antonie Van Leeuwenhoek, 86(1), 1–25. Macho, A. P., Boutrot, F., Rathjen, J. P., & Zipfel, C., (2012). Aspartate oxidase plays an important role in Arabidopsis stomatal immunity. Plant Physiology, 159(4), 1845–1856. Mansoori, A., Singh, N., Dubey, S. K., Thakur, T. K., Alkan, N., Das, S. N., & Kumar, A., (2020). Phytochemical characterization and assessment of crude extracts from Lantana camara L. for antioxidant and antimicrobial activity. Front. Agron., 2, 582268. doi: 10.3389/fagro. Mishra, S., Yang, X., Ray, S., Fraceto, L. F., & Singh, H. B., (2020). Antibacterial and biofilm inhibition activity of biofabricated silver nanoparticles against Xanthomonas oryzae pv. oryzae causing blight disease of rice instigates disease suppression. World Journal of Microbiology and Biotechnology, 36(4), 1–10. Mukhopadhyay, M. K., & Nath, D., (2011). Phytochemical screening and toxicity study of saraca asoca bark methanolic extract. International Journal of Phytomedicine, 3(4), 498. Nunes Da, S. M., Cardoso, A. R., Ferreira, D., Brito, M., Pintado, M. E., & Vasconcelos, M. W., (2014). Chitosan as a biocontrol agent against the pinewood nematode (Bursaphelenchus xylophilus). Forest Pathology, 44(5), 420–423. Oliveira, T. N., Silva-Filho, C. M., Malveira, E. A., Aguiar, T. K., Santos, H. S., Albuquerque, C. C., & Vasconcelos, M. A., (2020). Antifungal and antibiofilm activities of the essential oil of leaves from Lippia gracilis Schauer against phytopathogenic fungi. Journal of Applied Microbiology. Özkara, A., Akyil, D., & Konuk, M., (2016). Pesticides, environmental pollution, and health. In: Environmental Health Risk-Hazardous Factors to Living Species. IntechOpen. Padmavati, M., Sakthivel, N., Thara, K. V., & Reddy, A. R., (1997). Differential sensitivity of rice pathogens to growth inhibition by flavonoids. Phytochemistry, 46(3), 499–502. Panzella, L., Moccia, F., Nasti, R., Marzorati, S., Verotta, L., & Napolitano, A., (2020). Bioactive phenolic compounds from agri-food wastes: An update on green and sustainable extraction methodologies. Frontiers in Nutrition, 7. Pappalardo, H. D., Toscano, V., Puglia, G. D., Genovese, C., & Raccuia, S. A., (2020). Cynara cardunculus L. as a multipurpose crop for plant secondary metabolites production in marginal stressed lands. Frontiers in Plant Science, 11, 240. Pappas, M. L., Baptista, P., Broufas, G. D., Dalakouras, A., Djobbi, W., Flors, V., & Papadopoulou, K., (2020). Biological and molecular control tools in plant defense. In: Plant Defense: Biological Control (pp. 3–43). Springer, Cham. Patel, D. K., Patel, K., & Dhanabal, S. P., (2012). Phytochemical standardization of Aloe vera extract by HPTLC techniques. Journal of Acute Disease, 1(1), 47–50.

272

Bacterial Diseases of Rice and Their Management

Pérez-Montaño, F., Alías-Villegas, C., Bellogín, R. A., Del, C. P., Espuny, M. R., JiménezGuerrero, I., & Cubo, T., (2014). Plant growth promotion in cereal and leguminous agricultural important plants: From microorganism capacities to crop production. Microbiological Research, 169(5, 6), 325–336. Raghavendra, M. P., Satish, S., & Raveesha, K. A., (2009). Alkaloid extracts of Prosopis juliflora (Sw.) DC. (Mimosaceae) against Alternaria alternata. Journal of Biopesticides, 2(1), 56–59. Ram, T., Laha, G. S., Deen, R., Ramos, J. M., VeraCruz, C. M., & Brar, D. S., (2011). Oryza rufipogon, a valuable source for resistance to bacterial blight of rice. Plant Breeding, 130(6), 715–718. Ranasinghe, P., Pigera, S., Premakumara, G. S., Galappaththy, P., Constantine, G. R., & Katulanda, P., (2013). Medicinal properties of ‘true’ cinnamon (Cinnamomum zeylanicum): A systematic review. BMC Complementary and Alternative Medicine, 13(1), 1–10. Raveau, R., Fontaine, J., & Lounès-Hadj, S. A., (2020). Essential oils as potential alternative biocontrol products against plant pathogens and weeds: A review. Foods, 9(3), 365. Rojas, C. M., Senthil-Kumar, M., Tzin, V., & Mysore, K., (2014). Regulation of primary plant metabolism during plant-pathogen interactions and its contribution to plant defense. Frontiers in Plant Science, 5, 17. Salah, H. B., Jarraya, R., Martin, M. T., Veitch, N. C., Grayer, R. J., Simmonds, M. S., & Damak, M., (2002). Flavonol triglycosides from the leaves of Hammada scoparia (P OMEL) I LJIN. Chemical and Pharmaceutical Bulletin, 50(9), 1268–1270. Sathiyabama, M., & Parthasarathy, R., (2016). Biological preparation of chitosan nanoparticles and its in vitro antifungal efficacy against some phytopathogenic fungi. Carbohydrate Polymers, 151, 321–325. Seigler, D. S., & Ebinger, J. E., (1995). Taxonomic revision of the ant-acacias (Fabaceae, Mimosoideae, acacia, series gummiferae) of the new world. Annals of the Missouri Botanical Garden, 117–138. Sekizawa, Y., Tetsuro, W., & Makoto, O. D. A., (1965). Effect of phenazine against rice leaf blight bacterium, and its biochemical mechanism. Japanese Journal of Phytopathology, 30(3), 145–152. Shi, L., Li, P., Wang, W., Gao, M., Wu, Z., Song, X., & Hu, D., (2015). Antibacterial activity and mechanism of action of sulfone derivatives containing 1, 3, 4-oxadiazole moieties on rice bacterial leaf blight. Molecules, 20(7), 11660–11675. Singh, N., Mansoori, A., Jiwani, G., Solanke, A. K., Kumar, R., & Kumar, A., (2021). Evaluation of antioxidant and antimicrobial potential of Thespesia lampas root extracts. Journal of Experimental Biology and Agriculture Science, 9(1). Slusarenko, A. J., Patel, A., & Portz, D., (2008). Control of plant diseases by natural products: Allicin from garlic as a case study. Sustainable Disease Management in a European Context, 313–322. Strange, R. N., & Scott, P. R., (2005). Plant disease: A threat to global food security. Annu. Rev. Phytopathol., 43, 83–116. Sulaiman, S. F., Sajak, A. A. B., Ooi, K. L., & Seow, E. M., (2011). Effect of solvents in extracting polyphenols and antioxidants of selected raw vegetables. Journal of Food Composition and Analysis, 24(4, 5), 506–515. Sulaiman, S. F., Yusoff, N. A. M., Eldeen, I. M., Seow, E. M., Sajak, A. A. B., & Ooi, K. L., (2011). Correlation between total phenolic and mineral contents with antioxidant activity of eight Malaysian bananas (Musa sp.). Journal of Food Composition and Analysis, 24(1), 1–10.

Bioagents and Volatile Organic Compounds

273

Syed-Ab-Rahman, S. F., Carvalhais, L. C., & Omar, D., (2020). Development of plant-based emulsion formulations to control bacterial leaf blight and sheath brown rot of rice. Heliyon, 6(1), e03151. Szajdek, A., & Borowska, E. J., (2008). Bioactive compounds and health-promoting properties of berry fruits: A review. Plant Foods for Human Nutrition, 63(4), 147–156. Tao, H., Tian, H., Jiang, S., Xiang, X., Ahmed, W., Tang, R., & Cui, Z. N., (2019). Synthesis and bioactivity of 1, 3-thiazolidine-2-thione derivatives against type III secretion system of Xanthomonas oryzae. Bioorganic & Medicinal Chemistry, 27(15), 3364–3371. Treutter, D., (2005). Significance of flavonoids in plant resistance and enhancement of their biosynthesis. Plant Biology, 7(6), 581–591. Tsujibo, H., Kubota, T., Yamamoto, M., Miyamoto, K., & Inamori, Y., (2003). Characterization of chitinase genes from an alkaliphilic actinomycete, Nocardiopsis prasina OPC-131. Applied and Environmental Microbiology, 69(2), 894–900. Uemura, T., & Arimura, G. I., (2019). Current opinions about herbivore-associated molecular patterns and plant intracellular signaling. Plant Signaling & Behavior, 14(9), e1633887. Van, H., D., Hoa, P. T. P., Quang, N. D., Ton, P. H., Ha, T. H., Van, H. N., & Thom, V. T., (2014). Biological control of Xanthomonas oryzae pv. oryzae causing rice bacterial blight disease by Streptomyces toxytricini VN08-A-12, isolated from soil and leaf-litter samples in Vietnam. Biocontrol Science, 19(3), 103–111. Velásquez, A. C., Christian, D. M. C., & Sheng, Y. H., (2018). Plant–pathogen warfare under changing climate conditions. Current Biology, 28(10), R619–R634. Velusamy, P., & Gnanamanickam, S. S., (2003). Identification of 2, 4-diacetylphloroglucinol production by plant-associated bacteria and its role in suppression of rice bacterial blight in India. Current Science, 85(9), 1270–1273. Vengadeshkumar, L., Meera, T., Balabaskar, P., Sanjaygandhi, S., Rajamohan, K., Udhaya­ kumar, R., & Sudhasha, S. (2019). Antibacterial activity of Rhizophora apiculata leaf extract for the management of rice bacterial blight disease. Plant Pathology Journal (Faisalabad), 18(1), 39–46. Venkatesh, H. N., Thippeswamy, S., Abhishek, R. U., & Mohana, D. C., (2015). Antibacterial activity of alkaloid extracts and active constituents of some selected plants against Xanthomonas campestris. Journal of Agricultural Technology, 11(3), 683–691. Wang, L., Zhou, X., Lu, H., Mu, X., & Jin, L., (2020). Synthesis and antibacterial evaluation of novel 1, 3, 4-oxadiazole derivatives containing sulfonate/carboxylate moiety. Molecules, 25(7), 1488. Wu, M., Ni, L., Lu, H., Xu, H., Zou, S., & Zou, X., (2020). Terpenoids and their biological activities from Cinnamomum: A review. Journal of Chemistry, 2020. Yasmin, S., Zaka, A., Imran, A., Zahid, M. A., Yousaf, S., Rasul, G., & Mirza, M. S., (2016). Plant growth promotion and suppression of bacterial leaf blight in rice by inoculated bacteria. PloS One, 11(8), e0160688. Yousefi, H., Hassanzadeh, N., Behboudi, K., & Firouzjahi, F. B., (2018). Identification and determination of characteristics of endophytes from rice plants and their role in biocontrol of bacterial blight caused by Xanthomonas oryzae pv. oryzae. Hellenic Plant Protection Journal, 11(1), 19–33. Yu, X., Feng, B., He, P., & Shan, L., (2017). From chaos to harmony: Responses and signaling upon microbial pattern recognition. Annual Review of Phytopathology, 55, 109–137.

274

Bacterial Diseases of Rice and Their Management

Zeng, D., Wang, M. W., Xiang, M., Liu, L. W., Wang, P. Y., Li, Z., & Yang, S., (2020). Design, synthesis, and antimicrobial behavior of novel oxadiazoles containing various N-containing heterocyclic pendants. Pest Management Science, 76(8), 2681–2692. Zhang, H., & Wang, S., (2013). Rice versus Xanthomonas oryzae pv. oryzae: A unique pathosystem. Current Opinion in Plant Biology, 16(2), 188–195. Zou, T. B., Xia, E. Q., He, T. P., Huang, M. Y., Jia, Q., & Li, H. W., (2014). Ultrasoundassisted extraction of mangiferin from mango (Mangifera indica L.) leaves using response surface methodology. Molecules, 19(2), 1411–1421.

CHAPTER 17

Opportunities for Bioinformatics Tools for the Management of Rice Bacterial Diseases POOJA SAINI,1 SHIKHA YASHVEER,1 NEERU SINGH REDHU,1 SHALU CHAUDHARY,1 AARTI KAMBOJ,1 VIVEKANAND HEMBADE,1 KRITIKA SHARMA,1 and SONALI SANGWAN2 Department of Molecular Biology, Biotechnology, and Bioinformatics,

COBS&H, Chaudhary Charan Singh Haryana Agricultural University,

Hisar–125001, Haryana, India,

E-mail: [email protected] (S. Sangwan)

1

Department of Biotechnology, Maharishi Markandeshwar University,

Mullana-Ambala (133207), Haryana, India

2

ABSTRACT One of the most critical constraints is bacterial diseases in rice production. The diagnosis, identification, and management of plant pathogens are requisite for disease control. The next generation sequencing (NGS) has resulted in an exponential growth in sequential data of both pathogen and rice that ultimately augments rice disease diagnosis accurately. Owing to its small size (430 Mb), the rice genome was one of the first cereal crops to be sequenced and later served as a reference for annotation of other crops. Tools and resources are developed to improve the quality and accuracy of annota­ tion through prediction-based, and homology-based approaches to exploit partial genome sequence, viz. expressed sequence tag projects along with rice genome sequence. Additionally, the emergence of several mass spectrometry Bacterial Diseases of Rice and Their Management. Deepti Srivastava, Md. Shamim, Malik Mobeen Ahmad, & K. N. Singh (Eds.) © 2023 Apple Academic Press, Inc. Co-published with CRC Press (Taylor & Francis)

276

Bacterial Diseases of Rice and Their Management

(MS) techniques opened up more opportunities for finding information related to pathogenicity and/or virulence factors through proteomics in crop diagnostics and effective preventive measures. Currently, complete genome sequences for two rice subspecies japonica and indica, along with three bacterial blight (BB) pathogens are accessible. High-throughput sequence data accessibility and advances in bioinformatics could aid in deciphering interaction between rice-BB pathogens as well as host counter measures like innate immunity and R gene-medicated immunity against pathogens. The development of tools and techniques led to faster, and more precise specific motifs identification, thus assisting in plant disease diagnosis. Interdisciplinary nature of bioinformatics could offer several ways for better understanding of bacterial pathogenesis. Bioinformatics is employed for organization and storage of data generated through various biological methods coupled with their analysis comprising sequences (nucleotide and protein), structures, and metabolites. For instance, tasks like gene/protein structures and function prediction, gene variation identification, gene regula­ tion networks detection/prediction, conserved region identification, phylo­ genetic analysis and alteration in expression and metabolic profiles due to infection among others could be easily performed by utilizing bioinformatics tools. RiceMetaSysB, an open-source database of BB and rice blast respon­ sive genes (RGs), provides expression profiles comparison across genes, genotypes, and strains. In addition, protein structural analysis and molecular docking can shed lighter on molecular-level plant-pathogen interactions by providing information on avirulence gene, resistance gene and their role in disease or disease resistance regulation. 17.1 INTRODUCTION Rice (Oryza sativa), domesticated approx. 10,000 years ago, is a model plant for monocotyledons belonging to the Gramineae family. Currently, it is sustaining a large number of the world population and is widely cultivated in Asia, Europe, Africa, America, and Oceania, making it the second most consumed cereal grain. Hence, rice cultivation could provide a significant contribution towards the economic development of a country. According to the Food and Agriculture Organization (FAO) of the United Nations (FAOSTAT) 91.05% of rice is acquired and consumed by Asian countries (Verma, 2017). To fulfill the rising demand of rice consumers, its cultivation has to increase 40% by 2030 (Khush, 2005). Most popular subspecies for rice cultivation are japonica and indica belonging to O. sativa species. With increasing demand

Opportunities for Bioinformatics Tools for the Management

277

and changing environment, damage, and reduction of rice crop yield by any means is highly undesirable. Unfortunately, due to several abiotic and biotic factors, the loss in grain yield as well as financial loss occurred in rice every year. Rice diseases are caused by viruses, bacteria, fungi, nematodes, and insect infestation, which are one of the major causes behind the agricultural and economic loss. Rice blight disease caused up to 70% yield losses under favorable environmental conditions to Xoo infection (Reddy, 1979). Among bacterial diseases, bacterial blight (BB) and bacterial panicle blight (BPB) of rice are the ones extensively studied and are largely responsible for yield loss. The exponential increase in population rapidly changes the demandsupply scenario of crop production. Additionally, the absence of early infection detection and problem in identification of root cause for infec­ tion are also factors responsible for not being able to achieve the newer demand-supply food production goals. This further leads to the failure in the development of management strategies for controlling rice disease as well as in the investigation of their influence on rice production. Therefore, the development of effective management strategies which can be used at appropriate time to minimize yield loss is significant. Current management approaches like exclusion, chemical control, genetic resistance, biocontrol, and cultural practice are the basis of sustainable control of bacterial diseases of rice (Naqvi, 2019). The practice of existing management to protect crops from pathogen invasion and infection in an integrated manner is necessary; thus, scientists have started to work on biological methods (Liu et al., 2007). The utilization of hostile microorganisms or their secondary metabolites for management and monitoring of pathogens are considered to be an effective technology of disease control (Han et al., 2005; Nagendran et al., 2013). Some of the antibacterial compounds like oxolinic acid are adopted against BPB control in one country (Japan) but not adopted in any other country. Various formulations have also been developed to control or suppress bacte­ rial rice diseases (Rahman et al., 2020). Recently, nanoparticles and siliconbased management of bacterial disease has also been explored (Ahmed et al., 2020; Rodrigues and Datnoff, 2005). Several cultivars and hybrids with partial resistance are identified. The development and use of resistant cultivars are known to be the best strategy to lessen the damage produced by bacterial disease and to enhance the rice grain production in the long term. But development of resistant cultivars through conventional breeding can take a long time and biotechnological interventions need to come to the rescue. Another emerging field, Bioinformatics, utilizes the application of information communication technology in biological research. Bioinformatics is based on the computational usage and concepts

278

Bacterial Diseases of Rice and Their Management

of informatics, mathematics, statistics, biochemistry, chemistry, physics, and linguistics. The biotechnological and bioinformatics approaches in combina­ tion could result in earlier development of resistant cultivars. Bioinformatics is an extremely helpful tool for mapping, analyzing, and aligning diverse DNA and protein sequences, 3-D structure formation. Further, it can be utilized for data management, analysis of agriculture scientific discovery, as well as other sectors (Jayram and Dhingra, 2010). In this chapter, emphasis is on how bioinformatics can help in the development of resistant cultivars and management strategies for controlling rice bacterial disease. 17.2 BRIEF ABOUT RICE BACTERIAL DISEASES Bacterial diseases of rice are a major bottleneck towards their sustainable agriculture and productivity. They are a global nuisance, especially for rice agriculture in Asian countries. They are endemic to several rice species, varieties, and cultivars growing in Indian states and can cause an annual loss of US $3.6 billion. The bacterial diseases can be categorized into several groups, such as seedling, foliar, sheath, grain, and root disease, depending on the causative agent and disease symptoms (Table 17.1). Out of all the bacterial diseases listed in Table 17.1, BB, bacterial leaf streak (BLS) and BPB are the major cause of concern as they can easily devastate a crop, when the environmental conditions are conducive to disease growth. BB, causative agent, Xanthomonas oryzae pv. oryzae (Xoo) can destroy an entire year’s harvest for a smallholder, jeopardizing their food supply, revenue, and land ownership at peril. Numerous researches have been taken up on the management of this kind of diseases, mainly bacterial leaf blight (BLB), which includes chemical treatment and breeding for tolerant varieties. Many resistant genes have been isolated for future breeding purposes. Though over the recent decades, because of the introduction of semidwarf gene sd1 creating hybrids, the rice yield has been doubled. It still needed to be significantly increased in order to fulfill the demand of the growing population (Skamnioti and Gurr, 2009). Hence, enhancement in the cultivation management practices is important to confront the challenge of cultivation area availability, water, soil fertility along with increasing varia­ tion in climate, modification in insects and diseases caused by them. As rice production is affected by a number of diseases caused by bacteria, fungi, and viruses. The innovation of gene-conferred host plant resistance offers a viable alternative as well as an eco-friendly approach to control diseases to regulate yield loss.

Various Bacterial Diseases of Rice Affecting Rice Production Causative Agent

Symptoms

Management

1.

Seedling blight

Pseudomonas plantarii

The plant shows basal chlorosis, retardation of root Iron compounds application suppresses the disease as the tropolone production inhibited in iron presence. growth and leaf chlorosis of infected seedlings because of production of tropolone by P. plantarii. Transfer of thionine producing gene from oat to rice, also confirmed resistance against P. plantarii.

2.

Bacterial blight (BB)

Xanthomonas oryzae pv. oryzae (Xoo)

Leaf blight occurs from the tillering stage onward, in wilt or Kresek infected leaves roll up, turns grayish green and then yellow to straw-colored and wither, and generally entire plant dies.

Use of host resistance, modification in cultural practices, biological control, use of natural components or plant extracts and use of conventional and non-conventional chemicals.

3.

Bacterial Pseudomonas brown stripe syringae pv. Panici and Pseudomonas avenae

General symptoms are inhibition of germination, browning of stripes along the midrib or leaf margins, and abnormal mesocotyl elongation and curving of a sheath, symptoms masked after transplantation of infected seedlings to fields.

The pathogen can be eliminated by dry heat treatment for 6 days at 65°C from the seeds.

4.

Bacterial panicle blight

Burkholderia glumae or B. gladioli

It can cause seedling blighting or seeding rot in young plants and may affect individual glumes or entire panicles. Initially, it has seen discoloration from light on the basal portion of the glumes ranges from light green to light brown in infected florets. The disease shows linear lesions on sheaths and necrotic center, resulting in stem rot and sheath rot. Lesions on leaves are oval to circular with a smooth reddish-brown border and a gray center.

The disease can be eliminated by high temperatures and high relative humidity. An antibacterial compound oxolinic acid is effective against pathogen growth. Integrated use of existing management strategies of exclusion, chemical control, biocontrol, genetic resistance, and cultural practice also control of BPB. The best strategy to minimize the damage is use of resistant cultivars.

5.

Bacterial leaf streak

Xanthomonas oryzae pv. oryzicola.

At any stage of growth, disease can strike and to begin with as small as interveinal, water-soaked streaks. Ultimately, the entire leaves turn brown then grayish white and finally die.

Seed can be treated by soaking in 0.025% streptocycline solution overnight and with hot water at 52°C for 30 min are effective in radiating seed infection, sprays of Vitavax at 0.15–0.3% are

279

SL. Disease No.

Opportunities for Bioinformatics Tools for the Management

TABLE 17.1

(Continued)

SL. Disease No.

Causative Agent

Symptoms

Management

280

TABLE 17.1

used against infection and three sprays of 100 ppm streptocycline or agrimycin 100 at 10 days intervals from the earliest appearance of disease is effective. Initially, symptoms appear on under surfaces of leaves as small angular, water-soaked spots. The disease is characterized by light green to yellow halo around the leaf blade. In letter stage of infections, upper parts of plants turn yellow (chlorotic). Infections in the pods can spread to the seeds, causing them to become shriveled, discolored, even smaller than normal size.

Control strategy of halo blight is very similar bacterial blight. Also, use furrow irrigation can control the spread of pathogen

7. Sheath brown rot

Pseudomonas fuscovaginae

In seedlings stage, systemic discoloration occurs on the leaf sheath and may spread to the midrib and veins. Symptoms occur on the flag leaf sheath in mature plants, Glumes of panicles of infected leaf have water-soaked lesions of light brown color. Grains formed from infected panicles are deformed, discolored, and empty.

Use of seed treated with dry heat at 64°C for 6 days can help in the management of disease. Use of antibiotics for example streptomycin alone, or with oxytetracycline can effectively manage disease if applied a few days after panicle emergence.

8.

Sheath rot

Pseudomonas The symptoms of the disease are similar to sheath brown rot caused by Pseudomonas fuscovaginae. syringae pv syringae (syn P. oryzicola)

No management for the disease is available.

9.

Grain rot

Pseudomonas glumae.

The pathogen may be exterminated from small seed samples with dry heat treatment of 65°C for 6 days. The most efficient way for disease management is to

Halo blight

In seedlings stage, symptoms consist of watersoaked soft rot of leaf sheaths and wilting of leaves. Grains are shrunken and pale green,

Bacterial Diseases of Rice and Their Management

Pseudomonas syringae pv. oryzae,

6.

SL. Disease No.

(Continued) Causative Agent

Symptoms

Management

becoming dirty yellow to brown and dry. Indicative pre-treat rice seeds with a high concentration (1,010 feature of disease is brown margin between the CFU/ml) of the avirulent strain of P. glumae. infected and healthy parts of grain. A mild rot occurs in flag leaf sheath. 10. Bacterial palea browning

Erwnia herbicola

The infection begins, with light brown, watersoaked lesions on the lemma or palea. Lesions then turn dark brown, discoloration of palea is most common. The grains produced from infected panicles are immature grains and lighter.

11. Bacterial foot rot

Erwinia chrysanthemi

The characteristic symptom of the disease is dark No management for the disease is available. brown decay of tillers and wilting of leaves. The lesions rapidly extend down to the nodes, culms, and ultimately to crowns. Young infected plants have an unpleasant odor. In the advanced stage, nodes, culms, and crowns decay and can easily be detached from soil. Infection often begins in the ligules. Blackness of infected culms and internodes. Roots attached to infected nodes decay and fall off.

No management for the disease is available

Opportunities for Bioinformatics Tools for the Management

TABLE 17.1

281

282

Bacterial Diseases of Rice and Their Management

17.3 BACTERIAL BLIGHT (BB) RESISTANCE GENES Extensive genetic research has been conducted on the rice plant and resis­ tance to BB over the last 20 years. Several resistance (R) genes reportedly conferred resistance to Xoo strain (Jiang et al., 2020), out of them 11 had been cloned viz., Xa1, Xa3/Xa26, Xa4, xa5, Xa10, xa13, Xa21, Xa23, xa25, XA27, and xa41 (Table 17.2; Ji et al., 2018). These identified R genes are broadly used in breeding application to control diseases. Xa21 gene was first identified in the Oryza longistaminata (wild rice) and later introgressed into Oryza sativa (Dai, 2007). The resistance genes are divided into four catego­ ries: receptor-like kinase (RLK) genes, sugar will eventually be exported transporter (SWEET) genes, executor gene and other types of genes. Receptor-like kinase (RLK) genes belong to the largest family of plant recep­ tors that play a significant part in pathogen-associated molecular patterns (PAMPs) recognition and subsequently modulating the plant responses to invasive pathogens. The protein encoded by these genes are transmembrane proteins with versatile extracellular N-terminal and intracellular C-terminal kinase domains. The encoding protein for Xa3 (Li et al., 2004; Sun et al., 2004; Xiang et al., 2006) and Xa21 (Song et al., 1995; Pruitt et al., 2015) is LRR-RLK, while it is wall-associated kinase/RLK for Xa4 (Hu et al., 2007). SWEET genes are basically sugar transporter in plants, which facilitates nutrition supply to invading pathogens as well as and in turn renders most susceptible. Therefore, they are essential for the growth and development of plant, and can be manipulated to combat stress. Of total 11 cloned only recessive genes xa13 (Yang et al., 2006; Chu et al., 2006; Yuan et al., 2012), xa25 (Liu et al., 2011; Zhou et al., 2015) and xa41 (Antony et al., 2010; Yu et al., 2011; Streubel et al., 2013) encodes into Sweet-type proteins. Pathogen transcription activator-like (TAL) effectors are required for executor genes transcription. Onset of disease due to pathogen leads to binding of TAL effectors to promoter of executor genes, which enhances pathogen virulence followed by apoptosis of hypersensitive host cell. Cloned genes Xa10 (Tian et al., 2014), Xa27 (Gu et al., 2005) and Xa23 (Wang et al., 2014, 2015) belong to this group and encodes executor R proteins. Other type of genes that enables disease resistance in plants are TFII transcription factor and NOD-like receptors (NLR). Xa1 (Yoshimura et al., 1998; Ji et al., 2016a) and Rxo1 (Zhao et al., 2004a, b) are NLR genes, whereas xa5 (Jiang et al., 2006; Zou et al., 2010; Sugio et al., 2007) is TFII transcription factor. The first avirulence (Avr) gene cloned were avrXa7 and avrXa10 from Xoo that corresponds to the R genes Xa7 and Xa10, respectively which

Resistance Gene (Cloned) Information Existing in O. sativa Genome

SL. Resistance No. Gene (R)

Chromosome D/R Avirulence Gene Donor Plant (Avr) of Xoo

Source

Encoding Protein References for R Gene

1.

Xa3/Xa26

11

D

AvrXa3

Indica variety Minghui Japan 63, japonica variety Wase Aaikoku 3

LRR-RLK

Sun et al. (2004); Li et al. (2004); Xiang et al. (2006)

2.

Xa21

11

D

RaxX

O. longistaminata

Africa

LRR-RLK

Song et al. (1995); Pruitt et al. (2015)

3.

Xa4

11

D

–

Indica commercial variety

India

Wall-associated kinase/RLK

Hu et al. (2007)

4.

8 xa13 (OsSWEET11)

R

PthXo1

Cultivar BJ1

India

Sweet-type protein Chu et al. (2006); Yang et al. (2006); Yuan et al. (2012)

5.

4 xa25 (OsSWEET13)

R

PthXo2

Indica variety Minghui 63

China

Sweet-type protein Liu et al. (2011); Zhou et al. (2015)

6.

– xa41 (OsSWEET14)

R

PthXo3/TalC

African wild variety, O. barthii and O. gluberrima

–

Sweet-type protein Antony et al. (2010); Yu et al. (2011); Streubel et al. (2013)

7.

Xa10

11

D

AvrXa10

Rice cultivar Cas 209

–

Executor R protein Tian et al. (2014); Gu et al. (2008); Lee et al. (2003)

8.

Xa23

11

D

AvrXa23

O. rufipagon

China

Executor R protein Wang et al. (2014, 2015)

9.

Xa27

6

D

AvrXa27

O. minuta

Philippines Executor R protein Gu et al. (2005)

Opportunities for Bioinformatics Tools for the Management

TABLE 17.2

283

(Continued)

SL. Resistance No. Gene (R)

Chromosome D/R Avirulence Gene Donor Plant (Avr) of Xoo

Source

Encoding Protein References for R Gene NLR

10.

Xa1

4

D

PthXo1

Japonica cultivar Kogyoku

Japan

11.

xa5

5

R

Avrxa5

Aus-Bora variety

Bangladesh TFII transcription factor

Jiang et al. (2006); Zou et al. (2010); Sugio et al. (2007)

12.

Rxo1

–

D

AvrRxo1

Maize

–

Zhao et al. (2004a, b)

Yoshimura et al. (1998); Ji et al. (2016a)

Bacterial Diseases of Rice and Their Management

Note: D: dominant; R: recessive.

NLR

284

TABLE 17.2

Opportunities for Bioinformatics Tools for the Management

285

were cloned whereas Xa7 and Xa10 are not cloned yet. Other avr gene cloned for R genes are AvrXa3, RaxX. PthXo1, PthXo2, PthoXo3, AvrXa10, AvrXa23, AvrXa27, PthXo1, Avrxa5 and AvrRxo1 corresponding to Xa1, Xa3, xa13, xa25, xa41, Xa23, Xa27, Xa1, xa5 and Rxo1, respectively. Avirulence genes are triggered by a transcription activator-like effector (TAL) (Triplette et al., 2016). The central role of TAL effectors is pathogen manipulation of host tran­ scription and interference with the host defenses for pathogenesis. Overall, a comprehensive knowledge of the molecular interactions between Xoo and rice is crucial for the effective and durable disease control. Fortunately, the interactions of Xoo with rice serve as powerful and potential model for research and management of bacterial diseases. Further, the comparative and functional analysis among bacterial strain genome sequence available and pending genome sequence promises to provide lighter on the management of bacterial pathogenesis of plants. 17.4 ADVANCE BIOINFORMATICS TOOLS FOR DIAGNOSIS AND MANAGEMENT OF DISEASE In recent years, swift burgeoning in genomics and proteomics has given rise to biological data in a great amount and illustrating conclusions from these data needs sophisticated computational analyzes. As, rice is one of the world’s most important crop and extensively studied model plant, the accomplishment of rice whole genome sequence along with highthroughput experimental platforms have resulted to the origination of prodigious amount of data and development of specialized bioinformatic tools and databases for efficient organization, analysis, visualization, and data processing. The production and productivity of rice has a large impact on the world economy. Still, a large amount of rice produce is devastated by several abiotic and biotic stresses. Among the various rice diseases, the most important ones are the bacterial diseases. Bioinformatics have numerous practical applications in the management of current plant diseases with reference to study of pathogenicity of a pathogen, host-pathogen interactions and understanding the disease genetics which eventually helps to design the best management options. Hence, bioinformatics is vital in modern plant pathology for the designing of new plant diagnostic tools as described further.

286

Bacterial Diseases of Rice and Their Management

17.4.1 DATABASE AVAILABLE The recent advancement in the rice genome biology as rice serves as model plant for monocotyledon family, have produced great amount of data, i.e., sequenced reference genome, transcriptomes, proteomes, metabolomes, genetic variation, and gene annotation, etc. This data expansion demands the development of bioinformatics resources and databases for easy and publicly available storage, organization, processing, analyzing, and utilizing of data in a systematic manner. The objective of these databases has been to represent, organize, and to help locate and retrieve required information. It also integrates data with other information from rice biochemistry and physi­ ology. Thus, various open and online sources, biology databases have arisen for the welfare of rice researchers and scientists and to manage pathogenicity in rice. Databases are classified into Primary and Secondary or both. The primary databases are developed on the basis of direct result of experiment such as NCBI (National Center for Biotechnology Information) sequence read archive (SRA) (Kodama et al., 2013), Rice RAPdb (Saki et al., 2013), etc. The secondary databases are consisting of processed and analyzed data attained from primary datasets viz., EMBL-EBI’s Gene Expression Atlas (Petryszak et al., 2016), NCBI RefSeq (Pruitt et al., 2014). Some databases like Gramene (Tello-Ruiz et al., 2016) include both types of information. Some of important data bases are discussed below: 1. Gramene (http://www.gramene.org): It is an online resource of crops and model plant providing comparative functional genomics. It contains two major frameworks namely as genomes alliance, associated with Ensembl Plants and other is pathways (The plant reactome and archival BioCyc databases). Hence, this software provides region-specific (genome browser) and pathway-specific (Plant Reactome) data downloads. The other available data types are gene/ gene products, gene annotation, transcripts, metabolites, proteins, genomic variation, etc. (Tello-Ruiz et al., 2016). This database facilitates users to search gene of interest via asking the specific questions rather than performing a general text search and to check the distribution of results across all the genomes present in the database. 2. RiceMetaSysB Database (B for Biotic Stress) (http://14.139. 229.201/ricemetasysb): It is an open-source database that offers comprehensive information on rice BB and blast RGs. It offers various search options precise for parameters like genotype’s

Opportunities for Bioinformatics Tools for the Management

287

identity, tissue, and stage of the development that were used for the analysis, strain used for the infection and time points [days post inoculation (dpi)/ hours after inoculation (hai)] which are selected gene expression sampling, so that users can recoup the candidate genes on the basis of their needs and objectives. There is a provision in the database to organize the results according to LOC ID (gene locus ID), fold change (FC) and nature of regulation. The user can also recoup differentially expressed genes (DEGs) that are mutual to two or more strains (Sureshkumar et al., 2019). 3. Ricebase (http://ricebase.org): This database merges datasets to maintain key links between the previous and current genetic studies hence, an integrative genomic database. It includes DNA sequence data, genome annotation, molecular marker fragment and nucleotide variation data (Edwards et al., 2016). It has created the fully auto­ mated pipeline for evaluating Simple Sequence Repeats, SSRs, pseu­ domolecule assembly positions that can be utilized to overlay marker details on additional new assemblies of the other rice accessions or various species just when they become available. This application is easy for users when working across various genotyping platforms. 4. RGKbase (Rice Genome Knowledge Base) (http://rgkbase.big. ac.cn/RGKbase): This is annotated database for rice evolutionary biology and rice comparative genomics. It also includes information of transcriptomics, metabolites, epigenomic data, genomic variation, QTLs, and other relevant literature (Wang et al., 2013). In addition to the above-discussed database, bioinformatics tool like AnnoTALE is also available specifically dedicated to X. oryzae pv. oryzae and X. oryzae pv. oryzicola as they have large TALE repertories. AnnoTALE “http://www.jstacs.de/index.php/AnnoTALE”: This application suite is used to identify and analyze TALEs in Xanthomonas genomes. The Xanthomonas TALEs nomenclature has been inconsistent. Historically, sub-cloning of individual TALE genes has been done and TALE names have been assigned based on their induced resistant reaction (names beginning with “Avr” means avirulence), their input towards pathogenicity (names starting with “Pth” means pathogenicity) or their sequential position in the 67 genomes. As, Xoo is a worldwide scourge, so, a novel suit of applications called “AnnoTALE” has been developed. It helps to: i. Identify and analyze TALEs in Xanthomonas genomes; ii. Cluster TALEs into different classes;

288

Bacterial Diseases of Rice and Their Management

iii. Assign novel TALEs to the existing classes; iv. Propose TALE names with the help of a unified nomenclature; v. Predict the targets of TALE classes and individual TALEs. This suite of applications is available as a Java-FX-based stand-alone application providing interactive analysis sessions based on the graphical user interface (http://www.jstacs.de/index.php/ AnnoTALE). 17.4.1.1 PREDICTION AND ANALYZES OF TALE GENES The DNA binding domain is the most prominent feature of TALEs, that consists of an array of highly conserved tandem repeats. So, the TALE genes in Xanthomonas genomes are identified by AnnoTALE on the basis of the DNA sequence homology of the individual TALE domains. As, beforehand, the number of repeats is mysterious, so the genome for individual repeats is scanned first, which are then joined to form contiguous stretches. Then the occurrence of TALE-N and TALE-C domains are searched at the 5’ and 3’ ends of the stretches, thus giving the TALE open reading frame (ORF) (Grau et al., 2016). 17.4.2 NEXT GENERATION SEQUENCING (NGS) For the development and implementation of management strategies for disease, a thorough understanding of the genomes of rice and pathogen is essential. The rapid development in recent times of next-generation sequencing (NGS) has led to upgraded genetic improvement by boosting up the genome sequence number greatly in rice varieties. Rice draft genome sequencing was completed in 2002 and various isolates and strains of patho­ gens are being sequenced and reported till now. Various objectives can be achieved with single advent of sequencing. NGS has the potential to uncover various facets. It can answer various questions related to phylogeny, ricepathogen interaction, mechanism of pathogenicity and resistance. Resistance is the ultimate target that is intended to be achieved when the aim is to manage disease and protect yield. Post NGS the sequence can be subjected to various types of analysis based on different bioinformatics tools (Tables 17.3 and 17.4) to extract information such as gene clusters, their role in pathogen lifestyle and how these genes interact with host plant, if any gene cluster is present that is unique to the strain or isolate.

Different NGS Platforms Used for Rice Bacterial Diseases

Platform

Chemistry

Template Preparation Examples

References

Roche 454

Pyrosequencing

Clonal-emPCR

gDNA construction and sequence of X. oryzae

Chien et al. (2019)

GS FLX titanium

Pyrosequencing

Clonal-emPCR

Rice genome

Matsumoto et al. (2016)

Illumina Miseq

Reversible dye terminator

Clonal bridge amplification

Genomic sequences of the X. oryzae pv. oryzae phages, Xoo XF89b genomic seq

Kovács et al. (2019); Chien et

al. (2019)

Illumina Hiseq

Reversible dye terminator

Clonal bridge amplification

Rice O. meyeriana cDNA libraries were sequenced, Chinese rice

Cheng et al. (2016); Lii et al.

(2020)

Reversible dye Illumina Nextseq500 system terminator

Clonal bridge amplification

Whole genome sequencing of O. sativa Battu et al. (2017a, b)

indica cultivar,

Illumina genome analyzer II/IIx

Reversible dye terminator

Clonal bridge amplification

Rice genome (Nipponbare plants)

Matsumoto et al. (2016)

Life technologies SOLiD4

Oligonucleotide 8-mer Clonal-emPCR chained ligation

RNA-seq and transcriptome

Liu et al. (2012)

Pac biosciences SMRT

Single-molecule Phospho-linked fluorescent nucleotide

Genome Seq X. oryzae in rice, WGS of Tapia et al. (2016); Triplett et

al. (2011); Mondal et al. (2020)

X. oryzae Indian race 4

Opportunities for Bioinformatics Tools for the Management

TABLE 17.3

289

Various Bioinformatics Tools Involved in NGS Data Analysis

SL. No. Name

Mode

1. 2. 3.

Offline Offline Offline

1. 2. 3. 4. 5. 6. 7. 1. 2.

References

Midha et al. (2017) Midha et al. (2017) Kaur et al. (2020); Midha et al. (2017) MUSCLE v3.8.31 Offline Multiple sequence alignment Bansal et al. (2018) ClustalW Both Multiple sequence alignment Triplett et al. (2011) CLUSTAL X (version 1.81) Both The most similar sequences were further aligned Triplett et al. (2011) Minimus2 in AMOS package Both contigs aligned and merged Chien et al. (2019) Bowtie2 (ver.2.2.4) Offline For alignment of pre-processed genome and for Battu et al. (2017); the short reads alignment to the reference genome Cheng et al. (2016) Tools for Assembly of Reads Paracel Genome Assembler 2.6.2. Online Metagenomic endophyte reads assembly Sessitsch et al. (2012) Unicycler v0.4.4 Offline Demultiplexing assembly Kaur et al. (2020) Canu, version 1.5 bionformatic tool Offline Used for de novo assembly. Mondal et al. (2020) CLC Genomics workbench 6.5 Offline Platform used for assembly of the raw sequences Chien et al. (2019); into contigs (