9th International Conference on the Development of Biomedical Engineering in Vietnam: Proceedings of BME 9, 2022, Ho Chi Minh City, Vietnam: Translational Healthcare Technology from Advanced to Low and Middle-Income Countries in the Era of Covid and Digital Transformation 9783031446306, 3031446305

Citation preview

IFMBE Proceedings 95

Van Toi Vo · Thi-Hiep Nguyen · Binh Long Vong · Ngoc Bich Le · Thanh Qua Nguyen Editors

9th International Conference on the Development of Biomedical Engineering in Vietnam Proceedings of BME 9, 2022, Ho Chi Minh City, Vietnam: Translational Healthcare Technology from Advanced to Low and Middle-Income Countries in the Era of Covid and Digital Transformation

IFMBE Proceedings Series Editor Ratko Magjarević, Faculty of Electrical Engineering and Computing, ZESOI, University of Zagreb, Zagreb, Croatia

Associate Editors Piotr Ładyżyński, Warsaw, Poland Fatimah Ibrahim, Department of Biomedical Engineering, Faculty of Engineering, Universiti Malaya, Kuala Lumpur, Malaysia Igor Lackovic, Faculty of Electrical Engineering and Computing, University of Zagreb, Zagreb, Croatia Emilio Sacristan Rock, Mexico DF, Mexico

95

The IFMBE Proceedings Book Series is an official publication of the International Federation for Medical and Biological Engineering (IFMBE). The series gathers the proceedings of various international conferences, which are either organized or endorsed by the Federation. Books published in this series report on cutting-edge findings and provide an informative survey on the most challenging topics and advances in the fields of medicine, biology, clinical engineering, and biophysics. The series aims at disseminating high quality scientific information, encouraging both basic and applied research, and promoting world-wide collaboration between researchers and practitioners in the field of Medical and Biological Engineering. Topics include, but are not limited to: • • • • • • • • • •

Diagnostic Imaging, Image Processing, Biomedical Signal Processing Modeling and Simulation, Biomechanics Biomaterials, Cellular and Tissue Engineering Information and Communication in Medicine, Telemedicine and e-Health Instrumentation and Clinical Engineering Surgery, Minimal Invasive Interventions, Endoscopy and Image Guided Therapy Audiology, Ophthalmology, Emergency and Dental Medicine Applications Radiology, Radiation Oncology and Biological Effects of Radiation Drug Delivery and Pharmaceutical Engineering Neuroengineering, and Artificial Intelligence in Healthcare

IFMBE proceedings are indexed by SCOPUS, EI Compendex, Japanese Science and Technology Agency (JST), SCImago. They are also submitted for consideration by WoS. Proposals can be submitted by contacting the Springer responsible editor shown on the series webpage (see “Contacts”), or by getting in touch with the series editor Ratko Magjarevic.

Van Toi Vo · Thi-Hiep Nguyen · Binh Long Vong · Ngoc Bich Le · Thanh Qua Nguyen Editors

9th International Conference on the Development of Biomedical Engineering in Vietnam Proceedings of BME 9, 2022, Ho Chi Minh City, Vietnam: Translational Healthcare Technology from Advanced to Low and Middle-Income Countries in the Era of Covid and Digital Transformation

Editors Van Toi Vo School of Biomedical Engineering International University—Vietnam National University Ho Chi Minh City, Vietnam

Thi-Hiep Nguyen School of Biomedical Engineering International University—Vietnam National University Ho Chi Minh City, Vietnam

Binh Long Vong School of Biomedical Engineering International University—Vietnam National University Ho Chi Minh City, Vietnam

Ngoc Bich Le School of Biomedical Engineering International University—Vietnam National University Ho Chi Minh City, Vietnam

Thanh Qua Nguyen School of Biomedical Engineering International University—Vietnam National University Ho Chi Minh City, Vietnam

ISSN 1680-0737 ISSN 1433-9277 (electronic) IFMBE Proceedings ISBN 978-3-031-44629-0 ISBN 978-3-031-44630-6 (eBook) https://doi.org/10.1007/978-3-031-44630-6 © The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 This work is subject to copyright. All rights are solely and exclusively licensed by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. This Springer imprint is published by the registered company Springer Nature Switzerland AG The registered company address is: Gewerbestrasse 11, 6330 Cham, Switzerland Paper in this product is recyclable.

Preface

Vietnam is a rapidly developing, socially dynamic country, where interest in biomedical engineering (BME) activities has grown steadily. Located in a low- and middle-income countries (LMIC) ecosystem, Vietnam yet has an intellectual workforce of an advanced country. Hence, these conferences organized in Vietnam offer unique forums for the BME international community to share experiences and develop support and collaboration networks to improve educational, research and entrepreneurship in LMIC and advanced countries. In January 2004, under the sponsorship of the U.S. National Science Foundation, Professor Vo Van Toi of the Biomedical Engineering Department of Tufts University, Medford, Massachusetts, the USA, led a U.S. delegation that consisted of Biomedical Engineering professors from different universities in the USA and visited several universities and research institutions in Vietnam to assess the state of development of this field. This delegation proposed a five-year plan that was enthusiastically embraced by the international scientific communities to actively develop collaborations with Vietnam. Within this framework, in July 2005, the First International Conference on the Development of Biomedical Engineering in Vietnam was organized by Professor Vo Van Toi at University of Technology in Ho Chi Minh City. From that conference, a Consortium of Vietnam-International Universities was created to advise and assist the development of Biomedical Engineering in Vietnamese universities. In July 2007, the Second International Conference on the Development of Biomedical Engineering in Vietnam was held at University of Technology in Hanoi with the participations of the Asia-Pacific International Molecular Biology Network (AIMBN), Biomedical Engineering Society Singapore (BESS), International Federation for Medical and Biological Engineering (IFMBE), Société Française de Génie Biologique et Médical (SFGBM) and IFMBE Asia-Pacific Working Group. In March 2009, International University (IU) established its Biomedical Engineering (BME) Department and the Engineer degree program in BME. The BME Department at IU has since established the International Conference on the Development of Biomedical Engineering, a biennial event. In January 2010, the Third International Conference on the Development of Biomedical Engineering in Vietnam was organized by IU in Ho Chi Minh City. It reflected the steady growth of the activities in this field in Vietnam and featured the contributions of researchers of 21 countries, including: Australia, Belgium, Canada, Denmark, France, India, Japan, Korea, Malaysia, New Zealand, Philippines, Poland, Russia, Singapore, Spain, Switzerland, Taiwan, Thailand, the UK, the USA and Vietnam. The conference was endorsed by the International Federation for Medical and Biological Engineering (IFMBE). It also hosted the Clinical Engineering Workshop of the IFMBE Asia-Pacific Working Group. The contributed papers were published in the IFMBE Proceedings Series by Springer (ISBN 978-3-642-12019-0).

vi

Preface

In January 2012, the Fourth International Conference on the Development of Biomedical Engineering in Vietnam was organized in Ho Chi Minh City as a megaconference. It was kicked off by the Regenerative Medicine Conference (Jan 8–10, 2012) with the theme “BUILDING A FACE” USING A REGENERATIVE MEDICINE APPROACH”, endorsed mainly by the Tissue Engineering and Regenerative Medicine International Society (TERMIS) and co-organized by Professor Stephen E. Feinberg, University of Michigan Health System, the USA; Professor Anh Le, University of Southern California, the USA; and Professor Vo Van Toi, International University— VNU-HCM, Vietnam. It was followed by the Computational Medicine Conference, endorsed mainly by the Computational Surgery International Network (COSINE) and the Computational Molecular Medicine of German National Funding Agency; and the General Biomedical Engineering Conference, endorsed mainly by the International Federation for Medical and Biological Engineering (IFMBE) (Jan 10–12) and co-organized by Professor Paolo Carloni, German Research School for Simulation Sciences GmbH, Germany; Professor Marc Garbey, University of Houston, the USA; and Professor Vo Van Toi, International University—VNU-HCM, Vietnam. It featured the contributions of 435 scientists from 30 countries, including: Australia, Austria, Belgium, Canada, China, Finland, France, Germany, Hungary, India, Iran, Italy, Japan, Jordan, Korea, Malaysia, Netherlands, Pakistan, Poland, Russian Federation, Singapore, Spain, Switzerland, Taiwan, Turkey, Ukraine, the UK, the USA, Uruguay and Vietnam. The contributed papers were published in the IFMBE Proceedings Series by Springer (ISBN 978-3-642-32182-5). In June 2014, the Fifth International Conference on the Development of Biomedical Engineering in Vietnam occurred at IU of VNU-HCM. It officially opened the season for celebration of the 20th anniversary of Vietnam National Universities—Ho Chi Minh City. It also marked the 10th anniversary of International University and the 5th anniversary of the Biomedical Engineering Department. This conference features 231 papers of 532 authors and co-authors from 26 countries including Australia, Bangladesh, Belgium, Canada, China, Croatia, Czech Republic, Denmark, Finland, France, Germany, India, Israel, Italy, Japan, Korea, Malaysia, Norway, Singapore, Slovenia, Switzerland, Taiwan, Turkey, the UK, the USA and Vietnam. Almost all Vietnamese institutions have their delegations. Besides Vietnam, the 2 countries that have the most contributors were the USA and Australia. The plenary session featured the lectures on the progress in different fields of Biomedical Engineering by 8 distinguished keynote speakers such as Prof. Ratko Magjarevic, President of IFMBE; Dr. Robert A. Lieberman, Vice-President of International Society for Optics and Photonics SPIE; Prof. Vo-Dinh Tuan, Director of Fitzpatrick Institute for Photonics, Duke University, the USA; Prof. Christian Griesinger, Director of Max Planck Institute for Biophysical Chemistry, Germany; Prof. Anja Boisen, Director of VKR Centre Of Excellence “NAMEC”, Denmark; Prof. Yin Xiao, Director of Australia-China Centre for Tissue Engineering and Regenerative Medicine, Queensland University of Technology, Australia; Prof. Yukio Nagasaki, Department of Materials Science and Medical Sciences, University of Tsukuba, Japan; and Prof. Fong-Chin Su, President of Taiwanese Society of Biomedical Engineering, Director, Medical Device Innovation Center, National Cheng Kung University, Taiwan. The contributed papers were published in the IFMBE Proceedings Series by Springer

Preface

vii

(Vol. 46, Editors: Vo Van Toi and Tran Ha Lien Phuong, 2015, ISSN 1680-0737 ISSN 1433-9277 (electronic), ISBN 978-3-319-11775-1 ISBN 978-3-319-11776-8 (eBook), DOI 10.1007/978-3-319-11776-8). The Sixth International Conference on the Development of Biomedical Engineering in Vietnam occurred from June 27 to June 29, 2016, at IU of VNU-HCM. The theme of the conference was Healthcare Technologies for Developing Countries. The contributed papers were from 417 authors and co-authors, of whom 253 were corresponding authors from 23 countries including Australia, Canada, China, Finland, France, Germany, Hong Kong, India, Indonesia, Italy, Japan, Korea, Malaysia, Norway, Portugal, Singapore, Spain, Taiwan, Thailand, the UK, the USA and Vietnam. Besides Vietnam, 3 countries had the most contributors that were Australia, the USA and Korea. Ten distinguished keynote speakers gave their talks in plenary sessions and special topics sessions. They were: Prof. Jeff W.M. Bulte, Professor of Radiology, Oncology, Biomedical Engineering and Chemical & Biomolecular Engineering, Director, Cellular Imaging Section, Institute for Cell Engineering, Johns Hopkins University School of Medicine, the USA; Prof. Paolo Carloni, German Research School for Simulation Sciences GmbH and Institute for Advanced Simulation (IAS), Germany; Prof. John Huguenard, Director, Neuroscience Graduate Program, Stanford University, Professional Advisory Board, Epilepsy Foundation, the USA; Prof. Ryuji Kohno, Director, Medical Information and Communication Technology Center, Yokohama National University, Japan, Distinguished Professor, University of Oulu, Finland; Dr. Sajeda Meghji, Emeritus Reader in Oral Biology, University College London (UCL), the UK; Prof. Beom-Jin Lee, Dean of College of Pharmacy, Ajou University, Head of the Pharmaceutical Research and Development Agency, Korean Pharmaceutical Manufacturing Associations, Korea; Prof. Yu-Lung Lo, Distinguished Professor, Head of Department of Mechanical Engineering, National Cheng Kung University, Taiwan; Prof. Yasuhiko Tabata, Chairman, Department of Biomaterials, Institute for Frontier Medical Sciences, Kyoto University, Board of Governors, Tissue Engineering Society International, Japanese Society of Biomaterials, Japanese Tissue Engineering Society, Society for Hard Tissue Regenerative Medicine, Japanese Society of Inflammation and Regeneration, Japan Society of Drug Delivery System, Japanese Regenerative Medicine Society, Japan; Prof. Christopher Wildrick Woods, Director of Master of Science in Global Health, Director of Graduate Studies, Duke Global Health Institute, Duke University, Chief, Infectious Diseases Division, Durham VA Medical Center, the USA; and Prof. Hairong Zheng, Director of National Engineering Laboratory—Medical Imaging Technology and Equipment, Director of SIAT— Institute of Biomedical and Health Engineering, Director of Paul C. Lauterbur Research Centre for Biomedical Imaging, Shenzhen Institutes of Advanced Technology (SIAT), Chinese Academy of Sciences, China. Furthermore, 44 invited speakers gave their talks or tutorial lectures in the parallel sessions including Materials for Biomedical Applications, Biomechanics, Lab-ona-chip & Point-of-Care Technologies, Mathematical Modeling in Medicine, Biophotonics, Public Health, Pharmaceutical Sciences and Biomedicine, Medical Instrumentations, Healthcare Information Technology and Bioinformatics, Biomedical Signal & Image Processing, Neuroscience and Neuroengineering, Advanced in Stem Cell and

viii

Preface

Cell Reprogramming, Molecular and Cellular Techniques in Medicine, Ultrasonic Characterization of Bone Tissues and Advanced Molecular Simulation and Experimental Biophysical Approaches for Drug Design. In addition, the Vietnam–UK workshop in the BME field which was funded by the Newton Fund Researcher Links of British Council was conjointly organized by Prof. Le Hoai Quoc (SHTP), Dr. Le Chi Hieu (University of Greenwich) and Prof. Vo Van Toi (BME-IU) and coordinated by Dr. Le Quoc Trung (BME-IU). Researchers from 10 UK universities: (1) University of Greenwich, (2) Cardiff University, (3) North Umbria University, (4) Sheffield University, (5) University of Hertfordshire, (6) Newcastle University, (7) Oxford University, (8) London South Bank University, (9) University of Derby and (10) Aston University and representatives of British Council participated. The last day of the workshop was devoted to a round-table discussion among 21 Vietnamese and 12 UK researchers. Other activities included a field trip to visit SHTP and a new medical device manufacturer, and social events were also organized to introduce to the international guests Vietnamese culture. The contributed articles were published in the “IFMBE Proceedings Series”, Vol. 63 by Springer, Editors: Vo Van Toi, Nguyen Le Thanh An and Nguyen Duc Thang, ISBN: 978-981-10-4360-4, 2017. Sponsors included VNU-HCM, IU, Office of Naval Research Global, U.S. Army International Technology Center—Pacific, Springer, IFMBE, SHTP, NAFOSTED, Newton Fund, Korea United Pharm. Inc., Global IMD Center, ESTC and others. The Seventh International Conference (BME7) on the Development of Biomedical Engineering in Vietnam occurred from June 27 to June 29, 2018, at IU of VNU-HCM. The theme of BME7 was Translational Health Science and Technology for Developing Countries. This conference featured 202 papers, including 145 oral talks and 57 posters, of about 500 authors and co-authors from 19 countries including Australia, Canada, China, Czech, France, Germany, Israel, Italy, Japan, Korea, the Netherlands, Portugal, Singapore, Switzerland, Taiwan, Thailand, the UK, the USA and Vietnam. Besides Vietnam, 3 countries had the most contributors that were the UK, Korea and the USA. Fifteen distinguished keynote speakers gave their talks either in plenary sessions for the general public or in parallel sessions in in-depth specific topics. They were: (1) Jeff Bulte, Professor of Radiology, Oncology, Biomedical Engineering and Chemical & Biomolecular Engineering, Johns Hopkins University School of Medicine, the USA; (2) Nigel Culkin, Professor of Enterprise and Entrepreneurial Development, Fellow and Past-President of the Institute of Small Business and Entrepreneurship (ISBE), University of Hertfordshire, the UK; (3) Guillaume Haiat, Senior Research Director, French National Centre for Scientific Research, Paris, France; (4) Sunderesh S. Heragu, Professor and Head of School of Industrial Engineering and Management, Donald and Cathey Humphreys Chair, Oklahoma State University, the USA; (5) Beom-Jin Lee, Professor and Dean of College of Pharmacy, Ajou University, Head of the Pharmaceutical Research and Development Agency, Korean Pharmaceutical Manufacturing Associations, Korea; (6) Yung-cang Li, Professor of School of Engineering, RMIT University, Australia; (7) Paul Milgram, Professor of University of Toronto, Department of Mechanical & Industrial Engineering, Institute of Biomaterials and Biomedical Engineering, Toronto, Canada;

Preface

ix

(8) Nam-Trung Nguyen, Professor and Director of Queensland Micro- and Nanotechnology Centre, Griffith University, Queensland, Australia; (9) Ruth Nussinov, Professor and Senior Principal Investigator of National Cancer Institute and Tel Aviv University, Israel; (10) Wellington Pham, Associate Professor of Radiology and Radiological Sciences, Biomedical Engineering, Vanderbilt University School of Medicine, the USA; (11) Evan Y. Snyder, Professor of Stanford Burnham Prebys (SBP) Medical Discovery Institute, Director of Center for Stem Cells and Regenerative Medicine, Director of Stem Cell Research Center, Stanford Children’s Health Research Center, the USA; (12) Masahiro Takei, Professor and Vice-Dean of Department of Mechanical Engineering, Medical System Engineering, Chiba University, Japan; (13) Alex Vitkin, Professor of Medical Biophysics and Radiation Oncology, University of Toronto, Canada; (14) Cui Wen, Distinguished Professor of School of Engineering, RMIT University, Australia; and (15) Ping Xue, Professor of the Department of Physics, Tsinghua University, China. Furthermore, 15 invited speakers gave their talks or tutorial lectures in the parallel sessions including: Medical Instrumentations and Entrepreneurship, Biomaterials and 3D Printing, Nanomedicine and Drug Delivery Systems, Biophotonics, Biomechanics, Translational Health Science and Technology for Developing Countries, Recent Computational and Experimental Advances in Molecular Medicine, Regenerative Medicine and Tissue Engineering, Lab-on-a-chip & Point-of-Care Technologies, Biomedical Signal and Image Processing, Public Health: Cancer Therapy and Reconstructive Surgery and Advanced Technologies in Sleep Diagnosis and Sleep Medicine. In addition to these activities, a memorable event at the BME7 was the Award Ceremony of the Keylab to Prof. Ruth Nussinov, Professor and Senior Principal Investigator of National Cancer Institute (the USA) and Tel Aviv University, Israel; and the Signing Ceremony of the Memorandum of Understanding (MOU) between IU and Chung Hsing National University, Taiwan, as well as the MOU between the Biomedical Engineering Departments of IU and of Gwanju Institute of Science and Technology (GIST), Korea. In addition, the Vietnam–UK (VN-UK) Newton Workshop in the BME field was organized under the auspice of Researcher Links workshop grant delivered by British Council. Researchers from the UK and Vietnam met together to determine the opportunities for long-term collaboration. The mentors of the workshop included Prof. Le Hoai Quoc (SHTP), Prof. Vo Van Toi (BME-IU), Prof. Tony Cass (Imperial College London) and Prof. Nguyen T.K Thanh (University College London). The coordinators were Dr. Cecile Perrault—Lecturer, Department of Mechanical Engineering, University of Sheffield, UK, and Dr. Huynh Chan Khon, Lecturer at BME-IU. The workshop aimed to establish Microfluidics, Nanomaterials and Point-of-Care networks and stimulate collaborations on the R&D, technology transfer and entrepreneurship between the UK and Vietnam. It gathered 15 experts from 11 UK well-known institutions, more than 20 experts from different research, education and business institutions in Vietnam and representatives of British Council. Eleven UK universities including: (1) University College London, (2) Imperial College London, (3) University of Sheffield, (4) Newcastle University, (5) Coventry University, (6) University of Brighton, (7) University of Oxford, (8) University of Cambridge, (9) Manchester Metropolitan University (10) University of Portsmouth and (11) Oxford University Clinical Research Unit in Vietnam. Mr. Nguyen Minh Tuan, Head of Vietnam Ministry of Health’s Medical Equipment and Construction

x

Preface

Department, was the main invited speaker. The last day of the workshop was devoted to a round-table discussion among researchers. Several funding agencies in Vietnam and the UK were introduced. Many collaborative projects were identified to pave the way for follow-up concrete research proposals to be submitted for funding. Furthermore, Professor Vo Van Toi and BME Department faculty met with interested BME groups elsewhere and individual researchers below to discuss future mutual collaborations: (1) Dr. Tani Tohru’s group from Japan (Image guided surgery, Novel surgery methods); (2) Prof. Guillaume Haiat from France (Biomechanics, Quantitative ultrasound); (3) Prof. Sun Kim and 3 other professors from the BME Dept., Hanyang Uni., South Korea (Biosignal acquisition and processing system for educational purpose, Ubiquitous healthcare...); and (4) Prof. Jae Gwan Kim and 4 other professors from the BMSE Dept., GIST, South Korea (Biophotonics, Genomic medicine, Sleep medicine...). Several BME companies exhibited their products during the conference. Other activities included a field trip to visit manufacturers in SHTP. A banquet and social events were also organized to introduce to the international guests Vietnamese culture. Sponsors: VNU-HCM, IU, Office of Naval Research Global, VNPT, IFMBE, NAFOSTED, SHTP, Newton Fund, British Council, Korea United Pharm. Inc., CUBE DCM Korea, Vitech Development Co. Ltd., T&N Trading and Investment Co. Ltd., Tan Mai Thanh Medical and Instrument Co. Ltd., BCE Vietnam Co. Ltd., Ho Chi Minh City Department of Science and Technology, Cao Thang International Eye Hospital, SISG Group, EST Co. JSC., PTK Co. Ltd. and many others. More information on the BME7 can be found at: http://csc.hcmiu.edu.vn/bmeconf/bme2018/. The contributed articles were published in the “IFMBE Proceedings Series”, Vol. 69 by Springer, Editors: Vo Van Toi, Le Quoc Trung, Ngo Thanh Hoan and Nguyen Thi Hiep, ISBN: 978-981-13-5859-3. 2020. This is a book series, owned by the International Federation of Medical and Biological Engineering (IFMBE). The book series publishes the proceedings of all IFMBE conferences as printed books as well as electronic books on CD/DVD and Springer content platform link.springer.com. Every paper receives a DOI and is fully citable and recognized by several indexing services. The Eighth International Conference (BME8) on the Development of Biomedical Engineering in Vietnam was originally planned for July 2020 with the theme: “Healthcare Technology for Smart City in Low- and Middle-Income Countries”. The organizing committee of the conference received 153 submissions from 348 authors and co-authors from 20 countries, including Australia, Canada, France, Germany, India, Indonesia, Italy, Japan, Korea, Norway, Philippines, Spain, Singapore, Sweden, Switzerland, Taiwan, Thailand, the UK, the USA and Vietnam. However, since the COVID-19 pandemic was in full force, the planned face-to-face meeting was canceled. Yet, each manuscript was pre-reviewed by a Program Committee (PC) member before it was reviewed by two independent reviewers. The accepted manuscripts appeared in “IFMBE Proceedings Series”, Vol. 85 by Springer, Editors: Vo Van Toi, Thi Hiep Nguyen, Vong Binh Long and Ha Thi Thanh Huong, ISBN: 978-3-030-75505-8, 2022. Unlike the previous proceedings, this 1,074 page one was printed in B5 format and in color. The Ninth International Conference (BME9) on the Development of Biomedical Engineering in Vietnam occurred from December 27 to December 29, 2022, when the

Preface

xi

pandemic situation was under control, with the theme: “Translational Healthcare Technology from Advanced to Low- and Middle-Income Countries (LMIC) in the Era of Covid and Digital Transformation”. The conference website: https://bme.hcmiu.edu.vn/ bme9/. This conference was under the jurisdiction of Vietnam National Universities in Ho Chi Minh City (VNU) and co-organized by the School of Biomedical Engineering and the School of Medicine, both are members of VNU-HCM. Our sponsors included: Science and Technology Division of HCM City and the following companies: Thai Binh Scientific, Korea Pharma, BCE Việt Nam, T&N, Life Sciences, Merck Vietnam, Công Ty Giải Pháp Y Sinh ABT, ITS VN_Vạn Nam, DKSH, Dolomite-Blacksheep, Vitech, Trung Sơn TSSE, TABC, SISC, T&H and Mediworld. The organizing committee of the conference received 161 submissions from 455 authors and co-authors from 14 countries, including Australia, France, Germany, Iran, Japan, Korea, Malaysia, New Zealand, Saudi Arabia, Switzerland, Taiwan, the UK, the USA and Vietnam. Eight distinguished keynote speakers gave their talks in the plenary sessions for the general public: Prof. Anh D. Le, University of Pennsylvania, the USA; Prof. Nguyen Van Tuan, University of Technology Sydney, Australia; Prof. Nagasaki Yukio, University of Tsukuba, Japan; Prof. Mark Johnson, Northwestern University, the USA; Prof. Beom-Jin Lee, Ajou University, Korea; Prof. Chung-Gyu Park, Seoul National University, Korea; Prof. Thanh Duc Nguyen, University of Connecticut, the USA; and Prof. Karlheinz Peter, Baker Heart and Diabetes Institute, Australia. Nine invited speakers gave talks in parallel sessions on in-depth specific topics: Prof. Hang Ta, Griffith University, Australia; Prof. Michinao Hashimoto, Singapore University of Technology and Design; Prof. Nghiem Doan, Griffith University, Australia; Prof. Xiaowei Wang, Baker Heart, and Diabetes Institute, Australia; Dr. Justin Burrell, Center for Innovation & Precision Dentistry at the University of Pennsylvania, the USA; Dr. Hyun Je Kim, Seoul National University, Korea; Prof. Tien-Tuan Dao, Centrale Lille Institute, France; Prof. Vu-Hieu Nguyen, Université Paris-Est Créteil, France; and Prof. Yuning Hong, Department of Biochemistry and Chemistry, La Trobe Institute for Molecular Science, La Trobe University, Australia. In these proceedings, selected and carefully single-blind peer-reviewed manuscripts will appear under 11 topics: Medical Instrumentations; Tissue Engineering and Regenerative Medicine; Pharmaceutical Engineering; AI and Data Science for Healthcare; Molecular Medicine; Lab-on-a-chip and Microfluidics; Biophotonics; Biomedical Entrepreneurship; Neuroengineering; Modelling and Simulation in Biomedical Engineering; and Miscellany. The IFMBE Proceedings are indexed by Scopus, Scimago, Google Scholar and EI Compendex, among others. They are also submitted to Thomson Reuters (Clarivate, ISI Proceedings) for evaluation. For your search convenience, the author index is published at the end of this proceeding. We would like to thank all sponsors, the PC members and external reviewers who devoted their valuable time to reviewing and providing constructive feedback to the authors. Finally, we would like to thank Springer Publisher for their best assistance.

Organization

Editors Vo Van Toi Nguyen Thanh Qua Le Ngoc Bich Vong Binh Long Nguyen Thi Hiep

International University, VNU-HCM, Vietnam International University, VNU-HCM, Vietnam International University, VNU-HCM, Vietnam International University, VNU-HCM, Vietnam International University, VNU-HCM, Vietnam

PC Members Vo Van Toi Nguyen Thanh Qua Vong Binh Long Nguyen Thi Hiep Le Ngoc Bich Ha Thi Thanh Huong Pham Thi Thu Hien Tran Le Giang Huynh Chan Khon Truong Phuoc Long Trinh Nhu Thuy Ngo Thi Lua Vu Duy Hai Tran Duc Tan Nguyen Hong Van Nguyen Minh Nam Vo Van Giau Nguyen Minh Hien Pham Anh Vu Thuy Do Thi Thu Hang Nguyen Phuong Thuy Nguyen Thuy Trang Nguyen Trinh Trung Duong

International University, VNU-HCM, Vietnam International University, VNU-HCM, Vietnam International University, VNU-HCM, Vietnam International University, VNU-HCM, Vietnam International University, VNU-HCM, Vietnam International University, VNU-HCM, Vietnam International University, VNU-HCM, Vietnam International University, VNU-HCM, Vietnam International University, VNU-HCM, Vietnam International University, VNU-HCM, Vietnam International University, VNU-HCM, Vietnam International University, VNU-HCM, Vietnam Ha Noi University of Science and Technology, Vietnam Phenikaa University, Vietnam International University, VNU-HCM, Vietnam School of Medicine, VNU-HCM, Vietnam School of Medicine, VNU-HCM, Vietnam School of Medicine, VNU-HCM, Vietnam School of Medicine, VNU-HCM, Vietnam School of Medicine, VNU-HCM, Vietnam Seoul National University, Korea Industrial University of Ho Chi Minh City, Vietnam University of Copenhagen, Denmark

xiv

Organization

And Editing Team Nguyen Hoang Phuc Nguyen Thao Vi Nguyen Ho Song Hao Nguyen Thi Thanh Ngoc

International University, VNU-HCM, Vietnam International University, VNU-HCM, Vietnam International University, VNU-HCM, Vietnam International University, VNU-HCM, Vietnam

Notes Vietnam National Universities in Ho Chi Minh City (VNU-HCM) is one of the two leading university networks in Vietnam reporting directly to the Prime Minister of the country. It was founded in January 1995 and currently has 7 university members and several research institutions for a total of more than 5600 staff (including 2600 teaching staff), 60,000 full-time undergraduates, 7946 master’s and 1050 Ph.D. students. International University (IU) of VNU-HCM was established in 2003 to be a platform to promote the reform of higher education in Vietnam. It is the first public university that teaches all courses in English. It has extensive collaborations with many universities in Australia, New Zealand, Thailand, the UK, and the USA. At IU, there are about 9,400 students, 300 faculty and 200 staff. The School of Biomedical Engineering Department (BME) at IU was established in 2009 as the Department of IU and became a School in 2019. It offers accredited degrees of engineering, master’s and Ph.D. in BME. Its activities concentrate on the Design and Applications of Medical Devices to satisfy the urgent need of the country. Other activities include Signal and Image Processing, Pharmaceutical Engineering and Regenerative Medicine. The School promotes the close relationship between education, research and entrepreneurship. Its motto is high quality, sustainability and usefulness. It has more than 420 undergraduate and graduate students and 28 faculty and staff. In December 2015, the BME-IU undergraduate program was assessed by the ASEAN University Network Quality Assessment (AUN-QA) and ranked as the best in Vietnam and 2nd best in ASEAN of all programs assessed by AUN till that time. In 2019, it was accredited by the American-based ABET. Professor Vo Van Toi, Vice-Provost for Life and Health Science, Engineering and Technology Development of IU and Founder of the BME Department, obtained his Ph.D. in Micro-engineering at the Swiss Federal Institute of Technology—Lausanne (EPFL), Switzerland, in 1983. From 1983 to 1984, he was Postdoctoral Fellow at the Health Science and Technology Division (HST), a joint program of Harvard-MIT (USA). From 1984 to 2009, he was Faculty of the School of Engineering at Tufts University. He was Co-chair of the joint educational programs between the School of Engineering and School of Medicine and between the School of Engineering and School of Dental Medicine. From 1991 to 1992, he was on sabbatical from Tufts to be Research Professor at the Scheie Eye Research Institute of University of Pennsylvania (USA). From 1992 to 1994, he helped create and was Vice-Director of the Eye Research Institute in Sion (Switzerland). He was instrumental in establishing the BME Department at Tufts

Organization

xv

in 2003. From 2004 to 2007, he was nominated by President G. Bush to be Member of the Board of Directors of the Vietnam Education Foundation (VEF), a U.S. federal agency established by the U.S. Congress to bring the USA and Vietnam closer through educational exchanges related to science, engineering, mathematics, medicine and technology. From 2007 to 2009, he was on leave from Tufts to be Executive Director of VEF. In 2009, he resigned from VEF and took early retirement from Tufts to go back to Vietnam to establish and chair the BME Department at IU until 2018. He initiated the International Conferences on the Development of Biomedical Engineering. His research interests include the Design and Applications of Medical Devices, the Mechanism of Human Visual Systems, Ophthalmology and Telemedicine. For more information, please contact: Professor Vo Van Toi School of Biomedical Engineering International University - Vietnam National Universities Ho Chi Minh City, Vietnam Tel: (84-8) - 37 24 42 70 Ext. 3237 Website: www.hcmiu.edu.vn/bme Email: [email protected]

Organizers

Platinum Sponsors

Gold Sponsor

xvi

Organization

Silver Sponsors

Bronze Sponsors

Contents

Medical Instrumentations A Novel Device for Simultaneously Grinding Multiple Tissue Samples Without Cross-Contamination . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Hung Quoc Nguyen, Phong Nguyen Tran, Thai Minh Do, Viet Ngoc Tran, Toan Nguyen Anh Tran, and Toi Van Vo Development of a Smart Guidewire for Intravascular Sensing . . . . . . . . . . . . . . . Chao-Wei Dong, Dong-Hyun Joo, Ki-Jeong Moon, Se-Yeon Yoon, Hua Quang Huy Nguyen, and Woo-Tae Park Design and Implementation of an Assist Device in Data Collection and Rehabilitation Assessment for Patients with Limited Mobility after Stroke When Applying Constrained Induced Movement Therapy-the First Phase . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Anh-Khoa Tran, Thi-Thu-Hien Pham, Chi-Thanh Nguyen, and Ngoc-Bich Le Developing a Solid Health-Care Waste Incinerator for Disposing Waste Generated from Covid-19 Treatment and Quarantine Facilities . . . . . . . . . . . . . . Vu Duy Hai, Vu Anh Duc, Tran Quoc Vi, and Hoang Thi Mai Phuong Design of Ankle Brachial Index Measuring System for Detecting Peripheral Arterial Disease with Companion Mobile App . . . . . . . . . . . . . . . . . . Vu Duy Hai, Nguyen Bach Duy, Nguyen Thuy Duyen, and Tran Viet Quang Trung Research to Construct Intelligent Control Devices Using Brain Waves for the Disabled . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Huy Khoi Do, The Dung Nguyen, and Thi Bich Diep Nguyen Development of a Wireless Wearable Holter to Measure Blood Pressure and Heart Rate for Telemedicine . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Tien Thi Thuy Le, Viet Ngoc Tran, Nguyen Khoi Pham, Hung Quoc Nguyen, Nga Thi Tuyet Tu, and Toi Van Vo Cyber Telemedicine System Dedicated to Homecare Monitoring for Cardiovascular Diseases . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Nguyen Khoi Pham, Tien Thi Thuy Le, Viet Ngoc Tran, Hung Quoc Nguyen, Nga Thi Tuyet Tu, and Toi Van Vo

3

22

33

49

65

79

88

104

xviii

Contents

A Precision, High Intensity and Programmable Current Power Supply for LED in Biomedical Applications . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Viet Ngoc Tran, Qua Thanh Nguyen, Tien Thi Thuy Le, Nguyen Khoi Pham, and Toi Van Vo Cycling Rehabilitation Device – Design Solution . . . . . . . . . . . . . . . . . . . . . . . . . . Cai Viet Anh Dung, Nguyen Viet Thang, Tran The Thong, Vu Van Chien, Tran Minh Tri, Ngo Kim Long, Huynh Tan Hung, Vo Hong Cuong, Nguyen Minh Thong, Tran Van Hau, Lam Minh Yen, Nguyen Thi Le Thanh, Ho Bich Hai, Dang Phuong Thao, Thomas Rollinson, Nguyen Thi Kim Anh, Huynh Long Triet Giang, Louise Thwaites, and Linda Denehy Design of a Printer–Based Line Dispenser for Lateral Flow Assay Fabrication . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Tien Luong, An Van, Doan Hong Ngoc Tran, Dang Phu-Hai Nguyen, Thanh-Qua Nguyen, Le-Giang Tran, and Khon Huynh

119

130

139

Tissue Engineering and Regenerative Medicine The Effect of Sintering Temperature on the Behavior of Hydroxyapatite from Different Natural Sources in Artificial Saliva . . . . . . . . . . . . . . . . . . . . . . . . Nhi Thao-Ngoc Dang, Thien-Ly Vu, Tram Anh-Nguyen Ngoc, Thanh-Dat Nguyen, Toi Van Vo, and Thi-Hiep Nguyen Physico-Chemical Characterization of Animal Bone-Derived Hydroxyapatite Sintered at Different Temperatures . . . . . . . . . . . . . . . . . . . . . . . . Nhi Thao-Ngoc Dang, Tram Anh-Nguyen Ngoc, Thien-Ly Vu, Diu-Anh Phan, Toi Van Vo, and Thi-Hiep Nguyen Design and Evaluation of Simple Artificial Vascular Graft Bioreactor System . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Anh-Thai Huynh, Minh-Duy Le, Hoang-Huy Nguyen, and Thi-Hiep Nguyen Enhancing Stability of in Situ Crosslinked Hydrogel N,O-Carboxymethyl Chitosan – Aldehyde Hyaluronate by Supplementing Ionic Crosslinking of Alginate and Calcium Ions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Tuan-Ngan Tang, Quynh Duong-Tu Nguyen, Thao-Nhi Dang-Ngoc, and Thi-Hiep Nguyen

157

164

172

190

Contents

Fabrication and Characterization of Oxidizedbacterial Cellulose Membrane as a Potential Hemostatic Dressing . . . . . . . . . . . . . . . . . . . . . . . . . . . . Tram Hoang-Bao Tran, Thy Minh Nguyen, Hai Huu Nguyen, Bao Gia Nguyen, Khue Le-Minh Tran, and Thi Hiep Nguyen Investigation of Codonopsis Javanica Root Extract on Open Wound Model: In Vitro and In Vivo Studies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Nghia Hieu Bui, Khoa Ngoc-Khanh Tran, Chi Thi-Kim Le, and Thi-Hiep Nguyen Evaluation of Reactive Oxygen Species Production in Human Adipose Tissue-Derived Mesenchymal Stem Cells under High D-Glucose Condition . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Nhi Nguyen-yen Ha, Long Binh Vong, and Thuy Nhu Trinh

xix

206

219

231

The Effect of 10% Platelet-Rich Plasma on In-Vitro Wound Healing Ability of Adipose Tissue-Derived Mesenchymal Stem Cells Under High D-Glucose Conditions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Chau Ngoc-Minh Trinh, Nhi Nguyen-yen Ha, Long Binh Vong, My Ngoc-hoang Nguyen, Thuy Nhu Trinh, and Tho Thi-kieu Nguyen

241

Investigate the Effect of Vitamin D3 on Osteogenic Differentiation of Mesenchymal Stem Cells Derived from Adipose Tissue (AT-Mscs) Under High D-Glucose Levels . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Anh Hong Pham, Nhi Nguyen-yen Ha, Tan Thi-kim Huynh, Long Binh Vong, and Thuy Nhu Trinh

251

Preparation and Characterization of the Hydrogel System N, O-Carboxymethyl Chitosan/Oxidized Xanthan Gum . . . . . . . . . . . . . . . . . . . . . . . Phuc Hong Vo, Dat Quoc Do, Binh Thanh Vu, Tuan-Ngan Tang, Hoan Ngoc Doan, Phan Thi Thanh Tam, and Thi-Hiep Nguyen

261

Drug Delivery and Pharmaceutical Engineering Potential of Biosynthesized Silver Nanoparticles (AgNPs) to Promote Growth and Control Plant Pathogenic Bacteria of Lotus (Nelumbo nucifera) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Nguyen Quang Hoang Vu, Nguyen Dai Chau, Pham Thi Thanh Mai, Hoang Tan Quang, and Hoang Thi Kim Hong Preparation of Trimethyl Chitosan Nanoparticles for Spike Proteins Delivery . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Minh-Dat Quoc Tang, Hien Huu Tran, Thu-Ha Thi Nguyen, Nhu-Thuy Trinh, Van Toi Vo, and Long Binh Vong

275

286

xx

Contents

Silver Nanoparticle Inhibited Levofloxacin Resistance Development in Staphylococcus aureus . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Ngoc Tung Dang, Van Nhi Tran, and Thi Thu Hoai Nguyen

297

Catalase-Like Nanozymes and Their Applications in Alleviating Tumor Hypoxia for the Therapeutic Enhancement . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Dinh Nam Nguyen and Kim Truc Nguyen

309

Simple Magnetic Nanoparticle-Based System for Gene Delivery . . . . . . . . . . . . Tuan Huy Pham, Duc Minh Huy Nguyen, Hoang Kim Truong, and Thi Hai Yen Tran Solid Dispersion for Enhancing Bioactive Effectiveness of Resveratrol: A Mini Review . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Quyen Phuoc Le, Vy Nguyen-Thao Le, Tru Van Nguyen, and Van Hong Nguyen Characteristics of Ethanolic Cordyceps Militaris Extract by Ultrasonic-Assisted Extraction Method . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Thi Xuan Trinh, Bao Nghi Nguyen, Thanh Trung Nguyen, Van Trung Phung, and Thi Thu Hoai Nguyen Development of a Water-Soluble BODIPY Photosensitizer for Photodynamic Therapy . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Yu-Hsuan Kuo, Chia-Feng Hsieh, Xuan-Yu Chen, and Cheng-Chung Chang Synthesis and Application of Fluorescent Dye BMVA-12C in Imaging of Lung Cancer . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Dat Thanh Dinh, Min-Wei Wu, Dev-Aur Chou, and Cheng-Chung Chang Development of a Novel Sonosensitizer for Sonodynamic Therapy . . . . . . . . . . Tun-Pin Hung, Chia-Feng Hsieh, and Cheng-Chung Chang

324

333

348

363

373

383

Artificial Intelligent and Data Science for Health School Violence Detection with CNN and LSTM . . . . . . . . . . . . . . . . . . . . . . . . . Minh Bao Le Nguyen, Binh Thanh Nguyen, and Tin Dang Thanh The Fusion of Feature Extraction Applications and Blurring Techniques for Classifying Irish Sign Language . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Phuoc Thanh Nguyen, Viet Quoc Huynh, Thuan Nguyet Phan, and Tuan Van Huynh

395

404

Contents

Application of Artificial Neural Network in Deception Detection Based on Visual Cues . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Hoang Bao Vy Dinh and Quang Linh Huynh Evaluation of the Optimal Timing of Diagnosis/Prognosis of Myocardial Infarction Using the MLP Artificial Neural Network . . . . . . . . . . . . . . . . . . . . . . . Huynh Luong Nghia, Dinh Van Quang, Bui Xuan Quan, and Nguyen Thi Thuy A Deep Learning Approach to Personality Identification . . . . . . . . . . . . . . . . . . . Le Xuan Hieu, Le T. H. Toan, and Ngo Thanh Hoan Enhancing Cervical Vascular Pattern Segmentation Based on Mathematical Morphology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Vu Quoc Anh, Tran Van Tien, Ly Anh Tu, and Phan Ngoc Khuong Cat Classification of Alzheimer’s Diseases’ MRI Brain Images Leveraging 3D Convolutional Neural Networks . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Vo Quang-Tran, Nguyen Trung-Tin, B. T. Nhu Thuan, Bui Trung-Tin, Ngo Thanh-Hoan, and Ngo Lua Seizure Detection Using the Empirical Mode Decomposition and Domain Adaptation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Nguyen Thi Minh Huong and Huynh Quang Linh Brain Cell Segmentation from the LIVECell Dataset Using Deep Learning . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Hoang Nhut Huynh, Anh Tu Tran, Hong Duyen Trinh Tran, and Trung Nghia Tran

xxi

418

429

439

451

462

479

494

Design a System to Automatically Detect Common Skin Diseases Using Deep Learning and Web Application . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Phuc Hoang Nguyen, Hoan Thanh Ngo, and Lua Thi Ngo

506

Retinal Vessels Segmentation Based on Enhancing Multi-scale Line Detection . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Nguyen Mong Hien

519

Block-Based Texture Features for Chromoendoscopy Classification . . . . . . . . . . Viet Dung Nguyen, Hoang Nam Trinh, and Hoang Khoi Do Data Augmentation Techniques in Automatic Translation of Vietnamese Sign Language for the Deaf . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Duy Cop Do, Thi Tuyen Ho, and Thi Bich Diep Nguyen

529

540

xxii

Contents

Neer Classification on X-Ray and Computed Tomography of Patients Treated Proximal Humerus Fracture by Surgery at Military Hospital 175 . . . . . Nguyen Anh Sang, Phan Dinh Mung, Nguyen Ha Ngoc, Nguyen Thanh Cong, and Nguyen Dang Huy

551

Lab-on-Chip and Microfluidics Quantitative Thrombogenesis Analysis in an In-vitro Microfluidic Chip Using Image Analysis and CFD . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Ji-Seob Choi, Dong-Hwi Ham, Jung-Hyun Kim, Pyeong-Ho Jeong, Helem Betsua Flores Marcial, Jin-Ho Choi, and Woo-Tae Park Fabrication and Evaluation of Silk Microneedle Using Replica Molding from Milled Master Mold . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Hong-Phuc Pham, Mai-Phuong Le, Le-Giang Tran, and Thanh-Qua Nguyen Low-Cost Lateral Flow Dispenser System for Manufacturing Rapid Test Kits . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Yen Khanh Ngo, Tran Gia Linh Le, and Khon Huynh The Development of a Portable and Reusable Ketamine Sensor . . . . . . . . . . . . . Deng-Yun Jheng, Nguyen Van Hieu, Ngoc Luan Tran, Hsing-Ju Wu, Pei-Yi Chu, Thien Luan Phan, and Congo Tak Shing Ching The Formation of Fibrillar Fibronectin Under the Effect of Abnormal Shear Rate Within a Stenosis Vessel . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Bao-An Van, Dao N. Y. Khoa, Uyen Nguyen, Hoang-Nghi Mai Thi, Thanh-Qua Nguyen, and Khon Huynh Immobilization of Anti-hCG Antibody to Nitrocellulose via Protein G . . . . . . . Mai Thi Le, Anh Van Thi Le, Ngan Nguyen Le, Phuong Hong Lam, Duc Minh Trinh Dinh, Dung My Thi Dang, Tin Chanh Duc Doan, and Chien Mau Dang A Comparison of Single-Sized and Mixed-Sized Particles on Lateral Flow Assay Performance for SARS-CoV-2 Nucleocapsid Protein Detection . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Minh Hieu Vu and Khon Huynh Advancing Nucleic Acid Amplification Assay Analysis on Electrowetting-on-Dielectric Digital Microfluidic System with Integrated Impedance Analyzer . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Tuan Hoang, Tran Gia Linh Le, Yen Khanh Ngo, and Khon Huynh

563

573

583

591

600

615

631

641

Contents

xxiii

Biophotonics Optical Design for Automatic Inspection System of Defects on Disposable Surgical Scalpel Blades Using Machine Vision . . . . . . . . . . . . . . . Sy Hieu Dau, Thi Phuc Dang, Doan Quang My Han, Ta Chiu Hy, Le Nguyen An Khang, and Khau Nguyen Thanh Dat Study of Spinal Deformity by Optical Formetric Method . . . . . . . . . . . . . . . . . . . Quoc Khai Le, Quoc Khanh Vo, Thao Hoang Nguyen, The Thuong Nguyen, and Quang Linh Huynh Investigation of the Glucose Molar Absorptivity Concerning Sugar Concentration from Visible to Mid-Infrared (450 – 1550 nm) . . . . . . . . . . . . . . . Trung Tin Tran, My Ngoc Nguyen Thi, Van Phat Truong, My Nga Truong, and Trung Nghia Tran Evaluating the Effectiveness of Using Low-Level Laser Therapy for the Healing Process of Third-Degree Burns in Mice . . . . . . . . . . . . . . . . . . . . Tuan Anh Do, Hoang Cam Nguyen Le, Binh Long Vong, and Thi-Thu-Hien Pham Pesticide Detection Based on Surface-Enhanced Raman Spectroscopy and Its Barcode Database Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Chen-Wen Chang, Wen-Shiuan Liu, Yung-Ruen Tseng, Her-Terng Yau, and Cheng-Chung Chang Classification of Breast Cancer Images in Mice Utilizing Mueller Matrix Transformation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Hoang-Lan-Anh Nguyen, Quoc-Hoang-Quyen Vo, Van-Dao Chung, Thanh-Hai Le, Ngoc-Bich Le, Ngoc-Trinh Huynh, and Thi-Thu-Hien Pham

657

667

676

689

697

705

Biomedical Entrepreneurship Development and Commercialization of a Brain Training App Targeting the Vietnamese Elderly . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Thu Ngoc Minh Phan, Hieu Thanh Nguyen, Tri Nguyen Minh Huynh, Tuong Huu Nguyen, Tram Nguyen Yen Tran, and Huong Thi Thanh Ha Model for Academic Entrepreneurship in Biomedical Engineering Program for Vietnam . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Nga Thi Tuyet Tu, An Thanh Le Nguyen, Quy-Vo Reinhard, and Toi Van Vo

719

738

xxiv

Contents

Investigation on the Design and Implementation of Thermal Therapy Mat . . . . Nhat-Minh Nguyen, Khanh-Minh Nguyen, Thi-Thu-Hien Pham, Chi-Thanh Nguyen, and Ngoc-Bich Le Entrepreneurial Intention Among Engineering Students: Explanation Using Theory of Planned Behavior . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Huyen Lam Thanh Nguyen, Nga Thi Tuyet Tu, Tan Duy Le, and Han Nu Ngoc Ton Entrepreneurial Intention Among Engineering Students: Focus on Entrepreneurial Motivation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Khoa Duong Tien Chau, Nga Thi Tuyet Tu, Tan Duy Le, and Han Nu Ngoc Ton

749

765

788

Neuroengineering Classification of Concentration and Rest by Power Spectral Analysis with Support Vector Machine Model . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Cong Danh Nguyen, Quoc Tuong Minh, Cong Loi Dinh, Ngoc Quoc Bao Pham, Khai Le Quoc, and Linh Huynh Quang An Automated Scoring for REM and N3 Stage Using Wavelet Filters and Support Vector Machine with PSG Signal . . . . . . . . . . . . . . . . . . . . . . . . . . . . Khai Le Quoc and Linh Huynh Quang A Decision-Making Process Analysis Based on Prefrontal Hemispheric Asymmetry . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Minh Bao Pham, Nhi Yen Phan Xuan, Quoc Khai Le, and Quang Linh Huynh Fabrication of Ferritin Nanoparticle Patterns for Controlling Neuron Adhesion and Neurite Outgrowth . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Anh Quang Tran, Thanh-Nghia Nguyen, Phung Cong Phi Khanh, Tran Duc Tan, Andreas Offenhaeusser, Tobias Beck, and Dirk Mayer Clinicoepidemiology of Benign Paroxysmal Positional Vertigo: Initial Utilizing Videonystagmography in the Department of Neurology . . . . . . . . . . . . Xuan Uy Hung Phan, Van Anh Vu Doan, Thi Phuong Lan Tran, Van Chau Ha, Thi Mai Lan Tran, Thi Huong Giang Dinh, Thi Toan Nguyen, and Tien Trong Nghia Hoang

809

825

838

857

868

Contents

xxv

Molecular Medicine Assessment of Trizol-Based Method for Isolating Small RNAs from Plasma . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Le Ha Thu Uyen, Huynh Huu Luan, Duong Chung Thuy, Phan Ngo Hoang, Nguyen Thi Ngoc Thanh, and Nguyen Thi Hue High Expression of Mannosyl-Oligosaccharide Glucosidase Is Associated with Poor Prognosis of Renal Clear Cell Carcinoma . . . . . . . . . . . . . Thanh Nghia Dang and Minh Nam Nguyen SMC1A-Related Developmental and Epileptic Encephalopathies: A Case Report and Literature Review . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Mai Thi-Quynh Nguyen, Thu Thuy-Minh Nguyen, Thu Thi-Minh Nguyen, and Hang Thi-Thu Do Identification of GRB10 Expression as a Novel Blood Biomarker for Prognosis of COVID-19 Severity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Ngoc Minh Truong, Tan Thanh Giang Nguyen, Uyen Vo, Thanh Van Ngo, and Minh Nam Nguyen Effects of Fluoroquinolone Exposure to Growth and Morphology in Staphylococcus aureus . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Van Nhi Tran, Minh Khang Tran, Thuc Quyen Huynh, and Thi Thu Hoai Nguyen Down-Regulation of DHRS1 Predicts Poor Survival Outcome of Patients with Hepatocellular Carcinoma . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Tam Vy Le, Ngoc Thien Lam, Phuong D. Nguyen, Quynh Hoa Tran, Dinh-Truong Nguyen, and Minh Nam Nguyen Antibacterial Effect of Injectable Platelet-Rich Fibrin Against Periodontal Pathogens . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Thuy Anh Vu Pham and Thao Tran Thi Phuong

879

891

901

917

930

942

956

Modeling and Simulation in Biomedical Engineering Applying the Bilinear Model to Identify the Ventilator’s Two Double-Acting Pistons Pump . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Cong Toai Truong, Danh Khoa Nguyen, Ngoc Quy Tran, Van Tu Duong, Huy Hung Nguyen, and Tan Tien Nguyen

969

xxvi

Contents

Designing a Bioelectrical Impedance Phase Angle Measurement System to Support Evaluating Nutritional Status and Biochemical Components of Human Body . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Vu Duy Hai, Bui The Lam, Dao Thao Nguyen, and Phan Dinh Thanh Optimizing Near-Infrared Wavelength for Fruit Quality Optical-Based Assessment Using Monte Carlo Simulation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Quy Tan Ha, Thao Nguyen Dang Thi, My Ngoc Nguyen Thi, Anh Xuan Nguyen, Minh Chau Ta Ngoc, Huu Tai Duong, and Trung Nghia Tran

985

997

Modeling Bio-Impedance Measurement in a Reconstructed Model From MRI Images for Developing Electrical Impedance Tomography Application . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1008 Quoc Tuan Nguyen Diep, Hoang Nam Nguyen, Tich Thien Truong, and Trung Nghia Tran Simulating Light Propagation in a Reconstructed Model from Breast DICOM MRI Images for Developing Optical-Based Diagnosis Modality . . . . . 1018 Ngoc An Dang Nguyen, Thu An Ngo Thi, Minh Khoi Nguyen, Quy Tan Ha, and Trung Nghia Tran Characterization of the Hemodynamic Within the Coronary Artery and the Related Effects of Wall Shear Stress by Applying Computational Fluid Dynamics with Ansys Fluent . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1028 Bao An Van, Dao N. Y. Khoa, Thanh-Qua Nguyen, and Khon Huynh Miscellaneous Comparative Study on Antioxidant Capacity and Biochemical Composition in Local Lotus Species Nelumbo nucifera Gaertn in Central Vietnam . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1043 Pham Thi Thanh Mai, Nguyen Thi Ngoc Hanh, Nguyen Hoang Quang Vu, and Hoang Thi Kim Hong Study of the Therapeutic Effect in Low Back Pain Patients by Medical Training Therapy . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1055 Thi Anh Tuyet Vo, Quang Linh Huynh, Nguyen Thuy Vy Dinh, and The Thuong Nguyen Early Detecting the Abnormality of Heart Function via drtabc.com System (Made by Viet Nam) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1067 Bui Quoc Thang, Phan Dinh The Duy, and Vu Trong Thien

Contents

xxvii

Isolation and Identification of Antimicrobial Marine-Derived Actinomycetes from Bach Long Vi Island, Viet Nam . . . . . . . . . . . . . . . . . . . . . . 1075 Thi Nhu Quynh Hoang, Thi Hong Lien Hoang, Thi Quyen Vu, Thi Mai Huong Doan, Thi Hong Minh Le, and Duc Tuan Cao Effects of Ceftazidime Exposure on Phenotypic Characteristics of Pseudomonas Aeruginosa ATCC 9027 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1091 Hong Loan Ngo, Thuc Quyen Huynh, Ngoc Hoa Binh Nguyen, Nguyen Bao Vy Tran, and Thi Thu Hoai Nguyen The Application of Basophil Activation Test in Seafood Allergy Diagnosis: The Preliminary Results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1102 Nhat Quynh Nhu Nguyen, Kieu-Minh Le, Hieu Thao Nguyen, Bich Tram Duong, Le Duy Pham, and Hoang Kim Tu Trinh Effects of Sucrose Concentrations, Light Conditions, Initial Mass, and Yeast Extract on Biomass Proliferation and Saponin Accumulation of Panax vietnamensis Hairy Roots Cultures in Bioreactor . . . . . . . . . . . . . . . . . . 1113 Quach Ngoc Anh, Tran Van Minh, Bui Thanh Hoa, Ha Thi Loan, and Tran Nguyen Le Quyen Author Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1125

Medical Instrumentations

A Novel Device for Simultaneously Grinding Multiple Tissue Samples Without Cross-Contamination Hung Quoc Nguyen, Phong Nguyen Tran, Thai Minh Do, Viet Ngoc Tran, Toan Nguyen Anh Tran, and Toi Van Vo(B) Medical Instrumentation Department, School of Biomedical Engineering, International University of Viet Nam National Universities, Ho Chi Minh City, Vietnam [email protected]

Abstract. Clinical and diagnostic tests in laboratories are useful in screening, diagnosis, and prognosis. These tests require grinding specimens. Commonly, this is done by hand using mortars and pestles. With this method, only one sample can be done at a time, and the results are not uniform. A novel device for simultaneously grinding multiple tissue samples without cross-contamination is described below. The device consists of a first unit having several pestles and Eppendorf housings separated from each other, a second unit containing a planetary gear system connected to operate these Eppendorf tubes and pestles, and a third unit containing a motor and controller. These units are geometrically configured and dimensioned so that when they are stacked on top of one another they are in lock position and consequently the pestles are lined up with the Eppendorf tubes. The device was built so that 12 samples can be grinded at a time. A programable controller allowed users to select the grinding time at will. A mechanism permitted users to eject conveniently the pestles into the Eppendorf tubes after grinding to help avoid cross contamination. Many tests with shrimp leg tissues infected by white spot syndrome virus (WSSV) against controlled samples consisted of pure water were conducted. The grinded samples were inspected by eyes and checked for contamination using Polymerase Chain Reaction (PCR) machine. The results showed that device allows grinding tissues homogeneously in an effective way and reducing handiwork without cross-contamination. Small industrial production were conducted. Keywords: DNA Extraction · Shrimp Tissue · Eppendorf Tube · Homogenizing · Grinding Device

1 Introduction 1.1 Literature Review Biological samples need one or more pre-treatment measures before processing and identification [1] and tissue homogenization is a common method for preparing samples in the analysis of clinical samples [2]. The homogenization process includes vigorously © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. T. Vo et al. (Eds.): BME 2022, IFMPE Proceedings 95, pp. 3–21, 2024. https://doi.org/10.1007/978-3-031-44630-6_1

4

H. Quoc Nguyen et al.

mixing and griding two immiscible compounds (e.g., tissues and buffer solution) to get a homogenous compound [1]. The traditional method of tube and pestle is often widely used in laboratories for griding or homogenizing small tissue samples in limited amounts [2]. This method seems to have done the least harm to the cellular elements, and the reality that this approach may only accommodate very limited amounts of tissue at any given time can also be disadvantageous in certain situations [3]. When a greater amount of tissue needs homogenization, a device such as a blender or electronic pestle device is sufficient, but this technique is often a time-consuming and manual process; there has been not found successful way to integrate it into a large amount of sample by using the most effective method at the same time up to now [1]. One of the standard processes involving homogenization is the quantitation of proteins from tissues which is called The Bradford protein assay [4], a simple and reliable method for estimating protein concentrations. Bradford has been the standard form of protein quantification in several laboratories [1, 5]. The theory behind this experiment is that the attachment behind protein molecules to a dye called Coomassie Brilliant Blue G-250 [6] under acidic conditions results in a transition of color from brown to blue [7]. The protein quantitative can then be measured and calculated by spectrophotometer [8] to show the amount of dye in the blue form [9]. It is normally accomplished by calculating the absorbency of the solvent at 595 nm [10]. There are two stages performed by the Bradford, including the Standard assay procedure, which is ideal for testing from 10 to 100 µg protein and the Micro assay procedure, which is more sensitive and productive when protein levels are low (from 1 to 10 µg protein) [5, 8, 10]. 1.2 Analysis of Existing Devices To perform the above processes, the tissue can be crushed by hand, using rotating the pellet or stick on a sample in a tube until it is broken down (Fig. 1). The method is common but not efficient and time-consuming.

Fig. 1. The common griding method

Investigation of the existing devices on the market showed that there are 3 main types of micro-tube homogenizer: first is the basic one with low cost, portable and low speed, then the larger one with higher speed and the last one is the fully automatic device that is a high-speed homogenizer. Table 1 lists the above devices. After conducting the review and analyzing the existing devices, we found that their main issue is that none of them allowed grinding many tissue samples at the same time.

A Novel Device for Simultaneously Grinding Multiple Tissue Samples

5

Table 1. The current market of micro-tube homogenizer devices

Model Pellet Pestle Cordless Motor by Fisherbrand 1

D1000 Handheld Homogenizer by Benchmark Scientific 2

D1030 BeadBug Homogenizer by Benchmark Scientific 3

Features - Cordless Motor - AA Batteries - Adjustable Speed: up to 3,000 rpm - Cordless Motor - AA Batteries Adjustable Speed: up to 3,000 rpm

- Cordless Motor - AA Batteries Adjustable Speed: up to 3,000 rpm

Advantages - Portable - Easy to use

Disadvantages Cannot crush a large number of sample at a time.

Price $112

- Portable - High speed

Cannot crush a large number of sample at a time. Splashed around with high speed.

$890

- Portable - Easy to use - Shake to griding tissue

Cannot crush a large number of sample at a time. Take long time Need adding balls.

$700

1 https://t3.gstatic.com/images?q=tbn:ANd9GcQkloEZ70XtrP4CmmeSlKkhtE%20Uo2A6mH

P3D47nW7WEO3S1Be7Op 2 https://encrypted-tbn2.gstatic.com/images?q=tbn:ANd9GcQ9sQAhwj%20B9LG%20BlY% 20X4wiEjWcTw%20-VCMePiJkToSHV_Ts6gXzTtv 3 https://encrypted-tbn2.gstatic.com/images?q=tbn:ANd9GcRuWg_pZChsyqjPgvt%20UqEjTyQ OGeS-wjCXL6JAcfhIR2UeuhWM

We, therefore, proposed a solution for this issue, as described in detail below. Our novel device and method allow grinding many samples homogeneously at the same time. Therefore, users can develop a method to standardize the grinding time and speed of a kind of tissue so that the results are compatible with the analysis of its characteristics.

6

H. Quoc Nguyen et al.

2 Materials and Method Our prototype design has two crucial components, the mechanical and electronic parts. The mechanical part comprises three key elements: gear box (A), tube holder (B), and base (C) (Fig. 2 and Table 2). The electronic part includes the user interface with an OLED display, rotary knob, electric motor, and main electronic board. The gearbox serves as the central component of the mechanical part and operates based on a transmission system. The large driver gear is at the center of the gearbox, which is directly linked to the electric motor. Additionally, several smaller spur gears are positioned around the driver gear to enhance the grinding performance. During the operation, the driver gear drives the small gears, which connect to the griding sticks/pellet pestles to grind all samples simultaneously. The number of small gears is equivalent to the number of griding sticks and pellet pestles. Users can use a speed controller to adjust the grinding speed, depending on the type of sample (soft tissue, hard tissue, or liquid) they are working with. To improve efficiency and save time for users, the device features a mechanical extraction mechanism, which allows for quick extraction of tubes and pestles after the grinding process has been completed. This eliminates the need for manual extraction of individual tubes and pestles.

Fig. 2. The three main parts of the device

The components of the device are assembled through precise positional joints. The use is also simplified to save time and increase efficiency for on-site testing units. According to the standard procedure (Fig. 3): First, the user places the tube holder (B) into the base (C), then places the sample tubes into the separate divided chamber in the tube holder (B). Next, the user installs the pestle plastic into the gear box (A) in pre-designated hole positions. Finally, the gear box (A) is placed onto the device to commence the sample grinding process. Figure 4 shows the device assembled all together and its inside component.

A Novel Device for Simultaneously Grinding Multiple Tissue Samples

7

Table 2. Main components and their functions Components

Function

The gear box (A)

Includes gear drive transmission system assembly inside to connect 12 pestles. The rotating handle, in addition to the grip function, after the sample is finished, grinding is used to push the pestles of the Eppendorf tube so that they fall directly into the Eppendorf tube to prevent the liquid from falling from one pestle to the other to contaminate the sample

The tube holder (B) Includes separate baffles for each Eppendorf tube, avoiding cross-contamination. This chamber can be easily cleaned and disinfected with as many disinfectants as required The base (C)

Includes the electric components: motor, main electronic board, etc.

Fig. 3. The assembly procedure of the device

2.1 The Mechanical Design The Gear Box (A) The gear box in our device is comprised of two key components. Firstly, the transmission system plays a crucial role in generating the grinding motion through a gear drive that rotates the pestle. Secondly, the auto-release pestle system allows for the convenient removal of the pestle from the Eppendorf tube upon completion of the experiment.

8

H. Quoc Nguyen et al.

Fig. 4. The main components in our tissue griding device

The Transmission System The principle of operation of the transmission system is based on gear transmission. The gear system comprises 14 gears, including a driver spur gear, a driven spur gear, and 12 pestle spur gears (Fig. 5). The drive spur gear is powered by its connection to the DC motor in the base (C) through a rubber coupling, resulting in rotation. This rotation then drives the driven spur gear, causing simultaneous rotation of the 12 pestle spur gears. The gear system has been designed to have a gear ratio of 1:1, meaning that all gears have equal numbers of teeth and pitch diameters.

Fig. 5. The gear system design

The stability and steady operation of the gear system require a secure mounting mechanism, which is achieved through the implementation of “sandwich” holders. These holders consist of two components, a top slide and a bottom slide, and function to firmly grip and rotate the gear system by pressing it between the slides. The sandwich slides have multiple holes which align with the gear hubs for proper placement (Fig. 6). The pestle spur gear is fixed to flange bearings, which are positioned on 12 holes at preset positions on the “sandwich bottom” component, as shown in Fig. 6. The use of bearings helps to ensure smooth transmission and minimize friction, thereby enhancing the durability of the transmission system. The material used for constructing the sandwich bottom and the top is acrylic, a transparent plastic material with exceptional strength,

A Novel Device for Simultaneously Grinding Multiple Tissue Samples

9

Fig. 6. The side view of the gear system’s 3D model design

stiffness, and optical clarity. Spacers are used to create a gap between the two sandwich components while maintaining the proper positioning of the gears. The drive spur gear is connected to a rubber coupling to allow for connection to the DC motor in the base (C). Users can easily attach the stick pestle to the hole at the center of the pestle spur gear, which has an inner diameter specifically customized to fit the stick. The Auto-Release Pestle System The auto-release pestle system operates on the principle of spring force and a manual force piston with a ball-bearing roller system. This system comprises two main components: a roller ramp (Fig. 7) that is integrated into the sandwich top component and a rotating ball-bearing component (Fig. 8).

Fig. 7. A roller ramp 3D design model

This part is fit directly to the sandwich top part via 4 screw holes. Two mini-ball bearings are connected to the handle so that they roll on a ramp whenever the user rotates the handle (Fig. 9). When the rotation functions, it activates a downward motion of the pestle holder plate, which is connected to 12 slender rods, thus causing the pestle to be expelled from the spur gear (Fig. 10). This motion is facilitated using two compressed springs that are guided along two shafts. The pestle holder plate’s linear motion is facilitated by using two linear bearings, as depicted in Fig. 11. The completed gear box (A) is depicted in Fig. 12.

10

H. Quoc Nguyen et al.

Fig. 8. A rotated ball bearing 3D design model

Fig. 9. The rotation mechanism uses a ball bearing and ramped road

Fig. 10. The auto-release pellet pestles principle

The Eppendorf Tube Holder (B) The Eppendorf holder (B) is cylindrical, including internal dividers that separate individual tubes. The tube holder component is affixed to both the base (C) and the gearbox (A) through the use of positioning grooves (Fig. 13).

A Novel Device for Simultaneously Grinding Multiple Tissue Samples

11

Fig. 11. The structural components of the gear box part (A)

Fig. 12. The full assembly design of the gear box part (A)

Fig. 13. The tube holder position in the 3D model design

The design of the tube holder component has been meticulously crafted to meet two critical requirements for controlling cross-contamination. Firstly, its distinct design enables convenient cleaning and sterilization methods to be performed by the user. Secondly, the ample distance between the sample tubes effectively prevents crosscontamination and facilitates the removal of the Eppendorf tubes from the chamber (Fig. 14).

12

H. Quoc Nguyen et al.

Fig. 14. (A) The position to fit the Eppendorf tubes, (B) The 12 fixed positions for each Eppendorf tube in each chamber to avoid cross-contamination

The Base (C) The base (C) of the device consists of two distinct components: the electronic control box and the spring base that accommodates the Eppendorf tube (Fig. 15). The base features 12 springs positioned to correspond with the 12 Eppendorf tubes, with the aim of elevating the tubes to enhance the efficiency of the grinding process. In the center of the base, a DC motor is installed and connected to the gearbox (A) through a rubber coupling, serving as the source of motion for the gear mechanism.

Fig. 15. The section view of the base (C)

The use of springs in the base that supports the Eppendorf tubes enhances the compression between the ground samples contained within the tubes and the pestle rod when assembling the overall system. This results in an improvement in sample grinding efficiency. 2.2 The Electronic Part In the block diagram (Fig. 16), three critical components exist which are essential for the system’s operation. These components include the main circuit, which comprises the primary microcontroller and the H-bridge controller, the user interface, which enables the input and display of configuration data from the user; and the DC encoder motor,

A Novel Device for Simultaneously Grinding Multiple Tissue Samples

13

which has the capability to accurately measure rotations in real-time, thereby enabling the implementation of a closed-loop control model.

Fig. 16. The block diagram of the whole system

The combination of a Proportional Integral Derivative (PID) controller with an ARM microcontroller, an H-Bridge driver, and a DC encoder motor provides a highly effective solution for the control of dynamic processes in a wide range of applications. Figure 20 shows the actual user interface of the device. The rotary knob allows users to adjust the rotating speed and the function duration of the device. In the emergency situations, the device can be immediately stopped by pressing on it. The electronic control box encompasses the user interface and the motor controller. The user interface employs a 0.96” OLED display, along with a rotary encoder knob, to facilitate parameter adjustment and device activation (Fig. 17).

Fig. 17. (A) The mainboard PCB inside the electronic control box. (B) The user interface

The DC motor is controlled by a motor driver integrated into the main board, which is, in turn, regulated by a microcontroller. The electronic box constitutes the base of the device (Fig. 18). Figure 19 shows the flowchart of the program, which indicates that when the device is in operation, a timer countdown commences to keep track of the remaining time until completion.

14

H. Quoc Nguyen et al.

Fig. 18. The full assembly of the device

Start

Load Configuration Data (Time;RPM)

Change setting

Yes

Input Tim e

Input RPM

No

Run Motor

Tim er Countdown

Motor Stop

End

Fig. 19. The flowchart of the program

3 Results 3.1 Cross-contamination Evaluation A series of verification experiments were carried out at a specialized laboratory of a renowned domestic producer of various biochemical products and kits. A standard protocol was established and continuously developed after several rounds of experiments.

A Novel Device for Simultaneously Grinding Multiple Tissue Samples

15

In which the Ct value is one of the crucial indicators analyzed in detail in this experiment, aiming to determine whether the sample is contaminated or not. The Ct value in real-time PCR (Rt-PCR) refers to the threshold cycle number at which the amount of amplified product reaches a statistically significant level above background fluorescence. It is an indirect measure of the sample’s initial amount of target nucleic acid and is inversely proportional to the initial template concentration. The lower the Ct value, the higher the initial target nucleic acid concentration. Testing Protocol The protocol employs the verification method using control and test samples. The control sample used is a shrimp tissue sample containing White Spot Syndrome Virus (WSSV) with a fluctuating Ct of 14–18 Ct. The test sample is a treated water sample (DEPC). DEPC sample refers to Diethylpyrocarbonate (DEPC) treated water sample, which is a common sample used in laboratory experiments, particularly in molecular biology techniques such as RT-PCR. DEPC is a chemical that is added to water to inactivate any RNases (ribonucleases), which are enzymes that can degrade RNA. The DEPC-treated water is used as a blank sample to control for any potential contamination in laboratory experiments. Both samples are placed in separate rooms alternating. Then, the sample grinding procedure is performed an average of 3 times with a fixed number of rotations and times. After the sample grinding process is completed, the DEPC test samples are processed and analyzed using a Real-time PCR (Rt-PCR) machine. Test samples with a Ct result exceeding the threshold (>40 Ct) are considered uncontaminated. Experiment Results A series of experiments were conducted to assess the cross-contamination avoidance of the device during sample grinding. After each experiment, we obtained various results, both optimistic and pessimistic. From there, we discovered the most effective method of implementation. Experiment 1 (with Open Eppendorf) The experiments we conducted in a professional molecular biology laboratory met the standards of a biotechnology distribution company in Vietnam. The samples tested were shrimp samples containing the WSSV virus and DEPC samples. The required indicator was the qualitative detection of WSSV, using the AccuRiveShrimp DNA Prep Kit for the boiling extraction method and AccuPid WSSV Detection Kit, Q02WSV01.2A for qualitative detection. Table 3. Experiment 1 procedure (The shrimp and DEPC sample Eppendorf tubes were positioned alternately in the device) Sample Experiment 1

Shrimp Sample

DEPC Sample

Cotton Swab Sample

1st griding

0

12

4

2nd griding 3rd griding

6

6

0

0

12

4

16

H. Quoc Nguyen et al.

Based on Table 3, it can be seen that the total sample grinding was divided into three different stages. In the first griding, 12 tubes containing DEPC (negative) were placed in the device and crushed, then analyzed to check for WSSV-positive samples. To increase the ability to detect droplets splashing outside the tube chamber wall, cotton swab samples were obtained from cotton swabs and analyzed. In the second griding, both WSSV-positive shrimp samples and DEPC-negative samples were positioned alternately in the equipment and then analyzed to check for cross-contamination between the samples. In the final grinding, 12 DEPC water samples (negative) were placed back into the equipment to test for cross-contamination from the previous grinding. Table 4. The testing result of 1st and 3rd griding

Based on the results indicated in Tables 4 and 5, the tissue-grinding device performed well in all 3 grinding sessions with the same fixed speed and time (500 RPM for 3 min).

A Novel Device for Simultaneously Grinding Multiple Tissue Samples

17

Table 5. The testing result of 2nd Griding

In the second grinding session, all DEPC samples were negative, indicating no crosscontamination between the tubes. However, in the third grinding session, one DEPC water sample tested positive for the WSSV virus, which could be explained by droplets being ejected from the tube chamber during the second grinding session, leading to cross-contamination between the two grinding sessions. Experiment 2 (Eppendorf Has a Lid) We conducted the second experiment by adding an acrylic lid to the Eppendorf (Fig. 20) to minimize the effect of droplet splashing on the accuracy of the results. The protocol was performed similarly to the previous experiment.

Fig. 20. (A) Using the acrylic lid to cover the Eppendorf tube, (B) The method to input the acrylic lid to pestle stick before griding procedure

Based on the verification experiment, the results obtained were still similar to those of the previous experiment. After 4 rounds of sample grinding, one false positive result

18

H. Quoc Nguyen et al.

was obtained in the DEPC sample from the second round of grinding, with the previous position being that of the WSSV sample tube. A false positive sample appeared randomly in each round in the third and fourth rounds of griding. It can be seen that the use of an acrylic shield did not bring promising results, and the phenomenon of random sample contamination still occurred (Fig. 21). A

C

B

D

Fig. 21. The testing result of experiment 2, (A) 1st griding, (B) 2nd Griding, (C) 3rd Griding and (D) 4th Griding.

Experiment 3 (with Controlled Sanitation Procedure and Grinding Speed) After the two previous experiments, we found that the phenomenon of random crosscontamination still occurred, despite trying various methods to prevent it. Upon reviewing the entire process of conducting the experiment, from sample preparation, handling, griding, and analysis, we realized there were some mistakes in maintaining hygiene and

A Novel Device for Simultaneously Grinding Multiple Tissue Samples

19

controlling contamination, particularly during downtime when an additional disinfection process using the specialized disinfectant solution was needed. The grinding speed is also a factor that needs to be considered when grinding the samples. We obtained much more positive results after implementing a new sanitation procedure and adjusting the grinding speed, which differed from previous experimental trials (Table 6). Table 6. The result of experiment 3

The results obtained were extremely promising, with all DEPC-treated samples testing negative and no cross-contamination observed during the four consecutive sample griding sessions. 3.2 Device Fabrication After the successful contamination test, the device’s functioning was tested for reliability, accuracy and precision. Finally, the device was fabricated in series for commercialization (Fig. 22).

Fig. 22. The commercialized products

20

H. Quoc Nguyen et al.

4 Discussion After a series of validation experiments and improvements aimed at enhancing the device’s ability to prevent cross-contamination, we have achieved extremely promising results. Under continuous operating conditions and with samples placed near each other, the results demonstrated that the device had a high level of cross-contamination resistance while undergoing rigorous testing. By using automated sample grinding, laboratories can effectively save time and labor costs while achieving high-quality samples with uniform consistency.

5 Conclusion In summary, this novel device allows grinding several samples simultaneously without cross-contamination thanks to a special gear transmission mechanism, individual Eppendorf housing and an effective way to eject the pestle into Eppendorf tubes. The system constitutes an economical method to be applied for the sample grinding method of the shrimp and other animal tissue to detect some diseases based on PCR tests. Grinding several samples at the same time allows the development of a standard method for biopsy where all samples are processed in a uniform way. It is expected that this device will be debuted in the market of laboratory diagnostic instrumentations due to the benefits offered by this device in comparison with existing devices in the market. Embracing this method for usage can save considerable diagnostic time in a large scale of shrimp diseases needed to be tested, especially in Vietnam, one of the top countries in the shrimp industry. Acknowledgements. This research is funded by Vietnam National University HoChiMinh City (VNU-HCM) under grant number NCM2020-28-01.

Conflict of Interest. The contents are subject of a pending patent.

References 1. Wells, D.: Sample Preparation for Mass Spectrometry Applications. In: Principles and Applications of Clinical Mass Spectrometry, pp. 67–91. Elsevier (2018). https://doi.org/10.1016/ B978-0-12-816063-3.00003-7 2. Size, A., Sharon, A., Sauer-Budge, A.: An automated low cost instrument for simultaneous multi-sample tissue homogenization. Robot. Comput.-Integrated Manuf. 27(2), 276–281 (2011) 3. Hunter, M.J., Commerford, S.L.: Pressure homogenization of mammalian tissues. Biochem. Biophys. Acta. 47(3), 580–586 (1961) 4. Cheng, Y., et al.: Rapid method for protein quantitation by Bradford assay after elimination of the interference of polysorbate 80. Anal. Biochem. 494, 37–39 (2016) 5. Kruger, N.J.: The bradford method for protein quantitation. In: Walker, J.M. (ed.) The Protein Protocols Handbook. SPH, pp. 17–24. Humana Press, Totowa, NJ (2009). https://doi.org/10. 1007/978-1-59745-198-7_4

A Novel Device for Simultaneously Grinding Multiple Tissue Samples

21

6. Compton, S.J., Jones, C.G.: Mechanism of dye response and interference in the Bradford protein assay. Anal. Biochem. 151(2), 369–374 (1985) 7. He, F.: Bradford protein assay. Bio-Protocol 1(6), e45 (2011) 8. Spector, T.: Refinement of the Coomassie blue method of protein quantitation: a simple and linear spectrophotometric assay for ≤0.5 to 50 µg of protein. Anal. Biochem. 86(1), 142–146 (1978). https://doi.org/10.1016/0003-2697(78)90327-5 9. Congdon, R.W., Muth, G.W., Splittgerber, A.G.: The binding interaction of coomassie blue with proteins. Anal. Biochem. 213(2), 407–413 (1993) 10. Nakamura, K., et al.: Microassay for proteins on nitrocellulose filter using protein dye-staining procedure. Anal. Biochem. 148(2), 311–319 (1985) 11. Huang, C.-T., Jan, F.-J., Chang, C.-C.: A 3d plasmonic crossed-wire nanostructure for surfaceenhanced raman scattering and plasmon-enhanced fluorescence detection. Molecules 26(2), 281 (2021) 12. Lussier, F., et al.: Deep learning and artificial intelligence methods for Raman and surfaceenhanced Raman scattering. TrAC, Trends Anal. Chem. 124, 115796 (2020) 13. Fan, X., et al.: Deep learning-based component identification for the Raman spectra of mixtures. Analyst 144(5), 1789–1798 (2019) 14. Zhao, X.Y., et al.: Denoising method for Raman spectra with low signal-to-noise ratio based on feature extraction. Spectrochim. Acta Part A Mol. Biomol. Spectrosc. 250, 119374 (2021) 15. Luo, S.-H., et al.: Developing a peak extraction and retention (PEER) algorithm for improving the temporal resolution of Raman spectroscopy. Anal. Chem. 93(24), 8408–8413 (2021)

Development of a Smart Guidewire for Intravascular Sensing Chao-Wei Dong1 , Dong-Hyun Joo2 , Ki-Jeong Moon1 , Se-Yeon Yoon1 , Hua Quang Huy Nguyen1 , and Woo-Tae Park1,2(B) 1 Department of Mechanical Engineering, Seoul National University of Science and

Technology, Seoul 01811, Republic of Korea [email protected] 2 Convergence Program of Biomedical Engineering and Biomaterials, Seoul National University of Science and Technology, Seoul 01811, Republic of Korea

Abstract. This study presents a smart guidewire developed to measure the pressure inside blood vessels during minimally invasive surgery. The use of pressure sensor guidewires enables the medical doctor to make a judgement of the stent insertion procedure by precisely measuring coronary pressure. A pressure sensor is embedded inside the guidewire to measure the coronary lesion’s vascular pressure to determine the clogging’s severity. Pressure sensors inside the guidewires require high sensitivity, good linearity, and huge size reduction. The pressure sensor needs to be packaged inside a 350 µm diameter catheter. Size constraints and mechanical reliability requirements are extremely high. We describe the design and manufacture of the micro-scaled pressure sensor and the packaging process of the guidewire. To improve sensor sensitivity and reduce nonlinearity, we employed a finite element analysis to optimize the design for the membrane. The sensor fabrication process employs a cavity-first process for ultrathin sensor design. Additionally, we built a measurement system that records the sensor signal in air pressure. The results showed that the air pressure ranged up to 7.2 psi. We developed a systematic setup for assembling the ultraminiature pressure sensor inside the 800 µm guidewire. The packaging procedure includes the preparation of the electric wires, sensor placement, sensor to wire alignment, soldering, and finally, wired sensor placement inside the medical tubing. Keywords: Guidewire · MEMS Pressure Sensor · Intravascular Sensing · Medical Device

1 Introduction 1.1 Subject Introduction Cardiovascular disease (CVD) is the leading cause of mortality worldwide [1]. Cardiovascular disease (CAD) or atherosclerosis is the most common cause of heart failure among CVD. Fatty deposits or calcified sediments can form blood clots that block normal blood flow. If the condition worsens, the passageway can become completely blocked, © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. T. Vo et al. (Eds.): BME 2022, IFMPE Proceedings 95, pp. 22–32, 2024. https://doi.org/10.1007/978-3-031-44630-6_2

Development of a Smart Guidewire for Intravascular Sensing

23

causing a heart attack or stroke. Patients with coronary arteries may receive antiplatelet prescription drugs (e.g., clopidogrel, ticlopidine, or ticagrelor) or anticoagulant (e.g., aspirin) medications from their doctor. This therapy improves the chances of survival by reducing the size of clots in the coronary arteries. However, some thrombolytic drugs may carry a risk of bleeding, so there are strict requirements on the patient’s medical history and physical conditions. 1.2 Working Principle Very few cases of infection have been reported since the introduction of coronary stenting as a treatment for coronary heart disease in 1987 [2]. Coronary stents are tiny wire mesh tubes that can be drug-applied that are placed into blocked or narrowed arteries to prevent vessel closure, retraction and restenosis [3]. The development of coronary stents reduces the need for target vessel reconstruction; therefore, the use of coronary stents will be increasingly used in clinical procedures [4]. However, new studies revealed that treatments without stents can reduce mortality in a long-term follow-up study [5]. Fractional flow reserve (FFR) is a new indicator of the functional severity of coronary stenosis and is calculated from pressure measurements during coronary angiography. Evaluating and managing are challenging in patients with moderately severe chest pain and stenoses assessed by coronary angiography [5]. The FFR can easily be derived from the ratio of the mean distal coronary pressure to the aortic pressure during maximal vasodilation, with a normal value of 1 for this index, and coronary stenosis can be determined if the FFR is less than about 0.75 [6]. The study utilizes a guidewire to direct a miniaturized pressure sensor to the site of coronary artery stenosis. Measurements of proximal coronary pressure (Pa) and distal coronary pressure (Pd) were taken to assess the degree of stenosis. Figure 1 displays the intravascular sensing of the guidewire.

Fig. 1. Proximal coronary pressure (Pa) and distal coronary pressure (Pd) were measured simultaneously using a guidewire.

1.3 Characteristics and Challenges of this Work This study proposes an ultra-miniature piezoresistive sensor that is specially designed for medical guidewires. Medical guidewires require high sensitivity (resolution < 1 mmHg), and high linearity (non-linearity error < 1%), and are greatly limited by size, so the entire device is very challenging from design to development.

24

C.-W. Dong et al.

In this work, finite element analysis methods were used to design and optimize a new membrane structure to improve sensitivity and reduce nonlinear errors. The manufacturing process is also described in detail. To verify working capability and measure the prototype sensors, a test rig was also built for characterization. The setup is a semiautomatic measurement system that controls and collects real-time pressure signals from prototype sensors. In addition, we describe an assembly system for aligning and wiring the sensors.

2 Introduction 2.1 Subject Introduction Principle of Piezoresistive Sensor. The piezoresistance effect refers to the conversion of pressure change to electrical resistivity change in a piezoresistive pressure sensor through the use of a piezoresistor [7]. It occurs because when the inter-atomic spacing changes due to strain, the bandgap also changes, making it easier for electrons to rise into the conduction band. This causes a change in the resistivity of the material. The piezoresistor could be made by ion implantation or boron diffusion. In order to increase the sensitivity of the piezoresistive pressure sensor, a Wheatstone bridge was constructed by piezoresistors. The resistance changes due to compression and tension of the resistors facing each other, and if the resistance of R1 and R3 are decreased due to compression, the resistance of the resistors R2 and R4 increase due to tension, as shown in Fig. 2. By utilizing a full or half Wheatstone bridge, the change in resistance can be amplified. In this study, sensors were manufactured in two ways: a full Wheatstone bridge and a half Wheatstone bridge. The half-bridge consists of two fixed resistors and two variable resistors. The variable resistors are horizontally placed to perform tension and compression simultaneously, increasing the sensitivity.

Fig. 2. Piezoresistors in a Wheatstone bridge circuit.

Membrane Structure Design. This study aimed to optimize the design for high sensitivity and linearity. Traditional MEMS piezoresistive pressure sensors have limitations

Development of a Smart Guidewire for Intravascular Sensing

25

in sensitivity and are heavily influenced by thermal drift [8]. To solve this problem, it was necessary to taylor the membrane. Additionally, sensors should be manufactured with consideration for the size of blood vessels, which are, on average 3 to 4 mm. Heart disease causes blood vessels to decrease by 75%, meaning the width and thickness of the sensor should be made up to 300 µm or less, fitting within a standard 1 French diameter guidewire. The membrane of the pressure sensor is typically manufactured in a square shape due to low nonlinearity caused by pressure distribution at the edge of the frame. It has already been proven that a square membrane receives more stress than a circle [9]. In a guide wire, the length of the sensor is not restricted compared to the sensor’s width, meaning the sensor’s sensitivity could be increased by increasing the area of the membrane. Additionally, rectangular membranes with high sensitivity have rarely been used. To confirm this, the stress according to the circle, square, and rectangle was calculated through the Finite Element Method (FEM).

Fig. 3. Simulated stress of various membrane shapes.

Figure 3. Shows that the high-stress area in the circular membrane was under 1.18 × 106 N/m2 , the square membrane was under 1.64 × 106 N/m2 , and the rectangular membrane was under 2.69 × 106 N/m2 at the same pressure of 200 mmHg. This indicates that the rectangular membrane is the most sensitive shape. A simple rectangular membrane has a nonlinearity problem caused by an imbalance in the maximum stress applied to the edge. To solve this problem, a conventional crossbeam structure was added to concentrate the stress at each piezoresistor position, and a hollow region was added to the center of the membrane. By adding these patterns, the strength of the membrane was increased, the stress was more concentrated on the piezoresistor, and nonlinearity was reduced. Prior to producing the pressure sensors, COMSOL was used to simulate the stress, sensitivity, and nonlinearity errors of various membrane designs. A comparison of the design list and the sensitivity and nonlinearity is shown in Fig. 4.

2.2 Fabrication of Pressure Sensor Cavity SOI Wafer. In semiconductor manufacturing, silicon-on-insulator (SOI) technology involves fabricating silicon semiconductor devices in a layered silicon-oninsulator-silicon substrate to reduce parasitic capacitance within the device and thereby

26

C.-W. Dong et al.

Fig. 4. Comparison of sensitivity and nonlinearity of the design list and the proposed membrane design.

improve performance [10]. In this work, the cavities were fabricated before bonding the device layer silicon. This was essential to produce ultrathin (< 200 µm) devices that were needed for the guidewire sensors. This approach enabled the processed wafer to be thinned down to the required thickness without the danger of breaking the wafer [11]. Process Sequence. The manufacturing process of the pressure sensor is shown in Fig. 5. a) The manufacturing process was designed based on the C-SOI formed by wafer fusion bonding. b) An oxide etched for ion implantation. c) A high-dose p-type ion implantation process was performed on the surface of the SOI silicon wafer to form conductive traces. d) Resistor was formed with an ion implant, and the ion implant traces were annealed with a new oxide layer grown. e) Metal contact pads etched prior to metallization. f) Metal layer (Cr/Au) deposited. g) Metal traces and pads patterned using metal etching or lift-off process. h) Silicon nitride (Si3 N4 ) was used as a passivation layer to protect the sensor except for the gold metal pad surface. The optical micrographs of the medical pressure sensor are shown in Fig. 6(a) and (b), and the optical micrograph of the membrane and cavity is shown in Fig. 6(c).

2.3 Package Process Preparation of the Electric Wires. A four-strand multi-wire bundle with a diameter of 25 µm for each wire was used as a conductor, as shown in Fig. 7(a). The multi wires were insulated with polyimide, with a coating thickness of 1 µm (CU005826, Goodfellow Cambridge Ltd, UK), respectively. It was necessary to remove

Development of a Smart Guidewire for Intravascular Sensing

27

Fig. 5. Fabrication processes of cavity SOI pressure sensor.

Fig. 6. Characterizations of sensor and membrane structure.

the surface insulation to make the electrical connection to the electrode pads. Using hydroxyl (-OH) hydrolysis property, sodium hydroxide was used to dissolve the insulation coating. Figure 7(b) shows that the solid sodium hydroxide (NaOH) was mixed with DI water in a 1:1 wt/wt ratio and then heated with an alcohol lamp until boiling.

28

C.-W. Dong et al.

The wire was then placed inside the heated sodium hydroxide solution to remove the insulation coating for 5 min. The residual polyimide attached to the wire was removed using a sonicator and acetone (Fig. 7(c)). A conductivity test was performed using a multimeter to confirm that the insulation coating was removed. Soldering. We successfully soldered the wires to the electrode pads by using a specially constructed aligner (Fig. 7(d)), T7 size solder paste (SMD291SNLT7, Chipquik, USA), and a hot air desoldering station (WHA600, Weller, Germany). First, a 1 cm-long wire with a diameter of 25 µm was attached to the arm of the probe station positioner using double-sided tape, and then the end of the wire was coated with a solder paste. As shown in Fig. 7(e), the probe station positioner was used to apply the solder paste to the electrode pad. The solder paste was then heated with a hot air desoldering station at a temperature of 480 °C for 5 min. With enough heating, the solder paste transformed and showed a silver gloss, as shown in Fig. 7(f).

Fig. 7. Preparation of the electric wires and soldering processes.

Sensor to Wire Alignment. Two 3-axis stages (MBT616D, Thorlabs Inc, USA), an alligator clip, polydimethylsiloxane (PDMS) pad, an aluminum plate of F-shape, a copper structure for sensor support, and a thermal pad (TPA01, Gelidions, China) were used for the wire alignment stage, as shown in Fig. 8(a). First, we fixed the F-shape aluminum plate to one 3-axis stage and the copper structure to the other 3-axis stage. A thermal pad was placed on the copper structure, and attached the sensor was placed on the thermal pad. The wire was placed on the aluminum plate and covered with a PDMS pad to protect and hold it, and the end of the wire was fixed with the alligator clip. The 3-axis stage was then adjusted to align the sensor and wires. A sample of the complete soldered sensor is shown in Fig. 8(b). Wired Sensor Placement Inside the Guidewire Tubing. During the placement process of the sensor, a wire with a groove in the tail and an adhesive (Loctite 406, Henkel Loctite, China) were used to insert the sensor into the guidewire tubing. Initially, the tail of the wire was tied with a separate wire to be inserted inside the tubing, as shown in Fig. 8(c). The sensor and wire assembly were inserted into the tubing until the sensor was visible in the opening window. The sensor was manipulated with an external wire so that the

Development of a Smart Guidewire for Intravascular Sensing

29

sensor faced up in the window. Finally, the pressure sensor was fixed into position with a medical-grade adhesive, as shown in Fig. 8(d).

Fig. 8. Sensor placement inside the medical tubing.

3 Results and Discussion To test the prototype sensor, we proposed an air test setup, as shown in Fig. 9. We controlled the air pump and pressure regulator (5IN PCD-30PSIA-D, Alicat Scientific, Inc., USA) to automatically increase the input pressure from 0 to 372.35 mmHg at a specific time interval. A data acquisition system (MonoDAQ U-X-50, Mouser Electronics Inc., USA) was used to connect to a computer for data acquisition and signal processing. The performance was measured and compared of fabricated sensors against commercial reference sensors (SMI-1A-48-180-BBUU, TE connectivity, USA). Both sensors were connected to an external signal recorder and placed in a well-sealed test chamber at the same pressure environment. We increased the supplied pressure from 0 to 7.2 psi (372.35 mmHg), and the pressure sensor output voltage signals were collected from both sensors, as shown in Fig. 10. The tested commercial sensor (SMI sensor) had a sensitivity of 0.963 mV/psi (Fig. 10(a)), while the prototype sensor had a sensitivity of 0.714 mV/psi (Fig. 10(b)). Both sensors maintained high linearity in the pressure range of 7 psi. Additionally, we also conducted the pressure test on a tightly sealed column filled with dielectric oil. The results revealed that the prototype sensor displayed a sensitivity of 0.747 mV/psi as the liquid pressure gradually increased from 0 to 3.2 psi. These results validate that the packaged sensor has the ability to measure liquid pressure precisely. The dynamic responses of both sensors were recorded and compared in Fig. 11. The pressure inside the air chamber increased continuously from 18–45 s and maintained a constant pressure thereafter. Both sensors showed a fast response to the dynamic change of the pressure environment, as shown in Fig. 11(a) and (b).

30

C.-W. Dong et al.

Fig. 9. An air pressure setup layout of prototype sensor test.

Fig. 10. Performances of (a) reference SMI sensor, and (b) prototype sensor in an air chamber.

Fig. 11. Time responses of (a) SMI sensor, and (b) prototype sensor while automatically increasing the applied pressure.

4 Conclusion The aim of this study was to design, fabricate and package the ultra-miniature pressure sensor for coronary diagnosis. Based on finite element analysis and calculations, the novel membrane structure for pressure sensor was designed. We designed the process

Development of a Smart Guidewire for Intravascular Sensing

31

flow of the sensor, as well as executed the analysis and examination of the results at the end of each process. In addition, we determined the proposed packaging of the pressure sensor, including the alignment of the sensor and the wires and the soldering method. Furthermore, the approach for positioning and fixing the sensor inside the guidewire tube was described in detail. Finally, the fabricated sensors were tested in a pressure test setup to confirm the test capability of the system. A commercial sensor was used as a reference for simultaneous experiments with the prototype sensor. The comparison revealed that our sensor displayed slightly lower sensitivity (0.714 mV/psi) than the tested commercial sensor (0.963 mV/psi), which could be attributed to the membrane displacement limitation of the designed sensor. However, the sensor was able to maintain a relatively stable sensitivity (0.747 mV/psi) in a liquid environment filled with dielectric oil. This study serves as a valuable guide for future developments in the field by offering guidance for sensor design and testing. The findings of this study have the potential to advance pressure sensor technology in medicine. Acknowledgement. This work is based upon work supported by the Ministry of Trade Industry & Energy (MOTIE, Korea), Ministry of Science & ICT (MSIT, Korea), and Ministry of Health & Welfare (MOHW, Korea) under Technology Development Program for AI-Bio-Robot-Medicine Convergence (Project #20001234).

Conflict of Interest. The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

References 1. Balakumar, P., Maung-U, K., Jagadeesh, G.: Prevalence and prevention of cardiovascular disease and diabetes mellitus. Pharmacol. Res. 113, 600–609 (2016). https://doi.org/10.1016/ j.phrs.2016.09.040 2. Elieson, M., Mixon, T., Carpenter, J.: Coronary stent infections: a case report and literature review. Texas Hear. Inst. J. 39(6), 884–889 (2012) 3. Serruys, P.W., Kutryk, M.J.B., Ong, A.T.L.: Coronary-artery stents. N. Engl. J. Med. 354(5), 483–495 (2006) 4. Cruden, N.L.M., et al.: Previous coronary stent implantation and cardiac events in patients undergoing noncardiac surgery. Circ. Cardiovasc. Interv. 3(3), 236–242 (2010). https://doi. org/10.1161/CIRCINTERVENTIONS.109.934703 5. Pijls, N.H.J., et al.: Measurement of fractional flow reserve to assess the functional severity of coronary-artery stenoses. N. Engl. J. Med. 334(26), 1703–1708 (1996). https://doi.org/10. 1056/nejm199606273342604 6. De Bruyne, B., et al.: Coronary flow reserve calculated from pressure measurements in humans: validation with positron emission tomography. Circulation 89(3), 1013–1022 (1994). https://doi.org/10.1161/01.CIR.89.3.1013 7. Cookson, J.W.: Theory of the piezoresistive effect. Phys. Rev. 47(2), 194–195 (1935). https:// doi.org/10.1103/PhysRev.47.194.2 8. Dai, G., Li, M., He, X., Du, L., Shao, B., Su, W.: Thermal drift analysis using a multiphysics model of bulk silicon MEMS capacitive accelerometer. Sens. Actuators, A Phys. 172(2), 369–378 (2011). https://doi.org/10.1016/j.sna.2011.09.016

32

C.-W. Dong et al.

9. Faust, J.: Half cut stress concentration (HCSC) region design on MEMS piezoresistive cantilever for sensitivity enhancement. no. 1, p. 310 (1911) 10. Celler, G.K., Cristoloveanu, S.: Frontiers of silicon-on-insulator. J. Appl. Phys. 93(9), 4955– 4978 (2003). https://doi.org/10.1063/1.1558223 11. Mori, K.: Silicon-on-insulator (SOI) technology for micro-electromechanical systems (MEMS) and nano-electromechanical systems (NEMS) sensors. Silicon-On-Insulator (SOI) Technol. 2014, 435–453 (2014). https://doi.org/10.1533/9780857099259.2.435

Design and Implementation of an Assist Device in Data Collection and Rehabilitation Assessment for Patients with Limited Mobility after Stroke When Applying Constrained Induced Movement Therapy-the First Phase Anh-Khoa Tran1,2 , Thi-Thu-Hien Pham1,2 , Chi-Thanh Nguyen3 , and Ngoc-Bich Le1,2(B) 1 School of Biomedical Engineering, International University, HCMC, Ho Chi Minh City,

Vietnam [email protected] 2 Vietnam National University Ho Chi Minh City, Ho Chi Minh City, Vietnam 3 Faculty of Automation Technology Thuduc College of Technology, Ho Chi Minh City, Vietnam

Abstract. Constrained Induced Movement Therapy (CIMT) in hemiplegic patients is an effective method for upper extremity rehabilitation. Therapy aims to verify the viability and efficacy of CIMT in patients after stroke. The idea of the research is to develop a device that helps to collect motion parameters of the upper limbs (rehabilitation) using CIMT therapy. These parameters are very useful in assessing the patient’s condition and mobility as well as the degree of recovery after applying CIMT therapy. From the results of this evaluation, further studies will be carried out to develop the upper limbs’ exoskeleton to help support movement and restore function more effectively. Specifically, the study develops a wearable device that can collect data on motion and electromyography signals using accelerometers and electromyography sensors (EMG), respectively. The results demonstrate the feasibility and application capability of clinical data collection for the CIMT procedure. Keywords: Stroke Rehabilitation · Constrained Induced Movement Therapy · Data Logger · Rehabilitation Assessment

1 Introduction Many people with disabilities do not have equal access to health care, education, and employment opportunities, do not receive the disability-related services they requested, and in some cases, have been denied many daily life activities. After the entry into force of the United Nations Convention on the Rights of Persons with Disabilities (CRPD), disability has become increasingly understood as a human rights issue. Therefore, supporting and improving the activities of people with disabilities is receiving the attention © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. T. Vo et al. (Eds.): BME 2022, IFMPE Proceedings 95, pp. 33–48, 2024. https://doi.org/10.1007/978-3-031-44630-6_3

34

A.-K. Tran et al.

of researchers worldwide. Especially in developed countries, this issue is given top attention to improve living standards and create societal equity. Currently, there are many types of robots to assist people with disabilities, such as walking aids [1]; assistive devices [2]; Robots assist in moving and climbing stairs [3], etc. Rehabilitation medicine today has produced beneficial outcomes, such as increased limb and joint function, pain relief, faster healing, and psychological well-being [4–6]. Rehabilitation medicine aims to improve function by identifying and treating medical disorders, reducing deterioration, and preventing or treating consequences [7, 8]. Physiotherapists, rehabilitation physicians, and physical and rehabilitation specialists are all terms for medical professionals focusing on rehabilitation [8]. Rehabilitation medicine may involve a variety of therapists as well as medical specialists like psychiatrists, pediatricians, geriatricians, ophthalmologists, neurosurgeons, and orthopedic surgeons. Doctors and therapists can offer services in various regions of the world without any rehabilitation medicine professionals. Stroke rehabilitation is among the instances. In both the US and the UK, stroke is the main cause of disability [9, 10]. There are 15 million stroke victims worldwide each year, according to the World Health Organization (WHO). Five million passed away, and another five million had lasting disabilities. According to the 2010 Global Burden of Disease Study, stroke is the third most common cause of premature death and disability worldwide, as determined by Disability-Adjusted Life Years (DALY) [4]. Rehabilitation following a stroke can accelerate recovery and enhance the quality of life. In Vietnam, therapeutic activities overall and CIMT in specific are currently being introduced and developed, and there is still a lack of specialized equipment and human resources [11]. According to article [11], the data clearly demonstrates that Vietnam has very few databases that simply concentrate on the treatment side of rehabilitation and stroke, as well as very little investment. This is especially true of large hospitals like the Rehabilitation Hospital in Hanoi. CIMT is a successful method for regaining upper limb function in hemiplegic individuals. Verifying the application of CIMT in inpatients following stroke and the prognostic value of a number of cognitive and therapeutic independent factors are the two main objectives of therapy to determine a target group for whom this approach could be more useful [12]. Vietnamese therapists have created Constrained Induced Movement Therapy (CIMT) frameworks and completed a study that was carried out at two hospitals in Vietnam, according to information from [13]. A low-dose CIMT regimen (30 h) was administered by the treating physicians at the Hanoi Rehabilitation Hospital, while a high-dose CIMT regimen (72 h) was administered by the therapists at the Ho Chi Minh City Children’s Hospital. Both the low-dose and high-dose CIMT groups of kids demonstrated gains in routine tasks and personal therapy objectives. The dissemination of evidence-based practice in Vietnam is encouraged by this study. It is widely known that there are institutional and clinician hurdles to implementing evidence-based practice (EBP) in healthcare settings, as well as resource and time constraints [14–16]. For instance, CIMT is advised for chronic stroke patients with a finger extension higher than 10 degrees in a scientific statement from the American Heart Association (AHA) [17], but no control parameter exists. The Australian Stroke Guidelines,

Design and Implementation of an Assist Device

35

which state that CIMT is useful with more than 20 h of training but may be harmful when administered relatively early in the recovery ability [18], are less persuasive than imaging for CIMT. Again, a lack of a treatment parameter for the CIMT distribution as well as inconsistent treatments across the literature, were observed. Although CIMT is mentioned as a potential rehabilitation strategy in the New Zealand Concise Guidelines, no suggestions are made regarding the patient requirements or delivery guidelines for CIMT [19]. From the above barriers and limitations of rehabilitation using CIMT in both Vietnam and the world, we can see the urgency of a database system, and treatment methods and equipment must be consistent and reliable. This study aims to create a tool to measure upper limb mobility characteristics throughout rehabilitation utilizing CIMT therapy. These measures are highly helpful in determining the patient’s health, mobility, and level of recovery following the use of CIMT therapy. Further research will be done to create an exoskeleton for the upper limbs to support mobility and aid recovery function more successfully based on the findings of this test.

2 Methodology 2.1 Constrained Induced Movement Therapy Following Constrained Induced Movement Therapy, the therapeutic process lasts at least four weeks and involves three hours daily, five days per week. 20 therapy sessions totaling 60 h will be conducted. The patient is required to engage the affected limb for at least five “top arm usage hours” each weekday at home [20, 21]. CIMT Process required components of (1) Restraint of the less affected arm; (2) Massing of repetitive, structured practice; (3) intensive therapy in use of the more affected arm; (4) Monitoring arm use in life situations and problem-solving to overcome perceived barriers to using the extremity; (5) Behavioral agreement. 2.2 Modified Ashworth Measuring Scale Taub et al. [22] suggested that for selecting a patient for CIMT, follow the 10 × 10 × 10 eligibility criteria. That is, (1) 10 degrees active wrist extension on the affected hand; (2) 10 degrees active thumb abduction on the affected hand; (3) 10 degrees active extension of any other two digits on the affected hand. Additionally, in order to make the CIMT process more advantageous, it was recommended that [6]: • • • • •

Limited spasticity (0, 1, 1+ ) according to the modified Ashworth scale. Ability to move the affected arm 45° of shoulder flexion and abduction, and 90° of elbow flexion and extension. Adequate balance. Minimal cognitive dysfunction.

The modified Ashworth Scale reliability as a measure of spasticity has been researched in several studies [23, 24]. According to these researched models and criteria, this project can take those as an optimal reference in building a complete CIMT model using the Sub-Glove system.

36

A.-K. Tran et al.

3 System Design 3.1 Expected Functions and Solutions The suggested system is expected to follow the movement of the fingers on the upper arm and transform an analog muscle electromyography signal into a digitally plotted graph. The accelerometer, gyroscope, and angle sensors of the MPU 6050, as well as the EMG SEN0240, are the sensors designated for this device. The proposed system uses six sensors, including five MPU6050 accelerometer sensors and one EMG (i.e. EMG SEN0240) sensor. There are two different kinds of sensors in this group. The first is the MPU6050, which uses an integrated 3-axis gyroscope, 3-axis accelerometer, and digital motion processor to collect movement data. A second sensor interested in gathering muscular electromyography signals is the EMG SEN0240 from DFRobot and OYMotion. The precision of the applied EMG sensor can vary depending on the specific model used. The EMG sensor used in this project is the EMG SEN0240 from DFRobot and OYMotion, which has a precision of ± 3% for the input voltage and ± 5% for the input current. This means that the readings from the sensor may deviate from the true values by up to 3% for voltage and 5% for current. It is important to note that the precision of the sensor can also be affected by external factors such as noise, interference, and signal amplification. Therefore, appropriate signal processing techniques and noise reduction measures would be employed to improve the precision of the sensor readings. The Arduino Uno R3 category has been taken into consideration for the project’s central processing unit function. It also features a replaceable ATmega328 AVR microcontroller-based dual-inline-package (DIP) microcontroller board. When using a 9 V battery power source or 5 V DC voltage from a laptop power source, the device’s predicted tolerance is rounded to 10%. 3.2 Designated Locations of Sensors (MPU6050 and EMG) The authors attempted to use the sensors best by placing them in the locations depicted in Fig. 1. Using this collection of sensors should satisfy the author’s desire to obtain meaningful data while carefully considering desired output data measures. As a result, Fig. 1 depicts the designated sensor locations. In particular, five MPU6050 sensors are attached to the fingers in Fig. 1, one to the wrist, another to be used as a reference with the Arduino Uno R3 on the central housing, and the final sensor is the EMG SEN 0240, which is located on the side of the EMG housing unit. 3.3 3D Model In this study, Fusion 360 was deployed to the 3D structure of the proposed system (Fig. 2). Specifically, the system includes the Housing unit (container for Arduino Mega 2560), EMG module, and frame for MPU 6050 at the fingertips. The list of components is depicted in Fig. 2c consists of five MPU6050 sensors on the fingers, an Arduino Uno R3 on the Central Housing, and an EMG SEN 0240 on the side of the EMG housing unit.

Design and Implementation of an Assist Device

37

Fig. 1. Sensor distribution

Figure 2d demonstrates the functional block diagram of the proposed device. As shown, the sensors used in the device are the MPU6050 accelerometer and gyroscope sensors and the EMG SEN0240 sensor. The signals from these sensors are conditioned using a signal conditioning circuit before being sent to the microcontroller. The microcontroller used in this device is an Arduino Uno R3, which processes the signals and sends them to the Bluetooth module for wireless transmission to a computer. The device also includes a power management circuit to regulate the power supply and a display and user interface for monitoring and controlling the device. 3.4 Device Prototype Although the actual device (Fig. 3) is relatively different from the initial design, however, several prototypes and trials have been conducted for the purpose of finalizing the device in the aspect of aesthetics and minimalism.

38

A.-K. Tran et al.

b)

a)

c)

d)

Fig. 2. 3D model of a) central housing, b) MPU6050 housing, c) sensors assigned locations, a) functional block diagram

Design and Implementation of an Assist Device

a)

39

b)

Fig. 3. Overall location of components on model: MPU6050, Arduino Uno R3, EMG module, respectively.

a)

b)

Fig. 4. a) EMG electrode and b) EMG electrode position.

Electromyography (EMG) is a technique that measures the electrical activity of skeletal muscles. Proper placement of the electrodes is crucial to ensure the accuracy of the EMG signals. In this project, the EMG electrode position is critical to achieving reliable data for the Sub-Glove device.

40

A.-K. Tran et al.

The EMG electrodes (as shown in Fig. 4a) should be positioned correctly, with proper orientation across the muscle, to obtain the best signal possible. The surface EMG electrodes are placed along the muscle’s longitudinal midline, between the motor unit and the tendinous insertion (as shown in Fig. 4b). The electrode placement should be based on the muscle of interest and the motor point’s location, which is where the nerve enters the muscle. For example, to measure the activity of the biceps muscle, the electrodes should be placed on the belly of the muscle, with one electrode above the motor point and the other below it. The distance between the electrodes should be approximately two inches. The orientation of the electrodes is important, with the active (or detecting) electrode placed over the muscle belly and the reference electrode placed on an adjacent bone. Ensuring the skin is clean and dry before electrode placement is important to reduce skin impedance and improve signal quality. Moreover, it is recommended to use EMG preamplifiers that are integrated into the electrode, which can increase the sensitivity and accuracy of the signal. In summary, proper placement of the EMG electrode is crucial for obtaining reliable data that will be used in the Sub-Glove device. It requires careful consideration of the muscle of interest and the motor point location, proper orientation of the electrodes, and the use of EMG preamplifiers for increased sensitivity and accuracy. 3.5 Experimental Setup The experimental setup for this research project consists of the following components: Assist Device: The assist device used in this project is designed to collect muscle electromyographic (EMG) signals from the patient’s upper arm and transform them into digitally plotted graphs to assist in data collection and rehabilitation assessment for patients with limited mobility after stroke when applying Constrained Induced Movement Therapy. Sensors: The device includes six sensors, five accelerometer sensors (MPU6050) and one EMG sensor (EMG SEN0240). The MPU6050 sensors collect data on movement using the principle of a 3-axis gyroscope, a 3-axis accelerometer, and a digital motion processor integrated into a single chip. The EMG SEN0240 sensor collects electromyographic data. Arduino Uno R3: This microcontroller board is based on a removable, dual-inlinepackage (DIP) ATmega328 AVR microcontroller that is used as the central processing unit. Software: The software used in this project is designed to collect and analyze the data from the sensors and assist devices. Experimental Participants: patients with limited mobility after stroke who are undergoing Constrained Induced Movement Therapy are the participants in this study.

Design and Implementation of an Assist Device

41

Data size: • Participation number: 5 • Replications: 10 of every operation. Experimental Procedure: The experiment involves using the assist device and sensors to collect data on the patient’s upper arm movements during Constrained Induced Movement Therapy. The data is collected and analyzed to assess the patient’s rehabilitation progress. As previously said, it was suggested that [13] numerous measurements should be taken for diagnosing in order to make the CIMT process more effective. Specifically, the ability to move the affected arm: • • • •

90 degrees of elbow flexion and extension (Fig. 5), 90 degrees shoulder rotation (Fig. 6), Grasping objects (Fig. 7), Opening and closing (Fig. 8).

Digital Gonionmeter: The digital Gonionmeter is used to determine the degree of angle performed by the participant’s movement. Ethics: The study was approved by the Institutional Review Board of the local hospital. Written informed consent was obtained from all participants prior to their participation in the study. The confidentiality and anonymity of participants were ensured throughout the study. Overall, the experimental setup is designed to collect accurate and precise data on the patient’s upper arm movements during Constrained Induced Movement Therapy and to assist in the rehabilitation assessment for patients with limited mobility after stroke.

a)

b)

Fig. 5. a) 90° of elbow extension and b) flexion

42

A.-K. Tran et al.

a)

b)

Fig. 6. 90° shoulder rotation a) vertical and b) horizontal position

a)

b)

Fig. 7. Grasping objects a) grasping, b) releasing

4 Results and Discussion An analysis of the raw data demonstrated that the EMG and accelerometer signal patterns were visibly different for the identification tasks and situations are shown in the figures below. The plots in Fig. 9 were derived from data recorded while the subject was resting on his own and unattached to the EMG electrodes. When the examinee puts on the device, there are visible differences in the amplitude modulation of the EMG and accelerometer signals in all of the channels for this task, as shown in Fig. 10. To be more specific, the graph is intended to perform and display data from EMG sensors and accelerometer sensors for the thumb, index, mid, ring, and pinky fingers on the right hand, which are colored blue, red, yellow, and pink, respectively (pink for ring and pinky finger due to their muscle relation).

Design and Implementation of an Assist Device

a)

43

b)

Fig. 8. a) opening and b) closing hand

Fig. 9. Data signal at resting state

Figure 11 depicts the third task, in which the participant continuously closed and opened his or her hand. At first glance, the initial data in this graph represents the situation in which the device configures the sensors and collects prior data. It should be noted that closing and opening the hand is required for the system to initialize and warm up. The accelerometer and EMG patterns are all rapidly declining in Fig. 12 due to the movement of the right hand transforming from a resting state to a grasping position.

44

A.-K. Tran et al.

Fig. 10. Signal collection when putting on the device.

Fig. 11. Data signal when initiating sensors and then closing and opening hand.

The participant was asked to perform several normal movements in the experiment’s final task, including: • Right arm movement at 45° of shoulder flexion and abduction. • Elbow flexion and extension at 90°.

Design and Implementation of an Assist Device

45

Fig. 12. Data signal with object grasping.

These activities were carried out continuously for 10 s each. Figure 13 shows that the EMG and accelerometer sensors fluctuate in response to arm movement. Furthermore, EMG is clearly visible on the graph when the 90-degree elbow flexion and extension activity is performed.

Fig. 13. Data signal with normal hand movements.

46

A.-K. Tran et al.

Finally, Fig. 14 depicts the entire system signal when the participant removes the device. As shown, there were significant signal drops, and the connection status (represented by a green line) performed admirably for the system.

Fig. 14. Data signal when losing connection.

5 Conclusion This study proposed a sub-glove for CIMT data collection and monitoring utilizing electromyography and accelerometer transducers. The results are quietly positive and demonstrate the possibility of applying on the Ashworth Scale. This means that doctors and rehabilitation specialists could track up and take the signal from the device to investigate further signal scale or conduct deeper and harder exercises for patients. To sum up, the Sub-Glove can be used wisely to support patients and medical specialists in proceeding with rehabilitation therapy and optimize the collected signals. The Ashworth Scale will be used to develop a quantitative relationship between the patient’s level of movement and the signals from the accelerometer and electromyography transducers in the ensuing phases. Following that, a clinical experiment will be conducted, and the outcomes will be assessed. Acknowledgement. This research was funded by International University in Ho Chi Minh City under Grant No. T2021–03-BME/HD-DHQT-QLKH.

Design and Implementation of an Assist Device

47

References 1. Gu, J., Wang, J., Sun, M., Wu, Q.: Design of multifunctional combined walking aid. J. Phys. Conf. Ser. 1939(1), 012005 (2021). https://doi.org/10.1088/1742-6596/1939/1/012005 2. Duy, V.H., Dao, T.T., Quang, N.T., Le, N.-B.: Study on mechanical structure design for innovative multi-function assistive mobile robot. In: Duy, V.H., Dao, T.T., Zelinka, I., Choi, H.-S., Chadli, M. (eds.) AETA 2015: Recent Advances in Electrical Engineering and Related Sciences, pp. 645–654. Springer International Publishing, Cham (2016). https://doi.org/10. 1007/978-3-319-27247-4_54 3. Baishya, N.J., Ogai, H.: Wa-Chair: a concept for development of economical stair-climbing wheelchair. IOP Conf. Ser.: Mater. Sci. Eng. 307, 012010 (2018). https://doi.org/10.1088/ 1757-899X/307/1/012010 4. Shah, N., Lewis, M.: Shoulder adhesive capsulitis: systematic review of randomized trials using multiple corticosteroid injections. The Brit. J. General Pract.: The J. Royal College Gen. Pract. 57, 662–667 (2007) 5. Lambert, R.G.W., Hutchings, E.J., Grace, M.G.A., Jhangri, G.S., Conner-Spady, B., Maksymowych, W.P.: Steroid injection for osteoarthritis of the hip: a randomized, double-blind, placebo-controlled trial. Arthritis Rheum. 56(7), 2278–2287 (2007). https://doi.org/10.1002/ art.22739 6. Quinn, T.J., Paolucci, S., Sunnerhagen, K.S., Sivenius, J., Walker, M.F., Toni, D., Lees, K.R.: Evidence-based stroke rehabilitation: an expanded guidance document from the European Stroke Organisation (ESO) guidelines for management of ischaemic stroke and transient ischaemic attack 2008. J Rehabil Med 41(2), 99–111 (2009). https://doi.org/10.2340/165 01977-0301 7. Stucki, G., Reinhardt, J.D., Grimby, G.: Organizing human functioning and rehabilitation research into distinct scientific fields. Part II: conceptual descriptioins and domains for research. J. Rehabilit. Med. 39(4), 299–307 (2007). https://doi.org/10.2340/16501977-0051 8. Gutenbrunner, C., Ward, A.B., Chamberlain, M.A.: White book on Physical and Rehabilitation Medicine in Europe. J. Rehabil. Med.: Official J. UEMS Eur. Board of Phys. Rehabilit. Med. 45, l6–47 (2007) 9. Isaacs-Itua, A., Wong, S.: Stroke rehabilitation and recovery. Br. J. Hosp. Med. 82(9), 1–7 (2021). https://doi.org/10.12968/hmed.2020.0701 10. Yochelson, M.R., Dennison, A.C., Kolarova, A.L.: Stroke rehabilitation. In Braddom’s Physical Medicine and Rehabilitation, 6th edn., pp. 954–971.e3 (2021). https://doi.org/10.1016/ B978-0-323-62539-5.00044-8 11. World report on disability. ISBN 978 92 4 068521 5 (PDF) (2011) 12. Fabbrini, S., Casati, G., Bonaiuti, D.: Is CIMT a rehabilitative practice for everyone? Predictive factors and feasibility. Eur. J. Phys. Rehabilit. Med. 50(5), 505–514 (2014) 13. Coker-Bolt, P., DeLuca, S.C., Chi, H.K., Lê Tường, L.T.G., Thị, ĐN., Nguyen, T.B.N.: Improving quality of life for children with cerebral palsy in Vietnam: implementation of intensive models of rehabilitation. The Am. J. Occup. Ther. 75(Supplement_2), 7512515291p17512515291p1 (2021). https://doi.org/10.5014/ajot.2021.75S2-RP291 14. Menon, A., Bitensky, N.K., Straus, S.: Best practise use in stroke rehabilitation: from trials and tribulations to solutions! Disabil. Rehabil. 32(8), 646–649 (2010) 15. Salbach, N.M., Guilcher, S.J.T., Jaglal, S.B., Davis, D.A.: Factors influencing information seeking by physical therapists providing stroke management. Phys. Ther. 89(10), 1039–1050 (2009) 16. Jette, D.U., Bacon, K., Batty, C., et al.: Evidence-based practice: beliefs, attitudes, knowledge, and behaviors of physical therapists. Phys. Ther. 83(9), 786–805 (2003)

48

A.-K. Tran et al.

17. Miller, E.L., Murray, L., Richards, L., et al.: Comprehensive overview of nursing and interdisciplinary rehabilitation care of the stroke patient: a scientific statement from the American heart association. Stroke 41(10), 2402–2448 (2010) 18. National Stroke Foundation: Clinical Guidelines for Stroke Management. Melbourne, Australia (2010) 19. Stroke Foundation of New Zealand and New Zealand Guide_x0002_lines Group: Clinical Guidelines for Stroke Management 20. Gauthier, L.V., Taub, E., Mark, V.W., Perkins, C., Uswatte, G.: Improvement after constraintinduced movement therapy is independent of infarct location in chronic stroke patients. Stroke 40(7), 2468–2472 (2009) 21. Page, S., Levine, P., Sisto, S.A., Bond, Q., Johnston, M.V.: Stroke patients’ and therapists’ opinions of constraint induced movement therapy. Clin. Rehabil. 16, 55–60 (2002) 22. Taub, E., Uswatte, G.: Constraint-induced movement therapy: answers and questions after two decades of research. NeuroRehabilitation 21(2), 93–95 (2006) 23. Bohannon, R.W., Smith, M.B.: Interrater reliability of a modified ashworth scale of muscle spasticity. Phys. Ther. 67(2), 206–207 (1987). https://doi.org/10.1093/ptj/67.2.206 24. Bodin, P.G., Morris, M.E.: Inter rater reliability of the modified Ashworth Scale for wrist flexors spasticity following stroke. In: World Federation of Physiotherapy, 11th Congress, pp. 505–507 (1991)

Developing a Solid Health-Care Waste Incinerator for Disposing Waste Generated from Covid-19 Treatment and Quarantine Facilities Vu Duy Hai(B) , Vu Anh Duc, Tran Quoc Vi, and Hoang Thi Mai Phuong Biomedical Electronics Center, Hanoi University of Science and Technology, Hanoi, Vietnam [email protected]

Abstract. A huge amount of infected or potentially infected wastes has been generated globally since the outbreak of Coronavirus disease (COVID-19). These wastes include not only health-care waste from COVID-19 diagnostic testing and treatment, but also domestic waste generated by COVID-19 infected patients and their close contacts. These kinds of waste potentially contains SARS-CoV-2 so they must be disposed as hazardous waste, which becomes a huge challenge for developing countries that do not have sufficient health-care waste (HCW) disposal infrastructure. This paper presents the results of the study proposing an innovative solid health-care waste (SHCW) incinerator system that was developed from a disallowed-operating SHCW incinerator in Vietnam. The incinerator was designed to meet the regulations of the National technical regulation on solid health care waste incinerator of Vietnam. It had been in experimental operation to incinerate SHCW generated from locally medical facilities for six months in Phu Tho province, Vietnam. The results of emission analysis during the experimental operation show that the innovative system is capable of maintaining the concentration of CO less than 100 mg/m3 , the concentration of Dioxins/Furans less than 2.0 ng TEQ/Nm3 . The concentrations of SO2 , NO2 and HCl were also reduced by 9.8, 18.9 and 55.2 times, respectively, compared with the original incinerator. Additionally, the combustion duration when incinerating high-moisture infectious waste such as domestic waste from quarantine facilities is also reduced by about 30%. The study could support the HCW disposal infrastructure of Vietnam during the COVID-19 pandemic and could be used as a reference by other developing countries for pandemic control. Keywords: Solid Health-Care Waste · COVID-19 · Incinerator · Developing Countries

1 Introduction Health-care is one of the most essential services in any country so most governments have to focus on investing in and improving the health-care service efficiency. Meanwhile, the waste of this service, known as health-care waste, has not received proportional attention © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. T. Vo et al. (Eds.): BME 2022, IFMPE Proceedings 95, pp. 49–64, 2024. https://doi.org/10.1007/978-3-031-44630-6_4

50

V. D. Hai et al.

in many countries, especially developing countries [1]. According to the World Health Organization, HCW includes all the waste generated by health-care establishments, research facilities, and laboratories [2]. In addition, it includes the waste originating from “minor” or “scattered” sources such as those produced in the course of health care undertaken in the home (dialysis, insulin injections and others). Between 75% and 90% of the waste produced by health-care providers is non-risk or “general” health-care waste, comparable to domestic waste. The remaining 10–25% of health-care waste is regarded as hazardous and may create a variety of health risks [2]. In a large-scale assessment conducted by WHO in 22 developing countries in 2002, the authors reported that the proportion of health-care facilities that do not use proper waste disposal methods ranges from 18% to 64% [3]. Previously, competing with all of the other environmental problems that developing countries have to handle, SHCW disposal was often unnoticed or considered as general solid waste disposal [4]. However, due to the outbreak of COVID-19, a huge amount of infected or potentially infected wastes has been generated, and the improper treatment of these wastes could extend the spread of COVID-19 [5]. Hence the disposal of SHCW becomes an emerging challenge faced by all countries, especially developing countries, that do not have robust SHCW disposal infrastructure. These countries could no longer ignore this problem, and they are struggling to dispose of this kind of hazardous waste [5]. Sharing about 1,300 km of border with China, Vietnam was the first country to experience an outbreak of COVID-19, but the Vietnamese government had mostly succeeded in controlling the virus until the end of the first quarter of 2021. According to WHO’s statistics, until March 31st , 2021, Vietnam had reported a total of 2,594 confirmed cases of COVID-19 with 35 deaths [6]. However, starting from April 2021 as shown in Fig. 1, Vietnam has experienced the largest COVID-19 outbreak, and the number of COVID-19 cases in Vietnam had been increasing rapidly. The highest number of new confirmed cases in one day reached nearly 18,000. Until October 31st , 2021, there were 915,603 confirmed cases of COVID-19 with 22,030 deaths, reported to WHO.

Fig. 1. Increasing number of COVID-19 cases in Vietnam.

Developing a Solid Health-Care Waste Incinerator

51

To control the potential spread of COVID-19, the Vietnamese Government deployed a strategy of early detection, isolation, contact tracing, and quarantine [7]. Quarantine and treatment for cases and their close contacts is directly carried out by heads of committees and local authorities; and professionally supported by the public health sector [8]. When the number of COVID-19 cases increases, the number of treatment facilities for COVID19 patients and centralized quarantine facilities for close contacts of cases also increases rapidly. As a result, a huge amount of waste is generated from these centers. Until July 31st , 2021, more than 60% of COVID-19 cases in Vietnam concentrated in Ho Chi Minh City and surrounding areas. On July 31, 2021, the Vietnam’s Ministry of Health (MOH) recorded 90,243 confirmed cases in Ho Chi Minh City [9], over a total of 141,122 cases in Vietnam. These confirmed cases and their close contacts generated about 86.2 metric ton of COVID-19 waste during July 2021 [10]. Meanwhile, the average HCW generated in Ho Chi Minh City is only about 30 metric tons/month [11]. Thus, the quantity of infected or potentially infected wastes generated due to COVID-19 pandemic could be many times higher than the quantity of HCW normally generated before this pandemic. The task of disposing of these wastes is a big challenge for Vietnam’s HCW disposal infrastructure. The most common method of disposing of HCW currently in Vietnam is incineration. Incineration of waste is an oxidation operation run at high temperatures (850 °C - 1100 °C) in an incinerator. The organic and combustible material is incinerated and converted to inorganic and incombustible material and thus reduces the medical waste in volume and weight [12]. The controlled-air incineration is the most widely used medical waste incinerator technology, which is also known as starved-air incineration or twostage incineration [13]. A two-stage HCW incinerator consists of two main combustion chambers: the primary chamber and the secondary chamber. The primary chamber is a chamber where the ignition and burning of the waste occur [14]. In the primary chamber, the air-to-fuel ratio is low (starved-air), and the combustion gas temperatures are relatively low (760 °C–980 °C) [13]. The secondary chamber is a chamber where combustible solids, vapors, and gases from the primary chamber are burned, and settling of fly ash takes place [14]. Secondary chamber temperatures are higher than primary chamber temperatures, typically 980 °C–1095 °C [13]. Depending on the heating value and moisture content of the waste, additional heat may be provided by burners to maintain desired temperatures. Incineration of HCW has many benefits, such as significant volume reduction (about 90%), mass reduction (about 90%), thorough disinfection, and energy recovery [4]. Most HCW incinerators in Vietnam are low-cost, small-scale HCW incinerators and located on hospital campuses [15]. However, according to the research conducted in 51 first-class hospitals (Level-1 hospitals and Grade-1 provincial hospitals) having incinerators, only 3.9% of incinerators met all of regulations in the National Technical Regulation on Solid Health Care Waste Incinerator of Vietnam [15, 16]. Moreover, in many provinces of Vietnam, a huge amount of HCW is still combusted in industrial waste incinerators or domestic waste incinerators. The improper treatment and disposal of HCW, especially COVID-19 wastes, may further accelerate the spread of COVID19 pandemic, creating a serious risk for workers in the medical and sanitation fields, patients, and the society [5].

52

V. D. Hai et al.

During the operation of an SHCW incinerator, we encountered a problem in the combustion of COVID-19 waste. Most COVID-19 waste is domestic waste generated from COVID-19 quarantine facilities. This type of waste has high moisture, which is a different feature from general SHCW. The original SHCW incinerator did not have heat-generating agents to maintain the combustion of waste in the primary chamber. Therefore, the combustion of these wet waste in the SHCW incinerator is in a low efficiency state. A proposed solution to solve the task of disposing HCW and COVID19 pandemic waste is innovating existing HCW incinerators. Therefore, in this study, a method to innovate a two-stage retired HCW incinerator located in Phu Tho Province, Vietnam, is proposed.

2 The Two-Stage SHCW Incinerator Model The original two-stage SHCW incinerator is a negative pressure incinerator. The negative pressure is created by a forced draft fan and maintained in combustion chambers. Figure 2 shows the structure of this incinerator.

Fig. 2. Structure of the original SHCW incinerator.

The incinerator consists of three main parts: a primary chamber, a secondary chamber, and a chimney. The primary chamber’s dimensions are shown in Table 1. Combustion of waste in the incinerator occurs in two stages. In the first stage, waste is fed into the primary chamber, which is operated with less than the stoichiometric amount of air required for combustion. Primary combustion air is supplied from the bottom of the chamber in order to decompose the waste deposited on the grate located at the bottom of the chamber. The operating temperature range of the primary chamber is between 400 °C–1000 °C. Products of waste combustion, including ash, toxic gases, and others are led to the secondary chamber where they are completely combusted by a burner. The flue gas flows in the secondary chamber for more than 2 s, in a spiral

Developing a Solid Health-Care Waste Incinerator

53

Table 1. The dimensions of primary chamber. Parameter

Value

Height × Width × Length 1660 × 1820 × 2380 (m) Capacity (m3 )

7.2

Burning area (m2 )

3.07

Volume of waste (max) (metric ton)

1.2

trajectory to remove fly ash from the flue gas based on the effect of centrifugal force. Before moving to the chimney, the flue gas is mixed with air from the forced draft fan that quickly decreases the flue gas temperature to inhibit the Dioxins/Furans formation in the flue gas during incineration [17]. However, mixing the flue gas with air makes it impossible to observe the concentration of harmful substances in the flue gas. The combustion of waste in the primary chamber is maintained by combustion air with negative pressure. In this method, in the process of combustion HCW, the incinerator does not need to consume fuel to generate heat in the primary chamber, and the combustion could be simplified controlled by changing the draft fan power. However, when using this incinerator to incinerate waste having high moisture likely hazardous COVID-19 waste, the efficiency of combustion is quite low. This can be clearly seen when monitoring data on average primary chamber temperature during the incineration. The results are summarized as shown in Fig. 3.

Fig. 3. Measured temperature of the primary chamber during incinerating Covid-19 waste.

During the incineration of COVID-19 waste, the maximum temperature measured in the primary chamber is 624 °C, which is lower than Vietnamese Government’s regulation about the minimum temperature of the primary chamber during incineration [18]. In

54

V. D. Hai et al.

addition, the duration of an incineration lasts up to 12 h, which is 1.5 times longer than 8 h, the average time for an incineration of this original SHCW incinerator. To sum up, to be able to operate this incinerator safely and effectively, it is necessary to have methods to innovate it to overcome the reported problems.

3 The Proposed SHCW Incinerator System The methods to innovate the original model of the incinerator are researched and applied to control exhaust gas quality, ensure safety and effectively when disposing common SHCW waste and COVID-19 waste by the incinerator. The diagram of the proposed incinerator system is shown in Fig. 4.

Fig. 4. Diagram of the proposed SHCW incinerator system.

The instrument that creates negative pressure in combustion chambers is changed from a forced draft fan to an induced draft fan. Therefore, there is no more mixing of air into the flue gas before it is released into the environment. The concentration of O2 in flue gas is maintained at less than 16% when the incinerator is in operation [18]. The chimney of the original incinerator was removed, and an add-on gas cleaning system was connected after the secondary combustion chamber. After the flue gas is completely combusted in the secondary chamber, the gas is directed to a cooling tower. This cooling tower is designed and manufactured with three layers: the innermost layer is a heatand-corrosion resistant ceramic layer, the middle layer is the insulation layer, and the outermost layer is the steel shell layer. Inside this tower, a water spray nozzle system is installed on top. During the operation, water is sprayed with high pressure and small water jet size, which quickly lowers the temperature of the flue gas and removes the fly

Developing a Solid Health-Care Waste Incinerator

55

ash in the gas at the same time. Water carrying ash is collected at the bottom of the tower and led to a wastewater treatment system. After flowing through the cooling tower, the flue gas continues to be directed to a Sodium Hydroxide (NaOH) spray tower. The shells of the NaOH spray tower are manufactured similar to the shells of the cooling tower. There is a NaOH solution spray nozzle system installed in the middle part, inside this tower. The NaOH solution is used to absorb the amount of acid (HCl, HF, and others), and acidic oxide (SO2 , NO2 , CO2 , and others) in the flue gas. Above the nozzle system, many layers of short pipes are densely crisscrossed. These layers are designed to be able to condense steam in the flue gas. These collected water would flow down to the water collection tank located at the bottom of the tower, then be led to the wastewater treatment system. Subsequently, the dried flue gas is directed to a baghouse filtration. The activated carbon panels are installed inside this baghouse. These panels are arranged in a structure that increases the contact of the activated carbon surface with the flue gas. The remaining harmful substances in the flue gas, such as dioxins and mercury emissions, will be adsorbed by activated carbon in this cabinet. After all the above stages, the flue gas is led to the chimney and released into the atmosphere. This series of gas cleaning stages generate wastewater, which is led into a wastewater treatment system. Then, the wastewater is treated by a solution containing Ca(OH)2 , combined with filtration and settling methods. The amount of water after being treated and filtered, would be re-circulated for the flue gas treatment process. The schematic block diagram of the proposed incinerator system is shown in Fig. 5 [19, 20].

Fig. 5. Schematic block diagram of the proposed incinerator system.

To improve the incinerator’s efficiency of combusting COVID-19 waste, a method of providing heat for the primary chamber is proposed. In the original incinerator design, the combustion air entering the primary chamber is air at ambient temperature, but in a new design, combustion air is heated before entering the chamber. The heat from the gas cleaning system and wastewater treatment system is utilized to heat the combustion air, through the heat exchanger components. Therefore, combustion air would provide additional heat for the chamber and reduce moisture in the waste. Additionally, air slits

56

V. D. Hai et al.

are created on the primary chamber wall, in order to increase the contact area of the heated combustion air with the waste. Thus, the combustion efficiency of the incinerator will be improved. A remote-control system is designed to control the operation of the incinerator as shown in Fig. 6. The input data of the control system includes temperature of primary chamber, temperature of secondary chamber, temperature of flue gas, temperature, flow, concentration of particulate matter (PM), and gases (SO2 , NO2 , CO, O2 ) in the exhaust gas; the pH of the wastewater. These parameters are continuously monitored, and the operation of the incinerator is controlled to ensure that these parameters are within safe ranges. The remote-control system could control the operation of all equipment in the incinerator system, including: fans, burners, pumps, and combustion air doors. Therefore, this control system can control the operation of the incinerator by changing parameters such as the power of induced draft fan, the power of burner, the flow of heated combustion air entering the primary chamber, power of sprayed water and sprayed NaOH solution.

Fig. 6. The remote-control system of incinerator.

4 Estimation of the Proposed Incinerator System 4.1 Estimation Model The innovative SHCW incinerator is located in a centralized HCW treatment area in Phu Tho Province, Vietnam as in Fig. 7. The Ministry of Natural Resources and Environment of Vietnam granted permission to experimentally operate this incinerator for 6 months, from June 2021. The incinerator treated HCW from 13 hospitals in Phu Tho province. Before being moved to the incinerator, HCW is classified into the following categories: infectious sharp waste, infectious non-sharp waste, anatomical waste and other types of hazardous waste. The monthly average volume of each category treated by the incinerator during the 6 months of the experimental operation is shown in Table 2. In addition, from August 2021, the incinerator treated COVID-19 wastes from the treatment facilities for COVID-19 patients and centralized quarantine facilities for close

Developing a Solid Health-Care Waste Incinerator

57

Fig. 7. The innovated SHCW incinerator.

Table 2. Quantity of SHCW treated monthly during the experimental operation of incinerator.

Quantity of SHCW (tons/month) Proportion (%)

Infectious sharp waste

Infectious non-sharp waste

Anatomical

Other types

11659.3

17348.9

1976.9

797.2

36.7

54.6

6.2

2.5

contacts of cases in the locality. Before this time, the number of COVID-19 cases in Phu Tho was under 10 cases and the amount of COVID-19 waste was insignificant. However, after the COVID-19 outbreak in Vietnam, new COVID-19 cases appeared continuously in Phu Tho and the number of cases rapidly increased thereafter. COVID-19 quarantine and treatment facilities were constructed, resulting that the amount of COVID-19 waste that needed to be treated increased dramatically. The volume of COVID-19 waste treated by the incinerator is shown in Fig. 8.

Fig. 8. Quantity of potentially contaminated SARS-CoV-2 waste treated monthly.

58

V. D. Hai et al.

To control the operation of the incinerator, the parameters of the incinerator are monitored by the control system. The device used to measure temperature is K-type thermocouple, with a measured temperature range is from 0 °C–1300 °C. The chosen thermocouples have ceramic tube insulation to prevent corrosion. There is a continuous emission monitoring system, CEMS-5100, was used to observe the concentrations of harmful substances in the exhausted gas. This system was manufactured by Jiangsu Huihuan-Environmental Protection Technology Co., Ltd, in 2019 [21]. Based on ultraviolet absorption spectrum and difference absorption spectrum principles, this system can conduct on-line analysis and measurement for the concentrations of multiple gases including SO2 , NO2 , CO, O2 . In addition, during the experimental operation of the incinerator, the Center of Environmental Monitoring for the North of Vietnam measured the concentration of HCl and Dioxins/Furans in the exhaust gas to estimate the operation of the incinerator (Fig. 9).

Fig. 9. The continuous emission monitoring system CEMS-5100 in Phu Tho solid health-care waste treatment factory.

4.2 Estimation of Reducing CO The Carbon Monoxide (CO) combustion stage of the incinerator remains the same: CO is completely combusted in the secondary chamber, with high excess oxygen, forming CO2 . Additionally, CO combustion efficiency is dependent on the combustion temperature. The results of monitoring average (mean) concentration of CO each minute for each temperature stage are summarized as shown in Fig. 10. These are the results obtained during the early stage of combustion. The secondary chamber temperature is gradually increased to 1200 °C by heat provided by the burner. The concentration of O2 in the flue gas is always maintained lower than 16% during the process. According to the obtained results shown in the Fig. 10, the concentration

Developing a Solid Health-Care Waste Incinerator

59

Fig. 10. The decline in concentration of CO during incineration.

of CO only starts to decrease when the secondary chamber temperature reaches 500 °C, and decreases to nearly 0 mg/m3 when the temperature is above 1000 °C. Thus, the incinerator is capable of completely combusting CO in the flue gas. However, in order to ensure the combustion of CO efficiency, the operation of the incinerator needs to have a heating stage to raise the temperature of the secondary chamber to over 1000 °C before starting to combust waste in the primary combustion chamber. 4.3 Estimation of Reducing Dioxins/Furans The speedy reducing temperature of flue gas inside the cooling tower could inhibit the Dioxins/Furans formation in the flue gas during the combustion of SCHW [17]. To evaluate the effectiveness of inhibiting Dioxins/Furans formation, the concentration of Dioxins/Furans were measured and compared in two conditions: Condition 1–the flue gas does not go through the gas cleaning system (flue gas is not speedy cooled), and condition 2–the flue gas is passed through the gas cleaning system (flue gas is speedy cooled by water in cooling tower). The exhaust gas samples used to measure the concentration of Dioxins/Furans are taken from the chimney at three stages in one incineration. Stage 1 is the early stage, when the waste in the primary chamber starts to be combusted and the temperature of the primary chamber increases rapidly. Stage 2 is the middle stage, the combustion of waste is stable and the temperature of the primary chamber peaks or increases/decreases slowly. Stage 3 is the last stage, the combustion has passed the peak and gradually reduces, and the temperature of the primary chamber decreases rapidly. Each exhaust gas sample was taken within 30 min to measure the average concentration of Dioxins/Furans. The results of concentration measured in each stage are summarized as shown in Table 3. According to the results, the gas cleaning system reduces the concentration level of Dioxins/Furans more than 95%, so when the flue gas passed through the gas cleaning system, the concentrations measured are below 2.0 ng TEQ/Nm3 , which is the maximum allowable concentration of Dioxins/Furans specified in the National Technical Regulation on Solid Health Care Waste Incinerator of Vietnam [19].

60

V. D. Hai et al. Table 3. The average concentration of Dioxins/Furans in exhausted gas.

Stage

Secondary chamber temperature (o C)

Not speedy cooled

Speedy cooled

Exhausted gas temperature (o C)

Dioxins/Furans, PCDD/PCDF (ng TEQ/Nm3 )*

Exhausted gas temperature (o C)

Dioxins/Furans, PCDD/PCDF (ng TEQ/Nm3 )*

1

1050

200–283

35.7

55–57

0.7

2

1100

300–346

121

62–65

1.3

3

1200

400–421

228

69–71

1.8

(*Normal condition: 25 °C and 1 atm.)

4.4 Estimation of Reducing SO2 , NO2 and HCl In the NaOH solution spray tower, acidic oxide gases (SO2 , NO2 , and others) and acidic gases (HCl, HF, and others) are separated from the flue gas. The changes in concentrations of SO2 , NO2 and the concentration of HCl are monitored before and after spraying NaOH solution into the flue gas. The concentrations of SO2 and NO2 are continuously measured every 5 s by the CEMS-5100 system, the results of average (mean) concentration of these two gases per minute are summarized as shown in Fig. 11.

Fig. 11. The decline in concentration of SO2 and NO2 before and after spraying NaOH solution.

HCl is also a substance that exists in the flue gas of incinerators. However, the concentration of HCl cannot be measured continuously with the CEMS-5100 system. Therefore, to determine the value of concentration, the flue gas is sampled during 10 min before and after the NaOH spray tower is operated, then the collected gas samples are analyzed to determine the concentration of HCl. The method used to determine the concentration of HCl is the US EPA Method 26A method [22] and be performed by the Center of Environmental Monitoring for the North of Vietnam. The average (mean)

Developing a Solid Health-Care Waste Incinerator

61

concentration of SO2 , NO2 and HCl before and after the NaOH solution spray tower operated is summarized as shown in Table 4. Table 4. The average concentration of SO2 , NO2 and HCl before and after spraying NaOH. Solution Concentration (mg/m3 ) Before spraying After spraying

Concentration of HCl (mg/m3)

SO2

NO2

51.99 ± 3.58

381

69–71

5.30 ± 1.44

6.9

62–65

In Fig. 11, the period before the 10th minute is the period when the NaOH solution spray tower has not been operated. At the 10th minute, the NaOH solution spray tower is started to operate. After that, the concentration of SO2 and NO2 drops sharply. According to the results summarized in Table 4, the concentration of SO2 and NO2 when the NaOH solution spray tower is in operation decreased about 9.8 times and 18.9 times, respectively, compared to the concentration when the NaOH solution was not sprayed. In addition, the concentration of HCl also decreased about 55.2 times after the NaOH spray tower operated. A marked reduction of the concentrations of acidic oxides and acids in the flue gas not only reduces environmental pollution, but also limits the risk of the incinerator’s equipment being damaged by corrosion. 4.5 Estimation of Improving the Combustion Efficiency. To evaluate the combustion efficiency of the innovative incinerator in combusting Covid19 waste, the temperature of the primary chamber is measured during the Covid-19 waste combustion. The waste volume for each combustion at which the result is monitored is 800 kg. Figure 12 shows the rise in temperature during the first 2 h after the waste is started to combust. Figure 13 shows the graph of temperature of the primary chamber from the start to the end of combustion (the end of combustion is self-conventionally defined as the time when the concentration of CO in the flue gas drops below 100 mg/m3 with an inactive burner). In the Figs. 12 and 13 show that the combustion efficiency of the original incinerator with the high-moisture COVID-19 waste is low. During the first 2 h, the temperature of the primary chamber can only be raised to nearly 600 °C, and the maximum temperature during combustion is 624 °C. The combustion duration is about 12 h for approximately 800 kg, corresponding to under 70 kg/hour. This combustion efficiency is 50% lower than SHCW combustion efficiency of the original incinerator. When applying the method of drying waste and providing heat for the primary chamber by heated combustion air, the temperature of the chamber is rapidly raised. In the first 20 min the temperature has reached 400 °C and after 2 h the temperature has reached nearly 1000 °C. The maximum temperature measured at the primary chamber is up to 1025 °C. The combustion duration is shortened to about 8.5 h, corresponding to 70% of the combustion duration of the

62

V. D. Hai et al.

Fig. 12. The charts of temperature of primary chamber during first 2 h.

original incinerator. Thus, for wastes with high moisture such as COVID-19 waste, the innovative incinerator could ensure the efficient combustion without the use of auxiliary burners.

Fig. 13. The charts of temperature of primary chamber during incineration.

5 Conclusions In this study, we propose a method to innovate a general SHCW incinerator that does not meet the safety requirements for exhaust gas. The add-on gas cleaning system is designed and connected to the outlet of the original incinerator. This system could

Developing a Solid Health-Care Waste Incinerator

63

remove substances that pollute the atmosphere and harm to human health in the exhaust gas of the incinerator. With the measured results during the operation of the innovative incinerator, it is concluded that this incinerator has a lower level of pollutant generation than the original incinerator. The concentration of CO in the exhaust gas is maintained lower than 100 mg/m3 . The concentration of SO2 , NO2 , and HCl released into the atmosphere is decreased by 9.8, 18.9 and 55.2 times, respectively. Another harmful substance in the exhaust gas of the SHCW incinerator, Dioxin/Furan, also had a sharp decrease in concentration, and was maintained at less than 2 ng TEQ/Nm3 during the operation of the incinerator. With these figures, the innovative incinerator could be able to be officially licensed by the Ministry of Natural Resources and Environment of Vietnam. Additionally, the combustion efficiency of the incinerator is also improved, especially in the case that the incinerator has to incinerate the high-moisture Covid-19 generated from the quarantine and treatment facilities. The combustion temperature when combusting waste is raised above 650 °C and the incineration time is reduced by 30% compared to the incineration time of the general incinerator. The gas cleaning system for the SHCW incinerator is designed to be locally manufactured and assembled. However, the large size of the add-on gas cleaning system, and the associated wastewater treatment system, makes the entire system occupy a large area. In addition, the system also requires chemical costs to treat the flue gas, which increases the operating cost of the incinerator. Therefore, cost optimization is a problem that needs to be further studied. Besides, the design needs to continue to be optimized, and the efficiency of flue gas treatment also needs to be improved. The proposed method to make the existing SCHW incinerator be allowed to operate is an option to improve SHCW/infectious waste treatment efficiency, especially after the outbreak of COVID-19. Furthermore, ensuring the safety and the efficiency of the incineration of COVID-19 pandemic waste is a solution to reduce the risk of spreading Sars-CoV-2 to the community. It also helps the Vietnamese government face the emerging challenges caused by the COVID-19 pandemic in the present and future. Moreover, this method could be used as a reference by other developing countries for COVID-19 pandemic control. Acknowledgment. The authors would like to acknowledge the support of Biomedical Electronics Center, Hanoi University of Science and Technology; Phu Tho General Province Hospital. We would like to thank Amit J Nimunkar for his help during manuscript preparation. Disclosure Statement No potential conflict of interest was reported by the authors.

References 1. John, S.E., Nanjunda Swamy, C.,Manilal, A.: Bio-Medical Waste Incinerator Design for A Smart Arbaminch City, International Conference on Development of Smart Cities: Interface, Governance and Technology (2016) 2. World Health Organization: Safe management of wastes from health-care activities. https:// www.who.int/publications/i/item/9789241548564 (2014) 3. World Health Organization: Safe health-care waste management. https://www.who.int/water_ sanitation_health/medicalwaste/en/hcwmpolicye.pdf (2004)

64

V. D. Hai et al.

4. Olawale Olugbenga Olanrewaju: Design of medical wastes incinerator for health care facilities in akure. J. Eng. Res. Reports 5(2), 1–13 (2019) 5. El-Ramady, H., Brevik, E.C., Elbasiouny, H., et al.: Planning for disposal of COVID-19 pandemic wastes in developing countries: a review of current challenges. Environ. Monit. Assess. 193, 592 (2021) 6. World Health Organization: Health Emergency Dashboard (COVID-19). https://covid19.who. int/region/wpro/country/vn (2021) 7. Luong, T.T.T., Edit, O.M., Duc, P.V., et al.: The COVID-19 global pandemic: a review of the Vietnamese Government response. J. Global Health Reports 5, e2021030 (2021) 8. The Ministry of Health of Vietnam: Decision No. 963/QD-BYT on promulgating Temporary guidance on supervision and prevention of COVID-19, accessed from: https://thuvienphapl uat.vn/van-ban/the-thao-y-te/Quyet-dinh-963-QD-BYT-2020-Huong-dan-tam-thoi-giamsat-va-phong-chong-COVID-19-437400.aspx (2020) 9. The Ministry of Health of Vietnam Statistics. https://moh.gov.vn/en_US/web/ministry-ofhealth (2021) 10. Ho Chi Minh city generates more than 86 tons of medical waste every day. https://plo.vn/dothi/tphcm-phat-sinh-hon-86-tan-rac-thai-y-te-moi-ngay-1008641.html (2021) 11. Tighten collection and treatment of medical waste. https://www.sggp.org.vn/that-chat-thugom-va-xu-ly-rac-thai-y-te-606828.html (2019) 12. Yaman, C., Eroglu, T., Oktem, I., Taskmoglu, B.: Medical Waste Management-Medical Waste Disposal in Istanbul. Istanbul International Solid Waste, Water and Wastewater Congress (2013) 13. U.S. Environmental Protection Agency. Medical Waste Incinerator, accessed from: https:// www3.epa.gov/ttnchie1/ap42/ch02/final/c02s03.pdf (2018) 14. Richard, C.: Corey: definitions of terms used in incinerator technology. J. Air Pollut. Control Assoc. 15(3), 125–135 (1965) 15. Dam Thuong Thuong: Phan Ngoc Chau: Current situation of medical solid waste in hospitals and challenges in the prevention of Covid-19. J. Env. II, 03–08 (2021) 16. Hai, V.D., Hung, P.M., Hung, P.D., et al.: Design of noninvasive hemodynamic monitoring equipment using impedance cardiography. In: Van Toi, V., Le, T.Q., Ngo, H.T., Nguyen, T.-H. (eds.) BME 2018. IP, vol. 69, pp. 3–9. Springer, Singapore (2020). https://doi.org/10.1007/ 978-981-13-5859-3_1 17. Hai, V.D., Hung, P.M., Trung, L.H.P., et al. Design of software for wireless central patient monitoring system. In: Proceedings of KICS-IEEE International Conference on Information and Communication with Samsung LTE&5G Special Workshop, Hanoi, Vietnam, pp: 214– 217 (2017) 18. Huy H.Q., Thuan N.D., Hai V.D.: Building an elearning website for biomedical engineering education. In: The Third International Conference on the Development of Biomedical Engineering in Vietnam. IFMBE Proceedings, vol. 27. Springer, Berlin, Heidelberg (2010) 19. The National Technical Regulation on Solid Health Care Waste Incinerator of Vietnam (QCVN 02:2012/BTNMT). https://scem.gov.vn/vi/download/tieu-chuan/QCVN-02-2012BTNMT-Quy-chuan-ky-thuat-quoc-gia-ve-khi-thai-lo-dot-chat-thai-ran-y-te.html (2012) 20. Mukherjee, A., Debnath, B.: Sadhan kumar ghosh: a review on technologies of removal of dioxins and furans from incinerator flue gas. Procedia Environ. Sci. 35, 528–540 (2016) 21. CEMS-5100: Continuous Emission Monitoring System. https://huihuanhuanbao.en.madein-china.com/product/bSkEWBodAxGc/China-Cems-5100-on-Line-Test-Equipment.html (2021) 22. U.S. Environmental Protection Agency: Method 26A–Hydrogen Halide and Halogen– Isokinetic Method. https://www.epa.gov/emc/method-26a-hydrogen-halide-and-halogen-iso kinetic-method (2019)

Design of Ankle Brachial Index Measuring System for Detecting Peripheral Arterial Disease with Companion Mobile App Vu Duy Hai(B) , Nguyen Bach Duy, Nguyen Thuy Duyen, and Tran Viet Quang Trung Biomedical Electronics Center, Hanoi University of Science and Technology, Hanoi, Vietnam [email protected]

Abstract. Peripheral artery disease (PAD) is an abnormal narrowing of arteries other than those that supply the heart or brain. PAD most commonly affects the legs, but other arteries may also be involved, such as those of the arms, neck, or kidneys. The greatest risk factor for PAD is cigarette smoking. Other risk factors include diabetes, high blood pressure, kidney problems, and high blood cholesterol. Currently, PAD is typically diagnosed by finding an Ankle Brachial Index (ABI) or Ankle Brachial Pressure Index (ABPI) less than 0.90, which is the systolic blood pressure at the ankle divided by the systolic blood pressure of the arm. However, manual ABI measure depends on the operator’s skill, as lower leg arteries are hard to find. This study will aim to make an ABI measure device that can collect blood pressure simultaneously to make detecting PAD easier. The study presents the process of designing and improving a non-invasive automatic blood pressure monitor. We also integrate to measure the ABI in this term to detect the PAD. The system can measure blood pressure on multiple spots in the body to find the ABI and extend by creating a mobile app via WiFi connection for personal usage and long-term monitoring of one health. The design system includes four blood pressure monitoring channels to measure the ABI simultaneously and display results on mobile apps. The ABI measurement results of 20 volunteers with values from 9.0 to 1.2 are consistent with their health status, without a history of PAD. The imperfection in the method to find systolic pressure also can contribute to the error of the ABI result. However, despite these flaws, an oscillometric method is still a method of choice for most clinics for its convenience and safety. We recommended measuring multiple times for a better diagnosis. Keywords: Non-Invasive Blood Pressure · Ankle Branchial Index · Ankle Brachial Pressure Index · Peripheral Arterial Disease · Mobile App

1 Introduction With the rapid development of the economy, people’s eating and living habits are changing. Exercising less and eating high-calorie foods are gradually threatening human health. In recent years, many reports and research show that the age of patients with chronic diseases is decreasing dramatically and significantly. In particular, hypertension is a precursor to many chronic diseases, such as stroke, heart disease, and kidney disease [1]. © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. T. Vo et al. (Eds.): BME 2022, IFMPE Proceedings 95, pp. 65–78, 2024. https://doi.org/10.1007/978-3-031-44630-6_5

66

V. D. Hai et al.

According to the World Health Organization, in 1978, the prevalence of hypertension accounted for 10% to 15% of the population and is estimated to be 29% by 2025. In Vietnam, according to the Articles of General National survey on factors and risk of noncommunicate diseases in 2015, 18.9% of 18–69 years adults have high blood pressure. At the age of 18–25, the rate of hypertension increased from 15.3% in 2010 to 20.3% in 2015. Thus, 1 in 5 adults aged 25–64 years has high blood pressure. Therefore, blood pressure parameters have become one of the most important parameters in monitoring human health [1–3]. The detection or management, and treatment of hypertensive patients in the community have many difficulties. There are many influencing factors, such as poverty, lack of attention, lack of understanding, and low education level. Moreover, in today’s modern society, taking time every day to visit the clinic and medical center to monitor or measure blood pressure is often relatively difficult [4]. Peripheral artery disease (PAD) is an abnormal narrowing of arteries other than those that supply the heart or brain. Peripheral artery disease most commonly affects the legs, but other arteries may also be involved, such as those of the arms, neck, or kidneys. The greatest risk factor for PAD is cigarette smoking. Other risk factors include diabetes, high blood pressure, kidney problems, and high blood cholesterol. The Ankle Brachial Index (ABI) or Ankle Brachial Pressure Index (ABPI) is the ratio of the blood pressure at the ankle to the blood pressure in the upper arm (brachium), used to predict the severity of PAD. It assesses the severity of arterial insufficiency of arterial narrowing during walking. Calculating ABI or ABPI is illustrated in Fig. 1 and formula (1) [5, 6]. ABI =

Max Systolic Ankle Pressure Max Systolic Brachial Pressure

(1)

Currently, PAD is typically diagnosed by finding an ABI less than 0.90, which is the systolic blood pressure at the ankle divided by the systolic blood pressure of the arm. As the same with conventional blood pressure measuring, measuring blood pressure for PAD, we also use an air cuff as a middle medium to detect pressure. The blood pressure of the arms is an indicator of the general blood pressure of the body, but when blood goes farther in the body through the arteries, the pressure changes according to the condition of the patient’s arteries and the general health also resting and exercising situations will show different changes in reading. The relationship between ABI or ABPI and PAD is illustrated in Fig. 2 [7–9]. In a normal subject, the pressure at the ankle is slightly higher than at the elbow (there is a reflection of the pulse pressure from the vascular bed of the feet, whereas, at the elbow, the artery continues on some distance to the wrist). An ABI between and including 0.90 and 1.29 is considered normal (free from significant PAD), while a lesser than 0.9 indicates arterial disease. An ABI value of 1.3 or greater is also considered abnormal and suggests calcification of the walls of the arteries and incompressible vessels, reflecting severe peripheral vascular disease. The interpretation of ABI is shown in Table 1 [10–13]. However, manual ABI measure depends on the operator’s skill, as lower leg arteries are hard to find. Manual ABI repeats measurement four times for each pressure blood spot we are interested in, making it more time-consuming. So, this study will be aimed at making an ABI measure device that can collect blood pressure simultaneously to make the detection of PAD easier [14].

Design of Ankle Brachial Index Measuring System

Fig. 1. How to calculate ABI or ABPI and illustrative example.

Fig. 2. The relationship between ABI/ABPI and PAD.

67

68

V. D. Hai et al. Table 1. Interpretation of ABI.

ABI value

Interpretation

Action

1.3 and above

Abnormal

Refer or measure toe pressure

Vessel hardening 1.0 - 1.29

Normal range

None

0.90 - 0.99

Acceptable

0.80 - 0.89

Some arterial disease

Manage risk factors

0.50 - 0.79

Moderate arterial disease

Routine specialist referral

Under 0.50

Severe arterial disease

Urgent specialist referral

2 The Proposed Measuring System The proposed measuring system diagram is shown in Fig. 3. The system consists of 3 4 blocks as follows: Valve & Pump, Signal Processing, Display and Power Supply. The signal processing block and it performs the functions such as pulse width modulation (PWM), analog signal processing (ASP), analog to digital converter (ADC), digital signal processing (DSP) and connecting [15–17].

Fig. 3. The proposed measuring system.

The power supply is needed to power up several Op Amps and sensors, a microcontroller, a handy number of motors, an LCD screen, and additionally a Wi-fi module. Pump engines are pairs of electric pumps/valves that charge and discharge air for the cuff. Pump engines use little energy and have stable speeds. The exhaust engines used are electrical valves with an opening that can be adjusted. The Analog signal processing block is responsible for receiving signals from pressure sensors and proceeding with processing. The signal from the pressure sensor is fed into the measuring amplifier circuit to be converted to an output signal and amplified to the appropriate level for voltage calculation base pressure of the cuff. This signal is then further processed by a bandpass

Design of Ankle Brachial Index Measuring System

69

filter amplified to obtain the pulse signal. In addition, this block also includes pumpdischarge control circuits, and pulse conversion emitted from the microcontroller into a control signal for 2 pump - valve motors. Embedded software/signal processing: As a lot of calculation and control is needed, this cannot be a purely analog device. We need to use a microcontroller in our project to help control other electronic devices and do calculations. LCD screen: The LCD screen receives data about parameters from the digital processing block and displays it on the screen results. Smartphone app: The application receives data from the measuring device via Wifi, then stores the data and displays the results on the smartphone screen. We first start with the analog processing components. This part should be able to read pressure data within the normal human blood pressure range, up to 120 mmHg. These are relatively low range, so a standard industrial sensor will not be needed, and we can rely on a more common and accessible sensor we can buy from the “DIY” market. The more important part would be designing applier and filtering circuits. For amplifying with low-frequency signals like blood pressure, a simple amplifying method with op-amp is preferred over nonlinear methods like BJT or FET as the signal frequency is low enough not to be affected by lower bandwidth when using higher gain. Filtering processes are important to get both information from the sensor. Firstly, it is the pressure signal; this signal depends on the sensor’s output value and gains value from the amplifier. However, this signal can be affected by outside interference or even by the circuit and IC themselves. The pulse signal, this signal is the tiny pulse we can find on the pressure signal line. This signal results from the heart pumping blood through the arterial, causing small periodical changes in the pressure. This signal is based on the same frequency range as the heart pulse, only around 1–2 Hz center frequency. A range from 0.5 - 5 Hz should be able to capture most of the waveform shape of this signal; we do not need all the information from the pulse signal like with the ECG signal (which our pulse signal resembles) that can go up to 100 Hz. So, a low pass filter of 5 Hz is sufficient to help eliminate the outside noise and preserve information of the pulse signal. Since the pulse signal is the tiny wave on the pressure line, to attract this signal, we can do something similar to how to separate the DC component of the AC component (pulse signal) from the same signal (pressure signal); it is too high pass filtering the very low-frequency component of that signal. Hence, we can choose a high pass filtering of 0.5 Hz. The next part is signal processing. Analog will stay analog with a numerical value for humans to understand; this project will require digital processing to calculate meaningful value. To read analog values from the sensor, we need a step of analog and digital conversion; this can be done with an ADC IC or a microcontroller (MCU). With ADC IC, we can choose from a wide range of selections; they can be up to 16, 32-bit depth or with GHz range samples per second. However, dedicated ADC IC still needs support from the microcontroller, and with the complexity of writing the driver for the ADC, internal ADC inside the microcontroller is a better choice. Most microcontrollers nowadays have ADC peripherals for data acquisition purposes; most bit depth for ADC is 12 bits, and the sample rate up to 1 million Hz possibly. Since our data only have an upper-frequency range of 5 Hz, the minimum sample rate is only 10 Hz, so any microcontroller can support this. Since we have to read both the pressure signal and pulse signal and we have to read for all 4-set pressure information,

70

V. D. Hai et al.

eight total ADC channels are needed. This can propose some difficulty in programming. An ADC with direct memory access( DMA) support will be preferred as we can ease up the work for the CPU. The pulse signal is very small, so it is very prone to noise; analog filtering might not be enough to remove all the noise, and additional digital filters will be needed as they have a far greater order of filtering compared to analog filters. Digital filtering often uses a lot of computation resources of an MCU and may need to deal with float numbers too. A fast microcontroller with also float number support is preferred. Since our method of finding blood pressure parameters needs to analyze the whole signal from when measurement starts to finish and we have to deal with eight data channels, large memory or storage will be needed inside the microcontroller; it can be up to 100 KBs of RAM or Flash memory. An MCU with large memory is preferred. Motor control parts do not need too many requirements, as air pumps and air valves need only to be relatively low power and voltage not too high 3 v-6 v; the speed of these motors does not need to be fast and can be controlled by PWM. These components are however hard to find. The display is also an easy requirement as small screens are easy to buy, and there is a variety available for selection. We can be flexible in features, sizes, communication and of course price. We also do not want our device to be a closed system. We should leave a way for the device to communicate with other external devices, whether for debugging purposes or to extend the feature, for example, Wi-Fi capability. Almost all microcontrollers nowadays support debugging communication like JTAG or Serial wire and at least one 1 UART communication, so fortunately, it is a question we need to consider. The last and most important component is the power source, which is the most important feature of the embedded system. After briefly considering all the features needed, we need a power source to power up these features: Several Op Amps and sensors, a microcontroller, a handy amount of motors, an LCD screen and a Wifi module. Overall much power is needed, the total current draw can be well over 1A and for that factor, a battery-powered device may not be sufficient and make more design challenges we need to solve; powering the device from a wall socket through an AC-DC adapter is a more sensible choice. A software configuration management tool such as MIT Inventor is beneficial in software projects and will help programmers to deal with version management and provides the project members with access to a common code base. After having four values from our device, we will use the Esp32 microcontroller as a mid object for transmitting data from Stm32 (main microprocessor) to the Firebase server. We design an Android app to display Systolic, ABI, the result of your index and some advice, as you see on the right side. We can manage and store those indexes in Firebase automatically. Data calculated from hardware will be sent immediately over to the ESP32 via simple UART command. This is the layout of our real-time database; every change to the database can be viewed directly. Data sent over by ESP32 will be stored in the top branches. Other data history or timestamps will be stored inside the “user/save data” branches. The app has missions to fetch the latest data from top branches and save data back to the database, as shown in Fig. 4 [18]. When software configuration management tools are used, a lot of data will be collected in the repository. This data is not only the actual text stored in the source files but

Design of Ankle Brachial Index Measuring System

71

Fig. 4. The design of flow system

also different kinds of data, such as information about who made changes to a certain file and which changes were made between two file revisions. For project members and company management, this information can be valuable for determining the status and progress of a project. A tool will need to be developed to collect this data and transform it into usable information. Here the flow design showing how the app work, as well as the interaction between our app and database, is shown in Fig. 5 [19, 20].

Fig. 5. The App flow diagram

Using MIT App inventor tools, we can come up with applications like the following. Our app works well on current generation phones running Android, with the screen resolution of 6.4 . So far, we have tested on Redmi Note 9 and Samsung A30 phones and data receivers, displaying normally. Implementation of the proposed ABI measuring system for experiments is as shown in Fig. 6 with an electronic measuring circuit and App interface on smartphone.

72

V. D. Hai et al.

(a)

b)

Fig. 6. The proposed ABI measuring system (a) and App interface on smartphone (b).

3 Evaluation of the System 3.1 Experimental Measurement on Human Body We have conducted collecting the data on 20 volunteers at the laboratory aged between 18 and 24 with no history of peripheral artery disease diseases. All volunteers were tested with their approved consent. All the experiments were done by the doctors at Hanoi University of Science and Technology’s campus. The volunteers were left at rest without consuming any food, drink, or drugs for at least three hours before the measurement are shown in Fig. 7. The calculated NIBP (Systolic Pressure - SP), and ABI values of 20 volunteers are summarized below.

Fig. 7. Experiment setup in volunteer.

3.2 Evaluation of the Blood Pressure Parameter We have run the tests of our device against one of the commercial devices, the iChoice blood pressure monitor from Micro Life manufacture, as shown in Fig. 8. Our main goal

Design of Ankle Brachial Index Measuring System

73

is to find SP to detect PAD; we have only run a test to compare the systolic pressure between the two devices. We have run 20 tests for each device consecutively on the same person, each device tested one time between the other (our device then ichoice, then our device and so on) with 3 min rest between two times for blood regulation to return to normal. The time frame for the whole test was about 2 h, a healthy person’s blood pressure should not vary so much in such a time frame. The result is shown in Table 2 and Fig. 9.

Fig. 8. iChoice device is used to compare with the proposed measuring system.

By the result, we can see that the proposed measuring system is relatively close to the value of SP compared to iChoice device. In which, the mean absolute error is 3.8 mmHg, the max error is 10 mmHg and the min error is 1 mmHg. The STEDV of the proposed measuring system is 8.79 and the iChoice device is 7.72. With this result, the SP values measured from the proposed system are completely consistent with the current regulations on an error of NIBP measurement for medical use. The device catches up close to the commercial equipment [8]. 3.3 Evaluation of the ABI Measuring Result We have built four working blood pressure monitoring modules so that they can monitor blood pressure for ABI measures at the same time. The method of calculating ABI is maxed systolic pressure on both ankles divided by max systolic pressure of both brachial as formula (1). We test our device on all 20 volunteers; all are healthy person with no PAD conditions. Results of our initial test as shown in Table 3. Measurement results show that the ABI of all volunteers are in expected value for healthy people (ABI from 0.90 to 1.29). Specifically, out of 20 volunteers with no PAD

74

V. D. Hai et al. Table 2. The systolic pressure result versus iChoice device

No.

SP of proposed measuring system (mmHg)

SP of iChoice device (mmHg)

Absolute error (mmHg)

Difference (%)

1

101

110

−9

−8.18%

2

105

111

−6

−5.41%

3

98

105

−7

−6.67%

4

109

101

8

7.92%

5

103

102

1

0.98%

6

98

107

−9

−8.41%

7

91

100

−9

−9.00%

8

90

100

−10

−10.00%

9

98

88

10

11.36% (continued)

Table 2. (continued) No.

SP of proposed measuring system (mmHg)

SP of iChoice device (mmHg)

Absolute error (mmHg)

Difference (%)

10

104

95

9

9.47%

11

81

84

−3

−3.57%

12

95

96

−1

−1.04%

13

82

92

−10

−10.87%

14

80

90

−10

−11.11%

15

85

94

−9

−9.57%

16

88

98

−10

−10.20%

17

102

106

−4

−3.77%

18

84

90

−6

−6.67%

19

89

93

−4

−4.30%

20

92

89

3

3.37%

Average

93.8

97.6

3.8

−3.78%

STDEV

8.79

7.72

6.70

6.99%

conditions, there are 12 volunteers with ABI are shown in the normal range (from 1.02 to 1.19), 8 volunteers with ABI shown in acceptable (from 0.90 to 0.99). This result is completely consistent with the current health status of the volunteers [21, 22].

Design of Ankle Brachial Index Measuring System

75

Fig. 9. The graph shows the correlation of SP values between two devices.

So far, we have verified our single-channel blood pressure measurement to be nearly as accurate as a commercial device as well as successfully brought up a test with four channels measuring simultaneously. Theoretically, the minimum requirement for measuring PAD is satisfied. At least from what we have tested, the device can diagnose healthy status just fine within the healthy boundary. People who have PAD will likely have huge variations between peripherals and blood pressure, which can skew ABI heavily outside the normal range, so we can confidently say that our device can certainly diagnose such cases. But as far as accuracy is concerned, we still need to do a lot more tests for people with actual PAD and PAD with mild symptoms to measure false positive/negative, true positive/negative rate. A long with issues like oscillometric method accuracy, sample size and sample quality is the biggest limitation of this study that we hope to have a chance to improve in future.

4 Conclusions The authors have successfully proposed an ankle brachial index measuring system in this study. The proposed design allows safe and direct measuring results on the human body. Functional blood pressure monitoring device that can measure fours channel simultaneously to measure ABI. The experimental results have already proven rationality and confirmed the capabilities of the designed system. The systolic pressure values measured from the proposed system are completely consistent with the current regulations on an error of NIBP measurement for medical use. The device catches up close to the commercial equipment. The ABI of all volunteers is in expected value for a healthy person, completely consistent with the current health status of the volunteers. However, oscillometric methods of finding blood pressure are still debatable whether it is reliable, so measuring the exact ABI value is an even newer, harder topic. A lot of improvement will be needed to improve the ABI measurement. For this study, the only certain thing that is archived in the convenience of measuring. What we have tested is extremely small compared to what usual medical devices need to do. In the future, this project can be tested on more people against medical device standards. A study of the

76

V. D. Hai et al. Table 3. Results of measuring ABI of 20 volunteers on the proposed system

No.

SP of RA (mmHg)

SP of LA (mmHg)

SP of LL (mmHg)

1

101

110

99

2

103

107

3

104

4

95

5

SP of RL (mmHg)

ABI

Interpretation

92

0.90

Acceptable

107

96

1.00

Normal range

107

106

104

0.99

Acceptable

91

101

84

1.06

Normal range

89

95

116

97

1.22

Normal range

6

101

100

93

92

0.92

Acceptable

7

101

103

97

98

0.95

Acceptable

8

95

98

95

100

1.02

Normal range

9

99

98

97

108

1.09

Normal range

10

99

101

94

103

1.02

Normal range

11

99

95

90

112

1.13

Normal range

12

90

100

107

96

1.07

Normal range

13

93

110

99

89

0.90

Acceptable

14

98

105

99

94

0.94

Acceptable

15

100

104

105

110

1.06

Normal range

16

96

91

102

86

1.06

Normal range

17

88

96

114

99

1.19

Normal range

18

102

100

94

91

0.92

Acceptable

19

104

102

98

100

0.96

Acceptable

20

97

96

95

101

1.04

Normal range

properties of different blood pressure values on different body parts is also a suggestion we recommend, as knowledge of different body parts can lead to a better approximation of blood pressure and its relationship to PAD. Acknowledgment. The authors would like to acknowledge the support of the Biomedical Electronics Center (BMEC), the School of Electrical and Electronic Engineering (SEEE), the university clinic, Hanoi University of Science and Technology (HUST).

Disclosure Statement. No potential conflict of interest was reported by the authors.

References 1. McClary, K.N., Massey, P.: Ankle Brachial Index. In: StatPearls [Internet]. Treasure Island (FL): StatPearls Publishing (2022)

Design of Ankle Brachial Index Measuring System

77

2. Crawford, F., Welch, K., Andras, A., Chappell, F.M.: Ankle brachial index for the diagnosis of lower limb peripheral arterial disease. Cochrane Database Syst Rev. 9(9) (2016) 3. Xu, D., et al.: Diagnostic value of ankle-brachial index in peripheral arterial disease: a metaanalysis. Can J Cardiol. 29(4), 492–498 (2013) 4. Lane, R., Ellis, B., Watson, L., Leng, G.C.: Exercise for intermittent claudication. Cochrane Database Syst Rev.: CD000990 (2017) 5. Casey, S.L., Lanting, S.M., Chuter, V.H.: The ankle brachial index in people with and without diabetes: intra-tester reliability. J Foot Ankle Res 13, 21 (2020) 6. Casey, S., Lanting, S., Oldmeadow, C., et al.: The reliability of the ankle brachial index: a systematic review. J Foot Ankle Res 12, 39 (2019) 7. Davies, J., Williams, E.: Automated plethysmographic measurement of the ankle-brachial index: a comparison with the doppler ultrasound method. Hypertens Res 39, 100–106 (2016) 8. Monti, M., Calanca, L., Alatri, A., Mazzolai, L.: Accuracy of in-patients ankle-brachial index measurement by medical students. Vasa. 45(1), 43–48 (2016) 9. Špan, M., Geršak, G., Millasseau, S.C., Meža, M., Košir, A.: Detection of peripheral arterial disease with an improved automated device: comparison of a new oscillometric device and the standard Doppler method. Vasc Health Risk Manag. 12, 305–311 (2016) 10. Alvaro-Afonso, F.J., Garcia-Morales, E., Molines-Barroso, R.J., Garcia-Alvarez, Y., SanzCorbalan, I., Lazaro-Martinez, J.L.: Interobserver reliability of the ankle-brachial index, toebrachial index and distal pulse palpation in patients with diabetes. Diab Vasc Dis Res. 15(4), 344–347 (2018) 11. Demir, O., et al.: Individual variations in ankle brachial index measurement among Turkish adults. Vascular. 24(1), 53–58 (2016) 12. Millen, R.N., Thomas, K.N., Majumder, A., Hill, B.G., Van Rij, A.M., Krysa, J.: Accuracy and repeatability of the Dopplex Ability. Expert Rev. Med. Devices 15(3), 247–251 (2018) 13. Chesbro, S.B., Asongwed, E.T., John, E.B., Haile, N.: Reliability of ankle-brachial index measurements: a comparison of standard and vascular blood pressure cuffs. Top Geriatr Rehabil. 29(3), 195–202 (2013) 14. Babbs, C.F.: Oscillometric measurement of systolic and diastolic blood pressures validated in a physiologic mathematical model. Biomed Eng Online. 11, 56 (2012) 15. Hai, V.D.: Technique of Receiving Data from Medical Devices to Create Electronic Medical Records Database. Soft Computing Applications and Techniques in Healthcare. Boca Raton: CRC Press (2021). https://doi.org/10.1201/9781003003496 16. Hai, V.D., Hung, P.D., Hung, P.M., et al.: Design of noninvasive hemodynamic monitoring equipment using impedance cardiography. In: The 7th International Conference on the Development of Biomedical Engineering in Vietnam. IFMBE Proceedings, vol 69. Springer, Singapore (2019) 17. Hai, V.D., Hung, P.M., Trung, L.H.P., et al.: Design of software for wireless central patient monitoring system. In: Proceedings of KICS-IEEE International Conference on Information and Communication with Samsung LTE&5G Special Workshop, Hanoi, Vietnam, pp. 214– 217 (2017) 18. Ngoc, P.P., Hai, V.D., Bach, N.C., et al.: EEG Signal analysis and artifact removal by wavelet transform. In: The 5th International Conference on Biomedical Engineering in Vietnam. IFMBE Proceedings, vol 46. Springer, Cham (2015) 19. Hai, V.D., Thuan, N.D.: Design of laboratory information system for healthcare in Vietnam BK-LIS. In: The 3rd International Conference on Communications and Electronics, art. no. 5670692, pp.110–114 (2010) 20. Vu, H.D., Nguyen, T.D., Pham, N.P., et al.: A design of renal dataflow control and patient record management system for renal department environment in Vietnam. In: The Third International Conference on the Development of Biomedical Engineering in Vietnam. IFMBE Proceedings, vol 27. Springer, Berlin, Heidelberg (2010)

78

V. D. Hai et al.

21. Curry, S.J., et al.: Screening for peripheral artery disease and cardiovascular disease risk assessment with the ankle-brachial index: US Preventive Services Task Force Recommendation Statement. JAMA 320, 177–183 (2018) 22. Aboyans, V., et al.: Measurement and interpretation of the ankle-brachial index: a scientific statement from the American Heart Association. Circulation 126, 2890–2909 (2012)

Research to Construct Intelligent Control Devices Using Brain Waves for the Disabled Huy Khoi Do, The Dung Nguyen, and Thi Bich Diep Nguyen(B) Thai Nguyen University of Information and Communication Technology, Thai Nguyen, Vietnam [email protected]

Abstract. Brainwaves are a new and growing field of research. When we approach the brainwaves at different levels, we can use them to control the surrounding devices or apply them as an effective medical therapy to treat nerve-related diseases. Brainwave technology will help many people with disabilities, but their brain is still active. We study products that apply the brain’s level of concentration to control electrical appliances. The brain’s concentration level will be expressed through the control signal execution block. From there, it helps people with disabilities control electrical equipment in the house, like turning on and off fans, lights… The product will enable people with disabilities to enjoy technological advancements similar to what a normal person can do, with no gaps in appearance due to cognitive disabilities. Keywords: Signal Processing · Brainwaves · Electroencephalogram · Smart devices

1 Introduction Modern science has shown that there is a biological current in every human being. The brain is the place of concentration of many cells to produce electric signals. Using an Electroencephalogram (EEG), the scientists recorded the types of electrical potentials emitted and transmitted by brain cells along the nervous axis of the brain [1]. It is called a brainwave. Each type of brainwave reflects different mental states, which can also lead to different states of awareness. A disabled is a person who has one or more physical or mental disabilities that cause significant and permanent impairment in their ability to carry out activities of daily living. They are less healthy, less capable of participating in outdoor activities and do not benefit from all the scientific advances that ordinary people have. Currently, there are many devices to help people with disabilities, but there are not many comprehensive support products for people with total paralysis. Some recent studies can be mentioned as: Brain-controlled wheelchairs: A robotic architecture [2], High-speedspelling with a non-invasive brain–computer interface [3, 4]. The brain’s electric activity generates brainwaves with 3 types: Beta, Alpha, Theta, Delta and Gamma. Each type of brainwave reflects different mental states, which can also lead to different states of awareness. Every state of brainwaves occurs at a certain frequency, measured in units of Hz as illustrated in Fig. 1 [5]. To study the characteristics of brain waves in order to control various physical and mental states. © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. T. Vo et al. (Eds.): BME 2022, IFMPE Proceedings 95, pp. 79–87, 2024. https://doi.org/10.1007/978-3-031-44630-6_6

80

H. K. Do et al.

Fig. 1. Certain brain waveforms

Based on the above, the idea has been given to us “ Research to construct intelligent control devices using brain waves for the disabled”. The applied product will help people with disabilities take advantage of technological advances similar to what a normal person can do without the gap appearing because of sensory impairments.

2 The Proposed Method To solve the problem, we plan to build a Brainwave intelligent control device design that must meet the following requirements: The system uses a common micro-controller, simple programming, easy to replace and design a hardware device with compact scientific design, stable quality of operation. 2.1 The Block Diagram of Our System The components of the system block diagram are shown in Fig. 2: The block diagram of the system including the components is shown in Table 1. Brainwave Sensor. In this study, we choose MindWave as a product of EEG biosensor technology. MindWave measures securely and emits EEG power spectrums (alpha waves, beta waves) via Bluetooth Low Energy (BLE) or Bluetooth Classic to communicate wirelessly with a computer, iOS or Android device. This device includes a headset, ear clip and sensor arm. The reference electrode and the ground electrode of the headset are on the ear clip, and the EEG electrode is on the sensing arm, placed on the forehead above the eyes (FP1). It uses only one AAA battery with 8 h of operating time [6]. The technical specifications are set out below:

Research to Construct Intelligent Control Devices

81

Fig. 2. System block diagram.

Table 1. Components of the system block diagram. Function blocks

Function

Brainwave Sensor

waveform recognition to feed to the signal processing block

Signal Processing

Receive signal from the brain wave sensor, process the signal and send it to CPU

CPU

Receive signal from processing block to check Transmit signal to devices

Device

Works on the control signal of human-generated brain waves

Bluetooth

Transmit and receive data from the central processing unit to the device blocks, and receive and store information from the devices

Power Supply

Supply power to active blocks

- Use the TGAM1 module - Auto Wireless Pairing - Module BT/BLE. - Supported Platforms: Windows (XP/7/8/10), Mac (OSX 10.8 or later), iOS (iOS 8 or later) and Android (Android 2.3 or later) - Emitting 12-bit raw brainwaves (3–100 Hz) with a Sampling rate at 512 Hz - Output power spectrum EEG (Alpha, Beta, v.v.) - Analyze the quality of the signal of EEG - Weight: 90 g - Upward sensing arm: 225 mm x 155 mm x 92 mm - Downward sensing arm: 225 mm x 155 mm x 165 mm. - BT/BLE with BT (SPP) dual mode module for PC, Mac, Android; BLE (GATT) for iOS - Range of BT: 10 m

82

H. K. Do et al.

Design of Signal Processing and Central Processing Blocks. We use Arduino Uno R3, which is an at-mega328 chip-based microcontroller card. It has 14 digital I/O pins, of which 6 can be used for pulse width modulation. There are 6 analog input pins that allow us to connect external sensors to collect data. Using a quartz oscillator with a frequency of 16 MHz, there is a standard USB connection port for us to load programs on the board, a power supply pin for the circuit, an ICSP header, and a reset button. Figure 3 shows the block principle diagram of the central processing unit.

Fig. 3. The block principle diagram of CPU

Device Block Design. In this study, we use Module L298N – propeller motor control with the following specifications: + Driver: L298 integrates two H bridge circuits. + Control voltage: + 5 V ~ + 12 V + Maximum current per H-bridge is: 2A + Voltage of control signal: + 5 V ~ + 7 V + The current of the control signal: 0 ~ 36 mA + Energy waste: 20 W (when temperature T = 75 °C) + Storage temperatures: −25 °C ~ + 130 °C The function of the pins is as follows: + 12 V power, 5 V power: These are 2 pins that supply power directly to the motor. + Power GND: This pin is the GND of the motor power supply. + INPUT: IN1, IN2, IN3, and IN4 are connected with pins 5, 7, 10 and 12 of L298. These are the pins that receive the control signal. + OUTUT: OUT1, OUT2, OUT3, OUT4 (corresponding to INPUT pins) are connected to pins 2, 3,13,14 of L298. These pins will be connected to the motor.

Research to Construct Intelligent Control Devices

83

+ Two pins, A Enable and B Enable, are used to control the H-bridge in L298. If the logic level “1” (connected to the 5 V source) allows the H-bridge to work, if it is at the “0” logic level, the H-bridge circuit does not work. + Output A is connected to motor A, and output B is connected to motor B. Figure 4 shows the device block principle diagram.

Fig. 4. The device block principle diagram

Module Bluetooth HC-05. The HC-05 Bluetooth transceiver module is used to establish a serial connection between two devices using Bluetooth waves. A special feature of the HC-05 Bluetooth module is that the module can work in 2 modes: MASTER or SLAVE. Meanwhile, Bluetooth module HC-06 only works in SLAVE mode [7]. With the following settings: + UART: Baudrate 9600, N, 8, 1. + Pairing code 1234 or 0000. + To enter AT COMMAND mode, press and hold the button before powering on, the LED will flash 2 s. The baud rate for AT COMMAND mode is 38400. Tx pin connected to Rx pin. + Power on and don’t press the button will run normally. LED will flash fast. + EN pin only receives 3V3 TTL logic level. Power Supply. The power source used for the system is + 5 V supply for the ICs in the active circuit and + 3.3 V supply voltage for sensors and low-power devices. With the input source from 9 V to 12 V through IC LM7805 to convert to 5 V voltage and through IC LM1117 to switch back to 3.3 V voltage level to supply the operating system. Figure 5 shows power supply block diagram.

84

H. K. Do et al.

Fig. 5. Power Supply block diagram

2.2 The System Design Principle Diagram The product applies brain concentration to control electrical equipment in the home. The concentration of the brain will be indicated by the block that executes the control signal, which is the fan’s rotation speed. The higher the concentration, the quicker the fan runs. In addition, the control signal block is also shown through the LED system, the concentration in the brain is large, and the light will be on. If the concentration of the brain decreases to less than 30%, the light will turn off. Figure 6 shows the system design principle diagram.

Fig. 6. System design principle diagram

Research to Construct Intelligent Control Devices

85

2.3 Flowchart of the System Algorithm The system works with the first step being system initialization. We then test the connection; if the connection fails, we will return to check. If connected successfully, the electrode will be checked for brainwave signals. The process of analyzing and processing signals to measure brain concentration as a percentage. This signal outputs to LCD and LED. With less than 30% concentration, we perform the engine shutdown; from 30% to 60%, we program the operation to set the motor mode to level 1; in the other

Fig. 7. Algorithm flowchart of the system

86

H. K. Do et al.

case the concentration is greater than 60%, we set the motor mode to level 2. Figure 7 shows the algorithmic flowchart of the entire system.

3 Experiment and Evaluate the Results After this research, design and construction of products, we managed to build a smart control device using brain waves for people with disabilities to meet the goals and requirements set. We conduct product testing with the following process: Step 1: Turn on the device power switch. Step 2: Bluetooth connection between device and sensor. Step 3: When LCD shows “not connected”, adjust the electrodes on forehead and ears. Step 4: LCD display “connected” begins to focus the brain’s thoughts. The concentration level of the brain will level to control the level of engine speed and light level. Step 5: Turn off the device by dispersing the thoughts of the brain. The operator will wear a Mindwave brain wave sensor on his head and focus his thoughts to give a signal to control the device. A study with 10 people: 5 men and 5 women with 100 tests helped to evaluate the effectiveness of the product (Table 2). Table 2. Test results statistical table. Test number

Number of successful subjects in control level 1

Number of successful subjects in control level 2

1

7

6

2

8

8

3

10

10

4

10

10

- Both women and men can control the propeller to rotate when the mind is highly concentrated. - On the first inspection, 1 male and 2 females did not rotate the propeller because the concentration level was low. Among the remaining 7 survey subjects, there is 1 person who does not control level 2 successfully. - In the second survey: 01 male and 01 female did not make the propeller rotate because the concentration level was not high. - Through the third and fourth surveys: all 10 testers had begun to get used to the concentration level, the propeller was spinning. - And the next test, the concentration is higher, so it is easier to control the rotating propeller.

Research to Construct Intelligent Control Devices

87

As a result, we have self-assessed that we have successfully built an intelligent brainwave control device for people with disabilities to meet the objectives and requirements. It is the control of the electrical equipment by the brainwaves and may change the intensity of the device’s activity depending on the concentration of the operator’s thoughts. Going forward, we hope to improve this research so that we can develop more useful applications to improve the quality of life of persons with disabilities.

Conflicts of Interest. The authors have no conflict of interest to declare.

References Lopes da Silva, F.: EEG: origin and measurement. In: Mulert, C., Lemieux, L. (eds.) (2009) Carlson, T., Millan, J.R.: Brain-controlled wheelchairs: a robotic architecture. IEEE Journal of Robotics and Automation 20(1), 65–73 (2013) Koudelková, Z., Strmiska, M., Jašek, R.: Analysis of brain waves according to their frequency. Int. J. Biolo. Biomedi. Eng. 12 (2018) Chen, X., Wang, Y., Nakanishi, M., Gao, X., Jung, T.-P., Gao, S.: High-speed spelling with a non-invasive brain–computer interface. In: Proceedings of the National Academy of Sciences of the United States of America 112(44), 6058–6067 (2015) Siuly, S., Li, Y., Zhang, Y.: EEG signal analysis and classification. Springer Berlin Heidelberg, New York, NY (2017) Alazraq, F.A.: Introduction to EEG sensor, Mini tutorial, Hashemite University (2017) HC-05 Bluetooth Module User’s Manual (2010)

Development of a Wireless Wearable Holter to Measure Blood Pressure and Heart Rate for Telemedicine Tien Thi Thuy Le, Viet Ngoc Tran, Nguyen Khoi Pham, Hung Quoc Nguyen, Nga Thi Tuyet Tu, and Toi Van Vo(B) School of Biomedical Engineering, International University, Vietnam National University-Ho Chi Minh City (VNU-HCMC), 700000 HCMC, Vietnam [email protected]

Abstract. A novel wireless wearable, Holter, was developed to automatically measure blood pressure and heart rate based on the principle of oscillometry. It offers two measuring modes: on-demand - users activate the measurements at will, and programmable - measurements are triggered automatically at a selected rate. The accuracy of the results was validated using a mercury plethysmograph and simulator. The results are uploaded to a cloud server for remote monitoring and immediate care from healthcare providers when necessary. The main device is secured to an inflatable cuff wrapping around the user’s arm, consisting of a microprocessor control board and other electromechanical parts. Firmware was implemented to control the device’s functioning and wirelessly handshake to a smartphone developed for iOS and Android platforms for activating the Holter, displaying data, and facilitating communication between patients, healthcare providers, and relatives. Hence, this Internet of Things (IoT) ecosystem is useful in the LMIC society, where more and more adults not living with their parents can still care for them from a distance, and healthcare can be conveniently provided to patients living in remote areas. The collected data can be stored in a digital repository and utilized by artificial intelligence technology. The calibrated Holter accurately measured blood pressure under various conditions, including normal blood pressure, weak pulse, mild exercise, obesity, and tachycardia, except for arrhythmia, where significant inaccuracies were observed. Standard conditions resulted in higher accuracy, achieving 97.1% based on 300 samples, compared to 74.25% accuracy under arrhythmic conditions with 200 samples. Keywords: Holter Blood Pressure and Heart Rate · Cardiovascular Diseases · Oscillometry · Telemedicine · Plethysmography

1 Introduction One-third of all fatalities worldwide are caused by cardiovascular diseases, mainly due to high blood pressure [1]. About 88% of the 8.5 million fatalities in 2015 linked to hypertension occurred in LMICs [2]. The numbers were significantly higher in older adults (≥65 years) compared to younger adults ( 0.05) were found among these materials. Besides, the pH15-min of the other HA samples was below 5.0, as shown in Table 2. In addition, all HA sintered at 800, and 1000 °C steadily increased and reached a pH60-min value above 5.0 after 60 min, while HA sintered at 1200 °C still exhibited a low pH60-min value below 5.0. Likely, all HA sintered at 1200 °C still showed a significant (p < 0.05) lower pH profile than the other samples during the 24 h of storage: PC_HA_1200

162

N. T.-N. Dang et al.

reached pH24-h of 5.09 ± 0.02, and BV_HA_1200 exhibited pH24-hours of 4.75 ± 0.15, the lowest pH24-hours values. In comparison, the control (CT) with AS only did not show the neutralization that occurred throughout the test time. Furthermore, BV_HA_800 displayed the highest pH60-min value of 5.51 ± 0.08 and pH24-h of 5.83 ± 0.09, which were all above the critical pH level in the mouth of 5.5 to prevent tooth demineralization [18, 19]. These results prove that artificial saliva’s pH changes depend on the sintering temperature. The HA buffering effect became weaker, and the time to raise the acidic pH to 5.5 was prolonged as the temperature increased from 800 to 1200 °C.

4 Conclusion In this study, HA derived from bovine, galline, and porcine were sintered at either 800, 1000, or 1200 °C to investigate the effect of sintering temperature on HA composition and its behavior under demineralized oral conditions. As a result, all HA powders extracted from raw bones were highly crystalline and caused a pH increase after 24 h. Among the HA groups, bovine HA sintered at 800 °C reached the highest pH level; however, HA sintered at 1200 °C neutralized demineralized AS to a significantly lesser pH of 5.5, regardless of the animal HA sources. Therefore, HA extracted from bone waste sintered below 1200 °C can be considered a biomimetic agent in dental care products to raise the pH and extend remineralization. Acknowledgement. Vietnam National University funded this research under grant number NCM2020–28-01. The authors also thank the School of Biomedical Engineering, International University, Ho Chi Minh City, Viet Nam, for supporting facilities.

Declaration of Competing Interest. The authors declare no conflict of interest.

References 1. Wen, P.Y.F., Chen, M.X., Zhong, Y.J., Dong, Q.Q., Wong, H.M.: Global burden and inequality of dental caries, 1990 to 2019. J. Dent. Res. 101(4), 392–399 (2022) 2. Sarna-Bo´s, K., et al.: Physicochemical properties and surface characteristics of ground human teeth. Molecules 27(18), 5852 (2022) 3. Abou Neel, E.A., et al.: Demineralization-remineralization dynamics in teeth and bone. Int. J. Nanomed. 11, 4743–4763 (2016). https://doi.org/10.2147/IJN.S107624 4. Featherstone, J.D.B., Lussi, A.: Understanding the chemistry of dental erosion. In: Dental Erosion, vol. 20, pp. 66–76. Karger Publishers (2006) 5. Zhao, H., et al.: Natural tooth enamel and its analogs. Cell Rep. Phys. Sci. 100945 (2022) 6. Richardson, S., Vaughan, K.: Hydroxyapatite Toothpaste on Caries Prevention in Children (2022) 7. Meyer, F., et al.: Hydroxyapatite as remineralization agent for children’s dental care. Front Dent Med. 10 (2022) 8. Tao, S.-Y., et al.: Nano-hydroxyapatite use in oral medicine: a review. Int. J. Mater. Sci. Appl. 11, 62 (2022)

The Effect of Sintering Temperature on the Behavior of Hydroxyapatite

163

9. Par, M., Gubler, A., Attin, T., Tarle, Z., Tarle, A., Tauböck, T.T.: Ion release and hydroxyapatite precipitation of resin composites functionalized with two types of bioactive glass. J. Dent. 118, 103950 (2022) 10. Chen, L., Al-Bayatee, S., Khurshid, Z., Shavandi, A., Brunton, P., Ratnayake, J.: Hydroxyapatite in oral care products—a review. Materials (Basel) 14(17), 4865 (2021) 11. Obada, D.O., Dauda, E.T., Abifarin, J.K., Dodoo-Arhin, D., Bansod, N.D.: Mechanical properties of natural hydroxyapatite using low cold compaction pressure: Effect of sintering temperature. Mater. Chem. Phys. 239, 122099 (2020) 12. Toi, V.V., Lien Phuong, T.H. (eds.): 5th International Conference on Biomedical Engineering in Vietnam. IP, vol. 46. Springer, Cham (2015). https://doi.org/10.1007/978-3-319-11776-8 13. Mondal, S., Pal, U., Dey, A.: Natural origin hydroxyapatite scaffold as potential bone tissue engineering substitute. Ceram. Int. 42(16), 18338–18346 (2016) 14. Dey, S., Das, M., Balla, V.K.: Effect of hydroxyapatite particle size, morphology and crystallinity on proliferation of colon cancer HCT116 cells. Mater. Sci. Eng. C 39, 336–339 (2014) 15. Yap, A.U., Ong, J.E., Yahya, N.A.: Effect of resin coating on highly viscous glass ionomer cements: a dynamic analysis. J. Mech. Behav. Biomed. Mater. 113, 104120 (2021) 16. Yang, S.-Y., Choi, J.-W., Kim, K.-M., Kwon, J.-S.: Prevention of secondary caries using resinbased pit and fissure sealants containing hydrated calcium silicate. Polymers (Basel) 12(5), 1200 (2020) 17. Fuss, M., Wicht, M.J., Attin, T., Derman, S.H.M., Noack, M.J.: Protective buffering capacity of restorative dental materials in vitro. J. Adhes. Dent. 19, 177–183 (2017) 18. Willems, H.M., Kos, K., Jabra-Rizk, M.A., Krom, B.P.: Candida Albicans in oral biofilms could prevent caries. Pathog. Dis. 74(5), ftw039 (2016) 19. Meurman, J.H., Ten Gate, J.M.: Pathogenesis and modifying factors of dental erosion. Eur. J. Oral Sci. 104(2), 199–206 (1996)

Physico-Chemical Characterization of Animal Bone-Derived Hydroxyapatite Sintered at Different Temperatures Nhi Thao-Ngoc Dang1,2 , Tram Anh-Nguyen Ngoc1,2 , Thien-Ly Vu1,2 , Diu-Anh Phan1,2 , Toi Van Vo1,2 , and Thi-Hiep Nguyen1,2(B) 1 Vietnam National University, Ho Chi Minh City, Viet Nam

[email protected] 2 Tissue Engineering and Regenerative Medicine Laboratory, Department of Tissue Engineering

and Regenerative Medicine, School of Biomedical Engineering, International University, Ho Chi Minh City 700000, Viet Nam

Abstract. This study describes the effect of sintering temperature on mechanical properties, microstructure, chemical functional groups, and in-vitro bioactivity of hydroxyapatite (HA) extracted from bovine (BHA), galline (GHA) and porcine (PHA) bone. The HA was subjected to various sintering temperatures of 800, 1000, and 1200 °C. At 1200 °C, galline bone produces HA with maximum mechanical hardness (70.73 ± 8.49 N), which is higher than bovine HA (25.33 ± 5.27 N), the most common natural HA source, and the other samples. In addition, the morphology and particle size variations of HA samples are observed by scanning electron microscope (SEM). The results show that the average grain sizes become significantly more extensive and compact as temperatures increased from 800 to 1200 °C. In addition, the morphology of the HA-sintered body was also evaluated after soaking in simulated body fluid (SBF) for seven days to assess the bioactivity. It shows that a new apatite structure formed on all HA samples except GHA sintered at 1000 °C and PHA sintered at 1000 °C and 1200 °C. Thus, the sintering temperature can significantly affect the microstructure, hardness, and bioactivity of HA-derived animal sources. Keywords: Hydroxyapatite · Natural Sources · Sintering Temperature

1 Introduction The demand for bioactive ceramics in bone repair and regeneration has increased rapidly due to their direct bonding with host tissue and promoting new bone growth [1]. Hydroxyapatite (HA) is considered one of the most used biomaterials for ideal bone replacement due to its natural bone-like compositions, excellent biocompatibility, non-toxicity, and osteoconductive properties [2]. The synthesized HA and its derived products have received wide attention. Several synthesis methods based on chemical reactions have been investigated; however, they fail to reach commercial value because of their complicated synthesis process and high cost [3, 4]. Therefore, the naturally calcium-enriched © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. T. Vo et al. (Eds.): BME 2022, IFMPE Proceedings 95, pp. 164–171, 2024. https://doi.org/10.1007/978-3-031-44630-6_13

Physico-Chemical Characterization of Animal Bone

165

materials received much attention from modern ceramists to attain a simple route to get HA in unlimited supply with the economic benefit of waste recovery. Moreover, the previous research observed that HA derived from natural resources, such as animal bones, including elemental mineral ions, such as CO3 2− and Mg2+ , would improve biocompatibility, cell attachment, and proliferation compared to synthetic HA [5]. Bovine bone has been considered the most common waste source to extract HA [6]. Other naturally derived HA, such as porcine and galline bones, are also two kinds of widely available by-products from meat products that can be used as precursors to form HA. Despite this, there is a lack of comparative studies to characterize HA derived from bovine, galline, and porcine. In addition, HA has been commonly manufactured from natural bone through a sintering process, a significant factor influencing the material’s physical, mechanical, and biological properties [7, 8]. Therefore, this study investigated the effect of sintering temperatures at 800, 1000, and 1200 °C on HA extracted from bovine, porcine, and galline for physical-chemical characteristics and in-vitro bioactivity.

2 Methodology 2.1 Preparation of Natural HA The HA-extracted procedure was based on the work carried out by Tram et al. [9] with some modifications. Briefly, the HA samples were extracted from the bovine (BHA), galline (GHA), and porcine (PHA) femur waste bones collected from local slaughterhouses. The raw bones were defatted and deproteinized by two steps of boiling in hot water for 6 h and in a pressure cooker for 2 h. Then, bone samples were dried under sunlight to eliminate soot formation before calcining at 600 °C for 3 h. The resultant HA blocks were then crushed into smaller particles and pressed into round tablets with a diameter of 15 mm and a thickness of 2 mm. Then, the compact bodies were subjected to a sintering process at either 800 °C, 1000 °C, or 1200 °C for 3 h by a muffle furnace (P330 Nabertherm, Germany) with slow heating rates of 5 °C min−1 and held for 2 h. The HA sample name and synthesis conditions were denoted as in Table 1. Table 1. List of experimental hydroxyapatite samples. Sintering temperature Natural HA sources (°C) Bovine Porcine

Galline

600

BHA.600

PHA.600

GHA.600

800

BHA.800

PHA.800

GHA.800

1000

BHA.1000 PHA.1000 GHA.1000

1200

BHA.1200 PHA.1200 GHA.1200

166

N. T.-N. Dang et al.

2.2 Sample Characterization Physicochemical Characterization. Firstly, a hardness tester determined the mechanical strength via tablet breaking forces (LOGAN HDT-400L). The test was repeated for each sample to take the average value (n = 3). Then, the characterization of sintered HA particles morphology, shape, and size was observed using the scanning electron microscope (SEM, JEOL IT-100) operated at 20 kV. The samples were sputter-coated with gold before SEM analysis. Fouriertransformed infrared (FTIR) spectra over the region of 400–4000 cm−1 were obtained to evaluate the bonding patterns of HA samples using the Nicolet 6700 spectrometer. Simulated Body Fluid (SBF) Immersion. Each 40 mg of HA powder was immersed in 40 ml of simulated body fluid (SBF, 1.5×) for 7 days at 37 °C. SBF is prepared by following the protocol proposed by Kokubo et al. [10] with pH 7.4. After the extraction, the specimens were rinsed in distilled water and frozen dry. After SBF immersion, the described SEM techniques measured the structural and microstructural characteristics.

3 Results and Discussion 3.1 Physico-Chemical Analysis

Fig. 1. Images of experimental sintered HA tablets °C (A) and the subsequent tablet breaking force (B). (Scale bar: 1.0 cm).

From the observation of Fig. 1, the sintering temperature of HA samples affects the physical properties in terms of color, tablet shrinkage, and breaking force. In Fig. 1A, the color of the sintered HA tablets changed from grey to completely white (BHA and PHA) or light yellowish (GHA) after exposure at 800 °C and above. This confirms the elimination of the organic phases and the presence of hydroxyapatite during thermal treatments. Besides, the diameter of all HA tablets shrank approximately from 1.4 to

Physico-Chemical Characterization of Animal Bone

167

1.0 cm when the sintering temperature increased from 600 to 1200 °C. The tabletbreaking force results of HA are shown in Fig. 1B at various sintering temperatures. As expected, the increased breaking force is related to tablet shrinkage as the sintering temperature rises from 800 to 1200 °C. The hardness of BHA, GHA, and PH increases from 8.0 ± 0.73 to 25.33 ± 5.27, from 7.1 ± 1.3 to 59.27 ± 12.29, and from 8.0 ± 9.4 to 70.73 ± 8.49, respectively. Thus, compared to BHA samples, GHA and PHA sintered at 1200 °C showed a higher advantage in mechanical properties.

Fig. 2. SEM microstructure of the BHA (A1-A4), GHA (B1-B4), and PHA (C1-C4) sintered at 600 °C (A1-C1), 800 °C (A2-C2), 1000 °C (A3-C3) and 1200 °C (A4-C4). (Scale bar: 2.0 μm).

The variations in the SEM microstructure of HA were observed at various sintering temperatures from 600 to 1200 °C in Fig. 2. HA sintered at 600 °C (A1-C1) is composed of agglomerated particles without a defined morphology presence of collagen fibers. However, the grain structure of HA sintered at 800 °C (A2-C2) could indicate the removal of organic residues in animal bone during sintering. In addition, the grain size of both GHA and PHA were recorded between 100 and 150 nm, while the BHA particles with the size of 260 to 320 nm tend to be highly agglomerated. At 1000 °C, all HA particles significantly increased in size and became closer to each other to form interconnectivity

168

N. T.-N. Dang et al.

due to the densification process (A3-C3). Compared to 800 °C, BHA obtained after sintering at 1000 °C had the grain size increasing by 50%, 440 to 800 nm, while GHA and PHA varied mainly from 460 to 840 nm, rising to 70–80%. These variations in HA grain growth can be explained primarily by the presence of Na+ , Mg2+ , and CO3 2− ions replaced in its structure in different bone sources [11]. Further, SEM microstructures of HA sintered at 1200 °C (A4-C4). The neck formation by diffusion occurred, and the porosity decreased at this sintering temperature. The HA particle sizes become more extensive and consolidate with each other, leading to an appreciable enhancement in hardness results of HA tablets sintered at 1200 °C.

Fig. 3. FTIR spectra of the BHA, GHA, and PHA samples sintered at 800 °C (black line), 1000 °C (pink line), and 1200 °C (blue line) (Color figure online).

Figure 3 shows the FTIR spectra of BHA, GHA, and PHA samples after sintering at 800 °C, 1000 °C, and 1200 °C. The samples were tested at the frequency range between 400 and 4000 cm−1 . Overall, there are three major compositional groups in the samples, PO4 3− , CO3 2− , and OH− , characterized as the major bands in HA samples. Bands referring to the vibration OH− of water (H2 O) adsorbed on the material’s surface were located at around 3570 cm−1 and 1637 cm−1 . The 1090, 1046, 961, 601, 570, and 472 cm−1 bands correspond to the PO4 3− groups. At 1200 °C, the bands at around 1090, 1046, and 961 cm−1 become broader than those at lower temperatures due to

Physico-Chemical Characterization of Animal Bone

169

the loss of the PO4 3− group. In addition, the FTIR results confirmed the presence of B-types of carbonate hydroxyapatite due to the observation of the CO3 2− group at 869, 1384, and 1451 cm−1 in all HA samples sintered at 800 °C. The presence of carbonate ions in the HA structure could result in fewer crystalline materials and increases the HA solubility. Therefore, calcium and phosphate ions released from HA immersed in body fluid could increase, which is necessary for forming bone-like apatite. However, the thermal treatment at 1200 provided a decrease in CO3 2− bands at high temperatures. Similar results occurred in HA obtained from other biowaste sources [12, 13]. 3.2 In Vitro Assessment in SBF

Fig. 4. SEM images after seven days of immersion in 1.5×SBF of the BHA (A1-A3), GHA (B1-B3), and PHA (C1-C3) sintered at 800 °C (A1-C1), 1000 °C (A2-C2), and 1200 °C (A3-C3). (Scale bar: 1.0 μm)

Figure 4 shows the morphology changes of the tested natural HA samples after immersion in 1.5×SBF for seven days. Both grain size and texturization change are observed on the surface of BHA.800 (A1), BHA.1000 (A2), and BHA.1200 (A3) samples, which were partially covered by a new apatite layer with a flake-like structure. The described results agree with previous studies of the bovine HA soaked in SBF or different mediums, which characterizes the material bioactivity during ion exchange in SBF and provides 3D space for calcium and phosphorus compounds to deposit or for bone tissue fibers to grow [14]. The same feature was also recognized in GHA.800 (B1) and GHA.1200 (B3). However, the formation of the apatite layer on the surface of GHA.1000 and PHA samples was not transparently observed for incubation periods.

170

N. T.-N. Dang et al.

Therefore, the study in 1.5×SBF confirmed that natural HA’s apatite formation ability depended on extracted sources and sintering temperature.

4 Conclusion The present study has demonstrated that the sintering temperature can significantly affect the microstructure and hardness of HA derived from bovine, galline, and porcine bones. Compared to bovine sources, HA from galline and porcine sintered at 1200 °C was more advantageous in mechanical properties and more extensive grain growth. The FTIR confirmed the presence of B-types of carbonate HA in all sintered HA samples. The in vitro bioactivity test showed a new apatite structure formed on all HA samples except galline HA sintered at 1000 °C and porcine sintered at 1000 °C and 1200 °C. Therefore, HA bioactivity also depended on extracted sources and sintering temperature. Acknowledgments. Vietnam National University funded this research under grant number NCM2020-28-01. The authors also thank the School of Biomedical Engineering, International University, Ho Chi Minh City, Viet Nam, for supporting facilities.

Declaration of Competing Interest. The authors declare no conflict of interest.

References 1. Stanciu, L., Diaz-Amaya, S.: Chapter 4 – Bioceramics. In: Stanciu, L., Diaz-Amaya, S. (eds.) Introductory Biomaterials, pp. 57–75. Academic Press, Boston (2022) 2. Siddiqui, H.A., Pickering, K.L., Mucalo, M.R.: A review on the use of hydroxyapatitecarbonaceous structure composites in bone replacement materials for strengthening purposes. Materials (Basel) 11(10), 1813 (2018) 3. Arokiasamy, P., et al.: Synthesis methods of hydroxyapatite from natural sources: a review. Ceram. Int. (2022) 4. Sharifianjazi, F., et al.: Biocompatibility and mechanical properties of pigeon bone waste extracted natural nano-hydroxyapatite for bone tissue engineering. Mater. Sci. Eng. B 264, 114950 (2021) 5. Shi, P., Liu, M., Fan, F., Yu, C., Lu, W., Du, M.: Characterization of natural hydroxyapatite originated from fish bone and its biocompatibility with osteoblasts. Mater. Sci. Eng. C 90, 706–712 (2018). https://doi.org/10.1016/j.msec.2018.04.026 6. Ramesh, S., et al.: Characterization of biogenic hydroxyapatite derived from animal bones for biomedical applications. Ceram. Int. 44(9), 10525–10530 (2018) 7. Obada, D.O., Dauda, E.T., Abifarin, J.K., Dodoo-Arhin, D., Bansod, N.D.: Mechanical properties of natural hydroxyapatite using low cold compaction pressure: effect of sintering temperature. Mater. Chem. Phys. 239, 122099 (2020) 8. Herliansyah, M.K., Hamdi, M., Ide-Ektessabi, A., Wildan, M.W., Toque, J.A.: The influence of sintering temperature on the properties of compacted bovine hydroxyapatite. Mater. Sci. Eng. C 29(5), 1674–1680 (2009). https://doi.org/10.1016/j.msec.2009.01.007 9. Ngoc, B., Tram, T., Nguyen, T., Van Toi, V.: Synthesis and characterization of hydroxyapatite biomaterials from bio wastes. In: 5th Int. Conf. Biomed. Eng., Vietnam, vol. 46, pp. 336–337 (2015).https://doi.org/10.1007/978-3-319-11776-8

Physico-Chemical Characterization of Animal Bone

171

10. Kokubo, T., Takadama, H.: How useful is SBF in predicting in vivo bone bioactivity? Biomaterials 27(15), 2907–2915 (2006) 11. Mostafa, N.Y., Hassan, H.M., Mohamed, F.H.: Sintering behavior and thermal stability of Na+, SiO44− and CO32− co-substituted hydroxyapatites. J. Alloys Compd. 479(1–2), 692–698 (2009) 12. Horta, M.K.S., Moura, F.J., Aguilar, M.S., Westin, C.B., Navarro da Rocha, D., de Campos, J.B.: In vitro evaluation of natural hydroxyapatite from Osteoglossum bicirrhosum fish scales for biomedical application. Int. J. Appl. Ceram. Technol. 18(6), 1930–1937 (2021) 13. Khiri, M.Z.A., et al.: Crystallization behavior of low-cost biphasic hydroxyapatite/βtricalcium phosphate ceramic at high sintering temperatures derived from high potential calcium waste sources. Results Phys. 12, 638–644 (2019) 14. Li, X., et al.: 3D printing of hydroxyapatite/tricalcium phosphate scaffold with hierarchical porous structure for bone regeneration. Bio-Design Manuf. 3(1), 15–29 (2020)

Design and Evaluation of Simple Artificial Vascular Graft Bioreactor System Anh-Thai Huynh1,2 , Minh-Duy Le1,2 , Hoang-Huy Nguyen1,2 , and Thi-Hiep Nguyen1,2(B) 1 School of Biomedical Engineering, International University, Ho Chi Minh City

(HCMC) 700000, Vietnam [email protected] 2 Vietnam National University, HCMC 700000, Vietnam

Abstract. Cardiovascular diseases (CDs) are among the leading causes of death, especially in areas with limited medical resources. Due to the increasing prevalence of CDs and obesity, both of which cause blood vessel damage, there is a high demand for the use of artificial blood vessels (ABV) as an alternative treatment. A system that simulates human blood circulation is required to assess the functional performance of these vessels. Reportedly, synthetic polymers used to create artificial blood vessels have several drawbacks. In this study, we used an electrospinning technique to create an ABV from polycaprolactone (PCL), a versatile biopolymer widely used in tissue engineering (TE) applications and investigated the effects of three circulatory systems factors on these vessels using a bioreactor: temperature, flow rate, and pressure. To assess its mechanical properties, we mimicked cardiac biodynamic behavior using an Arduino Mega 2560, heat beds, peristaltic pump, temperature flow, and pressure sensor, creating a closed loop of displaying parameters and adjusting hydrodynamic performance, temperature, and flow rate. The results showed that this system accurately demonstrated the biodynamic features of the heart, making it a crucial tool for basic research and a cutting-edge model for advanced modifications. Keywords: Bioreactor · Artificial Vascular Graft · Physiological Parameters Sensors · Electrospinning · Tissue Engineering

1 Introduction 1.1 Literature Review Vascular substitutes in TE are becoming increasingly important due to the incidence of cardiovascular disease (CVD), which is one of the leading causes of death worldwide [1]. In 1949, Kunlin first used a saphenous vein for femoropopliteal bypass surgery [2, 3]. After that, autologous vessel grafts were considered the gold standard surgical treatment of diseased small-diameter vessels. Allograft and xenograft vessels prepared by cryopreservation or decellularization to reduce immunogenicity have been used as an © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. T. Vo et al. (Eds.): BME 2022, IFMPE Proceedings 95, pp. 172–189, 2024. https://doi.org/10.1007/978-3-031-44630-6_14

Design and Evaluation of Simple Artificial Vascular Graft

173

alternative to autologous vessels, but they typically have lower patency. Increased thrombogenicity, host immune response, and increased calcification have all been implicated in this. Since the 1950s, synthetic grafts made of polyethylene terephthalate (Dacron® and Teflon®) and expanded polytetrafluoroethylene (ePTFE) have been used in clinical procedures to replace medium-to-large-diameter vessels. However, due to rapid occlusion and acute thrombogenicity, these synthetic grafts are more likely to fail in vessels with a diameter of less than 6 mm [4, 5]. Vascular TE strives to create artificial vascular grafts in response to the urgent clinical demand for small-caliber vascular grafts that are less prone to thrombotic occlusion than synthetic vascular grafts and can accommodate juvenile patients’ somatic growth. However, the poor performance of synthetic polymer vascular grafts in small-diameter vascular replacement applications necessitates the new development of new biomaterials with improved patency [6]. PCL has many versatile properties, including biocompatibility, biodegradability, and nontoxicity [7]. Thanks to its native biocompatibility and biodegradability, PCL has been extensively studied for cardiovascular tissue engineering (vascular grafts, stents, materials, and valves used in cardiac surgeries made up of PCL), bone tissue engineering, cartilage tissue engineering, osteochondral tissue engineering, skin tissue engineering, nerve tissue engineering, etc. [7]. Despite PCL’s strengths as a biomaterial, issues with tissue engineering still need to be addressed and resolved. A tissue engineering scaffold made only of PCL has a sluggish rate of disintegration, little cell attachment, and mismatched mechanical characteristics. Other materials blended with PCL are remediation to overcome those drawbacks. Regarding mechanical properties, burst pressure is more clinically relevant than other physical and mechanical parameters because it better describes a surgeon’s urgent concerns about novel graft material. Thus, this study aimed to develop a bioreactor system that could simulate human body conditions and investigate the mechanical properties of artificial vascular grafts. 1.2 General Description of the Device The bioreactor system consists of a medium reservoir with a heater and a pump controlled by Arduino. The monitoring system displays temperature, flow, and pressure sensor data and interacts directly with the pump and heater, as shown in Fig. 1. Initially, we will heat the fluid container to the set temperature and then wait till the container reaches the stable point. Throughout the operation, the temperature sensor cannulated inside will monitor the temperature. Following that, we fill up the pipeline with high flow-rate fluid to eliminate bubble which causes noise to the flow sensor. For the bubble removal, we adjusted the flow rate and applied pressure to simulate heart biodynamic behavior through flow and pressure sensors. Following that, we cannulate vascular graft in a test vessel chamber designed to collect leak fluid owing to failure. Signals from temperature, flow, and pressure sensors will be feedback-and-control by the controller for communication with other components. Finally, data will be displayed and controlled through a user interface to alternate system performance. The red arrow indicates the fluid flow in a loop where it will be transmitted from the container by the peristaltic pump to the vessel chamber under the administration of sensors and back to the start.

174

A.-T. Huynh et al.

Fig. 1. Working principle of the bioreactor.

2 Design 2.1 Materials The primary factors for device evaluation are the heating system and hydrodynamic operation simulating heart biodynamic behavior. Primarily, it contains a heating system and peristaltic pump for the simulation and administration of sensors. The hydrodynamic simulation can adjust based on temperature, flow, and pressure parameters to research whether those factors affect graft durability, LCD sets, and real-time data for each factor. The control system adjusts the pump and heating system via the driver and H-bridge concerning user references (Fig. 2).

Fig. 2. Processing block diagram of the bioreactor.

Design and Evaluation of Simple Artificial Vascular Graft

175

Arduino Mega 256: Because our device requires many types of sensors with different communication and other modules such as motors and drivers. Arduino platform is optimal for its vast libraries to reduce firmware development period instead of AVR, ARM, etc. Arduino Mega 256 was applied to fulfill bioreactor requirements for its 5 interrupts to work as capture flags for flow sensors and buttons, while Arduino UNO and nano only have 2 interrupts. Furthermore, 54 digital inputs with 14 PWM channels for sensor communication and motors control allow for more improvements in designing firmware. Temperature Sensor: PT100 is an analog sensor with 2 resistors and has a high accuracy value of ±0.2 °C, which is on top priority for our design. Because the purpose of the bioreactor system purpose is to become a measuring device for our laboratory. Moreover, the SPI communication module already has a filter function, stabilizing the signal. Therefore, RTD sensors provide a high TCR (Temperature coefficient of resistance) which is 0.385 /°C. Flow Sensor: Because the biodynamic simulation whose flow value fluctuates between 0–200 ml/m of our device requires a small range of flow rate. Therefore, we must use a TAB32 flow sensor with a flow measurement range down to 0.033–2 l/m to monitor. This Hall-effect invasion nozzle can capture a signal with ±6% and the operating temperature to −10 to 65 °C sustaining the heating system in the bioreactor system. Pressure Sensor: The priority in our design for pressure sensors is water-proofing and the sensor’s accuracy. In this case, the Analog pressure sensor high-level analog output signal provides a 2.5% maximum error over 0 to +85 °C provides accuracy. The waterproof layer with pressure ranges from 0 to 50 kPa makes it ideal for simulated invasive blood pressure (200 mmHg limit) measurement. Driver Modules: IBT-2 H-bridge high current 43A motor driver is suitable for heating system applications. It is an optimized tool for high-current PWM control. TB6600 driver has an output peak current of 4.5 A and is used for driving 2-phase and 4-phase hybrid stepper motors such as NEMA 23.

2.2 Mechanical Design The design shown in Fig. 3 consists of an electrical case with a controlling system, driver, and H-bridge. At the same time, the second part is a bioreactor system on top of the case, whose purposes are simulating and alternating cardiac hydrodynamic characteristics for research purposes. The prototype was primarily made of acrylic plastic because it could be designed and machined into complex parts with high precision. These acrylic parts can be assembled with nuts and bolts to make a device; thus, it was a convenient and cost-effective building material to determine the possibility of the project. The heating system contains a Duran bottle taken from the laboratory and a metal heating plate to achieve desired conditions. After a few test runs, the temperature in the vascular chamber ranges from 36–42 °C, with 8-speed set points and manual pressure adjustment. Compared to existing bioreactor systems, the prototype offers a more reasonable price. The ultimate goal of simulating

176

A.-T. Huynh et al.

Fig. 3. Mechanical 3D design and detailed blueprints of the system.

heart biodynamic behavior and modifying parameters to study the mechanical properties of vascular grafts was achieved. Additionally, its small size makes transportation work simple. The prototype, however, has a few flaws, including temperature loss on the transmitting line and the risk of fluid invasion on the electrical circuit. Bioreactor System with an Incubator. The prototype has certain flaws in terms of temperature maintenance due to the location of the temperature sensor on the Duran chemical bottle and environmental exposure. The temperature sensor is mounted on top of the bottle’s cap, where the fluid is heated. When the fluid starts to circulate, the volume in the bottle decreases, preventing the solution from reaching the sensor, and the exposure to the laboratory environment acts as a radiator for the system. Consequently, temperature control becomes more challenging and unstable. As a result, the improved mechanism must design an incubator that acts as an isolated system to address temperature issues and potential electrical circuit risks [8]. The MKII heater for the 3D printer and DS18B20 temperature sensor is utilized to control the incubator’s temperature, which was originally from another device and available components, thanks to the advice of laboratory technicians. A custom incubator system creates a haven apart from laboratory environment exposure. The temperature of the liquid and the speed with which it is handled can be controlled via a machine interface. The computer-aided design software SolidWorks was used to miniature bioreactor model geometry. Workshop components made of acrylic plastic and aluminum extrusion were created and carefully adjusted (Fig. 4). In this design, an incubator is chosen to reduce environmental factors because the temperature sensor is larger than the pipeline, which would affect solution flow and pressure. Furthermore, it would be more complicated for the maintenance and water-proofing process because there must not be any leakages on the pipeline and corrosive damage on the temperature sensor. Calculations of flow velocity were used to mathematically define the human cardiac flow and determine the shear stress that occurred. Sensors, heat beds, pumps, and other model components have meshed in bioreactor fluid geometry for this purpose. The aluminum extrusion frame was built using space calculating and component placements (Fig. 5). The working principle is mainly the same as the prototype; however, there are some improvements in the mechanism and circuit to improve the performance. Firstly, the

Design and Evaluation of Simple Artificial Vascular Graft

177

Fig. 4. 3D view and detailed blueprints of bioreactor incubator system.

Fig. 5. 3D view and detailed blueprints of the incubator scaffold.

system is tempered at 37 °C to reduce heat loss in laboratory working conditions, and the heater is placed on the bottom to ensure constant air circulation. Secondly, I submerge the temperature sensor into a solution of a medium chamber for permanent contact with liquid. Finally, there are improvements in mechanism for convenient experiment preparation such as Luer fitting, custom-sized three-way connector, and high-pressure valve [9] (Fig. 6). Hardware Development. Power supply block. The system requires +3.3 V, and +5 V; the main power supply is taken from a DC power source +12 V and needs to be converted to lower voltage to perform the microprocessors and the rest of the components on board. However,

178

A.-T. Huynh et al.

Fig. 6. 3D view and detailed blueprints of the bioreactor system construction.

the electrical design or components flaw has produced a +5 V current with noises. Consequently, I must use a foreign XL4015 circuit as a substitute and lower further through the AMS1117-3.3V regulator (Fig. 7).

Fig. 7. Power supply circuit.

Sensors Block. Because we use high-voltage power supply lines for circuit boards, we must apply a sensor remove noise system was applied, which is designed to help seniors carry out clean signals and remove ripples and stabilize signals for sensors. I designed the filter circuit based on the frequency of noises, ranging from 45–55 Hz, captured by laboratory oscilloscopes. The temperature and flow sensor has a pull-up resistor to avoid noise or missed signals caused by under-voltage from sensors. Additionally, there is a second-order bandpass filter using op-amp LM358 to clear out high-frequency signals formed by high-voltage lines. The MAX31865 temperature sensor already has its filter circuit on the signal converter module (Fig. 8). The control of heat beds and the peristaltic pump is based on Arduino Mega 2560, Arduino platform has more time in programming and constructing systems thanks to available diverse libraries. Timer 1 is used for PWM generating and activating the state

Design and Evaluation of Simple Artificial Vascular Graft

179

Fig. 8. Sensor circuit.

machine while interrupting events are captured by activating debounce timer library (Fig. 9).

Fig. 9. Processing and controlling unit schematic.

The system requires +3 V, +5 V, and +12 V DC power, which are supplied from a DC power source +12 V through a voltage converter to lower voltage for the microprocessor, sensors, and other components of the on-circuit. To achieve this, the separated DC-DC converter is adapted to lower +12 V to +5 V and reduce electromagnetic noise of high voltage. It then goes through the AMS1117 −3.3 V regulator to convert into +3.3 V. The design of stepper motors and heat bed control systems based on the Arduino platform. The Arduino Mega 2560, which came with libraries, made it possible to create simple and easy-to-understand algorithms.

180

A.-T. Huynh et al.

2.3 Firmware Development Program Design. Firstly, the processor will identify sensors, set up a timer and interrupt to prepare for the operation, and configure other values via the interface for monitor and control. Secondly, the system operates feedback loop control where Arduino Mega 2560 records the temperature data from the PT100 sensor, flow sensor TAB32-S21PO18C-11R and pressure sensor MS5803-14BA (Fig. 10). Thirdly, algorithms calculate the offset value of PT100 and DS18B20 reading and change the duty cycle of pulse width modulation (PWM) output to IBT-2 H-bridge. These pulses are described by the ratio in percentage between the active and inactive time of the signal in the period, which is called the “duty cycle” (Fig. 11).

Fig. 10. Program flow chart.

For the state machine, there is a timer interrupt that periodically triggers a flag to record data, calculate the error, and generate pulses whose purpose is to run simultaneously with the main program. Triggering buttons will change the set-speed point of the peristaltic pump to control its velocity by changing the frequency of PWM for stepper motor driver TB6600 (Fig. 12) and the screen LCD. The end performance should be simple and easy to monitor so that users may record the experiment’s data. Operating with fluid, it should take a diligent attitude for researchers to conduct experiments to avoid damaging equipment. Cautious compliance with the following instruction is highly recommended, including pouring solution into the medium container, turning on the bioreactor and waiting until it reaches ideal conditions (It is necessary to wait for a while for the system temperature to reach its sustainability), and setting

Design and Evaluation of Simple Artificial Vascular Graft

181

Fig. 11. PWM duty cycle.

Fig. 12. PWM frequency.

up vascular graft after filling whole system pipeline with a solution. (The experiment must be conducted carefully for the system performance for electrical safety reasons). Evaluation. A Mercury thermistor is used to evaluate the temperature validation of the PT100 sensor. For flow validation, 2 beakers 500 ml are used to measure the fluid transmitted in 1 min at each speed point and compare with pulses counted by the Hall-effect flow sensor to calibrate. Regarding pressure validation, a manometer is used to calibrate our pressure sensor and reduce errors. Temperature test. The whole comparison process took 30 min for the heating system to reach the goal temperature, and this was repeated 3 times (the minimum required trials to analyze statistical results) to determine the error bar. During this process, there was a difference between real-time and measured temperature values caused by lowerheat pipeline transmission. The chart below shows the mean values of calibrated results after applying formulas compared to the standard values of the mercury thermometer (Fig. 13). The error bar indicated that the fluctuation of the sensor value is less than 1 °C from the thermometer value. Flow Test. Using the calculating approach, the accuracy of the solution flow was verified. The goal of this experiment was to validate the approximate flow rate of each of the peristaltic pump’s speed degrees. The actual and display volume was recorded after

182

A.-T. Huynh et al.

Fig. 13. Real and sensor temperature comparison with error bar after calibration.

pumping water 3 times after 1 min. The below chart shows the calibrated volume captured by the flow sensor concerning the actual volume pumped with an increasing flow rate (Fig. 14).

Fig. 14. Real and sensor flow comparison with error bar after calibration.

After taking the statistical approach, the error percentage between the electrical pulse volume and the real volume after taking statistics is less than 5%, which is insignificantly different (Fig. 15). The error is a missing pulse caused by the presence of bubbles in the pipeline, which makes the flow sensor unable to capture signals.

Design and Evaluation of Simple Artificial Vascular Graft

183

Fig. 15. Error percentage inflow of each speed degree.

Pressure Test. A gas blood pressure manometer was used to calibrate the pressure accuracy by applying force to specified pressure points and comparing the value of the manometer and pressure sensor value. In detail, this process was also repeated 3 times to calculate the mean value and error bar. This conduction was carried out to make a graph of pressure sensor values and calibrate them back to accurate values through a mathematical application. The figure below shows the formula used to correct the pressure sensor values in a tangent line (Fig. 16).

Fig. 16. Pressure calibration formula.

The calibrated result is also recorded three times to calculate the mean value and error for comparison. The below chart indicates the difference between the calibrated pressure value and manometer values is not greater than 1 mmHg (Fig. 17). The error was caused by the nanometer manual calibration and mechanical pressure clock.

184

A.-T. Huynh et al.

Fig. 17. Real and sensor pressure comparison with error bar after calibration.

3 Results and Discussion 3.1 Final Product The final system has fulfilled the initial requirements of the project, including simulation and alternation of heart biodynamic behavior based on temperature, flow, and pressure factors for evaluation of vascular graft mechanical properties (Table 1). The improved bioreactor incubator also resolves heat unstableness and reduces fluid exposure risk to electrical circuits. Table 1. Design achievements Specifications

Requirements

Achievements

Temperature

36–42 °C degree

36–42 °C degree

Flow

60–200 ml/min

58–477 ml/min (±5 ml/min)

Pressure

80–120 mmHg

0–200 mmHg

The temperature fluctuation between the solution container and vascular chamber has drastically decreased after the improved mechanism. The thermometer temperature is monitored at various speeds, and it is observed that the temperature tends to remain slightly lower at the end of the vascular chamber during the operation. The figures below show 2 formulas applied in the temperature calibration process of the prototype and new system (Fig. 18). It is observable that the temperature values of the sensor have approached closer to thermometer values.

Design and Evaluation of Simple Artificial Vascular Graft

185

Fig. 18. Temperature calibration formula of prototype and new model.

Because of the presence of bubbles in the pipeline interfering flow sensor, the Halleffect sensor is unable to detect pulses hindering the appearance of holes. Consequently, we initially ran the system with the highest speed for eliminating bubbles to calibrate or research. Furthermore, the new analog pressure sensor is more high-end than the old I2C pressure sensor due to generating a cleaner signal. From the pressure graph, the MS5803-01BA sensor has many low-pressure ripples, while the MP3V5050 sensor produces smoother sinuous waves (Fig. 19). Because the SPI communication sensor is easily affected by noise, in contrast, the analog sensor provides more accurate signals due to simple signal transmission. Finally, the pressure wave of the system has shown preliminary dynamic behavior of the heart pressure wave by gradually increasing the pressure through a plastic tube, with pressure values oscillating between 80–120 mmHg and 76–84 bpm, representing healthy adult blood pressure. 3.2 Experiments on Bioreactor Incubator System Results Using a biodynamic bioreactor incubator system, the burst pressure for the PCL tube was determined by raising liquid, which was sodium chloride in this experiment, pressure

186

A.-T. Huynh et al.

Fig. 19. Pressure graph of MS5803-01BA and MP3V5050 sensor.

till failure under dynamic cyclic simulated vessel loading. The pressure was increased, and the pressure at which the rupture occurred was taken as burst pressure [10]. The 1st PCL vascular sample has slightly higher burst pressure than the 2nd sample (n means that these burst pressure values can vary, even though they were created from identical solutions) (Fig. 20). As a result, it is critical to establish a standard for future vascular substitute research that can be relied on.

Fig. 20. Burst pressure records of PCL vascular graft.

Design and Evaluation of Simple Artificial Vascular Graft

187

3.3 Performance Discussion The final device generates a wide range of hydrodynamic conditions to examine material potential by modifying settings to simulate the biodynamic behavior of cardiac parameters based on temperature, flow, and pressure. The pressure value was slowly increased through a high-pressure vat till 120/80 mmHg. T-way connector transferred air pressure to the sensor and peristaltic pump dynamics Alloa wed profile comparable to physiological pressure regarding frequencies and shape (Fig. 21). The sinuous pressure wave results from a peristaltic pump whose rollers compress the tube to force the fluid transmitted to provide a pulsation-free flow rate.

Fig. 21. Pressure wave graph of bioreactor incubator system (right) and normal arteria (left).

Characterization of a custom-made bioreactor incubator system facilitated a broad relative pressure range of up to 200 mmHg; frequencies can be changed by adjusting the pump speed with different ejections from 55 to 480 ml per min. The figure below shows there is a higher flow rate, and the same pressure cause higher pulsation frequency. The system generates 76–84 bpm at a 115 ml/min flow rate and applied pressure of 120/80 mmHg. On the other hand, it generated over 120 bpm at a higher flow rate with the same pressure (Fig. 22). 3.4 Beneficial Features The bioreactor incubator system accurately demonstrated the biodynamic features of the heart. The temperature system controller successfully responded to the sensor with a ±1 °C error. The burst pressure measurement test was used to evaluate the mechanical qualities of vascular graft samples by gradually increasing pressure until failure. The finished product has largely met all TE requirements, while the price has been reduced by removing complex features, primarily for tissue maturation. Although the measurement was performed to prevent fluid from entering the electrical circuit, the user must exercise extreme caution when experimenting. Instead of flexible control algorithms, the implication method of controlling temperature is to use an H-bridge to change the duty cycle of PWM. In the future, the temperature control software can be modified by collecting temperature data statistics and using PID controllers independently for incubator and bioreactor systems, as well as calculating the flexible flow of solution rather than the fixed speed set points. The hardware can be

188

A.-T. Huynh et al.

Fig. 22. Vascular pressure at different speeds in 5 s.

optimized by replacing the advanced controlling unit with an Arduino and the exterior frame with acrylic plastic and aluminum extrusion instead of acrylic plastic and aluminum extrusion. For additional investigation, it is suggested that other fluids with different properties, such as viscosity, be used instead of sodium chloride for a more effective assessment. Furthermore, it is possible to investigate whether temperature and flow affect graft durability by changing device performance [11].

4 Conclusion This study aimed at creating a bioreactor platform that could imitate the biodynamics of the heart and be used to test the mechanical properties of vascular grafts. The system’s usability and performance were demonstrated by the successful implementation of conducting burst pressure measurements of PCL vascular grafts. Furthermore, characteristics such as adjustable parameters and ease of handling ensure that our research into the behavior of vascular graft material progresses. As a result, the bioreactor incubator device is both a valuable instrument for fundamental research and a cutting-edge model for advanced modifications. The technology is expected to become a standard for future vascular graft substitute research. Conflicts of Interest. This paper is not conflicted with any other contributions of the authors mentioned.

References 1. Seifu, D., Purnama, A., Mequanint, K., et al.: Small-diameter vascular tissue engineering. Nat. Rev. Cardiol. 10, 410–421 (2013) 2. Menzoian, J.O., Koshar, A.L., Rodrigues, N.: Alexis Carrel, Rene Leriche, Jean Kunlin, and the history of bypass surgery. J. Vasc. Surg. 54, 571–574 (2011)

Design and Evaluation of Simple Artificial Vascular Graft

189

3. Testart, J.: Jean Kunlin (1904–1991). Ann. Vasc. Surg. 9(Suppl.), S1–S6 (1995) 4. Abbott, W.M., et al.: Evaluation and performance standards for arterial prostheses. J. Vasc. Surg. 21, 746–756 (1993) 5. Bennion, R.S., et al.: Patency of autogenous saphenous vein versus polytetrafluoroethylene grafts in femoropopliteal bypass for advanced ischemia of the extremity. Surg. Gynecol. Obstet. 160, 239–242 (1985) 6. Desmet, W., et al.: Isolated single coronary artery: a review of 50,000 consecutive coronary angiographies. Eur. Heart J. 13, 1637–1640 (1992) 7. Malikmammadov, E., Tanir, T.E., Kiziltay, A., Hasirci, V., Hasirci, N.: PCL and PCL-based materials in biomedical applications. J. Biomater. Sci. Polym. Ed. 1–55 (2017) 8. Schwedhelm, I., et al.: Automated real-time monitoring of human pluripotent stem cell aggregation in stirred tank reactors. Sci. Rep. 9(1), 1–12 (2019) 9. Chavez, R.D., Walls, S.L., Cardinal, K.O.: Tissue-engineered blood vessel mimics in complex geometries for intravascular device testing. PLoS One 14(6), e0217709 (2019) 10. Aussel, A., et al.: In vitro mechanical property evaluation of chitosan-based hydrogels intended for vascular graft development. J. Cardiovasc. Transl. Res. 10(5–6), 480–488 (2017) 11. Tondreau, M.Y., et al.: Mechanical properties of endothelialized fibroblast-derived vascular scaffolds stimulated in a bioreactor. Acta Biomater. 18, 176–185 (2015)

Enhancing Stability of in Situ Crosslinked Hydrogel N,O-Carboxymethyl Chitosan – Aldehyde Hyaluronate by Supplementing Ionic Crosslinking of Alginate and Calcium Ions Tuan-Ngan Tang1,2 , Quynh Duong-Tu Nguyen1,2 , Thao-Nhi Dang-Ngoc1,2 , and Thi-Hiep Nguyen1,2(B) 1 School of Biomedical Engineering, International University, Ho Chi Minh City 700000,

Vietnam [email protected] 2 Viet Nam National University, Ho Chi Minh City 700000, Vietnam

Abstract. Hydrogels based on Schiff’s base reaction of N,O-carboxymethyl chitosan (NOCC) and aldehyde hyaluronate (AHy) have been applied widely in several biomedical fields such as drug delivery, post-operative anti-adhesion, tissue regeneration, etc. However, their low mechanical strength and rapid degradation limit their use in longer-duration applications. This study aimed to investigate the effects of supplementing another biopolymer, alginate (Alg), to enhance the hydrogel crosslink network via ionic crosslinking with Ca2+ ions from calcium chloride (CaCl2 ). The hydrogel samples were characterised by their crossectional morphology, FTIR spectra, porosity, compression modulus, and swelling–degradation behaviours. Cytotoxicity and cell viability were also evaluated. The results revealed that this simple approach successfully improved the mechanical strength and stability of the hydrogel while conserving the in vitro biocompatibility. This suggested expanded potential biomedical applications of the hydrogels. Keywords: Naturally Derived Polymer · N,O-Carboxymethyl Chitosan · Aldehyde Hyaluronate · Alginate · Multiple-Crosslinked Hydrogel · In Situ Crosslinked Hydrogel

1 Introduction Hydrogels are materials made of polymer molecules that can crosslink into networks and retain water to form a semi-solid state [1]. These unique substances have been applied widely in numerous biomedical fields, including tissue engineering. Based on the source of the constituent polymers, hydrogels can be divided into natural, synthetic, or mixed-sourced polymers. The polymer origin is the factor deciding many key properties of the hydrogel. Synthetic hydrogels have been developed and preferred due to their easily controllable © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. T. Vo et al. (Eds.): BME 2022, IFMPE Proceedings 95, pp. 190–205, 2024. https://doi.org/10.1007/978-3-031-44630-6_15

Enhancing Stability of in Situ Crosslinked Hydrogel

191

mechanical strength, stability and batch-to-batch homogeneity. However, up to date, natural hydrogels cannot be replaced completely by synthetic ones thanks to their irreplaceable biological properties. Since natural polymers (biopolymers) are obtained from living organisms, they themself are necessary bio-components or have a similar molecular structure to some substances of the human body. As a result, most bio-sourced hydrogels are degradable, non-toxic, and highly biocompatible, especially polysaccharide-derived ones have a lower risk of inflammatory and foreign body reactions compared to synthetic hydrogels [2]. Some well-known naturally derived polymers that have been utilised extensively in fabricating hydrogels include but are not limited to chitosan, hyaluronate, and alginate. Chitosan (CS) is the deacetylated derivative of chitin, which is the second most common natural origin polysaccharide and occurs in fungal cells and arthropodal exoskeletons. Its linear chain is constructed of the deacetylated monomer D-glucosamine and acetylated one N-acetyl-D-glucosamine, organised randomly [3]. In addition to biocompatibility, and degradability, thanks to its deacetylated unit, CS is aqueously soluble and can perform antimicrobial and haemostatic effects. Thus, CS-based hydrogels have been employed in tissue engineering of various tissue types such as skin, cartilage, bone, periodontal tissue, etc. [4]. However, the solubility only in the acidic solution and poor bioactivities of chitosan limit its application in the raw form without combination with other substances [5]. In contrast, hyaluronate (Hya) (also known as hyaluronic acid or hyaluronan) is one of the most abundant glycosaminoglycans and is present in the extracellular matrix (ECM) of almost all kinds of animal connective tissue. Its constructive unit is the disaccharide of D-glucuronate and N-acetyl-D-glucosamine. Hya contributes to a diversity of vital biofunctions, such as cell proliferation and migration, tissue healing, water retention, shock absorption (in articular cartilage tissue), etc. Therefore, having Hya as a component in hydrogel would significantly enhance the biocompatibility and bioactivities of the system. On the other hand, Hya is fastly degraded, and poor in mechanical strength, limiting its application in cases where long-term stability is required [6]. Combining CS and Hya can help take advantage of the strengths and improve the weaknesses of each component. One of the popular approaches to the combination is modifying CS into N,O-carboxymethyl chitosan (NOCC) to increase hydrophilicity in physiological pH, and oxidising Hya into aldehyde hyaluronate (AHy). When blended in the aqueous solution, these two derivatives can gel themselves due to the ability to selfcrosslink between amino groups of NOCC and aldehyde groups of AHy via Schiff’s base reaction [7]. This integration method proposed a potential hydrogel system with many advantages. It is non-toxic owing to no use of crosslinkers, biocompatible, hydrophilic, swellable, absorbable, degradable, and able to promote wound healing [7, 8]. However, its fast degradation rate, only around a week [8], disables the long-term applications for tissue engineering, suggesting the need for supplementary components to stabilise and prolong this hydrogel system. One plausible strategy is to add another polymer that can interact with and strengthen the crosslinking network. Alginate (Alg) has been chosen in one previous work [9]. Alg, obtained from brown algae and bacteria, is a group of anionic polysaccharides consisting of alternate polymeric blocks of D-mannuronate (M) and α-L-guluronate (L). Different

192

T.-N. Tang et al.

ratios of M and L blocks determine the physicochemical characteristics of Alg [10]. Algs are well known for their ease of gelation thanks to the configurational change of G blocks when their carboxyl groups chelate with specific divalent or trivalent cations such as Ca2+ , Ba2+ , Cu2+ , La3+ , etc. Amongst the above-mentioned cations, Ca2+ is employed the most since Alg-Ca2+ -based hydrogels are non-toxic [11]. Because Alg is an anionic polymer, its residues can interact electrostatically with cationic CS or NOCC. Furthermore, the presence of CS and HA can improve the poor ability of Alg to support cell adhesion, which is attributable to lacking cellularly interactive motifs [12]. Several experimental results from Le et al.’s study indicated Alg addition conserved the strong points of the original two-component NOCC-AHy system but also prolonged the gel state during immersion in the aqueous solution [9]. Nonetheless, in this hydrogel design, additive Alg merely interacted with NOCC via electrostatic force [9], which is considered weak and of low density in the neutral milieu owing to lacking protonated amino groups of NOCC to interact with carboxylate groups of Alg [13]. Moreover, the potential of establishing the secondary crosslinking network of Alg by introducing Ca2+ ions has not been exploited. Therefore, in the present study, we aimed to further develop the natural derivativebased hydrogel consisting of NOCC, AHy, and Alg to extend its application potential for biomedical fields requiring long duration, such as tissue engineering. Our work also tried to deploy materials obtained from low-cost sources from Vietnam and Asia to develop biomedical products economically with locally available resources. In detail, the primary crosslinking network for gelation was formed by Schiff’s base reaction between NOCC and AHy, with the electrostatic enhancement of Alg. Then, reinforcement of the primary hydrogel was conducted by immersing it in the calcium chloride (CaCl2 ) solution to induce ionic crosslinking of Alg. The dual-crosslink hydrogel was expected to possess improved qualities involving mechanical strength and slower degradation but still be non-toxic and biocompatible.

2 Materials and Methods 2.1 Materials Chitosan (CTO-MV02, derived from shrimp shell, ≥80% deacetylated) was purchased from Vietnam Food Joint Stock Company. Hyaluronic acid, sodium salt and sodium alginate were purchased in Vietnam. Chloroacetic acid was purchased from HiMedia Laboratories Pvt. Ltd. (India). Sodium hydroxide (NaOH) and hydrochloric acid (HCl) were purchased from Xilong Chemical Ltd. (China). Isopropyl alcohol was purchased from Guangdong Guanghua Sci-Tech Co., Ltd. (China). Ethylene glycol was purchased from China. Sodium meta periodate (≥99%) (NaIO4) was purchased from Thermo Fisher Scientific Inc. (UK). Dialysis tubing cellulose membrane (D9652, MWCO: 12– 14 kDa) and phosphate-buffered saline (P4417) (PBS) were purchased from SigmaAldrick Co. (USA).

Enhancing Stability of in Situ Crosslinked Hydrogel

193

2.2 Hydrogel Preparation NOCC Synthesis NOCC was synthesized from CS according to the previous study with some modifications [8] to be suitable for the Vietnam-obtained CS. Firstly, a suspension of 1 g of chitosan in 5 ml of isopropanol was made and was then alkalised by adding 5 ml of NaOH 62.5% (w/v) and stirring for an hour at room temperature. Subsequently, 1 ml of isopropanol containing chloroacetic acid 62.5% (w/v) was added dropmeal to the mixture at 60 °C, which was quadruplicated 5 min apart. The mixture was kept at 60 °C and stirred manually every 15 min to promote the carboxymethylation reaction. After 3 h, the residual solid sample was obtained by filtration, before being dissolved in 33 ml of distilled water for neutralisation with HCl 2.5 M. The neutralised solution was then filled in the dialysis bag (MWCO of 3 kDa), which was immersed in distilled water of 10-time larger volume. During the 3-day duration of dialysis, water was changed every 8 h. Finally, after being frozen for 8 h, the sample was lyophilised in the Freezone 6L Benchtop Freeze Dry System (Labcono, USA) for 36 h. The final product was preserved at 2–8 °C. AHy Synthesis AHy was synthesised based on our previous studies [8, 9], choosing the oxidation degree of 40%. In detail, 0.21 g of sodium metaperiodate (NaIO4 ) (40% molar equivalent of AHy dimers) was dissolved in 100 ml of Hya 1% (w/v) in distilled water. The solution was stirred magnetically at room temperature in the absence of light for 2 h to promote oxidation of Hya. Then, the solution was introduced with 0.4 ml of ethylene glycol (EG) and stirred for 1 h to induce the reaction between EG residual NaIO4 . Subsequently, the sample was filled in the dialysis bag (MWCO of 3 kDa), which was immersed in distilled water of 10-time larger volume. During the 3-day duration of dialysis, water was changed every 8 h. The dialysed solution was neutralised with NaOH 1M, before being frozen for 8 h and then lyophilised for 36 h. The final product was preserved at 2–8 °C. NOCC-AHy-Alg-Ca Hydrogel Preparation The procedure of preparing NOCC-AHy-Alg (NAA) hydrogel was similar to the previous work [9] with some simplification. First, the solutions of AHy 3% (w/v) and Alg 4% (w/v) were made and then mixed as the volume ratio 1:1 to make a homogeneous solution (AA). The initially crosslinked hydrogel was prepared by mixing NOCC 3% with AA at different ratios: 3:7, 4:6, 5:5, 6:4, and 7:3 (namely N3A7, N4A6, N5A5, N6A4, and N7A3, respectively). After gelling well-shaped, the preliminary hydrogels were immersed in CaCl2 0.1 M for 30 min (the concentration and time were referenced from the previous work [14]).

194

T.-N. Tang et al.

2.3 Characterisation Surface Morphology The cross-sectional surface morphology of the lyophilised hydrogels was observed under scanning electron microscopy (SEM) JSM-IT100 microscope (JEOL, Japan) at 10 to 15 kV. The sizes of the crossectional pores were determined by their maximum diameter, measured by ImageJ software. Fourier-Transform Infrared Spectroscopy (FTIR) FT-IR technique was utilized to research the crosslinking in the NOCC/AHy/Alg/Ca2+ system. The FT-IR spectra of NOCC, AHy, Alg were also recorded. All samples were frozen overnight and freezedried for at least 8 h to become hydrogel scaffolds before being performed by FT-IR spectrometer (Thermo Scientific Nicolet™ 6700) in the 400–4000 cm−1 wavelength range. Compressive Strength Cylindrical hydrogel samples were prepared and placed on a flat surface. The flat plate of the TA.XTPlus Texture Analyser (Stable micro system, UK) was lowered onto the sample to apply the compression stress and record the deformation extent of the sample. In vitro Swelling and Degradation Behaviours The weight change of hydrogel was evaluated under PBS solution (1×, pH = 7.4) at 37 °C. Briefly, newly-prepared hydrogel samples were weighed (W 0 ) before immersing in PBS. Then, the weight was measured at several time points until they degraded completely. The PBS medium was changed every weight time. The hydrogel samples were replicated in triplicate. The weight remaining percentage (W d , %) at each time point was calculated using the following equation: Wd (%) =

Wt × 100% W0

(1)

The results were expressed as the mean ± standard deviation. In vitro cellular experiments Cytotoxicity The cytotoxicity test was performed as the direct contact method according to ISO 10993-5:2009 [15]. Initially, L929 fibroblast cells were seeded into a 96-well plate at a density of 104 per well. After 24 h of incubation, sterilized hydrogel scaffolds in a cylinder shape with 6 mm in diameter and 1 mm in thickness were placed into the cultured wells and incubated for another 24 h. Then, the scaffolds and old media were removed and replaced by 100 μL Resazurin 0.02 mg/mL solution in DMEM. After 4-h incubation, the fluorescent signal was measured at excitation wavelength 530 nm and emission wavelength 590 nm by Varioskan™ Multiplate Reader. Live/dead Assay The procedure of culturing cells and applying hydrogels to them was similar to the cytotoxicity test. Initially, L929 fibroblast cells were seeded into a 96-well plate at a density of 104 per well. After 24 h of incubation, sterilized hydrogel scaffolds in a cylinder shape with 6 mm in diameter and 1 mm in thickness were placed into the cultured wells and incubated for another 24 h. The culture medium was then removed,

Enhancing Stability of in Situ Crosslinked Hydrogel

195

and the wells were washed carefully with PBS twice. Next, each well was added with 30 μl of working solution (FDA/PI) and incubated for 5 min. Finally, after being washed with PBS, live and dead cells in hydrogels are observed via the inverted light microscope (Nikon, Japan). 2.4 Statistical Analysis All experiments were replicated in triplicate or quadruple. Statistics were analyzed by OriginPro 2022 software. The Student’s t-test and one-way ANOVA test were applied to compare two and multiple groups, respectively. The significant level was set at p < 0.05.

3 Results and Discussion 3.1 Hydrogel Formation The combination of the three components NOCC, AHy, and Alg for hydrogel design was successful in our previous work, using high-quality chemicals purchased from SigmaAldrich [9]. In the present study, we aimed to make use of locally available low materials. Due to material source changes, several chemical properties of the studied biopolymers were varied, including polymer molecular weights, deacetylation degree of NOCC, M/G ratio of Alg, etc. This led to several modifications in the protocols of synthesising hydrogel precursors (NOCC and AHy) and inducing NAA gelation. As expected, just like the Sigma materials in the previous study [9], the initial mixing of the local-sourced NOCC, AHy, and Alg also yielded gels efficaciously (Fig. 1). The gelation time revealed that increasing the NOCC proportion would expedite the gelation, and the highest NOCC percentage (N7AA3) was the fastest-formed hydrogel (Fig. 1A). This suggested that the sample N7AA3 possessed the most balanced and optimal ratio of amino, aldehyde, and carboxyl groups for Schiff’s base reaction and electrostatic interaction, thereby accelerating the gelation rate. Meanwhile, the N3AA7 solution, containing too few amino groups of NOCC, significantly reduced the density of covalent formed by Schiff’s base reaction, leading to the delayed gelation duration of over 60 min (Fig. 1A) and frail gel formation (Fig. 1B). Therefore, N3AA7 was excluded from further experiments. After gelling with the primary covalent and electrostatic networks, the samples were immersed in CaCl2 0.1M to advance with the secondary ionic crosslinking network. Visually, after immersion, the gels became more opaque and shrunk slightly, making the shape form more rigidly. This could be ascribed to the more orderly arrangement of Alg chains as the result of the chelation between carboxyl groups of Alg G-blocks and Ca2+ to establish the ‘egg-box’ conformation linking adjacent polymer chains [16]. Additionally, water retained in the hydrogel tended to diffuse out to the CaCl2 medium to balance the higher osmotic pressure created by the high concentration of medium ions. However, less water content inside meant a denser internal polymeric crosslinking network, which anticipated improved mechanical properties and dimensional stability [17].

196

T.-N. Tang et al.

Fig. 1. Hydrogel formation: (A) Hydrogel formation with only primary crosslink network (NAA) and with secondary crosslink network (NAACa). (B) Gelation time of the primary NAA hydrogels with different component ratios.

3.2 Characterisation Cross-sectional Morphology Analysis The lyophilised hydrogels were sectioned and observed under SEM for their morphology (Fig. 2). Overall, all primary hydrogel samples (before immersing in CaCl2 ) demonstrated clear porous structures (Fig. 2A). N5AA5 samples possessed the smallest mean pore size, which was statistically significantly smaller than the others (Fig. 2B). In our previous study on NOCC-AHy hydrogels, the increase in NOCC proportion resulted in the smaller pore size of the hydrogel [8]. Different from that inversely correlated trend, the current work on the three-component hydrogel system seemed not to manifest any clear correlation between NOCC content and the pore size. This could be explained by the fact that the mutual interaction of these three polymers was much more complicated than the mere Schiff’s base reaction between NOCC and AHy. Specifically, the amino groups in NOCC chains not only reacted with aldehyde groups of AHy to form imine bonds but were also compelled by electrostatic force to bond with the anionic carboxyl groups [9]. These interactions could be both supporting and competing mutually. Hence,

Enhancing Stability of in Situ Crosslinked Hydrogel

197

the effect of NOCC proportion on the gelation process and crosslinking network could not be determined simply. This might also explain the discordance between the internal density of the hydrogels with the gelation time (N5AA5 formed the tightest crosslinking network but did not gel the fastest), because the different crosslinking mechanisms may occur at different speeds. After establishing the secondary ionic crosslinking network by immersing the hydrogels in CaCl2 , the cross-sectional morphology was transformed remarkably (Fig. 2A). The pore walls seemed to be deformed, especially in the N4AA6 sample, the round shape of the pores almost disappeared and the pore diameters were hardly determined and measured. These effects could be attributed to the hyperosmolarity of the CaCl2 medium, which withdrew internal water and shrank the gel volume. Moreover, the configurational change of anionic Alg chains when contacting with cations Ca2+ arose in the already-fixed gelling network, not in the free condition as in the solution. Therefore, arrangement alteration of Alg might also affect the previously-formed network. Nevertheless, despite the deformation of the round-shaped pores, the density of all samples was prominently reinforced. Particularly, the pore sizes of N7AA3-Ca were clearly smaller and the internal substance mass became denser, compared to the original N7AA3 (the difference in pore size was statistically significant) (Fig. 2A and B). Also, the pore distribution on the cross-sections of N7AA3-Ca was more homogenous than of the other after-immersion samples, which was clearly demonstrated in both the SEM micrographs (Fig. 2A) and the scatter-interval plot of the pore size distribution (more narrow distribution interval) (Fig. 2B). Despite containing the lowest Alg content, N7AA3-Ca manifested the optimal secondary ionic crosslinking network. This could be on account of the participation of NOCC to form this network besides Alg. Some previous studies succeeded in fabricating ionically crosslinked hydrogels based on the Alg-NOCC combination [18] or NOCC solely [19]. Because the reaction of polymeric anions with Ca2+ is extremely rapid, the part contacting sooner with cations might react more than the one contacting later, leading to inhomogeneity as one of the concerns for Alg hydrogel fabrication by using CaCl2 [11]. Therefore, we observed both the outer part, which was approached by Ca2+ first immediately after immersion, and the central part, which interacted later with the cations after their gradual infusion. Interestingly, the pore size difference between the centre and the edge was insignificant statistically in all CaCl2 -immersed samples (Fig. 2B). This suggested that the polymeric chains entangled in the primary network were harder to interact freely with cations, resulting in the delayed speed of forming ionic crosslinks. Furthermore, the similar density of the central region compared with the outer one indicated the ease of diffusing Ca2+ inside the hydrogel, or more generally, the ease of exchanging small molecules inside and outside the hydrogel, which is one of the essential qualities required for cell culture in the scaffold. Since N7AA3-Ca displayed the best cross-sectional morphology, this hydrogel sample was chosen to undergo further experiments. FTIR The FTIR spectra of the N7AA3-Ca sample were measured to evaluate its chemical structure, along with the spectra of its compositions NOCC, AHy, and Alg (Fig. 3). The NOCC spectrum possessed an asymmetric peak at 1599 and a symmetric one at

198

T.-N. Tang et al.

Fig. 2. Cross-sectional morphology of freeze-dried samples: (A) SEM photomicrographs of sample cross-sections and (B) pore sizes (maximal diameters) at the sample cross-sections. (*): p < 0.05.

Enhancing Stability of in Situ Crosslinked Hydrogel

199

1406 cm−1 , which were on account of the presence of group –COO− , thereby confirming successful carboxylation [20]. Meanwhile, the absorption frequency of –CHO at 1722 cm−1 [21] of AHy affirmed the oxidation of hydroxyl into aldehyde groups. Regarding the crosslinks of the hydrogel, the stretching bond of C=N, which represents Schiff’s base crosslinks, was not observable in the absorption band from 1615 to 1650 cm−1 [22] of the NOCC spectrum, maybe because it was obscured by the prominent peak of the carboxylate group at 1593 cm−1 . Comparing the stretching bands of carboxylate in Alg with the ones in N7AA3-Ca samples, the shifts of the asymmetric peak to the lower energy (from 1595 to 1582 cm−1 , respectively) and the symmetric peak to the higher energy (from 1408 to 1414 cm−1 , respectively), making the frequency difference between two peaks of N7AA3-Ca smaller than those of Alg. These changes are characteristics indicating that Alg carboxylate groups interacted ionically with Ca2+ [13, 23].

Fig. 3. FTIR of the N3AA7-Ca hydrogel and the individual components

Compressive Strength To compare the mechanical strength of the preliminary and the secondary networkenhanced hydrogels, the two samples were investigated for their compressive strength (Fig. 4). Accordant to the visual observation that the hydrogel after immersion had a sturdier shape, the supplementary ionic crosslinks impressively reinforced the withstandable compressive stress of the hydrogel. In detail, at the compressed point of 50% original height, N7AA3-Ca could resist the stress of 3175.4 ± 31.1 Pa, which was nearly 12-time greater than the bearable threshold of the preliminary N7AA3 (268.5 ± 82.8 Pa). This was compatible with other studies aiming to upgrade the mechanical strength of the hydrogel by designing the double-network [24] or the dual crosslinking hydrogels [25].

200

T.-N. Tang et al.

Even though the approach of this study did not yield a typical double-network hydrogel, which should possess a rigid polyelectrolyte network and a looser crosslinking network, the SEM micrographs showed that the internal mass of the enhanced hydrogel was denser, suggesting a higher density of crosslink network, thereby successfully improving the mechanical properties.

Fig. 4. Compressive stress-strain curves of the hydrogels N7AA3 and N7AA3-Ca.

In vitro Swelling and Degradation Behaviours One of the aims of this study is to maintain the hydrogel dimensional stability in the physiological solution for a longer duration. The record of kinetic weight change of the hydrogels immersed in the PBS solution over time showed a significant improvement (Fig. 5). The N7AA3 hydrogel swelled rapidly after 12 h of immersion and increased by 33.9 ± 0.10% of its original weight. However, the next day, it degraded dramatically and finally dissolved in the solution completely just after 7 days. In contrast, during the first day of immersion, the N7AA3-Ca hydrogel swelled at a smaller degree and reached its weight equilibrium at 115.5 ± 9.7% of its original weight. After that, the degradation occurred at a gradual speed. Its weight remained over two weeks and lasted until day 18. A slower speed and a smaller degree of swelling of N7AA3-Ca were consistent with the results of SEM photographs and compressive strength records that the stronger density of the internal hydrogel mass reinforced its mechanical strength and also dimensional stability in the aqueous solution. Therefore, the water had a lower chance of being absorbed into and taking place inside the more

Enhancing Stability of in Situ Crosslinked Hydrogel

201

rigid porous scaffold. And thanks to multiple crosslinking networks, the degradation speed was impeded. Because the ionic and electrostatic interactions are not stable in the aqueous environment owing to ion exchange [26], the networks based on these interactions were attenuated in the hydrogel intensely over time, which might contribute to the sharp drop on the line illustrating the mass change of N7AA3-Ca from day 6 to day 8 (Fig. 5). The covalent network was more stable [26], thereby maintaining the hydrogel mass for the latter duration. The degradation behaviours of the hydrogel were in line with the swelling ability. N7AA3 hydrogel could absorb and retain a larger water amount than N7AA3-Ca. Water molecules infusing the hydrogel occupy spaces in the network and interact with hydrophilic domains of the chains, which may dissolve some polymer chains, detrimentally affect the polymer-polymer bonding, and weaken the linkage network integrity [27]. And therefore, a lesser extent of swelling in N7AA3-Ca is instrumental to its prolonged shape and mass.

Fig. 5. Kinetic mass change of the hydrogels immersed in the PBS solution.

3.3 In vitro Experiments on Cells All the components for N7AA3-Ca preparation were well known for their non-toxicity. As expected, the cell viability culture with all hydrogels was higher than 70%, indicating that they were not toxic to the cell, according to ISO 10993-5:2009 [15] (Fig. 6A). The N7AA3 sample had a comparable living cell number to that of the three-component hydrogels in our previous study using Sigma chemicals [9]. This proposed the potential to make use of local low-cost resources. After establishing the secondary network

202

T.-N. Tang et al.

with Ca2+ , the viable cell rate did not differ from the preliminary hydrogel statistically (Fig. 6A), once again confirming that Ca2+ ion-based hydrogel is non-toxic [11]. The live/dead assay showed green colour staining the majority of the cell population (Fig. 6B–D), manifesting that the cells lived well under the covering layer of hydrogel. The number of red stains, representing the dead state, of the hydrogel-covered cells (in both N7AA3 and N7AA3-Ca) was more than the control (without hydrogel), but this difference was not remarkable. This was consonant with the cytotoxicity assay that the viability number of cells cultured with hydrogels was lower than the control but was still of high level. The red stain number in the pictures seemed to account for less than 30% (the approximate dead cell number in the cytotoxicity test). This might be because of the difference in the procedure of the two tests. In the cytotoxicity assay, the viability rate was calculated indirectly by comparing their fluorescence with that of the control, whilst the live/dead assay showed the live and dead cells in the same well. Furthermore, to stain with FDA/PI, the wells must have their old media removed. This step might affect the dead cells, which were not able to adhere firmly to the culture surface, by washing them away. Even though this weakness made the live/dead results not reflect exactly the live/dead rate, these fluorescence images still displayed a high quantity of living cells, covering the photographs full of green colour.

Fig. 6. Cellular experiments: Cytotoxicity assay (A) and live/dead assay of control (B), N7AA3 (C), and N7AA3-Ca (D). Scale bar: 200 μm.

Enhancing Stability of in Situ Crosslinked Hydrogel

203

According to the results, we succeeded in fabricating the hydrogel with multiple crosslinking networks established by combining several mechanisms, including the initial in situ Schiff’s base reaction, enhanced with the electrostatic interaction and followed by the supplementary crosslinking of anionic moieties with added cations. This multistep combination highlighted the novelty of the study since it incorporated various advantages of each single-network hydrogel model. The self-gelling NOCC-AHy is mechanically weak but plastic, flexible and self-healable; therefore, they can be applied in bio-injection to fill the irregular fracture or tissue-defected gap and in bioprinting at the initial stage of forming the bio-scaffold [7]. Meanwhile, the ionically-crosslinked hydrogels Alg-Ca are rigid and mechanically strong, but the diffusion method using CaCl2 for gelation must address the difficulty of controlling the reaction speed and the gel internal homogeneity [28]. Combining these two gelling methods improved the mentioned disadvantages, and also suggested a new direction in printing bioscaffolds: the initial step of forming the shape freely thanks to the flexibility of the primary crosslinking network and the subsequent step of fixing and stabilising the shape based on the supplementary crosslinking network.

4 Conclusion This initial study revealed several potentials of the multiple-crosslinking network hydrogel based on three naturally-derived polymers, NOCC, AHy, and Alg, with the nontoxic complementary crosslinker CaCl2 . Throughout several experiments, the hydrogel with ionic crosslink enhancement was proven to have its dominant advantages compared with the unenhanced one. With the additional ionic crosslinks, the hydrogel was improved for its compressive strength, and dimensional stability in the aqueous physiological environment but could still conserve its former virtue, including porosity and cytocompatibility. These encouraging results can suggest further study for this approach to hydrogel improvement. Firstly, this study has only investigated a fixed concentration of CaCl2 and the immersion time. Thus, to optimise the protocol, the alternative numbers of these two parameters should be examined profoundly. Possibly, the mechanical properties and stability of the hydrogel could be improved and controlled by varying these two parameters, thereby preparing various hydrogels for different purposes of applications such as wound healing, skin regeneration, bone and cartilage regeneration, etc. Secondly, this study employed the external method for establishing the ionic network. Although the SEM results showed that the internal density of the hydrogel was homogeneous, and this method is advantageous for its simple process, there should be a comparison between this and the internal method, in which insoluble calcium crystals are suspended in the gelling solution and induced to release Ca2+ gradually to crosslink with polymers in a controlled speed. Acknowledgments. This research is funded by International University, VNU-HCM under grant number SV2021-BME-04.

Conflicts of Interest. The authors have no conflict of interest to declare.

204

T.-N. Tang et al.

References 1. Thakur, S., Thakur, V.K., Arotiba, O.A.: History, classification, properties and application of hydrogels: an overview. Hydrogels 29–50 (2018) 2. Das, A., Ringu, T., Ghosh, S., Pramanik, N.: A comprehensive review on recent advances in preparation, physicochemical characterization, and bioengineering applications of biopolymers. Polym. Bull. (2022) 3. Verma, D., Fortunati, E.: 1 – Biopolymer processing and its composites: an introduction. In: Verma, D., Fortunati, E., Jain, S., Zhang, X. (eds.) Biomass, Biopolymer-Based Materials, and Bioenergy. Woodhead Publishing Series in Composites Science and Engineering. Woodhead Publishing, pp. 3–23 (2019) 4. Kravanja, G., Primožiˇc, M., Knez, Ž, Leitgeb, M.: Chitosan-based (nano) materials for novel biomedical applications. Molecules 24, 1960 (2019) 5. Aguilar, A., Zein, N., Harmouch, E., et al.: Application of chitosan in bone and dental engineering. Molecules 24, 3009 (2019) 6. Kim, H., Jeong, H., Han, S., et al.: Hyaluronate and its derivatives for customized biomedical applications. Biomaterials 123, 155–171 (2017) 7. Li, L., Wang, N., Jin, X., et al.: Biodegradable and injectable in situ cross-linking chitosanhyaluronic acid based hydrogels for postoperative adhesion prevention. Biomaterials 35, 3903–3917 (2014) 8. Nguyen, N.T.-P., Nguyen, L.V.-H., Tran, N.M.-P., et al.: The effect of oxidation degree and volume ratio of components on properties and applications of in situ cross-linking hydrogels based on chitosan and hyaluronic acid. Mater. Sci. Eng. C 103, 109670 (2019) 9. Le, A.N.-M., Nguyen, T.T., Ly, K.L., et al.: Modulating biodegradation and biocompatibility of in situ crosslinked hydrogel by the integration of alginate into N,O-carboxylmethyl chitosan– aldehyde hyaluronic acid network. Polym. Degrad. Stabil. 180, 109270 (2020) 10. Hasnain, M.S., Jameel, E., Mohanta, B., Dhara, A.K., Alkahtani, S., Nayak, A.K.: Chapter 1 – Alginates: sources, structure, and properties. In: Nayak, A.K., Hasnain, M.S. (eds.) Alginates in Drug Delivery, pp. 1–17. Academic Press (2020) 11. Sergeeva, A., Vikulina, A.S., Volodkin, D.: Porous alginate scaffolds assembled using vaterite CaCO3 crystals. Micromachines 10, 357 (2019) 12. Sarker, B., Boccaccini, A.R.: Alginate utilization in tissue engineering and cell therapy. In: Rehm, B.H.A., Fata Moradali, M. (eds.) Alginates and Their Biomedical Applications, pp. 121–155. Springer Singapore, Singapore (2018). https://doi.org/10.1007/978-981-10-691 0-9_5 13. Tang, S., Yang, J., Lin, L., et al.: Construction of physically crosslinked chitosan/sodium alginate/calcium ion double-network hydrogel and its application to heavy metal ions removal. Chem. Eng. J. 393, 124728 (2020) 14. Piras, C.C., Smith, D.K.: Multicomponent polysaccharide alginate-based bioinks. J. Mater. Chem. B 8, 8171–8188 (2020) 15. ISO E. 10993-5: 2009 – Biological Evaluation of Medical Devices – Part 5: Tests for in vitro Cytotoxicity (ISO 10993-5: 2009). German Version (2009) 16. Cao, L., Lu, W., Mata, A., Nishinari, K., Fang, Y.: Egg-box model-based gelation of alginate and pectin: a review. Carbohydr. Polym. 242, 116389 (2020) 17. Kuo, C.K., Ma, P.X.: Maintaining dimensions and mechanical properties of ionically crosslinked alginate hydrogel scaffolds in vitro. J. Biomed. Mater. Res. A 84A, 899–907 (2008) 18. Lin, Y.-H., Liang, H.-F., Chung, C.-K., Chen, M.-C., Sung, H.-W.: Physically crosslinked alginate/N,O-carboxymethyl chitosan hydrogels with calcium for oral delivery of protein drugs. Biomaterials 26, 2105–2113 (2005)

Enhancing Stability of in Situ Crosslinked Hydrogel

205

19. Liu, Z., Jiao, Y., Zhang, Z.: Calcium-carboxymethyl chitosan hydrogel beads for protein drug delivery system. J. Appl. Polym. Sci. 103, 3164–3168 (2007) 20. Miao, J., Chen, G., Gao, C., Lin, C., Wang, D., Sun, M.: Preparation and characterization of N,O-carboxymethyl chitosan (NOCC)/polysulfone (PS) composite nanofiltration membranes. J. Membr. Sci. 280, 478–484 (2006) 21. Tucureanu, ¸ V., Matei, A., Avram, A.M.: FTIR spectroscopy for carbon family study. Crit. Rev. Anal. Chem. 46, 502–520 (2016) 22. Cinarli, A., Gürbüz, D., Tavman, A., Birteksöz, A.S.: Synthesis, spectral characterizations and antimicrobial activity of some Schiff bases of 4-chloro-2-aminophenol. Bull. Chem. Soc. Ethiopia 25 (2011) 23. Papageorgiou, S.K., Kouvelos, E.P., Favvas, E.P., Sapalidis, A.A., Romanos, G.E., Katsaros, F.K.: Metal-carboxylate interactions in metal-alginate complexes studied with FTIR spectroscopy. Carbohydr. Res. 345, 469–473 (2010) 24. Gu, Z., Huang, K., Luo, Y., et al.: Double network hydrogel for tissue engineering. WIREs Nanomed. Nanobiotechnol. 10, e1520 (2018) 25. Chu, W., Nie, M., Ke, X., Luo, J., Li, J.: Recent advances in injectable dual crosslinking hydrogels for biomedical applications. Macromol. Biosci. 21, 2100109 (2021) 26. Maitra, J., Shukla, V.: Cross-linking in hydrogels – a review. Am. J. Polym. Sci. 4, 25–31 (2014) 27. Temenoff, J.S., Mikos, A.G.: Materials for Biomedical Applications. In: Biomaterials : The Intersection of Biology and Materials Science. Pearson/Prentice Hall, Upper Saddle River, N.J. (2008) 28. Andersen, T., Auk-Emblem, P., Dornish, M.: 3D cell culture in alginate hydrogels. Microarrays 4, 133–161 (2015)

Fabrication and Characterization of Oxidizedbacterial Cellulose Membrane as a Potential Hemostatic Dressing Tram Hoang-Bao Tran1,2 , Thy Minh Nguyen1,2 , Hai Huu Nguyen1,2 , Bao Gia Nguyen1,2 , Khue Le-Minh Tran1,2 , and Thi Hiep Nguyen1,2(B) 1 School of Biomedical Engineering, International University, Ho Chi Minh City

(HCMC) 700000, Vietnam [email protected] 2 Vietnam National University, Ho Chi Minh City (HCMC) 700000, Vietnam

Abstract. In recent years, there has been a growing interest in using bacterial cellulose for biomedical applications thanks to its higher purity and more desirable properties. Regarding hemostatic application, however, most studies on NO2 based oxidized bacterial cellulose (OBC) have focused on its use as a coating agent on another polymer substrate. In this study, we aimed to fabricate a hemostatic dressing of OBC itself by oxidizing an intact bacterial cellulose pellicle and investigating different reaction parameters, including pellicle dryness and oxidation period. Macroscopic observation showed that partially dried pellicles maintained better structural integrity than completely dried pellicles. Fourier-transform infrared (FT-IR) spectroscopy confirmed the change in all OBC samples’ chemical composition through the carboxyl groups. Although scanning electron microscope (SEM) images revealed no significant difference in cellulose fiber morphology between OBC membranes and pristine membranes, the tensile strength of all OBC samples was lower than the unmodified one. The reaction time of 24 h yielded the highest tensile strength among OBC samples and satisfied the required range of carboxyl content of 16–24% to impart hemostatic capability. The results suggest that the OBC membrane is a potential biomaterial for wound dressing applications. Keywords: Nata De Coco · Oxidized Bacterial Cellulose · Hemostatic Dressing · Tissue Engineering

1 Introduction Uncontrolled bleeding in trauma injuries has become one of the challenges over the years, accounting for approximately 33–56% of pre-hospital cases with high mortality rates. Therefore, effective hemorrhage control is critical in clinical settings with the help of hemostatic material [1, 2]. This material has been developed with the following essential properties when acting as a barrier to regulate the oxygen and moisture across the tissues: T.H.-B. Tran and T.M. Nguyen—Contributions of authors are similar. © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. T. Vo et al. (Eds.): BME 2022, IFMPE Proceedings 95, pp. 206–218, 2024. https://doi.org/10.1007/978-3-031-44630-6_16

Fabrication and Characterization

207

excellent hemostasis activity, biocompatibility, nontoxicity, no antigenicity, low cost, and ease of processing for the patient. Many topical hemostatic dressings have been recently commercialized, including Surgicel®, QuikClot®, and HemCon® [3–5]. Despite their advantages in arresting bleeding and stabilizing wounds, different issues associated with these products havebeen recorded, such as causing an exothermic reaction [6], unusual foreign body reactions if being exposed for a prolonged period in situ [7], and high prices prohibiting their potential in medical applications [8]. Hence, improvements in bio-based dressing for the hemostatic approach are tremendously needed to overcome the limitations of available products.

Fig. 1. The inter- and intra-hydrogen bonding of bacterial cellulose [8].

With its versatility, availability, and cost-effectiveness, cellulose has been extensively explored for various clinical applications. Specifically, bacterial cellulose (BC), microorganism-derived cellulose, is widely produced from the nonpathogenic bacteria Acetobacter xylinum (A. xylinum) in a culture medium and has glucose units linked through β (1,4) glycosidic bonds [9], as illustrated in Fig. 1. It can be obtained by extraction, fermentation, and purification to remove the secondary metabolites, yielding highly pure cellulose. Differing from that vegetal form, BC provides higher surface area, elasticity, resistance, and flexibility by the aggregation to generate longer and thinner fibrils, forming an ultra-fine fiber network [10]. Some remarkable features of BC in fabricating an ideal skin substitute are good biocompatibility, biodegradability, high purity, crystallinity, excellent porosity, mechanical strength, and moisture absorption capacity [11, 12]. Furthermore, the stress-strain behavior of BC is similar to that of the extracellular matrix in native tissues, as well as an optimal three-dimensional template for cellular interaction, making BC intrinsically favorable for skin regeneration. As a result, BC has demonstrated rapid epithelization, which can eliminate exudates, avoid infections, and reduce local pains, indicating that it represents the next generation of topical wound dressings and future regenerative medicine [13].

208

T. H.-B. Tran et al.

However, the initial state of BC hinders its use in biomedical applications; thus, chemical modifications are performed to regulate the substrate’s surface chemistry. Oxidation of cellulosic materials is a pivotal reaction in cellulose chemistry to modify BC into oxidized membranes, creating added-value products owing to the new functionality imparted [14]. Oxidized cellulose fibers are superior due to their excellent blood clotting behavior and absorbable hemostatic action, which is suggested to function under physical and chemical mechanisms. OBC has also been discovered to absorb a significant amount of blood, more than its practical weight, clotting the injured blood vessel by forming a plug at the wounded site and applying pressure on the surrounding tissue via the swelling effect [15]. Besides, the carboxyl content of approximately 16–24% generates a low pH level that induces the innate coagulation activity to accelerate the wound healing process, furthermore, endows an excellent antibacterial action of this cellulosic material. There have been various selections of oxidizing reagents that have shown to successfully introduce carboxyl groups into cellulose, divided into categories such as nonselective (nitrogen oxides in gaseous or solution in an appropriate organic solvent), a mixture of nitric acid, phosphoric acid, and sodium nitrite; or selective ones like periodate and nitroxyl radicals 2,2,6,6-tetramethylpiperidine N-oxyl (TEMPO) [16]. Different methods have shown the ability to create OBC, but still, some drawbacks must be considered. The dinitrogen trioxide was capable of producing 6–18% carboxyl content, but the presence of chromium in the product is undesirable. The reaction of nitrogen dioxide in nitric acid solution resulted in a high oxidation degree; however, the temperamental nature of these gases, as well as the difficulty in both availability and maintenance, have reduced their use [17]. Periodate oxidation of the two secondary OH groups has been observed to provide an increased 50% oxidation degree and preserved the morphological structure with experiments by Vasconcelos et al. and Toshikj et al. [18, 19]. However, although this is a classic technique, the reaction is relatively slow and is more common for plant-derived cellulose. Until now, TEMPO-mediated oxidation has become one of the most popularized protocols with a more controlled modification [4]. Nonetheless, the oxidation results in significant cellulose backbone depolymerisation, resulting in mechanical strength loss. The second significance is the toxicity to aquatic life, which cannot be disposed of or recycled, accumulating the spacing and raising price concerns [20]. The oxidation using a mixture of metal-free, organic solvents has also been carried out with various combinations of HNO3 , HNO3 –NaNO2 , H3 PO4 –NaNO2 , H3 PO4 –NaNO2 –NANO3 , and H3 PO4 /NO2 , may accidentally cause extensive hydrolysis, low yield of oxycellulose, and long oxidizing time. Among these, the combination of HNO3 /H3 PO4 -NaNO2 has proven to be an outstanding strategy for introducing carboxyl and carbonyl functional groups. The previous studies generally used cellulose derived from plants as their raw material. Here, Nata de CoCo, a nanofiber of bacterial cellulose produced by fermented coconut juice, will be used to modify the OBC [21–23]. Unlike previous studies utilizing OBC in powder or gauze form, this study focus on utilizing the purified pellicle of BC in its native forms to create a promising membrane with a preserved microfibrillar network and suitable carboxyl content for further hemostasis applications. This study oxidized purified sheets of Nata de Coco using the HNO3 /H3 PO4 NaNO2 system under different conditions of dryness and oxidation

Fabrication and Characterization

209

time. The oxidized membranes were then characterized using SEM, FTIR, titration for carboxyl content determination, and mechanical strength analysis.

2 Methodology 2.1 Materials Fresh Nata de Coco sheets (traditional bacterial cellulose from A. xylinum fermented coconut water forming bacterial-based pellicles) with a thickness of 3 cm were kindly provided by Minh Tam Coconut VN Co., Ben Tre Province, Vietnam. Sodium hydroxide (NaOH), hydrogen peroxide (H2 O2 ) 30% (w/w), nitric acid, phosphoric acid, sodium nitrite, glycerin (C3 H8 O3 ), and ethanol (C2 H5 OH) (99.6%) were purchased from Xilong Chemical Co., Ltd (China). 2.2 Methods Alkaline-Purification Treatment of Raw Bacterial Cellulose Blocks Fresh blocks of Nata de Coco were first washed with tap water to eradicate surface impurities and heated at 90 °C in deionized water for 2 h. The samples were then immersed in a NaOH 1M solution for a day to remove bacterial cell debris and rinsed with deionized water until the pH reached neutral. The purified membranes were stored in distilled water at 4 °C for further use. Oxidation of the Membranes Nitric acid and phosphoric acid were mixed in a 3:1 v/v ratio forming a 100 mL homogeneous solution. Purified BC sheets (partially dried and completely dried) with the size of 5 × 5 cm were divided into two groups (25% thoroughly soaked into the prepared acidic mixture. Thereafter, 1.4% (w/v) of sodium nitrite was added simultaneously. Reddishbrown gas immediately appeared, and the beaker was therefore covered with a petri dish to prevent any leakage of these fumes into the air. After evaluation, suitable dryness was further applied to the mixtures where they were left to react at room temperature in a continuously stirring plate under various concentrations of 20%, 30%, and 40% for different periods of 6, 12, 24, and 48 h, respectively. The diluted reaction mixture was filtered, and the resulting oxidized membranes were collected and washed with distilled water until the filtrate had a pH of approximately 4. Finally, glycerol, ethanol 50%, and distilled water were used to rinse the sample before storing it at 4 °C. Characterization of Oxidized Bacterial Cellulose Membranes Carboxyl Group Determination The carboxyl content presented in the treated membranes was determined based on the US Pharmacopeia USP23-NF18: The carboxyl groups in the samples react with the salts of weak acids to create the salt of oxidized cellulose while releasing an equivalent quantity of weaker acid. Oven-dried OBC samples weighing approximately 0.5 g (with a known amount of moisture content) were cut and immersed in 0.01 M HCl solution for

210

T. H.-B. Tran et al.

30 min under continuous stirring to acquire the acidic nature in which its cations were taken place by hydrogen ions, followed by 10 min of washing and rinsing with distilled water. The samples were then submerged in 50 mL of 2% w/v sodium acetate solution for 30 min using an ultrasonic to ensure complete ion exchange. The final filtration was titrated with a standard 0.1 N NaOH solution using phenolphthalein as a color indicator. The blank was used to adjust the volume of NaOH droplets. The carboxyl content of the oxidized samples was calculated as follows: Catboxyl content(%w/w) =

N (NaOH ) × V (NaOH ) × MW (COOH ) × 100% m × (1 − w/100)

where N: the normality of NaOH. V: the volume of NaOH (mL) consumed in titration after correcting for the blank. MW–COOH: the molecular weight of the carboxyl group. m: the weight of the dry testing sample (g) w: the moisture content of the membranes (%) FTIR Spectra Analysis Fourier-transform infrared (FT-IR) was used to investigate the differences between plain BC membranes (after alkaline purification) and oxidized ones. The spectrum was analyzed by a spectrometer (Spectrum GX, PerkinElmer Inc., USA) in the wavelength range of 400–4000 cm−1 . SEM Micrographs Observations Dried membranes with the size of 1 cm2 were sputter-coated with gold. The micrographs of the surfaces of the membranes were then captured using a scanning electron microscope (SEM, JSM-IT100, JEOL, Japan) with an accelerating voltage of 10 kV. 2.3 Statistical Analysis SPSS Statistics program (IBM) was used for the statistical analysis with a one-way analysis of variance (ANOVA) to determine the differences between sample groups, followed by a Tukey Kramer posthoc test. Data were reported as the mean ± standard deviation (SD) with p < 0.05 representing statistically significant. All the tests were performed in triplicate.

3 Results and Discussion 3.1 Results Purification and Oxidation After observing the oxidation, the partially dried sample retained its original form as opposed to the totally dried one, where it shrunk, showing better potential as a hemostatic dressing, illustrated in Fig. 2. By comparing 6 h, 12 h, 24 h, and 48 h partially dried and completely dried, the part was slightly ripped around the edge but remained intact, satisfying the research approach. Thus, the partially dried was selected with a suitable

Fabrication and Characterization

211

Fig. 2. Completely dried BC after 24 h and 48 h oxidized.

sample concentration. In addition, during the hydrolysis process, due to the over-swelling state was observed for the 40% concentration samples, leading to the BC samples could not fully submerge in the oxidizing solution. Hence, this concentration was eliminated. FTIR Analysis The FT-IR spectra of BC and OBC oxidized at different temperatures, times, and dry conditions, which were compared, are illustrated in Fig. 3. According to previous studies [17, 24, 25], the combination of HNO3 , H3 PO4 , and NaNO2 is expected to undergo the scission from which the production of soluble fragments occurs, where the oxidized cellulose molecules and hydrolyzed. All of the changes in the chemical structure of the purified BC are illustrated on the IR spectral curves. For all samples in different conditions, the absorption peaks at 3332 cm−1 and 2893 cm−1 correspond to the stretching vibration of O-H and C-H, respectively. While the stretching vibration of C = O and the production of COO- in salts, which correspond to peaks at 1728 cm−1 and 1639 cm−1 , respectively, have both been observed partially and dried in different conditions. These characteristics supported the existence of carboxyl groups in these OBC samples and attested to the effectiveness of the oxidized membranes. SEM Observation Through the SEM micrographs in Fig. 4, the raw and alkaline-treated purified BC samples obtained from a scanning electron microscope (SEM) showed uniformity in membrane surface morphology, with no significant difference in cellulose fiber structure before and after treatment with a strong base solution of 1 M NaOH and conditions of storing the final samples in distilled water at 4 °C. The cellulose microfibrils of both membrane samples after cleaning treatment did not appear as particles or bacterial cell debris, which can be easily seen when compared with the membrane samples at the pre-treatment stage with bacterial cells A. xylinum (elliptical and rod-shaped) adhered to the filamentous system through diffusion into the culture medium. The tightly bound fibers, randomly

212

T. H.-B. Tran et al.

Fig. 3. The FTIR spectrum of purified bacterial cellulose (Purified BC) and the oxidized bacterial cellulose.

stacked, intertwine to form a dense three-dimensional cellulose network with dendritic nodes appearing to be the region of amorphous cellulose. At these high magnifications (x2000 and x20000), areas of highly crystalline cellulose-containing more defined and directional fibers were also observable. Between the 20% and 30% OBC samples, the distinction in the structure and density of the cellulose network was negligible. Carboxyl Content Determination The carboxyl groups generated during the oxidation stage were examined using the acetate-titration method. The carboxyl groups react with salts from weaker acids (sodium acetate), produce OBC-salts, and release an equal amount of diluted acid. The carboxyl content of the oxidized samples at different conditions, such as the sample concentrations or the reaction duration, are shown in Table 1. The carboxyl groups generated during the oxidation stage were examined using the acetate-titration method. The carboxyl groups react with salts from weaker acids, produce OBC salts, and release an equal amount of diluted acid. The carboxyl content of the oxidized samples at different conditions, such as the sample concentrations or the reaction duration, are shown in Table 1. The impact of sample concentration on carboxyl content has first investigated. In comparison, the membranes produced by the HNO3 /H3 PO4 = 3:1 system exhibited the most excellent

Fabrication and Characterization

213

Raw BC

Purified BC

Completely-dried 24 h

Completely-dried 48 h

OBC 20% 6 h

OBC 20% 12 h

OBC 20% 24 h

OBC 20% 48 h

OBC 30% 6 h

OBC 30% 12 h

OBC 30% 24 h

OBC 30% 48 h

X2000

X20000

X2000

X20000

X2000

Fig. 4. The SEM micrographs of the raw BC, purified BC, and the oxidized membranes in different conditions (20%-6 h, 20%-12 h, 20%-24 h, 20%-48 h, 30%-6 h, 30%-12 h, 30%-24 h, and 30%48 h) and magnifications (x2000, x20000) at scale bar (10μm,1μm)

carboxyl content, up to 23.25 ± 2.00% for the 20% samples concentration. Considering the effect of the reaction time, the carboxyl content of the two concentations experienced similar phenomenon, rising gradually from 10.89 ± 0.21, 13.85 ± 1.38, to 23.25 ± 2.00 with the increased time from 6 h to 24 h, then dropping slightly at 48 h.

214

T. H.-B. Tran et al.

Table 1. The effect of carboxyl content in OBC samples through modified concentrations and oxidizing times. Oxidized sample

Carboxyl content (%)

OBC 20% 6 h OBC 20% 12 h OBC 20% 24 h OBC 20% 48 h

10.89 ± 0.21 13.85 ± 1.38 23.25 ± 2.00 21.62 ± 0.18

OBC 30% 6 h OBC 30% 12 h OBC 30% 24 h OBC 30% 48 h

8.85 ± 1.50 12.20 ± 3.43 17.69 ± 0.11 16.74 ± 0.15

Tensile Strength

Fig. 5. Stress-strain curves of oxidized membranes at different oxidizing conditions of 20% and 30% concentration.

The tensile testing was conducted to assess whether the oxidized membranes possessed satisfactory mechanical properties. The stress-strain curves were illustrated in Fig. 5 to depict the tensile strength, elongation, and strain at the breaking point of each sample. All the samples from the two concentrations underwent stages of linear elastic behavior, stress stiffening, and a final collapse after tensions, referring to a typical response for an elastomeric material. Under a similar concentration of 20%, the samples displayed a rather poor tensile strength as the stress values were no higher than 0.6 MPa. The average maximum loads dropped slowly, with the highest belonging to the 6 h sample (0.59 ± 0.20 MPa). The percentages of elongation at break were 40.52 ± 2.24, 31.01 ± 5.27, 25.62 ± 5.49, and 29.46 ± 12.24 following the increasing period of the oxidation reaction time. Meanwhile, in terms of the rupture strength, a much greater tolerance was recorded for the 30% concentration, presenting the highest force of 1.58 ± 0.04 MPa for the 6 h sample. The sustainable forces gradually decreased after having been oxidized for 6 h with the corresponding break strains of 33.37 ± 3.90, 29.08 ± 0.26, 24.94 ±

Fabrication and Characterization

215

1.19, and 25.37 ± 2.66, respectively. As expected, the ultimate stress of the oxidizing membranes experienced a somewhat declining trend with the longer oxidation reaction time. 3.2 Discussions The study aims to synthesize oxidized BC membranes under varied conditions of oxidant proportions, reaction temperatures, and duration. The OBC samples are expected to show desirable physical properties and carboxyl content for hemostatic dressing applications. It revealed that oxidizing purified BC pellicles with HNO3 /H3 PO4 –NaNO2 successfully produced varied results depending on the concentrations. As previously examined, higher or lower sample concentration had a significant influence on the structural integrity of the membranes. 40% concentration was proven to cause the over-swelling effect whereas a concentration lesser than 20% produced BC samples with weak mechanical properties unsuitable as a wound dressing material. Therefore, 20% and 30% concentrations were chosen for further analysis. FTIR graph indicates the appearance of the carboxyl group as evidence of a suitable oxidation system. Besides, through the oxidation treatment, a thicker coating layer was created on the fibrous surface, resulting in the high potential of this material in designing a matrix of uniform fibers [26]. The effect of sample concentration on the carboxyl content has been explained by the stronger hydrolysis of bacterial cellulose for the 20% concentration during the oxidation under a strong-acidic environment. In addition, the influence of the reaction time on the formed in the OBC is demonstrated in Table 1, which is similar to the previous document [27]. The trend of carboxyl content following increased oxidizing time showed the strongest hydrolysis effect at 24 h. As the samples continue to be hydrolyzed, more – COO will also be hydrolyzed, causing the decline of carboxyl content. Thus, these results indicated that oxidation stage parameters such as sample concentrations or the reaction time significantly affect the carboxyl content determination. As previously documented, the OBC with a carboxyl group concentration ranging from 16 to 24%, with a high potential in vitro hemostatic properties and biocompatibility [24]. Therefore, oxidized samples with a carboxyl content greater than 16% (OBC20%-24 h, OBC-20%-48 h, OBC-30%-24 h, and OBC-30%-48 h) is considered to be the optimal setting for the production of OBC for further investigation. Mechanical property is a prominent aspect in topical hemostatic dressings to address different problems and applications. It is expected that biomaterials designed for wound healing should exhibit greater tensile strength than natural human skin to prevent breakages after deformation in the vicinity of the damaged site. The material should be capable of tolerating a force higher than the 1.8 MPa of ultimate stress implied for human skin [28]. As the ultimate stress of the purified BC membrane is insufficient, chemical modification is needed to enhance the composites’ structural stability and mechanical strength. Based on the data, the oxidation at 30% concentration demonstrated better endurance through the improved tensile characteristics. Interestingly, the graphs also demonstrated that the prolonged oxidizing time is inversely proportional to the stress-strain reduction trend, which can be further emphasized in future studies. That being said, explanations for the difference in the values of the 20% and 30% concentrations remain unclear. Still,

216

T. H.-B. Tran et al.

reasons could be pointed towards the deviation in the thickness measurement and length while performing the assay, causing such inconsistency among the samples [29]. The oxidized system treatment considerably influenced the mechanical strength of the BC membranes in general.

4 Conclusions This study successfully produced and characterized oxidized bacterial cellulose membranes from fresh Nata de Coco sheets via HNO3 /H3 PO4 -NaNO2 system at modified sample concentrations and reaction duration. The FT-IR spectrum confirmed the introduction of carboxyl groups, which was then clarified by the titration method to determine the precise amount of carboxyl contents, with all the oxidized membranes exhibiting the acceptable value of 16–24%. SEM images did not present any significant difference between native BC membranes and the treated ones, revealing no discernible effect on the surface morphology, nanofibers diameter, and water absorption capacity. Moreover, oxidized membranes at 30% concentration met the criteria of high tensile strength and yield stress sufficient for therapeutical purposes, which was affirmed by the stress-strain curve. The oxidized membranes at 30% concentration were regarded as a promising wound dressing due to the satisfying physiochemical features that can serve as the baseline for future research. Ideally, a hemostatic material should fulfill minimal criteria, such as immediate induction at the wounded site, high availability, durability, and antibacterial capability that can be easy to utilize without the requirement of training at an affordable cost. Hence, implementations should be emphasized to enhance the characteristics of this novel hemostatic agent both in vitro and in vivo settings. A deeper investigation of the antibacterial performance through a chitosan-coated layer, blood-material interaction, and cytocompatibility, as well as modification of different oxidizing parameters in terms of chemicals, ratios, reaction temperature, and duration will be employed. Conflict of interests. The authors declare that there is no conflict of interest regarding the publication of this article.

References 1. Evans, J.A., van Wessem, K.J.P., McDougall, D., Lee, K.A., Lyons, T., Balogh, Z.J.: Epidemiology of traumatic deaths: comprehensive population-based assessment. World J. Surg. 34(1), 158–163 (2010). https://doi.org/10.1007/s00268-009-0266-1 2. Geeraedts, L.M.G., Kaasjager, H.A.H., van Vugt, A.B., Frölke, J.P.M.: Exsanguination in trauma: a review of diagnostics and treatment options. Injury 40(1), 11–20 (2009). https:// doi.org/10.1016/j.injury.2008.10.007 3. Khoshmohabat, H., et al.: A review of the application of cellulose hemostatic agent on trauma injuries. Open Access Emerg. Med. 11, 171–177 (2019). https://doi.org/10.2147/OAEM.S20 5006 4. Queirós, E.C., et al.: Hemostatic Dressings Made of Oxidized Bacterial Nanocellulose 5. Membranes’, Polysaccharides, vol. 2, no. 1, pp. 80–99, February 2021. https://doi.org/10. 3390/polysaccharides2010006

Fabrication and Characterization

217

6. Granville-Chapman, J., Jacobs, N., Midwinter, M.J.: Pre-hospital haemostatic dressings: a systematic review. Injury 42(5), 447–459 (2011). https://doi.org/10.1016/j.injury.2010.09.037 7. Arnaud, F., et al.: Exothermic reaction in zeolite hemostatic dressings: QuikClot ACS and ACS+®. Ann. Biomed. Eng. 36(10), 1708–1713 (2008). https://doi.org/10.1007/s10439-0089543-7 8. Wang, H., Chen, P.: Surgicel® (oxidized regenerated cellulose) granuloma mimicking local recurrent gastrointestinal stromal tumor: a case report. Oncol. Lett. 5(5), 1497–1500 (2013). https://doi.org/10.3892/ol.2013.1218 9. Esa, F., Tasirin, S.M., Rahman, N.A.: Overview of bacterial cellulose production and application. Agric. Agric. Sci. Procedia 2, 113–119 (2014). https://doi.org/10.1016/j.aaspro.2014. 11.017 10. Keshk, S.M.: Bacterial cellulose production and its industrial applications. J. Bioprocess. Biotech. 04(02) (2014). https://doi.org/10.4172/2155-9821.1000150 11. Portela, R., Leal, C.R., Almeida, P.L., Sobral, R.G.: Bacterial cellulose: a versatile biopolymer for wound dressing applications. Microb. Biotechnol. 12(4), 586–610 (2019). https://doi.org/ 10.1111/1751-7915.13392 12. Pang, M., et al.: Application of bacterial cellulose in skin and bone tissue engineering. Eur. Polym. J. 122, 109365 (2020). https://doi.org/10.1016/j.eurpolymj.2019.109365 13. Carvalho, R., Maio, P., Amaro, C., Santos, R., Cardoso, J.: Hydrogel allergic contact dermatitis and imidazolidinyl urea/diazolidinyl urea. Cutan. Ocul. Toxicol. 30(4), 331–332 (2011). https://doi.org/10.3109/15569527.2011.562270 14. Picheth, G.F., et al.: Bacterial cellulose in biomedical applications: a review. Int. J. Biol. Macromol. 104, 97–106 (2017). https://doi.org/10.1016/j.ijbiomac.2017.05.171 15. Carvalho, T., Guedes, G., Sousa, F.L., Freire, C.S.R., Santos, H.A.: Latest advances on bacterial cellulose-based materials for wound healing, delivery systems, and tissue engineering. Biotechnol. J. 14(12), 1900059 (2019). https://doi.org/10.1002/biot.201900059 16. Wu, Y., Wang, F., Huang, Y.: Comparative evaluation of biological performance, biosecurity, and availability of cellulose-based absorbable hemostats. Clin. Appl. Thromb. 24(4), 566–574 (2018). https://doi.org/10.1177/1076029617751177 17. Coseri, S., Biliuta, G., Simionescu, B.C., Stana-Kleinschek, K., Ribitsch, V., Harabagiu, V.: Oxidized cellulose—survey of the most recent achievements. Carbohydr. Polym. 93(1), 207–215 (2013). https://doi.org/10.1016/j.carbpol.2012.03.086 18. Cui, Q., Zheng, Y., Lin, Q., Song, W., Qiao, K., Liu, S.: Selective oxidation of bacterial cellulose by NO 2 –HNO3 . RSC Adv. 4(4), 1630–1639 (2014). https://doi.org/10.1039/C3R A44516J 19. Toshikj, E., Tarbuk, A., Grgi´c, K., Mangovska, B., Jordanov, I.: Influence of different oxidizing systems on cellulose oxidation level: introduced groups versus degradation model. Cellulose 26(2), 777–794 (2019). https://doi.org/10.1007/s10570-0182133-4 20. Vasconcelos, N.F., et al.: Oxidized bacterial cellulose membrane as support for enzyme immobilization: properties and morphological features. Cellulose 27(6), 3055–3083 (2020). https:// doi.org/10.1007/s10570-020-02966-5 21. Coseri, S., Biliuta, G., Simionescu, B.C.: Selective oxidation of cellulose, mediated by N -hydroxyphthalimide, under a metal-free environment. Polym. Chem. 9(8), 961–967 (2018). https://doi.org/10.1039/C7PY01710C 22. Xu, Y., Liu, X., Liu, X., Tan, J., Zhu, H.: Influence of HNO3/H3PO4–NANO2 mediated oxidation on the structure and properties of cellulose fibers. Carbohydr. Polym. 111, 955–963 (2014). https://doi.org/10.1016/j.carbpol.2014.05.029 23. Kumar, V., Yang, T.: HNO3/H3PO4–NANO2 mediated oxidation of cellulose—preparation and characterization of bioabsorbable oxidized celluloses in high yields and with different levels of oxidation. Carbohydr. Polym. 48(4), 403–412 (2002). https://doi.org/10.1016/S01448617(01)00290-9

218

T. H.-B. Tran et al.

24. Kotatha, D., Rungrodnimitchai, S.: Synthesis and characterization of nanofiber of oxidized cellulose from Nata De Coco. Int. J. Chem. Eng. 2018, 1–12 (2018). https://doi.org/10.1155/ 2018/2787035 25. Xu, Y., Qiu, C., Zhang, X., Zhang, W.: Crosslinking chitosan into H3PO4/HNO3– NANO2 oxidized cellulose fabrics as antibacterial-finished material. Carbohydr. Polym. 112, 186–194 (2014). https://doi.org/10.1016/j.carbpol.2014.05.054 26. Kaˇcuráková, M., Smith, A.C., Gidley, M.J., Wilson, R.H.: Molecular interactions in bacterial cellulose composites studied by 1D FT-IR and dynamic 2D FT-IR spectroscopy. Carbohydr. Res. 337(12), 1145–1153 (2002). https://doi.org/10.1016/S0008-6215(02)00102-7 27. Tran, N., et al.: Polyurethane/polycaprolactone membrane grafted with conjugated linoleic acid for artificial vascular graft application. Sci. Technol. Adv. Mater. 21(1), 56–66 (2020). https://doi.org/10.1080/14686996.2020.1718549 28. He, J.M., Wu, Y.D., Wang, F.W., Cheng, W.L., Huang, Y.D., Fu, B.: Hemostatic, antibacterial and degradable performance of the water-soluble chitosan-coated oxidized regenerated cellulose gauze. Fibers and Polymers 15(3), 504–509 (2014). https://doi.org/10.1007/s12221014-0504-5 29. Ho, T.T.-P., et al.: Fabrication of chitosan oligomer-coated electrospun polycaprolactone membrane for wound dressing application. Mater. Sci. Eng. C 120, 111724 (2021). https:// doi.org/10.1016/j.msec.2020.111724 30. Wang, Y.-Y., et al.: Review on the strategies for enhancing mechanical properties of bacterial cellulose. Review (2022, preprint). https://doi.org/10.21203/rs.3.rs-1783762/v1

Investigation of Codonopsis Javanica Root Extract on Open Wound Model: In Vitro and In Vivo Studies Nghia Hieu Bui1,2 , Khoa Ngoc-Khanh Tran1,2 , Chi Thi-Kim Le1,2 , and Thi-Hiep Nguyen1,2(B) 1 School of Biomedical Engineering, International University, Ho Chi Minh City

(HCMC) 700000, Vietnam [email protected] 2 Vietnam National University, Ho Chi Minh City (HCMC) 700000, Vietnam

Abstract. From ancient times, Codonopsis javanica root (CJR) has been used in Eastern traditional medicine to treat body weaknesses. CJR was dried and crushed into powder before being extracted using the reflux method with modified parameters such as solvent concentration, material-solvent ratio, and reaction time to obtain the total phytochemical constituents inside. The extraction was then loaded into Carbopol 934 to form a topical hydrogel. The DPPH assay indicated that the extraction has outstanding antioxidant properties. In vitro cell proliferation demonstrated that the presence of CJR extract helps accelerates cell growth and migration. However, an excessive quantity might reduce cell viability. Besides, in vivo evaluation in mice models also indicated the enhancement in epithelialization and regeneration process. Hence, this study introduced a topical drug used to promote healing rates with the extract concentration of 2.5 mg/ml in the sample was deemed optimal for further potential applications in open wound treatment. Keywords: Nature Herb Extract · Codonopsis Javanica · Carbopol 934 · Topical Gel · Wound Healing

1 Introduction Skin acts as a barrier between humans and their surroundings, protecting them from microorganisms, allergens, ultraviolet (UV) radiation, and chemicals while preventing moisture and nutrient loss [1]. Skin contacts directly with the external environment, making it more vulnerable to damage. Chronic and acute wounds are the two main types of wounds [2]. In most cases, abnormalities in the acute wound healing process, such as insufficient hemostasis, a delayed inflammatory response, and a fibroblast response, contribute to tissue regeneration failure. The appearance of foreign material or infection causes a prolonged inflammatory response, which causes the healing process to stop and enter the fibroproliferative phase [3]. Direct contact is recommendable in skin treatment since bioactive substances can penetrate directly into the damaged area. In topical application formulations, transdermal or topical drug delivery technologies are designed to © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. T. Vo et al. (Eds.): BME 2022, IFMPE Proceedings 95, pp. 219–230, 2024. https://doi.org/10.1007/978-3-031-44630-6_17

220

N. H. Bui et al.

transport substances through multiple layers of skin and into the systemic circulation system. Topical drug delivery methods, in particular, transfer therapeutic agents to one or more layers of the skin [4]. To date, natural herbs are regarded as a primary and crucial non-toxic source of medical treatment in developing and underdeveloped countries, with various plants found to be advantageous for wound healing [5]. Codonopsis is a genus of flowering plants in the Campanulaceae family [6]. Mainly, Codonopsis Javanica is one kind of perennial herbaceous plant in the form of branched vines, typically surviving in the mountain area, and is widely used in the traditional medicine of some countries such as China, India, Laos, and Vietnam [7]. The roots of Codonopsis Javanica, having a shape of a long cylinder tapering towards the lower stem, are proven by many previous studies to contain valuable compositions with anti-inflammation and antioxidant properties [8]. On the other hand, hydrogels are polymeric materials with a hydrophilic structure that allows them to hold large amounts of water in their three-dimensional networks [9]. The pharmaceutical industry uses hydrogels as deliverer substances due to their adhesion, semisolid consistency, swelling behavior, and biocompatibility [10]. Hydrogels have a wide range of applications in controlled release systems due to their biodegradability. Carbopol polymers, also known as carbomers, are high molecular weight polymers composed of polyacrylic acid cross-linked with allyl sucrose or allyl pentaerythritol, which form a hydrogel when dissolving in water. Carbopol 934 is a benzene-polymerized high-molecular-weight polyacrylic acid cross-linked with allyl sucrose. With the main component referred to as acrylic acid, Carbopol polymer aqueous dispersions have a pH range of 2.8 to 3.2, depending on polymer concentration [11]. Formulations, including medium to high-viscosity gels, emulsions, and suspensions, are made using Carbopol 934. In a research, the examination of the roots of Codonopsis javanica led to the discovery of 12 compounds. codojavanyol (1), (2E,8E)-9-(tetrahydro-2H-pyran-2-yl)nona-2,8diene-4,6-diyl-1-ol (2), lobetyol (3), lobetyolin (4), lobetyolinin (5), cordifolioidyne B (6), codobenzyloside (7), benzyl-a-L-arabinopyranosyl (1-6)-b-D-glucopyranoside (8), (Z)-8-b-D-glucopyranosyloxycinnamic acid (9), syringin (10), syringaresinol (11), and tryptophan (12) [12]. Previous research has indicated that using the extraction of herbs may be more beneficial in treatment than using an isolated compound [13]. Biological activity results from the incorporation of complex compositions. The reflux method was used to explore the extraction, and CJR extraction was tested for antioxidant ability, cell-material interaction, and in vivo tissue biocompatibility. For experimenting with animal models, the solution was combined with Carbopol 934 to form a hydrogel used as a topical drug. This study aims to establish a topical medication for wound healing and a variety of practical applications for CJR extract.

Investigation of Codonopsis Javanica Root Extract on Open Wound Model

221

2 Materials and Methods 2.1 Materials Codonopsis Javanica root (CJR) was purchased from Kon Tum Province, Vietnam. Sodium hydroxide (NaOH), Absolute ethanol (EtOH) was purchased from Xilong, China. DPPH (2,2-diphenyl-1-picrylhydrazyl) was purchased from Sigma, USA. All other chemicals are analytically graded. 2.2 Methods CJR Extraction. The selection of a solvent can impact the quantity and type of extracted compounds because the solubility of the compounds is influenced by the polarity of the solvent utilized. The greatest extraction values were obtained when using 50% methanol, followed by 50% ethanol, 50% acetone, water, ethyl acetate, and n-hexane [7]. This outcome implies that the efficiency of extraction is greatly influenced by the polarity of the solvent because polyphenols and flavonoids have a medium to high polarity, making them easily soluble in versatile solvents such as ethanol or methanol. Ethanol, which is less harmful than methanol, is frequently used in food processing and preservation. The CJR was washed to remove dirt before being cut into small pieces and oven-dried at 60 °C. The dried pieces are ground into powder and stored at 5 °C. The extraction process was carried out with modified extracted time, EtOH-CJR powder ratio, and EtOH concentration parameters. In particular, 1 g of dried CJR extract powder was dissolved in EtOH concentrations of 50% and 70%, with a 1/20 (w/v) and 1/30 (w/v) ratio. Then, for each EtOH concentration, the reflux extraction system was connected and heated to 70 °C for 30 and 60 min. With each timeline, the solution was filtered and then allowed to evaporate while all EtOH was at room temperature before being freeze-dried. This optimized condition has consulted the result of Zhao [14] and Nhut Pham [7]. In Vitro Analysis DPPH Assay. DPPH assay is used to determine the antioxidant activity of the extraction. The 0.2 mM solution of DPPH stock (2,2-diphenyl-1-picrylhydrazyl) was dissolved in EtOH. The stock was mixed with the extracted solution with a ratio of 1:1 and incubated for 30 min in the dark at room temperature. The absorbance at 510 nm was measured by a microplate reader (Varioskan LUX, ThermoScientific). The standard solution is Vitamin C (ascorbic acid), and the pure stock is used as a control sample. Cell-Materials Interaction Mouse fibroblast L929 cell line was cultured in Dulbecco’s Modified Eagle Media (DMEM, Gibco, USA), containing 10% fetal bovine serum (Gibco, USA) and 1% penicillin-streptomycin (Gibco, USA) with concentration of 0, 2.5, 5 and 10 mg extract powder per ml media to observe test the cytotoxicity of CJR extract on cells. All cells were harvested by brief incubation in 0.25% (w/v) trypsin-EDTA (Gibco, USA) for 3 min and centrifuged at 1300 rpm for 5 min. The supernatant was removed, and cell pellets were resuspended in cultured media. The effect of the extract on cell proliferation was investigated on L929 fibroblast cells. 7.2 × 104 cells were seeded into each well of

222

N. H. Bui et al.

the 24-well plate and incubated at 37 °C in media including the different concentrations of CJR extract. After 2 days, cells were detached from the cell culture plate by TrypsinEDTA. Afterward, the cell was mixed with Trypan Blue 0.4% (Life Technologies, USA) and the hemocytometer is used to examine the number of alive cells. The population doubling time (PDT) of cells treated with active saponins (1, 5, 10, 20, and 50 ng/mL). Preparation of Carbopol 934 Gel Loading CJR Extract (CaCJR). The whole process of loading codonopsis javanica extract in carbopol was illustrated on Fig. 1. Carbopol 934 was commercially purchased and 40% (w/v) of gel is prepared by dissolving in distilled water. The CJR extract solution in modified concentrations (2.5, 5, and 10 mg/ml) was loaded into the gel at a volume ratio of 1:1, then neutralized with NaOH to obtain a pH of approximately 6. The samples were abbreviated CaCJR 2.5, CaCJR 5, and CaCJR 10 to the CJR concentrations as shown in Table 1.

Fig. 1. Fabrication of CaCJR gel

Table 1. Sample preparation Sample name

CaCJR 2.5

CaCJR 5

CaCJR 10

Loading of CJR extract

Yes

Yes

Yes

Carbopol concentration (mg/ml)

20

20

20

CJR concentration (mg/ml)

2.5

5

10

In Vivo Studies of Carbopol 934 Gel Loaded with Optimal CJR Extraction (CaCJR) All animal experiments were carried out following the policy of the International University’s Institutional Animal Care and Use Committee, Vietnam National University

Investigation of Codonopsis Javanica Root Extract on Open Wound Model

223

in Ho Chi Minh City, Vietnam. Male Swiss albino mice from Pasteur Institute (Ho Chi Minh City, Vietnam), approximately 45–50 g in weight, were chosen for the in vivo study. A sterile 4mm diagnostic test punch was used to stipulate a circular pattern for the wound on the mouse’s plane at the shoulders. A serrate extractor was then used to lift the skin within the middle of the outline and iris scissors to make a full-thickness wound that extends through the hypodermic tissue, together with the panniculus carnosus, and excise the circular piece of tissue. Center the splint over the wound and anchor the splint with interrupted 3-0 nylon sutures to confirm positioning. The therapeutic compound to be tested (up to 100 µl) was applied to at least one wound and cover it with a Tegaderm transparent wound dressing (Nexcare 3M, USA). The process of wound healing was recorded daily with a digital camera. Histological evaluations of wound healing and material-tissue interaction were performed. The mice were sacrificed after 14 days, and the regenerated skin was removed and fixed in 10% formalin. The tissues were then fixative in a compound with the optimal cutting temperature. After staining with hematoxylin and eosin, the removed skins were cryo-sectioned (6 µm) and the histological alterations of tissue slices were assessed (H&E). An inverted microscope was used to observe the stained samples (Nikon Eclipse, Ti-U series, Japan).

3 Results and Discussion 3.1 Investigation of CJR Extract Condition Figure 2 depicted the various CJR extraction process parameters. According to the findings, increasing the solute-solvent ratio and extraction duration improved efficiency. As shown in Fig. 2a, the significant difference between the materials-solvent ratios of 1/30 and 1/20 was 31% and 21%, respectively. Nonetheless, the effects of the two EtOH concentrations on CJR extraction efficiency were not different in Fig. 2b. As per Fig. 2c, the extraction efficiency in an hour is approximately 32%, which is higher than the percentage in 30 min, which is 23%. As a result, the optimal extraction conditions were chosen as 1/30 solute-solvent in EtOH 70% for 60 min at 70 °C and preserved for future use in the investigative strategy. 3.2 In Vitro Studies Antioxidant Activity The DPPH radical scavenging activities were evaluated to assess antioxidant activity. The graph’s formula calculated IC50. The highest DPPH radical inhibition achieved was approximately 95% at 20 mg/ml. Nevertheless, the DPPH radical inhibition was saturated at concentrations greater than 10 mg/ml. Figure 3 showed that at 20 mg/ml, the highest DPPH radical inhibition reached nearly 95%. The IC50 was determined at a concentration of 0.9 mg/ml. The anti-inflammation properties of CJR extract can be improved due to its high antioxidant capacity. Furthermore, the presence of Inulin in the root of Codonopsis Javanica has been reported to induce anti-inflammation [15].

224

N. H. Bui et al.

Fig. 2. The efficiency of extraction by (a) Ratio of solute/solvent, (b) Ethanol concentration, and (c) Extraction time (** p < 0.01)

Fig. 3. Antioxidant activity of Codonopsis javanica root extract on DPPH

Investigation of Codonopsis Javanica Root Extract on Open Wound Model

225

Fig. 4. Scratch area after 48 h between treated and untreated group comparison

Cell Migration Assay Healthy cells usually migrate to another location, such as the scratch area, which is artificially created to measure the cell’s migration ability in the culture media. After 24 h, cells migrated significantly into a scratch area at concentrations of 2.5 and 5 mg/ml, but there was no difference between 10 mg/ml sample and the control, as shown in Figs. 4 and 5. The effected size area of groups 2.5, 5, 10 mg/ml and the control were approximately 11, 15, 24, and 26%, respectively. The wound area significantly reduced after 48 h at a concentration of 2.5 mg/ml compared to the others. The wound size area at concentration 5 mg/ml was about 7%, followed by group 10 mg/ml and control with 13 and 17%. Cell migration was improved in the presence of CJR extract, which reduces in order by increasing the extract dose. The result of the scratch assay also consolidates the proliferation assay. When cell monolayers are damaged or scratched, they respond by raising the concentration of growth factors and cytokines along the wound edge, thus, triggering the proliferation and migration of various cell types such as keratinocytes and fibroblasts [16]. The scratch area was dramatically reduced in order of decreasing concentration after being analyzed by Wimasis (Fig. 4). Cell Proliferation Assay The proliferation of cells was investigated in 4 groups as shown in Fig. 6. The result indicated the significance of the CJR extract group when compared to the control. The 2.5 mg/ml dose displayed the most giant counted cells compared to the other concentration and control. Specifically, the number of cells cultured in media with a concentration of 2.5 mg/ml was double that of the control. Compared to the initial number of seeded cells, cells cultured inside wells with the presence of CJR extract show significant proliferation. In particular, the number of cells in dosage of 2.5 mg/ml was increased more than sixfold, while in dosages of 5 mg/ml and 10 mg/ml as well as blank, the number was increased five times, four times, and three times respectively. As a results, the presence of

226

N. H. Bui et al.

Fig. 5. The wound size after 2 days (ns: not significant, ** p < 0.01, *** p < 0.001)

CJR extract, cells proliferate better. These phenomena can be explained by the presence of polysaccharides inside CJR. Inulin is a class of natural active polysaccharides found in Ginseng and Dangshen that are primarily employed in pharmaceutical and functional food preparations. The content of Inulin in Codonopsis Javanica is reported [17]. Inulin is built up of 2 ± 60 fructose units with one terminal glucose molecule [18]. The effect of fructose and glucose on cell growth was reported to promote fibroblast proliferation. 3.3 In Vivo Studies The control group is considered an untreated wound model. After 14 days, the wound closure in all four groups demonstrated partial wound healing. The scab appeared on day 1 in the CaCJR 2.5 and control groups, but it did not occur until day 2 in the CaCJR 5 and 10 groups. There was no significant change in wound size in the 4 groups in the first three days. On day 5, the wound began to heal in 3 treated groups. After two weeks, CaCJR 2.5 indicated outstanding re-epithelial ability compared to the other groups. CaCJR 5 also demonstrated promising potential in wound healing treatment, with a significant difference between the control and CaCJR 10 concentrations. This meant that wound closure was faster in the presence of CJR extract, but not in concentrations greater than 10 mg/ml due to cell toxicity. The wound gaps of the model treated with CaCJR 2.5 and 5 were narrowed, as shown in Fig. 7 at 4x magnification. It helped to effectively promote fibroblast growth, thereby hastening the healing process. However, at 10x magnification, the control model remained in the inflammation phase, with no regeneration of the epidermis layer; large scalps and inflammation cells were observed in the wound area. In Fig. 8, the mice

Investigation of Codonopsis Javanica Root Extract on Open Wound Model

227

Fig. 6. Proliferation of cells cultured in groups with different concentrations of CJR extract and control group (** p < 0.01, *** p < 0.001)

model treated with CaCJR 2.5 developed stratum corneum, which was considered in the late remodeling phase. In particular, the epidermis showed complete regeneration as thin as normal tissues in the wound area. Fat cells and blood vessels appeared as the cell arrangement established. Also, there was no discernible difference between the epidermis and dermis layers in the CaCJR 5-treated model. The wound area represents that the scalp was considerable, the cells were not thoroughly arranged, and a blood vessel formation. Besides that, the result of the model treated with CaCJR 10 contradicted the preceding because techniques can affect this sample when it is not cut in the middle of the wound. The effect on wound healing is inversely proportional to the concentration of CJR extract. This phenomenon could indicate an optimal CJR density; a CJR density above this limit could, in turn, inhibit cell normal behavior.

228

N. H. Bui et al.

Fig. 7. Representation images of the treated area of CaCJR gel and control from day 0 to day 14

Fig. 8. H&E staining images of the wound with no treatment and CaCJR gel treatments at 4x magnification

Investigation of Codonopsis Javanica Root Extract on Open Wound Model

229

4 Conclusion This study has extracted CJR in different conditions. It was discovered that the treated samples have excellent cytocompatibility and antioxidation properties. Nonetheless, an excessive amount of CJR reduced cell viability, and the extract solution did not affect antibacterial. Besides, the slow release of CaCJR gel, which is hydrogel formed by loading CJR into Carbopol 934, was also detected. The CJR concentration affected the re-epithelization and wound healing in mice, which expressed optimally at CaCJR sample with a concentration of 2.5 mg/ml was indicated as the optimal sample with a high potential for wound healing application. Hence, CJR extract and CaCJR gel could be investigated further for application as a gel to speed up wound healing. Acknowledgement. The authors would like to express their sincere gratitude to the School of Biomedical Engineering, International University, Vietnam National University, Ho Chi Minh City for the support and provision of equipment for this study.

Conflicts of Interest. The authors have no conflict of interest to declare.

References 1. Kruger, N.J.: Kruger-2009-The Bradford Method.pdf. Basic Protein and Peptide Protocols, pp. 17–24 (2009). https://doi.org/10.1385/0-89603-268-X:9 2. Krug, J.: Kinetic pattern formation at solid surfaces. In: Radons, G., Just, W., Häussler, P. (eds.) Collective Dynamics of Nonlinear and Disordered Systems, pp. 5–37. Springer, Heidelberg (2005). https://doi.org/10.1007/3-540-26869-3_2 3. Dubay, D.A., Franz, M.G.: Acute wound healing: the biology of acute wound failure. Surg. Clin. North Am. 83(3), 463–481 (2003). https://doi.org/10.1016/S0039-6109(02)00196-2 4. Published by Dove Press, IJN-119286-effects-of-carbopol-934-proportion-on-nanoemulsiongel-for-t, pp. 5971–5987 (2016). https://doi.org/10.2147/IJN.S119286 5. Maver, T., Maver, U., Kleinschek, K.S., Smrke, D.M., Kreft, S.: A review of herbal medicines in wound healing. Int. J. Dermatol. 54(7), 740–751 (2015). https://doi.org/10.1111/ijd.12766 6. Morris, K.E., Lammers, T.G.: Circumscription of Codonopsis and the allied genera Campanumoea and Leptocodon (Campanulaceae: Campanuloideae). I. Palynological data. Bot. Bull. Acad. Sin. 38(4), 277–284 (1997) 7. Pham, T.N., Nguyen, N.Q., Phan, M.P., Nguyen, T.T., Thanh, L.V., Phuong, T.T.M.: Study to evaluate the effectiveness and quality of products of the process of extracting Codonopsis javanica extract at pilot scale. IOP Conf. Ser. Mater. Sci. Eng. 1092(1), 012077 (2021). https:// doi.org/10.1088/1757-899x/1092/1/012077 8. Chong, E.J., et al.: Evaluation of electrospun PCL/gelatin nanofibrous scaffold for wound healing and layered dermal reconstitution. Acta Biomater. 3(3 SPEC. ISS.), 321–330 (2007). https://doi.org/10.1016/j.actbio.2007.01.002 9. Ahmed, E.M.: Hydrogel: preparation, characterization, and applications: a review. J. Adv. Res. 6(2), 105–121 (2015). https://doi.org/10.1016/j.jare.2013.07.006 10. Hamidi, M., Azadi, A., Rafiei, P.: Hydrogel nanoparticles in drug delivery. Adv. Drug Deliv. Rev. 60(15), 1638–1649 (2008). https://doi.org/10.1016/j.addr.2008.08.002 11. Panzade, P., Puranik, P.: Carbopol polymers: a versatile polymer for pharmaceutical applications. Res. J. Pharm. Technol. 3(3), 672–675 (2010)

230

N. H. Bui et al.

12. Phan, N.H.T., et al.: Polyacetylene and phenolic constituents from the roots of Codonopsis javanica. Nat. Prod. Res. 36(9), 2314–2320 (2020). https://doi.org/10.1080/14786419.2020. 1833200 13. Carmona, F., Pereira, A.M.S.: Herbal medicines: old and new concepts, truths and misunderstandings. Rev. Bras. Farmacogn. 23(2), 379–385 (2013). https://doi.org/10.1590/S0102-695 X2013005000018 14. Zhao, B., Zhao, W., Yuan, Z.: Optimization of extraction method for total saponins from Codonopsis lanceolata. Asian J. Tradit. Med. 7(1), 14–17 (2012) 15. Roberfroid, M.B.: Inulin-type fructans: functional food ingredients. J. Nutr. 137(11 Suppl), 2493S-2502S (2007). https://doi.org/10.1093/jn/137.11.2493S 16. Liang, C.C., Park, A.Y., Guan, J.L.: In vitro scratch assay: a convenient and inexpensive method for analysis of cell migration in vitro. Nat. Protoc. 2(2), 329–333 (2007). https://doi. org/10.1038/nprot.2007.30 17. Long, N.T.T., Boi, V.N., Cuong, D.X.: The content, purification degree, and molecular weight of Inulin of natural Dangshen roots (Codonopsis javanica) in Highland Lam Vien, Vietnam. J. Pharm. Res. Int. 32(24), 83–92 (2020). https://doi.org/10.9734/jpri/2020/v32i2430813 18. Meyer, D., Blaauwhoed, J.P.: Inulin. In: Handbook of Hydrocolloids, 2nd edn., pp. 829–848 (2009). https://doi.org/10.1533/9781845695873.829

Evaluation of Reactive Oxygen Species Production in Human Adipose Tissue-Derived Mesenchymal Stem Cells under High D-Glucose Condition Nhi Nguyen-yen Ha1,2 , Long Binh Vong2 , and Thuy Nhu Trinh2(B) 1 Faculty of Biology and Biotechnology, University of ScienceVietnam National University -

Ho Chi Minh City (VNU-HCMC), Ho Chi Minh City (HCMC) 700000, Vietnam 2 School of Biomedical Engineering, International UniversityVietnam National University -

Ho Chi Minh City (VNU-HCMC), Ho Chi Minh City (HCMC) 700000, Vietnam [email protected]

Abstract. Type 2 diabetes mellitus (T2DM) is viewed as a serious medical condition due to its microvascular and macrovascular complications, which are characterized by insulin resistance (IR). Reactive oxygen species (ROS) are considered to be the factor that provokes insulin resistance in T2DM. To examine the pathological mechanism of T2DM, AT-MSCs have been used to establish a disease model mimicking insulin resistance using high D-glucose. SM@siRNP has also been employed to investigate the ROS reduction effect on D-glucose-treated AT-MSCs. The expression of insulin resistance-related genes and EGR-1 protein were analyzed by reverse transcription-quantitative polymerase chain reaction (RT-qPCR). The ROS release was identified by DCFH-DA assay. The results demonstrated that high D-glucose (100 mM) has significantly increased the expression of insulin resistance-related genes (EGR-1, PTEN, GGPS-1) (p < 0.01), as well as the production of intracellular ROS (p > 0.001), compared to the non-treated group. SM@siRNP has been shown to decrease ROS production by antioxidant capacity and anti-inflammatory efficacy (p < 0.01). However, to confirm the effect of SM@siRNP on improving insulin sensitivity in AT-MSCs, the expression of those insulin resistance-related genes after medication treatment must be identified. In this study, the results provided an aspect of insulin resistance pathological mechanism which can be applied for further research on T2DM treatment, as well as an in vitro model for pre-clinical drug screening that can be used instead of an in vivo model. Keywords: Type 2 Diabetes · AT-MSCs · High D-Glucose Concentration · Reactive Oxygen Species · EGR-1 · PTEN · GGPS-1

1 Introduction In recent years, most insulin resistance or T2DM models have been established in animals, especially mice or rats. T2DM animal models can be as complex and heterogeneous as the human condition [1]. However, several limitations and challenges are associated © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. T. Vo et al. (Eds.): BME 2022, IFMPE Proceedings 95, pp. 231–240, 2024. https://doi.org/10.1007/978-3-031-44630-6_18

232

N. N. Ha et al.

with using animal models in research. The repetition rates in animal models are generally low due to difficulties in dietary control as well as rising conditions. The number of animals employed in research is enormous, which may result in significant financial costs. Moreover, in many countries, pathogenicity in animals is still controversial in terms of medical ethics. Thus, diseased stem cell lines were ideal materials for pre-clinical drug screening. Stem cells are widely employed because they are the origin of life, and changes in stem cells can result in changes in many other specialized cell types. Besides the expensive commercial cell lines that can cost up to 4000 dollars [2, 3], stem cells that were extracted directly from patients were frequently used in research. However, the pathophysiology of each patient has a significant impact on the characteristics of stem cells. As a result, developing disease models utilizing stem cells derived from healthy donors will improve the resolution of this problem. Mesenchymal stem cells (MSCs), or mesenchymal stromal cells, are adult stem cells with significant potential in tissue engineering and regenerative medicine due to their special characteristics such as self-renewal, differentiation [4, 5]. Several clinical studies have shown that stem cell therapy using mesenchymal stem cells (MSCs) is promising in the treatment of type 2 diabetes due to their prodigious properties, including the ability to promote insulin production and improve insulin resistance [6]. Eventually, based on the diversity and simple accessibility, adipose tissue mesenchymal stem cells (ATMSCs) are thought to be a better source of polyclonal mesenchymal stem cells to stimulate a model for type 2 diabetes and for stem cell therapy in the treatment of type 2 diabetes. On the other hand, the overproduction of reactive oxygen species (ROS) is the key to insulin resistance in T2DM. High glucose concentration has been linked to oxidative stress, which is defined as an imbalance in the synthesis of reactive oxygen species (ROS) and antioxidants [7–10]. In the project, the effect of high D-glucose concentration on ROS generation in AT-MSCs has been identified to simulate insulin resistance in vitro model. Moreover, medications such as metformin [11] which is a commercial diabetic drug, and nano silymarin complex, which is an antioxidant encapsulated in nanoparticles [12], were also investigated for their ability to reduce high D-glucose-induced ROS in this model.

2 Materials and Methods 2.1 Materials Human adipose tissue-derived mesenchymal stem cells (AT-MSCs) were isolated in the Laboratory of Regenerative Medicine and Stem Cell Biology, University of Tsukuba, Japan [13, 14]. AT-MSCs, after isolation, were sub-cultured 2 to 3 times to increase cell mass. Then, the cell line is tested for stem cell markers and purified using fluorescenceactivated cell sorting (FACs). Silymarin-loaded silica redox nanoparticles (SM@siRNP) used in this project were provided by the research team of Dr. Vong Binh Long. Silica-containing silica redox copolymer (PEG-b-siPMNT) was used to prepare siRNP according to the previous study [12]. Silymarin was encapsulated into the siRNP using a semi-permeable membrane tube by dialysis method. After 24 h of dialysis, silymarin-loaded silica redox nanoparticles (SM@siRNP) were collected and stored at 2–4 °C for further experiments.

Evaluation of Reactive Oxygen Species Production

233

2.2 Methods Stem Cell Culture Adipose tissue-derived mesenchymal stem cells (AT-MSCs) were cultured in IMDM, supplemented with 10% FBS, 1% antibiotics, and 5 ng/ml basic fibroblast growth factor (bFGF) at 37 °C, 5% CO2, and 98% humidity. All AT-MSCs that were used in this study were in passage 9 to 12. The Supplement of High D-Glucose and Medications During AT-MSCs Culture AT-MSCs were seeded plate and were incubated at 37 °C, with 5% CO2 , 98% humidity for at least 24 h to let them stable. High D-glucose (100 mM) was supplemented to the culture medium for 3 days to induce insulin resistance genes. After that, IR ATMSCs can be cryopreserved for further experiments, or RNA can be extracted to test for insulin resistance-related genes. High d-glucose and medications such as metformin and SM@siRNP are treated at the same time within 3 days. Quantitative Reverse Transcriptase Polymerase Chain Reaction (qRT-PCR) RNA was isolated on day 3 after treatment using Sepasol-RNA I Super G. Total RNA was firstly reversely transcribed by reverse transcriptase polymerase chain reaction (RTPCR) kit. Complementary DNA (cDNA) was used to examine the expression of EGR-1, PTEN, and GGPS-1 by real-time PCR (q-PCR) with Maxima SYBR Green/ROX qPCR Master Mix (2X) kit and reacted in LightCycler 96 System. Targeted genes were then analyzed by the 2−Ct method. β-actin gene was used as an internal control for the test. The users used for PCR reactions are shown in Table 1. Table 1. The primers used for quantitative polymerase chain reaction. Function

Gene

Primer

Sequence

Internal control

β-actin

5’-primer

GTGCGTGACATTAAGGAGAAGCTGTGC

3’-primer

GTACTTGCGCTCAGGAGGAGCAATGAT

5’-primer

AGTCTTTTCCTGACA TCTCTCTGAA

3’-primer

ACTAGGCCACTGACCAAGCTGAA

5’-primer

CTGGTAGGCGATGTCCTTA

5’-primer

TTGGCGGTGTCATAATGTCT

Transcription factors

EGR-1

Mediator of insulin PTEN resistance GGPS-1

3’-primer

GCAGAA AGACTTGAAGGCGTA

5’-primer

ACTGTTTGGATTAGCAGTAGGTCTC

3’-primer

GGAGTGTAGATTAGCATAATCATCC

DCFH-DA Assay 2’-7’dichlorofluorescin diacetate (DCFH-DA) is a fluorogenic dye that measures ROS activity. Cells were seeded in a 24-well-plate and treated with high D-glucose (100 mM)

234

N. N. Ha et al.

and medications (50 μM) at the same time. Three days after treatment, insulin (1000 nM) was supplemented to a D-glucose-treated sample and incubated at 37 °C, 5% CO2 for 3 h. H2O2 (2 mM) diluting in serum-free medium was added to the positive control sample and incubated for 90 min. After that, DCFH-DA (40 μM) was added and incubated for 30 min. Pictures were taken using a fluorescence microscope (Nikon eclipse Ni fluorescence microscope processed by NIS Elements (BR)), blue filter, and exposed under visible light for 3–5 s. The signal was measured at spectra of 495 nm and 535 nm for excitation and emission, respectively. DPPH Assay Antioxidant activity of SM@siRNP, silymarin and metformin was determined by DPPH free radical scavenging method by the mechanism in which antioxidants reduce the violet color of DPPH to yellow-colored products. Samples including SM@siRNP, silymarin, metformin, and vitamin C were diluted to 25 μM and 50 μM. Distilled water and DMSO 50% were used as a negative control since SM@siRNP, metformin, and vitamin C are soluble in distilled water, and silymarin is soluble in DMSO. All solutions were loaded to 96-well-plate as described below (Fig. 18) with the same volume of 150 μL. Next, 50 μL of 2,2-diphenyl-1-picrylhydrazyl (DPPH) (40 μg/mL) is added to sample-loaded wells and mixed well. The plate was incubated in a dark place for 30 min so reagents could react. After incubation, the plate was measured absorbance at 540 nm using a microplate reader. Statistical Analysis Significant differences among various groups were performed using student’s t-test and one-way analysis of variance (ANOVA) (Tukey post-hoc test; SPSS 20 software, IBM Corp.). The experiments in the research were repeated at least 3 times, P < 0.05 value was considered as a statistically significant difference. Data were presented as the mean ± standard deviation (SD).

3 Results and Discussion 3.1 The Effect of High D-Glucose Concentration on the Expression of Insulin Resistance-Related Genes Insulin resistance can be regulated by the expression level of EGR-1, PTEN, and GGPS-1 [15–18]. This project examined the effect of high D-glucose concentration at 100 mM on the expression of those genes. AT-MSCs were cultured in a medium containing 100 mM of D-glucose for 3 days. Insulin was added on day 3 to stimulate insulin resistance in AT-MSCs. The qPCR result showed that the expression of EGR-1, PTEN, and GGPS-1 was increased significantly in the high D-glucose-treated group (Fig. 1A). In fact, EGR-1 expression was upregulated in the high D-glucose treated group compared to that of the control (1.76-fold increase, P < 0.01, n = 3). Following that, the gene expression level of PTEN and GGPS-1 also increased 1.48-fold (P < 0.01, n = 3) and 1.51-fold (P < 0.05, n = 3), respectively, compared to the control. In addition, the expression of housekeeping gene- β-actin in different groups was expressed equally, which was presented via gel electrophoresis result, the amplification curve, and the melt curve results (Fig. 1B, C).

Evaluation of Reactive Oxygen Species Production

235

This indicated that the amount of cDNA in samples was the same. Thus, this resulted in the decrease of the insulin signal from the insulin receptors substrate in AT-MSCs. The results indicated that high D-glucose concentration at 100 mM upregulated the expression of EGR-1, PTEN, and GGPS-1, which might result in insulin resistance.

Ctrl

M

PTEN

Relative mRNA expression

Relative mRNA expression

EGR-1

D-glucose

Ctrl

Relative mRNA expression

A

D-glucose

GGPS-1 *: p< 0.05 **: p< 0.01 n =3

Ctrl

D-glucose

D-glucose

-actin

B

C

Fig. 1. A. The expression of insulin-related genes EGR-1, PTEN, and GGPS-1 was increased under high D-glucose conditions in AT-MSC. mRNA expression was examined by qRT-PCR with β-actin as an internal control. The data represent the mean ± SD, * < 0.05, ** < 0.01, n = 3. Ctrl: control, D-glucose: D-glucose treated at 100 mM. B. Agarose gel electrophoresis of β-actin. C. The amplification curves and the melt curves of β-actin.

3.2 High D-Glucose Concentration Promotes ROS Production in nAT-MSCs To examine the effect of high D-glucose concentration on ROS release, DCFH-DA was added to the cell medium, oxidized by ROS in cells, and then turned into a greenfluorescent compound. Pictures were taken by Nikon fluorescent inverted microscope processed by NIS element BR, and a microplate reader measured the fluorescent signal. The more green dots were presented in the images, the more ROS was generated. There are few green spots in the control group, whereas many green spots appeared in the H2O2 treated group, which means ROS was over-produced under the effect of H2O2. ROS were also detected in the D-glucose treated group, showing that high D-glucose concentrations of 100 mM generated intracellular ROS in AT-MSCs (Fig. 2). Statistical results showed that AT-MSCs cultured in high D-glucose (100 mM) had a significant increase in ROS production. When compared to a non-treated group, the intracellular ROS generation increased by about 2.5-fold (p < 0.001, n = 3) in the D-glucose treated

236

N. N. Ha et al.

group (p < 0.001, n = 3, Fig. 3). This indicated that high D-glucose concentration at 100 mM promoted ROS production in AT-MSCs. Moreover, the previous results showed that high D-glucose promoted the expression of insulin resistance-related genes in AT-MSCs, revealing that ROS overproduction can be involved in insulin resistance. Following that, some antioxidants can be tested for reducing high D-glucose-induced ROS release.

H2 O2

Ctrl

D-glucose

200 µm

Fig. 2. ROS release in AT-MSCs detected by DCFH-DA assay; Ctrl: control, non-treated ATMSCs; H2O2 treated as positive control; D-glucose treated at 100 mM. Scale bar is at 200 μm.

Fig. 3. Histograms for the statistical analysis of DCFH-DA positivity of nAT-MSCs group; data represent the mean ± SD, *** < 0.001, n = 3.

3.3 Silymarin Encapsulated Silica Redox Nanoparticles (SM@siRNP) and Its Antioxidant Although SM@siRNP has been proven to have better antioxidant activity than silymarin does [12]. However, the comparison between SM@siRNP, silymarin, and metformin,

Evaluation of Reactive Oxygen Species Production

237

which is a diabetic drug, has not been mentioned. In this project, compared to metformin, a DPPH assay was used to determine the antioxidant activity of SM@siRNP and silymarin. Vitamin C (ascorbic acid) was used as the control for the test since it is a strong antioxidant [19]. Silymarin, SM@siRNP, and metformin were tested at the concentration of 25 μM and 50 μM, based on the optimal concentration of metformin used in diabetic treatment, which is 50 μM. Except for the metformin group, the antioxidant activity of all groups was accelerated as their concentrations. Both silymarin and SM@siRNP showed better radical scavenging ability than metformin. Moreover, at 25 μM and 50 μM, the antioxidant activity of SM@siRNP was significantly higher than that of silymarin (Fig. 4). The results indicated that SM@siRNP could be used for reducing high D-glucose induced-ROS production in AT-MSCs. On the other hand, metformin, an antidiabetic medication that showed poor antioxidant activity, should be further tested on ROS reduction to clarify the link between ROS generation and insulin resistance.

% Inhibition

DPPH RADICAL SCAVENGING ASSAY

Concentration ( M) Fig. 4. Antioxidant activity of silymarin, SM@siRNP, and metformin determined by DPPH assay. Vitamin C (ascorbic acid) is used as a control for the test, n = 3.

3.4 SM@siRNP and Metformin Inhibited High D-Glucose Induced-ROS Production in nAT-MSCs Because high D-glucose concentration promoted ROS generation in AT-MSCs, medications have been applied to reduce ROS, including SM@siRNP, which has previously been demonstrated to be a strong antioxidant, and metformin, a commercial diabetic drug. High D-glucose (100 mM), metformin (50 μM), and SM@siRNP (50 μM) were supplemented at the same time to investigate the effect of those medications during the progress of ROS generation. The results indicated that the treatment groups showed a significant decrease in ROS production (Fig. 5). When compared to the D-glucose treated group, the intracellular ROS generation decreased by about 2.3-fold (p < 0.001, n = 3) in the metformin-treated group and about 1.67-fold (p < 0.001, n = 3) in the SM@siRNP

238

N. N. Ha et al.

treated group (Fig. 6). The results showed that metformin not only suppressed insulin resistance but also reduced ROS production, indicating that high D-glucose-induced ROS release is related to insulin resistance. Interestingly, there was no remarkable difference in ROS reduction between the two groups of treatment, SM@siRNP, and metformin, which indicates that SM@siRNP is a potential medication for insulin resistance in T2DM besides metformin. Although metformin has shown a poor antioxidant capacity (Fig. 4), it also has the ability to reduce ROS (Fig. 5). This can be explained by the fact that metformin decreased intracellular ROS levels by promoting Trx expression via the AMPK-FOXO3 pathway involved with the antioxidative glutathione system [20]. Ctrl

D-glucose

D-glucose + Met

D-glucose + SM@siRNP

Fig. 5. ROS release in treatment group detected by DCFH-DA assay; Ctrl: control, non-treated AT-MSCs; D-glucose treated at 100 mM; Metformin and SM@siRNP treated at 50 μM. Scale bar is at 200 μm.

Evaluation of Reactive Oxygen Species Production

239

Fig. 6. Histograms for the statistical analysis of DCFH-DA positivity of treatment groups; data represent the mean ± SD, *** < 0.001, n = 3.

4 Conclusion In summary, high D-glucose concentration at 100 mM induced insulin resistance-related genes EGR-1, PTEN, and GGPS-1, which can lead to insulin resistance in nAT-MSCs. Besides, ROS production was also increased significantly under high D-glucose concentration without the alteration in morphology and inhibition in proliferation. Metformin and SM@siRNP have been shown to reduce ROS generation by different mechanisms. These results suggest a potential treatment of insulin resistance through the mechanism of reducing ROS, as well as point out the possibility of mimicking hyperglycemia on stem cells for simulating in vitro disease models for drug screening. Acknowledgement. This research is funded by Vietnam National University Ho Chi Minh City (VNU-HCM) under grant number C2021-28-02. We thank Professor Osamu Ohneda for providing stem cells and Biotechnology Center for supporting some research materials and equipment.

Conflict of Interest. No conflict of interest regarding the publication of this paper.

References 1. Rees, D.A., Alcolado, J.C.: Animal models of diabetes mellitus. Diabet. Med. 22(4), 359–370 (2005). https://doi.org/10.1111/J.1464-5491.2005.01499.X 2. Human iPS Cell Line (Type 2 Diabetes) - iXCells Biotechnologies. https://www.ixcellsbi otech.com/ipsc-derived-cells/human-ips-cell-line-type-2-diabetes. Accessed 4 Sept 2021 3. Okita, K., et al.: A more efficient method to generate integration-free human iPS cells. Nat. Methods 8(5), 409–412 (2011). https://doi.org/10.1038/NMETH.1591 4. Mosna, F., Sensebé, L., Krampera, M.: Human bone marrow and adipose tissue mesenchymal stem cells: a user’s guide. Stem Cells Dev. 19(10), 1449–1470 (2010). https://doi.org/10.1089/ SCD.2010.0140 5. Ding, D.-C., Shyu, W.-C., Lin, S.-Z.: Mesenchymal stem cells. Cell Transplant. 20(1), 5–14 (2011). https://doi.org/10.3727/096368910X

240

N. N. Ha et al.

6. Qi, Y., Ma, J., Li, S., Liu, W.: Applicability of adipose-derived mesenchymal stem cells in treatment of patients with type 2 diabetes. Stem Cell Res. Ther. 10(1), 1–13 (2019). https:// doi.org/10.1186/s13287-019-1362-2 7. Gs, H.: Endoplasmic reticulum stress and the inflammatory basis of metabolic disease. Cell 140(6), 900–917 (2010). https://doi.org/10.1016/J.CELL.2010.02.034 8. Skliros, N.P., Vlachopoulos, C., Tousoulis, D.: Treatment of diabetes: crossing to the other side. Hell. J. Cardiol. 57(5), 304–310 (2016). https://doi.org/10.1016/J.HJC.2016.07.002 9. Rains, J.L., Jain, S.K.: Oxidative stress, insulin signaling, and diabetes. Free Radic. Biol. Med. 50(5), 567–575 (2011). https://doi.org/10.1016/J.FREERADBIOMED.2010.12.006 10. Tiganis, T.: Reactive oxygen species and insulin resistance: the good, the bad and the ugly. Trends Pharmacol. Sci. 32(2), 82–89 (2011). https://doi.org/10.1016/J.TIPS.2010.11.006 11. Nathan, D.M., et al.: Impaired fasting glucose and impaired glucose tolerance: Implications for care. Diab. Care30(3), 753–759 (2007) 12. Nguyen, T.H.T., et al.: Improving silymarin oral bioavailability using silica-installed redox nanoparticle to suppress inflammatory bowel disease. J. Control. Release 331, 515–524 (2021). https://doi.org/10.1016/J.JCONREL.2020.10.042 13. Trinh, N.T., et al.: Microvesicles enhance the mobility of human diabetic adipose tissuederived mesenchymal stem cells in vitro and improve wound healing in vivo. Biochem. Biophys. Res. Commun. 473(4), 1111–1118 (2016). https://doi.org/10.1016/J.BBRC.2016. 04.025 14. Trinh, N.-T., et al.: Increased expression of EGR-1 in diabetic human adipose tissue-derived mesenchymal stem cells reduces their wound healing capacity. Stem Cells Dev. 25, 760–773 (2016) 15. Josefsen, K., Sørensen, L.R., Buschard, K., Birkenbach, M.: Glucose induces early growth response gene (Egr-1) expression in pancreatic beta cells. Diabetologia 42(2), 195–203 (1999). https://doi.org/10.1007/S001250051139 16. Rosivatz, E.: Inhibiting PTEN. Biochem. Soc. Trans. 35(2), 257–259 (2007). https://doi.org/ 10.1042/BST0350257 17. Gupta, A., Dey, C.S.: PTEN, a widely known negative regulator of insulin/PI3K signaling, positively regulates neuronal insulin resistance. Mol. Biol. Cell 23(19), 3882 (2012). https:// doi.org/10.1091/MBC.E12-05-0337 18. Liang, N., Kitts, D.D.: Antioxidant property of coffee components: assessment of methods that define mechanism of action. Molecules 19(11), 19180–19208 (2014). https://doi.org/10. 3390/MOLECULES191119180 19. Hou, X., et al.: Metformin reduces intracellular reactive oxygen species levels by upregulating expression of the antioxidant thioredoxin via the AMPK-FOXO3 pathway. Biochem. Biophys. Res. Commun. 396(2), 199–205 (2010). https://doi.org/10.1016/J.BBRC.2010.04.017

The Effect of 10% Platelet-Rich Plasma on In-Vitro Wound Healing Ability of Adipose Tissue-Derived Mesenchymal Stem Cells Under High D-Glucose Conditions Chau Ngoc-Minh Trinh1 , Nhi Nguyen-yen Ha1 , Long Binh Vong1 , My Ngoc-hoang Nguyen1 , Thuy Nhu Trinh1(B) , and Tho Thi-kieu Nguyen2,3(B) 1 School of Biomedical Engineering, International University, Vietnam National University-Ho

Chi Minh City (VNU-HCMC), Ho Chi Minh City 700000, Vietnam [email protected] 2 Department of Otolaryngology, University of Medicine and Pharmacy at Ho Chi Minh City, Ho Chi Minh City 700000, Vietnam [email protected] 3 Department of Plastic and Reconstructive Surgery, University of Medicine and Pharmacy at Ho Chi Minh City, Ho Chi Minh City 700000, Vietnam

Abstract. Diabetic patients display increased risk of diabetic foot ulcer and chronic wound, mainly caused by the persistence of hyperglycemia. Adipose tissue-derived mesenchymal stem cells (AT-MSCs) and platelet rich plasma (PRP) have shown relevant advantages for wound healing by their ability to stimulate cell proliferation, migration, secrete growth factors and cytokines to accelerate the resolution of wound. In this study, we investigated the effect of PRP on the proliferation and wound healing in-vitro of AT-MSCs under high D-glucose conditions. PRP was activated by Thrombin and Calcium chloride. The cell proliferation was determined by MTT (3-[4,5-dimethylthiazol-2-yl]-2,5 diphenyl tetrazolium bromide) assay for 10 days. In-vitro scratch assay was used to examine the healing ability of AT-MSCs under the influence of high D-glucose concentrations. The results show that the doubling time of AT-MSCs cultured with PRP was significantly higher than those with FBS. Moreover, the wound healing ability in-vitro was induced significantly in PRP-treated AT-MSCs under high D-glucose conditions. Our research demonstrates the potential of PRP on the inducing woundhealing capacity of AT-MSCs under the impact of high D-glucose levels. This work gives a better knowledge of the influence of PRP on the activities of ATMSCs under high D-glucose conditions for future applications of AT-MSCs in the treatment of diabetes complications. Keywords: Diabetes · Human Mesenchymal Stem Cells · Platelet-Rich Plasma · High D-Glucose Concentrations · Wound Healing

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. T. Vo et al. (Eds.): BME 2022, IFMPE Proceedings 95, pp. 241–250, 2024. https://doi.org/10.1007/978-3-031-44630-6_19

242

C. N.-M. Trinh et al.

1 Introduction Diabetes is a serious, long-lasting disease that affects the lives and well-being of people, families, and communities all over the world [1]. Roughly 500 million people worldwide were affected by diabetes in 2019, and this number is estimated to increase by 10% by 2045. Diabetes affects the entire body and all wound sites as well. When your body suffers from diabetes, insulin is rarely produced or resisted by the body, so too much glucose is kept in the bloodstream without function. Elevated systemic glucose levels are the root cause of hyperglycemia. When hyperglycemia persists, it impairs the function of the vascular endothelium, which lowers oxygen delivery and restricts nutritional supplementation, delaying the wound healing process [2]. In-vivo and in-vitro research into diabetes are essential for understanding the disease’s pathology and pathophysiology, which are required for the development of more effective treatment alternatives [3]. In recent years, in-vitro studies have made it possible for scientists to look at multiple precise experimental settings at the same time using fewer resources than animal experiments. For disease research, cell lines, islets, human stem cells, and organoids serve as models for diabetes. Among these, the mesenchymal stem cell (MSC)-based model is highly regarded due to the fact that MSCs are a renewable source of target cells, genetically modified, and able to provide a suitable environment for the wound healing process [4]. MSCs are the origin of human life. They play a key role in regulating wound healing because of their ability to control cellular differentiation, immunological modulation, growth factor release, and angiogenesis [5]. Compared to other types of stem cells, adipose tissue-derived mesenchymal stem cells (AT-MSCs) have specific advantages and fewer limitations: they are abundant and easily harvested through a minimally invasive procedure; they are associated with fewer ethical concerns, and they have a lower risk of the host immune response [6]. In previous preclinical studies, AT-MSC treatment promoted wound healing in diabetic animal models. AT-MSCs work at the wound site by releasing growth factors, increasing the activity of existing cells at the wound site, and changing into different types of cells. Nonetheless, many studies demonstrate that AT-MSC function is impaired under conditions of high glucose. In a flap animal model and an in-vitro wound healing model [7, 8], Trinh T-T et al. (2016) found that diabetes AT-MSCs (dAT-MSCs) exhibited a lower capacity to repair wounds compared to nondiabetic AT-MSCs (nAT-MSCs). In 2010, “Camer et al.” reported that the proliferative ability of dAT-MSCs was lower than that of nAT-MSCs at high D-glucose concentrations (500 and 100 mg/dL) [9]. Yet, until 2017, Y. Li et al. showed that at 25 mM glucose concentration, the proliferation of primary MSCs was enhanced at under concentration of D-glucose levels [10]. For enhancing the efficacy of AT-MSCs in wound healing under a high D-glucose environment, the autologous cellular treatments comprising platelet-rich plasma and MSC applications are offered as a more potential routine wound care therapy method for patients with chronic and refractory wounds. Fetal Bovine serum is widely used as a supplement to the standard stem cell in-vitro model by their ability to promote proliferation and matrix synthesis. However, the potential risk of bovine pathogens in FBS serum limits its use in clinical applications. An alternative for FBS is, therefore, urgently needed. Platelet-rich plasma (PRP) is a valuable source to replace FBS by

The Effect of 10% Platelet-Rich Plasma on In-Vitro Wound Healing Ability

243

their potential to promote wound healing, blood vessel reduction, and soft and hard tissue regeneration [11, 12]. PRP is an enhanced blood fraction containing platelets at a concentration higher than that in circulating blood [9]. With plasma products containing high levels of platelets, they have the potential to have an effect on wound healing and promotion, blood vessel reduction, and soft and hard tissue regeneration [11, 12]. When platelets in PRP are activated, they release granules containing growth factors and regulatory proteins such as PDGF, EGF, IGFs, TGF-, VEGF, and others [9, 11, 12] that aid in cell proliferation, migration, and differentiation. To date, there has been relatively little study on the combination of AT-MSCs with PRP for the therapy of wound healing under the effect of high D-glucose. Previous studies reported at 10% PRP and AT-MSCs together [13, 14], which showed that the AT-MSCs’ ability to migrate and multiply was significantly increased. Because of this, we decided to compare the efficacy of serum FBS with that of supplementation of PRP since the risk of infection from animal origin makes it less useful as a therapy. As the effect of low to high D-glucose concentrations on AT-MSCs is still unknown, this work investigates the effect of 10% PRP on the proliferation and in-vitro wound healing of AT-MSCs under 3 concentrations of D-glucose (25, 50, and 100 mM).

2 Materials and Methods Stem Cell Culture AT-MSCs (AT-MSCs) are provided by the Laboratory of Regenerative Medicine and Stem Cell Biology, University of Tsukuba, Japan. These cells were characterized in the previous report [6]. Briefly, AT-MSCs were cultured in Iscove’s modified Dulbecco’s medium (Thermo, USA), with 10% fetal bovine serum (Thermo, USA), 1% antibiotics (Sigma, USA) and 5 ng/ml basic fibroblast growth factor (bFGF, Sigma, USA) at 37 °C and 5% CO2. The medium will be renewed every 3 days. Cells are frozen with cell banker solution (Sigma, USA) and preserved in liquid nitrogen for further experiments. The AT-MSCs in passages 5 and 9 were used for the experiments. Preparation of Activated PRP PRP, PPP (Platelet-poor plasma) and thrombin were provided from Miracle Plastic Surgery by the following procedure. Activated PRP was obtained using the method given by Natsuko. K from the Department of Plastic and Reconstructive Surgery, Kansai Medical University, Japan [19]. As an activator, a 1:1 (v/v) combination of 0.5 M CaCl2 and autologous thrombin was produced in advance. At room temperature, a 10:1 (v/v) combination of PRP and activator was centrifuged at 90 g and then 9000 g for 10 min each. The supernatant was filtered through a 0.22-m membrane and labeled as PRP-2 and PPP-2. Keep at −80 °C laboratory freezer until use. Cell Proliferation by MTT Assay AT-MSCs were seeded in IMDM medium with 10% FBS; after 24 h, the media was removed, and the cells were cultured in IMDM medium with 10% FBS (control), 10% PRP-1, 10% PPP-1, 10% PRP-2, and 10% PPP-2. The cell culture medium was replaced every three days. Five days following supplementation with PRP and PPP, the proliferation of AT-MSCs will be evaluated using an MTT (3-[4,5-dimethylthiazol-2-yl]-2,5

244

C. N.-M. Trinh et al.

diphenyl tetrazolium bromide) test. After 3, 6, 9 and 12 days of culture, all the medium was removed and added 50 µL of MTT reagent for each well. The plate was kept away from light and incubated for 4 h in incubator 37 °C, 5% CO2. After incubation, cells were treated with 100 µL DMSO solvent in each well for 15 min at room temperature. Absorbance was measured at OD = 540 nm. In-Vitro Scratch Assay Briefly, AT-MSCs were cultured on 24-well plates with a density of 5 × 104 cells/well and cultured in IMDM medium with 10% FBS. When cells had reached confluent monolayers (higher than 90%), aspirated 3 ml culture medium in each well then transferred into an eppendorf. Used a 1000 µL pipette tip (width 1 mm) to create on the surface of the culture. Gently shake the plate, then use the pipette to remove all the remaining medium in each well. Add 3 mL of media that has been aspirated into the eppendorf in the previous step and gently shake the plate to remove all the cell pieces. Add IMDM medium with 10% FBS (control), 10% PRP-1, 10% PPP-1, 10% PRP-2, and 10% PPP-2 into each well. Images of wound areas were recorded by inverted microscope and analyzed by Wimasis software (https://mywim.wimasis.com) at 0 h and after 24 h. Data are presented with the average of three measurements from wound areas. Statistical Analysis The significant differences among many test groups have been used to identify oneway ANOVA (Tukey post-hoc test; SPSS 20 software, IBM Corp.). P < 0.05 value is statistical significance. The data indicated the mean of the three independent experiments (mean ± SD).

3 Results and Discussion 3.1 Activated PRP by Calcium Chloride and Autologous Thrombin Activated PRP and PPP were obtained using the method given by Natsuko.K (Fig. 1). The interaction of CaCl2 and thrombin produces fibrin that is rich in platelets. CaCl2 inhibits citrate, allowing plasma to coagulate, while thrombin polymerizes fibrin, resulting in a coagulated gel. After the first centrifugation, the coagulates as a result of the fibrin polymerization process. At the second high-speed centrifugation, the fibrin fibers were completely removed from the plasma and the platelet was degranulated inside the soft gel to release growth factors. Finally, the plasma was filtered with 0.22 µm cell strainer to eliminate the gel formation and collect the growth factors-containing plasma. 3.2 The effect of 10% PRP on Cell Viability of AT-MSCs Under High D-Glucose Levels Platelet-Rich Plasma (PRP) is an autologous platelet plasma that includes many growth factors to accelerate wound healing and recovery after surgical repair. Hence, we evaluated the impact of 10% PRP to assess the influence of autologous platelet plasma on the growth of AT-MSCs in different high D-glucose levels (25 mM, 50 mM, 100 mM).

The Effect of 10% Platelet-Rich Plasma on In-Vitro Wound Healing Ability

245

Fig. 1. Preparation of activated PRP and PPP from the whole blood procedure. Activated PRP and PPP were obtained in Plastic Surgery following the procedure described in the methodology section (Fig. 1 a–e). Collect thrombin without anticoagulant from whole blood (Fig. 1f). PRP (Fig. 1g) and PPP (Fig. 1h) were activated by the addition of 0.5 M CaCl2 and thrombin in a ratio of 1:1 (v/v). After 10 min of activation, the gel was formed in PRP (Fig. 1i) and PPP (Fig. 1k).

Fig. 2. AT-MSCs proliferation under the impact of high D-glucose concentrations. Growth curve of AT-MSC under high D-glucose levels cultured with 0 mM D-glucose (A), 25 mM D-glucose (B), 50 mM D-glucose (C), 100 mM D-glucose (D). Cell viability graph of AT-MSCs in different groups after 12 days of culture (C). A number of cells were determined every 72 h by using MTT reagent for 12 days after D-glucose supplementation. Results are expressed as % of the control: AT-MSCs cultured with 10% FBS at day 03 as 100%. Data indicated the average values of three independent experiments (mean ± SD), **, P < 0.01.

246

C. N.-M. Trinh et al.

Fig. 3. Growth curve of AT-MSC under high D-glucose levels. AT-MSC cultured with 10% FBS and 10% PRP in control group (A) and various D-glucose concentrations: 25 mM (B), 50 mM (C) and 100 mM (D). A number of cells were determined every 72 h by using MTT reagent for 12 days after D-glucose supplementation. Results are expressed as % of the control: AT-MSCs cultured with 10% FBS at day 03 as 100%. Data indicated the average values of three independent experiments (mean ± SD), **, P < 0.01.

Cell proliferation of AT-MSCs cultured with 10% PRP was monitored for 12 days after D-glucose supplementation and compared with AT-MSCs cultured with 10% FBS. Our results showed that the statistical change in cell viability of AT-MSCs using the medium containing 10% FBS under the treatment of different D-glucose levels was not found during 12 days. Similarly, the results of AT-MSCs viability using 10% PRP did not receive any significant difference at the different D-glucose levels of treatment. Instead, the stimulatory effects on cell viability of PRP were stronger than those of FBS at the same different D-glucose levels. The doubling times of AT-MSCs cultured with 10% PRP (1,1574 ± 0,1332) were statistically different when compared with 10% FBS (0,2019 ± 0,0671). Differences in growth rates are most evident since day 6 of the culture process (Fig. 2). Figure 3 exhibits a clearer evaluation of different supplemented serums including 10% FBS and 10% PRP ability to stimulate proliferation of under various D-glucose concentrations. In general, 10% PRP promoted the highest proliferation rate when compared to that of 10% FBS after 12 days of culture period, yet has no statistical difference among various D-glucose concentrations. In addition of 10% FBS, control group showed a better proliferation rate than other groups (0,2019 ± 0,0671), however it still had less efficiency than group of 10% PRP (1,1574 ± 0,1332). In 25 mM and 50 mM D-glucosetreated groups, 10% PRP (10% PRP + 25, 0,7216 ± 0,0406 and 10% PRP + 50, 0,7073 ± 0,0764) shown statistically different from day 6 to day 12 of culture when compared with 10% FBS (10% FBS + 25 mM D-glucose, 0,3367 ± 0,0154 and 10% FBS + 50 mM D-glucose, 0,3471 ± 0,0308). The control and 100 mM group promote significant proliferation ability of AT-MSCs during 12 days. Under all D-glucose levels, 10% PRP shows the increased trend in cell proliferation; however, at day 12, the control

The Effect of 10% Platelet-Rich Plasma on In-Vitro Wound Healing Ability

247

group, 25 mM and 100 mM D-glucose group no longer support the cell growth; thus, they appear to have a slight decrease in cell’s number. Our investigation showed that 10% PRP had a higher potential for proliferation than 10% FBS. This result agrees with previous studies [13, 18–20] that PRP concentrations between 10 and 20% in the cell culture media had the greatest effect on cell growth. In addition, our previous publication showed that 100 mM and 200 mM D-glucose decreased the proliferation of AT-MSCs [17]. Furthermore, the high D-glucose concentrations also impaired proliferation and migration of human fibroblast, keratinocyte [9, 10]. In this present study, the results demonstrated that 10% PRP significantly increased the cell proliferation of AT-MSCs when exposed under 25 mM, 50 mM and 100 mM D-glucose. This evidence supports that 10% PRP brings valuable promise to improve the growth ability of AT-MSCs under exposure to high D-glucose concentrations. 3.3 10%PRP Induced the Ability of AT-MSCs to Heal Chronic Wounds In-Vitro The results demonstrated that the wound areas at 24 h of AT-MSCs in 10% PRP medium were significantly recovered in comparison with those of 10% FBS (wound area: 10%PRP, 10.98 ± 0.79% vs. 10%FBS, 25.64 ± 1.98%; P < 0.01; n = 5) (Fig. 4). Moreover, at all three high D-glucose levels, 10% PRP also shown significantly higher the ability to heal the wound when compared with 10% FBS (wound area: 10%PRP + 25 mM D-glucose, 15.10 ± 1.32 vs. 10%FBS + 25 mM D-glucose, 2.27 ± 2.72 and 10%PRP + 50 mM D-glucose, 12.09 ± 0.45 vs. 10%FBS + 50 mM D-glucose, 44.79 ± 1.77 and 10%PRP + 100 mM D-glucose, 32.89 ± 1.31 vs. 10%FBS + 100 mM D-glucose, 52.24 ± 1.96, P < 0.01; n = 5). Notably, the ability to cover wounds of AT-MSCs has been reduced when exposed to high D-glucose at 100 mM in comparison with control group (wound area: 10%PRP, 10.98 ± 0.79% vs. 10%PRP + 100 mM Dglucose, 32.89 ± 1.31 and 10%FBS, 25.64 ± 1.98% vs. 10%FBS + 100 mM D-glucose, 52.24 ± 1.96; P < 0.01; n = 5) (Fig. 3). The wound areas in 10% FBS + 100 mM Dglucose were not statistical differences (wound area: 10%FBS + 100 mM D-glucose, 52.24 ± 1.96, P < 0.01; n = 5) (Fig. 3). These results indicate that 10% PRP enhances the ability of migration in AT-MSCs in comparison with 10% FBS when exposed to high D-glucose conditions (50 and 100 mM). The ability of stem cells to migrate into the damaged area plays a very important role in wound healing [8, 14]. Our previous studies have shown that high D-glucoses concentrations is impaired the ability to heal wounds of AT-MSCs in-vitro model. Here, we aim to demonstrate that the PRP can induce the ability to heal wounds of AT-MSCs in-vitro under high D-glucose conditions. To study the influence of autologous platelet plasma on the wound healing capacity of AT-MSC under high D-glucose conditions, a scratch assay mimicking cell movement during in-vivo wound healing was conducted. Previous studies indicate that 10% PRP stimulates fibroblast migration within 24 h [16]. Similarly, our results show that the wound healing ability of AT-MSCs cultured with 10% PRP significantly enhanced the migration ability after 24 h in comparison with the control group. Our previous study demonstrated that the ability to cover wounds of AT-MSCs has been significantly reduced when exposed to 100 mM D-glucose [17]. In this present study, our data showed that 10% PRP can significantly enhance the migration ability of AT-MSC under exposure of 100 mM D-glucose. Nevertheless, in

248

C. N.-M. Trinh et al.

Fig. 4. 10% PRP enhances the ability of in vitro cell migration under high D-glucose conditions. (A) The image was taken using a microscope and analyzed by Wimasis software at 0 h and 24 h. (B) Percentage of wound areas of nAT-MSCs (control and 100 mM) and dAT-MSCs at 0 h and 24 h. Data were taken from the average of eight different wound areas and three replications (mean value ± SD); **, P < 0.01. Scale bar: 500 µm.

all groups treated with high D-glucose concentrations (25, 50 and 100 mM), 10% PRP also statistically promoted the migration ability of AT-MSCs when compared with 10% FBS media (Fig. 4). Thus, the result of this study shows that 10% PRP concentrations stimulate proliferation and migration of AT-MSC in-vitro.

The Effect of 10% Platelet-Rich Plasma on In-Vitro Wound Healing Ability

249

4 Conclusion Taken together, our study demonstrated that 10% PRP enhances the in-vitro wound healing ability of AT-MSCs in high D-glucose conditions compared with 10% FBS and 10% PPP. This work gives a better knowledge of the influence of PRP on the activities of AT-MSCs for future applications of AT-MSCs coupled with autologous platelet plasma products in the realms of wound healing and cosmetology. Acknowledgement. This research is also funded by Vietnam National University-Ho Chi Minh city (VNU-HCM) under the grant number NCM2020–28-01. We thank Professor Osamu Ohneda for providing stem cells and Biotechnology Center for supporting some research materials and equipment.

Conflict of Interest. No conflict of interest regarding the publication of this paper.

References 1. Saeedi, P., et al.: Global and regional diabetes prevalence estimates for 2019 and projections for 2030 and 2045: results from the International Diabetes Federation Diabetes Atlas. Diab. Res. Clin. Pract. 157, 107843 (2019). https://doi.org/10.1016/j.diabres.2019.10784 2. Okonkwo, U.A., DiPietro, L.A.: Diabetes and wound angiogenesis. Int. J. Mol. Sci. 18(7), 1419 (2017). https://doi.org/10.3390/ijms180714 3. Lilao-Garzón, J., Valverde-Tercedor, C., Muñoz-Descalzo, S., Brito-Casillas, Y., Wägner, A.M.: In vivo and in vitro models of diabetes: a focus on pregnancy. In: Islam, M.S. (ed.) Diabetes: from Research to Clinical Practice. AEMB, vol. 1307, pp. 553–576. Springer, Cham (2020). https://doi.org/10.1007/5584_2020_536 4. Dewangan, H., Tiwari, R.K., Sharma, V., Shukla, S.S., Satapathy, T., Pandey, R.: Past and future of in-vitro and in-vivo animal models for diabetes: a review. Indian J. Pharmaceut. Educ. Res. 51(4S), s522–s530 (2017). https://doi.org/10.5530/ijper.51.4s.79 5. Gadelkarim, M., Abushouk, A.I., Ghanem, E., Hamaad, A.M., Saad, A.M., Abdel-Daim, M.M.: Adipose-derived stem cells: effectiveness and advances in delivery in diabetic wound healing. Biomed. Pharmacother. 107, 625–633 (2018). https://doi.org/10.1016/j.biopha.2018. 08.013 6. Mazini, L., Rochette, L., Amine, M., Malka, G.: Regenerative capacity of adipose derived stem cells (ADSCs), comparison with mesenchymal stem cells (MSCs). Int. J. Mol. Sci. 20(10), 2523 (2019). https://doi.org/10.3390/ijms20102523 7. Trinh, N.T., et al.: Increased expression of EGR-1 in diabetic human adipose tissue-derived mesenchymal stem cells reduces their wound healing capacity. Stem Cells Develop. 25(10), 760–773 (2016). https://doi.org/10.1089/scd.2015.0335 8. Trinh, N.T., et al.: Microvesicles enhance the mobility of human diabetic adipose tissuederived mesenchymal stem cells in vitro and improve wound healing in vivo. Biochem. Biophys. Res. Commun. 473(4), 1111–1118 (2016). https://doi.org/10.1016/j.bbrc.2016. 04.025 9. Aliakbari, S., Mohammadi, M., Rezaee, M.A., Amini, A.A., Fakhari, S., Rahmani, M.R.: Impaired immunomodulatory ability of type 2 diabetic adipose-derived mesenchymal stem cells in regulation of inflammatory condition in mixed leukocyte reaction. EXCLI J. 18, 852 (2019). https://doi.org/10.17179/excli2019-1575

250

C. N.-M. Trinh et al.

10. Li, Y.M., et al.: Effects of high glucose on mesenchymal stem cell proliferation and differentiation. Biochem. Biophys. Res. Commun. 363(1), 209–215 (2007). https://doi.org/10.1016/ j.bbrc.2007.08.161 11. Burnouf, T., Goubran, H.A., Chen, T.M., Ou, K.L., El-Ekiaby, M., Radosevic, M.: Bloodderived biomaterials and platelet growth factors in regenerative medicine. Blood Rev. 27(2), 77–89 (2013). https://doi.org/10.1016/j.blre.2013.02.001 12. Cabaro, S., et al.: White cell and platelet content affects the release of bioactive factors in different blood-derived scaffolds. Platelets 29(5), 463–467 (2018). https://doi.org/10.1080/ 09537104.2017.1319046 13. Felthaus, O., et al.: Effects of different concentrations of Platelet-rich Plasma and PlateletPoor Plasma on vitality and differentiation of autologous Adipose tissue-derived stem cells. Clin. Hemorheol. Microcirc. 66(1), 47–55 (2017). https://doi.org/10.3233/CH-160203 14. Xu, P., et al.: Platelet-rich plasma accelerates skin wound healing by promoting reepithelialization. Burns Trauma (2020). https://doi.org/10.1093/burnst/tkaa028 15. Sun, Y., Cao, Y., Zhao, R., Xu, F., Wu, D., Wang, Y.: The role of autologous PRP on deep partial-thickness burn wound healing in Bama pigs. J. Burn Care Res. 41(3), 657–662 (2020). https://doi.org/10.1093/jbcr/iraa012 16. Park, H.B., Yang, J.H., Chung, K.H.: Characterization of the cytokine profile of platelet rich plasma (PRP) and PRP-induced cell proliferation and migration: upregulation of matrix metalloproteinase-1 and -9 in HaCaT cells. Korean J Hematol. 46(4), 265–273 (2011). https:// doi.org/10.5045/kjh.2011.46.4.265 17. Mai, H.-P., Trinh, N.-T., Long, V.B., Binh, N.T., Nguyen, D.-Q., Duong, H.-X.: The high D-glucose concentration reduces the ability of wound healing in vitro of human adipose tissue-derived mesenchymal stem cells. In: Van Toi, V., Nguyen, T.-H., Long, V.B., Huong, H.T.T. (eds.) BME 2020. IP, vol. 85, pp. 581–590. Springer, Cham (2022). https://doi.org/10. 1007/978-3-030-75506-5_49 18. Cavallo, C., et al.: Platelet-rich plasma: the choice of activation method affects the release of bioactive molecules. BioMed Res. Int. 2016, 6591717 (2016). doi:https://doi.org/10.1155/ 2016/6591717 19. Kakudo, N., et al.: Proliferation-promoting effect of platelet-rich plasma on human adiposederived stem cells and human dermal fibroblasts. Plastic Reconstruct. Surg. 122(5), 1352– 1360 (2008). https://doi.org/10.1097/PRS.0b013e318188204 20. Stessuk, T., et al.: Platelet-rich plasma (PRP) and adipose-derived mesenchymal stem cells: stimulatory effects on proliferation and migration of fibroblasts and keratinocytes in vitro. Arch. Dermatol. Res. 308(7), 511–520 (2016). https://doi.org/10.1007/s00403-016-1676-1

Investigate the Effect of Vitamin D3 on Osteogenic Differentiation of Mesenchymal Stem Cells Derived from Adipose Tissue (AT-Mscs) Under High D-Glucose Levels Anh Hong Pham1 , Nhi Nguyen-yen Ha1,2 , Tan Thi-kim Huynh2 , Long Binh Vong1 , and Thuy Nhu Trinh1(B) 1 School of Biomedical Engineering, International University, Vietnam National University-Ho

Chi Minh City (VNU-HCMC), Ho Chi Minh City 700000, Vietnam [email protected] 2 Faculty of Biology and Biotechnology, University of Science, Vietnam National UniversityHo Chi Minh City (VNU-HCMC), Ho Chi Minh City 700000, Vietnam

Abstract. Vitamin D3 plays a vital role in bone health, with low levels of vitamin D3 being related to skeletal fragility, fractures, and metabolic disorders such as diabetes. A correlation between diabetes mellitus and osteoporosis is attracting considerable interest, and research to find the prevention and treatment is gradually being studied. In this study, we investigated the effect of vitamin D3 on the osteogenic differentiation of mesenchymal stem cell-derived adipose tissue (AT-MSCs) under high D-glucose concentrations. Differentiated AT-MSCs were analyzed by Alizarin Red S staining and optical density measurement. The results have shown that Vitamin D3 has slightly increased the osteogenic differentiation of AT-MSCs under high D-glucose conditions. Therefore, the data partially explain an aspect of osteoporosis-related diabetes pathological mechanism, which can be applied for further research on the treatment of osteoporosis in diabetic patients, as well as an in vitro model for pre-clinical drug screening that can be used instead of an in vivo model. Keywords: Diabetes Mellitus · Osteoporosis · Vitamin D · Metformin · Mesenchymal Stem Cells · AT-MSCs · Osteogenic Differentiation · High D-Glucose Concentrations

1 Introduction Diabetes mellitus causes abnormalities in bone metabolism and a decrease in bone mineral density, which result in osteoporosis. If osteoporosis induced by diabetes is left untreated, the bone disorder may develop, which in extreme situations may lead to disability [1]. Hyperglycemia also affects the formation of reactive oxygen species A.H. Pham, N.N. Ha—Contributed equally. © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. T. Vo et al. (Eds.): BME 2022, IFMPE Proceedings 95, pp. 251–260, 2024. https://doi.org/10.1007/978-3-031-44630-6_20

252

A. H. Pham et al.

(ROS) and advanced glycation end products (AGE), which influences cell death processes [2]. Statistically, the amount of vitamin D in patients with high blood glucose, HbA1C, cholesterol, triglycerides, body mass index, and waist circumference tends to decrease [3]. Also, the researcher found that vitamin D levels inversely proportional to HbA1C were investigated in 120 diabetic patients [4]. This also may indicate a relationship between DM and vitamin D deficiency. Furthermore, vitamin D insufficiency may result in secondary hyperparathyroidism and bone loss, which can lead to osteoporosis, fractures, and mineralization abnormalities, leading to long-term effects such as osteomalacia and muscular weakness, which can cause falls and fractures [5, 6]. Therefore, it is extremely necessary to understand the relationship above, as well as to explore the solution to address the association between vitamin D deficiency, diabetes mellitus, and osteoporosis. Recently, metformin, an effective hypoglycemic, can modulate bone metabolism. In addition, several studies have shown that metformin has a long-term protective impact on bone metabolism [7, 8] in diabetic or prediabetic individuals [9, 10]. Moreover, vitamin D3 affects insulin sensitivity/resistance directly [11] in addition to its positive effects on the bone metabolism [6, 12]. Joanna Mitri et al. (2011) revealed that vitamin D3 treatment in patients at risk for type 2 diabetes leads to an enhanced role of β-cell, but non-significant, as well as an increase in HbA1c values than in the control group [13]. On the other hand, several clinical studies demonstrated that long-term treatment with metformin has no effect on blood vitamin D levels and does not lead to vitamin D deficiency in diabetic patients [14]. Another research investigated the individual and combined effects of metformin and vitamin D on suppressing the development of early colorectal cancer in a mouse model, demonstrating that it is possible to create novel medicines for managing colorectal cancer therapy [15]. In addition, the additive effects of metformin and vitamin D enhanced the efficacy of reduced cardiovascular events, renal complications, and smooth muscle insulin resistance when compared with the individual effects of metformin or vitamin D, demonstrated in a mouse model of streptozotocin-induced diabetes (STZ) and a mouse model of type 2 diabetes [16, 17]. Animal models overcome some limitations by providing physiological features inherent to the diabetic microenvironment, 3D bone architecture, and multicellular complexity. However, most experiments on animals, which are subjected to ethical and budget issues, do not fully synopsize human osteoporosis-related diabetes pathophysiology due to biological dissimilarities. Therefore, the employment of in vitro models in research is often emphasized and is considered a prerequisite to pre-clinical and clinical trials. Currently, the cell types used for the research are mainly cancer cell lines, expressing cells and fibroblasts. Many studies exploring diabetic complications are prominent. These studies all show great results, which indicates that cell models are essential for studies about the mechanism of pathology and biologically active substances. However, cancer cell lines have characteristics, unlike normal somatic cells, while somatic cells are limited in lifespan and are unable to maintain stability over times of sub-culture. Thus, MSCs are considered the most capable ones because they have the ability to self-renewal, stabilize through multiple passages, and can be obtained from many parts of the body [18, 19]. Therefore, creating a pathological mesenchymal stem cell line would bring researchers many scientific and economic benefits.

Investigate the Effect of Vitamin D3 on Osteogenic Differentiation

253

Taken together, due to the high prevalence of osteoporosis-related diabetes and vitamin D3 deficiency, there is a pressing demand to establish in vitro models using human MSCs under conditions of high D-glucose and to develop drug screening platforms that more accurately recapitulate the complex physiology of the relationship mentioned above.

2 Materials and Methods 2.1 Materials Human adipose-derived mesenchymal stem cells (AT-MSCs) were isolated at the Laboratory of Regenerative Medicine and Stem Cell Biology, University of Tsukuba, Japan. AT-MSCs were subcultured two to three times after isolation to increase the number of cells for the experiment. This cell line is then examined for stem cell markers and purified using fluorescence-activated cell sorting (FACs) [20]. 2.2 Methods AT-MSCs Culture AT-MSCs was cultured in IMDM, 10% FBS, 1%PS at 37 °C, 5% CO2. The culture medium was replaced every 3 days. The cell passages used in the experiment were at 6–8. In Vitro Osteogenic Differentiation of AT-MSCs AT-MSCs was differentiated in IMDM, 1% FBS and 1% PS, supplemented with dexamethasone, ascorbic acid and β-glycerol phosphate and hEGF. Vitamin D3 (1α,25(OH)2D3, Metformin, and D-glucose were added in the differentiation medium. The medium was replaced every 3–4 days till days 21–28. Alizarin Red S Staining The anthraquinone derivative Alizarin Red S can be used to detect calcium deposition in cell cultures. Aizarin Red Staining was conducted to visualize the formation of a mineralized matrix from day 21 to day 28 of osteogenesis. The cells were fixed with formalin 10% and then incubated with Alizarin Red S. The samples were observed and analyzed under the invert-microscope. Areas of mineralization appeared red. Pictures were taken with the invert-microscope using the NIR Element BR software. Afterwards, the mixture of sodium dodecyl sulfate 20% and hydrochloric acid (HCl) was used to lyse the cells to quantify the percentage of cell mineralisation. When the Alizarin Red S stain was fully dissolved, the mineralization was quantified by measuring the solution’s optical density (OD) with a microplate reader at 480 nm. Statistical Analysis One-way analysis of variance (ANOVA) was used to identify significant differences between various groups (Tukey posthoc test; SPSS 26 software, IBM Corp.). Experiments in the study were done at least in triplicate except when otherwise stated, and the level of significance was assessed at p ≤ 0.05. All data are expressed as the mean ± standard deviation (SD).

254

A. H. Pham et al.

3 Results and Discussion 3.1 Qualification of the Osteogenic Differentiation of AT-MSCs Under High D-Glucose Concentrations DM is characterized by persistent hyperglycemia, which leads to several significant consequences [21]. It has been shown that high D-glucose concentrations change the features and functions of AT-MSCs, including the osteogenic differentiation potential [22]. In this experiment, we evaluated the effect of high D-glucose concentrations on the osteogenesis potential of AT-MSCs. The cells were cultured in an osteogenic medium, supplemented with 25 mM, 50 mM, and 100 mM D-glucose. Compared to the control group, those concentrations have been proven to not cause cell apoptosis but to inhibit the growth rate of AT-MSCs [23]. Alizarin Red S staining was performed to examine the calcification of the surface of osteoblasts. In the staining result, when high concentrations of D-glucose were added to the differentiation medium, there was a statistically significant difference between D-glucose groups compared to the control group; the absorbance ratio of D-glucose samples tended to decrease compared to the control sample (25 mM, 1.37-fold decrease, n = 3 in each; 50 mM, 2.29-fold decrease, n = 3 in each; 100 mM, 7.05-fold decrease, n = 3 in each) (Fig. 1). Therefore, this indicated that high D-glucose concentrations inhibited the capacity of AT-MSCs to differentiate into osteocytes, which might explain osteoporosis in patients with type 2 diabetes. 3.2 The Effect of Different Levels of Vitamin D on the Osteogenic Differentiation Process of AT-MSCs Vitamin D3 plays an important role in the treatment of osteoporosis by influencing the number of osteoblasts, osteoclasts, and osteocytes in the bone [12]. There are few studies on the impacts of vitamin D3 on the osteogenesis of AT-MSCs; thereby, the vitamin D3 concentrations need to be investigated again. To explore the osteogenic differentiation effects of vitamin D3 in different concentrations on AT-MSCs, the cells were cultured in an osteogenic medium containing 1α,25(OH)2 D3 at various levels, including 50 nM, 10 nM, and 2 nM. Alizarin Red S staining assay was used to assess the calcium deposition that was produced as a result. The result before staining showed that the AT-MSCs in 50 nM and 10 nM-treated groups was different from the 2 nM-treated group. The cell monolayer remained under the mineralized-layer in 2 nM-treated group. Meanwhile, this layer gradually disappeared in 10 nM and 50 nM-treated groups, respectively (Fig. 2, Before). Comparing the calcium deposition of AT-MSCs under the treatment of three different concentrations of Vitamin D3 , it was noticeable that there was less color in the 50 nM and in 10 nM than the 2 nM-treated groups (Fig. 2, After). This indicated that the osteogenic differentiation ability of AT-MSCs in those two groups was lower than the 2 nM-treated group. These findings demonstrated that vitamin D3 at a concentration of 2 nM is safe for cell survival and promotes osteogenic differentiation. Based on these results, we used 2 nM 1α,25(OH)2 D3 in the subsequent experiments.

Investigate the Effect of Vitamin D3 on Osteogenic Differentiation

255

Fig. 1. Effect of various D-glucose levels on osteogenic differentiation. AT-MSCs were stimulated with an osteogenic induction medium containing D-glucose (25 mM, 50 mM, 100 mM) for 28 days. Control was presented with osteogenic differentiation samples without D-glucose. (A) Osteoblasts were recognized on day 28 by Alizarin red S staining, which indicated the calcification of the surface of osteoblasts (red). Scale bar: 100 μm. The high D-glucose concentrations reduced the ability to differentiate into osteocytes in AT-MSCs. (B) Absorbance was measured at 480 nm for Alizarin red S staining. The higher D-glucose concentrations were added, the more absorbance ratio of Alizarin red S was decreased. Data are presented as mean ± SD (n = 3). p** < 0.01, p*** < 0.01.

3.3 Quantification and Qualification of Vitamin D3 ’s Impact on Osteogenic Differentiation in AT-MSCs Under High D-Glucose Levels Vitamin D3 showed positive effects in treating osteoporosis and DM [4, 24]. Thus, in this experiment, the effect of 1α,25(OH)2 D3, on osteogenesis under high-levels of D-glucose was evaluated. The concentration of these substances is indicated in the figure legend. Alizarin Red S staining was used to examine calcification after 28 days of culture, and the absorbance at 480 nm was determined to properly quantify osteogenic differentiation. Overall, the changes caused by the supplement of 1α,25(OH)2 D3 to different high Dglucose levels were not significantly observed. The deposition of mineral matrix nodules was slightly higher in AT-MSCs cultured with the medium supplemented with vitamin D3 at 0 mM, 25 mM and 100 mM of D-glucose (Fig. 3). As shown in the graph of absorbance ratio (Fig. 3B), in the group of AT-MSCs treated with the additive of 1α,25(OH)2 D3 was raised at 25 mM D-glucose, compared to the control group. Although 100 mM D-glucose levels tend to inhibit the osteogenesis of AT-MSCs, this process could be seen that 1α,25(OH)2 D3 significantly increase the matrix accumulation by 1.96-fold, compared to the control group. However, the difference between the non-Vit D3 -treated group and the Vit D3 -treated group was not significant.

256

A. H. Pham et al.

Fig. 2. Effect of various vitamin D3 levels on osteogenic differentiation. AT-MSCs were stimulated with an osteogenic induction medium containing 1α,25(OH)2 D3 at 50 nM, 10 nM, and 2 nM concentrations. The resulting calcium deposition was analyzed by Alizarin Red S staining. The higher levels of vitamin D3 might have negative effects on cell survival, but they still induced osteogenic differentiation of AT-MSCs. Scale bar: 100 μm.

According to Francesca Posa et al., they explored that vitamin D3 at a concentration of 100 nM increased osteoblastic differentiation of DBSCs (dental bud stem cells), which leads to an increase in bone mineral matrix deposition [25]. Another previous research found that vitamin D at 10 nM enhanced osteogenic differentiation of hPDLSC (human periodontal ligament stromal cells) based on the expression of ALP and osteopontin (OPN) gene, which were the key osteogenic markers expressed during the process [26]. This finding was in accordance with an investigation of H9c2 cardiac cells, which demonstrated that 1α,25(OH)2D3 incubation improved the expression of the VDR [27]. 1α,25(OH)2D3 inhibited the growth of specific cells, including osteoblasts, osteoclasts [28], and MSCs, through binding to VDR [29, 30]. In this study, AT-MSCs osteogenic differentiation was affected by the higher levels of 1α,25(OH)2D3 at 50 and 10 nM, cells appeared to expire, no longer able to differentiate on day 16 and 17, respectively (Fig. 2). Vitamin D3 at 2 nM level has been shown appropriately for osteogenesis of AT-MSCs based on cell morphology and ability to still differentiate under the inverted-microscope (Fig. 3). Although adequate data is supporting the enhanced effects of 1α,25(OH)2D3 on the osteogenic differentiation of MSCs, the mechanism of vitamin D3 in MSCs osteogenic differentiation must be comprehensively clarified.

Investigate the Effect of Vitamin D3 on Osteogenic Differentiation

257

Fig. 3. Vitamin D3 induces the osteogenic differentiation process under high D-glucose concentrations. AT-MSCs were stimulated with an osteogenic induction medium containing 2 nM of 1α,25(OH)2 D3 under high D-glucose levels (25 mM, 50 mM, and 100 mM) for 28 days. The resulting calcium deposition was analyzed by Alizarin Red S staining, which indicated an increase in matrix mineralization along culturing time. (A) The picture was taken before and after Alizarin Red S staining on day 28 under the inverted microscope at 10× with the bar indicating 100 μm. (B) Pictures were taken with an iPhone camera, with the same exposure setting across all the treatments. No calcium nodules were considered as non-induction of the osteogenic differentiation sample. The yellow solution presented the calcified dye after lysing, the more dye on mineralized cells, the darker the yellow color. (C) The graph shows that the quantification of calcium deposits was performed photometrically. Y-axis represents the optical density measured at 480 nm. Data are presented as mean ± SD (n = 3). The significant difference between groups, p < 0.05 (*), p < 0.01 (**).

4 Conclusion The current work presents a thorough investigation of the impacts of vitamin D3 on the osteogenic differentiation capability of in-vitro MSCs derived from adipose tissue under high-level D-glucose. This finding has demonstrated that high D-glucose concentrations inhibited the osteogenic differentiation of AT-MSCs. Moreover, vitamin D3 has shown its potential in improving the osteogenic differentiation of AT-MSCs that has been inhibited by high D-glucose concentrations. Our observations pave the way for future investigations to better explain the impact of vitamin D on bone development, such as investigating gene and protein expression during the process. The evidence gained from

258

A. H. Pham et al.

this study could contribute to the understanding of the relationship between DM and osteoporosis and develop the treatment of DM and its complications. Acknowledgement. This research is funded by Vietnam National University HoChiMinh City (VNU-HCM) under grant number C2021-28-02. We thank Professor Osamu Ohneda for providing stem cells and Biotechnology Center for supporting some research materials and equipment.

Conflict of Interest. No conflict of interest regarding the publication of this paper.

References 1. Schacter, G.I., Leslie, W.D.: Diabetes and osteoporosis: Part I, epidemiology and pathophysiology. Endocrinol. Metabol. Clin. North Am. 50(2), 275–285 (2021). https://doi.org/10.1016/ j.ecl.2021.03.005 2. Fishman, S.L., Sonmez, H., Basman, C., Singh, V., Poretsky, L.: The role of advanced glycation end-products in the development of coronary artery disease in patients with and without diabetes mellitus: a review. Mol. Med. 24(1), 59 (2018). https://doi.org/10.1186/s10020-0180060-3 3. Lips, P., et al.: Vitamin D and type 2 diabetes. J. Steroid Biochem. Mol. Biol. 173, 280–285 (2017). https://doi.org/10.1016/j.jsbmb.2016.11.021 4. Kostoglou-Athanassiou, I., Athanassiou, P., Gkountouvas, A., Kaldrymides, P.: Vitamin D and glycemic control in diabetes mellitus type 2. Ther. Adv. Endocrinol. Metab. 4(4), 122–128 (2013). https://doi.org/10.1177/2042018813501189 5. De Martinis, M., et al.: Vitamin D deficiency, osteoporosis and effect on autoimmune diseases and hematopoiesis: a review. Int. J. Mol. Sci. 22(16) (2021). https://doi.org/10.3390/ijms22 168855 6. Lips, P., van Schoor, N.M.: The effect of vitamin D on bone and osteoporosis. Best Pract. Res. Clin. Endocrinol. Metab. 25(4), 585–591 (2011). https://doi.org/10.1016/j.beem.2011. 05.002 7. Gu, Q., Gu, Y., Yang, H., Shi, Q.: Metformin enhances osteogenesis and suppresses adipogenesis of human chorionic villous mesenchymal stem cells. Tohoku J. Exp. Med. 241(1), 13–19 (2017). https://doi.org/10.1620/tjem.241.13 8. Mu, W., et al.: Metformin promotes the proliferation and differentiation of murine preosteoblast by regulating the expression of sirt6 and oct4. Pharmacol. Res. 129, 462–474 (2018). https://doi.org/10.1016/j.phrs.2017.11.020 9. Sun, J., et al.: Histological evidence that metformin reverses the adverse effects of diabetes on orthodontic tooth movement in rats. J. Mol. Histol. (2016). https://doi.org/10.1007/s10735016-9707-y 10. Tolosa, M.J., et al.: Insulin-deficient diabetes-induced bone microarchitecture alterations are associated with a decrease in the osteogenic potential of bone marrow progenitor cells: preventive effects of metformin. Diab. Res. Clin. Pract. 101(2), 177–186 (2013). https://doi.org/ 10.1016/j.diabres.2013.05.016 11. Maestro, B., Campión, J., Dávila, N., Calle, C.: Stimulation by 1,25-dihydroxyvitamin D3 of insulin receptor expression and insulin responsiveness for glucose transport in U-937 human promonocytic cells. Endocr. J. 47(4), 383–391 (2000). https://doi.org/10.1507/endocrj.47.383 12. Hou, Y.C., et al.: Role of nutritional vitamin D in osteoporosis treatment. Clin. Chim. Acta 484, 179–191 (2018). https://doi.org/10.1016/j.cca.2018.05.035

Investigate the Effect of Vitamin D3 on Osteogenic Differentiation

259

13. Mitri, J., Dawson-Hughes, B., Hu, F.B., Pittas, A.G.: Effects of vitamin D and calcium supplementation on pancreatic β cell function, insulin sensitivity, and glycemia in adults at high risk of diabetes: the Calcium and Vitamin D for Diabetes Mellitus (CaDDM) randomized controlled trial. Am. J. Clin. Nutr. 94(2), 486–494 (2011). https://doi.org/10.3945/ajcn.111. 011684 14. Kos, E., Liszek, M.J., Emanuele, M.A., Durazo-Arvizu, R., Camacho, P.: Effect of metformin therapy on vitamin D and vitamin B12 levels in patients with type 2 diabetes mellitus. Endocr. Pract. 18(2), 179–184 (2012). https://doi.org/10.4158/ep11009.Or 15. Li, W., et al.: Combined use of vitamin D3 and metformin exhibits synergistic chemopreventive effects on colorectal neoplasia in rats and mice. Cancer Prev. Res. (Phila.) 8(2), 139–148 (2015). https://doi.org/10.1158/1940-6207.Capr-14-0128 16. Deshmukh, A., Manjalkar, P.: Synergistic effect of micronutrients and metformin in alleviating diabetic nephropathy and cardiovascular dysfunctioning in diabetic rat. J. Diab. Metab. Disord. 20(1), 533–541 (2021). https://doi.org/10.1007/s40200-021-00776-5 17. Kabel, A., Alotaibi, N., Alswat, N., Aldajani, M., Alnefaie, M.: Effect of the combination between metformin and vitamin D on experimentally-induced diabetic nephropathy. Int. J. Pharma Sci. Scient. Res. 2, 103–109 (2016). https://doi.org/10.25141/2471-6782-2016-2. 0103 18. Ding, D.-C., Shyu, W.-C., Lin, S.-Z.: Mesenchymal stem cells. Cell Transplant. 20(1), 5–14 (2011). https://doi.org/10.3727/096368910x 19. Mosna, F., Sensebé, L., Krampera, M.: Human bone marrow and adipose tissue mesenchymal stem cells: a user’s guide. Stem Cells Dev. 19(10), 1449–1470 (2010). https://doi.org/10.1089/ scd.2010.0140 20. Trinh, N.-T., et al.: Increased expression of EGR-1 in diabetic human adipose tissue-derived mesenchymal stem cells reduces their wound healing capacity. Stem Cells Develop. 25(10), 760–773 (2016). https://doi.org/10.1089/scd.2015.0335 21. DeFronzo, R.A., et al.: Type 2 diabetes mellitus. Nat. Rev. Dis. Primers. 1, 15019 (2015). https://doi.org/10.1038/nrdp.2015.19 22. Cramer, C., et al.: Persistent high glucose concentrations alter the regenerative potential of mesenchymal stem cells. Stem Cells Develop. 19(2), 1875–1884 (2010). https://doi.org/10. 1089/scd.2010.0009 23. Nguyen, Y.-N.H., et al.: The impairment of osteogenic differentiation of human adipose tissue-derived mesenchymal stem cells under high D-glucose concentrations. Vietnam J. Sci. Technol. Eng. 64(1), 72–77 (2022) 24. Melguizo-Rodríguez, L., Costela-Ruiz, V.J., García-Recio, E., De Luna-Bertos, E., Ruiz, C., Illescas-Montes, R.: Role of vitamin D in the metabolic syndrome. Nutrients 13(3) (2021). https://doi.org/10.3390/nu13030830 25. Posa, F., et al.: Vitamin D effects on osteoblastic differentiation of mesenchymal stem cells from dental tissues. Stem Cells Int. 2016, 1–9 (2016). https://doi.org/10.1155/2016/9150819 26. Ji, Y., et al.: Effect of 1α, 25-dihydroxyvitamin D3 on the osteogenic differentiation of human periodontal ligament stem cells and the underlying regulatory mechanism. Int. J. Mol. Med. 43(1), 167–176 (2019). https://doi.org/10.3892/ijmm.2018.3947 27. Hlaing, S.M., Garcia, L.A., Contreras, J.R., Norris, K.C., Ferrini, M.G., Artaza, J.N.: 1,25Vitamin D3 promotes cardiac differentiation through modulation of the WNT signaling pathway. J. Mol. Endocrinol. 53(3), 303–317 (2014). https://doi.org/10.1530/jme-14-0168 28. Reichrath, J.: Vitamin D and the skin: an ancient friend, revisited. Exp. Dermatol. 16(7), 618–625 (2007). https://doi.org/10.1111/j.1600-0625.2007.00570.x

260

A. H. Pham et al.

29. Feng, Y., Sun, Y., Jia, W., Zhang, C.: Platelet-rich plasma and 1,25(OH)2 vitamin D3 synergistically stimulate osteogenic differentiation of adult human mesenchymal stem cells. Biotechnol. Lett. 32(5), 635–642 (2010). https://doi.org/10.1007/s10529-009-0198-8 30. Khanna-Jain, R., Vuorinen, A., Sandor, G.K., Suuronen, R., Miettinen, S.: Vitamin D(3) metabolites induce osteogenic differentiation in human dental pulp and human dental follicle cells. J. Steroid Biochem. Mol. Biol. 122(4), 133–141 (2010). https://doi.org/10.1016/j.jsbmb. 2010.08.001

Preparation and Characterization of the Hydrogel System N, O-Carboxymethyl Chitosan/Oxidized Xanthan Gum Phuc Hong Vo1,2 , Dat Quoc Do1,2 , Binh Thanh Vu1,2 , Tuan-Ngan Tang1,2 , Hoan Ngoc Doan1,2 , Phan Thi Thanh Tam1,2 , and Thi-Hiep Nguyen1,2(B) 1 Department of Tissue Engineering and Regenerative Medicine, School of Biomedical

Engineering, International University, Ho Chi Minh City 700000, Vietnam [email protected] 2 Vietnam National University, Ho Chi Minh City 700000, Vietnam Abstract. 3D bioprinting is a new technology used in medicine to create complex biomimetic structures for applications in tissue engineering, regenerative medicine, and drug testing. The selection of materials for the bio-ink, a printable formulation, plays an important role in optimizing the 3D bioprinting process in accordance with the research objectives. Polymers, especially hydrogels, produce bio-inks with fascinating properties that can be manipulated artificially. We propose a hydrogel system combining N, O-carboxymethyl chitosan (NOCC) with oxidized xanthan gum (OXG) with different volume ratios to improve the mechanical properties. We incorporated NOCC and OXG into hydrogels, and confirmed by Fourier-transform infrared spectroscopy (FTIR) method. The change in the NOCC:OXG ratio affects the pore size, mechanical strength, and swelling of the hydrogel. NOCC/OXG hydrogel has a low endotoxin value and is not toxic to fibroblast cells. We recommend further studies to apply NOCC/OXG hydrogel in bio-ink. Keywords: N · O-Carboxymethyl Chitosan (NOCC) · Oxidized Xanthan Gum (OXG) · NOCC/OXG Hydrogel · Bio-Ink

1 Introduction 3D bioprinting technology has been improving for bio-manufacturing. From here, we can use in vitro tissues or organs as a drug test model. In the near future, we are waiting to use the production of replacement organs for medical applications [1, 2]. Bio-ink is a major component of 3D bioprinting technology. For medical applications, developing a suitable bio-ink, supporting cellular to grow and develop, is extremely important [3–5]. The printed products should have the ability to generate skeletons for multiple cell types with formability, biocompatibility, and cell adhesion. This requires thorough studies on the mechanical properties of bio-ink through the experimental survey of the quality of bio-ink [3]. Choosing the right material for bio-ink is strategic in creating the final product [6]. Natural polymers have excellent cell compatibility advantages. They can be easy to be changed in structure to cross-link to form a network of hydrated solid polymers. © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. T. Vo et al. (Eds.): BME 2022, IFMPE Proceedings 95, pp. 261–272, 2024. https://doi.org/10.1007/978-3-031-44630-6_21

262

P. H. Vo et al.

Optimizing the natural polymeric material structure to have suitable bio-ink is a challenge. Researchers have adjusted pH and temperature, or employed a crosslinking agent to enhance the structure of natural polymers [7]. However, medical application of these methods has been reported to have difficulties with cellular adhesion and cytotoxicity, leading to higher implant failure rates [8]. Dynamic covalent bonding method is a recently introduced method with the advantage of independently utilizing the inherent composition of the bio-ink system, avoiding the limitations of crosslinking agents, enzymes or photochemical activator [9]. In there, the Schiff base bond between the amine (-NH2 ) and aldehyde (–CHO) functional groups has the advantage of faster gelation than other types of bonds. Natural polymer materials, such as chitosan, xanthan gum, combining with a hydrogel system, may meet the mechanical stability after printing and can biocompatible, biodegradable and less immunogenic. Chitosan has multiple useful properties, including biocompatibility, biodegradability, and antibacterial qualities, and is used in a variety of biomedical fields. Chitin, a straight-chain polysaccharide, is partially reduced to create chitosan, which has −NH2 and −OH active groups [10, 11]. However, the hydrogel system from chitosan has the disadvantages of slow gelation time (up to 10 min) and poor mechanical properties. Even when the solution has a high viscosity, it only kept the hydrogel structure stable for a few hours. Moreover, the low pH is usually required for chitosan solvable but affects the cell adhesion. In addition, xanthan gum (XG) is a natural heteropolysaccharide produced industrially by fermenting glucose by the bacterium Xanthomonas campestris [12]. Even at small concentrations, XG has high viscosity, stable over a wide range of pH, ionic concentrations and temperatures, non-toxicity, excellent biocompatibility, intrinsic ability to effect immunoassays [13]. In this paper, we would apply chitosan carboxymethylation [14] to improve its solubility at neutral pH, carboxymethyl groups were added to the N- and O- positions of the glucosamine and N-acetylglucosamine units of chitosan, resulting in the NOCC. XG was chosen as a natural polysaccharide material satisfying the possession of two adjacent carbons with the same hydroxyl radical (vicinal diol) in the monomer structure which will be oxidized to the dialdehyde functional group by the agent sodium periodate (NaIO4 ) [15]. At the end, NOCC and OXG molecules form cross-links when the materials are combined to create the hydrogel products. These products were evaluated for gelation, mechanical strength, degradability, stability, biocompatibility.

2 Materials and Methods 2.1 Materials and Methods The chitosan from shrimp shells was purchased from the Vietnam Food Joint Stock Company. The xanthan gum was bought from Deosen Biochemical Ltd. Ethylene glycol, sodium periodate, hydrochloric acid, sodium hydroxide, and isopropyl alcohol were obtained from Xilong Chemical Co., Ltd (China). Chloroacetic acid was acquired from HiMedia Laboratories Pvt. Ltd. Chromogenic Endotoxin Quant Kit was obtained from Thermo Scientific (USA). Phosphate buffered saline (P4417) was bought from SigmaAldrich Co. (USA). All other chemicals are analytical grade.

Preparation and Characterization of the Hydrogel System

263

2.2 Hydrogel Preparation Preparation of NOCC NOCC was prepared based on a previously reported method [16]. 2 g chitosan was soaked in 10 mL isopropyl alcohol, then 10 mL NaOH 13 N was added. The mixture was incubated for 1 h at room temperature. 6.25 g chloroacetic acid dissolved in 10 mL isopropyl alcohol and added into the mixture. The mixture was incubated for 3 h at 60 °C. After collecting the solid phase of the mixture, the product was dissolved in distilled water and adjusted pH to 7.4 by HCl 2.5 M. The final mixture was lyophilized in the Freezone 6L Benchtop Freeze Dry System (Labconco, USA) in three days, producing NOCC. The final product was analyzed by the FTIR method before proceeding to the next steps. Preparation of OXG Sodium periodate 20% (w/w) was slowly added into xanthan gum 0,6% (w/w), at ratio 5:300 (v/v), stir continuously for 3 h in dark at room temperature. After that, ethylene glycol was added into the mixture, at ratio 1:83 (v/v) and was stirred at room temperature in the absence of light for 1 h to stop the reaction. The final mixture was lyophilized in three days, checked the pH value around 7.4, freeze-dried to obtain OXG. The final product was analyzed by the FTIR method before proceeding to the next steps. Synthesis of NOCC/OXG Hydrogels The lyophilized NOCC and OXG were dissolved in distilled water at 3% (w/w) and 1% (w/w) respectively. The NOCC/OXG hydrogel was generated by mixing the NOCC and OXG at 1:1 (N1O1), 1:2 (N1O2), 1:4 (N1O4) volume ratio to make a homogeneous solution. 2.3 Characterization of Hydrogels Scanning Electron Microscopy (SEM) of NOCC/OXG Hydrogels SEM imaging was performed to evaluate the surface structure of the hydrogel. Briefly, the hydrogels wound be gone through the lyophilization process to get dry scaffolds. After being coated with gold within one minute by coating machine (Cressington Sputter Coater 108 auto, Cressington Scientific Instrument, UK), samples were observed under JSM-IT100 InTouchScope™ SEM (JEOL, Japan) at 10 -15 kV. The images were analyzed using ImageJ (Image Processing and Analysis in Java, provide by National Institutes of Health, NIH-USA). Fourier-Transform Infrared Spectroscopy (FTIR) Analysis To observe the interaction between NOCC and OXG, Fourier-transform infrared spectroscopy (FTIR) was performed. Using a wavelength range of 4000 - 400 cm−1 under FTIR spectrometer (Thermo Scientific Nicolet™ 6700), the spectra were recoded and evaluated. Compressive Strength Place the prepared cylindrical hydrogel samples on the flat plate of the TA.XTPlus

264

P. H. Vo et al.

Texture Analyzer (Stable micro system, UK), select the program. The flat plate of the analyzer was lowered to create the compressive stress and the deformation extent of the samples was recorded. Swelling Study The water absorption of the hydrogel samples was evaluated through the swelling index. The newly hydrogel samples were prepared and their weight was noted down. After that, the hydrogels were immersed in 30 mL of 1X phosphate buffer saline (PBS) in a beaker. The hydrogels were removed from the PBS solution and were cleaned entirely using paper tissue. The swelling percentage was calculated by applying the formula (1): Swelling ratio (%) =

Wswollen gel − Winitial gel × 100 Winitial gel

(1)

The weights of swollen hydrogel (mg) and newly produced hydrogel (mg) are shown by Wswollen gel and Winitial gel , respectively. The experiment was performed three times. In Vitro Degradation Studies Weigh the freshly prepared hydrogel samples (W0 ), then immerse them in 30 mL of 1X PBS at pH = 7.4 and temperature 37 °C. This study was conducted for 60 days. At 8, 16, 24, and 60-day intervals, the weight of hydrogels was recorded (Wt ). After recording their weight, the PBS solution was refreshed. The hydrogel samples were replicated in triplicate. The degradation percentage (Wd ,%) was got according to the Eq. (2): Wd (%) =

Wt × 100 W0

(2)

2.4 Endotoxin Test Endotoxin concentrations in NOCC/OXG solutions were assessed using the Thermo Scientific™ Pierce™ Chromogenic Endotoxin Quant Kit. NOCC/OXG hydrogel samples were processed according to the manufacturer’s procedures. Extract solutions were prepared by immersing 0.1 g sample per 1 mL of endotoxin-free water and incubated for 24 h at 37 ± 1 °C. Adjust the samples pH to 6–8 using endotoxin-free 0.1 M NaOH. 200 μL of extraction were put on 96-well flat-bottomed tissue culture test plates (Millipore Sigma; Cat#Z707902). The results were read at λ = 405 nm on a microplate reader (Varioskan™ LUX multimode microplate reader, Thermo Scientific™). Raw data was then analyzed with the calibration curve obtained from four standards points (1.00, 0.50, 0.25, and 0.10 EU/mL). 2.5 In Vitro Cytotoxicity Assay The in vitro cytotoxicity test was performed according to ISO 10993–5:2009, using resazurin (Sigma-Aldrich® ) reagent. Normal fibroblast L929 cells (ATCC®) were cultured in 5% fetal bovine albumin and 1% antibiotics containing DMEM medium (Gibco™) and seeded at a density of 1 × 105 cells/mL in 96-well plates for 24 h. Following

Preparation and Characterization of the Hydrogel System

265

ISO 10993–12:2012, extract solutions were prepared by immersing 0.1 g sample per 1 mL culture media (DMEM, 10% FBS, and 1% penicillin-streptomycin) and incubated for 24 h at 37 ± 1 °C. The extracts were added to the cell-seeded wells and cultured for 24 h. After that, the extract solutions were removed and the culture media with resazurin (0.02 mg/mL) was added to each well and incubated for another 4 h. The fluorescence signals were measured at 530 nm/590 nm using a microplate reader (Varioskan™ LUX multimode microplate reader, Thermo Scientific™).

3 Results and Discussion 3.1 Fabrication and Characterization of NOCC/OXG Hydrogels OXG was synthesized by oxidizing xanthan gum with NaIO4 . The extra hydroxyl groups of XG are oxidized to dialdehyde, thereby opening the ring to form dialdehyde derivatives. NOCC is obtained by carboxymethylation of chitosan. The carboxymethyl groups are introduced into the N-terminus and the O-terminus of chitosan. Here the reaction occurs between the amine and hydroxyl groups of chitosan and the electrophilic carbon atom of monochloroacetic acid. The NOCC/OXG hydrogel is made by a Schiff base reaction between the amino group of NOCC and the aldehyde group of OXG (Fig. 1). The formation of amide bond cross-linked between NOCC and OXG resulted in porous structures in the hydrogel (Fig. 2). Accordant to the visual observation that the N1O4 and N1O2 hydrogel had a sturdier shape greater than N1O1 hydrogel. Thus, it is concluded that the increasing percentage of OXG in mixture can enhance the gelation ability of structure which can be explained by the more appearance of aldehyde (−CHO) groups in the units of XG, the more formation of Schiff base bonds with amine (−NH2 ) of NOCC. The surface morphology of the three hydrogel samples was recorded by SEM (Fig. 3A). Examining the NOCC/OXG hydrogel samples showed a connected porous structure, with intact walls and mainly circular pores. The results show that there is a gradual increase in pore size when increasing the proportion of OXG in the hydrogel. Specifically, the sample with the ratio NOCC/OXG 1:1 had the smallest pore size (116.98 ± 8.71 μm) and increased gradually at the ratio 1:2 (131.89 ± 7.56 μm) and 1:4 (173.02 ± 10.90 μm). Our Fig. 3B also shows the homogeneity of the pore diameter. Depending on the different cell types, it is necessary to investigate to find the right pore size to help the cells attach and grow. The pore size in hydrogel samples should be from 100 μm to 135 μm for bone cell growing [17]. Our results showed a solution for adjusting the hydrogel pore diameter, adjust NOCC:OXG ratio. To evaluate the characteristics of functional groups of NOCC/OXG hydrogel, we use the FTIR method with NOCC and OXG used as controls. The FTIR spectra of NOCC show the main peaks at 1411 cm−1 (νs (COO-)) and 1601 cm−1 (νa (COO-) ) correspond to the symmetric and asymmetric stretching vibration of the carboxylate ion, this show that the conversion of chitosan to NOCC has been successful [18]. A strong and wide band at 3600 − 3000 cm−1 (ν(O-H)) was OH stretching vibration. The appearance of the special peak at 1741 cm−1 (ν(C = O)) is attributed to C = O stretching vibrations involving the aldehyde groups, which indicates the successful oxidation of XG to OXG [19]. To make the NOCC/OXG hydrogel, one introduces the NOCC chain

266

P. H. Vo et al.

Fig. 1. The Schiff base between NOCC and OXG.

Fig. 2. Surface morphology of NOCC/OXG hydrogel at different ratios 1:1 (N1O1), 1:2 (N1O2) and 1:4 (N1O4) in two vision direction (front and top front view), and the crosslinking time was 60 min for all samples, scale bar = 5 mm.

into the 3D lattice of OXG. The Schiff base reaction occurs to form a dynamic covalent imine bond through the crosslinking of the amine and aldehyde groups. Here, we show that the stretching vibration of C = O at 1741 cm−1 (ν(C = O)) is different between the hydrogel samples. The peak at 1741 cm−1 (ν(C = O)) of NOCC/OXG 1:1 is quite small, showing that the imine bond is formed just enough, few (or no) residual C = O groups. NOCC/OXG 1:2 and/or 1:4 still have peaks at 1741 cm−1 (ν(C = O)), probably, because of the remaining of OXG. In addition, the C = N group, larger absorption band at 1606 cm−1 (ν(C = N)), shows that the major amines of NOCC and the aldehyde groups

Preparation and Characterization of the Hydrogel System

267

Fig. 3. Characterization of the NOCC/OXG hydrogel. (A) Surface morphology of the freeze-dried NOCC/OXG hydrogel at different ratios 1:1, 1:2, 1:4 captured by SEM, scale bar = 500 μm; (B) Pore size of NOCC/OXG hydrogel measured from SEM images using ImageJ software (100 measurements/samples).

of OXG have formed a Schiff base bond. The broad peak at 3600–3000 cm−1 (ν(OH)) usually is a marker for OH groups of all hydrogels, exhibiting their water holding or holding capacity. Those results showed that we have been synthesized NOCC/OXG hydrogel (Fig. 4). The mechanical properties of the hydrogels were evaluated in the form of compressive stress and compressive strain, as shown in Fig. 5 and Table 1. Through the observation of those results, it is reasonable to see that in the same oxidation degree, volume ratio 1:4 (1859.8 ± 49.5 Pa) has better mechanical properties than 1:2 (1340.7 ± 70.8 Pa) and 1:2 ratio is better than 1:1 (735.2 ± 40.1 Pa). There might be a possibility that the volume ratio (1:1 – 1:4) is proportional to the stability of the hydrogel’s structure. One of the goals of this study was to increase the hydrogel’s ability to maintain dimensional stability in a physiological solution. The swelling evaluation results (Fig. 6A) showed that the hydrogel samples took the same time period to reach equilibrium (within 3 h). Degradation results (Fig. 6B) performed within 60 days showed all samples had rather low degradation rates, with over 50% remaining at 60th day. The hydrogels fabricated from 1:1 volume ratio could not retain their cylindrical shape at a very early

268

P. H. Vo et al.

Fig. 4. The FTIR spectra of: NOCC, OXG and NOCC/OXG hydrogel at ratio 1:1 (N1O1), 1:2 (N1O2) and 1:4 (N1O4).

Fig. 5. Compressive stress-strain curves of the hydrogel samples.

Table 1. Values of compressive strength at 50% strain. Samples

Compressive strength (Pa)

N1O1

735.2 ± 40.1

N1O2

1340.7 ± 70.8

N1O4

1859.8 ± 49.5

stage, while hydrogels from 1:2 and 1:4 ratio consist much stability. Although the shape has been broken, the residue remains in the container, which contributes to the weight remaining until the last day. Over time, the outlook of the hydrogel was changed in the

Preparation and Characterization of the Hydrogel System

269

trend of being more yellow, which could be explained by the oxidation from environmental factors. This result is consistent with the SEM imaging and compressive strength, showing that thanks to many cross-linking networks, it helps to strengthen the mechanical strength and dimensional stability in the physiological solution, the degradation speed was impeded.

Fig. 6. Swelling and degradation analysis of NOCC/OXG hydrogels in PBS solution (values = mean ± SD, n = 3). (A) Swelling ratio over time; (B) Degradation test through 60 days by calculating the weight remaining (%) parameter.

3.2 Endotoxin Test Endotoxins are complex lipopolysaccharides (LPS), are found in the outer cell membrane of gram-negative bacteria. This macromolecule is responsible for septic shock leading to failure in animal model studies. Therefore, testing endotoxin levels in hydrogel samples plays a role in reducing the risk of sepsis and septic shock for further studies in animal models [20, 21]. We examined the expression of endotoxins found in the hydrogel samples tested using the endotoxin assay (Table 2). The results showed no significant difference in endotoxin concentrations between the hydrogel samples: N1O1, the lowest one, (0.989 ± 0.0704 EU/mL), N1O2 (0.995 ± 0.0225 EU/mL) and N1O4 (1.042 ± 0.014 EU/mL). All samples had lower endotoxin levels than other bio-ink products on the market such as: TissueFab® bioink Alg(Gel)ma-UV/365 nm (