Yeast Surface Display: Methods, Protocols, and Applications [1 ed.] 1493927477, 978-1-4939-2747-0, 978-1-4939-2748-7

Citation preview

Methods in Molecular Biology 1319

Bin Liu Editor

Yeast Surface Display Methods, Protocols, and Applications

METHODS

IN

MOLECULAR BIOLOGY

Series Editor John M. Walker School of Life and Medical Sciences University of Hertfordshire Hatfield, Hertfordshire, AL10 9AB, UK

For further volumes: http://www.springer.com/series/7651

Yeast Surface Display Methods, Protocols, and Applications

Edited by

Bin Liu UCSF, San Francisco, CA, USA

Editor Bin Liu UCSF San Francisco, CA, USA

ISSN 1064-3745 ISSN 1940-6029 (electronic) Methods in Molecular Biology ISBN 978-1-4939-2747-0 ISBN 978-1-4939-2748-7 (eBook) DOI 10.1007/978-1-4939-2748-7 Library of Congress Control Number: 2015937748 Springer New York Heidelberg Dordrecht London © Springer Science+Business Media New York 2015 This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, express or implied, with respect to the material contained herein or for any errors or omissions that may have been made. Cover illustration: The front cover photo was contributed by Maxwell Cherf and Dr. Jennifer R. Cochran. The scanning electron microscope image of yeast cells was purchased from PSmicrographs. Printed on acid-free paper Humana Press is a brand of Springer Springer Science+Business Media LLC New York is part of Springer Science+Business Media (www.springer.com)

Preface Yeast surface display techniques have evolved into a versatile tool for research and industrial applications. In 1993, Maarten P. Schreuder and colleagues described yeast cell wall display of heterologous proteins. In 1997, K. Dane Wittrup and colleagues described yeast surface polypeptide display library construction and screening. Since then, the field has seen explosive growth. Yeast surface display is now widely used for antibody library screening, protein and antibody engineering, and discovery of novel protein-ligand interactions. Billionmember antibody fragment libraries have been created and displayed on the surface of yeast, and used for identification of novel antibodies with desired affinity and specificity. The technique is also widely used in protein engineering to improve catalytic activities of enzymes, affinity and specificity of macromolecules such as T cell receptors, and fine epitope mapping. Furthermore, large human cDNA fragment libraries have been created and displayed on the surface of yeast, allowing identification of cellular proteins binding to a wide variety of ligands including nonprotein ligands. In addition to basic research, yeast surface display technology has found applications in industrial processes such as biofuel production and biosensor development. It is our hope that the content of this volume will help accelerate the work of protein chemists, antibody engineers, molecular and cell biologists, and industrial bioengineers. San Francisco, CA, USA

Bin Liu

v

Contents Preface. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Contributors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

v ix

PART I YEAST SURFACE ANTIBODY DISPLAY LIBRARY AND ANTIBODY ENGINEERING 1 Protein Engineering and Selection Using Yeast Surface Display . . . . . . . . . . . . Alessandro Angelini, Tiffany F. Chen, Seymour de Picciotto, Nicole J. Yang, Alice Tzeng, Michael S. Santos, James A. Van Deventer, Michael W. Traxlmayr, and K. Dane Wittrup 2 Isolation and Validation of Anti-B7-H4 scFvs from an Ovarian Cancer scFv Yeast-Display Library. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Denarda Dangaj and Nathalie Scholler 3 Combining Phage and Yeast Cell Surface Antibody Display to Identify Novel Cell Type-Selective Internalizing Human Monoclonal Antibodies. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Scott Bidlingmaier, Yang Su, and Bin Liu 4 Yeast Display-Based Antibody Affinity Maturation Using Detergent-Solubilized Cell Lysates . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Benjamin J. Tillotson, Jason M. Lajoie, and Eric V. Shusta

PART II

3

37

51

65

YEAST SURFACE DISPLAY AS A TOOL FOR PROTEIN ENGINEERING

5 Yeast Endoplasmic Reticulum Sequestration Screening for the Engineering of Proteases from Libraries Expressed in Yeast . . . . . . . . . Li Yi, Joseph M. Taft, Qing Li, Mark C. Gebhard, George Georgiou, and Brent L. Iverson 6 T Cell Receptor Engineering and Analysis Using the Yeast Display Platform . . Sheena N. Smith, Daniel T. Harris, and David M. Kranz 7 Epitope-Specific Binder Design by Yeast Surface Display . . . . . . . . . . . . . . . . . Jasdeep K. Mann and Sheldon Park 8 Applications of Yeast Surface Display for Protein Engineering . . . . . . . . . . . . . Gerald M. Cherf and Jennifer R. Cochran

vii

81

95 143 155

viii

Contents

PART III YEAST SURFACE CDNA DISPLAY LIBRARY CONSTRUCTION AND APPLICATIONS 9 Identification of Novel Protein–Ligand Interactions by Exon Microarray Analysis of Yeast Surface Displayed cDNA Library Selection Outputs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Scott Bidlingmaier and Bin Liu 10 Identification of Posttranslational Modification-Dependent Protein Interactions Using Yeast Surface Displayed Human Proteome Libraries . . . . . . Scott Bidlingmaier and Bin Liu 11 Utilizing Yeast Surface Human Proteome Display Libraries to Identify Small Molecule-Protein Interactions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Scott Bidlingmaier and Bin Liu

179

193

203

PART IV YEAST SURFACE DISPLAY IN BIOASSAY AND INDUSTRIAL APPLICATIONS 12 Enzyme Evolution by Yeast Cell Surface Engineering . . . . . . . . . . . . . . . . . . . Natsuko Miura, Kouichi Kuroda, and Mitsuyoshi Ueda 13 Electrochemical Glucose Biosensor Based on Glucose Oxidase Displayed on Yeast Surface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Hongwei Wang, Qiaolin Lang, Bo Liang, and Aihua Liu 14 Coupling Binding to Catalysis: Using Yeast Cell Surface Display to Select Enzymatic Activities . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Keya Zhang, Karan Bhuripanyo, Yiyang Wang, and Jun Yin 15 The Use of Yeast Surface Display in Biofuel Cells . . . . . . . . . . . . . . . . . . . . . . Alon Szczupak and Lital Alfonta

217

Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

269

233

245 261

Contributors LITAL ALFONTA • Department of Life Sciences and Ilse Katz Institute for Nanoscale Science and Technology, Ben-Gurion University of the Negev, Beer-Sheva, Israel ALESSANDRO ANGELINI • Koch Institute for Integrative Cancer Research, Massachusetts Institute of Technology, Cambridge, MA, USA; Department of Chemical Engineering, Massachusetts Institute of Technology, Cambridge, MA, USA KARAN BHURIPANYO • Department of Chemistry, University of Chicago, Chicago, IL, USA SCOTT BIDLINGMAIER • Department of Anesthesia, UCSF Helen Diller Family Comprehensive Cancer Center, University of California at San Francisco, San Francisco, CA, USA TIFFANY F. CHEN • Koch Institute for Integrative Cancer Research, Massachusetts Institute of Technology, Cambridge, MA, USA; Department of Biological Engineering, Massachusetts Institute of Technology, Cambridge, MA, USA GERALD M. CHERF • Department of Bioengineering, Stanford University, Stanford, CA, USA JENNIFER R. COCHRAN • Department of Bioengineering, Stanford University, Stanford, CA, USA; Department of Chemical Engineering, Stanford University, Stanford, CA, USA DENARDA DANGAJ • Department of Oncology, Ludwig Cancer Research Center, University of Lausanne, Lausanne, Switzerland JAMES A. VAN DEVENTER • Koch Institute for Integrative Cancer Research, Massachusetts Institute of Technology, Cambridge, MA, USA; Department of Chemical Engineering, Massachusetts Institute of Technology, Cambridge, MA, USA MARK C. GEBHARD • Department of Chemical Engineering, University of Texas at Austin, Austin, TX, USA GEORGE GEORGIOU • Department of Chemical Engineering, University of Texas at Austin, Austin, TX, USA; Section of Molecular Genetics and Microbiology, University of Texas at Austin, Austin, TX, USA DANIEL T. HARRIS • Department of Biochemistry, University of Illinois, Urbana, IL, USA BRENT L. IVERSON • Department of Chemistry and Biochemistry, University of Texas at Austin, Austin, TX, USA DAVID M. KRANZ • Department of Biochemistry, University of Illinois, Urbana, IL, USA KOUICHI KURODA • Division of Applied Life Sciences, Graduate School of Agriculture, Kyoto University, Sakyo-ku, Kyoto, Japan JASON M. LAJOIE • Department of Chemical and Biological Engineering, University of Wisconsin-Madison, Madison, WI, USA QIAOLIN LANG • Laboratory for Biosensing, Qingdao Institute of Bioenergy & Bioprocess Technology (QIBEBT) and Key Laboratory of Biofuels (QIBEBT), Chinese Academy of Sciences, Qingdao, China QING LI • Department of Chemistry and Biochemistry, University of Texas at Austin, Austin, TX, USA

ix

x

Contributors

BO LIANG • Laboratory for Biosensing, Qingdao Institute of Bioenergy & Bioprocess Technology (QIBEBT) and Key Laboratory of Biofuels (QIBEBT), Chinese Academy of Sciences, Qingdao, China AIHUA LIU • Laboratory for Biosensing, Qingdao Institute of Bioenergy & Bioprocess Technology (QIBEBT) and Key Laboratory of Biofuels (QIBEBT), Chinese Academy of Sciences, Qingdao, China BIN LIU • Department of Anesthesia, UCSF Helen Diller Family Comprehensive Cancer Center, University of California at San Francisco, San Francisco, CA, USA JASDEEP K. MANN • Department of Chemical and Biological Engineering, University at Buffalo, Buffalo, NY, USA; Bluebird Bio, Seattle, WA, USA NATSUKO MIURA • Division of Applied Life Sciences, Graduate School of Agriculture, Kyoto University, Sakyo-ku, Kyoto, Japan; Radiation Oncology Branch, National Cancer Institute, National Institutes of Health, Bethesda, MD, USA SHELDON PARK • Department of Chemical and Biological Engineering, University at Buffalo, Buffalo, NY, USA SEYMOUR DE PICCIOTTO • Koch Institute for Integrative Cancer Research, Massachusetts Institute of Technology, Cambridge, MA, USA; Department of Biological Engineering, Massachusetts Institute of Technology, Cambridge, MA, USA MICHAEL S. SANTOS • Koch Institute for Integrative Cancer Research, Massachusetts Institute of Technology, Cambridge, MA, USA; Department of Chemical Engineering, Massachusetts Institute of Technology, Cambridge, MA, USA NATHALIE SCHOLLER • Biosciences, SRI International, Menlo Park, CA, USA ERIC V. SHUSTA • Department of Chemical and Biological Engineering, University of Wisconsin-Madison, Madison, WI, USA SHEENA N. SMITH • Department of Biochemistry, University of Illinois, Urbana, IL, USA YANG SU • Department of Anesthesia, UCSF Helen Diller Family Comprehensive Cancer Center, University of California at San Francisco, San Francisco, CA, USA ALON SZCZUPAK • Department of Life Sciences and Ilse Katz Institute for Nanoscale Science and Technology, Ben-Gurion University of the Negev, Beer-Sheva, Israel JOSEPH M. TAFT • Department of Chemistry and Biochemistry, University of Texas at Austin, Austin, TX, USA BENJAMIN J. TILLOTSON • Department of Chemical and Biological Engineering, University of Wisconsin-Madison, Madison, WI, USA MICHAEL W. TRAXLMAYR • Koch Institute for Integrative Cancer Research, Massachusetts Institute of Technology, Cambridge, MA, USA; Department of Chemical Engineering, Massachusetts Institute of Technology, Cambridge, MA, USA ALICE TZENG • Koch Institute for Integrative Cancer Research, Massachusetts Institute of Technology, Cambridge, MA, USA; Department of Biological Engineering, Massachusetts Institute of Technology, Cambridge, MA, USA MITSUYOSHI UEDA • Division of Applied Life Sciences, Graduate School of Agriculture, Kyoto University, Sakyo-ku, Kyoto, Japan HONGWEI WANG • Laboratory for Biosensing, Qingdao Institute of Bioenergy & Bioprocess Technology (QIBEBT) and Key Laboratory of Biofuels (QIBEBT), Chinese Academy of Sciences, Qingdao, China; State Key Laboratory of Crop Biology, College of Agronomy, Shandong Agricultural University, Tai’an, Shandong, China YIYANG WANG • Department of Chemistry, Georgia State University, Atlanta, GA, USA

Contributors

xi

K. DANE WITTRUP • Koch Institute for Integrative Cancer Research, Massachusetts Institute of Technology, Cambridge, MA, USA; Department of Chemical Engineering, Massachusetts Institute of Technology, Cambridge, MA, USA; Department of Biological Engineering, Massachusetts Institute of Technology, Cambridge, MA, USA NICOLE J. YANG • Koch Institute for Integrative Cancer Research, Massachusetts Institute of Technology, Cambridge, MA, USA; Department of Chemical Engineering, Massachusetts Institute of Technology, Cambridge, MA, USA LI YI • Department of Chemistry and Biochemistry, University of Texas at Austin, Austin, TX, USA JUN YIN • Department of Chemistry, Georgia State University, Atlanta, GA, USA KEYA ZHANG • Department of Chemistry, University of Chicago, Chicago, IL, USA

Part I Yeast Surface Antibody Display Library and Antibody Engineering

Chapter 1 Protein Engineering and Selection Using Yeast Surface Display Alessandro Angelini, Tiffany F. Chen, Seymour de Picciotto, Nicole J. Yang, Alice Tzeng, Michael S. Santos, James A. Van Deventer, Michael W. Traxlmayr, and K. Dane Wittrup Abstract Yeast surface display is a powerful technology for engineering a broad range of protein scaffolds. This protocol describes the process for de novo isolation of protein binders from large combinatorial libraries displayed on yeast by using magnetic bead separation followed by flow cytometry-based selection. The biophysical properties of isolated single clones are subsequently characterized, and desired properties are further enhanced through successive rounds of mutagenesis and flow cytometry selections, resulting in protein binders with increased stability, affinity, and specificity for target proteins of interest. Key words Yeast surface display, Protein engineering, Directed evolution, Combinatorial library screening, Protein binders, Biophysical characterization

1

Introduction Directed evolution by yeast surface display has been used to engineer diverse protein scaffolds for therapeutic, diagnostic, and biotechnological applications [1, 2]. The efficacy of yeast surface display in protein engineering was first validated for the affinity maturation of existing protein binding scaffolds [3–7], but subsequently it has been shown to be highly useful for isolating de novo protein binders from naïve combinatorial libraries [8]. Combinatorial libraries of multiple immunoglobulin and nonimmunoglobulin scaffolds have been generated to enhance existing affinities or to introduce de novo binding function toward a wide spectrum of targets, including small organic molecules, peptides, and both soluble and membrane proteins [1, 2]. Single- or multiplechain immunoglobulin scaffolds include the antibody single-chain variable fragment (scFv) [3–8], the antibody fragment antigenbinding (Fab) portion [9–13], the fragment crystallizable (Fc)

Bin Liu (ed.), Yeast Surface Display: Methods, Protocols, and Applications, Methods in Molecular Biology, vol. 1319, DOI 10.1007/978-1-4939-2748-7_1, © Springer Science+Business Media New York 2015

3

4

Alessandro Angelini et al.

portion of immunoglobulin G (IgG) [14–16], the whole IgG [17], the camelid single-domain antibody (VHH) [18–20], and the singlechain T cell receptor (scTCR) [6, 21, 22]. Non-immunoglobulin scaffolds successfully engineered by yeast surface display comprise cystein knot peptides (knottins) [23–27], the human tenth domain of fibronectin type III (Fn3) [28–31], the lamprey variable lymphocyte receptor (VLR) [32, 33], the hyperthermophilic DNAbinding protein Sso7d [34, 35], human serum albumin (HSA) [36], green fluorescent protein (GFP) [37, 38], major histocompatibility complex (MHC) [39, 40], cytokines (e.g., interleukin-2, IL-2 [41–43]; interleukin-4, IL-4 [44]), growth factors (e.g., epidermal growth factor, EGF [45, 46]; vascular endothelial growth factor, VEGF [47]; hepatocyte growth factor, HGF [48]), the kringle domain [49], and hormones (e.g., leptins [50]). In addition to improving the affinity of protein binders, yeast surface display technology has also been used successfully to develop cross-reactive protein binders [51], generate conformation specific binders [52, 53], improve the stability and biophysical properties of a protein [22, 54–56], and engineer the function of several enzymes such as horseradish peroxidase (HRP) [57], biotin ligase BirA [58], sortase A [59], and several lipases [60–62], among many others. Another powerful application of yeast surface display is the identification of binding epitopes on a target protein. Fine epitope mapping to the level of functionally important amino acids has been achieved by generating yeast surface displayed libraries of fulllength or single-domain protein targets modified by random or rational mutagenesis, and assaying the binding phenotypes of linear- or conformation-specific binders toward these targets by flow cytometry [63–68]. Yeast surface display, like other directed evolution display technologies such as phage display [69], bacterial display [70], mammalian display [71, 72], ribosome display, and mRNA display [73], relies on an intimate linkage between genotype (plasmid encoding the gene) and phenotype (protein scaffold expressed on the cell surface). Although different yeast strains and numerous cell wall anchors have been used to display a large variety of protein scaffolds [33, 74–76], the Saccharomyces cerevisiae Aga2 protein of the mating protein a-agglutinin remains the most commonly used. In this system, protein scaffolds are expressed as fusions to the Aga2 protein that is linked to the a-agglutinin Aga1 protein through two disulfide bridges, resulting in a covalent complex on the surface of the yeast cell (Fig. 1). The gene encoding the Aga1 protein is stably integrated into the yeast chromosome, while the gene encoding the protein scaffold-Aga2 fusion is cloned into a circular yeast display plasmid vector that is maintained episomally in the yeast using a nutritional marker for selective growth (Fig. 1). Expression of both Aga1 and Aga2 is under the control of the galactose-inducible

Protein Engineering by Yeast Surface Display

5

Fig. 1 Schematic of protein scaffolds displayed on the surface of yeast and related plasmid maps. (a) Left, using the vector pCT-CON, the protein scaffold (dark grey ) is displayed as a C-terminal fusion to the Aga2 protein (light grey ), flanked by two tags for immunofluorescent detection: a hemagglutinin (HA) epitope tag (YPYDVPDYA) at the N-terminus (black) and a c-myc epitope tag (EQKLISEEDL) at the C-terminus (white). The Aga2 protein forms two disulfide bonds with the membrane-anchored Aga1 protein. Right, map of pCT-CON vector. (b) Left, using the pCHA vector, the protein scaffold (dark grey) is displayed as a N-terminal fusion to the Aga2 (light grey ) protein, flanked by an HA epitope tag at the N-terminus (black) and a c-myc epitope tag at the C-terminus (white). Right, map of pCHA vector. The vectors contain the following elements: GAL1-10 promoter, Aga2 gene, HA epitope tag, c-myc epitope tag, phosphoribosylanthranilate isomerase gene (TRP1), centromere sequence (CEN6), autonomously replicating sequence (ARSH4), MF alpha-1 terminator, TEM-1 β-lactamase gene (AmpR), and ColE1 origin of replication

promoter (Fig. 1). Since surface display is conditional rather than constitutive, potentially cytotoxic protein scaffolds can be expressed, circumventing library bias due to the negative selection of such scaffolds. Protein scaffolds can be displayed on the yeast surface as either C- or N-terminal fusions to the Aga2 protein (Fig. 1). To avoid possible steric hindrance that may affect the function of the protein scaffolds, the orientation of the fusions should be determined empirically. However, most commonly used protein scaffolds behave well when fused to the C-terminus of Aga2. Each yeast cell typically displays ~5 × 104 copies of the protein scaffold-Aga2

6

Alessandro Angelini et al.

fusions, although individual expression levels may be lower or higher depending on the stability and solubility of the protein scaffold. Variations in surface protein scaffold-Aga2 fusion expression levels can be measured and normalized by detecting the hemagglutinin (HA) and c-myc epitope tags using flow cytometry. Similarly, binding to the target of interest can be determined by labeling yeast cells with the biotinylated target and a secondary anti-biotin reagent that is conjugated to a fluorophore. Using a two-color labeling scheme, with one fluorophore for expression (anti-HA or c-myc tag) and another for target binding (antibiotin), protein scaffolds can be engineered for higher affinity and stability concomitantly. Alternative methods based on a “secretion-and-capture” approach have shown recent success. In these systems, the yeast cell surface is chemically conjugated to exogenous small organic capture molecules that specifically and non-covalently interact with the secreted protein scaffold in an autocrine fashion [17, 36, 77, 78]. Additionally, yeast surface 2-hybrid has been developed to enable the quantitative measurement of pairwise protein interactions via the secretory pathway by co-expressing both a protein scaffold (bait) that is covalently anchored to the cell wall, and a solubly secreted protein target (prey). This approach allows flow cytometry-based analysis of protein–protein interactions without the addition of exogenous labeled targets [39, 53, 79–81]. Yeast surface display technology offers several advantages over other display systems for the directed evolution of proteins. Because it relies on the eukaryotic post-translational machinery (e.g., disulfide isomerization and glycosylation), enabling the folding and secretion of large and complex glycosylated protein scaffolds containing multiple disulfide bonds that may be refractory to bacterial expression. Yeast surface display also allows high-throughput, quantitative screening and biophysical characterization of combinatorial libraries through the use of fluorescence-activated cell sorting (FACS), which confers multiple advantages. First, by using different protein target labeling approaches, including equilibrium binding, competition for limited target, and kinetic competition, yeast display combined with flow cytometry allows quantitative and fine discrimination between protein binders with varying binding affinities for the target [82, 83]. Moreover, flow cytometry allows the simultaneous screening of combinatorial libraries for binding to multiple targets. Finally, flow cytometry can be used for the biophysical characterization of individual protein binders as cell-surface fusions without the need for sub-cloning, soluble expression, and purification [54, 82, 84].

Protein Engineering by Yeast Surface Display

7

However, the yeast display technology is not without its limitations. First, the library size diversity (~107–109) is usually a few orders of magnitude lower than that obtained with other systems such as bacterial (~109–1011), phage (~109–1011), and mRNA (~1013–1014) display [2]. However, several studies have shown that yeast display libraries have higher functional library diversity because the post-translational processing of secreted proteins by yeast mimics that performed by mammalian cells [85, 86]. Recently, multiple display technologies have been combined to harness the unique advantages of each and enable previously unexplored applications [53, 86, 87]. Second, the differential glycosylation patterns in yeast and mammalian cells could also be a disadvantage for human glycosylated protein scaffolds displayed on yeast. However, recent studies have shown that this limitation can also be overcome [88]. Finally, for oligomeric protein targets, the presence of multiple protein scaffold copies on the surface of yeast could lead to undesired multivalent binding, and therefore the isolation of high avidity binders lacking the desired affinity. This limitation can be surmounted by applying kinetic selections [83]. Various protocols for protein engineering and selection using yeast surface display have been published previously [2, 28, 83, 89, 90]. In this work, we provide a detailed and updated protocol for the isolation of any class of protein binders from a combinatorial library and their subsequent characterization using yeast surface display. Protein binders are isolated by combining highly avid magnetic bead separations with subsequent FACS. Once initial candidate clones are identified, directed evolution can be applied, as needed, to engineer and select protein binders with improved properties of interest through several rounds of random mutagenesis and screening by dual-label flow cytometry (Fig. 2).

2

Materials

2.1 Yeast Strain and Plasmids

1. Yeast strain: the genetically modified Saccharomyces cerevisiae yeast strain, EBY100, was derived from BJ5465 (MATa, ura352, trp1, leu2, leu2Δ1, his3Δ200, pep4::HIS3, prb1Δ1.6R and can1 GAL) [3]. This strain is available from the authors or from the American Type Culture Collection (ATCC, catalogue No: MYA-4941). 2. Yeast display vectors: pCT-CON and pCHA are expression vectors designed for the expression, secretion, and display of protein scaffolds on the extracellular surface of Saccharomyces cerevisiae yeast strain EBY100 cells. Both vectors allow the detection of surface anchored protein scaffolds (Fig. 1). These plasmids are available from the authors.

8

Alessandro Angelini et al.

Fig. 2 The protein binder isolation and engineering process using yeast cell surface display. (a) Flowchart for the methodology of isolating protein binders from large combinatorial libraries displayed on yeast by magnetic bead separation followed by flow cytometry-based selection. The biophysical properties of isolated single clones are subsequently characterized, and desired properties are further enhanced through successive rounds of mutagenesis and flow cytometry selections, resulting in protein binders with desired properties; (b) Schematic representation for selection of protein binders from a naïve yeast display library using magnetic bead screening followed by flow cytometry sorting. The initial magnetic bead-based screening allows for the isolation of weak affinity binders through the highly avid interaction between yeast cells and the immobilized target on magnetic beads. Yeast cells isolated after the magnetic bead-based processes are further screened using fluorescence-activated cell sorting to isolate clones that exhibit higher binding affinity towards the target 2.2 Naïve Yeast Display Libraries

The following naïve yeast display libraries are available from the authors: Library

Diversity

Non-immune single chain antibody fragment (scFv) library [8]

1 × 109

Synthetic single chain antibody fragment (scFv) library G [91]

1 × 109

Human tenth type III fibronectin (Fn3) library G4 [28] 2.5 × 108

Protein Engineering by Yeast Surface Display

2.3 Yeast Media and Plates 2.3.1 Yeast Extract Peptone Dextrose (YPD)

9

Yeast Extract Peptone Dextrose (YPD) is a nutritionally rich media that allows high cell density (see Note 1). It is used for routine growth of yeast under nonselective conditions. 1. YPD media: 2 % w/v dextrose (D-glucose), 1 % w/v yeast extract, 2 % w/v peptone. 2. YPD agar plate: 2 % w/v dextrose (D-glucose), 1 % w/v yeast extract, 2 % w/v peptone, 1.5 % w/v agar. Store the plates at 4 °C for up to 6 months.

2.3.2 Synthetic Dextrose Medium with CasAmino Acids (SD-CAA)

Synthetic Dextrose medium with CasAmino Acids (SD-CAA) growth media and Synthetic Galactose medium with CasAmino Acids (SG-CAA) induction media are minimal media. These media contain a nitrogen and carbon source, a buffer salt, and a mixture of essential amino acids except Tryptophan (−Trp), which is used for selection of yeast transformed with plasmid bearing TRP1 marker. Removing D-glucose (SD-CAA medium) and adding D-galactose (SG-CAA medium) as a carbon source causes the GAL1 promoter to become de-repressed and induces transcription of the gene of interest. 1. SD-CAA media pH 4.5: 2 % w/v dextrose (D-glucose), 0.67 % w/v yeast nitrogen base, 0.5 % w/v casamino acids (−ade, −ura, −trp), 70 mM citrate buffer pH 4.5 (see Note 2). 2. SD-CAA agar plates pH 6.0: 2 % w/v dextrose (D-glucose), 0.67 % w/v yeast nitrogen base, 0.5 % w/v casamino acids (−ade, −ura, −trp), 18.2 % sorbitol, 1.5 % w/v agar, and 100 mM phosphate buffer pH 6.0. Store the plates at 4 °C for up to 6 months. 3. SG-CAA media pH 6.0: 2 % w/v D-galactose, 0.2 % w/v dextrose (D-glucose), 0.67 % w/v yeast nitrogen base, 0.5 % w/v casamino acids (−ade, −ura, −trp), and 100 mM phosphate buffer pH 6.0 (see Notes 3 and 4).

2.4

Bacteria Strain

2.5 Buffers and Solutions

Various Escherichia coli host strains can be used for the propagation and manipulation of recombinant DNA. Either chemically competent or electrocompetent E. coli cells can be used depending on the specific transformation needs. Host strains such as DH5α, DH10Β, TOP10, NovaBlue, XL1-Blue, and XL-10 Gold give high-quality DNA and are recommended for reproducible and reliable results. These strains are available through the American Type Culture Collection (www.atcc.org) as well as from commercial suppliers such as Agilent, Invitrogen, and Millipore. 1. Phosphate buffered saline (PBS) at pH 7.4: 10 mM sodium phosphate dibasic anhydrous (Na2HPO4), 2 mM potassium phosphate monobasic (KH2PO4), 137 mM sodium chloride (NaCl), and 2.7 mM potassium chloride (KCl).

10

Alessandro Angelini et al.

2. Phosphate buffered saline with bovine serum albumin (PBSA) at pH 7.4: PBS supplemented with and 0.1 % w/v bovine serum albumin fraction V (BSA). 3. 3 M sodium acetate at pH 5.0. 4. 1× Tris-acetate-EDTA buffer (TEA) at pH 8.0: 40 mM Tris base, 20 mM acetic acid, and 1 mM EDTA. 5. Ampicillin at 100 mg/mL. 6. Kanamycin at 35 mg/mL. 7. Penicillin (10,000 units/mL) and Streptomycin (10,000 μg/ mL). Sterile, premixed solutions are commercially available (Corning Cellgro). Store at −20 °C. For working concentrations, dilute the stock 100-fold. 2.6 Magnetic Bead Selection Reagents

1. Biotinylated target and control (see Subheading 2.7). 2. EZ-Link Sulfo-NHS-LC-Biotinylation Kit (Thermo Scientific). 3. Pierce Biotin Quantification KIT (Thermo Scientific) or Fluorescence Biotin Quantification KIT (Thermo Scientific). 4. Biotin protein ligase BirA enzyme (Avidity, product No. BirA500 or Bulk BirA). 5. DynaMag-2 magnet (Invitrogen). 6. Dynabeads biotin binder (Invitrogen). 7. Bovine serum albumin fraction V (Sigma).

2.7 FACS Selection Reagents

1. Biotinylated target (see Subheading 3.2.1).

2.7.1 Protein ScaffoldTarget Binding Detection

3. Mouse anti-biotin IgG-VioBlue (Bio3-18E7) (0.1 mg/mL) (Miltenyi Biotec).

2. Biotinylated lysozyme control (5 mg/mL) (GeneTex).

4. Mouse anti-biotin IgG-FITC (Bio3-18E7) (0.1 mg/mL) (Miltenyi Biotec). 5. Mouse anti-biotin IgG-APC (Bio3-18E7) (0.1 mg/mL) (Miltenyi Biotec). 6. Mouse anti-biotin (eBioscience).

IgG-PE

(BK-1/39)

(0.2

mg/mL)

7. Neutravidin-DyLight 488 (1 mg/mL) (Thermo Scientific). 8. Neutravidin-DyLight 650 (1 mg/mL) (Thermo Scientific). 9. Streptavidin-Alexa Fluor 488 (2 mg/mL) (Invitrogen). 10. Streptavidin-Alexa Fluor 647 (2 mg/mL) (Invitrogen). 2.7.2 Protein Scaffold Expression and Display Detection

1. Chicken anti-c-myc IgY (1 mg/mL) (Gallus Immunotech). 2. Mouse anti-c-myc IgG (9E10) (0.7 mg/mL) (Covance). 3. Mouse anti-HA IgG (16B12) (1 mg/mL) (Covance). 4. Goat anti-chicken IgG-Alexa Fluor 647 (2 mg/mL) (Invitrogen).

Protein Engineering by Yeast Surface Display

11

5. Goat anti-chicken IgG-Alexa Fluor 488 (2 mg/mL) (Invitrogen). 6. Goat anti-mouse IgG-Alexa Fluor 488 (2 mg/mL) (Invitrogen). 7. Goat anti-mouse IgG-Alexa Fluor 647 (2 mg/mL) (Invitrogen). 2.8 Transformation and Diversification Reagents

1. QIAprep Spin Miniprep Kit (Qiagen) and Plasmid Maxi Kit (Qiagen). 2. QIAquick PCR Purification Kit (Qiagen), QIAquick Gel Extraction Kit (Qiagen) or QIAEX II Gel Extraction Kit (Qiagen). 3. Zymoprep Yeast Plasmid Miniprep II Kit (Zymo Research). 4. Frozen-EZ Yeast Transformation II Kit (Zymo Research). 5. Taq DNA Polymerase with ThermoPol Buffer (New England Biolabs). 6. 2′-deoxynucleoside 5′-triphosphates (dNTPs) (New England Biolabs). 7. 8-oxo-2′-deoxyguanosine 5′-triphosphate (TriLink BioTechnologies). 8. 2′-deoxy-p-nucleoside-5′-triphosphate BioTechnologies).

(8-oxo-dGTP)

(dPTP)

(TriLink

9. BamHI-HF (20,000 U/mL) (New England Biolabs). 10. NheI-HF (20,000 U/mL) (New England Biolabs). 11. SalI-HF (20,000 U/mL) (New England Biolabs). 12. Agarose I Molecular Biology Grade (Thermo Scientific). 13. Quick-Load 2-Log DNA Ladder (New England Biolabs). 14. Gel Loading Dye Blue 6× (New England Biolabs). 15. GelGreen Nucleic Acid Stain 10,000× (Biotium Inc.). 16. Pellet paint co-precipitant (EMD Millipore).

3

Methods

3.1 Naïve Yeast Library Growth and Induction of Protein Expression

1. Thaw frozen aliquots of the desired yeast library at room temperature [92]. 2. Inoculate aliquots at tenfold diversity into 1 L of SD-CAA media. Grow at 30 °C with shaking (250 rpm) for 16–20 h to a typical OD600 of 6–8 (see Note 5). 3. Passage cells. Pellet at least tenfold the estimated library diversity at 3,000 × g for 5 min at 4 °C in 50 mL conical tubes (see Notes 6 and 7). Remove the supernatant and resuspend the cells to obtain a final concentration of ~1 × 107 cells/mL into 1 L of fresh SD-CAA media. Grow at 30 °C with shaking (250 rpm) until the cells reach an OD600 of 2–5 (mid-log phase) (see Notes 8 and 9).

12

Alessandro Angelini et al.

4. Induce cells. Pellet at least tenfold the estimated library diversity at 3,000 × g for 5 min at 4 °C in 50 mL conical tubes. Remove the supernatant and resuspend the cells to obtain a final concentration of ~1 × 107 cells/mL into 1 L of fresh SGCAA media. Grow at 20 °C with shaking (250 rpm) for 12–36 h (see Note 10). 5. Cells can be used directly for selection (see Subheadings 3.2 and 3.3) and characterization (see Subheading 3.4), or they can be stored at 4 °C for up to 1 month (see Note 11). 3.2 Selection of Binders Using Magnetic Beads

Selection of protein binders from a naïve yeast display library is performed using a two-step procedure involving magnetic bead screening followed by flow cytometry sorting. The initial magnetic bead based screening allows for the isolation of weak affinity protein binders within a relative short period of time and in a high throughput manner [93]. The multivalency of the yeast display system in combination with the use of biotinylated target bound to streptavidin-coated micron-sized magnetic beads results in a highly avid system, where multiple copies of the protein scaffold displayed on the yeast cell surface (~105 proteins displayed per cell) can interact with multiple copies of the target immobilized on the bead (~106 biotin binding site per bead). The highly avid interaction between yeast cells and magnetic beads allows for the isolation of weak binders that would not be detected by flow cytometry. The selection process usually begins with a “negative selection” in order to deplete the naïve library of streptavidin-coated magnetic bead binders (see Notes 12 and 13) followed by a “positive selection” against the target in order to enrich for the desired binders.

3.2.1

Target Biotinylation

The target can be biotinylated either chemically, by reacting primary amines (present in the side chains of lysine residues or at the amino terminus) with biotin functionalized with N-hydroxysuccinimide (NHS), or enzymatically, by using biotin ligase (BirA), an enzyme capable of adding a single biotin molecule on a unique 15 amino acid peptide tag (NGLNDIFEAQKIEWHEC) located on either the N- or C-terminus of a fusion protein target.

3.2.2 Negative Selection to Eliminate Magnetic Bead Binders

The negative selection step depletes binders to streptavidin-coated magnetic beads from the yeast display library. In the negative selection, the naïve yeast display library is incubated with streptavidincoated magnetic beads without the immobilized target and the unbound yeast are isolated as described below. 1. Use 10 μL of 4 × 105 beads/μL (4 × 106 beads) for 2 × 109 cells (see Note 14). 2. Resuspend the beads in the vial by tilting and rotating it for 5 min, and then transfer the desired volume of beads into a 2 mL microcentrifuge tube.

Protein Engineering by Yeast Surface Display

13

3. Wash the magnetic beads by adding 1 mL of ice-cold PBSA and resuspend gently by repeated pipetting. 4. Incubate the 2 mL microcentrifuge tube at 4 °C for 5 min on a rotating wheel. 5. Place the 2 mL microcentrifuge tube on a magnet and let it stand for 3–5 min at 4 °C before discarding the supernatant. Caution not to touch the beads. 6. Remove the 2 mL microcentrifuge tube from the magnet and wash the beads once more (steps 3–5). The magnetic beads are now ready to be used. 7. Pellet at least tenfold the estimated library diversity of induced yeast cells at 3,000 × g for 5 min at 4 °C in 50 mL conical tubes (see Subheading 3.1 and Note 7). 8. Remove the supernatant and wash the yeast display library by resuspending the cells with ice-cold PBSA, to obtain a final concentration of ~2 × 109 cells/mL. 9. Split the cells into 2 mL microcentrifuge tubes (2 × 109 cells/ mL/tube). 10. Pellet the yeast display library at 14,000 × g for 1 min at 4 °C in 2 mL microcentrifuge tubes. 11. Remove the supernatant and wash the yeast display library one more time by resuspending the cells in 1 mL ice-cold PBSA (final concentration of ~2 × 109 cells/mL/tube). 12. Pellet the yeast display library at 14,000 × g for 1 min at 4 °C in 2 mL microcentrifuge tubes. 13. Remove the supernatant and resuspend the yeast display library with 1 mL ice-cold PBSA (final concentration of ~2 × 109 cells/mL/tube). 14. Combine the previously washed magnetic beads without immobilized target with the 1 mL washed yeast display library (~2 × 109 cells/mL/tube). 15. Incubate the 2 mL microcentrifuge tube, containing both washed yeast display library and magnetic beads, at 4 °C for at least 2 h on a rotating wheel (see Notes 15 and 16). 16. Place the 2 mL microcentrifuge tube on a magnet for 3–5 min at 4 °C. 17. Collect the 1 mL of supernatant containing unbound yeast display library cells. 18. Wash the magnetic bead-yeast complexes by adding 1 mL of ice-cold PBSA. 19. Place the 2 mL microcentrifuge tube on a magnet for 3–5 min at 4 °C before discarding the supernatant.

14

Alessandro Angelini et al.

20. Wash the beads once time more by repeating steps 18–19. 21. Remove the tube from the magnet and resuspend the bead-yeast complexes in 1 mL fresh SD-CAA media. 22. Plate serial tenfold dilutions of the 1 mL bead-yeast complex solution on SD-CAA plates in order to estimate the number of streptavidin-coated magnetic bead binders. 23. Repeat the negative selection (steps 14–19) by incubating the collected 1 mL unbound yeast display library (from step 17) with 10 μL of newly prepared magnetic beads without immobilized target. 24. Collect the 1 mL of supernatant containing unbound yeast display library and use the cells directly for a new negative magnetic bead screening, or proceed with the positive selection (see Subheading 3.2.3; see Notes 12 and 13). 3.2.3 Positive Selection to Enrich for Target Binders

The biotinylated protein target is typically first immobilized on streptavidin-coated magnetic beads and subsequently exposed to the previously depleted yeast display library. The bead-yeast complexes are then isolated using a magnet as follows. 1. Prepare magnetic beads as Subheading 3.2.2, step 1–6).

described

previously

(see

2. Use 6.7–33 pmoles of biotinylated target for 10 μL of 4 × 105 beads/μL (4 × 106 beads) [28, 92] (see Note 17). 3. Dilute the biotinylated target in 100 μL of PBSA and add the solution to 10 μL of previously washed magnetic beads. 4. Incubate the 2 mL microcentrifuge tube at 4 °C for at least 1 h on a rotating wheel (see Note 18). 5. Place the 2 mL microcentrifuge tube on a magnet for 3–5 min at 4 °C before discarding the supernatant containing unbound biotinylated target. 6. Wash the magnetic bead-biotinylated target complexes by adding 1 mL of ice-cold PBSA. 7. Incubate the 2 mL microcentrifuge tube at 4 °C for 5 min on a rotating wheel. 8. Place the 2 mL microcentrifuge tube on a magnet for 3–5 min at 4 °C before discarding the supernatant. 9. Remove the 2 mL microcentrifuge tube from the magnet and wash the beads once more to ensure that any unbound biotinylated targets are removed completely. 10. Combine each 1 mL of magnetic bead-depleted yeast display library (see Subheading 3.2.2, step 24) with a separate tube(s) of 10 μL of prepared biotinylated target captured on streptavidincoated magnetic beads.

Protein Engineering by Yeast Surface Display

15

11. Incubate the 2 mL microcentrifuge tube(s), containing the yeast and magnetic beads, at 4 °C for at least 2 h on a rotating wheel (see Notes 16 and 19). 12. Place the 2 mL microcentrifuge tube on a magnet for 3–5 min at 4 °C before discarding the supernatant containing unbound yeast display library cells. 13. Wash the magnetic bead-yeast target complexes by adding 1 mL of ice-cold PBSA. 14. Incubate the 2 mL microcentrifuge tube at 4 °C for 5 min on a rotating wheel. 15. Place the 2 mL microcentrifuge tube on a magnet for 3–5 min at 4 °C before discarding the supernatant. 16. Remove the 2 mL microcentrifuge tube from the magnet and wash the beads twice more with ice-cold PBSA (see Note 20). 17. Resuspend the bead-yeast complexes in 1 mL of fresh SD-CAA media (see Note 21). 18. Transfer the 1 mL bead-yeast complex solution into a 15 mL glass tube containing 4 mL fresh SD-CAA media (final volume 5 mL). 19. Plate serial tenfold dilutions of the 5 mL bead-yeast complex solution on SD-CAA plates to estimate the number of target binders and library diversity. 20. Grow the 5 mL bead-yeast complex culture at 30 °C with shaking (250 rpm) for at least 16 h. 21. To remove the magnetic beads, pellet the selected yeast cells at 3,000 × g for 5 min at 4 °C in 15 mL conical tubes. 22. Remove the supernatant and resuspend the yeast-bead mixture with 5 mL fresh SD-CAA media. 23. Split the 5 mL yeast-bead mixture into multiple 2 mL microcentrifuge tubes (1 mL each tube). 24. Place the 2 mL microcentrifuge tube on a magnet for 3–5 min at room temperature. 25. Collect the supernatant from each 2 mL microcentrifuge tubes (total 5 mL) and inoculate it into a 250 mL baffled-bottom Erlenmeyer flasks tube containing 45 mL fresh SD-CAA media (final volume 50 mL). 26. Passage the cells twice and perform induction as described previously (see Subheading 3.1). 27. Newly induced cells can be used directly for a subsequent selection process, either by magnetic bead screening (see Subheading 3.2.2 for negative selection and Subheading 3.2.3 for positive selection; see Note 22) or by flow cytometry sorting (see Subheadings 3.3.1 and 3.3.2). Alternatively, induced cells can be stored at 4 °C for up to 1 month (see Note 11).

16

Alessandro Angelini et al.

3.3 Selection of Binders Using Flow Cytometry Sorting

The selected yeast cells isolated after the magnetic bead-based processes are further screened using fluorescence-activated cell sorting (FACS) to isolate clones that exhibit highest binding affinity toward the desired target. A flow cytometry sorting is first performed immediately after the magnetic bead-based processes to ensure selection of yeast cell clones displaying full-length binders. A second flow cytometry sorting is then executed to enrich for higher affinity full-length binders to the target.

3.3.1 Flow Cytometry Sorting to Isolate Yeast Clones Displaying Full-Length Protein Scaffold

The yeast display vectors are designed to include HA and c-myc epitope tags at the N-terminus and C-terminus of the yeast surface displayed protein scaffold, allowing for detection and selection of full-length binders by flow cytometry (Fig. 1). Yeast clones displaying full-length protein scaffolds will result in a dual positive fluorescence labeling for both tags, whereas yeast clones displaying proteins containing either a nonsense mutation, which ends in a premature stop codon, or a reading frame shift mutation, caused by insertions or deletions, will result in a single positive fluorescence labeling exclusively for only one of the two tags, most probably the N-terminus HA epitope tag (see Note 17). 1. Pellet at least tenfold oversampling of the estimated library diversity of induced yeast cells at 3,000 × g for 5 min at 4 °C in 50 mL conical tubes (see Subheading 3.2.3, step 27; see Note 7). 2. Remove the supernatant and wash the yeast cells by resuspending them in PBSA to obtain a final concentration of ~1 × 107 cells/mL. 3. Split the cells into 1.7 mL microcentrifuge tubes (1 × 107 cells/ mL/tube) (see Note 23). 4. Pellet the yeast cells at 14,000 × g for 1 min at 4 °C in 1.7 mL microcentrifuge tubes. 5. Remove the supernatant and resuspend the yeast cells with 50 μL PBSA (final concentration of ~2 × 108 cells/mL). 6. Primary staining. Add 1 μL of primary mouse anti-HA (1:100) and 1 μL of primary chicken anti-c-myc (1:100) antibodies to the yeast cells previously resuspended in 50 μL PBSA. Add 48 μL of additional PBSA to a final volume of 100 μL (see Notes 24 and 25). 7. Incubate the 1.7 mL microcentrifuge tubes containing either primary labeled or unlabeled yeast cells at room temperature for at least 20 min with rotation. The incubation time of ~1 h at room-temperature should be sufficient to ensure that the binding reaction approaches equilibrium (see Note 16). 8. Pellet the yeast cells at 14,000 × g for 1 min at 4 °C in 1.7 mL microcentrifuge tubes.

Protein Engineering by Yeast Surface Display

17

9. Remove the supernatant containing unbound primary reagents and wash the yeast cells by resuspending them with 1 mL icecold PBSA. 10. Pellet the yeast cells at 14,000 × g for 1 min at 4 °C in 1.7 mL microcentrifuge tubes. 11. Remove the supernatant and resuspend either primary labeled or unlabeled yeast with 50 μL ice-cold PBSA (final concentration of ~2 × 108 cells/mL) (see Note 26). 12. Secondary staining. Add 1 μL of goat anti-mouse Alexa Fluor 488 (1:100) and 1 μL goat anti-chicken Alexa Fluor 647 (1:100) secondary antibodies to the yeast cells previously resuspended in 50 μL PBSA. Add 48 μL of additional PBSA to a final volume of 100 μL. 13. Incubate the 1.7 mL microcentrifuge tubes containing secondary labeled and unlabeled yeast cells either on ice or on a rotating wheel at 4 °C for at least 20 min (see Note 16). 14. Pellet the yeast cells at 14,000 × g for 1 min at 4 °C in 1.7 mL microcentrifuge tubes. 15. Remove the supernatant containing unbound secondary reagents and wash the yeast cells by resuspending them in 1 mL of ice-cold PBSA. 16. Pellet the yeast cells at 14,000 × g for 1 min at 4 °C in 1.7 mL microcentrifuge tubes. 17. Remove the supernatant and resuspend labeled and unlabeled yeast cells in 500 μL of ice-cold PBSA (final concentration of ~2 × 107 cells/mL) for flow cytometry sorting. 18. Perform flow cytometry sorting. All samples should be analyzed, and yeast cells that are double positive for the HA and c-myc tags are collected into a 10 mL glass culture tube containing 2 mL of fresh SD-CAA media. 19. Once flow cytometry sorting is completed, rinse the sides of the 10 mL glass tube with another 2 mL of fresh SD-CAA media to recover any additional cells (5 mL final volume) (see Note 27). 20. Transfer the 5 mL contents into a larger 15 mL glass tube and grow up the yeast cells at 30 °C with shaking (250 rpm) for at least 24 h. 21. Pellet at least tenfold the estimated library diversity at 3,000 × g for 5 min at 4 °C in 50 mL conical tubes (see Notes 6 and 7). 22. Remove the supernatant and resuspend the cells into a defined volume of fresh SD-CAA media to obtain a final concentration of ~1 × 107 cells/mL. Grow at 30 °C with shaking (250 rpm) until the cells reach an OD600 of 2–5 (mid-log phase) (see Notes 8 and 9).

18

Alessandro Angelini et al.

23. Pellet at least tenfold the estimated library diversity at 3,000 × g for 5 min at 4 °C in 50 mL conical tubes (see Note 7). 24. Remove the supernatant and resuspend the cells in a defined volume of fresh SG-CAA media to obtain a final concentration of ~1 × 107 cells/mL. Grow at 20 °C with shaking (250 rpm) for 12–36 h (see Note 10). 25. Newly induced cells displaying full-length protein binders can be used directly for a subsequent flow cytometry-based selection process. Alternatively, induced cells can be stored at 4 °C for up to 1 month (see Note 11). 3.3.2 Flow Cytometry Sorting to Enrich for Higher Affinity Full-Length Binders to the Target

Yeast cells displaying full-length protein scaffolds are further screened by flow cytometry to isolate clones that bind to the soluble target of interest. For this purpose, yeast cells are initially labeled with both biotinylated target and primary anti-c-myc tag antibody. Yeast cells are then stained with fluorescently labeled secondary reagents, resulting in dual positive staining for both the tag and target. Yeast cells displaying full-length protein scaffolds but not bound to target will instead result in a single positive fluorescence staining exclusively for the C-terminus c-myc tag. The fluorescence activated cell sorting (FACS) and two-color labeling enable the binding affinity to be normalized to cell surface expression. Consequently, the affinities between clones can be accurately discriminated, allowing quantitative selection in real time (Fig. 3). Moreover, the dual-color labeling permits simultaneous selection for both protein stability and binding affinity, since the extent of protein surface expression has been shown to correlate with protein stability (see Note 17). 1. Pellet at least tenfold oversampling of the estimated library diversity of induced yeast cells at 3,000 × g for 5 min at 4 °C in 50 mL conical tubes (see Subheading 3.3.1, step 25, see Note 7). 2. Prepare yeast cells as described previously (see Subheading 3.3.1, steps 2–5). 3. Primary staining. Add 1 μL of primary chicken anti-c-myc (1:100) antibody and a desired amount of soluble biotinylated target to the yeast cells previously resuspended in 50 μL PBSA. Add additional PBSA to a final volume of 100 μL (see Notes 24, 25, 28 and 29). 4. Perform incubation and washing steps as described previously (see Subheading 3.3.1, steps 7–11, see Note 30). 5. Secondary staining. Add 1 μL of goat anti-chicken Alexa Fluor 647 (1:100) secondary antibody and 1 μL of NeutravidinDyLight 488 (1:100) to the yeast cells previously resuspended in 50 μL PBSA. Add 48 μL of additional PBSA to a final volume of 100 μL.

Protein Engineering by Yeast Surface Display

19

Fig. 3 Representative fluorescence activated cell sorting (FACS) data. Yeast cells displaying protein binders doubly labeled with chicken anti-c-myc antibody and biotinylated target, followed by double labeling with Alexa Fluor 647 conjugated goat anti-chicken antibody and DyLight 488 conjugated neutravidin. (a) Flow cytometry plot of a wild-type protein binder (clone A, light grey ) overlaid to the flow cytometry plot of an engineered protein binder mutant with tenfold higher affinity (clone B, dark-grey ), both labeled with 100 nM biotinylated target. Each single dot on the representative plot designate the DyLight 488 (y-axis) and Alexa Fluor 647 (x-axis) fluorescence intensity values for a single yeast cell. (b) Titration curves. For wild-type clone A and mutant clone B, 15-point curves were obtained in triplicate and plotted. Curve fitting results in a KD of 114 ± 6 nM for the wild type (clone A) and a ~10-fold higher affinity, KD of 11 ± 0.8 nM, for the affinity matured clone B

6. Perform incubation and washing steps as described previously (see Subheading 3.3.1, steps 13–17). 7. Perform flow cytometry sorting. All samples should be analyzed and yeast cells that are double positive for the c-myc tag and binding to the biotinylated target are collected into a 10 mL glass culture tube containing 2 mL of fresh SD-CAA media (see Note 31). 8. Recover, passage, and induce the cells as described previously (see Subheading 3.3.1, steps 20–24). 9. Newly induced cells can be used directly for a subsequent selection process by flow cytometry sorting (see Subheadings 3.3.1 and 3.3.2). Alternatively, induced cells can be stored at 4 °C for up to 1 month (see Note 11). 3.4 Single Clone Analysis and Characterization Using Yeast Surface Titrations

After the population with binding of interest is enriched and collected, individual clones of the population are identified by DNA sequencing and characterized using yeast surface titrations to determine the binding affinity (KD).

3.4.1 DNA Plasmid Extraction and Identification of Individual Yeast Clone

DNA plasmid extraction from yeast cells is performed using an adapted protocol from the original Zymoprep™ Yeast Plasmid Miniprep II Kit [28]. Purified DNA can be used (1) for DNA sequencing to identify the amino-acid sequences of the protein

20

Alessandro Angelini et al.

binders displayed in the selected yeast clones (see Note 32), (2) to transform new yeast cells and determine the affinity of unique clones using yeast cell surface titrations (see Subheading 3.4.2), (3) as a template to prepare mutagenized DNA inserts for further library generation and affinity maturation processes (see Subheading 3.5). 3.4.2 Clonal Yeast Preparation and Characterization by Yeast Surface Titrations

Selected protein binders can be characterized while directly expressed on the surface of the yeast cell, eliminating the need for additional sub-cloning, soluble protein expression, and purification steps. The apparent binding affinity (KD) of the interaction between the selected protein binder and its target is measured using yeast surface titrations (Fig. 3). Several studies have shown that KD values of a binding interaction determined using yeast cell surface titrations correlate well with the KD values measured using soluble protein [29]. 1. Transform a single binder clone from a DNA miniprep into competent EBY100 yeast cells using the Zymo Research Frozen-EZ Yeast Transformation kit (Zymo Research) following the manufacturer’s protocol (see Note 33). 2. Plate the entire transformation on SD-CAA plates and incubate at 30 °C for 2–3 days. 3. Pick a single EBY100 colony from the plate and inoculate 5 mL of SD-CAA media in a 15 mL glass culture tube. 4. Grow the cultures at 30 °C with shaking (250 rpm) for 16–20 h and induce protein expression in 5 mL fresh SG-CAA media as described previously (see Subheading 3.1). 5. Pellet 2 × 106 induced cells at 14,000 × g for 1 min in a 1.7 microcentrifuge tube. 6. Remove the supernatant and wash the cells by resuspending them in 1 mL of PBSA to obtain a final concentration of ~2 × 106 cells/mL. 7. Pellet cells at 14,000 × g for 1 min in a 1.7 microcentrifuge tube (see Note 34). 8. Remove the supernatant and resuspend cells in 1 mL of PBSA containing primary chicken anti-c-myc (1:1,000) antibody, to obtain a final concentration of ~2 × 106 cells/mL. 9. Aliquot 50 μL (1 × 105 cells) into 12 tubes (see Note 34). 10. Primary staining. Add varying concentrations of soluble biotinylated target (e.g., 0, 0.01, 0.03, 0.1, 0.3, 1, 3, 10, 30, 100, 300, and 1,000 nM) to the yeast cells previously resuspended in 50 µL PBSA containinig anti-c-myc antibody. Add additional PBSA to a final volume of 100 μL (see Notes 35 and 36).

Protein Engineering by Yeast Surface Display

21

11. Perform incubation and washing steps as described previously (see Subheading 3.3.1, steps 7–11; see Note 30). 12. Secondary staining. Remove the supernatant and resuspend 1 × 105 primary labeled cells in 100 μL of ice-cold PBSA containing secondary goat anti-chicken Alexa Fluor 647 (1:1,000) and Neutravidin-DyLight 488 (1:1,000). 13. Perform incubation and washing steps as described previously (see Subheading 3.3.1, steps 13–16; see Note 34). 14. Remove the supernatant and resuspend labeled yeast cells with 250 μL of ice-cold PBSA for flow cytometry analysis. 15. Perform flow cytometry analysis and record the data. The equilibrium dissociation constant (KD) is determined by fitting the recorded data to a monovalent binding isotherm. Fit the total median fluorescence intensity from the DyLight 488 channel for all samples (MFUtot) versus target concentration [L], using a global nonlinear least-square regression:  MFU range × [ L ]  MFU tot = MFU min +   K + [ L ]  D   varying the KD, MFUmin, and MFUrange (see Note 37). Once single clones have been characterized, the gene encoding the most desirable protein binder can be sub-cloned into an expression vector for soluble protein production in bacteria, yeast, or mammalian cells. Alternatively, random mutagenesis followed by flow cytometry sorting, a process termed affinity maturation, can be performed until the protein binder reaches the desired affinity and stability (see Subheading 3.5). 3.5 Library Construction and Yeast Transformation

There are many methods available to generate and diversify combinatorial libraries of protein binders using yeast surface display. The first step in constructing a combinatorial library of these proteins is randomizing the DNA insert that encodes for the protein scaffold to be engineered. Techniques commonly applied to generate linear DNA that encode for mutant protein binders include error-prone PCR with nucleotide analogs [89, 94, 95] and DNA shuffling [96–98]. Error-prone PCR with nucleotide analogs is generally the preferred method to prepare mutagenic DNA inserts, since the mutation rate can be controlled by varying the number of PCR cycles, and both transitional and transversional mutations occur. The yeast library is then generated using homologous recombination mediated by plasmid gap repair [98]. Yeast cells are naturally capable of performing homologous recombination, which allows for in vivo re-circularization of linearized vector with overlapping inserts. Linearized vector and PCR amplified

22

Alessandro Angelini et al.

mutagenized inserts are generally combined and introduced into the yeast through electroporation, and leads to the generation of a new yeast display library for further selection screening (see Note 38). Rounds of mutagenesis followed by flow cytometry sorting are often applied iteratively until protein binder clones with desired properties are identified. 3.5.1

Vector Preparation

1. Digest pCT-CON vector by using SalI, NheI, and BamHI restriction enzymes as follows (see Note 39): Component

Volume

pCT-CON vector (X μg/μL)

Y μL (to get 20 μg)

NEB buffer CutSmart (10×)

10 μL (1×)

SalI-HF at 20 U/μL (New England Biolabs)

3 μL (60 U)

ddH2O

100—Y—13 μL

Total volume

100 μL

Reaction is incubated at 37 °C for 16 h pCT-CON vector linearized with SalI

100 μL

NheI-HF at 20 U/μL (New England Biolabs)

3 μL (60 U)

BamHI-HF at 20 U/μL (New England 3 μL (60 U) Biolabs) NEB buffer CutSmart (10×)

7.5 μL (1×)

ddH2O

61.5 μL

Total Volume

175 μL

Reaction is incubated at 37 °C for 16 h pCT-CON vector digested with SalI, NheI, and BamHI

175 μL

NheI-HF at 20 U/μL (New England Biolabs)

1 μL (20 U)

BamHI-HF at 20 U/μL (New England 1 μL (20 U) Biolabs) SalI-HF at 20 U/μL (New England Biolabs)

1 μL (20 U)

Reaction is incubated at 37 °C for 16 h

2. Purify and concentrate the linearized DNA plasmid by ethanol precipitation [28, 92].

Protein Engineering by Yeast Surface Display

23

3. Dissolve the precipitated linearized vector in sterile ddH2O at a final concentration of about 1 μg/μL for electroporation. Digested and purified vector can be used immediately or stored long-term at −20 °C until needed. 3.5.2 Mutagenesis of DNA Encoding the Protein Scaffold (Insert) by Error-Prone PCR

1. Mutagenesis is performed by error prone PCR as follows (see Notes 40–42): Component

[C]i

[C]f

Volume

Primer forward

10 μM

500 nM

2.5 μL

Primer reverse

10 μM

500 nM

2.5 μL

dNTPs mix (dATP, dCTP, dGTP, dTTP)

10 mM

200 μM

1 μL

8-oxo-dGTP

20 μM

2 μM

5 μL

dPTP

20 μM

2 μM

5 μL

ThermoPol Reaction Buffer 10× (with MgCl2)

10×

1×

5 μL

DNA template

1 ng/μL

1 ng

1 μL

Taq DNA Polymerase

5 U/μL

2.5 U

0.5 μL

ddH2O (autoclaved or filter sterilized)

27.5 μL

Total volume

50 μL

The PCR reaction cycles should have the following incubation temperatures and times: Cycle

Step

Time

Temperature (°C)

1 (×1)

Denaturation

3 min

95

45 s

95

Annealing

30 s

55

Elongation

90 s

72

2 (×15) Denaturation

3 (×1)

Final elongation 10 min 72 4

2. Run the full-length PCR amplified products on a 1 % w/v lowmelt agarose gel electrophoresis in 1× TAE buffer, at 100 V for approximately 45–60 min. 3. Cut and extract the properly sized band and purify the product using a gel extraction kit following the manufacturer’s protocol (see Note 43). 4. Elute the DNA in 40 μL elution buffer.

24

Alessandro Angelini et al.

3.5.3 Amplification of Mutagenesis of DNA Encoding Protein Binder

1. Amplify the purified mutagenized DNA in the absence of nucleotide analogues to generate sufficient insert DNA for the transformation as follows (see Notes 41 and 44): Component

[C]i

[C]f

Volume

Primer forward

10 μM

500 nM

2.5 μL

Primer reverse

10 μM

500 nM

2.5 μL

dNTPs mix (dATP, dCTP, dGTP, dTTP)

10 mM

200 μM

1 μL

ThermoPol Reaction Buffer 10× (with MgCl2)

10×

1×

5 μL

Mutagenized DNA insert

10 ng/μL

40 ng

4 μL

Taq DNA Polymerase

5 U/μL

2.5 U

0.5 μL

ddH2O (autoclaved or filter sterilized)

34.5 μL

Total volume

50 μL

The PCR reaction cycles should have the following incubation temperatures and times: Cycle

Step

Time

Temperature (°C)

1 (×1)

Denaturation

3 min

95

45 s

95

Annealing

30 s

55

Elongation

90 s

72

2 (×30) Denaturation

3 (×1)

Final elongation 10 min 72 4

2. Verify the correct size and purity of the amplified DNA insert by running a small amount of PCR product on a 1 % w/v lowmelt agarose gel electrophoresis in 1× TAE buffer, at 100 V for approximately 45–60 min. 3. Purify and concentrate the PCR product by ethanol precipitation [28, 92]. 4. Confirm that the pellet is dry by tapping the tube firmly against the benchtop. A completely dry pellet should be readily dislodged from the bottom of the tube upon repeated tapping. 5. Dissolve the dried DNA insert in sterile ddH2O at a final concentration of about 1 μg/μL for yeast transformation by electroporation [28, 92]. Purified insert can be used immediately or stored long-term at −20 °C until needed.

Protein Engineering by Yeast Surface Display

25

Yeast display library cells are now ready for further expression and selection screening (see Subheading 3.1) or they can be longterm stored at −80 °C or in liquid nitrogen [92].

4

Notes 1. The doubling time of the Saccharomyces cerevisiae EBY100 strain in SD-CAA is approximately 3–4 h, about 50 % slower than that in YPD media (1.5–2 h). On solid SD-CAA medium at 30 °C, single EBY100 colonies may be seen after 48–72 h, whereas on solid YPD medium at 30 °C, single EBY100 colonies are seen after 24–48 h. 2. Presence of bacterial contamination is verified by using the microscope. Saccharomyces cerevisiae cells are round to ovoid, 5–10 microns (μm) in diameter, whereas an average sized bacterium such as Escherichia coli is about 2 μm long and 0.5 μm in diameter. Moreover, under the microscope, yeast cells appear static, whereas bacteria cells are motile. Bacterial contamination is minimized by growth in low pH media (pH 4.5) supplemented with penicillin and streptomycin. If bacterial contamination appears, continue to grow yeast culture in the presence of 35 μg/mL kanamycin to eliminate the contamination. 3. A small amount of dextrose (D-glucose) added to the induction SG-CAA media (0.2 % w/v) promotes cell growth during protein expression and improves protein scaffold expression levels. Higher levels of dextrose will suppress the GAL1 promoter. 4. The use of a less acidic media (pH 6.0) during protein expression guarantees that the protein scaffold will remain properly folded once displayed on the surface of yeast. 5. An optical dispersion of 1 at 600 nm (OD600 = 1) corresponds to approximately 1 × 107 cells/mL. For maximal sensitivity and linearity of optical dispersion measurements, culture samples should be diluted in order to obtain OD600 values that fall in the linear range of correlation (OD600 = 0.1–0.4). 6. Cell passage by starting a new culture using fresh SD-CAA eliminates dead yeast cells. 7. To prevent the loss of unique clones, the number of cells to be sub-cultured and used for every magnetic bead screening and flow cytometry sorting should always be at least tenfold higher than the estimated library diversity of the population. 8. At this point, cells could be freshly passaged and induced for surface protein expression, or frozen aliquots of the library can be prepared for long-term storage [92].

26

Alessandro Angelini et al.

9. Optimal protein expression occurs when cells are induced during the logarithmic phase of growth (OD600 = 2–5). 10. The temperature and length of induction may need to be optimized for different protein scaffolds. Surface protein expression is typically performed at 20 °C in order to improve the folding and secretion of protein scaffolds with low thermal stability. Moreover, induction at 20 °C ensures that the cells will not complete a doubling cycle, whereas at 30 °C the cells will continue to grow. At later stages of selection, the induction temperature can be raised to 30–37 °C if more stable clones are desired [28, 92]. 11. Yeast cultures can be stored for about 2 weeks at room temperature and for about 1 month at 4 °C without loss of viability. 12. The negative selection can be repeated multiple times using unbound collected cells and newly prepared magnetic beads without immobilized target. Depending on the type of yeast display library, 2–6 consecutive negative selections might be necessary to remove streptavidin-coated magnetic bead binders. Moreover, additional negative selections may be needed in-between successive positive selection steps to prevent the enrichment of previously undepleted streptavidin-coated magnetic bead binders. 13. If the target of interest possesses a peptide tag (e.g., Avi-tag, His-tag, Flag-tag) or a fusion protein partner (such as GST, MBP, GFP, Sumo, Fc and Albumin) we recommend performing negative selections with either the tag or the fusion protein partner only, in addition to the negative selections against streptavidin-coated magnetic beads. 14. The magnetic beads can be prepared while the protein scaffolds are being induced to display on the yeast cell surface. 15. The incubation time of 2 h should be sufficient to select for yeast library binders against magnetic beads [93]. 16. The yeast cells and reagents (e.g., magnetic beads, primary and secondary labeling components) should be maintained in suspension during the incubation by continuous inversion on a rotating wheel (in the case of 1.5 mL, 2 mL microcentrifuge tubes and 15 mL, 50 mL conical tubes) or on a microplate orbital shaker (in the case of 96-well plates). 17. A positive control for both magnetic beads and flow cytometry sorting selections is highly desirable to prove that all the primary and secondary reagents as well as the staining and selection procedures are working properly. The positive control should include single yeast clone displaying a known protein binder positive for all the staining reagents [92].

Protein Engineering by Yeast Surface Display

27

18. The incubation time of the biotinylated target with pre-washed streptavidin-coated magnetic beads can be performed overnight at 4 °C if the target is sufficiently stable. 19. The incubation step can be carried out at different temperatures (4–37 °C) if selection for clones with different affinities at different temperatures is desired. 20. The stringency of the selection can be fine-tuned by modulating the number of washings (typically between 1 and 5) as well as the length (1–15 min) and temperature (4–37 °C) of incubation. 21. Alternatively, it is also possible to selectively elute yeast bound to a specific target epitope by competition using a known defined domain-binding ligand. 22. The positive selection can be repeated multiple times using freshly expressed yeast display library cells and newly prepared magnetic beads with immobilized biotinylated target. Generally 2–3 consecutive magnetic bead-based positive selections might be necessary to enrich for binders against the desired biotinylated target. 23. In addition to the samples containing the cells to be sorted, prepare additional unlabeled and single-color control samples, 1 × 107 cells each. 24. Each flow cytometry experiment should include all the controls (unstained sample, single color anti-HA and/or anti-cmyc for expression only, single color anti-biotin for binding only, secondary reagents only) that must be prepared in parallel with the samples to be sorted (dual labeled cells). 25. The labeling volume varies depending on the number of yeast cells and should be large enough to ensure that yeast cells will stay in suspension during the entire incubation time. Typically, a labeling volume of 50 μL is used for 0.1–1 × 106 cells, 100 μL for 0.1–1 × 107 cells and 1 mL for a maximum of 1 × 108 cells (see Note 35). 26. All successive steps should be performed using ice-cold PBSA buffer and a refrigerated tabletop centrifuge. Tubes must be kept protected from light, on ice or at 4 °C, and on a rotating wheel or on a microplate orbital shaker during both washing steps and secondary reagent incubation. 27. Collect only 1 mL of cells per single 10 mL glass tube in order to prevent yeast flocculation or viability issues related to the presence of large amount of phosphate-based flow cytometry buffers. If the volume of collected cells significantly exceeds 1 mL, dilute the cells in fresh SD-CAA media, rinse off the sides of the tube, and pellet the yeast cells at 3,000 × g for 5 min at 4 °C. Remove the supernatant and resuspend the collected yeast cells in 5 mL of fresh SD-CAA media.

28

Alessandro Angelini et al.

28. The concentration of biotinylated antigen to be used is a function of the KD of the initial binder and that of the improved binder [99]. Regardless of the antigen concentration, adjust the reaction volume accordingly, while maintaining a tenfold excess target concentration to avoid antigen depletion (see Note 35). When selecting for very high affinity binders with picomolar binding affinities, equilibrium screening might become impractical because the required reaction volumes are too large. Kinetic dissociation competition can be used to overcome this problem [83]. 29. In some cases, it may not be possible to isolate weak protein binders by simply using higher target concentrations because of low availability or excessive nonspecific binding. To circumvent this problem, singly biotinylated targets can be preloaded on a tetravalent streptavidin- or neutravidin-fluorophore conjugate to form a very stable target-streptavidin or -neutravidin fluorescent complex (femtomolar affinity) under physiological conditions. Streptavidin or neutravidin preloading can increase the target avidity, enhancing the effective biotinylated target concentration up to 500-fold and thus the chances of successful enrichment. 30. The concentration of the biotinylated target used and the apparent binding affinity (KD) determines the reaction incubation time. The following formula allows you to determine the time necessary to approach equilibrium for a given target concentration:

(

τ = kon [ L ]0 + koff

)

−1

where τ is the equilibrium time constant, kon and koff are the association (“on”) and dissociation (“off”) rate constants of target-protein scaffold binding, respectively. [L]0 is the initial concentration of target in solution and it should be in at least tenfold molar excess over the total displayed protein binders in solution. The binding reaches 95 % of equilibrium at 3τ and 99 % equilibrium at 4.6τ. For a typical protein-target interaction, the association rate (kon) can be estimated as 1 × 105/M/s. The dissociation rate (koff) can be determined from the kon and the equilibrium dissociation constant (KD) using the relationship: kon P + L C koff

K D = koff / kon

where P is the cell surface displayed protein binder, L is the target in solution, and C is protein-target complex. For most naïve

Protein Engineering by Yeast Surface Display

29

libraries, the highest KD encountered will not fall below 1 nM and incubation time of ~1 h at room-temperature (25 °C) should be sufficient to ensure that a binding reaction with KD ~10 nM approaches steady-state. High affinity protein–protein interactions (KD below 1 nM) typically have koff values in the range of 1 × 10−3/s and lower, necessitating longer incubation times. An overnight incubation (16–20 h) at room-temperature (25 °C) is generally sufficient to ensure that a binding reaction with KD ~1 nM or slightly lower approaches equilibrium. 31. The binding affinity of yeast cells collected within the polygonal sort gate is normalized to surface expression levels of the protein scaffold (same DyLight 488/Alexa Fluor 647 ratio). At a defined target concentration, yeast cells displaying the highest numbers of the protein scaffold and the tightest binding affinity only are selected. Initial rounds of selection are usually less stringent and up to 1–5 % of the entire yeast population is sorted in order to enrich for both low and high affinity clones to avoid loss of unique clones. The collected doublepositive yeast cells are then expanded in culture and further screened by performing successive flow cytometry sorts using more stringent conditions at lower biotinylated target concentrations in order to achieve better separation between clones with different binding affinities. Collect approximately 0.1– 0.5 % of the entire population and enrich for clones with higher affinity. Typically, 4–5 rounds of fluorescence activated cell sorting are necessary to isolate surface displayed protein binders with high affinity for the target of interest. If the flow cytometry data reveal no evidence for target-binding clones, consider performing additional rounds of bead-based enrichments or constructing a library with a different diversification strategy. 32. Effective primers for DNA sequencing for both pCT-CON and pCHA vectors are: Primer

Sequence

Forward-pCT-CON 5′-GTTCCAGACTACGCTCTGCAGG-3′ Reverse-pCT-CON 5′-GATTTTGTTACATCTACACTGTTG-3′ Forward-pCHA

5′-GGAGAAAAAACCCCGGATC ATGAAGG-3′

Reverse-pCHA

5′-CTACACTGTTGTTATCAGATTTCG CTCGAG-3′

33. Although an incubation time of 45 min is considered sufficient, we observe increased transformation efficiency when longer incubation times (~2–3 h) are applied.

30

Alessandro Angelini et al.

34. The type of tube used for the reaction (1.5 mL microcentrifuge tube, 15 or 50 mL conical tubes) depends on the final volume that should be adjusted such that the target is in at least tenfold excess over the total displayed protein binder available in solution (see Note 35). For multiple clones of yeast cell surface titrations, we recommend using 96-well plates and washing cells by resuspending them into 200 μL of ice-cold PBSA. Plates are centrifuged at 3,000 × g for 5 min at 4 °C. 35. The labeling reaction volume may vary depending on the binding affinity (KD) of selected binders. The following formula allows you to determine the minimum reaction volume (Vmin) to be used while ensuring a tenfold molar excess of target over the total number of cell surface displayed protein binders present in solution:  10 × N  V min =   N × [ L ]   A  where N is the number of total protein displayed, NA is the Avogadro’s number (6.022 × 1023) and [L] is target concentration in solution. The titration experiments are usually performed in triplicate to obtain an average and standard deviation for the KD value from independent experiments. 36. The target concentration range should ideally span two orders of magnitude both above and below of the expected KD value of the clone being measured. However, practical considerations of reaction volume and reagent usage may limit the ability to achieve this goal. Although 105–106 cells (109–1010 protein binders in solution) are typically recommended, the number of cells per tube can be decreased to reduce the required reaction volume and therefore the amount of biotinylated target and labeling reagents needed. In the case of very high affinity protein-target interactions (KD < 10 pM), the amount of biotinylated target, labeling reagents and reaction volume to be used can be further decreased by using 1 × 104 induced cells (5 × 108 protein binders in solution). However, yeast cell amounts lower than 1 × 105 cells do not pellet effectively. Therefore, 9 × 104 non-induced cells can be added and mixed with 1 × 104 induced cells (total 1 × 105 cells per tube) to form visible cell pellets upon centrifugation, while ensuring tenfold target excess over protein binders in solution [30, 83]. 37. Nonspecific sticking at high concentrations can result in nonsaturating KD titrations for weak binders. 38. Although pre-circularized plasmids can be used for transformation, homologous recombination removes additional steps such as in vitro ligation and E. coli transformation.

Protein Engineering by Yeast Surface Display

31

Moreover, as the mutagenized inserts are also homologous to each other, additional recombination events occur between inserts allowing generation of libraries with even greater diversity [98]. 39. The three long serial digestion steps with distinctive restriction enzymes (SalI, NheI, and BamHI) ensure complete linearization and absence of full-length insert therefore preventing transformation of yeast cells with parental plasmid. Large amounts of linearized vector are necessary to generate a large, diverse library; therefore multiple digestion reactions should be performed in parallel. An analogous digestion strategy should be used for alternative vectors such as pCHA. 40. In order to reintroduce diversity into a protein scaffold, plasmids from single yeast binding clones, a pool of selected clones or an entire population can be used as templates for PCR reaction. The amount of template can range between 0.1 and 1.0 ng. 1 ng of DNA template corresponds to approximately 108 plasmid molecules. 41. DNA primers used for the insert mutagenesis and subsequent amplification are the same ones used for the amplification and generation of the naïve DNA library via homologous recombination in pCT-CON and/or pCHA vector. The primers are designed to have 30–50 bp homology regions at each end to the corresponding ends of the linearized vector for use during homologous recombination. Primer

Sequence

Forw-pCTCON 5′-GGAGGCGGTAGCGGAGGCGGAGGG TCGGCTAGC-3′ Revs-pCTCON

5′-GTCCTCTTCAGAAATAAGCTTTTGT TCGGAT-3′

Forw-pCHA

5′-TACCCATACGACGTTCCAGACTACG CTGCTAGC-3′

Revs-pCHA

5′-TCGGAGATAAGCTTTTGTTCTGCACG CGTGGATCC-3′

42. Nucleotide analogue mutagenesis allows the frequency of mutations to be tuned based on the number of PCR cycles and the relative concentration of the mutagenic nucleotide analogues used during PCR. Running the PCR with two analogues, 8-oxo-2′-deoxyguanosine-5′-triphosphate and 2′-deoxy-nucleoside-5′-triphosphate (8-oxo-dGTP and dPTP, respectively) under these conditions is expected to introduce, on average, one or more amino acid mutations per gene (for a gene of 500 bp).

32

Alessandro Angelini et al.

43. PCR products cycled 15–20 times are generally visible on a gel stained with GelGreen. Reactions cycled 5–10 times may not be visible on a gel. Use a DNA ladder or a control amplified insert as a standard to excise the appropriate site. It is important to gel-extract and purify the mutagenized DNA to remove any non-mutated plasmid templates before performing following PCR amplification step. 44. Large amounts of insert are necessary to generate a highly diverse library. Therefore, multiple PCR reactions should be performed in parallel to yield enough DNA for 20–40 transformations.

Acknowledgments We gratefully acknowledge all members of the Wittrup group for helpful discussions and critical reading of this chapter. Furthermore, we thank the Koch Institute Swanson Biotechnology Center for technical support, specifically the Flow Cytometry and Biopolymers Core Facilities for FACS experiments and DNA sequencing, respectively. The financial contributions from the Swiss National Science Foundation (SNSF Fellowship for Advanced Researchers PA00P3 139659 to A.A.), the NIGMS/MIT Biotechnology Training Program (T.F.C. and N.J.Y.), the ICBP (1 U54 CA112967 to S.D.P.), and the Austrian Science Fund (Schrödinger Fellowship J3496-N28 to M.W.T) are gratefully acknowledged. References 1. Boder ET, Raeeszadeh-Sarmazdeh M, Price JV (2012) Engineering antibodies by yeast display. Arch Biochem Biophys 526:99–106. doi:10.1016/j.abb.2012.03.009 2. Gera N, Hussain M, Rao BM (2013) Protein selection using yeast surface display. Methods 60:15–26. doi:10.1016/j.ymeth.2012.03.014 3. Boder ET, Wittrup KD (1997) Yeast surface display for screening combinatorial polypeptide libraries. Nat Biotechnol 15:553–557. doi:10.1038/nbt0697-553 4. Kieke MC, Cho BK, Boder ET et al (1997) Isolation of anti-T cell receptor scFv mutants by yeast surface display. Protein Eng 10:1303–1310 5. Boder ET, Midelfort KS, Wittrup KD (2000) Directed evolution of antibody fragments with monovalent femtomolar antigen-binding affinity. Proc Natl Acad Sci U S A 97:10701–10705. doi:10.1073/pnas.170297297 6. Holler PD, Holman PO, Shusta EV et al (2000) In vitro evolution of a T cell receptor

7.

8.

9.

10.

with high affinity for peptide/MHC. Proc Natl Acad Sci U S A 97:5387–5392. doi:10.1073/ pnas.080078297 Graff CP, Chester K, Begent R et al (2004) Directed evolution of an anti-carcinoembryonic antigen scFv with a 4-day monovalent dissociation half-time at 37 degrees C. Protein Eng Des Sel 17:293–304. doi:10.1093/protein/gzh038 Feldhaus MJ, Siegel RW, Opresko LK et al (2003) Flow-cytometric isolation of human antibodies from a nonimmune Saccharomyces cerevisiae surface display library. Nat Biotechnol 21:163–170. doi:10.1038/nbt785 van den Beucken T, Pieters H, Steukers M et al (2003) Affinity maturation of Fab antibody fragments by fluorescent-activated cell sorting of yeast-displayed libraries. FEBS Lett 546: 288–294 Blaise L, Wehnert A, Steukers MP et al (2004) Construction and diversification of yeast cell surface displayed libraries by yeast mating:

Protein Engineering by Yeast Surface Display

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

application to the affinity maturation of Fab antibody fragments. Gene 342:211–218. doi:10.1016/j.gene.2004.08.014 Weaver-Feldhaus JM, Lou J, Coleman JR et al (2004) Yeast mating for combinatorial Fab library generation and surface display. FEBS Lett 564:24–34. doi:10.1016/S00145793(04)00309-6 Walker LM, Bowley DR, Burton DR (2009) Efficient recovery of high-affinity antibodies from a single-chain Fab yeast display library. J Mol Biol 389:365–375. doi:10.1016/j. jmb.2009.04.019 Lou J, Geren I, Garcia-Rodriguez C et al (2010) Affinity maturation of human botulinum neurotoxin antibodies by light chain shuffling via yeast mating. Protein Eng Des Sel 23:311–319. doi:10.1093/protein/gzq001 Wozniak-Knopp G, Bartl S, Bauer A et al (2010) Introducing antigen-binding sites in structural loops of immunoglobulin constant domains: Fc fragments with engineered HER2/neu-binding sites and antibody properties. Protein Eng Des Sel 23:289–297. doi:10.1093/protein/gzq005 Traxlmayr MW, Wozniak-Knopp G, Antes B et al (2011) Integrin binding human antibody constant domains: probing the C-terminal structural loops for grafting the RGD motif. J Biotechnol 155:193–202. doi:10.1016/j. jbiotec.2011.06.042 Traxlmayr MW, Hasenhindl C, Hackl M et al (2012) Construction of a stability landscape of the CH3 domain of human IgG1 by combining directed evolution with high throughput sequencing. J Mol Biol 423:397–412. doi:10.1016/j.jmb.2012.07.017 Rakestraw JA, Aird D, Aha PM et al (2011) Secretion-and-capture cell-surface display for selection of target-binding proteins. Protein Eng Des Sel 24:525–530. doi:10.1093/protein/gzr008 Tereshko V, Uysal S, Koide A et al (2008) Toward chaperone-assisted crystallography: protein engineering enhancement of crystal packing and X-ray phasing capabilities of a camelid single-domain antibody (VHH) scaffold. Protein Eng Des Sel 17:1175–1187. doi:10.1110/ps.034892.108 Dong J, Thompson AA, Fan Y et al (2010) A single-domain llama antibody potently inhibits the enzymatic activity of botulinum neurotoxin by binding to the non-catalytic alpha-exosite binding region. J Mol Biol 397:1106–1118. doi:10.1016/j.jmb.2010.01.070 Ryckaert S, Pardon E, Steyaert J et al (2010) Isolation of antigen-binding camelid heavy

21.

22.

23.

24.

25.

26.

27.

28.

29.

30.

33

chain antibody fragments (nanobodies) from an immune library displayed on the surface of Pichia pastoris. J Biotechnol 145:93–98. doi:10.1016/j.jbiotec.2009.10.010 Kieke MC, Shusta EV, Boder ET et al (1999) Selection of functional T cell receptor mutants from a yeast surface-display library. Proc Natl Acad Sci U S A 96:5651–5656 Shusta EV, Kieke MC, Parke E et al (1999) Yeast polypeptide fusion surface display levels predict thermal stability and soluble secretion efficiency. J Mol Biol 292:949–956. doi:10.1006/ jmbi.1999.3130 Kimura RH, Levin AM, Cochran FV et al (2009) Engineered cystine knot peptides that bind alphavbeta3, alphavbeta5, and alpha5beta1 integrins with low-nanomolar affinity. Proteins 77:359–369. doi:10.1002/prot.22441 Silverman AP, Levin AM, Lahti JL et al (2009) Engineered cystine-knot peptides that bind alpha(v)beta(3) integrin with antibody-like affinities. J Mol Biol 385:1064–1075. doi:10.1016/j.jmb.2008.11.004 Silverman AP, Kariolis MS, Cochran JR (2011) Cystine-knot peptides engineered with specificities for alpha(IIb)beta(3) or alpha(IIb) beta(3) and alpha(v)beta(3) integrins are potent inhibitors of platelet aggregation. J Mol Recognit 24:127–135. doi:10.1002/jmr.1036 Kimura RH, Jones DS, Jiang L et al (2011) Functional mutation of multiple solventexposed loops in the Ecballium elaterium trypsin inhibitor-II cystine knot miniprotein. PLoS One 6:e16112. doi:10.1371/journal. pone.0016112 Moore SJ, Cochran JR (2012) Engineering knottins as novel binding agents. Methods Enzymol 503:223–251. doi:10.1016/ B978-0-12-396962-0.00009-4 Chen TF, de Picciotto S, Hackel BJ et al (2013) Engineering fibronectin-based binding proteins by yeast surface display. Methods Enzymol 523:303–326.doi:10.1016/B978-0-12-3942920.00014-X Lipovsek D, Lippow SM, Hackel BJ et al (2007) Evolution of an interloop disulfide bond in high-affinity antibody mimics based on fibronectin type III domain and selected by yeast surface display: molecular convergence with single-domain camelid and shark antibodies. J Mol Biol 368:1024–1041. doi:10.1016/j. jmb.2007.02.029 Hackel BJ, Kapila A, Wittrup KD (2008) Picomolar affinity fibronectin domains engineered utilizing loop length diversity, recursive mutagenesis, and loop shuffling. J Mol Biol 381: 1238–1252. doi:10.1016/j.jmb.2008.06.051

34

Alessandro Angelini et al.

31. Koide S, Koide A, Lipovsek D (2012) Targetbinding proteins based on the 10th human fibronectin type III domain ((1)(0)Fn3). Methods Enzymol 503:135–156. doi:10.1016/ B978-0-12-396962-0.00006-9 32. Tasumi S, Velikovsky CA, Xu G et al (2009) High-affinity lamprey VLRA and VLRB monoclonal antibodies. Proc Natl Acad Sci U S A 106:12891–12896. doi:10.1073/pnas. 0904443106 33. Xu G, Tasumi S, Pancer Z (2011) Yeast surface display of lamprey variable lymphocyte receptors. Methods Mol Biol 748:21–33. doi:10.1007/978-1-61779-139-0_2 34. Gera N, Hussain M, Wright RC et al (2011) Highly stable binding proteins derived from the hyperthermophilic Sso7d scaffold. J Mol Biol 409:601–616. doi:10.1016/j.jmb.2011.04.020 35. Gera N, Hill AB, White DP et al (2012) Design of pH sensitive binding proteins from the hyperthermophilic Sso7d scaffold. PLoS One 7:e48928. doi:10.1371/journal.pone.0048928 36. Schmidt MM, Townson SA, Andreucci AJ et al (2013) Crystal structure of an HSA/FcRn complex reveals recycling by competitive mimicry of HSA ligands at a pH-dependent hydrophobic interface. Structure 21:1966–1978. doi:10.1016/j.str.2013.08.022 37. Huang D, Shusta EV (2005) Secretion and surface display of green fluorescent protein using the yeast Saccharomyces cerevisiae. Biotechnol Prog 21:349–357. doi:10.1021/ bp0497482 38. Pavoor TV, Cho YK, Shusta EV (2009) Development of GFP-based biosensors possessing the binding properties of antibodies. Proc Natl Acad Sci U S A 106:11895–11900. doi:10.1073/pnas.0902828106 39. Jiang W, Boder ET (2010) High-throughput engineering and analysis of peptide binding to class II MHC. Proc Natl Acad Sci U S A 107: 13258–13263. doi:10.1073/pnas.1006344107 40. Wen F, Sethi DK, Wucherpfennig KW et al (2011) Cell surface display of functional human MHC class II proteins: yeast display versus insect cell display. Protein Eng Des Sel 24:701– 709. doi:10.1093/protein/gzr035 41. Rao BM, Driver I, Lauffenburger DA et al (2004) Interleukin 2 (IL-2) variants engineered for increased IL-2 receptor alpha-subunit affinity exhibit increased potency arising from a cell surface ligand reservoir effect. Mol Pharmacol 66:864–869. doi:10.1124/mol.66.4 42. Levin AM, Bates DL, Ring AM et al (2012) Exploiting a natural conformational switch to engineer an interleukin-2 ‘superkine’. Nature 484:529–533. doi:10.1038/nature10975

43. Rao BM, Driver I, Lauffenburger DA et al (2005) High-affinity CD25-binding IL-2 mutants potently stimulate persistent T cell growth. Biochemistry 44:10696–10701. doi:10.1021/bi050436x 44. Junttila IS, Creusot RJ, Moraga I et al (2012) Redirecting cell-type specific cytokine responses with engineered interleukin-4 superkines. Nat Chem Biol 8:990–998. doi:10.1038/ nchembio.1096 45. Cochran JR, Kim YS, Lippow SM et al (2006) Improved mutants from directed evolution are biased to orthologous substitutions. Protein Eng Des Sel 19:245–253. doi:10.1093/ protein/gzl006 46. Lahti JL, Lui BH, Beck SE et al (2011) Engineered epidermal growth factor mutants with faster binding on-rates correlate with enhanced receptor activation. FEBS Lett 585:1135–1139. doi:10.1016/j.febslet.2011. 03.044 47. Papo N, Silverman AP, Lahti JL et al (2011) Antagonistic VEGF variants engineered to simultaneously bind to and inhibit VEGFR2 and alphavbeta3 integrin. Proc Natl Acad Sci U S A 108:14067–14072. doi:10.1073/pnas. 1016635108 48. Jones DS 2nd, Tsai PC, Cochran JR (2011) Engineering hepatocyte growth factor fragments with high stability and activity as Met receptor agonists and antagonists. Proc Natl Acad Sci U S A 108:13035–13040. doi:10.1073/pnas.1102561108 49. Lee CH, Park KJ, Sung ES et al (2010) Engineering of a human kringle domain into agonistic and antagonistic binding proteins functioning in vitro and in vivo. Proc Natl Acad Sci U S A 107:9567–9571. doi:10.1073/ pnas.1001541107 50. Shpilman M, Niv-Spector L, Katz M et al (2011) Development and characterization of high affinity leptins and leptin antagonists. J Biol Chem 286:4429–4442. doi:10.1074/jbc. M110.196402 51. Garcia-Rodriguez C, Levy R, Arndt JW et al (2007) Molecular evolution of antibody crossreactivity for two subtypes of type A botulinum neurotoxin. Nat Biotechnol 25:107–116. doi:10.1038/nbt1269 52. Weaver-Feldhaus JM, Miller KD, Feldhaus MJ et al (2005) Directed evolution for the development of conformation-specific affinity reagents using yeast display. Protein Eng Des Sel 18:527–536. doi:10.1093/protein/gzi060 53. Hu X, Kang S, Lefort C et al (2010) Combinatorial libraries against libraries for selecting neoepitope activation-specific antibodies. Proc Natl Acad Sci

Protein Engineering by Yeast Surface Display

54.

55.

56.

57.

58.

59.

60.

61.

62.

63.

64.

U S A 107:6252–6257. doi:10.1073/pnas. 0914358107 Shusta EV, Holler PD, Kieke MC et al (2000) Directed evolution of a stable scaffold for T-cell receptor engineering. Nat Biotechnol 18:754– 759. doi:10.1038/77325 Traxlmayr MW, Obinger C (2012) Directed evolution of proteins for increased stability and expression using yeast display. Arch Biochem Biophys 526:174–180. doi:10.1016/j.abb. 2012.04.022 Traxlmayr MW, Faissner M, Stadlmayr G et al (2012) Directed evolution of stabilized IgG1-Fc scaffolds by application of strong heat shock to libraries displayed on yeast. Biochim Biophys Acta 1824:542–549. doi:10.1016/j. bbapap.2012.01.006 Lipovsek D, Antipov E, Armstrong KA et al (2007) Selection of horseradish peroxidase variants with enhanced enantioselectivity by yeast surface display. Chem Biol 14:1176– 1185. doi:10.1016/j.chembiol.2007.09.008 Parthasarathy R, Bajaj J, Boder ET (2005) An immobilized biotin ligase: surface display of Escherichia coli BirA on Saccharomyces cerevisiae. Biotechnol Prog 21:1627–1631. doi:10.1021/bp050279t Chen I, Dorr BM, Liu DR (2011) A general strategy for the evolution of bond-forming enzymes using yeast display. Proc Natl Acad Sci U S A 108:11399–11404. doi:10.1073/pnas. 1101046108 Shiraga S, Ishiguro M, Fukami H et al (2005) Creation of Rhizopus oryzae lipase having a unique oxyanion hole by combinatorial mutagenesis in the lid domain. Appl Microbiol Biotechnol 68:779–785. doi:10.1007/ s00253-005-1935-0 Shiraga S, Kawakami M, Ishiguro M et al (2005) Enhanced reactivity of Rhizopus oryzae lipase displayed on yeast cell surfaces in organic solvents: potential as a whole-cell biocatalyst in organic solvents. Appl Environ Microbiol 71:4335–4338. doi:10.1128/AEM. 71.8.43354338.2005 Han SY, Zhang JH, Han ZL et al (2011) Combination of site-directed mutagenesis and yeast surface display enhances Rhizomucor miehei lipase esterification activity in organic solvent. Biotechnol Lett 33:2431–2438. doi:10.1007/s10529-011-0705-6 Chao G, Cochran JR, Wittrup KD (2004) Fine epitope mapping of anti-epidermal growth factor receptor antibodies through random mutagenesis and yeast surface display. J Mol Biol 342:539–550. doi:10.1016/j.jmb.2004.07.053 Cochran JR, Kim YS, Olsen MJ et al (2004) Domain-level antibody epitope mapping

65.

66.

67.

68.

69.

70.

71.

72.

73.

74.

75.

76.

35

through yeast surface display of epidermal growth factor receptor fragments. J Immunol Methods 287:147–158. doi:10.1016/j.jim. 2004.01.024 Chung KM, Nybakken GE, Thompson BS et al (2006) Antibodies against West Nile Virus nonstructural protein NS1 prevent lethal infection through Fc gamma receptor-dependent and -independent mechanisms. J Virol 80:1340–1351. doi:10.1128/JVI. 80.3.1340-1351.2006 Levy R, Forsyth CM, LaPorte SL et al (2007) Fine and domain-level epitope mapping of botulinum neurotoxin type A neutralizing antibodies by yeast surface display. J Mol Biol 365: 196–210. doi:10.1016/j.jmb.2006.09.084 Garcia-Rodriguez C, Zhou Y, Marks JD (2010) Antibody epitope mapping using yeast display. In: Kontermann RE, Stefan D (eds) Antibody engineering, vol 1. SpringerVerlag, Berlin, pp 591–605. doi:10.1007/ 978-3-642-01144-3_37 Mata-Fink J, Kriegsman B, Yu HX et al (2013) Rapid conformational epitope mapping of antigp120 antibodies with a designed mutant panel displayed on yeast. J Mol Biol 425:444–456. doi:10.1016/j.jmb.2012.11.010 Smith GP (1985) Filamentous fusion phage: novel expression vectors that display cloned antigens on the virion surface. Science 228: 1315–1317 Daugherty PS (2007) Protein engineering with bacterial display. Curr Opin Struct Biol 17:474–480. doi:10.1016/j.sbi.2007.07.004 Ho M, Nagata S, Pastan I (2006) Isolation of anti-CD22 Fv with high affinity by Fv display on human cells. Proc Natl Acad Sci U S A 103: 9637–9642. doi:10.1073/pnas.0603653103 Beerli RR, Bauer M, Buser RB et al (2008) Isolation of human monoclonal antibodies by mammalian cell display. Proc Natl Acad Sci U S A 105:14336–14341. doi:10.1073/ pnas.0805942105 Lipovsek D, Pluckthun A (2004) In-vitro protein evolution by ribosome display and mRNA display. J Immunol Methods 290:51–67. doi:10.1016/j.jim.2004.04.008 Van der Vaart JM, te Biesebeke R, Chapman JW et al (1997) Comparison of cell wall proteins of Saccharomyces cerevisiae as anchors for cell surface expression of heterologous proteins. Appl Environ Microbiol 63:615–620 Kondo A, Ueda M (2004) Yeast cell-surface display: applications of molecular display. Appl Microbiol Biotechnol 64:28–40. doi:10.1007/ s00253-003-1492-3 Pepper LR, Cho YK, Boder ET et al (2008) A decade of yeast surface display technology:

36

77.

78.

79.

80.

81.

82.

83.

84.

85.

86.

87.

Alessandro Angelini et al. where are we now? Comb Chem High Throughput Screen 11:127–134 Rakestraw JA, Baskaran AR, Wittrup KD (2006) A flow cytometric assay for screening improved heterologous protein secretion in yeast. Biotechnol Prog 22:1200–1208. doi:10.1021/bp0600233 Sazinsky SL, Ott RG, Silver NW et al (2008) Aglycosylated immunoglobulin G1 variants productively engage activating Fc receptors. Proc Natl Acad Sci U S A 105:20167–20172. doi:10.1073/pnas.0809257105 Dutta S, Koide A, Koide S (2008) Highthroughput analysis of the protein sequencestability landscape using a quantitative yeast surface two-hybrid system and fragment reconstitution. J Mol Biol 382:721–733. doi:10.1016/j.jmb.2008.07.036 Hu X, Kang S, Chen X et al (2009) Yeast surface two-hybrid for quantitative in vivo detection of protein-protein interactions via the secretory pathway. J Biol Chem 284:16369– 16376. doi:10.1074/jbc.M109.001743 Lim KH, Madabhushi SR, Mann J et al (2010) Disulfide trapping of protein complexes on the yeast surface. Biotechnol Bioeng 106:27–41. doi:10.1002/bit.22651 VanAntwerp JJ, Wittrup KD (2000) Fine affinity discrimination by yeast surface display and flow cytometry. Biotechnol Prog 16:31–37. doi:10.1021/bp990133s Orcutt KD, Wittrup KD (2010) Yeast display and selections. In: Kontermann RE, Stefan D (eds) Antibody engineering, vol 1. SpringerVerlag, Berlin, pp 207–233. doi:10.1007/ 978-3-642-01144-3_37 Orr BA, Carr LM, Wittrup KD et al (2003) Rapid method for measuring ScFv thermal stability by yeast surface display. Biotechnol Prog 19:631–638. doi:10.1021/bp0200797 Bowley DR, Labrijn AF, Zwick MB et al (2007) Antigen selection from an HIV-1 immune antibody library displayed on yeast yields many novel antibodies compared to selection from the same library displayed on phage. Protein Eng Des Sel 20:81–90. doi:10.1093/protein/gzl057 Patel CA, Wang J, Wang X et al (2011) Parallel selection of antibody libraries on phage and yeast surfaces via a cross-species display. Protein Eng Des Sel 24:711–719. doi:10.1093/ protein/gzr034 Bowley DR, Jones TM, Burton DR et al (2009) Libraries against libraries for combinatorial

88.

89.

90.

91. 92.

93.

94.

95.

96.

97.

98.

99.

selection of replicating antigen-antibody pairs. Proc Natl Acad Sci U S A 106:1380–1385. doi:10.1073/pnas.0812291106 Wildt S, Gerngross TU (2005) The humanization of N-glycosylation pathways in yeast. Nat Rev Microbiol 3:119–128. doi:10.1038/ nrmicro1087 Colby DW, Kellogg BA, Graff CP et al (2004) Engineering antibody affinity by yeast surface display. Methods Enzymol 388:348–358. doi:10.1016/S0076-6879(04)88027-3 Chao G, Lau WL, Hackel BJ et al (2006) Isolating and engineering human antibodies using yeast surface display. Nat Protoc 1:755– 768. doi:10.1038/nprot.2006.94 Van Deventer JA, Wittrup KD. In preparation Van Deventer JA, Wittrup KD (2014) Yeast surface display for antibody isolation: library construction, library screening and affinity maturation. Methods Mol Biol 1131:151–181. doi:10.1007/978-1-62703-992-5_10 Ackerman M, Levary D, Tobon G et al (2009) Highly avid magnetic bead capture: an efficient selection method for de novo protein engineering utilizing yeast surface display. Biotechnol Prog 25:774–783. doi:10.1002/btpr.174 Zaccolo M, Williams DM, Brown DM et al (1996) An approach to random mutagenesis of DNA using mixtures of triphosphate derivatives of nucleoside analogues. J Mol Biol 255:589–603. doi:10.1006/jmbi. 1996.0049 Zaccolo M, Gherardi E (1999) The effect of high-frequency random mutagenesis on in vitro protein evolution: a study on TEM-1 beta-lactamase. J Mol Biol 285:775–783. doi:10.1006/jmbi.1998.2262 Stemmer WP (1994) DNA shuffling by random fragmentation and reassembly: in vitro recombination for molecular evolution. Proc Natl Acad Sci U S A 91:10747–10751 Stemmer WP (1994) Rapid evolution of a protein in vitro by DNA shuffling. Nature 370:389–391. doi:10.1038/370389a0 Swers JS, Kellogg BA, Wittrup KD (2004) Shuffled antibody libraries created by in vivo homologous recombination and yeast surface display. Nucleic Acids Res 32:e36. doi:10.1093/nar/gnh030 Boder ET, Wittrup KD (1998) Optimal screening of surface-displayed polypeptide libraries. Biotechnol Prog 14:55–62. doi:10.1021/ bp970144q

Chapter 2 Isolation and Validation of Anti-B7-H4 scFvs from an Ovarian Cancer scFv Yeast-Display Library Denarda Dangaj and Nathalie Scholler Abstract B7-H4 (VTCN1, B7x, B7s) is an inhibitory modulator of T-cell response implicated in antigen tolerization. As such, B7-H4 is an immune checkpoint of potential therapeutic interest. To generate anti-B7-H4 targeting reagents, we isolated antibodies by differential cell screening of a yeast-display library of recombinant antibodies (scFvs) derived from ovarian cancer patients and we screened for functional scFvs capable to interfere with B7-H4-mediated inhibition of antitumor responses. We found one antibody binding to B7-H4 that could restore antitumor T cell responses. This chapter gives an overview of the methods we developed to isolate a functional anti-B7-H4 antibody fragment. Key words pAGA2 vector, p416 BCCP vector, Magnetic sorting, Flow sorting, Cell panning, Homologous recombination, Immune checkpoint, Functional assays, Tumor-associated macrophages, CD3-stimulated T cells, T2 APCs, Humanized mouse model of ovarian cancer

1

Introduction B7-H4, also called B7x/B7s, is a B7 superfamily member recently identified as an inhibitory modulator of T-cell response [1–3]. When present at the surface of antigen presenting cells, B7-H4 negatively regulates T cell activation, possibly through interaction with a ligand that remains to be identified [4]. B7-H4 mRNA is widely expressed but the restricted pattern of protein expression in normal tissues suggests posttranscriptional regulation. B7-H4 expression in tumor tissues is observed in various types of human cancers such as breast [5], ovarian [6], pancreatic, lung [7, 8] melanoma [9], and renal cell carcinoma [10]. In most studies, B7-H4 was determined to be either located in the cytoplasm or at the plasma membrane protein by immunohistochemistry [9–13]. B7-H4 expression in ovarian cancer cell lines, B7-H4 expression was also reported to be mainly intracellular by flow cytometry [6, 7].

Bin Liu (ed.), Yeast Surface Display: Methods, Protocols, and Applications, Methods in Molecular Biology, vol. 1319, DOI 10.1007/978-1-4939-2748-7_2, © Springer Science+Business Media New York 2015

37

38

Denarda Dangaj and Nathalie Scholler

We have recently shown that B7-H4 is present at the surface of uncultured tumor cells derived from ovarian cancer samples and its expression is diminished when tumors are cultured in vitro. The broad presence of B7-H4 in various cancers and its known function as negative regulator of T cell activation suggest a specific role in down-regulation of antitumor immunity. In fact, ovarian cancerderived B7-H4+ TAMs suppress HER2-specific T-cell proliferation and cytotoxicity, and the blocking of B7-H4 expression on macrophages using morpholino antisense oligonucleotides improved tumor-associated antigen T-cell responses in vitro and in vivo [6]. Altogether, these results ascribe a translational value to B7-H4 as a target molecule for antitumor immunotherapy. In an effort to develop alternate means for blocking B7-H4 activity for development for clinical applications, we sought to isolate anti-B7-H4 recombinant antibodies (scFvs). Single chain Fragments variables (scFvs) are recombinant antibodies expressing single antigen-binding domain constituted by peptide-linked variable domains of heavy and light immunoglobulin chains. ScFvs small size, versatility, and amenability to affinity maturation, make them particularly interesting for in vivo targeting, in vivo imaging after conjugation with radioisotopes, and for therapeutic purposes after conjugation with endotoxins or nanoparticles [14] or fused to T cell signalling domains to engineer modified T cell receptors [15]. We first derived a yeast-display scFv library from tumorinfiltrating B cells and PBMCs of 11 ovarian cancer patients. AntiB7-H4 scFvs were isolated by selection for specific binding to both soluble B7-H4 recombinant protein (rB7-H4) expressed by mammalian cells and B7-H4+ cancer cells. Then, to identify scFvs that could reverse the B7-H4 mediated T cell inhibition, we set up in vitro systems to model T cell inhibition mediated by presentation of B7-H4 and we tested the ability of the newly isolated anti-B7-H4 scFvs to reverse nonspecific and antigen-specific T cell inhibitions in vitro and in a humanized mouse model of ovarian cancer [16].

2

Materials

2.1 Construction of Yeast-Display scFv Library Derived from Ovarian Cancer Patients

Using the vector pAGA2 [17] that enables homologous recombination in yeast, we built up a library of recombinant antibodies derived from B cells isolated from ascites (n = 10) and PBMCs (n = 1) of ovarian cancer patients (stages III or IV). 1. Yeast strain: EBY100. 2. Yeast growth media: SD-CAA and SD-CAA agar [18]. 3. Yeast induction media: SGR-CAA [18]. 4. PBE buffer: Phosphate buffer saline supplemented with 5 g/L of BSA fraction V and 10 mM EDTA, pH 8.

Anti-B7-H4 scFvs from Yeast-Display Library

39

5. Pretreating solution: 25 mM DTT, 0.6 M sorbitol, 20 mM Hepes, pH = 7.5. 6. Sorbitol 1 M. 7. Gene Pulser (Bio-Rad), 0.2 cm cuvette. 8. Incubator shaker at 30 °C. 9. Incubator shaker at 20 °C. 10. Yeast-display expression pAGA2 vector, available upon request to N. Scholler ([email protected]) pending MTA. 11. Ficoll-Paque PLUS (Life-Sciences) to isolate human lymphocytes from ascites and peripheral blood of ovarian cancer patients. 12. CD19 magnetic beads (Miltenyi), magnetic stand and LD columns (Miltenyi) to purify B cells from human lymphocytes isolated from cancer patients. 13. mRNA purification kit (Qiagen). 14. SuperScript II reverse transcriptase (Invitrogen). 15. Oligo(dT)12–18 Primer (Promega). 16. Platinum Taq DNA polymerase (Invitrogen). 17. dNTPs Master mix. 18. Forward and reverse primer sequences for amplification of human subfamilies of VH and VL gene fragments and cloning by in vivo homologous recombination in pAGA2 vector are listed in Tables 1 and 2. 19. DNA electrophoresis apparatus. 20. Thermocycler (PCR machine). 2.2 Isolation of Yeast-Display scFv Binding to B7-H4

We performed two rounds of screening of the yeast-display library. First, we selected yeast-display scFvs that bound to B7-H4 recombinant protein. Materials and methods for selection of yeast display recombinant antibodies with recombinant proteins were detailed in ref. [18]. We then proceeded to a second round of selection by differential panning of the selected yeast-display scFvs on B7-H4+ vs. B7-H4− cell lines that were plastic-immobilized. 1. Macrophages expressing B7-H4 [16]. 2. Trizol (Sigma). 3. Oligo (dT)12–18 Primer (Promega). 4. Reverse-Transcription PCR kit (Promega). 5. Primers for B7-H4 amplification and cloning into pTT28 expression vector [19]: B7-H4 For: 5′-gttctggtggtggaggttctggtggtggtggatctgagtttggtatttcagggagacactccatca 3′ B7-H4 Rev: 5′ agaccgaggagagggttagggataggcttaccgtcgacagaa gcctttgagtttagcagctgtag-3′.

40

Denarda Dangaj and Nathalie Scholler

Table 1 Forward primer sequences Forward primers name

Sub-families amplified

Primer sequence

VHF1

VH1/7

cag gts cag ctg gtr cag tct gg

VHF2

VH2

cag rtc acc ttg arg gag tct gg

VHF3

VH3

gar gtg cad ctg gtg gag tc

VHF4

VH4

cag stg cag ctg cag gag tcg ggc

VHF5

VH4

cag gtg cag cta car cag tgg ggc

VHF6

VH5

gar gtg cag ctg gtg cag tcy gg

VKF1

VK1/4

ghc atc cdg wtg acc cag tct cc

VKF2

VK2/6

gat rtt gtg atg ach cag wct cca

VKF3

VK3

gaa atw gtg wtg acr cag tct cca

VKF4

KV5

Gaa acg aca ctc acg cag tct cca g

VKF5

KV6

Gaa att gtg ctg act cag tct cca g

VLF1

VL1

cag tct gtg btg ack cag ccr cc

VLF2

VL2

car tct gcc ctg act cag cc

VLF3

VL3

tcc tat gag ctg ctg acd cag cya

VLF4

VL3–19

tct tct gag ctg act cag gac cc

VLF5

LV3–32

tcc tct ggg cca act cag gtg cc

VLF6

VL4/5

cwg cct gtg ctg act car yc

VLF7

LV6

aat ttt atg ctg act cag ccc c

VLF8

VL7/8

cag rct gtg gtg acy cag gag cc

VLF9

LV/10

cag scw gkg ctg act cag cca cc

VLF10

LV911

cgg ccc gtg ctg act cag cc

VHF

VKF

VLF

6. 293F cells for protein expression (Invitrogen). 7. OptiMEM (Invitrogen). 8. Lipofectamine (Invitrogen). 9. Snake skin dialysis membrane (Pierce). 10. Nickel sepharose beads (Sigma/resin).

Anti-B7-H4 scFvs from Yeast-Display Library

41

Table 2 Reverse primer sequences Reverse primers VHR VHR1

JH1/2/4/5

Tga gga gac rgt gac cag gg

VHR2

JH3

Tga aga gac ggt gac cat tgt cc

VHR3

JH6

Tga gga gac ggt gac cgt ggt cc

VKR1

JK1

Ttt gat ttc cac ctt ggt ccc

VKR2

Jk2/4

Ttt gat ctc cas ctt ggt ccc

VKR3

Jk3

Ttt gat atc cac ttt ggt ccc agg

VKR4

Jk5

Ttt aat ctc cag tcg tgt ccc ttg

VLR1

JL1

Tag gac ggt gac ctt ggt ccc

VLR2

JL2/3/5

Tag gac ggt cag cty ggt ccc

VLE3

JL4

Taa aat gat cag ctg ggt tcc tcc

VLR4

JL6

Gag gac ggt cac ctt ggt gcc

VLR5

JL7

Gaa gtc ctg tgc gag gca gc

VKR

VLR

M

R

W

S

Y

K

V

H

D

B

N

a/c

a/g

a/t

c/g

c/t

g/t

a/c/t

a/c/t

a/g/t

c/g/t

a/c/g/t

11. Equilibrium buffer (EQ buffer): 0.3 M NaCl, 0.05 M NaH2PO4, pH 8. 12. Washing buffer: 0.3 M NaCl, 0.05 M NaH2PO4, 20 mM imidazole. 13. Elution buffer (EB): 0.3 M NaCl, 0.05 M NaH2PO4, 300 mM Imidazole, pH 8. 14. NanoOrange Protein Quantification kit (Invitrogen). 15. HIS-probe (Santa Cruz Biotechnology). 16. Polyclonal anti-B7-H4 antibody (Abcam). 17. CO2 incubator at 37 °C. 18. Sterile hood for cell culture. 19. Cell culture media. 20. Phase-contrast microscope.

42

Denarda Dangaj and Nathalie Scholler

21. Wild type ovarian cancer cell lines (OVCAR3, C30) and ovarian cancer cell line expressing B7-H4 after viral transfection. 22. Cell medium. 23. RNA easy kit (Qiagen). 24. Ready-to-go you-prime First-Strand Beads (GE Healthcare). 25. Primers for B7-H4 amplification and cloning into pTT28 vector in frame with 6XHIS Tag. B7-H4-for: 5′-ggttctggtggtggaggttctggtggtggtggatctggtttgg tatttcagggagacactccatca-3′ B7-H4-rev: 5′-agaccgaggagagggttagggataggcttaccgtcgacagaag cctttgagtttagcagctgtag-3′. 26. Primers for B7-H4 amplification and cloning into Xba1/Sal1 linearized lentiviral vector [16]. B7H4-F: 5′-ACGCTCTAGAATGGCTTCCCTGGGGCAGA TCCTCT-3′ B7H4-R: 5′-ACGCGTCGACTTATTTTAGCATCAGGTAA GGGCTG-3′. 27. Self-inactivating lentiviral expression vectors pVSV-G (VSV glycoprotein expression plasmid), pRSV.REV (Rev expression plasmid), pMDLg/p.RRE (Gag/Pol expression plasmid), and pELNS transfer plasmid [20]. 28. Express Inn (Open Biosystems). 29. 293T human embryonic kidney cells. 30. QIAGEN Endo-free Maxi prep kit. 31. Ultracentrifuge and Beckman SW28 rotor (Beckman Coulter, Fullerton, CA). 32. Poly-L-Lysine coated 6-well plates. 33. Rotator. 34. Monoclonal anti-B7-H4 PE conjugated antibody (AbD Serotec). 2.3 Conversion of the Selected Yeast Display Anti-B7-H4 scFv into a Soluble Form and Screening in Systems Modeling B7-H4-Mediated Inhibition of T-Cell Functions

Anti-B7-H4 yeast-display scFvs were transferred from the display vector pAGA2 into its companion vector for yeast secretion, p416-BCCP [17] as detailed in ref. [18]. p416-BCCP vector is available upon request to N. Scholler ([email protected]), pending MTA. 1. T2 APC, wild type or transduced to express B7-H4. 2. Cancer cell lines, wild type or transduced to express B7-H4 and present tumor-associated peptide. 3. Primary human T cells expressing antigen-specific TCR. 4. Selected Anti-B7-H4 scFvs (final concentration 5 μg/ml). 5. IFN-γ quantification ELISA kit (BioLegend).

Anti-B7-H4 scFvs from Yeast-Display Library

3

43

Methods

3.1 Yeast Display Library Construction

3.1.1 B Cell Isolation and scFv Domain Amplification

The insertion of VH-VL fragments encoding the scFv in pAGA2 vector was performed by in vivo homologous recombination between three partners: VH PCR fragments, VL PCR fragments, and linearized pAGA2 vector (Fig. 1). Resulting scFvs were composed of VH (Fig. 1, orange fragment) and VL fragments (Fig. 1, green fragment) attached together by GGSSRSSSSGGGGSGGGG linker (Fig. 1, blue fragment). Sequences were added to each primer ends for enabling annealing with pAGA2 vector. 1. Isolate B cells from peripheral blood by centrifugation of diluted blood on Ficoll gradient (see Note 1) followed up by two washed in medium and magnetic separation with CD19 magnetic beads as recommended by the manufacturer 2. Isolate B cells from ascites after resuspension of the leukocytes in medium (5 × 106 cells/ml) by Ficoll gradient and magnetic separation with CD19 magnetic beads as in step 1. 3. Combine B cells and isolate mRNA (see Note 2)

Fig. 1 Schematic representation of the cloning by in vivo homologous recombinations of VL and VH fragments in pAGA2 vector. pAGA2 vector was linearized with Nhe1 and Xho1. VL fragments (green domain, Table 1) were flanked in 5′ with pAGA2 homologous sequence (black domains, 5′-ggtggtggaggttctggtggtggtggatctgtc-3′) for recombination with pAGA2 in 5′ end, and in 3′ end with homologous sequences (blue upper domain, 5′-cgctgccaccgccgccgctggaacttgacct agaggatccgcc-3′) for recombination with the linker (5′-ggcggatcctctaggtcaagttccagcggcggcggtggcagcggaggcggcggt-3′). VH fragments (orange domain, Table 2) were flanked in 5′ with homologous sequences (blue lower domain, 5′-ctaggtcaagttccagcggcggcggtgg-cagcggaggcggcggt-3′) for recombination with the linker and pAGA2 in 3′ end (grey domains, 3′-gtcttcttcagaaataagcttttgttcggatccctcgaa-5′) (Color figure online)

44

Denarda Dangaj and Nathalie Scholler

4. Perform reverse transcription reactions to permit PCR amplification of VH and VL fragments (see Note 3) 5. PCR amplify the products of retrotranscription using the primers described in Tables 1 and 2. Set up the PCR mix as described in ref. [18] and use the following cycling conditions: 94 °C 5 min at, (94 °C 1 min; 55 °C 1 min; 72 °C 1 min) × 25; 72 °C 7 min. 3.1.2 Yeast Transformation

1. Linearize pAGA2 vector with Nhe1 and Xho1 2. Separate linearized vector and PCR products by gel electrophoresis 3. Purify separated DNA fragments by gel extraction kit 4. Transfect the mixture of linearized pAGA2 vector, VH and VL into EBY100 yeast cells at a 1/3/3 ratio and proceed to electroporation. 5. Day 1: inoculate a single colony of EBY100 into 5 ml YEPD, cultured overnight (ON), 30 °C, 200 rpm. 6. Day 2: Inoculate appropriate volume (5, 10, 20, 40, 80 μl) saturated cells into 200 ml YEPD, and cultured ON, 30 °C, 200 rpm. 7. Day 3: Competent cell preparation and yeast electroporation. Identify the culture where the cell density is between 5 × 106 and 2 × 107 cells/ml. Resuspend these cells at 1 × 107/ml in SD-CAA. 8. Day 3 (continued): Spin down and resuspend the cells in ¼ volume pretreating solution. 9. Day 3 (continued): Incubate the cells at 30 °C for 30 min with rotation. 10. Day 3 (continued): The following steps are performed in ice or ice chilled solution. 11. Day 3 (continued): spin and wash the cells with ½ volume of 1 M sorbitol (ice chilled solution) 12. Day 3 (continued): spin and resuspend cells with 2–3 volume 1 M sorbitol (ice chilled solution). The cells are now competent for electroporation. 13. Day 3 (continued): mix linearized pAGA2 (NheI/XhoI) (1–10 μg) and 2–10 times scFv PCR fragments with 100 μl of competent cells (on ice) 14. Day 3 (continued): Perform electroporation at 1.5 kV. Resuspend the cells in 1 ml SD-CAA and inoculate into 1 L SD-CAA (ice-chilled solution) 15. Day 3 (continued): At the same time, serially dilute 100 μl with TE and plate on SD + CAA agar plate for library size assessment.

Anti-B7-H4 scFvs from Yeast-Display Library

45

16. Day 3 (continued): Grow the liquid culture at 30 °C, ON with agitation (250 rpm). After 16–20 h, the absorbance at 600 nm should read between 1 and 2 (A600 = 1 corresponds at 107 yeast/ ml). Grow the plated yeast up to 48 h at 30 °C. 17. Day 4: harvest the library and proceed to induction immediately (see Note 4), or store the culture up to 3 weeks at 4 °C (see Note 5). For long-term storage, add 15 % glycerol in the yeast culture and freeze 1 ml aliquots. 3.1.3 Induction of scFv Expression at the Yeast Cell Surface for Screening

1. Induce at room temperature (22–24 °C) with agitation (250 rpm), ON. A600 must be 0.5 after yeast resuspension in SGR-CAA, and 1–1.5 after ON culture. 2. Pellet induced yeast by centrifugation, resuspend in 50 ml of PBE, and pellet again (see Note 6). The pellet should measure about 5 ml. 3. Resuspend the pellet in an equal volume of PBE. Proceed to sorting/panning immediately, or store the induced library up to 2 weeks at 4 °C (see Note 7). 4. Selection by magnetic and flow sorting of yeast-display antiB7-H4 scFv using B7-H4 recombinant protein, as detailed in ref. [18].

3.2 Generation of B7-H4 Recombinant Protein and B7-H4 Expresser Cell Lines 3.2.1 B7-H4 Recombinant Protein

1. Isolate total RNA from tumor associated-macrophages. 2. Synthesize in vitro cDNA using oligo-dT. 3. PCR-amplify the extracellular domain of B7-H4 (IgC + IgV) from in vitro synthesized cDNA for cloning into pTT28 with the primers B7-H4-for and B7-H4-rev. 4. Purify plasmid DNA using the QIAGEN Endo-free Maxi prep kit. 5. Transfect 293-F mammalian cells with B7-H4-pTT28 vector using Express-Inn transfection reagent according to manufacturer’s instructions. 6. Harvest serum free supernatants containing soluble B7-H4 after 3 and 6 days of culture. 7. Dialyze 50–500 ml of cell supernatant containing soluble B7-H4 protein in 5 L of 1×PBS twice using snake-skin membrane. 8. Washing of Nickel sepharose resin preparation: centrifuge at 750 × g for 5 min to remove the preservative solution, wash once with 5 volumes of ddH2O, and twice with 5 volumes EQ buffer for 15 min at room temperature with gentle rotation. 9. Mix 1–1.5 ml of washed Nickel sepharose resin with 100 ml of SN and incubate at 4 °C for 1.5–2 h with rotation.

46

Denarda Dangaj and Nathalie Scholler

10. Remove SN containing unbound proteins by centrifugation. 11. Wash twice the resin containing bound B7-H4 with washing buffer for 5 min with gentle rotation (e.g., 50 ml for 500 ml initial SN). 12. Elute resin with EB buffer for 15 min at room temperature with gentle rotation. Repeat once. 13. Dialyze the eluted proteins against 1× PBS and repeat twice. 14. Quantify the protein concentration with the NanoOrange kit. 3.2.2 Generation of B7-H4 Cell Lines

1. Isolate total RNA from OVCAR-3 ovarian tumor cells and reverse transcript with the kit “ready-to-go you-prime FirstStrand Beads”. 2. PCR-amplify the full length B7-H4 using the in vitro synthesized cDNA as a template for PCR reaction with the primers B7-H4-F and B7-H4-R. 3. Digest the PCR products with XbaI and SalI enzymes and gel purify 4. Clone the digested PCR products into XbaI/SalI linearized pELNS, a third generation self-inactivating lentiviral expression vector [20], in which the transgene expression is driven by the EF-1a promoter, to obtain pELNS-B7-H4. 5. Purify plasmid DNA using the QIAGEN Endo-free Maxi prep kit. 6. Seed human embryonic kidney cells 293T at a density of 10 × 106 cell per T-150 tissue culture flask 24 h before transfection. 7. Transfected cells with 7 μg of pVSV-G (VSV glycoprotein expression plasmid), 18 μg of pRSV.REV (Rev expression plasmid), 18 μg of pMDLg/p.RRE (Gag/Pol expression plasmid), and 15 μg of pELNS transfer plasmid using Express Inn [20]. 8. Harvest viral supernatant at 24 and 48 h post-transfection. 9. Concentrate viral particles by ultracentrifugation for 3 h at 25,000 rpm using a Beckman SW28 rotor and resuspend in 4 ml of RPMI full medium. 10. Transduce the cancer cell lines C30 (1.5 × 105 in a six-well plate) with 1.5 ml and T2 cells (3 × 105 cells in a 24 well plate) with 3–5 ml pELNS-B7-H4 lentiviral particles. 11. Replace lentivirus containing medium with fresh RPMI 24 h after transduction 12. Check the expression of surface B7-H4 5–6 days post transduction using a monoclonal anti-B7-H4 PE conjugated antibody.

Anti-B7-H4 scFvs from Yeast-Display Library

3.3 Selection of Yeast Display Recombinant Antibodies by Differential Cell Panning

47

Further select the subpopulation of yeast-display scFvs by cell panning: 1. Grow in monolayer to 90 % confluence on poly-L-Lysinecoated dishes C30 ovarian cancer cell line transduced with pELNS-B7-H4 or with pELNS-GFP as negative control. 2. Induce recombinant sub-library.

B7-H4-selected

yeast-display

scFv

3. Wash twice with 50 ml PBE. 4. Deplete for nonspecific binding by two incubations with GFP+ C30 cells at a ratio of (30–60):1 yeast to C30 cells for 30 min at RT with gentle rotation to prevent clumping (1–2 speed). 5. Harvest unbound yeast cells and incubate with plasticimmobilized B7H4+ C30 cells for 30 min at RT with gentle rotation. 6. Wash plastic-immobilized B7H4+ C30 cells with bound yeast twice with PBS for 5 min at RT and examine under microscope. 7. Harvest yeast clusters that are still binding to cells and grow on the cell plate overnight. 8. The next day, transfer to a new flask for further amplification. 9. Repeat yeast panning four times. 10. Convert yeast displayed scFvs into soluble forms [18] and select for best binding scFv clones as described in refs. [17, 21]. 3.4 Screening in Systems Modeling B7-H4-Mediated Inhibition of T-Cell Functions

Test soluble anti-B7-H4 scFv in the following in vitro model systems. 1. Resuspend GFP- or B7-H4-transduced T2 APCs at 10 × 106 cells/ml and loaded with HER-2 or MART-1 peptides at 0.05 μM for 2 h at 37 °C. 2. Wash cells twice with RPMI medium. 3. Coculture peptide-loaded APCs with HER-2 TCR specific T cells at 1:1 ratio of 1 × 105 T2 APCs and 1 × 105 T cells, in 200 μl of RPMI medium in round bottom 96-well tissue culture plates. Use MART-1 peptides as irrelevant peptides for the mock stimulations of HER-2 TCR T cells. 4. Add 5 μg/ml of anti-B7-H4 or control scFvs in cocultures. 5. Analyze IFN-γ production of T cells cocultured with APC expressing B7-H4 or control GFP, in the presence or in the absence of recombinant antibodies (as indicated) and responses after 48 h using an IFN-γ quantification kit (Fig. 2).

Denarda Dangaj and Nathalie Scholler

48

GFP+T2

HER-2 TCR T cells

B7-H4+ T2

IFN-Y Concentration (pg/ml)

18000 16000 14000 12000 10000 8000 6000 4000 2000 0

untr

irrel scFv CscFv

26

56

Protein-based sorted anti-B7H4 scFvs

1#12

2#29

2#69

3#35

3#54

3#68

Cell-based sorted anti-B7H4 scFvs

Fig. 2 Screening of anti-B7-H4 scFvs that reverse B7-H4-mediated T cell inhibition. IFN-γ production of HER-2 TCR T cells pulsed with HER-2 or irrelevant peptide (MART-1) and cocultured with GFP (GFP+ T2, black bars) or B7-H4 transduced T2 APCs (B7-H4+ T2, grey bars), in the absence or in the presence of various anti-B7-H4 scFvs. IFN-γ production was measured with ELISA assay

4

Notes 1. Ficoll gradient: 15 ml of blood diluted with 15 ml of PBS is layered on 12.5 ml of Ficoll-Paque and centrifuge for 30 min at 1,200 rpm without brake at room temperature 2. Use 20–25 μg of mRNA 3. Up to 50 reverse transcription maybe necessary to reach the quantity template necessary for VH and VL fragment amplification. 4. The display of antibody fragments is induced by culture of the grown library in presence of galactose 5. For storage, yeast can be pelleted by 5 min of centrifugation at 3,000 × g and resuspended in 50 ml of SD-CAA. However, before induction yeast should be freshly passaged. 6. Yeast culture should look opalescent white and have a fresh smell. If the color is yellowish and the smell sour, suspect a contamination and consider thawing another library aliquot. We do not recommend using antibiotic or antifungic so early in the screening process as it can reduce the library diversity. 7. Yeast resuspension can be difficult after centrifugation and necessitate moving the pipette around rather than aspirating up and down.

Anti-B7-H4 scFvs from Yeast-Display Library

49

References 1. Sica GL, Choi IH, Zhu G et al (2003) B7-H4, a molecule of the B7 family, negatively regulates T cell immunity. Immunity 18:849–861, doi:S1074761303001523 [pii] 2. Prasad DV, Richards S, Mai XM et al (2003) B7S1, a novel B7 family member that negatively regulates T cell activation. Immunity 18:863–873, doi:S107476130300147X [pii] 3. Zang X, Loke P, Kim J et al (2003) B7x: a widely expressed B7 family member that inhibits T cell activation. Proc Natl Acad Sci U S A 100:10388– 10392. doi:10.1073/pnas.1434299100, 1434299100 [pii] 4. Kryczek I, Wei S, Zou L et al (2006) Cutting edge: induction of B7-H4 on APCs through IL-10: novel suppressive mode for regulatory T cells. J Immunol 177:40–44, doi:177/1/40 [pii] 5. Tringler B, Zhuo S, Pilkington G et al (2005) B7-h4 is highly expressed in ductal and lobular breast cancer. Clin Cancer Res 11:1842–1848. doi: 10.1158/1078-0432.CCR-04-1658 , 11/5/1842 [pii] 6. Kryczek I, Zou L, Rodriguez P et al (2006) B7-H4 expression identifies a novel suppressive macrophage population in human ovarian carcinoma. J Exp Med 203:871–881. doi:10.1084/ jem.20050930, jem.20050930 [pii] 7. Choi IH, Zhu G, Sica GL et al (2003) Genomic organization and expression analysis of B7-H4, an immune inhibitory molecule of the B7 family. J Immunol 171:4650–4654 8. Sun Y, Wang Y, Zhao J et al (2006) B7-H3 and B7-H4 expression in non-small-cell lung cancer. Lung Cancer 53:143–151. doi:10.1016/j. lungcan.2006.05.012, S0169-5002(06)002315 [pii] 9. Quandt D, Fiedler E, Boettcher D et al (2011) B7-h4 expression in human melanoma: its association with patients’ survival and antitumor immune response. Clin Cancer Res 17: 3100–3111. doi:10.1158/1078-0432.CCR10-2268, 1078-0432.CCR-10-2268 [pii] 10. Krambeck AE, Thompson RH, Dong H et al (2006) B7-H4 expression in renal cell carcinoma and tumor vasculature: associations with cancer progression and survival. Proc Natl Acad Sci U S A 103:10391–10396. doi:10.1073/ pnas.0600937103, 0600937103 [pii] 11. Jiang J, Zhu Y, Wu C et al (2010) Tumor expression of B7-H4 predicts poor survival of patients suffering from gastric cancer. Cancer Immunol Immunother 59:1707–1714. doi:10.1007/s00262-010-0900-7 12. Miyatake T, Tringler B, Liu W et al (2007) B7-H4 (DD-O110) is overexpressed in high

13.

14.

15.

16.

17.

18.

19.

20.

21.

risk uterine endometrioid adenocarcinomas and inversely correlated with tumor T-cell infiltration. Gynecol Oncol 106:119–127. doi:10.1016/j.ygyno.2007.03.039, S0090-8258(07)00198-9 [pii] Zang X, Thompson RH, Al-Ahmadie HA et al (2007) B7-H3 and B7x are highly expressed in human prostate cancer and associated with disease spread and poor outcome. Proc Natl Acad Sci U S A 104:19458–19463. doi:10.1073/ pnas.0709802104, 0709802104 [pii] van der Meel R, Gallagher WM, Oliveira S et al (2010) Recent advances in molecular imaging biomarkers in cancer: application of bench to bedside technologies. Drug Discov Today 15: 102–114. doi:10.1016/j.drudis.2009.12.003, S1359-6446(09)00405-X [pii] Porter DL, Kalos M, Zheng Z et al (2011) Chimeric antigen receptor therapy for B-cell malignancies. J Cancer 2:331–332 Dangaj D, Lanitis E, Zhao A et al (2013) Novel recombinant human b7-h4 antibodies overcome tumoral immune escape to potentiate T-cell antitumor responses. Cancer Res 73: 4820–4829. doi:10.1158/0008-5472.CAN12-3457 Zhao A, Nunez-Cruz S, Li C et al (2011) Rapid isolation of high-affinity human antibodies against the tumor vascular marker Endosialin/ TEM1, using a paired yeast-display/secretory scFv library platform. J Immunol Methods 363:221–232. doi:10.1016/j.jim.2010.09. 001, S0022-1759(10)00239-5 [pii] Scholler N (2012) Selection of antibody fragments by yeast display. Methods Mol Biol 907:259–280. doi:10.1007/978-1-61779974-7_15 Durocher Y, Perret S, Kamen A (2002) Highlevel and high-throughput recombinant protein production by transient transfection of suspension-growing human 293-EBNA1 cells. Nucleic Acids Res 30:E9 Lanitis E, Poussin M, Hagemann IS et al (2012) Redirected antitumor activity of primary human lymphocytes transduced with a fully human anti-mesothelin chimeric receptor. Mol Ther 20:633–643. doi:10.1038/ mt.2011.256, mt2011256 [pii] Dangaj D, Abbott KL, Mookerjee A et al (2011) Mannose receptor (MR) engagement by mesothelin GPI anchor polarizes tumorassociated macrophages and is blocked by anti-MR human recombinant antibody. PLoS One 6:e28386. doi:10.1371/journal.pone. 0028386, PONE-D-11-09405 [pii]

Chapter 3 Combining Phage and Yeast Cell Surface Antibody Display to Identify Novel Cell Type-Selective Internalizing Human Monoclonal Antibodies Scott Bidlingmaier, Yang Su, and Bin Liu Abstract Using phage antibody display, large libraries can be generated and screened to identify monoclonal antibodies with affinity for target antigens. However, while library size and diversity is an advantage of the phage display method, there is limited ability to quantitatively enrich for specific binding properties such as affinity. One way of overcoming this limitation is to combine the scale of phage display selections with the flexibility and quantitativeness of FACS-based yeast surface display selections. In this chapter we describe protocols for generating yeast surface antibody display libraries using phage antibody display selection outputs as starting material and FACS-based enrichment of target antigen-binding clones from these libraries. These methods should be widely applicable for the identification of monoclonal antibodies with specific binding properties. Key words Yeast surface antibody display, Phage antibody display, Human monoclonal antibody, scFv, FACS, Cell surface antigen, Internalization, Cell type-specific binding

1

Introduction Phage antibody display libraries are widely used to generate monoclonal antibodies with affinity for target antigens, and purified recombinant protein antigens and living cells are frequently used as the selection targets for phage antibody display libraries [1–13]. Although very large libraries can be generated and screened in phage antibody display-based selections, it is difficult to fine-tune the selections to select for specific binding properties such as affinity. Additionally, while selection of phage antibody display libraries on living cells yields antibodies that bind to native epitopes on the cell surface, it is difficult to direct the selections towards a specific target. One method of addressing these limitations is to generate yeast antibody display libraries from pre-enriched phage antibody display outputs selected on recombinant antigens, live cells, or tissues [7, 10–13]. Yeast surface display [14] has been widely utilized to screen

Bin Liu (ed.), Yeast Surface Display: Methods, Protocols, and Applications, Methods in Molecular Biology, vol. 1319, DOI 10.1007/978-1-4939-2748-7_3, © Springer Science+Business Media New York 2015

51

52

Scott Bidlingmaier et al.

large libraries for proteins or protein fragments with specific binding properties [15–21], and protocols for the construction and application of yeast surface display libraries have been previously described [21–23]. Using labeled target antigens, yeast antibody display libraries can be coupled with FACS to select high affinity antibodies that bind specifically to the targeted antigen [24, 25]. Use of yeast antibody display combined with FACS allows a more controlled and quantitative selection process that can be fine-tuned to enrich clones with particular binding properties more effectively than phage display. In this chapter we describe protocols for generating yeast single-chain variable fragment (scFv) display libraries by homologous recombination gap repair cloning using pre-enriched phage scFv display selection outputs as starting material, FACS-based enrichment of target antigen-binding clones from these libraries, and screening and sequencing analysis.

2

Materials

2.1 Generation of Phage-Derived Yeast scFv Display Library

1. Polyclonal phage scFv display selection outputs (see Note 1). 2. 2× YT: 16 g tryptone, 10 g yeast extract, 5 g NaCl, bring volume to 1 L with ddH2O, adjust pH to 7.0, and sterilize by autoclaving. 3. 1,000× Tetracycline: 100 mg tetracycline, add 70 % ethanol to 10 mL, and store aliquots at −20 °C. 4. Plasmid spin miniprep kit. 5. Primers for gap repair transfer of scFvs from phage vector to yeast display vector: PhageYD1 Forward 5′-CGGGATCTGT A C G A C G AT G A C G ATA A G G TA C C A G G AT C C A G T TTCTATGCGGCCCAGCCG-3′, PhageYD1 Reverse 5′-GA GAGGGTTAGGGATAGGCTTACCTTCGAAGGGCCCTC TAGATGCTAAACAACTTTCAACAGTTTC-3′ (see Note 2). 6. 10× PCR buffer. 7. dNTPs. 8. Taq polymerase. 9. S. cerevisiae strain EBY100 (MATa GAL1-AGA1::URA3 ura352 trp1 leu2Δ1 his3Δ200 pep4::HIS3 prb1Δ1.6R can1 GAL). 10. pYD1 or suitable yeast display vector. 11. EcoRI (see Note 3). 12. XhoI. 13. YPD: 10 g of yeast extract, 20 g of bacteriological peptone, 20 g dextrose, bring volume to 1 L with ddH2O, and filter sterilize.

Combine Phage and Yeast Antibody Display for Cell Surface Selection

53

14. 1 M Lithium acetate: 33 g lithium acetate, bring volume to 500 mL with ddH2O, and filter sterilize. 15. Electroporation solution (1 M Sorbitol/1 mM CaCl2): 91 g D-Sorbitol, 500 μL 1 M CaCl2; bring volume to 500 mL with ddH2O and filter sterilize (see Note 4). 16. 2-Mercaptoethanol. 17. 2 mm Electroporation cuvettes. 18. Electroporator (see Note 5). 19. 2× SR-CAA yeast growth media: 20 g raffinose, 14 g yeast nitrogen base, 10 g bacto casamino acids, 5.4 g Na2HPO4, 7.4 g NaH2PO4, bring volume to 1 L with ddH2O, and filter sterilize. 20. 10× SD-CAA for making plates: 70 g yeast nitrogen base w/o amino acids, 50 g bacto casamino acids, 100 g dextrose; bring the volume to 500 mL with ddH2O and filter sterilize. 21. SD-CAA plates: 5.4 g Na2HPO2, 7.4 g NaH2PO4, 17 g agar; bring the volume to 900 mL with ddH2O, autoclave to sterilize, let the agar cool until it is cool enough to touch, add 100 mL 10× SD-CAA, mix and pour into plates (100 or 150 mm) and allow to cool at RT, and store the plates at 4 °C until ready to use. 2.2 Enrichment of Target AntigenBinding Clones by FACS

1. Yeast scFv display library generated in previous section. 2. 20 % Galactose: 100 g galactose; bring the volume to 500 mL with ddH2O and filter sterilize. 3. PBS: 8 g of NaCl, 0.2 g of KCl, 1.44 g of Na2HPO4, 0.24 g of KH2PO4, bring the volume to 1 L with ddH2O, adjust pH to 7.4, and sterilize by autoclaving or filtration. 4. Biotinylated or (see Note 6).

fluorescently

labeled

target

molecules

5. Mouse anti-V5. 6. Goat anti-mouse-488. 7. Streptavidin-PE (SA-PE). 8. Streptavidin-488 (SA-488). 2.3 Screening and Sequencing of Binding Clones

1. pYD1-specific primers: pYD1 Forward 5′-AGTAACGTTT GTCAGTAATTGC-3′, pYD1 Reverse 5′-GTCGATTTTGT TACATCTACAC-3′ (see Note 7). 2. Primer for sequencing pYD1: Gap5 5′-TTAAGCTTCTGCA GGCTAGTG-3′ (see Note 7).

54

3

Scott Bidlingmaier et al.

Methods The methods detailed below assume that a pre-enriched (either on recombinant antigen or cells) scFv phage display library has been previously generated. It is also assumed that a biotinylated or fluorescently labeled target antigen is available. The methods below are divided into five categories: Generation of Yeast scFv Display Library from Phage Antibody Selection Outputs (Subheading 3.1); Enrichment of Target-binding Clones from Yeast scFv Display Library by FACS (Subheading 3.2); Screening and Sequencing of Binding Clones (Subheading 3.3). The yeast electroporation protocol is adapted from a previously described protocol [26, 27]. An outline of the selection strategy is shown in Fig. 1 and an example of FACS data from a selection is presented in Fig. 2.

3.1 Generation of Yeast scFv Display Library from Phage Antibody Selection Outputs

1. Prepare DNA minipreps from scFv phage display library selection for use as PCR template using standard methods. 2. Set up standard PCR reactions using PhageYD1 Forward and PhageYD1 Reverse primers and 1 ng of the appropriate scFv phage display library selection output plasmid prep as template for each 50 μL reaction. Set up enough reactions to generate 20 μg PCR product. 3. Run PCR reactions on 1.5 % agarose gel, cut out bands (approximately 800 bp) with a clean razor blade, and isolate PCR products using Qiagen gel isolation kit or comparable method following manufacturer’s protocols. Elute in ddH2O and measure concentration by spectrophotometer. If the yield is less than 20 μg, repeat the process until enough PCR product has been purified. 4. Digest 10 μg pYD1 with EcoRI and XhoI (see Note 8). Run digest on 0.75 % agarose gel, cut out large vector band with clean razor blade, and isolate fragment using Qiagen gel isolation kit or comparable method following manufacturer’s protocols. Elute in ddH2O and measure concentration by spectrophotometer. 5. Inoculate a 5 mL YPD culture with EBY100 and grow overnight with shaking at 30 °C and 200 rpm. 6. Determine concentration of the overnight yeast culture by measuring the OD600 of a 1:20 dilution using a spectrophotometer (1 OD600 = 2 × 107/mL). Use the overnight culture to

Fig. 1 (continued) from the polyclonal phage output will be purified and used as template to amplify the scFv genes with flanking primers designed for gap-repair-based yeast transformation (see text for details). The resulting yeast antibody display libraries will be subjected to FACS-based selection against fluorescence-labeled antigens or ligands to identify high affinity binders. The figure is adapted from our original drawings in [13] and [16]

Combine Phage and Yeast Antibody Display for Cell Surface Selection

55

Fig. 1 Outline of the combination selection strategy utilizing both phage and yeast surface antibody display. Naïve phage antibody display libraries will be first selected on target antigens or ligands, live or fixed cells, or tissues (fresh, frozen, or formalin-fixed paraffin-embedded). Selection condition can be manipulated to enrich for desired antibody property such as internalization. Following two to three rounds of selection, plasmid DNA

56

Scott Bidlingmaier et al.

Fig. 2 Example selection of target antigen-binding scFv clones from a yeast surface scFv display library by FACS. The yeast scFv display library was generated from polyclonal phage scFv display selection outputs enriched for binding to epitopes expressed on the surface of living cells. The yeast scFv display library was induced, incubated with biotinylated target antigen, and subjected to FACS as described in the methods. Enrichment of target antigen-binding scFv clones was achieved through three rounds of FACS with decreasing concentrations of biotinylated target antigen. The vertical axis represents target antigen binding, while the horizontal axis represents display of the V5 epitope tag. The shaded regions (R3) are the sorted populations for each round. Secondary detection reagents were alternated between PE (FL2) and FITC (FL1). Screening of the third-round output yielded clones with sub-nanomolar affinity for the target antigen

inoculate a culture in YPD (the inoculation volume should be at least 50 mL/transformation) at 0.5 OD600 and incubate at 30 °C, 200 rpm for 5–6 h (at least two cell divisions). 7. Pellet yeast cells by centrifugation at 1,000 × g for 3 min and remove media. 8. Wash yeast pellet twice with 15 mL ice-cold ddH2O and once with 15 mL electroporation solution. 9. After the electroporation solution wash, resuspend the cell pellet in 20 mL 0.1 M Lithium acetate and add 130 μL 2-mercaptoethanol. Shake at 225 rpm for 30 min at 30 °C (see Note 9). 10. Pellet the yeast cells by centrifugation, wash once with 15 mL ice-cold electroporation solution, and resuspend the cell pellet in electroporation solution to a final volume of 500 μL for each 50 mL of original culture volume and keep on ice until electroporation. 11. For each electroporation, add 3 μg linearized vector and 9 μg scFv PCR product insert to 400 μL conditioned yeast cells in electroporation solution and mix gently (see Note 10). 12. Transfer electroporation reaction to a pre-chilled 2 mm electroporation cuvette and keep on ice until electroporation. 13. Electroporate the cells at 2,500 V and 25 μF (see Note 11).

Combine Phage and Yeast Antibody Display for Cell Surface Selection

57

14. Transfer each electroporation reaction to 8 mL of recovery medium (1:1 mix of electroporation solution and YPD) and shake at 225 rpm for 1 h at 30 °C. 15. Pellet electroporated cells by centrifugation and resuspend in 1 mL 2× SR-CAA. Add 1 μL to 1 mL 2× SR-CAA and plate 10 μL on a 150 mm SD-CAA plate for titering. Plate the rest of the transformants on 150 mm SD-CAA plates at 200 μL/plate. 16. Incubate the plates inverted at 30 °C for 3–4 days until colonies grow. Count the number of colonies on the titer plate and estimate the number of transformants by multiplying by 105 (see Note 12). 17. Recover the library from plates by adding 5 mL of 2× SR-CAA to each plate and scraping with a flame-sterilized spreader and then collect the resuspended cells by pipetting. If there are any minor contaminating bacteria or fungus on the plates, it should be excised with a flame-sterilized scalpel prior to resuspending the cells. Determine cell number by taking an OD600 reading of a 1:50-diluted sample of the resuspended cells (1 OD600 approximately equals 2 × 107 yeast cells/mL). Pool transformants in a 50-mL conical using a pipetman. To prepare freezer stocks, mix 5 mL of sterile 50 % glycerol with 5 mL of the collected transformants, pipet 1 mL aliquots into cryotubes, and store at −80 °C. 3.2 Selection of Yeast scFv Display Library by FACS

1. Using the resuspended library, start a 100 mL culture at OD600 0.2 in 2× SR-CAA + 2 % galactose. Grow at 30 °C with shaking overnight. The induced library can be stored for several weeks at 4 °C. 2. Check induction of the library by FACS using the mouse antiV5 antibody. Spin down 100 μL of the induced library at 10,000 × g and wash twice with 1 mL PBS. Resuspend cells in 500 μL PBS and add 1 μL mouse anti-V5 antibody. Incubate at RT with rotation for 1 h. Wash three times with 1 mL PBS. Resuspend in 500 μL PBS and add 1 μL goat anti-mouse PE. Incubate at RT with rotation for 30 min. Wash three times with PBS, resuspend in 500 μL PBS, and place on ice. 3. Analyze the cells by FACS. At least 40 % of the population should be V5-positive (see Note 13). The induced library is now ready for FACS selection experiments. 4. Check the OD600 of a 1:10 dilution of the induced library to determine cell density. For the first round of sorting, add 108 yeast cells to six 1.5 mL Eppendorf tubes and wash them twice with 1 mL PBS. For example, if the calculated OD600 of the undiluted induced library is 5, then 1 mL of culture will contain approximately 108 cells.

58

Scott Bidlingmaier et al.

5. Resuspend the yeast in 500 μL PBS containing 200, 100, 50, 25, 12.5, and 0 nM biotinylated target antigen (see Note 14). Incubate for 1 h at 25 °C. 6. Wash each of the incubations twice with PBS and incubate with 500 μL of 1:500 diluted SA-PE (see Note 15) for 10 min at 25 °C. Wash the cells three times with PBS and resuspend each reaction in 3 mL PBS. Keep the cells on ice in the dark until sorting. 7. Analyze all six reactions by FACS. Compare the signal from the different target antigen concentrations to the negative control with no target antigen. If high affinity antibodies are desired, choose the lowest concentration of target antigen that gives significantly more signal than the negative control for sorting. If preservation of diversity is a priority, a higher concentration incubation should be sorted to reduce the stringency. Placement of sort gate can be similarly modulated to suit the desired stringency, but gating should not be extremely stringent in the first round. Analyze at least 5 × 107 cells from the chosen target antigen selection incubation and sort PEpositive cells into an Eppendorf tube containing 100 μL 2× SR-CAA. Make a note of the total number of cells analyzed and the number sorted. 8. Plate the sorted cells on one or several large pre-dried SD-CAA plates by gently spreading. Incubate the plates in an inverted position at 30 °C until colonies are formed (3–4 days). 9. Add 3 mL 2× SR-CAA to the plate(s) and recover the cells by scraping with a sterile cell spreader. To prepare a freezer stock, add 500 μL of 50 % glycerol to 500 μL cells in a cryotube and store at −80 °C. 10. To induce the first-round output, inoculate a 10 mL culture at 0.5 OD600 in 2× SR-CAA + 2 % galactose using the remaining cells from the round-one output and grow at 30 °C with shaking overnight. 11. Wash approximately 5 × 107 cells from the induced first-round output with PBS. Set up control and selection incubations using the biotinylated target antigen in the same manner as the first round and incubate for 1 h at 25 °C. If enrichment for higher affinity antibodies is desired, the target antigen concentration range can be lowered. 12. Wash the cells twice with PBS and incubate with 500 mL of 1:500 diluted SA-488 for 10 min at 25 °C. Alternating use of different secondary detection agents is suggested to minimize the chance of enriching antibody clones that may have some affinity for the secondary reagents. Wash the cells three times with PBS and resuspend in 1 mL PBS. Keep the cells on ice in the dark until sorting.

Combine Phage and Yeast Antibody Display for Cell Surface Selection

59

13. Analyze the reactions by FACS and again compare the signal from the different target antigen concentrations to the negative control with no target antigen. Choose the incubation that best suits your objectives for sorting. Analyze at least 107 cells from the chosen target antigen selection incubation and sort 488-positive cells into an Eppendorf tube containing 100 μL 2× SR-CAA. Again, make a note of the total number of cells analyzed and the number sorted, and plate the sorted cells on one or several large SD-CAA plates. If the output is ready to be screened at this point, some plates can be seeded at a lower density (500 cells/plate) based on the sorting data to facilitate the picking of individual colonies for screening. Incubate at 30 °C until colonies form. 14. Add 3 mL SR-CAA to plate(s) and recover cells by scraping. Prepare a frozen stock as previously described and store at −80 °C. Induce the second-round (if more rounds of sorting are necessary) output by inoculating a 10-mL culture at 0.5 OD600 in SR-CAA + 2 % galactose using the remaining cells and grow at 25 °C with shaking overnight. 15. Prepare incubations as described for the previous rounds, reducing the biotinylated target antigen concentration as appropriate if enrichment for higher affinity antibodies is desired. Use a secondary detection reagent different from the one used in the previous round and analyze and sort as described for the second round. Plate the sorted cells on one or several large SD-CAA plates. If the intention is to screen individual clones from this sort output, some plates can be seeded at a lower density (500 cells/plate) for screening. After the colonies have grown, make a glycerol freezer stock of the third-round sort output as described previously (see Note 16). 3.3 Screening and Sequencing of Binding Clones

1. Inoculate 2 mL 2× SR-CAA + 2 % galactose cultures with a yeast colony from the SD-CAA sort output plates and grow for at least 16 h with shaking at 30 °C (see Note 17). 2. Pellet 200 μL of the overnight cultures using a tabletop microfuge and wash twice with 1 mL PBS. 3. Incubate yeast for 1 h at room temperature with 100 μL of an appropriate concentration of biotinylated or fluorescently labeled target molecule and mouse anti-V5 antibody (1/1,000 dilution of stock solution) in PBS. 4. Wash yeast twice with 1 mL PBS and incubate with 100 μl 1/1,000 SA-PE and 1/1,000 Alexa fluor 647-conjugated anti-mouse secondary antibody in PBS for 20 min at room temperature. 5. Wash twice with 1 mL PBS and analyze the yeast by FACS. Plate small patches of binding clones on SD-CAA plates and incubate overnight at 30 °C.

60

Scott Bidlingmaier et al.

6. The scFv sequences of the binding clones can be determined by colony PCR followed by sequencing of the PCR products (see Note 18). From each patch, scrape about 5 μL of yeast with a sterile pipet tip and spread in the bottom of a PCR tube. Cap the tubes and microwave on high for 2 min. Prepare a PCR master mix as follows: 10× buffer

2.5 μL/reaction

dNTPs

Final concentration 200 μM each

Taq

1 μL/reaction

pYD1 Forward and pYD1 Reverse primers

Final concentration 0.5 μM each

ddH2O

Up to 25 μL/reaction

Add 25 μL PCR mix on top of microwaved yeast cells and run the following PCR cycle (see Note 19): 3 min at 95 °C 30 s at 95 °C 30 s at 51 °C

×30 cycles

90 s at 72 °C 5 min at 71 °C

7. Run the PCR reactions on an agarose gel, excise bands (should be approximately 1,200 bp) with a clean razor blade, and purify using the Qiagen gel isolation kit or other suitable protocol. Sequence the purified PCR products using the Gap5 primer.

4

Notes 1. We have used polyclonal phage scFv display selection outputs enriched for binding to living cells and recombinant protein target antigens as starting material for making yeast scFv display libraries. Our protocols are designed for phage scFv display libraries in the Fd vector [7, 28]. Before transfer to yeast, it is necessary to verify that the phage selection was successful by testing the polyclonal selection output for binding to the target (cells or purified target antigen). Protocols for the generation and use of phage scFv display libraries to select on purified target antigens, living cells, and tissues have been described previously [6, 10, 29–32].

Combine Phage and Yeast Antibody Display for Cell Surface Selection

61

2. These primers were designed to be compatible with the Fd phage display vector and the pYD1 yeast display vector. If other vectors will be used, then new primers will need to be designed. Gap repair cloning in yeast works most efficiently when greater than 40 base pairs of homology with the linearized vector are designed into the primer. Care must be taken when designing primers to ensure that the scFv is cloned in frame with the phage protein. 3. The EcoRI and XhoI restriction sites are designed for use with the pYD1 yeast display vector. If a different or modified vector is used, then different enzymes may have to be chosen. The sites chosen for linearizing the vector must be compatible with the scFv PCR gap repair primers. 4. Gentle heating may be required to help the sorbitol go into solution. 5. E.g., Eppendorf 2510 or Bio-Rad Gene Pulser II 6. We usually use biotinylated target antigens. We typically use the EZ-Link Sulfo-NHS-Biotin reagent for biotinylating purified recombinant protein targets. If possible some form of quality control (binding or activity) should be performed on the labeled target antigen. 7. Different primers may need to be designed if a vector other than pYD1 was utilized. 8. Two enzymes are used to minimize the uncut vector background. 9. Shaking can be done in a small flask or 50 mL conical. 10. In order to not dilute the electroporation reaction, the total DNA volume should be less than 50 μL. If the DNA concentration is not high enough to achieve this, it will need to be concentrated using a suitable method. 11. The time constant should be 3–5 ms, although we have observed lower time constants that still resulted in acceptable transfection efficiencies. If “popping” occurs, sharply tap the electroporation cuvette on a hard horizontal surface several times to eliminate air bubbles and repeat the electroporation. We use an Eppendorf 2510 electroporator. Other electroporators should work similarly using equivalent settings. 12. In our hands the transformation efficiency usually varies between 0.5 and 2 × 107 colonies/transformation, which is more than sufficient for the generation of yeast scFv display libraries from pre-enriched phage scFv display selection outputs. The number of transformations can be scaled up to suit the desired library size.

62

Scott Bidlingmaier et al.

13. The described strategy generates a c-terminal V5 epitope tag on the yeast-displayed scFv. There is always a display-negative population after induction when analyzed by FACS, and the maximum induction will vary from experiment to experiment. This is seen even when using pYD1-transformed EBY100 as a positive control. 14. We have provided a range that based on our experience usually covers most libraries generated from phage scFv display selection outputs. This range may need to be adjusted depending on the binding activity of different libraries. 15. Other fluorophore combinations can be used to match the capabilities of your FACS instrument. 16. Two or three rounds usually provide sufficient enrichment for monoclonal screening. More rounds of sorting can be done, but are likely to greatly reduce the diversity of the output. 17. The yeast can also be induced in 96-well plates for screening. We use round bottom polystyrene plates, inoculate 200 μL/ well, and shake on a platform shaker at 120 rpm. 18. Alternatively the plasmids can be rescued into bacteria, miniprepped, and sequenced. A protocol for this has been described by us previously [23]. 19. Although we have had good success with the simple microwave method, yeast colony PCR can be temperamental. Yeast minipreps followed by plasmid rescue into bacteria, miniprepping, and sequencing is an alternative method (see Note 18). This method also has the advantage of providing you with the plasmid containing the scFv, which can be used in downstream procedures such as PCR or cloning. We routinely use the colony PCR method for rapid screening and then rescue the plasmids from clones we wish to do additional work with. References 1. Clackson T, Hoogenboom HR, Griffiths AD et al (1991) Making antibody fragments using phage display libraries. Nature 352:624–628. doi:10.1038/352624a0 2. Marks J, Hoogenboom H, Bonnert T et al (1991) By-passing immunization. Human antibodies from V-gene libraries displayed on phage. J Mol Biol 222:581–597 3. Hoogenboom HR, Griffiths AD, Johnson KS et al (1991) Multi-subunit proteins on the surface of filamentous phage: methodologies for displaying antibody (Fab) heavy and light chains. Nucleic Acids Res 19:4133–4137 4. Barbas CF 3rd, Kang AS, Lerner RA et al (1991) Assembly of combinatorial antibody

libraries on phage surfaces: the gene III site. Proc Natl Acad Sci U S A 88:7978–7982 5. Gram H, Marconi LA, Barbas CF 3rd et al (1992) In vitro selection and affinity maturation of antibodies from a naive combinatorial immunoglobulin library. Proc Natl Acad Sci U S A 89:3576–3580 6. Sheets M, Amersdorfer P, Finnern R, Sargent P, Lindqvist E, Schier R, Hemingsen G, Wong C, Gerhart JC, Marks JD (1998) Efficient construction of a large nonimmune phage antibody library: the production of highaffinity human single-chain antibodies to protein antigens. Proc Natl Acad Sci U S A 95: 6157–6162

Combine Phage and Yeast Antibody Display for Cell Surface Selection 7. Liu B, Marks JD (2000) Applying phage antibodies to proteomics: selecting single chain Fv antibodies to antigens blotted on nitrocellulose. Anal Biochem 286:119–128 8. Poul MA, Becerril B, Nielsen UB, Morisson P, Marks JD (2000) Selection of tumor-specific internalizing human antibodies from phage libraries. J Mol Biol 301:1149–1161 9. Liu B, Huang L, Sihlbom C et al (2002) Towards proteome-wide production of monoclonal antibody by phage display. J Mol Biol 315:1063–1073. doi:10.1006/jmbi.2001.5276 10. Ruan W, Sassoon A, An F et al (2006) Identification of clinically significant tumor antigens by selecting phage antibody library on tumor cells in situ using laser capture microdissection. Mol Cell Proteomics 5:2364– 2373. doi:10.1074/mcp.M600246-MCP200 11. An F, Drummond DC, Wilson S et al (2008) Targeted drug delivery to mesothelioma cells using functionally selected internalizing human single-chain antibodies. Mol Cancer Ther 7:569–578 12. Zhu X, Bidlingmaier S, Hashizume R et al (2010) Identification of internalizing human single-chain antibodies targeting brain tumor sphere cells. Mol Cancer Ther 9:2131–2141 13. Ha KD, Bidlingmaier SM, Zhang Y et al (2014) High-content analysis of antibody phage-display library selection outputs identifies tumor selective macropinocytosis-dependent rapidly internalizing antibodies. Mol Cell Proteomics. doi:10.1074/mcp.M114.039768 14. Boder ET, Wittrup KD (1997) Yeast surface display for screening combinatorial polypeptide libraries. Nat Biotechnol 15:553–557 15. Bidlingmaier S, Liu B (2011) Identification of protein/target molecule interactions using yeast surface-displayed cDNA libraries. Methods Mol Biol 729:211–223 16. Bidlingmaier S, Wang Y, Liu Y et al (2011) Comprehensive analysis of yeast surface displayed cDNA library selection outputs by exon microarray to identify novel protein-ligand interactions. Mol Cell Proteomics 10:M110.005116 17. Bidlingmaier S, Liu B (2007) Interrogating yeast surface-displayed human proteome to identify small molecule-binding proteins. Mol Cell Proteomics 6:2012–2020 18. Bidlingmaier S, He J, Wang Y et al (2009) Identification of MCAM/CD146 as the target antigen of a human monoclonal antibody that recognizes both epithelioid and sarcomatoid types of mesothelioma. Cancer Res 69: 1570–1577 19. VanAntwerp JJ, Wittrup KD (2000) Fine affinity discrimination by yeast surface display and flow cytometry. Biotechnol Prog 16:31–37. doi:10.1021/bp990133s

63

20. Feldhaus MJ, Siegel RW, Opresko LK et al (2003) Flow-cytometric isolation of human antibodies from a nonimmune Saccharomyces cerevisiae surface display library. Nat Biotechnol 21:163–170. doi:10.1038/nbt785 21. Van Deventer JA, Wittrup KD (2014) Yeast surface display for antibody isolation: library construction, library screening, and affinity maturation. Methods Mol Biol 1131:151– 181. doi:10.1007/978-1-62703-992-5_10 22. Bidlingmaier S, Liu B (2006) Construction and application of a yeast surface-displayed human cDNA library to identify posttranslational modification-dependent proteinprotein interactions. Mol Cell Proteomics 5: 533–540 23. Bidlingmaier S, Liu B (2011) Construction of yeast surface-displayed cDNA libraries. Methods Mol Biol 729:199–210. doi:10.1007/978-1-61779-065-2_13 24. Orcutt KD, Slusarczyk AL, Cieslewicz M et al (2011) Engineering an antibody with picomolar affinity to DOTA chelates of multiple radionuclides for pretargeted radioimmunotherapy and imaging. Nucl Med Biol 38:223–233. doi:10.1016/j.nucmedbio.2010.08.013 25. Chao G, Lau WL, Hackel BJ et al (2006) Isolating and engineering human antibodies using yeast surface display. Nat Protoc 1:755– 768. doi:10.1038/nprot.2006.94 26. Benatuil L, Perez JM, Belk J et al (2010) An improved yeast transformation method for the generation of very large human antibody libraries. Protein Eng Des Sel 23:155–159. doi:10.1093/protein/gzq002 27. Meilhoc E, Masson JM, Teissie J (1990) High efficiency transformation of intact yeast cells by electric field pulses. Biotechnology (N Y) 8: 223–227 28. O’Connell D, Becerril B, Roy-Burman A et al (2002) Phage versus phagemid libraries for generation of human monoclonal antibodies. J Mol Biol 321:49–56 29. Winter G, Griffiths A, Hawkins R et al (1994) Making antibodies by phage display technology. Annu Rev Immunol 12:433–455 30. Vaughan T, Williams A, Pritchard K et al (1996) Human antibodies with sub-nanomolar affinities isolated from a large non-immunized phage display library. Nat Biotechnol 14:309–314 31. McCafferty J, Griffiths A, Winter G et al (1990) Phage antibodies: filamentous phage displaying antibody variable domains. Nature 348:552–554 32. Liu B, Conrad F, Cooperberg MR et al (2004) Mapping tumor epitope space by direct selection of single-chain Fv antibody libraries on prostate cancer cells. Cancer Res 64:704–710

Chapter 4 Yeast Display-Based Antibody Affinity Maturation Using Detergent-Solubilized Cell Lysates Benjamin J. Tillotson, Jason M. Lajoie, and Eric V. Shusta Abstract It is often desired to identify or engineer antibodies that target membrane proteins (MPs). However, due to their inherent insolubility in aqueous solutions, MPs are often incompatible with in vitro antibody discovery and optimization platforms. Recently, we adapted yeast display technology to accommodate detergent-solubilized cell lysates as sources of MP antigens. The following protocol details the incorporation of cell lysates into a kinetic screen designed to obtain antibodies with improved affinity via slowed dissociation from an MP antigen. Key words Membrane protein, Single-chain antibody (scFv), Yeast surface display, Cell lysates, Affinity maturation

1

Introduction Membrane proteins (MPs) comprise a large and growing class of therapeutic antibody targets because of their physical accessibility and involvement in the regulation of many disease states [1]. Because of limited solubility and relatively low natural or recombinant abundance, MPs can be troublesome antigens for antibody discovery and lead optimization using various platforms including animal immunization [2, 3] or in vitro antibody display techniques [4, 5]. In order to overcome these limitations, MP antigens must frequently be produced as soluble recombinant proteins. This often involves deletion of transmembrane domains followed by transformation into a heterologous host, expression, and purification [6, 7]. This process is laborious and can result in a peptide or protein that, while antigenic, may not be physiologically relevant [8]. Yeast surface display (YSD) is well developed for the engineering and optimization of antibody affinity, stability, and specificity [4, 9], but its use for MP antibody engineering has been limited to a few special cases [10, 11]. Therefore, to facilitate YSD-based affinity maturation of antibodies against MPs, we developed a

Bin Liu (ed.), Yeast Surface Display: Methods, Protocols, and Applications, Methods in Molecular Biology, vol. 1319, DOI 10.1007/978-1-4939-2748-7_4, © Springer Science+Business Media New York 2015

65

66

Benjamin J. Tillotson et al.

technique wherein the MP antigen is presented in the form of a detergent-solubilized cell lysate. By lysing cells in buffers containing nondenaturing detergents, the MPs are extracted from the membrane and solubilized via detergent interactions with their membranespanning hydrophobic domains [12]. This allows the solution phase presentation of the MP of interest in a near-native state without the need for truncation and heterologous production. In this way, MPs in detergent-solubilized cell lysates can be used directly in YSD-based screens [13–15]. Antibody-MP binding on the yeast surface can be detected through selective biotinylation of surfaceaccessible MP epitopes prior to cell lysis. Alternatively, by lysing cells without biotinylation, solubilized, but unlabeled MP antigens can compete for antibody binding in a kinetic (dissociation rate) screen (see Fig. 1) [15]. Altogether, these features and the detailed protocol discussed below extend the YSD platform to handle antibody engineering against MP antigens. As an illustrative example, we affinity matured a single-chain antibody (scFv), H7, recognizing the human transferrin receptor (TfR) that was previously identified in a phage display screen for internalizing scFv by Poul and colleagues [16]. Twofold to fourfold improvements in the dissociation rate constants were obtained by kinetic screening with HEK293 lysates containing solubilized TfR (see Fig. 1). Dissociation rate constants and apparent affinity improvements were quantitatively assayed with scFvs displayed on the yeast surface. These yeast surface binding parameters translated to a maximum sevenfold improvement in equilibrium binding affinity when soluble scFvs were titrated against cell surface TfR [15]. Importantly, although the screen was performed under detergentbased conditions, the improvements translated to the physiological situation.

2

Materials

2.1 Mammalian Cells and Cell Culture Components

1. HEK293 cells (CRL-1473), or cell line expressing MP of interest (see Note 1). 2. HEK293 Growth medium: Minimum Essential Medium (Alpha Modification) supplemented with 1× PSA (Penicillin, Streptomycin, Amphotericin B), 10 % Fetal bovine serum, 2 mM L-glutamine, 20 mM HEPES buffer pH 7.3. 3. Phosphate buffered saline (PBS) pH 7.4: 10 mM Na2HPO4, 2 mM KH2PO4, 137 mM NaCl, 2.7 mM KCl. 4. PBSCM: supplement PBS with 0.9 mM CaCl2 and 0.49 mM MgCl2. 5. Tissue culture-treated 75 cm2 polystyrene flasks (T75 flasks). 6. 50 μg/mL Poly-D-Lysine in sterile ddH2O.

Yeast Display-Based Antibody Affinity Maturation…

67

Fig. 1 Schematic representation of dissociation rate screening of a mutagenic, yeast display scFv library with MP antigen presented in a detergent-solubilized cell lysate. Specific example shown is for anti-TfR scFv. (a) Lysate creation consists of plasma membrane-selective biotinylation and subsequent lysis in a buffered detergent solution. A cell-impermeable biotinylation reagent is used to tag plasma membrane proteins, including the desired antigen (TfR), yielding biotin-tagged lysate (B-lysate). If the antigen-expressing cells were not biotinylated prior to detergent lysis, unlabeled cell lysate (U-lysate) results and acts as the soluble competitor in a kinetic screen. (b) A mutagenic scFv yeast display library is allowed to bind antigen present in the B-lysate. Antigen binding is detected using antibodies or streptavidin conjugates against the biotin tag, or antibodies against the MP of interest. Full-length scFv expression is detected by an antibody directed against the C-terminal c-myc tag. (c) After washing, an excess of U-lysate is applied in step (c) for a predetermined competition time. (d) ScFvs that retain B-lysate binding after competition, as distinguished by both binding (biotin) and c-myc signals, are isolated by flow cytometry to recover mutant scFvs that have an improved dissociation rate. Figure reproduced from ref. [15] by permission of Oxford University Press

2.2 Lysate Generation

1. EZ-Link™ Sulfo-NHS-LC-Biotin (Thermo/Fisher) (see Note 2). 2. PBSCM with 100 mM glycine. 3. Cell lysis buffer: 1 mL PBS, 1 % (v/v) Triton X-100 or alternative MP compatible detergent (see Note 3), 1× Protease inhibitor cocktail (PIC), 2 mM Sodium EDTA (see Note 4). 4. Sterile cell scrapers.

2.3 Yeast Surface Display (See Note 5)

1. S. cerevisiae strain EBY100 [17]. 2. Wash buffer (PBSCMA): Supplement PBSCM with 1 g/L protease-free bovine serum albumin (see Note 4), store at 4 °C.

68

Benjamin J. Tillotson et al.

3. Detergent wash buffer (PBSD): PBS supplemented with the same concentration and type of detergent selected for creation of cell lysates (see Note 3). 4. SD-CAA: 20.0 g/L dextrose, 6.7 g/L yeast nitrogen base, 5.0 g/L casamino acids, 10.19 g/L Na2HPO4·7H2O, 8.56 g/L NaH2PO4·H2O, add kanamycin (50 μg/mL) when indicated below. 5. SG-CAA: SD-CAA replacing dextrose with 20 g/L galactose. 6. Detection antibodies (see Note 6). 7. Surface display plasmid harboring the scFv gene of interest, e.g., pCT-ESO-scFv [15, 18].

3

Methods

3.1 Cell Culture and Generation of DetergentSolubilized Cell Lysates

The procedures described in this section have been optimized for adherent cell culture. However, biotinylation and cell lysis are easily adaptable to suspension culture. Lysate created from biotinylated cells is termed B-lysate while lysate created from unlabeled cells is termed U-lysate. 1. Coat T75 flasks to improve HEK293 cell adherence by incubating flasks with 10 mL of poly-D-lysine solution for 30 min at 37 °C. Aspirate coating. Rinse twice with 10 mL sterile PBSCM. 2. Culture HEK293 cells at 37 °C/5 % CO2 in growth medium so that they are 80–90 % confluent on the day of lysate creation (see Note 7). 3. Prepare 1 mL cell lysis buffer per T75 flask of HEK293 cells. Store on ice. 4. Immediately prior to use, prepare 10 mL biotinylation reagent per T75 flask by diluting Sulfo-NHS-LC-Biotin to 1 mg/mL in PBSCM (see Note 2). 5. Wash HEK293 cells twice with 10 mL sterile PBSCM at room temperature. 6. Incubate cells with biotinylation reagent for 30 min at 37 °C (see Note 8). 7. Alternatively, cells not undergoing biotinylation are washed once with 10 mL PBSCM prior to lysis. 8. All subsequent steps should be performed at 4 °C. Aspirate the biotinylation solution and quench the reaction by washing twice with 10 mL ice-cold PBSCM + 100 mM glycine and once with 10 mL ice-cold PBS. 9. Aspirate the washing solution, and add 1 mL ice-cold lysis buffer to each flask. Scrape the cells from the growth surface with

Yeast Display-Based Antibody Affinity Maturation…

69

the cell scraper, and collect the solution by micropipette into a 1.5 mL microfuge tube. 10. Vortex briefly, then rotate for 15 min at 4 °C. 11. Centrifuge the lysates at 4 °C, 18,000 × g for 30 min to remove insoluble material. 12. Transfer the supernatant that contains detergent-solubilized MPs to a new 1.5 mL microfuge tube. These ~1 mL aliquots comprise the B- and U-lysates employed in the affinity maturation (see Note 9). 3.2 Yeast Culture and Induction of Surface Display

1. Inoculate yeast into sterile SD-CAA media and grow overnight at 30 °C and 260 rpm. For clonal yeast, a single colony from an agar plate is sufficient for 3 mL overnight culture. For combinatorial libraries, use liquid culture inoculating between 10 and 100 times the library size to a final cell density of 90 % viability. At higher confluence cell viability decreased. 8. The time and temperature of the biotinylation reaction may be varied based on the nature of the target MP. For example, many MPs undergo endocytosis with subsequent degradation or recycling of the receptor back to the cell surface [24]. Given the dynamic nature of membrane protein biogenesis, recycling, and degradation, there may be a large intracellular pool of receptors not accessible to biotinylation at a given time [25]. For our purposes 37 °C and 30 min was chosen to take advantage of cell surface resident TfR turnover via endocytosis and recycling which occurs on the order of 10–15 min [26]. Alternatively, incubation can be carried out at 4 °C for 2 h to suppress endocytosis. 9. Once created, cell lysates are perishable and should be used immediately, or stored at 4 °C for a maximum of 24 h prior to use. 10. Provided there is a high enough MP concentration in the undiluted B-lysate such that the yeast surface bound, biotinylated MP is detected at reasonable signal to background levels, it will be possible to measure the dissociation rate constant as described in Subheading 3.3 and Note 12. This applies whether or not the scFv is saturated by the MP ligand and

76

Benjamin J. Tillotson et al.

opens up affinity maturation by kinetic screening to any lysate resident MP whose abundance can yield a detectable signal on the yeast surface. 11. Ratios of 50 μL B-lysate and 100 μL U-lysate per 2 × 106 yeast were used for koff determination and kinetic screening of H7 mutants. Large libraries will necessarily require a large volume of detergent-solubilized lysate for screening. As a result, cell culture should be scaled up accordingly. In lieu of multiple T75 flasks, 500 cm2 culture plates can be used. The volumes of B- and U-lysate were chosen to maintain an excess of unlabeled MP during the competition step. When labeled MP antigen dissociates, it will in essence be eliminated from rebinding the scFv as the excess unlabeled MP in U-lysate will compete favorably for scFv binding. This ensures accurate measurement of a pseudo-irreversible first-order dissociation rate constant. 12. The effects of detergents on yeast cells should be considered throughout the screening procedure. Yeast can be permeabilized by nonionic detergents at concentrations 95 % pure as determined by SDS-PAGE with Coomassie staining. 3. All the buffers contain 5 mM freshly prepared DTT to prevent TEV-P oxidation (see Note 18).

3.3.2 MBP-GST Fusion Protein Purification

To monitor the cleavage of fusion proteins by TEV-P or its variants, maltose-binding protein (MBP) and glutathione S-transferase (GST) protein are fused with an internal peptide linker containing ENLYFXS-H6, where X can be Q, H, or E. The H6 will facilitate the purification of the MBP-GST fusion complex using the Ni-NTA affinity resin. The respective fusions are designated MBP-ENLYFQSGST, MBP-ENLYFES-GST, and MBP-ENLYFHS-GST. 1. The MBP-GST fusion gene is cloned into the pRK792 vector and the protein is purified using Ni-NTA affinity resin (see Note 19). 2. The inoculated cells are grown in ampicillin selective LB media, and then induced with 1 mM IPTG when OD600 reaches 0.6. The induced cells are grown in a shaker at 20 °C for 20 h, 250 rpm. 3. The induced cells are collected by centrifugation at 8,000 × g for 15 min. Cell pellets are resuspended with cell lysis buffer (1:7 to 1: 10 ratio) in a glass beaker, adding 1 mg/mL lysozyme, 5 mM freshly prepared DTT, protease inhibitor cocktail (EDTA free, one tablet for 50 mL), 10 unit/mL DNAase. 4. The cell lysate is stirred with a stir bar for 1 h in the 4 °C cold room. The cells are further disrupted using a French Press. 5. The disrupted cell lysate is centrifuged at 30,000 × g for 1 h. The supernatant is then collected and filtered with 0.45 μm filter. 6. The supernatant is loaded into a column filled with Ni-NTA resin equilibrated with wash buffer. 7. The column is washed with at least 20-fold volume of wash buffer, and then followed by elution with elution buffer (see Note 20). 8. All the purified fusion protein should be >95 % pure as determined by SDS-PAGE with Coomassie staining.

3.3.3 TEV-P Characterization: Peptide Substrate Digestion

1. 5 μM to 6 mM of substrate peptide are incubated with 0.025–5 μM purified enzymes at 30 °C for 10–30 min. Reaction tubes were placed in a Thermomixer R (see Note 21). 2. The reactions are quenched with 0.5 % Trifluoroacetic acid (TFA) followed by freezing at −80 °C.

Yeast Endoplasmic Reticulum Sequestration Screening for the Engineering…

91

3. All the enzymatic reactions are analyzed by HPLC on a Phenomenex C18 reverse-phase column using an acetonitrile gradient and a flow rate of 1 mL/min (see Notes 22 and 23). 4. The product-synthesizing rate is calculated upon the integration area at 280 nm (see Note 24). 5. The data is fitted to nonlinear regression of the MichaelisMenten equation using KaleidaGraph software. 3.3.4 TEV-P Characterization: Protein Substrate Digestion

1. The enzymatic reactions are performed the same way with the peptide substrate digestion. All the enzymatic assays were carried out in the reaction buffer using freshly purified enzyme. 2. 0.1 μg protease is mixed with 5 μg MBP-GST fusion protein substrate, which is reacted in microfuge tube on a Thermomixer R at 30 °C for 1 h. 3. The reactions are quenched with 0.5 % Trifluoroacetic acid (TFA) followed by freezing at −80 °C. 4. All the enzymatic reactions are analyzed by SDS-PAGE with Coomassie staining.

4

Notes 1. To increase the efficiency of ligation and following transformation, the residual gel from the gel purification steps must be removed completely. A following DNA purification step using the Qiagen PCR purification kit can be used. 2. The ligation products need to be desalted to increase the efficiency of transformation through electroporation. 3. Library quality is evaluated by sequencing isolated plasmids. Twenty single clones are picked up from the pooled clones followed by plasmid DNA isolation using a QIAprep Spin Miniprep kit. 90 % correctness, which means 90 % of the sequenced plasmids contain the designed mutations, is required for a good library to be used for the following experiments. 4. The library error rate is calculated by the average number of mutations in 20 sequenced clones divided by the total number of residues of the native protease. 5. To enhance the transformation efficiency of the yeast cells, highly pure and concentrated DNA is preferred, with library DNA concentration above 0.5 μg/μL and the pESD plasmid concentration above 1 μg/μL. Generally, the mixed DNA volume should be less than 10 % of that of the competent cells in the electroporation cuvette.

92

Li Yi et al.

6. As for different mutagenesis libraries, the transformation DNA mix with varied ratios of the purified mutagenesis library against the linearized pESD plasmids should be tested to maximize the transformation efficiency. 7. The protease and the substrate genes in the pESD plasmid are under the control of the GAL1 and GAL10 promoters, respectively. The directed evolution of a protease against a substrate library, or a protease library against a substrate library, or a protease library against a specific substrate can be applied in the YESS system. The substrate library can be incorporated into the pESD vector using the similar strategy with the protease library. 8. The over-growth (OD600 higher than 3.0) of yeast cells before the induction will lower the protein expression and surface display efficiency. In addition, the initial OD600 of the induced cells should be kept lower than 1.0 but above 0.5. 9. Penicillin (final concentration of 100 units/mL) and streptomycin (final concentration of 100 μg/mL) can be added into the culture medium to avoid the bacterial contamination. 10. The total amount of cells that are collected for sorting in the first round should be ten times of the original library size to avoid the loss of the library diversity. 11. The anti-FLAG-PE antibody or the anti-6×His-FITC antibody is diluted in the cell washing buffer B for the antibody labeling. The antibody labeling process is performed at 4 °C for 15 min followed by room temp for 30 min. 12. A cell density concentration close to 5 × 106 cells/mL is preferred for loading into the FACSAria II for the cell sorting. 13. To avoid the interference of the PE signal to the FITC signal, a 510/20 nm emission filter for FITC is preferred. 14. The big sorting gate of the first round cell sorting can be drawn to be close to the major uncleaved cell population to lower the possibility of losing the target cells (Fig. 3a). 15. The total cells being analyzed and sorted for each round can be varied. It depends on the total number of the cells that are collected in the previous round. 16. 106 cells are enough for the FACS scanning for the single clones. 17. The plasmid DNA from the yeast cells is extracted using Zymoprep™ Yeast Plasmid Miniprep II kit. 18. The purified TEV-P is diluted in the storage buffer, with the concentration being kept lower than 0.5 mg/mL to avoid protein aggregation. 19. The MBP-ENLYFXS-H6-GST fusion gene is inserted into pRK792 construct, which contains an ampicillin resistant gene.

Yeast Endoplasmic Reticulum Sequestration Screening for the Engineering…

93

20. The purified fusion protein is dialyzed with reaction buffer for the later enzymatic experiments. 21. All the enzymatic assays are performed using freshly purified enzyme. Kinetic assays are carried out in reaction buffer. 22. The reaction samples are centrifuged at 16,000 × g for 1 min. The supernatant is collected for the HPLC analysis. 23. The proteolysis products are confirmed using LC-MS (ESI), which was performed on a Magic 2002 instrument. 24. To minimize the product inhibitory effect, the substrate conversion percentage is controlled to be less than 5 % to approximate steady-state kinetics. References 1. Marnett AB, Craik CS (2005) Papa’s got a brand new tag: advances in identification of proteases and their substrates. Trends Biotechnol 23:59–64. doi:10.1016/j.tibtech.2004.12.010 2. Overall CM, Blobel CP (2007) In search of partners: linking extracellular proteases to substrates. Nat Rev Mol Cell Biol 8:245–257. doi:10.1038/nrm2120 3. Rawlings ND, Barrett AJ, Bateman A (2010) MEROPS: the peptidase database. Nucleic Acids Res 38:D227–D233. doi:10.1093/nar/ gkp971 4. Craik CS, Page MJ, Madison EL (2011) Proteases as therapeutics. Biochem J 435:1– 16. doi:10.1042/BJ20100965 5. Yi L, Gebhard MC, Li Q et al (2013) Engineering of TEV protease variants by yeast ER sequestration screening (YESS) of combinatorial libraries. Proc Natl Acad Sci U S A 110:7229–7234. doi:10.1073/pnas.1215994110 6. Johnston M, Davis RW (1984) Sequences that regulate the divergent GAL1-GAL10 promoter in Saccharomyces cerevisiae. Mol Cell Biol 4:1440–1448 7. Boder ET, Wittrup KD (1997) Yeast surface display for screening combinatorial polypeptide libraries. Nat Biotechnol 15:553–557. doi:10.1038/nbt0697-553 8. Hardwick KG, Lewis MJ, Semenza J et al (1990) ERD1, a yeast gene required for the retention of luminal endoplasmic reticulum proteins, affects glycoprotein processing in the Golgi apparatus. EMBO J 9:623–630 9. Pelham HR, Hardwick KG, Lewis MJ (1988) Sorting of soluble ER proteins in yeast. EMBO J 7:1757–1762

10. Makino T, Skretas G, Kang TH et al (2011) Comprehensive engineering of Escherichia coli for enhanced expression of IgG antibodies. Metab Eng 13:241–251. doi:10.1016/j. ymben.2010.11.002 11. Fisher AC, Haitjema CH, Guarino C et al (2011) Production of secretory and extracellular N-linked glycoproteins in Escherichia coli. Appl Environ Microbiol 77:871–881. doi:10.1128/AEM.01901-10 12. Jung ST, Reddy ST, Kang TH et al (2010) Aglycosylated IgG variants expressed in bacteria that selectively bind FcgammaRI potentiate tumor cell killing by monocyte-dendritic cells. Proc Natl Acad Sci U S A 107:604–609. doi:10.1073/pnas.0908590107 13. Tropea JE, Cherry S, Waugh DS (2009) Expression and purification of soluble His(6)tagged TEV protease. Methods Mol Biol 498:297–307.doi:10.1007/978-1-59745-1963_19 14. Varadarajan N, Cantor JR, Georgiou G et al (2009) Construction and flow cytometric screening of targeted enzyme libraries. Nat Protoc 4:893–901. doi:10.1038/nprot.2009.60 15. Drummond DA, Iverson BL, Georgiou G et al (2005) Why high-error-rate random mutagenesis libraries are enriched in functional and improved proteins. J Mol Biol 350:806–816. doi:10.1016/j.jmb.2005.05.023 16. Benatuil L, Perez JM, Belk J et al (2010) An improved yeast transformation method for the generation of very large human antibody libraries. Protein Eng Des Sel 23:155–159. doi:10.1093/protein/gzq002

Chapter 6 T Cell Receptor Engineering and Analysis Using the Yeast Display Platform Sheena N. Smith, Daniel T. Harris, and David M. Kranz Abstract The αβ heterodimeric T cell receptor (TCR) recognizes peptide antigens that are transported to the cell surface as a complex with a protein encoded by the major histocompatibility complex (MHC). T cells thus evolved a strategy to sense these intracellular antigens, and to respond either by eliminating the antigenpresenting cell (e.g., a virus-infected cell) or by secreting factors that recruit the immune system to the site of the antigen. The central role of the TCR in the binding of antigens as peptide-MHC (pepMHC) ligands has now been studied thoroughly. Interestingly, despite their exquisite sensitivity (e.g., T cell activation by as few as 1–3 pepMHC complexes on a single target cell), TCRs are known to have relatively low affinities for pepMHC, with KD values in the micromolar range. There has been interest in engineering the affinity of TCRs in order to use this class of molecules in ways similar to now done with antibodies. By doing so, it would be possible to harness the potential of TCRs as therapeutics against a much wider array of antigens that include essentially all intracellular targets. To engineer TCRs, and to analyze their binding features more rapidly, we have used a yeast display system as a platform. Expression and engineering of a singlechain form of the TCR, analogous to scFv fragments from antibodies, allow the TCR to be affinity matured with a variety of possible pepMHC ligands. In addition, the yeast display platform allows one to rapidly generate TCR variants with diverse binding affinities and to analyze specificity and affinity without the need for purification of soluble forms of the TCRs. The present chapter describes the methods for engineering and analyzing single-chain TCRs using yeast display. Key words T cell receptors, Peptide antigens, Major histocompatibility complex, Yeast display, Singlechain T cell receptors, Affinity maturation, Intracellular antigens

1

Introduction The structural and biochemical properties of αβ T cell receptors have been revealed through the efforts of many labs over the past 20 years [1–6]. Among the findings, it has been shown that the variable (V) domains of each chain bind to the specific peptide/ MHC ligand in a conserved, diagonal orientation. The structural basis of this invariant orientation is still unclear, but it has been suggested to be due to the: (1) geometry required for the entire T cell complex (αβ TCR, CD3 subunits, and co-receptor CD4 or

Bin Liu (ed.), Yeast Surface Display: Methods, Protocols, and Applications, Methods in Molecular Biology, vol. 1319, DOI 10.1007/978-1-4939-2748-7_6, © Springer Science+Business Media New York 2015

95

96

Sheena N. Smith et al.

CD8) to productively engage the pepMHC and to signal the T cell during thymic selection [7, 8], (2) evolutionary pressures that yielded “germline” TCR regions with basal affinity for the helices of MHC molecules [6, 9], or (3) perhaps both [10]. Regardless of the mechanistic or evolutionary basis, the consequence of the conserved diagonal orientation is that it positions the complementarity determining regions (CDRs) of each V region (Vα and Vβ) in ideal proximity to the antigenic components of the ligand. That is, the most hypervariable regions of the TCR (CDR3α and CDR3β) are positioned directly over the most diverse component of the ligand, the bound antigenic peptide. In contrast CDR2 loops are positioned almost exclusively over the MHC helices, whereas CDR1 loops can contact either peptide or MHC. Because TCRs are oriented in this manner, engineering CDR3 loops for affinity maturation may provide the optimal opportunity to maintain the highest level of peptide specificity possible [11–15]. While there have been several antibodies engineered against individual pepMHC complexes [16–19], it is not clear whether the antibodies will maintain any type of consistent geometry [20]. In this case, while one might see some peptide selectivity, it remains to be seen if a high level of specificity for the selecting peptide is achieved. Recent reviews have described the possible applications for TCRs that have been engineered with higher affinity for their specific pepMHC ligands [21–23]. The applications include use of soluble forms of high-affinity TCRs (picomolar to nanomolar) as targeting components, coupled with other specificities such as antiCD3 scFv fragments for bispecific agents [15], or cytokines such as IL-10 [24] or IL-15 [25] for use as immunomodulators. Another application involves the introduction of the TCRs into T cells for adoptive therapies [26, 27], but the optimal affinities of these TCRs in order to avoid or minimize cross-reactivities with selfpeptides will likely be in the low micromolar to high nanomolar range [12, 28, 29]. The present report focuses on specific methods that our lab has used to affinity mature TCRs, and to more rapidly analyze the binding properties and specificity of these TCRs. By analogy to the development of single-chain antibody fragments (scFv), we have sought to develop strategies that allow expression of only the antigen-binding domains of the TCR as single-chain molecules (Vα-linker-Vβ or Vβ-linker-Vα), called either scTv or scTCR [22, 30–33]. The use of stabilized versions of the scTv fragments allows for high levels of expression in the yeast display format, and expression as soluble versions of the stabilized scTv fragments. While the first studies were performed with mouse TCRs, our more recent efforts have applied these same methods to human TCRs. One of the human Vα regions, called Vα2 (IMGT, TRAV12 family), has been shown to be exceptionally stable in the single-chain format, and serves as a platform for engineering human TCRs with different specificities and affinities [22, 32, 33]. Engineering is facilitated by

T Cell Receptors

97

the availability of various forms of the ligands, peptide/HLA class I complexes, some of which are commercially available. The methods involving these different forms, combined with the yeast display system, are also described here. Finally, we describe methods to rapidly discover and to analyze TCR variants with a wide range of affinities.

2

Materials

2.1 Yeast Display Strain, Plasmid, and Primers

1. Saccharomyces cerevisiae yeast display strain EBY100 (a GAL1AGA1::URA3 ura3-52 trp1 leu2Δ1 his3Ø200 pep4::HIS2 prb1Δ1.6R can1 GAL). 2. pCT302 Yeast Display Vector. 3. pCT302 Standard Primers (a) Splice 4L (Forward): 5′ GGCAGCCCCATAAACAC ACAGTAT. (b) YRS (Reverse): Rev 3′ CGAGCTAAAAGTACAGTGGG. (c) T7 (Reverse): Rev 3′ TAATACGACTCACTATAG.

2.2

DNA Purification

1. Zymoprep Kit II (Zymo Research). 2. QIAprep Spin Miniprep Kit (Qiagen). 3. QIAquick Gel Extraction Kit (Qiagen). 4. QIAquick PCR Purification Kit (Qiagen). 5. Pellet Paint Co-Precipitant (Novagen). 6. Agencourt AMPure XP PCR Purification Beads (Beckman Coulter).

2.3 Restriction Enzymes and Ligation

1. XhoI. 2. NheI. 3. BglII. 4. DpnI. 5. T4 DNA Ligase. 6. Calf Intestinal Alkaline Phosphatase (CIP).

2.4

PCR

1. FastStart High Fidelity PCR System (Roche). 2. dATP Solution. 3. dCTP Solution. 4. dGTP Solution. 5. dTTP Solution. 6. Deoxynucleotide (dNTP) solution mix. 7. PfuTurbo DNA Polymerase (Agilent). 8. Taq DNA Polymerase (Invitrogen).

98

Sheena N. Smith et al.

2.5 LiOAc Yeast Heat Shock Transformation

1. 50 % PEG 3350: dissolve 5 g PEG 3350 to a final volume of 10 mL ddH2O, sterile filter, and store at room temperature for up to 6 months. 2. 1 M LiOAc: dissolve 16.5 g LiOAc in 250 mL ddH2O, sterile filter, and store at room temperature for up to 6 months 3. 10× TE: dissolve 121 mg Tris-HCl (10 mM) and 29 mg EDTA (1 mM) in 100 mL ddH2O, sterile filter, and store at room temperature for up to 6 month. 4. Single-stranded carrier: Dissolve 200 mg Salmon Sperm DNA (Sigma) in 100 mL 1× TE buffer, aliquot into 1 mL stocks, and store at −20 °C.

2.6 Electrocompetent E. coli Strains

2.7

Yeast Media

1. For DNA amplification: Subcloning Efficiency DH5α Competent Cells (Invitrogen). 2. For Protein expression: BL21(DE3) Competent E. coli (New England Biolabs). 1. YPD media: Dissolve 10 g yeast extract, 20 g bacto-peptone, and 20 g dextrose, bring volume to 1 L with ddH2O, autoclave, and store at room temperature for up to 1 month. 2. YPD plates: Dissolve 10 g yeast extract, 20 g bacto-peptone, 15 g agar, and 20 g dextrose, bring volume to 1 L dH2O, and autoclave. Cool to ~55 °C and pour ~25 mL into 100 mm × 15 mm plates. Cool and store at +4 °C for up to 1 month. 3. SD-CAA media: Dissolve 14.8 g sodium citrate, 4.2 g citric acid monohydrate, 5 g casamino acids, 6.7 g yeast nitrogen base (without amino acids), 20 g dextrose, and 10 mL penicillin-streptomycin (10,000 U/mL), bring volume to 1 L with ddH2O, sterile filter, and store at 4 °C for up to 6 months. 4. SD-CAA plates: Dissolve 91.1 g sorbitol, 7.5 g agar, 7.4 g sodium citrate, and 2.1 g citric acid monohydrate in 400 mL of ddH2O, autoclave, and cool to ~55 °C. In a separate container combine 2.5 g casamino acids, 10 g dextrose, and 3.35 g yeast nitrogen base (without amino acids) to 100 mL of ddH2O, sterile filter, and add to cooled autoclaved solution. Mix and pour ~25 mL into 100 mm × 15 mm plates. Cool and store at +4 °C for up to 6 months. 5. SG-CAA media: Dissolve 14.8 g sodium citrate, 4.2 g citric acid monohydrate, 5 g casamino acids, 6.7 g yeast nitrogen base (without amino acids), 20 g galactose, and 10 mL penicillin-streptomycin (10,000 U/mL), bring volume to 1 L with ddH2O, sterile filter, and store at 4 °C for up to 6 months.

T Cell Receptors

2.8

Yeast Library

99

1. 1 M Sorbitol: dissolve 45.6 g sorbitol in 250 mL ddH2O, sterile filter, and store at 4 °C for up to 6 months. 2. 1 M Sorbitol/1 mM CaCl2: dissolve 45.5 g sorbitol and 27 mg of CaCl2 in 250 mL ddH2O, sterile filter, and store at 4 °C for up to 6 months. 3. 0.1 M LiAc/10 mM DTT: dissolve 1.65 g lithium acetate (LiAc) and 0.386 g dithiothreitol (DTT) in 250 mL ddH2O, sterile filter, and cool to 4 °C for immediate use. 4. 0.2 cm electroporation cuvettes.

2.9

Yeast Staining

1. Phosphate-buffered saline (PBS): Dissolve 8 g NaCl, 0.2 g KCl, 1.15 g Na2HPO4⋅7H2O, and 0.2 g KH2PO4 (anhydrous); bring volume up to 1 L with ddH2O, adjust pH to 7.4, autoclave, and store at room temperature. 2. PBS/1 % BSA: Dissolve 10 g bovine serum albumin (BSA) in 1 L PBS, sterile filter, and chill to 4 °C. 3. Anti-c-myc, chicken IgY fraction (Invitrogen cat. no. A12181). 4. HA.11 Clone 16B12 Monoclonal Antibody (anti-HA) (Covance cat. no. MMS-101P). 5. Alexa Fluor 647 Goat anti-Chicken IgG (H + L) (Molecular Probes cat. no. A-21449). 6. Streptavidin-Phycoerythrin (BD Pharmingen cat. no. 554061). 7. Alexa Fluor 647 F(ab′)2 Fragment of Goat anti-Mouse IgG (H + L) (Molecular Probes cat. no. A-21237). 8. BD DimerX HLA-A2:Ig Recombinant Fusion Protein, Human (BD Pharmingen cat. no. 551263).

2.10 HLA-A2 Expression Plasmids

1. HLA-A2 Heavy Chain (HLA-A2bsp in pHN1); obtained from the University of Massachusetts Medical School Tetramer Facility. 2. HLA-A2 Light Chain (β2 microglobulin in pHN1); obtained from the NIH Tetramer Facility.

2.11 Bacterial Expression Media

1. Luria Broth (LB): Dissolve 5 g yeast extract, 10 g tryptone, and 10 g NaCl in 1 L ddH2O, autoclave, and store at room temperature. 2. Ampicillin (100 mg/mL): Stock solution can be made by dissolving 1 g into 10 mL ddH2O, sterile filtering, and freezing individual aliquots at −20 °C. 3. LB + ampicillin (100 μg/mL) plates: Dissolve 5 g yeast extract, 10 g tryptone, 10 g NaCl, and 15 g agar in 1 L dH2O and autoclave. Cool to ~55 °C, then add 1 mL ampicillin stock at 100 mg/mL, swirl, then pour ~25 mL into 100 mm × 15 mm plates. Cool and store at +4 °C.

100

Sheena N. Smith et al.

2.12 Inclusion Body Isolation

1. Lysis Buffer: 50 mM Tris–HCl base, 100 nM NaCl, 0.1 % NaN3, 1 % Triton X-100, 10 mM dithiothreitol (DTT), and 1 mM phenylmethylsulfonyl fluoride (PMSF, dissolved in 1 mL isopropanol), bring volume to 1 L with ddH2O and adjust pH to 8.0 with hydrochloric acid. Buffer can be stored without DTT and PMSF for up to 6 months. 2. Osmotic Shock Buffer: 20 mM Tris–HCl base and 2.5 mM ethylenediaminetetraacetic acid (EDTA); bring volume up to 1 L with ddH2O, adjust pH to 8.0, and chill to 4 °C. 3. Osmotic Shock Buffer with Triton: Add 0.5 % Triton X-100 to 1 L osmotic shock buffer and chill to 4 °C. 4. Urea Extraction Buffer: 8 M urea, 25 mM MES, 10 mM EDTA, and 0.1 mM dithiothreitol (DTT) in 10 mL at pH 6.0. 5. Guanidine Extraction Buffer: 8 M guanidine-HCl, 50 mM Tris–HCl, 5 mM EDTA, 5 mM dithiothreitol (DTT) in 10 mL at pH 8.0.

2.13

MHC Refold

1. Refold Buffer: 400 mM Tris–HCl, 400 mM L-Arg, 2 mM EDTA; bring volume up to 200 mL with ddH2O, adjust pH to 8.0, and chill to 4 °C. 2. Injection Buffer: 3 M guanidine-HCl, 10 mM sodium acetate, and 10 mM EDTA; bring volume up to 250 mL with ddH2O and adjust pH to 4.2. Aliquots can be frozen and stored at −20 °C. 3. Dialysis Buffer: 20 mM Tris–HCl in 3 L ddH2O, adjust pH to 8.0, and chill to 4 °C. 4. Oxidized glutathione. 5. Reduced glutathione. 6. Phenylmethylsulfonyl fluoride (PMSF). 7. Regenerated Cellulose 6-8 MWCO Dialysis Tubing. 8. Amicon Ultra-4 Centrifugal Filter Units with Ultracel-10 membrane (Amicon).

2.14 MHC Biotinylation, Purification, and Quantification

1. In vitro Biotinylation Kit (Avidity). 2. HPLC Buffer: 20 mM Tris–HCl and 50 mM NaCl in 1 L ddH2O, adjust pH to 8.0, and degas. 3. EDTA Stock: 0.5 M EDTA in 50 mL ddH2O, adjust pH to 8.0, and sterile filter. 4. BCA Protein Assay kit (Pierce).

2.15 MHC-Restricted Peptides

1. UV-cleavable peptide, KILGFVFJV, where J is the photolabile amino acid residue, prepared by standard Fmoc-peptide solid phase synthesis using commercially available Fmoc-3-amino3-(2-nitro)phenyl propionic acid as a building block; store in the dark at −20 °C.

T Cell Receptors

101

2. HLA-A2-restricted peptide(s) (20 mg/mL): Dissolve 20 mg of lyophilized peptide into 1 mL DMSO; store at −20 °C. 3. HLA-A2-restricted peptide(s) (2 mg/mL): Perform a 1:10 dilution of 20 mg/mL peptide stock in DMSO in PBS; store at −20 °C. 2.16 Magnetic Selection

1. PBSM: 8 g NaCl, 0.2 g KCl, 1.44 g Na2PO4, 0.24 g KH2PO4, 5 g bovine serum albumin, and 744 mg EDTA in 1 L dH2O, adjust to pH 7.4, sterile filter, and store at 4 °C. 2. Microbeads conjugated to anti-mouse IgG (Miltenyi Biotec cat. no. 130-048-401). 3. Microbeads conjugated to streptavidin (Miltenyi Biotec cat. no. 130-048-101). 4. Microbeads conjugated to anti-biotin (Miltenyi Biotec cat. no. 130-090-485). 5. LS Columns (Miltenyi Biotec cat. no. 130-042-401).

2.17 DNA Quantification, Analysis, Site-Directed Mutagenesis, and 454 Sequencing

1. Qubit dsDNA HS Assay Kit (Life Technologies). 2. Agilent DNA 7500 Kit (Agilent Technologies). 3. QuikChange II or QuikChange Lightening Site-Directed Mutagenesis Kit (Agilent). 4. GS FLX Titanium Sequencing Kit XL+ (Roche). 5. GS FLX Titanium PicoTiter Plate Kit 70 x 75 (Roche).

2.18

Equipment

1. Thermocycler. 2. Two temperature controlled incubator shakers. 3. Electroporator (BioRad Gene Pulser II Electroporation System). 4. Flow Cytometer and FACS apparatus. 5. Amicon 8400 Stirred Ultrafiltration Cell (Millipore) with regenerated cellulose Ultrafiltration Discs, YM-10, 10 kDa NMWL, 76 mm (Millipore cat. no. 13642). 6. Superdex 200 10/300 GL gel filtration column (GE Biosciences cat. no. 17517501). 7. CL-1000 Ultraviolet Crosslinker (UVP, LLC). 8. MidiMACS Separator (Miltenyi Biotec). 9. MACS MultiStand (Miltenyi Biotec). 10. Qubit 2.0 Fluorimeter (Life Technologies). 11. Agilent 2100 Bioanalyzer (Agilent Technologies). 12. Roche/454 Genome Sequencer FLX+ (Roche).

102

3

Sheena N. Smith et al.

Methods

3.1 Yeast Surface Display of T Cell Receptors

Yeast display allows for surface expression, detection, and selection of recombinant proteins via an N- or C-terminal fusion to the yeast agglutinin factor Aga-2 [34]. By forming a disulfide linkage to Aga-1 on the yeast cell surface, 10,000–100,000 fusion copies of the protein of interest can be expressed on the yeast cell surface (Fig. 1). Yeast display offers certain advantages over other protein display methods. First, yeast provide eukaryotic expression and processing of the protein of interest as well as the quality control mechanisms that result from the yeast secretory pathway [30, 35, 36]. Second, libraries of yeast can be quantitatively selected for precise affinities or off-rates by fluorescence-activated cell sorting (FACS) [37]. Mutants selected by yeast display can also be analyzed directly on the surface of yeast without the need for subcloning and expression of large amounts of protein (discussed in Subheading 3.2) [30, 38, 39]. Finally, current library generation protocols have been optimized for the routine generation of large

Peptide MHC c-myc Vβ

5 µM

Vα

HA S -S AGA-1

Yeast Cell

AGA-2 S -S

Yeast Mating Proteins Fig. 1 Diagram of scTv fragment displayed on surface of yeast. An scTv fragment with an N-terminus HA tag and a C-terminus c-myc is depicted. The scTv construct is expressed as a fusion as an N-terminal fusion to the AGA-2 yeast mating protein, which forms covalent linkages to AGA-1 on the yeast cell surface. A total of 10,000–100,000 of copies of the scTv are expressed on the surface of each yeast cell and can bind to soluble pepMHC molecules. Expression of the construct can be monitored through antibodies against either tags (HA or c-myc) or antibodies specific for the scTv variable domains

T Cell Receptors

103

libraries on the order 109–1010 [40, 41]. Here we describe the design and cloning of T cell receptors as yeast-displayed single chains, and the use of yeast-displayed TCR libraries to engineer TCRs with improved stability. 3.1.1 Design and Cloning of T Cell Receptors for Yeast Display as SingleChain Variable Fragments

For expression and engineering of T cell receptors on the surface of yeast, we have used scTv fragments consisting of the variable α and β regions linked by a polypeptide. Although other linkers such as Gly/Ser-rich repeats can be used, we have used the charged linker first introduced into a soluble form of the TCR, GSADDAKKDAAKKDGKS [42]. The orientation of the scTv can be constructed in either the Vβ-L-Vα or the Vα-L-Vβ orientation. Expression of scTv fragments has shown higher expression levels than full-length constructs [31, 32], but they require introduction of mutations in order to stabilize the V regions in the absence of C regions. In this section we describe the method for cloning a TCR gene into the pCT302 yeast display vector as an scTv construct. The pCT302 vector contains a galactose promoter and an upstream HA tag (sequence: YPYDVPDYA), which can be used as a probe for expression. We suggest including a C-terminal c-myc epitope tag (sequence: EQKLISEEDL) for monitoring expression of the full-length fusion (Fig. 1). Given that the pCT302 vector does not contain a stop codon, a stop codon should be included at the 3′ end of the scTv sequence, or following the c-myc sequence if used. The following three sections describe cloning the scTV into the yeast display vector pCT302 (Subheading 3.1.2), LiOAc transformation into yeast (Subheading 3.1.3), and a standard yeast induction protocol (Subheading 3.1.4).

3.1.2 Cloning the scTv into the pCT302 Vector

The sequences of the TCR genes to be engineered typically originate from the cloning and sequencing of T cell clones isolated for reactivity against an antigen of interest. As described, we have shown that the human Vα2 region is amenable to expression as a single-chain with different Vβ regions, and thus it is advantageous to identify clones that use this Vα region [32]. Although the scTv construct can be cloned directly from the genes of the isolated T cell clone, we suggest having the scTv gene synthesized for optimized yeast expression. Gene synthesis and codon optimization are available commercially from a variety of companies (e.g., Genscript, DNA2.0, Genewiz). Flanking DNA sequences containing the 5′ NheI and 3′ XhoI and/or BglII restriction sites should be included in original gene synthesis to allow for subcloning into the yeast display vector pCT302. We recommend the addition of a C-terminal c-myc epitope tag (sequence: EQKLISEEDL) immediately following the sequence of the scTv in order to assess the population for truncations in future libraries derived from the scTv. Following the c-myc tag, 1–2 stop codons should be introduced prior to the flanking XhoI and/or BglII restriction sites.

104

Sheena N. Smith et al. Bgl I AGA-2

EcoRI

Vα

HA

Vβ

L

XhoI

NheI

Splice 4L

c-myc

YRS T7 pCT302 6972 bp

Fig. 2 scTv in the pCT302 yeast display vector. Depicted is the pCT302 vector with described cloning sites. The pCT302 vector contains the TrpI gene that allows for the auxotroph EBY100 yeast strand to grow on minimal media, and an ampicillin resistant gene that allows for growth in E. coli. The scTv ORF contains a galactoseinducible promoter such that expression of the scTv can be induced by growth in galactose. The 5′ region of the ORF contains the sequence for the yeast mating protein AGA-2 fused to the scTv construct. The scTv, depicted here as a Vα-Linker-Vβ, is flanked by an N-terminal HA epitope tag (HA sequence: YPYDVPDYA), which can be used as a probe for expression, and an added C-terminal c-myc tag (c-myc sequence: EQKLISEEDL) which we recommend adding to the scTv construct to probe for full-length variants. For cloning purposes, the standard Splice 4L, YRS, or T7 primers can be used for PCR-based mutagenesis and sequencing

Once synthesized, the scTv construct can be cloned into the pCT302 vector by ligation into the upstream NheI restriction site and either a downstream XhoI or BglII restriction site (Fig. 2). Traditional cloning methods utilizing competent E. coli, such as DH5α, can then be used to amplify the ligated scTv in the pCT302 vector. pCT302 contains an ampicillin resistant gene for selection in E. coli, which allows for growth in ampicillin concentrations up to 100 μg/mL. Splice4L, T7, and YRS are suggested primers to confirm proper cloning and for mutagenesis described in future sections (Fig. 2). 1. Optimize codon and synthesize the scTv gene of interest in the Vβ-L-Vα or Vα-L-Vβ orientation with a C-terminal c-myc tag (EQKLISEEDL) if desired and two stop codons. Include an N-terminal NheI restriction site (e.g., GCGGCCGCCACC) and a C-terminal XhoI and/or BglII restriction sites (e.g., CTCGAG) on flanking ends for cloning into pCT302

T Cell Receptors

105

(see Note 1). Typically the manufacturer of the gene will deliver the synthesized gene in a carrier plasmid. 2. If necessary, amplify codon-optimized gene provided by manufacturer by transforming competent E. coli, such as DH5α, expanding colonies in LB media with the specified antibiotic, and harvesting plasmid using Qiagen Miniprep kit. 3. Digest the amplified scTv plasmid with both NheI and XhoI or BglII according to the manufacturer’s protocol. Run entire samples on a 1 % agarose gel and gel purify the band containing the scTv (typically ~750 bp for scTvs) with a Qiagen gel extraction kit (see Note 2). 4. Meanwhile, the pCT302 plasmid should also be digested with the same restriction enzymes used to digest the scTv insert according to the manufacturer’s protocol. 5. Purify digested pCT302 plasmid using the Qiagen PCR purification kit according to the manufacturer’s protocol. 6. Dephosphorylate the linearized pCT302 vector using Calf Intestine Phosphatase (CIP) for 1 h at 37 °C according to the manufacturer’s protocol. Alternatively, entire digested vector can be run on a 1 % agarose gel and the band containing the digested pCT302 plasmid (typically ~6 Kb) can be gel purified using the Qiagen gel extraction kit according to the manufacturer’s protocol. 7. Perform ligation of digested scTv insert into the digested pCT302 vector using T4 ligase according to the manufacturer’s protocol (see Note 3). 8. Transform 1–2 μL of ligation products into competent E. coli, such as DH5α, and plate entire volumes of transformed E. coli on LB/Amp plates. Incubate plates for 8–12 h at 37 °C until colonies are visible. 9. Grow 4–6 colonies in 3 mL of LB media with Amp (100 μg/ mL) for 8–12 h at 37 °C. 10. Purify DNA using Qiagen miniprep, according to the manufacturer’s protocol. 11. Determine if ligations were successful by performing small (10 μL) test digests with both NheI and XhoI or BglII and running products on a 1 % agarose gel. Digestion of the correct product will yield two bands (one for digested pCT302 at ~6 Kb and one for the digested scTv at ~750 bp). 12. Confirm the sequence of the construct by sequencing using T7, Splice 4L, and/or YRS primers. 3.1.3 LiOAc-Mediated Transformation of EBY100 Yeast

Once the proper scTv is cloned into the pCT302 vector, the vector is transformed into EBY100 yeast by LiOAc-mediated transformation or electroporation. The pCT302 yeast display plasmid contains the trp1 gene, which allows for tryptophan synthesis in

106

Sheena N. Smith et al.

EBY100 yeast (Trp− Leu−). Here we describe how to perform an LiOAc-mediated heat shock transformation. This protocol has been adapted from Gietz [43]. 1. Streak a YPD plate with EBY100 yeast, preferably from a frozen stock. Grow the yeast for 36–48 h at 30 °C until colonies are visible. 2. Select an individual colony and transfer to 3 mL of YPD media to start a liquid culture. Grow liquid cultures until dense (density >OD600 8.0; approximately 24–48 h) shaking at 220 rpm at 30 °C. 3. For each yeast transformation, spin 1 mL of dense yeast culture at 1,800 × g for 3 min in sterile 1.7 mL microfuge tubes (see Note 4). 4. Aspirate supernatants and discard. 5. Wash cells by suspending in a sterile mixture of 800 μL ddH2O, 100 μL 10× TE, and 100 μL 1 M LiAc at room temperature. 6. Aspirate supernatant leaving ~50 μL of wash mixture and suspend cells in remaining volume. 7. Add the following heat shock mixture to cells in the order listed: (a) 264 μL 50 % PEG 3350. (b) 36 μL 1 M LiOAc. (c) 50 μL single-stranded DNA carrier, boiled for 8 min on a heat block prior to addition. (d) 1–5 μg pCT302 vector containing scTv insert in a volume of 50 μL. 8. Incubate cells at 42 °C for 1.5–2.5 h, gently vortexing occasionally to suspend pelleted cells. 9. After incubation, remove cells and spin at 16,000 × g for 1 min. 10. Aspirate supernatant and discard. 11. Spin an additional time at 16,000 × g for 1 min to remove any residual heat shock mixture and discard. 12. Suspend cells in 1 mL sterile ddH2O to wash. 13. Transfer 500 μL into a separate tube. 14. Pellet both tubes at 16,000 × g for 1 min. 15. Suspend one aliquot of yeast in 100 μL sterile ddH2O and plate entire volume on an SD-CAA plate. Grow at 30 °C for 36–48 h (until colonies visible). 16. Suspend the second aliquot in 3 mL SD-CAA media and grow at 30 °C for 24–48 h with shaking. Store at 4 °C once dense (see Note 5). 17. Once colonies are present on plates, expand 1–2 individual colonies each in 3 mL SD-CAA media in glass test tubes. Grow at 30 °C for approximately 48 h until dense (OD600 > 8.0).

T Cell Receptors

107

18. To confirm the correct sequence, 500 μL of the dense yeast culture should be lysed and DNA harvested using the Zymoprep II kit according to the manufacturer’s protocol (see Note 6). 19. Transform DH5α cells with 2.5 μL of DNA isolated from Zymoprep kit, and plate on LB/Amp plates. Grow overnight at 37 °C. 20. Grow a single colony from the LB/Amp plate in 3 mL liquid cultures with Amp (100 μg/mL) for 8–12 h. 21. Isolate and purify DNA using a miniprep kit and sequence DNA using either Splice 4L, T7, or YRS primers to confirm the correct identity of the plasmid. 22. Yeast cultures in SD-CAA media can be maintained in liquid culture at 4 °C for several months; however, it is recommended that they be freshly expanded within 1 week of use (e.g., by expanding 10–50 μL of dense yeast in 3 mL fresh SD-CAA media for 12–24 h). Frozen stocks of yeast cultures can also be snap frozen on dry ice and stored at −80 °C in 10 % DMSO indefinitely. 3.1.4 Standard Yeast Induction with SG media

EBY100 yeast containing the pCT302 plasmid are induced to express the scTv when transferred into galactose-minimal media. Here we describe a yeast induction procedure. 1. Determine the OD600 of the dense SD-CAA culture. An OD600 = 1 is equivalent to a concentration of approximately 1 × 107 cells/mL. 2. Yeast cells will be induced at a final concentration of 1 × 107 cells/mL. Determine the number of cells required for the volume of yeast being induced, typically 2 × 107, and transfer into sterile microfuge tubes (see Note 7). 3. Spin cells down at 1,800 × g for 3 min at 4 °C and suspend cells in 1 mL of cold SG-CAA media. 4. Repeat wash two additional times. 5. After last wash, suspend yeast to a final concentration of 1 × 107 cells/mL and transfer to a glass test tube. 6. Induce cultures for 48 h at 20 °C while shaking at 220 rpm. 7. Induced yeast can be stored at 4 °C for approximately 2 weeks.

3.1.5 Design and Selection of Yeast Libraries Generated by Error-Prone PCR

Because scTv fragments lack TCR constant regions that stabilize the TCR on the surface of the T cell, scTv constructs typically require mutations to generate a stabilized form to express on the surface of yeast. Typically the resultant mutations occur at the interface of the variable α and β domains, or now exposed region of the variable region that is normally buried by the constant region [13, 30–32, 36]. Recently, we showed that the use of the highly stable human Vα2 region enhances stabilization of the scTv on the surface of yeast and that the introduction of a serine substitution at

108

Sheena N. Smith et al.

the polymorphic residue 49 in Vα2 confers additionally stability [32]. We routinely introduce the F49S mutation into the Vα of our Vα2-containing scTv fragments during gene synthesis. Despite the increased stability conferred by the use of Vα2, further mutagenesis is often desirable in order to achieve higher surface expression. In this section we describe a method for creating a mutated scTv library by error-prone PCR, from which stabilized clones can be selected. Induced yeast are stained with a conformational-specific antibody that recognizes epitopes on the Vβ and/or the Vα chain, if available (see Note 8). Yeast cells that express the most stable scTv mutants are isolated by magnetic bead sorting and/or high-speed FACs. In order to eliminate TCR library variants that result from truncations through introduction of premature stop codons, c-myc-specific antibodies can be used to select for constructs expressing the full-length scTv if a C-terminal c-myc tag is added to the scTv construct. A flow chart for the selection of surface-stabilized scTvs is shown in Fig. 3. The following six sections describe error-prone library generation (Subheading 3.1.6), preparation of electrocompetent yeast (Subheading 3.1.7), staining yeast cells (Subheading 3.1.8), and both magnetic and FACS-based selections (Subheadings 3.1.9, 3.1.10, and 3.1.11). 3.1.6 Preparation of Error-Prone scTv PCR Insert and pCT302 Vector

Random mutagenesis of the scTv can be conducted by error-prone PCR, using Splice4L and T7 primers, which flank the scTv region of the gene. This method produces a 0.5 % error rate as described previously [44]. Error-prone scTv constructs along with NheI and XhoI digested pCT302 vector are simultaneously electroporated into EBY100 yeast. Overlap between digested pCT302 vector and error-prone PCR inserts allows the PCR products to be introduced into pCT302 by a process of homologous recombination. This method can generate yeast libraries in the range of 108–1010 independent mutants, using multiple electroporations. 1. For error-prone PCR, assemble 100 μL reactions in a PCR tube (see Note 9): (a) 220 μM dATP. (b) 200 μM dCTP. (c) 340 μM dGTP. (d) 2.4 mM dTTP. (e) 0.3 ng/μL template (scTv in pCT302 vector). (f) 250 nM Splice 4L primer (forward primer). (g) 250 nM T7 primer (reverse primer). (h) 5 ng/μL bovine serum albumin. (i) 3.325 mM MgCl2. (j) 0.5 mM MnCl2. (k) 1:10 dilution of 10× Taq Polymerase Reaction Buffer. (l) 1 μL Taq Polymerase.

T Cell Receptors

109

Clone Vα and Vβ TCR regions into pCT302 vector as scTv

Error-Prone PCR with Splice4L and T7 primers

Transform EBY100 Yeast with scTv errorprone library

Expand yeast in SD media and induce with SG media

Stain yeast for scTv surface expression (conformational epitope or c-myc)

Select yeast with higher scTv expression level by magnetic sorting or FACS

Repeat multiple times (2-5) until more positive population is isolated

Repeat if further stability is desired

Assess sorted library for surface expression

Isolate and characterize clones with increased surface levels

Identification of “stabilized” scTv

Fig. 3 Sample selection scheme for stabilized scTv fragment. This is a selection scheme that can yield surfacestabilized scTvs. Stabilized scTv constructs can be selected either by antibodies specific for conformational epitopes or by antibodies specific for the c-myc tag

2. Place PCR tubes in thermocycler and run the following protocol: (a) 95 °C for 1 min. (b) 25 cycles of: ●

95 °C for 1 min.

●

50 °C for 1 min.

●

72 °C for 3 min.

(c) 72 °C for 5 min. (d) 4 °C forever.

110

Sheena N. Smith et al.

3. Confirm amplification of the gene by running 10 μL of PCR product on a 1 % agarose gel to determine if correct scTv fragment amplified. For typical scTvs, the region between Splice4L and T7 is approximately 1.2 Kb. 4. Purify and concentrate PCR combined product with the Qiagen PCR Purification kit according to the manufacturer’s protocol. For Qiagen kits, spin columns hold a maximum of 10 μg of plasmid. Calculate the number of columns to use by approximating DNA concentration from the agarose gel ran in step 3 and elute each in >30 μL ddH2O. 5. In order to reduce background from the remaining template, digest the PCR reaction with DpnI according to the manufacturer’s protocol. 6. Perform an additional Qiagen PCR Purification as before and determine concentration. Because the scTv library will be introduced into pCT302 via homologous recombination, no further digest is required. 7. Meanwhile, digest pCT302 vector with NheI and XhoI restriction enzymes according to the manufacturer’s protocol. 8. Perform Qiagen PCR Purification according to the manufacturer’s protocol. For Qiagen kits, spin columns hold a maximum of 10 μg of plasmid. Calculate the number of columns to use by approximating DNA concentration from the agarose gel ran in step 3 and elute each in >30 μL ddH2O. 9. Run the entire volume of digested vector on a 1 % agarose gel and gel purify the band containing the digested pCT302 plasmid (typically ~5.7 Kb) using the Qiagen gel extraction kit according to the manufacturer’s protocol. It is recommended that the undigested pCT302 be ran on the same gel to distinguish digested from undigested DNA. 10. Mix 4 μg of error-prone mutagenized DNA insert and 1 μg of double-digested/gel-purified pCT302 in a 1.7 mL Eppendorf tube for each electroporation. Controls consisting of insert only and vector only should also be included to determine background (see Note 10). 11. Pellet DNA in 1.7 mL Eppendorf tube using Novagen Pellet Paint Co-Precipitant, according to the manufacturer’s protocol (see Note 11). Store pelleted DNA at −20 °C until ready for transformation into yeast. 3.1.7 Preparation of Electrocompetent Yeast

Once error-prone DNA and digested pCT302 have been obtained, yeast libraries are generated by electroporation. This protocol has been adapted and optimized from previous reported methods [22, 40, 41]: 1. Streak a YPD plate with EBY100 yeast, preferably from a frozen stock. Grow the yeast for 36–48 h at 30 °C until colonies are visible.

T Cell Receptors

111

2. Select an individual colony and transfer to 3 mL of YPD media to start a liquid culture. Grow liquid cultures for 6–12 h shaking at 220 rpm at 30 °C. 3. Expand liquid culture of EBY100 cells into 50 mL YPD culture in a 250 mL Erlenmeyer flask. Grow cultures overnight (12–16 h) at 30 °C with shaking. 4. The next morning, inoculate a prewarmed YPD liquid culture to an OD600 of 0.2 from overnight cultures. 50 mL of culture is required for each electroporation. Shake culture at 220 rpm at 30 °C (see Note 12). 5. Monitor OD600 hourly, until an OD600 of 1.5 is reached (approximately 6 h) (see Note 13). 6. Transfer 50 mL of culture into 50 mL conical tubes (e.g., ten total for a 500 mL culture). Pellet by spinning at 2,000 × g for 5 min and discard supernatants. 50 mL of culture (or one conical tube) will be used for each electroporation. From this step on, it is critical that all reagents and cells remain on ice for the duration of the procedure, except where indicated. 7. Wash cells in each conical tube in 25 mL cold sterile ddH2O, pellet cells by spinning at 2,000 × g for 5 min. Discard supernatant. 8. Wash cells in 25 mL of cold 1 M sorbitol/1 mM CaCl2, pellet cells by spinning at 2,000 × g for 5 min. Discard supernatant. 9. Suspend cells in 25 mL 0.1 M LiAc/10 mM DTT solution. Loosen caps to allow for aeration and secure lids with tape to maintain a sterile environment. Incubate cells at 30 °C while shaking at 220 rpm for 30 min. 10. Remove cells and place on ice. 11. Pellet cells at 2,000 × g for 5 min at 4 °C. 12. Remove supernatant and wash cells in 25 mL cold 1 M sorbitol/1 mM CaCl2 per tube. Pellet cells at 2,000 × g for 5 min. Discard supernatant. 13. Wash pelleted cells one time in 25 mL cold 1 M Sorbitol (No CaCl2). Pellet cells at 2,000 × g for 5 min at 4 °C. Discard supernatant. 14. Suspend cells in each conical tube in 1 M sorbitol (No CaCl2) to a final volume of 250 μL using repeat pipetting. 15. Suspend precipitated DNA from pellet paint (Subheading 3.1.6) in 10 μL of ddH2O. 16. Add 250 μL of EBY100 yeast cells to DNA. Mix well by pipetting and then transfer to a prechilled 2 mm electroporation cuvette. Let cuvettes incubate on ice for 5 min (see Note 14). 17. Using a BioRad Gene Pulser II Electroporation System, electroporate cells at 2.5 kV, 25 μF capacitance with a 0.2 cm gap cuvette. Typical time constant ranges are from 3.0 to 4.5 ms.

112

Sheena N. Smith et al.

18. Following pulse remove the cuvette and immediately add 1 mL of a 1:1 mixture of YPD media and 1 M sorbitol mixture to cells. Mix cells/YPD/Sorbitol mixture completely, and transfer contents of the cuvette into a sterile glass test tube. 19. Add an additional 1 mL of 1:1 mixture of YPD media and 1 M sorbitol to the cuvette and transfer to the glass tube to wash any residual cells in the cuvette. 20. Incubate electroporated yeast cells in glass test tubes at 30 °C for 1 h without shaking. 21. After 1 h incubation, gently vortex cells using the lowest setting on a benchtop vortex to suspend. 22. Transfer cells into conical tubes, combining electroporations from the same libraries into a single tube. 23. Pellet cells by spinning at 900 × g for 5 min and suspend in 10 mL SD-CAA. 24. Determine the library size by generating 1:100, 1:1,000, 1:10,000, 1:100,000, 1:1 × 106 dilutions from the 10 mL of cells in SD-CAA. For control electroporations, only plate undiluted cells. 25. Streak 10 μL of each dilution on SD-CAA plates and grow at 30 °C for 2–3 days until colonies are visible. The number of colonies on each plate corresponds to a total library size of 1 × 105, 1 × 106, 1 × 107, 1 × 108, and 1 × 109, respectively. To calculate diversity, average the library sizes calculated from the number of colonies for plates where colonies could be reliably counted. Background on controls should be minimal (i.e., less than 10 colonies), and the values should be subtracted from the diversity. 26. Transfer the remaining library from the 10 mL combined electroporations into 100 mL SD-CAA media for each electroporation (e.g., if eight electroporations are done, expand in 800 mL). Control electroporations can be discarded after plating. 27. Expand culture for 36–48 h at 30 °C, 220 rpm until saturation is reached (OD600 > 8.0). Pellet cultures in conical tubes in order to remove cellular debris by centrifuging at 2,000 × g for 5 min. 28. Decant supernatants and suspend sufficient cells to oversample the anticipated diversity in an SD-CAA to an OD600 of 1.0 and expand until dense (OD600 > 8.0) (see Note 15). 29. Yeast libraries in SD-CAA media can be maintained in liquid culture at 4 °C for several months; however, it is recommended that they be freshly expanded within 1 week of use. Frozen stocks of yeast cultures in 10 % DMSO can be snap frozen on dry ice and stored at −80 °C indefinitely. Sufficient aliquots should be made to oversample the library diversity calculated in step 24.

T Cell Receptors

113

30. The diversity of each library should be further assessed by isolating plasmids from at least ten individual colonies for each library and sequencing (protocol in steps 18–21 in Subheading 3.1.3; see Note 16). 3.1.8 Staining-Induced Yeast Cultures

Once an error-prone library has been made, it will be necessary to determine the initial staining profile with antibodies specific for conformational epitopes and c-myc. Here we describe the protocol to assess the staining profile of the library. 1. Induce the yeast library as described in Subheading 3.1.4. 2. Aliquot 50 μL of induced yeast to flow tubes and add 1 mL PBS/1 % BSA. 3. Spin tubes down at 1,800 × g and aspirate supernatant. 4. Suspend cells in 50 μL of primary antibody staining mixture (see Note 17). 5. Incubate cells on ice for 30–60 min. 6. Add 1 mL of PBS/1 % BSA, spin cells at 1,800 × g, and aspirate supernatant. 7. Suspend cells in 50 μL of secondary staining reagent staining mixture (see Note 18). 8. Incubate cells on ice for 30–45 min. 9. Add 1 mL of PBS/1 % BSA and spin cells at 1,800 × g for 3 min, aspirate supernatant. 10. Wash cells one additional time with 1 mL PBS/1 % BSA. 11. Suspend cells in 500 μL of PBS/1 % BSA. 12. Read cells using flow cytometer.

3.1.9 Selection of Stabilized scTvs from Error-Prone Library

In order to isolate scTv clones with enhanced stability on the surface of yeast, selections can be conducted using either magnetic cell sorting or fluorescence-activated cell sorting (FACS). Whereas FACS allows for more precise selection, it can be time-intensive and costly, especially when large libraries are selected. For this reason, our lab has found that magnetic cell sorting is both cost and time efficient for initial selections of stabilized scTv clones. Following 1–2 magnetic sorts, the diversity of the library is decreased and more precise sorts can be performed with FACS if desired. To isolate stabilized scTv clones, it is necessary to use an antibody specific for a conformational epitope. If truncations are noted from assessment of the staining profile of the library population as described in Subheading 3.1.8 at any step of the sort progression, selection can be conducted based on c-myc staining, which allows for the population to contain only full-length scTv fragments. The following two sections describe selection via magnetic beads (Subheading 3.1.10) and FACS (Subheading 3.1.11).

114

Sheena N. Smith et al.

3.1.10 Selection of Stabilized scTvs from Error-Prone Library Using Magnetic Cell Sorting

Here we describe a general magnetic sorting protocol that can be applied to use of either antibodies against Vα or Vβ conformational epitopes or the C-myc epitope tag. This magnetic protocol is adapted from Chao [40]. 1. Induce sufficient yeast cells in order to oversample the library diversity as described in Subheading 3.1.4 (see Note 19). 2. Determine the concentration of the cells postinduction by taking the OD600. An OD600 = 1 is equivalent to a concentration of approximately 1 × 107 cells/mL. 3. Determine the volume of cells needed to sample tenfold the library size for staining and selection. Pellet the required volume of yeast at 1,800 × g for 5 min in a 50 mL conical tube. 4. Aspirate supernatant and wash cells one time with 25 mL PBSM. 5. Spin cells down again at 1,800 × g for 5 min and aspirate supernatant. 6. Suspend cells in PBSM containing the appropriate amount of primary staining reagent (see Note 20). 7. Incubate at 4 °C with inversion or on ice with mild agitation every 10–15 min to keep cells in suspension for 1 h. 8. After incubation, suspend cells to a volume of 25 mL PBSM and spin at 1,800 × g for 5 min to wash. 9. Aspirate supernatant and suspend cells in 5 mL of PBSM buffer. Add 200 μL of Ig-linked microbeads to suspension and mix by inversion. 10. Incubate for 30–45 min with inversion or on ice with mild agitation every 10–15 min to keep cells in suspension. 11. Pellet cells at 1,800 × g for 5 min, aspirate supernatant, and suspend cells in 7 mL of PBSM buffer. 12. Meanwhile, place an LS column in the magnetic stand assembly and equilibrate with 3 mL cold PBSM buffer. Discard flow through. Apply the 7 mL of cells in PBSM media to the column. Cells that are bound to antibody remain stuck to the column. 13. Once cells have run through column, remove the LS column from the magnetic assembly and quickly reinsert column into magnetic assembly to allow beads to reorientate the column. 14. Wash column in the magnetic assembly with 10–20 mL of PBSM buffer to allow unbound cells trapped in the column to flow through. Discard flow through. 15. Remove column from magnetic stand assembly and elute cells by adding 7 mL of SD-CAA media and pushing cells into a collection tube using the provided plunger.

T Cell Receptors

115

16. Bring volume up to 10 mL and plate serial dilutions as done in steps 24 and 25 of Subheading 3.1.7 to determine the cells captured (see Note 21). 17. Expand the collected cells in 250 mL of SD-citrate-CAA media. 18. Expand culture for 24–48 h at 30 °C, shaking at 220 rpm until dense (OD600 > 8.0). 19. Induce cells and stain to assess surface expression of c-myc tag or conformational epitope according to protocols described in Subheadings 3.1.4 and 3.1.8. 20. If the desired surface expression level has not been achieved, another round of selection can be conducted using the same or different conformational epitope or c-myc antibody, either by another magnetic bead selection or by a FACS selection as described in the next section. 21. Once the library has been substantially enriched for stabilized scTv fragments, plate an aliquot on SD-CAA plates to isolate single colonies. 22. Pick approximately ten colonies, expand in SD-CAA media, and induce as described in Subheading 3.1.4. 23. Stain cultures as described in Subheading 3.1.8 and characterize individual colonies using flow cytometry to select for a highly stable variant(s). Sequences can be determined by harvesting plasmid and sequencing as described in steps 18–21 in Subheading 3.1.3. 24. Following expansion of yeast, frozen stocks of SD-CAA cultures can be snap frozen on dry ice and stored at −80 °C in 10 % DMSO indefinitely. 3.1.11 Selection of Stabilized scTvs from Error-Prone Library Using FACS

Sorting via FACS can provide selections of more precise cell populations. To sort error-prone libraries for stabilized scTv clones we describe the following protocol: 1. Induce sufficient yeast cells in order to oversample the current library diversity as described in Subheading 3.1.4. 2. Determine the concentration of the cells postinduction by taking the OD600. An OD600 = 1 is equivalent to approximately 1 × 107 cells/mL. 3. Determine the volume of cells needed to sample tenfold the current library size for staining and selection. Pellet the required volume of yeast at 1,800 × g for 3 min in a microfuge tube (see Note 22). 4. Aspirate supernatant and wash cells one time with 1 mL PBS/1%BSA.

116

Sheena N. Smith et al.

5. Spin cells down again at 1,800 × g for 3 min and aspirate supernatant. 6. Suspend cells in PBS/1 % BSA containing the appropriate amount of primary staining reagent (see Note 23). 7. Incubate on ice for 1 h. 8. After incubation, suspend cells to a volume of 1 mL PBS/1 % BSA and spin at 1,800 × g for 3 min to wash. 9. Suspend cells in a sufficient volume of fluorescently labeled secondary reagent and incubate for 30–45 min on ice. 10. Wash cells in 1 mL PBS/1 % BSA for a total of 2–3 washes. 11. Suspend cells to a concentration of 1 × 107 cells in PBS/1 % BSA. 12. Sort cells via FACS, sampling tenfold the current library diversity, and collect in a tube containing SD-CAA media (see Note 24). 13. Following sort, expand collected cells in 50 mL SD-CAA media and grow until dense (OD600 > 8.0). Depending on the number of cells collected, this can take anywhere from 1 to 3 days. 14. Induce and stain to assess surface expression of c-myc tag or conformational epitope according to protocols described in Subheadings 3.1.4 and 3.1.8. 15. If the desired surface expression level has not been achieved, another round of selection can be conducted using the same or different conformational epitope or c-myc antibody by FACS selection. 16. Once the library has been substantially enriched for stabilized scTv fragments, plate an aliquot on SD-CAA plates to isolate single colonies. 17. Pick approximately ten colonies, expand in SD-CAA media, and induce as described in Subheading 3.1.4. 18. Stain cultures as described in Subheading 3.1.8 and characterize individual colonies using flow cytometry to select for a highly stable variant(s). Sequences are determined by isolating plasmid and sequencing as described in steps 18–21 in Subheading 3.1.3. 19. Following expansion of yeast, frozen stocks of SD-CAA cultures can be snap frozen on dry ice and stored at −80 °C in 10 % DMSO indefinitely. 3.2 Peptide-MHC Ligands for Selection and Analysis of T Cell Receptors

A variety of soluble pepMHC ligands with different valencies can be utilized for selections or binding analyses of TCR clones and libraries on the surface of yeast. These reagents include expressed and refolded biotinylated pepMHC monomers, immunoglobulinlinked dimers, and streptavidin-conjugated tetramers (Fig. 4).

6.9 nM 20.6 nM 61.7 nM 185 nM 556 nM 1.66 μM 5 μM

2500 2000 MFI

MHC Monomer

Count

T Cell Receptors

117

EC50 = 210 nM

1500 1000 500 0

MART1/HLA.A2 Monomer Fluorescence

1 10 100 1000 10000 [MART1/HLA.A2 Monomer] (nM)

6000 MFI

MHC Dimer

Count

8000 6.9 nM 20.6 nM 61.7 nM 185 nM 556 nM

EC50 = 19 nM

4000 2000 0

MART1/HLA.A2 Dimer Fluorescence

1 10 100 1000 [MART1/HLA.A2 Dimer] (nM)

556 nM

1500 MFI

MHC Tetramer

Count

2000 20.6 nM 61.7 nM 6.9 nM 185 nM

EC50 = 18 nM

1000 500 0

MART1/HLA.A2 Tetramer Fluorescence

1 10 100 1000 [MART1/HLA.A2 Tetramer] (nM)

Fig. 4 Peptide-MHC ligands for the selection and analysis of T cell receptors. (Left panels) Schematics of pepMHC monomers, dimers, and tetramers are shown, where orange represents peptide, blue represents MHC heavy chain, and cyan represents MHC light chain. MHC monomers (top) are biotinylated and are used with a PE-conjugated SA secondary reagent to stain yeast-displayed TCRs. MHC dimers (middle) are fused to a mouse immunoglobulin and are used with a fluorophore-conjugated Goat anti-Mouse IgG secondary antibody to stain yeast-displayed TCRs. MHC tetramers (bottom) are directly bound to a PE-conjugated streptavidin molecule and can be used to stain yeast-displayed TCRs directly. (Center panels) Flow cytometry histograms showing the yeast staining profiles of the T1-S18.45 scTv, which binds to MART-1/HLA-A2, with the three pepMHC reagents at the indicated concentrations. The gray shaded curve represents yeast stained with secondary reagent only. (Right panels) Plots of the mean fluorescent intensity (MFI) obtained from the flow histograms at each concentration. EC50 values obtained from nonlinear regression analysis of the plots are shown in the inset

Multimeric pepMHC reagents, such as immunoglobulin-based dimers [45] and streptavidin-based tetramers [46], are able to increase the detection of weak TCR:pepMHC interactions through avidity effects (see Note 25). For TCRs with higher binding affinities, the use of monomeric reagents is preferred, as multivalent

118

Sheena N. Smith et al.

MHC reagents often do not distinguish between several fold changes in mean fluorescence intensity with affinities in the midlow nanomolar range [47]. Here we describe the generation of pepMHC reagents, and the use of such reagents to stain TCRs on the surface of yeast. Yeast library selection using these reagents is discussed later in Subheading 3.4.1. 3.2.1 Expression of Biotinylated PeptideMHC Ligands

In this section we describe the expression and purification of soluble HLA-A2 monomers. HLA-A2 monomers can be used directly to stain TCR on the surface of yeast utilizing fluorophoreconjugated streptavidin as a secondary reagent, or they can be preincubated with fluorophore-conjugated streptavidin to form tetramers as described in Subheading 3.2.9. HLA-A2 heavy chain and light chain are expressed separately as inclusion bodies, and refolded together in a 3:1 mass ratio along with a peptide of choice (Fig. 5a). The HLA-A2 heavy chain contains a biotinylation substrate peptide (bsp) sequence that allows for in vitro biotinylation. Refolded pepHLA-A2 monomers can be stored in aliquots at −80 °C for up to 12 months. The following four sections describe E. coli growth and induction (Subheading 3.2.2), isolation of inclusion bodies (Subheading 3.2.3), MHC refolds (Subheading 3.2.4), and MHC biotinylation and purification (Subheading 3.2.5). This protocol is adapted from [48, 49].

3.2.2 Growth and Induction of E. coli

1. Transform HLA-A2 heavy chain (with bsp tag) and HLA-A2 light chain (β2 microglobulin) into an E. coli strain optimized for protein expression, such as BL21(DE3), according to the manufacturer’s protocol and plate on LB plates containing 100 μg/mL ampicillin (see Note 26).

a Expression of MHC heavy and light chain

Isolation of Inclusion Bodies

MHC Refold with UV-peptide

MHC Purification & Biotinylation

UV peptide exchange

Tetramer formation with SA

MHC Monomers

MHC Tetramers

b

Fig. 5 Generation of peptide-MHC monomers and tetramers. (a) Flow chart for the preparation monomers and tetramers. (b) UV-cleavable HLA-A2-binding peptide containing an unnatural amino acid (orange) at position 8 which is cleaved on exposure of UV radiation, allowing for loading of other peptides

T Cell Receptors

119

2. Inoculate single colonies of HLA-A2 heavy and light chain into 3 mL LB cultures with 100 μg/mL ampicillin and grow for 4–8 h at 37 °C with rapid shaking to ensure adequate aeration. 3. Expand 3 mL cultures into 250 mL LB cultures with 100 μg/ mL ampicillin and grow 8–12 h at 37 °C with rapid shaking to ensure adequate aeration. 4. Subculture into 6 × 6 L flasks each containing 1.5 L prewarmed LB media each (total of 9 L) with 100 μg/mL ampicillin to an OD600 of 0.1. 5. Grow cells to an OD600 of approximately 1.0. It is recommended to take a 1 mL sample of the culture at this stage for characterization preinduction on an SDS-PAGE gel. 6. To induce expression, add IPTG to a final concentration of 0.7–1.0 mM. 7. Induce for 2–4 h at 37 °C. 8. Following induction, it is recommended to take a second 1 mL sample of the induced culture. Cells from both samples, preinduction and postinduction, can be pelleted in a microfuge for 5 min, suspended in SDS sample loading buffer, and ran on an SDS-PAGE gel to verify protein expression (i.e., a prominent band at about 36 kDa for HLA-A2 heavy chain or 12 kDa for HLA-A2 light chain in the postinduction samples compared to the preinduction sample). 9. Harvest E. coli by spinning in a centrifuge at 4,200 × g at 4 °C, keeping cell pellets on ice from this point onward. Growth can be slowed by transfer of flasks to 4 °C when multiple centrifuge runs are required. 3.2.3 Isolation of Inclusion Bodies

1. Suspend pelleted cells from entire 9 L preparation in 100 mL ice-cold lysis buffer. If desired, suspended cells can be left in lysis buffer on ice overnight. 2. Filter the suspended cells through a coarse filter, such as a tea strainer prior to microfluidization (see Note 27). 3. Prime the microfluidizer in osmotic shock buffer with triton prior to use. 4. Pass cell solution in lysis buffer through the microfluidizer 3–5 times until the consistency is like that of water. 5. Centrifuge lysed cell suspension at 11,000 × g at 4 °C for 30–60 min to pellet inclusion bodies. 6. Discard supernatant and fully suspend pellet in 40 mL osmotic shock buffer with triton to wash (see Note 28). 7. Centrifuge at 11,000 × g at 4 °C for 30 min. 8. Discard supernatant and repeat wash three more times, once more with osmotic shock buffer with triton followed by two times with osmotic shock buffer without triton.

120

Sheena N. Smith et al.

9. Following the fourth wash, pellets should be white. If the pellets still appear brown, perform additional washes. 10. Suspend inclusion bodies in 10 mL urea extraction buffer and incubate at room temperature with rotation for 1–2 h. For heavy chain extractions, we find that guanidine extraction buffer has higher yields. 11. Centrifuge at 11,000 × g at 4 °C for 45 min to remove any insoluble matter. Retain supernatant. 12. Perform a BCA assay or other protein quantification assay to determine protein concentration of the supernatant. 13. Aliquot 10 mg of protein into microfuge tubes. 14. Snap freeze tubes on dry ice and store at −80 °C. 3.2.4 MHC Refold

1. Chill 200 mL refold buffer to 4 °C. Keep refold mixture at 4 °C and stirring at all times. 2. Dissolve 62 mg oxidized glutathione and 308 mg reduced glutathione in a small volume of ddH2O (30 μL ddH2O. 7. Set up ten or more identical SOE PCR reactions in PCR tubes as follows: (a) 80.5 μL ddH2O. (b) 2.5 μL 10 mM dNTP. (c) 10 μL Pfu 10× Buffer. (d) 2 μL 10 mM Splice4L primer. (e) 2 μL 10 mM T7 primer. (f) 1 μL 5′ Pre-SOE #1 (100 ng/μL). (g) 1 μL 3′ Pre-SOE #2 (100 ng/μL). (h) 1 μL PfuTurbo polymerase. 8. Place PCR tubes in thermocycler and run the following program: (a) 95 °C for 1 min. (b) 5 cycles of: ●

95 °C for 1 min.

●

55–65 °C for 1 min.

●

72 °C for 3 min.

(c) 25 cycles of: ●

95 °C for 1 min.

●

50–60 °C for 1 min.

●

72 °C for 3 min.

(d) 72 °C for 5 min. (e) 4 °C forever. 9. Confirm that the SOE PCR products are the correct size (~1.2 Kb for standard scTv fragments) by running a small amount of each reaction on a 1 % agarose gel. 10. Combine successful SOE reactions into the same tube. 11. Purify and concentrate PCR combined product with the Qiagen PCR Purification kit according to the manufacturer’s protocol as in step 6. 12. Run entire samples on a 1 % agarose gel and gel purify the band containing the scTv library with a Qiagen gel extraction kit. 13. Assess the purity of gel-purified product by running a small volume of eluted SOE on a 1 % agarose gel (see Note 36). 14. Store PCR products at −20 °C until ready to pellet DNA with digested pCT302 prior to electroporation.

130

Sheena N. Smith et al.

3.4.3 Generation of Affinity Maturation Libraries

In order to generate scTv site-directed mutagenesis libraries, 4 μg of SOE products is precipitated with 1 μg digested pCT302 vector as described in steps 7–11 of Subheading 3.1.6. The same library protocol used to generate error-prone libraries as described in Subheading 3.1.7 is used this time with the SOE product instead of error-prone PCR product. If multiple libraries containing different degenerate regions will be combined for selections, we recommend performing separate electroporations and pooling the libraries according to the diversities determined by limiting dilutions after libraries have been expanded (see Note 37).

3.4.4 Selection of scTvs with Improved Affinities to Peptide-MHC

As performed with error-prone libraries to select for clones with improved stability (as described in Subheading 3.1.5), magnetic bead selections or FACS can be used to select mutants from scTv CDR libraries that bind with improved affinity to pepMHC. In order to assess the initial library population, staining should be performed with antibodies that recognize conformational epitopes of the Vα and/or Vβ chains (Subheading 3.1.8). If significant loss in binding occurs, we recommend performing a single magnetic bead selection using this antibody as was done in Subheading 3.1.10 to eliminate scTv variants which may no longer fold correctly due to destabilizing mutations in CDR loops. In addition selection can be performed with the anti-c-myc antibody to eliminate truncated variants initially or at any stage of the directed evolution process. Once the library has been excluded of misfolded and/or truncated scTv clones, selections with pepMHC reagents are performed. Typically, in order to assess the library for binding to pepMHC, a small aliquot of the library is induced and titrated with a variety of concentrations of a pepMHC reagent as in Subheading 3.3.1 at each step to determine selection criteria. In initial libraries prior to selection we often see little to no staining and recommend the use of 1–2 magnetic bead selections using higher concentrations of primary pepMHC reagents (see Note 38). Following 1–2 magnetic selections, a positively staining population usually emerges to which more stringent selections can be applied (i.e., staining with low concentrations of pepMHC reagents as described in Subheading 3.2). We recommend the use of a variety of pepMHC and secondary reagents in order to decrease the risk of isolation of nonspecific clones (see Note 39). In general we perform a total of 3–7 selections to isolate scTvs with low nanomolar affinities (see Note 40). A general selection workflow is shown in Fig. 7. Following isolation of clones that bind with improved affinity to the cognate pepMHC, additional libraries can be generated in other CDR regions using the improved scTv as a template for further library generation and selection. Stabilized and high-affinity scTvs can be expressed and refolded at high levels in E. coli and used as soluble reagents. Although not the focus of this review, this protocol has been recently described in detail in [22].

T Cell Receptors

131

Stabilized scTv template (Affinity ~1-100 μM)

Generation of site-directed CDR libraries

Increasing stringency is used for each progressive sort Magnetic bead selection

Transform library into yeast and conduct initial titration Repeat if higher affinity is desired

Selection with a Vα , Vβ, or cmyc antibody to remove misfolded or truncated variants (optional) Selection of library with pepMHC reagents

Isolate and characterize improved affinity clones

Expand, induce, titrate

Repeat (1-3 times)

Sort for highaffinity binders by FACS Repeat (3-5 times) Expand, induce, titrate

Fig. 7 Schematic of an example of the method for selecting higher affinity scTv fragments. Depicted is a general workflow for isolated high-affinity scTv fragments from CDR libraries. Initial searches are conducted via magnetic cell sorting or by using high-avidity reagents such as pepMHC tetramers or dimers. Final searches can be conducted via FACS with more stringent selection conditions, such as pepMHC monomers

3.4.5 Single-Codon Libraries and Deep Sequencing Approaches to Select T Cell Receptor Mutants with Desired Affinities

Although TCRs engineered by yeast display as described can yield KD values in the low nanomolar range, some applications of TCR engineering only require modest improvements from the wild-type TCR binding affinity. In the case of adoptive T cell therapies a strategy is to engineer TCRs just above the threshold where they are independent of the CD8 co-receptor (KD values 20,000 total sequences per 1/16th of a chip. Typically, a sample of at least 20 μL with a DNA concentration of at least 5 ng/μL is desired. 12. Dilute samples to 1 × 106 molecules/μL for sequencing. 13. In order to determine the sequences of the amplicon pool, emulsion-based clonal amplification and sequencing is performed on a Roche/454 Genome Sequencer FLX+ system for 400 flow cycles according to the manufacturer’s instructions. The library is sequenced on designated regions of a 70 × 75 PicoTiter Plate with the Roche XL+ sequencing kit, and signal processing and base calling are performed using the bundled 454 Data Analysis Software.

134

Sheena N. Smith et al.

14. Group the resulting sequences according to MID sequence for each library to be analyzed individually. 15. Align the gene sequences within each library and focus on the region of interest (i.e., the single degenerate codon region). Translate into amino acid sequences, and count the number of sequences with each amino acid (or stop codon) at the degenerate position. For this analysis we use BioPerl software for alignment and tabulate the raw output with a simple R script that counts the number of sequences for each amino acid at the degenerate position for each library and selection scheme. 16. Determine the frequency of each amino acid pre- and postselection by dividing the count for each amino acid (or stop codon) by the total number of sequences in the analysis. 17. Selection can be represented as the logarithm of the frequency of a particular amino acid or stop codon postselection divided by the frequency preselection and plotted on a bar graph as in Fig. 8.

4

Notes 1. We recommend avoiding EcoRI, NotI, and additional XhoI restriction sites in the codon optimization in order to facilitate cloning into pET expression vectors if expression of scTvs may be desired later on (reviewed previously in [22]). 2. Alternatively, PCR primers can be designed to amplify the scTv gene. PCR products should be digested with DpnI to remove the E. coli derived template plasmid (which is methylated), then double digested with both NheI and XhoI or BglII according to the manufacturer’s protocol. Following digestion, digest PCR products should be purified via Qiagen PCR Purification Kit prior to ligation into pCT302. 3. We find that optimal ligation conditions include 25–100 ng of digested pCT302 with a 1:3 or 1:6 molar ratio of digested insert and overnight incubation at 16 °C. Controls should include digested scTv and digested pCT302 only to determine background. 4. Although freshly grown EBY100 yeast are optimal, expanded EBY100 yeast stored at 4 °C in YPD liquid culture can be used up to 1 month for transformations. 5. If yeast grown on plates following transformation do not yield colonies, the expanded SD-CAA liquid cultures can be used to streak additional plates. 6. Because the purity of the DNA isolated from yeast is often low, the plasmid should be amplified in E. coli prior to sequencing. As an alternative, yeast colony PCR can be used to determine the sequence of the inserted plasmid; however, we typically find that it is beneficial to rescue the pCT302 plasmid

T Cell Receptors

135

in cases where library mutants are being assessed in order to minimize cloning at future steps. 7. For inductions for general staining of yeast, typically 2 mL cultures are made for induction (containing 2 × 107 cells total) in glass test tubes. When larger libraries are induced, typically enough cells to cover the diversity of the library at least tenfold are induced in 250–500 mL Erlenmeyer flasks. For smaller cultures, washes are done routinely in 1.7 mL microfuge tubes with 1 mL SG-CAA media. For larger inductions done in 15 mL or 50 mL conical tubes, 5 mL and 25 mL washes, respectively, should be done. 8. Antibodies specific for TCR Vα and Vβ are widely commercially available (e.g., Beckman Coulter, BD Pharmingen, Thermo Scientific). To determine whether an antibody recognizes a conformational epitope, prior to staining, incubate induced yeast at a series of different temperatures (from 4 to 80 °C) for 30 min. Conformational epitopes will show a decrease in binding when incubated at elevated temperatures due to irreversible denaturation of the scTv [57]. Staining of yeast with antibodies that bind to linear epitopes will show maintained (or increased) binding even at elevated temperatures. 9. In order to assure sufficient PCR product is formed, it is recommended to do several 100 μL PCR reactions simultaneously (typically 4–8). Reactions can be combined for future steps. 10. Typically, each electroporation (requiring 4 μg insert, 1 μg vector, and 50 mL of yeast) will yield 1 × 107–1 × 108 transformants. Routinely we generate libraries with eight electroporations, yielding libraries around 1 × 108–1 × 109 in size. If a library of 1 × 109 is required, we recommend doing no fewer than 20 electroporations. 11. Allow the pellet to dry for 20–30 min. To confirm that the pellet is dry, the 1.7 Eppendorf tube can be tapped on bench top. If the pellet is fully dried, it will dislodge from the bottom of the tube. 12. For example, if eight electroporations are being performed for a library with two controls, a 500 mL culture of yeast in a 2 L Erlenmeyer flask should be grown. For cultures greater than 500 mL, multiple flasks should be used to ensure adequate aeration. 13. The doubling time of EBY100 yeast is 1.5–2 h. 14. Be sure to not touch the metal sides of the cuvettes as it decreases the electroporation efficiency. We also recommend wiping the metal sides of the cuvette with kimwipe immediately prior to electroporation. 15. For example, if the calculated library size is 1 × 108, we recommend expanding no less than 1 × 109 cells.

136

Sheena N. Smith et al.

16. If the sequences of wild type or the same mutants occur multiple times, it is recommended to repeat error-prone PCR and library generation. For future attempts, the amount of template DNA for error-prone PCR can be decreased and the DpnI digest of product performed for a longer time. 17. We recommend diluting anti-HA antibody 1:50 in PBS/1 % BSA and anti-c-myc 1:50 in PBS/1 % BSA. For antibodies for the specific Vα and Vβ domains, we recommend using several concentrations initially to determine the optimal staining concentration. 18. For the anti-HA antibody (Covance), we recommend the use of Alexa Fluor 647 F(ab′)2 Fragment of Goat anti-Mouse IgG (H + L) (Molecular Probes) at a 1:100 dilution. For the c-myc antibody, we recommend the use of Alexa Fluor 647 Goat antiChicken IgG (H + L) (Molecular Probes) at a 1:100 dilution. 19. For example, if the diversity of the library is 1 × 108, we recommend inducing no less than 1 × 109 cells (i.e., 100 mL of culture at 1 × 107). 20. For large amounts of yeast (e.g., 1 × 108–1 × 109 cells), it is necessary to stain in a volume to maintain cell suspension (from 0.5 to 1.0 mL of primary reagent) and ensure the staining reagent is not depleted (approximate 10,000–100,000 of scTv fragments displayed on each yeast cell). 21. By determining the number of cells captured, the approximate percentage of cells selected from the total library can be used to determine the approximate new diversity. For example, if 10 % of total cells are captured in a library with a size of 1 × 108, the new diversity can be estimated to be 1 × 107 following the selection. 22. Typically we perform FACS selections for libraries that have diversities of 1 × 107 or less. If the diversity is higher, we recommend the use of magnetic bead selections to decrease the library size prior to FACS. If FACS is used for libraries of >1 × 107, the volume of reagents and washes must be increased to account for the greater cell number. 23. Typically 100 μL volumes are sufficient for libraries 70 % purity) without additional purification. We do not see significant binding differences when purified peptides are used. 30. It is recommended to retain 20 μL of refolded HLA-A2 as a prebiotinylated sample for SDS-PAGE. 31. We find it is beneficial to spike in excess peptide into staining mixtures in order to shift the equilibrium of MHC to peptidebound form, especially in cases where the peptide may be a weak MHC binder. 32. The theoretical diversity of libraries derived from NNS or NNK libraries can be determined by (4 × 4 × 2)X, where X is the number of degenerate codons. Typically libraries are made degenerate in up to 5 codons, such that the theoretical library size of (4 × 4 × 2)5, or 3.4 × 107, can easily be achieved with the yeast library protocol described in Subheading 3.1.7. 33. When creating SOE primers, it is necessary to have sufficient overlap between primers so Pre-SOE #1 and Pre-SOE #2 can bind to and extend off one another. We usually use SOE primers that contain 25–35 nucleotides of overlap depending on the GC content. Primers ideally will have similar melting temperatures to Splice4L and T7 primers (approx. 60 °C). In addition to having an overlap, we generally design the PreSOE #1 reverse primer to include an additional 25–35 nucleotides upstream to the overlap, and the Pre-SOE #2 primer to include an additional 25–35 nucleotides downstream to the degenerate residues. 34. We find that preforming four rounds of PCR at a higher annealing temperature allows for better fidelity in future cycles. For our standard protocol, the first four cycles are at an annealing temperature of 60 °C and the following 24 cycles are at 55 °C; however, one should consider the melting temperature of the primers designed in step 1 when choosing an appropriate annealing temperature. 35. If the standard PCR protocol has low or no yield, we recommend trying a lower annealing temperature to amplify PreSOE DNA. If bands appear as smears, PCR reactions should be repeated at a higher annealing temperature to increase

138

Sheena N. Smith et al.

fidelity. If the correct PCR product band is seen but there are extra bands present on the agarose gel (e.g., due to primer dimerization), Pre-SOEs can be alternatively gel purified using the Qiagen Gel Purification kit prior to SOE PCR. 36. The band containing the scTv gene should not contain a smear. If a smear appears, try repeating SOE reactions at an elevated annealing temperature. 37. Alternatively, SOE PCR products of libraries can be combined in equimolar ratios prior to homologous recombination; however, this does not allow for precise calculation of the representation of each library in the final population. 38. For example, 5 μM or greater concentrations of monomeric pepMHC (Subheading 3.2.7) used with either SA- or antibiotin-conjugated beads, or 100 nM or greater concentrations of dimeric pepMHC with anti-Mouse IgG-conjugated beads (Subheading 3.2.8). 39. Sometimes when consecutive selections are performed with the same secondary reagents, we isolate clones that bind nonspecifically to the secondary reagent (e.g., SA-PE, Goat antiMouse IgG). We recommend switching secondary reagents every selection in order to minimize the isolation of nonspecific binders. For example, if conducting two magnetic sorts with a biotinylated primary reagent, we recommend switching between streptavidin and anti-biotin microbeads. 40. Generally the number of selections that can be performed relies on the diversity of library. Following each selection, the new diversity of the library can be roughly estimated by the percent capture (i.e., for magnetic selections) or percent sorted (i.e., for FACS selections). Once the estimated diversity is on the order of 1–10, individual clones should be isolated and sequenced to determine whether sufficient diversity is present to warrant further sorting. 41. It is important to have fairly pure, homogenously sized PCR product prior to sequencing. Any remaining primer in the mix will significantly impede sequencing results.

Acknowledgments This work was supported by various NIH grants over the years (DMK), including current NIH grants P01 CA097296 (DMK), T32 GM070421 (SNS), and F30 CA180723 (DTH), and a grant from the Melanoma Research Alliance (DMK). We thank Dane Wittrup for helpful discussions, and past and current members of the Kranz lab.

T Cell Receptors

139

References 1. Davis MM, Boniface JJ, Reich Z et al (1998) Ligand recognition by alpha beta T cell receptors. Annu Rev Immunol 16:523–544 2. Davis MM, Krogsgaard M, Huppa JB et al (2003) Dynamics of cell surface molecules during T cell recognition. Annu Rev Biochem 72:717–742 3. van der Merwe PA, Davis SJ (2003) Molecular interactions mediating T cell antigen recognition. Annu Rev Immunol 21:659–684 4. Davis MM, Krogsgaard M, Huse M et al (2007) T cells as a self-referential, sensory organ. Annu Rev Immunol 25:681–695. doi:10.1146/ annurev.immunol.24.021605.090600 5. Garcia KC, Teyton L, Wilson IA (1999) Structural basis of T cell recognition. Annu Rev Immunol 17:369–397 6. Marrack P, Scott-Browne JP, Dai S et al (2008) Evolutionarily conserved amino acids that control TCR-MHC interaction. Annu Rev Immunol 26:171–203 7. Van Laethem F, Tikhonova AN, Pobezinsky LA et al (2013) Lck availability during thymic selection determines the recognition specificity of the T cell repertoire. Cell 154:1326–1341. doi:10.1016/j.cell.2013.08.009, S0092-8674(13)01003-9 [pii] 8. Li Y, Yin Y, Mariuzza RA (2013) Structural and biophysical insights into the role of CD4 and CD8 in T cell activation. Front Immunol 4:206. doi:10.3389/fimmu.2013.00206 9. Garcia KC, Adams JJ, Feng D et al (2009) The molecular basis of TCR germline bias for MHC is surprisingly simple. Nat Immunol 10:143– 147. doi:10.1038/ni.f.219, ni.f.219 [pii] 10. Kranz DM (2009) Two mechanisms that account for major histocompatibility complex restriction of T cells. F1000 Biol Rep 1:55–58 11. Holler PD, Holman PO, Shusta EV et al (2000) In vitro evolution of a T cell receptor with high affinity for peptide/MHC. Proc Natl Acad Sci U S A 97:5387–5392 12. Holler PD, Chlewicki LK, Kranz DM (2003) TCRs with high affinity for foreign pMHC show self-reactivity. Nat Immunol 4:55–62 13. Weber KS, Donermeyer DL, Allen PM et al (2005) Class II-restricted T cell receptor engineered in vitro for higher affinity retains peptide specificity and function. Proc Natl Acad Sci U S A 102:19033–19038 14. Li Y, Moysey R, Molloy PE et al (2005) Directed evolution of human T-cell receptors with picomolar affinities by phage display. Nat Biotechnol 23:349–354

15. Liddy N, Bossi G, Adams KJ et al (2012) Monoclonal TCR-redirected tumor cell killing. Nat Med 18:980–987. doi:10.1038/ nm.2764, nm.2764 [pii] 16. Chames P, Willemsen RA, Rojas G et al (2002) TCR-like human antibodies expressed on human CTLs mediate antibody affinitydependent cytolytic activity. J Immunol 169:1110–1118 17. Cohen CJ, Sarig O, Yamano Y et al (2003) Direct phenotypic analysis of human MHC class I antigen presentation: visualization, quantitation, and in situ detection of human viral epitopes using peptide-specific, MHCrestricted human recombinant antibodies. J Immunol 170:4349–4361 18. Denkberg G, Stronge VS, Zahavi E et al (2008) Phage display-derived recombinant antibodies with TCR-like specificity against alpha-galactosylceramide and its analogues in complex with human CD1d molecules. Eur J Immunol 38:829–840. doi:10.1002/ eji.200737518 19. Verma B, Neethling FA, Caseltine S et al (2010) TCR mimic monoclonal antibody targets a specific peptide/HLA class I complex and significantly impedes tumor growth in vivo using breast cancer models. J Immunol 184:2156–2165. doi:10.4049/jimmunol.0902414, jimmunol.0902414 [pii] 20. Mareeva T, Martinez-Hackert E, Sykulev Y (2008) How a T cell receptor-like antibody recognizes major histocompatibility complexbound peptide. J Biol Chem 283:29053–29059. doi:10.1074/jbc.M804996200, M804996200 [pii] 21. Richman SA, Kranz DM (2007) Display, engineering, and applications of antigen-specific T cell receptors. Biomol Eng 24:361–373 22. Stone JD, Chervin AS, Aggen DH et al (2012) T cell receptor engineering. Methods Enzymol 503:189–222.doi:10.1016/B978-0-12-3969620.00008-2, B978-0-12-396962-0.00008-2 [pii] 23. Oates J, Jakobsen BK (2013) ImmTACs: novel bi-specific agents for targeted cancer therapy. Oncoimmunology 2:e22891. doi:10.4161/ onci.22891, 2012ONCOIMM0357 [pii] 24. Stone JD, Yin Y, Mo M et al (2012) Engineering high-affinity T cell receptor/ cytokine fusions for therapeutic targeting. In Kaumaya P (ed) Protein engineering, ISBN: 978-953-51-0037-9, InTech 25. Stone JD, Chervin AS, Schreiber H et al (2012) Design and characterization of a protein superagonist of IL-15 fused with IL-15Ralpha and a

140

26.

27.

28.

29.

30.

31.

32.

33.

34.

35.

36.

Sheena N. Smith et al. high-affinity T cell receptor. Biotechnol Prog 28:1588–1597. doi:10.1002/btpr.1631 Soto CM, Stone JD, Chervin AS et al (2013) MHC-class I-restricted CD4 T cells: a nanomolar affinity TCR has improved anti-tumor efficacy in vivo compared to the micromolar wild-type TCR. Cancer Immunol Immunother 62:359–369. doi:10.1007/s00262-012-1336-z Stone JD, Kranz DM (2013) Role of T cell receptor affinity in the efficacy and specificity of adoptive T cell therapies. Front Immunol 4:244. doi:10.3389/fimmu.2013.00244 Zhao Y, Bennett AD, Zheng Z et al (2007) High-affinity TCRs generated by phage display provide CD4+ T cells with the ability to recognize and kill tumor cell lines. J Immunol 179:5845–5854 Chervin AS, Stone JD, Holler PD et al (2009) The impact of TCR-binding properties and antigen presentation format on T cell responsiveness. J Immunol 183:1166–1178. jimmudoi:10.4049/jimmunol.0900054, nol.0900054 [pii] Kieke MC, Shusta EV, Boder ET et al (1999) Selection of functional T cell receptor mutants from a yeast surface- display library. Proc Natl Acad Sci U S A 96:5651–5656 Richman SA, Aggen DH, Dossett ML et al (2009) Structural features of T cell receptor variable regions that enhance domain stability and enable expression as single-chain ValphaVbeta fragments. Mol Immunol 46:902– 916.doi:10.1016/j.molimm.2008.09.021,S01615890(08)00665-2 [pii] Aggen DH, Chervin AS, Insaidoo FK et al (2011) Identification and engineering of human variable regions that allow expression of stable single-chain T cell receptors. Protein Eng Des Sel 24:361–372 Smith SN, Sommermeyer D, Piepenbrink KH et al (2013) Plasticity in the contribution of T cell receptor variable region residues to binding of peptide-HLA-A2 complexes. J Mol Biol. doi:10.1016/j.jmb.2013.08.007, S0022-2836(13)00510-X [pii] Boder ET, Wittrup KD (1997) Yeast surface display for screening combinatorial polypeptide libraries. Nat Biotechnol 15:553–557 Shusta EV, Kieke MC, Parke E et al (1999) Yeast polypeptide fusion surface display levels predict thermal stability and soluble secretion efficiency. J Mol Biol 292:949–956 Shusta EV, Holler PD, Kieke MC et al (2000) Directed evolution of a stable scaffold for T-cell receptor engineering. Nat Biotechnol 18:754–759

37. Boder ET, Wittrup KD (2000) Yeast surface display for directed evolution of protein expression, affinity, and stability. Methods Enzymol 328:430–444 38. Feldhaus M, Siegel R, Opresko L et al (2003) Flow-cytometric isolation of human antibodies from a nonimmune Saccharomyces cerevisiae surface display library. Nat Biotechnol 21: 163–170 39. Gai SA, Wittrup KD (2007) Yeast surface display for protein engineering and characterization. Curr Opin Struct Biol 17:467–473. S0959doi:10.1016/j.sbi.2007.08.012, 440X(07)00119-4 [pii] 40. Chao G, Lau WL, Hackel BJ et al (2006) Isolating and engineering human antibodies using yeast surface display. Nat Protoc 1: 755–768. doi:10.1038/nprot.2006.94, nprot. 2006.94 [pii] 41. Benatuil L, Perez JM, Belk J et al (2010) An improved yeast transformation method for the generation of very large human antibody libraries. Protein Eng Des Sel 23:155–159. doi:10.1093/protein/gzq002, gzq002 [pii] 42. Soo Hoo WF, Lacy MJ, Denzin LK et al (1992) Characterization of a single-chain T cell receptor expressed in E. coli. Proc Natl Acad Sci 89:4759–4763 43. Gietz RD, Schiestl RH, Willems A et al (1995) Studies on the transformation of intact yeast cells by the LiAc/SS-DNA/PEG procedure. Yeast 11:355–360 44. Richman SA, Kranz DM, Stone JD (2009) Biosensor detection systems: engineering stable, high-affinity bioreceptors by yeast surface display. Methods Mol Biol 504:323–350. doi:10.1007/978-1-60327-569-9_19 45. Dal Porto J, Johansen TE, Catipovic B et al (1993) A soluble divalent class I major histocompatibility complex molecule inhibits alloreactive T cells at nanomolar concentrations. Proc Natl Acad Sci U S A 90:6671–6675 46. Altman JD, Moss PAH, Goulder PJR et al (1996) Phenotypic analysis of antigen-specific T lymphocytes. Science 274:94–96 47. Stone JD, Artyomov MN, Chervin AS et al (2011) Interaction of streptavidin-based peptide-MHC oligomers (tetramers) with cellsurface TCRs. J Immunol 187:6281–6290. doi:10.4049/jimmunol.1101734, jimmunol.1101734 [pii] 48. Garboczi DN, Ghosh P, Utz U et al (1996) Structure of the complex between human T-cell receptor, viral peptide and HLA-A2. Nature 384:134–141

T Cell Receptors 49. Garboczi DN, Utz U, Ghosh P et al (1996) Assembly, specific binding, and crystallization of a human TCR-alphabeta with an antigenic Tax peptide from human T lymphotropic virus type 1 and the class I MHC molecule HLAA2. J Immunol 157:5403–5410 50. Toebes M, Coccoris M, Bins A et al (2006) Design and use of conditional MHC class I ligands. Nat Med 12:246–251. doi:10.1038/ nm1360, nm1360 [pii] 51. Stone JD, Chervin AS, Kranz DM (2009) T-cell receptor binding affinities and kinetics: impact on T-cell activity and specificity. Immunology 126:165–176. doi:10.1111/ j.1365-2567.2008.03015.x, IMM3015 [pii] 52. Rudolph MG, Stanfield RL, Wilson IA (2006) How TCRs bind MHCs, peptides, and coreceptors. Annu Rev Immunol 24: 419–466 53. Chlewicki LK, Holler PD, Monti BC et al (2005) High-affinity, peptide-specific T cell receptors

54.

55.

56.

57.

141

can be generated by mutations in CDR1, CDR2 or CDR3. J Mol Biol 346:223–239 Dunn SM, Rizkallah PJ, Baston E et al (2006) Directed evolution of human T cell receptor CDR2 residues by phage display dramatically enhances affinity for cognate peptide-MHC without increasing apparent cross-reactivity. Protein Sci 15:710–721 Horton RM, Cai ZL, Ho SN et al (1990) Gene splicing by overlap extension: tailormade genes using the polymerase chain reaction. Biotechniques 8:528–535 Chervin AS, Stone JD, Soto CM et al (2013) Design of T-cell receptor libraries with diverse binding properties to examine adoptive T-cell responses. Gene Ther 20(6):634–644. doi: 10.1038/gt.2012.80 Orr BA, Carr LM, Wittrup KD et al (2003) Rapid method for measuring ScFv thermal stability by yeast surface display. Biotechnol Prog 19:631–638

Chapter 7 Epitope-Specific Binder Design by Yeast Surface Display Jasdeep K. Mann and Sheldon Park Abstract Yeast surface display is commonly used to engineer affinity and design novel molecular interaction. By alternating positive and negative selections, yeast display can be used to engineer binders that specifically interact with the target protein at a defined site. Epitope-specific binders can be useful as inhibitors if they bind the target molecule at functionally important sites. Therefore, an efficient method of engineering epitope specificity should help with the engineering of inhibitors. We describe the use of yeast surface display to design single domain monobodies that bind and inhibit the activity of the kinase Erk-2 by targeting a conserved surface patch involved in protein–protein interaction. The designed binders can be used to disrupt signaling in the cell and investigate Erk-2 function in vivo. The described protocol is general and can be used to design epitope-specific binders of an arbitrary protein. Key words Yeast surface display, Epitope-specific interaction, Monobody, Negative design, Assay development

1

Introduction Yeast surface display (YSD) is a versatile protein engineering tool and has been used to engineer various molecular properties, including stability, affinity, binding kinetics, and catalysis [1–3]. Key advantages of yeast display compared to other display platforms, especially phage display, include (1) improved folding of synthesized proteins and (2) normalization of activity with respect to expression in order to achieve quantitative screening of the displayed library. Because yeast is genetically amenable, a large library of mutants can be assembled and maintained [4, 5], which is critical to find binders with desired properties. To engineer binding affinity, the yeast cells displaying potential binders are screened with the target molecule, from which the highest affinity binders are isolated based on fluorescence or direct physical association [6]. The end result of a typical sort cycle is a collection of binders with improved expression and affinity for the target molecule. While some engineered binders may bind the target in ways that

Bin Liu (ed.), Yeast Surface Display: Methods, Protocols, and Applications, Methods in Molecular Biology, vol. 1319, DOI 10.1007/978-1-4939-2748-7_7, © Springer Science+Business Media New York 2015

143

144

Jasdeep K. Mann and Sheldon Park

interfere with the target function, more often the selected binders need to be characterized through additional rounds of epitope mapping or a functional screen to identify genuine inhibitors of function [7, 8]. This is because the binding affinity is typically engineered independent of the molecular details of interaction, and many binders are just that—binders and not inhibitors. As the size of the target molecule increases, an increasingly small fraction of engineered binders is expected to be functionally relevant. We recently described a YSD-based procedure for directly engineering epitope selectivity in order to streamline the discovery of functionally useful binders [9]. Our protocol involves the use of two alternative forms of the target molecule: wild type and a mutant containing surface substitution(s) at the desired epitope. The surface displayed library is then alternatively screened for binding to the wild type protein and for a lack of binding to the mutant protein. If the two molecules are structurally similar and differ only at the targeted surface, then the combination of positive and negative selections with wild type and mutant proteins will identify high affinity binders that are also epitope specific (Fig. 1).

Fig. 1 Schematic of the sorting strategy to engineer epitope-specific binders. (a) Yeast surface display library is assembled and expressed. (b, c) Using the target molecule for labeling, perform a series of positive sorting to identify the clones with the highest target affinity. (d) Construct a mutant protein containing one or more mutations at the desired target epitope. (e) Using the mutant protein, perform a negative sort to identify the binders whose interaction with the target protein is abrogated by the mutations. (f) The selected clones correspond to high affinity, epitope-specific binders

Engineering Epitope-Specific Binders

145

Given that disruption of ligand binding may disrupt signaling or catalysis, blocking functionally important sites of a signaling molecule or an enzyme with engineered binders should potentially inhibit the target molecule function. This strategy was used to engineer monobody binders of Erk-2 that inhibited its kinase activity by blocking a binding site used in intermolecular interaction [10–12]. Engineering epitope specificity by YSD thus offers an efficient method of discovering useful inhibitors of protein function.

2

Materials It is important that all reagents are prepared using molecular biology grade reagents in deionized water. Once prepared and sterilized, liquid reagents may be stored at 4 °C for several months. Both selective and nonselective yeast plates may be stored at 4 °C up to 1–2 months.

2.1 Yeast Culture Media Components 2.1.1 Nonselective Medium

Nonselective medium: yeast peptone dextrose (YPD) is used to propagate untransformed yeast. Growing transformed yeast in YPD will result in plasmid loss over time. 1. 10 g of yeast extract. 2. 20 g of peptone. 3. 20 g of dextrose. 4. Dissolve in 1 L water. Autoclave for 35 min at 121 °C. Store at 4 °C.

2.1.2 Selective Growth Medium

Selective growth medium: synthetic dextrose with Trp and Ura dropout (SD/-Trp-Ura). 1. 20 g of dextrose. 2. 6.7 g of yeast nitrogen base (without amino acid or ammonium sulfate). 3. 5 g ammonium sulfate. 4. 1.4 g of yeast synthetic dropout media mix lacking tryptophan, uracil, histidine, and leucine (from Sigma). The use of a quadruple dropout (-Trp,-Ura,-His,-Leu) as a base is convenient in case yeast needs to be cultured in other combinations of selection markers. By supplementing the mix with different nutrients, additional media can be prepared using common reagent. 5. 380 mg of leucine. 6. 76 mg of histidine. 7. 100 ml of 10× pH 6.0 or pH 4.5 media buffer (see below).

146

Jasdeep K. Mann and Sheldon Park

8. Add water to 1 L. To prepare a 5× stock, which is used to make selection agar plates, add water to 200 ml instead. 9. Sterilize using a 0.2 μm filter. Store at 4 °C (see Note 1). 2.1.3 Selective Induction Medium

Selective induction medium: synthetic galactose with Trp and Ura dropout (SG/-Trp-Ura). The only difference between the growth and induction media is the use of galactose in the induction medium. 1. 20 g of galactose. 2.–7. Rest of the components are same as in selective growth medium (see above). 8. Sterilize using a 0.2 μm filter and store at 4 °C.

2.1.4 Media Buffer

1. 10× sodium phosphate buffer at pH 6.0: This buffer is used to prepare selective yeast medium used to grow and propagate transformed yeast. To prepare the stock, dissolve 102 g of Na2HPO4·7H2O and 86 g of NaH2PO4·H2O in 1 L water. Sterilize by autoclaving before storage. 2. 10× sodium citrate buffer at pH 4.5: This buffer is used during cell sorting, which exposes the yeast culture to possible bacterial contamination. Low pH retards bacterial growth and reduces possible contamination. To prepare the stock, dissolve 14.7 g tri sodium citrate dihydrate (HOC(COONa) (CH2COONa)2·2H2O) and 4.29 g citric acid monohydrate (HOC(COOH)(CH2COOH)2·H2O) in 1 L water. Autoclave and store at 4 °C (see Note 2).

2.1.5 Yeast Selection Agar Plates

These plates are used to grow transformed yeast to identify individual yeast clones. 1. 180 g of sorbitol. 2. 15 g of bacto-agar. 3. Add water approximately to 700 ml and resuspend the solutes by stirring with a magnetic stir bar. 4. Add 100 ml of 10× media buffer (typically pH 6.0 is used). 5. Autoclave for 35 min at 121 °C. 6. Cool the autoclaved mixture while stirring until the temperature falls below 60 °C (warm to the touch). 7. Add 200 ml of filter sterilized 5× SD/-Trp-Ura stock. Adjust the volume to 1 L with sterile deionized water. 8. Slowly pour into 15 mm petri dishes (each plate holds ~25 ml of agar). Stack the plates together while the agar sets in order to minimize condensation on the lid. 9. Store the plates in a sealed bag at 4 °C. The plates are good for up to 2 months.

Engineering Epitope-Specific Binders

2.2 Target Protein Preparation

147

The target construction will vary from project to project. Here we describe the preparation of the Erk-2 kinase. 1. pRSET-Erk-2: a bacterial expression vector based on pRSET that contains the full-length rat Erk-2 gene downstream of the T7 promoter. NheI and BamHI restriction enzymes (New England Biolab) were used to clone the full length of Erk-2 between an N-terminal 6×histidine affinity tag and a C-terminal FLAG tag. 2. BL21(DE3) pLysS (Invitrogen): the cell line suppresses premature expression of the target molecule, which may be toxic to the cells. 3. Talon resin (Clontech), or other comparable immobilized metal affinity chromatography resin. 4. Imidazole (Sigma). 5. SDS-PAGE gel (Biorad): prepare 10–15 % acrylamide gel as needed. 6. Amicon centrifugal filters (Millipore): the filters are used for buffer exchange and concentration.

2.3 Magnetic Activated Cell Sorting (MACS)

1. EZ-Link Sulfo-NHS-Biotin (Thermo Fisher Scientific): this is used to chemically biotinylate purified Erk-2 so that it can be used with magnetic streptavidin resin to isolate the yeast displayed clones that bind the target. 2. Magnetic streptavidin-microbeads (Miltenyi Biotec). 3. MidiMACS Separator magnet (Miltenyi Biotec). 4. PBSB: Phosphate buffer saline plus 0.5 % (w/v) bovine serum albumin. 5. Kanamycin (Sigma). 6. Penicillin-Streptomycin (10,000 U/ml) (Life Technologies).

2.4 Yeast Surface Labeling for Flow Cytometry

1. Mouse monoclonal anti-cMyc antibody, 9E10 (AbD Serotec). 2. Mouse monoclonal anti-FLAG antibody, M2 (Agilent technologies). 3. Rabbit monoclonal anti-FLAG antibody (Sigma). 4. Anti-mouse IgG (whole molecule)–FITC antibody (Sigma). 5. Anti-mouse IgG (whole molecule)–R-phycoerythrin (PE) antibody (Sigma). 6. Anti-rabbit IgG (whole molecule)–FITC antibody (Sigma). 7. Alkaline phosphatase (AP)-conjugated goat anti-mouse antibody (Sigma). 8. Streptavidin-R-phycoerythrin, SA-PE (Biolegend). 9. PBSS-Phosphate buffer saline plus 0.1 % bovine serum albumin.

148

3

Jasdeep K. Mann and Sheldon Park

Methods

3.1 Library Construction

3.2 Growth and Induction of the Yeast Library

The yeast displayed fibronectin type 3 (Fn3) monobody library G4 was a gift from Dane Wittrup lab (MIT). The construction and characterization of the library was previously described [13, 14]. The library is assembled in the yeast vector pYD1 as a fusion with Aga2 and transformed into the yeast strain EBY100 (Invitrogen). 1. Thaw a frozen aliquot containing 2.5 × 109 cells or ~10-fold excess of the estimated library diversity, and inoculate into 500 ml of SD/-Trp-Ura culture medium. The starting OD600 ~ 0.5 (see Note 3). 2. Grow the cells at 30 °C with constant orbital shaking (250 rpm) overnight. The following morning, dilute the cells in 500 ml of fresh SD/-Trp-Ura medium to the starting OD600 = 0.5. 3. Continue to grow the cells in SD/-Trp-Ura at 30 °C until OD600 = 3. Centrifuge 100 ml of cells and remove the medium. Resuspend the cells in 300 ml SG/-Trp-Ura. Grow at 30 °C for 18 h with constant shaking to induce synthesis of the library (see Note 4).

3.3 Erk-2 Protein Purification

The protein purification steps will depend on the target protein. The following protocol describes the preparation of the Erk-2 kinase. 1. Transform pRSET-Erk-2 into BL21(DE3) pLysS and induce protein synthesis at the OD600 = 0.8 with 0.4 mM IPTG. Grow for 4 h at 37 °C. 2. Lyse the cells by sonication in a buffer containing 50 mM sodium phosphate (pH 8.0), 300 mM NaCl, 1 % triton X-100, 0.1 % 2-mercaptoethanol, 2 mM PMSF, and 10 % w/v glycerol. Mix the lysate with 2 ml of Talon resin. 3. Incubate the lysate and resin at 4 °C for 1 h with constant shaking. Wash the resin with 50 mM sodium phosphate (pH 7.2), 300 mM NaCl, and 20 mM imidazole. Repeat. 4. Elute the bound protein in three fractions of 1 ml of 50 mM sodium phosphate (pH 7.4), 300 mM NaCl, and 300 mM imidazole. Keep the elution volume as small as possible since the yield is low. 5. Concentrate the eluates using an Amicon centrifugal filter with the nominal cutoff of 10 kDa. Analyze the elution on a 12 % SDS-PAGE gel. 6. For biotinylation of Erk-2, incubate purified protein with tenfold excess of biotinylation reagent (EZ-Link Sulfo-NHSBiotin from Thermo Fisher Scientific) at 4 °C for 2 h. Remove unreacted biotin by buffer exchanging to PBS with a 30 kDa Amicon centrifugal filter.

Engineering Epitope-Specific Binders

3.4 Magnetic Bead Enrichment

149

1. Pellet 2.5 × 109 yeast cells (tenfold coverage of the library diversity) at 3,000 × g for 3 min. Wash the cells twice with 25 ml of PBSB and resuspend in 10 ml PBSB. 2. Incubate the cells with 1 μM biotinylated Erk-2 for 1 h at 20 °C (see Note 5). 3. Spin down the cells and wash twice with 25 ml PBSB. 4. Resuspend the pellet in 5 ml PBSB and incubate with 100 μl magnetic streptavidin coated microbeads for 15 min on ice. The yeast clones that display Erk-2 binding monobodies will now be decorated with streptavidin beads. 5. Separate the cells bound to the beads from the rest by using an LS column filled with ferromagnetic particles and a MidiMACS Separator magnet. Because the yeast particles covered with the beads are attracted to the magnet, they are selectively retained in the column compared to uncoated cells (see Note 6). 6. Wash the column with PBSB to remove the yeast cells that are not firmly bound to the beads. 7. Elute the streptavidin coated cells by removing the column from the magnet and washing the column in SD/-Trp-Ura (pH 4.5). 8. Grow the selected cells in citrate-based SD/-Trp-Ura (pH 4.5), supplemented with 50 μg/ml Kanamycin and penstrep (1:100) to retard the growth of bacteria. 9. Estimate the number of cells by plating serial dilutions of collected cells on SD/-Trp-Ura agar plates. Around ~0.1–1 % of the starting cells are typically retained in the fraction. For example, we obtained ~2 × 107 cells from the initial 2.5 × 109 cells corresponding to an estimate of 2 × 106 unique sequences.

3.5 High-Throughput Screen by Fluorescence Activated Cell Sorting (FACS)

1. Grow the cells until they have reached OD600 = 3. Dilute to OD600 = 0.5 and grow back to OD600 = 3. Induce protein synthesis by switching the medium to SG/-Trp-Ura. 2. Pellet the number of yeast cells corresponding to three- to tenfold excess of the estimated sequence diversity (e.g., 107 cells) and wash them with PBSS. 3. Label the cells with 500 nM biotinylated Erk-2 and anti-cMyc antibody (1:100 dilutions) at room temperature (i.e., around 20 °C) for 1 h (see Notes 7 and 8). 4. Wash the cells and incubate with SA-PE (1:100 dilution) and anti-mouse-FITC (1:50 dilution) on ice for 30 min in the dark. 5. Wash the cells and proceed to sorting by FACS. Because the average binders have weak affinity and likely dissociate quickly, it is important that the cells are analyzed as soon as possible after the final wash. Each FACS sorting cycle should not last more than 15 min. If additional cells need to be screened than can be analyzed in 15 min, a new batch of cells needs to be

150

Jasdeep K. Mann and Sheldon Park

washed and prepared every 15 min. Collect the clones with the most intense SA-PE labeling for a given expression level (e.g., roughly corresponding to 1–2 % of the analyzed cells) (see Notes 9 and 10). 6. Collect the selected cells in SD/-Trp-Ura (pH 4.5) containing kanamycin (50 μg/ml) and 1× pen-strep to prevent bacterial contamination. 7. Repeat the FACS analysis while gradually increasing the stringency of selection. For example, systematically decrease the concentration of biotinylated Erk-2 from 500 to 200, 100, 50, and 10 nM. To enrich the binding population, collect the top 1–2 % of the cells each time (see Note 11). 3.6 Epitope-Specific Selection with Mutant Protein

To identify the Fn3 clones with desired epitope specificity, perform negative selection with a mutant Erk-2 (see Note 12). The following factors need to be considered to design a mutant protein appropriate for the negative screen. First, the structure of the target protein should be consulted to make rational mutations. This is not as difficult a requirement to satisfy as it seems at first, since inhibitor design is typically attempted on proteins for which abundant biochemical and structural information is available. Second, the mutations should not interfere with protein folding or otherwise create significant structural perturbation to the protein. Because the mutated residues are usually located on the surface, it should be possible to introduce a mutation that does not cause significant structural perturbation. Finally, the engineered mutation should alter the chemical or physical properties at the mutated site. For example, the mutation may replace a hydrophobic residue with a charged residue or replace a small residue with a large residue. The substitutions should thus affect potential interaction at the mutated surface so that it can be used during negative selection. Keeping the above requirements in mind, we describe the design of the Erk-2 mutant used in our study. 1. Using the D-peptide bound Erk-2 structure (2GPH), design three mutations within the conserved docking site (“CD” domain), H123N, Y126H, and D319N, to disrupt the binding of a D-peptide. Introduce the mutations using mutagenic primers. Purify the mutant similarly as wild type. Verify that the overall structure of the protein remains the same by performing circular dichroism spectroscopy (Fig. 2a). 2. Incubate affinity optimized Fn3 clones on the yeast surface with 500 nM mutant Erk-2. A high concentration of Erk-2 is used to obtain clear separation between binding and nonbinding populations. 3. Collect the cells that do not bind mutant Erk-2 in order to enrich the Fn3 clones whose epitopes include mutated residues and are therefore likely to competitively inhibit the binding of

Engineering Epitope-Specific Binders

151

Fig. 2 Construction of mutant Erk-2 to engineer epitope specificity. (a) The circular dichroism spectra of wild type and mutant Erk-2 were compared to ensure that the mutations introduced at the CD domain do not affect the folding of Erk-2. (b) Functional testing to demonstrate that the engineered mutations prevent the binding of a D-peptide (bait). (c) An example of an engineered, epitope-specific monobody that binds wild type Erk-2 (left) but not mutant Erk-2 (right)

a D-peptide, whose binding is also disrupted by the mutation (Fig. 2b, c) (see Note 13). 4. Perform a final round of positive selection with wild type Erk-2 to identify the highest affinity clones with engineered epitope specificity (see Notes 14 and 15).

4

Notes 1. Synthetic yeast medium cannot be autoclaved because some components, e.g., glutamine, are heat labile and decompose during autoclaving. 2. When sorting a yeast library, the use of a low pH medium is strongly recommended to retard potential bacterial contamination. However, a low pH buffer alone does not guarantee contamination-free growth, and it is essential to practice good

152

Jasdeep K. Mann and Sheldon Park

sterile techniques at all time. We have observed that even with the addition of kanamycin and/or chloramphenicol the library can still get contaminated during a sort. Contaminated cultures are easy to spot based on visual inspection. Whereas yeast cells quickly settle to the bottom of a culture tube if left undisturbed, contaminated culture remains cloudy even after centrifugation. If the yeast culture becomes contaminated with bacteria and repeated sorting is not an option, it is possible to rid the culture of contamination by passing the cells through multiple centrifugation-wash cycles and propagating the cells in a low pH medium with antibiotics. 3. When working with a frozen yeast library, check cell viability by plating serial dilutions on SD agar plates. A plate containing a few hundred colonies gives the most reliable estimate of cell density. If the cells were frozen according to the established protocol (see ref. 4, for example), cell viability should be high and greater than 90 %. Low cell viability may reduce the sequence diversity in the library. 4. The cells should be freshly passaged just before induction in order to optimize protein expression. 5. Yeast cells are heavy and precipitate during long incubation. Keep the cells in suspension through gentle rocking. 6. Pipette the cells to avoid clumps. Magnetic separation should be done promptly at 4 °C to avoid dissociation of bound Erk-2. 7. The exact temperature of incubation is not important. For convenience, we leave the cells on the bench during the first labeling step. Subsequent labeling is done on ice to minimize dissociation of bound ligand. 8. Make sure that Erk-2 is used in stoichiometric excess compared to the number of monobody molecules on the yeast surface so that the binding does not significantly change the free protein concentration. The number of displayed molecules is estimated to be ~50,000 per cell. 9. Calibrate the compensation using cells labeled with 9E10 and secondary antibody conjugated with FITC or PE. For a double-labeled control, we express an engineered monobody that binds maltose binding protein (MBP) and label the cells with biotinylated MBP and SA-PE as well as 9E10 and secondary antibody. For negative controls, Fn3 displaying cells are labeled with secondary antibodies only. 10. Selecting a much smaller than 1 % of the population may collapse the diversity of the library too quickly and run the risk of losing useful binders that may not have the highest affinity. 11. The cells are initially labeled with SA-PE. However, the use of biotinylated Erk-2 introduces a bias. Some of the selected clones may also bind the FLAG tag rather than Erk-2. To

Engineering Epitope-Specific Binders

153

identify the clones that bind Erk-2, label bound Erk-2 with anti-FLAG antibody (M2) starting from Round 5. M2 labeling is not used until a later round because the Erk-2 affinity of the Fn3 clones is on average low at first and many monobodies may dissociate from Erk-2 during the time it takes for antibody labeling. 12. Negative selection should preferably be done after several rounds of affinity maturation, since it is difficult to differentiate between weak binders and nonbinders. 13. A gate should be drawn during the negative sort to minimize contamination of the clones that also bind the mutant protein. Because a high concentration of the mutant protein is used for labeling (e.g., 500 nM of mutant compared to 10 nM wild type during the preceding positive selection), the gate can be somewhat generous and still bias the clones based on different binding to wild type and mutant proteins. 14. If necessary, perform one or more rounds of positive sort following the negative sort to optimize the binding affinity. It is recommended that the negative sort is introduced toward the end of the selection cycle but not as the last selection step. 15. The individual clones must be tested against wild type and mutant proteins to demonstrate epitope-specific binding before functional testing is attempted. Only a small percentage of the selected clones are expected to bind both variants.

Acknowledgements This work was supported by the NSF grant (1053608) to S.P. References 1. Feldhaus MJ, Siegel RW (2004) Yeast display of antibody fragments: a discovery and characterization platform. J Immunol Methods 290:69–80 2. Gai SA, Wittrup KD (2007) Yeast surface display for protein engineering and characterization. Curr Opin Struct Biol 17:467–473. S0959doi:10.1016/j.sbi.2007.08.012, 440X(07)00119-4 [pii] 3. Pepper LR, Cho YK, Boder ET et al (2008) A decade of yeast surface display technology: where are we now? Comb Chem High Throughput Screen 11:127–134 4. Chao G, Lau WL, Hackel BJ et al (2006) Isolating and engineering human antibodies using yeast surface display. Nat Protoc 1:

755–768. doi:10.1038/nprot.2006.94, nprot. 2006.94 [pii] 5. Benatuil L, Perez JM, Belk J et al (2010) An improved yeast transformation method for the generation of very large human antibody libraries. Protein Eng Des Sel 23:155–159. doi:10.1093/protein/gzq002, gzq002 [pii] 6. Boder ET, Wittrup KD (2000) Yeast surface display for directed evolution of protein expression, affinity, and stability. Methods Enzymol 328:430–444 7. Cochran JR, Kim YS, Olsen MJ et al (2004) Domain-level antibody epitope mapping through yeast surface display of epidermal growth factor receptor fragments. J Immunol Methods 287:147–158

154

Jasdeep K. Mann and Sheldon Park

8. Levy R, Forsyth CM, LaPorte SL et al (2007) Fine and domain-level epitope mapping of botulinum neurotoxin type A neutralizing antibodies by yeast surface display. J Mol Biol 365:196– 210. doi:10.1016/j.jmb.2006.09.084, S00222836(06)01308-8 [pii] 9. Mann JK, Wood JF, Stephan AF et al (2013) Epitope-guided engineering of monobody binders for in vivo inhibition of Erk-2 signaling. ACS Chem Biol 8:608–616. doi:10.1021/ cb300579e 10. Bardwell AJ, Flatauer LJ, Matsukuma K et al (2001) A conserved docking site in MEKs mediates high-affinity binding to MAP kinases and cooperates with a scaffold protein to enhance signal transmission. J Biol Chem 276: 10374–10386. doi:10.1074/jbc.M010271200, M010271200 [pii] 11. Dimitri CA, Dowdle W, MacKeigan JP et al (2005) Spatially separate docking sites on

ERK2 regulate distinct signaling events in vivo. Curr Biol 15:1319–1324. doi:10.1016/j. cub.2005.06.037, S0960-9822(05)00672-X [pii] 12. Zhou T, Sun L, Humphreys J et al (2006) Docking interactions induce exposure of activation loop in the MAP kinase ERK2. Structure 14:1011–1019. doi:10.1016/j.str.2006.04.006, S0969-2126(06)00222-X [pii] 13. Hackel BJ, Ackerman ME, Howland SW et al (2010) Stability and CDR composition biases enrich binder functionality landscapes. J Mol Biol 401:84–96. doi:10.1016/j.jmb.2010. 06.004, S0022-2836(10)00604-2 [pii] 14. Hackel BJ, Kapila A, Wittrup KD (2008) Picomolar affinity fibronectin domains engineered utilizing loop length diversity, recursive mutagenesis, and loop shuffling. J Mol Biol 381:1238–1252. doi:10.1016/j.jmb.2008.06. 051, S0022-2836(08)00767-5 [pii]

Chapter 8 Applications of Yeast Surface Display for Protein Engineering Gerald M. Cherf and Jennifer R. Cochran Abstract The method of displaying recombinant proteins on the surface of Saccharomyces cerevisiae via genetic fusion to an abundant cell wall protein, a technology known as yeast surface display, or simply, yeast display, has become a valuable protein engineering tool for a broad spectrum of biotechnology and biomedical applications. This review focuses on the use of yeast display for engineering protein affinity, stability, and enzymatic activity. Strategies and examples for each protein engineering goal are discussed. Additional applications of yeast display are also briefly presented, including protein epitope mapping, identification of protein-protein interactions, and uses of displayed proteins in industry and medicine. Key words Yeast surface display, Protein engineering, Random mutagenesis, DNA shuffling, Affinity maturation, Protein stability engineering, Enzyme engineering

1

Introduction The ability to create engineered proteins with enhanced properties including increased binding affinity, stability, and catalytic activity, has had significant impact on biological research, medicine, and biotechnology. Despite an improved understanding of protein chemistry and folding, it remains challenging to design proteins from first principles. Thus, most strategies rely on combinatorial methods, such as directed evolution, to engineer optimized proteins, by applying random or site-directed mutagenesis techniques to generate “libraries” of up to 1014 variants of an individual protein. These protein libraries are then screened in a high-throughput manner to identify amino acid mutations that confer the desired phenotype. Numerous molecular display platforms have been specifically developed for protein engineering, including tethering libraries of protein variants to ribosomes and mRNA [1–5], or to the surface of phage [6, 7], bacteria [8], mammalian [9, 10], insect [11], or yeast [12] cells. In the case of cell surface display, each individual

Bin Liu (ed.), Yeast Surface Display: Methods, Protocols, and Applications, Methods in Molecular Biology, vol. 1319, DOI 10.1007/978-1-4939-2748-7_8, © Springer Science+Business Media New York 2015

155

156

Gerald M. Cherf and Jennifer R. Cochran

cell is transformed with a single vector encoding a protein variant of interest that is genetically fused to a cell-surface anchor protein. The anchor protein contains a signal sequence that directs efficient transport of the fusion protein to the cell surface, where it is immobilized and accessible to the extracellular space. Yeast surface display has become a leading platform for protein engineering due to its collective advantages, including (1) a eukaryotic expression system capable of incorporating posttranslational modifications such as disulfide bond formation; (2) low technical and time requirements relative to other eukaryotic display systems; (3) inclusion of epitope tags, which allows normalization of protein function (e.g., ligand binding) to surface expression and, thus, identification of proteins that both express at high levels and bind with high affinity to a target protein; and (4) compatibility with flow cytometric analysis, which allows quantitative measurements of equilibrium binding constants, dissociation kinetics, stability, and specificity of the displayed proteins without the laborious requirements of soluble protein expression and purification. This review primarily focuses on the applications of yeast display from a protein engineering perspective, including examples of protein affinity maturation, stability engineering, and enzyme engineering. Other applications of yeast display are briefly reviewed, such as protein epitope mapping, identification of protein-protein interactions, and display of proteins and enzymes on yeast cells for biotechnology and biomedical applications.

2

Yeast Surface Display Platform Yeast offer multiple options for cell surface anchor proteins, including Agα1p, Aga2p, Cwp1p, Cwp2p, Tip1p, Flo1p, Sed1p, YCR89w, and Tir1 [13]. Fusion of a protein of interest to the Cor N-terminus of an anchor protein typically results in the display of up to 100,000 copies of the fusion protein on the cell surface of Saccharomyces cerevisiae [14]. The choice of the anchor protein and fusion terminus depends on the protein to be engineered; generally the terminus farthest from the functional portion of the protein should be tethered to the anchor protein to avoid disrupting activity. The most common yeast display system employs fusion of the protein of interest to the C-terminus of the a-agglutinin mating protein Aga2p subunit, a technology pioneered by Boder and Wittrup [12] (Fig. 1). The yeast surface display construct designed for this system includes two epitope tags: a hemagglutinin (HA) tag between Aga2p and the N-terminus of the protein of interest, and a C-terminal c-myc tag (Fig. 1a). Induction of protein expression results in surface display of the fusion protein through disulfide bond formation of Aga2p to the β1,6-glucan-anchored Aga1p domain of a-agglutinin [15–17] (Fig. 1b). The epitope tags allow quantification of fusion protein expression, and thus

Applications of Yeast Surface Display for Protein Engineering

157

Fig. 1 Schematic representation of yeast surface display. (a) The protein of interest is flanked by two epitope tags: a 9-amino acid hemagglutinin antigen (HA) tag and a 10-amino acid c-myc tag, and is fused to the C-terminus of the a-agglutinin Aga2p subunit. (b) Protein display on the yeast cell surface. Following translation, the 69-amino acid Aga2p subunit associates with 725-amino acid a-agglutinin Aga1p subunit via two disulfide bonds. The fusion protein is subsequently secreted to the extracellular space where Aga1p is anchored to the cell wall via a β1,6-glucan covalent linkage. As a result, the protein of interest is displayed on the cell surface where it is accessible by soluble ligands. Functional display of the protein of interest (shown here as a scFv [129] modified from PDB 1X9Q using the UCSF Chimera package [130]) can be detected by a fluorescently labeled antibody or ligand (red star) specific to the native fold. The epitope tags are used to normalize protein function to surface expression level through either labeled anti-HA or anti-c-myc antibodies (green stars). These features allow flow cytometric sorting of a heterogeneous mixture of yeast cells, each displaying up to 100,000 copies of a individual protein variant, based on the biophysical and biochemical properties of the displayed proteins

normalization of protein function to expression level by flow cytometry using fluorescently labeled antibodies. However, detection of epitope tags yields no information on the fold or function of the protein of interest. Therefore, a ligand or antibody specific for the native fold of the displayed protein must be used to interrogate these properties. Protein engineering applications using yeast display involve expression of a protein library, which is generated from the underlying genetic material that codes for the protein variants. This connection is known as a genotype-phenotype linkage and must be maintained throughout the protein engineering process so that the desired protein variants can be identified by sequencing following library screening. To create a protein library, diverse genetic material,

158

Gerald M. Cherf and Jennifer R. Cochran

which can be obtained directly from organisms or generated by mutagenic PCR, is transformed into yeast cells and induction of expression through a GAL promoter leads to surface display of the protein variants. The resulting library can then be screened using flow cytometric sorting (also known as fluorescence-activated cell sorting, or FACS) to isolate yeast displaying proteins with the desired properties. For this purpose, yeast are incubated with fluorescent probes that differentially label the cells based on the biochemical and biophysical properties of their displayed protein (e.g., affinity, stability, specificity). The yeast cells are then passed single-file through the fluidics stream of a FACS instrument, which analyzes and sorts them based on cell size, granularity, and/or fluorescence measurements. Detailed protocols for library creation and screening have been well described in the field [14, 18–21]. Phage display and ribosome display techniques take advantage of panning-based methods to efficiently screen libraries as large as 1012–1014 variants. In comparison, yeast display offers lower throughput due to limitations in yeast transformation efficiency and current cell screening technology. The upper limit of library sizes that can currently be screened by FACS is ~108–109 yeast cells, determined by the maximum sampling rate (~50,000 cells/s) of the leading flow cytometry instruments. Moreover, libraries are typically sampled by FACS at higher coverage (e.g., 10×) to increase the probability of sampling each variant at least once. Thus, to increase throughput, yeast-displayed libraries of greater than 108 variants can first be screened using bead-based magnetic activated cell sorting (MACS) to reduce the library diversity before screening with FACS [22, 23]. In this method, magnetic beads are coated with a soluble target of interest, for example, an antibody or ligand. The beads are then incubated with the yeast library, and yeast displaying non-binding protein variants are removed by washing, after which the yeast binding the desired target are eluted and recovered. This method is advantageous for removing truncated, misfolded, and weak affinity proteins from the library, thereby reducing library diversity to a size that is amenable to quantitative screening by FACS. Finally, while differences between human and yeast glycosylation patterns have typically not prevented functional display of glycosylated human proteins, yeast strains that express human glycosylation machinery have been engineered and similar technology could potentially be developed for yeast display applications if human glycosylation is desired (see refs. 24–26 for reviews).

3

Engineering Proteins for Increased Affinity The affinity a protein has for its binding partner is a key parameter that often regulates the biological function of the bound complex. High binding affinity is a desired characteristic of proteins used for

Applications of Yeast Surface Display for Protein Engineering

159

research, therapeutic, and diagnostic applications, and thus multiple strategies for increasing protein affinity (termed “affinity maturation”) have been developed, with the most common involving directed evolution and molecular display technologies. Over the last decade, yeast display has become a leading platform for affinity maturation; in addition to the aforementioned advantages, yeast display can discriminate between proteins with only twofold differences in affinity [21, 27], further illustrating the sensitivity of this approach. A general strategy of affinity maturation using yeast display involves creation of a library on the order of 107–109 protein variants by random mutagenesis, followed by display of these variants on the surface of yeast as fusions to the Aga2p cell wall protein (Fig. 2).

Fig. 2 Isolating high-affinity protein variants from a yeast-displayed library by FACS. Following transformation of yeast cells with a gene library and induction of surface expression, two main strategies are used to differentially label the displayed library prior to screening: (1) an equilibrium binding strategy where the library is incubated with a ligand concentration 5–10 times greater than the expected KD value of the highest affinity variant, resulting in near saturation of tight binding variants and partial labeling of weaker affinity variants at equilibrium, and (2) a kinetic binding strategy where the library is incubated with ligand as described for the equilibrium binding strategy, but unbound ligand is removed by washing and the library is then incubated either with a 100-fold excess of unlabeled ligand or in a sufficiently large volume of buffer to prevent rebinding of dissociated ligand. During this second incubation step, the excess unlabeled ligand or large incubation volume prevents dissociated labeled ligands from rebinding. Proteins are thus differentiated based on their dissociation rate constants (koff), with variants having the slowest koff retaining the largest percentage of prebound labeled ligand. Addition of a fluorescently labeled anti-epitope tag antibody (not shown) permits normalization of yeast surface expression levels with binding, allowing the highest affinity variants to be isolated by FACS. Sorted pools of yeast clones can be expanded in culture for either analysis or a subsequent round of sorting, or DNA from these clones can be isolated, subjected to mutagenesis, and used to transform a new batch of yeast for further directed protein evolution. Components of the yeast display platform, including Aga1p, Aga2p, HA, and c-myc epitope tags, and detection antibodies depicted in Fig. 1, are omitted for clarity

160

Gerald M. Cherf and Jennifer R. Cochran

Subsequently, two main strategies are used to label the yeastdisplayed library prior to sorting by FACS. In the first approach, library members are screened based on their equilibrium dissociation constants (KD) [27, 28]. The yeast-displayed library is incubated with the soluble binding partner (ligand) at a concentration of approximately five- to tenfold greater than the expected KD of the highest affinity variants (typically near the KD of the wild-type interaction), and binding is allowed to reach equilibrium. This method requires at least a tenfold excess of ligand relative to the number of yeast-displayed protein variants in the binding reaction. If a lower ratio is used, binding may significantly alter the concentration of free ligand in solution, which would result in ligand depletion and noncompliance with rules that govern equilibrium binding isotherms. The second approach uses kinetic competition and screens yeastdisplayed variants based on their dissociation rate constants (koff) [12, 29, 30]. The library is incubated with a saturating concentration of fluorescently labeled ligand, washed, and then either incubated with 100-fold excess of unlabeled ligand, if available, or incubated in a sufficiently large volume of buffer to prevent rebinding of the labeled ligand after dissociation. This method is primarily used when evolving variants of a protein with a strong starting affinity (KD < 1 nM) that would require inconveniently large incubation volumes to meet the tenfold excess ligand requirement of the former method, or when the dissociation kinetics are the most important functional characteristic of the desired protein. Regardless of which labeling method is used, high-affinity variants are selected using FACS to isolate cells that exhibit high levels of binding for a given amount of cell surface expression, as measured by a fluorescent antibody against the C-terminal epitope tag and a fluorescently labeled soluble ligand, respectively (Fig. 1). Following each round of cell sorting, two paths can be taken: (1) the selected cells can be amplified in culture and sorted again to further reduce the library diversity to a smaller subset of clones with the highest affinity, or (2) DNA from the selected cells can be extracted and subjected to another round of mutagenesis (e.g., random mutagenesis or DNA shuffling [31]) to introduce additional diversity or combine potentially favorable mutations, followed by display of the new library and another round of cell sorting. The latter approach is termed “directed evolution,” and incorporates multiple rounds of mutagenesis and library screening to iteratively evolve proteins with the desired binding characteristics. After the library size is reduced to a smaller pool of highaffinity proteins, the concentration of soluble ligand can be lowered (while still avoiding ligand depletion) to adjust the resolution between the weaker and tighter binding proteins and further aid in selection of variants with the highest affinity. Typically, multiple rounds of mutagenesis and/or library sorting are applied to isolate high-affinity variants with equilibrium dissociation constants in the low nanomolar to picomolar range.

Applications of Yeast Surface Display for Protein Engineering

161

Following library sorting, individual variants can be quantitatively analyzed for their binding properties while still tethered to the yeast cell surface [27, 28]. This is a major advantage of yeast display technology as it allows fast, quantitative comparisons of binding properties without the need for laborious soluble expression and purification of each protein. For this purpose, the enriched library pool is amplified by culturing and is then plated to isolate individual yeast clones that each expresses a single variant. These individual clones are induced for cell surface expression and tested for binding to varying concentrations of ligand typically ranging from tenfold above to tenfold below the expected KD of the displayed variant. Equilibrium binding constants or dissociation kinetics are then determined by flow cytometry [27, 28]. Importantly, many studies have demonstrated that the KD of a protein-protein binding interaction measured on the surface of yeast is essentially equal to the KD measured using soluble proteins [32]. Using the general strategies outlined above numerous proteins have been engineered with enhanced affinities for their binding partners, including T cell receptors with greater than 100-fold enhanced affinity for a peptide/MHC ligand [33], epidermal growth factor (EGF) with 30-fold enhanced affinity for the EGF receptor [34], interleukin-2 (IL-2) with up to 30-fold enhanced affinity for the IL-2 receptor alpha subunit [35, 36], leptins with up to 60-fold enhanced affinity for the leptin receptor [37], an Axl receptor variant with 12-fold enhanced affinity for its ligand Gas6 (final KD = 2.7 pM) [38], and a signal-regulatory protein α (SIRPα) variant with ~50,000-fold enhanced affinity for CD47 (final KD = 11.1 pM) [39, 40]. Yeast display has also been applied to engineer and affinity mature numerous antibodies, including antibodies against cholera toxin [41], FITC [22], HIV-1 gp120 [42], hemagglutinin surface glycoprotein of the H1N1 virus [43], HER2/neu [44], T cell receptors [28], TNF-α [45], and a host of other targets (see ref. 46 for a review). In a classical demonstration of the technological capabilities afforded by yeast display, a fluorescein-binding antibody was engineered with a KD equal to 48 fM and a dissociation rate greater than 1,000-fold lower than the parent antibody [30], representing one of the strongest protein binding interactions ever engineered and among the strongest found in nature. Yeast display technology has also been used to engineer novel non-antibody protein binders against targets of interest. These socalled alternative scaffold proteins have been chosen for protein engineering applications based on positive attributes including stability, amenability to mutation, ease of expression and purification, and binding epitope surface area. Typically, the amino acid sequence of a contiguous solvent-exposed region of the scaffold is randomized to generate a “naïve” library, and the library is displayed on the surface of yeast and screened for binding to a target protein using FACS [47, 48]. A number of novel ligands have been engineered using this strategy, including cysteine knot peptides (knottins) that

162

Gerald M. Cherf and Jennifer R. Cochran

bind to various integrins with KD values in the picomolar to nanomolar range [47, 49–53], or that inhibit human matriptase-1 with picomolar to nanomolar inhibition constants (Ki) [54]; human fibronectin 10th type III domain scaffold [55] variants that bind to a variety of protein targets [18, 56, 57], such as lysozyme, with KD values in the nanomolar to picomolar range [29, 32]; green fluorescent protein variants that bind streptavidin-phycoerythrin, biotin-phycoerythrin, glyceraldehyde 3-phosphate dehydrogenase, and a neurotrophin receptor with KD values of 70 nM, 190 nM, 18 nM, and 3.2 nM, respectively [58]; human kringle domain variants that bind death receptor 4 (DR4), DR5, or TNF-α with KD values of 680 nM, 172 nM, and 29 nM, respectively [59]; and Sso7d protein variants from the hyperthermophilic archaeon Sulfolobus solfataricus that bind fluorescein, a peptide fragment from β-catenin, hen egg lysozyme, streptavidin, and chicken and mouse immunoglobulins with KD values in the nanomolar to micromolar range [60]. In many of the scaffold examples described above, the screening strategy identified a number of high-affinity ligands that bound to different epitopes of the target protein. Novel ligands have also been engineered to bind to a specific epitope of the target protein by first selecting all library variants that bind to a wild-type target protein, and then screening the selected pool of binders for variants that do not bind to an epitope-altered form of the target protein. As a recent example, a dengue virus-neutralizing antibody was engineered using yeast display by selecting antibodies from a library that bound to the wild-type viral envelope protein domain III, but not to a form of the target protein with a specific epitope mutated [61]. Importantly, this strategy is contingent on proper design of the mutant target epitope used for library screening. First, the target epitope must be sufficiently mutated such that ligands that bind to the wild-type epitope will not bind to the mutated form. Second, the mutation(s) must only affect the structure of the protein at the site of the target epitope and must not affect the global fold of the protein, as screening for epitopespecific binders using a completely misfolded mutant competitor would be futile.

4

Engineering Proteins for Increased Stability The stability of a protein generally refers to its ability to resist thermal and chemical denaturation and proteolytic degradation. High stability is a desired characteristic of proteins that are used for research, industrial, and therapeutic applications, and translates to longer shelf life, duration of activity, and in vivo activity. As with binding affinity, thermal stability can be analyzed while a protein variant is still tethered to the yeast cell surface, allowing for rapid, quantitative measurement of half-maximal denaturation (TM) values.

Applications of Yeast Surface Display for Protein Engineering

163

Three general strategies have been applied to engineer proteins with increased stability (Fig. 3). In each approach, a library on the order of 107 to 109 protein variants is generated by random mutagenesis and displayed on the surface of yeast as a fusion to the Aga2p cell wall protein.

Fig. 3 Isolating high-stability protein variants from a yeast-displayed library by FACS. (a) Screening of stable protein variants based on their level of surface expression. Transformation of yeast with a mutant gene library generally results in display of properly folded and truncated protein variants that range in expression level, which can be used as a proxy for protein stability [62–64]. Cells are labeled with a fluorescent antibody (green star) against the c-myc epitope tag (purple box) and a ligand (red star) specific to the native fold of the displayed protein, and cells expressing the highest levels of properly folded variants are selected by FACS. (b) Screening of stable protein variants based on their ability to resist irreversible thermal denaturation. Following heat incubation and sorting of yeast displaying stable protein variants, viable cells can be expanded in culture for additional screening and/or analysis, whereas DNA from nonviable cells must be isolated and amplified for analysis or an additional round of yeast transformation and screening. Point mutations are shown as red circles, and colors indicating protein identity match those shown in Fig. 1. The displayed protein depicted here is an scFv [129] modified from PDB 1X9Q using the UCSF Chimera package [130]

164

Gerald M. Cherf and Jennifer R. Cochran

The first strategy for stability engineering exploits a correlation between the yeast surface expression levels of properly folded proteins and their thermal stability [62–64] (Fig. 3a). For example, a library of single-chain T-cell receptor (scTCR) variants was expressed on the yeast surface and enriched for cells displaying the highest levels of properly folded protein as determined by binding to a conformationally specific antibody [65]. When individual protein mutants from this enriched pool of yeast were recombinantly expressed in soluble form and assayed, the most stable scTCR variant retained 80 % activity after incubation at 50 °C for 30 min, whereas the parent scTCR protein retained less than 10 % activity under the same conditions. In another example, yeast surface display and library screening were used to identify an epidermal growth factor receptor (EGFR) mutant with a TM of 61.0 ± 1.3 °C compared to a TM of 52.5 ± 0.7 °C for wild-type EGFR [66]. Similarly, yeast display was used to identify a single-chain class II major histocompatibility complex protein (scDR1αβ) with a TM of 73.3 ± 1.8 °C, whereas display of the properly folded wild-type scDR1αβ protein was barely detectable [67]. This general strategy has been applied to enhance the stability of numerous other proteins and is reviewed in detail elsewhere [68]. Despite the successes described above, using surface expression level as a proxy for protein stability may be better suited for proteins with low inherent thermal stabilities. The correlation between expression level and protein stability is due, in part, to the quality control process that occurs in the endoplasmic reticulum (ER) during protein synthesis and posttranslational processing. The ER quality control mechanism ensures efficient export of properly folded proteins, whereas misfolded proteins are retro-translocated across the ER membrane and degraded in the cytosol [69, 70]. This process generally results in inefficient expression of unstable proteins that adopt a higher ratio of misfolded to native structures. However, the observed correlation between yeast surface expression level and stability is likely limited to proteins of low stability, as proteins above a certain stability threshold are generally expected to escape the ER quality control mechanism. In support of this assumption, variants of a highly thermostable three-helix bundle protein α3D with varying Tm values all above 80 °C showed no correlation between yeast surface expression level and thermal stability [71]. A second strategy for increasing protein stability involves application of heat stress (up to 85 °C for 10 min) directly to a yeastdisplayed library prior to cell sorting (Fig. 3b) [65, 72, 73]. This approach may be better suited for proteins with higher inherent thermal stabilities, assuming that irreversible denaturation will occur under these experimental conditions. Yeast-displayed variants that resist thermal denaturation are discriminated by FACS, based on their ability to bind to a fluorescently labeled antibody or ligand specific to the native protein fold [67]. As an example, a library of

Applications of Yeast Surface Display for Protein Engineering

165

IgG1-Fc scaffold variants was displayed on yeast and subjected to heat stress (79 °C for 10 min) [21]. Stable IgG1-Fc variants that bound to a conformationally specific antibody or a soluble Fcγ receptor after heat stress were enriched using multiple rounds of FACS, and isolated variants were analyzed for thermal stability. IgG1-Fc variants were identified with increased TM values up to 91.0 ± 0.1 °C, compared to a TM of 82.6 ± 0.0 °C for wild-type IgG1-Fc. Using this general strategy, a Her2/neu-binding antibody fragment variant was engineered with an increase in TM from ~70 °C (parent IgG1-Fc) to ~75 °C and an increased resistance to aggregation [74]. Similarly, variants of a monomeric yeast-enhanced green fluorescent protein (GFPM) were engineered with three- to sixfold increased resistance to thermal denaturation at 70 °C [72]. Notably, increased thermal stability did not confer increased yeastsurface expression levels for the GFPM variants, which further supports the addition of a heat stress step to the library screening protocol when engineering proteins with high intrinsic thermostabilities. An important consideration is that although yeast cells remain intact and can be efficiently sorted by FACS even after heat stress (e.g., 72 °C for 90 min or 85 °C for 10 min) [73], their viability is compromised at temperatures above 42 °C [73]. Thus, after each round of heat stress and sorting, plasmid DNA from yeast cells should be isolated, amplified by PCR, and used to transform viable cells for a subsequent round of screening [20, 21]. Additionally, this strategy involving heat stress is only applicable to proteins/domains that denature irreversibly; refolding after heat stress would prevent discrimination between variants of different thermal stabilities. Alternatively, a third strategy exists for increasing protein stability that harnesses both the advantages of increased temperature and the quality control mechanisms of the ER to select stable variants. In this method, expression of surface-displayed protein is induced for 24 h at temperatures up to 37 °C (compared to 20 °C or 30 °C which is typically used) to shift the equilibrium of protein structures toward the misfolded state during protein synthesis and posttranslational processing in the ER while maintaining yeast cell viability. Generally, only proteins that are efficiently folded and processed at the elevated induction temperatures will avoid the ER quality control machinery and be efficiently exported to the cell surface. The library can then be sorted as described in the first strategy (Fig. 3a) to select variants with increased stabilities. For example, this strategy was applied to enhance the stability of an scTCR [65], and to engineer a hepatocyte growth factor fragment with a 15 °C increase in TM and a 40-fold increase in expression yield relative to the wild-type protein fragment [75]. In many cases, increased thermal stability also correlates to increased recombinant expression of the soluble form of the protein relative to the wild-type protein [66, 67, 76–79], highlighting an additional benefit of these techniques for protein engineering.

166

5

Gerald M. Cherf and Jennifer R. Cochran

Enzyme Engineering Directed evolution is a powerful technique for enzyme engineering. However, developing a strategy for linking the genotype of an enzyme mutant to its phenotype (e.g., catalytic activity or substrate specificity) poses a difficult challenge since in most cases substrate turnover results in a product that is diffusible and not covalently bound to the surface of a phage or cell. Thus, lower throughput microtiter or colony-based screening methods (103–104 variants) have historically been used for enzyme engineering [80–82]. Several alternate techniques have recently been developed to address these challenges, including oil-water emulsion methods that encapsulate genetic material, the translated enzyme, and its catalyzed product into droplets that can be sorted by flow cytometry [83, 84]. More recently, unique strategies incorporating yeast display have allowed libraries of up to 108 enzyme variants to be screened for increased activity and substrate specificity using FACS. In this approach, yeast cells are fluorescently labeled as a result of enzymatic activity, which allows discrimination of enzyme variants based on their level of activity and/or specificity. In one example, a library of horseradish peroxidase (HRP) enzyme variants was differentially labeled based on substrate specificity [85]. The library was incubated with a fluorescently labeled substrate, which produced a functionalized fluorophore by-product that covalently attached to tyrosines on the yeast cell surface. As a result, cells displaying the most active HRP variants were labeled with higher levels of fluorophore and subsequently selected by FACS. Using this strategy, an HRP variant with eightfold altered enantioselectivity was evolved using a combination of positive and negative selection [85]. A similar strategy was applied to evolve HRP variants with increased selectivity toward either substrate enantiomer by up to 2 orders of magnitude [86]. In another example, a general strategy for evolving bond-forming enzymes was developed (Fig. 4) and applied to identify a bacterial transpeptidase sortase A enzyme with a 140-fold enhancement in catalytic activity [87]. Yeast display has been applied to enhance the activity and/or substrate selectivity of a variety of other enzymes, including firefly luciferase [88], Rhizomucor miehei lipase [89], the adenylation domain of a nonribosomal peptide synthetase [90], E. coli lipoic acid ligase [91], and a tobacco etch virus protease [92]. In general, the success of these strategies was contingent on the enzyme substrate being labeled with an affinity handle or fluorescent probe. Thus, yeast display methodology is currently limited to engineering a subset of enzymes, as not all will be tolerant to such substrate modifications. Finally, many enzyme engineering examples employ sitedirected saturation mutagenesis [93] rather than random

Applications of Yeast Surface Display for Protein Engineering

167

Fig. 4 A general strategy for selecting bond-forming enzyme variants with increased catalytic activity from a yeast-displayed library [87]. A library of enzyme variants is generated and displayed as a fusion to Aga2p, and a reactive peptide handle (s6) is fused to Aga1p. Sfp phosphopantetheinyl transferase covalently links CoAconjugated enzyme substrate A to the s6 peptide handle, where it is accessible by the displayed enzyme. Subsequently, enzyme substrate B linked to an affinity handle (shown here as biotin) is incubated with the library, resulting in A–B bond formation catalyzed by active enzyme variants. Addition of a fluorescently labeled anti-epitope tag antibody (green star) and an affinity agent that binds to the handle on substrate B permits discrimination of enzyme variants with increased catalytic activity by FACS. Next, selected pools of yeast can be amplified for analysis or an additional round of screening, or their DNA can be extracted, subjected to mutagenesis, and used to transform new cells for further directed evolution. Application of this strategy is limited to bond-forming enzyme-substrate systems that remain functional when the substrates are tethered to the s6 peptide and an affinity handle

mutagenesis to generate protein libraries. This directed mutagenesis restricts the amino acid search space to a particular region of interest of the enzyme (typically proximal to the active site), and allows the investigation of every possible combination of mutations at selected amino acid positions. However, the maximum number of these positions one can exhaustively investigate is still limited by the throughput of the FACS instrument used to screen the library. For example, a library comprising every possible combination of amino acids at 6 or 7 sites in an enzyme (206 or 207 variants total) would require ~0.4 or 7 h to sort at 50,000 cells/s, respectively.

168

6

Gerald M. Cherf and Jennifer R. Cochran

Additional Applications Yeast display has been used for other purposes besides protein engineering, briefly described below, including protein epitope mapping, identification of protein-protein interactions, and generation of “armed” yeast cells for a variety of applications. Knowledge of the critical contact sites of a protein binding pair that govern their affinity can be advantageous. Two methods for identifying these contact sites, called domain-level [94] or fine [95] epitope mapping, have been developed using yeast display and applied to a wide range of protein binding pairs. For domainlevel epitope mapping, individual domains from one of the binding proteins are displayed on yeast and screened for binding to a soluble version of the other binding partner [94]. In addition, the competitive binding of two ligands has been tested to identify ligands that share overlapping binding epitopes. In contrast, fine epitope mapping has been used to identify specific amino acids at the binding interface that directly contribute to the binding affinity [95]. For this method, a protein library is generated using random mutagenesis, displayed on the surface of yeast, and incubated with its wild-type binding partner. Cells displaying weak-binding proteins are then selected and their encoding DNA is sequenced to identify consensus amino acid sites that substantially influence the affinity of the protein pair, and thus are suggestive of the binding interface location. These strategies have been applied to map the binding epitopes of EGFR-specific antibodies [94, 95] and engineered EGFR-specific scaffold proteins [96], antibodies against H1N1 [43] and H5N1 [97], virus hemagglutinin surface glycoprotein, gp120-binding antibodies [98], and other binding pairs as reviewed elsewhere [99, 100]. Yeast display has also been applied to identify new proteinprotein interactions. For example, an adult human testis cDNA library was displayed on yeast and screened for binding to phosphorylated peptides derived from autophosphorylation sites of EGFR and focal adhesion kinase (FAK) [101]. As a result, binding interactions were discovered between autophosphorylated EGFR sites and the SH2 domains of adapter protein APS and phosphoinositide 3-kinase regulatory subunit 3, as well as between autophosphorylated FAK sites and the SH2 domains of SH2B, tensin, and adapter protein APS [101]. Similarly, screening of a yeast-displayed human proteome library for binding to a mesothelioma-targeting single-chain variable antibody fragment (scFv) identified the specific cell surface antigen targeted by the scFv [102]. Yeast display has also been applied to identify interactions between proteins and small molecules. For example, a human

Applications of Yeast Surface Display for Protein Engineering

169

cDNA library comprising 2 × 107 cDNA fragments from multiple human tissue samples was displayed on yeast and screened for binding to biotinylated phosphatidylinositides [103]. As a result, known interactions with pleckstrin homology domains and a phosphotyrosine-binding domain were identified, and a novel interaction with a fragment of apolipoprotein H was discovered [103]. These and other protein-protein interactions identified using yeast display have been reviewed elsewhere [99, 100]. Divergent from protein engineering, yeast display technology has been used to functionalize yeast cells for a variety of biotechnology and biomedical applications, including generation of whole-cell biocatalysts, antimicrobial agents oral vaccines, and for biosorption of various metals. In one prominent example, microbial conversion of cellulosic biomass into fuels gained substantial interest as a means of establishing a renewable energy source and an alternative to petroleum-based fuel production. Yeast display is an attractive technology for generating biofuel from cellulosic material, as it enables enzyme production, cellulose hydrolysis, and fermentation all in one step by localization of cellulolytic, amylolytic, and xylanolytic enzymes at the yeast cell surface. S. cerevisiae has been engineered using yeast display technology to convert cellulosic material into bioethanol (for reviews, see refs. 104, 105). Specifically, yeast cells were engineered to codisplay endoglucanase II and β-glucosidase enzymes, and directly fermented 45 g of β-glucan per liter of media to produce 16.5 g of ethanol per liter in approximately 50 h [106]. The ratio of grams of ethanol produced to grams of β-glucan utilized was 0.48 g/g (or 93.3 % of the theoretical yield). Yeast co-displaying xylanase and β-xylosidase directly fermented xylan from sulfuric acid hydrolysate of wood chips [107], and yeast co-displaying glucoamylase and α-amylase directly fermented raw cornstarch [108]. Display of minicellulosomes on the surface of yeast for bioethanol production has also been achieved by simultaneously binding dockerin-tagged endoglucanase, exogluconase, and β-glucosidase enzymes to Aga2pscaffoldin protein fusions [109–112]. Yeast cells have also been engineered as whole-cell biocatalysts for various other applications. For example, yeast displaying Rhizopus oryzae lipase were used as whole-cell biocatalysts to generate biodiesel from methanol and soybean oil [113]; yeast displaying Geotrichum sp. lipase were used to enrich docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA) from fish oil [114]; yeast displaying Corynebacterium diphtheriae sialidase were used to transfer sialic acids for glycoprotein remodeling [115]; and yeast displaying glucose oxidase were used for electrochemical glucose sensing [116]. Yeast have also been functionalized with antimicrobial peptides [117, 118], pathogenic proteins for oral vaccine delivery [119–121], and metal-binding proteins for bioadsorption of various metals [122–128]. These and other examples have recently been reviewed [69].

170

7

Gerald M. Cherf and Jennifer R. Cochran

Conclusion Yeast surface display is an effective tool for protein and cellular engineering, and has facilitated countless applications in research, biotechnology, and medicine. In contrast to other technologies such as ribosome and phage display, yeast display offers compatibility with flow cytometric analysis, enabling quantitative on-cell measurements of protein expression level, stability, affinity, and specificity without the need for soluble protein expression and purification steps. Additionally, unlike bacterial and phage display, yeast display provides a eukaryotic expression system capable of producing complex mammalian proteins containing multiple disulfide bonds. This unique combination of advantages has established yeast display as a leading technology for engineering protein stability, expression, and binding interactions, and as an emerging technology for high-throughput enzyme engineering and yeast cell engineering. Furthermore, other than requiring a FACS instrument for quantitative library screening and analysis, yeast display employs standard laboratory equipment and materials for microbial transformation and culture, and libraries can be readily generated and screened by users within a matter of weeks. As the use and applications of yeast display continue to rapidly expand, it will be exciting to see the advances this powerful technology delivers in the years to come.

Acknowledgements Gerald M. Cherf is supported by the National Cancer Institute of the National Institutes of Health under Award Number F31CA186478, and funding from the Stanford Bioengineering Department. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health. References 1. He M, Taussig MJ (1997) Antibodyribosome-mRNA (ARM) complexes as efficient selection particles for in vitro display and evolution of antibody combining sites. Nucleic Acids Res 25:5132–5134 2. Hanes J, Plückthun A (1997) In vitro selection and evolution of functional proteins by using ribosome display. Proc Natl Acad Sci U S A 94:4937–4942

3. Roberts RW, Szostak JW (1997) RNApeptide fusions for the in vitro selection of peptides and proteins. Proc Natl Acad Sci U S A 94:12297–12302 4. Mattheakis LC, Bhatt RR, Dower WJ (1994) An in vitro polysome display system for identifying ligands from very large peptide libraries. Proc Natl Acad Sci U S A 91: 9022–9026

Applications of Yeast Surface Display for Protein Engineering 5. Mattheakis LC, Dias JM, Dower WJ (1996) Cell-free synthesis of peptide libraries displayed on polysomes. Methods Enzymol 267:195–207 6. Smith GP (1985) Filamentous fusion phage: novel expression vectors that display cloned antigens on the virion surface. Science 228:1315–1317 7. McCafferty J, Griffiths AD, Winter G, Chiswell DJ (1990) Phage antibodies: filamentous phage displaying antibody variable domains. Nature 348:552–554 8. Francisco JA, Campbell R, Iverson BL, Georgiou G (1993) Production and fluorescence-activated cell sorting of Escherichia coli expressing a functional antibody fragment on the external surface. Proc Natl Acad Sci U S A 90:10444–10448 9. Ho M, Nagata S, Pastan I (2006) Isolation of anti-CD22 Fv with high affinity by Fv display on human cells. Proc Natl Acad Sci U S A 103:9637–9642 10. Beerli RR et al (2008) Isolation of human monoclonal antibodies by mammalian cell display. Proc Natl Acad Sci U S A 105: 14336–14341 11. Ernst W et al (1998) Baculovirus surface display: construction and screening of a eukaryotic epitope library. Nucleic Acids Res 26:1718–1723 12. Boder ET, Wittrup KD (1997) Yeast surface display for screening combinatorial polypeptide libraries. Nat Biotechnol 15: 553–557 13. Kondo A, Ueda M (2004) Yeast cell-surface display—applications of molecular display. Appl Microbiol Biotechnol 64:28–40 14. Boder ET, Wittrup KD (2000) Yeast surface display for directed evolution of protein expression, affinity, and stability. Methods Enzymol 328:430–444 15. Kapteyn JC, Van Den Ende H, Klis FM (1999) The contribution of cell wall proteins to the organization of the yeast cell wall. Biochim Biophys Acta 1426:373–383 16. Roy A, Lu CF, Marykwas DL, Lipke PN, Kurjan J (1991) The AGA1 product is involved in cell surface attachment of the Saccharomyces cerevisiae cell adhesion glycoprotein a-agglutinin. Mol Cell Biol 11:4196–4206 17. Lu CF et al (1995) Glycosyl phosphatidylinositoldependent cross-linking of alpha-agglutinin and beta 1,6-glucan in the Saccharomyces cerevisiae cell wall. J Cell Biol 128:333–340 18. Koide S, Koide A, Lipovšek D (2012) Targetbinding proteins based on the 10th human

19.

20.

21.

22.

23.

24.

25.

26.

27.

28.

29.

30.

31.

32.

171

fibronectin type III domain (10Fn3). Methods Enzymol 503:135–156 Scholler N (2012) Selection of antibody fragments by yeast display. Methods Mol Biol 907:259–280 Zhao Q, Zhu Z, Dimitrov DS (2012) Yeast display of engineered antibody domains. Methods Mol Biol 899:73–84 Chao G et al (2006) Isolating and engineering human antibodies using yeast surface display. Nat Protoc 1:755–768 Feldhaus MJ et al (2003) Flow-cytometric isolation of human antibodies from a nonimmune Saccharomyces cerevisiae surface display library. Nat Biotechnol 21:163–170 Miller KD, Pefaur NB, Baird CL (2008) Construction and screening of antigen targeted immune yeast surface display antibody libraries. Curr Protoc Cytom Chapter 4:Unit4.7 Wildt S, Gerngross TU (2005) The humanization of N-glycosylation pathways in yeast. Nat Rev Microbiol 3:119–128 De Pourcq K, De Schutter K, Callewaert N (2010) Engineering of glycosylation in yeast and other fungi: current state and perspectives. Appl Microbiol Biotechnol 87: 1617–1631 Gerngross TU (2004) Advances in the production of human therapeutic proteins in yeasts and filamentous fungi. Nat Biotechnol 22:1409–1414 VanAntwerp JJ, Wittrup KD (2000) Fine affinity discrimination by yeast surface display and flow cytometry. Biotechnol Prog 16: 31–37 Kieke MC, Cho BK, Boder ET, Kranz DM, Wittrup KD (1997) Isolation of anti-T cell receptor scFv mutants by yeast surface display. Protein Eng 10:1303–1310 Hackel BJ, Kapila A, Wittrup KD (2008) Picomolar affinity fibronectin domains engineered utilizing loop length diversity, recursive mutagenesis, and loop shuffling. J Mol Biol 381:1238–1252 Boder ET, Midelfort KS, Wittrup KD (2000) Directed evolution of antibody fragments with monovalent femtomolar antigen-binding affinity. Proc Natl Acad Sci U S A 97:10701–10705 Stemmer WP (1994) Rapid evolution of a protein in vitro by DNA shuffling. Nature 370:389–391 Lipovsek D et al (2007) Evolution of an interloop disulfide bond in high-affinity antibody mimics based on fibronectin type III domain and selected by yeast surface display: molecular convergence with single-domain

172

33.

34.

35.

36.

37.

38.

39.

40.

41.

42.

43.

44.

45.

46.

Gerald M. Cherf and Jennifer R. Cochran camelid and shark antibodies. J Mol Biol 368:1024–1041 Holler PD et al (2000) In vitro evolution of a T cell receptor with high affinity for peptide/MHC. Proc Natl Acad Sci U S A 97:5387–5392 Cochran JR, Kim Y-S, Lippow SM, Rao B, Wittrup KD (2006) Improved mutants from directed evolution are biased to orthologous substitutions. Protein Eng Des Sel 19:245–253 Rao BM, Girvin AT, Ciardelli T, Lauffenburger DA, Wittrup KD (2003) Interleukin-2 mutants with enhanced alpha-receptor subunit binding affinity. Protein Eng 16:1081–1087 Rao BM, Driver I, Lauffenburger DA, Wittrup KD (2005) High-affinity CD25-binding IL-2 mutants potently stimulate persistent T cell growth. Biochemistry 44:10696–10701 Shpilman M et al (2011) Development and characterization of high affinity leptins and leptin antagonists. J Biol Chem 286:4429–4442 Kariolis MS et al (2014) An engineered Axl “decoy receptor” effectively silences the Gas6-Axl signaling axis. Nat Chem Biol 10:977–983 Weiskopf K et al (2013) Engineered SIRPα variants as immunotherapeutic adjuvants to anticancer antibodies. Science 341:88–91 Weiskopf K et al (2013) Improving macrophage responses to therapeutic antibodies by molecular engineering of SIRPα variants. Oncoimmunology 2:e25773 Tasumi S et al (2009) High-affinity lamprey VLRA and VLRB monoclonal antibodies. Proc Natl Acad Sci U S A 106:12891–12896 Walker LM, Bowley DR, Burton DR (2009) Efficient recovery of high-affinity antibodies from a single-chain Fab yeast display library. J Mol Biol 389:365–375 Shembekar N et al (2013) Isolation of a high affinity neutralizing monoclonal antibody against 2009 pandemic H1N1 virus that binds at the “Sa” antigenic site. PLoS One 8:e55516 Wozniak-Knopp G et al (2010) Introducing antigen-binding sites in structural loops of immunoglobulin constant domains: Fc fragments with engineered HER2/neu-binding sites and antibody properties. Protein Eng Des Sel 23:289–297 Rajpal A et al (2005) A general method for greatly improving the affinity of antibodies by using combinatorial libraries. Proc Natl Acad Sci U S A 102:8466–8471 Boder ET, Raeeszadeh-Sarmazdeh M, Price JV (2012) Engineering antibodies by yeast display. Arch Biochem Biophys 526:99–106

47. Moore SJ, Cochran JR (2012) Engineering knottins as novel binding agents. Methods Enzymol 503:223–251 48. Gera N, Hussain M, Rao BM (2013) Protein selection using yeast surface display. Methods 60:15–26 49. Silverman AP, Kariolis MS, Cochran JR (2011) Cystine-knot peptides engineered with specificities for α(IIb)β(3) or α(IIb)β(3) and α(v) β(3) integrins are potent inhibitors of platelet aggregation. J Mol Recognit 24:127–135 50. Kimura RH, Levin AM, Cochran FV, Cochran JR (2009) Engineered cystine knot peptides that bind alphavbeta3, alphavbeta5, and alpha5beta1 integrins with low-nanomolar affinity. Proteins 77:359–369 51. Silverman AP, Levin AM, Lahti JL, Cochran JR (2009) Engineered cystine-knot peptides that bind alpha(v)beta(3) integrin with antibodylike affinities. J Mol Biol 385:1064–1075 52. Moore SJ, Leung CL, Norton HK, Cochran JR (2013) Engineering agatoxin, a cystineknot peptide from spider venom, as a molecular probe for in vivo tumor imaging. PLoS One 8:e60498 53. Kimura RH et al (2011) Functional mutation of multiple solvent-exposed loops in the Ecballium elaterium trypsin inhibitor-II cystine knot miniprotein. PLoS One 6:e16112 54. Glotzbach B et al (2013) Combinatorial optimization of cystine-knot peptides towards high-affinity inhibitors of human matriptase1. PLoS One 8:e76956 55. Koide A, Bailey CW, Huang X, Koide S (1998) The fibronectin type III domain as a scaffold for novel binding proteins. J Mol Biol 284:1141–1151 56. Lipovsek D (2011) Adnectins: engineered target-binding protein therapeutics. Protein Eng Des Sel 24:3–9 57. Bloom L, Calabro V (2009) FN3: a new protein scaffold reaches the clinic. Drug Discov Today 14:949–955 58. Pavoor TV, Cho YK, Shusta EV (2009) Development of GFP-based biosensors possessing the binding properties of antibodies. Proc Natl Acad Sci U S A 106:11895–11900 59. Lee C-H et al (2010) Engineering of a human kringle domain into agonistic and antagonistic binding proteins functioning in vitro and in vivo. Proc Natl Acad Sci U S A 107:9567–9571 60. Gera N, Hussain M, Wright RC, Rao BM (2011) Highly stable binding proteins derived from the hyperthermophilic Sso7d scaffold. J Mol Biol 409:601–616

Applications of Yeast Surface Display for Protein Engineering 61. Puri V, Streaker E, Prabakaran P, Zhu Z, Dimitrov DS (2013) Highly efficient selection of epitope specific antibody through competitive yeast display library sorting. MAbs 5:533–539 62. Shusta EV, Kieke MC, Parke E, Kranz DM, Wittrup KD (1999) Yeast polypeptide fusion surface display levels predict thermal stability and soluble secretion efficiency. J Mol Biol 292:949–956 63. Kowalski JM, Parekh RN, Wittrup KD (1998) Secretion efficiency in Saccharomyces cerevisiae of bovine pancreatic trypsin inhibitor mutants lacking disulfide bonds is correlated with thermodynamic stability. Biochemistry 37:1264–1273 64. Kowalski JM, Parekh RN, Mao J, Wittrup KD (1998) Protein folding stability can determine the efficiency of escape from endoplasmic reticulum quality control. J Biol Chem 273:19453–19458 65. Shusta EV, Holler PD, Kieke MC, Kranz DM, Wittrup KD (2000) Directed evolution of a stable scaffold for T-cell receptor engineering. Nat Biotechnol 18:754–759 66. Kim Y-S, Bhandari R, Cochran JR, Kuriyan J, Wittrup KD (2006) Directed evolution of the epidermal growth factor receptor extracellular domain for expression in yeast. Proteins 62:1026–1035 67. Esteban O, Zhao H (2004) Directed evolution of soluble single-chain human class II MHC molecules. J Mol Biol 340:81–95 68. Traxlmayr MW, Obinger C (2012) Directed evolution of proteins for increased stability and expression using yeast display. Arch Biochem Biophys 526:174–180 69. Ellgaard L, Helenius A (2003) Quality control in the endoplasmic reticulum. Nat Rev Mol Cell Biol 4:181–191 70. Sitia R, Braakman I (2003) Quality control in the endoplasmic reticulum protein factory. Nature 426:891–894 71. Park S et al (2006) Limitations of yeast surface display in engineering proteins of high thermostability. Protein Eng Des Sel 19: 211–217 72. Pavoor TV, Wheasler JA, Kamat V, Shusta EV (2012) An enhanced approach for engineering thermally stable proteins using yeast display. Protein Eng Des Sel 25:625–630 73. Traxlmayr MW et al (2012) Directed evolution of stabilized IgG1-Fc scaffolds by application of strong heat shock to libraries displayed on yeast. Biochim Biophys Acta 1824:542–549 74. Traxlmayr MW et al (2013) Directed evolution of Her2/neu-binding IgG1-Fc for

75.

76.

77.

78.

79.

80.

81.

82.

83.

84.

85.

86.

173

improved stability and resistance to aggregation by using yeast surface display. Protein Eng Des Sel 26:255–265 Jones DS, Tsai P-C, Cochran JR (2011) Engineering hepatocyte growth factor fragments with high stability and activity as Met receptor agonists and antagonists. Proc Natl Acad Sci U S A 108:13035–13040 Schweickhardt RL, Jiang X, Garone LM, Brondyk WH (2003) Structure-expression relationship of tumor necrosis factor receptor mutants that increase expression. J Biol Chem 278:28961–28967 Buonpane RA, Moza B, Sundberg EJ, Kranz DM (2005) Characterization of T cell receptors engineered for high affinity against toxic shock syndrome toxin-1. J Mol Biol 353:308–321 Jones LL et al (2006) Engineering and characterization of a stabilized alpha1/alpha2 module of the class I major histocompatibility complex product Ld. J Biol Chem 281: 25734–25744 Weber KS, Donermeyer DL, Allen PM, Kranz DM (2005) Class II-restricted T cell receptor engineered in vitro for higher affinity retains peptide specificity and function. Proc Natl Acad Sci U S A 102:19033–19038 Henke E, Bornscheuer UT (1999) Directed evolution of an esterase from Pseudomonas fluorescens. Random mutagenesis by error-prone PCR or a mutator strain and identification of mutants showing enhanced enantioselectivity by a resorufin-based fluorescence assay. Biol Chem 380:1029–1033 Sroga GE, Dordick JS (2001) Generation of a broad esterolytic subtilisin using combined molecular evolution and periplasmic expression. Protein Eng 14:929–937 Stevenson BJ, Yip SH-C, Ollis DL (2013) In vitro directed evolution of enzymes expressed by E. coli in microtiter plates. Methods Mol Biol 978:237–249 Tawfik DS, Griffiths AD (1998) Man-made cell-like compartments for molecular evolution. Nat Biotechnol 16:652–656 Griffiths AD, Tawfik DS (2003) Directed evolution of an extremely fast phosphotriesterase by in vitro compartmentalization. EMBO J 22:24–35 Lipovsek D et al (2007) Selection of horseradish peroxidase variants with enhanced enantioselectivity by yeast surface display. Chem Biol 14:1176–1185 Antipov E, Cho AE, Wittrup KD, Klibanov AM (2008) Highly L and D enantioselective variants of horseradish peroxidase discovered by an ultrahigh-throughput selection method. Proc Natl Acad Sci U S A 105:17694–17699

174

Gerald M. Cherf and Jennifer R. Cochran

87. Chen I, Dorr BM, Liu DR (2011) A general strategy for the evolution of bond-forming enzymes using yeast display. Proc Natl Acad Sci U S A 108:11399–11404 88. Fushimi T et al (2013) Mutant firefly luciferases with improved specific activity and dATP discrimination constructed by yeast cell surface engineering. Appl Microbiol Biotechnol 97:4003–4011 89. Han S, Zhang J, Han Z, Zheng S, Lin Y (2011) Combination of site-directed mutagenesis and yeast surface display enhances Rhizomucor miehei lipase esterification activity in organic solvent. Biotechnol Lett 33:2431–2438 90. Zhang K et al (2013) Engineering the substrate specificity of the DhbE adenylation domain by yeast cell surface display. Chem Biol 20:92–101 91. White KA, Zegelbone PM (2013) Directed evolution of a probe ligase with activity in the secretory pathway and application to imaging intercellular protein-protein interactions. Biochemistry. doi:10.1021/bi400268m 92. Yi L et al (2013) Engineering of TEV protease variants by yeast ER sequestration screening (YESS) of combinatorial libraries. Proc Natl Acad Sci U S A 110:7229–7234 93. Steffens DL, Williams JGK (2007) Efficient site-directed saturation mutagenesis using degenerate oligonucleotides. J Biomol Tech 18:147–149 94. Cochran JR, Kim Y-S, Olsen MJ, Bhandari R, Wittrup KD (2004) Domain-level antibody epitope mapping through yeast surface display of epidermal growth factor receptor fragments. J Immunol Methods 287:147–158 95. Chao G, Cochran JR, Wittrup KD (2004) Fine epitope mapping of anti-epidermal growth factor receptor antibodies through random mutagenesis and yeast surface display. J Mol Biol 342:539–550 96. Boersma YL, Chao G, Steiner D, Wittrup KD, Plückthun A (2011) Bispecific designed ankyrin repeat proteins (DARPins) targeting epidermal growth factor receptor inhibit A431 cell proliferation and receptor recycling. J Biol Chem 286:41273–41285 97. Han T et al (2011) Fine epitope mapping of monoclonal antibodies against hemagglutinin of a highly pathogenic H5N1 influenza virus using yeast surface display. Biochem Biophys Res Commun 409:253–259 98. Mata-Fink J et al (2013) Rapid conformational epitope mapping of anti-gp120 antibodies with a designed mutant panel displayed on yeast. J Mol Biol 425:444–456

99. Pepper LR, Cho YK, Boder ET, Shusta EV (2008) A decade of yeast surface display technology: where are we now? Comb Chem High Throughput Screen 11:127–134 100. Gai SA, Wittrup KD (2007) Yeast surface display for protein engineering and characterization. Curr Opin Struct Biol 17:467–473 101. Bidlingmaier S, Liu B (2006) Construction and application of a yeast surface-displayed human cDNA library to identify posttranslational modification-dependent proteinprotein interactions. Mol Cell Proteomics 5:533–540 102. Bidlingmaier S et al (2009) Identification of MCAM/CD146 as the target antigen of a human monoclonal antibody that recognizes both epithelioid and sarcomatoid types of mesothelioma. Cancer Res 69:1570–1577 103. Bidlingmaier S, Liu B (2007) Interrogating yeast surface-displayed human proteome to identify small molecule-binding proteins. Mol Cell Proteomics 6:2012–2020 104. Kondo A, Tanaka T, Hasunuma T, Ogino C (2010) Applications of yeast cell-surface display in bio-refinery. Recent Pat Biotechnol 4:226–234 105. Tanaka T, Yamada R, Ogino C, Kondo A (2012) Recent developments in yeast cell surface display toward extended applications in biotechnology. Appl Microbiol Biotechnol 95:577–591 106. Fujita Y et al (2002) Direct and efficient production of ethanol from cellulosic material with a yeast strain displaying cellulolytic enzymes. Appl Environ Microbiol 68:5136–5141 107. Katahira S, Mizuike A, Fukuda H, Kondo A (2006) Ethanol fermentation from lignocellulosic hydrolysate by a recombinant xylose- and cellooligosaccharide-assimilating yeast strain. Appl Microbiol Biotechnol 72:1136–1143 108. Shigechi H et al (2004) Direct production of ethanol from raw corn starch via fermentation by use of a novel surface-engineered yeast strain codisplaying glucoamylase and alpha-amylase. Appl Environ Microbiol 70:5037–5040 109. Tsai S-L, DaSilva NA, Chen W (2013) Functional display of complex cellulosomes on the yeast surface via adaptive assembly. ACS Synth Biol 2:14–21 110. Kim S, Baek S-H, Lee K, Hahn J-S (2013) Cellulosic ethanol production using a yeast consortium displaying a minicellulosome and β-glucosidase. Microb Cell Fact 12:14 111. Tsai S-L, Oh J, Singh S, Chen R, Chen W (2009) Functional assembly of minicellulosomes on the Saccharomyces cerevisiae cell

Applications of Yeast Surface Display for Protein Engineering

112.

113.

114.

115.

116.

117.

118.

119.

120.

surface for cellulose hydrolysis and ethanol production. Appl Environ Microbiol 75:6087–6093 Tsai S-L, Goyal G, Chen W (2010) Surface display of a functional minicellulosome by intracellular complementation using a synthetic yeast consortium and its application to cellulose hydrolysis and ethanol production. Appl Environ Microbiol 76:7514–7520 Matsumoto T, Fukuda H, Ueda M, Tanaka A, Kondo A (2002) Construction of yeast strains with high cell surface lipase activity by using novel display systems based on the Flo1p flocculation functional domain. Appl Environ Microbiol 68:4517–4522 Pan X-X et al (2012) Efficient display of active Geotrichum sp. lipase on Pichia pastoris cell wall and its application as a whole-cell biocatalyst to enrich EPA and DHA in fish oil. J Agric Food Chem 60:9673–9679 Kim S, Oh D-B, Kwon O, Kang HA (2010) Construction of an in vitro trans-sialylation system: surface display of Corynebacterium diphtheriae sialidase on Saccharomyces cerevisiae. Appl Microbiol Biotechnol 88: 893–903 Wang H et al (2013) Yeast surface displaying glucose oxidase as whole-cell biocatalyst: construction, characterization, and its electrochemical glucose sensing application. Anal Chem 85:6107–6112 Ren R et al (2007) Display of adenoregulin with a novel Pichia pastoris cell surface display system. Mol Biotechnol 35:103–108 Jo J-H, Im E-M, Kim S-H, Lee H-H (2011) Surface display of human lactoferrin using a glycosylphosphatidylinositol-anchored protein of Saccharomyces cerevisiae in Pichia pastoris. Biotechnol Lett 33:1113–1120 Shibasaki S et al (2013) An oral vaccine against candidiasis generated by a yeast molecular display system. Pathog Dis 69: 262–268 Tamaru Y et al (2006) Application of the arming system for the expression of the 380R antigen from red sea bream iridovirus (RSIV) on the surface of yeast cells: a first step for the

121.

122.

123.

124.

125.

126.

127.

128.

129.

130.

175

development of an oral vaccine. Biotechnol Prog 22:949–953 Wasilenko JL, Sarmento L, Spatz S, PantinJackwood M (2010) Cell surface display of highly pathogenic avian influenza virus hemagglutinin on the surface of Pichia pastoris cells using alpha-agglutinin for production of oral vaccines. Biotechnol Prog 26:542–547 Kotrba P, Ruml T (2010) Surface display of metal fixation motifs of bacterial P1-type ATPases specifically promotes biosorption of Pb(2+) by Saccharomyces cerevisiae. Appl Environ Microbiol 76:2615–2622 Kuroda K, Shibasaki S, Ueda M, Tanaka A (2001) Cell surface-engineered yeast displaying a histidine oligopeptide (hexa-His) has enhanced adsorption of and tolerance to heavy metal ions. Appl Microbiol Biotechnol 57:697–701 Kuroda K, Ueda M (2003) Bioadsorption of cadmium ion by cell surface-engineered yeasts displaying metallothionein and hexa-His. Appl Microbiol Biotechnol 63:182–186 Kuroda K, Ueda M, Shibasaki S, Tanaka A (2002) Cell surface-engineered yeast with ability to bind, and self-aggregate in response to, copper ion. Appl Microbiol Biotechnol 59:259–264 Kuroda K, Nishitani T, Ueda M (2012) Specific adsorption of tungstate by cell surface display of the newly designed ModE mutant. Appl Microbiol Biotechnol 96:153–159 Kuroda K, Ueda M (2006) Effective display of metallothionein tandem repeats on the bioadsorption of cadmium ion. Appl Microbiol Biotechnol 70:458–463 Nishitani T, Shimada M, Kuroda K, Ueda M (2010) Molecular design of yeast cell surface for adsorption and recovery of molybdenum, one of rare metals. Appl Microbiol Biotechnol 86:641–648 Midelfort KS et al (2004) Substantial energetic improvement with minimal structural perturbation in a high affinity mutant antibody. J Mol Biol 343:685–701 Pettersen EF et al (2004) UCSF Chimera—a visualization system for exploratory research and analysis. J Comput Chem 25:1605–1612

Part III Yeast Surface cDNA Display Library Construction and Applications

Chapter 9 Identification of Novel Protein–Ligand Interactions by Exon Microarray Analysis of Yeast Surface Displayed cDNA Library Selection Outputs Scott Bidlingmaier and Bin Liu Abstract Yeast surface display is widely utilized to screen large libraries for proteins or protein fragments with specific binding properties. We have previously constructed and utilized yeast surface displayed human cDNA libraries to identify protein fragments that bind to various target ligands. Conventional approaches employ monoclonal screening and sequencing of polyclonal outputs that have been enriched for binding to a target molecule by several rounds of affinity-based selection. Frequently, a small number of clones will dominate the selection output, making it difficult to comprehensively identify potentially important interactions due to low representation in the selection output. We have developed a novel method to address this problem. By analyzing selection outputs using high-density human exon microarrays, the full potential of selection output diversity can be revealed in one experiment. FACS-based selection using yeast surface displayed human cDNA libraries combined with exon microarray analysis of the selection outputs is a powerful way of rapidly identifying protein fragments with affinity for any soluble ligand that can be fluorescently detected, including small biological molecules and drugs. In this report we present protocols for exon microarray-based analysis of yeast surface display human cDNA library selection outputs. Key words Yeast surface display, cDNA library, Exon microarray, Phosphatidylinositide, Novel nuclear phosphatidylinositide-binding proteins

1

Introduction Identifying proteins that interact with small bioactive molecules such as phosphatidylinositides is an important, but often challenging and rate-limiting step in understanding cellular signaling pathways. Using yeast surface display techniques, heterologous protein fragments can be efficiently displayed on the surface of the Saccharomyces cerevisiae yeast cell as C-terminal fusions to the yeast a-agglutinin subunit, Aga2p [1] and this technology has been extensively utilized in protein engineering applications such as antibody affinity maturation and epitope mapping [2–5]. We have previously described the construction of large (2 × 107) yeast

Bin Liu (ed.), Yeast Surface Display: Methods, Protocols, and Applications, Methods in Molecular Biology, vol. 1319, DOI 10.1007/978-1-4939-2748-7_9, © Springer Science+Business Media New York 2015

179

180

Scott Bidlingmaier and Bin Liu

surface-displayed human protein fragment libraries [6–8]. When coupled with fluorescence-activated cell sorting (FACS), yeast surface-displayed human protein fragment libraries can theoretically be used to identify protein fragments with affinity for any soluble molecule that can be fluorescently detected. These libraries have been used to identify human protein fragments with affinity for tyrosine-phosphorylated peptides [6], tumor-targeting antibodies [9], and phosphatidylinositides (PtdIns) [7]. Often a small number of clones become dominant during selection, making it likely that rare binding clones in the selection output will be missed by monoclonal screening. To capture the full diversity of yeast surface display selection outputs, we have developed methods using high-density human exon microarrays (see Fig. 1 for method outline). We applied these methods to PtdInsbinding enriched polyclonal yeast selection outputs that had been previously analyzed by standard monoclonal screening and sequencing. In addition to the nine PtdIns-binding protein fragments previously identified by monoclonal screening and sequencing [7], we identified an additional 17 novel PtdIns-binding protein fragments [10] (Table 1). Our results suggest that affinitybased selections with yeast human cDNA display libraries coupled with comprehensive analysis of the outputs using DNA microarrays is a rapid and efficient method for identifying protein interactions. In this report we describe protocols for the analysis of yeast surface display human cDNA library selection outputs using human exon microarrays.

2

Materials

2.1 Plasmid Recovery

1. Polyclonal yeast surface display selection outputs (see Note 1). 2. 10× SD-CAA for making plates: 70 g yeast nitrogen base w/o amino acids, 50 g Bacto casamino acids, 100 g dextrose; bring the volume to 500 mL with ddH2O and filter-sterilize. 3. SD-CAA plates: 5.4 g Na2HPO2, 7.4 g NaH2PO4, 17 g agar. Bring the volume to 900 mL with ddH2O, autoclave to sterilize, let the agar cool until it is cool enough to touch, add 100 mL 10× SD-CAA, mix and pour into plates (100 or 150 mm) and allow to cool at RT, and store the plates at 4 °C until ready to use. 4. Acid-washed glass beads (Sigma). 5. Spin miniprep kit (Qiagen). 6. 10G Supreme electrocompetent cells (Lucigen). 7. Transformation recovery medium (supplied with 10G Supreme cells). 8. 1 mm Electroporation cuvettes (Molecular BioProducts).

Analyze Yeast cDNA Display Selection Output by Exon Array

181

Fig. 1 Diagram of procedure for enrichment of clones displaying PtdIns-binding protein fragments and comprehensive exon microarray analysis of polyclonal selection output. A yeast library displaying human protein fragments was incubated with labeled PtdIns and binding yeast clones were enriched through several rounds of FACS. Polyclonal plasmid containing cDNAs encoding PtdIns-binding protein fragments was isolated from the polyclonal selection output and used as a template for in vitro transcription to generate biotin-labeled RNA. The labeled RNA was hybridized to the exon microarray and data was collected and analyzed. (This research was originally published in Mol Cell Proteomics [10] © the American Society for Biochemistry and Molecular Biology)

182

Scott Bidlingmaier and Bin Liu

Table 1 FACS-validated phosphatidylinositide-binding protein fragments identified by exon microarray analysis of yeast surface displayed cDNA library selection outputs. Expressed regions and total aa lengths are shown Protein

Expressed aa

APOH

94–345

345

ARNO

226–399

399

a

ATN1

Total aa

1–229

1,190

CRABP1

1–137

137

CRIP1Aa

1–140

164

2–221

771

FAM71B

267–546

605

GAB2

1–125

676

6–90

90

a

DAB2 a

HMGN2a

PtdIns-binding domain (aa)

PH (261–386)

PTB (36–176)

PH (9–116)

a

206–270

270

a

HOXB6

136–224

224

HOXC6a

150–235

235

144–255

255

NUCKS1

54–243

243

OSBP2

5–290

915

PH (185–272)

PDK1

232–429

429

PH (330–394)

PNPLA7a

1,013–1,274

HOXA5

HOXD4a a

a

POLS

412–542

PSD

739–1,024

PTPN5a

1,317 542 1,024

1–60

565

RNPS1

1–230

305

SBF1

1,638–1,893

SFRS4a

409–494

a

SPTBN2 a

WDR60 a

WNK1

1,893

PH (758–874)

PH (1,790–1,890)

494

2,101–2,390

2,390

60–260

1,066

924–1,156

2,382

PH (2,221–2,304)

aa amino acids, C2 C2 domain, PH pleckstrin homology domain, PTB phospho-tyrosine binding domain a PtdIns-binding protein fragments identified by human exon microarray analysis that were missed by monoclonal screening

Analyze Yeast cDNA Display Selection Output by Exon Array

183

9. Electroporators (Eppendorf 2510, Bio-Rad Gene Pulser II). 10. 2× YT: 16 g tryptone, 10 g yeast extract, 5 g NaCl, bring volume to 1 L with ddH2O, adjust pH to 7.0, and sterilize by autoclaving. 11. 1,000× ampicillin: 1 g ampicillin, add ddH2O to 10 mL, sterilize by filtration and aliquot, and store aliquots at −20 °C. 12. 150 mm 2× YT ampicillin plates: 16 g tryptone, 10 g yeast extract, 5 g NaCl, 17 g agar, bring volume to 1 L with ddH2O, adjust pH to 7.0, sterilize by autoclaving, let cool until not too hot to touch and add 1 mL 1,000× ampicillin. 13. Maxiprep kit (Qiagen). 2.2 Preparation of Biotinylated cRNA Probes

1. Plasmids recovered from polyclonal selection output (described in Subheading 3.1). 2. XhoI restriction enzyme. 3. NotI restriction enzyme. 4. 10× React 3. 5. Qiagen spin prep kit. 6. Biotin-16-UTP. 7. Ambion MAXIscript T7 kit (Ambion). 8. RNeasy Mini Kit (Qiagen).

2.3 Exon Microarray Data Analysis

1. Affymetrix GeneChip® Human Exon 1.0 ST Array (Affymetrix) (see Note 2). 2. Affymetrix Expression Console software (Affymetrix) (see Note 3). 3. Integrated Genome Browser software [7] (see Note 4). 4. Excel (Microsoft).

2.4 Recovery of Putative Binding Clones

1. cDNA-specific primer sets designed using the exon microarray data (see Note 5). 2. pYD1-specific primers: pYD1 Forward 5′-AGTAACGTTTG TCAGTAATTGC-3′, pYD1 Reverse 5′-GTCGATTTT GTTACATCTACAC-3′ (see Note 6). 3. 10× PCR buffer. 4. dNTPs. 5. Taq polymerase. 6. Primers for sequencing: Gap5 5′-TTAAGCTTCTGCAGGC TAGTG-3′, Gap3 5′-GTTAGGGATAGGCTTACCTTC-3′ (see Note 6). 7. Primer sets based on the 5′ and 3′ boundaries of the cDNA inserts with added EcoRI overhangs for cloning into pYD1 (see Note 7).

184

Scott Bidlingmaier and Bin Liu

8. EcoRI restriction enzyme and 10× EcoRI buffer. 9. pYD1 or suitable yeast display vector. 10. T4 DNA ligase and 10× ligation buffer. 11. Chemically competent E. coli cells. 12. Heat block at 42 °C. 13. 1,000× Ampicillin: 1 g ampicillin, add ddH2O to 10 mL, sterilize by filtration and aliquot, and store aliquots at −20 °C. 14. 100 mm 2× YT ampicillin plates: 16 g tryptone, 10 g yeast extract, 5 g NaCl, 17 g agar, bring volume to 1 L with ddH2O, adjust pH to 7.0, sterilize by autoclaving, let cool until not too hot to touch and add 1 mL 1,000× ampicillin and pour. 15. Spin miniprep kit (Qiagen). 16. S. cerevisiae strain EBY100 (MATa GAL1-AGA1::URA3 ura352 trp1 leu2Δ1 his3Δ200 pep4::HIS3 prb1Δ1.6R can1 GAL). 17. YPD: 10 g of yeast extract, 20 g of bacteriological peptone, 20 g dextrose, bring volume to 1 L with ddH2O, and filter-sterilize. 18. 50 % PEG-3350: 250 g PEG-3350, bring volume to 500 mL with ddH2O, and filter-sterilize. 19. 1 M lithium acetate: 33 g lithium acetate, bring volume to 500 mL with ddH2O, and filter-sterilize. 20. 10× SD-CAA for making plates: 70 g yeast nitrogen base without amino acids, 50 g Bacto casamino acids, 100 g dextrose, bring volume to 500 mL with ddH2O, and filter-sterilize. 21. SD-CAA plates: 5.4 g Na2HPO2, 7.4 g NaH2PO4, 17 g agar, bring volume to 900 mL with ddH2O and autoclave, let cool until not too hot to touch and add 100 mL 10× SD-CAA, pour plates of desired size (100 or 150 mm) and allow to cool at RT, and store plates at 4 °C until ready to use (see Note 8). 2.5

FACS

1. 2× SR-CAA yeast growth media: 20 g raffinose, 14 g yeast nitrogen base, 10 g Bacto casamino acids, 5.4 g Na2HPO4, 7.4 g NaH2PO4, bring volume to 1 L with ddH2O, and filter-sterilize. 2. 20 % Galactose: 100 g galactose; bring the volume to 500 mL with ddH2O and filter-sterilize. 3. PBS: 8 g of NaCl, 0.2 g of KCl, 1.44 g of Na2HPO4, 0.24 g of KH2PO4, bring the volume to 1 L with ddH2O, adjust pH to 7.4, and sterilize by autoclaving or filtration. 4. Biotinylated or fluorescently labeled target molecules (see Note 9). 5. Mouse anti-Xpress (Invitrogen). 6. Goat anti-mouse-647 (Jackson ImmunoResearch). 7. Streptavidin-PE (SA-PE) (Invitrogen).

Analyze Yeast cDNA Display Selection Output by Exon Array

3

185

Methods Protocols detailing the construction and use of yeast surfacedisplayed human protein fragment libraries for FACS-based enrichment of protein fragments with affinity for various target ligands have been described previously [8, 11]. Here we describe protocols for the comprehensive analysis of enriched polyclonal yeast surface display selection outputs using exon microarrays. It is assumed that a core facility or commercial service will be performing the chip hybridization and data collection steps and therefore protocols for these steps are not described. Additionally, since the Affymetrix Expression Console software used to process the raw chip data is frequently updated, detailed protocols for the software-based data processing will not be described. Instead, a brief outline of the data analysis we performed will be presented. Affymetrix provides detailed instruction manuals and video tutorials for the current version of the Expression Console software package on their website. The core facility or commercial service provider may also offer data analysis services. The methods below are divided into five categories: Plasmid Recovery From Polyclonal Yeast Display Selection Outputs (Subheading 3.1); Preparation of Biotinylated cRNA probes (Subheading 3.2); Exon Microarray Data Analysis (Subheading 3.3); Recovery of putative binding clones (Subheading 3.4); Testing candidate binding clones by FACS (Subheading 3.5).

3.1 Plasmid Recovery from Poly clonal Yeast Display Selection Outputs

1. Prewarm and dry one 150 mm SD-CAA plate for each selection output to be analyzed in a 30 °C incubator. Thaw freezer stocks of the selection outputs at RT and evenly spread 100 μL of each selection output on a 150 mm SD-CAA plate. Incubate the plates upside down at 30 °C for 1–2 days (see Note 10). 2. Add 5 mL of 2× SR-CAA to each plate, resuspend the cells by scraping with a flame-sterilized spreader, and then collect the resuspended cells by pipetting. Recover an approximately 200 μL yeast cell pellet by centrifugation and wash twice with ddH2O. 3. Resuspend the pellet in 400 μL Qiagen buffer P1 (see Note 11) and add approximately 400 μL glass beads (the beads should be about 50 % of the total volume). Vortex at high speed for 10 min and remove 250 μL of the cell slurry (leaving the glass beads behind) to a clean tube. 4. Add 250 μL buffer P2, gently mix by inverting, and incubate at RT for 5 min. 5. Add 350 μL buffer N3 (a cloudy precipitate will form) and spin at 16,000 × g in a microcentrifuge for 15 min. 6. Apply supernatant to a Qiagen spin miniprep column and spin at 16,000 × g for 1 min. Discard flow-through.

186

Scott Bidlingmaier and Bin Liu

7. Add 750 μL buffer PE and spin at 16,000 × g for 1 min. Discard flow-through and spin at 16,000 × g for 2 min to remove residual buffer PE. Replace collection tube with a clean Eppendorf tube, add 50 μL ddH2O, and spin at 16,000 × g for 1 min to elute. 8. Prewarm transformation recovery medium at 37 °C. Place electroporation cuvettes on ice. Thaw 10G supreme cells completely on ice (10–20 min) and aliquot 25 μL of cells for each output to be recovered to prechilled 1.5 mL Eppendorf tubes on ice. Add 4 μL of each of the polyclonal output yeast plasmid preps to the tubes with cells and stir gently without pipetting up and down. 9. Transfer 25 μL of the cell/ligation mixture to the chilled electroporation cuvettes, and electroporate using the following conditions (see Note 12). 10 μF 600 Ω 1,800 V Immediately add approximately 1 mL of the prewarmed recovery medium to the cuvette, resuspend the cells, and transfer to 17 mm culture tubes. 10. Incubate tubes at 37 °C with shaking at 250 rpm for 1 h. Dry 2× Y T-ampicillin plates at 37 °C while transformations are recovering. 11. Plate 1/10,000 of each transformation on a 2× YT-ampicillin plate for titering, and plate the remaining transformation cultures on three more plates at approximately 350 mL/plate. Incubate the plates overnight at 37 °C (see Note 13). 12. Add 3 mL 2× YT + ampicillin to each of the plates, resuspend cells with a flame-sterilized spreader, and collect by pipetting. 13. Prepare bacterial freezer stocks of the library by mixing 0.5 mL 50 % glycerol and 0.5 mL of the resuspended transformants in a cryotube and store at −80 °C. 14. Prepare several minipreps or a Qiagen maxiprep using the remaining resuspended transformants according to manufacturer’s protocols. Determine the concentration of the library DNA prep using a spectrophotometer. 3.2 Preparation of Biotinylated cRNA Probes

1. Set up the following digestions: 4 μL 10× React 3 10 μg recovered selection output plasmid 2 μL NotI Bring volume to 40 μL with ddH2O 4 μL 10× React 3

Analyze Yeast cDNA Display Selection Output by Exon Array

187

10 μg recovered selection output plasmid 2 μL XhoI Bring volume to 40 μL with ddH2O Incubate at 37 °C for 3 h (see Note 14). 2. Run the digestions on a 0.75 % agarose gel, cut out linearized bands with a clean razor blade, and isolate DNA using Qiagen gel isolation kit following manufacturer’s protocols. Elute in 50 μL EB buffer, combine the gel purified NotI and XhoI digestions, and measure the concentration with a spectrometer. 3. Thaw the frozen reagents from Ambion MAXIscript T7 kit. Vortex the 10× Transcription Buffer and ribonucleotide solutions until they are completely in solution. Once they are thawed, store the ribonucleotides on ice, but keep the 10× Transcription Buffer at room temp. Assemble transcription reaction at room temperature, adding the 10× Transcription Buffer after the water and template DNA are already in the tube: Nuclease-free water to

20 μL

DNA template

1 μg

10× transcription buffer

2 μL

10 mM ATP

1 μL

10 mM CTP

1 μL

10 mM GTP

1 μL

10 mM UTP

0.6 μL

10 mM biotin-16-UTP

0.4 μL

T7 enzyme mix

2 μL

4. Incubate for 1 h at 37 °C 5. Add 1 μL TURBO DNase, mix well, and incubate at 37 °C for 15 min 6. Purify the biotinylated cRNA probe from the in vitro transcription reaction using the RNeasy Mini Kit according to manufacturer’s instructions and quantitate using spectrophotometer (see Note 15). 3.3 Exon Microarray Data Analysis

Since it is assumed that that probe hybridization and data collection will be performed by a core facility or commercial service, detailed protocols for the exon chip hybridization and data collection will not be presented here. Briefly, the biotinylated cRNA probes were fragmented by sonication and 5 μg of each was hybridized to an Affymetrix GeneChip® Human Exon 1.0 ST Array and scanned with an Affymetrix GeneChip Scanner 3000 (Affymetrix) according to manufacturer’s instructions at a core facility.

188

Scott Bidlingmaier and Bin Liu

Although it is beyond the scope of this review to provide a detailed protocol for the software-based data analysis, a brief outline of the strategy we used to analyze the raw data with Affymetrix Expression Console and Integrated Genome Browser software [12] and generate a list of binding candidates for validation is presented below. Please refer to the Affymetrix website for detailed manuals and tutorials that describe use of current software versions. 1. Process .cel files using Expression Console software. 2. Generate list of ranked probeset intensities using Expression Console. 3. Calculate gene expression level using Expression Console and transfer annotated results to excel. 4. Visualize .chp files using Integrated Genome Browser software and examine high scoring genes and top probeset intensities. Look for genes with multiple continuous high-scoring probesets within the exons (see Fig. 2 for examples) (see Note 16). 5. Make a list of candidate binders and estimate the boundaries of the cDNA for each candidate based on the probeset intensity values (see Note 17). 3.4 Recovery of Putative Binding Clones

1. Design a forward and reverse primer located near the middle of each predicted candidate gene cDNA (see Note 18). 2. Set up standard PCR reactions using candidate cDNA-specific and vector-specific (pYD1 Forward and pYD1 Reverse) primers and 1 ng of the appropriate selection output plasmid prep as template. 3. Run PCR reactions on 1.5 % agarose gel, cut out bands with a clean razor blade, and isolate DNA using Qiagen gel isolation kit following manufacturer’s protocols. Elute in 50 μL EB buffer or ddH2O. 4. Sequence purified PCR products using the appropriate primer (Gap5 for PCRs done with pYD1 Forward or Gap3 for PCRs done with pYD1 Reverse). 5. Analyze sequence data to define the precise 5′ and 3′ cDNA insert boundaries and determine if the cDNA encoded protein is in-frame with AGA2 in the pYD1 yeast display vector. 6. Design new primer sets based on the newly determined 5′ and 3′ boundaries of the cDNA inserts, adding EcoRI overhangs to facilitate cloning (see Note 7). 7. PCR amplify the cDNA inserts using the cDNA-specific primer sets and gel purify. 8. Digest pYD1 and the candidate cDNA PCR products with EcoRI, purify, ligate, transform, miniprep colonies using standard molecular biology procedures, and sequence to confirm using the Gap5 sequencing primer.

Analyze Yeast cDNA Display Selection Output by Exon Array

189

Fig. 2 Visualization of probeset intensity data collected from an Affymetrix GeneChip® Human Exon 1.0 ST Array hybridized with cRNA probes prepared from polyclonal yeast cDNA display selection outputs enriched for binding to PtdIns [6]. The gene exon structure is shown in green. Intensity values for exon-associated probesets are represented by red bars below the gene exon structure. The exon structure and probeset intensity data is visualized using Integrated Genome Browser software. Grey bars represent the total protein with boxes indicating the location of known functional domains (PH, pleckstrin homology domain; PTB, phosphotyrosinebinding domain). The blue bars below represent the protein fragments encoded by the cDNA inserts determined by sequencing. Since the gene exon structures are interrupted by non-protein coding intronic sequences, they do not precisely align with the proteins depicted above. (This research was originally published in Mol Cell Proteomics [10] © the American Society for Biochemistry and Molecular Biology)

9. Inoculate a 5 mL YPD culture with EBY100 and grow overnight with shaking at 30 °C and 200 rpm. 10. Determine concentration of the overnight yeast culture by measuring the OD600 of a 1:20 dilution using a spectrophotometer (1 OD600 = 2 × 107/mL). 11. Use the overnight culture to inoculate a culture in YPD (the inoculation volume should be at least 1 mL/transformation) at 0.5 OD600 and incubate at 30 °C, 200 rpm for 4–5 h (at least two cell divisions).

190

Scott Bidlingmaier and Bin Liu

12. For each transformation, pellet 1 mL of the EBY100 culture by centrifugation at 3,000 × g for 3 min, wash with 1 mL sterile ddH2O, and remove ddH2O. 13. To each tube of cells, add the following in this order: 240 μL 50 % PEG-3350 36 μL 1.0 M lithium acetate 5 μg plasmid (candidate cDNAs cloned into pYD1). Bring volume to 360 μL with sterile ddH2O. 14. Vortex transformation mix vigorously and incubate tubes at 42 °C in a water bath for 40 min. 15. Spin transformation tubes at top speed for 30 s and remove transformation mix. Resuspend pellet in 100 μL sterile ddH2O and plate on prewarmed SD-CAA plates. Incubate the plates inverted at 30 °C for 3–4 days until colonies grow. Clones can be stored in SD-CAA + 20 % glycerol at −80 °C. 3.5 Testing Candidate Binding Clones by FACS

1. Inoculate 2 mL 2× SRG-CAA (2× SR-CAA + 2 % galactose) cultures with yeast colonies from candidate cDNA transformations and grow for at least 16 h with shaking at 30 °C. 2. Pellet 200 μL of the overnight cultures using a tabletop microfuge and wash twice with 1 mL PBS. 3. Incubate yeast for 1 h at room temperature with 100 μL of an appropriate concentration of biotinylated or fluorescently labeled target molecule (see Note 9) and mouse anti-Xpress antibody (1/1,000 dilution of stock solution) in PBS (see Note 19). 4. Wash yeast twice with 1 mL PBS and incubate with 100 μL 1/1,000 SA-PE and 1/1,000 Alexa fluor 647-conjugated anti-mouse secondary antibody in PBS for 30 min. 5. Wash twice with 1 mL PBS and analyze the yeast by FACS.

4

Notes 1. We have previously described protocols for the construction of yeast surface-displayed human cDNA libraries [4, 8] and their application to identify human protein fragments with affinity for tyrosine-phosphorylated peptides [2], tumor-targeting antibodies [5], and phosphatidylinositides [3]. As a starting point for exon microarray analysis we use polyclonal yeast surface displayed human cDNA selection outputs enriched for clones that bind to the desired target ligand. We enrich for target binding by FACS until the fraction of binding clones in the polyclonal outputs is greater than 90 %.

Analyze Yeast cDNA Display Selection Output by Exon Array

191

2. The GeneChip® Human Exon 1.0 ST Array has 1.4 million total probe sets (approximately four probes per exon and roughly 40 probes per gene). The probes tiled on the array are designed in the antisense orientation, requiring sense-strand labeled targets to be hybridized to the array. For more information about the GeneChip® Human Exon 1.0 ST Array consult the Affymetrix website. 3. Expression Console Software is used to analyze microarray data and is freely available on the Affymetrix website. 4. The Integrated Genome Browser is an application that allows the graphic visualization of exon microarray-generated data in the context of an annotated human genome. 5. After estimating the 5′ and 3′ boundaries of the cDNA candidates, internal primers should be designed to amplify the 5′ and 3′ cDNA/vector junctions. We find it convenient for downstream gel isolation to design the primers to produce an approximately 500 bp product. 6. If a yeast display vector other than pYD1 is utilized then different primers will need to be designed. 7. Design primers to amplify the candidate cDNAs based on the sequencing data. Take care to ensure that the cDNA coding regions will be in frame with Aga2 after cloning into the display vector. 8. Antibiotics (ampicillin and/or tetracycline) can be added to the plates if contamination is an issue. 9. It is best to use the same labeled target reagents that were utilized during the selection process. 10. The yeast should form an almost continuous layer of colonies. If the number of colonies seems too low to cover the expected diversity, more volume can be plated. 11. The method we describe is based on the Qiagen spin miniprep kit. The buffers used (P1, P2, N3, and EB) are provided in the kit. 12. We use an Eppendorf 2510 electroporator. Other electroporators should work similarly using the same settings. The time constant should be 3.5–4.5 ms. 13. There should be at least 100 colonies on the 1/10,000 titer plate. If the transformation efficiency is low, it will need to be repeated. 14. We use two different enzymes to linearize the plasmid to minimize the chances of cutting in the cDNA insert. 15. We hybridized 5 μg of each biotinylated cRNA probe to the exon array chip. If less than this amount is recovered after purification, the in vitro transcription reaction will need to be repeated.

192

Scott Bidlingmaier and Bin Liu

16. There will be some background from the common vector sequences in the in vitro transcribed probes. If data from several selection outputs is simultaneously visualized in the Integrated Genome Browser, it is easy to identify probesets with a high nonspecific background signal. 17. The sequences of the high signal intensity probes within a candidate gene can be recovered from within the Integrated Genome Browser. 18. We designed the primers to produce products about 500 bp in size for efficient PCR and gel-based purification. 19. There is an Xpress epitope upstream of the cDNA inserts in the pYD1 yeast display vector allowing the efficiency of surface display to be monitored using and anti-Xpress antibody.

Acknowledgments The work is supported by grants from the National Institute of Health (R01 CA171315, R01 CA118919, and R01 CA129491). References 1. Boder ET, Wittrup KD (1997) Yeast surface display for screening combinatorial polypeptide libraries. Nat Biotechnol 15(6):553–557 2. Feldhaus MJ, Siegel RW, Opresko LK et al (2003) Flow-cytometric isolation of human antibodies from a nonimmune Saccharomyces cerevisiae surface display library. Nat Biotechnol 21(2):163–170 3. Cochran JR, Kim Y-S, Olsen MJ et al (2004) Domain-level antibody epitope mapping through yeast surface display of epidermal growth factor receptor fragments. J Immunol Methods 287(1–2):147–158 4. Gai SA, Wittrup KD (2007) Yeast surface display for protein engineering and characterization. Curr Opin Struct Biol 17(4):467–473 5. Pepper LR, Cho YK, Boder ET, Shusta EV (2008) A decade of yeast surface display technology: where are we now? Comb Chem High Throughput Screen 11(2):127–134 6. Bidlingmaier S, Liu B (2006) Construction and application of a yeast surface-displayed human cDNA library to identify post-translational modification-dependent protein-protein interactions. Mol Cell Proteomics 5(3):533–540 7. Bidlingmaier S, Liu B (2007) Interrogating yeast surface-displayed human proteome to

8.

9.

10.

11.

12.

identify small molecule-binding proteins. Mol Cell Proteomics 6(11):2012–2020 Bidlingmaier S, Liu B (2011) Construction of yeast surface-displayed cDNA libraries. Methods Mol Biol 729:199–210 Bidlingmaier S, He J, Wang Y et al (2009) Identification of MCAM/CD146 as the target antigen of a human monoclonal antibody that recognizes both epithelioid and sarcomatoid types of mesothelioma. Cancer Res 69(4):1570–1577 Bidlingmaier S, Wang Y, Liu Y et al (2011) Comprehensive analysis of yeast surface displayed cDNA library selection outputs by exon microarray to identify novel protein-ligand interactions. Mol Cell Proteomics 10(3). http://www.mcponline.org/content/10/3/ M110.005116. Accessed 24 Sep 2013 Bidlingmaier S, Liu B (2011) Identification of protein/target molecule interactions using yeast surface-displayed cDNA libraries. Methods Mol Biol 729:211–223 Nicol JW, Helt GA, Blanchard SG et al (2009) The Integrated Genome Browser: free software for distribution and exploration of genome-scale datasets. Bioinformatics 25(20):2730–2731

Chapter 10 Identification of Posttranslational Modification-Dependent Protein Interactions Using Yeast Surface Displayed Human Proteome Libraries Scott Bidlingmaier and Bin Liu Abstract The identification of proteins that interact specifically with posttranslational modifications such as phosphorylation is often necessary to understand cellular signaling pathways. Numerous methods for identifying proteins that interact with posttranslational modifications have been utilized, including affinity-based purification and analysis, protein microarrays, phage display, and tethered catalysis. Although these techniques have been used successfully, each has limitations. Recently, yeast surface-displayed human proteome libraries have been utilized to identify protein fragments with affinity for various target molecules, including phosphorylated peptides. When coupled with fluorescently activated cell sorting and high throughput methods for the analysis of selection outputs, yeast surface-displayed human proteome libraries can rapidly and efficiently identify protein fragments with affinity for any soluble ligand that can be fluorescently detected, including posttranslational modifications. In this review we compare the use of yeast surface display libraries to other methods for the identification of interactions between proteins and posttranslational modifications and discuss future applications of the technology. Key words Posttranslational modification, Yeast surface display, cDNA library, Phosphopeptide, Src homology 2, Phosphotyrosine binding domains, Plant homeodomain finger, Glycosylation, Lipidation, Sumoylation, Acetylation, Ubiquitination, Methylation

1

Importance of Posttranslational Modification-Dependent Protein Interactions For many if not most cellular processes, posttranslational modifications (PTMs) play a critical role in signal transmission or functional regulation. More than 200 types of PTM are generated by thousands of cellular enzymes, including, but not limited to phosphorylation, glycosylation, lipidation, sumoylation, acetylation, ubiquitination, and methylation [1]. With recent advances in massspectrometry-based proteomics, enormous amounts of data can be rapidly generated. As a result, for several of the most intensively studied PTMs, such as phosphorylation, glycosylation, acetylation, and ubiquitylation, many thousands of modification sites have

Bin Liu (ed.), Yeast Surface Display: Methods, Protocols, and Applications, Methods in Molecular Biology, vol. 1319, DOI 10.1007/978-1-4939-2748-7_10, © Springer Science+Business Media New York 2015

193

194

Scott Bidlingmaier and Bin Liu

been accurately mapped [2]. In addition, increasingly sophisticated prediction software continuously generates more putative modification sites [3]. Indeed, current evidence suggests that the majority of eukaryotic proteins are likely to be posttranslationally modified in vivo, and it is almost a certainty that novel forms of posttranslational modification are yet to be discovered. Thus, the challenge of determining the biological function of each PTM site is vast and will only grow as our ability to identify PTMs outstrips our capacity to analyze their function. A common mechanism by which PTMs regulate biological functions is by modulating interactions with target proteins, often through specialized PTM-specific binding domains that are present in many types of protein. Protein phosphorylation is by far the most extensively studied PTM and numerous phosphorylation-specific protein-binding domains have been characterized and found to perform critical functions in almost all cellular processes. For example, through specific recognition of phosphotyrosine, SH2 and PTB domains play a crucial role in signal transduction pathways [4]. Similarly, phospho-Ser/Thr-binding domains such as 14-3-3, polo box, FHA, FF, BRCT, WW, WD40, and MH2 are known to regulate cell cycle progression and DNA damage responses [5]. An area of intense study is the regulation of histone function by PTMs, in particular methylation and acetylation, which plays a critical role in cellular processes such as transcription, DNA repair, chromosome segregation, and cell differentiation [6]. Methylation of histone tails at different residues recruits proteins or protein complexes that regulate chromatin activation or inactivation. Several domains that bind to methylated amino acid residues in proteins have been identified, including the plant homeodomain (PHD) finger, the Tudor domain, and the malignant brain tumor (MBT) domain [7]. Another important PTM, ubiquitination, is a critical regulator of cellular signaling pathways that control a wide range of biological processes including protein degradation, endocytosis, DNA repair, autophagy, transcription, immunity, and inflammation [8–13]. Ubiquitin signaling is decoded by proteins containing ubiquitinbinding domains (UBDs) and to date more than twenty UBD families have been described, with more continuing to be discovered [14]. It is thought that UBDs facilitate the formation of protein complexes, which might result in signal amplification [14]. In addition to ubiquitination, hundreds of proteins involved in almost all critical cellular functions are subject to posttranslational modification with small ubiquitin-related modifier (SUMO) proteins (termed sumoylation) [15–17]. Sumoylated proteins are recognized by proteins containing SUMO-interacting motifs (SIMs) which can promote the formation of protein complexes or modulate the activity or stability of the sumoylated protein [18–22]. Despite their importance, relatively few UBDs and SIMs have been

Identification of Posttranslational Modification-Dependent Protein Interactions…

195

identified, suggesting that more work is required in this area to further our understanding of how ubiquitination and sumoylation regulate cellular processes. Despite the critical importance of PTM-dependent binding proteins in regulating cellular processes, relatively few methods exist that allow efficient and comprehensive identification of proteins or domains that interact with PTMs. Several factors contribute to the challenge of identifying PTM-dependent binding proteins. PTMs are often dynamic and occur on only a small fraction of the cellular protein. This limitation is difficult to overcome as it is challenging to efficiently and specifically direct the incorporation of PTMs into proteins in vivo. In addition, some PTMdependent protein interactions are weak, making them difficult to identify by existing techniques. As a result, while the rate at which new PTM sites are being discovered is accelerating due to improved proteomic and computational approaches, our understanding of their detailed biological functions is lagging behind. Thus, there is a critical need for improved methods of identifying PTM-dependent binding proteins. In the following section we discuss and compare various methods that have been utilized for the identification of PTM-dependent binding proteins (summarized in Table 1). Table 1 Summary of methods utilized for identifying PTM-dependent protein interactions Method

Main advantages

Main disadvantages

References

Affinity purification/ Comprehensive (whole cell Difficult to identify low [24, 25] mass spectrometry lysate is interrogated) abundance proteins Increased ability to detect weak Unable to distinguish between interactions with cross-linking direct and indirect interactions [29–34]

Protein microarray

Fast Ability to identify low abundance proteins Direct interactions recovered

High start up cost Protein production quality control issues

Phage display

Large library size Direct interactions recovered

Complications displaying diverse [43] mammalian protein libraries in bacterial expression system

Tethered catalysis

PTMs generated in vivo may be Difficult to identify low [44, 45] more natural abundance proteins Unable to distinguish between direct and indirect interactions

Yeast human proteome display

Ability to identify low abundance proteins Direct interactions recovered Comprehensive high throughput analysis of selection outputs

Potential improper protein folding on the yeast surface Incomplete library coverage

[23, 49, 52]

196

Scott Bidlingmaier and Bin Liu

We propose that the yeast surface cDNA display approach that we originally described for identification of phosphopeptide binding proteins [23] is highly effective and generally applicable to the identification of novel PTM binding proteins.

2

Affinity Purification from Cellular Lysates Followed by Quantitative Mass Spectrometry Recently, affinity-based purification using modified peptide probes designed to mimic natural PTMs has been combined with stable isotope labeling with amino acids in cell culture (SILAC) and quantitative mass spectrometry to identify PTM-dependent protein–protein interactions [24, 25]. Peptide probes designed to mimic methylated and phosphorylated histone H3 as well as corresponding unmodified probes were used for affinity-based enrichment of binding proteins from SILAC-labeled nuclear extracts. To improve the recovery of weak interactions, the probes contain a benzophenone moiety, which allows photo-cross-linking. Quantitative mass spectrometry was then used to identify proteins selectively enriched by the modified histone probes. Several known and new proteins that bind methylated and phosphorylated histone H3 were identified [24, 25]. This approach, which the authors termed CLASPI (crosslinking-assisted and stable isotope labeling in cell culture-based protein identification) is flexible, comprehensive and addresses potential sensitivity issues posed by weak interactions with the addition of a cross-linking step. Since new probes mimicking different PTMs can be rapidly generated and tested, the method should be of significant value in identifying new PTM-dependent protein interactions. Disadvantages of the method include possible difficulties in recovering interacting proteins that are low abundance in the cellular lysates, and the inability to distinguish direct from indirect interactions in the primary mass spectrometry data.

3

Protein Microarray-Based Methods Protein microarrays are a rapidly emerging technology that allows researchers to quickly analyze protein interactions and function in a high-throughput manner while requiring only small amounts of reagent [26–28]. Several groups have utilized protein microarrays to identify and characterize PTM-dependent protein interactions. Using protein microarrays constructed with recombinant versions of nearly all human Src homology 2 (SH2) and phosphotyrosine binding (PTB) domains, binding specificity and affinity was analyzed by probing with peptides designed to represent both known and potential sites of tyrosine phosphorylation on several receptor tyrosine kinases, including the four ErbB receptors,

Identification of Posttranslational Modification-Dependent Protein Interactions…

197

FGFR1 and IGF1R [29–31]. Using this approach allowed the rapid collection of tens of thousands of binding measurements and resulted in the discovery of many previously unrecognized interactions. In another example of the use of protein microarrays to identify PTM-dependent binding proteins, Kowenz-Leutz et al. identified proteins that bind to the transcription factor C/EBPβ in a methylation-dependent manner using array peptide screening (APS) [32, 33]. Bacterially expressed His-tagged recombinant proteins produced from a cDNA expression library covering one third of the human proteome were immobilized on PVDF membranes and interrogated with methylated and unmethylated control peptides derived from C/EBPβ. Numerous interactions were uncovered, confirming the importance of C/EBPβ methylation status in modulating interactions with other proteins. Recently, Guzzo et al. used protein microarrays containing ~4,000 human transcription factors to conduct SUMO-binding assays and discovered that MYM-type zinc fingers from the transcription factors ZNF261 and ZNF198 function as SIMs [34]. Microarrays have the advantages of being rapid, flexible, and high-throughput. With modified peptide probes, many different PTMs can be rapidly tested and binding affinities and specificity can be at least semi-quantitatively determined. In addition, in contrast with lysate pulldown-based methods, interactions with naturally low abundance protein targets may be more readily identified and only direct interactions are likely to be recovered. Although the initial start up costs are high due to the need to express and purify large numbers of recombinant proteins, the cost diminishes over time since many experiments can be performed with a small amount of material. One significant issue with protein microarrays is quality control. Since a large number, often thousands, of proteins are being produced in parallel, it is impossible to ensure that they are properly folded and active. In addition, the proteins are often produced in a non-native host expression system, increasing the possibility of improper folding or modification. These factors could lead to the generation of both false negative and false positive results in the screening data. Finally, the way that a protein microarray is constructed limits its discovery potential to the annotated gene/protein space.

4

Phage Display Phage display is a widely used technique for identifying antibodies against a wide variety of target antigens [35, 36]. Using this versatile technique, highly diverse libraries displaying ≥109 unique antibody clones can easily be constructed and utilized to select antibodies with almost any desired binding property [37–42]. Kehoe et al. employed a number of selection strategies to isolate an anti-sulfotyrosine antibody from a single chain Fv (scFv) phage

198

Scott Bidlingmaier and Bin Liu

display library [43]. After several rounds of selection followed by the screening of almost 8,000 individual clones, a single scFv capable of recognizing sulfotyrosine in a sequence-independent manner was identified. Based on this result, it is likely that phage antibody display could be utilized to identify antibodies that bind specifically to other types of PTM. Although phage display has been extensively used for antibody discovery, its use for displaying large numbers of diverse protein types (e.g., the human proteome) and application to identification of PTM-binding proteins has been more limited, possibly due to complications that may arise when expressing mammalian proteins in a bacterial host.

5

Yeast and Mammalian Tethered Catalysis A modified yeast two-hybrid termed “tethered catalysis” was first described by Guo et al. and utilized to identify proteins that bind specifically to acetylated histone tails [44]. To create the “bait” for the two-hybrid experiment, fusions consisting of various histone N-terminal tail domains, a histone acetyltransferase domain, and a DNA-binding domain were constructed. The physical linkage between the histone acetyltransferase and its substrate results in the constitutive acetylation of the histone tail domain. As a control, versions with a catalytically inactive mutant histone acetyltransferase were also produced. Standard two-hybrid screens were performed using an activation domain library and three clones were identified that exhibit acetylation-dependent binding to the histone tail. Although relatively few interactions were discovered by this method, it served as an important proof of principle demonstrating that PTMs can be generated in a precisely targeted manner in vivo. Extending the tethered catalysis concept to a mammalian system, Spektor et al. developed a technique termed “mammalian tethered catalysis” and demonstrated its effectiveness by characterizing both known and novel histone H3 methylation-dependent binding proteins [45]. The initial step in mammalian tethered catalysis is similar to the yeast system, beginning with the construction of a bait expression construct consisting of an epitope tag for affinity purification, a histone H3-derived peptide containing the amino acid residue targeted for methylation, and the catalytic domain of histone methyltransferase G9a fused in tandem. This plasmid and a control plasmid containing a catalytically inactive mutant methyltransferase were transfected into mammalian cells and proteins associated with the fusion protein baits were purified from nuclear lysates by immunoprecipitation. SDS/PAGE analysis revealed a single methylation-dependent band which upon analysis by mass spectrometry was determined to be a truncated form of G9a encompassing the C-terminal region.

Identification of Posttranslational Modification-Dependent Protein Interactions…

199

In contrast to other methods, which generally utilize reagents modified in vitro, the tethered catalysis approach allows PTMs to be enzymatically produced in vivo, which may provide a more natural target as bait for identifying interacting proteins. As with other lysate pulldown-based methods, low abundance PTM-dependent binding proteins may not be recovered and it will be difficult to distinguish between direct and indirect binding interactions.

6

Yeast Displayed Human Proteome Libraries The key to overcome many of the limitations of the aforementioned methods is to develop a new technique that allows direct affinity capture using modified ligands and ready identification of the binding protein based on a tight linkage between the protein and its encoding gene. A eukaryotic surface display system such as yeast surface display [46, 47] would meet this requirement. We have constructed large (>2 × 107) libraries that display human protein fragments (≈100–400 amino acids) on the yeast surface as C-terminal fusions to the yeast a-agglutinin subunit, Aga2p and successfully used them to identify protein fragments that bind to posttranslationally modified phosphorylated peptides [23], small signaling molecule phosphatidylinositides [48, 49], and monoclonal antibodies [50]. To identify protein fragments the major tyrosine autophosphorylation sites of the epidermal growth factor receptor or focal adhesion kinase in a phosphorylation-dependent manner, we incubated the induced yeast proteome display libraries with biotinylated, tyrosine-phosphorylated peptides derived from the major autophosphorylation sites of either EGFR (EGFRpY1173) or FAK (FAKpY397). To compete away non-phosphorylation-dependent binding, corresponding non-phosphorylated, non-biotinylated peptides were added to the incubations in excess. Binding clones were enriched through several rounds of FACS and individual yeast clones were screened by FACS for phosphorylation-dependent binding using the EGFRpY1173 or FAKpY397 peptides. Four unique phosphopeptide-binding clones were identified. Clones expressing fragments encompassing the SH2 domains of adapter protein APS and phosphoinositide 3-kinase regulatory subunit 3 (PIK3R3) were recovered from the EGFRpY1173 sort, while clones expressing the SH2 domains of SH2B and tensin as well as the APS clone were recovered from the FAKpY397 sort. These clones bind the tyrosine-phosphorylated peptides but not the nonphosphorylated control peptides, thereby validating the utility of this approach for identifying PTM-dependent binding proteins. Yeast human proteome display libraries provide a powerful and flexible tool for identifying protein fragments with affinity for almost any soluble target ligand, and are particularly well suited for the study of PTM-dependent protein interactions. Since yeast

200

Scott Bidlingmaier and Bin Liu

protein expression pathways are similar to those found in mammalian cells, human protein fragments displayed by yeast human proteome libraries are likely to be properly folded and functional. As with protein microarrays, interactions with naturally low abundance protein targets may be more readily identified and only direct interactions are recovered. In contrast with protein microarrays, yeast human proteome display libraries can be generated relatively quickly at low cost and are an easily renewable resource [51, 52]. When coupled with a compatible method of high throughput nucleic acid analysis (e.g., exon microarrays or next generation sequencing), selection outputs can be comprehensively screened, allowing the discovery of a greater diversity of interactions [49]. Although expressed in a eukaryotic host, it is possible that some proteins may not be folded or modified properly, which may lead to the generation of false negative or false positive results. False negative results may also result from incomplete library coverage.

7

Future Directions Given the importance of PTMs in regulating biological processes, and the speed at which new PTMs are being cataloged, it is important to accelerate efforts to identify and characterize PTMdependent binding proteins in order to understand the underlying biology. Each of the methods described above has strengths and weaknesses, but novel techniques such as yeast surface cDNA display appear to be well suited for this task. Combined with data mining and bioinformatics, these discovery methods should improve our understanding of the role that PTM plays in normal and diseased cells. Technology aside, the choice of the bait ligand (PTM in the context of a biologic) will ultimately impact the significance of any discovery of PTM-binding proteins.

Acknowledgement We thank the National Institutes of Health for financial support (R01 CA118919, R01 CA129491, and R01 CA171315). References 1. Beck-Sickinger AG, Mörl K (2006) Posttranslational modification of proteins. Expanding nature’s inventory. By Christopher T. Walsh. Angew Chem Int Ed 45:1020. doi:10.1002/anie.200585363 2. Olsen JV, Mann M (2013) Status of largescale analysis of post-translational modifications by mass spectrometry. Mol Cell Proteomics 12:3444–3452. doi:10.1074/ mcp.O113.034181

3. Xu Y, Wang X, Wang Y et al (2014) Prediction of posttranslational modification sites from amino acid sequences with kernel methods. J Theor Biol 344:78–87. doi:10.1016/j.jtbi.2013.11.012 4. Wagner MJ, Stacey MM, Liu BA, Pawson T (2013) Molecular mechanisms of SH2- and PTB-domain-containing proteins in receptor tyrosine kinase signaling. Cold Spring Harb Perspect Biol 5:a008987. doi:10.1101/cshperspect.a008987

Identification of Posttranslational Modification-Dependent Protein Interactions… 5. Reinhardt HC, Yaffe MB (2013) PhosphoSer/Thr-binding domains: navigating the cell cycle and DNA damage response. Nat Rev Mol Cell Biol 14:563–580. doi:10.1038/ nrm3640 6. Rothbart SB, Strahl BD (2014) Interpreting the language of histone and DNA modifications. Biochim Biophys Acta. doi:10.1016/j. bbagrm.2014.03.001 7. Adams-Cioaba MA, Min J (2009) Structure and function of histone methylation binding proteins. Biochem Cell Biol 87:93–105. doi:10.1139/O08-129 8. Finley D, Ciechanover A, Varshavsky A (2004) Ubiquitin as a central cellular regulator. Cell 116:S29–S32, 2 p following S32 9. Kerscher O, Felberbaum R, Hochstrasser M (2006) Modification of proteins by ubiquitin and ubiquitin-like proteins. Annu Rev Cell Dev Biol 22:159–180. doi:10.1146/annurev. cellbio.22.010605.093503 10. Ulrich HD, Walden H (2010) Ubiquitin signalling in DNA replication and repair. Nat Rev Mol Cell Biol 11:479–489. doi:10.1038/ nrm2921 11. Kevei É, Hoppe T (2014) Ubiquitin sets the timer: impacts on aging and longevity. Nat Struct Mol Biol 21:290–292. doi:10.1038/ nsmb.2806 12. Duplan V, Rivas S (2014) E3 ubiquitin-ligases and their target proteins during the regulation of plant innate immunity. Front Plant Sci 5:42. doi:10.3389/fpls.2014.00042 13. Corn JE, Vucic D (2014) Ubiquitin in inflammation: the right linkage makes all the difference. Nat Struct Mol Biol 21:297–300. doi:10.1038/nsmb.2808 14. Husnjak K, Dikic I (2012) Ubiquitin-binding proteins: decoders of ubiquitin-mediated cellular functions. Annu Rev Biochem 81:291–322. doi:10.1146/annurev-biochem-051810-094654 15. Wilkinson KA, Henley JM (2010) Mechanisms, regulation and consequences of protein SUMOylation. Biochem J 428:133–145. doi:10.1042/BJ20100158 16. Gareau JR, Lima CD (2010) The SUMO pathway: emerging mechanisms that shape specificity, conjugation and recognition. Nat Rev Mol Cell Biol 11:861–871. doi:10.1038/ nrm3011 17. Flotho A, Melchior F (2013) Sumoylation: a regulatory protein modification in health and disease. Annu Rev Biochem 82:357–385. doi:10.1146/ annurev-biochem-061909-093311 18. Hecker C-M, Rabiller M, Haglund K et al (2006) Specification of SUMO1- and SUMO2interacting motifs. J Biol Chem 281:16117– 16127. doi:10.1074/jbc.M512757200

201

19. Ouyang J, Shi Y, Valin A et al (2009) Direct binding of CoREST1 to SUMO-2/3 contributes to gene-specific repression by the LSD1/ CoREST1/HDAC complex. Mol Cell 34:145– 154. doi:10.1016/j.molcel.2009.03.013 20. Minty A, Dumont X, Kaghad M, Caput D (2000) Covalent modification of p73alpha by SUMO-1. Two-hybrid screening with p73 identifies novel SUMO-1-interacting proteins and a SUMO-1 interaction motif. J Biol Chem 275:36316– 36323. doi:10.1074/jbc.M004293200 21. Song J, Durrin LK, Wilkinson TA et al (2004) Identification of a SUMO-binding motif that recognizes SUMO-modified proteins. Proc Natl Acad Sci U S A 101:14373–14378. doi:10.1073/pnas.0403498101 22. Song J, Zhang Z, Hu W, Chen Y (2005) Small ubiquitin-like modifier (SUMO) recognition of a SUMO binding motif: a reversal of the bound orientation. J Biol Chem 280:40122– 40129. doi:10.1074/jbc.M507059200 23. Bidlingmaier S, Liu B (2006) Construction and application of a yeast surface-displayed human cDNA library to identify post-translational modification-dependent protein-protein interactions. Mol Cell Proteomics 5:533–540. doi:10.1074/mcp.M500309-MCP200 24. Li X, Foley EA, Molloy KR et al (2012) Quantitative chemical proteomics approach to identify post-translational modificationmediated protein–protein interactions. J Am Chem Soc 134:1982–1985. doi:10.1021/ ja210528v 25. Li X, Foley EA, Kawashima SA et al (2013) Examining post-translational modificationmediated protein-protein interactions using a chemical proteomics approach. Protein Sci 22:287–295. doi:10.1002/pro.2210 26. Chen R, Snyder M (2010) Yeast proteomics and protein microarrays. J Proteomics 73:2147– 2157. doi:10.1016/j.jprot.2010.08.003 27. Reymond Sutandy F, Qian J, Chen C-S, Zhu H (2013) Overview of protein microarrays. Curr Protoc Protein Sci 0 27:Unit–27.1. doi: 10.1002/0471140864.ps2701s72 28. Zhu H, Bilgin M, Bangham R et al (2001) Global analysis of protein activities using proteome chips. Science 293:2101–2105. doi:10.1126/science.1062191 29. Jones RB, Gordus A, Krall JA, MacBeath G (2006) A quantitative protein interaction network for the ErbB receptors using protein microarrays. Nature 439:168–174. doi:10.1038/nature04177 30. Kaushansky A, Gordus A, Budnik BA et al (2008) System-wide investigation of ErbB4 reveals 19 sites of Tyr phosphorylation that are unusually selective in their recruitment

202

31.

32.

33.

34.

35.

36.

37.

38.

39.

40.

41.

Scott Bidlingmaier and Bin Liu properties. Chem Biol 15:808–817. doi:10.1016/j.chembiol.2008.07.006 Kaushansky A, Gordus A, Chang B et al (2008) A quantitative study of the recruitment potential of all intracellulartyrosine residues on EGFR, FGFR1 and IGF1R. Mol Biosyst 4:643–653. doi:10.1039/B801018H Kowenz-Leutz E, Pless O, Dittmar G et al (2010) Crosstalk between C/EBPβ phosphorylation, arginine methylation, and SWI/SNF/ mediator implies an indexing transcription factor code. EMBO J 29:1105–1115. doi:10.1038/emboj.2010.3 Pless O, Kowenz-Leutz E, Dittmar G, Leutz A (2011) A differential proteome screening system for post-translational modificationdependent transcription factor interactions. Nat Protoc 6:359–364. doi:10.1038/nprot. 2011.303 Guzzo CM, Ringel A, Cox E et al (2014) Characterization of the SUMO-binding activity of the myeloproliferative and mental retardation (MYM)-type zinc fingers in ZNF261 and ZNF198. PLoS One 9:e105271. doi:10.1371/journal.pone.0105271 Marks JD, Hoogenboom HR, Griffiths AD, Winter G (1992) Molecular evolution of proteins on filamentous phage. Mimicking the strategy of the immune system. J Biol Chem 267:16007–16010 Hoogenboom HR (2002) Overview of antibody phage-display technology and its applications. Methods Mol Biol 178:1–37 Griffiths AD, Malmqvist M, Marks JD et al (1993) Human anti-self antibodies with high specificity from phage display libraries. EMBO J 12:725–734 Huston JS, George AJ (2001) Engineered antibodies take center stage. Hum Antibodies 10:127–142 Liu B, Conrad F, Cooperberg MR et al (2004) Mapping tumor epitope space by direct selection of single-chain Fv antibody libraries on prostate cancer cells. Cancer Res 64: 704–710 Zhu X, Bidlingmaier S, Hashizume R et al (2010) Identification of internalizing human single-chain antibodies targeting brain tumor sphere cells. Mol Cancer Ther 9:2131–2141. doi:10.1158/1535-7163.MCT-09-1059 Ruan W, Sassoon A, An F et al (2006) Identification of clinically significant tumor antigens by selecting phage antibody library on tumor cells in situ using laser capture microdissection. Mol Cell Proteomics 5:2364– 2373. doi:10.1074/mcp.M600246-MCP200

42. An F, Drummond DC, Wilson S et al (2008) Targeted drug delivery to mesothelioma cells using functionally selected internalizing human single-chain antibodies. Mol Cancer Ther 7:569– 578. doi:10.1158/1535-7163.MCT-07-2132 43. Kehoe JW, Velappan N, Walbolt M et al (2006) Using phage display to select antibodies recognizing post-translational modifications independently of sequence context. Mol Cell Proteomics 5:2350–2363. doi:10.1074/mcp. M600314-MCP200 44. Guo D, Hazbun TR, Xu X-J et al (2004) A tethered catalysis, two-hybrid system to identify protein-protein interactions requiring post-translational modifications. Nat Biotechnol 22:888–892. doi:10.1038/nbt985 45. Spektor TM, Rice JC (2009) Identification and characterization of posttranslational modification-specific binding proteins in vivo by mammalian tethered catalysis. Proc Natl Acad Sci U S A 106:14808–14813. doi:10.1073/pnas.0907799106 46. Boder ET, Wittrup KD (1997) Yeast surface display for screening combinatorial polypeptide libraries. Nat Biotechnol 15:553–557. doi:10.1038/nbt0697-553 47. Boder ET, Wittrup KD (2000) Yeast surface display for directed evolution of protein expression, affinity, and stability. Methods Enzymol 328:430–444 48. Bidlingmaier S, Liu B (2007) Interrogating yeast surface-displayed human proteome to identify small molecule-binding proteins. Mol Cell Proteomics 6:2012–2020. doi:10.1074/ mcp.M700223-MCP200 49. Bidlingmaier S, Wang Y, Liu Y et al (2011) Comprehensive analysis of yeast surface displayed cDNA library selection outputs by exon microarray to identify novel protein-ligand interactions. Mol Cell Proteomics. doi:10.1074/mcp.M110.005116 50. Bidlingmaier S, He J, Wang Y et al (2009) Identification of MCAM/CD146 as the target antigen of a human monoclonal antibody that recognizes both epithelioid and sarcomatoid types of mesothelioma. Cancer Res 69:1570– 1577. doi:10.1158/0008-5472.CAN-08-1363 51. Bidlingmaier S, Liu B (2011) Construction of yeast surface-displayed cDNA libraries. Methods Mol Biol 729:199–210. doi:10.1007/978-1-61779-065-2_13 52. Bidlingmaier S, Liu B (2011) Identification of protein/target molecule interactions using yeast surface-displayed cDNA libraries. Methods Mol Biol 729:211–223. doi:10.1007/978-1-61779-065-2_14

Chapter 11 Utilizing Yeast Surface Human Proteome Display Libraries to Identify Small Molecule-Protein Interactions Scott Bidlingmaier and Bin Liu Abstract The identification of proteins that interact with small bioactive molecules is a critical but often difficult and time-consuming step in understanding cellular signaling pathways or molecular mechanisms of drug action. Numerous methods for identifying small molecule-interacting proteins have been developed and utilized, including affinity-based purification followed by mass spectrometry analysis, protein microarrays, phage display, and three-hybrid approaches. Although all these methods have been used successfully, there remains a need for additional techniques for analyzing small molecule-protein interactions. A promising method for identifying small molecule-protein interactions is affinity-based selection of yeast surfacedisplayed human proteome libraries. Large and diverse libraries displaying human protein fragments on the surface of yeast cells have been constructed and subjected to FACS-based enrichment followed by comprehensive exon microarray-based output analysis to identify protein fragments with affinity for small molecule ligands. In a recent example, a proteome-wide search has been successfully carried out to identify cellular proteins binding to the signaling lipids PtdIns(4,5)P2 and PtdIns(3,4,5)P3. Known phosphatidylinositide-binding proteins such as pleckstrin homology domains were identified, as well as many novel interactions. Intriguingly, many novel nuclear phosphatidylinositide-binding proteins were discovered. Although the existence of an independent pool of nuclear phosphatidylinositides has been known about for some time, their functions and mechanism of action remain obscure. Thus, the identification and subsequent study of nuclear phosphatidylinositide-binding proteins is expected to bring new insights to this important biological question. Based on the success with phosphatidylinositides, it is expected that the screening of yeast surface-displayed human proteome libraries will be of general use for the discovery of novel small molecule-protein interactions, thus facilitating the study of cellular signaling pathways and mechanisms of drug action or toxicity. Key words Yeast cell surface display, cDNA library, Small molecule-protein interaction, Drug-binding protein, Small signaling molecule-binding protein, Phosphatidylinositides, Chromatin remodeling, Transcription regulation, Homeobox domain-containing protein

1

Methods for Identifying Small Molecule-Interacting Cellular Proteins Small bioactive molecules are important regulators of many diverse cellular processes and their biological activity is usually dependent on specific interactions with cellular protein targets. Thus, identifying proteins that interact with small molecules is a critical

Bin Liu (ed.), Yeast Surface Display: Methods, Protocols, and Applications, Methods in Molecular Biology, vol. 1319, DOI 10.1007/978-1-4939-2748-7_11, © Springer Science+Business Media New York 2015

203

204

Scott Bidlingmaier and Bin Liu

but often challenging and rate-limiting step in understanding cellular signaling pathways or molecular mechanisms of drug action. This is particularly true in the drug discovery process, where a comprehensive identification of all protein targets is necessary for a thorough understanding of the mechanisms behind a drug’s beneficial or potentially deleterious effects. The most popular approach for identifying small moleculeprotein interactions relies on the affinity-based purification of interacting proteins from cellular lysates using an immobilized small molecule target, followed by mass spectrometry analysis [1–4]. For example, this method, termed “chemical proteomics,” has been applied to the identification of cellular targets of the anticancer kinase inhibitor drugs gefitinib [5], SU6668 [6], imatinib [7], dasatinib [7], and bosutinib [7], and was recently utilized to identify the E3 ubiquitin ligase complex component CRBN as the primary target of thalidomide teratogenicity [8]. Although this method has been extensively and successfully utilized to identify small molecule-interacting proteins, it is biased towards identifying strong interactions with highly expressed proteins and has difficulty identifying cellular targets expressed at low levels in the queried lysates. It is also less than straightforward using this method to detect transient but meaningful biological interactions. Additionally, mass spectrometry analysis often generates a large number of candidate proteins, including those that do not bind to the bait ligand directly, making validation a challenging task. Protein microarray technology has great potential for the detection and study of protein-small molecule interactions, in addition to other applications [9–11]. Protein microarrays containing thousands of purified recombinant proteins can be produced and subsequently assayed in a high-throughput manner using fluorescently labeled ligands. The technique has been successfully employed to identify and analyze proteins that bind to several small molecule targets, including phospholipids [12], GTP [13], small molecule inhibitors of rapamycin [14], and a potential small molecule therapeutic agent for Spinal Muscular Atrophy [15]. Although having enormous potential, the application of protein microarrays has been limited by incomplete proteome coverage and the difficulties and high cost of producing high quality protein arrays containing thousands of functional proteins. Phage display has found widespread use for identification of antibodies binding specifically to a bait molecule (often a protein). It can be adopted for cDNA library screening based on direct affinity interaction to uncover cellular proteins binding to a bait ligand. In phage display, very large libraries can be generated and selected and since the genotype and phenotype are physically linked, target identification is achieved by sequencing which is rapid and cheap compared to the mass spectrometry and large-scale protein production which are required for chemical proteomics and protein microarray

Utilizing Yeast Surface Human Proteome Display Libraries to Identify Small…

205

approaches, respectively. Since the early successful identification of cellular proteins that bind the small molecule drugs taxol and doxorubicin [16, 17], a large number of small molecule-interacting cellular proteins have been identified by affinity-based selection from phage cDNA and peptide display libraries [18–31]. Nevertheless, despite these successes, the recovery of some interactions may be limited by potential expression bias against eukaryotic proteins expressed in a prokaryotic host, which could lead to a high rate of both false positive and negative results and the low number of fusion proteins displayed on each phage particle. An adaptation of the popular eukaryotic yeast two-hybrid system has been developed, termed “three-hybrid,” in which a target small molecule is derivatized with an anchor that allows it to form a complex with the bait fusion protein [32]. Since its development, the three-hybrid method has been successfully used to identify many protein-small molecule interactions [33, 34]. Very recently, the three-hybrid approach has been used to identify proteins that bind to the drugs erlotinib, atorvastatin, and sulfasalazine [35], the glaucoma therapeutic anecortave acetate [36], and a panel of antituberculosis drugs [37]. Although these results are promising, a potential drawback of the three-hybrid technique is the requirement for the production of a derivatized small molecule ligand that must be cell permeable and able to gain access to the nucleus. In addition, like the two-hybrid system, the three-hybrid system also faces issues such as false positives and the need for an independent validation of a direct physical interaction. An emerging approach for identifying protein-small molecule interactions is yeast surface display, which allows the efficient display of heterologous proteins on the surface of Saccharomyces cerevisiae yeast cells [38]. Large and diverse yeast display human cDNA libraries can be easily generated, and when coupled with fluorescence-activated cell sorting (FACS) these libraries can theoretically be used to identify protein fragments that interact with any soluble molecule that can be fluorescently detected. Using FACS, yeast surface-display libraries can be screened at a rate of up to 50,000 cells/s, allowing the full diversity of large (108) libraries to be practically screened. In addition, FACS-based selection allows real time monitoring of the selection process and fine discrimination of clones with different binding properties. Target ligand concentrations and other incubation conditions can be adjusted to enrich clones with different affinities or characteristics. These flexibilities are not readily available to other screening methods such as three-hybrid assays and phage display. The selection outputs are observed to be diverse and not excessively dominated by a few high affinity binders. This is in contrast to methods that are based on affinity purification of target proteins directly from cell lysates, which are strongly biased towards the recovery of highly abundant cellular proteins and high affinity interactions.

206

Scott Bidlingmaier and Bin Liu

We have previously described the construction and application of yeast surface-displayed human protein fragment libraries to identify human proteins that interact with various target ligands, including small molecules [39–44]. Below we will summarize highlights of our experiments using yeast surface-displayed human proteome libraries combined with comprehensive exon microarraybased analysis to identify human proteins that interact with phosphatidylinositides [40, 44], a class of cellular lipids that play an important but poorly characterized role in many cellular processes. In particular, we will discuss the potential significance of nuclear phosphatidylinositide-binding proteins we identified and suggest directions for future research efforts.

2

Phosphatidylinositide-Binding Proteins and the Mystery of Nuclear Phosphatidylinositides Phosphatidylinositides are specialized lipids that make up a small fraction of the total cellular lipid pool and function as important regulators of many processes, including signal transduction, ion channels and transporters, vesicle trafficking, cytoskeletal organization, and motility [45, 46]. The various biological functions of phosphatidylinositides are mediated through association with proteins containing phosphatidylinositide-binding globular domains (such as PH, C1, FYVE, and PX domains) [47], or unstructured regions with clusters of basic and hydrophobic residues [48]. The discovery of additional protein domains or regions that bind to phosphatidylinositides is important for understanding the mechanisms by which they regulate cellular processes. Various techniques have been utilized to identify proteins that bind phosphatidylinositides (reviewed in [49]), including protein microarrays [12], affinity purification [50], neomycin nuclear extraction [51], a yeast growth rescue assay [52], λgt11-based expression cloning [53], quantitative mass spectrometry [54], and an in vitro transcription/translation-based expression cloning assay [55]. In addition to cytosolic membrane phosphatidylinositides, an independent pool of phosphatidylinositides and enzymes involved in their synthesis exists in the nucleus. Although significantly less is known about the functions, mechanism of action, and physical form of nuclear phosphatidylinositides, they are now known to be involved in the regulation of many important biological processes, such as cell cycle progression, chromatin organization, transcription, DNA repair, and RNA splicing and export (reviewed in [56–59]). To understand the mechanisms by which nuclear phosphatidylinositides regulate cellular processes, it is necessary to identify nuclear phosphatidylinositide-binding proteins. Although the presence of nuclear phosphatidylinositides has been known for many years, only a few nuclear proteins that bind phosphatidylinositides have

Utilizing Yeast Surface Human Proteome Display Libraries to Identify Small…

207

thus far been identified, including histones H1 and H3 [60], the PHD finger of ING2 [61], the nuclear receptors SF-1 and LRH-1 [62–64], Nucleophosmin/B23 [50], the PDZ domains of syntenin-2 and zonula occludens-1 and -2 [65], SAP30L and SAP30 [66], the transcriptional corepressor BASP1 [67], and RNA polymerase I and the Pol I transcription factor UBF [68]. Recently, a method specifically designed to enrich for nuclear phosphatidylinositide-interacting proteins based on neomycin extraction of intact nuclei was successfully utilized to identify many nuclear phosphatidylinositide-binding proteins, and a direct interaction between phosphatidylinositol 4,5-bisphosphate and DNA Topoisomerase IIα was verified [51]. Despite these successes, new methods are required to efficiently and comprehensively identify novel phosphatidylinositide-binding proteins.

3

Comprehensive Analysis of Yeast Display Human Proteome Library Selection Outputs Identifies Novel Phosphatidylinositide-Binding Nuclear Proteins We utilized biotinylated phosphatidylinositides for FACS-based enrichment of yeast surface-displayed human proteome libraries coupled with comprehensive output analysis by exon microarray to identify phosphatidylinositol-binding proteins [40, 44]. Intriguingly, many of the novel phosphatidylinositide-binding proteins we discovered are nuclear (summarized in Table 1). Four of the nuclear phosphatidylinositide-binding proteins (HOXA5, HOXB6, HOXC6, and HOXD4) contain a homeobox domain (Table 1), which is a sequence-dependent DNA binding domain found in transcription factors [69]. Follow-up experiments demonstrated that phosphatidylinositides and homeobox domain target DNA sequences bind competitively to homeobox domaincontaining protein fragments [44]. We speculate that nuclear phosphatidylinositides may regulate transcription by modulating the interaction between homeobox domain proteins and target DNA sequences (Fig. 1a), similar to a model proposed for the Sin3A corepressor complex proteins SAP30 and SAP30L [66]. Future experiments will be required to define the potential role that nuclear phosphatidylinositides play in the regulation of homeodomain transcription factors. The identification of mutations within the homeobox domain that selectively disrupt phosphatidylinositide binding without affecting DNA binding would be extremely beneficial to this endeavor. Three of the novel phosphatidylinositide-binding proteins we identified and verified (FAM71B, RNPS1, and SFRS4) and one unverified candidate (SRRP35) localize to nuclear speckles (Table 1) [70–73]. Interestingly, although the exact nature and location of nuclear phosphatidylinositides is currently unclear, evidence suggests that they may at least partially reside in distinct

208

Scott Bidlingmaier and Bin Liu

Table 1 Nuclear phospholipid-binding protein fragments identified by our yeast surface display human cDNA library screening [44] Protein

Accession #

Subcellular location

Binding verified

ATN1

EAW88707

C, N

+

FAM71B

NP_570969

N, NS

+

HMGN2

CAG46919

C, N

+

HOXA5

CAG47073

N

+

HOXB6

AAH14651

N

+

HOXC6

CAG33235

N

+

HOXD4

EAX11086

N

+

NUCKS1

Q9H1E3

N

+

PNPLA7

CAI14582

ER, IM, L, N

+

POLS

Q5XG87

N

+

RNPS1

AAC39791

N, NS, C

+

SBF1

AAH87612

N, IM

+

SFRS4

CAI14326

NS

+

HCFC1

NP_005325

C, N

SRRP35

EAW48561

N, NS

PARK7

NP_009193

C, N

SART1

NP_005137

N

SLC9A3R2

NP_004776

M, C, N

Accession # is based on NCBI Entrez protein database. The observed or predicted subcellular localization of the protein is indicated. ER endoplasmic reticulum, IM integral membrane, M membrane, L lysosome, N nucleus, C cytoplasm, NS nuclear speckle. aa amino acids. The table was adapted from tables originally presented in [44]

nuclear domains termed “speckles” [74–76], which are subnuclear structures enriched in pre-mRNA splicing factors [77]. The PDZ domains of syntenin-2 and zonula occludens-1 and -2 bind to phosphatidylinositides and regulate their localization to nuclear speckles [65, 78]. Thus, FAM71B, RNPS1, SFRS4, and SRRP35 may similarly be localized to nuclear speckles through binding to phosphatidylinositides. One of the phosphatidylinositide-binding proteins we identified is the DNA polymerase POLS (Table 1). Trf4p, the yeast homolog of POLS, is important for sister chromatid cohesion [79] and DNA double-strand break repair [80]. Notably, the phosphoinositide 3-kinase catalytic subunit p110β, its substrate, PtdIns(4,5), and its product, PtdIns(3,4,5), have been shown to localize to DNA double-strand breaks [81]. Thus, it is possible that

Utilizing Yeast Surface Human Proteome Display Libraries to Identify Small…

209

Fig. 1 Models for regulation of nuclear functions by phosphatidylinositides. (a) Because of the demonstrated binding of phosphatidylinositides to the homeodomain [44], nuclear phosphatidylinositides have the potential to prevent binding of transcription factors such as homeodomain proteins to homeobox target sequences (blue box) or displace bound homeodomain proteins from DNA, leading to altered gene expression. Homeodomain proteins have the potential to either positively or negatively regulate target genes—the drawing only depicts one of the scenarios (positive regulation). (b) Phosphatidylinositides accumulated at sites of double-strand DNA breaks act to recruit POLS, which participates in repairing the break. The figure was adapted from the original drawing presented in [44]

phosphatidylinositides at DNA damage sites recruit POLS to facilitate DNA repair or directly regulate the enzymatic activity of POLS (Fig. 1b). Another phosphatidylinositide-binding protein is HMGN2 (Table 1), a member of the nonhistone chromosomal HMGN protein family. HMGN proteins bind to nucleosome core particles without any DNA sequence specificity [82] and cause unfolding of higher-order chromatin structure to facilitate transcription [83–85] and replication [86]. Since phosphoinositide-mediated modulation of protein-chromatin interactions has been proposed as a general biological mechanism for transcriptional regulation [66], it is possible that phosphatidylinositide binding to HMGN2 contributes to this regulation. Proteins and lipids are some of the most abundant components in a cell, and current experimental data support the hypothesis that many biological events taking place in a living cell are mediated by protein-lipid interactions. The further identification and characterization of nuclear phosphatidylinositide-binding proteins will greatly advance our understanding of the molecular mechanisms by which nuclear phosphatidylinositols carry out their many important functions. In addition, targeted functional and biochemical studies are needed to understand the mechanisms by which phosphatidylinositides regulate important functions such as transcription and DNA repair through protein-phospholipid interactions.

210

4

Scott Bidlingmaier and Bin Liu

Future Directions While there are many techniques that have found use in identifying cellular proteins binding to small molecule ligands, yeast surface human cDNA display technology has emerged as a highly effective method for identifying novel interactions as it overcomes many limitations associated with other approaches. When coupled to FACS-based selection, the yeast display method can identify specific protein-small molecule interactions across varying affinity ranges. Comprehensive interrogation of selection outputs by either exon array or deep sequencing allows rapid identification of candidate binding proteins whose binding to the small molecule target ligand can be easily verified. The source of the cDNA used for yeast display library construction can also be expanded to increase proteome representation to further improve the chance of identifying rare but meaningful protein-small molecule ligand interactions. The challenge now is how to use the knowledge of these binding interactions to construct a biological understanding of cell signaling and drug actions.

Acknowledgements We thank the National Institutes of Health for financial support (R01 CA118919, R01 CA129491, and R01 CA171315). References 1. Ziegler S, Pries V, Hedberg C, Waldmann H (2013) Target identification for small bioactive molecules: finding the needle in the haystack. Angew Chem Int Ed 52:2744–2792. doi:10.1002/anie.201208749 2. Lomenick B, Olsen RW, Huang J (2011) Identification of direct protein targets of small molecules. ACS Chem Biol 6:34–46. doi:10.1021/cb100294v 3. Raida M (2011) Drug target deconvolution by chemical proteomics. Curr Opin Chem Biol 15:570–575. doi:10.1016/j.cbpa.2011.06.016 4. Sakamoto S, Hatakeyama M, Ito T, Handa H (2012) Tools and methodologies capable of isolating and identifying a target molecule for a bioactive compound. Bioorg Med Chem 20: 1990–2001. doi:10.1016/j.bmc.2011.12.022 5. Brehmer D, Greff Z, Godl K et al (2005) Cellular targets of gefitinib. Cancer Res 65:379–382 6. Godl K, Gruss OJ, Eickhoff J et al (2005) Proteomic characterization of the angiogenesis inhibitor SU6668 reveals multiple impacts on

7.

8.

9.

10.

11.

cellular kinase signaling. Cancer Res 65:6919– 6926. doi:10.1158/0008-5472.CAN-05-0574 Bantscheff M, Eberhard D, Abraham Y et al (2007) Quantitative chemical proteomics reveals mechanisms of action of clinical ABL kinase inhibitors. Nat Biotechnol 25:1035– 1044. doi:10.1038/nbt1328 Ito T, Ando H, Suzuki T et al (2010) Identification of a primary target of thalidomide teratogenicity. Science 327:1345–1350. doi:10.1126/science.1177319 Reymond Sutandy F, Qian J, Chen C-S, Zhu H (2013) Overview of protein microarrays. Curr Protoc Protein Sci Editor Board John E Coligan Al 0 27:Unit–27.1. doi: 10.1002/0471140864.ps2701s72 Chen R, Snyder M (2010) Yeast proteomics and protein microarrays. J Proteomics 73:2147– 2157. doi:10.1016/j.jprot.2010.08.003 Berrade L, Garcia AE, Camarero JA (2011) Protein microarrays: novel developments and applications. Pharm Res 28:1480–1499. doi:10.1007/s11095-010-0325-1

Utilizing Yeast Surface Human Proteome Display Libraries to Identify Small… 12. Zhu H, Bilgin M, Bangham R et al (2001) Global analysis of protein activities using proteome chips. Science 293:2101–2105. doi:10.1126/science.1062191 13. Schweitzer B, Predki P, Snyder M (2003) Microarrays to characterize protein interactions on a whole-proteome scale. Proteomics 3:2190–2199. doi:10.1002/pmic.200300610 14. Huang J, Zhu H, Haggarty SJ et al (2004) Finding new components of the target of rapamycin (TOR) signaling network through chemical genetics and proteome chips. Proc Natl Acad Sci U S A 101:16594–16599. doi:10.1073/pnas.0407117101 15. Singh J, Salcius M, Liu S-W et al (2008) DcpS as a therapeutic target for spinal muscular atrophy. ACS Chem Biol 3:711–722. doi:10.1021/ cb800120t 16. Rodi DJ, Janes RW, Sanganee HJ et al (1999) Screening of a library of phage-displayed peptides identifies human Bcl-2 as a taxol-binding protein. J Mol Biol 285:197–203. doi:10.1006/jmbi.1998.2303 17. Jin Y, Yu J, Yu YG (2002) Identification of hNopp140 as a binding partner for doxorubicin with a phage display cloning method. Chem Biol 9:157–162. doi:10.1016/ S1074-5521(02)00096-0 18. Van Dorst B, Mehta J, Rouah-Martin E et al (2012) Phage display as a method for discovering cellular targets of small molecules. Methods 58:56–61. doi:10.1016/j.ymeth.2012.07.011 19. Shim JS, Lee J, Park H-J et al (2004) A new curcumin derivative, HBC, interferes with the cell cycle progression of colon cancer cells via antagonization of the Ca2+/Calmodulin function. Chem Biol 11:1455–1463. doi:10.1016/j.chembiol.2004.08.015 20. Aoki S, Morohashi K, Sunoki T et al (2007) Screening of paclitaxel-binding molecules from a library of random peptides displayed on T7 phage particles using paclitaxelphotoimmobilized resin. Bioconjug Chem 18:1981–1986. doi:10.1021/bc700287v 21. Takakusagi Y, Kuramochi K, Takagi M et al (2008) Efficient one-cycle affinity selection of binding proteins or peptides specific for a small-molecule using a T7 phage display pool. Bioorg Med Chem 16:9837–9846. doi:10.1016/j.bmc.2008.09.061 22. Van Dorst B, De Coen W, Blust R, Robbens J (2010) Phage display as a novel screening tool for primary toxicological targets. Environ Toxicol Chem 29:250–255. doi:10.1002/etc.38 23. Van Dorst B, Mehta J, Rouah-Martin E et al (2010) cDNA phage display as a novel tool to screen for cellular targets of chemical compounds. Toxicol In Vitro 24:1435–1440. doi:10.1016/j.tiv.2010.04.003

211

24. Van Dorst B, Mehta J, Rouah-Martin E et al (2011) The identification of cellular targets of 17β estradiol using a lytic (T7) cDNA phage display approach. Toxicol In Vitro 25:388– 393. doi:10.1016/j.tiv.2010.10.012 25. Takami M, Takakusagi Y, Kuramochi K et al (2011) A screening of a library of T7 phagedisplayed peptide identifies E2F-4 as an etoposide-binding protein. Molecules 16:4278– 4294. doi:10.3390/molecules16054278 26. Matsumoto Y, Shindo Y, Takakusagi Y et al (2011) Screening of a library of T7 phagedisplayed peptides identifies alphaC helix in 14-3-3 protein as a CBP501-binding site. Bioorg Med Chem 19:7049–7056. doi:10.1016/j.bmc.2011.10.004 27. Manita D, Toba Y, Takakusagi Y et al (2011) Camptothecin (CPT) directly binds to human heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) and inhibits the hnRNP A1/topoisomerase I interaction. Bioorg Med Chem 19: 7690–7697. doi:10.1016/j.bmc.2011.09.059 28. Miyano Y, Tsukuda S, Sakimoto I et al (2012) Exploration of the binding proteins of perfluorooctane sulfonate by a T7 phage display screen. Bioorg Med Chem 20:3985–3990. doi:10.1016/j.bmc.2012.05.016 29. Kusayanagi T, Tsukuda S, Shimura S et al (2012) The antitumor agent doxorubicin binds to Fanconi anemia group F protein. Bioorg Med Chem 20:6248–6255. doi:10.1016/j.bmc.2012.09.015 30. Tsukuda S, Kusayanagi T, Umeda E et al (2013) Ridaifen B, a tamoxifen derivative, directly binds to Grb10 interacting GYF protein 2. Bioorg Med Chem 21:311–320. doi:10.1016/j.bmc.2012.10.037 31. Kuroiwa Y, Takakusagi Y, Kusayanagi T et al (2013) Identification and characterization of the direct interaction between methotrexate (MTX) and high-mobility group box 1 (HMGB1) protein. PLoS One 8:e63073. doi:10.1371/journal.pone.0063073 32. Licitra EJ, Liu JO (1996) A three-hybrid system for detecting small ligand-protein receptor interactions. Proc Natl Acad Sci U S A 93:12817–12821 33. Rezwan M, Auerbach D (2012) Yeast “N”-hybrid systems for protein–protein and drug–protein interaction discovery. Methods 57:423–429. doi:10.1016/j.ymeth.2012.06.006 34. Cottier S, Mönig T, Wang Z et al (2011) The yeast three-hybrid system as an experimental platform to identify proteins interacting with small signaling molecules in plant cells: potential and limitations. Plant Physiol 2:101. doi:10.3389/fpls.2011.00101 35. Chidley C, Haruki H, Pedersen MG et al (2011) A yeast-based screen reveals that

212

36.

37.

38.

39.

40.

41.

42.

43.

44.

45.

46.

Scott Bidlingmaier and Bin Liu sulfasalazine inhibits tetrahydrobiopterin biosynthesis. Nat Chem Biol 7:375–383. doi:10.1038/nchembio.557 Shepard AR, Conrow RE, Pang I-H et al (2013) Identification of PDE6D as a molecular target of anecortave acetate via a methotrexate-anchored yeast three-hybrid screen. ACS Chem Biol 8:549–558. doi:10.1021/ cb300296m Moser S, Johnsson K (2013) Yeast three-hybrid screening for identifying anti-tuberculosis drug targets. Chembiochem 14:2239–2242. doi:10.1002/cbic.201300472 Boder ET, Wittrup KD (1997) Yeast surface display for screening combinatorial polypeptide libraries. Nat Biotechnol 15:553–557. doi:10.1038/nbt0697-553 Bidlingmaier S, Liu B (2006) Construction and application of a yeast surface-displayed human cDNA library to identify post-translational modification-dependent protein-protein interactions. Mol Cell Proteomics 5:533–540. doi:10.1074/mcp.M500309-MCP200 Bidlingmaier S, Liu B (2007) Interrogating yeast surface-displayed human proteome to identify small molecule-binding proteins. Mol Cell Proteomics 6:2012–2020. doi:10.1074/ mcp.M700223-MCP200 Bidlingmaier S, He J, Wang Y et al (2009) Identification of MCAM/CD146 as the target antigen of a human monoclonal antibody that recognizes both epithelioid and sarcomatoid types of mesothelioma. Cancer Res 69: 1570–1577. doi:10.1158/0008-5472.CAN08-1363 Bidlingmaier S, Liu B (2011) Construction of yeast surface-displayed cDNA libraries. Methods Mol Biol 729:199–210. doi:10.1007/978-1-61779-065-2_13 Bidlingmaier S, Liu B (2011) Identification of protein/target molecule interactions using yeast surface-displayed cDNA libraries. Methods Mol Biol 729:211–223. doi:10.1007/978-1-61779-065-2_14 Bidlingmaier S, Wang Y, Liu Y et al (2011) Comprehensive analysis of yeast surface displayed cDNA library selection outputs by exon microarray to identify novel protein-ligand interactions. Mol Cell Proteomics. doi:10.1074/mcp.M110.005116 Di Paolo G, De Camilli P (2006) Phosphoinositides in cell regulation and membrane dynamics. Nature 443:651–657. doi:10.1038/nature05185 Balla T (2013) Phosphoinositides: tiny lipids with giant impact on cell regulation. Physiol Rev 93:1019–1137. doi:10.1152/ physrev.00028.2012

47. Lemmon MA (2008) Membrane recognition by phospholipid-binding domains. Nat Rev Mol Cell Biol 9:99–111. doi:10.1038/nrm2328 48. McLaughlin S, Murray D (2005) Plasma membrane phosphoinositide organization by protein electrostatics. Nature 438:605–611. doi:10.1038/nature04398 49. Best MD (2014) Global approaches for the elucidation of phosphoinositide-binding proteins. Chem Phys Lipids. doi:10.1016/j. chemphyslip.2013.10.014 50. Ahn J-Y, Liu X, Cheng D et al (2005) Nucleophosmin/B23, a nuclear PI(3,4,5)P3 receptor, mediates the antiapoptotic actions of NGF by inhibiting CAD. Mol Cell 18:435– 445. doi:10.1016/j.molcel.2005.04.010 51. Lewis AE, Sommer L, Arntzen MØ et al (2011) Identification of nuclear phosphatidylinositol 4,5-bisphosphate-interacting proteins by neomycin extraction. Mol Cell Proteomics 10:M110.003376. doi:10.1074/ mcp.M110.003376 52. Isakoff SJ, Cardozo T, Andreev J et al (1998) Identification and analysis of PH domaincontaining targets of phosphatidylinositol 3-kinase using a novel in vivo assay in yeast. EMBO J 17:5374–5387. doi:10.1093/ emboj/17.18.5374 53. Klarlund JK, Guilherme A, Holik JJ et al (1997) Signaling by phosphoinositide-3,4,5trisphosphate through proteins containing Pleckstrin and Sec7 homology domains. Science 275:1927–1930. doi:10.1126/ science.275.5308.1927 54. Jungmichel S, Sylvestersen KB, Choudhary C et al (2014) Specificity and commonality of the phosphoinositide-binding proteome analyzed by quantitative mass spectrometry. Cell Rep 6:578–591. doi:10.1016/j.celrep.2013.12.038 55. Rao VR, Corradetti MN, Chen J et al (1999) Expression cloning of protein targets for 3-phosphorylated phosphoinositides. J Biol Chem 274:37893–37900 56. Shah ZH, Jones DR, Sommer L et al (2013) Nuclear phosphoinositides and their impact on nuclear functions. FEBS J 280:6295–6310. doi:10.1111/febs.12543 57. Fiume R, Keune WJ, Faenza I et al (2012) Nuclear phosphoinositides: location, regulation and function. In: Balla T, Wymann M, York JD (eds) Phosphoinositides II: diverse biological functions. Springer, Netherlands, pp 335–361 58. Martelli AM, Ognibene A, Buontempo F et al (2011) Nuclear phosphoinositides and their roles in cell biology and disease. Crit Rev Biochem Mol Biol 46:436–457. doi:10.3109/ 10409238.2011.609530

Utilizing Yeast Surface Human Proteome Display Libraries to Identify Small… 59. Viiri K, Mäki M, Lohi O (2012) Phosphoinositides as regulators of proteinchromatin interactions. Sci Signal 5:pe19. doi:10.1126/scisignal.2002917 60. Yu H, Fukami K, Watanabe Y et al (1998) Phosphatidylinositol 4,5-bisphosphate reverses the inhibition of RNA transcription caused by histone H1. Eur J Biochem 251:281–287. doi:10.1046/j.1432-1327.1998.2510281.x 61. Gozani O, Karuman P, Jones DR et al (2003) The PHD finger of the chromatin-associated protein ING2 functions as a nuclear phosphoinositide receptor. Cell 114:99–111. doi:10.1016/S0092-8674(03)00480-X 62. Krylova IN, Sablin EP, Moore J et al (2005) Structural analyses reveal phosphatidyl inositols as ligands for the NR5 orphan receptors SF-1 and LRH-1. Cell 120:343–355. doi:10.1016/j.cell.2005.01.024 63. Li Y, Choi M, Cavey G et al (2005) Crystallographic identification and functional characterization of phospholipids as ligands for the orphan nuclear receptor steroidogenic factor-1. Mol Cell 17:491–502. doi:10.1016/j. molcel.2005.02.002 64. Ortlund EA, Lee Y, Solomon IH et al (2005) Modulation of human nuclear receptor LRH-1 activity by phospholipids and SHP. Nat Struct Mol Biol 12:357–363. doi:10.1038/nsmb910 65. Meerschaert K, Tun MP, Remue E et al (2009) The PDZ2 domain of zonula occludens-1 and -2 is a phosphoinositide binding domain. Cell Mol Life Sci 66:3951–3966. doi:10.1007/ s00018-009-0156-6 66. Viiri KM, Jänis J, Siggers T et al (2009) DNAbinding and -bending activities of SAP30L and SAP30 are mediated by a zinc-dependent module and monophosphoinositides. Mol Cell Biol 29:342–356. doi:10.1128/MCB.01213-08 67. Toska E, Campbell HA, Shandilya J et al (2012) Repression of transcription by WT1BASP1 requires the myristoylation of BASP1 and the PIP2-dependent recruitment of histone deacetylase. Cell Rep 2:462–469. doi:10.1016/j.celrep.2012.08.005 68. Yildirim S, Castano E, Sobol M et al (2013) Involvement of phosphatidylinositol 4,5bisphosphate in RNA polymerase I transcription. J Cell Sci 126:2730–2739. doi:10.1242/ jcs.123661 69. Gehring WJ, Qian YQ, Billeter M et al (1994) Homeodomain-DNA recognition. Cell 78: 211–223 70. van Koningsbruggen S, Straasheijm KR, Sterrenburg E et al (2007) FRG1P-mediated aggregation of proteins involved in premRNA processing. Chromosoma 116:53–64. doi:10.1007/s00412-006-0083-3

213

71. Loyer P, Trembley JH, Lahti JM, Kidd VJ (1998) The RNP protein, RNPS1, associates with specific isoforms of the p34cdc2-related PITSLRE protein kinase in vivo. J Cell Sci 111:1495–1506 72. Sapra AK, Änkö M-L, Grishina I et al (2009) SR protein family members display diverse activities in the formation of nascent and mature mRNPs in vivo. Mol Cell 34:179–190. doi:10.1016/j.molcel.2009.02.031 73. Cowper AE, Cáceres JF, Mayeda A, Screaton GR (2001) Serine-Arginine (SR) proteinlike factors that antagonize authentic SR proteins and regulate alternative splicing. J Biol Chem 276:48908–48914. doi:10.1074/jbc. M103967200 74. Osborne SL, Thomas CL, Gschmeissner S, Schiavo G (2001) Nuclear PtdIns(4,5)P2 assembles in a mitotically regulated particle involved in pre-mRNA splicing. J Cell Sci 114:2501–2511 75. Watt S, Kular G, Fleming I et al (2002) Subcellular localization of phosphatidylinositol 4,5-bisphosphate using the pleckstrin homology domain of phospholipase C δ1. http:// w w w. b i o c h e m j . o r g / b j / 3 6 3 / 0 6 5 7/ bj3630657.htm. Accessed 3 May 2014 76. Boronenkov IV, Loijens JC, Umeda M, Anderson RA (1998) Phosphoinositide signaling pathways in nuclei are associated with nuclear speckles containing pre-mRNA processing factors. Mol Biol Cell 9:3547–3560. doi:10.1091/mbc.9.12.3547 77. Spector DL, Lamond AI (2011) Nuclear speckles. Cold Spring Harb Perspect Biol 3:a000646. doi:10.1101/cshperspect.a000646 78. Mortier E, Wuytens G, Leenaerts I et al (2005) Nuclear speckles and nucleoli targeting by PIP2PDZ domain interactions. EMBO J 24:2556– 2565. doi:10.1038/sj.emboj.7600722 79. Wang Z, Castaño IB, Peñas ADL et al (2000) Pol κ: a DNA polymerase required for sister chromatid cohesion. Science 289:774–779. doi:10.1126/science.289.5480.774 80. Wang Z, Castaño IB, Adams C et al (2002) Structure/function analysis of the Saccharomyces cerevisiae Trf4/Pol sigma DNA polymerase. Genetics 160:381–391 81. Kumar A, Fernandez-Capetillo O, Carrera AC (2010) Nuclear phosphoinositide 3-kinase β controls double-strand break DNA repair. Proc Natl Acad Sci 107:7491–7496. doi:10.1073/pnas.0914242107 82. Shirakawa H, Herrera JE, Bustin M, Postnikov Y (2000) Targeting of high mobility group14/-17 proteins in chromatin is independent of DNA sequence. J Biol Chem 275:37937– 37944. doi:10.1074/jbc.M000989200

214

Scott Bidlingmaier and Bin Liu

83. Crippa MP, Trieschmann L, Alfonso PJ et al (1993) Deposition of chromosomal protein HMG-17 during replication affects the nucleosomal ladder and transcriptional potential of nascent chromatin. EMBO J 12:3855–3864 84. Tremethick DJ, Hyman L (1996) High mobility group protein 14 and 17 can prevent the close packing of nucleosomes by increasing the strength of protein contacts in the linker DNA. J Biol Chem 271:12009–12016

85. Trieschmann L, Alfonso PJ, Crippa MP et al (1995) Incorporation of chromosomal proteins HMG-14/HMG-17 into nascent nucleosomes induces an extended chromatin conformation and enhances the utilization of active transcription complexes. EMBO J 14:1478–1489 86. Vestner B, Bustin M, Gruss C (1998) Stimulation of replication efficiency of a chromatin template by chromosomal protein HMG-17. J Biol Chem 273:9409–9414

Part IV Yeast Surface Display in Bioassay and Industrial Applications

Chapter 12 Enzyme Evolution by Yeast Cell Surface Engineering Natsuko Miura, Kouichi Kuroda, and Mitsuyoshi Ueda Abstract Artificial evolution of proteins with the aim of acquiring novel or improved functionality is important for practical applications of the proteins. We have developed yeast cell surface engineering methods (or arming technology) for evolving enzymes. Here, we have described yeast cell surface engineering coupled with in vivo homologous recombination and library screening as a method for the artificial evolution of enzymes such as firefly luciferases. Using this method, novel luciferases with improved substrate specificity and substrate reactivity were engineered. Key words Yeast cell surface engineering, Protein evolution, In vivo homologous recombination, Firefly luciferase, Substrate specificity and reactivity

1

Introduction Yeast cell surface engineering has enabled the production of genetically engineered proteins on the cell surface. We have developed yeast cell surface engineering methods using genetically and nongenetically engineered yeast cells [1, 2]. Additionally, methods have been developed for displaying mutated peptides or protein libraries on the yeast cell surface [3–20] and for screening them for novel functionalities [4, 7–22]. Compared to the conventional screening method using purified enzymes, yeast cell surface engineering is convenient in that the proteins displayed on the cell surface need not be cleaved and purified for further analysis, except for specific purposes such as crystallization [15, 23]. Further, enzymes displayed on the yeast cell surface generally show better activities, similar to those noted for immobilized proteins [24, 25]. To date, enzymes [1, 2, 4, 7, 10, 13, 15, 17, 19, 20, 25–33], antibody fragments [8, 14, 22], and random proteins [3] or peptides [16] have been successfully displayed using these methods. As a result, numerous proteins or peptides with novel functionalities for applications in bioindustry have been developed. Screening peptide libraries enabled the development of yeast cells with novel

Bin Liu (ed.), Yeast Surface Display: Methods, Protocols, and Applications, Methods in Molecular Biology, vol. 1319, DOI 10.1007/978-1-4939-2748-7_12, © Springer Science+Business Media New York 2015

217

218

Natsuko Miura et al.

functionalities (e.g., tolerance to organic solvents [21] similar to that of selectively bred cells [34, 35]). Preparation and screening of peptide/protein libraries generally require the following three steps: identification of amino acid residues to be mutated, introduction of the desired mutation into the coding sequences, and screening mutated proteins for desirable functionalities. For the first step, several amino acids are selected on the basis of data from previous studies. Many enzymes have amino acids that are already known to be important for their catalytic activity or substrate specificity. These amino acids are usually selected for mutation [4, 8, 10, 13, 14, 19, 26, 33]. When the proteins of interest contain no such amino acids with known roles, the amino acid sequence of the target protein is compared with those of related proteins. Data from homology searches are then used to identify amino acids for mutation [7, 17, 20]. The three-dimensional structure of the protein also provides valuable clues for identifying the amino acids to be targeted for mutation [15]. Often, part of the amino acid sequence is replaced with a similar sequence [32]. Introduction of mutations is usually accomplished by PCR. Primers containing NNK codons [4, 7, 8, 10, 15, 16, 20, 33] or random primers [3] are often used for mutagenesis. Otherwise, primers are designed for cloning the cDNA sequences for the light chain of the antibody, which already contain random sequences [18]. When a single amino acid is selected as the target, the primer sets used for mutagenesis are often prepared one by one [13, 14, 17, 19]. Finally, mutants are selected for enhanced enzymatic activities or improved substrate-binding abilities. Because the yeast cells displaying mutants are alive, the mutants can be selected by screening for the acquisition of cell viability in harsh environments. Peptides and proteins that endow yeast cells with organic solvent tolerance have been developed by this method [16, 21]. Yeast cells displaying mutants with improved enzymatic activity can be selected on solid medium containing suitable substrates (halo-assay) [4, 7, 10] or clones can be separated and their individual enzymatic activities can be measured [13–15, 17, 19, 20]. Large-scale screening of libraries for selecting mutants with enhanced substrate-binding ability can be achieved by the use of fluorescence-activated cell sorting (FACS). FACS can be used either for screening displayed proteins [8] or for identifying substrates for the displayed enzymes [22]. To achieve high-throughput screening of the peptide/protein library displayed on the yeast cell surface, we have developed a single cell chip-based screening method [9, 11, 12, 18], whereby individual cells displaying mutant proteins can be separated. The cells can be grown on the chip [9, 11] or the enzymatic activities [12] or substrate-binding abilities [18] of each cell can be

Enzyme Evolution

219

determined. Molecular display is thus highly useful for evolving a wide range of enzyme properties [36, 37]. Identifying the specific property to be targeted for evolution in each step is the key to success in artificial protein evolution. Here, we have described specific methods for the evolution of firefly luciferases in order to obtain an enzyme with increased ATP reactivity and specificity, which will enable its applications in pyrosequencing [20]. Although the important catalytic amino acid residues in luciferases have been identified [38, 39], mutating the amino acid residues critical for catalytic activity may result in loss of ATP reactivity. Therefore, the mutagenesis sites were selected based on homology in the amino acid sequences of luciferases [20]. Combinatorial mutagenesis in these amino acids gave rise to three mutant firefly luciferases with both high ATP reactivity and specificity. Here, we have described methods for luciferase library construction by using NNK codon-containing primers and for measuring the luciferase activity without purification. We believe that the methods described here can be used for the evolution of diverse enzymes for future applications.

2 2.1

Materials Medium

1. LB Agar (LBA) plate: Dissolve 10 g tryptone, 5 g yeast extract, 5 g NaCl, and 15 g agar in 1 L deionized H2O and sterilize by autoclaving. Dissolve 100 mg ampicillin in 1 mL deionized H2O and sterilize by filtration using membrane filter (pore size: 0.45 μm) (store the 1,000× stock solution at −20 °C). Cool the sterilized medium (below 55 °C), and add ampicillin from the stock solution to a final concentration of 100 mg/L. Mix the contents and pour into plates. 2. LBA medium: Dissolve 10 g tryptone, 5 g yeast extract, and 5 g NaCl in 1 L deionized H2O and sterilize by autoclaving. Add ampicillin stock solution into cooled sterilized medium (below 55 °C) immediately before use to a final concentration of 100 mg/L. 3. YPD medium: Dissolve 10 g yeast extract, 20 g peptone, and 20 g dextrose in 1 L deionized H2O, and sterilize by autoclaving. 4. SDC + HML plate: Dissolve 6.7 g yeast nitrogen base without (w/o) amino acids (Difco), 20 g dextrose, 5 g casamino acids, 20 g agar, and amino acids according to the selection conditions (20 mg/L L-histidine–HCl, 30 mg/L L-methionine, and 30 mg/L L-leucine) in 1 L deionized H2O, and sterilize by autoclaving. Cool the sterilized medium (below 55 °C). Mix the contents and pour plates.

220

Natsuko Miura et al.

5. SDC + HML medium: Dissolve 6.7 g yeast nitrogen base w/o amino acids (Difco), 20 g dextrose, 5 g casamino acids, and amino acids according to the selection conditions (20 mg/L L-histidine–HCl, 30 mg/L L-methionine, and 30 mg/L L-leucine) in 1 L deionized H2O and sterilize by autoclaving. 6. SDC medium (buffered): Prepare SDC, add piperazine-1,4bis(2-ethanesulfonic acid) (PIPES) to a final concentration of 100 mM, and adjust pH (7.4) with 1 M KOH. 2.2 Strains and Plasmids

1. Saccharomyces cerevisiae strain BY4741/sed1Δ (Euroscarf): The genotype of this strain is MATa, his3Δ1, leu2Δ0, met15Δ0, ura3Δ0, YDR077w::KanMX4. SED1 encodes the GPIanchored cell wall protein, which is incorporated into the cell wall via a β-1,6-glucan side chain [40]. Thus, SED1 deletion creates a space in the cell wall and enhances the efficiency of cell surface display [41]. Typically, target proteins are displayed in this strain. 2. Plasmid pULD1 [41]: pULD1 is the plasmid used for cell surface display of target proteins/peptides and includes (1) the GAPDH promoter as a constitutive strong promoter in the presence of glucose, (2) a signal sequence of glucoamylase from Rhizopus oryzae for efficient translocation to the cell surface, (3) multiple cloning sites (BglII, NotI, SphI, NheI, and XhoI), (4) the FLAG epitope (DYKDDDDK) for the detection of cell surface display, (5) the 3′ half of α-agglutinin for cell wall anchoring, (6) URA3 and leu2-d auxotrophic markers for the selection of yeast transformants, (7) a 2 μm replication origin for the replication and maintenance of the plasmid in yeast, (8) the ampicillin-resistance gene Ampr for selection of Escherichia coli transformants, and (9) the origin for the replication and maintenance of the plasmid in E. coli. 3. Plasmid pULI1 [42]: pULI1 is the plasmid used for intracellular protein expression and includes (1) the GAPDH promoter, (2) multiple cloning sites (SacI, KpnI, BamHI, and SalI), (3) URA3 and leu2-d auxotrophic markers for the selection of yeast transformants, (4) a 2 μm replication origin for the replication and maintenance of the plasmid in yeast transformants, (5) the ampicillin-resistance gene Ampr for the selection of E. coli transformants, and (6) the origin for the replication and maintenance of the plasmid in E. coli transformants.

2.3 Plasmid Construction

1. KOD Plus DNA polymerase (TOYOBO) supplied along with 10× PCR buffer for KOD Plus DNA polymerase, 2 mM dNTPs, and 25 mM MgSO4. 2. MinElute PCR Purification Kit (Qiagen) for the purification of PCR products (70 bp to 4 kb).

Enzyme Evolution

221

3. QIAquick PCR Purification Kit (Qiagen) for the purification of PCR products (100 bp to 10 kb). 4. Restriction enzymes (NotI and XhoI) supplied with appropriate buffers. 5. 3 M Sodium acetate (pH 5.2): Dissolve 40.8 g sodium acetate trihydrate in 80 mL ultrapure H2O. Adjust the pH to 5.2 with glacial acetic acid, and make up the volume to 100 mL by adding ultrapure H2O. 6. 70 % Ethanol: To 70 mL of 99.5 % ethanol, add ultrapure H2O to a volume of 100 mL. 7. 50× TAE buffer: Dissolve 242 g Tris base in 57.1 mL glacial acetic acid. Add 18.6 g EDTA·H2O and make up the volume to 1 L by adding deionized H2O. Dilute 50× TAE buffer by 50-fold with deionized H2O to prepare 1× TAE buffer. 8. 1 % (w/v) Agarose gel: Dissolve 2 g agarose 1600 in 200 mL 1× TAE buffer by heating in a microwave until it boils. Cool the agarose solution until it can be handled safely, and pour it into the gel tray. 9. QIAEX II Gel Extraction Kit (Qiagen) (or other kits for the extraction of DNA from agarose gel). 10. Ligation High ligase (TOYOBO). 11. E. coli DH5α competent cells. 12. KOD Dash DNA polymerase (TOYOBO) supplied along with 10× PCR buffer (KOD Dash-compatible), and 2 mM dNTPs (or other efficient DNA polymerases). 13. Quantum Prep Plasmid Miniprep Kit (BioRad). 2.4 Yeast Transformation for Cell Surface Display

1. Frozen-EZ Yeast Transformation II (Zymo Research) supplied along with EZ 1 (for washing the yeast pellet), EZ 2 (for resuspending the yeast pellet), and EZ 3 solutions (containing polyethylene glycol) for yeast transformation using the lithium acetate method [43].

2.5 Immunofluorescence Labeling of Cells

1. 1× PBS: Dilute 10× PBS (1,370 mM NaCl, 81 mM Na2HPO4, 26.8 mM KCl, 14.7 mM KH2PO4, pH 7.4) tenfold with deionized H2O. 2. 3.7 % Formaldehyde/PBS: Add 37 μL of 37 % formaldehyde to 1× PBS to a final volume of 1 mL. 3. 1 % BSA/PBS: Dissolve 10 mg of bovine serum albumin in 1× PBS to a final volume of 1 mL. 4. Primary antibody: Alexa FluorR 488-conjugated goat antimouse IgG (Sigma). 5. Secondary antibody: Alexa Fluor 488 anti-mouse IgG (Invitrogen).

222

Natsuko Miura et al.

2.6 Measurement of Display Efficiency

1. Mouse monoclonal anti-FLAG M2 antibody (Sigma). 2. Microplate fluorometer (e.g., Fluoroskan Ascent FL from Thermo Scientific). 3. Ninety-six well microplate, opaque white (BD Falcon). 4. Ninety-six well microplate (353072; BD Falcon). 5. VMax Kinetic Microplate Reader (Molecular Devices, Sunnyvale, CA, USA).

2.7 Measurement of Luciferase Activity

1. Recombinant firefly luciferase (Promega, Madison, WI, USA). 2. Ninety-six well microplate, opaque white (BD Falcon). 3. Microplate luminometer (e.g., Fluoroskan Ascent FL from Thermo Scientific). 4. 50 mM tricine buffer (pH 7.8): 50 mM tricine (Sigma), adjust to pH 7.8 with 1 M KOH. 5. Substrate solution: Mix reagents according to the following composition: 1 mM D-Luciferin potassium salt (luciferin) (Biotium), 2 mM ATP or dATP, 5 mM MgSO4, 50 mM Tricine, pH 7.8. 6. Ninety-six well microplate (353072; BD Falcon). 7. VMax Kinetic Microplate Reader (Molecular Devices, Sunnyvale, CA, USA).

2.8 Extraction of Plasmids from Yeast Cells

3

1. RPM® Yeast Plasmid Isolation Kit (Qbiogene) supplied with Yeast Lysis Matrix, Alkaline Lysis Solution, Neutralizing Solution, GLASSMILK Spin Buffer, Wash Solution Concentrate, SPIN Filters, and Catch Tubes.

Methods To obtain mutant luciferases with increased ATP reactivity and specificity, the following procedures were performed: (1) preparation of yeast cells displaying wild-type luciferase, (2) measurement of displayed wild-type luciferase activity, (3) display of mutant luciferase libraries on the cell surface, (4) three-step screening of the mutant library for luciferase activity, and (5) extraction of plasmids from yeast cells for DNA sequencing. Activities of putative luciferases displayed on the cell surface were compared by determining the luciferase activity for each yeast cell. Assuming 1 OD600 = 1 × 107 cells/mL, the number of cells in the reaction solution can be estimated. Then, the activities of surface-displayed enzymes per single cell can be calculated. However, when the display efficiency of a transformant is higher than that of other mutants, the putative activity of the mutant protein per cell tends to become high. To avoid such misestimation, the activities of

223

Enzyme Evolution

wild-type and mutant luciferases were compared with the putative activity of single protein. The number of protein molecules displayed on the cell surface is estimated from the fluorescence intensity measured after immunofluorescence labeling. To generate standard curves, fluorophore-conjugated antibodies were used. 3.1 Construction of an Expression Plasmid for Cell Surface Display of the Wild-Type Enzyme (See Fig. 1)

1. Amplify the DNA fragment encoding the wild-type enzyme to be displayed together with the recognition sites of restriction enzymes at the 5′ and 3′ ends by using KOD Plus DNA polymerase according to the manufacturer’s instructions. 2. Analyze the PCR product using agarose gel electrophoresis. Add 2 μL of 6× loading dye to 10 μL of PCR product, and load the mixture onto a 1 % agarose gel. After electrophoresis, visualize the DNA by ethidium bromide staining. 3. Purify the PCR product by using a PCR product purification kit (for DNA fragment size ranging from 70 bp to 4 kb) or similar kits that are efficient for DNA fragments in the range of 100 bp to 10 kb (e.g., QIAquick PCR Purification Kit), according to the manufacturer’s instructions. 4. Digestion of pULD1 and the PCR product with restriction enzymes (NotI and XhoI): Prepare a mixture of 2 μg of DNA sample, 1 μL of restriction enzyme, 10 μL of 10× buffer, and ultrapure H2O to a final volume of 100 μL. Incubate the mixture at 37 °C for 3 h. 5. Add 10 μL of 3 M sodium acetate (pH 5.2) (final concentration: 0.3 M) and mix thoroughly. 6. Add 275 μL (2.5 volumes) of 99.5 % ice-cold ethanol and mix thoroughly.

a

b

Gene structure

plasmid

Plasmid introduction Display

5’-

- 3’ Transcription

Promoter

Secretion Protein encoding 3’-Half of αsignal gene to be agglutinin sequence displayed

GPI anchor attachment signal sequence

ER Translation

Golgi

Protein structure N-

Protein to be displayed

-C

C-Terminal half of αagglutinin

Modification

Yeast cell membrane GPI anchor

Secretion pathway

Secretion Vesicle

Cell wall

Fig. 1 Yeast cell surface engineering. (a) Gene and protein structures of target proteins. (b) Diagram illustrating the pathways leading to cell surface display of target proteins

224

Natsuko Miura et al.

7. Store the solution at −80 °C for 10 min, and centrifuge at 15,000 × g for 10 min at 4 °C. 8. Discard the supernatant, and add 500 μL of 70 % ice-cold ethanol. 9. Centrifuge at 15,000 × g for 5 min at 4 °C, and discard the supernatant. 10. Dry the DNA pellet in a lyophilizer. 11. Dissolve the DNA pellet in 10 μL of ultrapure H2O and subject it to 1 % agarose gel electrophoresis. Cut out the area of the gel containing DNA fragments and extract the DNA using QIAEX II Gel Extraction Kit according to the manufacturer’s instructions. 12. DNA ligation using Ligation High or analogous DNA ligases according to the manufacturer’s instructions: Combine 20–400 fmol of DNA fragment, 50–100 fmol of plasmid DNA, an appropriate amount of DNA ligase, and ligase buffer. Incubate the mixture at 16 °C for 1 h and follow the manufacturer’s protocols. 13. Transform 5 μL of E. coli DH5α competent cells with 1.5 μL of ligation reaction, and plate onto an LBA plate by using a flame-sterilized spreader. Incubate the plates at 37 °C overnight. 14. Perform direct colony PCR for confirming successful ligation by using KOD Dash DNA polymerase with the forward primer annealing to the upstream region (signal sequence of glucoamylase) of multiple cloning sites (GAs-F; 5′-CATGCAA CTGTTCAATTTGCCATTG-3′) and the reverse primer annealing to the downstream region (3′ half of α-agglutinin) of multiple cloning sites (AGα-R; 5′-GTGGAAATGGATCC AGTGGAATACG-3′) according to the manufacturer’s instructions. Subject the amplified DNA samples to 1 % agarose gel electrophoresis, and determine if ligation is successful by assessment of the size of the DNA fragment. 15. Inoculate 5 mL of LBA medium with E. coli transformants (that show successful ligation). Incubate at 37 °C with shaking overnight. 16. Extract and purify plasmid DNA using a miniprep kit (e.g., Quantum Prep Plasmid Miniprep Kit) according to the manufacturer’s instructions. Determine the concentration and purity of extracted plasmid DNA from absorbance measured at 260 and 280 nm using a spectrophotometer. 17. Verify the identity of plasmid DNA constructs by restriction performed using appropriate enzymes. Digest 2 μg of plasmid DNA as described in step 4, and perform electrophoresis on a 1 % agarose gel.

Enzyme Evolution

225

18. Perform sequencing on the ligated DNA fragment by using GAs-F, AGα-R (see step 14), and an appropriate primer annealing to the internal sequence of the ligated DNA fragment. 3.2 Yeast Transformation with the Plasmid Constructed for Cell Surface Display

1. Inoculate a single colony of S. cerevisiae BY4741/sed1Δ into 10 mL YPD medium in a test tube, and incubate at 30 °C with shaking overnight. 2. Prepare yeast competent cells using Frozen-EZ Yeast Transformation II according to the manufacturer’s instructions (see Note 1). 3. Dispense 50 μL each of the solution into separate tubes and store at −80 °C. 4. Mix 1 μg DNA with 50 μL of competent cells. 5. Add 500 μL EZ 3 solution and mix thoroughly. 6. Incubate at 30 °C for 45 min. 7. Mix vigorously by flicking with a finger or vortexing. 8. Spread 100 μL of the abovementioned transformant mixture on an SDC + HML plate. 9. Incubate the plates at 30 °C for 2–4 days to allow for the growth of transformants. 10. (Optional) For confirming the presence of the recombinant expression vector in the transformants, perform direct colony PCR using the efficient KOD Dash DNA polymerase with the primers GAs-F and Agα-R (see step 14 in Subheading 3.1), according to the manufacturer’s instructions.

3.3 Immunofluorescence Labeling of Cells

1. Inoculate a single colony of positive transformants (step 10 under Subheading 3.2) into 10 mL of buffered SDC + HML medium, and incubate at 30 °C with shaking until the stationary phase. 2. Harvest 1 mL of cell culture with an OD600 of 2.5–3.0, and centrifuge yeast cells at 800 × g for 5 min at room temperature (r.t.). 3. Discard the supernatant and suspend the cell pellet in 1 mL 1× PBS. 4. Centrifuge the cell suspension at 800 × g for 5 min at r.t. and discard the supernatant. 5. Resuspend the cell pellet in 1 mL of 3.7 % formaldehyde/PBS at r.t. for 1.5 h for fixation. 6. Wash the cells three times with 1 mL each of 1× PBS (see steps 3 and 4). 7. Suspend the cell pellet in 300 μL 1 % BSA/PBS for blocking nonspecific antibody binding, and incubate at r.t. with gentle shaking on a rotary shaker for 30 min.

226

Natsuko Miura et al.

8. Add 1 μL mouse monoclonal anti-FLAG M2 antibody, and incubate at r.t. with gentle shaking on a rotary shaker for 1.5 h. 9. Wash the cells with 1 mL of PBS (see steps 3 and 4). 10. Resuspend the cell pellet in 300 μL of PBS. 11. Add 1 μL Alexa Fluor® 488-conjugated goat anti-mouse IgG, and incubate at r.t. with gentle shaking on a rotary shaker for 1.5 h. 12. Wash the cells with 1 mL of PBS (see steps 3 and 4). 13. Resuspend the cell pellet in 30 μL of PBS. 14. Observe the cells under a fluorescence microscope equipped with appropriate filter units, and obtain fluorescence and phase contrast images. The green fluorescence from Alexa Fluor 488 is detected using a filter unit that consists of a 470–490 nm band-pass excitation filter, a 505 nm dichroic mirror, and a 510–550 nm barrier emission filter. 3.4 Measurement of Display Efficiency

1. Measure the OD600 of cell suspensions after immunofluorescence labeling and adjust the OD600 to 1. 2. Transfer 100 μL each of the cell suspensions (OD600 = 1) into individual wells of a 96-well white plate. 3. Prepare serial dilutions, that is, 0, 0.02, 0.04, 0.1, 0.2, 0.4, 1, 2, 4, 8, and 20 mg/mL, of Alexa Fluor® 488-conjugated goat anti-mouse IgG in PBS in the 96-well white plate (total volume = 100 μL/well). 4. Measure the fluorescence of the Alexa Fluor 488 dye from the cell surface by using a fluorometer fitted with 485 nm excitation and 527 nm emission filters. 5. Estimate the number of proteins displayed per cell by generating a calibration curve using Alexa Fluor 488 anti-mouse IgG (see Note 2).

3.5 Measurement of the Luciferase Activity of the Proteins Displayed on the Yeast Cell Surface

1. Inoculate single colonies of transformants into 10 mL of YPD medium, and incubate at 30 °C with shaking for 24 h. 2. Transfer 1 mL of the culture into a new 1.5 mL tube. 3. Centrifuge the cell culture at 13,000 × g for 10 s (r.t.), and discard the supernatant. 4. Resuspend the cells in 1 mL PBS. 5. Transfer the cells into 10 mL of buffered SDC + HML liquid medium to obtain an OD600 of 0.1. 6. Incubate at 30 °C for 15 h with continuous shaking. 7. Transfer 1 mL of the culture into a new 1.5 mL tube. 8. Centrifuge at 13,000 × g for 10 s (r.t.), and discard the supernatant. 9. Wash cells with 1 mL of 50 mM tricine buffer (pH 7.8).

Enzyme Evolution

227

10. Resuspend the cells in 100 μL of 50 mM tricine buffer (pH 7.8). 11. Transfer 10 μL of the cell suspension into the 96-well white plate. 12. Prepare serial dilutions of 150 ng/mL recombinant firefly luciferase in 50 mM tricine buffer (pH 7.8) in the 96-well white plate (each volume per well = 10 μL): 0, 5, 10, 20, 50, 100, and 150 ng/mL. 13. Add 90 μL substrate solution and measure the luminescence using a luminometer (see Note 3). 14. Transfer 100 μL of the reaction mixtures into 96-well plate and measure the OD600 using a VMax Kinetic Microplate Reader. 15. Estimate the activity of the displayed proteins per cell by generating a calibration curve using known amounts of recombinant firefly luciferase. 16. Estimate the enzymatic activity per single molecule of displayed proteins by dividing the above number (step 15 in Subheading 3.5) by the number of the proteins displayed per cell (see step 5 in Subheading 3.4) (see Note 4). 3.6 Cell Surface Display of the Mutant Luciferase Library (See Fig. 2)

Preparation of plasmid

1. Digest pULD1 with restriction enzymes and prepare a linear fragment (see steps 4–11 in Subheading 3.1). 2. Amplify luciferase gene fragments by using primers containing the NNK codon (see steps 1–3 in Subheading 3.1) and purify the amplicons. Prepare full-length luciferase with the homologous 30-bp region with the terminal of linear pULD1 (see Note 5 and Fig. 2). In vivo homologous recombination

Digestion with restriction enzymes

Yeast transformation

Plasmid

Mix

Restriction site A

Restriction site B

Terminal region (30-80 bp)

Yeast cell

Preparation of mutated gene fragments NNK

5’Template sequence

- 3’ Amplification by PCR

Mutagenesis site

Fig. 2 Schematic diagram illustrating the methodology used for the preparation and display of the mutant library. Gene fragments prepared by plasmid digestion and luciferase mutant fragments prepared by PCR are ligated inside the yeast cell

228

Natsuko Miura et al.

3. Transform yeast cells with the mixture of amplified DNA fragments and linear pULD1 fragments (see steps 1–10 in Subheading 3.2) (see Notes 6 and 7). 3.7 Screening the Mutant Enzyme Library (See Fig. 3)

1. Prepare yeast cell library in 15 % glycerol and spread on SDC + HML agar plates.

3.7.1 First Screening

1. Pick single colonies from the plate and sequentially inoculate into individual wells of a 96-well plate containing 150 μL each of buffered SDC + HML.

2. Incubate at 30 °C (see Note 8).

2. Incubate at 30 °C for 20 h (w/o shaking). 3. Transfer 10 μL of cultures into a fresh 96-well white plate. 4. Add 90 μL substrate solution and measure the luminescence intensity for ATP. 5. Select mutants exhibiting 20 % more ATP reactivity than the wild-type enzyme. 3.7.2 Second Screening

1. Pick single colonies from the plate and sequentially inoculate into individual wells of a 96-well plate containing 200 μL of YPD. 2. Incubate at 30 °C for 24 h (w/o shaking). 3. Inoculate into 200 μL of buffered SDC + HML, and incubate at 30 °C for 15 h.

1st screening (96-well plate)

Yeast cells displaying mutant proteins ATP-reactivity ≥ 20% of WT

2nd screening (96-well plate)

96-well plate

(ATP-reactivity) ×(ATP-specificity) ≥ 200% of WT

3rd screening (Test tube) yeast cell

(ATP-reactivity) ×(ATP-specificity) ≥ 200% of WT

protein mutant proteins

Test tube

Fig. 3 Schematic diagram illustrating the methodology used for screening the mutant luciferase library

Enzyme Evolution

229

4. Transfer a total of 10 μL of culture into the wells of a fresh 96-well white plate. 5. Add 90 μL of substrate solution and measure the luminescence intensity of ATP and dATP. 6. Pick up the mutants showing ATP reactivity × ATP specificity more than 200 % of that seen for the wild-type enzyme. ATP specificity was determined by the following formula: Value of ATP specificity = (luminescence intensity for ATP)/(luminescence intensity for dATP). 3.7.3 Third Screening

1. Pick single colonies from the plate and sequentially inoculate into test tubes, each containing 10 mL of YPD. 2. Incubate at 30 °C for 24 h (w/o shaking). 3. Inoculate cultures into 10 mL of buffered SDC + HML to obtain a final OD600 of 0.1 and incubate at 30 °C for 15 h. 4. Measure ATP reactivity and specificity (see step 16 under Subheading 3.5). 5. Pick up the mutants showing ATP reactivity × ATP specificity (see step 6 under Subheading 3.7.2) of more than 200 % of that of the wild-type enzyme.

3.8 Extraction of Plasmids from Yeast Cells

1. Pick single colonies from the plate and sequentially inoculate them into test tubes, each containing 10 mL of YPD. 2. Incubate at 30 °C for 24 h with shaking. 3. Inoculate into 10 mL of buffered SDC + HML and incubate at 30 °C for 15 h. 4. Extract plasmids from yeast cells by using the RPM Yeast Plasmid Isolation Kit according to the manufacturer’s instructions. 5. Sequence the extracted plasmids (see step 18 in Subheading 3.1) and reintroduce them into wild-type yeast cells for further experimental verification (e.g., confirmation of the cell surface display and enzymatic activity).

4

Notes 1. The competent cells can be stored at −80 °C by freezing slowly. For constructing the yeast library, 1 mL of competent cell was prepared from 30 mL of YPD liquid medium. 2. Use pULI1- and pULD1-transformed cells as the negative and positive controls, respectively. 3. If possible, the solution must be automatically dispensed just before the measurement. Measure the integrated sum of light

230

Natsuko Miura et al.

emitted for 20 ms, calculate the sum of light emitted in 1 s, and represent these data as relative light units per second (RLU/s). Measure the luminescence intensities for ATP and dATP separately. ATP specificity is determined by the following formula: ATP specificity = (luminescence intensity for ATP)/(luminescence intensity for dATP). The luciferase assay should be checked for linearity in each measurement. 4. Use pULD1-transformed cells as a negative control. 5. If necessary, extend the DNA fragments by PCR performed using the prepared DNA fragments containing a mutation [20]. The resultant DNA fragments contains mutated site(s) inside the DNA sequence and 30 bp of homologous region with terminal of linear pULD1 at each end (see Fig. 2). 6. The cell suspension of the yeast library prepared in 15 % glycerol can be stored at −80 °C. 7. In this method, the number of steps required to construct a library are lesser than those required for previously reported methods. 8. Plates can be stored at 4 °C for at least 2 months. References 1. Ueda M, Tanaka A (2000) Genetic immobilization of proteins on the yeast cell surface. Biotechnol Adv 18:121–140 2. Miura N, Aoki W, Tokumoto N et al (2009) Cell surface modification for non-GMO without chemical treatment by novel GMOcoupled and -separated co-cultivation method. Appl Microbiol Biotechnol 82:293–301 3. Zou W, Ueda M, Yamanaka H et al (2001) Construction of a combinatorial protein library displayed on yeast cell surface using DNA random priming method. J Biosci Biotechnol 92:393–396 4. Shiraga S, Ueda M, Takahashi S et al (2002) Construction of the combinatorial library of Rhizopus oryzae lipase mutated in the lid domain by displaying on yeast cell surface. J Mol Catal B Enzym 17:167–173 5. Ueda M (2004) Combinatorial bioengineeringdevelopment of molecular evolution. J Mol Catal B Enzym 28:4–6 6. Ueda M (2004) Future direction of molecular display by yeast-cell surface engineering. J Mol Catal B Enzym 28:139–144 7. Shiraga S, Kawakami M, Ueda M (2004) Construction of combinatorial library of the starch-binding domain of Rhizopus oryzae glucoamylase and screening of clones with enhanced activity by yeast display method. J Mol Catal B Enzym 28:229–234

8. Lin Y, Shiraga S, Tsumuraya T et al (2004) Isolation of novel catalytic antibody clones from combinatorial library displayed on yeastcell surface. J Mol Catal B Enzym 28:247–252 9. Fukuda T, Shiraga S, Kato M et al (2005) Construction of novel single cell screening system using a yeast cell chip for nano-sized modified-protein-displaying libraries. Nanobiotechnology 1:105–111 10. Shiraga S, Ishiguro M, Fukami H et al (2005) Creation of Rhizopus oryzae lipase having a unique oxyanion hole by combinatorial mutagenesis in the lid domain. Appl Microbiol Biotechnol 68:779–785 11. Fukuda T, Shiraga S, Kato M et al (2006) Construction of a cultivation system of a yeast single cell in a cell chip microchamber. Biotechnol Prog 22:944–948 12. Fukuda T, Kato M, Suye S et al (2007) Development of high-throughput screening system by single cell reaction using microchamber array chip. J Biosci Bioeng 104:241–243 13. Fukuda T, Kato M, Kadonosono T et al (2007) Enhancement of substrate recognition ability by combinatorial mutation of β-glucosidase displayed on the yeast cell surface. Appl Microbiol Biotechnol 76:1027–1033 14. Okochi N, Kato M, Kadonosono T et al (2007) Design of a serine protease-like catalytic triad on an antibody light chain displayed

Enzyme Evolution

15.

16.

17.

18.

19.

20.

21.

22.

23.

24.

25.

on the yeast cell surface. Appl Microbiol Biotechnol 77:597–603 Kadonosono T, Kato M, Ueda M (2008) Alteration of substrate specificity of rat neurolysin from matrix metalloproteinase-2/9-type to -3-type specificity by comprehensive mutation. Protein Eng Des Sel 21:507–513 Matsui K, Kuroda K, Ueda M (2009) Creation of a novel peptide endowing yeasts with acid tolerance using yeast cell-surface engineering. Appl Microbiol Biotechnol 82:105–113 Isogawa D, Fukuda T, Kuroda K et al (2009) Demonstration of catalytic proton acceptor of chitosanase from Paenibacillus fukuinensis by comprehensive analysis of mutant library. Appl Microbiol Biotechnol 85:95–104 Aoki W, Yoshino Y, Morisaka H et al (2011) High-throughput screening of improved protease inhibitors using a yeast cell surface displaying system and a yeast cell chip. J Biotechnol Bioeng 111:16–18 Kuroda K, Nishitani T, Ueda M (2012) Specific adsorption of tungstate by cell surface display of the newly designed ModE mutant. Appl Microbiol Biotechnol 96:153–159 Fushimi T, Miura N, Shintani H et al (2013) Mutant firefly luciferases with improved specific activity and dATP discrimination constructed by cell surface engineering. Appl Microbiol Biotechnol 97:4003–4011 Zou W, Ueda M, Tanaka A (2002) Screening of a molecule endowing Saccharomyces cerevisiae with n-nonane-tolerance from a combinatorial random protein library. Appl Microbiol Biotechnol 58:806–812 Fukuda N, Ishii J, Shibasaki S et al (2007) High-efficiency recovery of target cells using improved yeast display system for detection of protein-protein interactions. Appl Microbiol Biotechnol 76:151–158 Maeda H, Nagayama M, Kuroda K et al (2009) Purification of inactive precursor of carboxypeptidase Y using selective cleavage method coupled with molecular display. Biosci Biotechnol Biochem 73:753–755 Shiraga S, Kawakami M, Ishiguro M et al (2005) Enhanced reactivity of Rhizopus oryzae lipase displayed on yeast cell surface in organic solvents: potential as a whole cell biocatalyst in organic solvents. Appl Environ Microbiol 71: 4335–4338 Nakamura Y, Matsumoto T, Nomoto F et al (2006) Enhancement of activity of lipasedisplaying yeast cells and their application to optical resolution of (RS)-1-benzyloxy-3chloro-2-propyl succinate. Biotechnol Prog 22:998–1002

231

26. Fukuda T, Ishikawa T, Ogawa M et al (2006) Enhancement of cellulase activity by clones selected from the combinatorial library of the cellulose-binding domain by cell surface engineering. Biotechnol Prog 22:933–938 27. Kato M, Fuchimoto J, Tanio T et al (2007) Preparation of a whole-cell biocatalyst of mutated Candida antarctica lipase B (mCALB) by a yeast molecular display system and its practical properties. Appl Microbiol Biotechnol 75:549–555 28. Kadonosono T, Kato M, Ueda M (2007) Substrate specificity of rat brain neurolysin disclosed by molecular display system and putative substrates in rat tissues. Appl Microbiol Biotechnol 75:353–1360 29. Kadonosono T, Kato M, Ueda M (2007) Metallopeptidase, neurolysin, as a novel molecular tool for analysis of properties of cancer-producing matrix metalloproteinases-2 and 9. Appl Microbiol Biotechnol 75: 1285–1291 30. Fukuda T, Kato M, Kuroda K et al (2008) Improvement in enzymatic desizing of starched cotton cloth using yeast co-displaying glucoamylase and cellulose-binding domain. Appl Microbiol Biotechnol 77:1225–1232 31. Nishitani T, Shimada M, Kuroda K et al (2010) Molecular design of yeast cell surface for adsorption and recovery of molybdenum, one of rare metals. Appl Microbiol Biotechnol 86:641–648 32. Nagayama M, Maeda H, Kuroda K et al (2012) Mutated intramolecular chaperones generate high-activity isomers of mature enzymes. Biochemistry 51:3547–3553 33. Nakanishi A, Bae J, Kuroda K et al (2012) Construction of a novel selection system for endoglucanases exhibiting carbohydratebinding modules optimized for biomass using yeast cell-surface engineering. AMB Express 2:56 34. Matsui K, Hirayama T, Kuroda K et al (2006) Screening for candidate genes involved in tolerance to organic solvents in yeast. Appl Microbiol Biotechnol 71:75–79 35. Matsui K, Teranishi S, Kamon S et al (2008) Discovery of a modified transcription factor endowing yeasts with organic-solvent tolerance and reconstruction of an organic-solventtolerant yeast. Appl Environ Microbiol 74: 4222–4225 36. Ueda M (2011) Revolutionary protein engineering using molecular display. In: Sheehan MN (ed) Protein engineering: design, selection, and applications. Nova Science Publisher, New York, pp 73–80

232

Natsuko Miura et al.

37. Isogawa D, Kuroda K, Ueda M (2011) Wholecell biocatalyst for utilization of chitosan by yeast cell surface engineering of chitosanase. In: MacKay RG, Tait JM (eds) Handbook of chitosan research and application. Nova Science Publisher, New York, pp 425–434 38. Branchini BR, Magyar RA, Murtiashaw MH et al (1999) Site-directed mutagenesis of firefly luciferase active site amino acids: a proposed model for bioluminescence color. Biochemistry 38:13223–13230 39. Branchini BR, Murtiashaw MH, Magyar RA et al (2000) The role of lysine 529, a conserved residue of the acyl-adenylate-forming enzyme superfamily, in firefly luciferase. Biochemistry 39:5433–5440

40. Shimoi H, Kitagaki H, Ohmori H et al (1998) Sed1p is a major cell wall protein of Saccharomyces cerevisiae in the stationary phase and is involved in lytic enzyme resistance. J Bacteriol 180:3381–3387 41. Kuroda K, Matsui K, Higuchi S et al (2009) Enhancement of display efficiency in yeast display system by vector engineering and gene disruption. Appl Microbiol Biotechnol 82:713–719 42. Miura N, Kirino A, Endo S et al (2012) Tracing putative trafficking of the glycolytic enzyme enolase via SNARE-driven unconventional secretion. Eukaryot Cell 11:1075–1082 43. Ito H, Fukuda Y, Murata K et al (1983) Transformation of intact yeast cells treated with alkali cations. J Bacteriol 153:163–168

Chapter 13 Electrochemical Glucose Biosensor Based on Glucose Oxidase Displayed on Yeast Surface Hongwei Wang, Qiaolin Lang, Bo Liang, and Aihua Liu Abstract The conventional enzyme-based biosensor requires chemical or physical immobilization of purified enzymes on electrode surface, which often results in loss of enzyme activity and/or fractions immobilized over time. It is also costly. A major advantage of yeast surface display is that it enables the direct utilization of whole cell catalysts with eukaryote-produced proteins being displayed on the cell surface, providing an economic alternative to traditional production of purified enzymes. Herein, we describe the details of the display of glucose oxidase (GOx) on yeast cell surface and its application in the development of electrochemical glucose sensor. In order to achieve a direct electrochemistry of GOx, the entire cell catalyst (yeastGOx) was immobilized together with multiwalled carbon nanotubes on the electrode, which allowed sensitive and selective glucose detection. Key words Yeast surface display, Glucose oxidase, Electrochemical biosensor, Glucose

1

Introduction Glucose-1-oxidase (GOx) (beta-D-glucose:oxygen-1-oxidoreductase, EC 1.1.3.4) from Aspergillus niger is capable of oxidizing betaD-glucose to D-gluconolactone and releasing hydrogen peroxide, with glucose as electron donor [1]. The virtue of its glucose specific oxidation and extreme stability compared with other enzymes has allowed GOx to play the leading role in enzyme electrodes construction for easy-to-use blood sugar testing [2]. It has been estimated that the world’s market value of biosensors reaches about 5 billion US dollars, of which 85 % is attributed to glucose biosensors [3]. However, purified GOx is required for immobilization on electrode, increasing the cost. In addition, the conventional physical or chemical immobilization approaches often result in enzyme activity loss and reduction in fractions immobilized over time, and increase the difficulty of mass transfer, which has become the bottleneck in the area of enzyme based electrode development [4].

Bin Liu (ed.), Yeast Surface Display: Methods, Protocols, and Applications, Methods in Molecular Biology, vol. 1319, DOI 10.1007/978-1-4939-2748-7_13, © Springer Science+Business Media New York 2015

233

234

Hongwei Wang et al.

In the last decade, microbial surface display allowed direct utilization of whole cell catalysts with recombinant protein displayed on the cell surface, providing a low cost alternative to the purified enzymes. Robust surface display systems on bacterial (e.g., E. coli, B. anthracis) and yeast (e.g., S. cerevisiae and Y. lipolytica) had been developed and applied in peptide library screening, antibody production, live vaccine development and whole-cell biocatalysts construction, while the application in biosensor design is rare [5]. Recently, efficient E. coli surface display of xylose dehydrogenase [6] and glucose dehydrogenase [7, 8] has been developed. Meanwhile, sensitive and selective D-xylose biosensor [9, 10], D-glucose biosensor [7, 8] and assembly of xylosebased biofuel cell [11] were prepared by using E. coli surface displayed system. However, this prokaryotic system shows a major limitation as those large and complex proteins derived from eukaryotes often do not fold properly in E. coli. Therefore, it is necessary to develop an eukaryotic cell surface display system for biosensor design. The active GOx with improved pH and thermal stability had been successfully expressed in S. cerevisiae [12]. We hereby describe in detail bioelectrode construction using the yeast displayed GOx and carbon nanotubes. The exploration of this interesting whole-cell biocatalyst in the electrochemical glucose biosensing is presented.

2

Materials Prepare all solutions using ultrapure water and analytical grade reagents. Prepare and store all reagents at room temperature unless indicated otherwise. Carefully follow all waste disposal regulations when disposing waste materials.

2.1 GOx Display on Surface of S. cerevisiae

1. GOx deriving strain: Aspergillus niger CBS 513.88. 2. Yeast display system: pYD1 Yeast Display Vector Kit (Invitrogen, Carlsbad, CA). 3. YPD media: Dissolve 20 g peptone, 10 g yeast extract, and 15 g agar (optional) in 900 mL of water and autoclave for 20 min. Then, add 100 mL of 20 % filter-sterilized glucose. 4. Selection media: Dissolve 6.7 g YNB, 0.74 g Trp DO Supplement, and 15 g agar (optional) in 900 mL of water and autoclave for 20 min. Then, add 100 mL of 20 % filter-sterilized glucose. 5. Induction media: Dissolve 6.7 g YNB, 0.74 g Trp DO Supplement, and 15 g agar (optional) in 900 mL of water and autoclave for 20 min. Then, add 100 mL of 20 % filter-sterilized galactose. 6. Restriction enzymes (MBI Fermentas, Canada).

Electrochemical Glucose Biosensor by Yeast Display

235

7. Yeastmaker™ Yeast Transformation System 2 (Clontech, Japan). 8. 0.1 M phosphate buffer saline (PBS) (pH 7.4): Dissolve 2.90 g disodium phosphate dodecahydrate (Na2HPO4·12H2O), 0.24 g potassium phosphate monobasic (KH2PO4), 0.20 g potassium chloride (KCl), and 8.0 g sodium chloride (NaCl) with ultrapure water and dilute to 1,000 mL in volumetric flask. Adjust pH of the solution to 7.4 and autoclave. 2.2 Glucose Oxidase Activity Assay

1. Peroxidase (POD) solution: Immediately before use, dissolve 1 mg POD Type II (Sigma-Aldrich, USA) into 3 mL of cold water to make a solution containing about 60 Purpurogallin units/mL of POD. Store on ice. 2. 0.1 M PBS buffer (pH 7.4): Dissolve 2.90 g Na2HPO4·12H2O, 0.24 g KH2PO4, 0.20 g KCl, and 8.0 g NaCl with ultrapure water and dilute to 1 L in volumetric flask. Adjust pH of the solution to 7.4 and autoclave. 3. o-dianisidine solution: Dissolve 20 mg o-dianisidine dihydrochloride (Sigma-Aldrich, USA) in 8 mL water and then dilute 5.35–200 mL with 0. 1 M PB (0.21 mM o-dianisidine). Store at 4 °C protected from light. 4. Glucose solution: Dissolve 10 g (w/v) D-(+)-glucose (SigmaAldrich, USA) in 100 mL distilled water. 5. Reaction cocktail: Immediately before use, combine 192 mL o-dianisidine solution with 40 mL of glucose solution (0.17 mM o-dianisidine and 1.72 % glucose solution). 6. PB-10 pH meter (Sartorius AG, Germany). 7. UV/Vis Spectrophotometer (Beckman Coulter, Inc., USA). 8. Substrate solution for specific test: Dissolve 0.901 g D-(+)glucose, 1.711 g D-(+)-maltose, 1.711 g D-sucrose, 0.751 g D-(+)-xylose, 0.901 g D-(−)-fructose, 0.751 g D-(−)-ribose, 0.901 g D-(+)-galactose, 0.901 g D-(+)-mannose, 0.751 g L-(+)arabinose, and 1.711 g D-(+)-cellobiose in 100 mL distilled water to make a 50 mM substrate stock solution, respectively and store at 4 °C before use. All the sugars can be purchased from Sigma-Aldrich. 9. Cocktail for substrate test: Immediately before use, combine 19.2 mL o-dianisidine solution with 4 mL of glucose solution (10.69 mM substrate).

2.3 Preparation of Modified Electrode

1. 5 % Nafion (perfluorinated ion-exchange resin, 5 wt% solution in a mixture of lower aliphatic alcohols and water) (Aldrich Corporation, USA). 2. Multi-walled carbon nanotubes (MWNTs) (Wako Chemical Co., Tokyo, Japan). 3. 1-, 0.3-, and 0.05-μm alumina slurry (Aldrich Corporation) is dispersed with water under sonication before use.

236

Hongwei Wang et al.

4. MWNTs-Nafion suspension: 2 mg of MWNTs powder is dispersed in 1 mL of 0.05 wt% Nafion solution and ultrasonication for at least 10 min. 5. Glassy carbon electrode (GCE, 3 mm in diameter) (Chenhua Co., Shanghai, China). 2.4 Electrochemical Glucose Detection

1. 0.1 M PBS buffer (pH 7.4): Dissolve 2.90 g Na2HPO4·12H2O, 0.24 g KH2PO4, 0.20 g KCl, and 8.0 g NaCl with ultrapure water and dilute to 1,000 mL in volumetric flask. Adjust pH of the solution to 7.4. 2. 1.000 M glucose stock solution: Dissolve 900.8 mg β-D-(+) glucose in 5 mL 0.1 M PBS buffer (pH 7.4). 3. Yeast-GOx, see Subheading 2.1. 4. 660D electrochemical workstation Chenhua Co., Shanghai, China).

(CH

Instruments,

5. Reference electrode: saturated calomel electrode (SCE, Chenhua Co., Shanghai, China). 6. Counter electrode: platinum wire (Chenhua Co., Shanghai, China). 7. 99.99 % N2 gas.

3

Methods

3.1 Preparation of Yeast Catalyst 3.1.1 GOx Displaying on Surface of S. cerevisiae

3.1.2 Expression Induction

A frequently used gene encoding GOx (GenBank accession No. J05242.1) may be amplified from genomic DNA of A. niger CBS 513.88 or its mutant stains. The displayed GOx could be obtained by using pYD1 Yeast Display Vector Kit where the verified ORF is initially cloned into multiple cloning site (MCS) of pYD1 vector and transformed into S. cerevisiae EBY100. The details have been described in the manual of the kit, which used the a-agglutinin receptor of S. cerevisiae to display foreign proteins on the cell surface [13]. 1. Inoculate a single large yeast colony into 10 mL selection medium containing 2 % glucose and grow overnight at 30 °C with shaking at 200 rpm. 2. Read the absorbance of the cell culture at 600 nm (OD600) until it reaches between 2 and 5. 3. Centrifuge the cell culture at 3,000–5,000 × g for 5–10 min and harvest the cell pellets (see Note 1). 4. Resuspend the cell pellet in tryptophan drop out medium containing 2 % galactose to an OD600 of 0.5–1 (see Note 2). 5. Induce the recombinant protein expression by incubating the cell culture at 20–22 °C with shaking at 200 rpm.

Electrochemical Glucose Biosensor by Yeast Display

237

6. Remove a volume of cells equivalent to at least 1 OD600 units and assay the cell culture from 24 to 48 h time period (i.e., 24, 30, 36, 48 h) to obtain the cell culture with maximum display (see Note 3). 7. Harvest the cells by centrifuge at 3,000–5,000 × g for 5–10 min at room temperature. Resuspend the cell pellets with sterilized water by gentle shaking, centrifuge again and repeat this step. Finally, resuspend the yeast cells in 0.01 M PBS with a concentration of at least 1 OD600 per 10 μL, which could be stored at 4 °C as the cell stock for further analysis (see Note 4). 3.1.3 Glucose Oxidase Activity Assay

Glucose oxidase activity is determined by the coupled o-dianisidine peroxidase reaction [14]. Here, a modified protocol for the GOx activity of whole cell catalyst is described. 1. Sequentially pipette 2.9 mL of reaction cocktail, 0.1 mL of POD, and 0.1 mL yeast-GOx (PBS for blank) in suitable cuvettes. 2. Immediately mix by pipetting and record the increase in A500nm/min for 10 min at 25 °C or room temperature. Obtain the maximum linear rate for both the test and the blank using a minimum of a 1 min period. 3. To determine the amount of displayed GOx, add 0.1 mL yeast cells in 0.9 mL PBS and record the OD600. 4. Calculate the GOx activity (U). U = 3.1 ´ ( DA 500 nm / min test - DA 500 nm / min blank ) / ( 7.5) ´ OD600 nm where 7.5 is millimolar extinction coefficient of oxidized odianisidine at 500 nm [15]. One unit of GOx activity is defined as the amount of enzyme required to oxidize 1 μmol of glucose/min under the above assay conditions (see Note 5).

3.1.4 Stability and Specificity Test of Yeast Displayed GOx

1. To test the thermostability, incubate 0.1 mL of the yeast-GOx at different temperatures from 20 °C to 60 °C for 1 h using a water bath and put the samples on ice until enzyme assay (see Subheading 3.1.3) (see Note 6). 2. To test the pH stability, resuspend 0.1 mL of yeast-GOx stock in the same volume of test buffers (pH 4–11) and incubate at 25 °C for 1 h. Then, centrifuge the yeast-GOx at 5,000 × g for 5 min and resuspend the pellets in 0.01 M PBS. Put samples on ice until enzyme assay (see Subheading 3.1.3) (see Note 7). 3. To test the substrate specificity, carry out a set of enzyme assay as described in Subheading 3.1.3 but use a substrate test cocktail, which includes 10 mM of different substrates such as DGLUCOSE, D-maltose, D-sucrose, and D-xylose (see Note 8).

238

Hongwei Wang et al.

3.2 Preparation of the Modified Electrode

1. The bare GCE is polished carefully with 1.0-, 0.3-, and 0.05-­ µm alumina slurries, and then sonicated in anhydrous ethanol and distilled deionized water, respectively. 2. Rinse the electrode with ultrapure water and allow it to dry at room temperature. 3. Then, deposit 10 μL of MWNTs-Nafion suspension on the surface of GCE by dropwise pipetting and dry in air (see Notes 9 and 10). 4. After drying, 10 μL of GOx-yeast aqueous dispersion is added dropwise on the inverted GCE and dried overnight at 4 °C in a refrigerator (see Note 11). 5. Before use, syringe 10 μL of Nafion solution (0.05 wt%) to the electrode surface and air-dry. 6. Finally, the modified GCE should be immersed in PBS to remove any loosely adsorbed GOx-yeast and stored at 4 °C in a refrigerator under dry conditions. The thus-modified electrode is denoted as GCE/MWNTs/GOx-yeast/Nafion.

3.3 Bio-nano Electrode for Glucose Sensing 3.3.1 Calibration Curve of Glucose

1. Prepare glucose standard solution with concentrations ranging from 0 to 14 mM with 0.1 M PBS buffer from 1.000 M glucose stock solution (see Note 12). 2. Measure cyclic voltammograms (CVs) at scan rate of 50 mV/s in glucose solution under the ambient-N2 condition using a three-electrode system containing a GCE/MWNTs/GOxyeast/Nafion as the working electrode, a Pt wire as the auxiliary electrode, and a SCE as the reference electrode (Fig. 1a) (see Notes 13 and 14). 3. The cathodic peak currents (ipc) at about −0.5 V from the CVs are measured. Further, the cathodic peak current change (Δipc) varying glucose concentration is calculated (see Note 15). 4. Make standard curve for glucose by plotting Δipc as a function of glucose concentration (Fig. 1b).

3.3.2 Real Sample Measurements

1. Measure CVs at scan rate of 50 mV/s in a 0.1 M PBS buffer solution under the ambient-N2 condition. Carry out three repetitive measurements. 2. Measure CVs at scan rate of 50 mV/s in a 5.00 mL sample solution under the ambient-N2 condition. Carry out three repetitive measurements. Calculate Δipc,sample. 3. Spike 5 μL of 1.00 M glucose standard solution into the above 5.00 mL sample solution and stir well. Perform CV measurements again. Carry out three repetitive measurements. Calculate Δipc,sample+std.

Electrochemical Glucose Biosensor by Yeast Display

239

Fig. 1 (A) CVs of GCE/MWNTs/GOx-yeast/Nafion in PBS buffer (pH 7.4) containing different concentrations of glucose: 0.0 mM (curve a), 0.1 mM (curve b), 0.5 mM (curve c), 2.0 mM (curve d), 8.0 mM (curve e), and 12.0 mM (curve f). Scan rate, 50 mV/s. (B) Typical calibration graph of the glucose biosensor. (Reprinted with permission from H. Wang et al., Anal Chem 2013, 85, 6107–6112. Copyright©2014 American Chemical Society)

4. The glucose levels (C, mM) in the sample solution can be calculated as below:

(

C ( mM ) = 5 ´ Di pc, sample / Di pc, sample + std - Di pc, sample

)

It may be necessary to dilute the sample solution with PBS buffer before measurement (see Note 16).

240

4

Hongwei Wang et al.

Notes 1. If possible, pipette out the residual medium attaching the tubes. The residual glucose may affect the expression induction of recombinant protein, as the Gal1 promoter is preferable to be regulated by glucose rather than galactose. 2. This is to ensure that the cells continue to grow in log-phase. 3. In our case, we found the 30–36 h often provided the optimal time point for maximum display with 0.15 U/OD (Fig. 2b). 4. The washing step will get rid of the residual protease in cell culture. It may be not necessary to bring the cell stock to an exact concentration, which could be determined in the further dilution steps. Generally, this cell stock could be stored 4 °C for less than 1 month without apparently affecting the enzyme activity or resulting in enzyme leakage. 5. The GOx activity assay is generally sufficient. For further verification, proceed to staining of displayed proteins using an appropriate anti-tag antibody as described in the manual of pYD1 Yeast Display Vector Kit (Fig. 2a). 6. Usually, the GOx from A. niger generally exhibited good activity below 50 °C. In our case, the immobilization on cell wall would improve thermostability of GOx. Specifically, the displayed enzyme retained over 84.2 % of its activity at 56 °C, while 41 % enzyme activity maintained at 60 °C for 60 min. Besides, the intensive glycosylation of expressed protein by S. cerevisiae also affects enzyme thermostability. 7. Most of GOx from A. niger is stable within pH 4–8. In our case, approximately 53 % of enzyme activity was lost when the pH was