YAC Protocols [1st ed.] 9780896033139, 0896033139

Citation preview

CHAPTER 1

Generation of Large Insert YAC Libraries Zoia

Larin, Anthony P. Monaco, and Hans Lehrach

1. Introduction The introduction of yeast artificial chromosomes (YACs) as cloning vectors in 1987 has significantly advanced the analysis of complex genomes (I). The capability of cloning large DNA (1004000 kb) as YACs has accelerated the construction of physical maps and contig building (a contiguous set of overlapping clones). YAC contigs now cover entire human chromosomes (i.e., Y and 21) (2,3) and small genomes (i.e., Schizosaccharomyces pombe) (4), and large YAC contigs cover much of the human genome (5). The main advantages of YACs over prokaryotic-based cloning systems are their large insert capacity and ability to maintain sequences that are unstable or not well represented in bacteriophage or cosmid genomic libraries (6). Therefore, YACs complement existing cloning vectors (cosmids, bacteriophage) and new cloning vectors (Pl bacteriophage [Pl], bacterial artificial chromosomes [BACs], and Pl-derived artificial chromosomes [PACs]; for review, see ref. 7) in mapping and chromosome walking projects (6,8). Several laboratories have generated YAC libraries from different eukaryotic genomes including arabidopsis (9), S. pombe (4), mouse (IO, II), and human DNA (10,12,13). Libraries usually have been constructed in the Saccharomyces cerevisiae strain AB 1380, but other strains are available with additional genetic markers that may be useful for selection of products following homologous recombination of YACs From Methods II) Molecular B/o/ogy, Vol. 54 YAC Protocols Edlted by D Markle Humana Press Inc , Totowa, NJ

1

2

Larin, Monaco, and Lehrach

(14). In addition, recombination deficient yeast strains (radl or r&52) have also been used to reduce the problem of chrmerism owing to recombination in YACs (15), and these strains stabilize some sequencescloned in YACs (16). Analysis of YACs maintained in rud52 and radl yeast strains compared to standard strains indicate that the frequency of chimerism is lower (27). Different YAC vectors with centric and acentric arms have been constructed that allow rescue of end fragments in yeast for chromosome walking projects, and a bacteriophage T7 promoter for generation of riboprobes from the rescued end fragments (14). Other YAC vectors incorporate a conditional centromere that allows for amplification of YAC DNA under appropriate conditions (18). YAC libraries have been constructed by preparing and size fractionatmg high molecular weight DNA in solution using sucrose gradients (1,12), or in agarose by pulsed field gel electrophoresis (PFGE; IO, 13,I9). When DNA is prepared in agarose, YAC insert sizes are larger on average because shear forces seen with DNA in solution are minimized. However, partial degradation of DNA occurs when melting agarose containing high molecular weight DNA, perhaps due to metal ion contamination or denaturation (10). The presence of polyamines (10) or high concentrations of NaCl (100 mM) (20), protects DNA in agarose from degradation at the melting step. The authors constructed mouse, human, and S. pombe YAC hbrarres with average insert sizes of 700, 620, and 500 kb, respectively, by incorporating polyamines in the cloning procedure (10). This chapter describes in detail the protocols the authors used to construct large insert YAC libraries. This includes preparation of pYAC4 vector partial digestion of genomic DNA in agarose blocks, size fractionation by PFGE both before and after ligation to vector, and transformation of the yeast host AB 1380. 2. Materials 1.

Preparationof vector: All library construction protocols in this chapter are basedon the pYAC4 vector (I), avarlablefrom the American Type Culture Collection.

Vector DNA is prepared by large scale plasmid

extractions and

purification by CsCl gradientcentrifugation (22). 2. Restriction

enzyme digest buffers: For most restriction

digests, buffers rec-

ommendedby the manufacturerare adequate.The authorsrecommendT4

Large Insert YAC Libraries

3

polymerase buffer (21) when digesting vector DNA because it works with almost all restriction enzymesand calf intestinal alkaline phosphatase (CIP; Boehringer, Mannheim, Germany, 1 U/pL), thus eliminating precipitation of DNA and buffer changes between enzyme reactions. 1OX T4 polymerase buffer: 0.33M Tris-acetate, pH 7.9,0.66M potassium acetate, 0.1 OMmagnesium acetate, 0.005M dithiothrettol (DTT), 1 mg/mL bovine serum albumin (BSA). Store frozen at -20°C m small abquots. 3. Preparation and lysis of cells in agarose blocks: High molecular weight DNA from fibroblast or lymphoblastoid cell lines, whole blood, or fresh mouse spleen tissue IS prepared in low melting point agarose blocks (‘221, with 2-5 x lo6 cells/block (approx 1.5-40 pg DNA). 4. EcoRI partial digestion reaction buffer: 1 agarose block with DNA 80100 uL, 50 pL (5 mg/mL) BSA, 50 pL 10X EcoRI methylase buffer, 13 pL (O.lM) spermidine, 1 U EcoRI, 50-200 U EcoRI methylase (NEB), distilled water to 500 pL final volume. 5. 10X EcoRI methlyase buffer: 800 pM S-adenosyl-methionine (SAM, NEB), 0.02M MgCl,, 1.OM NaCl, OSM Tris-HCl, pH 7.5, O.OlM DTT. Store frozen at -20°C in small aliquots. 6. 100X Polyamines: 0.075M spermidine-(HCl),, 0.03OM spermine-(HC1)4 Store frozen at -20°C m small aliquots. 7. 10X Ligase buffer: 0.5M Tris-HCl, pH 7.5, O.lM MgC12, 0.03M NaCI, 1OX polyamines. 8. YPD medium: see Chapter 29. 9. Regeneration plates (23): 1.OM sorbitol (Sigma, St. Louis, MO), 2% dextrose, 0.67% yeast nitrogen base without amino acids (Difco, Detroit, MI; add as filter sterile after autoclaving of agar), 1X ammo acid supplements (without uracil), 2% agar. 10. 1OX Amino acid supplements (23) : 200 pg/mL adenme, 200 pg/mL arginine, 200 ug/mL isoleucine, 200 pg/mL histidine, 600 pg/mL leucine, 200 pg/mL lysine, 200 pg/mL methionine, 500 pg/mL phenylalanine, 200 yg/mL tryptophan (light sensitive, filter sterilize and store at 4OC), 1.5 mg/mL valine, 300 pg/mL tyrosine, 200 yglmL uracil (omit in regeneration and selective plates). 11. SCE: I.OM sorbitol, O.lMsodmm citrate, pH 5.8, O.OlMEDTA, pH 7.5, 0.03M 2-mercaptoethanol or O.OlM DTT (add fresh). 12. STC: 1.OM sorbnol, O.OlM Tris-HCl, pH 7.5, O.OlM CaCl,. 13. PEG: 20% Polyethylene glycol6000 (PEG, Serva, Heidelberg, Germany), O.OlMTris-HCl, pH 7.5, O.OlMCaCl,. Make fresh and filter sterilize. 14. SOS: 1.OM sorbitol, 25% YPD, O.O065MCaCl,, 10 ug/mL tryptophan, 1 pg/mL uracil. Make fresh and filter sterilize.

4

Larin, Monaco, and Lehrach

15. YAC selective media and plates: 2% dextrose, 0.67% yeast nitrogen base without amino acids (add filter sterile), 1X amino acid supplements (without uracil and tryptophan), 2% agar for plates. 16. Contour-clamped homogeneous electric field (CHEF) apparatus. The authors recommend the BioRad (Richmond, CA) system. 17. Small horizontal gel electrophoresis apparatus: Use to check restriction enzyme digests of vector and test ligations of vector and genomic DNA. 18. Electrophoresis buffer: For both CHEF and horizontal gels, the authors recommend TBE. 10X TBE: 0.89M Tris-borate, 0.89M boric acid, 0.016M EDTA. 19. Agarose: The authors recommend regular (SeaKern) and low melting point (LMP) (Seaplaque GTG) agarose from FMC. Most gels will be 1% (w/v) (aqueous). 20. Yeast and/or lambda concatamer size markers (BioRad). 21. Agarase (Sigma) dissolved in 50% (v/v) glycerol in water and store at 10 U/uL at -2OOC or P-agarase (NEB, Beverly, MA). 22. T4 DNA ligase (NEB) at 400,000 U/mL. 23. T4 polynucleotide kinase (NEB) at 10 U&L. 24. 1X TE: O.OlMTris-HCl, pH 7.5, O.OOlMEDTA, pH 7.5. 25. Proteinase K (Boehringer-Mannheim): Dissolve in water at 10 mg/mL and store in small aliquots at -2OOC. Alternatively, use pronase (BoehringerMannhelm). Add directly at 2 mg/mL. 26. Phenylmethylsulfonylflouride (PMSF, Sigma): Prepare at 40 mg/mL m ethanol or isopropanol and heat several minutes at 68°C to dissolve. Caution: Use gloves. It is toxic. 27. 0.5M EDTA, pH 8.0. 28. Lyticase (Sigma): Weigh out fresh prior to spheroplast formation (500 U/ 20 mL of yeast cells in SCE) and dissolve in SCE or water. Lyticase is difficult to get in solution and will need extensive vortexing. 29. 2-Mercaptoethanol (BDH, London, UK): Open m hood and use gloves, 30. For the yeast transformation, a spectrophotometer, a student microscope (lox, 25x, and 40x objectives and phase contrast), and a hemocytometer cell counter are needed. 3 1. Phenol equilibrated with O.lM Tris-HCl, pH 8.0. Caution: Wear gloves because phenol burns. 32. Chloroform. 33. 100% Ethanol. 34. Trinitriloacetic acid (BDH): Dissolve in water at O.lSMand store frozen in small aliquots at -20°C. Used to inactivate CIP.

Large Insert YAC Libraries

5

3. Methods 3.1. Preparation of pYAC

4 Vector 1. Before preparing pYAC4 arms for ligation to genomic DNA, test plasmid preps for deletions of telomere sequences during propagation in Escherichia coli. Digest 0.5 pg of the pYAC4 plasmid with Hind111 and check on a 1% agarose gel. Four bands should be visualized: a 3.5, 3.0, 1.9, and 1.4 kb doublet. 2. If there is an additional smaller fragment below the 1.4 kb doublet, then telomere sequenceshave been deleted from the plasmid and another preparation should be attempted. 3. For preparattve vector arms, digest 100-200 ug of pYAC4 with EcoRI and BamHI to completion m 500 pL 1X T4 polymerase buffer and check on a 1% agarose gel. Three bands should be visualized: 6.0, 3.7, and 1.7 kb. 4. Heat kill the EcoRI and BamHI at 68OCfor 10 min. 5. Add directly 0.03-0.06 U/ug vector of CIP and incubate at 37°C for 30 min. 6. Inactivate the CIP with trinitriloacetic acid to 0.015Mat 68OC for 15 min. 7. Extract twice with phenol, once with chloroform, and precipitate with ethanol. 8. Resuspend the vector arms at a concentration of 1 ug/uL in O.OlM TrisHCl, pH 7.5, and O.OOlMEDTA (1X TE). 9. Check the efficiency of dephosphorylation of vector ends and the ability of these ends to ligate after phosphorylation. Set up two 20-uL ligation reactions (2 pL 10X ligase buffer without polyamines, 0.5 ug of digested and CIP-treated pYAC4 vector, 1 U T4 DNA ligase), one with and one without 1 U of T4 polynucleotide kinase. 10. Check hgations on a I % agarose gel: a. Without kinase: 3 bands should be visualized as after digestton; and b. With kinase. The 1.7 kb BamHI fragment can ligate to itself and form several supercoiled forms below 1.7 kb. The upper arms (6.0 and 3.7 kb) should ligate together by their EcoRI and BarnHI sitesand form several larger fragments. 3.2. Partial Digestion of Genomic DNA 1. Partial digestion reactions: Prior to enzyme digestion, wash the blocks containing genomtc DNA in 1X TE with 40 pg/mL PMSF at 50°C to inactivate the proteinase K and twice in 1X TE to remove the PMSF. Blocks incubated in pronase instead of proteinase K need only be washed extensively in 1X TE. 2. Perform partial EcoRI digestions by incubating blocks with a combination of EcoRI and EcoRI methylase. To determine the best mixture of the two

6

Larin, Monaco, and Lehrach

3. 4. 5. 6. 7

enzymes, set up analytical reactions of 1 U of EcoRI with 0, 20, 40, 80, 160,320, and 640 U of EcoRI methylase. Place mdividual blocks in EcoRI partial digestion buffer (see Section 2., item 4) with the various combmations of EcoRI and EcoRI methylase and incubate on ice for 1 h. Transfer the reactions to 37°C for 4 h. Add EDTA and protemase K to 0.02M and 0.5 mg/mL, respectively, to terminate the reactions, and incubate at 37°C for 30 min. Check partial digests on a 1% agarose gel m a CHEF apparatus with yeast chromosomes as stzemarkers to see which combination of enzymes gives most DNA in the range of 200-2000 kb. Then digest many (6-l 2) blocks preparatively for the library construction usmg several of the best enzyme combmations (usually 1 U EcoRI and 50-200 U EcoRI methylase).

3.3. First Size Fractionation

by PFGE

1. Pool blocks containmg partially digested DNA in a 50-mL Falcon tube and wash once m 0.0 1M Tris-HCl, pH 7.5, and 0.05M EDTA. 2. Place blocks adjacent to each other in a trough m a 1% LMP agarose gel in 0.5X TBE, and preset for 1 h at 4°C. Place a genomic DNA block in the adjacent gel slot on either side of the trough and place yeast chromosome size markers in the outside gel slots. 3. Overlay the gel slots and trough wtth 1% LMP agarose. Subject the gel to electrophoresis at 160 V (4.7 V/cm), using a switch time of 30 s (which selects fragments 2400 kb) for 18 h at 15OCin a CHEF apparatus. 4. Remove the gel from the CHEF apparatus. Cut away only the outside lanes, including one lane each of partially digested genomic DNA and yeast chromosome size markers, and stain with ethidmm bromide (1 ug/mL) for 45 min. Keep the central portion of the preparative gel in 0.5X TBE plus 0.02M EDTA at 4°C. 5. Under UV light, notch the marker lanes at the edges of the limiting mobility (>400 kb) and take a photograph. Place adjacent to the central portion of the preparative gel, cut out the limiting mobility using the notches m the outside lanes as a guide, and place m a 50-mL Falcon tube. Stain all of the remaining preparative gel with ethidium bromide and take a photograph.

3.4. Ligation

to Vector

1. Equilibrate the gel slice (l-2 mL) containing the limiting mobility of size-selected DNA four times (30 min each) in 1X ligase buffer (see Section 2., item 7).

Large Insert YAC Libraries 2. Place the gel slice equilibrated m 1X ligase buffer in an Eppendorf tube (cl mL agarose/tube) and melt at 68°C for 10 min together with digested and CIP-treated pYAC4 vector (see Section 3.1.) m a ratio of 1: 1by weight of genomic DNA 3. Stir the vector and genomic DNA in molten agarose slowly with a pipet tip and mcubate at 37°C for l-2 h. 4. Add T4 DNA hgase to 4 U/uL, ATP, pH 7.5 and DTT to O.OOlMeach m 1X hgase buffer by slow stirring at 37°C. Incubate the reaction at 37°C for an additional 0.5-l h and then overnight at room temperature. For ligation efficiency controls, see Note 2. 5. Termmate the reaction by adding EDTA pH 8.0 to 0.02A4.

3.5. Second Size Fractionation

by PFGE

1. Melt the ligation reaction at 68°C for 10 mm and cool to 37°C. 2. Carefully pipet the molten agarose with a tip of bore diameter >4 mm mto a trough m a 1% LMP agarose gel m 0.5X TBE, and preset for 1 h at 4°C. Place some molten agarose ligation mix in the gel slots adjacent to the trough on each side and place yeast chromosome size markers in the outside gel slots. Overlay the gel slots and trough with 1% LMP agarose. 3. Subject the gel to electrophoresis in a CHEF apparatus using the same conditions as described in Section 3.3. for the first size fractionation. 4. Excise the limiting mobility as described m Section 3.3., step 5. If any degradation of DNA is seen at this step, see Note 1. 5. Equilibrate the gel slice (approx 2-3 mL), containing the limiting mobility from the second size fractionation, four times (30 min each) in 0.0 IMTrisHCI, pH 7.5,0.03M NaCl, O.OOlM EDTA, and 1X polyamines. 6. Score the equilibrated gel slice with a sterile scalpel and place lessthan 1mL of agarose into individual eppendorf tubes. Melt at 68°C for 10 min, cool to 37°C and add agarase(Sigma 15&200 U/mL of molten agarose or P-agarase 20 U/mL of molten agarose).Incubate at 37°C for 2-6 h prior to transformation.

3.6. Transformation Transformation is carried out as described (24) using lyticase (Sigma) to spheroplast yeast cells. The yeast strain S. cerevisiae AB1380 has largely been used (I), but libraries have been prepared in recombination deficient strains (1.5). 1. Streak a fresh YPD plate with the appropriate strain from a frozen glycerol stock. Grow at 30°C for 2-3 d. Inoculate a single colony into 10 mL of YPD. Let sit overnight at 30°C.

8

Larin, Monaco, and Lehrach

2. The next evening, inoculate 200 mL of YPD m a 1-L flask with 200 uL of the 10-mL overnight culture. Use a larger inoculum (1/lo0 or l/500) if it is a recombination deficient strain, because these cells tend to grow more slowly. Shake at 30°C overnight for 16-l 8 h. 3. When the ODboO,,,,,of a l/l 0 dilution of the ABl380 culture IS between 0 12 and 0.15, spht the culture mto 50-mL Falcon tubes. Check some of the culture under the mtcroscope for bacterial contamination. 4. Spm the tubes at 400-6OOg (3000 rpm on tabletop centrtfuge) for 510 mm at 20°C. Decant media and resuspend pellets m 20 mL of distilled, sterile water for each tube. 5. Spm 400-6OOg for 5-10 min at 20°C. Decant water and resuspend pellets m 20 mL of 1.OM sorbitol. 6. Spm 400-6OOg for 5-10 min at 20°C. Decant sorbrtol and resuspend pellets in 20 mL SCE. 7. Add 46 uL of 2-mercaptoethanol and take 300 j.tL from one tube for aprelyticase control. Add 500 U lyticase (Sigma), mix gently, and incubate at 3O’C. 8. At 5, 10, 15, and 20 min, test the extent of spheroplast formation of one tube by two independent methods: a. Using a spectrophotometer, measure OD6a0nmof a l/l0 dilution in distilled water. When the value is l/10 of the prelyticase value, spheroplast formation is 90% complete. b. Mix 10 yL of cells with 10 uL 2% SDS and check under the microscope using phase contrast. When cells are dark (“ghosts”) they are spheroplasted. 9. Take the spheroplastformation to 80-90%. This should take 1O-20 min. Then spin cells at 200-300g (1100 rpm on tabletop centrifuge) for 5 min at 20°C. 10. Decant SCE and resuspend pellets gently in 20 mL of l.OM sorbitol. Spm 200-300g for 5 min at 20°C. Decant sorbitol and resuspend pellets in 20 mL STC. 11. Take a cell count of one tube by making a l/l 0 to l/50 dilution in STC and count on a hemocytometer. 12. Spin cells at 200-300g for 5 min at 20°C and then resuspend m a volume of STC calculated for a final concentration of 4-O-6.0 x 10scells/ml when added to genomic DNA. 13. Add approx 0.5-l .Oug of DNA in digested agarose solution (50-75 uL) to 150 uL of spheroplasts in 15-mL conical polystyrene Falcon tubes. For transformation controls, use: a. No DNA; b. 10 ng supercoiled YCp50 (25); and c. 100 ng restricted and CIP-treated pYAC4. Let DNA and spheroplasts sit for 10 min at 20°C.

Large Insert YAC Libraries 14. Add 1.5 mL PEG and mix gently by Inverting tubes. Let sit for 10 mm at 20°C. Spin at 200-300g for 8 min at 20°C. 15. Carefully pipet off PEG solution and do not disturb pellets. Gently resuspend pellets in 225 pL of SOS. Place at 30°C for 30 mm. 16. Keep molten top regeneration agar at 48°C. If usmg small plates, add 5 mL of regeneration top agar (without uracil) to each 225 pL of SOS and cells. If you are using large (22 x 22 cm) plates, pool 10 tubes of 225 uL of SOS and cells to a 50-mL Falcon tube, and add 50 mL of regeneration top agar (without uracil). Mix gently by inverting the tube and pour quickly onto the surface of a prewarmed regeneration plate (without uracil) and let sit. Incubate plates upside down at 30°C for 34 d. 17. YAC analysis and replication of transformants. Good transformation efficiencies are between 2-8 x lo5 clones/ug YCp50 and 100-l 000 clones/pg genomic DNA. For low transformation efficiencies, see Note 3. Ptck YAC clones individually onto selective plates (without uracil and trypophan, see Section 2., item 14) to test for both vector arms. When usmg mmlmal adenine, visualize red color in YAC colonies containmg mserts Grow YAC clones in selective media and make agarose blocks contammg chromosomes to check the size of YAC clones by PFGE. To replicate clones for library screening, pick YAC clones individually into mtcrotiter dishes for screening of pools by polymerase chain reaction (PCR) amplification (26) or by colony hybridization after spotting onto filters using manual devices. A multipm transfer device, containmg 40,000 closely spaced pins, has been used to efficiently replicate YAC clones from the supportive agar matrix of regeneration plates to the surface of selective plates, for colony hybridization and picking into microtiter dishes (10).

4. Notes 1. Degradation of DNA: If anywhere m the cloning procedure you encounter complete or partial degradation of high molecular weight DNA, use yeast chromosomes in a series of control reactions to pinpoint the problem. Because yeast chromosomes can be visualized as distinct bands on PFGE, degradation can be detected much easier than in partial digests of genomic DNA. Test all buffers and enzymes (EcoRI methylase, T4 DNA hgase, proteinase K, agarase) for nuclease activity in mock cloning experiments using yeast chromosomes. Also, melt agarose blocks containing yeast chromosomes in buffers with and without 1X polyamines to test for partial degradation. 2. Ligation controls for vector and genomic DNA: Test the efficiency of hgation of vector arms to partially digested genomic DNA by incubating a small sample of the ligation reaction with and without 1 U T4 polynucle-

Larin, Monaco, and Lehrach

10

ottde kmase. Melt the samples and load them on a small 1% agarose gel to check for no change of vector arms without kmase and disappearance of vector arms to larger sized fragments when incubated with kmase. 3 Transformation efficiency: If your transformation efficiencies are routinely lower than expected, check the followmg: a. Always streak the yeast strain onto a fresh YPD plate before settmg up cultures. Cultures grown from old plates (>2 wk) seem to transform less well although they will appear to spheroplast normally. b. Try different concentrations of lyticase and percent spheroplast formation for optimum efficiency. c. Try various batches of sorbitol and PEG to see if there is any difference in transformatton efficiency. d. Always use distilled, deionized water to guard against heavy metal ion contammation that can degrade DNA or decrease transformation efficiency. e. Check the temperature of room. Transformation is best at 20-22°C and decreases dramatically at temperatures around 30°C. References 1 Burke, D T , Carle, G F , and Olson, M V. (1987) Cloning of large DNA segments of exogenous DNA mto yeast by means of artificial chromosome vectors Science 236,806-8 12. 2 Foote, S , Vollrath, D , Hilton, A., and Page, D. C (1992) The human Y chromosome overlappmg DNA clones spanning the euchromatic region Sczence 258,60-66 3 Chumakov, I , Rigault, P , Gmllou, S , Ougen, P , Billaut, A , Guascom, G , et al (1992) Continuum of overlappmg clones spanning the entire human chromosome 21q. Nature 359,38&387. 4. Maier, E., Howeisel, J , McCarthy, L., Mott, R , Grigortev, A. P., Monaco, A. P., Larm, Z., and Lehrach, H (1992) Complete coverage of the Schzzosaccharomyces pombe genome m yeast artificial chromosomes. Nature Genet 1,273-297. 5. Cohen, D., Chumakov, I., and Werssenbach, J. (1993) A first-generation physical map of the human genome. Nature 366,698-70 1, 6 Coulson, A., Waterston, R , Klff, J., Sulston, J , and Kohara, Y. (1988) Genome lmkmg with yeast artificial chromosomes Nature 335, 184-I 86 7. Monaco, A. P and Larm, Z. (1994) YACs, BACs, PACs and MACs artificial chromosomes as research tools Trends BzotechnoZ 12,280-286. 8. Garza, D , Ajioka, J W , Burke, D T., and Hart& D. L (1989) Mapping the Drosophtla genome with yeast artitictal chromosomes. Sczence 246,641&646. 9. Guzman, P. and Ecker, J (1988) Development of large DNA methods for plants, molecular clonmg of large segments of Arabtdopsts and carrot DNA mto yeast, Nuclezc Aczds Res 16, 11,091-l 1,105. 10 Larm, Z., Monaco, A P , and Lehrach, H. (1991) Yeast artificial chromosome libraries contammg large inserts from mouse and human DNA. Proc Natl Acad

Scz USA 88,4123-4127.

Large Insert YAC Libraries

11

11. Burke, D T , ROSSI,J M , Leung, J., Koos, D S , and Tilghman, S. M. (1991) A mouse genomtc library of yeast artttictal chromosome clones Mammal Genome 1,65. 12. Anand, R., Villasante, A , and Tyler-Smith, C (1989) Construction of yeast arttficial chromosome libraries wtth large inserts usmg fractronatton by pulsed-field gel electrophoresis. Nuclezc Acids Res. 17, 3425-3433. 13. Albertsen, H M , Abderrahim, H., Cann, H. C , Dausset, J , Le Pasher, D , and Cohen, D (1990) Construction and characterization of a yeast artifictal chromosome library containing seven haploid human genome equrvalents Proc Nat1 Acad Scl USA 87,5109-5113. 14 Reeves, R. H., Pavan, W. J , and Hieter, P (1992) Yeast artificial chromosome modificatron and manipulation, in Methods in Enzymology, vol. 2 16 (Wu, R , ed.), Humana, Totowa, NJ, pp. 584-603 15. Chartter, F. L., Keer, J T., Sutchffe, M. J., Henrtques, D A , Mileham, P , and Brown, S. D. M. (1992) Construction of a mouse yeast artificial chromosome library m a recombmant-deficient strain. Nature Genet 1, 132-136 16. Neil, D. L., Vtllasante, A., Fisher, R. B , Vetrie, D., Cox, B., and Tyler-Smtth, C (1990) Complete coverage of the Schizosaccharomyces pombe genome m yeast artificial chromosomes. Nuclezc Acids Res l&421428 17 Ling, L. L , Ma, N S -F , Smith, D. R., Miller, D D , and Molt-, D T (1993) Reduced occurrence of chtmeric YACs m recombinant deficient hosts. Nucleic Acids Res 21,6045,6046. 18. Smith, D. R., Smyth, A. P., and Motr, D T (1992) Copy number amplification of yeast arttfictal chromosomes, in Methods zn Enzymology, vol 216 (Wu, R , ed ), Humana, Totowa, NJ, pp 603-6 14. 19. McCormick, M. K., Shero, J H , Cheung, M. C., Kan, Y. W., Hteter, P A., and Antonarakis, S. E. (1989) Construction of human chromosome 2 1-specific yeast artificial chromosomes Proc Nat1 Acad Sci USA 86,9991-9995 20 Lee, J T , Murgia, A., Sosnoski, D M., Ohvos, I. M., and Nussbaum, R L (1992) Construction and characterisation of a yeast artrfictal chromosome library for Xpter-Xq27. 3: a systemattc determination of coclonmg rate and X-chromosome representation. Genomzcs 12, 526-533. 2 1. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) Molecular Clonzng A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Sprmg Harbor, NY. 22. Herrmann, B. G., Barlow, D. P., and Lehrach, H. (1987) An inverted duplication of more than 650 Kbp m mouse chromosome 17 medtates unequal but homologous recombination between chromosomes heterozygous for a large inversion. Cell 48,8 13-825. 23. Rothstein, R. (1985) Cloning in yeast, in DNA Clonzng Volume II (Glover, D. M., ed ), IRL Press, Oxford, UK, pp. 45-65. 24. Burgers, P. M. J. and Percival, K. J. (1987) Transformation of yeast spheroplasts without cell fusion. Anal Biochem 163,391-397. 25. Hieter, P , Mann, C., Snyder, M., and Davis, R W (1985) Mitottc stabihty of yeast chromosomes: a colony color assay that measures nondisjunction and chromosome loss. Cell 40,38 1-392 26. Green, E. D. and Olson, M. V. (1990) Systematic screening of yeast artificial chromosome ltbrarres by use of the polymerase cham reaction Proc Nat1 Acad Scl USA 87,1213-1217

CHAPTER2

YAC Library

Storage

and Transport

John E. Collins, Sheila Hassock, and Ian Dunham 1. Introduction The large size of mammalian genomes necessitates the use of cloning vectors that will accommodate genomic DNA inserts of at least several hundred kilobases. The development of the yeast artificial chromosome (YAC) cloning system (1) in the mid- 1980s and the construction of YAC libraries with large numbers of genome equivalents for both the human (2-5) and mouse genomes (5,6) provided a major impetus to mammalian genome mapping. These technical advances enabled the mapping of megabase-sized chromosomal regions (7,8), culminating in the first complete clone maps of single mammalian chromosomes (9,10). In 1994, it is fair to say that the success of any long range mapping and cloning project depends on access to YAC resources. In the human genome project, the distribution of YAC libraries to multiple laboratories and institutes has greatly facilitated progress by improving the availability of the libraries for screening. In our experience, direct access to YAC libraries is crucial for any ambitious mapping project, but dealing with large YAC resources has required the development of a series of appropriate tools and protocols. The authors describe a set of protocols to enable the easy manipulation of large numbers of YACs such as contained in a library made from the DNA of a complex genome. Traditionally, genomic DNA libraries in lambda or cosmid vectors, which may consist of more than a million recombinants, have been From Methods m Molecular Biology, Vol. 54 YAC Protocols Edited by D. Markle Humana Press Inc , Totowa, NJ

13

14

Collins, Hassock, and Dunham

screened by random replica plating and hybridization. The increase of insert size made possible by the YAC cloning system reduced the number of clones required to give high genome coverage, and this has allowed a change in approach so that single recombinant clones are stored separately in an ordered array. YAC libraries are stored with single YAC clones in separatewells of 96- (or 384-)well microtiter plate arrays at-70°C. Thus each YAC clone has a unique address within the library, consisting of the microtiter plate number and the well coordinate, A-H, on the vertical axis, and 1-12 on the horizontal axis. This address acts as a permanent reference for the YAC that can be stored in a database with associated information and commumcated along with the library. Clones from different libraries are distinguished by referring to the library from which they were derived. Hence, the authors could refer to YAC clone 639611 from the CEPH YAC library. It is essential that these reference numbers are used by all workers who use a widespread library so that data is kept compatible. YAC libraries may be received by one of the methods described in Section 3.5. Initially, the library will need to be replicated into three copies for storage. The first is an archive copy that should remain frozen. The second is a backup copy that is periodically duplicated to remake the third, working copy. The backup plates are also used to replace single working plates that may be lost through contamination or by being dropped. Libraries are replicated using a 96-pin tool (Fig. 1). Each microtiter plate is stamped onto YAC selective media and the colonies grown. An inoculum may then be taken from the agar plate into multiple microtiter plates filled with liquid media. Once a layer of cells has grown to cover the bottom of each well, the plate may be frozen in 15-20% glycerol. The authors store plates in sets of 16 in a purpose made aluminum racking system that IS convenient for our library screening protocols (II, see Chapters 3 and 4). Future manipulation of the library for replacement of plates or replication to send a copy elsewhere uses the same protocols. 2. Materials 1. 96-Pm tool (Fig. 1): This is made using 96-inoculation pins (Denley [Billmg Hurst, Surrey, UK] WR080/02), 2X 96 place heads (Denley WR080/01), a top plate (the authors make their own) all held together with eight spacers, four screws, and four nuts.

YAC Library

Storage

and Transport

Fig. 1.96-Pin hand held replicating tool (or hedgehog) (see Section 2., item 1). Note the two 96-place heads stabilize the pins to minimize horizontal movement and the spacers allow each pin 10 mm of vertical movement. Once sterilized, the tool can be held by the end pieces of the 96-place heads. 2. Wellfill 3 (Denley WF043) or multichannel pipetman for filling microtiter plates. 3. YPD medium: see Chapter 29. 4. AHC medium: see Chapter 29. 5. 80% Glycerol, autoclaved. 6. Flat-bottomed microtiter plates (Falcon 3072, Becton Dickinson, Lincoln Park, NJ). Round-bottomed plates are not recommended for YAC libraries as the cells will settle into a small area in the center and it may prove difficult to replicate from these plates. 7. Microtiter plate sealers (Dynatech [Chantilly, VA], cat. no. 00 1-O1O-5701). 8. IO-cm Rubber roller, available from all good art materials shops. 3. Methods

All the sterilization procedures and manipulations of YACs should be carried out in a class II microbiological safety cabinet in accordance with local regulations. This is also necessary to minimize contamination problems.

16

1. 2. 3. 4.

1.

2. 3. 4. 5. 6. 7. 8. 9.

Collins,

Hassock, and Dunham

3.1. Initial Sterilization of 96-Pin Tool Invert tool in flowhood (pins up). Spray wtth absolute ethanol from a wash bottle. Light a Bunsen burner and ignite ethanol covering the 96-pin tool. Ensure that the lit Bunsen IS kept well away from the ethanol bottle! Leave 96-pin tool to cool for at least 10 min. 3.2. Cyclic Sterilization Procedure When Using 96-Pin Tool Take 3-microtiter plate size dishes (use either a 1%cm diameter Petri dish or the sterile microtiter plate packaging). Fill one with water (not sterile), one with absolute ethanol, and the third sterile dish with YPD broth ensurmg that each tray 1s filled at least as deep as the depth of media m the microtiter plate. Take the sterile 96-pin tool (see Section 3.1.) and perform the desired YAC manipulation (see Sectton 3.3.). Rmse the end of the pins m the water to remove any agar or media and stamp them dry on a pad of dry &sues or towels. Place the pins into the absolute ethanol for a few seconds and then invert the tool m the flowhood. Ignite with the ethanol on the tool with the Bunsen flame, briefly wavmg the flame over each pm head (take care that the dish of ethanol is at the other end of the flowhood). Try not to make the tool hot by excessive flaming. Cool the pin heads by placing in the sterile YPD. (It IS posstble to avotd this step if you have two 96-pm tools and use them m rotatton allowing them to cool in the air flow after step 5.) Shake the tool to remove excess YPD. Perform the next YAC manipulation and repeat steps 3-6 after every YAC manipulation. At the end of each session, sonicate the tool in water in a sonicating water bath for 10 min to remove colony debris.

3.3. YAC Manipulation 3.3.1. Transfer of YACs from YPD Broth to Agar-Filled Microtiter Plate or Agar Plate 1, Place the 96 pins of the sterilized tool into athawed microtiter plate of YACs. 2. Gently scrape the tool on the bottom of the plate avoidmg splashes between wells. 3. Transfer the tool to an AHC agar dish and “stamp” the YACs onto the plate surface checking that all the pms are touching the agar. Do not allow

YAC Library

4. 5. 6. 7.

Storage and Transport

17

the full weight of the tool to rest on the agar as it will sink mto the plate, especially if it is still sightly warm. Place the AHC dish at the back of the hood for 5 min until the liquid has dried. Sterilize tool (see Section 3.2.). Incubate agar plate at 30°C for 2 d. If growth is patchy or nonexistent, see Notes 1 and 2; if contamination is a problem see Notes 3-7. Repeat manipulation as necessary.

3.3.2. Transfer of YACs from AHC Agar to Single or Multiple Copies of YPD Broth Microtiter Plates 1. Check each AHC agar plate for contaminants such as fungal growth or bacteria. At this stage contaminants may be cut out from the agar with a sterile scalpel, leaving an empty space in the library. The YAC can be added back to the library when it has been recovered usually by streaking separately on selective media (AHC). 2. Fill the required number of microtiter plates with 150 pL YPD broth per well using either a multichannel pipetman or an automatic well filler. 3. Place the 96 pins of the sterile tool over the colonies on the AHC agar dish, checking that all the pins are touching the colonies. 4. Transfer the tool to a prefilled YPD broth microtiter plate. Mix the tool in the broth to remove the cells. 5. If required, return the tool to the same AHC plate to collect more YAC colony and inoculate further copies of the plate as necessary. 6. Sterilize tool (see Section 3.2.). 7. Repeat manipulation as necessary. 8. Incubate microtiter plates at 30°C for 2 d.

3.4. Freezing

YACs in Microtiter

Plates

1. Look at the microtiter plate from beneath to check that the YACs have grown to cover the bottom of the microtiter plate. Occasionally, the YACs grow in clumps that will need to be dispersed using the sterile 96-pin tool before freezing. 2. Mix equal volumes of 80% glycerol and YPD broth to make 0.5X YPD broth containing 40% glycerol. This dilution makes the glycerol less viscous and easier to manipulate. 3. Add 100 uL of this 40% glycerol mix to each well to give an approximate final glycerol concentration of between 15 and 20% depending on how much of the original YPD broth has evaporated during incubation. It is as

18

Collins,

Hassock, and Dunham

well to check how much volume is lost through evaporation under your own condrttons. If a Wellfill is used, the delivery switch needs to be set at approx 150 uL, which wtll then add 100 uL to each well because of the vtscosity of the glycerol. The amount of glycerol delivered can be measured using an empty microtiter plate and a pipetman before proceeding to add the glycerol to the library plates. 4. Usmg the sterile tool, gently mix the glycerol with the YACs (see step 1 in Section 3.3.1.). This also disperses any clumps of YACs to form an even coverage of the well bottom. 5. Archive plates should be sealed with plate sealers 6. Freeze the microtiter trays at -70°C stacked and wrapped in suitable plastic bags to prevent frost. It is prudent to test that the type of bag you are using will survive freezing at -70°C beforehand. 3.5. Transport of YAC Libraries YAC libraries can be transported in a number of ways. The best method to suit the exporter and importer may be selected from the following: 1. Each microtiter plate is stamped onto a 15-cm selective media plate. This is the stmplest method as the exporter only needs to stamp the YACs from their backup stocks, and the importer has a plate ready to make microtiter plate copies. However, the plates are fragile and bulky, usually requiring careful transport by car. 2. Each microttter plate IS stamped into another microttter plate filled with 150 uL of YPD agar media. This is the most convenient method for international transport. It is compact and less susceptible to damage during rough handling. However, as the YACs do not tend to grow evenly m such a plate, it is difficult to use this plate for further copies. Thus the importer should recover the YACs m a YPD broth mtcrotiter plate and then make a further selective agar plate that IS used to expand the library. 3. YACs may be transported frozen in their microtiter plates. The obvious problem is keeping the large number of plates frozen. The authors have transported several YAC libraries m large expanded polystyrene boxes filled with dry ice. The importer has the advantage of being able to use the YACs immediately, for example for griddmg (see Chapter 3), although further copies may need to be produced. 4. Notes I, If the YACs do not grow, check that the media was made correctly with all the appropriate nutrients (e.g., glucose and adenine). Test a batch of media prior to starting on replication of a library.

YAC Library

Storage and Transport

19

2. If the YACs give a patchy growth pattern there are a number of possibihties: a. The tool is not cooled enough after sterilization. b. The pins are not touching either the agar or the bottom of the microtiter plate. It is possible that the pin heads are sticking to the back plate. This can be solved by cleamng the tool by sonication m water in a deeply filled water bath for 10 min. Tap the tool sharply before taking the colony lifts and visually check that all the pms are level. c. The AHC agar plates are poured too thin. A 15cm diameter Petri dish needs at least 50 mL of agar. d. The tool was not scraped enough on the bottom of the microtiter plate (see Section 3.3.1.). 3. In general, YACs are grown at each stage for 1 or 2 d. This is to minimize the chance of yeast and bacterial contamination competmg with the YAC colony. Where fast growing yeast contaminants have been a problem, the authors have added extra ademne to the media, allowing the YACs to grow more rapidly. It is worth noting that the further away from the original YAC library a plate has become, the more likely it is that contamination has occurred with other YACs or another organism. It is therefore important when duplicating and, especially, exporting libraries to try to use the closest possible copy to the original library without unnecessarily dtsturbing the archive plates. 4. Bacterial contamination may be controlled by adding 50 pg/mL ampicillin, 5 ug/mL tetracycline, or 30 pg/mL kanamycin, or a combination of these to the AHC agar before pouring the plates. 5. Spread of fast growing yeast contaminants may be limited by adding 100 ug/mL adenine to both broth and agar allowing the YACs to grow more quickly. YACs will grow sufficiently in high adenine media overnight, but will not turn red. However, the best policy is to remove the contaminants completely. This may be achieved by streaking the contents of the well onto AHC plates and after 2 d growth retrieving the red YAC from the contaminant. Unless there is obvious contamination at this point, the plate can be left for another few days at 4°C to allow the red color of the YACs to show fully. The recovered YAC can then be grown up in a microtiter plate and added back to the main library m the correct well. Contammated wells are cleaned by removing the contents and soaking in 95% ethanol for 10 mm. In some cases, two rounds of streaking may be necessary. 6. Most of the wtdely available YAC libraries do not necessarily contam a single YAC clone in each well, partly because the density of the YACs m the agar origmal transformation plates from which the YACs were picked

20

Collins, Hassock, and Dunham was high enough that a picking of a single transformant could not be guaranteed, and partly because mampulation of the mlcrotiter plates mvarlably leads to some cross contamination between wells. The amount of work required to streak out each clone to a single colony IS so great that this has not generally been done. Although this fact confounds screening strategies that rely on single well locations for each YAC, it does mean that the archive copies of the YAC libraries have been grown very little and so any YAC that is prone to deletion has had less chance to delete. However, contamination of YACs between the wells of microtlter plates IS a con-

tinual problem. The only way to obtain a pure clone from a microtiter plate well 1s to streak it onto an AHC agar plate and test the single colonies for STS or probe content (see Chapter 4). 7. Fungal contamination of agar plates may be removed by cutting out the affected area with a sterile scalpel. YAC colonies lost this way will need to

be recovered and added back to the library.

References 1. Burke, D. T., Carel, G. F., and Olson, M. V. (1987) Clonmg of large segments of exogenous DNA into yeast by means of artiticlal chromosome vectors. Science 236,806-812. 2. Brownstein, B. H., Silverman, G. A., Little, R. D., Burke, D. T , Korsmeyer, S J., Schlessinger, D., and Olson, M. V. (1989) Isolation of single-copy human genes from a library of yeast artificial chromosome clones. Science 244, 1348-l 35 1. 3. Anand, R. A., Riley, J. H., Butler, R., Smith, J. C., and Markham, A. F. (1990) A 3.5 genome equivalent multiaccess YAC library, construction, characterisation, screening and storage. Nucleic Aczds Res. 18, 195 l-l 956. 4. Albertsen, H. M., Abderrahlm, H., Cann, H. M., Dausset, J., Le Paslier, D., and Cohen, D. (1990) Construction and characterisation of a yeast artificial chromosome library containing seven haploid human genome equivalents, Proc. Natl Acad. Scl USA 87,4256-4260. 5. Larin, Z., Monaco, A. P., and Lehrach, M. (1991) Yeast artificial chromosome libraries containing large inserts from mouse and human DNA. Proc Natl Acad. Sci USA 88,41234127. 6. Chartier, F. L., Keer, J T., Sutcliffe, M. J., Hennques, D. A., Mileham, P , and Brown, S. D. M. (1992) Construction of a mouse yeast artificial chromosome library in a recombmatlon-deficient strain of yeast. Nature Genet 1, 132-136 7. Green, E. D. and Olson, M. V. (1990) Chromosomal region of the cystic fibrosis gene m yeast artificial chromosomes: a model for human genome mapping Scrence 250,94-98 8. Vetrie, D., Vorechovsky, I., Sideras, P., Holland, J., Davies, A., Flinter, F., et al. (1993) The gene involved in X-linked agammaglobulinaemia 1s a member of the src family of protein-tyrosme kinases. Nature 361,226-233.

YAC Library

Storage and Transport

21

9. Chumakov, I., Riault, P., Guillou, S., Ougen, P., Billaut, A., Guasconi, G , et al. (1992) Contmuum of overlapping clones spanning the entire human chromosome 21q. Nature (Lond.) 359,380-387. 10. Foote, S., Vollrath, D., Hilton, A., and Page, D. C. (1992) The human Y chromosome. overlappmg DNA clones spanning the euchromatic regions Sczence 258, 60-66. Il. Bently, D. R., Todd, C., Collins, J., Holland, J., Dunham, I., Hassock, S., et al. ( 1992) The development and application of automated griddmg for efficient screening of yeast and bacterial ordered libraries. Genomzcs 12,534-641.

CHAPTER3

YAC Library Preparation

Screening

of Hybridization

Charlotte

I

Filters and PCR Pools

G. Cole, John E. Collins, and Ian Dunham 1. Introduction

The storage of yeast artrficial chromosome (YAC) libraries in ordered microtiter plates required a new approach to screening for clones containing specific DNA sequences. Screening libraries of some 60,000 clones by hybridization to filters prepared from individual 96-well microtiter plates was not a feasible option, prompting development of the polymerase chain reaction (PCR)-based screening approach of Green and Olson (I). Here (and in all subsequently developed PCR-based strategies), YAC libraries are screened by performing the PCR on a series of pools of DNA derived from specific mixtures of yeast clones. Amplification of target DNA sequencefrom an individual pool indicates the presence of the required YAC within the parent microtiter plates. Further rounds of testing on subsidiary pools are used to reveal the exact location of the YAC. Thus, a library of approx 36,000 clones may be prepared as 24 individual pools of 1536 YACs each for the first round of the PCR, each pool containing yeast DNA from 16 microtiter plates. Screening by the PCR therefore requires the preparation of pools of total yeast DNA derived from several thousand different YAC clones in equal amounts (2-4). Pools contaimng fewer YACs may also be required for subsequent stages of PCR screening.

From Methods m Molecular Biology, Vol 54 YAC Protocols Edlted by D Markle Humana Press Inc , Totowa, NJ

23

24

Cole, Collins,

and Dunham

Although screening by the PCR has proved successful even for large projects ($5) it is also desirable to have the option of screeningwhole libraries by hybridization, thus circumventing the need to develop large numbers of suitable primer pairs (sequenced tagged sites [STSs]). Efficient screening of YAC clones by hybridization requires, first, that the DNA derived from many different individual clones is present at high densities on hybridization filters and, second, that these filters can be prepared rapidly and precisely. This has been achieved through the use of robots that automatically grid clones from microtiter plates onto hybridization filters in high density ordered arrays of clones (2,6-+). Thus, the system used in the authors’ laboratory grids 1536 YACs onto a single 8 x 12 cm filter (2,8; see Fig. 1 in Chapter 4). To enable subsequent identification of individual colomes following autoradiography, it is essential to preserve the ordered array precisely. Hence, the clones are gridded and grown on a nylon filter, the resulting colonies spheroplasted and lysed in situ, and the DNA denatured and fixed to the filter. Described herein are methods for the preparation of PCR pools from yeast DNA isolated in agarose plugs (see Note 1) and of filters for hybridization. The pools described are based on a relatively simple pooling system (see Fig. 2 in Chapter 4) and preparation of pools based on l/2 filters or rows and columns are not described. However, the method is applicable to any array of YACs grown on nylon filters. For the preparation of high-density Iilters for hybridization, the authors strongly advise the use of an automatic gridding system. The method given assumes access to a customized robot of the type described by Bentley et al. (2) or McKeown et al. (8; G. McKeown and A. Watson [Sanger Centre, Cambridge, UK], personal communication). However, nylon filters gridded in different arrays may be treated identically (see Note 2). Filters generated from YACs spotted onto filters manually using individual “pins” or a hand-held 96-pin replicating “hedgehog” (Chapter 2) may also be grown and treated in much the same way, with a few caveats, as detailed in Section 3. (see also Note 3). 2. Materials 2.1. Hybridization Filters 1. Sterile 80 x 120 mm nylon filters (Hybond N, Amersham, Arlington Heights, IL; available precut to size cat. no. RPN 119N) (seeNote 2).

YAC Library

Screening I

25

2. Sterile rectangular 8 cm x 12 cm Petri dishes with hds (Hybaid “colony picker plates with lids,” available from Hybaid [Teddington, Middlesex, UK] on request). For gridding of yeast colonies, these dishes are poured to uniform thickness (50 ml/dish) with YPD agar (see Chapter 29) contaming 50 pg/mL ampictllm, 5 pg/mL tetracycline (see Note 4). Plates can be reused by scraping out the media with a spatula and washing with detergent followed by sterilization with 70% tsopropanol and drying m a laminar flowhood. 3. Plastic trays with lids (30 x 40 x 2 cm trays from Jencons [Leighton Buzzard, Bedfordshire, UK], cat.no. 682-008; 390 x 290 mm lid from Marathon [London, UK], cat. no. TT2171132). 4. Yeast spheroplastmg solutron: 1M sorbrtol, 20 mM EDTA, 10 mM TrisHCl, pH 7.4, containing freshly added 0.1 mg/mL zymolyase 20T (ICN, High Wycombe, UK) and 14 mM P-mercaptoethanol (see Notes 5 and 6). 5. Denaturation solution: 0.5M NaOH, 1.5M NaCl. 6. Neutralization solution: 0.5M Tris-HCl, pH 7.4, 1.5MNaCl. 7. Protease solution: l/l0 dilution of neutralization solution containing 250 pg/mL protemase K. Sigma (St. Louts, MO) XI-S Protease 1sof suffictent quality. Store aliquots of stock proteinase K at 25 mg/mL, -20°C and make protease solution up freshly each time. 8. 50 mM Trrs-HCl, pH 7.4. 1. 2. 3. 4. 5. 6. 7. 8. 9.

2.2. PCR Pools Sterrle 80 x 120 mm nylon filters Hybond N, Amersham; avatlable precut to size, cat. no. RPN. 119N). See Section 2.1.) item 2 for high-density pools generated using robot Petri dishes, and for single plate pools, see Section 2.1.) item 2, or sterile 15-cm circular Petri dishes poured as noted wtth or without tetracycline. 50 mM EDTA, pH 8.0. Basic yeast spheroplastmg solutron: 1M sorbitol, 20 mM EDTA, 10 mM Tris-HCl, pH 7 4. Yeast spheroplasting solution containing 0.1 mg/mL zymolyase 1OOT (ICN), 14 mM P-mercaptoethanol, Low-gelling temperature (LGT) agarose (SeaPlaque agarose, FMC, Rockland, ME). 1 mL Disposable (flexible) plastic bulb style pipets, tube diameter approx 2-3 mm. Filter stertlized or autoclaved yeast lysis solution (YLS): 1% lithium dodecyl sulfate, 100 mM EDTA, 10 mA4 Tris-HCl, pH 8.0 (see Note 7). T,,tE: 10 mMTris-HCl, pH 8, 0.1 mA4EDTA.

Cole, Collins, and Dunham

26

3. Methods

I. 2.

3.

4.

3.1. Preparation of Nylon Filters for Hybridization 3.1.1. Growth of YACs on Nylon Filters Thaw working stocks of YACs stored m 15-20% glycerol (see Note 8). Label the nylon filters m the top left-hand comer corresponding to position Al of a microtiter plate with a suitable pen (e.g., Edding 1800) and lay onto the YPD agar plates (see Note 4). Carefully lift the filter and re-lay to remove air bubbles rf necessary Grid the YACs robottcally onto the filters following the manufacturers instructions (see also, ref. 2). Alternatively, stamp the YACs manually onto filters using the 96-pin “hedgehog” as described m Chapter 2, or spot the YACs onto filters using 0.6-2 mm pins (available from Cambridge Repetition Engineers, Cambridge, UK). Grow YACs for approx 27 h at 30°C (or until even growth is observed) (see Note 3).

3.1.2. Spheroplasting

and Lysis of YACs on Filters

1. Soak single layers of 3MM Whatman (Mardstone, UK) paper in spheroplastmg solutton, using approx 50 mL/780 cm2 of Whatman paper (26 x 35 cm sheets tf using the recommended trays). Pour off excess liquid (approx 5-10 mL) until the paper still “shines” but no pools of liquid remain. Avoid evaporation from Whatman paper prior to step 2 2 Remove the nylon filters from the agar plates taking care not to carry over lumps of agar and carefully lay the filters colony side up onto the freshly soaked Whatman paper. Check carefully to ensure no air bubbles are trapped under the filter (see Note 9). Place a lid over the tray, seal m a plasttc/autoclave bag, and incubate overnight at 37°C. 3. Remove filters from the spheroplasting tray and lay colony side up onto a fresh sheet of 3MM Whatman soaked in denaturation solution. Ensure no air bubbles are trapped under the Whatman paper or the filter. Leave at room temperature for at least 10 mm but no more than 20 mm. Check constantly for air bubbles. These are observed by the appearance of colonies that fall to lose their red color and may be alleviated by carefully lifting and relaying the filter. 4. Dry the filters for 10 min by laying colony side up onto a fresh piece of 3MM Whatman paper. 5. Carefully submerge each filter colony side up in neutralization solution. Use excess liquid (500 mL m a medium-sized sandwich box). Leave for approx 5 mm.

YAC Library

Screening

27

I

6. Carefully pour off the solution and replace with a l/l0 dilution of neutralization solution for 5 min at room temperature. 7. Incubate the filters colony side up in a sealed box containing protease solution at 37OC for 30-60 min. One hundred milliliters are sufficient for up to 40 filters in a suitable sized (small) sandwich box, but ensure that all filters are covered. 8. Wash the filters by submerging in an excessof l/l0 dilution of neutralization for 5 min, with very gentle shaking. Do not wipe the filters. 9. Wash the filters twice m an excess of 50 mMTris-HCl, pH 7.4 with very gentle shaking. 10. Following the final rinse, use a pair of tweezers to drag the back of the filter along the edge of the sandwich box to remove excess liquid and any debris stuck on the back of the filter. Lay flat on a fresh piece of 3MM Whatman paper. 11. An dry for at least 15 mm. When nearly dry, place another sheet of 3MM Whatman on top to prevent the filters from rolling up (see Note 10). 12. Place fully dried filters flat, colony side down, onto a UV transilluminator and irradiate for 2 min at 312 nm (see Notes 1l-13).

3.2. Preparation 1.

2.

1. 2. 3. 4. 5.

of Pools of YAC DNA for PCR

3.2.1. Growth of YACs Grid or stamp the YACs onto nylon filters as described in Section 3.1.1. For pools prepared from YACs gridded at high density, prepare two identical filters for each pool. The authors prepare high-density pools from 16 microtiter plates gridded in a 4 x 4 array (see Fig. 1 in Chapter 4). For pools prepared from single microtiter plates, stamp each plate onto a single filter using a 96-pin “hedgehog,” as described in Chapter 2. Grow the YACs for two nights at 3OOC. 3.2.2. Spheroplasting and Lysis of YACs in Agarose Plugs Lift the filters from the agarplatesusing tweezers,taking care not to remove any agar with the filter. Roll up loosely, colony side inward, and place in a 50-mL Falcon (Becton Dickinson) centrifuge tube containing 25 mL 50 rnA4EDTA. Screw the cap tightly and shake to wash off all the colonies. Remove the washed filter and discard. Pellet the yeast cells by spinning at 3000g for 5 min. Discard the supernatant and wash the pellet once more with 25 mL 50 mM EDTA, pelleting as in step 3. Determine the wet weight of cells (take an average of each pellet assuming approximately even growth and weight of cells) (see Note 14).

28

Cole, Collins, and Dunham

6. Prepare 2% molten LGT agarose in basic yeast spheroplasting solution, cool, and mamtam at 45°C. You will need approx 2 mLNAC filter. 7. Resuspend the cells in 2 vol of prewarmed (37OC) spheroplastmg solutton containing 0.1 mg/mL 1OOTzymolyase and 14 mM P-mercaptoethanol (e.g., 2 mL/g of cells). Maintain at 37°C. 8. Add 2 mL of molten LGT agarose per gram of cells to the cell suspension, mix well, and draw up the slurry mto the barrel of one or more dtsposable 1-mL plastic pipets (do not suck agarose into the bulb). Stand the pipet upright m the Falcon tube until set (place at 4°C if necessary for speed). 9. Once set,cut the tapered part of pipet away and extrude the agarose “worm” into a new 50-mL Falcon tube. 10. Cover with approx 10 mL of spheroplasting solution containing 0.1 mg/ mL zymolyase lOOT, 14 mM P-mercaptoethanol. Incubate overnight at 37°C with gentle shaking. 11. Replace the solution with 1O-l 5 mL of YLS (see Note 7). Incubate at 37°C for 30-60 min. 12, Replace with fresh YLS and incubate at 37°C overnight with gentle shaking. 13. Continue replacing with fresh YLS until there is no color left in the agarose (normally once or twice more). 14. The agarose “worms” can now be stored at room temperature m YLS or 0.5M EDTA (see Note 15). 3.2.3. Rinsing and Dilution of Agarose Plugs 1. Cut off up to 2.5 cm of agarose “worm” and place in a clean 50-mL Falcon tube. 2. Add 25 mL T,, 1E and incubate 50°C for 30 min. 3. Pour off To ,E, and repeat step 2 twice more. 4. Pour off To ,E and add 25 mL fresh T, lE. Wash at room temperature for 30 min with gentle shaking 5. Pour off To ,E and repeat step 4 twice more. 6. Place the agarose “worm” m a 1.5-mL Eppendorf tube and remove any liquid carried over. 7. Melt the agarose fully at 65°C for approx 15 mm. 8, Prewarm 700 yL To rE in a 1.5-mL Eppendorf tube to 65’C. Add 100 pL of the molten agarose, vortex briefly to mix, and incubate for an additional 5-10 min at 65°C. Vortex once more. 9. The diluted agarose pool is now ready for use. Store both the diluted PCR pool and the remaining neat melted agarose pool stock at 4°C. For rapid screening of libraries with large numbers of STSs, the pools may be aliquoted into 96-well microtrter plates, thus maximizing the use of multichannel pipets (see Note 16).

YAC Library

Screening I

4. Notes 1. Total yeast DNA can be prepared in solution. However, the authors have found that the agarose plug-based method is simpler to perform, gives a more consistent yield of DNA, and the resulting pools give more reliable PCR results when compared to solution DNA preparations. 2. The authors have found that the spheroplasting step was not effective on Hybond N+ positively charged membranes. 3. It is essential not to overgrow the yeast colonies, because the centers of larger colonies are not penetrated by the subsequent spheroplastmg and lysis solutions. This results in poor or halo-shaped hybridization signals around the edges of colonies only. Filters made from YACs stamped manually using a 96-pin replicating tool of the type described in Chapter 2 are particularly susceptible. 4. Plates can be poured and the filters layed on up to 3 d in advance. 5. Zymolyase does not go mto solution easily. Mix the powder vigorously m a small volume of spheroplasting solution for 2-3 mm prior to addition to the ml1 volume Mix again if allowed to stand prior to preparation of the spheroplasting trays. 6. To avoid excessive inhalation of P-mercaptoethenol, all relevant steps should be performed m a fume hood where practically possible. 7. YLS is toxic. Handle with care. 8. For robotically replicated YACs, the authors have observed that a more even growth occurs if gridding is postponed for at least one night following mixing of newly grown YACs with glycerol. This probably results from cells settling out to form an even layer of yeast on the bottom of the dish, rather than from the effects of freeze thawing. 9. Small an bubbles under individual colonies may not be immediately visible. Each filter should be checked again very carefully after several minutes by holding up to eye level. YACs over bubbles will not spheroplast and will be visible as darker colonies the following day. 10. Damp colonies will stick permanently to the second sheet of Whatman paper If layed on too soon. 11. Do not crosslink filters while wet/damp. 12. Some filters curl up during drying. Rubbing the surface of a Saran wrap (Dow Chemical Co., Uxbridge, Middlesex, UK)-covered UV-transtlluminator hard with a tissue creates static, thus holding the filters down. Cover with Saran wrap and a piece of cardboard to keep flat during crosslinking. 13. Titrate conditions of crosshnkmg. In the authors’ experience, crosslmking YAC filters usmg a standard UV transilluminator is more suitable and gives superior results compared to more specialized devices.

30

Cole, Collins,

and Dunham

14. The average wet weight of cells from a single-stamped filter or two htghdensity grtdded filters are approx 0.7 and 1 g, respectively. 15. To prevent precipitation of lithium dodecyl sulfate, all YLS must be rinsed out fully before storage of agarose plugs at 4°C (a mmimum of three 30-min washes m To ,E at 50°C as described m Section 3.2.3., steps 2 and 3) 16. The use of multichannel pipets vastly increases the rate of PCR screening. Pools are ahquoted mto 96-well microtiter plates as described below. Multichannel pipets are used both to set up the PCR reactions directly from the microtiter plate into a 96-well PCR plate, and to load the agarose gels. Round bottomed microtiter plates for pool storage are available from Falcon. PCR plates (96-well) are available from Hybaid or Costar (Cambridge, MA). To increase the efficiency of gel loading, combs are designed to form lanes at twice the frequency of mtcrotiter plate wells, hence, pools are arranged m the microtiter plate with odd numbers in the first column (pool 1 in Al, pool 3 m Bl, pool 5 in Cl, etc.) and even numbers m the second column (pool 2 m A2, pool 4 m B2, pool 6 m C2, etc.). Aliquot a maximum of 200 pL/well. Repeat this format until the plate 1s full. To prevent evaporation of the pools during storage, overlay each well with two drops of mineral oil and seal the plates with microtiter plate sealers (see Chapter 2, Materials and Methods). Followmg PCR, use the multichannel pipet to load column 1 mto wells 1,3,5,7,9, 11, 13, and 15. Load PCR reactions in the second column mto wells 2, 4, 6, 8, 10, 12, 14, and 16. In this way, the linear order 1, 2, 3, 4, and so on, is re-created on the gel Pools representmg several libraries may be aliquoted mto a single microtiter plate. Single plate (secondary) pools may also be aliquoted into microtiter plates.

References 1. Green, E. D. and Olson, M. V (1990) Systematic screening of yeast artificial-chromosome libraries using the polymerase chain reaction Proc Natl. Acad Scr USA 87, 1213-1217. 2. Bentley, D R , Todd, C., Collins, J., Holland, J , Dunham, I., Hassock, S., et al. (1992) The development and application of automated gndding for efficient screening of yeast and bacterial ordered libraries. Genomxs 12,534-541 3 Amemlya, C T , Alegria-Hartman, M J., Aslanidis, C., Chen, C., Nikohc, J , Grmgnch, J. C , and De Jong, P J. (1992) A two-dimensional YAC pooling strategy for library screening via STS and Alu-PCR methods. Nuclezc Acids Res 20, 255%2563. 4. Chumakov, I., Rigault, P., Gmllou, S., Ougen, P , Billaut, A , Guascom, G., et al

(1992) Continuum of overlapping clones spanning the entire human chromosome 21q. Nature (Lond) 359,380-387

YAC Library

Screening I

31

5. Foote, S., Vollrath, D , Hilton, A , and Page, D. C (1992) The human Y chromosome: overlapping DNA clones spanning the euchromatic regtons. Sczence 258,6&66. 6. Ntzettc, D. N., Zehetner, G., Monaco, A. P., Gellen, L., Young, B D., and Lehrach, H. (199 1) Constructron, arraying and high density screening of large insert libraries of the human chromosomes X and 2 1. their potential use as reference libraries. Proc. Nat1 Acad Scr USA 88,3233-3231 7. Copeland, A and Lennon, G (1994) Rapid arrayed filter productton using the “ORCA” robot. Nature (Lond) 369,42 1,422 (product review). 8. McKeown, G., Watson, A., Karunaratne, K., and Bentley D (1993) High throughput filter preparation robot. Genome Science and Technology (spectal first issue), Program and Abstracts Genome Sequencing and Analysis Conference V, October 23-27, 1993, p 56 (abstract C 21).

CHAPTER4

YAC Library Hybridization

John

Screening

II

and PCR-Based Screening Protocols

Charlotte E. Collins,

G. Cole, and Ian Dunham

1. Introduction Yeast artificial chromosome (YAC) libraries stored in microtiter plates are available for screening as either complex PCR pools or hybridization filters generated from YACs gridded at high densities (see Chapter 3). Different libraries may be available as either PCR pools, hybridization filters, or both. Consequently, screening strategies have been designed that rely solely on either technique, or use a combined approach. Clearly, access to the YAC library microtiter plates and an automatic gridding system allows the user greater flexibility and is an advantage in large mapping projects. Hybridization filters containing YACs gridded at high density locate each positive YAC to an individual microtiter plate well coordinate in one experiment. The precise arrangement and number of YACs on a filter will vary depending on the robot employed, and different centers will grid the same library in quite different arrays. For the purposes of this chapter, hybridization of nylon filters generated using the customized robot employed in the authors’ laboratory are described (Fig. 1, refs. 1,2, G. McKeown and A. Watson [Sanger Centre, Cambridge, UK], personal communication). A number of different PCR-screening strategies have been described (1,3-S). The more complex PCR pools based on high density row and From Methods In Molecular Biology, Vol 54. YAC Protocols Edlted by. D Markle Humana Press Inc., Totowa, NJ

33

Cole, Collins,

34

and Dunham

High Density YAC Filters

B

1

2

3

4

5

6

7

8

9

10

11

12

1

2

3

4

5

6

7

8

9

10

11

12

72mm

~-108

mm-*

Fig. 1. High-density YAC filters. (A) Representation of a hybridization result showing the 4 x 4 array of 1536 clones gridded from 16 microtiter plates onto a single 8 x 12 cm filter. Autoradiographs and filters are labeled in the top lefthand corner, corresponding to position Al of the microtiter plate. Within each square of 16 YACs the 16 microtiter platesare gridded as follows: row 1, plates

YAC Library

Screening II

column pools or combinatrons of l/2 plates may be able to locate a positive PCR signal to a single microtiter plate well using relatively few PCR pools. However, these may also give increased background noise. For the purposes of this chapter, use of a relatively simple pooling strategy is described (see Fig. 2). Here, each primary PCR pool contains total yeast DNA isolated from sixteen 96-well microtiter plates, or 1536 yeast colonies. The secondary PCR pools contain the DNA derived from each of the appropriate 16 plates individually. Once a YAC has been located to a single microtiter plate pools representing the 8 rows and 12 columns of the 96-well mrcrotiter plate can be prepared and screened, thus locating

the positive YAC to a single well (Fig. 3). Alternatively, a hybridization filter may be prepared and screened using the labeled sequence tagged

site (STS) as a probe (see Note 1). 2. Materials 2.1. Hybridization

1. YAC hybridization filters prepared as described m Chapter 3. 2. 20X SSC: 31MNaC1,0.3M Trr-sodium citrate, pH 7.0. 3. 100X Denhardts: 20 mg/mL Ficoll400-DL, 20 mg/mL polyvmylpyrrolidone 40, 20 mg/mL BSA pentax fraction V. 4. Hybridization buffer: 6X SSC, 1% sarkosyl, 10X Denhardt’s solution, 50 m&I Trrs-HCl, pH 7.4, 10% dextran sulfate. 5. 10-20 ng DNA probe. 6. Total yeast DNA: 40 ng at approx 10 ng/pL (see Note 2). 7. A-Minus nucleotrde mix: 1 mL 1.25MTris-HCl/O. 125M MgC12, 18 pL P-mercaptoethanol, 5 pL 100 mM dCTP, 5 pL 100 miI4 dTTP, and 5 pL 100 mMdGTP. 8. a-35S-(thio)clATP (600 Ci/mmol). 9. Sheared human placental DNA (10 mg/mL, e.g., Sigma [St. Louis, MO] D-3287) (see Note 3). l-4; row 2, plates 5-8; row 3, plates 9-12; row 4, plates 13-16. Filter 3 from a library is shown, therefore this filter contams YACs from microtiter plates 33-48 (see Fig. 2). The black crossesare drawn on to the autoradrograph to enable accurate interpretation of results wrth the help of the template shown in (B). (B) Scale drawing of the templatesused to aid interpretation of high-density YAC filter autoradiographs, Templates are prepared on overhead projector acetate sheetsusing fine, pale-colored pens. A positive signal is seen in (A) as follows: filter 3, C5, posttion 10. This signal therefore ongmates from mtcrottter plate 42, position C5.

Cole, Collins,

36 YAC Library

Plates

I-16

PCR Pooling

17-32

33-48

Scheme

n-(n+15)

..a . . . . .

........ AN

~

Primary Pools -

and Dunham

1

123.....

NC

PCR Products

~~~ Secondary Pools -

33

35 34

37 36

39 38

41 40

43 42

45 44

47 46

48

Fig. 2. YAC library pooling scheme. Total yeast DNA from 16 microtiter plates of YAC clones have been combined in each primary PCR pool to give primary pools 1 to N. The PCR is performed on each pool of DNA. Following gel electrophoresis of the PCR products, pool 3 is identified as containing at least one positive YAC with the help of the genomic positive control (lane marked C) and a DNA marker (i.e., 1-kb ladder, not shown). The PCR is performed on the 16 secondary PCR pools (pools 33-48) that correspond to primary pool 3. Gel electrophoresis would be performed to identify a positive secondary pool, thus identifying an individual positive YAC library microtiter plate.

YAC Library

Screening

37

II

Rows and Columns A

Strategy

Pooling Columns 1

2

3

B Rows and columns Columns

4

5

6

7

8

9

10

11 12

PCR Rows

Fig. 3. Row and column strategy. (A) Representation of a 96-well microtiter plate containing colony dilutions in TO,,E stamped from a single YAC library plate. An aliquot of YAC colony from each of the 12 columns and 8 rows are combined to generate rows and columns pools. For instance, the eight colony dilutions combined to generate PCR pool “column 5” are highlighted with the vertical block. The 12 colony dilutions combined to generate PCR pool “row C” are highlighted with the horizontal block. (B) Representation of results of gel electrophoresis of the 12 column and 8 row PCR pools, showing positive signals from column 5, row C, and a genomic positive control (+). Thus, a positive PCR result detected in the secondary PCR pool representing this plate has been localized to plate position C5.

Cole, Collins,

38

and Dunham

10. Wash solutions: a 2X SSC. b 0.5X SSC, 1% sarkosyl c 0.2X SSC, 1% sarkosyl. d. 0.2x ssc.

11. Autoradrography film (e.g., DuPont [Boston, MA] Cronex 4, cat. no. 6603478) and cassetteswith intensifying screens. 12. Luminescent sticker (e.g., glo-gos, Stratagene, La Jolla, CA). 2.2. PCR Screening 1. PCR pools prepared as described m Chapter 3. 2. Genomic DNA (15 ng/pL) derived from the speciesin question (i.e., human, mouse, etc.) containing the target sequence for use as a positive control. 3. 10X PCR buffer: 670 mM Tris-HCl, pH 8.8, 166 mM enzyme grade (NH4)$S04, 67 mill MgCl* (see Note 4). 4. 1OX Nucleotide mix: 5 mA4 each dNTP. 5. 1OX Primer mix: 13 pA4 each primer. 6. 5 mg/mL BSA (Sigma A-4628). 7. 700 mM /3-mercaptoethanol: 1 m 20 dilution of 14A4P-mercaptoethanol m sterile water 8. Tuq polymerase. 9. PCR grade mineral oil (e.g., Sigma 8042-47-5). 10. T0 ,E: 10 mMTris-HCl, 0.1 mMEDTA, pH 8. 11. 2.5% Agarose, 1X TBE mmigels containmg 0.2 pg/mL ethidium bromide in the gel and the running buffer (see Note 5). 12. 15-cm Circular YPD-agar plates (see Chapters 2 and 29; Note 6). 13. 96-Well microtiter plates. 14. 96-Pm replicating tool (see Chapter 2). 15 Access to YAC library microtiter plates. 3. Methods 3.1. Hybridization-Based Screening 3.1.1. Preparation of Labeled Probe 1. Prepare labeled probe using standard techniques (0.25-l x 1Ogcpm/pg of probe; see Note 7). 2. Separate labeled probe from unincorporated label if desired (see Note 8). 3. Add To ,E to give a final volume of 125 pL (see Note 9). 4. If competrtton 1s required, add 125 pL sheared placental DNA, 125 pL Tc ,E, and 125 pL 20X SSC. Mix well (see Note 10). 5. Boil for 5 min, snap chill on water/ice mix. If labeled yeast background is used (see Section 3.1.2.) this can be added to the probe mix before boilmg.

YAC Library

Screening II

3.1.2. Preparation of Labeled Yeast Background (Optional) 1. Prepare 35S-labeled yeast background. Use 40 ng of total yeast DNA in a routme random prime hexamer labeling, but substitute 5 pL [a-35S]dATP in place of [a-32P]dCTP and use A-minus nucleotide mix (see Note 11). 2. Following labelmg, add 100 pL T, 1E/25 pL labeled yeast background (do not separate unincorporated label). Store at -20 or -70°C. 3. Allow approx 0.5 pWl0 mL of hybridization buffer. Either add directly to the probe before boiling or boil for 5 mm, snap chtll on water/ice mix, and add to the hybridization mix separately. 3.1.3. Pretreatment and Hybridization

of Nylon Filters 1. Ensure the hybridization filters have been UV crosslmked (see Chapter 3, Section 3.1.2, step 12). 2. Prehybridize for 1 h at 65’C, preferably leave for 2-3 h. a. For library screens of up to 25 filters (see Note 12) the authors use empty rectangular 8 x 12 cm gridding plates (Chapter 3, Section 2.1.) item 2). Use approx 40 mL hybrtdization buffer for 25 filters, adding the filters individually to the hybridization buffer. Cover with a sheet of plastic (e.g., as used for hybridization bags) and the plate lid. Seal m a sandwich box containmg a moist tissue to prevent drying. b. For hybridization of one to three filters, the authors use a 15-mL roundbottomed plastic tube. Fill the tube with hybridization buffer, roll up the filter (colony side Inward), and use tweezers to slide the filter down to the bottom of the tube where it will unwind. Hybridtze upright m an orbital shaker. 3. Add the boiled probe to the filters. a. If using filters layered in a box, remove filters from the box draining excess hybridizatton buffer back mto the box. Add the probe to the buffer and mix well. Add filters back into the box one at a time (colony side down), covering each filter with hybridization buffer. Cover with plastic and seal as described in step 2a. b. If hybridizing filters in 15-mL tubes, add the probe into the center of the tube, re-cap, and invert gently at least 6-10 times to mix. 4. Hybridize with gentle shaking or 18-48 h, 65°C

3.1.4. Washing and Autoradiography

of Filters 1. Pour off hybridization buffer and wash filters m an excess of wash solutions (use at least 500 mL/25 filters). a. Wash twice in wash solution 1 for 5 min at room temperature with gentle shaking. b. Wash for 30 mm in wash solution 2 at 65OC with gentle shaking

40

2. 3.

4. 5. 6. 7. 8. 9.

10.

11.

1. 2. 3. 4.

Cole, Collins,

and Dunham

c. Wash for 30 mm in wash solution 3 at 65OC with gentle shakmg (see Note 13). d. Wash twice in wash solution 4 for 5 min at room temperature with gentle shaking. Smooth a sheet of Saran wrap (Dow, Uxbridge, Mtddlesex, UK) Just larger than the cassette onto a flat surface. Briefly touch the back of the filter onto a sheet of 3MM Whatman (Maidstone, UK) to drain excess hquid and lay the filters colony side down onto the smoothed out Saran wrap (see Note 14). Do not touch the colony side onto the Whatman paper and avoid hftmg the filter from the Saran wrap since colony debris and associated probe may stick to the Saran wrap. Cover with a second sheet of Saran wrap. Do not rub smooth the colony side of the Saran wrap, particularly after freezing, as the colony debris and associated probe will smear over the filter. Stick a glo-go on to a clear area of Saran wrap. Preflash the film and autoradiograph for 5 h to 7 d as necessary(see Note 15). Lay the autoradiography film over the wrapped up filters and mark the position of the corners of the filter and the position of each filter name. Filters may be rewashed if necessary (see Note 14). Carefully peel the filters off the Saran wrap (see Note 16) and wash as required, including a final room temperature wash without sarkosyl. Re-expose as described. Identify positive clones using a reference template if necessary. Prepare the template by using a pale (e.g., not black) fine marker pen to draw a grid on an overhead acetate sheet. If available use an autoradiograph with good yeast background signal as a model (see Fig 1). Mark small crosses on the autoradiograph at the mtersecttons of several 4 x 4 squares of clones (see Fig. 1; Note 17). Line up the crosses on the film with the intersections on the grid, making sure to keep the orientation of the labeled film and template correct. (The authors label filters m the A 1 position.) Each box on the template surrounds the clones grtdded in a 4 x 4 array from a specific well position in 16 microtiter plates. If background is not uniformly visible, the position within a square on the template 1sused to determine the source of the positive signal. 3.1.5. Rescreening of Positive Colonies Thaw the relevant working copies of the library plate. Streak to single colonies on AHC agar plates (see Chapter 29). Grow for two nights at 30°C. Fill 96-well microtiter plates with 150 pL YPD broth (see Chapter 29)

YAC Library

Screening II

41

5. If purificatton to single colonies is required, pick four to six colonies mto individual wells of the microtiter dish (see Note 18). Pick a mixture of colonies into a final well. Incubate at 30°C for 2 nights. If single colonies are not desired, pick a mixture of colonies into a single well of the microtiter dish. Grow for 2 nights at 30°C. 6. Duplicate and freeze the microtiter plates as described m Chapter 2, Section 3.4. 7. Using one of the copies only, stamp or grid the rescreen plates and prepare hybridization filters as described in Chapter 3. Hybridize the filters as described. 8. Use the second plate for archiving the appropriate clones (see Note 19).

3.2. PCR-Based Screening 3.2.1. Primary Pool PCR This method is based on the use of 0.5~mL microcentrifuge tubes. For rapid throughput of STSs, pools are stored in 96-well microtiter plates enabling the use of multichannel pipets to set up the reactions in PCR microtiter plates and to load the agarose gels (see Note 16, Chapter 3). 1. Prepare a PCR premix as follows (allow approx one spare tube worth for every 10 yeast primary pools, plus 2 tubes worth for controls): For each reaction tube, mix 1.5 uL 10X PCR buffer, 1.5 uL 10X dNTPs, 1.5 l.tL 10X primer mix, 0.49 JJL 5 mg/mL BSA, 0.21 pL 700 mM P-mercaptoethanol, 0.1 uL Taq polymerase (0.5 U), 6.7 yL To lE. Vortex to mix. 2. Place a 3-l.tL droplet of each yeast primary pool onto the side of a 0.5~uL Eppendorf tube approx 5 mm below the lip of the tube. 3. Place a 3 uL droplet of T,, ,E and 3 uL 25 ng/uL genomtc DNA onto the edge of the negative and positive control tubes. 4. Add 12 PL of PCR premix into each tube above the DNA (it will mix with the DNA by gravity). You do not need to change the pipet tip between aliquots of premix unless you have touched the DNA. 5. Add a drop of paraffin oil to each tube above the DNA/premix. The DNA/ premix should mix and drop to the bottom of the tube below the oil without centrifugation. 6. Perform 35 cycles of PCR (see Note 20). 7. Test 5 ltL of each PCR product on a 2.5% agarose mimgel prepared as described in Section 2. Include a suitable size marker at the end of each lane (see Note 21). Electrophorese until the bromophenol blue (if used in loading buffer) has migrated approx 3-5 cm. 8. Photograph gel under UV. 9. Identify all positive pools (see Notes 20,22, and 23).

Cole, Collins,

42 3.2.2. Secondary

and Dunham

Pool PCR

1. For each positive primary pool, identify the relevant secondary pools. The simple pooling system described in Fig. 2 identifies 16 secondary pools for each primary pool. 2. Prepare a PCR premix suffictent for each set of 16 secondary pools, plus the positive primary pool and a genomic and To iE control. Perform the PCR as described m detail m Section 3.2.1. 3. Identify the positive secondary pools. Each pool represents the contents of a single mrcrotiter plate in the poolmg systemjust described (see Note 24). 3.2.3. Preparation

of “Rows and Columns”

PCR

Preparation of rows and columns PCR pools can be avoided by the use of hybridization to nylon filters (see Note 1). 1. Thaw YAC library (working) mtcrotiter plate correspondmg to each positive secondary pool. 2. Stamp the contents of each mtcrotiter plate onto circular YPD agar plates usmg the 96-pin hedgehog as described m Chapter 2. Be sure to mark the appropriate position on the plate with “A 1,” corresponding to position A 1 m the microtiter plate. 3. Incubate the plates at 30°C for 2 mghts. 4. For each stamped plate, fill each well of two 96-well mtcrotiter dishes wtth 100 uL PCR-grade To ]E using a multrchannel pipet if available. 5. Using the 96-pin “hedgehog” stamp the YACs from each agar plate mto the two filled microtrter dishes (see Chapter 2). Be sure to preserve the Al posmon of the stamped agar plate and the microtrter dish (see Note 25). Label one plate “rows A-H” and the second plate “columns l-l 2.” 6. Store the agar plate at 4°C for future use. 7. Take the microtiter plate labeled “rows.” Mix using a pipet and transfer 10 pL of colony suspension from each of the 12 wells m row A (A 1-A 12) to the single well in position Al of a fresh microtrter dish (Fig. 3). You do not need to change pipet tips between each of the 12 wells. If you have access to a multichannel pipeter, steps 7, 8, and 9 can be performed simultaneously. 8. Repeat step 7, but transfer 10 uL of colony suspension from each of the 12 wells in row B (Bl-B12) to posmon Bl of the new mtcrotrter dish. 9. Repeat steps 7 and 8 for each of the remaining rows C to H until Al-H 1 of the new microtiter dish have been tilled with YAC pools representing rows A to H of the YAC library microtiter plate. Using a ptpet mix each of the wells to form a uniform colony suspension of all the YACs present.

YAC Library

Screening

II

43

10. Take the plate labeled “columns.” Mix using a pipet and transfer 10 pL of colony suspension from each of the 8 wells m column 1 (Al-Hl) to the single well in position Al of a second fresh microtiter dish. You do not need to change pipet tips between each of the 8 wells. If you have access to a multichannel pipeter, steps 10, 11, and 12 can be performed simultaneously. 11. Transfer 10 pL of colony suspension from each of the 8 wells m column 2 (A2-H2) to the single well in posttion A2 of the new microtiter dish as described in step 9. 12. Repeat steps 10 and 11 for each of the remainmg columns 3 to 12 until Al-Al2 of the new microtiter dish have been filled with YAC pools representmg columns 1 to 12 of the YAC library microtiter plate. Using a pipet mix each of the wells to form a uniform colony suspension of all the YACs present. 13. The microtiter dishes containing the colony suspensions can be stored at 4°C for several months or more. It is advisable to seal the wells to prevent evaporation. The authors use microtiter plate sealers (Dynatech [Chantilly, VA], cat. no. 001-010-5701). 1. 2. 3. 4. 5. 6. 7.

3.2.4. Rows and Columns PCR Set up a PCR premix sufficient for each set of 20 rows and columns PCR reactions (8 rows and 12 columns), plus the positive secondary pool, a genomic and a To ,E control as described m Section 3.2.1.) step 1(see Note 4). Aliquot 12 pL of PCR premix mto each of, for example, 23 tubes (for a single rows and columns PCR). Mix the colony pools well using a pipet and add 3 pL of colony suspension, 3 PL of genomic DNA, or 3 pL of To ,E into the PCR premixes as appropriate. Add a drop of mineral oil to each tube. Perform the PCR using appropriate conditions for 35 cycles (see Note 26). Test 5 pL of PCR product on a 2.5% agarose minigel as described in Section 2. and Section 3.2.1.) step 7. Photograph under UV and identify the positive pools. You expect one of the 8 rows (A-H) and 1 of the 12 columns (1-12) to be positive. Positive signals of the expected size in, for example, row pool C and column pool 5 determines that the positive YAC is expected to reside in position C5 of the original YAC library plate (Fig. 3, see Notes 27-29). 3.2.5. Confirmation

by Colony PCR The results of a rows and columns pool result must be confirmed by colony PCR on the single “positive” YAC identified (see Notes 4 and 26).

44

Cole, Collins, and Dunham

1. Set up a PCR premix sufficient for each colony to be confirmed, plus a genomic and a To ,E control as described in Section 3.2.1.) step 1 and ahquot 12 yL into each 0.5-mL PCR tube. 2. Use the stamped agar plate representing the relevant YAC library plate (stored at 4°C Section 3.2.3., step 6) to add the deduced positive YAC to the PCR premix: a. Either: Use a toothpick or yellow tip to suspend a small “blob” of colony in 100 pL of T0 ,E and add 3 pL of the resultmg colony suspension to the PCR, b. Or: Touch a yellow tip just onto the colony and stardn-ectlymto the PCR. In this caseadd 3 yL of T, ,E to the PCR tube to make up the volume to 15pL. 3. Perform the PCR as appropriate for 30-35 cycles and test on a 2.5% agarose mmtgel as described m Section 3.2.1.) step 7 (see Note 30). 4. Spreading of YACs between mtcrotiter plate wells during manipulation of the library can result m mixed colonies wtthm a single well. To confirm absolutely the presence of two STSs within a single YAC, streak the YAC to single colomes on AHC agar plates, pick individual colonies into 100 I.~LTo ,E for use m PCR testing as described. Use the same toothpick to patch the colony onto YPD agar plates for growth and future archivmg. Use the colony suspension to test mdtvtdual colonies with each STS (see Notes 19 and 20).

4. Notes 1. Generation of numerous row and column pools can be avoided by the preparation of a high density hybridization filter containing all the microtiter plates to be tested with one or more STSs. This is the authors’ method of choice when high throughput STS testing is required. Alternatively, a hybridization filter containing a single microtiter plate may be prepared manually. See Chapter 3 for preparation of hybridization filters. STSs are labeled by PCR-labeling (see ref. I, Note 7). 2. Items 6-8 in Section 2.1 are optional for labelmg yeast background if required. 3. Item 9 in Section 2.1. is optional for prereassoclation of hybridization probes where required. 4. Many different PCR buffers are available. Some may work better than others for parttcular STSs. However, the authors have found the buffer/PCR conditions given to be most reliable, particularly when used m a yeast colony-PCR. 5. We use 7.5-cm gels with two 23-well combs placed at 1.5 and 4.5 cm, respectively (Flowgen [Slttmgbourne, Kent, UK] mimgel apparatus, 23well combs available from Flowgen on request).

YAC Library

Screening II

6. Items 12-15, Section 2.2. are for preparation of single plate rows and columns if required. 7. Labeling may be performed using standard random primed hexamer labeling techniques or by PCR labeling (I). PCR labeling is particularly effective for labeling STS for use m library screens or secondary screens followmg primary and/or secondary PCR. Use 3-5 PL [a-32P]dCTP (3000 ci/mmol) for a full library screen m up to 40 mL hybridization buffer. Use 0.5-l PL (1 pL for PCR labeling) of [a-32P]dCTP for hybridization of l-3 filters m 15 mL buffer. 8. Separation of labeled probe from unmcorporated nucleotides 1snot necessary in order to achieve strong, clean signals and is only required to check labeling efficiency. The authors routinely use labeled probes directly. 9. If PCR labeling is used, add a small amount of a 0.5 % phenol red/dextran blue dye mix to help visualize separation of probe from mineral oil. 10. Contrary to conventional advice, the authors have found it is possible to add the boiled probe/human DNA mix directly to the hybridization filters without prior incubation. This includes labeled Mu-PCR probes derived from YACs for use m 2- or 3-filter hybridtzations. 11. Labeled yeast DNA background is not always necessary. Its inclusion depends on the type of probe used and the washing stringency. Some probes, e.g., small single copy STSs, may give no background hybrtdization signals on negative yeast colonies. In contrast, Mu-PCR probes and cosmids generally give adequate background when used alone. 12. Before using a newly prepared probe on a large number of filters it is advisable to hybridize and wash a single filter first using an aliquot of labeled probe. Freeze the remaining probe until the filter has been checked for unacceptably high (and potentially irreversible) background hybridization signals. 13. Although these conditions routinely work well, the stringency of washing conditions required will vary dependmg on the probe employed. 14. Do not dry excessively, since this compromises the effectiveness of rewashing. 15. Unless the filters sound very hot (>20 cpm), the authors routinely test after approx 16 h and take a second exposure as required. 16. It is normal to observe some(radioactive) colony debris stuckto the Saranwrap. 17. If the background ts faint these may be difficult to see at first. Look hard, holding the film up to the light at different angles or take a longer exposure. 18. It is advisable to use mixed isolates rather than mdividual colonies in subsequent tests owing to the possibility of part of the YAC insert m specific colonies deleting during growth. In regions prone to deletions isolation to individual single colonies may never be advisable.

46

Cole, Collins,

and Dunham

19. Once a colony result has been confirmed, the relevant yeast clone should be grown up for archiving and future testing. The authors pass all clones through selectton on an AHC agar plate and pick a mixture of colonies mto several microtiter plates. These are grown as described m Chapter 2 and transferred to sets of microtiter plates containing our entire collection of isolated YACs. The authors recommend preparing a master plate (which is rarely used, and never employed for robotic griddmg, etc.), a working master (remade when necessary from the master), and several working plates (remade from the workmg master). 20 Yeast pools (especially complex primary pools) may give PCR background, whereas human and rodent samples do not. Raising the annealing temperature and lowering the extension time can eliminate this problem. However, persistent yeast-specific fragments may be ignored if they do not interfere with the human-specific band. Yeast-specific fragments cannot be ignored if they overlap in size or they amplify stgmticantly more efficiently and may dominate amplification m a particular PCR tube. 2 1. To ensure correct sizing of PCR fragments, the authors recommend loadmg the products of amplification of human DNA at both ends of each comb. 22. Check immediately that the expected size has been amphfied. 23. Amplification of significantly more positives than expected from the library complexity indicates a potential problem because these signals are unlikely to result from amplification of a single copy human DNA sequence. It is more likely that they represent either human repeat sequences or intermittent yeast background. 24. The number of positive secondary pools per positive primary pool will depend on the library complexity and the arrangement of pools. The pooling scheme described in Chapter 3 normally yields one (occasionally two) positive secondary pools per primary pool for a 1.5 nnI4. The presence of amplification products in hamster or yeast DNA will interfere with the hybridization and analysis.

4.2. Dot-Blot

Hybridization

3. Preassociation of both the filter and the probe with human placental DNA to block repetitive sequences is a critical factor for obtaining clean and specific hybridization patterns. Failure of effective blocking of repetitive sequences will result in high background and preclude the identification of specific signal. If high background is detected even after an adequate preassociation, it may be useful to reduce the amount of probe in the hybridization solution down to a concentration of 0.1 x lo6 cprn/mL. In such instances, the problem may be caused by the presence m the YAC probe of low copy repeats that are not effectively blocked. 4. In our experience, it is possible to use the same dot blot at least 10 times, after which the efficiency of the hybridization decreasesand identification of specific hybridization signals becomes more and more difficult. The membranes that have been used to develop this protocol are Sureblot membranes (Oncor, Gaithersburg, MD).

Banfi and Zoghbi

120

Table 1 Comparisonof YAC Chimerism Detection Using &u-Dot Blot Hybridization and YAC EndsMapping Approaches YAC ends mapping Alu-dot blot Chimetic Nonchimeric hybridization YACs YACs Total Chtmerrc YACs

Nonchimenc YACs

19 3

0 19

19 22

5. The authors have tested the sensitivrty and reliabrlity of this technique by comparing it with the traditional YAC ends mapping approach. Table 1 summarizes the results of such comparison performed on more than 40 YAC clones. This analysis shows that for three clones &-dot-blot hybridization technique did not detect chimerism that was present based on YAC ends mapping. The presence of three false negatives among the YACs tested by&u-dot-blot hybridization suggest that the chimeric segment may be small and hence does not contain enough A/u-repeats in the correct orientation to permtt amplificatton of interdlu sequences.This limitation on detection of chimerism by relying on interdlu amphfication is also inherent to mapping by FISH analysis using Alu-PCR products. Nevertheless, the high reliability m detecting chimertc clones (19/l 9 in Table 1) and the ease of this approach make it a very useful tool for the initial characterization of a large number of YAC clones.

References 1. Green, E. D., Riethman, H. C., Dutchrk, J. E., and Olson, M. V. (1991) Detectron and characterizationof chimeric yeastartificial-chromosomeclones.Genomrcs11, 658-669. 2. Ledbetter, S. A., Garcia-Heras,J., and Ledbetter, D. H (1990) “PCR-karyotype” of human chromosomes m somatic cell hybrids. Genomics 8,614-622. 3. Breukel, C , Wtjnen, J., Tops, C., Klift, H., Dauwerse, H., and Khan, P. M. (1990) Vector-Alu PCR: a rapid step in mapping cosmids and YACs. Nucleic Acids Res 18,3097

4

Feinberg, A. P. and Vogelstein, B. ( 1984) A technique for radiolabeling DNA restrictton endonuclease fragments to high specific activity Anal. Btochem

137,

266,267.

5. Zoghbt, H. Y. and Chinault, A. C. (1993) Generation of YAC contigs by walking, in YACs* A User Guzde (Nelson, D L. and Brownstein, B. H., eds.), Freeman, New York, pp. 93-112

Detection of Chimerism

in YAC Clones

121

6. Bar& S , Ledbetter, S. A , Chmault, A. C., and Zoghbr, H. Y. (1992) An easy and rapid method for the detection of chimeric yeast artificial chromosomes clones. Nucleic Acids Res 20, 18 14 7. Nelson, D. L., Ledbetter, S. A., Corbo, L., Victoria, M. F., Ramirez-Sobs, R., Webster, T D., et al. (1989) Alu polymerase chain reaction* a method for rapid isolatron of human-specific sequences from complex DNA sources Proc Natl Acad Sci. USA 88,6157-6161.

CHAPTER12

Amplification

with Arbitrary

Primers

Anna Di Rienxo, Amy C. Peterson, and Nelson B. Freimer 1. Introduction Several methods have been published that rely on the use of short oligonucleotide primers with arbitrary sequences to amplify discrete DNA fragments by the polymerase chain reaction (PCR) (1,2). Typically, a single arbitrary primer is used in each reaction and amplification is achieved when the same sequence is present in inverted orientation at two sites separated by less than a few kilobases. These methods have several advantages: 1. They canbe usedto producequickly large numbersof discrete DNA fragmentswithout prior sequenceinformation; 2. Owing to the random nature of the process,the amplified fragments are likely to be evenly distributed acrossa genomic region; 3. Because they do not rely on the presenceof species-specific repetitive sequences(e.g., Ah repeats[3]), they can be used to analyze the genome of any species. The most common application of arbitrary primers is to amplify polymorphic DNA fragments that can be used to construct genetic maps. Such arbitrary PCR assays are supposed to detect single base variation in genomic DNA so that a given fragment is amplified depending on the presence of a sequencecomplementary to that of the arbitrary primer used. However, it is possible that mechanisms other than single point mutations may be at the basis of the variation detected by arbitrary amplification. From Methods m Molecular &o/ogy, Vol 54 YAC Protocols Edlted by Cl Markle Humana Press Inc , Totowa, NJ

123

124

Di Rienzo, Peterson,

and Freimer

Here the authors present a modification of the aforementioned methods that is not aimed at the identification of variation for genetic mapping purposes, but relies on the ability to amplify discrete DNA fragments from a yeast artificial chromosome (YAC) template (4). The authors expect that the present method will be employed mainly in physical mapping efforts. Arbitrary primers are utilized to generate large numbers of discrete PCR fragments from YAC templates. In addition, m order to produce PCR fragments near the YAC ends, the authors used the arbitrary primers in combination with primers designed to anneal specifically to vector end sequences. Once specific PCR fragments are identified, they can be used for a variety of applications. Owing to their likely even distribution across a genomic region, such fragments can be used to construct maps with fewer gaps. They can be used as probes for Southern blots or genomic denaturing gradient gel electrophoresis (gDGGE) (5). Also, they may be cloned and sequenced to generate sequence tag sites (STS) (6). In addition, the identification of candidate YAC ends by PCR with arbitrary and vectorspecific primers may provide preliminary information on the overlap between YACs whose order 1s unknown. Once the specificity of the potential YAC end fragments is confirmed by hybridization, the suggested order can be confirmed further by PCR with arbitrary primers only. The method relies on the use of YAC template DNA separated by pulse field gel electrophoresis and eluted from the agarose band. The YAC DNA is used as a template for PCR either with a single random 10-mer only or with a random lo-mer and a vector specific primer to obtain random fragments from the YAC insert or YAC ends, respectively. The PCR products are separatedon agarosegel electrophoresis and candidate bands are eluted from the agarose. Candidate band DNA is used to probe Southern blots containing the YAC DNA as well as control DNAs including genomic, somatic cell hybrid, and YAC vector DNAs. The results of the Southern hybridization will confirm the specificity of the PCR bands isolated on the agarose gel. 2. Materials

1. 10X PCR buffer: O.lM Tris-HCl pH 8.3, OSM KCI, 0.02M MgC12, 0.0 1% gelatin. 2. 1 mMdNTPs.

Amplification

with Arbitrary

Primers

125

3. Amplitaq polymerase (Perkin-Elmer Cents, Norwalk, CT). 4. 5 PMArbitrary prtmer solution m H20. (Ten-mers with arbitrary sequence can be purchased from Operon Technologies, Inc.) 5. 5 pA4 Vector primer solution in H20. The authors designed the following 16-mers: a. 93.16 S-TGAACCATCTTGGAG-3’ for the left arm; and b. 94.16 5’-AAGTCTGGAAGTGAA-3’ for the right arm. 6. Low melting point (LMP) agarose (Gibco BRL, Gaithersburg, MD). 7. Geneclean II kit (Biol 01). 8. 5X TB electrophoresis buffer: 54 g Trrs base, 27.5 g boric acid for 1 L. 9. 20X SSC: 175.3 g NaCI, 88.2 g sodium citrate, pH 7.0 (adjust wtth 1OM NaOH) for 1 L. 10. 10 mg/mL ethidium bromide. 11. 10% SDS. 12. 50X Denhardt’s solution: 5 g Ficoll (Type 400, Pharmacra, Uppsala, Sweden), 5 g polyvinylpyrrolidone, 5 g bovme serum albumin (Fraction V, Sigma, St. Louis, MO) for 500 mL. Filter sterilize and store at -20°C. 13. 25% Dextran sulfate. 14. IMNaOH. 15. 3MNaCl. 16. 1M Trrs-HCl pH 7.4. 17. 0.5M NaOH, 1.5M NaCI. 18. 0.5M Tris-HCl pH 7.4, 1.5MNaCl. 19. Hybridization solution: 6X SSC, 10X Denhardt’s solution, 1% SDS. 20. 0.1X SSC, 1% SDS.

3. Methods 3.1. Preparation of YAC Templates The first step consists in the preparation of YAC DNA as a template for PCR. Yeast cells are grown and agarose blocks are prepared as described in Chapter 7 so that approx 3 x 1O8cells are loaded in each gel lane. The electrophoresis conditions to separate YAC DNA from the yeast chromosomes vary depending on the size of the YACs examined. The authors were successful in determining appropriate electrophoresis conditions by means of the autoalgorithm provided with a CHEF mapper (BioRad, Richmond, CA) apparatus in 1% LMP agarose gel run m 0.5 x TB at 14°C. (EDTA was omitted from the electrophoresis buffer so that the template DNA would not contain any EDTA that might alter the efficiency of primer annealing during PCR.)

126

Di Rienzo, Peterson, and Freimer

I. Stam the agarose gel m a tray containing a 0.5 pg/mL ethtdium bromide solution for 15 mm. 2. Transfer the gel onto a clean sheet of Saran wrap on a UV transilluminator. 3. Usmg a sterile razor blade, excise the band containing the YAC DNA and transfer mto a sterile 1.5-mL Eppendorf tube. Use different razor blades for different YACs. 4. Add 200 p.L H20, heat to 65°C for 2 min, and vortex. The YAC DNA 1s now ready for PCR (see Note 1).

3.2. Arbitrary

PCR

The DNA from each YAC is subjected to PCR with a single arbitrary

lo-mer. A no-template control and a control containing YAC vector DNA are performed each time to check for contaminations or amplifica-

tion of yeast fragments. 1. For each reaction use: 2.5 pL 10X PCR buffer, 2.5 pL 1 WdNTPs, 1 ltL 5 pA4arbitrary lo-mer, 0.2 uL Amplitaq, 14 pL H,O, 5 pL template DNA. Make a master mix scaled up for the number of YAC templates and controls used. Ahquot 20 PL of master mix mto each tube and add 5 yL YAC template and 5 pL HZ0 for the negative control. Overlay with 60 pL mineral oil. 2. Amplificatton 1s carried out m a Perkin-Elmer Cetus thermal cycler (see Note 2) in 0.5-mL Eppendorf tubes usmg the followmg cyclmg profile: Imtial denaturatton at 94°C for 3 mm: a. 5 cycles of: 94°C for 1 min, 36°C for 5 min, 72’C for 2 min. b. 40 cycles of 94°C for 1 mm, 36’C for 1 mm, 72°C for 2 min. 3. Load 15 pL of each reaction on a 1.2% LMP agarosegel (approx 11 x 14 cm) contammg 0.5 pg/mL ethtdium bromide. Run at 33 V overmght. 4. Transfer the gel onto a UV transilluminator and excise the selected PCR bands. Transfer each band mto a 1.5-mL Eppendorf tube (see Note 3). 5. Add 209 pL HzO, heat to 65°C for 2 min, and vortex. The DNA 1snow ready to be labeled.

3.3. PCR with Arbitrary and Vector End Primers Each YAC template is amplified using an arbitrary primer and a vector specific primer with the aim of isolating PCR fragments at the ends of the YAC insert. For each YAWprimer combination, it is necessary to perform a PCR with the arbitrary primer only and a PCR with the vector primer only in order to check whether fragments obtained with the arbitrary and vector primer combination are the result of priming with either primer only. The other controls, i.e., no template and YAC vector, should also be performed every time.

Amplification

with Arbitrary

Primers

227

1. For each arbitrary/vector primer combination use: 2.5 pL 1OX PCR buffer, 2.5 pL 1 miJ4 dNTPs, 1 p.L 5 fl arbitrary IO-met-, 1 pL 5 @4 vector primer, 0.2 pL Amphtaq, 13 pL HzO, 5 pL template DNA. The control PCR wtth a single primer (either the arbitrary or the vector primer) are performed as described earlier for the arbitrary PCR except for the PCR profile. Make a master mix for all the YAC templates and the controls and aliquot 20 pL into 1.5-n& Eppendorftubes. Add 5-pL templates or 5 PL Hz0 for the no template control. Overlay with 60 PL mineral oil. 2. Amplificatton is carried out in a Perkin-Elmer Cetus thermal cycler in 0.5mL Eppendorf tubes using the following cycling profile: Initial denaturation at 94°C for 3 min: a. 5 cycles of: 94°C for 1 min, 44OC for 5 mm, 72°C for 2 mm. b. 40 cycles of: 94°C for 1 min, 44OC for 1 mm, 72°C for 2 min. 3. Load 15 PL of each reaction on a 1.2% LMP agarose gel containing 0.5 pg/mL ethidmm bromide. Run at 33 V overnight. 4. Transfer the gel onto a UV transillummator and excise the selected PCR bands. Transfer each band into a 1.5-mL Eppendorf tube (see Note 4). 5. Add 200 pL H20, heat to 65°C for 2 min, and vortex. The DNA is now ready to be labeled.

3.4. Southern

Hybridization

Analysis

In order to test the specificity of the PCR fragments obtained in the preceedmg two steps, they are used to hybridize Southern blots containing: 1. Genomic DNA; 2. Somattc cell hybrid DNA containing the genormc region cloned tn the YACs; 3. Mouse or hamster genomtc DNA, depending on which cells were used to make the somatic cell hybrids; 4. YAC(s) DNA prepared from yeast cell suspension, i.e., containing yeast as well as YAC DNA; and 5. YAC vector DNA. The use of the preceeding DNAs allows one to test whether a given fragment is specifically amplified from the genomic region contained in the YAC(s) and whether it contains areas of overlap between the different YACs examined on the same Southern blot (see Note 5). 1. Digest DNA with EcoRI or any other enzyme used in constructing the YAC library. Typically, 10 pg DNA are used to detect single copy sequences in mammahan genomes. Owing to the smaller size of the yeast genome, the use of 0.1 pg DNA IS preferable. This ensures that bands of similar intensity are produced in both the genomic and YAC lanes.

128

Di Rienzo, Peterson, and Freimer

2. Digested DNA is run on a 0.8% agarose at 60 V overnight; denatured m O.SNNaOH, l.SMNaCl; neutralized m 0.5MTns-HCl, pH 7.4, 1.SMNaCl; and transferred and covalently bound to nylon membrane. 3. Five microliters DNA from the PCR bands excised from the agarose gel are labeled with [32P] by random priming (7) to a specific activity of 1OScpmpg. 4. Prehybrtdize nylon membrane m hybridtzatton oven at 65°C overnight m 5-l 0 mL hybridization solutton. 5. Denature and dilute probe to approx lo6 cpm/mL in hybridization solution. Use 5-l 0 ml/hybridization tube. Hybridize overmght at 65°C. 6. Wash filters m 0.1X SSC, 1% SDS at 65°C. 7. Expose filters to Kodak XAR film in autoradiography cassettewith mtensifymg screens at -80°C for 24-48 h.

4. Notes 1. An alternative procedure to purify the YAC DNA from the excised band uses the Geneclean II kit according to the manufacturer’s recommendations. The DNA from a single YAC band should be diluted to a 300~pL final volume. 2. The authors found that a PCR protocol could not be reproducibly transferred to different PCR machines. In particular, the authors found that the pattern obtained with a given primer/template combination on a PerkinElmer thermal cycler could not be reproduced on a Perkin-Elmer 9600 PCR machine. However, the pattern obtained wtth a given primer/template combmation could be reproduced from one amphfication to another on any grven machme. 3. Selection of bands after PCR with arbitrary primers: Varying numbers of PCR products are usually obtained depending on the primer used and the size of the YAC. Also, the intensity of the bands varies withm the same amplification, In general, intense bands are preferred because they are more likely to represent specific PCR products. In addition to band mtensity, the criteria for selection depend on whether the order of the YACs is known and on the specific apphcatton of the method. In general, bands of the same size present in more than one YAC are interpreted as areas of overlap between YACs, whereas bands unique to a given YAC are mterpreted as nonoverlapping areas. If the order of the YACs 1sknown, unique bands are expected from nonoverlapping YACs and shared bands are expected only in overlapping YACs. If the order IS unknown, shared bands can provide prehminary information on overlap to be confirmed by Southem blot hybridrzation.

Amplification

with Arbitrary

Primers

129

4. Selection of bands after PCR with arbitrary and vector primers. Bands are considered candidate YAC ends if they are present only m the gel lane containing the PCR products from the combination of primers. Bands that are present also in any of the lanes containing the PCR products from single primers are the result of amplification with the same primer. The candidate YAC ends identified in the agarose gel are then used as probes for Southern blots. 5. The PCR bands used for hybridization of Southern blots may contam repetitive sequences. In the authors’ experience it is often possible to ldentify specific bands on the Southern blot even against a high background. However, m case the repetitive DNA background is too high to detect unique bands, the hybridization protocol can be modified to include 250 pg/mL genomic DNA in the prehybridization and the hybridization mixes. However, the authors have noticed that the addition of genomlc DNA sometimes prevents detection of specific bands. Therefore, the authors recommend performing the hybridization without genomlc DNA first and resort to it only if a very high background 1spresent.

References 1. Williams, J. G K., Kubelik, A. R., Livak, K. J., Rafalski, J A , and Tingey, S V. (1990) DNA polymorphisms amplified by arbitrary primers are useful genetic markers. Nucleic Acids Res 18,653 l-6535 2 Welsh, J and McClelland, M (1990) Fingerprintmg genomes using PCR with arbitrary primers Nuclerc Aczds Res l&72 13-72 18 3. Nelson, D. L , Ledbetter, S A., Corbo, L , Victoria, M F , Ramirez-Sohs, R , Webster, T., et al. (1989) Alu polymerase chain reaction: a method for rapid lsolanon of human-specific sequencesfrom complex DNA sources.Proc. Nat1 Acad. Set. USA 86,6686-6690 4. Di Rienzo, A,, Peterson, A., Das, S , and Frelmer, N B. (1993) Genome mapping by arbitrary amplification of yeast artificial chromosomes Mammahan Genome 4, 359-363. 5. Burmelster, M., diSiblo, G., Cox, D. R., and Myers, R. M. (1991) Identlficatlon of polymorphisms by genomic denaturing gradient gel electrophoresis: application to the proximal region of human chromosome 2 1 Nuclezc Acids Res. 19, 1475-148 1. 6. Olson, M., Hood, L , Cantor, C , and Botstein, D (1989) A common language for physical mapping of the human genome. Science 245,1434-1435. 7. Femberg, A. P. and Vogelstein, B. (1984) Addendum. a technique for radlolabeling DNA restriction endonuclease fragments to high specific activity Anal. Biochem. 137,266,267

CHAPTER13

End Rescue from YACs Using the Vectorette Donald J. Ogilvie and Louise A. James 1. Introduction 1.1. The Vectorette Principle The vectorette unit (1) consists of a pair of annealed oligonucleotides that contain two regions of complementary nucleotide sequenceflanking a 29-bp noncomplementary segment (Fig, 1). The 5’ terminus of one of these complementary regions is phosphorylated and displays a restriction enzyme-specific sticky (or blunt) end that permits ligation of vectorette units to both ends of a restriction fragment. A nested pair of polymerase chain reaction (PCR) primers, VP 1 and VP2, directed toward the phosphorylated end have most of their sequence, including their 3’ termini, in the noncomplementary region of the vectorette. These oligonucleotides cannot function as PCR primers on vectorette units without synthesis of a complementary strand from a primer located in the ligated DNA. Thus, although vectorette units will ligate to themselves and to all restriction fragments with matching ends, only DNA flanked by a specific primer (from known sequence)and a vectorette will be amplified in PCR. Because PCR only works effectively for pairs of primers separated by a few kilobases, it is necessary, in the absence of restriction map information, to construct a set of vectorette “libraries,” covering a range of restriction enzyme specificities, in order to maximize the chanceof obtaining a product. The number and choice of restriction enzyme specificities depends on the source of DNA and the size of products required. From: Methods m Molecular Biology, Vol 54 YAC Protocols Edlted by D Markle Humana Press Inc , Totowa, NJ

131

Ogilvie and James

132 A Vectorette unit and Primers GCTGTCTGTCGAAGGTAAGGAACGGACGA 9 (NNNN)XAAGGAGAGGAC 3 ‘I’ TKCTCTC

GAGAAGGGAGAG 3’ CTCll CCC TCTC 5’

CTG TCGCTAAGAGCATGCTECCAATGCTAAG

3’ CATGC-ITGCCAATGCTAAGCTCTKCCTCT Vectorette Pnmer 1 (VPl) 3’ TCGCTAAGAGCATGClTGCCAATGCTAAGC Vectorette Pnmer 2 (VP2)

5’

5

3 TTCCTCTCCTGTCGC 5’ Sequencmg Primer (SV)

B YAC vector (pYAC4) primers Rl

5’ ATAGGCGCCAGCAACCGCACCTGTGGCG

3’

R2

5’ C-ITGCAAGTCTGGGAAGTGAATGGAGAC

3

SR

5’ GTCGAACGCCCGATCTCAAG

Ll

5’ GTGl7ATGTAGTATACTCTTTCI-KAAC

L2

5’ C-IXAACAA-ITAAATACTCTCGGTAGCC

SL

5’ GITGGI-ITAAGGCGCAAG

3’

3’ 3’

3’

Fig. 1. Oligonucleotides used m vectorette end rescue from YACs: (A) The vectorette unit and associated PCR and sequencing primers. In the bluntended vectorette residue X = 5’ Phospho-T; Y = A. In the GATC sticky-ended vectorette (NNNN)X = 5’ Phospho-GATCG; Y = C. (B) PCR and sequencing primers for the r(tght) and l(eft) arms of the YAC vector pYAC4 (based on sequence in ref. 3).

With complex DNA sources (e.g., human or yeast genome), it is often necessary to carry out two rounds of PCR, with nested primers, to obtain sufficient specific product for other manipulations such as cloning, sequencing, and hybridization. 1.2. Application of Vectorette to End Rescue from YACs For efficient genome walking with yeast artificial chromosomes (YACs), it is desirable to isolate both the insert-terminal segments (2).

End Rescue from YACs

133 EcoRl (cloning S&J)

pYAC4

RIGHT

ARM

X I IDigest with X-specific ECORI

pYAC4

X J

1

restriction

enzyme

X I

RIGHTARM

Ligate Vectoreite pYAC4

RIGHT

ARM

VECTORElTE

PCR (2 rounds)

1 I EcoRl

Fig. 2. Amphfication of insert-terminal segment from a YAC using the vectorette. X = site(s) for restrtctron enzyme(s) used to construct the vectorette libraries. Rl, R2 = pYAC4 right arm (containing UK43 gene) vector PCR prtmers (Ll, L2 used for left arm [containing TRPZ gene]). VPl, VP2 = vectorette PCR primers. SRand Sv are sequencing primers. These can be specifically amplified in PCR with YAC clone vectorette “libraries” using primers specifying each YAC vector (pYAC4) arm (right and left) in conjunction with the vectorette primers (3) (Figs. 1

and 2) (see Note 1). For YAC insert-terminal segment isolation it is necessary to make vectorette libraries for each YAC clone. Unless multiple YACs are present, whole yeast (YAC clone) DNA is used as substrate for library construction (see Notes 2 and 3). The authors routinely construct vectorette libraries using a single blunt-ended vectorette with digests of YAC clone DNA with four blunt-cutter enzymes (AZuI, EeoRV, PvuII, and RsaI). This yields satisfactory products from both ends of -95% of YACs. As an alternative the authors have also used a GATC sticky-ended vectorette with the four restriction enzymes BarnHI, BgZII, BcZI, and MboI. Starting with YAC DNA in agarose plugs, insert-terminal segments from both ends of four YACs can be isolated in 3 d.

134

Ogilvie and James 2. Materials

1. YAC DNA in agarose plugs (-3 pg DNA m 100 pL agarose plug). (See Chapter 7 for preparation.) 2. Vectorette units and other oligonucleotides (Fig. 1). Vectorette units and reagents are available from Genosys Btotechnology Inc. (Woodlands, TX). 3. Enzymes:Tagpolymerase, T4 DNA ligase, and selectedrestriction enzymes. 4. Restrictton/ltgation buffer (RLB): 10X RLB is 100 mM Trts acetate, 100 mM magnesium acetate, 500 mM potassium acetate, pH 7.5. 5. TE: 10 mA4Trts-HCl pH 8.0, 1 mA4Na2EDTA. 6. 2MNaCl. 7. 100 mA4ATP. 8. 10X PCR buffer: 100 mMTris-HCl, pH 8.3,500 mMKC1, 10 mA4MgC12, 1% gelatin.

3. Methods 3.1. Construction of Vectorette Libraries from YAC DNA 3.1.1. Digestion of DNA 1. Dialyze one agarose plug from each YAC clone against 2 x 5 mL TE (for >2 h/change) in a 6-mL polystyrene bottle on a roller at 4°C. 2. Cut the plug into four equal portions using a clean scalpel blade. Equilibrate one portion with 0.5 mL of each of the followmg buffers for 60 mm on ice m 1.5-mL tubes: for AZuI, RsaI: 1X RLB; for EcoRV: 2X RLB; for PvuII: 1X RLB + 12.5 p.L 2MNaCl (per 0.5 mL RLB). 3. Remove the equilibration buffer and replace with 50 pL of fresh buffer containing 20-25 U of the appropriate restrictton enzyme. Equilibrate on ice for 30 min before transferring to a 37°C water bath for overnight incubation.

3.1.2. Ligation of Vectorette Units 1. Add 75 pL 1X RLB to each digest and incubate at 65°C for 10 mm to melt the agarose. Mix gently and transfer 40 pL to a clean 1.5-mL tube. Keep at 37°C. 2. Mix the following (adjustpro rata, depending on the number of YACs): 2 pL Blunt vectorette (2 pmol), 2 pL 100 mM ATP, 6 pL containing 20 U T4 DNA ligase, 40 pL 1X RLB. 3. Add 10 pL of this vectorette ligation mtx to each 40 pL of digested DNA. Incubate at 37OC for 2 h. 4. Add 200 pL sterile Hz0 and mix to yield vectorette “library.” Such hbrartes have been stored at -20°C for at least 2 yr without loss of activity.

End Rescue j?om YACs

135

3.2. Amplification

of YAC Insert-Terminal Fragments 3.2.1. First Round PCR 1. Mix the following m a OS-mL tube (1 for each restriction enzyme specrticity): 2 pL (-1-2 ng) vectorette library DNA, 10 nmol of each dNTP, 30 pmol each of VP1 and Rl (or Ll) primers, in 1X PCR buffer and 48 pL total volume. 2. Denature 96”C/lO mm. Add 1 U Tag polymerase in 2 pL 1X PCR buffer, then 92”C/2min, 60°C/2 min, 72”W min, and 39 cycles in thermal cycler. Although some YAC insert-terminal products are detectable by agarose electrophoresis after one round of PCR (3), better products in terms of specificity, yield, and size are obtained after a second round of PCR with nested primers.

3.2.2. Second Round PCR 1. Mix the following in a 0.5-mL tube: 2 pL diluted (1 in 200) first round PCR product, 10 nmol of each dNTP, 100 pmol each of VP2 and R2 (or L2) primers, m 1X PCR buffer and 98 pL total volume. 2. Denature 96OC/lO min. Add 2 U Tuq polymerase in 2 pL 1X PCR buffer, then 92OC/2min, 60°C/2 min, 72OC/3min, and 36 cycles in thermal cycler. 3.3. Characterization of YAC Insert-Terminal Fragments 3.3.1. Verification of Integrity of PCR Products 1. Examine 10-pL sample of second round PCR reaction by electrophoresis in 2% agarose. Store remainder of reaction at -20°C. 2. Select the best products (size, purity, and quantity) and digest 10-20 pL with 10 U EcoRI at 37°C overnight. This excises the amplified YAC vector sequences (left or right) from any insert-terminal vectorette products (Fig. 2). (EcoRI will also cleave any EcoRI sites within the amplified insert-terminal segment, see Fig. 3.) 3. Compare the EcoRI-digested products against 10 pL undigested sample of second-round PCR reaction by electrophoresis in 2% agarose. Genuine insert-terminal vectorette products will be cleaved at least once by EcoRI to yield a YAC vector-derived fragment of characteristic size (Figs. 3 and 4) (see Notes 5,6, and 7).

3.3.2. Preparation for Use in DNA Hybridization 1. Insert-terminal vectorette products with YAC vector sequences removed by EcoRI digestion can be excised from the test gel (see Section 3.3.1.).

136

Ogilvie

and James

kb 1.6

-

0.5

0.1

R

5

5R

6

6R

L

Fig. 3. Agarose gel electrophoresis of vectorette products from the right end of YAC 27ED3. Key to vectorette libraries used: 1 (RsaI); 2 (PvuII); 3 (Hinfl); 4 (EcoRV); 5 (BgZII); 6 (AZuI). Lanes marked R contain EcoRI digests of vectorette products: the common 90-bp band in each digest indicates cleavage of the pYAC4 (right arm) fragment. The Hi@ product is not cleaved because the Hinjl site to which the vectorette is ligated lies within the vector arm (see Fig. 4). Note the additional (0.42 kb) band in the EcoRI digest of the product from the BgZII library (lane 5R); this indicates the presence of an EcoRI site within the insert-terminal region amplified from this library. L = I-kb ladder marker (Gibco-BRL, Gaithersburg, MD). 2. Test gel slices containing these DNA bands are inserted into the wells of a 0.8% low gelling temperature (LGT) agarose gel and electrophoresed until the DNA has migrated about 1 cm. 3. DNA in LGT agarose is then excised and used for labeling and hybridization by standard methods. The vectorette component does not hybridize to human or yeast DNA. 3.3.3. Preparation for Use in Direct Sequencing 1. Purify undigested insert-terminal vectorette products by electrophoresis in LGT agarose. Excise the “verified” band, identified in the test gel (see

137

End Rescue from YACs Eco RI (RI) YAC insert uYAC4

R arm

Primer R2

$

Hinf

I (Hf)

+

Ah

I (Al)

,-a

Eco RV (RV)

-m

Pvu II (Pv)

-

Rsa I (Rs)

-

+

= Vectorette

n

= Vectorette

a

&I 11(W

map Restriction

product

, HfRl ,,

0

FR,s

0.4

,

,

0.8

1.2

“I’,

16kb

Fig. 4. Schematic representation of insert-terminal vectorette products from the right end of YAC 27ED3 with a predicted restrtction map. Section 3.3.1.), and purify the DNA (e.g., by using a Geneclean ktt). 2. Direct sequence the purified DNA using a standard protocol for PCR products (4) with vector (S, and S,) and vectorette (Sv) sequencing primers (Fig. 1).

4. Notes 1. Vectorette libraries can be used to isolate segments adjacent to any known sequencesfrom the YAC insert (not just thoseadjacent to the vector sequence). 2. If a YAC clone contains more than one YAC, insert-terminal vectorette products need to be carefully characterized (e.g., by hybridization of vector-free fragments to PFGE blots) m order to determine the YAC of ortgm. 3. The genomic origin of Insert-termmal fragments 1sof course subject to the possibility of noncontiguous ligation and other artifacts intrmsic to the YAC library. YAC walking strategies should include screens (e.g., somattc cell hybrids) for the evaluation of new markers 4. A new generation of vectorette units contammg a variety of restrlctton sites to facilitate cloning are also available from Genosys Btotechnology. It should be noted that these vectorettes are not compatible with the prrmers described m this chapter.

138

Ogilvie and James

5. Partial digestion of YAC clone DNA can lead to skipping of sites or generation of multiple vectorette products from the same library. Products have also been observed from cleavage of DNA by abnormal (e.g., “star”) restriction enzyme actlvlty. Such sites will not be present in the genomic sequence. 6. Ligation of vectorette usually results in “mactivation” of the restriction site for the enzyme used to create the fragment. 7. Calculations regardmg the size of vectorette products and then amplified segments should take account of contributions from the vectorette (-50 bp) and pYAC4 vector components (right arm = -90 bp; left arm = -70 bp). This is particularly important when selecting products for sequencmg or hybridization.

References 1. Markham, A F., Smith, J., and Anwar, R. (1990) A Methodfor the Ampltficatton of Nucleotzde Sequences UK patent GB-222 1909 B 2. Butler, R., Ogllvle, D J., Elvin, P., Riley, J H., Fmmear, R. S., Slynn, G., et al. (1992) Walking, cloning, and mapping with yeast artlticlal chromosomes: a contig encompassing D21S13 and D21S16 Genomzcs 12,42-51. 3. Riley, J. H., Butler, R , Ogilvie, D. J., Finniear, R., Jenner, D., Anand, R , et al. (1990) A novel, rapid method for the lsoiatlon of terminal sequences from yeast artificial chromosome (YAC) clones Nuclezc Acids Res 18,2887-2890. 4 Green, P M. and Giannelli, F. (1991) Direct sequencing of PCR-amplified DNA, in Methods in Molecular Biology, vol. 9, Protocols in Human Molecular Genetics (Mathew, C., ed.), Humana, Cl&on, NJ.

CHAPTER14

Isolation of YAC Ends by Plasmid Rescue Gillian

Bates

1. Introduction In the construction and characterization of yeast artificial chromosome (YAC) contigs, it is necessary to be able to isolate and map the ends of the genomic inserts. This is important with respect to both extending contigs, and identifying chimerism. A number of techniques have now been described and successfully applied to this purpose, and the majority of these methods are PCR-based, including Alu-vector PCR (I), vectorette libraries (2), and inverse PCR (3) (see ref. 4 for review). Although the possibility of isolating vector-insert junctions by plasmid rescue was identified in the initial article describing the pYAC vectors (‘J, these vectors were not designed with plasmid end rescue in mind. The most widely used YAC libraries are constructed in the pYAC4 vector, i.e., the Washington University (6), CEPH (7), ICRF (8), and ICI (9) libraries, and consequently, modifications to the vector arms need to be made in order to comprehensively use the plasmid rescue approach. The left arm (LA) of pYAC4 contains a Co/El bacterial replication origin and an ampicillin resistance gene in addition to the yeast elements: CEN#, TRPl, ARSl. In contrast, the right arm (RA) contains only a UM3 yeast selectable marker. Plasmid rescue can therefore only be directly applied to the LA vector-insert junction. YAC DNA is digested with a restriction enzyme that cuts within the LA distal to the C&El sequenceand amp genes.This enzyme will also cut at unknown locations within the genomic insert. After circularization, the fragment containing From Methods m Molecular B/ology, Vol 54 YAC Protocols Edited by D Markle Humana Press Inc , Totowa, NJ

139

140

Bates

the vector-insert junction is isolated as a plasmid by transformation of Escherichia coli and selection for ampicillin. Only XhoI and NdeI have a recognition site at an appropriate position in the LA, therefore limitmg the choice of restriction enzymes that can be used for end rescue to Nu’eI, X501, and Sal1 (compatible with XhoI on ligation). In order to extend the use of plasmid rescue to both pYAC4 vector arms and increase the number of restriction enzymes that can be used for this purpose, integrating plasmids pICL and PLUS have been developed that can be used to retrofit the pYAC4 vector arms (IO) (see Chapter 17 for a more complete descnptlon). Although the RA of pYAC4 contains neither a bacterial origin of replication nor an antibiotic resistance gene, the vector-insert junctions can be rescued indirectly. The YAC DNA 1s digested with an enzyme that yields vector insert fragment that contams the URA3 gene and is subcloned into a plasmid vector. The appropriate vector-insert fragment can be identified by URA3 complementation of E. coli containing the pyrF mutation (4, II). Plasmid rescue is a useful addition to the repertoire of techniques that are available for isolating vector-insert junctions from YAC clones. Although the PCR approaches are comparatively rapid, they do not always generate useful hybridization probes. Plasmid rescue allows the isolation of larger fragments thereby increasing the chance of obtaining single copy sequences. In addition, the use of the restriction enzymes 301 and Sal1 with this technique can generate plasmids of 20 kbp or greater which can be used directly as FISH probes providing an additional mapping option.

2. Materials 2.1. Preparation of YAC DNA Prepare yeast chromosomes in LMP agarose blocks as described in ref. 12 and Chapter 7.

2.2. Enzymes 1. Restriction enzymes(NEB, Beverly, MA). Perform reactions asrecommended. 2. 400 U/pL T4 DNA ligase (NEB). 3. Proteinase K (BDH, Leicestershire, UK) Dissolve m water to 10 mg/mL, freeze on dry ice, and store m ahquots at -20°C 4. Agarase (Camblochem, San Diego, CA, or Sigma, St. Louis, MO). Dlssolve at 20 U/pL m 50% sterile glycerol and store at -20°C.

Isolation

141

of YAC Ends 2.3. Solutions

and Buffers

1. TE: O.OlMTris-HCl, pH 7.6, 1 mA4EDTA. 2. 10X Ligase buffer: 0.4M Tris-HCl, pH 7.6,O. 1M MgC12, O.OlM DTT. 3. 1000X PMSF (phenylmethylsulfonyl fluoride) (Sigma): Prepare fresh by dissolving in tsopropanol at 40 mg/mL. Heat to 68°C m order to dissolve. 4. Hybrtdization solution: OSM sodium phosphate, pH 7.2, 7% SDS, 2 mM EDTA (13). 5. PCI: phenol, chloroform, isoamyl alcohol (volume ratios 25:24: 1). 6. CI: chloroform, isoamyl alcohol (volume ratios 24: 1). 7. LB medium: see Chapter 29 8. If unspecified, solutions were prepared as described (14).

2.4. Materials 1. High gellmg temperature agarose (SeaKern) and low melting point (LMP) agarose (Seaplaque) were from FMC Bioproducts (Rockland, ME). 2. Gene Pulser electroporation apparatus and 0.2-cm electroporation cuvet (Biorad, Rxhond, CA). 3. Nylon membranes (Hybond N+), Amersham (Arlmgton Heights, IL). 4. XLlblue E. colz (Stratagene Inc., La Jolla, CA). 3. Methods

3.1. Digestion

of YAC DNA

1. Digest the yeast genomic and YAC DNA m LMP agarose blocks (5 x 1O7 yeast cells is equivalent to 1 yg DNA in 80 uL) to completton wtth the required restriction enzyme (see Note 1). Digest two blocks with 50 U restriction enzyme m a volume of 400 pL. Mix all of the components thoroughly includmg the restriction enzyme, add the YAC block, and digest for 4 h. 2. Inactivate the restriction enzyme by the addition of proteinase K to 250 ug/mL and EDTA to 0.05Mand incubating at 37°C for 30 min. Then mactivate the proteinase K by washing the blocks m 15 mL of 40 ug/mL PMSF in TE twtce for 30 mm. 3. Load one block onto a 0.7% agarose gel (see Note 2) and after electrophoresis, transfer the DNA to a nylon membrane by Southern blotting and hybridize with the PvuIIIEcoRI fragment of pBR322 that is specific to the CEN4 containing vector arm of pYAC4. This both ensures that the digestion is complete and indicates the size of the fragment to be recovered.

142

Bates 3.2 Ligation

It is important to use ligation conditions that favor intramolecular rather than intermolecular ligation events and therefore a comparatively low DNA concentration must be used. A 400 uL ligation reaction contains approx 2.5 ng DNA/pL (see Note 3). 1. Equilibrate the digested block (80 pL) with TE + 0.25MNaCl by washing twice for 30 mm m 15 mL at room temperature. This will give a final NaCl concentration of 0.05Min a volume of 400 pL. Melt the equilibrated block with 40 uL 10X ligase buffer and the required volume of water at 68°C for 5 mm. Mix thoroughly and allow to cool to 37OC.Add ATP to 200 @4 and 4 I-J/uL T4 DNA hgase mix and incubate at 15°C overnight. 2. Add EDTA to 0.02M melt at 68°C for 5 mm. Place at 37°C for 10 mm. Add 4 yL agarase (see Note 4) and incubate at 37°C for 4 h or overnight. Extract once with PCI, once with CI, precipitate with ethanol, and resuspend in 4 uL TE. 3.3. EZectroporation Transformation of electrocompetent E. coli cells is performed using a

BioRad Gene Pulser electroporation apparatus. Electrocompetent cells, prepared as recommended (BioRad), routinely transform the bluescript plasmid (Stratagene Inc.) at transformation efficiencies of the order of 109/yg DNA. 1. Add 2 ltL DNA to 50 uL electrocompetent XL-blue cells, place on ice for 1 mm, and pulse in a 0.2~cm electroporation cuvet at 2.5 kV, 200 R, and 25 PF. Immediately add 1 mL LB to the cells and incubate at 37°C for 1 h with shaking. 2. Pellet cells, resuspend m 100 uL LB, and plate on an LB plate contammg 50 ug/mL ampicillin. For plasmids of up to 25 kb, between 20 and 500 colonies can be expected from the transformation and plating of half of the ligation reaction.

4. Notes 1. YAC DNA m the form of yeast chromosomes in LMP agarose blocks was used for these experiments as YAC DNA was already available in thts form. YAC mimprep DNA would also be suitable (ZO). 2. Digestion of genomic DNA with SalI or XhoI can be expected to generate large restriction fragments, a gel containing a higher percentage of agarose could be used with other restriction enzymes.

Isolation

of YAC Ends

3. A solution containing a 20 kb DNA molecule at a concentration of 2.5 ng DNA/pL would contain a j/i ratio of >5 where j is the effective concentration of one end of a DNA molecule in the neighborhood of the other end of the same molecule and i is a measure of all complementary termini in the solution (14). 4. Gelase (FMC) is a suitable alternative to agarase.

References 1. Nelson, D. L., Ballabto, A., Victoria, M. F , Pterettt, M., Bies, R. D., Gibbs, R. A., et al. (1991) A/u-primed polymerase chain reaction for regional assignment of 110 yeast arttficial chromosome clones from the human X chromosome: identification of clones associated with a disease locus. Proc Natl. Acad Sci. USA S&6157-6161 2. Riley, J , Butler, R., Ogrlvte, D., Finniear, R., Jenner, D., Powell, S., et al. (1990) A novel, rapid method for the isolation of terminal sequences from yeast artificial chromosome (YAC) clones. Nuclerc Aczds Res l&2887-2890. 3. Silverman, G. A., Ye, R. D., Pollock, K. M , Sadler, J. E., and Korsmeyer, S. J. (1989) Use of yeast artificial chromosome clones for mapping and walking within human chromosome segment lXq21 3. Proc Natl. Acad Sci USA 86,7485-7489 4. Silverman, G A. (1993) Isolating vector-insert junctions from yeast artificial chromosomes. PCR Methods Appi. 3, 141-150. 5. Burke, D T., Carle, G. F., and Olson, M. V. (1987) Cloning of large DNA segments of exogenous DNA into yeast by means of artificial chromosome vectors. Science 236,806-8 12 6. Brownstein, B. H., Silverman, G. A., Little, R. D., Burke, D. T., Korsmeyer, S. J., Schlessmger, D., and Olson, M V (1989) Isolation of single-copy human genes from a library of yeast arttticial chromosome clones. Science 244, 1348-1351. 7. Albertson, H. M , Abderrahim, H., Cann, H. M., Dausset, J., Paslier, D L , and Cohen, D. (1990) Construction and characterlsatton of a yeast artifictal chromosome library containing seven haplord human genome equivalents. Proc Natl. Acad. Scl USA 87,4256-4260. 8 Larin, Z., Monaco, A. P., and Lehrach, H. (1991) Yeast artificial chromosome libraries containing large inserts from mouse and human DNA. Proc Natl. Acad Sci. USA 88,4123-4127 9 Anand, R., Riley, J. H., Butler, R., Smtth, J. C., and Markham, A. F. (1990) A 3.5 genome equivalent multi access YAC library: construction, characterisation, screening and storage. Nuclex Acids Res. 18, 1951-1956. 10. Hermanson, G. G., Hoekstra, M. F., McElligot, D. L., and Evans, G. A. (1991) Rescue of end fragments of yeast arttficial chromosomes by homologous recombination m yeast. Nuclex Acids Res. 19,49434948. 11. Rose, M., Grisafi, P., and Botstem, D. (1984) Structure and function of the yeast URA3 gene: expression m Escherichia ~011.Gene 29, 113-l 24.

144

Bates

12 Herrmann, B. G., Barlow, D. P., and Lehrach, H (1987) An inverted duphcatton of more than 650 Kbp m mouse chromosome 17 medrates unequal but homologous recombmatron between chromosomes heterozygous for a large mversron Cell 48, 813-825. 13 Church, G M., and Gilbert, W. (1984) Genomx sequencing Proc Natl. Acad Scz USA 81,1991-1995 14 Sambrook, J , Fntsch, E F , and Maniatis, T (1989) Molecular CZonzng A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

CHAPTER 15

End-Rescue of YAC Clone Inserts by Inverse PCR Gary A. Silverman 1. Introduction The termini of yeast artificial chromosome (YAC) inserts can serve as probes or sequence tagged sites (STSs) that are useful in genomic analysis. For example, these elements can be used to: 1. 2. 3. 4.

Build physical maps and YAC contigs; Characterize and orlent YAC clones; Assess chromosomal origin and YAC chimerism; and Construct conventional and rare-cutting restriction maps.

Although many techniques have been developed, polymerase chain reaction (PCR)-based methods have proven to be a most efficient way to isolate large numbers of end-fragments (reviewed in ref. 2). To achieve logarithmic amplification, however, these techniques require that unique primer template sequencesflank both sidesof the end-fragment.Inverse PCR accomplishes this task by encircling the desired DNA fragment with known vector sequencesprior to the amplification step (Fig. 1) (26). First, sets of oligonucleotide primers in head-to-head, or inverse, orientation are synthesized for both the left and right YAC vector arms (Fig. 2). For reference, the left vector arm (LA) is that portion of the YAC vector that contains the TRPl, ARSl, and CEM sequences;whereas the right vector arm (R4) contains the UR43 gene. Second, YAC DNA is digested with one of a series of restriction enzymes that cleave at known locations within vector arm sequencesand at unknown locations within the genomic insert. From Methods m Molecular Bology, Vol 54 YAC Protocols Edited by D Markie Humana Press inc , Totowa, NJ

145

146 IA

Silverman LEFI’ ARM

INSERT

I

lef1 arm Izx

product

RIGHT ARM

digestion

right

arm

cp

Fig. 1. (A) Inverse PCR YAC DNA is digested with a restriction enzyme that cleaves at a known location in the vector arm and at an unknown location in the genomic insert (0). Templates for vector primers are oriented inversely and direct DNA synthesis in opposite directions (arrows). (B) Restriction fragments are self-ligated to form monomer circles. (C) Circularization of vector-insert junctions reorients primer templates and permits amplification of the intervening genomic insert (from ref. I with permission). Enzymes that cleave between the oligonucleotide template sequences and the EcoRI cloning site of the pYAC4 vector are avoided. The use of

several different restriction enzymes increases the likelihood of generating a vector-insert junction fragment that can be amplified efficiently by the PCR. Third, the DNA is diluted to a concentration of 0.2-2.0 pg/mL and self-ligated using T4 DNA ligase. This results in the formation of monomer circles in which known vector arm sequences now flank the genomic insert (Fig. 1). Circularization also reorients the vector arm templates so that the vector arm primers can anneal in the appropriate orientation. Finally, sets of LA or RA vector arm primers are used to amplify the desired LA or RA vector-insert junction fragments, respectively.

End-Rescue

of YAC Clone Inserts

Nhlll

GACTACGCGA?CATGGCGACCACACC Y13

Fig. 2. DNA sequence flanking the pYAC4 EcoRI cloning site. The location of various left arm (LA) and right arm (RA) vector primers used for inverse PCR (see Section 2.) are depicted by arrows. The vertical lme demarcates LA from RA. Insertions and point mutations not predicted by the composite sequence in Genbank (i.e., pBR322 and SUM) are underlined (from ref. I with permission).

Inverse PCR was used to construct megabase-size YAC contigs that encompass the BCL2 (6), Huntington’s disease (7), and MC genes (8, 9). A single restriction enzyme and inverse PCR was also used to isolate 12 of 14 end-fragments from a modified pYAC vector containing Arabidopsis thaliana DNA (I 0). The average sizes of inverse PCR fragments in our laboratory is 600 bp (range 26-1250 bp). The overall success rate of inverse PCR (>90%) is comparable to vectorette and other forms of ligation-mediated PCR. The use of gel-purified YAC DNA and a large panel of restriction enzymes that are available for both LA and RA rescue may account for the high success rate that have been experienced using this technique.

Silverman

148

2. Materials 2.1. pYAC4 Primers The DNA sequence of that segment of pYAC4 vector that encompasses the SUP4 gene and the EcoRI cloning site are depicted in Fig. 2. This sequence was determined by standard dideoxy chain termination methods and has been confirmed using several different YAC DNAs. The primers selected for LA and RA inverse PCR reactions have been derived empirically and work best with DNAs digested with different restriction endonucleases (see Section 3.4.). 1. LA prtmers: a. Sense #8: S-GTAGCCAAGTTGGTTTAAGG-3’; b. Antisense #15: 5’-ATACAATTGAAAAAGAGATTCC-3’; c. Antisense #13 S-GGACGGGTGTGGTCGCCATGATCGCG-3’.

and

2 RA primers. a. Antisense #3: 5’-AGTCGAACGCCCGATCTCAA-3’; b. Sense #2* 5’-GACTTGCAAGTTGAAATATTTCTTTCAAGC-3’; c. Sense #l 1: 5’-AAGAGTCGCATAAGGGAGAG-3’.

and

Primers are synthesized using standard phosphoramidite reagents, deprotected by ammonialysis, dried, resuspended m water at a concentration of 50 pA& and used without further purification. 2.2. Enzymes 1. Agarase:Epicentre Technologies(Madison, WI). 2. Restriction endonucleases: AccI, EcoRV, NZuIII, NZaIV, RsaI, SalI, S’hI, TaqI.

HaeIII,

HhaI,

HincII,

MboI,

3. T4 DNA hgase:400 U/pL, New England BioLabs (Beverly, MA). 4. Thermus aquaticus (Tuq) DNA polymerase: 5 UIyL, Perkm-Elmer (Norwalk,

CT).

2.3. Buffers

and PCR Reagents

1. 1OX Lrgase buffer: O.SMTris-HCl, pH 7.4,O. 1MMgC12, 0.2MDTT, 10 rnJ4 ATP, 50 ug/mL BSA. 2. 1OX PCR buffer: 500 mJt4 KCl, 100 mMTrrs-HCl, pH 8.3, 15 mA4 MgC12. 3. dNTP stock: A mixture of dATP, dGTP, dTTP, and dCTP each at 1.25 w. 4. YAC storage buffer: 30 mMNaC1, 10 mMTris-HCl, pH 8.0, 1 mMEDTA, pH 8, 0.75 mM spermidine trihydrochloride, and 0.3 mM spermine tetrahydrochloride.

End-Rescue

of YAC Clone Inserts

149

-450 -360 -280 -240

kb Fig. 3. Gel purification of YACs. High-molecular-weight DNAs from three different YAC clones (above lanes) were separated by pulsed-field gel electrophoresis. Electrophoresis conditions (CHEF apparatus, 6V/cm field strength, 20-40 s ramped switching interval, 24-h run) were selected to enhance separation of natural yeast chromosomes I (-240 kb), VI (-280 kb), III (-360 kb), and IX (-450 kb). Arrows indicate the positions where YACs were excised from the ethidium bromide stained gel (from G. Silverman, unpublished data, with permission). 3. Methods 3.1. DNA Preparation 3.1.1. Total Yeast DNA Total yeast DNA can be prepared from a broth culture by one of several techniques (see Chapter 6; ref. II). 3.1.2. Optional: Gel-Purified YAC DNA (see Note 1) 1. Prepare high-molecular weight yeast DNA in low melting point (LMP) agarose blocks or beads as described (see Chapter 7; ref. 6). 2. Place agarose plugs in a 1% LMP agarose gel that is prepared with 0.5X TBE buffer. Place the gel in a pulsed field gel electrophoresis chamber. Set voltages and switch intervals that optimize separation of the YAC from the natural yeast chromosomes (Fig. 3). 3. After electrophoresis, soak the gel for 30-60 min in a dilute solution of ethidium bromide (0.5 ug/mL). Visualize the YAC by UV illumination. Excise the band with a clean razor blade (Fig. 3) and place the gel slice in a microfuge tube.

Silverman

150

4. Place the tube on a rotating platform. Remove TBE buffer from the sample by washmg the gel slice for a minimum of 3 h in several changes of 1.5 mL of YAC storage buffer. The gel slice can be stored at 4°C m storage buffer or digested with agarase (see step 5). 5. Aspirate the YAC storage buffer. Melt the LMP agarose gel slice by mcubating the tube at 65°C for 10-15 mm. Place the tube in a 3740°C water bath and allow for temperature equilibration (-5 mm). Add l-2 U of agarase per 100 uL of molten agarose. Incubate for at least 1 h. The DNA/ agarose solution can be stored at 4’C.

3.2. Restriction

Endonuclease

Digestion

1. If the sample has been treated with agarase (see Section 3.1.) step 5), transfer 4 uL of the DNA/agarose solution to a new tube. If the gel slice containing the gel-purified YAC DNA has not been treated with agarase, remove the YAC storage buffer and incubate the sample m a 65°C water bath for 10 min. After the LMP agarose has melted, remove 4 pL and place in a new microfuge tube. Immediately place this tube in a 37°C water bath. Total yeast DNA, in the amount of 0.0 1-O. 1 ug, can be substttuted for the gel-purified material. However, the total volume of the subsequent reaction should remain at 10 pL. 2. To the tube contammg the 4 pL YAC DNA/agarose solution, add: 4 uL H20, 1 pL of appropriate 10X restriction enzyme buffer, and 1 uL of restriction endonuclease (5-l 0 U) (see Note 2). Incubate the mixture at the appropriate temperature for l-2 h or overmght. 3. Optzonal: Heat inactivate the restriction endonuclease by incubating the mixture at 65°C for 15-30 min. Samples can be stored at 4°C.

3.3. LigationlCircuZarization 1. If the restriction mix has solidified, heat the sample to 65°C for 10 min and then place at 37°C. 2. To the 10 pL restriction mixture, add: 34 pL H20, 5 uL 1OX ligation buffer, and 1 uL T4 DNA ligase. 3. Incubate overnight at 14OC. 4. The ligation mixture can be stored at 4°C.

3.4. PCR Amplification 1. If the ligation mrxture has solidified, heat the sample to 65°C for 10 min and then place at 37°C. 2. To a PCR tube, add: l-5 pL ligation mixture, 5 pL 10X PCR buffer, 8 pL dNTP stock, 1 pL sense primer (see Note 3), 1 p.L antisense primer (see Note 3), and 33-29 uL HZ0 (total reaction volume = 50 p,L),

End-Rescue

of YAC Clone Inserts

151

1.3. 06 0.3kb

Fig. 4. RA inverse PCR products. Gel purified YAC DNA from different clones (top of lanes) was digested with HueIII, ligated with T4 DNA ligase,and amplified with primers #2 and #3. PCR fragments were visualized after agarose gel electrophoresis and ethidium bromide staining. DNA sequence analyses of the PCR fragments in the yB 125A3, y36IB 10, y39BH5, and y 13HEl lanes confirmed the presence of insert-YAC vector junction fragments (from G.

Silverman, unpublisheddata,with permission). 3. Overlay the reaction mixture with 50 pL of mineral oil and “hot start” the PCR reaction by incubating the sample at 96°C for 10 min. 4. After the 10-min hot start, deliver 1 pL (1.25 U) of Thermus aquaticus DNA polymerase to the reaction by plunging the pipet tip through the mineral oil overlay. 5. Complete 3-O thermocycles by denaturing at 94OCfor 1 min, annealing at 55-6O”C for 1 min and elongating at 72°C for 1 min. To ensure all products are double stranded, the final elongation step can be increased to 4-5 min. 3.5. Analysis of PCR Products 3.5.1, Agarose Gel Electrophoresis and DNA Hybridization

Ten microliters of the reaction mix is aspirated from beneath the mineral oil, mixed with loading buffer, and electrophoresed through a 1% agarose gel. The appearance of PCR products can be confirmed by UV illumination of an ethidium bromide stained gel (Figs. 4 and 5). To confirm the presence of appropriate PCR products, the gel can be blotted and hybridized to an end-labeled oligonucleotide probe that hybridizes to a portion of the vector arm that is internal to the primer template (Fig. 6). To confirm that human DNA has been amplified, the PCR fragments can be labeled and hybridized to Southern blots of human genomic DNA (Fig. 6).

152

Silverman

1358603310194-

Fig. 5. LA inverse PCR products. Gel-purified YAC DNAs from clonesyA27D8 and yA24E4 were digested with different restriction enzymes, ligated with T4 DNA ligase, and amplified with primers #8 and #13. PCR products were visualized after agarose gel electrophoresis and ethidium bromide staining. PCR controls included AB1380 chromosomeVI (chromosomeVI is -280 kb and copurified with yA27D8), oligonucleotide primers alone, and a 500-bp product derived from a control template and primers (3LDNA) (from ref. 5 with permission).

of PCR Products Amplification products in the remaining sample (-40 pL) can be purified by gel electrophoresis (see Note 4). Purified PCR products are subcloned into appropriate plasmid vectors for subsequentDNA sequencing. Alternatively, PCR products can be sequenceddirectly using nested primers in either a modified T7 DNA polymerase (Sequenase, United States Biochemical, Cleveland, OH) or a cycle sequencing reaction (Cyclist ExoPfu DNA sequencing kit, Stratagene,La Jolla, CA). DNA sequenceanalysis confmns the presence of a rescued terminal fragment by identification of vector arm sequencesthat flank a novel segment of DNA (Fig. 7). 3.5.2. DNA Sequencing

End-Rescue

of YAC Clone Inserts

153

Barn HI

SUP4

oligonucleotide*

A27 A24 L* L*

Fig. 6. Characterization of inverse PCR products. (Left) The DNA in the agarose gel (see Fig. 5) was blotted to reinforced nitrocellulose. The specificity of LA PCR products was confirmed by hybridizing the blot to a [32P]end-labeled oligonucleotide probe specific for the amplified segment of the SUP4 gene (sequence shown in Fig. 7). (Right) Examination of inverse PCR products for human DNA sequences.Southern blot ofBamHI-digested human DNA hybridized with [32P]-labeled PCR product from the LA of yA27D8 (A27L*) or yA24E4 (A24L*) (from ref. 5 with permission).

4. Notes 1. This purification step reduces the incidence of spurious PCR products. Moreover, this step ensures that the correct products will be isolated in the event that the yeast contain more than one YAC. 2. MboI, NZuIII, TugI, NlaIV, HaeIII, EcoRV, and RsaI restriction endonucleases can be used to obtain LA products; whereas NlaIV, ElaeIII, NlaIII, HhaI, SphI, AccI, WI, and HincII can be used to obtain RA products (Fig. 2). A separate reaction is required for each enzyme selected. 3. A single set of PCR primers can be used for each vector arm. However, it has been determined empirically that combinations of certain vector arm

154

Silverman ECORI

SUP4 Region Sense Primer internal Probe Cloning Slh 6’-WI’ ~Q~AGCCAAQTTGGTTTAAG~GCAAGACTTTAATT~TCAC~C~AATT~ATGACT~A~AGTGTTCTGAGGCTG

CTCTGGACATGCAATCTTGCATGCTTTTGTCATGACAGGTCTTAAGAAGTTTATCAGCTTTCTCAAATAGCTG

AATGACAGAACACTGGATTTTTGTTCAGATAGCCTATCAACTTGGCATCTGTGTTGCGGTTGTCACTTGGTAA

CAAGATAAGTACTTACTA~QCQATCATQGCQACCACACCCQTCCT] 3’4

YIP5 Region Anttsense

Primer

5

Fig. 7. DNA sequence of the A24L inverse PCR product. Sequence of the product obtained after TuqI dtgestton, ctrculartzation, and LA amplification of yA24E4. In this case, the correct DNA sequence of the inverse PCR product should read through the senseprimer #8, a portion of the SUP4 locus, the EcoRJ cloning site, an unknown element (the end-fragment), and the reverse-complement of primer # 13. Location of the mternal oligonucleotide probe used m Fig. 6 is between the SUP4 senseprimer #8 and the EcoRI cloning site (from ref. 5 with permission). primers and enzymatlcally digested DNA are more successful m yielding mverse PCR fragments. To obtain LA products, primer combmations #5 and #8 are used with MboI- and NZaIII-digested DNA, whereas primers #I3 and #8 are used with TaqI-, NlaIV-, HaeIII-, and EcoRV-digested DNA. To obtain RA products, primers #2 and #3 are used with NZaIV-, H&II-, NZuIII-, H/x&, and S’hI-digested DNA, whereas primers #11 and #3 are used with AccI- and HzncII-digested DNA. 4. Unused primers also can be removed by collecting the sample in a microconcentrator cup (e.g., Microcon-30, Amicon, Inc., Beverly) that excludes higher molecular weight DNA.

Acknowledgments This work was supported by grants from the National Institutes of Health (HD28475), the Hearst Fund, the March of Dimes, and the Elsa Pardee Foundation. The author thanks Kelly Ames for the preparation of the manuscript.

End-Rescue of YAC Clone Inserts

155

References 1. Silverman, G. A. (1993) Isolating vector-insert junctions from yeast artificial chromosomes. PCR Methods Appl 3, 141-150. 2 Silver, J. and Keerikatte, V. (1989) Novel use of polymerase chain reaction to amplify cellular DNA adjacent to an integrated provitus J Vwol. 63, 1924-1928. (Published erratum appears in J, Vwol. 1990,64[6], 3 150.) 3 Trtglia, T., Peterson, M. G., and Kemp, D. J (1988) A procedure for in vitro amphfication of DNA segments that lie outside the boundaries of known sequences. Nucleic Acids Res. 16,8 186. 4. Ochman, H., Gerber, A. S., and Hartl, D L. (1988) Genetic apphcattons of an inverse polymerase chain reaction. Genetics 120,621-623. 5. Silverman, G. A., Ye, R. D., Pollock, K. M., Sadler, J E., and Korsmeyer, S J. (1989) Use of yeast arttfictal chromosome clones for mapping and walking within human chromosome segment 18q21.3. Proc Nat1 Acad. SCL USA 86,7485-7489. 6. Silverman, G. A., Jockel, J. I., Domer, P H., Mohr, R M., Taillon, M. P , and Korsmeyer, S. J. (1991) Yeast artificial chromosome clonmg of a two-megabasesize contig within chromosomal band 18q2 1 establishes physical linkage between BCL2 and plasminogen activator inhibitor type-2. Genomzcs 9,219228. 7. Zuo, J., Robbins, C., Talllon, M. P., Cox, D R., and Myers, R. M. (1992) Clomng of the Huntington disease region in yeast artificial chromosomes. Hum. Mol. Genet 1,149159.

8. Groden, J., Thlivens, A , Samowuz, W., Carlson, M., Gelbert, L., Albertsen, H , et al. (1991) Identttication and characterization of the familial adenomatous polyposts coli gene Cell 66,589-600 9. Joslyn, G., Carlson, M., Thliveris, A., Albertsen, H., Gelbert, L., Samowitz, W., et al. (1991) Identification of deletion mutations and three new genes at the familial polyposts locus. Cell 66,601--613. 10. Grill, E. and Somervtlle, C. (1991) Construction and characterization of a yeast artificial chromosome library of Arabzdopszs which IS suitable for chromosome walking. Mol. Gen. Genet. 226,484-490. 11. Rose, M. D., Winston, F., and Hieter, P. (1990) Methods in Yeast Gene&s* A Laboratory Course Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, p 198

CHAPTER16

Covering YAC-Cloned DNA with Phages and Cosmids Jiannis Ragoussis and Anthony P. Monaco 1. Introduction The detailed analysis of the DNA cloned in yeast artificial chromosomes (YACs) is performed by subcloning into vectors such as phages or cosmids, which allow a simpler purification of insert DNA in addition to allowing high resolution mapping. Cosmids or phages are still a preferred DNA source for the isolation of new polymorphic markers or coding sequences. For example, the techniques used to isolate genes involve screening of cDNA libraries with whole cosmids or applying cDNA selection on immobilized cosmid DNA (1). Exon amplification is most effective when applied to cosmids (2). The combination of these resources has been instrumental in identifying disease genes like Huntington’s and Spinocerebellar Ataxia 1 (3,4). In order to generate cosmids or phages covering the YAC insert, two main strategies can be adopted: 1. The screeningof gridded chromosome-specificcosmid libraries with isolated, labeled YAC DNA (5,6) or Alu-PCR products. 2. The construction of a library using whole YAC DNA (7). This method is useful in order to generateadditional resourcesto the onejust describedor in caseswhere an orderedchromosomespecific library is not available. Also, it can be usedto fill in gaps in contigs formed in chromosomespecific cosmid libraries. From Methods in Molecular Biology, Vol 54 YAC Protocols Edlted by D Markle Humana Press Inc , Totowa, NJ

157

Ragoussis and Monaco

158 2. Materials 2.1. Screening

of Gridded

Cosmid

Libraries

1. Yeast agarose plugs prepared as described m Chapter 7. 2. Pulsed-field gel electrophoresis (PFGE) apparatus, The contour-clamped homogeneous electric field (CHEF) apparatus is very suitable (e.g., CHEF DR-II, BioRad, Richmond, CA) or rotating field apparatus (e.g., Rotaphor, Biometra, Germany). 3. TBE electrophorests buffer (10X): 0.89M Tris base, 0.89M boric acid, 0.016MEDTA. 4. Low melting point (LMP) agarose (Seaplaque GTG) from FMC bioproducts (Rockland, ME). For regular agarose any electrophoresis grade ~111do. We recommend Seakem (FMC), Type V (Sigma, St. Louis, MO) or Ultrapure (BRL, Lite Technologies, Paisley, Scotland). 5. P-Agarase I (New England Biolabs, Beverly, MA). 6. Glassmilk DNA purification kit. We recommend Geneclean II from BIO 101 (La Jolla, CA). 7. Mini horizontal gel apparatus and power supply. 8. Heated blocks or water bath. 9. Thermal cycler (from Perkin Elmer-Cetus [Norwalk, CT], Techne [Cambridge, UK], or equivalent). 10. Oligo labeling buffer (OLB): Make up Solutions 0, A, B, and C as follows: a. Solution 0: 1.25M Tris-HCl, pH 8, 0.125M MgCl,. b. Solution A: Mix together 1 mL solution 0, 18 p.L P-mercaptoethanol, 5 pL 100 mM dATP, 5 pL 100 mA4 dGTP, 5 pL 100 mA4 dTTP. c. Solution B: 2M HEPES, pH 6.6. d. Solution C: 0.33 mg/mL hexanucleotides (Pharmacia, Uppsala, Sweden). Mix solutions A, B, and C in ratio 100:250: 150. 11. 10 mg/mL Bovine serum albumin (BSA) (New England Biolabs, BRL). 12. [a-32P]dCTP, 10 pCi/pL, 3000 Ci/rnmol (Amersham, Arlington Heights, IL). 13. Klenow enzyme (Escherichia coli DNA polymerase I large fragment). 14. SSC buffer (20X): 0.3MNa-citrate pH 7.4, 3MNaCl. 15. 20% SDS: 200 g/L sodium dodecyl sulfate. 16. 50X Denhardt’s solution: 1% BSA, 1% ficoll400, 1% polyvinylpyrrolidone. 17. Hybridization buffer: 6X SSC, 1OX Denhardt’s solution, 50 mMTris-HCl, pH 7.4, 1% sarkosyl (BDH), 10% dextran sulfate (Pharmacia). 18. Sonicated human placental DNA (Sigma) 10 mg/mL. 19. Alu-PCR prtmers: a. ALEl: 5’ GCCTCCCAAAGTGCTGGGATTACAG 3’. b. ALE3: 5’ CCAT/cTGCACTCCAGCCTGGG 3’.

Couering YAC-Cloned DNA 20. Amplitaq DNA Polymerase (Cetus, Roche Medical Systems, Branchburg, NJ). 2 1. PCR buffer (10X): 670 mMTris-HCl, pH 8.8, 166 mM(NH&S04 (enzyme grade), 67 mM MgClz. 22. Shaking water bath or rotating hybridization oven (available from Appligene [Illkirch, France], Hybaid or Techne [Teddington, Middlesex, UK]). 23. Plastic bags or boxes for hybridization, or special bottles if the oven is used. 24. Gridded cosmid library filters. High density library filters can be produced using a robotic device (81 or available from Gunther Zehetner, ICRF Laboratories (London). 2.2. Construction

of Cosmid

and Phage Libraries from Whole YAC DNA 1. Preparation of vector: For the cosmid library construction, the authors recommend SuperCos 1 (Stratagene, La Jolla, CA) and for the phage library construction EMBL3 or X-DASH (Stratagene). 2. Restriction enzyme buffers: The buffers recommended or supplied by the manufacturers are the best to use. For preparing the vector DNA, the authors use T4 polymerase buffer, because it IS suitable for most enzyme digests as well as calf intestinal phosphatase (CIP). 3. T4 Polymerase salts (1OX): 0.33MTris-acetate, pH 7.9, 0.66M K-acetate, 0.1OM Mg-acetate. 4. Dithiothreltol (DTT) solution at 50 mM. Store frozen. 5. BSA solution at 10 mg/mL. Store frozen. 6. Ligase buffer (10X): 0.5M Tns-HCl, pH 7.5,O. 1M MgC12, 0.3MNaCl. 7. T4 DNA hgase (New England Biolabs) at 400,000 U/mL. 8. T4 Polynucleotide kmase (New England Biolabs) at 10 U/uL. 9. TE: 10 mMTris-HCl, pH 7.5, 1 mA4EDTA. 10. 0.5MEDTA pH 8. 11. Phenol equilibrated with 0. 1M Tris-HCl, pH 8. 12. Chloroform/isoamyl alcohol 24: I. 13. Ethanol 100%. 14. CIP from Boehringer-Mannheim (Mannheim, Germany) at 1 U/uL. 15. 0.15M Trinitriloacetic acid (BDH) stored at -20°C in small aliquots. It is used to inactivate CIP. 16. Dextran T40 solution at 10 mg/mL. 17. ATP solution at 10 miI4. Store frozen. 18. In vrtro packaging extracts. The authors recommend Gigapack XL (Stratagene) for the cosmid library and Gigapack Gold (Stratagene) for the phage library.

160

Ragoussis and Monaco

19. Bacteria strains: XLI-BLUE MRA (P2 and non-P2 lysogen) for the phage library and XLI-BLUE MRA for the cosmtd library available from Stratagene. 20. NZCYM, TB, and LB media (see Chapter 29). 21 SM buffer. 10 mMNaC1,8.3 mMMgS04, 50mMTris-HCI, pH 7.5,0.01% gelatin. Autoclave to sterthze. 22. 3MM Filter paper (Whatman, Matdstone, UK) and Nylon membranes (the authors recommend Hybond-N, Amersham). 23. Denaturant solution: 1.5M NaCl, 0.5M NaOH. 24. Neutralization solutton: 1M Trts-HCl, pH 7.4, 1.5M NaCl. 25. X-ray film, cassettes,and intensifying screens.

3. Methods

1. 2. 3.

4. 5. 6.

7.

3.1 Screening of a Chromosome-Specific Cosmid Library Prepare agarose plugs and separate the YAC from the other yeast chromosomes by PFGE, as described in Chapter 7. Cut out the gel sltce contammg the YAC and purify the DNA with glassmilk by using Geneclean II kit or other equivalent product (for an alternative YAC DNA purification method, see Note 1). To radiolabel the DNA, take approx 20-50 ng of purified YAC DNA m solution (as Judged by comparison to known quantities of marker DNA on an agarose mimgel) and make up to 33 PL with water. Place in a bothng water bath for 5 mm then chill on ice. Add 10 PL OLB, 2 PL of 100 mg/mL BSA, 5U Klenow enzyme, and 3 uL [a-32P]dCTP. Incubate at 37°C for 4 h or overnight. Alternatively, labeled Alzl-PCR products from the YAC can be used as a probe (see Notes 2 and 3). Compete the human repetitive sequences prior to hybridization by making the labeled probe up to a volume of 125 PL wtth water, then addmg 250 pL of 10 mg/mL sonicated human placental DNA and 125 l.tL 20X SSC. Boll for 5 min, place on ice for 1mm, then incubate at 65°C for 30-60 mm and add to hybridization mix. Hybridize the filters overnight at 65°C and wash once in 2X SSC, 0.1% SDS at room temperature for 20 min, once m 2X SSC, 0.1% SDS at 65°C for 20 min, and twice in 0.1X SSC, 0.1% SDS at 65°C for 10 mm. The last wash can be increased to 68°C for further reduction of background signal tf required. Expose washed filters to X-ray film with intensifying screens at -70°C for 2 h to overnight.

Figure 1 shows an autoradiograph obtained from a high density cosmid grid hybridized with labeled probe from a YAC.

Covering

YAC-Cloned

DNA

161

Fig. 1. High density cosmid grid (6) hybridized with Alu-PCR products from an 800-kb long YAC. One hundred fifty individual clones have been picked. Filter kindly provided by Dean Nizetic (ICRF Laboratories, London).

1. 2. 3. 4. 5. 6. 7.

3.2. Construction of a Cosmid or Phage Library Using Whole YAC DNA (see Note 4) 3.2.1. Purtial MboI Digests of Yeast DNA in Agarose Blocks Make agarose plugs as described (Chapter 7) and wash thoroughly in TE. Set up four reactions each with one block (one block contains l-2 pg of DNA in approx 100 pL), 20 pL 10X T4 polymerase salts and 40 pL sterile water. Melt at 68°C for 10 min, then bring to 37°C. Add 20 pL BSA solution (10 mg/mL), 20 pL DTT solution (50 mM), and 0.1 UMboI. Incubate at 37OC,tube 1 for 2 min, tube 2 for 5 min, tube 3 for 10 min, and tube 4 for 15 min. Heat kill Mb01 at 68OC for 20 min and bring to 37°C. Add 3 uL P-agarase I and incubate for 2-3 h.

162

Ragoussis and Monaco

8. Add 0.1 U CIP in 40 pL 1X T4 polymerase buffer to each tube and incubate at 37OCfor 30 min. 9. Add trmimloacetic acid, pH 8.0 to 0.015Mand incubate at 68°C for 20 min. 10. Bring to room temperature and add 5 PL Dextran T40 (10 mg/mL) as carrier, Extract twice with an equal volume of phenol, once with an equal volume of chloroform, and precipitate by adding 5 PL more Dextran T40, making to 0. IA4 NaCl and adding two volumes of ethanol.

3.2.2. Ligation to EMBL3 Vector ArmslSuperCos 1 (see Note 5) 1. Resuspend the DNA pellet m IO PL TE. 2. Set up the following test ligations for each Mb01 partial digest: a. I pL DNA solution in 10 uL 1X ligase buffer, no ligase. b. 1 PL DNA solution in 10 mL 1X ligase buffer with 0.5 PL ligase. c. 1 uL DNA solution in 10 pL 1X ligase buffer with 0.5 pL ligase and 0.5 pL polynucleotide kinase. 3. Incubate at 37OC for 60 min then load on 0.3% agarose gel for analysis with lambda Hi&III and lambda SacI digests as size markers. From this gel, decide which is the best digest for phage and/or cosmid libraries. The digests with the bulk of DNA migrating between 45 and 35 kb are the most suitable. For best results use at least two different partial digest conditions. 4. Ligate partially digested DNA to vector arms: a. For phage library construction with vector arms in a 5-PL reaction: i. 0.5 PL 10X ligase buffer; ii. 0.5-l .O PL (OS-1 .O p,g) EMBL3 arms cut with BumHI and EcoRI (1: 1 ratio with insert); iii. 0.5 ltL ligase (400 U/mL); iv. 3-O-3.5 pL YAC DNA (Mb01 partial digest). b. For cosmid library construction with SuperCos 1 in a 20-PL reaction: i. 2.5 p,g YAC DNA (Mb01 partial digest); ii. 1.0 pL SuperCos 1 (1 pg/pL); iii. 2.0 uL 10X ligase buffer; iv. 2.0 p.L 10 mMATP; v. 1.OuL ligase (400 U/pL); vi. Sterile water to 20 pL. 5. Incubate at 16OCovernight or 4OCfor 2 d.

3.2.3. In Vitro Packaging of Phage Library (Stratagene) 1. Package cells and plate according to the detailed protocol provided by the manufacturer. Plate out three dilutions of the packaged material, 1 pL, 10-l pL, and 10” pL on 37-mm plates. Incubate at 37°C overnight.

Covering YAC-Cloned

DNA

163

2. Count the plaques on the 10-t plate and compare the lysogen and the nonP2 lysogen plaques. If they are comparable in numbers, then most of your plaques are recombinants. Calculate the titer of your original stock.

3.2.4. In Vitro Packaging of Cosmid Library (Stratagene Gigapack XL) 1. Package cells according to the detailed protocol provided by the manufacturer. 2. Make a 1: 10 and a 1:50 dilution in SM buffer of the packaged DNA. 3. Mix 25 PL of each dilution with 25 pL of prepared XLI-BLUE MRA cells (according to the Stratagene protocol) m a tube and let sit at room temperature for 30 min. 4. Add 200 pL of LB broth to each sample and incubate for 1 h at 37°C shaking gently every 15 min. 5. Spin tube for 30 s and resuspend the pellet in 50 PL fresh LB broth. 6. Plate the cells on Hybond filters placed on LB plates containing 50 pg/mL ampicillin and incubate overnight at 37°C. The titer should be between 1 x lo5 and 1 x lo6 transformants per mg DNA (see Note 6).

3.2.5. Filter Lifts from Phage Plaques 1. Dry the plate in a laminar flow hood for 30 min and place in the cold room for 30 min. 2. Place a dry Hybond N circle onto the plate. Pierce the membrane and agar with a 19-g needle asymmetrically several times for orientation markers. 3. After 30 s, lift the membrane and place onto 3MM paper soaked in denaturant solution for 2 min with plaque side up, 4. Repeat steps 2 and 3 with a fresh filter to generate a duplicate. 5. Move the filters to 3MM Whatman paper soaked in neutralization solution for 3 min. Do this again, then move to 2X SSC and wash, 6. Air dry, then bake and UV crosslink.

3.2.6. Preparation of Bacterial Colony Filters 1, Cool the bacteria plates for 30 min and place a nylon filter membrane on each plate. Allow to soak for 2 min. 2, Pierce the membrane and agar with a 19-g needle asymmetrically several times for orientation markers. Lift filters from plates and place onto 3MM paper soaked m denaturant solution for 5 mm (bacteria side up). 3. Place on 3MM Whatman paper soaked in neutralization solution for 5 min. Repeat on fresh Whatman and then wash in 2X SSC. Dry filters and bake/ UV crosslink.

164

Ragoussis and Monaco

Fig. 2. A phage library constructed using a 350-kb YAC clone. Five thousand clones were plated out in a 24 x 24-cm plate and screened with total human DNA. One hundred sixty clones are visible as distinct colonies, giving a theoretical lo-fold coverage of the YAC. The 11 black dots used for orientation on the film are present. The phage and cosmid filters can be used for hybridization with total

human DNA, specific repeated sequence,or single copy probes using the methods described in Section 3.1. Figure 2 shows an autoradiograph obtained from a phage library constructed from a YAC and probed with total human DNA. 4. Notes 1. The following is an alternative for the purification of YAC DNA for use as a hybridization probe. Separate the DNA in a 1% LMP agarose pulsed

field gel. Cut out the slice containing the YAC, equilibrate in TE, andmelt

Covering YAC-Cloned

2. 3.

4. 5.

6.

DNA

at 65°C. Add j3-agaraseI buffer, equilibrate to 40°C, then add 10 U/100 pL P-agarase I and incubate at 40°C for l-2 h. Phenol extract and ethanol precipitate the DNA, adding Dextran T40 or Glycogen to a final concentration of 0.1 pg/mL as carrier. Labeling ofAlu-PCR products: simply take 1 pL out of the PCR reaction (primary reaction, see Section 3.2.1. of Chapter 10) and label using the random priming method as described. Choice of probe for library screen, labeled en&e YAC DNA or Alu-PCR products? There are advantages in both. Whole YAC DNA gives a better coverage with a htgher number of positive clones. False positives will be included because of signals from rDNA sequences present in various degrees in particular chromosomes. Alu-PCR products give less positives leadmg to potential gaps, but the more limited number of clones makes the management and handlmg easier. The method described can be used for the construction of a cosmid library from any source. Chotce of vector to use for cosmid library constructton. The authors prefer SuperCos 1 because it is efficient with small amounts of DNA and the insert can be treated with CIP. In contrast to other systems, the insert can be excised with Not1 or EcoRI digests thus enabling easy mapping, subcloning, and further use for tdentttication of expressed sequences. In addition, it allows the generation of labeled RNA probes from each end for contig construction using hybridtzation approaches. How many cosmtds/phages should be plated? Not all YACs are present in storchiometrrc proportton to the other yeast chromosomes. We expect an average YAC of 650 kb to represent approx l/20 of the total DNA. One hundred sixty cosmtds would gave a theoretical 1OX coverage (average insert size 40 kb), and therefore plating out 3250 clones should be sufficient. For a 24 x 24-cm plate this number of clones should give individual colomes, provided they are evenly spread, which are easy to identify and pick.

References 1. Wei, H., Fan, W -F., Xu, H , Parimoo, S., Shukla, H., Chaplin, D., and Weissman, S. M. (1993) Genes m one megabase of the HLA class I region. Proc N&Z. Acad Sci USA 90, 11,870-l 1,874. 2. Church, D., Stotler, C., Rutter, J., Murrell, J., Trofatter, J., and Buckler, A. (1994) Isolation of genes from complex sources of mammahan genomrc DNA usmg exon amphflcation. Nature Genet. $98-105 3. Huntmgton’s Consortium (1993) A novel gene containing a trinucleotide repeat that is expanded and unstable on Huntington’s disease chromosomes Cell 72,97 l-983

166

Ragoussis and Monaco

4. Orr, H., Chung, M.-Y., Banfi, S., Kwiatkowskr, T., Jr., Servadio, A., Beaudet, A., et al. (1993) Expansion of an unstable trinucleotide CAG repeat in spinocerebellar ataxia type 1. Nature Genet. 4,22 l-226 5. Baxendale, S , MacDonald, M., Mott, R., Francis, F., Lm, C., Kirby, S., et al. (1993) A cosmid contig and high resolution restriction map of the 2 megabase region contaimng the Huntmgton’s disease gene Nature Genet. 4, 18 l-1 86. 6. Nizetic, D., Geilen, L , Hamvas, R., Mott, R., Grigoriev, A., Vatcheva, R., et al (1994) An integrated YAC-overlap and “cosmid-pocket” map of the human chromosome 21 Hum Mol. Genet. 3,759-770. 7. Banfi, S., Chung, M.-Y., Kwiatkowskt, T., Ranum, L., McCall, A., Chmault, A , et al. (1993) Mapping and cloning of the crtttcal region for spinocerebellar ataxra type 1 (SCA 1) in a yeast artrfictal chromosome conttg spamnng 1 2 Mb Genomzcs l&627-635.

CHAPTER17 Fragmentation and Integrative Modification of YACs Jennifer W. McKee- Johnson and Roger H. Reeves 1. Introduction The very large cloning capacity of yeast artificial chromosomes (YACs) has facilitated the analysis of complex genomes by bridging physical and genetic maps. The large size of YAC inserts also creates some unique problems, including identification of novel genes on large stretches of uncharacterized DNA, creating physical maps of large genomic inserts in YACs, and localizing defined sequences within the YAC. The well-characterized and highly efficient system of homologous recombination in Saccharowlyces cerevisiae (1,) can be used to introduce additional markers (e.g., neoR cassette, polylinkers, bacterial markers) and modifications to YACs that allow these problems to be addressed. This chapter covers fragmentation and integration, two recombination-based techniques for modifying the insert DNA and vector arm sequences of YACs. Specialized vectors containing cloned repetitive elements or sequences specific to YAC vector arms can recombine with homologous sequences in the YAC (2). Repetitive sequences are ideal for recombination-based modification because they are present at a high copy number and sufficiently widespread in the genome that most YACs will contain multiple representatives of these families. From. Methods m Molecular Biology, Vol 54’ YAC Protocols Edlted by D Markie Humana Press Inc., Totowa, NJ

167

168

McKee- Johnson and Reeves 1.1. Fragmentation

Chromosome fragmentation vectors (CFVs) were designed to facilitate the generation of physical maps of yeast chromosomes (3). CFVs contain a minimal yeast telomere, a yeast selectable marker, and a mammalian targeting sequence.Pavan et al. (4) designed vectors that use human repetitive elements to target recombination to homologous sequences in the inserts of human-derived YACs. These CFVs are linearized between the telomere and targeting sequence.When introduced into yeast, one end of the vector is quickly healed into a stable telomere, while the free end is highly recombrnogenic (Fig. IA). Recombination between the targeting sequencein the vector and homologous sequenceson the YAC introduces a telomere at that site and results in loss of sequencesdistal to the site of recombmation, including the original vector arm and selectable marker (Fig. 1B). (CFVs that include a centromere will delete sequencesproximal to the site of recombination.) The result is a set of nested deletions along the YAC that can be used to orient and localize genes, eliminate chimerrc segments, generate new markers, map exons by using a cDNA to target homologous recombination, and develop restriction maps. New subclones and sequencetagged sites (STSs) of the YAC can be generated by recovery of end plasmids from deletion derivatives (see Chapter 14). The products of fragmentation are selected based on the presence of the yeast selectable marker in the CFV and screened for loss of the original YAC vector arm marker. CFVs may be centric or acentric permitting fragmentation from both ends of the YAC. Fragmentation by an acentric CFV in an orientation that deletes the centric arm of the YAC will result in acentric recombinants that will be lost because of mitotic instability. Dicentric products generated usmg a centromere-containing fragmentation vector will also be unstable. Many of the available YAC libraries have been constructed using the pYAC4 cloning vector in the yeast strain, AB 1380. AB 1380 contains several selectable markers in addition to the URA3 and TRpl auxotrophies utilized by the YAC. All of these are point mutations that revert at some frequency or, more frequently, can be corrected by gene conversion with the correspondmg selectable marker on the CFV. Where the targeting sequence in the CFV and the target on the YAC share a long stretch of homology, this background presents no problem. However, in conditions where homologous recombination is suboptimal, for example, where the

Modification

of YACs

169

polylinker

Fig. 1. Fragmentation. (A) “Generic” CFV, pBPlO3, includes a telomere, the HIS3 yeast selectable marker, bacterial ampand orz’sequences,and a polylinker for introduction of a targeting sequence (5). (B) Fragmentation of a YAC at repetitive elements using CFVs with target sequences in opposite orientations will produce a nested deletion series. target is small (e.g., when an exon in genomic sequence is targeted by a cDNA) or diverges significantly from the target sequence (e.g., many repetitive element families), it is desirable to have a nonreverting marker with no homology to the CFV. A variety of yeast strains deleted for several markers have been constructed for use in this circumstance (Table 1). The

Table 1 Used in YAC Clonmg

Yeast Straw Strain

2

Genotype

ATCC#

AB1380”

MATa

ura3-5

trpl

ade2- I

canl-I 00

lys2-I

his.5

~PH857~

MA Ta

ura3-52

trpl-A63

ade2-101

cyh2R

lys2-801

hu3-A200

leu2-Al

16628

CGY2516

MA Ta

ura3-52

trpl-A63

Iys2&02

hls3-A200

leu2-Al

74013

yPH274

MATa MATa

ura3-52 ura3-52

trpl-A63 trpl-A63

hzs3-A200 hu3-A200

leu2-Al leu2-Al

76622

ade2-101 ade2-201

%oleucme and threomne should also be included m selectwe media for growth byPH925 is yPH857 with the addlhonal mutation m SARI, see Chapter 22

20843

Modification

of YACs

171

pBP series of CFVs employ the HIS3 gene as the selectable marker for fragmentation products. To use these vectors, YACs harbored in AB 1380 are first transferred to a his3 background, such as yPH925. This can be accomplished readily using the KAR-mediated transfer protocol (8,) described in Chapter 22. The his3A200 background is advantageous because the 3-kb deletion in the HIS3 gene cannot revert or be corrected by gene conversion and therefore background is reduced. Where less stringent conditions for homologous recombination are acceptable, several CFVs are available that complement the ly.s2-801 point mutation in AB 1380 (Table 2). Fragmented YACs, selected on the basis of the CFV marker and screened for the loss of the marker on the deleted YAC arm, are separated by pulsed field gel electrophoresis (PFGE) and analyzed with probes specific for the CFV and the retained vector arm (Fig. 2A). By comparing the sizes of multiple deletion derivatives, a map of recombination sites can be assembled. Unique sequence probes can be localized on the map by typing the set of fragmented YACs for the presence or absence of hybridization. Finer scale mapping of the parental YAC is achieved through restriction mapping of the deletion derivatives. For a given restriction fragment in an acentric fragmentation series, if recombination occurs distal to the fragment, its size will be unchanged. Recombination within the restriction fragment will reduce its size, and recombination proximal to the restriction fragment will eliminate it (4). Additional inforrnation can be gained by hybridizing conventional Southern blots of fragmentation derivatives with repetitive elements (Fig. 2B). Members of the human Alu element family are present on average every 4-5 kb in the genome; therefore, a human-derived YAC insert will nearly always contain a number of Alu elements. Each YAC and its derivatives will have a “repeat sequence profile.” As the size of the deletion derivatives decreases, a greater subset of the repetitive elements will be lost. 1.2. Integration Integrating vectors (IVs) can be used to isolate YACs containing specific inserts from a library (9), to create internal deletions in a YAC by targeting recombination to noncontiguous segments of the insert DNA (10, I I), to introduce site-specific mutations by a two-step gene replacement (12), and to insert new markers into the YAC (e.g., mammalian

Table 2 Chromosome Fragmentatton Vectors Name

Vector type

Target sequence

Selectable marker

Enzymesa

Refs.

ATCC#

5

77087

5

77088 77089

Rothstem, submitted

n/a

pBP1133~

Fragmentation

(Polylinker for insertmg any targeting sequence)

HIS3

~BPl08~, pBPlOsd

Fragment&on

300 bp Human Ah element

HIS3

San

pWJ522, pWJ528

Fragmentatton

130 bp Mouse B 1 element

HIS3

SaNXiioI

pBCL

Fragmentation

300 bp Human Ah element

LYS2

SalI

6

pBlF, pBlR

Fragmentation

130 bp Mouse B 1 element

LYS2

San

Edmonson et al., submitted.

pRS3 13

Transformanon control

HIS3

7

77142

pRS317

Transformation control for LYS2 CFV

LYS2

7

77157

%&cated restriction enzyme yields hnear molecules sunable for transformation bReplaces pBP62 (4) ‘Replaces pBP63a (4) dReplaces pBP63b (4).

n/a

Modification

A

of YACs

B 23kl

45Okb 360kb 310kb

4kb

15Okb

Fig. 2. Analysis of fragmented YACs. (A) PFGE analysis of fragmentation derivatives of 450 kb YAC, 4B4, hybridized with the centric YAC arm probe (Table 3). The parental yeast strain, yPH925, contains no YAC and gives no signal with this probe. (B) EcoRI digest of successively smaller fragmentation derivatives of 4B4 hybridized with a repetitive DNA element. selectable markers) (4,1.?). In each case, an IV is linearized to expose two ends of a linear molecule with homology to sequences on the YAC. Recombination introduces a yeast selectable marker. In the specific examples used here, an IV containing a HIS3 selectable marker is targeted to repetitive elements in the YAC insert or to the YAC vector arm, depending on the enzymes used to expose the appropriate targeting sequences. Products of this recombination are selected for the presence of yeast selectable markers from both YAC arms and the IV. The result is a duplication of the target sequence with the IV selectable marker between the recombination sites (see Fig. 3 on page 176). Selected YACs are further analyzed by PFGE and generation of an “Ah profile” to confirm proper targeting and integrity of the YAC. Note that the use of different IVs for different purposes will require corresponding changes in selective medium, restriction enzymes used for analysis, and so on (Table 3). The following examples pertain specifically to pBP47 (Fig. 3A) targeted to Ah sequences or to the YAC vector arm as indicated.

Table 3 Integration Vectors Name pICL

Target sequence AmpR on centric pYAC4 arm,

Enzymea

Selection

Refs

ATCC#

ScaI

LYS2

14

77408

adds polylinker PLUS

Residual tetR on acentw pYAC4 arm, adds ampR and bacterial on

SalI

LYS2

14

n/a

pCGS990

CEN on centric pYAC4 arm,

SaZI

LYS2

15

n/a

EcoRIb

HIS3

9

77082

HIS3

28

87028

replaces entire arm and adds amplifiable CEN pBP47

AmpR on centrtc pYAC4 arm,

adds neoR cassette pDC47

PVUIC

As for pBP47 but uses a polI1 promoter for neoR

SmaIb

pLNA

300 bp human Ah element, adds neoR

NorIb ScaIC

LYS2

16

n/a

pLUNA

URA3 on acentric pYAC4 arm, adds neoR, ampR, and bacterial on

ApaI

LYS2

16

nla

PRAN4

pBR322 sequence on acentrtc pYAC4 arm, adds neoR, ampR, and bacterial on

BamHI

ADE2

17

77481

TICLU2

URA3 on acentric pYAC4 arm, adds thymldme kinase (TK) gene

HzndIII

uRA3

18

n/a

pRVl

URA3 on acentrtc pYAC4 arm, adds neoR

HzndIII

LYS2

19

n/a

PVUIC

pRV2

Human L 1 repetitive element, adds neoR

EcoRI + BumHI

LYS2

19

nfa

pLNA1

Am9 on centric pYAC4 arm, adds neoR

AatII

LYS2

20

n/a

pLNT2

Residual tetR sequence on acentric pYAC4 arm, adds neoR, ampR, and bacterial OYZ

EcolU

LYS2

20

n/a

pLNE3 1

Human Ah element, adds neoR

EcoRI

LYS2

20

n/a

a Indtcated enzyme yields lmear molecules swtable for tmnsformatlon. b Lmeanzation with tks enzyme targets human Ah sequences. c Lmeanzatlonwith this enzymetargetsam$ sequences m the centric YAC arm

176

McKee- Johnson

BUliHl

and Reeves

HIS3

B

Fig. 3. Integration. (A) The IV plasmid, pBP47, is used to insert the neoR mammalian selectable marker into YACs. This vector targets insertion to Ah sequences when linearized with EcoRI, or to the acentric pYAC4 vector arm when linearized with PvuI. (B) Integrative modification targeted to repetitive elements in the YAC insert.

2. Materials 2.1. Lithium

Acetate

(LiOAc)

Transformation

1 O.lM LiOAc: 5.01 g LiOAc in 500 mL sterile, distilled H20. Filter sterilize and store at room temperature. 2. 40% Polyethylene glycol (PEG): Bring 40 g PEG, average mol wt 3350

Modification

of YACs

177

Table 4 Probes Commonly Used for Analysis of Modified YACs Name HIS3 LYS2 uRA3 TRPI

Acentric YAC arm probe Centric YAC arm probe NeoR

(Sigma,

3.

4. 5. 6. 7. 8. 9. 10.

Plasmld

Enzvme BamHI EcuRV

Size

Refs.

ATCC#

1.7 kb

2.5 7 25

77157 77305

25 26

77306 31344

pJJ2 17 pRS317 pJJ244 pJJ280 pBR322

PvuIIISa A

1.1 kb 0.9 kb 1.4 kb

pBR322

PvuIVEcoRl

2 3 kb

26

31344

pHIS3pol2neo

BaZIEcoRI

0.8 kb

27

n/a

4.0 kb

SmaI

EcoRI

St. LOUIS, MO) to a volume

of 100 mL in 10 mh4 Tris-HCl,

77304

pH

7.5. Adjust pH to 7.5, filter sterilize (do not autoclave), and store in 10-mL aliquots at -20°C. Frozen altquots are stable for several months. Replicator and sterile velvets: A replicator can be purchased from Owl Scientific Products, Inc. (Cambridge, MA). Purchase velvet by the yard from a fabric store and cut into 13 x 13 cm squares. A dark color of velvet is preferable for seeing the yeast. Used velvets should be soaked in diluted Lysol(25 mL/L) nnmediately after each use, washed using hot water and no soap, dried, and autoclaved m alummum foil. PCI: phenol, chloroform, isoamyl alcohol (volume ratios of 25:24: 1). CI: chloroform, isoamyl alcohol (volume ratios of 24: 1) RestrictIon enzymes, various suppliers. 3MNaOAc pH 6.0 (adjusted with acetic acid). 95% Ethanol. TE: 10 mMTris-HCl, 1 WEDTA, pH 8.0. AHC and SD medium: See Chapter 29.

2.2. Analysis

of Modified

Refer to Table 4 for information mented YACs.

YACs

on probes used in analysis of frag-

3. Methods 3.1. Preparation of Vector DNA for Transformation Any type of plasmid isolation protocol that provides clean, concentrated DNA is acceptable for vector preparation.

178

McKee- Johnson and Reeves 3.1.1. CFV and IV Preparation

1. Digest 50 pg of plasmid to completion with the appropriate restriction enzyme(s) (see Table 1). Linearized vector can be stored frozen so large digests can be prepared. 2. Heat inactivate restriction enzymeper the manufacturer’s recommendations. 3. Remove a small alrquot for electrophorests to check completeness of digest. If there is any circular DNA remaining, repeat the digest. Any remaining circular DNA will transform at a high efficiency, resulting m a high background. 4. Extract digested DNA with an equal volume of PCI. 5. Extract once with an equal volume of CI. 6. Add l/10 volume 3M NaOAc and 2 volumes cold 95% ethanol. 7. Chill at least 30 min at -20°C. 8. Collect precipitate by centrifugation at htgh speed for 15 mm m a 4°C microcentrifuge. 9. Pour off supernatant and an dry pellet. 10. Resuspend m 50 pL of TE to give a concentration of approx 1 pg/pL. 11. Store at -20°C until use. 3.2. Lithium Acetate Transformation of Yeast A variety of methods are available for transformation of yeast including electroporation (21,22), spheroplast transformation (231, and lithium acetate. The lithium acetate protocol presented here is an adaptation of the protocol described by Ito et al. (24) and is technically simple, reproducible, and requires no special equipment. Transformation efficiencies are on average lO-lo3 colonies per microgram of yCP test plasmid (Table 1). 1. Inoculate 5 mL of selective media (AHC or SD + supplements) with a “matchhead” of yeast from a fresh plate. Incubate overnight at 30°C with vigorous shaking. 2. Add the 5-mL overnight culture to 45 mL of fresh selective media. Incubate 2-6 h at 30°C with shakmg. 3. Check the ODboOusing a spectrophotometer. The ideal range for this protocol is OD,,a 1-2; however, cultures with ODs as low as 0.4 can be used with a slight decrease m efficiency. 4. Transfer the culture to a 50-mL screwtop tube and collect cells by centrifugation at 2000g for 5 min at 4°C. 5. Decant the supernatant. Resuspend cells in 10 mL of 0.M LiOAc by pipetmg or gentle vortexmg.

Modification

of YACs

179

6. Collect cells by centrifugatlon at 2000g for 5 mm at 4°C. 7. Decant the supernatant and resuspend cells in 10 mL 0. IM LiOAc. Incubate at 30°C for 1 h without shaking. Alternatively, cells can be stored at 4°C overnight with no effect on transformation efficiency. 8. Collect cells by centrifugation at 600g for 5 min at 4°C. 9. Decant the supernatant and resuspend cells in 0. 1M LiOAc using a pipet. 10. Aliquot 50 pL of cells into Eppendorf tubes. 11. Add prepared vector DNA and carrier DNA as needed. Use 0.5-2.0 pg of circular test plasmid DNA (Table 1) as a transformation control. Vector concentrations should be titrated (see Note 1). 12. Incubate 10 min at room temperature. 13. Add 0.5 mL of 40% PEG, pH 7.5 that has been warmed to room temperature. Always use a fresh aliquot of PEG; pH is cntical. 14. Mix by vortexing or repeated inversion. 15. Incubate 1 h at 30°C. 16. Heat shock in a 42’C water bath for 5 min. This step 1sessential(see Note 2). 17. Top off tube with sterile, distilled H,O. Mix by inversion. 18. Collect cells by centnfugation at high speed for 5 s in a microfuge. 19. Decant supematant and resuspend cells in 1.OmL sterile, distilled H20. 20. Collect cells by centrifugation at high speed for 5 s in a mlcrofuge. 21. Decant supematant. Resuspend cells m 0.1 mL sterile, distilled HzO. 22. Spread each 100 PL of cells on a 100-mm selective plate (e.g., when using a pBP 100-series CFV, use an appropriately supplemented SD plate lacking histidine). At this step, select only for the CFV or IV marker, not the YAC markers. Incubate inverted at 30°C. Colonies should be visible in 2-5 d (see Notes 2 and 3). 3.3. Identification of Fragmented YACs 3.3.1. Auxotrophic Analysis 1. Using sterile toothpicks or an inoculating loop, pick colonies onto a plate that selects for the presence of the CFV marker and the retained YAC vector arm marker (U&I3 or TWI). 2. Incubate overnight at 30°C. 3. Use a replicator to plate colonies onto a plate that selects for the lost vector arm marker. This step is essential as up to 30% of colonies may possessall three markers. 4. Incubate overnight at 3O’C. 5. Select for expansion and further analysis those colonies showing the appropriate auxotrophies/prototrophies (see Note 4).

180

McKee-Johnson

and Reeves

3.4. Analysis of Fragmented YACs Fragmented YACs are analyzed by PFGE to determine the sizes of deletion derivatives and to assurethat each strain contains only one YAC, and by probing conventional Southern blots with repetitive elements (human Alu or mouse B 1 elements) to confirm that each fragmented YAC is a member of a nested deletion series. 3.4.1. PFGE Analysis

Refer to Chapter 7 for information on making high mol wt DNA plugs and performing PFGE. Select PFGE conditions that will yield the greatest separation of fragments smaller than the parental YAC. Some fragmentation derivatives may be visible under UV light after ethidium bromide staining; however, others may be obscured by comigrating yeast chromosomes. Transfer of the large DNA fragments to filters is facilitated by treatment of the gel with 0. 1N HCl for 20 min prior to denaturation. PFGE blots of CFV derivatives should include the unfragmented YAC and parental yeast strain without a YAC, and are analyzed using the following probes (Table 4) in the order listed (see Note 5). 1 Probe 1: Selectable marker from the retained YAC vector arm. Thus probe will hybridize to the mutant endogenous gene as well as the fragmented YACs. Hybridtzatton to the parental (unfragmented) YAC permits better comparison of size changes and determination of the number of YACs. 2. Probe 2: CFV marker (e.g., the HIS3 gene for the pBP-100 series vectors). This probe should colocahze with the vector arm marker indicating proper targeting of the CFV to the YAC. 3. Probe 3: Deleted YAC vector arm marker. This probe should only hybridize to the parental YAC and, depending on the probe and strain, to the endogenous yeast gene. 4. Probe 4: Sequences specttic to the YAC insert (unique or repetitive elements). The presence or absence of hybridization of these probes to a panel of fragmentation dertvattves can be used to localize and orient unrque sequences on the YAC, whereas repetitive sequences should identify all but the shortest dertvattves. 3.4.2. Repeat Sequence Profile by Conventional Southern Blotting

Refer to Chapter 7 for information on restriction digestion of high mol wt DNA prepared in agarose plugs (see Note 6).

Modification

of YACs

181

1. Digest DNA from CFV products to completton (2-16 h) with a 6-base cutter restriction enzyme. Include DNA from the parental YAC and the background yeast strain without a YAC as controls. 2. Separate the restrictton fragments on a 1% agarose gel. 3. Denature, neutralize, and transfer to nylon or nitrocellulose membrane. 4. Probe with repetitive elements. 3.5. Integrative

Transformation

Vectors are prepared as described in Section 3.1. using appropriate restriction endonucleases (Table 3). Lithium acetate transformation is accomplished as described in Section 3.2. At step 11, use 2-5 pg of pBP47 linearized with EC&I (to target integration to AZu elements) or PvuI (to target integration to plasmid sequences in the centric arm of pYAC4). 1. 2. 3. 4. 5.

3.5.1. Auxotrophic Analysis Using a sterile toothpick or inoculating loop, pick colonies onto a plate that selects for the presence of the IV marker and the U&t3 gene from the YAC vector arm. Grow overnight at 30°C. Replicate colonies onto appropriately supplemented SD plates lacking htstidine, tryptophan, and uracil. Grow overnight at 30°C. Colonies that exhibit all three prototrophies should be selected for further expansion and analysis. 3.5.2. PFGE

Protocols for making high mol wt DNA plugs and PFGE are provided in Chapter 7. PFGE conditions should be selected to expand the region of the electrophoretic karyogram including the YAC. The gel should be blotted and analyzed with the following probes (Table 4) (see Note 7). 1. Probe 1: U.3 or TRPl. These probes will hybridize to the parental as well as modified YACs; the sizes should all be approxrmately the same. 2. Probe 2: IV marker. This can be the yeast or mammalian selectable marker. This probe will hybridize only to targeted YACs and the signal should colocalize to the same position as the UK43 and TRPl probes. 3.5.3. Conventional Southern Analysis

Refer to Chapter 7 for restriction endonuclease digestion of high mol wt DNA plugs. IVs can be targeted to repetitive elements within the YAC

McKee- Johnson and Reeves

182

insert or to sequences in the YAC vector arm. Both cases will be considered here using pBP47 as an example. 1. Digest the high mol wt plug DNA with BamHI, with CZaI, and with a third enzyme that provides a good Alu profile of the YAC. Controls include DNA from the background yeast strain and cells containing the parental Y AC. 2. Separate restriction fragments on a 1% agarose gel. 3. Denature, neutralize, and transfer to nylon or nitrocellulose. 4. Hybridize with the following probes (Table 4): a. Probe 1: TRPI. This probe is mformative for the CM digest of YACs with pBP47 targeted to the YAC vector arm. A YAC made m pYAC4, digested with &I, and hybridized with TRPl, will give a 5.9-kb band. Integration of pBP47 mto the TRPI arm of pYAC4 will cause this band to shift to 12 kb, mdicating proper targeting of the IV. If a band shift occurs for this probe when targeting pBP47 to repetitive elements improper integration has occurred. b. Probe 2: IV specific probe. For pBP47, this can be either the yeast (‘15’31 or mammalian selectable marker (neoR). BumHI digests of strains from pBP47 targeted to repetitive elements will yield a 6.1-kb band representing most of the IV when integration is targeted to an Ah sequence (or sequences). c. Probe 3: Ah (repetitive) element. Alterations to the AZu profile should be minimal. If the IV is targeted to repetitive elements, restriction enzymes that cut in the IV should yield two new Alu-containing fragments because integration reduplicates the target sequence but changes the restriction sites around both. (Note that these can be the same size as one of the original Ah profile bands and thus may not be obvious.) An enzyme that does not cut IV or Ah sequences will give an AZu profile with a size change in only one Ah element. If pBP47 IS targeted to the vector arm, there will usually be no change in the repetitive element profile beyond the addition of the Alu element in the IV. Loss of several bands from the Ah profile suggeststhat each end of the ltnearized vector targeted a different Alu element, deleting the intervening sequence. These YACs should be discarded (see Note 8) 4. Notes 4.1. Lithium Acetate Transformation 1. Titration of vector: The optimal amount of linearized CFV or IV used in

eachtransformation serieswill vary between strains and transformations. A range of concentrations including 0.5, 1, 2, and 5 pg per reaction is

Modification

of

YACs

183

recommended. For smaller amounts of vector ( 2.0. It may take 2 d to overcome the growth lag caused by transfer from glucose to

Amplification

of the Copy Number of YACs

235

galactose as a carbon source. The rate of growth also depends on the yeast host strain and its ability to use galactose as a carbon source. Saturation is reached at a lower cell density than is observed durmg growth m glucosesupplemented media. 6. Subculture at l/100 dilution, transferring 50 pL of the culture directly into 5-mL amplification medium. If using only one round of growth in methotrexate and sulfamlamtde, subculture at l/200. Use 2X concentration of sulfanilamtde, methotrexate, and thymidme for inefficient galactose users such as AB 1380 (see Notes 3-5). 7. Grow with aeration at 30°C until saturation (ODeoO> 2.0). This usually takes longer than 2 d, especially for inefficient galactose users because the amplification medium strongly mhibits growth. Growth m the amplification medium also changes the morphology of the cells that form large clusters and chains. 8. Subculture at l/10 dilution, transferring 0.5 mL mto 5 mL fresh amplification medium. This second subculture increases the copy number in yeast host strains that grow well in galactose. It may be omitted, depending on the amount of amplification desired and the host strain. 9. Grow cells until saturated to ODboO> 2.0. This usually takes another 2 d (see Note 6). 10. Subculture at l/100 dilutton, transferring 50 FL mto 5 mL of YPD or AHC medium (see Note 7). 11. Grow until saturated. This usually only takes a day because the cells grow faster and revert to a nearly normal morphology m this nonselective growth medium. This step increases the efficiency of cell wall digestion by lytic enzyme with minimal loss of ampltficatton. Cells that have gone through thts subculture in YPD should not be regrown m amplification medium because this can cause instability and deletions in YACs. 12. Harvest cells by centrifugation. Prepare the yeast genomic DNA in agarose plugs (see Chapter 7). 13. Measure the amount of copy number amplification by pulsed field gel electrophoresis of amplified and unamplified samples followed by ethidium bromide staining. 14. Expect an amplification of 10-25 copies for most YACs, with those in AB 1380 falling at the lower end of the range (see Note 8).

4. Notes 1. The selective plates can be made with 2% galactose substituted for glucose, for clones that grow well on galactose. 2. Yeast cells grow better at a fairly heavy initial inoculum.

Ling, Smith, and Moir 3. For amplification in strams that grow poorly on galactose, such as AB 1380, it ts most convenient to subculture only once at l/100 dilution m amplification medium supplemented with twice the concentration of sulfanilamide, methotrexate, and thymidine. Let the culture grow to saturation as described in Section 3., step 7, skip steps 8 and 9, and proceed to step 10. 4. For amplification of copy number in microtiter plates, grow cells overnight in AHC medium with 2% galactose as the carbon source in place of glucose, subculture at l/l 00 dilution into amplification medium, and grow until the bottom of the wells are covered with cells. 5. For amplification on agar plates, patch or replica plate the clones onto amplification medium supplemented with twice the concentration of sulfamlamide, methotrexate, and thymidine in 2% agar. Let the cells grow for 4-7 d until sizable colonies are seen. The colonies or patches will have a yellowish color. Replica plate to YPD plates and grow overnight before use. 6. The cells in amplification medium can be harvested by centrifugation and stored frozen in 15% glycerol at -70°C for later regrowth in YPD. 7. The cells reach a higher density with growth in YPD than in AHC medium without any significant loss of amphtication. 8. Low amplification may be owing to insufficient growth m the amplification medium. To boost amplification, cells from the first or second subculture m amplification medium can be further grown in amplification medium with a higher concentration of sulfamlamide, methotrexate, and thymidine. References 1. Burke, D. T., Carle, G. F., and Olson, M. V. (1987) Cloning of large segmentsof exogenousDNA into yeastby means of artificial chromosomevectors. Science 236,806-8 12 2. Coulson, A., Waterston,R., Kiff, J., Sulston,J., and Kohara, Y (1988) Genome linking with yeastartificial chromosomesNature 335, 184-I 86. 3 Guzman,P. andEcker,J. R (1988) Development of large DNA methodsfor plants. molecular cloning of large segmentsof Arubidopsis and carrot DNA into yeast. Nuclezc Acids Res. 16, 11,09l-l 1,105 4. Brownstein, B. H., Silverman, G. A., Little, R. D., Burke, D. T., Korsmeyer, S. J., Schlessmger,D., and Olson, M. V. (1989) Isolation of single-copy human genes from a library of yeastartificial chromosomeclones.Scrence 244, 1348-1351. 5 Smith, D. R. (1994) Vectorsand host strainsfor cloning and modification of yeast artificial chromosomes,in YAC Libraries A User’s Guide (Nelson, D L. and Brownstem, B. H , eds.),Freeman,New York, pp. 1-31. 6. Fangman,W. L., Hice, R. H., and Chiebowicz-Steclziewska, E. (1983) ARS replication during the yeastS phase.Cell 32,83 l-838.

Amplification

of the Copy Number of YACs

7. Clarke, L. and Carbon, J. A. (1980) Isolation of a yeast centromere and construction of functional small crrcular chromosomes. Nature 287,504-509. 8. Murray, A. W., Schultes, N. P., and Szostack, J. W (1986) Chromosome length controls mitotic chromosome segregation in yeast. Cell 45,529-536. 9. Hieter, P., Mann, C., Synder, M., and Davis, R. (1985) Mitotrc stability of yeast chromosomes: a colony color assay that measures nondisjunction and chromosome loss. Cell 40,38 l-392 10. Smith, D. R., Smyth, A. P., and Moir, D. T. (1990) Amplification of large artificial chromosomes. Proc Natl. Acad. Sci. USA 87,8242X3246. Il. Chlebowicz-Sledziewska, E. and Sledziewski, A. Z. (1985) Construction of multicopy yeast plasmids with regulated centromere function. Gene 39,25-3 1. 12 Hill, A. and Bloom, K. (1987) Genetic manipulation of centromere function. Mol. Cell. Blol. 7,2397-2405.

13. Beggs, J. D. (1978) Transformation of yeast by a replicating hybrid plasmid. Nature 275, 104-109. 14. McNeil, J. B. and Friesen, J. D. (1981) Expression of the herpes simplex virus thymidme kinase gene in Saccharomyces cerevulae. MOE Gen Genet 184,386-393. 15. Zealy, G. R., Goodey, A. R., Piggot, J. R., Watson, M. E., Cafferkey, R. C., Doel, S. M., et al. (1988) Amplification of plasmid copy number by thymidme kmase expression in Saccharomyces cereviszae. Mol Gen. Genet 211, 155-159. 16. Zhu, J., Contreras, R., Gheysen, D., Ernst, J., and Fiers, W. (1985) A system for dominant transformation and plasmid amplification m Saccharomyces cerevuiae. Bzo/Technology 3,45 l- 456. 17. Murray, A. W. and Szostack, J. W. (1987) Pedigree analysis of plasmid segregation in yeast. Cell 34,96 l-970. 18. Grivell, A. R. and Jackson, J F. (1968) Thymidine kinase: evidence for its absence from Neurospora crassa and some other microorgamsms, and the relevance of this to the specific labellmg of deoxyribonucletc acid J. Gen Mcroblol 54,307-3 17. 19. Goodey, A. R., Doel, S. M., Piggot, J. R., Watson, M. E. E., Zealy, G. R., Cafferkey, R., and Carter, B. L A. (1986) The selection of promoters for the expression of heterologous genes in the yeast Saccharomyces cerevwae. Mol Gen Genet. 204, 505-511. 20. Smith, D. R., Smyth, A P , and Moir, D. T. (1992) Copy number amplification of yeast artificial chromosomes Methods Enzymol. 216,603-614. 21. Smith, D. R., Smyth, A. P., Strauss, W. M., and Moir, D. T. (1993) Incorporation of copy-number control elements into yeast artificial chromosomes by targeted homologous recombination. Mammal. Gen. 4, 141-147. 22. Moir, D. T., Dorman, T. E., Smyth, A. P., and Smith, D. R. (1993) A human genome YAC library in a selectable high-copy-number vector. Gene 125,229-232.

CHAPTER22

Transfer of YAC Clones to New Yeast Hosts Forrest

Spencer

and

Giora

Simchen

1. Introduction

Yeast artificial chromosome (YAC) clones are propagated in yeast, a host organism with a variety of established techniques for altering DNA sequences by homologous recombination in vivo. The modification of existing YAC clones allows the removal of undesired insert DNA (e.g., neighboring coding sequences or chimeric segments), the introduction of new selectable markers, or the replacement of wild-type DNA with defined mutant alleles. To use existing vector systems for YAC manipulation by homologous recombination, transfer to other yeast hosts is often necessary. The development of alternative host strains has been motivated in part by the paucity of nonreverting genetic markers in the genotype of the common library host AB1380 (1). In addition, clones with unstable inserts may be more faithfully propagated in recombinationdeficient yeast strains (see, e.g., 2-4). At this time, three different methods for transfer of YACs to new hosts have been described. Two commonly used methods are transfer by traditional genetic cross (spore colony analysis after mating and meiosis) and yeast transformation with chromosome-sized DNA molecules. These techniques work well, but present significant technical barriers to use by laboratories not routinely applying them. The manipulations involved in these two methods are described in detail in Chapters 1 and 19 and in brief descriptions presented at the end of the Methods section. For most purposes, a newer method, transfer by Karl- mating, will be more efficient. This method From Methods m Molecular Bology, Vol 54 YAC Protocols Edited by D Markle Humana Press inc , Totowa, NJ

239

240

Spencer and Simchen

employs simple microbiological techniques (yeast culture and the use of selective media) and is described in detail herein. After transfer by any method, the presenceof a YAC clone of expected structure should be veritied by analysis of the electrophoretic karyotype of the recipient yeast strain. In examples described herein, AB 1380 serves as the YAC donor, and YPH857 (or related strain YPH925) as the new host. For YAC modification, the most useful new genetic markers in these strains are his3A200, leuddl, and cyh2R. his3A200 is a nonreverting complete gene deletion that will support the efficient recovery of relatively rare recombination events, e.g., those that must occur through sequences with imperfect homology, such as human Alu repeats (5). Using this marker, false-positive background transformants (owing to reversion or gene conversion from the introduced HIS3 gene copy) are not observed. The pair of markers leu2Al and cyh2R can be used to provide the sequential positive and negative selections employed in a two-step replacement paradigm (6,7) for the introduction of defined DNA sequence modifications. YPH925 is YPH857 after introduction of the mutation karl Al 5. 1.1. Transfer by Karl- Mating In this method, a YAC is transferred between nonfused nuclei in a defective mating (from donor to recipient), and cells of the recipient genotype with the newly introduced YAC are identified as viable colonies on selective medium. Laboratory yeast can be cultured in either haploid or diploid phases of the life cycle (8). When yeast cells from haploid strains of opposite mating type encounter one another, they will fuse to form diploid cells. The processes involved in cell fusion include directed cell growth resulting in “schmoo” formation, cell/cell adhesion and the degradation of cell walls at the schmoo tips, plasma membrane and cytoplasmic fusion to form a heterokaryon, and nuclear fusion (karyogamy) mediated by a spindle-like microtubule-based structure. The yeast KARl gene was first identified in a mating defective mutant that formed heterokaryons, but failed in nuclear fusion (9). Subsequent studies have shown that the IURI gene encodes a polypeptide that is essential for viability and is associated with the yeast microtubule organizing center (IQll). A subset of karl mutants, however, are fully viable and exhibit only the defect in nuclear fusion during mating, as observed for cells carrying the original mutant allele.

Transfer of YAC Clones to New Yeast Hosts YAC transfer by Karl- mating is illustrated in Fig. 1. To initiate the process, donor strain cells are mixed with recipient cells in approximately equal numbers and allowed to mate. In a Karl- mating, cellular fusion produces heterokaryons with normal frequency, but processes required for nuclear fusion are highly defective. Therefore, true diploids form rarely (from -1% of heterokaryons), whereas -99% of heterokaryons generate daughter cells that inherit a nucleus of one (either) parental genotype. This is indicated in Fig. 1 by the heavy arrow in the nonfusion pathway. Most daughters from a nonfusion heterokaryon will exhibit a nuclear genotype identical to either parent in a mixed cytoplasmic environment (9). These are referred to as “cytoductants.” At a low frequency, cytoductants are produced that have inherited a chromosome from the opposite parent: approx 0.1% of cytoductants exhibit acquisition of a given transferred chromosome. These have been referred to as “chromoductants” (12). YACs can also be transferred (13) and cytoductants that have acquired a YAC have been called “YACductants” (1#,15). The molecular events that result in chromosome transfer in Kar l- matings are not well understood. For YAC transfer by Karl- mating, the donor and recipient strains must have several properties. They must be haploid yeast strains of opposite mating type, and at least one of the two must be Karl-. The recipient strain must contain a recessive drug resistance marker, such as canlR (resistance to the poisonous arginine analog, canavanine) or cyJ~2~ (resistance to cycloheximide). The yeast CANI gene encodes argmine permease (Id), and cad mutations provide recessive drug resistance because a single wild-type allele will allow lethal canavanine uptake. The yeast CYH2 gene encodes the ribosomal protein L29, which can mutate to cycloheximide resistance (17). cyJ~2~mutants are recessive, presumably because the presence of cycloheximide sensitive ribosomes on polysomes prevents the resistant ribosomes from completing translation. This recessive resistance conferred by either of these markers provides a means of selection for the recipient strain genotype in haploid state. The recipient must also contain an auxotrophic marker (e.g., ura3) that can be complemented by a prototrophic allele present on the YAC to be transferred (e.g., URA3). Thus, among products generated in a Karlmating, YACductants are identified as cells that simultaneously exhibit drug resistance (unlike true diploids, or the parental donor strain), and YAC marker prototrophy (unlike the parental recipient strain).

242

Spencer and Simchen

DONOR --DRUGSENSITIVE(DOMINANT) --YACMARKERPROTOTROPHY

RECIPIENT &a+

Cvh s ii;’

--DRUGRESlSTANT(RECESSIVE) --YACMARKERAUXOTROPHY

CyhR Ura‘Trp‘

HETEROKARYON

HAPLOIDPRODUCTS

Cytoductants

Normal Diploid --DRUGSENSITWE Cyhs --YACMARKERPROTOTROPHY

Iho+ Trp+

-- DRUGRESISTANT CyhR --YACMARKERAUXOTROPHY OR --DRUGSENSITIVE Cyhs --YACMARKERPROTOTROPHY

Ura-Tq-

Um+Ttp+

YACductant -_DRUGRESISTANT CykR --YACMARKERPROTOTRPHY

Ura+ Trp+

Transfer of YAC Clones to New Yeast Hosts

243

In practice, a variable but significant fraction (range 3080%) of colonies resulting from this double selection are found to be bona fide YACductants on analysis of their electrophoretic karyotype (‘#,15). The remainder are principally derived from diploid cells that have become drug resistant owing to loss of the dominant sensitivity allele. (This may have occurred by loss of the chromosome with the sensitive allele, segregation after mitotic recombination to produce homozygous drug resistance alleles, gene conversion of the sensitive to the resistant allele, or new mutation of the sensitive allele to a resistant form.) It is therefore often desirable to employ an additional criterion to positively identify a transfer product. Of the several possibilities, the use of a replica plate test is described. This test determines the status of a recessive auxotrophic marker from the recipient parental genotype, which would be complemented in a diploid. After this screening, candidates are subjected to electrophoretic karyotype analysis. Virtually all are found to be YACductants. 1.2. Versatile Application of Transfer by Karl- Matings In the example given in this Chapter, a YAC is transferred from AB1380 to YPH925, its recipient and new host, in a single transfer step. However, YAC transfer in Karl- matings can be applied with considerable versatility using either of the following

two strategies.

1. Two properties of Karl- chromosome transfer allow further flexlbrhty. the Karl- defect is unilateral (a single mutant parent specifies the mating defect) and chromosome transfer is bidirectional (the karZAl5 parent may be either the YAC recipient or donor). Moreover, YAC transfer can also be accomplished in matings between two karZAl5 strains. These properties have lead to the suggestion that a YAC can be moved between vntually any pair of hosts in Karl- matings using a series of two or three transfer steps (IS). For example, a YAC transferred from AB1380 into YPH925 can now be transferred to a MA Ta canZR recipient that will allow selection of one or both YAC markers (URA3 and TRPI). Thus second step wrll Fig. 1. (previous page) YAC transfer. Phenotypic characteristics that distmguish the yeast strains established by each colony type are described. At least one of the parental strains must be a karl mutant. The phenotypesgiven in italics represent the cross described in the example: AB1380 + YAC (donor) by YPH925 (recipient).

244

Spencer and Simchen

provide immediate access to yeast hosts with new genetic markers useful in YAC modification. It may also be useful m facilitating the transfer of unstable clones into a recombmation deficient host. The recipient m the second step need not contain the karlAl mutation since the donor does, although both donor and recipient may be mutant (15). The basic requirements for recipient strains in secondary (or tertiary) transfer steps are: the appropriate mating type; a selectable recessive drug resistance marker that is not present in the immediate YAC donor; and auxotrophy for a marker carried on the YAC. The number of transfer iterations required to construct the desired strain using this method will be dictated by the mating type of the final recipient. In addition to YPH925, three other strains useful as mtermediaries for series transfer protocols are available through the American Type Culture Collection (ATCC). The four related strains and their genotypes are: a. YPH925: MATa ura3-52 1~~2-801ade2-101 his3A200 trplA63 leu2Al cyh2R karl Al 5 (ATCC accession #90834); b. 2477: MATa ura3-52 iys2-801 ade2-101 hts3A200 trpldl leu2Al canlR karlAl (ATCC accession #90835); c. 2479: MATa ura3-52 lys2-801 ade2-101 hts3A200 trpldl leu2Al canlR karlAl (ATCC accession #90836); and d. 2480: MATa ura3-52 lys2-801 ade2-101 his3A200 trplA63 leu2Al cyh2R karlAl (ATCC accession #90837). 2. New recipient strains with desired genetic properties can be constructed by introducing the cloned karlAl allele using two-step gene replacement methods (18; and Chapter 18). LYS2- and UZL43-based integrating plasmids suitable for this purpose have been generated (E. Vallen and M. Rose, unpublished; 14).

2. Materials 1. Yeast strains: a. AB1380 + YAC: MATa ura3 lys2-lot ade2-lot his5am trpl canl1000~ Ile- Thr- + YAC (URA3 TRPZ); b. YPH925 (see Note 1): MATa ura3-52 lys2-801 ade2-102 his3A200 trplA63 leu2Al cyh2R karlAl5. 2. Media: See Chapter 29 for medta formulations. For YAC transfer, liquid media required are YPD and SD + lys + ade + his

+ leu + ile + thr. Platesrequiredare SD + trp + lys + ade + his + leu with cycloheximide, SD + lys + ade + his + leu + cycloheximide, and SD + lys + ade + his + cycloheximide.

Transfer of YAC Clones to New Yeast Hosts

245

For analysis of electrophoretic karyotypes, liquid media required are SD + lys + ade + his + leu (for colony-purified candidate YACductants), SD + lys + ade + his + ile + thr (for AB1380 + YAC), and YPD (for AB1380 and YPH925). Add supplements at these final concentrations: 20 mg/L uracil, 30 mg/L L-lysine, 20 mg/L adenine sulfate, 20 mg/L L-hi&dine, 20 mg/L L-tryptophan, 30 mg/L L-leucine, 30 mg/L L-isoleucine, 200 mg/L L-threonine. Supplements may be conveniently prepared as filter-sterilized 1OO-fold concentrated stocks and added after the other ingredients are autoclaved. Where appropriate, cycloheximide is added to media just prior to pouring at a final concentration of 3 mg/L. A filter-sterilized stock solution of 10 mg/mL cyclohextmide in HZ0 may be stored at 4°C.

3. Methods 3.1. Transfer by Karl-

Mating

1. Grow overnight cultures of YPH925 in 5 mL YPD liquid medium, and AB1380 + YAC in 5 mL SD + lys + ade + his + ile + thr liquid medium (which maintains selection for the presence of the YAC). 2. Determine the culture density by measuring absorbance at 600 nm m a spectrophotometer and converting to cells per milliliter. (An absorbance at 600 nm of 0.1 indicates -lo6 cells/ml. The overnight cultures wtll probably have to be diluted between lo- and 1OO-fold to measure within instrument range.) 3. Pellet lo7 cells each of YPH925 and AB 1380 + YAC in 1.5-mL Eppendorf centrifuge tubes by spinmng about I5 s in a microcentrifuge. 4. Resuspend YPH925 and AB1380 + YAC cells together in a total of 1 mL fresh YPD liquid, and transfer the mixture to a sterile culture tube. 5. Culture together at 30°C for 4-6 h with good aeration (e.g., on a tilted rotatmg drum) (see Note 2). 6. Plate the cells onto SD + lys + ade + his + trp + leu with cycloheximide (see Note 3) in a dilution series on three plates: 50 pL, 300 pL, and remainder (see Note 4). 7. Incubate plates at 30°C for 4-6 d. Large colonies should appear over a heavy lawn of plated cells. (A good mating should yield 2200 Cyh2R Ura+ Trp+ colonies.) 8. Replica plate to SD + lys + ade + his + leu + cycloheximide, and culture for l-2 d at 30°C. This will remove much of the heavy lawn, as well as provide selection for the other YAC marker. 9. Replica plate again to SD + lys + ade + his + leu + cycloheximide, as well as SD + lys + ade + his + cycloheximide (no leucine). This step distin-

246

10. 11. 12. 13.

14.

Spencer and Simchen guishes YACductants from the undesirable Cyh2R diploid false-positive colonies: CyhR YACductants will be unable to grow without leucine (leu2Al), whereas the diploids will be leucine prototrophs (LEU2/ZeuZAl) (see Note 5). Incubate plates at 30°C for l-2 d. From the SD + lys + ade + hts + leu + cycloheximtde plate, choose SIXlarge well-spaced colonies that are unable to grow on the plate without leucine. Streak each of the six for single colonies on SD + lys + ade + his + leu + cycloheximrde, and choose a single colony from each to estabhsh strain stocks. For each candidate YACductant strain, prepare high molecular weight DNA from yeast m agarose, and separate the chromosomes on a pulsed field gel (see Chapter 7) Include AB 1380 (no YAC), AB 1380 + YAC, and YPH925 as useful controls. Examine the electrophoretic karyotype of each(see Note 6). A YACductant will have yeast chromosomes correspondmg to the recipient, wrth the addition of a YAC band (see Figs. 2 and 3). In additton, cotransfer of natural yeast chromosomes will occur m approx 20% of YACductants (14,25). These are visualized as extra bands within the YPH925 karyotype (with migration of AB 1380 chromosomes), or increases in band intensity. Although these cotransferred chromosomes will seldom be of any importance m subsequent manipulations of the transferred YAC, YACductants containing them can be avoided by careful analysts of the karyotypes.

3.2. Transfer by DNA-Mediated Transformation In this method, the YAC clone is prepared from the donor as deproteinated high molecular weight DNA in low-melting point agarose blocks (described in detail in Chapter 7), and introduced into the recipient by transformation of very high efficiency yeast spheroplasts, described in detail in Chapter 1). For example, a pYAC4 clone can be transferred from AB1380 to YPH857 with the following manipulations. Chromosome-sized DNA is prepared from YAC-containing yeast cells suspended in low-meltingpoint agarose.Approximately 200 ng of high molecular weight total yeast DNA in 10 pL molten agarose are used to transform recipient yeast cells made competent by spheroplasting. YPH857 cells in logarithmic phase (3 x lo7 cells/ml) are spheroplasted by controlled treatment with an enzyme preparation that degrades the yeast cell wall (i.e., Zymolyase or Lyticase). The spheroplasts are then exposed to the transforming total yeast DNA in the presence of polyamines (0.3 rnA4 spermine, 0.75 n.M

Transfer of YAC Clones to New Yeast Hosts

247

Yeast Chromosomes

XI VIII, v IX III VI I Fig. 2. Electrophoretic karyotypes of AB1380 and YPH925. A photograph of a CHEF gel stained with ethidium bromide shows the chromosome length polymorphisms observed in comparison of the karyotypes of ABl380 and YPH925. Electrophoresis was in 1% low EEO agarose in 0.5X TBE at 200 V. Field direction was switched every 60 s for 16 h, and then every 90 s for 16 h. As shown, theseconditions separateDNA molecules in the yeastkaryotype (21), with an effective range from chromosome I (2 10kb) through chromosome IV ( 1400 kb).

spermidine), polyethylene glycol, carrier DNA, and calcium chloride. They are then subjected to a mild heat shock, allowed a short period of recovery in rich media-containing sorbitol for osmotic balance, and plated in a top agar layer on sorbitol-containing plates that select for the growth of transformants exhibiting YAC marker acquisition (UE43 and TRPI). The identity of transformants as YPH857 containing an intact, newly introduced YAC clone should be confirmed by electrophoretic karyotype analysis. Successful use of this method requires the production of yeast spheroplasts with very high transformation competence, i.e., that yield approx 500 transformants per nanogram of a test circular plasmid such as pYAC4 (19). (The control circular minichomosome should be introduced in a

Spencer and Simchen

248

-

F

- YAC

Fig. 3. YACductant identification by electrophoretic karyotype. A CHEF gel illustrating YAC transfer by Karl- mating is shown. Electrophoresis conditions chosen (1% agarose, 0.5X TBE, 2OOV, with gradually increasing pulse times from 5-35 s) display the length polymorphisms between the small yeast chromosome bands of the donor and recipient, as well as presence of the YAC band. The YACductant on the left shows cotransfer of AB1380 chromosome IX (note the band 4 doublet). h, 50-kb ladder of unit length lambda phage and concatemers.

parallel tube of competent yeast cells without polyamines: Treatment with these will dramatically decreasethe efficiency of transformation by small quantities of circular DNA.) In general, this protocol can be expected to yield a few to dozens of YAC transformants. 3.3. Transfer

by Traditional

Genetic

Cross

By this method, desired genetic markers for the new host background are introduced by forming heterozygous diploids, and analyzing meiotic products to identify YAC-containing spore colonies of preferred genetic composition. The resulting strain will contain the specifically selected markers, and will be otherwise a mixture of the two parental laboratory strain backgrounds. Access to a tetrad dissection microscope is required.

Transfer of YAC Clones to New Yeast Hosts Briefly, cells of opposite mating type are cultured together, and subjected to genetic selection for diploids (e.g., using complementing auxatrophic markers) or physically manipulated to isolate zygotes from the mating population. The resulting diploid colonies will contain the YAC, and desired markers in heterozygous state. Diploid yeast are induced to undergo meiosis (sporulation) by culturing on low nitrogen media, generally for 3-5 d. The product of meiosis is an ascus containing four spores derived from a single diploid cell. Spores from individual tetrads can be physically manipulated for analysis using a microscope equipped with a glass microneedle. These spore products will germinate on return to rich media, and, if they have been separated from one another, can be analyzed for segregation of genetic markers by replica plating to various selective media. The number of tetrads that must be analyzed will depend on the number of independently segregating markers desired in the preferred strain. Protocols for mating, diploid selection, sporulation, and tetrad dissection are presented in detail in Chapter 19. For example, a YAC clone in AB1380 can be introduced into a strain with the genetic markers from the alternative host YPH857 by the following method. If the haploid strains AB 1380 + YAC (which is MATa) and YPH857 (which is MATa) are allowed to mate, diploid products containing the YAC are of the genotype: M4Ta LEU2 yra3-52 MATa leu2Al uru3-52 + YAC (lJRA3 TRFI)

&2-801 lys2-801

pde2-lot ade2-101

hisjam HIS5

m hu3A200

g& trplA63

canl-10s CAhUs

Q@ cyh2

Selection for cells that are simultaneously Leu+ His+ Ura+ Trp+ will allow YAC-containing diploids to grow, and will prevent growth of haploid parental yeast (or diploid cells without a YAC). After colony purification of two such diploids, they should be sporulated on low nitrogen medium, and tetrads dissected. With the exception of the His- auxotrophs (which may indicate the presence of hisjam, his3A200, or both mutations), the spore phenotypes from this cross provide an unambigous indication of the genotype. Each true tetrad will show 2+:2- segregation for leucine prototrophy (LEU2 vs leu2Al), canavanine resistance (canl-IO@ vs CANIs), cycloheximide resistance (CYH2s vs ~yh2~), and will contain 2 MATa and 2 M.4Ta spores. Because the YAC was present in one copy, most tetrads should also show 2:2 segregation for the YAC (half of the spores will contain

250

Spencer and Simchen

the markers URA3 and TRPI). The hrstidine genotype can be determined by complementatron tests using available tester strains (22): e.g., MATa his3A200 (YPH389), MATa his3A200 (YPH390), MATa his5 (YPH391), and MATa his5 (YPH392). The YPH857 markers his3A200, leuddl, cyh2R are useful for YAC modification. A desired spore genotype of HIS5 his3A200 + YAC should appear with the frequency (l/2)3, and therefore 6 tetrads will provide 3 desired spores, on average. Similarly, a spore genotype HIS5 his3A200, Zeu2A1, cyh2R + YAC should appear with frequency (l/2)5, requiring on average 24 tetrads for 3 such spores. The presence of a YAC clone with expected structure should be confirmed by analysis of the electrophoretic karyotype of the final strain.

4. Notes 1. The karlAZ.5 mutation is a nonreverting 70 amino acid deletion allele that can be conveniently confirmed by Southern blot. Its presence does not adversely affect the structural integrity or mitottc stability of YACs (14,25), and it IS as karyogamy deficient as the original missense karl-Z allele. 2. In an alternative procedure, the cells can be incubated together on a sterile Whatman filter paper disk laid on a YPD plate. To accomplish this, resuspend the donor and recipient cell mixture m a small volume of YPD (30-50 pL), and carefully spot them onto the sterile filter paper disk. Incubate the plate at 30°C for 4-6 h, move the disk (with sterile forceps) into a sterile test tube containing 1 mL YPD, and shake the cells off the disk. Plate the cells as described in step 6. 3. This plate is designed to selecttvely allow the growth of YACductant colonies, which will be Ura+ Cyh R. The AB1380 parent will fall to grow because of the lack of isoleucine and threonine, and the presence of cycloheximide. The YPH925 parent will fail to grow because of the lack of uracil. A false posttive background of CyhR cells derived from Ura+ diploids does appear, but will be dealt with in steps %l 1. 4. Within the dilution platmg scheme suggested, the expected lo-fold difference in CyhR colonies is generally not observed. This presumably reflects a negative effect of high cell densities on the recovery of YACductants. Thus, the authors recommend plating at variable densities to ensure recovery of a convenient number of well-spaced colonies. 5. At this point, there are several alternative strategies. For example, candidate YACductants for further analysis can be identified by determmmg the mating type locus composition using PCR (20), as described in Chapter

Transfer of YAC Clones to New Yeast Hosts 19. The desired colonies will be MATa, whereas the false-posmve background will be largely MATaIMATa heterozygotes. Or, for small scale applications of this transfer technique (e.g., transfer of a single YAC), steps 9-l 1can be skipped altogether, and a larger number of candidates screened directly by pulsed field gel analysis. 6. There are several chromosome length polymorphisms that distinguish the YPH925 genetic background from AB 1380. The number of chromosome length polymorphtsms vtsible on a given pulsed field gel depends on the runnmg condrtrons during electrophoresis, and sharpness of the chromosomal bands. Several readily apparent polymorphisms are tllustrated in Fig. 2.

Acknowledgments The authors would like to acknowledge stimulating discussions and valuable contributions of C. Connelly, E. Green, P. Hieter, Y. Hugerat, 0. Hurko, S. Klein, and D. Zenvirth. References 1. Burke, D., Carle, G., and Olson, M (1987) Cloning of large segments of DNA into yeast by means of artificial chromosome vectors. Science 236,806-g 12. 2. Lmg, L., Ma, N., Smith, D., Miller, D., and Mou, D. (1993) Reduced occurrence of chrmerrc YACs m recombmatron-deficient hosts Nuclezc Acids Res. 21,6045,6046. 3. Chartier, F., Keer, J., Sutcliffe, M., Hennques, D., Mrleham, P , and Brown, S (1992) Construction of a mouse yeast artificial chromosome library m a recombrnation-deficient strain of yeast. Nature Genet. 1, 132-136 4. Nell, D., Villasante, R., Vetrre, D., Cox, B., and Tyler-Smith, C. (1990) Structural mstabihty of tandemly repeated DNA sequences cloned in yeast artificial chromosome vectors. Nuclezc Acids Rex 18, 1421-1428 5. Pavan, W., Hieter, P., and Reeves, R. (1990) Generation of deletion derlvatlves by targeted transformation of human-derived yeast artificral chromosomes Proc. NutE Acad Scl USA 87, 130%1304. 6. Spencer, F., Ketner, G., Connelly, C , and Hreter, P. (1993) Targeted recombmation-based clomng and mampulatron of large DNA segments in yeast Methods 5, 161-175. 7. Ketner, G., Spencer, F , Tugendreich, S , Connelly, C., and Hieter, P. (1994) Efticrent manipulation of the human adenovuus genome as an infectious DNA clone. Proc Natl. Acad Sci USA 91,6186-6190. 8. Botstem, D. and G Fink (1988) Yeast: an experimental organism for modern biology. Science 249,1439-1443. 9. Conde, J. and Fink, G. (1976) A mutant of Saccharomyces cerevisiae defective for nuclear fusion. Proc Natl. Acad Sci. USA 73, 3651-3655 10. Rose, M. and Fink, G. (1987) KARI, a gene required for function of both intranuclear and extranuclear microtubules in yeast Cell 48, 1047-1060.

252

Spencer and Simchen

Il. Vallen, E , Htller, M., Scherson, T., and Rose, M. (1992) Separate domains of KARI mediate distmct functions in mitosis and nuclear fusion J Cell Blol 117, 1277-1287. 12. Jt, H., Moore, D , Blomberg, M., Bratterman, L , Voytas, D., Natsoulis, G , and Boeke, J (1993) Hotspots for unselected Ty 1 transposmon events on yeast chromosome III are near tRNA genes and LTR sequences. Cell 73, 1007-1018. 13. Hugerat, Y. and Srmchen, G (1993) Mrxed segregation and recombination of chromosomes and YACs during single-dtviston meiosis in spol3 strains of S cerevwae. Genetics 135,297-308 14. Spencer, F., Hugerat, Y., Stmchen, G , Hurko, 0 , Connelly, C , and Hteter, P (1994) Yeast karl mutants provtde an effective method for YAC transfer to new hosts. Genomics 22, 118-126. 15. Hugerat, Y., Spencer, F., Zenvirth, D., and Stmchen, G. (1994) A versatile method for efficient YAC transfer between any two strams. Genomlcs 22, 108-l 17. 16. Hoffmann, W. (1985) Molecular characterization of the CAN2 locus of 5’. cerevwae. J Blol Chem 260, 11,83 l-l 1,837 17. Kaufer, N., Fried, H., Schwindinger, W., Jasm, M., and Warner, J. (1983) Cyclohextmrde resistance m yeast: the gene and its protein. Nucleic Acids Res. 11, 3123-3133. 18. Rothstem, R. (199 1) Targeting, disruptton, replacement, and allele rescue: integrative DNA transformation m yeast. Methods Enzymol. 194,28 l-30 1. 19. Connelly, C., McCormtck, M., Shero, J., and Hieter, P. (1991) Polyammes eliminate an extreme size bias against transformation of large yeast artttictal chromosome DNA. Genomlcs lO, lO-16 20 Huxley, C., Green, E., and Dunham, I. (1990) Rapid assessment of S. cerevtstae mating type by PCR. Trends Genet. 6,236. 2 1. Carle, G. and Olson, M. (1984) Separation of chromosomal DNA molecules from yeast by orthogonal-field-alternation gel electrophoresis. Nucleic Acids Res 12, 5647-5664.

CHAPTER23

Use of ACEDB as a Database for YAC Library Data Management Ian

Dunham

and

Gareth

Ll. Maslen

1. Jntroduction Increasingly, the libraries that are the basic genomic DNA resources of physical mapping projects are stored in ordered arrays in the wells of 96- or 384-well microtiter plates (see Chapters 2-4). Localization of individual genomic clones to single wells of 96-well microtiter plates rather than the traditional random plating has meant that screening of these libraries is no longer done “in isolation.” The results of all library screens may be accumulated over time and positive signals ascribed to the individual clones. In this way potential links between markers are more quickly identified and any worker who has access to the library can obtain a clone that has been previously identified positive with a particular marker. Thus the resources available to the mapping community have become less parochial and more highly organized. The distribution of yeast artificial chromosome (YAC) and other libraries by their constructors to many centers around the world, ensures that, at least in principle, an investigator has access to the sum of all data generated in that library, and the power of the ordered genomic resource strategy is further enhanced. However, this change in the way genomic DNA libraries are used has brought with it the need to store efficiently and display the screening data for libraries consisting of hundreds of thousands of clones. The very fact that a YAC library carries with it a burgeoning history of screening that is communicable presents the problem of how to store, display, and communicate these data. From Methods m Molecular Biology, Vol 54 YAC Protocols Edited by D Markle Humana Press Inc , Totowa, NJ

253

254

Dunham

and Maslen

There have been a number of different database solutions used for YAC library data, each of which has its own pros and cons (see Note 1). We describe how we have made use of the functionalities present in the freely available ACEDB database program to store and display the data obtained in our effort to make a physical map of human chromosome 22. We believe that this approach is both flexible and efficient, and in addition is fully compatible with the protocols outlined in Chapters 2-4. The ACEDB program was originally developed by Richard Durbin and Jean Thierry-Mieg for the nematode genome mapping and sequencing project (I). It is an object-oriented database management system that also provides tools that allow genetic and other biological data to be displayed in a natural way through the use of a series of graphical displays. Versions of the ACEDB system have been used not only for the nematode genome project, but also for Arabidopsis data (AATDB), for human genome mapping data for chromosomes 2 1, 22, and X; Drosophila; and many other plant and animal genome proJects. The software is continually developing with regular releases of updated versions, and an everincreasing and active group of users (see Section 4.). A detailed step-by-step description of all the intricacies of ACEDB is beyond the scope of this chapter, and such descriptions are available elsewhere (I-4). We can only hope to illustrate how useful the system has been to us, and point you in the right direction by outlinmg where to go to find more information and begin to set up the system. Therefore, in this chapter, we deviate from the format of the rest of this volume, and present first a description of how we have used ACEDB for storage and display data from extensive screening of YAC and other genomic libraries. Then we outline the basic resourcesyou would need to use ACEDB in a similar way. Finally, we present a brief introduction to how to get hold of and setup the program, how to customize it to suit your purposes,and how to obtain information on the program and follow future developments. 2. ACEDB

for Genomic

Clone Libraries

2.1. Introduction

Our approach to organization and screening of YAC libraries is outlined in Chapters 2-4. To facilitate storage, display, and analysis of data generated using these procedures we have utilized the program ACEDB. In particular, we have made extensive use of an interface that is an integral part of the program and that allows the user to display ordered arrays

Use of ACEDB for Data Management

255

M123Gl Length Orlgm Reference

RPgth

CEPH

320

Construction and characterlsation of a yeast artlflclal chromosome library containing seven haplold human genome equivalents

Fig. 1. The tree representationof single YAC clone object in ACEDB. The tree for the clone M 123G1 is shown, containing dataon its size as measuredby PFGE,the information that it is a YAC clone from the CEPH YAC library, and the referenceto that library. Each item of text in bold is a pointer to another object that can be displayed by picking with the left mousebutton. of clones in a graphic called the Clone-Grid display. Hybridization or STS content data for the clones in the gridded array can be entered through this display via a point and click procedure. It is this aspect of the program on which we focus. In order to fully appreciate the speed and utility of using the program, we strongly recommend that this chapter should be read with a live and functioning version of the program available to explore. Therefore a detailed reading is best accompanied by the human chromosome 22 implementation of ACEDB as used in the examples, and that can be obtained as described in Section 4.2. 2.2. ACEDB

Basics

All the information in ACEDB is stored as objects, which each belong to one of a number of classes. Each object has a unique name in the class to which it belongs. The classes are standard units such as clones, loci, papers, and so on, which may be displayed in class-specific ways. What may be stored in the objects in each class is governed by a model that describes the makeup of the class. Each object may also contain pointers to related data that are stored in objects of other classes. The data in an individual object are stored in the form of a tree with tags pointing to the information at the end of the tree (Fig. 1). In general, all objects in either a text or graphical display can be picked using the mouse opening up another window with information about the picked object. When you start ACEDB you will see a pair of windows (Fig. 2). In the main window (uppermost in Fig. 2) is a list of all the visible classes of objects within the database.Any class can be picked by clicking with the left mouse button and a second click will reveal a list of all the objects in the class in the second (lower) window, the “selection list.” In Fig. 2, the

Template: Classes: Map Locus Paper Laboratory Pool Datasheet Keyword KI-probe Probe

ICI-grid Polygrid

+j

[H&p/ f

7

,.

Journal Sequence Restriction Contlg KeySet STS AluPCR-probe YAC-Probe ICRF-grid Framework

,
FTP ncbi.nlm.nih.gov

Connected to ncbi.nlm.nih.gov. 220-Welcome to the NCBI FTP Server fncbi.nlm.nih.gov) 220 220 ncbi FTP server (Version wu-2.4(2/ Mon Apr 18 13:33:40 ready.

EDT 1994)

266

Dunham

Name (ncbi.nlm.nih.gov:idl) : anonymous 331 Guest login ok, send your complete e-mail address Password: 230 Guest login ok, access restrictions apply. FTP> cd repository/acedb 250 CWD command successful. FTP> 1s 200 PORT command successful. 150 Opening ASCII mode data connection for file list.

and Maslen as password.

ace3 xv ace2

c.elegans human. c21 . cache

code.3.3. tar.Z README.3 - 3 226 Transfer complete. 74 bytes received in 0.0074 s (9.8 Kbytes/s) FTP> cd c.elegans 250 CWD command successful. FTP> binary 200 Type set to I. FTP> get README

200 PORT command successful. 150 Opening ASCII mode data connection 226 Transfer complete. local:

README remote:

3165 bytes received FTP> quit 221 Goodbye. pabay fi dll : 74 :

for README (3086 bytes).

README

in 0.17 seconds

You could now read the README

(19 Kbytes/s)

file as follows:

pabayfidll : 74 : more README README file for acedb database repository _______________________ _____________________ This

directory

database

for

contains

the

the nematode

public

release

Caenorhabditis

of

elegans.

ACEDB,

It

the

also

the source code for the ACEDB genomic database manager. Get and read the file NOTES to get further general information.

Files

are:

INSTALL

installation

NOTES

read this this file

README

shell

next

script

genomic

contains

Use of ACEDB for Data Management README.LINUX angistute.sit.hqxMacintosh angistute.ps.2 bin.sparc.Z-0. tar.Z 4.1.3 bin.solaris.2-0. tar.Z bin.solaris.2-OA. tar.Z bin.iris.2-0. tar.Z

bin.alpha.2-0.

tar.Z

cor2asc. for

doc.2-0.

tar.Z

letter.2-8 letter.2-9

letter.2-10 macace2.0. Bin

pmapace. Z proteins.2-8. tar.Z source. 2-O. tar. 2 update.2-1. tar.Z ... update.2-10. tar.Z

information

about LINUX version Word 171 version of Australian

postscript

file

of Australian

executables,

run

time files

executables, executables, executables, executables,

run time files run time files run time files

update

up to current

for

PCs tutorial

tutorial Sun Spare SunOS

Sun Spare Solaris Solaris alternate SGI MIPS Irix run time files Dee Alpha OSFl for transfer of VAX CONTIG9 data various documentation release letter for 2-8 (first version 2 release) release letter for 2-9 release letter for 2-10 MacBinary file of macace-see letter for transfer of VAX CONTIG9 data proteins for mu1tiple alignment display source, run time files, and dot

files

You need all the updates from 2-1 up to the latest one and either bin.etc or source.etc, but not both. Werecommend the bin versions if possible because you need various freely available, but nonstandard, things to recompile (gee and MIT X libraries). You also need the most up- to-date proteins. *. tar.Z to see the protein alignments to predicted genes. Sun SPARCstation 1, It,

2, IPC, IPX running SunOS 4.1.3: bin.sparc... Sun Spare running Solaris, especially Classic, LX, Sparcstation 10 bin.solaris.. , DEC DECstation3100, 5100 etc. bin.mips... DEC alpha/OSF-1 bin.alpha... Silicon Graphics Iris series, compiled on R4000 Indigo bin.iris.. . PC 486 with Linux free Unix bin.linux... Other Unix: There exist, or have existed, ports onto Alliant, BP, IBM R6000, Next, Convex. To use these versions you must make

268

Dunham

and Maslen

the executable from the source or contact us. Please let Jean Thierry-Mieg know if you need help, or have a new port, Sunview: We no longer support Sunview.Please contact us if you need it badly,but part of the graphic code would need modifications. Macintosh: There is now a running macintosh version. Anonymous FTP to genome.lbl .gov, and look in directory pub/macace. To make a database FTP the appropriate script INSTALL,

from scratch or just install the latest release, tar.Z files to an ACEDB home directory and run the

When you first run the program it makes an empty database file. next time you run it you should select the “Add Update” option the main menu to add all the updates. Please

let

us know either

Richard Durbin Jean Thierry-Mieg

if

you have problems

[email protected] [email protected]

installing

Richard Durbin Jean Thierry-Mleg pabaylidll : 75:

please

the system.

[email protected]

If you want the nematode data you must mget update*. After you run the INSTALL script you will have a directory containing further documentation. If you have further questions, addresses that follow.

The from

send mail

to one of

called

wdoc

us at the

rd@mrc - lmba . cam, ac. uk mieg@crbml. cnusc. fr

If you follow these instructions, getting the update files and the binary appropriate to your machine you should be able to set up a functional copy of the nematode ACEDB database. 4.2. Obtaining

the Human Chromosome 22 Version of ACEDB You can get hold of the human chromosome 22 version of ACEDB that was used in the examples in this chapter by FTP from ftp.sanger.ac.uk. A typical session will proceed as follows, again with your typed commands in bold:

Use of ACEDB for Data Management

269

pabay[idlI :131:ftp ftp.sanger.ac.uk Connected to ftp.sanger.ac.uk. 220 islay FTP server (SunOS 4.11 ready. Name fftp.sanger.ac.uk:idlj: anonymous 331 Guest login ok, send ident as password. Password: 230 Guest login ok, access restrictions apply. FTP> cd pub/human/chr22/humana 250 CWD command successful. FTP> 1s 200 PORT command successful. 150 ASCII data connection for /bin/is (193.60.84.123,40382) (0 bytes). acedb.22. tar.Z 226 ASCII Transfer complete. 87 bytes received in 0.062 s (1.4 Kbytes/s) FTP> binary 200 Type set to I. FTP> get acedb.22. tar.Z 200 PORT command successful. 150 Binary data connection for acedb.22. tar.Z /193.60.84.123,40384) 110900639 bytes). 226 Binary Transfer complete. local: acedb.22. tar.Z remote: acedb.22. tar.Z 1024000 bytes received in 7 s (1.4et02 Kbytes/sJ

FTP> quit 221 Goodbye. pabayfidll:132:

To install this database, move the file acedb.22.tar.Z into an appropriate directory, for instance, your home directory. Make sure that you have 50 Mb of free space. Then uncompress and untar the file to produce a series of subdirectories that form the database structure. This is done as follows. First list the files in the directory: pabay[idl1:133:ls acedb.22. tar.Z pabay[idll:134:

Uncompress the tar.Z file and list the files: pabay[idl1:134:uncompress pabayCidl1:135:ls

acedb.22.

tar.Z

Dunham

270

and Maslen

acedb.22. tar pabaylidlI:136:

Extract the tar file to create the directory structure: pabay[idlI :136: tar -xf acedb.22. pabay[idlI :137:ls acedb.22 acedb. 22. tar pabay[idll:138:cd acedb.22/ pabay[idll:138:ls externalFiles bin database in-situ

tar.

pictures

rawda ta

wdoc wquery

wspec

pabay[idlI:139:

In the bin directory there are executables for SunOS 4.1.3 (bin/ xace.SUN) and Solaris (bin/xace.SOL) operating systems for Sun sparcstations. If you are running on a different machine you will need to get the appropriate executable as described in Section 4.1. and put it in the acedb.22/bin directory. Rename the executable you need to be xace, e.g., for the Solaris executable: pabay [id1 I : 139 :mv bin/xace. pabay[idll:140:

SOL bin/xace

You should now be able to run the database as follows. First you set the ACEDB environment variable to the directory that contains the database directory structure. Then run the executable to start the database: pabaylidll :ldO:setenv ACEDB $HOME/acedb.22 pabay Lid1 I : 141: $ACEDB/bin/xace & pabayfidlI:142:

The two starting windows of the database should now appear as in Fig. 2, and you will be able to explore the database. If you experience any problems with getting this database to run, please contact Ian Dunham by email (id1 @sanger.ac.uk). 4.3. Setting Up Your Own Database for YAC Library Data If you have looked at either the C. elegans or human chromosome 22 versions of ACEDB, then you are already halfway to setting up your own database. You can use the same database structures and executable for your own version. It is also worth bearing in mind that you can also transfer the data present in any ACEDB database to your own database

271

Use of ACEDB for Data Management

by dumping the data from the first database, in the form of a text file in so-called .ace format, and then reading that data into your own database, providing the databases have models that are compatible. Thus data are readily transferable in a simple text form that can be edited if necessary using a text editor. Before experimenting with setting up your own database, read all the documentation that is available (see the following). If you wish to take advantage of the data structures we have set in place for handling YAC library data generated as described in Chapters 2-4, it is best to start with the chromosome 22 database as your template, as this provides the appropriate data models. The first thing to do is to copy the database structure to a new set of directories where you will establish your new database. pabay[idll:85:cp pabay[idlI:86:cd pabayCidll:87:

-r $HOME/acedb.22/ newdatabase

$HOME/newdatabase

In order to add or remove data from the database you will need to have write access to the database. To allow yourself write access register your userid in the file $ACEDB/wspec/passwd.wrm according to the instructions in the file. Then initialize the database.You do this by first deleting the file database/ACEDB.wrm: pabay[idlI:87:ls bin externalFiles database in-situ pabay[idlI :88:cd database/ pabay[idll:89:ls ACEDB . wrm blocks . wrm pabay[idll:90:m ACEDB.wrm rm: remove ACEDB. wrm (y/n)? y pabay[idlI:91:

pictures rawda ta

wdoc wquery

lock. wrm

log.wrm

wspec

and then start the new database as you did in Section 4.2., except grant yourself ACEDB superuser status by setting the environment variable ACEDB-SU. pabayfidll:92:setenv ACEDB-SIT pabay[idll:93:setenv ACEDB $HOME/newdatabase pabaylidlI:94:$ACEDB/bin/xace & pabay[idll:95:

272

Dunham

and Maslen

The program will then ask if you want to initialize the system, and you click the yes button to confirm. The database will now initialize, which will take some time. At the end you will see the two starting windows of ACEDB as before, except that the databasewill be empty. In order to add data to the new database, get write access from the drag-down menu on the right button in the main menu. You can then enter data by one of two means. First there is an interactive data entry mode that allows you to enter data within the databaseone piece at a time while seeing where you are making changes. The second method involves parsing data into the database from an external text file, known as .ace file, which must conform to a simple syntax. Both these methods are described in the documentation and also m ref. 2. For simphcity’s sake, we briefly describe the latter method for an example file. We have left three .ace files (cephgrids.ace, icigrids.ace, and icrfgrids.ace) that construct the Clone-Grid displays we use for our database in the FTP site at ftp.sanger.ac.uk in the directory pub/human/acedb/acefiles. Get these files by anonymous FTP or dump them from the chromosome 22 ACEDB version. Place them into your $ACEDB/rawdata directory. From your database, with write access, you can now select the “read .ace files” option from the right button menu in the main window. A window will appear, and you should click the “open file” button that will spawn a file chooser window. Select the cephgrids.ace files from the file list and press the button to read in the file. When the file has been read in, you can quit the “read .ace files” window and choose the Clone-Grid class. You should see all 24 of the Clone-Grids representing the CEPH megaYAC library in 4 x 4 high-density grid array. You can then save this edit session from the main window to incorporate these grids permanently mto the database. It is worth taking a look at the structure of these .ace files to see how the grid structure was formed and entered. In these *grids.ace files the clones in the Clone-Grid are entered via their positions within the high density array. It is also possible to enter Clone-Grid arrays mto the database as the individual microtiter plates of 96 clones and then to assemble each high density Clone-Grid from the individual microtiter plates. This approach is called the virtual grid and has the advantage of giving much greater flexibility in the make up of nonstandard grids of clones. In addition, if a clone is added or removed from one of the parent microtiter plates in the database, the change will be valid on all the virtual

Use of ACEDB

for Data Management

273

grids that use that plate, rather as in the real world. However, for clone library grids that are unlikely to change in their content, it is better to use the setup specified m the *grids.ace files, as these take less time to draw and redraw than a virtual grid. The specifics of making virtual grids are dealt with in Note 3. The structure of your database in terms of how the data is displayed, and what kind of data can be stored, is determined by the tiles in the wspec directory. Each of these files has a description of its structure and function as a set of comments within the tile, and the files can be edited according to those instructions. Of primary importance in terms of what kind of data can be stored is the models file, $ACEDB/models.wrm. This file determines the structure of the data within the database. If you have used the human chromosome 22 version of ACEDB as the basis for your new database,then the models file is the form that we have used extensively for YAC library data. Using these models, we store all the data that we require to keep track of our library screening. A number of examples of the type of data stored are shown in Fig. 7. In addition it is possible to add new data structures to the model files so that the model can be further customized to your needs. Details of how to do this are really beyond the scope of this description and can be found in the documentation. 4.4. Obtaining and Further

Documentation Information

There are a number of sources of information that will be invaluable if you wish to set up and maintain your own ACEDB database. Here we provide details of the major current sources at the time of writing. 4.4.1. ACEDB

Documentation

Provided

with the Program

While in an ACEDB database, an on-line help is available that covers the practicalities of moving around the database and the details of the functions available within the specialized displays. The on-line help is obtained either by clicking a help button in many windows or by dragging down to the help option in the menu available on the right button in all windows. You can move around the help window by picking on topics or using the buttons and menu provided. For information on using ACEDB installation and configuration, program documentation is provided with the program release. If you have got ACEDB via FTP, then in the directory $ACEDB/wdoc there should be files for a user’s guide, an installation guide, and a configu-

Dunham

274

A

An example of data structure

and Maslen

for an STS.

stD22S277 Positive-locus D22S277 Posttion Hybridizes-to 22~01~1

A216Bll M882G4 17B4 69C6

STS

AFM-Num AFM 168xa 1 Oligo-1 TTCTTGTGTGGTAGTCTGGG Oligo-2 TACCNACTCCCCAAACTATG STS-length 140 170 CA-repeat Orrgmator Weissenbach J Reference A second-generation linkage map of the human genome B

An example of data structure

for a YAC clone.

M697C3 Type AluPCRqrobe prM697C3 Posttion Posmveqrobe stD22S451 prR12IE2 prR7HGl prR31DDlO prM937A12 prM697C3 st234zh4 Negattvegrobe stD22S314E stwr-405 stD22S292E stD22S286E 1250 Length Gel-length Origin YAC CEPH Grldded CEPH6 22polyl Added-togrid-by ID Added-to_grid CGC 17.4.94 C

An example of data structure

for a vectorette probe.

prM882G4R Type Vectorette-from_YAC M882G4 Position Falter-number M22.553 14.6.93 Hybridizes-to 22~01~1 A5lD4 69C6 M843H2 M882G4

weak

Use of ACEDB for Data Management

275

ration guide. These guides are also available from the same FTP site as the C. eEeguns version of the program in the file doc.2-O.tar.Z (see Section 4.1.). 4.4.2. Email Announcements

List

New releases of software are announced on the ACEDB electronic mailing list. To get on to the ACEDB announcements mailing list, send mail to [email protected] or [email protected]. 4.4.3. ACEDB

Network

News and FAQ List

There is a BIOSCI newsgroup that provides a forum for questions and discussion of the ACEDB system. If you have access to a Network News server, you can choose to subscribe to the group bionet.software.acedb, where you can read articles on the system and even post any questions you may have. If you do not have access to the BIOSCI conferences via a newsreader (e.g., rn, trn) you can participate in the conference by electronic mail. To subscribe to the email version of the conference send email to [email protected] (UK and European readers use [email protected] or biosci.daresbury.ac.uk) with no subject line and only the message: subscribe ACEDB-SOFT in the body. To unsubscribe send the message unsubscribe ACEDB-SOFT to the same address. This is an automated service. Your email address will be taken from the header of the message that you send. If you then send mail to [email protected], the mail will be distributed to all subscribers and to the electronic conference. In addition, a list of questions and answers known as a FAQ (frequently asked questions) list is posted monthly to the group (3). This list intended to be used as an index to ACEDB databases and for information about the software. The latest text version of the list can also be obtained via Fig. 7. (previouspage) Examples of datastructuresfor objects in the human chromosome22 version of ACEDB. Examplesare shownfor (A) an STSobject, (B) a YAC clone, and (C) a vectorette-probederived from one end of a YAC. In each case, the text items in bold are pointers toward other objects that can be displayed by picking with the left mousebutton.

276

Dunham

and Maslen

anonymous FTP at machine net.bio.net as file: publBIOSCI/ACEDBl ACEDB.FAQ or at rtfm.mit.edu as pub/usenet/news.answers/acedb-faq. World Wide Web users may access the FAQ using the Uniform Resource Locator (URL): hltp://probe.nalusda.gov:8OOO/acedocs/acedbtoq.html. If you only have electronic mail, the FAQ can be retrieved from [email protected]. 4.4.4. Other ACEDB Resources Available on the Network 1 The ACEDB Documentation Server IS listed on the home page for the Agr~cultural Genome World Wide Web Server at http://probe.nalusda gov:8000. 2. The Australian Natronal Genomic Information Service has prepared documentation of the C elegans version of ACEDB m the files Angrsturte.ps and angistute.hqx available by anonymous FTP at ncbi nih.gov m repositorylacedblace2. 3. The text for refs. 2 and 4 is available through FTP or gopher from weeds.mgh.harvard.edu. 4. An ACEDB developer’s archive has been set up and is available by anonymous FTP from weeds.mgh.harvard.edu m the acedb-dev directory. 5. The Genome Computing Group, Lawrence Berkeley Laboratory, has an anonymous FTP service at machme genome.lbl.gov (13 1.243.224.80) that includes a repository of contributed software for data conversions. In addition, a number of useful FTP and WWW sttes are given in Note 2. 4.4.5. ACEDB Developers’ Workshop An ACEDB workshop is held annually. Information about past and future workshops can be obtained from the sources in Sections 4.1.2.4.1.4. 5. Notes 1. A number of the labs that have been involved in large scale library screenmg have developed then own databasesfor storage of YAC library screenmg data. Many of these programs are either based on commercially available relational database systems, such as Sybase, or are not publicly available at this time. Information about these database systems may be found by browsing the network sites given m Note 2. One example is the Reference Library Database (RLDB) system used at the ICRF in London for storage of screenmg information for their m-house libraries. Information about the RLDB system can be obtained by email from [email protected] or [email protected]. 2. Some other useful WWW sites: These server sites can be reached over the World Wide Web using a client program such as X mosaic (see Table 1).

Use of ACEDB for Data Management

277

Table 1 World Wide Web Server Sites Server URL

Organization or mformation

htp.Jfwww.sanger ac.uk http://moulon.mra.fr/acedb/acedb.html gopher:lfweeds mgh harvard.edul77l.mdexf Caenorhabditis-elegans_Genome http://probe.nalusda.gov*8OOOlacedocs/ mdex.html http:lprobe.nalusda gov 8000lacedocsf acedbfaq.html http:llwww.hgmp mrc uk http.//www.genethon frlgenethon-enhtml http llgdbwww gdb.org http NWWW.CHLC.org http./www-genome.wi

mit edu

http:flwww bto cam ac.uk http.//www.hgp,med.umtch.edu/#btomfo http.//gea.lif

tenet uk

http*//www-hgc.lbl.gov

held

Sanger Centre (Hmxton, Cambridgeshire, UK) (mcludes ACEDB documentation as Mosaic documents) ACEDB (Moulon, France) ACEDB via gopher (Harvard, MA) ACEDB documentation server (National Agrtcultural Library, Beltsville, MD) ACEDB FAQ (National Agricultural Library) Human Genome Mapping Project (Hinxton, Cambridgeshire, UK) Genethon (Paris, France) Genome Database (Baltimore, MD) Cooperattve Human Linkage Center (Iowa City, IA) WI/MIT Center for Genome Research (Cambridge, MA) Umversity of Cambridge, Department of Biochemistry (Cambrtdgeshire, UK) Michigan Human Genome Center (Ann Arbor, MI) Reference Library Database, Imperial Cancer Research Fund (London, UK) Lawrence Berkeley Laboratory Human Genome Center (Berkeley, CA)

grid defimtrons m ACEDB. Each grid IS composed of 16 microtiter plates gridded m a 4 x 4 pattern. This pattern IS repeated for each position of a 8 x 12 microtiter plate. This layout yields a grldded array of (4 x 4) x (8 x 12) = 1536 clones. Clones are located according to then position within the 4 x 4 array at each row and column junction of the polygrid. This array of clones can be represented wtthm the ACEDB database as a single text file containing the names of all 1536 clones, or as a vntual grid defined in terms of the component microtiter plates. The principal advantage of the virtual grid is that tt IS a highly flexible method of creating new grads, or altering pre-exrsting grids. Microtiter plates may be added to, or deleted from, the gnd definition file m a single step, ehmmatmg the need for large scale editing of individual clones in a grid defimtron Alterations made to

3. Virtual

Dunham

278

and Maslen

the contents of any indivtdual microtiter plate are propagated throughout all the grids contaimng that plate. Grids are thus updated with the mmrmum of human intervention, reducing the possibthty of outdated informatron remaining in the database,and easing the load of maintaimng the database. The virtual grid is defined in terms of the component microtiter plates. Each microtiter plate can be defined as an array of clones in an ASCII text file in .ace format. For instance, the following .ace file specifies a microtiter plate called Xp 1.1 of YAC clones. N Xp 1.1microtiter.ace Clone-Grid : “Xp 1.1” Title “Xpl. 1” Lines-at 1 1 No-stagger Al-labelmg ~~~ 1“lA1” “lA2” “lA3” “lA4” “1Arj” “lA6” “lA7” “l,,# “lA9” “lAl0” “IA1 1” “lA12” ~~~ 2 “1~1” “1~2” “1~3” “lB4” “1~5” “1B6” “1~7” “lB8” “lB9” “lBlO”\ “1Bll” “lB12” Row 3 “lCl”“lC2” “lC3” “l(l/> “1(-y “lC6” “1(-y “l(yy “l(y “l(-go” “lC11” “lC12” Row 4 “lD1” “lD2” “lD3” “lD4” “lD5” “lD6” “lD7” “lD8” “lD9” “lDl0” “ID1 1” “lD12” Row 5 “lE1” “lE2” “lE3” “lE4” “lE5” “lE6” “lE7” “lE8” “lE9” “lEl(y\ “lEl1” “lE12” ~~~ 6 “1~1” “1~2” “1~3” “lF4” “1~5” “lF6” “lF7” “lF8” “lF9” “lFl0”\ “1Fll” “lF12” Row 7 “lG1” “lG2” “l@” “lG4” “l@” “1,-&V “lG7” “lG8” “lG9” “lGl0” “1Gll” “lG12” Row 8 “lH1” “lH2” “lH3” “lH4” “lH5” “lH6” “lH7” “lH8” “lH9”

InMd In&d

“lHlO”\“lHl “Xpoly-1” “XpolyQ”

\

\ \

\

l”“lH12”

Clone-Grid is the name of the microtiter plate. Title is the title displayed for the clone grid by ACEDB. Lines-at, No-stagger, and Al-labeling are ACEDB comments that affect the manner in which the Clone-Grid information is visually displayed. The In_grid tag indicates that the microtiter plate is part of the Xpoly-1 and Xpoly-2 high-density grids. Each microtiter plate is linked to a high-density Clone-Grid object.

Use of ACEDB for Data Management

279

Following is shown the .ace file text description of the composition of a high-density Clone-Grid which contains the microtiter plate Xpl . 1. Each position in the 4 x 4 array of clones present on the grid is defined by the microtiter plate present at that position. Clone-Grid : Xpo1y.J Title Xpoly-1 Layout Lines-at No-stagger A l-labeling Virtual-row 1 Virtual-row 2 Virtual-row 3 Virtual-row 4

4

4

xp1.1 xp1.2 xp1.3 xp1.4 Xp1.5 Xp1.6 Xp1.7 Xp1.8 xp1.9 xp1.10 xp1.11 xp1.12 Xp1.13 Xp1.14 Xp1.15 Xp1.16

As with the microtiter plate Clone-Grid objects, the Title, Layout, No-stagger, and Al-labeling tags affect the display of the grid. The Virtual-row tags define which microtiter plates occur at each position in the 4 x 4 clone array present on the grid. Thus, the Xp 1.1 microtiter plate always occurs at position 1 in the 4 x 4 array. The virtual grid is thus generated from the clones present in each microtiter plate. This arrangement allows the grid to be edited at a macroscopic level of whole microtiter plates, or at the level of a single clone present on a microtiter plate. This flexibility makes the virtual clone grid a powerful tool for manipulating and editing arrays of clones within ACEDB. 4. Since the time this chapterwas written a new version of the ACEDB databasehas beendeveloped(ACEDB4). This databaseis also available from the same sitesas the ACEDB2 databasedescribed in this chapter. ACEDB4 is a more advanced version of the database, and differs from the previous ACEDBZ and ACEDB3 versions in a number of important respects, which are detailed in the release notes. Most of these alterations will have little, or no effect, with regard to the operation of the database as described in this chapter, however a number of alterations which do impinge on the material discussed in this chapter are mentioned: a. The class Clone-Grid has been replaced by class Grid. b. The clone class has been subdlvided into several new classesrelated to the vector used for cloning (i.e., classesBAC, PAC, YAC, cosmid, etc.). Each object in the class has a prefix to indicate the type of cloning vector used (e.g., y for YAC clones). This scheme allows clones from

280

Dunham

and Maslen

different ordered libraries to be differentiated from each other and so ease database adnnmstratlon. c. The classes Probe and STS contam the hybrtdtzatton and screening mformatton for the libraries. The tag Hybrtdtzes-to has been replaced by the tag Positive-?Class, where ?Class refers to the vector used for clonmg.

Acknowledgments The authors thank Richard Durbin for his invaluable help with ACEDB and for the modifications to the Clone-Grid displays that were essential for our use of the system. They would also like to thank Charlotte Cole for her comments on the development of the manuscript and Ian Dunham thanks the members of the Sanger Centre chromosome 22 mapping group for use of their combined data.

References 1. Durbm, R and Thierry-Mteg J (1991) A C elegans Database, Documentatzon, Code and Data Available from anonymous FTP servers at lit-mm lirmm fr, cele mrc-lmb cam ac uk and ncbi nlm mh gov 2 Dunham, I , Durbm, R , Thierry-Mteg J , and Bentley, D R (1994) Physical mappmg proJects and ACEDB, m Guide to Human Genome Computmg (Bishop, M J , ed ), Academic, London, pp 11 l-l 58 3 Sherman, B K (1994) ACEDB Genome Database FAQ Usenet news.answers Available via Universal Resource Locators ftp //rtfm mit.edu/pub/usenet/ news answerslacedb-faq-and-http-l/probe nalusda.gov:8000/acedocs/ acedbfaq.html 4. Cherry, J. M. and Cartmh, S. W. (1993) ACEDB, a tool for biological mformation, m Automated DNA Sequenczng and Analysts (Adams, M , Fields, C , and Venter, C , eds ), Academic, San Diego, CA, m press 5 Cole, C G , Patel, K , Shipley, J , Sheer, D, Bobrow, M., Bentley, D R , and Dunham, I. (1992) Identification of region-specific YACs using pools ofAlu-PCR probes labelled via linear-amplification Genomics 14,93 l-938 6. Aho, A. V , Kemighan, B W , and Weinberger, P. J. (1988) The A WK Programmmg Language, Addison-Wesley, Reading, MA 7. Wall, L. and Schwartz, R. L. (1991) Progrummzng Perl O’Reilly & Associates, Inc., Sebastopol, CA.

CHAPTER24

YAC Transfer into Mammalian Cells by Cell Fusion Nicholas

I? Davies

and

Glare

Huxley

1. Introduction The large regions of DNA that can be cloned in yeast artificial chromosomes (YACs) are ideal for expression studies of the complex genes and gene clusters found in the mammalian genome. Such studies require that the YAC of interest be transferred into a suitable expression system, such as mammalian cells in tissue culture or transgenic animals. Recent experiments indicate that large genes cloned on YACs may be transferred

intact and are often expressed at a level comparable to the endogenous genes and in a fully controlled fashion owing to the large amount of flanking DNA containing long range controlling elements (reviewed in ref. I). This chapter describes the use of fusion with yeast spheroplasts to introduce YAC DNA into mammalian cells, a procedure that can be used with rodent cell lines in tissue culture, including ES cells prior to generation of chimeric mice (2-4). An alternative method for the introduction of YAC DNA into mammalian cells in tissue culture, including ES cells,

is lipofection as described in Chapter 26. Microinjection, as described in Chapter 25, can also be used to introduce YAC DNA into adherent cells in tissue culture or into transgenic mice by pronuclear injection. The lack of any physical handling of the DNA makes fusion ideal for the intact transfer of YAC DNA hundreds of kilobases in size because there is no step where the large DNA would be subjected to shearing forces. This is in contrast to lipofection or microinjection, both of which require gel purification of intact YAC DNA that becomes increasingly difficult with From Methods m Molecular Bology, Vo/ 54 YAC Protocols Edited by D Markle Humana Press Inc , Totowa, NJ

281

282

Davies and Huxley

YAC DNA over about 600 kb in size. A striking demonstration of the transfer of extremely large DNA intact comes from an experiment in which a whole Schizosaccharomycespombe yeast chromosome, 3.5 Mb in size, was transferred into a mouse cell line (C 127) by fusion with yeast spheroplasts (5). 1.1. YAC Transfer by Cell Fusion The demonstration that polyethylene glycol (PEG)-mediated fusion of plasmid-containing yeast spheroplasts and mammalian cells resulted in the stable transfer of the plasmid to the mammalian cells (6) provides an attractive means by which to transfect DNA without the limitations of mechanical extraction. Fusion of yeast spheroplasts with mammalian cells has now been used to transfer YAC DNA to a variety of rodent cell lines (2-4,7-20). Where the integrity of the introduced YAC DNA has been investigated, the general observation is that the majority of the transformed cell lines contain essentially intact YAC DNA at low or single copy number, which has integrated mto a mammalian chromosome. YACs of around 600 kb have been transferred by several investigators and no limit to the size of YAC that can be transferred has yet been reached. One feature of fusion is that the entire yeast genome is initially introduced into the mammalian cell along with the YAC of interest. This leads to the integration of a variable amount of yeast DNA into the mammalian genome. The amount of yeast DNA integrated is variable between different cell lines as shown in Fig. 1. This figure shows Southern blot analysis of cell lines derived by fusion of mouse L A-9 cells with yeast carrying the 660 kb YAC yHPRT (yHPRTlO1, 103, 105, and 106) and of ES cells with yeast carrying the 320 kb YAC Iglc (3B2, 3B3, 3B4). As can be seen, the cell lines yHPRT105, 3B3, and 3B4 appear to contain no yeast DNA as detected with the yeast repetitive element Tyl that is present in about 30 copies scattered throughout the yeast genome (see lane containing yeast DNA). This means that it is easy to screen for cell lines with very little yeast genomic DNA. In addition, it has been shown that the yeast DNA does not interfere with germline transmission of ES cells (3,4). In most cell lines that have been investigated by in situ hybridization to metaphase spreads, the YAC DNA and any yeast genomic DNA are observed integrated at a single position in a host chromosome as shown

YAC Transfer into Cells

283

432 -.

TY~

Fig. 1. Yeast genomic DNA present in cell lines made by fusion of mouse cells with yeast spheroplasts. Each lane contains DNA from the cell line indicated above the lane, or size markers (M), or DNA from yeast (yeast). The DNA was cut with EcoRI, separated on an agarose gel, blotted onto Hybond N, and hybridized with the yeast repetitive element Ty 1. Sizesare indicated on the left of the gel. There is cross-hybridization of the probe to some of the DNA in the size marker lane. Figure courtesy of Amanda McGuigan. in Fig. 2A. In a minority of instances the YAC DNA has been observed to integrate as amplified arrays (Fig. 2B) or to be maintained as extrachromosomal elements (Fig. 2C) rather than integrated into a host chromosome (15-17). These phenomena have only been observed in transformed rodent cell lines that are known to be able to support high levels of gene amplification. The cell lines containing extrachromosomal elements are also rather unstable and would be missed if only the most healthy and

284

Davies and Huxley

.

Fig. 2. In situ hybridization of metaphase spreads from different cell lines derived by fusion of mouse L A-9 cells with yeast containing the YAC yHPRT. (A) A metaphase spread from a cell lme with a single mtegratlon of YAC and yeast DNA: stained with DAPI (left), the FITC signal of the purified YAC probe (center), and the rhodamine signal of the yeast genomlc DNA probe (right). (B) A metaphase spread from a cell line with a large amplified region of YAC and yeast DNA: stamed with DAPI (left), the FITC signal of the yeast genomic DNA probe (center), and the rhodamme signal of the purified YAC DNA probe (right). (C) A metaphase spread from a cell line with extrachromosomal elements: stained with DAPI (left), the FITC signal of the purified YAC DNA probe (center), and the rhodamine signal of the yeast genomic DNA probe (right). The images have been reversed so that the fluorescent signal is black. Figure reproduced from ref. 1.5with permission.

YAC Transfer

into Cells

fast growing cell lines are picked. Amplification and extrachromosomal elements have not been observed in ES cell lines. Although fusion has been reported with a variety of rodent cell lines, including ES cells, it has become clear that certain mammalian cell lines do not give rise to cell lines after fusion with yeast spheroplasts (21; several unpublished observations). Fusion with human cells, after initial difficulties, has now been described (22) and it seems that persistence and careful choice of an appropriate selectable marker cassette wrll yield success with most cell lines (see Note 6). 1.2. Overview of Fusion of Yeast Spheroplasts and Mammalian Cells The protocols used by the many different investigators who have used fusion to introduce YACs into mammalian cells are basically the same. There are slight modifications as to the order of pelleting the yeast and mammalian cells, the composition of the PEG solution, and the exact way the pellet is resuspended. Yeast cells have a relatively thick cell wall surrounding their membrane. Before fusion of yeast and mammalian cells can take place, this cell wall must be removed in order for transfer of the yeast DNA into the mammalian cells to occur. This procedure, known as spheroplasting, involves the use of an enzyme (yeast lytic enzyme, lyticase, or zymolyase), which breaks down components of the yeast cell wall. The fusion process is then mediated by PEG, which stimulates the sticking together of the membrane of the yeast spheroplasts and the mammalian cells. The cells are then plated out to regenerate as colonies derived from single cells. The cells are allowed to recover for 48 h before the addition of selection to allow time for expression of the resistance gene on the YAC. 1.3. Retrofitting the YAC Introduction of YAC DNA into mammalian cells by fusion with yeast spheroplasts requires that one can select for those cells that have taken up the YAC DNA. This is often done by introducing a dominant selectable marker, such as a gene for G418 resistance or an HPRT minigene, onto the YAC by homologous recombination in the yeast host. The introduction of a selectable marker onto a YAC is often referred to as “retrofitting” and is described in Chapter 17.

Davies and Huxley The promoter used for the expression of the selectable marker and the copy number of the resistance gene have been found to be very important to success. There are a number of retrofitting plasmids available that carry the gene for G4 18 resistance (neo) driven by a range of different promoters, such as the mouse metalothionine, TK, or PGK promoters. The authors have observed a large difference in the number of colonies obtained with YACs retrofitted using different vectors and it is probably advisable to assay a variety of vectors for their ability to form G4 18 resistant colonies in the cell line of interest. Furthermore, multiple copies of the resistance gene in the YAC arm probably give higher levels of expression of the protein and consequently more colonies (2). Indeed, Lamb et al. (23) observed up to a 1O-fold increase in the number of colonies obtained when transferring a YAC containing multiple wo copies into ES cells, as compared to one containing a single ~160gene. Suitable restriction digestion and the increase in size of the YAC can be used to determine how many copies of the selectable marker have been introduced onto the YAC. 2. Materials 1. lMTris-HCI, pH 7.5. Filter sterlhze or autoclave. 2. 1M CaCl*. Filter sterilize or autoclave.

3. 1M Sorbltol. Filter sterilize or autoclave. 4. SCE: IMSorbitol, O.lMsodium citrate pH 5.8, 10 WEDTA, sterilize.

pH 8.0. Filter

5. SCEM: Add 43 pL of P-mercaptoethanolto 20 mL of SCE. P-mercaptoethanol should be used in a tie

hood.

6. STC: lMSorbito1, 10 mMTris-HCl, pH 7.5, 10 miVCaC1,. Filter sterilize or autoclave.

7. PEG solution: 50% PEG 1500,10mMCaC12, 10%DMSO. Make up fresh by mixing the followmg: 4 mL of 50% (v/v) PEG 1500 (Boehringer Mannheim [Mannhelm, Germany] cat. no. 783 641, ready to use solution m 75 mM HEPES buffer), 40 pL of 1M CaC12,400 PL of DMSO (tissue

culture grade).Brmg to 37OC. 8. Enzyme solution: Dissolve yeast lytic enzyme (ICN cat. no. 152270) in SCE at 2.6 mg/lOO pL. Make fresh. 9. L A-9 cell medium: DMEM with Glutamax-1 (Gibco-BRL [Gaithersburg, MD] cat. no. 61965-026) supplemented with 10% fetal calf serum (FCS, Globepharm, Surrey). 10. PBS: Sterile 10X solution (Sigma [St. Louis, MO] cat. no. D.1480). 11. Trypsm-EDTA: Sterile 1X solution (Gibco-BRL cat. no. 45300-019).

YAC Transfer into Cells

287

3. Methods 3.1. Yeast Culture and Preparation of Yeast Spheroplasts

The protocol for making yeast spheroplasts is basically as described by Burgers and Percival (24). Yeast are generally grown in media that select for maintenance of the YAC. In the case of YACs retrofitted with a selectable marker, these are often dropout media lacking lysine or, if both the URA3 and TRPl genes on the YAC are intact, AHC (see Chapter 29) made with 40 mg of adenine/L. It is good practice to culture yeast from a frozen stock (15% glycerol at -70°C) rather than serially transferring strains on agar plates as YACs delete at a significant frequency. Colonies take about 3 d to grow up on agar plates. Prepare the yeast spheroplasts before trypsinizing the mammalian cells and carry out the fusion within l-2 h of preparing the spheroplasts. 1. Inoculate 5 mL of selective yeast media with a large colony of yeast and grow overnight at 30°C with shaking. At this point the culture should be saturated (see Note 1). This overnight culture can be kept at 4°C for up to 1 wk or used immediately. 2. In the afternoon, inoculate 3X 100 mL of selective media with 20,100, and 500 pL of the overmght culture. Grow overnight at 30°C with shakmg. 3. Take 100~pL samples of the cultures and dilute fivefold. Count the yeast with a hemocytometer and use the culture that is 23 x lo7 cells/ml. 4. Transfer a total of 150 x 10’ cells to 50-mL comcal polypropylene tubes. Spin down for 5 min at 6OOgat room temperature and discard the supematant. 5. Resuspend yeast m 20 mL H20, spin down as described, and discard the supernatant. 6. Resuspend yeast in 20 mL of 1M sorbitol, spm down as described, and discard the supernatant. 7. Resuspend cells in 20 mL of SCEM and add 60 pL of enzyme solution. 8. Place in a 30°C water bath about 15 mm until 90% spheroplasted.

To determine the degree of spheroplasting, take 20 PL of cells and add to 80 pL of water, put 20 PL onto a microscope slide and cover with a coverslip, and observe under 32x with phase contrast. The intact yeast are bright under phase contrast, whereas the spheroplasts lyse in water leaving dark remains and clear cases so that the percentage of

spheroplasting can be determined (see Note 2). From this point on treat the spheroplasts gently as they lyse easily. Use a lo-mL pipet to resuspend the spheroplasts, as this reduces shearing.

Davies and Huxley

288

9. Pellet the yeast spheroplasts at 240g for 5 mm at room temperature and dtscard the supernatant. 10. Resuspendyeast m 2 mL of STC by swirling and ptpetmg gently, then make up to 20 mL with STC. Spin down as described and discard supernatant. 11. Repeat wash in step 10. 12. Resuspend cells m 2 mL of STC. 13. Make a 1 m 100 dilution of the yeast spheroplasts m STC and count the spheroplasts with a hemocytometer. 14. Place 10 pL of the yeast spheroplasts on a microscope slide with a coverslip. Under phase contrast, all the spheroplasts should be intact and bright. When water is placed at the side, so that it spreads under the cover slip, all the spheroplasts should lyse. The yeasts are now ready for use and are stable for at least 1 h.

3.2. Yeast Spheroplast-Rodent

Cell Fusion

1. Harvest exponentially growing cells by trypsimzation and neutralize with media contaming FCS (see Note 3) 2. Pellet the cells at 15Ogfor 5 min and discard the supernatant. 3. Resuspend the cells m DMEM without FCS and repeat step 2. 4. Repeat the wash in step 3 twice more. 5. Count the cells with a hemocytometer and brmg to 2 x 106/mL m DMEM without FCS. 6. Place 1 x lo8 yeast spheroplasts into a 15-mL conical tube, centrifuge at 240g for 5 min, and remove supernatant completely while takmg care not to disturb the pellet. 7. Carefully layer 1 mL of cells (2 x 106) onto the yeast pellet usmg a blue pipet tip, taking care not to dislodge the yeast. 8. Pellet the cells at 240g for 5 mm and remove the supernatant with a blue pipet tip. 9. Add 0.5 mL of PEG solution prewarmed to 37OC and gently resuspend the cells by mixing and pipeting with a blue tip. Let sit for l-2 min at room temperature. 10. Now dilute the cells slowly (over approx 2 min) with gentle stirrmg, with 5 mL DMEM without FCS. Carefully invert the tube a couple of times to mix (see Note 4). Il. Pellet the mixture at 240g for 5 mm, remove supernatant, and resuspend in full media containing FCS, penicillm, and streptomycm. 12. Plate out cells m normal cell medium at a suitable density for selection. For rapidly growing rodent cell lines, plate the entire fuston mixture onto four 1O-cm dishes. It is important that the cells should not be touching each other before the selection is added.

YAC Transfer into Cells 13. The day after fusion remove any dead cells and yeast by washing with 1X PBS followed by the addition of fresh cell media (see Note 5). 14. Apply G4 18 or other selection at 48 h post fusion and thereafter (see Note 6). 15. Colonies will normally be observed within 2 wk and can be picked from separate plates for expansion as independent cell lines.

4. Notes 1. Slow growmg yeast: Some strams of yeast,notably minutes that arise spontaneously and lack mitochondria, grow slowly and only reach confluency after 2 or 3 d. Minutes fuse efficiently with mammalian cells but culture times should be Increased to give the desired number of yeast cells. Minutes can be distinguished from other AB1380 derived strains by bemg white rather than pink. 2. Making good yeast spheroplasts: If it is found that the yeasts do not form spheroplasts m about 20-25 min, or a different brand of yeast lytic enzyme is used, it is necessary to carry out an optimization experiment to determine how much enzyme is needed to give spheroplasting in the appropriate length of time. The spheroplasts should be kept until the end of the fusion procedure and then rechecked with a phase contrast microscope to ensure that the spheroplasts are still intact. If it is found that the spheroplasts have lysed during preparation or by the end of the experiment one should suspect either that they have been handled too roughly or that some detergent is present. If detergent is suspected, rinse all glassware thoroughly before making any of the solutions to be used to make the spheroplasts and, if possible, use plasticware instead of glassware. 3. Other cell lines: Minor variants of this protocol have been used to mtroduce YACs mto a variety of rodent cell lines in tissue culture including ES cells that can then be transmitted through the germline (3). If other cells are used, the same methods for preparation of the yeast spheroplasts and fusion with the cells should be used. However, the media used for the growth of the mammalian cells, the density of cell plating, and the concentration of G418 or other selection should be modified appropriately. As described in the Introduction, many cell lines seem to be resistant to fusion with yeast spheroplasts. 4. Fusion with PEG: Care must be taken when mixing the media into the PEG solution. Rapid mixing causes swift osmotic changes that can damage the mammalian cells. 5. Washing off yeast cells: The host yeast strain used for most YAC libraries (AB1380) will not generally grow in DMEM with 10% FCS, and simple washing with PBS will remove the bulk of the yeast. In some other media, such as Earls with 15% FCS, some yeast growth is observed and the yeast

Davies and Huxley

290

should be washed off more thoroughly. Fusion with cells that grow m suspension has not been described, but some other method for removal of the yeast would probably be necessary. 6. Selectable marker: The selectable marker must be highly expressed m the cell line being used and tt IS advantageous to have multiple copies of the marker on the YAC that may give increased levels of expression. As different promoter and resistance gene combmatrons function differently in different cell lines, tt is best to collect a variety of retrofitting vectors and determine which one gives the highest number of colonies when transfected into the mammalian cell lme of interest. Resistance to G4 18 IS the most commonly used marker that IS retrofitted onto YACs, but the Herpes simplex TK gene has been used m TK negative mouse L cells (25), and an HPRT mmlgene has been used successfully in HPRT negative ES cells (4). Other markers, such as resistance to hygromycm or histidmol, are also very effective in mammalian cells.

Acknowledgments N. P. Davies is grateful to the Cancer Research Campaign and AFRC for financial support of this work. The authors thank M. Briiggemann for DNA from ES cell lines 3B2,3, and 4. References 1, Huxley, C. (1994) Transfer of YACs to mammalian cells and transgemc mice, m Genetic Engweermg (Setlow, J. K , ed.), Plenum, New York, pp. 65-91 2. Davies, N. P., Rosewell, I. R., Richardson, J. C., Cook, G. P , Neuberger, M. S., Brownstem, B. H., et al (1993) Creation of mice expressing human antibody light chains by mtroduction of a yeast artificial chromosome containing the core region of the human mnnunoglobulin K locus BioTechnology 11,911-914. 3. Jakobovits, A., Moore, A. L , Green, L. L., Vergara, G J., Maynard-Currie, C. E , Austin, H. A , and Klapholz, S. (1993) Germ-lme transmission and expression of a human-derived yeast artificial chromosome. Nature 362,255-258. 4 Green, L L., Hardy, M. C., Maynard-Currie, C E , Tsuda, H , Lome, D M , Mendez, M. J , et al. (1994) Antigen-specific human monoclonal antibodies from mice engineered with human Ig heavy and light chain YACs. Nature Genet. 7,13-21 5. Allshire, R. C., Cranston, G., Gosden, J R., Maule, J. C., Hastie, N. D , and Fantes, P. A. (1987) A fission yeast chromosome can replicate autonomously in mouse cells. Cell SO,39 l-403.

6. Ward, M., Scott,R. J., Davey, M. R., Clothier, R. H., Cocking, E. C., and Balls, M. (1986) Transfer of antibiotic resistance genes between yeast and mammahan cells under conditions favoring cell fusion. Somat Cell Mol. Genet 12, 10 l-l 09.

YAC Transfer into Cells

291

7. Traver, C. N., Klapholz, S., Hyman, R. W., and Davis, R. W. (1989) Rapid screening of a human genomic library m yeast artificial chromosomes for single-copy sequences. Proc. Natl. Acad. Sci. USA 86,5898--5902. 8. Pachnis, V., Pevny, L , Rothstein, R., and Costantim, F. (1990) Transfer of a yeast artificial chromosome carrying human DNA from Saccharomyces cerevzszae into mammalian cells. Proc Nat1 Acad Scz USA 87,5 109-5 113 9. Pavan, W. J., Hteter, P., and Reeves, R. H. (1990) Modificatton and transfer mto an embryonal carcmoma cell lme of a 360-kilobase human-derived yeast artificial chromosome. Mel CeZl Bzol 10,4163-4169. 10. Gnirke, A., Barnes, T. S., Patterson, D., Schtld, D., Featherstone, T., and Olson, M V. (1991) Clomng and in vivo expression of the human GART gene using yeast artificial chromosomes. EMBOJ. 10, 1629-1634 11. Huxley, C., Hagino, Y., Schlessinger, D., and Olson, M. V. (1991) The human HPRT gene on a yeast artificial chromosome is functional when transferred to mouse cells by cell fusion. Genomzcs 9,742-750. 12 Davies, N. P., Rosewell, I R., and Bruggemann, M (1992) Targeted alterations m yeast artifictal chromosomes for inter-species gene transfer. Nuclezc Aczds Res 20, 2693-2698

13 Riley, J H , Morten, J. E N., and Anand, R (1992) Targeted integration of neomycin into yeast artificial chromosomes (YACs) for transfection into mammalian cells. Nuclezc Acids Res. 20,297 l-2976. 14. Demmer, L. A. and Chaplin, D. D. (1993) Simultaneous transfer of four functtonal genes from the HLA class II region into mammalian cells by fusion with yeast spheroplasts carrying an artificial chromosome. J. Immun 150,5371-5378 15. Featherstone, T. and Huxley, C. (1993) Extrachromosomal maintenance and amphfication of yeast artificial chromosome DNA in mouse cells Genomzcs 17,267-278 16. Markie, D., Ragoussis, J., Senger, G., Rowan, A., Sansom, D , Trowsdale, J., et al. (1993) New vector for transfer of yeast artificial chromosomes to mammalian cells. Somat Cell Mol Genet 19,161-169. 17. Nonet, G. H. and Wahl, G. M. (1993) Introduction of YACs containing a putattve mammalian replication origin into mammahan cells can generate structures that replicate autonomously. Somat Cell Mol. Genet. 19, 17 l-l 92 18. Silverman, G. A., Yang, E., Profftt, J. H., Zutter, M., and Korsmeyer, S. J. (1993) Genetic transfer and expression of reconstructed yeast artificial chromosomes containing normal and translocated BCL2 proto-oncogenes. Mel Cell Biol. 13,5469-5478.

19. Soh, J., Donnelly, R. J., Mariano, T. M., Cook, J. R., Schwartz, B., and Pestka, S. (1993) Identification of a yeast artificial chromosome clone encoding an accessory factor for the human interferon y receptor: evidence for multiple accessory factors, Proc. Natl. Acad. Scz USA 90,8737-8741.

20. Cook, J. R., Emanuel, S. L., Donnelly, R. J., Soh, J , Martano, T. M., Schwartz, B., et al. (1994) Sublocahzation of the human interferon-y receptor accessory factor gene and characterization of accessory factor activity by yeast artificial chromosomal fragmentation. J Bzol Chem. 269,7013-70 18.

292

Davies

and Huxley

21 Huxley, C. and Gnirke, A (1991) Transfer of yeast arttfictal chromosomes from yeast to mammalian cells B~oEssuys 13,545-549 22 Wada, M., Ihara, Y., Tatsuka, M., Mttsut, H , Kohno, K., Kuwano, M., and Schlessmger, D (1994) HPRT yeast arttficial chromosome transfer mto human cells by four methods and an mvolvement of homologous recombmation Blochem Bzophys Res Commun 200,1693-1700

23 Lamb, B. T., Stsodta, S. S., Lawler, A. M , Slum, H. H., Km, C. A , Keams, W. G., et al. (1993) Introductton and expresston of the 400 ktlobase precursor amylotd protein gene m transgemc mice. Nature Genet 5,22-30 24. Burgers, P. M. J and Percival, K. J (1987) Transformation of yeast spheroplasts wtthout cell fusion Anal Blochem 163,391-397 25 Elicent, B., Labella, T., Hagmo, Y , Snvastava, A , Schlessmger, D., Ptha, G , et al (1991) Stable integration and expression in mouse cells of yeast artifictal chromosomes harboring human genes. Proc Nat1 Acad Scz USA 88,2 179-2 183

CHAPTER25

YAC Transfer Andreas

by Microinjection

SchedZ, and LZuis

Brenda MontoZiu

Grimes,

1. Introduction Soon after the first report of how yeast artificial chromosomes (YACs) could be used as cloning vectors for large DNA fragments, the transfer of YACs into mammalian cells came into focus of interest, Following mammalian cell transfer, the YAC Integrates into the host genome. Because of the large size of YACs, genes contained within the construct should be regulated and expressed at levels comparable to their endogenous counterparts. This method should, therefore, allow the identification of genes by complementation and can also be used to study gene function and regulation in vivo. YACs ranging in size from 35-650 kb have been transferred to mammalian cells. Possibly the most straightforward approach to generate transgenic cell lines is to transfer YACs by spheroblast fusion, a technique described in Chapter 24. This method, however, normally leads to integration of the entire yeast genome in addition to the YAC, which might interfere with the interpretation of the results of some experiments. It is now possible to purify YAC DNA from a gel and use it for microinjection into the nucleus of a recipient cell. In this chapter, the authors describe a method for the isolation of purified and concentrated YAC DNA. Protocols for microinjection into immortalized somatic cells in culture and fertilized mouse oocytes are discussed. Purification of YAC DNA for microinjection faces two problems: isolation of sufficiently concentrated DNA and DNA shearing or degradation. From Methods m Molecular Btology, Vol 54 YAC Protocols Edited by D Markle Humana Press Inc , Totowa, NJ

293

294

Schedl, Grimes, and Montoliu

In contrast to plasmid DNA, YACs are normally maintained as a single-copy molecule per yeast cell. An important advance in YAC technology came from the development of retrofitting vectors, which introduce an amplification system into normal YACs (I; Chapter 21). The retrofitting vector is used to replace the normal YAC centromeric arm by homologous recombination. Under selective conditions, YAC copy number increases 10-100 fold, which dramatically increases the amount of YAC DNA for isolation. Although it is possible to isolate enough YAC DNA for microinjection purposes without an amplification step, the authors would highly recommend YAC modification with a retrofitting vector, if it will be used for more than one experiment.* The purity of the sample is increased significantly, especially for YACs comigrating with one of the endogenous yeast chromosomes. Purification of YAC DNA from the endogenous yeast chromosomes is achieved by preparative pulsed-field gel electrophoresis (PFGE) of yeast DNA embedded in agarose plugs. Because of the low amount of YAC DNA within the gel, it is often necessary to further concentrate the DNA. In our hands, best results are achieved with a method employing a second gel run. For this purpose, the excised PFGE gel slices (1% agarose) containing the YAC DNA are embedded into 4% low melting point (LMP) agarose and gel electrophoresis is performed at a 90” angle to the PFGE run (see Fig. 1). Because DNA migrates faster in low percentage agarose, it will be concentrated at the border to the high percentage gel. After the second gel run the DNA can be excised in an agarose slice of a much smaller volume (usually l/5 of the original slice) and purified by agarase digestion. The advantage of this method over others is that the YAC DNA is protected within the agarose gel slice and can be stored at 4°C until needed. Agarase treatment involves an incubation step at 68°C to melt the LMP agarose. These high temperatures can lead to breakage of large DNA molecules when incubated in buffers of low ionic strength. It is, there*Note added in proofs. The thymrdme kmase gene (TIC), presentm amphficattonvectorsto apply strongselectivepressure,contamsa crypttc promoterin its codingsequence, which leads to expressionin the testes.Recentresultshave shownthat this can confer male sterrhty m transgemcmace(2). Estabhshment of transgemchnesfrom YAC constructscarrying amplification vectorsmight, therefore,be drfficult.

YAC Transfer by Microinjection fore, essential to equilibrate gel slices prior to agarasedigestion in a high salt buffer, which have proven very effective in stabilizing DNA during isolation procedures. Passage of large DNA through the microinjection needle is likely to cause shearing of DNA molecules >150 kb in size. Gnirke et al. (3) microinjected a 590 kb YAC into mouse cells in culture. The largest contiguous fragment transferred was about 500 kb. The authors suggest that there is a limitation on the size of a DNA molecule that can be microinjected as an intact molecule because of the constraint imposed by the small diameter of the injection needle. High molecular weight DNA can also be protected from shearing by using polyamines, such as spermine and spermidine. Polyamines protect DNA by forming inter- as well as intro-molecular bridges owing to ionic interactions (4,5). However, under low salt conditions this leads to precipitation of DNA making it unsuitable for microinjection. In electronmicroscopic studies, the authors have shown recently that low concentrations of spermine and spermidine in combination with high salt leads to compaction of DNA by the formation of globular structures (6). YAC DNA prepared in the presence of 100 n-M NaCl and polyamines can be centrifuged for periods as long as 15 min without precipitation. Although there are not enough data at present, it is quite likely that YAC DNA prepared with high salt and polyamines is more resistant to shearing during microinjection than YAC DNA prepared in high salt alone. The authors therefore suggest to include spermine and spermidine when working with YACs larger than 200 kb. An important factor to consider is the DNA concentration to be used for microinjection. Plasmid DNA is normally at a concentration between 1 and 2 ng/pL when used for microinjection into mouse pronuclei. Assuming an injection volume of l-2 pL, approx 500 copies of a standard, plasmid-derived construct (3-5 kb) are being transferred per injection. In contrast, only two to five copies are injected when working with a 500 kb YAC at similar concentrations. It is therefore recommended to use slightly higher DNA concentrations in YAC microinjection experiments. However, it should be kept in mind that DNA concentrations higher than 10 ng/pL lead to a reduction in survival of the injected embryos (7). We are now routinely microinjecting a 470 kb YAC at a concentration of 5 ng/pL. Survival rates of injected and transferred embryos are as high as 20-30%.

296

Schedl, Grimes, and Montoliu

2. Materials Heavy metal ions present in buffers even in traces will lead to degradation of YAC DNA during agarasetreatment. Make sure to use water of highest quality (e.g., Milli-Q, Millipore, Bedford, MA) for the preparation of buffers and gels. 1. SE: IM sorbitol, 20 mM EDTA, pH 8.0. 2. TENPA: 10 mA4 Tris-HCl, pH 7.5, 1 mM EDTA, 100 mM NaCl, 30 pM spermme, 70 pA4 spermidine. 3. MlcromJection buffer IB. 10 mM Tris-HCl, pH 7.5, 0 1 mM EDTA, 100 mA4NaCl, 30 fl spermme, 70 l&! spernndine. 4. LIDS: 1% hthium-dodecylsulfate, 100 mM EDTA, pH 8.0. 5. Zymolyase-1OOT (store at 4°C) (ICN Btomedrcals Inc., Costa Mesa, CA). 6. Nusieve GTG LMP agarose (FMC, Rockland, ME). 7. Seaplaque GTG LMP agarose (FMC). 8. P-Mercaptoethanol(l4M stock). 9. P-Agarase (store at -20°C) (New England BioLabs, Beverly, MA). 10. Dialysis Filters, filter type VM, 0.05 pm pore size, cat. no: VMWP 02500. 11. Petri dishes for tissue culture (NUNC, Naperville, IL). 12. Automatic InJectton System (Zeiss, Germany). 13. Femptotips, Eppendorf (Brmkmann Instruments Inc , Westbury, NY). 14. Insert molds (plug formers) (Pharmacia, Uppsala, Sweden). 15. CHEF-DR II, PFGE system (Bio-Rad Labs, Richmond, CA). 16. SD medium: See Chapter 29. For growth of pYAC4 clones m the host AB 1380 this should be supplemented with 10 mg/L ademne, 20 mg/L histidine, 50 mg/L lysme, 50 mg/L isoleucme, and 50 mg/L tryptophan (maintaining selection for the URA3 gene). For other YAC vectors, hosts, or retrofitted YACs, supplements will have to be altered accordmgly. 17. 1X TAE: 40 mMTris-acetate, 1 mMEDTA, pH 8.5.

3. Methods 3.1. Preparation of High-Density for Preparative PFGE

Plugs

1. Inoculate 500 mL of SD medium (with appropriate supplements, see Section 2.) with the yeast strain containing the YAC and grow the culture in a 2-L flask to late log phase (2-3 d, at 3O”C, 250 r-pm). 2. Prepare a solution of 1% Seaplaque GTG LMP agarose m SE buffer containing 14 mM P-mercaptoethanol and keep at 42°C until use. 3. Spm down cells at 2000g for 5 mm and resuspend the pellet m 50 mL SE buffer. Transfer the cell suspension mto a 50-mL Falcon tube.

YAC Transfer by Microinjection 4. Seal the bottom of Pharmacia plug formers (insert molds) with strips of tape and place them on ice. 5. Wash cells twice with SE (2OOOg,5 mm.). 6. After the last washmg step, discard the supernatant, and carefully remove all liquid by cleanmg the inside of the tube with a paper towel. The cell pellet should be approx 1-l .5 mL. 7. Add 200 mL of SE buffer. With a cut off yellow tip, try to resuspend the pellet. The suspension will be very thick and difficult to pipet. 8. Transfer OS-mL aliquots of the cell suspension mto 2-mL Eppendorf tubes and keep at 37OC. 9. Just before use, dissolve 10 mg Zymolyase-1OOT in 2.5 mL of the LMP agarose solution (see Note 1). 10. Transfer 0.5 mL of this solution to the yeast cell suspension and mix thoroughly the agarose with the cells by pipeting up and down using a blue cutoff tip (see Note 2). Keep the solution at 42°C at all times to avoid setting of the agarose. 11. Using a cutoff yellow tip, pipet 80-mL aliquots of the mixture mto plug formers kept on ice. Leave for 10 min to allow the agarose to set. 12. Transfer the plugs into SE buffer containing 14 mM P-mercaptoethanol and 1 mg/mL zymolyase. Incubate at 37°C for 4-6 h. 13. Replace the buffer with LrDS buffer using at least 0.5 ml/plug and mcubate at 37°C with gentle rocking. After 1 h refresh the LrDS buffer and continue incubation overnight. 14. Wash plugs extensively m TE pH 8.0 until no more bubbles (from LiDS solution) can be seen.Store plugs in O.SMEDTA at 4OCuntil use (seeNote 3). 3.2, Isolation

2. 3. 4. 5.

YAC DNA

Microinjection Cast a gel using 0.25X TAE, 1% agarose. Tape up several teeth of the comb to obtain a preparative lane of approx 5 cm (see Note 4). If the DNA wtll be concentrated by a second gel, standard agarose can be used. Otherwise use 1% LMP agarose (Seaplaque GTG). Wash the high-density yeast plugs for 4 x 15 mm in 0.25X TAE with gentle shaking on a rocking platform. Load the plugs next to one another into the preparative lane (see Note 5) and seal the slot with 1% LMP agarose (0.25X TAE). Run the PFGE in a cooled buffer (0.25X TAE) using conditions optimized to separate the YAC from the endogenous chromosomes (see Note 6). After the gel run, cut off marker lanes on either side of the preparative lane (including approx 0.5 cm of the preparative lane; see Fig. 1) and stam them for

1.

of Intact

298

6.

7. 8.

9. 10. 11. 12. 13. 14. 15. 16. 17.

Schedl, Grimes,

and Montoliu

on a rocking platform in 0.25X TAE buffer containing 0.5 pg/mL ethidium bromide. Mark the positton of the YAC band under UV hght usmg a sterile scalpel blade. Reassemble the gel and excise the part of the preparative lane contammg the YAC DNA. Excise also two slices containing endogenous yeast chromosomes (one greater and one smaller than the YAC, if possible) to serve as marker lanes for the second gel run. Position the gel slices on a minigel tray with the YAC slice m the mtddle and casta 4% Nusteve GTG LMP agarosegel 0.25X TAE around them (seeFig. 1). Run the gel at a 90” angle to the PFGE run (see Fig. 1) for approx 6-8 h at 4 V/cm m 0.25X TAE (circulating buffer). The running time depends on the size of the gel slice as well as on the agarose (percentage and brand) used for the PFGE run. Cut off and stain the two marker lanes (see Fig. 1) to localize the DNA (see Note 7). Excise the concentrated DNA from the corresponding position of the YAC DNA lane. Equilibrate the gel slice on a rocking platform m 20 mL of TENPA buffer for at least 1.5 h. Transfer the gel slice into a 1.5-mL Eppendorf tube and remove all additional buffer using a tine tipped (e.g., yellow tip) pipet. Melt the agarose for 3 min at 68OC,centrifuge for 10 s to bring down all of the molten agarose to the bottom of the tube, and incubate for an additional 5 mm at 68°C. Transfer the tube to 42°C for 5 mm. Add 2 U of agarase (New England BtoLabs) per 0.1 mL of molten gel slice (see Note 8). Incubate for an addttiona13 h at 42°C. Dialyze the resulting DNA solution for 1 h on a floating dialysis membrane (Mtllipore, pore size 0.05 pm) against microinjectton buffer (IB). To determine the DNA concentration, check l-2 yL on a thm 0.8% agarose gel with small slots, using h DNA of known concentratton as a standard (see Note 9). The integrity of the DNA can be checked by running 10-20 uL of the preparation on a PFGE gel (use a comb with small slots). After loading the DNA solution fill the slot with 1% LMP agarose to prevent loss of your sample when placing the gel into the running buffer.

3.3. Injection

into Cultured

Cells

The Zeiss Automatic Injection System (AIS) can be used for rapid injection of large numbers of cells growing on cell culture dishes, A digital camera attached to a microsope transmits an image of the cell mono-

YAC Transfer

299

by Microinjection

A

Excise: Marker

slice

YAC slice Marker slice

!T; -2’ . .

+! ._

I

stain

C

B

Excise YAC DNA I-- I

cut

/-

F cut

Fig. 1. Schematic drawing of the two-step gel isolation procedure. (A) After preparative-PFGE both sides of the gel are cutoff, stained in ethidium bromide (hatched areas), and the position of the YAC DNA is marked under UV-light using a scalpel blade. The gel is reassembled and the region of the gel containing the YAC in the preparative lane (hatched box), as well as two marker slices containing yeast chromosomes (black boxes) are excised. (B) Gel slices are positioned on a gel chamber, embedded in 4% LMP agarose, and standard gel electrophoresis is performed at a 90” angle to the PFGE run. (C) Marker lanes are stained to localize the concentrated DNA and the area corresponding to the YAC is excised from the center lane (see text for details).

300

Schedl, Grimes, and Montoliu

layer to the computer screen. An interactive computer program is then used to position the microinJection needle at the surface of a “reference cell.” The position of the needle tip is stored by the computer and serves as a reference point for the rest of the injections. Nuclei of other cells visible on the screen can now be marked for injection by pressing on the computer mouse. Injections are performed automatically by the computer. The amount of DNA injected can be regulated by altering the length of time taken to carry out the injection as well as the pressure delivered during the injection. High pressures result in higher efflux of the DNA containing solution. The pressure to be set depends on the viscosity of the DNA solution and the size of the needle opening (because each supplied needle is not identical, it has to be adjusted individually in each experiment). The pressure in a standard experiment will vary between 70 and 150 hPa. Almost confluent dishes are best to inject. A too low cell density allows only a few cells to be injected per frame, whereas cells on confluent plates do not grow in one plane making it impossible to set the needle to inject all cells in the frame. The efficiency of micromjectlon will depend greatly on the cell type. Best results are achieved using cells with big and easily visible nuclei. 1. Grow cells on a 60 x 15 mm circular Petri dish (NUNC)

to 80% confluency

m the medrum required by the cell type. 2. Immediately before injection replace 5 mL of fresh medium over the cells. Then add 5-10 mL of liquid

paraffin

over the medium,

which acts as a

barrier to prevent contammation from aerial microbes as well as preventing evaporation of the medmm during mjectlons. 3. Switch on computer, microscope, monitor, Eppendorf mIcroinJector, and pump. Wait for the stage to reset, then place the culture dish on the stage, and bring cells into focus at the lowest magnification (5x). They should now be visible on the monitor screen. 4. Adjust pump to Pl > 3000 hPa (see Note 10). 5. Use the yellow button on the mouse to call up the menu. Choose the command MOVE STAGE from the mam menu to select a region of the dish that is almost confluent and the cells look as if they are growing in one plane. The stage can be moved by clicking (always use the top/yellow button) onto the crossed double arrows. The direction of the arrow mdicates the direction m which the stage ~111 move. The distance from the center of the cross determines the speed with which the stage moves,

YAC Transfer by Microinjection

301

6. Return to the main menu (click twice on mouse) and select MARK/ INJECT. A new menu will appear that allows you to choose from the following options: a. NEW FILE: Allows generation of a file in which the positions of the injected cells will be stored. To use this option the bottom of the dish has to be marked to give the machine left and right hand references (scratch crosses at either side). Find the marks after the plate has been placed on the stage and click cursor on the appropriate box to record the references. If you generate a file you must enter an operator and a sample name. If you do not want to record positions of inJected cells choose NO, and leave the operator and sample as 00. b. APPEND: Allows you to go back to a previous file to find the cells that have been microinjected. c. COPY: Copies settings from an existing file. d. NO: This option does not record the cells that are injected and is sufficient for most applications. e. ANGLE, Z-SPEED, OBJECTIVE, OPTOVAR are used as default, as they appear on screen. 7. Select the number of frames you want to inject by filling in numbers of 10 or less for X and Y values. A frame is the wmdow visible on the screen and, therefore, represents the field in which cells can be marked and injected at a time. Each frame has specific X and Y coordinates. The computer moves along the X-axis first. An array of 5 x 10 frames will allow you to inject more than 1000 cells depending on the confluency of the plate. The maximum number of frames is 10 x 10. 8. Click on DATA OK. 9. Load 1.5 pL of DNA solution mto an Eppendorf microloader and insert it into an Eppendorf Femptotip (microinjection needle) placing it carefully at the very bottom of the tip. Slowly release the DNA solution trying to avoid the introduction of air bubbles, which can block the needle. 10. Twist the needle carefully to remove it from its cover and load the needle by screwing it into the injection needle holder at the microscope. 11. Choose the option ADJUST from the menu. Use the mouse control (yellow button) to lower the needle by clicking onto the arrow in the center of the screen. Hold the mouse button pressed during needle movement. The distance from the center determines the speed of the movement. Start with high speed and slow down when you approach the paraffin layer. Once the needle touches the paraffin find it in low power magnification of the microscope. Use the micrometer screws on the needle holder to center

302

Schedl, Grimes, and Montoliu

the needle in the frame. The needle appears as a dark spot that “ripples” out from the center. Change the lens to higher magnification. Focus on a plane intermediate between the cells and the needle and bring the needle down into focus using the mouse control. Repeat this procedure gradually moving up through 10x, 20x, 32x, and 40x lenses. Care should be taken to move the needle very slowly at highest magnification (i.e., short, 1-s clicks at the slowest speed) as the needle is very prone to being broken. Once the needle is pressing on the chosen cell, a small halo becomes visible. If the needle presses too hard on the cell, it will be punctured and a hole will be visible. If this happens, immediately raise the needle and focus on tt to check it has not broken. Once the needle is touching the cell, click on MARK TIP (2x). This option allows you to use the cursor to mark the tip of the needle so the computer can tdentify its position. 12. The following options are available to adJust the postnon of the needle. a. STEP DOWN: Lowers the needle in the smallest possible increment. b. MARK TIP: Allows to set the reference point for the computer software. To adjust, click on the very tip of the injection needle. This can be repeated during the course of injections. c. INJECTION TIME: Determines the time the needle remains within the cell and is, therefore, one parameter for the volume delivered to the nucleus. This time has to be varied depending on DNA viscosrty, pressure and needle diameter. A time of 0 2 s is a good value to start with. d. MOVE STAGE: Allows you to move the stage directed with the mouse. e. RESTART: Takes you back to the mam menu and you can reset any of the parameters. f. HOME: Takes the needle back to the original posmon. g. POSITION OK: Click on this when you are ready to start imecting. 13. To perform the mjectrons click on MARK NEXT. This will allow you to direct the computer to the nuclei of cells to be injected. Click on MARK and subsequently onto the nuclei. To start the inJections click on INJECT. The computer will perform the injections into the marked cells. If you wish to stop the injection at any point, press on the yellow mouse button firmly and make adJustments. Successfully injected cells can be identified by a temporary dramatic swelling of the nucleus. If no change of cells can be observed after a number of injections, check the following possibilities: a. The injection needle 1sblocked: Use the high pressure button (Pl) at the injection machine control panel to release DNA, which can be monitored down the microscope. If this does not help the needle has to be replaced.

YAC Transfer by Microinjection

303

b. The computer is injecting in the wrong plane: Stop the injections by pressing the yellow button and try lowering or lifting the needle in single step increments. Be careful not to break the needle on the surface of the dish by lowering it too much.

c. Too low pressure:Increasethe pressurefor P3 (usually in the rangeof 70-I 50). Beawarethattoo high pressurewill resultin burstingof the cells. Pressthe mousebutton at any time during injections to adjust the needle height or remark the tip of the needle (see Note 11). To inject the whole frame

againpressRESTART. Alternatively you can carry on with CONTINUE. 14. To finish the injections press RESTART, MARK/INJECT, DATA OK, RESTART, HOME, EXIT. 15. Remove paraffin layer in cell culture hood and add fresh medium. Traces

of paraffin will not be harmful to the cells. 16. Leave in 37°C tissue culture incubator overnight to recover. 17. The following day trypsinize cells and split 1:4 into 100 x 15 mm Petri

dishes (NUNC) (see Note 12). Add selection for DNA uptake. After lO-14 d colonies of cells are visible, which have taken up the mammalian selectable marker present on the YAC. Typically one clonal population of cells can be established per 1000 cells inJected with YAC DNA. Sev-

eral thousand cells can be injected in 3-4 h. 3.4. Pronuclear Injections into Fertilized Mouse Oocytes

The procedure for generating transgenic mice involves isolation of fertilized oocytes from superovulated females, microinjection of DNA into pronuclei and the transfer of injected oocytes into pseudopregnant foster mothers. A detailed description of these steps would be far beyond the scope of this book and we are therefore referring to other literature dealing extensively with this method (see refs. 8 and 9). In the following section we concentrate on differences of the YAC approach to the standard procedure. Preparation of DNA constructs for injection normally involves a filtration step in which the DNA is passed through a membrane with a 0.2~ym pore size. This step is recommended to avoid blocking of the injection needle by dust particles in the DNA solution. YAC DNA preparations should not be subjected to filtration because of shearing forces occurring during this step. We have found that blockage of the needle is a relatively infrequent event if the agarose digestion was successful. In some cases it might be necessary to centrifuge the DNA for 5 min (12,000 rpm Eppendorf centrifuge) to remove undigested gel pieces.

304

Schedl, Grimes, and Montoliu

However, because small particles of agarose can trap DNA, we would strongly recommend to determine the DNA concentration after the centrifugation step. Some DNA preparations are very sticky, which is probably owing to incomplete agarose digestion. In these cases a higher proportion of injected oocytes will be found to lyse and the injection needle has to be exchanged more frequently. Prepare a new batch of DNA for the next injection day and take care to digest all agarose. Flush the pipet once or twice before each injection to make sure the needle has not been blocked. The percentage of lysed oocytes should not be markedly higher, when compared with normal constructs. When using an automatic injection machine, injections can be carried out using the balance pressure only. This is the lowest pressure applied permanently to counteract the capillary force of the needle. Setting the balance pressure at a slightly higher value than normal leads to a continuous flowthrough of DNA. Injections can be controlled by the length of time the needle is allowed to remain in the pronucleus. This “slow” injection probably reduces the shearing forces occurring m experiments with high injection pressures. Injected oocytes can be either transferred on the same day to the oviduct of pseudopregnant foster mothers or incubated overnight at 37°C in Ml6 buffer. Normal survival rates (20-30%) of transferred embryos even at DNA concentrations as high as 5 ng/pL should be obtained. Transgenic animals can be identified by PCR or Southern blot analysis with DNA isolated from tail tips. With 250 kb constructs, approx 1O-20% of the offspring should have YAC DNA integrated. Preliminary data suggest the efficiency with bigger constructs (500 kb) to be slightly lower (5-l 0%). Once a transgenic line has been established it is important to confirm the integrity of the integrated construct. This can be achieved by conventional PFGE mapping and Southern analysis using several probes from different regions of the YAC. However, this requires a detailed knowledge of the restriction map of the construct. Alternatively, the elegant RecA approach can be used to release the entire YAC from the mouse genome (3,lO; and Chapter 8). Constructs of 250 kb and smaller should in most cases integrate as intact YACs and without rearrangements (12). The fate of larger YACs followmg pronuclear mjection is not yet known.

YAC Transfer by Microinjection

305

4. Notes 1. Zymolyase-IOOT does not completely dtssolve at this concentratton. Weigh the required amount and work with a protein suspension. 2. Only a completely homogeneous mixture will yield high-quality plugs with even distribution of yeast cells, and therefore DNA. 3. DNA plugs prepared this way can be storedwithout degradation for at least 1yr. 4. To ensure even migration of DNA through the gel, it 1srecommended to run the preparative lane m the center of the gel. DNA in preparative lanes bigger than 5 cm, may migrate anomalously, thereby producing “smilmg” effects Uneven DNA migration leads to imprecise excision of the YAC and, as a result, DNA at a lower final concentration. 5. Best results are achieved using rectangular plugs (such as produced in Pharmacia plug formers), which can be loaded next to one another without intervening spaces. Use 90 mL of the 1% gel for a small BioRad casting chamber (14 x 12.7 cm). The plugs should occupy the entire height of the gel. Therefore, when casting the gel, make sure that the comb is touching the bottom of the casting chamber. Make sure that the castmg chamber as well as the PFGE chamber are absolutely leveled (use a spirit level) to avotd any loss of DNA during the gel run. 6. Good separatton from endogenous yeast chromosomes is achieved using a single pulse time instead of a time ramp for the entire run. It is worthwhile to test out several conditions before starting the isolation procedure. 7. If the DNA has not yet completely run mto the Nusteve LMP gel, continue the electrophoresis. Because it is impossible to digest normal agarose with the enzyme agarase, tt is important to excise only LMP maternal. 8. Do not add agarase directly from the -2OOC freezer, which can lead to setting of part of the LMP agarose. Load the enzyme into the tip and allow to warm up for a few seconds by placing mto the molten agarose. Carefully release the enzyme while stirring slowly with the tip. Mixmg can be achieved by releasing air bubbles into the solution. 9. It is useful to prepare a 2 ng/pL stock solution of 3LDNA. Loading of 2, 5, 10, and 20 ng of thts standard should allow a relatively accurate determtnation of the YAC DNA concentratton. 10. The Pl readmg must be >3000 hPa for the apparatus to work. Use the black knob on the pump to adjust the vacuum if there is no pressure m the system. 11. It has been observed that the needle has to be raised (or lowered) slightly as it travels along the X-axis. At frame numbers 11,2 I,3 1,41, etc. the needle often has to be lowered (or raised) again to ensure the nuclei are injected. 12. We use Petri dishes rather than flasks, which makes it easier to work with clomng rings once colonies have grown.

306

Schedl, Grimes, and Montoliu References

1. Smtth, D R., Smyth, A. P., Strauss, W. M., and Motr, D T. (1993) Incorporation of copy-number control elements mto yeast artificial chromosomes by targeted homologous recombinatton. Mammahan Genome 4, 141-147. 2. Al-Shawi, R., Burke, J., Wallace, H , Jones, C., Harrison, S., Buxton, D., Maley, S , Chandley, A , and Bishop, J 0 (1991) The herpes simplex virus type 1 thymtdine kmase is expressed m the testes of transgemc mace under the control of a cryptic promoter Mol Cell Blol 11,4207-42 16 3. Gmrke, A., Huxley, C., Peterson, K., and Olson, M V (1993) Mtcromjection of intact 200- to 500-kb fragments of YAC DNA into mammalian cells Genomzcs 15,659-667

4 Gosule, L C and Schellman. J. A (1978) DNA condensatton with polyamines. I. Spectroscopic studies. J MOE Biol 121,3 1l-326 5. ChattoraJ, D. K., Gosule, L. C., and Schellman, J. A. (1978) DNA condensatton with polyammes. II. Electron macroscopic studies. J Mol. Bzol 121, 327-337 6 Montoliu, L., Schedl, A., Kelsey, G., Zentgraf, H , Ltchter, P., and Schutz, G. (1994) Germ line transmission of yeast artificial chromosomes in transgemc mice Reprod Fertll Dev ,6,577-584 7 Brmster, R. L., Chen, H. Y , Trumbauer, M. E., Yagle, M. K., and Palmiter, R. D. (1985) Factors affecting the efficiency of introducing foreign DNA into mice by mtcroinjecting eggs. Proc Natl. Acad. SCL USA 82,4438-4442. 8. Hogan, B., Constantini, F., and Lacy, E. (1986). Manipulatzng the Mouse Embryo, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY 9. Murphy, D. and Carter, D A. (1993) Transgenests m the mouse, m Methods rn Molecular Biology, Vol. 18, Transgenests Techmques (Murphy, D and Carter, D. A , eds ), Humana, Totowa, NJ, pp. 109-l 76. 10. Ferrin, L J and Camerim-Otero, R. D. (199 1) Selecttve cleavage of human DNA RecA-assisted restriction endonuclease (RARE) cleavage. Science 254, 1494-1497. 11 Schedl, A , Montoliu, L., Kelsey, G , and Schittz, G (1993) A yeast artificial chromosome covering the tyrosmase gene confers copy number-dependent expression in transgenic mice. Nature 362,258-260

CHAPTER26

Transfection of Mammalian via Lipofection William

Cells

M. Strauss

1. Introduction The use of baker’s yeast, Succharomyces cerevisiae, for the cloning of extremely large genomic intervals (exceeding 1 Mb) was made possible with the development of yeast artificial chromosomes (YACs) (I). YACs are linear molecules containing all the control elements necessary for stable replication and segregation during the yeast life cycle. This cloning strategy was used to develop a technology for shuttling large genomic intervals back and forth between mammals and yeast. The purpose of this chapter is to provide the investigator with the techniques necessary for transfecting YACs into mammalian cells. This chapter contains four components: 1. 2. 3. 4.

Preparation of YAC DNA; Gel purification of YAC DNA; Introduction of YAC DNA into mammalian cells; and Analysis of transfectants.

Each component includes an overview (with background, critical parameters, and anticipated results), special materials, and protocol(s). 1.1. Preparation of YAC DNA Large amounts of purified YAC DNA are required for transfections and these preparations are expensive and time consuming. A preparation costs the laboratory at least $100 in consumable supplies. To recover enough useful total yeast DNA for gel purification attention must be From. Methods m Molecular Biology, Vol 54 YAC Protocols Edlted by D Markle Humana Press Inc , Totowa, NJ

307

308

Strauss

paid to the growth and embedding conditions. In this section techniques for growth and handling of large amounts of healthy yeast culture are discussed. A fresh moculum of cells is prepared to start a large 24-h culture. After harvesting this large volume of culture, the cellular DNA is processed into intact chromosomal DNA. To maintain its structure the chromosomal DNA is embedded at high density in low melt agarose. This section contains the most important and technically difficult step in this chapter. For preparation of DNA, there are two important qualities of a yeast culture: the number and age of the growing yeast. The growth conditions must ensure that a sufficient quantity of yeast cells from the early stationary phase are available. Older cells, which have entered the late stationary phase, are not suitable, as they have undergone maturation of their cell wall. After maturation of the cell wall, the cells become difficult to spheroplast and the chromosomal DNA preparation is of inferior quality. In chromosomal plug preparations made from cultures with a large fraction of old cells, many of the embedded cells will not be lysed or will be incompletely lysed. Sometimes plugs made from older cultures are also unstable as they may be contaminated by DNA degrading activities. To be practical, quantitative recovery of transfection quality gel-purified DNA also requires that batch to batch variation be eliminated. Every chromosomal DNA prep should have identical quantities of total yeast chromosomes. Final spheroplasted cell concentration must be calculated for each preparation. One must determine experimentally the number of yeast cells recovered, and then project what the final embedding volume (plug volume) should be. This is accomplished by determining the ratio of initial cell volume to final plug volume. This ensures that the loading capacity of the pulsed field gel apparatus is not exceeded. The culture growth preparation as outlined is designed to yield a large amount of relatively synchronized yeast culture at the appropriate stage of maturity. A 2-L preparation of most yeast strains should yield 20 mL of packed cells. This will supply W-120 pg intact YAC DNA. In a given transfection, the typical experiment requires approx 40 pg of a 500-kb YAC. 1.2. Gel Purification of YAC DNA The separation of the yeast genome from YAC DNA is necessary for purification. Currently, only one method is available that ensures reasonable purity and physical integrity. This method is called pulsed field gel

Transfection

of Mammalian

Cells

309

electrophoresis (PFGE) (2,3) and involves the fractionation of the yeast/ YAC DNA in a low melt agarose gel. The region of the gel containing the YAC is excised and then used for subsequent experiments. The PFGE technique only allows a small window of optimal resolution for the separation of DNA species. The desired size range of DNA molecules must first be determined prior to the commencement of the DNA isolation. The PFGE electrophoretic environment can favor the isolation of a single molecular species, The environment can also exclude a certain size class while concentrating the remaining molecular species into a focused band. PFGE-purified DNA has been used as a source for YAC library construction, for FISH probes, and in transfection of mammalian cells (4-6). The critical parameters can be grouped into two categories: DNA preparation (previous section) and PFGE-run conditions. The success of the whole protocol is absolutely determined on the quality of the input DNA. If the DNA is degraded or if the density is too high there will be significant contamination and poor resolution. Time is well spent preparing the highest quality DNA possible. Applied electric field angle proves to be a critical determinant of resolution at high DNA loading concentrations (see Fig. 1). Field angles of 120” are sufficient for low concentrations of chromosomal DNA. However, at cell loading concentrations >0.28 (see Notes 1 and 2), the field angle must be lowered. If one does not lower the field angle the resolution between bands often will be compromised and result in a smeared gel. The optimal applied electric field angle can vary a bit but ranges between 104” and 110”. Routinely, we work with field angles of 105” 107”. One additional benefit of a decreased electric field angle is that the length time for a PFGE run can be reduced. At high DNA loading concentrations the PFGE gel-agarose concentration has a marginal effect on overall resolution. It does prove to have a major effect on overall DNA mobility. For a given DNA concentration, the variation of PFGE gel-agarose concentration over a threefold range can result in a 25% change in mobility. The relative separation of each chromosomal band will not change accordingly. Furthermore, high PFGE-agarose gel concentrations can play a complicating role in recovering the YAC DNA for transfection, whereas very low agarose concentrations can produce a gel that is very fragile (see Notes 2, 3, and 4). Thus, the author routinely works within a range of agarose concentra-

Struuss

kb

Fig. 1. Effect of PFGE field angle on resolution. Identical preparations of yeast chromosomes were loaded on 1% agarose gels and fractionated under either 120” applied field angle or 106’, for similar switching times and run duration. From left, the first seven lanes are the same high concentration plug preparation (0.32; see Note l), the eighth lane is a control of low concentration. Notice the improved separation in the gel run at 106”.

tions from 0.7-l .O%. The author has worked successfully with concentrations as low as OS%, and as high as 1.2%. For most purposes, a concentration of 0.8% is satisfactory. The PFGE switching routine is very important to isolate effectively the particular classes of DNA molecules for further experimentation. PFGE gels can be either run with fixed switching times or with ramped switching times. The main difference between these two types of routines for preparative purposes is that fixed switching routines tend to exclude certain molecular size ranges and focus others. Ramped routines tend to spread resolution over a greater size range with a loss in ideal

Transfection

of Mammalian

Cells

311

resolution for a particular class of sizes. Ideally, if one is trying to concentrate all molecules over a certain size range, and exclude all molecules that are smaller, then a fixed switching routine is perfect. If, however, one is trying to isolate a particular class of molecules, for example, chromosome V from 5‘. cerevisiae, then a ramped routine is preferred, as both molecules smaller and larger can be spread out over a larger portion of the gel. This protocol can produce quantities of DNA in the microgram range per milliter of PFGE gel slice. The degree of contaminating DNA from other size species depends on the quality of the DNA and the amount of DNA loaded on the gel. The more dilute the DNA the lower the contamination owing to comigration of different molecular species. Sample DNA can take various periods of time to prepare; the actual PFGE run time varies from as short as 12 h to as long as 40 h. Runs longer than this can be achieved if one is working with very large molecules (>5 Mb) but the time required to isolate DNA for further experimentation can become prohibitive. 1.3. Introduction of YAC DNA into Mammalian Cells

Efficient transfection of mammalian cells using DNA conjugated to cationic lipids was reported using DOTMA and the process was termed lipofection (7) to distinguish this method from other transfection procedures. With conventionally sized DNA molecules and a variety of currently available cationic lipids, a wide range of efficiencies have been reported. Differing cellular targets respond to a particular lipofection protocol with significantly divergent results, thus no single protocol can guarantee universally optimized success. The scientist must try a variety of lipids, in combination with cells, and DNA. Classification of cells morphologically into two groups can assist in determining the best approach to transfection. Cells in culture either grow in suspension or adhere to a substrate. Cells that grow in suspension grow with a minimal surface exposed to the environment. Adherent cells can either spread out to expose a maximal surface area or they can round up to expose a minimal surface to the environment. This difference in cellular topology is determinant in the choice of a lipofection protocol. The first protocol described herein is designed to work with adherent cells

312

Strauss

that spread out on a substrate. The second protocol is for cells grown in suspension or are adherent but expose the mmimal surface. Ideally, DNA concentration can be varied to optimize the lipid to DNA ratio in the transfection complex. With conventionally sized DNA molecules this is easily accomplished. However, with ultrahigh molecular weight DNA in the form of YACs, the DNA concentration is much less easily manipulated. Purified YAC DNA was first introduced into mammalian cells (5,6,, simply by excising a portion of a low melt PFG gel and mixing the agarased slurry with lipid and applying to adherent cells. Thus, the DNA concentration is limited to the loading capacity of the PFGE system employed. Methods have been described (8) that provide some limited concentration but never provide material better than a fivefold concentration. These concentration procedures can also impair the quality of the input DNA, consequently the investigator must weigh the effort of preparation against the possible results. The protocols described herein assume that the DNA is not concentrated further after gel purification. Transfection of gel purified YAC DNA represents a flexible approach to functional testing of large cloned genomic intervals. Lipofection’s flexibility is the result of three features: 1. Owing to the wide array of commercially available cattonic liplds, many cell types from differing species can be transfected with success. For Instance, cells derived from human sources are known to be dtfticult to transfect via fusion protocols, these cells can be successfully transfected with DNA-hpid mlcelles. 2. Llpofection operates opttmally at low DNA concentrations; thts is the srtuation encounteredwith YAC transfections.Because of the loading capacity of PFGE gels, after puriticatton of YAC DNA, the quantities available range from l-5 pg/2 mL of gel slice. 3. Finally, the technology required to establish hpofection in a laboratory is very modest. Assummg the expertise and facilities to work wtth ultrahigh molecular weight DNA, all that IS requtred IS access to a standard tissue culture facility.

The most important parameters can be divided into those that relate to the DNA-lipid transfection complex, and those that relate to the cells. Transfection of intact YACs relies on the gentle handling of the DNA before and after liquefaction of the agarose. During the dialysis of the

Transfection

of Mammalian

Cells

313

agarose bound DNA, attention must be directed to the quality of the water used to make buffers, it should from a sterile deionized source, double glass/quartz distilled is adequate. Condensing agents must be used with ultrahigh molecular weight DNA to prevent shearing. In general a polyvalent cation will coordinate DNA and compact it. The coordination occurs through the negatively charged PO4 backbone of DNA and a positively charged repeating unit on the condensing agent. The most commonly used condensing agents are the polyamines spermidine and spermine. Spermidine has a coordination number of +3 and spermine +4. Mixtures of spermidine/spermine have been utilized by several investigators in the production of YAC libraries. Spermine has about a 1O-fold greater capacity for condensation than does spermidine (9), thus in the protocols that the author has developed, the use of spermidine has been omitted during dialysis. Also, no additional benefit was observed with concentrations of spermine >500 pM, and the concentration of spermine was reduced to a minimum. The spermine should always be from a fresh source to ensure that it is not oxidized. A second condensing agent, with a very high coordination number (> 1000), poly L-lysine is used during the digestion of agarose. Although the binding of spermine is reversible under the conditions of high salt or electric field strengths of 5-10 V/cm, the binding of poly L-lysme is essentially irreversible. It is very important to use poly L-lysine very sparingly, because over titration will result in the precipitation of DNA into a large stringy mass. The small volume of poly L-lysine is pipeted on to the agarose slice, prior to heating to 6568°C. Never agitate the sample while melting the agarose, as this will shear the DNA. After cooling the melted gel slice to 4O”C, agarase is added. In this cooled state very gentle tapping of the mix can be performed and is sufficient to disperse the enzyme. Never vortex. Similarly, when adding lipid, gentle tapping of the tube is sufficient to disperse the lipid. A polystyrene tube is recommended, as the lipid and DNA will not adhere to the side of the tube. Finally, always use wide bore pipets when transferring the condensed DNA or DNA-lipid complex. There is much lore concerning the transfectability of mammalian cells. Adherent cells occasionally show toxicity with certain lipids, for instance, DOTMA has a very steep toxicity curve owing to the fact that

314

Strauss

the formulation may be difficult for cells to metabolize. This toxic effect is ameliorated by transfecting a confluent monolayer. Confluent monolayers are not ideal for transfection. Transfections should be performed on cells that are growing rapidly, thus it is desirable for adherent cells to be used at a subconfluent stage. As a compromise and as a general rule the cells should have reached near confluence (g&95%) just prior to addition of transfection complex. Suspension cells should not reach saturation prior to transfection. In most saturated cultures, many of the cells can actually be dead or sick, consequently one should use a large volume of recently split cells. Transfection efficiency is cell-type dependent. Even if the protocol is optimized the range of efficiencies can vary over several orders of magnitude. Utilizing murine fibroblastic cell lines and the adherent-cell transfection protocol transfection efficiency can range from 10e5-10” drug resistant clones. Using some embryonic carcinoma cell lines with the suspension cell protocol, similar results can be obtained. With ES cells, the range varies from 1@-10-7drug resistant clones. From this population of drug resistant clones, a portion will contain intact YACs and some YAC fragments. With attention paid to condensing the YAC DNA, prior to transfection, this ratio can be invariant as a function of YAC size. For YAC clones >lOO kb, after transfection, 10% of drug resistant cell clones should contain intact YACs. 1.4. Analysis of Trans fectan ts To determine whether a transfected cell line contains a YAC requires screening many cell lines. This determination can present a significant technical problem. Several approaches exist: 1. Drug selection; 2. Restriction mapping; and 3. In situ hybridization. A complete discussion of these topics is outside the context of this chapter (see Chapters 7-10 in this volume). Some general comments are presented as well as a useful protocol. 1.4.1. Drug Selection of Transfectants In order to differentiate the cells that have taken up YAC DNA from those that have not, drug selection must be used. The YAC can contain a

Transfection

of Mammalian

Cells

315

cis-encoded drug resistance gene or the marker can be cotransfected ($6, IO). Most YACs are from libraries where no drug marker was fashioned into the vector and must be retrofitted with a resistance marker. Many conversion cassettes have been constructed (see Chapters 17 and 21). The important consideration is to use the marker system that will suit the experimental need best. A few general points are worth considering. If two different markers are used, one on each arm, then after transfection each arm of the YAC can be selected. Only those clones with both arms of the YAC would therefore be further characterized. Some marker cassettes also contain rare restriction sites, these sites can be very useful in subsequent characterization. Finally, the location of the drug marker can be chosen with great precision and different locations provide very different advantages. The investigator should carefully consider where to place the selectable marker(s). Because of the nature of the DNA-lipid micelles formed during lipofection, cotransfections are possible. To achieve cotransfection it is necessary to mix a drug marker cassette in a limiting molar quantity with YAC DNA. The DNA-lipid micelle is then formed of two DNA species. The transfection complex is mixed with the target cell. Application of the drug to the media would then proceed as usual. As the marker DNA is present in limiting quantity compared to YAC DNA, the chances for both DNA species to coexist in the same cell line is improved. Despite the limiting amount of selectable marker DNA in the transfection complex, most of the drug resistant colonies will not contain YAC DNA. Thus the central disadvantage of the cotransfection approach is that selection must be followed by a screening step for YAC DNA. This translates into more work for the researcher. When using cotransfection with drug selection one must screen 102-lo3 clones instead of 107-lo* cells in the whole culture. Certainly this is labor saving but it represents 10 times more work than using a colinear selectable marker, The advantage of the cotransfection approach is that the YAC does not have to be modified. For some experiments this is a major advantage. For instance, YACs can be quite unstable. If this situation occurs, then modification by homologous recombination may be prohibited. By cotransfection, one can successfully transfect the gel-purified material despite the inability to modify the clone.

316

Strauss 1.4.2. DNA Isolation

from Transfected

Lines

In order to determine whether transfected cell lines contain YAC DNA, genomic DNA must be isolated from many cell lines. The following protocol was designed to facilitate the isolation of small amounts of DNA for initial screening of hundreds of cell lines. Most conventional methods for isolating genomic DNA utilize a proteinase K step followed by phenol/CHCl, extraction to remove protein. The DNA produced by this type of method is very pure and stable in storage. Unfortunately, the organic extractions require multiple pipeting steps and transfer of aqueous DNA solution to several different tubes. When dealing with many samples, this represents a prohibitive amount of work. The protocol described here does not involve any organic extractions or tube changes (11). In fact, the cellular tissue is lysed right in the growth vessel, a 24-well dish. This protocol enables a single investigator to produce restriction enzyme digestible genomic DNA from hundreds of cell lines with a marginal commitment of effort. Proteinase K is a very robust and stable enzyme. This protocol utilizes the minimal amount that still allows for isolation of high quality DNA. If the investigator exceeds the amounts specified, proteinase K activity will still be found in the processedDNA. This carryover of proteinase K activity will prevent the digestion of the DNA with restriction enzymes and the DNA will be useless for analysis by Southern blotting and hybridization. During the overnight digestion of the DNA with proteinase K, the samples must be mixed. The consistent gentle agitation of the tissue culture plate ensures that the cells are completely dispersed and digested. If the plate is not rocked, there will be incomplete processing and the DNA will fail to digest well. The 24-well dish can contain varying numbers of cells depending on the nature of the cell line. It is important to ensure that each well has grown up to confluence, or near confluence. It is also important that there is little well to well variation. When consistent numbers of cells are available then the recovery of DNA will be similar from well to well. After the cells are grown up in the 24-well dishes, it is expected that high grade DNA will be available in less than 2 d. The difference between working with one 24-well tray and 10 trays is minimal. Furthermore the yield of DNA does not vary with the scaling of the experiment. In general one can expect 100-200 pg of DNA recovered from each well, this is enough for about 10 restriction digests or 10 lanes on a gel.

Transfection

of Mammalian

317

Cells

1.4.3. Determination

of YAC Xntegrity

The central issue in transfections of YACs is the integrity of DNA after manipulation. DNA integrity can be impaired in the yeast host, during gel purification or during the transfection itself. Given the very large size of YAC clones, the determination of YAC integrity represents a formidable problem. There are three approaches to determination of YAC integrity (see Chapters 7-10 in this volume). The first approach utilizes a single probe which hybridizes in very many locations to YAC DNA. One such probe would be a LINE sequence probe. This probe can be used in combination with a restriction enzyme that recognizes a six-base sequence to generate a YAC fingerprint. The fingerprint of the YAC before transfection is compared to the transfected YAC fingerprint. If there is significant similarity between the two fingerprints then there is a good chance that the YAC is intact. The second approach to determination of YAC integrity relies on the availability of many unique sequence probes. These unique probes are derived specifically from different regions of the YAC. Hybridization of these probes to cell line Southern blots indicates the presence (or absence) of particular regions, the YAC. This hybridization can be accomplished individually or in pools. A pooling strategy can significantly reduce the amount of work, and the resulting data will look much like the fingerprint generated with a repeat probe. Both of the two preceding approaches can yield important information using infrequent or frequently cutting restriction enzymes. The choice of enzyme is largely dictated by the method of DNA preparation. If the high throughput DNA isolation protocol (see Section 3.4.) is used then a frequent cutting enzyme must be used with a standard electrophoretic environment. If the YAC DNA can be differentiated from host DNA by restriction fragment length polymorphisms (RFLPs), then probes from the YAC vector or from the cloned insert can be used for structural analysis (see Fig. 2). For instance, if a human YAC clone is transfected into a murine cell line then either of the foregoing two approachesto restriction mapping could be used. On the other hand if the degree of polymorphism between the YAC and host genome is not great, only the second approach may be useful. One example is the use of A4us spretus YAC clones to transfect MUS musculus cell lines. In this case there is little repeat sequencedivergence, so a repeat sequence fingerprint cannot be generated. There is sufficient sequence

318

Strauss

divergence, however, to differentiate a spretus YAC from a musculus genome with unique sequenceprobes and informative restriction enzymes. The appropriate choice of enzyme will differentiate the YAC sequences from the host sequences(see Fig. 2). In either case, the vector probe will allow the investigator to determine the copy number of each arm in the transfected cell line. For instance, no BamHI sites exist in the pYAC4 vector, thus using this enzyme and a probe from one arm will show a single hybridizing band if the YAC is present in single copy number (see Fig. 2). The arm specific probes easily can be generated by the digestion of pBR322 with PvuII and BamHI. The two fragments generated will each correspond to one arm. A variant of restriction mapping for the purpose of determining the integrity of transfected YAC DNA depends on engineering the YAC before transfection. If rare cutting sites are constructed into either side of the YAC vector, then an even stronger demonstration of integrity after transfection can be made. If these rare cutting sites are not found in the cloned insert, after restriction digestion, fractionation, and hybridization a unique restriction fragment the approximate size of the original YAC will be revealed only if the transfectant contains an intact YAC. Rearranged transfected YACs should exhibit a band of different mobility. The third approach to determination of transfected YAC integrity requires fluorescent in situ hybridization technology (FISH). Mitotic and interphase chromosomes of transfected cell lines can be analyzed by this technique. One can determine which YAC fragments are present in the cell line, which fragments are colinear, and where in the genome the YAC transgene is located. YAC specific probes can be screened rapidly by this procedure with a point to point resolution of ~10 kb when using the interphase chromosome. 2. Materials of Large Volume Yeast Cultures Density Chromosomal DNA

2.1. Preparation and High 1. Digestion buffer: 250 mA4 EDTA, 20 mM Tris-HCl, pH 7.6, 2% n-lauryl sarcosine, 0.5 mg/mL proteinase K. Add the ProtemaseK fresh prior to use. 2. Phenylmethylsulfonylfluoride (PMSF) 100X stock: 100 mM PMSF in 100% isopropanol, made up fresh prior to use.

3. Storagebuffer: O.lM EDTA, 0.02M Tris-HCl, pH 8.0.

DmIn --~-

Pm

Wllll

12341234

I2 +

BAMIII

34

1234

P3-n 1234

wull I2

3

BUlm 4

Pm

I2341234

wuw I

g

34

l i-

-9-4 ‘e -4.3

i 1 -M i -24 4 1

Lt

Rt

Fig. 2. RFLP analysis of ES cells transfected with a YAC. The ES cells were propagated without feeders on gelatincoated tissue culture plates in the presence of lo3 U/mL of leukocyte inhibitory factor (LIF). DNA was prepared in plugs, digested with’BamH1, MI, or PvuII, separated by.electrophoresis on a 1% gel and transferred to a Zetabind filter (Cuno). DNA was successively hybridized to a collagen cDNA probe, a left arm (Lt) YAC probe or a right arm (Rt) YAC probe. Lanes 1 and 2 contain DNA from transfected ES cells, lane 3 contains M. muscuhs DNA and lane 4 contains M. spretus DNA. The figure clearly shows the power of RFLP analysis for the demonstration of successful transfection of YAC DNA.

320

Strauss

4 5. 6. 7.

5% SeaPlaque-GTG agarose m 100 mM EDTA, pH 8.0 Zymolyase 1OOT(Seigaku America Inc., Rockville, MD). 1M Sorbitol, 20 mM Tris-HCl, pH 7.0. Drop out mix powder (lacking uracil and tryptophan for selection of conventional YACs): Mix together well 2 g (except where noted) of each of the following dry constituents:adenine, alanine,p-ammobenzotc acid (0.2 g), arginine, asparagme, aspartic acid, cysteme, glutamic acid, glutamme, glycine, histidine, rnositol (0.1 g), isoleucine, leucme (4 g), lysine, methtonine, phenylalanme, prolme, serine, threonme, tyrosme, valme. Store at room temperature. 8. Rich drop out media: Add 2 g of the appropriate drop out mix to flask 1, then add 1.45 g yeast nitrogen base without ammo acids and ammonium sulfate (Difco, Detroit, MI), 5 g ammomum sulfate (Difco), and 500 mL of dH20. In flask 2 suspend 20 g agar m 450 mL dH,O, autoclave each separately and then mix, and add 50 mL of 40% glucose. Pour plates and allow to set for 24 h prior to use. Liquid media is prepared in a similar fashion except that the agar is omitted. 9. @Mercaptoethanol (Sigma, St. Louis, MO). 10. PFGE plug molds. 1 2 3. 4. 5. 1. 2. 3. 4. 5.

2.2. Gel Purification 1OX TBE (Tns-borate-EDTA) electrophoresis buffer: 242 g Tris base, 123 g Boric acid, 5.2 g EDTA-Na,, dissolve m 4 L of dHzO. Dilute 1:20 prior to use m a PFGE apparatus, 1:10 for other electrophoretic applications. Low melt agarose: SeaPlaque GTG agarose (FMC, Rockland, ME). PFGE apparatus (BioRad [Richmond, CA] CHEF DRIII). Ethidtum bromide (10 mg/mL stock solution). Dialysis buffer: 20 mMTris-HCl, pH 7.6, 1 mMEDTA, 100 l..uJ4spermme. 2.3. Lipofection Dulbecco’s Modified Eagle media (DMEM) (Gibco-BRL, Gaithersburg, MD). 10X DMEM (Gibco-BRL). OptiMEM (Gibco-BRL). Evans-Kaufman (EK) media: 500 mL high glucose DMEM, 75 mL fetal bovine serum, 5 mL nonessential amino acids, 5 mL pemctllin/streptomycin, 4 pL P-mercaptoethanol (all available from Gibco-BRL). Commercially available lipids (see Note 5): a. Gibco-BRL. Lipofectin (DOTMA and DOPE), lipofectamine (DOSPA and DOPE). b. Boehringer Mannheim (Mannheim, Germany): DOTAP. c. Promega (Madison, WI): DOGS.

Transfection

of Mammalian

Cells

321

6. Condensing agents: spermine (Fluka, Buchs, Switzerland), poly+-lysine low molecular weight (Sigma, PO879). 7 Plasticware: 100-n-u-ncell culture dishes, T75 and T175 cell culture flasks. 8. P-Agarase: For transfections, it is important to use a very high quahty agarase, two preparations (NEB and Gelase) are recommended.

2.4. Genomic

DNA Isolation

1. Lysis buffer: 100 mMTris-HCl, pH 8.5,5 rnMEDTA, 0.2% SDS, 200 mM NaCl. On day of procedure add proteinase K stock to produce 100 pg/mL. 2. Proteinase K stock solution (1000X): 100 mg/mL m 20 mM Tris-HCI, 1 rnMEDTA, pH 8.0. 3. T,,E: 20 mMTris-HCl, pH 7.6-8.0, 1 MEDTA. 4. Plasticware: 24-well cell culture dishes. 3. Methods

3.1. Preparation and High

of Large Volume Yeast Cultures Density Chromosomal DNA

1. Inoculate 50 mL of rich drop out media with a 1:100 dilution of a stationary culture. 2. Grow the culture overnight at 30°C in a roller drum to saturation. 3. Inoculate 2 L of the same drop out media with the fresh overnight culture at an inoculation of 1:100. 4. Shake cultures at 260 rpm at 30°C. (Grow up for a duration not to exceed 24 h. It is important not to overgrow the culture.) 5. Transfer the cells and broth to Beckman 1-L canister bottles and spin in J6 at 800-l OOOgfor 10 mm to pellet cells. 6. Resuspend cells in distilled deionized water and repeat the pelletmg. 7. Resuspend cells in 1M sorbitol and repeat the pelleting. 8. Resuspend cells in 10 mL of 1M sorbitol and transfer to a 50-mL plastic conical, rinse out the 1-L canister to recover all of the cells, and add to the 50-mL tube. 9. Spin down the cells m 56 at SOCrlOOOgfor 5 min and gently remove the clear supematant; the sorbitol will contrtbute 10 mL of volume, the total volume should be 30 mL so there should be approx 20 mL of cells (see Note 1). 10. Add 17 mL of 1M sorbitol and 1 mL of /3-mercaptoethanol to bring final volume to 48 mL, then add 60 mg of zymolyase 100-T. After mixing, split the reaction between 3 x 50 mL conical tubes (16 ml/tube) and mcubate at 37°C for 45-70 min till spheroplasted (check microscopically, see Note 6). 11. Add 5 mL of 5% SeaPlaque GTG low melt agarose in 100 mA4 EDTA (equilibrated to 54°C) and immediately cast m plug molds.

322

Strauss

12. Eject plugs into two fresh 50-mL plastic conicals, using an air line. 13. Add digestion buffer (with fresh proteinase K) and digest overnight at 5055OCwith very gentle agitation. 14. Treat with 1 mMPMSF by simply adding a 1: 100 volume of stock solution to the tube and letting sit for 60 min at room temperature. 15. Decant inactivated digestion buffer and add storage buffer.

3.2. Gel Purification

of YAC DNA

1. Prepare source DNA in agarose plugs, and dialyze in 0.5X TBE. 2. Pour a 0.5-l .2% low melt agarose gel in 0.5X TBE using a glass casting plate with velcro strips. Use a single slot trough with small wells at either end for lane markers (see Fig. 3; Note 4) 3, Equilibrate the DNA plugs against runnmg buffer (0.5X TBE) and load them into the slot trough lengthwise. Make sure that the plugs are as close to each other as possible without placing them under significant compression. The plugs can be sealed in the trough with a little warm agarose. (Use the same mixture as you used to pour the gel.) 4. Into the outer lanes, load sizemarkers to ensure accurate sizing of the DNA fragments. (If one is fractionating whole yeast chromosomes this step is unnecessary.) 5. Place the whole glass plate (with the gel firmly attached to It) mto a prechilled PFGE apparatus. Let the gel equilibrate in the chamber for lO15 min, then commence the PFGE run. 6. After the PFGE run is complete, slice off the left and right edges of the gel contaming the size markers and a small portion of the sample DNA. Carefully slide these samples into a staining bath containing running buffer with 100 mg/L ethidium bromide. Let the gel slice slices stain for 30-60 min, and destain with buffer alone for 30-60 min (see Notes 7 and 8). 7. Place these slices side by side with a ruler atop a UV transilluminator (short or medium wave UV is suitable) and photograph. (It 1simportant to examme both sides of the gel as PFGE gels often run with a little deformation from edge to edge.) 8. Going back to the remaining unstained gel, place two rulers on either side of the gel. Line up a third ruler along the width of the gel using the photograph as a reference. Use a clean scalpel to slice a strip of the desired section of the gel. 9. Transfer this slice to a 50-mL conical centrifuge tube and dialyze against the dialyses buffer listed in Materials. (At least three changes are required over a course of 12 h.) The DNA is usually stable for several days to a week, but it should be used as soon as possible.

Transfection

of Mammalian

Cells

323

I

‘\ velcro teeth

\

g ass

20 cm

_I

1

b

20 cm

Fig. 3. A schematic for the construction of a large format gel support. Velcro teeth are glued to a standard glass plate with silicone adhesive. The gel is then cast by wrapping tape around the edges of the plate, inserting the slot comb onto the plate, and pouring melted agarose onto the plate. IO. In order to accessthe gel-bound DNA, subdivide the gel slice in to OS- to 2.0~mL sections and transfer into capped and sterile 15-mL round bottom polystyrene tubes (Falcon, Lincoln Park, NJ).

3.3. Lipofection

Procedures

3.3.1. Lipofection of Adherent Cells 1. A few days (depends on growth rate of cells) prior to the transfection, plate out cells onto 100-mm dishes. The plating should ensure that the day of the transfection the cells will be 95% confluent (see Note 9).

324

Strauss

2. On the day of transfection add to the gel slice poly L-lysme to a final concentration of 4 pg/mL. Warm the tube to 65-68”C until the gel slice 1s melted and equilibrate at 40°C for 5 mm. 3. Add 10 U of P-agarase, gently mix, and allow to digest for 60-120 mm. 4. Add the appropriate amount of catiomc hpid (for DOTAP 5-30 pg) and allow the mixture to complex at room temperature for 30 min. 5. Equilibrate the transfection complex sample with 1:10 volume of 10X DMEM, 1 mL of OptiMEM can be added. The final volume should be between 2 and 5 mL. 6. Wash the monolayer of cells free of standard medium with OptiMEM and then apply the transfection complex (see Note 10). 7. Stop the transfection at 4 h or continue overnight depending on the viability of the cells. Stop the transfectton by changing to fresh media. Culture for 24-48 h and apply selection. 3.3.2. Lipofection of Cells in Suspension Some cells grow in suspension, and some cells that grow adherently

are better transfected in suspension. In particular this protocol was developed for use with murine embryonic stem cells (ES cells). I. Thaw a vial of ES cells and expand on a feeder layer in a T25 flask for 3 d. Split the flask 1:6 on to 3 x T75 flasks and culture for 3 d. Dependmg on the size of the experiment these three flasks can again be split 10X T175 (approx 1:8 spht by surface area). It IS important to use the cells on d 3. 2. On d 3, trypsimze the cells and remove the feeder cells from the culture by preplatmg on fresh plastic plates for 30 min at 37°C. Wash the nonadherent cells and count. 3. Add 5 x 106-1 x 1O7cells to each 15-mL polystyrene tube (Falcon) containing the prepared transfection complex (see Section 3.3. I.), loosely recap, and place m an mcubator at 37OCfor 4 h with occasional (once an hour) gentle mixing to resuspend the settled cells. 4. Subsequently plate the cells from each tube mto a single lo-cm trssue culture dish over a monolayer of uradiated feeder cells in Evans-Kaufman (EK) media. 5. Change the media 24-48 h later and place the cells under selection. This is called d 0. 6. By d 2 there should be massive cell death, and few colonies should remam. By d 6 real resrstant colomes should be discernible from background and colonies can be picked on d 8-10 (see Note 11).

Transfection

of Mammalian

3.4. High

Throughput

325

Cells Genomic

DNA Isolation

1. Into each well of a 24-well tray containing growing cells, pipet 500 PL of lysis solution. 2. Incubate overnight at 55°C on a gently rocking or rotatmg rack. 3. Add 500 PL of isopropanol. 4. Rock the samples back and forth to mix. After the samples are well mixed the DNA should precipitate and form a lacy pellet. 5. With a fresh yellow tip pick the pellet out of the tube and transfer to a fresh tube, the samples can be washed (optional) with 95% ethanol. 6. When all tubes are complete add 100 PL of TzoEto the samples and allow to resolubilize. Use 10 PL for each genomic digest destined for Southern blot.

4. Notes 1. All the proportions of sorbrtol and agarose are calculated to achieve a certain concentration of cells, expressed as a ratio of initial cell volume to final agarose plus cell plus sorbitol volume. The desired ratio of cell volume to final plug volume is between 0.32 and 0.35. For example, if one has 20 mL of cells and wants a final ratio of 0.32 then the final amount of agarose embedded cells would be 63 mL (20/63 = 0.32). 2. Do not overload the gels, DNA density in the plugs makes a significant difference in final resolution on PFGE. Routine concentrations of 6 x 1OS to 1 x 1Ogyeast cells per milliliter are never a problem, very high concentrations of yeast can be used with care. 3. It takes quite a while for the low percentage agarose gels to solidify, one trick is to cast the gel m a 4OCcold room. 4. The gel setsinto the velcro and thus the casting plate grips and supports the delicate gel during handling and electrophoresis. This item is easily homemade utilizing velcro strips (only the teeth portion) silicon glue and a standard 20 x 20 glass plate. 5. Transfection lipids: a. DOTMA: N-[ l-(2,3-diioleyloxy)propyl]-N,N,N-trimethylammonium chloride. b. DOSPA: N-[2-( (2,5-bis(3-aminopropyl)amino]- 1-oxypentyl} amino) ethyl]-N-,N-dimethyl-2,3,bis(9-octadecenyloxy)1-propanaminium trifluoroacetate). c. DOTAP: N-[ 1-(2,3-Dioleoyloxy)propyl]-N,N,N-trimethyla~oniummethylsulfate. d. DOGS: Dioctadecylamidoglycyl spermidine. e. DOPE: dioleoyl phosphatidylethanolamine.

326

Strauss

6. Microscopic determination of spheroplasting is best achieved m the following manner: Prepare a 1% SDS and 1M sorbrtol solution. On a microscope slide place a 10-pL drop of the SDS and 10-nL drop of the sorbitol m a separate location. To each drop add 2.5 nL of the treated yeast culture. Mix and cover the drops with a coverslip. Examme the cells under a phase microscope at 200x magnification. The sorbitol-treated cells should look unchanged from untreated cells, the SDS-treated cells should appear blown apart, pale, and ghost-like if successful spheroplasting has been achieved. 7. It facilitates further transfer of these staining samples to place the strips on top of a plastic or glass sheet prior to and during staining. 8. This step improves the signal to noise ratio by reducing the background. 9. It has been observed that there is less toxicity with confluent monolayers. 10. It is important to transfer the transfectlon complex as gently as possible to ensure that the DNA is not sheared. The use of wide bore pipets is recommended. 11. Some cells grow m a nonadherent manner, for selection of nonadherent cell lines different strategies must be employed. Obviously, if one IS working with a cell line that grows m suspension the latter half of this protocol is inappropriate. After the transfection step the cells can be selected in bulk and then cloned in microtiter wells after a significant period of drug selection. The disadvantage of this approach is the faster growing clones. Clones that grow faster will tend to predominate and bias recovery of other clones. An alternative IS cloning or simple fractionatron of the transfected cells prior to the commencement of selection.

References 1. Burke, D. T., Carle, G. F., and Olson, M. V. (1987) Cloning of large segments of exogenous DNA into yeast using artificial-chromosome vectors. Science 236, 806-812. 2. Schwartz, D. C. and Cantor, C. R. (1984) Separation of yeast chromosome-sized DNAs by pulsed field gradient gel electrophoresis. Cell 37,67-75. 3. Chu, G., Vollrath, D., and Davis, R. (1986) Separation of large DNA molecules by contour-clamped homogeneous electric fields Scrence 234, 1582-l 585 4. Strauss, W. M., Jaenisch, E , and Jaemsch, R. (1992) A strategy for rapid production and screening of yeast artificial chromosome libraries. Mammaltan Genome 2, 150-157. 5. Strauss, W. M and Jaenisch, R (1992) Molecular complementation of a collagen mutation in mammalian cells using yeast artificial chromosomes. EMBO J 11, 417-422 6. Strauss, W. M., Dausman, J., Beard, C., Johnson, C., Lawrence, J. B., and Jaemsch, R. (1993) Germ line transmission of a yeast artificial chromosome spanning the murine alpha 1(I) collagen locus. Sczence 259, 1904-l 907.

Transfection

of Mammalian

Cells

327

7. Felgner, P. L., Gadek, T. R., Holm, M., Roman, R., Chan, H. W , Wenz, M., et al (1987) Lipofection, a highly efficient, lipid-mediated DNA-transfectton procedure. Proc Nat1 Acad. Sci. USA 84,74 13-74 17 8. Lamb, B. T., Sisodia, S. S., Lawler, A. M., Slunt, H. H , Kttt, C. A., Kearns, W. G., et al. (1993) Introduction and expression of the 400 kb precursor amyloid protem gene in transgenic mice. Nature Genet 5,22-30 9. Gosule, L. C. and Schellman, J. A. (1978) DNA condensation with polyamines. J Mel Biol 121,3 1l-326 10. Chow, T. K., Hollenbach, P. W., Pearson, B. E , Ueda, R. M., Weddell, G N , Kurahara, C. G., et al. (1993) Transgenic mice containing a human heavy chain immunoglobulm gene fragment cloned in a yeast artificial chromosome. Nature Genet 4, 117-123. 11. Laird, P W., Zyderveld, A., Linders, K., Rudmcki, M. A., Jaenisch, R., and Berns, A. (199 1) Simplified mammalian DNA tsolatlon procedure. Nucleic Acids Res 19,4293.

CHAPTER27

The Isolation of cDNAs by Hybridization of YACs to cDNA Libraries Russell

G. Snell

1. Introduction The isolation of genes from large candidate regions is one of the major problems for the molecular biologist. With the advent of yeast artificial chromosomes (YACs), the problem of cloning these regions is now largely solved; however, screening these large genomic regions for expressed sequences is still a very time-consuming task. The scale of this task will become even greater as the emphasis shifts to the identification of the genes involved in polygenic disorders. There are a number of methods for identifying expressed sequences, all of which have their merits and difficulties. It is likely that more than one method will be necessary to isolate all the genes coded for in a genomic region. The hybridization of radioactively labeled YACs to filter lifts of cDNA libraries is described in this chapter. This is a relatively straightforward method for isolating at least some of the genes from within a candidate region (1,2). It has been used successfully to identify specific genes, including the neuroflbromatosis type 1 gene and the human alpha adducin gene, demonstrating the potential power of this technique (3,4). The main advantage of this technique over others is its simplicity. 1.1. Overview of the YAC Hybridization Method There are two problems in using YACs as hybridization probes. First, YACs are lO&lOOO times longer than the DNA generally used as a From Methods m Molecular Biology, Vol 54 YAC Protocols Edited by D Markle Humana Press Inc , Totowa, NJ

329

330

Snell

probe. The molar concentration for an equivalent mass of a YAC IS 1OOto lOOO-fold less. Consequently, as the signal from a hybridization is directly related to the net activity per copy, the activity per kilobase has to be increased for anywhere near equivalent results. Second, the large numbers of repeat sequences in a YAC that will be labeled as part of the probe must be stopped from hybridizing to prevent spurious clone detection. In the method described here, the first difficulty is overcome by simply using lo- to 20-fold more isotope in the YAC labeling reaction over a conventional reaction for an equivalent mass of DNA. Longer autoradiographic exposure times also “enhance” the signal. The second difficulty is avoided by preannealing the repeat sequences in the probe and on the plaque lift filters with competitor DNA. This effectively removes these sequences from the hybridization. In order to reduce the complexity of the probe, and thereby increase the hybridization signal, the YAC is first separated by size from the majority, or ideally all, of the host’s chromosomes. This is accomplished using preparative pulsed field gel electrophoresis (PFGE) (5,6). The YAC DNA is then retrieved by cutting it out of the gel. This is then used as a probe after radioactively labeling to a high specific activity and prehybridizing with added cold DNA. In some cases, when YACs cannot be separated from comigrating yeast chromosomes, these have to be included in the probe. This increases the complexity of the probe so more isotope may have to be added to the labeling reaction. The cDNA library to be screened obviously should be made from the tissue that is likely to contain the transcripts of the gene of interest. The library is plated at a relatively low density, as large plaques are easier to detect. Filter lifts are taken from the plates and prehybridized in denatured blocking DNA. This step again results in the preferential annealing of repeat sequences and blocks nonspecific sites on the filter. The preannealed probe is then added to the preannealed filters and allowed to hybridize. Following the hybridization, the excess probe is washed off at various stringencies aiming for a low background without removing the specific hybridization. Positively hybridizing plaques are then replated and screenedagain in the sameway. Clones that come through this procedure are localized by hybridization back to the YAC (and, if possible, somatic cell hybrid DNA), which also serves as a check for the presenceof repetitive sequencesin the clone.

The Isolation

of cDNAs

The three most important parameters in this method are the choice of library to screen, the activity of the probe, and the stringency of the posthybridization washes. Even with all these precautions however it is unlikely that the procedure can be optimized so that only true localizing clones are isolated. This results in part because low level repeats are not effectively blocked from the probe and also the true signal to background ratio is low. 2. Materials 1. Yeast synthetic drop out media (seeChapter29). 2. SE: 75 mMNaC1,25 mA4 EDTA, pH 8.0. Sterilize by autoclaving. 3. Low melting point (LMP) agarose. 4. 0.5M Dithiothreitol (DTT). This is prepared m SE, filter sterilized, and stored at -2OOC. 5. 10 mg/ mL Lyticase (1000 U/mg, Sigma [St. LOWS,MO] cat. no. L8012), prepared in SE and used the same day. 6. OSM EDTA, pH 9.5. 7. Sodium lauryl sarcosyl (SLS). 8. Proteinase K (20 mg for each YAC clone grown). 9. 5X TBE: For 1 L 54 g Tris, 27.5 g boric acid, 20 mL 0.5MEDTA, pH 8.0. 10. 10 mg/mL Ethidium bromide. Powder is dissolved in water and stored at room temperature m a light proof vial. 11. [a-32P]dCTP (3000 Ci/mmol, Amersham, Arlington Heights, IL). Partlcular care should be taken when handling the radioactive isotope as a considerable amount is used in this procedure. 12. Sheared human placental DNA (Type III Sigma). 13. Sheared denatured salmon sperm DNA (Type III, Sigma). 14. YAC vector DNA. 15. 20X SSC: For 1 L 175.3 g NaCl, 88.2 g sodium citrate. Adjust pH to 7.0 with NaOH. 16. 50X Denhardt’s reagent: For 500 mL, 5 g Ficol (type 400 Pharmacia,

Uppsala, Sweden), 5 g polyvinylpyrrolidone, 5 g bovine serum albumin (BSA) (fraction V, Sigma). Filter sterilize and store at -20°C. 17. 18. 19. 20. 2 1.

Sodium dodecyl sulfate (SDS). PEG 8000. Phage cDNA library. Hybond N (Amersham, Amersham, UK). 1OX Klenow polymerase buffer: 0.5M Tris-HCl, pH 7.5, 0. 1M MgCl*, 10 WDTT, 0.5 mg/mL BSA.

22. Escherichra coli DNA polymerase 1, Klenow fragment.

332

Snell

23. 3dNTP mix, each 0.5 mA4 (minus dCTP). 24. Random hexanucleotides (Pharmacta). 25. Block molds, 100 each 100 pL in volume and shaped to produce wellshaped blocks.

3. Methods 3.1. Growth ofYeast Containing YACs and Preparation of DNA in Blocks This method produces 100 blocks of 100 yL in volume, each containing approx 3 l.tg of DNA. 1. Inoculate 200 mL of appropriately supplemented mmimal medial (see Chapter 29) with a few mtcroliters of a glycerol stock. Grow for 2 d shaking at 30°C. 2. Make up fresh 5 mL of 2% LMP agarose in SE containing 1mg /mL (1000 U/ mL ) lyticase and 50 mM DTT/200 mL of initial culture. Melt the agarose in the SE and cool to 42OCbefore adding the lyticase and DTT. Keep at 42°C for use. 3. Harvest the yeast by centrifugation at SOOgfor 5 min and wash by resuspending the pellet in 50 mL of SE and recentrifuge. Repeat this step. 4. Resuspend the washed pellet in 5 mL of SE, incubate at 42°C for a few minutes. 5. Mix the cells m SE with the LMP agarose, DTT, lyticase by pipeting up and down a few times, then pour mto the molds, and allow to set. 7. Place the agarose blocks containing the cells in 5 mL of SE with 25 mM DTT and 0.5 mg/mL lyticase (500 U/mL), for 4 h at 37°C. 8. Pour off the solution and add 9 mL 0.5M EDTA, pH 9.5, 1 mL of 10% SLS, and 20 mg of proteinase K. Incubate at 50°C for 48 h. The DNA containing agarose blocks can then be stored m this solution indefinitely at 4°C (see Note 1).

3.2. Purification

of Probe DNA by PFGE

1. Precool the running buffer (0.5X TBE) to the desired temperature m the electrophoresis tank. 2. Make a 1% LMP agarose gel without ethidium bromide. 3. Load samples into the wells of the gel, making sure that the top of the sample is below the surface of the gel. It is not necessary to wash the blocks before electrophorests. To prevent samplesfrom floating out of the gel, some warm LMP agarose can be added to the sample in the well. 4. Place the gel m the tank making sure that the gel will remain flat on the bottom of the tank or tray during the run.

The Isolation

of cDNAs

5. Electrophoresis conditions will vary according to the apparatus used and the size of the YAC to be separated. Using CHEF apparatus from BioRad (Richmond, CA) ramped pulse times from I O-200 s over 42 h at 160 V are good starting conditions for YACs >3OOkb.For YACs smaller than this, a ramp of 5-80 s over 22 h at 200 V and 14°C gives good resolution. More generally, lengthening the average pulse times increases the difference m mobtlity of larger YACs. 6. After electrophoresis the DNA is stained by soaking the gel m the runnmg buffer containing 5 pg/mL of ethidium bromide for 30 min. 7. An estimation of relative level of fluorescence is made of the YAC band to determine the amount of DNA and it is cut out of the gel (see Note 2). 3.3. cDNA Library PZating (see Note 3) There are many well written protocols for plating phage libraries that vary slightly depending on the vector-host cell combination (7,s). The only variation from these protocols recommended is to reduce the density of the plaques to approx 2000/g-cm plate and grow them to confluence. The larger plaque size enables easier clone identification. Plaque lifts are taken on Hybond N (Amersham) according to the manufacturer’s instructions. It may be that if an alternative membrane is used, the hybridization protocol, in particular the filter blocking, may have to be changed. 3.4. Probe Labeling, Filter Prehybridization, and Hybridization A considerable amount of isotope is used in this procedure. Care should be taken to minimize exposure. The labeling method is random primer extension (9). 1. Estimate the concentration of DNA in the agarose containing the YAC band by comparing the amount of DNA (as estimated by relative fluorescence) with the mass of the agarose. 2. Melt the band by heating to 65°C and take a volume equivalent to approx 100 ng of DNA. Calculate the volume of water needed to increase the final reaction volume to 300 yL (inclusive of the other components in the labeling reaction) and add to the agarose. Boil this for 5 min. 3. At 37°C (while the DNA in agarose is still molten) add 30 pL of the 3 dNTP mix, 30 uL of the 10X Klenow fragment buffer, 0.5 pg of the random hexanucleotides, the appropriate volume of [a-32P]dCTP (see Note 4), and 20 U of Klenow fragment. Incubate from 4-16 h at 37°C. Alternatively, a commercial labeling kit can be used.

334

Snell

4. To ethanol prectpitate the probe and separate it from the majority of the unincorporated nucleotides, heat the labeling reaction to 65°C to melt the agarose and quickly add 150 pL of 7SMammonium acetate and 900 pL of ethanol. Mix by pipeting carefully and place on ice for 30 min. 5. Centrifuge at full speedin a microfuge for 10 min and discard the supematant. The pellet consists of agarose and DNA as well as some unincorporated nucleotides that do not present any problems. 6. Estimate the volume of the pellet and add to it 1 mg of sheared human placental DNA (100 pL of 10 mg/mL), 20 pg of YAC vector DNA, and water to a final volume of 300 pL. Boil for 5 mm making sure the probe is fully resuspended. Determine the activity of the probe in dpm. 7. Add 100 pL of 20X SSC (final concentration 5X SSC) and place at 65°C for 4-6 h. This step is designed to preanneal the repeat sequences m the probe. 8. Make up the filter prehybridization/hybridization solution consisting of 5X SSC, 5X Denhardt’s, 6% PEG 8000, 1% SDS 100 p.g/mL sheared denatured salmon sperm DNA, and 100 pg/mL sheared denatured human placental DNA (or DNA from the speciesthe YAC DNA originated from). Denature the DNA by boiling for 10 min then add to the rest of the solution Approximately 100 mL is sufficient for 40 or more g-cm filters. 9. Prehybridize the filters for 4-6 h at 65°C in a box with gentle agitation at the same time that the probe is preannealing. 10. After the preannealmg of the probe and the prehybridization of the filters pour off some of the prehybridization solution and add the probe to this (see Note 5). Mix and add back to the filters. Hybridize for 24 h at 65°C. 11. After hybridization pour off the probe and commence washing the filters m 4X SSC 0.1% SDS at 65°C for 20 min. The stringency is then increased step wise (2X SSC, 1X SSC, 0.5X SSC, 0.2X SSC, all with 0.1% SDS at 65°C) until the activity measured within 1 cm of a single filter with a Gelger counter (Mm1 Instruments series 900 mini monitor) is approx 4 cps. The final wash stringency may be 0.5X SSC or 0.2X SSC, depending on the activity remainmg on the filters (see Note 6). 12 Autoradiography should be carried out at -7OOC or colder usmg an intensifying screen for l-3 d. 13. Plaques corresponding to a range of hybridization mtensities should be picked for purification by hybridization using the same method as the primary screen. They should be plated at a lower density so single plaques are well spaced.

Some of the purified clones will be false positive, either because they contain sequences that are either low level repeats, yeast, or just spuri-

The Isolation

of cDNAs

335

ous. It is necessary to test each cDNA by hybridization to PFGE Southern blots of a selection of YACs that are expected to be positively and negatively hybridizing. Repeats are apparent after only 2-3 h autoradiography. Further localization by hybridization to Southern blots of separated digested YAC DNA, genomic DNA, and somatic cell hybrids, if available, should also be done.

4. Notes 1. Yeast chromosome degradation in blocks: This seems to be mostly dependent on the batch of lyticase used. If the chromosomes are degraded, try another batch of lyticase. 2. No apparent YAC band: Sometimes rt is not obvious which is the YAC band, either due to low DNA concentration or comigration of the YAC with one of the yeast chromosomes. It may be necessary therefore to identify the location of the YAC band by Southern blotting and hybridization. 3. Choice of a cDNA library: Do not use a library that has been made using yeast carrier RNA at any stage. 4. The amount of radioisotope needed is dependent both on the size of the YAC to be labeled and whether there are comigrating yeast chromosomes that will be labeled as part of the probe. As a guide, 150 pCi IS sufficient isotope for single YACs of up to about 300 kb. For larger YACs or YACs copurified with yeast chromosomes, the net activity per 100 ng of DNA does not increase much when more than 330 PCi is added. 5. Activity of the probe: I have used probe ranging m activity from 1.7-4.8 x lo6 dpm/mL. It may be that even higher activity will result in background problems. 6. The washing of the filters is probably the most critical step. Because of the high complexity of the probe the relative difference between background signal and true plaque detection is not high. Therefore, all the background activity should not be washed off the filters, at least initially.

References 1. Elvin, P., Slynn, G , Black, D., Graham, A., Butler, R , Riley, J , Anand, R., and Markham, A. F. (1990) Isolation of cDNA clones using yeast artificial chromosomeprobes.Nucleic Acids Res. 18,39 13-39 17 2. Snell, R. G., Doucette-Stamm,L. A., Gillespie, K M., Taylor, S. A. M., Rlba, L , Bates,G. P., et al. (1993) The isolation of cDNAs within the Huntington disease region by hybridisation Mel

Genet

of yeast artificial chromosomes to a cDNA library Hum.

2,305-309.

3. Wallace, M. R., Marchuk, D. A., Anderson, L. B., Letcher, R., Odeh, H. M., Saulino, A. M., et al. (1990) Type 1 neurofibromatosls gene: identification of a large transcript disrupted m three NFl patients.Science 249, 18 l-l 86.

4 Taylor, S A. M , Snell, R. G., Buckler, A., Ambrose, C., Duyao, M , Church, D , et al. (1992) Clonmg of the a-adducm gene from the Huntington’s disease candidate region of chromosome 4 by exon amphfication. Nature Genet 2,223-227 5 Schwartz, D C. and Cantor, C. R (1984) Separation of yeast chromosome-sized DNAs by pulsed field gradient gel electrophoresrs. Cell 37,67-75. 6 Chu, G , Vollrath, D , and Davts, R W. (1986) Separation of large DNA molecules by contour-clamped homogeneous electrtc fields Science 234, 1582-1585 7. Sambrook, J. Frttsch, E F., and Mamatis, T. (1989) MoZecular BzoZogy--A Laboratory ManuaE 2nd ed , Cold Sprmg Harbor Laboratory, Cold Spring Harbor, NY. 8 Ausubel, F M., Brent, R., Kingston, R. E., Moore, D. D., Serdman, J. G , Smrth, J. A , and Struhl, K. (1993) Current Protocols zn Molecular Brology, Greene Pubhshmg and Wiley, New York 9. Feinberg, A. P and Vogelstem, B. (1983) A techmque for radiolabelling DNA restrtctron fragments to a high specific activity Anal Blochem 132, 6-13

CHAPTER 28

cDNA Selection Satish

with YACs

Parimoo

1. Introduction One of the major efforts in the field of positional cloning and the human genome project is to identify coding sequences or transcription units in large genomic regions such as yeast artificial chromosomes (YACs).The task proves to be challenging because only a small percent of the total DNA of the genome codes for mRNA, whereas the remainder consists of introns, intergenic sequences, and various repetitive sequences, Gene discovery by large scale genome sequencing with the available sequencing technology is not a practical approach, at least for the present. Several approaches for identifying expressed sequenceshave been described (1-9). So far, however, experience with these methods at the megabase level remains limited. A simple and efficient polymerase chain reaction (PCR) (10) based approach of direct cDNA selection (11) is described in detail here to permit rapid identification of cDNA fragments encoded by large genomic DNAs, such as YACs. This approach has been used successfully to identify several new genes in one megabase region of the HLA-A region (12,13). It has also been tested, although to a limited extent, with total yeast genomic DNA containing YACs that could further simplify the process (14). The general approach of cDNA selection consists of immobilizing the target genomic DNA fragments (YAC DNA restriction enzyme digests) on a small piece of nylon paper. Total cDNA library fragments are amplified by PCR from cloned short-fragment (sf) random primed cDNA libraries using flanking vector primer sequences.This cDNA is annealed From Methods m Molecular Bology, Vol 54 YAC Protocols E&ted by D Markle Humana Press Inc , Totowa, NJ

337

Purim00

338 lmmoblllse heat denatured DNA on a

Block repeats & rlbosomal RNA sequences

Second cycle 01 hybrld- selection with a new preblocked nylon piece. PCR smellflcatlon with prlher pair ‘A’

h( -7 i‘&=-

~9 d$

Wash

off nonspeclflcally

Elute

& PCR amplify

-z -

4

cDNA

with EcoRI,

Sonlcated, blunt-ended denatured quenching DNA molecules

&

PCR ampllfled cDNA library Inserts wlth Xgtitl flenklng sequences (prlmer palr ‘C)

molecules.

molecules

-

Size select

Digest

bound cDNA

r

Analyze

PCR products (optional)

8 make

a llbrary

on Southerns

molecules

clone

In ligtl0

I Analyze

Analyze

+

plaques non-encoded

for repeats, sequences.

rlbosomal Discard

RNA (1. any them.

other plaques for unknown and any known encoded In the target genomlc DNA.

cDNAs

Fig. 1. Schematic representation of cDNA selection. The primer sets ‘C’ and ‘A’ are identical to the primer sets I and II respectively (Section 2.3.).

to the immobilized target DNA (YAC) on the nylon paper discs in the presence of an excess of quenching/blocking reagents to block repeats and GC-rich sequences such as ribosomal sequences. The nylon paper discs containing immobilized DNA are washed to remove nonspecific material, and the cDNAs are recovered by thermal elution, PCR amplification, and cloning. Multiple cycles of selection can be performed as depicted schematically in Fig 1. It is possible to carry out the selection process with very small amounts of target DNA and relatively small

cDNA Selection with YACs amounts of cDNA because of the high sensitivity of PCR. The selection can be carried out with either a single cDNA library in order to get tissue specific cDNAs or with a mixture of cDNAs to get a more comprehensive coverage of cDNAs. The advantage of using a short-fragment random primed library is that it is least affected by any bias introduced by PCR as a result of the size of cDNAs or GC-rich regions of a particular cDNA.

2. Materials 2.1. YAC DNA and cDNA Libraries 1. YAC DNA: YAC DNA is purified by pulsed field gel electrophoresls and electroeluted after restrlctlon digestion of the DNA in agarose plugs. For preparation, see Section 2.5.2. 2. cDNA library: Short-fragment random primer primed cDNA libraries. For preparation, see Section 2.5.3.

2.2. Blocking

Reagents

(see Note 1)

1. Ribosomal RNA clones: a. pR7.3 and pR5.8: Human ribosomal RNA 4% precursor coding region

EcoRI fragments(7.3 and 5.8 kb) cloned in the plasmid pBR 322 (IS). (These were kindly provided by David Ward at the Yale Medical School.) b. Yeast ribosomal RNA clones: RibH 15 and RibH 7 clones contain the entire yeast ribosomal RNA precursor sequence as 7.3 and 2.5 kb Hind111fragments, respectively in pBR322 (16,17). (These were kindly provided by R. Kucherlapati at the Albert Einstein College of Medicine, New York.) These may be necessary for selection with very large YACs (l-2 Mb) corn&rating with large yeast chromosomes, known to harbor severalcopiesof ribosomal RNA genes.They arealso necessary when the target DNA is yeast total DNA rather than pure YAC. 2. Repeat library (RL) DNA: a. RL-I: A genomic repetitive sequence library prepared from the human partial digest genomic library by pooling and subcloning 500 plaques that hybridized to a [32P]probe prepared from total genomic DNA (e.g., XRL-1 m ref. 22). This serves as a source of high copy repeats, and may be replaced by commercially available C&l DNA (BRL, Gaithersburg, MD) supplied as sonicated DNA. b. RL-2: A particular human chromosome specific genomic library subcloned in a high copy plasmld vector such as Bluescript (Stratagene, La Jolla, CA). This library supplements the other repeat library RL-I and may be able to quench some medium or rare abundance repeats. The chromosome library to be usedfor this purposeshould be derived

340

Purim00

from a chromosome dtfferent from the one from which the YAC is derived (e.g., p15 for chromosome 6 YAC selection, ref. 12). It is important to bear in mind, while choosing a particular chromosome specific library, that they are usually contaminated with a small percentage of other chromosomes. 3. Poly d1. dC: From Pharmacia (Uppsala, Sweden) (cat. no. 27-7875); it is dissolved m water and used as such without any further treatment. 4. Yeast DNA: DNA from yeast host alone (without any YAC) such as Succharomyces cerevisiae strain AB 1380.

2.3. PCR Primers 1. Set I (outer primer set of the vector hgtl0): a. 5’ CCACCTTTTGAGCAAGTTCAG 3’. b. 5’ GAGGTGGCTTATGAGTATTTC 3’. 2. Set II (inner set of the vector hgtl0, closest to the EcoRI site): c. 5’ AGCCTGGTTAAGTCCAAGCTG 3’. d. 5’ CTTCCAGGGTAAAAAGCAAAAG 3’.

2.4. Other Reagents

(see Note 2)

1, Restriction enzymes (New England Biolabs, Beverly, MA): EcoRI, HindIII, BamHI. 2. Enzymes: Amplitaq DNA polymerase (Perkin Elmer-Cetus, Norwalk, CT), Mung Bean nuclease (New England Biolabs), RQl DNase and RNasin (Promega, Madison, WI), and T4 DNA ligase (New England Biolabs). 3. Commercial kits: cDNA synthesis kit (BRL, cat. no. 18267-013); Gigapack plus cDNA packaging kit (Stratagene); PCR ds-DNA cycle sequencing system (BRL cat no. 18196-O14). 4. Lambda gt 10 arms: Commercially available EcoRI digested and dephosphorylated hgtl0 arms (Stratagene). 5. Synthetic olrgonucleotides: random hexamers (Pharmacia). EcoRI adaptors (Promega, cat. no. C1291). 6. Ohgo-dT cellulose Type 3 (Collaborative Research, Bedford, MA). 7. Chemicals (Sigma, St. Louis, MO): Tris base (cat. no. T8524), ethylene diamine tetraacetic acid (EDTA), sodium chloride, sodium acetate, ammomum acetate, sodium hydroxide, sodium dodecyl sulfate (SDS), sodium citrate, sodium phosphate (monobasic), calcium chloride. 8. Wash solutions: a. Wash solution I: 2X SSC, 0.1% SDS. b. Wash solution II: 1X SSC, 0.1% SDS. c. Wash solution III: 0.2X SSC, 0.1% SDS. d. Wash solution IV: 0.1X SSC, 0.1% SDS. e. Wash Solution V: 0.1X SSC.

cDNA Selection

with YACs

9. 10. 11. 12.

Ethidium bromide solution, 10 mg/mL (Sigma). Glycogen, 20 mg/mL (Boehringer-Mannheim, Mannheim, Germany). 20X SSC: 3M sodium chloride, 0.3M sodium citrate, pH 7.0. 20X SSPE: 3M sodium chloride, 0.2Msodium phosphate (monobasic), 20 rmI4 EDTA, pH 7.4. 13. 5X SSPE: 0.75M sodium chloride, 0.05M sodium phosphate (monobasic), 5 nuI4 EDTA, pH 7.4. 14. Ammomum acetate: 7.5M, pH 7. 15. Sodium acetate: 3A4,pH 7. 16. SM: 50 mMTrts-HCl, pH 7.5,0.2% MgS04 7 H20, O.lMsodium chloride, 0.0 1% gelatin. 17. Denaturing solution: 0.5M sodium hydroxide, 1.5M sodium chloride. 18. Neutrahzation solutron: 0.5M Tris-HCl, pH 8, 1.5M sodium chloride. 19. ATP, 100 mM (Pharmacra). 20. Deoxynucleotide trtphosphates, 100 rnA4, pH 7.5, stock solutions (Pharmacra). 2 1. MgCl,: 20 nuI4 stock (Perkin Elmer-Cetus). 22. Ligatronbuffer(lX): 50mMTris-HCl,pH7.8, lOmMMgCl,,5mMDTT (Boehringer-Mannheim), 1 n~I4 ATP. 23. TE: 10 mM Tris-HCl, pH 8, 1 rnA4EDTA. 24. TLE: 10 mA4 Tris-HCl, pH 8, 0.1 mM EDTA. 25. 0.5X TBE: 45 nnI4 Tris-base, 45 mA4 boric acid, 0.1 mM EDTA, pH 8.3. 26. DNase incubatron buffer (1X): 50 mM Trrs-HCl, pH 7.9, 10 mMNaCl,6.0 mA4 MgCl*, 0.1 nnI4 CaCl,. 27. PCR buffer: 10X without MgC12 (Perkin Elmer-Cents). 28. Somcatron buffer: 10 mA4 Tris-HCl, 10 mM EDTA. 29. Phenol (Boehringer-Mannheim): Equilibrated to pH 7.5 wrth 10 rnA4 Tris-HCl (18). 30. Chloroform (T. J. Baker, Phillipsburg, NJ). 3 1. Phenol-chloroform: 1:1 mixture of phenol and chloroform. 32. Dialysis tubing (Spectra/Phor 2, Spectrum): Flat width 25 mm. 33. Centricon- (Amtcon, Danvers, MA).

2.5. Preparation

of the Reagents

2.5.1. Yeast Genomic DNA Preparation Yeast genomic DNA is isolated by standard methods (see Chapter 6). 2.5.2. Preparation of YAC DNA (see Note 3) 1. Preparation of yeast DNA in agarose plugs is described in Chapter 7. 2. Size fractionate the yeast chromosomes from the agarose plugs in 1% SeaKem GTG agarose m 0.5X TBE on a BioRad CHEF electrophoresis

342

3.

4. 5.

6. 7. 8.

9.

Purim00 apparatus or a similar apparatus in order to achieve separation of the YAC of interest. Refer to Chapter 7 for details. Identify the YAC DNA band by ethtdmm bromide staining of the gel. If a YAC comigrates with a native yeast chromosome and is indistinguishable on the gel, it is identified by hybrtdization of Southern blot (from a single lane of the gel) to pBR 322 or a related plasmid probe. During blottmg, the remainder of the gel is wrapped in Saran wrap and stored at 4OC. After identification of the YAC, excise the DNA band of mterest (from 10 slots or more) and store it in a capped 15mL Falcon tube at 4°C until further use. Soak agarose piece containing YAC DNA in TE for 1 h and then equilibrate in an approprtate restrtction enzyme buffer for 2 h at 4°C with a change of buffer in between, Immerse an 8-cm long agarose slice containing the YAC DNA in 4-5 mL of the restriction enzyme buffer with 0.25-0.5 U of enzyme/pL such as Hind111 or BamHI in a 15-mL Falcon tube and incubate at 37OC for at least 6-8 h with gentle rotation. Add EDTA, pH 8, to a final concentration of 20 mM to stop the reaction. After 30 min, replace the solution with 0.5X TBE and incubate for another 30 mm. It may be a good practice, in general, to make two preparations of YAC DNAs digested with two dtfferent enzymes separately, and then pool them after electroelution and phenol extraction for cDNA selection. Cut a dialysis tubing of appropriate length in order to fit the agarose slice, and boil and wash it as described (181. Fill the dialysis tubing with 7-8 mL of 0.5X TBE and the agarose gel piece containing DNA. Place in a horizontal agarose gel electrophorests tank (23 x 35 cm) and electroelute DNA at least overnight in 0.5X TBE at 90 V. Several dialysis tubmgs can be fitted in this size gel box. For a single sample use a smaller gel box. Keep dialysis bags in such a way so that the agarose slice is parallel to the electrodes. Pour enough buffer so that the bags arelust submerged under the buffer. After completion of electroelution, the polarity is reversed for 1 min before removal of the dialysis tubings. Check for complete electroelution of the DNA by ethidium bromide staining of the agarose slice. Concentrate the electroeluted sample m a Centricon- (Amicon) to -250 pL. Ethanol precipitate the DNA after phenol-chloroform extractton in the presence of 0.3M sodium acetate and 2 pg glycogen as carrier, and dissolve the YAC DNA m 10 yL TE.

cDNA Selection

with YACs

10. Determine the concentratron by ethidium bromide spot detection (IS). For this purpose, mix equal volumes (2.5 uL) of each DNA sample and ethidium bromide (2.5 uL of 1 pg/mL solution) and spot them on a sheet of Saran wrap. Spot various concentrations (l-10 ng) of standard DNA such as restriction enzyme digest of genomic DNA of known concentration and ethidium bromide in similar volumes as the test samples. Place the Saran wrap on a transilluminator and take one or more pictures with different exposures. Estimate the concentration of test samples by comparison with the standard DNA sample fluorescence. The YAC DNA is adjusted to a concentration of 40-60 ng/uL. 2.53. Short-Fragment cDNA (sf-cDNA) Libraries (Average Size: 400-1500 bp) 1. Prepare total RNA from the tissue or cell line of interest by standard methods, such as a combination of guanidine thiocyanate/phenol extraction (19) and selective precipitation of RNA by lithium chloride (20). Remove any traces of DNA by treating the total RNA with 10 U of RQ 1 DNase/mg of RNA in the presence of RNasin in the DNase incubation buffer at 37OCfor 15-30 min. Ethanol precipitate RNA after phenol-chloroform extraction by adding l/10 vol 3M sodium acetate and 2.5 vol ethanol. 2. Isolate poly A+ RNA from the total RNA by oligo-dT cellulose columns as described (18). 3. Prepare double-stranded cDNA in a 40-uL reaction from 5 ug of poly A+ RNA by the method of Gubler and Hoffman (21) using one of the commercial cDNA synthesis kits (see Materials). 4. Use random hexanucleotide [p(dN),] instead of oligo(dT)i2-,s as the primer for the first-strand cDNA synthesis in order to generate random sf-cDNAs. Use 6.75 ug of p(dN&/40 uL of first-strand cDNA synthesis mixture so as to generate cDNAs of the size up to 1500 baselengths, as judged by alkaline agarose gel electrophoresis (18). All the other steps of cDNA synthesis are as described in the protocol provided by the manufacturer. 5. Make cDNA blunt ended by treatment with 1 U of mung bean nuclease/ug cDNA at 29°C for 30 mm (18). After addition of EDTA to 10 mM, inactivate nuclease by phenol, phenol-chloroform, and chloroform extraction. Precipitate cDNA by addition of a half volume of ammonium acetate and 2.5 vol of ethanol. 6. Ligate EcoRI adapters to the double-stranded cDNA by standard procedures (18). 7. Size fractionate cDNA in a 1% low melting point (LMP) agarose gel and purify cDNA of the size range of 40&1500 bp by excising the gel piece,

344

Parimoo

melting the agarose, extractmg cDNA with phenol, phenol-chloroform, chloroform, and ethanol precipitation after the addition of half volume of ammonium acetate (18). 8. Ligate the gel-purified cDNA to the hgt 10 arms according to the vendor’s protocol. 9. Amplify three million or more plaques (for a deeper library) by plating 75,000-100,000/150-mm Petri dish. Harvest phage with 15 mL SM/plate. Pool all the phage lysate and purify phage DNA by standard methods (18). 1. 2

3.

4.

2.5.4. Preparation of Blocking Reagents (see Note 4 ) The DNA samples (plasmid or yeast DNA) are prepared by standard methods (IS) (see Chapter 6). Digest the blocking reagent DNA samples with EcoRI and ethanol precipitate the DNA. Somcate the DNA in sonication buffer to generate DNA of -0.2-0.8 kb m size. Ethanol precipitate the DNA after phenol-chloroform extraction. Treat all the DNA samples, after somcation, with mung bean nuclease at 1 U/pg DNA for 30 mm at room temperature, and then extract with phenol, phenol-chloroform, and chloroform. Ethanol precipitate the DNA in the presence of 0.3M sodium acetate. Dissolve the DNAs (from step 3) m a small quantity of TE for storage. After estimation of concentration at 260 nm, 20X stocks of each are made in water and stored m aliquots at -20°C. The 20X stock concentration of each of the quenching reagents is: RL-I (e.g., XRLI or Cot1 DNA) = 0.5 pg/pL; RL-II (e.g., ~15) = 1 p.glp.L; pR 7.3 and pR 5.8 (I:08 ratio) mixture = 0.8 p.g/p.L;yeast host (ABl380) DNA = 0.5 pg/pL, poly dI.dC = 0.4 pg/pL, Rib H15 = 4 pg/pL and Rib H7 = 2 pg/pL.

3.1. Amplification

3. Methods of cDNA

Inserts

by PCR

1. Amplify the cDNA inserts from the sf-cDNA library by PCR using primer set I. Start PCR reactions in at least 10 Eppendorf tubes m order to have enough material after processmg. (See Table 1 and Note 5 for details.) 2. Freeze the amplified samples at -20°C if not used or processed the same day. Combme the amplified products, extract with chloroform and isoamyl alcohol mixture (24.1 [v/v]) once and precipitate the cDNA with ethanol. Fractionate this cDNA by electrophoresis m a 1% LMP agarose gel (load four or more slots) and isolate the cDNA between 400 and 1500 bp stze after phenol-chloroform extraction and ethanol precipitation as described earlier (see Section 2.5.3.).

345

cDNA Selection with YACs Table 1 Hot-Start PCR Amplification of sf-cDNA Library” Component

Volume, pL

Final concentration

2

10 ng

2

0644

2

0.6 pA4

cDNA library, 5 ng phage DNA/pL m TE Primer # 1, 30 p&f stock Pnmer #2, 30 Cul/istock 1OX PCR buffer, without MgC 12 20 mA4 MgClz AmphTaq polymerase, 5 U/pL (Cetus enzyme) Sterile water

63.5

Total volume

90.0

10

1x

10

2mM 25u

05

%over the samples with mineral 011 and place the tubes In the PCR machme Denature the samples at 94’C for 2 min and then Incubate at 80°C At this stage pause the machine, and without removing the tubes, add 10 JJL of 2 0 r&4 dNTP mixture (each 2 mM) by dlppmg the plpetman tip almost to the bottom of the tube and releasmg the solution with proper care (final dNTP m PCR IS 0 2 mM) Contmue PCR cycles as follows 94°C for 45 s/50°C for 45 s/72’C for 2 mm for 30 cycles for Perkm Elmer PCR 9600 machme and 94°C for 70 s/5O”C for 70 s/7O”C for 2 mm for 30 cycles for Perkm Elmer PCR 100 machme. A final extension of 5 mm at 72°C at the end of 30 cycles IS carried out m either machme

3.2. Immobilization of Target Genomic DNA onto Nylon Discs (see Notes 6 and 7) 1, Cut Hybond-N nylon (Amersham, Arlington Heights, IL) into 2.5 x 2.5 mm squares. 2. Mark the discs for different samples with a pencil by gently marking dots at the comers on the side that is not used for spotting DNA (the blank side). 3. In an Eppendorf tube, mix 2.5 pL of restriction enzyme digested YAC DNA (40-60 ng/pL) with 2.5 pL H&II digested bacteriophage $X174 DNA as carrier DNA (200 ng/pL in water). 4. Denature the DNA from step 3 at 95-98°C for 3 min, and chill the tube on ice immediately. Spin briefly. 5. Add an equal volume (5 pL) of 20X SSC to the denatured DNA and mix. Spot the DNA in 0.5~pL aliquots on 2.5 x 2.5 pieces of Hybond on the sides not marked with pencil marks to immobilize 10-l 5 ng of YAC DNA/ disc. Dry under a lamp.

346

Purim00

6. Place the discs on a small sheet of Whatman (Matdstone, UK) 3 MM paper and transfer onto several sheets of Whatman 3 MM soaked with denaturmg solution. Transfer the sheetof paper after 5 min to a dry paper to remove excess alkali and place it on sheets of Whatman paper soaked with the neutralization solutron for 1 min; then transfer onto fresh Whatman paper soaked with fresh neutralizing solutton for another 2-3 min, and finally to 1OX SSC for 2 mm. 7. Transfer the discs onto a dry Whatman filter, and UV crosslink in a Stratalinker (Stratagene) at the autocrosslmk mode for 1 min while they are damp. Transfer the discs into 0.5-mL Eppendorf tubes and bake at 80°C with lids open in a vacuum oven for 0.5 h. Store dry in Eppendorf tubes with lids closed at 4°C until used. Baking for 2 h at 80°C alone is also successful. Prepare two discs for each YAC sample so as to suffice for two cycles of cDNA selectton

3.3. First Cycle of Selection 3.3.1. Prehybridization /Quenching (see Note 8) 1. Prepare blocking/quenchmg mtx, and set up prehybrrdtzation of the DNA discs in 0.5-mL Eppendorf tubes, as shown in Table 2. The 20X stock concentrations are given in Section 2.5.4. 2. After completion of prehybridtzation, remove the oil phase and wash the nylon discs twice briefly with 5X SSPE containing 0.1% SDS at room temperature. Keep the discs m this solutron at room temperature until ready for hybridization.

3.3.2. Hybridization

(see Notes 9-l 1)

1. After prehybridization, transfer the discs with the help of pipetman tips into the fresh tubes contammg the hybridization mrx without letting dtscs dry. Care IS taken not to let the DNA-munobilized side of disc come in contact with the walls of the tube to prevent oil smudging. 2. Hybridrzation mix (40-50 pL) is aliquoted quickly into fresh 0.5-mL Eppendorf tubes, and the nylon discs are transferred into these tubes individually from 5X SSPE solution. Only a few samples are handled at a time m order to mmimrze reannealing of the cDNA and other reagents. The tubes are covered with mineral oil and incubated at 65°C for 36-40 h with gentle rocking. See Table 3 for setting up hybridization.

3.3.3. Washing Discs (see Note 12) 1. Remove the top oil phase from the tubes. Using vacuum suction, take out most of the solutron, leaving behind Just enough to cover the discs. The last traces are removed with a pipetman tip without letting discs dry at any stage during these washes.

347

cDNA Selection with YACs Table 2 Prehybndlzation Conditions for Nylon Discs Bearing Immobilized YAC DNA0 Volume/tube

Stock Blocking reagents, 20X

Fmal concentration

2.5 PL of each, total = x pL YPL 30 PL

1x

Water X+Y The tube 1s placed in boiling water for 5 mm and then chdled m ice. The following components are then added sequentially: 20X SSPE (18) 50X Denhardt’s (28)

12.5 /JL 5X SSPE 5X Denhardt’s 5 PL The tube IS placed m a 65°C water bath briefly Just to warm the solution and then SDS IS added. 10% SDS

2.5 PL

Final volume

50 PL

0.5% SDS

“The above volumes are given for one tube, and the prehybrldizatlon mix 1s prepared in bulk for three to four tubes at a time. Then 50 pL 1squickly aliquoted into the tubes contammg nylon discs with unmobllized target DNA The tubes are covered with mmeral 011and Incubated at 65°C for 24 h with gentle rockmg 2. Immediately

3.

4.

5. 6. 7. 8.

add 300 PL of wash solution

I at room temperature.

Vortex

for 5 s and remove the solution as earlier. Repeat two more times. Transfer discs to fresh 1.5-mL Eppendorf tubes, each containing 600 PL of solution I. The wet discs are transferred by dragging the discs along the wall of the Eppendorf tube with the DNA side in contact with the plpetman tip; the blank side (without DNA) is in contact with the surface of the Eppendorf tube. Avoid scratching the nylon discs. Wash the discs next with 600 PL of solution I at 65°C for 20 min each three times, removing the wash solution m between as earlier. Keep wash solution I at 66-67”C in between the washes. Vortex each time before addition and removal of each solution. Transfer discs to fresh tubes again as earlier. Wash with 600 PL of solution II at 65°C once for 20 min. Wash with solution III once at 65OCfor 15 min. Transfer the tubes to fresh tubes as earlier and wash with 600 PL of solution IV twice at 65’C for 20 min each. Next rinse the discs with solution V twice at room temperature, and transfer to 0.5-mL siliconized Eppendorf tubes containing 40 PL of autoclaved

348

Purim00 Table 3 cDNA Hybridization Conditions for Nylon Discs Bearing Immobilized YAC DNAa Stock

Volume/tube

Blocking reagents, 20X except poly dI.dC Amplified cDNA Sterile water x+y+z=

2 uL of each, total = x pL YPL z PL 24 PL

Final concentration 1x n

The tubes are put m boiling water for 5 minutes, chilled quickly, and briefly spun, then to each tube mdrvidually the followmg components are added: 20X SSPE 50X Denhardt’s

10 j.lL 5X SSPE 5X Denhardt’s 4 PL The tubes are warmed briefly at 65°C and then SDS is added: 10% SDS

2 PL

Fmal volume

40 pL

0 5% SDS

‘For the first cycle of selection, a final concentration of 10 pg/mL cDNA IS present m the hybrtdtzatton solutton when a single cDNA hbrary ISused, a final concentratton of 5 pg/mL of each cDNA ISpresent when a combmatton of several cDNA hbrarres IS used for the first cycle of selectton For the second cycle of selection, the final concentratron of hybrtdtzmg cDNA dertved from the first cyde of selectton wtth a smgle library or a mrxture IS 0.250 5 pg/mL and 0 51 0 pg/mL, respectrvely. The hybridrzatron is at 65°C for 36-40 h water. Care is taken not to carry over salt solution from the previous tube. Also, never let nylon discs dry during transfers. The tubes can be stored overnight at 4°C or processed immediately for PCR ampltficatron.

9. Heat the tubes containing the discs m 40 PL of water m the PCR machme at 98°C for 5 min, briefly spm the tubes, and chill. Transfer 20 PL from each tube to fresh PCR tubes for PCR amplification, and store the rest as backup sample at -20°C.

3.3.4. First Round ofPCR (see Note 13) Carry out hot-start PCR with 20 pL eluate from Section 3.3.3., step 9 in a 50-pL volume using primer set I for 30 cycles with the same cycling conditions as described in Table 1. The concentration of primers is 0.3 pM in the final PCR reaction mixture.

cDNA Selection

with YACs

349

3.3.5. Second Round of PCR 1. Take out 3 p-L from the first round of PCR for re-PCR in a 100-PL volume with a 0.6 IuU final concentration of primer set I, as described earlier. 2. Analyze an ahquot of 5 ltL of the final product on a 1% agarose gel. A smear of an average size of -0.3 kb should be visible on ethidmm bromide staining. 3. Extract the remainder of the PCR product with phenol-chloroform mtxture and ethanol precipitate the cDNA after addition of EDTA to a final concentration of 5 mM, l/10 vol of 3M sodium acetate and 2 pg glycogen. 3.3.6. Size Selection of cDNA. 1. Size fractionate once-selected cDNA after second round of PCR (see Section 3.3.5., step 3) on 1% LMP agarose gel. The agarose piece containing DNA >0.35 kb is cut out and processed for DNA extraction and ethanol precipitated as before. If the volume of the solution before ethanol precipitation is -600-700 ,uL, then concentrate it to -200-300 PL by speed-o-vat; in case of larger volumes, use the Centncon-30 or Centricon100 (Amicon) before ethanol precipitation. 2. After ethanol precipttatton, dissolve the DNA in 50 pL TE and take 20 pL for spectrophotometric estimation m a 0.1 -mL or 0.5-mL cuvet. 3.4. Second Cycle of Selection 3.4.1. Prehybridization I Quenching

Carry out the same steps as before (see Section 3.3.1.) steps l-2) using YAC DNA immobilized on new nylon discs. Quenching materials and conditions are the same. 3.4.2. Hybridization

Follow the same steps as before in the first cycle (see Section 3.3.2., steps l-2), except that a lower concentration of cDNA is used in this second cycle of the selection. The concentration of once-selected cDNA (from Section 3.3.6.) in the final 40 pL of hybridization mixture is 0.250.5 pg/mL if only a single cDNA library was used in the first cycle of selection. This concentration can be increased to 0.5-l .Opg/mL if a mixture of cDNA libraries were used in the first cycle of selection. 3.4.3. Washing Discs

Same as in first cycle (see Section 3.3.3., steps l-9).

350

Purim00

3.4.4. First Round of PCR Amplification This step is identical to the one described in the first cycle (Section 3.3.4.), except that primer set II is used (0.3 m in a 50-p,L final volume). 3.4.5. Second Round of PCR Amplification 1. Identical to the second round of PCR of the first cycle of selection (Section 3.3.5., step l), except that primer set II is used (0.6 win a 100~PL volume). 2. Analyze an aliquot of 5-pL on an analytical agarose gel. To the rest of the PCR material add EDTA to a final concentration of 5 mM. The cDNA 1s extracted with phenol, phenol-chloroform, chloroform alone, and then ethanol precipitated after the addition of l/2 vol of ammonium acetate solution and 2 pg glycogen. 3. Dissolve the DNA in 10 PL of TE.

3.5. Cloning

and Analysis

of the Selected Library 3.5.1. Analysis of PCR-Amplified and Selected cDNA This step is optional. Take 0.5 PL of cDNA from the PCR mix of first and second selection and run a Southern blot along with the total PCRamplified cDNA from the cDNA library. Analyze the blots with various specific probes (single copy sequences encoded by the YAC) if known, and nonspecific probes such as total genomic DNA (for repeats) and ribosomal RNA probes (see Notes 14 and 15). As an example, see Fig. 2 Southern blot, showing enrichment of class I genes and an anonymous sequence B 30.7-a rare single copy sequence encoded by the YAC B30H3. The signal from repeats and ribosomal probes is either invisible or very faint in the selected samples in contrast to the total cDNA sample.

Fig. 2. (opposite page) Selection with the 300 kb YAC B30H3 from the human MHC region. Southern blots of selected cDNAs after one or two cycles of selection (as indicated) from 5 ng purified YAC DNA immobilized on nylon (lanes 14) or from a nylon strip from a CHEF Southern blot containing the YAC B30 H3 (lane 5). Probes: YAC encoded (specific) probes: (A) HLA-A; (B) anonymous clone B30.7; (C) YAC nonencoded (nonspecific) probes: MHC class II; (D) human P-globin; and (E) ribosomal RNA probe. The concentration of total cDNA in the hybridization mixture for selection was 10 pg/mL during the first cycle of selection and 0.25 pg/mL during the second cycle of selection. All the lanes m the blot are identical.

cDNA Selection with YACs

Twice Once Selected Selected --

Probes

MHC class I

A

B 30.7

B

MHC

class II

C

Human b-globin

D

Ribosomal RNA

E

351

352

Parimoo 3.5.2. Cloning

of the Selected DNA

1. Digest the twice-selected cDNA wtth 40-80 U of EcoRI m a 50-uL vol for 1 h at 37OC. 2. Extract the cDNA with phenol and chloroform and ethanol precipitate after the addition of EDTA to 10 mM and 2 ug glycogen. 3. Size fractionate the EcoRI digested cDNA on 1% agarose, and cut out the agarose with DNA >0.3 kb in size. The DNA 1s extracted with phenol, phenol-chloroform, and chloroform before ethanol precipitatton in the presence of ammonium acetate and glycogen as described earlier. 4. Dissolve the DNA m 10 FL of TLE. Estimate the concentration either spectrophotometrically or by ethidium spot detection as described m Section 2.5.2., step 10. 5. Ligate 0.5 ng size-selected cDNA with 0.5 ug of hgtl0 arms in a 5-p.L final volume containing ligation buffer and 200 U of T4 DNA hgase at 14°C for overnight. 6. In vitro package 4 PL of the ligation mix (from step 5) with the cDNA packaging kit (see Materials) as per the manufacturer’s instructions. The packaged DNA can be stored at 4°C and should be used preferably within 1 wk for amplifying the library in Escherichla coli c600hfl according to the protocol of the vendor. 3.5.3. Amplification

and Analysis

of the Selected Library

1. Make one confluent plate of plaques from the selected and packaged material (from step 6), and harvest phage lysate with 15 mL SM (18). This represents a high titer selected hbrary stock (titer -lOlO). Store at 4°C. 2. Plate a part of the selected and amplified-selected library at a low density to pick up random individual plaques. About 1O-20 plaques are randomly picked and resuspended in 100 uL of SM. 3. Add a drop of chloroform to the phage suspension and mix briefly. Store at 4OC for at least 6-8 h. 4. Determine the percentage of plaques with inserts and their size distribution after PCR amphlication of l-2 uL of phage suspension from individual plaques (step 3) in a 100~uL PCR reaction mixture. For this purpose, it is not necessaryto perform hot-start PCR; all the components of PCR, including dNTPs and enzyme, can be mixed, and the tubes should be put into the machine when the temperature is at least 70°C. Dtstmct single bands ranging from 200-600 bp or more in size should be visible (see Note 16).

cDNA Selection

1. 2. 3.

4.

with YACs

353

3.5.4. Screening of the Selected cDNA Library for Novel (Unknown) Clones (see Notes 17-20) Pick at random at least 50 plaques for every 100 kb of YAC, and resuspend in 100 pL of SM. Amplify the individual cDNA inserts by taking 1 pL of phage suspension in a 50 PL PCR, as described earlier. Make a dot blot from these individual PCR reactions by spotting about 1 pL of the PCR product in an array of 96 dots. Make multiple blots dependmg on the number of the probes to be used. Store rest of the PCR products at -2OOC. Probe the blots with ribosomal RNA probes, total genomic DNA for repeats, and any other probes known to be encoded by the YAC. At this stage one can make pools of the PCR products from rows and columns m the form of 96 grid plates and use them also as probes to identify the overlapping clones. After eliminating undesirable and/or overlappmg clones, sequence at least 150-200 bp of the PCR products rapidly using ds-PCR cycle sequence kit. For sequencing individual PCR products, take 2-3 pL out of 50 FL of the PCR-amplified

product (amplified

with primer

set I) and

SubJeCt

it

to the

PCR-based cycling sequencing without any intermediate purification, using one of the mner primers of set II as [32P] end-labeled sequencing oligonudeotide and the vendors’s instructions. 5. Analyze these sequences for any sequence matches in the GENEMBL databank. 6. Confirm unique sequencesthat are encoded m a particular YAC by Southern blots using total genomic DNA, YAC DNA, and DNA (if available) from a somatic hybrid cell line known to harbor a chromosome region corresponding to the YAC of interest. 7. Screen a full-length cDNA library by using these short fragment selected clones as probe.

4. Notes 1. Blocking reagents either can be prepared by individual investigators or procured from different laboratories. 2. All the reagents should be stored properly. Storage of deoxynucleotide triphosphate solutions in several small abquots at -70°C is recommended highly. Most of the reagents are available commercially. 3. The immobilized target DNA (e.g., YAC DNA) should be free of yeast RNA or any oligonucleotides. 4. It is important that all the plasmids and DNA samples, comprismg the blocking reagents, should be completely digested with EcoRI enzyme and sonicated and treated with mung bean nuclease,as described in Section 25.4.

354

Parimoo

5. Contammation of PCR reagents or improper storage of deoxynucleotide trtphosphates can create problems m PCR amplifications. Hence, proper precautions should be taken to avoid these problems. All PCR reactions should be set up using aerosol resistant tips for the pipetman. Wherever possible, the solutions and the plasticware should be autoclaved for at least 30 min. It is desirable to use commercrally available silicomzed Eppendorf tubes when ethanol precipitation of small amounts of cDNA is mvolved. Hot-start PCR is a must. (See Table 1 footnote for the details.) 6. Some batches of nylon paper may occasionally give higher background. Those batches that give clean results with usual dot blots or Southern blots should be kept separately and used within 1 or 2 yr. 7. Improper mnnobilization of target DNA and subsequent leaching may causefortuitous PCR amplifications. DNA to be immobilized should be spotted m minimal volume, and W and/or baking should be carried out properly. 8. If a YAC comigrates with a yeast chromosome in the l-2 megabase region, include sonicated and blunt-ended yeast ribosomal RNA clones as additional blocking reagents during prehybridization and hybridization as described in Section 3. 9. During hybridrzation of the nylon discs with the sf-cDNA (Table 3), poly [(dI) (dC)] is excluded from the hybridizatron mix. The concentration of Rib H15 and Rib H7 DNA (for total yeast DNA experiments or mega YACs selections) is reduced by half that used in the prehybrtdization step. 10. The heat-denatured blocking agents and the cDNA should be chilled on ice and added to the discs as quickly as possible to avoid reannealing problems. 11. One can use either a single cDNA library for selection tf the goal is to get tissue specific cDNAs, or a mixture of cDNA librartes if a more comprehensive identificatton is warranted. 12. Under the circumstances, where GC-rich regions pose a problem, one can use a more stringent wash with 2.4A4 tetraethylammonium chloride (Et4 NCl) in the final stages of washmg the discs (22), and, finally, wash the discs with 0.1X SSC several times before using them for PCR. However, this wash has not been used as a matter of routine for several YACs that were tested. 13. Too many cycles of PCR should be avoided, as tt generates high molecular wetght products after nucleotide triphosphates are exhausted. 14. Presence of a high number of clones of repeats or ribosomal RNA could reflect either a YAC that is deficient in genes or improper preparation of the blocking reagents. 15. Some YACs may contain region-specific low level repeats that are not competed out by the quenching cocktail. In such cases,a significant number of cDNAs with homologies to such repeats may be selected. One way

cDNA Selection with YACs of overcoming this problem 1sto hybridize the selected library plaques to such repeats and to remove them physically. Alternatively, one can make an additional blocking reagent derived from several plaques that hybridize to such repeats. The DNA from this quenching reagent can be readily prepared by PCR amplification of the plaques, followed by EcoRI digestion and mung bean nuclease treatment. 16. A high percentage (>30%) of small insert cDNA clones (