Vitamin D: A Pluripotent Steroid Hormone: Structural Studies, Molecular Endocrinology and Clinical Applications. Proceedings of the Ninth Workshop on Vitamin D, Orlando, Florida, USA, May 28–June 2, 1994 [Reprint 2020 ed.] 9783110882513, 9783110141573

Citation preview

Vitamin D A Pluripotent Steroid Hormone: Structural Studies, Molecular Endocrinology and Clinical Applications

« D

3

I „

*

o

4

f rn

a OJ HH

Q

>

1 P

P t

s

/ o

V

£ *

^ w

/

cT

\

D

Vitamin D A Pluripotent Steroid Hormone: Structural Studies, Molecular Endocrinology and Clinical Applications Proceedings of the Ninth Workshop on Vitamin D Orlando, Florida (USA) • May 28 - June 2,1994 Editors A. W. Norman • R. Bouillon • M. Thomasset

W G DE

Walter de Gruyter • Berlin • New York 1994

Editors A n t h o n y W. N o r m a n , Professor, Ph. D . Department of Biochemistry U n i v e r s i t y o f California, Riverside, C A 92521 USA

M o n i q u e T h o m a s s e t , D o c t e u r des S c i e n c e s I N S E R M U n i t é 120 Hôpital Robert D e b r é 48 B d Sérurier 75019 Paris France

R o g e r B o u i l l o n , Professor, M . D . , Ph. D . Katholieke Universiteit L e u v e n Laboratorium v o o r E x p e r i m e n t e l e G e n e e s k u n d e e n E n d o c r i n o l o g i e Onderwijs e n N a v o r s i n g Gasthuisberg B-3000 Leuven Belgium W i t h 377 figures a n d 124 tables. ® Printed on acid-free paper which falls within the guidelines of the A N S I to ensure permanence and durability. Library of Congress Cataloging-in-Publication

Data

Workshop on Vitamin D (9th : 1994 : Orlando, Fla.) Vitamin D : a pluripotent steroid h o r m o n e : structional studies, molecular endocrinology, and clinical applications : proceedings of the Ninth Workshop on Vitamin D, Orlando, Florida (USA), May 28 - J u n e 2, 1994 / editors, A. W. N o r m a n , R. Bouillon, M. Thomasset Includes indexes. ISBN 3-11-014157-4 (alk. paper) 1. Vitamin D—Congresses. 2. Vitamin D—Therapeutic use—Congresses. 3. Vitamin D in the b o d y - C o n g r e s s e s . I. N o r m a n , A. W . / A n t h o n y W.) 1938 - . II. Bouillon, R. III. Thomasser, M. (Monique), 1942 - . IV. Title [DNLM: 1. Vitamin D - p h y s i o l o g y - c o n g r e s s e s . 2. Vitamin D - c h e m i s t r y - c o n g r e s ses. 3. Vitamin D—therapeutic use-congresses. 4. Receptors, Calcitriol—metabolismcongresses. 5. G e n e Expression Regulation—drug effects—congresses. 6. Cell Differentiation—physiology—congresses. Q U 173 W926v 1994] QP772.V53W67 1994 612.3'99-dc20 DNLM/DLC 94-35262 for Library of Congress CIP Deutsche Bibliothek

Cataloging-in-Publication

Data

Vitamin D : a pluripotent steroid h o r m o n e ; structural studies, molecular endocrinology and clinical applications ; proceedings of the Ninth Workshop on Vitamin D, Orlando, Florida (USA), May 28 - J u n e 2,1994 / ed. A. W. N o r m a n . . . - Berlin ; New York : de Gruyter, 1994 ISBN 3-11-014157-4 N E : N o r m a n , Anthony, W. [Hrsg.]; Workshop on Vitamin D < 9,1994, Orlando, Fla. >

© Copyright 1994 by Walter de G r u y t e r & Co., D-10785 Berlin. All rights reserved, including those of translation into foreign languages. N o part of this book may be reproduced in any form - by photoprint, microfilm or any other means nor transmitted nor translated into a machine language without written permission from the publisher. Printing: Gerike G m b H , Berlin. Binding: Mikolai, Berlin. - Printed in Germany.

FOREWORD The Ninth Workshop on Vitamin D was held at the Marriott's Orlando World Center in Orlando, Florida from May 28 - June 2, 1994. A total of 502 registered delegates from 31 countries were in attendance. These included representatives from Argentina (12), Australia (8), Austria (4), Belgium (20), Brazil (2), Canada (14), China (2), Columbia (1), Denmark (25), Finland (6), France (38), Germany (27), Hungary (1), India (1), Ireland (1), Israel (8), Italy (5), Japan (38), Mexico (1), Monaco (1), New Zealand (5), Norway (4), Philippines (1), Poland (3), Spain (15), Sweden (10), Switzerland (13), The Netherlands (10), Ukraine (1), United Kingdom (39), and the United States (184). The substantial attendance at the Orlando Workshop reflects the continuing high level of world-wide interest in research developments related to vitamin D. The 502 delegates are second only to the 595 delegates who participated in the Eighth Workshop in Paris, France in July 1991. Tabulated below are the dates and attendance, as well as the number of talks given at the nine Vitamin D Workshops that have now been held. Certainly, as represented by the "presentations per delegate", it is very clear that virtually all of the delegates are actively engaged in research in vitamin D.

Workshop Number I II III IV V VI VII VIII IX

Date October 1973 October 1974 January 1977 February 1979 February 1982 March 1985 April 1988 July 1991 May 1994

Number of Delegates

Number of Countries Represented

Number of Presentations Talks Posters

Presentations per Delegate

56

3

5

0

0.09

221

22

84

0

0.39

332

20

45

124

0.51

402

26

80

205

0.76

455

25

95

298

0.86

474

27

77

380

0.96

381

24

82

292

0.98

595

32

76

415

0.82

502

31

91

348

0.89

The formal program of the Ninth Workshop on Vitamin D included 50 verbal presentations by invited speakers and 37 promoted free communications, as well as 348 poster presentations.

VI An additional feature of the Ninth Workshop was inclusion of four 40-minute plenary lectures by highly distinguished scientists who have not previously been associated with vitamin D research. Their participation in the Workshop reflects the significant involvement of active vitamin D research in the four important frontiers of oncology, immunology, regulation of gene transcription and molecular biology of steroid hydroxylases. Thus, Dr. Barry D. Kahan spoke on "Cyclosporin concentrationcontrolled immunosuppressive regimes and application to test the new immunosuppressive rapamycin and brequinar"; Dr. Benita S. Katzenellenbogen spoke on "Estrogen and antiestrogen actions in breast cancer: regulation of proliferation and oncogene expression"; Dr. Bert W. O'Malley presented an overview on "Recent advances in steroid hormone action" and Dr. Evan R. Simpson discussed "Novel mechanisms involved in the regulation of genes encoding steroid hydroxylases: implications for vitamin D metabolism". The scientific program was conceived by the Program Committee and implemented by the Advisory Committee. The members of the Program Committee were: L. Binderup (Denmark), R. Boland (Argentina), S. Christakos (USA), J. A. Eisman (Australia), F. H. Glorieux (Canada), J. G. Haddad (USA), H. L. Henry (USA), B. W. Hollis (USA), S. Ishizuka (Japan), G. Jones (Canada), T. Kobayashi (Japan), H. P. Koeffler (USA), K. Kragballe (Denmark), J. B. Lian (USA), U. A. Liberman (Israel), P. H. Maenpaa (Finland), E. B. Mawer (UK), A. Mourino (Spain), Y. Nishii (Japan), W. H. Okamura (USA), J. L. H. O'Riordan (UK), J. M. Pettifor (South Africa), J. W. Pike (USA), G. S. Reddy (USA), T. A. Reinhardt (USA), W. F. C. Rigby (USA), B. L. Riggs (USA), E. Ritz (Germany), E. Slatopolsky (USA), T. Suda (Japan), M. R. Uskokovic (USA) and R. H. Wasserman (USA). In addition, the Program Committee reviewed some 311 submitted Free Communication abstracts which were candidates for verbal presentation. Each of the Program Committee members provided a score for 50-80 abstracts which were related to their area of research expertise. This allowed formulation of a rank ordered list of the average scores for all the abstracts so that ultimately 37 abstracts were selected for verbal presentation at the Workshop. This book presents the published Proceedings of the Ninth Vitamin D Workshop and is organized by general topics. Within each topic the first series of contributors are from the Invited or Plenary Speakers (usually 9 pages) followed by the Free Communications (2 pages); where appropriate the 2-page chapters are grouped first by studies in humans, then whole animals, followed by cell culture and biochemical/chemical studies. This Proceedings book (the eighth in a series) for the first time includes a chapter on Neurosciences. The quality and diversity of the sciences presented at the Ninth Workshop was again at an exceptionally high level. Remarkable progress continues to be made in research areas related to the vitamin D endocrine system; these include chemistry, biochemistry and biology, and clinical applications. From a chemical perspective, it is clear that the secosteroid l a , 2 5 dihydroxyvitamin D3 continues to challenge and stimulate organic and physical chemists. This molecule displays unusual conformational flexibility with its 8 carbon side chain, rotation around the 6-7 single carbon bond of the broken B ring and, as well, the chair-chair interconversion of the A ring. Several presentations focused on identifying the energy minimum of the population distribution of the position of the key la-hydroxyl in 3-

VII dimensional space. These results have important implications for the various receptors, both nuclear and membrane, for l a ^ t O H ^ D j . In addition the chemical synthesis of new analogs continues at a frenetic pace. Several new analogs were reported at this meeting and these, of course, provide a fertile ground for study of selective action in the biological arena. In addition, progress continued in identifying the la,25(OH)2D3 hormone response element (HRE) present in the promoters of regulated genes. Reports in the biological areas included a detailed molecular biological consideration of how the nuclear receptor for 1CX,25(OH)2DT interacts with other transcription factors and with other receptors (e.g., retinoia-x-receptor (RxR) or the thyroid receptor to form a heterodimer) to selectively regulate gene transcription. Also there were some reports studying the membrane receptor for la,25(OH)2D3 that is associated with generation of "rapid actions". In addition, there was a dramatic advance in our understanding at the basic science level of la,25(OH)2Dj actions in the autoimmune aspects of diabetes, and cell differentiation of born normal and neoplastic cells. But probably the most impressive advances have been at the clinical level. In addition to the application of la,25(OH)2D3 to managing certain aspects of renal osteodystrophy which were first approved in the USA in 1977, and the use of l a ( O H ) D j in Japan for treatment of osteoporosis, there are a host of new areas of realized or promising clinical applications. These include the application of calcipotriol [la,24S-(OH)2"22-ene-26,27 dehydro vitamin Dg] to manage certain forms of psoriasis; the use of la,25(OH)2-22-oxa-D3 to selectively reduce the secretion of parathyroid hormone (PTH) which contributes to the secondary hyperparathyroidism of chronic renal failure; the application of several analogs [la,25(OH) 2 -16-ene-23-yne-Do or 24a,26a,27a-tn-homo-22,24-diene-la,25(OH) 2 D 3 ] to treat selected forms of leukemia and as well breast cancer, and possibly colon and prostate cancer. Also the use of la,25(OH)2-16-ene-D-j, 20-epi-22-oxa24a,26a,27a-tri-homo-la,25(OH) 2 D3, and 20-epi-la,25(OH) 2 D3 as immunosuppressant agents in certain autoimmune diseases (immune encepnalitis) or organ transplantation (heart, skin, or pancreatic islets) were discussed. Finally, a whole session was devoted to describing recent results of application of vitamin D3 or its daughter metabolite la,25(OH)2D 3 in the treatment and prevention of post menopausal osteoporosis. The point was emphasized that in type II osteoporosis, supplementation with the parent vitamin D3 was effectively able to treat the nutritional deficiency frequently present in the geriatric population. In contrast in type I osteoporosis, which occurs in the female after menopause, treatment with la,25(OH)2D3 has been found to have a therapeutic benefit in reducing the incidence rate of vertebral crush fractures. There is also the provocative possibility that polymorphisms in the gene for the nuclear la,25(OH)2D3 receptor may be evaluated in patients so as to provide some predictive insight as to the potential severity of the rate of loss of bone mineral after the menopause. Still another new aspect of the Ninth Workshop was the organization of two "poster rounds" whereby two experts guided interested participants on a tour of the displayed posters. Thus, Professors K. Kragballe and M. F. Hollick led a dermatology poster tour while Professors P. De Clercq and S. R. Wilson led a chemistry tour.

Vili Another highlight of the Ninth Workshop on Vitamin D was the Awards Ceremony. The Leo Foundation of Copenhagen, Denmark provided a generous gift of $10,000 to support twelve awards to Young Investigators under the age of 35 who had submitted a meritorius abstract to the Workshop. The recipients are listed on page X. Six Career Recognition Awards were given to distinguished scientists to honor their significant and continuing contributions to the field of vitamin D research during the individual's career. The list of recipients for this Ninth Workshop, as well as the Eighth Workshop, are listed on page XI. The Advisory Committee as well as the Program Committee acknowledge the financial support of the many sponsors of the Ninth Workshop on Vitamin D. A tabulation of them appears on the following page. Without the generous multicorporate financial support, it would have been impossible to have had a vitamin D workshop that included such a comprehensive program and world-wide attendance. The setting for the Workshop in the spacious and elegant but friendly Marriott's Orlando World Center was ideal. It was also undoubtedly enhanced by the close proximity of the magic of Walt Disney World® and the Kennedy Space Center. The presentation of the Ninth Workshop on Vitamin D in Orlando, Florida would not have been possible without the dedicated and highly professional contributions of Ms. Marian Herbert, Workshop Secretary, Ms. June E. Bishop, Workshop Coordinator (who has now attended and assisted in the last seven consecutive Workshops), Ms. Amy Inaba and Mr. Don Satchell. Their collective efforts involved not only the extensive communications with all the delegates and sponsors but also the publication of the 289-page Abstract Book. Finally, the Advisory Committee invites interested scientists to the next, the Tenth Workshop on Vitamin D, which will be held in Strasbourg, France from May 24 29, 1997. We look forward to meeting you in Strasbourg.

Roger Bouillon, Leuven Anthony W. Norman, Riverside Monique Thomasset, Paris June 1994

IX

Official Sponsors and Donors NINTH WORKSHOP ON VITAMIN D SPONSORS Chugai Pharmaceutical Co., Ltd. Japan

Novo Nordisk A/S Denmark

F. Hoffmann-La Roche Ltd. Switzerland

Procter & Gamble Pharmaceuticals USA

Hoffmann-La Roche Inc. USA

Solvay-Duphar BV The Netherlands

Institut Scientifique Roussel France

Sumitomo Pharmaceuticals Co., Ltd. Japan

Laboratoires Leo SA France

Teijin Limited Japan

Leo Pharmaceutical Products Ltd. A/S Denmark

Westwood Squibb Pharmaceuticals Research Institute USA

DONORS Abbott Laboratories USA

Procter & Gamble Pharmaceuticals France

Amoco BioProducts Corporation USA

Research Institute for Medicine and Chemistry (RIMAC) USA

Cephalon, Inc. USA INCSTAR CORPORATION USA Kureha Chemical Industry Co., Ltd. Japan Laboratory Dr. Limbach, Prof. Schmidt-Gayk & Colleagues Germany

Ross Laboratories USA Schering AG Germany TEVA Pharmaceutical Industries Ltd. Israel

X YOUNG INVESTIGATOR AWARDEES NINTH WORKSHOP ON VITAMIN D

Dilon Daniel

Chantal Mathieu

Department of Chemistry University of California-Riverside Riverside, California, USA

Lab. Exper. Med. & Endocrinology Katholieke Universiteit Leuven Leuven, Belgium

Helene Defacque

Theresa Matkovits

Department of Cellular Biology Universite Montpellier II Montpellier Cedex, France

F. Jeffrey Dilworth

Department of Biochemistry Queen's University Kingston, Ontario, Canada

AnneMarie Gagnon

Department of Biochemistry University of Ottawa Ottawa, Ontario, Canada

Mireille Lambert

Dept of Biochemistry & Molecular Biology New Jersey Medical School Newark, New Jersey, USA

Hans Postlind

Department of Pharmaceutical Biosciences University of Uppsala Uppsala, Sweden

Trudy Vink-van Wijngaarden Department of Internal Medicine III Erasmus University Rotterdam, The Netherlands

Susana B. Zanello

Hôpital Robert Debre Paris, France

Departamento de Biología Universidad Nacional del Sur Bahia Blanca, Argentina

Gail Marchetto

Hong Zhao

Department of Biochemistry University of California-Riverside Riverside, California, USA

Department of Chemistry New York University New York, New York, USA

XI

Vitamin D Workshop Career Recognition Awardees Awarded for distinguished career contributions to vitamin D related research.

EIGHTH WORKSHOP (Paris, France 1991) Dr. Sonia Balsan (France)

Pediatrician

Dr. Livia Miravet (France)

Rheumatology

Professor B.E.C. Nordin (Australia) Dr. Milan Uskokovic (USA)

Osteoporosis Research Chemistry of 1,25-dihydroxyvitamin D3

NINTH WORKSHOP (Orlando, Florida 1994) Dr. Angelo Caniggia (Italy)

Osteoporosis Research

Dr. Jack W. Coburn (USA)

Renal Osteodystrophy

Dr. William G. Dauben (USA)

Photochemistry of Vitamin D

Dr. Nobuo Ikekawa (Japan)

Chemistry of Vitamin D

Dr. B. Lawrence Riggs (USA)

Osteoporosis Research

Dr. Robert H. Wasserman (USA)

Calcium Binding Proteins

Contents

Chemistry of Vitamin D Shape and Conformation of Vitamin D. 11-Fluoro-la-Hydroxyvitamin D 3 : The Quest for Experimental Evidence of the Folded Vitamin D Conformation P. J. de Clercq, G.-D. Zhu, D. van Haver, H. Jurriaans

3

Conformation and Related Topological Features of Vitamin D: Structure-Function Relationships W. H. Okamura, M. M. Midland, M. W. Hammond, N. Abd.Rahman, M. C. Dormanen, I. Nemere, A. W. Norman

12

Chemical Conversion of Vitamin D 3 to Calcitriol Lactone G. Pizzolato, P. M. Wovkulich, M. R. Uskokovic, A. Norman

21

Design, Synthesis, and SAR of Some 1-Substituted A-Ring Analogs of Calcitriol G. H. Posner

25

A General Synthetic Route to A-Ring Hydroxylated Vitamin D Analogs from D-Pentoses R. M. Moriarty, J. Kim and H. Brumer 111

27

Retiferols. Design and Synthesis of the New Class of Vitamin D Analogs A. Kutner, H. Zhao, A. Podosenin, H. Fitak, M. Chodynski, S. J. Halkes, S. R. Wilson

29

Introduction of la-Hydroxyl Group to Provitamin D Causes New Photoisomerization Reactions S. Yamada, H. Ishizaka, H. Ishida, K. Yamamoto

31

Synthesis and Determination of the Configurations of the 23-Hydroxylated Metabolites of Calcipotriol (MC 903) and their Epimers M. J. Calverley

33

Syntheses of Potential Inhibitors of 25-Hydroxyvitamin D 3 -la-Hydroxylase: A-Ring Analogs D. Daniel, W. H. Okamura

35

Metallic Complexes of Hydroxylated Derivatives of Vitamin D 3 X. T. Do, A.-S. Coquin, S. Megdad, M. A. Khan, G. Bouet

37

A New Route to the Lythgoe-Roche's A-Ring Precursor of la,25-Dihydroxyvitamin D 3 M. Torneiro, S. Vrielynck, A. M. Garcia, J. L. MascareHas, L. Castedo, A. Mourino

39

Structure-Activity Studies of Fluorinated Vitamin D Analogs K. Iseki, Y. Tanaka, M. Kawai, S. Unten, N. Ikekawa, Y. Kobayashi

41

XIV An In Vitro Model of Previtamin D Photosynthesis as Possible Monitor of Ozone Depletion I. Terenetskaya

43

Synthesis of 24-Hydroxy-Vitamin D Analogues J. Granja, M. Rey, J. A. Martinez, A. Fernandez, L. Castedo, A. Mouriflo

45

Chromatographic Isolation and Spectroscopic Characterization of the Photoisomers of la,25-Dihydroxy-Provitamin D3 S. Gliesing, M. Reichenb&cher, M. Gonschior, F. Ude, C. Lange, B. Schdnecker

47

A New Route to the Vitamin D Triene System J. L. Mascarenas, A. M. Garcia, C. Varela, L. Castedo, A. Mourino

49

Studies on the Synthesis of 19-Norprevitamin D3 Analogues M. Maestro, L. Sarandeses, R. Riveiros, L. Castedo, A. Mourino

51

Structure/Function Studies of Vitamin D Steroids The Need for New Vitamin D Analogues: Mechanisms of Action and Clinical Applications L. Binderup, C. Carlberg, A.-M. Kissmeyer, S. Latini, I. S. Mathiasen, C. Mork Hansen

55

Future Prospects for Vitamin D Analogs Y. Nishii, N. Kubodera, K. Sato, K. Kumaki

64

Chemistry and Biology of 22,23-yne Analogs of Calcitriol C. Bretting, C. Mark Hansen, N. Rastrup Andersen

73

Chemistry and Biology of 23-oxa-aro- and 23-thia-aro-Vitamin D Analogues with High Antiproliferative and Low Calcemic Activity G. Grue-Sorensen, E. Binderup, L. Binderup

75

Activity of Vitamin D Analogs in Co-Transfected COS-7 Cells H. van Baelen, R. Convents, R. Bouillon

77

Synthesis and Biological Character of 113-Hydroxylated Vitamin D3 Analogs N. Kubodera, Y. Ono, H. Watanabe, A. Kawase, T. Okano, N. Tsugawa, T. Kobayashi

79

Biological Activity and Conformational Analysis of lJ5,25-Dihydroxyvitamin D3 and its Analogues T. Okano, N. Tsugawa, S. Masuda, A. Takeuchi, T. Kobayashi, N. Kubodera, K. Sato, N. Johnson, G. H. Posner, Y. Nishii

81

Topological Mimics of the 6-s-cis-Conformer of la,25-Dihydroxyvitamin Based on the Provitamin D Skeleton M. W. Hammond, A. W. Norman, J. E. Bishop, M. C. Dormanen, W. H. Okamura

83

D3

XV Chemistry and Biology of Highly Active 22-oxy Analogs of 20-epi Calcitriol with Very Low Binding Affinity to the Vitamin D Receptor M. J. Calverley, G. Grue-Sorensen, C. Bretting, L. Binderup

85

New Discoveries in Vitamin D Related Compounds H. Zhao, A. Kutner, A. Podosenin, S. R. Wilson

87

Modelling of Previtamin D Photosynthesis in View of its Conformational Flexibility O. G. Dmitrenko, I. P. Terenetskaya

89

Active Vitamin D Analogs with Side Chain Hydroxyl Group Occupying Diverse Spatial Region K. Yamamoto, S. Yamada, M. Ohta

91

Synthesis and Biological Activity of 23-oxa Vitamin D Analogues A. Steinmeyer, M. Haberey, G. Kirsch, G. Neef, K. Schwarz, R. Thieroff-Ekerdt, H. Wiesinger

93

Synthesis and Biological Activity of 20-Hydroxylated Vitamin D Analogues K. Hansen, C. Merk Hansen

95

20-Methyl Vitamin D Analogues G. Neef, G. Kirsch, K. Schwarz, H. Wiesinger, A. Menrad, M. Fähnrich, R. Thieroff-Ekerdt, A. Steinmeyer

97

26-Substituted Calcitriols and Other A-Ring Substituted Analogues - Synthesis and Biological Results B. Schönecker, M. Reichenbächer, S. Gliesing, R. Prousa, S. Wittmann, S. Breiter, R. Thieroff-Ekerdt, H. Wiesinger, M. Haberey, D. Scheddin, H. Mayer 99 Syntheses and Biological Activity of lß-Substituted Active Vitamin D3 Analogs H. Ishida, M. Shimizu, K. Yamamoto, K. Yamaguchi, S. Yamada

101

Vitamin D Binding Protein Probing the Vitamin D-Sterol Binding Domain of Human Vitamin D-Binding Protein: Chemical Modification of Specific Amino Acid Residues N. Swamy, R. Ray

105

Crystallization and Preliminary X-Ray Investigation of Vitamin D-Binding Protein from Human Serum C. Verboven, H. de Bondt, C. de Ranter, R. Bouillon, H. van Baelen 107 Effects of Vitamin D-Binding Proteins on Biological Functions of 1 a,25-Dihydroxyvitamin D3 Analogues S. Ishizuka, A. Honda, Y. Mori, N. Kurihara, J. Tatsumi, K. Anai, K. Ikeda, A. W. Norman

109

XVI Vitamin D Hydroxylases: Biochemistry and Regulation Differences of the Regulation of 24-Hydroxylase Gene Expression in the Kidney and Intestine T. Suda, K. lida, Y. Ohyama, K. Ozono, M. Uchida, S. Kato, T. Shinki

113

Regulation of the Ferredoxin Component of Renal Hydroxylases at the Transcriptional and Postradiational Level and of the Protein Inhibitor of Cyclic AMP-Dependent Kinase H. L. Henry, C. Tang, R. Blanchard, G. S. Marchetto

122

Site and Rate of Hydroxylation of la-OH-D 3 Analogs by CYP27 Not Altered by Increasing Length or Changing Orientation of Vitamin D3 Side Chain F. J. Dilworth, S. Strugnell, Y.-D. Guo, M. J. Calverley, H. L. J. Makin, G. Jones

131

Protein Kinase C Up-Regulates 1 a,25-Dihydroxyvitamin D 3 -Induced Expression of 24-Hydroxylase Gene T. Shinki, M. Namiki, M. Uchida, K. Ozono, Y. Ohyama, T. Suda 133 IGF-I Restores the Age-Related Defect in Renal l,25(OH) 2 D 3 Biosynthesis in Response to Dietary Phosphorus Restriction in Rats M.-S. Wong, V. Tembe, M. J. Favus

135

In Vitro Production of 1,25-Dihydroxyvitamin D 3 by Cultured Mouse Kidney Cells and its Regulation by Extracellular Phosphate and IGF-1 C. Menaa, F. Vrtovsnik, G. Friedlander, M. Garabedian

137

The Cytochromes P450 Catalyzing 25-Hydroxylation of Vitamin D and la-Hydroxy lation of 25-Hydroxyvitamin D 3 in Pig Liver E. Axen, H. Postlind, H. Sjöberg, K. Wikvall

139

Evidence that l a - and 27-Hydroxylation of 25-Hydroxyvitamin D 3 are Catalyzed by CYP27 in Pig Kidney Mitochondria H. Postlind

141

The Kinetics of Monocyte la-Hydroxy läse in Uremia. Modulation by Calcitriol and 25(OH)D 3 Therapy A. Dusso, M. Gallieni, S. Kamimura, A. Ahmed, E. Slatopolsky

143

Eicosanoid Inhibitor and Cytokine Regulation of l,25(OH)2D 3 Synthesis in Synovial Fluid Macrophages from Patients with Inflammatory Arthritis S. J. Fowler, J. Y. Yuan, A. J. Freemont, E. B. Mower, M. E. Hayes

145

25-Hydroxyvitamin D-la-Hydroxy läse is Responsible for the Synthesis of I.25-Dihydroxyvitamin D 3 by Peritoneal Macrophages of CAPD Treated Uremic Patients S. Shany, /. Zuili, N. Yankowitz, C. Chaimovitz 147 Influence of Extracellular Calcium in the Kinetic Behaviour of 1-Hydroxylase (1-OHase) and 24-Hydroxylase (24-OHase) in Walker Carcinosarcoma 256 Cells (WS) and in the Renal Proximal Tube Phenotype Cells (LLC-PK1) M. J. Municio, M. L. Traba 149

XVII Insulin and Calcitonin Decrease the Expression of the Renal 25(OH)D-24Hydroxylase Cytochrome P450 in Diabetic Rats N. Wongsurawat, M. A. Boltz, R. Nemani, H. J. Armbrecht

151

Continuous Activation of 25-Hydroxyvitamin D 3 -24-Hydroxylase mRNA Expression by la,25-Dihydroxyvitamin D3-3ß-Bromoacetate M. L. Chen, R. Ray, G. Heinrich, Y.-J. Ohyama, K. Okuda, M. F. Holick

153

Regulation of 24-Hydroxylase mRNA Expression by la,25(OH)2D 3 and its Fluorinated Analogues Y. Miyamoto, T. Shinki, M. Namiki, Y. Ohyama, T. Kasama, T. Sato, T. Suda.

155

Comparative Effects of 1,25-Dihydroxyvitamin D 3 and EB 1089 on Murine 25-Hydroxyvitamin D 3 -24-Hydroxylase S. Roy, J. Martel, O. Chahal, H. S. Tenenhouse

157

Vitamin D Metabolism and Catabolism Target Cell Metabolism of Vitamin D and its Analogs G. Jones, D. Lohnes, S. Strugnell, Y.-D. Guo, S. Masuda, V. Byford, H. L. J. Makin, M. J. Calverley

161

In Vivo Regulation of Rat Intestinal 24-Hydroxylase (I-24-OHase): Potential New Role of Calcitonin M. J. Beckman, J. P. Goff, T. A. Reinhardt, D. C. Beitz, R. L. Horst

170

Metabolism of la,25-Dihydroxyvitamin D 3 and One of its A-Ring Diastereomer la,25-Dihydroxy-3-Epivitamin D 3 in Neonatal Human Keratinocytes G. S. Reddy, K. R. Muralidharan, W. H. Okamura, K.-Y. Tserng, J. A. McLane

172

Vitamin D Metabolism in Human Colon Adenocarcinoma-Derived Caco-2 Cells H. S. Cross, M. Peterlik, H. Egger, I. Schuster

174

Studies on Vitamin D Metabolism by a Human Small Cell Lung Cancer (SCLC) Cell Line, NCI-H82 S. E. Heys, M. E. Hayes, E. B. Mawer

176

The In Vitro Metabolism of Calcipotriol, l,24(OH) 2 D 3 and l,25(OH) 2 D 3 A.-M. Kissmeyer, L. Binderup

178

Regulation of Tissue Inhibitor of Metalloproteinases (TIMP) by 1,25- and 24,25Dihydroxyvitamin D 3 in the Rat Growth Plate D. D. Dean, D. S. Howell, O. E. Muniz, G. A. Howard, B. A. Roos, Z. Schwartz, B. D. Boy an, R. Grumbles 180 The Effect of Parathyroid Hormone on Renal 24-Hydroxylase Activity in the Isolated Perfused Rat Kidney B. R. Thomas

182

XVIII Steroidal Hormones as Modulators of Vitamin D Metabolism in Human Keratinocytes 1. Schuster, G. Herzig, G. Vorisek

184

Potentialisation of Vitamin D (Analogs) by Cytochrome P-450 Enzyme Inhibitors is Analog- and Cell-type Specific J. Zhao, S. Marcelis, B. K. Tan, A. Verstuyf, R. Bouillon 186 Novel Cleavage of Vitamin D 2 Side Chain During Catabolism by Keratinocyte Cell Line G. Jones, V. Byford, R. Kremer, H. L. J. Makin, J. C. Knutson, C. W. Bishop.

188

22-Oxacalcitriol is Metabolized to C 2 i Side-Chain-Cleaved Products in Both Liver and Target Cells S. Masuda, V. Byford, H. L. J. Makin, R. Kremer, T. Okano, T. Kobayashi, N. Kubodera, Y. Nishii, G. Jones

190

Metabolism of the la,25(OH) 2 D 3 Analog 1 a,25(OH) 2 -16-ene-23-yne-D 3 in BALB/c Leukemic Mice and WEHI-3 Myeloid Leukemia Cells D. P. Satchell, A. W. Norman

192

Microtubules Mediate Cellular 25(OH)D 3 Traffic and the Response to 1,25(OH)2D3 in Human Monocytes S. Kamimura, M. Gallieni, E. Slatopolsky, A. Dusso

194

Study of the Metabolism of l,25-Dihydroxy-16-ene-Vitamin D 3 in Rat Kidney Using On-line HPLC-Electrospray Tandem Mass Spectrometry B. Yeung, P. Vouros, M.-L. Siu-Caldera, G. S. Reddy

196

Human Placental Explants: An Efficient In Vitro Model for Comparative Metabolism of l,25(OH) 2 D 3 and its Synthetic Analogs N. L. Gelardi, G. S. Reddy

198

24,25(OH) 2 D 3 Modulates l,25(OH) 2 D 3 Metabolism in Human Osteoblasts M.-L. Siu-Caldera, L. Zou, M. Ehrlich, G. S. Reddy

200

Metabolism of 25 Hydroxy Vitamin D 3 : Kinetics of 23 and 24 Hydroxylases in Human Term Placenta S. J. Kang, N. Gelardi, L. P. Rubin, E. E. Delvin, G. S. Reddy

202

Comparative Study in Vitamin D Metabolism from the View-Point of Ontogeny and Phylogeny A. Takeuchi, T. Okano, H. Sekimoto, Y. Ishida, T. Kobayashi

204

Receptors for la,25(OH)2D3 Receptor Mediated Genomic Actions of l,25(OH) 2 D 3 : Modulation by Phosphorylation M. R. Haussler, P. W. Jurutka, J.-C. Hsieh, P. D. Thompson, S. H. Selznick, C. A. Haussler, G. K. Whitfield

209

XIX Modulation of Vitamin D3 Target Gene Selectivity by Receptor Dimerization L. P. Freedman, B. Cheskis, B. Lemon, M. Liu, T. L. Towers

217

The Molecular Basis for the Genomic Actions of the Vitamin D3 Hormone J. W. Pike

226

Expression of RXRa in Human Leukemic Cells During Differentiation Induced by All-Trans Retinoic Acid and 1 a,25-Dihydroxyvitamin D3 H. Defacque, T. Commes, D. Pariente, C. Sevilla, J. Marti

235

Differential Activation of the Vitamin D Receptor (VDR) by l,25(OH) 2 Vitamin D3 and its 20-Epimers S. Peleg, M. Sastry, E. Collins, J. Bishop, A. W. Norman

237

Dopamine Activates Vitamin D Receptor But Not Retinoid Receptor Mediated Transcription T. Matkovits, S. Christakos

239

Ordered Binding of Human Vitamin D and Retinoid-X Receptor Complexes to Asymmetric Vitamin D-Responsive Elements C. H. Jin, J. W. Pike

241

Immunohistochemical Localization of 1,25-Dihydroxy vitamin D 3 [l,25(OH) 2 D3] Receptors (VDR) in Human and Rat Pancreas J. A. Johnson, J. P. Grande, P. C. Roche, R. Kumar 243 Structure-Function Relationship of Human Parathyroid Hormone on Vitamin D Receptor Regulation in Osteoblast-Like Cells (ROS 17/2.8) S. Sriussadaporn, J. F. Whitfield, V: Tembe, M. J. Favus

245

Insulin-Like Growth Factor I Up-Regulates Intestinal l,25(OH) 2 D 3 Receptor in Phosphorus Restricted Rats S. Sriussadaporn, M. Wong, V. Tembe, M. J. Favus

247

A Peptide C-Terminal to the Second Zn-Finger of Human Vitamin D Receptor is Able to Specify Nuclear Localization Z. Luo, P. H. Maenpad

249

Molecular Cloning and Sequencing of a Novel cDNA Related to the Steroid/Thyroid/Vitamin Family of Nuclear Receptors from a Vitamin DDeficient Chick Intestinal cDNA Library E. D. Collins, A. W. Norman

251

Isolation and Analysis of cDNA Encoding a Naturally-Occurring Truncated Form of the Human Vitamin D Receptor L. Sturzenbecker, B. Scardaville, C. Kratzeisen, M. Katz, P. Abarzua, J. Omdahl, J. McLane

253

EB 1089, a Vitamin D Analogue, Induces the Vitamin D Receptor to Form Selective Receptor Complexes Depending on Cell Type I. S. Mathiasen, A. G. Mackay, K. W. Colston, L. Binderup

255

XX Gene Regulation l,25(OH) 2 D 3 Response Elements: Is There an Order? M. B. Demay, H. M. Kronenberg, J. L. Heymont, C. E. Bogado, S. L. Mackey

259

Vitamin D Regulation of Osteocalcin Gene Transcription: A Model for Defining Molecular Mechanisms of l,25(OH) 2 D3 Control of Osteoblast Growth and Differentiation J. B. Lion, G. S. Stein, J. L. Stein, A. van Wijnen, M. Montecino, R. Desai, A. R. Shakoori, E. Breen, H. Hoffinan, S. M. Pockwinse

264

Regulation of Integrin Expression by 1,25 Dihydroxyvitamin D3 F. P. Ross, X. Cao, H. Mimura, M. Chiba, S. L. Teitelbaum

273

Identification of a Chicken Intestinal DNA Binding Activity Not Related to the Vitamin D Receptor, but Capable of Specific Binding to Vitamin D Response Elements S. Ferrari, R. Battini, S. Molinari

282

Transcriptional Regulation of the Avian Mitochondrial Genome by Altered Dietary Vitamin D3 Status: A Comparison of Intestinal and Kidney Responses S. S. Hannah, S. Y. Chou, K. E. Lowe, R. R. Zielinski, H. L. Henry, A. W. Norman

284

A Novel Vitamin D Response Element in the Murine c-fos Promoter R. St. -Amaud, G. A. Candeliere

286

l,25(OH) ? -Vitamin D 3 (D 3 ) Interactions with 3,5,3'-Triiodothyronine (T3) Signaling in 3 Osteosarcoma Cell Lines G. R. Williams, R. Bland, M. C. Sheppard

288

l,25(OH) 2 -Vitamin D 3 (D 3 ) Signaling in HT-29 Cells: Interactions with 9-eis Retinoic Acid (9-eis RA) K. F. Kane, M. J. S. hangman, G. R. Williams

290

Protein Inhibitor of Cyclic AMP-Dependent Protein Kinase: Genomic Cloning of a l,25(OH) 2 D 3 Down-Regulated Protein M. Rowland-Goldsmith, H. L. Henry

292

Lack of 9-eis Retinoic Acid Effect on Renal 24-Hydroxylase mRNA Expression by 1,25-Dihydroxyvitamin D 3 In Vivo T. A. Reinhardt, R. L. Horst

294

Regulation of Osteopontin Expression by Calcitriol in Mouse Epidermal JB6 Cells P.-L. Chang, T.-F. Lee, A. L. Ridall, C. W. Prince

296

Dissociation between Regulation of Growth and C-myc Oncogen Expression by Vitamin D in Caco-2 Cells W. Hulla, E. Källay, W. Krugluger, M. Peterlik, H. S. Cross

298

XXI TGF-ßl Inhibits the Induction of Osteocalcin Gene by l,25(OH) 2 D 3 at the Level of Transcription A. Pirskanen, T. Jääskeläinen, P. H. Mäenpää 300 Mechanism of Action of 1,25-Dihydroxyvitamin D Differs in Kidney, Intestine, and Bone Cell Lines H. J. Armbrecht, T. L. Hodam, M. A. Boltz

302

mRNA Levels of the Inhibitor Protein of cAMP-Dependent Protein Kinase are Regulated by l,25(OH) 2 D 3 and Forskolin G. S. Marchetto, H. L. Henry

304

Vitamin D Receptor (VDR) Interactions with Vitamin D 3 Response Elements (VDRE) in the Parathyroid Hormone (PTH) and Osteocalcin Genes are Different N. S. Hawa, S. Vadher, J. L. H. O'Riordan, S. M. Farrow 306 Coordinate Regulation of Rat Parathyroid Gland Function by Calcium and 1,25Dihydroxyvitamin D 3 A. J. Brown, M. Zhong, J. Finch, E. Slatopolsky

308

Phosphorylation Pathways Affect Binding of AP-1 and Vitamin D Receptor to their Combined Response Element in the Promoter Region of Human Osteocalcin Gene T. Jääskeläinen, A. Pirskanen, P. H. Mäenpää

310

Rapid Actions of Vitamin D Steroids Transmembrane Signal Pathways Induced by Calcitriol, Estradiol, Testosterone and Progesterone in Osteoblasts M. Lieberherr, B. Grosse, M.-T. Tassin, M. Kachkache, A. Bourdeau

315

Non-Nuclear Actions of loi,25(OH) 2 D 3 and 24R,25(OH) 2 D 3 in Mediating Intestinal Calcium Transport: The Use of Analogs to Study Membrane Receptors for Vitamin D Metabolites and to Determine Receptor Ligand Conformational Preferences A. W. Norman, M. Dormanen, W. H. Okamura, M. Hammond, I. Nemere

324

Nongenomic Effects of Vitamin D B. D. Boyan, V. L. Sylvia, D. D. Dean, Z. Schwartz

333

Binding of the Occupied Vitamin D Receptor (VDR) to Extra-Nuclear Sites: A Potential Mechanism of Nongenomic Actions of la,25(OH) 2 D 3 Y. Kim, S. Dedhar, K. Hruska

341

A Common Mechanism for the Vitamin D Reeeptor Activation and for the Nongenomic Actions of Calcitriol J. Barsony, W. McKoy, I. Renyi, M. E. Liberman

345

The Calciotropic Hormone l,25(OH) 2 -Vitamin D 3 Stimulates Phospholipase D Activity in Cultured Muscle Cells R. Boland, S. Morelli, A. R. de Boland

347

XXII Rapid Non-Genomic Effect of la,25-Dihydroxyvitamin D 3 on Osteoblast Nuclei A. M. Sorensen, D. T. Barati 349 1 a,25-Dìhydroxyvitamin D 3 Induces a Rapid and Sustained Increase in Cytosolic Calcium in Cultured Human Keratinocytes D. M. Jackson, M. F. Holick 351 Aged-Related Changes in the Non-Genomic Response of Intestinal Mammalian Cells to 1,25-Dihydroxy-Vitamin D 3 V. Massheimer, G. Picotto, A. R. de Boland, R. Boland

353

Video Imaging of Intracellular Calcium in Insulinoma Cells: Effects of l,25(OH) 2 D 3 I. N. Sergeev, W. B. Rhoten

355

Cellular Signalling Responses Mediated by l,25(OH) 2 -Vitamin D 3 in Rat and Chick Myoblasts G. Vazquez, A. R. de Boland

357

Involvement of Adenylate Cyclase System in 1,25-Dihydroxyvitamin D 3 Rapid Stimulation of C a 2 + Uptake by Heart Cells G. Santillân, J. Sellés, R. Boland

359

Specific Binding of 1,25-Dihydroxyvitamin D 3 to Rat Colonocyte Basolateral Membranes R. J. Mailloux, M. J. G. Bolt, R. K. Wali, T. A. Brasitus, M. D. Sitrin

361

Protein Kinase C Participates in the Signal Transduction Pathway Triggered by 1,25-Dihydroxyvitamin D 3 in Myocytes M. J. Marinissen, J. Sellés, R. Boland

363

Calbindins D—Function and Gene Regulation: Calcium Transport Mechanistic Studies on Intestinal C a 2 + Transport M. D. Sitrin, T. A. Brasitus

367

Vitamin D, the Intestinal Plasma Membrane Calcium Pump Gene Expression and the Calbindins R. H. Wasserman, J. S. Chandler, Q. Cai, R. Kumar 376 Tissue Specific Calbindin-D 9K Gene Regulation by Calcitriol and Sexual Hormones C. Perret, F. l'Horset, C. Blin, M. Lambert, S. Colnot, M. Thomasset

385

Proteins that Bind to the Calbindin-D 9K Promoter: Known Factors and a New Intestinal Factor M. Lambert, S. Colnot, C. Blin, F. l'Horset, M. Raymondjean, M. Thomasset, C. Perret

394

Studies of the Human Calbindin-D 9K Gene J. R. F. Walters, A. Howard, N. Moghrabi, S. Legon

396

XXIII Calbindins Revisited in the Rat Dental Pulp A. Berdal, A. Brehier, D. Hotton, A. Nanci

398

In Situ Hybridization of Calbindins mRNAs in Rat Ameloblasts D. Hotton, J. L. Davideau, J. F. Bernaudin, A. Berdal

400

Immunoreactive Calbindins-D28K and and Mineralization of Rat Epiphyseal Chondrocytes in Culture N. Baimain, B. von Eichel, R. Toury, F. Belqasmi, M. Hauchecorne, G. Klaus, O. Mehls, E. Ritz

402

Regulation of Calbindin-D 28K by Parathyroid Hormone in MDBK Cells G. K. Mutema, I. N. Sergeev, W. B. Rhoten

404

Phosphorylation and Modulation of Calbindin D 2 8 K by Activation of Protein Kinase C (PKC) A. M. Gagnon, J. E. Welsh

406

Caco-2 Cells: A Human Intestinal Cell Line for Studying the Biologic Activity of Vitamin D Analogs R. J. Wood, G. S. Reddy, J. C. Fleet

408

EGF Down Regulates Both Calbindin D 28 K and the VDR in MDBK Cells M. Donepudi, J. E. Welsh

410

Does Calbindin-D2gK Buffer Intracellular Free Calcium? W. B. Rhoten, I. N. Sergeev

412

Calbindin-D 28K (CaBP-D 28K ) in the Rat Endocrine Pancreas: In Vivo and In Vitro Immunolocalization and its Regulation by Vitamin D 3 Deficiency and 1,25Dihydroxyvitamin D 3 P. -M. Bourlon, A. Faure-Dussert, B. Billaudel, G. Tramu, B. Sutter, M. Thomasset 414 Effect of Two Antiestrogens (Tamoxifen and ICI 182780) on Calbindin-D 9K Gene Expression In Vivo in the Rat Uterus, and In Vitro in Primary Cultures of Myometrial Cells C. Blin, F. l'Horset, M. Lambert, S. Colnot, T. Leclerc, M. Thomasset, C. Perret 416 Identification of a 9 kDa Calcium-Binding Protein in the Chick as Calbindin-D 9K S. B. Zanello, L. Drittanti, A. W. Norman, R. L. Boland 418 Effect of Antisense Sequences Against Calretinin on WiDr Cells J.-C. Gander, V. Gotzos, M. R. Celio, B. Schwaller

420

Intestinal Absorption of Calcium and Strontium Demonstrate a Similar Response to Calcitriol Treatment R. Barto, A. J. A. M. Sips, J. C. Netelenbos, W. J. F. van der Vijgh 422 Physiological Concentrations of 24,25(OH) 2 Vitamin D 3 Decrease the Intestinal Calcium Uptake in the Atlantic Cod, Gadus Morhua D. Larsson, B. T. Björnsson, K. Sundell

424

XXIV Effects of Vitamin D and DL-Buthionine-S, R-Sulfoximine on Intestinal Calcium Absorption N. Tolosa de Talamoni, V. Baudino, A. Marchionatti 426 l,25-(OH)2D3 Stimulates Ca 2 +-Uptake Across the Duodenal Brush Border by at Least Two Independent Mechanisms R. Kaune, J. Harmeyer

428

Effect of Heavy Metals on the Level of Calbindin D2SK and the Assimilation of Ca in Chick Duodenum M. Valinietse, V. Bauman, D. Babarykin

430

Apparent Nephron Localization of the l,25(OH)2D3-Stimulated Calmodulin Binding Proteins in the Rat Kidney E. K. O. Siaw, X. Qin, M. Okwueze, M. R. Walters

432

Raised Intestinal Calcium Secretion in the Young Oophorectomised Rat P. D. O'Loughlin, H. A. Morris

434

Validation of a Simple Test Measuring Intestinal Calcium Absorption Using Strontium as a Marker A. J. A. M. Sips, W. J. F. van der Vijgh, R. Barto, J. C. Netelenbos

436

Cell Differentiation In of E. T.

Vitro Effects of Potent Vitamin D 3 Analogs on Proliferation and Differentiation Seven Human Breast Cancer Cell Lines Elstner, S. de Vos, S. Pakkala, D. Heber, L. Binderup, M. Uskokovic, Umiel, H. P. Koeffler 441

Terminal Differentiation of Human Leukemia Cells (HL60) by a Combination of 1,25-Dihydroxyvitamin D 3 and Retinoic Acid (All Trans or 9-eis) A. Verstuyf, C. Mathieu, L. Verlinden, B. T. Keng, R. Bouillon

449

1,25-Dihydroxyvitamin D3 Induces Growth of Thyroid C Cells and Inhibits Calcitonin Secretion In Vitro M. Lazaretti-Castro, J. G. H. Vieira, F. Raue

451

Differentiation of Human Myelomonocytic Leukemia Cell Lines by Retinoic Acid and Vitamin D 3 Analogs, MC903 and EB1089: Characterization of Cooperative Effects T. Commes, H. Defacque, C. Sevilla, F. Yajid, J. Dornand, J. Marti

453

Effect of Ascorbate and Calcitriol on HL-60 Promyelocytic Cell Line Proliferation and Differentiation G. Löpez-Lluch, M. I. Burön, F. J. Alcai'n, F. Borrego, J. M. Quesada, P. Navas

455

Evidence for a Vitamin D Paracrine System Regulating Fetal Pneumocyte Type II Maturation: Local Synthesis of l,25-(OH) 2 D 3 by Lung Fibroblasts T. M. Nguyen, S. Koite, H. Guillozo, L. Marin, C. Tordet, M. Garabedian 457

XXV Inhibition of IEC-6 Cell Growth by l,25(OH) 2 D 3 : Involvement of TGFß D. Bonell, J. Welsh

459

Interactions between Vitamin D Derivatives, Retinoids and Granulocyte Macrophage - Colony Stimulating Factor in Leukemic Cell Differentiation S. Y. James, S. M. Kelsey, M. A. Williams, A. C. Newlands, K. W. Colston....

461

1,25(OH) 2 D 3 and Agents that Increase Intracellular cAMP Synergistically Inhibit the Proliferation of Mouse Fibroblasts N. Saati, A. Ravid, U. A. Liberman, R. Koren 463 la,25-Dihydroxyvitamin D Rapidly Triggers Inhibition of Fibroblast Contraction of Collagen Lattices D. Greiling, R. Thieroff-Ekerdt 465

Cancer Potential Direct and Indirect Influence of l,25(OH) 2 D 3 on the Growth of Human Colonic and Breast Carcinoma S. Saez, F. Meggouh, M.-F. Lefebvre, F. Descotes, R. Pamphile, L. Adam, M. Crepin 469 The Role of la25(OH) 2 D 3 and its Analogs in Breast Cancer K. W. Colston, A. G. Mackay, S. Y. James

477

Extra-Renal Synthesis of 1,25-Dihydroxyvitamin D: Implications in Inflammatory Arthritis and Cancer E. B. Mawer, M. E. Hayes, J. L. Berry, M. Davies 485 Colon Cancer and Prediagnostic Serum 25-D and 1,25-D Levels M. M. Braun, K. J. Helzlsouer, B. W. Hollis, G. W. Comstock

494

Vitamin D Levels as a Risk Factor for Female Breast Cancer E. C. Janowsky, B. S. Hulka, G. E. Lester

496

Serum 1,25-Dihydroxyvitamin D Levels in Dogs with Cancer-Associated Hypercalcemia and Elevated Levels of Parathyroid Hormone-Related Protein T. J. Rosol, L. A. Nagode, D. J. Chew, C. G. Couto, A. S. Hammer, C. L. Steinmeyer, C. C. Capen

498

Growth Inhibition of Human Colon Cancer in Severe Combined Immunodeficient (SCID) Mice by l,25-(OH) 2 D 3 , DD-003 Y. Tanaka, A.-Y. S. Wu, N. Ikekawa, K. lseki, M. Kawai, Y. Kobayashi 500 Development of Uterus Leiomyosarcoma Tumors and Lung Carcinoma in Calbindin-D 9K 40T Antigen Transgenic Mice C. Perret, B. Romagnolo, T. Molina, H. Hinke, A. Porteu, M. Lambert, S. Colnot, M. Thomasset, A. Kahn

502

XXVI Synergistic Inhibition of Breast Cancer Cell Growth by Vitamin D3 Analogs and Tamoxifen T. Vink-van Wijngaarden, H. A. P. Pols, L. Binderup, C. J. Buurman, G. -J. C. M. van den Bernd, J. C. Birkenhäger, J. P. T. M. van Leeuwen

504

Comparative Effects of l,25(OH) 2 D 3 and EB1089 on Cell Cycle Kinetics in MCF-7 Cells M. Simboli- Campbell, J. Welsh

506

Effect^ of la,25(OH) 2 D3 and Some Selected Analogues on the Invasiveness of Human Mammary Carcinoma Cells In Vitro C. Mark Hansen, T. L. Frandsen, N. Brünner, L. Binderup

508

Growth Regulation of Three Sublines of the Human Prostatic Carcinoma Cell Line LNCaP by an Interrelated Action of 1,25-Dihydroxyvitamin D3 and Androgens J. P. T. M. van Leeuwen, G. J. Steenbrugge, J. Veldscholte, G. J. C. M. van den Bernd, M. H. A. Oomen, H. A. P. Pols, J. C. Birkenhäger

510

Vitamin D and its Analogs Enhance the Expression of Transforming Growth Factor-ß System at Various Levels in Cultured Breast Carcinoma Cells K. Koli, J. Keski-Oja

512

Biologically Active Receptors for Vitamin D 3 are Present in Multiple Human Prostatic Carcinoma Cell Lines G. J. Miller, T. E. Hedlund, K. A. Moffatt

514

Antiproliferative and Antiestrogenic Effects of 1,25-Dihydroxyvitamin D3 and All-Trans Retinoic Acid in Breast Cancer Cells P. Balaguer, D. Gagne, A. Joyeux, E. Demirpence, M. Pons, J.-C. Nicolas ....

516

l,25(OH) 2 D 3 Potentiates TNF Cytotoxicity on Human Cancer Cells D. Rocker, A. Ravid, R. Yacobi, U. A. Liberman, R. Koren

518

Actions of 1,25-Dihydroxyvitamin D and Synthetic Analogs on Cultured Human Prostate Carcinoma Cells R. J. Skowronski, D. M. Peehl, S. Cramer, D. Feldman

520

Effects of 17 ß Estradiol (E2) and Triidothyronine (T3) on Breast Cancer Vitamin D 3 Receptors (VDR) M. T. F. Escaleira, C. R. Nogueira, M. M. Brentani

522

l,25(OH)2D 3 Increases the Cellular Level of the Calcium Dependent Protease, Calpain I, in Human Renal Cell Carcinoma Cells A. Ravid, R. Koren, C. Rotem, O. Jehoshua, T. Glaser, N. S. Kosower, U. A. Liberman

524

Induction of Apoptotic Cell Death by l,25(OH) 2 D 3 in MCF-7 Breast Cancer Cells J. Welsh, M. Simboli-Campbell, M. Tenniswood

526

XXVII Immunology The Role and Mechanism of Vitamin D Analogs in Immunosuppression J. M. Lemire, D. C. Archer, L. Beck, G. S. Reddy, M. R. Uskokovic, H. L. Spiegelberg

531

Prevention of Type I Diabetes in NOD Mice by 1,25 Dihydroxyvitamin D 3 and its Analogues C. Mathieu, M. Waer, R. Bouillon

540

Immunosuppressive Effects of MC 1288 - A Novel Vitamin D Analogue - On Cardiac and Small Bowel Grafts C. Johnsson, G. Tufveson

549

Synergistic Immunosuppression by l,25(OH) 2 D 3 (Analogues) and Cyclosporin A: Animal Experiments Confirm In Vitro Data R. Bouillon, D. Branisteanu, M. Waer, C. Mathieu 551 Calcitriol Modulates Elderly Monocyte HLA DR and DQ Expression and Function J. M. Quesada, J. L. Villanueva, P. Sanchez, M. E. Martinez, B. Ostos, J. Perla, R. Solana 553 Vitamin D-Induced Homotypic Cell Adhesion M. Hewison, L. Faulkner, M. Dabrowski, S. Vadher, E. Hughson, D. R. Katz, J. L. H. O'Riordan

555

The Effect of la,25-Dihydroxyvitamin D 3 on Hybridoma Growth and Antibody Production L. K. Davenport, J. L. Berry, E. B. Mawer

557

Dermatology Mode of Action of 1,25-Dihydroxy-Vitamin D 3 and Analogs in the Treatment of Psoriasis K. Kragballe

561

I,25(OH) 2 D 3 Modulated Calcium Induced Keratinocyte Differentiation: From the Culture Dish to the Psoriatic Patient D. D. Bikle

568

1,25-Dihydroxyvitamin D 3 and its Analogs Herald a New Pharmacologic Approach for the Treatment of Psoriasis M. F. Holick

576

The Effectiveness of Topical 1,25-Dihydroxy vitamin D 3 (l,25(OH) 2 D 3 ) Application in the Treatment of Psoriasis: An Immunohistological Evaluation J. Reichrath, A. Perez, T. Chen, A. Kerber, F. A. Bahmer, M. F. Holick

584

Seven Years of Clinical Experience with Topical Calcipotriene in Psoriasis J. Berth-Jones, J. F. Bourke, P. E. Hutchinson

586

XXVIII

The Effects of Topical Calcipotriol on Systemic Calcium Homeostasis J. F. Bourke, J. Berth-Jones, M. Wong, S. Holland, S. J. lqbal, P. E. Hutchinson

588

Calcipotriol Applied to Normal Human Skin Changes the Number and Morphology of Epidermal Langerhans Cells T. N. Dam, K. Kragballe, J. Hindkjcer

590

Expression of the Vitamin D Receptor mRNA and Protein in Normal and Psoriatic Skin H. Solvsten, M. Svendsen, K. Fogh, K. Kragballe

592

Calcipotriol (MC 903) - Induced Epidermal Hyperplasia is not Associated with a Disturbed Terminal Differentiation in Normal Mouse Skin A. Menrad, C. Okon, A. Härtung

594

Effects of TV-02 on Epidermal Proliferation and Differentiation In Vivo H. Sato, T. Ohta, H. Uno, M. Kiyoki

596

Psoriatic Keratinocytes Metabolize 3 H-la,25-Dihydroxyvitamin D 3 at a Rate Faster than the Normal Keratinocytes S. Ray, R. Ray, M. F. Holick

598

I,25 Dihydroxyvitamin D Upregulates the Phosphatidyl Inositol (PI) Signalling Pathway in Human Keratinocytes by Increasing Phospholipase C-ß (PLC-ß) Levels S. Pillai, D. D. Bikle, M.-J. Su, J. Abe

600

Regulation of the Antiproliferative and Differentiation Activities of 1,25Dihydroxyvitamin D 3 by Growth Factors in Cultured Human Keratinocytes T. C. Chen, K. Persons, W.-W. Liu, M. L. Chen, M. F. Holick

602

Regulation of Vitamin D Receptor Levels by l,25(OH) 2 D 3 in Undifferentiated and Differentiated Normal Human Keratinocyte Cultures M. L. Svendsen, H. Solvsten, K, Fogh, K. Kragballe

604

Differential Effects of 1 a,25-Dihydroxyvitamin D 3 on Human B Cells and Keratinocytes J. A. McLane, S. Sharma, G. S. Reddy, J. W. Morgan

606

Increased PKC Activity in Cultured Human Keratinocytes and Fibroblasts after Treatment with la,25(OH) 2 D 3 N. M. Hanafin, K. S. Persons, M. F. Holick

608

Synthesis of and Response to 1,25 Dihydroxycholecalciferol by Subpopulations of Murine Epidermal Keratinocytes. Existence of a Paracrine System for 1,25 Dihydroxycholecalciferol M. Rizk-Rabin, Z. Rougui, Z. Bouizar, M. Garabedian, J. Pavlovitch

610

Vitamin D 3 and Calcipotriol Stimulate Gene Transcription after Binding to the Vitamin D Receptor in Human Keratinocytes Transfected with a Vitamin D Response Element L. 0. Henriksen, K. Kragballe, T. G. Jensen, K. Fogh

612

XXIX All-Trans Retinoic Acid Inhibits Binding of 1,25-Dihydroxyvitamin D 3 to the 1,25-Dihydroxyvitamin D 3 Receptor of Cultured Human Keratinocytes K. Fogh, H. Solvsten, H. Johnke, K. Kragballe

613

Growth Inhibition of Human Keratinocytes by 1,25-Dihydroxyvitamin D3 is Linked to Dephosphorylation of Retinoblastoma Gene Product T. Kobayashi, K. Hashimoto, K. Yoshikawa

615

Hair Follicle-Expression of 1,25-Dihydroxyvitamin D 3 Receptors (VDR) and Retinoid-X Receptor-a (RXR-a) R. Paus, M. Jung, M. Schilli, A. Kerber, C. Egly, P. Chambon, F. A. Bahmer, J. Reichrath

617

Neurosciences Rat Brain Glial Cells Synthesize and Respond to 1,25-Dihydroxyvitamin D3 by an Increased Production of Nerve Growth Factor I. Neveu, P. Naveilhan, F. Jehan, C. Baudet, M. Garabedian, D. Wion, P. Bracket 621 1,25-Dihydroxyvitamin D3 Induces Nerve Growth Factor in the Brain M. S. Saporito, E. Robbins, E. Brown, K. C. Hartpence, J. Battle, J. L. Vaught, S. Carswell

629

Regulation of Calbindin-D28K: Possible "Cross Talk" between Steroid Receptor and Signal Transduction Pathways: Implications for Neuroscience S. Christakos, R. K. Gill, S. Lee, M. Mattson, G. Stoupakis, Y. Wang

633

Effects of 24R,25-Dihydroxyvitamin D3 on y -Glutamyl-Transpeptidase and Alkaline Phosphatase Activities in Rat Brains F. Darcy, L. Sindji, J. C. Peter, E. Garcion, A. Girault, M. A. Khan, P. Bracket, X. T. Do

640

Transcription of the NGF, BDNF and LNGFR Genes in Osteoblast-like Cells: Regulation by 1,25-Dihydroxyvitamin D 3 (l,25(OH) 2 D 3 ) F. Jehan, I. Neveu, D. Harvie, P. Naveilhan, E. Dicou, P. Bracket, D. Wion ..

642

Induction of Glioma Cell Death by 1,25 Dihydroxyvitamin D 3 P. Naveilhan, C. Baudet, F. Berger, A. L. Benabid, P. Bracket, D. Wion

644

Renal Osteodystrophy Use of Calcitriol in Treating the Secondary Hyperparathyroidism of Uremia: What are the Differences between Oral and Intravenous Therapy? J. W. Coburn

649

Prevention of Renal Osteodystrophy by Vitamin D Analogs N. A. T. Hamdy, J. A. Kanis

658

XXX Decreased 1,25-Dihydroxyvitamin D 3 Receptor Density is Associated with a More Severe Form of Parathyroid Hyperplasia in Chronic Uremic Patients N. Fukuda, H. Tanaka, Y. Tominaga, M. Fukagawa, K. Kurokawa, Y. Seino...

666

Recovery of l,25(OH) 2 D Secretion after Kidney Transplant Depends on the Previous Levels of 25(OH)D M. Ladizesky, O. L. Blanco, S. Zeni, C. Mautalen, P. Castellanos

669

Effects of 24,25(OH)2D3 on the Bone Metabolic Abnormalities in 7/8 Nephrectomized Rats J. J. Kazama, M. Fukagawa, M. Kumagai, H. Yamato, N. Taniguchi, H. Yi, F. Gejyo, M. Arakawa, H. Ozawa, K. Kurokawa

671

Bone and Cartilage The Role of Vitamin D in Bone Marrow Cell Differentiation S. C. Manolagas, X. -P. Yu, T. Bellido, H. Mocharla, R. L. Jilka, E. Abe

675

The Action of 24R,25(OH) 2 D 3 on Bone T. Nakamura, Y. Nagai, H. Yamato, T. Matsumoto, M. Kumegawa, Y. Seino...

684

Conversion of the Vitamin D BindingMutations Protein to a Macrophage Activating Factor: Associated Defects in Osteopetrotic S. N. Popoff, G. B. Schneider 693 Alteration of Charge State of the Bone Matrix Protein Osteopontin (OPN) Induced by l,25(OH) 2 D 3 J. B. Safran, G. C. Wright, R. Khoury, W. T. Butler, M. C. Farach-Carson....

702

l,25(OH) 2 D 3 Corrects Underphosphorylation of Osteopontin in Osteoblasts L. Rifas, L. V. Avioli, S.-L. Cheng

704

HYP/YMouse

Positive Effects of Dietary Calcium and Vitamin D Supplementation on Bone Mineral Density and Mechanical Bone Strength in Growing Male Rats T. Kimura, T. Okano, N. Tsugawa, Y. Okamura, T. Kobayashi

706

24R,25-Dihydroxyvitamin D3 has Bone Forming Ability in HYP Mouse T. Yamate, H. Tanaka, Y. Nagai, H. Yamato, N. Taniguchi, T. Nakamura, Y. Seino

708

Possible Biological Role of 24R,25(OH)2D3 E.-G. Seo, A. W. Norman

710

in the Process of Fracture Healing

Effect of Cadmium on Bone and Vitamin D Metabolism in Rats K. Ueda, A. Adachi, T. Okano, N. Tsugawa, S. Onosaka, T. Kobayashi

712

Long Term Responsiveness to Steroid Hormones Exhibited by Human Fetal Osteoblast-like Cells J. Patava, M. Slater, K. Kingham, M. R. Wilkinson, B. E. Tuch, R. S. Mason

714

XXXI Regulation of Procollagen Type I Synthesis by Various Steroids in Human Osteosarcoma Cells A. Mahonen, A. Jukkola

716

Vitamin D Binding Protein-Macrophage Activating Factor and Bone: Beneficial Effects of DBP-MAF Infusion on Skeletal Functions in Osteopetrotic Rats G. B. Schneider, S. N. Popoff

718

L-Ascorbic Acid is Required for Vitamin D Metabolite-Induced Osteocalcin Secretion in Primary Rat Osteoblasts R. Goralczyk

720

Canine Bone Marrow Cells Infected with Canine Distemper Virus are HyperResponsive to la,25-Dihydroxyvitamin D 3 A. P. Mee, C. May, D. Bennett, P. T. Sharpe, E. B. Mower

722

Interaction of l,25(OH) 2 D 3 and PTH on Growth Plate Chondrocytes G. Klaus, B. von Eichel, T. May, U. Hügel, E. Ritz, O. Mehls

724

In Vitro Effect of Calcitonin on the Mineralization of Tooth Germ in Mice; Comparison with the Effect of Parathyroid Hormone and la,25-Dihydroxyvitamin D3 S. Matsumoto, S. Arakawa, A. Togari

726

24,25(OH)2D3 Induces Differentiation of Resting Zone Chondrocytes into a Growth Zone Chondrocyte Phenotype Z. Schwartz, D. D. Dean, R. Gomez, B. D. Boyan

728

Effect of 1,25-Dihydroxyvitamin D 3 and Two Vitamin D Analogues on the Proliferation and Differentiation of Chick Chondrocytes C. Farquharson, C. C. Whitehead

730

The Influence of Vitamin D Metabolites on Isolated Cartilage Cells Derived from Callus in Rachitic Chicks C. Lidor, Y. Mirovsky, S. Edelstein

732

Miscellaneous Biological Actions of Vitamin D Metabolites and Analogs Increased Sensitivity to Sex Steroids after Pretreatment of Skeletal-Derived Cells with Vitamin D Metabolites D. Sömjen, Y. Weisman, A. M. Kaye 737 Effects of Two Vitamin D 3 Analogues, OCT and ED-71, on Calcium Metabolism in Intestine and Bone and Parathyroid Hormone Secretion in Vitamin D-Deficient Rats N. Tsugawa, T. Okano, S. Masuda, A. Takeuchi, T. Kobayashi, N. Kubodera, K. Sato, Y. Nishii

739

Effect of Vitamin D on the Oxidoreductase Activities of Citric Acid Cycle A. Perez, F. Canas, R. Pereira, N. Tolosa de Talamoni

741

XXXII An Evaluation of Vitamin D 3 Photoisomers and their Metabolites on the Proliferation of Human Keratinocytes and HL-60 Cells C. Torchinsky, T. C. Chen, W. Liu, K. Persons, Z. Lu, M. F. Holick

743

Kinetic and Dose-Dependent Effects of 24R,25-Dihydroxyvitamin D 3 on Renal Alkaline Phosphatase and y -Glutamyltranspeptidase Activities in Intact Rats X. T. Do, J. C. Peter, A. Girault, A. Rabjeau, G. Bouet, L. Sindji, F. Darcy...

745

Assays for Vitamin D Steroids Development and Clinical Application of an Iodinated 25(OH)D Radioimmunoassay B. W. Hollis

749

External Quality Assessment of 25 Hydroxyvitamin D Assays G. Carter, J. Hewitt, D. J. Trafford, H. L. Makin

759

Evaluation of Conditions for Acid Catalyzed Isomerization of 25-Hydroxyvitamin D3 and Sample Preparation by Solid-Phase Extraction S. M. Koncikowski, S. R. Sirìmanne, A. L. Sowell, V. L. Maggio, J. R. Barr, R. L. Jones, B. A. Bowman, E. W. Gunter 761 A Sensitive Immunoassay for 1,25-Dihydroxy Vitamin D Using Stable 125 I-Radiolabel D. Laurie, A. K. Barnes, K. J. Burgess, R. T. Duggan The Use of Iodine-Labelled [ Dihydroxyvitamin D3 J. L. Berry, E. B. Mawer

125

763

I] Tracer in the Assay of 1,25765

Nutrition Nutritional Aspects of Vitamin D in Japanese T. Kobayashi, A. Takeuchi, T. Okano, H. Sekimoto, Y. Ishida

769

Vitamin D in Foods P. H. Manila, V. I. Piironen, E. J. Uusi-Rauva, P. E. Koivistoinen

771

A Survey of Vitamin D Content in Fortified Milk from the U.S. and Canada Q. Shoo, T. C. Chen, H. Heath, M. F. Holick

773

Estimation of Vitamin D and its Metabolites in Meat E. B. Mawer, U. C. S. Gomes

775

Total Parenteral Nutrition and Vitamin D Insufficiency M. Bashyam, E. T. Obi-Tabot, Z. Lu, T. Chen, M. F. Holick

Ill

Osteomalacia (OM) due to Vitamin Depletion (D-) in the U.S. B. Basha, D. S. Rao

779

XXXIII Vitamin D Intoxication - The Role of Increased Bone Resorption in the Genesis of Hypercalcaemia M. Davies, P. L. Selby, J. S. Marks, P. E. Still, E. B. Mawer

781

Hypervitaminosis D in Children and in Young Growing Animals Y. Jiang, J. Zhao

783

Vitamin D Status in Monkey Candidates for Space Flight S. B. Arnaud, T. J. Wronski, V. I. Korolkov, R. Dotsenko, M. Navidi, P. Fung

785

Peculiarities of Calcium and Phosphate Regulation in Horses J. Harmeyer, R. Twehues, C. Schlumbohm, R. Kaune

787

Vitamin D and its Metabolites Increase the Toxic Effect of Heavy Metals in Chicks D. Babarykin, M. Valinietse, V. Bauman, N. Benin

789

The Vitamin D Endocrine System and Lead Intoxication C. S. Fullmer

791

Provitamins D and Vitamins D in Plankton D. S. Rao, N. Raghuramulu

793

Vitamin D-like Activity in Lycopersicon Esculentum T. P. Prema, N. Raghuramulu

795

Osteoporosis Role of the Vitamin D-Endocrine System in Age-Related Bone Loss B. L. Riggs, S. Khosla

799

Role of Vitamin D in Prevention of Hip Fractures P. J. Meunier, M.-C. Chapuy

807

Vitamin D Receptor Gene Alleles and Genetics of Osteoporosis J. A. Eisman, N. A. Morrison, P. J. Kelly, P. N. Sambrook, G. Howard, J.-C. Qi, A. Tokita, L. Crofts, T. V. Nguyen, J. Birmingham

812

Effect of Aging and Osteoporosis on the Bone Levels of l,25(OH)2D3 C. Lidor, P. Sagiv, B. Amdur, R. Gepstein, 1. Otremski, T. Hallel, S. Edelstein

817

Recent Studies of Calcitriol in Osteoporosis M. W. Tilyard

824

Clinical Studies with Vitamin D Analogs in Osteoporosis J. C. Gallagher

830

l,25(OH) 2 Vitamin D in the Prevention of Corticosteroid Bone Loss P. Sambrook, P. Kelly, N. Morrison, J. Eisman

836

XXXIV Calcitriol in the Treatment of Postmenopausal Osteoporosis: Retrospective Analysis of Long-Term, Open-Label Treatment A. Caniggia, R. Nuti, G. Martini, B. Frediani, S. Giovani, R. Valenti, G. Silvestri, M. Matarazzo

842

A Comparison of the Effects of Alfacalcidol Treatment and Vitamin D Supplementation on Calcium Absorption in Elderly Women with Osteoporosis R. M. Francis, I. T. Boyle, C. Moniz, A. M. Sutcliffe, B. S. Davis

850

Effects of 1-a-Hydroxyvitamin D 3 on Bone Mineral Densities and Fractures in Patients with Osteoporosis M. Shiraki, T. Inoue, H. Orimo

852

Electromagnetic Fields Can Prevent Bone Mass Loss Caused by Ovariectomy: Experimental Study in Rats A. Zati, E. Marchi, S. Gnudi, R. Giardino, M. Fini, R. Mongiorgi, T. W. Bilotta

854

Calcidiol Protects Bone Mass in Rheumatoid Arthritis Patients Treated by Low Dose Glucocorticoids J.-P. Devogelaer, W. Esselinckx, C. Nagant de Deuxchaisnes

855

Slow-Release Sodium Fluoride and Continuous Calcium Citrate Therapy Improves Cancellous Bone Connectivity in Osteoporosis: Two Dimensional Trabecular Strut Analysis J. E. Zerwekh, H. K. Hagler, K. Sakhaee, F. Gottschalk, R. D. Peterson, C.Y.C. Pak 857 Osteoporosis in Men R. Nuti, G. Martini, B. Frediani, R. Valenti, S. Giovani, A. Marcocci, G. M. Silvestri

859

Osteoporosis and Mechanical Stress: Does Physical Exercise Improve Clinical and Metabolic Symptoms? A Controlled Trial A. Zati, S. Gnudi, C. Tarozzi, P. Cremonini, M. A. Servadei, T. W. Bilotta

861

Association between Serum 25-Hydroxyvitamin D and Bone Mineral Density in a Normal Population Sample in Germany S. H. Scharia, C. Scheidt-Nave, G. Leidig, M. Seibel, R. Ziegler

863

Prophylactic Effects of 1,24,25-Trihydroxyvitamin D 3 on Ovariectomy-Induced Cancellous Bone Loss in the Rat R. G. Erben, H. Bimer, U. Bante, S. Bromm, W. A. Rambeck

865

Neonatology and Pregnancy Effects of Vitamin D Supplementation in Pregnant Women on the Frequency of Neonatal Hypocalcemia E. Mallet, A. Hénocq, C. H. de Ménibus

869

XXXV Human Dental Development and Vitamin D I. Bailleul-Forestier, J. L. Davideau, /. Bourillot-Noble, L. Malaval, A. Berdal

C. Nessmann,

871

No Effects of Calcitriol Deficiency and Vitamin D Treatment on Active Calcium Absorption in Newborn Piglets B. Schröder, D. Thienenkamp, J. Harmeyer, C. H. van Os, J. A. H. Timmermans, G. Breves 873 Gerontology Comparative Effects of a Three-Month Supplement with 25(OH)D or Vitamin D in Vitamin D-Deficient Elderly Patients M. C. Chapuy, C. Larquier, R. Peyron, P. J. Meunier

877

Biochemical Response to Combined Vitamin D 3 and Calcium Supplementation in Elderly People with Vitamin D Insufficiency P. J. Meunier, M. C. Chapuy, P. Chapuy, M. C. Hazard, J. L. Thomas

878

Biological Effects of Vitamin D and Calcium Supplementation in Elderly Institutionalized Patients J. L. Sebert, R. Bellony, M. Garabedian, M. Brazier, M. Maamer, F. Agbomson, M. Chauvenet

879

Calcium Absorption and Serum 250HD in Normal and Nursing Home Elderly Women H. K. Kinyamu, J. C. Gallagher, K. Rafferty, K. M. Petranick, J. Potter

881

Other Basic Science Topics A Role for Vitamin D in Early Development? P. S. A. White, K. W. Colston, T. R. Arnett

885

The Evolution of the Vitamin D Endocrine System: 25(OH)D3 is an Active Metabolite in Invertebrates L. Kriajev, I. Otremski, S. Edelstein

887

I.25-Dihydroxyvitamin D3 Stimulates Pyruvate Kinase Activity in Human Fibroblasts B. Lunghi, E. Meacci, M. Stio, P. Bruni, C. Treves

889

1,25(OH)2D3 Administration Alters Protein Phosphorylation in the Rat Kidney X. Qin, E. K. O. Siaw, M. R. Walters

891

Photosynthesis of Previtamin D 3 and its Isomerization to Vitamin D 3 in the Savanna Monitor Lizard X. Q. Tian, T. C. Chen, M. Allen, M. F. Holick

893

Regulation of Stimulatory G a Subunit in Vitamin D Deficients Rats C. Marguet, A. Husson, M. Leroy, J. P. Basuyau, E. Mallet

895

XXXVI Other Clinical Topics The Control of Secondary Hyperparathyroidism E. Slatopolsky, J. A. Delmez, A. Brown

899

Phosphate and Glucose Metabolism in Idiopathic Recurrent Calcium Urolithiasis (RCU) of Males - Association of Postprandial Urinary Hyperexcretion of Phosphate, Glucose, Protein, with High Blood Levels of l,25(OH) 2 Vitamin D P. O. Schwüle, U. Herrmann, H. Kissler

908

Relation between Vitamin D and Hypocalcemia in Children with Meningococcal Sepsis M. E. Martinez, M. J. Sánchez-Cabezudo, J. Garcia Pérez, J. Casado-Flores, J. A. Valdivieso

910

HIV Infection and Abnormal Vitamin D Metabolism: Serum Levels of 1,25Vitamin D Correlates with Clinical Progression, Survival and Markers of Immunodeficiency C. Haug, F. Müller, P. Aukrust, S. S. Fraland

912

Assessment of the Synergistic Interactions of Immunosuppressive Agents B. D. Kahan, T. Chou, N. Tejpal, M. Wang, C. Chee, S. Stepkowski

914

Will Vitamin D 3 Analogs be Used to Enhance Graft Acceptance in Experimental Animal and Human Transplantation? P. Veyron, R. Pamphile, L. Binderup, J.-L. Touraine

922

Studies on Prevention of Rickets in North China X. C. Chen, H.-C. Yan, Q.-M.Xu

930

Molecular Mechanism of 1,25-Dihydroxyvitamin D 3 Induced Differentiation of a Human Megakaryoblastic Leukemia Cell Line L.-N. Song

932

Author Index

937

Subject Index

947

Cell Line Index

965

Zoo Index

967

CHEMISTRY OF VITAMIN D

SHAPE AND CONFORMATION OF VITAMIN D. 11-FLUORO-1a-HYDROXYVITAMIN D3: THE QUEST FOR EXPERIMENTAL EVIDENCE OF THE FOLDED VITAMIN D CONFORMATION PIERRE J. DE CLERCQ, GUI-DONG ZHU, DIRK VAN HAVER and HANS JURRIAANS, Department of Organic Chemistry, University of Ghent, Krijgslaan 281 (S4), B-9000 Gent, Belgium. Introduction. 1a,25-Dihydroxyvitamin D3 (1a,25-(OH)2-D3, 3, Scheme 1), the hormonaily active form of cholecalciferol (vitamin D3,1), is responsible for controling intestinal calcium absorption (ICA) and bone calcium mobilization (BCM)(1). The discovery that it is also involved in cell differentiation and proliferation and may play a role in the immune system, has stimulated in recent years an impressive search for analogues with a potential therapeutic value (2, 3).

compd Ri 1 H 1a H 1b H 2 OH 2a OH 2b OH 3 OH

R2

R3

R4

H F H H F H H

H H F H H F H

H H H H H H OH

In spite of numerous structure-function analyses (4), precise information about the active topology of 1a,25-(OH)2-D3 at the time it interacts with its receptor(s) is still lacking. This is primarily due to the flexible nature of the molecule (5). In this context the vitamin D structure can be viewed as a central CD ring system, to which are connected two conformationally independent flexible entities, the upper side chain and the lower part consisting of the A ring and the connecting diene (so-called seco B ring). Several vitamin D structures have been investigated by X-ray diffraction (6); they only reveal, however, a static image of the molecule. The side chain, with its five rotatable C-C bonds, is more appropriately analyzed through force field calculations (5, 7). As for the A ring, NMR solution studies have established a dynamic equilibrium between nearly equimolar populations of two chair conformations (8). However, recent force-field calculations and1H-NMR LIS experiments on vitamin D3

4 have shown that two intermediate diplanar conformations, referred to as half-chair or twist forms, should also be taken into account (9). Rotation about the C6-C7 single bond must be facile. Indeed, the known vitaminprevitamin D equilibration requires vitamin Dto assume the s-c/s or folded geometry (10, 11). The preferred conformation of the diene moiety as revealed by X-ray diffraction (6) and 1 H NMR (12), however, is the s-trans or extended geometry. Quite surprisingly, recent calculations by the group of Wilson indicated the s-c/'s conformation in which the A ring is folded over the top of the C ring to be the global energy minimum (13). In this steroid-like conformation the 1a-OH group is in proximity of the C11 position, a functional area known to be of critical importance to glucocorticoids. So far, however, no experimental evidence has been obtained forthe presence of the folded geometry in solution (8f, 9a). An attractive proposal, therefore, would consist in placing a suitable substituent on C11 to interact with the 1a-OH group in order to increase the population of the folded conformers up to a detectable level. Being only slightly more bulky than a H atom, thus modifying the vitamin D structure only to a small extent, and known to give hydrogen bonding (14), a F substituent seemed ideal for this purpose. In the present paper we describe, therefore, 11-fluorinated vitamin D3 derivatives that were synthesized with the aim of inducing the folded conformation via intramolecular hydrogen bonding between the 1-OH group and the 11 -F substituent. Molecular Modeling. Molecular model examination of the folded conformation reveals that such a hydrogen bond would involve an axial 11 p-F substituent on the C ring and an axially oriented 1a-OH group on the A ring, with the torsional angle C2C1-0-H close to 180°. In order to confirm this working hypothesis, force field calculations were performed on models for 1a-OH-D3 (2), 11a-F-1a-OH-D3 (2a) and 1 ipF-1a-OH-D3 (2b). The molecular mechanics calculations were carried out using MM2(91), including Allinger's latest MM2 force field together with a n-system treatment (former MMP2)(15). To simplify the calculations, the vitamin D3 side chain, considered to play no role in the present investigation, was substituted by a methyl group. Thus, so far as modeling is concerned, the cited derivatives refer to the corresponding model compound with a methyl group on C17. The s-trans or extended (E) and s-c/s or folded (F) geometries of the diene moiety were each combined with four conformations of the A ring, two chair (C) and two diplanar or twist (T) conformations in which the 3-OH adopts either the equatorial (e) or axial (a) position. Using a (+) or (-) to refer to the sign of the torsional angle at C5C6-C7-C8, eight conformations were considered. Table 1 shows the result of the MM2(91) minimizations using starting geometries with a torsional angle C5-C6-C7C8 of 180° (E) or +/-60° (F), C2-C1 -O-H of 180° and C2-C3-0-H of 60°. From these results we derive the following conclusions: (i) in our hands, the (+)EC(e) form or classical s-trans geometry corresponds to the global energy minimum in 2 and 2a; (ii) the folded (-)FC(e) and (-)FT(a) forms, however, become the preferred conformations in the 11 p-F derivative 2b, with calculated 10 11F distances of 287 pm and 275 pm, respectively, in line with the presence of a OH "F hydrogen bond (Figure 1) (14). The result also indicates that, as in the case of vitamin D3 (9), the A-ring dipla-

5 Table 1.

Relative Steric Energies E (kJ mol"1) and 10-11F Distances d (pm) of the Calculated Vitamin D Conformations3 2

compd

2a

conform (+)EC(e)

0.00

0.00

4.02

(-)ET(e)

1.93

1.80

5.86

(-)EC(a)

2.93

2.55

6.86

(+)ET(a)

3.10

2.76

7.16

(-)FC(e)

5.10

4.98

(-)FT(a)

6.36

(+)FT(e) (+)FC(a) a

d

E

2b

E

d

E

d

0.00

287

7.82

3.01

275

7.07

6.49

11.63

8.62

7.66

13.56

322

Program MM2(91 ); distances d > 400 pm omitted.

Figure 1.

Preferred (-)FC(e) Conformation of 11(3-F Derivative 2b

nar or twist forms are real minima with steric energies comparable to the corresponding chair forms. For derivative 2b four additional folded conformations were calculated in which the C ring was in the boat form (equatorial position of the 11 p-F substituent). Upon minimization no OH F hydrogen bond was found and the steric energies were calculated to be more than 10 kJ mol"1 higher then for the (-)FC(e) minimal energy conformer (C-ring chair form), indicating a negligible participation in the conformational mixture. To have a more quantitative idea of the distribution between the extended and folded geometries, one must know the contribution of all the possible conformations to the equilibrium mixture, including the rotamers of the 1 -OH and 3-OH groups. Therefore, 3 x 3 rotamers (torsional angles C2-C1-0-H and C2-C3-0-H of 60°, -60° and 180°)

6

were generated for each of the above eight conformations of the 11 p-F derivative 2b and all 72 starting geometries were minimized using MM2(91), resulting in 32 extended and 26 folded unique conformations. From their relative steric energies, according to a Boltzmann distribution at 298 K, the E/F ratio was calculated to be 31:69 in favour of the folded geometries. In comparison, the same type of calculation carried out for 1a-OH-D3 (2) gave an E/F ratio of 88:12. Synthesis. Our synthetic efforts towards the 11-fluorinated vitamin D derivatives are presented in Scheme 2. Epoxidation of enone 4, readily available from Grundmann's ketone (16), gave the a-epoxide (17) which was reductively opened with lithium di1. H2O2, NaOH 2. Me2CuLi R'O 3. TMSI * 37%

1. 7 or 8, n-BuLi THF, -78 °C 2. PPTS

P(0)Ph2 1. DASTor FAR 2. TBAF

H; R = TBDPS OR; R = TBDMS : H; R = TBDPS : OR; R = TBDMS

HO*"" 11 Ri = H 12 Rt =OH Scheme 2

HO*' 1a Ri=H 2a R1 = OH S=

HO 1b R1 = H 2b R-j . OH TBDMS = t-BuMe2Si TBDPS = t-BuPh2Si

methylcuprate to yield the 11a-OH intermediate 5. After protection of the OH group using 1 -(trimethylsilyl)imidazole, ether 6 was subjected to the Wittig-Horner conditions with the known phosphine oxides 7 and 8 (18), resulting in the corresponding

7

trienes in high yield. Selective cleavage of the TMS ether with pyridinium p-toluenesulfonate (PPTS) in dichloromethane afforded the A-ring protected alcohols 9 and 10, respectively (yield over90%)(19). Treatment of 9 with (diethylamino)sulfur trifluoride (DAST)(20) in dichloromethane at -78 °C resulted in a complex reaction mixture which was first desilylated using tetrabutylammonium fluoride (TBAF) in tetrahydrofuran and then carefully separated by chromatography (column on silica gel, followed by twice HPLC). This gave in 23% combined yield the elimination product 9,11 -dehydrovitamin D3 (11 )(21) and a single 11 -fluorinated derivative (ratio 3:2, respectively). The latter was shown by 1 H NMR to correspond to the a-isomer 1a, i.e. the 11 p-hydrogen has a large sum of vicinal coupling constants Uvic of 32 Hz (axial position) and the angular Me group appears as a singlet at the same position as in 1 and 2 (-0.55 ppm). No formation of the p-isomer 1 b could be detected. The retention of configuration observed during this process is probably due to homoallylic participation by the A7,8 bond (22). For the purpose of synthesizing the 11 p-fluorinated 1a-OH-D3 derivative 2b, it became clear that an alternative fluorinating agent would be necessary. A/-(2-Chloro1,1,2-trifluoroethyl)diethylamine (FAR)(23) has been shown to substitute hydroxyl groups with less formation of elimination products (23b). Therefore, alcohol 10 was treated with FAR in dichloromethane at 0 °C for 1 h and subsequently with tetrabutylammonium fluoride in tetrahydrofuran, leading to a 1:3:1 mixture of the 9,11-dehydro elimination product 12 (24), the a-isomer 2a and the desired p-isomer 2b. The configuration of the latter was established by 1 H NMR: the 11a-hydrogen shows a small SJvic of 12 Hz (equatorial position) and the angular Me resonance, due to a [1,3]-syndiaxial interaction with the 11 p-F substituent, is shifted downfield of the normal position to 0.69 ppm and appears as a doublet with a coupling of 2.6 Hz. Longrange coupling between syndiaxially oriented F substituents and Me groups is well documented in steroids and is very diagnostic in configurational assignments (25). DAST, CH2CI2 -78 °C

F

v

8, n-BuLi THF, -78 °C ->•4 66%

eq 1

In the above experiments our attempts to displace the 11a-OH group by fluorine were carried out on the preformed full vitamin D skeleton, rather then on the hydroxy intermediate 5. Indeed, we had found that, although 5 could be converted into the 11 p-F compound 13 in 48% yield using DAST, the subsequent Wittig-Horner coupling of 13 with the anion derived from the phosphine oxide 8 only led to elimination to give back enone 4 (eq 1). Results and Discussion. The 1 H-NMR spectral parameters of the fluorinated vitamin D3 derivatives in CDCI3 as solvent are listed in Table 2. The non-fluorinated vitamin D 3 (1) and 1a-OH-D3 (2) are included for comparison (8). Of particular interest to the present investigation is the vicinal coupling constant 3J6,7 of the diene moiety,

a X

•£> 05 CO LO Il 2 ci có tí CVJ ^ T-

co. tí I

00

CO.

05 T3 O ) LO O 1: S ci lo

I

c\J IO

^ tí in I- g Tt co CM TD T—

n

T3

^

• . •

cj

1 0

m

TJ-

2 B « ó »

N X co H cg

j- -a cu co ^ 5 ci r- tíOJ TU

co co sÏ B W t f i

LO

3 ^

co s;

o cj

8

I Q. 3

8

CO

OH

less polar M

N

OH

9 SiMe3

M C 1439

(10)

11

^

M C 1578 (12)

SCHEME 1 The conversion of the group "N" to "M" involves the standard sequence (2,3,4) of triplet-sensitised 5 E to 5 Z photoisomerisation and desilylation of the ring A hydroxyls. T h e shown assignments of 23-configurations are made on the basis of the subsequent transformations.

34

(ii) n-Bu N*F" SCHEME 2 The relative 23,24-corifigurations in the intermediates (17) and (19) were deduced from the identification of trans and c/'s epoxides (J2324) generated stereospecifically by cyclisation of the derived O-mesylates (cf. ref. 4). Since the absolute configuration at C-24 is known, their full stereochemistry follows. Reduction of MC 1441 (6) (Scheme 1)gave a ca. 1:3 mixture of side chain diols, as determined by integration of the distinct 23-H signals in the 1H-NMR spectrum. However, the mixture ran as an unresolved broad peak on HPLC, T„= 5.8 min [LiChrosorb" Si 60 column (25 cm x 4 m m ) using EtOAc as eluent at a flow rate of3ml/min]. This peak could easily be separated from the corresponding reduction product of MC 1439 (10) (T„= 4.1 min), which again was shown by NMR to consist of a ca. 1:3 mixture of side chain diols. The single compounds MC 1575 and MC 1577 obtained on Scheme 2 comigrated respectively with these reduction products, and moreover were found to correspond (NMR) respectively to the minor (from MC 1441) and major (from MC 1439) constituents of the reduction mixtures. Taken together, these results clearly demonstrate the basis for deducing the configurations of all six hydroxy compounds in Scheme 1, in particular those of the ketols, MC 1441 and MC 1439.

1. 2. 3. 4.

REFERENCES Masuda, S., Strugnell, S., Calverley, M. J., Makin, H. L. J., Kremer, R., and Jones, G. (1994) J. Biol. Chem. 269, 4794-4803 Calverley, M. J. (1987) Tetrahedron 43, 4609-4619 Calverley, M. J. (1992) in Trends in Medicinal Chemistry '90 (Sarel, S., Mechoulam, R., and Agranat, I., eds) pp. 299-306, Blackwell Scientific Publications, Oxford Calverley, M. J. (1990) Synlett 157-159

SYNTHESES OF POTENTIAL INHIBITORS OF D3-ICX-HYDROXYLASE: A-RING ANALOGS

25-HYDROXYVITAMIN

DILON DANIEL and WILLIAM H. OKAMURA, Department of Chemistry, University of California Riverside, California 92521, USA As part of our general ongoing studies of the metabolites of vitamin D3, we have been interested in the mechanism of action of 25-hydroxyvitamin D3-1ahydroxylase (1-OH-ase). In this regard, our laboratory previously reported the synthesis of 1b, a potent competitive inhibitor of 1-OH-ase (Chart 1) (1). However, this analog exists as a rapidly equilibrating 56:44 mixture of the vitamin 1b and previtamin form 2b via a 1,7-hydrogen shift. The study was ambiguous to the extent that it was unclear whether the active form of the inhibitor was 1b or 2b. Hence, the target 3b was of interest for evaluation as an inhibitor since the analog is "locked" in the vitamin form; it cannot undergo a 1,7-shift to a previtamin form 4b because of the presence of the sp 2 center at carbon-9. In addition, we envisaged a systematic study of the different oxa A-ring analogs 1a-c and 3a-c, which would enable a more thorough analysis of the inhibitory structural demands of 1-OH-ase. We herein report studies directed towards the synthesis of these analogs. Chart 1. (a, n = 0; b, n = 1 ; c, n = 2)

R = HorTMS

7, X = O; V = OTMS

The overall strategy employed is a tandem palladium coupling methodology (2) in which vinyl bromide 6 or 9 (Chart 1) is coupled with the appropriate enyne (Chart 2). The vinyl bromide 6 was obtained from Grundmann's ketone 5 (3) after 25-hydroxylation and a Wittig reaction with bromomethyltriphenylphosphonium bromide (2). Ketone 7 was transformed to enone 8 via a phenylselenium intermediate, and a Wittig reaction on the enone 8 using bromomethyltriphenylphosphonium bromide provided vinyl bromide 9.

36

Palladium Coupling. The enyries were synthesized by Williamson ether synthesis of allyl bromide and the appropriate 1-hydroxyalkyne. The results of the coupling of the vinyl bromides with enynes using 20 mol % Pd(PPh3)4 and the reaction conditions are shown in Chart 2. When either vinyl bromide 6 or 9 was coupled with enynes of varying length, the ratio of products obtained differed and the results are also shown in Chart 2. Chart 2. (a, n = 0; b, n = 1 ; c, n = 2) 2a (23%) + 10a (22%) + 12a (10%) S^li < " - 1 1b/2b (41%) + 12b (23%) THF, Et 3 N, T P P N ^ , 65 °C , 20 -100 h 1c (36%)

6

Pd(PPh 3 ) 4

+

9

Pd(PPh 3 ) 4

+

^ - t i ^ c T ^

Toluene, Et 3 N, TPP, 85 °C, 4 h

o t S - " - 3a (12%) + 11a (23%) + 13a (8%) + 14a (12%) 3b (27%) + 13b (16%) + 14b (18%)

OR

OR

R = H or TMS

H or TMS

10a, A 9 1 1 = dihydro

I2a,b a m

11a, A 9 1 1 = ene

13a,b A 9 1 1 = ene

OTMS

14a, b

• dihydro

The cyclized products 3a,b where R = TMS were deprotected with TBAF to give the desired free alcohol analogs 3a,b. S u m m a r y : The analogs 2a, 1b/2b, 1c, 3a, and 3b have been synthesized using a common tandem palladium coupling strategy. The new A-ring oxa analogs are presently being evaluated as to their 1-OH-ase inhibitory properties in the laboratories of Professor H.L. Henry in the Department of Biochemistry at UC Riverside. While the overall yields of the new oxa analogs are low and mixtures result, the method provides rapid access to these analogs, and, from a synthetic standpoint, the results define the overall scope and limitations of the tandem coupling methodology. Whether this approach can be improved remains for further experimentation. (NIH-DK-16595 and NIH-CA-43277) References: (1) Henry, H.L., Fried, S., Shen, G-Y., Barrack, S.A., Okamura, W.H. (1991) J. Steroid Biochem. Molec. Biol. 38, 775-779. (2) Trost, B.M., Dumas, J., Villa, M. (1992) J. Am. Chem. Soc. 114, 9836-9845. (3) Kiegiel, J., Wovkulich, P.M., Uskokovic, M.R. (1991) Tetrahedron Lett. 32, 6057-6060.

METALLIC COMPLEXES OF HYDROXYLATED DERIVATIVES OF VITAMIN D3 X T. DO*, A-S COQUIN*, S. MEGDAD**, M A. KHAN** AND G. BOUET** Laboratoires de Physiologie* et de Chimie de Coordination**, Faculté de Pharmacie, Université d'Angers, F-49100 Angers (France). As far as we know, very few complexes have been studied using vitamin D or its hydroxylated derivatives as ligands. Barton and Patin used vitamin D2 (ergocalciferol) to obtain iron carbonyl complexes through the trien system (1) and the same authors synthetized palladium chloride n allyl complexes with calciferol, ergosterol, 3-ep*-ergosterol and 7-dehydrocholesterol (2). In addition Qitao, using a pH metric method at a constant ionic strength (0.1 mol.h1) concluded that both Ca " and Cd " give 1:1 (metahligand) and 1:2 complexes (3).ln this paper, we describe the CoCl2:Vit D3 (or its hydroxylated derivatives) system in aqueous NaCI solutions (9 g.h1) at constant ionic strength of 0.3 mol.I-1. The choice of the cobalt as centre of coordination was made because its cation is the central element in vit Bi2- In order to determine the composition of the occurring complexes we have applied the continuous variations method for qualitative determinations (4). Experimental It is well known that vit. D3 and analogues are not very stable when exposed to air or light, consequently, the solutions were always prepared just before recording spectra. The vit. D3 or its hydroxylated derivatives were first dissolved in methanol (2.5 cm3) under dinitrogen atmosphere and further diluted in 50 cm3 of sodium chloride solution. The cobalt solution was prepared in the same way in order to obtain the same molarity of the two solutions. The spectra were recorded at 25 °C (298 K) with a Hitachi U 2000 spectrophotometer. Results and discussion Composition of the complexes To draw the curves for the continuous variations we have determined the corrected absorbance Aeon- (5, 6) in order to keep only the spectrum of the complex species (m is related to the metal and v to the cholecalciferol) : Acorr = Aexp - ( C m E m + C V Ev) (where e is the molar extinction coefficient) As the aqueous solutions of cobaltous chloride present a very weak absorption in the visible region because of their low molarity, it can be assumed that s m » 0. Thus the chosen wavelengths were around the maximum absorption band of the vitamin D3 or its derivatives. The figure 1 presents the curves obtained with 24R,25-dihydroxyvitamin D3. All the ligands give 1:1 and 1:4 type complexes. Estimated overall stability constants The overall stability constants at 298 K were estimated assuming that at a given wavelength, the observed absorption is due to the free ligand only. The logarithmic values of the overall stability constants, log p are tabulated below.

38

1:4 type

LIGAND

^max(nm)

1:1 type

25 (OH) D 3

250

4.7 ±0.2

1a,25 (OH) 2 D 3

283

3.6 + 0.4

16.7 ±0.2

24R,25 (OH) 2 D 3

301

4.3 ± 0.4

17.3 ±0.4

Proposed structures As the complex species are soluble in aqueous solutions, the hydrophilic moiety of the ligands should be in the outer part of the complex. Therefore, the only coordinating atom is the oxygen of the OH in 3, as shown in figure 2. "291 nrtr-*— 296nm

306 nm"«- 311 i

Tamoxifen (mg/kg)

OCT (ng/kg)

ß

0

OCT (0.001 ^g/kg, po)

-

Tamoxifen (0.01 mg/kg, po)

.

Fig. 7 Effect of OCT and tamoxifen on the growth of ER-positive breast carcinoma MCF-7 in athymic mice (Ref. 18)

70

Fig. 8 Effect of OCT and Adriamycin on the growth of ER-negative human breast carcinoma MX-1 in athymic mice (Ref. 18)

tumor, oral administration of OCT as well as the antiestrogen tamoxifen five times a week for 4 weeks suppressed tumor growth in a dose-dependent fashion.

The

antitumor effect of 1.0 |xg/kg of OCT was comparable to that of 2.0 mg/kg of tamoxifen.

In addition, a synergistic antitumor effect of submaximal doses of OCT

and tamoxifen was observed in MCF-7 tumor (Fig. 7). Oral administration of OCT three times a week for 4 weeks also suppressed the growth of ER-negative MX-1 tumor in a dose-dependent manner without raising serum calcium concentrations (Fig.8). These results indicate that OCT suppresses the growth of ER-negative as well as ER-positive breast carcinoma in vivo without causing hypercalcemia and that the antitumor effect of OCT can be enhanced by tamoxifen in an ER-positive tumor. It is suggested that OCT may provide a new strategy, either alone or in combination with other anticancer drugs, for systemic adjuvant therapy of breast carcinoma regardless of ER status. Future prospects for vitamin D analogs

Finally, we would like to focus on the

immuno-regulating activity of active vitamin D and its analogs. The relations of vitamin D receptor and immune cells according to what we know today are summarized in Fig.9. The diversity and complexity of the immune reaction of vitamin D lead to different immunoreactions by each vitamin D analogs. Vitamin D analogs with different structures have different action sites and different potencies.

We

already reported that oral administration of OCT augmented the primary immune

71

g /

Thymus

\

VDH

Fig. 9 Vitamin D receptor in the immunocytes

response induced by immunization with a sub optimal number of SRBC (10), and prolonged the average life span of autoimmune MRL/I mice while preventing the appearance of proteinuria (19).

Recently, Dr. Binderup and her colleagues have

reported that KH 1060, characterized by an epi-form at the 20 position of OCT with an elongated side chain, shows an incredibly potent activity, inducing a considerable immunosuppressive action in vitro (20), suggesting it might have potential as an agent in the prevention of graft rejection. When we want to analyze the biological properties which determine the clinical usefulness of vitamin D derivatives, the following points should have to be taken into account: 1) Binding affinity to the vitamin D receptor (VDR) 2) Binding affinity to the DBP and other serum proteins 3) Metabolism in major target organs of vitamin D such as the liver, intestine and kidney, and excretion into urine and bile 4) Half-life in blood 5) Delivery to and metabolism in target organs 6) After reaching the target organ, transport to VDR in the nuclei 7) The gene expression process 8) Differences between in vivo and in vitro activities It has been frequently observed in the papers so far reported that hypercalcemia, which is a side effect well known to physicians in the clinic, is induced all the time by raising the dose of vitamin D derivatives. However, at the dose levels to induce hypercalcemia, much more serious and unpredictable side effects such as

72 elevations of G O T and G P T or renal toxicity can be greatly reduced. Consequently, if it would be possible to induce one specific biological activity at a dose under the administration level at which hypercalcemia appears, the effect of that vitamin D derivative would be undoubtedly a much improved treatment for the target disease. Refferences 1. Abe, E., Miyaura, C., Sakagami, H., Takeda, M., Konno, K., Yamazaki, T., Yoshiki, S., and Suda, T. (1981) Proc. Natl. Acad. Sci. USA 78, 4990-4994. 2. Kubodera, N., Watanabe, H., Kawanishi, T., and Matsumoto, M. (1992) Chem. Pharm. Bull. 40, 1494-1499. 3. Miyamoto, K., Murayama, E„ Ochi, K„ Watanabe, H., Kubodera, N. (1993) Chem. Pharm. Bull. 4 1 , 1 1 1 1 - 1 1 1 3 . 4. Christiansen, C. (1994) Amer. J. Med. 94, 646-650. 5. Gallagher, J.C., Jerpbak, C.M., Johnson, K.A., DeLuca, H.F., Riggs, B.L. (1982) Proc. Natl. Acad. Sci. USA 79, 3325-3329. 6. Okano, T., Tsugawa, N., Masuda, S., Takeuchi, A., Kobayashi, T., Takita, Y., Nishii, Y. (1989) Biochem. Biophys. Res. Commun. 163, 1444-1449. 7. Tsurukami, H., Nakamura, T., Suzuki, K., Sato, K., Higuchi, Y., Nishii, Y. (1994) Calcif. Tissue Int. 54, 142-149. 8. Abe, J., Morikawa, M., Takita, Y., Miyamoto, K., Kaiho, S., Fukushima, M., Miyaura, C., Abe, E„ Suda, T „ Nishii, Y. (1987) FEBS Lett., 226, 58-62. 9. Morimoto, S., Imanaka, S., Koh, E., Shiraishi, T., Nabata, T., Kitano, S., Miyashita, Y., Nishii, Y., Ogihara, T. (1989) Biochem. Int. 19, 1143-1149. 10. Abe, J., Takita, Y., Nakano, T., Miyaura, C., Suda, T., Nishii, Y. (1989) Endocrinology, 124, 2645-2647. 11. Abe, J., Nakano, T „ Nishii, Y., Matsumoto, T., Ogata, E., Ikeda, K. (1991) Endocrinology, 129, 832-837. 12. Oikawa, T., Yoshida, Y., Shimamura, M., Ashino-Fuse, H., Iwaguchi, T., Tominaga, T. (1991) Anti-Cancer Drugs, 2, 475-480. 13. Brown, A. J., Ritter, C. R., Finch, J. L., Morrissey, J., Martin, K. J., Murayama, E„ Nishii, Y., Slatopolsky, E. (1989) J. Clin. Invest., 84, 728-732. 14. Inoue, M., Wakasugi, M., Wakao, R., Gan, M., Tawata, M., Nishii, Y., Onaya, T. (1992) Life Science, 51, 1105-1112. 15. Shimosawa, T., Ando, K., Fujita, T. (1993) Hypertention, 21, 253-258. 16. Endo, K., Hirata, M., Ohkawa, H., Kumaki, K., Kubodera, N., Slatopolsky, E. (1993) J. Am. Soc. Nephrol., 4, 719. 17. Nishina, H., Sato, F., Shimaoka, S., Kitamura, H., Ohishi, T., Kawanishi, T., Aso, Y., Takahashi, F., unpublished data. 18. Abe-Hashimoto, J., Kikuchi, T., Matsumoto, T., Nishii, Y., Ogata, E., Ikeda, K. (1993) Cancer Res., 53, 2534-2537. 19. Abe, J., Nakamura, K„ Takita, Y., Nokano, T „ Irie, H., Nishii, Y. (1990) J. Nutr. Sci. Vitaminol. 3 6 , 2 1 - 3 1 . 20. Binderup, L., Latini, S., Binderup, E., Bretting, C., Calverley, M., hansen, K. (1991) Biochem. Pharmacol. 42, 1569-1575.

73 CHEMISTRY AND BIOLOGY OF 22,23-YNE ANALOGS OF CALCITRIOL C. BRETTING 1 , C. M 0 R K HANSEN 2 , N. RASTRUP ANDERSEN 3 , Departments of Chemical Research1, Biochemistry 2 and Spectroscopy 3 , Leo Pharmaceutical Products, DK-2750 Ballerup, Denmark. Introduction. Vitamin D analogs with the 20-epi-configuration have potent activity on cancer cell growth and differentiation (1) and on the immune system (2). X-ray crystallography on a cholesterol derivative with the same side chain as the potent analog KH 1060 shows that the side chain is oriented to the "left" or "north west" (3). Molecular mechanics calculations on the 20-epi analogs KH 1060 and MC 1288 also, but not conclusively, indicate this orientation (4). Our present study on rotationally restricted analogs (Table) supports the same deduction. Synthesis. Scheme 1. The starting materials for the 20-"normal" and the 20-"epi" analogs were the aldehydes 1 or 2 (5). They were converted to the alkynes 3 (6), and their lithium salts were reacted with an oxirane (7) or alkylated (8) with a protected side chain synthon. Photoisomerizatjon and deprotection (5) gave the 20-"normal"/20-"epi" compounds of the Table. Scheme 2. The A17,20-Z and -E, and the A20,21 analogs of the Table were synthesized from the 20-ketone 4 (9). Addition of lithium acetylide side chain synthons gave the 20-hydroxy intermediates . They were acid-dehydrated and photoisomerized or vice versa. The A17,20-Z intermediate was the major product and the A20,21 and the A 17,20-E isomers were minor products. These were separated by repeated preparative HPLC, but only for n=2 were all three isomers obtained in sufficient purity. Assignment of Z- and E-configuration was made by NMR, comparing 1 indicates that the analog is more active.

Table 21

n

n H

1

U 937 Inhibition of Proliferation Calcemic Activity in the rat

Vitamin D Receptor Binding

2

3

Leo Code no. 4

Biological Test Data Relative to 1,25(OH) 2 D 3

'

wl

20-"epi"

Ä17.20-Z

A20.21

3.9

32

1.4

0.27 CB 1260

280 0.44 CB 1167

490 0.07 CB 1005

0.63

H

H

0.07 CB 1081

710 0.17 CB 1174

0.71

290 0.02 CB 1120

0.25

Û17.20-E

3.5

0.87 CB 1099

1.2 0.03 CB 1184

20-"norm."

0.89 CB 1303

2.5 0.001 CB 1212

1.8 CB 1309

0.1 0.02 CB 999

25 0.76 CB 1102

Discussion. In the U937 assay both the Z- and the 20-epi analogs (n=2;3) are several hundred times more potent than calcitriol, for n=1;4 less so, while the (single) E-isomer, and the 20-normal isomers are only a few times more (or less) active. The A20,21 analogs are equipotent to calcitriol. No obvious pattern can be seen in the VDR-binding activity, but the E-analog (CB 1212) is particularly inactive. The calcemic activities of CB 1005, C B 1174, and CB 1120 are somewhat smaller than that of calcitriol. Preliminary molecular modelling studies, using the software package Sybyl, indicate that the 20-"epi"analogs prefer the "north-west", while the 20-"normal"-analogs prefer the "north-east" conformation. The results from this study indicate that the receptor involved has a binding site corresponding to the "north-west" region of the vitamin D molecule. Acknowledgements. W e thank Mr. P. Jacobsen for expert synthetic assistance and Dr. A. Lagersted for the molecular modelling studies. References. (1) Binderup, L., Latini, S., Binderup, E., Bretting, C., Calverley, M . a n d Hansen, K. (1991 )Biochem. Pharmacol. 42, 1569-1575. (2) Binderup, L. (1992) Biochem. Pharmacol. 43, 1885-1892. (3) Wilson, S.R., Zhao, H. and Dewan, J. (1993) Bioorg. Med. Chem. Lett. 3, 341-44. (4) Midland, M M., Plumet, J. and Okamura, W.H. (1993) Bioorg. Med. Chem. Lett. 3, 1799-1804. (5) Calverley, M.J. (1987) Tetrahedron 43, 4609-4619. (6) Calverley, M.J. and Bretting, C.Aa.S. (1993) Bioorg. Med. Chem. Lett. 3, 1841-1844. (7) Yamaguchi, M. and Hirao, I. (1983) Tetrahedron Lett. 24, 391-394. (8) Burger, A., Colobert, F., Hetru, C. and Luu, B. (1988) Tetrahedron 44, 1141-1152. (9) Hansen, K., Calverley, M.J. and Binderup.L. (1991) in Vitamin D: Gene Regulation, StructureFunction Analysis and Clinical Application (Eds. Norman, A.W., Bouillon, R. and Thomassset, M.), pp. 161-162. Walter de Gruyter, Berlin. (10) Chaudhuri, N.K. and Gut, M. (1965) J. Am. Chem. Soc. 87, 3737-3744.

CHEMISTRY AND BIOLOGY OF 23-OXA-ARO- AND 23-THIA-ARO-VITAMIN D ANALOGUES WITH HIGH ANTIPROLIFERATIVE AND LOW CALCEMIC ACTIVITY GUNNAR GRUE-S0RENSEN1, ERNST BINDERUP1 and USE BINDERUP2, 'Department of Chemical Research and department of Biochemistry, Leo Pharmaceutical Products, DK-2750 Ballerup, Denmark. INTRODUCTION. EB1213 and GS1500, two follow-up candidates to Calcipotriol as antipsoriatic agents, represent a new type of analogues of calcitriol (Scheme, next page). A number of analogues, structurally related to EB1213 and GS1500, were synthesized and tested for biological activity (Schemes). SYNTHESIS. The 23-oxa- and 23-thia-aro-vitamin D analogues were prepared from the tosylate MC1245 (1) or the 20-ep/-tosylate MC1277(2). The over all yields were generally in the range of 60-80%. The hydroxy- or mercapto-benzyl alcohols used in the first step were prepared from the corresponding hydroxy- or mercapto-benzoic acid esters by LiAIH4 reduction or by reaction with MeMgX, EtMgX or MeLi.

20S (normal): MC1245 20R (epi): MC1277 X = 0 orS R =H, Me or Et

x j l -j-eoh ' R a) HX^ ^ / NaH / DMF DMF b) HV/anthracene/CH2CI2 C) HF / EtOAc / MeCN / H 2 0

BIOLOGICAL ACTIVITY. Compounds in the Scheme were tested for their ability to inhibit the proliferation of U937 histiocytic leukemia cells relative to calcitriol (3). Selected compounds were given orally to rats for 7 days and the excretion of calcium in the urine from day 3 to 7 was measured. The calciuric effect relative to calcitriol was determined (3). From the "Structure/activity Scheme" it was concluded that: • 20-Epi configuration invariably gave the most antiproliferative compounds. • A meia-substituted phenylene group gave the most antiproliferative compounds. • An a,a-dimethyl benzylalcohol sidechain termination gave higher antiproliferative activity than the corresponding unsubstituted or o,o-diethyl benzylalcohol analogues. 23-Oxa analogues showed a slightly higher antiproliferative activity than the corresponding 23-thia analogues. • 23-Thia analogues were slightly less calcemic than the corresponding 23-oxa analogues. The binding affinities to the chicken intestinal vitamin D receptor are the same for EB1213 and calcitriol, while GS1500 shows a twelvefold lower affinity.

76

Compound name / antiproliferative activity / calcemic activity 'Human U 937 cells, relative to calcitriol "Urinary calcium (rats), relative to calcitriol

OH EB1224/0.2/0.03 GS1780 / 0.09 / -

EB1220 / 0.08 / • GS1790 / 0.6 / -

EB1213/260/0.08 GS1500/144/ 0.002

t

EB1255/0.5/0.004 GS1498/2.7/0.0003

I

J*

V ^ X EB1219/100/ 0.06 GS1730/ 4.9/ 0.001

EB1215/0.27/0.25/0.001

OH

'

EB1244 / (tZc-Pre), 4 — c 2 + c 2 . (Pre), 5 — c 3 (T).

Thus the possibility has been shown to attain the higher concentration of Pre under higher conversion of initial Pro and lower T accumulation by the shift of conformational equilibrium to cZc-Pre conformation. In conclusion, one may note that experimental studies of provitamin D photoisomerization in various organized media under restricted molecular geometry (4-7) show that such purposful influence on the conformational equlibrium of previtamin molecule can be attained by the choice of proper reaction medium. Acknowledgment Prof. A.A.Serikov is gratefully acknowledged for his interest in this work. References 1. Jacobs, H.J.C. and Havinga, E. (1979) Adv.Photochem. 11, 305-373. 2. Dauben, W.G. and Funhoff, D.J.H. (1988) J.Org.Chem. 53, 5070-5075. 3. Dmitrenko, O.G.andTerenetskaya, I.P. (1993) Teor. iExper.Khim.29(4), 326-332 (Translated in English). 4. Moriarty, R.M., Schwartz R.N., Lee,C. and Curtis,J.V. (1980) J.Am.Chem.Soc. 102(12), 4257-4259. 5. Yamamoto, J.K. and Borch, R.F.(1985) Biochemistry 24(13), 3338-3344. 6. Terenetskaya, I.P., Perminova, O.G. and Yeremenko, A.M. (1990) J.Mol.Struct. 219, 359-364. 7. Terenetskaya, I.P., Perminova, O.G. and Yeremenko, A.M. (1992) J.Mol.Struct. 267, 93-98.

ACTIVE VITAMIN D ANALOGS WITH SIDE CHAIN GROUP OCCUPYING DIVERSE SPATIAL REGION

HYDROXYL

K. YAMAMOTO. 1 S. YAMADA 1 and M. OHTA.2 'institute for Medical and Dental Engineering, Tokyo Medical and Dental University, 2-3-10 Surugadai Kanda, Chiyodaku, Tokyo 101, 2 Fuji Gotemba research Labs., Chugai Pharmaceutical Co., Ltd. 1-135 Komakado, Gotemba, Shizuoka 412, Japan. We designed and synthesized active vitamin D analogs (1-10) whose side chain hydroxyl groups occupy diverse spatial regions to study the structure and activity relationships and to clarify the molecular mechanism of vitamin D action. Conformational Analysis and Design of Analogs. Hydroxyl groups play a major role in binding to a receptor protein. To clarify the side chain conformation of l,25(OH)2D3 to bind to VDR, we analyzed the mobility of the side chain in terms of the spatial region accessible by the 25-hydroxyl group. Figure 1 shows a stereoview of the conformations of l,25(OH)2D3 and its 20-epimer: the wire structures show most stable conformation of the two vitamin D and they are superimposed at the skeletal part, and dots show the regions where the 25-hydroxyl group of each vitamin D can access. Inspecting the dot map we notice that each vitamin D has two major densely populated regions: A and G for l,25(OH)2D3 and EA and EG for 20-epi-l,25(OH)2D3. These regions correspond to anti (A) and gauche(+) (G + ) conformations for l,25(OH)2D3, and anti (EA) and gauche(-) (EG") conformations for 20-epi-l,25(OH)2D3 with respect to the 17,20,22,23-angle. Figure 1

We designed ten 22-substituted analogs of active vitamin D, 1-10, whose side chain hydroxyl is restricted to occupy one of the four spatial regions defined above and the analogs were classified into group A, G + , EA, and EG" accordingly (Figure 2). The substituent at C(22), the key position to determine the side chain conformation, serves to restrict the side chain mobility. Figure 2

G + Me

Bu

0u OH

B u 0H

! EG'

Bu

"rpri Ve ' r ^ H Her

?u

Bu QH

'-Pr o

1

Bu OH

" r1 ^n V '

EA

„u

92 Synthesis. Syntheses of analogs, 1-10, were performed via diastereoselective conjugate addition of alkyl cuprate to steroidal (£)- and (Z)-22-en-24-one and -22-en-24oate as the key step as shown in scheme 1 (1,2). Alkyl cuprates add under kinetic conditions to the (E)- and (Z)-enones (X=R") as well as (£)- and (Z)-enoates (X=OR") with reverse selectivity. Thus either 22R- or ¿'-substituted side chains were constructed efficiently and stereoselectively (80-100%). Scheme 1

1, 3, 7 and 9 2, 4, 8 and 10

—

Biological Activity. The activity of the analogs, 1-10, to bind to VDR was examined in compared with l,25(OH)2D3 (Table I). It is apparent that the members of A and EG" group analogs show much higher activity than the others. The contrasting activities of the two 22-methyl analogs (1 and 2) are especially outstanding: VDR binding ( 1 : 2 : 1 , 2 5 ( O H ) 2 D 3=1/40:1/3:1); differentiation of HL-60 cells (1:2:1,25(OH)2D3=1/70:1:1). The results suggest that the conformation of l,25(OH) 2 D 3 involved in binding to VDR and responsible for activity is the 17,20,22,23-anti form and the region where 25-hydroxyl group occupies is the A. Then the question arises why 20epimer shows VDR binding activity similar to l,25(OH)2D3 (3) though the regions occupied by the 25-hydroxyl group of each compound do not overlap: A and EG are in different spatial regions (see stereoview of Fig.l). One of the possibilities is that 25hydroxyl groups of l,25(OH)2D3 and its 20-epimer bind to the different site of VDR and the other is that the 20-epimer binds to VDR by flipping the molecule horizontally. Further studies are progressing to verify the possibilities. compound side chain hydroxyl group relative affinity with VDR

l,25(OH)2D3

1

2

3

4

5

6

G+ & A

G+

A

G+

A

EG-

EA

1

1/40

1/3

1/200

1/15

1/40

1/300

References 1) Yamamoto, K„ Yamada, S„ and Yamaguchi, K. (1992) Tetrahedron Lett. ,33, 7521-7524. 2) Yamamoto, K., Takahashi, J., Hamanó, K., Yamada, S., Yamaguchi, K. and DeLuca, H. F. (1993) J. Org. Chem. , 58, 2530-2537. 3) Binderup, L., Latini, S., Binderup, E., Bretting, C., Calverley, M. and Hansen, K. (1991) Biochem. Pharmacol. 42, 1569-1575.

SYNTHESIS AND BIOLOGICAL ACTIVITY OF 23-OXA VITAMIN D ANALOGUES ANDREAS STEINMEYER, MARTIN HABEREY, GERALD KIRSCH, GUNTER NEEF, KATINCA SCHWARZ, RUTH THIEROFF-EKERDT AND HERBERT WIESINGER, Research Laboratories of Schering AG, D-13342 Berlin, Germany Introduction. 1a,25(OH) 2 D 3 regulates serum calcium homeostasis and exerts also an effect on cell proliferation and differentiation. In search for compounds which selectively act on differentiation, a new series of 1 a-hydroxylated 23-oxa vitamin D 3 derivatives was synthesized with an increased number of carbon atoms in the side chain and with modifications at the 20-position. Synthesis. Structural modifications of the 23-oxa side chain include incorporation of alkyl-groups in the 26,27-position, double homologation in 24-position and/or a methyl-, methylen- or cyclopropyl-group in the 20-position. The key transformation in the synthetic approach is the phase-transfer alkylation of vitamin D C22 alcohol with t-butyl-bromo-acetate or trimethyl 4-bromo-orthobutyrate (1,2). Methods. The binding affinity to the vitamin D receptor (VDR) was assessed by the potency of test compounds to compete with 1a,25-dihydroxy-[26,27-methyl 3 H]cholecalciferol for the binding site in a pig intestinal nuclear extract. The binding affinity of compounds to purified human vitamin D binding protein (DBP) (generously supplied by Prof. Bouillon) was assessed likewise by the potency of test compounds to compete with 25-hydroxy-[26,27-methyl 3 H]-cholecalciferol for the binding site. The induction of HL60-cell differentiation was measured after incubation with substances for 96 hours by the ability of differentiated cells to reduce nitroblue-tetrazolium. The calcium-mobilizing activity was determined in juvenile rats by measurement of renal calcium excretion during 16 hours after subcutaneous administration of the substances (3). Structure-activity relationship. 1a,25(OH) 2 D 3 and compound 1 have similar biological properties with respect to VDR binding, DBP binding and HL60-cell differentiation, whereas calcium mobilising activity of compound 1 is 5-fold reduced. All further structural modifications of the side chain (compounds 2-9) lead to a complete loss in DBP binding affinity. Elongation of the side chain by one carbon atom in the 26,27-positions (compound 2) does not change VDR binding, HL60-cell differentiation and calciuric activity compared to calcitriol. However, elongation of the side chain by two carbon atoms either in the 26,27-positions (compound 3) or in the 24-position (compound 4) results in a selective reduction of the calciuric activity. Analogues with a methyl-, methylen- or cyclopropyl-group in the 20-position (compounds 5-9) have similar biological activities in comparison to the corresponding compounds with natural configuration at the 20-position (compounds 2 and 3). In summary, 23-oxa-1a,25(OH) 2 D 3 (compound 1) has a reduced calcium mobilising activity. Side chain elongation of 23-oxa-1a,25(OH) 2 D 3 leads to a complete loss of DBP binding affinity and a further markedly diminished calciuric activity whereas the activity on cell differentiation is unchanged. 20-modified 23-oxa vitamin D analogous show similar biological activities in comparison to compounds with natural configuration at the 20-position.

94 Tabulated structure-activity relationship of 23-oxa vitamin D analogues. VDR binding DBP binding HL60-cell Calciuric affinity affinity differentiating activity relative to relative to activity relative to 1,25(OH) 2 D 3 25(OH)D3 relative to 1,25(OH) 2 D 3 1,25(OH) 2 D 3 [DR]* [RBA] [RBA] [DR]**

No. C o m p o u n d R:

1,25(OH)2D3

Y^Yoh

100

1.2

1

1

1

ZK 150582

33

0.5

2

5

2

ZK 150154

50

Compound V (56.5%) = 1a,24(R)-(OH)2D3 (54.2%) > MC903 (38.2%) > 1a,24(S)-(OH)2D3 (17.6%) under serum-free culture conditions. The order of relative % potency for MNC formation was MC903 (1851.1%) > Compound V (1526.3%) > OCT (572.4%) > VT-102 (168.3%) > 1 a,25-(OH)2D3 (100%) > 1 a,24(R)-(OH)2D3 (86.1%) > 1a,24(S)-(OH)2D3 (63.5%) under serumsupplemented culture conditions, whereas the order of that was 1 a,25-(OH)2D3 (100%) > MC903 (97.1%) > Compound V (60.7%) > VT-102 (51.1%) > OCT (43.9%). These results indicated a good correlation between the VDR binding affinity for 1a,25-(OH)2D3 analogues, cell differentiation activity of HL-60 cells and MNC formation activity from human cord blood cells under serum-free culture conditions. In contrast there was an inverse correlation in binding affinity of these analogues for serum DBPs under serum-supplemented culture conditions and the cell differentiation and MNC formation. Conclusion: Cell differentiation and MNC formation activities of VT-102, Compound V, OCT, MC903 and 1a,24(R)-(OH)2D3 were greater than those of 1 a,25-(OH)2D3 under serum-suppiemented culture conditions, but they were weaker than those of 1a,25-(OH)2D3 under serum-free culture conditions. These results indicate that biological response in culture is highly correlated with the interaction between the 1a,25-(OH)2D3 analogues and DBPs and that it can be altered, depending on the binding affinity for DBPs. References: 1. Tanaka, H., Abe, E., Miyaura, C., Shiina, Y. and Suda, T. (1983) Biochem. Biophys. Res. Commun. 117, 86-92 2. Reichel, H„ Koeffler, H. and Norman, A. W. (1989) New Engl. J. Med. 230, 980-991 3. Inaba, M., Okuno, S., Nishizawa, Y., Yukioka, K., Otani, S., Matsui-Yuasa, I., Morisawa, S., DeLuca, H. F. and Morii, H. (1987) Arch. Biochem. Biophys. 258, 421-425 4. Tanaka, Y., DeLuca, H. F., Kobayashi, Y. and Ikekawa, N. (1984) Arch. Biochem. Biophys. 229, 348-354 5. Ikekawa, N. and Ishizuka, S. (1992) Molecular Structure and Biological Activity of Steroids, Eds. by Bohl, M. and Duax, W.L. p293-316, CRC Press, Boca Raton. 6. Tarella, C., Ferrero, D., Gallo, E., Pagliardi, G. L. and Ruseetti, F. W. (1982) Cancer Res. 42, 445-449 7. Kurihara, N„ Civin, C. and Roodman, D. (1991) J. Bone Mineral Res. 6, 257-261 8. Honda, A., Mori, Y „ Otomo, S., Ishizuka, S. and Ikekawa, N. (1991) Steroids, 56, 142-147

VITAMIN D HYDROXYLASES: BIOCHEMISTRY AND REGULATION

DIFFERENCES OF THE REGULATION OF 24-HYDROXYLASE GENE EXPRESSION IN THE KIDNEY AND INTESTINE TATSUO SUDA, KAZUYOSHI IIDA, YOSHIHIKO OHYAMA1, KEIICHI OZONO2, MOTOYUKI UCHIDA3, SHIGEAKI KATO4, and TOSH IM AS A SHINKI, Department of Biochemistry, Showa University, Tokyo 142, and 'Graduate Department of Gene Science, Hiroshima University, Higashi-Hiroshima 724, 2 Osaka Medical Center for Maternal and Child Health, Osaka 590-02, 3 Kureha Chemical Industry Co. Ltd., Tokyo 169, and "Department of Agricultural Chemistry, Tokyo University of Agriculture, Tokyo 156, Japan. Introduction For the past two decades, the mechanisms of regulation of vitamin D metabolism have been studied only in terms of the enzyme activity. Parathyroid hormone (PTH) and 1 a,25-dihydroxyvitamin D3 [1a,25(OH)2D3] are the two major physiological factors involved in the regulation of renal 24-hydroxylase activity of 25-hydroxyvitamin D3 [25(OH)D3] in mammals. Recently, we purified 25(OH)D3-24hydroxylase from rat kidney and cloned its cDNA (1). The cloned cDNA was 3.2 Kbp long and contained a 1542 bp open reading frame encoding 514 amino acids. The cloning of the rat kidney 25(OH)D3-24-hydroxylase cDNA has enabled us to examine mRNA expression of this enzyme. Using this probe, a comparison was made between the renal and intestinal 24-hydroxylase mRNA expression induced by 1 a,25(OH)2D3 in rats. More recently, we identified the sequence of vitamin Dresponsive element (VDRE) in the 5'-upstream region of the rat 24-hydroxylase gene. We review here recent advances on the mechanism of regulation of 24hydroxylase, in particular focussing the differences between the kidney and intestine. 1 a,25-Dihydroxyvitamin D3-24-hydroxylase 1 cx-Hydroxylase is the only enzyme responsible for the biosynthesis of 1 a,25(OH)2D3 from 25(OH)D3. 1 a-Hydroxylase is localized preferentially on the inner mitochondrial membrane of renal proximal convoluted tubules (1). Contrary to the preferential localization of 1 a-hydroxylase in the kidney, 24-hydroxylase is distributed in various tissues. The enzyme has been found in the kidney, intestine, lymphocytes, fibroblasts, bone, skin, macrophages, and other tissues that possess 1a,25(OH)2D3 receptors (VDR) (2). In the kidney, 24-hydroxylase is located on the inner mitochondrial membrane of the proximal convoluted tubules as well (3). The major regulators of 24-hydroxylase are PTH and 1a,25(OH)2D3. In vivo administration of PTH to thyroparathyroidectomized (TPTX) rats decreased renal

114

roduction of 24,25(OH)2D3, whereas administration of 1 a,25(OH)2D3 increased 24,25(OH)2D3 production (4). The actions of PTH and 1a,25(OH)2D3 on 1 a- and 24-hydroxylase appear to have common fundamental mechanisms, although their actions are opposite. PTH acts by a mechanism involving cAMP, and the 1 a,25(OH)2D3 action requires new protein synthesis. 24-Hydroxylase activity is greatly suppressed in rats when animals are fed a low calcium diet or a vitamin Ddeficient diet (5). This is preferentially due to an increase in serum PTH levels. The 24-hydroxylase enzyme has been purified from the kidneys of cows (6), hogs (7), chicks (8), and rats (9). The amino-terminal sequence of rat 24-hydroxylase had no homology with that of chick 24-hydroxylase (8,10). Human 24-hydroxylase cDNA was cloned from an HL-60 cell cDNA library using a reverse transcription polymerase chain reaction (RT-PCR). Human 24-hydroxylase cDNA consisted of a 1539 bp open reading frame encoding 513 amino acids (11). Analysis of the amino acid sequence showed that human 24-hydroxylase was 90% homologous to that of rat 24-hydroxylase, with 100% homology in the 21 amino acids heme-binding region. The structural gene encoding 25(OH)D3-24-hydroxylase was isolated from rat genomic DNA (12). The length of the gene was about 15 Kbp, and it was composed of 12 exons. Southern blot analysis indicated that it was derived from a single copy. A major T residue was identified at the cap site; a putative TATA (ATAAATA) box was at position -30 bp and a putative CCAATbox was at -58 bp. Four potential vitamin D responsive elements (-427/-413, -423/-409, -210/-199, and -175/161 bp) were found in the 5'-flanking region. However, these sequences did not have a direct repeat motif Effects of vitamin D metabolites on the promoter activity of 24-hydroxylase gene In the COS cells, 1a,25(OH)2D3 at 10* and 10 7 M dose-dependently enhanced the expression of the promoter activity of the CAT construct containing the region -646/+9 bp. 25(OH)D3 and 24,25(OH)2D3 at 10"6 M were also effective in stimulating CAT activity, although they had little effect at 108 and 107 M. In contrast, a higher concentration (5 x 106 M) of vitamin D3 had little effect on CAT activity. The difference of the activity between various vitamin D metabolites in inducing the promoter activity of 24-hydroxylase appeared to be related to the binding affinity of vitamin D metabolites to VDR. Deletion analysis of the promoter activity The COS cells were transfected with several deletion mutants of the 5'-flanking region fused to the CAT reporter gene.. In the first series of experiments, we used five CAT constructs that contained the promoter region between -2.2 Kbp to -167

115 bp at the 5'-terminals and at +188 bp at the 3'-terminals. All of the constructs responded to 10 7 M 1a,25(OH)2D3 about 20- to 30-fold, although the construct -167/+188 bp showed only 3-fold induction (Fig. 1 A). This indicates that the VDRE of the 24-hydroxylase gene is located near the TATA box. In the second series of experiments, we prepared four CAT constructs that carried the regions -291/+9, -167/+9, -102/+9 and -70/+9 bp. The constructs -167/+9 and -291/+9 bp responded to 1a,25(OH)2D3to a similar extent (10-fold)(Fig. 1B). However, the constructs -102/+9 and -70/+9 bp did not respond to 1 a,25(OH)2D3. The deletion of the region -167/-102 bp from the construct -950/+9 bp decreased the 1a,25(OH)2D3 responsiveness to a very low level (2-fold). These results suggest that the segment between -167 and -102 bp plays a major role in the vitamin D response of the 24hydroxylase gene (14).

i Conversion A. Low-resolution analysis

+188

-2.2 K -950

+

29.2 ± 7 . 4

0.8 ± 0 . 4

36.5

40.7 ± 4 . 8

1.6 ± 0 . 6

25.4

4 4 . 9 + 6.3

1.3 ± 0 . 7

34.5

41.8 ± 7 . 1

2.6 ± 1 . 3

16.1

10.2 ± 3 . 2

3 . 2 ± 1.7

3.2

1.2 ± 0 . 5

1.1 ± 0 . 5

1.1

% Conversion

Fold induction

la,25(OH)2D3

B . Detailed deletion analysis -291

-950

Fig. 1.

Fold induction

la,25(OH)2D3

44.2 ± 4 . 6

4.4 ± 1 . 0

10.0

51.4±5.6

5 . 6 ± 1.8

9.2

1.6 ± 0 . 2

1.7±0.2

0.9

5 . 4 ± 1.2

5.4 ± 1 . 0

1.0

4.8 ± 1 . 4

2.2 ± 0 . 6

2.2

Deletion analysis of the rat 24-hydroxylase gene promoter. C O S 7 cells were transfected

with various C A T constructs containing promoter fragments as indicated. Numbers on the left of each deletion represent the 5'-end of the DNA sequence relative to the transcription initiation site. A: low resolution analysis. Each fragment of the promoter was ligated into a pCAT-basic vector. After transfection of C A T constructs, cells were maintained for 2 days, then cultured for 24 hr in the presence or absence of 1 0 ' M 1 a,25(OH)2D3. B: detailed deletion analysis. The 5' flanking region of the 24-hydroxylase gene w a s deleted using the appropriate restriction enzymes. A deletion mutant between -167 and -102 bp w a s constructed by inserting the fragment -950/-167 bp into the c o n s t r u c t - 1 0 2 / + 9 bp. O h y a m a e f a / . , Ref. 14.

116 Gel mobility shift analysis The human vitamin D receptor and the rat RXRfi were synthesized by in vitro translation of their respective cDNAs. In the gel shift assay using the fragment -204/-129 bp, a retardation band appeared only in the co-presence of 1 a,25(OH)2D3, VDR, and nuclear extracts of COS cells (or RXRP). In contrast, no protein-DNA complex was observed when the synthetic fragment -145/-98 bp was used. Removal of either VDR, nuclear extracts, or 1a,25(OH)2D3 abolished the formation of the retarded band. Finally, oligonucleotides 24 (5'-CGTGTCGGTCAC CGAGGCCCCGGC-3') and 25 (5'-CGGCGCCCTCACTCACCTCGC-3') were used as probes in the gel mobility shift assay in the presence or absence of VDR, nuclear extracts of COS cells, RXRp, and 1a,25(OH)2D3. Only oligonucleotide 25 produced the retarded band in the presence of both the nuclear accessory factor and 1 a,25(OH)2D3. These results confirm that the sequence AGGTGAGTGAGGGCG in the antisense strand of the 24-hydroxylase gene is required for efficient binding of the VDR-RXR complex (Table I).

Table I Comparison of nucleic acid sequences of VDREs Gene

Sequence

Location

Rat 24-hydroxylase

AGGTGA g t g AGGGCG

(-151 - -137)

Rat osteocalcin

GGGTGA a t g AGGACA

(-460 - -446)

Human osteocalcin

GGGTGA a c g GGGGCA

(-499 ~ -485)

Mouse osteocalcin

GGTTCA c g a GGTTCA

(-757 « -743)

Rat calbindin-D9k

GGGTGT e g g AAGCCC

(-489 - -475)

Mouse calbindin-D28k

GGGGGA t g t g AGGAGA

(-198 - -182)

Ohyama et al., Ref. 14.

Regulation of 24-hydroxylase mRNA expression Administration 1a,25(OH)2D3 to vitamin D-deficient rats dose-dependently stimulated the expression of 24-hydroxylase mRNA in both the kidney and intestine, but the expression by 1a,25(OH)2D3 was far more sensitive in the intestine. The dose level of 1a,25(OH)2D3 required to induce intestinal 24-hydroxylase expression was only 1/100 that required to induce renal 24-hydroxylase. Induction of intestinal 24-hydroxylase expression by 1a,25(OH)2D3 was far more rapid than that of renal 24-hydroxylase mRNA as well (15).

117

Kidney P450cc24 P-Actin

Intestine

"ft ifMSr. ÉRP 19R9r W 0 1

2 3 (h)

B Kidney

0 1

n

Intestine

-t

P450CC24

2 3 (h)

P-Actin 1

2 3 (h)

1

2 3 (h)

Fig. 2. Northern blot analyses of mRNA showing the time course of changes in the expression of renal and intestinal 24-hydroxylase (P450cc24) mRNA in vitamin D-deficient sham-operated (A) and TPTX (B) rats after 1a,25(OH)2D3 injection. Shinki etal., Ref. 15.

To further examine the induction of 24-hydroxylase mRNA expression by 1a,25(OH)2D3, we compared time-dependent induction of 24-hydroxylase mRNA expression between the kidney and intestine. After a single injection of 1 a,25(OH)2D3, a marked increase in mRNA expression occurred within as little as 1 hr in the intestine, and the expression increased time-dependently thereafter (Fig. 2). In contrast, in the kidney, mRNA expression was scarcely detectable 3 hr after 1 a,25(OH)2D3 injection. In the kidney, but not in the intestine, thyroparathyroidectomy (TPTX) greatly enhanced the sensitivity of 24-hydroxylase mRNA expression induce by 1 a,25(OH)2D3. TPTX shortened the time needed to induce expression of renal, but not intestinal, 24-hydroxylase mRNA. Previously, we reported that the administration of PTH significantly reduced the activity of renal 24-hydroxylase (3). The inhibitory effect of PTH on renal 24hydroxylase activity was mediated by cAMP (3). Administration of PTH or cAMP to vitamin D-deficient rats greatly reduced the expression of 24-hydroxylase mRNA in the kidney but not in the intestine. When rats were fed a vitamin D-repleted diet containing low calcium for 2 weeks, serum levels of calcium, phosphorus, 25(OH)D3, and 24,25(OH)2D3 were significantly decreased as compared with those in the adequate calcium group. In contrast, serum levels of 1a,25(OH)2D3 and PTH

118 in the low calcium rats were 6 and 1.7 times higher than those in the adequate calcium rats, respectively. As expected, rats maintained on the low calcium diet had much higher intestinal 24-hydroxylase activity than those on the adequate calcium diet. In contrast, renal 24-hydroxylase activity in the low calcium group was much lower than that in the adequate calcium group, irrespective of the extremely high circulating levels of 1 cx,25(OH)2D3 in the former group. In parallel with the in vitro 24-hydroxylase activity, the renal levels of 24-hydroxylase mRNA in the adequate calcium group was much higher than that in the low calcium group (Fig. 3) (15). In contrast, in the intestinal mucosa, no expression of 24-hydroxylase mRNA was detected in the adequate calcium group, whereas it greatly increased in the low calcium group. The expression of 1a,25(OH)2D3 receptor mRNA changed in parallel with that of 24-hydroxylase mRNA in both the kidney and intestine. These findings demonstrate that the expression of 24-hydroxylase mRNA is downregulated by PTH in the kidney but not in the intestine through a VDR-mediated mechanism.

Kidney P450cc24

m

Intestine m

VDR (3-Actin N L

N L

Fig. 3. Expression of 24-hydroxylase (P450cc24) mRNA and 1a,25(OH)2D3 receptor (VDR) mRNA in rats maintained on a vitamin D-repleted diet containing 0.7% calcium (adequate, N) or 0.03% calcium (low, L).

Shinki

eta!., Ref.15.

Catabolism of 1a,25(OH)2D3 For the past 20 years, over 30 metabolites of vitamin D have been isolated and identified. Almost all of the putative target tissues of vitamin D have been shown to possess 24-hydroxylase activity (2). 1 a,25(OH)2D3 induces 25(OH)D3-24hydroxylase and probably a series of enzymes responsible for the conversion of

119 24,25(OH)2D3to 25(OH)-24-oxo-D3, 23,25(OH)2-24-oxo-D3, and 23(OH)-tetranor D3. 23(s)-and 26-hydroxylations of 25(OH)D3 produce a lactone, 25(01-1) D3-23,26lactone. 1a,25(OH)2D3 is metabolized to 1a,25(OH)2D3-23,26-lactone in a similar manner. The major metabolites generated from 1a,25(OH)2D3 are 1 a,24,25(OH)3D3,1 a,25(OH)2-24-oxo-D3, 1a,23,25(OH)3-24-oxo-D3, and 1 a,23(OH)2-tetranor D3. These metabolites may be generated in a sequential pathway, which results in the C23-C24 cleavage and, therefore, inactivation of the compounds. Role of 24-hydroxylase in vitamin D metabolism The question is the biological role of 24-hydroxylase. The general concept has been that the substrate of 24-hydroxylase is 25(OH)D3. Nephrectomy greatly reduces serum levels of 24,25(OH)2D3 (16). This indicates that the major site for 24,25(OH)2D3 production is the kidney tissues. Because the serum concentration of 25(OH)D3 is about 500-fold higher than that of 1cx,25(OH)2D3, 25(OH)D3 appears to be a major substrate for 24-hydroxylase at least in the kidney. In agreement with this, serum levels of 24,25(OH)2D3 changed in parallel with the renal 24hydroxylase activity but not with the intestinal 24-hydroxylase activity (15). 24-Hydroxylase has been found not only in the kidney but also in many other target tissues of vitamin D. Haussler etal. (17) have long contended that the physiological substrate of 24-hydroxylase may be 1a,25(OH)2D3 rather than 25(OH)D3. The Km value of 24-hydroxylase for 1a,25(OH)2D3 has been reported to be 1/5 to 1/30 that for 25(OH)D3 (18). It is reasonable to speculate that the substrate of 24-hydroxylase in vivo is 1a,25(OH)2D3 rather than 25(OH)D3. However, it has been generally believed that the substrate of 24-hydroxylase is 25(OH)D3. The preferential 24-hydroxylation reaction of 25(OH)D3 in the kidney may be explained by the following reasons. First, the serum concentration of 25(OH)D3 is much higher than that of 1a,25(OH)2D3. Second, the intracellular concentration of 25(OH)D3 may be very high in the renal cells, compared with that in other target cells of vitamin D. Since 25(OH)D3 is metabolized into 1 a,25(OH)2D3 exclusively in the kidney, renal cells may have a capacity to incorporate 25(OH)D3 more effectively than other cells. The kidney is not only an endocrine organ of vitamin D but also a target organ of vitamin D, whereas the intestine is only a target organ of this vitamin. In the classical concept, the kidney converted 25(OH)D3 to both 1a,25(OH)2D3 and 24,25(OH)2D3 as the endocrine organ. In the new concept, however, the kidney converts 25(OH)D3 to 1a,25(OH)2D3 as the endocrine organ. In addition, both the kidney and intestine can convert 1a,25(OH)2D3to 1a,24,25(OH)3D3 as the target organs of vitamin D (Fig. 4).

120 Classical concept

New concept

Endocrine organ Kidney

1 24.25(0H)2P3]

Target organ

I PTH I

I 1O,25(OH)ID7|

Kidney

I 1^25(QH)2DT|

Kidney

[lc^iOH)^]

25(OH)B

Stimulation Inhibition

Intestine I 25(OH)D3 I

124,25(OH)2D3|

|24,25(OH)2D3 I 1o,24,25(OH)3D3 I

Fig. 4. The classical concept and new concept of vitamin D metabolism and the sites where parathyroid hormone (PTH) acts. The kidney is not only an endocrine organ but also a target organ of vitamin D, whereas the intestine is only a target organ of the vitamin. In the classical concept, the kidney converted 25(OH)Cte to both 1 a,25(OH)2D3 and 24,25(OH)2D3 as the endocrine organ. In the new concept, however, the kidney converts 25(OH)D3 to 1a,25(OH)2D3 as the endocrine organ in response to PTH. In addition, both the kidney and intestine convert 1a,25(OH)2D3 to 1 a,24,25(OH)3D3 as the target organs of vitamin D. Also, the kidney converts 25(OH)D3 to 24,25(OH)2D3 because the intracellular concentration of 25(OH)Db would be much higher in the kidney than the other target organs of vitamin D.

To verify this hypothesis at an mRNA level, the effect of 25(OH)D3 and 24,25(OH)2D3 administration on 24-hydroxylase gene expression was examined in vitamin D-deficient rats. When 25(OH)D3 or 24,25(OH)2D3 was given together with 1 a,25(OH)2D3, both 25(OH)D3 and 24,25(OH)2D3 greatly stimulated the transcriptional response of both the renal and intestinal 24-hydroxylase gene to 1 a,25(OH)2D3. In contrast, administration of 25(OH)D3 into vitamin D-deficient rats greatly increased renal, but not intestinal, expression of 24-hydroxylase gene. 24,25(OH)2D3 alone also increased the mRNA expression of 24-hydroxylase in the kidney, but the level of expression was only 1/2 that of 25(OH)D3. These results clearly indicate that the renal expression of 24-hydroxylase gene is regulated by an autocrine or a paracrine mechanism of newly synthesized 1 a,25(OH)2D3 in the kidney. The expression of 24-hydroxylase gene is modulated through the V D R E located between nucleotides -151 and -137 bp in the promoter region of the

121 enzyme. If the role of 24-hydroxylase is to initiate the degradation of 1a,25(OH)2D3, the enzyme should be renamed 1 a,25(OH)2D3-24-hydroxylase. References 1. Paulson,S.K. and DeLuca, H.F. (1985) J. Biol. Chem. 260, 11488-11492. 2. Pike, J.W. (1991) Annu. Rev. Nutr. 11, 189-216. 3. Kawashima, H„ Torikai, S. and Kurokawa, K. (1981) Proc. Natl. Acad. USA. 78, 1199-1203. 4. Shigematsu, T., Horiuchi, N., Ogura, Y., Miyahara, T. and Suda, T. (1986) Endocrinology 118,1583-1589. 5. Armbrecht, H.J., Forte, L.R. and Halloran, B.P. (1984) Am. J. Physiol. 246, E266-E270. 6. Bort, R.E. and Crivello, J.F. (1988) Endocrinology 123, 2491-2498. 7. Gray, R.W., Omdahl, J.L. Ghazarian, J.G. and Horst, R.L. (1990) Steroids 55, 395-398. 8. Moorth, B„ Mandel, M.L. and Ghazarian, J.G. (1991) J. Bone Miner. Res. 6, 199-204. 9. Ohyama, Y. and Okuda, K. (1991) J. Biol. Chem. 266, 8690-8695. 10. Ohyama, Y., Noshiro, M. and Okuda, K. (1991) FEBS Lett. 278, 195-198. 11. Chen, K.S., Prahl, J.M. and DeLuca, H.F. (1993) Proc. Natl. Acad. Sci. USA. 90, 4443-4547. 12. Ohyama, Y., Noshiro, M., Eggertsen, G., Gotoh, O, Kato, Y., Bjorkhem, I. and Okuda, K. (1993) Biochemistry 45, 513-516. 13. MacDonald, P.N., Haussler, C.A., Terpening, C.M., Galligan, M.A., Reeder, M.C., Whitfield, G.K. and Haussler, M.R. (1991) J. Biol. Chem. 266, 18808-18813. 14. Ohyama, Y., Ozono, K., Uchida, K., Shinki, T „ Kato, S., Suda, T., Yamamoto, O., Noshiro, M. and Kato, Y. (1994) J. Biol. Chem. 269, 1054510550. 15. Shinki, T., Jin, C.H., Nishiumra, A., Nagai, Y., Ohyama, Y., Noshiro, M., Okuda, K. and Suda, T. (1992) J. Biol. Chem. 267, 13757-3762. 16. Turner, R.T., Avioli, R.C. and Bell, N.H. (1984) Calcif. Tissue Int. 36, 274-278. 17. Haussler, M.R., Mangelsdorf, D.J., Komm, B.S., Terpening, C.M., Yamaoka, K., Allegretto, E.A., Baker, A.R., Shine, J., McDonnell, D.P., Hughes, M., Weigel, N.L., O'Malley, B.W. and Pike, J.W. (1988) Recent Prog. Horm. Res. 44, 263305. 18. Burgos-Trinidad, M. and DeLuca, H.F. (1991) Biochim. Biophys. Acta. 1078, 226-230.

REGULATION O F THE FERREDOXIN COMPONENT O F RENAL HYDROXYLASES AT THE TRANSCRIPTIONAL AND POSTRANSLATIONAL LEVEL AND O F THE PROTEIN INHIBITOR O F CYCLIC AMP-DEPENDENT KINASE H.L. Henry, C. Tang, R. Blanchard, and G.S. Marchetto Department of Biochemistry, University of California, Riverside, CA 92521

INTRODUCTION The renal mitochondrial hydroxylases, which are responsible for converting 25(OH)D 3 into either l,25(OH) 2 D 3 or 24,25(OH) 2 D 3 , consist of three protein components.

A flavoprotein which is associated with the mitochondrial membrane

accepts electrons from NADPH and passes them to the 12 kDA matrix iron sulfur protein which in turn passes the electrons to cytochrome P450. The stereospecific hydroxylation of the steroid is accompanied by reduction of molecular oxygen to one molecule of water and one to the hydroxyl group to be incorporated into the steroid molecule.

These

enzymes are also known as mixed function oxidases and are similar, as far as we know, to the mitochondrial hydroxylases which produce the classical adrenal and gonadal steroidogenic hormones. Many substances have been shown to alter the rate of the 1- and 24-hydroxylation of25(OH)D 3 in the kidney and in other cells and tissues. Our laboratory has shown with primary cultures of chick kidney cells that l,25(OH)2D 3 reduces its own synthesis (1,2), and induces that of 24,25(OH)2D 3 . This result has been replicated in several other systems (3,4). Parathyroid hormone, PTH, has the opposite result, increasing the renal synthesis of l,25(OH) 2 D 3 and decreasing that of 24,25(OH) 2 D 3 .

This result is

mimicked by forskolin and cyclic AMP (5), suggesting a role of the cyclic AMP-mediated signal transduction pathway in the regulation of 25(OH)D 3

metabolism. There is also

strong evidence for the involvement of the protein kinase C signal transduction pathway in the regulation of the hydroxylation of 25 (OH) D 3 , as the protein kinase C activators TPA and OAG decrease 1-hydroxylation and increase the 24-hydroxylation of 25(OH)D 3 (6).

These regulatory effects influencing the hydroxylation of 25(OH)D 3 are

summarized in Table 1.

123 In this paper are summarized our recent results regarding the regulation of a modulator of the protein kinase A signaling system, protein kinase inhibitor (PKI) and studies examining the regulation of the ferredoxin component of the 1-hydroxylase. Table 1. Role of Signaling Pathways in the Regulation of 25(OH)D3 Metabolism in the Kidney l,25(OH) 2 D 3

24,25(OH) 2 D 3

l,25(OH) 2 D 3

I

t

PTH, FSK

t

I

TP A, OAG

I

t

The table summarizes the effects of the indicated agents on the production of 1 , 2 5 ( 0 ^ 2 ^ 3 o r 24,25(OH)2p3 in primary cultures of chick kidney cells under a variety of experimental conditions, similar effects are observed in other model systems. See references 1-4. THE INHIBITOR PROTEIN OF CYCLIC AMP DEPENDENT PROTEIN KINASE, PKI PKI, is an endogenous 76 amino acid protein which inhibits the catalytic subunit of cyclic AMP-dependent protein kinase. It contains a pseudosubstrate site for kinase activity in amino acids 18-22, GRRNA, where the alanine replaces the serine which would be phosphorylated in a substrate protein. PKI not only inhibits the free catalytic subunit of cyclic AMP dependent protein kinase, but has also recently been implicated in the subcellular localization of the enzyme (7). We showed a number of years ago (8) that the levels of the inhibitor protein are regulated by vitamin D status in the chick kidney, but not in other tissues examined thus far (Figure 1). PKI activity is also down-regulated by l,25(OH)2D3 in primary cultures of chick kidney cells as illustrated in Figure 2 (9). More recently we have found that PKI mRNA levels are up-regulated by vitamin D deficiency in vivo and by l,25(OH)2D3 in cell culture (10). We have also obtained the gene for PKI from a chick genomic library and have found that the N-terminal amino acids 1-50 are encoded by one exon and amino acids 51-76 are encoded by a second exon (11). This is an interesting result, since the amino acids responsible for the ability of PKI to inhibit the catalytic subunit of cyclic AMP dependent protein kinase lies entirely within the first exon.

It is tempting to

124 speculate that the portion of the peptide responsible for affecting the subcellular localization of the catalytic subunit is, at least, partially, encoded by the second exon. >-

— f >

• -D T FFL+O

200-

ot
ff-3H]1,25-(OH)2D3, cells are incapable of significant metabolism of a higher concentration of combined radioactive 1,25-(OH) 2 D 3 and non-radioactive analog.

Incubate HPK1A-ras Cells 48 hrs With Analogs

Figure 5 . Methodology to generate microgram quantities of non-radioactive vitamin D metabolites.

Total Lipid Extraction

/ HPLC Analysis

\ GC-MS Analysis

167 Experiments [ 18] using 24,24-dif luoro-1,25-(OH) 2 D 3 suggest t h a t t h e molecule is able t o occupy VDR and survive in cells for a longer time than the parent molecule 1,25-(OH) 2 D 3 so that its biological e f f e c t s last longer. This is entirely consistent w i t h the ability of this molecule t o bind equally well t o the VDR and yet survive the catabolic sequence in Figure 1 by virtue of its 24-fluorine groups. Thus, one can rationalize the increased effectiveness of several vitamin D analogs containing fluorines or extra carbon atoms, as molecules resistant t o catabolism. On the other hand, several analogs w e have studied recently are susceptible t o target cell catabolism and in some cases this may be even faster than t h a t of 1,25-(OH) 2 D 3 . Molecules w e have studied include 1o,25-(OH) 2 dihydrotachysterol [ 2 5 ] , 20-epi-1,25-(OH) 2 D 3 [261, M C 9 0 3 (calcipotriol) [ 2 7 ] , 22-oxacalcitriol (OCT) [28] and 1,24(S)-(OH) 2 D 2 [ 2 9 ] . A n example of this type of metabolism is s h o w n in Figure 6. Some analogs such as M C 9 0 3 and OCT are subject t o metabolism in both target cells and liver cells (HepG2 and Hep3B hepatoma models) and w e presume this means metabolism in vivo is faster than 1,25-(OH) 2 D 3 . This is because these compounds are susceptible t o both vitamin D-dependent and vitamin D-independent enzymes. All metabolites tested t o date f r o m any of these analogs have reduced biological activity in reporter gene transcriptional assays and implies t h a t these are indeed catabolites (e.g. [27]).

Figure 6:

Metabolism of 1,24(S)-(OH) 2 D 2 in HPK1A-ras Cells

T i m e (min)

It should be noted t h a t tampering w i t h the side chain of a vitamin D analog o f t e n also drastically modified its DBP binding. Therefore, the in vivo biological activity of a vitamin D analog not only depends upon its VDR binding and its rate of metabolism w i t h target and other cells but also upon its delivery t o those tissues. These ideas w e r e recently incorporated into an overview of the analog field [ 3 0 ] .

168 Summary Calcitriol-inducible C-24 oxidation in target cells gives rise to calcitroic acid in a variety of cells. The pathway probably involves a transient C 23 -aldehyde intermediate. The pathway appears to play a crucial role in the duration of the 1,25(OH) 2 D 3 signal in target cells. New analogs can be designed to render the molecule more susceptible or more resistant to target cell catabolism. However, these changes do not guarantee survival of the drug due to alternative degradatory pathways.

Acknowledgements These studies were funded by the Medical Research Council of Canada. We thank the following, whose past and present contributions were not rewarded by coauthorship of this paper: Dr. H.S. Tenenhouse, Dr. P. Rasmussen, Dr. J. Knutson, Dr. C.W. Bishop, Dr. N. Kubodera, Dr. Y. Nishii, Dr. B. Miller, F.J. Dilworth, G. Makin and F. Qaw.

References [1] Harnden, D., Kumar, R., Holick, M.F., and DeLuca, H.F. (1976) Science 193, 493-494. [2] Esvelt, R.P., Schnoes, H.K., and DeLuca, H.F. (1979) Biochemistry 18, 39773983. [31 Esvelt, R.P., and DeLuca, H.F. (1981) Arch. Biochem. Biophys. 2 0 6 , 4 0 3 - 4 1 3 . [4] Yamada, S., Ohmore, M., Takayama, H., Takasaki, Y., and Suda, T. (1983) J. Biol. Chem. 258, 457-463. [5] Napoli, J.L., and Horst, R.L. (1983) Biochemistry 22, 5 8 4 8 - 5 8 5 3 . [6] Reddy, G.S., Tserng, K.Y., Thomas, B.R., Dayal, R., and Norman, A . W . (1987) Biochemistry 26, 324-331. [7] Jones, G., Kung, M., and Kano, K. (1983) J. Biol. Chem. 258, 12920-12928. [8] Makin, G., Lohnes, D., Byford, V., Ray, R., and Jones, G. (1989) Biochem. J. 262, 173-180. [9] Reddy, G.S., and Tserng, K. (1989) Biochemistry 28, 1763-1769. [101 Lohnes, D., and Jones, G. (1987) J. Biol. Chem. 262, 14394-14401. [11] Calverley, M.J. (1990) Synlett. 155-157. [12] Holick, S.A., Holick, M.F., MacLaughlin, J.A. (1980) Biochem. Biophys. Res. Commun. 97, 1031-1037. [13] Jones, G., Haussler, C., Meyer, J., Komm, B.S., and Haussler, M.R. (1991) J. Bone Min. Res. 6, S123. [14] Miller, B.E., Chin, D.P., and Jones, G. (1990) J. Bone Min. Res. 5, 597-607. [15] Tomon, M., Tenenhouse, H.S., and Jones, G. (1990) Endocrinology 126, 2868-2875. [16] Mandla, S., Tomon, M., Byford, V., and Jones, G. (1991) Eighth Workshop on Vitamin D, Paris, July 5-10, abstract 179.

169 [17] [18] [19] [20] [21] [22] [23] [24] [25] [26] [27] [28]

[29]

[30]

Meyer, J „ Galligan, M „ Jones, G., Komm, B.S., and Haussler, M.R. (1991) J. Bone Min. Res. 6, S185. Lohnes, D (1989) Ph.D. Thesis, Queen's University, Kingston, Canada. Tenenhouse, H.S., Yip, A., and Jones, G. (1988) J. Clin. Invest. 8 1 , 4 6 1 - 4 6 5 . Tenenhouse, H.S., and Jones, G. (1990) J. Clin. Invest. 85, 1450-1455. Chandler, J.S., Chandler, S.K., Pike, J.W. and Haussler, M.R. (1984) J. Biol. Chem. 259, 2214-2222. Shinkii, T „ Jin, C.H., Nishimura, A., et. al. (1992) J. Biol. Chem. 267, 13757-13762. Nishimura, A., Shinkii, T., Jin, C.H., Ohyama, Y., Noshiro, M., Okuda, K. and Suda, T. (1994) Endocrinology 134, 1794-1799. Guo, Y.D., Strugnell, S., Back, D.W. and Jones, G. (1993) Proc. Natn. Acad. Sei., 90, 8668-8672. Qaw, F., Calverley, M.J., Schroeder, N.J., Trafford, D.J.H., Makin, H.L.J, and Jones, G. (1993) J. Biol. Chem., 268, 282-292. Dilworth, F.J., Calverley, M.J., Makin, H.L.J, and Jones, G. (1994) Biochem. Pharm., 47, 987-993. Masuda, S., Strugnell, S., Calverley, M., Makin, H.L.J., Kremer, R. and Jones, G. (1994) J. Biol. Chem., 269, 4794-4803. Masuda, S., Byford, V., Makin, H.L.J., Kremer, R., Okano, T., Kobayashi, T., Kubodera, N., Nishii, Y. and Jones, G. Ninth Workshop on Vitamin D, Orlando, Florida, June 1994. See this volume. Jones, G., Byford, V., Kremer, R., Makin, H.L.J., Knutson, J.C. and Bishop, C.W. Ninth Workshop on Vitamin D, Orlando, Florida, June 1994. See this volume. Jones, G. and Calverley, M.C. (1993) Trends Endocrinol. Metab., 3, 297-303.

IN VIVO REGULATION OF RAT INTESTINAL 24-HYDROXYLASE (1-24OHASE): POTENTIAL NEW ROLE OF CALCITONIN MATTHEW J. BECKMAN*, JESSE P. GOFFt, TIMOTHY A. REINHARDTt, DONALD C. BEITZ*, AND RONALD L. HORSTt Department of Animal Sciences, Iowa State University, Ames, IA 50011*; and U.S. Department of Agriculture, Agricultural Research Service, National Animal Disease Center, Metabolic Diseases and Immunology Research Unit, Ames, IA 50010-0070t Introduction 24-Hydroxylation is the first in a series of steps leading to the inactivation of 1,25-dihydroxyvitamin D3 [l,25(OH)2D3], the active form of vitamin D3 (1). The present study examines the effect of vitamin D3 and calcium status on I-24-OHase regulation. We found that calcitonin causes suppression of I-24-OHase mRNA expression and activity. Methods Diets and animals: Upon arrival (day 0) weanling rats (21 day-old) male rats (Harlan Sprague-Dawley) received a purified vitamin D3 (5 IU/g)-calcium sufficient (NC) diet (Teklad, Madison, WI) containing 1.0-1.2% calcium and 0.4% phosphorus. Half of the rats were switched to a low calcium (LC) diet (0.02% calcium and 0.4% phosphorus) on day 14. Starting on day 21 and continuing for a total of 8 doses, one half of the rats from each group were given excess vitamin D3 at a rate of 25,000 IV 3x per week. These groups were designated NCT (normal calcium diet plus excess vitamin D3) and LCT (low calcium diet plus excess vitamin D3). Rats were killed on day 40. In a second experiment additional NCT rats underwent TPTX or sham surgery following the third dose of excess vitamin D3 (day 28). After surgery, excess vitamin D3 administration was resumed for a total of eight doses as previously stated. Additionally, calcitonin was injected IP (100 IU/rat, Amour Pharmaceutics, Tarrytown, NY) into three rats from each group 4 h before euthanizing. In a third experiment additional LCT rats were treated with either calcitonin or placebo (saline) on day 40, 4 h before euthanizing. Blood and tissue analysis: Intestinal mucosa was scrapped from the first 15 cm of the duodenum and used in either mRNA analysis (6,7) or I-24-OHase activity measurements (4). Plasma calcium was determined by atomic absorption spectroscopy. Plasma calcitonin was measured by using a radioimmunoassay kit from Nichols Inst. (San Juan Capistrano, CA).

•If II »»»*

1 I n t e s t i n a l 2 4 - O H a s e Activity

NC HCT I C 1-CT

LCT

Fig. 1

Fig. 2

Fig. 3

I.CT/CT

171 Table 1. plasma Ca. calcitonin, and I-24-OHase Treatment NC NCT

Calcium (mg/dl) 10.7+0.2

Calcitonin (pg/ml) 21.2+1.1

12.6±0.3 a

LC

9.7+0.2®

36.1±2.5 a 15.9±0.9

LCT

10.5+0.2 b

19.4+2.3 b

a

p 3

9-ctsRA

RXR Target Qenes

VDR Taget Genes

Fig. 7. Ligands modulate the dimerization state of VDR.

225 absence of ligand, the selective influence of ligands on dimer formation might provide a mechanism by which nuclear receptors remain hormoned e p e n d e n t for target gene expression, setting up sensitive regulatory responses to modest fluctuations of intracellular ligand concentrations in vivo. This work was supported by NIH grants DK45460 and NCI-P30-CA-08748, and by the N e w York Community Trust. L.P.F. is a Scholar of the Leukemia Society of America. REFERENCES 1. Luisi, B.F., Schwabe, J, and Freedman, L.P. (1994) In Vitamins and Hormones (Litwack, G., ed.), Academic Press, N e w York, in press. 2. Freedman, L.P. and Luisi, B.F. (1993) J. Cell. Biochem. 51,140-150. 3. Freedman, L.P., Luisi, B.F., Korszun, Z.R., Basavappa, R., Sigler, P.J., and Yamamoto, K.R. (1988) Nature 334, 543-546. 4. Luisi, B.F., Xu, W., Otwinowski, Z., Freedman, L.P., Yamamoto, K.R., and Sigler, P.B. (1991) Nature 352, 497-505. 5. Nöda, M., Vogel, R.L., Craig, A.M., Prahl, J., DeLuca, H.F., and Denhardt, D.T. (1990) Proc. Natl. Acad. Sei. USA 87, 9995-9999. 6. Towers, T.L., Luisi, B.L., Asianov, A., and Freedman, L.P. (1993) Proc. Natl. Acad. Sei. USA 90,6310-6314. 7. Perlmann, T., Rangarajan, P.N., Umesono, K., and Evans, R.M. (1993) Genes & Develop. 7,1411-1422. 8. Kurokawa, R., Yu, V., Naar, A., Kyakumoto, S., Han, Z., Silverman, S., Rosenfeld, M.G., and Glass, C.K. (1993) Genes & Develop. 7,1423-1435. 9. Umesono, K., Murakami, K.K., Thompson, C.C., and Evans, R.M. (1991) Cell 65,1255-1266 10. Wilson, T.E, Paulsen, R.E., Padgett, K.A., and Milbrandt, J. (1992) Science 256, 107-110. 11. Lee, M.S., Gippert, G.P., Soman, K.V., Case, D.A. and Wright, P.E. (1989) Science 245, 635-637. 12. Wilson, T.E., Fahrner, T.J., and Milbrandt, J. (1993) Mol. Cell. Biol. 13, 5794-5804. 13. Ueda, H., Sun, G.-C, Murata, T., and Hirose, S. (1992) Mol. Cell. Biol. 12, 5667-5672. 14. Freedman, L.P., Arce, V., and Perez-Fernandez, R. (1994) Molec. Endocrin., 8,265-273. 15. Cheskis, B. and Freedman, L.P. Mol. Cell. Biol. (1994) 14, 3329-3338. 16. Lehmann, J.M., Zhang, X-k., Graupner, G., Lee, M.-O., Hermann, T., Hoffmann, B., and Pfahl, M. (1993) Mol. Cell. Biol. 13, 7698-7707. 17. Zhang, X.-k., Lehmann, J., Hoffmann, B., Dawson, M.I., Cameron, J., Graupner, T., Tran, P., and Pfahl, M. (1992) Nature 358, 587-591.

THE MOLECULAR BASIS FOR THE GENOMIC ACTIONS OF THE VITAMIN D 3 HORMONE J.WESLEY PIKE Department of Biochemistry, Ligand Pharmaceuticals Inc., La Jolla, CA 92037 USA. INTRODUCTION. The hypothesis that the active form of vitamin D might function as a steroid hormone-like molecule was proposed well over two decades ago. During the intervening years, a series of significant experimental observations have bolstered that hypothesis and proven it to be true. These findings include the identification of a receptor molecule in target tissues which binds 1,25dihydroxyvitamin D3 (1,25(OH)2D3), its biochemical characterization over many years, and its final molecular cloning in 1987. The latter event revealed the vitamin D receptor (VDR) to be a legitimate member of the steroid, thyroid and vitamin receptor gene family and set the stage for more indepth studies aimed at understanding receptor structure and function. More recently, considerable effort has been focused upon identifying both sequence elements within vitamin Dsensitive gene promoters which mediate 1,25(OH)2D3 action as well as the intraand intermolecular interaction of the VDR with those elements. In this paper, we summarize recent advances in our understanding of the genomic mechanism of action of vitamin D3. VITAMIN D3-RESPONSIVE ELEMENTS. Our promoter mapping studies utilizing the human osteocalcin (hOC) gene provided the first glimpse into the nature of a vitamin D3-responsive element (VDRE) (1,2). Since that time, several vitamin D-inducible genes have been cloned and the VDREs within those genes characterized. They include the gene for rat osteocalcin (3,4), mouse osteopontin

Gene

Location . 1

Sequence

r ^ rOC

-445

GGGTGA

3

AGGACA

hOC

-490

GGGTGA

3

GGGGCA

mOP

-750

GGTTCA

3

GGTTCA

r240H

-252/-144

GGTTCA

3

GGTGCG

AGGTGA

3

AGGGCG AGGGCG

h240H

-163

AGGTGA

3

rPitl

-62

AGTTCA

4

AGTTCA

mCaBPgk

-481

GGGTGT

3

AAGCCC

rCaBP 2 8k

-191

GGGGGA

4

AGGAGA

Figure 1.

Location and Sequence of Natural VDREs

227

(5), rat calbindin 28K (6), mouse calbindin 9K (7), rat (8,9) and human (Pike et al., in preparation) 25-hydroxyvitamin D3-24-hydroxylase (240Hase), and rat Pit-1 (10). The location and sequence of the VDREs found within these genes are illustrated in Figure 1. As is clear from this summary, there is considerable diversity to be found in VDREs. The location of VDREs within gene promoters varies from proximal (-62) to distal (-750). Interestingly, two apparent VDREs are located within the rat (8,9) and possibly the human 240Hase promoters. Finally, despite the diversity, each VDRE is comprised of two hexanucleotide halfsites separated by three to four base pairs. This spacing requirement for vitamin D3 specificity conforms largely, although not exclusively, to the spacing rule proposed by Evans and coworkers for the retinoid, thyroid, and vitamin D class of intracellular receptors (11). Figure 2 outlines a consensus VDRE derived from the natural response elements identified in Figure 1. The consensus sequences for each halfsite are both related to the general element AGGTCA, although they are clearly not identical, supporting the notion that the proteins which interact at these two sites may be dissimilar (see below). The identification of enhancer elements within genes known to be regulated by 1,25(OH)2D3, and the similarity of these elements to those which mediate the action of other steroids provides the final conclusive proof that vitamin D acts at the genomic level.

Position

5

3

4

5

6

Sequence

G/A

G

G/T

T

G/C

A

Optimum

A

Figure 2.

A Consensus Sequence For the Vitamin D Responsive Element

T

T

C

A

2

4

2

G

1

3

1

NNN G/A

G

A G

6

G/T A/G/T C

G/A

T

A

T

C

THE HUMAN OSTEOCALCIN VDRE LOCUS REPRESENTS A PARADIGM FOR TRANSCRIPTIONAL COMPLEXITY. Figure 3 documents the sequence of the hOC promoter from -512 to -483. This sequence reveals a complex motif comprised of an upstream AP-1 site and the immediately adjacent VDRE. Our previous functional studies have shown that while the VDRE sequence itself is sufficient for vitamin D3 induction via the VDR, the upstream AP-1 site functions to alter basal activity in the absence of vitamin D and to synergize in its presence (2). Consistent with this view, DNA binding assays have revealed that whereas the VDR binds exclusively to the VDRE sequence, Jun/Jun homodimers or Jun/Fos heterodimers, known components of AP-1 interact at the AP-1 site (12). Perhaps more importantly, both proteins are capable of binding to this locus simultaneously (12). The latter observation suggests several possible mechanisms for the observed synergy; either both protein complexes contribute to a more stable protein heterocomplex or the presence of both facilitates more efficient contact with the transcriptional initiation machinery.

228 AP-l

VDRE

-512

^

G G T G A C T C A C C A C T G A G T

Figure 3.

CC GG

G G G T G A C C C A C T

-483 ACG TGC

G G G G C A C C C C G T

T T A A

:

The Human Osteocalcin V D R E Locus

INTERACTION OF THE VDR WITH SPECIFIC DNA REQUIRES A HETERODIMERIC PARTNER REPRESENTED BY THE RETINOID X RECEPTOR SUBFAMILY. An important observation was made early on that the VDR required a protein partner for high affinity interaction with specific DNA in vitro (13-15). This finding derived from the observation that VDR obtained from recombinant expression in yeast was unable to interact with the hOC V D R E unless combined with mammalian cell extracts. Extensive studies revealed that this factor was a protein(s), and that it was widely distributed in mammalian cells. The identity of this factor was subsequently revealed by several investigators as members of the retinoid X receptor (RXR) subfamily (16,17). Thus, high affinity binding of the V D R with specific DNA requires the formation of a dimer with R X R (a, p, or y) or perhaps additional receptors as yet unknown. While it is clear that high affinity interaction of the VDR with specific DNA requires a heterologous partner in vitro, the contribution of that partner to vitamin D activation in vivo has been considerably more difficult to prove. Experiments aimed at clarifying this relationship have employed cotransfection to examine the role of R X R s in VDR transactivation and have used ligands such as 9-cis retinoic acid as a means of altering the functional concentration of exogenous or endogenous R X R s (18,19). Although these studies have hinted at a role for the R X R family in vitamin D induction, unequivocal and convincing evidence remains lacking. LACK OF EVIDENCE FOR AN ALTERNATIVE SIGNALLING PATHWAY FOR 1,25(OH)2D3. A recent study by Carlberg et al. (20) has suggested that vitamin D might elicit a transcriptional response via unique V D R E s that bind only VDR homodimers. The study was carried out in insect cells devoid of R X R s wherein the authors examined the activities of overexpressed VDR and/or R X R on synthetic response elements fused to the viral thymidine kinase promoter. VDR exhibited transcriptional activity in the absence of added R X R on a unique response element comprised of typical halfsites spaced by an unusual 6 base pairs. The study, however, is compromised by one or more of the following: the presence of Uitraspiracle, an insect homolog to R X R which binds the VDR, weak 1,25(OH)2D3-inducibility, and overexpression of receptor. Perhaps more to the point, a natural gene containing the V D R E motif proposed by Carlberg and coworkers has not been identified. The authors suggest that alternative halfsites

229

in the hOC gene promoter comprised of one in the AP-1 site and one located 6 base pairs downstream (the first halfsite of the bona fide VDRE) may represent such an element. However, our functional definition of the hOC VDRE (2) does not support this suggestion. Moreover, recent footprint analyses ( Pike and Allegretto, in preparation) suggest that homodimer formation by VDR alone is limited to the functionally defined hOC VDRE and, perhaps more importantly, requires substantially higher amounts of pure receptor for binding. This observation is consistent with the idea that the affinity of the VDR for DNA is inherently lower when paired with itself. As most, if not all, mammalian cells contain one or more isoforms of RXR, it seems likely that following 1,25(OH)2D3 induction, the VDR/RXR heterodimer would occupy the natural VDRE with high affinity. A reduction in VDR concentration, coupled to high affinity occupancy of the natural VDRE would preclude filling of any putative low affinity sites. The further suggestion by Schrader et al (21) that signalling by vitamin D3 might also involve heterodimer formation with the thyroid receptor or the retinoic acid receptor through similar mechanisms retains the same faulty logic. VDR DOMAINS OF DIMERIZATION AND TRANSACTIVATION. Previous experiments have suggested that the carboxy terminal domain of the VDR is essential for dimerization interaction with its protein partner (15). As important, perhaps, is the observation that DNA is not required for this association. In order to more precisely define the dimerization domain of the VDR, a series of internal deletion mutants of the VDR was prepared beginning within the hinge region and extending through the carboxy terminus, as illustrated in Figure 4. The size of the mutations ranged from 6 to 11 amino acids. Evaluation of each of the expressed mutant VDRs revealed that all but the four most carboxy terminal deletions were incapable of hormonal interaction. Despite that lack of 1,25(OH)2D3 binding activity, however, DNA binding analysis revealed the presence of two distinct regions of activity that when mutated resulted in loss of dimerization with both nuclear accessory factor and RXRa. These regions of activity align with two conserved regions found within the steroid receptor gene family as documented in Figure 4. Thus, the dimerization domain of the VDR is bipartite, and localized to two separate but adjacent regions of the VDR molecule. We examined the transcriptional activity of the VDR in a yeast cell background using the Cyc1 promoter-VDRE fusion coupled to p-galactosidase as a reporter. VDR is inactive in yeast when expressed alone. However, coexpression of RXRy leads to strong activation, supporting the role of the RXR heterodimeric partner in the transactivation capacity of the VDR. Interestingly, the presence of the two partners results in constitutive transactivation through the VDRE; for reasons currently unknown, 1,25(OH)2D3 exerts no transcriptional inducing effect. We utilized this phenomenon to map the activation domain of the VDR using each of the carboxy terminal deletion mutants by expressing each together with RXRy. As summarized in the previous figure, transactivation capacity colocalizes with dimerization. These experiments provide functional proof that dimerization with

230 1

21

B1

232

270

320

375

424

N f" " NT

DNA

CT

Hinge

1,25(OH) 2 D 3

• •

Binding

Dimerization

Transactivation

DNA Binding Domain

1,25(OH)2D Binding Domain

Dimerization and Transactivalion

Figure 4. Important Functional Domains of the Human VDR. The hVDR is indicated. Vertical lines denote internal deletion sites. Blackened areas denote deletions leading to loss of the respective function. RXR is essential for transcriptional activation of the VDR. Importantly, they also suggest that at this level of resolution the transactivation domain of the VDR colocalizes with its dimerization domain. Further studies at a higher level of resolution are ongoing to localize a subdomain within the dimerization region responsible for the transactivation surface. PHOSPHORYLATION OF THE HUMAN VDR. In 1985, we reported that the mouse VDR was phosphorylated in vivo following treatment of cultured 3T6 fibroblasts with 1,25(OH)2D3 (22). This modification led to retarded migration of the VDR in denaturing cells and was not observed in the absence of treatment with hormone. Phosphoamino acid analysis of this material reveal the exclusive presence of phosphoserine (23). Although receptor phosphorylation could be temporally correlated with hormonal treatment of the cells, the functional consequence of this modification was uncertain. In order to gain some insight into the possible role of phosphorylation on VDR function, we have recently mapped the site of phosphorylation on the human VDR to serine 205, an amino acid located between the DNA and hormone binding domains (24). Early results suggested that the human VDR was phosphorylated in a hormone-modulated manner following transfection of the hVDR cDNA in COS-1 cells (25). Thus, we utilized this system to prepare phosphorylated receptor and mapped the phosphoserine site using traditional peptide cleavage studies together with manual Edman degradation analysis. A summary of the results obtained are illustrated in Figure 5. As can be seen in Figure 5B,

231

proteolysis of phosphorylated receptor with either trypsin or V8 protease leads to the identification of two phosphopeptides with overlapping sequence spanning amino acid residues from 171 to 206. Indeed, as seen in Figure 5C, sequential digestion with the above enzymes is consistent with the identification of the same receptor fragment. Further sequential digestion with trypsin and then either CNBr, chymotrypsin, or thermolysin, limits the site of phosphorylation to between residues 202 to 206. Finally, phosphate release studies reveal the modification to occur on serine 205. Importantly, this peptide exhibits a major reduction in incorporated phosphate in the absence of cellular treatment with 1,25(OH)2D3, suggesting strongly that modification of serine 205 is influenced by hormone. Thus, the human VDR is phosphorylated in a hormone-modulated manner on serine 205. These data are consistent with the determination by Haussler and coworkers of covalent modification of serine 205 (26) on the human VDR. Our methodology, however, did not identify additional sites of phosphorylation as proposed by the latter group. Proof of the existence of those sites will undoubtedly require the approach documented here.

Full lenglh VDR 21

B

81

270

320

37S

Trypsin

V8 Protease I

O

232

125 1

Trypsin + V8 Protease

171 I Trypsin + CNBr

171

206

206

1

195

Trypsin + Chymotrypsin I

206

LU-M

1

200 1

1

Trypsin + Thermolysin I

1

171-HTPSFSGDSSSSCSDHCITSSDMMDSSSFSNLDLSE-2C6

6 205

Figure 5. Phosphopeptide Mapping of the Human VDR (see Ref. 24 for details)

232

In an extension of the above studies, we mutated VDR serine 205 to alanine and evaluated the transcriptional activity of the mutant following transfection of the receptors into mammalian cell hosts together with a VDRE linked reporter (24). Mutation of serine 205 had no effect on the ability of the VDR to transactivate through the above system. Although these experiments would suggest that phosphorylation is not implicated in receptor function, subsequent experiments revealed that the VDR continued to be phosphorylated in a hormone-modulated manner on a nearby, but undefined serine residue. Our results not only preclude any conclusions with respect to phosphorylation and VDR function, but have serious ramifications regarding a strictly mutagenesis approach taken by others to the study of phosphorylation of the VDR. ROLE OF 1,25(OH) 2 D 3 ON RECEPTOR ACTIVATION. The specific interaction of VDR with VDRE DNA in vitro is strongly enhanced in the presence of 1,25(OH)2D3 (15). This observation, together with the finding that a nuclear factor mimicked by the RXR subfamily was required for specific DNA binding, prompted us to examine the effect of 1,25(OH)2D3 on the affinity of the VDR for its protein partner. These studies were carried out in the absence of DNA as technical considerations prevented examination of the effect of ligand on the affinity of the preformed heterodimer for DNA. A 10 fold increase in affinity of the VDR for its heterodimeric partner was observed in the presence of 1,25(OH)2D3 (15). This increase in affinity for the protein partners, together with the likely possibility that the heterodimer itself maintains a higher affinity for DNA suggests that an important role for the 1,25(OH)2D3 ligand is to enhance formation of a protein/protein/DNA complex. Is it possible to detect conformational changes in the carboxy terminus of the VDR following ligand binding? In 1985, Allegretto et al (27,28) showed that limited tryptic digestion of 1,25(OH)2D3-occupied chicken VDR resulted in the formation of a 35 kDa fragment of the receptor that retained ligand but no longer bound DNA. In the absence of 1,25(OH)2D3, however, identical treatment with trypsin led to complete degradation of the protein, no detectible receptor fragments, and loss of hormone-binding capacity. These studies are consistent with similar observations on other steroid receptors carried out in the late 1970s, and strongly suggest that a major conformational change within the carboxy terminus of the VDR occurred following 1,25(OH)2D3 binding. This structural change protects from tryptic degradation and may be instrumental in enhancing the affinity of the VDR for its protein partner. Interestingly, recent experiments which we (Cheng and Pike, in preparation) and others (29) have carried out utilizing proteolysis of 35S-methionine labelled VDR derived from in vitro transcription-translation technics have led to identical conclusions. It is unlikely, however, that this technic will be sufficient in sensitivity to convincingly detect major degradation pattern changes following VDR complex formation with the plethora of vitamin D analogues which have emerged over the last several years that appear to selectively promote bioresponses unencumbered by hypercalcemia (30).

233 SUMMARY AND CONCLUSIONS. This chapter describes recent advances in our understanding of the genomic mechanism of action of the vitamin D3 hormone. The VDR, which mediates the action of 1,25(OH)2D3 on gene regulation, does so through an association with DNA sequence elements located within regulated promoters. The motif of these elements as well as the sequences themselves are consistent with those which interact with other members of the steroid, thyroid, and vitamin receptor gene family. The VDR associates with high affinity on DNA in combination with a protein partner; one example of such a partner, although perhaps not an exclusive example, is the R X R subfamily. The interaction of the VDR as a homodimer on DNA sequences also can be demonstrated in vitro. It is clear, however, that this interaction exhibits a much reduced affinity. This observation, coupled with the fact that a gene with unique DNA structure selectivel y receptive to a VDR homodimer remains to be identified, calls into question the role of such a receptor complex in vivo. Additional studies have revealed that the formation of a VDR/RXR heterodimer occurs through a bipartite dimerization domain located in the carboxy terminus of the VDR and likely a similarly domain located in the R X R subfamily. The association of the two proteins is enhanced by the presence of 1,25(OH)2D3 through conformational changes induced in the receptor by the ligand. An additional effect of 1,25(OH)2D3 on the VDR is to induce phosphorylation; in the human VDR this serine is located at residue 205. The role of this modification in receptor function remains undefined. Despite the considerable unknowns remaining regarding 1,25(OH)2D3 action, it is clear that research during the past several years has significantly clarified our understanding of the genomic mechanism of action of the vitamin D 3 hormone. REFERENCES 1. 2. 3. 4. 5. 6. 7. 8.

Kerner, S.A., Scott, R. A., and Pike, J.W. (1989) Proc. Natl. Acad. Sci. USA 86, 4455-4459. Ozono, K., Liao, J., Kerner, S.A., Scott, R.A., and Pike, J.W. (1990) J. Bio.l Chem. 265, 21881-21888. Demay, M.B., Gerardi, J.M., DeLuca, H.F., and Kronenberg, H.M. (1990) Proc. Natl. Acad. Sci. U S A 87, 369-373. Terpening, C.M., Haussler, C.A., Jurutka, P.W., Galligan, M.A., Komm, B.S., and Haussler, M.R. (1991) Mol. Endo. 5, 373-385. Noda, M., Vogel, R.L., Craig, A.M., Prahl, J., DeLuca, H.F., and Denhardt, D. (1990) Proc. Natl. Acad. Sci. USA 87, 9995-9999. Gill, R.K. and Christakos, S. (1993) Proc. Natl. Acad. Sci. U S A 90, 29842988. Darwish, H.M. and DeLuca, H.F. (1992) Proc. Natl. Acad. Sci. U S A 89, 603-607. Ohyama, Y „ Ozono, K „ Uchida, ZM., Shinki, T., Kato, S., Suda, T „ Yamamoto, 0., Noshiro, M., and Kato, Y. (1994) J. Biol. Chem. 269, 10545-10550.

9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23.

24. 25. 26. 27. 28. 29. 30.

Zierold, C, Darwish, H.M., and DeLuca, H.F. (1994) Proc. Natl. Acad. Sei. USA 91, 900-902. Rhodes, S.J., Chen, R„ Dimattia, G.E., Scully, K.M., Kalla, K.A., Lin, S., Yu, V.C., and Rosenfeld, M.G. (1993) Genes Develop 7, 913-932. Umesono, K., Murikammi, K.K., Thompson, C.C., and Evans, R.M. (1991) Cell 65, 1255-1266. Pike, J.W. (1993) In: Steroid Hormone Receptors (Ed. V.K. Moudgil) Birkhausen Boston, P. 163-191. Liao, J, Ozono, K., Sone, T., McDonnell, D.P., and Pike, J.W. (1990) Proc. Natl. Acad. Sei. USA 87, 9751-9755. Sone, T„ Ozono, T., and Pike, J.W. (1991) Mol. Endo. 5, 1578-1586. Sone, T„ Kerner, S.A., and Pike, J.W. (1991) J. Biol. Chem. 266, 2329623305. Yu, V., Delsert, C., Andersen, B., Holloway, J.M., Devary, O.V., Naar, A.M., Kim, S.Y., Boutin, J.M., Glass, C.K., and Rosenfeld, M.G. (1991) Cell 67, 1251-1266. Kliewer, S.A., Umesono, K„ Mangelsdorf, D.J., and Evans, R.M. (1992) Nature 355, 446-449. MacDonald, P.N., Dowd, D.R., Nakajima, S., Galligan, M.A., Reeder, M.C., Haussler, C.A., Ozato, K„ and Haussler, M.R. (1993) Mol. Cell Biol. 13,5907- 5917. Minucci, S., Zand, D.J., Dey, A., Marks, M.S., Nagata, T., Grippo, J.F., and Ozato, K. (1994) Mol. Cell Biol. 14, 360-372. Carlberg, C., Bendik, I., Wyss, A., Meier, E., Sturzenbecker, L.J., Grippo, J.F., and Hunziker, W. (1993) Nature 361, 657-660. Schräder, M., Muller, K.M., and Carlberg, C. (1994) J. Biol. Chem. 269, 5501-5504. Pike, J. W. and Sleator, N.M. (1985) Biochem. Biophys. Res. Commun. 131, 378-385. Haussler, M.R., Mangelsdorf, D.J., Komm, B.S., Terpening, C.M., Yamaoka, K„ Allegretto, E.A., Baker, A.R., Shine, J., McDonnell, D.P., Hughes, M.R., Weigel, N.L., O'Malley, B.W., and Pike, J.W. (1988) Ree. Prog. Horm. Res. 44, 263-305. Hilliard, G.M., Cook, R.G., Weigel, N.L., and Pike, J.W. (1994) Biochemistry 33, 4300-4311. McDonnell, D.P., Scott, R.A., Kerner, S.A., O'Malley, B.W., and Pike, J.W. (1989) Mol. Endo. 3, 635-644. Jurutka, P.W., Hsieh, J.C., McDonald, P.N., Terpening, C.M., Haussler, C.A., and Haussler, M.R. (1993) J. Biol. Chem. 268, 6791-6799. Allegretto, E.A. and Pike, J.W. (1985) J. Biol. Chem. 260, 10139-10145. Allegretto, E.A., Pike, J.W., and Haussler, M.R. (1987) J. Biol. Chem. 262, 1312-1319. Keidel, S., LeMotte, P., and Apfel, C. (1994) Mol. Cell Biol. 14, 287-298. Jones, G. and Calverley, M.J. (1993) TEM 4, 297-303.

EXPRESSION OF RXRg IN HUMAN LEUKEMIC CELLS DURING DIFFERENTIATION INDUCED BY ALL-TRANS RETINOIC ACID AND 1a.25DIHYDROXYVITAMIN D3. H. Defacque, T. Commes. D. Parienté, C. Sevilla and J. Marti. INSERM U65. Université Montpellier II, CP 100, 34095 Montpellier cedex 05, FRANCE

PHAGOCYTIC

ACTIVITY

150-

îoo-

HL-60

U937

THP-1

P^,,,.- , . . _ . Figure 1. Effect of VD and RA on HL-60, u937 and THP-I cell differentiation. Expression of chemiluminescence triggered by opsonized zymosan. Cells treated for 72 h without ( •

INTRODUCTION All-trans retinoic acid (RA) and 1a, 25-dihydroxyvitamin D3 (VD) are potent inducers of normal and leukemic monocytic differentiation. We have studied the effects of treatments associating RA and VD on the phenotype of three human leukemic cell lines, HL-60, U937 and THP-1, representing different stages of monocytic development. We observed at most cooperative effects upon RA and VD cotreatments of HL-60 and THP-1 cells, while both agents were able to synergize in inducing U937 cell differentiation v(1. 2). Whatever the ' _A differentiation parameter, RA strongly potentiated the action of VD or its non analogues (figure 1). The ca|cemjc

were " " " a " " . ;" ,„ i „ ) or nuclear receptors for V D and RA (VDR

with 100 nM RA (0), 100 nM vd and RARs) belong to the same family of T^y °were° ttien^harvested Z ^ L Hgand-activable transcriptional activators, chemi luminescence of 105 cells was Both types of receptors, which are present assayed as described in reference ¡n monocytic (1)

cells,

are

able

to

" form heterodimers with common partners, the RXRs, which bind the 9-c/s isomer of RA. Here we investigated a possible involvement of RXRa in myeloid differentiation by analyzing its mRNA and protein expression, using RT/PCR assays and immunochemical detection (3).

RESULTS. RXRa transcripts were detected by RT/PCR in the three cell lines. Using polyclonal antibodies produced against a synthetic peptide corresponding to an amino acid sequence specific of RXRa, we found that only nuclear extracts from THP-1 cells contained detectable amounts of the RXRa protein. The band was unique and had the same size as the recombinant mouse RXRa protein produced in transfected COS-1 cells. The presence of the mRNA in proliferating, undifferentiated HL-60 and U937 cells, at a time when the protein could not be detected, suggested the existence of post-transcriptional mechanisms regulating the expression of RXRa. Our major finding was that VD or the non calcemic analogue EB1089 promoted the expression of the RXRa protein in HL-60 and U937 cells. This effect was dose-dependent and was higher with the synthetic

236 analog previously shown to be more potent than VD on cell differentiation. RA alone did not induce detectable expression of RXRa protein. The cotreatment of U937 cells by RA and either VD, MC903 or EB1089 induced larger amounts of RXRa, but this RA-induced increase was not observed in HL-60 cells. In the THP-1 cell line, which is the more mature of the three cell lines, the constitutive RXRa expression was not significantly enhanced upon treatments by RA, VD or their combinations. The expression of RXRa protein (figure 2, top) was correlated with inhibition of cell growth (figure 2, bottom). The highest levels were observed after 48 h treatment, either with VD alone in the case of HL-60 cells, or with combinations of RA and VD in U937 cells, at the time when cells acquire macrophagic properties. RXRoC

expression

2"

48

72

o

growth

24

48

72

24

48

72

Inhibition

o

24

Time (Hours)

48

72

CONCLUSION. We have shown that in HL60 and U937 cells, the RXRa protein increased upon VD treatment and that in U937 cells, maximal levels were induced by combining RA and VD treatments. This expression was not associated with mRNA increase, suggesting a more complex post-transcriptional regulation. More generally, we found a correlation between the expression of RXRa and the acquisition of monocytic properties. Thus, the receptor should be required for the activation of monocytic specific genes, by interacting with RARs, VDR or other nuclear receptors involved in this differentiation process.

Figure 2. Time-course induction of RXRa protein (top) and inhibition of cell growth (bottom). HL-60 and U937 cells were treated by 100 nM RA (opened circles), 100 nM VD (opened triangles) or 100 nM of both agents (closed triangles) during the indicated times. Results are expressed as : integral of optical densities obtained after western blotting experiments (IOD, top) (performed as in ref. (3)), or (3H) thymidine incorporation in treated cells versus non - treated cells (bottom)(1) .

ACKNOWLEDGEMENTS We are gratefull to Pr. P. Chambon and Dr. C. Egly for their j n t e r est to this work and for providing us anti-receptors antibodies. We also thank Dr. Binderup (Leo Laboratories, Ballerup, Denmark) for the gifts of VD analogs,

REFERENCES.. (1) Taimi, M„ Chateau, M.T., Cabanne, S. and Marti J.(1991) Leuk. Res. 15, 1145-1152. (2) Taimi, M., Defacque, H., Commes, T., Favero, J., Caron, E., Marti, J. and Dornand, J. (1993) Immunology, 79, 229-235. (3) Rochette-Egly, C., Lutz, Y., Saunders, M:, Scheuer, I., Gaub, M P. and Chambon, P.(1991) J. Cell. Biol.115, 535-545.

DIFFERENTIAL ACTIVATION OF THE VITAMIN D RECEPTOR BY 1,25 (OH) 2 "VITAMIN D3 AND ITS 20-EPIMERS

(VDR)

S. PELEG*, M. SASTRY*, E. COLLINS"1", J. BISHOP"1" AND A.W. NORMAN+. Department of Medical Specialties*, The University of Texas M.D. Anderson Cancer Center, Houston, TX 77030 and Department of Biochemistry"1", University of California, Riverside, CA 9252120 Introduction: The vitamin D3 metabolite, 1, 25(OH)2-vitamin D3 (1,25D3) functions, in culture, as a antiproliferative agent of numerous cell types and a differentiation/maturation hormone of hematopoietic and epidermal cells. The antiproliferative activities of the analogs 20-epi-l,25(OH)2D3 (IE) and 20-epi22-oxa-24a-27a-trihomeo-l,25-(OH)2D3 (ID) are, respectively, 200 and 7,000 fold higher than that of 1,25D3 [1], Because the antiproliferative action of 1,25D3 and its analogs is mediated by the nuclear receptor for vitamin D (VDR), we examined which of the molecular events associated with receptor activation has been augmented by the 20-epimers. Transcription activation: The Antiproliferative action of. 1,25D3 and its analogs requires direct and indirect regulation of many genes. Furthermore, because this effect must be assessed after prolonged incubation of the cells with the ligand in the presence of serum proteins and growth factors, the results can be influenced by the uptake and stablity of the tested compounds. Therefore, we tested the transcriptional activity of the analogs by DNA transfer into ROS 17/2.8 cells [2], The cells were transfected with transgenes containing well-characterized vitamin D-responsive elements (VDREs) from either the osteocalcin or the osteopontin gene, attached to the thymidine kinase promoter/growth hormone reporter gene. The transfected cells were incubated with the ligands for 1 hour in the absence of serum proteins and tested for reporter gene expression 48 hours later. We found that the effective dose required to reach 50% of maximal transgene expression (ED50) was 50- (ID) and 200-fold(IE) lower than that for 1,25D3. Therefore a single VDR-dependent transcription event was activated more efficiently by the 20-epimers than by 1,25D3. Liaand binding: Although the transcriptional activities of vitamin D metabolites and analogs are in general directly correlated with their affinity for the receptor, it has already been shown that in vitro, the affinity of the 20-epi analogs to the chick intestine VDR is similar to that of 1,25D3 [1], However it is possible that binding of the analogs by the receptor was more efficient in vivo than in vitro because receptor-binding properties of intact cells were different or because uptake of the analogs was more efficient than uptake of 1,25D3. To test these possibilities, we used ROS 17/2.8 cells to determine the competiton indexes of the analogs, relative to

238 1,2 5D3, in vitro and in vivo. In vitro assays were performed with cell homogenates as previously described [3]. In vivo assays w e r e performed by incubating the cells w i t h the competitors for 1 hour without serum and then measuring the remaining unoccupied binding sites in cell homogenates. These latter assays simultaneously tested the uptake and relative affinity of each compound to VDR in vivo. We found that the competition indexes of the analogs were lower than that of 1,2 5D3 both in vitro and in vivo. Therefore, the augmented transcriptional activity of the analogs was not due to a higher affinity to VDR or to an improved uptake mechanism. DNA-binding activity and d i m e r i z a t i o n : The chain of events leading to transcriptional activation of VDR by the ligand includes dimerization with retinoid X receptor (RXR) and binding to VDRE. To test if the analogs facilitated any of these events more than 1,25D3 did, we tested the VDRE-binding activity of ligand-induced VDR by electrophoretic mobility shift assays (EMSAs) [2]. Extracts from cells transfected with recombinant VDR gene and treated with 1,25D3 or the analogs were incubated with radiolabeled osteopontin VDRE; the VDR/VDRE complexes were separated from the free probe by electrophoresis, visualized by autoradiography, and quantitated by densitometry. We found that the ED50 for DNA binding of IEand ID-induced VDR were, respectively, 500-fold and 160-fold lower than the ED50 for 1,25D3-induced VDR. The effect of the ligands on dimerization with RXR was assessed by quantitating the fraction of VDR/DNA complexes supershifted in the EMSA by anti-RXR antibodies. These antibodies, a generous gift from Dr. P. Chambon, recognized the three RXR gene products, so we were able to detect simultanelusly all three potential VDR/RXR complexes. We found that the ED50 for heterodimerization of IE-induced and ID-induced receptor were 16-fold and 100-fold, respectively, lower than for 1,25D3induced receptor. Conclusion: Analogs IE and ID enhanced transcriptional activity of VDR more than 1,25D3 did, by facilitating dimerization of VDR with RXR and binding of VDR to VDRE. We hypothesize that the augmented activation was not due to higher affinity but due to differences in contact sites of the 20-epimers and 1,25D3 with the VDR. These differential interactions lead to conformational changes that augment VDR action. References: 1. Binderup, L., Latini, S., Binderup E., Bretting, C., Calverley, M. and Hansen, K. (1991) Biochem. Pharmacol.42,1569 1575. 2. Peleg S., Abruzzese R.V., Cooper, C. W. and Gagel R.F. (1993) Mol. Endocrinol. 7, 999-1008. 3.Wecksler, W.R. and Norman, A.W. (1980) Methods Enzymol., 67, 488-494.

DOPAMINE ACTIVATES VITAMIN D RECEPTOR BUT NOT RETINOID RECEPTOR MEDIATED TRANSCRIPTION THERESA MATKOVITS AND SYLVIA CHRISTAKOS, Department of Biochemistry and Molecular Biology, UMD-New Jersey Medical School and Graduate School of Biomedical Sciences, Newark, New Jersey 07103, USA. Recently, convincing evidence has been presented that steroid receptormediated transcription can be activated by phosphorylation in the absence of ligand. Using okadaic acid (OA), an inhibitor of protein phosphatase 1 and 2A, and/or cAMP, a functional role of phosphorylation in transcriptional activation was first shown for the activation of the COUP transcription factor (1) and the progesterone receptor (2). Similar transcriptional activation in the absence of ligand was subsequently shown for ER-mediated transcription (3). In addition, recent reports have shown activation of PR and ER-mediated transcription in the absence of ligand by the catecholamine neurotransmitter, dopamine, which binds to its plasma membrane receptor resulting in the activation of membrane-associated signaling mechanisms (4). These findings suggest that PR and ER-mediated modulation of neuronal gene expression may occur by dual activation, by ligand and/or by dopaminergic signaling mechanisms. However, not all steroid receptor-mediated transcription can be activated in a ligand-independent manner. For example, human glucocorticoid and human mineralocorticoid receptors were found to be unresponsive to activation by OA and dopamine (4), suggesting some specificity for the ligandindependent activation of steroid receptor-mediated transcription. In this study we report ligand independent transcriptional activation of the vitamin D receptor and retinoid receptors. To determine the effect of phosphatase inhibitors or dopamine on VDR, RAR, and RXR-mediated transcription, CV1 cells were transiently transfected with the corresponding receptor expression vector and a reporter construct that contains either the VDRE found in the rat osteocalcin gene (OCVDREtkCAT), the RARE found in the RAR/? promoter (/?2RARE), or an RXR specific response element found in the cellular retinol binding protein type II gene (pCRBPIICAT). As shown previously in our laboratory, CV1 cells transfected with the reporter construct OCVDREtkCAT and pAVhVDR expression vector (from W. Pike) showed a 25 ± 5-fold induction in C A T activity in the presence of 10 8 M 1,25(OH) 2 D 3 . OA alone (50 nM), in the absence of ligand, also activated VDR-mediated transcription (55 ± 5-fold induction). The inhibition of cellular phosphatases enhanced the induction of the 1,25(OH) 2 D 3 -activated, VDRmediated transcription by 30%. In order to examine the possibility that phosphorylation can regulate transcription by retinoic acid receptors, CV1 cells were transfected with RAR expression vectors and reporter plasmids that

240

contain a R A R E . 3 0 nM O A treatment alone resulted in an induction in C A T activity with R A R a and R A R 0 similar to that seen in the presence of 10' 7 M retinoic acid (RA). Unlike the other two members of the R A R family, within the limits of sensitivity of our a s s a y s , R A R p w a s not found to be responsive to treatment with 3 0 nM O A (1.2 ± 0 . 2 fold induction), whereas R A R / w a s responsive to treatment with 1 0 7 M RA (6.2 ± 0 . 9 fold induction). T o date there have been no reports concerning phosphorylation of R X R s . However, since these receptors are members of the steroid receptor superfamily, most of whose members are phosphoproteins, we investigated the possibility of phosphorylation regulating RXR-mediated transcription. When cells were transfected with the R X R o expression vector, 3 0 nM O A resulted in a transcriptional response similar to that observed with 10"7 M 9-c/'s R A (4.5 ± 0.7.fold induction). O A (30 nM) treatment alone also lead to an induction of C A T activity in extracts from cells cotransfected with p C R B P I I C A T and RXR/? or R X R / (4.2 ± 0 . 2 and 7 . 0 ± 0 . 5 fold induction, respectively). Since dopamine receptors are colocalized in certain brain regions with vitamin D and retinoid receptors, we asked whether dopamine treatment could result in activation of V D R or retinoid receptor mediated transcription. Treatment of cells cotransfected with p A V h V D R and O C V D R E t k C A T with 1 0 0 - 5 0 0 ¿/M dopamine resulted in a 3-11 fold induction in C A T activity. Dopamine receptors belong to two major subtypes, D, and D 2 . Treatment of cells with 1 0 0 JJM of the selective D, agonist, S K F 3 8 3 9 3 , resulted in a 2 0 ± 4 fold induction in C A T activity. Treatment of cells with 1 0 0 or 5 0 0 /JM quinpirole, a selective D 2 agonist, had no effect on VDR-mediated transactivation suggesting the specificity of the effect for the D, receptor subtype. When C V 1 cells were transfected with RARor, -/?, -y or RXRo, -/?, or -y expression vectors and the corresponding reporter plasmid, maximum stimulation of transcription w a s not greater than 1.6 fold in the presence of 1 0 0 - 4 0 0 y M dopamine or 1 0 0 fjM S K F 3 8 3 9 3 . T h e s e data suggest specificity for dopamine activation amongst members of the steroid hormone receptor superfamily. In conclusion, V D R , RXRo, -/? -y, and R A R a and -/? can be rendered transcriptionally active in the absence of ligand by agents which enhance phosphorylation. T h e activation of the V D R by dopamine will allow us to explore possible physiological consequences of this ligand-independenttranscriptional activation. 1. 2. 3. 4.

Power, R. F., Lydon, J . P., Conneely, 0 . M. and O'Malley, B. W. (1991) Science 2 5 2 , 1 5 4 6 - 1 5 4 8 . Denner, L. A., Weigel, N. L., Maxwell, B. L., Schrader, W. T . and O'Malley, B. W. (1990) Science 2 5 0 , 1 7 4 0 - 1 7 4 3 . Aronica, S. M. and Katzenellenbogen, B. S. (1993) Mol. Endocrinol. 7, 743-752. Power, R. F., Mani, S. K., Codina, J . , Conneely, O. M. and O'Malley, B. W. (1991) Science 2 5 4 , 1.636-1639.

ORDERED BINDING O F HUMAN VITAMIN D AND RETINOID-X R E C E P T O R C O M P L E X E S T O ASYMMETRIC VITAMIN D - R E S P O N S I V E ELEMENTS C.H. JIN and J.W. PIKE. Department of Biochemistry, Ligand Pharmaceuticals Inc., San Diego, CA 92121, USA. INTRODUCTION. The vitamin D receptor (VDR) is a member of the nuclear receptor superfamily of ligand-dependent transcription factors that act in a cistrans fashion to stimulate transcription from the promoters for target genes. Current studies have revealed two fundamental differences between the V D R and steroid hormone receptors during interaction with DNA. First, vitamin Dresponsive elements (VDREs) are composed of two directly repeated hexanucleotides separated by three base pairs (1); the steroid hormone responsive element consists of a palindromic arrangement of a conserved recognition motif. Second, in contrast to the estrogen and glucocorticoid receptors, which appear to bind to DNA exclusively as homodimers (2,3), V D R requires a nuclear accessory factor(s) (NAF) for binding to VDREs (4,5). Thus, the interaction of VDR with NAF on a c/'s-element may be very important for regulating the transcription of target genes. Recently, several lines of evidence suggest that retinoid X receptor (RXR) may be a good candidate for NAF. In this chapter, we discuss the requirement of RXR for VDR-dependent transactivation, properties of the binding of VDR/RXR heterodimers to VDREs, and the polarity of the complex. VDR requires RXR for efficient transcription in yeast cells. In order to clarify whether V D R requires RXR for transactivation, we used a yeast system that is a pure steroid receptor expression system and also has posttranslational modification similar to that of higher eukaryotes. Transformants that express VDR alone do not activate transcription of p-galactosidase, a reporter gene driven by the CYC-1 promoter containing a V D R E derived from either the human osteocalcin (hOC) promoter, a synthetic direct repeat-3 (DR-3), or a direct repeat-6 (DR-6) sequence. However, transformants that co-express V D R and RXRy markedly increase transcriptional activity driven by these VDREs. There is no significant difference between the transcriptional activities induced through VDREs derived from hOC or a DR-3. Also, comparable transactivation was induced through the DR-6 sequence in a yeast transformant that coexpressed VDR and RXR-y. VDR requires RXR for binding to various VDREs. We used recombinant VDR and RXR produced in yeast cells to examine the binding of VDR to various VDREs in the presence or absence of the RXR by electrophoretic morbility shift assay. V D R bound to various VDREs of hOC, murine osteopontin, human 24hydroxylase genes as well as direct repeat-3 (DR-3) as heterodimers with RXRa; the profile of these complexes among the heterodimers and VDREs was identical. Formation of VDR homodimer was not apparent. Together with the transcriptional activity, these data suggest that the formation of heterodimers between V D R and RXR is a prerequisite for activating transcription of target genes.

242 Polarity of DNA-binding domain. To determine whether each of the receptors preferentially bound to the upstream or downstream half-site of an asymmetric c/s-element, a strategy of domain-swap was employed. Thus, the DNA binding domain (DBD) of VDR was replaced with that of the glucocorticoid receptor. The chimeric receptor (VGV) did not bind to VDREs with RXRa, nor to a glucocorticoid responsive element (GRE). However, VGV was capable of binding to an ordered VDRE-GRE chimeric c/s-element (Fig. 1A, 5V3G) with RXRa in the direct repeat orientation, but not in the reverse orientation (5G3V) (Fig. 1 A). Interestingly, an antibody against VDR, whose epitope was at the Cterminus of the DBD, was able to bind to VGV/RXRa heterodimers and in turn interfere with the formation of the receptors on different c/s-elements. CONCLUSIONS. RXR potentiates the formation of high affinity VDRE complex as a VDR heterodimer and stimulates VDR-dependent transcriptional activity in yeast. VDR preferentially forms heterodimers with RXRs on all VDREs tested; the specific polarity of the heterodimer on the hOC VDRE is as illustrated in Fig. 1B. HOC

5'-

5V3G

5'-

GGGGCA GGGTGA

G

AGAACA

V

Figure 1. Schematic representation of specific polarity in the binding of the heterodimer of VDR and RXR to VDRE REFERENCES. 1. Ozono, K„ Liao, J., Kerner, S.A., Scott, R.A., and Pike, J.W. (1990) J. Biol. Chem. 265, 21881-21888. 2. Kumar, V., and Chambon, P. (1988) Cell 55, 145-156. 3. Luisi, B.F., Xu, W.X., Otwinowski, Z., Freedman L.P., Yamamoto, K.R., and Sigler, P.B. (1991) 352, 497-505. 4. Liao, J., Ozono, K., Sone, T„ McDonnell, D.P., and Pike, J.W. (1990) Proc. Natl. Acad. Sci. U.S.A. 87, 9751-9755. 5. Sone, T., McDonnell, D.P., O'Malley, B.W., and Pike, J.W. (1990) J. Biol. Chem. 265, 21997-22003.

IMMUNOHISTOCHEMICAL LOCALIZATION OF 1,25-DIHYDROXYVITAMIN [l,25(OH) 2 D 3 ] RECEPTORS (VDR) IN HUMAN AND RAT PANCREAS

D3

J.A. Johnson, J.P. Grande, P.C. Roche, and R. Kumar. Departments of Medicine and Biochemistry and Molecular Biology, and Laboratory Medicine, Mayo Clinic/Foundation, Rochester, MN 55905 Introduction Vitamin D status is known to affect pancreatic insulin secretion (1,2,3), as well as protein and enzyme secretion by the exocrine pancreas (4), but does not affect glucagon (5) or somatostatin secretion (6). l,25(OH) 2 D 3 acts to regulate gene expression through the intracellular VDR. Studies using radiolabeled l,25(OH) 2 D 3 have suggested that VDR are located in pancreatic islets (7), but no direct evidence of this has been presented until now. We used immunohistochemical techniques to stain serial sections from both human and rat pancreas for the presence and specific location of the VDR and calbindin-D^. Methods For human pancreas, normal uninvolved tissue from patients undergoing abdominal surgery was used. Rat pancreas was obtained from normal female Holtzman rats. Paraffinembedded pancreatic tissues were cut in serial sections 4 nm thick and placed on silanized slides. Immunohistochemistry was performed using polyclonal antibodies to VDR, calbindin^28k> i n s u l i n ( t 0 identify B-cells), glucagon (to identify o-cells) and somatostatin (to identify 6 -cells). All sections then were treated with biotinylated goat anti-rabbit IgG, followed by peroxidase-Iabeled streptavidin. Sections were developed using aminoethyl carbazole and counterstained with hematoxylin. Pre-immune rabbit serum was used in place of primary antibodies for negative controls. Results and Conclusions Using immunohistochemistry, this study shows for the first time that the VDR is present in the islets of human and rat pancreas. The VDR appears to localize in human and rat islets in cells (B-cells) that stain positively with the insulin antibody (Panels A & B). Cells containing glucagon immunoreactivity (a-cells) are distributed mostly in the periphery of the islets and do not appear to immunostain with the V D R antibody. Somatostatin containing cells are sparsely distributed in islets and most likely do not contain VDR epitopes. In addition to islet cells, the VDR also was present in pancreatic acinar cells, but not in duct cells, nerve cells, or blood vessels of human or rat pancreas (Panels A & B). Calbindin-D^ immunoreactivity is localized exclusively to the islet in both human and rat pancreas (Panels C & D), where it appears to co-localize with VDR immunostaining (Panels A & B). Calbindin-D^ has been localized to the pancreatic islet in rat previously (8,9). No non-specific staining was found in either human or rat pancreatic tissue sections for any of the antibodies used. The presence of VDR in the islets of both human and rat pancreas suggests that l,25(OH) 2 D 3 alters the function of these cells via a genomic mechanism. Because calbindin^28k ' s not present in pancreatic acinar cells, l,25(OH) 2 D 3 may act through different mechanisms to influence exocrine pancreatic secretion than it does to regulate islet insulin secretion.

244

Immunohistochemistry on serial sections of human and rat pancreas. Original magnification is 400X. Panel A: human pancreas, VDR Ab; Panel B: rat pancreas, VDR Ab; Panel C: human pancreas, calbindin-D^k Ab; Panel D: rat pancreas, calbindin-D^ Ab. Open arrows indicate acinar cells (exocrine pancreas); solid arrows indicate islets of Langerhans.

References 1. 2. 3. 4. 5. 6. 7. 8. 9.

Billaudel, B., Labriji-Mestaghanmi, H., Sutter, B.C.J., and Malaisse, W.J. (1988) J. Endocrinol. Invest. 11,585-593. Clark, S.A, Stumpf, W.E., and Sar, M. (1981) Diabetes 30,382-386. Ishida, H., and Norman, A W . (1988) Molecular Cellular Endocrinol. 60,109-117. Heidbreder, E., Sieber, P., and Heidland, A (1975) Res. Exp. Med. 166,147-163. Norman, AW., Frankel, B.J., Heidt, AM., and Grodsky, G.M. (1980) Science 209,823-825. Ishida, H., Seino, Y., Seino, S., Tsuda, K., Takemura, J., Nishi, S., Ishizuka, S., and Imura, H. (1983) Life Sei. 33,1779-1786. Narbaitz, R., Stumpf, W.E., and Sar, M. (1981) J. Histochem. Cytochem. 29,91-100. Morrissey, R.L., Bucci, T.J., Empson, R.N., Jr., and Lufkin, E.G. (1975) Proc. Soc. Exp. Biol. Med. 149,56-60. Roth, J., Bonner-Weir, S., and Norman, AW.(1982) Endocrinol. 110,2216-2218.

STRUCTURE-FUNCTION RELATIONSHIP OF HUMAN PARATHYROID HORMONE ON VITAMIN D RECEPTOR REGULATION IN OSTEOBLAST-LIKE CELLS (ROS 17/2.8) SUTIN SRIUSSADAPORN, JAMES F. WHITFIELD*, VRISHALI TEMBE and MURRAY J. FAVUS, Department of Medicine, The University of Chicago, Chicago, IL 60637, USA. * Institute for Biological Sciences, National Research Council of Canada, Ottawa, Ontario, Canada KIA OR6. Introduction. Studies of the relationship between parathyroid hormone (PTH) structure and its function in the activation of protein kinases have revealed that different regions within the biologically active PTH-(1-34) peptide are responsible for different functions. The first two N-terminal amino acids are required for plasma membrane adenylate cyclase stimulation, and the C-terminal region 3234 is necessary for PKC translocating activity (1). Though PTH is known to regulate vitamin D receptor (VDR) (2,3), no study on the structure-function relationship of the peptide in the regulation of VDR has been previously described. The aim of this study was to examine the relationship of structure and function of PTH in the regulation of VDR in osteoblast-like cells ROS 17/2.8. Methods. ROS 17/2.8 cells (kindly provided by Dr. Sevgi Rodan) were cultured in a modified F-12 medium (mF-12) containing 1.1 mM Ca + + , 28 mM HEPES, 2 mM glutamine, 5% fetal bovine serum (FBS), at 37°C, under 5% C O 2 - 95% air. Experiments were performed at confluent culture. At 24 h before the experiment, culture medium was changed to mF-12 containing 2% charcoal-treated FBS. On the day of experiment, cells were incubated in serum free mF-12 containing vehicle or different concentrations of one of the following synthetic human (h) PTH peptides: (1-34), (1-31), (3-34) and (13-34) in the absence or presence of 0.5 nM 1,25(OH)2 D3 for 16 h. At the end of the incubation, the culture medium was removed and the cells were further incubated in serum free mF-12 for 2 h. Cells were then harvested, washed, counted, homogenized in ice-cold hypertonic buffer (300 mM KCI, 10 mM Tris-HCI, 1 mM EDTA, 5 mM DTT, 10 mM sodium molybdate, pH 7.4) and centrifuged at 220,000 x g for 60 min. Duplicate aliquots of 200 nl of the supernatant were incubated with 1.5 nM of 1,25(OH)2 [23,24-methyl-3H] D3 in the absence and presence of a 300 - fold molar excess of 1,25-(OH)2D3 at 4°C for 16 h to determine total and nonspecific binding, respectively. Bound and free hormone were separated by hydroxylapatite. Specific binding was determined by subtraction of nonspecific from total binding. Values were shown as mean ± SE. The differences of means among groups were estimated by ANOVA. P value of < 0.05 was considered statistically significant. To determine the effect of hPTH fragments on VDR gene expression, total RNA was extracted and co-amplifications of the mRNAs of VDR and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) genes by PCR procedure for 30 cycles were performed. The primers used in this study were: reverse primers 5'CCTCATAAAGTTCCAGGTGG3' for VDR cDNA and 5'GTATCCGTTGTGGATCTGACA3' for GAPDH cDNA, and forward primers 5'GGAGGCACTGCTGGGCTGCAA3' for VDR cDNA and 5'CCTCTCTCTTGCTCTCAGTAT3' for GAPDH cDNA. The PCR conditions were: 94°C, 30 sec for denaturation; 57°C, 1 min for annealing; and 72°C, 1 min for polymerization.

246

Results. hPTH-(1-34) at concentrations of 10~9 to 10"7 M caused a dosedependent decrease in VDR content from control levels of 70.2 ± 2.2 fmol/mg protein to 62.1 ± 3.3 (-16%) at 10"9 M, 52.3 ± 5.3 (-25.5%; p < 0.02) at 10"8 M and 45.5 ± 3.5 fmol/mg protein (-35.3%; p = 0.001) at 10"7 M (n = 6). hPTH-(1-31) also decreased VDR content from 65.5 ± 2.6 to 55.3 ± 5.0 (-19.5%) at 10' 9 M, 44.3 ± 3.7 (-32.4%; p < 0.01) at 10"8 M and 40.5 ± 2.1 fmol/mg protein (-38.2%; p < 0.01) at 10"7 M (n = 6). Incubation of ROS 17/2.8 cells with 0.5 nM of 1,25(OH)2 D3 led to up-regulation of VDR content by 330-370% of control. hPTH-(1-34) decreased the VDR up-regulatory effect of 1,25(OH)2 D3 from 330% to 230% at 10"® M (p < 0.001) and 170% (p < 0.001) at 10"7 M of control, respectively (n = 6). hPTH-(1-31) also decreased the receptor up-regulatory effect of 1,25(01-1)2 D3 from 370% to 280% (p < 0.001) at 10"8 M and 220% (p < 0.001) at 10"7 M of control, respectively (n = 6). hPTH-(3-34) and (13-34) at concentrations of 10"9 to 10-7 M did not decrease VDR content either in the absence or presence of 1,25(OH)2 D3. Quantitation of VDR mRNA by PCR procedure showed that PTH-(134) and (1-31) at 10"7 M but not (3-34) and (13-34) inhibited ROS 17/2.8 cell VDR gene expression either in the absence or presence of 1,25(OH)2 D3 (Figure 1). a

b

c

d

e

f

g

h

i

j - VDR (443 bp) - GAPDH (344 bp)

Figure 1. 2.5% Agarose gel electrophoresis of the co-amplified products of VDR and GAPDH mRNAs. Lanes a t o j represent the PCR products obtained from ROS 17/2.8 cells treated with vehicle, hPTH-(1-34), (1-31), (3-34), (13-34), 1,25(OH)2 D 3 , 1,25(OH) 2 D 3 + (1-34), 1,25(OH) 2 D 3 + (1-31), 1,25(OH) 2 D 3 + (3-34), and 1,25(OH) 2 D 3 + (13-34), respectively. Similar results were observed from 3 separate sets of experiments.

Discussion. The present study has shown that the PTH fragments (1-34) and (131) which contain the adenylate cyclase - cAMP - PKA stimulating domain were responsible for the down-regulation of VDR and inhibition of 1,25(OH)2 D3 induced VDR up-regulation in ROS 17/2.8 cells. Whereas the fragments (3-34) and (13-34) which stimulate only PKC activity did not decrease cellular VDR content. These observations indicate that down-regulation of VDR content in ROS 17/2.8 cells by PTH is mediated through the adenylate cyclase pathway. The role of the adenylate cyclase pathway in the regulation of VDR is supported by the evidence that increased cellular cAMP activity induced by forskolin also decreased VDR content and inhibited 1,25(OH)2 D3 induced VDR up-regulation in ROS 17/2.8 cells (data not shown). The decrease in VDR mRNA of the cells after incubation with PTH-(1-34) and (1-31) suggests that PTH down-regulates VDR content and inhibits 1,25(OH)2 D3 induced VDR up-regulation by stimulation of adenylate cyclase activity which subsequently suppresses VDR gene expression. References. 1. Habener, J.F., Rosenblatt, M. and Potts, J.T. (1984) Physiol. Rev. 64, 985-1053. 2. Pols, H.A.P., Van Leeuwen, J.P.T.M., Schilte, J.P., Visser, T.J. and Birkenhager, J.C. (1988) Biochem. Biophys. Res. Comm. 156, 588-594. 3. Reinhardt, T.A. and Horst, R.L. (1990) Endocrinology 127,942-948.

INSULIN-LIKE GROWTH FACTOR I UP-REGULATES INTESTINAL 1,25(OH) 2 D 3 RECEPTOR IN PHOSPHORUS RESTRICTED RATS SUTIN SRIUSSADAPORN, MANSAU WONG, VRISHALI TEMBE and MURRAY J. FAVUS, Department of Medicine, The University of Chicago, Chicago, IL 60637, USA. Introduction. Insulin-like growth factor I (IGF-I) has several biological effects on bone and mineral metabolism including regulation of renal 1,25(OH)2 D3 production (1). Recently, we have found that the ability of kidney to increase 1,25(OH)2 6 3 production during phosphorus restriction is impaired in aging (12 week-old) rats (2) but can be restored by infusion of IGF-I. IGF-I has been shown in vitro to increase 1,25(OH)2 D3 receptor (VDR) abundance in mouse fibroblasts and human breast cancer cells (3). However, the in vivo effect of IGF-I on tissue VDR content is not known. Several studies have shown that factors which affect 1,25(OH)2 D3 metabolism such as administration of 1,25(OH)2 D3 (4), parathyroid hormone (5), dietary calcium (6), and phosphorus restriction (7) also alter tissue VDR content. Accordingly, we hypothesized that IGF-I might have some effect on tissue VDR content particularly in intestinal mucosa which is the major target tissue of 1,25(OH)2 D3 and possesses IGF-I receptors (8). Therefore, experiments were undertaken to explore the in vivo effect of IGF-I on intestinal VDR content using young and aging phosphorus restricted rats. Methods. Young (Y; 2 week-old; weight 50 - 75 g) and aging (A; 12 week-old; weight 325 - 350 g) male Sprague-Dawley rats were randomly assigned to two groups. One group was fed a synthetic normal diet (NPD; 0.6% Ca, 0.65% P), and the second group was fed a synthetic low phosphorus diet (LPD; 0.6% Ca, 0.1% P) for 5 days until sacrifice. All animals received either IGF-I (1.5 mg/Kg BW/24 h) or vehicle (0.1% BSA, 0.1 M acetic acid) via Alzet miniosmotic pumps model 1003D continuously during the 72 h prior to sacrifice. At sacrifice, blood was saved for serum Ca, P, and 1,25(OH)2 D3 measurements, and the first 10 cm of small intestine was excised for VDR binding assay as described elsewhere (5,6). Values were shown as mean ± SE. The differences of means among groups were estimated by ANOVA. P value of < 0.05 was considered statistically significant. Results and Discussion. The results are summarized in Table 1. In YLPD, serum 1,25(OH)2 D3 and intestinal VDR content increased by 2.8 and 1.9 fold, respectively compared to YNPD (p < 0.001). In YLPD+IGF, infusion of IGF-I further increased intestinal VDR content from 1.9 to 2.8 fold over YNPD (p < 0.001) without further changes in serum Ca, P, and 1,25(OH)2 D3 levels suggesting that IGF-I has a direct additive effect on intestinal VDR up-regulation induced by LPD. In ANPD+IGF, infusion of IGF-I did not alter serum 1,25(OH)2 D 3 or intestinal VDR content, indicating that IGF-I has no direct effect on VDR regulation in aging rats. In ALPD, though LPD increased serum 1,25(OH)2 D3 by 1.8 fold over ANPD (p < 0.02), the increase in serum 1,25(OH)2 D3 was less than that observed in YLPD (1.8 vs. 2.8 fold; p < 0.001) and was not accompanied by upregulation of intestinal VDR. In ALPD+IGF, infusion of IGF-I increased serum

248

1,25(OH)2 D3 by 2.2 fold and intestinal VDR content by 2.4 fold over ANPD+IGF (p < 0.001). IGF-I did not alter serum Ca and P i n any experimental groups. These observations suggest that IGF-I up-regulates intestinal VDR in aging P restricted rats indirectly through increases in serum 1,25(OH)2 D3 level. Table 1

Effect of 72-hour-IGF-l infusion on serum Ca, P, 1,25(OH)2 D3 levels and intestinal VDR content. n

YNPD YLPD YLPD+IGF ANPD ANPD+IGF ALPD ALPD+IGF

7 7 7 7 4 6 8

Ca (mg/dl) 10.50 12.24 11.85 10.20 9.85 10.82 11.17

± ± ± ± ± ± +

P (mg/dl)

0.09 11.04 ± 0 . 2 1 0.26 5.78 ± 0 . 2 7 6.19 ± 0 . 2 2 0.15 0.09 7.45 ± 0 . 2 6 0.06 7.44 ± 0.23 0.12 4.86 ± 0.41 0.09 5.29 ± 0.32

1,25(OH)2 D 3 (pg/ml)

VDR content (fmol/mg protein)

122.4 365.3 338.3 113.5 143.8 205.2 310.6

158.5 304.8 441.4 59.6 53.1 62.4 127.9

± ± ± ± ± ± ±

4.9 21.3 35.3 14.8 5.5 28.2 15.6

± 12.7 ± 28.6 ± 19.5 ± 4.3 + 5.7 ± 5.1 ± 9.4

Abbreviations: YNPD and ANPD, Y and A rats fed NPD and infused with vehicle, respectively; YLPD and ALPD, Y and A rats fed LPD and infused with vehicle, respectively; ANPD+IGF, A rats fed NPD and infused with IGF-I; YLPD+IGF and ALPD+IGF, Y and A rats fed LPD and infused with IGF-I, respectively. Summary. In the present study, we have shown that continuous infusion of IGF-I for 72 h up-regulates intestinal VDR content during dietary phosphorus restriction in both young and aging rats. In addition, the effect of IGF-I on VDR content is age-dependent. In young phosphorus restricted rats, IGF-I directly increases intestinal VDR. Whereas in aging phosphorus restricted rats, IGF-I up-regulates intestinal VDR content indirectly through increased serum 1,25(OH)2 D3 levels. The mechanism of age-dependent VDR response to IGF-I is not clearly known, however, changes in tissue IGF-I receptor regulation with age (9) might be involved. Further studies are needed to support this notion. References. 1. Nesbitt, T. and Drezner, M.K. (1993) Endocrinology 132, 133-138. 2. Wong, M.S. and Favus, M.J. (1993) J. Bone Miner. Res. 8 (supp 1), S224. (abstract) 3. Costa, E.M. and Feldman, D. (1986) Biochem. Biophys. Res. Comm. 137, 742747. 4. Reinhardt, T.A. and Horst, R.L. (1990) Endocrinology 127, 942-948. 5. Favus, M.J., Mangelsdorf, D.J., Tembe, V., Coe, B.J. and Haussler, M.R. (1988) J. Clin. Invest. 82,218-224. 6. Sriussadaporn, S., Wong, M.S. and Favus, M.J. (1993) J. Bone Miner. Res. 8 (suppl 1), S171. (abstract) 7. Krishnan, A.V. and Feldman, D. (1991) J. Bone. Miner Res. 6,1099-1107. 8. Laburthe, M., Rouyer-Fessard C. and Gammeltoft, S. (1988) Am. J. physiol. 254, G457-G462. 9. Werner, H., Woloschak, M., Adamo, M., Shen-Orr, Z., Roberts, C.T., Jr. and LeRoith, D. (1989) Proc. Natl. Acad. Sci. U.S.A. 86, 7451-7455.

A PEPTIDE C-TERMINAL TO THE SECOND Zn-FINGER OF HUMAN VITAMIN D RECEPTOR IS ABLE TO SPECIFY NUCLEAR LOCALIZATION ZHONGJUN LUO and PEKKA H. MAENPAA, Department of Biochemistry & Biotechnology and A.I. Virtanen Institute, University of Kuopio, FIN-70210, Kuopio, FINLAND. Introduction: Nuclear envelope forms a major barrier within the cell. Nuclear pores provide large channels permitting small molecules to diffuse between the cytoplasm and nucleoplasm. Macromolecules are excluded or enter the nuclei by selective transport mechanisms, which usually require a short sequence of the protein called the nuclear localization signal (NLS). Its most conserved feature seems to be a cluster of several positively charged amino acids. The DNAbinding, hinge, and hormone-binding regions of hVDR contain several sequences, which are rich in basic amino acids, including amino acids 41-52, 67-72, 77-80, 99-109, and 368-371. We chose the sequence 67-108 to study, whether there exists a NLS in this region of the receptor capable of specifying nuclear localization. Methods: VDR27 (amino acids 67-108 of hVDR), VDR13 (amino acids 97-108), and VDR14 (amino acids 67-80) were conjugated to FITC-labelled IgG using a bifunctional coupling reagent, mmaleimidobenzoyl-n-hydroxysuccinimide ester (MBS). Before conjugation, the peptides were reduced by NaBH^ The chimeras were microinjected into the cytoplasm of human osteosarcoma MG-63 cells, which were grown at 37°C in Dulbecco's modified Eagle's medium (MEM) supplemented with FCS, L-glutamine, penicillin, streptomycin, and nonessential amino acids in an atmosphere of 5% C 0 2 / 9 5 % air. The chilling studies were done by draining out the culture medium, adding cold (4°C) medium, and cooling the cells on ice for 30 min before and 30 min after the injection, or for 30 min after the injection and then warming for 30 min or 1 h. The energy depletion studies were carried out by incubating the cells for 30 min prior to, during, and 30 min after the injection in Hank's balanced salt solutions with ImM carbonyl cyanide ptrifluoromethyloxyphenyl-hydrazone and 6 mM 2-deoxyglucose at 37'C. In the WGA inhibition experiment, the cells were microinjected with 0.4 mg/ml WGA in the peptide-linked FITC-IgG solution and incubated for 30 min, 1 h, 6 h, or 12 h. The cells were observed directly with Nikon Microphot-FXA microscope. Results: IgG alone was too large to pass through the pores of the nuclear envelope and was excluded. VDR27 linked to IgG was able to enter the nuclei as did SV40 T peptide, a wellcharacterized NLS from SV40 large T antigen, although a weak labeling of some cytoplasmic structures was also observed in almost all cells. The nuclear accumulation of VDR27-linked and SV40 T-linked IgG was inhibited by chilling, energy depletion, and WGA treatment. VDR13 and VDR14 were not able to target IgG into the nuclei.

250 Discussion: In this report, we have tried to determine, whether there is a nuclear localization signal in hVDR, since the size of vitamin D receptor is so near to the functional radius of nuclear pores (about 4.5 nm) that VDR may even diffuse through the nuclear pores. The constitutive NLSs, which have been characterized in other steroid hormone receptors using deletion mutant experiments, are mostly localized in the hinge region between the DNA- and hormone-binding domains. We now show that, also in hVDR, the hinge region acts as a NLS. The hVDR NLS resembles a class of bipartite nuclear targeting motifs consisting of a downstream cluster of two basic amino acids, a spacer region of ten to twenty amino acids, and an upstream cluster in which three out of five amino acids are basic. It seems that both clusters of basic amino acids at the Nterminal and C-terminal ends of VDR27 are simultaneously necessary for nuclear localization, since VDR13 and VDR14, which contain only one basic cluster of VDR27 each, did not target IgG into the nuclei.

Figure: Nuclear transport of VDR27, VDR13, VDR14, and the SV40 T conjugated to FITC-IgG in MG-63 cells. The peptide-linked antibodies were microinjected into the cytoplasm of MG-63 cells within 20 min, incubated for 1 h at 37°C, and then observed with microscope. Panel A: SV40 T linked to FITC-IgG, Panel B: VDR27 linked to FITC-IgG, Panel C: VDR13 linked to FITC-IgG, Panel D: VDR14 linked to FITC-IgG. References: 1. Breeuwer, M. and Goldfarb, D. S. (1990) Cell 60, 999-1008. 2. Dingwall, C. and Laskey, R. A. (1991) Trends Biochem. Sci. 16, 478-481. 3. Kalderon, D., Richardson, W. D., Markham, A. F. and Smith, A. E. (1984) Nature 311, 33-38. 4. Boulikas, T. (1993) Crit. Rev. Euk. Gene Expr. 3, 193-227.

MOLECULAR CLONING AND SEQUENCING OF A NOVEL cDNA RELATED TO THE STEROID/THYROID/VITAMIN FAMILY OF NUCLEAR RECEPTORS FROM A VITAMIN D-DEFICIENT CHICK INTESTINAL cDNA LIBRARY ELAINE D. COLLINS and ANTHONY W. NORMAN Department of Biochemistry, University of California, Riverside, CA 92521 USA. Introduction: la,25(OH)2D3 is a seco-steroid that functions in a manner homologous to steroid hormones. The ligand-bound receptor is localized to the nucleus where it binds to response elements on the DNA, affecting the transcription of sensitive genes. Receptors for la,25(OH)2D3 have been found in numerous tissues (1), and the full-length cDNA for the la,25(OH)2D3 receptor (VDR) has been cloned and sequenced for human intestine (2), HL-60 cells (3), and rat intestine (4), but not for chick intestine. Since the chick is the primary model system used in our laboratory, we were interested in cloning the VDR from chick intestine. Methods and Results: In order to clone the chick VDR, a probe was constructed using PCR. Primers were designed corresponding to sequences flanking the DNA binding domain of the human VDR. A 289 bp probe was cloned and sequenced from a vitamin D -deficient chick kidney library. The sequence of this probe had an identity of 96% to the corresponding region of the human VDR sequence. The chick VDR probe was used to screen a vitamin D-deficient chick intestinal library. More than 10^ plaques were screened and twenty six positive clones were selected for further screening. Southern blot analysis of purified DNA from these plaques revealed that two of the clones were strongly positive, thirteen were moderately positive and eleven were negative. Two clones were selected for sequencing, clones 17 and 21. These two clones were plaque purified through two additional rounds of screening and were rescued by an in vivo process as pBluescript (SK)- plasmid. Restriction analysis of the clones revealed that clone 17 contains an insert of 1500 nucleotides and clone 21 contains an insert of 1900 nucleotides. The two clones were sequenced using a thermocycling modification of the dideoxy sequencing method. The complete sequence for clone 17 was obtained but only a partial sequence for clone 21. The two clones appear to overlap since about 1200 nucleotides of sequence between the two clones are identical. Homology searches of the sequence of clone 17 indicated that these clones have high identity with members of the steroid/thyroid/vitamin D family of nuclear receptors, particularly within a region of 210 nucleotides that corresponds to a putative DNA binding domain. This region shares 80% identity with the chick thyroid receptor (T3R-a) and 75% identity with human VDR. The deduced amino acids of this

252 domain contain conserved cysteine residues that are characteristic of the DNA binding domain of this superfamily. Figure 1 illustrates the homology of the deduced amino acid sequence for the DNA binding domain of clone 17 compared to selected receptors.

First z i n c linger Clonel7

C V V C G D K A S G Y H Y N A L T C E G C

C T3R-«

-

T -

-

-

T -

-

S

-

R T3R-II H RAR-T

- F - - N -

R VDR

- G -

H VDR

- G -

-

-

K G F F R R S I T K N

-

R C I

- - - - - -

T

-

R C I

- - - - - -

T

-

G V S S - - - -

S

F R

-

T - F - F

-

-

M

-

Q Q Q

A V Y K

-

-

L H P T

-

S

-

S L H P S

-

S

-

M V Y T

-

M

K

R K

-

L F T

M

-

R K

-

M F T

S e c o n d zinc linger Clone 17

C K N G G N C E M D M Y M R R K C Q E C

C T3R-0

R L R K C K Q M G M

Y D

-

c - V I

-

K I T - N Q - - L -

- F K

-

- I Y V - -

Y E

-

K - I I

-

K V T - N Q -

- F K

-

- I Y V - -

- F Q

-

- F E V - -

R T3R-II

-

H RAR-r

- H R D K

-

R VDR

- P F N

-

D - R I T K D H

Il - - A -

K R - V D I - -

H VDR

- P F N

-

D - K I T K D N

H - - A -

K R - V D I - -

-

- I I N K V T - N R - - Y -

Figure 1. Comparision of the DNA binding domain of clone 17 with that of seleceted other steroid receptors. Clone 17 contains an open reading frame of 454 amino acids with an initiating methionine and an in frame stop codon. The clone was transcribed and translated in vitro. The resulting [^SJ-methionine labeled protein had a molecular weight of 52 kDa as determined by electrophoresis on a 12% SDS-polyacrylamide gel. Additional studies are underway to determine the ligand for this receptor, its pattern of expression and its DNA recognition response element. 1. Lowe, K.E., Maiyar, A.C., and Norman, A.W. (1992) Crit. Rev. Eukar. Gene Exp. 2, 65. 2. Baker, A.R., McDonnell, D.P., Hughes, M., Crisp, T.M., Mangelsdorf, D.J., Haussler, M.R., Pike, J.W., Shine, J., and O'Malley, B.W. (1988) Proc. Natl. Acad Sei. USA, 85, 3294. 3. Goto, H., Chen, K. Prahl, J.M., and DeLuca, H.F. (1992) Biochim. biophys. Acta 1132, 103. 4. Burmester, J.K., Wiese, R.J., Maeda, N. and DeLuca, H.F. (1988) Proc. Natl. Acad. Sei. USA 85, 9499.

ISOLATION AND ANALYSIS OF cDNA ENCODING A NATURALLY-OCCURRING TRUNCATED FORM OF THE HUMAN VITAMIN D RECEPTOR L. STURZENBECKER1, B. SCARDAVILLE 1 , C. KRATZEISEN 1 , M. KATZ 1 , P. ABARZUA 2 , J. OMDAHL 3 , and J. McLANE 1 . Depts. of 1 Preclinical Dermatology Research & 2 Oncology, Hoffmann-La Roche, Nutley, NJ 07110 & 3 Dept. of Biochemistry, UNM School of Medicine, Albuquerque, NM 87131 INTRODUCTION 1,25(OH) 2 D 3 elicits a variety of changes in cell physiology. Some of these changes are initiated by activating the genomic functions of the known vitamin D receptor (VDR) (6, 9). Other 1,25(OH) 2 D 3 -induced changes (7, 8, 11) are linked to alternate, as yet unidentified, non-genomic mechanisms. In an effort to elucidate the mechanisms of action of 1,25(OH) 2 D 3 in human keratinocytes, a keratinocyte cDNA library was screened for VDRs. The VDR cDNAs isolated encoded a receptor which is (likely) 3 aa shorter at the amino terminus than the known VDR (1). As transactivating domains have been identified in the amino termini of some nuclear receptors (2, 3, 4, 10), we thought it possible that this truncated isoform of the receptor (tVDR) might possess biological properties different from those of the known VDR. Therefore, we studied the ligand binding, transactivation, and heterodimerization/DNA binding activities of tVDR relative to the known VDR. RESULTS AND DISCUSSION A human keratinocyte cDNA library was screened at high stringency for VDRs using the known VDR cDNA as probe (13). The inserts from three positive plaques were sequenced and found to differ from the previously published sequence by a T to C transition at base + 2 (1). This likely results in a 3 aa truncation at the amino terminus of the polypeptide. Next, human neonatal foreskin keratinocyte primary cultures were batched and the mRNA was subjected to RT-PCR and sequence analysis. Both a C and a T were identified at base + 2 . Thus, keratinocytes produced t w o VDR mRNA species which appeared to encode different polypeptides. The possible biological significance of the truncated VDR (tVDR) was investigated by comparing the ligand binding, transactivation and heterodimerization/DNA binding capacities of tVDR and VDR. Saturation binding analyses indicated that both receptors bound 1,25(OH) 2 D 3 with a K 0 of approximately 1 nM. In transiently transfected CV-1 cells, the t w o receptors induced transcription of t w o different reporter constructs (rat osteocalcin (VDRE) 3 -tk-luciferase and rat 24-hydroxylase promoter region-luciferase) to similar levels in a ligand-dependent fashion. In gel shift experiments, in vitro translated receptors bound the human osteocalcin VDRE comparably and only in the presence of RXR. Thus, tVDR»activity in each of these assays was comparable to that of the previously described VDR. Comparison

of VDR mnj HQS I cDNA

Sequences

Figure 1 VDR

-81

G C C T T T GGG TCT G A A GTG TCT GTG AGA C C T CAC

BOS 1

G C C T T T GGG TCT G A A GTG TCT GTG AGA C C T CAC

VDR

AO A AGA GCA C C C CTG GGC TCC ACT TAC CTG C C C

BQS1

von BOS1

AGA AGA GCA CCC CTG GGC TCC ACT TAC CTG C C C CCT G C T CCT TCA G G G I A T Q I G A G GCA ATG G C G G C C met g l u ala met sla ele C C T G C T CCT TCA G G G lACGl GAG GCA ATG G C G G C C met ale ala

+6 «3

VDR

AGC ACT TCC CTG CCT GAC CCT G G A GAC ser thr s e r leu p r o a s p p r o gly asp

GTG val

+421

BOS1

AGC ACT TCC CTG C C T GAC CCT G G A G A C ser thr ser leu p r o asp p r o gly asp

GGC val

+418

VDR

T T T G G C A AT GAG ATC TCC TGA ile ser *** phe gly asn glu

+ 427

BQS1

T T T G G C A AT GAG ATC TCC TGA ph« gly asn glu ile ser " '

+ 424

254 A .

O S T E O C A L C I N V O n E r T K - L U C CONSTRUCT

0.05

0.5

1

3

10

30

100

500

CONCENTRATION 1,25-DIHYDROXYVITAMIN D, 2D3 IN MEDIATING INTESTINAL CALCIUM TRANSPORT: THE USE OF ANALOGS TO STUDY MEMBRANE RECEPTORS FOR VITAMIN D METABOLITES AND TO DETERMINE RECEPTOR LIGAND CONFORMATIONAL PREFERENCES Anthony W. Norman^*, Murray Dormanen*, William H. Okamura^, MM * Marion Hammond"*, and Ilka Nemere Departments of Biochemistry* and Chemistry^, and Division of Biomedical Sciences^, University of California, Riverside, CA 92521 USA

Introduction: It is well established that la,25(OH)2-vitamin D3 [la,25(OH>2D3] is a hormonally active product of the vitamin D endocrine system (1). This seco steroid is now known to produce biological effects both via interaction with nuclear/cytosol receptors (nVDR) to regulate gene transcription (2) and via other membrane receptors which generate rapid biological responses, believed to be independent of direct interaction with the genome (3). Evidence has also been presented from a number of laboratories that 24R,25(OH)2-vitamin D3 [24R,25(OH>2D3] has important biological functions both acting in collaboration with la,25(OH)2D3 (4) as well as acting alone (5,6). This communication reports our ongoing studies concerning transcaltachia, or the rapid hormonal stimulation of intestinal calcium absorption (7). Previous reports have described mechanistic aspects of the process (8-10) and suggested that the receptor which mediates signal transduction for transcaltachia is associated with the intestinal epithelial basal lateral membrane (11,12); therefor it is postulated that this membrane receptor (BLM-VDR) is separate and distinct from the nuclear la,25(OH)2D3 receptor (nVDR) (13). Here we present evidence that transcaltachia can be initiated independently by either la,25(OH)2D3 or 24R,25(OH)2D3 and provide data describing the preferred ligand shape of the membrane receptor which is responsible for la,25(OH)2D3 stimulated transcaltachia. There are three unique structural features of the vitamin D steroids, including the hormones la,25(OH)2D3 and 24R,25(OH)2D3 which contrast with the rigid structures of the classical steroid hormones, e.g., estradiol, Cortisol, testosterone, progesterone and aldosterone (see Fig. 1). This includes the presence of an 8 carbon side-chain, a seco firing (the 9, 10-carbon-carbon bond is broken), and a conformationally active A-ring. Accordingly, vitamin D steroids display an unusual degree of conformational mobility. This conformational mobility of the vitamin D hormones then allows generation of a wide array of shapes which are available for binding to any potential receptors that may be involved with the generation of vitamin D-related biological responses; see Fig. 1.

325

Figure 1: Three key structural aspects of the seco-steroid la,25(OH)2D3 confer a unique range of conformational mobility on this molecule. (1A) The intact 8 carbon side chain of vitamin D3 and related seco-steroids can easily assume numerous shapes and positions by virtue of rotation about its many single bonds. The "dots" indicate the position in three-dimensional space of the 25-hydroxyl group for some 394 readily identifiable side chain conformations. A discussion of the consequences of the side-chain conformational mobility has been previously presented (14, 15). (IB) The cyclohexane-like A-ring is free to rapidly interchange between a pair of chair-chair conformers effectively equilibrating the key l a and 36 hydroxyls between equatorial and axial orientations (16). (1C) Rotational freedom about the 6-7 carbon-carbon bond of the seco B-ring allows conformations ranging from the more steroid-like 6 - s - m conformation to the open and extended 6-s-trans form of the hormone (17).

326 Figure 2 presents the structures of the various analogs of la,25(OH)2D 3 which are discussed in this communication.

1,25-(OH) 2 -D 3

24R,25-(OH)rD3

JM 1a,25-(OH)r7-DHC

25-(OH)-16-ene-23-yne-D 3

JM 1a,25-(OH) 2 -Lumisterol3

Figure 2: Structures of analogs discussed in this paper, (alphabetical order according to their one- or two-letter designations): AS [24R,25(OH)2D3], AT [25(OH)-16-ene-23-yne-D 3 ], BO [25(OH)D 3 ], C [la,25(OH) 2 D 3 ], HF [l,25(OH)2-d 5 -pre-D 3 ], JM [la,25(OH) 2 -7-dehydrocholesterol], and JN [la,25(OH)2-lumisterol 3 ].

327

The earlier report of Norman et al. (17) on the ability of a "6-s-cis" locked analog (HF) to efficaciously promote transcaltachia, prompted the evaluation of two additional analogs, J M and JN, which are permanently locked in a 6-s-cis orientation (see Fig. 2). It should be noted that J M and JN are not seco steroids, since the 9, 10 carbon-carbon bond is intact; they are, in reality, provitamins by virtue of the presence of a A5,A7 double bond system. When J M and JN were separately introduced at 300 pM into the perfused intestinal system (18), it was found (see Fig. 3A) that JN was a full agonist, i.e. equipotent to la,25(OH)2D3, while J M was only a weak partial agonist of transcaltachia. This is the first demonstration of vitamin D biological activity for a provitamin. Also, the difference in activity (JN>JM) suggests that the putative membrane receptor for transcaltachia can recognize differences in the structure of analog JN versus analog JM.

O—O CONTBOL t 1—i—r •—• 300 DM I.^SIOHIjOJ 4 9000 pM ?3 depend on continous activation of protein kinase C. METHODS Myoblast cultures were prepared by controlled trypsin digestion of breast muscle from 12-day-old chick embiyos as previously described (1). Cells (70% confluency) were prelabeled with pH]choline (2 uCi/ml) or PH]arachidonic acid (1 uCi/ml) for 48 ns and then stimulated with agonists. After treatment, lipids were extracted according to Folch (2). pH]choline-labelled metabolites were separated by TLC (3) and radioactivity counted by liquid scintillation. Phospholipase D activity was determined measuring phosphatidylethanol (PEt) production (4). RESULTS AND DISCUSSION l,25(OH)2D3-stimulated phosphatidylcholine (PC) hydrolysis was examined in chick myoblasts. Conclusive evidence demonstrating a role for l,25(OH)2D3stimulable PLD was obtained assessing the formation of [->H]PEt m 3 H]arachidonate-labelled cells incubated in the presence of 1.5% ethanol. The lormone increased PHjPEt formation in a time ana dose-dependent manner (Fig. 1). The effects of l,25(OH)2D3 were specific since other vitamin D3 metabolites: 25OHD3 and 24,25(OH)2D3 failed to produce PEt accumulation (data not shown). We also explored the participation of transmembrane signals as cofactors for hormone-stimulable PLD. The phorbol ester TPA (100 nM), a well known activator of PKC, stimulated PEt accumulation in myoblasts (+123%, 15 min). The response to the combined stimulation with TPA and l,25(OH)2E>3 was significantly greater (+280%) than each individual response. In addition, PKC inhibitor H7, completely suppressed TPA effects but did not alter l,25(OHbD3-accumulation of PEt. Down regulation of PKC prevented the accumulation of PEt induced by the phorbol ester w file did not affect l,25(OH)2D3 action. Simultaneous exposure 01 cells to the

t

348

FIG. 1 Time course (panel A) and dose-response (panelB) of l,25(OH) 2D3-.stimulated /3H]PEt formation in chick myoblasts

• CONTROL 1 GDP pS • 1,25 (OH^Qj 1I0"®M I ! GDP PS * 1,25(OHL Dj 0GTP8 S IX» y Ml 3.0

¡3 o

2.0

1.0

10""

10"" XT" 10"' 1.25 (OH^DjIM0LARI

I

FIG. 2 G protein-mediation of l,25(OH)2D3-stimulation of PLD activity in chick myoblasts

hormone and TPA in PKC-down regulated cells, increased PEt production to the same extent than the hormone alone. The effect of the hormone on PEt accumulation was dependent on extracellular Ca2 + as it was potently inhibited by EGTA and the Ca2+-channel blockers nifedipine and verapamil. AIF4", a known stimulator of G proteins, increased myoblast PLD activity in a dose-dependent fashion ( 2 5 - 5 0 % ; 2.5-5 mM). As shown in Fig.2, the non-nydrolyzable analogues GTPyS mimicked and GDPBS abolished l,25(OH)2D3-dependent PLD activity. In addition, Pertussis toxin suppresed by 92% hormone-dependent PEt accumulation. In conclusion, these results indicate tnat 1,25(OH)2Dj is capable of stimulating the rapid hydrolysis of PC by a Ca2 + -dependent, PRC-independent PLD-catalyzed mechanism which involves a Pertussis toxin sensitive guanine-nucleotide binding regulatory protein. REFERENCES l .-Morelli S., de Boland A.R. and Boland R. (1993) Biochem J 289,675-679. 2.-Folch J., Lees M. and Sloane-Stanley G.H. (1957) J Biol Chem 226, 497-509. 3.-Liscovitch M (1989) J Biol Chem 264, 1450-1456. 4.-Liscovitch M. and Amsterdam A (1989) J Biol Chem 264, 11762-11767.

RAPID NON-GENOMIC EFFECT OF la,25-DIHYDROXYVITAMIN D3 ON OSTEOBLAST NUCLEI A. M. SORENSEN, D. T. BARAN, Department of Orthopedics, University of Massachusetts Medical Center, Worcester, Massachusetts 01655, USA. Introduction. la,2 5-Dihydroxyvitamin D 3 (la,25(OH)2D3) rapidly increases calcium levels in nuclei isolated from hepatocytes (1) and osteoblast-like cells (2). ATP also increases calcium levels in nuclei isolated from hepatocytes (1,3). Both la,25-(OH)2D3 and ATP activate phospholipase C in osteoblastlike cells resulting in inositol triphosphate generation (46). The purpose of this study was to determine the effects of la,25-(OH)2D3 and ATP on phospholipid metabolism in nuclei isolated from osteoblast-like cells. Methods. Cell Cultures: Osteoblast-like rat osteosarcoma cells, ROS 17/2.8 were grown in culture medium consisting of DMEM:F12(50:50) plus 10% fetal calf serum. Cells were grown for 6-7 days and harvested for experiments by trypsinization with 0.25% trypsin and 0.002% EDTA. ROS 17/2.8 cells were suspended in ice cold hypotonic swelling buffer [10 mM KC1, 30 mM Tris/HCl (pH 7.9) , 5 mM MgCl 2 , and 10 mM BME] for 2 0 minutes prior to homogenization. This produced 95-98% recovery of intact nuclei viewed at 100-fold magnification. Results. la,25-(OH) 2 D 3 , 20 nM, significantly increased 3 Hinositol triphosphate ( 3 H-IP 3 ) levels in the nuclear envelope after 5 minutes (65+14 vs 77+15 cpm/5 X 106 nuclei, p : . which represent the effective dose achieving 50% response. N . R . - E D W was not reached even at 1 0 M .

Induction of differentiation of breast cancer cell lines. T h e analysis of differentiation of breast cancer cells was determined by the expression of lipid in these cells after e x p o s u r e to V D 3 and

444 V D 3 analogs (10" 7 M ) for three days (Table 2). A p p r o x i m a t e l y 10 % of control cells expressed lipid. E x p o s u r e to V D 3 increased the n u m b e r of positive cells to 2 8 - 8 9 % lipid positive staining cells in t h e cell lines. T h e m o s t potent inducer of differentiation w a s K H 1060 with b e t w e e n 3 0 and 9 0 % of t h e cells b e c o m i n g lipid positive in the various lines. T h e M C 1288 and H M w e r e t h e next m o s t potent c o m p o u n d s , and analog V was in general only slightly m o r e potent than V D 3 . D i f f e r e n t i a t i o n w a s also assessed by analysis of expression of casein; t h e result paralleled t h o s e observed f o r Oil red O method of visualization of lipids. Interestingly, the V D 3 c o m p o u n d s and in particular K H 1060 induced differentiation of B T 2 0 and M D A - M B - 4 3 6 . F o r e x a m p l e , 7 0 to 80 % of t h e s e cells b e c a m e lipid positive in the p r e s e n c e of K H 1060. In contrast, t h e s e cells w e r e resistant to t h e antiproliferative affects of the analogs. T h i s suggests a disassociation between induction of differentiation and inhibition of proliferation of these breast cancer cells. Induction of apoptotic cell death by K H 1060 in breast cancer cell lines. T h e strong antitumor effect of K H 1080 o n breast cancer cells may b e caused by apoptosis. T o test this hypothesis, w e m e a s u r e d D N A f r a g m e n t a t i o n as a m a r k e r for apoptosis in our study. N o D N A f r a g m e n t a t i o n was detected in B T 4 7 4 (low ER-positive) and M D A - M B - 2 3 1 ( E R - n e g a t i v e ) cells after 4, 2 4 , 4 8 and 7 2 h o u r s of incubation with KH 1060 (10 6 M). In M C F - 7 u n d e r t h e s a m e conditions, D N A f r a g m e n t a t i o n occured after 48 and 72 h o u r s of incubation with t h e V D 3 analog. Table 2. Induction of differentiation of breast cancer cell lines by VD3 compounds (lipid visualization) Lipid positive cells (%) Breast cancer cell lines

control

VD3

KH 1060

MC 1288

HM

V

MCF-7

6 ± 3

13 ± 6

28 ± 5

18 ± 7

14 ± 4

12 ± 5

BT474

12 ± 4

20 + 9

62 ± 1 0

29 ± 6

50 + 4

26 ± 5

MDA-MB-231

4 ± 2

7 ± 4

59 + 6

30 ± 7

50 + 14

13 ± 5

MDA-MB-361

8 ± 3

25 ± 3

69 ± 7

50 ± 6

39 ± 8

35 ± 4

SK-BR-3

10 ± 5

18 + 6

70 ± 12

46 ± 7

35 ± 8

20 ± 10

BT20

5 ± 4

35 ± 14

69 ± 8

55 ± 12

59 ± 16

20 + 5

MDA-MB-436

3 ± 4

5 + 4

89 ± 14

50 ± 7

69 + 10

16 ± 6

V D 3 compounds were tested in suspension culture at 1 0 ' M for three days. Results represent the mean + SD of lipd positive cells in three independent experiments.

D i s c u s s i o n . In this study, w e examined the biological profiles of four potent V D 3 analogs o n clonal proliferation and differentiation of seven breast cancer cell lines in vitro. T h e results a r e s u m m a r i z e d in T a b l e 3. All breast cancer cell lines h a v e receptors for V D 3 . T h e K H 1060 w a s t h e m o s t potent inhibitor of clonal g r o w t h irrespective of E R status of the breast cancer cells. T h i s d r u g belongs to a n e w class, 20-epi-vitamin D 3 analogs, which are considerably m o r e potent than V D 3 . T h e alteration of steriochemistry at carbon 2 0 on the side chain, is a p r o m i n e n t d i f f e r e n c e between V D 3 and the 20-epi-vitamin D , analogs. A p r e v i o u s study has suggested that these 20-epi-analogs are potent inhibitors of g r o w t h and inducers of differentiation of U 9 3 7 monoblasts; they also strongly d o w n - m o d u l a t e cytokine-mediated T -

445 lymphocyte activation (21). The other 20-epi-vitamin D 3 analog (MC 1288) is also very active in inhibiting clonal proliferation and inducing differentiation of both breast cancer cells (Tables 1,2) as well as myeloid leukemic cells in vitro (37). The reasons for this increased potency are presently unknown. The KH 1060 binds with similar affinity as VD3 to VDR preparations from intestinal cells and a number of cultured tumor cells (21). Our previous transactivation studies using a reporter gene containing a vitamin D 3 response element (VDRE) strongly suggested that the difference between MC 1288 and VD3 cannot be ascribed to differential abilities either to enter the cells or to bind VD3 receptors (37). Most likely, the increased potency is associated with post-receptor binding effects, such as either increased metabolic stability of the receptor-drug complex, higher affinity for the DNA-binding site, or alteration of the conformation of the receptor after binding of the ligand (21,43). The other possibility is that the 20-epi-vitamin D 3 -VD3 receptor complex may interact with different VDREs than those recognized by VD3-VDRs. Recently, evidence has accumulated to suggest that some effects of the VD3 analogs may be mediated independent of the VD3 nuclear receptor. For example, several VD3 analogs have been found to cause intracellular C a + + fluxes through a non-genomic mechanism which is independent of the classical pathway of receptor mediated activity (45). However, previous data by ourselves suggested that MC 1288 mediates its effects through the classical VD3 receptor pathway (37). The breast cancer cell lines in our study have different sensitivities to the inhibitory effects of VD3 compounds. The most sensitive lines were MCF-7 and SK-BR-3 cells. The MDA-MB-231 cells were relative resistant to VD3, HM and V, but showed a good response to KH 1060. MDA-MB-436 and BT20 lines were resistant to the antiproliferative effect of all the V D 3 compounds. Shabahang et al. provided data that well-differentiated cancer cell lines demonstrated higher levels of VD3 receptors than the poorly differentiated cells (46). In our study, all the cell lines had immunologically detectable VD3 receptors; number and affinity of these receptors were not measured. Table 3. Summary of effects of VD3 compounds on breast cancer cell lines in vitro Breast cancer cell lines

ER*

Vitamin D3 receptors

Inhibition of clonal proliferation"

Induction of differentiation lipid casein

DNA fragmentation

MCF-7

+

+

+

t

t

+

BT474

±

+

+

t t

t

-

MDA-MB-361

+

+

+

t t

t

MDA-MB-231

-

+

+

t t

t

SK-BR-3

-

+

+

t t

t

N.D.

BT20

-

+

-

t t

t

N.D.

MDA-MB-436

-

+

-

t t

t

N.D.

N.D. -

* Estrogen receptor (ER) - data from Ceriani et al. 1992 and Grunt (personal communication). • • B r e a s t cancer cells were cultured in agar for 14 days in the presence of V D 3 compounds ( 1 0 " - 10* M ) . N . D . , none done.

Analysis of differentiation of breast cancer cell lines, as measured by expression of both lipid and casein markers, showed that VD3 compounds induced differentiation in all of the breast

446 cancer cell lines. The most potent inducer of differentiation was KH 1060. Interestingly, KH 1060 caused the differentiation of 69-89 % of BT20 and MDA-MB-436 cells; in contrast, these cell lines were resistant to the antiproliferative effects of the same analogs in clonogenic assay. This suggests that breast cancer cells undergoing measurable differentiation, can still actively proliferate. Apoptosis was studied in several breast cancer cell lines after different times of incubation with KH 1060. Since maintenance of cell numbers reflect a balance between cell division and apoptosis, the uncontrolled growth of tumors may result from either an increase in proliferation or a decrease in apoptosis, or both. Therapeutic agents which induce tumor regression may do so via either inhibition of proliferation or activation of apoptosis. No apoptosis, as measured by DNA fragmentation, was detected in BT474 and MDA-MB-231 cells after their exposure for 4, 24, 48 and 72 hours to a high concentration (10'6 M) of KH 1060. This suggests that the prominent antitumor effect of KH 1060 in these breast cancer cell lines was independent of apoptosis. In contrast, apoptosis occured in MCF-7 cells after 48 and 72 hours of incubation with this analog. Apoptosis is an active process and depends on expression of a specific set of genes (47). Expression of wild-type p53 is associated with induction of apoptosis (48,49). Mutant p53 can inhibit apoptosis (50). Breast cancer is a result of progressive accumulation of many different somatic mutations in diverse genes such as oncogenes and tumor suppressor genes. Alterations in p53 expression are frequently found in breast cancer patients (51,52). About 30 to 50 % of the cases have a mutant p53 gene and nearly an addition 30 % have a nonfunctional wild type p53 because the protein is in the cytoplasm of tumor cells (53). Patients with p53 mutations in inflammatory breast carcinoma have a poor prognosis (54). Breast cancer cell lines with overexpression of p53 have significantly higer levels of metastasis to the lung when transplanted subcutaneously into animals (55). The BT474 and MDA-MB-231 which had no apoptosis in the presence of high concentrations of KH 1060, contain a mutant form of p53. In contrast, MCF-7 which undergoes apoptosis after exposure to KH 1060, has a wild-type p53 (56). In summary, we have identified a group of VD3 analogs (especially KH 1060) with potent effects on proliferation and differentiation of breast cancer cells in vitro: these analogs should be studied in vivo in appropriate breast cancer model systems. References 1. 2. 3. 4. 5. 6. 7.

Henderson, G. (1984) In: Bonadonna, G. ed., vol 1. Chichester Wiley. 229-280. Manni, A. (1987) In: Ariel, I.M., Cleary, J.B. eds., New York: McGraw-Hill Book Co. 119-127. Zhang, Q.X., Borg, A., Fogua, A.W. (1993) Cancer Res. 53,5882-5884. Berger, U., Wison, P., McClelland, R.A., Colston K., Haussler M.R., Pike W., and Coombes C. (1987). Cancer Res. 47, 6793-6799. Eisman, J.A., Martin, T.J., Maclnyre, I., Frampton, R.J., Moseley, J.M. and Whitehead, R. (1980) Biochem. Biophys. Commun. 93, 9-15. Feldman, D, Chen, T., Hirst, M., Colston K., Karasek, M. and Cone, K. (1980) J. Clin. Endocrinol. Metab. 51, 1463-1465. Baker, A.R., McDonnell D.P., Hughes, M., Crisp, T.M., Mangelsdorf, D. J., Haussler, M.R., Pike J.W., Shine, J. and O'Malley B.M. (1988) Proc. Natl. Acad. Sci. USA.85, 3294-3298.

447 8. 9.

10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31.

32. 33. 34. 35. 36.

Minghetti, P . P . and Norman, A . W . (1988) F A S E B . 2, 3043-3053. Haussler, M . R . , Mangelsdorf, D . J . , Komm, B.S., Terpening, C . M . , Yamaoka, K . , Allegretto, E . A . , Baker, A . R . , Shine, J . , McDonnell, D . P . , Hughes, M . , Weigel, N . L . , O ' M a l l e y , B . W . and Pike, J . W . (1988) Recent Prog. H o r m . Res. 44, 263-305. Colston, K . W . , Colston M . J . , Fieldsteel, A.H. and Feldman, D . (1982) Cancer Res. 42, 856-859. Eisman, J . A . , Martin, T . J . , Maclntyre, I. and Moseley, J . M . (1979) Lancet 2, 13351336. Frampton, R . J . , Omond, S.A. and Eisman, J . A . (1983) Cancer Res. 43, 4443-4447. Abe, J . , Nakano, T . , Nishii, Y . , Matsumoto, T . , Ogata, E . and Ikeda, K. (1991) Endocrinology 129, 832-837. Eisman, J . A . , Barkla, D . H . and Tutton, P . J . M . (1987) Cancer Res. 47, 21-25. Colston, K . W . , Berger, U. and Coombes, R . C . (1989) Lancet 1, 188-191. Bower, M . , Colston, K . W . , Stein, R . C . , Hedley, A., Gazet, J . - C . , Ford, H . T . and Combes, R . C . (1991) Lancet 337, 701-702. H o n m a , Y „ Hozumi, M. and Abe, E. (1983) Acad. Sci. USA 80, 201-204. Sato, T . , Takusagawa, K., Asoo, N. and Konno, K. (1984) Br. J. Cancer 50, 123-125. Zhou, J . - Y . , Norman, A . W . , Chen, D . - L . , Sun, G., Uskokovic, M . and Koeffler H . P . (1990) Proc. Natl. Acad. Sci. USA 78, 3929-3932. Frappart, L . , Falette, N . , Lefebvre, M . F . , Bremond, A., Vauzelle, J . L . and Saez, S. (1989) Differentiation 40, 63-69. Binderup, L . , Latini, S., Binderup, E . , Bretting, C., Calverley, M. and Hansen, K. (1991) Bioch. Pharmacology 42, 1569-1575. Mathiasen, I.S., Colston, K . W . , Binderup, L . (1993) J. Steroid Biochem. Molec. Biol. 46, 365-371. Dokoh, S., Donaldson, C . A . and Haussler, M . R . (1984) Cancer Res. 44, 2103-2109. Abe, E . , Miyaura, C., Sakagami, H., Takeda, M., Konno, K., Yamazaki, T . , Yoshiki, S. and Suda, T . (1981) Proc. Natl. Acad. Sci. USA 79, 4990-4994. Miyaura, C . , Abe, E . , Kuribayashi, T . , Tauaka, H . , Konno, K., Nishii, Y. and Suda, T . (1981) Biochem. Biophys. Commun. 102, 937-943. Brehier, A and Thomasset, M. (1988) J. Steroid, biochem. 29, 265-270. Norman, A . W . , Zhou, J . H . , Henry, H . L . , Uskokovic, M . R . and Koeffler, H. P. (1990) Cancer Res. 50, 6857-6864. Kragball, K. and Wildfang, I. (1990) Dermatol. Res. 282, 164-167. Ollson, J . , Gulberg, U . , Ivhed, J. and Nilsson, K. (1983) Cancer Res. 43, 5862-5867. Manglesdorf, D . , Koeffler, H . P . , Donaldson, C . A . , Pike, J . W . and Haussler, M . R . (1984) J. Cell. Biol. 98, 391-398. McCarthy, D . J . , Hibbin, J . F . , San Miguel, J . F . , Freake, H . C . , Rodriguez, B., Andrews, C . , Pinning, A., Catovsky, D. and Goldman, J . M . (1984) Int. J. Cell Cloning 2, 227-242. Koeffler, H . P . , Armatruda, T . , Ikekawa, N., Kobayashi, Y. and DeLuca, H . F. (1984) Cancer Res. 44, 5624-5628. Binderup, L . and Bramm, E. (1988) Biochem. Pharmac. 37, 887-895. Abe, J . , Morikawa, M . , Miyamoto, K., Kaiho, S., Fukushima, M . , Miyaura, C., Abe, E . , Suda, T . and Nishii, Y. (1987) FEBS Lett. 226, 58-62. Ostrem, V . K . , Tanaka, Y., Prahl, J., DeLuca, H . F . and Ikekawa, N. (1987) Proc. Natl. Acad. Sci. USA 84, 2610-2614. Colston, K . W . , Mackay, A . G . , James, S . Y . , Binderup, L . , Chander, S. and Coombes, R . C . (1992) Biochem. Pharmacol. 44, 2273-2280.

448 37. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. 55.

Elstner E., Lee, Y.Y., Hashiya, S., Pakkala, S., Binderup, L., Norman, A. W., Okamura, W. and Koeffler, H.P. (1994) Blood (in press). Kuguchi, K., Giometti, C., Chubb, C.H., Fujiki, H. and Huberman, E. (1992) Biochem. and Biophisic. Res. Communic. 189, 1261-1267. Sheehan, D.C. (1980) In: Theory and Practice of Histotechnology, 2nd ed. C.V. Mosby Compant, St. Louis, 209. Bacus, S.S., Kiguchi, K., Chin, D., King, C.R. and Huberman, E. (1990), Molec. Carcinogenesis 3, 350-362. Sellins, K.S. and Cohen, J.J. (1987) J. Immunol. 139, 3199-3206. Umiel, T. (1994) Cancer Res. (submitted) Inaba, M., Okuno, S., Inoue, A., Nishizawa, Y., Morii, H. and DeLuca, H.F. (1989) Arch. Biochem. Biophys. 268, 35-39. Ceriani, R.I., Peterson, A., Blank, E., Chan, C.M., Cailleau, R. (1992) In Vitro Cell. Dev. Biol. 28A, 397-402. Zhou, L.X. Nemere I., and Norman, A.W. (1992) J. Bone Miner. Res. 7, 457-463. Shabahang, M., Buras, R.R., Davoodi, F., Schumaker, L.M., Nauta, R.J. and Evans, S.R.T. (1993) Cancer Res. 53, 3712-3718. Raff, M.C. (1992) Nature (Lond.) 356, 397-400. Yonish-Rouach, E., Rensmitzki, D., Lotem, J., Sachs, L., Kimchi, A. and Oren, M. (1991) Nature (Lond.) 352, 345-347. Shaw, P., Bovey, R., Tardy, S., Sahli, R., Sordat, B. and Costa, J. (1992) Proc. Natl. Acad. Sci. USA 89, 4495-4499. Lotem, J. and Sachs, L. (1993) Cell Growth & Differ. 4, 41-47. Crawford, L.V., Pim, D.C. and Lamb, P. (1984) Mol. Biol. Med. 2, 261-272. Cattoretti, G., Rilke, F., Andreola, S., D'Amato, L. and Delia, D. (1988) Int. J. Cancer 41, 178-183. Moll, U.M., Rion, G. and Levine, A.J. (1992) A. J. Proc. Natl. Acad. Sci. USA 89, 7262-7266. Riou, G., LS, M.G., Travagli, J.P., Moll, U.M. and Levine, A.J. (1994) AACR Abstract 1314. Mehta, R.R., Graves, J.M. and Das Gupta, T.K. (1994) AACR Abstruct 286. 56.Bartek, J., Iggo, R., Gannon, J. and Lane, D.P. (1990) Oncogene 5, 893-899.

TERMINAL DIFFERENTIATION OF HUMAN LEUKEMIA CELLS (HL60) BY A COMBINATION OF 1,25-DIHYDROXYVITAMIN D3 AND RETNOIC ACID (ALL TRANS OR 9-CIS).

A.Verstuyf, C.Mathieu, L.Verlinden, B.T.Keng and R.Bouillon. Lab. Exp. Med.& Endocrinology (LEGENDO) , K.U. Leuven, Belgium. Introduction

The active form of vitamin D is an important inhibitor of cell proliferation and stimulator of cell differentiation when added to the human promyelocytic leukemia cell line HL60 (1) . Similar effects are observed with other substances such as all trans retinoic acid and 9-cis retinoic acid (2) . These hormones achieve their effects through interaction with their respective receptors (VDR, RAR, RXR), members of the same steroid/thyroid hormone superfamily. The aim of this study was to evaluate the effects of a combination of l,25(OH)2D3 and retinoic acid (all trans or 9cis) on proliferation and differentiation of HL60 and to test the reversibility of the induced differentiation. Methods

HL60 cells were cultured in RPMI 1640 medium supplemented with 20% heat inactivated FCS and Gentamycin (50/ig/ml) . Cells (lxl05/ml 80cm2 Falcon) were incubated with the drugs for 4 days or 6 days for the reversibility tests in a humidified atmosphere of 5% C02 in air at 37oc. The HL60 cells were thereafter incubated in the above described medium in the absence of the test substances for another 48 or 96 hours. Cell proliferation was assessed by measuring methyl [3H] thymidine incorporation. The functional capacity of the HL60 cells was tested via the NBT reduction test. The presence of cell surface markers was evaluated by monoclonal antibodies (CD14,HLA-DR,CD24,CD67) as described (J. Steroid Bioch. Mol. Biol., in press). Results

The cell proliferation was inhibited as expected by l,25(OH)2D3 and retinoic acid alone (IC50 of cell suvival was 4xlO~7M, 9xl0"6 M and 9xlO_7M for l,25(OH)2D3, all trans and 9cis retinoic acid, respectively). Combination of l,25(OH)2D3 and either form of retinoic acid resulted in a partially additive decrease in cell proliferation. The functional capacity of the HL60 cells was tested via the NBT reduction test and there exists a dose dependent induction of functional differentiation by l,25(OH)2D3 and retinoic acid (all trans or 9-cis). Fig. 1 shows the additive effect between l,25(OH)2D3 and retinoic acid. NBT reducing activity was increased from 65%, 81%, and 88% with l,25(OH)2D3 , all trans retinoic acid and 9-cis retinoic acid alone, respectively to 100% upon combination of l,25(OH)2D3 with all trans retinoic acid or 9cis retinoic acid. l,25(OH)2D3 induced a monocytic differentiation (100% CD14+ cells with lO'TVt 1,25 (OH)2D3) ,

450 CD14

granulocytic while retinoic acid led to a predominantly differentiation (36% and 42% CD67+ cells with 10~6M all trans and 9-cis retinoic acid respectively). Additive effects on differentiation were observed upon combination of the drugs, achieving a mainly monocytic differentiation (100% CD14+ cells) . The effects on proliferation and differentiation were reversible, while the combination of drugs resulted in a persitant proliferation arrest and a differentiation that improved after withdrawal of the drugs (Fig.l). Discussion In the present study, we investigated the effects of combining l,25(OH)2D3 and retinoic acid (all trans or 9-cis) on the human promyelocytic leukemia cell line HL60. The direction of the induced differentiation was mainly monocytic for 1,25 (OH) 2D3 and mainly granulocytic for both stereoisomers of retinoic acid. The induction of mixed monocytic/granulocytic features on HL60 cells by retinoic acid has already been observed preveously, since it has been demonstrated that retinoic acid could induce the c-fms gene in HL60 cells (3) . After withdrawal of retinoic acid from the culture supernatant, this monocytic differentiation became even more pronounced. Upon combination of l,25(OH)2D3 and retinoic acid the main direction of differentiation was clearly monocytic. For the period we examined, the achieved differentiation stage is final and persistent, with even progression of differentiation to more mature stages and cell death, after removal of the drugs from the culture medium. References 1.McCarthy,DM.,San Miguel,JF.,Freake,HC. et al.(1983) Leuk.Res.7:51. 2.Warrell, RP. Jr,De The,H.,Wang, ZY.,Degos, L. (1993) 329:177-190. 3.Hsu, HC., Yang, K., Kharbanda, S. et al. Leukemia (1991) 7:458.

1,25-DIHYDROXYVITAMIN D3 INDUCES GROWTH OF THYROID C CELLS AND INHIBITS CALCITONIN SECRETION IN VITRO M. Lazaretti-Castro*, J.G.H. Vieira*, F. Raue#, Division of Endocrinology*, Escola Paulista de Medicina, Sao Paulo, Brazil and Dept. of Internal Medicine I#, Universität Heidelberg, Germany. Introduction: Medullary thyroid carcinoma is a tumor of thyroid gland C cells and in most patients is characterized by high levels of serum calcitonin (CT) and slow growth, indicating a relative well differentiated carcinoma. In some patients, however, this tumor shows an aggressive behavior, with rapid progression and lower CT levels. This inverse correlation between growth rate and CT production has been demonstrated in the TT cells (1), a unique culture of a human C cell carcinoma (2). During the logarithmic growth phase, TT cells produce lower levels of CT peptide and mRNA and in confluent cells the secreted CT and CTmRNA levels rise (1), showing that CT synthesis is inversely linked to growth rate. 1,25-Dihydroxyvitamin D (1,25D3) has a direct suppressive effect on CT gene expression (3), but no reference to its effect on cell growth has been made. 1,25D3 has been described as a modulator of cell growth and differentiation in many tissues, thus, we investigated the effects of 1,25D3 on TT cell growth and on CT secretion. Methods: TT cells were cultivated as described previously (4). 1- 72 h prior to the experiment, cells were subcultured in plates in RPMI 1640 medium supplemented with 16% charcoal-stripped FCS and 0.01 M Hepes buffer. 1,25D3 and 24,25D3 were added to the medium in different concentrations over a dose range of 0.01 to 100 nM. After 4 days cells were washed with PBS buffer and fresh medium was added for another 2 h and subsequently removed. The medium was stored at -20"C for CT determination by radioimmunoassay (RIA). The total cellular protein was determined. 2- TT cells were subcultured in plates and maintained as described above. After 72 h, different concentrations of 1,25D3 and 24,25D3 were added to the cells for 48h. The medium was then withdrawn, the cells were washed and incubated for 30 min in HBBS buffer with 1 % BSA, removed and fresh buffer containing 3 mM Ca'' plus 50 mM K was added again to the cells. After 30 min the buffer was removed and stored for CT determinations (depolarization of the cells with potassium was used to increase cytosolic calcium because the TT cell line does not respond to increases in extracellular calcium (5)). 3- In another experiment, 24 h after incubation of the cells with different concentrations of 1,25D3 and 24,25D3, 1 nCi/well of iH-methyl thymidine was added. Three hours later the medium was removed and the cells were washed twice with ice-cold 5% trichloroacetic acid (TCA); 0.5 ml/well of 0.25 M NaOH was then added, the cells were mechanically detached, the suspension was transferred to scintillation vials containing 4.5 ml of scintillation solution, and radioactivity counted for 1 min. Data were analyzed statistically by the Wilcoxon test, with the level of significance set at P 5 a 'u a 0

3 3.0 E E 2.8 i 2.6

2D levels in association with solid tumours Squamous cell lung cancer Little is known about vitamin D metabolism in malignancy-associated hypercalcaemia in solid tumours. Plasma levels of l,25(OH)2D have usually been reported as depressed in HHM. Hypercalcaemia is often associated with raised levels of PTHrP, the major tumour factor implicated in HHM; PTHrP has, however, been reported in animal experiments as stimulating renal synthesis of l,25(OH)2D. This effect might be predicted in view of the N-terminal homology and similarity of biological action between this hormone and PTH. Other factors may militate against the synthesis of l,25(OH)2D, particularly the raised calcium level. In addition, a tumour-derived factor has been described which appears to inhibit l,25(OH)2D synthesis (30). We were therefore surprised to find that 5 out of 10 patients with severe hypercalcaemia associated with squamous cell lung cancer had frankly elevated serum l,25(OH)2D concentrations, 72-115 pg/ml (reference range 20-50 pg/ml), the remaining 5 patients had l,25(OH)2D values from 1-19 pg/ml. All the values for PTHrP (1-86) were raised, but no relationship could be discerned between these measurements and the values for l,25(OH)2D. The only significant relationship was with serum 25(OH)D, suggesting that substrate concentration was important, and raising the possibility that this synthesis of l,25(OH)2D was extra-renal. Further support for this concept came from one patient who was treated for hypercalcaemia with the bisphosphonate, APD. The subsequent lowering of serum calcium had no effect on l,25(OH)2D, as might have been expected, despite the fact that PTH rose on treatment (Fig 6). This lack of control by calcium and PTH would be compatible with non-renal synthesis. Figure 6. The effect of bisphosphonate (APD) on serum calcium, PTHrP, l,25(OH)2D and PTH in a hypercalcaemic patient with squamous cell lung cancer. 120" E a 100" n. 80" D 60" as 40o in 20fH o4 60-1 E "Rh 40o.

,

•

APD

API)

S H ?neu 3

4

Days

0-1 c

3

4

Days

Breast cancer In contrast to the high serum levels of l,25(OH)2D seen in some patients with lung cancer, all the hypercalcaemic patients we have investigated with breast cancer, have had suppressed concentrations of the hormone (31). Patients with early breast cancer, on the

492 other hand, have raised l,25(OH)2D levels in about one-third of cases (Fig 7a) The origin of this l,25(OH)2Ö is at present unknown. In view of the known anti-proliferative properties of l,25(OH)2D, by receptor-mediated actions, we have a prospective study under way to investigate any potentially beneficial action of higher l,25(OH)2D levels on the course of the disease. Preliminary results suggest that in advanced breast cancer, serum l,25(OH)2D levels may be related to clinical response to treatment; patients who responded well had higher l,25(OH)2D concentrations than poor responders (Fig 7b) although it is too early to know whether there is a causal relationship.

Summary The synthesis of l,25(OH)2D in extra-renal sites may be of clinical significance. In inflammatory arthritis, l,25(OH)2D produced locally in the synovial joint by activated M 0 s may have an anti-inflammatory effect. Vitamin D treatment which increases SF l , 2 5 ( O H ) 2 D levels results in a decrease in M 0 count which is a measure of the inflammatory response. The control of M 0 l,25(OH)2D synthesis is complex, depending on cytokines and eicosanoids, offering possibilities for therapeutic intervention. Hypercalcaemia is rare in inflammatory arthritis, probably reflecting the relatively small number of cells involved in l,25(OH)2D synthesis, and its general restriction to local sites. The site of extra-renal synthesis of l,25(OH)2D in lymphoma is not well defined, but is probably either the lymphoma cells themselves or M0s associated with them. In this condition cell numbers are such that, provided there is an adequate supply of substrate, nonrenal l,25(OH)2D contributes to the systemic pool, raising the concentration to supranormal values, so that hypercalcaemia may be a fairly frequent result. The contribution of l,25(OH)2D to hypercalcaemia associated with solid tumours is not yet clear, but the role of the hormone in this condition may be more important than was formerly believed. The possibility that raised l,25(OH)2D in certain types such as breast cancer may have an effect on the course of the disease requires further investigation. References 1. 2. 3. 4.

Fraser, D.R. and Kodicek, E. (1970) Nature 228, 753-766. Whitsett, J.A., Ho, M„ Tsang, R.C., Norman, E.J.(1981) J. Clin. Endocrinol. Metab. 53,484-488. Bouillon, R„ Van Assche, F.A., Van Baelen, H., Heyns, W. and De Moor, P. (1981) J. Clin. Invest. 67, 589-596. Papapoulos, S.E., Fraher, L.H., Sandler, L.M., Clemens, T.L., Lewin, I.G. and O'Riordan, J.L.H. (1979) Lancet i, 627-630.

493 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31.

Adams, J.S., Sharma, O.P., Gacad, M.A. and Singer, F.R. (1984) J. Clin. Invest. 72, 1856-1860. Barbour, G.L., Coburn, J.W., Slatopolsky, E„ Norman, A.W. and Horst, R.L. (1981) N. Engl. J. Med. 305, 440-443. Bikle, D.D., Nemanic, M.K., Gee, E. and Elias, P. (1982) J. Clin. Invest. 78, 557-566. Minghetti, P.P. and Norman, A.W. (1988) FASEB J. 2, 3043-3053. Mawer, E.B. and Hayes, M.E. (1992) Prog, in Endocrinol. (Proc. 9th Int. Congr. Endocrinol., Nice 1992), Ed. R Momex, C Jaffiol and J Leclerc, Parthenon Publishing, London pp. 382-386. Hayes, M.E., Denton, J., Freemont, A.J. and Mawer, E.B. (1989) Ann. Rheum. Dis. 48, 723-729. Mawer, E.B., Hayes, M.E., Still, P.E., Davies, M„ Lumb, G.A., Palit, J. and Holt, P.J.L. (1991) J. Bone Min. Res. 6,733-739. Mawer, E.B., Hann, J.T., Berry, J.L. and Davies, M. (1985) Clin. Sei. 68, 135-141. Mawer, E.B., Berry, J.L., Cundall, J.P., Still, P.E. and White, A. (1990) Clin. Chim. Acta 190,199-210. Boissier, M.C., Chiocchia, G. and Fournier, C. (1991) 8th Vitamin D Workshop, Paris, Abstracts p88. Manolagas, S.C., Wernst, D.A., Tsoukas, C.D., Provvendini, D.M. and Vaughan, J.M. (1986) J. Lab. Clin. Med. 108, 596-600. Tsoukas, C.D., Provvendini, D.M. and Manolagas, S.C. (1984) Science 224, 1438-1440. Rigby, W.F.C. (1988) Immunobiol Today, 9,54-58. Jones, S.T.M., Yuan, A., Hayes, M. and Freemont, A.J. (1993) Br. J. Rheumatol. 32, Suppl. P65. Adams, J.S., Gacad, M.A., Diz, M.M. and Nadler, J.L. (1990) J. Clin. Endocrinol. Metab. 70, 595-600. Hayes, M.E., Yuan, J.Y., Freemont, A.J. and Mawer, E.B. (1994) Int. J. Immunother. X, 1-9. Fowler, S.J., Yuan, J.Y., Freemont, A.J., Mawer, E.B. and Hayes, M.E. (1994) (This volume). Mundy, G.R. and Martin, T.J. (1982) Metabolism 31, 1247-1277. Stewart, A.F., Horst, R., Deftos, L.J., Cadman, E.C., Lang, R. and Broadus, A.E. (1980) N. Engl. J. Med. 303,1377-1383. Breslau, N.A., McGuire, J.L., Zerwekh, J.E., Frenkel, E.P. and Pak, C.Y.C. (1984) Ann. Int. Med. 100, 1-7. Davies, M„ Hayes, M.E., Mawer, E.B. and Lumb, G.A. (1985) Lancet i, 1186-1188. Davies, M., Hayes, M.E., Lin Yin, J.A., Berry, J.L. and Mawer, E.B. (1994) J. Clin. Endocrinol. Metab. 78, 1202-1207. Shigano, C., Yamamoto, I., Dokoh, S., Hino, M., Aoki, J., Yamada, K., Morita, R., Kameyama, M. andTorizuka, K. (1985) J.Clin. Endocrinol. Metab. 61, 761-768. Heys S.E., Hayes, M.E. and Mawer, E.B. (1994) (This volume). Mawer, E.B., Hayes, M.E., Heys, S.E., Davies, M., White, A., Stewart, M.F. and Smith, G.N. (1994) J. Clin. Endocrinol. Metab. in press. Fukomoto, S., Matsumoto, T., Yamoto, H., Kawashima, H., Ueyama, Y., Tamaoki, N. and Ogata, E. (1989) Endocrinology 124, 2057-2062. Mawer, E.B., Davies, M„ Gargan, P., Walls, J., Howell, A., Ratcliffe, W.A. and Bundred, N. (1993) J. Endocrinol. 137, Suppl P38.

This work has been supported by grants from the Medical Research Council (Programme Grant no. 902 6370), the Arthritis and Rheumatism Council and North Western Regional Health Authority, U.K.

COLON CANCER AND PREDIAGNOSTIC SERUM 25-D and 1,25-D

LEVELS

M . M i l e s B r a u n 1 , K a t h y J. H e l z l s o u e r 2 , B r u c e W. H o l l i s 3 , George W. Comstock2, ^Epidemiology and Biostatistics Program, N a t i o n a l C a n c e r I n s t i t u t e , B e t h e s d a , M D 20852 U S A , 2 D e p t . of E p i d e m i o l o g y , J o h n s H o p k i n s U n i v . Sch. of H y g i e n e a n d P u b l i c H e a l t h , 3 D e p t . of P e d i a t r i c s , M e d i c a l U n i v . of S o u t h Carolina. Introduction. C o l o n c a n c e r w i l l r a n k s e c o n d in n u m b e r of f a t a l i t i e s a m o n g a l l c a n c e r s i t e s in t h e U n i t e d S t a t e s in 1994, w i t h 49,000 deaths predicted. Although inherited p r e d i s p o s i t i o n is e s t i m a t e d t o a c c o u n t for a b o u t 10% o f c o l o n c a n c e r c a s e s , t h e e t i o l o g y for t h e v a s t m a j o r i t y of c a s e s remains obscure. Migrant studies and other epidemiologic studies suggest that nutritional and other environmental f a c t o r s a r e i m p o r t a n t in t h e e t i o l o g y of c o l o n c a n c e r (1). Reports that colon cancer rates vary by latitude, w i t h h i g h e r r a t e s in t h e n o r t h a n d l o w e r r a t e s in t h e s o u t h (2), h a v e s t i m u l a t e d s o m e i n v e s t i g a t o r s to h y p o t h e s i z e t h a t i n c r e a s e d c u t a n e o u s s y n t h e s i s of v i t a m i n D m a y p r o t e c t against colon cancer. E f f e c t s of 1 , 2 5 - D o n c e l l d i f f e r e n t i a t i o n a n d p r o l i f e r a t i o n may be relevant to cancer etiology. For e x a m p l e , t h e h y p e r p r o l i f e r a t i o n of k e r a t i n o c y t e s t h a t c h a r a c t e r i z e s t h e s k i n d i s e a s e p s o r i a s i s is e f f e c t i v e l y t r e a t e d w i t h 1 , 2 5 - D (3). T h e v i t a m i n D a n a l o g u e , calcipotriol, has been reported to have similar efficacy w i t h less tendency to induce hypercalcemia, suggesting that cell differentiation and proliferation effects can be uncoupled f r o m c a l c e m i c e f f e c t s (4). O t h e r p o s s i b l e e f f e c t s of v i t a m i n D o n c a n c e r a r e related to calcium homeostasis. It h a s b e e n p r o p o s e d t h a t , in the gut, dietary calcium may prevent colon cancer by binding and neutralizing potentially toxic fatty acids and bile acids. A n o t h e r h y p o t h e s i s is t h a t e p i t h e l i a l c e l l s of the colon are more likely to terminally differentiate w h e n c a l c i u m c o n c e n t r a t i o n is i n c r e a s e d (5). Methods. S e r u m s a m p l e s w e r e o b t a i n e d in 1974 f r o m a b o u t o n e t h i r d of t h e r e s i d e n t s of W a s h i n g t o n C o u n t y (Maryland, USA) f o r epidemiologic s t u d y . The 20,305 samples were frozen at - 7 0 d e g r e e s C. S e r u m w a s a v a i l a b l e for 57 o f c a s e s of c o l o n c a n c e r d i a g n o s e d b e t w e e n 1984 a n d 1991. Cases were matched t o c o n t r o l s in a 1:2 r a t i o , w i t h m a t c h i n g o n a g e (+/- 1 y r ) , r a c e , s e x a n d d a t e of b l o o d d r a w (+/- 1 m o n t h ) . Controls had a l s o d o n a t e d b l o o d in 1974, a n d t h e y w e r e f r e e of c o l o n c a n c e r t h r o u g h t h e d a t e of d i a g n o s i s of t h e c a s e . A s s a y s for 2 5 - D a n d 1 , 2 5 - D w e r e p e r f o r m e d by s t a n d a r d m e t h o d s . The

495 l a b o r a t o r y w a s u n a w a r e of w h e t h e r s p e c i f i c s a m p l e s from cases or controls.

originated

Results. M e a n s e r u m l e v e l s of v i t a m i n D m e t a b o l i t e s and controls were quite similar; CASES (N=57) M e a n 25-D n g / m l (s.d.)

23.6

in c a s e s

CONTROLS (N=114) (9.2)

23.2

(7.8)

Mean 1,25-D p g / m l (s.d.) 34.7 (7.9) 34.6 (10.0) A n a l y s i s b y q u i n t i l e of s e r u m level s i m i l a r l y f o u n d n o statistically significant differences between cases and controls. Discussion. T h e r e s u l t s of a p r i o r s t u d y of s i m i l a r d e s i g n t o o u r s , i n t h e s a m e c o h o r t , f o u n d t h a t low l e v e l s of s e r u m 2 5 - D w e r e a s s o c i a t e d w i t h s i g n i f i c a n t l y i n c r e a s e d r i s k for t h e d e v e l o p m e n t of c o l o n c a n c e r s e v e r a l m o n t h s t o e i g h t y e a r s later, although a monotonic dose-response relationship between serum levels and colon cancer risk was not observed (6). N o n e of t h e c a s e s or c o n t r o l s w e s t u d i e d w e r e i n c l u d e d in the prior study. O u r s t u d y of t h e r i s k of c o l o n c a n c e r 10 t o 17 y e a r s a f t e r s e r u m c o l l e c t i o n w a s n o t l a r g e e n o u g h t o r u l e o u t c a t e g o r i c a l l y a n i n c r e a s e d r i s k a s s o c i a t e d w i t h low 25-D levels. H o w e v e r , if s u c h a n e f f e c t d o e s e x i s t , it m o s t l i k e l y is s m a l l e r t h a n p r e v i o u s l y r e p o r t e d . References. 1. Potter, J.D., Slattery, M.L., Bostick, R.M., S . M . E p i d e m i o l R e v 1993; 1 5 : 4 9 9 - 4 5 .

Gapstur,

2.

G a r l a n d CF, G a r l a n d FC. D o s u n l i g h t a n d v i t a m i n D r e d u c e t h e r i s k of c o l o n c a n c e r ? I n t J E p i d e m i o l 1 9 8 0 ; 9 : 2 2 7 - 3 1 .

3.

Holick, M.F. Proc Soc Exper Med

4.

B i n d e r u p , L., Bramin, E. B i o c h e m P h a r m a c o l 95.

5.

B o s t i c k , R . M . , P o t t e r , J . D . , F o s d i c k , L. J N a t l Inst 1993;85:132-41.

6.

G a r l a n d CF, G a r l a n d FC. S e r u m 2 5 - h y d r o x y v i t a m i n D a n d colon cancer: eight year prospective study. Lancet 1989;ii:1176-8.

1989;19:246-57. 1988;37:889Cancer

VITAMIN D LEVELS AS A RISK FACTOR FOR FEMALE BREAST CANCER ESTHER C JANOWSKY*, BARBARA S. HULKA*, AND GAYLE E. LESTER+. Department of Epidemiology* and Department of Orthopedic Surgery+, University of North Carolina, Chapel Hill, North Carolina 27514,USA Introduction. Two recent ecological studies have described an inverse relationship between exposure to solar radiation and either incidence of (USSR)(1) or mortality from (USA)(2) breast cancer. Interestingly, an earlier description of the geographic patterns of breast cancer in the United States indicated that the latitudinal relationship was strong for women over age 55 while the distribution for women aged 20-44 was nearly uniform throughout the country(3). This is consistent with the observed heterogeneity in risk factors for breast cancer by menopausal status(4). It follows that adequate vitamin D levels may be of greater significance for post menopausal women than for premenopausal women. Recent work has described the role of vitamin D in cell proliferation and differentiation. Evidence for the possible relationship between vitamin D and breast cancer is based on several lines of investigation: 1) studies on the population level support a relationship between low levels of vitamin D and breast cancer (vide supra)] 2)1,25(OH)2D displays a growth-inhibitory effect on human breast adenocarcinoma cells in culture irrespective of their sex-steroid dependence(5); 3)cultures of the human breast cancer cell line BT-20 demonstrate increased differentiation when exposed to 1,25(OH)2D daily for 8 days(6); 4)Vitamin D receptors (VDRs) have been found in many normal mammalian tissues, including breast tissue(7). Animal studies indicate that virginal animals lack VDRs in mammary tissue(8,9). Whether VDRs are present in the normal human breast prior to pregnancy is unknown. Early breast cancer does not affect blood levels of 1,25(OH)2D. The evidence for this comes from a study of women with axillary-node-negative breast cancer; the research involved a randomized, double-blind, placebocontrolled two-year trial of tamoxifen and bone mineral density(10). There was no decrease from baseline in the level of 1,25(OH)2D over the two year period of the study in either group. This is consistent with a lack of tumor effect on vitamin D levels in patients diagnosed with early breast cancer. However, it should be recognized that patients with advanced disease and hypercalcemia of malignancy often have low circulating concentrations of 1,25(OH)2D and parathyroid hormone(11). This study examined the hypothesis that women with low levels of the physiologically active vitamin D metabolite 1, 25(OH)2D are at increased risk of developing breast cancer. Methods. Stored blood samples were available from a just-completed case-control study of breast cancer. The source population included patients seen at three local referral clinics over a fifteen month period. The cases consisted of 40 postmenopausal (ages 60-82) white women with axillary node negative, incident adenocarcinoma of the breast. The control group of 40 women was drawn from the same breast referral clinics and was matched to cases on age, race, clinic, and month of blood drawing. The analysis of the

497 1,25(OH)2D metabolite was carried out with a 3 H based radioreceptor assay from INCSTAR (Stillwater, Minnesota). To accommodate the whole blood specimens, fresh (as opposed to regenerated) columns were used for each sample extracted. A preliminary study gave results for 1,25(OH)sD which were approximately 23% lower in assays on whole blood than on plasma. Although the D levels from whole blood samples were lower than from plasma samples, this effect should be the same for both cases and controls thus preserving internal validity. Estimates of within batch variation were derived from one set of identical samples run in both the reference assay and experimental assay. These figures were close to the range of 12.5% to 6.9% for low (mean ±SD, 4.0+0.5 pg/mL) and medium (mean+SD, 28.8±2.0 pg/mL) values respectively reported for within batch variation by INCSTAR. Results. There were no statistically significant differences between the groups in traditional risk factors for breast cancer such as age, history of breast cancer in first degree relatives, age at first pregnancy, number of children, number breast feeding any children, age at menarche, age at menopause, hormone replacement therapy. The 1,25(OH)2D level was lower among cases than controls as predicted by the hypothesis (mean difference! SE, 2.25 ±1.29 pg/mL, p 0.088).There was an inverse association between 1,25(OH)2D and age. Levels of the active hormone decreased at a rate of approximately 0.3 pg/mL/year, with a similar slope of decline for both groups (p -0.309, p 0.048). However, blood levels of the active hormone were less variable in the control group than the case group when controlled for the effects of age and month of blood drawing. There were differences (p 0.14) between levels of 1,25(OH)2D from month to month among the cases but not the controls. A history of breast feeding was associated with higher, although nonsignificant 1,25(OH)2D levels among both cases and controls. Conclusions. Mean levels of the active metabolite of vitamin D, 1,25(OH)2D were lower in postmenopausal women with early breast cancer than in a group of matched controls, supporting the research hypothesis. The increased variability of 1,25(OH)2D in cases compared with controls may indicate impaired homeostatic mechanisms. The beneficial effect of lactation on breast cancer risk may be related to increased levels of 1,25(OH)2D. The study confirms previous observations that 1,25(OH)2D levels decrease with age. 1. 2. 3. 4. 5. 6.

Gorham ED, Garland FC, Garland CF. (1990) Int J Epidemiol 19:820-824. Garland FC, Garland CF, Gorham ED. (1990) Preventive Med 19:614-622. Blot WJ, Fraumeni JF, Stone BJ. (1977) J Natl Cancer Inst 59:1407-1411. Paffenbarger RS, Kampert JB, Chang H. (1980) Am J Epid 112:258-268. Chouvet C, Vicard E, Devonec M, Saez S. (1986) J Steroid Biochem 24:373-376. Frappart L, Falette N, Lefebvre MF, Bremond A, Vauzelle JL, Saez S. (1989) Differentiation 40:63-69. 7. DeLuca HF, Ostrem V. (1987) Adv Exp Med Biol 206:413-429. 8.Eisman JA, Macintyre I, Martin TJ, Frampton RJ, King RJB. (1980) Clinical Endocrinol 13:267-272. 9.Colston KW, Berger U, Wilson P, Hadcocks L, Naeen I, Earl HM, Coombes RC. (1988) Molecular and Cellular Endocrinol 60:15-22. 10.Love RR, Mazess RB, Barden HS Epstein S Newcomb PA, Jordan VC, Carbone PP, DeMets DL.(1992) NEJM 326:852-856. H.Holick MF.(1990) J Nutr 120:1464-1469.

S E R U M 1,25-DIHYDROXYVITAMIN D LEVELS IN DOGS WITH CANCERA S S O C I A T E D HYPERCALCEMIA AND ELEVATED LEVELS OF PARATHYROID HORMONE-RELATED PROTEIN Thomas J. Rosol*, Larry A. Nagode*, Dennis J. Chew + , C. Guillermo Couto + , Alan S. Hammer + , Carole L. Steinmeyer*, and Charles C. Capen*. Depts. of Vet. Pathobiology* and Clin. Sciences*, Ohio St. Univ, Columbus, OH 43210, U S A . Introduction: Human patients with humoral hypercalcemia of malignancy (HHM) usually have normal or low circulating levels of 1,25-(OH) 2 D. In contrast, rodent models of H H M and nude mice with transplanted neoplasms that induce H H M have increased serum 1,25-(OH) 2 Dconcentrations (1). Normal or increased serum 1,25-(OH) 2 D concentrations are an inappropriate response to hypercalcemia. Certain human patients with lymphoma and hypercalcemia may have increased circulating 1,25-(OH) 2 D levels due to production of 1,25-(OH) 2 D by the neoplastic cells (2). Production of 1,25-(OH) 2 D in patients with HHM may occur by either: (1) stimulation of 25-hydroxyvitamin D-1ff-hydroxylase activity in the kidney or (2) extrarenal production of 1,25-(OH)2D by the neoplasm. The purpose of this study was to investigate circulating concentrations of 1,25-(OH) 2 D in dogs with various forms of naturally occurring HHM associated with increased circulating parathyroid hormone-related protein (PTHrP) concentrations. Materials and Methods: Circulating levels of 1,25-(OH) 2 D and N-terminal PTHrP (Incstar Inc.) were measured in normal dogs, dogs with spontaneously occurring H H M (before and after therapy for the inciting neoplasm), and dogs with nonhypercalcemia-inducing neoplasms (3,4). Dogs had HHM associated with lymphoma (n = 25), apocrine adenocarcinomas of the anal sac (CAC) (n = 8), or miscellaneous carcinomas (n = 7) (Fig. 1). Normocalcemic dogs with neoplasms had adenocarcinomas of the anal sac (CAC) (n = 8) or lymphoma (n = 11) (Fig. 1). Results: Dogs with HHM had increased circulating concentrations of PTHrP (2 to 100 pM) compared to control dogs (< 1.8 pM). Serum 1,25-(OH) 2 D in control dogs (Fig. 1, group 1) ranged from 20-50 pg/ml with a mean of 36 pg/ml. Serum 1,25-(OH) 2 D usually was normal or suppressed in dogs with HHM; however, the means of all groups were in the normal range (Fig. 1, groups 2-6). There were distinct subgroups of dogs with hypercalcemia and lymphoma (10) or apocrine adenocarcinomas (3) that had increased serum concentrations of 1,25-(OH) 2 D (50-85 pg/ml) (Fig. 1, groups 2 + 4). Serum 1,25-(OH) 2 D concentrations were low in some dogs with HHM or normocalcemia and neoplasia. Evaluation of serum 1,25-(OH) 2 D before and after treatment (surgery, radiation or chemotherapy) of dogs with HHM revealed significantly (P < 0.01) reduced 1,25-(OH) 2 D concentrations (16 ± 10 compared to 38 ± 20 pg/ml) after therapy and return to normocalcemia. Serum 1,25-(OH)2D was determined in 4 dogs with parathyroid adenomas. The 1,25-(OH)2D concentration in 3 of these dogs was mildly increased or in the high-normal range (47, 50, and 51 pg/ml).

499 Figure 1.

90

o

80

O

60

E ® 70 CL

z

r•

»

? 50 ?

40 30

«r

10 CONTROL N0RM0CALCCWU

Group

C*C HTPfBCAICIWIA

CAC LYMPHOMA LYMPHOMA NO tuoMYP|B«ORMOCALCE MIA CALCCUIA CALCtMU

MISC TUMOR

1

Discussion: S e r u m 1 , 2 5 - d i h y d r o x y v i t a m i n D c o n c e n t r a t i o n s in dogs w i t h H H M are variable and may be either decreased, normal, or increased. In dogs w i t h decreased 1 , 2 5 - ( O H ) 2 D , the suppression may be due t o h y p e r c a l c e m i a , l o w s e r u m PTH levels, renal impairment due t o hypercalcemic n e p h r o p a t h y , or the p r o d u c t i o n o f renal 1 - a - h y d r o x y l a s e inhibitors by the t u m o r s associated w i t h H H M (5). In dogs w h e r e 1,25-(OH) 2 D is in the normal range or is increased, mechanism(s) exists t o produce 1,25-(OH) 2 D in spite of hypercalcemia. T h e renal 1 - » - h y d r o x y l a s e in some cases may be stimulated by PTHrP itself; h o w e v e r , there w a s no correlation of serum 1,25-(OH) 2 D w i t h circulating PTHrP c o n c e n t r a t i o n s in dogs w i t h HHM. A n alternate hypothesis w o u l d be t h a t certain t u m o r s p r o d u c e 1,25-(OH) 2 D. This may be the case in some dogs w i t h l y m p h o m a , since there w a s a striking subgroup that have increased s e r u m 1 , 2 5 (OH) 2 D. It has been reported that certain l y m p h o m a s in h u m a n patients are capable o f p r o d u c i n g 1,25-(OH) 2 D (2). In most cases, s e r u m 1 , 2 5 - ( O H ) 2 D c o n c e n t r a t i o n s decreased after successful t r e a t m e n t of the inciting t u m o r and return t o n o r m o c a l c e m i a . These findings support the hypotheses t h a t increased circulating c o n c e n t r a t i o n s of PTHrP in H H M either stimulates renal 1 -ah y d r o x y l a s e or t h a t some t u m o r s produce 1,23-(OH) 2 D. References: 1. Rosol, T. J. and Capen, C. C. (1992) Lab. Invest. 6 7 , 6 8 0 - 7 0 2 . 2. A d a m s , J. S., Fernandez, M., Gacad, M. A . , Gill, P. S., Endres, D. B., Rasheed, S., and Singer, F. R. (1989) Blood 7 3 , 2 3 5 - 2 3 9 . 3. Hollis, B. W . ( 1 9 8 6 ) Clin. Chem. 3 2 , 2 0 6 0 - 2 0 6 3 . 4 . Rosol, T. J . , Nagode, L. A . , Couto, C. G., Hammer, A. S., C h e w , D. J., Peterson, J. L., A y l , R. D., Steinmeyer, C. L., and Capen, C. C. ( 1 9 9 2 ) Endocrinology 1 3 1 , 115 7 - 1 1 6 4 . 5. F u k u m o t o , S., M a t s u m o t o , T., Y a m o t o , H., K a w a s h i m a , H., U e y a m a , Y., T a m a o k i . N., and Ogata, E. (1989) Endocrinology 124, 2 0 5 7 - 2 0 6 2 .

GROWTH INHIBITION OF HUMAN COLON CANCER IN SEVERE COMBINED IMMUNODEFICIENT (SCID) MICE BY 1,25-(OH) 2 D 3 , DD-003 YOKO TANAKA*, AN-YA S. WU', NOBUO IKEKAWA", KATSUHIKO ISEKI+, MAKOTO KAWAI++, and YOSHIRO KOBAYASHI+. Veterans Affairs Medical Center and Department of Medicine, Albany Medical School", Albany, NY 12208, Iwaki Meisei University", Iwaki Fukushima 970, Japan, MEC Laboratory, Daikin Industries*, Tsukuba, Ibaraki 305, Japan, Department of Microbiology, Aichi Medical University++, Nagakute, Aichi 480-11, Japan. Introduction Epidemiological and animal studies suggest a possible role for vitamin D in the prevention and treatment of colon cancer. The active form of vitamin D 3 , 1,25-dihydroxyvitamin D 3 [1,25-(OH)2D3], modulates the growth and differentiation of normal and cancer cells including colon cancer cells. In an animal experiment, 1,25-(OH)2D3 suppressed growth of human colon cancer xenograft implanted in immunosuppressed mice maintained on a low calcium diet (1). Thus, low calcemic analogs of 1,25-(OH)2D3 may be potential therapeutic drugs against colon cancer. Numerous analogs of 1,25-(OH) 2 D 3 have been synthesized in the hope of clinical use against cancers and proliferative disorders. Few reports have been published regarding in vivo effectiveness of low calcemic analogs; those studies utilized s.c. implanted human breast cancer in nude mice (2), and chemically induced rodent mammary tumors (3). Although vitamin D is associated with reduced incidence of colon cancer, analogs of vitamin D aiming colon cancer treatment have not been developed. We have synthesized 22(S)-24-homo-1,22,25trihydroxyvitamin D 3 (DD-003) (4) which expressed high antiproliferative effect on colon cancer cells in culture without causing hypercalcemia in rats. We examined in vivo activity of DD-003 against colon cancer utilizing the HT-29 human colon cancer cell clot implanted in the subrenal capsule (SRC) of the severe combined immunodeficient (scid) mouse. Methods HT-29 cells were cultured in RPMI-1640 containing 10% heatinactivated fetal bovine serum. Cultured HT-29 cells were collected by trypsinEDTA treatment and solidified with fibrinogen and thrombin. The resulting clot was cut into pieces of as uniform size as possible, using a dissecting microscope equipped with an ocular micrometer. A clot was implanted under the kidney capsule of a scid mouse, and the implant size was measured in situ using the microscope to compute the initial tumor diameter [(width x length)/2]. The tumor-implanted mice were given DD-003 dissolved in ethanol/propylene glycol (5/95, v/v) or the vehicle i.p. 3 times a week. At the termination of the experiment, tumor diameter, tumor volume (width x length x height x 1/2) and serum calcium concentrations were measured. The tumor-bearing kidney was fixed with 10% buffered formalin for histological analysis.

501 Results Starting seven days after implantation of HT-29 tumor, mice were given 3 (ig/kg body weight DD-003 or the vehicle for 11 days. Mice in both groups appeared healthy and showed similar final body weights and serum calcium concentrations. The HT-29 tumor grew rapidly in control mice. Control tumors were large; the tumor boundary was somewhat obscure, yet sufficiently well defined for measurement of tumor size. The malignant growth was evident with characteristic cancer-host interactions such as tumor angiogenesis and invasion into normal kidney tissue, and frequent mitoses. Tumors in DD-003 treated mice were smaller, with prominent necrosis, less invasion and less angiogenesis as compared with the control. Increase in tumor diameter: 2.26 ± 0.39 (control) vs 0.85 ± 0.26 mm (treated), p