Trends in Frontal Areas of Plant Science Research [1 ed.] 9788184876765, 9788184876055

Citation preview

Trends in Frontal Areas of Plant Science Research

Trends in Frontal Areas of Plant Science Research

Editors

Sangram Sinha Rabindra Kumar Sinha

Narosa Publishing House

New Delhi  Chennai Mumbai Kolkata

Trends in Frontal Areas of Plant Science Research 308 pgs. | 98 figs.

Editors Sangram Sinha Rabindra Kumar Sinha Professor of Botany Tripura University Tripura Copyright © 2018 Department of Botany, Tripura University Suryamaninagar, Tripura www.tripurauniv.in NAROSA PUBLISHING HOUSE PVT. LTD. 22, Delhi Medical Association Road, Daryaganj, New Delhi 110 002 35-36 Greams Road, Thousand Lights, Chennai 600 006 306 Shiv Centre, Sector 17, Vashi, Navi Mumbai 400 703 2F-2G Shivam Chambers, 53 Syed Amir Ali Avenue, Kolkata 700 019 www.narosa.com All rights reserved. No part of this publication may be reproduced, stored in a retrieval system, or transmitted in any form or by any means, electronic, mechanical, photocopying, recording or otherwise, without prior written permission of the publisher. All export rights for this book vest exclusively with Narosa Publishing House Pvt Ltd. Unauthorised export is a violation of terms of sale and is subject to legal action. For Sale in India, Pakistan, Bangladesh, Nepal, Bhutan and Sri Lanka only. ISBN 978-81-8487-605-5 E-ISBN 978-81-8487-676-5 Published by N.K. Mehra for Narosa Publishing House Pvt Ltd., 22, Delhi Medical Association Road, Daryaganj, New Delhi 110 002 Printed in India

Dedicated to the memory of late Prof. R. C. Srivastava

izks- ¼LoxhZ;½ vkj-lh- JhokLro dh Le`fr esa lefiZr

PREFACE It was a great pleasure for us to organize a national seminar on Trends in Frontal Areas of Plant Science Research sponsored by UGC to instill the scientific spirit and to promote plant science research in respective arenas both intra and extramurally. The deliberations and interactions were exciting and led to the formulation of positive recommendations serving as guidelines to augment future research strategies. We have included peer reviewed papers recommended by the editorial board. Nevertheless, we hope that the contents will be useful to the post graduate students, researchers, teachers and the scientific community working in related fields. We express our deep sense of gratitude to Prof. Anjan Kumar Ghosh, Hon’ble Vice Chancellor, Tripura University for his active support and inspiration without which the idea to publish this book would not have materialized. The sudden untimely demise of late Prof. R. C. Srivastava has in fact, inflicted irremediable loss to the Department vis-àvis to the scientific community of Tripura as a whole. The financial support received from the University Grants Commission under UGCSAP (DRS-I) is gratefully acknowledged. We also thankfully acknowledge the passionate cooperation extended by Prof. M. K. Singh, Dean, Faculty of Science, our colleagues and research students. Sangram Sinha Rabindra Kumar Sinha

FOREWORD Plants sustain life on this Earth. Every other life form is dependent on plants for its survival. Thus, there is a great need to unravel the mysteries of botany and the associated biological phenomena. For several years the Department of Botany in Tripura University is performing frontline research on plant life, especially, for the plants growing in Tripura and the surrounding regions. Thus, the book collecting various papers presented in the National Seminar on Trends in Frontal Areas of Plant Science Research will be an important addition to the domain of botanical research. I thank the organizers of the National Seminar and the Editors of this volume. I wish such National Seminars and Publications will establish the leadership of Tripura University in the botanical and bioscience research in future.

CONTENTS Preface vii Foreword

ix

1. Biodiversity: Key Pillar for Survival 1—11 —Animesh Bose, Poushali Das and N. D. Paria 2. Exploitation of Biodiversity for Genetic Improvement of Banana 13—45 —Anath Bandhu Das 3. Photoperiod-mediated Regulation of Tuberization in Potato (S. tuberosum spp. andigena) 47—67 —Kirtikumar R. Kondhare, Amit Kumar and Anjan K. Banerjee 4. Bamboo Shoots: A Potential Source of Nutraceuticals 69—84 —Kananbala Sarangthem 5. A Population Genetics Perspective in Plant Pathology: A Case Study of the 2014 Late Blight Pandemic in West Bengal 85—89 —Sanjoy Guha Roy 6. Orchid Germplasm: Its Conservation and Propagation Strategies 91—101 Through In Vitro Approach —Nirmalya Banerjee and Tustu Mondal 7. Women and Environment: An Integral Social Bond for Ecological and Economic Security and Resilience 103—110 —Atul Kumar Gupta 8. Maximum Entropy Distribution Modelling and Habitat Suitability of a Critically Endangered Tree Dipterocarpus gracilis Blume in Tripura, Northeast India 111—119 —Koushik Majumdar, Dibyendu Adhikari and Badal Kumar Datta 9. Antioxidant, Total Phenol and Some Nutritional Status of Dioscorea hamiltonii Hook. f. and Dioscorea bulbifera L. Var. Sativa (Hook.f.) Prain, in Tripura, NE India. 121—127 —Bimal Debnath, Chiranjit Paul and Amal Debnath 10. Andromonoecy in Solanum sisymbriifolium Lamk. 129—135 —Moumita Saha and Badal Kumar Datta 11. Reproductive Biology of Tropical Kudzu, Pueraria phaseoloides (Roxb.) Benth 137—145 —Somnath Kar and Badal Kumar Datta 12. Organ Identity Genes and Sex Expression in Coccinia grandis (L) Voigt. 147—159 —Kanika Karmakar, Rabindra Kumar Sinha and Sangram Sinha 13. Bamboo Resources and Population Dynamics of Two Different Etho-ecological Areas in West District of Tripura 161—167 —Sunita Debbarma, Surajit Basak, Sangram Sinha and Rabindra Kumar Sinha 14. Comparison of ISSR and SSR Markers to Study the Genetic Diversity in Curcuma spp. from Tripura 169—179 —Kishan Saha, Rabindra Kumar Sinha and Sangram Sinha

xii  |  Contents 15. Diversity, Botany and Importance of Two Mucuna Species: 181—189 M. bracteata DC. and M. interrupta Gagnep. in Tripura —Debasree Lodh, Prasenjit Patari, Surochita Basu and Md. Jasim Uddin 16. Diversity of Fungal Endophytes and Antibacterial Study of Some Selected Endophytes Isolated from Five Plants of Tripura 191—197 —Sukla Bhattacharjee, Ajay Krishna Saha and Panna Das 17. Antibacterial Activity of Leaf Extracts of Bambusa bambos (L.) 199—204 Voss. and Bambusa tulda Roxb. of Tripura —Sudipta Sinha, Gopal Debnath, Ajay Krishna Saha and Panna Das 18. Checklist of Mushroom Diversity in West Tripura, North-East India 205—213 —Sanjit Debnath, Aparajita Roy Das, Pintu Karmakar, Gopal Debnath, Panna Das and Ajay Krishna Saha 19. Effects of pH, Carbon and Nitrogen Sources on Mycelial Growth 215—221 of Fusarium sporotrichioides in Submerged Culture Condition —Pintu Karmakar, Koyel Sen Gupta, Swati Gupta-Bhattacharya, Panna Das and Ajay Krishna Saha 20. Phylloplane and Endophytic Fungal Diversity in Ananus comosus L. of Sepahijala District of Tripura and Antioxidant Potential of Two Isolated Endophytes 223—230 —Sanchita Bhattacharya, Ajay Krishna Saha and Panna Das 21. Antibacterial Activity of Silver Nanoparticles Synthesized from Leaf 231—237 Extract of Paspalum conjugatum P. J. Berguis —Gopal Debnath, Panna Das and Ajay Krishna Saha 22. Comparison of Arbuscular Mycorrhizal Fungal Colonization and Diversity of Two Different Rubber Plantations of Tripura, Northeast India 239—247 —Atithi Debnath, Sudipta Sinha, Krishna Talapatra, Kripamoy Chakraborty, Ajay Krishna Saha and Panna Das 23. Seasonal Pattern of Nitrate Reductase and Nitrogenase Enzyme Activities 249—252 in Desmodium triflorum (L.) DC.—A Folklore Species of India —Joyeeta Dey and Rabindra Kumar Sinha 24. Soil Nutrients and Plant Association Analysis Under Different Habitats of a 253—266 Threatened Carnivorous Plant Drosera burmannii Vahl. in Tripura, India —Biswajit Sutradhar, Bal Krishan Choudhary, Koushik Majumdar and Badal Kumar Datta 25. Studies on Phytolith Morphotypes of Some Bamboo Species of Tripura, North East India 267—275 —Ashish Kumar Chowdhury and Badal Kumar Datta 26. Chemical Constituents of Mussaenda roxburghii and Dillenia pentagyna 277—288 —Ranjit Ghosh, Joyanta Bhowmik, Sukhen Bhowmik and Utpal C. De 27. In-vitro Wound Healing Activity of Parkia javanica on Human Keratinocyte (HaCat) Cell Line 289—293 —Susmita Saha, Manikarna Dinda, Parimal karmakar and Samir Kumar Sil

Index 295––296

Trends in Frontal Areas of Plant Science Research Edited by: S. Sinha, R.K. Sinha © Department of Botany, Tripura University, 2017

Biodiversity: Key Pillar for Survival Animesh Bose, Poushali Das and N. D. Paria* Centre of Advanced Study, Taxonomy & Biosystematics Laboratory, Department of Botany, University of Calcutta, Kolkata, West Bengal, India. *Corresponding author: [email protected]

The term ‘biodiversity’ was first used in its long version (biological diversity) by Lovejoy (1980) and is most commonly used to describe the number of species. Further, this term was coined by Walter G. Rosen, a biologist and senior programme officer at the National Research Council, U.S. in respect of understanding of a chaotic, diminishing natural world, (Takacs, 1996). Since the publication of the book “Biodiversity” edited by E.O. Wilson, in the year 1988, there has been an accelerating momentum in the publications of articles, holding of seminars, workshops, etc. concerning biodiversity on various aspects. In course of time, Jutro (1993) recorded 14 definitions related to biodiversity which have been used differently. According to Terry Erwin (1991) biodiversity is “the sum of earth species including all their interactions and variations within their biotic and abiotic environment in both space and time.” However, there are two well accepted definitions of “Biodiversity” at global level. One such definition refers to “The variability among living organisms from all sources including, inter alia, terrestrial, marine and other aquatic ecosystems and the ecological complexes of which they are part; this includes diversity within species, between species and of ecosystems (UNEP, 1992) and the other one is “The totality of genes, species, and ecosystems in a region” (WRI, IUCN and UNEP, 1992). Possibly the simplest definition for biodiversity, lacking in specificity or context, is merely the number of species. Yet many have argued that biodiversity does not equate to the number of species in an area. The term for this measure is species richness (Fiedler and Jain, 1992), which is only one component of biodiversity. In fact, the aspects of biodiversity are vast and varied. Through the current era of attrition and depletion, it forms the important link to the future survival, adaptation, evolution or decline and ultimate extinction.

Convention on Biological Diversity (CBD) There are several international conventions organised by different bodies drawing attention on biodiversity issues directly or indirectly. Each of the biodiversity-related conventions acts to implement actions at the national, regional and international level regarding shared goals of conservation and sustainable use. The important conventions are the International Plant Protection Convention (1952), the Ramsar Convention on Wetlands

2  |  Biodiversity: Key Pillar for Survival

(1971), the World Heritage Convention (1972), the Convention on International Trade in Endangered Species of Wild Fauna and Flora (1975), the Convention on Conservation of Migratory Species (1985), Convention on Biological Diversity (1992, year of entry into force: 1993), and the International Treaty on Plant Genetic Resources for Food and Agriculture (2004). Among these, Convention on Biological Diversity (CBD) is of profound importance as this convention makes the world conscious for the first time about the values and significance of biodiversity, and, it is the most comprehensive international agreement that addresses all aspects of biodiversity in a holistic manner. The CBD was adopted during the Earth Summit (UNCED) in Rio de Janeiro, Brazil in 1992, and currently has 193 countries as Parties (entered into force on 29 December 1993). Reaffirming sovereign rights of nations over their biological resources, the Convention has set three main objectives: (i) conservation of biological diversity; (ii) sustainable use of biodiversity; and (iii) rational sharing of the benefits derived from the domestic and wild plants. The first two objectives are straight forward while the third one was effective barrier to the biotechnology products of developed or industrialised countries. During the past years, the developed countries (industrialized) have developed new medicines, biotechnology produces, crops, etc. using the raw materials of tropical species, but without giving any return of due profits earned out of them. Thus, the countries in which the wild tropical species were originally found did not receive fair compensation from the developed countries for the use of their species in question. India was the first country to sign the Convention and ratified it on 18th February, 1994. The signatory country is committed to achieve the goals of the Convention as a rule.

Level of Biodiversity Usually, biodiversity is considered at three major levels: Genetic diversity, species or taxonomic or organismal diversity, ecological or community or habitat diversity. There is another aspect of biodiversity known as molecular biodiversity (Campbell, 2003). Genetic diversity: This is the variety of genetic information contained in all of the individual plants, animals and microorganisms occurring within populations of species. Simply it is the variation of genes within species and populations. Species or taxonomic or organismal diversity: This is the variety of species or the living organisms. Historically, species are the fundamental descriptive units of the living world and this is why biodiversity is very commonly, and incorrectly, used as a synonym of species diversity, in particular of species richness. Ecological or community or habitat diversity: While it is possible to define what is in principle meant by genetic and species diversity, it is difficult to make a quantitative assessment of diversity at the ecosystem, habitat, or community level. There is no unique definition or classification of ecosystems at the global level, and it is difficult in practice to assess ecosystem diversity other than on a local or regional basis, and then only largely in terms of vegetation. Ecosystems are further divorced from genes and species in that they explicitly include abiotic components, being partly determined by soil/parent material and climate.

Animesh Bose et.al.  | 3

Molecular diversity: Molecular biodiversity is the richness of molecules found in life. It is distinct from genetic diversity, though both ultimately depend on inheritable DNA. It occurs within one individual, between individuals of the same species, between related species, within and between phyla and ecosystems, and throughout evolution. Without molecular biodiversity evolution cannot occur, either in the origin of a new species, its survival and development, or its eventual extinction (Campbell, 2003).

Biodiversity in Relative Measurement In measuring the biodiversity, Ecologists and biogeographers divide species richness into four major components: point richness/diversity (the number of species that can be found at a single point in space), alpha diversity (the number of species in a single community, which comes closest to the popular concept of species richness and can be used to compare the number of species in different ecosystem types), beta diversity (change in species composition along environment gradients representing intercommunity diversity or between habitat diversity) and gamma diversity (“the rate at which additional species are encountered as geographical replacements within a habitat type in different localities”).

Distribution of Biodiversity Biodiversity or biological diversity is everywhere, both on land, air and in water including all organisms, from microscopic bacteria to more complex plants and animals present in the biosphere. In general, it refers to the variety of all forms of life on earth. Global: According to the World Conservation Monitoring Centre. (WCMC, 1992), the total number of species described at the global level so far is 1,604,000. However, WCMC has estimated that at the global level there are likely to be 17,980,000 species, i.e. about 14 times more than the presently known species. The increase is likely to be primarily from the tropics and subtropics. However, a more realistic working figure of species at the global level is around 12,250,000 (WCMC, 1992). The most recent figure of the estimated total number of species present in the globe is 1,730,725, (IUCN, 2014). Even the number of plant species has been subjected to substantial revision in recent years, with current estimates being around 307, 674 species as opposed to the previously commonly cited figure of 2,50,000 (Heywood and Iriondo, 2003). The estimated number of vertebrates, invertebrates, plants, and animals by IUCN (2014) are presented in Table 1. Mc Neely et al. (1990) estimated that 70% of the world’s flowering plants occur in twelve Mega-diversity centres or Mega-diversity countries. These include: 1. Brazil, 2. Colombia, 3. Mexico, 4. Indonesia, 5. Peru, 6. Malaysia, 7. Ecuador, 8. India, 9. Zaire, 10. China, 11. Madagascar, 12. Australia. A country is defined as one of the “megadiversity” country that either (a) contains 20,000 higher plant species or, in the case of a country with fewer than 20,000 but more than 10,000 such species, at least 5000 endemics; or (b) contains at least 2000 species of higher vertebrates (mammals and birds), or 200 such species as endemics. Mittermeier et al. (1997) has identified 17 megadiverse countries, mostly located in the tropics. These 17 megadiversity countries encompass 60–70% of all global biodiversity. In fact, the developing and the underdeveloped countries located

4  |  Biodiversity: Key Pillar for Survival

in tropical and sub-tropical regions are endowed with vast natural resources than the developed countries located in temperate zones of the earth. In alphabetical order, the 17 megadiverse countries are: Australia, Brazil, China, Colombia, Democratic republic of Congo, Ecuador, India, Indonesia, Madagascar, Malaysia, Mexico, Papua New Guinea, Peru, Philippines, South Africa, United States, and Venezuela. Six of the world’s 17 ‘megadiversity’ countries are in the Neotropics. India: India, known for its rich heritage of biological diversity, has so far documented over 96,373 species of animals and 47,513 species of plants (MoEF, 2014) in its ten biogeographic regions. Besides, it is recognized as one of the eight Vavilovian centres of origin and diversity of crop plants, Vavilov (1935) having more than 300 wild ancestors and close relatives of cultivated plants, which are still evolving under natural conditions. India is also a vast repository of Traditional Knowledge (TK) associated with biological resources. India ranks among the top ten species-rich nations and shows high endemism. India has four global biodiversity hotspots (Himalaya, Indo-Burma, Western Ghats and Sri Lanka, and Sundaland), (Table 2). According to Nayar (1996), India has over 40 sites, which are known for their high endemism and genetic diversity. The Indian flora is more varied than that of any other country of equal area in the eastern hemisphere, if not on the globe (Hooker, 1904). Table 1:  Estimated number of described species Category

Vertebrate Animals

Mammals Birds Reptiles Amphibians Fishes Total Vertebrates

Invertebrate Animals

Insects Spiders and scorpions Molluscs Crustaceans Corals Others Total Invertebrates

Plants

Flowering plants (angiosperms) Conifers (gymnosperms) Ferns and horsetails Mosses Red and green algae Total plants

Species

Totals

5,513 10,425 10,038 7,302 32,900 66,178 1,000,000 102,248 85,000 47,000 2,175 68,827 1,305,250 268,000 1,052 12,000 16,236 10,386 307,674

Animesh Bose et.al.  | 5

Others

Lichens Mushrooms Brown algae Total Others TOTAL SPECIES

17,000 31,496 3,127 51,623 1,730725

(Source: IUCN, 2014)

In terms of plant diversity, India ranks tenth in the world and fourth in Asia. With over 47,513 plant species, India represents nearly 11% of the world’s known floral diversity. As elsewhere in the world, many organisms especially in lower groups such as bacteria, fungi, algae, lichens and bryophytes are yet to be described and remote geographical areas are to be comprehensively explored. According to the present estimates, India’s contribution to the global biodiversity is around 8% species.

Biodiversity Hotspots We are witnessing the opening phase of a mass extinction episode that, if allowed to persist, could well eliminate a large proportion of all species among other forms of biodiversity within the foreseeable future (Myers, 1993; Wilson, 1992). We do not have sufficient resources for planning and maintaining conservation measures. Biodiversity conservation attempt may be successful by creating and maintaining the safeguard of hotspots. A hotspot is qualified by an area containing at least 0.5% or 1500 of the world’s 300,000 plant species as endemics. A hotspot may further be characterised which has lost 70% or more of its primary vegetation. Based on floristic richness, Myers (1988, 1990) recognized 18 hotspots throughout the world. Later, Myers et al. (2000) identified 25 biodiversity hotspots distributed in the world. Recently, 35 biodiversity hotspots have been identified. The 35th hotspot is the Forests of East Australia (Williams et al., 2011). Nine leading hot spots have been recognised which contain 30% of all plants, 25% of all species in four vertebrate groups, and 0.75 of earths land surface (Myers et al., 2000). The leading hot spots are richer in endemics than other hot spots. Hottest hotspots can be recognised depending on five key factors: numbers of endemics and endemic species/ area ratios for both plants and vertebrates, and habitat loss. Some of them are Madagascar, Philippines, Sundaland, Brazils Atlantic Forest, Carribbean, Indo-Burma, Western Ghats and Sri Lanka, Eastern Arc Mountains and Coastal Forests of Tanzania and Kenya (Myers et al. 2000). The tropical Andes is the richest and most diverse biodiversity hotspot in the world and the Amazon rainforest, the world’s largest continuous rainforest area, is estimated to host a quarter of the world’s terrestrial species (Mittermeier et al. 2004). Myers et al., (2000) recognised two hotspots which are represented by India, i.e. Indo-Burma and Western Ghats-Sri Lanka. Recent studied revealed that Nicobar Islands are also included under Sundaland hotspots, which topography is dominated by two of the largest islands in the world: Borneo and Sumatra. This study revealed that India represented four biodiversity hotspots, of which Himalaya and Sundaland are new along

6  |  Biodiversity: Key Pillar for Survival

with previous two hotspots (Table 2). According to Nayar (1996), India has over 40 sites which are known for their high endemism and genetic diversity. As a matter of fact three hotspots from Indian subcontinent are recognized as hottest hotspots. Table 2:  Salient features of Hotspots of India. Vital signs

Hotspot original extent (Km2) 2

Hotspot vegetation remaining (Km ) Endemic plant species

Himalaya

Indo-Burma

Western Ghats and Sri Lanka

Sundaland

741,706

2,373,057

189,611

1,501,063

185,427

118,653

43,611

100,571

3,160

7,000

3,049

15,000

Endemic threatened birds

8

18

10

43

Endemic threatened mammals

4

25

14

60

Endemic threatened amphibians

4

35

87

59

Extinct species Human Population Density

0

1

20

4

123

134

261

153

(Source: Botanical Survey of India, 2009)

Diversity of Cultivated Plants N. I. Vavilov (1935) with his Soviet research workers identified several centres of origin and diversity of cultivated plants in more than 60 countries of Asia, Africa, southern Europe, North and South America and also through the length and breadth of the USSR. Vavilov identified eight independent centres of origin of the major cultivated plants worldwide or, in other words, eight regions of domestication of various plants. These centres include Chinese centre of origin (136), Indian (Hindustan) centre of origin (117), Indo-Malay centre (42), Near Eastern centre (38), Mediterranean centre (84), Abyssinian centre (38), South Mexican & Central American centre, South American (PeruvianEcuadorian-Bolivian) centre (45). In addition to the main south American centre of origin, Vavilov also recognized two subcentres : The Chiloe centre (4) and Brazilian-Paraguayan centre (13). The numbers within the parentheses indicate the number of diversity of cultivated plants in the concerned centre.

Value of Biodiversity In assessing the value of biodiversity, one may be perplexed to enlist such values as are innumerable to consider in the context of natural resources. Some major values include (a) economic value, (b) medicinal value, (c) ecosystem value, (d) cultural, ethical and historical value, (e) industrial value, etc. There are vast natural resources in the treasures of biodiversity, some of which are still untapped. For conserving biodiversity at the level of species and ecosystem, we need to explore the genetic diversity that occurs within them. Modern agricultural techniques and tools have led to an excessive dependence

Animesh Bose et.al.  | 7

on a few miracle strains of fewer plants and animals; but we still have to move in this regard for many more plants and animals for greater need and human welfare. However, looking at the biological resources, we can appreciate the various produce derived from organisms, which are the main source of food, fibre, medicines, fuel wood and ornamental plants. Five thousand plant species are known to have been used as food by humans. Presently about 20 species feed the majority of the world’s population and just 3 or 4 only are the major staple crops to majority of population in the world. A large number of plants and animals materials are used for the treatment of various ailments. Presently, about 80% of the world population is still dependent on medicinal plants for health care and 20% of the drugs in pharmaceutical firms are of plant origin, either extracted from the plants or synthetic derivatives of these plant species. According to World Health Organisation (WHO), more than 3.5 billion people rely on herbal medicines. It is well known that all the major systems of medicines – Ayurveda, Homoeopathy, Siddha, Unani and Traditional Chinese Medicine (TCM) are largely based on drugs of plant origin. From the time immemorial, India has been known to be the rich repository of medicinal plants. These plants constitute the main resource base for the primary health care system in the country.

Threats to Biodiversity The major threats to biological diversity that result from human activities are habitat destruction, habitat fragmentation, habitat degradation (including air and water pollution), the overexploitation of species for human use, the invasion or introduction of exotic species, and the increased use of toxic chemicals and fertilizers, global climate change, etc. Most threatened species face at least two or more of these threats, leading their way to extinction. These threats will continue to increase in the coming years due to explosion of human population, developmental activities and overexploitation of species, etc.

Protection & Conservation of Biodiversity According to Jordan (1995), “Conservation is a philosophy of managing the environment in such a way that does not despoil, exhaust, or extinguish it or the resources and values it contains”. In Rio Convention, it was internationally agreed upon by the participating leaders of the different countries to safeguard the common concern of humanity by conserving nature and utilizing genetic resources in sustainable manner. In view of the fact, conservation programmes are chiefly implemented by two basic methods, i.e. on-site (in situ) and off-site (ex situ). In situ conservation denotes conservation of plants and animals in their natural habitats. The merit of in situ conservation is that it allows continuation of evolutionary change. When seeds of wild plants are collected from the wild and stored as in ex-situ conservation, the supposed evolution will stop along with the co-evolution of pests and pathogens. The ex situ methods of conservation of flora and fauna are done at off site, that is away from the original place of occurrence. In-situ conditions are particularly

8  |  Biodiversity: Key Pillar for Survival

advantageous in tropical rain forests where many species occur in low densities and have a high degree of endemism. In connection with such conservation programmes, the biosphere reserve plays a pivotal role. The concept of Biosphere Reserves, as a method of sustainable development was launched by the UNESCO Man and the Biosphere Program (MAB) in the early 1970. In contrast to typical national parks or other nature reserves, the biosphere reserve concept allows habitation within a reserve area. Three roles of a biosphere reserve are realized by the designation of’ three zones with a reserve. A core zone is a natural protected area in which only nondisruptive research, such as environmental monitoring is allowed. Often core zones are pre-existing protected areas such as national parks or nature preserves. A buffer zone surrounds or adjoins the cores, and only activities compatible with the protection and preservation of’ the cores are allowed there. Beyond the buffer zone is a transition zone often called manipulating zone, which has no clear limits. It includes human settlements and economic activities compatible with conservation and preservation of the reserve ecosystems. In addition to the above, there are a number of programmes, ways and means for conservation and protection of biodiversity either directly or indirectly. Some of these include conservation of specific ecosystem, legislation for providing safeguard for the maintenance of existing biodiversity, domestication for overexploited species, use of indigenous knowledge for study and storage of germplasm, rehabilitation of endangered and threatened species, etc.

Taxonomic Studies of Seedlings – A Potential Method of Plant Conservation It is obvious that the high rate of seedling mortality is one of the reasons for extinction of species in the long run. This drives the existing seedlings highly vulnerable or endangered. A thorough survey from germination stage to establishment, subsequent growth and development of seedlings particularly of rare or threatened plants, may reveal the critical factors, if any, responsible or prevailing situation, and accordingly proper care can be taken up to provide safeguard for seedlings from mortality in nature. For this purpose both in-situ and ex-situ conservation of seedling plants will be of immense help. The study of seedling morphology provides important clues to identify the plants at juvenile stage in absence of flowers and fruits. With such advantage, these plants can be protected from biotic interference and natural hazards, before they get disappeared from the wild. The distinguishing morphological parameters of seedlings which can assist in this regard mainly include collet, cotyledon, paracotyledon, hypocotyl, epicotyl, internode, and eophyll. Variations in these characters are useful for the identification and delimitation of taxa at different taxonomic levels in angiosperms through the construction of artificial key. Accordingly, Deb and Paria (1986), Kamilya and Paria (1993), Das et al. (2001), Paria (2014), Bose and Paria (2015) have contributed the significance of seedling morphology in identification and provided clues for conservation of angiospermic plants, especially having economical and medicinal values, as well as of some mangroves plants also.

Animesh Bose et.al.  | 9

Role of Botanists In recent years, there is an accelerating awareness concerning the impact of global warming, climate change, desertification, industrialization, and change in life cycle pattern of plants, etc. It is acknowledged that the future survival of humanity depends on the conservation and protection of natural wealth. To overcome the various constraints and hurdles, there is an urgent need of coordinated efforts of scientists, government departments, nongovernmental organizations and local people to undertake effective attempts for conservation of plants through all possible measures. To avoid the loss of biodiversity the government authorities have formulated stringent rules to safeguard and protect the existing biodiversity, ensuing protection of the present natural assets. In this context, the role of a botanist assumes prime significance for conservation of biodiversity including threatened plants. The tasks of a botanist can be broadly divided as: (i) Identification and characterization of an endangered plant. (ii) Study of taxonomy, ecology and physiology. (iii) To understand the reasons for a particular plant becoming endangered. (iv) Propagation of the plant under controlled environment followed by in situ and ex situ conservation. (v) To create a self-sustainable population of threatened species in their natural habitat. (vi) Compilation of database and documentation of all threatened plants. (vii) To explore the utility of an endangered plant, if any, for basic as well as commercial applicability. (viii) Use of molecular markers and molecular diagnostic tools to give valuable support for the rapid and accurate identification of plant species through DNA bar-coding (Bapat et al., 2012).

REFERENCES Bapat, V. A., Dixit, G. B. and Yadav, S. R. 2012. Plant biodiversity conservation and role of botanists. Current Science, 102(10): 1366-1369. Bose, Animesh. and Paria, N. D. 2015. Seed and Seedling Morphology in Cheilocostus speciosus (Costaceae). Phytomorphology, 65(3&4): 109-113. Campbell, A. K. 2003. Save those molecules! Molecular biodiversity and life. Journal of Applied Ecology, 40: 193-203. Das, S., Ghosh, M. and Paria, N. 2001. Seedling morphology of some mangroves of Sunderbans, India: a taxonomic approach. Feddes Repertorium, 112(5-6): 357-369. Deb, D. K. and Paria, N. 1986. Seedling morphology of some economic trees. Indian Agric. 30(2): 133-142. Erwin, T. 1991. A plan for developing consistent biotic inventories in temperate and tropical habitats. Part 1 of Establishing a Tropical Species Co-ocurrence Database (T. L. Erwin, Ed.). Memorias del Museo de Historia Natural, parts 1-3. Universidad Nacional Mayor de San Marcos, Lima. Fiedler, P. L. and Jain, S. K. 1992. Conservation Biology: The Theory and Practice of Nature Conservation, Preservation and Management. Chapman and Hall, New York.

10  |  Biodiversity: Key Pillar for Survival

Heywood, V. H. and Iriondo, J. M. 2003. Plant Conservation: old problems, new perspectives. Biological Conservation, 113: 321-335. Hooker, J. D. 1904. A sketch of the Flora of British Indian. Oxford. IUCN. 2014. IUCN Red List Categories. IUCN Species Survival Commission, Gland, Switzerland. Jordan, C. F. 1995. Conservation. John Wiley & Sons, New York. Jutro, P. R. 1993. What biodiversity information do decision makers need? In Proceedings of the Norway/ UNEP Expert Conference on Biodiversity. O. T. Sandlund and E. J. Schei (eds.), Directorate for Nature Management and Norwegi an Institute for Nature Research, Trondheim, Norway. Kamilya, P. and Paria, N. 1993. Seedling morphology of some members of the Polygonaceae and its taxonomic value. Rheedea, 3: 29-34. Lovejoy, T. E. 1980. The Global 2000 Report to the President (G. O. Barney, ed.), 2: 327-332. Penguin, New York. Mc Neely, J. A., Miller, K. R., Reid, W. V., Mittermeir, R. A. and Werner, T. B. 1990. Conserving the world’s Biological Diversity, IUCN, Gland Switzerland. Mittermeier, R. A., Gil, P. and Mittermeier, C. G. 1997. Megadiversity: Earth’s Biologically Wealthiest Nations. Garza Garcia N.L. Mexico: CEMEX. Mittermeier, R. A., Robles, G. P., Hoffmann, M., Pilgrim, J., Brooks, T., Mittermeier, C. G., Lamoreux, J. and da Fonseca, G. A. B. 2004. Hotspots Revisited. Garza Garcia N.L. Mexico: CEMEX. MoEF. 2014. India’s fifth national report to the Convention on Biological Diversity. Ministry of Environment, Forest, Government of India. Myers, N. 1988. Threatened biotas: ‘hotspots’ in tropical forests. Environmentalist, 8: 187208. Myers, N. 1990. The Biodiversity Challenge: Expanded hot-spots analysis. Environmentalist, 10: 243-256. Myers, N. 1993. Operational criteria for deforestation “Hot Spots”. Institute for Remote Sensing Applications, Joint Research Center of the European Communities, Ispra/ Varese, Italy. Myers, N., Mittermeier, R. A., Mittermeier, C. C., da Fonseca, G. A. and Kent, J. 2000. Biodiversity hotspots for conservation priorities. Nature, 403: 853-858. Nayar, M. P. 1996. Hotspots of Endemic Plants of Indian, Nepal and Bhutan. Tropical Botanic Garden and Research Institute, Thiruvanamthapuram, Kerala. Paria, N. D. 2014. Botanical Research in India in the domain of seedling morphology in relation to taxonomy. Science and Culture, 80(9&10): 262-270. Takacs, D. 1996. The Idea of Biodiversity. Johns Hopkins University Press, Baltimore.

Animesh Bose et.al.  | 11

Vavilov, N. I. 1935. Selected writings of N. I. Vavilov: the origin, variation, immunity and breeding of cultivated plants. Translated from Russian by K.S. Chester. Chronica Batanica, 13: 1-93. Williams, K. J., Ford, A., Rosauer, D. F., De Silva, N., Mittermeier, R., Bruce, C., Larsen, F.W., Margules, C. 2011. Forests of East Australia: The 35th Biodiversity Hotspot. In F.E. Zachos and J.C. Habel (eds.), Biodiversity Hotspots. Springer-Verlag Berlin Heidelberg, 295-310. Wilson, E. O. 1988. Biodiversity. National Academy Press, Washington, DC. Wilson, E. O. 1992. The Diversity of Life. Harvard University Press, Cambridge. World Conservation Monitoring Centre (WCMC). 1992. Global Diversity: Status of the Earth’s Living Resources. Chapman & Hall, London. WRI, IUCN, and UNEP. 1992. Global Biodiversity Strategy. World Resources Institute, Washington, D.C.

mmm

Trends in Frontal Areas of Plant Science Research Edited by: S. Sinha, R.K. Sinha © Department of Botany, Tripura University, 2017

Exploitation of Biodiversity for Genetic Improvement of Banana Anath Bandhu Das P.G. Department of Botany, Utkal University, Vani Vihar, Bhubaneswar 751004, Odisha, India, Corresponding author: [email protected]/[email protected]

Bananas make largest agricultural production that are cultivated in more than 120 countries in the world. Banana products represent an essential food resource and have important roles in socioeconomic and ecological context. All the cultivated varieties are generally seedless triploid clones either from the species Musa acuminata (group AAA) or from species Musa balbisiana (group BBB) or mixture of both A genome and B genome forming groups AAB and ABB. Varieties of banana (table top type) and plantains (cooking type) are diploid in wild and sometime outcome of natural breeding and selection process to form tetraploid clones of AA and AB genomes. The main banana varieties cultivated for export, known as ‘Grande Naine’, ‘Poyo’ and ‘Williams’, belong to the monospecific triploid bananas (AAA) of the Cavendish sub-group. They differ from each other only in somatic mutations such as plant height or bunch and fruit shape. Diploid bananas, close to the ancestral wild forms, are still cultivated in Southeast Asia. In other regions, triploid clones belonging to different sub-groups – Plantain, Silk, Lujugira, Gros Michel, Pisang Awak – are the most widely distributed. Bananas are not only consumed as fresh fruits but also cooked, like plantains. They are processed into chips, fries, fritters, purees, jams, ketchup and alcohol. The daily per capita consumption of bananas ranged from 30 g to over 500 g in some East African countries. Other parts of the plant are also used like the pseudostem is used for its fibres and as floaters (Musa textilis) in the Philippines, and the leaves are used to make shelters or roofs or as wraps for cooking. In Thailand, the floral buds of particular varieties (Pisang Awak) are used in various culinary preparations. Some varieties are also considered to have medicinal properties. Since banana possessed very narrow genetic difference with very small genome size like M. acuminata (~537Mbp) and M. balbisiana (~591- 615 Mbp), it is very difficult to protect banana from divesting disease and pests (Stover and Simmonds 1987, Jones 1999); hence address of this issue is very important for banana improvement. Various major fungal diseases like Sigatoka disease caused by Mycosphaerella musicola and black leaf streak disease caused by M. fijiensis result in severe losses in crop production. In certain

14  |  Exploitation of Biodiversity for Genetic Improvement of Banana

areas, Fusarium wilt due to the soil born fungus Fusarium oxysporum f. sp. cubense prevents the cultivation of susceptible varieties like the Gros Michel types. Great constraints are also exerted by the nematodes – Radopholus similis and several representatives of the genus pratylenchus – and by the black weevil of banana, Cosmopolites sordidus. Besides, viral diseases are greatest concern mainly of banana bunchy top virus, banana streak virus and banana bract mosaic virus. So need of potential wild cultivars of banana, with resistant characters of these disease, is prime concern in the current context of banana improvement programme. North East India is a treasure house of a large number of wild diploid, tripold and tertaploid banana germplasm which has great potential to explore and to catalogue these untapped genetic resources in a consortium mode. Genetic improvement has mainly focused on obtaining varieties resistant to principal pests and diseases. Breeding bananas through hybridisation, which began in the 1920s, is currently being pursued at different countries of the world. FHIA in Honduras is breeding banana for export as well as the ‘cooking’ types (Rowe 1984). EMBRAPA-CNPMF in Brazil (Dantas et al. 1993), NRCB and TNAU in India (Sathiamoorthy et al. 2000, Krishnamoorthy and Kumar 2004) aim at breeding local types of dessert and cooking bananas. CARBAP (Jenny et al. 2003) in Cameroon and IITA (Tenkouano and Swennen 2004) in Nigeria are conducting research on plantain and banana breeding in Africa. These research centres are mainly interested in developing new tetraploid varieties by crossing triploid varieties and wild or improved diploid clones with resistance to diseases. In the French West Indies, CIRAD has conceived another crossing strategy aimed at the development of triploid varieties directly from diploid plant material (Bakry et al. 2001). Since the 1980s, apart from these conventional breeding approaches, other groups have focused on mutagenesis as at IAEA (Roux 2004) in Austria or on the selection of somaclonal variants as at TBRI (Hwang and Ko 1990) in Taiwan. These technologies appeared as a result of the development of in vitro culture techniques designed for rapid industrial multiplication of micro-propagated banana plants.

Morphology of Banana Banana is a giant herb with pseudostem, formed by interlocking leaf sheaths, reaches height of ~1.0 m to 8.0 m. The leaves emerge from the apical meristem of the underground rhizome (true stem). The bud eventually gives rise to a shoot and the central meristem induces the ‘flower’ primordia, followed by the growth and elongation of the true stem within the pseudostem and later by the emergence of the inflorescence. The emergence of inflourence varied from 6-7 months to 1-1.5 years. The inflorescence can be vertical, pendant or sub-horizontal and is complex which made up of an ear of cymes. Cymes are inserted spirally on the floral stem and are composed of one spathe and single or double rows of flowers at its axils. These are the first ranks of flowers, usually called ‘hands’, from which the fruit bunches develop. The first hand contains female flowers with an ovary in the inferior position and non-functional stamens reduced to staminodes. Sometimes the stamens develop but these first flowers are hermaphrodite. Wild bananas have fruits

Anath Bandhu Das  | 15

filled with seeds with little pulp. In parthenocarpic banana plants, the ovaries of female flowers are filled with pulp that forms the fruit without pollination or seed formation. As female fertility is quite low or sometimes null. After the female flowers, two or three hands of neutral flowers appear with undeveloped floral parts, followed by hands of male flowers with reduced undeveloped ovaries and well developed stamens. In some cultivars, growth of the ear meristem is stopped very early, but the inflorescence generally continues to grow indefinitely to form the so-called male bud. If it is not cut, this male bud will continue to grow until fruit maturity. In addition to wild species, many cultivars have male flowers with some degree of pollen fertility.

Agronomic Variations Characterization and botanical classification of different banana varieties have been made through morphotaxonomy (Simmonds and Shepherd 1955, Simmonds and Weatherup 1990). A set of 119 agro-morphotaxonomic descriptors has been defined as the norm for description of bananas (IPGRI-INIBAP and CIRAD 1996). These descriptors serve as a basis for a system of information exchange between collections and the MGIS (musa germplasm information system), run by INIBAP. Computerized tools have also been developed to identify the varieties on the basis of these descriptors (Perrier and Tezenas du Montcel 1990). There is considerable variability regarding the aerial parts in the wild germplasm. Pseudostem colour, presence of colour spots at the petiole base, the shape of the petiolar canal, plant height and growth habit varied from germplasm to germplasm. Most important variations were found in the inflorescences and consequently the fruit bunches. Differences between fruits are determined by their size, shape and colour along with the pulp colour. Dessert bananas vary in taste and aroma; some diploid Pisang Mas cultivars are very sweet, Silk Bananas are sweet and acidulous and the Cavendish bananas are bland in nature. Clones of the plantain sub-group have a very firm cooking orangeyellow flesh unlike other cooking bananas (sub-groups Laknao, Popoulou, Bluggoe and Monthan). Lujugira, the so-called East African highland bananas, are quite unique and, depending on the clone, used for cooking or brewing beer. Morphological variability in the male floral bud involves differences in the shape and colour of the bracts and male flowers (Figs. 1-8)

16  |  Exploitation of Biodiversity for Genetic Improvement of Banana

Figs. 1-3. Musa wild germplasm; Musa ornate (1a-b), M. velutina (2a-b); M. laterita (3a-b). Figs. 4-8. Musa wild germplasm; Musa beccarii (4a-b); M. paradisica (5); M. balbisiana (6); M. itinerans var. formosana (7); M. acuminate (8)

Origin of Banana Musa L. of the family Musaceae is separated into five sections (i) Australimusa with 2n = 20 (TT genome), (ii) Callimus a with 2n = 20, (iii) Rhodochlamys with 2n = 22, (iv) Eumusa with 2n = 22 and (v) Ingentimusa with out any proper classification. Species classified among Callimusa and Rhodochlamys mainly contain plants of floral interest. Among the Australimusa, some accessions are cultivated for their fibre and mainly belongs to M. textilis. Several other Australimusa accessions have edible fruit on erected bunches which are only cultivated in the Pacific region. All the other Musa accessions with edible fruits are bananas. Kurz (1865), Dodds (1943) and Cheesman (1947) suggested that bananas related to Eumusa are originated mainly from two wild diploid species i.e. M. acuminata

Anath Bandhu Das  | 17

(A genome) and M. balbisiana (B genome). Plants of these two species produce fruit filled with seeds. They reproduce both sexually and by vegetative means from shoots. In Southeast Asia, fruits of some wild accessions are consumed before the seeds become hard and in particular, varieties with soft seeded fruits are consumed. But real edible bananas are results of a combination of fruit parthenocarpy and sterility. As mentioned by Simmonds and Shepherd (1955), domestication is a succession of non-linear but interdependent stages followed by selection of parthenocarpic clones, selection for gametic sterility, selection of triploid plant and enhancement of the phenotypic diversity through vegetative propagation. Parthenocarpy is usually considered as a pure acuminata character and is polygenic in nature (Simmonds (1953). The domestication was observed in areas of Philippines, north of the Moluccas in Indonesia and in Papua New Guinea for starchy fruit. Besides, seed-bearing wild M. acuminata subsp. banksii with high starch content were also reported (Simmonds 1962). Existence of parthenocarpic pure balbisiana is still being discussed (Jarret and Litz, 1986, Valmayor et al. 1991). Dodds and Simmonds (1948) and Dessauw (1988) suggested that auxin metabolism perhaps disturb the development of seeds in the fruits leading to parthenocarpy. Chromosomal factors also play a major role in banana fertility during the course of evolution. Structural heterozygosity and triploidy are the major factors known to cause meiotic errors that lead to lower fertility (Bakry et al. 1990). Dodds (1943), Dessauw (1988) and Shepherd (1999) showed that more than four chromosome rearrangements exist within the M. acuminata complex following the spatial and temporal isolation of the acuminata sub-species. Shepherd (1999) structured the species in six groups called ‘translocation group’ that differentiate by at least one rearrangement and he described the meiotic disturbance of the intergroup hybrids. Sterility of interspecific hybrids may have a genomic origin as the homology between the genome acuminata and balbisiana is partial. The 3x and 4x bananas are often more vigorous and give larger fruits than diploids. In natural conditions, triploid varieties have resulted from cross-pollinations between diploid clones producing 2n gametes and diploid clone producing n gamete (Fig. 9, Redrawn from Bakry et al. 2009).

Phenotypic and Genotypic Diversity Global phenotypic diversity of the recent triploid varieties is resulted from (i) fixation by the sexuality of ancestral triploid plants followed by (ii) diversification due to the vegetative propagation. Varieties derived from each other by vegetative propagation are related to the same sub-groups in Musa complex. Musa origin and migration of cultivars have been drawn by

Fig. 9.  Diagrammatic representation of domestication of Musa species. Reproduce from Bakry et al. 2009.

18  |  Exploitation of Biodiversity for Genetic Improvement of Banana

Champion 1967, De Langhe 1995, Rossel 1999, Lentfer and Boyd 2004, Lejju et al. 2006, Ball et al. 2006). Bananas were cultivated from India to the Pacific region, from north of Australia to Taiwan and even in southern Japan in the early days. They were introduced at various times in Africa more than 3000 years ago. Plantains and a few diploids were the first to reach East Africa and Southeast Asia (De Langhe 1995). Bantu-speaking peoples took them to West Africa. Now a days, plantains have almost disappeared from the east coast of Africa, but are found in all the humid zones of Central and West Africa. In the fifth century, introduction of so-called East African highland bananas and cooking bananas was done originally from Indonesia via Madagascar. On the American continent, the appearance of dessert-type banana plants is linked with the discovery of the New World in the fifteenth century. However, cooking types – plantains may have arrived earlier from the Philippines on the west coast of South America, in Peru and Ecuador, about 200 years before the current era (Langdon 1993). The evolution involved species existing within a given biotope gave rise to monospecific M. acuminata cultivars or to inter-specific hybrids derived from crosses between M. acuminata and M. balbisiana and even between sections Eumusa and Australimusa (Jenny et al. 1999). The diploid bananas, wild and cultivated, are presently much less widespread than the cultivated triploids. However, they are still found in the endemic state throughout Southeast Asia. The diploid clones are nevertheless indispensable for genetic improvement programmes, especially because of the low fertility of the triploids. The seminiferous wild bananas of the genus Musa are found in the humid but welldrained valleys and glades of forests in the tropical zone, in south and Southeast Asia and in the Pacific from the Indian peninsula to the Samoan islands. More than 25 species have been reported within the genus Musa. Species belonging to Australimusa (T genome) and M. schizocarpa (S genome) of the section Eumusa are present in the eastern area of Indonesia, Papua New Guinea and the Pacific. The Australimusa are identified by their erect inflorescence. The various species of this section were described by Cheesman (1947) and Argent (1976) as related and morphologically very close. Molecular analyses show little variability and structuration compared to the Eumusa section. M. schizocarpa is characterized by water-green stem colour and a green colour of the bracts of the male bud. Little variability has been found at the morphological as well as at the molecular level compared to M. acuminata (Argent 1976, Carreel et al. 1994). M. balbisiana, of the section Eumusa, is found from India to the Philippines, Papua New Guinea and occasionally in the Indochina peninsula. During the previous decade, new interest for this species resulted in the identification of more polymorphism (Uma et al. 2005, Ge et al. 2005). Still more plant molecular characterization are therfore needed. Only AA varieties of the Pisang mas type, which have small, very sweet fruits, are cultivated on a large scale outside their zone of origin. Diploid edible bananas or cultivars are classified according to their genome in groups AA, AB, AS or AT, of which more than 90% are AA. The general cloud structuration can be explained, through the analysis of cytoplasmic and nuclear genomes, as originated from a gene flow between the M. acuminata sub-species. In banana, information on the chloroplast and mitochondrial

Anath Bandhu Das  | 19

genomes indicated a paternal heredity (Faur´e et al. 1994). The AA cultivars can thus be divided into nine cytoplasmic types or cytotypes, but most of them correspond to three cytotypes only. Each cytotype can be assigned either to distinct sub-species or to an intersubspecific origin. The use of more complete morpho-descriptors or molecular markers and their analysis by multivariate statistical methods led to organisation in genomic groups: AAA, AAB and ABB with few AAT/ATT/AAS. The RAPD and RFLP data do not indicate a clear distinction between AAB and ABB as morphological markers. M. balbisiana is less polymorphic with the molecular markers and the two genomes B of ABB are rarely differentiated. Several AAB cultivars also have their two A genomes nearly identical (Carreel et al. 2002). Differences between morphotaxonomy and molecular analysis also show that limits of sub-group are not always as clear as in the best known plantain or Cavendish subgroups. D’Hont et al. (2000) checked with GISH the exact genome structure of some interspecific cultivated clones. In most cases, the results were consistent with the chromosome constitution estimated by means of phenotypic descriptors (e.g. 11 A and 22 B for the ABB). Exception was found inthe clone ‘Pelipita’which has 8 A and 25 B chromosomes instead of the predicted 11 A and 22 B. Within each group, it is also possible to distinguish clones of the dessert type from clones of the cooking type within the AAB on a morphological basis, and within the three groups AAA, AAB and ABB by means of molecular markers. Thus, among the AAB, dessert bananas of the sub-groups Silk, Mysore, Pome-Prata and Pisang Kelat are differentiated from the typical cooking bananas; Plantain, Popoulou, Maia Maoli and Laknao. It is to be noted that the clone Pisangaja Bulu of the sub-group Pisang Rajah has a profile intermediate between the dessert and cooking types. This dessert/cooking classification can be ascribed to the genome A of each of these sub-groups.

Genetic Resources Utilization A distinction can be made between production for export and for domestic markets in India, Brazil and Africa where a subsistence food-crop system prevails. Cultivation of bananas for export has passed through several stages in the last 100 years (Maillard 1986). Literature survey (1870) indicated that the report of the first export of Gros Michel bananas was found from Jamica to the North American markets and therafter, in 1880 from Costa Rica where Keith set up a commodity chain. Two years later, Fyffe began to supply the English market with ‘Dwarf Cavendish’ from the Cavendish sub-group, which had flourished in the Canary Islands since the beginning of the fifteenth century. Gros Michel, which is characterised by the natural robustness of its fruit, permitted shipment of entire packed bunches. Because of its tall height, only low-density plantations were possible – 800 plants per h – and treatment of plants against leaf diseases was difficult. Productivity decreased progressively in plantations due to wilt disease as the variety proved susceptible to a soil fungus, Fusarium oxysporum f. sp. cubense, which blocks the conducting vessels of the stock and leaf sheaths. Identified in tropical America (Costa Rica and Panama) since 1890 (Stover 1962), this disease, called Panama disease, prompted growers to search for new territories as no effective antifungal treatment was known. At

20  |  Exploitation of Biodiversity for Genetic Improvement of Banana

present, all bananas grown for export belong to the sub-group Cavendish in which the cultivars differ from each other only by mutations. Six main clones, distinguishable by their size and a few associated characteristics, have been cultivated for some years: ‘Lacatan’, ‘Val´ery’, ‘Poyo’, ‘Williams’, ‘Grande Naine’ and ‘Dwarf Cavendish’. Although distinct from an agronomic point of view, all Cavendish varieties are difficult to differentiate by refined molecular biology methods. Production of dessert bananas for export (14m tons per year in 2006) relies on a very narrow genetic basis and is therefore at the mercy of any new pathogen. In fact, this has already happened with the appearance of race 4 of Fusarium oxysporum f. sp. cubense on Cavendish bananas in subtropical production zones like South Africa, the Canary Islands, Australia and Taiwan. Diversified production for local markets is estimated to be 87m tons per year in 2006. The Cavendish bananas alone represent 43% of this domestic production, the other sweet and sweet acid varieties totalizing nearly 12%. Among cooking bananas, plantains represent 18% of the world production whereas other cooking varieties and bananas of mixed use totalize 26% (Lescot 2006). Many banana cultivars, genetically very different, are cultivated in Southeast Asia and the Pacific region. Diversity within the same area – field, plot, farm – reduces with remoteness from the centre of origin of the species. Dessert banana production and consumption in Brazil, one of the three largest producing countries in the world, together with India and Uganda, are mainly based on varieties belonging to the Cavendish, Pome and Silk sub-groups. In West and Central Africa, production is based on cooking bananas of the plantain sub-group, including more than 100 cultivars. Beer and cooking bananas, different from plantains, are chiefly grown in East Africa. Europeans and North Americans almost solely consume Cavendish bananas. Contrarily, Asians relish all types of bananas: ‘Pisang Mas’ (the small ‘Figue Sucr´ee’), Pisang Awak and Lakatan, among the better known, but also Pisang Tandok of the plantain sub-group, Gros Michel and Silk bananas.

Low Effency in Banana Breeding Programme Most of the cultivated bananas are triploid, with a low fertility and high heterozygosity. Progenies are usually of small size and composed of a mix plant of different ploidy level or aneuploids. Little knowledge on genetics and heredity is available. The low fertility of cultivated bananas is a handicap for breeders. Triploid varieties may usually produce a few seeds when pollinated. In triploids, seed setting is overall higher in ABB in comparison than AAB. Seed set is lower and vary from no seed in Cavendish to ~ 400 seeds per bunch in some AAB clones when pollinated with wild species (Bakry and Horry 1992a). In triploid varieties, the number of fruits per bunch varies from 100–250 and the number of ovules ranking from 300–600 per fruit. In the absence of gamete sterility, the seed potential could be theoretically estimated from 30,000 to 150,000 seeds per bunch. In triploid bananas, reproductive barriers induce a reduction of about 99.8–99.9% of female fertility. In diploids, the inter-specific AB clones are completely sterile probably due to the partial homeology between the acuminata and balbisiana chromosomes whereas AA varieties show a wide range of male and female fertility. The overall fertility of AA varieties

Anath Bandhu Das  | 21

is higher than the triploid fertility. In wild clones, there are fewer reproductive barriers, the male flowers being plenty of viable pollen as the fruits, plenty of seeds. Quantities over 5,000 seeds per bunch are usual in wild acuminata as wild balbisiana accessions. Seeds in cultivated clones are often abnormal with the absence of embryo or endosperm like in inter-specific acuminata × balbisiana crosses. Seeds containing no endosperm usually show irregularities compared to wild clones. So, the seeds coming from controlled pollinations germinate rarely (over 20%) under greenhouse conditions. This explores in vitro embryo rescue in banana breeding, which can increase germination rate often up to 85% (Bakry and Horry 1992a). These difficulties to breed cultivated bananas did not favour progress in genetic studies. Abnormalities in the meiosis are very frequent in diploid and triploid clones showing chromosomes pairing of regular bivalents. At the diploid level, structural heterozygosity that is present in most diploid varieties brings aneuploid gametes with 12–16 chromosomes instead of 11.These irregularities lead to the formation of gamete distributions with strong shifts for recombination and in relation to the random distribution of alleles (Vilarinhos 2004, Vilarinhos et al. 2004). At triploid level, occurrence of aneuploid gametes and formation of 2n to 4n gametes are also frequently reported. So far, no genetic studies have been really developed on bananas. For the moment, the principles of banana improvement still rely on crosses between two parents bringing complementary features followed by a phase of phenotypic selection before eventual new crosses. The breeding strategies in bananas are not yet based on the recombination of genes but more on the association of outstanding phenotypes. More recent constraints in banana breeding are related to the occurrence of banana streak disease (BSD) in progenies caused by several strains of BSV (a plant pararetrovirus, genus Badnavirus from the Caulimoviridae family). Many interspecific acuminata/balbisiana hybrids derived from parents free of BSV have been found infected with one or several BSV strains that may lead to complete death. This infection is thought to arise from viral integrated sequences (EPRV, endogenous pararetrovirus) in the nuclear genome of M. balbisiana (B genome) (Harper et al. 1999). Some of the plants are immediately infected by virus after crosses of Lheureux 26 F. (Bakry et al. et al. 2003). Other hybrids showed a later expression of the disease under stress conditions (Dallot et al. 2001). The mechanism by which the EPRV-BSV is activated in inter-specific hybrids is under investigation. Some investigators decided not to use donors of B genome as they were shown to increase the probability of triggering the activation of EPRV-BSV. It is unfortunate because M. balbisiana confers rusticity, hardiness, good ratooning and ability to produce strong root system in hybrids. Till now, no M. balbisiana accession free of EPRV-BSV has been found in the most important ex situ Musa collections around the world. Therefore, there is a huge necessity to prospect new endemic M. balbisiana accessions in the centre of origin of the species (Uma et al. 2005) and to determine their status regarding BSV integrated sequences. At the same time, it is necessary to initiate a breeding programme to free the B genome from EPRV-BSV susceptibility. Clones in the ABB ‘Bluggoe’ and AAA ‘Gros Michel’ sub-groups are susceptible to Fusarium wilt or Panama disease of banana caused by the soil-inhabiting fungus Fusarium

22  |  Exploitation of Biodiversity for Genetic Improvement of Banana

oxysporum Schlecht f. sp. cubense. The currently described races of Foc refer to strains of the pathogen that have been observed to be pathogenic to particular host cultivars in the field. Race 1 is pathogenic to cultivars in the AAB ‘Silk’ and ‘Pome’ sub-groups and on AAA ‘Gros Michel’. Race 2 is pathogenic to ABB ‘Bluggoe’ and other closely related cooking bananas. Race 3 has been recorded on Heliconia species and has little to no effect on banana. Race 4 attacks AAA ‘Cavendish’ and all cultivars attacked by races 1 and 2. Chemical control, flood fallowing, crop rotation and the use of organic amendments have not been effective in managing Fusarium wilt. It is now generally accepted that the only effective means of control is by host resistance. Natural sources of resistance exist in wild species and cultivars and in synthetic diploids developed by breeding programmes. Biotechnology, mutation breeding and somaclonal variations are also being used to produce resistant genotypes. BLSD also affects many cultivars that have resistance to SD, such as those in the plantain sub-group (AAB). Yield losses of up to 50% have been reported in some cases. Mycosphaerella musicola was first identified in Java in 1902. Resistance to fungicides has been developed by both M. fijiensis and M. musicola strains causing sigatoka leaf spot disease in the Caribbean, Central America and Africa. Genetic resistance to BLSD and SD is clearly the best long-term goal for disease control especially for smallholders who cannot afford to purchase chemicals. The inheritance of the BLSD resistance from the wild diploid Calcutta 4 has been studied in various crosses. Progenies of crosses made between wild diploids (AA) are now being studied in order to understand the inheritance of BLSD resistance and to localize genes or quantitative trait loci (QTLs) using genetic maps (Carreel et al. 1999). Nematode species cause the most serious damage to bananas due to migratory endoparasites, Radopholus similis, Pratylenchus coffeae and Pratylenchus goodeyi, the endoparasite Helicotylenchus multicinctus and the sedentary parasite Meloidogyne spp. Depending on local conditions, the associated damages of any of these nematode species may be locally important where their densities are high (Gowen et al. 2005). Nematodes infection can be controlled by nematicides in the field or by modified agricultural practices (planting of healthy banana tissue cultured plants in cleaned soils) (Chabrier and Qu´en´eherv´e 2003). Thus, nematode resistance is not yet the priority for dessert banana breeders in comparison to Fusarium wilt. In addition, resistance to nematodes through genetic improvement is hindered by difficulties associated with banana breeding. Despite these difficulties, some progress has been made. Several clones of ‘Pisang Jari Buaya’ (AA) have been recognized as an exploitable source of resistance to burrowing nematode. At CIRAD, some AA cultivated clones have also been identified as tolerant or resistant to several species of nematodes (Qu´en´eherv´e et al. 2006) and most of their triploid progenies shown to be more tolerant to these pathogens than the Cavendish varieties.

Biotechnological Improvement In vitro mass multiplication and somaclonal variation Remarkable progress has been made particularly during the 25 years on micropropagation of bananas through proliferation of vegetative meristems in vitro. This method is now

Anath Bandhu Das  | 23

widely used to promote the exchange of germplasm and to produce material for planting. Many morphological and agronomic variations have appeared in plants obtained by micro-propagation (Vuylsteke et al. 1991, Cˆote et al. 1993). Hence, given the difficulties in conventional breeding, several research groups have attempted to increase the variability of bananas in the Cavendish sub-group by focusing on somaclonal variations (Daniells and Smith 1993) or inducing mutations artificially (Roux 2004). Micro-propagation has many advantages: high multiplication rates of clean planting materials and the small amount of space required to multiply large numbers of plants. In vitro propagated plants did not manifest however superior performance compared to conventional suckerderived propagules under severe pathogen’s epidemics or suboptimal crop husbandry (Vuylsteke and Ortiz 1996). Nonetheless, a major advantage of in vitro-derived plants would be their more homogenous growth, which has implications for research and timing of field practices (Blomme et al., 2008). Tissue culture-derived plantlets would be also most relevant for establishing field nurseries for further conventional propagation or newly bred or selected germplasm. Somaclonal variation is genetic variation resulting from micro-propagation and appears to be ubiquitous in Musa. Although most variants are inferior to the original cultivar from which they were derived (Smith and Drew 1990, Vuylsteke et al. 1996), it is possible to recover a few superior somaclonal variants. In order to carry out recurrent selection over several successive cycles, each including a micro-propagation phase and a selection phase in the field, Cavendish clones were identified with new resistance (to pathogens/pests), fruit quality and productivity traits. Among the in vitro plants of a traditional Cavendish variety, susceptible to tropical race 4 of Fusarium wilt, a variant clone resistant to the disease, Pei-Chiao, was selected by TBRI in Taiwan. This clone had unfavourable agronomic characteristics but, after in vitro multiplication, led to another clone, Tai-Chiao No.1, with resistance to the disease and improved production characteristics (Tang and Hwang 1994). In last 15 years, more than ten local cultivars of Indian banana from Odisha regions have been exploited for in vitro mass multiplication (Das and Das 1991, 1992, Palai and Das 2002) and protocol have been standerized for cooking and table top banana and cultivated in almost all districts of Odisa. The varieties includes table top types (Cavendish, Grande Naine, Red velchi, Chakrakeli, Malika, Champa and Khatia) and cooking types (Gajabantala, Mendhi bantala and Paunsia bantala). In genral, micropropagation of banana requires high amount of BAP or Kn (2-6 mg-l) to produce shoot multiplication supplemented with low amount of IAA or NAA (0.1-0.5 mg –l) in MS media (Murasige and Skoog 1962). In vitro rooting requires only IAA 0.1-0.2 mg-l supplemented with 0.5 mg –l activated charcoal. Subsequently, the culture plants could be acclimatized and hardened in green house and net house condition (Figs. 10-15). Prolonged culture and use of old multiplication stock resulted somaclonal variation in tissue culture banana with genetic variability. Some of the somaclonal varients are found in tissue culture having not much of of good agronomic traits but have potential for improvement (Figs 16-17). Therefore, any in vitro mass multiplication of banana should always backed up by molecular screening of genetic fediality, ploidy checking and virus or pathogen indexing for obtaining disease free, authentic qualitity planting material.

24  |  Exploitation of Biodiversity for Genetic Improvement of Banana

Figs. 10-15.  Different stages of in vitro mass multiplication of banana Musa accuminata var. Robusta. Shoot bud initiation (10), shoot multiplication & elongation (11-12), rooting (13), greenhouse aclamitazition in portray (14) and Net house hardening

Anath Bandhu Das  | 25

Figs. 16-17.  Somaclonal variation obtained in tissue culture banana Musa accuminata var. Robusta. Multihead flower bunches with out leaf originated directly from rhizome (16) and chlorophyll deficient albuno mosice on leaf (17).

Figs. 18-19.  FISH of hAT 1 element on Musa acuminata. Pisang Rajha showing hAT signal on AAA genomes with signals (18), Williams showing hAT signals on all the AAA chromosomes (19).

26  |  Exploitation of Biodiversity for Genetic Improvement of Banana

The somaclonal variation used in breeding has the following advantages and disadvantages: Advantages: (i)The development of new and stable variants (ii) High variation frequency (iii) The development of variability in agronomic characteristics. Disadvantages are : (i) Uncontrollable and imperceptible variations (ii) Variability is not new and apparently useless (iii) Nature and frequency of variability depend on the genotype and other factors (iv) Some variations are unstable and not inherited. In vitro and field somoclonal variations produced dozens of cultivars of the (AAA) genomic group, a Cavendish subgroup, and of the AAB cultivars such as Pacovan, a ‘Prata’ mutant. Thus, the selection of superior clones can contribute significantly to the increase in production and quality of the banana fruits. Lichtemberg (1997) emphasized the importance of selecting natural mutants for banana crops in Israel, South Africa, Australia and Spain (Canaries). These countries cultivate little more than 40,000 hectares of banana, in subtropical conditions. In South Africa, this selection is carried out with the help of farmers from pre-select clones in their plantations and later studied by public research institutions (Lichtemberg, 1997). In Israel, private companies maintain breeding programs using clone selection as the most promising technique (Khayat et al. 1998). To verify the true value of selections carried out in tropical regions, clones from Israel were evaluated in the Philippines, and they showed an 18% productivity increase over the best local selection, as well as superior quality (Khayat et al. 1998). Presenty, Israel exports plantlets of these clones worldwide, including Central and South America, and, more recently, the Northeast of Brazil. Clones selected in Israel, Taiwan, South Africa, Canarias and Australia are being evaluated in the Madeira Island and South Africa (, Eckstein et al., 1998, Ribeiro and Silva 1998). Mutants resistant to pests and diseases are easier to select than superior clones for quality, productivity, architecture and plant height. Hwang and Ko (1986) evaluated the field behavior of a diverse number of banana mutant clones of the Cavendish subgroup in Taiwan and obtained resistant genotypes to Fusarium oxysporum f. sp. Cubense (race 4), responsible for the Panama Disease by meristem culture.

Somatic Embryogenesis Somatic embryogenesis focuses essentially on two objectives: development of new effective micro-propagation techniques and of cell regeneration systems necessary for the development of non-conventional breeding programmes. The technique was successfully applied to diploid immature embryos and then to plant tissues (Novak et al. 1989, Dhed’a et al. 1991) and floral tissues (Escalant et al. 1994). Regeneration of plants by adventitious embryogenesis and cell suspensions has also progressed (Cˆote et al. 1996). These embryogenesis methods were developed in very different genotypes: cultivars of dessert and cooking triploid bananas of agronomic interest and diploid clones useful for genetic improvement programmes.

Current Status of Transgenic Banana Several research centres were involved in this work, including the Katholieke Universiteit Leuven (KUL), Belgium, Boyce Thompson Institute (BTI) for Plant Research associated

Anath Bandhu Das  | 27

with Cornell University (USA), Centro Agron´omico Tropical de Investigaci´on y Ense˜nanza, Costa Rica (CATIE), International Atomic Energy Agency, Austria (IAEA), Queensland University of Technology, Australia (QUT) and French Agricultural Research Centre for International Development, France (CIRAD). Transgenic banana plants were first obtained by particle bombardment of cell suspensions (S´agi et al. 1995) and by Agrobacterium tumefaciens inoculated on in vitro sections of plant meristems (May et al. 1995) and on cell suspensions (Khanna et al. 2004). Priority is given to transferring genes to confer resistance to viruses – CMV and BBTV. Moreover, strategies for the acquisition of these resistances by genetic transformation are now available. Considerable damage inflicted by weevils and nematodes justifies rapid implementation of research programmes focusing on protease inhibitors and Bacillus thuringiensis (Bt) genes. The damage caused by Mycosphaerella and Fusarium fungi has already prompted research to identify resistant genes –chitinases, antifungal proteins and so forth (Pei et al. 2005). Several groups have also considered modifying the metabolic routes that control ripening – the anti-sense gene 1-aminocylopropane-1-carboxylate synthase – to stop ethylene synthesis and to decrease the maturation of the fruits in non-refreshed post-harvest conditions. Recently, researchers from the Bhabha Atomic Research Centre, India, investigated the possibility of producing hepatitis B antigen in banana with the aim of developing an oral vaccine (Kumar et al. 2005). The transgenic banana plants resistant for bacterial wilt disease can be developed by using genes for antimicrobial peptides, and other plant defense-related proteins that tend to act as bactericidal compounds. Genetic transformation using microprojectile bombardment of embryogenic cell suspension is now routine work (Becker et al. 2000, Sagi et al. 1995). An efficient method for direct gene transfer via particle bombardment of embryogenic cell suspension has been reported in cooking banana cultivar Bluggoe and plantain (Sagi et al. 1995). Becker et al. (2000) reported the genetic transformation of Cavendish banana cv. Grand Nain. The recovery of transgenic plants of banana obtained by means of Agrobacterium tumefaciens mediated transformation has also been reported. The protocol has been developed for Agrobacterium mediated transformation of embryogenic cell suspensions of the banana cultivars Rasthali (Ganapathi et al. 2001). The protocol has also been established using shoot tips from various cultivars of Musa (May et al. 1995, Tripathi et al. 2002, 2003). Researchers of International Institute of Tropical Agriculture (IITA), Uganda in collaboration with National Agriculture Research Organisation (NARO), Uganda are attempting to establish the genetic transformation of East African Highland Bananas (EAHB) using the shoot tips, at Kawanda Agriculture Research Institute (KARI).

Cytology and Molecular Cytogenetics Cytological analysis was recorded from long time in banana. The basic number n = × = 9,10,11 was recorded by number of authors. However, most of the edible bananas were found to be triploid (2n = 33) having small to medium size chromosomes with symmetric karyotype. Thus, a very little information on germplasm characterization is available aided with chromosome number and structure. In our laboratory we completed cytology and

28  |  Exploitation of Biodiversity for Genetic Improvement of Banana

karyotype and cytophotometric analysis of nine varieties of banana which showed static chromosome number (3n = 33) but with a little variation in karyotype and DNA content (Das and Das 1997). Cytogenetic tools have been improved to obtain high-resolution banding patterns for identifying deletions, insertions or translocations on chromosomes. Molecular cytogenetics is now used as a powerful tools to those already available for studying genome organization, evolution, recombination and help to identify physical localization of gene on chromosome.

Fluorescent in Situ Hybridization (FISH) on Banana Chromosome Fluorescent in situ hybridization (FISH) was used on mitotic chromosomes (Figs. 18 - 19) to localize the physical sites of 18S-5.8S-25S and 5S rRNA genes in Musa (Doleželová et al. 1998, Osuji et al. 1998). A single major intercalary site was reported on the short arm of the nucleolar organizing chromosome in both A and B genomes. Diploid, triploid and tetraploid genotypes showed two, three and four sites, respectively. Heterogeneous Musa lines showed different intensity of signals that indicate variation in the number of copies of these genes. 5S rDNA were found in eight and six subterminal sites in Calcutta 4 (AA) and Butohan 2 (BB) respectively. Triploid lines showed six to nine major sites of 5S rDNA of widely varying intensity. The diploid hybrids had five to nine sites of 5S rDNA while the tetraploid hybrid had 11 sites (Osuji et al. 1998). Dual colour FISH showed that the satellite chromosomes carrying the 18S-25S loci did not carry the 5S loci in all studied accessions but telomeric sequence was detected as pairs of dots at the ends of all the chromosomes without intercalary sequences (Doleželová et al. 1998). Detection of the integration of viral sequences of banana streak badnavirus (BSV) in two metaphase spreads of Obino l’Ewai plantain (AAB) was achieved using FISH (Harper et al. 1999). The monkey  retrotransposon was identified and localized in  Musa using FISH (Balint-Kurti et al. 2000). Useful cytogenetic markers for Musa, with low amounts of repetitive DNA sequences of BAC clones were used as probes for FISH on mitotic metaphase chromosomes (Hřibová et al. 2008). Only one clone gave a single-locus signal on chromosomes of M. acuminata cv. Calcutta 4 with a cluster of 5S rRNA genes. Most of the BAC clones gave dispersed FISH signals throughout the genome. A modern chromosome map technology known as high-resolution fluorescent  in situ hybridization (FISH) was applied in Musa species using BAC clone positioning on pachytene chromosomes of Calcutta 4 (M. acuminate of Eumusa group and M. velutina of Rodochlamys group. Centromeric retrotransposons were detected in banana chromosomes hybridized with MusA1 by FISH. Since all of the banana chromosomes are metacentric or submetacentric, signals were located around the centre of the chromosome, indicating that loci are found near or within the centromere (Neumann et al. 2014). Genomic organization and molecular diversity of two main banana DNA satellites were analysed in a set of 19 Musa accessions, including representatives of A, B and S genomes and their interspecific hybrids. FISH with probes for the satellite DNA sequences, rRNA genes and a single-copy BAC clone 2G17 resulted in characteristic chromosome banding patterns in M. acuminata and M. balbisiana, which may aid in determining genomic constitution in interspecific hybrids.

Anath Bandhu Das  | 29

The knowledge of Musa satellite DNA was improved by increasing the number of cytogenetic markers and the number of individual chromosomes can be identified in Musa (Cızkova et al. 2014).

Genomic in Situ Hybridization (GISH) Genomic in situ hybridization (GISH) is a powerful tool to differentiate alien chromosomes or chromosome segments from parental species in interspecific hybrids (Schwarzacher et al. 1989). In Musa, GISH was successfully applied to differentiate the chromosomes of different genomes on both mitotic and meiotic chromosomes. The first study that used GISH in Musa was with chromosome spreads prepared from root tips. The total genomic DNA of diploid lines AA and BB was able to label the centromeric regions of all 22 chromosomes of the corresponding line. However, the two satellite chromosomes of genome B labelled strongly with genomic A DNA. GISH discriminated A and B chromosomes in AAB and ABB cultivars hence, has immense potential for identification of chromosome origin and can be used to characterize cultivars and hybrids produced in Musa breeding (Osuji et al. 1997, D’Hont et al. 2000). GISH also successfully differentiated the chromosomes of the four known genomes, A, B, S and T, which correspond to the genetic constitutions of wild Eumusa species M. acuminata, M. balbisiana, M. schizocarpa and the Australimusa species, respectively (D’Hont 2005). Conventional cytogenetic and GISH analyses of meiotic chromosomes were now a days used to investigate the pairing of different chromosome sets at diploid and tetraploid levels, and to reveal the chromosome constitution of hybrids derived from crosses involving allotetraploid genotype. The 11 chromosomes were found as three sets in a tetrasomic pattern, three in a likely disomic pattern and the five remaining sets in an intermediate pattern. The segmental inheritance pattern exhibited by the AABB allotetraploid genotype implies chromosome exchanges between M. acuminata and M. balbisiana species, and opens new horizons for reciprocal transfer of valuable alleles (Jeridi et al. 2011).

Flow Cytometry in Genome Size and Ploidy Detection Flow cytometry (FCM) protocols have been applied for studying the natural variation in  Musa nuclear DNA content (genome size) for taxonomic purposes and for checking ploidy among gene bank accessions and breeding materials (Doležel et al. 1994, Kamaté et al. 2001, Asif 2001, Bartos et al. 2005). It was revealed that the A genome of M. acuminata and clones with AA genome constitution is around 12 % larger than the B genome of M. balbisiana, with small intraspecific variation in nuclear DNA found in a number of wild acuminata diploid and parthenocarpic bananas, whereas large variation seems to be exhibited among triploid varieties (Lysak et al. 1999, Kamaté et al. 2001). Genomic composition of Musa accessions on a core collection based on ITS (internal transcribed spacer sequences of the nuclear ribosomal DNA) regions and SSR polymorphism, along with assessment of DNA content and ploidy by FCM, has given support to the hypothesis of the occurrence of homologous recombination between A and B genomes, or between M.

30  |  Exploitation of Biodiversity for Genetic Improvement of Banana

acuminata subspecies genomes, leading to discrepancies in the number of sets or portions from each parental genome (De Langhe et al. 2010, de Jesus et al. 2014). Research on the genetic stability/instability of in vitro somatic embryogenesis (SE) cultures by FCM for polyploid bananas (Roux et al. 2003, 2004) and recently, by FCM and cytological analysis of embryogenic M. acuminata ssp. malaccensis cell suspension cultures, and of their somatic embryo-derived plantlets, adds support to the use of in vitro high-throughput production of clean banana planting materials for ploidy determination (Youssef et al. 2011).

DNA Markers PCR based markers, RFLP, nuclear and cytoplasmic molecular markers have been applied to manage genetic resources in banana. These studies enabled characterisation of genetic variability, determination of the extent of heterozygosity and characterisation of phylogenetic relationships between wild, diploid and triploid clones (Carreel et al. 1994). These results are now being used by CIRAD to define cross strategies leading to better parental combinations (Raboin et al. 2005). The first genetic map of banana was established on 90 loci-58 RFLP, 4 isozymic and 28 RAPD markers. This map was completed with 30 micro-satellite markers. A second map was made; it comprised more than 300 markers, distributed in 11 linkage groups, which correspond to the basic genomic number in bananas (Noyer et al. 1997). By combining these two maps, it was possible to come up with an outline map based on 130 locus-specific markers. This map could be helpful in carrying out marker-assisted selection (Carreel et al. 1999). Molecular DNA-based markers are powerful tools for gaining insights into individual genetic characteristics, and for determining allele frequency.

RFPL, RAPD, ISSR, SNP and IRAP Markers RFLPs have been found to be useful in Musa for constructing genetic linkage maps, characterizing germplasm, phylogenetic analysis (Gawel et al. 1992, Jarret et al. 1992, Lanaud et al. 1992, Bhat and Jarret 1995, Jenny et al. 1997) and analysis of variation in the chloroplast genome (Gawel and Jarret 1991, Baurens et al. 1997). RFLP markers have been linked to polymorphisms in resistance gene analogues (Hippolyte et al. 2014). These markers were useful for detecting genetic variations in Indian wild Musa balbisiana populations (Uma et al. 2006). The use of more specific, PCR-based types of markers overcomes most of the disadvantages associated with RFLPs. Random amplified polymorphic DNA (RAPD) has been widely used to distinguish diverse Musa germplasms (Kaemmer 1992, Howell et al. 1994, Bhat and Jareet 1995, Uma et al. 2006, Jain et al. 2007) and, to identify duplications among accessions in tissue culture germplasm banks. A molecular linkage map has also been developed using a variety of marker systems including RAPD (Faure et al. 1993). Specific RAPD markers for the A and B genome of Musa have been identified (Pillay et al. 2000, 2006). These demonstrate the potential value of this technique for germplasm characterization and cultivar identification. Kaemmer (1992) was first to report the use of RAPDs for fingerprinting of

Anath Bandhu Das  | 31

wild species and cultivars of banana (Musa spp.) by using simple sequence repeats (SSRs). Later, Howell et al. (1994) used RAPD markers by adopting a set of nine primers that were shorter (N10) than SSRs (N16) but the authors were able to find enough polymorphism that was unique to each of the nine genotypes representing the AA, AAA, AAB, ABB and BB genomes. Subsequent multivariate analysis showed a strong correlation between the polymorphism obtained and the morphological characters used to classify each of the groups. The use of RAPDs was reported to identify 57 cultivars by using 60 numbers of 10-mer random primers, where only 49 primers gave consistent results, and the primer OPC-15 (5ʹ-GACGGATCAG-3ʹ) helped to distinguish 55 of the cultivars by producing 24 bands of all tested primers (Bhat et al. 1995). These markers failed to properly characterize the clones that Gros Michel and Venkel had previously thought belonged to the Acuminata group (AAA). However, chloroplast polymorphism was shown to be identical to M. balbisiana. This showed the potential of using RAPDs markers for proper cultivar identification and germplasm classification. Similar applications but with a variant were reported by Baurens et al. (1997) who used a single primer (5ʹ-TATAGTTACCAAGTGGTGGGGG-3ʹ) designed from a human Alu sequence. ISSRs were used to assess the genetic diversity (Lu et al. 2011) and classification of 27 wild banana accessions collected in Guangxi, China. The results showed that the collected germplasm was derived from diverse origins and evolutionary paths of banana in Guangxi (Qin et al. 2014). Recently, ISSRs were used to analyse the pattern of genetic variation and differentiation in 32 individuals along with two reference samples of wild Musa, which corresponded to three populations across the biodiversity-rich hot-spot of the southern Western Ghats of India (Padmesh et al. 2012). AFLP markers were reported as a powerful tool for evaluating genetic polymorphisms and relationships in Musa (Crouch et al. 1999, Loh et al. 2001, Wong et al. 2001, 2002, U de et al. 2002). In this regard, three subspecies were suspected in the acuminata complex based on AFLP analysis, dominated by the subspecies microcarpa, malaccensis and burmannica (U de et al. 2002). The relationship between M. acuminata and M. balbisiana and their relatedness to cultivated bananas has been reported more clearly using AFLP (Wongniam 2010). Several primers were selected from the AFLP results that can be easily used to identify A and B genomes within cultivars using a simple PCR. They also serve for discriminating amongst species with A, B, S and T genomes within Musa species, as well as between plantains and cooking bananas (Youssef et al. 2011). Genomic tools to assist germplasm exploitation is important for banana, especially, in the context of the use of Musa genomic diversity. Genomic studies in banana are currently developed within the framework of the Global Musa Genomics Consortium, an international network of investigators, for establishing Musa as a model crop for studies on comparative genomics leading eventually to sequencing of the banana genome (INIBAP 2005). In comparative genomics, Musa is seen as an ideal model for understanding genomic evolution in relation to biotic and abiotic stresses in vegetatively

32  |  Exploitation of Biodiversity for Genetic Improvement of Banana

propagated polyploid crop. The consortium currently brings together expertise from 32 institutions in 22 countries. Consortium members have so far developed BAC libraries from M. acuminata and M. balbisiana (Vilarinhos et al. 2003, Safar et al. 2004). The first sequencing of some BAC clones showed that less than 50% of the DNA in these clones was coding for genes. Like most plant genomes, the banana genome seems to comprise gene-rich areas that are separated by long stretches of repetitive sequences (INIBAP 2005). More recently, the sequencing of several acuminata and balbisiana BAC clones led to the identification of resistance gene analogs (RGAs) and genes coding proteins involved in abiotic stresses (salt tolerance, low temperature, heat shocks and drought tolerance). In addition, the B genome and perhaps the A genome as well, containing viral DNA from the BSV in the course of the evolution of balbisiana, has found a niche in the banana’s genome.

Figs. 20.  RAPD and IRAP profile of 21 genotypes of Indian banana. RAPD profile amplified with OPD 20 primer (20/1) and OPA-14 primer (20/2) as well as amplification pattern of LTR6194 primers (20/3). Reproduce after Shelke and Das (2015) Proc. Natl. Acad. Sci., India, Sect. B Biol. Sci. 85:1027–1038.

Anath Bandhu Das  | 33

Table top banana (AAA) and cooking type plantines (BBB/ABB) are cultivated commercially for high yield and lucrative market value. Random amplified polymorphic DNA (RAPD) and inter-retrotransposon amplified polymorphism (IRAP), were used to characterize genetic variations among 21 banana germplasm (Table 1). IRAP primers were designed to determine ‘AA’ and ‘BB’ specific markers on the basis of repetitive and genome-wide dispersed long terminal repeat (LTR) retrotransposons. RAPD markers successfully detected genetic variation between genotypes. IRAP markers amplified either by a single primer or a combination of primers, based on LTR orientation, successfully amplified different retrotransposons dispersed in the Musa genome. The average level of polymorphism exhibited by RAPD and IRAP markers were 71.47 % and 81.3 % respectively that suggest substantial genetic variations among the tested varieties (Fig. 20). All the 12 table-top varieties were clustered together while four cooking varieties i.e. Bantala-I, Bantala-II, Dakhkhnisagar and Athiakol with ‘BB’ formed a distinct group and perhaps IRAP markers are more robust than RAPD (Shelke and Das 2015). Single nucleotide polymorphism (SNP) variations in the genome sequence of individuals of a population or species are known as single nucleotide polymorphisms (SNPs). The development of this technique in humans demonstrated improvements in sequencing technology and availability of an increasing number of SNP sequences (Buetow et al. 1999); this development has made direct analysis of genetic variation at the DNA sequence level in genomes from different organisms (Soleimani et al. 2003). Modern high-throughput DNA sequencing technologies and bioinformatics tools have led to the discovery that SNPs constitute the most abundant molecular markers in the plant genomes which has revolutionized the pace and precision of plant genetic analysis and the discovery that SNPs are widely distributed throughout genomes although their occurrence and distribution varies among species (Mammadov et al. 2012). More recently, single nucleotide polymorphism (SNP) studies for marker discovery of the use of beta carotene (provitamin A) in plantains (Mmeka et al. 2013) and SNPs found in the partial sequence of the gene encoding the large sub-units of ADP-glucose pyrophosphorylase, a key enzyme related to starch metabolism, in banana and plantains (Mahendhirana et al. 2014), provide important information for new approaches in investigating the wide range of banana germplasm biodiversity and incorporating the information in banana and plantain breeding. Table 1.  List of different germplasms of banana collected from various region of India for RAPD and IRAP markers. Sl No. 1.

Name of the cultivars

Location

Genome (2n/3n)

Musa ornate-I

Goalpara, Assam

AA

22

2.

Musa ornate-II

Kalimpong, West Benagl

AA

22

3.

Sonkeli

Amravati, Maharashtra

AAA

33

4.

Amrutkeli

Raichur, Karnataka

AAA

33

5.

Mysore Placton

Raichur, Karnataka

AAA

33

34  |  Exploitation of Biodiversity for Genetic Improvement of Banana 6.

Patakpura

Puri, Odisha

AAA

33

7.

Placton

Raichur, Karnataka

AAA

33

8.

Jahaji

Jorhat, Assam

AAA

33

9.

Grand Naine

Amravati, Maharashtra

AAA

33

10.

Singapuri

Jagatsingpur, Odisha

AAA

33

11.

Mahalaxmi

Amravati, Maharashtra

AAA

33

12.

Champa

Goalpara, Assam

AAB

33

13.

Chini Champa

Puri, Odisha

AAB

33

14.

Malbhog

Goalpara, Assam

AAB

33

15.

Chakrakeli

Simachalam, Andhara Pradesh

AAB

33

16.

Kabuli-I

Midnapore, West Bengal

ABB

33

17.

Kabuli-II

Keonjhar, Odisha

ABB

33

18.

Athiakol

Goalpara, Assam

BB

22

19.

Bantal-II

Kendraparda, Odisha

BBB

33

20.

Bantal-I

Bhubaneswar, Odisha

BBB

33

21.

Dakhkhnisagar

Kendraparda, Odisha

BBB/ABB

33

Transposomal element distribution in different Musa acuminata and M. bulbisiana was carried out for isolation of genome specific markers in table top and cooking banana. We isolated hAT like transposable elements of tergate site duplication (TSD) and terminal inverted repeats (TIR) of two homoeologous BAC sequesces for M. accuminata (A genome) and M. bulbisiana (B genome). Spanning primers amplified elements and their flanking regions from 21 diverse Musa accessions suggest TSD and TIR like transposable –related mechanism of insertion. It was revealed that hAT1 (265 bp long with 8bp TSD and 30 bp TIR) and hAT2 (876 bp long with 8bp TSD and 14 bp TIR) are A genome specific while hAT 3 of 525 bp lng with 8 bp TDS and 8 bp terminal and sub-terminal inverted repeats is B genome specific. Fluorescent in situ hybridization of these markers also recognize genome specificity with disperse repetitive sequences on the diploid (2n = 22) and triploid (2n = 33) chromosomes of banana (Das et al. 2010, 2011 and Das 2013).

Conclusion Banana genome and the nature of the crop as a parthenocarpic fruit and sterile triploid plant, hinders breeding programme in banana. Biotechnological strategies like DNA marker techniques have contributed considerably in providing a vast amount of information that helps in understanding the nature of Musa genome and its genetic diversity. It is high time for use of recently developed molecular markers (SSR) in banana. In addition, despite their relatively high cost, the high-throughput technologies based on SNPs or small-scale indels are efficient alternatives to traditional markers, because of their greater abundance, high polymorphism. SNPs also allow easy and unambiguous identification of alleles or haplotypes. A good marker system for polyploid crops should be dosage sensitive and

Anath Bandhu Das  | 35

have the ability to distinguish heterozygous genotypes with multiple haplotypes. On the other hand, molecular cytogenetics techniques have played a great role in understanding the  Musa  genome construction, determining genomic constitution of the interspecific hybrids and studying the natural variation in Musa nuclear genome size as well as in checking ploidy levels among gene bank accessions and breeding materials. In addition, the knowledge on Musa satellite DNA was improved by increasing the number of cytogenetic markers and the number of individual chromosomes. The combination of all molecular approaches surveyed and discussed in this chapter can help in the revelation of the genetic diversity in Musa. The genetic basis of the varieties cultivated in the world is extremely narrow and the risk of disappearance of this culture due to the emergence of new diseases is very high. The challenge for the future is to perpetuate banana production while preserving environment. Diploid varieties can cumulate various sources of resistance to diseases and also genes encoding for good fruit quality. In this perspective, markerassisted selection will be an invaluable tool for the improvement of diploids within M. acuminata as well as to seek and select new clones of M. balbisiana free from integrated viral sequences. A better understanding and exploitation of combining abilities between clones at the triploid level is desirable. Tissue culture techniques provides avenues in mass multiplication of elite clones of North east region of India like Malbhoge, Chinichampa, Jhaji of Assam and Sobri variety of Tripura. It’s the need of hour for introduction of new agronomically important gene of interest, obtained from molecular markers and rapid production of disease free quality planting material or embryo resque, in banana breeding programme.

REFERENCES Argent GCG. 1976. The wild bananas of Papua New Guinea. Royal Botanic Garden Edinburgh 35: 77–114. Asif MJ, Mak C, Othman RY. 2001. Characterization of indigenous  Musa  species based on flow cytometric analysis of ploidy and nuclear DNA content. Caryologia 54(2): 161–164. Bakry F, Horry JP. 1992a. Tetraploid hybrids from interploid 3x × 2x crosses in cooking bananas. Fruits 47: 641–647. Bakry F, Carreel F, Caruana ML, Cˆote F, Jenny C, T´ezenas du Montcel H. 2001. Banana, pp. 1–29. In: Tropical Plant Breeding (Charrier A, Jacquot M, Hamon S, Nicolas D. Eds.), CIRAD Publisher, Collection Rep`eres, Montpellier, France. Bakry F, Horry JP, Teisson C, T´ezenas Du Montcel H, Ganry J. 1990. L’am´elioration g´en´etique des bananiers `a l’IRFA/CIRAD. Fruits d’Outre-Mer. Sp´ecial bananes — R´eunion annuelle “bananiers” 1989: 25–40. Balint-Kurti PJ, Clendennen SK, Dolezelova M, Valarik M, Dolezel J, Beetham PR. 2000. Identification and chromosomal localization of the monkey retrotransposon in Musa sp. Mol Gen Genet 263: 908-915.

36  |  Exploitation of Biodiversity for Genetic Improvement of Banana

Ball T, Vrydaghs L, Van den Houwe I, Manwaring J, De Langhe E. 2006. Differentiating banana phytoliths: wild and edible Musa acuminata and Musa balbisiana. Journal of Archeological Science 33: 1228–1236. Bartos J, Alkhimova O, Doleželová M, De Langhe E, Doležel J. 2005. Nuclear genome size and genomic distribution of ribosomal DNA in  Musa  and  Ensete  (Musaceae): Taxonomic implications. Cytogenet Genome Res 109: 50-57. Baurens FC, Noyer JL, Lanaud C, Lagoda PJL. 1997. Sequence tagged site markets to draft the genomic structure of the banana chloroplast. Fruits 52: 247-259. Becker DK, Dugdale B, Smith MK, Harding RM, Dale JL. 2000. Genetic transformation of Cavendish banana (Musa spp. AAA group) cv. ‘Grand Nain’ via microprojectile bombardment. Plant Cell Reports. 19: 229-234. Bhat KV, Jarret RL. 1995. Random amplified polymorphic DNA and genetic diversity in Indian Musa germplasm. Genet Resour Crop Evol 42:107–118. Blomme G, Swennen R, Tenkouano A, Turyagyenda FL, Soka G, Ortiz R. 2008. Comparative study of shoot and root development in micropropagated and sucker-derived banana and plantain (Musa spp.) plants. J. Appl. Biosciences 8:334–342. Buetow KH, Edmonson MN, Cassidy AB. 1999. Reliable identification of large numbers of candidate SNPs from public EST data. Nat Genet 21: 323–325. http://www.aun. edu.eg/faculty_agriculture/arabic/journal/english/w_elkhorashy.pdf (accesed 20 October 2014). Cˆote FX, Domergue R, Monmarson S, Schwendiman J, Teisson C, Escalant JV. 1996. Embryogenic cell suspensions from the male flower of Musa AAA (cv. Grand Nain). Physiology of Plant 97: 285–290. Cˆote FX, Sandoval J, Marie P, Auboiron E. 1993. Variations in micropropagated bananas and plantains: literature survey. Fruits 48: 15–23. Carreel F, Abadie C, Carlier J, Tomekpe K, Lagoda P, Bakry F. 1999. Genome mapping and genetic analysis of the black leaf streak resistance in bananas. In: The International Symposium on the Molecular and Cellular Biology of Banana, Boyce Thompson Institute for Plant Research, 1999/03/22–25, Ithaca, Etats-Unis. Carreel F, Gonzalez De Leon D, Lagoda PJL, Lanaud C, Jenny C, Horry JP, Tezenas Du Montcel H. 2002. Ascertaining maternal and paternal lineage within Musa by chloroplast and mitochondrial DNA RFLP analyses. Genome 45: 679–692. Carreel F, Noyer JL, Gonzalez de Leon D, Lagoda PJL, Perrier X, Bakry F, T´ezenas du Montcel H, Lanaud C, Horry JP. 1994. Evaluation de la diversit´e g´en´etique chez les bananiers diploides (Musa sp.). Genetics Selection Evolution 26: 125–136. Chabrier C, Qu´en´eherv´e P. 2003. Control of the burrowing nematode (Radopholus similis Cobb) on banana: impact of the banana field destruction method on the efficiency of the following fallow. Crop Protection 22: 121–127. Champion J 1967. Les bananiers et leur culture. 1. Botanique et g´en´etique. IFAC, Paris, France, p. 212.

Anath Bandhu Das  | 37

Cheesman EE. 1947. Classification of the bananas. 2. The genus Musa L. Kew Bulletin 2, 106–117. Cızkova J, Hribova E, Humplıkova L, Christelova P, Suchankova P, Dolezel J. 2013. Molecular analysis and genomic organization of major DNA satellites in banana (Musa  spp.). PLoS ONE.8:e54808.http://www.plosone.org/article/ info%3Adoi%2F10.1371%2Fjournal.pone.0054808 (accesed 20 October 2014). Crouch JH, Crouch HK, Constand H, Van Gysel A, Breyne P, Van Montagu M, Jarret RL, Ortiz R. 1999. Comparison of PCR-based molecular marker analysis of Musa breeding populations. Mol Breed 5: 233–244. D’Hont A, Paget-Goy A, Escoute J, Carreel F. 2000. The interspecific genome structure of cultivated banana, Musa spp. revealed by genomic DNA in situ hybridization. Theoretical and Applied Genetics 100: 177–183. D’Hont A. 2005. Unraveling the genome structure of polyploids using FISH and GISH; examples of sugarcane and banana. Cytogenet Genome Res 109: 27-33. Dallot S, Acu˜na P, Rivera C, Ram´ırez P, Cˆote FBEL, Lockhart BEL, Caruana ML. 2001. Evidence that the proliferation stage of micropropagation procedure is determinant in the expression of Banana streak virus integrated into the genome of the FHIA 21h hybrid (Musa AAAB). Archives of Virology 146: 1–12. Daniells JW, Smith MK. 1993. Somatic mutation of bananas: their stability and potential, pp. 162–171. In: Proceedings of the International Symposium on Recent Developments in Banana Cultivation Technology (Valmayor, R.V. et al. Eds.), INIBAP-ASPNET, Los Banos, Philippines. Dantas JLL, Shepherd K, Dos Santos Soares Filho W, Cordeiro ZJM, De Oliveira E Silva S, Alves EJ, Da Silva Souza A. 1993. Banana genetic improvement programme in execution at CNPMF/EMBRAPA – Results obtained. In ‘Third meeting of the technical advisory committee of INIBAP for Latin America and the Caribbean’. San Pedro Sula. Das A. B., Shelke, R. G., Schwarzacher T., Heslop-Harrison J. S. 2011. Genetic characterization of Indian banana (Musa sp.) through hAT like transposable elements and RAPD markers. International Conference on Plant Science in Post Genomic Era (ICPSPGE-2011) at Sambalpur University, Jyoti Vihar, Orissa 17-19th Feb. 2011 [Abstract No. GPMH -215, pp.29]. Das A.B. 2013. Physical mapping of rDNA genes and hAT like transposable elements in identifying banana genomes applying FISH technique. Proc. 100 Indian Science Congress, Section Plant Sciences pp.29. Das AB, Das P, 1991. Shoot multiplication and regeneration related isozyme markers in meristem cultures of Musa. Orissa Journal of Horticulture 19: 107-117. Das AB, Das P, 1992. Rapid multiplication of Musa acuminata ‘Dwarf Cavendish’ through meristem culture and evaluation of chromosomal stability. Orissa Journal of Horticulture 20: 22-27.

38  |  Exploitation of Biodiversity for Genetic Improvement of Banana

Das AB, Das P, 1994. Estimation of 4C DNA content and karyotype analysis in some table banana varieties (Musa acuminata). Cytobios (Great Britain) 78: 213-220. Das AB, Das P, 1997. Estimation of nuclear DNA and karyotype analysis in nine cultivars of Musa. Cytobios (Great Britain) 90: 181-192. Das, A. B., Nair, A., Schwarzacher, T., Heslop-Harrison, J. S. 2010. Genetic and chromosomal organization and biodiversity in Indian and other genotypes of banana. Society for Experimental Biology, International SEB conference on Chromosome Organization and Cytogenomics, at Prague, Czech Republic, 2nd & 3rd July - 2010 [Abstract No. C6.36, pp.273-274]. de Jesus ON, Silva SdO, Amorim EP, Ferreira CF, de Campos JMS, de Gaspari GS, Figueira A. 2013. Genetic diversity and population structure of  Musa  accessions in ex situ conservation. BMC Plant Biology 13: 41. http://www.biomedcentral.com/14712229/13/41 (accesed 20 October 2014). De Langhe E, Hřibová E, Carpentier S, Doležel J, Swennen R. 2010. Did backcrossing contribute to the origin of hybrid edible bananas? Annals of Botany 106: 849–857. De Langhe E. 1995. Is plantain the oldest fruit crop in the world? pp. 44–47. In: The King Baudouin Award to IITA. Leuven (BEL). Dessauw D. 1988. Etude des facteurs de la st´erilit´e du bananier (Musa spp.) et des relations cytotaxinomiques entre M. acuminata Colla et M. balbisiana Colla (III). Fruits d’Outre-Mer. 43: 685–700. Dhed’a D, Dumortier F, Panis B, Vuylsteke D, De Langhe E. 1991. Plant regeneration in cell suspension cultures of cooking banana cv. ‘Bluggoe’ (Musa spp. ABB group). Fruits 46:125–135. Dodds KS, Simmonds NW. 1948. Sterility and parthenocarpy in diploid hybrids of Musa. Heredity 2: 101–117. Dodds KS. 1943. Genetical and cytological studies of Musa. V. Certain edible diploids. Journal of Genetics 45: 113-138. Doležel J, Doleželová M, Novák F. 1994. Flow cytometric estimation of nuclear DNA amount in diploid bananas (Musa acuminata and M. balbisiana). Biologia Plantarum 36: 351–357. Doleželová M, Valárik M, Swennen R, Horry JP, Doležel J. 1998. Physical mapping of the 18S-25S and 5S ribosomal RNA genes in diploid bananas. Biol Plantarum 41: 497-505. Eckstein K, Fraser C, Husselmann J, Temple Murray N. 1998. The evaluation of promissing new banana cultivars. Acta Horticulturae. 490: 57-69. Escalant JV, Teisson C, Cˆote FX. 1994. Amplified somatic embryogenesis from male flowers of triploid banana and plantain cultivars (Musa sp.). In Vitro Cellular and Developmental Biology 30: 181–186. Faur´e S, Noyer JL, Carreel F, Horry JP, Bakry F, Lanaud C. 1994. Maternal inheritance of chloroplast genome ant paternal inheritance of mitochondrial genome in bananas (Musa acuminata). Current Genetics 25: 265–269.

Anath Bandhu Das  | 39

Faure S, Noyer JL, Horry JP, Bakry F, Lanaud C, Goazalez de Lean D. 1993. A molecular marker-based linkage map of diploid bananas (Musa acuminata). Theor Appl Genet 87: 517-526. Ganapathi TR, Higgs NS, Balint-Kurti PJ, Arntzen C, May GD, Van Eck JM. 2001. Agrobacterium-mediated transformation of embryogenic cell suspensions of the banana cultivar Rasthali (AAB). Plant Cell Reports. 20:157-162. Gawel NJ, Jarret RL, Whittemore AP. 1992. Restriction fragment length polymorphism (RFLP)-based phylogenetic analysis of Musa. Theor Appl Genet 84: 286–290. Gawel NJ, Jarret RL. 1991. Chloroplast DNA restriction fragments length polymorphisms (RFLPs) in Musa species. Theor Appl Genet 81: 783–786. Ge XJ, Liu MH, Wang WK, Schaal BA, Chiang TY. 2005. Population structure of wild bananas, Musa balbisiana, in China determined by SSR fingerprinting and cpDNA PCRRFLP. Molecular Ecology 14: 933–944. Gowen S, Qu´en´eherv´e P, Fogain R. 2005. Nematode parasites of bananas and plantains., pp. 611–643. In: Plant Parasitic Nematodes in Subtropical and Tropical Agriculture, 2nd Edition (Luc M, Sikora RA, Bridge J. Eds.), CAB International, Wallingford, UK. Harper G, Osuji JO, Heslop-Harrison JS, Hull R. 1999. Integration of banana streak badnavirus into the  Musa  genome: Molecular and cytogenetic evidence. Virology 255: 207-213. Hippolyte I, Bakry F, Seguin M, Gardes L, Rivallan R, Risterucci A-M, Jenny C, Perrier X, Carreel F, Argout X, Piffanelli P, Khan I, Miller R, Pappas G, Mbeguie-A-Mbeguie D, Matsumoto T, De Bernardinis V, Huttner E, Kilian A, Baurens F-C, D’Hont A, Cote F, Courtois B, Glaszmann JC. 2014. A saturated SSR/DArT linkage map of Musa acuminata addressing genome rearrangements among bananas. BMC Plant Biol 2010; 10: 65–65. http://www.biomedcentral.com/1471-2229/10/65 (accesed 20 October 2014). Howell EC, Newbury HJ, Swennen RL, Withers LA, Ford-Lloyd BV. 1994. The use of RAPD for identifying and classifying Musa germplasm. Genome 37: 328–332. Hřibová E, Doleželová M, Doležel J. 2008. Localization of BAC clones on mitotic chromosomes of  Musa acuminate  using fluorescence  in situ  hybridization. Biologia Plantarum 52: 445-452. Hwang SC, Ko WH. 1990. Selection of improved Cavendish banana mutants resistant to race 4 Fusarium oxysporum f. sp. cubense. Acta Horticulturae 275: 417–423. INIBAP. 2006. Annual report 2005 Unlocking the secrets of the banana genome, pp. 14–17. IPGRI Publisher, Rome, Italy. ISBN 2-910810-76-3. IPGRI-INIBAP/CIRAD. 1996. Descriptors for banana (Musa spp.), 55pp. IPGRI Publisher,Rome, Italy. ISBN 92-9043-307-8. Jain PK, Saini MK, Pathak H, Gupta VK. 2007. Analysis of genetic variation in different banana (Musa species) variety using random amplified polymorphic DNAs (RAPDs). Afri J Biotechnol 6: 1987–1989.

40  |  Exploitation of Biodiversity for Genetic Improvement of Banana

Jarret R, Gawel N, Whittemore A, Sharrock S. 1992. RFLP-based phylogeny of Musa species in Papua New Guinea. Theor Appl Genet 84: 579–584. Jarret RL, Litz RE. 1986. Isozymes as genetic markers in bananas and plantains. Euphytica 35: 539–549. Jenny C, Carreel F, Bakry F. 1997. Revision of banana taxonomy: Klue Tiparot (Musa sp.) reclassified as a triploid. Fruits 52: 83-91. Jenny C, Carreel F, Tomekpe K, Perrier X, Dubois C, Horry JP, T´ezenas du Montcel H. 1999. Banana, pp. 113–139. In: Diversit´e G´en´etique Des Plantes Tropicales Cultiv´ees (Hamon, P., Seguin, M., Perrier, X., and Glaszmann, J.-C. Eds.), CIRAD Publisher, Collection Rep`eres, Montpellier, France. Jenny C, Tomekpe K, Bakry F, Escalant JV. 2003. Conventional breeding of bananas. In: Mycosphaerella Leafspot Diseases of Bananas: Present Status ant Outlook. Proceedings of the Workshop on Mycosphaerella Leaf Spot Diseases held in San Jos´e, Costa Rica on 20–23 May 2002. INIBAP, Montpellier, France. Jeridi M, Bakry F, Escoute J, Fondi E, Carreel F, Ferchichi A, D’Hont A, Rodier-Goud M. 2011. Homoeologous chromosome pairing between the A and B genomes of Musa spp. revealed by genomic in situ hybridization. Annals of Botany 108: 975–981. Jones DR. 1999. Diseases of Banana, Abac´a, and Enset. CABI Publishing, Wallingford, Oxon, UK, 544 pp. Kaemmer D. 1992. Oligonucleotide and amplification fingerprinting of wild species and cultivars of banana (Musa spp.) Bio/Technology 10: 1030-1035. Kamaté K, Brown S, Durand P, Bureau JM, De Nay D, Trinh TH. 2001. Nuclear DNA content and base composition in 28 taxa of Musa. Genome 44(4) 622–627. Khanna H, Becker D, Kleidon J, Dale J. 2004. Centrifugation assisted Agrobacterium tumefaciens-mediated transformation (CAAT) of embryogenic cell suspensions of banana (Musa spp. ‘Cavendish’ AAA and ‘Lady finger’ AAB). Molecular Breeding 14: 239–252. Khayat E, Duvdevani A, Shchukin A, Lahav E. 1998. Banana improvement program at Rahan meristem. Acta Horticulturae 490: 71-78. Krishnamoorthy V, Kumar N. 2004. Evaluation of parental banana varieties and new hybrids regarding potential yield and resistance to Sigatoka and nematode in India. Fruits 59: 159–168. Kumar GBS, Ganapathi TR, Revathi CJ, Srinivas L, Bapat VA. 2005. Expression of hepatitis B surface antigen in transgenic banana plants. Planta 222: 484–493. Lanaud C, Tezena du Montcel H, Jolivot MP, Glaszman JC, Gonzalez de León D. 1992. Variation in ribosomal gene spacer length among wild and cultivated banana. Heredity 68: 148-156. Langdon R. 1993. The banana as a key to early American and Polynesian history. The Journal of Pacific History 28: 15–35.

Anath Bandhu Das  | 41

Lejju BJ, Robertshaw P, Taylor D. 2006. Africa’s earliest bananas ? Journal of Archeological Science 33: 102–113. Lentfer C, Boyd W. 2004. Tracing antiquity of banana cultivation in Papua New Guinea. Pacific Biological Foundation Publisher, Port Macquarie, Australia, p. 18. Lescot T. 2006. Banana in figures, the world’s favorate fruit. Fruitrop 140: 5–9. Lichtemberg LA. 1997. Bananicultura nos subtrópicos. Epagri/EEI, Itajaí-SC. 48p. (Relatório de viagem). Loh JP, Kiew R, Set O, Gan LH, Gan YY. 2000. Amplified fragment length polymorphism fingerprinting of 16 banana cultivars (Musa cvs.). Mol Phylogenet Evol 17: 360–366. Lu Y, Xu WH, Xie YX, Zhang Z, Pu JJ, Qj YX, Li HP. 2011. Isolation and characterization of nucleotide-binding site and C-terminal leucine-rich repeat-resistance gene candidates in bananas. Genet Mol Res 10: 3098-3108. Lysak MA, Doleželová M, Horry JP, Sweenen R, Doležel. 1999. Flow cytometry analysis of nuclear DNA content in Musa. Theor Appl Genet 98: 1344–1350. Mahendhirana M, Ramirez-Prado JH, Escobedo-Gracia Medrano RM, Canto-Canché B, Tzec-Simá M, Grijalva-Arango R, James-Kay A. 2014. Single nucleotide polymorphisms in partial sequences of the gene encoding the large sub-units of ADPglucose pyrophosphorylase within a representative collection of 10 Musa genotypes. Electronic Journal of Biotechnology 17: 137–147. Maillard JC. 1986. Le march´e international de la banane: etude g´eographique d’un syst`eme commercial. Fruits 41: 287–296. Mammadov J, Aggarwal V, Buyyarapu R, Kumpatl S. 2012. SNP Markers and their impact on plant breeding. International Journal of Plant Genomics 728398. http://dx.doi. org/10.1155/2012/728398 (accesed 20 October 2014). May GD, Rownak A, Mason H, Wiecko A, Novak FJ, Arntzen CJ. 1995. Generation of transgenic banana (Musa acuminata) plants via Agrobacterium-mediated transformation. Bio. Technol. 13: 486-492. Mmeka EC, Adesoye AI, Vroh BI, Ubaoji KI. 2013. Single nucleotide polymorphism (SNP) markers discovery within  Musa  spp (plantain landraces, AAB genome) for use in beta carotene (Provitamin A) trait mapping. American Journal of Biology and Life Science 1: 11-19. Neumann P, Navrátilová A, Koblížková A, Kejnovský E, Hřibová E, Hobza R, Widmer A, Doležel J, Macas J. 2011. Plant centromeric retrotransposons: A structural and cytogenetic perspective. Mobile DNA 2: 4. http://www.mobilednajournal.com/ content/2/1/4 (accesed 20 October 2014). Novak FJ, Afza R, Van Duren M, Perea-Dallos M, Conger BV, Xiolang T. 1989. Somatic embryogenesis and plant regeneration in suspension cultures of dessert (AA, AAA) and cooking (AAB) bananas. BioTechnology 46: 125–135.

42  |  Exploitation of Biodiversity for Genetic Improvement of Banana

Noyer JL, Causse S, Tomekpe K, Bouet A, Baurens FC. 2005. A new image of plantain diversity assessed by SSR, AFLP and MSAP markers. Genetica 124: 61–69. Noyer JL, Dambier D, Grivet L, Lanaud C, Lagoda P. 1997. A saturated map of diploid banana, Musa acuminata (microsatellites, RFLP, Isozymes, RAPD and AFLP). In: Plant and Animal Genome V, p. 138. International Conference on the Status of Plant Genome Research, San Diego (USA), 1997/01/12–16. Osuji JO, Crouch J, Harrison G, Heslop-Harrison JS. 1997. Identification of the genomic constitution of  Musa  L. lines (bananas, plantains and hybrids) using molecular cytogenetics. Annals of Botany 80: 787–793. Osuji JO, Crouch J, Harrison G, Heslop-Harrison JS. 1998. Molecular cytogenetics of Musa species, cultivars and hybrids: Location of 18S-5.8S-25S and 5S rDNA and telomere-like sequences. Annals of Botany 82: 243-248. Padmesh P. Mukunthakumar S. Vineesh PS, Hari Kumar K, Krishnan PN. 2012. Exploring wild genetic resources of Musa acuminata Colla distributed in the humid forests of southern Western Ghats of peninsular India using ISSR markers. Plant Cell Reports 31: 1591-1601. Palai SK, Das AB 2002. Large scale propagation of Musa balbisiana cv. Muguni through in vitro techniques. In: Proceedings of the State level Seminar of Advances in production of quality planting materials of Horticultural crops, Orissa Horticultural Society, OUAT, BBSR, pp. 133-136. Pei XW, Chen SK, Wen RM, Ye S, Huang JQ, Zhang YK, Wang BS, Wang Z, Jia SR. 2005. Creation of transgenic bananas expressing human lysozyme gene for Panama wilt resistance. Journal of Integrative Plant Biology 47: 971–977. Perrier X, Tezenas du Montcel H. 1990. Musaid, a computerized determination system, pp. 76–91. In: Identification of Genetic Diversity in the Genus Musa (Jarret, R.L. Ed.), INIBAP, Montpellier, France. Pillay M, Nwakanma DC, Tenkouano A. 2000. Identification of RAPD markers linked to A and B genome sequences in Musa L. Genome 43: 763–767. Pillay M, Ogundiwin E, Tenkouano A, Dolezel J. 2006. Ploidy and genome composition of Musa germplasm at the International Institute of Tropical Agriculture (IITA). Afr J Biotechnol 5: 1224–1232. Qin XQ, Peng HX, Long X, Yao JY. 2014. Preliminary study on ISSR analysis and classification of wild Musa germplasm in Guangxi, China. Acta Hort 2011; 897: 259-262. http:// www.actahort.org/books/897/897_29.htm (accesed 20 October 2014). Qu´en´eherv´e P, Marie-Luce S, Barout B, Grosdemange F. 2006. Une technique de criblage vari´etal pr´ecoce des bananiers envers les n´ematodes phytoparasites. Nematology 8: 147–152. Raboin LM, Carreel F, Noyer JL, Baurens FC, Horry JP, Bakry F, Tezenas du Montcel H, Ganry J, Lanaud C, Lagoda PJL. 2005. Diploid ancestors of triploid export banana

Anath Bandhu Das  | 43

cultivars: molecular identification of 2n restitution gamete donors and n gamete donors. Molecular Breeding 16: 333–341. Ribeiro LNV, Silva JA da. 1998. Preliminary studies of Cavendish banana cultivars under the edafoclimatic conditions of Madeira Island. Acta Horticulturae. 490:85-88. Roux N, Strosse H, Toloza A, Panis B, Dolezel J. 2004. Detecting ploidy level instability of banana embryogenic suspension cultures by flow cytometry. In: Jain MS, Swennen R. (eds.) Banana Improvement: Cellular, Molecular, Biology, and Induced Mutations In Sci Publishers Inc., pp251–261. Roux N, Toloza A, Radeck Z, Zapata-Arias FJ, Doležel J. 2003. Rapid detection of aneuploidy in Musa using flow cytometry. Plant Cell Reports 21: 483–490. Roux N. 2004. Mutation induction in Musa – review, pp. 23–32. In: Banana Improvement: Cellular, Molecular Biology, and Induced Mutations (Mohan Jain, S. and Swennen, R. Eds.), Science Publishers, Inc., Enfield, NH, USA. Rowe P. 1984. Recent advances in breeding dessert bananas, plantains, and cooking bananas. Fruits 39: 149–153. S´agi L, Panis B, Remy S, Schoofs H, de Smet K, Swennen R, Cammue B.1995. Genetic transformation of banana and plantain (Musa spp.) via particle bombardment. BioTechnology 13: 481–485. Safar J, Noa-Carrazana JC, Vrana J, Bartos J, Alkhimova O, Sabau X, Simkova H, Lheureux F, Caruana ML, Dolezel J, Piffanelli P. 2004. Creation of a BAC resource to study the structure and evolution of the banana (Musa balbisiana).Genome 47: 1182–1191. Sagi L, Panis B, Remy S, Schoofs H, De Smet K, Swennen R, Cammue BPA. 1995. Genetic transformation of banana and plantain (Musa spp.) via particle bombardment. Bio Technology 13: 481-485. Sathiamoorthy S, Uma S, Valsala Kumari PK, Soorianatha Sundaram K, Kumar N, Selvarajan R, Menon R. 2000. Banana Improvement Programme in India. Paper presented in PROMUSA meeting held at Bangkok from 6 to 8, November, 2000. Schwarzacher T, Leitch AR, Bennett MD, Heslop-Harrison JS. 1989. In situ localization of parental genomes in a wide hybrid. Annals of Botany 64: 315–324. Shelke RG, Das AB 2015. Analysis of genetic diversity in 21 genotypes of Indian banana using RAPDs and IRAPs markers. Proc. Natl. Acad. Sci., India, Sect. B Biol. Sci., (Springer) 85(4):1027–1038. DOI 10.1007/s40011-015-0505-1. Simmonds NW Shepherd K. 1955. The taxonomy and origins of the cultivated bananas. Journal of Linnean Society (Botany) 55: 302–312. Simmonds NW, Weatherup STC. 1990. Numerical taxonomy of the wild bananas (Musa). New Phytology 115: 567–571. Simmonds NW. 1953. Segregations in some diploid bananas. Journal of Genetics 51: 458–469. Simmonds NW. 1962. The evolution of the bananas. Longmans, London, UK, p. 170.

44  |  Exploitation of Biodiversity for Genetic Improvement of Banana

Smith MK, Drew RA. 1990. Current aplications of tissue culture in plant propagation and improvement. Australian Journal of Plant Physiology 17: 267-289. Soleimani VD, Baum BR, Johnson DA. 2003. Efficient validation of single nucleotide polymorphisms in plants by allele-specific PCR, with an example from barley. Plant Mol Biol Rep 21: 281–288. Stover RH, Simmonds NW. 1987. Classification of banana cultivars. p.86-102. In: Bananas. 3.ed. Longmans, New York. Stover RH. 1962. Fusarial wilt (Panama Disease) of Bananas and other Musa species. Commonwealth Mycological Institute, Kew, Surrey, 117pp. Tang CY, Hwang SC. 1994. Musa mutation breeding in Taiwan, pp. 219–227. In: The Improvement and Testing of Musa: A Global Partnership, La Lima, Honduras, 27–30 April 1994. INIBAP, Montpellier, France. Tenkouano A, Swennen R. 2004. Plantains and banana: progress in breeding and delivering improved plantain and banana to African farmers. Chronica Horticulturae 44: 9–15. Tripathi L, Hughes Jd’A, Tenkouano A. 2002. Production of transgenic Musa varieties for sub-Saharan Africa. 3rd International Symposium on the Molecular and Cellular Biology of Banana http://www.promusa.org/publications/leuven-abstracts.pdf Tripathi L, Tripathi JN, Oso RT, Hughes Jd’A, Keese P. 2003. Regeneration and transient gene expression of African Musa species with diverse genomic constitution and ploidy levels. Tropic. Agric. 80: 182-187. U de G, Pillay M, Nwakanma A, Tenkouano A. 2002. Analysis of genetic diversity and selectional relationships in Musa using AFLP markers. Theor Appl Genet 104:1239– 1245. Uma S, Siva SA, Saraswathi MS, Durai P, Sharma TVRS, Singh DB, Selvarajan R, Sathiamoorthy S. 2005. Studies on the origin and diversification of Indian wild banana (Musa balbisiana) using arbitrarily amplified DNA markers. Journal of Horticultural Science and Biotechnology 80: 575–580. Uma S, Siva SA, Saraswathi MS, Manickavasagam M, Durai P, Selvarajan R Sathiamoorthy S. 2006. Variation and intraspecific relationships in Indian wild Musa balbisiana (BB) population as evidenced by random amplified polymorphic DNA. Genetic Resources in Crop Evolution 53: 349-355. Valmayor RV, Silayoi B, Jamaluddin SH, Kusumo S, Espino RRC, Pascua OC. 1991. Banana classification and commercial cultivars in Southeast Asia. In: Information Bulletin (PHL), PCARRD-Department of Science and Technology, Los Banos (PHL). Vilarinhos AD, Benabdelmouna A, Bakry F, Piffanelli P, Triaire D, Lagoda P, Noyer JL, Courtois B, Carreel F, D’hont A. 2004. Characterisation of translocations in ‘Calcutta 4’ and ‘Madang’. International congress on Musa: Harnessing research to improve livelihoods – 6–9 July 2004, Penang, Malaysia.

Anath Bandhu Das  | 45

Vilarinhos AD, Piffanelli P, Lagoda P, Thibivilliers S, Sabau X, Carreel F, D’-Hont A. 2003. Construction and characterisation of a bacterial artificial chromosome library of banana (Musa acuminata Colla). Theoretical and Applied Genetics 106: 1102–1106. Vilarinhos AD. 2004. Genetic and cytogenetic mapping in bananas: characterisation of translocations. Th`ese de Doctorat, ENSAM, Montpellier, France, p. 115. Vuylsteke D, Ortiz R. 1996. Field performance of conventional vs. in vitro propagated propagules of plantain (Musa spp., AAB group). HortScience 31:862–865. Vuylsteke D, Swennen R, de Langhe E. 1991. Somaclonal variation in plantains (Musa spp. AAB group) derived from shoot-tip culture. Fruits 46: 429–439. Vuylsteke D, Swennen R, De Langhe E. 1996. Field performance of somaclonal variants of plantain (Musa spp., AAB group). J. Amer. Soc. Hort. Sci. 121:42–46. Wong C, Kiew R, Argent G, Ohn S, Lee SK, Gan YY. 2002. Assessment of the validity of the sections in Musa (Musaceae) using AFLP. Ann Bot 90: 231-238. Wong C, Kiew R, Loh JP, Gan LH, Lee SK, Ohn S, Gan YY. 2001. Genetic diversity of the wild banana Musa acuminata Colla in Malaysia as evidenced by AFLP. Ann Bot 88: 1017–1025. Youssef M, James A, Rivera-Madrid R, Ortiz R, Escobedo-Gracia Medrano RM. 2011.  Musa genetic diversity revealed by SRAP and AFLP. Mol Biotech 47: 189–199.

Research Institute Acronyms BRS: Banana Research Station, Kerala Agricultural University, India. BTI: Boyce Thompson Institute for Plant Research, USA. CARBAP: The African Centre for Research on Banana and Plantain, Cameroon. CATIE: Centro Agron´omico Tropical de Investigaci´on y Ense˜nanza, Costa-Rica. CIRAD: French Agricultural Research Centre for International Development, France. EMBRAPA-CNPMF: Empresa Brasileira de Pesquisa Agropecu´aria Centro Nacional de Pesquisa de Mandioca e Fruticultura Tropical, Brazil. FHIA: Fundaci´on Hondure˜na de Investigaci´on Agr´ıcola, Honduras. IAEA: International Atomic Energy Agency, Austria. IITA: International Institute of Tropical Agriculture, Nigeria. KUL: Katholieke Universiteit Leuven, Belgium. 1 Genetic Improvement of Banana 45 NRCB: National Research Centre for Banana, India. QDPI: Queensland Department of Primary Industry, Australia. QUT: Queensland University of Technology, Australia. TBRI: Taiwan Banana Research Institute, Taiwan. TNAU: Tamil Nadu Agricultural University, India.

mmm

Trends in Frontal Areas of Plant Science Research Edited by: S. Sinha, R.K. Sinha © Department of Botany, Tripura University, 2017

Photoperiod-mediated Regulation of Tuberization in Potato (S. tuberosum spp. andigena) Kirtikumar R. Kondhare, Amit Kumar and Anjan K. Banerjee* Biology Division, Indian Institute of Science Education and Research (IISER) Pune, Dr.HomiBhabha Road, Pune- 411008, Maharashtra, India. *Corresponding author: [email protected]

Summary Potato development (tuberization) is a process in which a specialized underground stem (stolon) develops into a mature tuber under inductive conditions. In this process, stolon acts as a focal point that coordinates mobile signals, transcription factors (TFs), hormones, and involves interaction between environmental, biochemical, and genetic factors. In Solanum tuberosum spp. andigena, tuberization is regulated by red light receptor - phytochromeA/B (PHYA/B) and blue light receptor - cryptochrome. Under Short Days (SD), the levels of StBEL5 transcript and StPTBs (Polypyrimidine Tract-Binding proteins) increases and leads to the activation of StCDF1 (CYCLING DOF FACTOR 1) transcription in the leaves of andigena plants. Enhanced StCDF1 levels suppress St CONSTANS, the repressor of tuberization, as a result, the levels of Flowering Locus T (an Arabidopsis homologue in potato) StSP6A increases. In parallel, the transcripts of FKF1 (FLAVIN BINDING KELCH REPEAT F-BOX PROTEIN 1) and GI (GIGANTEA) decrease, and StCDF1 is stabilised. Moreover, POTH1 (class-I KNOX) transcript levels are also shown to be enhanced in leaves under short days. Subsequently, StBEL5-StPTBs RNP complex, StSP6A protein and POTH1 transcript moves from leaves to stolon through the phloem. In stolons, following StBEL5 translation, StBEL5-POTH1complex activates tuber signalling pathway. This activation is achieved possibly through the StBEL5-POTH1 heterodimer complex or StSP6A protein mediated downstream gene regulation. In contrast, under Long Days (LD),the levels of StBEL5 transcript and StPTBsdecrease,FKF1 and GI levels increase, and StCDF1 is destabilized in leaves of andigena plant.Moreover, StCONSTANS level increases leading to a decreased level of StSP6A protein. These series of events result in reduced transport of StBEL5-StPTBs RNP complex, StSP6A protein, and POTH1 transcript into the stolon, and hence tuber development is inhibited under LD conditions. The recent findings regarding the role of several molecular players such as KNOX (POTH1, POTH15) and BEL1-like (StBEL5, -11 and -29) homeoboxTFs, calcium-

48  |  Photoperiod-mediated Regulation of Tuberization in Potato (S. tuberosum spp. andigena)

dependent protein kinase 1 (CDPK1), miRNAs (miR156, miR172 and miR390), and the StBEL5-StCDF1-StSP6A module in photoperiod-mediated regulation of tuberization in S. tuberosum spp. andigena are discussed in this chapter. Keywords Tuberization; KNOX; BEL1-like; CDPK; miRNA; StSP6A; StCDF1

Abbreviations ABA Abscisic acid BEL BEL1-like homeobox transcription factor BEL5/11/29 BEL1-like homeobox transcription factor 5/11/29 StCDF1.1/1.2/1.3 CYCLING DOF FACTOR 1.1/1.2/1.3 in potato CDPK Calcium dependent protein kinase CRY Cryptochromes FKF1 FLAVIN BINDING KELCH REPEAT F-BOX PROTEIN 1 FT Flowering locus T GA Gibberellin GA2ox GA2-oxidase GA3ox GA3-oxidase GA13ox GA13-oxidase GA20ox GA20-oxidase GI GIGANTEA KNOX Knotted1-like homeobox transcription factor LD Long day LOX Lipoxygenase miRNA MicroRNA miR156/172/390 MicroRNA 156/172/390 PHOR1 Photoperiod responsive1 protein PHYA/B Phytochrome A/B POTH1/15 Potato homeobox transcription factor 1/15 PTB Polypyrimidine tract-binding protein RAP1 Related to apetala2 1 SD Short day SPL9 Squamosa promoter binding protein-like 9 StSP5G A repressor of StSP6A in potato Potato ortholog of flowering locus T StSP6A StCO1/2 Potato homologs of CONSTANS TALE Three amino acid loop extension superfamily TF Transcription factor UTR Untranslated region

Kirtikumar R. Kondhare et.al.  | 49

Potato (Solanum tuberosum L.) belongs to the Solanaceae family, and is one of most important food crops worldwide. Over the years, tuber formation (tuberization mechanism) has been the major interest among many researchers around the globe to improve tuber yields as well as to investigate the molecular mechanism governing tuber development. The potato plant has 12 chromosomes with genome size of ~850Mb. Most of the cultivated potatoes are tetraploid, and thus have 48 somatic chromosomes. Potato genome was sequenced in 2010, which has further paved the way for the rapid progress in functional analysis of genes regulating tuber development.Under inductive conditions, a specialized underground stem (known as stolon) arrests longitudinal elongation, triggers radial swelling at the subapical region (Fig. 1), and develops into a mature tuber (so called potatoes) enriched with starch, protein, antioxidants, and vitamins (Shan et al. 2013). Tuber formation involves three phases- induction, initiation and proliferation (Gregory 1956). Tuber induction is associated with suppression of axillary branching, frequent abortion of flower buds, and enlargement of leaf size (Ewing and Struik1992). The induction phase is species specific in potato. It requires short days, and is mediated by a leaf-derived systemic florigen family protein StSP6A (Navarro et al. 2011). Significant progress has been made in identifying candidate genes involved in tuber development. However, detailed mechanism of how a tiny stolon transforms in to a large tuber is still not fully elucidated.It is known that number of Transcription Factors (TFs) as well as other biochemical and genetic components work in a squad right from perception of the photoperiod signal in leaves to their transport to stolon tip to exert negative and/ or positive regulation to initiate tuber induction. In this book chapter, we present the recent findings about the role of important molecular players such as KNOX and BEL1liketranscription factors (TFs), Calcium Dependent Protein Kinases (CDPKs), miRNAs (miR156, miR172, miR390), and the StBEL5-StCDF1-StSP6A module in tuberization along with other environmental factors and the role of important phytohormones. Considering the functions of these major molecular players, finally,we describe a revised model for photoperiod-mediated regulation of tuberization in andigena.

Fig. 1.  Stolon transitions in S. tuberosum ssp. andigena. Under short days (SDs), a stolon passes through different transitions to eventually form a tuber. Developmental stages (I), (II) and (III) represent stolons from 4th, 7th and 10th days during SD induction, respectively. Stolonsat 7th day (II) are characterised by a distinct apical hook; whereas 10th day stolon (III) is characterised by swelling at the apical region. Bar is 2 mm.

50  |  Photoperiod-mediated Regulation of Tuberization in Potato (S. tuberosum spp. andigena)

Environmental Factors Environmental factors such as photoperiod, temperature, light intensity and nitrogen levels are shown to regulate tuber development. Amongst these factors, photoperiod and temperature conditions are the most extensively investigated. Cultivated potatoes derived from Chilean landraces (S. tuberosum spp. tuberosum) produce tubers under Long Days (LDs; 16 h light/8 h dark), whereas some potato species such as S. tuberosum spp. andigena (diploid) form tubers only under Short Days (SDs; 8 h light/16 h dark) (Ewing and Wareing1978; Rodriguez-Falcon et al. 2006). Photoperiod-dependent tuberization in andigena involves: perception of signals under SD photoperiod, short term adaptive response to SD conditions, generation and transport of tuber inducing signals to stolons, tuber formation, and long term adaptive responses to tuber growth (Martinez-Garcia et al. 2002). Earlier, it was suggested that tuberization was controlled by specific stimuli produced in the terminal leaf cluster (Chapman 1958), and also in old and young leaves (Hammes and Beyers 1973; Ewing 1978) under inducing conditions of photoperiod and temperature (Nitsch 1965; Menzel 1985). Recent studies have demonstrated that this signal is a BEL1-like transcript (StBEL5), and the transport of its transcript to the stolon tip occurs during SDs (Banerjee et al. 2006; Lin et al. 2013); where StBEL5 interacts with its knotted1like homeobox (KNOX) partner- POTH1 to regulate target genes involved in cell division and expansion (Chen et al. 2004). Similar to tuberization, flowering is also governed by mobile signals, TFs and other environmental factors. Both these pathways share common molecular players, and are regulated by red light receptors, phytochrome A/B (PHYA/B) and blue light receptor, cryptochromes (CRY) (Endo et al. 2007), suggesting a common molecular mechanism for flowering and tuberization. Tuber formation is the plant’s strategy to survive in harsh winters and it is observed that low temperatures (18-20 ˚C) promote tuber formation in potato plants, whereas temperatures higher than 25 ˚C inhibit tuberization (Gregory 1956). Bushnell (1925) reported that amount of carbohydrates utilized by potato plant for respiration is more in higher temperatures. This leads to the reduced level of carbohydrates available for tuber bulking. Werner (1934) proposed that temperature and photoperiod can be viewed as similar environmental cues as longer days can be easily associated with higher temperature and vice versa. Thus, it appears that photoperiod and temperature cues converge at some point in the pathway and exert their effect on tuberization. Several studies have demonstrated that high intensity light (400 µmol m-2s-1) can promote tuber formation in andigena even under LDs (Bodlaender 1964; Wheeler and Tibbitts 1986). Nitrogen content is the least investigated among the environmental factors that regulate tuberization. Different stages of tuber formation such as starch and dry matter accumulation, size and yield of tubers are shown to be affected by nitrogen. Potato plants use majority of total nitrogen before tuberization compared to tuber initiation phase. Field trials have shown that a three way splitting of nitrogen application can increase tuber yields by 11-15% compared to when nitrogen was applied as one treatment (http://www.yara.us/agriculture/crops/ potato/key-facts/role-of-nitrogen). Moreover, different forms of nitrogen can also affect stolon length, number and branching (Svensson 1962; Osaki et al. 1995; Gao et al. 2014).

Kirtikumar R. Kondhare et.al.  | 51

Ammonium (NH4-N) application is shown to enhance shoot growth compared to nitrate (NO3-N) application before or during tuber initiation phase. On the other hand, plants supplied with nitrate at tuber initiation stage resulted in earliness in stolon formation, stolon number as well as tuber formation compared to plants treated with ammonium (Gao et al. 2014). Thus, the timing of nitrogen application and the tuber developmental stage are crucial to optimise tuber yield.

Plant Hormones and Other Factors Hormones such as auxin, gibberellins (GAs) and cytokinines (CKs) are the major phytohormones involved in the regulation of tuber development. The role of auxinresponsive proteins (e.g. ARF6, EBF1) in tuberization has been demonstrated in several studies (Faivre-Rampant et al. 2004; Horvath et al. 2006), and it is also well established that a critical concentration of auxin is required for tuberization (Sergeeva et al. 2000). Auxin levels increases dramatically in the stolon prior to tuberization and remain relatively high during the subsequent tuber growth, suggesting a stimulatory role for auxin in tuber formation (Roumeliotis et al. 2013). Photoperiodic conditions are shown to tightly regulate the expression of GA biosynthesis genes (GA20ox and GA3ox) and GA catabolic gene (GA2ox) in a number of plant species (Martin et al. 1996; Kamiya and Garcia-Martinez 1999; Ross et al. 1999; Yamaguchi and Kamiya 2000). Earlier, it was proposed that different stages of tuber development are dependent on GAs (Martinez-Garcia et al. 2002). For example, under short days, StGA3ox2 levels were high in the shoot apex and leaves of potato plant, but low in the stolons. This influenced tuber formation suggested a possible interaction between photoperiod and GA-dependent signalling pathways for regulation oftuberization (Bou-Torrent et al. 2011). Amador et al. (2001) showed that PHYB (a photoreceptor)mediated GA response is regulated by a novel arm repeat photoperiod responsive1 protein (PHOR1; a component of GA-signalling pathway in potato. It is known that GAs regulate stolon elongation during tuber development; where they promote longitudinal cell expansion by causing a transverse orientation of microtubules and microfibrils to the cell axis (Xu et al. 1998). In contrast, higher GA levels are known to inhibit tuber induction (Carrera et al. 1999). Phytohormone cytokinin (CK) is known to regulate cell division by controlling the cell cycle (Vreugdenhil 2004). A recent study by Eviatar-Ribak et al. (2013) demonstrated that over-expression lines of TLOG1 (Tomato Lonely Guy1) exhibited production of aerial tubers from juvenile axillary meristems of tomato plant (which naturally does not form tubers). LOG1 is a CK biosynthetic gene encoding an enzyme that converts inactive CKs to active CKs such as trans-zeatins. This study suggested that, like auxin, CK also acts as positive regulator of tuber development. Application of another phytohromone ABA not only showed earlinessin tuberization, but also exhibited enhanced tuber yield, suggesting that ABA stimulates tuber development (Menzel1980). Subsequently, Xu et al.(1998) proposed that the tuber promoting effect of ABA is due to its negative effect on GA metabolism. A recent report by Roumeliotis et al. (2012) indicated that application of strigolactone (another group of phytohormone)can reduce tuber formation; however, detailed mechanism needs to be further investigated.

52  |  Photoperiod-mediated Regulation of Tuberization in Potato (S. tuberosum spp. andigena)

A number of studies have shown that tuberizationis associatedwith an increase in activity of lipoxygenases (LOXs) or LOX-derived hormone compounds (Siedow 1991; Koda 1992; Nam et al. 2005). Suppressor mutants of a tuber-specific LOX (StLOX1) exhibited a significant reduction of tuber yield and also showed a disruption in tuber formation (Hannapel et al. 2004), supporting that LOXs act as strong tuber-inducing signals. In addition, sucrose is also shown to be an important metabolic signal involved in tuber initiation and growth. In vitro tuber formation is highly dependent on sucrose concentration (reviewed in Donnelly et al. 2003) suggesting its role in triggering sink storage function. Under LDs, silencing of a sucrose transporter- StSUT4 resulted in increased tuber formation in andigena plants, and the effect was more pronounced when external GA was applied to these plants (Chincinska et al. 2008). In another study, the levels of StCONSTANS(a suppressor of tuber development) and StSP6A (an inducer of tuber development) were found to be down-regulated and up-regulated, respectively, in StSUT4 silenced andigena plants under SDs(Chincinska et al. 2013). Thus, it appears that there is a mechanistic link between sucrose transport, the photoperiodic pathway and clock genes, which orchestrate tuber formation under inductive conditions.

KNOX TFs KNOX genes are ubiquitous in plants. They belong to the Three Amino Acid Loop Extension (TALE) superfamily ofhomeoboxTFs,and are important regulators of plant development (Burglin 1997). The first KNOX gene to be reported was KNOTTED1(Kn1) from maize (Vollbrecht et al. 1991). Based on expression pattern and sequence divergence, they are grouped into two subclasses; class-I and -II (Kerstetter et al. 1994). Class-I KNOX genes are involved in shoot apical meristem maintenance, leaf development and tuberization (Rosin et al. 2003; Ragni et al. 2007; Hay and Tsiantis 2010; Uchida et al. 2010). KNOX proteins interact with another group of TFs from the TALE superfamily(BEL1-like homeobox proteins) (Smith et al. 2002; Chen et al. 2003; Hamant and Pautot 2010). The KNOX-BEL interactions are selective, and hence different KNOX-BELL dimers regulate a unique set of target genes (Hay and Tsiantis 2010).In potato, seven KNOX genes have been identified: Potato Homeobox 1 (POTH1), POTH15, POTH20, StKn1, StHox1, StHox2 andStPetroselinum(Rosin et al. 2003; Mahajan et al. 2012; 2016). Of them, the role of POTH1 and POTH15 in leaf development and tuberization has been characterised (Rosin et al. 2003; Mahajan et al. 2012; 2016), whereas the role of other KNOX genes in potato are not yet investigated.POTH1 overexpression lines of andigenatuberized earlier and produced more tubers at a faster rate than controls under both SD and LD photoperiods in in vitro conditions (Rosin et al., 2003). Hetero-grafting experiments have shown that transcript of POTH1 moves basipetally through the phloem (Mahajan et al. 2012). In the stolon, POTH1StBEL5 heterodimer binds to a tandem TTGAC motif in the promoters of GA20ox1 and GA2ox. These interactions have been shown to reduceGA levels that is required for tuber formation (Chen et al. 2003, 2004; Hay et al. 2003; Bolduc and Hake 2009). KNOX genes also regulate levels of cytokinin, auxin, and biosynthesis of lignin (Hewelt et al. 2000; Frugis et al. 2001; Hertzberg et al. 2001; Hay et al. 2003; Mele et al. 2003; Yanai et al. 2005;

Kirtikumar R. Kondhare et.al.  | 53

Hay et al. 2006; Du et al. 2009). Earlier, Bolduc et al. (2012) and Tsuda et al. (2014) reported that KNOX-I genes targetother homeobox and hormone metabolism genes including brassinosteroid catabolism genes. Recently, Mahajan et al. (2016) have identified more than 6000 target genes of POTH15 (a class-I KNOX) mainly involved in responses to hormones, biotic/abiotic stresses, transcription regulation, and signal transduction in potato, suggesting that POTH15 controls diverse developmental processes in potato. This report also showed the presence of a tandem TGAC core motif (characteristic of KNOX-BEL binding; Chen et al. 2004) in 173 targets of 200 randomly chosen target genes within 3.0 kb in the upstream sequence of the transcription start site, suggesting a possible KNOX-BEL interaction with the target genes.

BEL1-like (BEL) TFs Similar to KNOX, BEL1-like TFs are ubiquitous in plants. In potato, thirteen BEL TFs including StBEL5 have been identified (Sharma et al. 2014). BEL proteins contain a conserved homeobox domain and the BEL domain, both of which are crucial for their function. Of the 13 BEL proteins, StBEL5, -11 and -29 constitute nearly two-thirds of the total transcript values for the entire BEL family in potato (Sharma et al. 2014). In Arabidopsis, BEL TFs has been shown to regulate shoot apical meristem and floral development. The role of StBEL5 as a mobile and tuber inducing signal has been well characterised in potato (Banerjee et al. 2006; Lin et al. 2013). BEL and KNOX interaction control numerous developmental processes in plants. As explained above, POTH1-StBEL5 hetero-dimer binds to a TTGACTTGAC motif in the promoters of GA2ox1 and GA20ox1, and regulate tuber formation in andigena under SDs (Chen et al. 2003; 2004). Even single base pair mutation in this tandem motif (e.g. mutation in the 9th base) completely abolished the binding of POTH1-StBEL5 heterodimer to their targets. Over-expression lines of StBEL5 in andigena exhibited a reduction in GA levels in stolons and leaves (Chen et al. 2003; Rosin et al. 2003), which was associated not only with the earliness in tuberization under in vitro conditions, but also with an increased tuber yield in soil grown plants under SDs. In contrast, StBEL5 RNAi lines showed 30-40% reduction in tuber yield in soil grown plants (Cho et al. 2015). Both POTH1 and StBEL5 transcripts are produced in leaves during LDs, but they move across the phloem and accumulate in stolon tips upon SD induction (Banerjee et al. 2006; Chatterjee et al. 2007; Mahajan et al. 2012).It has also been demonstrated that both 3’ and 5’ Untranslated Regions (UTRs) affect the movement of both StBEL5 and POTH1 mRNAs. Recently, Sharma et al. (2016) have reported alcohol-inducible StBEL5 overexpression lines of andigena, and identified numerous StBEL5 target genes involved in the metabolism of auxin, CK, ABA, brassinosteroid and ethylene. Network of genes that mediate tuber formation, for example, other BEL TFs, Aux/IAA, CLAVATA1, PINs, LOGs, POTLX1, GA2ox1 and GA20ox1, were also identified as StBEL5 targets (Sharma et al. 2016). Similar to StBEL5, transcripts of StBEL11 and -29 (close homologs of StBEL5) are recently shown to be phloem mobile from leaves to roots and stolons (Ghate and Sharma et al., under revision) and suppress tuber formation. It is also shown that BEL proteins interact with POTH1 and four tobacco KNOX-I proteins, however, their affinities for each other

54  |  Photoperiod-mediated Regulation of Tuberization in Potato (S. tuberosum spp. andigena)

vary (Sharma et al. 2014). Based on RNA profiling in phloem cells (Yu et al. 2007; Campbell et al. 2008), Sharma et al. (2014) proposed that there is a crosstalk between StBEL5, -11 and -29 in the stolon which ultimately decides the activation of tuber development pathway.

Polypyrimidine Tract Binding Proteins (PTBs) Polypyrimidine tract binding proteins (PTBs) are chaperons that bind to RNA for their protection, transport and metabolism(Ham et al. 2009). Six PTBs have been identified in potato: StPTB1, StPTB6, StPTB7, StPTB7.1, StPTB7.2 and StPTB7.3 (Cho et al. 2015). StPTB1 and -6 are induced in leaves by SDs, and RNA gel shift assays have reported that they bind preferentially to ‘CU (Cytosine Uracil)’ motifs in the 3’ and 5’ UTRs of StBEL5, and mediate the movement of its mRNA in to the roots and stolons under short days (Banerjee et al. 2006; 2009; Cho et al. 2012; 2015). Moreover, StPTB1 and -6 suppression lines exhibited 50-80% reduction in tuber yield, whereas their over-expression lines showed enhanced tuber yield (Cho et al. 2015), indicating that StPTBs act as positive regulator of tuber development.

Flowering Locus T (FT) Flowering Locus T (FT) is a member of the phosphatidylethanolamine-binding protein family that interacts with the bZIP transcription factor FLOWERING LOCUS D (FD) at the shoot meristem and initiates flowering (Kardailsky et al. 1999; Kobayashi et al. 1999; Abe et al. 2005; Wigge et al. 2005).Three FT orthologssuch as StSP6A, StSP3D and StSP5G have been identified in potato (Navarro et al. 2011). It is reported that StSP6A and StSP5G are involved in tuberization, whereas StSP3D is involved in flowering (Navarro et al. 2011).Hetero-grafting studies with StSP6A over-expression line as scion and wild-type as stock have demonstrated that StSP6A protein is mobile, and tuber yield was increased in heterografted plants (Navarro et al. 2011).StSP6A protein accumulates in leaves and stolons in response to SDs, which is in direct correlation with StBEL5 activity in leaves. The induction switch for StSP6A in leaves under SDs is not known.It has been shown that the promoter sequence of StSP6A has five tandem TTGAC motifs, and StSP6A activity in leaves under short days was completely abolished in mutants of these motifs (Sharma et al. 2016).Yeast-2 hybrid assays confirmed that StSP6A binds with StBEL5, -11 and -29 (Sharma et al. 2016).Under SDs,StBEL5 induces StSP6A in leaves as well as in stolons. Over-expression lines of StSP6Atuberized even under LDs, whereas its suppression lines showed a decrease in tuber yield (Navarro et al. 2011), confirming that StSP6A protein acts as a tuber activator.PHYB enhances the levels of CONSTANS to maintain its repressive effect in leaves.Though StSP6A protein acts as a co-activator in tuberization, its partner is not yet known.

CYCLING DOF FACTOR Family Proteins (CDFs) CYCLING DOF FACTOR family proteins (CDFs) are transcriptional regulators from the zinc finger DOF family.Three CDFs such as StCDF1.1, StCDF1.2 and StCDF1.3 have been

Kirtikumar R. Kondhare et.al.  | 55

reported in potato. StCDF1.1 (referred hereafter as StCDF1) encodes full-length protein, and is involved in maturity of the plant. In contrast, StCDF1.2 and StSDF1.3 encode truncated proteins, and are involved in early maturity in potato (Kloosterman et al. 2013). Transcription of StCDF1 is induced by StBEL5 in leaves under SDs (Sharma et al. 2015). In Arabidopsis, CONSTANS (CO) and FT act as flowering inducers, where StCDF1 binds to CO and FT, and repress the flowering mechanism (Sawa et al. 2007; Song et al. 2012). In Arabidopsis flowering, FKF1 (FLAVIN-BINDING, KELCH REPEAT, F-BOX PROTEIN) and GI (GIGANTEA) destabilizes StCDF1. GI/FKF1 regulate the clock complex by their response to light. Long days stabilises GI and FKF1 that activate CONSTANS and FT inducing flowering. In potato, it has been proposed that StCO1/2 (potato homologs of CONSTANS) acts as a tuberization repressor (Kloosterman et al. 2013). StCDF1 in potato represses StCO1/2thereby removing its negative effect on StSP6A in leaves, and as a result, StSP6A protein moves to stolon under SDs and tuber development is activated (Kloosterman et al. 2013).

Model for StBEL5-StCDF1-StSP6A Mediated Activation of Tuberization In an early experiment, Chailakhyan et al. (1981) showed that flowering tobacco (Nicotiana tabacum) shoots (scion) when was grafted onto potato stocks stimulated tuberization, indicating the existence of common regulatory pathways/factors between flowering and tuberization process. In some species of andigena, tuberization is under photoperiodic control but flowering is not, suggesting that there could be different mobile signals involved in the regulation of the photoperiodic response mechanism during flowering and tuberization in potato (Jackson 2009). Recent discoveries have shown that potato CONSTANS (CO) and SP6A protein are two such molecular players that are common between flowering and tuberization (Martinez-Garcia et al. 2002; Gonzalez-Schain et al. 2012; Navarro et al. 2011). Short day induced tuberization in andigena plants was supressed by overexpressing A. thaliana CONSTANS (AtCO), whereas silencing of potato CO promoted tuberization under LDs (but not under SDs) (Martinez-Garcia et al. 2002), suggesting that potato CO represses tuberization in a photoperiod-dependent manner. Further, Gonzalez-Schain et al. (2012) showedthat potato CO acts as a long-distance regulatory signal in tuberization, and the activity of CO protein is post-transcriptionally regulated by light through an interaction with PHYA/B and CRY2 (Yanovsky et al. 2002). CO protein acts downstream of a signalling cascade that involves interaction of the clock gene, GI (Park et al. 1999), and the number of other blue-light absorbing proteins, e.g. FKF1, that regulate downstream effectors, including members of the CDF family (Imaizumi et al. 2005). Similar to Arabidopsis, Rodriguez-Falcon et al. (2006) have identified a potato GI homologueStGI having similar function. Recently, Navarro et al. (2011) have shown that StSP6A protein acts as a mobile signal that initiates tuberization and is regulated independent of flowering pathway. Thus, StCO and StSP6A have an established role in tuberization in potato. Abelenda et al. (2011) showed that StCDF1 is associated with the StCO and StSP6A genes. During LDs, binding of FKF1 and GI to the CDF protein, targets it for degradation by the 26S proteasome (Sawa 2007). Potato StCO1 was transcriptionally

56  |  Photoperiod-mediated Regulation of Tuberization in Potato (S. tuberosum spp. andigena)

repressed in andigena lines containing the 35S::StCDF1.2 transgene under LDs, indicating a conserved repressive function of potato StCDF1 on StCO1/2. The StCDF1 expression peaks just before dawn under SDs that resulted in a strong upregulated expression of the StSP6A gene under SDs.Another FT ortholog in potato, StSP5G appeared to be act as a repressor of StSP6A. Under SDs, StSP5G transcript level was negligible, whereas its transcript level was highly increased under LD condition. Peak level of StCDF1 under SDs not only represses StCO1/2 expression but also down-regulates the StSP5G gene, which indirectly induces StSP6A expression. Thus, StCDF1 acts as an indirect inducer of StSP6A by down-regulating StSP5G through StCO1/2 (Kloosterman et al. 2013). Recent study by Sharma et al. (2016) have demonstrated that the expression of StCDF1 and StSP6A was induced by StBEL5, indicating that StBEL5 acts upstream of both StCDF1 and StSP6A in the tuber activation pathway. Considering the above findings of StCDF1-StCO1/2-StSP6A, Kloosterman et al. (2013) proposed a model for the induction of tuberization. In this model, the clock output proteins StGI and StFKF1 regulate the abundance of StCDF1. Subsequently, StCDF1 not only down-regulates StCO1/2 but also supresses the transcription of StSP5G, enabling expression of the mobile StSP6A protein signal, and resulting in the induction of tuber development at the stolon tip.A very recent review by Hannapel et al. (2016) have illustrated in details the role of some of these molecular players in regulating tuber developmental pathway. In the model proposed by Hannapel et al. (2016), it is shown that StBEL5 front-loads signal activity in the leaf through transcriptional induction of both StCDF1 and StSP6A during the onset of tuberization. Subsequently, these signals get doubled-down in stolons, where StBEL5KNOX heterodimer induces transcription of both StSP6A and StBEL5. Thus, according to this model, StBEL5 is positioned upstream of a regulatory network that controls tuber formation. StBEL5 functions to directly activate the tuberization program and to amplify other pivotal signals in the pathway (Fig. 2). In this model, authors suggested thatStSP6A could be regulated by itself or through its interaction with StCDF1 promoter in stolon. It is also likely that StBEL5 could regulate the expression of StCDF1 as it has been shown that StCDF1 promoter has six tandem TGAC core motifs (a characteristic of KNOX-BEL binding). Thus, identifying the crosstalk between StBEL5, StCDF1 and StSP6A could give better insights into the role of this StBEL5-StCDF1-StSP6A regulatory module in tuber development.

Kirtikumar R. Kondhare et.al.  | 57

Fig. 2.  Signalling network emphasizing the role of StBEL5, KNOX, StCDF1 and StSP6A in tuber formation (Modified from Hannapel et al. 2016).CO1/2, CONSTANS1/2; SD, short day; LD, long day.

Role of miRNAs in Tuberization Previously, two miRNAs (miR156 and miR172) were shown to control juvenile to reproductive stage transition in Arabidopsis (Wu et al. 2009). Recent studies have also demonstrated the role of Arabidopsis miR172 (Martin et al. 2009) and potato miR156 (Eviatar-Ribak et al. 2013; Bhogale et al. 2014) in tuber formation. Moreover, Santin et al. (2016) have reported that a potato miRNA (miR390) and its target StCDPK1 (Calcium dependent protein kinase 1) could serve as a regulator of tuber formation. In wild-type andigena plants, miR156 showed differential expression profiles under SD/LD conditions in a tissue-specific manner (Bhogale et al. 2014), where miR156 levels were significantly lower in leaves and stem, butthe levels were higher in stolons under SDs compared to LDs. Consistent with the findings in Arabidopsis, the relative levels of miR156 in potato leaves and stem decreased with increase in age of plants (Bhogale et al. 2014). In Arabidopsis, during the transition from a juvenile (vegetative) phase to an adult (reproductive or floral induction) phase, miR156 regulates miR172 expression via SQUAMOSA PROMOTER BINDING PROTEIN-LIKE 9 (SPL9) (Wu et al. 2009). This regulatory module is likely to be active in potato leaves under LDs, as there are high levels of miR156 but reduced levels of StSPL9 and miR172. In contrast, an increased accumulation of miR156 (Bhogale et al. 2014) and miR172 (Martin et al. 2009) in SD-induced stolons reflects a lack of regulation of miR172 by miR156, possibly due to the tissuespecific action of miR156 or spatial exclusion (Bhogale et al. 2014).Considering the recent findings of Eviatar-Ribak et al. (2013) and Bhogale et al. (2014), a model for the regulation of tuberization by miR156 is proposed here. According to this model, under SDs, miR156

58  |  Photoperiod-mediated Regulation of Tuberization in Potato (S. tuberosum spp. andigena)

is possibly transported through the phloem and accumulates in underground stolons. Reduced miR156 accumulation in aerial organs inhibits the formation of aerial tubers, whereas in LDs, increased levels of miR156 in leaves and stems assist the vegetative growth of the plant. Thus, miR156 appears to have a different function in short and long days (Bhogale et al. 2014). The levels of miR172 were significantly higher in leaves, stem, stolons and swollen stolons under SD conditions compared to LD conditions in wild-type andigena plants. Moreover, the swollen stolons at the onset of tuberization showed the highest abundance of miR172 expression suggesting a photoperiod influence on transcript accumulation. A model for regulation of tuberization by miR172 has been proposed by Martin et al. (2009), where PHYB acts upstream, followed by miR172, RELATED TO APETALA2 1 (RAP1; a putative miR172 target gene, and also a repressor of StBEL5), and StBEL5, to regulate tuberization. PHYB regulates RAP1 through either miR172-dependent or -independent pathway. It was suggested that PHYB might repress the movement of StBEL5 mRNA and miR172 from leaves into stolons under LDs. Under SDs, this repression is possibly released to allow StBEL5 and miR172 to induce tuberization. This is consistent with the notion that PHYB acts in LDs to repress a tuber inducing pathway that is active under SDs (Jackson et al. 1996). Increased levels of miR172 in leaves and stolons lead to the inhibition of RAP1, and facilitate StBEL5 expression and inducestuberization. However, an effect of miR172 target genes on tuberization through StBEL5-independent pathway cannot be ruled out. In addition, calcium signalling plays an important role in potato development. Calcium is the key second messenger in plants and Calcium Dependent Protein Kinases (CDPKs) transduce calcium signatures into specific responses including tuberization (Balamani et al. 1986; MacIntosh et al. 1996; Raices et al. 2003). Santin et al (2016) have recently shown that miR390 is a putative posttranscriptional regulator of StCDPK1, suggesting a possible crosstalk between miRNAs and CDPKs in controlling tuber formation in potato.Authors also reported that the miR390-StCDPK1 module phosphorylates its downstream target StPIN4, indicating that this module could serve as a possible tuber development regulator in potato. Moreover, in plants, Polycomb Group (PcG) proteins are shown to play important roles in regulating transition from juvenile to adult phase. A study by Pico et al. (2015) has reported that one of the PRC1 (Polycomb Repressive Complex 1) members, AtBMI1, represses miR156 and loss of AtBMI1 correlates with up-regulation of pri-MIR156A/C in Arabidopsis. This study further suggests that another PRC1 member, EMBRYONIC FLOWER (EMF1), participates in the regulation of SPL and miR172 genes. In Arabidopsis, it has been shown that EMF1 mutants lead to early flowering (Kim et al. 2012). However, it is noteworthy that PcG mediated regulation of miR156 and miR172 have been studied in Arabidopsis in context of flowering, but not with respect to tuberization in potato. Hence, it would be interesting to investigate the role of PcG members in a photoperioddependent regulation of tuberization in andigena.

Kirtikumar R. Kondhare et.al.  | 59

The Activation of Tuberization Pathway Earlier, Sarkar (2010) had proposed a tuber development mechanism in andigena highlighting the known molecular players/mobile signals. Here, we have described an updated model for a photoperiod-dependent regulation of tuberization in andigena plants. In this pathway, PHYB regulates the expression of StBEL5 (Banerjee et al. 2006; 2009) via miR172 and RAP1 (Martin et al. 2009), and of StSP6A protein via StCDF1, StCO1/2 and StSP5G (Imaizumi et al. 2005; Park et al. 1999; Sawa et al. 2007; Yanovsky et al. 2002; Rodriguez-Falcon et al. 2006; Navarro et al. 2011; Kloosterman et al. 2013) to control tuberization under SD/LD photoperiods (Fig. 2). The role of miRNAs such as miR156, miR172 and miR390 in mediating tuber development under SD/LD conditions was also explained in the previous section (Bhogale et al. 2014). Apart from this, as explained above, number of other molecular players/factors/hormones has also been shown to have a major role in tuberization e.g. GA biosynthesis and metabolic pathways, mi390-CDPK1 module, lipoxygenase (Carrera et al. 1999; Martinez-Garcia et al. 2002; Hannapel et al. 2004; Kim et al. 2007; Kloosterman et al. 2007; Rutitzky et al. 2009;Bou-Torrent et al. 2011). Under SDs in leaves of andigena plants (Fig. 2), StBEL5 transcript and StPTBs levels are increased, which results in activation of StCDF1 transcription. Enhanced StCDF1 transcript level removes the repressor of tuberization, StCO1/2, and the levels of StSP6A protein increase. Moreover under short days, the levels of FKF1 and GI, which are shown to destabilise StCDF1, goes down under short days, whereas the levels of KNOX-I (POTH1) transcript are shown to be enhanced in leaves. The StBEL5-StPTBs RNP complex, StSP6A protein and the POTH1 transcript moves from leaves to stolon through the phloem. In the stolon, StBEL5 is translated, and the StBEL5-POTH1complex activates tuber formation by regulating tuber marker genes (e.g. GA2ox1, GA20ox1, GA3ox1), via either StBEL5-POTH1 heterodimer complex or StSP6A protein mediated signalling pathway. In the stolon, it is also shown that StBEL5 induces StBEL11 and -29 transcript levels that are known to supress root and tuber growth under short days (Fig. 2). How StBEL5, StBEL11 and StBEL29 works together in fine tuning of tuber development is still an open question. Under LDs in leaves of andigena plants (Fig. 2), the levels of StBEL5 transcript and StPTBs are decreased. The levels of FKF1 and GI increases and as a result, StCDF1 is destabilized. The StCO1/2 levels are increased leading to decreased levels of StSP6A protein in leaves. These events lead to minimised escort of the StBEL5-StPTBs RNP complex, StSP6A protein and POTH1 transcript into the stolon and eventually, tuber development is inhibited (Fig. 2). Although a number of molecular players and mobile signals regulating tuber development have been identified in potato e.g. KNOX/BEL TFs, StCDPKs, miRNAs, PHYA/B, StCO1/2, StSP6A and StCDF1, we have no idea how some of these mobile signals are loaded and unloaded into/from the phloem? Among BEL TFs, how StBEL5, -11 and -29 works together in fine tuning of tuber development needs further investigation. Moreover, thecrosstalk between StBEL5, StCDF1 and StSP6A would need to be investigated further. Although the role of StSP6A protein as a mobile signal and positive co-activator in tuberization has been investigated, the information about its protein partner that helps

60  |  Photoperiod-mediated Regulation of Tuberization in Potato (S. tuberosum spp. andigena)

in its mobility through the phloem and their subsequent mechanism of action in the stolon is unknown. What upstream regulators control differential expression of miR156 under SD/LD conditions in potato (andigena) is also not clear. Moreover, as andigena potato plants produces tubers only under short days, are there any epigenetic modifiers such as polycomb or trithorax group proteins involved in this short day induction of tuber activation pathways?

Acknowledgments Financial support from IISER Pune and DST, Govt. of India is gratefully acknowledged. KK and AK acknowledge research fellowship obtained from Dept. of Biotechnology, and CSIR, India, respectively. Authors are thankful to Prof. David Hannapel (Iowa State University, USA) for his collaboration in StBEL11 and -29 functional analyses.

REFERENCES Abe M, Kobayashi Y, Yamamoto S, Daimon Y, Yamaguchi A, Ikeda Y, Ichinoki H, Notaguchi M, Goto K, Araki T (2005) FD, a bZIP protein mediating signals from the floral pathway integrator FT at the shoot apex. Science 309: 1052-1056. Abelenda JA, Navarro C, Prat S (2011) From the model to the crop: genes controlling tuber formation in potato. Curr Op in Biotechnol 22: 287-292. Amador V, Monte E, Garcia-Martinez J-L, Prat S (2001) Gibberellins signal nuclear import of PHOR1, a photoperiod-responsive protein with homology to Drosophila armadillo. Cell 106: 343-354. Balamani V, Veluthambi K, Poovaiah BW (1986) Effect of calcium on tuberization in potato. Plant Physiol 80: 856-858. Banerjee AK, Chatterjee M, Yu Y, Suh SG, Miller WA, Hannapel DJ (2006) Dynamics of a mobile RNA of potato involved in a long-distance signaling pathway. Plant Cell 18: 3443-3457. Banerjee AK, Lin T, Hannapel DJ (2009) Untranslated regions of a mobile transcript mediate RNA metabolism. Plant Physiol 151: 1831-1843. Bhogale S, Mahajan AS, Natarajan B, Rajabhoj M, Thulasiram HV, Banerjee AK (2014) MicroRNA156: A potential graft-transmissible microRNA that modulates plant architecture and tuberization in Solanum tuberosum spp. andigena. Plant Physiol 164: 1011-1027. Bodlaender KBA, Lugt C, Marinus J (1964) The induction of second-growth in potato tubers. Eur Potato J 7: 57-71. Bolduc N, Hake S (2009) The maize transcription factor KNOTTED1 directly regulates the gibberellin catabolism gene ga2ox1. Plant Cell 21: 1647-1658.

Kirtikumar R. Kondhare et.al.  | 61

Bolduc N, Yilmaz A, Mejia-Guerra MK, Morohashi K, O’Connor D, Grotewold E, Hake S (2012) Unraveling the KNOTTED1 regulatory network in maize meristems. Genes Dev 26: 1685-1690. Bou-Torrent J, Martinez-Garcia JF, Garcia-Martinez JL, Prat S (2011) Gibberellin A1 metabolism contributes to the control of photoperiod-mediated tuberization in potato. PLoS ONE 6: e24458. Burglin TR (1997) Analysis of TALE superclass homeobox genes (MEIS, PBC, KNOX, Iroquois, TGIF) reveals a novel domain conserved between plants and animals. Nucl Acid Res 25: 4173-4180. Bushnell J (1925) The relation of temperature to growth and respiration in the potato plant. MinnAgricExpStn Tech Bull 34: 29. Campbell B, Hallengren J, Hannapel DJ (2008) Accumulation of BEL1-like transcripts in solanaceous species. Planta 228: 897-906. Carrera E, Jackson SD, Prat S (1999) Feedback control and diurnal regulation of gibberellin 20-oxidase transcript levels in potato. Plant Physiol 119: 765-773. ChailakhyanMKh, Yanina LI, Davedzhiyan AG, Lotova GN (1981) Photoperiodism and tuber formation in grafting of tobacco onto potato.Dokl.Akad.Nauk SSSR 257: 12761280. Chapman HW (1958) Tuberization in the potato plant.Physiol Plant 11: 215-224. Chatterjee M, Banerjee AK, Hannapel DJ (2007) A BELL1-like gene of potato is light activated and wound inducible. Plant Physiol 145: 1435-1443. Chen H, Rosin FM, Prat S, Hannapel DJ (2003) Interacting transcription factors from the TALE superclass regulate tuber formation. Plant Physiol 132: 1391-1404. Chen H, Banerjee AK, Hannapel DJ (2004) The tandem complex of BEL and KNOX partners is required for transcriptional repression of ga20ox1. Plant J 38: 276-284. Chincinska IA, Liesche J, Krügel U, Michalska J, Geigenberger P, Grimm B, et al. (2008) Sucrose transporter StSUT4 from potato affects flowering, tuberization, and shade avoidance response. Plant Physiol 146: 515-528. Chincinska I, Gier K, Krügel U, Liesche J, He H, Grimm B, et al. (2013) Photoperiodic regulation of the sucrose transporter StSUT4 affects the expression of circadianregulated genes and ethylene production. Front Plant Sci 4: 26. Cho SK, Kang IH, Carr T, Hannapel DJ (2012) Using the yeast three-hybrid system to identify proteins that interact with a phloem-mobile mRNA. Front Plant Physiol 3: 189. Cho SK, Sharma P, Butler NM, Kang IH, Shah S, Rao AG, Hannapel DJ (2015) Polypyrimidine tract-binding proteins of potato mediate tuberization through an interaction with StBEL5 RNA. J Exp Bot, doi:10.1093/jxb/erv389 Donnelly JD, Coleman WK, Coleman SE (2003) Potato microtuber production and performance: A review. Amer J Potato Res 80: 103-115.

62  |  Photoperiod-mediated Regulation of Tuberization in Potato (S. tuberosum spp. andigena)

Du J, Mansfield, SD, Groover AT (2009) The Populushomeobox gene ARBORKNOX2 regulates cell differentiation during secondary growth. Plant J 60: 1000-1014. Endo M, Mochizuki N, Suzuki T, Nagatani A (2007) Cryptochrome2 in vascular bundles regulates flowering in Arabidopsis. Plant Cell 19: 84-93. Eviatar-Ribak T, Shalit-Kaneh A, Chappell-Maor L, Amsellem Z, Eshed Y, Lifschitz E (2013) A cytokinin-activating enzyme promotes tuber formation in tomato. Curr Biol 23: 1057-1064. Ewing EE (1978) Shoot, Stolon, and Tuber Formation on Potato (Solanum tuberosum L.) Cuttings in Response to Photoperiod. Plant Physiol 61: 348-353. Ewing EE, Wareing PF (1978) Shoot, stolon, and tuber formation on potato (Solanum tuberosum L.) cuttings in response to photoperiod. Plant Physiol 61: 348-353. Ewing EE, Struik PC (1992). Tuber formation in potato: Induction, initiation and growth. Hortic. Rev 14: 89-98. Faivre-Rampant O, Cardle L, Marshall D, Viola R, Taylor MA (2004) Changes in gene expression during meristem activation processes in Solanum tuberosum with a focus on the regulation of an auxin response factor gene. J Exp Bot 55: 613-622. Frugis, G, Giannino D, Mele G, Nicolodi, C, Chiappetta A, Bitonti MB, Innocenti AM, Dewitte W, van Onckelen H, Mariotti D (2001) Overexpression of KNAT1 in lettuce shifts leaf determinate growth to a shoot like indeterminate growth associated with an accumulation of isopentenyl-type cytokinins. Plant Physiol 126: 1370-1380. Gao Y, Jia L, Hu B, Alva A, Fan M (2014) Potato Stolon and Tuber Growth Influenced by Nitrogen Form. Plant Prod. Sci. 17(2): 138-143. Gonzalez-Schain ND, Diaz-Mendoza M, Zurczak M, Suarez-Lopez P (2012) Potato CONSTANS is involved in photoperiodic tuberization in a graft-transmissible manner. Plant J 70: 678-690. Ghate TH, Sharma P, Kondhare KR, Hannapel DJ, Banerjee AK. The mobile RNAs, StBEL11 and StBEL29, suppress growth of roots and tubers in potato. Plant Molecular Biology (Under revision). Gregory LE (1956) Some factors for tuberization in the potato plant. Am J Bot 43: 281-288. Ham BK, Brandom JL, Xoconostle-Cázares B, Ringgold V, Lough TJ, Lucas WJ. (2009) A polypyrimidine tract binding protein, pumpkin RBP50, forms the basis of a phloemmobile ribonucleoprotein complex. The Plant Cell 21: 197-215. Hamant O, Pautot V(2010) Plant development: a TALE story. Comptes Rendus Biol 333: 371-381. Hammes PS, Beyers EA (1973) Localization of the photoperiodic perception in potatoes. Potato Res 16: 68-72. Hannapel DJ, Chen H, Rosin FM, Banerjee AK, Davies PJ (2004) Molecular controls of tuberization. Am J Potato Res 81: 263-274.

Kirtikumar R. Kondhare et.al.  | 63

Hannapel DJ, Sharma P, Lin T, Banerjee AK (2016). Front-loaded and doubled-down: The signaling network of tuberization. An Update on the Tuber Activation Pathway. Plant Physiology (In press). Hay A, Tsiantis M (2010) KNOX genes: Versatile regulators of plant development and diversity. Development 137: 3153-3165. Hay A, Jackson D, Ori N, Hake S (2003) Analysis of the competence to respond to KNOTTED1 activity in Arabidopsis leaves using a steroid induction system. Plant Physiol 131: 1671-1680. Hay A, Barkoulas M, Tsiantis M (2006) ASYMMETRIC LEAVES1 and auxin activities converge to repress BREVIPEDICELLUS expression and promote leaf development in Arabidopsis. Development 133: 3955-3961. Hertzberg M, Aspeborg H, Schrader J, Andersson A, Erlandsson R, Blomqvist K, Bhalerao R, Uhlen M, Teeri TT, Lundeberg J, Sundberg B, Nilsson P, Sandberg G (2001) A transcriptional roadmap to wood formation. Proc Nat Acad Sci USA 98: 14732-37. Hewelt A, Prinsen E, Thomas M, Onckelen HV, Meins, F (2000) Ectopic expression of maize knotted1 results in the cytokinin-autotrophic growth of cultured tobacco tissues. Planta 210: 884-889. Horvath BM, Magyar Z, Zhang Y, Hamburger AW, Bako L, Visser RGF, Bachem CWB, Bogre L (2006) EBP1 regulates organ size through cell growth and proliferation in plants. EMBO J 25: 4909-4920. Imaizumi T, Schultz TF, Harmon FG, Ho LA, Kay SA (2005) FKF1 F-box protein mediates cyclic degradation of a repressor of CONSTANS in Arabidopsis. Sci 309: 293-297. Jackson SD (2009) Plant responses to photoperiod. New Phytol 181: 517-531. Jackson SD, Heyer A, Dietze J, Prat S (1996) Phytochrome B mediates the photoperiodic control of tuber formation in potato. Plant J 9: 159-166. Jackson SD, James P, Prat S, Thomas B (1998) Phytochrome B affects the levels of grafttransmissible signal involved in tuberization. Plant Physiol 124: 423-430. Kamiya Y, Garcia-Martinez JL (1999) Regulation of gibberellin biosynthesis by light.Curr Opin Plant Biol 2: 398-403. Kardailsky I, Shukla VK, Ahn JH, Dagenais N, Christensen SK, Nguyen JT, Chory J, Harrison MJ, Weigel D (1999) Activation tagging of the floral inducer FT . Science 286: 1962-1965. Kerstetter R, Vollbrecht E, Lowe B, Veit B, Yamaguchi J, Hake S (1994) Sequence analysis and expression patterns divide the maize knotted1-like homeobox genes into two classes. Plant Cell 6: 1877-1887. Kim M-S, Kim H-S, Kim Y-S, Baek K-H, Oh H-W, Hahn K-W, Bae R-N, Lee I-J, Joung H, Jeon J-H (2007) Superoxide anion regulates plant growth and tuber development of potato. Plant Cell Rep 26: 1717-1725.

64  |  Photoperiod-mediated Regulation of Tuberization in Potato (S. tuberosum spp. andigena)

Kim SY, Lee J, Eshed-Williams L, Zilberman D, Sung ZR (2012) EMF1 and PRC2 cooperate to repress key regulators of Arabidopsis development. PLoS Genet 8: e1002512. Kloosterman B, Navarro C, Bijsterbosch G, Lange T, Prat S, Visser RGF, Bachem CWB (2007) StGA20ox1 is induced prior to stolon swelling and controls GA levels during potato tuber development. Plant J 52: 362-373. Kloosterman B, Abelenda J, Gomez MDMC, Oortwijn M, De Boer JM, Kowitwanich K, Horvath BM, van Eck HJ, Smaczniak C, Prat S, Visser RGF, Bachem CWB (2013) Naturally occurring allele diversity allows potato cultivation in northern latitudes. Nature 495: 246-250. Kobayashi Y, Kaya H, Goto K, Iwabuchi M, Araki T (1999) A pair of related genes with antagonistic roles in mediating flowering signals. Science 286: 1960-1962. Koda Y (1992) The role of jasmonic acid and related compounds in the regulation of plant development. Int Rev Cytol 135: 155-199. Lin T, Sharma P, Gonzalez DH, Viola IL, Hannapel DJ (2013) The impact of the longdistance transport of a BEL1-like mRNA on development. Plant Physiol 161: 760-772. MacIntosh GC, Ulloa RM, Raices M, TellezIñón MT (1996) Changes in calcium dependent protein kinase activity in in vitro tuberization in potato. Plant Physiol. 112: 1541-1550. Mahajan A, Bhogale S, Kang IH, Hannapel DJ, Banerjee AK(2012) The mRNA of a Knotted1-like transcription factor of potato is phloem mobile. Plant Mol Biol 79: 595608. Mahajan AS, Kondhare KR, Rajabhoj MP, Kumar A, Ghate T, Ravindran N, Habib F, Siddappa S, Banerjee, AK (2016) Regulation, over-expression and target gene identification of Potato Homeobox 15 (POTH15) - a class-I KNOX gene in potato. J Exp Bot. doi:10.1093/jxb/erw205 Martin DN, Proebsting WM, Parks TD, Dougherty WG, Lange T, Lewis MJ, Gaskin P, Hedden P (1996) Feed-back regulation of gibberellin biosynthesis and gene expression in Pisum sativum L. Planta 200: 159-166. Martin A, Adam H, Diaz-Mendoza M, Zurczak M, Gonzalez-Schain ND, Suarez-Lopez P (2009) Graft-transmissible induction of potato tuberization by the microRNA miR172. Development 136: 2873-2881. Martinez-Garcia JF, Garcia-Martinez JL, Bou J, Prat S (2001) The interaction of gibberellins and photoperiod in the control of potato tuberization. J Plant Growth Regul 20: 377386. Martinez-Garcia JF, Virgós-Soler A, Prat S (2002) Control of photoperiod regulated tuberization in potato by the Arabidopsis flowering-time gene CONSTANS. Proc Natl AcadSci USA 99: 15211-15216. Mele G, Ori N, Sato Y, Hake S (2003) The knotted1-like homeobox gene BREVIPEDICELLUS regulates cell differentiation by modulating metabolic pathways. Genes Dev 17, 2088-2093.

Kirtikumar R. Kondhare et.al.  | 65

Menzel BM (1980) Tuberization in potato (Solanum tuberosum) cultivar Sebago at high temperatures: responses to gibberellin and growth inhibitors. Ann Bot 46: 259-266. Menzel C (1985) Tuberization in potato at high temperatures: interaction between temperature and irradiance. Ann Bot 55: 35-39. Nam K-H, Minami C, Kong F, Matsuura H, Takahashi K, Yoshihara T (2005) Relation between environmental factors and the LOX activities upon potato tuber formation and flower-bud formation in morning glory. Plant Growth Regul 46: 253-260. Navarro C, Abelenda JA, Cruz-Oro E, Cuéllar CA, Tamaki S, Silva J, Shimamoto K, Prat S (2011) Control of flowering and storage organ formation in potato by FLOWERING LOCUS T. Nature 478: 119-122. Nitsch J (1965) Existence d’un stimulus photopériodique non-spécifique capable de provoquer la tubérisation chez Helianthus tuberosus L. Bull Soc Bot Fr 112: 333-340. Osaki M, Shirai J, Shinano T, Tadano T (1995) Effects of ammonium and nitrate assimilation on the growth and tuber swelling of potato plants. Soil Sci. Plant Nutr. 41: 709-719. Park DH, Somers DE, Kim YS, Choy YH, Lim HK, Soh MS, Kim HJ, Kay SA, Nam HG (1999) Control of circadian rhythms and photoperiodic flowering by the Arabidopsis GIGANTEA gene.Sci 285: 1579-1582. Pico S, Ortiz-Marchena MI, Merini W, Calonje M (2015) Deciphering the role of Polycomb Repressive Complex 1 (PRC1) variants in regulating the acquisition of flowering competence in Arabidopsis. Plant Physiol 168(4): 1286-97. Ragni L, Truernit E, Pautot V(2007) KNOXing on the BELL: Tale homeobox genes and meristem activity. Inter J Plant Devel Biol 1: 42-48. Raices M, Gargantini PR, Chinchilla D, Crespi M, Tellez-Inon MT, Ulloa RM (2003) Regulation of CDPK isoforms during tuber development. Plant Mol Biol 52: 10111024. Rodriguez-Falcon M, Bou J, Prat S (2006) Seasonal control of tuberization in potato: conserved elements with the flowering response. Annu Rev Plant Biol 57: 151-180. Roumeliotis E, Kloosterman B, Oortwijn M, Kohlen W, Bouwmeester HJ, Visser RGF, Bachem CWB (2012) The effects of auxin and strigolactones on tuber initiation and stolon architecture in potato. J Exp Bot 63: 4539-4547. Ross JJ, MacKenzie-Hose A, Davies PJ, Lester DR, Twitchin B, Reid JB (1999) Further evidence for feedback regulation of gibberellin biosynthesis in pea. Physiol Plant 105: 532-538. Rutitzky M, Ghiglione HO, Cura JA, Casal JJ, Yanovsky MJ (2009) Comparative genomic analysis of light-regulated transcripts in the Solanaceae. BMC Genomics 10: 60. Santin F, Bhogale S, Fantino E, Grandellis C, Banerjee AK, Ulloa RM (2016). An ubiquitously expressed StCDPK1 is regulated by miR390 at post transcriptional level and phosphorylates its downstream target StPIN4 in potato. Physiologia Plantarum (in press).

66  |  Photoperiod-mediated Regulation of Tuberization in Potato (S. tuberosum spp. andigena)

Sarkar, D. (2010) Photoperiodic inhibition of potato tuberization: An update. Plant Growth Regul. 62: 117-125. Sawa M, Nusinow DA, Kay SA, Imaizumi T (2007) FKF1 and GIGANTEA complex formation is required for day-length measurement in Arabidopsis. Science 318: 261265. Song YH, Smith RW, To BJ, Millar AJ, Imaizumi T (2012) FKF1 conveys timing information for CONSTANS stabilization in photoperiodic flowering. Science 336: 1045-1049. Sergeeva LI, de Bruijn SM, Koot-GronsveldEAM, Navratil O, Vreugdenhil D (2000) Tuber morphology and starch accumulation are independent phenomena: evidence from ipt-transgenic potato lines. Physiol Plant 108: 435-443. Siedow JN (1991) Plant lipoxygenase: Structure and function. Ann Rev Plant Physiol Plant Mol Biol 42: 145-188. Shan J, Song W, Zhou J, Wang X, Xie C, Gao X, Xie T, Liu J (2013) Transcriptome analysis reveals novel genes potentially involved in photoperiodic tuberization in potato. Genomics 102 (4): 388-396. Sharma P, Lin T, Grandellis C, Yu M, Hannapel DJ (2014) The BEL1-like family of transcription factors in potato. J Exp Bot 65 (2): 709-723. Sharma P, Lin T, David J. Hannapel DJ. (2016) Targets of the StBEL5 transcription factor include the FT ortholog StSP6A. Plant Physiology, DOI:10.1104/pp.15.01314 Smith HMS, Boschke I, Hake S (2002) Selective interaction of plant homeodomain proteins mediates high DNA-binding affinity. Proc Nat AcadSci USA 99: 9579-9584. Svensson B (1962) Some factors affecting stolon and tuber formation in the potato plant. Eur Potato J. 5: 28-39. Tsuda K, Kurata N, Ohyanagi H, Hake S (2014) Genome-wide study of KNOX regulatory network reveals brassinosteroid catabolic genes important for shoot meristem function in rice. Plant Cell 26: 3488-3500. Uchida N, Kimura S, Koenig D, Sinha N (2010) Coordination of leaf development via regulation of KNOX1 genes. J Plant Res 123 (1): 7-14. Viola R, Roberts AG, Haupt S, Gazzani S, Hancock RD, Marmiroli N, Machray GC, Oparka KJ (2001) Tuberization in potato involves a switch from apoplastic to symplastic phloem unloading. Plant Cell 13: 385-398. Vollbrecht E, Veit B, Sinha N, Hake S (1991) The developmental gene Knotted-1 is a member of a maize homeobox gene family. Nature 350: 241-243. Vreugdenhil D (2004) Comparing potato tuberization and sprouting: opposite phenomena? Am J Potato Res 81: 275-280. Werner HO (1934) The effect of a controlled nitrogen supply with different temperatures and photoperiods upon the development of the potato plant. Res Bull Nebraska AgricExpStn No 75: 132.

Kirtikumar R. Kondhare et.al.  | 67

Wheeler RM, Tibbitts TW (1986) Growth and tuberization of potato (Solanum tuberosum L.) under continuous light. Plant Physiol 80: 801-804. Wigge PA, Kim MC, Jaeger KE, Busch W, Schmid M, Lohmann JU, Weigel D (2005) Integration of spatial and temporal information during floral induction in Arabidopsis. Science 309: 1056-1059. Wu G, Park MY, Conway SR, Wang J-W, Weigel D, Poethig RS (2009) The sequential action of miR156 and miR172 regulates developmental timing in Arabidopsis. Cell 138: 750-759. Xu X, van Lammeren AAM, Vermeer E, Vreugdenhil D (1998) The role of gibberellin, abscisic acid, and sucrose in the regulation of potato tuber formation in vitro. Plant Physiol 117: 575-584. Xu X, et al. (2011) Potato genome sequencing, genome sequence and analysis of the tuber crop potato, Nature 475: 189-195. Yamaguchi S, Kamiya Y (2000) Gibberellin biosynthesis: its regulation by endogenous and environmental signals. Plant Cell Physiol 41: 251-257. Yanai O, Shani E, Dolezal K, Tarkowski P, SablowskiR, Sandberg G, Samach A, Ori N (2005) Arabidopsis KNOXI proteins activate cytokinin biosynthesis. Curr Biol 15: 1566-1571. Yanovsky MJ, Kay SA (2002) Molecular basis of seasonal time measurement in Arabidopsis. Nature 419: 308-312. Yu YY, Lashbrook CC, Hannapel DJ (2007) Tissue integrity and RNA quality of laser microdissected phloem of potato. Planta 226: 797-803.

mmm

Trends in Frontal Areas of Plant Science Research Edited by: S. Sinha, R.K. Sinha © Department of Botany, Tripura University, 2017

Bamboo Shoots: A Potential Source of Nutraceuticals Kananbala Sarangthem Department of Life Sciences, Manipur University, Canchipur -795003, Manipur, India E-mail: [email protected]

Summary Bamboo, the wonderful ‘Green gold’ plant is nature’s most valuable gifts to mankind. The emerging fresh young delicate bamboo shoots are one of the important and culturally significant food items in oriental countries and are available in markets in various sliced forms, fresh, dried, pickled, fermented and canned version. Recently bamboo shoots have attracted significant research and commercial interest due to its use as a new health food and as a potential nutraceuticals. Nutraceuticals are products derived from food sources that are purported to provide extra health benefits, in addition to the basic nutritional value found in foods. The present paper explores the various bioactive components present in different bamboo species along with its nutraceutical potential. The young fresh bamboo shoots contain various ingredient of nutritional significance like carbohydrate, protein, ascorbic acid, flavonoids, tannins, total phenols and amino acids and dietary fiber which may offer health benefits. The bamboo shoots are rich in minerals, have adequate amount of glucose, low in fat, tender, delicious and nutritive. The cyanogenic glycosides content in bamboo shoots were found to decrease substantially in the fermented samples below the human toxic level. Both fresh and fermented bamboo shoots contain high level of phytosterols. These phytosterol act as nutraceuticals and are precursors of many pharmaceutically active steroidal drugs. Phytosterols are effective in lowering cholesterol by inhibiting the absorption of cholesterol from the small intestine. Hence Bamboo shoots may be promoted as health enhancing food due to its rich nutritive bioactive components which are of great interest in both food and pharmaceutical industries. Key words Bamboo shoots, bioactive component, phytosterols, neutraceuticals. Bioactive components of plants appear to be essential for optimal health and longevity. They have various functionalities that provide excellent molecular properties for the production of nutraceuticals, functional foods and food additives (Gil-Chavez et al., 2013). Nutraceuticals are products derived from food sources that are purported to provide extra health benefits, in addition to the basic nutritional value found in

70  |  Bamboo Shoots: A Potential Source of Nutraceuticals

foods (Maher, 2003). Nutraceuticals may be considered as health bio-actives that may be used in functional foods and one of the most researched groups of nutraceuticals in the area of cardiovascular diseases is phytosterols (Zawistowski, 2002). Plant sterols, known generally as phytosterols, are essential components of the membrane lipid bilayer (Schuler ,1997). There is considerable interest in phytosterols as dietary supplements as they are reported to lower cholesterol levels ( Ostlund et al., 2003) and also have a positive impact on cardiovascular diseases (Patel and Thompson,2006; Weingartner et al., 2009). Again , bioactive compounds that are used as natural product-derived therapeutic agents or as disease-preventing nutrients.( Ajikumar ,2008). Over the last few decades, natural bioactive compounds with potential for the treatment and prevention of human diseases have attracted much attention in many laboratories and industries and bamboo is one such source of nutraceuticals The bamboo shoots have anti-hypertensive, anti-tumour and anti-oxidant properties. Bamboo leaves and Bamboo salt made from the culm of bamboo is used as a medicinal food in many Asian countries. Due to its various uses, bamboo is now being recognized for economic and environmental development, thus leading to change its image from ‘poor man’s timber to “Green Gold”. In addition to its multifarious uses, bamboo shoots are now being promoted as health food (INBAR 1997; Ogunwusi, 2011). The emerging fresh young bamboo shoots which are used in numerous Asian dishes and are available in markets in various sliced forms, fresh, fermented and canned version (Tai, 1985; Fu et al, 1987; Midmore, 1998). At present over two million tons of edible bamboo shoots are consumed in the world in each year (Yang et al. 2008). In Manipur, a state located in the north eastern part of India, the fresh succulent bamboo shoots slices and the fermented shoot slices done in large scale are highly prized vegetable food items. More than 700,000 culms are extracted every year in Manipur (Statistical bulletin of Manipur forest, Govt. of Manipur, 1999-2000). Young delicate bamboo shoots are of favorite because of its high fiber content and its delicacy (Fuchigami,1990). They are rich in minerals, have adequate amount of glucose, low in fat and is brittle, tender, delicious and nutritive (Yamaguchi and Kusama, 1976; Yamaguchi, 1983; Nirmala et al., 2008; Park and John, 2009). Bamboo also contains many secondary metabolites which can be used as precursors of many pharmaceutical industries (Sarangthem and Singh, 2003). In spite of their high nutritive value, bamboo shoots are found to contain cyanogenic glycosides releasing hydrogen cyanide which is toxic to human being. The cyanogenic glycoside in bamboo is taxiphyllin which is a p-hydroxylatemandelonitrile triglochinin (Nahrstedt, 1993; Hunter and Yang, 2002; Pandey and Ojha, 2013; Schwarzmaier,1977). Taxiphyllin is a bitter compound (Ke-jun et al., 2005) making some bamboo shoots taste bitter to eat. Processing and fermentation of the bamboo shoots decreases the toxicity of the cyanogenic glycoside (Sarangthem and Hoikhokim, 2010). In the present paper , bioactive component and phytosterols content in bamboo shoots both fresh and fermented form (traditional and scientifically modified fermentation) were being studied so that Bamboo shoots may be promoted as health enhancing food.

Kananbala Sarangthem  | 71

Materials and Methods The emerging young fresh succulent bamboo shoots of Bambusa tulda , B. balcooa, Dendrocalamus hamiltonii, D. Hookeri, Pseudostachyum polymorphum, Schizostachyum dulloa were collected during the growing season (May- July) from different districts of Manipur, India. Fermentation Preservative methods of the fresh succulent bamboo shoots were done in large-scale in Manipur by traditional methods of fermentation process. The fermented bamboo shoot slices are locally called soibum and soidon. Bamboo shoots of many species like Bambusa tulda , B. balcooa, Dendrocalamus hamiltonii, D. Hookeri, Pseudostachyum polymorphum, Schizostachyum dulloa and Thyrsostachys oliveri were used for fermentation of soibum. Traditional Method of Fermentation The soibum is prepared traditionally by storing thin slices of fresh succulent and soft bamboo shoots in certain containers/chambers for 2-3 months. The fermented chambers are either made of bamboo planks or roasted earthen pots. The inner surface of bamboo chambers are lined with banana leaves and a thin polythene sheets. The upper surface is sealed with polythene sheet and weights are then put on top for proper pressing. At the initial stage of fermentation the exudates is leached/drained out of the tilted side of the bamboo plank chamber. After fermentation is completed, which is indicated by the smell, colour and texture, soibum can be stored up to one year. Laboratory Fermentation Fermentation of the fresh bamboo shoot slices were also carried out in the laboratory by a modified form of the traditional method of fermentation which involves inoculating thin slices of succulent bamboo shoots with the exudates obtained from already fermented slices of bamboo shoots (traditionally fermented) under aseptic condition using a Laminar flow. After inoculation, the samples were kept in an incubator at 30+2oC for a period of 90 days. To assess the nutritional values, bioactive component and phytoserol content of the mixture of fresh bamboo shoot slices each of Bambusa tulda , B. balcooa, Dendrocalamus hamiltonii, D. Hookeri , Pseudostachyum polymorphum, Schizostachyum dulloa and Thyrsostachys oliveri . and fermented samples of these succulent bamboo shoots, different parameters of biochemical analysis were conducted as follows: Moisture content were determined using the ISTA methods (1996) as follows: Moisture content (%) =

Original weight – Oven dry weight × 100 Original weight

72  |  Bamboo Shoots: A Potential Source of Nutraceuticals Table 1: Comparison of the proximate and nutritional content in fresh edible bamboo shoots and fermented bamboo shoot slices (Scientifically modified laboratory fermented and traditionally fermented for three months ). Fresh bamboo shoot slices

Laboratory fermented sample (3 months old fermentation)

Traditionally fermented sample (3 months old fermentation)

1. Carbohydrate (mg/100gfresh wt.)

734.50±2.08

385.84±0.98

262.97±1.98

2. Soluble protein (mg/100gfresh wt.)

462.28±1.85

321.49±1.51

298.47±0.63

Parameters

3. Crude protein (% dry wt.)

2.50±0.07

2.76±0.13

2.69±0.09

4. Total amino acid (mg/100g fresh wt.)

205.77±1.39

261.03±2.03

223.69±1.32

5. Ascorbic acid (mg/100gfresh wt.)

5.76±0.21

2.17±0.05

2.00±0.19

6. Moisture (%)

79.47±1.20

68.92±0 .18

73.36±1.38

7. pH value

6.08±0.22

4.18±0.07

4.41±0.34

* Data presented as mean ± SD. Table 2: Bioactive component present in fresh edible bamboo shoots and fermented bamboo shoot slices (Scientifically modified laboratory fermented and traditionally fermented for three months) Parameters

Fresh bamboo shoot slices

Laboratory fermented sample (3 months old fermentation)

Traditionally fermented sample (3 months old fermentation)

1. Total phenol (mg/100gfresh wt.)

97.73±1.40

204.91±3.80

190.65±1.48

2. Flavonoid (mg/100 fresh wt)

51.11±1.77

56.73±0.86

63.96±0.41

3. Tannin (mg/100 fresh wt)

31.49±1.50

52.00±1.58

68.21±0.55

* Data presented as mean ± SD.

Analysis of Total Carbohydrate Total carbohydrate contents were determined by hydrolyzing the polysaccharides into simple sugars by acid hydrolysis and estimating the resultant monosaccharides spectrophotometrically by Anthrone’s method (Hedge et al. 1962). The 0.1 g of bamboo shoots was hydrolyzed by keeping in boiling water bath for 3 hours in 5 mL of 2.5 N hydrochloric acid (HCl), cooled to room temperature, neutralized with solid sodium

Kananbala Sarangthem  | 73

carbonate (Na2CO3) until the effervescence ceases. The volume was made upto 100 mL with distilled water. The filtrate (0.5 mL) and glucose standards were taken. The volume was made upto 1 mL with distilled water and 4 mL of anthrone reagent was added. The solutions were then kept in boiling water bath for 8 min and absorbance was measured at 630 nm against blank. The amount of carbohydrate (g)in the sample was then calculated with the help of standard curve prepared using glucose. Analysis of Total Soluble Protein Estimation of phosphate buffer soluble proteins were done in fresh samples by Lowry’s et al. (1951) methods. Calculations were done from the standard curve prepared by using BSA (Bovine Serum Albumin) as the standard solution. The optical density was measured at 660 nm. Analysis of Total of Crude Proteins Crude protein was determined and calculated by multiplying conversion factor 6.25 to the nitrogen content. The total nitrogen content was estimated by following the Microkjeldahl method of Doneen (1932) with some modification incorporated by Langs (1958). Analysis of Ascorbic Acid The ascorbic acid content of the fresh and fermented sample of bamboo shoots were determined volumetrically (Raghu et al., 2007) by titrating with 2, 6 dichloro- indophenol dye. The amount of ascorbic acid content in the sample was calculated, using the following formula. I¥S¥D Ascorbic acid (mg/100 g of tissues) = ¥ 100 A¥W Where, I = ml of indophenols reagent used in the titration; S = mg of ascorbic acid reacting with I of the reagent; D = volume of the extract in ml; A = the aliquot titrated in ml and W = the weight of the sample. Analysis of Amino Acid Total free amino acid was determined with ninhydrin reagent as per Yemm and Cocking (1955). The amounts of total free amino acids were calculated using a standard curve prepared from glycine.

Analysis of Total Phenols The dried powdered bamboo shoot samples were extracted in 10 ml of methanol by intermittent maceration up to 48 h, centrifuged and the supernatants were used for the estimations of total phenols. Total phenolic contents were determined by folin-ciocalteu method with sodium carbonate solutions following McDonald et al. (2001). The absorbance was measured at 765 nm using chlorogenic acid as the standard.

74  |  Bamboo Shoots: A Potential Source of Nutraceuticals

Analysis of Total Flavonoids The dried powdered bamboo shoot samples were extracted in 10 ml of methanol by intermittent maceration up to 48 h, centrifuged and the supernatants were used for the estimation of flavonoids. Flavonoids content were determined by Aluminium chloride method following Chang et al. (2002). The calibration curved was prepared by different concentrations of Quercetin in methanol. The absorbance was measured at 415 nm in a spectrophotometer. Analysis of Tannin Tannin contents were determined by Folin-Denis method (Sadasivam and Manickam, 1992) which is based on the non-stoichiometric oxidation of the molecules containing a phenol hydroxyl group. Tannin like compounds reduced phosphotungstomolybdic acid in alkaline sodium carbonate solutions to produce highly blue coloured solutions. The intensity of which is proportional to the amount of tannin. The absorbance was measured at 700 nm using tannic acid as the standard compound. Table 3: Comparison of the anti-oxidant properties in fresh edible bamboo shoots and fermented bamboo shoot slices Sample

% of inhibition of DPPH (µg/ml ) 10µg ml-1

20µg ml-1

30µg ml-1

50µg ml-1

IC50

Fresh bamboo shoot slices

22.85±1.36

40.37±0.69

66.70±0.85

79.70±0.64

2.10±0.05

Laboratory fermented bamboo shoot slices

17.57±1.27

33.82±1.18

40.49±3.04

77.50±0.64

3.33±0.01

Traditionally fermented shoot samples

22.99±1.50

37.84±1.16

52.56±1.13

68.03±0.99

5.30±0.24

Quercetin (standard sample)

27.16±1.27

45.09±0.27

77.02±1.43

86.022±1.2

8.56±0.07

* Data presented as mean ± SD. Table 4: Composition of terpenoids in the bamboo shoots of Bambusa balcooa detected using (GC-MS) head space technology Components

RT

MW

Formula

M/Z

Ar-turmerone

27.816

216

C15H20O

83

β-pinene

8.675

204

C15H24

93

Di-epi-alpha-cedrene

34.579

204

C15H24

119

Fenretinide

51.346

391

C26H33NO2

109

b-Guaiene

10.618

204

C15H24

161

g-Himachalene

35.460

204

C15H24

119

Noscapine

31.487

413

C22H23NO7

220

Longifolene-12

27.235

204

C15H24

94

Kananbala Sarangthem  | 75 β-phellandrene

34.379

136

C10H16

93

Ergost-8(14)-en-3-ol

35.773

400

C28H48O

43

Phenanthrene,2-nitro

24.693

223

C14H9NO2

223

DPPH (2,2-Diphenyl-1 Picrylhydrazyl) Radical Scavenging Activities Preparation of the extracts- 10g of the powdered samples were extracted in a Soxhlet apparatus with 100 mL of ethanol (60ºC for 12 h). The samples were filtered through Whatman No.1 paper in Buchner funnel, the filtrate was freeze dried and weighed. 2, 2-Diphenyl-1-picrylhydrazyl (DPPH) and quercetin were obtained from Hi Media. The method used by Fogliano et al. (1999) was adopted. The absorbance of the colour developed was measured at 517 nm by a spectrophotometer. Data were processed using excel and the concentrations that caused 50% reduction in absorbance (RC50) were calculated. Percent inhibition of DPPH was calculated by following equation (Lee et al., 1998) % Inhibition = 1 – (A1/A2) × 100 Where, A1 is the absorbance of the test samples and A2 the absorbance of control reaction. Analysis for Cyanogenic Glycoside Cyanogenic glycosides estimation was done using the technique of Picrate impregnated paper according to Bradbury et al., 1999. The liberation of HCN is indicated by the colour change of picrate paper from yellow to reddish or red brown colour in proportion to the amount of HCN released. Absorbance was measured at 510nm and the total cyanide content was determined by preparing standard curved from potassium cyanide. Analysis of Terpenoids by Gas Chromatography-Ion Trap Mass Spectrometry Analysis of terpenoids is done by following the method of Anthony and Michael (2003). The fresh bamboo shoot of bambusabalcooa was washed repeatedly with water and cleaned again with deionized water and immediately placed directly into 4ml screw top vials and capped with silicone septa. The sample vials were placed in a water jacketed beaker maintained at 50°C for 1 hr to allow the volatiles to equilibrate in the headspace. Following the equilibration period, the sample vial remained in the water jacketed beaker while the SPME fiber was expose to the headspace for 15minutes under static conditions. The injector 1079 was fitted to it .The injector temperature maintained at 220°C and a 20:1 split ratio was used for all samples. The SPME was inserted into the injection port for 2minutes for sample desorption. Separation was accomplished using Varian (30m, id 250 limit 350 factor 4). Column temperature 60°C (0 min hold) to 240°C(0 min hold) at 3°C/min. The flow rate 1.0ml/min. The Varian ion trap mass spectrometer was operated in EI+ mode m/z ranged (50-500). Analysis of Total Phytosterol The delicate bamboo shoot apex was sliced and oven dried at 60oC± 2oC for 12h. The

76  |  Bamboo Shoots: A Potential Source of Nutraceuticals

dried samples of the delicate shoot apex were then crushed to powder form. The powder was used for determination of total phytosterols using Liebermann-Burchard reaction (Katayama et al. 1974). Extraction of Phytosterols To purify phytosterols, the dry fermented samples were taken and extracted in a 1litre clevenzer apparatus using benzene, petroleum ether and 2N ethanolic KOH(10:5:1) as the refluxing solvent (Sarangthem and Srivastava,1997). After selective solubilization of the crude phytosterols with acetonitrile, the crude phytosterols were then subjected to TLC (Stahl, 1969). Analysis of Phytosterols TLC was performed on silica gel-G plates (0.25mm thick, 20x20 cm) using solvent pairs hexane: ethyl acetate (3:1). Detecting reagent were acetic anhydride and sulphuric acid (30:1). For obtaining crystallized form of the phytosterols isolated from fermented shoot samples, preparative TLC was conducted. The phytosterols (tentatively identified as βsitosterol, stigmasterol,and campesterols) resolved on TLC and confirmed with standard samples were scraped and eluted in chloroform for analysis. The UV spectral analysis for the crystals obtained after preparative TLC (Stahl 1969) as well as control authentic samples (Sigma Chemicals, USA) were measured from 225 to 400 nm on a Beckmann DU-64-spectrophotometer. HPLC Method The fractions obtained after preparative TLC were further purified by refluxing with acetonitrile and the precipitate so obtained along with β- sitosterol, Stigmasterol& campesterols (Sigma Chemicals) were analysed by High performance liquid chromatography(HPLC). Methanol /water/acetic acid (750:240:10) was as the mobile phase; flow rate 1ml/min run time 20min,column temperature 300c , Injection temperature 280°C, inj. 30μl.column used –Zorbax SB-C18 Further analysis of IR, NMR and Mass spectral analysis were done at CDRI, Lucknow for confirmation of the compound in comparison with control authentic samples (Sigma Chemicals, USA).

Results and Discussion The results in Table 1 shows that fresh bamboo shoot slices mixture each of Bambusa tulda, B. balcooa, Dendrocalamus hamiltonii, D. Hookeri Pseudostachyum polymorphum, Schizostachyum dulloa and Thyrsostachys oliveri shows 79.47 per cent of water content; 6.08 pH value 5.76 mg/100g fr.wt. of ascorbic acid; 205.77 mg/100g fr.wt. of total amino acid; 2.50% dry wt. of crude protein;462.28 mg/100g fr.wt. of buffer soluble protein and 734.50 mg/100g fr.wt. of total carbohydrate (Table 1). Similar findings were also reported by

Kananbala Sarangthem  | 77

many workers (Kitagawa, 1971; Mizumoto et al., 1975; Yamaguchi and Kusama, 1976; Kozukue et al., 1982 and Yamaguchi, 1983). Laboratory fermented sample shows 68.92 per cent of water content; 4.18 pH value 2.17 mg/100g fr.wt. of ascorbic acid; 261.03 mg/100g fr.wt. of total amino acid ;2.76 %dry wt. of crude protein; 321.49 mg/100g fr.wt. of buffer soluble protein and 385.84 mg/100g fr.wt. of total carbohydrate (Table 1). The traditionally fermented bamboo shoot slices shows 73.36 per cent of water content; 4.41 pH value 2.00 mg/100g fr.wt. of ascorbic acid; 223.69 mg/100g fr.wt. of total amino acid ;2.69 % dry wt. of crude protein; 298.47 mg/100g fr.wt. of buffer soluble protein and 262.97 mg/100g fr.wt. of total carbohydrate (Table 1) Bamboo shoots contain the bioactive component of 97.73 mg/g fr.wt. of total phenols and 5.11 mg/g fr.wt of flavonoids and 31.49 mg/g fr.wt of tannin (Table 2). The phenolic and flavonoids compounds have been reported to exert multiple biological effects including antioxidant, free radical scavenging, anti-inflammatory, anticarcinogenic and antiviral activities (Miller, 1996 ;Oboh 2008) Several studies indicated that the antioxidant activities of some plants are highly correlated with their phenolic contents (Palav et al. 2006; Oboh 2008; Gupta et al. 2010). Therefore, the bamboo shoots can also be used for formation of natural anti- oxidants. Pandey et al. (2011) also reported that phenolic acids have a correlation with antioxidant properties. Table 5: Phytosterols content in fresh bamboo shoots ,traditionally fermented bamboo shoots (soibum) and scientifically modified laboratory fermented samples. Name of the sample

Concentration of total phytosterol (% dry wt.)

1.Fresh bamboo shoot samples

0.15±0.08

2.Traditionally fermented bamboo shoot samples

0.65±0.21

3. Scientifically modified laboratory fermented shoot samples

0.33.±0.04

Data presented as mean ± SD.

Fig. 1. Changes in the cyanogenic glycosides (HCN) content during fermentation of the bamboo shoot slices of Bambusa balcooa. Laboratory fermentation and traditional fermentation.

78  |  Bamboo Shoots: A Potential Source of Nutraceuticals

Fig. 2. Analysis of terpenoids from the bamboo shoots by Gas Chromatography-Ion Trap

Fig. 3. Chromatograms of phytosterols by HPLC

DPPH radical is scavenged by antioxidants through the donation of a hydrogen atom, forming the reduced DPPH. The colour changes from purple to yellow colour after reduction and this is quantified by its decrease in absorbance at 517nm. In the present study all the methanolic extracts of the fresh and fermented samples exhibited antioxidant activity in dose-dependent manner. The percentage of inhibition and IC50 are given in

Kananbala Sarangthem  | 79

table no.4. Highest radical scavenging activity as % of DPPH inhibition is 79.70% at 50µg/ml with fresh bamboo shoot slices (Table 3). Antioxidant of bamboo leaves (AOB), an extract from Phyllostachys pubescens, has been reported to exhibit multiple biological activities, such as scavenging oxygen radicals and anticancer, antibacterial, and antiviral activitiy, and is especially known for its antioxidant activity(Park and Jhon,2010; Saki and Maeda,2010). Several studies indicated that the antioxidant activities of some plants are highly correlated with their phenolic contents (Palav et al., 2006; Oboh 2008; Gupta et al. 2010). Pandey et al. (2011) also reported that phenolic acids. have a correlation with antioxidant properties. Changes in the cyanogenic content during fermentation of the bamboo shoot slices were conducted. The weekly analysis on the hydrogen cyanide content assessed in the laboratory fermentation (90 days) with the bamboo shoot slices of Bambusa balcooa shows a decreasing trend of hydrogen cyanide level (Fig.1). In all fermentation it shows a degradation of HCN content with the advance of fermentation. Since HCN are highly volatile, the loss of HCN during the fermentation processes like peeling, slicing, cutting, repeated washing (3-4 times) is quite rapid. This may explain the reason that though bamboo shoots may contain significantly higher levels of HCN, however, the HCN content is reduced substantially to non toxic level for safe consumption. Head space GC-MS analysis of terpenoids in the fresh bamboo shoots of Bambusa balcooa showed the presence of nine peaks eluted at retention time starting from 24.69 minutes to 51.34 minute. The compounds in the descending order of the peaks are arturmerone, β-pinene, di-epi-α-cedrene, fenretinide β-guaine, γ- himachalene,noscapine, longifolene-12, β- phellandrene, ergost-8 (14)-ene-3-ol,Phenanthrene, 2-nitro.as shown in table 4 and figure 2. Many researchers have also reported that terpenoids have many physiological functions such as anti-sepsis, antivirus, anti-tumor, anti-fatigue, antihyperlipidemia, antihypertension, anti- hyperglycemia, etc (Yao, 2001; Yao et al.,2004). The level of total phytosterols in the succulent shoot samples of different species of bamboo ranges from 0.15 per cent dry wt. in fresh shoot slices The level of phytosterols increases to four times or more in fermented bamboo slices. Fermentation increases the accumulation of certain by-products as a result of breaking down of the raw organic molecules (polymers) by the activity of microorganisms. The crude phytosterols extracted from the bamboo shoot slices when subjected to selective solubilization yielded different amount of phytosterols in various fractions (Fig.3), which on further analysis by Cochromatography with TLC, HPLC with standard samples revealed that the fractions were β–sitosterol, stigmasterol and campesterol (Fig.3). This was further identified by analysis of its melting point, molecular wt. and mass spectral analysis at CDRI, Lucknow. The UV and IR spectral data of the compound showed similarity with those obtained with the authentic samples of β–sitosterol, stigmasterol and campesterol (Sigma Chemicals,USA). Park and Jhon have pointed out that bamboo shoots could reduce the serum total cholesterol, low-density lipoprotein cholesterol (Park and Jhon, 2009; 2010). Phytosterols have received particular attention due to their capability to lower serum cholesterol levels in humans, resulting in significant reduction of the risk of cardiovascular diseases (Plat &

80  |  Bamboo Shoots: A Potential Source of Nutraceuticals

Mensink, 2001). Furthermore, they were also regarded as a kind of natural product with anti-inflammatory (Bouic, 2002), anti-bacterial (Ovesna et al., 2004), and anti-carcinogenic properties (Raicht et al.,1980;Awad et al., 2000). The present study concludes that bamboo shoots both fresh and fermented form can be of good nutraceutical source as they contain good amount of carbohydrates, proteins, vitamin and other nutritive food value . They are low in calories and cyanogens content and have significant amount of phenolics, flavanoids, anti-oxidant properties. Several studies indicated that the antioxidant activities of some plants are highly correlated with their phenolic contents and have a correlation with antioxidant properties. Therefore, the bamboo shoots can also be used for formation of natural antioxidants. Bamboo shoots have high terpenoid and phytosterol contents , hence bamboo shoots are regarded as potential sources of terpenoid and sterols . Phytosterols have received particular attention due to their capability to lower serum cholesterol levels in humans, resulting in significant reduction of the risk of cardiovascular diseases. Furthermore, they were also regarded as a kind of natural product with many health benefits such as anti-inflammatory ,antibacterial and anti-carcinogenic properties etc. Bamboo shoots were a kind of phytosterolrich health food and the representative compounds found in bamboo shoots were β-sitosterol, campesterol, stigma sterol as the major sterol. According to these and above findings bamboo shoots can be portrayed as a rich potential source of nutaceuticals which will be of interest to the food and pharmaceutical industries.

Acknowledgments The Author is thankful to the University Grant Commission (UGC), New Delhi (F.No.41431/2012 (SR) and Dept. of Biotechnology, Govt. of India ( DBT) (.BT/475/NE/TBP/2013), for providing financial support to carry out the research work.

REFERENCES Ajikumar P, Tyo K, Carlsen S, Mucha O, Phon T and Stephanopoulos G (2008) Terpenoids: opportunities for biosynthesis of natural product drugs using engineered microorganisms. Mol Pharm 5:167–190 Anthony F Lagalante and Michael E Montgomery (2003) Analysis of terpenoids from hemlock (TSuga) species by solid-phase microextraction gas chromatography iontrap mass spectrophotometry J. Agric., Food Chem 51(8): 2115-2120 Awad A B, Downie D and Fink C S (2000) Inhibition of growth and stimulation of apoptosis by b-sitosterol treatment of MDA-MB-231 human breast cancer cells in culture. International Journal of Molecular Medicine 5: 541–545 Bouic P J (2002) Sterols and sterolins: New drugs for the immune system? Drug Discovery Today 7(14): 775–778

Kananbala Sarangthem  | 81

Bradbury M G, Egan S V, Bradbury J H (1999) Determination of all forms of cyanogens in cassava roots and cassava products using picrate paper kits. J of the Sci of Food and Agric 79: 593-601 Chang C, Yang M, Wen H, Chern J (2002) Estimations of total flavonoid content in propolisby two complementary colorimetric methods.J. Food Drug, Anal 10: 178-182 Fu MY, Ma NX, Qui FG (1987) Bamboo production and scientific research in Thailand. Chinese Journal of Bamboo Research 6(1): 54−61 Fuchigami M (1990) Differences between bamboo shoots and vegetables in thermal disintegration of tissues and polysaccharides fractionated by successive extraction. J Food Sci 55:739–45 Gil-Chavez GJ, Villa JA, Ayala-Zavala JF, Heredia JB, Sepulveda D, Yahia EM et al., (2013) Technologies for extraction and production of bioactive compounds to be used as nutraceuticals and food ingredients: an overview. Compr Rev Food Sci Food Saf 12:5–23 Gupta VK, Kumria R, Garg M, Gupta, M. (2010) Recent updates on free radicals scavenging flavonoids: An overview. Asian J Plant Sci 9: 108−117. Haque MR, Bradbury JH. (2002) Total cyanide determination of plants and foods using the picrate and acid hydrolysis methods. Food Chemistry 77:107−114. Hedge JE, Hofreiter BT ( 1962) Carbohydrate Chemistry. New York: Academic Press, p. 17. Hunter I, Yang F (2002) Cyanide in Bamboo shoots. International Network for Bamboo and Rattan (INBAR) ; p.7. ISTA (1996) International Rules for Seed Testing. Proc.“Int. Seed Testing Association” 31: 1-152. Katayama M., Holl C.T., Chen NC., Hirota, T , Kiribuchi, J. and Sumahashi, S (1974) A method for fractional determination of soybean in four class by florisil column chromatography. Agri. Biol. Chem 38: 1661. Kitagawa Y (1971). Distribution of Vitamin C in some stark vegetables. Eiyo to Shokuryo. 24:449-451. Kozukue N, Kozukue E, Terai H .Mizuno S ( 1982) HPLC analyses of amino acids in plant materials as DNP-derivatives by use of methyl benzoate as the internal standard. J. Food Sci. 47:1584-1586. Ke-jun C, Jing C, Gao-lin L, Yao H, Hui-fen L, Wei S.-m, Jun Y, Hu CQ (2005) Taxiphyllin: A Cyanogenic Glucoside with Tyrosinase Inhibitory Activity from the Shoots of Pleioblastus amarus. Natural Product Research and Development. 17: 733-772. Lee, S. K., Mbwambo, Z. H., Chung, H. S., Luyengi, L., Games, E. J. C. and Mehta, R. G. 1998. Evaluation of the antioxidant potential of natural products. Combinatorial Chemistry and High Throughout Screening. 1: 35-46.

82  |  Bamboo Shoots: A Potential Source of Nutraceuticals

Lowry OH, Rosebrough NJ, Farr AL, Randall RJ (1951). Protein measurement with folin phenol reagent. Journal of Biological Chemistry, 193: 265. Maher, J.H.2003. Physiological Functions of Phytonutrients. http://www.naturalhealthweb.com/articles/maher6.html McDonald S, Prenzler PD, Autolovich M, Robards K ( 2001) Phenolic content and antioxidant activity of olive extracts. Food Chemistry 73: 73−84. Midmore D(1998) Culinary bamboo shoots. In:The New Rural Industries. Hyde,KW, editor. Rural Industries Research and Development Corporation..p.188-196. Miller AL (1996) Antioxidant flavonoids: Structure, function and clinical usage. Alt. Med. Rev.1: 103-111. Mizumoto K, Haseba A, Minamiso H, Mari S , Azuma K (1975) Composition of bamboo shoots from Kogoshima Prefecture, Kagoshima-ken Kogyo Shikenjo Nempo.22: 68-71. Nahrstedt AF ( 1993). Proceedings of the International Symposium on Phytochemistry and Agriculture Wageningen. Oxford: Oxford University Press, pp. 107−129 Nirmala C, Sharma ML, David E (2008) A comparative study of nutrient components of freshly harvested, fermented and canned bamboo shoots of Dendrocalamus giganteus Munro, bamboo science and culture. Journal of American Bamboo Society 21(1): 41−47. Oboh G ( 2008) Antioxidative potential of Ocimum gratissimum and Ocimum canum leaf polyphenols and protective effects on some pro-oxidants induced lipid peroxidation in rat brain: An in vitro study. American Journal of Food Technology, 3: 325−334. Ogunwusi A A ( 2011) Potentials of bamboo in Nigeria‟sIndustrialSector. Journal of Research in Industrial Development, 9(2):136-146. Ostlund R.E, Racette SB,; Stenson WF (2003) Inhibition of Cholesterol Absorption by Phytosterol-Replete Wheat Germ Compared With Phytosterol-Depleted Wheat Germ.Am. J. Clin. Nutr., 77 (6):1385–1589. Ovesna Z, Vachalkov A and Horvathova K( 2004) Taraxasterol and b-sitosterol: New naturally naturally compounds with chemoprotective/chemopreventive effects. Neoplasma 51(6): 407–414. Palav YK, Dmello PM.( 2006) Standardization of selected Indian medicinal herbal raw materials containing polyphenols as major phytoconstituents. Indian Journal of Pharmaceutial Sciences, 68: 506−509. Pandey AK, Ojha V (2011) Precooking processing of bamboo shoots for removal of antinutrients. Journal of Food Science and Technology, DOI: 10.1007/s13197-0110463-4. Pandey A K, Ojha V (2013) Standardization of harvesting age of bamboo shoots with respect to nutritional and anti-nutritional components. Journal of Forestry Research. 24: 83-90.

Kananbala Sarangthem  | 83

Park E, Jhon D (2009) Effects of bamboo shoot consumption on lipid profiles and bowel function in healthy young women. Nutrition, 25(7−8): 723−728 Park E J., Jhon D Y (2010) The antioxidant, angiotensin converting enzyme inhibition activity, and phenolic compounds of bamboo shoot extracts. LWT−Food Sci. Technol. 43 (4): 655−659. Patel MD and Thompson PD (2006). Phytosterols and Vascular Disease. Atherosclerosis 186 (1):12–19. Plat J., and Mensink R P ( 2001.) Effects of plant sterols and stanols on lipid metabolism and cardiovascular risk. Nutrition, Metabolism, and Cardiovascular Diseases, 11: 31–40. Raghu V, Patel K, Srinivasan K ( 2007) Comparison of ascorbic acid content of Emblica officinalis fruits determined by different analytical methods. Journal of Food Composition and Analysis, 20(6): 529−533. Sadasivam S, Manickam A. In: Biochemical methods for agricultural Sciences. New Delhi:Wiley Eastern Limited;. P. 11-12. Sarangthem K and Srivastava RC (1997). Enrichment of phytosterols level in fermenting sample of succulent shoots of Dendrocalamus species grown in Manipur. Nat. Acad. Sci. letters 20(5&6): 64-67 Sarangthem K, Singh TN. 2003. Microbial bioconversion of metabolites from fermented succulent bamboo shoots into phytosterols. Current Science. 84(12): 1544−1547. Sarangthem K and Hoikhokim (2010) Cyanogen content in bamboo plants Bio. Sci., 5 (2):178-180 Schuler I, Milon A, Nakatani Y, Ourisson G, Albrecht A, Benveniste ( 1991) Differential effects of plant sterols on water permeability and on acyl chain ordering of soybean phospatidyl choline bilayers. Proc Natl Acad Sci USA 88:6926–6930 Schwarzmaier U (1977) Cyanogenesis of Dendrocalamus: Taxiphyllin. Phytochemistry. 16: 1599-1600 Seki T, Maeda H ( 2010) Cancer preventive effect of Kumaizasa bamboo leaf extracts administered prior to carcinogenesis or cancer inoculation. Anticancer Res 30(1): 111−118 Stahl E (1965) Thin layer Chromatography. New York:Academic Press. Tai KY (1985) .The management and utilization of shoot producing bamboos in Taiwan, J Chinese forestry 18 (2): 1-46 Weingärtner O. et al. (2009) Controversial Role of Plant Sterol Esters in the Management of Hypercholesterolaemia. European Heart Journal ; 30: 404–409 Yang Q, Duan Z, Wang Z, He K, Sun Q, Peng Z ( 2008) Bamboo resources, utilization and ex-situ conservation in Xishuangbanna, South-eastern China.Journal of Forest Resource 19(1): 79−83

84  |  Bamboo Shoots: A Potential Source of Nutraceuticals

Yamaguchi M, Kusama M (1976) The nutritive compounds of several dried bamboo shoots.Yokyo Kasai, Kentyu. 16(59-61) Yamaguchi M (1983) World vegetables: Principles, production and nutritive value. Van Nostrandreinhold Company Publishers Yao XS (2001) Natural Drug Chemistry. 3rd ed. People’s Medical Publishing House. Beijing, China. Yao XB, Wu XQ, Zhang Y (2004) Quantitative analysis of triterpenoid friedelin in bamboo bark (zhuru) by GC. Chin. J. Pharm. Anal. 24(4): 387-390 Yemm EW, Cocking EC (1995 ) The determination of amino acids with ninhydrin.Analyst. 80:209-213 Yamaguchi I and Kusama M (1976) The nutritive compounds of several dried bamboo shoots. Tokyo Kasai Daigaku Kenkyu Kiyo.16: 59-61. Yamaguchi M (1983) World Vegetables. Avi. Publishing Comp. Inc.Westport Connecticut.

mmm

Trends in Frontal Areas of Plant Science Research Edited by: S. Sinha, R.K. Sinha © Department of Botany, Tripura University, 2017

A Population Genetics Perspective in Plant Pathology: A Case Study of the 2014 Late Blight Pandemic in West Bengal Sanjoy Guha Roy Department of Botany, West Bengal State University, Barasat, Kolkata-700126, India Corresponding author: [email protected]

The objective of any plant pathologist is to control the disease outbreaks that occur and thereby reduce yield losses. It is sobering to know that if diseases could be controlled in at least six of the major crop species (Rice, Wheat, Maize, Potato & Soybean), it could feed an astounding 8.5% - 61.2% of the world’s population annually, based on the 2011 population estimate of 7 billion people (Fischer, 2012). However, it is amply clear that despite our technological advances we are waging a losing battle with these pathogens who are our competitors and enemies (Strange & Scott, 2005). Even though there are efforts to reduce fungicide usage through better management and sanitary practices as well as alternatives in the form of biocontrol agents to fungicides, we are still largely dependent on fungicides for growth of our crops, so much so the total reported sale of fungicides was $ 15,674 million for a single year in 2015 (Leadbeater, 2015)! In fact “without the use of fungicides commercial potato production in Ireland would be impossible” (Cooke 1992). A testimony to this fact is that that worldwide costs for chemical management of Phytophthora diseases alone represent over 25% of the annual fungicide market! Though the same is true in developing countries like India, effective use of fungicides however is in question. Unambiguous identification of causal organism of the disease, correct fungicide selection, dosage and time of application are hindered by lack of proper dissemination of knowledge to the farmers who often depend on shopkeepers who sell these fungicides, with little or no knowledge for prescribed dosages and selection of fungicide. However, attempts are now being made to rectify these lacunae and reach the farmers and probably with time these will be addressed. But linked to fungicide usage is another very basic issue on which the crux of success of control measures depend, but has till date been ignored- that of formulating fungicide recommendations for any single pathogen taking into account the clonal, regional spatiotemporal variations as elucidated below.

86  |  A Population Genetics Perspective in Plant Pathology: A Case Study of the 2014...

While population genetics and genetic variation in plant pathogens are subjects that have generated much interest since the late 1980s and recently almost every recent issue of major plant pathological and mycological journals has at least one article on genetic variation of a plant pathogen species. But, the idea that population biology is relevant to plant pathology because plant diseases are caused by populations of parasites is yet to be addressed and included in disease management programs in India (viz. Late Blight on potato and tomato). Hence the whole premise on which current control objectives are based are not successful and we get epidemics of late blight almost every alternate year which wipe out almost entire produces bringing about social and political upheaval. One pathogen lesion on one leaf does not have a significant economic or ecological impact. An epidemic that causes significant crop loss involves thousands or millions of infection events involving an entire population of parasites and their host plants. To control the disease, a plant pathologist must develop methods to control the entire pathogen population. Thus it is important to understand the population biology of plant pathogens in order to develop rational control strategies. Once this is included, it will bring about a paradigm change in the way in which plant pathogens are managed in India. Understandably, implementation of effective control strategies requires more knowledge about the genetic structure of population of plant pathogens (Wolfe and Caten, 1987), as control strategies must target a population instead of an individual if they are to be effective. Defining the genetic structure of a population is a logical first step in studies of fungal/oomycete population genetics because the genetic structure of a population reflects its evolutionary history and its potential to evolve: aspects important for formulating disease management strategies. ‘Genetic structure’ refers to the amount and distribution of genetic variation within and among populations (McDonald, 1997). Whether population genetics becomes an integral discipline within plant pathology depends, in part, on whether it can be integrated with epidemiology and disease management. Evolutionary biology and population genetics have the potential to deliver much basic information about plant pathogens. Population genetics is a field concerned with determining the extent and pattern of genetic variation in populations with the goal of understanding the evolutionary processes affecting the origin and maintenance of genetic variation. The conceptual framework is based on evolutionary biology and on the processes affecting the genetic composition of populations: selection, mutation, gene flow, genetic drift, and mating systems. The advances in technology also brought about a marked change in emphasis in population genetics of plant pathogens. Accurate population definition is essential so that sampling is done in a manner which will enable inferences to be made about the population of interest. From an operational perspective, recognition of population structure is very important when estimating population genetic parameters. In fungi that undergo both asexual and sexual reproduction, it is necessary to differentiate between diversity at individual locus, ‘gene diversity’ and diversity based on the number of genetically distinct individuals in a population, ‘genotype diversity’. Taken together, gene and genotype diversity constitute genetic diversity (McDonald,

Sanjoy Guha Roy  | 87

1997). It is however, important to distinguish between studies of population diversity and population genetics; the former yield the raw data, to which the latter can be applied to answer questions on the fundamental mechanisms and process of genetic change in populations (Cooke and Lees, 2004). Detection of diversity is usually done through use of phenotypic and genotypic markers that are selectively neutral, highly informative, reproducible and relatively easy and inexpensive to assay. It is clear however, that no single marker system would be adequate for all aspects of research on diversity of Phytophthora species (Milbourne et al., 1997). The choice of genetic marker can have a substantial impact on the analysis and interpretation of data. As Phytophthora reproduce mainly asexually, producing a population structure that is largely composed of clonal lineages, a neutral marker such as a DNA fingerprint may be used to address both questions relating to roles played by population size, mating systems and gene flow, and also for questions relating to effects of selections, for which usually selective markers are used; assuming there is complete correspondence between genotype (DNA fingerprint) and phenotype (for e.g. pathotype) (McDonald, 1997). However, such assumption may not be valid as variable pathotypes can arise within the same clonal lineages (Abu-El Samen et al., 2003). Though it is best to use a widest practical array of genetic markers, combining a mixture of selected and neutral unlinked markers encompassing the nuclear (and mitochondrial) genome(s) distributed across many chromosomes; the number of marker loci assayed varies with the objective and resources available to the investigator. In the last two decades, there is now considerable resources available for the late blight of Potato & Tomato causal organism Phytophthora infestans. An array of well standardized phenotypic markers like mating type assays, virulence assays, germination temperature and fungicide sensitivity along with genotypic markers like RG57 (A moderately repetitive multi-locus RFLP probe DNA probe that has been used routinely for DNA fingerprinting of P. infestans which hybridizes to more than 25 nonallelic polymorphic fragments of EcoRI-digested P. infestans DNA), mitochondrial haplotypes, multiplexed SSRs, effector repertoires as well as whole genome assemblies are available. Worldwide flux in populations of Phytophthora infestans (Fry, 2016) necessitates screening and reassessment of the genetic diversity of the populations using the above mentioned tools for effective control. It is in the above context, our laboratory recently started looking at the diversity of P. infestans populations on Tomato and Potato in eastern India. This first such snapshot of the region also includes the populations that caused the 2014 late blight pandemic in Bengal which led to farmers’ suicides, rise in prices and stopping of export of potatoes to neighboring states, all of which had wide political and societal implications. As of date this characterization of East Indian populations is a work in progress. A part of which has been presented before at the International Symposium on “Phytophthora: Taxonomy, Genomics, Pathogenicity, Resistance and Disease Management” organised by ICAR-Central Plantation Crops Research Institute, Kasaragod in association with IIHR and AAPMHE at ICARIndian Institute of Horticultural Research Bengaluru during 9-12, September, 2015. The P.infestans population in this region was found to be mostly metalaxyl resistant and a few

88  |  A Population Genetics Perspective in Plant Pathology: A Case Study of the 2014...

intermediate in resistance but with one tomato isolate from Assam showing sensitivity to this fungicide and all the isolates were of A2 mating type. Worldwide, the population of P.infestans is rapidly changing to metalaxyl resistant and A2 mating type and this mirrors the trend elsewhere. Mitochondrial haplotypes were found to be all of Ia type, the type similar to that witnessed in South India recently (Chowdappa et.al., 2015) but different from those found earlier in northern India (Chimote et al., 2010). RG57 analysis showed the lineage to be similar to A2_blue_13 lineage found in Europe but with minor differences. SSR analysis of 12 co-dominant loci revealed 40 multilocus genotypes (MLGs), indicating that the population was highly diverse and unique to this region reaffirming the premise mentioned at the start of this article the reason why current policies of recommending uniform control measures across all regions without taking into account clonal lineage variations were failing as evidenced by complete yield loss in blight years. Variations were also seen in the fungicide sensitivities tested for the common fungicides used against P.infestans, viz. Azoxystrobin (Amister©), Dimethomorph (Acrobat©), Mancozeb/Maneb (Indofil M-45©), Fosetyl-Al (Allite©) and Cymoxanil + Mancozeb (Curzate M8©). Regional variations were evident in their EC50 values indicating varying history of fungicide usage which as mentioned before was often random. Association of clonal lineages (MLGs) with geographical regions and fungicide sensitivity proved productive as the first step towards region specific fungicide recommendations based on existing clonal lineage could now be formulated as regional differences could be discerned. However, further association of MLGs with other phenotypic and genotypic parameters and effector repertoire of P.infestans particularly with AVR3A is in progress and once the analysis is completed, it would provide valuable inputs for formulating control measures for late blight on potato and tomato in this eastern Indian region.

REFERENCES Abu-El Samen, F. M., Secor, G. A., and Gudmestad, N. C. (2003). Variability in virulence among asexual progenies of Phytophthora infestans. Phytopathology, 93: 293-304. Chimote VP, Kumar M, Sharma PK, Singh PH and Singh BP (2010) Characterization of changes in phenotype and genotype of Phytophthora infestans isolates from India. Journal of Plant Pathology, 92 (3): 669-77. Chowdappa P, Nirmal Kumar BJ, Madhura S, Mohan Kumar SP, Myers KL, Fry WE and Cooke DL (2015) Severe outbreaks of late blight on potato and tomato in south India caused by recent changes in the Phytophthora infestans population. Plant Pathology, 64: 191-199. Cooke LR (1992) Potato blight control in Ireland: a challenging problem. Pesticide Outlook, 13(4): 28-31. Cooke, D. E. L. and Lees, A. K. (2004), Markers, old and new, for examining Phytophthora Infestans diversity. Plant Pathology, 53: 692–704.

Sanjoy Guha Roy  | 89

Fisher MC, Henk DA, Briggs CJ, Brownstein JS, Madoff LC, McCraw SL, Gurr SJ. (2012). Emerging fungal threats to animal, plant and ecosystem health. Nature. 11-484 (7393):186-94. Fry WE (2016) Phytophthora infestans: New tools (and Old Ones) Lead to New Understanding and Precision Management. Annual Review of Phytopathology, Vol. 54 (In Press) Leadbeater A. (2015): Recent developments and challenges in chemical disease control. Plant Protect. Science, 51: 163–169 McDonald, B.A. (1997). The population genetics of fungi: Tools and techniques. Phytopathology. 87: 448-453. Milbourne, D., Meyer, R., Bradshaw, J.E., Baird, E., Bonar, N., Provan, J., Powell, W., and Waugh, R. (1997). Comparison of PCR based marker systems for the analysis of genetic relationships in cultivated potato. Molecular Breeding. 3: 127–36. Strange RN and Scott PR (2005) Plant Disease: A Threat to Global Food Security. Annual Review of Phytopathology, 43: 83 -116. Wolfe, M.S., and Caten, C.E. (1987). Populations of Plant Pathogens: Their Dynamics and Genetics. (Eds), Blackwell Scientific Publications, Oxford. UK.

mmm

Trends in Frontal Areas of Plant Science Research Edited by: S. Sinha, R.K. Sinha © Department of Botany, Tripura University, 2017

Orchid Germplasm: Its Conservation and Propagation Strategies Through In Vitro Approach Nirmalya Banerjee* and Tustu Mondal Cytogenetics and Plant Biotechnology Laboratory, Department of Botany, Visva-Bharati, Santiniketan West Bengal, India. Corresponding author: [email protected]

Orchidaceae is one of the largest families of flowering plants known for their distinction of flowers and undeniable charm. The immense floral variations found in more than 25,000 species and 1, 20,000 registered hybrids, along with their long shelf lives, make orchids one of the most important floriculture crops. This ancient group of plants originated probably 125 million years ago at the time of break-up of Gondwana land. Most fascinating fact is that 1229 species from 184 genera of orchids were reported from India (Singh & Chauhan, 1999). The major orchid rich phyto-geographical regions of India are Peninsular India, Northeastern India, the Eastern and the Western Himalayas. The most represented genera of orchids are Dendrobium (183 species), Bulbophyllum (62 species), Eria (53 species), Coelogyne (43 species), Vanda (31 species), Habenaria (30 species), Haemaria (20 species), Liparis (20 species) and Paphiopedilum (19 species) (Dressler, 1993). The use of orchids in indigenous medicinal system of India has a very long history. The medicinal value of orchids is found recorded over 3000 years in Ayurveda as major source of important therapeutics. A wide range of chemical compounds are presented including dendrobine, nobiline, erianin etc. (used as antioxidant, antiangiogenic and antitumour agent) which have been isolated from different orchid species. Extracts and metabolites of these plants, particularly those from flowers and leaves, possess useful pharmacological properties like anti-rheumatic, anti-inflammatory, anti-carcinogenic, hypoglycemic, antimicrobial, anticonvulsive and antiviral activities.

Orchid Conservation Today, like many other angiospermic plants, survival of orchid plants in the wild is in question. But the current increase in temperature and variable weather patterns have occurred over an extremely short period of time where evolutionary processes are not able to match. Therefore, many valuable orchid species have not been able to adapt

92  |  Orchid Germplasm: Its Conservation and Propagation Strategies Through In Vitro Approach

to changing temperature and weather. Orchid species were influenced by adverse environmental conditions like insufficient water supply, diseases, lack of nutrients or photoperiodic disturbance. Human encroachments in the wild with concurrent habitat destruction accompanied by illegal poaching of orchids for large-scale trade are the major reasons of species endangerment. According to the Indian Red data book published by the Botanical Survey of India, 10% of the total flowering plants of India are endangered which includes a large number of orchid taxa. In IUCN Red List Categories (2006) CITES Appendix I (Convention on International Trade in Endangered Species) have the species threatened with extinction and affected by trade viz. Aerangis ellisii, Dendrobium cruentum, Laelia jongheana, Laelia lobata, Paphiopedilum sp., Peristeria elata, Phragmipedium sp., Renanthera imschootiana. All species except those mentioned in Appendix I were included in CITES Appendix II (Hedge 1996) which are not necessarily threatened with extinction but may become so unless trade in specimens of such species is strictly regulated. Considering these facts, it has become an urgent task to save our valuable orchid germplasm through different conservation methodologies (Fig. 1). Knowledge about genetic diversity of different population is the baseline for the conservation of any concerned species. Several aspects of conservation biology, such as loss of genetic diversity and restoration of threatened populations, can only be addressed by detailed population genetic studies. Therefore, as a first step to facilitate conservation of wild orchids and formulating comprehensive conservation plans, comparative population studies at molecular levels are needed to collect information at the species level and the patterns of genetic diversity.

Fig. 1:  Conservation strategies for orchid

Among the various conservation strategies for Orchid, in situ conservation deals with efficient management of natural habitat, formation of national park and sanctuaries, creation of Biosphere reserve. Subsequently, development of Orchidaria, Creation of seed bank etc. included under ex situ conservation. But propagation of orchids through conventional methods is extremely time consuming, since most are characterized by slow vegetative growth as well as poor natural seed germination; the latter being dependent on the association with species-specific fungi. Therefore, ex situ cultivation of species, followed by transfer of propagated plants in the wild to restore natural population would

Nirmalya Banerjee et.al.  | 93

be considerably slow and less convenient strategy. In addition to this, conservation of germplasm through seed bank is less likely to achieve long-term goal, since orchid seeds, characterized by the lack of substantial reserve food materials, show rapid loss of viability. In view of these limitations, it is undeniably desirable to incorporate various in vitro techniques such as micropropagation, symbiotic seed culture, asymbiotic seed culture, organ culture, growth limitation, and cryopreservation for efficient conservation of orchids (Fig. 2).

Fig. 2.  In vitro Conservation

In Vitro Seed Germination The seeds of orchids, produced in large numbers in each capsule, are highly fragile and possess virtually no stored food material or endosperm (Fig. 3). In nature they cannot utilize their own scanty lipid reserves, break down starch or photosynthesize (De Pauw et al. 1995). Following water uptake, which causes swelling, orchid seeds may turn green, but fail to develop further in the absence of fungal infection (symbiotic germination). Consequently, they exhibit extremely poor germinate rates in nature (less than 1%). However, successful in vitro germination of orchid seeds in high frequency took place following the formulation of Knudson B and C medium (Knudson 1922, 1946). Various medium amendments like organic additives (peptone, yeast extract, coconut water etc.) and plant growth regulators (BAP, NAA, IAA, 2,4-D, IBA, etc.) were used for optimized germination and protocorm growth. The culture of immature seeds often referred to as embryo/green-pod/ green-fruit culture has opened new dimension in conservation and commercialization of orchid genetic resources and has been successfully employed in a large number of commercially important or endangered taxa representing both epiphytic and terrestrial habits (Roy and Banerjee 2001, Roy and Banerjee 2002, Naha et al. 2013, Majumder and Banerjee 2015). Orchid seed germination and subsequent development into seedlings is usually accompanied by an intervening protocorm stage (Fig. 4). In general orchid seed germination includes swelling of embryos and their emergence through an

94  |  Orchid Germplasm: Its Conservation and Propagation Strategies Through In Vitro Approach

apical or lateral slit in the seed coat as globular/elongated spherules which subsequently form chlorophyllous, hairy, and pear-shaped protocorms.

Fig. 3:  SEM showing seed structure and surface

Fig. 4:  Developmental stages of orchid seed germination

In Vitro propagation Plant regeneration involving various micropropagation techniques in orchids may occur via triderectional pathway (Fig. 5) involving callus formation or direct shoot bud/axillary shoot formation or protcorm like body (somatic embryo) mediation (Roy and Banerjee 2003, Roy et al. 2007, Mondal et al. 2013, Wu et al. 2014).

Nirmalya Banerjee et.al.  | 95

Fig. 5:  Morphogenetic pathways of organ culture

The various modes of orchid micropropagation are shoot tip culture, leaf segment culture, inflorescence axis and flower bud culture, rhizome segment culture, root segment culture, thin cell layer culture (Chugh et al. 2009). Explants were cultured in Modified Knudson’s C medium (1946) supplemented with various concentrations and combinations of medium amendments like PGR treatments (BAP, NAA, TDZ, Kinetin), polyamine treatments (Putrescine, spermidine, Spermine), carbohydrate treatments (sucrose, lactose, maltose, mannose, galactose and fructose) incubated at 25 ± 2°C under 10 hr photoperiod (37.5 lux.m–2.sec–1) irradiance. In shoot tip culture of Dendrobium farmerii, successful propagation via direct somatic embryos or indirect via callus phase along with direct adventitious shoots is obtained in TDZ-NAA combinations (Fig. 6). Among the carbohydrate treatments glucose, maltose and fructose show significant increase in PLB production whereas galactose have an inhibitory effect in many species of Dendrobium and Vanda. Leaf culture of Rhynchostylis retusa depicts TDZ induced direct plantlets and BAP-induced granular callus. Embryogenic callus were maintained in PGR free medium (Fig. 7). Somatic embryos were appearing in subsequent developmental stages of callus which ultimately form rooted plantlets in this medium. Subsequently, successful results were also obtained with direct morphogenesis from Rhizome nodal culture of Geodorum densiflorum through de novo rhizome initiation,

96  |  Orchid Germplasm: Its Conservation and Propagation Strategies Through In Vitro Approach

rhizome enlargement, rhizome branching, rhizome formation on both sides, aerial shoot from several nodes (Fig. 8).

Fig. 6:  Propagation through shoot-tip culture of Dendrobium sp. : A. Callus induction, B. Callus differentiation; C. & D. Direct PLB formation and differentiation; E. Rooted plantlets Fig. 7:  Foliar regeneration of Vanda sp. : A. & B. Direct PLB formation at the basal cut end of leaf explants; C. & D. Callus induction and differentiation; E. PLBs transferred to fresh medium F. Plantlet formation . Fig. 8:  Rhizome nodal culture of Geodorum densiflorum : A. de novo Rhizome initiation, B. Rhizome enlargement; C. Rhizome branching, D. Rhizome formation on both sides; E. Aerial shoot from several nodes; F. Root initiation in aerial shoot

Assessment of Genetic Fidelity For regenerants produced by in vitro culture techniques, an important concern is their genetic fidelity with respect to the mother plant because genetic variation may occur during in vitro culture. Cytological and DNA markers have been used to identify and verify the origin, stability of clones and plants regenerated in culture (Joshi and Dhawan 2007, Kishor and Devi 2009, Mondal et al 2013, Yin et al 2013). In cytological study, the somatic chromosome from micropropagated species of Doritis, Vanda and Dendrobium roots revealed the exact number of chromosomes as it was in the respective mother plant. Molecular markers such as ISSR and RAPD markers are powerful and valuable tools

Nirmalya Banerjee et.al.  | 97

used for analysis of genetic fidelity of these in vitro regenerated plants. RAPD and ISSR profiles obtained through amplification of genomic DNA of the in vitro grown plants and that of the mother plant were similar (Fig. 9). Primers producing the monomorphic bands confirm the genetic homogeneity of the in vitro regenerated plants and no variation occurred during clonal propagation.

Fig. 9:  RAPD and ISSR profile of the regenerated plants (R) and mother plant (Mp) of some orchid species Developmental stages of orchid seed germination

In Vitro Storage Generally, in vitro storage of cultured propagules was performed through two different methods (Fig. 10). In first method, the plant materials were encapsulated by sodium alginate, using Ca (NO3)2 as gelling agent to develop synthetic seeds (Gantait et al 2012, Gantait and Sinniah 2013). These synthetic seeds were subsequently stored at various temperatures, with or without growth retardants or cytokinin (Fig. 11). The alginate coated micropropagules of Vanda testacea stored at control (only water) and in KC medium supplemented with BAP 8 μM upto 10 months showed regrowth, but gradually lost viability as affirmed by TTC test. Gel beads of V. tessellata also dried up after 6 months suggesting that encapsulation is not a suitable option for long term in vitro storage.

98  |  Orchid Germplasm: Its Conservation and Propagation Strategies Through In Vitro Approach

Fig. 10:  Schematic diagram of the strategy employed for medium-term in vitro storage of orchid protocorms

Fig. 11: In vitro storage through     Fig. 12: In vitro storage of protocorm synthetic seed (Encapsulation), in liquid culture on filter paper

In the second method, plant materials were subjected to direct storage (Fig. 12), where established cultures of protocorms and other propagules were transferred to growth chambers having different low temperature and light intensity (Banerjee and De Langhe 1985, Gangaprasad et al 1999, Paula et al 2000, Sarkar et al 2001). For this purpose, media manipulations by reducing the strength of the basal medium or use of cytokinins and growth retardants have exhibited additional effect on growth retardation. As for example, half strength of basal media was effective for slow growth storage of Vanda tessellata and V. coerulea; and different concentrations of BAP are effective over the PGR-free media,

Nirmalya Banerjee et.al.  | 99

BAP 8 μM being optimum for in vitro storage of D. nobile and V. tessellata where seedling growth is predominately restricted to globular and leaf primordial stage even after 13 months of storage. Among the growth retardants tried, ancymidol, quercetin and paracoumaric acid have least effect on growth retardation. However, significant reduction in growth with has been achieved in many species of Dendrobium and Vanda with abscisic acid chlorocholine chloride and paclobutrazol compared to PGR free medium. Low-temperature storage of orchid cultures also proved to be of considerable importance for the preservation of genetic diversity and specific clones (Ishikawa et al 1997, Wang et al 1998.). Cryopreservation (storage in liquid nitrogen at -196º C) of seeds, shoot meristems, cell suspensions, protocorms and protocorm-like bodies in vitro could be used in addition to conventional methods of conservation (, Thammasiri 2000, Tsukazaki et al 2000, Lurswijidjarusa and Thammasiri 2004). Cryopreservation completely inhibits all possible processes of cell metabolism and seed aging, thereby can be used for storing of tissues for unlimited time. So far successful cryopreservation of orchid seeds have been reported in about 20 species and appeared a promising line of germplasm storage. During storage, propagules requires no transfer to fresh medium, thus reducing the cost of maintenance of germplasm cultures.

Conclusion These studies have been attempted to develop successful storage methods that enable the establishment of extensive basal collections, with representative genetic diversity. Additionally, these biotechnological strategies demonstrated the possibility of improving survival of orchid seedlings and plantlets with cross application to rare and endangered species. Establishing in vitro plant stocks have an immediate benefit by reduction the collection pressure on the wild orchid populations. These collections allow for continuous supply of valuable material for wild population recovery, molecular investigations, ecological studies, or commercial uses in the pharmaceutical and floriculture industry.

REFERENCES Banerjee N, De Langhe E. 1985. A tissue culture technique for rapid clonal propagation and storage under minimal growth conditions of Musa (banana and plantain). Plant Cell Rep. 4: 351-354. Chugh S, Guha S, Rao U. 2009.Micropropagation of orchids: a review on the potential of different explants. Sci. Hortic. 122: 507–520. De Pauw MA, Rempherey WR, Palmer CE. 1995. The cytokinin preference for in vitro germination and protocorm growth of Cypripedium candidum. Ann. Bot. 75: 267-275. Dressler, R.L. 1993. Phylogeny and Classification of the Orchid Family. Dioscorides Press, Portland, Oregon.

100  |  Orchid Germplasm: Its Conservation and Propagation Strategies Through In Vitro Approach

Gangaprasad A, Decruse SW, Seeni S, Menon VS. 1999.Micropropagation and restoration of endangered Malabar daffodil orchid Ipsea malabarica. Lindleyana 14: 47–56. Gantait S, Bustam S, Sinniah UR. 2012. Alginate-encapsulation, short-term storage and plant regeneration from protocorm-like bodies of Aranda Wan Chark Kuan ‘Blue’ x Vanda coerulea Grifft. ex. Lindl. (Orchidaceae). Plant Growth Reg. 68(2): 303-311. Gantait S, Sinniah UR. 2013. Storability, post-storage conversion and genetic stability assessment of alginate-encapsulated shoot tips of monopodial orchid hybrid Aranda Wan Chark Kuan ‘Blue’ x Vanda coerulea Grifft. ex. Lindl. Plant Biotechnol. Rep. 7(3):257–266. Hegde SN. 1996. Orchid wealth of India, Arunachal Forest News, 14(1): 6-19. Ishikawa K, Harata K, Mii M, Sakai A, Yoshimatsu K, Shimonura K. 1997. Cryopreservation of zygotic embryos of a Japanese terrestrial orchid (Bletilla striata) by vetrification. Plant Cell Rep. 16: 745-757. Joshi P, Dhawan V. 2007.Assessment of genetic fidelity of micropropagated Swertia chirayita plantlets by ISSR marker assay.Biol Plant. 51: 22–26. Kishor R, Devi HS. 2009. Induction of multiple shoots in a monopodial orchid hybrid (Aerides vandarum Reichb.f × Vanda stangeana Reichb.f) using thidiazuron and analysis of their genetic stability. Plant Cell Tiss. Org. Cult. 97(2): 121-129. Knudson L. 1922. Non symbiotic germination of orchid seeds. Bot. Gaz.73: 1-7. Knudson L. 1946.A new nutrient solution for the germination of orchid seeds. Amer. Orch. Soc. Bull. 14:214-217. Lurswijidjarusa W, Thammasiri K. 2004. Cryopreservation of shoot tips of Dendrobium Walter Oumae by encapsulation/ dehydration. Sci. Asia. 30: 293-299. Majumder M, Banerjee N. 2015. Effective nutritional requirements and in vitro approach for asymbiotic seed germination and seedling growth of some terrestrial orchids. In Pullaiah T. (Ed.) Biotechnological Approaches for Sustainable Development. Regency Publication, Delhi: 83-140. Mondal T, Aditya S, Banerjee N. 2013. In vitro Axillary Shoot Regeneration and Direct Protocorm-like Body Induction from Axenic Shoot Tips of Doritis pulcherrima Lindl. Plant Tissue Culture & Biotech. 23(2): 251-261. Naha S, Mondal T, Banerjee N. 2013.Asymbiotic seed germination and seedling development of Vanda testacea(Lindl.)Reichb. f.: An in vitro approach for optimization of cultural requirements for a medicinally important rare orchid.Int. J. Curr. Res. 5(4): 1006-1011. Paula M, Watt MP, Thokoane NL, Mycock D, Blakeway F. 2000. In vitro storage of Eucalyptus grandis germplasm under minimal growth conditions.Plant Cell Tiss. Org. Cult. 61: 161-164. Roy J, and Banerjee N. 2002.Optimization of in vitro seed germination, protocorm growth and seedling proliferation of Vanda tessellata (Roxb.) Hook Ex G Don. Phytomorph. 52: 167-178.

Nirmalya Banerjee et.al.  | 101

Roy J, Banerjee N. 2001. Cultural requirements for in vitro seed germination,protocorm growth and seedling development of Geodorum densiflorum (Lam.) Schltr. Ind. J. Exp. Biol. 39: 1041-1047. Roy J, Banerjee N. 2003. Induction of callus and plant regeneration from shoot-tip explants of Dendrobium fimbriatum Lindl. var. oculatum Hk. f. Sci Hortic. 97: 333-340. Roy J, Naha S, Majumdar M, Banerjee N. 2007. Direct and callus- mediated protocormlike body induction from shoot-tips of Dendrobium chrysotoxum Lindl. (Orchidaceae). Plant Cell, Tiss. Org. Cult. 90: 31-39. Sarkar D, Chakrabarti SK, Naik PS. 2001. Slow growth conservation of potato microplants: efficacy of ancymidol for long-term storage in vitro. Euphyt. 117: 33-142. Singh, K. P. & A. S. Chauhan. 1999. Sikkim. In Floristic Diversity and Conservation Strategies in India. Vol. ID, (V. Mudgal & P. K. Hajra Ed.), Botanical Survey of India, Calcutta. Pp. 1419-1456. Thammasiri K. 2000. Cryopreservation of seeds of a Thai orchid (Doritis pulcherrima Lindl.) by vetrification. CryoLett. 21: 237-244. Tsukazaki H, Mii M, Tokuhara K, Ishikawa K. 2000. Cryopreservation of Doritaenopsis suspension culture by vitrification. Plant Cell Rep. 19: 1160-1164. Wang JG, Ge JG, Liu F, Bian HW, Huang CN. 1998. Cryopreservation of seeds and protocorms of Dendrobium candidum. CryoLett. 19: 123-128. Wu K, Zeng S, Lin D, Teixeira da Silva JA, Bu Z, et al. 2014. In Vitro Propagation and Reintroduction of the Endangered Renanthera imschootiana Rolfe. PLoS ONE 9(10): e110033. Yin ZF, Zhao B, Bi WL, Chen L, Wang QC. 2013. Direct shoot regeneration from basal leaf segments of Lilium and assessment of genetic stability in regenerants by ISSR and AFLP markers. In Vitro Cell. Dev. Biol.-Plant. 49: 333–342.

mmm

Trends in Frontal Areas of Plant Science Research Edited by: S. Sinha, R.K. Sinha © Department of Botany, Tripura University, 2017

Women and Environment: An Integral Social Bond for Ecological and Economic Security and Resilience A. K. Gupta, IFS PCCF & CWLW, CEO and PD, IGDC Project, Tripura Corresponding author: [email protected]

The forests along with inbuilt biodiversity components constitute the physical environment. This, in turn, acts as a viable and sustainable source of livelihood to the human population. It is estimated that about one hundred million people depend on forests needed for their survival in order to have key elements like goods and /or services or incomes. At least one third of the world’s rural population depends on firewood, medicinal plants, food, and compost for agriculture that come from forests. In forestry sector, women play a major and critical role owing to their intimate familiarity with the forests like the nook and crannies of their home. The Food and Agriculture Organization (FAO) has concluded through their studies that (1) forests are often a major source of paid employment for rural women; (2) Rural women are often the principal caretaker and guardians of the forests; (3) women have an extensive knowledge of forest resources; and (4) in many areas, women have demonstrated that they are not only the primary users but also the most effective protectors of the forests. Amongst the three types of land viz., Forest, revenue, and private, women are most dependent on Forest lands, where they are gatherers of forest produce for subsistence and sale. Women are also employed by the Forest Department and contractors to work as unskilled labourer. They have similar roles as collectors and as wage-employees on common and revenue lands, though to a lesser extent, as these lands are more degraded. In community forestry and Joint Forest Management programmes, women are also supposed to participate in the management of afforested areas. Women are also involved as producers in farm forestry programmes. Thus women have four distinct occupational roles in forestry – gathering, wage employment, management, and production. Women’s employment in forest based enterprise is estimated to be approximately 572 million days, of which 90 per cent is in the small scale enterprises using NTFPs as raw material (Khare, 1987). Women primarily collect two of the main cash earners among NTFPs, sal seeds and tendu leaves. It is estimated that more than 1, 50,000 tones of tendu leaves are harvested annually by 600,000 women and children (Kaur, 1991).

104  |  Women and Environment: An Integral Social Bond for Ecological and Economic...

The forestry staff and contractors alike prefer women for certain forestry operations, like nursery work, and collection of non-timber forest products. They often get lower wages than men for similar work, are not being paid regularly, and are subjected to harassment if they complain (CIDA 1988). An ILO study (1987) of the Social Forestry Programme of Orissa observed that nowhere in the Appraised Project Document was there any mention of the working condition of women, they got no benefit of labour laws and no safety or health measures were being undertaken; whereas work performed outdoors under exposure to changing weather required heavy physical effort, sometimes in difficult terrain, and away from their homes. The Village Forest Committee was generally not involved in payment of wages, which in any case were lower than the minimum prescribed. It is estimated that the total wage employment for women in the collection of forest produce is as high as 300 million women days (Pant 1980). Yet hardly any rules exist for regulating their working hours, safety precautions, provisions of latrines, job recruitment, leave and other benefits, training policies, productivity-linked bonus, compulsory insurance against accidents, shelters, civic amenities, arrangements for care of children and infants and medical care. By planting trees on land previously used for agriculture crops female labourer tends to get displaced (ILO, 1988; Arnold et al., 1988). A study of eucalyptus plantations in Tamil Nadu under the farm forestry programme (Malmer, 1987) revealed a drop in the wage employment for women from 112 to 45 per ha while the male employment rose from 12 to 45 per ha. In most of the states, there is no clear provision for women’s membership. In cases where one person can represent a household, it invariably ends up being a man. However, most of the states have tried to overcome this by providing 1 male and 1 female representative per household and even joint husbandwife membership, as in Tripura and West Bengal. Degradation of natural resources, natural environment, deforestation and displacement, have all worsened women’s material condition and social status, and more so of the tribal women. Male migration and abandonment of women due to increasing practice of bigamy, leaves large numbers of pauperized and indebted women to fend for themselves. Men’s absence for long periods is compelling many poor women to become primary breadwinners of their households. Head loading firewood from forests and collecting other NTFPs for sale are often the only few income earning opportunities available to such women (Adithi, 1993). However, they receive abysmally low returns for their labour (GOI, 1988). Women-headed households are now estimated to represent one-third of the total households in the country. Such households are disproportionately concentrated below the poverty line due to an increasing ‘feminization of poverty’ (GOI, 1995). Such women’s economic productivity is particularly critical for 65 million households below the poverty line. The poorer the family, the more it depends for its survival on the earnings of its female members (World Bank, 1991). In Tripura too, the women, both among tribal and non-tribal communities, have been acting almost on regular basis as firewood and minor forest produce gatherers, water

A. K. Gupta  | 105

fetchers, herbalists, etc. These activities keep them in close proximity with the forests and thus enable them to have vibrant knowledge of its diversity and importance. The critical role of women in forestry management and conservation has been duly recognized in the policies of the forest department in the state. Taking cue from the National Forest Policy, 1988 and the National Resolution on Joint Forest Management, the State forest department has constituted Joint Forest Management Committees (JFMCs) and Eco-development Committees (EDCs) where participation of women both at the administrative, managerial and execution level is ensured. The mandatory provision in the JFMC/EDC constitution to have automatic membership to the wife of the adult male member in the family has resulted in about 45,000 women members across the State in 472 JFMCs. Similarly, in yet another participatory programme through Forest Development Agencies (FDA), the participation of women in both General and Executive Bodies has been made mandatory. In most of the JFMCs all women Self Help Groups (SHG) have been constituted. Assured access and entitlements to common pool forest resources through JFM programme, therefore, has particular significance for such resource poor women for increasing livelihood security. However, it needs to be recognized that women do not constitute a homogenous category and are equally differentiated by caste, class and ethnicity, as men with equally diverse, often conflicting, forest related priorities shaped by their specific situations. JFM programme has inbuilt provisions thus ensuring correct identification of forest dependent women for facilitating increase in their livelihood security through participatory resource planning and management. It has been observed in the working of almost all the JFMCs/SHGs/EDCs in the State that the women have taken lead in practically all different types of income generating activities being executed for the economic and social well being of the local dependent communities. Women also happen to be the primary players in the collection, processing, and marketing of NTFPs who gather bulk of forest produce, including food and fuelrelated forest products that are sold in the market as opposed to the men who are mainly responsible for construction timber, poles and some collection of medicinal plants. This relationship between the environment and forests assumes much greater importance in Tripura, where more than 77% tree cover and about 60% of forest area (of the total geographical area of the State) support more than 85% of the total human population depending on forestry resources. Among the tribal population in the State, this dependency stands at as high as 92%. For more effective conservation, management and protection of forests and biodiversity in the State, it is to be ensured that the rights, privileges and other fringe benefits being earmarked for women more than commensurate the hours and energy spent by them in ensuring food security for the entire family.

Basic Facts on Women in Tripura As against population (2011 census, GoI) of male population (18.7 lakhs), the female population is 17.9 lakhs. The sex ratio is 957:1000 as against National average for females at 933. The literacy rate among females is 82.72% as against males at 91.53%, and overall

106  |  Women and Environment: An Integral Social Bond for Ecological and Economic...

state literacy rate at 94.65%, which is highest in the country. The female literacy rate is higher than all India rate at 54.3%. As regards works force, the females make up for only 28.9 per cent (4.2 lakhs) as against male work force at 71.1 per cent. However, the main female workers are still very less at only 11 per cent (males at 51.5 per cent) and most of this female work force are marginal workers (10.1 per cent as against males at only 5.4 per cent). The cultivators amongst females are 28.1 per cent, which is higher than the males at only 26.6 per cent. The per cent contribution of females as agriculture labourers is also higher at 34.6 per cent as against males at only 19.6 per cent. Household and other workers amongst females make up for 6.2 and 31.1 per cent as against their male counterparts contributing at 1.8 and 52.1 per cent.

Women & Forests: The Policy Support Realizing the importance of the role of women the forestry sector, enabling changes have been made in various policies aiming at the management of the natural resources, with special reference to the forestry and wildlife sector. These changes have been introduced both at the Central and State level policies. The National Forest Policy, 1988 of the Government of India have brought out enabling provisions to ensure that the women participation is made mandatory both at the decision-making and implementation levels. National Resolution on Joint Forest Management (June 1990) and Eco-development (1991) also have such provisions to make women’s participation almost mandatory in the participatory forestry and wildlife management related issues. In Tripura too, the JFM resolution has been adopted since 1991 wherein provisions have been kept for active participation of the women. The wife of adult male member automatically becomes the member of the JFM and EDC Committees. In the Executive Committee of JFMCs, 33 per cent seats are reserved for women participation. To ensure the participation of women in the Committee meetings, it has further been mandated in the Resolution that no meeting of the Executive Committee could be held unless 33 per cent of the total women members are present to complete the quorum. Likewise in the Committees of the Forest Development Agencies (FDA), similar mandatory participation of the women is ensured. In the newly developed Forest Villages and Regrouped Forest Villages in the State, special emphasis is given on the women’s participation. Attempts are being made to constitute all women Self Help Groups (SHGs) to impart focused economic benefits to the women in the family. A number of Centrally Sponsored Schemes (National Bamboo Mission, Integrated Forest Protection, Management of Gregarious Flowering, etc.) have specific provisions for raising Mahila (women) nurseries and other SHGs for providing alternative mode of livelihood to remove the drudgery among the women. As of now, a total of more than 1000 JFMCs and about 45 EDCs have already been constituted with about 75,000 families. Therefore, at least 55,000 women participation is ensured in the participatory forestry management. Besides, there are about 608 SHGs, of which at least 10 per cent are all women, and in other SHGs also the women participation

A. K. Gupta  | 107

is more than the male members. Realizing that main emphasis need be given on the tribal populations living in the interior areas, about 60 percent of the total JFMC/EDC families selected belonged to scheduled tribe group. In line with this approach, the majority of the women participation is also from amongst the ST communities. Having about 4400 ha area made available as plantation area under the JFM/EDC committees, the scope has been provided to the members, especially the women members, to take up the alternative (both land and non-land based) livelihood options. The Forest Department has a target to increase the number of JFM/EDC Committees to cover all those Gram Panchayats and Village Committees having substantial forest cover (about 874 numbers) with corresponding increase in the number of SHGs (1200 SHGs). It is, therefore, anticipated that the involvement of women would be almost doubled in the coming few years and this may change the entire socio-economic fabric of the families sharing the natural resources, especially in the interior areas.

Attitudinal Change in the Forest Department (In built role of women) With the adoption of the JFM and EDC resolutions, the forest department has demonstrated a major shift in its attitude towards conservation and management of the natural forestry and wildlife resources. It has led to a total switch over from the isolationist approach to the participatory approach. Currently, all the schemes in the department are being implemented in the participatory mode with the active involvement of the people sharing the natural resources for meeting their subsistence economy. The motto of the Forest Department in its Perspective Plan for the next decade or so aptly describe this change in attitude while exhorting for Socio-economic Security of the People of the State through Ecological Stability. The management of the natural resources in the state has been fused and synergized with the improvement in the socio-economic conditions of the people of the state. This approach is being implemented in the field through various innovative programmes and schemes. Some of the programmes are as follows:

• Focus on voluntary settlement of the shifting cultivators in regrouped forest villages. A total of 23 such regrouped villages have been established with about 3800 families, 90 per cent of which are belonging to the scheduled tribe communities. In all these families, the women are the main target group both for undertaking the activities and as beneficiaries. The provisions for better education of the children, development of housing, medical, and drinking water facilities in all the villages has directly helped women in the family to devote much less time in procuring all these life-saving commodities from far flung areas. Better health and education facilities both for children and women have also helped in marked improvement in the socio-economic conditions of the families as a whole. No wonder, that many more shifting cultivators request the department for their voluntary resettlement on similar pattern.

108  |  Women and Environment: An Integral Social Bond for Ecological and Economic...









• Large-scale construction of check dams both for soil and water conservation and providing scope as vibrant livelihood measure through pisciculture. A total of more than 1500 check dams have been created in the department covering an area of about 873 ha. In majority of these dams, the pisciculture has been introduced where women are playing a vital role and have been the main achiever of the economic benefits. • Creating plantations of short rotation and economically useful species ensuring short term and immediate economic returns to the dependent people. A total of 2800 sq km area has so far been covered under plantations of various species. Of this, about 30 to 32 per cent is covered under short rotation and economically useful fruit/fodder species. The women being the main NTFP collectors for the household subsistence economy, the plantations of such species has directly benefited them in saving them time from going to distant places to collect the NTFPS. The time thus saved is being devoted in the welfare of the children at home and for performing other socio-economic activities leading to the economic and social welfare of the family as a whole. • Farm forestry has been promoted in the department with main objective of providing fuel and fodder to the families. A total of 170 sq km area has so far been covered under this scheme since 1996, mainly through Angan Ban prakalpa (45 sq km) providing the forest based products in their courtyards. In this programme too, the women have been the main player both as participant and beneficiary. This scheme has raised the economic conditions of about 26,000 families. • Special emphasis on the river bank plantations for conservation of soil and providing employment to the people • Capacity building of grass root level/cutting edge personnel for change in their mindset to be able to adopt the new schemes and plans all aimed at their economic welfare linked with the ecological security of the area.

Thrust Areas The Forest Department has identified few thrust areas to ensure direct economic benefits to the local dependent people. These thrust areas are specifically catering to the needs of the women in each household leading to multiple benefits. On the one hand the family income is increased, and on the other the drudgery among the women members is removed leading to all round development of the entire family. With more time available at the disposal of the women, they are able to devote the same in the education and health aspects of the children. Some of the thrust areas are:

• Service Sector based livlihood options (non-land based): By nature, women are much better suited for many non-land based vocations, such as, tailoring, chanachur making, artificial flower making, ornament making, handloom, agarbatti rolling etc. There is an urgent need to harness this in-built strength that the women posses by imparting them enabling training and supporting to set up small cottage-based ventures for self earning.

A. K. Gupta  | 109















• Bio-Fuel Sector: Jatropha plantations are being promoted in the participatory mode in all the forest divisions. The Department has entered into a Public Private Partnership mode to ensure the marketing of the products for instant economic benefits to the beneficiaries. The role of women in this sector is very vital especially in raising the nurseries and assisting in taking up the plantations. More than 2000 ha of Jatropha plantation has so far been raised and most of which would be ready for harvest of seeds for sale. • Medicinal and NTFP Plantations: The Forest Department in collaboration with the State medicinal Plants Board, Tripura has taken up many projects, both on forest and private lands to undertake plantations of medicinal and other NTFP species. • Forest Villages: A total of 62 Forest Villages have been selected for facilitating the infrastructure and economic development with the financial assistance from the Ministry of Tribal Affairs, Government of India. One major component in this scheme is related with the participation of women. Most of the activities chosen for this scheme are going to benefit the women directly for their social and economic development. • Bamboo Sector: Bamboo is the lifeline for the rural households in Tripura. The use of bamboo is found in practically all spheres of their day-to-day activities. The bamboo is used both for personal use and also for sale in the market to earn livelihood. However, the commercial use of bamboo has not yet found its due place in the rural economy. Recently, many State and Central schemes are focusing in enhancing the bamboo resources in the State and mainly at promoting the commercial use of different species of bamboo. The cluster based approach to promote cottage based handicrafts and other uses are being promoted by encouraging the JFMCs/EDCs to re-group themselves in activity based SHGs. The role of women in this aspect is very crucial as these can work part time to produce bamboo based value added goods for direct economic benefits. Of a total of 408 SHGs under the Forest Department, about 10 per cent are exclusively women based and in these, more than 90 per cent are bamboo based. • Eco-tourism: Forestry and Wildlife based eco-tourism has great potential in the state. The involvement of EDC members in promoting eco-tourism is being initiated in the department in many existing protected areas and the parks and gardens. In this sector too, the role of women would be very crucial as these could be involved in many eco-tourism related activities that would benefit them economically and socially as well. • Parks and Gardens: The forest department has come up with many parks and garden across the state exclusively in participatory mode. These parks and gardens are helping in providing direct economic benefits to the people, especially women, who are engaged for routine maintenance and other works round the year. • Raising Nurseries and Quality Planting Material: As mother, the women have innate quality of nursing. This very nature among women may make them

110  |  Women and Environment: An Integral Social Bond for Ecological and Economic...

‘natural expert’ in the arts and techniques of raising seedlings and quality planting materials. Under the Indo-German Project, many women members, either as individuals or as part of any given SHG, have proved themselves much ahead to their counterpart male members both in terms of quality and quantity outputs.

The Way Ahead…..

• Ensuring rights and privileges to the women vis-à-vis their inputs in the management and conservation of forests. • More capacity building in Income Generating Activities (IGA). • Facilitating constitution of many more all women SHGs. • Technological interventions in traditional IGAs to increase per capita productivity – facilitate women spending more time with children. • Awareness for environment protection in women – help in passing on to the children as future guardians.

REFERENCES Kaur, R. 1991. Women in Forestry in India. Working Paper, Women in Development, World Bank, Washington D. C. Khare, Arvind, 1987. Small Scale Forest Enterprises in India with Special Reference to the Role of Women. National Review Paper, ISST, New Delhi. Adithi, 1993. Homage to our Foremotherhs, mimeo, Patna. GOI, 1988. Shramshakti, Report of the National Commission on Self-Employed Women and Women in Informal Sector, New Delhi. GOI, 1995. Country Paper, The Fourth World Conference on Women, Beijing, 1995; Department of Women and Child Development, Ministry of Human Resource Development, New Delhi. World Bank, 1991. Gender and Poverty in India, Washington.

mmm

Trends in Frontal Areas of Plant Science Research Edited by: S. Sinha, R.K. Sinha © Department of Botany, Tripura University, 2017

Maximum Entropy Distribution Modelling and Habitat Suitability of a Critically Endangered Tree Dipterocarpus gracilis Blume in Tripura, Northeast India Koushik Majumdar1*, Dibyendu Adhikari2 and Badal Kumar Datta1 1

Plant Taxonomy and Biodiversity Laboratory, Department of Botany, Tripura University, Suryamaninagar– 799 022, Tripura, India. 2 Centre for Advanced Studies in Botany, School of Life Sciences, North-Eastern Hill University, Shillong– 793 022, Meghalaya, India. Corresponding author: [email protected]

Summary With the rise of the risk for species loss, alternative strategies for predicting habitat distribution and population estimation were taken to ensure threatened species conservation. In order to improve the conservation status of Dipterocarpus gracilis Blume in its natural habitat, a model was proposed for predicting potential areas of distribution and suitable habitats using ‘Maximum Entropy (MaxEnt) distribution algorithm’ under future species reintroduction programme in Tripura. The model was developed using twenty four sites data recorded in its native range in south Tripura. We used Normalized Difference Vegetation Index (NDVI) and Digital Elevation Model (DEM) to predict suitable habitat. The present study encompasses additional record of D. gracilis for the flora of Tripura state with potential suitable habitat distributions within the current home range. Keywords: Habitat suitability modelling, ENM, NDVI, DEM, Critically Endangered Tree Quantification of existing population, relocation of distribution and monitoring its habitats is the prime concern toady for most conservation biologist and ecologist to mitigate the impacts of climate change on the remaining viable population and suitable habitats of threatened species (Balmford and Bond 2005). Ecological Niche Modelling (ENM) not only can provide a useful tool to predict species additional population and distribution area, but also help setting prioritized strategies for species conservation and restoration programme (Guisan and Thuiller 2005). ENM has been using widely to assess the potential geographical distribution for many threatened and endangered species (Ganeshaiah et al. 2003, Guisan and Thuiller 2005, Peterson et al. 2007, Elith et

112  |  Maximum Entropy Distribution Modelling and Habitat Suitability of a Critically...

al. 2011). ENM are commonly used for predicting species distributions under changing climates (Buisson et al. 2010, Sanchez et al. 2011), and these models may be used to make recommendations for conservation practitioners to deal with potential climate change (Sanchez et al. 2011). Dipterocarpus gracilis, a Critically Endangered (CR) tree species listed by IUCN, is mainly distributed in Southeast Asia (Ashton 1998). In India, this species was reported from Andaman Island, Arunachal Pradesh and Assam; where limited populations dwell only in some Protected Areas (PAs). In course of our floristic investigation, we observed its natural occurrence in Tripura and hence, this is another additional tree recorded for the flora of Tripura state (Fig. 1). There were very limited data on the distribution, population and habitat status of this species (Ashton 1998). In this study, our objectives were set to: (1) assess habitat characteristic of D. gracilis, (2) to predict suitable habitat and additional distribution sites of D. gracilis in Tripura.

Materials and Methods Study Area and Collection of Species Occurrence Data Tripura is a small state with 10,486 km2 geographical area in the North-Eastern region of India, located between 22o56’ and 24o32’ N latitude to 90o09’ and 92o20’ E longitudes. The whole geographical area of the state was divided into 10 × 10 km size grids and hence, total ca. 105 grids were developed. Extensive field surveys were carried out in order to locate this species in Tripura since 2014. Total 31 grids were covered and 24 locations of D. gracilis were recorded based on our extensive field surveys in Tripura. All geographical coordinates were recorded by Garmin GPS. Predictor Variables and Modeling We used MaxEnt model for predicting the potential habitat of this plant species using the environmental variables (Phillips et al. 2006). Estimates of species distribution data (by presence only) has been proved to work well in practice (Andersonet al. 2006, Wardet al. 2009) from freely available software http://www.cs.princeton.edu/~schapire/MaxEnt/. We used Elevation (Digital Elevation Model-DEM)- WorldClim website for NDVI derived from SPOT vegetation sensor data for measurement of healthy green vegetation on the ground. Data processing was done to create 12 monthly mean composite NDVI images. We used 24 filed occurrence records, GIS, environmental layer (Enhanced vegetation index) and the maximum entropy distribution modelling approach (Phillips 2008, Phillips and Dudik , 2008) to predict the potential distribution of this tree in order to develop the strategic planning for its conservation. All 24 occurrences were considered as the total known distribution for the species and converted to point vector file for modelling the distribution of the species. In the present study, composite MODIS EVI images (MOD13Q1) with a spatial resolution of 250 m downloaded from Oak Ridge National Laboratory Distributed Active Archive Centre (http://daac.ornl.gov/MODIS/modis.html) were used to characterize environments across the region. The images were downloaded in

Koushik Majumdar et.al.  | 113

Geo-tiff format and converted to ASCII raster grids. EVI (Enhanced vegetation index) has been considered as the modified NDVI with improved sensitivity to high biomass regions and improved vegetation monitoring capability (Huete et al. 1999). In order avoid cloud cover and other spurious effects the MODIS EVI products are generated by compositing daily data every 16 days, resulting in 23 composites per year (Huete et al. 2002). We used elevation layers as their influence on species distribution and other topographic variables such as slope and aspect in the model (Adhakari et al. 2012). However, we did not use bioclimatic variables as we observed species occurrence within a limited geographical area (South Tripura). ENMs were built using the maximum entropy niche modelling approach implemented in the software MaxEnt v3.3.3k (http://www.cs.princeton. edu/~schapire/MaxEnt) as it estimates the probability distribution for a species occurrence based on environmental constraints and is applicable with presence-only data (Philips et al. 2006). We used the jackknife procedure and percent variable contributions to estimate the relative influence of different predictor variables. Then we evaluated the resulting model with the Receiver Operating Curves (ROC) calculating the area under curve (AUC). Higher AUC score indicates better prediction by model regarding species presence/absence. It also indicated those environmental variables that are highly correlated with the predicted distribution of species. The area under the receiver operating characteristic curve (AUC) value was evaluated and the model was graded as: poor (AUC < 0.8), fair (0.8 < AUC < 0.9), good (0.9 < AUC < 0.95) and very good (0.95 < AUC < 1.0) following Thuiller et al. (2005).

Results and Discussion Distribution and Habitat Qualities of D. gracilis We recorded D. gracilis from relatively 24 different sites of habitat mostly situates in South Tripura district. The present distribution records of D. gracilis in Tripura supplement additional data for the flora of Tripura state. Distribution of this species was recorded in the extreme southern parts of the state i.e., Sabroom, Bagafa and Trishna, forming almost a continuous belt in Tekka Tulsi RF and few other scattered areas in Kashari RF, Garji RF, Betaga Ladhua RF and Muhuripur RF. Present distribution model also clearly distinguish only those forest patches which fall under protection as Reserve Forest (RFs). The species prefer the edge of streams or slope areas where vegetation is composed of semi-evergreen. Lithocarpus spicata, Holigarna caustica, Phoebe attenuata, Actinodaphne obovata, Saraca indica, Knema angustifolia, Palaquium polyanthum etc. was found commonly associated with D. gracilis at the altitudinal ranges between 26.7- 73m amsl. This tree generally prefer slope areas in the forest at an angle >30°. It typically prefers to grow in red laterite soil and few site also found in loam soils. Soil pH typically range between 6.57.7 with an average value of 6.83 whereas, atmospheric humidity ranges between 48.20 - 85 % and temperature fluctuation recorded between 27 -36.60°C.

114  |  Maximum Entropy Distribution Modelling and Habitat Suitability of a Critically... Table 1: The predictor environmental variables used in the MaxEnt model and the estimates of their relative contributions and permutation importance. Code

Variable

Unit

Percent Contribution

Permutation Contribution

Eu_1

NDVI January

mm

0.1

0.1

Eu_2

NDVI February

mm

0.0

0.0

Eu_3

NDVI March

mm

59.4

3.8

Eu_4

NDVI April

mm

0.0

0.0

Eu_5

NDVI May

mm

0.4

0.1

Eu_6

NDVI June

mm

0.8

0.1

Eu_7

NDVI July

mm

0.3

1.0

Eu_8

NDVI August

mm

0.1

0.1

Eu_9

NDVI September

mm

0.0

0.0

Eu_10

NDVI October

mm

0.1

0.0

Eu_11

NDVI November

mm

0.0

0.0

Eu_12

NDVI December

mm

14.4

24.8

h_dem

Elevation

m

22.5

69.8

h_aspect

Aspect

-

1.6

0.1

h_slope

Slope

-

0.4

0.0

Topography

-

0.0

0.0

h_topoind

Fig. 1:  Showing D. gracilis in Tripura A) Habit, B) Tree trunk, C) Twig and leaves, D) Flower and E) Fruit

Koushik Majumdar et.al.  | 115

Fig. 2:  Potential habitat distribution of the D. gracilis in Tripura. The redareas in the map represent the highly suitable habitat.

Habitat Suitability Modeling of D. gracilis The present MaxEnt model predicts potential distribution for D. gracilis with high success rates and it also confirms the present distribution record of the species. The areas in South Tripura, i.e., Sabroom, Bagafa, Trishna and especially TekkaTulsi Reserve Forest (RF) show maximum habitat suitability for the species (Fig.2). Here we used only known twenty four sites data of D. gracilis for our present model. Pearson et al. (2007) successfully produced models for geckos in Madagascar (using MaxEnt) with only five occurrence records. De Siqueira et al. (2009) produced a model for a rare plant in Brazil based only on seven occurrence records using GARP modelling software. Even very few numbers of location can be used to predict the potential distribution of species in areas with relatively few available data (Stockwell and Peterson 2002, Pearson 2007, Babar et al. 2012).In ROC, the performance is measured from the area under curve (AUC). ROC curve is a plot between sensitivity (true positive fraction), i.e. absence of omission error and the proportion of incorrectly predicted observed absences (1-specificity) or false positive fraction, i.e. commission error. The specificity is defined using predicted area, rather than true commission. AUC value of 0.50 indicates that the model is close to random and is a poor indicator, whereas a value of 1 indicates best run (Swets 1998). The model calibration

116  |  Maximum Entropy Distribution Modelling and Habitat Suitability of a Critically...

test for D. gracilis generated acceptable results AUC test = 0.997 (Fig.3). AUC above 0.95 for all variables indicates very high accuracy in MaxEnt model.

Fig. 3:  Receiver operating characteristic curve with area under curve (AUC) for the habitat model of D. gracilis in Tripura.

Contribution of the Variables to the Model Approximation of percent contributions and permutation importance of different environmental variables are given in Table 1. The environmental variable with highest gain when used in isolation is eu3_1_eur (NDVI March) contributed 59.4% to the MaxEnt model which therefore appears to have the most useful information (Fig.4). It was found from the field survey that the layers NDVI March (eu3_1_eur) correspond to the period of flowering phage of D. gracilis. Sensitivity of EVI layers towards flowering and fruiting phage of the species Ilex khasiana Purk. was also reported by Adhikari et al. (2012). Menon et al. (2010) also used 11 EVI layers to characterize environments variables for predicting the distribution of Gymnocladus assamicusin in Tawang and West Kameng district of Arunachal Pradesh. Elevation (h_dem) contributed 22.5% to the MaxEnt model which therefore appears to have the second useful information. Thus, habitat elevation is another important factor for the distribution of D. gracilis. We found this tree at mean elevation of 55.94 m (ranges between 26.7 to 73 m). Literature study also revealed that this tree usually prefer low hills slopes, but can also grow between sea level and 800 m (Ashton 1998). It can also withstand shade in youth. However, the environmental variable eu12_1_eur contributed 14.4% to the MaxEnt model which therefore again can be related to the species phenology during local dry month (NDVI December). D. gracilis is a large tree found

Koushik Majumdar et.al.  | 117

in lowland mixed deciduous, semi-evergreen and evergreen dipterocarp forest (Ashton 1998). Waring et al. (2006) reported that EVI has more advantages over other vegetation index because it is sensitive to site-specific variations and may be more sensitive to local variation in canopy leaf area and chlorophyll concentrations.

Fig. 4:  Percent contribution of the predictor environmental variables associates with the suitable habitat distribution of D. gracilisto the MaxEnt model.

Conclusion and Recommendations Present results are important for identification of additional geographical area of this species. The results will also play a major role in building strategic planning for the future conservation programme of this species. The potential habitat distribution map for D. gracilis can be helpful in land use management planning and monitoring around its existing wild populations. This will cater to identify prioritized conservation sites and also in selecting new sites for reintroduction of the species in its natural habitat. However, it is recommended that such model should not be interpreted as the actual limits of the range of the species and so it should need to consider as the species preferred habitat. Reduction of actual forest areas, habitat modification and felling for timber are the most important threat of this species. NDVI (March and December) and elevation are the major factors which contributed 96.4% to MaxEnt model. Other layers of EVI contributed 3.7% to the distribution model of D. gracilis. Additional areas which were identified through this predicted distribution model need re-survey for confirmation of the species existences.

118  |  Maximum Entropy Distribution Modelling and Habitat Suitability of a Critically...

Further studies are also required for standardization of its large scale propagation to re-introduce the species in the identified suitable areas including monitoring the viable population both in wild and planted condition.

Acknowledgements We acknowledge the Mohamed Bin Zayed Species Conservation Fund (MBZSCF Project ID: 12255404) for providing grant. We also offer special thanks to Dr. Nicolas Heard, Head of Fund Management, MBZSCF for continuous encouragement. We are grateful to Dr. A. K. Gupta, PCCF, Tripura Forest Department for the permission required for inventory of field data. Thanks are due to Samir Kumar Debnath, Montosh Roy, Bal Krishan Choudhury and Jitarditya Debnath for their continuous field assistance.

REFERENCES Adhikari, D., Barik, S. K., and Upadhaya, K. 2012. Habitat distribution modelling for reintroduction of Ilex khasiana Purk., a critically endangered tree species of northeastern India. Ecol. Eng. 40: 37-43. Ashton, P. 1998. Dipterocarpus gracilis. The IUCN Red List of Threatened Species 1998:e.T31315A9624557. http://dx.doi.org/10.2305/IUCN.UK.1998.RLTS. T31315A9624557.en. Downloaded on 10 December 2015. Babar, S., Amarnath, G., Reddy, C. S., Jentsch, A., & Sudhakar, S. 2012. Species distribution models: ecological explanation and prediction of an endemic and endangered plant species(Pterocarpus santalinus L. f.). Curr. Sci. 102(8): 1157-1165. Balmford, A.and Bond, W. 2005. Trends in the state of nature and their implications for human well‐being. Ecol. Lett.8(11): 1218-1234. Buisson, L., Thuiller, W., Casajus, N., Lek, S. and Grenouillet, G. 2010. Uncertainty in ensemble forecasting of species distribution. Global Change Biol. 16(4): 1145-1157. De Siqueira, M. F., Durigan, G., De Marco, P., Jr. and Peterson, A. T. 2009. Something from nothing: Using landscape similarity and ecological niche modeling to find rare plant species. J. Nat. Conserv. 17: 25–32. Elith, J., Graham, C.H., Anderson, R.P., Dudık, M., Ferrier, S., Guisan, A., Hijmans, R.J., Huettmann, F., Leathwick, J.R., Lehmann, A. et al. 2006. Novel methods improve prediction of species’ distributions from occurrence data. Ecography. 29(2):129-151. Elith, J., Phillips, S. J., Hastie, T., Dudík, M., Chee, Y. E. and Yates, C. J. 2011. A statistical explanation of MaxEnt for ecologists. Divers. Distrib.17(1): 43-57. Ganeshaiah, K. N., Barve, N., Nath, N., Chandrashekara, K., Swamy, M. and Uma Shaanker, R. 2003. Predicting the potential geographical distribution of the sugarcane woolly

Koushik Majumdar et.al.  | 119

aphid using GARP and DIVA-GIS. Curr. Sci. 85(11): 1526-1528. Guisan, A.and Thuiller, W. 2005. Predicting species distribution: offering more than simple habitat models. Ecol. Let. 8(9):993-1009. Huete, A., Justice, C.and Van Leeuwen, W. 1999. MODIS vegetation index (MOD13). Algorithm theoretical basis document, 3, 213. Huete, A., Didan, K., Miura, T., Rodriguez, E. P., Gao, X.and Ferreira, L. G. 2002. Overview of the radiometric and biophysical performance of the MODIS vegetation indices. Remote Sens. Environ.83(1): 195-213. Jackson, C.R. and Robertson, M.P., 2011. Predicting the potential distribution of an endangered cryptic subterranean mammal from few occurrence records.  J. Nat. Conserv.19(2): 87-94. Menon, S., Choudhury, B.I., Khan, M.L. and Peterson, A.T. 2010. Ecological niche modeling and local knowledge predict new populations of Gymnocladus assamicus a critically endangered tree species. Endanger Species Res.11: 175–181. Phillips, S. J., Anderson, R. P.and Schapire, R. E. 2006. Maximum entropy modeling of species geographic distributions. Ecol. Model. 190(3): 231-259.Chicago Phillips, S. J. 2008. Transferability, sample selection bias and background data in presence‐ only modelling: a response to Peterson et al.(2007). Ecography 31(2): 272-278. Peterson T, A., Papeş, M. and Eaton, M. 2007. Transferability and model evaluation in ecological niche modeling: a comparison of GARP and MaxEnt. Ecography30(4): 550560. Sanchez, A. C., Osborne, P. E. and Haq, N. 2011. Climate change and the African baobab (Adansonia digitata L.): the need for better conservation strategies. African J.Ecol. 49(2): 234-245. Swets, J. A. 1998. Measuring the accuracy of diagnostic systems. Science 240: 1285–1293. Stockwell, D.R.B. and Peterson, A.T. 2002. Effects of sample size on accuracy of species distribution models. Ecol. Model. 148: 1–13. Thuiller, W., Richardson, D. M., Pysek, P., Midgley, G. F., Hughes, G. O.and Rouget, M. 2005. Niche-based modelling as a tool for predicting the risk of alien plant invasions at a global scale. Global Change Biol. 11(12): 2234-2250. Ward, G., Hastie, T., Barry, S., Elith, J. and Leathwick, J. R. 2009. Presence‐only data and the EM algorithm. Biometrics 65(2): 554-563. Waring, R.H., Coops, N.C., Fan, W. and Nightingale, J. M. 2006. MODIS enhanced vegetation index predicts tree species richness across forested eco-regions in the contiguous U.S.A. Remote Sens. Environ. 103: 218–226.

mmm

Trends in Frontal Areas of Plant Science Research Edited by: S. Sinha, R.K. Sinha © Department of Botany, Tripura University, 2017

Antioxidant, Total Phenol and Some Nutritional Status of Dioscorea hamiltonii Hook. F. and Dioscorea bulbifera L. Var. sativa (Hook.f.) Prain, in Tripura, NE India Bimal Debnath*, Chiranjit Paul and Amal Debnath Department of Forestry and biodiversity, Tripura University, Suryamaninagar-799022, Tripura, India *Corresponding author: [email protected]

Summary The present study was carried out to investigate the antioxidant activity (DPPH scavenging potential), total phenolic content, total protein, free amino acid, carbohydrate and moisture content of male and female tubers of Dioscorea hamiltonii and Dioscorea bulbifera var. sativa. Methanolic extracts of female tubers of both the species had the highest phenolic content and antioxidant activity in comparison to their male stalks. Direct correlation is observed in their phenolic content and antioxidant activity.Total protein, free amino acid and carbohydrate content of the female stalk of both the species werefound to be higher in comparison to male tubers.D. hamiltonii female has highest Soluble sugar content (5.92 ± 0.132 mg/gm) and D. bulbifera var. Sativa female has the lowest (2.09 ± 0.119 mg/gm). Moisture content is highest (67%) in male D. bulbifera var. Sativa and lowest (65%) in D. hamiltonii. The data furnish useful information for utilization of this underutilized wild tuber crop in Tripura. Keywords: Antioxidant activity, Dioscorea hamiltonii and Dioscorea bulbifera var. sativa Dioscorea a dioecious genus of Dioscoreaceae is an important tropical ‘Yam’ which plays a vital role among the tribal communities of Tripura by serving as a food and as a traditional medicine. The literature survey reveals that, some varieties are producing toxic tuber,although some variety produces popular tuber vegetables and food. Different ethnic groups of the State have been using several species of Dioscorea as a source of food due to their high nutrientcontent. Most of the Dioscorea species grow widely in the forest floor in adverse climatic condition. For their edible tubers the wild varieties D. bulbifera var. sativa and D. hamiltonii are quite popular to the forest dwellers of the State. D. hamiltonii is also consumed by these people to get relief from piles and burnt and D. bulbifera var. sativa enhances appetite (Teponno et al., 2007). D. bulbifera var. sativa is also used for the treatment of leprosy and tumour in Bangladesh (Mbiantchaet al., 2011).

122  |  Antioxidant, Total Phenol and Some Nutritional Status of Dioscorea hamiltoni...

Tubers of bulbifera are also used for the treatment of pig cysticercosis by the native people of western highland of Cameroon (Teponno et al., 2007). Tubers of D. hamiltonii are very popular among the tribal peoples of Tripura and is often compared with potato tubers for their taste as a vegetable. High antioxidant activity of storage protein (dioscorin) and mucilage (carbohydrate) of tubers are also reported in other species of Dioscorea (Hou et al., 2001, 2002). Although both the species of Dioscorea have long been used as food and traditional medicines, no scientific work has so far been carried out to highlight the nutritional status and anti-oxidant activity of these species. Therefore the present work was undertakento evaluate the nutritional status and anti-oxidant activity of these species.

Materials and Methods Materials The fresh tubers of D. bulbifera var. sativa and D. hamiltonii were collected from Debipur, South Tripura, India. Plants were identified using the Flora of Tripura (D.B Deb, Vol.II,1983) Flora of Assam (Kanjilal et al.,1939) and Bangladesh ethno botany online data base,. Plant Sample Extraction Tubers were cleaned, shade dried and pulverized to a powder in a mechanical grinder. Required quantity of powder was weighed and transferred tostoppard flask and treated with methanol until the powder is fully immersed. The flask was shaken every hour for the first six hours and then it was kept aside and again shaken after 24hours. This process was repeated for four days and then the extract was filtered with Whatman NO. 1 filter paper. The filtrate was collected and evaporated to dryness by using the vacuum distillation unit. Moisture Content The moisture content was determined by drying the samples in an oven at 80°C for 48hrs and was expressed on a percentage basis. Estimation of Total Phenol Content Total phenol content was estimated using the Folin-Ciocalteu method. Samples (100μl) were mixed thoroughly with 2 ml of 2% Na2CO3. After 2 min. 100 μl of Folin-Ciocalteu reagent was added to the mixture. The resulting mixture was allowed to stand at room temperature for 30 min and the absorbance was measured at 743 nm against a blank. Total phenol content was expressed as milligram per gram of methanol extract of plant samples using Gallic acid as standard. DPPH Radical Scavenging Activity The free radical scavenging activities of methanol extract of all the samples were evaluated by 1, 1-diphenyl-2-picryl-hydrazyl (DPPH) method. Different concentration of

Bimal Debnath et.al.  | 123

methanol extracts (50,100, 200, 400, 600, 800, 1000, 1200 µg/ml) was mixed with 300 µl DPPH (0.02mM). The absorbance was measured at 517 nm using a UV-VIS double beam spectrophotometer (Dynamica, DB-20, Sl. No. - 6622065) after 30 minutes of incubation at dark. Blank is prepared by mixing methanol with DPPH. Ascorbic acid was used as the reference. Scavenging of DPPH was calculated by using the formula: DPPH scavenging activity (% of inhibition) = (A0 –A1)*100/A0; where A0 is the absorbance of control reaction and A1 is the absorbance of the sample. All the sets were repeated thrice and results were recorded as average. Estimation of Total Free Amino Acids The amount of total free amino acid was estimated following the method of Yemm and Cocking (1955). In this method, 50mg fresh tubers were homogenized in 10ml of 50% aqueous ethanol with a pinch of activated charcoal. The slurry was centrifuged at 1000 rpm for 10 minutes and free amino acids were extracted in the form of a clear supernatant. The volume of supernatant was raised to 10 ml with aqueous 50% ethanol. To 1ml of the supernatant 2ml of Ninhydrine (2%, w/v in dehydrated alcohol) was added. The mixture was kept in a water bath at 75±2oC for 10 minutes and after cooling, aqueous alcohol (1:1) was added to make up the volume to 3ml. The absorbance of the violet complex was measured at 570nm on a spectrophotometer. The amount of total free amino acid was calculated with the help of a standard curve prepared from glycine and was expressed as mg of amino acids per gram fresh weight of the sample. Total Protein The total amount of protein was determined by the Lowry method (1951). In this 500mg sample crushed in 5ml of extraction buffer and centrifuged in10, 000 rpm for 30 minutes and the supernatant is used for estimation of protein. Estimation of Carbohydrate The amount of total Carbohydrate was estimated by the Anthrone method. In this method 100mg dried powder sample was taken into a test tube and hydrolyzed by keeping it in a boiling water bath for three hours with 5ml of 2.5N HCl and cool to room temperature. The material was neutralized with solid sodium carbonate until the effervescentstopped. After that the volume was made upto 100ml with distilled water and centrifuged. The supernatant was collected. To 0.5ml of the supernatant 4ml of 0.2% anthrone was added and the volume was made up to 5ml with distilled water. The mixture was heated for eight minutes in a water bath, cooled rapidly and measure the green to dark green colour at 630 nm. Estimation of Soluble Sugar The amount of total soluble sugar was estimated following the method of Yemn and Willis (1955). In this, 500mg fresh tubers were crushed in 10ml of 95% aqueous ethanol and centrifuged at 5000 rpm for 15 minutes, to the supernatantpinch of activated charcoal was

124  |  Antioxidant, Total Phenol and Some Nutritional Status of Dioscorea hamiltoni...

added and the volume was made up to 10ml, it was centrifuged at 5000 rpm for 15 minutes and the clear solution was taken. To 0.2ml of the supernatant 2.5ml of 2% anthrone was added and the volume was made up to 3ml with 95% aqueous ethanol. After 30 minutes absorbance was measured at 620nm on a spectrophotometer. The amount of total soluble sugar was calculated with the help of a standard curve prepared from glucose and was expressed as mg of soluble sugar per gram of the fresh weight of the sample. Statistical Analysis All the data were analyzed by using (Statgraphics Centurion XVII, software) and means were compared by T-test. Mean was considered to be significant when the P-value is less than 0.05 (P 35 mM) were periodically sprayed on the leaves of female and GyM plants (Table 3) prior to flowering stage. After 12 d of foliar spray of 35 mM AgNO3 solution, the converted flower buds were harvested at different stages and fixed in 1:3 acetic acid:ethanol mixture for stage specific histological study.

150  |  Organ Identity Genes and Sex Expression in Coccinia grandis (L) Voigt. Table 1:  List of degenerate primers Primer Semi quantitative RT-PCR

Primer Sequence

PI GSP2

5′-TCACTGGTGTTCGTGAGAAGCAGTCGGAG-3′

AG GSP1

5′-TCTATGTGATGCTGAAGTTGCTCTAATCG-3′

AG GSP2

5′-TAGTGGAATCTGAGGATGCCTTCTTGTATC-3′

G-3′end Identification CgPI B12 F CgPI D8 R

5′-GGAAAAAGACTGTGGGATGCNAARCAYGA-3′ 5′-TCTTTCTTGCAGATTTGGTTGNATNGGYTG-3′

CgAG A26 F 5′-GAGGAAAGATTGAAATTAAGAGAATHGARAAYAC-3′ CgAG A51 R 5′-CTCTCAGCTTAGCAGCTTCYTGYTGRTA-3′

Table 2:  List of accession numbers of the sequences of the species used for designing degenerate primers. Accession No. ACH72974.1 ABA39727.1 CAC80858.1

Species

Accession No.

Species

Prunus serotina

AAD02250.1

Cucumis sativus

Theobroma cacoa

AAS46018.1

Petunia hybrida

Malus domestica

AAY79173.1

Vitis vinifera

AAC08528.1

Cucumis sativus

ABQ51323.1

Carica papaya

ABC25564.1

Momordica charantia

ABS32248.1

Prunus persica

AEU08497.1

Corylus heterophylla

ADU15475.1

Actinidia chinensis

XP_002283924.1

Vitis vinifera

AED92817.1

Arabidopsis thaliana

Q40885.1

Petunia hybrida

AER30449.1

Passiflora edulis

CAJ44130.1

Misopates orontium

CAC28021.1

Malus domestica

CAA16753.1

Arabidopsis thaliana

CAD32764.1

Betula pendula

Results and Discussion To test whether Organ Identity Genes (OIGs) have any role in determining the sex of the developing flowers of male, female and GyM plant, OIGs (CgPI and CgAG) were isolated and an expression analysis was carried out using semi-quantitative RT-PCR. The degenerate primers based on the conserved sequences of PI (PISTILLATA) and AG (AGAMOUS), yielded ~350 bp of PISTILLATA (CgPI) and ~250 bp of AGAMOUS (CgAG) homologs through RT-PCR reaction (Fig. 3a). The percentage amino acid identity between CgPI and CUM26 (PISTILLATA homolog in Cucumber) was 98% whereas between CgAG and CUM1 (AGAMOUS homolog in Cucumber) it was 99%. The sequences for CgPI (AB859715) and CgAG (AB859714) have been deposited in DDBJ. Fragments isolated for CgPI belongs to the K box region. Whereas, the fragment isolated for CgAG belongs to the MADS-MEF2 like domain having DNA binding site, dimerization interface and putative phosphorylation site. These deduced sequences were further used for designing gene specific primers (GSPs) for expression analysis.

Kanika Karmakar et.al.  | 151

CgPI, a B class gene required for petal and stamen development, was found to be expressed in male, wild type female and GyM flower buds (Fig. 3b). Expression of CgAG, a C class gene essential for stamen and carpel development, was also noted in male, wild type female and GyM flower buds (Fig. 3b). The experimental results showed that both these genes are expressed in all developmental stages (early, middle and late) of flowers from male, female and GyM plant. While there was no significant difference of gene expression with CgAG, CgPI had a significant difference of expression across all three sexual forms during early, middle and late developmental stages (Fig. 3b). It was found that the CgPI expression is comparatively high in male flower buds than that of wild type female whereas, GyM flowers revealed an intermediate level of CgPI expression (Fig. 3b). Results of stamen-specific expression analysis of CgAG and CgPI showed a significant difference of gene expression between stamens of male, GyM-H, AgNO₃ treated female plant, rudimentary stamens of GyM-F and wild type female plant (Fig. 3c), whereas no significant changes in the level of CgAG were observed in all stamens and staminodes studied. The B and C functions genes viz. CgPI and CgAG show homology to CUM26 and CUM1 of Cucumis sativus respectively. sqRT-PCR studies suggest that like Silene latifolia (Hardenack et al. 1994), the male flowers of C. grandis had higher CgPI expression compared to wild type female and no significant difference was observed in CgAG expression of three sexual phenotypes (Fig. 3b). This observation was also true for stamen specific expression analysis (Fig. 3c). The experimental data indicate that OIGs might be under differential regulation in male, female and GyM plant leading to the development of male, wild-type female and GyM-H as well as GyM-F flowers. AgNO3 Induced Sex Modification Different concentrations (Table 3) of silver nitrate (AgNO3) solution were sprayed on the basal leaves of female and GyM plant. Flower buds of wild type female plants after application of AgNO3 solution showed enhanced growth of stamens compared to untreated plants (Fig. 4a-d). Histological studies further confirmed the dose dependent stamen growth in wild type female flowers (Fig. 4h-k). However, concentrations higher than 35 mM had lethal effect. At dosages of 30 and 35 mM of AgNO₃, the morphology of newly opened wild type female flowers was comparable to GyM-H flowers after 10-12 d of observation (Fig. 4 d-g). Interestingly, AgNO3 application also enhanced the stamen development in GyM-F flowers (Fig. 5).

152  |  Organ Identity Genes and Sex Expression in Coccinia grandis (L) Voigt.

Fig. 1:  Morphology of mature flowers of Coccinia grandis. Macroscopic view of staminate flower (a) of male plant, pistillate flower (b) of female plant, hermaphrodite (GyM-H) (c) and pistillate (GyM-F) (d) flowers of gynomonoecious (GyM) plant with petals cut open. Petals removed from staminate flower (e) of male plant, pistillate flower (f) of female plant, hermaphrodite (GyM-H) (g) and pistillate (GyM-F) (h) flowers of gynomonoecious (GyM) plant to show inner floral organs. st, stamens; c, carpels; rst, rudimentary stamens; o, ovary. Bars,1 cm. (Reproduced from Ghadge et al. 2014)

Kanika Karmakar et.al.  | 153

Fig. 6:  Floral phenotypes of silver nitrate (AgNO3) treated female plant. Complete conversion of female flower to male flower on repeated application of AgNO3 solution (30 mM).

Fig. 2:  Flower development in Coccinia grandis. Developmental stages of the flowers are assigned according to the length of the flower buds. (a) Male, (b) female and (c) gynomonoecious (GyM) flower buds. Bars, 1 cm. (Reproduced from Ghadge et al. 2014)

154  |  Organ Identity Genes and Sex Expression in Coccinia grandis (L) Voigt.

Fig. 3:  Identification and expression analysis of organ identity genes from C. grandis. (a) Isolation of CgPI and CgAG from total RNA harvested from flower buds using degenerate primers and one step RT-PCR. (b) Expression patterns of CgPI and CgAG in flower buds of male, female and gynomonoecious (GyM) C. grandis at different developmental stages (early, middle and late) by semi-quantitative RT-PCR. (c) Stamen-specific expression patterns of CgPI and CgAG from flowers (late developmental stage) of male, female, hermaphrodite (GyM-H) and pistillate (GyM-F) of gynomonoecious (GyM) and converted flowers from AgNo3 treated plants. Error bars are standard errors and asterisks denote significant (P < 0.05) differences, when tested with Single factor ANOVA. Table 3:  Sex modification in female flower of Coccinia grandis after treatment with different doses of silver nitrate AgNO3 conc. Tested

No. of sprays (7 days apart)

Effect

Days required for modification of sex after first spray

Days required for reversion to normal female flower after second spray

20 mM

2-3

Incomplete development of stamens from staminodes. Ectopic expression also occurs.

15 – 20 days

10 - 12 days

25 mM

2-3

Staminodes convert into stamens.

15 - 20 days

10 - 12 days

30 mM

1-2

Complete conversion of staminodes into stamens (100 %). Rare sex reversal is also observed after 3 exposures.

10-12 days

15 – 18 days

35 mM

1

Complete conversion of staminodes into stamens (100 %).

10-12 days

12- 15 days

>35 mM

1

Lethal

—

—

Kanika Karmakar et.al.  | 155

Fig. 5:  Effects of silver nitrate (AgNO₃) solution on flower development of gynomonoecious (GyM) plant. (a-d) Longitudinal sections of flowers at different developmental stages from silver nitrate treated gynomonoecious (GyM) plant (after spraying of 35 mM silver nitrate solution). p, petals; s, sepals; c, carpels; st, stamens; rst, rudimentary stamens; o, ovary. Bars: (a) 1 cm; (b, c, d) 2 mm.

Fig. 4:  Effects of silver nitrate (AgNO3) solution on female plant. (a-c) are the pictures of female flowers after spraying of AgNO3 solution showing gradual enhanced stamen growth. Magnified view of stamens in (d) pistillate flowers of AgNO3 treated female plant and (e) hermaphrodite (GyM-H) flowers of gynomonoecious (GyM) plants. Scanning electron micrographs of top view of (f) pistillate flowers from AgNO3 treated female plant and (g) hermaphrodite (GyM–H) flowers of gynomonoecious (GyM) plants. Petals and sepals have been removed to better view sexual structures. Longitudinal sections (h-k) at various developmental stages of flower buds from silver nitrate treated female plant (after spraying of 35 mM silver nitrate solution). p, Petals; s, sepals; c, carpels; st, stamens; o, ovary. Bars, (f), 300μm; (g), 1mm; (h, i), 1mm; (j, k), 2mm. (Reproduced from Ghadge et al. 2014)

156  |  Organ Identity Genes and Sex Expression in Coccinia grandis (L) Voigt.

Phenomenon of silver nitrate stimulated stamen development in female plants of C. grandis mimics the pathway of stamen development in GyM plants. Y chromosome is absent in both of these sexual phenotypes and pollens of converted flowers of AgNO3 treated female plant are sterile in nature like the pollens of GyM-H flowers. This suggests that stamen development is induced in wild type female by an unknown pathway which is independent of Y-mediated mechanism as was reported in Silene latifolia (Law et al. 2002). The occurrence of complete sex reversal of female is rare (Fig. 6) but it shows that the gynoecium growth is completely blocked at the primordial stage. This suggests that even in absence of Y linked SuF locus gynoecium suppression is possible in the changed environment. However, silver nitrate effect is a transient event and normal female flower develops after a period of 15-20 days. This may be due to the fact that the effective AgNO3 concentration below threshold level can not impede the molecular mechanism leading to the formation of gynoecium with arrested stamen growth. This also depicts that AgNO3 at an optimum concentration stimulates stamen development in wild type female and GyM-F of C. grandis. This is possible only if the interference in male differentiation pathway of wild type female and GyM-F flower is completely blocked, that results in subsequent promotion of stamen development. In such a condition, possibility of the presence of male repressive factor in untreated plants and its de-repression by AgNO3 molecule in treated wild type female and GyM-F cannot be ruled out. Evidence from this study indicates that gynoecium suppression even in absence of Y-linked SuF is possible. The absence of Y chromosome and the characteristic development of stamens in hermaphrodite plants of GyM and modified female flowers not only indicate the possibilities of the presence of stamen promoting factor (SPF) elsewhere in the genome but it also suggests that stamen promotion is not absolutely Y chromosome specific.

Acknowledgements The first author acknowledges research fellowship obtained from UGC and DBT, Govt. of India, for financial support during the tenure of this work. Authors are also grateful to Dr. Anjan kumar Banerjee, Associate Professor, IISER Pune, for providing all laboratory facilities to carry out this work.

REFERENCES Abràmoff, M.D., Magalhães, P.J. and Ram, S.J. 2004.Image Processing with ImageJ. Biophotonics International 11:36–42. Ainsworth, C., Parker, J. and Buchanan-Wollaston, V. 1998. Sex determination in plants. Current Topics in Developmental Biology 38:167–223. Ainsworth, C. 2000. Boys and girls come out to play: the molecular biology of dioecious plant. Annals of Botany 86:211–221. Bhowmick, B.K., Jha, T.B. and Jha, S. 2012. Chromosome analysis in the dioecious cucurbit Coccinia grandis (L.) Voigt. Chromosome Science 15:9-15.

Kanika Karmakar et.al.  | 157

Beyer, E.M. 1976. Silver ion: a potent antiethylene agent in cucumber and tomato. Hort Science 11:195–196. Bowman, J.L., Smyth, D.R. and Meyerowitz, E.M. 2012. The ABC model of flower development: then and now. Development 139:4095-4098. Bhaduri, P.N. and Bose, P.C. 1947. Cyto–genetical investigations in some common cucurbits, with special reference to fragmentation of chromosomes as a physical basis of speciation. Journal of Genetics 48:237–256. Brunner, A. M., Rottmann, W. H., Sheppard, L. A., Krutovskii, K., DiFazio, S. P., Leonardi, S. and Strauss, S. H. 2000. Structure and expression of duplicate AGAMOUS orthologues in poplar. Plant Molecular Biology 44: 619-634. Chaidamsari, T., Samanhudi, Sugiarti, H., Santoso, D., Angenent, G. C. and de Maagd, R. A. 2006. Isolation and characterization of an AGAMOUS homolog from cocoa. Plant Science 170:968-975. Chailakhan, M.K. 1979. Genetic and hormonal regulation of growth, flowering and sex expression in plants. American Journal of Botany 66:717–736. Coen, E. S. and Meyerowitz, E. M, 1991. The war of the whorls: genetic interactions controlling flower development. Nature 353: 31-37. Charlesworth, D. 2012. Plant sex chromosome evolution. Journal of Experimental Botany64 (2):405-420. Deb, D.B. 1981. The Flora of Tripura. Vol I. Today and tomorrow’s publ. New Delhi. pp. 251-267. Dellaporta, S.L. and Calderon-Urrea, A. 1993. Sex determination in flowering plants. ThePlant Cell 5:1241–1251. Farbos, I., Veuskens, J., Vyskot, B., Oliveira, M., Hinnisdaels, S., Aghmir, A., Mouras, A. and Negrutiu, I. 1999. Sexual dimorphism in white campion: deletion on the Y chromosome results in a floral asexual phenotype. Genetics 151:1187–1196. Ferrario, S., Immink, R. G. and Angenent, G. C. 2004. Conservation and diversity in flower land. Current Opinion in Plant Biology 7: 84-91. Guha, A., Sinha, R. and Sinha, S. 2004. Average packing ratio as a parameter for analyzing the karyotypes of dioecious cucurbits. Caryologia 57:117–120. Guttman, D.S. and Charlesworth, D. 1998. An X-linked gene with a degenerate Y-linked homologue in a dioecious plant. Nature, 393:263–266. Hardenack, S., Ye, D., Saedler, H. and Grant, S. 1994. Comparison of MADS box gene expression in developing male and female flowers of the dioecious plant white campion. The Plant Cell 6:1775–1787. Hossain, A. M., Islam, M. and Ali M. 1996. Sexual crossing between two genetically female plants and sex genetics of kakrol (Momordica dioica Roxb.). Euphytica90:121-125. Jack, T. 2004. Molecular and genetic mechanisms of floral control. The Plant Cell 16:S1-17.

158  |  Organ Identity Genes and Sex Expression in Coccinia grandis (L) Voigt.

Kumar, L.S.S. and Deodikar, G.B. 1940. Sex chromosomes of Coccinia indica Wight and Arn. Current Science9:128–130. Kumar, V., Parvatam, G. and Ravishankar, G.A. 2009 AgNo3 – a potential regulator of ethelene activity and plant growth modulator. Electronic Journal of Biotechnology 12(2):1-15. Kumar, L.S.S. and Vishveshwaraiah, S. 1952. Sex mechanism in Coccinia indica Wight and Arn. Nature170:330–331. La’nnenpa”a”, M., Parkkinen, S., Ja”ryvimen, P., Lemmetyinen, J., Vepsa”la”men, S., Savola, T., Keinonen, K., Keina”nen, M. and Sopanena, T. 2005. The expression and promoter specificity of the birch homologs for PISTILLATA/GLOBOSA and APETALA3/DEFICIENS. Physiologia Plantarum 125: 268-280. Lazarte, J.E. and Garrison, A. 1980. Sex modification in Asparagus officinalis L. Journal of the American Society for Horticultural Science105:691–694. Law, T.F., Lebel- Hardenack, S. and Grant, S.R. 2002. Silver enhances stamen development in female white campion (Silene latifolia [Caryophyllaceae]). American Journal of Botany 89:1014–1020. Matsunaga, S., Hizume, M., Kawano, S. and Kuroiwa, T. 1994. Cytological analyses in Melandrium album: genome size, chromosome size and fluorescence in situ hybridization. Cytologia 59:135–141. Ming, R., Bendahmane, A. and Renner, S.S.2011. Sex chromosomes in land plants. Annual Review of Plant Biology 62:485–514. Mohan Ram, H. Y. and Sett, R. 1980. Induction of male flowers in a pistillate line of Ricinus communis L. by silver and cobalt ions. Planta 149:413-415 Rajput, J. C., Parulekar, Y. R., Sawant S. S. and Jamadagni, B. M. 1994. Sex modification in Kartoli (Momordica dioca Roxb.) a by foliar sprays of silver nitrate (AgNo3). Current Science 66(10):779. Renner, S.S. and Ricklefs, R.E. 1995. Dioecy and its correlates in the flowering plants. American Journal of Botany, 82:596–606. Roy, R.P and Roy, P.M. 1971. Mechanism of sex determination in Coccinia indica. Journal of Indian Botanical Society 50:391–400. Sanwal, S.K., Kozak, M., Kumar, S., Singh, B. and Deka, B.C. 2011. Yeild improvement through female homosexual hybrids and sex genetics of sweet gourd (Momordica cochinchinensis Spreng.). Acta Physiol Plant 33:1991-1996. Sousa, A., Fuchs, J. and Renner, S.S. 2012. Molecular cytogenetics (FISH, GISH) of Coccinia grandis: A ca. 3 myr- old species of Cucurbitaceaewith the largest Y/autosome divergence in flowering plants. Cytogenetic and Genome Research, 139(2):107-118. Stankovic, L. and Prodanovic, S. 2002. Silver nitrate effects on sex expression in cucumber (Cucumis sativus). Acta Horticulturae, 579:203–206. Vander Linden, G. C., Vosman, B. and Smulders, M. J. M. 2002. Cloning and characterization

Kanika Karmakar et.al.  | 159

of four apple MADS box genes isolated from vegetative tissue. Journal of Experimental Botany 53: 1025-1036. Westergaard, M. 1940. Studies on cytology and sex determination in polyploidy forms of Melandrium album. Dansk Botanisk Arkiv 10:1–131. Westergaard, M. 1958. The mechanism of sex determination in dioecious flowering plants. Advances in Genetics, 9:217–281. Yao, J. L., Dong, Y. H. and Morris, B. A. M. 2001. Parthenocarpic apple fruit production conferred by transposon insertion mutations in a MADS-box transcription factor. Proceesings of the National Academy of Sciences USA 98: 1306-1311. Yampolsky, C. and Yampolsky, H. 1922. Distribution of the sex forms in the phanerogamic flora. Bibliography of Genetics 3:1–62.

mmm

Trends in Frontal Areas of Plant Science Research Edited by: S. Sinha, R.K. Sinha © Department of Botany, Tripura University, 2017

Bamboo Resources and Population Dynamics of Two Different Etho-ecological Areas in West District of Tripura Sunita Debbarma1, Surajit Basak2, Sangram Sinha1 and Rabindra Kumar Sinha1 Cytogenetics and Plant Biotechnology Laboratory, Department of Botany1 Department of Molecular Biology and Bioinformatics Lab. 2, Tripura University Suryamaninagar-799022, Tripura. Corresponding author: [email protected]

Summary Bamboo is one of the fast growing species with versatile uses. Different species of bamboo are found growing wild throughout the state of Tripura. A comparative documentation work on bamboo population in two different etho-ecological areas of west Tripura district was carried out. The study revealed differences in species diversity and their distribution pattern including growth forms in terms of number of clusters as well as number of culms per cluster in an area. Distribution and population dynamics of bamboo resources were significant in tribal dominated areas. Present study highlights etho-ecological information with regard to bamboo species diversity and conservation along with their sustainable uses. Keywords: Bamboo diversity, Bamboo population, etho-ecological, ADC (Autonomous District Council) Tripura is one of the hilly states of Northeast India with an geographical area of 10,491.69 sq.km and inhabited by 19 different indigenous tribes along with other comunities like Manipuri and Bengalis each having different cultural heritage (Dev Verman 1986). Total forest area of Tripura is ~ 60% of which bamboo represents 14.92% (Naithani 2008, Gupta 2008). Bamboo is one of the economically important plants of Tripura growing wild throughout the state with its versatile uses (Deb 1983). A survey work was under taken at two different etho-ecological areas of Mohanpur sub-division in West District of Tripura. The present work aims to document bamboo populations and their distribution patterns in two Grampanchayates of Mohanpur sub-division inhabited and represented by two different ethnic communities. Present study also highlights etho-ecological information with regard to bamboo species diversity and conservation along with their sustainable uses (Tewari, 1992).

162  |  Bamboo Resources and Population Dynamics of Two Different Etho-ecological Areas...

Materials and Methods Selected etho-ecological areas of Mohanpur sub-division of west Tripura District were selected for investigation of Bamboo populations and their diversity (Fig.1). Several field trips were made to identify Bamboo growing areas and conduct survey activities. The work is primarily aimed to generate information on Bamboo diversity and its growth status in two selected Grampanchayats namely Bijoynagar and Gamchakobra having geographical areas of 8sq.km and 5.8sq.km respectively. Gamchakobra Grampanchayat is a TTAADC area (Tripura Tribal Autonomous Area District Council) predominantly inhabited by tribal population whereas Bijoynagar Grampanchyat represents nontribal area. During the present investigation six (6) villages were selected under each Grampanchayats. The survey work mainly recorded the location with GPS data, number of Bamboo species, number of bamboo clusters in an area, number of Bamboo culms per cluster along with range and age of the clusters. Experimental data generated on present bamboo population studies were recorded in tabular form (Table 3). A suitable statistical analysis was carried out (Levene 1960) to compare the distribution pattern of bamboo species in the two etho-ecological areas. Various uses of bamboo raw material in the tribal dominated ADC area were also recorded and documented.

Results and Discussion Bamboo populations of two distinct etho-ecological areas of Monhanpur subdivision of west Tripura District revealed the differences in terms of its species diversity and the number of bamboo cluster. As many as 10 different bamboo species under four different genera were found growing in the present study areas (Tables1and 2). Species like Bambusa balcooa Roxb., Bambusa cacharensis Majumder, Bambusa pallida Munro., Bambusa vulgaris Schard ex Wendl., Melocanna baccifera (Roxb.) Kurz., Thyrsostachys oliveri Gamble were found growing in almost all the villages of both the Grampanchayates. Species like Bambusa polymorpha Munro., Bambusa tulda Roxb., Dendrocalamus hemiltonii Ness and Ann. Ex Munro, Dendrocalamus strictus (Roxb.) Ness. were also found growing in villages of Gamchakobra though in lesser numbers. However, these were totally absent in Bijoynagar Grampanchayat. Bambusa cacharensis was found to be the most prevalent species followed by Bambusa vulgaris at Gamchakobra ADC villages. Solid Bamboo species with solid internodes like T. oliveri was found abundantly growing in Bijoynagar Grampanchayat. Mono culture practices of T. oliveri is very common in Mohanpur sub-division due to its high economic return and market value (Fig.2a).Relatively more diversity in bamboo species was observed at tribal dominated Gamchakobra village (Figures.2b and 3), in spite of conventional and regular utilization of bamboo species by the tribal people for their daily needs. Present findings indicate the existence of sustainability of bamboo production and diversity in tribal dominated areas of Gamchakobra. Moreover, a comparative study of the number of bamboo clusters in two different etho-ecological areas reveled to be significant according to Levene’s Test for equality of Variances (Table 3). Diverse use of bamboo resources as vegetables, and preparation of different household items by the

Sunita Debbarma et.al.  | 163

tribal ethnic group of Gamchakobra were documented (fig.4 a-f). Present observation corroborated with previous records (Ranjan 2004) indicating daily needs and significance of bamboo raw materials for day to day life of rural people of this region. Table 1:  Bamboo population at Gamchakobra Grampanchayat (ADC) of Mohanpur Sub-division, West Tripura Name of the villages

1.Gamsakobra

2.Jagatbandhu Para

3.Rabia Narayan Para

4.Purba Ramnagar

Name of the Bamboo species

No. of Bamboo cluster in an area

No. of Bamboo culm per cluster (range)

Age of the cluster (range) in years

LAT.

LONG.

ALT.

24º54’53.2’’

91º21’23.1’’

30m

24º54’12.2’’

91º21’14.4’’

36m

24º53’40.9’’

91º21’00.2’’

28m

24º55’06.8’’

91º20’30.2’’

34m

i. B. balcooa

10

40-70

10-12

ii. B. cacharensis

56

25-290

10-25

iii. B. pallida

03

40-80

8-12

iv. B. vulgaris

25

28-250

10-15

v. M. baccifera

01

170

6-7

vi. T. oliveri

02

40-60

5-7

vii. B. Polymorpha

07

20-130

12-17

viii. D. hemiltonii

01

100

5-6

ix. B. tulda

08

100-150

10-15

i. B. balcooa

08

40-70

7-10

ii.B. cacharensis

51

25-130

12-16

iii. B. pallida

02

10-15

2-5

iv. B. vulgaris

28

25-80

10-15

v. M. baccifera

01

220

7-8

vi. T. oliveri

01

30

3-4

i. B. balcooa

11

40-250

15-20

ii. B. cacharensis

46

30-120

20-22

iii. B. pallida

02

45-80

6-8

iv. B. vulgaris

32

40-90

8-10

v. M. baccifera

01

230

7-8

vi. T. oliveri

02

20-28

4-6

i. B. balcooa

12

50-200

20-25

ii. B. cacharensis

44

30-300

20-28

iii. B. pallida

03

10-25

5-7

iv. B. vulgaris

45

20-80

6-9

v. M. baccifera

01

200

6-7

vi. T. oliveri

01

25

3-4

GPS Data

164  |  Bamboo Resources and Population Dynamics of Two Different Etho-ecological Areas... 5.Karuja

6.Ramkrishna Para

i. B. balcooa

10

20-50

6-15

ii. B. cacharensis

49

20-90

6-10

iii. B. pallida

-

-

-

iv. B. vulgaris

37

20-250

15-20

v. M. baccifera

01

180

5-6

vi. T. oliveri

01

45

4-5

vii. D. strictus

07

20-30

8-12

-

-

-

i. B. balcooa

-

20-350

20-25

iii. B. pallida

03

12-17

3-4

iv. B. vulgaris

40

40-150

10-15

v. M. baccifera

01

220

8-9

-

-

-

ii. B. cacharensis

vi. T. oliveri

24º54’56.8’’

91º20’46.1’’

15m

24º54’05.3’’

91º20’46.3’’

19m

Table 2: Bamboo population at Bijoynagar Grampanchayat (Non-ADC) of Mohanpur Sub-division,West Tripura. Name of the villages

1.Bijhoynagar

2.Bijoynagar Uttarpara

3. Bjoynagar Sarkarpara

Name of the Bamboo species

No. of Bamboo cluster in an area

No. of Bamboo culm per cluster (range)

Age of the cluster (range) in years

i. B. balcooa

07

50-150

12-25

ii. B. cacharensis

02

25-40

20-25

iii. B. pallida

01

57

10-15

iv. B. vulgaris

02

15-20

10-18

v. M. baccifera

-

-

-

vi. T. oliveri

27

16-90

10-15

i. B. balcooa

06

15

20-25

ii. B. cacharensis

03

100-120

10-12

iii. B. pallida

02

6-10

3-6

iv. B. vulgaris

04

10-18

8-10

v. M. baccifera

01

150

8-9

vi. T. oliveri

18

20-150

10-12

i. B. balcooa

05

28-68

10-12

ii. .B. cacharensis

04

35-85

10-12 4

iii. B. pallida

01

8

iv. B. vulgaris

-

-

-

v. M. baccifera

01

100

6-8

vi. T. oliveri

22

21-56

10-12

GPS Data LAT.

LONG.

ALT.

24º01’35.6’’

91º23’18.43’’

32m

24º00’51.7’’

91º23’’19.2’’

28m

24º00’53.3’’

91º23’69.8’’

30m

Sunita Debbarma et.al.  | 165 4. Bijoynagar Malakar para

i. B. balcooa

6. South Bijoynagar

25-55

20-25

-

-

-

iii. B. pallida

02

70-80

7-15

iv. B. vulgaris

05

25-55

10-17

v. M. baccifera

01

270

10-12

ii. B. cacharensis

5.Madhya Bijoynagar

05

vi. T. oliveri

-

-

-

i. B. balcooa

07

75-120

20-25

ii. .B. cacharensis

-

-

-

iii. B. pallida

-

-

-

iv. B. vulgaris

02

8-12

6-7

v. M. baccifera

01

40

3-4

vi. T. oliveri

27

25-70

7-8

i. B. balcooa

04

25-70

20-25

ii. B. cacharensis

04

25-50

8-10

iii. B. pallida

01

23

5-6

iv. B. vulgaris

03

10-27

6-8

v. M. baccifera

-

-

-

vi. T. oliveri

-

-

24º00’42.3’’

91º23’27.7’’

22m

24º00’23.7’’

91º23’26.2’’

33m

24º00’03.6’’

91º23’28.1’’

35m

-

Table 3: Comparative Bamboo population in two different Grampanchayats of Mohanpur Sub-Division of west Tripura District Name of the Bamboo species

Name of the Grampanchayats 2

Gamchakobra (5.8 km ) (ADC area)

Biyoynagar (8 km2) (Non- ADC area)

Total Number of Bamboo clusters in an area

No. of bamboo cluster Mean± SD

Number of Bamboo culms per cluster (range)

Total Number of Bamboo clusters in an area

No. of bamboo cluster Mean ± SD

Number of Bamboo culms per cluster (range)

Bambusa balcooa

51

08.50±03.99

40-250

34

05.67±01.11

15-150

Bambusa cacharensis

246

41.00±18.73

20-350

13

02.17±1.67

25-120

Bambusa pallida

13

02.17±1.06

40-80

07

01.17±0.72

57-80

Bambusa vulgaris

207

34.7±6.85

20-250

16

02.67±1.57

15-55

Meloccana baccifere

06

203.33±38.29

1220

04

93.33±70.15

560

07 01.17±0.69 40-60 94 Tyrsostachys oliveri Independent Samples Test : Levene’s Test for Equality of Variances

15.67±11.50

16-150

166  |  Bamboo Resources and Population Dynamics of Two Different Etho-ecological Areas... F-value

9.386

P-value

0.012*

Significant at 0.05

Fig. 3:  Distribution pattern of bamboo species in two Grampanchayats of Mohanpur Sub-Division with respect to number of bamboo cluster.

Fig. 1:  Illustrative map of Mohanpur Sub-Division of Tripura (Non- ADC area & ADC area). The symbol represent bamboo population surveyed area. 2a & b. Bamboo population sites.

Sunita Debbarma et.al.  | 167

Fig. 4: (a-f) Tribal household bamboo items: (a) Cattle musk, (b) Poultry cage, (c) Rice container “Langa”,(d) Bamboo shoot vegetable, (e) “Kiship”- a fan and (f) Bamboo hubble-bubble-the “Dapa”.

Acknowledgements Authors are thankful to the Department of Biotechnology (DBT) & University Grants Commission, (UGC) for providing financial support to the Department of Botany, Tripura University, Suryamaninagar-799022, India. We also thank to Block Development office, Mohanpur Sub-Division and villagers for extending their co-operation during the work.

REFERENCES Deb, D.B., 1983. The Flora of Tripura. Today and tomorrow’s Publ., New Delhi, Dev Verman, S.B.K., 1986. The Tribes of Tripura of Dissertation. Spl. Series 1. Directorate of research publication. Govt. of Tripura, Agartala, India. 1-52. Gupta, A.K. 2008. National bamboo Mission. Aholistic scheme for development of Bamboo Sector in Tripura Ind. Forester.134(3):305-315. Levene, H. 1960. Robust testes for equality of variances. In Contributions to Probability and Statistics (I. Olkin, ed.) 278–292. Stanford Univ. Press, Palo Alto, CA. MR0120709. Naithani, H. B. 2008. Diversity of Indian bamboos with special reference to northeast India. Indian Forester. 134. 765-788. Ranjan, M.P., Iyer Nilam and Pandya Ghanshyam 2004. Bamboo and Cane. Craft of Northeast India. The Development commissioner of Handicraft, Govt. of India. Tewari, D. N. 1992.A monograph of Bamboo. International Book Distributors, Dehradun, India: 495p.

mmm

Trends in Frontal Areas of Plant Science Research Edited by: S. Sinha, R.K. Sinha © Department of Botany, Tripura University, 2017

Comparison of ISSR and SSR Markers to Study the Genetic Diversity in Curcuma spp. from Tripura Kishan Saha, Rabindra Kumar Sinha and Sangram Sinha* Cytogenetics and Plant Biotechnology Laboratory, Department of Botany, Tripura University, Suryamaninagar-799022, Tripura, India *Corresponding author: [email protected]

Summary Two DNA based Techniques, ISSR and SSR were compared to study the genetic diversity of four species of Curcuma from Tripura. 16 ISSR primers generated a total of 104 bands out of which 93 bands showed polymorphism (88.06%) with an average of 6.5 alleles per locus. In comparison to ISSR profile, 9 SSR primers produced 61 amplified bands with an average of 6.78 alleles per locus. In SSR profile 52 bands were polymorphic accounting for 82.70% polymorphism. UPGMA dendrogram cluster analyses revealed similar clustering pattern in ISSR, SSR and combined ISSR-SSR data. Cophenetic correlation coefficient between the dendrogram and original similarity matrix were highly significant both for ISSR and SSR markers. PCA led to a similar characterization. Our overall findings suggest that the combined use of ISSR and SSR data could be used to establish the relatedness and genetic diversity in between different species of Curcuma more effectively. Key words: Curcuma sp. Genetic Diversity, Inter Simple Sequence Repeats, Simple Sequence Repeats, Polymerase Chain reaction, Dendrogram, Principal Coordinate Analysis. Curcuma belonging to the family Zingiberaceae comprises ca. 80 species and shows wide spread distribution from tropical Asia to Australia and south pacific region (Skornickova et al. 2007). The highest diversity of Curcuma has been found in India and Thailand and about 40 species are indigenous to India (Velayudhan et al. 1999). The state of Tripura situated in the sub Himalayan region of North East India is one of the hotspot of Indo-Burma biodiversity region of the world (Myers et al. 2000, Mao et al. 2009). While, Deb, (1983) reported three species in this phytogeographical region, we have identified one more species C. caesia in our recent documentation. Several DNA based molecular markers are now available for assessing the genetic diversity as well as in evaluating the inter and intraspecific genetic relationship of these, RAPD, ISSR, SSR and AFLP etc. are

170  |  Comparison of ISSR and SSR Markers to Study the Genetic Diversity in Curcuma...

being used regularly for genetic diversity assessment because a thorough knowledge of the level and distribution of genetic variation is essential for conservation of germplasms (Dreisigacker et al. 2005, Sharma et al. 2008, Naiket al. 2010 Das et al. 2011). Micro satellite or Simple Sequence Repeat (SSR) markers provide endless high-throughput applications in molecular breeding by providing accurate, cost effective and reliable genotyping (Siju et al. 2010). In higher plants Inter Simple Sequence Repeat or ISSR markers are also frequently used because they are known to be abundant, very reproducible and highly polymorphic (Zietkiewicz et al. 1994, Bornet and Branchard 2004). Moreover, the ISSR based molecular fingerprinting technique is a good alternative to AFLP when tested on Curcuma species (Syamkumar and Sasikumar 2007, Singh et al. 2012). An attempt has therefore been made to determine the effectiveness of ISSR and SSR markers in assessing the genetic diversity of Curcuma species grown in Tripura.

Materials and Methods Plant Material and DNA Extraction Four different species of Curcuma, viz., C. amada Roxb., C. longa L., C. zedoaria (Christm.) Roscoe and C. caesia Roxb. found in wild state were collected from different geographical locations of Tripura (Table 1) and grown in the experimental garden of the Department of Botany, Tripura University for experimental purposes. Besides, rhizomes of one population of cultivated C. longa were also grown in the experimental garden for the present study. Total genomic DNA was extracted according to the manufacturer’s protocol (DNeasy® Plant Mini Kit-Qiagen, part no.69104). DNA concentration was determined using the Nanodrop 2000C spectrophotometer (Thermo Scientific- USA) and qualitative study was performed in 1.5% Agarose gel. Table 1: Different species of Curcuma collected from different locations of Tripura Species and populations Place of collection

Latitude and altitude Herbarium No.

Curcuma amada

Suryamaninagar, West Tripura 23°45’39.40”N, 21 m

TUH - 465

Curcuma longa1(Wild)

Jampui Hill, North Tripura

24°02’30.21”N, 570 m

TUH - 457

Curcuma longa2 (Cultivated Pop-I)

Madhupur, Sepahijala

23°43’28.96”N, 24 m

TUH - 486

Curcuma caesia

Suryamaninagar, West Tripura 23°45’43.13”N, 22 m

TUH - 485

Curcuma zedoaria

Baramura hill, West Tripura

TUH - 459

23°48’41.24”N, 70 m

ISSR Analysis PCR amplification was performed with 16 ISSR primer (Table 2) using mixture of 25 µl containing genomic DNA (30 ng/µl), dNTPs 10mM (Qiagen), 25 mM of MgCl2 (Sigma), 10X Taq buffer (Sigma), 10µM primer and 2.5 Unit of Taq Polymerase (Sigma). PCR amplification was carried out in a Thermal Cycler (Applied Biosystems, Gene Amp* PCR System 9700). PCR was performed at an initial temperature of 94oC for 5 minutes for complete denaturation. The second step consisted of 44 cycles having three ranges of

Kishan Saha et.al.  | 171

temperature: 94oC for 1 minute, 50oC for 1.30 minutes for primer annealing and 72oC for primer extension, followed by 72oC for 10 minutes. All amplified reactions were repeated at least two times for confirmation. The amplified products were visualized using 2% Agarose gel electrophoresis and scanned through a gel documentation system. SSR Analysis Nine SSR markers were chosen (Table 2) for the study of genetic diversity in four different Curcuma species. PCR amplification was performed using a mixture of 25 µl containing genomic DNA (30 ng/µl), dNTPs 10mM (Qiagen), 25 mM of MgCl2 (Sigma), 10X Taq buffer (Sigma), 10µM of each of forward and reverse primers and 2.5 Unit of Taq Polymerase (Sigma). PCR amplification was carried out in a Thermal Cycler (Applied Biosystems, Gene Amp* PCR System 9700). PCR was performed at an initial temperature of 94oC for 5 minutes for complete denaturation. The second step consisted of 35 cycles having three ranges of temperature: 94oC for 1 minute, 1 minutes with varied temperatures as per the melting temperature of SSR primers and 72oC for primer extension, followed by 72oC for 20 minutes. All amplified reactions were repeated at least two times for confirmation. The amplified products were visualized using 2% Agarose gel electrophoresis and scanned through a gel documentation system. Table 2: List of SSR and ISSR Primers Primer Code CBT03 CBT04 CBT05 CBT08 CBT09 Clon04 Clon08 Clon10 Clon09

Sequence (5’-3’)

Primer Code

Sequence (5’-3’)

F:ATCAGCAGCCATGGCAGCGAC

HB12

CACCACCACGC

R:AGGGGATCATGTGCCGAAGGC

811

GAGAGAGAGAGAGAGAC

F:ACCCTCTCCGCCTCGCCTCCTC

814

CTCTCTCTCTCTCTCTA

R:CTCCTCCTCCTGCGACCGCTCC

825

ACACACACACACACACT

F:CTCTGTCTCCTCCCCCGCGTCG

807

AGAGAGAGAGAGAGAGT

R:TCAGCTTCTGGCCGGCCTCCTC

872

GATAGATAGATAGATA

F:CAGCAGATTTTTGCTCCG

P6

CCACCACCACCACCA

R:GTCGCGTTCGTGGAAAT

UBC 873

GACAGACAGACAGACA

F:AGGGGGCAGTGGAGAG

ISSR 2

ACACACACACACACACTA

R:ACGTTCCTGCACTTGACG

827

ACACACACACACACACCG

F:TAAATTTGCGAAGGCAATCC

UBC 842

GAGAGAGAGAGAGAGAYG

R:CCGCAGAGGAATTTGAAGAG

844

CTCTCTCTCTCTCTCTAC

F:CCGGTGAGGGTGATATCTTG

P3

AGAGAGAGAGAGAGAGTG

R:AAGCTCAAGCTCAAGCCAAT

UBC 808

AGAGAGAGAGAGAGAGC

F: GTGGGAATTGGATTGCTCTC

UBC 852

TCTCTCTCTCTCTCTCCGA

R: GAGAACTCCCCATGCTTCAG

816

CACACACACACACACAT

F:GGAGGAGGCAGTTGATTTGT R: GCTTTGGTGGCTAGAGATGC

172  |  Comparison of ISSR and SSR Markers to Study the Genetic Diversity in Curcuma...

Data Collection and Statistical Analysis The amplified fragments obtained from the SSR and ISSR profiles were visually analysed and scored as binary data (1/0 for the presence or absence) of each fragment. Only clear and reproducible bands were taken into account; the intensity of the bands was not considered. The numbers of polymorphic and monomorphic bands were determined for each primer in all species studied. Polymorphic Information Content (PIC) was computed using the formula PIC = 1 – ∑pi2, where pi is the frequency of ith allele at a given locus (Roldan-Ruiz et al. 2000) and Marker Index (MI) was calculated according to the formula Powell et al.(1996). The number of observed alleles, mean number of effective alleles (Kimura et al.1964), Nei’s (Nei 1973) gene diversity index (H) and Shannon index (Lewontin 1972) were calculated using the POPGENE software (Yehet al.1997). The level of similarity between the species was established using DICE’s (Dice1945 coefficients. Similarity coefficients were used to construct the dendrogram applying with the SIMQUAL, SAHN (sequential agglomerative, hierarchial and nested) (Sneath and Sokal 1973) TREE procedure by UPGMA clustring algorithm (Sokal and Michener 1958) through the NTSYS Pc (Numerical Taxonomy System, 2.21q version) (Rohlf 2002). Cophenetic values were calculated by using COPH procedure of each combination. Original matrices were compared by applying Mantel test (Mantel 1967) in the option of MXCOMP in NTSYS Pc 2.21q program by implementing Dice coefficient. The correlation coefficients calculated with Mantel test enables the finding of correlation between similarity matrices and phenetic trees obtained from cophenetic values to measure goodness of fit (Lapointe and Legendre 1992). Further, Principal Coordinate Analysis (PCA) was performed with modules of STAND, CORR and EIGEN of NTSYS pc using the Euclidean distances with the help of NTSYS pc-2.21q software.

Results and Discussion ISSR Band Pattern The PCR amplification using ISSR primers gave rise to different number of DNA fragments depending upon their simple sequence repeat motifs (Fig. 1). The 16 ISSR primers produced 104 bands with an average of 6.5 per primers (Table 3). Of which 93 bands were polymorphic accounting for 88.06% polymorphism with 1.51 effective numbers of alleles. The number of bands ranged from 3 (UBC 808) to 11 (HB12) and varied in size. The percentage of polymorphism ranged from 66.66 to 100, whereas the highest and lowest PIC value for ISSR primers were recorded in UBC873 (0.46) and 807 (0.30) with an average of 0.36.The MI value on the other hand, ranged from 19.55 (P6) to 46.00 (UBC 873). The genetic diversity among the species at interspecific levels were screened using the POPGENE software and the average values of the observed number of alleles (na), Nei’s gene diversity index(h) and the mean Shannon index (I) were found to be 1.87, 0.31 and 0.47 respectively (Table 7).

Kishan Saha et.al.  | 173 Table 3: Degree of polymorphism and polymorphic information content for ISSR primers in four species of Curcuma. Markers ISSR

Combined (SSR+ISSR) analysis

Primers code

NSB

PB

MB

PPB

PIC

MI

HB12

11

10

1

90.90

0.32

29.09

811

6

5

1

83.33

0.35

28.89

814

6

5

1

83.33

0.40

33.33

825

9

9

0

100.00

0.41

40.89

807

8

7

1

87.50

0.30

26.25

872

6

5

1

83.33

0.27

22.22

P6

6

4

2

66.66

0.29

19.55

UBC 873

8

8

0

100.00

0.46

46.00

ISSR2

6

6

0

100.00

0.43

42.67

827

6

5

1

83.33

0.35

28.89

UBC 842

7

7

0

100.00

0.37

36.57

844

5

5

0

100.00

0.42

41.60

P3

4

3

1

75.00

0.28

28.00

UBC808

3

2

1

66.66

0.32

32.00

UBC852

4

4

0

100.00

0.44

44.00

88.88

0.41

40.89

88.06

0.36

33.80

85.39

0.35

30.81

816

9

8

1

Total

104

93

11

Avg./Primer

6.5

5.8

Total

165

145

20

Avg./Primer

NSB Number of score band PB polymorphic bands, MB monomorphic bands PPB Percentage polymorphic band PIC average polymorphic information content for polymorphic bands, MI marker index = POL (%) X PIC. Table 4:  Similarity coefficient among the species of Curcuma ISSR

C. amada

C. longa1

C. amada

1.000

C. longa1

0.579

1.000

C. longa2

C. zedoaria

C. longa2

0.582

0.897

1.000

C. zedoaria

0.384

0.396

0.424

1.000

C. caesia

0.569

0.509

0.459

0.612

C. caesia

1.000

174  |  Comparison of ISSR and SSR Markers to Study the Genetic Diversity in Curcuma...

Fig. 1:  ISSR fingerprints of four species of Curcuma. M- 1kb plus (Qiagen) ladder, L1-L5 represents Curcuma amada, Curcuma longa1, Curcuma longa2, Curcuma zedoaria and Curcuma caesia

A dendrogram based on UPGMA analysis showed the genotype C.amada and C.longa belong to one cluster and that of C.zedoaria and C.caesia in a separate cluster (Fig. 3a). Dice’s coefficient showed that C.longa1 and C.longa2 were related to each other with similarity value of 0.897 whereas the similarity value between C.zedoaria and C.caesia was found to be 0.612 (Table 4). The cophenetic correlation coefficient between original matrices with dendrogram, using Mantel test, was found to be 0.935.PCA was analysed on the basis of ISSR data indicated that the first 3 coordinate components accounted for 35.03%, 27.84% and 22.00% variation (Fig. 4d). SSR Band Pattern Nine SSR primers produced a total of 61 amplified fragments (Fig. 2) with an average of 6.78 alleles and 1.45 effective alleles per locus (Table 5). From the present experiment it was observed that out of the total amplified products, 9 bands were monomorphic and 52 bands were polymorphic and these were amplified in the range of 100-5000bp. Maximum number of bands were recorded in CBT 04, CBT08 and CBT09. However, the average number of polymorphic bands obtained per primer was 5.78. The percentage of polymorphic bands were found to be 50-100, whereas lowest and highest PIC values for SSR primers were recorded in CBT08, CBT09 (0.39), and CBT04 (0.24) with an average of 0.33. Screening of genetic diversity among the species at interspecific levels were done using the POPGENE software and the average values of the observed number of alleles (na), Nei’s gene diversity index(h) and the mean Shannon index (I) were found to be 1.78,0.27 and 0.41 respectively (Table 7).

Kishan Saha et.al.  | 175 Table 5: Degree of polymorphism and polymorphic information content for SSR primers in four species of Curcuma. Markers SSR

Primers code

NSB

PB

MB

PPB

PIC

MI

CBT 03

7

6

1

85.71

0.34

29.39

CBT 04

9

7

2

77.78

0.20

15.21

CBT 05

8

7

1

87.50

0.36

31.50

CBT 08

9

8

1

88.89

0.39

34.76

CBT 09

9

8

1

88.89

0.39

34.76

clon 04

5

4

1

80.00

0.35

28.16

clon 08

2

1

1

50.00

0.24

12.00

clon 10

5

5

0

100.00

0.35

35.20

clon 09

7

6

1

85.71

0.34

29.39

Total

61

52

9

Avg./Primer

6.78

5.78

82.72

0.33

27.82

NSB Number of score band PB polymorphic bands, MB monomorphic bands PPB Percentage polymorphic band PIC average polymorphic information content for polymorphic bands, MI marker index = POL (%) X PIC

Fig. 2:  SSR fingerprints of four species of Curcuma. M- 1kb plus (Qiagen) ladder, L1-L5 represents Curcuma amada, Curcuma longa1, Curcuma longa2, Curcuma zedoaria and Curcuma caesia

176  |  Comparison of ISSR and SSR Markers to Study the Genetic Diversity in Curcuma... Table 6: Similarity coefficient among the species of Curcuma SSR

C. amada

C. amada

1.000

C. longa1

C. longa2

C. zedoaria

C. longa1

0.684

1.000

C. longa2

0.633

0.709

1.000

C. zedoaria

0.706

0.500

0.648

1.000

C. caesia

0.536

0.464

0.475

0.708

C. caesia

1.000

The genetic relationship among the species of Curcuma showing two clusters were expressed as UPGMA dendrogram using SAHN Neighbor Joining Trees (Fig. 3b). The DICE coefficients revealed that the genotypes of C.amada and C.longa belonged to one cluster and that of C.zedoaria and C.caesia in a separate cluster. Dice’s coefficient also showed that C.amada and C.longa were related to each other with similarity value of 0.684 whereas the similarity value between C.zedoaria and C.caesia was found to be 0.708 (Table 6). Mantel test was performed for cophenetic correlation coefficient between original matrices with cophenetic values was found to be 0.6743. Based on SSR data PCA was analysed which showed that the first 3 co-ordinate components accounted for 33.35%, 26.21% and 23.58% variation (Fig. 4e). Table 7: Genetic diversity parameters in four species of Curcuma Parameters

SSR

ISSR

The number of observed alleles, na

1.78 ± 0.41

1.87 ± 0.33

The mean number of effective alleles, ne

1.45 ± 0.32

1.51 ± 0.32

The mean Nei’s gene diversity index, h

0.27 ± 0.17

0.31 ± 0.15

Shannon index, I

0.41 ± 0.24

0.47 ± 0.21

Fig. 3:  Dendrograms representing the genetic variability of Curcuma sp. using different similarity coefficient in ISSR(a), SSR(b) and Combined SSR and ISSR (c) fingerprints.

Combined (ISSR and SSR Data) he ISSR and SSR data were combined for UPGMA cluster analysis. The dendrograms T obtained from the cluster (Fig. 3c) analysis of SSR and ISSR gave similar clustering pattern of combined analysis with Dice similarity coefficient ranging from 0.44 to 0.82. The coefficient correlation between dendrogram and original similarity matrices was

Kishan Saha et.al.  | 177

also significant (r=0.958). Principal Coordinate Analysis (PCA) was performed with the complete set of SSR and ISSR data for four species of Curcuma (Fig. 4f). The first threeprinciple coordinate components accounted for 33.88%, 25.72 % and 22.34% of the total molecular variation.

Fig. 4:  Principal coordinate analysis (PCA) maps d-ISSR, e-SSR and f- Combined SSR and ISSR for the species of Curcuma.

In our recent survey we have documented four species of Curcuma from Tripura, out of which Curcuma longa is extensively cultivated throughout the state. However, C. longa was also found in the wild condition particularly in higher altitude of Jampui hills. The genetic diversity of different species of Curcuma from the North Eastern region of India was also assessed (Das et al. 2011) using ISSR fingerprinting but the formation of an independent cluster of C. caesia alone as was reported could not be ascertained in our present study even after repeated experimental trials. The presence of C. caesia and C. zedoaria in the same cluster and their similarity indices indicate that they might have arisen from a common ancestor inspite of their diverse ecological habitats. Overall, the account of genetic diversity determined by different markers systems provides different bands of information, very much essential in management of germplasm resources. The combined use of related ISSR and SSR markers could be used to determine the genetic diversity more effectively.

Acknowledgements The first author is grateful to University Grants Commission, New Delhi for providing BSR fellowship.KS is also grateful to Dr. Anjan K. Banerjee, IISER Pune for providing Laboratory facilities.

REFERENCES Bornet, B. and Branchard, M. 2004. Use of ISSR fingerprints to detect microsatellites and genetic diversity in several related Brassica taxa and Arabidopsis thaliana. Hereditas. 140:245-248. Dice, L.R. 1945. Measures of the Amount of ecologic association between species. Ecology. 26:297-302.

178  |  Comparison of ISSR and SSR Markers to Study the Genetic Diversity in Curcuma...

Deb, D. B. 1983. The Flora of Tripura. Vol- II, Today and Tomorrow’s publication, New Delhi. Dreisigacker, S., Zhang, P., Warburton, M.L., Skovmand, B., Hoisington, D., Melchinger, A.E. 2005. Genetic diversity among and within CIMMYT wheat landrace accessions investigated with SSRs and implications for plant genetic resources management. TheorAppl Genet. 101:653-661. Das, A., Kesari, V., Satyanarayana, V.M., Parida, A., Rangan, L., 2011. Genetic relationship of Curcuma species from Northeast India using PCR-based markers. Mol Biotechnol. 49:65–70. Kimura, M., and Crow, J. F. 1964. The number of alleles that can be maintained in a finite population. Genetics. 49:725-738. Lewontin, R.C. 1972. Testing the theory of natural selection. Nature. 236:181-182. Lapointe, F.J., Legendre, P. 1992. Statistical significance of the matrix correlation coefficient for comparing independent phylogenetic trees. Syst Biol. 41:378–384. Myers, N., Mittermier, R. A., Mittermier, C.G., Fonseca, G. A. B. da., and Kent, J. 2000. Biodiversity hotspots for conservation priorities. Nature, 40:853-858. Mao, A. A., Hynniewta, T.M., and Sanjappa, M. 2009. Plant wealth of northeast india with reference to ethnobotany. Indian Journal of Traditional Knowledge.8:96-103. Mantle, N. 1967. The detection of disease clustering and generalized regression approach. Cancer Res. 27:209-220. Nei, M. 1973. Analysis of gene diversity in subdivided populations. Proceedings of the National Academy of Sciences. USA. 70:3321-3323. Naik, P.K., Alam, M.A., Singh, H., Goyal, V., Parida, S., Kalia, S., Mohapatra, T. 2010. Assesment of genetic diversity through RAPD, ISSR and AFLP markers in Podophyllum hexandrum: a medicinal herb from northeastern Himalayan region. PhysiolMolBiol Plant. 16:145–148. Powell, W., Morgante, M., Andre, C., Hanafey, M., Vogel, J., Tingey, S., and Rafalski, A. 1996. The comparison of RFLP, RAPD, AFLP and SSR (microsatellite) markers for germplasm analysis. Molecular Breeding. 2:225–238. Roldan-Ruiz, I., Dendauw, J., Van Bockstaele, E., Depicker, A., and De Loose, M. 2000. AFLP markers reveal high polymorphic rates in ryegrasses (Lolium spp.). Molecular Breeding, 6:125-134. Rohlf, F. J. 2002. NTSYSpc. Numerical taxonomy system. New York: Exeter software. Skornickova, J.L.,Otakar, S., Jarolimova, V., Sabu, M., Fer, T., Travnicek, P. and Suda, J. 2007. Chromosome numbers and genome size variation in Indian species of Curcuma (Zingiberaceae). Annals of Botany, 100:505–526. Sharma, A., Namedo, A.G., Mahadik, K.R. 2008. Molecular markers: net prospects in plant genome analysis. Pharmacogn Rev. 2:23–34.

Kishan Saha et.al.  | 179

Siju, S., Dhanya, K., Syamkumar, S., Sheeja, T. E., Sasikumar, B., Bhat, A. I., Parthasarathy,V. A., 2010. Development, characterization and utilization of genomic microsatellite markers in turmeric (Curcuma longa L.). Biochemical Systematics and Ecology 38: 641–646. Syamkumar, S., and Sasikumar, B. 2007. Molecular marker based genetic diversity analysis of Curcuma species from India. ScientiaHorticulturae. 112:35-24. Singh, S., Panda, M.K., and Nayak, S. 2012. Evalution of genetic diversity in turmeric (Curcuma longa L.) using RAPD and ISSR markers. Industrial Crops and Products. 37:284-291. Sneath, P.H.A., Sokal, R.R. 1973. Numerical taxonomy - the principles and practice of numerical classification. (W. H. Freeman: San Francisco). Sokal, R. R., C. D. Michener, 1958. A statistical method for evaluating systematic relationships, Univ. Kansas. Sci. Bull. 38:1409-1438. Velayudhan, K.C., Muralidharan, V.K., Amalraj, V.A., Gautam, P.L., Mandal, S., and Kumar, D. 1999. Curcuma Genetic Resources. Scientific Monograph No. 4, National Bureau of Plant Genetic Resources, New Delhi. Yeh, F. C., Yang, R. C., Boyle, T. B. J., Ye, Z. H., and Mao, J. X. 1997. POPGENE, the user friendly shareware for population genetic analysis. Alberta: Molecular Biology and Biotechnology Centre, University of Alberta. Zietkiewicz, E., Rafalski, A., and Labuda, D. 1994. Genome fingerprinting by simple sequence repeat (SSR)-anchored polymerase chain reaction amplification. Genomics. 20:176-183.

mmm

Trends in Frontal Areas of Plant Science Research Edited by: S. Sinha, R.K. Sinha © Department of Botany, Tripura University, 2017

Diversity, Botany and Importance of Two Mucuna Species: M. bracteata DC. and M. interrupta Gagnep. in Tripura Debasree Lodh, Prasenjit Patari, Surochita Basu* and Md. Jasim Uddin Department of Botany, Tripura University, Suryamaninagar- 799 022 * Corresponding author: [email protected]

Summary Mucuna, a tropical leguminous climber with ~150 sp distributed worldwide having ~10 reported from India, has attracted attention due to L-DOPA content in its seeds, widely used in therapeutics of Parkinson’s disease. It is used in many Ayurvedic formulations as ‘Atmagupta’. Mucuna, locally known as ‘Bangphai’ is used as ornaments, in religious festivals, and plant extract is used for pain relief, cut and wound healing by the tribal community. The two target species M. bracteata and M. interrupta grow wild in West and South Tripura and according to fruit morphology can be categorized in two distinct groups. The species show remarkable diversity in habitat, growth form, vegetative and reproductive morphology and plant-arthropod interactions. M. bracteata grows as widespread populations of cover crop in natural and managed terrestrial habitats and M. interrupta grows in isolated river side populations. Here is an effort to prepare a species specific key including collection area, plant exo-morphology, leaf micro-morphology, reproductive micro-morphology, chlorophyll and phenol content; and is first report of M. interrupta from Tripura. Keywords: Diversity, growth form, interaction, reproductive morphology, chlorophyll and phenol content. The genus Mucuna Adans (fam: Leguminoseae), a tropical leguminous climber, represented by ~150 sp species of annual and perennial legumes has its centre of origin at Africa, China, Malaysia, India and West Indies (Burkill, 1966; Natarajan et al., 2012); from where it spread to other regions of the world. There are 9-15 species from India (Jaheer and Sathyanarayana, 2010; Sathyanarayana et al., 2011; Natarajan et al., 2012), five are endemic to Western Ghats and Eastern Himalaya (Leelambika et al., 2010), two are endemic to Peninsular India and M. imbricata, M. bracteata, M. macrocarpa, M. sempervirens and M. nigricans are restricted to North East region (Jaheer and Sathyanarayana, 2010). Mucuna has attracted attention due to presence of L- DOPA (L-3,4-dihydroxyphenylalanine), a non-protein amino acid precursor of the neurotransmitter dopamine in seeds, that is used

182  |  Diversity, Botany and Importance of Two Mucuna Species: M. bracteata DC. ...

for treatment of Parkinson’s disease and mental disorders (Inamdar et al., 2012; Soares et al., 2014). Mucuna is not only medicinally important; it is nutritionally valuable and can be applied to several environmental causes. It is used as cover crop, grown to improve soil nitrogen content, protect soil and restore soil fertility in regions of soil overuse and degradation. Traditionally the plant has been used against neuropathy, oedema, fever, delirium, amenorrhea, elephantiasis, constipation, ulcers etc. The seeds used as nervine tonic, astringent, aphrodisiac; the hairs of pods are vermifuge; the leaves used in treatment of ulcers, inflammation, helminthiasis and cephalagia; the roots are bitter, thermogenic, emollient, stimulant, purgative and diuretic. The bark powder mixed with dry ginger is applied over painful rheumatic joints, etc. (Natarajan et al., 2012). According to Ayurvedic Pharmacopoeia of India (2008), Mucuna is referred to as ‘Atmagupta’ having properties like rasa, guna, virya, vipaka, karma; is used in formulations like brhat, masa, taila against vatavyadhi, kampavata, klaivya, raktapitta, dustavrana, daurbalya etc. Tripura, a state of North East India, occupying 10,491.69 sq km area has high plant diversity and falls under the Indo Burma Hotspot. Biodiversity of the state is rapidly dwindling at the cost of development. Rubber plantations have been on the rise and so have been environmental concerns for soil overuse that have led to refuge in plants with soil improving capacity like Mucuna. Of the three species M. pruriens (L.) DC., M. bracteata DC. and M. nigricans (Lour.) Steud. reported from Tripura (Deb, 1981), M. bracteata is widely acclaimed as a cover crop. Reports have shown that growing Mucuna can decrease nematode population, improve physical properties of soil such as soil bulk density, soil porosity and soil resistance, making it an excellent choice for rotation or intercropping in managed plantations (Samarappuli et al., 2003; Ceballos et al., 2012). Mucuna with 2n = 22 chromosomes (Kumar and Subhramaniam 1986), has appreciable generic variability in the pinnately trifoliate leaves, axillary inflorescence, flowers, ovoid, oblong or linear fruits with irritant bristles. Propagation is both vegetative as well as seed based; however, seed is commercially important due to its L-DOPA content. Previous studies have revealed that taxonomic treatment is difficult, owing to wide geographical, climatic distribution and tremendous variability in morphological and agronomic traits (Capo-chichi, 2003; Padmesh et al., 2006). So any study on the genus requires a careful and detailed investigation of morphological and other parameters. Here is an effort to prepare a species specific key including collection area, plant exo-morphology, leaf micro-morphology, reproductive morphology, chlorophyll and phenol content for the two species under study- Mucuna bracteata DC. and Mucuna interrupta Gagnep.

Materials and Methods The two species of Mucuna, viz., M. bracteata and M. interrupta collected from two different districts, West and South of Tripura, were identified based on taxonomic key of Wilmot Dear (1992, 2010) and Flora of Tripura State (Deb, 1981) and voucher specimens submitted to Departmental Herbarium, Tripura University. Morphological attributes like internode length, leaf, flower, fruit and seed characters were accounted for. Leaf peels from apical, middle and basal portions of the sixth leaf of three plants were taken for stomata and

Debasree Lodh et.al.  | 183

trichome observations. Aceto-carmine pollen stainability and pollen size were measured; all measurements were taken under Olympus microscope. Total chlorophyll content of leaf was measured according to Arnon’s protocol (1949) and phenol content of seeds was measured using Folin-Ciocalteu colorimetric method (Waterhouse, 2003) with some modifications.

Results and Discussion Comparative studies on M. bracteata and M. interrupta show lots of variability in habitat, growth form, vegetative and reproductive morphology. The present study first reports M. interrupta from Tripura, adding a fourth to the list of Deb (1981). M. interrupta is found to grow in isolation at only five riverside areas in South Tripura, whereas M. bracteata grows wild, widespread in West Tripura and used as cover crop for management of rubber plantations and fallow land. The two species show lots of variability in habitat, growth, vegetative and reproductive morphology and can be assigned to two distinct categories based on reproductive morphology (thick textured pod like linear fruit and ellipsoid leathery fruit) and habitat (Kato et al., 2004 and Wilmot-Dear 1992). Our observations show significant difference in vegetative and reproductive exo-morphology, leaf micromorphology and biochemical characteristics of the two species (Table- 1 and Fig. 1-4). Rhombic-ovate, entire, acute tipped leaves; dense, thick robust, pendulous, unbranched inflorescence with about 18 flowers in the upper 2/3 part and 6 remnant scars in the basal part; purple keel in flower, linear fruit, ellipsoid, small dark brown seeds of M. bracteata are quite different than the ovate, entire, apiculate tipped leaves; small, pendulous, unbranched inflorescence with about 12 flowers; white keel in flower; oblong fruit; reniform, discoid, distinctly large, reddish brown seeds in M. interupta. However, there is less difference in micro-morphology as regards stomata size (255.59 µm2 and 458.11 µm2); Stomatal Index (21.45 and 28.02; Salisbury, 1927) trichome type and length (small tapering with 173.47 µm and long tapering with 482.06 µm) and pollen stainability (95% and 98%) of M. bracteata and M. interrupta respectively. There is difference in chlorophyll content of two species- 2.29 mg/g in M. bracteata and 1.27 mg/g in M. interrupta; and in phenol content in the two - 8.11mg/g DW and 7.04mg/g DW in M. bracteata and M. interrupta respectively. Multiple plant-arthropod interactions were noted in M. interrupta, two ant speciesOecophylla and Crematogaster along with Thyreocoridae bug was observed. Fruit of M. interrupta has undulating lamella that serve as domatia for ant species as also reported by Kato et al. (2004). Bats were observed to visit M. interrupta during flowering season. Thyreocoridae bugs were noted only during late flowering season with M. bracteata. M. interrupta that is restricted to riverside locations in mixed deciduous forests thrives there, as its moisture requirements are met and also the arthropod interactions provide indirect benefit to the plant in the forest (Eubanks and Styrsky 2006). M. interrupta is variously used by tribal communities of Tripura- as ‘Chabina’ by Reang tribe, the fruit extract is traditionally applied on cuts and wounds for quick

184  |  Diversity, Botany and Importance of Two Mucuna Species: M. bracteata DC. ...

healing, oil extracted from the leaves and fruits prevent rusting of iron, seeds are used as ornaments; as ‘Thunka’ by Mog people, during Buddha Purnima; as ‘Banarghila’ by Chakma community used in sprains; as ‘Rhkankhu’ by Tripuri people, who use it during marriage ceremony, as known from our survey. M. bracteata is used more as a cover crop. Table 1:  Key for M. bracteata and M. interrupta. Parameter

M. bracteata

Natural habitat

M. interrupta

Widespread, terrestrial populations; West Tripura

Isolated, wetland populations;

Rhombic-ovate, entire, acute; 56.64±3.81

Ovate, entire, acute;

South Tripura Plant exo-morphology Leaf shape and Size (cm2) 38.45±1.62 Flower colour and Size (cm) Purple; Keel- Purple; 4.95±0.07

Purple; Keel- White; 4.50±0.04

Inflorescence size (cm)

20.15±0.45

8.98±0.36

No of flower/inflorescence

18.00±1.00

12.00±1.00

No. of fruit per fruit group

9.00 ±1.00

4.00±1.00

6.07±0.36

24.24±0.65

2

Size of each fruit (cm ) No. of seed/fruit

3-4

1-2

0.47±0.01

4.57±0.13

Brown Fruit; Blackish brown seed with fade reddish brown molting

Reddish brown Fruit; Reddish brown seed with a blackish ridge around the margin

Ellipsoid

Reniform, discoid

Stomata Size (µm2)

255.59±13.50

458.11±9.00

Trichome length (µm)

173.47±7.82

482.06±22.66

1934.74±0.26 and 95.15%

3777.20±0.16 and 97.53%

Chlorophyll (mg/g)

2.29±0.19

1.27±0.17

Phenol (mg/g)

8.11±0.09

7.04±0.08

Size of each seed (cm2) Colour of Fruit and seed

Seed shape Micro-morphology

Pollen Size (µm2) and Stainability(%) Biochemical Analysis

Debasree Lodh et.al.  | 185

Fig. 1:  Plant population of M. bracteata (A, C) and M. interrupta (B, D); Plant twig of M. bracteata (E) and M. interrupta (F); 6th leaf of two sp. M. bracteata (G), M. interrupta (H); Inflorescence of M. bracteata (I) and M. interrupta (J).

Thus our study has led to identifying Mucuna interrupta Gagnep. earlier not known from the state, supports distinct categorization of the Mucuna species under study, in accordance with Kato et al. (2004) and also highlights the need of further insight into the plant-fruit-arthropod interactions of M. interrupta from tropical ecology viewpoint.

186  |  Diversity, Botany and Importance of Two Mucuna Species: M. bracteata DC. ...

Fig. 2:  Plant twig with inflorescence of M. bracteata (A) and M. interrupta (B); Single and dissected flower of M. bracteata (C,c) and M. interrupta (D,d); Plant twig with fruit of M. bracteata (E) and M. interrupta (F); Open fruit and seeds of M. bracteata (G, I) and M. interrupta (H, J).

Debasree Lodh et.al.  | 187

Fig. 3:  Bug interaction with vegetative portions of M. bracteata (A) and M. interrupta (B); Ant interaction with vegetative and reproductive parts of M. interrupta (C, D).

Fig. 4:  Stomata of M. bracteata (A) and M. interrupta (B); Trichome of M. bracteata (C) and M. interrupta (D); Pollen of M. bracteata (E) and M. interrupta (F).

188  |  Diversity, Botany and Importance of Two Mucuna Species: M. bracteata DC. ...

Acknowledgements Financial support from DST in the form of INSPIRE fellowship to Debasree Lodh and instrumentation facility of UGC-SAP (DRS-I) assisted, Department of Botany, Tripura University is gratefully acknowledged. Plant identification by Prof. B.K. Datta and arthropod identification by Prof. B. K. Agarwala is gratefully acknowledged.

REFERENCES Arnon, D. I. 1949. Copper enzymes in isolated chloroplasts. Polyphenoloxidase in Beta vulgaris. Plant Physiol. 24: 1-15. Anonymous. 2008. The Ayurvedic Pharmacopoeia of India. Ministry of Health and Family welfare Department Of ISM & H. vol- III (I). Burkill, I. H. 1966. A dictionary of economic products of the Malay Peninsula. Ministry of Agriculture and Cooperatives, Kuala Lumpur, Malaysia, p 2444. Ceballos, A. I. O., Rivera, J. R. A., Arce, M. I. M. O., and Valdivia, C. P. 2012. Velvet bean (Mucuna pruriens var. utilis) a cover crop as bioherbicide to preserve the environmental services of soil. In Herbicides- Env. Imp. Stud. Mang. App. 167-184. Capo-chichi, L. J. A., Weaver, D. B., and Morton, C. M. 2003. The use of molecular markers to study genetic diversity in Mucuna. Trop. Subtrop. Agroeco. 1: 309-318. Deb, D. B. 1981. The flora of Tripura state. Today and tomorrows’ printers and publishers. Vol-I, II. Eubanks, M. D. and Styrsky, J. D. 2006. Ant-Hemipteran Mutualisms: Keystone Interactions that alter Food Web dynamics and Influence Plant Fitness. In: Trophic and Guild Interactions in Biological Control. (Eds Brodeur, J. and Boivin, G.) Springer. III: 171189. Inamdar, S., Joshi, S., Jadhav, J., and Bapat, V. 2012. Innovative use of intact seeds of Mucuna monosperma Wight for improved yield of L-DOPA. Nat. Prod. Bioprospect. 2: 16-20. Jaheer, M., and Sathyanarayana, N. 2010. Karyomorphological studies in Mucuna of India. Chromo. Bot. 5: 37-41. Kato, H., Yamane, S., and Phengklai, C. 2004. Ant colonized domatia on fruits of Mucuna interrupta (Leguminosae). J. Plant Res. 117: 319-321. Kumar, V., and Subramaniam, B. 1986. Chromosome Atlas of flowering plants of the Indian subcontinent. Bot. Surv. Ind. vol- I, II. Leelambika, M., Mahesh, S., Jaheer, M., and Sathyanarayana, N. 2010. Comparative evaluation of genetic diversity among Indian Mucuna species using morphometric, biochemical and molecular approaches. World J. Agri. Sci. 6(5): 568-578. Mueller-Harvey, I. and Mc Allan, A. B. 1992. Tannins: their biochemistry and nutritional properties. Advanced Plant Cell Biochem. Biotech. 151-217.

Debasree Lodh et.al.  | 189

Natarajan, K., Narayanan, N., and Ravichandran, N. 2012. Review on ‘Mucuna’- The wonder plant. Int. J. Pharm. Sci. Rev. Res. 17(1): 86-93. Padmesh, P., Reji, J. V., Jinishdhae, M., and Seeni, S. 2006. Estimation of genetic diversity in varieties of Mucuna pruriens using RAPD. Biologia Plantarum. 50(3): 367-372. Salisbury, E. J. 1927. On the causes and ecological significance of stomatal frequency with special reference to the woodland flora. Philos. Transac. Roy. Soc. B. 216: 1-65. Samarappuli, L., Karunadasa, S., Mitrasena, U. and Shantha, N. 2003. Mucuna bracteata: Ideal cover crop for efficient soil and water management in rubber cultivation. Trop. Agri. Res. Extn. 6: 85-90. Sathyanarayana, N., Leelambika, M., and Mahesh, S. 2011. AFLP assessment of genetic diversity among Indian Mucuna accessions. Physiol. Mol. Biol. Plants. 17(2): 171-180. Soares, A. R., Marchiosi, R., Siqueira-Soares, R.C., Lima, R. B., Santos, W. D., and FerrareseFilho, O. 2014. The role of L-DOPA in plants. Plant Sig. Behavior. 9: 1-7. Waterhouse, A. L. 2003. Determination of total phenolics. In: Current Protocols. In: Food Analytical Chemistry. John Wiley and Sons. I. Wilmot-Dear, C. M. 1992. A revision of Mucuna (Leguminosae: Phaseoleae) in Thailand, Indochina and the Malay Peninsula. Kew Bullet. 47(2): 203-245. Wilmot-Dear, C. M. 2010. Flora of China. 10: 207-218.

mmm

Trends in Frontal Areas of Plant Science Research Edited by: S. Sinha, R.K. Sinha © Department of Botany, Tripura University, 2017

Diversity of Fungal Endophytes and Antibacterial Study of Some Selected Endophytes Isolated from Five Plants of Tripura Sukla Bhattacharjee1*, Ajay Krishna Saha1 and Panna Das2 1

Mycology and Plant Pathology Laboratory, 2Microbiology Laboratory Department of Botany, Tripura University, Suryamaninagar – 799022, Tripura *Corresponding author: [email protected]

ummary Plants are the reservoir of different micro-organisms among which endophytes S have recently gained attention. An endophyte is an endosymbiont, often a bacterium or fungus or actinomycetes that usually colonize living internal tissues of plantswithout causing any “injury or overt symptom to their host”. The present study was conducted to evaluate the diversity of fungal endophytes from some selected plants of Tripura. The study revealed a total of 17 fungal endophytes recovered from 405 segments of leaves, bark and root of five selected plants. Sterile forms were also isolated. Of these isolates Fusarium oxysporum was found to be present in all the five plants whereas Penicillium sp. and Diaporthe phaseolorum were foundin four plants except  Dillenia  indica  (L.). Further some selected species were screened for antibacterial activity against the Gram positive bacteria Bacillus subtilis MTCC 619 and negativePseudomonas aeroginosa MTCC 424 by the paper disk susceptibility test. All the endophytes showed differential inhibition zone against the tested bacteria. Key words: Endophytes, Endosymbiont, Diversity, Antibacterial activity. Fungi are heterotrophic eukaryotes with unique characteristics that set them well apart from both plants and animals. The role of symbiosis between plant and microorganism is considered a key element for eukaryotes colonization in the land (Heckman et. al 2001). Fungi are so versatile in adapting themselves that they could occupy a variety of ecological habitats (Suryanarayan 1998). Fungi are also known to establish themselves inside healthy plant tissues without causing any “injury or overt symptom to their host”. Such an association is generally termed as endophytic association (Bills1996). This is a topographical term and it includes bacteria, fungi, actinomycetes, and algae, which spend their whole life or a period of life cycle in the symplast or apoplast region of healthy plant tissues without producing any disease or symptoms. Fungal endophytes though very

192  |  Diversity of Fungal Endophytes and Antibacterial Study of Some Selected Endophytes...

important are relatively less studied group of microbes that colonize healthy plant tissues without causing any damage to the host plants (Bacon 2000). Different works carried out so far regarding the role of endophytes in host plants indicate that they can stimulate plants growth, increase disease resistance, improve plants ability to withstand environmental stresses and recycle nutrients (Sturz et al. 2000, Strobel 2002). Besides these, endophytes are also recognized as rich sources of bioactive metabolites of multifold importance ((Tan and Zou 2001, Strobel and Daisy 2003).The relationship between an endophyte and its host is complex as this association varies profoundly (Owen and Hundley 2004). Individual plant may act as a host to one or more endophytes and the composition of the fungal community usually differs between host species (Petrini 1991, Strobel and Daisy 2003, Huang et al.2007, Okane et al.1998, Arnold 2007 and Saikkonen 2007). Variation in the diversity of fungi may be associated with location, climate and leaf age (Petrini 1991 and Asai et al. 1998). Sampling and characterizing fungal endophyte diversity is an emerging challenge which may lead to the discovery of new species, novel compounds and a better understanding of their role in eco-systems (Arnold and Lutzoni 2007, Saikkonen 2007 and Rodriguez et al.2009). The present study was conducted to reveal the fungal endophytic distribution and diversity from five different medicinal plants of Tripura along with the screening of antibacterial activity of the selected endophytes.

Materials and Methods The plants selected for the proposed work were Sapindus mukorossi Gaertn. (Reetha), Piper betel L.(Betel leaf), Dellinia indica L. (Chalta), Cinnamomum tamala (Buch.-Ham.) T.Nees&Eberm. (Tejpata), and Acacia auriculiformis Benth.(Akash moni). Samples from Sapindus mukorossi, Acacia auriculiformis were collected from Tripura University campus, Piper betel and Cinnamomum tamala samples were collected from Suryamaninagar and Dellinia indica was collected from Abhoynagar areaof Agartala, Tripura. Samples were kept in closed sterile polythene bags and processed within 24 hrs of collection. Isolation and Inoculation of Endophytic Fungi Leaf, bark and root samples were thoroughly washed in running tap water followed by sterile water and the further procedure was performed under laminar air flow. The samples were then dipped in 70% ethanol for 30 seconds, 5% NaOCl for 2 minutes followed by rinsing with sterile distilled water. The samples were then cut into 0.5 Sq. cm each with the help of a sterile scissor and dried on sterile blotting paper. Inoculation was done under laminar air flow. Each sample thus prepared was placed in a sterile petridish and by teasing them with sterile needle and forceps, they were transferred to Malt Extract Agar medium (MEA) supplemented with antibiotic streptomycin 10mg/ml and incubated at 25oc for 7days. For each sample three replicates were maintained. They were monitored every day for growth of endophytic fungal colonies. Fungi growing out from the samples were subsequently transferred onto fresh malt extract agar medium with the help of inoculation loop. The procedure was repeated several times in order to isolate pure colonies. All reagents used were of analytical grade.

Sukla Bhattacharjee et.al.  | 193

Identification of Endophytic Fungi The grown up colonies were then stained with lacto-phenol cotton blue and observed underdigital compound microscope. The fungal species were identified on the basis of cultural characteristics and morphology of fruiting bodies and spores by using standard texts and keys (Domsch et al. 1980,Ellis 1993, Watanabe 2002). Isolates unable to produce sporeswere exposed to light to stimulate sporulation. Those isolates which did not produce spores were treated as sterile mycelium (Lacap et al.2003). Cultivation of Endophytic Fungi Fresh mycelia from seven days old culture of selected endophytic fungi from medicinal host plants were inoculated in 100ml Malt Extract Broth (MEB) in 250 ml Erlenmeyer flasks and were incubated for 30 days at 25°C in stationary condition. Broth of eachfungal endophyte was filtered and the filtrate was extracted three times withethyl acetate at room temperature. Evaporation of the extractedsolution was done in a rotary evaporator (Superfit rotavap R/171). Antibacterial Assay Extracts from endophytic fungi were screened for antibacterial activity against bacteria by disc diffusion method. Test bacterial strainscollected from IMTECH Chandigarh, India include gram positive Bacillus subtilis MTCC 619 and gram negative Pseudomonas aeruginosa MTCC 424. For each test, 0.1 ml of the bacteria was spread into nutrient agar plates. The paper discs soaked in the fungal extract were placed on to the bacterial plates in triplicate and the plates were incubated at 37oC for 24 – 48 hrs. After the incubation, the inhibition zone was measured and expressed in millimeter.

Results and Discussion In the present study five different plants were selected for isolation of fungal endophytes from leaf, bark and root tissues (Table 1). Table 1: Selected plants for isolation of fungal endophytes. Serial No. 1.

Plant species

Family

Sapindus mukorossi Gaertn.

Sapindaceae

2.

Cinnamomum tamala (Buch.-Ham.) T.Nees & Eberm.

Lauraceae

3.

Piper betel L.

Piperaceae

4.

Dellinia indica L.

Dilleniaceae

5.

Acacia auriculiformis Benth.

Fabaceae

A total of 17 endophytic fungi were isolated from five different plants of Tripura. Of these 17 fungal isolates, it was observed that Fusarium oxysporum was present in all the five plants whereas Penicillium sp and Diaporthe phaseolorum were present in four plants except Dellinia indica L. Among all the plants, highest numbers of endophytes were obtained

194  |  Diversity of Fungal Endophytes and Antibacterial Study of Some Selected Endophytes...

from Acacia auriculiformis and the lowest number was found in Piper betel. Prevalence of endophytes was found to bemorein the modified petiole ofAcacia auriculiformis. In case of bark, the highest number of endophytes was obtained from C. tamala and in roots too, highest frequency was recorded in Acacia auriculiformis. Fusarium oxysporum, Penicillium sp. and Diaporthe phaseolorum were found to be the dominant species. Presence of sterile mycelia in leaves of host plants was observed in the present investigation. Table 2: Isolated fungal endophytes from selected plants of Tripura. Names of Endophytes

Alternaria aiternata

Sapindus mukorossi

Cinnamomum tamala

Piper betel

Dillenia indica

Acacia auriculiformis

L

B

R

L

B

R

L

B

R

L

B

R

MP

B

R

0

0

0

0

2

3

0

0

0

0

0

0

1

0

0

Aspergillus alutaceus

3

0

0

0

3

0

0

0

3

3

0

0

0

0

2

Aspergillus erythrocephalous

3

0

0

0

0

0

0

0

0

0

0

0

0

0

1

Chaetomium funicola

0

0

0

0

0

0

0

0

0

0

0

0

0

0

1

Cladosporium cladosporioides

0

0

0

0

0

0

0

0

0

0

0

0

1

0

0

Curvularia lunata

0

0

0

0

0

0

0

0

0

0

0

0

1

0

0

Lasiodiplodiasp.

0

1

0

0

0

0

0

0

0

0

0

0

0

0

0

Epicoccum nigrum

0

0

0

0

0

0

0

0

0

6

0

0

0

0

0

Humicola sp.

0

0

0

0

0

1

0

0

0

0

0

0

0

0

2

Monilia sp.

0

0

0

0

0

0

0

0

0

0

0

0

0

0

1

Fusarium oxysporum

0

12

3

0

6

0

0

6

3

0

0

3

0

0

2

Nigrospora sp.

0

0

0

0

0

0

0

0

0

0

0

0

0

1

0

Penicillium sp.

0

0

6

0

3

3

4

0

6

0

3

0

1

0

2

Pestalotia sp.

0

0

0

0

0

0

0

0

0

0

0

0

0

2

0

Pythium lammimatum

0

0

0

0

0

6

0

0

0

0

2

0

0

0

0

Trichoderma viride

0

0

0

0

0

0

0

0

0

3

0

3

0

0

0

Diaporthe phaseolorum

6

9

0

0

3

3

3

0

0

0

0

0

2

0

2

White sterile

9

0

0

27

0

2

9

3

7

3

0

0

3

0

0

L-Leaf, B- Bark, R- Root, MP- Modified petiole

Mycelia sterilia have been often isolated as leaf endophytes from many host plants (Bills 1996, Suryanara-yanan et al. 1998, Rajagopal et al. 2000, Huang et al. 2007). Alternaria alternata are reported as endophytes in wide range of plant species (Rajagopal and Suryanarayanan2000). Normally Alternaria alternata and Curvularia lunata occur as phylloplane fungi but they are capable of penetrating the superficial layers of leaf and grow as endophyte suggesting conversion to endophytic mode of life to overcome adverse environmental conditions (Cabral et al. 1993, Bills 1996). Similar results were also found in the present study. In terms of dominance and evenness, Dillenia indica was found to be richest source whereas Acacia auriculiformis exhibited least dominance. Shannon’s

Sukla Bhattacharjee et.al.  | 195

diversity index and Simpson index were highest in Acacia auriculiformis and lowest in Dillenia indica (Table 3). Table 3: Showing the diversity indices of isolated endophytic fungi. Diversity indices

Sapindus mukorossi

Cinnamomum tamala

Piper betel

Dillenia indica

Acacia auriculiformis

Dominance

0.43

0.47

0.41

0.59

0.29

Shannon

0.91

1.06

0.97

0.67

1.44

Simpson

0.55

0.51

0.57

0.40

0.69

Evenness

0.86

0.93

0.92

0.98

0.92

Table 4: Antibacterial activity of the extracts of endophytic fungus against the tested bacteria Endophytes

Inhibition zone (mm) Bacillus subtilis

Pseudomonas aeroginosa

-

-

Aspergillus erythrocephalous

-

-

Alternaria aiternata

-

-

5.0

-

Aspergillus alutaceus

Cladosporium cladosporoides

-

-

Pestalotia sp.

8.0

-

Fusarium oxysporum

7.0

11.5

Diaporthe phaseolorum

9.5

8.5

Curvularia lunata

Fig. 1:  (a) A. Erythrocephalous, (b) Lasio diplodia, (c) Trichoderma viride, (d) Penicillium sp. (e) Alternaria alternata, (f) Diaporthe phaseolorum

196  |  Diversity of Fungal Endophytes and Antibacterial Study of Some Selected Endophytes...

Selected endophytes were screened for antibacterial activity against Gram positive Bacillus subtilis and Gram negativePseudomonas aeroginosa. It was found that among selected endophytes screened for antibacterial activity only Cladosporium cladosporoides, Pestalotia sp, Fusarium oxysporum, and Diaporthe phaseolorum showed activity against the tested bacteria. Though Fusarium oxysporum and Diaporthe phaseolorum showed activity against both the bacteria, Cladosporium cladosporoides and Pestalotia sp. exhibited activity only against Bacillussubtilis(Table 4). Our experimental results in terms of isolation of endophytes and their antimicrobial activity also corroborated the previous findings (Selim et al. 2011).The diversity of endophytic fungi documented in the present investigation shows differential association with different plant parts and the antibacterial activity of some of these endophytes is a good indicator of bio-control agents.

Acknowledgements The authors are grateful to the Head, Department of Botany for providing all kinds of facilities. The first author is thankful to the UGC, Government of India for providing BSR fellowship.

Fig. 2:  Antibacterial activity of the extracts of endophytic fungi against the tested bacteria

REFERENCES Arnold, A. E. and Lutzoni, F. 2007. Diversity and host range of foliar fungal endophytes: are tropical leaves biodiversity hotspots? Ecol. 88: 541–549. Asai, E., Hata, K., and Futai, K. 1998. Effect of simulated acid rain on the occurrence of Lophodermium on Japanese black pine needles. Mycol Res. 102: 1316–1318. Bacon, C. W. and White, J. F. 2000. Microbial endophytes. Marcel Dekker, New York. Bills, G. F. 1996. Isolation and analysis of endophytic fungal communities from woody plants. Endophytic fungi in grasses and woody plants: Syst. Eco. and Evol. 31-65.

Sukla Bhattacharjee et.al.  | 197

Cabral, D., Stone, J. K., and Carroll, G. C. 1993. The internal mycobiota of Juncus sp.: Microscopic and cultural observations of infection patterns. Mycol Res 97: 367-376. Domsch, K. H., Gams, W., and Anderson, T. H. 1980.Compendium of soil fungi. Academic Press, London. Ellis, M.B. 1993. Dematiaceous hyphomycetes. CAB International, Wallingford. Heckman, D. S., Geiser, D. M., Eidell, B. R., Stauffer, R. L., Kardos, N. L., and Hedges, S.B. 2001. Molecular Evidence for the Early Colonization of Land by Fungi and Plants. Sci. 293:5532: 1129-1133. Huang, W. Y., Cai, Y. Z., Xing, J., Corke, H. and Sun, M. 2007. Potential antioxidant resource: endophytic fungi isolated from traditional Chinese medicinal plants. Econ Bot.61:14-30. Lacap, D. C., Hyde, K. D., and Liew, E. C. Y. 2003. An evaluation of the fungal “morphotype” concepts based on ribosomal DNA sequence. Fungal divers. 12: 53-66. Okane, I., Nagagiri, A. and Ito, T.1998. Endophytic fungi in leaves of ericaceous plants. Can J Bot. 76: 657–663. Owen, N. L., and Hundley, N. 2004. Endophytes—the chemical synthesizers inside plants. Sci Prog. 87:79–99. Petrini, O. 1991. Fungal endophyte of tree leaves. In: Andrews J, Hirano SS (eds) Microbial ecology of leaves. Springer Verlag, New York. 179–197. Rajagopal, K., and Suryanarayanan, T. S. 2000. Isolation of endophytic fungi from the leaves of neem (Azadirachta indica A.Juss). Curr Sci. 78(11): 1375-1378. Rodriguez, R. J., White, J. F. J. R., Arnold, A. E., and Redman, R. S. 2009. Fungal endophytes: diversity and functional roles-Tansley review. New Phytologist 182: 314–330. Saikkonen, K. 2007. Forest structure and fungal endophytes. Fungal Bio Rev. 21: 67–74. Selim, K. A., El-Beih, A. A., AbdEl-Rahman, T. M., and El-Diwany, A. I. 2011. Biodiversity and antimicrobial activity of endophytes associated with Egyptian medicinal plants. Mycosphere. 2(6): 669-678. Strobel, G. A. 2002. Microbial gifts from the rainforest. Can J Phyto Pathol.24: 14–20. Strobel, G., and Daisy, B. 2003. Bioprospecting for microbial endophytes and their natural products. Microbiol mol biol rev. 67:491-502. Sturz, A. V., Christie, B. R., and Nowak, J. 2000. Bacterial endophytes: potential role in developing sustainable systems of crop production. Crc cr rev plant sci 19: 1–30. Suryanarayanan, T. S., Muruganandham, V., Rajagopal, K., and Girivasan, K. P. 1998. Soil Mycoflora of commercially operated solar salterns . Kavaka. 24:11-13. Tan, R. X., and Zou, W. X. 2001. Endophytes: a rich source of functional metabolites. Nat. prod. rep. 18: 448–459. Watanabe, T. 2002. Pictorial atlas of soil and seed fungi. Morphologies of cultured fungi and key to species. CRC Press, Florida.

mmm

Trends in Frontal Areas of Plant Science Research Edited by: S. Sinha, R.K. Sinha © Department of Botany, Tripura University, 2017

Antibacterial Activity of Leaf Extracts of Bambusa bambos (L.) Voss. and Bambusa tulda Roxb. of Tripura Sudipta Sinha1*, Gopal Debnath1, Ajay Krishna Saha1 and Panna Das2 1

Mycology and Plant Pathology Laboratory, 2Microbiology Laboratory, Department of Botany, Tripura University, Suryamaninagar-799 022, Tripura, India *Corresponding author: [email protected]

Summary Antibacterial activity of ethanolic and methanolic extracts of the fresh leaves of Bambusa bamboos and Bambusa tulda was evaluated against Gram-positive and gramnegative bacterial strains by disc diffusion method. Inhibitory effect of two crude extracts was clearly visible against both types of bacteria tested. Moreover, the role of ethanolic leaf extracts in forming effective inhibitory zone against Staphylococcus aureas and E. coli is also highlighted. Keywords: Bamboo, antibacterial activity, ethanolic leaf extract. Bamboos popularly known as ‘Green Gold’, ‘Poor Man’s Timber’, etc belonging to the family Gramineae, are represented world over by about 90 genera with over 1200 species. Asia is rich in bamboo diversity with approximately 900 species belonging to 65 genera, of which 14 species are endemic to the region. India is the home of about 136 species of bamboo falling under 23 genera with genus Bambusa widely distributed in the country. The next widely distributed genus is the Dendrocalamus, which is found to grow widely in the plains of south and central India. Bamboo has many health benefits. Medicinal uses of bamboo have been known and practiced by Asian healers of old. Bamboo leaves have been used clinically in some Asian countries in the treatment of fever and hypertension (Kweon et al. 2001, Wang et al. 2012). The medicinal effects of bamboo leaves are mostly attributed to their antioxidant capacity (Hoyweghen, et al. 2010). Bamboo leaves have been used in traditional Chinese medicine for treating fever and for detoxification for over 1000 years (Zhang and Ding, 1996). Bambusa bambos (L.) Voss. has been widely used in Indian Folk medicine. In ayurveda, the entire plant is used as astringent, laxative, for inflammatory conditions and as diuretic. Shoots of the plant are used for dislodgement of worms from ulcer. Leaves are used in treatment of leprosy, amenorrhoea, dysmenorrhoea, eye troubles, lumbago, haemorrhoids and hematemesis (Joshi, 2000). The crushed shoot juice of Bambusa tulda Roxb. is applied to the injury of nails due to iron sword or arrows.

200  |  Antibacterial Activity of Leaf Extracts of Bambusa bambos (L.) Voss. and...

The boiled decoction of the fermented shoot is prescribed for ring worm, tumours and meningitis. The fruits are belief to enhance fertility (Singh et al. 2010). The objective of this study aims at screening of antibacterial activity of ethanolic and methanolic leaf extracts of Bambusa bambos (L.) Voss. and Bambusa tulda Roxb. against the strains of Staphylococcus aureus a major food pathogen and Escherichia coli which is also known as a diarrheagenic.

Materials and Methods Fresh bamboo leaves were collected from bamboosetum, Tripura University campus. The fresh bamboo leaves were cut into small pieces, oven dried at 500C for 2 days and milled to become flour. The powdered leaf of bamboo was extracted at concentration of 5% (w/v) using methanol and ethanolseparately. Each mixture was filtered to remove the insoluble matter and the dried extract was obtained by evaporating the solvent using vacuum rotary evaporator (Superfit Rotavap). Test bacterial strains were procured from IMTECH Chandigarh, India.The selected bacterial strains are Gram-negative bacteria E. coli (MTCC 40) and Gram-positive bacteria Staphylococcus aureus (MTCC 96). Disc diffusion was carried out for the bacterial suspension containing 10-6 CFU cells. Stock cultures were maintained at 4°C on slopes of nutrient agar. Active cultures for experiments were prepared by transferring a loop full of microorganism from the stock cultures to test tubes of Nutrient broth, and incubated for 24 hrs at 37°C. The cultures were diluted with fresh Nutrient broth.Nutrient agar media were prepared and then about 20 ml of sterilized nutrient agar media was poured into each sterile petriplates and allowed to solidify. Ethanolic and methanolic leaf extracts of bamboo were tested for antibacterial activity against Gram-positive and Gram-negative bacteria by the disc diffusion method. 100 µl of the test bacterial strains were evenly spread over the prepared plates by using a sterile glass spreader. Each Paper disc pouring with 10µl of distilled water (Negative control), methanol, ethanol, streptomycin, methanolic and ethanolic bamboo leaf extractat 1 mg/ ml concentration were then placed on prepared plates. These plates were incubated at 37oc for 24-48 hours. After incubation period, the results were recorded and the inhibition zone was expressed in mm. The zone of inhibition of different bamboo leaf extract are recorded in table 1.

Results and Discussion Antibacterial activity of methanolic and ethanolic extractof Bambusa tulda and Bambusa bambos leaves showed effective activity against both grampositive and gramnegative bacteria. In comparison with antibiotic (positive control) ethanolic leaf extract of boththe bamboo showed highest activity against Staphylococcus aureus and whereas methanolic and ethanolic leaf extract of B. tulda showed lowest activity against E. coli. In the present study the antibacterial activity of the leaves of Bambusa bambos and Bambusa tulda has been

Sudipta Sinha et.al.  | 201

investigated. The ethanolic and methanolic leaves extract of B. bambos and B. tulda showed effective inhibitory action against both tested Gram-positive and Gram-negative bacteria. However, ethanolic extract showed more antibacterial activity against both tested bacteria than the methanolic extract of both bamboo species. Table 1: Showing antibacterial activity of bamboo leaf extracts. Name of Bacteria

Bambusa tulda Methanolic extract

Bambusa bambos

Ethanolic extract

Methanolic extract

Ethanolic extract

Inhibition zone in mm DW

M

Me

A

DW

E

Ee

A

DW

M

Me

A

DW

E

Ee

A

Staphylococcus aureus

0

6

15

24

0

7.5

27

25

0

7

18

27

0

7.5

28

25.5

Escherichia coli

0

7.5

11

18

0

9

11.5

19

0

6

13

19

0

8

21

23

DW-distilled water, M-methanol, E-Ethanol, Me- methanolic sample extract, Ee- ethanolic sample extract, A-Antibiotic.

Fig. 1: Plates showing the inhibition zone of the bamboo leaf extracts (Bambusa bambos) against the tested bacteria In the figure, plate (a) and (b) showing antibacterial activity of ethanolic and methanolic bamboo leaf extract against Staphylococcus aureus, (c) and (d) showing antibacterial activity of ethanolic and methanolic bamboo leaf extract against Escherichia coli.

202  |  Antibacterial Activity of Leaf Extracts of Bambusa bambos (L.) Voss. and...

Fig. 2: Graph showing the antibacterial activity of leaf extracts of B.bambos. Inhibition zone of ethanolic bamboo leaf extracts against the growth of both the bacteria is greater than the methanolic extract.

Fig. 4: Antibacterial activity of leaf extracts of B. tulda. Inhibition zone of ethanolic bamboo leaf extracts against the growth of S. aureus is greater than the methanolic extract. Whereas ethanolic and methanolic leaf extracts were showing slightly similar inhibition zone

Sudipta Sinha et.al.  | 203

Fig. 5. Graph showing the antibacterial activity of leaf extracts of B. tulda. Inhibition zone of ethanolic bamboo leaf extracts against the growth of S. aureus is greater than the methanolic extract. Whereas ethanolic and methanolic leaf extracts were showing slightly similar inhibition zone.

In the present study the antibacterial activity of the leaves of Bambusa bambos and Bambusa tulda has been investigated. The ethanolic and methanolic leaves extract of B. bambos and B. tulda showed effective inhibitory action against both tested Gram-positive and Gram-negative bacteria. However ethanolic extract showed more antibacterial activity against both tested bacteria than the methanolic extract of both bamboo species. Similar observation was found by Durgesh and Tumane (2017) where the ethanolic leaf extract of B. bambos showed highest inhibitory activity against three bacteria including Staphylo coccus sp. Mulyono et al.(2012) showed that ethanolic extract was more effective than methanol-ethanolic extract to inhibit all tested pathogenic E. coli which can be correlated with the present study.Using ethanolic extract of bamboo leaves, Singh et al. (2010) demonstrated the action against S. aureus, E. coli and Pseudomonas sppand it was shown to be 2.1mm, 3.1mm and 1.2mm zone of inhibition respectively. In the present study ethanolic leaf extract of B. bamboss howed excellent zone of inhibition against E.coli(21 mm) and S. aureus (28 mm) and ethanolic leaf extract of B. tulda showed excellent zone of inhibition against S. aureus (27 mm). Singhet al. (2012) used methanolic extract of fermented Bambusa balcooa shoots and found effective antibacterial activity against E. coli, S. aureus and P. aeruginosa, which showed similarity with our findings. According to Durgesh et al. (2014) the difference in the antibacterial activity from the same source when extracted with different solvent has proven that not all phytochemicals having antibacterial activity are soluble in a single solvent. Thus ethanolic leaf extract of B. bambos and B. tulda can be considered to be as equally potent as the antibiotics used now-a-days.Antibacterial activity assay by disc diffusion method resulted in formation of clear zones around the discs revealing that both ethanolic and methanolic leaf extracts of both the bamboo could inhibit the growth of bacteria. The results clearly showed that ethanolic extracts were more effective than methanolic extracts to inhibit both the tested bacteria. Inhibition of the growth of S. aureus by ethanolic leaf extracts of both the bamboo was very effective as compared to streptomycin.

204  |  Antibacterial Activity of Leaf Extracts of Bambusa bambos (L.) Voss. and...

Acknowledgements The authors are grateful to the Head, Department of Botany, Tripura University for providing all sorts of facilities. The first author is thankful to the UGC- BSR, Government of India for the financial assistance.

REFERENCES Durgesh D. W. And Tumane P. M. 2014. Antibacterial activity of Bambusa bambose L. against Multiple Drug Resistant (MDR) bacteria isolated from clinical specimen. Int. J. Pharm. Sci. Rev. Res., 25(1), 37: 215-218. Hoyweghen, L.V. Karalic, I. Calenbergh, S.V. Deforce, D. Heyerick, A. 2010. Antioxidant flavones glycosides from the leaves of Fargesia. robusta. J. Nat. Prod.,9: 1573-1577. Joshi, S.G. (2000). Medicinal plants. New Delhi: Mohan Primlani Publiction, p 314-15. Kweon, M.H., Hwang, H.J., Sung, H.C. 2001. Identification and antioxidant activity of novel chlorogenic acid derivatives from bamboo (Phyllostachys. edulis). J. Agric. Food Chem., 10: 4646-4655. Mulyono N.W., Lay B, Rahayu S, Yaprianti I. 2012. Antibacterial Activity of Petung Bamboo (Dendrocalamus Asper) Leaf Extract Against Pathogenic Escherichia coli and Their Chemical Identification International Journal of Pharmaceutical & Biological Archives 3(4):770-778 Singh A.S., Bora T.C., Singh R.N. 2012. Preliminary phytochemical analysis and antimicrobial potential of fermented Bambusa balcooa shoots. The Bioscan, 7(3):391-394. Singh P.K., Devi S.P., Devi K.K., Ningombam D.S., Athokpam P. 2010. Bambusa tulda Roxb. in Manipur State, India: Exploring the Local Values and Commercial Implications. Not Sci Biol., 2(2): 35-40. Singh V.K., Shukla R., Satish V, Kumar S., Gupta S. and Mishra A. 2010. Antibacterial Activity of Leaves of Bamboo. Int. J. Pharm. Bio Sci., 1(2): 1-5. Wang, J. Yue, Y.D. Jiang, H. Tang, F. 2012. Rapid screening for flavone C-glycosides in the leaves of different species of bamboo and simultaneous quantitation of four marker compounds by HPLC-UV/DAD. Int. J. Anal. Chem., 205101:1-205101:8. Zhang, Y. and Ding, X.L. 1996. Studies on anti-oxidative fraction in bamboo leaves and its capacity to scavenge active oxygen radicals. J. Bamboo Res., 15: 17-24.

mmm

Trends in Frontal Areas of Plant Science Research Edited by: S. Sinha, R.K. Sinha © Department of Botany, Tripura University, 2017

Checklist of Mushroom Diversity in West Tripura, North-East India Sanjit Debnath1*, Aparajita Roy Das1, Pintu Karmakar1, Gopal Debnath1, Panna Das2 and Ajay Krishna Saha1 1

Mycology and Plant Pathology Laboratory, 2Microbiology Laboratory Department of Botany, Tripura University, Suryamaninagar-799 022, Tripura, India *Corresponding author: [email protected]

Summary Mushrooms are one of the most important components of the forest ecosystem. Their edibility, poisonous nature, psychotropic properties, mycorrhizal and parasitic associations with the forest trees make them economically important and interesting to study. The Northeastern region of India abounds in forest wealth, including many species of trees and other woody plants. Tripura is one of the seven states in the north eastern part of India. The present study was conducted to assess the diversity of mushrooms found in West Tripura during May to September 2014. Collections were done from nine sites of West Tripura. Out of nine locations, Salbagan represented highest diversity of mushrooms compared to rest other sites. Overall twenty two mushroom species were collected under this study, of which five different morphotypes belong to Marasmius sp., three to Lentinus sp., two to Termitomyces sp., and one each to Agaricus sp., Lactarius sp., Tricholoma sp., Schizophyllum sp., Xylaria sp., Pleurotus sp., Xerulina sp., Auricularia sp., Geastrum sp., Polyporus sp., and Thelephora sp. Out of total twenty two species, nine species categorized as edible mushrooms, twelve were categorized as non edible by the toxicity test. The study revealed that Geastrum sp., Polyporus sp. and Schizophyllum sp. were highly abundant and Lentinus sp. 2 was least abundant. Present checklist of mushroom diversity will be helpful for future studies as well as will provide a baseline data on mushroom diversity in Tripura. Key words: Mushrooms, West Tripura, abundant, diversity. Mushrooms are defined as “a macro fungi with a distinctive fruiting body which can be hypogeous or epigeous, large enough to be seen with the naked eye and to be picked by hand” (Chang and Miles (1992). Mushrooms alone are represented by about 41,000 species, of which approximately 850 species are recorded from India (Deshmukh 2004). Forest fungi play important ecological role in forest ecosystems, acting as mycorrhizal symbionts, decomposers and pathogens (Dighton et al. 2005). During the rainy season, different species of both edible and non edible mushrooms usually grow on various

206  |  Checklist of Mushroom Diversity in West Tripura, North-East India

natural substrates such as garden soil, decaying wood, termite nest, palm wastes, leaf humus, under the shade provided by teak, sal and rubber plantations of Tripura. Some mushrooms are found growing in association with trees of a particular family or genus (Arora 2008; Karwa and Rai 2010). Angiospermic forest, mixed forest and decaying wood are good source of mushrooms. According to Ajith and Janardhanan (2007), developing countries like India having rich biodiversity of mushrooms are a boon for progress in the field of food, medicine and several nutraceuticals. Edible fungi are more important for a tropical / subtropical country like India, which has a climate, most congenial for the natural growth of such fungi (Purkayastha and Chandra 1985). Schizophyllum commune one of the most common mushrooms, is widely distributed worldwide and usually grows abundantly during the rainy season. This species frequently appears on dead wood and is a known wood decomposer of over 150 genera of flowering plants (Cooke 1961). For planning and managing ecosystem biodiversity data on mushroom diversity in different vegetation types is important (Engola et al. 2007). The specific goals of this study are: collection of wild edible and medicinally important mushrooms from forest bed, identification and documentation of new mushrooms along with the evaluation of the abundance and diversity of mushrooms in west Tripura.

Materials and Methods Study Area Tripura is one of the seven states in the north eastern part of India with a geographical area of 10491 km2, of which 6292 km2 (59.98%) is covered with forest as per legal classification in the state. It is located in between latitudes 22º57’ and 24º33’ N latitudes and 91 º10’ and 92 º20’ E longitudes. Samples were collected from forest, villages, etc. During May to September, 2014, collections were made from Chanmari, Suryamaninagar, R.K. Nagar, Mandwi, Lake chowmuhani, Jogendranagar, Bonikyachoumohani, Salbagan and Hatipara of West Tripura. Mushroom Collection and Identification Different species exhibit different fruiting phonology, which vary at different altitudes and regions. Mushrooms were collected from different habitats with the help of forceps but those growing on wood were collected along with small part of adhering wood and photographed. Each sample was wrapped in the paper envelop along with field notes, date of collection, habitat, locality and specimen number on tag. The specimens were carefully placed on blotting sheet and brought to the laboratory for further analysis. The measurements of various parts of mushrooms and morphological features were recorded. Spore prints were done for identification. These samples were dried in hot air oven at 45º-55º C for 24 hours and after drying, the samples were preserved in polyethylene bag by adding 1, 4-dichlorobenzene. These bags were preserved for further analysis. For morphological identifications the books written by Pegler (1977), Purkaystha and Chandra (1985) were consulted. Edibility test was done by the method of Svrcek (1998).

Sanjit Debnath et.al.  | 207

Fig. 1:  Mushrooms collection sites of West Tripura.

Results and Discussion Morphological Identification and Processing A total of twenty two mushroom samples were collected from West Tripura (Fig. 1). On the basis of morphological characters mushrooms were identified and depicted in Table 1 and shown in Fig.2. Out of twenty two samples, five different morphotypes belong to Marasmius sp. (MCCT 21, MCCT 48, MCCT 49, MCCT 51 and MCCT 52), three to Lentinus sp. (MCCT 27, MCCT 50 and MCCT 56), two to Termitomyces sp. (MCCT 57 and MCCT 62), one each to Agaricus sp. (MCCT 10), Auricularia sp. (MCCT 47), Geastrum sp. (MCCT 53), Lactarius sp. ( MCCT 11), Mycena sp. (MCCT 30), Polyporus sp. (MCCT 54), Schizophyllum sp. (MCCT 25), Tricholoma sp. (MCCT 24), Thelephora sp. (MCCT 55), Xerulina sp.( MCCT 41) and Xylaria sp. (MCCT 26). One morphotype (MCCT 34) is yet to be identified. Nine mushrooms morphotypes were edible, twelve were non edible and one mushroom sample is yet to confirm the edible nature (Table 1). All the species were identified on the basis of their morphological characters as well as spore size. Dry mushroom samples were preserved in the Mycology and Plant Pathology laboratory, Department of Botany, Tripura University, having the accession tag as MCCT (Mushroom Culture Collection Tube). All information’s about mushrooms such as scientific name, location, habitat, and morphological characters were presented in Table 1.

208  |  Checklist of Mushroom Diversity in West Tripura, North-East India

Fig. 2: Different types of Mushrooms collected from West Tripura, North-East India as numbering with MCCT (Mushroom Culture Collection Tube).

Lab. Accession Number

MCCT 10

MCCT 11

MCCT 21

MCCT 24

MCCT 25

MCCT 26

MCCT 27

MCCT 30

MCCT 34

MCCT 41

Sl. No.

1

2

3

4

5

6

7

8

9

10

Xerulina sp.

Unidentified

Mycena sp.

Lentinus sp.1

Xylaria sp.

Schizophyllum sp.

Tricholoma sp.

Marasmius sp. 1

Lactarius sp.

Agaricus sp.

Scientific Name

20/08/2014, Salbagan (West Tripura)

04/08/2014, Bonikochumohai, Khoyerpur (West Tripura)

21/07/2014, Jugendranagar (West Tripura)

08/07/2014, Lakechumohani (West Tripura)

05/07/2014, Mandwi (West Tripura)

05/07/2014, Mandwi (West Tripura)

05/07/2014, Mandwi (West Tripura)

20/06/2014, R.K Nagar (West Tripura)

02/06/2014, Suryamaninagar (West Tripura)

11/05/2014, Chanmari (West Tripura)

Date of collection and location

On living plant

On roots of living plant

On soil

On living plant

On soil or dad plant

On dead plant of Mango.

On soil

On decaying leaf of Rubber

On soil

On ground in open field soil

Habitat

Flabelliform

Depressed

Cyathiform

Applanate

Convex

Cap Shape

White

Cream

Dark brown

White

Brown

Cap Colour

Absent

16-17 cm

7-8 cm

10-12 cm

4-5 cm

Stipe Length

White

Cream

Light brown

White

White

Stipe Colour

1-1.5 cm

3-4 cm

3-4 cm

2 cm

Depressed

Funnel shaped

Depressed

Funnel shaped

Whitish brown

White to Cream

White to Cream

Cream

2.5-3 cm

2 cm

7 cm

10-12 cm

White

White to Cream

White to Cream

Cream

Fruiting bodies 4-6 cm in length, 0.5– 1 cm in broad, growing either singly or in groups which are typically seen emerging from soil, dark brown, becoming darker at maturity.

1-5 cm

10-11 cm

2-3 cm

8-9 cm

5 cm

Cap Diameter

Table 1: Showing scientific name, location, habitat, morphological characters and edibility status of mushrooms.

Non edible

Non edible

---

Edible

Non edible

Edible

Edible

Non edible

Edible

Edible

Edible or non edible

Sanjit Debnath et.al.  | 209

Lab. Accession Number

MCCT 47

MCCT 48

MCCT 49

MCCT 50

MCCT 51

MCCT 52

MCCT 53

MCCT 54

MCCT 55

MCCT 56

MCCT 57

MCCT 62

Sl. No.

11

12

13

14

15

16

17

18

19

20

21

22

Termitomyces sp.2

Termitomyces sp.1

Lentinus sp.3

Thelephora sp.

Polyporus sp.

Geastrum sp.

Marasmius sp.5

Marasmius sp.4

Lentinus sp.2

Marasmius sp.3

Marasmius sp.2

Auricularia sp.

Scientific Name

28/09/2014, Salbagan (West Tripura)

26/09/2014, Suryamaninagar (West Tripura)

12/09/14, Hatipara (West Tripura)

02/09/14, Salbagan (West Tripura)

02/09/14, Salbagan (West Tripura)

02/09/14, Salbagan (West Tripura)

02/09/14, Salbagan (West Tripura)

02/09/14, Salbagan (West Tripura)

02/09/14, Salbagan (West Tripura)

02/09/14, Salbagan (West Tripura)

02/09/14, Salbagan (West Tripura)

02/09/14, Salbagan (West Tripura)

Date of collection and location

On soil

On soil

On dead plant

On soil

On decaying leaf

On decaying leaf of Sal

On decaying leaf of Sal

On soil

On decaying wood

On soil with shaded area

On soil with shaded area

On dead wood

Habitat

Cap Shape

Cap Colour

Stipe Length

Stipe Colour

Convex to Applanate

Conic

Infundibuliform

Convex

Convex to Applanate

Pale orange

Creame to White

Dark Brown

Red to White

Orange to White

5 cm

4.5 cm

9 cm

3 cm

3-3.5 cm

Pale orange

White

Dark Brown

Yellow

Yellow

2-2.5 cm

15-17 cm

6-6.5 cm

Applanate

Umbonate

Infundibuliform

Cream

Cream

White to Cream

6-6.5 cm

28 cm

10 cm

Cream

Cream

White

Hymenophorephore commonly rosette i.e., finger like, several erect, and in central base.

Semicircular, 3×4 cm wide.

Small egg shaped ball. In maturity the outer skin peeling back to form 5-7 coloured brownish hygroscopic arms. Spores black.

1 cm

1-1.5 cm

5.5-6 cm

1 cm

2-2.5 cm

Fruit body ear to shell shaped or forming narrow, flabby elastic, 7×8 cm.

Cap Diameter

Edible

Edible

Non edible

Non edible

Non edible

Non edible

Non edible

Non edible

Non edible

Non edible

Edible

Edible or non edible

210  |  Checklist of Mushroom Diversity in West Tripura, North-East India

28 -

-

-

-

-

-

-

-

-

-

Polyporus sp

Termitomyces sp. 1

Termitomyces sp. 2

Thelephora sp

Tricholoma sp.

Xerulina sp.

Xylaria sp.

Unidentified

-

-

Schizophyllum sp.

-

-

-

-

Marasmius sp. 5

Mycena sp.

-

-

-

-

-

-

-

-

-

-

-

-

-

-

Marasmius sp. 3

-

60

-

-

-

-

-

-

-

R.K. Nagar

Marasmius sp. 4

-

-

-

Marasmius sp. 1

Marasmius sp. 2

-

-

Lentinus sp. 1 -

-

-

Lactarius sp.

-

25

-

Geastrum sp.

-

-

-

Auricularia sp.

Lentinus sp. 2

-

65

Agaricus sp.

Lentinus sp. 3

Suryamani nagar

Chanmari

Macrofungi

-

30

-

7

-

-

-

120

-

-

-

-

-

-

-

-

-

-

-

-

-

-

Mandwi

-

-

-

-

-

-

-

-

-

-

-

-

-

-

-

-

-

100

-

-

-

-

Lakechumohani

-

-

-

-

-

-

-

-

-

25

-

-

-

-

-

-

-

-

-

-

-

-

Jugendranagar

2

-

-

-

-

-

-

-

-

-

-

-

-

-

-

-

-

-

-

-

-

-

Bonikochumohai

Table 2: Showing checklist of fruit body count of mushrooms found in West Tripura, India.

-

-

15

-

90

25

-

-

120

-

20

4

6

4

-

-

1

-

-

120

3

-

Salbagan

-

-

-

-

-

-

-

-

-

-

-

-

-

-

-

30

-

-

-

-

-

-

Hatipara

Sanjit Debnath et.al.  | 211

212  |  Checklist of Mushroom Diversity in West Tripura, North-East India

Population of Mushroom ut of twenty two mushroom species Geastrum sp. (MCCT 53) Polyporus sp. (MCCT 54) O and Schizophyllum sp. (MCCT 25) were highly abundant (120 fruit body) in relation to number of samples collected. Lowest population of Lentinus sp.2 or MCCT 50 (1 fruit body) was observed. Geastrum sp. (MCCT 53) and Polyporus sp. (MCCT 54) from Salbagan and Schizophyllum sp. (MCCT 25) from Mandwi were highly abundant in occurrence. Lentinus sp.2 (MCCT 50) found in Salbagan was lowest abundant in occurrence. Numbers of fruit bodies of collected mushrooms are shown in Table 2. In nature, mushrooms grow in soil, on decaying organic matter, wood stumps, in association with living plant, or roots of living plant, etc. During the collection of mushrooms, it was observed that the mushrooms were dependent upon the habitat in which they occurred. This survey showed that rainy season was favorable for mushroom growth. The distribution and abundance of natural mushrooms is influenced by the natural factors (Swapna et al. 2008), like rains and availability of decomposed organic matters (Deepak et al. 2014). Occurrence of mushrooms in forest bed, village and plantation site was suggested a close relationship between mushroom population and forest health. Singer (1989) reported 1320 species belonging to 129 genera under Agaricales. A survey was conducted in Jeypore Reserve Forest, Assam by Tapwal et al. (2013) and revealed 30 macrofungi species representing 26 genera belonging to 17 families associated with different tree species. Among the collected species of macrofungi from forest of Shimoga District-Karnataka, India, only Schizophyllum sp. was the most frequent and abundant (Swapna et al. 2008). Krishnappam et al. (2014) reported Psythyrella sp., Armillaria sp. and Calocera sp. to be the most abundant genera during five years survey in Chikmagalur district of Western Ghats, India. Pushpa and Purushothama (2012) in a survey in scrub jungles and urban places in an around Bangalore, recorded 90 mushroom species, out of which maximum abundance of Coprinus disseminates, Coprinus fibrillosis and Schizophyllum commune. However, our investigation revealed that Geastrum sp. (MCCT 53), Polyporus sp. (MCCT 54) and Schizophyllum sp. (25) were highly abundant. The results of the presents study showed that out of 22 mushrooms, 11 mushrooms were collected from Salbagan forest area which depicted that Salbagan forest area was highly abundant and diverse in mushroom flora. The present study provides a checklist of wild mushroom diversity of West Tripura, North-East India.

Acknowledgements The authors are grateful to the Head, Department of Botany for providing all sorts of facilities. The first author is also thankful to the DBT, Government of India for the financial assistance.

REFERENCES Ajith, T.A., Janardhanan, K.K. 2007.Indian medicinal mushrooms as a source of antioxidant and antitumor agents. J. Clin. Biochem.Nutr.40: 157-162.

Sanjit Debnath et.al.  | 213

Arora, D. 2008. Notes on economic Mushrooms: Xiao RenRen: The little people of Yunnan. Econ. Bot.62: 514-544. Chang, S.T. and Miles, P.G., 1992. Mushroom Biology-a new discipline. The Mycologist.6: 64-65. Cooke, W.B. 1961. The genus Schizophyllum. Mycologia. 53: 575-99. Deepak, V., Anjuli, C., and Poonam, D. 2014. Biodiversity of Mushroom in Patharia forest of Sagar (M.P)-III. Int. J. Biodivers. Conserv. 6(8): 600-607. Deshmukh, S.K. 2004.Biodiversity of tropical basidiomycetes as sources of novel secondary metabolites.In Microbiology and Biotechnology for Sustainable Development (ed. P.C. Jain), CBS Publishers and Distributors, New Delhi.121-140. Dighton, J., White, J.M., Oudemans, P. 2005. The fungal community. Its organization and role in the ecosystem, 3rd edn. CRC, Boca Raton. Engola, A.P.O., Eilu, G., Kabasa, J.D., Kisovi, L., Munishi, P.K.T., and Olila, D.2007. Ecology of edible indigenous mushrooms of the Lake Victoria basin (Uganda). Res. J. B. Sci. 2(1): 62-68. Karwa A, Raj, M.K. 2010.Tapping into the edible fungi biodiversity of Central India. Biodiversitas. 11(02): 97-101. Krishnappam, Swapna, S., and Syed, A. 2014. Diversity of macrofungal communities in chikmagalur district of western ghats, india. Proceedings of the 8th international conference on mushroom biology and mushroom products (icmbmp8) 2014. Pegler, D. N. 1977. A Preliminary agaric flora of East Africa.Kew Bull. Addit. Ser.6: 1-615. Purkayastha, R.P. and Candra, A. 1985. Manual of Indian Edible Mushroom. Today and Tomorrow Printer and Publisher, New Delhi: 266. Pushpa, H. and Purushothama, K.B. 2012. Biodiversity of Mushrooms in and Around Bangalore (Karnataka), India. American-Eurasian J. Agric. & Environ. Sci. 12(6): 750759. Svrcek, M. 1998. The Illustrated Book of Mushrooms. Caxton ed., London, UK. 19. Singer, R. 1989. The Agaricales in modern taxonomy.4th ed. J. Cramer, Weinheim. 912. Swapna, S., Syed, A., and Krishnappa, M. 2008.Diversity of macrofungi in semi-evergreen and moist deciduous forest of Shimoga District Karnataka, India. J. Mycol. Plant Pathol. 38(1):21-26. Tapwal, A., Kumar, R. and Pandey, S. 2013. Diversity and frequency of macrofungi associated with wet ever green tropical forest in Assam, India. Biodiversitas.14: 7378.

mmm

Trends in Frontal Areas of Plant Science Research Edited by: S. Sinha, R.K. Sinha © Department of Botany, Tripura University, 2017

Effects of pH, Carbon and Nitrogen Sources on Mycelial Growth of Fusarium sporotrichioides in Submerged Culture Condition Pintu Karmakar1*, Koyel Sen Gupta2, Swati Gupta-Bhattacharya2, Panna Das3 and Ajay Krishna Saha1 1

Mycology and Plant Pathology Laboratory, 3Microbiology Laboratory Department of Botany, Tripura University, Suryamaninagar-799 022, Tripura, India 2 Division of Plant Biology, Bose Institute, Main campus-93/1,Acharya Prafulla Chandra Road, Kolkata-700 009 * Corresponding author: [email protected]

Summary The effects of carbon source, nitrogen source and pH on the mycelial growth of the Fusarium sporotrichioides in submerged culture were evaluated. Among the 5 carbon sources tested, the highest growth was found in lactose as carbon source which is slightly higher than that of sucrose supplemented medium. The highest mycelial submerged growth was recorded in peptone as nitrogen source. The maximum biomass production was observed at pH 6. The results showed that fungal growth decreased gradually at pH higher than 6. Key words: Fusarium sporotrichioides, Carbon source, Nitrogen source, pH, Biomass The genus Fusarium has been considered as one of the very interesting and important group of fungus because of its diversity and cosmopolitan distribution. They produce dormant structures, mostly in the form of chlamydospores to keep on living in soils for many years before these structures are stimulated to grow. Fusarium species produce three types of spores viz. micro-conidia, macro-conidia and chlamydospore. The genus Fusarium is common in temperate and tropical areas of the world. It has also been isolated from avocado fruit, bean, cabbage, hemp, soybean, etc. It produces toxins such as zearelenone and zerelenol (Verma et al., 1998), but its role in antigenic/allergenic activity is unclear. The knowledge of nutritional requirements is the main need in the cultivation of microorganisms using any cultural technique. Carbon is the major component and the molecules of carbon also contribute to oxygen and hydrogen. The media components are responsible for the mycelial growth and spore yield. Although the saprophytic fungi

216  |  Effects of pH, Carbon and Nitrogen Sources on Mycelial Growth of Fusarium sporotrichioides...

utilize a range of nutrient sources but for the mass production and commercialization, simple and cheap media are needed (Shah and Tarik, 2005). For the full growth of microorganisms, the macro elements like carbon, hydrogen, oxygen, sulphur, phosphorus and nitrogen are required which are the components of carbohydrates, nucleic acids and proteins. In addition to growth substances the growth characteristics are useful in the tolerance selection studies. The present work was undertaken to study the effects of pH, different carbon and nitrogen sources on mycelial growth of Fusarium sporotrichioides collected from air for understanding the nutritional requirements and ecological survival of the isolate.

Materials and Methods Source of Microorganism Fusarium sporotrichioides was collected with the aid of Anderson two stage Airsampler from the air .This fungus was morphologically identified from Agharkar Research Institute, Pune having the Accession No. 3939. This fungus was cultured on Malt Extract Agar with 15% agar (Himedia), 15% malt (Himedia) and 5% peptone (Himedia) and used as stock. Composition of Basal Synthetic Medium Glucose 30 g; Yeast extract 1 g; Peptone 2.5 g ; MgSO4 0.5 g; CaCO3 0.5g; Monopotassium phosphate 0.25g; FeCl3 10 mg; ZnSO4 0.1 mg ; Inositol 50 mg ; Thiamine 100 mg ; Biotin 50 µg ; CaCl2 (0.1M)- 5 ml and Distilled water 1L. Effects of pH on Mycelial Growth Six different pH gradients ranging from 5 to 10 with a difference of 1 were prepared by using either N/10 HCl or NaOH before autoclaving. 30 ml of the basal medium was taken in each conical flask and three replicates of each set were used. The flasks were sterilised by autoclaving at 15 psi for 20 minutes. Sterilized media were inoculated with 4 mm mycelial discs. Flasks were then incubated at 28ºC ± 2ºC. Mycelium was harvested after 21 days of incubation. Dry mycelial weight was taken after drying the biomass in an oven at 60 0c overnight and expressed as dry weight of mycelia (gm/ 30ml). Effects of Carbon Source on Mycelial Growth To find out the effects of carbon and nitrogen sources on mycelial growth of Fusarium sporotrichioides, the basal medium was used. Glucose was replaced separately by the different carbon sources such as lactose, sucrose, fructose, xylose and starch in this basal medium. Each flask containing 30 ml basal media, glucose was substituted with a carbon source to be tested was inoculated in triplicate with 4 mm mycelial discs and incubated at 280c ± 20c. Control set did not contain any carbon compound. After 21days of incubation dry mycelial weight was taken by drying the biomass in an oven at 600 C overnight and expressed as dry weight of mycelia (gm/ 30ml).

Pintu Karmakar et.al.  | 217

Effects of Nitrogen Source on Mycelial Growth Basal medium was used for studying the effect of different nitrogen sources on the mycelial growth of the fungus. The quantity of various nitrogen sources like potassium nitrate, ammonium nitrate, yeast extract, casein and peptone was supplemented just like the amount of peptone present in the basal medium. Control set did not contain any nitrogen compound. Sterilized media were inoculated with 4 mm mycelial discs in triplicate for each nitrogen source and incubated at 280c ± 20c. Mycelia was harvested after 21 days of incubation. Dry mycelial weight was taken after drying the biomass in an oven at 600 C overnight and expressed as dry weight of mycelia (gm/ 30ml). Statistical Analysis Average Mean and standard error calculation was done by Origin 7.0.

Results and Discussion The present investigation was conducted to study the effect of pH, carbon and nitrogen sources on mycelial growth of Fusarium sporotrichioides. To find out the most suitable carbon source for mycelial growth of Fusarium sporotrichioides various types of carbon sources including lactose, sucrose, fructose, xylose, and starch were supplemented instead of glucose as the carbon source in the basal medium. Submerged growth of Fusarium sporotrichioides varied in different carbon sources. The results of this investigation indicated maximum growth was observed in medium containing lactose (0.379gm/ 30 ml) after 21 days of incubation (Table 1 and Fig. 2c). Medium containing sucrose and fructose also showed effect on the growth of Fusarium sporotrichioides. These results were found in proximity with the findings of Ray (2004) who showed that lactose and glucose had similar effect on growth of Botryodiplodia theobromae.

Fig 1: Morphology of Fusarium sporotrichioides a= Fusarium sporotrichioides showing the mycelial growth and b= showing microscopic picture of the micro and macro conidia.

218  |  Effects of pH, Carbon and Nitrogen Sources on Mycelial Growth of Fusarium sporotrichioides... Table 1: Total biomass production of Fusarium sporotrichioides as influenced by carbon sources SL No.

Carbon Source

Dry weight of mycelia (gm/30 ml)*

1

Control

0.210±0.003

2

Lactose

0.379±0.005

3

Sucrose

0.372±0.059

4

Fructose

0.270±0.009

5

Xylose

0.235±0.040

6

Starch

0.247±0.067

*Data represent Mean ± SE Table 2: Total biomass production of Fusarium sporotrichioides as influenced by nitrogen sources SL No.

Nitrogen Source

Dry weight of mycelia (gm/30 ml)

1

Control

0.180+0.003

2

Potassium nitrate

0.282±0.052

3

Ammonium nitrate

0.207±0.024

4

Casein

0.278±0.008

5

Yeast extract

0.220±0.019

6

Peptone

0.360±0.014

*Data represent Mean ± SE from 3 replicates Table 3: Effect of different pH on the growth of Fusarium sporotrichioides. SL No.

pH

Dry weight of mycelia (gm/30 ml)

1

Control

0.148±0.002

2

pH-5

0.268±0.008

3

pH-6

0.278±0.012

4

pH-7

0.251±0.042

5

pH-8

0.216±0.048

6

pH-9

0.212±0.058

7

pH-10

0.149±0.057

Pintu Karmakar et.al.  | 219

Fig 2: Growth of Fusarium sporotrichioides with different carbon and nitrogen source and pH on submerged culture condition. 2a- showing the effects of carbon source, 2b- showing the effect of nitrogen source and 2c – showing the effect of pH at different range on biomass production.

To investigate the effect of nitrogen sources on mycelial growth of the test fungi grew on the medium containing various nitrogen sources separately. Among the five nitrogen sources tested, maximum growth was found in peptone (0.360gm/ 30 ml) followed by

220  |  Effects of pH, Carbon and Nitrogen Sources on Mycelial Growth of Fusarium sporotrichioides...

potassium nitrate (0.282gm/ 30 ml) after 21 days of incubation ( Table 2 and Fig 2b). Lowest growth was found in control which was devoid of nitrogen . Holb and Chauhan (2005) observed that peptone was the best nitrogen source that promoted quickest growth of Monilia polystroma. Saha et al., (2008) found maximum growth of Lasiodiplodia theobromae in beef extract (310 mg) followed by peptone (305 mg) and potassium nitrate (268.1 mg) which is similar with our findings. Growth of the fungus influenced by increasing or decreasing the pH level from the neutral level. This fungus can tolerate a wide range of pH 5– pH 10. Mean dry weight of mycelium weight of the fungus on different pH levels was calculated and shown in Table 3. Results showed that Fusarium sporotrichioides grew maximum in pH 6.0 (dry mycelial weight 0.278gm/ 30 ml) (Table 3 and Fig. 2c). At high acidic range of pH, the fungi showed very poor growth of mycelium. Growth of fungi increased with increase in pH up to 6 and then decreased growth was observed pH higher than 6. Imran Khan et al., (2011) showed optimum pH for growth of F. oxysporum and F. ciceri ranged from 6.5 to 7.0. Kishore et al. (2009) and Groenewald (2005); also found pH 5.5 to 7.0 was the best for growth and sporulation of Fusarium oxysporum f. sp. lini ( Belley), which is also in a conformaty with our result. In conclusion, different pH strongly influenced the growth of Fusarium sporotrichioides. Maximum biomass obtained at pH 6. The different carbon and nitrogen sources supplemented to the culture broth differentially influenced the growth of the airborne fungi Fusarium sporotrichioides. Lactose and sucrose was the best carbon source for the growth of the test fungi. Peptone and KNO3 could be the potential nitrogen source for the growth of Fusarium sporotrichioides.

Acknowledgements The authors are thankful to Head of Department of Botany, Tripura University for providing Laboratory facility. The first author is grateful to DBT, Govt. of India for financial support.

REFERENCES Groenewald, S. 2005. Biology, Pathogenicity and Diversity of Fusarium oxysporum f. sp. cubense. M.Sc. (Agri.) Thesis. Faculty of Natural and Agricultural Science, Universiity of Pretoria etd, Pretoria. p. 176. Holb, I.J., and S.V.S. Chauhan, 2005. Effect of carbohydrate and nitrogen sources on the growth rates of Monilia fructigena and M. polystroma isolates. J. Mycol. Plant Pathol., 35:128-131. Imran Khan, H. S., Saifulla M., Mahesh, S. B. & Pallavi, M.S., 2011. Effect of Different Media and Environmental conditions on the growth of Fusarium oxysporum f. sp. ciceri Causing Fusarium Wilt of Chich pea, International Journal of Science and Nature, Kishore, R., Pandey, M., Dubey, K. and Kumar, Y. 2009. Effect of Temperature and pH on

Pintu Karmakar et.al.  | 221

Growth and Sporulation of Fusarium moniliforme V. subglutinans Wr. and Rg., The Causal Organism of Wilt of Maize. Bio. J. 4 (1,2): 75-78. Saha, A., Mandal P., Dasgupta S.and D. Saha, 2008. Influence of culture media and environmental factors on mycelial growth and sporulation of Lasiodiplodia theobromae (Pat.) Griffon and Maubl. 29(3): 407-410. Shah FA, Tariq MB. FEMS Microbiol. Lett. 2005, 250 (2): 201-207. Ray, R.C.: 2004. Extracellular amylase (production by fungi) Botryodiplodia theobromae and Rhizopus oryzae grown on cassava starch residue.J. Environ. Biol., 25, 489-495 . Verma J, Sridhara S, Rai D. Gangal SV.,1998, Isolation and immunobiochemical characterization of a major allergen(65 kDa) from Fusarium equiseti. Aliergy .53:111315.

mmm

Trends in Frontal Areas of Plant Science Research Edited by: S. Sinha, R.K. Sinha © Department of Botany, Tripura University, 2017

Phylloplane and Endophytic Fungal Diversity in Ananus comosus L. of Sepahijala District of Tripura and Antioxidant Potential of Two Isolated Endophytes Sanchita Bhattacharya1*, Ajay Krishna Saha1 and Panna Das2 1

Mycology and Plant Pathology Laboratory, 2Microbiology Laboratory Department of Botany, Tripura University *Corresponding author: [email protected].

Summary Pineapple (Ananus comosus L.) is a natural fruit of Tripura. Queen and Kew are the two main cultivars grown in different parts of Tripura. The present investigation was conducted to document phylloplane fungi from green, senescing and decomposing leaf and endophytic fungi from green leaf and root of Queen variety of pineapple plant which is extensively cultivated in Sepahijala district. Though seven fungal species were isolated during fruiting and non-fruiting seasons only two leaf endophytic fungal species Lasiodiplodia theobromae and Penicillium sclerotiorum were screened for antioxidant activity by DPPH (Diphenyl Picryl Hydrazil) radical scavenging assay. Both of the fungal endophytes exhibited differential potential of antioxidant activity and the results have been analyzed as well. Keywords: Ananus comosus L., endophyte, Lasiodiplodia theobromae, Penicillium sclerotiorum, antioxidant activity. Different fungal assemblages are present in each part of the substratum of each host. Phylloplane fungi, endophytes, wood-attacking fungi, litter decomposing fungi, plant parasitic fungi, root-inhabiting fungi and mycorrhizal fungi are found in the various niches of only one tree. Phyllosphere fungi that include endophytes and epiphytes colonize the interior and the surface, thereby occupying two distinct habitats of the leaf (Petrini 1991). Phyllosphere fungi occur not only on living leaves but also on decomposing leaves at the initial stages of decomposition. Endophytes are the microbes that colonize living internal tissues of plants, without causing any immediate overt negative effect (Bacon & White, 2000), are found in diverse habitats. They reside asymptotically within most living tissues of plants. Numerous bioactive molecules have been isolated from endophytic fungi Strobel and Daisy, 2004.

224  |  Phylloplane and Endophytic Fungal Diversity in Ananus comosus L. of Sepahijala District...

Antioxidants may protect the body by scavenging the reactive metabolites (Sen 1995; Hegde and Joshi 2009). Therefore, it is of great importance to find new sources of safe and inexpensive antioxidants of natural origin (Murthi et al. 2011). DPPH assay is one of the most widely used methods for screening antioxidant activity of natural products (Pushpalatha et al. 2011). The natural antioxidants were characterized from the fungal compounds by Sun et al. (2004). Pineapple (Ananas comosus L.), a natural fruit of Tripura state, grows extensively under favourable subtropical agro-climatic conditions. Queen and Kew are the main cultivars grown in different parts of Tripura and are available during mid May to mid September. The main season is June-July and off- season is during the month from October to December. The present study was aimed to document phylloplane fungi from green, senescing and decomposing leaf and endophytic fungi from green leaf and root of the host plant Ananas comosus L along with the evaluation of antioxidant potential of two dominant endophytes isolated from leaf.

Materials and Methods Selection of Site Two experimental sites were selected for sampling from Sepahijala districts which were Banerjeebagan, Jumerdepa (N23°34.273’ E091°21.133’) and Kamrangatali (N23°29.304’ E091°22.679’). Collection of Explants Collection of explants was carried out from January 2014 to April 2015. Fruiting season and non-fruiting season were marked from March to October and from November to February respectively. Leaves and roots of healthy and disease free Ananas comosus L plants were selected from experimental sites in sterile polythene bags and processed within 24 hours of collection. Attached leaves were separated into living (green) and senescent (yellow) leaves. Leaves from the litter layer were collected as leaves of decomposing state.

Fig. 1: Ananus comosus ev. Queen plant.

Fig. 2: Explants; a-green leaf, b-senescing leaf, c-decomposed leaf and d-root.

Sanchita Bhattacharya et.al.  | 225

Isolation and Identification of Epiphytic and Endophytic Fungi Leaf disk /leaf pieces were obtained from green, senescing and decomposed leaves and subjected to washing techniques (Abdel-Fatth et al. 1977), placed on 2% Malt Extract Agar (MEA) added with Chloramphenicol (50mg/lit), and incubated for 48 h of incubation at 23±2°C in darkness. For isolation of endophytic fungi, surface sterilization of explants (root and green leaf) was done. Teased tissue pieces were placed on Potato-Dextrose-Agar (PDA) medium or MEA (Malt Extract Agar) medium supplemented with Streptomycin (50mg/lit) to suppress bacterial growth and incubated at 30°C for 21 days. For identification of fungi Macroscopic characteristics of colonies (color, consistency) and microscopic characteristics (morphology of vegetative and reproductive structures) were observed. The standard manuals and literatures were used for identification of fungi (Ellis 1971; Domsch et al. 1980; Watanabe 2002). Identification was authenticated by morphological or Molecular identification (ITS sequence of rDNA ) by Agharkar Research Institute (NFCCI , Pune). In the present investigation, Colonization rate (CR), Isolation rate (IR), Relative frequency (RF) (Photita et al. 2001, and Colonization frequency (CF) (Hata and Futai 1995) were determined. Production of Fungal Extract The endophytic fungi was cultured in 100ml Erlenmeyer flasks containing Malt extract broth for 30 days at 25°C under stationary conditions. The inoculum was prepared by cutting disc of mycelial agar from eight days old culture. After 30 days, the mycelial biomass was separated from the liquid medium. The biomass was extracted two times with methanol to determine the bioactivity of the mycelia mat. Then filtering was done through Whatman No.4 filter paper and the remaining solvent was removed by rotary evaporation at 40°C (ROTAVAP:PBV-7D). The samples were stored in a freezer at -20 °C. Scavenging Activity Against DPPH Radicals Antioxidant activity was determined by slightly modified method of Mau et al. (2004). Dried fungal biomass extract (125- 16000 µg/ml) in methanol (4 ml) was mixed with 1 ml of a methanolic solution containing DPPH (Sigma) to make a final concentration of 0.2 mM. The mixture was shaken vigorously and left to stand for 30 min in dark and the absorbance was measured at 517 nm against a blank. EC50 (µg/ml) is the effective concentration at which DPPH radical were scavenged by 50% and was obtained by interpolation from linear regression analysis. Ascorbic acid was used as a control. Inhibition of free radical by DPPH in percent (%) was calculated as follows: Percentage (%) of inhibition= [(A Blank – A Sample) / A Blank] ×100. Where, A Blank is the absorbance of the control reaction and A Sample is the absorbance of the test compound.

226  |  Phylloplane and Endophytic Fungal Diversity in Ananus comosus L. of Sepahijala District...

Results and Discussion Seven fungal species isolated from collected explants exhibited explant-wise differential pattern of distribution. Of them, Lasiodiplodia theobromae (MPL/A/24), Daldinia eschscholtzii (MPL/A/16) and Penicillium sclerotiorum (MPL/A/12) were endophytes whereas Aspergillus flavus (MPL/A/11), Fusarium sp. (MPL/A/21) and Trichoderma harzianum (MPL/A/17) were isolated as epiphyte and as well as endophytes. Mucor mucedo (MPL/ A/3a) was only isolated as epiphyte. Trichoderma harzianum, Penicillium sclerotiorum and Fusarium sp. were isolated from leaf and root explants of wild Rubber tree as endophytes (Ghazis and Chaverri, 2010). Tejesvi et al. (2006) isolated endophytic fungal species Fusarium sp. and Trichoderma sp, from inner bark segments of ethno-pharmaceutically important trees. Endophytic association of Lasiodiplodia theobromae with the host plant was reported and it can be a producer of biological compound (Orlandelli et al. 2012).

Fig. 3: Microphotographs of isolated fungal species a:Mucor mucedo, b: Fusarium sp, c:Aspergillus flavus, d:Penicillium sclerotiorum., e: Daldinia eschscholtzii, f: Trichoderma harzianum and g: Lasiodiplodia theobromae.

Colonization rate (CR) and Isolation rate (IR) of fungal species was higher in leaf in both seasons as compared to root. CR of explants in both the seasons was slightly higher in site II (Table 1).

Sanchita Bhattacharya et.al.  | 227 Table 1: Colonization and isolation rate of fungal species (Endophytes) Site

Fruiting season Leaf *CR

Non fruiting season Root

**IR

CR

Leaf IR

CR

Root IR

CR

IR

Site I

87.5

1.05

67.5

0.83

80.0

0.92

57.50

0.65

Site II

82.5

1.08

60.0

0.76

77.5

0.8

55.00

0.72

[*CR-Colonization Rate, **IR-Isolation Rate]

Among the epiphytic fungi isolated from green leaf and senescing leaf, relative frequency of Fusarium sp was highest in both the seasons at both sites. But in decomposing leaf, Mucor mucedo recorded highest relative frequency in site I and Aspergillus flavus recorded highest relative frequency in site II during the period of study (Table 2). Table 2: Relative frequency of epiphytic fungi from green, senescencing and decomposed leaves. Site

Site I

Site II

Name of fungal Species/ Explants

Fruiting season

Non-Fruiting season

Green leaf

Senescing leaf

Decomposed leaf

Green leaf

Senescing leaf

Decomposed leaf

Aspergillus flavus

-

31.57

36.36

-

-

22.85

Fusarium sp.

68.75

44.73

-

68.42

56.67

-

Mucor mucedo

-

23.68

63.63

-

43.33

45.71

Trichoderma harzianum

31.57

-

-

31.57

-

31.42

Aspergillus flavus

-

-

43.24

-

-

69.44

Fusarium sp.

70.96

67.64

24.32

70.00

63.63

-

Mucor mucedo

-

-

32.43

-

-

30.56

Trichoderma harzianum

29.03

32.35

-

30.00

36.36

-

Among isolated endophytes, relative frequency and colonization frequency of L. theobromae was highest in leaf and root in both seasons. However, site wise variations were also observed. P. sclerotiorum was found next to L. theobromae in fruiting seasons of site I. But in non fruiting season of site I, P. sclerotiorum and T. harzianum were found next to L. theobromae in leaf and root respectively. In site II, P. sclerotiorum was found next to L. theobromae during fruiting season of leaf only. T. harzianum was recorded next to L. theobromae during fruiting seasons of root only. But in non fruiting season of site II, P. sclerotiorum was found next to L. theobromae in both leaf and root (Table 3)

228  |  Phylloplane and Endophytic Fungal Diversity in Ananus comosus L. of Sepahijala District... Table 3: Relative frequency and Colonization frequency of fungal endophytes: Site

Site I

Site II

Name of the fungal species

Fruiting season Leaf

Non fruiting season

Root

Leaf

Root

*RF

**CF

RF

CF

RF

CF

RF

CF

Aspergillus flavus

-

-

12.12

7.40

-

-

-

-

Daldinia eschscholtzii

19.04

14.28

-

-

18.91

18.75

-

-

Fusarium sp.

11.90

11.42

-

-

-

-

19.23

21.73

Lasiodiplodia theobromae

45.23

45.71

42.42

40.74

45.94

50.00

57.69

52.17

Penicillium sclerotiorum

23.80

28.57

27.27

33.33

35.13

31.25

-

-

Trichoderma harzianum

-

-

18.18

18.51

-

-

23.07

26.08

Aspergillus flavus

-

-

19.35

12.50

-

-

-

-

Daldinia eschscholtzii

16.27

9.09

-

-

-

-

-

-

Fusarium sp.

13.95

9.09

-

-

-

-

-

-

Lasiodiplodia theobromae

48.23

60.60

51.61

50.00

53.73

58.06

62.06

63.63

Penicillium sclerotiorum

20.93

21.21

-

-

40.62

41.93

20.68

27.27

Trichoderma harzianum

-

-

29.03

37.50

-

-

17.21

13.63

[*RF-Relative Frequency, **CF- Colonization Frequency]

Fig. 2:  Free Radical Scavenging activity of endophytic fungi Penicillium sclerotiorum (MPL/A/12) and Lasiodiplodia theobromae (MPL/A/24).

Depending on relative frequency of two dominant endophytes, Lasiodiplodia theobromae

Sanchita Bhattacharya et.al.  | 229

(MPL/A/24) and Penicillium sclerotiorum (MPL/A/12) were selected for evaluation of antioxidant potential by DPPH assay. Endophytic fungi reported to have antioxidant components like flavonoids, carotenoids, phenolics, tannin and ascorbic acids that were also known to exhibit free radicals scavenging activity (Kumarasen et al. 2015) The methanolic extract against DPPH radical showed maximum inhibition of 68.78 % at the maximum concentration of 16000 µg/ml for Lasiodiplodia theobromae (MPL/A/24) and 85.44 % at the maximum concentration of 16000 µg/ml for Penicillium sclerotiorum (MPL/A/12). EC50 value of Lasiodiplodia theobromae and Penicillium sclerotiorum were recorded as 1018 µg/ml and 502 µg/ml, respectively, whereas EC50 value of ascorbic acid was 75 µg/ml. Fusarium sp. and Penicillium sp. were isolated as endophyte from Lobelia nicotianifolia and subjected to antioxidant activity by DPPH method and EC50 value against DPPH radical was found to be 320 µg/mL for Penicillium extract (Murthy et al. 2011). Documentation of fungal community showed variation in non-fruiting and fruiting seasons as well as also in green leaf, senescence leaf and decomposing leaf. Methanolic extract of studied endophytes may be considered to act as primary antioxidant.

REFERENCES Abdel-Fattah, H. M., Moubasher, A. H. and Abdel-Hafez, S. I. I. 1977. Fungus flora of root and leaf surface of broad bean cultivated in Oases, Egypt. Naturalia Monspeliensia Ser. Bot. 27: 167-177. Bacon CW, White JF. 2000 – Microbial Endo-phytes. Marcel Deker, NewYork, USA. Domsch K.H, Gams W, Anderson T.H. 1980. Compendium of soil fungi Vol.1. Academic Press (London) Ltd. Ellis, M. B. 1971. Dematiaceous hypomycetes, CAB International. Gazis, R and Chaverri, P. 2010 Diversity of funga lendophytes of leaves and stems of wild rubber trees (Hevea brasiliensis) in peru. Fungal ecology 3: 240 – 254. Hata, F. and Futai, K. 1995 – Endophytic fungi associated with healthy pine needles and needles infested by pine needle gall midge Thecodiplosis japonensis. Cana-dian Journal of Botany 73: 384–390. Hegde, K. and Joshi, A.B. 2009. Hepatoprotective effect of Carissa carandas Linn root extract against CCl4 and paracetamol induced hepatic oxidative stress. Ind J Exp Biol. 47: 660‐667. Kumaresan, V. Karthi, V. Senthilkumar, B.S. Balakumar and A. Stephen. 2015. Biochemical Constituents and Antioxidant Potential of Endophytic Fungi isolated from the Leaves of Azadirachta indica A. Juss (Neem) from Chennai, India. JAIR.3 (8):355-359. Itamar, S. Melo, Suikinai N. Santos, Luiz H. Rosa, Marcia M. Parma, Leonardo J. Silva, Sonia C. N. Queiroz and Vivian H. Pellizari. 2014. Isolation and biological activities of an endophytic Mortierella alpina strain from the Antarctic moss Schistidium antarctici. Extremophiles, 18:15-23.

230  |  Phylloplane and Endophytic Fungal Diversity in Ananus comosus L. of Sepahijala District...

Mau, J.L., Huang, P.N., Hung, S.J., and Chen, C.C. 2004, Antioxidant property of methanolic extracts from two kinds of Antrodia camphorata mycelia. Food Chem. 86: 25-31. Murthy, N.K, Pushpalatha, K. C. and Joshi, C. G. 2011, Antioxidant activity and phytochemical analysis of endophytic fungi isolated from Lobelia nicotianifolia. J. Chem. Pharm. Res., 3(5):218-225. Orlandelli, R.C., Alberto, R.N., Almeida, T.T., Azevedo, J.L. and Pamphile, J.A. 2012. In vitro Antibacterial Activity of Crude Extracts Produced by Endophytic Fungi Isolated from Piper hispidum Sw. Journal of Applied Pharmaceutical Science. 2(10):137-141. Osono, T., 2002. Phyllosphere fungi on leaf litter of Fagus crenata: occurrence, colonization, and succession, Canadian Journal of Botany, 80 (5): 460-469. Petrini, O. 1991. Fungal endophytes of tree leaves. In: Andrews JH,Hirano SS (eds) Microbial ecology of leaves. Springer, BerlinHeidelberg New York, pp 179–197. Photita, W., Lumyoug, S., Lumyoug, P., Hyde, and K. D. 2001 – Endophytic fungi of wild banana (Musa acuminate) at Doi Suthep Pui National Park, Thailand. Mycological Re-search 105:1508-1513. Sen, C.K. 1995. Oxygen toxicity and antioxidants: state of the art. Ind J Physiol Pharmacol 39: 177‐196. Strobel, G., and Daisy, B .2003. Bioprospecting for Microbial Endophytes and Their Natural Products. Microbiology and molecular biology reviews, 67(4): 491–502 Sun, C., Wang, J.W., Fang, L., Gao, X.D. and Tan, R.X. 2004. Free radical scavenging and antioxidant activities of EPS2, an exopolysaccharide produced by a marine filamentous fungus Keissleriella sp. YS 4108. Life Sci 75: 1063-1073. Tejesvi, M.V., Mahesh, B., Nalini, M.S., Prakash, H.S., Kini, K.R., Subbiah, V. and Shetty, H.S. 2006. Fungal endophyte assemblages from ethnopharmaceutically important medicinal trees. Can. J. Microbiol. 52: 427-435. Watanabe, T. 2002- Pictorial Atlas of soil and seed fungi: Morpholologies of cultured fungi and key to species. 2nd ed. CRC Press Florida US.

mmm

Trends in Frontal Areas of Plant Science Research Edited by: S. Sinha, R.K. Sinha © Department of Botany, Tripura University, 2017

Antibacterial Activity of Silver Nanoparticles Synthesized from Leaf Extract of Paspalum conjugatum P. J. Berguis Gopal Debnath1*, Panna Das2 and Ajay Krishna Saha1 1

Mycology and Plant pathology Laboratory, 2Microbiology Laboratory Department of Botany, Tripura University, Suryamaninagar- 799022, Tripura, India * Corresponding Author: [email protected]

Summary The present study was conducted to evaluate the antibacterial activity of silver nanoparticles synthesized from the leaf extract of Paspalum conjugatum as bioreductant. UV-visible studies of the subjected materials revealing the surface Plasmon resonance at 442 nm confirmed the formation of silver nanoparticles. Biosynthesized silver nanoparticles were tested for antibacterial activity against Gram-positive Bacillus subtilis (MTCC 619) and Staphylococcus aureus (MTCC 96) and also in Gram-negative E. coli (MTCC 40) and Pseudomonas aeruginosa (MTCC 424) bacteria by the disc diffusion method. Silver nanoparticles showed more antibacterial activity than silver (Ag) ion and aqueous extract of leaf.The result suggested that green synthesized silver nanoparticles can be used as effective growth inhibitors inantimicrobial control systems and can be used in generation of antibacterial drugs. Key words: Paspalum conjugatum, Silver nanoparticles, UV-Vis spectroscopy and Antibacterial activity. In recent years, nanotechnology has been emerging as a rapidly growing field with numerous applications in science and technology for the purpose of manufacturing new materials (Savithramma et al. 2011). The most important and distinct property of nanoparticles is that they exhibit larger surface area-to-volume ratio. Among the nanoparticles studied so far, extensive research has been done on silver nanoparticles (AgNPs) keeping in view of their potential bio-medical applications (Sasikala et al. 2015). Different types of metallic nanoparticles like copper, zinc, titanium, gold, and silver have been produced by biological methods. However, the interest in silver nanoparticles has been increasing due to their high antimicrobial activity against bacteria, viruses and eukaryotic microorganisms (Rai et al. 2008). Silver nanoparticles have wide application in biomedical science like treatment of burned patients, antimicrobial activity and used in the targeted drug delivery, and so forth (Singh et al. 2010). The most important

232  |  Antibacterial Activity of Silver Nanoparticles Synthesized from Leaf Extract of Paspalum...

application of silver and silver nanoparticles is in medical industries, in such medicines as topical ointments to prevent infection against burns and open wounds (Ip et al. 2006). The chemical procedures involved in the synthesis of nano-materials generate a large amount of hazardous byproducts as environmental contaminants (Zhang et al. 2008). The synthesis of metallic nanoparticles using a green procedure is of great interest in terms of introducing environment friendly synthesis procedures (Duran et al., 2011. The importance of these nanoparticles is recognized by the publication of many reviews on the biosynthesis and properties of metallic nanoparticles in the last 4 years (Rai et al. 2008; Mohanpuria et al. 2008; Bhattacharya and Mukherjee 2008; Schluesener 2008; Sharma et al. 2009; Singh et al. 2009; Korbekandi et al. 2009; Krumov et al. 2009; Kumar and Yadav, 2009, Arya, 2010; Blanco et al. 2010; Gade et al. 2010; Narayanan and Sakthivel, 2010; Popescu et al. 2010; and Zhang et al. 2011). The present study was focused to synthesize silver nanoparticles from the leaf extract of Paspalum conjugatum and to evaluate the antibacterial activity of synthesized nanoparticles on the growth of Gram-negative E. coli (MTCC 40) and Pseudomonas aeruginosa (MTCC 424) and also in Gram-positive bacteria Bacillus subtilis (MTCC 619) and Staphylococcus aureus (MTCC 96) bacteria.

Materials and Methods Leaves of Paspalum conjugatum was collected from Tripura University campus, Suryamaninagar and brought into the laboratory for further processing. Approximately 5g leaves were washed repeatedly with distilled water to remove all surface impurities. The cleaned leaf samples were then boiled with 100 ml double distilled water for 15 minutes. This solution was then filtered through Whatman filter paper no. 41 and stored in 40C for further experiment. An aqueous solution of 1mM of silver nitrate (99.99% Sigma Aldrich) was prepared and used for the synthesis of AgNPs. Five ml of leaf extract was added into 95 ml of 1mM silver nitrate solution to reduce Ag+ to Ag0 and incubated in Shaker incubator at 150 rpm in 37°C for 3 days which resulted in a change incolor (Nagajyothi et al. 2013). Synthesis of silver nanoparticles by reducing the silver ions solutions with leaf extract may be easily studied by UV-visible spectroscopy. The absorption spectra of the reaction mixture were measured using 200-700 nm range by “Perkin Elmer Lamda 25” spectrophotometer with scanning speed of 300 nm/minutes. For UV-Vis spectral analysis absorbance data were collected from spectrophotometer and plotted the data on software origin 7. Biosynthesized silver nanoparticles produced by the grass leaf extract of Paspalum conjugatum were tested for antibacterial activity against Gram-positive and Gram-negative bacteria by the disc diffusion method (Nene and Thapliyal, 1979). Test bacterial strains were collected from IMTECH Chandigarh, India. The selected bacterial strains of Gramnegative E. coli (MTCC 40),and Pseudomonas aeruginosa (MTCC 424) and Gram-positive Bacillus subtilis (MTCC 619) and Staphylococcus aureus (MTCC96) were sub-cultured. An

Gopal Debnath et.al.  | 233

aliquot of 40µl of each bacterial test strain was added into 3ml of nutrient broth (NB) and incubated at 370C at 160 rpm for 24 hours. Bacterial concentration of fresh culture was determined by measuring optical density (OD) at 600 nm wave length. Disc diffusion method was carried out by the bacterial suspension containing106 cells. About 20 ml of sterilized nutrient agar media was poured into each sterile petriplate and allowed to solidify. 100 µl of the test bacterial strain was evenly spread over the prepared plates by using a sterile glass spreader. Each Paper disc pouring separately with 10µl of distilled water (Negative control),crude grass leaf extract, silver nitrate solution (1mM), silver nanoparticle solution and antibiotic streptomycin (1mg/ml positive control) was then placed on prepared plates. These plates were incubated at 37oc for 24-48 hours. After the incubation period, results were recorded and the inhibition zone was expressed in mm.

Results and Discussion Five ml leaf extract of Paspalum conjugatum was added to 95ml aqueous silver nitrate solution (1mM), resulting in a rapid change in dark orange colour within 80 min due to excitation of surface plasmon vibration in metal nanoparticles. It was reported that silver nanoparticles exhibit dark orange color in aqueous solution due to excitation of surface plasmon vibrations in silver nanoparticles (Mulvaney et al. 1996 and Nagajyothi et al. 2013). Silver nanoparticles are known to exhibit a UV–Visible absorption maximum in the range of 400–500nm. In this report the formation of AgNPs was initially confirmed using UV– Visible spectroscopy due to Surface Plasmon Resonance phenomenon-SPR (Chudasama et al. 2009). According to Krasovskii and Karavanskii, 2008 the formation and stability of silver nanoparticles can be monitored by UV- Vis spectral analysis. In the present study UV–Vis spectra of the solution of leaf extract with silver nitrate (1 Mm) showed a strong broad peak at 442 nm (Fig. 1), which indicated the presence of AgNPs.

Fig. 1: UV-Vis spectrum of bio functionalized AgNPs showing surface plasmon peak at 442nm

234  |  Antibacterial Activity of Silver Nanoparticles Synthesized from Leaf Extract of Paspalum...

Fig. 2: Plates a) Staphylococcus aureusb) E. coli shows antibacterial activity of silver nanoparticles produced by leaf extract of Paspalumconjugatum against bacterial species, streptomycin(pcositive control). Leaf extract, silver nitrate (AgNO3) solution, silver nanoparticles solution (AgNPs) and distilled water (Negative control). Table 1: Antibacterial activity of silver nanoparticles Bacterial strain

Standard (positive control)

Silver nitrate (AgNO3)

Silver nanoparticles (AgNps)

Leaf extract

Distilled water (Negative control)

Staphylococcus aureus

16

7

10

0

0

Pseudomonas aeruginosa

14

6

9

0

0

Bacillus subtilis

22

7

9

0

0

E. coli

11

6

11

0

0

Antibacterial activity was investigated using disc diffusion method. The diameter of inhibition zone ( in mm) are shown in table 1: In case of Staphylococcus aureus the inhibition zone showed16 mm in Streptomycin (positive), 7mm in silver nitrate (AgNO3) and 10 mm in silver nanoparticles. In case ofPseudomonas aeruginosa the inhibition zone showed14 mm in Streptomycin (positive control), 6 mm in silver nitrate (AgNO3) and9 mm in silver nanoparticles (AgNPs) solution. In case of Bacillus subtilis the inhibition zone showed 22 mm in Streptomycin (positive control), showed7 mm in silver nitrate (AgNO3) and 9 mm in Silver nanoparticles (AgNPs) solution.In case of E. coli,the inhibition zone showed12 mm in streptomycin (positive control), 6 mm in silver nitrate (AgNO3) and11 mm in Silver nanoparticles (AgNPs) solution. In all sets leaf extract and distilled water (Negative control), no inhibition zone was foundInSilver nanoparticles (AgNPs),inhibition zone was found in all the test bacteria. Silver nanoparticles showed highest inhibition zone (11mm) in E. coli followed by 10 mm inhibition zone in Staphylococcus aureus. Comparatively lower inhibition zone (9mm) was recorded in both Pseudomonas aeruginosa and Bacillus subtilis.

Gopal Debnath et.al.  | 235

According to Gong et al. (2007) silver nanoparticles has made a remarkable comeback as a potential antimicrobial agent and proved to be most effective as it has good antimicrobial efficacy against bacteria, viruses and other eukaryotic micro-organisms. The use of silver nanoparticles is also important, as several pathogenic bacteria have developed resistance against various antibiotics. In this study,green synthesized AgNPs exhibited very good antibacterial activity against both Gram-positive (Staphylococcus aureus, Bacillus subtilis) and Gram-negative bacteria (Escherichia coli, Pseudomonas aeruginosa) than silver nitrate (AgNO3). Several workers have also investigated the antibacterial activity of biosynthesized silver nanoparticles against Staphylococcusaureus, Escherichia coli, P. aeruginosa and K. pneumonia. (Lok et al., 2007; Ruparelia et al., 2009; Amin et al., 2012; Kotakadi et al., 2013; Gaddam et al., 2014.) The silver nanoparticles biologically synthesized from grass leaf extract of Paspalum conjugatum may be used as effective growth inhibitors in antimicrobial control systems.The antibacterial property of the synthesized nanoparticles can be exploited in generating green antibacterial drugs.

Acknowledgements The authors are grateful to the Head, Department of Botany for providing all sorts of facilities. The first author is thankful to the UGC, Government of India for the financial assistance.

REFERENCES Amin, M., Anwar, F., Janjua, M.R.S.A., Iqbal, M.A., and Rashid, U. 2012. Green synthesis of silver nanoparticles through reduction with Solanum xanthocarpum L. Berry extract: characterization, antimicrobial and urease inhibitory activities against Helicobacter pylori. Int. J. Mol. Sci. 13: 9923–9941. Arya, V. 2010. Living systems: eco-friendly nanofactories. Digest J. Nanomater. Biostruct. 5: 9–21. Bhattacharya, R. and Mukherjee, P. 2008. Biological properties of “naked” metal nanoparticles. Adv. Drug Deliv. Rev. 60: 1289–1306. Blanco-Andujar, C., Tung, D. and Thanh, N.T.K. (2010). Synthesis of nanoparticles for biomedical applications. Annu. Rep. Prog. Chem. Sect. A. 106: 553–568. Chen, X. and Schluesener, H.J. 2008. Nanosilver: a nanoproduct in medical application. Toxicol. Lett. 176: 1–12. Chudasama, B., Vala, A., Andhariya, N., Mehta, R., and Upadhyay, R. 2009. Enhanced antibacterial activity of bifunctional Fe3O4-Ag core-shell nanostructures. Nano. Res. 2: 955-965. Dura ´n, N., Marcato, P.D., Dura ´n, M., Yadav, A., Gade, A. and Rai, M. 2011. Mechanistic aspects in the biogenic synthesis of extracellular metal nanoparticles by peptides, bacteria, fungi and plants. Appl. Microbiol. Botechnol. 90: 1609–1624.

236  |  Antibacterial Activity of Silver Nanoparticles Synthesized from Leaf Extract of Paspalum...

Duran, N., Marcat , P. D., Gade, A. A. and Rai, M. 2007. Fungi-mediated synthesis of silver nanoparticles: characterization processes and applications .Bio. Chem. Lab. Gaddam, S .A., Kotakadi , V. S., Sai Gopal, D. V. R. and Subba Rao, Y., and Reddy, A. V. 2014. Efficient and robust biofabrication of silver nanoparticles by cassia alata leaf extract and their antimicrobial activity. J. Nanostruct. Chem. 4:82. Gade, A., Ingle, A., Whiteley, C. and Rai, M. 2010a. Mycogenic metal nanoparticles: progress and applications. Biotechnol. Lett. 32: 593–600. Gong, P., Li, H., He, X., Wang, K., Hu, J., Tan, W. 2007. Preparation and antibacterial activity of Fe3O4 Ag nanoparticles. Nanotech. 18: 604–611. Ip, M., Lui, S.L., Poon, V.K.M., Lung, I., Burd, A. 2006. Antimicrobial activities of silver dressings: an in vitro comparison. J. Med. Microbiol. 55: 59–6. Kora, A., Arunachalam, J. 2011. Assessment of antibacterial activity of silver nanoparticles on Pseudomonas aeruginosa and its mechanism of action. World J. Microbiol. Biotechnol. 5: 1209–1216. Korbekandi, H., Iravani, S. and Abbasi, S. 2009. Production of nanoparticles using organisms. Crit. Rev. Biotechnol. 29: 279–306. Kotakadi, V.S., Subba R. Y., Gaddam, S.A., Prasad, T.N.V.K.V., Varada R. A., and Sai, G.D.V.R. 2013. Simple and rapid biosynthesis of stable silver nanoparticles using dried leaves of Catharanthus roseus Linn. G. Donn and its anti microbial activity. Colloi. Surf. B Biointer. 105:194–198. Krasovskii, V.V. and Karavanskii , A. 2008. Surface plasmon resonance of metal nanoparticles for interface characterization. Optic. Mem. and Neu. Net. 17: 8-14. Krumov, N., Perner-Nochta, I., Oder, S., Gotcheva, V., Angelov, A. and Posten, C. 2009. Production of inorganic nanoparticles by microorganisms. Chem. Eng. Technol. 32: 1026–1035. Kumar, V. and Yadav, S.K. 2009. Plant-mediated synthesis of silver and gold nanoparticles and their applications. J. Chem. Technol. Biotechnol. 84: 151–157. Lok, C., Ho, C., Chen, R., He, Q., Yu, W., Sun, H., Tam, P.K., Chiu, J., and Che, C. 2007. Silver nanoparticles: partial oxidation and antibacterial activities. J. Biol. Inorg. Chem.12: 527–534. Mohanpuria, P., Rana, N.K. and Yadav, S.K. 2008. Biosynthesis of nanoparticles: technological concepts and future applications. J. Nanopart. Res. 10: 507–517. Mulvaney, P. 1996. Surface plasmon spectroscopy of nanosized metal particles.Lang. 12: 788-800. Nagajyothi, P.C., Sreekanth, T.V.M., Lee J.I., and Lee K.D. 2014. Mycosynthesis: Antibacterial, antioxidant and antiproliferative activities of silver nanoparticles synthesized from Inonotus obliquus (Chaga mushroom) extract. Photochem. and Photobio. B: Biology.130: 299–304.

Gopal Debnath et.al.  | 237

Narayanan, K.B. and Sakthivel, N. 2010. Biological synthesis of metal nanoparticles by microbes. Adv. Colloid Interface Sci. 156: 1–13. Nene, Y.L.,Thapliyal.P.N.1979. Fungicides in Plant Disease Control. 2nd ed. New Delhi: Oxford and IBH Publishing Co. 507. Popescu, M., Velea, A. and Lo ˝rinczi, A. 2010. Biogenic production of nanoparticles. Digest J. Nanomater. Biostruct. 5: 1035–1040. Rai, M.K., Yadav, A.P. and Gade, A.K. 2008. Current trends in phytosynthesis of metal nanoparticles. Crit. Rev. Biotechnol. 28: 277–284. Ruparelia, J.P., Chatterjee, A.K., Duttagupta, S.P., and Mukherji, S. 2008. Strain specificity in antimicrobial activity of silver and copper nanoparticles.Acta. Biomater. 4: 707– 716. Sasikala, A., Rao, M. L.. Savithramma, N. and Prasad, T. N. V. K. V. 2015. Synthesis of silver nanoparticles from stem bark of Cochlospermum religiosum (L.) Alston: an important medicinal plant and evaluation of their antimicrobial efficacy . Appl. Nanosci.5: 827–835. Savithramma, N., Linga, R. M., Rukmini, K., and Suvarnalatha, D. P. 2011. Antimicrobial activity of silver nanoparticles synthesized by using medicinal plants. Inter J. of Chem. TechRes. 3: 1394–1402. Sharma, V.K., Yngard, R.A. and Lin, Y. 2009. Silver nanoparticles: green synthesis and their antimicrobial activities. Advan. Colloid Interface Sci. 145: 83–96. Singh, A., Jain, D., M. Upadhyay, K., Khandelwal, N., and Verma, H. N. 2010. Green synthesis of silver nanoparticles using Argemone mexicana leaf extract and evaluation of their antimicrobial activities,” Digest J. of Nanomat and Biostruc. 5: 483–489. Singh, M., Singh, S., Prasad, S. and Gambhir, I.S. 2009. Nanotechnology in medicine and antibacterial effect of silver nanoparticles. Digest J. Nanomater. Biostruct. 3: 115–122. Zhang, M., Liu, M. Prest, H. and Fischer, S. 2008.Nanoparticles secreted from ivy rootlets for surface climbing,” Nano Letters, 8:1277–1280. Zhang, X., Yan, S., Tyagi, R.D. and Surampalli, R.Y. 2011. Synthesis of nanoparticles by microorganisms and their application in enhancing microbiological reaction rates. Chemosphere 82: 489–494.

mmm

Trends in Frontal Areas of Plant Science Research Edited by: S. Sinha, R.K. Sinha © Department of Botany, Tripura University, 2017

Comparison of Arbuscular Mycorrhizal Fungal Colonization and Diversity of Two Different Rubber Plantations of Tripura, Northeast India Atithi Debnath1, Sudipta Sinha2, Krishna Talapatra1, Kripamoy Chakraborty1, Ajay Krishna Saha2 and Panna Das1* 1

Microbiology Laboratory, 2Mycology and Plant Pathology Laboratory, Department of Botany, Tripura University Suryamaninagar-799 022, Tripura, India *Correspondence author: [email protected]

Summary The present study was conducted to evaluate the colonization and species composition of arbuscular mycorrhizal (AM) fungal of two rubber plantation sites of Tripura. The roots of rubber trees in Takmachara showed higher AM colonization than Amtali plantation. A total of 1062.64 spores/ 100g and 780 spores/ 100g of soil were isolated from Amtali and Takmachara, respectively. 9 and 4 AM fungal morphotypes were found from Amtali and Takmachara, respectively. The genus Glomus represented the highest abundance in both the sites by 6 and 4 species from Amtali and Takmachara site, respectively. Keywords: Hevea brasiliensis AM fungal colonization, AM Fungal Spores Hevea brasiliensis Müll. Arg. is the main tree species exploited in the world for the production of natural rubber (Compagnon and D’Auzac 1986). Rubber is an important commercial crop in Tripura. The rubber plantation in Tripura extends to 50070 ha with a production of 23280 t as on 2008-09 (Rubber Board 2010). The term “Mycorrhiza” means literally “fungus root” it refer to the fact that fungi form many type of symbiotic association with the roots or other underground organ of plant (Kothamasi et al. 2001). Among soil microscopic organisms, the arbuscular mycorrhizal (AM) fungi play a very important role in natural ecosystems as well as in agroecosystems due to their capacity to form arbuscular mycorrhizae, which are considered to be the most widely distributed and important symbiotic association in nature (Brachmann and Parniske 2006). The AM fungi are all obligately biotrophic, depending on green plants to supply the carbon compounds essential for tissue production and survival (Ho and

240  |  Comparison of Arbuscular Mycorrhizal Fungal Colonization and Diversity of Two Different...

Trappe 1973). AM fungi may enhance water absorbing ability of plant from soil (Bi et al. 2001) thus promotes the plant growth (Mahendra et al. 2001). The occurrence of AM fungi was monitored by occurrence of spores (Wastie 1965). The practices such that crop rotation, fertilization, and tillage affect the composition and diversity of AM fungal communities as well as spore and mycelium densities and extent of infection in roots in temperate and tropical agroecosystems (Jansa et al. 2002, Oehl et al. 2003). Therefore, modern agroforestry and agricultural planting systems respect biological factors like mycorrhizal fungi as inevitable components of useful plants grown in monocultures (Sieverding 1991). Recently, Debnath et al. (2014) reported AM fungal colonization of plants and AM fungal diversity in the open land adjacent to rubber plantation. However, our study was conducted to evaluate the mycorrhizal colonization and AM fungal species distribution in two rubber plantations of Tripura.

Materials and Methods Study Sites For this present assessment of mycorrhizal colonization, the root samples were collected from the rubber plantation located near Rose Valley Park, Amtali and from the Takmachara, Tripura, Northeast India (Fig. 1).

Fig. 1:  Map of Tripura showing location of study sites

Atithi Debnath et.al.  | 241

Soil was also collected from rhizosphere of each plant at depth of 0-15 cm. All the soil collected from different plants was mixed and 500 g were collected in polythene bags. Samples were labeled properly and were brought to the laboratory for further assessment. Analysis of Soil Properties In soil properties, pH, electrical conductivity and moisture content of soil samples were measured. The Organic Carbon was estimated by using Walkley-Black method (1934). The soil available Nitrogen was estimated by following Black (1982) method. Available Phosphorus, Potassium and Calcium of soil samples were determined using the method of Jackson (1978). Preparation of Roots and Assessment of AM Fungi Thoroughly washed root samples were cut into small pieces approximately 1cm in size which were then cleared and stained (Das and Kayang 2008). The estimation of AM fungal colonization was done by the magnified intersection method (McGonigle et al. 1990). AM Fungal Spore Isolation and Identification For spore analysis, 100 g of soil was taken and extracted by modified wet sieving and decanting method (Muthukumar et al. 2006). The isolated spores were picked up with needle in 1–2 drops of polyvinyl alcohol-lactoglycerol under a dissecting microscope (Koske and Tessier 1983) for identification. The taxonomic identification of spores to species level (http://www.invam.caf.wvu.edu and http://www.lrzmuenchen.de/~schuessler/ amphylo). Data analysis Standard errors of means were calculated. Abundance and relative abundance were also calculated. The calculation was done in MS Excel, 2003.

Results and Discussion Soil Properties The soil from Amtali revealed higher moisture content (%) than Takmachara. Both the soil samples showed acidic pH. The electrical conductivity, organic carbons (%), available nitrogen, available potassium, available calcium were higher in Takmachara than Amtali. Available phosphorus was also high in Takmachara than Amtali (Table 1). The effects of AM fungi on their host plant communities are not absolute but context-dependent, varying with host species, plant life history stage, resource availability, and abiotic conditions (O’Connor et al. 2002). This study resembles with the observations of Wang et al. (2008) and Fortin et al. (2002) where increasing soil pH had detrimental effects on AM fungal spore germination and mycorrhization.

242  |  Comparison of Arbuscular Mycorrhizal Fungal Colonization and Diversity of Two Different... Table 1: Soil Physico-chemical properties of the Rubber plantations of Amtali and Takmachara in Tripura, Northeast India. Sites

Moisture content (%)

pH

Electrical conductivity (cS cm–1)

Organic carbon (%)

Available Nitrogen (kg/ha)

Available Phosphorus (kg/ha)

Available Potassium (kg/ha)

Available Calcium (kg/ha)

Amtali

9.182

5.22

091

0.52

215.48

14.61

65.51

52.48

Takmachara

8.08

4.52

128

1.40

349.09

14.77

160.39

120.43

Mycorrhizal Root Colonization Mycorrhizal structures such as hyphae, vesicles and arbuscules were observed (Fig. 2). Root colonization associated with rubber plants of two different plantation sites revealed that AM fungal association was considerably higher in rubber plants from Takmachara than Amtali (Fig. 3). The AM fungal colonization% is presented in Table 2. Table 2: Mycorrhizal colonization in rubber plants from Amtali and Takmachara in Tripura, Northeast India Name of the plant

AM fungal colonization RLA%

RLV%

RLH%

Hevea brasiliensis

7.82±1.88

30.79±4.76

92.59±2.25

Hevea brasiliensis

9.83± 1.69

14.30±1.13

43.21±2.30

RLA%= root length percent of arbuscules, RLV%= root length vesicles percent, RLV%= root length hyphal percent.

Fig. 2: Mycorrhizal colonization of H. brasiliensis collected from two sites. (a) hyphal coil (hc) in plants from Amtali, (b) arbuscules of rubber plant in Amtali, (c) vesicle (vc) of rubber plants from Amtali, (d) hyphae of rubber plant of Takmachara rubber plant (e) Arbuscules (ar) in root from Takmachara & (f) vesicles in roots from Takmachara

Atithi Debnath et.al.  | 243

Fig. 3: Comparison of mycorrhizal colonization in root of Hevea brasiliensis between two sites.

According to Deka et al. (1998) AM fungal infection in the roots of five-year-old rubber plantation ranged between 68 to 88 percent on surface layers in different treatments which contradict with this study and also with results of Nair and Girija (1988) recorded highest VAM infection in rubber (71 percent) in Kerala. The root colonization of Amtali rubber plants showed similar result as given by Omorusi et al. (2012), Schwob et al. (1999). The AM fungal root colonization of Takmachara rubber plants resemble with the observation of Debnath et al. (2014) and within range given by Basumatary et al. (2014) where growth response of Hevea brasiliensis clones at 60, 120 and 180 days after inoculation using native AM fungi inoculants was observed. AMF species composition and spore density are highly variable and influenced by plant characteristics and a number of environmental factors such as soil pH and soil moisture content (Boddington and Dodd 1999). AM Fungal Spores Diversity and Distribution A total of 1062.64 spores/ 100g of soil and 780 spores/ 100g of soil were found from Amtali and Takmachara soil respectively. The total number of spores of this study is within the range given by Schwob et al. (1999) in rubber plantation sites of Brazil and higher than Basumatary et al. (2014) observation of rubber plants. Amtali rubber plantation represented 9 AM fungal morphotypes and 4 morphotypes by Takmachara. Glomus sp 1, Glomus sp 2, Glomus sp 3 were common in both the sites. In Amtali highest relative abundance was occupied by G. aggregatum and in Takmachara by Glomus sp 1 (Table 3).

244  |  Comparison of Arbuscular Mycorrhizal Fungal Colonization and Diversity of Two Different... Table 3: Relative abundance of arbuscular mycorrhizal fungi from the soils of rubber plantation of Amtali and Takmachara in Tripura, Northeast India Fungal species

Amtali

Takmachara

Acaulospora sp 1

1.41

-

Ambispora sp 1

1.41

-

Glomus aggregatum

33.80

-

Glomus macrocarpum

8.45

-

G. multiculae

-

32.00

Glomus sp 1

22.54

36.00

Glomus sp 2

15.49

14.67

Glomus sp 3

5.63

17.33

Glomus sp 4

9.86

-

Rhizophagus irregulare

1.41

-

100.00

100.00

Diversity indices revealed the highest AM fungal species richness, Shannon and Simpson in Amtali rubber plantation. Dominance and evenness was maximum in case of Takmachara rubber plantation (Table 4). Table 4: Diversity indices of two rubber plantations of Tripura

Diversity indices Species richness Dominance Shannon Simpson Evenness

Amtali 9 0.23 1.81 0.77 0.68

Takmachara 4 0.29 1.321 0.71 0.94

It is now accepted that the low species richness often reported for arid and semi-arid ecosystems by extraction of spores from field soil reflects limitations in the sporulation patterns under field conditions (Stutz and Morton 1996, Stutz et al. 2000). The occurrence of S. calospora and S. pellucida spores (Oehl et al. 2004) was found to be negatively correlated with the soil contents of available phosphorus (Oehl et al. 2002). These AM fungal taxa have a specific multidimensional niche that is determined by the plant species that are present at a site and by edaphic factors such as pH, moisture content, phosphorus (P), and nitrogen (N) availability. As a result, there is large between and within-site variation in the composition of AM fungal taxa (Burrows and Pfleger 2002, Hart and Klironomos 2002).

Atithi Debnath et.al.  | 245

Acknowledgments The authors are thankful to Head, Department of Botany, Tripura University for providing the laboratory facilities. The first and second authors are grateful to University Grant Commission, New Delhi, India for the fellowship.

REFERENCES Basumatary, N., Parkash, V., Tamuli, AK., Saikia, AJ., and Teron, R. 2014. Arbuscular mycorrhizal inoculation affects growth and rhizospheric nutrient availability in Hevea brasiliensis (Willd. ex A. Juss.) Mull. Arg. Clones. Int.J.Curr.Biotechnol. 2(7): 14-21. Bi, Y., Ding, B., and Li, X. 2001. Effects of VA mycorrhiza on utilizing nutrient and water of winter wheat. Chin. J. S. Science. 32: 99. Black, CA. 1982. Methods of soil analysis. Pregmon Press, England. Boddington, CL., and Dodd, JC. 1999. Evidence that differences in phosphate metabolism in mycorrhizae formed by species of Glomus and Gigaspora might be related to their life cycle strategies. New Phytol. 142: 531–538. Brachmann, A., and Parniske, M. 2006. The Most Widespread Symbiosis on Earth. Plos Biol 4(7). Burrows, RL., and Pfleger, FL. 2002. Arbuscular mycorrhizal fungi respond to increasing plant diversity. Canadian Journal of Botany. 80: 120-130. Compagnon, PD., and D’ Auzac, J. 1986. Le Caoutchouc naturel: Biologie, culture, production. G.P. Das, P., and Kayang, H. 2008. Stamp pad ink, an effective stain for observing arbuscular mycorrhizal. structure in roots. World J Agricult Sci. 4: 58–60. Debnath, A., Sinha, S., Saha, AK., and Das P. 2014. Arbuscular mycorrhiza fungal diversity in open land adjacent to rubber plantation in Tripura, Northeast India. Mycorrhiza news. 26(3): 4-9. Deka, HK., and Mishra, RR. 1984. Distribution of soil microflora in jhum fallows in NE India. Acta Botanica Indica. 12: 180-184. Fortin, JA., Becard, G., Declerck, S., Dalpe, Y., Starnaud, M., Coughlan, AP., and Piche, Y. 2002. Arbuscular mycorrhiza on root-organ cultures. Canadian Journal of Botany. 80: 1–20. Hart, M., and Klironomos, JN. 2002. Diversity of arbuscular mycorrhizal fungi and ecosystem functioning. In: van der Heijden MGA. Sanders, IR. Mycorrhizal ecology: Ecological Studies 157. Berlin, Germany: Springer Verlag. 225-242. Ho, I., and Trappe JM. 1973. Translocation of 14C from Festuca plants to their endomycorrhizal fungi. Nature, New Biology. 224: 30–31.

246  |  Comparison of Arbuscular Mycorrhizal Fungal Colonization and Diversity of Two Different...

Jackson, ML. 1978. Soil chemical analysis. Prentice Hall, New Delhi, India. Jansa, J., Mozafar, A., Anken, T., Ruh, R., Sanders, IR., and Frossard, E. 2002. Diversity and structure of AMF communities as affected by tillage in a temperate soil. Mycorrhiza. 12: 225–234. Koske, RE., and Tessier, B. 1983. A convenient, permanent slide mounting medium. Myco. Soc. of Am. News letter. 34: 59. Kothamasi, D., Kuhad, RC., and Babu, CR. 2001. Arbuscular mycorrhizae in plant survival strategies. Trop. Ecol. 42: 1-13. Mahendra, R., Deepak, A., and Singh, A. 2001. Positive growth responses of the medicinal plants Spilanthes calva and Withania somnifera to inoculation by Piriformosporao indica in a field trial. Mycor. 11: 123–128. McGonigle, TP., Miller, MH., Evans, DG., Fairchild, GL., and Swan JA. 1990. A new method which gives an objective measure of colonization of roots by vesicular-arbuscular mycorrhizal fungi. New Phytologist. 115: 495–501. Muthukumar, T., Senthilkumar, M., Rajangam, M., and Udaiyan, K. 2006. Arbuscular mycorrhizal morphology and dark septate fungal associations in medicinal and aromatic plants of Western Ghats, Southern India. Mycor. 17: 11–24. Nair, SK., and Girija, VK. 1988. Incidence of vesicular arbuscular mycorrhiza in certain tree crops of Kerala. Journal of Plantation Crops. 16: 67-68. O’Connor, PJ., Smith, SE., and Smith, FA. 2002. Arbuscular mycorrhizas influence plant diversity and community structure in a semiarid herbland. New Phytol. 154: 209–218. Oehl, F., Sieverding, E., Ineichen, K., Mäder, P., Boller, T., and Wiemken, A. 2003a. Impact of land use intensity on the species diversity of arbuscular mycorrhizal fungi in agroecosystems of Central Europe. Applied and Environmental Microbiology. 69: 2816–2824. Oehl, F., Sieverding, E., Ineichen, K., Mäder, P., Dubois, D., Boller, T., and Wiemken, A. 2004. Impact of long-term conventional and organic farming on the diversity of arbuscular mycorrhizal fungi. Oecologia. 138: 574–583. Oehl, F., Tagmann, HU., Oberson, A., Besson, JM., Dubois, D., Mäder, P., Roth, HR., and Frossard, E. 2002. Phosphorus budget and phosphorus availability in soils under organic and conventional farming. Nutrient Cycling in Agroecosystsems. 62: 25–35. Omorusi, VI., Igeleke, CL., Ogbebor, NO., Evueh, GA., and Omo-Ikerodah, EE. 2012. Current Status of Mycorrhizal Spore Numbers and Root Colonization of Hevea Saplings as Affected By Seasonal Variations in Plantations of Rubber Research Institute of Nigeria, Iyanomo. Researcher. 4(1): 37-41. Rubber Board. 2010. Rubber Growers Companion. The Rubber Board. 130. Schwob, I., Ducher, M., and Coudret, A. 1999. Effects of climatic factors on native arbuscular mycorrhizae and Meloidogyne exigua in a Brazilian rubber tree (Hevea brasiliensis) plantation. Plant Pathology. 48: 19–25.

Atithi Debnath et.al.  | 247

Sieverding, E. 1991. Vesicular arbuscular mycorrhiza management in tropical agrosystems. Eschborn: Deutsche Gesellschaft fu¨ r technische Zuzammenarbeit. Stutz, JC., and Morton, JB. 1996. Successive pot cultures reveal high species richness of arbuscular endomycorrhizal fungi in arid ecosystems. Can J Bot. 74: 1883–1889. Stutz, JC., Copeman, R., Martin, CA., and Morton, JB. 2000. Patterns of species composition and distribution of arbuscular mycorrhizal fungi in arid regions of southwestern North America and Namibia, Africa. Can J Bot. 78: 237–245. Walkley, A., and Black, IA. 1934. An examination of the Degtjareff method for determining organic carbon in soils: Effect of variations in digestion conditions and of inorganic soil constituents. Soil Sci. 63: 251–263. Wang, YY., Vestberg, M.,Walker, C., Hurme, T., Zhang, X., and Lindström, K. 2008. Diversity and infectivity of arbuscular mycorrhizal fungi in agricultural soils of the Sichuan Province of mainland China. Mycorrhiza. 18: 59–68. Wastie, RL. 1965. The occurrence of an Endogene type of endotrophic mycorrhiza in Hevea brasiliensis. Transactions of the British Mycological Society. 48: 167-168.

mmm

Trends in Frontal Areas of Plant Science Research Edited by: S. Sinha, R.K. Sinha © Department of Botany, Tripura University, 2017

Seasonal Pattern of Nitrate Reductase and Nitrogenase Enzyme Activities in Desmodium triflorum (L.) DC.— A Folklore Species of India Joyeeta Dey* and Rabindra Kumar Sinha Department of Botany, Tripura University, (A Central University), Suryamaninagar 799022, Tripura, India. *Correseponding author: [email protected]

Summary The dynamics of nitrate reductase and nitrogenase activity in the leaves, nodules and rhizobial suspension of Desmodium triflorum; of the family Fabaceae were investigated. Maximum activity of nitrate reductase was recorded in rhizobial suspension (8.56 m mol NO2- produced h-1ml-1 rhizobial suspension) followed by nodules (6.9 µ mol NO2- produced h-1g-1 nodules fr. wt.) and and leaves (4.09 m mol NO2– produced h-1g-1 leaf fr. wt.). Activity of nitrogenase was highest, 7.01 m moles NH3 produced h-1g-1 nodules fr. wt. in nodules than rhizobial suspension (4.47 m moles NH3 produced h-1ml-1 suspension). Differential nitrogenase activity was also recorded in different seasons of the year. Present study highlights the significance of Desmodium triflorum as an efficient nitrogen fixing cover crop besides its documented ethnomedicinal values. Keywords: Seasonal variation, Nitrate Reductase, Nitrogenase, Desmodium triflorum (L) DC. Biological nitrogen fixation is the process that changes inert nitrogen to biologically useful ammonia. This process is mediated in nature only by bacteria. Nitrate assimilation and nitrogen fixation are the two major pathways in the biological nitrogen cycle which provide common nitrogen sources for the synthesis and utilization of proteins and nucleic acids in all living organisms. Nitrate Reductase (NR) is the first and the rate limiting enzyme in nitrate utilization in plants and it has a positive correlation between plant growth and biomass yield (Jhonson et al. 1976). Nitrogenases are enzymes produced by root nodulating bacteria and play key role in utilizing atmospheric nitrogen. The leguminous plants in association with root nodulating bacteria are capable of fixing atmospheric nitrogen through their efficient symbiotic association. A large number of weed legumes are the natural resource for biological nitrogen fixation and soil amelioration (Tian et al.

250  |  Seasonal Pattern of Nitrate Reductase and Nitrogenase Enzyme Activities in Desmodium...

2000; Dey et al. 2015). In Tripura as many as 35 weed legumes are luxuriantly growing in different localities of Tripura (Deb 1983). Desmodium triflorum (L.) DC. is one of the creeper weed legume growing wild in this region. The significance of Desmodium triflorum as a folklore species having different ethno-medicinal applications is also well documented (Rajith et al. 2010; Bapuji et al. 2009; Pandey et al. 2014 ).

Material and Methods The plant specimens were collected from Suryamaninagar area (N-23º45´40.6´´and E-091º16´04.3´´) of West Tripura. The in vivo Nitrate Reductase activity was measured in fresh leaves, nodules and rhizobial samples of Desmodium triflorum collected during different period of the year (Hageman and Hucklesby, 1971). Assay of Nitrogenase in the nodules and rhizobial samples of Desmodium triflorum was also performed spectrophotometerically by modified method of Conway (Srivastava et al. 1980).

Results and Discussion In the present study, seasonal variation of nitrate reductase and nitrogenase activities in Desmodium triflorum were clearly recorded. Maximum activity of nitrate reductase was recorded in rhizobial suspension (8.56 µ mol NO2- produced h-1ml-1 rhizobial suspension) followed by nodules (6.9 µ mol NO2- produced h-1g-1 nodules fr. wt.) and leaves (4.09 µ mol NO2-produced h-1g-1 leaf fr. wt.) during the month of September (Table 1). Minimum activity of nitrate reductase was recorded during winter irrespective of different nature of the source of the sample of Desmodium triflorum (Fig:1). High activity of nitrogenase was observed in nodules (7.01 µ moles NH3 produced h-1g-1 nodules fr. wt.) than rhizobial suspension (4.47 µ moles NH3 produced h-1ml-1 suspension) during the month of September (Table:2). Nodular nitrogenase activity was higher irrespective of seasons (Fig:2). The minimum activity of NR and Nitrogenase was recorded during the month of December while moderate activities were registered in March and June. This variation in the pattern of these enzyme activities may be attributed due to factors like leaf age, atmospheric temperature, pH of soil, presence of minerals like dissolved inorganic nitrogen and carbon in the soil, availability of oxygen in the soil, diurnal variation (Griffith, 1979; Chanda,2003). The average peak activities of NR and Nitrogenase recorded within the prevailing temperature 32-34° C in September seems to be the ideal for the present nitrogen metabolising enzymes. Highest activity of Nitrate Reductase and Nitrogenase were recorded during the month of September in Desmodium triflorum, can be utilized as potential nitrogen source in soil amelioration programme and can also be used as cover crop.

Joyeeta Dey et.al.  | 251 Table-1: Biochemical estimates of Nitrogenase activities of Desmodium triflorum during four different seasons of the year. Source of sample types

September

December

March

June

In vivo NR activity in leaves (µ moles NO2– produced h-1g-1 leaves fr. wt.)

4.092±0.04

0.53±0.008

2.18±0.04

3.49±0.002

In vivo NR activity in nodules (µ moles NO2– produced h-1g1 nodules fr. wt.)

6.9±0.008

0.96±0.01

3.94±0.05

5.11±0.01

In vivo NR activity in rhizobial suspension (µ moles NO2– produced h-1ml-1 suspension.

8.56±0.03

0.92±0.006

5.23±0.005

6.9±0.008

Table-2: Biochemical estimates of nitrate reductase activities of Desmodium triflorum during four different seasons of the year. Source of sample types

September

December

March

June

N2-ase activity in nodules ( µ moles NH3 produced h-1g1nodule fr. wt.)

7.01±0.02

1.31±0.04

5.13±0.21

5.84±0.03

N2-ase activity in rhizobial suspension (µ moles NH3 produced h-1ml-1 suspension )

4.47±0.04

0.82±0.01

3.27±0.03

3.95±0.02

   Fig. 1: Nitrate reductase activities of Desmodium triflorum during four different seasons of the year.

Fig. 2: Nitrogenase activities of Desmodium triflorum during four different seasons of the year.

252  |  Seasonal Pattern of Nitrate Reductase and Nitrogenase Enzyme Activities in Desmodium...

Acknowledgements Authors are thankful to the University Grants Commission, (UGC-SAP, DRS-I) New Delhi for providing financial support to the Department of Botany, Tripura University, Suryamaninagar-799022, India.

REFERENCES Bapuji J. Lenin and Vekat ratnam S.(2009). Traditional Uses of Some Medicinal Plants by tribals of Gangaraju Madugula Mandal of Visakhapatnam District, Andhra Pradesh. Ethnobotanical Leaflets 13: 388-98. Chanda Sumitra V.(2003). Factors affecting nitrate reductase activity in some monocot and dicot species. Journal of Plant biology, 46(1):41-45. Deb, D.B. (1983). Flora of Tripura. Today and Tomorrow’s Printers and Publishers,; pp.124-192. Griffith D.J.(1978). Factors affecting nitrate reductase activity in synchronous cultures of Chlorella.New Phytologist. 82, Issue :2, pp427-437 Hageman, R. H. and Hucklesby, D. P. (1971). Nitrate reductase from higher plants. In: A. San Pietro (ed.),.Academic Press, London; Methods in Enzymolgy, 23A: 491-503. Johnson, C.B. , W.J. Whittington, and G.C. Blackwood. (1976). Nitrate Reductase as a possible predictive test for crop yield. Nature, 262:133-34. Pandey Amit and Mavinkurve Rajashree G.(2014). Ethno-Botanical usage of Plants by the Chakma Community of Tripura, Northeast India. Bulletin of Environment, Pharmacology and Life Sciences. 3 [6] 2014: 11- 14. Rajith N. P. and Ramachandran V. S.(2010). Ethnomedicines of Kurichyas, Kannur district, Western Ghats, Karala. Indian Journal of Natural products and resources.1(2), pp:249-253. Srivastava, R.C and Mathur, S.N (1980). Nodulation and nitrate reductase activity in nodules and leaves of black-gram (Vigna mungo) as affected by varying day-lengths. Indian J. Exp. Biol. 18 (3) : 300 – 302. Tian,G., Kolawole,G.D., Kang, B.T., and Kirchhof, G.(2000). Nitrogen fertilizer replacement indexes of legume cover crops in the derived savanna of West Africa. Plant and soil.224(2):287-296.

mmm

Trends in Frontal Areas of Plant Science Research Edited by: S. Sinha, R.K. Sinha © Department of Botany, Tripura University, 2017

Soil Nutrients and Plant Association Analysis Under Different Habitats of a Threatened Carnivorous Plant Drosera burmannii Vahl. in Tripura, India Biswajit Sutradhar*, Bal Krishan Choudhary, Koushik Majumdar and Badal Kumar Datta Plant Taxonomy and Biodiversity Laboratory, Department of Botany, Tripura University, Suryamaninagar, West Tripura, 799022 *Corresponding author: [email protected]

Summary Drosera burmanii Vahl. is a carnivorous plant species inhabiting in some restricted seasonal flooded agricultural fields of Tripura. In spite of the carnivorous nature of the species for nutrients extraction, assessment of population status and habitat conditions of this plant is very important to know the impact of soil nutrient limitation. In this study, two different natural populations (categorized as non-degraded and degraded) were selected. Five 1×1 meter size quadrats were laid at five different sites in two different habitats. Inventorisation of plant species and soil sampling was done. The soil physicochemical properties was estimated at two soil depth viz. 0-10 and 10-20 cm. Overall 23 plant species belonging to 20 families were recorded. The value of Soil Organic Carbon (Mg ha-1), Total Nitrogen (kg ha-1); Total Phosphorus (kg ha-1) was high at nondegraded site than the degraded one. Key words: Drosera burmanii Vahl., Phytosociology, Soil Nutrient Pools. Drosera commonly known as sundews comprises one of the largest genera of carnivorous plants, with at least 194 species (McPherson, 2010). Drosera burmanii Vahl. an annual insectivorous plant is distributed widely in China, Japan, Malaya, West Africa and Australia, with their rosette-like leaves covered with sticky glandular hairs and trichomes which trap insects (Nordbakken et al. 2004). Out of the 4 genera that compose the family Droseraceae, only the genus Drosera occurs in Tripura. In Himalayan Mountain it was reported from the base up to 4000 ft (1291m) and in Deccan, it was found up to 8000 ft (2438 m). In north east India, the species has been reported from Khasi and Garo hills of Meghalaya (Kanjilal et al. 1934-1940). The members of the family Droseraceae lure, capture and digest insect using stalked mucilaginous glands covering their leaf surface (Piliackas

254  |  Soil Nutrients and Plant Association Analysis Under Different Habitats of a Threatened...

et al. 1989, Nordbakken et al. 2004). Various species of Drosera vary greatly in size and form, found growing in most of the places on the earth. Drosera burmanii Vahl. Carnivory in plants is generally accepted as an adaptation to a specific environment where nutrients are scarce, but sunlight and moisture are abundant (Givinish et al. 1984). Insect capture has been assumed to supplement root nutrient uptake, with emphasis on the acquisition of additional Nitrogen (N) from the captured prey, and this is presumed to be an adaptation to a low nutrient environment (Givinish et al. 1984, Perica and Berljak, 1996). The carnivorous plant species inhabit flooded acidic south Indian soils low in nutrients (Jayaram and Prasad, 2006). Although the species are in the vulnerable category, it can be considered as a potentially endangered species, but government environmental regulation agencies have not adopted any stringent conservation measures. The plant is having medicinal importance. D. burmanii is used traditionally as an antiseptic on poisonous bites and all forms of throat infection by Tripuri community. It is locally known as “Baishakhtali”, meaning the drug which absorbs poison (Majumdar et al. 2010). The whole plant paste of Drosera burmanii is given to cure blood dysentery (Mitra and Mukherjee, 2010). There is now an urgent need to understand the habitat and adopt regional conservation measures (Jayaram and Prasad, 2006, 2007). Chandler and Anderson (1976) and Dixon et. al., (1980), measured the plant uptake of the total N contained in their insect prey to be 29% and 76%, respectively. Nutrient acquisition is the main benefit of carnivory for plants. Most of these unique species grow in habitats with low nutrient content in the soil. This lack of nutrients will inhibit growth and function in most species of plants. The soils are usually wet or waterlogged, mostly acid, and usually poor in available mineral nutrients (N, P, K, Ca, Mg; Adamec, 1997a). To compensate for this hindrance, these plants obtain nutrients, such as N and phosphorus (P), from insect prey (Givinish et al. 1984; Méndez, 1999). This supplement of inorganic nutrients allows for increased growth and photosynthesis in the plant. Carnivorous plants utilize this adaptation to many different extents; some species of Drosera obtain as little as 20% of their nitrogen from insect prey, while other species derive up to 90% (Ellison, 2001). It is apparent from the study (Millet et al. 2003), that prey capture is an important, but not an essential component of the N nutrition of the Drosera plants studied. It appears that the plants benefit from N in the captured prey through a decreased Carbon: Nitrogen (C: N) ratio. However, it is not clear whether an increase in the proportion of plant N that is obtained from captured prey replaces or augments N obtained from root uptake. Drosera usually prefers to grow in marshy areas with small proportion of sand generally acidic environment (pH 3.9-4.3). Some carnivorous plants may reduce their growth and even die when grown in nutrient enriched soils (Juniper et al. 1989). Thus, analysis of edaphic factors is very essential to know the overall habitat status. D. burmanii is a red listed plant and it was listed as Least Concern (LC) by IUCN due to habitat loss in the wetland drainage (Zhuang, 2011). Hence, the objective of this study was set (1) to analyze the plant habitat association of D. burmanii, (2) to estimate the nutrient pools in its habitat, and (3) to establish relationship between habitat association and nutrient pool under this study.

Biswajit Sutradhar et. al.  | 255

Materials and Methods Study Area The present study was conducted in and around Tripura University campus and adjacent area during the month of January to May 2014 (Fig. 1). Two different sites were selected for the study, one is edge area of marshy lake (non-degraded) and another is low laying seasonal paddy land (degraded). Study area was selected based on the eye view presence of Drosera on the surface. Five number of 1x1 m2 size quadrate were laid at five different sites, for enumeration of all species present in both habitats. The distance between two habitats was about 500m. The climate of the study area is monsoonal.

Fig. 1: Location of the study area A0 Non-degraded site and B) Degraded site

Sample Collection and Analysis Two different natural population stands were selected for field studies. During the survey, locations of the sampling plot, where D. burmannii was observed were recorded by Global Positioning System (GPS). The community structure, population density of Drosera and the associated species were determined through 5, 1m × 1m quadrat randomly placed on five different sites of each habitat, with an average of 0.02% sampling intensity. Soil sampling was done in the middle of same quadrat for respective depth i.e. 0-10, 10-20 and

256  |  Soil Nutrients and Plant Association Analysis Under Different Habitats of a Threatened...

0-20 cm. Composite samples were prepared, air-dried, ground and passed through 2 mm sieve and for each depth five replicates of each composite were analyzed. Soil pH was measured in 1M KCl suspension of 1:5 (soil: liquid) using digital pH meter. Soil moisture was calculated on dry weight basis (Anderson and Ingram, 1989). Soil nutrients (N, P and K) were analyzed using CNS analyser at ICAR laboratory, Lembucherra, Agartala, Tripura. All the plants were counted and each collected specimen was further processed for preservation on the herbarium sheet as per method proposed by Jain and Rao (1997). The SOC was estimated by wet oxidation method (Walkley and Black, 1934). Dry soil BD at 1050C was estimated by the core method (Blake and Hartge, 1986). The total stock (Mg ha-1 and kg ha-1) was calculated by following standard method (Guo and Gifford, 2002). Associated species were identified with the help of existing literature (Deb, 1981; Sharma and Balakrishnan 1993) and herbarium available at Botanical Survey of India, Shillong. To study community structure the Shannon-Winner Index of diversity was used. Species richness was determined as the number of species present in each of the study sites (Whittaker, 1975). Along with diversity index, Pielou index of evenness and Simpson dominance index were calculated (Magurran, 1988).

Results and discussion Habitat Composition and Diversity he details of the plant community of the two habitats are given in Table 1. The T inventorisation of the two habitats showed the presence of 23 plant species belonging to 20 families, out of which 13 plant species were recorded in non-degraded site and 16 plant species from the degraded sites. The significant difference in terms of species richness was found between the sites (ANOVA df=8; F 6.15; P = 0.012). In 2011, Majumdar et al. reported 31 species under 26 genera from the same locality. This indicates that the number of species was reduced compared to the earlier record. However in the early study, 19 species were unique to site (i), 20 species were unique to site (ii), and 8 species were common in both sites. The low species richness in disturbed areas could be attributed to the effect of forest disturbances. The family Cyperaceae constituted 19.35% of the total species present due to its marshy habitat. Jayaram and Prasad (2006) reported that suitable association of D. burmanii especially dominated with genera of Utricularia and Eriocoloun. Chakraborty and Bhattacharya (2013) reported that the habitat of D. burmanii was dominated with species of Poaceae and Cyperaceae in the plains of West Bengal. A comparison of species richness and dominance shows high values for site (i) representing 17.00 ± 1.53 and 0.50 ± 0.11 respectively. Total number of individuals recorded from non-degraded habitat and degraded habitat was 280 and 296 respectively. The maximum value of ShanonWiener index of general diversity was found in non-degraded (1.74) which is higher than degraded site (1.18). The species dominance (ANOVA df=8; F 3.98; P = 0.021) and Shanon-Wiener diversity (ANOVA df=8; F 4.95; P = 0.024) significantly varies between the non-degraded and degraded sites. However, there is no significant variation in density, though density of D. burmannii was high in non- degraded site (19.2) than degraded (16).

Biswajit Sutradhar et. al.  | 257

D. burmanii was ecologically or relatively more important (RIV= 52.32) at non degraded site than the degraded one (RIV= 40.54). Chakraborty and Bhattacharya (2013) estimated IVI 14.63 of D. burmanii in the plains of West Bengal. The rare fraction analysis of species richness revealed that non degraded site had more species compared to degraded one (Fig. 2). Table 1: Population structure of D. burmannii and its associate plants in different habitats

Density

Acacia auriculiformis A. Cunn. Ex Benth.

-

-

-

-

1

0.2

0.34

3.04

2

Ammannia baccifera L.

-

-

-

-

4

0.8

1.35

4.05

3

Centella asiatica L.Urban

-

-

-

-

20

4

6.76

12.16

4

Chrysopogon aciculatus Trin.

-

-

-

-

1

0.2

0.34

3.04

5

Cyperus pumilus L.

12

2.4

4.04

9.04

13

2.6

4.39

7.09

6

Desmodium triflorum L.

-

-

-

-

6

1.2

2.03

4.73

7

Drosera burmannii Vahl.

96

19.2

32.32

52.32

80

16

27.03

40.54

8

Cyperus diffusus Vahl.

36

7.2

12.12

17.12

-

-

-

-

9

Eriocaulon R. Br.

17

3.4

5.72

15.72

6

1.2

2.03

7.43

10

Fuirena ciliaris (L.) Roxb.

29

5.8

9.76

19.76

-

-

-

-

11

Hypricum japonicum Thunb. FL Jap

-

-

-

-

55

11

18.58

32.09

12

Limnophila chinensis (Osb.) Merr.

-

-

-

-

27

5.4

9.12

19.33

13

Lindernia ciliata (Colsm.) Pennell in Journ.

12

2.4

4.04

9.04

-

-

-

-

cinereum

Relative Importance value (RIV)

Individual

1

Relative Density (RD)

Relative Importance value (RIV)

Relative Density (RD)

Degraded

Density

Non- Degraded

Individual

Sl. Species name No

258  |  Soil Nutrients and Plant Association Analysis Under Different Habitats of a Threatened... 14

Lindernia antipoda (L.) Alston in Trin.

7

1.4

2.36

7.36

-

-

-

-

15

Ludwigia perennis L. Sp. PL.

-

-

-

-

1

0.2

0.34

3.04

16

Lygodium sps.

-

-

-

-

1

0.2

0.34

3.04

17

Melastoma malabathricum L.

1

0.2

0.34

5.34

18

3.6

6.08

19.59

18

Microcos paniculata L.

25

5

8.42

13.42

-

-

-

-

19

Nelsonea canescens (Lamk.) Spreng.

12

2.4

4.04

9.04

-

-

-

-

20

Panicum brevifolium L.

7

1.4

2.36

7.36

39

7.8

13.18

21.28

21

Rotala indica (Wild.) Koehne in Bot.

5

1

1.68

6.68

17

3.4

5.74

11.15

22

Syzygium cumini L.

-

-

-

-

7

1.4

2.36

7.77

23

Utricularia gibba L. Sp.

21

4.2

7.07

17.07

-

-

-

-

Table 2: Diversity of different plant species in two habitats of D. burmanaii Habitat Diversity

Non-degraded habitat

Degraded habitat

S1

S2

S3

S4

S5

Mean

S1

S2

S3

S4

S5

Mean

Number of Species

7

8

6

8

8

7.4

6

4

2

6

3

4.2

Number of Individuals

75

62

43

60

56

59.2

107

40

27

83

40

59.4

Simpson Dominance

0.26

0.17

0.23

0.18

0.20

0.21

0.22 0.32 0.51

0.31

0.43

0.36

Shannon Diversity

1.64

1.86

1.61

1.83

1.75

1.74

1.63 1.24 0.69

1.39

0.96

1.18

Evenness Index

0.73

0.80

0.84

0.78

0.72

0.77

0.85 0.86 0.99

0.67

0.87

0.85

Menhinick Index

0.81

1.02

0.92

1.03

1.07

0.97

0.58 0.63 0.38

0.66

0.47

0.55

Biswajit Sutradhar et. al.  | 259

Fig. 2: Comparison of species richness between non-degraded & degraded sites with rare fraction curve.

  Fig. 3: Species abundance curve and rank for Non-degraded and Degraded habitats.

he abundance curve and rank analysis revealed steeper graph in the non-degraded T site than the degraded one (Fig. 3). Majority of the species showed lower abundance and population, whereas few species showed higher values. The analysis of diversity pattern revealed that inspite of having almost same number of individuals (Table 2), the mean number of species at non- degraded site was more (7 individuals) than the degraded one (4 individuals). Some species with lower competitive ability reduce their density or disappear in plant communities because of competition for light and nutrient availability (Grime, 1998). Decreases in biodiversity reduce plant community stability and degrade ecosystem functions and processes (Tilman, 1999). The habitat of D. burmanii is mostly dominated by some localized annual grass species (Majumdar et al. 2011 ). Davies and Svejcar (2008) reported that plant species diversity and richness were much lower in exotic

260  |  Soil Nutrients and Plant Association Analysis Under Different Habitats of a Threatened...

annual grass-invaded compared to non-invaded plant communities. The dominance index is inversely related with diversity. The value of dominance was more in degraded habitat (0.36) than the non- degraded one (0.21). Species evenness signifies how species are evenly distributed in the community. Here it is found that in non-degraded site the species were less evenly distributed than the degraded one with a value of 0.77 and 0.85 respectively. Effect of Soil Depth of Soil Organic Carbon (SOC) and Nutrient (%) In the present investigation, different physico-chemical properties of soils (Table 3 and Fig. 4) were analyzed. Soil pH in the habitats varied from 4.2 (degraded) to 4.88 (nondegraded) for 0-10 cm soil depth, similarly at 10-20 cm soil depth, pH varies from 4.00 (degraded) to 4.92 (non degraded). This clearly indicates that the soil of degraded sites i.e. lake margins are more acidic in nature. SOC (%) varied from 0.61(degraded) to 1.35 (nondegraded) for 0-10 cm soil depth and for 10-20 cm soil depth it was 0.48 (degraded) to 1.35 (non-degraded). The value of Soil Total Nitrogen (%) in 0-10 cm soil depth varied from 0.102 (degraded) to 0.164 (non-degraded) and for 10-20 cm soil depth, varied from 0.103 (degraded) to 0.144 (non-degraded). Givnish et al. (1984) suggested that mineral nutrient uptake due to carnivory should achieve positive photosynthetic benefits only in nutrientpoor, sunny, and moist habitats whereas negative photosynthetic benefits would occur in shady habitats (Adamec, 2002). Increase soil Nitrogen provides opportunity to weed or other grass species to establish and dominate in the habitat and the dominance of weedy species in Nitrogen rich condition, suppress the non weedy species and consequently diversity declines in the herbaceous vegetation (Bradley et al. 2002; Sharma et al. 2005). Chandler and Anderson (1976) observed that the effect of prey supplied to Drosera species diminished when the Nitrogen supply to the soil increased. Nitrogen poor grasslands represented by slow-growing perennials are more susceptible to introduction of fastgrowing annual grasses under increased soil Nitrogen availability; because annual grasses quickly utilize the available Nitrogen (Dukes and Mooney 1999). Soil Total Phosphorus (%) ranged from 0.006 (degraded) to 0.005 (non degraded) for 0-10 cm soil depth and for 10-20 cm soil depth ranged from 0.103 (degraded) to 0.004 (non-degraded). Soil available Potassium (%) varied from 0.133 (degraded) to 0.103 (non-degraded) for 0-10 cm soil depth and 0.130 (degraded) to 0.81(non-degraded) at 10-20 cm soil depth.. According to Givnish et al. (1984), carnivorous plants should be restricted to nutrient-poor habitats owing to the high costs associated with carnivory. In degraded site, overall analysis showed that 21.42% decline in SOC was noticed, whereas other nutrients like Soil Total Nitrogen, Phosphorus and Potassium did not show any trend in decrease or increase in their value. All carnivorous plants are green and able to fix CO2, although the growth of some species is partly dependent on organic carbon uptake from prey (Lüttge, 1983). Belnap and Phillips (2001) reported that the habitat invaded by annual grass had less rich soil biota. Disturbance approaches may affect soil nutrient and carbon storage both directly (e.g., defoliation) and indirectly by altering plant community structure in grassland (Klumpp et al. 2007). Although growing in mineral-poor habitats, Drosera may have nearly the same

Biswajit Sutradhar et. al.  | 261

composition of macro-elements as other non-carnivorous plants growing in the habitat (Dykyjová, 1979). Among the other soil physicochemical properties, pH (ANOVA df=8; F 17.35; P = 0.004) and total Nitrogen in top layer (ANOVA df=8; F 6.18; P = 0.012) significantly varied between the sites. In non-degraded site, about 22.86% decrease in Soil Phosphorus and 76.69% increase in Soil Potassium was noticed from top (0-10 cm) to second layer (10-20 cm). A typical feature of carnivorous plant is relatively high efficiency of Nitrogen and Phosphorus re-utilization from aged plant organs, which is also higher than that in other accompanying non- carnivorous plant (Karlsson, 1988). Jayaram and Prasad (2006) observed D. burmanii in open, wet, nutrient-poor and generally acid soils (pH 5.2–6.0), usually in marshy areas with a small proportion of sand. Moreover, increased Nitrogen itself and reduced soil pH caused by it, minimized the number of rare, perennial, forbs and Nitrogen -fixing species (Goulding et al. 1998, Suding et al. 2005). Generally, carnivorous plants respond less to prey at high soil nutrient levels than at lower levels (Givnish et al. 1984; Karlsson et al. 1991). Effect of Soil Depth on Nutrient Pool The total stock value of Soil Organic Carbon (SOC Mg ha-1) varied from 9.44 (degraded) to 21.47 (non-degraded) for 0-10 cm soil depth and at 10-20 cm soil depth it varied from 7.21 (degraded) to 20.24 (non-degraded). Soil Nitrogen (kg ha-1) ranged from 155.39 (degraded) to 257.33 (non-degraded) for 0-10 cm and for 0-20 cm soil depth, its value ranged from 155.40 (degraded) to 213.82 (non-degraded). The Soil Phosphorus showed value between 8.92 (degraded) to 8.69 (non-degraded) for 0-10 cm and for 10-20 cm soil depth, the value ranged from 11.94 (degraded) to 6.37 (non-degraded). Soil potassium also ranged from 205.65 (degraded) to 159.04 (non-degraded) for 0-10 cm and at 0-20 cm soil depth the value varied from 194.68 (degraded) to 275.11 (non-degraded). Carnivorous plants growing in natural habitats are subjected to competition with non- carnivorous plants (Wilson, 1985). Their mortality and prey availability may be affected by opportunistic predators (Thum, 1989; Zamora, 1990). The nutrients released from insect carcasses may be washed out by rain or even whole prey completely washed away by heavy rains (Karlsson et al. 1987). Hence, the degraded site dominated with grass is less populated with Dosera. In natural habitats, carnivorous plants re-utilize soil nutrients from their senescing shoots much more efficiently than that of accompanying non-carnivorous plant species growing in the same habitats. This may be due to eco-physiological adaptation to combined unfavourable soil conditions along with catching of prey (Adamec, 2002). The value of BD (g cm-3) ranged from 1.53 (degraded) to 1.57 (non-degraded) for 0-10 cm soil depth and for 1020 cm, its value ranged from 1.51 (degraded) to 1.49 (non-degraded). In degraded site, Soil Nitrogen (kg ha-1) was found to decrease (23.63%) but a significant increase in Soil potassium was recorded (72.98%). High soil nutrient in the non-degraded site may (Fig. 4) increase soil C by stimulating belowground production (van Groenigen et al. 2006). Soil C storage decreased substantially with habitat degradation (He et al. 2008). Schippers and Joenje (2002) suggested that heavy disturbance may alter soil nutrient cycling and carbon storage. Thus, the degraded ecosystem has a potential to alter not only the aboveground

262  |  Soil Nutrients and Plant Association Analysis Under Different Habitats of a Threatened...

community, but also the belowground soil properties and the soil carbon-sink function (Piao et al. 2009). The present habitats are actually shallow root system, where most biomass is concentrated in the top 30 cm of soil (Nippert et al. 2012). In most Drosera species, high nutrient condition supports longer roots for absorbing more nutrients from the nutrient poor soil (Givnish et al. 1984). In some Drosera species, a large amount of nutrients coming from carnivory is stored in winter buds and utilized for vigorous growth throughout the following season (Schulze and Schulze, 1990). Table 3: Value of different nutrient pools in both habitat of D. burmannii Edaphic Properties

Soil pH (KCL)

Non-degraded

Degraded

0-10 cm

10-20 cm

0-20 cm

0-10 cm

10-20 cm

0-20 cm

4.88

4.92

4.90

4.20

4.00

4.10

SOC (%)

1.352

1.376

1.364

0.616

0.484

0.550

Soil N (%)

0.164

0.144

0.153

0.102

0.103

0.102

Soil P (%)

0.005

0.004

0.005

0.006

0.103

0.007

Soil K (%)

0.103

0.181

0.141

0.133

0.130

0.132

SOC (Mg/ha)

21.47

20.24

21.14

9.44

7.21

8.33

Soil N(kg/ha)

257.33

213.82

235.58

155.39

155.40

155.40

Soil P(kg/ha)

8.69

6.37

7.53

8.92

11.94

10.43

Soil K(kg/ha)

159.04

275.11

217.08

205.65

194.68

200.17

C: N

8.02

8.37

8.19

6.67

5.25

5.83

Bulk Density ( g/cm3)

1.57

1.49

1.53

1.53

1.51

1.52

Fig. 4: Graph showing different soil edaphic factors associated with the habitat of D. burmannii

Biswajit Sutradhar et. al.  | 263

Like other carnivorous plants, Drosera is likely to be a sensitive indicator of global climate change and other environmental impacts such as enhanced nitrogen deposition (Ellison and Goteli, 2001). It was observed that the population of D. burmannii were high in the non-degraded than the degraded site. D. burmannii has specific choice for its association. It is difficult to compare growth effects of soil nutrient supply in carnivorous plants under natural conditions due to variations in nutrient levels in the habitat and also for insect-feeding rates. Even, the role of microelements in carnivory is still unclear. The species richness and dominance index were found higher in non-degraded site which may be due to the availability of water and low soil pH than that of degraded habitat. Based on Shannon Index, Simpsons Index and species richness, the study indicates high diversity at non-degraded site than the degraded one. The environmental factors are controlling the species survivability in the area. The soil organic carbon and total nitrogen were present in the higher quantity at the non-degraded site, whereas total phosphorus was high at the degraded site of the habitats. The study may help developing proper management practice to conserve this species at local and regional scale.

REFERENCES Adamec, L. 1997. Mineral nutrition of carnivorous plants: A review. Bot. Rev. 63: 273–299. Adamec, L. 2002. Leaf absorption of mineral nutrients in carnivorous plants stimulates root nutrient uptake. New Phytol. 155, 89-100. Anderson, J. M., and Ingram, J. S. I. 1989. Tropical Soil Biology and Fertility: A handbook of methods of analysis. CAB International, Wallingford, UK. Barthlott, W. and Ashdown, M. 2007. The curious world of carnivorous plants: a comprehensive guide to their biology and cultivation. Timber Press, Portland. Belnap J and Phillips SL. 2001. Soil biota in an ungrazed grassland: response to annual grass (Bromus tectorum) invasion. Ecol.l Appli. 11:1261–1275. Blake, G.R., and K.H. Hartge. 1986. Bulk density. p. 363–375. In A. Klute (ed.) Methods of soil analysis. Part 1. 2nd ed. Agron. Monogr. 9. ASA and SSSA, Madison, WI. Bradley,  R,  Drijber,  R,  Knops  J.M.H.   2002.  Examining the roles of plant species and nitrogen in the structure and function of microbial communities. Center. Grassl. Stud. 84:1–8. Chakraborty, S. and Bhattacharya, M. 2013. Associated vegetation of Sundew (Drosera burmanii Vahl.) in plains of Eastern Himalayan of West Bengal. Environ. and Ecol. 31 (2B): 480-83. Chandler, G. E. and Anderson, J. W. 1976. Uptake and metabolism of insect metabolites by leaves and tentacles of Drosera species. New Phytol. 77: 625–634. Davies, K. W., and T. J. Svejcar. 2008. Comparison of medusahead-invaded and noninvaded Wyoming big sagebrush steppe in southeastern Oregon. Rangeland Ecol and Manag. 61:623–629.

264  |  Soil Nutrients and Plant Association Analysis Under Different Habitats of a Threatened...

Deb, D. B. 1981. The Flora of Tripura State. Vol I. Today and Tomorrow’s Printers and Publishers, New Delhi. Dixon, K.W., Pate, J. S. and Bailey, W. J. 1980. Nitrogen nutrition of the tuberous sundew Drosera erythrorhiza Lindl. with special reference to catch of arthropod fauna by its glandular leaves. Aust. J. Bot. 28: 283–297. Dukes J. S. and H. A. M ooney. 1999. Does global change increase the s uccess of biological invaders ? Trends in Ecology and Evolut ion, 14 (4):135-139. Dykyjová D. 1979. Selective uptake of mineral ions and their concentration factors in aquatic higher plants. Folia Geobot. Phytotax. 14: 267–325. Ellison, A. M. and Gotelli, N. J. 2001. Evolutionary ecology of carnivorous plants. Trends Ecol. Evol. 16: 623-629. Givinish, T. J., Burkhardt, E. L., Happel, R. E., and Weintraub, J. D. 1984. Carnivory in the bomeliad Brocchinia reducta, with a cost/benefit model for the general restriction of plants to sunny, moist, nutrient-poor habitats. Am. Nat. 124: 479–497. Goulding,  K.W.T.  , Bailey,  N.J.  Bradbury,  N.J.  et al. 1998.  Nitrogen deposition and its contribution to nitrogen cycling and associated soil processes. New Phytol 139:49–58. Grime J. P. 1998. Benefits of plant diversity to ecosystems: immediate, filter and founder effects. J. Ecol. 86, 902–910. Guo, L. B.  and  Gifford, R. M.  2002. Soil carbon stocks and land use change: a meta analysis. Global Change Biol. 8, 345–360. He, N.P., Yu, Q., Wu, L, Wang, Y.S. and Han, X.G. 2008. Carbon and nitrogen store and storage potential as affected by land-use in a Leymus chinensis grassland of northern China. Soil Biol Biochem 40:2952–2959. Hooker, J. D. 1897. The Flora of British India. Vol. IV. L. Reeve and Co., London, pp. 683. Jain, S. K. and Rao, R. R. 1997. A Handbook of Field and Herbarium Methods. Today and Tomorrows’ Printers and Publishers, New Delhi. Jayaram, K. and Prasad, M. N. V. 2006. Drosera indica L. and D. burmanii Vahl., medicinally important insectivorous plants in Andhra Pradesh-regional threats and conservation. Curr. Sci. 91: 943-946. Jayaram, K., Prasad, M. N. V. 2007. Rapid in vitro multiplication of Drosera indica L.: A vulnerable, medicinally important insectivorous plant. Plant Biotechnol. Rep. 1: 79-84. Juniper, B.E., Robins, R.J., and Joel, D.M. (eds.) 1989. The Carnivorous Plants. Academic Press, London. Millett, J., Jones, R. I. and Waldron, S. 2003. The contribution of insect prey to the total nitrogen content of sundews ( Drosera spp.) determined in situ by stable isotope analysis. New Phytol. 158: 527–534 Karlsson, P. S. 1991. The effect of soil nutrient status on prey utilization in four carnivorous plants. Oecologia. 86: 1-7.

Biswajit Sutradhar et. al.  | 265

Karlsson, P. S., K. O. Nordell, S. Eirefelt & A. Svensson. 1987. Trapping efficiency of three carnivorous Pinguicula species. Oecologia 73: 518-521. Klumpp, K., Soussana, J. F., and Falcimagne, R.: Effects of past and current disturbance on carbon cycling in grassland mesocosms, Agric. Ecosyst. Environ., 121, 59–73, 2007. Lüttge, U. 1983. Ecophysiology of Carnivorous Plants, In: O.L. Lange, P.S. Nobel, C.B. Osmond and H. Ziegler (eds.), Encyclopedia of Plant Physiology, New Series, Vol. 12C. Springer-Verlag, BerlinHeidelberg-New York, pp. 489-517. Magurran, A. E. 1988. Ecological Diversity and Its Measurement. Princeton University Press, Princeton. Majumdar, K., Datta, B. K. and Shankar, U. 2010. Community structure and Population status of Drosera burmannii Vahl with new distributional record in Tripura, India. J. Ecol. Nat. Environ. 3 (13): 410-414. McPherson, S. R. 2010. Carnivorous plants and their habitats. 2 Volumes. Redfern Natural History Product Ltd., Poole. Menhinick, E. F. 1964. A comparison of some species diversity indices applied to samples of field insects. Ecology: 45: 859-861. Millett, J., Svensson, B. M., Newton, J. and Rydin, H. 2012. Reliance on prey-derived nitrogen by the carnivorous plant Drosera rotundifolia decreases with increasing nitrogen deposition. New Phytol. 195: 182–188. Mitra, S., Mukherjee, S. K. 2010. Ethnomedicinal usages of some wild plants of North Bengal plain for gastrointestinal problem. Int. J. Tradi. Know. 9: 705-712. Nippert, J.B., Wieme, R.A., Ocheltree, T.W. & Craine, J.M. (2012) Root characteristics of C4 grasses limit reliance on deep soil water in tallgrass prairie. Plant and Soil, 355, 385–394 Nordbakken, J. .F, Rydgren, K. and Okland, R. H. 2004. Demography and population dynamics of Drosera anglica and D. rotundifolia. J. Ecol. 92: 110-121. Perica, M. C. and Berljak, J. 1996. In vitro growth and regeneration of Drosera. spatulata Labill on various media. Horti. Sci. 31: 1033-1034. Piao S, Ciais P, Friedlingstein P, De Noblet-Ducoudre N, Cadule P, Viovy N, Wang T 2009. Spatiotemporal patterns of terrestrial carbon cycle during the 20th century. Global Biogeochemical Cycles, 23, GB4026. Piliackas, J. M. and Barbosa, L. M. 1989. Aspectos Biológicos e Ecológicos de Plantas Carnívoras. Ecossistema 14: 89-103. Saridakis, D. P., Torezan, J. M. D. and Andrade, G. 2004. Microhabitat preferences of six Drosera (Droseraceae) from Tibagi river basin, Parana state, Brazil. Braz. Arch. Biol. Technol. 47: 495-501. Shannon, C. E. and Weiner, W. 1963. The Mathematical Theory of Communication. University of Illinois Press, Urbana, USA.

266  |  Soil Nutrients and Plant Association Analysis Under Different Habitats of a Threatened...

Sharma, B. D., and Balakrishnan, N. P. 1993. Flora of India, Vol. I. Botanical Survey of India, Calcutta. Sharma, G.P., Singh, J.S and Raghubanshi, A.S .2005.  Plant invasions: emerging trends and future implications. Curr Sci 88:726–34. Schulze, W. and E.-D. Schulze. 1990. Insect capture and growth of the insectivorous Drosera rotundifolia L. Oecologia 82: 427-429. Schippers P and Joenje W 2002. Modelling the effect of fertiliser, mowing, disturbance and width on the biodiversity of plant communities of field boundaries. Agric Ecosyst Environ 93:351–365 Simpson, E. H. 1949. Measurement of diversity. Nature. 163: 688-688. Suding,  K.N., Collins,  S.L., Gough  L  et al.   2005.   Functional- and abundancebased mechanisms explain diversity loss due to N fertilization. Proc Natl Acad Sci USA 102:4387–92. Tandon, H. L. S. 1993. Methods of analysis of soils, plants and waters. New Delhi, India. Thorén, L. M., Tuomi, J., Kämäräinen, T. and Laine, K. 2003. Resource availability affects investment in carnivory in Drosera rotundifolia. New Phytol. 159: 507–511. Thum, M 1989. The significance of opportunistic predators for the sympatric carnivorous plant species  Drosera intermedia and Drosera rotundifolia. Oecologia 81: 397-400. Tilman, D. 1999. The ecological consequences of changes in biodiversity: a search for general principles. Ecology 80: 1455–1474. Walkley, A. and I. A. Black. 1934. An examination of Degtjareff method for determining soil organic matter and a proposed modification of the chromic acid titration method. Soil Sci. 37: 29-37. Whittaker, R. H. 1972. Evolution and measurement of species diversity. Taxon. 21: 213-251. Whittaker, R. H. 1975. Communities and Ecosystems, Macmillan, New York. Wilson, S.D. 1985. The growth of Drosera intermedia in nutrient-rich habitats: the role of insectivory and interspecific competition. Can. J. Bot. 63, 2468-2469. Van Groenigen, K. J., J. Six, B. A. Hungate, M. A. De Graaf, N. Van Breemen, and C. van Kessel. 2006. Element interactions limit soil C storage. Proc. Natl. Acad. Sci. U.S.A 103:6571–6573. Zamora, R.  1990. Observational and experimental study of a carnivorous plant-ant kleptobiotic interaction. Oikos 59: 368-372. Zhuang, X. 2011. Drosera burmanni. The IUCN Red List of Threatened Species 2011: e.T169038A6566220. http://dx.doi.org/10.2305/IUCN.UK.20111.RLTS. T169038A6566220.en. D

mmm

Trends in Frontal Areas of Plant Science Research Edited by: S. Sinha, R.K. Sinha © Department of Botany, Tripura University, 2017

Studies on Phytolith Morphotypes of Some Bamboo Species of Tripura, North East India Ashish Kumar Chowdhury* and Badal Kumar Datta Plant Taxonomy and Biodiversity Laboratory Department of Botany, Tripura University, Suryamaninagar-799022, Tripura. * Corresponding author: [email protected]

Summary Bamboo is an important group of flowering plant belonging to the family Poaceae which accumulates silica in the form of phytoliths. The phytoliths are amorphous micrometric particles protect the plant from various biotic and abiotic stresses. It also provides mechanical support, stiffness and durability to the culms of bamboo. Silica bodies are precipitated in the epidermis or in the bundle sheath cells of the vascular bundles and in the sub-epidermal layer of plant tissue.The present study was aimed to find out the distribution, diversity and frequency of opal phytoliths in the leaves of three species of bamboo by wet oxidation method. Variation was observed in the morphotype of Phytoliths and in total, seven types of phytolith morphotypes (SCS, SCR, BF, BP, LCW, SCC and SCLT) were found in the leaves of three bamboo species, viz., Bambusa cacharensis, Bambusa nutans, and Bambusa vulgaris. Among these, SCS type is the most abundant phytolith with frequency of above 50%. Short cell saddle (SCS), Short cell rondel (SCR), Long cell wavy (LCW) and BF type of phytolith morphotype was observed in both the species of Bambusa cacharensis and Bambusa vulgaris, but not observed in Bambusa nutans. BP type of phytolih was commonly observed in both the species of Bambusa nutans and Bambusa vulgaris but not observed in Bambusa cacharensis. SCC type of phytolith observed only in Bambusa nutans (2.79±0.68%) and SCLT morphotype was observed in Bambusa vulgaris (3.00±0.61%). Therefore, the study of phytoliths possesses taxonomic values and can be interpolated as a parameter permitting identification of bamboo species. Key words: Bamboo, Poaceae, Silica, Phytolith, Epidermal cell Phytoliths (Greek, phyto = plant, lithos = stones) or plant stones are amorphous micrometric particles of silica that are deposited in or between cells of living plant tissues of many plant families (Piperno, 1998, Pearsall, 2000).The occurrence of silicon as silica bodies or phytoliths in many plants has been correlated with mechanical support, stiffness and, actually these phtoliths protect the plant from various biotic and abiotic stresses (Mazumdar, 2011, Hari Babu et al. 2011). Because of their consistent shape within species,

268  |  Studies on Phytolith Morphotypes of Some Bamboo Species of Tripura, North East India

phytoliths provide significant taxonomic information of study for the reconstruction of past environment as well as past plant–people relationship (Wilding and Dress, 1971; Mulholland, 1989; Mulholland and Rapp, 1992). As some plants were found to produce distinguishable, characteristic or “diagnostic” shaped Phytoliths, they are well established as useful tools in archaeology, angiosperm taxonomy (Piperno, 1988) and recently for nanotechnology (Neethirajan et al. 2009). The family Poaceae produces abundant, diverse and distinctive opaline silica bodies with diagnostic morphological features that permit identification to subfamily, or in some instances, lower taxonomic levels (Hodson et al, 2005).The documentation of many diagnostic phytoliths in bamboos is of considerable significance. The Bambusoideae also contribute a large number of phytoliths diagnostic at the tribe, subtribe and genus levels (Wang and Lu, 1993; Piperno and Pearsal, 1998; Kondo et al. 1994).The present study mainly focusses on diversity, distribution as well as frequency of phytoliths in the leaves of three bamboo species viz., Bambusa cacharensis, Bambusa nutans and Bambusa vulgaris in order to understand their significances in identifying bamboo species.

Materials and Methods Fresh and mature leaves of three bamboo species (Bambusa cacharensis, Bambusa nutans, and Bambusa vulgaris) comprising the subfamily Bambusoideae were collected from the Bambusetum of Tripura University campus, Suryamaninagar, Tripura, North-East India(23o45′38.4′′ N and 91o15′54.0′′ E). The collected species were identified with the help of standard literature “The Flora of Tripura state” vol. II, Deb (1983) and “Flora of Assam” Vol.V,Bore,N.L(1940).Phytoliths were extracted from leaf by wet oxidation method (Mazumdar and Mukhopadhyay, 2009a.) with minor modification. All the collected samples were cleaned with mild detergent solution to remove adherent soil particles. Then the samples were cleaned with distilled water in an ultrasonic water bath for two times and dried in hot air woven at 60oC for 2 hours. Then, approximately 2g of each sample was takenin a test tube after slicing them in small pieces and keptin 15 ml of saturated nitric acid for overnight. The solution was centrifuged at 2000 rpm for 10 min, decanted, and then boiled in 10% Hydrochloric acid in water bath to remove calcium, and finally washed with distilled water 2-3 times. The processed materials were then centrifuged with acetone at 2000 rpm for 10 minutes each time and dried with acetone. The phytoliths sediments were transferred to storage vials. The residual subsamples were mounted onto microscopic slides in Canada balsam medium for photomicrography and in 10% Glycerol for counting and line drawing.A minimum of 300 phytoliths grains were counted for each sample. Slides were observed under light microscope and photographs were taken with Olympus digital camera (SLI500) attached with Olympus trinocular microscope (Model: Olympus CX21i). Measurements were made along the longest axis of the phytoliths with the help of SImage 2013. In the present study phytolith morphotypes were described and classified according to International Code for Phytolith Nomenclature, ICPN (Madella et al. 2005) and Phytolith Core (Phytolith database, GPEG-2014) classification. Statistical analysis was done with the help of MS Excel 2007.

Ashish Kumar Chowdhury et.al.  | 269

Results and Discussion In the present studya wide array of phytolithmorphotypes were observed in the leaves of three bamboo species such as Bambusa cacharensis, Bambusa nutansand Bambusa vulgaris (Table 1). The observed phytoliths (Figs. 2-4) of each species were measured (Table 2) and their frequency (Table 3) and distribution (table 4) were recorded. The data obtained from the frequency phytolith assemblages (Fig. 1) as well as measurements indicate considerable variations. The morphotype observed in the species Bambusa cacharensis are SCS, SCR, BF and LCW (Fig. 2).SCS type includes both square and elongated shape phytolith morphotypes. SCR type includes flat tower, two horn tower and three horn tower phytolith morphotypes. Among them, SCS is the most abundant (almost 61%) morphotype and LCW shows least abundant (almost 4%) phytolith morphotype. The morphotype observed in the species Bambusa nutanswasSCS (both elongated and square morphotype), SCR (two horn tower), BP, LCW and SCC (Fig. 3). Among them, SCS is the most abundant (almost 56%) morphotype and SCC shows least abundant (almost 2%) phytolith morphotype. The morphotype observed in the Bambusa vulgariswere SCS(both elongated and square shaped), SCR (Two horned tower), BP, BF, LCW and SCLT (Fig.4). Among them, SCS is the most abundant (almost 50%) morphotype and SCC shows least abundant (almost 3%) phytolith morphotype. Phytolith morphotype observed in the three species shows abundant SCS type (>50%) of phytolith which is an important characteristic and feature of these three species under the sub-tribe Bambusoidae.SCS, SCR and LCW types of phytoliths are common among the three species.BF type of phytoliths morphotype was observed in both the species of Bambusa cacharensis and Bambusa vulgaris, but not observed in Bambusa nutans. BP type of phytolith was commonly observed in both the species Bambusa nutans and Bambusa vulgaris, but not observed in Bambusa cacharensis.SCC type of phytolith was rarely observed only in Bambusa nutansand SCLT morphotype was rarely observed in Bambusa vulgaris. Table 1: Different types of phytoliths with their abbreviations. Sl. No.

Type

Abbreviations

1

Short cell saddle

SCS

2

Short cell rondel

SCR

3

Buliform fan

BF

4

Buliform parallepipedal

BP

5

Long cell wavy

LCW

6

Short cell long tower

SCLT

7

Short cell cross

SCC

270  |  Studies on Phytolith Morphotypes of Some Bamboo Species of Tripura, North East India Tableand 2: Measurement Structure and Measurement of three Phytoliths of three Bamboo species. Table 2: Structure of Phytoliths (µm) of Bamboo(µm) species. Name of species

Shape SCS SCR Dimensio n Bambusa L MEAN 16.81 ± 11.84 cacharensis ± SD 4.19 ±1.62 s RANG 12.19 to 9.67 to E 27.71 14.55 W MEAN 11.89 ± 7.84 ± ± SD 1.62 0.073 RANG 9.60 to 7.20 to E 14.28 9.23 Bambusa L MEAN 17.38 ± 7.64 ± nutans ± SD 3.33 2.29 RANG 12.74 to 5.35 to E 25.50 12.74 W MEAN 12.83 ± 5.98 ± ± SD 2.49 1.87 RANG 8.11 3.49 to E to17.28 10.66 Bambusa L MEAN 17.12 ± 13.57 ± vulgaris ± SD 3.05 2.4 RANG 12.38 to 9.74 to E 24.38 19.46 W MEAN 13.71± 10.02 ± ± SD 1.69 1.93 RANG 9.2 to 7.45 to E 16.88 13.39 Values with - show absence of Phytolith morphotype

BF 41.43 ± 2.21 38.26 to 44.22 29.69 ± 4.62 23.97 to 34.16 43.80 ± 3.74 38.19 to 44.62 10.02 ± 1.93 22.30 to 39.09

BP

26.75 ± 4.9 21.40 to 33.02 22.54 ± 3.79 19.38 to 20.43 30.52 ± 2.78 27.25 to 33.97 22.16 ± 2.99 18.24 to 25.58

LCW 50.68 ± 10.04 40.50 to 68.31 16.56 ± 0.78 15.65 to 17.62 38.47 ± 6.28 31.73 to 50.31 12.39 ± 2.9 6.73 to 16.25 51.07 ± 9.88 62.32 to 35.94 12.28 ± 0.74 12.23 to 13.032

SCLT

SSC

-

-

-

-

-

-

5.86 ± 0.69 12.87 to 15.20 14.14 ± 1.04 4.92 to 6.66

13.94 ± 0.25 13.72 to 14.23 13.55 ± 0.22 13.30 to 13.73 -

Table 3: Frequency (%) of Phytolith morphotypes of three Bamboo species Name of the species Bambusa cacharensis

Morphotypes SCS

SCR

61.57±5.01 28.17±2.26

BP

BF

LCW

SCLT

SCC

0.0

5.94±1.84

4.18±1.08

0.0

0.0

0.0

13.51±3.44

0.0

2.79±0.68

Bambusa nutans

55.76±7.65 18.67±1.99 8.76±1.65

Bambusa vulgaris

50.75±4.42 13.98±2.97 7.47±1.66 14.49±1.63 10.25±1.55 3.00±0.61

Values are mean’s (n = 5), Values with 0.0 show absence of Phytolith morphotype

0.0

Ashish Kumar Chowdhury et.al.  | 271 Table 4: Occurrence of phytoliths morphotypes in three bamboo species. Sl. No.

Phytolith morphotypes

Abundant

Common

Rare

1

Bambusa cacharensis

Name of the species

SCS,SCR,BF, LCW.

SCS

SCR, BF

LCW

2

Bambusa nutans

SCS, SCR, BP, LCW, SCC

SCS

SCR, BP, LCW

SCC

3

Bambusa vulgaris

SCS, SCR, BP, BF, LCW, SCLT

SCS

SCR, BF, BP, LCW

SCLT

≥50% abundant, 5% common,