The American Medical Association Encyclopedia of Medicine 0394565282, 9780394565286

In easy-to-understand language, this comprehensive guide covers common and uncommon disorders, diseases, their symptoms

661 67 77MB

English Pages 1184 [1187] Year 1989

Report DMCA / Copyright

DOWNLOAD PDF FILE

Recommend Papers

The American Medical Association Encyclopedia of Medicine
 0394565282, 9780394565286

  • 0 0 0
  • Like this paper and download? You can publish your own PDF file online for free in a few minutes! Sign Up
File loading please wait...
Citation preview

THE

AMERICAN MEDICAL ASSOCIATION

ENCYCLOPEDIA OF MEDICINE

Page intentionally left blank.

THE

AMERICAN MEDICAL ASSOCIATION

ENCYCLOPEDIA OF MEDICINE MEDICAL EDITOR Charles B. Clayman, MD

Random House New York

Copyright© 1989 by Dorling Kindersley Limited and the American Medical Association All rights reserved under International and PanAmerican Copyright Conventions. Published in the United States by Random House, Inc ., Nevv York.

The information in this encyclopedia reflects current medical knowledge. The recommendations and information are appropriate in most cases; however, they are not a substitute for medical diagnosis. For specific information concerning your persondl medical condition, the AMA suggests that you consult a physician. The n~IQIN

= ~:;:':.:!'ui.:";c.,.. I ,_,i,,_. n.,couiow•"''"Nelo

I ''"

N0 ■■■■■ · 3' c.11,... Jll'l,llc ................. YO."lll'" "'"'•colipHa"""•~~•

I

I I

L-------------J . l '"'"'-,._,.~"C'!

.

Fever in children ~ -- ----.::ually caused by infection or bacterium. However. a so become feverish if CANCER WATCH me overheated. Do Recurrent abdominal pain irin: use an aspirin (especially in people over 40) may raised temperature indicate cancer. especially if the ild's forehead to feel hot symptoms are newly developed increased sweating and a ard are accompanied by a ing of being sick. Normal change in eating or bowel habits. may vary from 97 to Consult yol•r physician without 37.5°C). Minor delay! within this range are no ...__ _ _ _ _ _ _-.-_ _ __,_,,ncem if your child seems otherwise well.

Other information ----+Some symptom charts have additional boxes containing self-help advice or information directed at particular groups of people.

""~""'°"'-

..

"'

f.lllEIIG(IICY'

CEffllfOCALHl

"'Mffdrtll•

""'11M1'11""-''

Warning _ _ _ _ __ _ _ _ Warning boxes draw your attention to potentially serious symptoms and give practical advice

- - - - - Emergency! Get medlcal help now! This instruction indicates that the problem may be life-threatening and needs immediate medical attention. Call for an ambulance or. if you are certain that the person can be moved safely. take him or her to the nearest hospital emergency room.

Pa,,,a,, rwhtfebel'M!et111'iel'leel

,rc,s,on..,aoe,,,:t,e bteaslbone and ,s ooeoe(l JP

~

cl>es:

Equipment Detailed illustrations show the workings of special equipment, such as a heart-lung machine.

Gastrectomy.

WHY IT IS CONE Sut)iecl 10 ava,lab,hly ol a donor a hean 11.;r'lg

tfansplant can ofler hOpc to someone who ,s dy,ng OI an end stage ch rONC

lung disease whe!t'er or nOI tieo, she,saiso sullering lrom heart disease Diseases

Reasons for surgery - - -----++-· Different med ical images - such as photog raphs, X rays , or scans of diseased tissue show why operations are necessary Thei,esec11()f1SWl"l'etai..t,Y1 homdheaQny IUO!J (ar ,ell) and dll emohysv.malOu!,,

.....~~ - - Step-by-step text and Illustrations Explanatory captions and anatomically correct illustrations take you through the most important stages of surgical procedures . Large numbers show the sequence of events and help you follow the different stages.

13

HOW TO USE THE ENCYCLOPEDIA

HOW TO FIND INFORMATION ON DRUGS The A to Z of Medicine contains individual entries on all maior drug groups (from ACE inhibitor drugs to Vasodilator drugs) and on the most important generic drugs (from Acebutolol to Zidovudine). Other informaDrug charts

tion on drugs can be found in general entries, such as Drug, Drug dependence, and Drug poisoning. The Drug Glossary gives concise information on almost 3,000 generic and brand-name drugs, showing the

generic equivalents of brand-name drugs, and identifying the drug groups to which individual drugs 6elong. Each glossary entry crossrefers you for more information to the A to Z of Medicine .

Generic name

j

Selected entries on ind ividual drugs are accompanied by an illustrated chart that summarizes important information about the drug . Group to which the drug belongs

Injection

Suppository

Inhaler

Dig xin

Drops

_____.--OfGIT ALIS

Forms in which the--drug is available

--,:=--)-----......,.---:---±:---r~--:-----::----,----,,..._-

[ -----f\lSCIOUS VICTIM first-aid boxes have a distinctive red border and a special heading. A list of first-aid boxes describing emer.;~.,:-~-.J . .. gency tec~nigues, with their:;age ·-a ' ·,;. ·; • I numbers, 1s given on page 8.

EMERGENCY FIRST-AID TECHNIQUES

l

I UNCONSCIOUS VICTIM

Turn to page 8 for the page numbers of emergency first-aid boxes.

WARNING _ _ _ _ __ _ Warning boxes contain essential advice and ind icate when professional help should be sought.

__.Ir,__-_-_----------•I II I I

r-----------1 loo~ I I

I I

I

I



rub the affected p arts

■ attempt lo bursl blisters ■

warm the affected atfil!_ with direct heat ■ allow the victim lo walk on a frostbitlen foot

WARNING

Frostbite 1s often accompanied by hypothermia . which must be treated first. Proper medical attention should be soug ht promptly . but first aid should be given immediately

1 ::~:' .~: :~~:.: :;:·.~;'. .~;: .·:. ~-":, ~;:-~;·,;~,' ,I•• rui1• ,11!1t'f ,., ,, .,, IJI• top l' r,K,'> , ,., , ~JI '

",..,1, .,

,._,,• I •l1qJ','

I

_ _ _ _ _ _ _ _ _ _ _ ..I

I.

I I I

I

L------------~ 14

I I I I

St b t Fir~~ai~-~~~niques are clearly desc ribed in numbered seq uences of text and illustrations

Close-ups - - - - ~ t - - : , . . . . ; DO NOT These boxes tell you what not to do when treating an injured person .

More detailed illustrations show you exac tly what to do.

2 : , ·::'; ,'::,;:;:,\.:.: :~,~~:::;,:·:~:~~:~: ~"'""""'' .. ,.,.,'111'1" ~ ht••1 1 II 1,,,,,111•1111

11Ut • I,,,, I •• ••,•,''" I ••,._,.•~••·• '' i,,"\l Powder Injection Ointment [D Ointment available over-the-counter

'.!:O

Available as generic

An a11tibacterial drug active against many of the bacteria that cause skin and eye infections. It is often used in combination with other antibiotics, such as neomycin and polymyxin B, that complement its antibacterial activity. Bacitracin is usually applied to the skin as a powder or ointment and to the eye in the form of an ointment. It is not absorbed into the bloodstream when taken by mouth and is therefore given by injection when used to treat a severe infection. Kidney damage is a possible adverse effect and bacitracin is therefore used only for severe infections that have not responded to other more common antibiotics.

Back

Baby Doe case

The area from the shoulders to the buttocks. The back is supported by the spinal column (see Spine), which is bound together by ligaments and supported by muscles that also control posture and movement.

A celebrated legal case involving the medical care of infants born with severe physical handicaps. In 1983 the Department of Health and Human Services began requiring that the maximum of resources be used to preserve life in such cases. Traditionally, the decision to preserve the life of the severely handicapped was determined after consultation among the physician, the child's family, and, often, the family

Problems involving the back are numerous. They arise from a number of causes affecting the spine, and can involve disorders of bones, muscles, ligaments, tendons, nerves, and joints in the spine. These disorders can cause back pai11 with or without sciatica- pain in the buttock and down the back of the leg. (See also Spine disorders box.)

150

Back disorders

Back pain Most people suffer from back pain at some time in their lives. In many cases it is labeled "nonspecific back pain" and no exact diagnosis is made because the pain resolves with rest and because analgesics (painkillers) are used before any tests such as X rays are performed. CAUSES

Nonspecific back pain is one of the largest single causes of lost working days through illness in the US. People most likely to suffer from back pain are those whose jobs involve much heavy lifting and carrying, or those who spend long periods sitting in one position or bending awkwardly. Overweight people are also more prone to back pain-their backs carry a heavier load and they tend to have weaker abdominal muscles, which help provide back support. Nonspecific back pain is thought to be due to a mechanical disorder affecting one or more structures. The disorder may be a ligament strain, a muscle tear, damage to a spinal facet joint, or a disk prolapse. In addition to pain from a damaged structure, spasm of surrounding muscles will cause additional pain and tenderness over a wider area and can cause temporary scoliosis. Abnormalities of a facet joint and disk prolapse can both cause sciatica (pain in the buttock and down the back of the leg into the foot), resulting from pressure on a sciatic nerve root as it leaves the spinal cord . Coughing, sneezing, or straining will increase the pain. Pressure on the sciatic nerve can cause "pins and needles" in that leg and weakness in muscles activated by the nerve. Rarely, pain can radiate down the femoral nerve on the front of the thigh. Osteoarthritis in the joints of the spine can cause persistent back pain. A11kylosinR spondylitis causes back pain and stiffness with loss of back mobility. Coccy1,;ody11ia (pain and tenderness at the base of the spine) can occur after a fall in which the coccyx has struck the ground, during pregnancy, or for unknown reasons. Fibrositis is a controversial term used to describe pain and tenderness in muscles usually in the back. It is often worse in cold and damp weather and is occasionally associated with feeling sick. Unlike other causes of back pain, fibrositis is not accompanied by muscle spasm or restriction of back movement. ft often responds to nonsteroidal anti-inflammatory drugs.

BACK PAIN

BACKACHE Pain and/or stiffness in the back that may be continuous or intermittent.

B

Of recent origin

Did the pain come on after lifting something heavy, after coughing, ANO/OR after exercising strenuously?

YES

YES . . . This is probably sciatica, which may be

Does the pain prevent you from moving OR does the pain shoot down one leg?

caused by compression of lumbar nerve roots. Consult your physician. See • Disk prolapse • Lumbosacral spasm • Sciatica



NO



NO

•• •• •• •• •• •

YES . . You probably have low back pain as a

Is the pain mainly in the small of your back and not spreading elsewhere?

result of strain.

See• Strain



p ■ • • • • ■■■ ••••• ■ NO

r temperature (38°C)or

YES

YES . . You may have an infection in the kidney,

Do you have pain in one side of the small of your back just above the waist AND do you feel sick?

pyelonephritis, or the pain may be part of a generalized virus infection. Consult your physician. See • Pyelonephritis • Viruses



NO

••

• •• •• ••

• •

NO

• • ■•

Many virus infections, such as influenza, may cause backache, sometimes quite severe. Consult your physician . See • Influenza

Are you over 60 AND/OR have you recently spent several weeks in bed or in a wheelchair?

• •• •• •



YES

Is the pain much worse on one small point in the spine?



NO

YES . .

"B° Consult your physician without delay! You may have bone damage as a result of osteoporosis. See • Osteoporosis

•• ■

NO

■■■ ••• ■■ m ■■ •••••• Other common causes of backache Sudden onset of backache also can arise from strain, being overweight, pregnancy, and from postural pain associated with poor design of bed, car, or working chair. Falls can also cause compression fracture of the spine . Continued on next page

151

BACK PAIN

Gradual onset of stiffness and pain (over a period of months)

B

YES ■ NO

■ ■ ■ ■ ■ ■ ■ ■ ■ ■ ■ ■ ■

YES

Is the pain mainly in the neck or high in the back between the shoulder blades?

See • Cervical osteoarthritis

■ ■

NO ■■■■■ +



■ ■ ■ ■ ■

Is the pain worse when you get up in the morning?

Arthritis of the joints in the neck (sometimes a result of wear and tear) may be the cause of this pain. Consult your physician.

Osteoarthritis of the lower thoracic. lumbar. or sacral spine is a possible diagnosis. It usually subsides spontaneously with rest. heat. and analgesics (painkillers). Consult your physician. See • Osteoarthritis

YES



Your bed may not be giving your back enough support. but there is a possibility of chronic inflammation of the join ts. This may be due to ankylosing spondylitis. especially if you are under 35. Consult your physician.

NO

See • Ankylosmg spondylitis

•• • ■

Other common causes of backache Gradual onset of backache can also arise from recurring low back strain. sometimes related to being ove rweight. and from having poor posture.

If you are unable to make a diagnosis from this chart, consult your physician

Pyelonephritis can cause back pain with pain and tenderness in the loin, fever, chills, and pain when passing urine. Cancer in the spine can cause persistent back pain that disturbs sleep and is unrelieved by rest. SELF-HELP

Back pain and sciatica may improve by resting in bed on a firm mattress or a board. Analgesics (painkillers) and the application of heat to the back can help the pain. If the pain persists, is very severe, or is associated with weakness in a leg or problems with bladder control, a physician should be consulted without delay. 152

INVESTIGATION

Examination of the back may show tenderness in specific areas and loss of motion of the back . Weakness or loss of sensation in the legs implies pressure on a nerve rout; this requires prompt investigation . X rays of the spine may show narrowing between the spinal di sks, osteoarthritis, osteoporosis, ankylosing spondylitis, compression fracture, stress fracture, bone metnstnsis, or spo11dylo/isthesis (displacement of vertebrae) . X rays will not reveal ligament, muscle, facet joint, or disk damage. To reveal pressure on a nerve

root (for example, due to prolapse of a disk), 111yelogrnphy, CT scanning, or MRI is performed. TREATMENT

If a specific cause is found for back pain, treatment will be for that cause. Acute, nonspecific back pain is treated with periods of rest and use of analgesic drugs (painkillers). Chronic nonspecific back pain is more difficult to treat. Treatment may include taking aspirinlike medication, mlfi-i11fln111111ntory drugs, or 11111sclc-relnxn11t dnigs; nrnp1111ct11re or spinal injection; or exercise, spinal 111n11ip11/ntio11, wearing an elastic brncc, or spinal surgery.

BACTERIA

BACK PAIN Most people experience back pain some time in their lives, but in most cases it is not serious and the problem corrects itself before investigation takes place. However, some kinds of back pain can be related to a specific disorder In the diagram below , you will find the most common sites affected by back pain .

REDUCING STRAIN ON THE BACK

B

~--

Osteoarthritis

Pain and sliffness in lhe back due lo degeneration of lhe joints between the vertebrae in one (or more) of the cervical, thorac ic , or lumbosacral regions .

Flbrosltls

Pain and tenderness

Don't push a heavy objec t in front with straight arms ; this pu ts strain on the back.

Do push backward; the strain is taken by the legs instead .

Don 't slouch ; the lower back is pushed out at an angle , resulting in strain .

Do sit up straight . with the spine rest ing against the chair back.

Nonspecific back pain

Pain that commonly affects the lower back but may occur in other parts due to ligament, muscle. joint. or disk damage

J Pyelonephritis

Pain in the loin due to infection ol--- ·-•••••

I

I

'

500 400

I

7--- -...

...

.. , ...::.·-,:••· ,..... ••• •• ••• .. -_____... .. ;..... ..•••= •••i---••• --- ----

300

- - ~-

.A.4 • • '

•-·•-- +-

200

• • • i, . _._....., ._ • •

100

··-

0

Vear

I

I

1972

1974

, •. 4

·•►••

~•u

······••t••lri•• '

1976

1978

I

1980

'

I

1982

The downward sloping graphs for the US probably result from a combination of healthier living and better treatment of heart disease. In the UK. death rates have remained more constant. wh ile Japan has always had a low rate . Note the higher death rates in men.

Key - - - - - - US male • • • • • • • US female - - - - - - UK male • • • • • •• UK female - - - - - - Japan male • • • • • • • Japan femal e

309

C

CORONARY HEART DISEASE

CORONARY ARTERY BYPASS

C

This is now the most common and successful major heart operation in the Western world . Each year some 500,000 Americans undergo the operation, which can relieve them from dependence on drug treatment for heart disease and restore them to active life HOW IT IS DONE Coronary artery bypass is a major procedure, requiring two surgeons and lasti ng up to five hours .

1

WHY IT IS DONE Narrowed coronary arteries are unable to supply the heart muscle with a sufficient amount of blood ; as a result, it becomes starved of oxygen . This may cause angina (chest pain) or, if the narrowed artery becomes blocked , heart tissue damage. By attaching lengths of a vein taken from the leg to the aorta and to a point below the blockages, the narrowed or blocked sections can be bypassed . Before the operation

The first surgeon makes an incision down the center of the patient's chest. The heart is then exposed by opening the pericardium

After the operation

2

Simultaneously. several incisions are made in the leg. and a length of vein removed . Site of incision

Second surgeon

3

Before any incisions are made in the coronary arteries. the patient is con nected to a heart-lu ng machine. This takes over the function of the heart and lungs wh ile the surgeon repairs the heart .

Superior vena cava (tied off) .

4

A section of the vein taken from the leg is then sewn to the aorta and to a point below the blockage . If several arteries are blocked, they can be bypassed by using other sections from the same leg vein .

5

The heart-lung machine is disconnected, allowing blood to flow back into the coronary arteries

310

Deoxygenated blood to heartlung machine _

Inferior vena

Pericardium _

6

Finally, the breastbone is wired together, and pericardium and chest are sewn up.

CORONARY THROMBOSIS

35 to 64 declined by 35 percent between 1968 and 1982. Part of this decline is thought to be due to better medical treatment of elevated blood pressure, one of the causes of CHO, and part is due to improved surgical treatment of narrowed coronary arteries. Also, emergency treatment of heart attacks has improved. CAUSES

CHO is caused by reduction in the blood flow to the heart muscle and to its electrical conducting system, which initiates and coordinates the contractions (beats) of the muscle (see Heart). The coronary arteries are first narrowed and may eventually be blocked by plaques (patches) of the cholesterol-rich fatty deposit called atheroma. Further narrowing or blockage may be caused by thrombi (blood clots) formed on the roughened surface of the plaques. The causes of atheroma are numerous and interrelated (see Atherosclerosis) . In addition to some genetic predisposition and diseases such as diabetes mellitus and hypertension (elevated blood pressure), the main causes are smoking, lack of exercise, being overweight, and elevated blood cholesterol (which itself is linked in part with a diet rich in dairy and animal fats) . The importance of personality traits, behavior, and stress as causes is still disputed. Some physicians believe thatneart attacks are more frequent in people with "type A" personalities. Such individuals are always in a hurry, checking the time, impatient with delays, and interrupting colleagues in mid-sentence-but they are also doers and achievers. There is some evidence that heart attacks occur more frequently in people who are depressed after the death of a relative, loss of a job, or some other adverse life event. The medical consensus is that these psychological and behavioral factors are less important than physical factors-smoking, unhealthy diet, high blood pressure, and lack of exercise. SYMPTOMS

In its early stages, atheroma of the coronary arteries causes no symptoms. The first symptom is usually either angina pectoris or heart attack. Angina pectoris is discomfort or pain in the chest, typically brought on by exertion and relieved by rest. The pain is a dull ache in the middle of the chest or a feeling of pressure that may spread up to the neck or down the arms (on the left more often than the

right) . In some cases the pain occurs only in an arm or in the neck. The characteristic pain comes on predictably after a certain amount of exertion-after walking halfway up the stairs, for instance- and disappears after resting a minute or so. Angina occurs when the heart muscfe is working hard and getting too little blood for the amount of effort being expended. If the blood supply to part of the muscle is cut off completely by a blood clot or spasm in one of the coronary arteries, the result is an acute myocardial infarction (a coronary thrombosis or heart attack)-death of a portion of the heart muscle. The main symptom is intense chest pain of the same type as angina, but not relieved by rest and not necessarily brought on by effort; in addition the victim may become cold, sweat profusely, feel weak and nauseated, or even lose consciousness as the pumping action of the heart is weakened and shock ensues. Angina and AMI may lead to disturbances in the electrical conduction system of the heart with resulting arrhythmias (abnormalities in heart beat) ranging from ectopic beats (occasional double beats) to tachycardia (rapid beats) and ventricular fibrillation (ineffective fluttering of the heart muscle). The latter causes rapid loss of consciousness and is fatal if not treated within a few minutes. DIAGNOSIS AND INVESTIGATION

An AMI may produce such clear-cut symptoms that the diagnosis is in no doubt. Confirmatory tests may include electrocardiografhy and measurement of the !eve of serum creatine kinase enzymes released into the blood by damaged muscle. The conditions of patients who have intermittent attacks of angina are usually assessed by electrocardiography both at rest and during contro!Ied exercise. When the angina is rersistent, severe, changing in quahty, or of recent onset, the patient's condition is assessed by various heart imaging techniques. These imaging procedures, such as coronary angiography (injection of a radiopaque dye into the arteries followed by X ray), give the physician detailed, precise data on the extent of the narrowing of the coronary arteries and any damage to the heart muscle. The data aid in determining whether medical or surgical treatment is best. TREATMENT

Angina may be relieved by a range of drugs that improves the blood flow

through the coronary arteries and/or that reduces the work load on the heart during exercise. These drugs include glyceryl trinitrate and other

nitrates, beta-blockers, calcium channel blockers, and peripheral vasodilator drugs. Arrhythmias are commonly treated with beta-blockers, calcium channel blockers, and specific antiarrhythmic drugs. If the heart's pumping action is weak, it may sometimes be improved by vasodilators or digoxin. If drug treatment fails to relieve the symptoms, or if investigation shows extensive narrowing of the coronary arteries, blood flow may be improved by coronary artery bypass surgery (in which a vein graft is used to skip over the narrowed segment) or by transluminal angioplasty (in which the narrowed part of the artery is stretched apart when a balloon, passed to the site, is inflated). An AMI is usually treated initially in a hospital coronary care unit. Treatment may be given with thrombolytic drugs in an attempt to dissolve the clot, the affected coronary artery may be widened by angioplasty or may be immediately bypassed by surgery, or treatment may simply be aimed at allowing the heart to recover by a natural process of healing. OUTLOOK AND PREVENTION

CHD is a disease of middle to old age, but its foundations are laid in the teens and early adult life. The chances of developing the disease can be considerably reduced by an "anticoronary" life-style . The person who has never smoked, exercises regularly, has a normal weight and blood pressure, and eats a prudent diet is unlikely to develop symptoms of CHO until late in life. Even when symptoms develop, treatment can do a great deal to halt their progression. Studies of patients treated by coronary bypass surgery for disease affecting all the major coronary arteries reveal that 80 to 90 percent are still alive five years after the operation. Survival is even better among those with less extensive disease; they can usually be treated with drugs. Survival is substantially improved in patients who quit cigarette smoking.

Coronary thrombosis Narrowing or blockage of one of the coronary arteries (which supply blood to the heart muscle) by a tnrombus (clot). This causes a section of the heart muscle to die because it has been deprived of oxygen. 311

C

CORONER

C

Coronary thrombosis is one of the main processes involved in coronanJ heart disease, the major cause of death in the US. Sudden blockage of a coronary artery causes an acute myocardial infarction (death of a portion of heart muscle). The terms coronary thrombosis and myocardial infarction thus tend to be used interchangeably, but the latter is the more precise medical term for heart attack.

Coroner A public officer appointed to look into any death in which the cause is unknown, or when it is suspected or known to result from unnatural causes. A coroner is most often called when the deceased was not attended by a physician during the final illness. Other circumstances vary from state to state. If there are any uncertainties about the cause of death, the coroner will order a postmortem examination before issuing a death certificate. If the death is thought to be due to unnatural causes, the coroner will hold an inquest.

Corporate practice The employment of a physician by a lay-controlled corporation that sells the services of the physician for profit. Because the pnysician, as an employee, is presumed to owe greater loyalty to the corporation than to the patients, corporate practice has been opposed on ethical grounds. Physician employment by hospitals, health maintenance organizations, and similar providers is regarded as an independent contractor arrangement, the physician being free to make medical decisions independently of the corporation. Under these circumstances, no objections are raised.

Cor pulmonale Enlargement and strain of the right side of the heart due to chronic lung disease . Damage to the lungs increases resistance to blood flow from the heart through the branches of the pulmonary artery and causes pulmonary hypertension (increased pressure in the pulmonary artery). The resultant "back pressure" strain on the heart may eventually cause right-sided heart failure with edema (ffuid collection in the tissues). (See Pul111011ary hypertension.)

Corpuscle Any minute body or cell, particularly reef and white blood cells or certain types of nerve endings. 312

Corset A device worn on the trunk to treat back pain and spinal injuries or deformities. Soft corsets, usually made of cotton fabric stiffened with plastic or metal, have straps enabling them to be tightened. Most commonly prescribed for back pain, corsets work in the same way as weight-lifters' belts-by exerting increased pressure on the abdomen they take the weight of the trunk off the lower spine. They also restrict painful movements and help keep the back warm. Rigid corsets are made of plaster or lightweight plastic and must be molded to the body. They immobilize and support the spinal column when it has become unstable as the result of injury or help to correct its faulty alignment, as in scoliosis (curvature of the spine).

Corticosteroid drugs COMMON DRUGS

Beclomethasone Betamethasone Cortisone Oexamethasone Hydrocortisone Prednisolone Prednisone

r-------------, I I

I I I I

WARNING Sudden withdrawal of corticosteroid drugs may cause serious illness or death. Always inform a physician you are taking or have recently taken corticosteroids.

I I I I

L------------J HOW CORTICOSTEROIDS WORK

A group of drugs similar to the natural corticosteroid hormones produced by the cortex of the adrenal glands. WHY THEY ARE USED

Corticosteroid drugs have a wide variety of uses. They are prescribed as hormone replacement therapy to patients with an inadequate level of natural corticosteroids caused by Addison's disease or following surgical removal of the adrenal glands. Corticosteroid drugs are used in the treatment of inflammatory intestinal disorders, such as Crohn's disease and ulcerative colitis. Temporal arteritis needs urgent treatment with corticosteroids to reduce inflammation in the artery leading to the retina and so prevent blindness. Other disorders that often improve with corticosteroid treatment include asthma, rheumatoid arthritis, eczema, iritis (inflammation of the iris), and allergic rhinitis (hay fever). The injection of corticosteroids around an inflamed tendon may relieve pain in disorders such as tennis elbow. Corticosteroid drugs are also used to suppress the immune system to prevent rejection of a transplanted organ (see Transplant surgery) and in the treatment of some types of cancer, such as a lymphoma or [eukemia. POSSIBLE ADVERSE EFFECTS

The incidence and severity of any adverse effects depends on the dosage, the form in which the drug is given, and the length of treatment.

•t T"fi-l-l';'ft---- Inflamed

skin

When given as hormone replacement therapy , corticosteroids supplement or replace natural hormones. Large doses have an antiinflammatory effect as they red uce the production of prostaglandins. They also suppress the immune system by reducing the release and activity of white blood cells.

Dilated blood vessels Increase 1n wh ite blood cells Corticosteroids

~ ~1--Reduced inflammation

Blood vessels ret urn to normal

Fewer white blood cells

COSMETIC SURGERY

Adverse effects are uncommon when corticosteroids are given in the form of a cream or by inhaler because only small amounts are absorbed into the bloodstream. Corticosteroid tablets taken in high doses for long periods may cause edema (tissue swelling), /Jypertension (high blood pressure), diabetes mellitus, peptic ulcer, Cushing's syndrome, hirsutism (excessive hairiness), inhibited growth in children, and, rarely, cataract or psychosis. High doses of corticosteroid drugs also increase susceptibility to infection by impairing the body's immune system (natural defenses). Long-term treatment with corticosteroid drugs suppresses the natural production of corticosteroid hormones by the adrenal glands. Sudden withdrawal of the drugs may lead to collapse, coma, and death (see Adrenal failure).

Corticosteroid hormones A group of hormones produced by the adrenal glands that control the body's use of nutrients and the excretion of salts and water in the urine.

Corticotropin An alternative name for ACTH (adrenocorticotropic hormone).

Cortisol Another name for lzydrocortisone, an important corticosteroid hormone produced by the adrenal glands.

Cortisone A synthetic corticosteroid drug used to reduce inflammation in severe allergic, rheumatic, and connective tissue diseases. It is also used as a replacement hormone in Addison's disease, in which there is a corticosteroid hormone deficiency, and after adrenal gland removal.

Coryza See Cold, common.

Cosmetic dentistry Procedures to improve the appearance of the teeth. In many cases, these treatments are also necessary to restore or prevent further damage to the teeth and/or gums. Teeth that are out of alignment can become decayed because the bite is

incorrect and because the teeth are hard to keep clean. Such teeth can be moved into proper position by fitting a fixed orthodontic appliance (braces) that stays in place over a period of months. Correction is usually best carried out during childhood, when the teeth and jaws are still growing and developing, but can be done in adults as welf. The main use of a crown is to restore normal tooth structure and prevent further damage when a tooth is severely decayed or broken. However, crowns can also be important for appearance, particularly when a front tooth is damaged; in this case a forcelain crown is fitted because o its similarity in color to the natural teeth that surround it. Bonding is a relatively new technique with a wide range of cosmetic uses. It can be usecf to treat chipped or malformed teeth, to close small gaps between front teeth, or to cover stained or discolored teeth . In some cases it can be used instead of a crown for front teeth. Teeth that have become discolored because the pulp is dead or has been removed can be treated by bleaching.

Cosmetic surgery Hair transplant -

------~

Blepharoplasty

Transplantation of hair-bearing skin from the back or sides of the head to bald areas

Dermabrasion -

- - - --

Removal of excess skin on the eyelids

-

-

·"''

~

··

Removal of the upper skin layers to improve the appearance of skin blemishes

•' ~ ~

.::__

Face-lift - - - -- -- - - - ~ Removal of excess fac ial skin and tightening of the remainder to reduce wrinkles and jowls

Rhinoplasty

Alteration of the shape or size of the nose

Mentoplasty Alteration of the shape or size of the chin

Mammoplasty - - -- - ~- - - -- ---Breast reduction by remova l of excess tissue or breast enl argement by insertion of implants

Body-contouring operations Remova l of excess tissue and fat to alter body shape

Types of treatment The d ifferent p rocedu res va ry as to permanency and sat isfac tory results .

An operation performed primarily to improve the appearance of an individual rather than to improve function or cure disease. WHY IT IS DONE

Cosmetic surgery can improve appearance in a number of ways. Skin blemishes can be removed, and the appearance of an unsightly scar improved. The shape and size of the nose, chin, jaw, or breasts can be altered. Excess skin and fat, and any unsightly creases or marks that come with age or loss of weight, can be removed from the eyelids, face, breasts, or stomach. An individual's expectations of the benefits of cosmetic surgery are often too great, however. Cosmetic surgery will not produce a dramatic change in personafity or cure depression that a person attributes to his or her appearance. Nor can it reproduce an exact replica of someone else' s features. Some procedures (such as face-lifts and hair transplants) may need to be repeated over the years; other procedures (such as body contour surgery) may result in uneven residual fat and unattractive scarring. Anyone contemplating cosmetic surgery should discuss the operation in detail with his or her physician. 313

C

COSTALGIA

Costalgia

C

Pain around the chest due to damage to a rib or to one of the intercostal nerves (which run beneath the ribs). A broken rib produces pain and tenderness over the affected part of the rib cage. The pain is made worse by deep breathing and often persists for several weeks after the original injury. Damage to one of the intercostal nerves is most commonly a result of an attack of the virus infection herpes zoster (shingles). The pain is difficult to treat successfully and tends to persist for several months or longer.

Cough A retTex action to try to clear the airways of mucus, phlegm, a foreign body, or other irritants or blockages. Most coughs are due to irritation of the airways by dust, smoke, or mucus dripping from the back of the nose. However, in some cases a cough may be a symptom of an underlying disorder, most commonly a cold (see Cold, common), but sometimes a serious illness such as lung cancer. A cough is said to be productive when it brings up mucus or phlegm, and unproductive, or dry, when it does not. CAUSES

Among the more common causes of a cough are irritation of the upper respiratory tract-the pharynx (throat), larynx (voice box), and trachea (windpipe)-by inhaled particles, smoke, dust, or gases, or inflammation of these airways (see

Pharyngitis;

L1lryngitis;

Tracheitis),

usually as a result of a viral infection. In a child, inflammation of the upper respiratory tract can narrow the airways considerably (a condition called croup), causing a barking cough and breathing difficulty. Infection with the bacterium BORDETELLA PERTUSSIS produces a characteristic type of cougn (see Pertussis). Bronchitis (inflammation of the bronchi, the air passages into the lungs) produces thick mucus and phlegm and causes severe coughing. The disorder may be brought on by an infection, but is often the result of smoking (see Cough, smokers'). In bronchiectasis (distortion or dilatation of the bronchi), a large amount of infected phlegm collects in the bronchi, making the sufferer cough persistently in an attempt to bring up the phlegm, which may be associated with bleeding. Bronclwspasm (temporary narrowing of the bronchi) causes a dry cough that 314

is usually worse at night. It is a feature of asthma, but also may be due to infection or allergic reaction. The damage to lung tissues caused by pneumonia (inflammation of the lungs due to infection) results in painful coughing that brings up bloodflecked phlegm. Damage to the lungs brought about by pulmonary edema (accumulation of fluid in the lungs) produces a cough that is dry at first, but which later may bring up frothy, blood-stained phlegm. The cough associated with viral bronchitis and viral pneumonia is often dry and persistent, and may interrupt sleep. Various chronic lung infections, notably tuberculosis and fungal infections (such as histoplasmosis), may cause a cough. Many pneumoconioses (dust diseases of the lungs) also cause a cough, which is usually accompanied by shortness of breath. An inhaled foreign object, such as a peanut, that lodges in the larynx causes violent coughing to relieve choking. If the object travels further down and blocks a bronchus, inflammation and mucus will be produced at the site of obstruction, leading to a persistent cough. Lung cancer and, less commonly, other tumors of the air passages usually first cause a mild cough, then a more severe one that may produce blood-stained phlegm. Sometimes, especially in children, coughing develops as a nervous reaction to stress. SELF-HELP

In some cases, a dry cough may be relieved by sucking on throat lozenges or by drinking warm, soothing drinks, such as honey and water. If ineffective, narcotic cough remedies afford symptomatic relief, particularly at bedtime to permit sleep. Productive coughing is the body's way of unblocking airways obstructed by mucus or phlegm and, in such cases, cough suppressants should be avoided since they can do more harm than good. An expectorant cough medication or drinking lots of fluids can help loosen mucus or phlegm if there is difficulty coughing it up. A physician should be consulted if any cough persists for more than two or three days, is severe, or is accompanied by symptoms such as chest pain, green phlegm, coughed-up blood, or breathing difficulty. TREATMENT

Treatment depends on the underlying disorder. For exam pie, antibiotics may be given for a bacterial infection,

a bronchodilator and/or corticosteroid drugs for asthma, breathing exercises and postural drainage (lying in a position that allows mucus to drain from the bronchi) for bronchiectasis and chronic bronchitis, and surgery or radiation therapy for cancer.

Coughing up blood Known medically as hemoptysis, coughing up blood is due to rupturing of a blood vessel in the airways, lungs, nose, or throat. The underlying cause can range from persistent coughing to a serious disorder, such as cancer. Coughed-up blood may be in the form of bright-red or rusty-brown streaks or clots in or on the phlegm, a pinkish froth, or, more rarely, pure blood. The form it takes depends as much on the size of the ruptured blood vessel as on the underlying cause. Because of the possibility of a serious underlying disorder, all cases of coughing up blood require medical assessment. Coughing up blood should not be confused with blood in the mouth, which is usually due to a nosebleed or to bleeding gums. CAUSES

The most common cause of coughing up blood is an infection-such as pneumonia, bronchitis, or tuberculosis- in which inflammation of the bronchi (airways into the lungs) and alveoli (air sacs) damages the wall of a blood vessel. Similarfy, in bronchiectasis the bronchi become enlarged and distorted, which can lead to rupture of a blood vessel and coughing up blood. Any disorder that causes persistent coughing, such as tracheitis (inflammation of the windpipe), can produce hemoptysis as a result of the coughing putting strain on the blood vessels in the airways. Another cause of coughing up blood is congestion in, and subsequent rupture of, blood vessels within the fungs. Congestion can be due to heart failure, mitral stenosis (narrowing of the mitral valve in the heart), or pulmonary embolism (blood clot lodged in an artery in the lungs). A malignant tumor can lead to coughing up blood by eroding the wall of a blood vessel in the larynx (voice box), bronchi, or alveoli. Any bleeding disorder (such as hemophilia) can also cause hemoptysis. INVESTIGATION AND TREATMENT

A chest X ra1/ may be carried out. Anyone who· smokes, who is older than 40, whose chest X rays are abnormal, or who has coughed up blood more than once may need bronchos-

COUGHING UP BLOOD

COUGH

A noisy expulsion of air from the lungs that may produce sputum (phlegm) or be '·dry."

Is the cough dry, producing no sputum?

• •• •• •• •• ••• •• ••• •• •• •• •

YES

l

[ Are you hoarse or have you lost yo: voice?



t

YES

See • Hoarseness • Voice, loss of

YES

Coughing is a normal reaction to expel a foreign body from the lungs. If coughing fails to clear your lungs or is continuous for more than one hour, consult your physician .

NO

NO

Might you have inhaled a small particle of food, such as a peanut?



NO

See • Foreign body

■ ■ Might you have inhaled the fumes of an irritant (such as a cleaning fluid that contains ammonia)'?

YES

The fumes have probably irritated your lungs and caused the coughing. If the condition does not improve within one hour, consult your physician .



NO

Have you had a dry cough with no other symptoms for more than a month?



■ ■ ■ ■ ■ ■ ■ ■ ■ ■ ■ ■ ■ ■ NO

YES

~

Consult your physician without delay! Your coughing is probably caused by inflammation, but it may also be a symptom of a tumor . See • Lung. cancer of



Are you short of breath, even though you have not been exercising?

YES

See • Breathing difficulty

YES

Persistent inflammation of the airways to the lungs may be the cause of a cough that brings up sputum, especially if you smoke and have had similar periods of persistent coughing in past winters. Consult your physician.



NO



Do you cough up thick, gray or green-yellow sputum most days?

• •

NO

..----- /~\ ------, CANCER WATCH A persistent cough that starts to get worse may indicate lung cancer, especially if you smoke. Consult your physician without delay!

■ ■ ■

■ ■ ■

See • Bronchitis

Continued on next page

315

COUGH REMEDIES

Have you had your cough for several weeks or months AND has it been getting more severe?

YES :::::::::::::::::::::::::::::::::::::::::::::: Consult your physician without delay! Asthma or chronic bronchitis may be the cause of your symptoms. but the possibility of tuberculosis or lung cancer also exists.

See •Asthma • Bronchitis • Lung, cancer of • Tuberculosis



NO

• ■ ■

Of recent origin - within the past week.

Is your temperature

YES ......J.

Are you breathless? ;J YES !~--------~■--]~

100°F (38°C}



or above?

NO

. .....•

• •

••

NO

See • Pneumonia



■ ■ ■

• ■ ■ ■

Do you have a runny nose AND/ OR a sore throat?

Call your physician without delay! These symptoms suggest that you may have pneumonia.

You may have acute bronchitis or a viral infection. Treat the fever. If there is no improvement in 24 to 48 hours. consult your physician. See• Fever

YES ::::=:::=====:::::::::::::::::::::::::::::::

You probably have a cold. Take analgesics and gargle with salt water. See • Cold, common



NO

If you are unable to make a diagnosis from this chart, consult your physician.

copy, a diagnostic procedure in which a flexible viewing tube is passed into the lungs. In about one third of cases, no underlying cause is found . Treatment depends on the cause, but may include antibiotic drugs, anticoagulant drugs, and diuretic drugs .

Cough remedies COMMON DRUGS Expectorants Ammonium chloride

Cough suppressants Antihistamines Codeine Dextromethorphan

316

A bewildering variety of over-thecounter medications is available for treating a cough . Most cough remedies consist of a syrupy base to which various active ingredients and flavorings are added. Two main groups of drugs are used: expectorants, intended for coughs that are producing sputum (phlegm), and cough suppressants, intended for dry coughs. It is important to select the correct type of medication-a cough suppressant taken for a sputum-producing cough may interfere with the coughing up of sputum and may delay recovery.

HOW THEY WORK

Expectorants "loosen" a cough by stimulating the production of watery secretions in the lungs. Some expectorants also have a mucolytic action (a direct effect on the sputum that makes it less sticky) . Cough suppressants act on the part of the brain that controls the coughing reflex. Drugs with this effect include some antihistamine drugs and the narcotic analgesic drug codeine. POSSIBLE ADVERSE EFFECTS

All cough suppressants have a sedating effect and may cause drowsiness. Using cough remedies to alleviate the

CRAMP

symptoms of a persistent cough may delay diagnosis of a serious disorder.

Cough, smokers' A recurrent cough that is very common among smokers, particularly heavy smokers and those who have smoked for a long time. In many instances, the sufferer becomes accustomed to his or her cough and regards it as normal. Usually, coughing is triggered by the accumulation of large amounts of abnormally thick sputum (phlegm) in the airways (a feature of bronchitis), which is caused by inflammation of the airways due to smoking. TREATMENT

Stopping smoking usually stops the persistent cough, though it does not happen immediately. The longer the person has been smoking, the longer the cough will persist after quitting. Because of fue health hazards of smoking, it is essential for the smoker to consult his or her physician about a cough, particularly if there is any change in its frequency or character. (See also Tobacco smoking.)

Counseling Advice and psychological sufport given by a health professiona and usually aimed at helping a person cope with a particular problem (for example, bereavement or cancer treatment). A more general exploration of a person's feelings and attitudes, not aimed at one particular problem, is sometimes included in the definition. WHY IT IS DONE

Counseling can help people with problems at school, work, or within the family; provide advice on family planning, abortion, and sexual and marital problems; help people deal with drinking and drug problems; and provide support during life crises. Counseling methods may be used by caseworkers as a means of historytaking and information gathering. Physicians, too, may use a counseling style when interviewing a patient whose medical problem is complicated by personal circumstances, or when the objectives of the consultation are not clear. HOW IT IS DONE

Some counseling, especially for genetic disorders (see Genetic counseling) or the treatment of cancer, consists mainly of providing personalized information in a setting in which the patient, or client, is encouraged to ask questions and to express any doubts and uncertainties.

The techniques that are used in psychotherapeutic counseling are essentially similar. The counselor encourages the individual to make statements about his or her feelings, experiences, and problems. These statements can then be discussed and explored for inconsistencies as a means of helping the individual develop a greater and more realistic understanding of his or her problems. Usually, counseling is a one-to-one activity. However, in some situations, such as sex therapy, representatives of a particular point of view or gender model may be incorporated (for example, one male and one female counselor). This is termed co-counseling. Counseling may also occur in small groups. (See also Child Rllidance; Family therapy; Marital co11nseli11g.)

relieve pain, stiffness, and limping, osteotomy is required . The neck of the bone is cut and the two ends are repositioned and secured at the correct angle. This usually eases the condition so that the patient can walk with only minor discomfort.

Crab lice See Pubic lice.

Cradle cap A condition common in babies in which thick, yellow scales occur in patches over the scalp. Cradle cap is harmless, although it tends to recur. Cradle cap is a form of seborrheic dermatitis, which may also occur on the face, neck, behind the ears, and in the diaper area . The skin in these areas may look red and inflamed.

Cowpox An infection caused by the vaccinia virus, which usually affects cows. An attack of cowpox used to confer immunity against smallpox (now presumed to be extinct) because the viruses responsible for the two diseases were very similar. This fact was the basis of smallpox vaccination. Vaccinia virus, which gave its name to "vaccination," continued to be used as smallpox vaccine until smallpox was considered to have been eradicated in the 1970s.

Coxa vara A deformity of the hip in which the angle between the neck and head (ba11) of the femur and the shaft of the femur (thigh bone) is reduced, causing shortening of the leg and a limp. CAUSES ANO INCIDENCE

The most common cause is injuryeither a fracture of the neck of the thigh bone or, in adolescence, injury to the developing part of the head of the bone. The deformity can also occur if the bone tissue in the neck of the bone is soft instead of firm, so that it bends under the weight of the body. This softening may be congenital or the result of a bone disorder such as rickets or Pagct's disease . SYMPTOMS ANO DIAGNOSIS

The symptoms are pain and stiffness in the hip and increased difficulty in walking. The disorder is diagnosed by X rays, which reveal the deformity.

Appearance of cradle cap Most prevalent between 3 and 9 months of age, it is not clear why cradl e cap occurs. but it is not a result of poor hygiene . TREATMENT

Rub warm olive or mineral oil into the baby's scalp and leave on overnight. This loosens and softens the scales, which can be gently washed off the next day with a mild, antidandruff shampoo. This procedure may need repeating for a few days until all scales have been loosened. The baby's hair should be brushed daily using a softbristled brush . This will also help loosen the scales so they can be removed with a fine-tooth comb. If the condition seems to be worsening or if the skin looks inflamed, a physician should be consulted. A mild corticosteroid cream may be prescribed until the condition improves.

TREATMENT ANO OUTLOOK

Cramp

When coxa vara is due to an underlying bone disorder, it can be treated to bring about hardening of the bone tissue; however, little can be done about bone that is soft from birth. To

Painful spasm in a muscle caused by excessive and prolonged contraction of the muscle fibers. Cramps are a common occurrence and usually last only a few moments. 317

C

CRAMP, WRITERS' CAUSES

C

Cramps often occur during or immediately after exercise because of a buildup of lactic acid and other chemicals in the muscles (caused by increased muscular activity) and small areas of muscle fiber damage. Cramps can also occur during any repetitive movement such as writing (see Cramp, writers'), or through sitting or lying in an awkward position. Any condition that causes profuse sweating, such as a fever, heat wave, or prolonged exercise, can lead to cramps in resting muscles; the loss of sodium salts in the sweat disrupts muscle cell activity. Cramps at night may be due to poor circulation of blood into the legs (see Peripheral vascular disease), but often there is no known cause. TREATMENT

The pain can be helped by massaging or stretching the muscles involved. If cramps occur regularly at night your

physician may prescribe a drug containing calcium or quinine, which can help prevent painful recurrences. If cramps persist for longer than an hour they are likely to be due to a more serious medical condition and the attention of a physician should be sought immediately.

Cramp, writers' Painful spasm in the muscles of the hand, making it impossible to write. In most cases the muscles in the hand are still able to perform other tasks, indicating that the problem may be psychological in origin. Contrary to this theory, however, writers' cramp fails to respond to psychotherapy. The use of muscle relaxants and other drugs has also met with little success in tackling the problem. The condition sometimes improves if the hand is rested for months, but often it is permanent. Occasionally the other hand becomes affected.

Cranial nerves Twelve pairs of nerves that emerge directly from the brain-as opposed to the spinal nerves, which connect with the spinal cord. All but two of the cranial nerve pairs connect with nuclei in the brain stem (the lowest section of the brain). The other two (the olfactory and optic nerves) link directly with parts of the cerebrum (the main mass of the brain). All the nerves emerge through various openings in the cranium (skull); many then soon divide into several major branches.

Craniopharyngioma A tumor of the pituitary gland. The condition is very rare. There are about one or two cases per million population in the US each year. Symptoms include headaches, vomiting, defective vision, stunted growth, and failure of sexual development. If untreated, the tumor may result in permanent brain damage.

FUNCTIONS OF CRANIAL NERVES Some cranial nerves are principally concerned with delivering sensory information from organs, such as the ears , nose, and eyes, to the brain. Others carry messages that move the tongue, eyes. and facia l (and other) muscles, or stimulate glands 1 Olfactory nerve Smell

such as the salivary glands. A few have both sensory and motor functions . One of the nerves- the tenth cranial, or vagus nerve-is one of the most important components of the parasympathetic nervous system , concerned with maintaining the rhythmic

automatic function of the internal body machinery. It has branches to all the main digestive organs, the heart, and the lungs.

,-----------lfJ:[J

2 Optic nerve Vision

3,4,6 Oculomotor, trochlear, and abducent nerves Eye movements

8 Acoustic (vestibulocochlear) nerve Hearing and balance

9 Glossopharyngeal nerve Taste and throat sensations

-

.. ·· ,•

· · -•

.

.•/ ,-,.

'

-.

1' ~- ·, \

'. ij .

'

·_,, ·-: . . ,·' ,, ., ..._. _.··

.. - ·

10 Vagus nerve Breathing. circul ation , and digestion

,

5 Trlgeminal nerve Facial sensation and Jaw movements

11 Spinal accessory nerve Move ments of neck and bac k muscles

7 Facial nerve Facial expressions and taste

12 Hypoglossal nerve Tongue movements

318

CREUTZFELDT-JAKOB SYNDROME

Craniopharyngiomas are identified by imaging techniques for the brain (see Brain imaging) and are usually removed surgically.

Craniosynostosis The early closure of one or more of the joints between the bones of the cranium (see Skull). Craniosynostosis may occur in a baby affected by a bone disease, such as rickets, in a baby with multiple birth defects, or in an otherwise health,Y baby. It may also occur if the baby s brain is abnormally small. DIAGNOSIS AND TREATMENT

The physician's diagnosis is made from the outward appearance of the skull and by skull X ray. Treatment must be undertaken during the first few months of life to prevent brain damage. An operation is performed to separate the skull bones by cutting away the fused edges and separating the bony plates.

Craniotomy Removal of part of the skull to carry out an operation on the brain, such as performance of a biopsy, removal of a tumor, or aspiration and drainage of an abscess or blood clot. After the operation the bone is replaced and the membranes, muscle, and skin are sewn back into position. Following successful surgery, the patient can usually leave the hospital within a week. He or she will generally experience mild headaches for a time, but little real pain.

Cranium The part of the skull around the brain.

Cream

the risk of an explosion. Also, cremation involves additional formalities, principally to prevent destruction of a body before tne possibility of a crime has been ruled out.

Crepitus The grating sound heard, and the sensation felt, when two rough surfaces rub together. It may be experienced when the ends of a broken bone rub against each other or in osteoarthritis, when the cartilage that covers the bony surfaces of a Joint has worn away and the roughened areas of the joint grind against each other. The sound is usually loud enough to be heard by the naked ear. Fainter sounds, audible through a stethoscope, are produced when lung alveoli rub together-as a result of inflammation due to pneumonia, for example. Crepitus is also used to describe the sound s made when an area of subcutaneous emphysema (air under the skin) or gas gangrene (gas within infected tissues) is pressed.

Cretinism A condition characterized by mental retardation, stunted growth, and coarse facial features. It results from decreased production of the hormone thyroxine by the thyroid gland. (See also Hypothyroidism.)

Creutzfeldt-Jakob syndrome A very rare degenerative condition of the brain presumably caused by a slow virus (one that causes no signs of disease until many months or years after the original infection). In most instances, no source of infection is discovered. However, rarely, infection has been linked with brain surgery when instruments contaminated by the virus have been used, transplantation of an infected cornea, and treatment with growth hormone extracted from pituitary glands after death (current growth hormone preparations are products of genetic engineering and carry no risk). The condition causes progressive dementia and myoclonus (sudden

PROCEDURE FOR CRANIOTOMY

Burr holes A series of burr holes is made. They must be very close together if the bone is thick.

Before the operation , all or part of the patient's scalp is shaved. After a general anesthetic has been given, layers of skin , muscle, and membrane are cut away from the skull at the planned operation site and the bone between them is cut with a saw. The lid of bone is then either lifted back on a hinge of muscle or removed completely. The dura (the outer membrane lining the brain) is then opened to reveal the inner membranes and the brain.

A thick, semisolid preparation used to apply medications to the skin for tnerapeutic or prophylactic (preventive) purposes. Creams are useful in the treatment of dry skin conditions because their high water content gives them a moisturizing effect.

Creatinine clearance See Kidney function tests.

Cremation Burning dead bodies to ash. Typically, the process takes between one and two hours and results in 5 to 7 pounds (2.3 to 3.2 kg) of ash . In some cases certain precautions must be taken before cremation can be performed. For example, if the deceased person was fitted with a pacemaker, it must be removed from the body because of

Skin hinged back

Burr hole

Gigli 's saw

Flap of skull hinged back

Gigli's saw The cuts between the burr holes are made using Gigli's saw, wh ich is passed between the burr holes using a malleable saw guide.

319

C

CRIB DEATH

C

muscular contractions) . Muscular coordination diminishes, the intellect and personality deteriorate, and blindness may develop. As the disease progresses, the power of speech is lost and the body becomes rigid. There is no treatment and death usually occurs within three to 12 months of onset.

Crohn's disease may cause pain, fever, diarrhea, and loss of weight. The most common site of inflammation is the terminal ileum (the end of the small intestine where it joins the large intestine) . The intestinal wall becomes extremely thick due to continued chronic inflammation, and deep, penetrating ulcers may form. The disease tends to be patchy; areas of the intestine that lie between diseased areas may appear to be normal, but are usually mildly affected.

Abscesses (pus-filled pockets of infection) form in about 20 percent of patients. Many of these abscesses occur around the anus, but some occur within the abdomen. Complications in other parts of the body may include inflammation of various parts of the eye, severe arthritis affecting various joints of the body, ankylosing spondylitis (an inflammation of the spine), and skin disorders (including eczema).

Cri du chat syndrome

CAUSES AND INCIDENCE

A congenital (present at birth) condition characterized by a catlike cry due to a small larynx. Mental handicap, unusual facial characteristics (such as a wide spacing between the eyes), a small head, and shortness of stature are other typical features. Cri du chat syndrome is rare and the result of a chromosomal abnormality; a portion of one chromosome is missing in each of the affected individual's cells. No treatment is possible. The child needs special care and schooling if he or she survives infancy. (See also Genetic cou11sc/i11g.)

The cause is unknown. It may represent an abnormal allergic reaction or may be an exaggerated response to an infectious agent, such as a bacterium or a virus. There is a slight genetic predisposition (inherited tendency to develop the disease). The incidence of Crohn's disease varies between three and six new cases per year per 100,000 population in most developed countries, including the US; the incidence seems to have increased over the last 30 vears. A person may be affected at any age, but the peak ages are in adolescence and early adulthood and after 60.

Crisis

SYMPTOMS

A term that describes a turning point in the course of a disease (marking the onset of either recovery or deterioration), an emergency, or a distressing time of emotional difficulty (such as divorce or a death in the family) . The term was in common use before the advent of antibiotics when patients with lobar p11e11111011ia would be watched for the crisis.

In young people the ileum (small intestine) is usually involved, and the disease causes spasms of pain in the abdomen, diarrhea, and chronic sickness due to loss of appetite, anemia, and weight loss. The ability of the small intestine to absorb food is reduced. In the elderly, it is more common for the disease to affect the rectum and cause rectal bleeding. In both groups the disease may also affect the anus, causing chronic abscesses, deep fissures (cracks), and fistulas (passageways that create an abnormal link between organs of the body). Crohn's disease can also affect the colon (large intestine), causing bloody diarrhea. It is rare in the mouth, esophagus, stomach, and duodenum (upper part of the small intestine). Complications may affect the intestines or may develop elsewhere in the body. The thickening of the intestinal wall may narrow the inside diameter so much that an intestinal obstruction occurs. About 30 percent of patients with Crohn's disease develop a fistula. Internal fistulas may form between loops of intestine. External fistulas to the skin of the abdomen or the skin surrounding the anus may follow a surgical operation (or rupture of an abscess) and may cause leakage of feces onto the skin.

If the symptoms suggest Crohn's disease, a physical examination may reveal tender abdominal swellings that indicate thickening of the intestinal walls. Sigmoidoscopy (examination of the rectum with a viewing tube) may confirm the disease's presence in the rectum. X rays using barium meals or barium enemas (see Barium X-ray examinations) will show thickened loops of bowel with deep fissures. It may be difficult to differentiate between Crohn's disease that affects the colon and ulcerati-ue colitis, a form of inflammatory disease that is limited to the large intestine, but colonoscopy (examination of the colon using a flexible viewing tube) and biopsy (removal of a piece of tissue for microscopic examination) may help in doubtful cases. Blood tests may show evidence of protein deficiency or anemia .

Crib death See Sudden infant death syndrome.

Crisis intervention The provision of immediate advice or help to people with acute personal or sociomedical problems. Many voluntary organizations have been established to help people in crisis. Help may also be available at walk-in centers or social services departments. In addition to other crisis services, these centers may offer counseling, usually with the aim of helping clients cope with crises rather than of providing longer-term help.

Critical A term used to mean seriously ill, or to describe a crucial state of illness from which it is uncertain whether or not the patient will recover.

Crohn's disease A chronic inflammatory disease that can affect any part of the gastrointestinal tract from the mouth to the anus.

320

DIAGNOSIS

TREATMENT

Sulfasalazine may be given by mouth to try to control the inflammatory process and corticosteroid drugs may be given by mouth or as enemas. Severe acute attacks may require admission to the hospital for blood transfusion, intravenous feeding, and treatment with corticosteroid drugs given intravenously. The severity of the disease fluctuates widely, and the patient is usually under long-term medical supervision. Some patients find that particular foods exacerbate their symptoms. Others may benefit from a highvitamin, low-fiber diet. A surgical operation to remove damaged portions of the intestine may be needed to treat chronic obstruction or blood loss. If the small intestine is involved, the surgeon will remove as little of the intestine as possible, seeking only to remove the most affected parts since the surgery is not curative. If the large intestine is involved, surgery may involve removal of narrowed obstructing segments. Emergency surgery may be required to deal with an abscess. Simple drainage of an abscess will pro-

CRUCIA TE LIGAMENTS

duce an external fistula, but occasionally the patient is too ill for any further treatment. Surgery may also occasionally be required for obstruction, perforation, or severe bleeding. OUTLOOK

The disease is chronic and the symptoms fluctuate over many years, "burning out" in time for some patients. Many patients eventually require surgical treatment to deal with the complications of the disease. The recurrence rate after surgery is high, although recurrences may be delayed for many years. Some patients with localized disease remain in normal health indefinitely after surgery and seem to be cured. There is no predisposition to intestinal cancer.

pathomimetic bronchodilator drug first. Hoarseness and throat irritation can be avoided by rinsing the mouth with water after inhalation.

Crossbite A type of malocclusion in which the lower teeth overlap the upper teeth. In a normal bite, just the reverse is true.

Cross-eye A type of strabismus (squint) in which one eye turns inward relative to the other eye.

Cromolyn sodium ALLERGY

Capsule Inhaler Eye drops Nose drops fjj Prescription needed

!!fl

Not available as generic

A drug used in the treatment of some types of asthma and allergic conditions such as allergic rhinitis (hay fever), allergic conjunctivitis, and food allergy. Cromolyn sodium was introduced in the 1970s. WHY IT IS USED

Cromolyn sodium is commonly given by inhaler to prevent attacks of mild to moderate asthma in children. It is also prescribed for allergic asthma in adults and for asthma induced by exercise or cold air. Cromolyn sodium has a slow onset of action, taking up to four to six weeks of regular dosing to produce its antiasthmatic effect. Its use sometimes permits a reduction in the dosage of other drugs taken to relieve attacks. It is not effective for the relief of an acute asthmatic attack in progress. Taken as a nasal spray, cromolyn sodium is useful in treating allergic rhinitis. In the form of eye drops, it treats allergic conjunctivitis, and as capsules it can help in some types of food allergy.

Appearance of cross-eye

Most types of cross-eye can, and should, be corrected to improve appearance and vision.

Cross matching A procedure used to determine compatibility between the blood of someone requiring a blood transfusion and that of a blood donor. Red blood cells from the donor are mixed with serum from the recipient, and red blood cells from the recipient are mixed with serum from the donor. After a short time, the mixtures are examined on a glass slide under a microscope. Clumping together of the red cells to form a small clot indicates the presence of antibodies in the serum, showing that the blood is not compatible. If no clotting occurs, the donor's blood may be safely transfused to the recipient.

Croup

Cromolyn sodium works by blocking the release of histamine (a chemical released into the body when an allergic reaction occurs).

Inflammation and narrowing of the air passages in young children, causing a barking cough, hoarseness, and stridor (a wheezing or grunting noise on breathing in). The condition is very common in children up to the age of about 4 years. In older children and adults, the air passages are too wide and the cartilage in the wall too stiff for any swelling or inflammation to cause the walls to collapse.

POSSIBLE ADVERSE EFFECTS

CAUSES

Side effects are generally mild and rarely require the drug to be stopped. Coughing and wheezing on innalation may be prevented by using a sym-

Croup is brought on by a viral infection, often a cold, affecting the larynx (voice box), trachea (windpipe), and bronchi (airways into the lung).

HOW IT WORKS

Several different types of virus can infect this part of the respiratory system, so one bout of croup does not confer immunity from subsequent attacks; some children are prone to recurrent bouts. Croup tends to occur in outbreaks in late faII and winter. TREATMENT

Most cases are mild and pass quickly. A parent should remain calm and comfort the child; once soothed, the child will be able to breathe more easily. Providing cool mist for the child to inhale may also help (by utilizing a room humidifier or sitting in the bathroom with the shower running, for example). Cool night air has a beneficial effect as well . If a child is struggling to breathe or turns blue, medical help should be obtained immediately. The child should be taken to the hospital and there given humidified oxygen in a tent. When breathing is seriously obstructed, treatment involves either passing a tube down the throat or an operation called a trachcostomy in which a tube is passed into the throat through the neck to bypass the obstruction. In either case, the tube can usually be removed within 24 hours. Complete recovery takes place within a few days.

Crowding, dental A type of malocclusion that occurs when there is insufficient space along the jawbones to accommodate all the teeth in correct alignment.

Crown, dental An artificial replacement for the crown of a tooth (the part above the gum) that has become decayed, discolored, or broken. A porcelain crown is usually used on front teeth because of its similarity in color to natural teeth, but back teeth require the greater strength of a crown made from gold or from porcelain fused to metal. (See illustration, next page.)

Cruciate ligaments Two ligaments in the knee that pass over each other to form a cross (hence their name, from the Latin word "crux," meaning cross). The ligaments form connections between the femur (thigh bone) and tibia (shin) inside the knee joint. The role of the cruciate ligaments is to prevent overbending and overstraightening at the knee joint. Consequently, if these ligaments are torn, the knee joint becomes unstable and may cause pain. 321

C

CRUSH SYNDROME

HOW CROWNS ARE FITTED The tooth is filed to form a peg over which the replacement is fitted. An impression of the peg and natural

POST CROWNS

tooth is taken and a replica made. Using this as a model, the crown is constructed.

If the natural tooth is heavily decayed or has been weakened, a post crown is fitted .

C

Tooth root

1

This tooth is so decayed that a retaining Damaged peg cannot be fashioned . tooth

Cast full crown

Porcelain jacket c rown

Porcelain fused to metal crown

Three-quarter crown

2

The natural crown of the tooth is com~ - - ~ pletely removed .

Tooth trimmed Gold

1

A cracked, heavily filled , or broken tooth can be replaced by a crown.

2

The remaining part of

the tooth is shaped to receive the crown.

fl The crovv'i7, a hollovw V shell, is fitted over the

Crying in infants

Damage to a large amount of body muscle-most commonly as a result of a serious auto accident-causing renal failure. Protein pigments released into the bloodstream from the damaged muscles temporarily impair the functioning of the kidney. As a result, some substances normally excreted in the urine build up to toxic levels in the blood. Without treatment the kidney failure may be fatal. Today, treatment by dialysis gives the kidneys a chance to recover their function.

Occasional crying in a baby is normal behavior- it is the baby's only means of communicating a need. Only when crying is inconsolable or unusual in any way should it be regarded as signifying a problem.

Crutch palsy

322

CAUSES

Crying in infants is usually a response to needs or discomforts, such as hunger, thirst, a wet or soiled diaper, tiredness, interrupted sleep, a desire to be comforted, feeling hot or cold, boredom, or separation from parents. Most healthy babies stop crying when their needs are attended to. Persistent crying, when it is not due to a continually ignored or unrecognized need, may be a baby's reaction to the overwrought state of a parent who is angry, resentful, or overtired. In a minority of cases, crying may be due to illness, commonly ear or throat infections, or to viral fevers. Persistent crying may indicate maltreatment (see Child abuse). TREATMENT

A crying baby should always be attended to. The idea that attending to a crying infant is "giving in" is wrong. Persistent lack of attention is believed to have an adverse effect on emotional development in later life. If a baby continues to cry after a feeding and a change of diaper, parents should make sure that their child is not too hot or cold, and should try to comfort the baby. A baby sling can be used to provide continuous

;:~tin canal

shaped tooth and cemented in place .

Crush syndrome

Weakness or paralysis of muscles in the wrist, fingers, and thumb from a crutch pressed tightly under the arm, caused by pressure on the nerves that supply these muscles. The disorder occurs only after prolonged walking with a crutch that is too tall for the individual. A crutch should fit comfortably under the arm when standing upright, with the hand taking much of the weight. Crutch palsy can also occur after falling asleep with one arm over the back of a chair with the top of the chair pressed into the armpit. Usually, the person has fallen asleep after a bout of drinking, giving the disorder its common name, Saturday night palsy. Symptoms usually improve without treatment since the damage to the nerves is temporary. In rare cases, exercises are needed to strengthen the wrist and fingers .

,-- .

Crown

3

A post is cemented

into the rcct co.no!

and the crown is cemented over the post.

physical contact. The baby may also prefer being propped up in a chair rather than Tying flat, so that he or she can look around. Parents should try to get as much sleep as possible, and mothers especially should put aside at least one period during the day for relaxation . If the baby cries at night, parents should take turns attending to him or her. Medical advice is usually necessary only if a baby cries persistently despite all attempts to soothe him or her, if a normally quiet baby starts to cry a lot, if a baby also has diarrhea, vomiting, fever, or seems sick, or if a baby cries only weakly or not at all. Parents should not attribute persistent crying to teething or colic without consulting a physician.

CryoA prefix meaning cold. It is often used to indicate that a procedure uses freezing or low temperatures.

Cryopreservation The preservation of living cells by freezing . The technique is used chiefly to store human eggs, sperm, and blood for later use. WHY IT IS DONE

In a woman who is infertile because of blocked fallopian tubes, eggs can be removed from her ovaries, frozen, and stored until they can be used for in vitro fertilization. Treatment of cancer by radiation therapy or chemotherapy carries the

CT SCANNING

slight risk of damaging sperm. lf the man wants to retain the option of future fatherhood, a sample of his sperm is collected before treatment and frozen for possible later use in artificial insemination. Sperm from donors can also be frozen and used in this way to enable a woman whose husband is infertile to bear a child. Plasma and blood from rare blood groups can be preserved by freezing and stored in a blood bank for long periods until needed. HOW IT IS DONE

The cells to be preserved are first immersed in a fluid, usually glycerol. Glycerol enters and surrounds the cells so that they are protected from the normally destructive effect of freezing (see Cryosurgery). The temperature is lowered as the concentration of protecting fluid is increased until the final storage temperature of about -290°F (-180°C) is reached. OUTLOOK

Apart from widespread cryopreservation of cells, there has also been some success with freezing and reusing small areas of tissue, such as the cornea and portions of skin. This has led to much experimental work on the possibility (as yet unfulfilled) of cryopreservation of major organs, such as the heart, liver, and kidneys, taken from people who have recently died, for the purposes of transplantation. This would enable transpfants to be carried out on a normal surgical time scale rather than as a race against time, as at present.

Cryosurgery The use of temperatures below freezing to destroy tissue. The term is also applied to the use of cold during surgery to produce adhesion between an instrument and body tissue. Cryosurgery has been in common use only for the past decade; in many cases it is proving to be a useful alternative to more traditional surgery or radiation therapy. WHY IT IS DONE

Because cryosurgery causes only minimal scarring, it is particularly valuable for dealing with malignant tumors in the cervix and in major organs, such as the liver or bowel, in which heavy scarring can block vital openings or channels. For cosmetic reasons, it is also the best technique for removing skin cancers, such as basal cell carcinoma, and skin disfigurements, such as birthmarks. Hemorrhoids and other anal lesions can be treated rapidly and effectively.

Cryosurgery is also a good method for handling tiny structures in the eye; it has proved particularly useful in performing cataract surgery and for treating retinal detacltment. HOW IT IS DONE

Treatment of an internal tumor with cryosurgery is a major operation requiring a general anesthetic. The growth is destroyed in one of two ways-by applying a metal probe cooled to the temperature of liquid nitrogen, about -256°F (-160°C), or by spraying it with liquid nitrogen. Skin cancers, disfigurements, and hemorrhoids are usually treated in the outpatient department, using a metal probe cooled to the same temperature as above. The procedure is virtually painless, since the extreme cold paralyzes the nerves in the skin as a local anesthetic does. After treatment, a blister develops, which may weep for a few days before healing. Although there is little scarring, the treated area may show up as a patch of paler skin.

Cryptococcosis A rare infection caused by inhaling the fungus CRYPTOCOCCUS NEOFORMANS. It is found throughout the world, especially in soil contaminated with pigeon droppings . Infection with the fungus may cause meningitis (inflammation of the coverings ot the brain) or granular growths in the lungs, skin, or elsewhere. Most but not all cases occur in people whose resistance to infection has been drastically lowered by diseases such as AIDS and Hodgkin's disease or by immunosuppres-

sant drugs. SYMPTOMS

Meningitis is the most usual, and serious, form that the illness takes. Symptoms include headache, stiffness in the neck, fever, drowsiness, blurred vision, and a staggering gait. If the infection is not treated, it may end in coma and death. When the disease attacks the lungs it causes chest pain and a cough, sometimes with sputum (phlegm); there may also be a skin rash of ulcerating spots. DIAGNOSIS AND TREATMENT

Cryptococcal meningitis is diagnosed from a sample of fluid drawn from the spine. An X ray may be needed to detect any damage to the lungs, and laboratory examination of the sputum, lun 5 !:iopsy, and bronchoscopy may be needed. Most cases in which only the lungs have been infected need no treatment, clearing up of their own accord. When

the meninges have been affected, a combination of the antifungal drugs amphotericin B and flucytosine is usually given for about six weeks. Although these drugs are usually effective, relapses can occur.

Cryptorchidism A developmental disorder of male infants in which the testes fail to descend normally into the scrotum. (See Testis , 11ndesccndcd.)

C L

CT scanning A diagnostic technique in which the combined use of a computer and X rays passed through the body at different angles produces clear crosssectional images ("slices") of the tissue being examined. CT (computerized tomography) scanning- also known as CAT (computerized axial tomography) scanning or whole body scanning- provides clearer and more detailed information than X rays used by themselves. In addition, CT scanning tends to minimize the amount of radiation exposure.

...

WHY IT IS DONE

The first CT scanner, which came into operation in 1972, was developed to study the brain. Since then, CT brain scanning has marked a major advance in the diagnosis and treatment of tumors, abscesses, and hemorrhages in the brain, as well as strokes and head injuries. These once required tests, such as angiography and ventriculography (an outmoded technique for imaging the ventricles of the brain), that not only were difficult to perform, lengthy, and not always clear-cut in their findings, but also entailed some risk for the patient. CT scanning, on the other hand, is simple, quick, accurate, and carries a modest exposure to radiation. As well as being essential for the study of the brain, CT scanning is invaluable in investigating disease of any part of the trunk. It is particularly useful for locating and imaging tumors, and for guiding the operator who is performing a needle biopsy. RESULTS

Using the information produced by the scanner, a computer constructs cross-sectional images of the tissue under examination. These images, displayed on a TV screen, reveal soft tissues (including tumors) more clearly than normal X-ray pictures. The images are particularly valuable in brain scans due to their sharp definition of ventricles (fluid-filled spaces). The images can be manipulated

323

[ r

CULTURE

PERFORMING A CT SCAN

...

C

CT scanning combines the use of a computer and X rays passed through the body at different angles to produce clear cross-sectional images of areas of body tissue. Before the scan is carried out, a contrast medium may be injected to make blood vessels , organs, or abnormalities show up more clearly; a drink of contrast medium may be given to highlight loops of intestine.

1

The patient lies on a table that can be moved up or down to allow easy transfer and accurate position ing within the machine .

A central sliding cradle in the table moves the patient. at a controllable rate . into the machine

...

::J,.,

-... _,, -, _J

Right kidney The machine can be tilted in either direction to allow precise areas to be X-rayed

2

3

A great number of X-ray beams , each of low dosage and lasting only a fraction of a second, are passed through the body at different angles as the scanner rotates around the patient .

electronically to provide the best view of the area of interest, and adjacent two-dimensional "slices" can be reconstructed to produce threedimensional representations as well as images in different planes.

Culture A growth of bacteria or other microorganisms, cells, or tissues cultivated artificially in the laboratory. WHY IT IS DONE

Microorganisms are collected and cultivated to enable the cause of an infection to be accurately diagnosed. Cultivation produces larger numbers of microorganisms in a form suitable for further tests. Healthy cells are cultured to diagnose various disorders prenatally and for studying chromosomes. Human tissues, such as skin, may be cultured to produce larger amounts for use in grafting. Other tissues, notably human a11111ion (embryonic tissue) and monkey kidney, are cultivated to provide a medium in which viruses can be 324

Spine

Gas in stomach

Rib

Liver

The amount of X rays absorbed by different tissues is recorded by detectors in the scanner and tran sformed by a computer into an image, which is interp reted by a radiolog ist.

grown and identified in the laboratory; viruses will multiply only within living cells. HOW IT IS DONE MICROORGANISMS The type of specimen collected from the patient depends on the suspected site of infection. For example, a throat swab is made if a streptococcal throat infection is suspected, a urine specimen is collected if urinary tract infection is thought likely, a sputum sample if respiratory infection is suspected, or a feces sample if gastrointestinal infection is suspected. Likewise, a blood sample is cultured (blood culture) if the bloodstream is thought to be infected. Bacteria, fungi, and, occasionally, viruses m _ ay be cultured directly from the blood. The specimen is collected in a sterile conli:1iner and is incubated at body temperature in a carefully chosen culture medium. Liquid or solid culture media, usually agar gel or meat-based broth, are used for culturing bacteria. These media contain various nutrients

chosen for the particular needs of the organism suspected of causing the infection; the media may also contain ingredients to discourage the growth of other organisms. Any bacteria present will multiply to form visible colonies. The type of bacteria can be identified by noting the appearance of the colony, by chemical tests, and by examining the bacteria under the microscope. Bacterial cultures can be tested with various antibiotics to determine which antibiotic may be the most effective against a particular infection. CELLS AND TISSUES For the diagnosis of prenatal abnormalities, cells are collected by amniocentesis or clwrionic villus sampling. Cells for studying chromosomes (see Chromosome anali1sis) are cultured from white blood cefls or cells gathered from the inside of the cheek. Cells and tissues to be used for analysis, for growing viruses, or to be used for grafting are cultured in a small amount of fluid containing nutrients essential for their growth.

CUSHING'$ SYNDROME

Cupping

Curet

An ancient form of treatment used to draw blood to the surface of the skin. Cupping is still used in folk healing in some countries, particularly in China and Turkey. A small vessel-commonly a glass jar, animal horn, ceramic vessel, or a closed-ended bamboo tube-is heated and applied to the skin. When it cools and the air inside contracts, a partial vacuum is created, causing the skin to be sucked into the vessel, producing a rounded area of inflammation. Believers in this form of treatment think the inflammatory response is therapeutic.

A spoon-shaped surgical instrument for scraping away material or tissue from an organ, cavity, or surface.

Curettage The use of a sharp-edged, spoonshaped surgical instrument called a curet to scrape abnormal tissue, or tissue for anafysis, from the lining of a body cavity or from the skin. Curettage is commonly used to remove infected material from an abscess, to scrape tissue from the lininl? of the uterus as part of a D and C (dilatation and curettage) operation, and to remove small growths from the skin. (See also Curettage, dental.)

Curettage, dental Heated glass applied to skin - - - ~

Uses of cupping Conditions treated by this techn ique include bronchitis, asthma, and musculoskeletal pains.

Curare An extract from the bark and juices of various trees that has been used for centuries by South American Indians as an arrow poison. The principal active ingredient is tubocurarine, a drug that inhibits muscle contractions by interfering with the action of acetylclwline, a neurotransmitter (chemical released from nerve endings).

Cure To treat successfully; that is, to restore to normal health after an illness. The term usually means the complete disappearance of a disease rather than just a halt in its progress. Any medication or therapy used in the treatment of an illness may also be called a cure. In general, infections may be cured, as may some tumors. By contrast, chronic conditions, such as osteoarthritis, or endocrine deficiency diseases, such as hypothyroidism (underactivity of the thyroid gland), are never cured but undergo remission or are controlled with Tong-term hormone treatment.

The scraping of the wall of a cavity with a dental rnret (a narrow, spoonshaped, scaling instrument). It is one method used in the treatment of simple periodontal pockets occurring in periodontitis. The curet is used to remove the lining and diseased tissue from the lateral walls of the root. This enables the healthy, underlying tissue to reattach itself to the root surface, which is cleared of calculus deposits before curettage.

Curling's ulcer A type of stress ulcer (a disruption in the lining of the stomach or duodenum following any severe injury, infection, or shock) that occurs specifically in people who have suffered extensive skin burns. Ulcers develop about 24 hours after the burns and are usually small and multiple. Diagnosis and treatment are as for other types of stress ulcer.

Cushing's syndrome A hormonal disorder caused by an abnormally high circulating level of corticosteroid hormones, produced naturally by the adrenal glands. CAUSES ANO INCIDENCE

Cushing's syndrome may be produced directly by an adrenal gland tumor, causing excessive secretion of corticosteroids, by prolonged administration of corticosteroid drugs, or by enlargement of both adrenal glands due to a pituitary tumor. Corticosteroid drugs are widely used for inflammatory conditions such as rheumatoid arthritis, inflammatory bowel disease, and asthma. The pituitary gland controls the activity of the adrenal gland by producing a hormone known as ACTH (adrenocorticotropic hormone),

which stimulates the cortex (outer portion) of the adrenal gland to grow. Overactivity or a tumor of the pituitary can thus lead to over{roduction of ACTH, overgrowth o the adrenal glands, and excess secretion of corticosteroids. Some lung cancers and various other tumors may also secrete ACTH, with similar results. Cushing' s syndrome can occur at any age, but is most common in middle age. Most cases today are caused by excessive, prolonged use of corticosteroid drugs, but these cases are usually mild. The patient is often described as having cushingoid features rather than full-blown Cushing's syndrome. Cases caused by pituitary overactivity (sometimes called Cushing's disease) are much more common in women, and those caused by lung tumors are more common in men . SYMPTOMS

People with Cushing' s syndrome have a characteristic appearance. The face appears round ("moon-faced") and red, the trunk tends to become obese with a humped upper back, and the limbs become wasted. Acne develops and purple stretch marks may appear on the abdomen, thighs, and breasts. The skin is thin and bruises easily. The bones become weakened and are at increased risk of fracturing (see Osteoporosis). Women may become increasingly hairy. Affected people are more susceptible to infection and may suffer from stomach or duodenal ulcers. Mental changes often occur, including depression, paranoia, or sometimes euphoria. Insomnia may be a problem. Patients may develop hypertension (increased blood pressure) and edema (fluid collection in the tissues). About one fifth of patients develop diabetes mellitus. In children, Cushing's syndrome may suppress growth. DIAGNOSIS

Anyone suspected of having Cushing's syndrome should be examined by an endocrinologist. Obese or depressed patients may have many of the clinical features of Cushing's syndrome, making diagnosis difficult. Diagnosis requires measurement of ACTH levels in the blood and corticosteroid levels in the blood and urine. CT scanning of the adrenal and pituitary glands is performed to look for abnormalities. TREATMENT

If the cause is overtreatment with corticosteroid drugs, the condition is usually reversible with gradual withdrawal of drug treatment.

325

C

CUSP,DENTAL

C

If the cause is shown to be a tumor or overgrowth of an ad renal gland, the gland is removed surgicaHy. If the tumor lies in the pituitary gland, it is removed by surgery or shrunk by irradiation and medication. Patients subsequently need hormone replacement therapy; without it, they would be left completely deficient in adrenal or pituitary hormones.

Cusp, dental One of the small, protruding areas occurring on the grinding surface of a tooth (see Teeth) .

Cuspid A name for a canine tooth (see Teeth) .

Cutaneous Pertaining to the skin. For example, a subcutaneous injection is an injection given beneath the skin.

Cutdown The creation of a small incision in the skin over a vein to gain access to the vein. A cutdown may be necessary when it is essential to take blood or give intravenous fluid, and a vein cannot be identified through the skin.

CVS See Chorionic villus sampling.

Cyanide Any of a group of mostly highly toxic substances that contains the cyanogen chemical group. Chemicals in this group consist of a carbon atom linked to a nitrogen atom. The poisonous effects of cyanides are due to their ability to block a specific e11zy111e (cytochrome oxidase) that plays an essential role in the uptake of oxygen by cells. This blocking action deprives cells of oxygen , which, in turn, produces a rapid progression of symptoms from breathlessness, through paralysis and unconsciousness, to death . Because of their toxicity, cyanides have few applications. Hydrogen cyanide is used to kill rodents and fumigate buildings. It has also been used in gas chambers. Certain other cyanides are powerful eye irritants and are used in some tear gases.

Cyanocobalamin A name for vitamin B11 .

Cyanosis Bluish coloration of the skin and mucou s membranes (such as the lining of the mouth) due to too much

326

deoxygenated he111oglobi11 in the blood. Cyanosis is generally most obvious in the beds of the fingernails and toenails and on the lips and tongue. Cyanosis occurs most frequently because of slow blood flow through the skin as a result of low temperatures (the familiar sign of turning blue with cold). ln such cases, where no other symptoms are present, it does not indicate a serious underlying disease process. In other cases, however, cyanosis may be a serious sign and requires medical investigation. Cyanosis may indicate poor peripheral blood circulation in which the fingers and toes turn blue even in relatively warm conditions . It may also be a sign of a heart or lung disorder, such as heart failure, lung damage, or pulmonary edema (fluid in the lungs). More rarely, cyanosis may be present at birth, when it may be a sign of a congenital heart disease in which some of the blood is not pumped to the lungs (where oxygen, and thereby a bright red color, is obtained) . Instead, the blood goes directly to the rest of the body (see Heart disease, congenital).

Cyclosporine IMMUNOSUPPRESSANT

Injection

f!jf)

Prescription needed

~

Not available as generic

An immunosuppressm1t drug that suppresses the body's natural defense against abnormal cells; it was introduced in 1984. WHY IT IS USED

Cyclosporinc's immunosuppressant action is of particular use following trallsplant surgery, when the body may start to reject the transplanted organ unless the immune system is damped down. Cyclosporine is now widely used following many different types of transplant surgery, including heart, kidney, bone marrow, liver, and pancreas transplants. Its use ha s considerably reduced the risk of tissue rejection and also the need for large doses of corticosteroid drugs . Cyclosporine may need to be taken in oral form fur an indefinite period following surgery. POSSIBLE ADVERSE EFFECTS

Cyclacillin A penicillin-type antibiotic commonly used to treat acute otitis media (acute infection of the middle ear), sinusitis, and cystitis. (See Penicillins .)

Cyclobenzaprine A 11111scle-relaxa11t drug mainly used in the short-term treatment of painful muscle spasm caused by injury.

Cyclophosphamide An a11tica11cer drug used mainly in the treatment of Hodgkin's disease and leukemia, often in combination with other anticancer drugs. It is also useful as an in111111nosuppressant drug , helping prevent rejection of a transplanted organ by modifying the body's natural defense against abnormal or foreign cells. Cyclophosphamide has also been used to treat connective tissue diseases such as severe systemic lupus

crythe111t1tos11s .

Cycloplegia Paralysis of the ciliary muscle, which controls the shape of the lens in the eye. With the ciliary muscle out of action , the process of accommodntion is not able to w ork properly. Accommodation occurs when light rays from near objects are focused onto the retina (visual receptive layer) at the back of the eye.

Because cyclosporine reduces the effectiveness of the immune system, people being treated with this drug have an increased susceptibility to infection. Any flulike illness or localized infection requires immediate treatment by a physician. Cyclosporine has also been found to cause kidney damage in some people. Regular monitoring of kidney function is therefore necessary for people being given this drug. lf signs of kidney damage, such as protein in the urine, are detected, the dose of cyclosporine may need to be reduced or another drug substituted. Another adverse effect related to kidney damage is hypertension . A fairly common adverse effect of cyclosporine is swelling of the gums .

Cyclothymia A type of personality characteristic that is associated with marked changes of mood . From being cheerful, energetic, and sociable people, these individuals may, for no Jpparent reason, quickly become withdrawn, gloomy, and listless. These swings of mood mav be regular, may last for days or months, and may be separated by relatively "normal" periods of behavior. Sometimes an obvious manic-depressiue illness results, or there may be a family history of

CYSTECTOMY

such illness. There may be an associated pyknic (rounded and stout) body build. People with cyclothymia who are mainly "up" or "manic" often have very successful careers; others may resort episodically to heavy drinking or difficult behavior.

around parasites in organs such as the liver, brain, or intestinal wall in diseases such as liydatid disease, cysticercosis, and mnebiasis. Other types of cyst include Baker's cyst (behind the knee) and dermoid cyst (a type of skin cyst that may contain particles of hair follicles, sweat glands, nerves, and teeth). Cysts are usually harmless in themselves, but they may disrupt the function of the organ or tissues in which they grow. Those in the skin are unsightly, but, if accessible, can be surgically removed.

Cyst An abnormal lump or swelling, filled with fluid or semisolid materiaf, in any body organ or tissue. The causes of cysts are numerous. They may result from blockage of the duct leading from a fluid-forming gland-sebaceous cysts in the skin, for example. Alternatively, there may be abnormal activity or growth of a fluidforming tissue, with no means of the fluid escaping-in an ovarian cyst, for example. Finally, cysts may form

Sebaceous cysts under the ear These cysts result from blockage of ducts leading from sebaceous glands in the skin The cysts are benign; if they become unsightly, they can be surgically removed

Cyst-/cystoPrefixes that denote the bladder, as in cystitis (inflammation of the bladder) and cystoscopy (endoscopic examination of the bladder).

Cystectomy Surgical removal of the bladder, after which urine is passed from the body via a specially constructed channel emerging in a stoma (mouthlike opening) on the lower abdomen. WHY IT IS DONE

Cystectomy is performed either as a curative or palliative procedure for a widespread cancer of the bladder (see Bladder tumors). Once a cancer begins to invade the bladder muscle, treatment may be by surgery, radiation therapy, chemotherapy, or a combination of the treatments.

HOW CYSTECTOMY IS DONE The operation is a major proced ure performed using general anesthesia. An incision is made in the abdomen , and the ureters are cut and tied . The bladder and other organs are removed (see below) and the stoma formed . After the operation , the patient is given intravenous infusions of fiuids , salt, and glucose until the intestines function normally again.

In women , the uterus, fallopian tubes , ovaries, and part of the vagina (as well as the bladder) are removed

In men, the prostate gland and the bladder are removed

RISKS AND OUTLOOK

A cystectomy is likely to cause a major disturbance in life-style. In men, the operation in most cases causes impotence (due to damage to nerve tracts involved in penile erection) and in women it leads to infertility (although the majority of women who undergo the operation are past childbearing age). In addition, the patient needs to adapt to wearing an external pouch to collect urine and to learn about care of the stoma. Before undergoing surgery, cystectomy patients are thus advised to discuss their concerns about the operation and its consequences with the physician, surgeon, and enterostomy (stoma care) therapist. Many patients, however, are able to return to a fully active and healthy life. In recent years, the use of continent urinary diversions, with no external pouch, has been investigated. The newer pouches permit the patient to control the drainage of urine by emptying the pouch with a catheter. Results are encouraging, although they are still considered experimental.

Ureters usually cut here

Bladder

Prostate gland

Piece of small intestine with blood supply intact - -

Uterus

--i----'!'-'---':,....-,t;..,,~

Formation of the stoma The two ureters are joined to a short section of small intestine that has been detached from the remainde r of the intestines . One end of this loop of intestine is formed into a stoma by insertion throug h the abdominal wall.

Urine expulsion Urine produced by the kidneys is channeled via the ureters and intestinal loop out of the body through the stoma

327

C

CYSTIC ERCOSIS

Cysticercosis

C

An infection characterized by the presence, in tissues such as the muscle and brain, of cysts formed by the larval (immature) stage of the pork tapeworm. Cysticercosis is an extremely rare disease in the US and most other developed countries, although cases occur in Latin America, Africa, parts of Asia, and Eastern Europe.

Cystic fibrosis An inherited disease, present from birth, characterized by a tendency to chronic lung infections and an inability to absorb fats and other nutrients from food. When cystic fibrosis (CF) was first identified in the 1930s, before effective antibiotics were available, almost all sufferers died in early childhood. More recently, however, and particularly since 1975, the outlook has changed dramatically. With more advanced methods of diagnosis and treatment, including the use of a wide range of antibiotics, over two thirds of CF sufferers now survive into adult life, although few of them are in perfect health. CF remains, however, a serious and potentially fatal disorder. CAUSES AND INCIDENCE

CF (or mucoviscidosis, as it is sometimes called) is caused by a defective gene. The defect is of the recessive type, which means that a person must inherit it in a double dose (one gene from each parent) before any outward abnormality is apparent (see Genetic disorders). People who inherit the defective gene in a single dose (from one parent only) are called "carriers"; they are normally unaware of the fact and have no symptoms. Among whites in the US and elsewhere, about one person in 22 is such a "carrier." The chance that any (random) procreating white couple are both carriers is roughly one in 500. In this event, each of their children has a one in four chance of inheriting the defective gene from both parents and of being born with CF. The incidence of the disease among whites is thus about one per 2,000 live births. In nonwhites, however (for example, among black Africans), the disease is very rare (perhaps only one person in 90,000 is affected). The mechanism by which the gene defect leads to the features of CF is unknown. It is known, however, that certain glands do not function properly . Most seriously, the glands in the

328

lining of the bronchial tubes produce excessive amounts of thick mucus, which predisposes the person to chronic lung infections. A further serious malfunction is failure of the pancreas to produce enzymes involved in the breakdown of fats and their absorption from the intestines; this deficiency causes malnutrition. Sweat glands are also affected. SYMPTOMS AND SIGNS

The pattern of development of the disease, and the severity of its features, varies considerably among individuals. Hence, although the disease is sometimes obvious soon after birth, in other cases it escapes detection for months or years. In a typical, or classical, case, the child passes feces that are pale, greasy-looking, and foul-smefling, and in some cases he or she may fail to thrive. The child also suffers from persistent chest infections, causing constant coughing and breathlessness. Pneumonia, bronchiectasis, and bronchitis commonly develop, and the lungs become damaged. Sterility (not impotence) occurs in the majority of male sufferers but not in affected females; some otherwise healthy adult males have attended infertility clinics and been diagnosed subsequently as having CF. Other features of the disease include stunted growth in many cases, and also abnormally salty sweat, which may require salt replacement in hot climates, but is otherwise harmless. DIAGNOSIS AND TREATMENT

Suspicious symptoms should be reported to a physician as soon as they are noticed, since the earlier treatment with antibiotics is started, the less lung damage will be caused by chest infections. Once the diagnosis is considered, it is easily confirmed or refuted by simple laboratory tests, including a sweat test. In some areas, screening of all newborn infants for CF is available. Confirmation of the diagnosis and supervision of treatment is best carried out from a special center staffed by physicians, nurses, and physiotherapists who have a particular knowledge of the disease. To enable food to be properly digested, replacement pancreatic enzyme preparations must be taken with meals. The diet needs to be rich in calories and proteins, and a vitamin supplement is often prescribed as an extra precaution . These measures bring about weight increase and more normal feces .

AFFECTED FAMILIES

The parents of a child with CF must assume that any subsequent child has a one in four chance of being born with the disease. Unaffected siblings of affected people have a two in three chance of being "carriers," creating problems if they plan to have children with someone who also has CF in the family. Advice can be obtained through genetic counseling. Recent research has succeeded in establishing the location (on chromosome number 7 in a person's cells) of the gene involved in CF and has identified biochemical "markers" on the gene that are present when it is defective. It is now possible, therefore, to identify carriers of the defective gene, and also to detect CF before birth. This service can sometimes be offered to parents who already have a CF child and are contemplating a second pregnancy. First, the presence of the markers for the defective gene is established in both parents. Between eight and 10 weeks into pregnancy, fetal cells obtained by chorionic villus sampling are analyzed to see if the markers of CF are present; alternatively, chemical tests on cells obtained by amniocentesis (at 17 or 18 weeks of pregnancy) can confirm whether or not the child will have CF. In either case, the parents may choose to terminate the pregnancy if the fetus is affected. OUTLOOK

The highly specialized treatment given to CF sufferers today provides them with a much better quality of life than was formerly possible. Even so, most suffer permanent lung damage and have a considerably shortened life expectancy. Some people have been treated by heart and lung transplantation, while others have had a lung transplantation only; the results seem very encouraging.

Cystitis Inflammation of the inner lining of the bladder, caused by an infection that is usually due to bacteria . Anything that obstructs the voiding of urine from the bladder, or leads to incomplete voiding of urine, tends to encourage infection; stagnant urine in the bladder or urethra (the tube leading from the bladder to the exterior) provides a good breeding ground for bacteria. INCIDENCE AND CAUSES

In women, cystitis is common because the urethra is short, making it easier for infectious agents to pass from the mucous membrane around the

CYSTOMETRY

urethral opening up into the bladder. The bacteria may come from the vagina or from the intestine via the anus. Most women have cystitis at some time. A calculus (stone) in the bladder, a bladder tumor, or a urethral stricture increases the risk of infection due to obstruction of urine flow. In men, cystitis is rare (because of the longer urethra) and usually occurs only in the presence of an obstruction, which in most cases is due to an enlarged prostate gland compressing the urethra where it leaves the bladder. Rarely, the obstruction is due to a urethral stricture. In children, cystitis is often due to a structural abnormality of the ureters (tubes that carry urine from the kidneys to the bladder) at the point at which they enter the bladder, allowing reflux (backward flow) of urine into the ureters when the bladder muscle contracts. This leads to incomplete voiding of urine and to subsequent infection. Another possible source of infection is the introduction of a catheter (flexible tube) into the bladder-a procedure used to drain urine in a variety of circumstances (see Catheterization, urinary), including the treatment of incontinence and urinary retention. Diabetics are particularly susceptible to urinary tract infections.

AVOIDING CYSTITIS A few simple measures can help women prone to cystitis reduce the chances of recurrence. In particular,

women shou ld drink a lot of flui d, especially c ranberry juice, to encou rage acid ity of the urine

Fluid consumption

Rectum _ _

Drink plenty of fluids- so that the urine is consistently pale-and ensure th at the bladder is completely emptied at eac h vi sit to the toilet.

The main symptom of cystitis in both sexes is a frequent urge to pass urine, with only a small amount of urine passed each time. Passing urine is accompanied by pain, which is usually of a burning or stinging nature. Occasionally, the urine is foul smelling or contains blood. There may be a fever and occasionally chills and continuous discomfort in the lower abdomen. In children, there may be no urinary symptoms, only fever, or the child may cry when passing urine. DIAGNOSIS

OUTLOOK

The diagnosis of a urinary infection can be confirmed by examining a sample of urine under the microscope, looking for pus cells, and in certain instances trying to grow the bacteria in a culture. When no infection is found in someone with symptoms of cystitis, the diagnosis may be urethritis (inflammation of the urethra), a bacterial prostatitis, or, in women only, the urethral syndrome, in which the cause is thought to be trauma to the urethra from sexual activity.

Prompt treatment of cystitis with antibiotics usually settles the infection within 24 hours, with no complications. Occasionally, damage to the kidneys due to pyelonephritis occurs, usually because the infection has spread before significant symptoms have appeared. More tests are performed when there are recurrent infections in women, any infection in men, and usually after one infection in children.

TREATMENT

Women with the symptoms of cystitis should drink large quantities of fluid,

Hygiene Women prone to cystitis should wipe from front to back after a bowel movement and empty the bladder soon after intercourse.

including cranberry JUiee, which encourages acidity of the urine. If an infection is present, antibiotics are prescribed to destroy the bacteria and prevent the infection from spreading to cause pye/onep/zritis (infection of the kidneys) . In many cases, the physician will have the patient start a course of antibiotics, especially when pus cells are in the urine, before waiting for the result of the urine culture. The physician will then check the results of the culture to confirm the presence of an infection. Cultures are more frequently performed when there have been recurrent urinary tract infections. Sensitivity of the bacteria to various antibiotics is ascertained from a culture. In men, antibiotics are prescribed to treat the symptoms of cystitis, but more tests are arranged to look for any obstruction to urinary flow. In children, antibiotics are prescribed and usually more tests are performed to check for a disorder such as reflux of urine into the ureters.

SYMPTOMS

C

pushes against weakened tissues in the vaginal wall. Weakened tissues may be associated with descent of the uterus from its normal position down into the vagina (see Uterus, prolapse of). A cystocele may not cause symptoms, but occasionally the urethra (through which urine drains from the bladder) is pulled out of position . This may cause stress i11co11tille11ce (leakage of urine on coughing, lifting, or sneezing) or the bladder may not empty completely when urine is passed. The urine remaining in the bladder may then become infected, causing frequent and very painful urination (see C1/stitis) . Exercises to strengthen the pelvic floor muscles (which support the bladder, uterus, and other pelvic organs) may help relieve the symptoms (see Pelvic floor exercises). In severe cases, surgery is needed to lift and to tighten the tissues at the front of the vagina.

Cystometry A procedure carried out to provide information about normal bladder function and about abnormalities either of the nerves supplying the bladder or of the bladder muscle itself. The procedure measures pressure changes in the bladder as it fills, and also the total bladder capacity and the presence of any residual urine after the bladder has fully contracted. WHY IT IS DONE

A swelling at the front and top of the

Cystometry is used to investigate urinary incontinence or poor bladder emptying caused by damage to the bladder muscles (following childbirth or pelvic surgery, for example) or to disruption of the nerve control of these muscles (as in Parki11s011's disease or

vagina formed where the bladder

diabetes mellitus).

Cystocele

329

CYSTOSCOPY HOW IT IS DONE

C

The examination, which takes about 20 minutes, is performed by a urologist or a trained urological technician. ft is usually done on an outpatient basis and no anesthetic is required. A catheter (flexible tube) and pressure measuring probe are inserted into the bladder and sometimes the rectum. The bladder is gradually filled with water or carbon dioxide and a series of pressure readings is taken . They indicate the point at which reflex bladder emptying occurs.

Cystoscopy The examination of the urethra and bladder cavity using a cystoscope (viewing tube inserted up the urethra). Modern cystoscopes have a metal sheath with interchangeable fiberoptic telescopes, allowing a viewing angle ranging from zero to 120 degrees. The zero-angle lens is best for examination of the urethra and prostate; the 70- and 120-degree angles are used to inspect the bladder wall. WHY IT IS DONE

Cystoscopes have both diagnostic and therapeutic uses. Diagnostic uses include inspection of the bladder cavity for calculi (stones), bladder tumors, and sites of bleeding and infection, as well as the obtaining of urine samples from each kidney individually to look for infection or tumor cells. In addition, by means of radiopaque dye injected into the ureters via the cystoscope, X rays can be

taken to investigate the site of any obstruction to the flow of urine (see retrograde pyelography). Many diseases of the urethra and bladder lend themselves to treatment via the cystoscope. Bladder tumors can be both biopsied and treated with diathermy or 1aser, calculi can be crushed or removed with basket forceps from the bladder or ureter, and stents (narrow tubes) can be inserted into the ureter to relieve any obstruction.

Cystostomy The surgical creation of a hole in the bladder. A cystostomy is usually performed to drain urine when the introduction of a catheter (flexible tube) into the bladder via the urethra is inadvisable or impossible.

Cystourethrogram, voiding An X-ray procedure for studying a person's bladder while he or she is urinating. The technique is most commonly used on young children who have had urinary infections to detect reflux of urine- that is, urine being forced back up the ureters (the tubes leading from the kidneys) as the bladder contracts. If severe, reflux leads to repeated infection, which can damage the kidneys.

-cyte The suffix that denotes a cell. A leukoc1/te is a white blood cell; an erythrocyte is a red blood cell.

PROCEDURE FOR CVSTOSCOPY Cystoscopy allows inspection and treatment of the bladder using local anesthesia. There is no risk of damage to the genital organs or

urinary tract, although the patient may feel some discomfort when passing urine for a few days afterward.

-~ ..

View through cystoscope

Thecyst~

E y e p i e c e ~::: --:; - ;::.:;:;:;;:a:;;;;;;:;;:;:;;;;;;;;;;:;;;;;;;;;:;;;;;:;;;;;V ;:ie:;w ;:in:;:g;;:~;;:.._ ig--:iJ:~d forceps

330

CytoThe prefix used to describe a relationship to a cell, as in cytomegalic, which means "giant cell."

Cytologist A technician skilled in differentiating the appearance of normal from malignant cells.

Cytology The study of individual cells, as distinct from histology (the study of groups of cells forming a tissue). The main application of cytology in medicine is to detect abnormal cells; it is thus used extensively to diagnose cancer. Cytology is becoming more important in prenatal screening forcertain fetal abnormalities. APPLICATIONS

The best known use of cytology is screening for cancer of the cervix, a procedure known as the cervical smear test (Pap test). A scraping of cells from the cervix and vagina is examined under a microscope; if they show precancerous changes, the woman's condition can be observed and she can be treated before cancer develops. Cytology is also used to confirm (or exclude) the diagnosis of other cancers. Coughing up blood may be due to lung cancer, but a cytological examination of cells in a sample of sputum (phlegm) will help determine whether or not cancer actually is the cause. Similarly, cytology is valuable in detecting recurrent tumors in people who have already been treated for cancer. It is used particularly in cases of bladder cancer, in which tumors tend to recur after the original cancer has been successfully treated. Regular urinary cytology can detect any recurrent tumors at an early stage. Cytology may be helpful in determining the cause of conditions such as pleural effusion (fluid in the pleural cavity around the lungs) and ascites (fluid in the abdomen). Examination of cells in a sample of fluid usually indicates whether the condition is caused by cancer or an infection. Fine needle aspiration biopsy of internal organs is growing as a method of diagnosis that utilizes cytology. A needle is guided to the organ (usually with the help of ultrasound or CT scan11ing) and a sample taken for examination. The procedure may eliminate the need for surgical biopsy or a major operation. The other principal application of cytology is in various screening techniques for the early detection of fetal

CYTOTOXIC DRUGS

abnormalities such as Down's syndrome. The most widely used of these techniques is a11111ioce11tesis, in which a sample of the fluid that surrounds the fetus is removed and the cells in the fluid examined for abnormalities. Clwrionic villus sampli11g is used earlier in the pregnancy. Usually, the cells must be cultured before a determination is made. MODERN DEVELOPMENTS Various techniques are being developed to improve the ability to detect abnormal cells. Cells aspirated from various organs or tissues, as well as cells from cervical smears, can be studied further by the technique of flow cytometry (which uses a laser beam to scan cells and produce an image of the cells' DNA contents, thus differentiating between cells that are benign and those that are malignant). The use of monoclonal antibodieshighly specific proteins that react with only one particular tyre of protein on the surface of a eel (see Antibod11, monoc/ona/)- makes it easier to detect

small numbers of abnormal cells in the midst of many normal ones, thereby improving the sensitivity of cytological tests for cancer. A refinement of this technique involves labeling the monoclonal antibodies with fluorescent stains, which makes them stand out against a dark background. Other modern techniques have made it possible to detect abnormalities in chromosomes and even in individual genes. Such procedures have a potentially wide application for prenatal screening for congenital abnormalities, but many of them are still in the developmental stages and are not yet generally available.

indication of previous infection). In most cases, however, it produces no symptoms. More serious CMV infections can occur in people with impaired immunity, such as the elderly and those with AIDS . A pregnant woman can transmit the virus to her unborn child; this could cause malformations and brain damage in the child .

Cytomegalovirus

A group of drugs that kills or damages cells; a type of anticancer drug. Cytotoxics primarily affect abnormal cells but they can damage or kill healthy cells, especially those that are multiplying rapidly. For example, they may affect noncancerous cells in bone marrow, causing anemia and increasing susceptibility to infection.

One of the family of herpes viruses . It has the unique effect of causing the cells it infects to take on a characteristic enlarged appearance. Infection with the cytomegalovirus (CMV) is extremely common. Approximately 80 percent of adults have a11tibodics to it in their blood (an

Cytopathologist A specialist in the microscopic appearances of cells in health and disease; also called a cellular pathologist. (See also Cytology.)

Cytotoxic drugs

CYTOLOGY METHODS Cel ls for cytological examination are obtained in several ways , depending on the part of the body being investigated . Recent improvements in

Cells from the cervix These are scraped away with a spatula.

imaging tech niques have made it possible to collect cells from previously inaccessible sites . If the cytologist can make a definite d iagnosi s from a cell

Cells from the respiratory tract, esophagus, or stomach These are usually obtained by using an endoscope and small brush o r suction tube.

sample removed from a tumor using a very fine need le, the patient may be spared an exploratory operation.

Cells from body fluids

Aspiration biopsy

Th ese are obtained either by passing the fluid throug h a filter or by centrifug ation .

A ve ry fine needle can be acc uratel y passed into a suspected tumor and a biopsy samp le of cells removed .

EXAMINATION UNDER THE MICROSCOPE

The cells are smeared on a microscope slide and stained with dyes. The cytologist then examines them, looking for abnormal ities of size or shape in the cells or their nuclei. The smears are then graded- as normal, as displaying abnormalities, or as showing malignant cells .

• Normal cells in cervical smear

Smear showing abnormal cells

Smear showing malignant cells

331

C

TREATMENT

Dacryocystitis Inflammation of the tear sac, which lies between the inside corner of the eyelids and the nose. CAUSES

The inflammation usually results from blockage of the duct, which carries the tears from the tear sac to the nose. Inflammation may be followed by bacterial infection of fluid trapped in the tear sac. In infants, the tear duct may fail to develop an opening. In adults, the cause of the duct blockage is usually unknown. Rarely, it follows an injury; more often, it follows inflammation in the nasal region.

Irrigation can sometimes clear the obstruction. A cannula (fine tube) is introduced into one of the drainage openings into the tear duct and saline flushed through it. Antibiotic drops or ointment are prescribed to treat infection . In infants, massage of the tear sac can empty the sac and sometimes clear a blockage. If irrigation and antibiotics fail to clear up the symptoms, a dacryocystorhinostomy (surgery to drain the tear sac into the nose) can be performed. In the infirm elderly, if recurrent infection is the main problem, the tear sac may be removed.

ing) and other disorders of the uterus. It is also used as a means of terminating a pregnancy (see Abortion, elective) and may sometimes be carried out following a miscarriage. HOW IT IS DONE

D and C is usually carried out under general anesthesia. The cervix is difated (stretched open) so that a curet (a spoon-shaped surgical instrument) can be inserted into the uterus to scrape away the endometrium. The scrapings may then be examined under the microscope to assess the condition of the uterus. Curet Speculum

Danazol ANDROGEN HORMONE

Capsule

[jJ

Prescription needed

[!O

Not available as generic

An antiestrogenic drug used in the treatment of endometriosis (a condition in which fragments of the lining of the uterus occur elsewhere in the pelvic cavity), fibrocystic breast disease (breast tenderness and lumpiness that worsen before menstruation), and menorrhagia (heavy periods).

Forceps (to hold rim of cervix)

Uterus Cervix

Procedure for D and C The vagina is dilated with a speculum, the cervix is dilated, and a cure! is inserted into the uterus to scrape away the endometrium.

HOW IT WORKS

Tea r gland

i '

'\ ...

'I

Danazol suppresses the release of gonadotropin hormones (pituitary hormones that stimulate activity in the ovaries and testes). This reduces the production and release of estrogen from the ovaries. The change in hormone levels usually prevents ovulation, which results in irregularity or absence of menstruation. Danazol is usually administered in courses lasting a few months. The disorder may recur once treatment has been discontinued.

RESULTS

Removal of the endometrium causes no side effects and it may be beneficial if the lining has thickened, causing heavy periods. The endometrium soon grows again normally as part of the menstrual cycle (see Menstruation).

Dander

SYMPTOMS

Side effects may include nausea, dizziness, rash, back pain, weight gain, and flushing. Pregnancy should be avoided while taking (and shortly after taking) danazol because the drug can cause masculine characteristics in a female fetus .

Usually only one eye is affected. There may be pain, redness, and swelling in the area between the inner corner of the eyelids and nose. Occasionally, pus discharges from the inner can thus (corner). Prior to infection in the tear sac, the only symptom may be a watery eye and tearing due to obstruction of the duct.

DandC

Minute scales shed from an animal's skin, hair, or __ .,. • feathers. Both humans and u ·; pets produce such scales, which float in the air or settle on a surface, making up a large proportion of household dust. Human dandruff is a type of dander, except that the scales produced by the scalp are relatively large and easily visible. Some people are allergic to animal dander and develop the symptoms of allergic rhinitis (hay fever) or asthma if they breathe in the scales.

A gynecological procedure in which the endometrium (lining of the uterus) laid down after each menstrual period is scraped away. Short for dilatation and curettage, D and C is commonly used in the diagnosis and treatment of menorrhagia (heavy menstrual bleed-

A common, harmless, but irritating condition in which dead skin is shed from the scalp, often producing unsightly white flakes in the hair and on the collar and shoulders of clothes.

Tear sac Blocked tea r duct

Mechanism of dacryocystitis Inflammation of the tear sac occurs wh en the duct that carries tears from the tear sac becomes bl ocked.

332

POSSIBLE ADVERSE EFFECTS

~

~,:,:,.>:lx:9 @

Dandruff

DEAFNESS

The usual cause of the condition is seborrheic dermatitis, an itchy, scaly rash on the scalp, which may also occur on the face, chest, and back. TREATMENT

Shampoo frequently with an antidandruff shampoo. If this fails, a physician may prescribe a corticosteroid cream or lotion lo apply to the scalp or an antifimgal cream (even though dandruff is not a fungal infection), which sometimes helps. Whatever the treatment, dandruff usually requires constant control.

Dantrolene MUSCLE RELAXANT

Capsule Injection l!f) Prescription needed f!O Not available as generic Used to relieve muscle spasm caused by spinal injury, stroke, or neurological disorders such as cerebral palsy or multiple sclerosis. It does not cure the underlying disorder, but often leads to a gradual improvement in mobility. Dantrolene is occasionally used to treat abnormal urine retention (see

Urine retention) . POSSIBLE ADVERSE EFFECTS

Dantrolene acts predominantly on the muscles rather than the nervous system; consequently, it causes less sedation than many other musclerelaxant drugs. Alcohol should be avoided during treatment, however, because it increases the sedative effect. Dantrolene may cause diarrhea, muscle weakness, and, rarely, kidney damage. In rare cases, dantrolene may also cause a skin rash on exposure to sunlight. Exposure to sun should therefore be avoided during treatment.

Dapsone An antibiotic used in the treatment of leprosy and dermatitis herpetiformis, a rare skin condition. POSSIBLE ADVERSE EFFECTS

Dapsone may cause nausea, vomiting, and, rarely, damage to the liver, red blood cells, and nerves. During long-term treatment, blood tests are carried out regularly to monitor liver function and the number of red cells in the blood.

Daydreaming Conjuring up pleasant or exc1tmg images or situations in one's mind during waking hours. Everyone

daydreams to some extent, but it may be more common during unhappy or stressful periods in a person's fife. Children and teenagers may spend a considerable amount of time daydreaming. In general, this is not a cause for concern unless schoolwork and relationships suffer, at which time professional help may be needed.

DDT The generally used abbreviation for the insecticide dichloro-diphenyltrichloro-ethane. Developed in Switzerland in the early 1940s, DDT was much more effective than previous insecticides and it became an important weapon against insecttransmitted diseases, particularly in hot climates. A disadvantage of DDT is that some insects have adapted genetically t_o it so th~t their_offspring become resistant to its toxtc effects. (See also Pesticides.)

Deafness Complete or partial inability to hear. Tota[ deafness is rare and is usually congenital (present from birth). Partial deafness, ranging from mild to severe, is most commonfy the result of an ear disease, injury, or degeneration of the hearing mechanism with age. All deafness is either conductive or sensorineural. Conductive deafness is faulty transportation of sound from the outer to the inner ear, usually due to damage to the eardrum or the three connected bones in the middle earthe malleus, incus, and stapes. In sensorineural deafness, sounds that reach the inner ear fail to be transmitted to the brain because of damage to the structures within the inner ear or to the acoustic nerve, which connects the inner ear to the brain. CAUSES CONDUCTIVE DEAFNESS In an adult, the most common cause of conductive deafness is earwax blocking the outer ear canal. Less commonly, otosclerosis (in which the stapes loses its normal mobility) may be responsible. In a child, otitis media (middle-ear infection) with effusion (a collection of fluid in the middle ear that is often sticky like glue) is by far the most common cause of this type of deafness. Rarely, conductive deafness can be caused by /Jarotrauma (damage to the eardrum or middle ear due to sudden pressure changes in an aircraft or under water) or by a perforated eardrum (see Eardrum, perforated) as the result of injury, a middle-ear infection, or surgery on the ear.

Defects of the inner ear are sometimes congenital, due to an inherited fault in a chromosome, to birth inju ry, or to damape to the developing fetus-for example, as the result of the mother having had rui•e/la (German measles) during pregnancy. Damage to the inner ear may also occur soon after birth as the result of severe jaundice. Sensorineural deafness that develops in later life can be caused by prolonged exposure to loud noise, by Meniere's disease (increased fluid pressure in the labyrinth), by certain drugs (such as streptomycin), or by some viral infections . All damage the cochlea and/or labyrinth. These structures also degenerate naturally with old age (pres/Jycusis) . Damage to the acoustic nerve may be the result of an acoustic neuroma (a benign tumor on the nerve). As the acoustic neuroma enlarges, it causes increasing deafness. SE:, 51.)RINEURAL DEAFNESS

INCIDENCE

Deafness at birth-which is sensorineural and incurable- is rare, occurring in only one in 1,000 babies. But deafness that develops in young children- usually conductive and curable-is common. As many as one fourth of the 5 year olds starting school have some degree of hearing loss as the result of previous middle-ear infections. The hearing mechanism gradually degenerates with age, and about one fourth of the population over 65 need a hearing aid. SYMPTOMS, SIGNS, AND DIAGNOSIS

A baby suffering from congenital deafness fails to respond to sounds, and, although crying is often normal, he or she does not babble or make the other baby noises that precede speech. This condition is usually first noticed by a parent, but the deafness is almost always diagnosed during one of the child's regular visits to a pediatrician. Routine hearing tests are performed on children to detect any hearing loss, which is usually due to otitis media with effusion. In an adult who has started to become deaf, sounds heard are not only quieter than before but are also distorted and less clear, high tones are less audible than low ones, the sounds "s," "f," and "z" are not heard, and speech may be difficult to understand if there is background noise. Deafness in one ear may be noticed only when that ear alone is used (for example, when the sufferer uses the affected ear when on the telephone). 333

D

DEATH

Earwax

Perforated ea rdrum

Meniere's disease Drug toxicity

~ - -- - - Acoustic neuroma

D

_____,,___,....,,...._ __ _ Occupat ional deafness

_ _ _ _ _ _ Otoscleros1s

Middle car effusion

, _ _ _ _ __

Ba rotrauma

Some possible causes of deafness The affected part is shown in each c ase Some problem s (e.g .. earwax) cause conductive deafness; others (e .g ., d rug toxi c ity) cause sensorineural deafness

Deafness may be accompanied by tinnitus (noises in the ear) and vertigo (dizziness and loss of balance). It sometimes causes confusion, paranoia, and auditory hallucinations, and can lead to withdrawal and depression. Examination of the ear with an otoscope (a viewing instrument with a light attached) can show if the outer ear canal is obstructed by wax or if the eardrum is inflamed or there is fluid behind it. To determine whether deafness is conductive or sensorineural, hearing tests are used. TREATMENT

Children born deaf need special instruction if they are to learn to speak. The process is a long and

Death Permanent cessation of all vital functions; the end of life. The classic indicators of death are the permanent cessation of the function of the heart and lungs; in most cases these remain the criteria by which a physician diagnoses and certifies death. During the 1960s, however, medical technology advanced to allow the artificial (machine-assisted) maintenance of breathing and heart beat in cases where the lungs and heart would otherwise have stopped due to gross structural brain damage. This prompted a reexamination of the concepts of death and, in the late 1970s, state legislatures, at the urging of the medical profession, began recognizing an afternative criterion of death. This alternative is brain death, defined as the irreversible cessation of all func334

difficult one, but eventually many children can communicate effectively, often with sign language. Conductive deafness in children due to otitis media with effusion is treated by an operation to drain the fluid from the middle ear through a hole in the eardrum (see Myr111gotomy). While awaiting surgery the child should sit at the front of the classroom to hear as much as possible. When conductive deafness is caused by wax in the ear, the wax is removed by syringing the ear with warm water. A perforated eardrum is usually allowed to heal of its own accord, but, if it has not done so after two or three tions of the entire brain, including the brain stem. An individual can thus now be certified legally dead if there is either irreversible cessation of circulatory and respiratory functions or if the criteria for brain death are satisfied. DIAGNOSIS OF DEATH

The determination of death is considered a medical diagnosis. Physicians are expected to exercise their medical judgment within a defined legal framework . The diagnosis of death under normal circumstances, when the individual is not on a ventilator (breathing machine), is based on absence of spontaneous breathing, absence of heart beat, and on the pupils being dilated and unresponsive to light. The legal criteria for diagnosing brain death are based on the deter-

months, a surgical repair, called tympanoplasty, is often carried out. Conductive deafness due tu otosclerosis is usually treated by stapedectomy, an operation in which the overgrown stapes is replaced with an artificial substitute. Hearing aids are sometimes used to lessen deafness caused by otosclerosis, in which case the hearing aid takes the form of a bone-conducting device that transmits sound to the inner ear through a vibrating pad touching the bone behind the ear. The main use of hearing aids, however, is in treating sensorineural deafness, which cannot be cured because the structures of the inner ear are too delicate to allow surgery to be performed on them. These hearing aids increase the volume of sound reaching the inner ear by means of an amplifier and an earphone that fits into the outer ear. A new development in the treatment of sensorineural deafness is the cochlear implant, in which electrodes that can receive sound signals are implanted in the inner ear. The single channel device has been replaced by one with multiple channels. Up to now, however, it has achieved only limited success. Lipreading is an invaluable aid for all deaf people, whatever the type and severity of their deafness. People addressing a deaf person should remember to face him or her and not shout, which only distorts sounds. Various household aids, such as an amplifier for the earpiece of a telephone, are available. mination of the irreversible cessation of brain function. The guidelines state there must be clear evidence of irreversible damage to the brain; persistent deep coma; no attempts at breathing when the patient is taken off the ventilator; and absence of brainstem function (such as the response of the pupils to light, grimacing in response to pain, and the involuntary blink when the surface of the eye is touched). The guidelines warn that this assessment might not be reliable if the patient is intoxicated, has an extremely low body temperature, or is in shock. An EEG showing absence of electrical activity in the brain's cerebrum is not required, but sometimes provides useful confirmatory evidence of brain death diagnosed by the above criteria. (See also Mortality .)

DECOMPRESSION, SPINAL CANAL SUDDEN DEATH

In infants (mainly up to 1 year of age), death that occurs without warning is called sudden infant death syndrome (SIDS) or crib death. The causes of SIDS are unknown, although there are several theories. In adults, common causes of sudden death include injury, myocardial infarction (heart attack), brain hemorrhage, and pneumonia. Less common causes include anaphylactic shock, asthma, and suicide. Cases of sudden death must be reported to the coroner or medical examiner, who decides if a postmortem examination (see Autopsy) should be performed.

Debility Generalized weakness and lack of ambition and energy. Debility may be caused by a physical disorder (such as anemia) or a psychological disorder (such as depression).

Debridement Surgical removal of foreign material and/or dead, damaged, or infected tissue from a wound or burn to expose healthy tissue. Such treatment promotes healthy healing of badly damaged skin, muscle, bone, and other tissue.

Decalcification, dental The dissolving of minerals in a tooth. The first stage of decay, it is caused by the bacteria in plaque acting on refined carbohydrates (mainly sugar) in food to produce acid. After prolonged or numerous exposures, the acid causes changes on the surface of the tooth. The decalcified area can be seen as a chalky white patch when the plaque is brushed away. At this stage, the process is partly reversible if a mineralizing solution is applied. If the decalcification penetrates the enamel, it spreads along the junction between the enamel and dentin, and then into the dentin. Lack of professional treatment at this point will permit bacteria to enter the pulp. Further destruction of dentin wiII then be caused by bacterial enzymes, and the pulp, once infected, may die. (See also Caries, dental.)

Decay, dental See Caries, dental.

Decerebrate The state of being without a functioning cerebrum (the cerebral hemispheres and associated structures), which is

the main controlling part of the brain. This situation occurs when the brain stem (the upward extension of the spinal cord) is severed, which effectively isolates the cerebrum.

Deciduous teeth See Primary teeth .

Decompression sickness A hazard of scuba divers, also known as the "bends" and formerly known as caisson disease. Decompression sickness results from the formation of gas bubbles in the diver's tissues during ascent from depth.

D

Inert gas di ssolved in tissue fluids and blood

Pressure reduced (ascent)

CAUSES AND INCIDENCE

The amount of gas that can be held dissolved in a tissue (such as blood or body fat) increases with pressure (such as at great depth underwater) a11d decreases when the pressure is released. At depth, divers accumulate large quantities of inert gas in their tissues from the high-pressure gas mixture they breathe (see Scuba-diving medicine); if air is being breathed (as is usual for amateur divers), the main inert gas is nitrogen. When the diver ascends, pressure falls and the gas can no longer be held within the tissues; if the pressure reduction is rapid, the gas may form bubbles-just as bubbles form in a bottle of beer when the cap is flipped off. The bubbles may block blood vessels, causing various symptoms. Trained divers avoid problems by allowing the excess gas built up in their tissues to escape slowly via their blood into their lungs during controlled, very slow ascent.

Bubbles form 1n blood vessel and tissues

Bubble blocking blood vessel

How decompression occurs On ascent. pressure is reduced rapidly and the gas may form bubbles that may, in turn , cause symptoms. Divers avoid this by ascending slowly.

pressure is slowly reduced, allowing the excess gas to escape safely via the blood and lungs. OUTLOOK

If treated promptly by decompression, most divers with the bends make a full recovery. However, in serious, untreated cases, there may be long-term complications such as partial paralysis. Repeated episodes lead to degenerative disorders of the bones and joints.

SYMPTOMS

Symptoms may appear any time within 24 hours after a dive. Common symptoms include skin itching and mottling, and severe pains in and around the larger joints, particularly the shoulders and knees. Symptoms of nervous system impairment (such as leg weakness, visual disturbances, or problems with balance) are particularly serious, as is a painful, tight feeling across the chest, which may indicate the presence of bubbles in the vessels feeding the heart and in the circulation to the lungs. TREATMENT

Any diver with the symptoms described should be transported immediately to a decompression chamber. Pressure within the chamber is raised by pumping in air; this causes the bubbles within the diver's tissues to redissolve, and symptoms to disappear. Subsequently, the

Decompression, spinal canal A surgical procedure to relieve pressure on the spinal cord or on a nerve root emerging from the cord. WHY IT IS DONE

Pressure on the spinal cord may be due to a disk prolapse, to a tumor (in most cases benign) of the membranes surrounding the cord or of the cord itself, to a narrow spinal canal (spinal stenosis), which may be present from birth or caused by osteoarthritis, or to fracture of the vertebrae after an accident. Any of these conditions can cause weakness or paralysis of the limbs and also loss of bladder and bowel control. HOW IT IS DONE

To treat major disk prolapses and tumors, a laminectomy (removal of the bony arches of one or more vertebrae) to expose the affected part of the cord or nerve roots must be performed. 335

DECONGESTANT DRUGS

D

Severely prolapsed disks are cut away and affected nerve roots are freed from surrounding tissues. It is sometimes preferable to treat compressive conditions by using an anterior approach in which the spinal column is entered from the front. When pressure is being caused by a tumor or abscess in a vertebra, the affected section of bone is removed. If a large portion of bone is removed, bone grafting is carried out at the end of the operation.

THE ACTION OF DECONGESTANTS Decongestants work by narrowing blood vessels in the membranes that line the nose. Th is action red uces Enlarged blood vessels

swelling, inflammation , and the amount of mucus produced by the nasal lin ing. Constricled blood vessels

Swollen nasal lining

Less mucus Reduced swe lling

I

I I

RECOVERY PERIOD

Confinement to bed in a flat position is necessary initially, with measures taken to prevent bedsores and physical therapy given to keep the leg muscles strong. Usually a patient can get up within a few days. Heavy lifting and carrying must be avoided for several weeks. OUTLOOK

Recovery of movement, sensation, and bladder control, and achievement of pain relief after treatment, depend on the severity and duration of the pressure before the operation, the success of the surgery in relieving the pressure, and whether damage was sustained by the cord and nerves during the operation.

Decongestant drugs COMMON DRUGS Ephedrine Oxymetazoline Phenylp ropanolamine Pseudoephedrine Xylometazoline

Symptoms worsen when . after several

I

doses for a short time.

I days of treatment. decongestants are I suddenly withdrawn . Use only in low

Congested nasal lining

Effect of decongestants

When blood vessels enlarge in response to infection or irritation. increased amounts of fluid pass into the lining, which swells and prod uces more mucus

Chemicals stimulate constriction of the blood vessels in the nasal lining , which reduce s swelling , mucus p rod uction, and nasal con gestion.

If decongestant nose drops are taken for several days and then stopped, congestion frequently recurs ("rebounds") and may be worse than that for which the drug was taken. For this reason, decongestants should be taken for as short a time as possible.

Deductible

r--------------. WARNING I I

Nasal __ passage

I I I

A provision in many health insurance policies that makes the patient responsible for a certain doflar amount of medical charges before the benefits of the insurance policy begin to apply. (See also Coi11s11ra11ce.)

... ____________ J Defecation Drugs used to relieve nasal congestion. Small amounts of these drugs are present in many over-the-counter cold remedies, which are available in tablet or nose-drop form. Decongestant drugs are commonly used in the treatment of upper respiratory tract infections, especially in patients susceptible to otitis media (middle-ear infection) or sinusitis (sinus infection) . POSSIBLE ADVERSE EFFECTS

Taken by mouth, decongestant drugs may cause tremor and palpitations; they are therefore not usually prescribed if a person has heart disease. In the form of nose drops, only small amounts are absorbed into the bloodstream and adverse effects are unlikely.

336

The expulsion of feces from the body via the anus.

Defense mechanisms Techniques used by the mind as a means of coping with unpleasant or unwelcome events, experiences, impulses, or emotions . For example, death of a relative normally provokes grid and/or anger. One defense against these emotions may be repression- refusal to recognize these feelings and appearing to be unaffected by the event. Another reaction is denial- carrying on as though the relative is still alive. A person who feels guilty about hating his or her father may transfer this hate to another ferson or turn the bad feelings towan himself or herself.

Disturbing impulses may take the opposite form in conscious thought. For instance, a person with strong sexual feelings may be excessively prudish or inhibited. The body's defense mechanisms against infection are described under irmmme system.

Defensive medicine The practice of ordering medical tests or procedures primarily to protect against any charge of malpractice.

Defibrillation A technique in which a brief electric shock is administered to the heart, usually via two metal plates placed on the wall of the chest. Also called cardioversion, defibrillation is performed to treat some types of arrhyth111ia (irregular or rapid heart beat). The sudden burst of electricity through the heart converts fibrillation (rapid, uncoordinated heart beat) or tach11cardia (rapid heart beat) back into a ·normal, regular heart beat. Occasionally a drug, such as lidocaine, is injected into a vein before the procedure to try to stabilize the heart rhythm. Defibrillation can be carried out as an emergency procedure to treat ve11tricular fi/1rillatio11, which most commonly starts after a myocardial i11farctio11 (heart attack). It may also be used to treat an arrhythmia that has lasted several hours or days.

DEHYDRATION

Defoliant poisoning

Degeneration

Defoliants are applied to plants to cause their leaves to drop off and the plants to die. Commonly used as weedkillers, defoliants are poisonous if swallowed. They shoula therefore always be kept in clearly labeled containers and stored out of the reach of children. The most widely used defoliant weedkillers are sodium chlorate, potassium chlorate (see Chlorate poisoning), and paraquat. Another familiar defoliant is dioxin, which was used by US forces in Vietnam and has also occasionally been released into the atmosphere as a result of industrial accidents. Allegations have been made that this toxic substance caused nerve and other disorders in many Vietnam veterans and in others who have been exposed to it (as well as causing birth defect s in their children). There is no convincing scientific evidence to support these allegations.

Physical and/or chemical changes in cells, tissues, or organs that reduce their efficiency. Its true cause is unknown, but may be due to a disease process; degeneration is also a feature of aging. Other known causes include injury, reduced blood supply, poisoning (by alcohol, for example), or a diet deficient in a specific vitamin . (See also Degenerative disorders.)

Deformity Any malformation or distortion of part of the body. Deformities may be congenital (present at birth) or they may be acquired as a result of injury, disease, disorder, or disuse. Most congenital deformities are relatively rare. Among the more common are clubfoot (talzpes) and cleft lip and palate. The last two may occur separately or together. Injuries that can cause deformity include burns, torn muscles, broken bones, and dislocated joints. Among the various diseases and disorders that may cause deformity are infections (such as tuberculosis and leprosy), damage to or disorders of nerves (such as paralysis of the facial nerves), some deficiency diseases (such as rickets), and a condition of unknown cause called Paget's disease of the bone. Disuse of a part of the body-as a result of being bedridden or confined to a wheelchair, for example-can lead to deformity through stiffening and contracture (shortening) of unused muscles or tendons. Many deformities can be corrected by reconstructive surgery, various orthopedic techniques (including surgery), exercise, or by a combination of these methods. For example, cleft lip and cleft palate are now routine1y treated during childhood by reconstructive surgery, with good results in most cases. It is often possible to prevent the development of a deformity due to disuse by regular exercise.

Degenerative disorders A blanket term covering a wide range of conditions in which there is progressive impairment of both the structure and function of part of the body. This definition excludes diseases caused bv infection, inflammation, altered immune responses, chemical or physical damage, or malignant change. Many of the features of aging, such as wrinkling of the skin, are due to degenerative changes in body tissues, but, in degenerative disorders, the changes come on earlier in life, are more rapid, and typically affect some organs and not others. Microscopic examination of an organ affected by degenerative disease often shows that the number of specialized cells or structures is reduced and that their place has been taken by connective or scar tissue. Some diseases that were once thought to be degenerative disorders later proved to be due to slow viruses (such as Creutzfeldt-Jakob syndrome). Other degenerative disorders, such as Parkinsonism, may be traceable to poisoning- with carbon monoxide or with MPTP, an impurity formed during the illegal manufacture of one of the many designa drugs. Future research may identify specific infective or environmental causes for other degenerative disorders that are at present thought to be degenerative. NERVOUS SYSTEM

Among degenerative disorders affecting the nervous system the most common is Alzheimer's disease, the main cause of presenile and senile dementia . Jn H1111tingto11's chorea, dementia is combined with disorders of movement. Susceptibility to the degenerative changes in the brain is due to an abnormality in a single gene; the disease is transmitted from one generation to the next in a dominant pattern of inheritance (see Genetic disorders) . In Parkinson's disease and in degenerative disorders that affect the cerebellum, abnormalities of movement are the main features. In motor 11e11ron diseases, such as Werdnig-Hoffmann

disease and other diseases in their infantile forms, the prime symptom is muscular weakness. EYES

Blindness in early adult life can be caused by a condition called Leber's optic atrophy, which is due to loss of nerve cells in the retina. Retinitis pigmc11tosa, another retinal degeneration, can cause blindness in childhood, but some vision may be preserved until late middle age. Both disorders have a genetic basis. By contrast, senile macular degeneration is not an inherited condition and rarely develops before the seventh decade. JOINTS

The most familiar degenerative disorder is osteoartlzritzs, sometimes known as degenerative joint disease. Susceptibility to the condition seems to run in families; it also develops in sports enthusiasts and manual workers who have repeatedly damaged their joints. The prime features of osteoarthritis are thinning and destruction of the cartilage covering the surfaces of the joints and overgrowth and distortion of the bone around affected joints. ARTERIES

Some hardening of the arteries seems to be a feature of aging. In some individuals, however, the degenerative changes in the muscle coat of these blood vessels are unusually severe and calcium deposits may be seen on X-ray films (as in Monckeberg's sclerosis, a type of arteriosclerosis). MUSCLES

The muscular dystrophies are a group of genetic disorders that cause distinctive patterns of muscular weakness, sometimes associated with increased muscle bulk. Myopatlzies , by contrast, are muscle disorders for which an external cause, such as a chemical toxin, can usually be identified . Myopathies are not classed as degenerative disorders.

Deglutition The medical term for swallowing.

Dehiscence The splitting open of a partly healed wound, most commonly the splitting open of a surgical incision that has been closed with sutures or clips.

Dehydration A condition in which a person's water content has fallen to a dangerously low level. Water accounts for about 60 percent of a man's weight and 50 percent of a woman's, and the total water 337

DEJA vu

D

content must be kept within fairly narrow limits for healthy functioning of cells and tissues (see Water) . The concentration in the body's fluids of mineral salts and other dissolved substances also must be kept within a narrow range. In many cases of dehydration, salt will have been lost as well as water. CAUSES

Normally, dehydration is prevented by the sensation of thirst, which encourages a person to drink when the body is short of water. This mechanism may fail because water is not available or because of high losses of water from the body. Even in a temperate climate, a minimum of three pints of water continues to be lost every 24 hours through the skin via perspiration, from the lungs into the air, and in the urine to rid the body of waste products. Severe dehydration is likely to develop within a few days if no water is taken. Large amounts of water may be lost in vomit or diarrhea, particularly if the diarrhea is profuse and watery (as in cholera) or in the urine of anyone with uncontrolled diabetes mellitus, diabetes insipidus, and some types of renal failure. In all these cases, the thirst sensation may not encourage sufficient water intake to balance the losses. SYMPTOMS AND SIGNS

Symptoms and signs of water depletion mclude severe thirst, dry lips and tongue, an increase in heart rate and breathing, dizziness, confusion, and eventual coma. The skin looks dry and loses its elasticity. Any urine passed is small in quantity and dark-colored. If there is salt depletion (usually as a result of heavy sweating, vomiting, or diarrhea), there may be lethargy, headaches, cramps, and pallor.

TREATMENT

Once dehydration has developed, fluid and salt replacement may be required at a far faster rate than that required to simply prevent dehydration. Sometimes, fluids must be given intravenously and the water/salt balance requires careful monitoring with blood tests and adjustment.

Deja vu French for "already seen." A sense of having already experienced an event that is happening at the moment. Deja vu is a common phenomenon that has never been properly explained. Some people believe that it is due to an unconscious emotional response caused by similarities between the current event and some past experience. Others believe that a neurological "short circuit" results in the experience registering in the memory before reaching consciousness. Frequent occurrence of deja vu may sometimes be a symptom of temporal lobe epilepsy.

Delinquency Behavior in a juvenile that in an adult would be considered a crime. The term is often extended to include noncriminal behavior, such as being truant, running away from home, drinking alcohol, or using drugs. Juvenile delinquency is probably caused by a combination of factors-social, psychological, and biologicalbut relatively few offenders suffer from a definite mental disorder or mental retardation. Child guidance or family therapy may be recommended for delinquents and their families. Persistent offenders are sometimes sent to special schools and may be taken into care or made wards of the court.

PREVENTION

When living in a hot climate, or when suffering from a fever, vomiting, or diarrhea, the simplest rule is to drink enough water to produce urine that is consistently pale. This often means drinking well beyond the point of thirst (possibly a pint of water every hour during the heat of the day). Salt losses from heavy sweating need to be replaced either in the diet or by adding a quarter of a teaspoon of table salt to each pint of drinking water. Bottled mineral water can help maintain the intake of salts. For vomiting and diarrhea, special salt and glucose rehydration mixtures for adding to water may be purchased from drugstores. 338

Delirium A state of acute mental confusion, commonly brought on by physical illness . The symptoms are those of disordered brain function , and vary according to personality, environment, and the severity of illness. Failure to understand events or remember what has been happening, increased anxiety, physical restlessness, and sudden swings of mood occur as delirium worsens. At its most severe, the patient ma>:: hallucinate, suffer from illusions (for example, seeing nurses as threatening monsters), lapse into terrified panic, and resort to shouting and violence. Usually the symptoms are worse at

night, because of sleep disturbance and the fact that darkness and quiet make visual illusions more likely. CAUSES

While any severe illness may underlie this state, high fever and disturbances of body chemistry are often present. Children and older people are most liable, particularly after major surgery or when there is a preexisting brain disturbance such as dementia. Drugs, various poisons, and alcohol are common precipitants. TREATMENT

Treatment is of the underlying physical disorder, with appropriate nursing management to reauce anxiety. Suitable fighting, calm and clear communication, appropriate seclusion, and known, trusted attendants are all important. Particular attention must be paid to fluids and nutrition, but tranquilizers (e.g., chlorpromazine, haloperidol, or thioridazine) are often necessary for sedation of the physical restlessness. The control of infection by antibiotics has probably made this condition much rarer than it was 50 years ago.

Delirium tremens A state of confusion accompanied by trembling and vivid hallucinations. It usually arises in chronic alcoholics after withdrawal or abstinence from alcohol, and often occurs following admission to the hospital with an injury or for a surgical operation. SYMPTOMS, SIGNS, AND TREATMENT

In the early stages, symptoms include restlessness, agitation, trembling, and sleeplessness. Overactivity of sympathetic nerve pathways causes a rapid heart beat, fever, dilation (widening) of the pupils, and profuse sweating that may fead to dehydration. Confusion follows with visual and sometimes auditory hallucinations, and the patient appears terrified. Convulsions may also occur. The symptoms usually subside within three days . Treatment consists of rest, rehydration, and sedation in a hospital. Sedative drugs used include chlorpromazine or chlordiazepoxide. Injections of vitamins, particularly thiamine (vitamin B), may be given, since some of the features of delirium tremens seem to be linked with thiamine deficiency (see Wer-

nicke-Korsakoff syndrome).

Delivery Expulsion or extraction of a baby from the mother's uterus. In most cases the baby lies lengthwise in the uterus with

DE MORGAN'S SPOTS

its head facing downward and is delivered head first through the vaginal opening by a combination of uterine contractions and maternal effort at the end of the second stage of labor (see Childbirth) . If the baby is lying in an abnormal position (see Breech delivery; Ma/presen tation), if uterine contractions are weak, or if there is disproportion between the size of the baby s head and the mother's pelvis, a forceps delivery or vacuum extraction may be required; these are called operative deliveries. In some cases, vaginal delivery is impossible or potentially dangerous to the mother or the baby, and cesarean section is necessary.

Deltoid

in a paranoid delusion involves persecution or jealousy. For instance, a person may believe that he or she is being poisoned or that a partner is persistently unfaithful (see Paranoia). A person suffering from delusions of grandeur believes, for example, that he or she is related to royalty . Persistent delusions are a sign of serious mental illness, notably schizophrenia and dementia. (See also Hallucination; Il/usion.)

Dementia A general decline in all areas of mental ability. Dementia is usually due to brain disease and is progressive, the most obvious feature being increasing intellectual impairment. INCIDENCE

The triangular muscle of the shoulder region that forms the rounded flesh of the outer part of the upper arm, and passes up and over the shoulder joint. The wide end of the muscle is attached to the scapula (shoulder blade) and clavicle (collarbone). The muscle fibers converge to form the apex of the triangle, which is attached to the humerus (upper-arm bone) about halfway down its length. The central, strongest part of the muscle raises the arm sideways. The front and back parts of the muscle twist the arm. LOCATION OF THE DELTOID Muscle of the shoulder region , forming the rounded , outer part of the upper arm , and attached to the scapula and clavicle.

.,.....r-+- - - - - + 4 - Deltoid

muscle

Delusion A fixed, irrational idea not shared by others and not responding to reasoned argument. The central idea

Dementia is the great health problem of modern developed societies, since long life is creating an increasing proportion of elderly citizens. Some 10 percent of those over 65 years and 20 percent of those over 75 years are affected to some degree by dementia. CAUSES

Traditionally, dementing illnesses were divided into presenife (under 65 years of age at onset) and senile (over 65 years). This is now regarded as an artificial division, although treatable causes are more common in the younger age group. Causes include head injury, pernicious anemia, encephalitis, myxedema, syphilis, brain tumor, and alcoholism. Such "reversible" illnesses account only for some 10 percent of dementias. The great majority of them result from cerebrovascular disease (including strokes) and from Alzheimer's disease. While the former can sometimes be helped by treatment of hypertension (high blood pressure) or heart disease, the recurrent loss of blood supply to the brain is often due to narrowed or blocked arteries within the brain, and a gradual deterioration occurs. Alzheimer's disease is at present completely irreversible, consisting as it does of gradual loss of brain cells and shrinkage of the brain substance.

outbursts or embarrassing behavior (such as urinating in public) may be the first obvious signs of the illness. Commonly the person's failure s in judgment result in the magnification of his or her unpleasant personality traits; families may have to endure unreasonable demands, accusations, pilfering, and even physical assault. Paranoid and depressive illnesses (see Paranoia; Depression) with psychotic delusions may occur as dementia worsens. Irritability or anxiety, with the patient retaining some awareness of his or her emotional state, alters to a shallow indifference toward all feelings. Personal habits deteriorate, clothes and possessions become soiled and dirty, and speech becomes incoherent. Demented individuals lapse into "second childhood" and require total nursing care of their feed ing, toilet, and physical activities. TREATMENT

While appropriate treatment of certain illnesses is effective in arresting decline (such as surgery for a brain tumor or thyroid replacement for myxedema), management of the most common, Alzheimer-type illness is based mostly on the treatment of symptoms. The patient should be kept clean and well nourished in comfortable surroundings with good nursing care, and sedatives should be given for obvious restlessness or paranoid beliefs. These measures can help ease the distress for both patient and family. Timing of a transfer to suitable hospital or custodial care must be sensitively organized . Research into medication to alleviate memory loss and intellectual decline has shown some promise, but no truly effective treatment is yet available commercially.

Dementia praecox An outdated term for severe schizophrenia, especially that developing in adolescence or early adulthood . It means literally "prematurely out of one's mind."

SYMPTOMS

De Morgan's spots

The person with dementia may not remember recent events, may become easily lost in a familiar neighborhood, may fail to grasp what is going on, and may become confused over days and dates. These symptoms tend to come on gradually and may not be noticed right away. People also tend to cover up their problems by confabulation (making up stories to fill the gaps in their memories). Sudden emotional

Harmless red or purple raised spots in the skin, about one tenth of an inch across, that usually affect middle-aged or elderly people. De Morgan's spots are also called cherry spots or cherry angiomas and consist of a cluster of minute blood vessels. With increasing age they become more numerous but do not increase in size. The spots are of no significance but may bleed if injured.

339

D

DEMYELINA TION

D

Demyelination

Dengue

Density

Breakdown of the fatty sheaths that surround and electrically insulate nerve fibers. The sheaths provide nutrients to the nerve fibers and are vital to the passage of electrical impulses along them . Demyelination "short-circuits" the functioning of the nerve, causing loss of sensation, coordination, and power in specific areas of the body . The affected nerves may be within the central nervous system (CNS, comprising the brain and spinal cord) or may be part of the peripheral nervous system, which links the CNS to the body's sense receptors, muscles, glands, and organs.

A tropical disease caused by a virus spread by the mosquito AEDES AEGYPTI. It occurs in Southeast Asia, the Pacific region, parts of Africa, South and Central America, and the Caribbean. There have been occasional outbreaks in Mexico, Puerto Rico, and the US Virgin Islands in recent years, and a few cases have occurred along the Gulf coast. Symptoms and signs appear five to eight days after a bite by an infected mosquito and include fever, rash, severe joint and muscle pains, and headache. These symptoms often subside after about three days, recur a few days later, and then subside again. Serious complications are uncommon . Full recovery may take several weeks. The symptoms of severe muscle and bone pain have led to dengue being called breakbone fever. No specific treatment is available for dengue, though analgesics (painkillers) may relieve symptoms. No vaccine is available at present, so avoidance involves personal protection against mosquito bites in areas where the disease is prevalent (see Insect bites).

The "heaviness" of a substance per unit volume. Density is a measure of how much a given volume of a substance weighs. For instance, a cubic inch of lead is considerably heavier than a cubic inch of wood; lead is therefore denser than wood. In radiology, the term density relates to the amount of radiation absorbed by the structure being X rayed. Bone, which absorbs much radiation, appears white on X-ray film . By contrast, a lung, which contains mostly air, absorbs very little radiation and appears dark on film. The same holds true in CT scanning.

Cell body

f :Jt,ifir~==--- Nucleus

~~- Myel,n -

-+-+-•

sheath

Degeneration of sheath

Mechanism of demyelination The fatty myelin sheaths that surround and insulate nerve fibers break down. cau sing the affected nerves to "short-circu it."

Patches of demyelination are the prime feature of multiple sclerosis, a disea se with symptoms that include blurred vision, muscle weakness, and loss of coordination . The cause of the demyelination is not known. In many cases, attacks of demyelination alternate with periods of partial or complete recovery of nerve function. Encephalomyelitis is a rare disorder caused by inflammation of nerve cells within the CNS and sometimes areas of demyelination. It may be due to a viral infection or very rarely an allergiclike reaction following immunization. Symptoms vary from headache to brain damage.

Dendritic ulcer A type of corneal ulcer characterized by threadlike extensions that branch out in various directions from the center. The ulcer is commonly caused by infection of the cornea by the virus that causes herpes simplex.

340

~

Densitometry The measurement of bone density, as determined by the concentration of calcified material. WHY IT IS DONE

Densitometry is used to confirm the presence of osteoporosis (wasting away of bone substance) or to diagnose rickets in young children. It is also useful in assessing the response of these conditions to treatment. HOW IT IS DONE

The most accurate way to measure bone density is by analyzing the weight and content of a bone biopsy sample. However, this technique is time-consuming and requires an operation to remove the sample. CT scanning provides more detailed pictures of the internal bone structure that enable smaller changes in bone density to be seen . A relatively new and expensive technique is single or dual photon absorption, in which the pattern of absorption of a beam (or beams) of radiation as it passes through the bone is analyzed on an electronic counter. The dual photon method is used to evaluate the mineral content of the type of bone found in the vertebrae and most other bones where fractures from osteoporosis occur.

Dental assistant A person who is trained to help a dentist at chairside and in the office. The dental assistant is responsible for maintaining the cleanliness of the dentist's office and equipment, and for sterilizing and setting out instruments for each patient. During treatment of a patient, he or she passes instruments to the dentist and mixes any materials that are needed, such as cement for fillings. Other duties include record-keeping, processing X-ray films, and giving patients instructions on oral hygiene.

Dental emergencies Injuries or disorders of the teeth and gums that require immediate treatment because of severe pain and/or because delay could lead to poor healing or complications. A tooth that has become avulsed (completely dislodged from its socket) in an accident will be gently washed, reimplanted as rapidly as possible (see Reimplantation), and then immobilized with a splint. The success rate is about 90 percent if the tooth is out of its socket for 30 minutes or less, but falls to about 70 percent if the tooth is not reimplanted for 90 minutes . An extruded tooth (one that is partially dislodged from its socket) should be manipulated back into the socket within a few minutes of the injury. A direct blow to a tooth may cause a fracture (see Fracture, dental). If the root is fractured so that the tooth is split in two, the halves will be brought closely together and splinted in position, usually for several months (see Splinting, dental). If the crown is fractured, but only the enamel and dentin are affected, a tooth-colored, composite filling will prevent pain from the exposed dentin, stop bacteria from entering the tooth , and restore

DENTAL EXAMINATION

appearance. If the fracture of the crown involves the pulp of a mature tooth, a root canal filling is needed (see Root canal treatment). In a young tooth, a dressing of calcium hydroxide placed over the pulp soon after the accident may allow a hard tissue barrier to form and prevent the pulp of the tooth from dying. Sometimes a blow hard enough to fracture teeth may also fracture the jaw; the fractured parts may need to be wired together to allow them to heal (see Wiring of the jaws). Toothache may be so severe that eating and sleeping are disturbed. Temporary pain relief can be gained by placing a sedative dressing in the tooth until the cause of the pain can be treated. The most severe dental pain is usually caused by an abscess (infection). This is treated either by antibiotics to reduce the swelling, or by draining the abscess (see Abscess, dental), foflowed by endodontic treatment. Swelling, pain, and inflammation also may occur around an impacted wisdom tooth, and the jaw may become stiff and difficult to open. This requires immediate treatment to prevent the infection from spreading (see Impaction, dental). Acute necrotizing ulcerative gingivitis comes on suddenly and causes pain, inflammation, ulceration, and bleeding of the gums. It is a destructive condition, and professional treatment should be sought as quickly as possible.

Dental examination Examination of the mouth, gums, and teeth by a dentist. A dental examination may be performed as a routine check at least once a year or as part of the assessment of the condition of a person complaining of a symptom. WHY IT IS DONE

Routine examinations enable caries (cavities) and diseases of the gums and mouth to be detected and treated at an early stage before they cause serious damage. The examinations also allow the efficiency of oral hygiene to be checked. It is particularly important for children to have their teeth examined by a dentist regularly so that the dentist can monitor replacement of the primary teeth by permanent teeth. If any problems occur, such as crowding, the dentist can refer the child for orthodontic treatment at the correct stage. HOW IT IS DONE

Before the examination, the dentist or dental hygienist usually asks about

SCOPE OF DENTAL EXAMINATION A dental examination includes an assessment of the condition of the teeth , of the gums, of the mouth, and of the bone that surrounds the teeth .

Dental assistant X-ray viewing screen

D

0

Constructing a dental record During the main part of the dental examination. the dentist checks for the presence or absence of individual teeth Any abnormalities and all fillings are recorded by the assistant.

Instruments used The dentist uses a mirror to see the backs of the teeth and into the back of the mouth; a metal instrument is used to probe for cavities or chips. ~ ~-;.;.-----1- Mirror

L_l_~'.,j)~'.::::~E:~~c:t-Probe

the patient's general health, especially if it is the person's first visit to a dentist or the first visit after a long time. Understanding the person's general health is important since it can affect the type of treatment that is recommended. A person with a heart valve disorder, for example, may be under increased risk of contracting bacterial endocarditis after extraction of a tooth or any other dental treatment. Particular care also is needed when treating diabetics and people who have had hepatitis. People with allergies may react dangerously to penicillin; people taking certain drugs can react badly to anesthesia. If the person feels pain, the dentist will ask him or her questions, such as when the pain was first noticed and whether it is continuous or intermittent. The dentist begins by noting the general appearance of the patient and by examining the face and neck externally. The face is inspected for puffiness that might indicate a dental abscess and the neck is felt for swollen lymph glands, which may be caused

by an infection of the mouth or teeth. The dentist also feels the temporomandibular joint (jaw joint) for any abnormal movements (see Temporoma11dibular joint syndrome). Next the dentist examines the patient's bite and the teeth asa whole, noting any tilted, rotated, overlapping, or missing teeth and observing points of contact between teeth, and the presence of any excessive movement in a tooth when the patient makes chewing movements. Using a mirror to see the backs of the teeth and into the back of the mouth, the dentist then examines individual teeth, using a metal instrument to probe for cavities or chips. Fillings and crowns are inspected for fit, jagged edges, and signs of erosion or cracks. If teeth are missing, the alveolus (bone that surrounds and supports the teeth) is examined for signs of abnormality, especially if the patient is to be fitted with a prosthodontic appliance, such as a bridge. If the patient wears a denture, it is checked to ensure it still fits. 341

DENTAL HYGIENIST

The gums and inside of the mouth are examined for signs of disease. Gums that are red, puffy, or receding or that bleed easily when touched with the probe may indicate gingivitis or periodontitis. White discoloration of the inside of the mouth may signify candidiasis or leukoplakia . Finally, the dentist assesses the accumulation of plaque and calculus on the teeth; this indicates the efficiency of the patient's oral hygiene. Inspection of the teeth and gums is sometimes followed by dental X rays.

Dental hygienist See Hygienist, dental.

Dental X ray An image of the teeth and jaws that provides information essential for detecting, diagnosing, and treating conditions that can threaten oral and general health. The part to be imaged is placed between a tube emitting X rays and a photographic film. Because X rays are unable to pass easily through hard tissue, a shadow of the teeth and bone is seen on the film. WHY IT IS DONE

X rays can reveal disorders of the teeth and surrounding tissues that a dentist would not see during a normal visual examination of the mouth. Small caries (cavities), abscesses, cysts, tumors, and other disorders can be detected and treated before obvious

signs and symptoms have developed, avoiding serious long-term damage. Early identification of dental problems, such as impacted teeth, allows treatment to be carefully planned and carried out at an early stage. RISKS

The amount of radiation received from dental X rays is extremely small, and the risk of any harmful effects is negligible. However, a woman who is, or suspects she may be, pregnant should tell her dentist, who may recommend the use of a leaded apron during the examination or postpone X rays until after the pregnancy.

Dentifrice A paste, powder, or gel used with a toothbrush to clean the teeth. Although brushing without a dentifrice removes food debris and some plaque (see Plaque, dental), a slightly abrasive dentifrice is needed to remove the remaining plague and the salivary pellicle (a thin protein film). A dentrifice contains the following: an abrasive- usually an insoluble, organic salt, such as dicalcium phosphate, which ideally does not scratch the teeth; a synthetic detergent for foaming action; humectants to bind the ingredients together and keep them moist; thickening agents; flavorings; and colorings. Fluoride has been added to dentifrices for many years, and the dra-

matic drop in caries has been partly attributed to its presence in the majority of preparations. A variety of desensitizing dentifrices is available for teeth that are sensitive due to exposed dentin near the gum margin.

Dentin Hard tissue surrounding the pulp of a tooth (see Teeth) .

Dentist The equivalent of the family practitioner for teeth. Dentists perform regular checkups, clean teeth, fill cavities, extract teeth (if absolutely necessary), correct problems with tooth alignment, and provide and fit bridges and/or dentures to replace missing teeth. They also check for cancer of the mouth, perform cosmetic procedures (such as bonding) and give general advice on how to care for the teeth and gums. Most dentists refer patients with complicated problems to dental specialists in different branches of dentistry.

Dentistry The science or profession concerned with the teeth and associated structures of the mouth. Dentistry involves the prevention, diagnosis, and treatment of disease, injury, or malformation of the teeth, gums, and jaws. The majority of dentists work in

TYPES OF DENTAL X RAY There are three different types of X ray. Each is useful for revealing particular problems.

Bite-wing X rays These X rays show the crowns of the teeth . They are useful for detecting areas of decay between teeth and changes in bone caused by periodontal (gum) disease. The film is in a holder with a ce ntral tab onto which the patient bites.

Periapical X rays These X rays give detailed pictures of whole teeth and the surrounding gums and bone. They show unerupted or impacted teeth, root fractures , abscesses, cysts, tumors, and the characteristic bone patterns of some skeletal diseases . The film, in a protective casing . is p laced in the patient's mouth and is held in position behind the teeth to be X rayed .

342

Panoramic X rays These X rays show all the teeth and surrounding structures on one large film . They are invaluable for finding unerupted or impacted teeth, cysts. jaw fractures, or tumors. Pictures are recorded continuously onto fil m as the camera swings around from one side of the jaw to the other.

DEPERSONALIZATION

general dental practice (77 percent in the US). They are qualified to undertake all aspects of dental care, including cleaning teeth, filling cavities, extracting teeth, and fitting crowns, bridges, and dentures. Although they are qualified to diagnose and treat complicated problems, dentists may refer patients to a practitioner in one of the specialized branches of the dental profession. Orthodontics concerns the moving of improperly aligned teeth to improve function and appearance. ProstFwdontics concerns the provision of bridgework and dentures to replace missing teeth and the provision of substitutes for missing oral tissues. Two branches specialize in the treatment of diseases: endodontics involves the treatment of diseases of the pulp, while periodontics involves the treatment of disorders that damage the supporting structures of the teeth, such as the gums.

Dentition The characteristics of a person's teeth, including the number and arrangement in the jaw. The term is also used to describe the eruption of teeth.

Denture An appliance that replaces missing natural teeth. A denture consists of an acrylic (tough plastic) and/or metal base mounted with acrylic or porcelain teeth. A natural appearance is achieved by choosing artificial teeth of the size, color, and snape that closely

resemble the original teeth and that blend well with the contours of the person's face . FITTING

The dentist takes impressions of the upper and lower gums. The impressions are removed from the mouth and allowed to harden. Models are then made by pouring plaster of Paris into the hardened impressions. Denture baseplates created from these models will fit the mouth accurately, but, to ensure that the bite will be correct when the artificial teeth are positioned, the dentist must also record the relationship of the upper and lower jaw. This is done by having the patient bite onto wax-rimmed plates (bite blocks) that can be trimmed to indicate the correct relative positions of the teeth. Using the bite blocks as a guide, a temporary denture with the teeth waxed into position is then produced. The patient tries it on so the dentist can make adjustments to the position or choice of teeth. When the dentist and patient are satisfied with the bite and appearance, the wax is replaced by acrylic or metal, and the finished, polished dentures are fitted at the patient's next visit. Additional visits may be needed to modify any part of the base that is uncomfortable. Dentures fitted immediately after tooth extraction usually require extra visits so that adjustments to the fit can be made as the tissues heal. Often a new acrylic lining is fused to the existing baseplate. Sometimes a soft lining

TYPES OF DENTURES Partial dentures

Full dentures

Immediate dentures

(made of slow-setting impression material) is inserted temporarily to minimize pain.

Partial dentures are used when only some teeth are missing. They fill unsightly gaps, make chewing easier, maintain clear speech, and keep the remaining teeth in position. Teeth on either side of a gap may tip (making cleaning more difficult) or drift (placing unnatural stress on the

tissues of the mouth). Partial dentures are held in place by metal clasps that grip adjacent teeth or by clasps combined with metal rests (extensions of the denture plate that rest on the tooth surface).

Full dentures are needed when there are no teeth left in the mouth . They stay in place by resting on the gum ridges and , in the case of upper dentures, by

suction. Fitting is usually delayed for several months after extraction of teeth to allow the gums to shrink and change shape as they heal.

Immediate dentures are fitted immediately after extraction of teeth. They protect the gum and control bleeding from extraction sites. Since a toothless period is avoided, they are particularly useful

for replacing front teeth. However, they can be expensive and require follow-up visits for refitting or relining so that they Iii comfortably.

Deodorant A substance that removes bad smelling odors, especially body odors. Deodorants may contain antiseptics to destroy bacteria, perfume to mask odors, and antiperspirants (drugs that reduce the production of sweat). Deodorant preparations are a useful aid against body odor caused by decomposition of sweat by bacteria on the skin. Deodorant liquids are also available to put into a colostomy or ileostomy bag. Deodorant drugs, such as bismuth, can be taken by mouth to reduce ostomy odor.

Deoxyribonucleic acid See DNA; Nucleic acids.

Dependence Psychological or physical reliance on persons or drugs. An infant is naturally dependent on parents, but, as he or she grows, dependency normally wanes. Some adults never become fully independent, continuing to demand excessive love, admiration, and help from others. Alcohol and drugs (such as opiates, amphetamines, and tranquilizers) may induce a state of physicaf or emotional dependence in heavy, regular users. A person who is dependent may develop physical symptoms (sweating and abdominal pains) or emotional distress if deprived of the drug. The pattern of dependence varies with the drug and with the personality of the individual. (See also

Alcohol dependence; Drug dependence.)

Depersonalization A state of feeling unreal. The sufferer often describes feeling "like a robot" or "as though a glass screen came down." The sensation usually comes on suddenly, though it may be momentary or last for hours. It is often accompanied by derealization (experiencing the world as unreal). An otherwise healthy person may experience depersonalization as an isolated event, especially if he or she is tired or worried . Although frightening, it is rarely serious. More often, people who have anxiety disorders experience depersonalization during panic attacks, especially if hyperventilation (rapid, shallow breathing) occurs. Other causes include drugs (e.g., LSD, antidepressants, or cannabis), migraine, and temporal lobe epilepsy. 343

D

DEPILATORY

Depilatory A chemical hair remover, such as barium sulfide, in the form of a cream or paste. Depilatories are used for cosmetic reasons and in the treatment of hirsutism (excessive hairiness). HOW THEY WORK

Depilatories dissolve hair at the surface of the skin. They do not affect the hair root and therefore do not permanently remove the hair. POSSIBLE ADVERSE EFFECTS

Depilatories may cause an allergic reaction, with inflammation and swelling. It is advisable to test them first on a small area of skin (they are not usually recommended for use on the face). Depilatories should not be used after a hot bath or shower. Heat increases blood flow to the skin and opens skin pores, thus increasing the amount of chemical that is absorbed into the body.

Depot injection An intramuscular (into a muscle) injection of a drug specially formulated to give a slow, steady absorption of its active chemicals into the bloodstream . Depot injections usually contain a much higher dose than that normally given by injection. Absorption of the drug is slowed by the inclusion of substances such as oil or wax . The release of the active drug can be made to last for hours, days, or weeks, depending on the formulation. A depot injection is useful for patients who may not take their medication correctly. A depot injection also prevents the necessity of giving a senes of injections over a short period . Examples of drugs given by depot injection include corticosteroid drugs and antipsyclzotic drugs . Disadvantages of this type of injection include side effects caused by the uneven release of the drug into the bloodstream and prolonged adverse reactions caused by the long-acting nature of the treatment. Patients who are receiving regular depot injections usually carry a warning card in case emergency treatment is required from another physician.

Depression Feelings of sadness, hopelessness, pessimism, and a general loss of interest in life, combined with a sense of reduced emotional well-being. Most people experience these feelings occasionally, often as a normal response to a particular event. For example, it is natural to feel sad when 344

a close relative dies . However, if the depression occurs without any apparent cause, deepens, and persists, it may be a symptom of a wide range of psychiatric illnesses. When a person's behavior and physical state are also affected, it then becomes part of a true depressive illness. SYMPTOMS

Symptoms vary with the severity of the illness. In a person with mild depression, the main symptoms are anxiety and a variable mood. Sometimes he or she has fits of crying that occur for no apparent reason. A person with more serious depression may suffer from loss of appetite, difficulty sleeping, loss of interest and enjoyment in social activities, feelings of tiredness, and loss of concentration. Movement and thinking may become slowed; in some cases, the opposite occurs, and the person becomes extremely anxious and agitated. Severely depressed people may have thoughts of death and/or suicide, and feelings of guilt or worthlessness. In extreme cases, they may have hallucinations or delusions (believing, for example, that someone is poisoning them). Intensity of symptoms often varies with the time of day. Most depressed people feel slightly better as the day progresses, but in some people the symptoms are worse at night. As a depressive illness progresses, the symptoms become more and more prominent. Finally, the person may become totally withdrawn and spend most of the time huddled in bed. CAUSES

Usually, a true depressive illness has no single obvious cause. It may be triggered by certain physical illnesses (such as stroke or hepatitis), by hormonal disorders (such as hypothyroidism), or by the hormonal changes that occur after childbirth (see Postpartum depression). Some drugs, including the birthcontrol pill and sleeping pilfs, are contributing factors. If the depression is a part of a manic-depressive illness, inheritance may play a part, since this illness tends to run in families. Aside from these biological causes, social and psychological factors may play a part. Lack of a satisfactory mother-child relationship may lead to depression in later life (see Bonding), especially when combined with difficult social circumstances. For example, a woman whose mother died early in her life may be particularly vulnerable if she has to cope with bringing up a child on her own.

Depression may also be related to the number of disturbing events or changes in a person's life. INCIDENCE

Depression is the most common serious psychiatric illness. Some 10 to 15 percent of people suffer from it at some time in their lives, especially the milder forms. The more severe manicdepressive type affects only about 1 to 2 percent of depressed people, but the incidence of all forms of the illness increases with age. This may be due to social isolation, failing mental powers, and physical illness. Depression appears to be more common in women, with about one in six seeking help for depression at some time in their lives (as opposed to only one in nine men) . This may be a true difference or may result from the fact that women are more prepared to visit physicians for their depressive symptoms while men may oe more likely to resort to alcohol, violence, or other expressions of discontent. TREATMENT

There are three main forms of treatment for depression, depending on the type and severity of the illness. Psychotherapy, whether individual or in a group, is most useful for those people whose personality and life experiences are the main causes of their illness. Many different types of therapy are available, ranging from an informal, purely practical approach to problem-solving, to the more structured approaches of cognitivebehavioral therapy and psychoanalysis. Drug treatment is used for people who have predominantly physical symptoms. Antidepressant drugs are usually effective in over two thirds of these patients, provided the drugs are taken in a sufficient dosage over a long enough period of time. Electroconvulsive therapy (ECn, which is given under a general anesthetic, is usually reserved for treating severely depressed people, especially if they are suffering from delusions or have failed to respond to treatment. ECT is effective and safe, and may be lifesaving; the only side effect may be a mild, temporary memory impairment. Trials have shown that ECT relieves severe depression faster than drugs . OUTLOOK

Although depressive illness is a common cause of distress and social problems, the outlook is good for most sufferers, provided they are given appropriate treatment and advice. The main risk is suicide. In affluent

DERMATOLOGY

societies the rate of suicide is about 20 per 100,000 population; at least 80Jercent of these deaths are relate to depression . The rate is highest in elderly men who are socially isolated and physically ill or in pain, but the rate is increasing in younger people. Many people suffering from depression do not require hospitalization and make a good recovery. People with severe and prolonged depression (especially the elderly) may require continuous treatment and may be socially handicapped . However, spontaneous recovery is possible after many years of illness.

Derangement An outdated term for severe mental disorder. It was first used in the nineteenth century to describe the idea of an orderly mind that had become "disarranged." Today it is usually applied to wild, disturbed behavior rather than a specific mental state. The term derangement also applies to disorders of the ligaments in the knee joint (i.e., internal derangement of the knee).

Derealization Feeling that the world has become unreal. Jt usually occurs with depersonalization and shares the sudden onset, symptoms, and causes of that condition. Sufferers commonly describe feeling that they are "looking at the world through a glass screen." Derealization may be caused by excessive tiredness, hallucinogenic drugs, or disordered brain function.

Dermabrasion The removal of the surface layer of the skin by high-speed sanding to reduce the pitted scars of acne, to improve the appearance of unsightly raised scars, or to remove tattoos. The skin is numbed with a local anesthetic and the surface layer removed by a fastrevolving abrasive wheel. Healing takes about two weeks and the fufl effect of the treatment is apparent after two months.

SEBORRHEIC DERMATITIS

This is a red, scaly, itchy rash that develops on the face (particularly the nose and eyebrows), scalp, chest, and back. On the scalp it is the most common cause of dandruff. The rash often develops during times of stress, but its exact cause is unknown. Generally, the treatment of dermatitis must be tailored to each case. Applying topical corticosteroids and/or antimicrobials is often helpful. Also, gentle handling of the involved skin is imperative (i.e., avoidance of scratching and irritating substances-like detergents). CONTACT DERMATITIS

In this type, the rash is a reaction to some substance that comes in contact with the skin. The reaction may result from a direct toxic effect of the substance or may be an allergic response . Among the more common causes of the reaction are detergents (including traces left in washed clothes), nickel (in watch straps, bracelets, necklaces, and the fastenings of underclothes), chemicals in rubber gloves and condoms, certain cosmetics, plants (such as poison ivy), and medications (among them the antibiotic neomycin in cream or droplet form). The type of rash varies considerably according to the substance causing it, but it is often itchy, and may flake or blister; its distribution corresponds to the skin area in contact with the causative substance. When it is not clear what substance is responsible, suspected chemicals are placed in contact with the skin of the back and are kept in place there with tapes for a few days to see whether any produces a patch of dermatitis. Once the offending substance is identified, it can then be avoided, if possible. A corticosteroid medication may be used for the treatment of an existing rash .

Dermatitis herpetiformis A chronic skin disease in which clusters of tiny, red, intensely itchy blisters occur in a symmetrical pattern on various parts of the body, most commonly the back, elbows, knees, buttocks, and scalp. The disease usually develops in adult life and is believed to be related to celiac sprue, a condition in which the small intestine is allergic to gluten, a constituent of wheat and other cereals. One of the symptoms of celiac sprue is chronic diarrhea, which also occurs in some people with dermatitis herpetiformis. Both conditions often improve after treatment with a glutenfree diet.

Dermatographia Sensitivity of the skin to mechanical irritation, to the extent that firm stroking leads to the appearance of itchy wheals (raised areas), which are slightly darker than the surrounding skin. The term dermatographia literally means "writing on the skin," and in fact it is sometimes possible with a few finger strokes actually to write visible words on the skin of a sufferer's back. Dermatographia (also called dermographism) is a form of urticaria (hives) and is most common among fair-skinned people with a tendency to allergic conditions such as eczema.

Dermatologist A physician who has been trained to treat problems relating to the skin, hair, and nails. Problems include everything from wrinkles, warts, and hair loss to acne, athlete's foot, and skin cancer. Treatment methods include medication (topical and/or oral), surgery, or the destruction of unwanted growths by freezing, burning, lasers, and radiation .

Dermatitis Inflammation of the skin, sometimes due to an allergy but in many cases occurring without any known cause. Many types of dermatitis are better known as eczema (for example, atopic, discoid, infantile, and hand eczema). Apart from eczemas, the three main forms of skin inflammation are seborrheic dermatitis, contact dermatitis, and photodermatitis.

Dermatitis artefacta Any self-induced skin condition. It may range from a mild scratch selfinflicted by someone under stress to severe and extensive mutilation by a psychologically disturbed patient. The skin damage may take any form- ulcers, blisters, or scratches. The damage often has a symmetrical or bizarre pattern and, to the trained eye, does not resemble that seen in any skin disease.

Contact dermatitis Reaction to the nickel in a watch strap produced the itchy, blistering rash on the inside of the wrist shown above.

Dermatology The study ofskin diseases. Dermatology is involved with the study of the physiology and pathology of the skin 345

D

DERMATOME

D

and its appendages (e.g., hair, sweat glands, and oil glands). ln the study of disease it includes investigation (such as examining skin scrapings under a microscope), diagnosis, and treatment, which principally consists of applying the appropriate creams, lotions, or ointments. Dermatopathology is the study of the microscopic appearance of diseased skin tissue. Skin diseases are relatively common, accounting for about 15 percent of all illnesses. fn many instances no cause can be found or permanent cure provided. This is true for many cases of psoriasis and eczema, two of the most common skin conditions.

Dermatome An area of skin supplied with nerves from one spinal root (see Nervous system). The entire surface of the body is an interlocking mosaic of dermatomes, the pattern of which is very similar from one person to another. Loss of sensation in a dermatome signifies damage to a particular nerve root, the most usual cause of which is a disk prolapse. Derma tome also refers to an instrument for cutting variable thicknesses of skin for use in skin grafting.

Dermatomyositis A rare, sometimes fatal, disease in which the muscles and skin become inflamed, causing weakness of the muscles and a skin rash. CAUSES AND INCIDENCE

The disorder belongs to a group of illnesses called the autoimmune disorders, in which, for reasons that are not fully understood, the body's defense system against disease starts attacking the body's own tissues. The condition is sometimes associated with underlying cancer of an internal organ. Two thirds of people suffering from dermatomyositis are middleaged women. SYMPTOMS

The first sign is often a red rash on the bridge of the nose and cheeks, followed by a purple discoloration on the eyelids and sometimes a red rash on the knees, knuckles, and elbows. Muscles then start to become weak, stiff, and painful, particularly those in the shoufders and pelvis where the limbs join the trunk. The skin over them feels thicker than normal. Sometimes the muscle pains precede the rash. The sufferer may also experience bouts of nausea, a loss of weight, and fever. 346

DIAGNOSIS ANO TREATMENT

The diagnosis is confirmed by blood tests, electromyography (to detect the electrical activity of muscles; see EMC), and a biopsy (removal of a small piece of tissue for microscopic analysis) of skin or muscle. Treatment is with corticosteroid and/or immunosuppressant drugs (to reduce the inflammation) and physical therapy (to prevent muscles from scarring and shrinking as they heal). OUTLOOK

In about 50 percent of cases, full recovery occurs after a few years. In about 30 percent, the disease is persistent, causing muscle weakness. In the remaining 20 percent, it is progressive and affects the lungs and other organs and may be fatal.

A dermoid cyst also sometimes develops in the skin of the head and neck, causing a small painless swelling, which may be removed for cosmetic reasons. This type of dermoid cyst is usually congenital and contains only skin structures.

Dermoid tumor See Oermoid cyst.

DES The abbreviation for the synthetic estrogen drug diethylstilbestrol.

Desensitization A technique, used in behavior therapy for treating phobias, in which the patient is gradually exposed to the cause of the fear.

Dermatophyte infections

Desensitization, allergy

A group of common fungal infections of the skin, hair, and nails, also called tineal infections (some are also called ringworm). Dermatophyte fungi can be spread from one person to another or from an animal such as a cat or dog to a person. The infections they cause usually have both a Latin name incorporating the term "tinea" and a common name-for example, tinea pedis (athlete's foot) and tinea capitis (ringworm of the scalp). (See Tinea.)

See Immunot!zerapy.

Dermoid cyst A benign tumor with a cell structure similar to that of skin and containing hairs, sweat glands, and sebaceous glands. Fragments of cartilage, bone, and even teeth are also often found within such tumors. About 10 percent of ovarian tumors are dermoid cysts. They are often readily diagnosed because the bony material within them is opaque to X rays. They very rarely become malignant (cancerous), but can enlarge up to several inches in diameter to cause discomfort and abdominal swelling. As with any enlarging ovarian tumor, surgery is recommended.

Designer drugs

r =;;;;;---------, I I I I

Designer drugs carry a high risk of drug dependence, with severe wit~drawal reactions. and of drug po1sonmg, causing effects such as brain damage.

I I I I

L------------J A group of illegally produced chemicals that mimics the effects of specific drugs of abuse. Made in illicit laboratories, these drugs are cheap to produce and thus undercut the street prices of drugs such as LSD and amphetamine drugs. Designer drugs are often made in such a way that their structures are subtly different from the drugs they imitate. As a result, these drugs escape the federal laws that control the manufacture and distribution of drugs listed under the Controlled Substance Act (CSA). TYPES

Designer drugs can be divided into three major groups: those derived from narcotic analgesics (painkillers) such as meperidine and fentanyl; drugs that mimic amphetamine drugs (stimulants); and variants of phencyclidine (PCP), a drug originally used in animal anesthesia that causes hallucinations. POSSIBLE ADVERSE EFFECTS

Appearance of dermoid cyst on head The growth is firm . painless, and has an inner cavity that contains a fatty substance and sometimes hair, teeth, and bony material.

Designer drugs are highly potent. Some derivatives of fentanyl, for example, are between 20 to 2,000 times more powerful than morphine; this has led to a high incidence of death due to drug poisoning. Amphetamine derivatives cause brain damage at doses only slightly

DEVELOPMENTAL DELAY

higher than those required for a stimulant effect. Although they have been abused as aphrodisiacs, amphetamine derivatives commonly impair orgasm in both men and women and may prevent erection. Many designer drugs contain impurities. For example, a substance known as MPIP, contained within an analogue (derivative) of meperidine, has caused permanent brain damage that has resulted in symptoms and signs of Parkinson's disease. Phencyclidine analogues often cause seizures and psychosis. OUTLOOK

New laws are being introduced in many states to control the use of designer drugs. The Analogue Enforcement Act, if approved by Congress, will restrict tne use of all such substances.

Desipramine An antidepressant drug. It takes about 10 to 14 days before desipramine improves the condition of the person who is depressed . It has less of a sedative effect than some other antidepressants, and is therefore useful in treating patients for whom sedation is undesirable. Possible adverse effects include a dry mouth, and, rarely, constipation and blurred vision.

Desmoid tumor A growth, usually in the abdominal wall. The tumor is hard, with a welldefined edge. Desmoid tumors occur most frequently in women who have had children. Stretching or bruising of the abdominal muscle fibers during pregnancy may be a factor in their development. Desmoid tumors may also arise at the sites of old surgical incisions in the abdomen or elsewhere in the body, and they are often regarded as overgrowths of scar tissue. Surgical excision is the usual treatment, although recurrence of the growth at the same site is common. Radiation therapy may arrest the growth of desmoid tumors.

Detergent poisoning If swallowed, the cleaning agents in shampoos, laundry powders, and cleaning liquids cause vomiting, diarrhea, and a swollen abdomen. The treatment is to dilute the detergent by giving the victim plenty to drink. The same types of detergents can irritate the skin by removing its natural oils; people who constantly use them should protect their hands.

Developmental delay A term used when a baby or young child has not achieved new abilities within the normal time range and has a pattern of behavior that is not appropriate for his or her age. Development is an increase in the abilities-physical, intellectual, and social-and is a well-orchestrated process, with new abilities and new patterns of behavior appearing at given ages, while existing patterns of behavior change and sometimes disappear (see Child development). Delays may be of varying severity and may affect any or all of the major areas of human achievement (i.e., development of the ability to walk upright, of fine hand-eye coordination, of listening, language, and speech, and of social interaction). Developmental delay is not a term used for slow increase in physical size (see Growth; Short stature) or for late appearance of sexual characteristics (see Puberty). The term developmental delay is not usually applied to children over the age of 5. In general, the child who is slow in one or two aspects of development and of average or perhaps advanced ability in others needs to be distinguished from the child who is delayed in most aspects. When there is a significant delay in a few aspects, there may be a specific (although often not obvious) disability such as a visual or hearing impairment, which, if adequately treated, may allow the child to catch up. Children who are developmentally delayed in most aspects usually have a more generalized problem- for example, fack of adequate stimulation and teaching at home or a slowness to learn because of limited intellectual abilities. CAUSES

Some important causes of generalized developmental delay are shown in the accompanying table. It is important to remember that a child born prematurely will reach most developmental milestones later than other children. Parents will want to recognize how old the baby would be if born at term rather than prematurely. Causes of delay in specific areas of development are outlined below. WALKING ANO MOVEMENT SKILLS There is an enormous time range within which most children learn to walk; children are not considered delayed unless they are not walking by themselves by 18 months. In most late walkers, no serious cause is found. Late walking is an

CAUSES OF GENERALIZED DEVELOPMENTAL DELAY Unsatisfactory parental interaction (e.g .. lack of affection. stimulation. or teaching, or lack of consistent and constant guidelines of acceptable behavior).

D

Severe visual impairment. Vision is vitally important for normal development in all areas. Children learn to recognize objects by sight before learning their names. they learn about sounds by seeing which objects make which sounds. and they become motivated to crawl and walk by the desire to explore the surroundings they see. (See Vision. disorders of; Blindness.)

Severe hearing impairment. (See Deafness.)

Limited intellectual abilities. (See Mental retardation.) Damage to the brain before. during, or after birth. or in infancy. The results of damage depend on which parts of the brain are damaged and on severity. (See Brain damage; Cerebral palsy_)

Severe disease of other organs and systems of the body. (See Nutritional disorders; Heart. Bone, Muscles, and Kidney disorders boxes.)

inherited feature in some families and is probably due to delayed maturation of the nervous system. Such children learn to walk a few months later than other children, and from then on usually develop new skills at a normal rate. Other children develop slightly unusual patterns of locomotion-for example, creeping on their abdomens or shuffling on their bottoms. These traits also tend to run in families. Such children may miss out on the crawling stage. They eventually stand and walk and from then on follow the normal developmental sequence in all other developmental aspects. A more specific reason for delayed walking and other skills is weakness of the leg muscles and other muscles. This can occur in boys with pseudohypertrophic muscular dystrophy and in children with spina bifida. Cerebral palsy is a disorder affecting all aspects of motor development; it may

347

DEVIATION, SEXUAL

cause slowness and difficulty in gaining control of the head and neck muscles during the first months of life as well as delay in sitting and walking. HAND-EYE COORDINATION Any defect of vision or of the nerves and muscles used to control fine finger movements may be a cause of delayed manipulative skills. However, the most common cause is not a specific abnormality but lack of experiencestimulation and encouragement are extremely important in the acquisition of these skills. If a child has only large toys to play with and is not encouraged to use the small finger muscles, skills involving the muscles will be delayed. Similarfy, if a child is left lying down for most of the time instead of in a sitting position, the hands will not be in the correct position to acquire certain skills. RESPONSE TO SOUND If a child is unresponsive to sound it may be due to deafness. However, children who are not talked to may show a lack of interest in the human voice, although they may respond normally to other sounds. Children exposed continually to a great deal of noise may show a general lack of interest in sound. A rare cause of unresponsiveness to the human voice is the psychiatric condition of autism . An affected child can hear normally but shows little interest in human contact of any kind . Although unresponsive to human voices, autistic children often become obsessively interested in particular sound-producing toys. SPEECH AND LANGUAGE The most important cause of delayed speech is deafness of any degree. Other common causes are lack of stimulation (when parents do not talk to the child sufficiently) and a familial pattern of delayed speech, which is more common in boys than girls. Twins are often late talkers, perhaps because they may receive less individual parental attention . Twins sometimes develop a private language that includes idiosyncratic words and nonverbal communication. Children exposed to two or more languages may show signs of speech delay and may confuse the languages. However, many children become naturally bilingual or trilingual with no difficulties. Any generalized difficulty with muscle control can affect speech production; muscle control can be a particular difficulty in children with cerebral palsy. Damage to, or structural defects of, the speech muscles, 348

larynx, or mouth may also cause speech difficulties, as may any disorder affecting the speech area of the brain (see Dysarthria; Dysphonia;

Aphasia; Speech disorders). BLADDER AND BOWEL CONTROL Children vary enormously in the age at which confident control of bowel and bladder function is acquired. Usually bowel function is acquired first. Delay in bladder control is much more common than delayed bowel control. There are many possible causes. (See

Incontinence, urinary; Enuresis; Incontinence, fecal; Encopresis.) ASSESSMENT AND TREATMENT

In many instances, the parents will be the first to notice that their child is not acquiring new skills at the same rate as his or her peers. A physician should be consulted. Problems are sometimes detected during one of the developmental checks that are carried out routinely in the US and other developed countries. These checks are performed by physicians or other health professionals at varying ages, but usually at birth, 6 weeks, 6 to 8 months, 12 to 15 months, 2 years, 3 years, and 5 years. If a developmental delay is discovered, the first step is to establish the cause by undertaking a full assessment. This examination usually includes hearing and vision testing, a full physical examination, and thorough developmental assessment. Further investigation is arranged as necessary. It may include referral to a pediatrician, neurologist, psychologist, speech therapist, occupational therapist, or physical therapist. Once the severity of the delay, and the probable cause, has been discovered, appropriate treatment can be arranged. In many cases, the parents can be reassured that there is no serious abnormality and that their child can be expected to develop normally without any specific treatment. Sometimes advice is given regarding suitable toys and other stimulation. Specific treatment may include provision of glasses or a hearing aid; treatment may also include a lengthy course of speech therapy or psychiatric counseling for the whole family . In some cases it is felt that the child's best interests are served by admission to a special school for children with specific difficulties-for example, a language unit or a school for physically handicapped children. Whatever the cause, children can be helped to achieve their full potential by provision of appropriate therapy.

Professionals are usually involved in assessing the abilities of a child and deciding on the appropriate help. Parents are often of prime importance in providing this help.

Deviation, sexual A form of sexual behavior in which intercourse between adults is not the final aim. Instead, the man (deviation is rare in women) achieves erection and orgasm in other ways, such as by being whipped or wearing women's clothes. Forms of sexual deviation include exhibitionism, transvestism,

fetishism, frottage, necrophilia, pedophilia, sadism, and masochism.

Dexamethasone CORTICOSTEROID (t ~

/

✓/

r-1

t? #

~ J'

e)

Tablet Injection Nasal spray Eye drops

!!i)

Prescription needed

~

Available as generic

Dexamethasone is a corticosteroid drug prescribed as a nasal spray to relieve nasal congestion caused by allergic rhinitis (hay fever) and as eye drops in the treatment of iritis (inflammation of the iris). It is given in tablet form to treat severe cases of asthma and to reduce inflammation of the brain due to head injury, stroke, or a brain tumor. Occasionally, dexamethasone is injected into an inflamed joint to ease pain and stiffness caused, for example, by osteoarthritis. POSSIBLE ADVERSE EFFECTS

Taken as a nasal spray or in eye-drop form, minor local side effects, such as a nosebleed or eye irritation, may occur. When prescribed as a tablet, either for a prolonged period or in high doses, adverse effects common to other corticosteroids may occur.

Dextroamphetamine A central nervous system stimulant (see Stimulants). Dextroamphetamine is prescribed for narcolepsy (a rare condition characterized by excessive sleepiness) . Paradoxically, it is also used to treat children with hyperactivity, although the reason it helps in this condition is not known. Dextroamphetamine is no longer recommended as an appetite suppressant for people who are attempting to lose weight. ABUSE

Because of its stimulant properties, dextroamphetamine has become a drug of abuse. It is one of a group of

DIABETES MELLITUS

drugs commonly referred to as "uppers." If use is prolonged, the stimulant effects lessen and a higher dose must be taken to produce the desired effect. In an overdose, dextroamphetamine can cause seizures and hypertension.

Dextrocardia A rare condition, present from birth, in which the heart is situated in, and points toward, the right-hand side of the chest instead of the left. The heart may also, but not necessarily, be malformed . Sometimes, the position of the abdominal organs is also reversed, so that the liver is on the lefthand side and the stomach on the right. When all organs are on the opposite side of the body from where they are customarily found, it is known as situs i11vers11s. The cause of dextrocardia is unknown. No treatment is necessary unless the heart is malformed, in which case surgery may be necessary (see Heart disease, congenital).

Diabetes insipidus A rare condition characterized by the passing of enormous quantities of dilute urine (polyuria) and excessive thirst (polydipsia). These symptoms also occur, in a milder form, early in diabetes mellitus, a much more common disease that in all other respects is different from diabetes insipidus. CAUSES

Diabetes insipidus usually results from a failure of the pituitary gland to secrete antidiuretic hormone (ADH). Normally, this hormone diminishes the amount of water passed by the kidneys into the urine to maintain a constant dilution of the blood . Diseases of the pituitary, including damage from injury or a tumor, can cause failure of secretion. In rare cases, the disease (called nephrogenic diabetes insipidus) is due to failure of the kidneys to respond to normal levels of AOH. This type is usually congenital (present from birth), but may result from a kidney disease called pyelonephritis. SYMPTOMS, DIAGNOSIS, ANO TREATMENT

~ Abnormal position

Normal position

Heart positions In dextrocardia. the heart is situated in, and points toward , the right-hand side of the chest instead of the left

Dextrose Another name for glucose, one of the monosaccharide sugars. Dextrose is absorbed from digested carbohydrates through the intestinal wall into the bloodstream. It is also available in the form of tablets, as an injection used in the emergency treatment of hypoglycemia (low blood sugar), and as a component of feedings given by infusion (see Feeding, artificial).

Diabetes, bronze Another name for hemochromatosis, a rare disease in which excessive amounts of iron are deposited in tissues such as the liver, pancreas, and skin. Its name comes from the bronze skin coloration and diabetes mellitus that usually develop in people who suffer from this disorder.

A person with diabetes insipidus may pass between 10 and 40 pints of urine every 24 hours-provided this output is matched by a similar intake of water. If water is unobtainable or withheld, the signs and symptoms of dehydration will appear, leading to confusion, stupor, and coma. Treatment is normally by administration of a synthetic variety of antidiuretic hormone. This, however, is ineffective in treating people with the nephrogenic variety of the disease. These people must be placed on a low-sodium diet and treated with a drug that slows the development of thirst symptoms.

Diabetes mellitus A disorder in which the pancreas produces insufficient or no insulin, the hormone responsible for the absorption of glucose into cells for their energy needs and into the liver and fat cells for storage. As a result, the level of glucose in the blood becomes abnormally high, causing excessive urination and constant thirst and hunger. The body's inability to store or use glucose causes weight loss and fatigue. Diabetes mellitus also results in disordered lipid metabolism and accelerated degeneration of small blood vessels. Apart from the symptoms of thirst and excessive urination, the disease has nothing in common with the much rarer disorder diabetes insipidus.

There are two main types of diabetes mellitus. Insulin-dependent (type l) diabetes, the more severe form, usually first appears in people under the age of 35 and most commonly in people between the ages of 10 and 16. It develops rapidly. The insulin-secreting cells in the pancreas are destroyed, probably as a result of an immune response after a virus infection, and insulin production ceases almost completely. Without regular injections of insulin, the sufferer lapses into a coma and dies. The other main type, non-insulindependent (type II) diabetes, is usually of gradual onset and occurs mainly in people over 40. In many cases it is discovered only during a routine medical examination. Insulin is produced, but not enough to meet the body's needs, especially when the person is overweight. Often the body is resistant to the effects of insulin. ln most cases, insulin-replacement injections are not required; the combination of dietary measures, weight reduction, and oral medication keeps the condition under control. CAUSES ANO INCIDENCE

Diabetes mellitus tends to run in families. However, of those who inherit the genes responsible for the insulin-dependent form, only a very small proportion eventually develop the disease. In these cases the disorder possibly occurs as the delayed result of a viral infection that had damaged the pancreas several years earlier. In the case of non-insulin-dependent diabetes, the greater proportion of people predisposed to the disease by heredity (primarily those who are overweight) go on to acquire it. Although obesity is the primary cause of unmasking latent diabetes, other causes that can unmask or aggravate diabetes are certain illnesses (among them pancreatitis and tlzyrotoxicosis), certain drugs (including some corticosteroids and some diuretics), infections, and pregnancy (see

Diabetic pregnancy). In the US about two persons per 1,000 have insulin-dependent diabetes by the age of 20; overall, the insulindependent form affects about 150 to 200 persons per 100,000. Non-insulindependent diabetes is more common, with as many as 2,000 persons per 100,000 affected. DIAGNOSIS

A physician who suspects diabetes in a patient can often obtain confirmation from testing a sample of urine for its glucose level. Further confirmation

349

D

DIABETES MELLITUS

LIVING WITH DIABETES MELLITUS

D

As the level of glucose in the blood rises, the volume of urine required to carry it out of the body is increased, causing not only a continuous need to urinate but also constant thirst. The high levels of sugar in the blood and urine impair the body's ability to fight infection, leading to urinary tract infections (such as cystitis and pyelonephritis) , vaginal yeast infections (candidiasis) , and recurrent skin infections. Because the body's cells are starved of glucose, the sufferer feels weak and fatigued . The cells are able to obtain some energy from the breakdown of stored fat, resulting in weight loss. However, the chemical processes involved in this breakdown of fat are defective (especially in insulin-dependent diabetics), leading to the production of acids and substances called ketones, which can cause coma and sometimes death. Other possible symptoms of undiagnosed diabetes include blurred vision , boils, increased appetite , and tingling and numbness in the hands and feet. Symptoms develop in all untreated insulin-dependent diabetics , but symptoms develop in only one third of those with the non-insulin-dependent type . There are many people suffering from a mild form of the disease who are unaware of it. The disease often is diagnosed only after complications of the diabetes have been detected.

is secured when significantly high glucose levels are obtained from blood samples following an overnight fast or from samples taken two hours after a meal. Glucose-tolerance tests are not usually required . TREATMENT

The aims of treatment are to prolong life, relieve symptoms, and prevent long-term complications. Success depends on keeping the level of blood glucose as near normal as possible through maintenance of normal weight, regular physical activity, and careful dietary management. In people with insulin-dependent diabetes, treatment consists of regular self-injections, one to four times a day, with insulin (either obtained from ani350

.,...P'+.-.---- Fatigue Blurred

,. -------Constant ------------ th1 rst

Muscle weakness

_

Testing urine for glucose Urine can be tested for glucose by means of a chemically impregnated strip dipped into a sample of urine . The resulting color change in the strip is compared with a chart to indicate the glucose level.

Pyelonephritis and continual ,,,___' - _ need to urinate

Cystitis Candidiasis

l

~~~~~~s~nd in hands and feet

Direct testing of blood glucose A pricking device is used to obtain blood, which is spread on a chemically coated strip. The strip is inserted into an instrument that reads the blood glucose.

DEVICES FOR INJECTING INSULIN

Insulin can be injected using a disposable syringe and needle or a pen with refill cartridges (below), or it may be infused continuously from a portable pump (right) .

'}

Spare needles .

Cannula Refill cartridge

LI J I.. _... JD~ Insulin pen

Portable pump

This device is useful if multiple daily injections are needed .

The pump infuses insulin via a cannula inserted through the skin .

mals or of a human type synthesized by genetic engineering). In addition, the person must follow a diet in which carbohydrate intake is regulated and spread out over the day according to a consistent timetable. In this way, marked fluctuations in the glucose levels in the blood can be avoided. Disturbances in the careful balance between insulin and glucose intake can result in hyperglycemia (too much glucose in the blood), causing the symptoms of the untreated disease, or hypoglycemia (too little glucose), which can lead to weakness, confusion, dizziness, sweating, and even unconsciousness and seizures. To help prevent this, diabetics (of both types) are advised to regularly moni-

tor their blood and urine glucose levels with do-it-yourself testing kits. For difficult-to-control diabetes, an insulin pump is an alternative treatment for those who are willing to monitor their blood glucose levels carefully. Insulin is continuously infused from a refillable pump through a needle implanted in the skin. Control is often no better than that for multiple daily injections. As a precaution against an attack of hypoglycemia, insulin-dependent diabetics need to carry some sugar or glucose with them at all times. Because of the disabling effects of hypoglycemia, insulin-dependent diabetics who drive must declare their disorder to insurance companies and

DIAGNOSIS

car-licensing authorities. Those with poorly controlled insulin-dependent diabetes are sometimes advised against doing jobs that involve working at a height or operating a public conveyance, and against engaging in activities like race-car driving or flying, where they may be a danger to themselves and others. Because the pancreas does produce some insulin in non-insulin-dependent diabetics, the disorder can often be controlled by dietary means alone (regulating the carbohydrate intake with meals spaced out over the day). This not only lowers the blood glucose level, but also reduces weight. If diet fails to lower the glucose Ievel sufficiently, hypoglycemic tablets (oral antidiabetic drugs that stimulate the pancreas to produce more insulin) may be prescribed, though these are ineffective unless dietary restrictions are observed. All people with mild diabetes need regular advice from their physicians so that any complications can be detected and treated at an early stage. Diabetics should wear or carry information identifying them as diabetics in case of an emergency. COMPLICATIONS

Complications eventually develop in a large number of diabetics. These complications tend to be more likely if the diabetes has not been well controlled, but they can occur even if there has been good control. Complications include retinopathy (damage to the retina, the light-sensitive area at the back of the eye, and the blood vessels serving it), peripheral neuropathy (damage to nerve fibers), and nephropathy (kidney damage). Ulcers on the feet, which in severe cases can develop into gangrene, are another risk, but with good foot care they can usually be prevented. Diabetics also have a higher-thanaverage risk of atherosclerosis (narrowing of the arteries), hypertension (high blood pressure), other cardiovascular disorders, and cataracts (opacities of the lens of the eye). There are, however, people who have lived full and active lives with diabetes mellitus for 50 years or more with few complications. OUTLOOK

With modern treatment and sensible self-monitoring, almost all diabetics can look forward to a normal life. The life expectancy of people who have well-regulated, insulin-dependent diabetes is little different than that of nondiabetics. Those with the non-

insulin-dependent illness have a slightly reduced life expectancy because of circulatory and heart disorders, which often are present when the diabetes is diagnosed.

Diabetic pregnancy A small number of women acquire diabetes mel/itus during pregnancy-a phenomenon called gestational diabetes. Diabetes mellitus may also have been present and under treatment before pregnancy. In both cases, special precautions are necessary. PREEXISTING DIABETES

Nearly all women with established diabetes mellitus can have a normal pregnancy, provided the diabetes is well controlled throughout. It is important to plan the pregnancy and to make sure that the blood glucose level is under particularly good control before and at the time of conception; otherwise there is a slightly increased chance of the baby being malformed. If control is poor during the pregnancy, there may be an increase in the amount of glucose reaching the baby (which makes the baby grow faster than normal) and this may cause difficulties at birth. Also, the growth of infants of diabetic mothers may be stunted; these babies may have complications in the days immediately after birth. GESTATIONAL DIABETES

Gestational diabetes is most often detected in the second half of pregnancy, when increased glucose appears in the urine or the baby is found to be bigger than expected when a physician examines the mother's abdomen (though these findings do not always mean the mother is diabetic). Apparently, not enough insulin is produced to keep the blood glucose fevels normal during the pregnancy. Obstetricians now screen for diabetes at 26 weeks. Gestational diabetes usually disappears with the delivery of the baby, but can be a sign of future diabetes in up to three fourths of these mothers. CARE

When feasible, diabetic pregnancies are treated at high-risk obstetrical centers (many of which offer prepregnancy clinics for those witn established diabetes to help achieve good control before conception) and at antenatal clinics to supervise all aspects of the pregnancy. The chances that the baby of a diabetic parent will become diabetic are about one in 100 and, if both parents are diabetic, about one in 20. If

only the father is diabetic, no special precautions need to be taken at conception or during the pregnancy.

Diacetylmorphine A synthetic drug similar to morphine, usually referred to by its popular name, heroin.

D

Diagnosis The determination by a physician of the cause of a persons problem. Usually this entails identifying both the disease process--pneumonia or cirrhosis of the liver, for exampleand the agent responsible, such as pneumonia due to legionnaires' disease, or cirrhosis due to alcohol. Diagnosis is part science and part art; an experienced physician relies not only on his or her scientific knowledge and experience, but also on intuition to recognize the pattern of an illness and establish a diagnosis. THE MEDICAL HISTORY

The patient's own account of his or her illness is perhaps the most important part of the diagnostic procedure. This history provides vital clues, which can then be augmented by questions from the physician in an exchange that may last some 20 to 30 minutes in a complex case or if the physician has not previously seen the patient. What the physician is looking for is a pattern of symptoms that is strongly suggestive of a single disease. For example, the features of a migraine headache, duodenal ulcer, enlarged prostate gland, or angina pectoris are often unmistakable. In some circumstances the physician may not attempt to reach a final diagnosis. If a patient has had only a sore throat for 48 hours, the physician may be content to treat the condition symptomatically, attempting to relieve the symptoms while awaiting the results of a throat culture or other laboratory tests. However, when symptoms have been more prolonged, the physician will want to reach at least a provisional diagnosis before beginning treatment, partly because any treatment is likely to affect the symptoms and thus make diagnosis more difficult. EXAMINATION AND TESTS

Tests may be ordered after a physical examination and the formation of a provisional diagnosis. However, confirmation is obtained in a variety of ways, including tissue biopsy, culture of microorganisms, or finding the cause at surgery. If specific treatment (either with drugs or by 351

DIAGNOSIS-RELATED GROUP

Diagnosis-related group

STEPS IN DIAGNOSING A CONDITION A physician may go through several steps to ascertain the cause of a person 's problem. The history, physical examination , and tests may provide vital clues . A physician usually makes at least a

D

provisional diagnosis before beginning any treatment because treatment can mask symptoms, making the physician 's job of estab lishing an exact diagnosis more difficult.

Taking the medical history

Perhaps the most important part of the diagnostic procedure is the patient's own account of his or her illness - the medical history, "Listen to the patients. they are telling you their diagnosis" is the traditional teaching given to medical students. Many physicians

believe that the medical history provides the strongest basis for ascertaining a diagnosis. The added information derived from the physical examination is small, but at times, critical.

Conducting a physical examination

After the medical history has been obtained, the physician has in mind a short list of probable diagnoses . A physical examination helps shorten the list. The physician is then left with a differential diagnosis. A differential diagnosis is a group of possible diseases

that could account for the patterns of symptoms and signs (ie. , physical findings, such as enlargements of lymph glands or tenderness in a specific region of the abdomen).

Next, based on his or her working diagnosis, the physician may order a series of laboratory tests on the blood (and sometimes the urine) and may also arrange for diagnostic imaging of suspect organs by techniques such as ultrasound scanning, X rays,

CT scanning, MRI, or radionuclide scanning . The results of these tests either confirm the physician 's working diagnosis or narrow the possibilities so the physician may be confident that he or she has found the correct diagnosis.

Physicians today also use computer systems and algorithms to help reach a diagnosis. Both approaches rely on analysis of large numbers of patient records to quantify probabilities and to devise an orderly series of questions - a decision tree. The main purpose of computer assistance is to

remind the physician of the full range of possible diagnoses for a particular set of symptoms, thereby making it less likely that any possibility will be overlooked . It remains the task of the physician to integrate the facts and decide upon a diagnosis.

Using a computer

352

Dialysis A technique used to remove waste products from the blood and excess fluid from the body as a treatment for rennl failure (kidney failure). WHY IT IS DONE

Ordering special tests

surgery) relieves the symptoms and cures the patient, the diagnosis is likely to have been correct-although it is also possible that the patient may have recovered spontaneously and the treatment may simply have coin-

A system of payment tor medical service to patients getting care from certain provider organizations and to Medicare patients. The system was established by amendments to the Social Security Act in 1983. Under the diagnosis-related group (DRG) system, hospitalized patients are classified into one of 467 diagnosisrelated groups; hospitals are then reimbursed at a set rate for each of the diagnosis categories. If the costs of a patient's care exceed the fixed rate, the hospital must absorb the cost. But, if the hospital's costs are less than the set rate, it may retain the difference. By determining costs prospectively, hospitals presumably have an incentive to manage patient care efficiently. Under the former system of retrospective payments, hospitals had fittle incentive to monitor costs.

cided with the time of recovery. Alternatively, if the patient dies, a pathologist can usually, but not always, determine by postmortem examination (see Autopsy) what the disease process had been.

The main function of the kidneys is the maintenance of electro/1/te and water balance and the excretion of waste products. Fully one fifth of the blood pumped by the heart goes to the kidneys; tne kidneys filter approximately 150 liters of blood daily. From this volume of blood, the kidney reabsorbs important elements, such as sodium, potassium, calcium, amino acids, glucose, and water. The kidneys excrete, as urine, the protein breakdown product nitrogen in the form of urea, as well as other excess minerals, toxins, and drugs. In people whose kidneys have been damaged, this process mar faileither suddenly (in acute rena failure) or gradually (in the chronic form of the disease). Wastes start to accumulate in the blood, with harmful, sometimes life-threatening effects. In severe cases, the function of the kidneys must be taken over by the artificial means of dialysis. In cases of acute kidney failure, dialysis continues until the kidneys recover and start functioning normally again. However,in chronic kidney failure, patients may need to undergo dialysis for the rest of their lives or until they can be given a kidney trnnsplnnt. Dialysis therapy may not always be chosen by the patient and physician when kidney failure is simply a part of an otherwise rapidly fatal disorder.

DIALYSIS

PROCEDURE FOR DIALYSIS There are two methods of removing wastes from the blood and excess fluid from the body when the kidneys have fai led . The first , hemodialysis, may also be used as emergency treatment in some cases of poisoning or drug overdose. It makes use of an artificial kidney (or "kidney machine ") and can be carried out at home. Peritoneal dialysis, also done in the home, requires an abdominal incision (wh ich is done in the hospital) .

HOW HEMODIAL YSIS IS DONE

1

Access to the bloodstream for rapid removal and return of blood is obtained by a shunt connecting an artery to a vein. needle con2 Anected to plastic tubing passes blood to the artificial kidney and back to the patient. The artificial kidney consists of many layers of special membrane.

Vein

Artery

Shunt sewn into blood vessel

WHY IT IS DONE In people with damaged kidneys, the process of maintaining the balance of electrolytes and water, and of excreting waste products, may fai l, causing harmfu l, if not life-threatening , effects. Dialysis can take over the function of the kidneys until they start working normall y again . Or dialysis can function for the kidneys fo r the rest of a seriously affected person's life if a kidney transplant is not performed . Diseased kidney The kidney at right was removed from a person with adult polycystic kidney disease- one of many d isorders that may damage kidney function to the extent that dialysis is needed .

membrane 3 The separates the

Blood out of Yr~- - - dialyzer

patient's blood from a special fluid called dialysate . Wastes, toxic molecules, and excess fluid pass from the blood into the dialysate .

Machine that prepares dialysate

Artificial 1--,,,"'=:,.f+c.;..+I- membrane

"'-''-=--'-"lillL.!..-:"--.L.....__,._...,

Blood into dialyzer _ __ _ __ Dialysate to and from dialyzer _ _ _ __

dialysate is 4 The discarded and the purified blood is returned to the patient. Each session lasts two to six hours.

HOW PERITONEAL DIAL VSIS IS DONE

Blood cell

1

A small abdominal incision is made (us ing a local anesthetic); a catheter 1s inserted through it into the peritoneal cavity. Dialysate from a bag attached to the catheter passes into the cavity, where it is left for several hours. Spinal column - --ITTrllTTTP;;Tr,7T:n==:;i,pnr7 Fluid

Peritoneal membrane

Capillary wall

bag is 3 dTheiscarded and replaced with a bag containing fresh dialysate . The process, which takes about an hour , is repeated during the day or overnight.

products and excess 2 Waste water from the blood vessels lining the peritoneal cavity seep through the peritoneal membrane into the cavity and mix with the dialysate. The fluid is then allowed to drain out (by the release of a clamp) through the catheter and into the empty dialysate bag .

353

DIAPER RASH

Cloth diapers should be well rinsed and kept soft. Sometimes an ointment containing a mild corticosteroid drug needs to be prescribed to suppress the inflammation. It is often prescribed in combination with an antifungal drug to kill any thrush organisms that are present (see Candidiasis).

HOW IT IS DONE

D

There are two methods of dialysis. Hemodialysis, which removes wastes by passing blood through an artificial kidney machine, was pioneered early in the 1940s. Peritoneal dialysis, which makes use of a natural filtering membrane within the body's abdomen, was developed in theearly1970s. In most cases, hemodialysis is performed in outpatient dialysis centers by trained staff nurses, but, in the US, 5 percent of patients undergoing dialysis carry it out themselves with a kidney machine installed in the home. Peritoneal dialysis may be performed in a hospital, but an increasing number of patients are now able, once the catheter has been inserted into the abdomen, to carry out the dialysis themselves at home, a procedure known as continuous ambulatory peritoneal dialysis. For patients with chronic kidney failure, hemodialysis needs to be carried out several times a week. In the treatment of acute kidney failure, the process is carried out more intensively over a period of days or weeks until the kidneys are working normally again. Complications of hemodialysis may include weakening of the bones (see Osteomalacia; Osteodystrophy), anemia, infections, and pericarditis. Complications of peritoneal dialysis are the same as for hemodialysis along with peritonitis. OUTLOOK

Long-term dialysis enables /eople who would once have die from chronic kidney failure to live relatively normal lives. Their diet and fluid intake must be restricted somewhat and they may not feel completely well. However, many do return to full or part-time employment. Since the patient's health is invariably affected in the long run, many physicians feel that dialysis should be replaced with a kidney transplant, which, if successful, can bring about a drama tic restoration of general health.

Diaper rash A common condition affecting babies with otherwise healthy skin. Diaper rash results from skin irritation by substances contained in the feces or urine. Friction from roug h diapers and prolonged wetting also play a part. Babies vary in their su sceptibility to ~iaper r~sh .. Occasionally, skin mffammahon 1s severe. In some babies, diaper rash may be the first indication of sensitive skin and future skin problems, such as eczema. 354

Diaphragm, contraceptive

Symptoms of diaper rash The skin over the buttocks, genitals , and inner thig hs becomes red and sore at fi rst, and may progress to bli stering . TREATMENT AND OUTLOOK

Prevention is better than cure. The aim is to keep the baby's skin dry for as long as possible. A newborn breastfed baby passes urine about 20 times each day and has a bowel movement after each feeding, so this presents a major practical problem. Change diapers frequently and, after each change, apply a water-repellent emollient. Ideally, the diaper should be left off for an hour or so each day.

The most commonly used female barrier method of contraception, in the form of a hemispherical dome of thin rubber with a coiled metal spring in the rim. The diaphragm is individually fitted to each woman. (See

Contraception, barrier methods.)

Diaphragm muscle The dome-shaped sheet of muscle that separates the thorax (chest) from the abdomen. The diaphragm is attached to the spine, ribs, and sternum. The diaphragm plays a vital role in breathing. For air to be drawn into the lungs, fhe muscle fibers of the diaphragm contract, thereby pulling the central tendon downward. This action enlarges the chest, and air passes into the lungs to fill the increased space. (See also Breathing.)

ANATOMY OF THE DIAPHRAGM The diaphragm is attached to the spine, the lower pairs of ribs, and the lower end of the sternum (breastbone) . The muscle fibers of the diaphragm converge on the central tendon, a thick, flat plate of dense fibers. There are openings in the diaphragm for the esophagus , phrenic nerve (which controls diaphragm movements and hence breathing) , and the aorta and vena cava blood vessels .

A

Thorax Rib _ __

_

;_:_:::.....~'-?&\-- - - Outline Attachment of diaphragm to rib cage and sternum _ _

of lung

/:JJ0 t:o/;S.::::;:;::::,,--7i

Inferior vena cava - ---Hk-"'~=o=:;.L,rK,

-""':~

L_L / NY¾''/) ~ -

~ ~~-kt-

N\.4',;~t;,1-----

- - - Central tendo n

-

-

Phrenic nerve

""-.,- ~ - -- Cut edge o f diaphragm

Spine _ _ _ _ _ _ __

_

Abdo m en

DIAPHRAGM MUSCLE

DIARRHEA Frequent passing of unusually loose bowel movements.

YES

Have you had other attacks of diarrhea during the past few weeks?

NO

r-

I I I

-----,

WARNING A child who has diarrhea may be seriously ill if he or she has any one of the following danger signs: continuous abdominal pain for six hours or more repeated vomiting for more than 12 hours • refusal to drink sunken eyes abnormal drowsiness passing no urine for six hours or more Call your physician now!

I •

I • I

I •

I • I •

■ ■

Stress can often cause diarrhea. However, if you also have bouts of cramping abdominal pain and constipation or alternating constipation and diarrhea, consult your physician.

■ ■ ■

See • Anxiety • Diverticular disease • Intestine, cancer of • Irritable bowel syndrome



I I

I

Have you been having bouts of lower abdominal pain?

I I I I

YES

D

See • Abdominal pain



NO

I



I I

Consult your physician without delay! · · · · · · · • go Apersistent change in bowel habit

I _____ .J

I L-

YES

NO



I

Do the attacks occur when you are under emotional stress?

should always be investigated to rule out the slight possibility of cancer. See • Intestine, cancer of

■ ■

YES

go Consult your physician without delay! Raw, inflamed areas may have developed along the intestines or at the anus. Bloody diarrhea may also be due to infection. This is especially likely if you have recently returned from abroad; dysentery may be a possibility.



NO ■ ■ ■ ■ ■ ■

See • Dysentery • Hemorrhoids • Ulcerative colitis

Have you felt sick or been vomiting AND/OR is your temperature 100"F (38'C) or above?

YES

Inflammation of the digestive tract as a result of infection or food poisoning is probable. Consult your physician. See • Gastroenteritis



NO ■

Have you recently started to take any medicines?

YES

Sensitivity to certain drugs and food may cause diarrhea. If you are taking drugs or feel that food may be causing your problems, consult your physician.



NO

Continued on next page

355

DIARRHEA

Have you eaten anything in the past 24 hours that might have gone bad OR to which you may be allergic?

D

YES

You may have food poisoning , especially if others who shared the meal with you have the same symptoms. See • Food poisoning



NO

If you are unable to make a diagnosis from this chart and your diarrhea persists for more than 48 hours or recurs, consult your physician.

Diarrhea Increased fluidity, frequency, or volume of bowel movements, as compared to the usual pattern for a particular person. Diarrhea itself is not a disorder but is a symptom of an underlying problem. Acute cfiarrhea affects almost everybody from time to time- usually as the result of eating contaminated food or drinking contaminated water. These attacks normally clear up within a day or two with or without treatment. Chronic diarrhea may be due to a serious intestinal disorder and requires investigation by a physician. Diarrhea in infants is generally more serious than diarrhea in adults because it is more likely to cause severe, even potentially fatal, dehydration. However, elderly people also do not tolerate diarrhea well, and possible dehydration must be anticipated and treated immediately. DIARRHEA IN ADULTS

In normal bowel activity the colon (large intestine) absorbs much of the water from the food residues (in liquid form) that pass through it, producing semisolid feces . If the intestinal contents pass through the colon too quickly, or if the small intestine is inflamed and secretes fluid into the fecal material, diarrhea may result. CAUSES

Acute diarrhea starts abruptly and usually lasts from a few hours to two or three days. The most common cause is food poisoning. Diarrhea that starts within six hours of eating usually indicates that the food has been contaminated by toxins from STAPHYLOCOCCUS or CLOSTRIDIUM bac-

356

Persistent diarrhea If your diarrhea is severe, you may lose a dangerous amount of body fluid. Drink plenty of fluids and oonsult your physician without delay. See • Rehydration therapy

teria. If diarrhea develops 12 to 48 hours after eating, it is probably due to contamination by bacteria such as SALMONELLA or CAMPYLOBACTER, or by a virus such as the rota virus or Norwalk virus. Infective gastroenteritis may also be acquired as a result of droplet infection, with adenoviruses or echoviruses, for example. Acute diarrhea may be caused by interference with the intestinal flora (harmless bacteria in the intestine) as a result of travel to a country where these bacteria are of a different type. Other causes of acute diarrhea include anxiety and, less commonly, slzigellosis, typhoid and paratyphoid, drug toxicity, food allergy, and food intoferance. In the case of shigellosis and amebic dysentery, there may be blood in the feces . Chronic diarrhea generally takes the form of repeated attacks of acute diarrhea. Causes include Crolzn 's

disease, ulcerative colitis, diverticular disease, cancer of the large intestine (see Intestine, cancer of), thyrotoxicosis, and irritable bowel syndrome. In all of these conditions, except thyrotoxicosis and irritable bowel syndrome, there may be blood in the bowel movements. TREATMENT

The water and electrolytes (salts) lost during a severe attack of diarrhea need to be replaced to prevent dehydration. An effective means of doing this is to drink water to which salt and sugar have been added. To make up such an oral rehydration solution, dissolve one teaspoon of salt and four teaspoon s of sugar (which helps the intestine absorb the water

and salt) in one quart (0. 95 liter) of water. It is important to be accurate with the measurements as too much salt may cause further dehydration. Alternatively, it is possible to buy ready-prepared electrolyte mixtures that also contain small amounts of potassium replacement that need only to bt added to a specific amount of water. A pint of the oral rehydration liquid should be drunk every hour, and no solid food eaten, until the diarrhea subsides. Antidiarrlzea/ drugs should not be taken to treat attacks of diarrhea resulting from infection because they may prolong the illness. Diarrhea that recurs, persists for more than a week, or is accompanied by blood in the bowel movements requires investigation to discover the underlying cause. In addition to taking the patient's case history, the physician will probably arrange for a stool culture to determine whether or not infection is the underlying cause. If it is not, other tests may be carried out, such as a barium enema or meal (see Barium X-ray examinations), sigmoidoscopy, and a biopsy of the rectum. These tests enable the physician to discover the underlying cause; treatment will be for that cause. DIARRHEA IN INFANTS

Most cases of diarrhea in infants are of the acute form , which carries the risk of rapid dehydration (especially when accompanied by vomiting); it can be fatal unless countered quickly. CAUSES

The most common cause is gastroenteritis resulting from a viral infection. Babies who are entirely breast-fed are

DIET AND DISEASE

less likely to contract the illness than those who have been bottle-fed . Viral gastroenteritis can damage the lining of the small intestine, thereby impairing its ability to absorb nutrients, and can cause a temporary deficiency of the enzyme lactase. The latter may lead to lactose intolerance (inability to absorb sugar from milk), which may produce secondary diarrhea that can last for several weeks. TREATMENT

An infant who shows signs of dehydration (drowsiness, unresponsiveness, prolonged crying, loose skin, glazed eyes, a depressed fontanelle at the front of the head, and a dry, sticky mouth and tongue) needs urgent medical attention. In other cases, the baby should not be fed milk, and an electrolyte mixture (obtainable from a pharmacist) should be given to replace lost water and salts. lf the diarrhea persists for more than 48 hours, a physician should be consulted. However, if the diarrhea clears up within this period, milk can be gradually reintroduced over a 24-hour period . The first feeding should consist of one part milk to three parts water, the second of equal parts of milk and water, the third of three parts milk to one part water, and the fourth of undiluted milk.

Diastole The resting period of the heart muscle; it alternates with the period of muscular contraction (systole).

Diathermy The production of heat in a part of the body using high-frequency electric currents, microwaves, or ultrasound. The heat generated can be used to increase blood flow and to reduce deep-seated pain in rheumatic and arthritic conditions. By using large currents, enough heat can be produced to bloodlessly destroy tumors and diseased parts. A diathermy knife is used by surgeons to coagulate bleeding vessels or to separate tissues without causing them to bleed (see Electrocoagulation).

Diathesis A condition of the body that makes the tissues react in a specific way to an outside stimulus. For example, a bleeding diathesis is present when a bleeding disorder (such as hemophilia) makes a person susceptible to prolonged bfeeding after an injury . A diathesis may be inherited or acquired as a result of an illness.

Diazepam

Dicyclomine

BENZODIAZEPINE ANTICONVULSANT MUSCLE RELAXANT

~~ /✓ /

i.l ~ Rlu .1"5

Tablet Capsule Injection Rectal suppository

!!iJ

Prescription needed

~ Available as generic

One of the best known and most widely used benzodiazepine drugs. Diazepam is used mainly to treat anxiety and insomnia . It is also prescribed as a muscle-relaxant drug (for example, to treat spasm of the back muscfes), and as an anticonv11lsa11t drug in the emergency treatment of epileptic seizures. Diazepam is also commonly used to treat the symptoms of alcohol withdrawal. POSSIBLE ADVERSE EFFECTS

Diazepam may cause drowsiness, dizziness, and confusion; driving and hazardous work should therefore be avoided. Alcohol increases the sedative effect of diazepam and should therefore be avoided during treatment with this drug. Like other drugs in this group, diazepam can be habit-forming if taken regularly, and its effect may diminish with prolonged use. Individuals who have taken diazepam regularly for more than two weeks should never stop their treatment suddenly. Instead, they should gradually decrease the dose under medical supervision to avoid withdrawal symptoms. Withdrawal symptoms include severe anxiety, sweating, and, in rare circumstances following large doses, seizures.

Dicumarol An anticoagulant drug used to treat venous thrombosis and pulmonary embolism (blood clot in the lungs). It is also prescribed to prevent formation of an embolism in patients with a heart valve disorder or arrhythmia (irregular heart beat), or after heart surgery. Dicumarol takes three to five days to have its full effect; a faster acting anticoagulant, such as heparin, is usually also given during the first few days of treatment. Frequent blood-clotting tests (prothrombin times) are usually given during treatment with dicumarol. POSSIBLE ADVERSE EFFECTS

Adverse effects include flatulence, diarrhea, nausea, and, occasionally, bleeding in some part of the body, which may produce a nosebleed, bruising, or hematuria.

An antispasmodic drug used to relieve abdominal pain in irritable bowel syndrome and infantile colic. It is also used in the treatment of urinary incontinence caused by irritable bladder. Dicyclomine may cause dry mouth, blurred vision, and constipation.

Dideoxycytidine Originally developed for use as an anticancer drug, dideoxycytidine (DOC) has been found to slow the multiplication of the HIV virus and is currently under investigation as a treatment for AIDS.

Dienestrol An estrogen drug used as a cream to treat atrophic vaginitis (dryness of the vagina), which commonly occurs after the menopause.

Diet See Nutrition.

Diet and disease Until comparatively recently, medical concern about diet in Western countries was focused on dietary deficiencies in the poor. Today, however, deficiency diseases are very rare in developed countries (except in alcoholics, in people with malabsorptive intestinal disorders, and in people on extremely restricted diets) but are a major problem in many developing countries. In these countries, starvation or malnutrition may result in 111arasm11s or J..washiorkor. Specific vitamin deficiencies in childhood may cause rickets or blindness due to keratomalacia; lack of certain vitamins in adult life may lead to beriberi, pellagra, or scurvy. In the West, the pendulum has swung the other way, and many common disorders are due partly to overconsumption of certain types of food. FATS

Virtually all people in developed countries have some degree of atherosclerosis (narrowing of arteries by deposits of fatty material), which can lead to cardiovascular diseases (such as coronary heart disease, stroke, and peripheral vascular disease). Most nutritionists believe that a major cause of atherosclerosis is a high level of the chemical cholesterol in the blood due to a high intake of saturated fats, which are found in meat, eggs, and dairy products. The disease is much less common in countries (such as Japan) in which fat in the diet is minimal and mostly polyunsaturated.

357

D

DIET AND DISEASE

esophagus and liver (see Liver cancer), and research groups are examining many other associations. FOOD ALLERGIES

f_D

us

France

Africa

South China

Finland

World dietary habits and disease In the US, bowel cancer may be more common because of high fat , low fiber consumption; dental caries are caused by high sugar intake. Coronary heart disease is common among Finns because of their fatty diets;

CALORIES

Obesity places a person at greater risk of acquiring serious disorders, such as diabetes mellitus, coronary heart disease, stroke, and osteoarthritis. Americans are among the most overweight of populations; the cause is simply an excess intake of calories (units of energy), mostly in the form of refined carbohydrates (such as arc found in white bread, cakes, cookies, candy, and soft drinks), fatty meat and meat f.roducts, dairy products, and alcoho. ALCOHOL

Apart from causing obesity, overconsumption of alcohol can lead to cirrhosis of the liver, brain damage (see Wernicke-Korsakoff syndrome), peripheral neuritis, anct cardiomyopathy, and has been linked with pancreatitis, esophageal cancer (see Esophagus, cancer of), and many other disorders. FIBER

The part played by diet in digestive disorders is less clear than the part played by diet in cardiovascular disease or obesity, but there is evidence suggesting that fiber may be an important factor in some illnesses. 358

in France, a certain liquor is blamed for the frequency of esophageal cancer; in South China, certain fungi in food cause esophageal cancer; and in Africa, aflatoxins may cause liver cancer.

Fiber-found in foods such as wholegrain bread and vegetables-provides bulk to enable the large intestine to work effectively and also helps regulate the absorption of nutrients in the small intestine. Lack of dietary fiber has been implicated in intestinal disorders such as divrrticular disease, chronic constipation, and hemorrhoids. SALT

In Western countries, hypertension (high blood pressure) is far more prevalent than in primitive societies. Many nutritionists believe the main reason is the much higher intake of salt in the West. However, it is unlikely that some people would accept the large cut in salt from their diet that would be necessary to have any substantial effect on blood pressure.

It is fashionable to ascribe a great deal of illness to food allergy, but in fact the numbers of people in whom disease can definitely be traced to this factor are small. They include those who suffer from celiac sprue, as the result of an intolerance to gluten, a protein in cereals; some migraine sufferers, in whom foods such as chocolate, cheese, or red wine produce an attack; and people who develop a rash after eating shellfish or soft fruit (see Urticaria). In addition, some attacks of asthma and eczema may be due to an allergy to eggs and dairy products; and an allergy to food additives, such as artificial flavorings and colorings, may be a factor in eczema and irritable bowel syndrome. Some physicians believe that allergy to food additives is a major cause of behavioral disorders, such as hyperactivity in children, but research evidence suggests that this association is rare. Treatment for selfdiagnosed food allergy should always be supervised by a physician. A PRUDENT DIET

Although the connection between certain types of food and disease has not been proved in all cases, enough evidence exists to indicate that it is wise to make sure your diet is low in fats and refined carbohydrates, high in fiber, and free of artificial additives. (See also Nutritional disorders.) GOOD DIETARY HABITS Eat fresh rather than preserved , packaged , or conven ience foods . Eat plenty of vegetables and fruit . When raw or lightly cooked, they retain a higher nutritional value .

Eat whole-grain products including whole-grain bread .

Cut down consumption of red meat, instead, eat fish, poultry, and legumes.

DIET AND CANCER

Comparisons of the patterns of cancer in different countries suggest that diet may be as important a factor as tobacco in the cause of cancers. A high intake of fat (and possibly of meat) has been linked with cancer of the bowel (see Intestines, cancer of) and the breast (see Breast cancer). Moldy foods are known to cause cancer of the

Keep the fat content of your diet low and use polyunsaturated fats and vegetable oils rather than saturated fats.

Cut down on sugar in all foods . When choosing filling foods , eat potatoes in their skins, pasta, or rice.

DIGESTIVE SYSTEM

Dietetics

Diflunisal

The study of nutrition and the application of nutritional science to people both sick and healthy. Dietetics involves not only a detailed knowledge of the composition of foods, the effects of cooking and processing, and dietary requirements, but also psychological aspects, such as eating habits.

A 11onsteroidal a11ti-i11flam111atory drug

Diethylstilbestrol ESTROGEN

~i / ✓ / iJ ~ #'ftl~ O Tablet Injection Vag inal suppository

!i)

Prescription needed

l!fl

Available as generic

A drug that mimics the natural estrogen hormone estradiol; it may be used to replace or supplement estrogen when natural hormone production is abnormal. WHY IT IS USED

Diethylstilbestrol (DES) is used to treat the symptoms of hypogonadism (underdeveloped ovaries), symptoms of the menopause (such as hot flashes and sweating), and atrophic vaginitis (dryness of tfte vagina), which is common after the menopause. DES is sometimes prescribed in high doses as a postcoital contraceptive (see Contraception, postcoital). It is also useful in the treatment of prostate cancer. It was formerly used as a treatment for threatened miscarriage, but this use has been abandoned as a result of evidence that vaginal cancer may develop many years later in daughters of women who took DES. POSSIBLE ADVERSE EFFECTS

Side effects are as for other estrogen drugs. DES should not be taken during pregnancy.

Differentiation The process by which the cells of the early embryo, which are almost identical and have not yet taken on any particular function, gradually diversify to form the distinct tissues and organs of the more developed embryo. In cancer terminology, the word means the degree to which the microscopic appearance of the tissue resembles normal tissue.

Diffusion The spread of a substance (by movement of its molecules) in a fluid from an area of high concentration to one of lower concentration, thus producing a uniform concentration throughout.

(NSAID) used to relieve joint pain and stiffness in osteoarthritis, rheumatoid arthritis, and other types of arthritis. It is also prescribed to treat back pain, sprains, and strains. Occasionally, it is prescribed to ease pain after a minor operation or dental treatment. Diflunisal may cause nausea, indigestion, diarrhea, and a rash.

Digestive system The group of organs that breaks down food into chemical components that the body can absorb and use for energy and for building and repairing cells and tissues. The digestive system consists of the digestive tract (also known as the alimentary tract or alimentary canal) and various associated organs. The digestive tract is basically a tube through which food passes; it consists of the mouth, pharynx (throat), esophagus, stomach, intestines (the small intestine, comprising the duodenum, jejunum, and ileum, and large intestine, comprising the cecum, colon, and rectum), and the anus. The associated digestive organs-such as the salivary glands, liver, and pa11creas--secrete digestive juices that break down food as it passes through the tract. Food and digestion products are moved through the intestine, from the throat to the rectum, by peristalsis (waves of muscular contractions of the intestinal wall). THE DIGESTIVE PROCESS

The human diet is made up of foods consisting of nutrients (vitamins, minerals, carbohydrates, proteins, and fats), residues (mainly vegetable fiber) , and water. Most vitamins and minerals are absorbed into the bloodstream without change. However, before other nutrients can be absorbed, they must be broken down by digestive agents into simpler substances with smaller molecufes. Part of food breakdown is physical, performed by the teeth, which cut and chew food, and the stomach, which chums it. The rest of the process is chemical, performed by the action of enzymes, acids, and salts. Carbohydrates, which are provided mainly by starchy and sugary foods, are the body's principal source of energy. The digestive process eventually converts all carbohydrates to three simple forms of sugar: glucose, fructose, and galactose. Proteins, wftich are found in abundance in meat, fish, eggs, cheese,

peas, beans, and lentils, are essential for the replacement and repair of cells. They are broken down into polypeptides, peptides, and amino acids. Fats (also known as lipids), which are found not only in meat and dairy products, but also in oily plant foods such as peanuts, provide energy and some of the materials for cell building and maintenance. Fats also carry the fat-soluble vitamins A, D, E, and K. When fats are digested by lipases (enzymes that are secreted by the pancreas and intestine), they are broken down into glycerol, glycerides, and fatty acids. The digestive process begins in the mouth, where the teeth chop food and the salivary glands secrete saliva, which lubricates the food and contains enzymes that begin to break down carbohydrates. The mouth also contains sensory nerves in the taste buds on the tongue. The tongue manipulates food in the mouth and forms it into small balls for easy swallowing. From the mouth, food passes into the pharynx, which then pushes it into the esophagus. The esophagus does not contribute to the breakdown or absorption of food products; its sole function is to squeeze food down into the stomach . In the stomach, food is mixed with acids and digestive juices produced in the stomach lining; these help break down proteins. The stomach also breaks down food mechanically by its continual churning action. When the food has been converted to a semiliquid consistency, it passes into the duodenum. The liver produces bile salts and acids, which are stored in the gallbladder and then released into the duodenum. These salts and acids help break down fats. The pancreas also releases digestive juices into the duodenum, and these juices contain enzymes that further break down carboh(drates, fats, and proteins. The fina breakdown stages are completed in the small intestine, carried out by enzymes produced by glands in the lining of the intestine. As the breakdown products of digestion pass through the small intestine, they are absorbed by its thin lining and pass into the bloodstream or the lymphatic system. Finally food passes into the large intestine, where most of the water it contains is absorbed by the lining of the colon. Undigested matter and sloughed lining cells from the digestive tract are then expelled via the rectum and anus as feces.

359

D

DIGESTIVE SYSTEM

THE DIGESTIVE PROCESS

Swallowing

Digestion starts when food enters the mouth. It continues as the food is propelled through the digestive tract by waves of muscular contractions (peristalsis). The digestive process also involves other organs {the · salivary glands, liver, gallbladder, and pancreas), which produce enzymes and acids that help break down the food.

In the inouth. food is cut and ground by the teeth and mixed with saliva. which softens food and breaks down certain carbohydrates . After swallowing. the food mass (bolus) enters the esophagus.

Esophagus-- - - - - - - - - - - - - - - - - - . . .

ACTION OF DIGESTIVE AGENTS

Agent or enzyme (where produced)

Digestive action

Amylase (mouth and pancreas)

Converts starch (a form of carbohydrate) to maltose

Sucrase. maltase. and lactase (pancreas and small intestine)

Break down vegetable and milk sugars into glucose. fructose. and galactose

Hydrochloric acid (stomach) Pepsin (stomach) Trypsin (pancreas) Peptidase (small intestine)

Assist in the breakdown of proteins into polypeptides, peptides. and amino acids

Lipase (pancreas) Bile salts and acids (liver- stored in the gallbladder)

Break down fats into glycerol, glycerides, and fatty acids

TIME SCALE

Food is carried down the esophagus by peristaltic action and enters the stomach.

Stomach-------.... Food is broken down further by churning and by the action of hydrochloric acid and digestive enzymes secreted by the stomach lining. Food remains in the stomach until it is reduced to a semiliquid consistency (chyme), when it passes into the duodenum.

Duodenum---- - --~ As food travels along the duodenum, it is broken down further by digestive enzymes from the liver, gallbladder, and pancreas. The duodenum leads directly into the small intestine.

The approximate period food spends in each part of the digestive system is shown below. Small intestine - - -h=¢1.,,.,,,d---\r----t--

Mouth 1 minute -----::i:,,G,.,.'\\IC Esophagus 3 minutes --r----Water in lungs

Dry drowning

Larynx

Types of drowning In four fifths of deaths due to drowning, the victim has inhaled li quid into his or her lungs In the other fifth , no liquid is present in the lungs (dry drowning). In both cases, death is the result of suffocation .

375

D

I-

DROWNING, DRY FIRST AID AND IBEATMENT

D

If a person is panicking at the surface of the water, he or she should be thrown any large item that will float. Ideally, the person should be approached in a boat and reached. If approached by swimming, an attempt should be made to calm the person before contact is made , otherwise he or she may struggle, possibly causing the rescuer to drown as well. The victim should be supported with the head above water and towed to the nearest boat or shore. An ambulance should be called and the person's medical condition assessed. If breathing and/or the pulse (felt in the neck) is absent, resuscitative measures should be started (see Cardiopulmona ry resuscitation ). They should be continued until an ambulance or physician has arrived. Often, a victim of n ear drowning will make an apparently remarkable recovery after being resu scitated. The person should nevertheless be sent to a hospital for investigation and observation . Water may have passed from the lungs into the blood, and the lining of the lungs may have been damaged. In either case, symptoms may develop some hours after rescue and may be life threatening.

Drowning, dry A form of drowning in which no fluid enters the lungs.

DROWNING:

About one fifth of fatal drowning cases are "dry"- illustrating the fact that d eath from drowning results mainly from lack o f oxygen, whether or not water has entered the lungs (see Drowning). Victims of dry drowning have a particularly s trong laryngeal reflex, which diverts water into the s tomach instead of the lungs, but at the same time impairs breathing.

Drowsiness A state of consciousness between full wakefulness and sleep or unconsciousness. It is m edically significant if it is abnormal. Abnormal drowsiness may be the result of a head injury, high fever, meningitis (inflammation of the membranes that surround the brain and spinal cord), a metabolic disorder such as uremia (excessive metabolic products in the blood), or liver failure . Alcohol or drugs may also produce this effect. In a diabetic, drowsiness may be due to hypoglycemia (low blood sugar), usually as a re sult of taking too much insulin, or to hyperglycemia (high blood sugar) due to inadequate control of the disorder. If a person who is drowsy fails to awaken after being shaken, pinched , and shouted at-or wakes and then relapses into drowsiness-treat the situation as a medical emergency and call for professional help immediately. (See Unconsciousness. )

Drug Any chemical substance that alters the function of one or more body organs or changes the process of a disea se. Drugs include prescribed medicines, over-the-counter remedies, and the recreational, social, and illicit use of drugs, such as cocaine. Many food s and drinks contain small quantities of substances classed as drugs-tea, coffee, and cola drinks, for example, all contain caffei11e, which is both a stimulant and a diuretic drug. Each drug n o rmally has three names: a detailed , descriptive chemical name; a shorter, generic name (see Generic drug) that has been officially approved; and a specific brand name chosen by the company that manufactures it. Drugs a re e ither licensed for prescription 6y a physician only or are over-the-counter preparations available at a drugstore or supermarket. SOURCES

Originally, all drugs were naturally occurring substances extracted from animals, plants, and minerals. Today, most drugs are produced artificially in the laboratory, ensuring a purer preparation with a predictable potency (strength) that is safe r for medical use . Some drugs, such a s insulin and growth hormone, are now sometimes synthesized using genetic engineering procedures. New drugs are discovered in a number of ways: by screening a substance

RESCUE METHODS

Throwing the victi m something to hold on to is useful if he or she is still conscious and has not panicked.

Otherwise , go to the person in a boat or, if no boat is a va ilable, reach him or her by swimming .

MEASURES THAT MAY HELP PREVENT DROWNING ACCIDENTS

Throwing a buoy or line If no life buoy is available, use any large object that floats . It should preferably have a rope attached to pull the person to safety (a rope alone may be suff ic ient).

Never jump into d eep water 1 without ensuring that there is an easy and obvious method of exit.

2

Wear a life jac ket or buoyancy device for all water sports (such as sailing and windsurfi ng). Rescuing from a boat Aft er grasping the person·s arms, it may be necessary to ""bounce ·· him o r her in the water to gain momentum for a lift into the boat. With two rescuers . one can enter the water to assist.

3

Swim only in pools or from public beache s designated as safe and patrolled by lifeguards.

4

Do not drink alcohol before swimming or water sports of any kind . Towing A pan icky victim may need to be calmed before making contact ; otherwise, he or she may struggle. During the tow ashore, it is important to keep the person 's face above water .

376

dren shou ld always be 5 Chil supervised when swimming and when they are taking baths.

6

Never walk on an iced-over pond or river unless the ice has first been tested by an adult.

DRUG

for different types of activity against a disease; by making alterations to the structure of an established drug; or, occasionally, by finding a new application for a drug that is being used for another condition.

METHODS OF ADMINISTERING DRUGS Action

How taken

Drugs are digested and absorbed from the intestine in the same way as nutrients. How quickly the tablet or liquid works depends on how rapidly it is absorbed. This. in turn. depends on such factors as the drug's composition, how quickly the drug dissolves, and the effect of digestive juices on it.

CLASSIFICATION

A drug is classified in one of the following ways: 1) according to its chemical make up (a corticosteroid drug, for example ); 2) according to the disorder it treats (an antihypertensive drug, for example, is used to treat high blood pressure); or 3) according to its specific effect on the body (a diuretic drug, for example, increases the volume of urine). EVALUATION

All new drugs are tested for their efficiency and safety. Tests usually go through three stages: laboratory trials on animals; laboratory trials on human volunteers; and, finally, clinical trials on patients. The Food and Drug Administration (FDA) will issue a license if studies provide evidence of the drug's efficacy and safety according to strictly defined standards. The FDA also establishes standards of quality, purity of the preparation, and adequate labeling. Evaluation continues even after a drug has become widely prescribed. A drug's license may be withdrawn if toxic effects are reported frequently or if even a few patients develop serious illness attributable to the drug. WHY DRUGS ARE USED

Drugs can be used in the treatment, prevention, or diagnosis of a disease. They are prescribed to relieve physical or mentaf symptoms, to replace a deficient natural substance (such as a hormone), or to stop the excessive production of a hormone or other body chemical. Some drugs are given to destroy foreign organisms, such as bacteria or viruses. Others, known as vaccines, are given to stimulate the body' s immune system (natural defenses) to form antibodies. Antibiotic drugs, diuretics, analgesics (painkillers), and tranquilizers are among the most commonly prescribed drugs. The most frequently used overthe-counter remedies include analgesics, cough and cold remedies, vitamins, and tonics. HOW DRUGS WORK

Drugs act on cells in the body or the infecting organism by stimulating or blocking chemical reactions. In many cases, this action occurs because the drug impersonates a chemical that occurs naturally in the body.

By injection

Drugs g iven by injection have a very rapid effect. Injection is also used if dig estive juices would destroy a d rug .

As a cream, anal or vaginal suppository, pessary, nasal spray,

These drugs have a local effect on the parts of the body that are exposed to them as well as a systemic (generalized) effect if some of the drug is absorbed into the bloodstream from the site of application.

or by i n -h a l e . r '~ - :·.

.....------:::-

~

\

... • ·

.

\

~_.. ...--~-:;·

·•···

.

.

.

.

_ .·

Some drugs act by binding (becoming attached) to a drug receptor (a specific site on the cell's surface that matches the chemical structure of the drug) . This triggers a change in chemical activity within the cell. Other drugs work by being absorbed into the cell, where they affect the chemical processes directly. Drugs may also have a placebo effect, which occurs because of the individual's positive or negative expectations of the drug's action. METHODS OF ADMINISTRATION

Drugs are given in different forms and in different ways (see table). These methods depend on many factors, including the severity of the illness, the part of the body being treated, the properties of the drug, and the speed and duration of action required. ELIMINATION

Drugs taken by mouth that are not absorbed in the intestine are excreted in the stools. Drugs that have entered the bloodstream are eliminated through the kidneys in the urine. Some drugs are broken down into inactive forms in the liver by enzymes before elimination.

D

DRUG INTERACTIONS

Taking drugs together or in combination with food or alcohol may produce effects on the body that differ from those occurring when a drug is taken on its own. Such drug interactions occur if chemicals in the different substances act on the same receptors or if one chemical alters the absorption, breakdown, or elimination of another chemical. Physicians often make use of interactions to increase the effectiveness of a treatment; combinations of drugs are often prescribed to treat infection, cancer, or hypertension (high blood pressure). Many interactions, however, are unplanned; they may reduce the benefit from a drug or increase its level in the blood and cause adverse effects. Patients undergoing long-term drug treatment may be advised to carry warning cards to avoid dangerous interactions from any treatment received during an emergency. Patients should tell their physicians about any other drugs they are taking to prevent interactions with drugs the physician may prescribe.

COMPLIANCE

ADVERSE EFFECTS

If drug treatment is to be beneficial, the full course must be taken as instructed by a physician. It is estimated that as many as two out of every five people who are prescribed a drug do not take it properly, if at all. Reasons for noncompfiance include failure to understand instructions for taking the drug, fear of possible reactions, or simply not bothering to take the drug.

Most drugs can produce adverse effects-harmful or unpleasant reactions that result from a normal dose of the drug. These adverse effects can be divided into predictable adverse reactions, which result from the effects of the chemical structure of the drug, and bizarre (unpredictable) reactions, which are unrelated to the drug's normal chemical effects on cells. Predictable adverse reactions are 377

DRUG ABUSE

due to the difficulty experienced by the drug manufacturer in targeting the action of a drug to a single tissue or organ. For example, antic/10/inergic drugs prescribed to relieve spasm in the intestine also cause blurred vision and dryness of the mouth. Symptoms may wear off as the body adapts to the drug; otherwise, they usually are relieved by reducing the dose or increasing the interval between doses. Any change in the absorption, breakdown, or elimination of a drug (caused, for example, by gastrointestinal, liver, or kidney disease) that increases its concentration in the blood will increase the risk of predictable adverse effects. Bizarre drug reactions may be due to a genetic disorder (for example, lack of a specific enzyme that usually inactivates the drug), an allergic reaction, or the formation of antibodies that damage tissue. Common side effects of this type include a rash, facial swelling, or jaundice. Occasionally, anaphylactic shock (a severe allergic reaction), characterized by breathing difficulty or collapse, may occur. AT! bizarre drug reactions usually necessitate withdrawal of the drug . Many drugs cross the placenta and some adverse!{ affect growth and development o the fetus. Most drugs pass into the breast milk of a nursing mother; some have adverse effects on the baby. A drug is useful only if its overall benefit to the patient outweighs the risk and severity of any adverse effects. Research on new drugs partly aims to discover preparations that act selectively on target organs to avoid unwanted effects on other tissues.

Drug abuse COMMON DRUGS

Stimulants Amphetamines Depressants Alcohol Barbiturates Psychedelics LSD Narcotics Cocaine Heroin Anabolic steroids

The use of a drug for a purpose other than that for which it is normally prescribed or recommended. The reasons for drug abuse include the desire to escape from reality or achieve 378

a mystical experience, curiosity about its effects, and the search for selfawareness. Certain types of drugs (for example, anabolic steroids) are sometimes abused to improve performance in sports. Problems resulting from drug abuse may arise from the adverse effects of the drug, from accidents during intoxication, and from the habit-forming potential of many drugs, which may lead to drug dependence.

Drug addiction Physical or rsychological dependence on a drug. (See Drug dependence.)

watering eyes, and sweating. More severe reactions include diarrhea, vomiting, trembling, cramps, confusion, and, rarely, seizures and coma. These symptoms are usually relieved if the drug is taken again. Withdrawal symptoms probably occur because the body has become adapted to the continuous presence of the drug, which reduces the release of certain natural chemicals (for example, nicotine affects production of epinephrine and similar substances). When the drug is no longer taken or is withheld, the chemical deficiency is exposed. COMPLICATIONS

Drug dependence The compulsion to continue taking a drug, either to produce the desired effects that result from taking it, or to prevent the ill effects that occur when it is not taken. TYPES

Drug dependence takes two forms: psychological and physical. A yerson is psychologically dependent i he or she experiences craving or emotional distress when the drug is withdrawn. In physical dependence the body has adapted to the presence of the drug, causing the symptoms and signs of a withdrawal syndrome when the drug is withdrawn. Withdrawal is usually associated with severe physical and mental distress. CAUSES AND INCIDENCE

Drug dependence develops as a result of regular and/or excessive use of a drug. Several million people in the US are dependent on nicotine, on the caffeine in coffee and tea, and on alcohol. Many thousands are dependent on tranquilizers. Dependence occurs most frequently with drugs that alter the individual's mood or behavior. Narcotic analgesics used briefly to treat a disorder (for example, the use of morphine to treat a heart attack) hardly ever lead to dependence. Intravenous drug abuse carries a high risk of dependence; the rapidity with which the drug produces its effects reinforces the habit of injecting the drug. Some people seem to be more susceptible to dependency than others. Factors that usually play a part include pressure from friends and associates, and environmental factors, such as poverty, unemployment, disrupted family life, and the availability of drugs. SYMPTOMS AND SIGNS

A mild withdrawal reaction may cause yawning, sneezing, a runny nose,

Drug dependence may cause physical problems, such as lung and heart disease from tobacco smoking and liver disease from drinking excessive amounts of alcohol. Mental problems, such as anxiety and depression, are common during withdrawal. Dependence may also be associated with drug tolerance, in which an increasingly higher dose of the substance is needed to produce the desired effect. Complications may occur as an indirect result of dependence. For example, people who inject a narcotic drug may get sick and die as a result of an infection, such as hepatitis or AIDS, introduced into the bloodstream on a dirty needle. In other cases, the abusers may suffer from an overdose because of confusion about the dosage or because they take a purer, more potent preparation than they are used to. In severe cases, social problems result from the disruption of family life and from criminal acts carried out to pay for drugs. TREATMENT

Controlled withdrawal programs are available in special centers and larger hospitals. These programs usually offer supervised reductions in dose. Alternative, less harmful drugs may be given, as well as treatment for witndrawal symptoms. Social service agencies and support groups may provide follow-up care. OUTLOOK

Successful treatment requires motivation on the part of the addict. Problems frequently recur when addicts return to the circumstances that originally gave rise to drug abuse and dependence.

Druggist A pharmacist. A person who is licensed to dispense drugs and to make up prescriptions.

DUMPING SYNDROME

Drug overdose The taking of an excessive amount of a drug, which may cause toxic effects. (See Drug poiso111ng.)

Drug poisoning The harmful effects on various organs of the body as a result of taking an excessive dose of a drug. CAUSES AND INCIDENCE

Drug poisoning may be accidental or deliberate. Accidental poisoning is most common in young children under the age of 5 years who swallow colored tablets thinking they are candies . Child-resistant drug packaging has helped reduce this risk. In adults, accidental poisoning usually occurs in the elderly because they are confused about their treatment and dosage requirements. Accidental poisoning may also occur during drug abuse. Deliberate poisoning is usually unsuccessful and is done as a cry for help (see Suicide; Suicide, attempted). The drugs taken in overdose are usually benzodiazepine drugs,

antidepressant drugs, acetaminophen, or aspirin . Homicide and suicide may involve administration of a drug by another person. TREATMENT

In dealing with a drug overdose, firstaid measures depend on the condition of the patient. If the patient is unconscious, ensure that the airway is clear and that there is normal breathing and a pulse before rolling the patient into the recovery position and summoning emergency he!£. If the person is not breathing, artificial respiration should be started. Any individual who has taken a drug overdose and any child who has swallowed tablets belonging to someone else should be seen by a physician. It is important to identify which drugs have been taken. Empty bottles may provide vital clues; save any you find. Contact the poison control center, hospital emergency room, or a physician for advice. If the victim is fully conscious, you may be advised to induce vomiting by sticking a finger down the throat or giving ipecac if this is available. Some drugs taken in excess may cause hypothermia; if this occurs, keep the victim warm with blankets. Treatment in the hospital may involve gastric lavage (emptying the stomach using several pints of water passed down a tube through the mouth and esophagus). This procedure usually is effective only if the drug has been taken within the pre-

vious four hours or a few hours longer for drugs (such as aspirin and antidepressants) that slow down normal stomach emptying. Charcoal may be given in some cases to reduce the absorption of the drug from the intestine into the bloodstream . Diuresis (increased production of urine) may be induced using an intravenous infusion to speed up the elimination of the drug from the bloodstream. Antidotes are available only for specific drugs. They include naloxone (given to reverse breathing difficulty caused by morphine), methionine (given to reduce the formation of toxic substances in the liver from acetaminophen), and chelating agents with deferoxamine (given to absorb and inactivate iron). COMPLICATIONS

Drug poisoning may cause drowsiness and breathing difficulty (due to effects on the brain), irregular heart beat, and, rarely, cardiac arrest, seizures, and kidney and liver damage. ECG monitoring (electrical recording of the heart) is usually done for the first 24 to 48 hours after poisoning with a drug that is known to have effects on the heart. Antiarrhythmic drugs are prescribed to treat any heart beat irregularity as it develops. Seizures are treated with anticonvulsant drugs. In some serious cases, the patient requires artificial ventilation because of severe drug-induced breathing difficulty. Blood tests to monitor liver function and careful monitoring of urine output are carried out if the drug is known to have any toxic effect on associated organs.

Dry socket Infection at the site of a recent tooth extraction, causing pain, bad breath, and an unpleasant taste. A complication of about 2 percent of extractions, dry socket occurs most commonly when a blood clot fails to form in the tooth socket after a difficult extraction, such as removal of an impacted wisdom tooth. Infection may also develop following a normal extraction if the blood clot becomes dislodged (for instance, because of excessive rinsing of the mouth). In some cases, the clot itself may become infected, or infection may have been present before the extraction. The inflamed socket appears dry, and exposed bone, which may be dead and fragmented, is often visible. TREATMENT

The socket is gently irrigated to remove debris, and then may be coated with a soothing, anti-inflammatory paste, such as zinc oxide or eugenol (oil of clove). Antibiotics may also be prescribed if drainage of the socket is incomplete. The infection usually begins to clear up within a few days.

DSM Ill The third, and most recent, edition of the "Diagnostic and Statistical Manual of Mental Disorders," published by the American Psychiatric Association in 1980. DSM III provides criteria for classifying psychiatric illnesses for use by physicians when making diagnoses and by those compiling statistics and insurance forms.

Dual personality See Multiple personality.

Dry eye

Duct

See Keratoconjunctivitis sicca.

A tu be or a tube like passage leading from a gland to allow the flow of fluids-for example, tears through the tear ducts.

Dry ice Frozen carbon dioxide, also known as carbon dioxide snow. Unlike most substances, carbon dioxide changes directly from a gas to a solid when it is cooled, without first passing through a liquid phase. In practice, dry ice is produced by allowing carbon dioxide gas stored under pressure to escape through a small nozzle. This rapid expansion cools the carbon dioxide to about -95°F (-70°C), and dry ice is formed as a powder. This powder is then compressed into cakes. Dry ice is sometimes applied to the skin to destroy warts and nevi, which it does by virtue of its low temperature. (See also Cryosurgery.)

Dumbness See Mutism.

Dumping syndrome Symptoms including sweating, faintness, and palpitations resulting from the rapid passage of food from the stomach into the upper intestine. It mainly affects people who have had a partial or total gastrectomy (surgical removal of the stomach). Symptoms may occur within 30 minutes of eating (early dumping, usually associated with a lowered blood volume) or after 90 to 120 minutes (late dumping,

379

D

DUODENAL ULCER

usually due to low blood sugar and potassium). Some tense reople may have symptoms of dumping with an intact stomach. CAUSES

D

Gastric surgery interferes with the normal mechanism by which food is emptied from the stomach. If a meal that is rich in carbohydrates is "dumped" too quickly from the stomach, it may cause the upper intestine to swell. In addition, certain hormones are released in excess into the bloodstream. These hormones, with the intestinal swelling, cause the symptoms of early dumping. As sugars are absorbed from the intestine, they rafidly increase the blood glucose ]eve, causing an excess amount of insulin to be released, which in turn may later lower the blood sugar level below normal, causing the symptoms of late dumping. A person who has had a gastrectomy can avoid symptoms by eating frequent, small, dry meals that do not contain refined carbohydrates such as white sugar. Symptoms may also be prevented by fying down after a large meal. Drug treatment is not often successful, but adding guar gum to food to slow the emptying of the stomach and the absorption of sugars is sometimes effective.

known cause, although the condition is slightly more common in certain groups-for example, in people whose work involves gripping tools, especially those that vibrate. The condition is a common feature in people with alcoholic liver cirrhosis. There is a slight tendency for the condition to run in families, though this does not necessarily mean it is inherited genetically. Men over 40 are the most commonly affected.

LOCATION OF THE DUODENUM The duodenum is about 10 inches (25 cm) long and shaped like a C on its side; it forms a loop around the head of the pancreas . Gallbladder

SYMPTOMS AND SIGNS

The tissues under the skin in the palm of the hand become thickened and shortened, with tethering of the tendons that run into the fingers. A small, hard nodule forms on the palm of the hand and it spreads to form a band of hard tissue under the skin, with puckering of the skin itself. The affected fingers start to bend more and more over a period of months or years and cannot be pulled back straight. TREATMENT

Stomach

Ampulla of Valer Pancreas

Duodenal ulcer

Duodenum

A raw area in the wall of the duodenum, caused by erosion of its inner surface lining. Duodenal and gastric ulcers (similar raw areas in the fining of the stomach) are also call~d peptic ulcers and have similar causes, symptoms, and treatment.

The first part of the small intestine, extending from the pylorus (the muscular valve at the lower end of the stomach) to the ligament of Treitz, which marks the boundary between the duodenum and the jejunum (the second part of the small intestine). Ducts from the pancreas, liver, and gallbladder feed into the duodenum through a small opening called the ampulla of Yater, which is surrounded by the sphincter of Oddi. Digestive enzymes (proteins that break down food) contained in bile and the pancreatic secretions are released into the duodenum through this opening.

Duodenitis Inflammation of the duodenum of uncertain cause, vague symptoms, and no physical signs. Treatment (which has never conclusively proved to be effective) is similar to treatment for a duodenal ulcer (see Peptic ulcer). The diagnosis of duodenitis is made by gastroscopy (examination of the walls of the duodenum with a gastroscope, a fiberoptic viewing tube passed through the esophagus, stomach, and pylorus). Instead of an ulcer there is a diffuse area of inflammation, with redness and swelling of cells in the duodenal lining and often bleeding after contact with the tip of the gastroscope. A direct correlation between the gastroscope findings and any symptoms that could be considered duodenitis has yet to be made from clinical studies. 380

The only treatment is surgical and is performed when the deformity has become unsightly or has started to impede hand function. During surgery the bands of thickened tissue under the skin are cut and separated to free the tendons.

Dupuytren's contracture A disorder of the hand in which the ring and little fingers become fixed in a bent position and can be straightened only by an operation. In about half the cases, both hands are affected. The disorder is named after the French surgeon who first described it, Baron Guillaume Dupuytren (1777-1835). CAUSES AND INCIDENCE

The cause of the disorder is unclear. In most cases there is no apparent or

Thickened band □ 'fr--+--- of tissue

Surgery for Dupuytren's contracture

Bands of tissue under the skin that have become th ickened are cut and separated so that the tendons are freed .

Dust diseases

0

A group of lung disorders caused by inhalation, usually over several years at work, of dust particles that are absorbed into the lung tissues. There they cause fibrosis (formation of scar tissue) and progressive lung damage with crippling symptoms.

DYING, CARE OF THE

The main symptoms are a cough (with dark sputum) and breathing difficulty. It usually takes at least 10 years of exposure to dusts containing coal, silica, talc, or aluminum before serious lung damage develops (see Pneumoconiosis). Inhalation of asbestos dust can cause damage in much less time (see Asbestosis). Workers in relevant industries show considerable variation in their susceptibility to dust disease. These peopfe should have regular medical checkups to ensure that any signs of disease are detected early and serious damage is thus prevented.

Dwarfism See Short stature.

Dying, care of the People who are near death should be provided with physical and psychological care so that their final period of life is as free from pain, discomfort, and emotional distress as possible. Today, with good quality medical care, many deaths, even those from cancer, are pain-free and are associated with little physical discomfort. Emotional distress can be minimized by perception, understanding, and sensitive communication on the part of all those caring for the dying person. Usually, these people include physicians and other medical professionals, counselors, social workers, clergy, family, and friends. Family and friends should realize that they may undergo great emotional strain and may sometimes experience guilt for not being able to do more for the dying person. They, too, may benefit from counseling. WHEN AND WHAT TO TELL THE DYING PERSON

Over the last 20 years it has become more common for physicians to tell dying people, particularly cancer patients, the facts related to their diagnoses. Generally, if a person can discuss the likely outcome of his or her illness and can prepare for death, then dying itself is eased. However, there are people who prefer not to know or blocK out the knowledge. The wishes of the patient should be paramount; these wishes may not always be clear and those caring for the patient need considerable perception and understanding. Careful probing should be attempted before any blunt statements are made. Sometimes, even though the dying person has made it clear that he or she would prefer to talk about death, family members feel unable to do so,

and this can cause the patient much isolation and suffering. Sometimes, the dying person may find it easier to talk to someone who is not a relative. In both cases, specially trained people, counselers, and members of the clergy may be able to help promote communication between the patient and the family. PHYSICAL CARE

For most dying people, pain is often the most feared problem. Today, however, virtuall{ all pain can be relieved by the use o analgesics (painkillers). Regular, low doses of the drugs are given so that pain never builds up and the patient remains alert. Powerful analgesics, such as morphine and other opiates, are commonly given to relieve severe pain. When analgesic drugs are not adequate, other methods may be needed. These include nerve blocks (in which a nerve carrying pain from the body to the brain is interrupted by an injection or surgery), cordotomy (also called rhizotomy, or severing of nerve fibers in the spinal cord), or TENS (nerve stimulation with small electric currents), which is less likely to be effective once narcotic analgesics have been used. Physical symptoms other than pain may also cause great distress. Nausea and vomiting may be a problem when the kidney and liver have ceased to function adequately. A combination of two or three drugs may occasionally control the symptom. An obstruction in the esophagus can cause vomiting or difficulty swallowing and may need to be relieved by an operation or by laser treatments through an esophagoscope. Another common problem is breathlessness, which usually responds to morphine. The patient may develop aches or become stiff from being in bed. Comfort can be improved by keeping the patient as active as possible. Toward the end, the dying person may become restless and breathing may become difficult, either because the lungs become waterlogged as the heart fails or because of a constant trickle of saliva into the windpipe. These symptoms can be relieved by medication and by placing the patient in a more comfortable position. PSYCHOLOGICAL CARE

Emotional care is every bit as important (if not more so) as the relief of pain. Many people feel anger or depression at the thought of dying; feelings of guilt or regret over the past are also common. Ultimately, how-

ever, given loving, caring support from family, friends, and others, most terminally ill people come to terms with the thought of death. Sometimes antidepressant drugs are prescribed to relieve severe depression. A great cause of anxiety and worry may be fear of a painful end. Patients should be reassured that adequate pain relief will be maintained at all times and that even when death is very close they need not fear suffering. Most people sink into unconsciousness just before the end and die "in their sleep." Fear of dependency and loss of dignity may also cause worry. The dying person should be allowed to participate as much as possible in family discussions and decisions regarding the future. Preparing for death may include practical matters, such as writing a will, or other less tangible things such as saying "I'm sorry," "thank you," or "goodbye." Confession and reassurance from a priest or spiritual counselor are also important for some people. Perhaps the most pressing need for the terminally ill person is communication. Relatives, friends, and caregivers must be willing to share the dying person's concerns. HOME OR HOSPITAL?

The treatment of most types of cancer requires hospital facilities at one time or another. However, once an illness has a foreseeable end, many people prefer and many families choose to care for a dying relative at home. Few terminally ill patients require complicated nursing for a prolonged period, and the sort of loving understanding and emotional care needed may be best provided at home. At home, too, the dying person can maintain some dignity and independence, avoid isolation, and participate in family life. By contrast, a hospital is better equipped to deal with acute illness. HOSPICES

Hospices are small units, sometimes linked to a general hospital, that have been established specifically to care for the dying and their families. Their numbers have grown considerably during the last few years. Hospital routine is generally absent; instead, the efforts of the hospice staff, which includes nurses specially trained in terminal care, are directed toward the relief of physical and emotional pain. Basic to the hospice philosophy is the idea that dying people and their families need help, care, and understanding. It has been argued that a dying person might find the sight of 381

DYS-

other people dying depressing, but it has been found that most people who die in a hospice are reassured because death occurs peacefully.

Dys-

D

A prefix meaning abnormal, difficult, painful, or faulty, as in dysuria (pain on passing urine). Key

Dysarthria A speech disability caused by disease or damage to the physical apparatus of speech, or to nerve pathways controlling this apparatus. Dysarthria differs from aphasia (another type of speech disorder) in that dysarthric patients have nothing wrong with the speech center in the brain. They are able to formulate, select, and write out words and sentences grammatically; it is only vocal expression that causes problems. Dysphonia is a speech disability with a more restricted meaning than dysarthria, referring only to defects of sound production caused by some disease or damage to the larynx. CAUSES

Dysarthria is a common feature of many degenerative conditions affecting the nervous system, such as multiple sclerosis, Parki11s011's disease, and HzmtinS?ton's chorea. It also affects some children who have cerebral palsy. Dysarthria may result from a stroke, brain tumor, or an isolated defect or damage to a particular nerve (such as the hypoglossal nerve that controls tongue movements). Structural defects of the mouth, as occur in cleft lip and palate, or even ill-fitting false teeth may also affect speech. TREATMENT

There is no specific treatment for dysarthria. In some cases, drug or surgical treatment of the underlying disease or structural defect may restore the ability to speak clearly. In other instances, patients may benefit from speech therapy. (See also Speech.)

Dyschondroplasia A rare disorder, present from birth, characterized by the presence of multiple tumors of cartilaginous tissue within bones. Dyschondroplasia is caused by a failure of normal bone development from cartilage. Usually only the bones in one limb are affected; the bones and limb are shortened, with resultant deformity.

Dysentery A severe infection of the intestines, causing diarrhea (often mixed with

382

High prevalence □ Moderate

prevalence

Areas of amebic dysentery Amebic dysentery is most prevalent in countries where standards of hygiene are low. The photograph shows a magnified sample of ENTAMOEBA HISTOL YT/CA.

blood, pus, and mucus) and abdominal pain . The person may spend hours straining on the toilet, producing little but blood-stained watery mucus. There are two distinct forms of dysentery. Shigellosis, also called bacillary dysentery, is caused by infection with any of a group of bacteria called shigella. The diarrhea starts suddenly and is watery; sometimes toxemia (the presence of bacterial toxins in the blood) develops. Amebic dysentery is caused by the protozoan (single-celled) parasite ENTAMOEBA HlSTOLYTICA. It starts more gradually and often runs a chronic course. The main risk with acute dysentery is dehvdratio11 from loss of fluid in the diarrhea. (See also Colitis.)

Dyskinesia Abnormal muscular movements caused by a brain disorder. Uncontrollable twitching, jerking, or writhing movements occur that cannot be suppressed and may impair the performance of voluntary (willed) movements. The disorder may involve the whole body or may be restricted to a group of muscles, such as those around the eye. Different types of dyskinesia include chorea (mainly jerking movements), athetosis (writhing movements), c/,oreoathetosis (a combined form), tics (repetitive fidgets), tremors, and m11oclo11us (muscle spasms) . Dyskinesias may result from brain damage at birth or it may be a side effect of certain drugs, particularly

some drugs used to treat psychiatric illnesses and the antiemetic drug metoclopramide. The affected brain region is a group of linked nerve centers called the extrapyramidal system, which includes the basal ga11glia. Dyskinesias due to drugs often resolve when drug use is stopped. Otherwise they are difficult to treat. Drugs such as tetrabenazine may help reduce choreic movements, but often the physician must prescribe several drugs in turn before one (if any) is effective. (See also Parki11so11is111).

Dyslexia A specific reading disability characterized by difficulty in coping with written symbols. The term is not used to describe other types of reading difficulty, such as problems arising from brain damage or mental handicap, or from speech or visual defects. In addition, dyslexia does not include reading problems caused by educational or social neglect. CAUSES AND INCIDENCE

Emotional disturbance, minor visual defects, and failure to "train" the brain have all been suggested as possible causes of dyslexia, but there is now good evidence that a specific, sometimes inherited, neurological disorder underlies true dyslexia. Some 90 percent of dyslexics are male. SYMPTOMS

The key feature oi dyslexia is that in other respects the child has entirely normal intelligence. Thus, his or her attainment of reading skills lags far behind other scholastic abilities and

DYSURIA

overall IQ. Usually, the child can read numbers or musical notes much more easily than words. Furthermore, while many first- and second-grade children tend to reverse letters and words (for example, writing or reading p for q, b for d, was for saw, no for on), the majority soon correct such errors. Dyslexic children continue to confuse these symbols. Letters are transposed (as in pest for step) and spelling errors are common. These children may even be unable to read words they can spell correctly. Writing from dictation may be difficult even though most dyslexics can copy sentences. TREATMENT

It is important to recognize the problem early to avoid any added frustrations. Specific remedial teaching can help the child develop "tricks" to overcome the deficit, and avoidance of pressure from parents combined with praise for what the child can do is equally important. Given the right support and training, sufferers can usually overcome their difficulties. Many dyslexics have developed notable careers while still retaining some features of dyslexia.

Dysmenorrhea Pain or discomfort during or just before a menstrual period. Most teenage girls and young women suffer to some degree from what is called primary dysmenorrhea. It usually starts two or three years after the first period, once ovulation is established; often it diminishes after the age of about 25, and it is rare after childbirth. Dysmenorrhea is known to be associated with the hormonal changes that occur during a period, but the exact mechanism of the link between them remains uncertain. One possibility is that dysmenorrhea is due to excessive production of, or undue sensitivity to, prostaglandin, the hormone that stimulates muscular spasm of the uterus. Secondary dysmenorrhea is, by definition, due to an underlying disorder (such as endometriosis or pelvic

inflammatory disease). Either type of dysmenorrhea may or may not be accompanied by premenstrual syndrome, a bloated feeling and irritability, depression, and other changes that commonly occur in the days preceding menstruation. SYMPTOMS

Dysmenorrhea is typically felt as cramplike pain or discomfort in the lower abdomen, which may come and

go in waves. There may also be dull Tower backache and, in some women, nausea and vomiting. In primary dysmenorrhea the pain starts shortly before a period and usually lasts for less than 12 hours. About 10 percent of women have symptoms severe enough to interfere with their work or leisure activities. In secondary dysmenorrhea the pain begins several days before a period and lasts throughout it. Mild primary dysmenorrhea is often relieved by analgesics (such as aspirin) or prostaglandin inhibitors (drugs that bloc!< the action of prostaglandin) such as naproxen. Rest in bed with a heating pad or hot-water bottle is a traditionaf and sometimes effective remedy. If symptoms are severe, they can usually be relieved by suppressing ovulation, either with the birth-control pill or with non-contraceptive hormones. Treatment of secondary dysmenorrhea depends on the cause.

Dyspareunia The medical term for painful sexual intercourse. (See Intercourse, painful.)

Dyspepsia The medical term for indigestion.

Dysphagia The medical

term for swallowing

difficulty.

Dysplasia Any abnormality of growth. The term applies to misshapen structures such as the skull (cranial dysplasia) and to abnormalities of single cells (cellular dysplasia). Abnormal cell features include the size, shape, and rate of multiplication of cells.

D

Dyspnea The term for difficult or labored breathing. (See Breathing difficulty.)

Dysrhythmia, cardiac The medical term, sometimes used as an alternative to arrhythmia, meaning disturbance of heart rhythm .

Dystonia Abnormal muscle rigidity, causing painful muscle spasms, unusually fixed postures, or strange movement patterns. Dystonia may affect a localized area of the body, or it may be more generalized. The most common types of localized dystonia are torticollzs (painful neck spasm) and scoliosis (abnormal curvature of the spine) caused by an injury to the back that produces muscle spasm. More generalized dystonia occurs as a result of various neurolo9ical disorders, including Parkinson s disease and stroke, and may also be a feature of schizophrenia. Dystonia may be a side effect of antipsychotic drugs.

Dysphasia

Dystrophy

A term sometimes used to describe a disturbance in the ability to select the words with which we speak and write (and/or to comprehend and read) caused by damage to regions of the brain concerned with speech and comprehension. (See Aphasia.)

Any disorder in which the structure and normal activity of cells within a tissue have been disrupted by inadequate nutrition. The usual cause is poor circulation of blood through the tissue, but dystrophy can also be due to damage to nerves or to lack of catalytic protein (a specific enzyme) in that tissue. In muscular dystrophies, muscle cells fail to develop normally, causing weakness and paralysis. In the leukodystrophies, there is demyclination (loss of the sheath surrounding nerves) within the brain, causing a variety of disturbances of sensation, movement, and intellect. Corneal dystrophies are a rare, usually inherited, cause of blindness. In this condition, cells lining the cornea are damaged and the eye's surface becomes opaque.

Dysphonia Defective production of vocal sounds in speech, caused by disease or damage to the larynx (the voice box at the top of the windpipe) or to the nerve supply to the laryngeal muscles. Dysphonia should be distinguished from dysarthria, in which speech is defective because of damage or disease involving the controlling nerve pathways or muscles of other speech apparatus (e.g., respiratory muscles, throat, tongue, or lips); it is also to be distinguished from expressive aphasia, in which the ability to speak may be profoundly disturbed by damage to the speech center in the brain. (See also Larynx disorders box;

Speech; Speech disorders.)

Dysuria The medical term for pain, discomfort, or difficulty in passing urine. (See

Urination, painful.) 383

ANATOMY Of THE EAR the vesti bule, semicircular canals , and cochlea . Sensory impulses from the inner ear pass to the brain via the vestibulocochlear nerve

The outer ear com prises the pinna and ear canal ; the middle ear- the eardrum , hammer, anvil, sti rrup , and eustachian tube; and the inner ear-

. ,....~~o~•· '--tt-'

.t

'

.

Ear The organ of hearing and balance. The ear consists of three parts: the outer ear, the middle ear, and the inner ear. The outer and middle ear are concerned primarily with the collection and transmission of sound. The inner ear is responsible for analyzing sound waves; it also contains the mechanism by which the body keeps its balance.

Hammer

MIDDLE EAR

The middle ear is a small cavity between the eardrum and the inner ear. It conducts sound to the inner ear by means of a chain of three tiny, linked, movable bones called ossicles. They link the eardrum to an oval window in the bony wall on the opposite inner side of the middle-ear cavity. The bones are named because of their shapes. The malleus (hammer) is joined to the inside of the eardrum. The incus (anvil) has one broad joint with the malleus (which lies almost parallel to it) and a delicate joint to the third bone, the stapes (stirrup). The base uf the stapes fills the oval window, which leads to the inner ear. The middle ear is cut off from the outside by the eardrum, but it is not completely airtight; a ventilation passage, called the eustachian tube,

384

Vestibulocochlear nerve

Anvil

OUTER EAR

The outer ear consists of the pinna (also called the auricle), which is the visible part of the ear, composed of folds of skin and cartilage. The pinna leads into the ear canal (also called the meatus), which is 1 inch (2.5 cm) long in adults and closed at its inner end by the tympanic membrane (eardrum). The part of the canal nearest the outside is made of cartilage. The cartilage is covered with skin that produces wax, which, along with hair, traps dust and small foreign bodies. The eardrum separates the outer ear from the middle ear. The eardrum is a thin, fibrous, circular membrane covered with a thin layer of skin. It vibrates in response to the changes in air pressure that constitute sound and works in conjunction with the other components of the middle ear.

.....

-:i•

Stirrup

Semicircular canals .,.- - I - - ' ' - ,

Pinna

\,

~

"-

Ear canal

runs forward and down into the back of the nose. The eustachian tube is normally closed, but it opens by muscular contraction with yawning and swallowing. The middle ear acts as a transformer, passing the vibrations of sound from the air outside (which is a thin medium) to the fluid in the inner ear (which is a thicker medium) . INNER EAR

The inner ear is an extremelv intricate series of structures contai11ed deep within the bones of the skull. It consists of a maze of winding passages, collectively knmvn as the fabyrinth. The front part, the cochlea, is a tube resembling a snail's shell and is concerned with hearing. (For " detailed discussion oi how this system works, see /le11ri11g.) The rear part (three semicircular canals and two other organs) is concerned with balance. The semicircular canals are set at right

angles to each other and are connected to a cavity known as the vestibule. The canals contain hair cells bathed in fluid. Some uf these cells are sensitive to gravity and acceleration; others respond to positions and movements of the head (i.e., side to side, up and down, or tilted). The information concerning posture or direction is registered by the relevant cells and conveved bv nerve fibers to the brain. (See also Ear disorders box.)

Earache The most common cause of earache is acute otitis media (infection of the middle ear), most commonl y occurring in young children . The pain is likely to be severe and stabbing; there may also be loss of hearing and a raised temperature. If the eardrum bursts, there is a discharge oi fluid and immediate relief from the pressure and therefore the accompanying pain.

EARACHE

DISORDERS OF THE EAR The ear is susceptible to a large variety of disorders, some of which can lead to deafness. Vertigo (dizziness associated with a disturbance of balance) as a result of ear disease is not common, but it occurs in some disorders of the inner ear. CONGENITAL DEFECTS

Very rarely, a baby is born with an absent or extremely narrowed external ear canal , and sometimes the small bones of the middle ear are deformed or absent. Occasionally, the pinna (external ear) is missing or distorted. Rubella (German measles) affecting a woman during the first three months of pregnancy can cause severe damage to the baby's hearing apparatus, leading to deafness. INFECTION

Infection is the most common cause of ear disorders Infection may occur in the ear canal, leading to otitis externa, or may affect the middle ear, causing otitis media, which often leads to perforation of the eardrum (see Eardrum, perforated). Persistent middle-ear effusion (buildup of fluid within the middle ear), often due to infection, is the most common cause of hearing difficulties in children. Middle-ear infection can spread to cause mastoiditis (infection of the mastoid process, the bone behind the ear) or brain abscess, but these complications have become extremely rare since the introduction of antibiotics. Virus infection of the inner ear may cause labyrinthitis with severe vertigo and/or sudden hearing loss.

ear canal and perforation of the eardrum can result from poking objects into the ear or, rarely , from careless syringing. A sudden blow, especially a slap, to the ear or a very loud noise may also perforate the eardrum. Prolonged exposure to loud noise or close proximity to a loud explosion can cause tinnitus (noises within the ear) and/or deafness. Pressure changes associated with flying or scuba diving can also cause minor damage and pain (see Barotrauma). TUMORS

Tumors in the ear are rare, but occasionally a basal cell carcinoma (rodent ulcer) or a squamous cell carcinoma affects the pinna . The latter may also involve the ear canal. Cancers of the middle and inner ears are extremely rare. Acoustic neuroma is a benign (nonmalignant), slow-growing tumor of the acoustic nerve that may press on structures within the ear to cause deafness, tinnitus, and imbalance. Cholesteatoma. a growing collection of skin cells and debris, is not a tumor, but may be equally dangerous. OBSTRUCTION

Ear canal obstruction is most often caused by dried earwax. but may also result from otitis externa. In children, a frequent cause is putting a foreign body into the ear (see Ear. foreign body in). DEGENERATION

Deafness in many elderly people is due to presbycusis, deterioration of the hair cells in the cochlea. POISONING/DRUGS

The inner ear is especially sensitive to damage by certain classes of drugs. The most important-the aminoglycoside antibiotic drugsINJURY include such drugs as streptomycin Cauliflower ear is the result of repeated and gentamicin. These drugs can injury to the pinna. Injury to the external cause damage to the cochlear hair

Another common cause of earache is otitis extemn (inflammation of the outer ear canal), which is often caused by infection. Infection may be localized or affect the whole canal, sometimes taking the form of a boil or abscess. The earache mav be accompanied by irritation or itching in the ear, a discharge, and mild deafness. A much rarer cause of earache is herpes zostcr infection, which causes blisters in the ear canal. The earache

may persist for weeks or months after the infection has cleared. Intermittent earache may also occur in people with dental problems, tonsill itis, throat cancer, pain in the lower jaw or neck muscles, and other disorders affecting areas near the ear. Earache in this case is caused because the ear and many nearby areas are supplied by the same nerves; in these cases the pain is said to be "referred" to the ear.

cells, especially if used in high concentration and particularly in the presence of kidney disease, which can delay the excretion of the drugs from the body. There are other drugs that can damage ear function, including quinine. aspirin , and the diuretic drugs furosemide, ethacrynic acid, and bumetanide. OTHER DISORDERS

In otosclerosis. a hereditary condition, the base of one of the small bones in the middle ear becomes fixed, causing deafness. Meniere's disease is an uncommon disorder in which deafness., vertigo, and tinnitus result from the accumulation of flu id within the labyrinth in the inner ear.

INVESTIGATION

The function of hearing is investigated by various tuningfork and audiometric hearing tests. wh ich reveal different types and levels of hearing loss. The external ear canal and the eard rum may be examined with an otoscope and mirror: an otoscopic microscope may also be used . The function of the balancing mechanism of the inner ear is investigated by observing nystagmus (Jerky eye movements) when the head is placed in different positions or the whole body rotated. and when the ear is gently syringed with hot or cold water (caloric tests) . These tests may be refined and recorded by electronystagmography

INVESTIGATION

The phvsician inspects the outer ear manuallv and then examines the ear canal and drum with an otoscopc and, if necessary, a binocular microscope; he or she may arrange for X rays and other tests to be carried out (see Enr, cxn111i11ntio11 of>. The mouth, throat, and teeth are also examined. TREATMENT

Analgesics (painkillers) may be given and the underlying cause of the 385

EAR, CAULIFLOWER

earache treated. Antibiotic drugs are prescribed for an infection. Pus in the outer ear may need to be aspirated (sucked out), usually as an office procedure. Pus in the middle ear may require draining through a hole made in the eardrum; this operation is known as 111yri11goto111y.

Ear, cauliflower See Cauliflower car.

Ear, discharge from Fluid emitted from the ear, usually as the result of an infection of the outer ear (see Otitis externa) or middle ear (see Otitis media). In very rare cases following fracture of the skull, cerebrospinal fluid or blood may be discharged from the ear. INVESTIGATION AND TREATMENT

Any discharge from the ear should be reported to your physician. Tests may include performing /rearing tests and taking a swab of the discharge to produce a rnlture for laboratory analysis. It may be necessary to clean and carefully inspect the ear using a special microscope and/or take special X rays to rule out clwlesteatoma (a benign condition associated with chronic drainage from the ear).

Eardrum, perforated Rupture or erosion of the eardrum, usually as the result of acute otitis media (infection of the middle ear). CAUSES

In acute otitis media, pus builds up in the middle-ear cavity and, unless the infection is treated, the pressure may burst the eardrum. A hole may also be eroded in the eardrum as the result of chronic otitis media. Less common causes of rupture are inserting a sharp object into the ear to relieve irritation, a blow on the ear (usually a hard slap), a nearby explosion, fracture of the base of the skull, barotrauma (caused by air pressure change during flying or diving), or, very rarely, a tumor of the middle ear. The physician may puncture the eardrum to drain the middle ear and prevent rupture in a more critical area. TREATMENT ANO OUTLOOK

Anyone who suspects a perforated eardrum should first cover the ear with a clean, dry pad to prevent infection from entering the middle ear; next, consult a physician. An analgesic (painkiller) may be taken. The physician will prescribe antibiotic drugs to treat an y infection. Except in chronic otitis media that has damaged the sound-transmitting

386

bones in the middle ear, no other treatment is usually required, since the eardrum generally heals on its own. Normal hearing is restored within a month. If a perforation fails to heal or close sufficiently within six months, a myringoplasty (an operation in which the eardrum is repaired with a tissue graft from elsewhere in the body) may be performed. Many perforations can be healed with an office treatment that "freshens" the edges of the perforation so that it has another chance to heal on its own.

FIRST AID: FOREIGN BODY INEAR

·-------------. I I I I I I I

DO NOT

■ attempt to dislodge the

object by probing. Small objects must be removed by a physician ■ pour liquid into the ear unless you are certain the .. object is an insect

-------------

I I I I I I I

,I

TO REMOVE AN INSECT

Ear, examination of The ear requires examination any time the following symptoms develop: earache, discharge from the ear, loss of hearing, a feeling of fullness in the ear, disturbance of balance, tinnitus (noises in the ear), or swollen or tender lymph nodes below or in front of the ear. The physician can inspect only the pinna (the visible outer ear), the ear canal, and the eardrum. To investigate the middle and inner ears, more specialized tests are required. HOW IT IS DONE

The physician inspects the pinna manually for any evidence of swelling, tenderness, ulceration, or deformity and examines the skin above and behind the ear for signs of previous surgery. To inspect the ear canal and eardrum, the physician usually uses an otoscope (a viewing instrument for examining the ear). If necessary, a more magnified, three-dimensional image can be obtained by using a binocular microscope. To obtain images of the middle and inner ears, the physician may arrange for plain X rays, tomography, CT sca11ning, or MRI to be carried out. Hearing and balance may require assessment by means of hearing tests, caloric tests, and clcctronystagmography.

Ear, foreign body in The external ear canal is a common location for foreign bodies. Children often insert small objects, such as beads, peas, or stones, into their ears. lt is also possible for insects to fly or crawl into the ear. TREATMENT

These must always be removed by a physician. Under no circumstances should removal be attempted by poking with cotton swabs, hair pins, or similar objects; these efforts usually drive the object farther into the ear canal. SMALL OBJECTS

Tilt the victim's head so that the affected ear is facing upward . Pour lukewa rm water into the ear and the insect may float to the surface. If this fails. call your physician .

The physican will remove the object either by syringing or by grasping it with a pair of fine-toothed forceps. A brief general anesthetic may be required if the object is impacted, as often occurs with organic foreign bodies, such as beans, which swell when moistened by ear secretions. INSECTS An insect can sometimes be removed from the ear by having the person tilt his or her head so that the affected side is uppermost and then pouring oil or lukewarm water into the ear. If this is not successful, a physician will need to syringe the ear after killing the insect with chloroform or drowning it with oil. It is impossible for insects to penetrate the brain from the ear.

Ear piercing Making a hole in the earlobe or, occasionally, another part of the external ear, to accommodate an earring. Ear piercing was once performed with a needle, but the risk of transmitting diseases through the use of unsterile needles caused this method to be replaced by a special ear-piercing gun.

ECG HOW IT IS DONE

effusio11 in children. The tube equalizes

A local anesthetic is not necessary, since the procedure causes only minor discomfort. The ear lobe is pierced by a post or stud (sometimes called a sleeper), fired into it by the gun, which does not come into contact with the car. The posts are of gold or goldplate (cheaper metals can cause contact dcr111nt1tis), are kept sealed in a sterile pack before use, and are not handled during the procedure. For six weeks after insertion, the posts must be cleaned regularly with hydrogen peroxide or rubbing alcohol to prevent infection; the posts are kept in the ears and turned twice daily to prevent the hole from closing.

the pressure on both sides of the eardrum, permitting drainage. Tubes are usually allowed to fall out on their own, which generally occurs between six and 12 months after insertion. Children should not swim unless they wear special earplugs.

Ears, pinning back of See Otoplnsty.

Ear tube A small tube that can be inserted through the eardrum at 11111ri11goto111y (a surgical incision made in the eardrum) to treat persistent 111iddle-enr

Earwax A deep yellow or brown secretion, medically known as cerumen, produced by glands in the outer-ear canal. In most people, wax is produced in only small amounts, falls out on its own, and causes no trouble; in other people, so much wax forms that it regularly obstructs the canal, sometimes as often as every few months. Excess earwax may produce a sensation of fullness in the ear and, if the canal is blocked completely, partial deafness. These symptoms are made worse if water enters the ear and makes the wax swell. Prolonged blockage may also inflame the skin of the canal, causing irritation.

THE ELECTROCARDIOGRAM (ECG) Electrocardiography causes no discomfort. Electrodes connected to a recording machine are applied to the chest, wrists, and ankles. The machine displays the electrical activity in the heart as a trace on a moving graph or on a screen. Any abnormality is thus revealed to the physician . At below right are shown normal and abnormal recordings. An ECG can be taken at home, in the physician's office, or in the hospital; a 24-hour record can be obtained from a tape recorder worn by the patient.

Lead positions Recordings are taken with a lead attached to these positions

ECG Also sometimes called EKG, the abbreviation for electrocardiogram, a record of the electrical impulses that

Modern electrocardiograph A modern. lightweight, portable ECG machine . Leads from the machine are attached to the chest, wrists. and ankles using conducting jelly

0.4

l Normal rhythm

, The heart chambers are '-...;__..,__ contracting with complete regularity .

~ --r--l1--~-.., Seconds 0.2

Ecchymosis The medical term for a bruise.

~

R

0

Wax completely blocking the ear should always be removed. A firm plug of wax can be removed by a physician with a ring probe, rightangle hook, or forceps. If the wax is too soft for this, it can be softened further with oil and then flushed out with an ear syringe containing warm water. If there is a possibility that the eardrum is damaged, the physician uses suction instead of syringing. A person can remove his or her own earwax with mineral oil drops (for hard wax) or hydrogen peroxide drops (for soft wax) or with commercially available preparations. Cotton swabs should not be used. They can push wax deep into the canal, making the problem worse.

0.6

T Ventricular fibrillation Here, the contractions of the lower heart chambers are extremely irregular. Normal ECG This tracing shows the elect rical activity preced ing one normal heart beat. The vertical axis shows the current flowing toward the recording lead . The rise at P occurs just before the atria (upper heart chambers) begin to contract, the ORS "spike " occurs just before the ventricles (lower chambers) begin to contract, and the rise at T occurs as the electrical potential returns to zero

Complete heart block The upper and lower heart chambers are be ating independently

j

Atrial fibrillation Caused by the upper heart chambers beating fast and irreg ularly

387

ECHOCARDIOGRAPHY

immediately precede contraction of the heart muscle. The waves produced are known as the P,Q,R,S, and T waves. An ECG is a useful means of diagnosing disorders of the heart, many of which produce deviations from normal electrical patterns. Among these disorders are coro11ary

heart disease, coronary thrombosis, pcricarditis (inflammation of the

E

membrane surrounding the heart),

cardiomyopathy (heart muscle disorders), myocarditis (inflammation of the heart muscle), and arrhythmia (see Arrhythmia, cardiac).

Echocardiography A method of obtaining an image of the structure of the heart using ultrasound (inaudible, high-frequency, sound waves) . The sound is reflected differently by each part of the heart and a complex series of echoes results. WHY IT IS DONE

Echocardiography is a major diagnostic technique used to detect structural, and some functional, abnormalities of the heart wall, the heart valves, and the heart's large blood vessels. Blood flow across valves is also measured. The procedure is especially valuable for studying disorders of the heart valves. Abnormal opening and closing of the valves can be detected because they deviate from normal patterns of valve movement. Other diagnostic uses include detection of congenital heart disease (such as ventricular septa/ defect, a hole in the wall between the two lower chambers of the heart), various abnormalities of the large blood vessels, cardiomyopathy (enlargement or damage of the heart muscle), aneurysms (swellings caused by weakening of the heart wall or the walls of blood vessels), the presence of a blood clot within the chambers of the heart, and pericarditis. HOW IT IS DONE

Echocardiography is harmless and the patient feels nothing; it has the added advantage of producing recordings without having to place an instrument inside the patient's body. The transducer (the instrument that sends out and receives sound signals) is placed on the chest in a position that alfows its sound waves to reach the structures under investigation. The echoes are detected, amplified, and then displayed visually as a series of lines on an oscilloscope screen or a paper tape. This information is interpreted by cardiologists as a picture of the heart and its valves and the way they are working. 388

Echocardiography has become more sophisticated and methods have been developed that incorporate a moving transducer, or a set of transducers, attached to a computer. This allows a series of different views of the heart to be obtained, and a twodimensional scan can thus be produced. When recorded on videotape, an easily recognizable ficture of the activity of the interior o the heart can be seen . Another recently developed feature is Doppler echocardiography. This technique can indirectly measure the flow velocity of blood as it passes through the heart. It can be useful in assessing malfunctioning valves (e.g., in aortic stenosis or mitral insufficiency) and in assessing patients with congenital heart disease.

Echolalia The compulsive repetition of what is spoken by another person . The tone and accent of the speaker are copied as well as the actual words. It is an unusual symptom of catatonic schizophrenia and sometimes also occurs in people suffering from autis111 and some forms of 111rntal retardation. Echolalia may be accompanied by echopraxia (imitating the behavior of another person) .

Eclampsia A rare, serious condition of late pregnancy, labor, and the period following delivery . Eclampsia is characterized by seizures (convulsions) in the woman, sometimes followed by coma and death; eclampsia also threatens the life of the baby. The disorder occurs as a complication of moderate or severe (but not mild) preec/a111psia, a common condition of late pregnancy that is marked by hyperte11sio11 (high blood pressure), protein11ria (protein in the urine), and edema (an excessive accumulation of fluid in the tissues). CAUSES

Both preeclampsia and eclampsia are believed to be caused by a substance or toxin produced by the placenta, the organ in the uterus that sustains the unborn child. To date, however, extensive investigations have failed to identify the cause. Eclampsia occurs more commonly in women who have had little or no prenatal care . Preeclampsia develops in these women without it being recognized and treated. INCIDENCE

About half of all cases develop in late pregnancy, one third during labor, and the rest after delivery .

SYMPTOMS AND SIGNS

In eclampsia the symptoms that characterize severe preeclampsia are present. In addition, before the onset of seizures, the woman may suffer from headache, confusion, blurred vision, and abdominal pain . The seizures consist of violent, rhythmic, jerking movements of the limbs caused by involuntary contraction of the muscles; there may also be breathing difficulty caused by constriction of the muscles of the larynx. The seizures may sometimes be followed by coma. TREATMENT

The seizures are treated by ensuring that the woman can breathe properly (sometimes by inserting an endotracheal tube down her throat) and by giving a11ticonv11/sant drngs, which prevent further seizures. The baby's condition is monitored throughout. Rapid delivery (often by emergency cesarea11 section) is usually performed, since the condition often clears once the baby is born. OUTLOOK

About one third to one half of babies fail to survive eclampsia, usually because of lack of oxygen in the uterus . Of these deaths, half occur before delivery, the others soon after . After delivery, the mother's blood pressure usually returns to normal within a week and proteinuria clears within six weeks. In about 5 to 10 percent of cases, however, serious complications develop in the woman before, during, or after delivery. These may include failure of the heart and lungs, kidney, or liver, intracerel1ra/ hemorrlwge, p11eumo11ia, or pulmonary edema.

Econazole An a11tif1111gal drug used in the form of a cream to treat fungal skin infections (see Athlete's foot; Tinca). Econazole is also prescribed to treat cn11didiasis . Econazole is a fast-working antifungal drug (usually beginning to act within two days). Skin irritation is a rare adverse effect.

ECT The abbreviation for electroconvulsive therapv, which uses an electric shock to induce a seiwrc as a form of psychiatric treatment . Muscle-rela xant drugs are used to minimize movements of the bodv and the effects of ECT are limited primarily to the brain . WHY IT IS USED

ECT is used almost exclusively to treat severe depressive illne ss that is caus-

ECTOPIC PREGNANCY

ing symptoms such as weight loss or apathy. lt is used less widely to treat postpartum depression, catatonic schizophrenia, and some cases of mania that have not responded to other treatments. ECT is not used to treat people with severe physical illness or those who have had a recent myocardial infarction (heart attack). HOW IT IS DONE

The patient is given an anesthetic and a muscle relaxant before two padded electrodes are applied to the temples, one on each side or both on the same side. A controlled electric pulse is delivered to the electrodes from a small machine until the patient experiences a brain seizure. The seizure is indicated by brief muscular rigidity, followed by twitching of the limbs and eyelids. Afterward, patients experience only a mild discomfort similar to the discomfort felt after a minor dental operation. Treatment usually consists of six to 12 seizures (two or 'three per week). OUTLOOK

If a true brain seizure has been induced at each session, the patient's condition usually begins to improve

Ectopic pregnancy A pregnancy that develops outside the uterus, most commonly in the fallopian tube, but sometimes in the ovary or, rarely, in the abdominal cavity or cervix. It is a cause of acute abdomen (see Abdomen , arnte). INCIDENCE AND CAUSE

About one in every 100 pregnancies is ectopic. The fertilized ovum (egg) may become "stuck" in the fallopian tube if the tube is damaged or abnormal in any way. Ectopic pregnancies are more common if there is some congenital abnormality of the fallopian tubes, if the tubes have been previously operated on or infected, or if the woman has an IUD . They are also more likely if the woman has been taking the progesterone-only birth-control pi!I, has ingested postcoital hormonal contraception, or has undergone a (failed) sterilization, especially if the fallopian tubes have been cauterized.

by the third treatment, often dramatically. Temporary amnesia is a possible side effect.

Ectasia A medical term for widening or distention, usually used to refer to a disorder affecting a duct that carries secretions from a gland or organ. For example, mammary duct ectasia- a rare disorder that affects mainly menopausal women- is widening of the ducts that carry secretions from the tissues of the breast to the nipple (sec Breast).

-ectomy A suffix denoting surgical removal. Tonsillectomy is surgical removal of the tonsils .

Ectoparasite A parasite that lives in or on its host's skin and

~~;i~~fn 1~ru~~~~ct~~tf~

host's blood. Various lice, ticks, mites, and some types of fungi are occasional ectoparasites of humans. By contrast, endoparasites live inside the body. nal pain and vaginal spotting. After rupture or internal hemorrhage, the symptoms of internal bleeding appear- pallor, sweating, weakness, and faintness. COMPLICATIONS

An ectopic pregnancy may cause the woman to go into shock due to severe loss of blood when the developing fetus damages the surrounding strucFallopian tube

Ectopic heart beat A contraction of the heart muscle that is out of the normal timed sequence. An ectopic heart beat occurs shortly after a normal beat and is followed by a longer than usual interval. Ectopic beats can occur in a heart that is otherwise functioning normally and may cause no symptoms. Multiple ectopic beats can sometimes cause

palpitations. After a myocardial infarction (heart attack), the occurrence of multiple ectopic beats is a sign of damage to the conduction system of the heart muscle. Multiple ectopic beats may lead to ventricular ftbn/lation, a rapid uncoordinated heart beat that can cause collapse and death . Multiple ectopic beats that are causing palpitations, or that occur after a myocardial infarction, are often treated with an a11tiarrh11thmic drug . (See also Arrhythmia, cardiac.) tures . Ectopic pregnancies are lifethreatening and are responsible fur about 10 percent of maternal deaths (deaths as a result of pregnancy or its complications). In the US approximately 50 women die each year as a result of ectopic pregnancy. DIAGNOSIS

The physician usually performs a pregnancy test on any sexually active woman of childbearing age who has persistent, unexplained lower abdominal pain. Ultrasound scanning and a laparoscopy (examination of the abdominal cavity with a viewing instrument) may also be performed. TREATMENT

Once an ectopic pregnancy is confirmed, an operation is performed to remove the developing fetus, the placenta, and any damaged tissue at the site of the pregnancy. Any torn blood vessels are repaired and, if the fallopian tube cannot be repaired, it is removed. If blood loss has been severe, transfusions are needed.

SYMPTOMS AND SIGNS

Most ectopic pregnancies are discovered in the first two months, often before the woman realizes she is pregnant. In most cases a menstrual period is missed, but, in about 20 percent of the women, menstruation occurs. Symptoms of ectopic pregnancy usually include severe abdomi-

Ectopic A medical term used to describe a structure that occurs in an abnormal location or position or an activity that occurs at an abnormal time.

OUTLOOK

Location of an ectopic pregnancy The pregnancy usually develops in the fallopian tube; occasionally it develops in the ovary, abdominal cavity. or cervix.

It is still possible to have a normal pregnancy even if one fallopian tube has been removed, although the chances of conception are slightly reduced. Women with two damaged tubes may require i11 vitro fcrtilizati011 to achieve an intrauterine pregnancy. 389

E

ECTROPION

Ectropion A turning outward of the eyelid so that the inner surface is exposed. INCIDENCE AND CAUSE

E

Ectropion most commonly occurs in elderly people because of weakness of the muscle surrounding the eye; it usually affects the lower lid. It may also be caused bv the contraction of scar tissue (from' wounds, burns, or surgical treatment) in the skin near the lids. In these cases, the upper lid may be affected. Ectropion often follows facial palsy, in which the muscles surrounding the eye (and other facial muscles on that side) are paralyzed.

The appearance of ectropion An example of ectropion affecting the lower eyelid of one eye The lid is turned outward to reveal the lining of its inner surface .

family, may also have other allergies, such as ast'1111a or allergic rhinitis. Atopic eczema is common in babies and often appears between the ages of 2 and 18 months. A mild but intensely itchy rash occurs, usually on the face , in the inner creases of the elbows, and behind the knees. The skin often scales in these areas, and small red pimples may appear. As the baby scratches, the pimples begin to "weep" (leak) and join to form large weeping areas. Infection may occur, particularly in the diaper area. For mild cases, treatment consists of applying emollients, such as petroleum jelly, which help keep the skin in the infected area soft. In severe cases, corticosteroid ointments may be prescribed, and 1111tibiotic drngs may be given for infection. Antilzista111i11c drugs may be prescribed to reduce itching, particu1arly if it keeps the baby awake at night. It is important to prevent the baby from becoming too hot (e.g., by wearing too many clothes), which aggravates the condition. Only cotton clothing, which is nonirritating and absorbent, should be in direct contact with the skin.

GENERAL TREATMENT

SYMPTOMS AND SIGNS

Even slight ectropion interferes with normal drainage of tears by distorting the opening of the tear duct. Chronic co11j1111ctiuit1s mav result, with redness, discomfort, and overflow of tears so that the skin becomes damp and inflamed . Constant wiping tends tu pull the lid farther from the eye. TREATMENT

Lid-tightening surgery (the removal of a wedge of tissue from the lid) is simple and effective in the early stages of ectropion. Even plastic surgery with skin grafting is liable to fail if the condition is long-standing.

Eczema An inflammation of the skin, usually causing itching and sometimes accompanied by scaling or blisters. Some forms of eczema are better known as dermatitis (such as seborrheic dermatitis, contact dermatitis, and photodermatitis) . Eczema is sometimes caused by an allergy, but often occurs for no known reason . TYPES

This chronic, superficial inflammation occurs in people who have an inherited tendency toward allergy. They, or members of their ATOPIC ECZEMA

390

help reduce inflammation, although the disorder is persistent and often resistant tu treatment. HAND ECZEMA This type is usually a result of irritation by substances such as detergents, household cleansers, and dishwashing liquid, but may occur for no ascertainable reason. Itchy blisters, up to about 1 inch (2.5 cm) across, develop, usually on the palms, and the hand may be covered with scales and cracks. Tests are performed to check for allergy. Hand eczema usually improves if rubber gloves are worn over white cotton gloves when in contact with any irritants. The hands should be thoroughly patted dry after washing. An unscented hand cream should be applied several times a day. If severe, corticosteroids may be prescribed for the inflammation and antibiotics may be given for infection. STASIS DERMATITIS In people with varicose veins, the skin on the legs may become irritated, inflamed, and discolored. The most important factor is swelling of the legs, which may be controlled with compression bandages or special stockings. Mild corticosteroid ointments may give temporary relief.

Atopic eczema An example of atopic eczema on the creases of the inner wrist. showing the characteristic pimples and raw. scaling skin Because the rash is intensely itchy . scratching is usually inevitable and aggravates the condition

Atopic eczema often clears of its own accord as the child grows older, although it may come and go for several years before disappearing finally. Most children outgrow the condition by the time they reach puberty. NUMMULAR ECZEMA This type usually occurs in adults . The cause is unknown . Nummular eczema takes the form of circular, itchy, scaling patches anywhere on the skin , similar to those of thl' iungal infection ti11ca (ringworm}, from which the eczema needs to be distinguished . Corticosteroid ointments may be applied to the affected skin to

Tu reduce irritation and the likelihood of scratching, a soothing ointment should be applied to the affected areas, which should then be covered by a dressing to prevent scratching. Absorbent, nonirritating materials such as cotton should be worn next to the skin; irritating fabrics such as wool, silk, cmd rough synthetics should be avoided .

Edema An abnormal accumulation of serumlike fluid in the body tissues . It may or may not be visible (as a swelling) and can be either local (as following an injury) or general (as in heart failure) . Generalized edema (also called anasarca) was once popularly known as dropsy . WATER BALANCE IN THE BODY

Water accounts for roughly three fifths of body weight and it is constantly exchanged between bloo~ and tissues. Water is forced out ot the capillaries and into the tissues by the press ure of blood being pumped around the body. By a reverse process, which depends on the waterdrawing power of the proteins in the blood (see Osmosis), it is reabsorbed into the capillaries from the tissues . These two mechanisms normally are

EEG

If a finger is pressed into skin swollen by edema, it makes an indentation that slowly flattens out as the fluid seeps back.

in balance, keeping the levels of water in the blood and the tissues more or less constant. Another factor involved in maintaining this balance is the action of the kidneys, which pass excess salt from the blood into the urine to be excreted from the body.

TREATMENT

CAUSES OF EDEMA

Various disorders can interfere with these processes. Heart failure leads to blood congestion in the veins, creating backward pressure in the capillaries. This backward pressure overcomes osmotic pressure in the capillaries and thus causes more fluid than normal to be forced into the tissues at various places throughout the body. Backward pressure can also be created by a tumor pressing on veins. The edema produced is confined to the area drained by the obstructed vein. In the nephrotic syndrome, there is an abnormal loss of protein from the blood, which reduces its osmotic pressure and prevents enough fluid from being drawn from the tissues into the blood. Renal failure prevents salt from being excreted from the body, allowing it to accumulate in the tissues and attract water to it. Other disorders that can cause edema include cirrhosis of the liver, which leads to blood congestion in the veins of the liver, lowers blood protein (and therefore osmotic pressure), and causes salt retention. A deficiency of protein in the diet, as may occur in alcoholics, can also reduce osmotic pressure; edema in alcoholics may also be due to deficiency of thiamine (vitamin B1), leading to beriberi. Injury may cause edema by damaging capillaries and thus allowing fluid to leak out of them. Lymphedema may result from blocked lymphatics. Finally, certain drugs may cause edema. These include corticosteroid and androgen drugs, and high-estrogen oral contraceptives, which act on the kidneys, causing a certain amount of salt retention. Antidiuretic hormone (see ADH) increases water retention by the kidneys. SYMPTOMS AND SIGNS

Until the excess fluid in the body increases by more than about 15 percent, edema may show itself only as an increase in weight. After that it is evident as a swelling, often in the lower part of the body, commonly in the lower back and around the ankles. In severe cases, fluid accumulates in one or more of the large body cavities. For example, in ascites, fluid collects in the peritoneal cavity of the abdomen,

Chronic edema An example of chronic edema, showing the characteristic swelling and stretched, shiny skin. In this patient, the skin of the left leg is also ulcerated.

The aim is always to remedy the underlying cause of the edema. ln many cases, however, the underlying cause is not remediable and the only treatment is to make the body excrete the excess fluid by increasing the output of urine by the kidneys . This is done by restricting dietary sodium and taking diuretic drugs, which the patient may need indefinitely.

Edentulous Without teeth, either because they have not yet grown or because they have fallen out or been removed.

causing abdominal swelling. In pleural effusion, fluid fills the pleural cavity of

EEG

the lungs, resulting in compression of the lungs and breathing difficulty. In pulmonary edema, the air sacs of the lungs become waterlogged, again causing breathing difficulty.

The abbreviation for electroencephalogram. An EEG records the minute electrical impulses produced by the activity of the brain. The technique of electroencephalography was first

HOW ELECTROENCEPHALOGRAPHY IS DONE A number of small electrodes are attached to the scalp. Shaving of the scalp is unnecessary. The electrodes are connected to an instrument that measures the brain's impulses in microvolts and amplifies them for recording purposes. The technique is painless, produces no side effects, and takes about 45 minutes. Recordings are taken with the subject at rest, with eyes open and then shut, during and after hyperventilation, and while looking at a flashing light. It is also helpful , espec ially when epilepsy is suspected , to record activity as the patient goes to sleep. EEG wave patterns Alpha waves The prominent pattern of an awake, relaxed adult whose eyes are closed .

Beta waves The lower, faster oscillation of a person who is concentrating on an external stimulus.

Delta waves The typical pattern of sleep, but also found in young infants; rarely, they are caused by a brain tumor.

Theta waves The dominant waves of children aged 2 to 5; also produced by frustration and found occasionally in psychopaths.

391

E

EFFUSION

used in medicine in 1928, although it was known since the nineteenth century that electrical impulses could be recorded from animal brains. WHY IT IS DONE

E

An EEG indicates, by the frequency of the recorded activity, the mental state of the subject-that is, whether he or she is alert, awake, or asleep. Also, by revealing characteristic wave patterns, the EEG can help in diagnosing certain conditions, especially epilepsy and certain types of encephalitis, demen tia, and tumors. Electroencephalography can also be used to monitor the conditions of patients during surgery and to assess the depth of anesthesia on the brain and spinal cord. It is also used as a test for brain death, but it is not required to make the determination.

Effusion The escape of fluid through the walls of a blood vessel into a tissue or body cavity, often as a result of a vessel being inflamed or congested . For example, pleurnl effusio11, a symptom of heart failure, occurs when raised blood pressure in the veins leads to fluid being forced out of the blood and through the walls of capillaries into the pleural cavity that surrounds the lungs.

Effusion, joint Accumulation of fluid within a joint space, causing swelling and sometimes pain and tenderness. A joint is enclosed by a capsule lined with a membrane called the synovium. This membrane normally secretes small amounts of fluid to lubricate the joint, but if it is damaged or inflamed (by arthritis, for example) it produces excessive amounts of fluid.

Location of knee joint effusion Excessive production and accumulation of fluid within a knee joint may be caused by injury or inflammation.

392

TREATMENT

Analgesics (painkillers), anti-inflammatory drugs, and corticosteroid injections help relieve pain and inflammation . The swelling can be reduced by rest, firm wrapping with a bandage, ice packs, and, when possible, keeping the affected joint raised. In some cases, the fluid may need to be aspirated (drawn out) with a hypodermic needle and syringe. Antibiotics may also be given if the cause is infective arthritis (also called septic arthritis). Physical therapy may be necessary later to restore full movement to the joint.

Egg See Ovum.

Ego The conscious sense of oneself, equivalent to "I." In Freudian psychoanalytic theory, this part of the personality maintains a balance between the primitive, unconscious instincts of the id, the controls of the superego (or conscience), and the demands of the outside world.

Egomania An unhealthy overconcern with oneself. People described as egomaniacs talk constantly about themselves or their own activities, to the exclusion of everything else. Egomania is not regarded as a mental disorder, but such extreme self-conceit is sometimes said to indicate underlying mental instability.

Ehlers-Danlos syndrome An inherited disorder of collagen, the most important structural protein in the body. Affected individuals have abnormally stretchy, thin skin that bruises very easily. Wounds are slow to heal and leave paper-thin scars . Sufferers tend to bleed easily from the gums and gastrointestinal tract. The joints are exceptionally loose and are prone to recurrent dislocation . Ehlers-Danlos syndrome is usually (although not always) inherited in an autosomal dominant pattern (see Genetic disorders). This means that many affected individuals have an affected parent; each of an affected person's children has a 50 percent chance of being affected. There is no known specific treatment for Ehlers- Danlos syndrome, although unnecessary accidental injury, as may occur in contact sports, should be avoided. The outlook for a normal life expectancy is good.

Eisenmenger complex A complication of ventricular sepia/ defect (a hole in the heart between the two pumping chambers). Normally, the ventricles are separate and no blood flows between them . The pressure of blood flow from the left ventricle is normally much higher than from the right; when a ventricular septa! defect exists, the shunt of blood from the left to the right ventricle raises the pressure of blood flow to the lungs, and there is a gradual rise in blood pressure in the pulmonary (lung) arteries . If the defect is not corrected surgically within the first few years of life, the prolonged pulmonary hypertension damages small blood vessels in the lung tissue and increases the resistance to blood flow, making it harder and harder to pump the blood through the lungs. As the pressure increases, it reverses the flow of blood through the septa! defect so that blood then flows from the right ventricle to the left. At first this reversal is intermittent, often associated with exercise. Deoxygenated blood (blood that is on its way to the lungs to receive oxygen) instead of going to the lungs to get oxygen, gets passed directly into the body. SYMPTOMS AND SIGNS

Eisenmenger complex causes breathing difficulty, fainting during exercise, and cyanosis (blue skin) due to hypoxia (lack of oxygen in the blood) . The diagnosis is confirmed by cardiac cathelerizatio11 (the insertion of a thin tube into the heart via a blood vessel under X-ray control) . TREATMENT AND OUTLOOK

Once permanent changes have developed, surgical correction of the ventricular septa! defect does not help because the lung damage has already occurred. Most affected people die in their 30s or 40s. The only treatment in a severely disabled individual is a '1eart-/1111g tra11spla11t . (See also Heart

dist'ase, co11ge11ital.)

Ejaculation The emission of semen from the penis at orgasm . Ejaculation is a reflex action that depends on regular and rhythmic pressure on the penis, usually during intercourse or masturbation. This stimulation acts on spinal nerve s and triggers ejaculation. Shortly before ejaculation the mu scles around the epididymides (ducts where sperm are stored) , the prostate gland, and the seminal vesicles contract rhythmically, forcing the

ELDERLY, CARE OF THE

EJACULATORY DISORDERS

Premature ejaculation

Premature ejaculation is the most common sexual problem in men and is especially common in adolescents. Most adult men occasionally experience premature ejaculation. often because of overstimulation or

anxiety about sexual performance. If premature ejaculation occurs frequently, the cause may be psychological. Sexual counsel ing and techniques for delaying ejaculation may help (see Sex therapy) .

Inhibited ejaculation

Inhibited ejaculation is a rare condition in which erection is normal, or even prolonged. but ejaculation does not occur. It may be psychological in origin, in which case sexual counseling may help. or it may be a

complication of other disorders. such as diabetes mellitus . Inhibited ejaculation may also occur during treatment with certain drugs. such as some anti hypertensives.

Retrograde ejaculation

In this disorder, the valve at the base of the bladder fails to close during ejaculation. This forces the ejaculate backward into the bladder. Retrograde ejaculation can occur as a result of a neurological disease. after

surgery on the neck of the bladder. after prostatectomy, or after extensive pelvic surgery. There is no treatment, but intercourse with a full bladder can sometimes lead to normal ejaculation.

sperm from the epididymides to move forward and mix with the secretions from the seminal vesicles and prostate. At ejaculation, this fluid is propelled through the urethra and out of the body. Because both semen and urine leave the body by the same route, a valve at the base of the bladder closes during ejaculation. This not only prevents ejaculate from going into the bladder but also stops urine from contaminating the semen.

ANATOMY OF THE ELBOW

The elbow is a hinge joint between the lower end of the humerus and the upper ends of the radius and ulna. The biceps muscle bends and rotates the arm at the elbow.

1.Y..--\-+ - -- -

1o+1++-4,

oa 'via:------1--11-s~\a00~,9-a.0~ o\ (:' 'fJatifJg

J

.i ll

;'

~ ,?_•.::,_.

8

FOOT

or food additives. It may be associated with an adverse reaction to foods such as green peppers, fried foods, or onions. Food intolerance can be caused by an inborn or acquired biochemical defect, such as lactase deficirncy (an inability to digest milk sugar found more commonly in blacks, Asians, Indians, and people of Mediterranean origin).

Food poisoning A term used for any illness of sudden onset, usually with stomach pain, vomiting, and diarrhea, suspected of being caused by food eaten within the previous 48 hours. Most cases are the result of contamination of food by bacteria or viruses. Food poisoning is usually suspected when, for example, several members of a household (or customers at a restaurant) become ill after eating the same food. TYPES AND CAUSES

Food poisoning can be classified, according to cause, into infective and noninfective types. Some foods can cause poisoning of either type. For example, shellfish such as mussels, clams, and oysters can become contaminated by viruses or bacteria, by toxins acquired from poisonous plankton (tiny marine animals and plants), or by chemical pollutants in the water. BACTERIAL CAUSES The bacteria most commonly responsible for food poisoning belong to a group called salmonella, certain strains of which are able to multiply rapidly in the intestines to cause widespread inflammation. Some farm animals, especially poultry, commonly harbor such bacteria. If frozen poultry is not completely thawed before being cooked, it is liable to cause poisoning. Salmonella bacteria may also be transferred to food from the excrement of infected animals or people, either by flies or by the handling of food by an infected personespecially if the hands have not been washed after using the toilet. If contaminated food is left for any time in warm conditions, a large colony of bacteria may develop without obvious food spoilage. Other bacteria cause the formation of toxins that may be difficult to destroy even with thorough cooking. Toxin-forming strains of staphylococcal bacteria, for example, may spread to food from a septic abscess on a foodhandler's skin. Botulism is a rare, lifethreatening form of food poisoning

caused by a bacterial toxin and associated with home preservation of food. VIRAL CAUSES The viruses that most commonly cause food poisoning are Norwalk virus (a common contaminant of shellfish) and rotavirus. They cause food poisoning when raw or partly cooked foodstuffs have been in contact with water contaminated by human excrement. NONINFECTIVE CAUSES include poisonous mushrooms and toadstools {see Mushroom poiso11i11g), and fresh fruit and vegetables that have been accidentally contaminated with high doses of insecticide. Chemical poisoning can also occur if food has been stored in an unsuitable container-for example, if a container that has previously held a poison is used to store food, or if acidic fruit juice is kept in a metal container made partly of zinc. Various exotic foods (for example, the puffer fish, considered a delicacy in Japan, or cassava, a staple food in many tropical countries) can also cause moderate to lethal poisoning if improperly prepared and cooked. SYMPTOMS

The onset of symptoms varies according to the cause of poisoning. The symptoms usually develop within 30 minutes in the case of chemical poisoning, between one and 12 hours in the case of bacterial toxins, and between 12 and 48 hours with virus and salmonella infections. Symptoms vary considerably according to how heavily the food was contaminated, but usually include nausea, vomiting, diarrhea, stomach pain, and, in severe cases, shock and collapse. The symptoms of botulism are markedly different, with nervous system symptoms such as difficulty speaking, visual disturbances, muscle paralysis, and vomiting. DIAGNOSIS

The diagnosis of bacterial food poisoning can usually be made from a culture of a sample of the person's vomit or feces. Chemical food poisoning can often be diagnosed from a description of what the person has eaten within the previous few hours, and from analysis of a sample of the suspect food, if available. FIRST AID AND TREATMENT

If severe vomiting and diarrhea suddenly develop (or if a person collapses), medical assistance should be sought. Samples of any food left from a recent meal should be kept; they may help pinpoint the cause and possibly prevent a widespread outbreak of food poisoning.

If roisoning by a chemical or bacteria toxin is suspected, gastric lavage (washing out the stomach) may be carried out. Otherwise, treatment in a hospital is directed primarily toward preventing dehydration by replacing fluids intravenously. Milder cases can be treated at home. The affected person should eat no solid food but should drink plenty of fluids, which should include some salt and sugar to replace what is being lost (see Rehydration therapy). Except for botulism and some cases of mushroom poisoning, most food poisoning is not serious. Recovery generally occurs within three days. PREVENTION

Some simple measures can virtually eliminate the chances of food poisoning. Hands should always be washed before handling food, and fresh vegetables and fruit rinsed in clean water. Cutting boards and implements used on raw meat should also be rinsed before they are used on other food. Frozen poultry should always be completely thawed before cooking and then should be well cooked. Ask for advice on the preparation of any food unfamiliar to you at the point of sale. Suspect items-such as mussels that do not open when boiled, bulging tin cans, or any food that smells or looks obviously spoiledshould be rejected. Finally, people who preserve food at home should take care to sterilize food thoroughly by heatin 2 it in a pressure cooker at 250°F (120 C) for 30 minutes.

Foot The foot has two vital functions-to support the weight of the body in standing or walking and to act as a lever to propel the body forward. STRUCTURE

One of the bones of the foot is the calcaneus (heel bone); it is jointed with the talus, the second largest bone of the ankle. In front of the talus and calcaneus is a series of smaller bonesthe navicular, cuboid, and cuneiform. These in turn are jointed with five long bones called the metatarsals. The phalanges are the bones of the toes; the big toe has two phalanges, all the other toes have three. Tendons passing around the ankle connect the muscles that act on the various bones of the foot and toes. The main blood vessels and nerves pass in front of and behind the inside of the ankle joint to supply the foot. The undersurface of the normal foot forms a natural arch that is supported by

463

F

FOOTOROP

SKELETON OF THE FOOT

The calcaneus is attached to the talus above. In front are the navicular, cuboid , and cuneiform bones , which are attached to the metatarsals. Phalanges form the toes . An adult has 26 bones in each foot-one eighth of the total number in the entire skeleton.

Footdrop

Forceps delivery

A condition in which the foot cannot be raised properly. It hangs limp from the ankle joint, causing it to catch on the ground when walking.

The use of forceps (see Forceps , obstL'fric) by an obstetrician to ease out the baby's head during a difficult birth (see also Childbirth). Varnum extraction may be used as an alternative.

CAUSES

Neuritis (inflammation of a nerve) affecting the nerves that supply muscles that move the foot is a common cause of footdrop; it may be due to diabetes 111e/lit11s, 11111/tiple sclerosis, or certain neuropathies (see Neuropathy) . Pressure on a nerve root as it leaves the spinal cord due to disk prolapse or, rarely, a tumor can also cause weakness in the foot muscles. TREATMENT

__,_,__ _ _ Navicular --+-,-+,,+-,f - - -- Cuneiforms

Metata rsals

The underlying cause is treated, but in many people the weakness persists. A footdrop splint (see Brace, orthopedic) can keep the foot fixed in position when walking.

Foramen Phalanges

ligaments and muscles. Fascia (fibrous tissue) and fat form the sole of the foot, which is covered by tough skin. DISORDERS

Injuries to the foot commonly result in fracture of the metatarsals and phalanges. The calcaneus may fracture following a fall from a height onto a hard surface. Deformities of the foot are fairly common and include talipes (clubfoot), flatfoot, andclawfoot. Another common deformity is a bu11ion, which is a bursa (fluid-filled pad) overlying the joint at the base of the big toe. A number uf disorders can affect the skin of the foot. Corns, small areas of thickened skin on a toe, are usually caused by tight-fitting shoes. Pla11tar warts appear on the skin on the sole, while athlete's foot, a fungal infection, mainly affects the skin between the toes, causing it to become itchy, sore, and cracked. Gout, a fairly common type of arthritis, often affects the joint at the base of the big toe or one of the joints in the foot. lni,;rown toenail commonly affects the nai) of the big toe, causing inflammation of the surrounding tissue and paronychia (infection of these tissues). Footdrop, the inability to raise the foot properly, is due to damage to the muscles in the leg that perform this movement or the nerves that supply these muscles.

464

A natural hole or passage in a bone or other body structure, usually to allow the passage of nerves or blood vessels. The foramen magnum is the large opening in the base of the skull through which the spinal cord passes.

Forceps A tweezerlike instrument used for handling tissues or equipment during surgical procedures. Various types of forceps are designed for specific purposes. For example, forceps used for holding or removing wound dressings have scissor handles to make manipulation easier. Tissue forceps have fine teeth at the tip of each blade so that tissues can be handled delicately during operations. (See also

Forceps delivery; Forceps , obstetric.) TYPES OF FORCEPS Dressing forceps

WHY IT IS DONE

Forceps delivery is used if the mother is overtired or unable to push out her baby unaided, or if the baby is showing signs of fetal distress. (If fetal or maternal distress occurs before the second stage of labor begins, a cesarean section rather than a forceps deli very is necessary.) Forceps are used to control the head in breech delivery (with the baby's buttocks first) to prevent a too-rapid delivery. Forceps are also used if the baby's head is stuck in the middle of the mother's pelvis and needs to be rotated before delivery is possible. Called a midforceps delivery, this requires extreme skill on the part of the obstetrician; a cesarean section may be performed instead . HOW IT IS DONE

The mother is given an analgesic (painkill er) and either local or epidural a11csthesi11. She then lies on her back, with her legs raised in stirrups, and her bladder is emptied with a catheter. The obstetrician then examines the mother. Forceps can be applied only if the cervix (neck of the uterus) is fully dilated and the baby's head is engaged in the felvis. An cpisiotomy (making of a smal cut in the perineum) is usually performed before a forceps delivery . The forceps blades are placed on either side of the infant' s head , just in front of the ears. If the baby's chin points downward, gentle traction is applied to the forceps and the baby delivered. If the chin is pointing sideways or upward, rotation of the head is necessary before traction can be applied; in such cases, rotation forceps are used. RECOVERY PERIOD

After a forceps delivery, care is similar to that following a spontaneous (unassisted) vaginal delivery. Sometimes there is greater bruising of the perineum, but thi s usually heals rapidly and can be eased by the application of ice packs. After a forceps delivery, the baby may have forceps marks on th e face. They disappear after a few days. The length of stay in the hospital is usually the same as after a delivery without forceps.

Artery forceps

Forceps, obstetric Locking handles

Surgical instruments u sed to deliver the head of a baby in a difficult labor.

FORENSIC MEDICINE

foreig11 body in), eye (see Eye, foreign body i11), rectum, urethra, and vagina. A metallic, glass, or wood splinter that embeds in the subcutaneous tissue is also a foreign body.

OBSTETRIC FORCEPS The two wide, blunt blades are designed to fit around the baby's head. The handles lock together so that the blades are held apart.

Foreign medical graduate Graduates of non-US medical schools, even if US citizens . Foreign medical graduates (FMGs) may qualify for training in US residency programs and for subsequent licensing after successfully passing a test of language and medical ski!Is. Positioning The forceps blades lie along the sides of the baby's head , just in front of the ears

The first obstetric forceps were invented about 300 years ago by the obstetrician Peter Chamberfen. They were kept as a family secret for use on private patients, and were not in common use until about 100 years later. Obstetric forceps consist of two blades that cup the baby's head. Each blade is joined to a separate handle and the two handles are fitted together; when assembled, the blades

are separated by a fixed distance (see illustrated box).

Foreign body Any object in an organ, opening, or passage of the body that should not be there. It may enter accidentally (by inhalation or swallowing, for example) or it may be deliberately introduced. Common sites include the airways (see C/10ki11g), ear (see Enr,

Forensic medicine The branch of medicine concerned with the law, especially criminal law. The forensic pathologist is a physician who specializes in the examination of bodies when circumstances suggest death was unnatural (i.e., suicide, homicide, or an accident). The examination usually includes an assessment of the time of death (from data such as the temperature of the corpse and its state of decomposition), deduction of the likely nature of any weapon used (from study of the injuries), and matching of blood, hair,

COMMON FOREIGN BODIES IN CHILDREN Chi ldre n constantly experiment with objects in the environment. They frequently place small objects into their mouths, noses, or ears. As a result , a Ear and nose Attempting to remove a foreign body from the ear can be dangerous because of the risk of pushing the object further in . The physician uses a syringe, suction, or forceps . A foreign body in the nose may be taken out with tweezers by the physician; an older ch ild may be able to blow it out while the other nostril is blocked

Lungs Inhaled objects such as peanuts or teeth may become lodged in the bronchi and cause obstruction of air flow , resulting in pneumonia or lung collapse. Symptoms may include choking , coughing, and breathing difficulty. The child should not be inverted , slapped on the back, or made to vomit. but should be taken to the hospital immediately.

swa llowed or stuck foreign body is a common occurrence. It is wise to keep all small objects well out of reach of children .

X ray of foreign body This X ray shows that the child has swallowed a closed hair barrette. Stomach Foreign bodies in the stomach include coins. batteries, marbles, and buttons Most small , smooth objects pass safely out of the body in feces, but an object that has failed to pas s through the body after seven to ten days usually requires removal. Batteries should be removed surgically because they release acid that seriously damages the digestive tract.

465

-

F

FORESKIN

F

and skin from the victim with those on any weapons, on the clothing of suspects, oron parts of an automobile. Forensic pathologists may also be asked to examine victims of alleged sexual assault or child abuse. They also consult in cases of attempted poisoning and possible drug deaths. Forensic scientists use laboratory methods to study body fluids (such as blood, semen, and saliva) found on or near the victim and compare the fluids with those from suspects. They are also trained in ballistics and the identification of fibers from clothing. In addition, forensic scientists may advise on blood grouping (see Blood groups) in cases of disputed paternity.

Foreskin The popular name for the prepuce, the loose fold of skin that covers the glans (head) of the penis when it is flaccid and which retracts during erection. At birth, the foreskin is attached to the glans, but, after the age of 6 months, it gradually separates from the glans. In some boys, the foreskin remains tight until the age of 3 or 4, making retraction difficu1t or impossible. However, unless this causes recurrent infection (by preventing adequate cleaning of the glans) or prevents normal urination, there is no need to consult a physician and no attempt should be made to force the foreskin back. In some societies, the foreskin is routinely removed from newborn boys, an operation called circumcision, usually for religious or hygienic reasons. Circumcision may be performed at any age as a treatment for disorders of the foreskin. DISORDERS

In phimosis, the foreskin remains fersistently tight after the age o 5, causing difficulty in urination and ballooning of the foreskin. There may be recurrent balanitis (infection and inflammation of the glans and foreskin). Erection is often painful, which is why the condition is frequently discovered only at puberty. In the related disorder paraphimosis, the foreskin becomes stuck in the retracted rosition, causing painful swelling o the glans.

Forgetfulness See Memory .

Formaldehyde A colorless, pungent, irritant gas. In medicine, a solution of formaldehyde and a small amount of alcohol in

466

water-a preparation known as formalin-is used to preserve tissue specimens or to harden them (a procedure called fixation) before they are stained and examined. Formalin is also used as a disinfectant.

Formication An unpleasant sensation, as if ants were crawling over the skin. It is an uncommon symptom, most often resulting from abuse of cocaine or similar drugs. Formication should be distinguished from a paranoid delusion in which people falsely believe they are infested by ants or worms. In either case, a rash may result from excessive scratching and lead in rare cases to a misleading diagnosis of a skin disease.

Formula, chemical A way of expressing the constituents of a chemical in symbols and numbers. Every known chemical substance has a formula. Water, for example, has the formula H~O, indicating that it is composed of two hydrogen atoms (H~) and one oxygen atom (0).

Fracture A break in a bone, most commonly caused by a fall. A bone is usually broken directly across its width, but can also be fractured lengthwise, obliquely, or spirally. TYPES OF FRACTURE

Fractures are divided into two main types: closed (or simple) and open (or compound). In a closed fracture the broken bone ends remain beneath the skin and little or no surrounding tissues are damaged; in an open fracture one or both bone ends project through the skin. Fractures may also be classified according to the shape or pattern of the break (see box). If the two bone ends have moved apart, the fracture is termed displaced; in an undisplaced fracture the ends remain in alignment and there is simply a crack in the bone. CAUSES AND INCIDENCE

Most fractures are caused by a sudden injury that exerts more force on the bone than it can withstand. The force may be direct, as when a finger is hit by a hammer, or indirect, as when twisting the foot exerts severe stress on the tibia (shin). Some diseases, such as osteoporosis and certain forms of cancer, weaken bone so much that it takes only a minor injury- or none at all- for the

bone to break. This type of fracture is termed pathological. Common sites of fracture include the hand, the wrist (see Col/es' fracture), the ankle joint, the clavicle (collarbone), and the neck of the femur (thigh bone), usually as the result of a fall. Elderly people are the most prone to fractures because they fall more and because their bones are fragile. SYMPTOMS AND SIGNS

There is usually swelling and tenderness at the site of the fracture and, in some cases, deformity or projecting bone ends. The pain is often severe and is usually made worse by any movement of the area. FIRST-AID TREATMENT

Anyone suffering a suspected or known fracture should be taken to the hospital; if the injured person cannot walk, medical help should be summoned. Do not try to force back a displaced bone yourself. Treat severe bleeding (see Bleeding, treatment of), covering any open wounds with a clean dressing. Move the patient as little as possible. Splinting is usually necessary, especially if the injured person needs to be moved or if there is a long delay before help arrives. If an injured arm can be bent comfortably across the chest, s(lint it first and then apply a sling. 1 spi11a/ injury is suspected, do not move the person at all unless his or her life is in immediate danger or he or she is choking on vomit. Do not give the injured person any food or liquid in case an operation requiring a general anesthetic must be carried out. PROFESSIONAL TREATMENT

X rays are taken to confirm the diagnosis and to provide a clear picture of the type of fracture and the degree of displacement or malalignment. Bone begins to hea1 immediately after it has broken. The first aim of treatment is therefore to ensure that the bone ends abut each other and are in alignment so that, when the fracture heals, the bone will retain its previous shape. Bone ends that have been displaced are maneuvered back into position- a procedure known as reduction. The bone may be manipulated through the skin (closed reduction) using a local or general anesthetic. Alternatively, the bone may be repositioned by means of an operation using anesthetic in which the site is opened (open reduction). Once the fracture has been reduced, the bone is immobilized to allow the broken pieces to reunite firmly.

FRACTURE

FRACTURES: TYPES AND TREATMENT There are two main types of fractures: simple (closed) and compound {open) . Within these two categories are several other types, three of which are illustrated here.

Compound fracture A sharp piece of bone punctures the skin and is therefore exposed to organisms . There is a high risk of infection.

Transverse fracture The result of a sharp, direct blow or a stress fracture caused , for example , by prolonged running .

Greenstick fracture This type usually occurs in children . Sudden force causes only the outer side of the bent bone to break Simple fracture The broken bone does not break the skin. Because organisms do not come into contact with the fracture , infection is rare.

Comminuted fracture The bone shatters into more than two pieces. This fracture usually is caused by severe force, such as in a car accident.

REPAIR OF FRACTURES

There are various ways of repairing fractures, depending on the particular bone, the severity of the fracture, and the age of the patient Internal fixation The photograph at left shows immobilization of an unstable hip fracture by the insert ion of metal screws across the bone ends.

THE BONE HEALING PROCESS

After a fracture , the bone starts to heal immediately. Any displacement of the bone ends must therefore be corrected without delay to minimize deformity. blood clot 1 Aforms between the bone ends, sealing off the ends of the damaged vessels.

External fixation Immobilization may be achieved by means of a plaster cast (above) or, in cases such as an unstable fracture of the tibia (left and above left), through the use of metal pins inserted into the bone on either side of the break and locked into position on an external metal frame.

2

4

Macrophages invade the fracture site to remove wound debris. Fibrob lasts then create a mesh to form a base for new tissue.

Remodeling takes place, with more dense, stronger bone laid down .

3

5

New bone (callus) is laid down between the bone ends and over the fracture line.

Over a period of weeks, the bone returns to its former shape

467

FRACTURE,DENTAL

In some cases the ends of the fractured bone may be fixed together by metal pins inserted through the skin and into the bone and kept in position by attachment to an external frame (external fixation); once the fracture has healed, the pins and frame are removed. In other cases an operation is done to open up the injury site and fasten together the bone pieces with metal screws, nails, plates, rods, or wires (internal fixation) . RECOVERY PERIOD

F

The time taken for fractures to heal varies considerably and depends on many factors . Fractures mend much more easily in children than in adults, and in babies they can heal in as little as two weeks. In an adult a weightbearing bone, such as the tibia, may take up to six months to knit together completely; bones that do not bear weight, such as the radius and clavicle (coUarbone), generally take no longer than eight weeks. COMPLICATIONS

Most fractures heal without problem. Healing is sometimes delayed because the blood supply to the affected bone is inadequate (as a result of damaged vessels) or because the bone ends are not close enough together. If the fracture fails to unite, internal fixation or a bone graft may be required. Occasionally, bone ends reunite at the wrong angle. If this causes deformity, an operation may be necessary to refracture the bone, set it correctly, and fix it with nails. Osteomyelitis is a danger of open fractures and may be difficult to eradicate. REHABILITATION

Complete immobility of a bone for a prolonged period can cause loss of muscle bulk, stiffness in nearby joints, and edemn (accumulation of fluid in the tissues) with the risk, especially in the elderly, of permanent disability. For this reason the patient is encouraged to begin gradually using the affected part as soon as is safely possible and is given exercises to perform to restore flexibility to the joints and strength to the muscles (see Physicnl therapy).

Fracture, dental A break in a tooth. Although tooth enamel is hard, it is also brittle and can easily be fractured by suddenly striking a hard surface, as may occur in a sports injury or a fall. If the fracture is confined to the tooth's enamel or to the enamel and dentin, it can usually be repaired by bonding, in which the surface of the tooth is etched with a mild acid solu-

468

tion and a plastic resin material is attached to the roughened surface. If the pulp is affected, root-cmwl trcntment may be necessary . Fractures of the root are most damaging if they occur in the lower two thirds of the tooth because the remaining fragment does not offer sufficient support for a replacement crown. A tooth fractured vertically usually cannot be saved. Front teeth that project more than normal are vulnerable to accidental fracture. They should be repositioned by orthodontic treatment. (See also Orthodontics; Bonding, dcntnl.)

Fragile X syndrome An inherited defect of the X chro1110s0111c that causes mental retardation . Fragile X syndrome is the most common cause of mental retardation in males after Down's syndrome. The disorder occurs within families according to an X-linked recessive pattern of inheritance (see Ge11ctic disorders). Although males are mainly affected, women are able to carry the genetic defect responsible for the disorder and pass it on to some of their sons, who are affected, and some of their daughters, who in turn become carriers of the defect. Approximately one in 1,500 men is affected by the condition; one in 1,000 women is a carrier. In addition to being mentally retarded, affected males are generally tall, physically strong, have a prominent nose and jaw, increased ear length, large testicles, and are prone to epileptic seizures. About one third of female carriers show some degree of intellectual impairment. There is no treatment for the condition . If a woman has a history of the syndrome in her family, it is useful to seek genetic counseling regarding the risk of a child being affected.

Freckle A tiny patch of pigmented skin, often round or oval in shape. Freckles occur on sun-exposed areas of skin and tend to become more numerous as a result of continued exposure. The tendency to freckling is inherited and most often occurs in fair and red-haired people. Freckles are harmless, but people with highly freckled complexions should avoid excess sunlight and should use sunscreens.

Free-floating anxiety Vague feelings of apprehension and tension associated with ge11ernlized m1xicty disorder.

Frequency See Uri11ntion, frequent.

Freudian slip Also known as a slip of the tongue, a minor error in speech or action that turns out to be what the person really wanted to say or do . The term, also called a parapraxia, is derived from Sigmund Freud's book "The Psychopathology of Everyday Life." As the error tends to be laughed off, Freud saw the process as a compromise between the fulfillment of an unconscious wish and the conscious effort to repress it.

Freudian theory A discipline of psychology developed by Sigmund Freud (1856-1939), a Viennese neurologist. The theory developed out of his treatment of neurotic patients using hypnosis and formed the basis of his technique of psychonnnlvsis. Freud believed that feelings, thoughts, and behavior were controlled by unconscious wishes and conflicts and that problems occurred when these desires were not fulfilled or the conflicts remained unresolved . According to Freud, the conflicts originated in childhood and persisted into adulthood. The essence of his theory concerns early psychological development, particufarly sexual development, which now is seen to encompass much more than just the "sexual" to include the early relationship with the parent. Freud defined a number of stages-oral, anal, and genital (representing the areas of the body on which an infant's attention becomes fixed at different ages)-and three components of personality-the id, ego, and superego (based on pleasure, reality, and moral and social constraints, respectively). The classic Freudian model sees all behavior as having its roots in unconscious instincts, but ultimately being determined by the interplay between the id, ego, and superego. Psychoanalysis aims to treat mental disorders by encouraging the patient to allow thoughts to flow in any conscious direction without censorship. Freud believed that important information would emerge from the unconscious mind. (See also Psyc/10n11alytic theory; Psyc/10thernpy.)

Friedreich's ataxia A very rare inherited disease in which degeneration of nerve fibers in the spinal cord causes ntnxin (loss of coordinated movement and balance). The

FROZEN SHOULDER

disease is the result of a genetic defect, usually of the autosomal recessive type (see Genetic disorders). It affects about two people per 100,000. SYMPTOMS

Symptoms first appear in late childhood or adolescence. The main symptoms are unsteadiness when walking, clumsy hand movements, slurred speech, and rapid, involuntary eye movements. In many cases there are also abnormalities of bone structure and alignment. TREATMENT AND OUTLOOK

There is as yet no cure for the disease. Once it has developed, it becomes progressively more severe, and, within 10 years of onset, more than half the sufferers are confined to wheelchairs. If cardiomyopatl1y (heart muscle disease) develops, it may contribute to an early death. People who have blood relatives with Friedreich's ataxia should seek genetic counseling before starting a family.

ARST AID:

FROSTBITE

,--------------, r--------------, I DO NOT I ■ rub the affected parts

I

I I I I

■ attempt to burst blisters

■ warm the affected area with direct heat ■ allow the victim to walk on a frostbitten foot

I I

I I I I I

II I I I I I I

WARNING

I

Frostbite is often accompanied by hypothermia, which must be treated first. Proper medical attenlion should be sought promptly, but first aid should be given immediately.

1 1

I I I I I

L--------------.1 1--------------· 1 Shelter the victim from the cold and remove clothing from the affected part. Remove anything that constricts, su ch as ri ngs or a watch .

Frigidity A term used to describe the inability to want or enjoy sexual intercourse (see Sexual desire, inhibited). The term has been used almost exclusively with reference to women and is now being discouraged because of its negative connotations-blaming a woman for something that may exist only in the mind of her partner. In the past, the term frigid was also used to describe a woman who does not achieve orgasm. This condition is now called inhibited sexual excitement; the terms anorgasmia, and foreorgasmy are also sometimes used (see

Orgasm, lack of).

Frostbite Damage to tissues caused by extremely cold temperatures-below 32°F (0°C). Frostbite can affect any part of the body that is not properly covered, but the nose, ears, fingers, and toes are most susceptible. If only the skin and underlying tissues are damaged, recovery may be complete. If blood vessels are affected, the damage is permanent and gangrene can follow, which may necessitate amputation of the affected part. The lower the temperature, the shorter the time required to cause damage; wind and blizzard conditions also cause damage more quickly. The first symptoms are a pins and needles sensation, followed by complete numbness. The skin appears white, cold, and hard, and then becomes red and swollen. After the

2

Rewarm the af!ected area by covering it with warm hands or clothing . Frostbitten hands can be warmed in the victim 's armpits; feet can be warmed in the rescue r's armpits.

tissue has thawed, blisters form and some areas of skin are black, indicating that the tissue is dead. Frostbite must be treated promptly. The person should be sheltered from the cold and the affected parts warmed as quickly as possible by immersing them in lukewarm water at 1l0°F (44°C). Movement of the affected parts should be avoided; massage is not helpful.

Frottage The act of rubbing against another person to achieve sexual arousal. Also called frotteurism, it is usually carried out in a densely packed crowd where a man rubs his (clothed) genitals against a woman's buttocks or thigh. Such men commonly indulge in other sexual deviations, may nave a fetishist interest in buttocks, and are unable to form successful sexual relationships.

Frozen section A rapid technique for preparing biopsy specimens (small pieces of tissue) for microscopic examination. WHY IT IS DONE

Frozen section is carried out during surgical procedures to determine

3

If warm water (no hotter than 110°F) is available, immerse the affected part The area should then be cove red with a sterile dressing.

whether tissue is malignant, so that the surgeon knows whether to remove more tissue before completing the operation. It is primarily used in diagnosing a breast lump as benign or malignant, but can also be useful in excluding malignancy as a diagnosis in growths of the thyroid or intestine or in diagnosing a lymphoma. In many instances, diagnosis is made before surgery, obviating the need for frozen section. Diagnosis may be by percutaneous (through the skin) needle biopsy. HOW IT IS DONE

A small piece of tissue is removed by the surgeon and sent to the histology laboratory. After being frozen quickly in liquid nitrogen, the specimen is cut into very thin sections, placed on a glass slide, and stained so that the cells can be examined under the microscope. The entire process takes about 20 minutes.

Frozen shoulder Stiffness and pain in the shoulder, making normal movement of the joint impossible. In severe cases, the shoulder may be completely rigid and pain may be extremefy intense.

469

F

FRUSTRATION

Frozen shoulder is caused by inflammation and thickening of the lining of the capsule in which the joint is contained. The problem usually develops for no known reason, but in some cases it follows a minor injury to the shoulder, a stroke, chronic bronchitis, or angina pectoris. The condition mainly affects middle-aged people, and there is a higherthan-average incidence among people with diabetes mellitus. TREATMENT

F

lasts only for a matter of hours, the patient may be confused and agitated. A fugue is not common, but causes great alarm among relatives and friends because of its sudden onset and strange quality. Causes include dissociative disorders, the nutomatis111 of certain types of epilepsy (especially temporal lobe or psychomotor epilepsy), depression, head injury, and dementia.

Fulminant

Moderate symptoms can be eased by taking analgesics (painkillers) and anti-inflammatory drugs, and by applying ice packs to _the shoulder or usmg a heat famp on 1t. A severe case may require injections of corticosteroid drugs into the joint to relieve pain and exercises to restore movement. Manipulation of the joint using a general anesthetic can also restore mobility, but carries the risk of initially increasing pain in the joint. Whatever the severity and treatment of the condition, recovery is usually slow and may be prolonged.

A medical term used to describe a disorder that develops and progresses suddenly and with great severity. The term is usually applied to an infection that has spread rapidly through the bloodstream to affect several organs and cause a high fever. The term may also be applied to types of arthritis in which many joints are painful and stiff and deformities appear soon after the onset of symptoms, or to a cancer that has spread rapidly to cause dramatic weight loss and debility .

Frustration

See Pol/11tio11.

A deep feeling of discontent and tension because of unresolved problems, unfulfilled needs, or because the path to a goal is blocked. In a person who is mentally healthy, frustration can be dealt with in a socially acceptable way. In less well-adapted people, it may lead to regress1011 (going back to childlike behavior) and, in particular, aggression or depression. There has been much research into the relationship between frustration and violent and criminal behavior. Some people believe that all aggressive acts are related to exposure to violence while growing up or are an indication of prior frustration.

FSH Abbreviation for f~llicle-sti11111/nti11g hor111one, a gonndotropm lwnnone (one that stimulates the gonads- the ovaries and testes) produced by the anterior part of the pituitary gland.

Fugue An episode of altered consciousness that causes the sufferer to wander (e.g. , from home or work). It may last hours ur days and the subject docs not remember it afterward. In a fugue of long duration, behavior may appear normal but certain symptoms (e.g., hallucinations, feeling unreal, or an unstable mood) may accompany it. In a fugue that

470

Fumes Functional disorders A term for illnesses in which there is no evidence of organic disturbance even though performance is impaired.

Fungal infections Diseases of the skin or other organs caused by the multiplication and spread of fungal organisms. Infections range from mild and unnoticed to severe and sometimes fatal. Fungal infections are also called mycoses. Fungi can also cause asthma and allergic alveolitis but these are allergic disorders not infections. CAUSES

Some fungi are harmlessly present all the time in areas of the body such as the mouth, skin, intestines, and vagina, but are prevented from multiplying through competition from bacteria. Other fungi are dealt with by the body's i11111111ne system (defenses against infection). Fungal infections are more common and serious in people who are taking long-term antibiotics (which destroy the bacterial competition) and in those who are taking corticosteroid drugs or 1111111u11osuppressa11t drugs (used to suppress the immune system). These infections more commonly involve people with an immune deficiency disorder, such as AIDS. Fungal infections are described as opportunistic

because they take advantage of the victim's lowered defenses. Some fungal infections are also more common in people with diabetes mellitus . A warm, moist atmosphere encourages the development of fungal skin infections. TYPES

Fungal infections can be broadly classified into superficial infections (those that affect the skin, hair, nails, genital organs, and the inside of the mouth); subcutaneous infections (those beneath the skin); and "deep " infections (those affecting internal organs, such as the lungs or, more rarely, the liver, bones, lymph nodes, brain, heart, or urinary tract). SUPERFICIAL INFECTIONS The main superficial fungal infections are cnndicfinsis (thrush) and tinca (including ringworm and athlete's foot), both of which are very common. Candidiasis is caused by the yeast CANDIDA ALBICANS and usually affects the genitals or inside of the mouth . Tinea affects external areas of the bodv. SUBCUTANEOUS INFECTIONS These are rare. The most common is called sporotriclwsis and may follow contamination of a scratch . Most other conditions of this type occur mainly in tropical countries. The most important example of this type is 111yceto111a, or Madura foot. DEEP INFECTIONS These are rare or uncommon (although becoming more common), but can be a serious threat to people who have an immune deficiency disorder or arc taking immunosuppressive drugs. In the US, fungal infections of this sort include aspers illosis, liistoplns111osis, cryptococcosis, and /7/nstomycosis, all caused by different fungi. The fungal spores enter the body by inhalation into the lungs. Candidiasis can also spread from its usual sites to infect the esophagus, urinary tract, and numerous other internal sites.

Fungi Simple parasitic life-forms • including molds, mildews, l"f yeasts, mushrooms, and ~ toadstools. There are more than 100,000 different species of fungi worldwide. Of these, most are either harmless or positively beneficial to human health, including various yeasts used in baking and brewing, some molds that are the source of certain n11tibiotic drngs , and various edible mushrooms and truffles that are considered gastronomic delicacies in many parts of the world. There are,

FURUNCLE

FUNGAL DISEASES

Scalp ringworm

The skin, scalp , genitals, and nails are the most common s ites of fu ngal infection. Examples of types include tinea (ringworm) a nd candidiasis (thrush). Fungi also (rarely) infect the lungs and other inte rnal organs to cause a more serious disease. They may also cause allergic lung di sease, such as fa rmers ' lung.

Candidiasis

Lung infection

Jock itch Onychomycosis (nail infection)

Fungal nail infection This condition most often affects people whose hands are frequently immersed in water. It is liable to last for years Antifungal medications benefit some peop le.

~,:

F

Athlete 's foot

Common sites of fungal infection Fungi grow best in warm , moist areas of the body.

Colony of fungal cells The microscope p hotograph at left shows a colony of yeast cells in a skin fragme nt.

FUNGAL GROWTH

1

Many fungal colonies originate from spores that have been carried in the air and have settled at a suitable site for growth.

2

3

If nu trients are available The cells of many fung i and other conditions (such divide to form a network as tem perature) are favorable, con sisting of branc hed chains a spore starts to divide. of tubular filaments called hyphae

however, also a number of types of fungi that can cause illness and sometimes fatal disease in humans. The study of fungi and fungal diseases is known as mycology. Some fungi, notably the yeasts, occur as colonies of individual cells. In others, the cells divide to form chains of tubular filaments called hyphae, which are organized into a complex network called a mycelium. With some soil-living fungi, parts of the mycelium form into large fruiting bodies, seen as mushrooms or toadstools. Many fungi form minute bodies called spores, which are like seeds. These spores can be carried in the air and, if they settle in a suitable location with nutrients available, they divide to form a new mycelium; the molds that eventually form on exposed food are a type of mycelium. Fungal spores are ever-present in the air and soil. FUNGI AND DISEASE

Fungi can cause illness and disease in a variety of ways. First, the fruiting bodies of some soil-living fungi contain toxins that

can produce direct poisoning if eaten (see Mushroom poisoning). Second, certain fungi that infect food crops produce dangerous toxins that can cause a type of food poisoning if contaminated food is eaten . The best known of these are a fungus that infects rye and other cereals and produces a toxin called ergot, and anothe r that grows on groundnuts and produces the poison aflatoxin. Ergot poisoning is rare today, but chronic aflatoxin poisoning from eating moldy groundnuts is a suspected cause of fiver cancer in some regions of Asia and Africa. Third, the inhaled spores of some fungi can cause a persistent allergic reaction in the lungs, known as allergic alveolitis. Farmers' lung, caused by spores from moldy hay, is an example of such a reaction. Fungal spores are also sometimes responsible for other allergic disorders such as asthma and allergic rhinitis (hay fever). Fourth, some fungi are able to invade and form colonies or mycelia within the lungs, in the skin, beneath the skin, or sometimes in various

4

Eventually a colony may start forming its own spores. They may be carried to new sites to set up new growths .

tissues throughout the body, leading to conditions ranging from mild skin irritation to severe, or even fatal, widespread infection and illness (see

Fungal infections) .

Fungicidal See Antifungal dntgs .

Funny bone Popular term for the small area at the back of the elbow where the ulnar nerve passes over a prominence of the humerus (upper arm bone). A blow to the nerve causes acute pain and sometimes numbness of the forearm.

Furosemide A diuretic drug commonly used to treat edema (fluid retention) and hypertension (high blood pressure). When given by injection, furosemide has a rapid effect. It is therefore often used in emergencies to treat pulmonary edema (fluid in the lungs).

Furuncle Another name for a boil that usually involves a hair follicle . 471

SYMPTOMS

A few days after taking an incriminated drug or food, or during the course of an infectious ilfness, symptoms of hemolytic anemia (such as jaundice, fatigue, headaches, shortness of breath on exertion, and sometimes darkening of the urine due to the destruction of red blood cells) may develop in affected people. DIAGNOSIS AND TREATMENT

G6PD deficiency An inherited disorder that affects the chemistry of red blood cells, making them prone to damage during an infectious illness or from certain drugs or foods . CAUSES AND INCIDENCE

G61'0 deficiency is caused by the production within red blood cells of abnormal molecules of an enzyme (a type of protein) called gfucose6-phosphate dehydrogenase. Because the molecules of this substance are defective, they cannot carry out their normal function , which is to help in a chemical process that protects the cells from damage. The disorder is the result of an abnormality in the affected person 's genetic material and is inherited in an X-linked recessive pattern (see CC11ctic disorders) . This means that most of those affected are male, but women may carry the defective gene in a hidden form and pass it on to some of their sons. The disorder is much more common among blacks than whites, affecting about 15 percent of black males in the US. A variant of the disorder, called fm., ism, affects a small number of whites of Mediterranean origin. The particular drugs that can precipitate hemolysis (red cell destruction) in affected people are sh own below. Individuals with favism are, in addition, extremelv sensitive to a chemical in broad beans, which they must avoid eating.

The presence of G6PD deficiency can be established by a blood screening test. The deficiency cannot be treated but any episode of hemolytic anemia caused by a drug can be halted by stopping use of the drug. Full recovery then takes place within a few days. Anyone with a history of G6PD deficiency in the family should ask for a screening test before taking any of the incriminated drugs. If the test result is positive, these drugs should be avoided. Anyone known to have the condition should also seek prompt treatment for anv infectious ilfness to prevent a hemol)'tic crisis.

GABA Common abbreviation for gammaaminobutyric acid , a 11c11rotra11smittcr (chemical released from nerve endings). GABA controls the flow of nerve impulses by blocking the release of other neurotransmitters (e.g., 11orepi11cp/Jri11e and dopamine) that stimulate nerve activitv. The activity of GABA is increased by be11zudi112epiiie drugs and by a11tico11vulsa11t drugs. It has been suggested that people with f-lw1ti11gto11 's chorea (a hereditary disease characterized by mental retardation and involuntary movement) have insufficient GABA-producing nerve cells in the brain centers that coordinate movement.

Gait The style or manner of walking . Some neuromuscular disorders are evaluated on the basis of altered gait.

DRUGS TO BE AVOIDED BY PEOPLE WITH G6PD DEFICIENCY Class

Drugs to avoid

Antimalarial drugs

Primaquine. chloroquine. quinine. dapsone

Antibacterial and antibiotic drugs

Nitrofurantoin. sulfonamides (such as sulfisoxazole and sulfacetamide), chloramphenico1: nalidixic acid

Analg esics (painkillers)

Aspirin ·

Miscellaneous

Vitamin K (water-soluble form) . probenecid . quinidine· ·These drugs do nol usually cause problems in the type of G6PD deficiency that affects blacks in the US

472

Galactorrhea Spontaneous, persistent production of milk by a woman who is not pregnant or lactating (producing milk after childbirth), or, very rarely, production of milk by a man. CAUSES

Lactation is initiated by a rise in the level of prolactin (a hormone produced by the pituitary gland). Galactorrhea is caused by an excessive amount of prolactin being secreted as a result of a pit11itnn1 tumor, or due to other endocrine diseases, such as hypothyroidislll. Certain a11tipsychotic drugs (such as chlorpromazine) and some brain diseases (for example, 1111'11i11gitis) may be associated with increased prolactin production. However, in about 50 percent of cases, no cause can be found . SYMPTOMS AND SIGNS

The breast secretion is obviously milklike. If it is of any other color or bloodstained, another cause (such as a breast tumor) should be suspected. Excessive levels of prolactin may also adversely affect the ovaries, causing mne11orrhea (absence of menstrual periods) or i11fertility. If the underlying cause is a pituitary tumor, the symptoms may include headache and visual disturbances. TREATMENT

Surgery or radiatio11 therapy may be required if there is a pituitary tumor, but the symptoms are often controlled and the size of the tumor is decreased by treatment \vith /iromocripti11c. In addition to treating the underlying cause, hormone or drug therapy may be used to suppress prolactin and prevent milk production. Bromocriptine, which suppresses prolactin production, can successfully treat galactorrhea when the cause is unknown, and also may regulatt· periods and fertility.

Galactosemia An extremely rare inability of thP body's biochemical system to break down galactose (a sugar derived from the milk sugar lactose) into glucosP because of the absence of an enzyme in the liver. Galactosemia is caused bv an autosomal recessive genetic defect (see Crnetic disordcr~) SYMPTOMS

Galactosemia causes no symptoms at birth, but jaundice, diarrhea, and vomiting soon develop and the baby fails to gain weight. If untreated, the condition results in liver disease, cataract (opacity in the lens of the eye), and lllt'llfa/ retardatio11 .

GALLIUM

Gallbladder cancer

DIAGNOSIS AND TREATMENT

The diagnosis is confirmed from urine and blood tests. Feeding with a special lactose-free milk leads to dramatic improvement; normal milk must be avoided throughout life.

Gallbladder A small, pear-shaped sac situated underneath the liver, to which it is attached by fibrous tissue. Bile produced by the liver passes to the gallbladder by means of a small tube, the cystic duct. This duct branches off from the bile duct, which carries bile from the liver to the duodenum. Within the gallbladder, bile is stored and concentrated (by absorption of its water content through the gallbladder walls). When food passes from the stomach to the duodenum, secretin and cholecystokinin (gastrointestinal hormones) cause the gallbladder to contract and expel its content of bile into the duodenum, where the bile emulsifies fats contained in the food . (See also Biliary system.)

ANATOMY OF THE GALLBLADDER

M

A small , muscular sac that lies under the liver. The gallbladder expels . bil e via the common bile duct into the duodenu m. L - -'-

,

'---i

A rare cancer of unknown cause, occurring mainly in old age. It usually occurs in gallbladders with gallstones, but affects only a minute number of gallstone sufferers. The incidence of this cancer is less than three new cases per 100,000 population per year. The cancer may cause jaundice and tenderness in the upper right abdomen but is sometimes symptomless. It is diagnosed by ultrasound scanning; occasionally, the cancer is discovered during surgery on the gallbladder. Cancer of the gallbladder is treated bv removal of as much of the tumor as possible. The cancer often has invaded the liver by the time it is detected, making the outlook poor.

Gallium A metallic element whose radioactive

Common bile duel

- - --

~"'1

form is used in radionuclide scanning (a technique for obtaining images of internal organs). Gallium is injected into the bloodstream and, about 72 hours later, scanning is performed .

DISORDERS OF THE GALLBLADDER The gallbladder rarely causes problems in childhood or early adulthood but, from middle age onward, the increasing occurrence of gallstones can sometimes give rise to symptoms. Because the digestive system can function normally without a gallbladder, its removal has little known long-term effect. CONGENITAL ANO GENETIC DEFECTS

Abnormalities present from birth may include no gallbladder, an oversized gallbladder, or two gallbladders; these defects rarely cause problems. METABOLIC DISORDERS

The principal disorder of the gallbladder, with which most other problems are associated , is the formation of gallstones. Gallstones are common, but only about 20 percent of people with gallstones have symptoms requiring cholecystectomy (surgical removal of the gallbladder). Attempts by the gallbladder to expel the stone or stones can cause severe biliary colic (abdominal pain). There are three main types of gallstones: cholesterol gallstones, pigment gallstones, and mixed gallstones. The great majority are cholesterol or

mixed gallstones, and women are affected four times as often as men. Every year about 1 million Americans develop gallstones. Many people carry "silent" gallstones, which produce no symptoms. INFECTION ANO INFLAMMATION

If a gallstone becomes stuck in the outlet from the gallbladder, the trapped bile may irritate and inflame the gallbladder walls and the bile itself may become infected. This is called acute cholecystitis. The first symptom may be biliary colic, which is followed by fever and abdominal tenderness. Repeated attacks of biliary colic and acute cholecystitis can lead to chronic cholecystitis, in which the gallbladder becomes shrunken and thick-walled and ceases to function. Rarely, the gallbladder may become inflamed without the presence of gallstones- a condition that is called acalculous cholecystitis. · Occasionally, cholecystitis proceeds to a condition in which the gallbladder fills with pus, called empyema of the gallbladder. This can cause a high fever and severe abdominal pain . TUMORS

Gallbladders harboring gallbladder cancer usually contain gallstones. However, this cancer is extremely

uncommon compared to the high prevalence of gallstones. OTHER DISORDERS

In rare cases where a gallbladder is empty when a stone obstructs its outlet, it may fill with mucus secreted by the gallbladder walls, resulting in a distended, mucus-filled gallbladder known as a mucoce/e,

INVESTIGATION

Gallbladder problems are investigated by physical exam ination and techniques such as ultrasound scanning, radionuclide scanning, or cholecystography (X rays of the gallbladder after it has been filled with a contrast medium). Blood tests ~a~~i:~s~u~e

I

--,t===-1~._,tj~B,-...J

473

G

GALLSTONES

Gallium tends to accumulate in tumors and pus cells; its main uses in scanning are to detect malignant diseases, such as Hodgkin's disease, and abscesses or areas of osteomyelitis.

Gallstones

G

Round or oval, smooth or faceted lumps of solid matter found in the gallbladder (the sac under the liver where bile is stored and concentrated). Gallstones are sometimes found in the bile ducts (which connect the gallbladder and liver to the duodenum). In these cases, the symptoms can be severe. There may be between one and 10, or sometimes more, stones varying in size from about 0.05 inch to 1 inch (1 to 25 mm) across . Gallstones composed principally of cholesterol are the most common type, but some contain a high content of bile pigments and other substances, such as chalk. CAUSES AND INCIDENCE

Gallstones develop when an upset occurs in the chemical composition of bile. When the liver makes bile, it can put too much cholesterol into it (which occurs in obesity) or it may fail to put in enough of the detergent substances that normally keep cholesterol, a fatty substance, in solution. Once the bile is overloaded with cholesterol, a tiny particle can form that gradually grows as more material solidifies around it, eventually forming a stone. Something else in the bile (its nature is unknown) actually triggers this process. Fasting for long periods may help gallstones develop by causing bile to stagnate in the gallbladder. Gallstones are rare in childhood and become progressively more common with age. Two to three times more women than men are affected (autopsies show that 20 percent of all women have gallstones when they die). Risk groups include overweight people and women who have had many children. Use of the birth-control pill may cause gallstones to form earlier than they would otherwise. PREVENTION

People should avoid becoming overweight and should eat as little sugar and fat as possible. Some experts believe a high intake of fiber helps and that drinking one alcoholic drink a day has a protective value. SYMPTOMS

Only about 20 percent of gallstones cause symptoms or complications. Symptoms commonly begin only 474

when a gallstone gets stuck in the duct leading from the gallbladder. This causes biliary colic (intense pain in the upper right side of the abdomen or between the shoulder blades) and may make the sufferer feel sick and possibly vomit. Indigestion made worse by fatty foods often seems to be associated with gallstones. Other potential complications include cl10/en1stitis (inflammation of the gallbladder) and bile duct obstruction leading to jaundice. DIAGNOSIS AND TREATMENT

Ultrasound sca11ni11g can detect 95 percent of gallstones and is therefore the first test to be performed. An older and slightly less sensitive method is X-ray cholec1fstography, which utilizes an iodinated dye that is taken either by mouth or in,·ected into a vein. Blood tests may a so be performed. If the physician suspects the stones have escaped into the bile ducts, c/10/angiography may be carried out. Stones that do not cause symptoms can safely be left alone, as they are unlikely to cause trouble. When symptoms are severe, cl10/ecystectv111y (surgical removal of the gallbladder) is carried out; this cures the problem in 95 percent of cases. In some cases drug treatment may be used, especially if the stones are small and noncalcified. Tablets containing chenodiol or ursodeoxycholic acid can dissolve stones over several months. X rays or ultrasound scans of the gallbladder are done to check progress. Stones recur in about half the cases when the drug is stopped, so ultrasound scans are carried out over the following few years. OUTLOOK

New treatments are being developed . Extracorporeal shock-wave litlwtripsy uses shock waves to shatter the stones. In another technique a tube is inserted into the gallbladder and a strong solution that dissolves cholesterol is flushed through. The safety and long-term value of these treatments is still being investigated.

Gamma globulin A substance prepared from human blood that contains antibodies against most common infections. (See J1111111111e

serum globulin.)

Ganglion A cystic swelling associated with the sheath of a tendon. It is a common

condition and usually occurs on the wrist, although a finger or foot may sometimes be affected. The cyst, which contains thick fluid derived from the synovial fluid that lubricates tendons and 1· oints, can vary from the size of a smal pea to, rarely, the size of a golf ball. A ganglion may disappear spontaneously; if it does not, treatment is usually necessary only if it is painful or unsightly. The fluid may be sucked out with a needle and syringe. The cyst commonly recurs after such treatments, however. The best approach is to remove the cyst surgically, after which recurrence is rare.

Gangrene Death of tissue, usually as a result of loss of blood supply. It may affect a small area of skin, a finger, or a substantial portion of a limb. SYMPTOMS

Pain is felt in the dying tissues, but once they are dead they become numb. The affected skin and underlying tissue turn black. Bacterial infection may develop, causing the gangrene to spread and give off an unpleasant smell. There may be redness, swelling, and oozing pus around the blackened area. There are two types of gangrene (dry and wet). In dry gangrene there is usually no bacterial infection; the deprived area dies because its blood supply is blocked. This type of gangrene does not spread to other tissues. It may be caused by

arteriosclerosis, diabetes 111ellit11s, thrmn bosis, an embolism, or frostbite.

Gambling, pathological Chronic inability to resist impulses to gamble, resulting in personaf or social problems. Most gamblers can stop at a given point; pathological or "compulsive" gamblers seem unable to control the amount they spend and are unable to stop even when they continue to lose. The urge to gamble is so great that tension can be relieved only by more gambling. Family problems, bankruptcy, and crime may follow.

Gangrene of the foot This photograph shows a foot with an extensive area of dead tissue, with blackening of the overlying skin

GASTRECTOMY

Wet gangrene develops when dry gangrene or a wound becomes infected by bacteria. A particularly virulent type-known as gas gangrene-is caused by a dangerous strain of bacteria that destroys muscles and produces a foul-smelling gas. Gas gangrene has caused millions of deaths in war. TREATMENT

Treatment of dry gangrene consists of improving circulation to the affected body part before it is too late. If the tissue becomes infected, the patient is given antibiotics to prevent wet gangrene from setting in. If wet gangrene is diagnosed, amputation of the affected part is unavoidable. Usually, some of the adjacent living tissue must be removed as well.

Ganser's syndrome A rare, factitiolls disorder in which a person seeks, consciously or unconsciously, to mislead others regarding his or her mental state. Ganser' s syndrome occurs most often in prisoners. A characteristic of the disorder is the giving of "approximate answers" (for example, 2x2=5); the choice of an answer near the correct one suggests that the person knows the real response. The sufferer also displays symptoms that simulate psychosis, such as episodes of intense agitation or stupor.

Gardnerella vaginalis A bacterium found in increasing numbers in the vaginal discharge of women with vaginitis (inflammation of the vagina).

Gargle A liquid preparation to wash and freshen the mouth and throat, usually not meant to be swallowed. Gargles may contain mouth fresheners, flavorings, antiseptics, or local anesthetics (see Anesthesia, !veal). Those containing antiseptics and local anesthetics relieve the irritation associated with sore throats, but do not cure the underlying cause. The home remedy of gargling with salt water is equally effective in most circumstances.

Gastrectomy Removal of the whole stomach (total gastrectomy) or, more commonly, a part of the stomach (partial gastrectomy). Gastrectomy is a major operation requiring hospitalization and extensive postoperative care. WHY IT IS DONE

Total gastrectomy is a rare operation used to treat some stomach cancers. Partial gastrectomy is fairly common; it is usually performed to deal with a peptic ulcer (gastric ulcer or duodenal ulcer), ulcers that have failed to heal after changes in diet or drug treatment, ulcers that bleed very badly or perforate (break through the stomach

or duodenal wall), and some cancers located closer to the stomach's outlet. In treating duodenal ulcers, removal of part of the stomach may be combined with vagotomy (cutting of the nerves to the acid-secreting part of the stomach) to prevent more ulcers. HOW IT IS DONE

A general anesthetic is given and the stomach emptied by means of a nasogastric tube (a tube passed through the nose down the esophagus into the stomach). The entire stomach is removed in a total gastrectomy; the risk of complications or death from this procedure is high. Smaller portions of stomach are removed with less danger. RECOVERY PERIOD

After the operation, the nasogastric tube is left in position to allow digestive system secretions to drain. When the volume of these secretions diminishes and normal peristalsis (the rhythmic contractions that force food through the digestive system) returns, the patient is given small amounts of water. If these do not cause abdominal pain or nausea, the nasogastric tube is removed. Intake of fluids is gradually increased and, within a few days, a light diet can be started. COMPLICATIONS

Because removal of the stomach disturbs normal digestion, postgastrectomy syndromes (side effects after gastric surgery) can develop

TYPES OF GASTRECTOMY There are several different types of gastrectomy operations . In total gastrectomy, the whole stomach is Duodenum

removed ; in partial gastrectomy, between one half and two th irds of the stomach is removed . There are

two common types of partial gastrectomy operation-the Billroth I and the Billroth II.

Stomach

I

Jejunum

Total gastrectomy The whole stomach is removed and the esophagus is joined directly to the jejunum (the middle section of the small intestine) .

Billroth I gastrectomy The remaining part of the stomach is joined to the duodenum (the first part of the small intestine).

Billroth II gastrectomy The surgeon performs a gastrojejunostomy (a procedure in which the stomach is joined to the jejunum) and seals the end of the duodenum to form a blind loop .

475

GASTRIC BUBBLE

G

in some patients. The most troublesome are fullness and discomfort after meals; formation of an ulcer at the new junction between stomach and small intestine; regurgitation of bile, which may lead to gastritis (inflammation of the stomach), esophagitis (inflammation of the esophagus), and vomiting of bile; diarrhea; and the dumping syndrome (sweating, nausea, dizziness, and weakness felt soon after eating a meal because food leaves the stomach too quickly). These side effects usually disappear in time, but diet and drug treatment or another operation may be necessary. Other complications include ma/absorption (a reduced ability to absorb food, minerals, and vitamins), which may lead to anemia or osteoporosis (thinned bones). After total gastrectomy, patients cannot absorb vitamin B12 and are therefore given monthly injections for the rest of their lives. OUTLOOK

Only about 10 percent of patients suffer complications requiring further treatment. Ulcer recurrence is infrequent, but there is a small risk of cancer of the stomach developing after partial gastrectomy.

Gastric bubble A balloon, about 2 inches (5 cm) in diameter and 3.5 inches (9 cm) long, that is inserted through the mouth and into the stomach as a means of weight control in people who are dangerously obese. The gastric bubble was approved in 1985 by the US Food and Drug Administration (FDA) only for people who are 100 percent overweight. The procedure is not without risk. In addition, no studies have been performed to evaluate whether or not weight is regained after removal of the bafloon .

Gastric erosion A break in the innermost layer (mucosa) of the membrane that lines the stomach. If a break extends deeper than this layer, it is called a gastric ulcer (see Peptic ulcer). Gastric erosion occurs in some cases of gastritis (inflammation of the stomach lining) . The causes of gastric erosions are not clear, but many cases are the result of the ingestion of alcohol, iron tablets, aspirin, or other nonsteroidal anti-inflammatory drugs (NSA!Ds), such as phenylbutazone or indomethacin. The stress of serious illness, such as septicemia (blood poisoning), burns, or renal failure, may also bring on a gastric erosion.

476

Often there are no symptoms, although erosions may bleed, resulting in hematemesis (see Vomiting blood) or melena (black feces containing blood). The blood loss, on the other hand, may be small but persistent, eventually causing anemia. The condition is diagnosed 6y gastroscopy (direct examination of the stomach through a flexible viewing tube), which reveals the small bleeding points in the stomach lining. Gastric erosions usually heal completely in a few days when treated with antacid drugs and 11/cer-hcaling drugs, such as cimetidine, ranitidine, or famotidine.

Gastric ulcer A raw area in the wall of the stomach caused by a breach of its inner surface lining. (See Peptic ulcer.)

Gastritis Inflammation of the mucous membrane that lines the stomach. The illness may be acute, occurring as a sudden attack, or chronic, developing gradually over a long period. CAUSES

Gastritis may be caused by irritation of the stomach lining by a drug, most commonly aspirin or alcohol; by infection of the stomach by CAMPYLOBACTER bacteria; or, in some people, by extreme physical stress such as head injury, severe burns, or the development of liver failure. Chronic gastritis may be caused by prolonged irritation of the stomach by alcohol, tobacco smoke, or bile; damage of the lining by an autoim111u11e disorder, as in pernicious anemia (see Anemia, megnloblastic); or degeneration of the lining with age. Acute gastritis may cause erosions in the lining that bleed easily. In the chronic form, blood may ooze continually from the lining.

the esophagus to the stomach (see Gastroscopy). A biopsy (removal of a tiny sample of tissue for analysis) may be performed at the same time, using an attachment at the end of the gastroscope. Microscopic examination of the sample indicates the type of inflammation. The correlation between the microscopic findings and the symptoms is not always clear. TREATMENT

A person with gastritis should take acetaminophen rather than aspirin for pain relief, avoid alcohol, and not smoke. U/cer-heali11g drugs may help heal the inflamed lining.

Gastroenteritis Inflammation of the stomach and intestines, often causing sudden and sometimes violent upsets. The illness does not usually last for more than two or three days and the sufferer tends to recover without any specific treatment other than replacement of lost fluid and salt. Dysentery, typhoid fever, cholera, food poiso11i11g, and travelers' diarrhea-as well as many milder stomach upsets-are all forms of gastroenteritis. CAUSES AND INCIDENCE

Gastroenteritis is an extremely common cause of mild illness in developed countries and a major cause of death in some developing ones. The illness may be caused by any of a variety of viruses, bacteria, and other small organisms that have contaminated food or water supplies. There are also a number of noninfectious causes of gastroenteritis-for example, food intolerance, very spicy foods, certain drugs, toxic substances, and excessive intake of alcohol. In many people, antibiotic drugs cause symptoms similar to those of gastroenteritis because the drugs can upset the balance of bacteria that occur naturally in the intestines.

SYMPTOMS

SYMPTOMS

Gastritis produces many of the same symptoms as a gastric ulcer, with which it may be confused. Symptoms include discomfort in the upper abdomen (often aggravated by eating), nausea, and vomiting. In acute erosive gastritis, the feces may be black with blood lost from the stomach; in the chronic condition, slow blood loss may cause anemia (see Anemia, iro11deficie11cy), resulting in pallor, tiredness, and breathlessness.

The onset and severity of symptoms depends on the type and concentrations of the microorganisms, food, or toxic substance causing the illness. Appetite loss, nausea, vomiting, cramps, and diarrhea are the symptoms; these may come on gradually, but more often arpear suddenly. The combination o symptoms may be so mild that they cause little disruption to daily routine, or the attack may be so severe and persistent that it is disabling, causing dehydration, shock, and collapse. In babies and the very old, this may warrant intravenous fluid treatment.

DIAGNOSIS

The diagnosis is made by examining the stomach lining through a gastroscope, a viewing tube passed down

GASTROJEJUNOSTOMY DIAGNOSIS

In mild attacks, the symptoms alone are sufficient to make a diagnosis, but in more serious cases the physician may ask about contact with infected people, food that has been eaten recently, and recent travel abroad. TREATMENT AND OUTLOOK

Mild cases are treated at home. The affected person should rest, freferably in bed, and take plenty o fluids, which should include salt and sugar if much fluid is being lost by vomiting and diarrhea-4 level teaspoons of sugar and a quarter of a teaspoon of salt for each pint of liquid (see Rehydration therapy). No solid food should be eaten until symptoms subside. In severe cases where shock and collapse occur, the person will be taken to the hospital. Patients are given intravenous fluids to replace the vital body salts lost by vomiting and diarrhea. After the acute phase, water and then other clear fluids are given; if these fluids do not cause further upset, a bland diet is introduced. Antibiotic treatment is reserved for specific bacterial infections such as typhoid. In most cases the illness subsides gradually without any special measures; recovery is usually complete with no complications. PREVENTION

Care taken in food preparation and hygiene can substantialfy reduce the chances of gastroenteritis (see Food poisoning; Food-borne infection). Some protection against typhoid and cholera can be acquired by vaccination before traveling to countries where these diseases are still common. Avoidance of substances known to cause upset helps minimize noninfectious attacks of gastroenteritis. Those caring for a person with the symptoms of gastroenteritis should be scrupulous about personal hygiene to prevent the illness from spreading.

Gastroenterologist A physician specially trained in the management of disorders of the digestive system. His or her work is concerned with the treatment of peptic ulcers of the stomach and duodenum, conditions affecting the gastrointestinal tract from mouth to anus, and diseases of the liver and gallbladder. The work of the gastroenterologist has been revolutionized in recent years by the development of fiberoptic endoscopes. Much of the gastrointestinal tract can now be visualized directly by these instruments and samples can be taken for laboratory examination.

HORMONES IN THE DIGESTIVE TRACT Hormones released from endocrine cells in the stomach, pancreas, and intestine aid digestion by stimulating the release of bile from the gallbladder and enzymes from the pancreas into the duodenum.

Gastrln Secreted mainly by cells in the stomach in response to eating food (especially protein) . It causes the stomach to produce more acid and stimulates contraction of muscle in the wall of part of the stomach, ileum, and colon. This contraction propels food through the digestive tract.

Cholecystoklnln - - - - - ~ Released by lhe duodenum in response lo fats and acid . It causes lhe gallbladder lo squeeze bile into the duodenum and stimulates the production of pancreatic enzymes, which pass into the duodenum through the pancreatic duct.

G

Secretin _ _ _ _ _ _ __ _____ Secreted by the lining of the duodenum in response to acid entering from the stomach . It acts on the pancreas to increase the output of bicarbonate, which neutralizes acid from the stomach . It also increases the release of enzymes from the pancreas.

omach

Pancreas Duodenum

The gastroenterologist, whenever possible, treats patients by advising on diet and life-style and/or by prescribing medication; if necessary, the gastroenterologist refers patients for surgical treatment.

Gastroenterology The study of the digestive system and the diseases and disorders affecting it. The major organs involved include the mouth, esophagus, stomach, duodenum, small intestine, colon, and rectum. Diseases of the liver, gallbladder, and pancreas are also included in this specialty.

Gastrointestinal hormones A group of hormones released from specialized endocrine cells in the stomach, pancreas, and intestine that controls various functions of the digestive organs. Gastrin, secretin, and cholecystokinin are probably the best documented of these hormones. (See illustrated box, above.) Various other gastrointestinal hormones released by the intestine include motilin, neurotensin, and enteroglucagon; their precise functions are still being studied. DISORDERS

Disorders that are produced by gastrointestinal hormones are relatively rare. The most notable

example is a tumor of gastrin-secreting cells in the pancreas or the wall of the intestine, a condition called Zollinger-

Ellison syndrome.

Gastrointestinal tract The part of the digestive system that consists of the mouth, esophagus, stomach, and intestine; it excludes the liver, gallbladder, and pancreas.

Gastrojejunostomy A surgically created connection between the stomach and the jejunum (the middle two thirds of the small intestine). It is sometimes combined with partialgastrcctomy (removal of the lower part of the stomach). WHY IT IS DONE

The operation is performed as part of the treatment of a duodenal ulcer (see Peptic ulcer). The purpose of the procedure is to allow food to pass directly from the stomach to the small intestine, thereby avoiding the faulty emptying encountered when vagotomy alone is performed, and permitting a bypass around a scarred, obstructed duodenum. HOW IT IS DONE

The preparation of the patient is the same as for gastrectomy. If the gastrojejunostomy is to be combined with partial gastrectomy, some of the lower part of the stomach is removed . The 477

GASTROSCOPY

surgeon then pulls up the first part of the jejunum and stitches it to the lower part or remnant of the stomach; a new opening is made through which food will pass. RECOVERY PERIOD AND OUTLOOK

Complications, recovery, and outlook are the same as for gastrectomy.

Gastroscopy

G

Examination of the lining of the esophagus, stomach, and duodenum (first part of the small intestine) by means of a long, flexible viewing tube, called an esophagogastroduodenoscope, inserted through the mouth (see Endoscope). WHY IT IS DONE

Gastroscopy is used to investigate symptoms (such as severe pain or bleeding in the upper abdomen) and to look for disorders of the esophagus, stomach, and duodenum. The procedure may also be used to assess how these disorders are responding to treatment. Gastroscopy is used to identify the source of bleeding and sometimes to treat bleeding sites in the stomach and duodenum . Attachments at the end of the instrument enable the physician to remove biopsy samples (small amounts of tissue for inspection). Other procedures may be carried out using a gastroscope, such as injecting esophageal varices (abnormally enlarged veins in the esophagus) or dilatation (opening up) of an esophageal stricture. The gastroscope is also used to facilitate passage of a gastric feeding tube through the skin (percutaneous gastrostomy). HOW IT IS DONE

The stomach should be empty for gastroscopy, so patients are asked to fast for at least six hours beforehand. The procedure is usually performed using a local anesthetic sprayed onto the back of the throat and a sedative to relax the tatient. A general anesthetic is used i elaborate investigations or treatments are required or if the patient is particularly anxious. A diagnostic examination usually lasts for between five and 20 minutes. Some discomfort may be felt as the tube passes down the throat; there may be a sore throat afterward. Complications from gastroscopy are rare . Most are caused by inhalation of vomit or reactions to the sedatives.

Gastrostomy A surgically produced opening in the stomach, usually connecting the stomach to the outside so that a feed-

478

ing tube can be placed into the stomach or passed into the small intestine. (Gastroscopy utilizes a flexible viewing tube to examine the lining of the stomach and other organs.) People who are starving because of cancer of the esophagus (see Esophagus, cancer on or who are unable to chew and swalfow due to stroke or other neurologic disease may be candidates for gastrostomy. (See also Feeding , artifi.cia/ .)

Gauze An absorbent, open-weave fabric, usually made of cotton. For medical purposes it is usually sterilized and sealed in a package. Gauze is often used as a dressing for wounds. It can be applied dry or can be immersed in an antiseptic fluid or cream; a bandage is used to hold it in place. The gauze absorbs blood and other fluids oozing from the wound. Gauze is usually not used to dress skin ulcers because it tends to stick to moist surfaces and, when removed, dislodges new tissue. Surgeons sometimes insert pieces of gauze into wounds during surgery to keep the operative site relatively free of blood, which otherwise might obscure structures.

Gavage The process of feeding liquids through a nasogastric tube (one passed into the stomach through the nose) . See Feeding, artificial. Gavage also refers to hyperalimentation (treatment of a patient by excessive feeding beyond the requirements of appetite).

Gay bowel syndrome A group of conditions affecting the anus, rectum, and colon that occurs most frequently, but not exclusively, in male homosexuals. Most of the conditions in gay bowel syndrome result from various forms of sexual contact, including penile-anal contact, oral-anal contact, and fisting (insertion of the fist into the rectum). If carried out regularly, these activities are likely to cause structural abnormalities (such as hemorrhoids, anal fistulas, and rectal ulcers) or inflammatory anal-rectal conditions (such as proctitis). They may also cause the spread of AIDS, hepatitis, and intestinal infections (such as shigellosis and mnebiasis) or other infections (such as genital warts, gonorrhea , syphilis, and (1/mpl10gra1111/0111a uc11ere11111) that can also be spread by vaginal intercourse.

Gemfibrozil A lipid-lowering drug used in the treatment of certain types of hyperlipidemia (raised levels of fats such as cholesterol in the blood). Gemfibrozil works mainly by reducing the production of lipoproteins (fats combined with protein) in the liver.

Gender identity The inner feeling of maleness or femaleness. Gender identity is not necessarily the same as biological sex. Gender identity is fixed within the first two to three years of life and is reinforced during puberty; once established, it usually cannot be changed. Gender role is the public declaration of gender identity-that is, the image people present outwardly that confirms their inner feelings about their gender. Gender identity problems occur when a person has persistent feelings of discomfort about his or her sexual identity. Transsexualism is the most common example of this problem.

Gene A unit of the material of heredity. In physical terms, a gene consists of a short section of the substance deoxyribonucleic acid (DNA) contained within the nucleus of a cell (see Nucleic acids). In functional terms, a particular gene has a specific influence on the workings of a cell; the activities of the same gene in many different cells specifies a particular physical or biochemical feature of the whole body (for example, hair color or a chemical step in the digestion of food). Every human cell holds, within its nucleus, more than 50,000 different genes. Through the sum of their effects, genes influence and direct the development and functioning of all organs and systems within the entire body. In short, they provide an instruction manual or program for growth, survival, reproduction, and possibly also for aging and death . Each of a person's cells (with the exception of egg and sperm cells) contains an identical set of genes. This is because all the cells are derived, by a process of division, from a single fertilized egg, and with each division the genes are copied to each offspring cell. Within any cell, however, some genes are active and others are idle, according to the specialized nature of the cell (e.g., different sets of genes are active within liver cells and nerve cells).

GENE

WHERE DO YOUR GENES COME FROM?

Genes

Grandfather

Grandmother

Grandmother

Grandfather

A person's gene s are inherited from his or her parents. Hall come from the mother and hall from the father via the egg and sperm cells. Each parent provides a different selection , or "mix," of his or her genes to each chi ld; this accounts for the marked differences in appearance , health , and personality among most brothers and sisters. Everyone holds a copy of his or her genes with in each body cell. Genes

Father

■■

Gene transmission In th is diagram, only eight genes are shown- in reality, each cell in the body c ontains about 50,000 genes. Half of them come from the mother and hal f from the father- thus a quarte r of the genes originate from eac h of the four grandparents.

Mother

•• Egg and sperm

If the genes from any two people (other than identical twins) are compared, they always show a number of differences. These differences account for all or much of the variation among people in such aspects as gender, height, skin, hair and eye color, and body shape, and in susceptibility to certain diseases and disorders (see Inheritance; Genetic disorders). Genes also influence intelligence, personality, physical and mental talents, and behavior, although the extent of their contribution here is less clear-cut because environment and learning also play an important role.

whole process of development and growth can be thought of as being programmed by the sequential switching "on" or "off" of particular genes; this control program is exceedingly complex. The activities of control genes help differentiate, for example, between nerve and liver cells, where quite different sets of genes are active or idle. If the control genes are disrupted, cells may lose their specialist abilities and begin to multiply out of control; this is the probable mechanism by which cancers and other tumors are started (see Carcinogenesis; Oncogenes).

GENE STRUCTURE AND FUNCTION

MUTANT GENES

ALLELES, DOMINANCE, AND RECESSIVENESS

The physical material of inheritance, DNA, is an extremely long, chainlike structure. Along with some protein, it is what makes up the 23 pairs of chromosomes in the nuclei of all cells. A gene corresponds to a small section of DNA within a chromosome. All genes fulfill their function, or exert an influence in cells or in the body at large, by directing the manufacture of particular proteins. (See illustrated box, next page.) Although many proteins have a particular structural or catalytic role in the body, others are synthesized solely for the purpose of influencing the activity of other genes, which they are able to switch "on" or "off." The genes responsible for making these proteins are termed "controf" genes. The

Whenever a cell divides, copies of all of its genetic material are made for the two daughter cells by the process of DNA replication (see Nucleic acids) and chromosomal division. However, the copying process is not perfect, and very occasionally a fault occurs, leading to a small change (mutation) in the nucleic acid sequence; this, in turn, alters the structure of the DNA in one of the daughter cells-and thus leads to a change in one of its genes. This mutant gene is then passed on each time the cell subsequently divides. If a gene mutation occurs during the formation of an egg or sperm cell that later takes part in fertilization, the person who develops from the fertilized egg will have the mutant gene in each of his or her cells.

The consequences of inheriting a mutant gene are influenced by further factors. For every protein in the body, there are normally two genes ca(able of directing the manufacture o that protein-one inherited from the mother and one from the father . These may or may not be identical. The two genes are carried at the same location on each of a pair of chromosomes. If one of the genes mutates, leading to production of an altered protein, it can often be "masked" by the presence of a normal gene on the other chromosome of the pair. In fact, the gene at any particular location on a chromosome can exist in any of various forms, called alleles, consisting usually of a normal form and one or more mutant forms, which

Carrying a mutant gene can have various effects. In some cases, it affects the structure of the protein whose manufacture the gene directs. Depending on the importance of the protein and the change in its structure, this usually has a disadvantageous effect, ranging from mild to lethal. Moreover, the mutant gene may be passed on to some of the person's own children. Diseases or disorders that result from such mutant genes are known as genetic disorders. Very rarely, genetic mutations occur that have a positively beneficial effect (see Mutation) .

479

GENE

WHAT GENES ARE AND WHAT THEY DO Genes are units of hereditary material contained in a person's cell s. They hold information for all aspects of bodily g rowth and development. exerting the ir effects by directing the manufacture of protei ns. All of a person 's genes come from his or he r parents. The physical differences between people, such as in eye, hair, and ski n color. arise from slight differences in gene structure.

G

DNA PRINTOUT Through painstaking laboratory research . the exact structure of many genes is now kn own.

llC - GAG -CAl-CTG -GGG-AfGTCA- TGT-CCT-TC A- TCG-TTT TGA-TTA -CCG-ACC - CC A- TCG fAl-GAC-ACG-CA A- GTT-CCGCGG-TCA-CGC- ACG-TCA - TGTGGG-G AC- TCG-T AA -lC A- CGT CAA-GCG - AGT-fTA- AAT - AGACGA-CGC - AGC-TTT-G AA - lf CTAT-MC - Tr!C--T AA ·- CTG · I rl\ TTG-TTA - TGT-G AT-GGG-TTA ATG-AGC-GGA-GfG-CAT - TAT -

KX xx KK 3 xx XX xx 1

2

6

u 13

7

KK

xx

14

15

1(1(

xx

19

20

8

~x xx 4

5

XK XX XX xx 9 10 11 12 xx xx xx 16

XI(

xx

21

22

17

18

XK XY Cytoplasm

Chromosomes Genes are conta ined in the c hromosomes within the nuclei of a person's cells. Each ch romosome contains a long strand of the hereditary substance deoxyribonucleic acid (D NA)

Genes-~~

DNA and genes DNA has a long. threadlike molecule mad e up of two intertwined st rands. "the double helix ." Genes are segments of DNA within chromosomes . Each gene

This printout shows a small part of the DNA base sequence in the gene that codes for the protein trypsin , a digestive enzyme

has a function (to direct the manufacture of one typ e of protein). the instructions for this function are encoded w ith in the stru cture o f its segment of DNA

V,' - '~

- - --

Sequence of bases Each strand of DNA is a string of "nucleotide bases," linked by sugar and phos ph ate side chains. There are four types of base adenine,

Sugar-phosphate side chain

cytosi ne, guanine. and thymi ne (A. C. G. and T). The sequence of bases in a gene (segment of DNA) is the code for protein manufacture.

Structural proteins Some proteins are used as structural components of cells. tissues . and organs Decoding apparatus To decode a gene. a negative copy of it is made. using the gene as a template: this copy (called messenger RNA) then passes to the cytoplasm of the cell for decoding (see Prote,n synthesis)

480

Protein molecule

Protein molecule The information in a gene is decoded to make a protein molecule. which is folded and consists of a string of amino acids

Enzymes Other proteins are enzymes. wh ich promote important chem ical p rocesses vi tal lo bod ily growth and funct ioning

GENETIC COUNSELING

cause the production of altered proteins. If the effects of a particular allele mask or override those of the allele carried at the same location on its partner chromosome, it is said to be dominant. The masked allele is said to be recessive. Dominant genetic traits, such as brown eyes and blood group A, are those in which the allele producing the trait needs to be present only in a single dose for it to have an outwardly apparent effect. Recessive traits, such as blue eyes and blood group 0, are those in which an allele for the trait must usually be present in a double dose for it to have an outward effect. The patterns by which various traits and disorders are passed on from parents to children, including the further complication of sex-linked and multifactorial inheritance and disorders, are discussed under l11herita11ce and Genetic disorders. Medical advice on genetic matters- for example, to parents on the chances of an intended child being affected by a particular genetic disorder- is the province of genetic counseling.

Generalized anxiety disorder A neurotic illness in which the main symptoms are chronic and persistent apprehension and tension about nothing in particular ("free-floating anxiety"). There may also be many unspecific physical reactions such as trembling, jitteriness, sweating, lightheadedness, and irritability. Symptoms may be so severe that they interfere with everyday living and require medical attention . Psychotherapy and drugs are the treatment, although sedatives and tranquilizers are kept to a minimum because dependence can result.

General paralysis of the insane The common term for the mental and physical deterioration that occurs in the late stage of untreated syphilis when it affects the brain substance.

Generic drug A medicinal drug marketed under its official, chemical name (its generic name) rather than under a patented brand name. Generic names are chosen by appointed drug experts and approved by governmental agencies.

Genetic code The inherited instructions, contained in chemical form within the nuclei of cells, that specify the activities of cells and thus the development and func-

tioning of the whole body . The term "genetic code" is also used more widely to include the system by which the instructions are copied from a cell to its offspring, the chemical basis by which the instructions are encoded, and the "key" by which the coded instructions are translated. The basis of the genetic code is contained within molecules of th e long, chainlike substance deoxvribonucleIC acid (DNA) . DNA, along with some protein, makes up the chro1110s0111es present in the nuclei of cells. A particular gc11e, or unit of inheritance, corresponds to a section of DNA within a chromosome. Each gene contains the coded instructions for a cell to manufacture a particular protein, which may be an c11zy111e with a vital role in the cell's activities or may have some other function or structural use in the body . Most activity in the body stems from the manufacture of proteins under the guidance of genes . Little was known about how bits of DNA could specify the manufacture of proteins until the chemical structure of DNA was worked out in 1953. It was found that DNA consists of two long intertwined strands (the "double helix"), each consisting of a sequence of simple chemicals called nucleotide bases. Four different types of base, labeled A, C, G, and T, occur in DNA. The sequence of these bases along particular sections of one of the strands provides the instructions for protein manufacture. The bases A, C, G, and T can be thought of as the letters of the code. Their sequence along a section of DNA (for example, CGGATCCTAGTTGATCATGAC) woi;ld be completely meaningless without the kev to the code, employed by the cell's decoding apparatus. This decoder reads the bases three at a time, and each triplet of bases codes for a particular amino acid, the chemical unit from which proteins are made. For example, the base sequence ACG in a section of DNA codes for the amino acid cysteine and the sequence TGA codes for threonine. As triplets of nucleotide bases are read in turn, the corresponding amino acids are brought together and linked, and, as a complete sequence of bases is read, a chain of amino acids (a polypeptide chain) is formed. This may be a protein molecule itself or may form part of a larger protein structure. Certain base triplets, found at the end of gene sequences, code for termination of protein synthesis.

A complication of the system is that the decoding apparatus does not read directly from DNA but from an intermediary substance, messenger ribonucleic acid (RNA). The DNA acts as a template for RNA manufacture (see Protein svnthcsis). See Nucleic acids for the proc·ess by which DNA is copied and passed on from each cell to its offspring (and via egg and sperm cells to a new individual).

Genetic counseling Guidance given to a person or persons (usually by a physician who has experience in genetics) who are considering having a child but are concerned because there is a blood relative (including perhaps a previous child) with an inheritable disorder, or because they are at risk for some other reason of bearing a child with such a disorder. In most cases, genetic counseling entails predicting the chances of recurrence of a condition that has already affected one or more members of a family. Such counseling depends first on a precise diagnosis of the disorder; the counselor must be able to explain why the disorder occurred and how it is inherited. Genetic counseling may also include discussion of the prognosis (outlook) for an affected child, advising couples about contraception if, after counseling, they decide not to have children or more children, and sometimes discussing the alternative routes to parenthood. WHO IS COUNSELED?

Counseling is important for parents of a child with a gc11etic disorder, such as cystic fibrosis or hemophilia, or a chromosomal ab11ormality, such as Down's or Turner's syndrome. It may be useful if a child is born with birth defects , such as a cleft lip or congenital heart disease, and may be helpful in many other conditions, such as epilepsy, mental retardation, or abnormal sexual development. It may also be useful for prospective parents if there is a history of any of these conditions in a blood relative. Genetic counseling may also help in relation to first-cousin marriages and advanced maternal age. HOW IT IS DONE

Genetic counseling may be provided by a clinical geneticist, by a pediatrician, or by the family practitioner. The counselor makes a pedigree (family tree) of the family . This includes details of any diseases in the family, any blood relationship 481

G

GENETIC DISORDERS

between partners, or any history of miscarriages. Information from death certificates or postmortem reports of relatives may also be needed. When a couple has already had a child with abnormalities, the counselor will ask if there was any exposure to radiation or drugs during pregnancy, or if there was any injury to tne child at birth, as these can cause abnormalities in otherwise healthy families. The counselor also examines the affected child (and his or her parents) and arranges for any necessary tests, such as chromosome analysis, to be done. The parents' chromosomes may sometimes need to be studied as well, because certain conditions, such as Down's syndrome, sometimes result from abnormalities in the parents' chromosomes. For many genetic disorders, it is now possible to establish with some certainty whether or not the parents of an affected child are "carriers" of a defective gene, which can significantly affect the chances of recurrence. Although the actual genes are not identified, DNA markers (fragments of genetic material known to be close to the defective gene on a chromosome) have been identified, and these can be looked for on the parents' chromosomes by advanced laboratory techniques (see Genetic probe). Such techniques are becoming more readily available. Virtually every case investigated by a genetic counselor is unique. Several factors may influence the chances of a disorder recurring and, in some cases, complex mathematical calculations must be carried out to estimate the risk for a couple. WHAT IT CAN OFFER

When a couple has had a child with abnormalities, an important aspect of counseling is the expfanation ofhow it occurred and how the child will fare, including the chances of the child having children and whether they, too, will be affected. Otherwise, advice consists mainly of an estimate of the risk of occurrence or recurrence of the disorder in question. The couple's decision to have children or more children of their own depends partly on the risk estimate, but also on other factors, such as the severity of the disorder, the burden an affected child would place on the family, and the availability of alternative routes to parenthood. The decision on the best course of action is left to the parents after they have had detailed discussions with 482

the counselor and feel satisfied that they understand the condition in question and its implications. When there is a significant risk of producing an abnormal child, the parents may choose to try for a healthy child (but may allow the pregnancy to continue to term only if no abnormality is found during prenatal testing). This applies only to certain conditions, such as spina bifida, Down's syndrome, hemophilia, and muscular dystrophy, in which prenatal diagnosis by amniocentesis or c/10rio11ic villus sampling is able to reveal (with reasonable accuracy) an abnormality early in pregnancy. In such cases, an elective abortion may be chosen if an abnormality is found. If a couple decides against having children, options for parenthood include adoption and artificial insemination by donor (the mother's egg is fertilized by a donor sperm). The latter is worth considering if both parents are carriers of a rare inherited condition or if the father has a dominant or X-linked genetic disorder. Test-tube fertilizaton of a donor egg by the father's sperm, in cases where the mother carries an abnormal gene, is not yet widely available but is a possibility for the future.

Genetic disorders Any disorder caused, wholly or in part, by a fault or faults in the inherited, genetic material within a person's cells-that is, in the genes formed from the substance deoxyribonucleic acid (DNA), which make up the chromosomes in a person's cells. A large number of diseases have, wholly or in part, a genetic cause. Many genetic disorders are apparent at birth and are thus also co11ge11ital. However, the terms genetic and congenital are not synonymous; many genetic defects do not become apparent until many years after birth, and many congenital abnormalities are not genetic in origin. Most people with a genetic disorder have one or more relatives affected by the same disorder-that is, the disorder is also familial. However, there are also occasions when a child is born unexpectedly with a genetic disorder (that is, with no previous family history). There are a number of mechanisms by which this can occur. CAUSES AND TYPES

The reason abnormal genetic material can lead to disorders or disease is that genes control the manufacture in cells of enzymes and other proteins that play

roles of varying importance in cells and in the body as a whole. If the genetic material is defective, abnormal proteins (or abnormal amounts of proteins) may be produced, causing disturbances in body chemistry that lead to disease. For a person to exhibit a genetic disorder, the abnormality in the genetic material must usually be present in each of his or her celfs, which means that it must also have been present in either the egg or the sperm cell (or both) from which the individual was derived. There are two ways in which this can happen. The first is that one or both parents carried a defect in their own genetic material; the second is that a mutation (a change in the genetic material) occurred during the formation of egg or sperm cell. Mutations are one of the mechanisms by which a child affected by a genetic disorder can be born into a family that has never had a known history of genetic disorders. With some of the more common genetic disorders, such as hemophilia, about one third of cases are due to new mutations. Genetic disorders fall into three broad classes: chromosome abnormalities, unifactorial defects, and multifactorial defects. In the first, a child is born with an abnormal number of whole chromosomes, or extra or missing bits of chromosomes, in the cells. Since chromosomes contain many genes, this can lead to multiple disturbances and disorders. (See

Chromosomal abnormalities.) Unifactorial disorders are caused by a single defective gene or pair of genes; these disorders are distributed among the members of an affected family according to relatively simple laws of inheritance. Multifactorial disorders are caused by the additive effects of several genes, along with environmental factors; the pattern of inheritance is less straightforward. UNIFACTORIAL DISORDERS

These disorders are rare, but there are many, and in total they cause a considerable amount of disability. All uni factorial genetic disorders are the result of defects in a gene, or in a pair of genes, controlling the production of a particular protein. They can be divided into two groups-called sex-linked and autosomal disordersaccording to whether the affected gene or genes are located on the sex chromosomes (nearly always the X chromosome) or on any of the other 22 pairs of chromosomes, which are called autosomes (see Chromosomes).

GENETIC DISORDERS

UNIFACTORIAL GENETIC DISORDERS Autosomal dominant In these disorders, the defective gene must be present in only a single dose lo cause outward abnormality. Each child of an affected person usually has a 1 in 2 chance of inheriting the defective gene and of being affected and a 1 in 2 chance of being unaffected . Autosomal recessive Here, a defective gene must be inherited in a double dose to cause abnormality. Usually both parents of an affected person are unaffected carriers of the defective gene . Each of their children has a 1 in 4 chance of being affected and a 2 in 4 chance of being a carrier.

X-linked recessive These conditions are caused by defects on the X chromosome usually leading to outward abnormality in males only, where the defect cannot be masked by a second , normal, X chromosome. Women can be carriers of the defect and half their sons may be affected .

Unaffec ted parent

Affected parent

•• • •• • • • •• • • Unaffected child

Affecled child

1 in 2 chance

1 in 2 chance

Unaffected parenl (carrier)

Unaffected child

1 in 4 chance

Unaffected child (carrier)

1 in 4 chance

Carrier mother

Unaffected boy

Affected boy

1 in 4 chance

1 in 4 chance

1 in 4 chance

Defective gene •

Affected child

Normal gene

Examples Albinism (oculocutaneous) Cystic fibrosis Friedreich's ataxia Galactosemia Hurler's syndrome Phenylketonuria Sickle cell anemia Tay-Sachs disease

Key Defective gene 1 in 4 chance

Unaffected father

Unaffected girl

Unaffec ted girl (carrier)

1 in 4 chance

1 in 4 chance



dose for it to have an outwardly apparent effect. Such individuals are termed lzeteroz1/gotes with respect to the gene, which means they carry one normal copy and one defective copy of the gene. Because the defective gene is dominant-that is, it overrides the normal gene-its presence usually leads to an outwarcf abnormality (but not always a severe one). Some affected people have inherited the defective gene from one of their parents. In other cases there is no family history of the condition; the defect has usually arisen as a result of a mutation. If an affected individual has children, each one has a 50 percent chance of inheriting the defective gene and

Normal gene

Examples Christmas disease Color blindness (most types) Fragile X syndrome G6PD deficiency Hemophilia Muscular dystrophy (Ouchenne)

Key

@

0

0

Autusomal disorders generally affect both sexes equally and are further divided into two groups, called autosomal dominant and autosomal recessive, according to whether the defective gene need be present in a single or double dose to cause an outward abnormality. The sex-linked disorders show a bias in their incidence among the sexes. Most are of one type-called X-linked recessive disorders-and primarily males are affected. Some examples of these three varieties of unifactorial disorder are shown in the table. AUTOSOMAL DOMINANT DISORDERS With these disorders, a person need carry the defective gene in only a single

Key

Unaffected parent (carrier)

Unaffected child (carrier)

Examples Achondroplasia Hereditary spherocytosis Huntington's chorea Marfan's syndrome Neurofibromatosis Polycystic kidney (adult type) Polyposis coli Tuberous sclerosis

Defective X chromosome Normal X chromosome



Y chromosome

thus also the chance of being affected. Often these disorders appear in each of several generations, finally disappearing only when the affected individuals in a generation have no affected children or no children at all. AUTOSOMAL RECESSIVE DISORDERS People who manifest these disorders have always acquired the particular gene defect in a double dose-they are said to be lwmozygotes with respect to the defective gene. In most cases, both parents of an affected person are heterozygotes-they carry the defective gene in a single dose along with a normal gene. But, because the defective gene is recessive and "masked" by the normal gene, they display no outward abnormality. 483

GENETIC ENGINEERING

G

With all autosomal recessive defects, the number of such carriers in the population always outnumbers those who are actually affected. For example, with cystic fibrosis (the most common disorder of this type), one in 22 of the population is a carrier of the defective gene, but only one person in 2,000 is born with the condition. The majority of carriers are unaware of the fact and have no family history of the condition-the defective gene has been passed on to them silently over many generations. When two carriers have children and one is born with an autosomal recessive condition, the manifestation of the defect thus usually comes as a complete surprise. If both parents are carriers, any subsequent child will have a one in four chance of also being affected. X-LINKED RECESSIVE DISORDERS In these conditions, the defective gene is on the X chromosome. Women have two X chromosomes in their cells; men have only one, which they inherit from their mothers and pass on to their daughters. When a woman inherits the defective gene in a single dose, because it is recessive, it is masked by the normal gene on her other X chromosome, so she displays no outward abnormality. She is a heterozygote carrier of the defective gene. However, when a male inherits the defective gene, there is no normal gene on a second X chromosome to mask it, and he will display the abnormality. The familial pattern of these disorders is as follows. Affected males far outnumber affected females and in all cases have inherited the genetic defect from their mother (who is a carrier). They pass the defective gene to none of their sons but to all of their daughters, who become carriers in turn. Carrier females transmit the defective gene on average to half their sons, who are affected, and to half their daughters, who become carriers in turn. Thus, the pattern is for some of the males in an affected family to have the disorder, while the females in the family are either known or possible carriers. MULTIFACTORIAL DISORDERS

A large number of disorders fall into this category-including asthma, insulin-dependent diabetes mellitus, sclrizophrenin, and a number of conditions present at birth, such as clubfoot and cleft lip nnd pnlnte. In each case, susceptibility to the disorder is thought to be determined by a number of different genes that, 484

along with environmental influences, have an additive effect. The degree to which susceptibility to each of these various disorders is determined by genes has been estimated and is termed its heritability. AFFECTED FAMILIES

The underlying cause of genetic disorders (defects in genes) cannot be treated. However, there are a number of methods by which the chances of a child being born with a genetically based disorder can be reduced. If a couple is considering having children and any parents or close blood relatives (or they themselves) have a genetically based disorder, they would be wise to obtain genetic counseling. This is especially important if the couple has had a child with a genetically based condition. Once a pregnancy is established, study of the genetic material in fetal cells obtained by techniques such as chorionic villus sampling and amniocentesis can establish whether or not certain genetic disorders are present. In cases where a serious disorder is found, a termination of the pregnancy may be chosen.

Genetic engineering A branch of genetics concerned, in its broadest sense, with the alteration of the inherited, genetic material carried by a living organism to produce some desired change in the characteristics of the organism. In practice, the main application of genetic engineering to date has been to mass-produce a variety of substances-all proteins of various sorts-that have uses in medical treatment and diagnosis. The function of any gene is to control the production of a particular protein in a living cell. If the gene responsible for synthesizing a useful protein can be identified, and if such a gene can be inserted into another cell that can be made to reproduce rapidly, then a colony of cells containing the gene can be grown. The colony will then produce the protein in large amounts. WHY IT IS DONE

Genetic engineering has been used for producing some human hormones (notably msulin and growth lzormone), some proteins for use in vaccines (against hepatitis, for example), and interferon, a substance with potential for treating viral infections. Other valuable aids to treatment are genetically engineered fnctor Vlll (a protein used for the treatment of hemophilia), TPA (tissue plnsminogcn

activator), a substance that dissolves blood clots, and many other medically useful substances. HOW IT IS DONE

The main technique for mass-producing useful proteins by genetic engineering is called recombinant deoxyribonucleic acid (DNA) technology. DNA is the substance in cells that consists of strings of genes, which control the manufacture of different proteins. The first stef is to identify the gene in the DNA o a cell that controls the manufacture of a particularly useful protein. This involves a number of highly sophisticated laboratory techniques. The next step is either to extract the gene from the cell or, if the exact chemical structure of the gene can be worked out, to synthesize it. The final step is to introduce the gene into the DNA of a suitable recipient cell. By the use of enzymes that can split a molecule of the recipent cell's DNA at certain sites, a gap can be produced into which the additional gene can be spliced (hence the term recombinant DNA). The types of cells or organisms suitable for such genetic alteration are those that can subsequently be made to reproduce rapidly and indefinitely. The most popular organisms to date have been the common intestinal bacterium ESCHERICHIA COLI and various yeasts, but cells of other organisms, including human cancer cefls, have also been used with success. OUTLOOK

In view of the ease with which some of the bacteria and other organisms used for genetic engineering can reproduce, and the possibility of accidentally creating and liberating highly dangerous microorganisms, doubts have frequently been expressed about the dangers of "tampering with nature" in this way. These dangers are real but are well recognized by researchers in the field, who have produced stringent codes of practice and regulations to ensure safety. In the future, it may be possible to extend genetic engineering to the manipulation of human genetic material for purposes of treating ge-

netic disorders.

Genetic probe A specific fragment of deoxyribonucleic acid (ONA) used to determine whether particular defects or genetic "markers" are present in a person's or a fetus's genetic material-that is, in the DNA that, along with some pro-

GERIATRIC MEDICINE

tein, makes up the chromosomes in his or her cells . Genetic probes are used primarily in the prenatal diagnosis of certain genetic disorders and to determine whether or not certain people are "carriers" of gene defects. Often, there is no technique for detecting the defective gene itself. However, for certain gene defects (e.g., the one responsible for cystic fibrosis) markers (sections of DNA with a specific base sequence) have been identified that very commonly occur on particular chromosomes in association with the defect. Hence, if the marker can be found, it provides strong evidence that the gene defect is also present. This has particular implications for

genetic counseling. In one technique, the chromosome under test (obtained from a cell of the person or the fetus under investigation) is first broken up using enzymes (the probe) in a test tube; the fragments are then fixed onto a filter. A radioactively labeled sequence of DNA that will bind to the "marker" sequence of DNA in the chromosome (if present) is then added, and sophisticated techniques are performed to see whether such binding has occurred.

Genetics The study of inheritance-that is, how the characteristics of living organisms are passed from one generation to another, the chemical basis by which such characteristics are determined, and the causes of the similarities and differences among individuals of one species (for example, the human species) or among different species. More particularly, genetics includes the study of deoxyribonucleic acid (DNA), the substance in cells that determines the characteristics of an organism, and of genes, which are units of inheritance corresponding to specific bits of DNA. Particular branches of human genetics include population genetics, which studies tne relative frequency of various genes in different human races; molecular genetics, which is concerned with the structure, function, and copying of DNA from one cell to another, and also how mutations (changes) occur in DNA; and medical or clinical genetics, which is concerned with the study and prevention of genetic disorders.

Genital herpes See Herpes, genital.

Genitalia

Genital warts

The reproductive organs, especially the external ones. The male genitalia include the penis, testes (within the scrotum), prostate gland, seminal vesicles, and associated ducts, such as the epididymis and vas deferens. The female genitalia include the ovaries, fallopian tubes, uterus, vagina, clitoris, vulva, and

See Warts, genital .

Bartlwlin's glands.

Genital ulceration An eroded area of skin on the genitalia. In men the ulcer may be on the skin of the penis or scrotum; in women it may be on the vulva or within the vagina. CAUSES

The most common cause of genital ulceration is a sexual/If transmitted disease. The early stages ·of syphilis are characterized by a hard chancre, a painless ulcer where the bacteria penetrated the skin. This may be followed by shallow, elongated ulcers once the chancre has healed. The herpes simplex virus causes painful, fluid-filled blisters to develop on the genitalia; if these blisters become infected by bacteria they may ulcerate. Both chancroid and granuloma inguinale are bacterial infections that cause genital ulcers; they are common in tropical countries. In the former the ulcers are painful, in the latter they are painless. Lymplzogra1111lo111a venercum is a viral infection in which the resulting blisters occasionally ulcerate. Other causes of genital ulceration include herpes zoster, tuberculosis, or a tumor of the testis, which can erode the scrotum to cause an ulcer. Genital ulceration may also be a side effect of drugs. It can be caused by solutions applied to genital warts in high concentrations. It can also be a reaction to a drug taken by mouth; sulfonamide antibacterial drugs, for example, can cause mouth and genital ulcers (see Stevens-Johnson syndrome). Belu;ct's syndrome is a rare condition that causes tender, recurrent ulcers in the mouth and on the genitals. Cancer of the penis or vulva may cause a single, painless ulcer with raised, rolled edges that turn outward. DIAGNOSIS

The diagnosis of the underlying cause is made from the appearance of the ulcer and the presence of other signs, such as enlarged lymph glands or a skin rash. Swabs from the ulcer are taken and the material examined and cultured to look for a specific bacterium or virus. Blood tests to detect antibodies to a specific type of infection may be performed.

Gentamicin ANTIBIOTIC Injection Ointment Cream Eye drops

/J

Prescription needed Available as generic

A drug given by injection, sometimes in combination with another antibiotic, to treat serious infections. For example, gentamicin is used to treat meningitis, septicemia (blood poisoning), and endocarditis (inflammation of the heart lining). Gentamicin cannot be given by mouth because it is inactivated during digestion. During treatment, blood tests are taken to determine gentamicin levels to monitor dosage and thus reduce the risk of toxic damage to the kidneys or inner ear. The drug is used in eye drops to treat conjunctivitis caused by infection .

Gentian violet A purple dye used mainly by biologists to make bacteria visible under the microscope. Gentian violet also has antiseptic properties and can be applied to the skin to treat burns, boils, carbuncles, and fungal infections. It is occasionally used to relieve soreness in the mouth caused by candidiasis (thrush).

Genu valgum The medical term for knock-knee.

Genu varum The medical term for bowleg.

Geriatrician A physician who specializes in treating elderly patients and the special conditions related to aging.

Geriatric medicine The medical specialty concerned with care of the elderly. Many diseases and disorders that affect the elderly may occur in patients of all ages, but older people tend to respond differently to sickness and treatment. For example, aging is associated with a progressive decline in the functioning of major organs-the heart, lungs, kidneys, liver, and brain. Consequently, an infection in one of these organs or elsewhere in the body that would cause only minor illness in a young adult might be life-threatening in an 485

G

GERM

older person. Any illness in an elderly person may cause a temporary but marked slowing of thought processes, and may even lead to confusion and other features that may be mistaken for dementia . This is due to the added stress placed on the brain during the illness. Furthermore, many medicinal drugs are eliminated from the body by the liver or kidneys and, if these organs are affected by aging, dosages of drugs used in treatment may need to be modified to avoid dangerous side effects. A physician who specializes in geriatrics is expert at assessing the health of patients and in assessing the complex features of their disease. He or she takes particular care not to give excessive doses of drugs and tries also to avoid moving the patient away from familiar surroundings unless hospital admission is essential. Geriatricians are also skilled at rehabilitation; they usually make the contacts (with social services and voluntary agencies) that are necessary to arrange a comprehensive rehabilitation program.

Germ The popular term for any microorganism that causes disease. Examples include a virus or bacterium (see Bacteria) . In medicine, the term is used to describe simple, undifferentiated cells that are capable of developing into specialized tissues, such as the cells of the early embryo.

early this century by a group that adopted the name gestalt, meaning "form, " "pattern, " or "configuration. " In studying emotional states and social issues, Gestalt theory emphasizes viewing things as a whole rather than breaking them down into collections of stimuli and responses. Gestalt therapy became popular as a means of coping with personal problems and is still practiced today by some therapists; this type of therapy aims to increase self-awareness by looking at all aspects of an individual within his or her environment.

Gestation The period from conception to birth, during which the developing fetus is carried in the uterus. Gestation normally lasts around 270 days, about nine months. Because of the difficulty in determining the precise date of conception, physicians time pregnancies from the first day of the last normal menstrual period, giving a gestation period of 284 days.

Giardiasis An infection of the small intestine, caused by the proto~oan (single-celled) parasite GIARD/A LAMBLIA . Giardiasis is most common in tropical area s and in travelers to the tropics. Recently it has become more common in developed countries, affecting especially homosexual men , people living in institutions, and preschool children. The infection is particularly

common where large numbers of young children gather together- for example, in day-care centers and preschools. The disease is spread by contaminated food or water or by direct personal contact (e.g., by handto-mouth contact). SYMPTOMS

About two thirds of those infected have no symptoms. When symptoms do occur they begin one to three days after the parasite has entered the body . The person has violent attacks of diarrhea accompanied by flatus (gas); the feces are foul-smelling, may be greasy, and tend to float in the toilet bowl. Abdominal di scomfort, cramps, or swelling, loss of appetite, and nausea may also occur. In some cases, the infection becomes chronic. DIAGNOSIS AND TREATMENT

The infection is diagnosed from microscopic examination of a sample of feces for the presence of the parasites. If there is any doubt, a jejuna! biopsy (removal of a small sample of tissue for microscopic analysis) ma y be carried out. Acute giardiasis usually clears up without treatment. However, treatment incorporating the antibiotic metronidazole or quinacrine relieves symptoms quickly and prevents the spread of infection. PREVENTION

Infection can be prevented by thorough hand washing before handling food and by avoiding eating foocf or drinking water that could possibly be contaminated .

German measles Another name for rubella.

Germ cell tumor A localized proliferation of cells that are the immature forms of either sperm in the male testis or ova (eggs) in the female ovary. (See Sc111i110111a.)

Gerontology The study of aging in all its aspects (developmental, biological, medical, sociological, and psychological). The specialty that treats the medical problems of th e elderly is called geriatrics (see Geriatric medicine) .

Gestalt theory Ideas based on the notion that the whole is more than the sum of its parts; a school of psychology based on the idea that a sense of wholeness is more important than the individual bits and pieces of perception and behavior. It was found ed in Germany 486

HOW GIARDIASIS IS SPREAD Giard iasis is spread by contam inated water or food , or by personal contact. Th is parasitic infection is most com mon in the tropic s, but recen tly it has become a more freq uent occurrence in developed countries, especially among groups of preschool ch il d ren .

0 ,~ e6

\torn dr1nk1ng untre 'J'Ja.ge or through ha tea 1,z,:

,f,i'O'i seo ?~e_rs_o_ '1}e ~e ~e,c\e e,0~0 0'"

ij

~,~?f ~ ~



.,,,, 1

·'

_ -

GLAND

Giddiness See Dizziness.

Gigantism Excessive growth (especially height) resulting from overproduction, during childhood or adolescence, of growth hormone by a tumor of the pituitary gland. Untreated, the tumor eventually destroys the pituitary gland and results in death during early adult life. If the tumor develops after growth has stopped, the result is acromegaly rather than gigantism. Oversecretion of growth hormone from early life can result in an individual attaining an immense height. The tallest documented giant in medical history, Robert Wadlow, reached a height of 8 feet 11 inches and a weight of 475 pounds before he died at age 22. Such instances are rare, however. By far the most common reason for a child being tall is that his or her parents are tall. Other rare causes of excessive height in childhood are Marfan's syndrome and thyrotoxicosis. DIAGNOSIS AND TREATMENT

The diagnosis of gigantism is made when brain imaging and blood tests confirm the presence of a pituitary tumor and excessive growth hormone. The condition may be treated with bromocriptine, a drug that blocks the release of growth hormone, or by surgery or radiation therapy to destroy or remove the tumor.

The syndrome is more common in males, partially inherited, and is probably underdiagnosed because of its strange symptoms. It is usually of lifelong duration but antipsyclwtic drugs, such as haloperidol, can often provide effective relief.

Gingiva The Latin name for the gum that surrounds the base of the teeth.

Gingivectomy Surgical removal of part of the gum margin. Gingivectomy may be used to treat severe cases of gingival hyperplasia (thickening of the gums), a condition usually caused by anticonvulsant treatment with phenytoin. Gingivectomy also is used to remove pockets of infected gums formed during advanced stages of gum disease

(periodontitis). Gingiveclomy is performed in the dentist's office using local anesthetic. After surgery, the newly exposed area around the base of the teeth may initially be sensitive; the exposure also gives the teeth a longer appearance. There are no complications as long as scrupulous oral hygiene is maintained after surgery.

Gingivitis Inflammation of the gingiva (gums), often due to infection. Gingivitis is a reversible stage of gum disease. CAUSES

Gilbert's disease An inherited disorder that affects the way bilirubin is processed by the liver and that may cause mild jaundice. Sufferers are otherwise healthy. Gilbert's disease is common, affecting about 2 percent of the population. Usually there are no symptoms. When there are symptoms, they may include malaise, anorexia, upper abdominal pain, and mild jaundice. Usually no treatment is necessary, but the drug phenobarbital can relieve jaundice and other symptoms.

Gilles de la Tourette's syndrome A rare disorder of movement, named for the French neurologist who first described it in 1885. It starts in childhood with repetitive grimaces and tics, usually of the head and neck, sometimes of the arms, legs, and trunk. Involuntary barks, grunts, or other noises may appear as the disease progresses. In about half the cases, the sufferer has episodes of coprolalia (using foul language).

Gingivitis is usually caused by the buildup of plaque (a sticky deposit of bacteria, mucus, food particles, and other irritants) around the base of the teeth. It is thought that toxins produced by bacteria within the plaque irritate the gums, causing the gums to become infected, tender, and swollen. Gingivitis can result from injury to the gums, usually from overvigorous toothbrushing or careless flossing. INCIDENCE

Mild gingivitis is very common in young adults. Pregnant women and diabetics are susceptible because of changes in their hormone levels. SYMPTOMS

Healthy gums are pink or brown and firm; in people with gingivitis, they become red-purple, soft, shiny, and swollen. The gums bleed easily, especially during toothbrushing, and are often tender. PREVENTION AND TREATMENT

Good oral hygiene is the main means of preventing and treating gingivitis. Teeth should be thoroughly brushed with a fluoride dentifrice (toothpaste)

l Example of gingivitis The gums around the bases of the upper teeth are pL!ffy. shiny. and tender. They overhang the teeth margins. Affected gums often bleed when brushed.

r

I

G

at least once a day and after meals, if possible; dental floss should be used at least once a day. It is also important to visit your dentist at least once a year (or more often if he or she recommends) so that teeth can be cleaned to remove calculus (mineralized plaque) and accumulated plaque through a procedure known as scaling. The dentist may prescribe an antibacterial mouthwash for use at home.

f

,.._

COMPLICATIONS

Untreated gingivitis may damage gum tissue around the base of the teeth, leading to the formation of pockets in which plaque and calculus can collect. Bacteria within the plaque may cause inflammation to spread, eventually leading to periodo11titis, an advanced stage of gum disease in which the supporting tissues of the teeth and tfte surrounding bone become eroded, loosening the teeth. Acute necrotizing ulcerative gingivitis may develop due to invasion of tissue by anaerobic bacteria ·in people with chronic gingivitis, especially those with lowered resistance to infection. Also called trench mouth or Vincent's disease, acute necrotizing ulcerative gingivitis is a serious condition resulting in destruction of gum tissue; it requires a course of antibiotic treatment.

Gland A group of specialized cells that manufactures and releases chemical substances, such as hormones and enzymes, for use in the body. There are two main types of glands: endocrine and exocrine. Endocrine glands do not have ducts and thus release their secretions directly into the bloodstream; examples include the pituitary, thyroid, and adrenal glands. Target organs may be quite distant from the endocrine glands.

487

I-

GLANDERS

l. G

Exocrine glands have ducts and release their secretions either onto the surface of the skin or into a hollow structure such as the mouth or digestive tract; examples include the sebaceous glands, which secrete sebum onto the skin, and the salivary glands. Collections of cells in the lymphatic system, the lymph nodes, are sometimes referred tu as glands. Strictly speaking, this is incorrect usage because they do not secrete chemical substances. However, they do release white blood cells, which play an important role in fightin g infections and allergic reactions.

Glanders An infection of horses and donkeys that is rarely transmitted to humans. It occurs in Asia, Africa, and South America and is caused by the bacterium PSEUDOMONAS MALLET, which enters the body through a cut or abrasion or by being breathed in . Initially, symptoms (mild fever, headache, general aches and pains, and possibly some generalized swelling of the lymph nodes) are vague. If bacterial entry was through a wound, ulcers or abscesses may then appear at the site; if entry was through the lungs, p11e11mo11ia may develop. In severe cases, septicemia (blood poisoning) may then follow. DIAGNOSIS AND TREATMENT

The disease is diagnosed by identifying the bacteria in a sample of pus or sputum (phlegm) or by detecting antibodies to the bacteria in a blood sample. Early treatment with an appropriate antibiotic usually clears the infection .

When the underlying cause is localized, swollen glands also tend to be confined to a limited area; for example, a throat infection may result in swelling only of the lymph glands in the neck. Swollen glands near the surface of the skin-in the groin or neck, for example-are usually felt as tender, sligh t1y warm lumps. However, swelling of deeper glands, such as those in the lungs or abdomen, is almost invariably unnoticeable. INVESTIGATION AND TREATMENT

In many cases, the cause of swollen glands is obvious from the presence of a localized infection or a bee sting that has caused an allergic reaction. In other cases, the accompanying symptoms usually indicate the cause; for example, swollen glands with a sure throat, fever, and tiredness suggest infectious 11101101111c/eosis (glandular fever) . If swollen glands persist or there is no obvious cause, tests may be necessary. These may include a blood count, chest X rays to look for swollen glands in the lungs, or a biopsy (removal of tissue for microscopic analy sis) of an affected gland. Treatment depend s on the underlying cause. Antibiotics may be given for a bacterial infection, antihistamines for an allergy, or radiatio11 therapy or cl1c11wtherapy (or both) may be used to treat a tumor.

Known medically as lymphadenopathy, enlargement of the lymph nodes (glands) as a result of inflammation and/or proliferation of white blood cells within them . CAUSES

488

Glasses Simple optical devices used to correct focusing errors in the eyes so that clear vision 1s achieved. The lenses are made of glass or plastic and the shape and thickness are chosen during an eye test (see Vision tests). TYPES OF LENSES

Lenses may be convex (outwardly curved), concave (inwardly curved), or cylindrical. Most are single-vision lenses, but bifocal or trifocal lenses, with smaller areas differing in power from the main lens, are common . Varifocal lenses, with power increasing gradually from the center to one edge, are becoming popular. Lenses may have a permanent tint or may incorporate chemicals that produce darkening on exposure to light.

Glass eye See Eye, artificial.

Glaucoma A condition in which the pressure of the fluid in the eye is so abnormally high that it causes damage. A minimal pressure is required to maintain the shape of the eyeball, but excessive pressure may result in the compression and obstruction of the small internal blood vessels and/or the fibers of the optic nerve. The result is nerve fiber destruction and partial or complete loss of vision. TYPES AND CAUSES

Glands, swollen

Swollen glands are a very common symptom and are usually due to an infection or allergic reaction (see Allergy). Children are especially prone to swollen glands as a result of infection, partly because the lymphatic system plays a more important part in combating infections in childhood than in adult life. Rarer causes of swollen glands include lymplzo111a , J-/odgki11 's dismse, leuke111in (cancer of the white blood cells), or a 111dastasis (secondary cancer that has spread from elsewhere in the body).

Glandular fever See Mo1101111c/eosis , i11fectio11s .

Groin Common sites of swollen glands The three most common si tes where swollen g lands can be fe lt are in the neck. armpit. and g roi n

The most common form is chronic open-angle glaucoma, which rarely occurs before the age of 40 and often causes no symptoms until blindness is advanced. It is due to a gradual blockage of the outflow of aqueous humor (fluid in the front compartment of the eve) over a period of years, causing a sfow rise in pressure. This type tends to run in families. In acute closed-angle glaucoma, there is a sudden obstruction to the outflow of aqueous humor from the eye and the pressure rises suddenly. Subacute angle-closure glaucoma is similar to acutl' glaucoma, but develops more slowly or occurs intermittently. Congenital glaucoma is due to a s tructural abnormality in the drainage angles of the eyes . Glaucoma can also be caused by injury to the eye, or by a serious eye disease such as ,weitis, dislocation of the lens, or adhesions between the iris and the cornea.

GLAUCOMA INCIDENCE

WHY GLASSES ARE USED For hyperopia (farsightedness), convex (or plus) lenses are needed . Sufferers of presbyopia also need

plus (magnifying) lenses. Myopia (nearsightedness) requires concave (or minus) lenses. Before correction Farsightedness is caused when focusing power is inadequate Light from a distant object is focused on the retina. but light from a close object is focused behind it.

FARSIGHTEDNESS

Lens

After correction Convex magnifying (or plus) lenses cause the light from the close object to focus on the retina .

Glaucoma is one of the most common major eye disorders in people over 60; it is responsible for 15 percent of blindness in adults in the US. Nearly 2 percent of people over the age of 40 have chronic glaucoma. The incidence rises with age and about 10 percent of people over 70 have abnormally raised pressure within the eye. SYMPTOMS AND SIGNS

Chronic glaucoma often causes no symptoms because the gradual loss of peripheral vision is not apparent to the affected person . Only 1ate in the disease, when there is severe, irreversible damage, may the person be aware of some visual loss.

Before correction Distant objects are blurred , because the focusing power of the eye is too great. Light from the distant obJect is focused in front of the retina .

NEARSIGHTEDNESS

0 Ciliary body _ _

After correction Concave weaken ing (or minus) lenses are used to cause the light from the distant object to focus onto the retina .

ASTIGMATISM

The surrounding surfaces of the cornea are steeper in one direction than in the other . The correcting lenses are designed with additional curvature in one meridian . The lenses are then set accurately in the frame of the glasses so that the steepest curves correspond to the flattest meridian of the cornea. Both concave lenses for myopia and convex lenses for hype ropia and presbyopia can be designed in this way to correct astigmatism.

~

Blocked drainage channel - -- ----h~'!-ri

)

Vertical plane in focus

Horizontal plane out of focus

Acute closed-angle glaucoma This type of glaucoma is caused by an unduly narrow angle between the iris and the back of the peripheral cornea . Dilation of the pupil may therefore lead to a sudden complete blockage of the outflow, causing a rapid increase in pressure in the eyeball .

The symptoms of acute glaucoma include a dull, severe, aching pain in and above the eye, some fogginess of vision, and the perception of rainbow rings around lights at night (halos). Nausea and vomiting can occur and the eye can become red and have a partly dilated pupil and a hazy cornea. Subacute glaucoma can cause similar mild, brief episodes. DIAGNOSIS

Chronic glaucoma often causes no symptoms and is usually detected only by regular, routine eye examina489

G

GLIOBLASTOMA MULTIFORME

tions. Applanation tonometry (by which eye pressure is measured) is an essential check for glaucoma (see Eye, examination of), especially if there is a family history of fhe disorder. Use of an ophthalmoscope to examine the back of the eye may show an abnormal optic nerve. Visual field testing and gonioscopy (examination of the drainage angle) can also be important. TREATMENT

G

Chronic open-angle glaucoma can usually be controlled with eye drops, which reduce the pressure in the eye. Repeated tonometry and visual field testing may be carried out to ensure that tne pressure is being controlled; if necessary, other eye drops will be given. If drops fail to control the pressure, tablets or long-acting capsules may also be prescribed. The medications for treatment of chronic glaucoma usually are prescribed for fife since, if stofped, the pressure generally rises. I medications fail to reduce the pressure in chronic glaucoma, and if there is a continuing foss of visual field or vision, laser surgery or cutting surgery may be necessary to open up the drainage channel or to create an artificial channel for the aqueous humor. Acute closed-angle glaucoma is a medical emergency calfing for urgent treatment. Various treatments (i.e., eye drops, pills, liquids, and/or intravenous fluids) are given to try to reduce the very high eye pressure. Usually, after the pressure is controlled, laser surgery or cutting surgery is necessary for the treatment of acute glaucoma and subacute glaucoma to try to prevent a recurrent attack. Usually a peripheral iridccto111y is done. A small opening is made in the periphery of the iris so that aqueous humor can drain more easilv. The iridectomy is often curative but: if the drainage angle was damaged by the attack, medications may be needed to control the pressure after surgery. If the iris is scarred at the drainage angle, other types of surgery, such as creating an artificial drainage channel, may be necessary. OUTLOOK

The pressure rise of glaucoma can be prevented by treatment, but early diagnosis and treatment are needed to prevent any impairment of vision. Regular eye examinations are important for early detection.

Glioblastoma multiforme A fast-grow ing and highly malignant type of brai11 t11111or. Clioblastoma 490

multiforme is a type of glioma, a tumor arising from glial (supporting) cells within the brain. Most glioblastomas develop within the cerebrum (the main mass of the brain). There are about five to 10 new cases of glioblastoma multiforme per million population per year in the US. The cause is unknown. Symptoms, diagnosis, and treatment are as for other types of brain tumor. Despite treatment, the outlook is poor, with few patients surviving beyond two years.

Glioma A type of brai11 tumor arising from the supporting glial cells within the brain. Gliomas make up about 60 percent of all primary brain tumors (growths originating from the brain itself rather than spread from elsewhere). There are about two to four new cases of glioma per 100,000 people annually in the US.

Cross section of a brain This photograph (taken from an autopsy specimen) shows a la rge area of brain infiltrated by a glioma (dark color)

Types of glioma include astrocyto111a, gliobrasto111a 11111/tiformc (a highly malignant variety of astrocytoma), epe11d11111011w and mcd11/lo/,/asto111a (more cc)mmon in children), and oligodrndroglioma. Symptoms, diagnosis, and treatment are as for other types of brain tumor.

Glipizide An oral liypo1;lyccmic drug used in the treatment ot non-insulin-dependent diabetes 111el/itus. Glipizide stimulates the pancreas to produce i11s11/i11, which promotes glucose uptake into muscle and fat, thereby lowering the blood glucose level.

Globulin Any of a group of proteins characterized by being insoluble in water but soluble in dilute salt solutions; antibodies (also known as 111111111110glob11/i11s) c1re an example.

TYPES

Globulins can be divided into three main groups, known as alpha-, beta-, and gamma-globulins. Alpha-globulins include alpha,antitrypsin and haptoglobin. The former is an enzyme produced by the lungs and liver; deficiency is associated with hepatitis in children and emphysema (a lung disorder) in young adults. Haptoglobin is found in the blood, where it binds together hemoglobin (the oxygen-carrying protein in red blood cells) and prevents it from being excreted in the urine by the kidneys. Various other alphaglobulins are produced as a resu1t of inflammation, tissue damage, autoim1111111e disorders (when the immune system attacks the body's own tissues), or certain cancers. Beta-globulins consist mainly of low-density lipoproteins (LDLs), substances involved in the transport of fats in the blood circulation, and transferrin, which carries iron in the blood. The amount of beta-globulins is increased in certain types of liyperlipide111ia (abnormally high levels of fats in the blood). All of the gamma-globulins are antibodies, proteins produced by the immune system in response to infection, during allergic reactions, and after organ transplants. Gammaglobulins may also be produced in any disorder that causes persistent inflammation of an organ, such as rheumatoid arthritis or cirrhosis of the liver. In addition, certain conditions, such as m11/tiplc 111yelo111a, result in the production of large amounts of a specific gammaglobulin.

Globus hystericus A form of hysteria in which there is an uncomfortable feeling of a "lump in the throat ." This lump is felt to interfere with swallowing and breathing, sometimes so much so that the sufferer is convinced that he or she cannot breathe. Respiration comes in sighs or gasps, anxiety increases, and hypm•entilatio11 (rapid breathing) and symp toms of a panic attack often ensue. Some patients insist that their Adam's apple has become larger or displaced in some way. There is no true physical basis for these attacks, which occur in anxious or depressed people. The condition is not life-threatening. Breathing in and out of a small paper bag fitted tightly around the nose and mouth will alleviate the symptoms brought on by hyperventilation. Treatment is by

GLOMERULOSCLEROSIS

reassurance, breath-control training, and, in some instances, psychotherapy. Use of antia11xiety drugs or a11tidepressa11t drugs to treat the condition is rarely helpful.

Glomerulonephritis Inflammation of the glomeruli (filtering units of the kidney) . Both kidneys are affected, although not all the glomeruli are affected simultaneously. Damage to the glomeruli hampers the removal of waste products, salt, and water from the bloodstream, which may cause serious complications. CAUSES AND INCIDENCE

The incidence of glomerulonephritis varies markedly among different parts of the world, mainly because some common tropical diseases (such as malaria and schistosomiasis) are important causes. Although these diseases rarely are responsible for glomerulonephritis in developed countries, glomerulonephritis is still the most common cause of chronic renal failure (loss of kidney function) in the US and Europe. Some types of the disease are caused by the patient's im111u11e syste111 making antibodies to eliminate microorganisms- usually the bacteria responsible for a minor infection, such as streptococcal sore throat infections. Particles called immune complexes, formed from antibodies and bacterial antigens, circulate in the bloodstream and become trapped in the glomeruli; this triggers an inflammatory process that may damage the glomeruli and prevent them from working normally. Glomerulonephritis also occurs in some a11toim111111u' disorders, systemic lupus erythematosus (a chronic disease of connective tissues), and the immunoglobulin A (lgA) glomerulonephritis known as Berger's disease.

into the urine, which can become blood-stained . When protein is continually lost in the urine, the result is edema (swelling of parts of the body; see illustration). The combination of proteinuria (large amounts of protein in the urine) , low albumin (protein) in the blood, and edema is called the

11ephrotic sy11dro111e. In some cases, glomerulonephritis is severe and sudden, so that kidney failure develops over a few days; patients often notice that they are passing very small quantities of urine. DIAGNOSIS

There are numerous types of glomerulonephritis; one cause may produce a different type in different individuals. Urinalysis and exa mination of the urine sediment (after centrifugation) is helpful in diagnosis. Kidney biopsy (removal of a small amount of tissue for laboratory analysis) is also important for diagnosis. Other tests that may be performed are blood and urine sampling to measure how well the kidney is removing waste products and to measure how much protein is being lost in the urine. These tests may be repeated during treatment to see how the kidneys are responding .

Treatment depends on the type and severity of the disease, as revealed by biopsy. Affected children usually have mild form s characterized by the nephrotic syndrome; they usually recover completely after treatment. Children who experience acute glomerulonephritis after a streptococcal infection usually recover even without specific treatment of the glomerulonephritis. Adults tend to respond less wt'.'11 to treatment, but drugs may be prescribed to control hypertension and a special diet given to reduce the kidneys' load . This may prevent or delay eventual renal failure . A minority of people with severe glomerulonephritis may be given 1111mu11osuppressa11t drugs (to dampen the body's defense system), or plasmaplieresis to remove substances and particles from the bloodstream that trigger the inflammation (i.e., substances released as a result of the immune response).

Glomerulosclerosis Scarring that occurs as a result of damage within the glomeruli (filtering units) of the kidney.

THE EFFECTS OF GLOMERULONEPHRITIS The glomeruli are damaged as a result of inflammation. Red blood cells and protein leak into the urine.

Protein loss from the circulation causes fluid to accum ulate in body tissues, causing edema.

:-xr,r,:,-s:---+---

Damaged glomerulus

_ __,__ Red blood cells Protein ....,__ ___ Urine travels toward the bladder '.o r-- --

Cross section of a damaged glomerulus Damage to the glomerulus causes red blood cells and protein to p ass into the urine, which may be blood -stained .

SYMPTOMS

Mild forms of glomerulonephritis may produce no symptoms and the disease may be noted only when a urine sample is tested for some other reason . Sometimes a mild puffiness of the soft tissues surrounding the eyeballs (periorbital edema) may be apparent. Other times it comes to light only when renal failure has reached an advanced stage and symptoms arise because of -the accumulation of waste products and fluid that are usually eliminated in the urine. High blood pressure may develop and some sufferers experience a dull ache in the loins. Damaged glomeruli may allow the escape of red blood cells

TREATMENT AND OUTLOOK

?"'"'7-;;7"'""T7:-:==:::::2L Normal tissue Water Blood Protein

Healthy tissue Through osmotic pressure, protein molecules in the blood draw back water lost to surrounding tissues

Edema If protein is lost into the urine , there is a fall in osmotic pressure and more water escapes into surrounding tissues, causing swelling.

491

G

GLOMUS TUMOR

G

Mild glomerulosclerosis occurs normally with age; a 10 percent decrease in renal function is common each decade after age 30. However, even a 75 percent reduction in renal function is compatible with a normal life. Glomerulosclerosis may occur in some severe types of glomerulonephritis that are difficult to treat and in which damage progresses to destroy the kidneys. Typically, sufferers develop heavy proteinuria (the presence of protein in the urine) and severe edema (swelling of parts of the body due to fluid collection). Glomerulosclerosis is also found in some people with diabetes mellitus. It is seen in reflux nephropathy (backflow of urine from bladder to kidney sometimes associated with infection) and in some people with hypertension. Intravenous drug abuse may cause glomerulosclerosis. The condition has also been found in some people who have AIDS.

Glomus tumor A small, painful, bluish swelling in the skin, usually on a finger or toe near or under the nail, that is tender to touch and more painful if the limb is hot or cold. The tumors result from an overgrowth of glomus bodies, structures with numerous nerve endings that normally control blood flow and temperature in the skin. Glomus tumors are surgically removed .

smoking, and avoiding acidic or spicy food s that aggravate the soreness. Regular rinsing of the mouth with a salt solution may help.

Glossolalia Speaking in jargon or an imaginary language that has no actual meaning or syntax. Today it occurs almost exclusively at religious meetings. Some Christians regard glossolalia as a sign of possession by the Holy Spirit; scientists tend to view it as a form of hypnosis or hysteria.

Glossopharyngeal nerve The ninth cranial nerve, the glossopharyngeal nerve performs both sensory and motor functions. It conveys sensations, especially taste, from the back of the tongue, regulates secretion of saliva by the parotid gland, and controls movement of the throat muscles. LOCATION OF THE GLOSSOPHARYNGEAL NERVE

The nerve arises from the medulla oblongata and branches to the tongue , parotid gland , and pharynx.

Glucagon is extracted from the pancreas of pigs or cows for use as a drug. It is given by subcutaneous (under the skin) injection in the emergency treatment of sufferers of diabetes me/litus who are unconscious as a result of hypoglycemia (low blood sugar) . Glucagon produces recovery within 15 to 20 minutes; the patient is then given glucose by mouth to prevent a relapse. Nausea and vomiting are occasional adverse effects.

Glucocorticoids Hormones produced by the cortex (outer layer) of the adrenal glands that affect carbohydrate metabolism by increasing the blood sugar level and the amount of glycogen in the liver. The principal glucocorticoid is hydrocortiso11e (also called cortisol), which also has a milder mineralocorticoid (affecting sodium and potassium balance) effect.

Glucose

Removal of all or part of the tongue. Glossectomy may be performed in the treatment of cancer of the tongue, but more usually such cancers are treated by radiation therapy. If a large part of the tongue is removed, speech is impaired and eating is difficult. A liquid diet is then necessary.

BLOOD SUGAR LEVELS

Despite wide variation in carbohydrate intake (and, therefore, large fluctuations in the amount of glucose in the body), the concentration of glucose in the blood-the blood sugar fevel-is normally kept within narrow limits. This is achieved by the actions of several hormones, notably insulin,

Glossitis

492

USE ASA DRUG

The body's chief source of energy for cell metabolism. A monosaccharide (simple sugar) carbohydrate, it comes principally from the digestion of other carbonydrates, although a small amount is also produced in cells by the metabolism of fats and proteins.

Glossectomy

Inflammation of the tongue . The tongue feels sore and swollen and looks red and smooth; adjacent parts of the mouth may also be inflamed. Glossitis occurs in iron deficiency anemia, in pernicious and megaloblastic anemias, and in other vitamin B deficiencies. Other causes include infection (especially herpes simplex) of the mouth, irritation by dentures, and excessive use of alcohol, tobacco, or spices. A congenital form of glossitis affects the middle portion of the back of the tongue . Treatment is for the underlying cause. Self-help measures include maintaining good oral hygiene, not

(sugar). The glucose is then released into the bloodstream, where it is available as a source of energy for cells anywhere in the body. Glucagon therefore regulates the level of glucose in the blood; when the level falls, glucagon is released from the pancreas. Glucagon opposes the action of insulin.

glucagon, epinephrine, corticosteroids, and '{rowtil hormone. If the blood sugar levei is abnormally high (known as

Glottis The part of the larynx (voice box) that consists of the vocal cords and the slitlike opening between them.

Glucagon A hormone produced by the pancreas. Glucagon stimulates the breakdown of glycogen (a carbohydrate stored in the liver and muscles) into glucose

hyperglycemia), it may cause glycosuria (glucose in the urine). An abnormally low blood sugar level is called

hypoglycemia. Insulin, released by the.pancreas in response to increased blood sugar levels, lowers the level by stimulating the uptake of glucose by cells. Inside the cells, glucose may be "burned" to produce energy, converted to glycogen for storage (mainly in the liver and

GOITER

muscles), or used in the production of triglycerides and fats. Glucagon is released by the pancreas when the blood sugar level is low. It stimulates the breakdown of stored glycogen to glucose, which is then released into the bloodstream. Epinephrine (released by the adrenal glands at times of stress) and corticosteroids (also released by the adrenals in response to factors such as infection) have the same basic effect as glucagon. That is, they stimulate the release of glucose to increase the blood sugar level.

Glue sniffing See Solvent abuse.

Gluten One of the proteins of wheat and certain other grains that gi'."'es dough its tough, elastic character. Celine sprue, a sensitivity to gluten, is thought to affect between 0.1 and 0.2 percent of the population.

Gluten enteropathy See Celiac sprue.

Gluten intolerance

ears, and in cough remedies to help soothe a dry, irritating cough. Taken as a suppository or an enema, glycerin relieves constipation by softening hard feces.

Glycerol An essential constituent of fats. Glycerol is released during digestion and absorbed either alone or in combination with fatty acids. When one molecule of glycerol combines with three molecules of fatty acids, the result is a type of fat known as a triglyceride. Most of the glycerol is deposited in the body's fat stores; the remainder is taken up by the liver, where it may be converted into glucose (sugar) to provide energy.

Glycogen The principal carbohydrate storage material in the body. lt is a polysaccharide, consisting of many saccharide (sugar) molecules linked to form a long chain, and is found mainly in the liver and muscles. Glycogen plays an important role in controlling blood sugar levels. When there is too much sugar (glucose) in

See Celiac sprue.

Gluteus maximus

LOCATION OF THE GLUTEUS MAXIMUS

The large, powerful muscle in each of the buttocks that helps give them their rounded shape. The gluteus maximus is responsibfe for moving the thigh sideways and backward.

The top is attached to the sacrum , coccyx, and pelvis. The lower part is attached to the femur (thigh bone).

t

Glyburide An oral hypoglycemic drug used to treat non-insulin-dependent diabetes me/litus. Glyburide stimulates the pancreas to produce insulin, which promotes the uptake of glucose (sugar) into muscle and fat tissue, thereby lowering the level of glucose in the blood.

Gluteus -,;,...,..:.,:.,+"-H-- maximus

WHY IT IS USED

Glycerin is used in moisturizing creams to help prevent dryness and cracking of the skin (for example, it is used to protect the nipples during breast-feeding). Glycerin is used in ear drops to help soften earwax prior to syringing of the

Glycosuria The presence of glucose (a type of sugar) in the urine. CAUSES

Glucose is normally filtered from the bloodstream by the kidneys (along with many other normal blood constituents and unwanted waste products). The filtered fluid passes down the many tubules of the kidneys, where all except the unwanted substances are reabsorbed and returned to the bloodstream (see Kidney). Glucose is one of the substances that the tubules almost completely reabsorb. The kidney may fail to reabsorb all the glucose because of hyperglycemia (a high level of glucose in the blood) or if the tubules have been damaged and are unable to reabsorb even normal amounts of glucose. Hyperglycemia occurs in diabetes mel/itus. Damage to the kidney tubules may be a result of rare metabolic disorders present from birth or be a consequence of drug or heavy metal poisoning. Glycosuria can also sometimes occur in people with healthy kidneys that are unable to reabsorb all of the glucose filtered out of the bloodstream. This condition tends to run in families. Glycosuria often occurs during pregnancy because of hormonal changes, a condition that is usually not serious if it is not accompanied by other symptoms and if the blood glucose level is normal. DIAGNOSIS AND TREATMENT

Glycerin A colorless syrup made from glycerol (an essential constituent of fats) and used in several drug preparations. Glycerin has a high water content, evaporates slowly, is easily absorbed, and has a softening effect.

the blood, the excess is converted to glycogen. This conversion (controlled by insulin and corticosteroid hormones) takes place chiefly in the liver and muscles. When the blood sugar level is low, glycogen is converted back to glucose (a process regulated by the hormones glucagon and epinephrine) and released into the bloodstream .

~AfP+.1-:f---

Hamstring muscles

Glycosuria by itself does not necessarily indicate a serious condition. It may be found during a routine examination or if the physician is performing specific tests because diabetes mellitus is suspected. Urine can be tested for gfucose by using a chemically impregnated strip that changes color when it comes in contact with glucose. Treatment depends on the underlying cause.

Gnat bites See Insect bites.

Goiter Enlargement of the thyroid gland, visible as a swelling on the neck

493

G

GOLD CAUSES

G

The thyroid gland may enlarge (without any disturbance of its function) at puberty, during pregnancy, or as a result of taking the birth-control pill. In many parts of the world the main cause of a goiter is lack of sufficient iodine in the diet. The thyroid requires this mineral to produce the hormone thyroxine; a d e fi ciency causes the gland to swell . A toxic goiter is one that develops in Graves' disease or with other types of overactivity of the thyroid gland in which there is excessive production of thyroid hormones. This leads to thyrotoxicosis, characterized by symptoms such as increased appetite, warm, dry skin, weight loss, tremor, insomnia, and occasional muscle weakness and agitation . A goiter also usually is found in Hashimoto's thyroiditis, an autoimmune disorder, and de Quervain's thyroiditis, an inflammatory condition, both of which damage the gland; it may also be caused by a tumor or nodule in the gland and, in rare cases, by cancer (see Thyroid cancer). A goiter can also be caused by taking antithyroid drugs for overactivity of the thyroid gland.

tests or radionuclide scanning carried out to determine the activity of the thyroid gland. A goiter not caused by disease may eventually disappear naturally or may be so small that it does not require treatment. However, a large or unsightly goiter, or one that is causing difficulties with swallowing or with breathing may require total or partial removal (see Thyroidectomy). If iodine deficiency is identified as the cause, the patient will be advised to eat more fish and iodized salt, which are rich in the mineral. When a goiter is the result of disease, treatment will be for the underlying disorder. If a drug is the cause, the goiter usually disappears once the course of treatment is over.

Gold ANTI RHEUMATIC

Capsule Injection Prescription needed [!O Not available as generic

0

Gold is used to treat rheumatoid arthritis and arthritis arising as a complication of psoriasis. It is usually prescribed in severe active cases when a

nonsteroidal anti-inflammatory drug

(NSAID) has been ineffective. HOW IT WORKS

Gold has an anti-inflammatory action that relieves joint pain and stiffness and can prevent more damage. POSSIBLE ADVERSE EFFECTS

A common adverse effect of gold is

dermatitis (inflammation of the skin); if

Appearance of goiter

The th yroid may become enlarged for any of various reasons, including dietary deficiency of iodine, inflammation, or an autoimmune disorder affecting the gland.

itching occurs, the drug is usually withdrawn . Gold may damage the kidneys, liver, and bone marrow. Tests are performed during treatment to check the function of these organs. Gold may cause loss of appetite, nausea, diarrhea, abdominal pain, and, occasionally, anaphylactic shock (a serious allergic reaction that requires emergency treatment).

DIAGNOSIS AND TREATMENT

Diagnosis is based on the nature of the swelling, along with accompanying symptoms and the results of blood 494

Gonadotropin hormones Hormones that stimulate cell activity in the gonads (ovaries and testes) . Gonadotropins are essential for female and male fertility . The most important gonadotropins, folliclestimulating hormone (FSH) and luteinizing hormone (LH) , are secreted by the pituitary gland. Another gonadotropin, HCG (see Gonadotropin , human clzorionic), is produced by the placenta. GONADOTROPIN HORMONE THERAPY

Synthetic HCG is used in the treatment of recurrent miscarriage and certain types of female and male infertility. Menotropin (a gonadotropin extracted from the urine of women past the menopause) contains both FSH and LH and is used in the treatment of female infertility due to a failure to ovulate. Gonadotropinlike substances are currently being evaluated as contraceptives and as a treatment for cancer of the prostate gland.

Gonadotropin, human chorionic

Golfers' elbow

A hormone produced by the placenta in early pregnancy. Human chorionic gonadotropin (HCC) stimulates the ovaries to produce estroRen and proxesterone, hormones needed to maintain a healthy pregnancy. HCC is excreted in the urine; its measurement forms the basis of most pregnancy tests (a high level confirming pregnancy).

A condition caused by inflammation of the bony prominence (epicondyle) on the inner side of the elbow, to which certain forearm muscles are attached. lt is caused by overuse of these muscles, which act to bend the wrist and fingers. Activities that can cause the condition include gripping and twisting (such as using a screwdriver) or playing golf with a faulty grip or swing.

HCG extracted from the urine of pregnant women is given by injection to treat certain types of infertility. Along with clomiphene tablets it may induce ovulation in women who have not been ovulating. In men, it may be used to increase sperm production. HCC is occasionally given to prevent miscarriage in women whose production of progesterone is deficient.

SYMPTOMS

A goiter can range in size from a barely noticeable lump to an enormous swelling, depending on the cause . Large swellings may press on the esophagus or the trachea, making swallowing or breathing difficult. Any accompanying symptoms must be verified with X-ray pictures.

SYMPTOMS AND TREATMENT

The inflammation causes pain and tenderness at the inner side of the elbow and sometimes in the forearm. Treatment consists of resting the elbow, applying ice packs, and taking analgesics (painkillers) and/or antiinflammatory tablets. If the pain is severe or persistent, injection of a corticosteroid drug may be helpful. If the pain has occurred after participation in a sport, it is wise to take a break from the sport for a week or two to prevent recurrence and to seek advice about playing technique.

HCG THERAPY

GOUT

HCG is also prescribed for the treatment of cryptorchidism (see Testis, undescended) in young boys, although surgical correction is usually required.

Gonads The sex glands-the testes in men and the ovaries in women. The testes, situated in the scrotum, produce sperm and secrete the hormone testosterone. The ovaries, situated in the abdomen, release usually one ovum (egg) between them each month and secrete the hormones estrogen and progesterone. The activities of the gonads-both male and female-are regulated by gonadotropin hormones refeased by the pituitary gland.

Gonorrhea A sexually transmitted disease, commonly known as "the clap." It is one of the most common infectious diseases in the world. CAUSES AND INCIDENCE

Gonorrhea, caused by the bacterium is most frequently transmitted during sexual intercourse, including oral or anal sex. An infected woman may also transmit the disease to her newborn baby during childbirth. Gonorrhea is the second most common sexually transmitted disease, after nonspecific urethritis, and is most prevalent among young adults who have had multiple sexual partners. There are approximately 1 million cases of gonorrhea reported annually in the US. Since many cases are not reported, the true annual incidence may be closer to 3 million cases.

NEISSERIA GONORRHOEAE,

SYMPTOMS AND SIGNS

Gonorrhea has a short incubation period of two to 10 days. In men, srmptoms usually \nclude a 1:1ret~ral discharge and pam on urmation. About 60 percent of infected women have no symptoms; if symptoms are present, they usually consist of a vaginal discharge or a burning sensation when urinating. Infection acquired through anal sex causes gonococcal proctitis (inflammation of the rectum and anus). It causes pain and anal discharge in only about 10 percent of infected people. Oral sex with an infected person may lead to gonococcal phan;ngitis, causing soreness in the throat but, again, most people have no symptoms. A baby exposed to infection in the mother's reproductive tract during childbirth may acquire gonococcal ophthalmia, a severe inflammation affecting one or both eyes.

COMPLICATIONS

Untreated gonorrhea may spread to other parts of the body. In men, it may cause prostatitis (inflammation of the prostate) or epididymo-orchitis (inflammation of the testes), affecting fertility. In women, untreated gonorrhea involves the fallopian tubes, causing pelvic inflammatory disease (PIO). If the fallopian tubes are damaged, the woman is very likely to become infertile as a result. Gonococcal bacteria may spread through the bloodstream to cause gonococcal arthritis, with pain and swelling of joints around the body. Multiplication of bacteria in the bloodstream causes septicemia, with generalized symptoms and signs, including fever and malaise; it can even spread to the brain or heart and cause death. DIAGNOSIS

eventually resulting in inflammation and disruption of the normal functioning of the lungs and kidneys. The disease usually affects young men, but can develop at any age. Mild forms may be treated with 1mmunosuppressant drugs (drugs that hamper the normal working of the body's immune system) and plasma exchange (plasmapheresis). The outlook is not good for people with severe and repeated attacks; they are treated by dialysis (a technique for removing waste products from the blood) and, eventually,

kidney transplant.

Good Samaritan laws Statutes (in most states) that legally protect a physician who voluntarily aids an injured or unconscious person at the scene of an accident.

Gout

Many disorders can cause urethral or vaginal discharge. To confirm a diagnosis of gonorrhea, laboratory tests are necessary. Tests are carried out on a sample of the discharge or on swabs taken from the urethra or cervix.

A metabolic disorder that causes attacks of arthritis, usually in a single joint. Gout may be associated with kidney stones and ultimately may lead to kidney failure.

TREATMENT

An acute attack of gout usually affects a single joint, most commonly the joint at the base of the big toe, but it can affect other joints, including the knee, ankle, wrist, foot, and small joints of the hand. The affected joint is red, swollen, and extremely tender; the pain reaches a peak level of intensity within 24 to 36 hours. The redness and swelling may spread and be confused with ce1lulit1s (inflammation of the connective tissue). The intensity of the pain is such that the person may not be able to stand on an affected foot or even tolerate the pressure of bedclothes on it. Sometimes there is a mild fever. The first attack usually involves only one joint and lasts a few days. Some people never have another attack, but most have a second attack between six months and two years after the first. After the second attack, more and more joints may be involved, and there may be constant pain due to damage to the joint from chronic inflammation.

Gonorrhea is treated with antibiotics, usually penicillin or ampicillin. If the infection is caused by penicillin-resistant NEISSERIA GONORRHOEAE or if the infected person is allergic to penicillin, other antibiotics, such as tetracycline, ceftriaxone, or spectinomycin, may be used. Tests are performed to ensure that the infection has been cured. OUTLOOK

Treatment for gonorrhea is effective but does not protect against reinfection. Sexual partners must be told that they might have gonorrhea even if they have no symptoms; many clinics have counselors (known as contact tracers) who identify and inform all people wh? might have been infected by the patient.

Goodpasture's syndrome A rare condition characterized by glomerulonephritis (inflammation of the filtering units of the kidney), coughing up blood (hemoptysis), and anemia. Goodpasture's syndrome is a serious disease; unless treated at an early stage, it may lead to life-threatening bleeding into the lungs and progressive renal failure. Goodpasture's syndrome is an autoimmune disorder (one in which the body's immune system attacks its own tissues). Antibodies are formed that attack the capillaries (tiny blood vessels) in the lungs and kidneys,

SYMPTOMS AND SIGNS

TREATMENT

Pain and inflammation in gout can be controlled with laIJ;e doses of a

nonsteroidal

anti-inflammatory

drug

(NSAID). If use of an NSAID is contraindicated, colchicine may be prescribed. For maximal benefit, treatment should start as soon as an attack begins; patients prone to recurrent attacks should carry their gout 495

G

GRAFTING

medication. As the inflammation subsides, usually within two_ to_ thr~e days, the dose of med1cahon 1s reduced and finally stopped. If an attack of gout is not responding to treatment with NSA!Ds or colchicine, a corticosteroid drng may be injected into the affected joint. Increased levels of purine (a product of DNA) can raise the level of uric acid in the blood . Although a strict low-purine diet is not necessary, people with gout should avoid foods that are high in purine, such as liver

G

and other organ meats, legumes, and poultry. Excess alcohol consumption should alsu be avoided because it may precipitate an acute attack in a susceptible individual. Many people never have mow than a few attacks of gout, and further treatment is usually unnecessary . If attacks arc recurrent, the frequency can be reduced bv lowering the urate levels with drugs that either inhibit the formation of uric acid (such as allopurinol) or increase the excretion of uric acid by the kidneys with

GOUT Gout is a common joint disease. affecting 10 times more men than women . In men it occurs at any time after puberty: in women it usually occurs only afte r the menopause . There is often a family history of the

,_,,,...-,--,.~,:e:.,1>i'-ii-tt--f--

disorder. Hype ruricemia (excess uric acid in the blood) leads to formation of uric acid crystal s in Joints: crystals may also be deposited in soft tissues in the ears and around tendons .

tm11spln11t ; Hmrt lm11spln11t; Livt;r tm11 spln11t; Trm1spla11t surgery); heart valves (sec Hea rt mll'c surgery); and

DIAGNOSIS

blood

Microsurgery).

in joint space

Appearance of gout Deposition of uric acid c rystals in the joint space have caused inflammation and obvious swelling of the affected right knee.

Grafting The process of transplanting hea lthy tissue from one part of the body to another (autografting), from one person to another (allografting or homografting) , or from an animal to a person (xenografting) . Grafting is used to repair or replace diseased or otherwise defective tissue. The primary tissues transplanted are skin (see Skin graft); bone (see B()Hl' gmft); bone marrow (see Ro11e marrow /ra,1sp/n11tatio11); the cornea of the eve (see Corneal graft); the kidney, the heart, and the liver (see KidtH't/

Gout is considered as a diagnosis whenever an attack of arthritis affects a sing le joint A blood test is usually performed: a high level of uri c acid suggests gout.

Crystals precipitate

Crystal precipitation Crystals of uric acid precipitate into the joint space and surrounding tissues of the knee. causing intense in flamm ation and extreme pain

uricosuric drugs (such as probcnccid and sulfinpyrazone). If the serum urate is very high , these drugs will need to be taken for life, as untreated hyperuricemia may lead to hypertension or kidney disease.

Aspiration Fluid is aspirated (removed th rough a needle into a syringe) from the swollen knee Joint and examined under a microscope

Microscopic evidence The presence of uric acid crysta ls confirms the diagnosis

vessels

nerves

(see

COMPLICATIONS

With autografting, the grafted tissue is usually assimilated at the new site without any trouble and soon grows into the surrounding tissue to provide a good repair. Problems occur, however, with allografting (hornografting) and xenografting, both of which are usually carried out to replace rather than repair tissue. Xenografting is not performed clinically except for the use of porcine (pig) heart valves . The major drawback to allugrafting is that the recipient's defen se system automatically attempts to reject the foreign cells of the donor's tissue and to d estroy them in the same way that it would invading microorganisms. The only exceptions are in the case of identical twins (because their tissue matches exactly) and in that of corneal grafting, since the cornea has no blood supply (and therefore no whitt" blood cefls and antibodies to act as a defense system). To nvercome rejection, as close a match as possible between the tissues of the recipient and donor is sought (see Tiss11c-typi11g). /111111111ws11pprcssm1t drugs (especially cyclospori11c) arc given to suppress the body's defense system- though this can cause other problems, such as decreased kidney function. Cydosporine, the immunosuppressant drug introduced in 1984, has been particularly effective in the control of organ rejection a nd gmf/-pcr-

s11s-/10st disease. 496

and

GRAVES' DISEASE

Graft-versus-host disease

Grand mal

A common complication of bo11e marrow tra11spla11tati011. It is caused by cells called cytotoxic T-li1mphocytes, present in the transplanted marrow, attacking the transplant recipient's tissues. Lymphocytes form part of the i1111111111e system and normally play a beneficial role by attacking celfs recognized as foreign. However, in transplant procedures, it is just this activity of the lymphocytes that causes disease. Graft-versus-host (GYH) disease may occur soon after any organ transplantation or may appear some months later. The first sign of the disease is usually a skin rash. Then there may also be diarrhea, abdominal pain, jaundice, inflammation of the eyes and mouth, and breathlessness. Most patients recover within a year, but some gradually get weaker and thinner and about one third die. Graft-versus-host disease can be prevented by giving immunosupprcssant drugs, such as cyclosporine, to all transplant recipients. If the disease develops, it is treated with corticosteroid dntgs and with other immunosuppressants. It may be possible to prevent GYH disease in bone marrow transplants by removing cytotoxic T cells from the donor marrow before the transplant is done.

A type of epileptic seizure in which the person, sometimes after warning symptoms, cries out, falls to the ground unconscious, and suffers generalized jerky muscle contractions. The seizure may last for a few minutes. The person usually remains unconscious for a time and may have no recall of the seizure on awakening. (See also Epilepsy.)

Gramicidin An antibiotic drug used in combination with other drugs of this class to treat bacterial infections of the eye or skin. It is prescribed in the form of eye drops or an ointment.

Gram's stain An iodine-based stain widely used in bacteriology to help differentiate among various types of bacteria. It is also known as Gram's iodine. There are several different methods of Gram staining. Basically, the specimen is stained with gentian violet, followed by Gram's solution, and then treated with a decolorizing agent such as acetone. Finally, the specimen is counterstained with a red dye. Bacteria that retain the dark violet stain are known as gram-positive; those that lose the violet stain after decolorization but take up the counterstain (causing them to appear pink) are gram-negative. Examples of grampositive bacteria include several species of streptococcus, staphylococcus, and clostridium; gram-negative bacteria include VIBRIO CHOLERAE (which causes cholera) and various species of salmonella.

Granulation tissue A mass of red, moist, granular tissue that develops on the surface of an ulcer or open wound during the process of healing. The tissue consists mainly of fibroblasts (which make collagen) and numerous small blood vessels. (See also Healing; Wound.)

Granuloma An aggregation of cells, of a type associated with chronic inflammation, anywhere in the body. CAUSES AND TYPES

Granulomas usually occur as a reaction to the presence of certain infectious agents or to a foreign body, but may occur in conditions of unknown cause. Certain infections, such as tuberculosis, brucellosis, lcproslJ, and syphilis, although caused by different bacteria, give rise to infective granulomas in many different organs of the body. Sarcoidosis, a condition of unknown cause, is also characterized by granulomas in different organs. Granulomas may also occur in parasitic and fungal infections. A foreign body granuloma can occur as a reaction to inorganic material, such as dust, talcum powder, dirt, or a suture. A pyogenic granuloma is a common benign skin tumor that develops on exposed areas following minor injury. It is frequently found on the hands of gardeners. The swellings are raised, moist, and tender and often disappear gradually without treatment. They can be excised surgically, or by electrocoagulatio11 or cryosurgery. Many other, largely unrelated, conditions are described as granulomas. For example, a dental granuloma is a swelling arising from poorly fitting false teeth; a granuloma may also form a benign growth on the iris. (See also Granuloma mznulare; Gra,111/o,na inguinale; Granuloma, lethal midline.)

Granuloma annulare A harmless skin condition characterized by a circular, raised area of

skin, occurring most commonly in children on the knuckles or fingers, or less commonly on the upper part of the feet or on the elbows or ears. The raised area spreads slowly outward to form a ring, 1 to 3 inches in diameter, with raised edges and a flattened center. Rarely, several of these ringlike plaques occur over a wider area. The cause of the condition is unknown. The diagnosis of granuloma annulare is by means of a skin biopsy (removal of a small sample of tissue for microscopic investigation). No treatment is necessary. fn most cases, the affected skin heals completely over several months or years.

Granuloma inguinale A sexually transmitted disease that causes ulceration of the genitals. The infection is caused by bacterialike organisms called Donovan's bodies. Granuloma inguinale is common in the tropics, especially Papua, New Guinea, although it is very rare in developed countries. There are about 100 cases in the US per year, usually occurring in homosexual men. The first symptoms are painless, raised nodules on the penis or labia or around the anal area. The nodules gradually ulcerate and then form bright red, raised areas that are usually painless. These areas sometimes become purulent (contain pus) and, if left untreated, may eventually heal with extensive scarring. Diagnosis is based on finding Donovan's bodies in a biopsy sample (tissue removed from a sore). The antibiotics tetracycline or gentamicin provide effective therapy.

Granuloma, lethal midline A rare disorder of unknown cause in which the nose and other facial structures become inflamed and eventually destroyed by progressive damage to the skin and underlying tissues. Patients with midline granuloma are usually in their 40s or 50s; women are affected more often than men. The first symptoms are usually caused by ulceration within the nose. Tissue destruction may spread to the facial sinuses, the gums, and the eye orbits. The most effective treatment is radiation therapy, which usually halts the progression of the disease and may improve symptoms for years.

Graves' disease A disorder characterized by toxic goiter (an overactive and enlarged thyroid gland), excessive production of 497

G

GRAVIDA

thyroid hormones leading to thyrotoxicosis, and sometimes exophthalmos (bulging eyeballs). It is a type of autoimmune disorder (disturbance in the body's immune system).

Gravida

G

The medical term for a pregnant woman. The term is often combined with a prefix to indicate the total number of pregnancies (including the present one). For example, primigravida is a woman who is pregnant for the first time, and secundigravida is one who is pregnant for the second time; multigravida is a general term for a woman who has been pregnant at least once before.

Gray An SI (International System of Units) unit of radiation dosage (see Radiation units box).

Gray matter Regions of the central nervous system (brain and srinal cord) consisting principally o closely packed and interconnected nuclei of nerve cells, rather than their filamentous projections or axons, which make up the white matter. In the brain, gray matter is primarily found in the outer layers of the cerebrum (the main mass of the brain and the region responsible for advanced mental functions) and in some regions deeper within the brain. Gray matter also makes up the inner core of the spinal cord.

Grief An intensely unhappy and painful emotion caused by the loss of a loved one. (See Bereavement.)

Grip The hand is particularly well adapted for gripping, with an opposable thumb (that is, able to touch all the other fingers), specialized skin on the palm and fingers to provide adhesion, and a complex system of muscles, tendons, joints, and nerves that enables precise movements of the digits. The hand can perform two basic grips: grasping, which is a strength hofd that involves the whole hand, and pinching, a precision hold using the thumb and a finger. Both grifs are controlled by a combination o long muscles in the forearm and short muscles in the hand itself. Gripping ability can be reduced by any condition that causes muscular weakness or impairment of sensation

498

in the palms or fingers (e.g., a stroke or nerve injury) or by disorders that affect the bones or joints of the hand or wrist, such as arthritis or a fracture.

Grippe A term of French origin for any influenzalike illness (see Influenza). The term was once used commonly in English-speaking as well as Frenchspeaking countnes.

Griseofulvin ANTI FUNGAL

(l)},/ ✓ /i.1iY'#~J'C) Tablet Capsule Liquid

f!jJ

Prescription needed

!!!I

Available as generic

A drug given by mouth to treat tinen infections (a group of fungal infections) that have not responded to creams and lotions. Griseofulvin is particularly useful in the treatment of infections affecting the scalp, beard, palms, soles of the feet, and nails. Common side effects are headache, loss of taste, dry mouth, abdominal pain, and increased sensitivity of the skin to sunlight. During long-term treatment, griseofulvin may cause liver or bone marrow damage; blood tests are usually carried out to check organ function.

Groin The hollow between the lower abdomen and top of the thigh. (See also Groin, lump 111 the; Groin strain .)

Groin, lump in the The most common cause of a swelling in the groin is enlargement of a lymph gland as a result of an infection (see Glands, swollen). Another common cause is a hernia, a protrusion of intestine through a weak area in the abdominal wall. Other possible causes of a lump in the groin include an abscess (a pusfilled sac), a lipoma (a painless benign tumor of fat cells), or an undescended testis (see Testis, undescended). Rarely, a lump in the groin may be due to a varicose vein or an aneun1sm (a balloonlike swelling in an artery). INVESTIGATION

Examination of the swelling by a physician usually reveals its cause.

Groin strain Pain and tenderness in the groin due to overstretching a muscle, typically while running or participating in

sports. The muscles commonly affected are the adductors on the inside of the thigh, which rotate and flex the thigh and pull it inward, and the rectus femoris (at the front of the thigh), which also flexes the thigh. Pain and tenderness in the groin that mimic pain due to muscle strain may sometimes be caused by osteoarthritis in the hip or lower spine, pubic osteitis (inflammation of the pubic bones, situated at the front and base of the spine), or an inguinal hernia (a protrusion of intestine through a weak area in the abdominal wall). INVESTIGATION AND TREATMENT

When the cause is obviously a simple muscle strain, treatment is with physical therapy. However, if another cause is suspected, or if what was thought to be a muscle strain does not respond to physical therapy, tests sucn as X rays may be required. An X ray may show that a muscle has pulled a small piece of bone away from the pelvis; surgery to wire the bone back into position may be necessary.

Ground substance The thick, gellike material, sometimes called tissue matrix, in which the cells, fibers, and blood capillaries of cartilage, bone, and connective tissue are em6edded. Ground substance consists principally of a large amount of water chemically linked to complex carbohydrate and protein molecules. The water enables nutrients and gases essential for metabolism and respiration to pass easily from the blood capillaries to the cells. Because of its gellike consistency, ground substance also protects the cells, fibers, and capillaries from damage. Excess ground substance is produced in hypothyroidism (underactivity of the thyroid gland). This results in a condition called myxedema, in which ground substance accumulates in the skin, leading to thickening of the skin and coarsening of the facial features.

Group therapy Any treatment of emotional or psychological problems in which groups of patients meet regularly with a therapist. Interaction among members of the group is thought to be therapeutic and for certain problems is considered to be more effective than the traditional patient-therapist relationship. The group setting is also useful for Job-related therapy. The group may range in number from three to 40 people, but eight to 10 people is the usual size. Members

GROWTH, CHILDHOOD

meet for an hour or more once or twice a week to discuss their problems openly with one another under the guidance of the therapist. Group therapy is most useful for people with personality problems and for sufferers from alcohol dependence, drug dependence, anxiety disorders, eating disorders (such as anorexia nervosa and bulimia), and depressive illnesses (see Depression).

Growth, childhood The period of most rapid growth occurs before birth, during embryonic and fetal development. After birth, the growth rate decreases steadily, although it is still very rapid in the first few years of life, esrecially the first year. At the onset o puberty there is another major period of growth and development that continues until full adult height is reached, usually at about the age of 18. As a general rule, increase in weight follows the same pattern as increase in height. Significant variations occur within the typical overall growth pattern. For example, baby boys grow faster than girls until the age of about 7 months, when girls grow faster than boys. Girls continue to grow more rapidly until about 4 years, when the rate of growth becomes the same, and remains so until puberty. However, in overall height, girls tend to be shorter than boys at all ages until puberty, when they become taller for a few years because they enter the pubertal growth spurt earlier than boys. But because puberty occurs later in boys, their final height is greater. Growth is not simply a process of

Growing pains Vague aches and pains that occur in the limbs of children. The pains usually are felt at night and most often affect children between 6 and 12 years old. Their cause is unknown, although they do not seem to be related to the process of growth itself. Growing pains are of no medical significance and require no treatment, though the pains may interfere with becoming taller and heavier. The body shape also changes because different areas grow at different rates. At birth, the head is already about three quarters of its adult size; the head grows to almost full size during the first year. Thereafter, it becomes proportionately smaller because the body grows at a much faster rate. The limbs grow faster than the trunk during early childhood but more slowly during puberty. Different tissues also grow at different rates. For example, lymphatic tissue grows rapidly until just before adolescence, when it begins to shrink. The brain also grows quickly during the early years, but reaches about nine tenths of its adult weight by the age of 5, after which its growth rate decreases markedly. FACTORS THAT INFLUENCE GROWTH

Growth can be influenced by heredity and by environmental factors, such as nutrition, general health, and emotional welfare. Hormones also play an important role, particularly growth hormone, thyroid hormone, and, at puberty, the sex hormones. A child with taller-than-average p.'.lrents also tends to grow to above-

the child's sleep and may alarm the parents. If pain is severe or associated with other symptoms, such as joint swelling or malaise, a pediatrician should be consulted.

Growth An abnormal proliferation of cells within a localized area (see Tumor); the increase in height and weight as a child develops (see Growth, childhood). average height because of the effects of heredity. However, this may be counteracted by poor health or inadequate nutrition. In infancy, weight is the best indicator of health and the state of nutrition. Thereafter, height is equally important. Regular measurement of height, weight, and, in babies, head circumference, provides an invaluable record of a child's growth rate. A chronic illness, such as asthma, will retard growth if it is undetected. Even a minor, short-lived illness can slow growth, although the growth rate usually catches up again when the child recovers. In some cases, slow growth may be the only indication that a child is ill, malnourished, or emotionally distressed or deprived. However, there is wide individual variation in the rate at which children grow and short stature does not necessarily indicate poor health. Each case of slow growth requires assessment by a pediatrician. Abnormally rapid growth is rare. Usually, it is a familia1 trait but occasionally it may indicate an underlying disorder, such as a pituitary gland tumor. (See also Age; Child development; Gigantism.) If the body is divided into eight equal parts, it can be seen that proportions change radical ly in relation to the bod y's overall length. For example, a newborn baby's legs account for only three eighths of his or her height wh il e an adol esce nt's legs account for one half. A newborn's head accounts for as much as one fourth of his or her height while an adolescent' s head accounts for only one eighth .

CHANGES IN BODY PROPORTIONS BETWEEN BIRTH AND ADOLESCENCE

2 3 4

5 6

7 8 (Eighths)

Newborn

2 years

5 years

8 years

Adolescence

499

G

GROWTH, CHILDHOOD

GROWTH CHART: BOYS 1 TO 18 YEARS Height

In 75-

cm 190 -:-

70 -

180 -

Weight

I ! J_J• .......,,.

"',,,---s__ ,_.

170 65 60 55 50 45-

G

i

I

160 150-

I

--- ---

120-

-

35 -

90 80 -

30 -

-- 4

,_. '4 ; 'r---,J ;,,if

--r I

I

,;

20-

50-

-

40-

15-

30 -

10-

, ...

;

I

;

'

--

,-

-, ," .,.

,,.

'

I/

I

i,

,

~

!,"' ·

:-

-

.

,

--

:,

I

i 6

7

I

8

I

9

' 10 11

17

- 60

- 100

- 45

- 90

- 40

- 80

- 35

- 70

- 30 - 25 - 20

- 40 - 30

- 15

Weight

70 -

180-

~-~

lbs - -190

I

- 180

170 -

- 170

160-

- 160

60-

150--

- 150

55-

140-

- 140

130-

- 130

65 -

5045-

kg

- 85 - 80 - 75 - 70 -- 65 - 60

120-

- 120

- 55

110-

- 110

- 50

40 -

100-

--100

- 45

35 -

90 -

- 90

- 40

80-

- 80

- 35 - 30

302520 ·15 10-

5--

70 -

- 70

60 -

- 60

50 -

- 50

40 -

- 40

30 -

- 30

_..,,___,_...J_ -

20-

!

--+---::~-:-:~~-' .,r ;~t::::·_~i :1;•

.~

~?-

Hyperthyroid rhythm The hyperthyroid heart beat shown in th is tracing is irregu lar and adnormally rapid .

,, , ;

Muscle wasting - -- - - - - - -Severe hyperthyroidism may cause wasting of both skeletal and heart muscle; the latter may lead to irregularities of heart rhythm.

-

--+-I-'"----

__,

Increased appetite - - - - -- - - - - - - - 1 . < - ~ . . . 4~..U-... This symptom is a result of the metabolic overactivity that hyperthyroidism causes Despite increased appetite, there is often weight loss.

removal of part of the thyroid gland. In older patients, an alternative is a single dose of radioactive iodine, which is taken up by the thyroid and destroys some of its tissue.

Hypertonia Increased rigidity in a muscle. It may be caused by damage to its nerve supply or by cell changes within the muscle itself. Hypertonia causes episodes of continuous muscle spasm (e.g., in the bladder wall when the outflow uf urine is being obstructed by an enlarged prostate gland). Persistent hypertonia in limb muscles following a stroke or major head injury causes spasticity. A variable increase in muscle tension associated with abnormal patterns of movement and posture is referred to as dystonia.

Hypertrichosis Growth of excessive hair, often in places not normally covered with hair. Hypertrichosis is often a result of taking certain drugs (including cyclosporine, minoxidil, and diazoxide).

558

The disorder is not the same as hirsutism, which is excessive hairiness in women due to abnormal levels of male hormones. Hypertrichosis is also the term used to describe hair growth in a colored, fleshy mole.

Hypertrophy Enlargement of an organ or tissue due to an increase in the size, rather than number, of its constituent cells. For example, skeletal muscles increase in size in response to increased physical demands. (See also Hyperplasia.)

Appearance of exophthalmos Hyperthyroidism can cau se swelling of ti ssues around the eyes , resulting in a staring appearance .

(such as diuretic drugs) that reduces the excretion of uric acid by the kidneys. Increased amounts of purine in the diet may raise the level of uric acid in the blood, precipitating gout. TREATMENT

Drugs such as allopurinol (which reduces uric acid production in cells) and probenecid or sulfinpyrazone (which increase the excretion of uric acid by the kidneys) may be prescribed for life to prevent complications. Foods high in purine (e.g., liver, poultry, and dried peas and beans) need to be avoided.

Hyperuricemia

Hyperventilation

An abnormally high level of uric acid in the blood. Hyperuricemia may lead to the . development of gout due to the deposit of crystals of uric acid in the joints; it may also cause kidney stones (see Cairn/us , 11ri11ary tract) and tophi (crystals in the tissues).

Abnormally deep or rapid breathing, usually caused by anxiety. Hyperventilation may also occur as a result of uncontrolled diabetes mellitus, oxygen deficiency, renal failure, and some lung disorders (such as pulmonary edema and emphysema). Hyperventilation causes an abnormal loss of carbon dioxide from the blood, which can lead to alkalosis (increase in blood alkalinity). Symptoms include numbness of the

CAUSES

Hyperuricemia may be caused by an inborn error of meta/Jolism, by rapid destruction of cells as part of a disease such as /e11kc111ia, or by medication

HYPOCHONDRIASIS

extremities, faintness, and tetany (painful spasms and twitches of the muscles in the hands and feet), and a sense of an inability to take a full breath. The effects of alkalosis often add to the already existing feelings of anxiety, and may give rise to the "hyperventilation syndrome," in which the sufferer experiences a feeling of impending doom. Breathing into a plastic or paper bag during an attack may help reduce the loss of carbon dioxide and avoid the risk of alkalosis. Hyperventilation associated with uncontrolled diabetes or uremia represents a compensatory effort by the body to eliminate excess carbon dioxide in dealing with acidosis. In this case, the hyperventilation syndrome does not develop.

Hyphema Blood in the front chamber of the eye, almost always caused by an injury that ruptures a small blood vessel in the iris or the ciliary body. Vision is markedly affected while the blood remains mixed with the aqueous humor, but it clears as the red cells sink. Usually the blood disappears completely within a few days and vision is fully restored, but there is a risk of delayed bleeding three to five days after the injury. Drug treatment or surgical evacuation of the blood is sometimes necessary.

HISTORY

THERAPEUTIC USES

A form of hypnotism was first practiced by the Austrian physician Franz Mesmer in the eighteenth century. Mesmerism (renamed hypnotism after the Greek god of sleep) began to receive attention from many leading members of the medical community in the nineteenth century. The celebrated Parisian physician Charcot gave public demonstrations, and Freud used hypnosis in his early treatment of hysteria. Hypnotism continues to attract much popular interest, both theoretical and medical, but its clinical use is still much debated. Likewise, its use to stimulate the memory of witnesses for courtroom testimony is controversial. Hypnosis for this purpose is acceptable in some jurisdictions and not in others.

Some psychoanalysts use hypnosis as a means of helping patients remember and come to terms with disturbing events or feelings that have been repressed from consciousness. More often, hypnosis is used as a means of helping patients relax. It may be useful in people suffering from anxiety, panic attacks, or phobias, and is sometimes successful in treating addictive habits, such as smoking. Scientific studies are lacking, however, and claims of fantastic cures should be treated with skepticism.

HOW IT IS DONE

A prefix meaning under, below, or less than normal, as in hypodermic (under the skin), hypoglycemia (abnormally low blood sugar level), and hypotension (lower than normal blood pressure).

For hypnosis to succeed, the subject must first want to be hypnotized. The second requirement is relaxation, so a comfortable chair and a quiet, dimly lit room are usually necessary. The subject is usually asked to fix his or her attention on a particular object while the therapist quietly repeats phrases such as "Be still and listen to my voice" or "Empty your mind of all thoughts." The person gradually becomes more and more re1axed, eventually losing touch with the environment and hearing only the therapist's voice. At the end of the session, the subject "wakes up" when told to do so. With training, it is possible for people to practice autohypnosis (selfhypnosis) by repeating certain phrases to themselves or imagining relaxing scenes. Some people are more easily hypnotized than others, usually those with an intense imaginative life. The ability seems to be related to early childhood experiences and may be partly inherited. CHARACTERISTICS

Appearance of hyphema Blood that has collected in the front chamber of the eye is clearly visible in front of the iris; hyphema is usually caused by an injury.

Hypnosis A trance like state of altered awareness that is characterized by extreme suggestibility. Hypnosis was once befieved to be a form of sleep. However, the EEG (electrical tracing of brain-wave activity) of a hypnotized person does not show any of the normal sleep patterns.

Hypnotized subjects wait passively to be told what to do by the therapist and are very suggestible-they touch or hold imaginary objects and act out suggested roles. They do not, however, obey commands to behave in a manner they would normally regard as dangerous or improper. Attention usually becomes highly selective, so that only one person at a time is heard. Subjects frequently will obey orders to forget everything that has happened during hypnosis, or, alternatively, to remember or repeat behavior learned while hypnotized (posthypnotic suggestion).

Hypnotic drugs Drugs that induce sleep, such as antianxiety and barbiturate drugs.

Hypo-

Hypoaldosteronism A deficiency of aldosterone in the body. This hormone, along with other corticosteroid hormones (notably hydrocortisone ), is produced by the adrenal cortex (outer part of the adrenal glands). Removal of, or damage to, the cortex results in a deficiency of these hormones, which, in turn, causes

Addison's disease.

Hypochondriasis The unrealistic belief or fear that one is suffering from a serious illness, despite medical reassurance. SYMPTOMS

Hypochondriacs worry constantly about their bodily health and interpret any physical symftom, however trivial, as evidence o a serious disorder. The feared disease may involve many parts of the body or may center on a particular organ and a single disease, as in cardiac neurosis (fear of heart disease). Hypochondriacs constantly seek medical advice and undergo numerous tests and treatments. Rarely, an obscure physical disorder is discovered, but it does not justify the symptoms described. CAUSES

Hypochondriasis is usually a complication of other psychological disorders, including obsessive-compul-

sive behavior, phobia, generalized anxiety disorder, schizophrenia, depression, and brain diseases, such as dementia and brain tumors. 559

H

HYPOGLOSSAL NERVE

The cause of hypochondriasis in the absence of an underlying disorder is uncertain. However, it seems to be more common in people who suffered from a true organic illness during childhood or were constantly exposed to sick relatives. The reason for this may be that the hypochondriac becomes programmed to overreact to every bodily feeling, though there may also be an inherited sensitivity to pain. Other factors that may predispose a person to hypuchondriasis include social stresses and personality type (usually obstinate) . TREATMENT

When there is an underlying mental disorder, it is treated as required. Hypochondriasis alone is more difficult to treat. An understanding and patient physician can often help relieve distress.

Hypoglossal nerve The nerve that controls movements of the tongue. The hypoglossal nerve is rarely damaged. If damage does occur (e.g ., as a result of a stroke), one side of the tongue becomes paralyzed. LOCATION OF HYPOGLOSSAL

NERVE The hypog lossal nerve arises in the medulla oblongata (part of the brain stem), passes through the base of the skull, and runs around the throat to the tongue.

~ i:· . ·. . / ,-!-: }/ /i

Brain stem_-1,~~c::::-

"·r .

insulin (a hormone that regulates the level of glucose in the blood), resulting in an abnormally high level of glucose. To lower it, diabetics take either hypo'\lycemic drugs by mouth or insuhn by injection. Too high a dose of either can reduce the blood sugar to too low a level, thus starving the body cells of energy. Hypoglycemia can also occur if a diabetic person misses a meal, fails to eat enough carbohydrates, or exercises too much. Rarely, hypoglycemia can result from drinking a large amount of alcohol or from an insuli110111a (an insulin-producing tumor of the pancreas); it also occurs for no known reason in some children, but is usually only temf1orary. Hypog ycemia is a serious condition. The brain needs glucose for its metabolism and to function properly, and prolonged lack of it may lead to permanent intellectual impairment in an affected person. SYMPTOMS

The principal symptoms include sweating, weakness, hunger, dizziness, trembling, headache, palpitations, confusion, and sometimes double vision. Behavior is often irrational and aggressive and movements are uncoordinated; this state may be mistaken for drunkenness. The victim may lapse into a coma due to extremely low blood sugar. TREATMENT

Insulin-dependent diabetics should always carry sugar with them (in a convenient form such as sugar lumps or glucose tablets) to take at the first sign of an attack of hypoglycemia. If it is suspected that an unconscious person has suffered a hypoglycemic attack, medical help should be summoned immediately. The physician will give an injection of either glucose solution or the hormone glucagon; the latter counteracts the effects of insulin and raises the blood sugar level by stimulating the conversion of glycogen to glucose.

Hypoglycemics, oral

Hypoglycemia An abnormally low level of glucose (sugar) in the blood. Almost all cases occur in sufferers from insulin-dependent diabl'fes 111ellit11s. In this disease, the pancreas fails tu produce enough

560

Oral hypoglycemics lower blood glucose levels by increasing the production by the pancreas of i11s11hn, a hormone that increases the amount of glucose that is absorbed from the bloodstream into body cells. Insulin rather than oral hypoglycemics may need to be prescribed temporarily to control the blood glucose level (e.g., during surgery, pregnancy, or a severe illness) . Oral hypoglycemics are of no use in treating insulindependent diabetes because in these cases the pancreas is unable to produce any insulin. POSSIBLE ADVERSE EFFECTS

Oral hypoglycemic drugs may cause hypoglycem,a (abnormalfy low blood glucose) if the dosage is too high or if the person has not had enough to eat.

Hypogonadism Underactivity of the gonads (testes or ovaries). Hypogonadism may be caused by disorders of the testis or ovary or by a pituitary gland disorder resulting in deficient production of go11adotropi11 lwr111011e. In affected males, hypogonadism causes the symptoms and signs of ai1drogc11 hormone deficiency. In females, it causes the symptoms and signs of estrogen lzormo11e deficiency.

Hypohidrosis Reduced activity of the sweat glands. It is a feature of hypohidrotic ectodermal dysplasia, a rare, inherited, incurable condition characterized by reduced production of sweat usually accompanied by dry, wrinkled skin, sparse, dry hair, small, brittle nails, and conical teeth. Other causes include exfoliative dermatitis and some a11tic/10li11ergic drugs.

Hypomania Hypoparathyroidism

Acetohexamide Chlorpropamide Glipizide Glyburide Tolazamide Tolbutamide

r WARNiN"G___ - -- - - - - ,

I Consult your physician if you regularly I experience symptoms. such as I dizziness, nausea, and sweating, that relieved only by food or a sugary I are drink.

HOW THEY WORK

A moderate form of 111a11ia.

COMMON DRUGS Hypoglossal nerve _ _ _ ___,

A group of drugs that are used to treat non-insulin-dependent diabctes 111el/it11s when hyperglycemia (raised blood glucose level) cannot be controlled simply by diet.

I I I I

L------------.JI

Insufficient production of parathyroid hormone produced by the parathyroid gln11ds, which lie behind the thyroid gland in th e neck. Parathyroid hormone, along with vitamin D and calcitonin (a hormone produced by the thyroid gland), regufates the level of calcium in the body . A deficiency of the hormone results in low levels of calcium in the blood and ti ssue fluid s.

HYPOTENSION

HYPOPLASTIC LEFT HEART SYNDROME The heart defects associated with this syndrome are shown (at right) and compared with those of

the normal heart (at left). Neither the left ventricle (pum ping chamber) nor the aorta is properly formed .

Pulmonary artery

~ - - Aorta Ductus J/tik""=--:==-',_"l-..,_~~--_arteriosus Pulmonary artery

Left ventricle Right ventricle _ _,.,.____,..,..._

Left ---+++- ventricle Right ~e--+""t---ventricle

In a normal heart, blood is pumped by the left ventricle to the body via the aorta. If the left ventricle is poorly formed. blood can reach the body only via the ductus arteriosus, wh ich closes soon alter birth.

CAUSES

WHY IT IS DONE

The most common cause of hypoparathyroidism is the accidental removal of the parathyroid glands during surgery on the thyroid gland. It may also result from surgery to remove a portion of the parathyroid glands themselves in the treatment of hyperpn rathyroid ism (overproduction of parathyroid hormone). Occasionally, the parathyroid glands are absent from birth, or they may cease to function for no apparent reason.

Hypophysectomy is sometimes performed to remove a pituitnry tumor that may be the cause of a number of endocrine diseases, such as acromegaly and Cushi11g's syndrome. The operation may also be performed to treat some types of breast, ovary, or prostate gland cancer, the growth of which is stimulated by hormones secreted by the pituitary gland.

SYMPTOMS

the gland is removed via the nose. However, if the tumor is very large, a craniotomy (incision into the skull) is performed just above the hairline, and a flap of bone temporarily removed to give access to the gland.

The main effect of a low level of calcium in the body is tetnny, an increased excitability of the nerves that causes uncontrollable, painful, cramplike spasms of the face, hands, arms, and sometimes the feet. Rarely, general seizures similar to those of an epileptic attack may occur. DIAGNOSIS AND TREATMENT

The condition is diagnosed by tests to measure the level of parathyroid hormone in the blood. If the patient is suffering from an attack of tetany, calcium may be injected slowly into a vein to provide quick relief. To maintain the blood calcium at a normal level, a lifelong course of calcium and vitamin D tablets is necessary (the vitamin D is needed to increase absorption of calcium from the diet). Regular checkups are also necessary.

Hypophysectomy Surgical removal of the pituitary gland or destruction of the gland by radioactive implnnts.

HOW IT IS DONE

A general anesthetic is given. Usually

aorta (main artery carrying blood from the heart to the body) is malformed and blood can reach it only via a duct (the ductus arteriosus) that links the aorta to the pulmonary artery (blood vessel that transports blood to the lungs). At birth the baby may seem healthy, but within a day or two the ductus arteriosus closes off and the baby collapses, becoming pallid and breathless. There is no effective surgical treatment for the condition and most affected babies die within a week. The risk of parents having another affected child is small.

Hypospadias A congenital defect, occurring in about one in 300 male babies, in which the opening of the urethra is situated on the underside of the glans (head) or shaft of the penis. Sometimes the penis curves downward, a condition known as clwrdee. In an extreme form of hypospadias the urethral opening lies between the genitals and the anus, the scrotum is small, and the testes are undescended. In such cases the genitals may resemble those of a female and the true sex of the child may be in doubt. TREATMENT

Single-stage operations to correct hypospadias are available today. The penis is straightened and a tube of skin (or occasionally bladder lining) is used to create a new urethra that extends to the tip of the penis. The operation is usually performed before the boy is two years old. Surgery is usually successful, allowing the boy to pass urine normally and, later, to have satisfactory sexual intercourse.

Hypoplasia

Hypotension

Failure of an organ or tissue to develop fully and reach its normal adult size.

The proper medical term for low blood pressure. Some healthyJeople with a normal heart and bloo vessels have blood pressure well below average for their age. The term hypotension is usually used only when blood pressure has fallen to the extent that blood flow to the brain is reduced, causing dizziness and fainting . In postural hypotension (the most common type), symptoms occur after abruptly standing or sitting up . Usually, blood pressure increases slightly with these changes in posture; in people with postural hypotension, this increase fails to occur. Postural hypotension may be an adverse effect of n11tidepressm1t drugs or m1tiliypertensive drugs (drugs used to treat high

Hypoplasia, enamel A defect in tooth enamel. It is usually due to mnelogenesis imperfecta (a hereditary condition), but may also be caused by vitamin deficiency, injury, or infection of a primary tooth that interferes with maturation of enamel.

Hypoplastic left heart syndrome A serious and usually fatal form of congenital henrt disease that affects about one to two newborn babies in every 10,000 live births. The baby is born with a poorly formed ventricle (pumping chamber) on the left side of the heart and other heart defects. The

561

H

t

HYPOTHALAMUS

blood pressure). It also occurs in diabetics because of nerve damage disrupting the reflexes that control blood pressure. Acute hypotension (of sudden onset) may be caused by injuries involving heavy blood loss or serious burns leading to hypovolemia (reduced blood volume) and physiological shock, or by any crisis, such as myocardial infarction (heart attack) or adrenal failure, that leads to shock. Treatment of hypotension depends on the underlying cause (diabetes mellitus, for example). For many people with postural hypotension, adjustment of medication may resolve the condition.

H

Hypothalamus A region of the brain, roughly the size of a cherry, situated behind the eyes and beneath another brain region called the thalamus. It has nerve connections to most other regions of the nervous system. LOCATION OF HYPOTHALAMUS

This small area of the forebrain lies under the thalamus and above the pituitary gland. Cerebrum

Hypothalamus

the eyes, and increased blood flow to muscles (known as the "fight or flight" response). Other groups of nerve cells in the hypothalamus are concerned with the controlofbodytemperature. Some are sensitive to heat and cold so that, when blood flowing to the brain is hotter or cooler than normal, the hypothalamus switches on temperature-regulating mechanisms (among them sweating or shivering). The hypothalamus receives information from internal sense organs regarding the level of glucose in the blood and the body's water content; if they are too low, it stimulates appetite for food and drink. The hypothalamus is also involved in regulating sleep, in motivating sexual behavior, and in determining mood and the experience of emotions. Another role of the hypothalmus is coordination of the function of the nervous and endocrine (hormonal) systems of the entire body. The hypothalamus connects with the pituitary gland through a short stalk of nerve fibers and controls hormonal secretions from this gland. It does this in two ways-through direct nerve connections and through specialized nerve cells, which secrete hormones called releasing factors into the blood to flow directly to the pituitary. In this way, the hypothalamus can convert nerve signals into hormonal signals. Thus, the hypothalamus indirectly controls many of the endocrine organs, including the pituitary, thyroid, adrenal cortex, and gonads. DISORDERS

Disorders of the hypothalamus are usually caused by a brain hemorrhage within the hypothalamic region (see lntracere/Jral hemorrhage) or by an expanding pituitary tumor. Loss of hypothalamic function can have diverse effects, ranging from hormonal disorders (see Endocrine S1/Stem) to disturbed temperature regulation, and increased or decreased appetite for food, sex, and sleep. FUNCTION

Hypothermia

The hypothalamus exerts overall control over the sympathetic nervous system (part of the auto11omic 11en 1011s system, which controls the internal body organs). When we are suddenly alarmed or excited, signals are sent from higher regions of the brain to the hypothalamus, which initiates sympathetic nervous system activity. This causes a faster heart beat, increased breathing, widening of the pupils of

A fall in body temperature to below 95°F (35°C). It causes drowsiness, lowers breathing and heart rates, and may lead to unconsciousness or death. Most victims are elderly people who are unable to keep sufficiently warm in winter. The term hypothermia is also used to describe the deliberate lowering of body temperature during some forms of surgery (see Hypothermia, surgical).

562

CAUSES

Hypothermia can be caused by pro1onged exposure to extremely cold weather, swimming in the sea, or wearing damp clothing in cold conditions. However, most cases occur in elderly people living in poorly heated homes. As the body ages, it gradually loses its sensitivity to cold; an elderly person's body temperature may drop without the individual being aware of it. In addition, the aging body also becomes increasingly less able to reverse a fall in temperature. This reduced ability is also present in the very young; aside from the elderly, babies are the most common victims of hypothermia. The risk of hypothermia is increased if an elderly person is also suffering from a disorder that reduces the body's heat production (such as hypothyroidism), impairs mental function (such as senile dementia), or reduces mobility (such as arthritis). Certain drugs may also contribute to the onset of hypothermia. For example, tranquilizers (such as chlorpromazine) may lower the level of consciousness and reduce the ability to shiver (shivering has a protective function against cold). SIGNS

A person suffering from hypothermia is usually pale, puffy-faced, and listless. The heart rate is slow and the victim is often drowsy and confused . Areas of the body that are normally warm (such as the armpits and the groin) are cold. In severe hypothermia, breathing becomes slow and shallow, the muscles are often stiff, the victim may become unconscious, and the heart may beat only faintly and irregularly or-especially if the body temperature falls below 90°F (32.2°C}-it may stop beating altogether. DIAGNOSIS

The condition is usually obvious from the above signs and the victim's circumstances. To determine how cold the body has become, the physician takes a rectal temperature with a special low-reading thermometer. Alternatively, the temperature of the urine may be measured. TREATMENT

Hypothermia is a medical emergency and anyone suspected of suffering from it requires immediate medical attention. Mild hypothermia usually responds to giving the victim warm drinks and covering the head (from which as much as 20 percent of the body's heat loss takes place).

HYPOTHYROIDISM

FIRST AID: HYPOTHERMIA

,---------------. I I I I I I I

DO NOT

■ let the victim walk ■ warm the victim by rubbing his

or her skin ■ give the victim any alcohol ■ warm the victim by applying direct heat

I I I I I

.

IN ADULTS

1

Seek medical help . If th e victim is unconscious and breathing , place in the re covery position II not breathing, beg in artificial resp iration .

, ______________ 2

Move the victim to a warm pl ace. Take off wet clothing and rep lace with dry, or dry off and cover w ith waterproof material

IN BABIES

Medical help should be sought immediately. Hypothermia is often difficult to detect. The baby may look pink and healthy, but he or she may be unusually limp and drowsy. Rewarm the baby by keeping him or her well wrapped .

3

If the victim is consc ious, give a warm (not hot) drink Hold the mug if necessary.

4

If the victim is otherwise healthy, place in a warm (not hot) bath.

geons to perform quick (eight to 10 minutes) operations on the heart while blood circulation throughout the body was completely stopped. Today, open heart surgery is usually performed with the general blood circulation maintained by means of a '1eart-/u11g machine. Nevertheless, mild hypothermia- with the body temperature reduced from 98.6°F (37°C) to about 82 to 88°F (28 to 31°C}--is still generally induced as a safety measure. It can allow heart operations to proceed for several hours. A heat exchanger, installed into the machine circuit, can be used to cool the blood before return to the body, thus inducing hypothermia. The blood supply to the heart muscle itself is interrupted during open heart surgery, so the heart also must be vigorously cooled by continuously instilling cold saline into the open chest cavity at a temperature of about 40°F (4°C). By this method, damage to the heart muscle from lack of oxygen is minimal, even after an operation lasting several hours. At the end of the operation, rewarming of the patient is carefully synchronized with restarting the heart and the switch back from use of the heart-lung machine.

Hypothyroidism When the condition is more severe, treatment varies according to the age of the victim. A young person is usually warmed in a hot bath. However, this causes a rush of blood to the surface of the body, reducing the supply to the heart and brain, which could be fatal to an elderly person. For this reason, warming is carried out gradually in the elderly (at a rate of about l °F (0.6°C per hour) by placing the person in a room with a temperature of 78°F (25°C) and covering him or her with layers of heat-reflecting material known as space blankets. Rectal temperature is monitored every half hour until the temperature and vital signs show improvement. When hypothermia is severe enough to be life-threatening, the victim is admitted to an intensive-care unit and warmed rapidly by safe means; part of the circulating blood is bypassed outside the body, where it is warmed, or warm fluid is run into the abdominal cavity. PREVENTION

It is recommended that an elderly person's living quarters be heated at a

temperature of at least 65°F (l8°C). Relatives or neighbors of elderly people living by themselves should check regularly throughout winter that these people have additional means of keeping warm, including suitable clothing, warm blankets, and nutritious food. Elderly people should also be made aware of the need to eat hot food and drink warm fluids several times a day and wear a warm hat at all times. People walking or climbing in cold weather should carry survival bags, lined with space blankets, which they can crawl into while waiting for help in the event of an accident.

Underactivity of the tliyroid gland and, therefore, underproduction of thyroid hormones. CAUSES AND INCIDENCE

Hypothermia, surgical

Most cases of hypothyroidism are caused by the body developing antibodies against its own thyroid gland (an example of an autoimmune disorder) with a resultant reduction in thyroid hormone production. Hasliimoto's tlzyroiditis is an example of this phenomenon . More rarely, hypothyroidism may result from surgery to remove part of the thyroid gland as a treatment for hyperthyroidism (overactivity of the thyroid). Hypothyroidism affects about 1 percent of the adult population. It is most common in elderly women, though it occurs at all ages and in both sexes.

The deliberate reduction of body temperature to prolong the period for which the vital organs can safely be deprived (partially or totally) of their normal blood supply during open heart surgery. Cold reduces the rate of metabolism in cells and tissues; hence, lack of oxygen is better tolerated as the temperature is lowered. In the early days of heart surgery, induced hypothermia allowed sur-

Thyroid hormones stimulate energy production, so a deficiency of them causes generalized tiredness and lethargy. There may also be muscle weakness, cramps, a slow heart rate, dry and flaky skin, hair loss, and a deep and husky voice . In addition, the skin and other body tissues may thicken and there may be weight gain-a syndrome known as myx-

SYMPTOMS AND SIGNS

563

H t

HYPOTONIA

edema. In some cases, a goiter (enlargement of the thyroid gland) develops, although not all goiters are due to hypothyroidism. The severity of the symptoms depends on the degree of thyroid deficiency. Mild deficiency may cause no symptoms; severe deficiency may produce all of the above symptoms. If hypothyroidism occurs in childhood and remains untreated, it may retard growth, delay sexual maturation, and inhibit normal development of the brain. DIAGNOSIS AND TREATMENT

H

The disorder is diagnosed by tests to measure the level of thyroid hormones in the blood. Treatment consists of replacement therapy with the thyroid hormone thyroxine; in most cases, hormone therapy must be continued for life. Such treatment may not cure a goiter, which may require surgery.

Hypotonia Abnormal muscle slackness. Normally, a muscle that is not being used has a certain built-in tension. In a number of disorders affecting the ner-

vous system (such as Huntington's chorea) this natural tension or tone is moderately or markedly reduced.

Hypotonia in infants Excessive limpness in infants, also called floppy infant syndrome. FEATURES

Hypotonic babies cannot hold their limbs up against gravity and thus tend to lie flat with their arms and legs splayed. Their limbs and joints seem slack when moved by someone else. Floppy babies move around less than normal babies and their mothers may report that they did not feel the baby move much during pregnancy. When held horizontally by the trunk, face downward, they hang limply. CAUSES

Premature infants are naturally more floppy than full-term infants, but, as they mature, their muscles attain the normal tension. Hypotonia is often a feature of chromosomal disorders, such as Down's S1/ndrome. Illnesses that affect general ·health (e.g., malnutrition, congenital heart disease, and hypothyroidism) may also cause hypotonia.

More specifically, disorders of the brain (particularly cerebral palsy) and of the spinal cord (such as WcrdnigHoffmann disease) are characterized by hypotonia. Treatment depends on the cause.

Hypovolemia An abnormally low volume of blood circulating in the body. It usually follows severe blood loss, which may occur as a result of injury, internal bleeding, or surgery. Hypovolemia also occurs in various other conditions, such as serious burns, severe dehydration, or, rarely, adrenal crisis (see Addison's disease). Hypovolemia is a dangerous condition because, untreated, it can lead to shock, which is potentially fatal.

Hypoxia An inadequate supply of oxygen to the tissues. CAUSES

Temporary hypoxia may occur as a result of strenuous exercise in which the normal supply of oxygen cannot meet the additional requirements of the tissues. In such cases, the condi-

PERFORMING A HYSTERECTOMY Hysterectomy may be performed through the abdomen or the vagina. For an abdominal hysterectomy, the incision is made in the lower abdomen (see below). In vaginal hysterectomy , the uterus is removed through an incision at the top of the vagina . Site of incision for abdominal hysterectomy The incision is made in the lower abdomen (in this case horizontally) level with the top of the pubic hair.

Abdominal hysterectomy The uterine vessels are clamped . Traction is placed on the top of the uterus and lhe vessels are tied and then divided . In some cases, the fallopian tubes are cut and the tubes and ovaries left in place.

POSTOPERATIVE PROBLEMS Fallopian tube

. __ __ r - - S1teof ,_

incIs1on

hil jJ} .- -~Vagina 564

Many women worry that the ir sex lives will be affected by hysterectomy. Physically , there should be no noticeable change in the woman 's sex life . Counseling before the proced ure can help dispel any misconceptions or fears. Depression is not uncommon in women who are inadequately counseled .

Vaginal hysterectomy After a vaginal incision is made. the uterus and cervix are removed (the ovaries cannot be removed in a vaginal hysterec tomy). The upper end of the vagina is repaired by stitching.

HYSTEROTOMY

tion disappears once exercise has stopped and breathing has reoxygenated the tissues. More serious causes include impaired breathing (see Respiratory faifure), usually as a result of a lung disorder; ischemia (reduced blood flow to a tissue), which may be due to an artery disorder or a heart disorder; and severe anemia, in which the oxygen-carrying capacity of the blood is reduced. Another, rare, cause is carbon monoxide poisoning, which prevents the blood from being adequately oxygenated. In severe cases, any of these more serious causes may lead to anoxia (complete absence of oxygen in a tissue), which, if prolonged, may cause tissue death. SYMPTOMS AND SIGNS

Hypoxia in muscles forces the muscle ce!Is to produce energy by anaerobic metabolism, which produces lactic acid as a by-product. The accumulation of lactic acid causes cramps. Hypoxia in heart muscle may cause the chest pain of angina pectoris. Hypoxia of the brain initially causes confusion, dizziness, and incoordination, progressing to unconsciousness and deatft if the condition persists. TREATMENT

Severe, potentially life-threatening hypoxia may require treatment by oxygen therapy or artificial ventilation. Otherwise, the treatment depends on the underlying cause.

Hysterectomy Removal of the uterus. Hysterectomy is one of the most frequently performed operations in the US. WHY IT IS DONE

Hysterectomy is most often performed to treat fibroids (benign tumors of the uterus) that are causing symptoms. It is also performed to treat cancer of the uterus or cervix (see

Uterus, cancer of; Cervix, cancer of). Occasionally, a hysterectomy is performed to relieve menorrhagia (heavy menstrual bleeding) or endometriosis (a condition in which fragments of the uterine lining occur elsewhere in the pelvis) that has not responded to a D and C or hormone treatment. A hysterectomy may also be performed to remove a severely prolapsed uterus (see Uterus, prolapse of). TYPES

The most common type of hysterectomy is a simple hysterectomy, in which the uterus and cervix only are removed. In a total hysterectomy, the fallopian tubes and ovaries are removed as well. If cancer is

advanced, a radical hysterectomy (in which the pelvic lymph nodes are also removed) 1s necessary. RECOVERY PERIOD

After the operation a drainage tube may be inserted at the site of the incision. For a few days there may be some vaginal bleeding and discharge and considerable tenderness and pain. The stay in the hospital depends on the age and health of the woman and whether there are postoperative problems. Full recovery requires another three to six weeks; sexual intercourse can be resumed about a month after the surgery.

WHY IT IS DONE

The examination is performed as part of the investigation of infertility. Dye injected during laparoscopy indicates whether the tubes are blocked, but hysterosalpingography is needed to determine the site of the blockage, which is most often due to scar tissue caused by a previous infection. Hysterosalpingography also outlines any distortion in the uterus, such as a congenital abnormality or a fibroid .

OUTLOOK

After hysterectomy the woman is unable to bear children; she does not menstruate and needs no contraception. If the ovaries have also been removed from a woman before or around the menopause, hormone replacement therapy should be considered.

H

Hysteria A term encompassing a wide range of physical or mental symptoms that are attributed to mental stress in someone who is not psychotic. Derived from the Greek word for uterus, hysteria was originally thought to be a physical disorder confined to women. By the nineteenth century, hysteria was believed to have a psychological origin and was used to describe many seemingly bizarre states (including hallucination, sleepwalking, and trances). Today, many psychiatrists feel that the term hysteria is no longer helpful in diagnosis. In modern classifications, therefore, the symptoms formerly grouped under this term are now included in the more specific diagnostic categories of converswn dis-

order; dissociative disorders; somatization disorder; and factitious disorders. Physicians still sometimes use the term loosely to describe any difficult, unusual, or exotic behavior that does not seem consistent with the symptoms or situation of the patient. Mass hysteria describes the spread of psychologically produced symptoms (such as fainting) from person to person. It usually occurs in schools or institutions of young women in response to group tensions or worries and is often triggered by a person with a charismatic personality.

Hysterosalpingography An X-ray procedure performed to examine the inside of the uterus and fallopian tubes.

A normal hysterosalpingogram The X-ray image shows rad iopaque dye filli ng the uterus and passing through the fa llopian tubes into the pelvic cavity. HOW IT IS DONE

The test is an outpatient procedure performed by a radiologist and/or a gynecologist. Because the procedure may be uncomfortable (often producing a cramplike pain), the patient is usually mildly sedated. A plastic or metal cannula is inserted into the cervix (neck of the uterus), a radiopaque dye (one that shows up on X-ray film) is passed through it into the uterus and the fallopian tubes, and X-ray pictures are taken to reveal any abnormalities. The procedure takes 10 to 30 minutes. RISKS

In a woman who has just become pregnant, the dye may wash the fertilized egg out of the fallopian tube; if this does not happen, the embryo may be damaged by radiation from the X rays. To avoid these risks, the test is carried out only in the second half of the menstrual cycle, when it is certain the woman is not pregnant.

Hysterotomy A method of late abortion in which the abdomen and uterus are surgically opened to remove the fetus. Hysterotomy is the most complicated method of abortion and carries the highest risk. It is rarely used today; instead, prostaglandin drugs are used to terminate pregnancy by inducing labor. 565

Id

Damaged tissue

i---~

Inflamed !issue

- ---=-=>I'--,-

Enlarged blood vessels

Idiocy

Ice pack application

~ - - Ice pack Reduced inf/am ma lion

Iatrogenic Meaning literally "physician produced," the term iatrogenic can be applied to any medical condition, disease, or other adverse occurrence that results from medical treatment. The development of an iatrogenic condition does not necessarily imply a lack of care or knowledge on the part of the physician. Effective forms of treatment are seldom, if ever, entirely free of possible unwanted effects. The drowsiness produced by some groups of antiallergy drugs is one example.

~:-c:8:::;;::::::::=----,.;\-

Reduced bleeding Blood vessels

c;:::::==::;:.:---='"'"'!'---+-- conslricled L..:.-:..Lc..:._.:::....\!~~--"-'-'=-=:tr---

Nerve numbed

Use of an ice pack Applying an ice pack to an area of damaged tissue helps relieve pain. reduce inflammation and further tissue damage, and minimize bleeding and swelling . HOW IT IS DONE

Ibuprofen A 11onsteroidal a11ti-i11flammatory drug

(NSAID) used as an analgesic (painkiller) in the treatment of headache, menstrual pain, and painful injury to soft tissues (such as muscles and ligaments). The anti-inflammatory effect of ibuprofen helps reduce joint pain and stiffness occurring in some types of arthritis, such as r/1eumatoid arthritis and osteoarthritis. Ibuprofen may cause abdominal pain, diarrhea , nausea, heartburn, and, rarely, dizziness. It may also cause a peptic ulcer, but is less likely to do so than some other NSAIDs.

Ice packs Means of applying ice (in a towel or other material) to the skin to relieve pain, stem bleeding, or rL'duce inflammation. Cold causes the blood vessels to contract, reducing blood flow. WHY IT IS DONE

Ice treatment is used to relieve pain in a variety of disorders, including severe headache, hemorrhoids, and pain in the throat after a to11sillccto111y. Another common tu;e is after sports injuries to minimize swelling, bruising, and further tissue damage. In sports injuries, ice is usually combined with the application of a pressure bandage and the raising of the injured part. Ice may also be used to stop bleeding from small vessels, as in a nosebleed.

566

One of the three parts of the personality (with the ego and superego) described by Sigmund Freud. The id is the primitive, unconscious store of energy from which come the instincts for food, love, sex, and other basic needs. The id seeks simply to gain pleasure and to avoid pain. (See also Psychoanalytic theory.)

Ice is wrapped in a wet cloth (to prevent it from burning the skin) and applied to the skin's surface. Chemical packs are also available; striking or shaking the pack mixes the chemicals within, producing a liquid with a very low temperature.

lchthyosis A rare, inherited condition in which the skin is dry, thickened, scaly, and darker than normal due to an abnormality in the production of kerati,1 (a protein that is the main component of skin). The name ichthyosis is taken from the Greek word "ichthus" (meaning fish); the condition is commonly called fish skin disease. Ichthyosis usually appears at or shortly after birth and generally improves during childhood. The areas most commonly affected are the thighs, arms, and backs of the hands. There is no special treatment, although lubricants and emulsifying ointments help the dryness and bath oils moisten the skin . Washing with soa p makes ichthyosis worse and should be avoided. The condition improves in a warm, humid atmosphere. lchthyosis is at its worst in cold weather (when the sufferer should wear additional layers of protective, warm clothing).

lcterus Another term for ja1111dice.

An outdated term for severe me11tal retardation. Idiots were defined as ha ving an IQ of under 35.

Idiopathic Of unknown cause. For example, epilepsy in which no specific cause can be found is referred to as idiopathic epilepsy. The word idiopathic comes from the Greek "idio-" meaning "one's own" and "pathos" meaning disease.

ldoxuridine An a11tiviral drug. Idoxuridine is used to treat herpes simplex infections affecting the eyelids or cornea of the eye . It is occasionally given to prevent a recurrence of herpes simplex infection in people receiving corticosteroid drug treatment for a different eye disorder. ldoxuridine may cause irritation of the eye and, in rare cases, photophobia (abnormal sensitivity to light), swollen eyelids, or blurred vision.

lleostomy An operation in which the ileum (lower part of the small intestine) is brought through an incision in the abdominal wall and formed into an artificial outlet for the bowel to allow the discharge of feces into a bag attached to the skin. An ileostorny is usually permanent. WHY IT IS DONE

Permanent ileostomy is usually performed for people with ulcerative colitis or Cro/m 's disease whose health, despite drug treatment, continues to deteriorate because of chronic inflammation of the colon. For these people, the only means of restoring health is to perform a colectomy (an operat ion to remove the colon and rectum) followed by an ileostomy. Temporary ileostomy is sometimes required at the time of partial colectomy (removal of part of the colon) to allow the repair of the colon to heal before waste material passes through it. Temporary ileostomy may also be carried out as an emergency measure in a person who is very ill due to an

ILEOSTOMY

PROCEDURE FOR ILEOSTOMY Two incisions are made in the abdominal wall (usually on the right side)-a small circular cut for the stoma (most often located about 2 inches below the waist and away from the hipbone and groin crease) and a vertical cut to give access to the intestine and mesentery

-

of Clamp

Skin edge

Sites of incisions

Mesentery

Sutures

- --+-- Colon (removed) Ileum

'

L_

- - + - -- ------
. microorganism

IMMUNOGLOBULINS

that has spread. Any person who is taking corticosteroid drugs or who has previously had a severe reaction to the same vaccine should not be vaccinated. Some vaccines, such as those for typhoid and yellow fever, should not be given to very young children. Vaccination should be deferred if the person has a fever or infection . A number of vaccines, particularly the rubella vaccine, shoufd not be given during pregnancy due to the risk of affecting the fetus.

Immunoassay A group of laboratory techniques that indudes ELISA (enzyme-linked immunosorbent assay) and radioimmunoassay. Both are used in the diagnosis of infectious diseases; variants of radioimmunoassay, such as the radioallergosorbent test (RAST) and the radioimmunosorbent test (RIST), are also used in the diagnosis of allergies and in the meas~rement of blood hormone concentrations. Either technique can determine the presence or absence in a person's blood of a specific protein-such as an antigen (a protein on the surface of a microorganism or an allergen), a specific antibody (a protein formed by the body's immune system to protect against a particular type of microorganism or allergen), or other protein, such as a hormone. The principle underlying these techniques is that, for any specific antibody, there is a specific antigen. If molecules of these two proteins come in close contact, they will bind strongly to each other. Any specific antibody will bind only to its own antigen, and vice versa. HOW IT IS DONE

First, the surface of a plate or the inside of a test tube is prepared with a covering of the specific protein (antigen or antibody) that will bind to the antibody or antigen whose presence in the blood is to be tested. For example, in the ELISA test for antibody to HIV (the virus responsible for AIDS), the inside of a test tube is lined with small amounts of antigen from HIV. This surface is then exposed to plasma of the blood; if the antibody (or antigen) under test is present, it will stick strongly to the surface. The surface is then washed and a chemical added that will bind to the bound protein. This chemical is itself linked either to an enzyme called peroxidase (in the ELISA test) or to a radioactive isotope (in radioimmunoassay).

Any excess chemical is washed away, and, if the antibody or antigen was present, either peroxidase or radioactivity is left on the surface. Peroxidase can be detected by adding another chemical that changes color in its presence; radioactivity can be measured by a gamma counter. The RIST differs from other types of radioimmunoassay in that the blood serum containing the substance being tested is first mixed with a solution containing the same substance, which has been radioactively labeled. The radioactive and the test versions compete to bind to the test plate. The result is that, after washing, the less radioactivity found on the test plate, the more test substance must have been present in the blood serum.

Immunodeficiency disorders Disorders in which there is a failure of the immune system's defenses to fight infection and tumors. Immunodeficiency may be the result of an inherited or congenital defect that interferes with the normal development of the immune system or the result of acquired disease that damages the system's function. The result, in either case, is the appearance of persistent or recurrent infection by organisms that would not ordinarily cause disease, incomplete recovery from illness with poor response to customarily effective treatment, and an undue susceptibility to certain forms of cancer. The infections seen in people with immunodeficiency disorders sometimes are called opportunistic infections because the microorganisms take advantage of the person's lowered defenses. Infections of this type include pneumonia caused by PNEUMOCYSTIS CARINII, widespread herpes simplex infections, and many

fungal infections. INHERITED IMMUNODEFICIENCY

The adaptive part of the immune system (which mounts specific defenses against particular microorganisms or tumor cells) has two major prongs. One of these, the humoral system, relies on the production of antibodies, or immunoglobulins, manufactured by B-lymplwcytes. The other prong is called the cellular system and relies on the activity of I-lymphocytes. Congenital or inherited deficiencies can occur in either of these systems. Deficiencies of the humoral system include hypogammaglobulinemia (in which the production of one or more types of immunoglobulin is interfered

with) and agammaglobulinemia (in which there is an almost complete absence of B-lymphocytes and immunoglobulins). The most common type of hypogammaglobulinemia affects about one person in 600 and may cause no more than repeated mild attacks of respiratory infection. Agammaglobulinemia is a rare, grave condition that often has a fatal outcome in infancy or childhood. Congenital deficiencies of the I-lymphocytes may lead to problems such as persistent and widespread candidiasis (thrush) affecting the skin, mouth, throat, and vagina. Problems of this type are caused by the inability of the immune system to fight fungi . A combined deficiency of both prongs of the immune system is also known. It is called severe combined immunodeficiency. Infants with this combined deficiency usually die within the first year of life. ACQUIRED IMMUNODEFICIENCY

Acquired deficiency of the immune system may occur in either of two ways---by damage to the immune system as a result of its suppression with drugs or by disease processes. Deliberate suppression of the immune system with immunosuppressant drugs and corticosteroid drugs is usually carried out as _part of the treatment of autoimmune disorders and after transplantation to minimize the risk of organ rejection. Diseases that cause immunodeficiency include infection with HIV (human immunodeficiency virus), which leads to AIDS (acquired immunodeficiency syndrome). Severe malnutrition, especially with protein deficiency, and many types of cancer can also cause immunodeficiency. IMMUNODEFICIENCY IN THE ELDERLY

A degree of immunodeficiency arises simply as a consequence of age. The thymus, which pfays an important part in the production of I-lymphocytes, reaches peak size in puberty and steadily shrinks thereafter. This results in a decline in the number and activity of I-lymphocytes with age; there is also a decline in the numbers of B-lymphocytes.

lmmunoglobulins Proteins found in the blood serum and in tissue fluids, also known as antibodies. Immunoglobulins are produced by cells of the immune system called B-lymphocytes. Their function is to bind to substances in the body that are recognized as foreign antigens (often proteins on the surface of bac-

575

IMMUNOLOGIST

teria and viruses). This binding is a crucial event in the destruction of the microorganisms that bear the antigens. Immunoglobulins also play a central role in allergies and hyperse11sitivity reactions. In this case they bind to antigens that are not necessarily a threat to health, which may provoke an inflammatory reaction. There are five classes of immunoglobulins; of these, immunoglobulin G (lgG) is the major immunoglobulin in human blood serum. The IgG molecule consists of two parts, one of which binds to antigen; the other binds to other cells of the immune system. These other cells are principally white cells called phagocytes, which then engulf the microorganisms bearing the antigen. The antigen-binding site of the IgG molecule is variable in its structure, the different versions of the molecule being capable of binding to an almost infinite number of antigens. lmmunoglobulins can be extracted from blood of recovering patients and used for passive immu111zatio11 against certain infectious diseases .

Immunologist A specialist in the functioning of the immu11e system who may also devise ways in which the immune system can be stimulated to provide immunity (principally through the use of vaccines) and who investigates and treats problems related to the immune system. The latter include allergies, autoimmu11e disorders, and im1m1110deficiency disorders such as AIDS. Immunologists also play an important part in tra11spla11t surgery, looking preoperatively for a good immunological match between recipient and donor organ, and suppressing the recipient's immune system after transplantation to minimize the chances of organ rejection.

Immunology The study of the functioning and disorders of the i111111u11e system.

lmmunostimulant drugs A group of drugs that increases the efficiency of the body's i1111111111e system (natural defenses against infection and abnormal cells). Immunostimulant drugs include vacci11cs, which protect against specific infectious diseases (see l1111111111izatio11) . Two drugs belonging to this group are interferon (used to treat viral infections and certain types of cancer) and zidov11di11e (used to treat AIDS).

576

Some immunostimulant drugs enhance the ability of a vaccine to stimulate the immune system and are added to the vaccine for this reason. Aluminum phosphate, for example, increases the effectiveness of the teta1111s vaccine.

lmmunosuppressant drugs COMMON DRUGS

Anticancer drugs Azathioprine Chlorambucil Cyclophosphamide Methotrexare Corticosteroid drugs Dexamethasone Prednisone Others Cyclosp onne

A group of drugs that reduces the activity of the body's i1111111111e system (natural defenses against infection and abnormal cells). Immunosuppressant drugs are prescribed after transplant surgery to prevent the rejection of foreign tissues. They are also given to halt the progress of autoi111111u11e disorders (in which the body's immune system attacks its own tissues) when other treatments are ineffective. They are unable, however, to restore tissue that has already been damaged. HOW THEY WORK

Immunosuppressant drugs work by suppressing the production and activity of lymphocytes, a type of white blood cell that plays an important part in fighting infection and in eliminating abnormal cells that may form a malignant tumor. POSSIBLE ADVERSE EFFECTS

Apart from the individual effects of each type, these drugs increase the risk of infection and of the development of certain cancers.

lmmunotherapy A preventive treatment of allergy to substances such as grass poflens, house-dust mites, and wasp and bee venom. Immunotherapy involves giving gradually increasing doses oi the substance, or allergen, to which the person is allergic. This works by making the i1111111111e system less sensitive to that substance, probably by causing production of a particular "blocking" a11ti/,ody, which reduces the symptoms of allergy when the substance is encountered in the future. Before starting treatment, the physician and patient try to identify trigger factors for allergic symptoms. Skin or sometimes blood tests are per-

formed to confirm the specific allergens to which the person has antibodies. Immunotherapy is usually recommended only if the person seems to be selectively sensitive to several allergens (such as grass). HOW IT IS DONE

A purified extract of a small amount of the allergen is injected into the skin of the arm. An injection is given once a week for about 30 weeks, after which injections can be administered every two weeks. Eventually, injections can be given every four weeks; the duration of therapy is three to four years. RISKS

There is a danger of a11aphylnctic shock (a severe allergic reaction) shortly after an injection . Therefore, immunotherapy requires medical supervision and is not cfone at times of exposure to the substance ca using the a!Iergy. IMMUNOTHERAPY IN CANCER TREATMEMT

Another use of the term immunotherapy refers to stimulation of the immune system to treat cancer. It is still largely experimental, but it may prove a useful adjunct to other therapies, such as chemotherapy, in the treatment of leukemia, ly111p/10111a, and some other cancers. One type of immunotherapy relies on the use of immunostimulants, substances that cause general stimulation of the immune system. Another technique is to inoculate the patient with tumor cells or cellular extracts, rendered harmless by irradiation, that have been taken from another person suffering from the same disease. The patient's immune system then produces its own a11tibodies, which attack the tumor cells. Alternatively, immunoglobulins (ready-made antibodies) from another person with the same type of. tumor can be given to the patient. More recently, monoclonal antibodies (see Antibodies, 111011oc/onnl) to be directed against tumors have been produced artificially by genetic e11gi11cermg. fllterferon or chemical poisons can be linked to these antibodies to increase their ability to destroy tumor cells. One drawback to the administration of some of these anticancer treatments is that they, too, may be recognized as foreign by the person's immune system, causing either allergic reactions (serum sickness) or new antibody production, which inte rferes with the activity against cancer.

Impaction, dental Failure of a tooth to emerge fully or at all from the gum when, because of



IMPETIGO

Impacted wisdom teeth This X ray shows impacted wisdom teeth lying horizontally in the lower jaw The impacted teeth are wedged against the adjacent molars and are not able to erupt normally.

mechanical impediment, it is embedded in bone or soft tissue beyond its normal eruption time. Impaction is caused by overcrowding of the teeth in places where little room is left for the teeth that erupt last (the wisdom teeth and the upper canines). It is also caused by the tooth traveling in the wrong direction and by dense bone that impedes the tooth's progress.

IMPACTED WISDOM TEETH

CAUSES AND INCIDENCE

These are common, but usually cause no trouble unless they partially penetrate the gum, leaving a flap of tissue over most of the crown. Plaque bacteria and food debris then collect between the tooth and the gum, which often becomes inflamed and painful. There may also be swollen lymph nodes in the upper neck and difficulty opening the mouth . Rinsing the area with warm , salt water and taking n11nlgesics (painkillers) can relieve some symptoms of the condition, but, if it is severe, nntil1iotic drugs are required to clear up the infection. A dentist may decide that the tooth requires extraction to prevent more trouble.

Impetigo is caused by bacteria entering the skin through a broken area, such as a cut, cold sore, or an area affected by eczema. The infection is more common in warm weather. Impetigo was once extremely common, but occurs less frequently now because of improved standards of personal hygiene. Small epidemics occasionally occur in schools.

IMPACTED UPPER CANINES

These teeth play a much more important part than do wisdom teeth in biting and chewing. If they are impacted, they are nut usually removed, but instead are trained into the correct position by means of an orthodontic applim1ce.

SYMPTOMS AND SIGNS

The skin reddens and small, fluidfilled blisters appear on the surface. The blisters tend to burst, leaving moist, weeping areas underneath; the released fluid dries to leave honey-colored crusts on the skin. The infected area may spread at the edges or another patch may develop nearby. In severe cases there may be swelling of the lymph nodes in the face or neck, accompanied by a fever. Very occasionally, complications such as septicemia (blood poisoning) or '?lomerulonephritis (inflammation of the kidneys) develop. TREATMENT

Impetigo A highly contagious skin infection, common in children, that usually occurs around the nose and mouth.

TYPES OF IMPLANTS Implants may be inserted into various parts of the body. They can be used to replace a diseased structure, to improve appearance , to maintain proper functioning of an internal organ , to treat certain disorders, or to deliver drugs or hormones.

_ _ _ __ _ Eye An implant can be used to replace the lens of the eye after cataract removal, or the entire eyeball if it requires removal because of injury or disease.

'---+--+------ Face Pieces of bone taken from another part of the body, or shaped pieces of silicone, can be implanted on the face to make a receding chin more prominent or to improve the contour at a fracture site

Hormonal _ __ _ _ __ _ _ _ _ _ _, Some hormonal drugs (particularly hormonal contraceptives) can be placed in implants that are inserted under the skin to release the drug slowly over time Alternatively. such drugs can be incorporated in some IUDs (intrauterine contraceptive devices)

Because impetigo spreads rapidly, it is advisable to consult a physician. Antibiotic drugs in tablet or ointment form usually dear up the problem in about

--+- --+~+-- - Heart

Cardiac pacemakers (battery-powered electronic devices connected by wires to the heart muscle) can be implanted in the chest to regulate the heart beat ; diseased heart valves may be replaced w ith artificial or natural substitutes.

Breast _ _ _ _ __ _ _ _ _ _ _ __ Silicone implants can be used to restore breast shape after mastectomy (breast removal) for cancer or to increase breast size for cosmetic purposes (augmentation mammoplasty) .

Therapeutic - - - - - - - - - - - - -t---t-----tf-"' ·

Occupational therapy can help people who

~~:u~5:i~/~da~hritis Sufferers are shown how to cope with everyday tasks. provided with aids for use in the home. and taught principles of joint protection .

The finger joints are the most commonly affected, resulting in a weak grip. Swelling of the wrist and carpal t11111lel sy11dro111e (tingling and pain in the fingers caused by pressure on the median nerve) are also common. Tc110s1111oz,itis (inflamed painful tendon sheaths) may develop in the wrist and the fingers ma y turn white on

Prostheses Many joints, such as the C) hip, can now be re pl aced with sub sti tutes made from hard-wearing metal and plastic materials. Prostheses may be the only satisfactory solution if a joint becomes seriously damaged .

/

..

~ =,

Physical therapy aids in the relief of pain and stiffness and helps sufferers to regain use of affecte d joints and muscles The physici an may recommend removable splints to rel ieve pain in th e hands and wrists .

exposure to cold, a condition known as Ray11awi's phe1w111mo11 . lnvolvement of the feet causes pain in the ankles, arches, and toes . Some of the other joints affected are shown above. In some cases, soft nodules develop beneath the skin over bony surfaces; in others, bursitis occurs, in which the fluid -filled sac around a joint becomes

RH INCOMPATIBILITY

inflamed. When the knee is affected, a fluid-filled swelling known as a Baker's cyst may develop behind it. Many sufferers feel fatigued as a result of the anemia that usually accompanies the disease. Early morning stiffness is common, and sufferers may require help getting out of bed and dressing. DIAGNOSIS

The diagnosis is based on the patient's condition and history, the continuance of symptoms for at least six weeks, X rays of affected joints, and blood tests (including a check for specific antibodies known as rheumatoid factor). If rheumatoid factor is absent from a person who otherwise appears to have rheumatoid arthritis, the condition is known as seronegative rheumatoid arthritis. TREATMENT

Some of the main treatment options are outlined in the box opposite.

Nonsteroidal anti-inflammatory drugs (NSAIDs) may be used to relieve joint pain and stiffness. Antirheumatic drugs, such as gold or penicillamine, may be used to arrest or slow the progress of the disease. lmmunosuppressant drugs, such as corticosteroid drugs or azathioprine, are given to suppress the body's immune system if antirheumatic drugs fail to control the disorder or if they produce severe side effects. Corticosteroid drugs may be injected into the joint to provide local pain relief. Physical therapy and occupational therapy are often important. Destroyed joints can sometimes be replaced with artificial substitutes (see Arthroplasty). Hip and knee replacements are the most common. COMPLICATIONS

In severe cases of rheumatoid arthritis, inflammation may also affect the covering of the heart (causing pericarditis), the small blood vessels (resulting in poor circulation and ulcers on the hands and feet), the lungs (leading to pleural effusion or pulmonary fibrosis), the eyes or mouth (making them dry; see Sjogren's syndrome), the lymph glands (producing tender swellings in the neck, armpit, and groin), and the spleen (causing hypersplenism). OUTLOOK

Most sufferers must take drugs for the rest of their lives, but effective control of symptoms usually allows a nearnormal level of activity. Modem methods of treatment have reduced the incidence and severity of deformity and disability.

Rheumatoid arthritis, juvenile

Rheumatoid spondylitis

A rare form of arthritis (joint inflammation) that affects children and lasts more than three months. Juvenile arthritis occurs more often in girls than in boys, and most commonly starts between the ages of 2 and 4 or around puberty.

See Ankylosing spondylitis.

Rheumatologist A physician who diagnoses and treats arthritis, rheumatism, and other afflictions of the joints, muscles, or connective tissues (see Rheumatology).

TYPES AND SYMPTOMS

There are three main types of juvenile arthritis. Still' s disease (systemic onset juvenile arthritis) starts with an illness characterized by fever, rash, enlarged lymph glands, abdominal pain, and weight loss. These symptoms last several weeks; joint pain, swelling, and stiffness may not begin for several months. A second type, called polyarticular juvenile arthritis, starts with pain, swelling, and stiffness in a numberof joints. In the third type, pauciarticular juvenile arthritis, four or fewer joints are involved. DIAGNOSIS

Diagnosis is based on the symptoms and signs and the exclusion of other disorders that can cause joint symptoms in children, such as viral or bacterial infections, rheumatic fever, Crohn's disease, ulcerative colitis, hemophilia, sickle cell anemia, and leukemia. Blood tests may help identify the cause of the arthritis. COMPLICATIONS

Possible complications include short stature, anemia, pleurisy, pericarditis (inflammation of the outer lining of the heart), and enlargement of the liver and spleen. Uveitis (inflammation of the iris and the surrounding muscles in the eye) may develop and, if untreated, may damage vision. Rarely, amyloidos1s (deposition of a starchy substance in body organs) may occur; if the kidney is involved, renal failure may develop. TREATMENT

Joint pain and stiffness may be relieved by aspirin, nonsteroidaf antiinflammatory drugs, and, in very severe cases, antirheumatic drugs (such as gold, penicillamine, chloroquine, or azathioprine) or corticosteroid drugs. Splints may be worn during the day to rest acutely inflamed joints and at night to reduce the risk of deformities. Physical therapy reduces the risk of muscle wasting and contractures. Excessive physical exercise should be avoided and special shoes worn to reduce the risk of foot deformity. OUTLOOK

In most children the arthritis disappears after several years. However, some are left with permanent stiffness and joint deformity.

Rheumatology

The branch oT medicine concerned with the causes, develorment, diagnosis, and treatment o joint, muscle, and connective tissue diseases. Rheumatologists use a wide variety of investigative techniques, ranging from X rays of joints to tests of muscle function and blood analysis. Treatment is similarly varied; it includes courses of anti-inflammatory drugs or analgesics and rest.

Rh incompatibility A mismatch between the blood of a pregnant woman and that of her baby with respect to the Rh (Rhesus) blood group. In certain circumstances, this mismatch can lead to hemolytic disease

of the newborn. CAUSE

Blood groups are determined by substances called factors on the surface of red blood cells, which differ among individuals. The best known grouping is the A,B,O system. The Rh system (first identified in Rhesus monkeys) was discovered early in this century. It consists of several factors, one of which (D factor) is the most important cause of Rh incompatibility. People can have blood that is Rh positive (carry the D factor in their blood) or Rh negative (do not carry it). Having a positive or negative blood type is determined by genes (i.e., it is an inherited trait). Rh incompatibility can arise only when a woman's blood is Rh negative and her baby's blood is Rh positive. This can happen only if the baby's father's blood is also Rh positive. There are usually no problems during a woman's first pregnancy with a baby whose blood is Rh positive. However, as shown in the diagram (overleaf), the baby may sensitize the woman to Rh-positive blood; if she has a subsequent pregnancy with an Rh-positive baby, there is a risk of hemolytic disease of the newborn. A woman whose blood is Rh negative can also be sensitized if she is mistakenly given a transfusion of Rh-positive blood. INCIDENCE

Among white people in the US, about one person in six has Rh-negative 871

R

RHINITIS

blood; in about one pregnancy in 11 the mother's blood is Rh negative and the baby's blood is Rh positive. In the past, hemolytic disease of the newoorn was a common cause of stillbirth and of a severe fetal condition called erythroblastosis fetalis, in which destruction of fetal blood cells led to severe fetal disease or death. Hemolytic disease of the newborn due to Rh sensitization is becoming rare, primarily due to the development of Rh.,(D) immune globulin. When given by injection to a woman within 72 hours of delivery, it prevents 99 percent of Rh sensitization. In addition, Rh.,(D) immune globulin is given to women after a miscarriage, elective abortion, amniocentesis, or any other procedure that might result in exposure of the mother to the fetal blood cells. Rh (D) immune globulin is also generally given to women with Rh-negative blood who are seven months pregnant. The injection contains antibodies to Rh factor, which destroy any of the baby's blood cells that may have entered the woman before they have a chance to sensitize her. Rh incompatibility is less common in black ancf Oriental families than in white families due to comparative rarity of the Rh-negative blood group in nonwhites. 0

DIAGNOSIS AND TREATMENT

A pregnant woman's blood groups are checked at the first prenatal visit. Women who have Rh-negative blood are tested for the presence of Rh antibodies at this and subsequent visits. The management of the pregnancy and childbirth, if antibodies are

R

present and there is a risk to the baby, is as described under hemolytic disease

of the newborn.

Rhinitis Inflammation of the mucous membrane that lines the nose, usually manifested by some combination of nasal obstruction, nasal discharge, sneezing, and facial pressure or pain. TYPES

A feature of the common cold (see Cold, common), rhinitis due to viral infection may lead to sinusitis. ALLERGIC RHINITIS Also known as hay fever, this type may be seasonal, due to pollens, or year-round, due to house dust, molds, or pets (see Rhinitis, allergic). It most commonly occurs with vasomotor rhinitis. VASOMOTOR RHINITIS This type of rhinitis is an intermittent or continual condition. The nose becomes overresponsive to stimuli, including pollutants such as tobacco smoke, temperature and humidity changes or extremes, certain foods, certain medicines, and/or certain emotions. The condition is common in pregnancy and in those taking the estrogen-progestogen contraceptive pill or other estrogen medication. HYPERTROPHIC RHINITIS Repeated nasal infections can cause hypertrophic rhinitis, in which tissue in the nasal mucosa thickens and veins become chronically congested. This results in constant stuffiness, and sometimes impairment of the sense of smell. In extreme cases, part of the swollen tissue may be removed. ATROPHIC RHINITIS This wasting of the mucous membrane can result from VIRAL RHINITIS

aging, chronic bacterial infections, or extensive nasal surgery. Other features of the disorder can include persistent nasal infection, a discharge that dries to a crust, loss of smell, and an unpleasant odor. Treatment is with antibiotic and estrogen drugs .

Rhinitis, allergic Inflammation ot the mucous membrane that lines the nose due to an allergy to pollen, dust, or other airborne substances. Also known as hay fever, the disorder causes sneezing, a runny nose, and nasal congestion. CAUSES

In some people, inhaling particles of certain harmless substances provokes an exaggerated response by the immune system, which forms antibodies against them (see Allergy). The otherwise harmless substances, known as allergens, trigger the release of histamine and other chemicals that cause inflammation and fluid production in the lining of the nose and sinuses (air cavities around the nose) . The most common of the allergens that cause allergic rhinitis are tree, grass, and weed pollens; molds; animal skin scales, hair, or feathers; house dust; and house-dust mites. Pollen-induced allergic rhinitis is seasonal. Tree pollens are most prevalent in spring, grass pollens in summer, and weed pollens in summer and early fall. Sufferers are worst affected on days when the pollen count is high-that is, during hot and windy weather, especially in heavily vegetated, low-lying areas. People affected by household allergens, such as dust, tend to have less severe symptoms but are affected throughout the year.

HOW Rh INCOMPATIBILITY OCCURS

INCIDENCE

Without preventive treatment, an Rhnegative woman who is exposed to D factor (a substance present only in

Allergic rhinitis is a common complaint, affecting as many as 5 to 10 percent of the population. It is more common in people who have other allergies, such as asthma or eczema; like these disorders, it has a tendency to run in families. The condition usually develops before the age of 30 and affects more women than men.

Rh-positive blood) may develop antibodies that will attack the red blood cells of any future Rh-posit ive babies. Subsequent pregnanc ies

Fi rst pregnancy

. +-

SYMPTOMS AND SIGNS

..

Rh-negative mother Rh-positive baby

872

At birth, baby's blood enters mother's circulation

t

Antibodies against Rh-positive blood formed in mother

Antibodies cross placenta and destroy red blood cells of su bsequent Rh-positive babies

Exposure to the allergen produces an itching sensation in the nose, palate, throat, and eyes. This is followed by sneezing, stuffiness, a runny nose, and, usually, watering eyes. The eyes may also be affected by co11ju11ctiv1tis, which makes them red and sore. PREVENTION AND TREATMENT

Skin tests help identify the allergen responsible for the disorder. Once the

RIB, FRACTURED

allergen is known, exposure should be avoided or kept to a minimum, although this is difficult when the cause is pollens. For mild attacks of allergic rhinitis, occasional use of a decongestant spray or drops may clear up symptoms, but use for more than three or four days can make the condition worse. For many sufferers, treatment is with antihistamine drugs. Antihistamines reduce the symptoms of itching and some degree of nasal congestion and runny nose, but many have the disadvantage of causing drowsiness. Treatment of allergic rhinitis may also include corticosteroid drugs, which can be used in the nose. The drug cromolyn sodium, inhaled regularly throughout the pollen season, may help to prevent attacks by blocking the allergic response. Desensitization to a particular pollen allergen by injecting gradually increasing amounts of it into the skin over a period of years can result in long-term relief of symptoms (see

Immunotherapy).

Rhinophyma Bulbous deformity and redness of the nose occurring almost exclusively in elderly men. Rhinophyma is a complication of severe rosacea (a skin disorder of the nose and cheeks). The tissue of the nose thickens, small blood vessels enlarge, and the sebaceous glands become overactive, making the nose excessively oily. Rhinophyma can be remedied by an operation. With the use of a general anesthetic, the swollen tissue is cut away until the nose is restored to a satisfactory shape. Skin grafting is not necessary, since the remaining tissue rapidly regenerates.

Rhinoplasty

Rhythm method

An operation that alters the structure of the nose to improve its appearance or to correct a deformity caused by injury or disease. Incisions are made within the nose (to avoid visible scars) using either a local or a general anesthetic. The septum (the vertical wall of cartilage and bone that divides the nose) may be altered if breathing passages are blocked. Then the cartifage and bone of the nasal structure are reshaped. Occasionally, a bone or cartilage graft is used. The nose is splinted in position for about 10 days. Rhinoplasty usually causes considerable bruising and swelling, and the results may not be clearly visible for weeks or months. Rare complications include recurrent nosebleeds due to persistent crusting at the incision sites and breathing difficulty due to narrowing of the nasal passages.

See Contraception, periodic abstinence.

Rhinorrhea The discharge of watery mucus from the nose, usually due to rhinitis or to the flow of cerebrospinal fluid from the nose following a head injury. (See

Nasal discharge.)

DISORDERS

The ribs can easily be fractured by a fall or blow (see Rib, fractured). A rib is one of the more common sites for a benign bone tumor or for a metastasis (a secondary malignant tumor that has spread from cancer elsewhere in the body). In rare cases a person is born with one or more extra ribs lying above the uppermost normal rib. Known as cervical ribs, the additional ribs may press on nerves supplying the arm or cause other problems.

Rh isoimmunization The development of antibodies formed against Rh-positive blood in a person who has Rh-negative blood. (See Rh incompatibility; Hemolytic

disease of the newborn.)

Rh 0 (D) immune globulin An antiserum that contains antibodies against Rh (Rhesus) D factor (a substance present on the red blood cells of people who have Rh-positive blood). It is given to a woman who has Rh-negative blood after she has given birth to a baby whose blood is Rh positive or if she has had a miscarriage or elective abortion. Rh (D) immune globulin is also given to a pregnant woman with Rh-negative blood after she has had amniocentesis or bleeding episodes or in other instances in which she might be exposed to fetal blood cells, as well as in the seventh month of pregnancy. The inj·ected antibodies destroy any red ce ls from the fetus that have entered the woman's blood. This is important to prevent or reduce the risk of the woman forming her own antibodies against Rh-positive blood, which might adversely affect any subsequent pregnancies. (See Rh incom0

Example of rhinophyma This disfiguring condit ion is remedied by paring away the excess tissue. The skin soon regenerates after treatment.

Rib Any of the flat, curved bones that form a framework for the chest and a protective cage around the heart, lungs, and other organs. There are 12 pairs of ribs, each joined at the bad< of the rib cage to a vertebra in the spine. Their arrangement is shown in the illustration on the next page. Between the ribs, and attached to them, are thin sheets of muscle that help to expand and relax the chest during breathing. The spaces between the ribs also contain nerves and blood vessels.

patibility; Hemolytic disease of the newborn.)

Rib, fractured Fracture of a rib is usually caused by a fall or blow, but occasionally it is caused by minor stress on the rib cage, such as that produced by prolonged coughing or even laughing. The fracture causes severe pain that is made worse by deep breathing, and tenderness and swelling of the overlying tissue. The diagnosis is confirmed by X rays. Pain is relieved by analgesics (painkillers) or, occasionally, by an injection of a long-acting, local anesthetic drug. Most rib fractures are undisplaced (i .e., the bone ends remain in alignment) and, in these cases, healing is usually spontaneous and straightforward. A displaced or splintered fracture may cause complications if the sharp ends or fragments rupture the spleen or pierce a 1ung, causing lung collapse (see Pneumotfwrax). Multiple rib fractures can result in flail chest. Strapping is rarely used to aid healing because it hinders chest expansion and thus increases the risk of pneumonia. Instead, the patient is encouraged to take deep breaths while holding the injured side. If several ribs are fractured and displaced, an operation may be performed to wire them back in position. 873

RIBOFLAVIN

ANATOMY OF THE RIBS There are seven true ribs attached to the sternum, three fal se ribs, each attached to a rib above , and two floating ribs on each side . They are joined to the spine and sternum so

that, when pulled up by the intercostal muscles (between the ribs) , they expand the chest, drawing air into the lungs. The front ends of the ribs are linked to the sternum by cartilages.

Righ t lung - - - ,

TREATMENT

2

3 4

Fixed ribs

5

5

6

6

7

7 8

9

Floating ribs

Riboflavin The chemical name of vitamin B2 (see

Vitamin B complex).

Rickets A nutritional deficiency disease of childhood that affects the skeleton. Because inadequate amounts of calcium and phosphate are incorporated into an affected child's bones as they grow, the bones become deformed. In adults, a similar process leads to osteomalacia. CAUSES AND INCIDENCE

The most common cause of rickets is deficiency of vitamin D, which is vital for the absorption of calcium from the intestines into the blood and for its incorporation into normal bone. Vitamin D is found in fat-containing animal substances, such as oily fish, butter, egg yolk, liver, and fish liver oils. There are also small amounts in human and animal milk. The vitamin is also made in the body through the action of sunlight on the skin . Rickets occurs primarily in poor countries and in communities where babies receive inadequate vitamin Din the diet and simultaneously do not get enough sunlight. Breast milk alone

874

and, in infants, flattening of the head as a result of the softness of the skull. Infants with rickets often sleep poorly and show delay in crawling and walking. Other features include kyphoscoliosis (spinal curvature), enlargement of the wrists, ankles, and ends of the ribs, pelvic pain, a tendency to fractures, and muscle weakness.

10

cannot provide all a baby's needs for vitamin D, so a breast-fed baby who gets little sun should be given vitamin D supplements. Rickets is now rare in the US and in other developed countries where vitamin D supplements are given to infants, where the vitamin is added to foods such as cow's milk, margarine, and breakfast cereals, and where most children and babies eat a varied diet and get adequate exposure to the sun. The disorder is seen only in vulnerable groups, such as premature babies, strict vegetarians, and some food faddists who avoid the foods rich in vitamin D listed above. Rickets occasionally develops as a complication of an intestinal disorder that causes ma/absorption (failure to absorb nutrients from the intestines). It also occurs in certain rare forms of kidney and liver disease and in children undergoing long-term therapy with antico11vulsa11t drugs (which interfere with the action of vitamin D).

A child with rickets is treated with vitamin D supplements; he or she should also be given plenty of milk to provide calcium. Treatment continues until X rays show healing. The child should not be given excessive vitamin D supplements, however, as they can lead to hypercalcemia. Treatment of other causes of rickets depends on the underlying disorder.

Rickettsia A type of parasitic microorganism. Rickettsi_ae resemble small bactena, but they are able to multiply only by invading the cells of another life form; in this respect they are more like viruses. Rickettsiae are primarily parasites of the arthropods (insects and insectlike animals), such as lice, fleas, ticks, and mites. However, these arthropods can transmit rickettsiae to larger animals (such as rodents, dogs, or humans) via the saliva of biting ticks or through their feces being deposited on the skin, with the rickettsiae passing to the blood via a small skin break. Human diseases caused by different types of rickettsiae include Rocky Mountain spotted fever, Q fever, and the various forms o( typhus.

Rifampin An antibacterial drug used in the treatment of tuberculosis. Rifampin is also used to treat leprosy, endocarditis, and osteomyelitis. It is also used to treat certain asymptomatic people who are meningitis bacteria carriers. The drug is usually prescribed with other antibacterial drugs because some strains of bacteria quickly develop resistance to rifampin alone. Rifampin causes harmless, orangered discoloration of the urine, saliva, and other body secretions. Other side effects include muscle pain, nausea, vomiting, diarrhea, jaundice, flulike symptoms, rash, and itching.

SYMPTOMS AND DIAGNOSIS

The most striking feature of advanced rickets is deformity of the bones, especially of the legs and spine. Typically, there is bowing of the legs

Rigidity Increased tone in one or more muscles, causing them to feel tight; the affected part of the body becomes

ROOT-CANAL TREATMENT

stiff and inflexible. Causes of rigidity include injury to a muscle, artnritis affecting a nearby joint, a neurological disorder, such as Parkinson's disease or stroke, or the tightening of an abdominal muscle overlying an area of inflamed peritoneum (see Peritonitis). See also Spasticity.

Ritodrine causes an increased heart rate if given intravenously. Other side effects include. t_remor, palpitatioi:is, nausea, vom1tmg, chest pam, breathlessness, and nightmares.

River blindness See Onclzocerciasis.

Rigor

RNA

Popularly called a chill, a violent attack of shivering, often associated with a fever. Rigor may also refer to stiffness or rigidity of body tissues, as in rigor mortis.

Ribonucleic acid, one of the two types of chemicals that carry the inherited, coded instructions within a cell for the cell's activities, or that assist in the decoding of these instructions; the other type is deoxyribonucleic acid (DNA). In all animal and plant cells, it is DNA that holds a permanent record of the instructions; RNA helps decode the instructions. In some viruses, the instructions for viral multiplication are held by RNA. (See also Nucleic acids; Protein synthesis.)

Rigor mortis The stiffening of muscles that occurs after death. It starts some three to four hours after death and is usually complete after about 12 hours; however, stiffness gradually disappears over the next 48 to 60 hours. The greater the amount of physical exertion before death, the sooner rigor mortis begins. Similarly, the sooner rigor mortis begins, the sooner it passes. These facts have important medicolegal implications and, along with other factors, are used to assess the time of death.

Ringing in the ears See Tinnitus.

Ringworm A popular name for fungal skin infections (commonly of the feet, groin, scalp, nails, or trunk). Ringworm is marked by ring-shaped, reddened, scaly, or blistery patches. (See Tinea.)

Patch of ringworm The name arises from the tendency for certain skin fungus infections to spread uniformly outward, leaving normal skin inside the ring .

Ritodrine A drug used to prevent or delay premature labor (see Prematurity) by relaxing the muscles of the uterus.

0

Rocky Mountain spotted fever

A rare, infectiC?us di~ease caused by a nckettsia (a microorganism similar to a bacterium) and transmitted from rabbits and other small mammals by the bites of ticks. The disease occurs most commonly on the Atlantic seaboard (it was initially recognized in the Rocky Mountain states). Its incidence has risen steadily since 1980, and there are now more than 1,000 cases of Rocky Mountain spotted fever reported annually. SYMPTOMS AND SIGNS

About a week after the tick bite, mild fever, loss of appetite, and slight headache may develop graduafly. However, sometimes symptoms (e.g., high fever, prostration, aching, tender muscles, severe headache, nausea, and vomiting) come on suddenly and are severe. Two to six days after the onset of symptoms, small pink spots appear on the wrists and ankles. The spots then spread over the body and darken, enlarge, and bleed. The illness usually subsides after about two weeks; in untreated cases marked by extremely high fever, death may occur from pneumonia or heart failure. DIAGNOSIS AND TREATMENT

Diagnosis may be difficult because, initially, Rocky Mountain spotted fever resembles several other infections. Laboratory tests on blood and tissue samples can confirm the diagnosis. Treatment with the antibiotic drugs chloramphenicol or tetracycline usually cures the disease.

PREVENTION

People living in tick-infested areas should use an insect repellent, examine the body daily for the presence of ticks, and gently pull away with forceps any ticks that are found.

Roentgenography See X rays; Radiology.

Role-playing The acting out of a role (the pattern of behavior exrected of an individual in a given socia situation). The conscious adoption of different roles is a useful technique for learning about oneself, other people, or particular situations. The phrase "sick role" describes the type of passive behavior expected and alfowed of a patient; people who have social or emotional problems may unconsciously adopt this role as a means of escaping from social obligations and of gaining the sympathy and understanding of others.

Root-canal treatment A dental procedure performed to save a tooth in which the pulp (the living tissue within a tooth) has died or become untreatably diseased, usually as the result of extensive caries. HOW IT IS DONE

The main steps in root-canal treatment are shown in the diagrams on the overleaf. X rays are taken to establish the length of the pulp cavity. A local anesthetic may be given. The tooth is isolated from the saliva with a rubber dam (a small sheet of rubber) to prevent infection. A hole is drilled in the crown of the tooth, the pulp is removed, and the crown is then sealed with a temporary filling. About one week later the dentist removes the filling to ensure that the cavity is free of infection; if it is not, an antibiotic paste is applied and the tooth is resealed. When no infection can be detected, the cavity is filled and the chamber is sealed. COMPLICATIONS

If the pulp cavity has not been filled completely, bacteria may enter, leading to apical periodontitis (inflammation of fhe tissues around the root tips). It may then be necessary to make an opening in the gum and bone overlying the affected root to allow pus to drain. In some cases, a small portion of the root tip may be removed and the area filled with amalgam. RESULTS

Teeth whose pulp cavities have been filled may function well for as long as normal teeth. However, the teeth

875

RORSCHACH TEST

ROOT-CANAL TREAT MENT

---++--+----- Pulp chamber

1

A hole is drilled into th e crown so that all infected material can be removed from the pulp c hamber. The root canals are then slightly enlarged and shaped with long, fine-tipped instruments.

The exact cause of rosacea is unknown, but sometimes it is caused by overuse of corticosteroid creams in the treatment of other skin disorders. The condition affects about one in 500 people and is most common among middle-aged women. Rosacea usually begins with temporary flushing, often after drinking a hot beverage or alcohol, eating spicy food , or entering a hot environment. It may then develop into permanent redness of the skin, sometimes accompanied by pustules resembling those of acne. In some elderly men, the condition leads to rhinophyma (bulbous swelling of the nose). TREATMENT

Ant1sept1c paste

A lengthy course of the antibiotic drug tetracycline usually suppresses rosacea but it does not cure it. Rosacea may recur over a period of five to 10 years, after which the condition usually disappears on its own.

Roseola infantum

2

Antibiotic paste is packed into the cavity and a temporary filling fitted. After a week or so, the filling is removed and the canals are checked for sterility.

r-~------

-+-- - - Artificial crown

v r--+--- - Cement seal

Filli ng paste 1----.,1-1-'!a-.P..+ --

- Points

3

R

The canals are filled with filling paste and/or tapering solid "points" made of gutta-percha resin mixed with zi nc and bismuth oxides. The roots are then seal ed with a cement and an artificial crown is fitted.

sometimes turn slightly gray; if this is unsightly, bleaching, a crown, or a facing can restore the appearance.

Rorschach test A test in which the subject reveals his or her attitude, conflicts, and emotions by responding to a set of inkblot pictures. The inkblot pictures are standardized, but of such a nature that the individual tends to project his or her unconscious attitude. The inkblot test was devised by the Swiss psychiatrist Hermann Rorschach early this century. (See also Personality tests.)

Rosacea A chronic skin disord er in which the nose and cheeks are abnormally red .

876

A common infectious disease that primarily affects children aged 6 months to 2 years. Roseola infantum is probably caused by a virus and is characterized by the abrupt onset of irritability and a fever . The temperature may rise as high as 105°F (40 .5°C). However, on the fourth or fifth day, it drops suddenly back to normal. At about the same time, a rash appears on the trunk, often spreading quickly to the neck, face, and limbs. The rash rarely lasts longer than a day or two. Other symptoms may include a sore throat and enlargement of lymph nodes in the head and neck. Occasionally, a child may have a febrile seizure during the course of the fever, but the illness has no serious results or complications. There is no specific treatment other than to keep the child cool and give acetaminophen to reduce the fever.

Rotator cuff A reinforcing structure around the shoulder joint composed of four muscle tendons that merge with the fibrous capsule enclosing the joint. The rotator cuff may be torn as the result of a fall. A partial tear may cause painful arc syndrome (pain when the arm is lifted in a certain arc away from the body) . A complete tear seriously limits the ability to raise the arm and, in cases of severe disability, may require surgical repair .

Roughage See Fiber, dietary.

Roundworms Also known as nematodes, a class of elongated, cylindrically shaped worms. A dozen or so types are the main parasites of humans (the accompanying table summarizes the main ones). In many cases, the adult worms inhabit the human intestines, usually without causing symptoms unless there is a large number of worms. Sometimes, passage of worm larvae through various parts of the body is the main cause of symptoms. Most infestations are treated relatively easily with antihelmintic drugs. In temperate areas, such as the US, the only common type of roundworm disease is pimvorm infestation (which mainly affects children) . Ascariasis, whipworm infestation, and trichinosis are also fairly common, although they often cause no symptoms. Toxocariaszs occasionally occurs. In tropical countries, roundworm diseases are much more common; they include those mentioned above and hookworm

infestation, strongyloidiasis, guinea worm disease, and different types of filariasis.

Rubber dam A rubber sheet used to isolate one or more teeth during certain dental procedures. The dam acts as a barrier against saliva and prevents the inhalation of debris or small instruments. To fit a dam, the dentist punches small holes in the sheet for the teeth to protrude, and secures the sheet with clamps and a frame.

Rubella A viral infection, also known as German measles (although the similarities to measles are few) . Rubella causes a trivial illness in children and a slightly more troublesome one in adults. It is serious only when it affects a woman in the early months of pregnancy, when there is a chance that the virus will infect the fetus, which can lead to any of a range of severe birth defects, known as rubella syndrome. CAUSES AND INCIDENCE

Apart from mother-to-baby transmission, the rubella virus is spread from person to person in airborne droplets. Symptoms develop after an incubation period of two to three weeks. Once common worldwide, rubella is now much less prevalent in most developed countries as a result of vaccination programs. The aim in the US has been to eradicate the virus by compulsory vaccination of all children before school entry; the results are encouraging. By 1986 the incidence

RUPTURE

in the US had been reduced to 551 reported cases of rubella and only 14 cases of rubella syndrome. SYMPTOMS AND COMPLICATIONS

The infection usually occurs between the ages of 6 and 12 and is almost invariably mild. A rash appears on the face, spreads to the trunk and limbs, persists for a few days, and then disappears. There may be a slight fever and enlargement of lymph nodes at the back of the neck. In some cases, the entire infection passes unnoticed. In adolescents and adults, there may be more marked symptoms, such as headache before the rash appears and a more pronounced fever. The virus may be transmitted to others from a few days before the symptoms appear until a day after they disappear. Polyarthritis (inflammation affecting several joints) is an occasional shortlived complication, starting shortly after the rash has faded .

DISEASES CAUSED BY ROUNDWORMS (NEMATODES) Disease

Adult length

Distribution

How acquired

Ascariasis (common roundworm)

6- 15 inches

Worldwide

By swal lowing worm eggs that have contaminated food or fingers

Ente ro biasi s (pinworm)

0.1- 0 .5 inches

Worl dwide

By swal lowing worm eggs that have contaminated fingers

Trichuriasis (whipworm)

1- 2 inches

Worldwide

By swallowing worm eggs that have contaminated food or fingers

Ancylostomiasis (hookworm)

0.5 inc hes

Tropics

By penetration of skin of feet by worm larvae in soil

Strongyloidiasis

0 .1 inches

Tropics

By penetration of skin of feet by worm larvae in soil

Toxoc ariasi s

A few inches

World wide

By swallowing worm eggs from dirt or dog feces

Trichinosis (pork worm)

0 .05 inches

Worldwide

By eating undercooked pork containing encysted worm larvae

Filariasis

1- 20 inches

Trop ic s

By mosq uito and other insect bites

CONGENITAL INFECTION

Rubella is a risk to the unborn baby only if the mother is infected during the first four months of pregnancy. The earlier in pregnancy infection occurs, the more likely the infant is to be affected, and the more serious the abnormalities tend to be. In very early pregnancy, miscarriage may occur. An affected infant may have one or many defects. The most common abnormalities, in order of frequency, are deafness, congenital heart disease, mental retardation, cataract and other eye disorders, purpura, cerebral palsy, and bone abnormalities. About 20 percent of affected babies die in early infancy. An affected infant continues to harbor the virus and may infect others via his or her urine, stools, and saliva for a year or more after birth. DIAGNOSIS AND TREATMENT

Rubella is easily confused with other conditions such as rashes caused by other viruses, drugs, and scarlet fever. It can be positively diagnosed only by laboratory isolation of the virus from a throat swab or by tests to look for antibodies to the virus in the blood. There is no specific treatment for rubella. Acetaminophen can be given to reduce fever. Treatment of rubella syndrome is of the defects exhibited. PREVENTION

Rubella vaccine is highly effective in providing long-lasting immunity to the disease; it is given to all babies (usually combined with measles and mumps vaccine) at about 15 months of age. Reactions to the vaccine are usually negligible. Rubella infection itself also provides immunity.

Any female of childbearing age (or approaching it) who is unsure whether she has been immunized or has had rubella, should have her immune status checked. If she is not immune, vaccination is performed only if there is no chance that she is pregnant because of the risk of the vaccine causing rubella in the fetus. A nonimmune pregnant woman must avoid contact with anyone who has rubella; if such contact occurs, she should immediately seek a physician's advice. Passive immunization with immune globulin may help prevent infection of the fetus.

Rubeola Another name for measles.

Running injuries Many of the millions of people who jog or run to keep fit sustain a variety of injuries as a result. Most running injuries can be prevented by taking simple precautions. TYPES

Common injuries include tendinitis (inflammation of a tendon); stress fracture of the tibia (shin), the fibula (the other long bone in the lower leg), or a bone in the foot; plantar fasciitis (inflammation of tissue in the sole of the foot); and other overuse injuries.

Tearing of the hamstring muscles at the back of the thigh is common in sprinting. Long-distance runners are more likely to suffer back pain due to jarring of the spine, tibial compartment syndrome (painful cramp in the lower leg causedby muscle compression), or shzn splints (pain along the inner edge of the tibia). PREVENTION

Shoes should fit snugly to provide stability but should not cramp the foot; they require insoles to cushion the jarring force on legs and spine. Shoes should not be allowed to become worn, since this can cause abnormal positioning of the foot during running, leading to foot strain. Before running, warm-up exercises should be performed to reduce the risk of injury. Beginners should run short distances at first, and experienced runners should keep their running within sensible bounds. Running should be done in an upright posture, with the trunk, neck, and arms relaxed. Long periods of running uphill, downhill, or along the side of a slope should be avoided because they increase stress on the ankle and knee.

Rupture See Hernia . 877

R

Sacroiliitis

Sac A pouch, or baglike organ or body structure. The amniotic sac is the thin, membranous, fluid-filled bag that surrounds the fetus .

Saccharin An artificial sweetener.

Sacralgia Pain in the sacrnm (the triangular spinal bone below the lumbar vertebrae) caused by pressure on a spinal nerve in this area. Sacralgia is usually the result of a disk prolapse. In rare cases, however, it may be due to bone cancer. (See also Back pain.)

Sacralization Fusion of the fifth (lowest) lumbar vertebra with the upper part of the sacrum (the triangular spinal bone below the lumbar vertebrae). Sacralization may occur as a birth anomaly, in which case it usually produces no symptoms and is discovered only when an X ray of the back is taken for some other reason. Sacralization may also be performed as a surgical procedure to treat a disk prolapse or spondylo/isthesis, in which a vertebra is displaced over the one below it. (See also

Spinal fusion.)

Sacroiliac joint One of a pair of rigid joints between each side of the sacrum (the triangular spinal bone below the lumbar vertebrae) and each ilium (the largest of the bones that form the outer walls of the pelvis). The bony surfaces within the joint are lined with cartilage and have a small amount of synovial fluid (see Synovium) between them. Strong ligaments between the sacrum and ilium permit only minimal movement at the joint. DISORDERS

The sacroiliac joint may be strained (usually as a result of childbirth or overstriding when running), producing pain in the lower back and buttocks. It may also become inflamed, a condition called sacroiliitis.

878

Inflammation of the sacroiliac joint (one of a pair of joints between each side of the sacrum and each ilium). Sacroiliitis can be caused by ankylosing spondylitis, rheumatoid arthritis, or, in rare cases, by an infection that has spread through the bloodstream from elsewhere in the body. The principal symptom is pain in the lower back, buttocks, groin, and back of the thigh. The pain may be accompanied by fever and malaise if the underlying cause is an infection. If the cause is ankylosing spondylitis, pain may be accompanied by stiffness in the back and hips that is worse after rest and alleviated by exercise. Sacroiliitis is diagnosed by X rays and blood tests. If infection is suspected, fluid may be removed from the joint and checked for microorganisms. Treatment is with no11steroida/ anti-inflammatory drugs or, if the joint is infected, antibiotic drugs .

Sacrum The large triangular bone in the lower spine. Its broad upper part articulates with the fifth (lowest) lumbar vertebra, and its narrow lower part with the coccyx (tailbone). The sides of the sacrum are connected by sacroiliac joints to the iliums (the largest of the bones that form the pelvis). Thus, the sacrum sits like a wedge in the center of the back of the pelvis. STRUCTURE OF THE SACROILIAC JOINT

The sacrum consists of five vertebrae (spinal bones) that are fused together to form a single solid structure.

_ _ _ Fifth lumbar vertebra Sacral canal

f

Coccyx

Sacrum

Sacral foramina

The sacrum is a strong bone and is rarely fractured. If a fracture does occur, it is usually a result of a fall or of a powerful direct blow to the bone. Otner disorders include sacra/gin (pain in the sacrum, sometimes due to a disk prolapse); spondylolisthesis, in which the fifth lumbar vertebra slips over the sacrum; and a birth anomaly in which the sacrum is fused to the fifth lumbar vertebra (see Sacralization) . See also Bone disorders box; Spine disorders box.

Sadism

The joint forms an interface between the sac rum at the back of the pelvis and the ilium (hip bone) on each side of the body.

Ilium Lumbar vertebrae

Sacroiliac _ _ -+----cc~ ----~ ligaments Sacroiliac Join!

STRUCTURE OF THE SACRUM

-+----,-L-,-1---fc,~,.,._... ...

A love of cruelty and inflicting pain on other people. The term is derived from the name of the French novelist the Marquis de Sade. Sadism often refers specifically to the achievement of orgasm through hurting, humiliating, or torturing one's partner or other victim. It is more common in men and often accompanied by masochism (a desire to be abused) . Sadistic activities include beating, whipping, and bondage, usually accompanied by verbal abuse. Sadists rarely inflict serious physical damage (the genuinely sadistic murderer is rare) but rape often has a sadistic basis. Only in rare cases do sadists seek help from a psychiatrist. (See also Sadomasochis111 .)

Sadomasochism Sexual arousal caused by inflicting pain or punishment (sadism) or by receiving abuse (masochism). Sadism

SALIVA

and masochism may be combined in a person, although one trait usually predominates. The sadomasochist is generally male and may practice other sexual deviations, such as fetishism. Researchers have found sadomasochistic literature to be a common form of pornography. The practice may be more widespread than is generally known; biting is a common sex practice. In a broad sense, any relationship in which there is one very dominant and one submissive partner can be said to have sadomasochistic elements.

SADS Seasonal affective disorder syndrome, an incompletely studied and proved phenomenon in which mood changes are alleged to occur with the seasons.

Safe period See Contraception , periodic abstinence.

"Safe" sex A term used to describe preventive measures taken to reduce the risk of acquiring a sexually transmitted disease. "Safe" sex has been publicized recently because of the spread of AIDS, but the same principles apply to prevention of other sexually transmitted diseases, such as hepatitis B, herpes, and gonorrhea. Sexual intercourse is completely safe only if you and your partner are monogamous (have not had sex with anyone else) and did not receive a blood product infusion before 1985, when blood products began to be tested for the AIDS virus. To reduce

Salicylic acid

the risk of acquiring AIDS, casual sex and sex with multiple partners should be avoided. People with a higher risk of carrying AIDS include intravenous drug abusers, bisexual and homosexual men, prostitutes, promiscuous men or women, hemophiliacs and their partners, and people from areas where there is a very high incidence of AIDS (e.g., Central Africa and Haiti). Antibody testing to show whether a person has been exposed to the AIDS virus is being used by dating organizations. Members are issued a "safe sex card" if their test results are negative; they are retested every six months. This procedure provides no guarantee against contracting AIDS. It can take six months to produce antibodies after exposure to the virus. Known methods of transmitting the AIDS virus include vaginal intercourse, anal intercourse, oral sex, sharing sex aids such as vibrators, and any sexual activity that causes bleeding in the vagina or anus. Any sexual practice that involves contact with urine or feces also poses a risk. Sex during menstruation is particularly dangerous if the woman is a carrier. "Dry kissing," cuddling, caressing, massage, or mutual masturbation (providing there is no broken skin or ejaculation of semen near the vagina) are not believed to transmit the virus. To reduce the risk of acquiring AIDS or any other sexually transmitted disease, a condom should be worn. If a condom fails to prevent transmission, the cause is most likely to be incorrect use or a torn condom (especially during anal intercourse).

The watery, slightly alkaline fluid secreted into the mouth by the salivary glands and the mucous membranes that line the mouth. Saliva contains the digestive enzyme amylase, which helps break down carbohydrates (see Digestive system). It also keeps the mouth moist, lubricates food to aid swallowing, and makes it possible to taste food (taste buds are stimulated only by dissolved substances). In addition to amylase, saliva contains chemicals, such as sodium, potassium, calcium, and chloride; pro-

transmitted disease, but it does reduce the risks. Whether a condom is used to prevent disease transmission or to

prevent conception , it should be used in conjunction with a spermicide preparation .

A keratolytic drug used in the treatment of skin disorders, including dermatitis,

eczema, psoriasis, ichthyosis, acne, warts, and callosities (see Callus, skin). Salicylic acid is sometimes used to treat fungal infections. Salicyclic acid may cause inflammation and skin ulcers if used over a long period or applied to a large area.

Saline Salty, or consisting of or containing salt (sodium chloride). The term is also used to refer to a solution of salt, particularly one that has the same concentration as body fluids (known as physiological, or normal, saline). This solution, found in tears, is a component of contact lens solution. Physiological saline may be given in large amounts (by injection or infusion into a vein) to replace body fluids in cases of dehydration. It is sometimes used in small quantities to dissolve drugs for injection.

Saliva

HOW TO USE A CONDOM Using a condom is not a guarantee against transmission of HIV (the AIDS virus) or other sexually

.

s

',

•·..' ••· ·. 1.,·'. ~

._,1 .}··.

'

1

The penis should be fully erect before the condom is put on. The condom should be in place before any vaginal or anal penetration by the penis and before oral sex.

2

Use a brand of condom that has been approved by a regulatory authority . Do not use a condom that has no teat, is time-expired, or appears defective.

3

The teat-end should be squeezed free of air and the condom unrolled fully over the penis . Do not stretch the condom tightly; a tight condom is more likely to burst.

4

The penis should be withdrawn soon after ejacu lation. During withdrawal, the base of the condom should be held to prevent spilling the semen .

879

SALIVARY GLANDS

teins; mucin (the principal constituent of mucus); urea; white blood cells; and debris from the lining of the mouth .

Salivary glands Three pairs of glands that secrete saliva, via ducts, into the mouth. The largest pair, the parotid glands, lies over the angle of the jaw, just below and in front of the ears; the ducts of these glands run forward and inward to open inside the cheeks. The sublingual glands are situated in the floor of the front of the mouth, where they form a low ridge on each side of the frenulum (the central band of tissue that attaches the underside of the tongue to the floor of the mouth) . This ridge has a row of small openings through which saliva is secreted. The submandibular glands lie toward the back of the mouth close to the sides of the jaw. Their ducts run forward to open under the tongue on two small swellings, one on either side of the frenulum. DISORDERS

Among the most common salivary gland disorders is infection of the parotid glands with the mumps virus. Another frincipal disorder is the formation o calculi (stones) in a duct or within the substance of a gland. A stone in a duct causes a swelling that enlarges during eating because of damming of the sa liva flow; it may ANATOMY OF THE SALIVARY GLANDS

Each gland con sists of thousands of saliva-secreting sac s. Tiny ducts carry the saliva into the main ducts leading to the mouth.

s

Parotid gland

Parotid duct

also be painful. Surgical removal of a stone in a duct is straightforward, but a stone in a gland itself may necessitate removal of the entire gland. Occasionally, the parotid glands are affected by sarcoiaosis, wnich may cause considerable swelling. In rare cases, sarcoidosis also affects the facial nerve, which may result in facial palsy. If oral hygiene is poor, the salivary glands may become infected by bacteria spreading from the mouth, which can lead to the development of an abscess in the affected glands. Tumors of the salivary glands are rare, except for a type of parotid tumor that is usually slow-growing, painless, and benign (but whicn occasionally becomes malignant). Insufficient secretion of saliva, causing a dry mouth (see Mouth , dry), ma_y result from dehydration or Sjogre11 s syndrome. Certain drugs also decrease salivation as a side effect. (See also

Salivation, excessive.)

Salivation, excessive The production of too much saliva occurs in numerous disorders, including mouth irritation caused by jagged teeth or dental caries, toothache, gi11givitis (inflammation of the gums), mouth ulcers, any painful mouth injury, and esoplwgitzs (inflammation of the esophagus) . A variety of conditions that affect the nervous system can also cause excessive salivation, among them

Parkinson's disease, rabies, mercur1/ poiso11ing, and overactivity of the parasympathetic division of the autonomic nervous S1/Stem (which controls the salivary glands), usually due to disease or drugs.

Salmonella An important group of bacteria. One type of salmonella causes typhoid fever; others are a common cause of bacterial

food poisoning.

Salpingectomy Surgical removal of one or both fallopian tu /Jes. Salpingectomy may be performed if the tube has become infected (see Salpin ~itis), as a method of contraception ' (see Sterilization , female), or to treat an ectopic pregnancy. (See also Salpi11go-oopl10rcctomy.)

Salpingitis Submand1bular gland

880

Sublingual gland

Inflammation of a fallopian tllbc (the tube that runs from the ovary to the lop of the uterus), commonly caused by infection spreading upward from the vagina, cervix, or uterus.

CAUSES AND INCIDENCE

Salpingitis may be a result of a chlamydia/ infection or a bacterial infection, especially gonorrhea. Although salpingitis usually results from a sexually transmitted disease, it may also follow childbirth, miscarriage, or elective abortion. Other causes include peritonitis (inflammation of the abdominal lining), or, rarely, a bloodborne infection, such as tuberculosis . SYMPTOMS AND SIGNS

Symptoms and signs include severe abdominal pain, fever, and frequent urination. The abdomen is very tender and the sufferer is usually most comfortable lying on her back with her legs bent at the knee. Vaginal examination is painful. DIAGNOSIS

The presence of infection may be confirmed by a blood test showing a high number of white blood cells . A culture of a swab sample of the vaginal discharge allows identification of the causative microorganism. Laparoscopy (examination of the inside of the abdominal cavity with a viewing tube) may be performed to confirm the diagnosis and to exclude the possibility of ectopic pregnancy or appendicitis, which can cause similar symptoms . COMPLICATIONS

Pus may collect within the fallopian tube itself (pyosalpinx), sometimes followed by fluid collection within the tube (hydrosalpinx). Pus collection within the abdominal cavity causes a pelvic abscess . Occasionally, the infection persists despite treatment and causes a variety of symptoms, such as persistent back pain that is worse before menstruation, frequent heavy periods, and pain during intercourse. If the infection damages the inside of the tubes, eggs may be unable to pass the blockage, resulting in infertility or an increased risk of ectopic preg1ia11cy. TREATMENT

Treatment includes bed rest, fluid s, analgesics (painkillers), and antibiotic drugs. Surgery is performed to drain a pyosalpinx, hydrosalpinx, or pelvic abscess. If infection persists despite antibiotics, the damaged tubes may be removed, sometimes with the uterus and most of the ovary. (See also

Salpi11gccto111y; Salpi11go-oophorecto111y.)

Salpingography See J-Jystcrosalpi11gography.

Salpingo-oophorectomy Removal of one or both fallopian tubes and ovaries. Salpingo-oophorectomy may be performed to treat persistent

SCALP

salpingitis (inflammation of the fallopian tubes), cancer of the ovary (see Ovarlj, cancer of), cancer of the uterus (see · Uterus, cancer of), or clwriocarcinoma (a malignant tumor derived from placental tissue). The operation is often carried out with a hysterectomy (removal of the uterus and cervix). Salpingo-oophorectomy is carried out using a general anesthetic. Removal of the fallopian tube or tubes is a brief, straightforward procedure and the short recovery period is usually problem-free.

Salt Any compound of an acid and a base. In general usage, the term usually refers specifically to one such compound---common table salt, known chemically as sodium chloride (see Sodium). The term salt may also be applied to a particular chemical salt or mixture of salts used medicinally (often as a purgative), as in magnesium sulfate and sodium sulfate. (See also Saline.)

Salve A term for a healing, soothing, often medicated, ointment.

Sand-fly bites Sand flies are tiny, delicate, long-legged flies that inhabit most warm parts of the world and, in some areas, transmit disease to humans via their bites. Sand flies are about one eighth of an inch (3 mm) long and can breed in a variety of habitats, including forests, sand, and city rubble. In the US, sand flies are common in many areas, although they do not transmit disease. Elsewhere, diseases spread by these flies include various forms of leishmaniasis in tropical and subtropical regions and barto11el/osis in the western Andes. Sand-fly fever is an influenzalike illness of short duration that is caused by a virus spread by the flies in parts of the Mediterranean and Asia. Sand flies primarily bite after dusk. In areas where they are numerous, the best protection is to wear insect repellents and clothing that covers the arms and legs and is snug at the wrists and ankles (see Insect bites).

Sarcoidosis A rare disease of unknown cause in which inflammation occurs in lymph nodes and other tissues throughout the body, usually the lungs, liver, skin, and eyes. The disorder occurs primarily in young adults . SYMPTOMS AND SIGNS

Acute sarcoidosis is associated with fever and generalized aches . It may also cause enlargement of lymph nodes in the neck and elsewhere, breathlessness, arthritis, or en1tlze111a nodosum (red-purple swellings on the legs). Chronic sarcoidosis can cause a variety of symptoms, including fever, a purple rash on the face, painful joints, a painful, bloodshot eye, and areas of numbness. Sometimes, the disease produces no symptoms. Complications include scarring and thickening of the lung tissues (fibrosis) and hypercalcemia (an abnormally high calcium level in the blood), which may damage the kidneys. DIAGNOSIS AND TREATMENT

A diagnosis may be suggested from a chest X ray (which shows enlarged lymph nodes) and from the rash. A biopsy of the lung, skin, lymph gland, or liver confirms the diagnosis. Many people with sarcoidosis are not seriously ill; the disease may resolve without treatment. About 90percent of patients recover completely within two years, with or without treatment, but persistent, chronic disease develops in 10 percent. Corticosteroid drugs are prescribed to treat persistent fever or persistent erythema nodosum, to prevent blindness in an affected eye, and to reduce the risk of permanent lung damage. Chloroquine is sometimes used to treat skin abnormalities.

Sarcoma A cancer of connective tissue (such as cartilage), blood vessels, or the fibrous tissue that surrounds and supports organs. Types of sarcoma include osteosarcoma and c/wndrosarcoma (both arising in bones), Kaposi's sarcoma (which mainly affects the skin and is common in people who have AIDS), and fibrosarcoma.

Saturated fats See Fats and oils.

Sanitary protection

Scab

Articles used to protect clothing from blood stains during menstruation. Disposable sanitary napkins or tampons are available in different absorbencies to meet individual needs.

A crust that forms on the skin or on a mucous membrane at the site of a healing wound or infected area. A scab is composed of fibrin and serum that has leaked from the wound and

dried, along with skin scales, pus, and other debris. A similar term is eschar, used in connection with burns.

Scabies A skin infestation caused by the mite SARCOPTES SCABIEI, which burrows into the skin, where it lays eggs. Scabies is highly contagious. Hatched mites can pass from an infested individual to a person standing close beside him or her, although infestation is more likely through physical contact (such as sexual intercourse). The disorder is most common in infants, children, young adults, or in people who are institutionalized. SYMPTOMS

The openings of the mite's burrows can be seen on the skin as tiny, gray, scaly swellings, usually between the fingers, on the wrists and genitals, and in the armpits. Later, reddish lumps may appear on the limbs and the trunk. The infestation causes intense itching, particularly at night, and scratching results in the formation of scabs and sores. TREATMENT

The condition is treated by applying an insecticide lotion (such as li11Ja11e) to all skin below the sufferer's head. The lotion usually kills the mites, but itching may persist for up to two weeks. All members of the affected person's household (even if they show no signs of infestation) should be treated simultaneously.

Scald To burn with hot liquid or steam (see Burns).

Scaling, dental Removal of calculus (a hard, chalky deposit) from the teeth, performed to prevent or treat periodontal disease (disorders of the gums and other tissues supporting the teeth) . Scaling is carried out with an instrument called a scaler. It may have a sharp, scraping edge or be an ultrasonic model with a tip that vibrates at high speed to chip away the deposit. After scaling, the teeth are usually polished with a mild abrasive paste and motorized buffers.

Scalp The region of the skin and underlying tissue layers of the head that is normally covered with hair. Scalf skin differs from other areas o skin because it is tougher and it is attached to an underlying sheet of muscle 881

s

SCALPEL

(called the epicranius) that extends from the eyebrows, over the top of the head, and to the nape of the neck. This muscle is only loosely attached (by connective tissue) to the skull, making it comparatively easy for areas of scalp to be torn off (e.g., as a result of catching the hair in machinery). Because the scalp is richly supplied with blood vessels, wounds bleed profusely. The scalp may be affected by a variety of liair or skin disorders. The most common are dandruff; hair loss, particularly in men (see Alopecia); sebaceous cysts; psoriasis; fungal infections, such as ringworm (see Ti11ea); and parasitic infestations such as lice. Cradle cap, a harmless form of seborrheic dermatitis in which greasy, crusty patches appear on the scalp, is common in infants.

I l

Scalpel A surgical knife for cutting tissue. Scalpels with steel blades are used for most operations, but in some cases (e.g., eye surgery) sharper diamond or ruby blades are used.

Scanning techniques

s

Images of the body organs can be produced by a variety of scanning techniques that record, process, and (depending on the technique) analyze the sound waves, radio waves, or X rays that pass through or are generated by body tissues. The scanning technique used most widely in medicine is ultrasound, in which inaudible, ultrahigh frequency sound waves are passed into the region being examined. These sound waves are reflected more strongly by some structures than others, and the pattern of reflections is detected by one or more transducers and displayed on a screen. Ultrasound was originally developed by the military for the detection of submarines beneath the sea. However, in the past 20 years, it has been refined and developed for the examination of a fetus and also the heart, liver, kidney, and other organs. CT scanning uses X rays to measure variations in the density of the organ being examined; it compiles an image or picture by computer analysis. Radionuclide scanning involves the injection into the body of radioactive substances that are taken up in different amounts by different organs. Radioactive iodine, for example, becomes concentrated in the thyroid gland . A radioactivity detector, such as a gamma camera, is positioned near 882

the organ under study, and the pattern of radiation being emitted is recorded and displayed on a screen. MRI (magnetic resonance imaging) uses a powerful electromagnet to align the nuclei of atoms of hydrogen, phosphorus, or other elements in the body. The nuclei are then knocked out of position by radio waves; in realigning themselves with the magnetic field, they produce a radio signal that can be detected and transformed into a computer-generated image. (See also PET sca1111i11g.)

Scaphoid One of the wrist bones. The scaphoid is the outermost bone on the thumb side of the hand in the proximal row of carpals (the row of wrist bones nearest the elbow). A fracture of the scaphoid is one of the most common wrist injuries, usually occurring as a result of a fall on an outstretched hand. A characteristic symptom of this injury is tenderness in the space between the two prominent tendons at the base of the thumb on the back of the hand. This symptom may be a more positive indication of a scaphoid fracture than an X ray. Treatment consists of immobilizing the wrist in a cast. An undiagnosed, untreated scaphoid fracture may not heal, which can lead to osteoarthritis or, in some cases, necrosis (death) of part of the bone. These complications may result in persistent pain in the wrist and restriction of its movement.

Scapula The anatomical name for the shoulder blade. The scapula is a flat, triangular bone situated over the back of the upper ribs . On its rear surface is a prominent spine (which can be felt under the skin) that runs diagonally upward and outward to a bony prominence (called the acromion) at the shoulder tip. The acromion articulates with the end of the clavicle (collarbone) to form the acromioclavicular joint. Just below the acromion is a socket (called the glenoid cavity) into which the head of the humerus (upper arm bone) fits to form the shoulder joint. The scapula serves as an attachment for certain muscles and tendons of the arm, neck, chest, and back, and is involved with movements of the arm and shoulder. Because the scapula is well padded with muscle, great force is required to fracture it. Treatment of a fracture consists of putting the shoulder in a sling

until the fracture has healed. Physical therapy may be needed to restore movement to the joint.

Scar Any mark left on damaged tissue after it has healed. Scar tissue forms not only on the skin but on all internal wounds (e.g., after a muscle tear or where surgery has been performed). The body repairs a wound, ulcer, or other lesion by increasing production of the tough, fibrous protein collagen at the site oI the damage. The collagen helps form new connective tissue, which covers the area of the lesion. If the edges of an incision are brought together when healing takes place, the resultant scar is narrow and pale; if the edges are left apart, the scar is more extensive (see Healing). ABNORMAL SCAR FORMATION

A hypertrophic scar is a large, unsightly scar that may develop at the site of a wound that has become infected. Some people have a family tendency toward hypertrophic scars for no apparent reason. A kelo1d is a large, irregularly shaped scar that continues to grow in size as the body continues to produce extra collagen after a wound has healed; this type of scar is more common in black than in white people. Adhesions are areas of scar tissue that form between unconnected parts of internal organs; they are a potential complication of intestinal surgery.

Scarlatina Another name for scarlet fever.

,--

- - - - - -~

- ---,

LOCATION OF THE SCAPULAE

The two scapulae are the prominent wing-shaped bones in the upper back. They facilitate many arm and shoulder actions. Acromion

Scapula

Humerus

Acromioclavicular joint

SCHISTOSOMIASIS

Scarlet fever An infectious disease of childhood that is caused by a strain of streptococcal bacteria. Characterized by a sore throat, fever, and rash, scarlet fever is far less common and dangerous than it once was. CAUSES AND SYMPTOMS

The bacteria are spread in droplets coughed or breathed into the air. After an incubation period of two to four days, a sore throat, headache, and fever develop in an infected child. A rash soon appears, caused by a toxin released by the bacteria. The rash begins as a mass of tiny red spots on the neck and upper trunk and spreads rapidly. The face is flushed (except for

Schistosomiasis A parasitic disease, also known as bilharziasis, that occurs in most tropical countries and afflicts over 200 million people worldwide. CAUSES AND INCIDENCE

The disease is caused by any of three species of flukes called schistosomes and is acquired from bathing in infested lakes and rivers in the tropics. Forms of schistosome (cercariae) penetrate the bather's skin and develop within the body into adult flukes (see life-cycle diagram at right). Eggs produced by the adult females provoke inflammatory reactions, which in turn may cause symptoms. The infestation causes bleeding, ulceration, and fibrosis (scar tissue formation) in the bladder or intestinal walls; infestation may also cause inflammation and fibrosis in other organs, such as the liver.

an area around the mouth) and a white coating with red spots may develop on the tongue. Alter a few days the coating peels to reveal a bright red appearance. Soon afterward, the fever subsides, the rash fades, and there is frequently some skin peeling, especially on the hands and feet. As with other types of sore throat caused by streptococci (see Strep throat), there is a risk of rheumatic fever or glomerulonephritis (inflammation in the kidneys) if the infection is not treated promptly. DIAGNOSIS AND TREATMENT

The physician diagnoses scarlet fever from the symptoms and signs and, if microscopic examination of a sample of urine or feces to detect eggs. Since the early 1980s, treatment has been revolutionized by a new drug (praziquantel), a single dose of which kills the flukes and thus prevents, or limits, damage to internaf organs. PREVENTION

Since no vaccine is available against the disease, visitors to areas where

necessary, by culture of the bacteria from a throat swab. Treatment is with antibiotic drugs, usually penicillin (or erythromycin if the person has a penicillin allergy). Treatment usually leads to a rapid recovery. During the illness, the child should rest, drink plenty of fluids, and be given acetammophen to relieve discomfort and reduce fever.

Schistosome _ ./ A type of fluke (flattened · - worm). Three types of ~ schistosomes are parasites ~ , of humans, causing the disease schistosomiasis in tropical regions of the world. schistosomiasis is present (i.e., much of the tropics) should regard all lakes and rivers as unsafe for swimming. Control of the disease rests on the provision of latrines and their regular use by the population. The Chinese claim to have achieved some success through measures directed against snails and through imposing strict sanitary regulations.

SYMPTOMS

Symptoms vary considerably. Some infested people have no symptoms, others become severely ill and suffer serious complications. The first symptom is usually tingling and an itchy rash where the cercariae have penetrated the skin. Many weeks later, when the adults start producing eggs, an influenzalike illness may develop. Sometimes severe, the illness is marked by high fever, chills, aching, and pains. Subsequent symptoms may include blood in the urine or feces, abdominal or low back pain, and enlargement of the liver and/or spleen. Complications of longterm infestation may include liver cirrhosis, bladder tumors, and renal failure. DIAGNOSIS AND TREATMENT

The diagnosis is made from a special blood test for antibodies to the parasites (see Immunoassay) and from

s

Cycle of schistosomiasis The disease affecls a large proportion of lhe population in some parts of the world. such as the Nile valley in Egypt. Many methods have been tried to break the cycle of the

disease in affected areas. with varying success. Methods used have included strict sanitary regulation s and measures to erad icate freshwater snails.

883

SCHIZOID PERSONALITY DISORDER

Schizoid personality disorder Inability to relate socially to other people. People with this trait, which is apparent from childhood, are often described as "loners" and have few, if any, friends. They are markedly eccentric, seem to lack warmth or concern for others, and may be vague and detached from day-to-day activities. Psychoanalysts believe the condition results from an impoverished motherchild relationship. Schizophrenia develops in about 10 percent of people diagnosed as having a schizoid personality. However, not all schizophrenics initially have schizoid personalities. Although the marital and employment prospects for schizoid people are severely impaired, some succeed in socially isolated occupations. (See also

Avoidant personality aisorder.)

Schizophrenia A general term for a group of psychotic illnesses characterized by disturbances in thinking, emotional reaction, and behavior. Schizophrenia is sometimes referred to as "split personality" because the sufferer's thoughts and feelings do not relate to each other in a logical fashion. However, the disorder should not be confused with multiple personality. Schizophrenia is a disabling illness with a prolonged course that almost always results in chronic ill health and some degree of personality change. PREVALENCE

s

Schizophrenia is the most common form of psychotic illness. It has an average lifetime prevalence throughout the world of just under 1 percent. Approximately 1.5 million US citizens are currently affected. For reasons that arc not understood, the disorder is more common in certain geographic areas (e.g., Western Ireland and inner-city populations). Onset is usually between the ages of 15 and 25, being, on average, five years later in women than in men; otherwise, males and females are equally affected. CAUSES

Inheritance has been shown to play a role in the development of schizophrenia. First-degree relatives (parents, children, or siblings) of schizophrenics have a 10 percent chance of the illness; more distant relatives have a lower risk. If both parents are schizophrenic, one in three of their children becomes ill, and, if schizophrenia develops in one identical twin, the other twin has

884

approximately a one in two chance of being affected. However, factors other than genetics must also play a part or the illness would inevitably develop in both twins. Biological studies have shown that certain forms of brain damage (such as temporal lobe epilepsy, tumors, and encephalitis) tend to be related to schizophrenic symptoms. Brain imaging techniques, especially CT scanning and PET scanning, have revealed abnormalities of structure and function in the brains of schizophrenics. It has also been demonstrated that certain drugs, such as amphetamines, can cause a schizophrenic illness and that drugs blocking the action of the brain chemical dopamine often relieve schizophrenic symptoms. It seems likely that schizophrenia is possibly worsened by stress in the individual's personal life. SYMPTOMS

Schizophrenia may begin insidiously, with the individual becoming slowly more withdrawn and introverted, and losing his ur her drive and motivation. The change may not be noticed for months or years, until it becomes apparent that the individual is suffering from delusions (false ideas that do not respond to reasoned argument) or hallucinations (a sensory experience in the absence of an external stimulus). In other cases, the illness comes on more suddenly, usually in response to some external stress. Delusions may take a variety of forms, ranging from single ideas, such as the belief that one is Jesus Christ or Napoleon, to elaborate delusional systems in which special significance is attached to everyday objects or events. In paranoid schizophrenia, the illness is dominated by delusions of grandeur, persecution, or jealousy. Hallucinations frequently are experienced as voices that comment on behavior or thoughts, occasionally in the form of conversations in which the sufferer is referred to as he or she. This type of auditory third person hallucination occurs exclusively in schizophrenia. True visual hallucinations are rare in Western cultures, but distortions of visual perception do occur; faces or objects may look sharper or change shape. Bodily sensations, such as tingling, are common. Most schizophrenics also suffer from a variety of thought disorders, which impair concentration or clear thinking. Sufferers describe their thoughts as being blocked, or inserted into or withdrawn, from their

minds by some outside force. They may also feel that their thoughts are being broadcast to others; in rare cases, the thoughts are experienced as echoes inside the head. Disordered thinking is reflected in muddled and disjointed speech. Disturbance of association results in the schizophrenic jumping between subjects that are seemingly unrelated. Inability to think in abstractions often leads to bizarre responses to questions. For example, when a girl was asked why she was turning in a circle, she said she felt she was in a knot and was trying to unravel herself. In some cases, speech disintegrates, becoming a "word salad" of odd phrases, neologisms (made-up words), and detached syllables. In a rare form of schizophrenia, catatonia may occur, in which sufferers adopt prolonged rigid postures or engage in outbursts of repeated movement. Symptoms of manic-depressive illness may accompany schizophrenia, especially in the early stages. However, as the illness progresses, emotions usually become severely blunted, there is increasing detachment from other people, and there is a loss of interest in hobbies or occupations. Behavior becomes more eccentric and self-neglect is common. DIAGNOSIS

For a diagnosis of schizophrenia to be made by current US standards, the individual must have continuous signs of a profound break with reality and evidence of fragmentation (disorganization) of the personality for at least six months during some time in his or her life. This six-month period must include at least one phase when there are symptoms of hailucinations, delusions, or marked thought disorders. TREATMENT

The main form of treatment consists of antipsychotic drugs (such as chlorpromazine), some of which can be given as long-acting depot injections, which reduces the symptoms and makes the person more amenable to psychotherapy. Drug treatment is effective in suppressing the more obvious symptoms, such as hallucinations, but may result in side effects, particularly dyskinesia (abnormal muscular movements) and tremor. Schizophrenics may be treated initially in the hospital; once the major symptoms are controlled, most return to the community. Adequate provision of day centers, decent housing,

SCINTIGRAPHY

and vocational opportunities can do much to further control symptoms, improve the sufferer's self-reliance, prevent relapse, and reduce the stigma attached to mental illness. If the patient is to live at home, the family needs to be provided with support and guidance, since some schizophrenics may be difficult to live with. A certain number relapse, especially if they do not take their medication regularly. OUTLOOK

While some 10 percent of those in whom schizophrenia develops remain severely impaired for life, the majority can return to varying degrees of independence. About 30 percent return to normal lives and occupations. The particular form of the illness is important in determining the outlook. Individuals who have schizophrenia combined with manic-depressive symptoms often recover fully, as do many with catatonia. Paranoid schizophrenics, because of the preservation of their personalities, are often able to function well, albeit as somewhat eccentric members of the community. Schizophrenia that comes on slowly, starting around puberty, often causes significant impairment. Although drugs have improved the outlook for most schizophrenics, inadequate community care frequentfy results in relapse, neglect, vagrancy, or imprisonment.

Schonlein-Henoch purpura Inflammation of the blood vessels, causing leakage of blood into the skin, joints, kidneys, and intestine. The disease is most common among young children, especially boys, and often occurs after an infection such as a sore throat. The precise cause of Sch6nlein-Henoch purpura is unknown, although some experts believe it is due to an abnormal alfergic reaction in response to an infection. SYMPTOMS

The main symptom is a slightly raised, purplish rash on the buttocks and backs of the legs and arms. The joints are often painful, the hands and feet may be swollen, and the child may complain of colicky abdominal pain. Infrequently, bleeding from the intestine occurs, which gives rise to blood in the feces. The kidneys may become inflamed, resulting in hematuria (blood in the urine). DIAGNOSIS AND TREATMENT

The condition must be distinguished from blood-clotting disorders by performing blood-clot/mg tests.

No specific treatment is required other than bed rest and mild analgesics (painkillers) . Most children recover within a month, although complications may arise if nephritis (inflammation of the kidneys) persists. In severe cases, the physician may prescribe cor-

ticosteroid drugs.

LOCATION OF THE SCIATIC NERVE

The diagram below shows the nerve in a cutaway of the right thigh and knee , as seen from behind.

Sciatica Pain that radiates along the sciatic nerve. The pain sometimes extends from the buttock down the leg to the foot, although usually only part of this area is affected (usually tne buttock and thigh). In severe cases, the pain may be accompanied by numbness and/or weakness in the affected area .

Gluteus maximus

~::---':if-c-¥2:-'~~ -?t-+- muscle

Sciatic nerve

CAUSES

The most common cause of sciatica is a prolapsed intervertebral disk pressing on a spinal root of the nerve (see Disk prolapse). Less commonly, it may be caused by pressure on the nerve from a tumor, abscess, or blood clot, or simply from sitting in an awkward position. Any disorder that involves nerves (such as certain infections, diabetes mellitus, or alcohol dependence) may affect the sciatic nerve and produce sciatica.

Hamstring muscles

Peroneal nerve

TREATMENT

Treatment is directed toward the underlying cause, but in many cases the cause is not identified. Thus, treatment consists of measures to relieve the pain, including taking analgesics (painkillers) and resting in bed. With such treatment, the pain usually disappears within a few days. In severe cases, the pain may persist for several weeks. Sciatica tends to recur.

Sciatic nerve The primary nerve of the leg and the largest nerve in the body. The sciatic nerve is a branch of the sacral plexus (nerve network) in the pelvis, and is formed from several lumbar and sacral spinal nerves. From the sacral plexus, the sciatic nerve passes below the sacroiliac joint (at the back of the pelvis, near the sacrum) and backward to the buttock, from where it passes behind the hip joint and runs down the back of the thigh. Above the back of the knee, the sciatic nerve divides into two main branches, called the tibial nerve and the common peroneal nerve. The upper part of the sciatic nerve, above the point of division, supplies the hip joint, many of the thigh muscles, and the skin on the back of the thigh. The lower part-the tibial and peroneal nerves-supplies the

knee and ankle joints, all the muscles of the lower leg and foot, and most of the skin below the knee. DISORDERS

Probably the most common disorder of the sciatic nerve is sciatica, which is often due to a prolapsed intervertebral disk pressing on a spinal root of the nerve (see Disk prolapse). The upper part of the nerve may also be damaged by dislocation of the hip ,·oint, which, in severe cases, may resu tin paralysis of muscles below the knee and widespread numbness of the skin in that part of the body. Damage to the peroneal nerve, often due to a fracture of the upper fibula (the outer bone of the lower leg), may produce footdrop and numbness of the skin at the side of the lower leg and back of the foot. The tibial nerve is deeply buried in body tissues and thus is rarely injured. However, it is sometimes damaged by dislocation of the knee, whicft may cause paralysis of the lower leg and foot, and numbness in the sole of the foot .

Scintigraphy A less common, alternative name for

radionuclide scanning. 885

s

SCIRRHOUS

Scirrhous

Scleroderma

Scleromalacia

A medical term meaning hard and fibrous . The word is usually applied to malignant tumors that have dense, fibrous tissue within them.

A rare condition, also known as systemic sclerosis, that can affect many organs and tissues in the body, particularly the skin, arteries, kidneys, lungs, heart, gastrointestinal tract, and joints. Scleroderma is an autoimmune disorder (in which the body's immune system attacks its own tissues). Scleroderma is twice as common in women and is most likely to appear between the ages of 40 and 60.

Softening of the sc/era (the white portion of the eye). Sclcromalacia is frequently a complication of scleritis (inflammation of tn.e sclera), especially when the scleritis is caused by rheumatoid arthritis. Scleromalacia perforans is a rare, severe form of the condition in which the entire thickness of sclera is involved; the underlying choroid bulges through and sometimes perforates the sclera .

Sciera The white outer coat of the eye, visible through the transparent conjunctiva. The sclera is composed of dense, fibrous tissue formed from collagen, which is strong and protects the inner structures of the eye from injury. It may, however, be penetrated by sharp objects. Disease of the sclera is uncomm on, but scleritis (inflammation of the sclera) may occur, usually with a collagen disease such as rheumatoid arthritis. The healthy sclera sometimes shows a blue tinge from the underlying choroid. If the sclera is exceptionally thin, which occurs in osteogenesis imperfccta, this blue appearance is striking. LOCATION OF THE SCLERA

The sclera is about one seventieth of an inch thick and continuous with the cornea at the front of the eye. It is extremely tough .

s

SYMPTOMS AND SIGNS

The number and the severity of symptoms varies dramatically . The most common symptom is Raynaud's phenomenon, a painful, three-color (white, red, blue) response of the hands and/or feet to cold exposure; it may be present for many years without any other symptoms. Also common are changes in the skin (especially of the face and fingers), which becomes shiny (as if it had been waxed), tight, and thickened. There is often puckering around the mouth, giving the sufferer a characteristic masklike appearance. The pulled skin often leads to difficulty performing certain maneuvers, such as bending the fingers or opening the mouth. In some people, other parts of the body are affected, leading to problems such as difficulty swallowing, shortness of breath, palpitations, high blood pressure, joint pain, stiffness, and muscle weakness. There are wide variations from person to person in the degree to which different parts of the body arc involved and the rate at which the disease progresses. Progression is often rapid in the first few years and then slows down or even stops. In a small number of people, degeneration is rapid, usually leading to death from heart failure , respiratory failure, or renal failure. DIAGNOSIS AND TREATMENT

Scleritis Inflammation of the sci era (white of the eye) . Scleritis usually accompanies a collagrn disease, such as rheumatoid arthritis. It also occurs in herpes zoster ophthalmicus, and in Wegener's granulomatosis, when it may lead to areas of local thinning and possible perforation of the sclera. Scleritis is fersistent, but often responds we! to corticosteroid eye drops. In severe cases, these drugs may increase the risk of perforation. 886

A physical examination is usually sufficient to confirm the diagnosis, but a blood test and a skin biopsy (removal of tissue for microscopic examination) may be performed. There is no cure fur scleroderma, but treatment ca n relieve symptoms and associated problems. Vasodilator drugs and avoiding exposure to cold can relieve Raynaud's phenomenon. Physical therapy may be recommended for joint problems. A11tihypcrtensivc drugs may be given to treat high blood pressure and dialysis may be undertaken for renal failure. Corticosteroid drngs are sometimes prescribed if the muscle is involved.

Sclerosis A medical term for hardening of a body tissue. It is usually used to refer to hardening of blood vessels, as in atherosclerosis (hardening of arteries), or to hardening of nerve tissue due to deposition of abnormal connective tissue, which occurs in the later stages of multiple sclerosis.

Sclerotherapy A method of treating varicose veins (distended, tortuous veins), especially in the legs. Hemorrhoids (varicose veins in the anus) and esophageal varices (swollen veins at the bottom of the esophagus that may bleed) are sometimes treated this way. The vein is injected with a strongly irritating solution (called a sclerosant). This causes inflammation in the lining of the vein, blocking it, and eventual fibrosis (scar tissue formation), which leads to the vein's obliteration. For a varicose vein in the leg, the process is assisted by first emptying the vein of blood . After injection, firm pressure is applied so that the walls of the vein are pressed together. Compression is maintained by tight bandaging.

Scoliosis A deformity in which the spine is bent to one side. The thoracic (chest) or lumbar (lower back) regions are the most commonly affected. TYPES AND CAUSES

Scoliosis usually starts in childhood or adolescence and progressively becomes more marked until the age at which growth stops. In many such cases, another part of the spine curves toward the opposite side ofthe body to compensate for the scoliotic curvature, resulting in the spine becoming S-shaped. The cause of juvenile scoliosis is unknown; if the condition is not corrected, it may lead to severe deformity. More rarely, scoliosis develops as a result of a congenital abnormality llf the vertebrae, poliomyt!litis that has

SCUBA-DIVING MEDICINE

weakened the spinal muscles on one side of the body, or tilting of the pelvis due to one leg being shorter than the other. Occasionally, a spinal injury (such as a disk prolapse or ligament sprain) causes temporary scoliosis. In such cases, the spinal curvature appears suddenly and is accompanied by back pain and sciatica. DIAGNOSIS AND TREATMENT

Scoliosis is diagnosed by a physical examination of the spine, hips, and legs, along with X rays of the spine. lf the cause of the condition is known, treatment is directed toward that cause (e.g., bed rest for a disk prolapse or wearing an orthopedic shoe with a raised heel to correct a pelvic tilt due to unequal leg lengths). Scoliosis of unknown cause may not require treatment if the curvature is slight. However, regular measurement of the spine is necessary to assess the progress of the condition. If it seems to be worsening-or if the curvature is already marked-it may be treated by immobilization of the spine in a hinged plaster jacket or adjustable metal brace, followed by surgery and bone grafting to fuse the affected spinal vertebrae in a straight line (see Spinal fusion). A steel rod with hooks or some other metal device may be used to keep the spine straight until the bones become fused.

Scopolamine An antispasmodic drug used to treat irritable bowel syndrome, nausea, and motion sickness. Scopolamine is also a premedication (drug given to prepare a person for surgery). Adverse effects may include drowsiness, dry mouth, and blurred vision.

SYMPTOMS

The effects of many types of scorpion stings are little worse than a bee sting, with mild to moderate pain and tingling or burning at the site of the puncture wound. With more dangerous species, there may be sweating, restlessness, diarrhea, and vomiting (caused by stimulation of the autonomic nervous system) in addition to severe pain. The venom may also affect the rhythm and strength of the heart's contractions. Fatalities are uncommon in adults; young children and the elderly are at greater risk. TREATMENT

Any person stung by a scorpion should seek immediate medical attention. For children, or if there are symptoms other than pain, admission to the hospital is advisable. If pain 1s the only symptom, mild analgesics (painkillers) and cold compresses may be all that is needed. In severe cases, local anesthetics and powerful painkillers may be required, and an antivenin to deactivate the venom may be given by intravenous infusion. Antivenins active against the venoms of local, dangerous types of scorpions are available in most parts of the world where such species exist. PREVENTION

In areas where scorpions are common, clothes and footwear should be shaken out before being put on. Scorpions can be discouraged from entering a house by barriers, such as a porch elevated at least 8 inches above the ground.

Scotoma

disease are lessened by diagnosis before symptoms develop. (See also

Cancer screening.)

Scrofula Tuberculosis of the lymph nodes in the neck, often those just beneath the angle of the jaw. Scrofula was once a common disorder, usually caused by the drinking of contaminated milk. Abscesses would form in the lymph nodes and, after bursting through the skin, leave scars on the neck. Today scrofula is rare in developed countries. It occasionally develops in Asian or African immigrants in whom the infection has spread from tuberculosis elsewhere in the body. Antibiotic drugs clear up the condition in most cases.

Scrotum The pouch that hangs below the penis and contains the testes. The scrotum consists of an outer layer of thin, wrinkled skin over a layer of musclecontaining tissue. Swelling of the scrotum may be caused by an inguinal hernia, a swelling of one of the testes, a hydrocele (a fluid-filled sac around one of the testes), or, in severe heart failure, edema (fluid retention). LOCATION OF THE SCROTUM

The scrotum has oil-secreting glands and thinly scattered hairs on its surface. Internally it is divided by a membrane into two halves, each containing a testis. Vas deferens

An area of abnormal vision within the

J,,

visual field .

Scorpion stings

Screening

Scorpions are eight-legged crea_ture~ with ~exible tails endmg m a p01son reservoir and a sharp stinger. They are present in most warm regions of the world and are nocturnal, spending the day in dark crevices under rocks and in the loose bark of trees. Sometimes scorpions enter human habitation and crawl into shoes or clothing. If accidentally disturbed, a scorpion is likely to sting, which is achieved by arching its tail over its back. Some highly venomous species are found in Mexico, North Afnca, South America, parts of the Caribbean, and India. About40 species exist in the US, but only one, found in southern states, is dangerous to humans.

The testing of apparently healthy people with the aim of detecting disease at an early, treatable stage. The ideal screening test is reliable, with a low rate of false-positive results (the results of the test are positive even though the people tested do not in fact have the disease) and a low rate of false-negative results (the results of the test are negative even though the people tested have the disease). An ideal test is also inexpensive, simple, and acceptable to people, causing neither discomfort nor danger. For a screening test to be of practical use, people found to have the disease must benefit from early diagnosis. Screening for unsuspected diabetes is of no use since there is no evidence that the late complications of the

,,,,' ,'

,,,,''

s

:,

I I I, I I I,

,, f '; /

Penis

Scuba-diving medicine A minor medical specialty concerned with the physiological hazards of underwater diving with self-contained underwater breathing apparatus (S.C.U.B.A.). 887

SCURVY

Amateur divers breathe compressed air, which consists mainly of nitrogen and oxygen. These gases are harmless at surface pressures (oxygen is essential to life), but they become toxic at high pressure. Nitrogen impairs the nervous system when air is breathed at depths from about 80 feet (24 m) downward, causing slowed mental functioning and other symptoms that mimic alcohol intoxication (nitrogen narcosis). Oxygen becomes toxic when air is breathed at about 260 feet (80 m), when it can cause convulsions or lung damage. To attain greater depths without risking nitrogen and oxygen poisoning, professional divers use gas mixtures other than air. A typical mixture consists of helium, witn only small amounts of oxygen and nitrogen; the helium is relatively nontoxic. THE BENDS At depth, divers accumulate in their tissues excess quantities of any inert gas they are breathing (nitrogen, if air is being breathed). If pressure is released too quickly (i.e., the diver ascends too fast) and if a large amount TOXIC EFFECTS OF GASES

THE MAIN HAZARDS

Most diving hazards stem from the increase in pressure with depth . At a depth of 33 feet (10 m), the total pressure is twice the surface pressure. At 99 feet (30 m), it is four times the surface pressure. MECHANICAL EFFECTS OF PRESSURE CHANGE

During descent, divers must introduce gas into their middle-ear cavities and facial sinuses to prevent damage as the pressure mounts. This mounting pressure is what airline passengers experience during descent and repressurization (see Barotrawna). Whatever depth they attain, divers must be supplied with breathing mixtures at a pressure equal to the external water pressure. Thus, at 99 feet (30 m), a diver breathes gas at four times the surface pressure. During ascent, gas in the lungs expands and can rupture the lung tissues if the diver panics and inadvertently holds his or her breath- a serious condition known as pulmonary barotrauma (burst lung). Symptoms may include coughing up blood, inability to urinate, breathing difficulties, and unconsciousness.

RECOMPRESSION CHAMBER FOR DIVING ACCIDENTS Divers suffering from the bends or other pressure- related ac cidents are often treated in a recompres sion

chamber. The patient is usually accompanied in the recompression chambe r by a physician.

of gas has accumulated because the diver remained at depth for too long, this gas can no longer be held in the tissues and may form bubbles, causing

decompression sickness. Additional hazards include hypothermia (dangerous chilling) due to immersion in cold water, bites or stings from marine animals (see Bites, animal; Ve110111ous bites and stings), and risk of drowning. OTHER HAZARDS

ACCIDENT PREVENTION AND TREATMENT

Any person taking up scuba diving should first receive a medical checkup and undergo thorough training at a recognized diving school. Pressure-related accidents, such as burst lung and decompression sickness, are treated by recompression of the diver in a special pressure chamber so that any bu6bles or pockets of gas in the blood or tissues arc reabsorbed . This is followed by slow release of the pressure. Treatment of other accidents (such as hypothermia and near drowning) is as for nondivcrs .

Scurvy A disease caused by inadequate intake of vitamin C. Scurvy is rare today in developed countries as a result of increased consumption of fresh fruit and vegetables. Body stores of vitamin C give protection against scurvy for about three months. CAUSES AND SYMPTOMS

s

Sealed entrance hatch

Physician

How it works A gas mixture (usually air) is pumped into l he c hamber As pressure increases, bubbles (pockets of gas) in the diver's

888

Supply of air or othe r gas mixture under pressure

tissues are reabsorbed. and symptoms disappear. Once all symptoms have gone. the pressure is slowly released

Inadequate supplies of vitamin C disturb the body's normal production of co/lage11 (connective tissue) . Collagen continues to be produced but it is unstable, causing weakness of small blood vessels and poor healing in wounds. Hemorrhages may occur anywhere in the body. They are most obvious in the skin, where they result in widespread bruising. Bleeding from the gums and loosening of the teeth are common; bleeding into muscles and joints also occurs in scurvy, causing pain. Scurvy is especially serious in children because bleeding into the membranes surrounding the long bones may cause separation of the growing ends of the bones and interference with growth. Major, and sometimes fatal, hemorrhages into and around the brain can occur. Scurvy is often associated with other vitamin deficiencies and anemia is common. PREVENTION AND TREATMENT

A modest intake of fruit (particularly citrus fruit) and vegetables provides the body with sufficient vitamin C to

SECURITY OBJECT

prevent scurvy. Other sources are milk, liver, kidneys, and fish. Scurvy is treated with large doses of vitamin C. Bleeding stops in 24 hours, healing resumes, and muscle and bone pain quickly dissipate.

Sealants, dental Plastic materials applied to the chewing surfaces of the molars and premolars to help prevent decay. Back teeth have minute surface grooves in which food debris and bacteria can collect and cause decay (see Caries, dental). Sealing the teeth stops harmful material from getting into the grooves. Sealants are of the most benefit to children and should be applied as soon as possible after the permanent teeth have erupted. Teeth to be sealed often require no drilling or anesthesia. The tooth surface may be acid-etched to roughen it so that the sealant will adhere better (see Bonding, dental). The semiliquid sealant is then applied and is usually hardened by directing a narrow beam of intense light at the treated tooth for a few seconds. Some sealants arc premixed with a chemical activator that causes them to set.

which case they are very painful. Large cysts or cysts that have been infected should be removed using local anesthetic. The physician makes a small incision in the skin and removes the cyst. If the entire cyst wall is removed, recurrence is rare.

when immersed in water or cracked when exposed to a dry atmosphere. Sebum also protects the skin from invasion by bacteria and fungi. Oversecretion causes a greasy skin, called seborrhea . It may lead to seborrheic dermatitis or acne vulgaris.

Sebaceous glands

Secobarbital

Minute glands in the skin that secrete a lubricating substance called selnan. Sebaceous glands either open into hair follicles or discharge directly onto the surface of the skin. They are most numerous on the scalp, face, and anus; they do not occur on the palms of the hands or soles of the feet. The production of sebum by the sebaceous glands is partly controlled by androge11 fwrmoncs (male sex hormones). Disorders of the sebaceous glands may lead to seborrhea, seborrheic dermatitis, or arne vulgaris.

A barbiturate drug sometimes used as a premedicatio11 (drug given to prepare a person for surgery) because of its sedative effect. Secobarbital is seldom used today as a sleeping drug because of its short-lived action and the risk of drug depC11de11ce. Other possible adverse effects include daytime drowsiness, clumsiness, dizziness, confusion, and rash.

Cross section of skin showing sebaceous gland

Sebaceous gland

Seasickness A type of motion sickness.

See SADS.

Sebaceous cyst Seborrhea Excessive secretion of sebum, causing increased oiliness of the face and a greasy scalp. The exact cause is uncertain, although a11droge11 lzon11011es (male sex hormones) are known to play a part. The condition is most common in adolescent boys. Seborrhea usually disappears by adulthood without treatment. However, people with seborrhea are more likely than the average to have other skin conditions, particularly seborrheic dermatitis and acne vulgaris.

Seborrheic dermatitis See Dermatitis.

Sebum Massive sebaceous cyst Cyst s rarely grow as large as this one. located on the back of the neck. Cysts are harm less and easily removed surgicall y.

A term applied to a disease or disorder that results from or follows another disease (which is called the primary disease). For example, secondary hypertension (high blood pressure) occurs as a result of some underlying primary disorder, such as a hormona1 or kidney disease. The term secondary is also used to refer to a metastasis (a malignant tumor that has spread from a primary cancer to affect another part of the body).

Secretion

Seasonal affective disorder syndrome

A nonspecific term for a large, smooth nodule under the skin (also called a wen when it is on the scalp). The most common sites of sebaceous cysts are the scalp, face, ear, and genitals. Although harmless, sebaceous cysts may grow very large and sometimes become infected by bacteria, in

Secondary

The oily secretion produced by the sebaceous glands of the skin. Sebum is composed of fats and waxes; it lubricates the skin, keeps it supple, and protects it from becoming sodden

The manufacture and release by a cell, gland, or organ of chemical substances (such as e11zymes or hormo11es) that are needed for metabolic processes elsewhere in the body. In contrast, excrctio11 is the production and release of waste products. The term secretion is also used to refer to the secreted substances themselves. The secretions of exocri11e glands (e.g., the salivary glands) are carried away in ducts; the secretions of endocrine glands (e.g., the thyroid) are released directly into the bloodstream.

Security object A significant item, such as a special blanket, an old garment, or a favorite soft toy, that provides comfort and reassurance to a young child. In many cases, a child settles down to sleep more easily if his or her security object is near. Some children are unable to sleep without their security objects. Sometimes referred to as transitional objects, these items represent to the child something partway between a person and a thing. The child may become deeply attached to the object and may become highly distressed if an attempt is made to remove it. 889

s

SEDATION

Security objects are often important during the toddler stage and may be used for several years. Most children grow out of the need for such an item by the time they are 7 or 8 years old, but close attachments to special toys may persist. There is no evidence that security objects are in any way harmful. (See also Thumb-suckmg.)

Sedation The use of a drug to calm a person. Sedation is used to reduce excessive anxiety and occasionally to control dangerously aggressive behavior. It may also be used as part of premedication to produce relaxation before an operation or before an uncomfortable procedure such as gastroscopy. (See also Sleeping drugs.)

Sedative drugs

Seizure A sudden episode of uncontrolled electrical activity in the brain. If the abnormal activity remains confined to one area, the person may experience tingling or twitching of only a small area of the body, such as the face or an extremity. Other possible symptoms include hallucinations or intense feelings of fear or familiarity (deja vu). If the abnormal electrical activity spreads Each numbered trace shows changes in elect ric potential between two poi nts on the skull surface.

s 4

2

2

3 4 No rmal trac es

Abnormal traces d uring seizure

EEG changes during a seizure The traces are record ings of electrical activity in a patient's brain , obtained from electrodes placed at various locat ion s on the scalp and linked to an EEG machine . They show the change in activity at the onset of a seizure.

890

Seizure, febrile Twitching or jerking of the limbs with loss of consciousness occurring in a child after a rapid rise in temperature. Febrile seizures are common; about one child in 20 experiences one or more attacks. The seizures tend to run in families, are usually not serious, and occur mainly in children between 6 months and 5 years. CAUSES AND SYMPTOMS

A group of drugs used to produce sedation (calmness). Sedative drugs include sleeping drugs, antianxiety drugs, antipsychotic drugs, and some antidepressant drugs. A sedative drug is often included in a premedication (drug given to prepare a person for surgery).

3

throughout the brain, consciousness is lost and a grand ma/ seizure results. Recurrent seizures are called epilepsy. Seizures may be caused by many different neurological or medical problems, including head injury, infection, cerebrovascular accident (stroke), brain tumor, metabolic disturbances, or alcohol (withdrawal or hereditary intolerance of alcohol).

Febrile seizures are caused by a disturbance in the normal electrical activity in the brain, but in most cases there is no underlying brain disorder. The fever that triggers the seizure usually develops with an acute infectious illness, such as tonsillitis or otitis media (inflammation of the middle ear). The child loses consciousness and his or her arms and legs twitch uncontrollably for a few minutes. After regaining consciousness, the child may be drowsy. TREATMENT

During a seizure, objects that could be harmful should be moved out of the child's way. Biting the tongue is rare and absolutely no attempt should be made to prevent it by wedging the mouth open. This can cause cuts and broken teeth. Once the seizure is over, the child should be placed in the recov-

ery position. If the child has not had a seizure before, a physician should be consulted; if the seizure lasts for more than five minutes, an ambulance should be called. If something other than a fever is suspected of causing the seizure, the physician may perform investigative tests, such as a lumbar puncture to determine whether meningitis is the cause. No treatment is needed for the seizure, but treatment may be given for the underlying infection.

package. The dose can be repeated every four hours. Bedclothes should be removed and a fan directed toward the child. Sponging the child's face and body with lukewarm water may be comforting but is of dubious value in lowering temperature. Most children who have one or more febrile seizures are completely normal and suffer no ill effects from the attacks. A second febrile seizure occurs in about 30 to 40 percent of cases, usually within the following six months. Recurrences are more likely if the child is abnormally mentally developed, if there was a complex or prolonged (longer than 15 minutes) first febrile seizure, and if there are family members with epilepsy. Children with all of these handicaps have about a one in 10 chance of having epilepsy develop. In healthy children, the risk of epilepsy is small.

Selenium A trace element that helps preserve the elasticity of body tissues, thereby slowing the aging process. Selenium also improves the oxygen supply to the heart and helps form prostaglandins (substances that help prevent abnormal blood clotting and high blood pressure). A balanced diet supplies the minute amount of selenium required by the body. The richest dietary sources are meat, fish, whole grains, and dairy products. The selenium content of vegetables depends on the amount of the mineral in the soil in which they were grown. DEFICIENCY AND EXCESS

Neither deficiency nor excess of selenium usually has any effect on health. However, prolonged selenium deficiency-as a result of a poor diet or subsistence on vegetables grown in selenium-poor soil-may possibly cause premature aging, muscle pain, and, eventually, heart disease. Excessive intake as a result of taking supplements or, rarely, from eating vegetables grown in soil with an abnormally high selenium content (as is found in some intensively irrigated areas) may cause baldness, loss of nails and teeth, fatigue, vomiting, and, with massive doses, death.

PREVENTION AND OUTLOOK

MEDICAL USES

If an infectious illness develops in a susceptible child, parents can prevent further seizures by reducing the child's temperature. Acetaminophen should be given immediately at the first signs of fever at the full dose for the child's weight given on the

Selenium is a constituent of some multivitamin and mineral preparations. Selenium sulfide is used in some antidandruff shampoos.

Self-help organizations See special section at back of book.

SENSATE FOCUS TECHNIQUE

Self-image An individual's view of his or her personality. Some psychologists believe that neurosis stems from incongruity between self-image and how others see one (as occurs in an inferiority complex). Psychotherapy treats neurosis by bringing about a change in the person's perception of the self.

is measured and the specimen examined under the microscope. Normal semen contains from 20 million to 200 million sperm per milliliter. Semen analysis may show a deficiency in the number of sperm (oligosper111ia), a complete absence of sperm (azoospermia), altered shape, or diminished motility.

Self-mutilation

Semen, blood in the

The act of deliberately miunng oneself. Self-mutilation usually takes the form of cutting the wrists or burning the forearms with cigarettes. It most often occurs in young adults with personalitlj disorders, many of whom are afso drug or alcohol abusers, and is three times more common in women. Self-mutilators often have had a violent upbringing and may also suffer from mental retardation. The reasons self-mutilators give for their behavior include aggressive impulses, relief of tension, and sadomasochistic fantasies. More unusual forms of self-harm, such as gouging out the eyes or mutilating the genitals, are almost always due to psychosis. Self-destructive biting is a feature of Lesch-Nyhan syndrome, a rare metabolic disorder that causes gout and mental retardation.

A harmless condition, also called hemospermia, in which a small amount of blood is present in the semen. The blood, which is usually seen as a darkish stain in the semen at ejaculation, usually comes from small blood vessels in the region of the prostate gland or seminal vesicles. In the majority of cases, no cause is found.

Semen Fluid produced by the male on ejaculation. Semen is composed of fluid from the seminal vesicles (which produce the greatest part of the semen volume), fluid from the prostate gland, and sperm. An important constituent of the fluid from the seminal vesicles is fructose (a sugar), which stimulates the sperm to become mobile. The concentration of fructose, the production of sperm, and the volume of the semen is dependent on the presence of the male sex hormone testosterone. Semen analysis is performed as part of the investigation of male infertility.

Seminoma See Testis, cancer of.

Senile dementia See Dementia.

Senility Changes in mental ability caused by old age. Most people over age 70 suffer from some degree of impaired

a Senna

A laxative drug obtained from the leaves and pods of the Arabian shrubs CASSIA ACUTIFOLIA and CASSIA ANGUSTIFOLIA. Senna stimulates bowel contraction and is used to treat severe constipatio11; it may color the urine yellow-brown or red.

Sensate focus technique A method taught to couples who are experiencing sexual difficulties caused by psychological rather than organic factors. The aim of the technique is to make each partner more aware of his or her pleasurable bodily sensations as well as those of the partner, and to reduce anxiety about performance. Sensate focus technique is farticularly useful in treating 1oss o sexual desire, failure to become sexually

STEPS IN THE SENSATE FOCUS TECHNIQUE The technique is useful in treating a variety of sexual problems, including

impotence and difficulties in reach ing orgasm.

In the first stage (left), each partner 1 gives the other as much pleasure as possible by caressing any part of the body other than the breasts or genitals.

s 2

The second stage (above) progresses to stimulation of the genitals and breasts but stops short of orgasm. Intercourse is still not permitted at this stage .

Semen analysis A method of determining the concentration, shape, and motility (ability to move) of sperm. Semen analysis is imyortant in the investigation of male infertility. It is also performed some weeks after vasectomy (male sterilization) to ensure that the semen no longer contains sperm. The semen specimen is produced by masturbation and should be as fresh as possible for successful analysis in the laboratory. The volume of semen

memory and reduced ability to concentrate. With age, there is an increasing risk of dementia, which affects about one in five of those over 80. Depressive illness (see Depression) and confusion due to physical disease are also common, but there is a reduced prevalence of neurotic illness.

3

The final stage consists of sexual intercourse . Both partners concen-

trate on enjoyment rather than on orgasm, which is not the main goal.

891

SENSATION

PRINCIPAL SENSORY PATHWAYS INTO THE BRAIN Eyes Muscle and joi nt receptors

Balance organs in ears Coch leas in ears Internal organs

L-D

:J

Lo



□ □

Nose

Destinations of sensory information Some of the information entering the brai n passes vi a the brain stem and/or thalamus lo the cerebral cortex (outer su rface of the

aroused (see Sexual desire, inhibited), or inability to achieve orgasm (see Orgasm, lack of), and in helping overcome impotence or premature ejaculation (see Ejaculation , disorders of). HOW IT JS DONE

The technique, which should ideally be practiced in a relaxed, romantic or erotic setting, has three stages (see illustrated box on previous page). If premature ejaculation is a problem, one of the techniques to prevent it can be used (see Sex therapy). EFFECTIVENESS

The sensate focus technique has an extremely high success rate- between 80 and 98 percent, depending on the sexual problem.

Sensation A feeling or impression (such as a sound, an odor, touch, or hunger) that has entered consciousness. The senses are the faculties by which information about the external environment and about the body's internal state is collected and brought to the central nervous system (brain and spinal cord). SENSORY RECEPTORS

Information is collected by millions of microscopic structures (called receptors) throughout the body. Receptors are found in the skin, muscles, and joints, in the internal organs, in the walls of blood vessels, and in special sense organs, such as the eye and inner ear. Receptors are attuned to a

Vision

Thalamus

8 □ □

BJ □ □

Position Hearing

]

Pain, temperature, touch

~ainstem

Tongue

892

~



Skin

s

□Cerebellum

Sensory area of cerebral cortex

Limbic system

□ □

□ □

Taste

□ brai n). where sensations are perceived . Other information does not lead to con scious sensation. This includes certain data about body

posture , processed in the cerebellum , and about internal body functioning , processed in the brai n stem.

particular stimulus, such as light of a particular wavelength, chemical molecules of a certain shape, vibration, or temperature. They fire (send an electrical signal) when excited. Some receptors arc the terminals (free nerve endings) of long nerve cell fibers, others are specialized cells that connect to such fibers . When a receptor fires, a signal passes along the appropriate nerve fiber to the spinal cord, to the brain, or to both. The principal pathways and destinations of sensory information entering the brain are shown in the diagram above. Only a proportion of this information reaches sensory areas of the cerebral cortex (outer surface of the brain) and is consciously perceived (see Sensory cortex; Brain) .

and temperature sensations. Proprioception relies on receptors in the muscles and joints to provide information on the position in space of parts of the body. Pain is one of the most primitive senses; it warns of noxious stimuli through receptors at the skin surface and inside. Many types of receptors are found in the skin. Some are sensitive to pressure, others to the movement of hairs, others to temperature change. Skin receptors are made up of the terminals of nerve fibers, which are wrapped around the roots of hairs, formed into disks, or surrounded by a series of membranes to form onionlike structures (called pacinian corpuscles). Different patterns of stimulation of these receptors give rise to such sensations as pain, tickling, firm ?r lig~t pressure, heat or cold. Certam skm areas (the lips, palms of the hands, and genitals) have a particularly high concentration of receptors. Most of the signals from these receptors pass, via the cranial or spinal nerves and tracts in the brain or spinal cord, to the thalamus and then to two regions of the sensory cortex called the somatosensory cortices. Sensations perceived at certain points within these regions correspond to the parts of the body from which the signals originated. Much larger areas of cortex are devoted to sensations originating from the hands and lips than from less sensitive parts.

THE SPECIAL SENSES

The special senses include vision, hearing, taste, and smell. The receptor cells for these senses are collected into special organs- the retina in the eyes, the auditory apparatus in the ears, the taste buds in the tongue, and the apparatus for smell in the nose. Information from these organs passes directly to the brain via cranial nerves. Much of the information passes to the cerebral cortex, although some goes to other areas of the brain (e.g., from the eyes to the cerebellum, where it is used to help maintain balance). INTERNAL AND TOUCH SENSES

These senses include the pain, proprioception (position), pressure,

SEPARATION ANXIETY

Sensation, abnormal Unpleasant, dulled, or otherwise altered sensations without obvious stimulus (e.g., a burning sensation when there is no heat). Abnormal sensations result from damage to, or pressure on, sensory nerve pathways. TYPES AND CAUSES

The most common types are tinnitus or numbness and/or a pins and needles sensation, sometimes combined with pain and, in some cases, with coldness or burning sensations. Neuralgia is characterized by pain with a stabbing, brief, repetitive quality. More unusual disturbances include the feeling that fluid is trickling down the skin, tnat part of the body is being constricted by a tight band, or that insects are crawling over the skin (formication). The special senses can also be impaired or altered by damage to the relevant sensory apparatus or nerve tracts (see Vision, disorders of;

Smell; Deafness; Tinnitus). Neuropathy (damage to peripheral nerves) from thiamine deficiency in alcoholics, from diabetes mellitus, or from heavy metal (such as lead) poisoning is a common cause of abnormal sensation. The sufferer may complain of tingling or a feeling of walking on cotton. The peripheral nerves may also be damaged or irritated by infections such as fierpes zoster (shingles) or by a tumor pressing on a nerve, often causing severe pain. Spinal injury, head injury, stroke, and multiple sclerosis are other causes of damage or degeneration of nerve pathways in the brain or spinal cord.

Damage to the thalamus (a relay station for sensory pathways in the center of the brain) can produce particularly unpleasant results, such as a spreading sensation resembling an electric shock that occurs after a simple pinprick. Damage to the parietallobe in the brain can lead to loss of the ability to locate or recognize objects by touch. DIAGNOSIS AND TREATMENT

Many tests (including tests of sensation, testing of reflexes, blood tests, urinalysis, and CT scanning or angiography) may be required to discover the cause of abnormal sensation. Pressure on or damage to nerves can sometimes be relieved by surgery or by dietary or other treatments to remove or treat the underlying cause. In other instances, severe intractable pain or other abnormal sensation can be relieved only by cutting the relevant sensory nerve fibers or by giving injections to chemically block the transmission of signals along them.

Senses See Sensation.

Sensitization The initial exposure of a person to an allergen or other substance recognized as foreign by the body's immune system, which leads to an immune response. On second and subsequent exposures to the same substance, there is a much stronger and faster immune reaction. This action forms the basis of allergy and other types of hypersensitivity reaction.

NEUROLOGIC SENSORY TESTING

A region of the outer part of the cerebrum (the main mass of the brain) in which sensory information comes to consciousness. The sensory cortex contains several layers of interconnected neurons (nerve cells) with complex interconnections. Pressure, pain, and temperature sensations from the skin, muscles, joints, and internal organs are perceived in regions of the parietal lobe (upper side part of the cerebrum) on both sides of the brain. These regions are called the somatosensory cortices. Taste sensations are also perceived in the parietal lobes. Light, color, shape, and other visual sensations are perceived in the occipital lobes at the back of the cerebrum; sounds are perceived in the temporal lobes at the sides.

Sensory deprivation Removing the normal sights, sounds, and physical feelings from a person. Sensory deprivation can produce a variety of mental changes, demonstrated by studies in which volunteers lie immobile in bed (or in a tub of warm water) wearing masks and gloves in a sound-deadened room. After long periods, reported effects generally include feelings of unreality, difficulty thinking, and hallucinations; EEG recordings show a slowing of brain activity. Prisoners kept in solitary confinement experience similar symptoms, and infants deprived of the companionship and presence of others tend to be disturbed in later life. (See also Bonding; Emotional deprivation.)

Separation anxiety

Light touch With the patient's eyes closed, a piece of cotton is brushed lightly across the face.

Vibration A vibrating tuning fork is held against a prominent bone, such as the ankle bone or mastoid bone.

Pinprick The prick tests pain sensation and may be repeated at different locations on the patient's body.

Position sense The patient, with eyes closed, tells in which direction his or her finger is moved.

Pain pinch ~ Pain sense may be further tested by pinching the Achilles tendon at the back of the heel.

· ·

,. .

·

Two-point discrimination Measures ability to ,,. · distinguish two pinpricks .. , ✓• from a single prick. .... .--.

_._. :::

Standard tests When examining a patient's nervous system, a physician usually includes several standard

Sensory cortex

tests of touch, position, pain, and vibrat ion senses, such as those above .

The feelings of distress that a young child experiences when parted from his or her parents or home. Separation anxiety is a normal aspect of infant behavior that increases in intensity until about 2 years of age, but is often minimal by 3 to 4 years. When threatened with separation, the child usually reacts by crying, clinging to the parent, and demanding to be cuddled . Such signs are indicative of bonding, which is considered essential to a child's emotional development. Separation anxiety disorder is a childhood illness in which the reaction to separation is greater than that expected for the child's level of development. The anxiety may manifest itself in the form of headaches, nausea, toothaches, dizziness, or difficulty sleeping. When separated, the child may worry that he 893

s

SEPSIS

or she will never be reunited with the parents or that they will be killed. Some children refuse to visit friends or attend school. Separation anxiety disorder may be a feature of depression.



percent of all cases of congenital heart disease and affecting about 200 babies in every 100,000. Atrial septa) defects occur in about 8 percent of cases (50 babies per 100,000). SYMPTOMS AND SIGNS

Sepsis Infection of a wound or body tissues with bacteria that leads to the formation of pus (see Suppuration) or to multiplication of the bacteria in the bloocf. If the blood becomes infected with bacteria that the immune system can eradicate entirely or prevent'from multiplying excessively, the condition is known as bacteremta. However, if bacteria that form toxins are present in the blood in large numbers and are multiplying rapidly, the condition (as a result of the toxemia and bacteremia) is called septicemia (blood poisoning). See also Septic shock.

Septal defect A heart abnormality, developed before birth, in which there is a hofe in the septum (partition) between the left and right sides of the heart. Commonly known as a hole in the heart, septal defect varies in its effects according to the size and position of the defect. TYPES

s

When the hole is in the septum separating the two ventricles (lower chambers of the heart), the abnormality is known as a ventricular septa) defect; when it is in the septum between the two atria (upper chambers), it is called an atrial septa) defect. In both types, the hole allows some of the freshfy oxygenated blood in the left half of the heart (which supplies tissue s throughout the body) to flow into the rignt half, mix with deoxygenated blood, and recirculate through the lungs. If the hole is large, the misdirection of blood results in a greatly reduced oxygen supply to the tissues and excessive blood flow through the lungs. Some children are born with both atrial and ventricular septa! defects; either type may be accompanied by one or more other heart abnormalities and/or other birth defects. CAUSES AND INCIDENCE

The precise cause of this defect is unknown in most cases. (For information on fa ctors influencing the development of congenital heart abnormalities, see Heart disease, congenital and Birth defects.) Ventricular septa) defects are the most common type of congenital heart abnormality, occurring in about 30

894

A small defect of either kind produces little or no effect. With a large ventricular hole, heart failure may develop six to eight weeks after birth, causing breathlessness, feeding difficulties, pallor, and sweating. With large atrial defects, however, heart failure may not develop for many years or may not develop at all. With both types of defect, pulmonary hyperte11sio11 (high blood pressure in the arteries supplying the lungs) may develop. This is more likefy, and occurs at an earlier age, in large ventricular defects. With ventricular defect there is also a slight risk of endocarditis (inflammation of the lining of the heart); in atrial septa) defect, atrial fibrillation (rapid, irregular beating of the atria) may occur after age 30. DIAGNOSIS

The diagnosis is made by a physician who hears, through a stethoscope, a heart murmur (a type of abnormal heart sound made by turbulent blood Ventricular septal defect Pulmonary '---1----,, _ _ artery

Pulmonary ,_.,,_ __ ve,ns

(iO,~·~ rtf'~- -

Deoxygenated blood

Oxygenated ---- blood · ·, -.---,--.c:."'

Hole in ventricular "----- septum

Atrial septal defect Pulmonary -==--:::=o~-artery Hole in atrial septum Oxygenated ----blood Deoxygenated "-.__blood

Two types of septal defect In both cases. oxygenated blood is forced from the left to the right side of the heart throug h the hole in the septum Too much blood passes Jo the lungs (via the pulmonary artery) and too little to the body tissues (via the aort a)

flow through the hole). Diagnosis also includes chest X rays and an ECG. The diagnosis can be confirmed by Doppler echocardiography. TREATMENT

Atrial septa) defects are repaired only if they cause symptoms or if examination and tests suggest that complications may develop. As the child grows, small ventricular holes often become smaller, or even close, on their own. If a large ventricular defect is causing heart failure, it is treated with diuretic drugs and with digitalis drugs in babies. If the hole does not close spontaneously, it is repaired by open heart surgery, usually before the child reaches school age. The operation has an extremely high safety and success rate. OUTLOOK

Modern surgery is so effective in dealing with large septa) defects that it enables most affected people to lead normal lives.

Septicemia Rapid multiplication of bacteria and the presence of their toxins in the blood, a condition commonly known as blood poisoning. As distinct from bacteremia (in which bacteria are present in the blood but do not always multiply), septicemia is always a serious, life-threatening condition. CAUSES

Septicemia usually arises through escape of bacteria from a focus of infection somewhere in the body (such as from an abscess or from a urinary tract or intestinal infection, or because of pneumonia or meningitis). Septicemia is more likely in people whose natural resistance to infection has been lowered by an immunodeficiency disorder or by immunosuppressant drugs, allowing the bacteria to multiply unchecked. SYMPTOMS AND SIGNS

A person in whom septicemia develops suddenly becomes seriously ill, with a high fever, chills, rapid breathing, headache, and often clouding of consciousness. Skin rashes or jaundice may occur and sometimes the hands are unusually warm . In many cases, especially when large amounts of toxins are produced by the circulating bacteria, the person passes into a state of septic shock, a life-threatening condition. DIAGNOSIS AND TREATMENT

A diagnosis of septicemia can be confirmed, and the infective bacteria identified, by growing a culture of the organisms from a blood sample.

SERUM

Treatment is started as soon as septicemia is suspected by giving an intravenous infusion (slow introduction into a vein) of antibiotic drugs and of glucose and/or saline solution. The focal site of infection is sought immediately and may be surgically removed. Provided the infection is recognized and treated promptly, there is usually a full recovery.

Septic shock A highly dangerous condition in which there is tissue damage and a dramatic drop in blood pressure as a result of septicemia and toxemia (the multiplication of bacteria and the presence of their toxins in the blood). In many cases, the toxins are the main cause of trouble because they can cause damage to cells and tissues throughout the body, promote clotting of blood in the smallest blood vessels, and seriously interfere with the normal blood circulation. Damage occurs especially to tissues in the kidneys, heart, and lungs. The toxins may cause leakage of fluid from blood vessels and a reduction of the ability of the vessels to constrict, leading to a drop in blood pressure. CAUSES AND INCIDENCE

Septic shock is most common in people hospitalized with such major disorders as diabetes mellitus, cancer, or liver cirrhosis and who have a focus of infection somewhere in the body (often the intestines or urinary tract) that has led to septicemia. Progression to septic shock 1s especially likely in people who have an immunodeficiency disorder, in people taking immunosuppressant drugs for cancer, or in people given prolonged and inappropriate antibiotic treatment. Newborn infants are also particularly susceptible if septicemia develops. SYMPTOMS AND SIGNS

The symptoms vary with the extent and site of major tissue damage. Broadly, they are the same as in septicemia, with additional symptoms including cold hands and feet, often with cyanosis (blue-purple coloration) due to slowed blood How, a weak, rapid pulse, and markedly reduced blood pressure. There may be vomiting and diarrhea. A poor output of unne may indicate that damage to the kidneys is occurring and that there is a risk of renal failure. Heart failure and abnormal bleeding may also develop. TREATMENT

Septic shock requires immediate treatment, including the use of antibiotic drugs and sometimes surgery to

remove the focus of infection. Rapid fluid replacement by infusion and the maintenance of urine flow to prevent the effects of renal failure are other essential procedures. Measures are also taken to raise the blood pressure and to promote better blood supply to tissues. These measures include intravenous infusions and

oxygen therapy. Despite treatment, septic shock remains a grave condition; survival rates are no better than 50 percent.

Septum A thin dividing wall within or between parts of the body. The nasal septum is the sheet of cartilage and bone that separates the nostrils.

Sequela A condition that results from or follows a disease, disorder, or injury. The term is usually used in the plural (sequelae) to refer to the complications of a disease. The sequelae of a common cold may include bronchitis, sinusitis, and otitis media (inflammation of the middle ear).

Sequestration A term used in medicine to refer to a portion of diseased or necrotic (dead) tissue being separated from, or joined abnormally to, surrounding healthy tissue. The term usually refers to a complication of osteomyelitis (bone infection) in which part of a bone dies and becomes separated from healthy bone. Sequestration may also refer to a rare congenital abnormality of the lungs in which part of a lobe is not directly connected to a bronchus (airway) but may be connected to surrounding alveoli (air sacs).

Serology A branch of laboratory medicine concerned with analysis of the contents of blood serum (the clear fluid that separates from clotted blood). Various serological techniques are extremely useful in the diagnosis of infectious diseases. If a person has been exposed to a particular infectious organism, antibodies (proteins with a role in immunity) directed specifically against the organism appear in that person's serum some days after exposure. Their presence or absence in the blood can be detected by such laboratory techniques as immunoassay, including the ELISA test and radioimmunoassay. The absence of specific antibodies detected by serology may allow a physician to exclude a particu-

Jar infection as the cause of the illness; a rising level of antibody may give good evidence that a particular infection is present. In other cases, serological techniques are used to identify parts of infectious organisms (antigens) by studying the reaction between the antigens (obtained by culture of a specimen taken from a patient) and serum samples known to contain certain antibodies. A series of tests may be carried out in which the unknown antigen is added to various antiserums (preparations containing specific antibodies) in test tubes; a positive reaction is sometimes revealed by a color change. In addition to devising and carrying out such diagnostic tests, serologists may be involved in developing antiserums for passive immunizatzon. Serologists may also test blood samples for various genetically determined protein markers, including substances that determine blood groups. Such tests can help resolve paternity suits (see Paternity testing) or cases in which blood left at the scene of the crime can be compared with blood taken from suspects.

Serotonin A substance found in many tissues, particularly blood platelets, the lining of the digestive tract, and the brain. Serotonin has a variety of effects in the body. It is released from platelets at the site of bleeding, where it constricts small blood vessels, thus reducing blood loss. In the digestive tract, it inhibits gastric secretion and stimulates smooth (involuntary) muscles in the intestinal wall. In the brain, it acts as a neurotrans,nitter (a chemical involved in the transmission of nerve impulses between nerve cells). Serotonin is thought to be involved in controlling states of consciousness and mood; its action in the brain is disrupted by certain hallucinogenic drugs, notably LSD.

Serum The clear fluid that separates from blood when it clots. Serum does not contain blood cells or the protein (fibrinogen) in blood that helps form clots. Serum does contain salts, glucose, and other proteins (including various antibodies formed by the body's immune system to protect against infection). Serum prepared from the blood of a person (or animal) who has been infected with a microorganism usually

895

s

SERUM SICKNESS

contains antibodies that can protect against that organism if the serum is injected into someone else. This is called an antiserum, and its use forms the basis of passive immunization.

Serum sickness A short-lived illness that may develop about 10 days after injection with an antiserum of animal origin (e.g ., antirabies serum equine, obtained from horses). Serum sickness is a type of hypersensitivity reaction similar to an allergy. A similar illness can occur after taking certain drugs . CAUSES

s

Antiserums are preparations obtained from human or animal blood containing specific antibodies (substances with a role in immunity). Antiserums are sometimes given to protect against dangerous infections. When an antiserum is prepared from animal blood, a protein in the serum may be misidentified by the body's immune system as a potentially harmful foreign substance (antigen). In scrum sickness, the immune system produces antibodies that combine with the antigen to form particles called immune complexes. They are deposited in various tissues, stimulate more immune reactions, and lead to inflammation and symptoms. Certain drugs can cause a similar response, though the drug molecules probably combine with a protein in the blood or tissues before they are misidentified as antigens. Penicillin is the most important drug capable of causing serum sickness. Serum sickness is different from anaphylactic shock, another type of hypersensitivity reaction that can also develop in response to antiserums, drugs, and otner substances. Anaphylactic shock is a more severe, immediate reaction. SYMPTOMS AND TREATMENT

A week or two after exposure to the antiserum or drug, symptoms appear. There may be an itchy rash, pain in the joints, fever, and enlargement of lymph nodes. In severe cases, a state similar to shock, with low blood pressure, develops. All symptoms usually clear up within a few days provided (in the case of a drug) that its use is stopped . Soothing lotions can help relieve itching. The physician may prescribe a ,wnsteroidal anti-i11flm11111atory drug to relieve joint pain and an a11tihistami11e drug to shorten the duration of the illness. In severe cases, a corticosteroid drug may be prescribed.

896

People who have had serum sickness or anaphylactic shock should note the name of the injection or drug to which they are sensitive. Mention should also be made in the medical records to warn health care personnel against future use of the drug .

Sex Another term for gender and a commonly used term for sexual intercourse.

Sex change Radical surgical procedures, usually combined with sex hormone therapy, that alter a person's anatomical gender. Sex change operations are performed on transsexuals (see Transsexualism) or on people with ambiguous genitalia (see Pse11dohcr111aphroditis111; l--!crmaphroditism). WHY IT IS DONE

Sex change operations on transsexuals are performed to give the person a physical appearance that he or she believes coincides with his or her psychological gender identity. ~ex change operations on people with ambiguous genitalia (i.e., with external sex organs resembling those of the opposite sex) are performed to modify or improve the anatomical gender and thus provide a more defined sexual identity. HOW IT IS DONE

Sex change involves a series of major operations on the genitourinary tract carried out after hormone therapy and counseling. The male-to-female sex change is the more common procedure. Prosthetic breasts may be implanted to augment the breast growth that has resulted from hormone therapy. An operation removes the erectile tissue of the penis and repositions the urethra. The skin of the penis is used to make the lining for a vagina, which is created in the perineum. The testes are removed and the skin of the scrotum is used to make the labia. In the female-to-male sex change, a mastectomy is performed to remove the breasts. Afterward, removal of the uterus and ovaries is carried out. This may be followed by a penile graft, which involves constructing a new urethra by grafting an abdominal skin flap over a catheter; the graft and the surrounding skin are then separated to make a penis. The upper end is inserted into the perineum and the lower end is detacf1ed . AMBIGUOUS GENITALIA Operations are usually carried out in infancy . Babies with ambiguous genitalia are assigned TRANSSEXUALS

a sex as soon as possible after birth, given appropriate surgical and hormonal treatment, and reared as a member of the assigned sex. Operations on adults who have ambiguous genitalia are uncommon today. ln general, they are similar to those performed on transsexuals, with variations depending on specific anatomical problems. OUTLOOK

The degree to which transsexuals adjust to their new gender varies. Some make a complete adjustment but others are left with serious psychological problems. Hormone therapy may need to be continued for life to maintain secondary sexual characteristics such as body shape, hair distribution, and voice change. Female transsexuals can have intercourse but cannot conceive. Males cannot impregnate or ejaculate; they achieve an erection only with mechanical aids (e.g., penile impla11ts).

Sex chromosomes A pair of chromosomes that determines gender. !J0 Sex chromosomes are found in each of a person's cells along with 44 other chromosomes (autosomes). In women, the sex chromosomes are of similar appearance and are called X chromosomes. ln men, one sex chromosome is an X and the other, a smaller chromosome, is a Y. Thus, the normal sex chromosome complement for women is XX, and for men, XY.

'\f/

FUNCTION

Like all chromosomes, the X and Y chromosomes exert their effects in the body through the activities of their constituent genes . These genes contain the coded instructions for chemical processes within cells and aspects uf growth and development within the body as a whole. The X and Y chromosomes differ in one fundamental way . Genes on the Y chromosome are concerned solely with gender. Their presence ensures a male, their absence a female . The X chromosome, which is common to both sexes, contains many genes vital to general body development and functioning. Absence of the X chromosome is incompatible with life . The presence of a single X chromosome and 44 autosomes appears to provide the blueprint for general body functioning and development, which seems to have an underlying female pattern. This is demonstrakd in people with Turn er's sy11dro111e, who

SEX THERAPY

have only one sex chromosome, an X. Although full female sex characteristics never develop, these people are nevertheless unmistakably female in appearance and identity. Full female sex characteristics develop only in the presence of a second X chromosome. Addition of a Y chromosome converts the female to the male pattern.

Sex determination The factors that determine biological sex. The underlying determinants are the sex chromosomes in a person's cells--two Xchromosomes in females, and one X and one Y chromosome in males. During early life in the embryo, these chromosomes cause the development of different gonads (primary sex organs)-the testes in males and the ovaries in females. In males, the testes then produce hormones that cause the development of a male reproductive tract, including a penis. In females, absence of these mafe hormones leads to a different pattern of development, with the formation of fallopian tubes, uterus, and vagina. Many years after birth, another surge of hormones from the gonads leads to the development of secondary sexual characteristics, such as facial hair in males and breasts in females. Defects can arise in this process, leading, in some cases, to ambiguous sex. Some people acquire an abnormal complement of sex chromosomes (see Chromosomal almormalities) and all the characteristics of one sex do not develop. In some female fetuses, a metabolic defect causes the production of large amounts of male hormones (see Adrenal hyperplasia, congenital), causing masculinization of the female genitals (such as enlargement of the clitoris to form an appendage resembling a penis). Conversely, in some male fetuses, male hormones are not produced or they are produced but fail to cause masculinization; the child's genitals are feminized to some degree (the extreme case of this is ca!Ied testicular feminization syndrome). Finally, there are very rare cases of true hermaphroditism, in which a child is born with both testicular and ovarian tissue and may have both a vagina and a penis. These ambiguities are different from transsexualism, in which a person's biological sex is not in doubt, although it conflicts with his or her psychological disposition. When an infant is born with ambiguous genitals, the cause of the ambiguity is investigated and the

child is assigned the sex believed to offer the best chance for a healthy life. The decision depends on the possibilities for establishing one sex or another through hormonal and/or surgical treatment. In most cases, a satisfactory male or female appearance and sexual capacity can be achieved. Full reproductive potential (ability to have children) can be achieved in some cases.

Sex hormones Hormones that control the development of primary and secondary sexual characteristics and regulate various sex-related functions in the body, such as the menstrual cycle and the production of eggs or sperm . There are three main types of sex hormones-androgen hormones (male sex hormones), estrogen hormones (female sex hormones), and progesterone lzor1/IOlles (which have the specialized function of preparing for and maintaining pregnancy).

Sex-linked Pertaining to a trait or a disorder determined by the sex chromosomes in a person's cells or by the genes carried on those chromosomes. Most people carry two sex chromosomes in their cells. Disorders caused by an abnormal number of sex chromosomes include Turner's s11ndrome (which affects females only and is caused by a missing X chromosome) and Klinefelter's syndrome (which affects mafes only and is caused by one or more extra X chromosomes). Most other sex-linked traits or disorders are caused by recessive genes on the X chromosome (see Genetic disorders). These traits or disorders, which almost exclusively affect males, include such conditions as hemophilia, Duchenne muscular dystrophy, and color vision deficiency.

Sex therapy Counseling for and treatment of psyclwsexual dysfunction (sexual difficulties not due to a physical cause). Sex therapy is usually undertaken in conjunction with marital (or relationship) counseling. It is estimated that at least 50 percent of couples experience some form of sexual problem at some stage in their relationships; in most cases, the problem is psychological in origin. Sex therapy can help by changing the general attitude of one or both partners toward sex, by increasing each person's understanding of his or

her sexual needs and those of the partner, and by teaching techniques to deal with specific problems at home. Both partners attend the therapy sessions, but individual sex therapy may also be useful. TECHNIQUES

In the sensate focu s teclmi,!11e, the couple explores pleasurable, re axed, sensual rather than sexual, bodily sensations. The goal of this technique is to reduce anxiety about sexual performance and increase individual awareness of how to give and receive pleasure for at least 15 minutes. To prevent premature ejaculation (see E1nculatio11 , disorders of), the most common sexual difficulty in men, two techniques are taught. One is the squeeze technique (see illustration below). The other technique requires both partners to stop thrusting a moment before ejaculation is imminent. In both cases, once the man has achieved control of this reflex, sexual activity is resumed. The techniques can be repeated as many times as required . They can be learned and are highly successful. THE SQUEEZE TECHNIQUE

Th is techn ique is used for treating and preventing premature ejacul ation in men.

s Method Either partner squeezes th e penis when the man is about to ejacul at e, pressing just bene ath the glans (head of the penis) usi ng the thumb and two fingers

Women who rarely or never experience orgasm (sec Orgasm , lack of) or who have vaginismus (spasm of the vaginal muscles, preventing intercourse) may be treated individually, conjointly, or at group therapy sessions. The woman is encouraged to come to terms with her sexuality. She is taught exercises for relaxing and tightening the pelvic muscles and

897

SEXUAL ABUSE

to stimulate the clitoris to achieve orgasm (through masturbation) as a preliminary to intercourse. RESULTS

Sex therapy has proved successful for many sexual problems, with particularly effective results in treating vaginismus, premature ejaculation, lack of orgasm, impotence, and failure to consummate marriage.

common reason for failure is the partner's poor or insensitive sexual overtures or technique, although hostility, anxiety, guilt about the sex act, or fear of sexual inadequacy may contribute to the froblem. In rare cases, an individua is simply unable to respond to a particular partner but can respond to another, making the sexual problem selective. TREATMENT

Sexual abuse

abuse; Rape.)

Problems that have a psychological basis or that are caused by the partner's sexual technique can often be successfully treated by sex therapy or marital (relationship) counseling. Sexual problems with a physical or chemical cause often improve once the underlying condition is resolved.

Sexual characteristics, secondary

See Deviation, sexual.

The subjection of a person to sexual activity that is likely to cause physical or psychological harm. There is a federal law mandating that child-adult sexual contact be reported to a child protection agency. (See also Child

Physical features appearing at puberty that indicate the onset of adult reproductive life. In girls, the earliest secondary sexual characteristic is enlargement of the nipples and breasts. Soon thereafter, pubic and underarm hair appears, and body fat increases around the hips, stomach, and tops of the thighs to produce the female body shape. In boys, enlargement of the testes is the first change, followed by thinning of the skin of the scrotum and enlargement of the penis. Pubic, facial, and other body hair appears, the voice deepens, and muscle bulk and bone size increase.

Sexual desire, inhibited

s

Lack of sexual desire or of the ability to become physically aroused during sexual activity (see Sexual intercourse). Either form of the condition may be physical or psychological. CAUSES

A high proportion of women and some men experience loss of sexual desire at some point in their lives. Common physical causes include fatigue, ill health, and vaginal tenderness after childbirth. Certain drugs can also reduce sexual desire, including sleeping pills, antidepressants, antihypertensives, oral contraceptives, and alcohol. Psychological factors include depression, anxiety, severe stress, a conflictual relationship with or grief at the death of a sexual partner, or an unwanted pregnancy, an abortion, or a traumatic sexual experience such as rape or incest. LACK OF PHYSICAL AROUSAL It is rare for a woman or a man to be incapable of physical sexual arousal. The most LACK OF DESIRE

898

Sexual deviation Sexual dysfunction See Psychosexua/ dysfunction.

Sexual intercourse The act in which a man's penis is inserted into a woman's vagina with her consent and cooperation. Sexual intercourse provides pleasurable sensations that may result in orgasm for one or both partners. The ejaculation of the man's sperm into the woman's reproductive tract is the usual means by which reproduction is achieved. Couples bring many variations to the sexual act in terms of emotions, positions, and techniques used. However, for most, kissing, tenderness, and foreplay precede penetration. During sexual intercourse, a series of physiological responses occurs. PHASES OF INTERCOURSE

Physiologically, intercourse can be divided into four phases-arousal, plateau, orgasm, and resolution. DISORDERS

Problems with intercourse may have physical or psychological origins. (See also Intercourse, painful; Psychosexual

dysfunction; Sexual problems.)

Sexuality A general term for the capacity, behavior patterns, impulses, emotions, and sensations connected with reproduction and the use of the sex organs. In biology, sex refers specifically to the anatomical differences between male and female. Sexual attraction, distraction, control, and expression make sexuality a powerful factor in the workplace, as a marketing tool, and in the pursuit of personal or mutual gratification.

Heterosexuality is sexuality directed toward the anatomically opposite sex; in homosexuality the attraction is toward the same sex. The term bisexuality refers to people who experience sexual attraction to members of either sex. (See also Gender identity.)

Sexually transmitted diseases Infections transmitted primarily, but not exclusively, by sexual intercourse. HISTORY AND INCIDENCE

Also known as venereal diseases, sexually transmitted diseases (STDs) are acquired more often by people who have many new sex partners each year. Some of the major STDs are also transmitted by blood and thus occur in drug addicts who share needles. Until about 25 years ago, STDs were thought to be limited to syphilis, gonorrhea, clzancroid, and lymphogranuloma venereum. Today, however, tnese four diseases account for only 10 to 15 percent of all STDs seen in STD clinics. The most common conditions are

chlamydia/ infections, trichomoniasis, genital herpes (see Herpes, genital), pubic lice, genital warts (see Warts, genital), and AIDS. Some other diseases, including viral hepatitis, scabies, candidiasis, and molluscum contagiosum, can also be transmitted by sexual intercourse, but they are not usually classified as STDs. During the second world war, STDs became more prevalent in the US and Europe; they declined when the introduction of penicillin provided a cure for syphilis and gonorrhea. In the 1960s and 1970s, however, STDs increased again with the introduction of oral contraception. The birth-control pill led not only to women having more sex partners, but also to fewer couples using barrier contraceptives, which provide some protection against infection in addition to preventing pregnancy. Also in the 1970s, genitourinary physicians recosnized that so-called nonspecific uretlmtis was usually due to chlamydia. By the early 1980s a diagnosis of nonspecific urethritis was being made in about 25 percent of all people who visited STD clinics; in most of these people, careful laboratory testing showed evidence of chlamydia! infection. Throughout the 1970s and the early 1980s, most patients with an STD could expect a rapid cure with an antibiotic. In the late 1970s, however, it became apparent that certain STDs (notably herpes and hepatitis B) could not be cured by drugs and that herpes

SEXUALLY TRANSMITTED DISEASES

SEXUAL INTERCOURSE The term sexual intercourse usually refers to the act during which the male penis is inserted into the female vagina . However, some people use the term more broadly to

a plateau phase (during which penetration usually occurs) , orgasm , and resolution. The duration of each stage of intercourse varies.

refer to a much wider range of sexual activity. Physiologically, intercourse falls into four main stages- arousal (which generally includes a period of foreplay) ,

Arousal in men Sexual thoughts, the sight and feel of his partner's body, and foreplay may sexually arouse a man . Blood enters the penis so that it becomes firm and erect.

Arousal in women Similar factors lead to arousal in women as in men, though foreplay may be more important. The clitoris lengthens, the vag ina enlarges, and its walls secrete a lubricating fluid .

Plateau phase in men Vaginal penetration usually takes place during this phase and thrusting movements begin. The penis reaches maximum size and the testes elevate.

Plateau phase in women Muscular contractions in the wal ls of the vag ina help grip the penis The uterus rises , and the clitoris pulls back beneath its hood of skin

Orgasm in men Muscular contractions in the ducts connecting the testes, prostate, and penis force semen out of the penis, accompanied by intensely pleasurable sensations.

Orgasm in women The walls of the outer part of the vagina contract rhythmically and strongly several times and an intense sensual feeling spreads from the clitoris and throughout the body.

Resolution in men The penis returns to half its fully erect size and the testes descend .

Resolution in women The clitoris subsides and, more gradually, the vagina relaxes and the uterus fa ll s.

BREATHING RATE

HEART RATE

BLOOD PRESSURE

Breaths per minute

Beats per minute

Millimeters of mercury (mm Hg)

I

50

-- ~ - -

I ...

..., .. .. I.... . . ..... . I

~-. :,---•-JI'••

40

...... ..

~

30

-

20

~...-

...~ . -

~ -,

250

..·... ... . -.

•!..

300

200

150

' 50 I

Key

• • • Men

250

200

p

.-..-..... .. .. .. ... :...... . .. -:.-. .,:: .•·r --.. • •

~

100

10 A

......... .~ .-......•' ~----:., .... ·... . .,.. ... .. ....... .. . ...... ...... ·-

150

. i-

i, •

··- ~ - - - -

100

I

I

0 Women

A

R

A = arousal

Breathing rate Both men and women breathe faster and louder as sexual excitement builds. The rate rises gradually, peaking at about twice the normal rate at orgasm .

P

= plateau

p

0

O = orgasm

A

R

p

0

R

R = resolution

Heart rate Intercourse provides vigorous exercise for the heart. The heart rate increases rapidly during arousal, peaks as high as 200 beats per minute at orgasm, then drops.

Blood pressure Systol ic blood pressure rises in a similar pattern to heart rate, peaking at orgasm. The rise may be more marked in men than in women.

899

s

SEXUAL PROBLEMS

INCIDENCE OF GONORRHEA IN THE US 307 372

Rate per 100,000 population

384

PREVENTION AND OUTLOOK

375 1983

388 418 435 445

0

100

200

500

400

300

Gonorrhea The incidence of gonorrhea peaked in the 1970s but has shown an almost uninterrupted

dec line in the 1980s. It remain s. however, the most common of all re portable diseases.

INCIDENCE OF PRIMARY AND SECONDARY SYPHILIS IN THE US 14.4 11.4

Rate per 100,000 population

11 5 1984

12 2

1983

14.1

1982

14 .6

1981

13.7 12.1

0

2.0

6.0

4.0

8.0

Syphilis Syph ilis is uncommon in the US today. Its incidenc e increased in the late 1970s and early 1980s , then declined in the middle

12.0

100

14.0

16.0

1980s - possibly help ed by a move toward "safe " sex after the appearance of AIDS. There was an unexpected inc rease in 1987.

1987

8.5 61

Rate per 100,000 population

42

1.2 0.44

1981

0 .12

1980

Not known 0

2

3

4

5

AIDS New cases of AIDS roughly doub led each year from 1982 to 1985, but it was two years before c ases doubled again . Th is may reflect

could become chronic and hepatitis could be fatal. With the recognition of AIDS in 1982, STDs became a threat to life. Promiscuous sex is now a high-risk activity.

900

6

7

8

To prevent transmitting infection, treatment is made available to all recent sexual partners. The confidential tracing and treatment of contacts is an essential part of the management of STDs (see Contact tracing). The incidence of most STDs (with the exception of AIDS) fell in the middle 1980s. There were 372 new cases of gonorrhea per 100,000 in 1986 compared with 470 cases in 1976. However, a resurgence of penicillinresistant gonorrhea in 1988 suggested that efforts to educate people on "safe" sex measures had yet to tally, disturbances of language rather than of speech, since they result from an impaired ability to understand or to form words in the language centers of the brain, rather than from any fault of the apparatus of speech production. DISORDERS OF LANGUAGE

s

Damage to the language centers of the brain (usually as a result of a stroke, head injury, or brai11 tumor) leads to a disorder known as aphasia. Both children and adults can be affected. The ability to speak and write and/or to comprehend written or spoken words is impaired, depending on the site and extent of the damage. Delayed development of language in a child is characterized by slowness to understand speech and/or slow growth in vocabulary and sentence structure. Delayed development has many causes, including hearing loss, lack of stimulation, or emotional disturbance (see Developmental delay) . DISORDERS OF ARTICULATION

Articulation is the ability to produce speech sounds; a defect of articulation is sometimes referred to as dysarthria. Damage to nerves passing from the brain to muscles in the larynx (voice box), mouth, or lips can cause speech to be slurred, indistinct, slow, or nasal. The sources of such damage are similar to those that cause aphasia (e.g., stroke, head injury, tumors, 11111/tiple sclerosis, Parki11s011 's disease) but the affected regions of the brain arc different. Damage to the cerebellum, for example, produces a characteristic form of slurred speech. Structural abnormalities of the mouth, such as cleft palate (see Cleft lip and palate) and ma)align~d teeth, can also cause poor articulation.

926

Delayed development of articulation, characterized by an inability to make sounds at appropriate ages, may cause incomprehensible speech . Causes are hearing problems or slow maturation of the nervous system. DISORDERS OF VOICE PRODUCTION

These disorders include hoarseness, harshness, inappropriate pitch or loudness of the voice, and abnormal nasal resonance. In many cases, the cause is a disorder affecting closure of the vocal cords (see Larynx disorders box). A voice pitched too high or low or that is too loud or soft may be caused by a hormonal or psychiatric disturbance or by severe hearing loss. Abnormal nasal resonance is caused by too much air (hypernasality) or too little air (hyponasality) flowing through the nose during speech. Hypernasality may result from damage to the nerves supplying the palate (roof of the mouth) or be a result of cleft palate. It causes a deterioration in the intelligibility of speech. Hyponasality is caused by blockage to the nasal airways by excess mucus and has the sound of someone speaking with a cold. DISORDERS OF FLUENCY

Nonfluent speech is marked by repetitions of single sounds or whole words and by blocking of speech; the underlying cause is not understood (see Stuttering) .

Speech therapy A form of therapy that attempts to help people with a variety of communication problems. WHY IT IS DONE

Any person with a disturbance of language or a disorder of articulation, voice production, or fluency of speech (see Speech disorders) may be helped by speech therapy. These problems may occur as part of a broader problem, such as a physical handicap, learning difficulty, or hearing loss. Speech therapists work with all age groups.

test may be performed. The therapist may also assess language comprehension ~y observing the client's reaction to wntten or spoken requests. After making an assessment, the therapist decides on the form of treatment, which is carried out in two parts. A program of exercises is started to improve a specific aspect of language ability or speech performance (e.g., a technique to improve speech fluency) . Also, the therapist works with the people most involved with the client (e.g., family, teachers, or friends), explaining to them the nature of the difficulties and how they can help. The aim of therapy is to create a climate that will provide the client with opportunities for effective communication.

Sperm The male sex cell, also known as spermatozoon (singular) or sp~rmatozo~ . . . . . (plural), responsible for fer tilizatim1 of the female ovum. Sperm are microscopically tiny, measuring 0.002 inch (0.05 mm) in length. Sperm are produced within the seminiferous tubules of the testes by a process known as spermatogenesis. The production and development of sperm is dependent on the male sex hormone testosterone and on gonndotropin hor111011es produced by the pituitary gland . Sperm production commences at puberty. The original cell from which a sperm develops contains 46 chromosomes, including the XY pair of male sex chromosomes. By a process of cell division, the number of chromosomes in the sperm is halved to 23, including either the X or the Y from the original pair of sex chromosomes. This Xor Y is responsible for determining the sex of an embryo that develops after fertilization of the ovum by the sperm (see Sex dctcr111i11ation) .

C. .--~

HOW IT IS DONE

The therapist- a person trained in the causes, assessment, and treatment of speech and language problemsusually begins by taking a history from the client or from a relative or friend, asking how and when the difficulties developed. Relevant medical details are also sought from the client's physician, if necessary. The dient may be asked to provide a sample of speech (which may be recorded) or of writing for detailed analysis . An examination of the physical structures of speech and a hearing

Human sperm magnified 350 times Each sperm consists of a head that contains the hereditary material and a long, whiplike tail that propels it along .

SPHYGMOMANOMETER

The final stage of spermatogenesis takes place in the ep1didymis, where the sperm grow tails that will propel them through the woman's reproductive tract after ejaculation during sexual intercourse.

pyloric sphincter. It controls the stomach's outflow. The anal sphincter at the rectal outlet is partly under voluntary control, permitting us to decide when to empty the bowel.

Spermatocele

A surgically created valve or other device used to treat or prevent urinary or fecal incontinence. An artificial urinary sphincter consists of an inflatable cuff that is inserted around the base of the bladder or upper part of the urethra. When inflated, the cuff prevents urine from leaking from the bladder. The patient deflates the cuff by using a pump, which is usually situated in the scrotum in males or adjacent to the labia in females. An artificial sphincter to prevent fecal incontinence may be created after removal of the colon and rectum. This operation, an alternative to a conventional ileostomy, involves using a loop of ileum to create a pouch in which bowel contents collect. Evacuation of feces is controlled by an artificial sphincter, surgically fashioned from a section of ileum. A similar "continent ileostomy" may be provided for a person whose bladder has been removed to treat cancer and whose ureters are then joined to a segment of ileum that is formed into a pouch. This procedure is still under development and considered experimental, as are other methods of continent urinary diversion .

A harmless cyst of the epididymis (the tube that transmits sperm from the testis) that contains fluid and sperm. If the spermatocele grows to a large size or becomes uncomfortable, it is usually removed surgically. Although the operation is straightforward, it may result in an interruption of the passage of sperm, which may render the testis on the affected side infertile.

Spermatozoa See Sperm.

Spermicides Contraceptive preparations that kill sperm. Spermicides are usually recommended for use with a barrier device, such as a condom or diaphragm, to increase the final contraceptive effect (see Contraception,

barrier methods). Some spermicides, such as nonoxynol, may protect against the organisms that cause various sexually transmitted diseases, including gonorrhea and AIDS. A possible adverse effect is irritation of the genitals of either partner.

Sphenoid bone The bat-shaped bone in the center of the base of tne cranium (the part of the skull that encases the brain). The central body of the bone contains the sphenoidal sinus (air space) a~d, \n the upper surface, a depression m which the pituitary gland is situated. The wings support part of the temporal lobe of the brain (see Cerebrum) and form part of the back and side walls of the orbits (eye sockets). There are various canals and foramens (holes) in the wings to enable the optic and other cranial nerves to pass through.

Spherocytosis, hereditary An inherited disorder so named because of the large number of unusually small, round, red blood cells (spherocytes) in the circulation. These cells have an abnormal membrane (outer envelope), which makes them fragile, and a much reduced life span because they are readily trapped, broken up, and consumed when blood passes through

Sphincter, artificial

Spherocytes in blood A person with hereditary spherocytosi s has a large number of these unusually small, round , frag ile, red cells in the blood .

the spleen . At times, the rate of hemolysis (red cell destruction) exceeds the rate at which new cells can be made in the bone marrow, leading to anemia (reduced level of the oxygencarrying pigment hemoglobin in the blood due to lack of red cells). INCIDENCE

Hereditary spherocytosis is the most common form of inherited hemolytic anemia in people of northern European extraction. About one person in 4,500 in the US has the condition. The disorder is inherited in autosomal dominant fashion (see Genetic disorders). Each of an affected person's children has a 50 percent chance of inheriting the defective gene responsible for the abnormality. SYMPTOMS, DIAGNOSIS, AND TREATMENT

Symptoms of anemia, such as tiredness, shortness of breath on exertion, and pallor, may develop at any age. Other symptoms include jaundice (caused by the high rate of blood cell destruction) and enlargement of the spleen. Occasionally, there are crises (triggered by infections) when all the symptoms worsen. Gallstones, also caused by the high rate of bilirubin release, are a frequent complication. The diagnosis is made from the presence of spherocytes in the blood of someone with anemia and from tests to ascertain the structure of the red cell membrane. The treatment is splenectomy (removal of the spleen). The red cells remain abnormally shaped, but the rate at which they are destroyed drops markedly, leading to a striking, and usually permanent, improvement in the patient's health.

Sphincter A ring of muscle around a natural opening or passage that acts like a valve, regulating inflow or outflow. For example, the outlet of the stomach into the duodenum is called the

Sphincterotomy A surgical procedure that involves cutting the muscle that closes a body opening or that constricts the opening between body passages. In rare cases, sphincterotomy is performed on the anal sphincter to treat an anal fissure . It is also performed on the ampulla of Yater (the opening of the common bile duct into the duodenum) to release an impacted gallstone.

Sphygmomanometer An instrument for measuring blood pressure. It consists of a cuff with an inflatable bladder that is wrapped around the upper arm, a rubber bulb to inflate the bladder, and a device that indicates the pressure of blood. This pressure device may consist of a calibrated glass column filled with mercury, a spring gauge and dial, or, in more modern instruments, a digital readout display. (For an explanation of how a sphygmomanometer is used, see Blood pressure.)

927

SPIDER BITES

Spider bites Nearly all spiders produce venom, which they inject, via a pair of fangs, to paralyze and kill their prey. However, only a few species are harmful to humans. In the US, the two most dangerous types are the black widow spider (LATRODEcrus MACTANS) and the brown recluse spider (LOXOSCELES RECLUSA).

s

The black widow is a small, shiny black spider, less than half an inch (1 cm) long but with a leg span of up to 2 inches (5 cm). It has a red hourglassshaped marking on its underside. This spider can be found in most parts of the US in woodpiles, sheds, and the bowls of outside toilets, from which it may deliver a bite to a person's buttocks or genitals. A bite from a black widow can cause severe pain and muscle spasms (starting near the site of the bite and spreading), heavy sweating, stomach cramps, nausea, vomiting, tightness in the chest, breathing difficulty, and a sharp rise in blood pressure. These symptoms may continue for several days. Deaths from cardiac arrest or respiratory failure occur occasionally in children or the elderly, but are uncommon in adults. Treatment consists of analgesics (painkillers) and an intravenous injection of a solution of calcium gluconate, which relieves the muscle cramps. If symptoms are very severe, or if the patient is a young child, an antivenin active against the spider venom may also be given. Recluse spiders are brown or brown-yellow. They occur in southern and southwestern states, where they inhabit crevices in or around houses. Their bite causes severe pain, reddening, blistering, and death of tissue at the site of the wound, followed by a deep ulcer. Treatment consists of analgesics, care of the wound to prevent infection, and measures to deal with complications, which can include hemolytic anemia and renal failure. Fatalities have occurred in children. Other dangerous spiders include relatives of the black widow spider, and the "funnel web" spider of Australia. The hairy tarantula of southern Europe is relatively harmless, although its bite is painful.

Spider nevus A discolored patch of skin that takes the form of a red, raised dot the size of a pinhead with small blood vessels radiating from this dot. Also called telangiectasia, spider nevi represent

928

Typical spider nevus The nevus consists of a tiny. red , raised dot from which widened blood ca pillaries radiate outward in all directions.

the outward appearance of a dilated arteriole (small artery) and its connecting capillaries. Small numbers of spider nevi are common in children and pregnant women. However, in larger quantities, spider nevi may be a sign of an underlying disorder, such as advanced cirrhosis of the liver. Lesions resembling multiple spider nevi (but without the "spider legs") may be a sign of hereditary hemorrhagic telangiectasia, a disorder of the blood vessels that causes bleeding and irondeficiency anemia.

Spina bifida A congenital defect in which part of one (or more) vertebrae fails to develop completely, leaving a portion of the spinal cord exposed. Spina bifida can occur anywhere on the spine but is most common in the lower back. The severity of the condition depends on how much nerve tissue is exposed. CAUSES AND INCIDENCE

The cause of spina bifida remains unknown; it is thought that many factors are involved. The incidence is about one case per 1,000 babies born. The incidence increases with either very young or old maternal age. A woman who has had one affected child is ten times more likely than the average of having another affected child. TYPES

There are four known distinct forms of spina bifida . SPINA BIFIDA OCCULTA This is the most common and the least serious form . There is little external evidence of the defect apart from a dimple or a tuft of hair over the area of tfte underlying abnormality. Spina bifida occulta often goes completely unnoticed in otherwise healthy children, although occasionally there are accompanring abnormalities of the lower part o the spinal cord . Symptoms, which include leg weakness, cold and blue

feet, and urinary incontinence, may be present from birth or may develop later in life. MYELOCELE Also known as meningomyelocele, this is the most severe form of spina bifida. The nature of the defect is shown in the illustrated box on the opposite page. A chifd with myelocele is usually severely handicapped. The legs are partially or completely paralyzed, with loss of sensation in all areas below the level of the defect; hip dislocation and other leg deformities are common. Hydrocephalus (excess cerebrospinal fluid within the skull) is common and may result in brain damage. Associated abnormalities include cerebral palsy, epilepsy, mental retardation, and visual problems. Paralysis of the bladder leads to urinary incontinence or urinary retention, repeated urinary tract infections, and eventual kidney damage. The anus may be paralyzed, causing chronic constipation and leakage of feces. MENINGOCELE This form is less severe than myelocele. The nature of the defect is shown in the box opposite. ENCEPHALOCELE This is a rare type of spina bifida in which the protrusion occurs through the skull. There is usually severe brain damage. DIAGNOSIS

Closure of the vertebral canal usually occurs within four weeks of conception, meaning that meningomyeloce1e can often be diagnosed at an early stage in the pregnancy by ultrasound scanning. High levels of alplw-fctoprotcin in the amniotic fluid or maternal blood may indicate spina bifida. After birth, spina bifida is easy to recognize if there is a protruding sac. Spina bifida occulta can be diagnosed only by spinal X ray. TREATMENT

In cases that are not severe, surgery may be performed to close the defect and thus prevent further damage to the spinal cord . Ideally, the operation should be performed in the first few days of life. If the abnormality is serious, surgery may allow the child to survive, although he or she may have gross physical and mental handicap. If hydrocephalus develops, a s'11111/ (tube) is inserted into the brain to relieve the builduf of fluid. Retention or incontinence o urine is relieved by an indwelling catheter (which is changed every four to six weeks); in older children, self-ca theterization can be taught (see Catheterization , urinary). Laxatives or enemas may be needed for constipation.

SPINAL CORD

TYPES OF SPINA BIFIDA There are different forms of spina bifida. In one type (spina bifida occulta), the only defect is a fa ilu re of the fusion of the bony arches behind the spinal cord. When the bone defect is more extensive , there

may be a meningocele, with protrusion of the meninges (the membranes surrounding the cord) or, more seriously, a myelocele, with change in the spinal cord itse lf

Spinal cord A cylinder of nerve tissue, about 18 inches long and roughly the thickness of a finger, that runs down the central canal in the spine. It is a downward extension of the brain . The spinal cord and brain can be considered parts of a single unit-the central nervous system (CNS).

MYELOCELE

MENINGOCELE

tion and subsequent controlled spread of the local anesthetic solution determines the area that is anesthetized. After spinal anesthesia, a headache may develop in between 1 and 5 percent of patients.

STRUCTURE

-t-t-'=-t-----Cerebrospinal fluid

____,,........_+----- Cerebraspinal fluid

Meningocele In this type, the nerve tissue of the spinal cord is usually intact; there is skin over the bulging sac and there are therefore usually no funct ional problems . However, repairs are necessary early in life.

Physical tlzempy encourages mobility and independence; for the more severely affected, wheelchairs and other walking aids may be required. Depending on the degree of disability, special schooling and training for employment may be needed. PREVENTION

Parents who have had one child with spina bifida should undergo genetic counseling if they are considering another pregnancy.

Spinal accessory nerve The eleventh cranial nerve. The spinal accessory nerve differs from the other cranial nerves in that only a small part of it originates from the brain; most of the nerve comes from the spinal cord. The part of the nerve originating from the brain supplies many muscles of the palate, pharynx (throat), and larynx (voice box). Damage to this part of the nerve may give rise to dysphonia (difficulty speaking) and dysphagia (difficulty swallowing). The spinal part of the nerve supplies some large muscles of the neck and back, notably the sternomastoid (which runs from the breastbone to the side of the skull) and the trapezius (a large, triangular muscle of the

Myelocele In this type, the baby is born with a raw swelling over the spine It consists of malformed spinal cord , which may or may not be contained in a membranous sac . The chi ld is likely to be very handicapped .

upper back, shoulder, and neck). Damage to the spinal fibers of the nerve paralyzes these muscles. Such damage usually occurs as a result of surgery for cancer in which lymph nodes in the neck are removed.

Spinal anesthesia A method of blocking pain sensations before they reach the central nervous system by injecting an anesthetic into the cerebrospinal fluid in the spinal canal. The technique is primarily used to accompany surgery on the lower abdomen and legs. Operations on the hip and prostate gland are commonly performed using spinal or epidural anestlzesia. The decision as to which anesthesia to use is made after discussion among the patient, anesthesiologist, and surgeon . The procedure is performed by inserting a delicate needle between two vertebrae in the lower part of the spine (see Lumbar puncture) and introducing anesthetic into the cerebrospinal fluid surrounding the spinal cord and its terminal nerve roots. Because the nerves emerging from the spinal cord are bathed in cerebrospinal fluid, they absorb the anesthetic. The position of the injec-

At the core of the spinal cord is a region with a butterfly-shaped cross section, called the gray matter. It contains the cell bodies of neurons (nerve cells) along with glial (supporting) cells. Some of the nerve cells are motor neurons, whose axons (long, projecting fibers) pass out of the spinal cord in bundles within the spinal nerves and extend to glands or muscles in the trunk and limbs. Others are interneurons (nerve cells contained entirely within the central nervous system), which act to convey messages between other neurons. Also entering the gray matter are the axons of sensory neurons (which have their cell bodies outside the spinal cord). These axons connect with the motor neurons or interneurons. Surrounding the gray matter are areas of white matter, which consist of bundles of nerve cell axons running lengthwise through the cord. Sprouting from the spinal cord on each side at regular intervals are two nerve bundles-the spinal nerve roots, which contain the fibers of motor and sensory nerve cells. They combine to form the spinal nerves, which emerge from the spine and are the communication cables between the spinal cord and all regions of the trunk and limbs. The whole of the spinal cord is bathed in cerebrospinal fluid and surrounded by a protective sheath, a continuation of the 111e11inges that protect the brain . FUNCTION

The nerve tracts that make up the white matter of the spinal cord act mainly as highways for sensory information passing upward toward the brain (ascending tracts) or motor signals passing downward (descending tracts). However, the cord is also capable of handling some of the sensory information itself and of provid-

929

s

SPINAL FUSION

LOCATION OF THE SPINAL CORD

The cord runs some 18 inches downward from the brain through a canal in the spine, tapering toward its lower end. ~ - - Spinal cord

nerve cells and fibers within the cord do not regenerate. However, reflexes con trolled by the spinal cord are usually maintained. Pressure on the cord (e.g., by a blood clot, an abscess, or tumor) can similarly affect movement and sensation. However, the effects of pressure can often be relieved by surgery. Infections of the spinal cord (including poliomyelitis) are relatively rare but can cause serious damage. In multiple sclerosis, a degenerative disease, there is patchy loss of the insulating sheaths around nerve fibers.

Spinal fusion A major surgical procedure to join two or more adjacent vertebrae, the bones that make up the spine. Vertebra

Spinal nerve

Spinous process of vertebra

Gray matter

WHY IT IS DONE

Spinal fusion is performed if abnormal movement between adjacent vertebrae (as revealed by X rays) causes severe back pain or may damage the spinal cord. Such abnormal movement may be due to various spinal disorders, including spondylolisthesis, dislocated facet joints (the movable joints that connect vertebrae), scoliosis, osteomyclitis, a tumor or injury destroying one or more vertebrae, or osteoarthritis that causes degeneration of spinal joints. HOW IT IS DONE

Dorsal root Dorsal root ganglion

s

Structure The gray matter contains nerve cell bodies, the white matter consists of tracts of nerve fiber s. Spinal nerves join the cord at regular intervals.

ing appropriate motor responses without recourse to the brain. Many reflex actions (such as the knee jerk reflex) are controlled in this way by the spinal cord. DISORDERS

The spinal cord may be injured as a result of trauma to the spine (see Spi11al i11j11ry). If an ascending or descending tract is severed, it interrupts communication between the brain and parts of the body served from parts of the cord below the injury. This can lead to a variety of patterns of paralysis and/or loss of sensation, which are usually permanent because

930

Using a general anesthetic, the affected vertebrae are exposed. Arthrodesis (joint fusion) is then carried out, sometimes with a bone graft, using bone chips taken from the pelvis. A temporary fixation is made with a plate or screws. The recovery period includes bed rest for up to six weeks. When mobility is resumed, the patient may initially need to wear a plaster jacket. full fusion of the vertebrae takes up to six months. Results are usually good, but fusing the vertebrae may place greater strain on the rest of the spine and cause more back pain. The potential gain must be weighed against the risks.

Spinal injury Damage to the spi11e and sometimes to the spinal cord, in which case the injury may cause loss of sensation and muscle weakness or paralysis. CAUSES

Spinal injury is usually caused by one of three tfpes of severe forcelongitudina compression, hinging, and shearing. Longitudinal compression, usually due to a fall from a height, crushes the vertebrae (seg-

ments of spine) lengthwise against each other. Hinging, which can occur in a whiplash injury suffered in an automobile accident, subjects the spinal column to sudden, extreme bending movements. Shearing, which may occur when a person is knocked over by a motor vehicle, for example, combines both hinging and rotational (twisting) forces. Any of these forces can dislocate the vertebrae, fracture them, or rupture the ligaments that bind them together. In severe dislocations and fractures, the vertebrae, accumulated fluid, or a blood clot may press on the spinal cord, or the cord may be torn or even severed. In all of these cases the function of the spinal cord is impaired or destroyed. An unstable injury is one in which there is the possibility that vertebrae will shift and cause damage, possibly severing the spinal cord. Other injuries are called stable. SYMPTOMS AND SIGNS

Damage to the vertebrae and ligaments usually causes severe pain and swelling of the affected area. Damage to the spinal cord results in loss of sensation and/or motor function below the site of injury. Injuries below the neck may cause paraplegia (weakness or paralysis of the legs and sometimes part of the trunk); damage to the cord in the neck may result in quadriplegia (weakness or paralysis of alI four limbs and the trunk) or may be fatal. Weakness or paralysis is often accompanied by loss of bladder or bowel control, resulting in urinary or fecal incontinence or retention. Pressure on the spinal cord may cause motor abnormalities, such as muscle weakness or paralysis. It may also cause abnormalities of sensation, such as pain, tingling, or burning sensations. DIAGNOSIS AND TREATMENT

After an accident in which a spinal injury may have occurred, the victim should be moved only by someone trained in all aspects of first aid. X rays of the spine are carried out to determine whether the spine has been injured and the extent of any damage. In a stable injury, the patient must rest in bed until comfortable movement is possible; he or she may then need to wear an orthopedic collar or corset for support or to relieve pain in the injured area. The priority in an unstable injury is to stabilize the affected bones. If they are dislocated, the surgeon usually manipulates them back into position using a general anesthetic. Some

SPINAL NERVES

unstable fractures are treated by skeletal traction to align the bone ends and hold them in position until healing occurs (which may take up to three months). Other unstable fractures require an operation to fasten the bone ends together permanently with a metal plate or wires. Surgical repair of damaged nerve tracts in the spinal cord is not possible. Treatment is directed toward preventing the development of problems secondary to the main symptoms. For

Spinal nerves A set of 31 pairs of nerves that connects to the spinal cord. STRUCTURE

The spinal nerves emerge in two rows from either side of the spinal cord and leave the spine through gaps between adjacent vertebrae (segments of spine). Because the spinal cord runs only two thirds of the way down the canal in the center of the spine, the lowest nine pairs of nerves must travel some distance down the canal before finally leaving the backbone. They form a spray of nerves in this area known as the cauda equina. The distribution and branching of the spinal nerves ensures that all parts of the trunk, arms, and legs are supplied with a network of sensory and motor nerve twigs.

example, the patient is turned regularly in bed to prevent bedsores from forming as the result of immobility and lack of sensation in the skin. Physical therapy is carried out to stop joints from locking and muscles from contracting as the result of paralysis. Retention of urine or feces may require catheterization (see Catheterizntio11 , 11ri11ary) or enemas. OUTLOOK

Recovery is usually complete when the spinal cord has not been damaged,

although there may be some residual pain and stiffness. When there has been pressure on the spinal cord, surgery to remove the source of the pressure can bring variable improvement in symptoms. Even when there is damage to the cord, some improvement may occur for up to 12 months. In such cases, the patient's recovery can be aided by a program of rehabilitation. This may include forms of physical and occupational therapy, which can help morale and independence.

ANATOMY OF THE SPINAL NERVES The 31 pairs of nerves are divided into groups-cervical , thorac ic, lumbar , and sacral- accord ing to the section of spine from which they emerge. Those connecting with the midd le part of the spinal cord encircle the body, branching to supply a fairly distinct segment of trunk. Those emerg ing from top and bottom of the spine join to form networks, called plexus , from wh ich branches arise to supply the arms and legs. Nerve twigs

Distribution The branches of each nerve divide as they travel further from the spinal cord As a result, all parts of the head and neck are supplied w ith a network of ne rve twigs.

FUNCTION

Like all nerves, the spinal nerves consist of bundles of the axons (long fibers) of individual neurons (nerve cells). Some of these fibers carry information from sensory receptors in the skin, muscles, and elsewhere toward the spinal cord; other motor fibers carry signals from the spinal cord to muscles and glands. Just before it connects to the spinal cord, each spinal nerve splits into two bundles, one of which carries only sensory fibers and the other of which carries only motor fibers. These bundles are sometimes called spinal nerve roots.

s Nerve bundle Nerve axon

DISORDERS

Damage to the shock-absorbing disk of cartilage between two vertebrae sometimes leads to pressure on a spinal nerve root, causing pain (see Disk prolapse). Injury to a spinal nerve may lead to loss of sensation and movement in a part of the body. Damage or degeneration from such causes or from infection, diabetes, vitamin deficiency, and poisoning can lead to neurological symptoms such as pain, numbness, or twitching (see Nerve i11j-

Structure Each nerve con sists of b undles of the axons, or fibers, of individual nerve cell s

that have their cell bodies in or close to the spinal cord .

ury; Neuropathy). 931

SPINAL TAP

Spinal tap See Lumbar puncture.

Spine The column of bones and cartilage that extends from the base of the skull to the pelvis, enclosing and protecting the spinal cord and supporting the trunk and head. STRUCTURE AND FUNCTION

The spine is made up of 33 roughly cylindrical bones called vertebrae. Each pair of adjacent vertebrae is connected by a joint, called a facet joint, which both stabilizes the vertebral column and allows movement in it. Between each pair of vertebrae lies a diskshaped pad of tough fibrous cartilage with a jellylike core (nucleus pulposus) called an intervertebral disk (see Disk, i11tervertcbral). These disks act to cushion the vertebrae during movements such as running or jumping. STRUCTURE OF THE SPINE

The spine is made up of a column of 33 rough ly cylindrical bones called vertebrae . Runn ing through the center of this bony structure is the spinal cord .

j

Cervical spine Seven vertebrae , the topmost of which supports the skul l.

Spirometry

The whole of the spine encloses the spinal cord, a column of nerve tracts running from the brain. Peripheral nerves (see Peripheral nervous system) branch off from the spinal cord to every part of the body, their roots passing between the vertebrae. The vertebrae are bound together by two long, thick ligaments running the length of the spine and by smaller ligaments between each vertebra. Several groups of muscles are attached to the vertebrae. These muscles control movements of the spine and also help to support it. In a normal spine the cervical section curves forward, the thoracic section backward, the lumbar section forward (particularly in women), and the pelvic section backward.

A pulmonary function test used to help diagnose or assess a lung disorder or to monitor treatment. The procedure is shown in the illustrated box below. The spirometer records the total volume of air breathed out, known as the forced vital capacity (FVC). It also records the volume of air breathed out in 1 second, known as the forced expiratory volume in 1 second (FEV1). In obstructive lung disease (such as asthma, emphysema, and chronic bronchitis), the FEV/FVC ratio is reduced because the airways are narrowed, thus slowing expiration. In a restrictive lung disease (such as interstitial pulmonary fibrosis), the FVC and FEV 1 are reduced almost equally with little change in the ratio. This is because lung expansion is limited but the airways are not narrowed.

Spirochete A spiral-shaped bacterium. Spirochetes cause syphilis, pinta and yaws (both related to syphilis), and leptospirosis, relapsing fever, and

Spironolactone A potassium-sparing diuretic drug. Combined with thiazide or loop diuretics, spironolactone is given to treat

Lyme disease.

SPIROMETRY

Volume (exp ired liters)

This technique is used to assess certain lung conditions and the patient's response to treatment. It records the rate at which a patient exhales air from the lungs and the total volume exhaled.

5

Thoracic spine Twelve vertebrae that run down the rear wall of the chest. A pair of ribs is attached to each vertebra.

4

3 2

1 2 Time (seconds)

3

4

5

6

7

Normal FEV, {forced expiratory volume of the first second) is the volume of air exhaled in the first second and is normally 60 to 80 percent of FVC (forced vital capacity), the total volume exhaled

s

Volume (expired liters)

5

_J

~

Lumbar spine Fi ve vertebrae. This section is the one under the most pressure during lift ing .

4

Sacrum Five fused vertebrae.

1 2 Time (seconds)

3

2

J

] ] 932

Coccyx Four fused vertebrae

How it is done The patient exhales forcibly th rough a mouthpiece into the spirometer. This causes the spirometer to produce a graph like that shown at right.

FVC

3

4

5

6

7

Asthma A patient with asthma cannot exhale air as fast as normal, due to narrowing of the airways , so FEV , is reduced in comparison with FVC

SPLENECTOMY

DISORDERS OF THE SPINE Many disorders of the spine, despite their different causes, result in just one symptom-back pain. CONGENITAL DISORDERS

Some children are born with a gap in the vertebrae that leaves part of the spinal cord exposed. This condition (spina bifida) results in leg paralysis and incontinence. INFECTION

Osteomyefitis (infection of bone and bone marrow) may in rare cases affect a vertebra, destroying both bone and disk. The most common cause is the spread of an infection, such as tuberculosis, from elsewhere in the body.

INJURIES

Lifting heavy objects, twisting suddenly, or adopting bad posture can cause any of the following spinal injuries- a sprained ligament. torn muscle. spondyfolisthesis (dislocated vertebrae) , dislocated facet joint, or disk prolapse (rupture of the tough outer layer of the disk). A direct blow, a fall from a height, or sudden twisting can result in fracture of one or more vertebrae. Overexercising the spine can have the same effect (see Stress fracture) .

hypertension (high blood pressure) and edema (fluid retention). Spironolactone may cause numbness, weakness, nausea, and vomiting. Less common adverse effects include diarrhea, lethargy, impotence, rash, and irregular menstruation in women. High doses of spironolactone may cause abnormal breast enlargement in men.

Spleen An organ that removes and destroys worn-out red blood cells and helps fight infection. Weighing about 7 ounces (200 grams), the spleen is a fistsized, spongy, dark purple organ lying in the upper left abdomen behind the lower ribs. STRUCTURE

The spleen is covered with a capsule from which many fibrous bands run inward to give the organ a spongelike structure. The spaces between the bands are filled with lymph tissue, composed of lymphocytes and phagocytes (cells that ingest other cells or foreign particles), and red blood cells. Blood is supplied to the spleen by a large artery that branches extensively witnin the organ.

OTHER DISORDERS

In some people the spine becomes abnormally curved. The excessive curvature may be inward in the lower back (see Lordosis), outward in the upper back (see Kyphosis), or to one side (see Scoliosis). Causes include infection, osteoporosis, congenital spine disorder, and muscle disorders.

TUMORS

Tumors of the spine are usually malignant; in most cases , they have spread from cancer elsewhere in the body (see Bone cancer) .

INFLAMMATION

In ankyfosing spondyfitis , and in some cases of rheumatoid arthritis, the joints in the spine become inflamed and later fuse, causing permanent stiffness. Osteochondritis juvenifis (inflammation of the growing area of bone in children and adolescents) can affect the vertebrae, when the disease may cause deformity of the spine.

older women, can weaken the vertebrae. Under the weight of the trunk, the vertebrae may then fracture.

DEGENERATION

Osteoarthritis (degeneration of joint cartilage due to wear and tear) affects the joints in the spines of virtually everyone over 60, particularly people who do h~avy manual work or people whose spines have already been affected by disease or injury. Osteoporosis (thinning and softening of bone). which is most common in

FUNCTION

One of the two main functions of the spleen is to control the quality of circulating red blood cells. It accomplishes this by removing and breaking down all worn-out red cells approximately 120 days after they have been produced in the bone marrow and by destroying other red cells that are misshapen or defective. The other role of the spleen is to help fight infection by producing some of the antibodies, pnagocytes, and lymphocytes that destroy invading microorganisms. In the fetus, the spleen produces red blood cells. After birth, this function is taken over by the bone marrow. However, in certain diseases that affect cell production in the bone marrow (such as thalassemia), the spleen may resume production. Despite its functions, the spleen is not an essential organ. If it is removed, its activities are largely taken over by other parts of the lymphatic system, although the individual is more susceptible to infection. DISORDERS

The spleen enlarges in many diseases, including infections such as malaria,

INVESTIGATION

Spinal disorders are investigated by X rays, CT scanning , and myelography. Other bone imaging techniques , including MRI, may sometimes be performed , as may other tests.

infectious mononucleosis (glandular fever), schistosomiasis, tuberculosis, and typhoid fever; in leukemia and thalassemia; in some diseases that cause hemolytic anemia (such as sickle cell anemia); and in tumors of the spleen. The enlargement, which can often be felt as a swelling in the upper left abdomen, is sometimes accompanied by hypersplenism. Lymphomas (tumors of lymphoid tissue) may develop in the spleen and elsewhere in the lymphatic system. The spleen is sometimes ruptured by a severe blow to the abdomen, usually in an automobile crash or by a fall from a height. A rupture is much more likely if the spleen is enlarged or if overlying ribs are fractured. Rupture can cause severe bleeding, which may be fatal. For this reason, the injury requires an emergency operation to remove the spleen and tie off the artery supplying it (see Splenectomy).

Splenectomy Surgical removal of the spleen. WHY IT IS DONE

Splenectomy is usually performed after the spleen has been seriously injured, causing severe hemorrhage.

933

s

SPLINT

The organ is removed because it is difficult to repair and because, in an adult, its absence has virtually no known ill effects. Its function is largely taken over by other parts of the lymphatic system and by the liver. The spleen is also removed to treat primary hypcrsplc11ism and certain types of anemia, such as hereditary sphcrocytosis. Splenectomy may be performed during laparotomy (surgical exploration of the abdomen) as part of a process (called staging) to assess the extent of Hodgkin's disease. HOW IT IS DONE

Using a general anesthetic, a vertical or horizontal incision is made in the upper left abdomen, exposing the spleen. After attachments to other tissues have been cut and blood vessels leading into and out of the spleen have been clamped and severed, the organ is removed. The operation takes about an hour.

ing include treatment of finger injuries, such as fracture or baseball fi11r,;er, and of rheumatic disorders affecting the fingers, such as tenosvnovitis (inflammation of tendon linings) and rhcwnatoid arthritis.

Splinting, dental The mechanical joining of several teeth to hold them firmly in place while an injury heals or periodontal disease is treated. Splints may be used to secure teeth that have been fractured (see Fracture, dental) or loosened (see Luxated tooth). They may also be used after a tooth has been reimplanted (see Reimplantation , dental). Occasionally, teeth loosened by periodontal disease may be splinted to adjacent, firmer teeth. Splints may also be required after orthog11athic surgery. Splints are fashioned directly in the mouth with a variety of materials,

such as wire, quick-setting plastic, and plastic crowns that can be bonded together. (See also Wiring of the jaws.)

Split personality A term used to describe two distinct disorders-11111/tiple personality, in which an individual has two or more personalities, each of which dominates at different times, and schizophrenia, in which the sufferer's feelings and thoughts are not logically related to each other.

Spondylitis Inflammation of the joints between the vertebrae in the spine. Spondylitis is usually caused by a rheumatic disorder, such as a11kylosi11g spondylitis or rheumatoid arthritis. In rare cases, spondylitis is due to a bacterial infection that has spread from elsewhere in the body.

RECOVERY PERIOD AND OUTLOOK

Patients usually leave the hospital six to 10 days after the operation. Complications, such as infection of the operation site, are rare . In an adult, absence of the spleen slightly increases the risk of contracting infections; children become markedly more susceptible, particularly to pneumococcal pneumonia . A child who has undergone a splenectomy should be immunized with pneumococcal vaccine and given long-term anti/1iotic dru«s. Healthy fragments of a removed spleen are occasionally reimplanted in a child immediately after splenectomy; in some cases, these fragments regenerate to form an efficient new spleen .

FIRST AID: SPLINTS

1

If help is coming , do not move the victim but support the limb by placing one hand above the fracture and the other below ii.

3

Tie the victim's ankles and feet together with a fi gure-of-eig ht bandage. Secure the bandage on the victi m's uninjured side.

Splint

s

A device used to immobilize part of the body. Splints may be made of acrylic, polyethylene foam, plaster of Paris, or aluminum . Ambulances may carry inflatable splints. In an emergency, a splint can be constructed from a piece of wood or a rolled magazine or newspaper that is secured to the extremity .

Splinting The application of a spli11/ . Splinting is used as a first-aid measure (see illustrated box) to prevent movement of a fractured limb or to immobilize a suspected fracture of the spine; this is especially important when the victim is being moved . Splinting is sometimes required for leg fractures that are being treated by tractio11 . Other uses of splint934

2

If the ambulance is delayed or if the victim must be moved out of danger. first immobilize the leg . Place soft padding, such as a roll of cotton rolled around a splint, between the victim 's kn ees and ankles and gently bring the unin1ured leg to the injured one.

4

Tie bandages around the knees , thighs. and legs, being ca reful to avoid the fracture site. Tie all knots on the uninjured side.

SPORTS INJURIES

Spondylolisthesis

Spondylolysis

The slipping forward (or occasionally backward) of a vertebra over the one below it. A forward slippage of the fifth (lowest) lumbar vertebra over the top of the sacrum is the most common form of the condition, but it may also occur between the fourth and fifth lumbar vertebrae or between two cervical (neck) vertebrae.

A spinal disorder in which the arch of the fifth (or, rarely, the fourth) lumbar vertebra consists of relatively soft fibrous tissue instead of normal bone. As a result, the arch is weaker than normal and is more likely to be deformed or damaged under stress, which may produce spo11dylolisthesis (forward slippage of a vertebra over the one below it). Otherwise, spondylolysis is usually symptomless.

CAUSES AND SYMPTOMS

Lumbar spondylolisthesis, which involves two lumbar vertebrae or the fifth lumbar vertebra and the sacrum, is usually due to spondylolysis (in which the bony arch of a lumbar vertebra is abnormally soft and thus liable to slip under stress) or to osteoarthritis of the spine (in which the joints between the vertebrae become worn and unstable). The principal symptoms of lumbar spondylolisthesis include pain in the back that is worse when standing and

sciatica. Cervical spondylolisthesis may be caused by a neck injury, congenital abnormality of the cervical spine, or rheumatoid arthritis (in which the supporting ligaments of the cervical spine are weakened or the joints between the vertebrae become worn). The main symptoms are pain and stiffness in the neck and, in severe cases, pain, numbness, or weakness in the sufferer's hands and arms. DIAGNOSIS AND TREATMENT

Spondylolisthesis is diagnosed by X rays of the spine. Treatment may include traction, immobilization of the affected area in a plaster jacket or cervical collar, and physical therapy. In severe and rare cases (in which there is nerve compression damage or severe back pain), an operation to fuse the affected vertebrae may be necessary (see Spinal fusion).

Lumbar vertebra sli ps forward

Normal spine

Defect Spinal nerves becomes distorted

Spondylolisthesis

Lumbar spondylolisthesis If the lowest lumbar vertebra slips forward on the sacrum, it may distort or press on a spinal nerve. causing symptoms such as backache or sciatica.

Sponge, contraceptive A disposable, circular piece of polyurethane foam impregnated with spermicide that is inserted into the vagina as a method of birth control. (See Co11fraceptio11, barrier methods.)

Sporotrichosis A chronic infection caused by the fungus SPOROTHRIX SCHENCKII, which grows on moss and other plants. The infection is most often contracted through a skin wound; gardeners and florists are particularly vulnerable. An ulcer develops at the site of the wound and is followed by the formation of nodules (which can be seen as a chain of protuberances beneath the skin) in lymph channels around the site. Potassium iodide solution taken by mouth usually clears up the infection. Rarely, in people whose resistance to disease has been lowered, sporotrichosis spreads to the lungs, joints, and other parts of the body. This condition may require prolonged treatment with the antifungal drng amphotericin B.

Sports, drugs and The use of drugs to improve athletic performance has been universally condemned by authorities because it endangers the health of athletes and gives users of drugs an unfair advantage. Random urine tests to detect drug abuse are performed in most sports, both during competition and at other times during the season. Certain drugs may be taken legitimately by athletes for medical disorders such as asthma or epilepsy. Care should be used, however, when taking a drug to treat diarrhea, nasal congestion, or cough because some common medications contain prohibited substances.

they also impair judgment and may cause excessive aggression, which increases the risk of injury to the user or an opponent. Stimulants, such as amphetamine drugs, carry the risk of causing arrhythmias; prolonged use may cause heart failure (reduced pumping efficiency) and increase the risk of a brain /zemorrliage. Some cold and cough remedies contain low doses of prohibited drugs and should be avoided before competition. Caffeine contained in coffee, tea, and cola drinks, and available in tablets, is another popular stimulant. Most authorities only prohibit the use of caffeine in high doses. HORMONES Two types of hormone drugs may be abused-anabolic steroids (see Steroids, anabolic) and growth hormone. Anabolic steroids are substances similar to the male sex hormone testosterone. They are used because they speed the recovery of muscles after strenuous exercise. This permits a more demanding training schedule and causes an increase in muscle bulk and strength. Anabolic steroids are used primarily by weight lifters, field event athletes, and bodybuilders. Risks of anabolic steroids include liver damage, liver tumors, and adrenal gland damage. In men they may cause infertility and impotence; in women they may cause virilization. If taken during childhood, anabolic steroids may cause short stature by affecting the growing areas of bones. Growth hormone is abused to stimulate growth of muscle; it is likely to cause acromegaly (excessive bone growth leading to deformity of the face, hands, and feet) and may cause

diabetes mel/itus. Only narcotic analgesics are prohibited but the use of any painkiller (even a weak analgesic such as acetaminophen) may aggravate an in/·ury or lead to permanent damage by al owing the individual to participate with his or her pain masked. PAINKILLERS

BETA-BLOCKER DRUGS

Beta-blocker drugs

are taken to reduce tremor in sports in which a steady hand is vital. Many authorities now prohibit these drugs in the absence of a specific medical disorder that requires them.

TYPES OF DRUGS ABUSED

Sports injuries

Four types of drugs are abused to enhance physical or mental condition. STIMULANTS Drugs of this group are taken to prevent fatigue and to increase self-confidence. However,

Any injury that arises during participation in sports. Most sports injuries are not actually specific to sports; they can also occur as the result of other activities. 935

s

SPORTS MEDICINE

The wide range of sports m1urics includes all types of fracture, head injury (including concussion), muscle tear (see Strain), figament sprain or tears, te11di11itis (inflammation of a tendon) or tendon rupture,J·oint dislocntion or su/Jluxatio11 (partial islocation), or injury to a specific organ (such as an eye

i11piry). Injuries specific to sports activities arc mostly comparatively trivial. Examples include JOgRers' 11ipple (nipple soreness caused by friction) and baseball finger (tendon rupture in a finger caused by the ball s triking the end of the finger) . Many injuries are given a sports prefix to their names, but can also be caused by injury unrelated to sports. Tennis elbow (painful inflammation of the bony prominence on the outside of the elbow) is a tvpe of overuse injury that may occur from playing tennis, but more commonly results from an activity such as sawing wood. Treatment of a sports in/·ury depends on the body part invo ved and the severity of the damage . Recovery is not complete until the damaged area is free of pain during exercise. Exercises under the guidance of a sports physician or physical therapist may be required to ensure full recovery of movement, balance, and coordination of the injured part and to restore general fitness to reduce the likelihood of further injury.

Sports medicine

s

The branch of medicine concerned with assessment and improvement of fitness and the treatment and prevention of medical disorders rcfated to sports. Sports medicine physicians give advice about exercises that improve endurance, strength, and flexibility; perform fitne ss tests; offer nutritional advice to improve performance; regulate the abuse of drugs by athletes (see Sports, drugs and); and provide on-site medical care at sporting events. Preventive work in sports medicine includes advising the individual on footwear, clothing, and protective equipment to reduce th e likelihood of injury, and on fluid requirements to prevent dehydration . In addition, the sports physician advises professional athletes on immunization requirements before competition abroad, on coping with jct lag, and on changes in altitude and climate. In conjunction with the physical therapi st (sec Physirnl therapy), a sports ph ysician diagnoses and treats sports injuries.

936

Spouse abuse Repeated deliberate physical injury inflicted by one spouse on the other, most often by a man on a woman. PREVALENCE

About one third of all reported assaults are by males on their female partners, and about one third of women filing for divorce describe physical abuse . There is little doubt that in addition to reported cases of spouse abuse many cases go unreported. In about 20 percent of reported cases the abuse continues for more than 10 years. CAUSES

Men who abuse their spouses have usually learned domestic violence from their parents' behavior, have an immature personality and low selfesteem, and acquire macho attitudes from their peer groups. Aggravating factors including alcohol depe11de11ce, drug abuse, stress, and obsession with the partner's sexual fidelity (sec

Jealous11, morbid). Abu·sed women in many cases stay with their partners for a combination of reasons, the most common of which are feelings of personal inadequacy, a sense of guilt leading to the belief that the violence is justified, fear of the social stigma involved in telling others about the abuse, underlying Tove for the partner, financial dependence, unwillingness to break up the family, social isolation, and depression (producing apathy). MANAGEMENT OF

THE PROBLEM

Shelters have been opened in some areas to provide a temporary refuge for abu sed women and their children. More effective means of enforcing alimony payments by the courts would provide women with the financial resources needed to leave their partners. Marital co1111seli11g al so has a role, provided the couple wishes to address the problem openly. The best long-term approach to reducing the scale of the problem probably lies through education and a downgrading of the traditional macho view of acceptable male behavior.

Sprain Tearing or stretching of the ligaments that hold together the bone ends in a joint, caused by a sudden pull. The fibrous capsule that encloses the joint may also be damaged. The most commonly sprained joint is the ankle; it is usuafly sprained as a result of "going over" the outside of the foot so that the complete weight of the body is placed on the ankle.

A sprain causes painful swelling of the joint, which cannot be moved without increasing the pain. There may also be spasm (involuntary contraction) of surrounding muscles. TREATMENT

An X ray of theJ·oint is usually performed to exclu e the possibility of fracture. Treatment consists of applying an ice pack to reduce swelling, wrapping the joint with a compression bandage, resting it in a raised position until the pain and swelling begin to subside, and taking analgesics (painkillers) to relieve pain. Once the joint is no longer painful, it should be gently exercised. If ligaments are badly torn, mmsteroufal m1ti-i11flm11111atory drn~s may be prescribed to speed healing. In extremely severe cases, surgical repair may be necessary.

Sprue A disorder of the intestines that causes failure to absorb nutrients from food. There are two forms of sprue. One occurs mainly in tropical regions (see Sprue, tropical); the other, celiac sprue, occurs more widely and is due to sensitivity to the wheat protein gluten.

Sprue, tropical A disease characterized by chronic 111alabsorptio11 (impaired absorption of nutrients from the diet by the small intestine) and, as a result, mal1111tritio11. As in cc/iac sprne, villi (frondlike projections) on the lining of the intestine become flattened, decreasing their surface for absorption. CAUSE AND INCIDENCE

The cause of tropical sprue is unknown, but it may result from an infection of the intestine. The disease occurs in tropical regions (e.g., the Caribbean, Far East, and India) . SYMPTOMS AND TREATMENT

Symptoms include loss of appetite, weight loss, megaloblastic a11e111ia (caused by a deficiency of folic acid and vitamin Bd, an inflamed mouth, sore tongue, and greasy diarrhea . The diagnosis is confirmed by a jejuna) biopsy (removal of a small sample of tissue from the upper small intestine for analysis). The disease responds well to treatment with antibiotic drugs and dietary supplements of folic acid, vitamin B12, and other vitamins and minerals if necessary.

Sputum Mucous material produced by the cells lining the respiratory tract. Also known as phlegm, sputum is released

SQUAMOUS CELL CARCINOMA

FIRST AID:

allergic reaction normally produces colorless sputum, and pulmonary edema (fluid retention in the lungs) may result in frothy, pink sputum. Hemoptysis (blood in the sputum) may be caused by infection or lun'\ cancer. Sputum may be examined under a microscope or prepared to culture any bacteria that might be present.

SPRAINS

r--------------, I I I I

WARNING

A severe sprain may be indistinguishable from a broken bone. If in doubt, treat as a fracture .

I I I I

L.-------------.J

Squamous cell carcinoma One of the three most common types of skin cancer; the others are basal cell carcinoma and malignant 111e/ano111a. CAUSES AND INCIDENCE

1

The victim may not be able to move the affected joint or stand up if the knee or ankle is injured. Help the victim

into a comfortable position and raise the injured body part.

2

3

If the sprain is recent, apply a cold compress to the affected area and leave for about 30 minutes . This will reduce blood flow and swelling

Cover the area with a roll of cotton and secure with a bandage . Make two turns around the foot, bring it across the top , and around the ankle.

Squamous cell carcinoma arises from flattened, scalelike cells in the skin, usually areas that have been exposed to strong sunlight for many years and that may already have developed actinic or solar keratoses. This cancer is most common in pale-skinned, fairhaired people older than 60. The incidence is also higher in people whose work has exposed them to compounds such as arsenic, tar, coal, paraffin, or heavy oils.

A squamous cell carcinoma This tumor has sp read slowly to cover much of the area in front of the patient's ear It can be treated by radiation therapy. SYMPTOMS AND SIGNS

The tumor starts as a small, firm, painless lump or patch (usually on the lip, ear, or back of the hand) and slowly enlarges, often resembling a wart or ulcer. If untreated, it may spread to other parts of the body and prove fatal. All suspicious skin lesions should be reported to a physician.

4

Continue figure-of-eight turns, with each tu rn of the bandage overlapping the last turn by three fourth s of its width .

from glands in the walls of the bronchi (airways) and from cells lining the nose and sinuses. Sputum production may be increased by infection (see Respiratory tract infection), by an allergic reaction (see Asthma; Rhinitis, allergic), or by

5

Bandage until the foot (not toes), ankle, and lower leg are covered Secure the loose end . Seek medical aid- an X ray may be necessary.

inhalation of irritants, such as tobacco smoke (see Cough , smokers'). The presence of sputum in the bronchi triggers a reflex cough . The character of sputum varies. A bacterial infection usually causes yellow or green sputum, an

DIAGNOSIS AND TREATMENT

The diagnosis is based on a skin biopsy (removal of a small sample of tissue for analysis). The tumor is either removed surgically or destroyed by radiation therapy or Cr1/osurgery (application of extreme cold). Treatment with anticancer drugs may also be necessary. Any person who has had a squamous cell carcinoma should limit his or her exposure to sunlight. A follow-up examination is required to check for recurrence.

937

s

SQUINT

Squint See Strabismus.

Stable Unmoving, fixed, resistant to change, or in a state of equilibrium. A patient's condition is described as stable when it is neither deteriorating nor improving; a stable personality is one that is not susceptible to abnormal behavioral excesses or mental illness. ln chemistry, a stable substance is one that is resistant to changes in its chemical composition or physical state, or is not radioactive.

Stage A term used in medicine to refer to a period or phase in the course of a disease, particularly in the progression of cancer. In assessing most types of cancer, a method (staging) is used to determine how far the cancer has progressed. The cancer is described in terms of how large the main tumor is, the degree to which it has invaded surrounding tissue, and the extent to which it has spread to lymph glands or other areas of the body. In Hodgkin's disease, staging also takes into account whether the lymph nodes on both sides of the diaphragm are affected, and whether the spleen is involved. Staging not only helps to assess outlook (in general, the more advanced the stage, the worse the outlook) but also the most appropriate treatment. For example, a cancer at a particular stage may respond better to radiation therapy than to surgery.

Staining

s

The process of dyeing specimens of cells, tissues, or microorganisms so that they are clearly visible or easily identifiable under a microscope. Staining is also sometimes carried out to detect or identify certain chemical substances in cells. Before a specimen can be examined under a microscope, it must be preserved and then sliced (or smeared) extremely thinly. After these procedures, most specimens are almost transparent, so staining is necessary to make them easily visible. In cytology (the study of cells), cells are most commonly stained by the Papanicolaou (Paf) method; in histology (the study o tissues), the most commonly used stain is hematoxylineosin, a double stain that colors nuclei blue and cytoplasm pink. Many other stains can be used to identify particular structures or products within cells. These stains may be

938

used in addition to hematoxylin-eosin to clarify a diagnosis or to identify a particular microorganism in tissues. In bacteriology, Gram's stain is widely used to identify and differentiate between groups of bacteria. A more recent development is the use of special fluorescent dyes that stain specific chemical constituents of cells or tissues; when illuminated with ultraviolet light, the stained constituents glow. Another widely used technique called immunoperoxidase staining involves labeling (washing) the cells with antibodies to various cell components or cell chemicals. The antibodies are tagged with a dye that can be seen under the microscope as red-brown, enabling the observer to identify certain components if they are present within the cell.

Stammering See Stuttering.

Stanford-Binet test A type of intelligence test.

Stanozolol A steroid drug (see Steroids, anabolic).

Stapedectomy An operation to treat hearing loss caused by otosclerosis. In this disorder, the base of the stapes (the innermost of the three sound-conducting bones in the middle ear) becomes fixed to the entrance of the inner ear by an overgrowth of spongy bone. As a result, the stapes can no longer move freely to transmit sound to the inner ear. This form of deafness, often familial , is helped by a hearing aid but is curable only by surgery. HOW IT IS DONE

Using a local or general anesthetic, an incision is made in the ear canal and the eardrum is folded forward. All or most of the stapes is removed and a plastic or metal prosthesis is inserted into the entrance to the inner ear; the other end is attached to the incus (the middle auditory ossicle). In this way, sound can once again be successfully transmitted to the inner ear. The eardrum is then repaired. OUTLOOK

The operation improves hearing considerably in more than 90 percent of cases. However, in about 1 percent of patients, hearing deteriorates or is lost altogether. Because of this risk, a stapedectomy is usually carried out on onfy one ear at a time, although otosclerosis usually affects both ears.

Stapes Also known as the stirrup because of its shape, the stapes is th.e innermost of the three tiny, sound-conducting bones in the middle ear called auditory ossicles (see Ear); it is the smallest bone in the body. The head of the stapes articulates with the incus (the middle auditory ossicle) and its base fits into the oval window in the wall of the inner ear. Overgrowth of bone that causes the stapes to become fixed in position (otosc/erosis) can cause deafness.

I

Staphylococcal infections > A group of infections / ·. caused by bacteria of ~he .·. · staphylococcus family. (&, ·•·•. ···. Staphylococci, which grow in grapelike dusters, are a common cause of skin infections but can also cause serious internal disorders. Staphylococcal bacteria are present harmlessly on the skin of most people. If the bacteria become trapped within the skin by a blocked sweat or sebaceous gland, they may cause superficial skin infections, such as pustules, boils, abscesses, styes, or carbuncles. Infection of deeper tissues may result if the skin is broken (see Wound infection). In newborn babies, toxins released by bacteria on the skin can cause a severe, blistering rash called the scalded skin syndrome (see

Necrolysis, toxic e!idermal). Staphylococca bacteria are also harmlessly present in the membranes that line the nose and throat. When mucus is not cleared from the lungs, such as after a viral infection, organisms may accumulate in the lungs and cause pneumonia. In menstruating women (particularly those using highly absorbent tampons), toxin-producing staphylococci may colonize the mucous membranes lining the vagina, causing toxic shock syndrome. A different type of staphylococcus can cause urinary tract infection. Sometimes staphylococci enter the bloodstream as a result of spread from a skin infection or as a result of introduction from a needle, leading to septic shock, infectious arthritis, osteom1/elitis, or bacterial endocarditis. · Staphylococcal food poisoning is caused by ingestion of toxins produced by the bacteria . A common source of contamination is a pustule on the skin of a food handler.

Starch See Carbohydrates.

STERILIZATION

Starvation A condition caused by lack of food over a long period, resulting in weight loss, changes in 111eta/1olism (body chemistry), and extreme hunger. (Sec also Anorexia nervosa; Fasting; Nutri-

tional disorders.)

Stasis A reduction or cessation of flow. For example, in venous stasis there is diminution or complete stoppage of blood flow through one or more veins.

cause public concern, such as alcohol or drug abuse, accidents, violence, or diseases such as AIDS, coronary heart disease, and cancer. Comparison of th e vital statistics of different countries (or regions within a country) gives a measure of the relative health of their populations as a whole. A detailed comparison may also show variations between social classes or ethnic groups. (Sec also Life

expectancy; Statistics, medical; Centers for Disease Control.)

Statistics, medical

Status asthmaticus

The science of medical statistics has grown rapidly in recent years as physicians feel increasing pressure from insurance companies and the public to evaluate and choose among the numerous medical treatments available. As a result, all medical research institutions today employ statisticians to advise on the design and interpretation of medical trials, and on the interpretation of data obtained from such trials. For example, when two treatments are to be compared (or the results of surgical treatment are to be compared with not operating), the statistician advises on how many patients are required in the trial to establish a valid conclusion. He or she also advises on other aspects of methodology, including how to allocate patients to various treatment groups, how frequently to take measurements of the outcomes of the treatments, and how to analyze the mathematical results. In addition to assessing treatments, statisticians are involved in the analysis of other medical data, which may be as diverse as the i11cide11ce and prevalence of various disorders and diseases, infection rates after surgery, waiting times in outpatient clinics, and the frequency of side effects from drugs. (See also Statistics, vital.)

A severe and prolonged attack of asthma. Status asthmaticus is a serious and potentially life-threatening condition that requires urgent treatment.

Statistics, vital

See Polycystic ovary.

Assessment of the health of a country's population, which relies on the collection of data on birth and death rates and the causes of death (see Mortality). In most Western countries today, all deaths are certified (usually by a medical practitioner) and recorded in a national register. They are then classified by cause and analyzed according to factors such as age, sex, occupation, social class, and ethnic group. Particular attention is paid to deaths associated with childbirth (see Maternal mortalit1/; lllfant mortality) or with factors that

Status epilepticus Prolonged or repeated epileptic seizures without any recovery of consciousness between attacks. Status epilcpticus is a medical emergency tnat may be fatal if not treated promptly. It is more likely to occur if anticonvulsmlt drugs are taken erratically or if they are withdrawn suddenly. (Sec Epilepsy.)

STDs See Sexually trm1smitted diseases .

Steatorrhea The presence of excessive fat in the feces. Steatorrhea causes diarrhea characterized by offensive-smelling, bulky, loose, greasy, pale-colored feces, which tend to float in the toilet and are difficult to flush away. Steatorrhea is a symptom of diseases that interfere with the breakdown and absorption of fat in the diet (notably pancreatitis and ce/iac sprue) and of the removal of large segments of small intestine. It is also a side effect of some lipid-lowering drugs.

Stein-Leventhal syndrome Stenosis Narrowing of a duct, canal, passage, or tubular organ, such as a blood vessel or the intestine. Aortic stenosis is narrowing of the aortic valve opening from the left ventricle (lower chamber of the heart); pyloric stenosis is narrowing of the pylorus (the lower outlet from the stomach).

Stereotaxic surgery Brain operations carried out by inserting delicate instruments through a surgically created hole in the skull

and guiding them, using X rays or CT scanning, to a specific area. WHY IT IS DONE

Stereotaxic procedures are used in the treatment of pituitary gland tumors, in which the gland is cut out or a radioactive implant is inserted into the gland to destroy it. Other uses include a brain biopsy (taking a small sample of tissue for analysis), insertion of permanent stimulating wires to control otherwise intractable pain, and destruction of areas of the brain to treat disabling neurological disorders, such as severe depression (see Psyc/10s11rgery) or, in rare cases, temporal lobe epilepsy. Stereotaxic surgery is also occasionally used to treat people with Parkinson's disease in whom severe tremor has not responded to drugs . HOW IT IS DONE

With the use of a general or local anesthetic, an adjustable metal frame is attached to the skull with screws. The area to be treated is located by X rays or CT scanning and the best position for inserting the instrument is calculated mathematically. The skull is then entered by means of a burr hole or cra11ioto111y, and the angle of the frame is adjusted to hold and guide a hollow tube into the brain at the correct angle . The required instrument (a needle for biopsies, a scalpel or diathermy probe for cutting or destroying areas) is then inserted through the tube and the operation is performed; more X rays or scans may be taken during the procedure.

Sterility The state of being germ-free, or a term for permanent infertility.

Sterilization A term that refers to the complete destruction or removal of living organisms or to any procedure that renders a person unable to reproduce (see Sterilization, female; Vasectomy). The elimination of microorganisms is vitally important in preventing the spread of infection. It may be achieved by various physical or chemical means, such as by boiling, steaming, or autoclaving (steaming under high pressure); irradiation with ultraviolet light or X rays; or applying antiseptics or disinfectants. Sometimes, more than one method is used (e.g., bed linen may be disinfected and then autoclaved). Liquids can also be sterilized by passing them through extremely fine filters that trap microorganisms as tiny as viruses. 939

s

STERILIZATION, FEMALE

Sterilization, female A usually permanent method of contraception in which the fallopian tubes are sealed or cut to prevent the male sperm from reaching the ova. Sterilization is a common method of contraception; nearly 10 percent of women over the age of 30 and one fourth of women with five or more children have been sterilized. WHY IT IS DONE

Women who have completed their families or do not plan to have children may choose to be sterilized to avoid the inconvenience or side effects of other methods of contraception. Sterilization may also be chosen by a woman in whom a pregnancy would be a serious threat to health, or in whom there is an unacceptably high risk of children being affected by a serious hereditary disease. HOW IT IS DONE

The illustrated box shows common procedures for female sterilization, performed using laparoscopy.

FEMALE STERILIZATION Laparoscopic sterilization (below) is the most common method . Both fallopian tubes must be cut, sealed , or otherwise obstructed so that eggs and sperm cannot meet for fertiliza tion to occur.

Alternatively, the surgeon may work directly through a small incision just below the navel. Known as a minilaparotomy, this procedure is carried out in the first few weeks after a woman has delivered a baby, when the uterus is high in the abdomen and the fallopian tubes can be reached easily. In other cases, the surgeon may approach the fallopian tubes via the vagina. The tubes are cut and tied off. Surgical removal of the uterus, fallopian tubes, or ovaries to treat specific disorders also results in sterilization. These operations are performed through a larger abdominal incision and today are considered too drastic to be performed only for sterilization. In an investigational method, a hysteroscope (a type of endoscope) is passed through the vagina into the uterus; the exits to the fallopian tubes are plugged from the inside. Most sterilization techniques are performed on an outpatient basis. Surgical removal of the uterus (see

~ ~

Cutting

IG5l

Constriction

~

A small loop of the fallopian tube may be drawn up, secured by a tight ligature, and then cut off. The loop is constricted by a tight band . Reversal is possi ble with this sterilization technique.

Clipping .

.

s Laparoscopic sterilization An endoscope (viewing tube} and an operating instrument are passed through separate small incisions in the abdomen.

Instruments The trocar is a sharppointed inner stylus surrounded by a closefitting tube. the cannula. The instrument can be passed through th e abdominal wall . After insertion. the trocar is removed, leaving the hollow cannula in place Other instruments are passed through the hollow cannula.

940

~

A plastic or metal clip may be applied to obstruct egg passage. In theory. this method is al so reversible .

Cautery Electrocoagulation (diathermy) can be used to burn through and thus seal the fallopian tube .

Hysterectomy) or fallopian tubes and (see Salpingo-ooplwrectomy; Ooplwrectomy) requires a hospital stay.

ovaries

OUTLOOK

Sterilization has a small failure rate; if pregnancy does occur after sterilization, the chance of an ectopic pregnancy is 10 times greater than the normal rate. Although sterilization should be considered permanent, microsurgical techniques may be successfuf in restoring fertility; 70 to 75 percent of women who undergo such surgery later achieve pregnancy.

Sterilization, male See Vasectomy.

Sternum The anatomical name for the breastbone, the long, narrow, flat plate of bone that forms the central part of the front of the chest. The sternum consists of three main parts--an upper, triangular portion, called the manubrium; a long, narrow middle part, the body; and, at the lower end, a small, slightly flexible, leaf-shaped projection, the xiphoid process. The upper part of the manuorium articulates with the inner ends of the two clavicles (collarbones); attached to the sides of the manubrium and body are the seven pairs of costal cartilages that join the sternum to the ribs. Between the manubrium and body is a type of joint known as a symplzysis. It aflows slight movement between these two parts of the sternum when the ribs rise and fall during breathing. The sternum is very strong and requires great force to fracture it. The principal danger of such an injury is not the fracture itself, but the possibility that the broken bone may be driven inward and damage the heart (which lies behind the sternum).

Steroid drugs COMMON DRUGS Nandrolone Oxandrolone Stanozolol

A group of drugs that includes the corticosteroid drugs, which are similar to hormones produced by the cortex of the adrenal glands, and the anabolic steroid drugs (see Steroids, anabolic), which have an effect similar to that of the hormones produced by the male sex organs.

Steroids, anabolic Drugs that have an anabolic (proteinbuilding) effect similar to testosterone and other male sex hormones.

STILLBIRTH

LOCATION OF THE STERNUM The sternum , or breastbone, is joined to the ribs and clavicles by flexible couplings that allow adequate freedom of the chest while breathing in and out.

hole in its center. A physician presses the diaphragm against a patient's chest or back to hear high-pitched sounds. The concave bell side is placed in gentle contact with the skin to hear low-pitched sounds.

Stevens-Johnson syndrome A rare skin condition characterized by severe blisters and bleeding in the mucous membranes of the lips, eyes, mouth, nasal passage, and genitals. Stevens-Johnson syndrome is a severe form of erythema multiforme.

Sticky eye A common description of one of the symptoms of conjunctivitis (inflammation of the conjunctiva[ membrane) in which the eyelids become stuck together with discharge.

Stiff neck

WHY THEY ARE USED

Anabolic steroids, by mimicking the anabolic effects of testosterone, build tissue, promote muscle recovery following injury, and help strengthen bones. They are given to treat some types of anemia and, infrequently, to treat postmenopausal women who have osteoporosis. ABUSE

Anabolic steroid drugs have been widely abused by athletes despite the serious risks to health (see Sports,

A very common symptom, usually due to spasm (involuntary contraction) in muscles at the side or back of the neck. In most cases, the spasm occurs suddenly and for no apparent reason. It is usually first noticed as a stiff neck upon waking and is called tortico/lis, or wryneck. Torticollis is thought to occur as a result of a minor neck injury-such as a ligament sprain or subluxation (partial dislocation) of a cervical (neck) joint-that has passed unnoticed but has caused irritation of the cervical spinal nerves; this, in turn, leads to spasm of the neck muscles. A stiff neck due to muscle spasm may also be caused by a disk prolapse or by a whiplash injury in the cervical spine. A relatively rare, but potentially serious, cause of a stiff neck is meningitis (infection of the meninges, the membranes that surround the brain and spinal cord). In such cases, the stiffness is usually accompanied

drugs and). POSSIBLE ADVERSE EFFECTS

Adverse effects include acne, edema, liver and adrenal sland damage, infertility, impotence m men, and virilization in women.

Stethoscope An instrument for listening to sounds in the body, particularly those made by the heart or lungs. The standard stethoscope consists of a Y-shaped flexible plastic tube with an earpiece at the end of each arm of the Y, and a sound-detecting device at the base. One side of this device consists of a thin plastic diaphragm; the other side has a concave bell that has a

STETHOSCOPE

Earpieces

by headache, vomiting, fever, photophobia (abnormal sensitivity to light), and intense pain when bending the neck.

Stiffness A term used to refer to difficulty in moving a joint, to restriction of movement in a joint, or to difficulty stretching a muscle. Causes of joint stiffness include arthritis (inflammation of joint surfaces) and capsulitis (inflammation of the joint lining). In rheumatoid arthritis, severe joint stiffness may last up to two hours after waking. Causes of muscle stiffness include cra111p and spasticity (increased rigidity).

Stillbirth A baby born dead after the 28th week of pregnancy. Stillbirth is also called late fetal death. Stillbirths must be reported and the cause of death recorded on the death certificate. INCIDENCE

The incidence of stillbirth has decreased dramatically in developed countries over the last 50 years. In the US the incidence fell from 19.2 stillbirths per 1,000 total births (i.e., live births plus stillbirths) in 1950 to 9.2 stillbirths fer 1,000 total births in 1980. In genera , stillbirths are more common in poor communities, among older women, and when good prenatal and obstetric care are lacking. CAUSES

The precise cause of stillbirth is unknown in at least one third of cases. Severely malformed babies, particularly those with anencephaly, spina bifida, or hydrocephalus, account for at least one fifth of stillbirths. A maternal disorder, such as

antepartu m hemorrhage, hypertension (high blood pressure), or any other condition affecting the function of the placenta, may result in stillbirth, often because the fetus is deprived of oxygen. Another cause is Rh incompati&ility between mother and baby. Some infectious diseases (including measles, chickenpox, influenza, toxoplasmosis, rubella, cytomegalovirus, herpes simplex, syphilis, and malaria) may harm the fetus if contracted during pregnancy. In general, the more severe the infection, the greater the risk of stillbirth. A pregnant woman who is exposed to an infectious disease to which she is not immune should consult her physician. PSYCHOLOGICAL EFFECTS

Bell

The loss of a baby is deeply distressing. The bereaved parents usually 941

s

STILL'S DISEASE

experience a sense of loss that is just as intense as if any other loved person had died, and often they experience feelings of depression, guilt, anger, and inadequacy. Emotional support from friends, relatives, and self-help groups is useful, as is counseling by a medical professional.

Still's disease See Rheumatoid arthritis, juvenile.

Stimulant drugs COMMON DRUGS

Nerve stimulants Caffeine Dextroamphetamme Methylphenidate Respiratory stimulants Doxapram Nikethamide

Drugs that increase nerve activity in the brain by initiating the release of 11orepi11ephrine from nerve endings (see Neurotransmitter). TYPES

There are two main groups of stimulant drugs-nerve stimulants (including amphetamine drngs), which reduce drowsiness and increase alertness by their action on the reticular activating system in the brain stem, and respiratory stimulants (see Analeptic drugs), which act on the respiratory center in the brain stem. WHY THEY ARE USED

s

Nerve stimulants are given to treat 11arcolepsy (characterized by excessive sleepiness). Paradoxically, they have also been found useful in the treatment of hyf1eractivity in children. Nerve stimu ants also suppress the appetite but their use in the treatment of obesity has decreased because of their adverse effects. Despite the risk of adverse effects, nerve stimulants are sometimes abused because they prevent fatigu e, increase alertness, and may improve self-confidence. The use of nerve stimulants by athletes is widely condemned by physicians and sports organizations (see Sports, drugs and) . POSSIBLE ADVERSE EFFECTS

Effects include shaking, sweating, palpitations, nervousness, sleeping problems, hallucinations, paranoid delusions, and seizures. Long-term use may lead to tolerance (the need for greater amounts to have the same effects) and drug depe11dence.

Stimulus Anything that evokes a response (i .e., an agent or event that directly results in a change in the activities of the body 942

as a whole or of any individual part) . For example, the sight and smell of food stimulate salivation. Certain nerve cells (known collectively as receptors ) are specialized to respond to specific stimuli . One example of such nerve cell specialization is the rods and cones in the retina of the eye that respond to light.

In most cases, the heart soon starts beating again, the skin flushes, and consciousness is regained. If this fails to happen, cardiopulmonary resuscitation should be carried out promptly to prevent brain damage. Most sufferers are fitted with a pacemaker to maintain normal heart beat and prevent future attacks.

Stings

Stoma

Stinging animals include scorpions and some insects (such as bees and wasps), jellyfish and related marine animals (such as anemones and corals), and some fish (such as stingrays). There are marked differences among these groups in the way the sting is delivered and its effects. (See Insect sti11gs; Scorpion stings; Jellyfish sti11gs; Ve11omous bites and stings.) Nettles and some other plants carry minute stinging hairs that hold an irritant liquid. The hairs penetrate and break off in the skin; the liquid enters the wound and has an immediate irritant effect, which rarely lasts more than an hour or two. Washing the affected area and applying calamine lotion can provide relief. Contact with poison ivy and related plants may result in a more severe allergic reaction, sometimes requiring medical attention (see Plants, poisonous) .

A term meaning mouth or orifice. A stoma in the abdomen acts as an artificial anus; it may be temporary (diverting feces from a healing wound in the intestine) or permanent (because part of the intestine has been removed). See also Colostomy; Ileostomy .

Stitch A temporary, sudden, sharp pain in the abdomen or side that occurs during severe or unaccustomed exercise, usually running. The cause of a stitch is unknown. Stitch is also commonly used to refer to a suture used to close a wound (see Suturing) .

Stomach A hollow, saclike organ of the digestive system that is connected to the esophagus and the duodenum (the first part of the small intestine). The stomach lies in the left side of the abdomen under the diaphragm. STRUCTURE

The stomach is flexible, allowing it to expand when food is eaten; in an adult, the average capacity is about 3 LOCATION OF THE STOMACH

Food enters the stomach from the esophagus and exits into the duodenum. The stomach lining sec retes gast ri c juice and protective mucus. Fundus _ _ _ _ Muscle -

~

- ----,.

Stokes-Adams syndrome Recurrent episodes of temporary loss of consciousness caused by insufficient blood flow from the heart to the brain. This deficient blood supply is due to very rapid or very slow arrhythmia (see Arr'1ytlz111ia, cardiac), which markedly reduces the pumping efficiency of the heart, or to complete heart block (abnormally slow conduction of electrical impulses through the heart muscle), resulting in temporary cessation of the heart beat. SYMPTOMS AND TREATMENT

In a typical attack, the person faints suddenly and turns blue if the period of unconsciousness is prolonged. The breathing rate increases and a very slow pulse can be felt. Occasionally, lack of oxygen supply to the brain may cause a seiw re (convulsion) .

Pyl oric sphincter

Parts of the stomach The fundus and antrum are two of -th e main stomach parts: the lower esophageal segment and pyloric sphincters control entry and exit of food

STOMACH CANCER

DISORDERS OF THE STOMACH Disorders of the stomach have a variety of causes. Because the stomach is a reservoir, disorders in the process of emptying the stomach contents occur. Other problems relate to the stomach's role in the preparation of ingested food for digestion.

due to the appearance of secondary growths elsewhere in the body. Benign (noncancerous) polyps can also develop in the stomach. ULCERATION

· The acid and other digestive juices secreted by the stomach sometimes attack the stomach lining. The healthy stomach is prevented from INFECTION digesting itself mainly by the The large amount of hydrochloric protective layer of mucus secreted acid secreted by the stomach by the lining and by the speed with protects the stomach from some infections by destroying many of the which damaged surface cells are replaced by the deeper layers. Many bacteria, viruses, and fungi that are influences can upset this delicate taken in with food and drink. When balance. One of the most important the protective power is insufficient, a is excessive acid secretion. The variety of gastrointestinal infections resulting peptic ulcers are probably may occur. the most common serious stomach disorder. Peptic ulcers are TUMORS sometimes caused by stress, or by Stomach cancer causes about severe injury, such as major burns. 15,000 deaths annually in the US. accidents, and after surgery and Early symptoms are often mistaken severe infections; often they occur for indigestion and diagnosis is often for no apparent reason. The delayed until it is too late for a cure. stomach lining can be damaged by Any change in the customary large amounts of aspirin or alcohol , functioning of the digestive system is sometimes causing gastritis important. especially after fifty. A (inflammation of the stomach lining). persistent feeling of fullness. or pain before or after meals. should never be This may lead to ulceration of the stomach lining. ignored. Unexplained loss of appetite or frequent nausea should always AUTOIMMUNE DISORDERS be reported. A tumor in the upper Pernicious anemia is caused· by the part of the stomach, near the opening failure of the stomach lining to produce of the esophagus, can cause obstruction and difficulty in swallowing . intrinsic factor, a substance whose role is to facilitate the absorption of vitamin Sometimes a stomach tumor remains B 12. Failure to produce the intrinsic "silent" and the first signs are

pints (1.5 liters). The stomach wall consists of layers of longitudinal and circular muscle, lined by special glandular cells that secrete gastric juice, and supplied by blood vessels and nerves. A strong muscle at the lower end of the stomach forms a ring called the pyloric sphincter that can close the outfet leading to the duodenum. FUNCTION

Although the main function of the stomach is to continue the breakdown of food that is started in the mouth and completed in the small intestine, it also acts as a storage organ, enabling food to be eaten only two or three times a day. Food would have to be eaten every 20 minutes or so if storage were not possible. The sight and smell of food and the arrival of food in the stomach stimulate gastric secretion. The gastric juice secreted from the stomach lining con-

tains pepsin (an enzyme that breaks down protein), hydrochloric acid (which kills bacteria taken in with the food and which creates the most suitable environment for the pepsin to work in), and intrinsic factor (which is essential for the absorption of vitamin B12 in the small intestine). The stomach lining also contains glands that secrete mucus, which helps provide a barrier to prevent the stomach from digesting its~lf. The layers of muscle produce rhythmic contractions about every 20 seconds that churn the food and gastric juice; the combined effect of this movement and the action of the digestive juice convert the semisolid food into a creamy fluid. This process takes varying lengths of time, depending on the nature of the food. Generally, however, the richer the meal, the longer it takes to be emptied

factor occurs if there is atrophy of the stomach lining, which also causes failure of acid production. Tests that determine a person's ability to absorb vitamin B12 are important in the investigation of this condition. Pernicious anemia is usually due to an autoimmune disorder. OTHER DISORDERS

Enlargement of the stomach may be caused when scarring from a chronic peptic ulcer occurs at the stomach outlet. It may also be a complication of pyloric stenosis, a rare but serious condition caused by narrowing of the stomach outlet. Rarely, the stomach may become twisted and obstructed , a condition called volvulus.

INVESTIGATION

Stomach disorders are investigated primarily by barium X-ray examinations and/or gastroscopy. Occasionally, a biopsy (removal of a tissue sample for microscopic analysis) is performed.

from the stomach. The partially digested food is squirted into the duodenum at regular intervals by the contractions of the stomach and relaxation of the pyloric sphincter.

Stomach cancer A malignant tumor that arises from the lining of the stomach, also called gastric cancer. CAUSES AND INCIDENCE

The cause of stomach cancer remains uncertain but evidence suggests that an environmental factor, probably diet, plays a part. Recent speculation has centered on an association between stomach cancer and eating quantities of salted, pickled, or smoked foods. Certain other factors, such as megaloblastic anemia, partial gastrectomy, and belonging to blood group A, seem to increase the risk of this cancer developing. 943

s

STOMACH IMAGING

Stomach cancer rarely affects people under the age of 40 and is twice as common in men as in women. There is marked geographic variation- with a very high rate of 80 to 90 cases per 100,000 people in Japan compared with fewer than 10 per 100,000 in the US, where it causes around 15,000 deaths per year. There has been a dramatic decrease in the worldwide incidence of stomach cancer over the past 50 years. SYMPTOMS AND SIGNS

The symptoms of stomach cancer (if any) are often indistinguishable from those of peptic ulcer. In the advanced stages, there is usually loss of appetite, the sensation that the stomach is filling up quickly, nausea and vomiting, and weight loss. DIAGNOSIS AND TREATMENT

The condition is suggested by barium X-ray examination and confirmed by gastroscopy (examination of the stomach by a flexible viewing tube). A biopsy of the stomach lining (removal of a tissue sample for microscopic examination) may also be performed using a gastroscope. The only effective treatment is gastrectomy. However, only about 20 percent of patients are able to undergo such surgery; in the rest, the tumor has spread too widely at the time of diagnosis. In inoperable, advanced cases, radiation therapy and anticancer drugs may be used.

Stones Small, hard aggregates of solid material within the body. Also called calculi, they are formed from substances that are present to excess in fluids such as urine or bile. (See

Calculus , urinary tract; Gallstones.)

Stool Another word for feces.

Stork bite A small, flat, harmless, pinkish-red skin blemish found in 30 to 50 percent of newborn babies. Such marks, which are also called salmon patches, are a type of lzema11gio111a usually found arouncf the eyes and at the nape of the neck. Stork bites around the eyes usually disappear within the first year; those at the base of the neck may persist indefinitely.

Strabismus A condition in which there is abnormal deviation of one eye in relation to the other. Strabismus, also known as squint, may be convergent (crosseye), in which one eye is directed too far inward, or divergent (walleye), in which one eye is directed outward. Occasionally, one eye is directed upward or downward relative to the other (vertical strabismus). CAUSES

Strabismus usually starts in early childhood because of a failure in the

OUTLOOK

s

If the cancer is detected at a very early stage (before it has spread beyond the stomach lining), a high cure rate is possible. In Japan, where mass screening by gastroscopy is performed, 85 percent of people are still alive five years after treatment by surgery . In advanced disease, however, the outlook is not good, with le ss than 10 percent of patients surviving longer than five years.

Stomach imaging

Convergent strabismus This boy is using his right eye (note th e light reflection in the center of the pupil) . Left visual development has stopped.

See Barium X-ray exami11atio11s.

Stomach pump See Lavage, gastric.

Stomach ulcer A raw area in the stomach lining, also called a gastric ulcer. If nonmalignant, it is a peptic ulcer.

Stomatitis Any form of inflammation or ulceration of the mouth. Examples include

111011th ulcers, cold sores, ca11didiasis (thru sh), and Vincent's disease. 944

Divergent strabismus Simultaneous perception with both eyes would cause double vision, so the brain suppresses the image from the deviating eye

proper development of the mechanisms that align the two eyes. A common contributory factor is lzyperopia (farsightedness), which forces the child to accommodate (focus to see clearly) excessively and causes the eyes to turn inward. In children who are acquiring the capacity to see simultaneously with two eyes, strabismus causes double vision and noncorresponding, different images from the malaligned eyes. Because of the double vision, the brain rapidly suppresses the image from the deviating eye. Strabismic amblyopia (visual loss) may occur. In adults, strabismus may occur as a result of various disorders of the brain, of the nerves controlling the eye muscles, or of the eye muscles themselves. It may be a symptom of stroke,

diabetes

mellit11s, multiple

sclerosis,

tumor, or thyroid eye disease. Strabismus that develops in adults causes double vision; although untreated strabismus may disappear, treatment is usually needed. TREATMENT

Treatment in young children may include covering the normal eye with a patch to force the child to use the weak (amblyopic) eye . This treatment attempts to allow development of normal vision in the affectecf eye by establishing the functional connections between the eye and the brain. Glasses and/or surgery can be used to try to correct the deviation of the eyes. Patching to try to improve the poor vision in the weak eye may be tried until age 10; surgery can be performed later to improve appearance. Strabismus acquired later in life always causes double vision and requires medical investigation of the underlying cause. If the strabismus does not clear up, then special glasses or surgery may be tried.

Strain Tearing or stretching of muscle fibers as a result of suddenly pulling them too far. There is bleeding into the damaged area of muscle, causing pain, swelling, and muscle spasm; a bruise usually appears a few days after the injury. Muscle strain of the back is a common cause of nonspecific back pain. Strains are most common in athletes. Treatment consists of applying an ice pack to the affected area to reduce swelling, wrapping it with a compression bandage, and resting the limb in a raised position for 48 hours . Analgesics (painkillers) may also be

STREPTOMYCIN

taken to relieve pain. After resting the muscle, physical therapy invofving stretching exercises should be started to prevent possible shortening of the muscle as a result of scar tissue forming in it. In some cases, nonsteroidal anti-infla111111atory drugs may be prescribed to speed healing. The risk of muscle strain can be reduced by performing warm-up exercises before any sports activity.

Strangulation The constriction, usually by twisting or compression, of a tube or conduit in the body, blocking blood flow and interfering with the function of the affected organ. This may occur with a hernia or after twisting of the testis (see

Testis, torsion of). Strangulation of the neck with the hands or with a ligature, such as a cord or scarf, may be deliberate or accidental. The primary lethal effect arises from compression of the jugular veins in the neck. This prevents blood from flowing out of the brain and head, where it stagnates and its oxygen content is quickly used up. In addition, compression of the windpipe restricts breathing and impairs oxygenation of the blood. The victim's face becomes congested with blood and takes on a livid purple-blue coloration. He or she loses consciousness and, some minutes later, brain damage and death occur from lack of oxygen. Any constricting ligature must be removed as quickly as possible and medical help summoned. If the victim is not breathing, artificial respiration should be performed until an ambulance or physician arrives.

FIRST AID:

STRAIN

1

Make the victim as comfort able as possible , then steady and support the inju red part.

To prevent accidental strangulation, a child's environment shouTd be kept free of potential ligatures-such as cords on toys or clothing or dangerous restraining apparatus. Children should be discouraged from playing with lassos .

Strangury A symptom characterized by a painful and frequent desire to empty the bladder, although only a few drops of urine can be passed. Causes of strangury include prostatitis (inflammation of the prostate gland), cystitis, and bladder cancer (see Bladder tumors) .

Strapping The af plication of adhesive tape to part o the body to exert pressure and hold a structure in place. Strapping is used to reduce pain and swelling caused by soft tissue injuries, such as sprains and muscle tears. It may also be applied to joints to prevent injury due to excessive movement, or to strengthen a joint that has been injured to help prevent recurrence.

Strawberry nevus A bright red, raised birthmark that is a type of hema11gio111a.

Strep throat An infection of the throat caused by certain bacteria of the streptococcus group. Strep throat is most common in children and is spread by droplets (containing the bacteria) that are coughed or breathed into the air. In some people, the bacteria cause few or no symptoms, but a proportion suffer a sore throat, fever, general malaise, and enlarged lymph nodes in the neck. In some cases, toxins released by the bacteria lead to a rash, a condition known as scarlet fever. The diagnosis is usually made by identifying the bacteria in a culture grown from a throat swab. The infection is treated with penicillin or with another antibiotic drug if the person is allergic to penicillin. An untreated strep throat infection may lead to the serious complications of glomerulonephritis (inflammation in the kidneys) or rheumatic fever.

Streptococcal infections A group of infections caused by bacteria of eo,. the streptococcus family. c:P~ Streptococci are spherical bacteria that grow like strung beads; they are among the most common disease-causing bacteria in humans.

Cbo

2

Apply a cold comp ress to reduce pain and swelling . Seek medical aid.

Certain types of streptococci are present harmlessly in most people's mouths and throats. If the bacteria gain access to the bloodstream (sometimes after dental treatment), they are usually destroyed. However, in some people with heart valve defects there is a risk of the bacteria settling in the heart to cause bacterial endocarditis. Another type of streptococcus is present harmlessly in the intestines but can spread, via the urethra, to cause :i

urinary tract infection. Other types of streptococci cause

tonsillitis, strep throat, otitis media (middle-ear infection), pneumonia, erysipelas, or wound infections. Beta-hemolytic streptococcal infection may be the cause of any of the aforementioned, or may result in scarlet fever (characterized by a rash). Infections from these same streptococci may also give rise to the serious complications of rheumatic fever and glomerulonephritis . These infections are prevented through prompt treatment with antibiotic drugs (most often penicillin). People in whom rheumatic fever has developed are advised to take an antibiotic drug before, during, and after dental treatment and certain diagnostic and surgical procedures.

Streptokinase A thrombolytic drug used to dissolve blood clots in myocardial infarction (heart attack) and pul111v11ar1/ embolism. Streptokinase is most effective in dissolving newly formed clots. Given by injection in the early stages of a heart attack, streptokinase may limit the amount of damage that is caused to the heart muscle . Treatment with streptokinase is strictly supervised because of the risk of allergic reaction or excessive bleeding. Other adverse effects include rash, fever, wheezing, and arrhythmias (irregularities of the heart beat).

Streptomycin An antibiotic drug used to treat a number of uncommon infections, including tularemia, plague, brucellosis, and gfanders. Streptomycin is sometimes given with a penicillin drug to treat endocarditis (inflammation of the lining of the heart and heart valves). Once used to treat a wide range of other infections, streptomycin has now been largely superseded by newer, more effective drugs with less serious side effects. Discovered in the 1940s, streptomycin was the first effective drug treatment for tuber945

STRESS

culosis; it is still sometimes used to treat resistant strains. POSSIBLE ADVERSE EFFECTS

Most seriously, streptomycin may damage nerves in the inner ear, disturbing balance and causing dizziness, ringing in the ears, and deafness. Other possible adverse effects include numoness of the face, tingling in the hands, headache, mafaise, nausea, and vomiting.

Stress Any interference that disturbs a person's healthy mental and physical well-being. A person may experience stress in response to a wide range of physical and emotional stimuli, including physical violence, internal conflicts, and significant life events (e.g., death of a loved one, the birth of a baby, or divorce). Some people are more susceptible than others to stressrelated medical problems. EFFECTS

When faced with a stressful situation, the body responds by increasing production of certain hormones, such as cortisol and epinephrine. These hormones lead to changes in heart rate, blood pressure, metabolism, and physical activity designed to improve overall performance. However, at a certain level, they disrupt an individual's ability to cope. Less than 20 percent of people are effective in crises such as fires or floods.

Continued exposure to stress often leads to mental and physical symptoms, such as anxiety and depresswn, dyspepsia, palpitations, and muscular aches and pains. Posttraumatic stress disorder is a direct response to a specific stressful event. (See also

Relaxation techniques.)

Stress fracture A fracture that occurs as a result of repetitive jarring of a bone. Common sites include the metatarsal bones in the foot (see March fracture), the tibia or fibula (lower leg bones), the neck of the femur (thigh bone), and the lumbar region of the spine. Stress fractures are most common among runners, particularly those who run on hard surfaces with inadequate footwear (see Sports injuries). The main symptoms include pain and tenderness at the fracture site. Diagnosis is by X rays, although sometimes a stress fracture does not show up on an X ray until it has started to heal. Occasionally, a radionuclide bone scan (see Bone imaging) may be performed to confirm the diagnosis. Treatment consists of resting the affected area for four to six weeks. In some cases, it is also necessary to immobilize the fracture in a plaster cast. After recovery, modification of exercise routines and the use of suitably cushioned footwear may help to prevent a recurrence.

Stress ulcer An acute peptic ulcer that sometimes develops after shock, serious burns, severe injuries, or during a major illness. Stress ulcers are usually multiple and are most common in the stomach; they differ from chronic peptic ulcers in that the raw area does not spread deep into the stomach lining. The exact cause is unknown. Treatment is primarily preventive; patients in intensive-care units are commonly given antacid drugs and/or histamine-2

receptor antagonists.

Stretcher A frame covered with fabric that is used in first aid for carrying the sick, injured, or deceased. Many stretchers are available, including the standard stretcher, which consists of canvas stretched between two long poles on each side, and the trolley bed, a more sophisticated, adjustable stretcher on wheels that is carried in ambulances. Stretchers can be improvised by passing two poles through holes made in the corners of canvas bags, or by rolling up poles in parallel sides of a strong rug or blanket. An overcoat may also be used. Ideally, stretchers should be fairly rigid. The ends of a loaded stretcher should be lifted simultaneously.

Stretch mark The common name for stria.

Stria

STRESS AND HEART RATE The graph shows how a person 's heart rate varies over a typical day. Exercise and stress both activate the body's "fight or flight" system and

s

Heart rate per minute

120~- -- - -- - -- - - - - - - - - -- - -- - ~ Drive home

Drive to work

100 -+--

Time

7

-

8

Lunch with c lient - 1--- - - -- - -- - - --+-Business presentation

Five-mile jog l---'-"- - ----1

9

7

10 11

12

Stress levels through the day Although the home and workplace both present stress, for many city dwellers the

946

increase heart rate, but repeated alerting of the system without accompanying physical activity is probably harmful.

2

3

4

5

6

8

9

10

most taxing parts of the day are those spent co mmuting

Commonly called a stretch mark, a line on the skin caused by thinning and loss of elasticity in the dermis (underlying skin layer). Striae first appear as red, raised lines. Later they become purple, eventually flattening and fading to form shiny streaks, usually between a quarter of an inch and a half inch wide.

11 Appearance of striae Commonly known as stretch marks, striae often devel op on the abd omen, thighs. and breasts of pregnant women.

STROKE

and smoking also increase the risk of stroke by increasing the risk of hypertension and/or atherosclerosis. Oral contraceptives increase the risk of stroke in women under 50.

USING A STRETCHER Stretchers are used to carry injured or seriously ill people to avoid the risk of further injury. Any type of stretcher should be fairly rigid and should always be tested for strength before use.

INCIDENCE

In the US, the overall incidence of stroke is about 200 people per 100,000 population annually. The incidence rises steeply with age and is higher in men than in women . SYMPTOMS AND SIGNS

Keeping the victim warm Place a blanket diagonally on the stretcher. Lift the victim carefully onto the blanket and tuck in the corners.

Striae often develop on the hips and thighs during the adolescent growth spurt, especially in athletic girls. They are a common feature of pregnancy, developing in about 75 percent of pregnant women, and tend to occur on the breasts, thighs, and lower abdomen. Purple striae characteristically develop in people with

Cushing's syndrome. Striae are possibly caused by an excess of corticosteroid hormones, which are known to suppress fiber formation in the skin and to cause collagen in the skin to waste away. There is no effective means of prevention or treatment.

Stricture Narrowing of a duct, canal, or other passage in the body. A stricture may result from infection and inflammation; damage to and subsequent formation of scar tissue in or around a passage; the development of a tumor; spasm of muscles in a passage wall; or excessive growth of tissue around a passage, which occurs in prostatism when the enlarged prostate gland constricts the urethra (the passage between the bladder and outside). In some cases, a stricture is congenital.

Stridor A noisy, high-pitched breathing sound caused by abnormal narrowing of the larynx or trachea. Stridor is most common in young children. It usually occurs in croup, which is caused by a viral infection of

Improvising a stretcher Tu rn the sleeves of two coat s inside out. Pass two strong poles th rough the sleeves and button the coats

the upper airways. A less common, but more serious, cause is the bacterial infection epiglottiditis. Other causes of stridor include an inhaled foreign body and certain disorders of the larynx, such as tumors, vocal cord paralysis, and laryngomalacia (softening of the cartilage of the larynx).

Stroke Damage to part of the brain caused by interruption to its blood su{ply or leakage of blood outside o vessel walls. Sensation, movement, or function controlled by the damaged area is impaired. Strokes are fatal in about one third of cases and are a leading cause of death in developed countries. CAUSES

The main types and causes of stroke are shown in the box overleaf. Certain factors increase the risk of having a stroke. The two most important are hypertension (high bfood pressure), which weakens the walls of arteries, and atherosclerosis (thickening of the lining of arterial walls), whicn narrows arteries. Other factors that increase the risk of a stroke include atrial fibrillation (a type of irregular heart beat), a damaged heart valve, and a recent myocardial infarction (heart attack). All of these conditions can cause blood clots in the heart that may break off and migrate to the brain. Polycythemia (a raised level of red cells in the blood), lzyperlipidemia (a high level of fatty substances in the blood), diabetes mellitus,

Damage to a specific area of the brain impairs bodily sensation, movement, or function controlled by that part of the brain. Some of the possible symptoms and signs are shown in the illustrated box overleaf. A stroke that affects the dominant of the two cerebral hemispheres in the brain (usually the left hemisphere) may cause disturbance of language and speech (see Aphasia). Movement on one side of the body is controlled by the cerebral hemisphere on the opposite side. Thus, damage to areas controlling movement in the right cerepral hemisphere results in weakness or paralysis on the left side of the body. Such one-sided weakness or paralysis, known as hemiplegia, is one of the most common effects of a serious stroke. When symptoms last for less than 24 hours and are followed by full recovery, the episode is known as a transient ischemic attack. Such an attack, which usually lasts for only a few minutes, is a warning signal that a sufficient supply of blood is not reaching part of the brain. About a third of major strokes are fatal, a third result in a permanent handicap, and a third result in no lasting ill effects. COMPLICATIONS

Possible complications of a major stroke include pneumonia and the formation of blood clots in the veins of the leg (see Thrombosis, deep vein), which may travel to the artery supplying the lung to cause a potentially fatal

pulmonary embolism. DIAGNOSIS

If someone is thought to have had a stroke, a physician or ambulance should be summoned immediately. In about two thirds of cases, symptoms are serious enough to require admission to the hospital. CT scanning of the brain is performed to determine whether the symptoms are caused by a stroke or by some other disorder, such as a brain

tumor, brain abscess, subdural hemor-

947

STROKE

TYPES AND CAUSES OF STROKE Stroke may be caused by any of three mechanisms (below) . Thrombosis and embolism both lead to cessation of the blood supply to

part of the brain and thus to infarction (tissue death). Rupture of a blood vessel in or near the brain may cause an intracerebral hemorrhage or a

subarachnoid hemorrhage. Any part of the brain may be affected by a stroke; accordingly, the symptoms vary considerably.

CEREBRAL THROMBOSIS

CEREBRAL EMBOLISM

HEMORRHAGE

,_-llill.i!.,____

Area deprived of blood

Area deprived of blood

Thrombus blocks artery

Embolus blocks artery

Thrombosis Blockage by a thrombus (clot) that has built up on the wall of a brain artery accounts for 40 to 50 percent of strokes.

Burst artery

Embolism Blockage by an embolus (usually a clot) swept into an artery in the brain accounts for 30 to 35 percent of cases. Tissue death within brain The photograph at left shows a vertical slice through the brain of someone who died of a stroke . A large region of tissue death (dark area), caused by bleeding and oxygen deprivation, can be seen on one side.

Bleeding Rupture of a blood vessel and bleeding within or over the surface of the brain accounts for 20 to 25 percent of cases. Estimated incidence

per 1,000 population

30 -,--

20

10

Age

30

50

Incidence with age Strokes are ra re to uncommon under the age of 60, but

SYMPTOMS

60

Dizziness and confusion

Age

Vi sual disturbance

High blood pressure

Slurred speech or loss of speech

Atherosclerosis (narrowed artery channels)

Difficulty swallowing

Heart disease Diabetes mellitus

Polycythemia Hemiplegia Weakness or paralysis on one side of the body is one of the more common effects of a serious stroke

80

90

thereafter the chances of one occurring increase rapidly.

Smoking

948

70

RISK FACTORS

The symptoms of a stroke usually develop over minutes or hours, but occasionally over several days. Depending on the site , cause, and extent of damage, any or all of the symptoms at right may be present, in any degree of severity. The more serious cases lead to rapid loss of consciousness, coma , and death or to severe physical or mental handicap, but some strokes cause barely noticeable symptoms.

s

40

Hyperlipidemia Use of estrogens

STURGE•WEBER SYNDROME

rhage (bleeding into the space between the outermost and middfe membranes covering the brain), or e11cephalitis (inflammation of the brain). A lumbar puncture may be necessary to exclude the possibility of meningitis (inflammation of the membranes covering the brain and spinal cord). To further examine the cause and extent of brain damage, investigations may include an ECG, chest X rays, blood tests, angiography, and MRI . TREATMENT

In the hospital, patients who are unconscious or semiconscious require a clear airway, feeding by means of intravenous infusion or a nasogastric tube, and regular changing of position to avoid bedsores or pneumonia. Any edema (accumulation of fluid) within the brain caused by the stroke may be treated with corticosteroid drugs or

diuretic drugs. When a stroke has been caused by an embolism, anticoagulant drugs may be prescribed (in many cases for the rest of the patient's life) to help prevent recurrences. In other instances, aspirin is prescribed or vascular surgery performed to reduce the risk of subsequent stroke. Every effort is made to restore any lost movement or sensation by physical therapy and to remedy any speech disturbance by speech therapy. OUTLOOK

About halfof patients recover more or less completely from their first stroke. Many people paralyzed by a stroke learn to walk again. Any intellectual impairment, however, is often permanent. Survivors left with some form of permanent handicap may require occupational therapy and aids in the home. About 5 percent require longterm institutional care.

Stroma The tissue that forms the framework of an organ, as distinct from the functional tissue (called the pare11cl1yma) and the fibrous outer layer that holds the organ together. The stroma of the ovaries is the supporting tissue in which the ovanan follicles (the parenchyma) are embedded. The ovarian stroma consists of fibrous tissue, smooth muscle cells, spindleshaped cells, and a rich supply of blood vessels.

Strongyloidiasis An infestation of the intestines by a tiny parasitic worm, STRONGYLOIDES STERCORALIS. The disease is widespread in the tropics, especially the

Far East. In the US, it is occasionally found in Vietnam War veterans and refugees, but is otherwise rare. Strongyloidiasis is contracted in affected areas by walking barefoot on soil contaminated with feces. Worm larvae penetrate the skin of the feet and, via the lungs and throat, migrate to the small intestine. There they develop into adults, which burrow into the intestinal wall to produce larvae. Most larvae are passed in the feces, but some enter the bloodstream to begin a new cycle. Thus, an infestation may persist in one person for many years.

Strychnine poisoning Strychnine is an extremely poisonous chemical found in the seeds of species of S TRYCHNOS, a group of tropical plants. Although once used as a tonic and general stimulant, strychnine is no longer used therapeutically. Its principal use today is as an ingredient in some rodent poisons; most cases of strychnine poisoning occur in children who accidentally eat such poisons. However, the extremely bitter taste of strychnine and its lack of easy availability makes this form of poisoning rare.

SYMPTOMS AND TREATMENT

SYMPTOMS AND TREATMENT

The larvae cause itching and raised red patches where they enter the skin. In the lungs they may cause bleeding (resulting in the coughing up of blood) or pneumonia. Intestinal infestation may produce no symptoms but, if heavy, causes discomfort, a swollen abdomen, and diarrhea. Occasionally, an infested person dies of complications, such as septicemia or meningitis, many years after contracting the infection. Pneumonia may occur more readily in a person whose immune system has been compromised. The disease is diagnosed from microscopic examination of a sample of feces. Strongyloidiasis is treated with an antihelmintic drug, which eradicates the worms.

The symptoms of poisoning begin soon after strychnine has been eaten. If untreated, death may occur. Initial symptoms include restlessness, stiffness of the face and neck, and increased sensitivity of sight, hearing, taste, and smell. These symptoms are followed by alternating episodes of seizures and floppiness. Eventually, death occurs from respiratory arrest. The primary objectives of treatment are to prevent seizures and maintain breathing. The victim is given intravenous injections of a tranquilizer or barbiturate, which counteract the effects of strychnine and thus help prevent seizures. To maintain breathing, the victim may be placed on a ventilator. With prompt medical treatment, recovery usually occurs within about 24 hours.

Strontium A metallic element that does not occur naturally in its pure form but is present as various compounds in certain minerals (notably strontianite and celestite), seawater, and marine plants. It is also found in food and, although not essential to the body, is metabolized in a manner similar to calcium and incorporated into bone. In addition to the compounds, there are several radioisotopes (radioactive varieties) of the element, of which strontium 90 is medically the most important. It does not occur naturally, but is produced in relatively large amounts during nuclear fission reactions and is also present in the fallout from some nuclear bomb explosions. Strontium 90 emits radiation (in the form of beta particles) for a comparatively long time (the half-life of this radioisotope is about 28 years), and accumulates in bone, where the radiation may cause leukemia and/or bo11e tumors. Other radioisotopes of strontium have also been used in medicine to diagnose and treat bone tumors.

Stuffy nose See Nasal congestion.

Stump The end portion of a limb that remains after amputation .

Stupor A state of almost complete unconsciousness from which a person can be aroused only briefly and only by vigorous external stimulation. (See also Coma.)

Sturge-Weber syndrome A rare, congenital condition that affects the skin and the brain. Characteristically, a large purple hemangioma (a birthmark caused by abnormal distribution of blood vessels) extends over one side of the face, including the eye. A similar malformation of blood vessels in the brain may cause some degree of weakness on the opposite side of the body, progressive mental retardation, and epilepsy. Glaucoma (increased pressure within the eyeball)

949

STUTTERING TREATMENT

Stuttering can often be improved by speech therapy, which may include teaching the person to give equal weight to each syllable. Electronic aids to mask the speaker's voice or to relay speech back to the speaker via headphones are also employed.

St. Vitus' dance An outdated term for the disorder now called Sydenham's chorea. Appearance of Sturge-Weber syndrome The characteristic birthmark, shown here on the lower part of the face , extends over the left eye and temple.

may develop in the affected eye, leading to a partial or complete loss of vision. The birthmark can be disguised with masking creams; seizures can usually be controlled with anticonvulsant drugs. In severe cases, surgery on the affected part of the brain may need to be performed.

Stye Also called a hordeolum, a small, pusfilled abscess near the eyelashes caused by infection. If the stye is painful, warm compresses may help the pus to discharge. Antibiotic eye ointment can help prevent recurrence.

Stye on upper eyelid A stye most often forms near the inner corner of an eye but may develop at the base of any of the eyelashes .

Subacute A medical term applied to a disease that runs a course in time between acute and chronic. In subacute meningitis, the symptoms persist over a period of several weeks; in the acute form, the entire illness may last several days or a couple of weeks.

SYMPTOMS

People who stutter have problems with different words and sounds. The severity of the stutter is also related to circumstances. Some people find that the stuttering is worse wnen they are anxious (such as during public speaking or when using the telephone), while others experience more difficulty when refaxed. Problems rarely occur during singing or reading in unison (possibly because less communication is involved). Some stutterers also have tics and tremors. CAUSES

The cause of stuttering is uncertain , although it tends to run in families. Some researchers believe that stuttering is due to a subtle form of brain damage; others regard it as a primarily psychological problem.

950

An attack may cause immediate loss of consciousness or a sudden violent headache, often followed by loss of consciousness. If the person remains conscious, other symrtoms such as photophobia (dislike o bright light), nausea, vomiting, drowsiness, and stiffness of the neck may develop. Unconscious patients may recover, but attacks during the ensuing dar or weeks are common and often fata . The diagnosis is confirmed by CT scanning and by the presence of large amounts of blood in the cerebrospinal fluid following lumbar puncture. The site of the burst blood vessel is investigated by a11giograplzy (injection of a radiopaque substance into the bloodstream followed by X rays), which may not be performed until the patient's condition has stabilized. TREATMENT

INCIDENCE

Stuttering occurs in about 1 percent of the adult population. It is also fairly common temporarily in children aged 2 to 4. About half the children whose stutter persists until age 5 continue to stutter in adult life. The problem is more common in boys, twins, and lefthanded people.

SYMPTOMS

DIAGNOSIS

Stuttering A speech disorder in which there is repeated hesitation and delay in uttering words or in which sounds are unusually prolonged. Stuttering, also known as stammering, usually starts in childhood, beginning before age 8 in 90 percent of sufferers.

Subarachnoid hemorrhage usually occurs spontaneously, without any head injury, although it may follow unaccustomed physical exercise. In the US each year, about five to 10 people per 100,000 suffer a subarachnoid hemorrhage. It is somewhat less common than intracerebral hemorrhage (another form of stroke), in which bleeding occurs within the brain itself. Subarachnoid hemorrhage is particularly common between tne ages of 35 and 60.

Subarachnoid hemorrhage A type of brain hemorrhage in which blood from a ruptured blood vessel spreads over the surface of the brain. CAUSES AND INCIDENCE

The most common cause of subarachnoid hemorrhage is a burst aneurysm (bulge in a weakened wall of an artery), frequently on the circular arrangement of blood vessels at the base of the brain, less commonly a ruptured angioma (abnormal proliferation of blood vessels within tne brain). Bleeiliary system 168 parts of: Bile duct 167; Gallbladder 473; Liver 644 Biliousness 169 Bilirubin 169 in Blood 182 causing Jaundice 610; Kernicterus 616 as constituent of Bile 167 in diagnosis of Anemia 101 excess of: Hyperbilirubinemia 552 Billings' method 169 Billroth's operation 169 types of gastrectomy 475 Biltricide 1098 Binet's test 169 type of Intelligence test 595 binge eating: feature of Binge-purge syndrome 169; Bulimia 218 Binge-purge syndrome 169 binocular vision: mechanism of: the function of the optic nerve 746; the sense of vision 1053 Bio- 169 Bioavailability 169 Biochemical analysis 30 Biochemistry 169 Biofeedback training 170 Relaxation techniques 859 Biological limits 46 Biomechanical engineering 170 Biopar Forte 1098 Biopsy 31, 170 biopsy procedures 171 in diagnosis of Breast, cancer of 206; Cancer 225; Esophagus, cancer of 420; Lung cancer 651; Pharynx, cancer of 790; Proctitis 822; Rectum, cancer of 856; Stomach cancer 943; Sprue, tropical 936 and Endoscopy 405; endoscopes 406; Sigmoidoscopy 906 types of: Bone marrow biopsy 195; biopsy of the cervix 254; Liver biopsy 645; Renal biopsy 860; Skin biopsy 912 Biorhythms 171 and Jet lag 611 biotin: constituent of Vitamin B complex 1059 Biozyme C 1098 Biperiden 1098 Biphetamine 1098 Bipolar disorder 172 example: Manic-depressive

illness 663 birds, diseases from: examples: Alveolitis 90; Histoplasmosis 541; Psittacosis 829 Birth: see index entry Childbirth Birth canal 172 Birth control 172 methods of: Contraception 302; Contraception, barrier methods 304; Contraception, hormonal methods 305; methods of contraception 303; Contraception, periodic abstinence 305; Contraception, postcoital 306; Family planning 440; Sterilization, female 940; Vasectomy 1040 birth-control pill: Oral contraceptives 747 Birth defects 172, 173 causes of: Chromosomal abnormalities 277; Genetic disorders 482; Pregnancy, drugs in 815 and Embryo 397; Infant mortality 581; Newborn 726 Birth injury 173 and Newborn 727 Birthmark 174 treatment of: Cryosurgery 323; Laser treatment 629; removing skin blemis/1es 35 types of: Hemangioma 526; Nevus 726; Port-wine stain 810 birth rates: Statistics, vital 939 Birth weight 174 and Prematurity 817; Sudden infant death syndrome 952 Bisacodyl 1098 Bisexuality 174 and Sexuality 898 Bismuth 174 causing Melena 673 Bite (dentistry): abnormality of: Malocclusion 966 affected by Thumb-sucking 893 medical term: Occlusion 739 Bites, animal 174 first aid: insect stings and bites 593; snakebite 921 types of: Insect bites 591; Snakebites 920; Spider bites 928; Venomous bites and stings 1044 Bites, human 175 Bithin 1098 Bithionol 1098 Bitolterol 1098 Black death 175 modem term: Plague 799 Black eye 175 Child abuse 263 black feces: see index entry Feces, abnormal Blackhead 175 feature of Acne 64 Blackout 175

1125

Blackout (continued) Fainting 435 Black teeth: Discolored teeth 363 Blackwater fever 175 Bladder 175 anatomy of the b/addrr 176 disorders of the bladder 177 and Catheterization, urinary 242 investigation of: Cystometry 329; Cystoscopy 330 part of Urinary tract 1025; the urinary system 1028 removal of: Cystectomy 327 stone in: Calculus, urinary tract 224 Bladder cancer: Bladder tumors 175 bladder control: in children: Developmental delay 348; Toilet-training 994 defective: Disk prolapse 365; Enuresis 408; Incontinence, urinary 579 Bladder tumors 175 causing Incontinence, urinary 580 Blastomycosis 176 type of Fungal infection 470 blastocyst: development of: Zygote 1088 blastula: development of: the process of fertilization 446 Bleaching, dental 177 bleaching, hair: Hair 503 Bleb 177 Bleeder 177 Bleeding disorders 178 Bleeding 177 causing Hypotension 562; Hypovolemia 564; Renal failure 860; Shock 901 and Menstruation 677; Nosebleed 731; Placenta previa 799; Postpartum hemorrhagt> 81 I; Uterus, cancer of 1032; Varicose veins 1038 stopping: Bleeding, treatment of 179; Blood clotting 185; Hemostasis 531; Pressure points 820 see also index entry Bleeding disorders Bleeding disorders 178 and Blood clotting 185; Platelets 801 diagnosis of: Blood clotting tests 185 treatment of: Blood prnducts 189; Factor VIII 435; Hemostatic drugs 531 ; Phytonadione 794 types of: Christmas disease 277; Hemophilia 530; Thrombocytopenia 980; Von Willebrand 's disease 1066 Bleeding gums: Gingivitis 487 bleeding, rectal: Rectal bleeding 855

1126

bleeding time: measurement of: Blood-clotting tests 185 Bleeding, treatment of 179 Pressure points 820 in Shock 901 Blenoxane 1098 Bleomycin 1098 Bleph-10 1098 Blephamide 1098 Blepha ri tis 179 causing Eyelashes, disorders of 433 treatme nt of: Sulfacetamide 954 Blepharoplasty 179 Blepharospasm 180 spasm of Eyelid 433 Blind loop syndrome 180 Blindness 180 causes of: Cataract 240; Cavernous sinus thrombosis 244; Chloroyuine 271; Corneal abrasion 307; Filariasis 454; Glaucoma 488; Keratomalacia 615; Onchocerciasis 742; TaySachs disease 966; Trachoma 1002 and disorders of the cornea 308; disorders of the eye 431; disorders of the retina 867 partial: Transient ischemic attack 1005 temporary: Migraine 688 types of: Color vision deficiency 292; Night blindness 727 Vision , loss of lll54 Blind spot 181 blinking, abnormal: Tic 988 Blister 181 bloating: Abdominal swelling 55 and Feces, abnormal -143; Hirschsprung's diseasP 540 Blocadren 1098 Blocked nose: Nasal congestion 715 Nasal obstruction 715 Blocking 182 Blood 182 and Blood clotting 184; Circulatory system 280, 281 constituents of: Blood cells 182; co11stit11c11ts of blood 183; Hemoglobin 528; Lymphocyte 655; Plasma 800; Plasma proteins 801; Platelet 801; Serum 895 disorders of: Bleeding disorders 178; disorders of the /Jlood 186 blood alcohol levels: alcohol 1110 Norlutin 1110 Normodyne 1110 Norpace 1110

1160

Norpace CR 1110 Norpramin 1110 Nor-Q-D 1110 Nortriptyline 731 Noscapine 1110 Nose 731 damage to lining of: Cocaine 285

disorders of: Nasal congestion 715; Nasal discharge 715; Nasal obstruction 715; Nosebleed 731 ; Nose, broken 732; disorders of the nose 732; Rhinitis 872; Rhinophyma 873

function of: Smell 918; the sense of smell 919 and Nasopharynx 716 part of: Nasal septum 715 reshaping of: Rhinoplasty 873 Nosebleed 731 feature of Yellow fever 1086 Nose, broken 732 Nose reshaping: medical term : Rhinoplasty 873 Nostrilla 1110 Notezine 1110 notochord : part of Embryo 397 Novafed 1110 Nova fed A 1110 Novahistine OMX 1110 Novocain 1110 Novolin L, N , R 1110 NPH Insulin 1110 NREM (nonrapid eye movement) sleep: and sleep patterns 915; Sleepwalking 917 type of Sleep 914 NSA!Ds: see index entry Nonsteroidal anti-inflammatory drugs NSU: abbreviation for Nonspecific urethritis 730 Nubain 1110 Nuclear energy 732 and Radiation 844 Nuclear magnetic resonance: alternative term: MRI 699 Nuclear medicine 733 Nucleic acids 733 breakdown of: Uric acid 1025 as constituents of Chromosomes 279; Genes 478,480

fun ction of: Protein synthesis 827

and Genetic code 481 manufacture o f: Vitamin B complex 1059 in Nucleus 735; Viruses 1050, 1051 types of: DNA 369; RNA 875 Nucleus 735 atomic: Nuclear energy 732; Radiation 844 cellular: Cell 245 constituents of: Chromosomes 279; Nucleic acids 733 Nucofed 1110 Numbness 735 associated with Pins and

needles sensation 796 symptom chart 734 symptom of Carpal tunnel syndrome 238; Cervical osteoarthritis 252; Multiple sclerosis 701; Raynaud's disease 853; Stroke 947; Transient ischemic attack 1005

Nutrition Nydrazid 1110 Nylidrin 1110 Nymphomania 737 Nystagmus 737 a disorder of the eye 431 and Vertigo 1048 Nystatin 737 Nystex 1110

type of Sensation, abnormal 893

Numorphan 1110 Nupercainal 1110 Nuprin 11 JO Nurse 735 Nursing: Breast-feeding 207 Nursing care 735 Nursing home 735 Nutracort 1110 Nutraplus 1110 Nutrient 736 types of: Carbohydrates 232; Fats and oils 441; Fiber, dietary 452; Minerals 689; Proteins 827; Trace elements 1001; Vitamin 1056; Water 1070

see also index entries Nutrition; Nutritional disorders Nutrition 736 and Calorie 226; Diet and exercise 18; Energy requirements 407; Food additives 461 the four food groups and recommended daily servings 737 of infants: Feeding, infant 443 recommended daily dietary allowances