Shiga Toxin-Producing E. coli: Methods and Protocols (Methods in Molecular Biology, 2291) 1071613383, 9781071613382

Citation preview

Methods in Molecular Biology 2291

Stephanie Schüller Martina Bielaszewska Editors

Shiga ToxinProducing E. coli Methods and Protocols

METHODS

IN

MOLECULAR BIOLOGY

Series Editor John M. Walker School of Life and Medical Sciences University of Hertfordshire Hatfield, Hertfordshire, UK

For further volumes: http://www.springer.com/series/7651

For over 35 years, biological scientists have come to rely on the research protocols and methodologies in the critically acclaimed Methods in Molecular Biology series. The series was the first to introduce the step-by-step protocols approach that has become the standard in all biomedical protocol publishing. Each protocol is provided in readily-reproducible step-bystep fashion, opening with an introductory overview, a list of the materials and reagents needed to complete the experiment, and followed by a detailed procedure that is supported with a helpful notes section offering tips and tricks of the trade as well as troubleshooting advice. These hallmark features were introduced by series editor Dr. John Walker and constitute the key ingredient in each and every volume of the Methods in Molecular Biology series. Tested and trusted, comprehensive and reliable, all protocols from the series are indexed in PubMed.

Shiga Toxin-Producing E. coli Methods and Protocols

Edited by

Stephanie Schüller Norwich Medical School, University of East Anglia, Norwich, UK

Martina Bielaszewska National Reference Laboratory for E. coli and Shigellae, National Institute of Public Health, Prague, Czech Republic

Editors Stephanie Schu¨ller Norwich Medical School University of East Anglia Norwich, UK

Martina Bielaszewska National Reference Laboratory for E. coli and Shigellae National Institute of Public Health Prague, Czech Republic

ISSN 1064-3745 ISSN 1940-6029 (electronic) Methods in Molecular Biology ISBN 978-1-0716-1338-2 ISBN 978-1-0716-1339-9 (eBook) https://doi.org/10.1007/978-1-0716-1339-9 © Springer Science+Business Media, LLC, part of Springer Nature 2021 This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. This Humana imprint is published by the registered company Springer Science+Business Media, LLC, part of Springer Nature. The registered company address is: 1 New York Plaza, New York, NY 10004, U.S.A.

Preface Since its discovery in 1982, Shiga toxin-producing E. coli (STEC) has gained notoriety for causing severe renal and neurological disease due to the production of potent Shiga toxins. The importance of this pathogen has been underlined by the publication of the Methods in Molecular Medicine book E. coli: Shiga Toxin Methods and Protocols edited by Dana Philpott and Frank Ebel in 2003. Novel methodologies have been developed since which have contributed to the detection, clinical diagnosis, and treatment of STEC infections as well as a better understanding of its epidemiology and pathogenesis. In particular, the accessibility of whole genome sequencing and bioinformatic tools has demonstrated the fluidity of the STEC genome and blurring of boundaries with other E. coli pathotypes which has become relevant in the large 2011 outbreak in Germany caused by a Shiga toxin-producing enteroaggregative E. coli hybrid strain. Similar to the 2006 “Spinach outbreak” in the USA, the source of the German epidemic was traced to contaminated fresh produce, thus emphasizing the need to understand STEC persistence in the extraintestinal environment. In addition, it has become evident that STEC virulence factors including Shiga toxins are released within outer membrane vesicles and extracellular vesicles and can thus travel within the host over long distances and contribute to pathogenesis. Another shift in perspective has been evoked by the discovery that the expression of STEC virulence genes in the gut is largely governed by environmental cues including physicochemical factors and signals from the host cells and resident microbiota. This knowledge is reflected in the sophistication of biologically relevant STEC infection models including fermenters, stem cell-derived organoids, and advanced in vivo models. In this book, we have aimed to include these new technologies for the detection, characterization, and investigation of STEC and Shiga toxins. We hope this book will become a valuable resource for clinicians, epidemiologists, members of the food and farming industry, and researchers interested in STEC pathogenesis. We would like to thank the series editor John Walker for the invitation to edit this book and guiding us through every step of the process. Most importantly, we are grateful to all authors who shared their methodology and expertise and dedicated time to writing their chapters despite the ongoing COVID pandemic.

v

Contents Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

1 Integrated Approach for the Diagnosis of Shiga Toxin-Producing Escherichia coli Infections in Humans . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Stefano Morabito, Fabio Minelli, and Rosangela Tozzoli 2 Shiga Toxin-Producing E. coli in Animals: Detection, Characterization, and Virulence Assessment . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Stefanie A. Barth, Rolf Bauerfeind, Christian Berens, and Christian Menge 3 Identification of Shiga Toxin-Producing Escherichia coli Outbreaks Using Whole Genome Sequencing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Stefan Bletz, Alexander Mellmann, and Barbara Middendorf-Bauchart 4 Predicting Host Association for Shiga Toxin-Producing E. coli Serogroups by Machine Learning . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Nadejda Lupolova, Antonia Chalka, and David L. Gally 5 Isolation and Characterization of Shiga Toxin Bacteriophages . . . . . . . . . . . . . . . . Lorena Rodrı´guez-Rubio and Maite Muniesa 6 Lambda Red–Mediated Recombination in Shiga Toxin-Producing Escherichia coli . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Kenneth G. Campellone and Alyssa M. Coulter 7 Functional Analysis of Shiga Toxin-Producing Escherichia coli Biofilm Components in Plant Leaves . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Nicola J. Holden, Kathryn M. Wright, Jacqueline Marshall, and Ashleigh Holmes 8 Virulence Factor Cargo and Host Cell Interactions of Shiga Toxin-Producing Escherichia coli Outer Membrane Vesicles . . . . . . . . . . . . . . . . . . Martina Bielaszewska, Lilo Greune, Andreas Bauwens, Petra Dersch, ¨ ter Alexander Mellmann, and Christian Ru 9 Isolation and Characterization of Shiga Toxin-Associated Microvesicles . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Annie Willysson, Anne-lie Sta˚hl, and Diana Karpman 10 Thin-Layer Chromatography in Structure and Recognition Studies of Shiga Toxin Glycosphingolipid Receptors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ¨ thing Johanna Detzner, Gottfried Pohlentz, and Johannes Mu 11 Identification of Nanobodies Blocking Intimate Adherence of Shiga Toxin-Producing Escherichia coli to Epithelial Cells . . . . . . . . . . . . . . . . . ´ ngel Ferna´ndez David Ruano-Gallego and Luis A

vii

v ix

1

19

87

99 119

145

163

177

207

229

253

viii

12

13

14

15

16

17

18

19

20

Contents

Determining Shiga Toxin-Producing Escherichia coli Interactions with Human Intestinal Epithelium in a Microaerobic Vertical Diffusion Chamber . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ¨ ller Conor J. McGrath and Stephanie Schu Human Epithelial Stem Cell-Derived Colonoid Monolayers as a Model to Study Shiga Toxin-Producing Escherichia coli–Host Interactions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Karol Dokladny, Julie G. In, James Kaper, and Olga Kovbasnjuk Use of the Dynamic TIM-1 Model for an In-Depth Understanding of the Survival and Virulence Gene Expression of Shiga Toxin-Producing Escherichia coli in the Human Stomach and Small Intestine . . . . . . . . . . . . . . . . . . Ophe´lie Uriot, Sandrine Chalancon, Carine Mazal, Lucie Etienne-Mesmin, Sylvain Denis, and Ste´phanie Blanquet-Diot Measuring Effector-Mediated Modulation of Inflammatory Responses to Infection with Enteropathogenic and Shiga Toxin-Producing E. coli . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Georgina L. Pollock, Cristina Giogha, and Elizabeth L. Hartland Interaction of Bovine Lymphocytes with Products of Shiga Toxin-Producing Escherichia coli . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Andrew G. Bease, Robin L. Cassady-Cain, and Mark P. Stevens Infection of Immunocompetent Conventional Mice with Shiga Toxin-Producing E. coli: The DSS + STEC Model . . . . . . . . . . . . . . . . . . . . . . . . . . Gregory Hall, Shinichiro Kurosawa, and D. J. Stearns-Kurosawa Infant Rabbit Model for Studying Shiga Toxin-Producing Escherichia coli. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Jennifer M. Ritchie Citrobacter rodentium Lysogenized with a Shiga Toxin-Producing Phage: A Murine Model for Shiga Toxin-Producing E. coli Infection . . . . . . . . . . Laurice J. Flowers, Shenglan Hu, Anishma Shrestha, Amanda J. Martinot, John M. Leong, and Marcia S. Osburne Overview of the Effect of Citrobacter rodentium Infection on Host Metabolism and the Microbiota . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Eve G. D. Hopkins and Gad Frankel

Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

273

285

297

317

333

353

365

381

399 419

Contributors STEFANIE A. BARTH • Friedrich-Loeffler-Institut/Federal Research Institute for Animal Health, Institute of Molecular Pathogenesis, Jena, Germany ROLF BAUERFEIND • Institute for Hygiene and Infectious Diseases of Animals, Justus Liebig University Gießen, Gießen, Germany ANDREAS BAUWENS • Institute for Hygiene, University of Mu¨nster, Mu¨nster, Germany ANDREW G. BEASE • The Roslin Institute and Royal (Dick) School of Veterinary Studies, University of Edinburgh, Midlothian, UK CHRISTIAN BERENS • Friedrich-Loeffler-Institut/Federal Research Institute for Animal Health, Institute of Molecular Pathogenesis, Jena, Germany MARTINA BIELASZEWSKA • National Reference Laboratory for E. coli and Shigellae, National Institute of Public Health, Prague, Czech Republic; Institute for Hygiene, University of Mu¨nster, Mu¨nster, Germany ´ STEPHANIE BLANQUET-DIOT • Microbiology Digestive Environment and Health, UMR UCA-INRA 454 MEDIS, Universite´ Clermont Auvergne, Clermont-Ferrand, France STEFAN BLETZ • Institute of Hygiene and National Consulting Laboratory for Hemolytic Uremic Syndrome (HUS), University Hospital Mu¨nster, Mu¨nster, Germany KENNETH G. CAMPELLONE • Department of Molecular & Cell Biology, Institute for Systems Genomics, University of Connecticut, Storrs, CT, USA ROBIN L. CASSADY-CAIN • The Roslin Institute and Royal (Dick) School of Veterinary Studies, University of Edinburgh, Midlothian, UK SANDRINE CHALANCON • Microbiology Digestive Environment and Health, UMR UCA-INRA 454 MEDIS, Universite´ Clermont Auvergne, Clermont-Ferrand, France ANTONIA CHALKA • Division of Infection and Immunity, The Roslin Institute and Royal (Dick) School of Veterinary Studies, University of Edinburgh, Edinburgh, UK ALYSSA M. COULTER • Department of Molecular & Cell Biology, Institute for Systems Genomics, University of Connecticut, Storrs, CT, USA SYLVAIN DENIS • Microbiology Digestive Environment and Health, UMR UCA-INRA 454 MEDIS, Universite´ Clermont Auvergne, Clermont-Ferrand, France PETRA DERSCH • Institute for Infectiology, Center for Molecular Biology of Inflammation (ZMBE), University of Mu¨nster, Mu¨nster, Germany JOHANNA DETZNER • Institute for Hygiene, University of Mu¨nster, Mu¨nster, Germany KAROL DOKLADNY • Division of Gastroenterology, Department of Internal Medicine, University of New Mexico Health Sciences Center, University of New Mexico School of Medicine, Albuquerque, NM, USA LUCIE ETIENNE-MESMIN • Microbiology Digestive Environment and Health, UMR UCA-INRA 454 MEDIS, Universite´ Clermont Auvergne, Clermont-Ferrand, France ´ NGEL FERNA´NDEZ • Department of Microbial Biotechnology, Centro Nacional de LUIS A Biotecnologı´a, Consejo Superior de Investigaciones Cientı´ficas (CNB-CSIC), Madrid, Spain LAURICE J. FLOWERS • Department of Molecular Biology and Microbiology, Tufts University School of Medicine, Boston, MA, USA; Tufts University Graduate School in Biomedical Sciences, Boston, MA, USA; Department of Dermatology, University of Pennsylvania, Philadelphia, PA, USA

ix

x

Contributors

GAD FRANKEL • MRC Centre for Molecular Bacteriology and Infection, Department of Life Sciences, Imperial College London, London, UK DAVID L. GALLY • Division of Infection and Immunity, The Roslin Institute and Royal (Dick) School of Veterinary Studies, University of Edinburgh, Edinburgh, UK CRISTINA GIOGHA • Centre for Innate Immunity and Infectious Diseases, Hudson Institute of Medical Research, Clayton, VIC, Australia; Department of Molecular and Translational Science, Faculty of Medicine, Nursing and Health Sciences, Monash University, Clayton, VIC, Australia LILO GREUNE • Institute for Infectiology, Center for Molecular Biology of Inflammation (ZMBE), University of Mu¨nster, Mu¨nster, Germany GREGORY HALL • Department of Pathology and Laboratory Medicine, Boston University School of Medicine, Boston, MA, USA; Toxikon Corporation, Bedford, MA, USA ELIZABETH L. HARTLAND • Centre for Innate Immunity and Infectious Diseases, Hudson Institute of Medical Research, Clayton, VIC, Australia; Department of Molecular and Translational Science, Faculty of Medicine, Nursing and Health Sciences, Monash University, Clayton, VIC, Australia NICOLA J. HOLDEN • Cell & Molecular Sciences, The James Hutton Institute, Dundee, UK ASHLEIGH HOLMES • Cell & Molecular Sciences, The James Hutton Institute, Dundee, UK EVE G. D. HOPKINS • MRC Centre for Molecular Bacteriology and Infection, Department of Life Sciences, Imperial College London, London, UK SHENGLAN HU • Department of Molecular Biology and Microbiology, Tufts University School of Medicine, Boston, MA, USA; Institute of Animal Science, Guangdong Academy of Agricultural Sciences, State Key Laboratory of Livestock and Poultry Breeding, Key Laboratory of Animal Nutrition and Feed Science in South China, Ministry of Agriculture and Rural Affairs, Guangdong Key Laboratory of Animal Breeding, Guangzhou, China JULIE G. IN • Division of Gastroenterology, Department of Internal Medicine, University of New Mexico Health Sciences Center, University of New Mexico School of Medicine, Albuquerque, NM, USA JAMES KAPER • Department of Microbiology & Immunology, University of Maryland School of Medicine, Baltimore, MD, USA DIANA KARPMAN • Department of Pediatrics, Clinical Sciences Lund, Lund University, Lund, Sweden OLGA KOVBASNJUK • Division of Gastroenterology, Department of Internal Medicine, University of New Mexico Health Sciences Center, University of New Mexico School of Medicine, Albuquerque, NM, USA SHINICHIRO KUROSAWA • Department of Pathology and Laboratory Medicine, Boston University School of Medicine, Boston, MA, USA JOHN M. LEONG • Department of Molecular Biology and Microbiology, Tufts University School of Medicine, Boston, MA, USA NADEJDA LUPOLOVA • Division of Infection and Immunity, The Roslin Institute and Royal (Dick) School of Veterinary Studies, University of Edinburgh, Edinburgh, UK JACQUELINE MARSHALL • Cell & Molecular Sciences, The James Hutton Institute, Dundee, UK AMANDA J. MARTINOT • Department of Infectious Diseases and Global Health, Tufts Cummings School of Veterinary Medicine, North Grafton, MA, USA CARINE MAZAL • Microbiology Digestive Environment and Health, UMR UCA-INRA 454 MEDIS, Universite´ Clermont Auvergne, Clermont-Ferrand, France CONOR J. MCGRATH • Norwich Medical School, University of East Anglia, Norwich, UK

Contributors

xi

ALEXANDER MELLMANN • Institute of Hygiene and National Consulting Laboratory for Hemolytic Uremic Syndrome (HUS), University Hospital Mu¨nster, Mu¨nster, Germany; Institute for Hygiene, University of Mu¨nster, Mu¨nster, Germany CHRISTIAN MENGE • Friedrich-Loeffler-Institut/Federal Research Institute for Animal Health, Institute of Molecular Pathogenesis, Jena, Germany BARBARA MIDDENDORF-BAUCHART • Institute of Hygiene and National Consulting Laboratory for Hemolytic Uremic Syndrome (HUS), University Hospital Mu¨nster, Mu¨nster, Germany ` , Rome, Italy FABIO MINELLI • Istituto Superiore di Sanita ` , Rome, Italy STEFANO MORABITO • Istituto Superiore di Sanita MAITE MUNIESA • Department of Genetics, Microbiology and Statistics, University of Barcelona, Barcelona, Spain JOHANNES MU¨THING • Institute for Hygiene, University of Mu¨nster, Mu¨nster, Germany MARCIA S. OSBURNE • Department of Molecular Biology and Microbiology, Tufts University School of Medicine, Boston, MA, USA GOTTFRIED POHLENTZ • Institute for Hygiene, University of Mu¨nster, Mu¨nster, Germany GEORGINA L. POLLOCK • Centre for Innate Immunity and Infectious Diseases, Hudson Institute of Medical Research, Clayton, VIC, Australia; Department of Molecular and Translational Science, Faculty of Medicine, Nursing and Health Sciences, Monash University, Clayton, VIC, Australia JENNIFER M. RITCHIE • University of Surrey, Guildford, UK LORENA RODRI´GUEZ-RUBIO • Department of Genetics, Microbiology and Statistics, University of Barcelona, Barcelona, Spain DAVID RUANO-GALLEGO • Department of Microbial Biotechnology, Centro Nacional de Biotecnologı´a, Consejo Superior de Investigaciones Cientı´ficas (CNB-CSIC), Madrid, Spain CHRISTIAN RU¨TER • Institute for Infectiology, Center for Molecular Biology of Inflammation (ZMBE), University of Mu¨nster, Mu¨nster, Germany STEPHANIE SCHU¨LLER • Norwich Medical School, University of East Anglia, Norwich, UK ANISHMA SHRESTHA • Department of Molecular Biology and Microbiology, Tufts University School of Medicine, Boston, MA, USA ANNE-LIE STA˚HL • Department of Pediatrics, Clinical Sciences Lund, Lund University, Lund, Sweden D. J. STEARNS-KUROSAWA • Department of Pathology and Laboratory Medicine, Boston University School of Medicine, Boston, MA, USA MARK P. STEVENS • The Roslin Institute and Royal (Dick) School of Veterinary Studies, University of Edinburgh, Midlothian, UK ` , Rome, Italy ROSANGELA TOZZOLI • Istituto Superiore di Sanita OPHE´LIE URIOT • Microbiology Digestive Environment and Health, UMR UCA-INRA 454 MEDIS, Universite´ Clermont Auvergne, Clermont-Ferrand, France ANNIE WILLYSSON • Department of Pediatrics, Clinical Sciences Lund, Lund University, Lund, Sweden KATHRYN M. WRIGHT • Cell & Molecular Sciences, The James Hutton Institute, Dundee, UK

Chapter 1 Integrated Approach for the Diagnosis of Shiga Toxin-Producing Escherichia coli Infections in Humans Stefano Morabito, Fabio Minelli, and Rosangela Tozzoli Abstract Shiga toxin-producing Escherichia coli (STEC) are human pathogens causing severe diseases, such as hemorrhagic colitis and the hemolytic uremic syndrome. The prompt diagnosis of STEC infection is of primary importance to drive the most appropriate patient’s management procedures. The methods to diagnose STEC infections include both direct isolation of the STEC from stool samples and the identification of indirect evidences based on molecular, phenotypic, and serological applications. Here, the procedures in use at the Italian Reference Laboratory for E. coli infections are described. Key words Shiga toxin, Real time PCR, STEC isolation, Vero cell assay, ELISA, Anti-lipopolysaccharide antibodies, Serology

1

Introduction Shiga toxin-producing Escherichia coli (STEC) cause a spectrum of diseases in humans, including either enteric or systemic syndromes. In fact, following infection different outcomes may occur. These include asymptomatic carriage of the microorganism, mild diarrhea, or hemorrhagic colitis, and the life-threatening hemolytic uremic syndrome (HUS). The latter represents the most severe manifestation of STEC infection, usually occurring in children, the elderly, and immuno-compromised patients [1]. HUS is characterized by hemolytic anemia, thrombocytopenia, and acute renal failure [2] and is the major cause of kidney impairment in children, resulting in fatality in 2–7% of cases [3]. HUS can also cause longterm sequelae, such as renal impairment, hypertension, or neurological injury [2, 4]. The use of antimicrobials to treat STEC infections is controversial [5], as it has been observed that it may provoke an increase in the production or release of Shiga toxins (Stx) [6]. Antimicrobials

Stephanie Schu¨ller and Martina Bielaszewska (eds.), Shiga Toxin-Producing E. coli: Methods and Protocols, Methods in Molecular Biology, vol. 2291, https://doi.org/10.1007/978-1-0716-1339-9_1, © Springer Science+Business Media, LLC, part of Springer Nature 2021

1

2

Stefano Morabito et al.

administration may thus represent a significant risk factor for the progression of the infection towards the most severe forms of STEC-induced disease, HUS [7]. The management of STEC infection is mainly supportive, and in severe cases it includes hemodialysis [8]. It has been recently described that patients with STEC-induced HUS had great benefit from volume expansion by generous intravenous fluids administration upon early diagnosis of STEC infection, and it was proposed that this practice may lead to positive effects on both short- and long-term disease outcomes, by reducing organ damage [9]. Therefore, a prompt etiological identification is pivotal for the clinical management of the patients. Stx is the major virulence factor of STEC and belongs to a heterogenous family of AB5 toxins, including two major antigenically distinct types, Stx1 and Stx2. STEC may possess Stx1 or Stx2 gene or a combination of the genes encoding the two types. Large variability in stx gene sequences has been described, and they can be divided in several subtypes of both stx1 and stx2, with some of them being more associated to the severe disease [10]. In fact, although Stx1 has been also linked to human illness, STEC that produce Stx2, and particularly subtypes Stx2a, Stx2c, and Stx2d, are more often associated with the development of the most severe forms of infection [11, 12]. Apart from the production of Shiga toxins, STEC are phenotypically indistinguishable from the commensal E. coli, commonly present in the human intestine. Therefore, the detection of STEC in complex samples and the confirmation of the E. coli isolates as STEC are based on the identification of the presence of the Stx-coding genes and/or the Stx themselves. This is carried out by means of molecular biology methods, such as the Real-Time or conventional PCR, and assays aiming at identifying the cytopathic effect induced by the Stx onto monolayers of cultured cells, respectively. Finally, the indirect evidence of the presence of STEC infection may be revealed by detecting circulating antibodies against the lipopolysaccharide (LPS) of E. coli in serum samples of patients. In the present chapter, the integrated approach for the diagnosis of STEC infections carried out at the Istituto Superiore di Sanita` (ISS) in Rome is described. ISS is the National Institute for Public Health in Italy and acts as National Reference Laboratory for STEC infections and as European Union Reference Laboratory for E. coli including STEC according to the 625/2017 EU Regulation. ISS coordinates the National Registry of HUS in Italy and the Laboratory receives clinical samples from the Italian network of pediatric nephrology units for the diagnosis of STEC infections in cases of HUS and, to a lesser extent, bacterial cultures or isolated strains for their confirmation as STEC. Hereafter, the procedures in place in the ISS are reported, and the different approaches used are critically addressed.

Laboratory Diagnosis of STEC Infections

2

3

Materials Prepare all solutions using ultrapure water (resistivity 18.2 MΩ/cm at 25
C) and analytical grade reagents. Dissolve the oligonucleotides and probes used for Real-Time PCR (RT-PCR) in nuclease-free water. Adjust the pH of the media and solutions at room temperature (25
C) using NaOH or HCl solutions, if needed.

2.1 Reagents and Media for the Detection and Isolation of STEC

1. Fecal sample collected into a dedicated sterile container (1–2 g of feces are sufficient). 2. Mixed or pure bacterial cultures. 3. Tryptone soy broth (TSB): 17 g/L casein peptone (pancreatic), 2.5 g/L dipotassium hydrogen phosphate, 2.5 g/L glucose, 5 g/L sodium chloride, 3 g/L soy peptone (papain digest.), pH 7.3. 4. MacConkey agar: 17 g/L peptone, 3 g/L proteose peptone, 10 g/L lactose, 1.5 g/L bile salts, 5 g/L sodium chloride, 0.03 g/L neutral red, 0.001 g/L crystal violet, 13.5 g/L agar, pH 7.1. 5. Cefixime-tellurite sorbitol MacConkey agar (CT-SMAC): 20 g/L peptone, 10 g/L sorbitol, 5 g/L sodium chloride, 1.5 g/L bile salts, 0.03 g/L neutral red, 0.001 g/L crystal violet, 13.5 g/L agar, 0.0025 g/L potassium tellurite, 0.05 mg/L cefixime, pH 7.1. 6. Rhamnose MacConkey agar (RMAC): 17 g/L peptone, 3 g/L proteose peptone, 10 g/L rhamnose, 1.5 g/L bile salts, 5 g/L sodium chloride, 0.03 g/L neutral red, 0.001 g/L crystal violet, 13.5 g/L agar, pH 7.1. 7. TBX agar: 20 g/L peptone, 1.5 g/L bile salts, 0.075 g/L X-ß-D-glucuronide, 15 g/L agar, pH 7.2. 8. Kit for DNA purification. 9. Primers and probes for RT-PCR assays (see Table 1): Prepare stock solutions by dissolving oligonucleotides to the final concentration of 100 μM and probes to the final concentration of 50 μM; store at 20
C in 100 and 50 μL aliquots, respectively. Prepare working solutions by diluting the stock solutions in the ratio of 1:5 with nuclease-free water to obtain the concentration of 20 μM for the primers and 10 μM for the probes. 10. RT-PCR kit: It contains the Mastermix for amplification. It may or may not include the Internal Amplification Control (IAC). In case the IAC is present, follow the instructions supplied with the kit. Store at 20
C. Dilute the Mastermix to obtain a 1 concentration in each reaction.

4

Stefano Morabito et al.

Table 1 Genes detected with RT-PCR and oligonucleotides used Gene target

Oligonucleotides forward, reverse, and probes (50 –30 )

Reference

stx1

stx fwd: TTTGTYACTGTSACAGCWGAAGCYTTACG stx rev: CCCCAGTTCARWGTRAGRTCMACRTC Probe-CTGGATGATCTCAGTGGGCGTTCTTATGTAA

[17]

stx2

stx fwd: TTTGTYACTGTSACAGCWGAAGCYTTACG stx rev: CCCCAGTTCARWGTRAGRTCMACRTC Probe-TCGTCAGGCACTGTCTGAAACTGCTCC

[17]

eae

eae fwd: CATTGATCAGGATTTTTCTGGTGATA eae rev: CTCATGCGGAAATAGCCGTTA Probe-ATAGTCTCGCCAGTATTCGCCACCAATACC

[18]

rfbEO157

O157 fwd: TTTCACACTTATTGGATGGTCTCAA O157 rev: CGATGAGTTTATCTGCAAGGTGAT Probe-AGGACCGCAGAGGAAAGAGAGGAATTAAGG

[17]

wbdIO111

O111 fwd: CGAGGCAACACATTATATAGTGCTTT O111 rev: TTTTTGAATAGTTATGAACATCTTGTTTAGC Probe-TTGAATCTCCCAGATGATCAACATCGTGAA

[17]

wzxO26

O26 fwd: CGCGACGGCAGAGAAAATT O26 rev: AGCAGGCTTTTATATTCTCCAACTTT Probe-CCCGTTAAATCAATACTATTTCACGAGGTTGA

[17]

ihp1O145

O145 fwd: CGATAATATTTACCCCACCAGTACAG O145 rev: GCCGCCGCAATGCTT Probe-CCGCCATTCAGAATGCACACAATATCG

[17]

wzxO103

O103 fwd: CAAGGTGATTACGAAAATGCATGT O103 rev: GAAAAAAGCACCCCCGTACTTAT Probe-CATAGCCTGTTGTTTTAT

[19]

11. Sterile loops for bacteriology (1 and 10 μL). 12. Microcentrifuge tubes (1.5/2 mL). 13. RT-PCR tubes (0.2 or 0.1 mL). 14. Micropipettes and sterile tips. 15. Incubator (37
C). 2.2 Reagents, Media, and Type of Samples for the Detection of Free Shiga Toxin

1. Fecal sample collected into a dedicated sterile container (1–2 g of feces are sufficient). 2. Saline solution: Dissolve 8.5 g NaCl in 1 L of ultrapure water, sterilize by autoclaving. 3. 10 trypsin/EDTA solution: 2 g/L EDTA, 5 g/L trypsin in saline solution. Store at 20
C. 4. 200 mM L-glutamine (100 stock). Store at 4
C.

Laboratory Diagnosis of STEC Infections

5

5. 100 penicillin/streptomycin stock solution: 10,000 U/mL penicillin G, 10 mg/mL streptomycin sulfate in saline solution. Store at 20
C. 6. Gentamicin solution (50 mg/mL). Store at 4
C. 7. Trypan blue staining solution (use according to the producer’s instruction). 8. Vero cells (cell line from the kidney of Cercopithecus aethiops, ATCC CCL-81). 9. Medium 199 with Earle’s salts, supplemented with 5% fetal calf serum, 2 mM glutamine, and a 1 mix of antibiotics (penicillin/streptomycin). Alternatively, Minimal Essential Medium supplemented as above can be used for Vero cells growth. Store at 4
C. 10. 25 cm2 tissue culture–treated flasks. 11. 96-well plates with lids, flat bottom, tissue culture treated. 12. Cell culture incubator (37
C, 5% CO2). 13. Anti-Stx1 and anti-Stx2 neutralizing polyclonal antibodies (produced in rabbits at ISS). 14. Sterile syringes. 15. 0.22 μm syringe filters. 16. Micropipettes and sterile tips. 17. Sterile loops for bacteriology (10 μL). 18. Sterile disposable microcentrifuge tubes (1.5/2 mL). 2.3 Reagents for the Detection of Anti-LPS Antibodies in Serum Samples by ELISA

1. Serum sample in a sterile vial (50 μL is sufficient). 2. Carbonate buffer: Solution A: 0.86 g/10 mL NaHCO3; solution B: 1.06 g/10 mL Na2CO3. Add 4.53 mL of solution A to distilled water (about 1 L), adjust pH to 9.6 with solution B and make up to 1 L with distilled water. 3. Phosphate-buffered saline (PBS): 8.0 g/L NaCl, 0.2 g/L KCl, 1.44 g/L Na2HPO4∙2H2O, 0.24 g/L KH2PO4, pH 7.4. 4. ELISA buffer: PBS with 3% skim milk (w/v) and 0.1% Tween 20 (v/v). Store at 4
C. 5. Detection substrate (diethanolamine/p-nitrophenyl phosphate). Use according to the manufacturer’s instructions. 6. Anti-human total IgG (secondary antibody) conjugated with alkaline phosphatase. Use according to the manufacturer’s instructions. 7. Tris-buffered saline (TBS): 1.21 g/L Tris–HCl, 7.9 g/L NaCl, pH 7.2. Store at 4
C. 8. Phenol crystalline. 9. 3 M sodium acetate.

6

Stefano Morabito et al.

10. Absolute ethanol. 11. Polystyrene Multiwell plates for immunoassay recommended for ELISA. 12. Beckmann Optima XPN-90 Ultracentrifuge with the SW41 rotor (or equivalent ultracentrifuge). 13. Sorvall centrifuge with the SS34 rotor (or equivalent centrifuge). 14. Corex glass tubes. 15. Nutrient agar (e.g., TSA, TSB added with agar 15 g/L). 16. 50 mL disposable tubes. 17. 1.5 mL sterile disposable tubes. 18. Micropipettes and sterile tips. 19. Sterile distilled water. 20. E. coli LPS reference strains. 21. Water bath at 65
C. 22. Incubator (37
C).

3

Methods

3.1 Molecular and Microbiological Approach to the Diagnosis of STEC Infections

Historically, the most common serogroups of STEC strains isolated from HUS cases were the so-called “top five,” namely O157, O26, O111, O103, and O145 [13] and thus most of the diagnostic methods focused on the detection of these features. Nowadays, many more STEC serogroups are reported as causes of human severe disease, and the serogroup (e.g., O157) is no longer considered as a hallmark of pathogenicity [14]. The common feature of all STEC is the presence of genes encoding Shiga toxin(s). The aim of the method presented here is in line with this paradigm, being centered on the detection of the Stx1- and Stx2-coding genes (Stx2a to Stx2g with the exception of Stx2f, see Note 1) [15] and the intimin-coding gene eae, whose product is involved in the peculiar “attaching and effacing” colonization mechanism. The detection of genes targeting to the top-five serogroups is still part of the methodology described but is only carried out in presence of a positive result in the eae PCR, and the procedure is followed by the attempt of isolation anyway (see Note 2). The present method is used to test clinical samples (fecal specimens, mixed and pure bacterial cultures), sent to the Italian Reference Laboratory for the diagnosis of STEC infections. DNA samples may also be sent to the Laboratory and are also processed with this method (screening step only). The procedure for the complex matrices (fecal samples and mixed bacterial cultures) is divided in two sections, consisting of the screening followed by culture or subculture aimed at isolating

Laboratory Diagnosis of STEC Infections

7

the STEC strain identified at the screening step. The detection of the STEC virulence genes is carried out by RT-PCR using DNA extracted from bacterial cultures obtained following the enrichment of the clinical samples or the growth of the bacterial culture or isolates. When a positive result for the stx genes is obtained, single colonies are screened for the presence of the same genes, to isolate the STEC strain. This latter part of the procedure is not applied to the confirmation of pure STEC cultures. The procedure as a whole is sequential: in case of the detection of stx1 and/or stx2, the isolation of the STEC is attempted. The detection of the eae gene is performed on the stx-positive cultures or may be carried out simultaneously to the Stx-coding genes. In case of positivity to both the stx and the eae genes, the detection of top-five serogroup-specific genes may be carried out to aid the isolation. As a matter of fact, when some of the top-five serogroups are suspected (following the detection of one or more top-five serogroup associated genes in the screening of fecal samples), solid media such as CT-SMAC or RMAC, developed to facilitate the isolation of STEC O157 and O26 respectively, may be used. STEC O157 are resistant to cefixime and potassium tellurite and do not ferment sorbitol, whereas some STEC O26 do not ferment rhamnose and can be thus identified as colorless colonies onto CT-SMAC and RMAC, respectively (see Note 2). An exception are sorbitol-fermenting STEC O157:NM (nonmotile) strains, which are susceptible to tellurite and cannot be thus isolated on CT-SMAC. The procedure consists of the following steps: Sample preparation, template DNA purification, setting up and running the RT-PCR assays, and solid media plating for isolation. 3.1.1 Preparation of Fecal Samples

Keep fecal specimens refrigerated at 4
C if they were shipped at room temperature or refrigerated, or at 20
C if they were sent frozen in dry ice. Let the sample equilibrate at room temperature before starting the analysis. Inoculate aseptically 1 g of fecal specimen (1 g approximately corresponds to a 10 μL loopful) into 10 mL of TSB and incubate at 37
C for 18–24 h without shaking. Proceed with the DNA extraction step.

3.1.2 Preparation of Bacterial Cultures

Store bacterial cultures frozen, refrigerated, or at room temperature, depending on their nature (liquid broths, agar plates, cultures with cryo-preservatives, cultures streaked on sloped agar in tubes). Inoculate the bacterial culture samples, either mixed or pure cultures, in 10 mL of TSB using a sterile loop (1 μL) and incubate at 37
C for 18–24 h without shaking. Proceed with the DNA extraction step.

8

Stefano Morabito et al.

3.1.3 Preparation of Rectal Swabs

Transfer the rectal swab into 10 mL of TSB and incubate at 37
C for 18–24 h without shaking. Proceed with the DNA extraction.

3.1.4 DNA Extraction

Extract DNA from 1 mL of the enrichment culture using any commercial non-immobilized resin according to the manufacturer’s protocol. Use the purified DNA as a template for RT-PCR analyses described below. Dilute the DNA 1:10 before use. In case of isolated strains, dilute 1:100. Purify DNA from control strains (i.e., strains possessing the genes targeted by the RT-PCR) using the same kit and dilute 1:100.

3.1.5 Setting Up and Running of the RT-PCR

The amplification reactions for the identification of stx1 and stx2 genes are conducted as multiplex, along with Internal Amplification Control (IAC). As for the other targets (eae or serogroupassociated genes), they may be amplified as separate reactions along with the internal amplification control. According to the ISS protocol, set up the PCR reactions in total of 20 μL for each sample as described in Table 2, and analyze each sample in duplicate. Run the PCR for all targets, except for wzxO103, using the following thermal profiles: 1. 5 min at 95
C; 2. 15 s to 95
C; 3. 60 s to 60
C. Repeat steps 2 and 3, 40 times. Run the amplification of the wzxO103 gene as follows: 1. 5 min at 95
C; 2. 15 s to 95
C; 3. 60 s to 55
C. Repeat steps 2 and 3, 40 times.

3.1.6 Interpretation of PCR Results

The positive test sample has an increase in fluorescence as the amplification cycles increase, relative to the target gene channel (Fig. 1) (see Note 3). The correct evaluation of the results is primarily based on the observation of controls, which shall produce amplification in positive controls and will not yield any curve in negative controls. In the case one of controls do not produce the expected result, the assay should be repeated. Additional to the observation of the controls, the IAC should also be considered when evaluating PCR results (see Note 4). Check that there is no inhibition in the tested samples by examining the amplifications related to IAC. The IAC in use at ISS is the pUC19 [16] (Table 2). A good amplification of the IAC has the Ct (threshold cycle) values of 25–33 (see Note 5). In some cases, when analyzing complex samples, positivity may be detected in the lower regions of the graph (around or beyond the 35 amplification cycles). If such late positivity is detected, the result is assessed on a case-by-case basis. If the positivity affects only one of the two replicas, the test is not repeated and is considered positive for signals that rise within the 35th amplification cycle. In contrast, the samples are considered negative, on a case-by-case basis, if the signal rises beyond the 35th amplification cycle.

Laboratory Diagnosis of STEC Infections

9

Table 2 Schemes for the preparation of the RT-PCR reactions Reagent

Final concentration or amount

Mix per sample (stx1/stx2) Real-time PCR Mastermix

1

Primer stx FWD

1 μM

Primer stx REV

1 μM

stx1 Probe FAM

0.2 μM

stx2 Probe ROX

0.2 μM

Internal Amplification Control primer FWD

0.5 μM

Internal Amplification Control primer REV

0.5 μM

Internal Amplification Control probe HEX

0.2 μM

DNA sample

2 μL

Internal Control DNA pUC19

Ten copies

Water to the final volume of 20 μL Mix per sample (eae and serogroup-associated genes) Real-time PCR Mastermix

1

Primer FWD

0.5 μM

Primer REV

0.5 μM

Probe FAM

0.2 μM

Internal Amplification Control Assay

Same as above

DNA sample

2 μL

Internal Control DNA pUC19

Ten copies

Water to the final volume of 20 μL 3.1.7 Isolation of the STEC from the Positive Cultures

When the presence of stx genes in the RT-PCR screening is detected, the isolation is attempted by streaking the enrichment culture onto a solid media such as the TBX agar or MacConkey agar, followed by screening of isolated typical E. coli colonies using the same RT-PCR procedure used in the screening of stool samples and bacterial cultures. In case of the positivity for stx genes, the eae gene and one of the serogroup-specific genes, alternative media known to provide selectivity or specificity towards certain E. coli serogroups are used to select the colonies. In particular, the CT-SMAC is selective and differential for E. coli O157:H7, which does not ferment sorbitol and is resistant to cefixime and tellurite, whereas RMAC allows to visualize some E. coli O26 colonies that

10

Stefano Morabito et al.

Fig. 1 RT-PCR amplification curves. Panel a: The positive controls-related curves raise approx. at 18–20 cycle. Panel b: The curves related to positive samples raise typically later than those generated by the amplification of pure cultures (as the positive controls in a)

Laboratory Diagnosis of STEC Infections

11

do not ferment rhamnose. It has to be noted that sorbitolfermenting STEC O157:NM (non-motile) strains are indeed susceptible to tellurite and cannot be thus isolated on CT-SMAC. Media capable of identifying all STEC strains are not available, and the isolation of STEC from enrichment cultures still relies mostly on the use of the general media as the TBX agar or MacConkey agar. Several commercial chromogenic media (e.g., CHROMagar™) are proposed for this purpose but they may not work properly with all STEC serogroups and their suitability should be verified by the laboratory. 3.2 Detection of Free Shiga Toxin in Fecal Samples

Free fecal Shiga toxin is detected in order to identify the STEC infection in the absence of STEC isolation or other microbiological, molecular, or serological evidence (see below). The assay is very sensitive and can detect the presence of the free fecal toxin after the bacterium has been cleared following, e.g., an antibiotic treatment. The use of the Vero cell assay (VCA) requires the expertise in cellular biology, the morphology of the Stx-mediated cytotoxic effect, and neutralization experiments with anti-Stx1 and/or antiStx2 antibodies to confirm the specificity of the observed cytotoxicity (see Note 6). For these reasons, this assay is carried out by reference laboratories only. 1. Detach confluent Vero cell monolayers from the flask’s wall by digestion with trypsin/EDTA (final concentration of 1) for 10 min at 37
C. 2. Resuspend the cells in cell culture medium M199 and perform vital cells count in a Burker chamber through trypan blue staining. 3. Use a part of the cells to propagate the cell culture by seeding approximately 1010 cells into a 25 cm2 fresh cell culture flask containing M199 supplemented with penicillin/streptomycin (about 10 mL of medium) (see Note 7). Incubate at 37
C and 5% CO2 until the cells are confluent (this takes approx. 5 days). 4. Seed the other part of the cell suspension into a 96-well microplate. Seed approximately 5  104 cells/well in a final volume of 180 μL of M199 medium supplemented with penicillin/ streptomycin (as described in Subheading 2) and 100 μg/mL of gentamicin. Incubate at 37
C with 5% CO2 until the cells reach a semiconfluent layer, which may take approx. 24–48 h. 5. Prepare the fecal extract by suspending approximately 1 g or 1 mL (if liquid) of the fecal sample in 1 mL of sterile saline solution in a 1.5 mL tube and mix thoroughly by inverting the tube several times. 6. Centrifuge the suspension at a high speed (13,000  g for 10 min at 4
C), transfer the supernatant to a new tube, and sterilize by filtration through a 0.22 μm filter.

12

Stefano Morabito et al.

7. Prepare two-fold dilutions (1:2 and 1:4) of the sterile fecal extract, and add 20 μL of each dilution and the undiluted extract to the cell monolayers in the microplate wells. This results in final filtrate dilutions 1:10, 1:20, and 1:40. 8. Incubate at 37
C and 5% CO2 for 72 h. Observe the appearance of a cytopathic effect (CPE) after 24, 48, and 72 h to monitor the progression of the CPE, which includes the detachment of the rounded cells from the well surface followed by the cell death. 9. If needed, confirm the specificity of the CPE by applying serum neutralization test (see Note 6). 3.3 Detection of Antibodies Against STEC LPS in Patients’ Sera Using ELISA

This method is used in patients with HUS to get an indirect evidence of STEC infection when the results of the direct methods (STEC virulence gene PCRs, STEC isolation, and free fecal Shiga toxin detection) are negative. The approach is based on the detection of antibodies against E. coli LPS circulating in the patient’s serum using an ELISA assay. The test described here is a colorimetric assay, based on the use of p-nitrophenyl phosphate (pNPP) which turns yellow (λmax ¼ 405 nm) when dephosphorylated by the alkaline phosphatase coupled to the secondary antibody used to detect the circulating antibodies which are captured by the LPS used to sensitize the ELISA plates. The test is used to screen for a limited number of LPSs representing the STEC strains which are most frequently associated with HUS (O157, O26, O103, O111, O145) (see Note 8).

3.3.1 LPS Preparation

Use a reference strain for each serogroup you wish to probe for the presence of antibodies in the sera in order to prepare the reference LPS. 1. Inoculate the reference strain in 1 mL of TSB and incubate in a static flask overnight at 37
C. 2. Streak each overnight bacterial culture onto seven plates of nutrient agar (e.g., TSA) and incubate overnight at 37
C. 3. Resuspend the bacteria from the seven plates in 12 mL of TBS in a 50 mL tube. 4. Heat the bacterial suspension to 65
C in a water bath. Pre-warm 25 mL of liquid phenol to 65
C. 5. Add 25 mL of the pre-warmed phenol to the bacterial suspension under a hood and incubate at 65
C for 1.5 h in water bath. 6. Cool to room temperature and centrifuge at 800  g for 45 min at 4
C. 7. Recover the aqueous phase and add 20 mL of distilled water pre-warmed at 65
C to the tube and incubate again at 65
C for 90 min.

Laboratory Diagnosis of STEC Infections

13

8. Cool at room temperature and centrifuge at 800  g for 90 min at 4
C. 9. Collect the supernatant in a clean flask and add 3 M Na-acetate (one-tenth of the recovered volume, to get a final concentration of 0.3 M Na-acetate) and 5 volumes of absolute ethanol (kept at 20
C). Store at 4
C overnight. 10. Centrifuge the solution at 10,000  g and at 4
C in Corex glass tubes for 45 min. Discard the supernatant and resuspend the pellet in deionized water. 11. Centrifuge at 250,000  g (38,000 rpm with a SW41 Ti rotor) for 4 h at 4
C; resuspend the pellet (i.e., isolated LPS) in 200 μL deionized water and store at 20
C. Identify the working dilution of the LPS by using a serum sample known to be positive for the specific anti-LPS antibody (see Note 9). 3.3.2 ELISA Protocol

1. Prepare the working dilution of the reference LPS needed for the assay (see Note 9) in carbonate buffer and add 100 μL to the wells of an ELISA plate; use two wells per serum sample. Perform this step on day 1. Incubate overnight at 37
C. Perform steps 2–6 on day 2. 2. Wash the microplate(s) with carbonate buffer three times (200 μL per well). 3. Add ELISA buffer (200 μL per well) and incubate at 37
C for 30 min. 4. Remove the ELISA buffer and add the patient’s serum (diluted to 1:500 and 1:1000 in ELISA buffer) (100 μL per well). Add positive and negative controls for LPS antigens and serum samples, respectively (see Note 10). Incubate at 37
C for 90 min. 5. Remove the serum and the controls and wash the wells three time with ELISA buffer (200 μL per well). 6. Add secondary antibody (anti-human total IgG) conjugated with alkaline phosphatase diluted 1:4000 in ELISA buffer (100 μL per well). Incubate at 37
C for 90 min. 7. Remove the secondary antibody and wash with ELISA buffer (200 μL per well). 8. Add the diethanolamine/p-nitrophenyl phosphate substrate and incubate under the conditions indicated by the supplier. 9. Read the plate with a spectrophotometer at λ ¼ 405 nm after 15 min and 30 min of incubation at the dark, e.g., wrapped in an aluminum foil.

14

Stefano Morabito et al.

3.3.3 Interpretation of the Results

4

A serum is considered positive for a specific anti-LPS antibody, if the OD405 value is at least one-third of the positive control value or higher (e.g., the positive control serum OD405 ¼ 2.350 and the test sample OD405 ¼ 0.783 or higher). The negative controls’ OD405 values shall not exceed one-tenth of those yielded by the corresponding positive control.

Notes 1. The lack of the determination of stx2f gene is due to the fact that until recently this subtype had been reported mainly in the animal reservoir. Nonetheless, a RT-PCR targeting stx2f is available at the ISS website (https://www.iss.it/about-eu-rl-vtec). This RT-PCR can be applied when an stx2 and stx1 RT-PCR negative result is obtained in the presence of free Shiga Toxin detected in the Vero cell assay. 2. If one of the top five serogroups is suspected, an immunomagnetic serogroup-specific enrichment may be attempted to augment the chance to isolate the STEC, which may be present in stools of HUS patients in low amounts, for the following purpose of characterization. This piece of the protocol in our laboratory works best only with STEC O157 and O26 among the top five and sometimes its application may also be detrimental as there can be the simultaneous presence of an E. coli belonging to one of the target serogroups and the STEC: this could lead in losing the STEC present in the sample when following the serogroup rather than the Stx-coding genes. Therefore, the immuno-magnetic serogroup-specific enrichment is not going to be discussed here. 3. Different probe labels and quenchers can be used for the RT-PCR assays, but they should be selected according to the compatibility with the RT-PCR apparatus in use (i.e., availability of different detection channels). 4. If no fluorescence related to IAC is observed, the reaction shall be repeated diluting the sample 1:10 or following re-extraction of nucleic acid where possible if the problem persists. 5. The Ct value corresponds to the time point at which the amplification curve starts to grow, corresponding to the beginning of the exponential amplification. 6. Verification of the specificity of the CPE by a neutralization assay with anti-Stx1 and/or anti-Stx2 antibody is carried out if the CPE observed is not morphologically clear. Neutralization is performed by incubating the fecal extracts with a preparation of antibodies against the Stx1 and/or Stx2 for one hour at 37
C followed by inoculation onto the Vero cells monolayers

Laboratory Diagnosis of STEC Infections

15

in the same conditions as those described for the VCA. At ISS, in-house produced polyclonal antibodies raised in rabbits are used diluted 1:2000, but any poly- or monoclonal neutralizing antibody anti-Stx1 or Stx2 can be used, after determining the best conditions for the assay. The titer of the antibody to be used has been determined empirically at ISS by neutralizing the supernatant of an overnight culture of an STEC strain with serial dilutions of the polyclonal antibody and registering the highest dilution, which is still active to neutralize the CPE induced onto Vero cells monolayers. 7. The number of cells transferred to the flask is not a crucial parameter. The indicated number of seeded cells is meant to be a kind of a guidance but the growth of the cells in flask may develop differently in different laboratories, and the right couple number of cells/days to the monolayer should be determined in each laboratory. 8. There are more than 180 different serogroups identified for E. coli, and it would not be feasible to test for each and every of them into a single ELISA assay. To restrict the test to the most reported STEC serogroups in human cases of disease is a valuable strategy. At ISS, we prepare LPS of any new STEC serogroup we identify and add it to the panel for period of six months to monitor the circulation of the STEC serogroup concerned. 9. The working dilution of the LPS is determined empirically at ISS by running the ELISA assay after sensitizing the ELISA plate with dilutions of the newly prepared LPS and using for the detection a previously assayed serum sample positive for the presence of antibodies against the concerned LPS. The working dilution to be used is the one providing the best signal-tonoise ratio. 10. Human serum samples from patients with HUS that have been previously characterized are used as positive controls, in wells sensitized with the corresponding LPS antigens. The negative controls of the antigens are carried out by sensitizing the wells with the specific LPS and conducting the entire ELISA test without adding the serum sample. Finally, the highest serum concentration (1:500) will be placed in a well that has not been added with the LPS antigen and subjected to all the following ELISA test steps to exclude non-specific reactions. Such reactions may occur, due to cross-reactions between the serum samples and the microwell’s plastic. In case these non-specific reactions are detected, it is necessary to use further dilutions of the serum sample or eliminate the complement from the serum by incubation at 56
C for 30 min.

16

Stefano Morabito et al.

References 1. Petruzziello-Pellegrini TN, Marsden PA (2012) Shiga toxin-associated hemolytic uremic syndrome: advances in pathogenesis and therapeutics. Curr Opin Nephrol Hypertens 21(4):433–440. https://doi.org/10.1097/ MNH.0b013e328354a62e 2. Noris M, Remuzzi G (2005) Hemolytic uremic syndrome. J Am Soc Nephrol 16 (4):1035–1050. https://doi.org/10.1681/ ASN.2004100861 3. Jacquinet S, De Rauw K, Pierard D, Godefroid N, Collard L, Van Hoeck K, Sabbe M (2018) Haemolytic uremic syndrome surveillance in children less than 15 years in Belgium, 2009-2015. Arch Public Health 76:41. https://doi.org/10.1186/s13690-018-0289x 4. Loirat C, Saland J, Bitzan M (2012) Management of hemolytic uremic syndrome. Presse Med 41(3 Pt 2):e115–e135. https://doi.org/ 10.1016/j.lpm.2011.11.013 5. Freedman SB, Xie J, Neufeld MS, Hamilton WL, Hartling L, Tarr PI, Nettel-Aguirre A, Chuck A, Lee B, Johnson D, Currie G, Talbot J, Jiang J, Dickinson J, Kellner J, MacDonald J, Svenson L, Chui L, Louie M, Lavoie M, Eltorki M, Vanderkooi O, Tellier R, Ali S, Drews S, Graham T, Pang XL, (APPETITE) APPEIT (2016) Shiga toxin-producing Escherichia coli infection, antibiotics, and risk of developing hemolytic uremic syndrome: a meta-analysis. Clin Infect Dis 62 (10):1251–1258. https://doi.org/10.1093/ cid/ciw099 6. Kakoullis L, Papachristodoulou E, Chra P, Panos G (2019) Shiga toxin-induced haemolytic uraemic syndrome and the role of antibiotics: a global overview. J Infect 79(2):75–94. https://doi.org/10.1016/j.jinf.2019.05.018 7. Safdar N, Said A, Gangnon RE, Maki DG (2002) Risk of hemolytic uremic syndrome after antibiotic treatment of Escherichia coli O157:H7 enteritis: a meta-analysis. JAMA 288(8):996–1001. https://doi.org/10.1001/ jama.288.8.996 8. Agger M, Scheutz F, Villumsen S, Mølbak K, Petersen AM (2015) Antibiotic treatment of verocytotoxin-producing Escherichia coli (VTEC) infection: a systematic review and a proposal. J Antimicrob Chemother 70 (9):2440–2446. https://doi.org/10.1093/ jac/dkv162 9. Ardissino G, Tel F, Possenti I, Testa S, Consonni D, Paglialonga F, Salardi S, BorsaGhiringhelli N, Salice P, Tedeschi S, Castorina P, Colombo RM, Arghittu M,

Daprai L, Monzani A, Tozzoli R, Brigotti M, Torresani E (2016) Early volume expansion and outcomes of hemolytic uremic syndrome. Pediatrics 137(1). https://doi.org/10.1542/ peds.2015-2153 10. Scheutz F, Teel LD, Beutin L, Pie´rard D, Buvens G, Karch H, Mellmann A, Caprioli A, Tozzoli R, Morabito S, Strockbine NA, Melton-Celsa AR, Sanchez M, Persson S, O’Brien AD (2012) Multicenter evaluation of a sequence-based protocol for subtyping Shiga toxins and standardizing Stx nomenclature. J Clin Microbiol 50(9):2951–2963. https://doi. org/10.1128/JCM.00860-12 11. Friedrich AW, Bielaszewska M, Zhang WL, Pulz M, Kuczius T, Ammon A, Karch H (2002) Escherichia coli harboring Shiga toxin 2 gene variants: frequency and association with clinical symptoms. J Infect Dis 185(1):74–84. https://doi.org/10.1086/338115 12. Melton-Celsa AR, O’Brien AD (2014) New therapeutic developments against Shiga toxinproducing Escherichia coli. Microbiol Spectr 2 (5). https://doi.org/10.1128/microbiolspec. EHEC-0013-2013 13. EFSA (2009) Technical specifications for the monitoring and reporting of verotoxigenic Escherichia coli (VTEC) on animals and food (VTEC surveys on animals and food) on request of EFSA. EFSA J 7(11):1366 14. EFSA BIOHAZ Panel, Koutsoumanis K, Allende A, Alvarez-Ordonez A, Bover-Cid S, Chemaly M, Davies R, De Cesare A, Herman L, Hilbert F, Lindqvist R, Nauta M, Peixe L, Ru G, Simmons M, Skandamis P, Suffredini E, Jenkins C, Monteiro Pires S, Morabito S, Nauta M, Niskanen T, Scheutz F, daSilva FM, Messens W, Bolton D (2020) Scientific opinion on the pathogenicity assessment of Shiga toxin-producing Escherichia coli (STEC) and the public health risk posed by contamination of food with STEC. EFSA J 18 (1):5967 15. Grande L, Michelacci V, Bondı` R, Gigliucci F, Franz E, Badouei MA, Schlager S, Minelli F, Tozzoli R, Caprioli A, Morabito S (2016) Whole-genome characterization and strain comparison of VT2f-producing Escherichia coli causing hemolytic uremic syndrome. Emerg Infect Dis 22(12):2078–2086. https://doi.org/10.3201/eid2212.160017 16. Fricker M, Messelh€ausser U, Busch U, Scherer S, Ehling-Schulz M (2007) Diagnostic real-time PCR assays for the detection of emetic Bacillus cereus strains in foods and recent food-borne outbreaks. Appl Environ

Laboratory Diagnosis of STEC Infections Microbiol 73(6):1892–1898. https://doi. org/10.1128/AEM.02219-06 17. Perelle S, Dilasser F, Grout J, Fach P (2004) Detection by 50 nuclease PCR of Shiga-toxin producing Escherichia coli O26, O55, O91, O103, O111, O113, O145 and O157:H7, associated with the world’s most frequent clinical cases. Mol Cell Probes 18(3):185–192. https://doi.org/10.1016/j.mcp.2003.12.004 18. Nielsen EM, Andersen MT (2003) Detection and characterization of verocytotoxin-

17

producing Escherichia coli by automated 50 nuclease PCR assay. J Clin Microbiol 41 (7):2884–2893. https://doi.org/10.1128/ jcm.41.7.2884-2893.2003 19. Perelle S, Dilasser F, Grout J, Fach P (2005) Detection of Escherichia coli serogroup O103 by real-time polymerase chain reaction. J Appl Microbiol 98(5):1162–1168. https://doi. org/10.1111/j.1365-2672.2005.02545.x

Chapter 2 Shiga Toxin-Producing E. coli in Animals: Detection, Characterization, and Virulence Assessment Stefanie A. Barth, Rolf Bauerfeind, Christian Berens, and Christian Menge Abstract Cattle and other ruminants are primary reservoirs for Shiga toxin-producing Escherichia coli (STEC) strains which have a highly variable, but unpredictable, pathogenic potential for humans. Domestic swine can carry and shed STEC, but only STEC strains producing the Shiga toxin (Stx) 2e variant and causing edema disease in piglets are considered pathogens of veterinary medical interest. In this chapter, we present general diagnostic workflows for sampling livestock animals to assess STEC prevalence, magnitude, and duration of host colonization. This is followed by detailed method protocols for STEC detection and typing at genetic and phenotypic levels to assess the relative virulence exerted by the strains. Key words Shiga toxin, Shiga toxin-producing Escherichia coli, STEC, Virulence genes, Host–cell interactions, Prevalence, PCR, Pulsed-field gel electrophoresis, Multilocus sequence typing, Vero cell cytotoxicity assay, ELISA, Adhesion assay, Invasion assay

1

Introduction Shiga toxin-producing E. coli (STEC) are food-borne pathogens that can evoke diarrhea, hemorrhagic colitis (HC), and hemolytic uremic syndrome (HUS) in humans [1]. Cattle and other ruminants are primary reservoirs for STEC serotypes frequently associated with human disease, e.g., O157:H7 [2] and non-O157 STEC serogroups including O26, O45, O103, O111, O121, and O145 [3–5]. Humans principally acquire the infection via the oral route by consumption of food items or water contaminated with fecal matter from livestock and wild ruminants [2]. Domestic swine can also carry and shed STEC but the role of swine in the epidemiology of STEC-related human disease is likely minor [6]. STEC strains producing the Shiga toxin (Stx) 2e variant cause edema disease (ED) in piglets and are referred to as the edema disease E. coli (EDEC) subtype of STEC [7]. In this chapter, all

Stephanie Schu¨ller and Martina Bielaszewska (eds.), Shiga Toxin-Producing E. coli: Methods and Protocols, Methods in Molecular Biology, vol. 2291, https://doi.org/10.1007/978-1-0716-1339-9_2, © Springer Science+Business Media, LLC, part of Springer Nature 2021

19

20

Stefanie A. Barth et al.

Stx-producing E. coli are referred to as STEC, with the exception of porcine pathogenic STEC-encoding Stx2e for which the acronym EDEC is used. 1.1 Edema Disease of Swine (ED)

ED (syn. E. coli enterotoxaemia) is an acute, severe, and often fatal swine disease that primarily affects piglets during the first 2 weeks after weaning. ED is common in most countries with intensive swine production and, due to high morbidity and mortality, can have a significant economic impact on farms. ED is caused by certain STEC strains that are able to colonize the porcine small intestine and produce Stx2e (EDEC). Bacterial colonization of the porcine intestine is mediated by the ability of these bacteria to adhere to villous epithelial cells via their cytoadhesive F18 fimbriae. Two major subtypes of F18 fimbriae are distinguished by serologic and molecular methods and both have been detected in EDEC strains: F18ab fimbriae (previously called F107 fimbriae) and F18ac (formerly termed 2134P, 8813, or Av24 fimbriae) [8]. The expression of receptors for these fimbriae on the apical enterocyte surface is inherited as a dominant trait among pigs and determines susceptibility to diseases caused by F18-fimbriated pathogenic E. coli [9]. Most EDEC strains belong to E. coli serogroups O138, O139, and O141 and also to others such as O8, O147, and O149. Some strains are O-non-typeable [10]. Similar to enterotoxigenic E. coli (ETEC), many EDEC strains produce heat-labile E. coli enterotoxin I (LT-I), or heat-stabile E. coli enterotoxins I or II (ST-I, ST-II), and/or F4 or F5 fimbriae in addition to Stx2e and F18 fimbriae [11]. These strains may be regarded as EDEC/ETEC hybrids. Clinical manifestation in weaned piglets is a hallmark of ED. Piglets usually acquire EDEC during the suckling period or early after weaning via the fecal–oral route. The sudden increase in nutrient protein due to the change of feed and the concomitant withholding of protective milk antibodies during weaning are assumed to initiate massive growth of the pathogen in the small intestine and to trigger the pathogenesis of ED [12]. Symptoms and lesions are extensively elicited by Stx2e after its translocation from the pathogen colonization site across the intestinal epithelium into the bloodstream. Stx2e causes a systemic microangiopathy characterized by fibrinoid necrosis of endothelial and smooth muscle cells in small arteries and arterioles. Subsequently, perivascular edema, hemorrhage, and ischemic necrosis occur in several locations, conspicuously in the subcutis of the forehead, eyelids and submandibular region, in the submucosa of the larynx and stomach, and in the brain. Focal perivascular damage of the brain tissue is accompanied by a progredient neurologic dysfunction, e.g., ataxia, paralysis, convulsions, and lateral recumbency. Infarction and malacia in the brain stem are the main causes of death in affected pigs [12, 13]. However, in cases where EDEC/ETEC

STEC in Animals

21

hybrid strains are implicated, diarrhea and subsequent dehydration can predominate the clinical appearance [14, 15]. Treatment of ED rarely proves successful and economically reasonable, particularly in severely affected pigs. Measures taken during an outbreak rather focus on the protection of healthy mates from infection or from the onset of disease. Several meta- and prophylactic measures have been suggested for control and prevention of ED [16, 17]. The discovery that Stx2e and F18 fimbriae are not only crucial virulence factors in the pathogenesis of ED but also are protective antigens has stimulated efforts to develop specific protocols for active and passive immunization [18–20]. The European Commission has granted a marketing authorization valid throughout the EU for two Stx2e-based toxoid vaccines and an F18-based live E. coli vaccine for swine [21]. On most farms, the most successful strategy to prevent outbreaks of ED is a combination of several measures instead of any single activity [16]. 1.2 STEC Carriage and Shedding by Ruminants

Since a targeted treatment for STEC-induced human diseases is still not in sight, prevention of human infection with STEC from animal and environmental sources has the highest priority. Prophylactic measures to prevent exposure are challenging as up to 86% of cattle shed STEC with their feces [2, 22]. Bovines can already become infected at calves’ age by minute infectious doses [23]. After initial replication in the ileum, cecum, and colon, persistent infection is established and followed by prolonged shedding of the bacteria for several months [24, 25]. While strains considered to be particularly virulent to humans, like those of serovar O157:H7, preferably colonize epithelia covering lymphoid follicles [26] and the squamous epithelium [27] at the recto-anal junction, STEC of other serovars evenly colonize the large bowel mucosa in numerous microcolonies [26]. In principle, experimental and natural STEC infections of cattle remain asymptomatic [28, 29]. STEC are able to induce bloody diarrhea in calves [30, 31], but infections of adult cattle establish in the absence of intestinal inflammation. STEC have adopted a commensal-like lifestyle in the intestinal milieu of bovines [32]. In periods of low pathogen exposure (on pasture), STEC shedding rates may temporarily drop below the detection limit for the bacteria [33], but the same STEC clone can be maintained in a single herd for several months and years [25, 34]. Even though STEC are shed for longer periods by calves than by adult cattle [35] and the latter harbor Stx-specific antibodies [36], a previous STEC infection does not protect from reinfection even with the same strain [35, 37]. Shedding of STEC by cattle at high numbers (commonly defined as >104 colony-forming units [cfu]/ g of feces), so-called super-shedding, seems to be the major source of deposition into the environment and has an important role in augmenting cattle-to-cattle transmission [38]. Such shedding is not confined to certain animals [39] but viewed as an occasional

22

Stefanie A. Barth et al.

phenomenon with the potential to occur in any individual bovine. These relatively rare super-shedding events contribute significantly to human risk [40]. 1.3 STEC Virulence Assessment and Its Challenges

Identification of the STEC virulence gene profiles is the basis of the modern approach to an impact assessment of STEC on public health [41]. Numerous attempts have been undertaken to subtype the many different STEC strains that are shed by animals in order to predict a given strain’s degree of threat to human health. Various levels of host adaptation have been traced back to certain patterns of virulence genes and their expression levels. E.g., STEC O157: H7 strains express iha, espA, rfbE, and ehxA to different extents according to their origin from natural infections of humans or cattle [42]. Spontaneous Stx production is higher in HUS-associated STEC clones than in bovine STEC isolates, and Stx1 production is induced more strongly by iron deprivation in vitro in the former [43]. A reduced capacity to produce Stx2 in bovine STEC correlates with the presence of the Q21 allele of the late antiterminator protein Q upstream of stx in the genome of stx-converting prophages, whereas strongly inducible Stx production seems to be linked to the Q933 allele [44]. Indeed, a support vector machine analysis of bovine and human E. coli O157 isolate sequences identified cattle strains more likely to be a serious threat to human health by comparing them with sequences from human isolates [45]. This distinction was possible despite the fact that the majority of the isolates involved were members of previously defined pathogenic lineages and encoded key virulence factors. The major differences between human and bovine E. coli O157 isolates were the relative abundances of predicted prophage proteins. However, the confidence in relying on such analyses to predict human pathogenicity of STEC isolates was severely shattered by the appearance of unexpected novel and unusual STEC strains possessing a blended virulence profile combining genetic patterns of STEC and human adapted enteroaggregative E. coli (EAEC), rarely detected in animal hosts before [46, 47]. Although the O104:H4 STEC/EAEC hybrid strain that caused the 2011 German outbreak appears to be preferably adapted to humans, the strain’s potential to colonize intestinal epithelial cells of humans and cattle [48] indicates that even STEC strains with an unusual genotype can colonize hosts of various species. Indeed, the outbreak strain colonizes calves under experimental conditions [49], its genetic markers are present in the cattle population [50], and the strain has been grouped in the midst of bovine commensal strains in a recent comprehensive genome analysis unveiling the evolutionary sources [51]. Colonization of the mucosal site is a complex process but a highly conserved feature of intestinal E. coli strains [52]. Different outcomes of bacterial infection in various hosts may result inter alia from differential abilities to interact with the respective epithelial

STEC in Animals

23

cells [53], specific differences in cellular receptor distribution [54, 55], and altered expression of bacterial factors [42]. In the natural reservoir, virulence factors of bacterial pathogens counteract elements of the immune control generating a balance between pathogen and host [56]. In order to appraise the relative level of host adaption and virulence of an outbreak strain to possible reservoir hosts, comparing its interaction with host-specific cells in vitro and linking its reaction profile to that of defined bovine- and human-associated E. coli strains may be instrumental to raise the level of preparedness against future outbreaks implicating unusual STEC strains. Several methods have been deployed to support risk assessment in the public health context, including:

2

l

Detection of stx genes in conjunction with the presence of the LEE locus (namely eae) and genes encoding for EHEC hemolysin (ehxA).

l

Whole genome sequencing of strains and analysis of the virulence associated gene profile and the resistance profile.

l

Vector machine analysis of isolate sequences to predict human adaptation [45].

l

Phenotypic confirmation of Stx production by Vero cell assay [48, 57, 58] or by ELISA [59] (see Subheading 4.4).

l

Antimicrobial susceptibility testing using antimicrobial disc diffusion or broth dilution assays according to the CLSI protocol [60].

l

Assessment of adherence and invasion capabilities for epithelial cells [46, 48, 58, 61] (see Subheading 4.5).

l

Assessment of virulence gene transcription and its regulation in cultured mammalian cells [48] (see Subheading 4.6).

Diagnostic Workflows for STEC Detection in Animals The pathogenesis of STEC-associated diseases originates from colonization and multiplication of the pathogens at intestinal mucosal surfaces. STEC strains, including the highly virulent O104:H4 strain, which caused the large outbreak of HUS and HC in Germany in 2011, are noninvasive [46, 48, 49]. Despite the fact that viable bacteria were occasionally found at necropsy in mesenteric lymph nodes in natural hosts [62], STEC have not been detected in extraintestinal tissues during the course of systemic disease [63, 64]. Consequently, fecal matter is the principal diagnostic sample for detecting STEC and EDEC in animals.

24

Stefanie A. Barth et al.

Shiga toxins (Stxs), potent bacterial exotoxins produced and released by STEC [65], represent the principal virulence factors implicated in pathogenesis [66]. Many human pathogenic STEC strains inherit the ability to settle on the enteric mucosa by inducing attaching and effacing (AE) lesions leading to a tight association of single bacteria or small-size colonies with intestinal epithelial cells. The genes involved are encoded by the locus of enterocyte effacement (LEE) in the STEC chromosome [67, 68]. While the LEE is a key determinant in pathogenesis, not all STEC possess it, indicating that some strains deploy alternative virulence and colonization factors [69]. The occurrence of an outbreak caused by the unusual yet highly virulent O104:H4 hybrid strain, which lacked the LEE locus [46], stresses the fact that Stx is the only common denominator of STEC strains posing a threat to susceptible hosts. This notion can be extended to O80:H2 STEC/ExPEC (extraintestinal pathogenic E. coli) hybrid strains [70, 71] and also to EDEC strains deploying different subtypes of F18 fimbriae to colonize the porcine intestine. An important diagnostic tool to identify STEC, specifically those of serotype O157:H7, in clinical samples, food samples, and feces is sorbitol MacConkey agar. STEC strains of O157:H7 serotype are not capable of fermenting sorbitol, which allows for an easy identification of suspicious colonies on solid agar plates. Immunomagnetic separation applying magnetic beads coated with anti-O antibodies, e.g., anti-O157 coated beads, helps to enrich STEC of the respective O serogroup for a subsequent cultural detection. The increasing clinical importance of sorbitol-fermenting O157 strains (SF-O157) in Central Europe [72], the recognition of STEC strains of other serogroups as human health threat [73], and the SF capabilities of porcine pathogenic EDEC [74] strictly limit the value of this simple biochemical property for diagnostic use when it comes to analyzing samples from animal sources. Similarly, a hemolysin produced by STEC (designated EHEC hemolysin) causes hemolytic zones on specific blood agar plates [75] and is present in many but not all STEC isolates of human and animal origin [76–78]. Taken together, methods to detect STEC in animals are essentially based on the detection of a limited number of virulence factors by molecular biological methods with the gene-encoding Stx being the primary target [57, 67]. A strict application of molecular methods for clinical diagnosis of ED in pigs or for the assessment of STEC prevalence in animal populations has the advantage that the respective laboratory procedures can be performed under conditions of comparably low biosafety precautions. By contrast, directed work with STEC isolates must be conducted under biosafety level 3 conditions in many countries. Since certain STEC strains are considered potential biological warfare agents, restrictive measures for accessing the laboratories and the material therein apply. The reader is strongly

STEC in Animals

25

advised to seek approval by the competent authorities of the country in which the work is to be conducted to ensure strict compliance with the pertinent regulations before work is taken up. If a biological material confirmed to contain STEC strains—with cultures of isolated STEC in particular—is forwarded to other laboratories, shipping may also have to meet specific requirements. Such are laid down in the “UN Recommendations on the Transport of Dangerous Goods” and regulations based thereupon like the “Accord relatif au transport international des marchandises Dangereuses par Route” (ADR) and the International Air Transport Association (IATA) global standards. 2.1 Detection of EDEC in Piglets

Implementation of effective control and prevention measures against postweaning syndromes in swine generally requires that their causes are accurately identified. Definitive diagnosis of ED is essentially based on (a) appearance of typical clinical signs and/or lesions in pigs in combination with (b) presence of viable EDEC or EDEC/ETEC bacteria in these pigs. Consequently, diagnosis of ED includes systematic application of different diagnostic procedures usually according to the following order: l

Recording the medical history.

l

Clinical examination of affected pigs,

l

Necropsy of representative perished or euthanized pigs, including gross and histopathological examinations (facultative).

l

Bacteriological analysis of intestinal contents or feces from representative pigs.

ED must be suspected if sudden death, neurological signs, subcutaneous edema, dyspnea, and unusual sound of squeals are observed in piglets during the first weeks after weaning [79]. Gross and microscopic lesions such as gelatinous subcutaneous edema, submucosal edema in the stomach and mesocolon, pulmonary edema, hemorrhage, arteriopathy, perivascular edema, and encephalomalacia corroborate the suspicion [16, 17]. A presumptive diagnosis may be easier in an ED outbreak when affected animals display the full range of signs [17]. However, laboratory-based diagnosis is indispensable since ED must be differentiated from a number of diseases that may occur with similar manifestations, e.g., water deprivation, vitamin E-selenium deficiency, poisoning (sodium chloride, selenium, lead, organic arsenic), pseudorabies, Gl€asser’s disease, classical swine fever, Teschen/Talfan disease, septicemia, and meningoencephalitis caused by Streptococcus suis or Salmonella enterica serovar Choleraesuis [16]. The presence of EDEC or EDEC/ETEC in affected piglets is considered proven as soon as suspect E. coli bacteria are cultured from intestinal contents or feces and typical virulence factors or genes are subsequently confirmed in these bacteria (virotyping).

26

Stefanie A. Barth et al.

2.1.1 Specimen Collection

EDEC are noninvasive bacteria shed by infected pigs with their feces. Thus, intestinal content and intestinal mucosal swabs are the most appropriate specimens for laboratory examination as they usually yield high EDEC counts in culture when collected from the distal jejunum, ileum, or colon of piglets as long as the animals have not yet received antibiotic treatment [80]. Samples should be obtained from perished or euthanized piglets immediately after their death to avoid artifacts by overgrowth of non-causative microorganisms. Rectal swabs and fecal samples from affected piglets are also highly suitable for bacterial culture of EDEC and EDEC/ETEC. Sometimes it is more convenient for the collector and causes less discomfort to the animals when fecal samples are collected from freshly voided feces on the pen floor. This procedure is acceptable if the material really originates from piglets with suspected ED. Bacterial counts of EDEC and EDEC/ ETEC can decrease rapidly after the onset of symptoms in infected piglets and can be low in samples associated with chronic or mild forms of ED. Therefore, samples provide the best chance to isolate the causative bacterial pathogen when taken from acutely and severely affected animals during the first days of sickness. Analogous to porcine E. coli diarrhea, we recommend to take samples from at least 3–5 representative piglets in an outbreak [81]. Group and environmental sampling strategies have become increasingly important for the efficient surveillance of infectious diseases in modern pig production systems. Boot swab (syn. sock swab) techniques have been developed to collect fecal samples from pen floors and have proven valuable for detecting diarrheagenic E. coli at nurseries [82]. Boot swabs are obtained by walking through the pen of concern while wearing boots covered with a sterile disposable plastic sock and a polyethylene overboot on the outside. Another method of sampling pigs at pen-level utilizes pieces of cotton ropes that are transiently exposed as a toy to the animals of interest. Pigs chew on these ropes due to their natural exploratory behavior, thereby soaking the cotton with “oral fluids.” These oral fluids can be recovered and represent an appropriate test matrix potentially containing not only antibodies against various pathogens but also the viral and bacterial pathogens themselves [83]. We have used boot swabs and oral fluids successfully to detect EDEC and EDEC/ETEC strains in batches of weaned piglets (data not published). All samples should be collected in clean, sterile containers and stored on ice or refrigerated until they are further processed.

2.1.2 Sample Shipment

To obtain accurate and reliable test results, all samples must be processed and submitted to the bacteriological examination as soon as possible, optimally within 3 h. Keep samples on ice or refrigerated (4–6
C) during shipment to the laboratory. Consider the use of a bacteriological transport medium such as Stuart medium, if laboratory processing cannot be started within 24 h [16].

STEC in Animals

27

2.1.3 Sample Analysis

Under Subheading 4.1, we describe detailed protocols that have proved valuable in our hands for isolation and subsequent confirmation of EDEC and EDEC/ETEC from clinical or environmental samples by PCR. Parts of that section represent updates from an earlier version [84]. Please note that boot swabs and cotton ropes require specific processing in the laboratory to harvest the specimens that can then be cultured for bacteria (see Subheadings 4.1.1 and 4.1.2). Multiplex PCR techniques make it possible to rapidly screen large numbers of bacterial isolates for a variety of discriminative virulence genes, thus facilitating detection and classification of pathogenic E. coli with great sensitivity and specificity. The porcine STEC/ETEC multiplex PCR was originally introduced by Casey and Bosworth [85]. We complemented the original protocol to additionally facilitate detection of the intimin gene (eae) which is a distinguishing virulence marker of enteropathogenic E. coli (EPEC) and some STEC [86]. The porcine EDEC duplex PCR combines the F18-specific primers of the aforementioned multiplex PCR and Stx2e-specific primers published by Scheutz et al. [87].

2.2 Detection of STEC in Ruminants

In the past four decades, several hundred articles have reported the detection of STEC in farmed ruminants, in animals displayed at farm fairs, and kept in petting zoos. Reported estimates of the STEC prevalence on cattle farms in Europe vary widely between 0% and 86% [88–93]. Multiple factors are known to influence STEC shedding including diet [94, 95], precipitation, ambient temperature, region, and season [96–98]. Carriage of STEC by cattle and sheep can range from low to very high, i.e., supershedding [40, 99]. Individual STEC shedding by cattle may vary significantly from birth to slaughter in terms of numbers of bacteria shed and also with regard to the strains detectable [22] as calves become exposed to a plethora of different STEC strains in the first month after birth [29, 58]. According to Zoonoses Directive 2003/99/EC, European member states are obliged to collect relevant and comparable data on zoonoses, zoonotic agents, and food-borne outbreaks but notification requirements differ significantly from country to country [41]. In 2018, testing of 1690 sample from animal units (animals or herds or flocks) was reported by only six member states. Overall, the presence of STEC was reported in 7.6% of them. There is still large use of methods that only detect E. coli O157 in samples from animals. Other animal samples were tested using the ISO TS 13136:2012 method, implemented for food and animal feeding stuffs rather than samples taken from livestock intra vitam [100]. Only limited attempts have been made to precisely estimate the STEC prevalence in ruminants at a nationwide scale. Two national cross-sectional surveys in Scotland [101, 102] demonstrated the presence of E. coli O157 on approximately 20% of farms producing cattle for human consumption. A structured survey in England and

28

Stefanie A. Barth et al.

Wales during 1999 estimated herd-level STEC O157 prevalence to be 38.7% [103], while a 2003 convenience survey in England and Wales identified STEC O157 on 32.2% of 255 farms [104]. The British E. coli O157 in Cattle Study (BECS) between September 2014 and November 2015 on 270 farms across Scotland and England and Wales [105] revealed herd-level prevalence estimates for E. coli O157, with the majority of strains being stx positive, of 23.6% for Scotland and of 21.3% for England and Wales. Other STEC serotypes were not monitored in these studies. 2.2.1 Study Designs

In lieu of continuous and comprehensive monitoring and reporting by competent authorities for STEC carriage and shedding by livestock in many countries, timely and tailored prevalence studies are required to provide a sound basis for implementing pre- and postharvest food safety measures to prevent human disease. Studies must be designed according to good epidemiologic practices and may be manifold depending on the hypothesis to be proven. Two examples are provided hereafter. For a cross-sectional study, authors of the BCES study systematically identified to-be-sampled farms taking into account estimated prevalences and geographic information as well as participation in a previous STEC prevalence study [105]. Sampling teams were sent once to each farm. The sample group was the group of nonbreeding cattle closest to slaughter on the day of the visit. At the sampling visit, a questionnaire was completed through a face-to-face interview. Another study aimed at assessing STEC shedding by cattle between birth and slaughter and only considered a small number of farms [22]. On each farm, groups of 25 heads of cattle were monitored on average. Each animal among the beef groups was sampled at intervals of approximately 2  4 weeks from birth to slaughter. Sampling was interrupted for the periods when the cattle were kept on pasture and were thus not accessible for regular examinations. Some animals were also sampled on the day of slaughter before transport to the abattoir, immediately upon arrival at the abattoir, and just before slaughter.

2.2.2 Specimen Collection

Even though fecal matter is the prime sample to be taken, other sampling matrices are also feasible: l

Natural fecal pats (freshly voided) [105, 106]: This matrix is appropriate when sampling in the pens aims to avoid approaching and handling of single animals. Samplers should ensure that they do not sample from the same pat twice nor from old, dried, or desiccated pats. The number of pats taken from each group depends on group size [102, 107, 108]. For each sample, a 30 mL universal container is filled to just below the threaded portion with feces taken from several locations on a fresh pat. Samplers may preferentially target areas

STEC in Animals

l

l

l

l

29

on the surface of the pat where mucus is apparent to appreciate the recto-anal junction as principal colonization site of O157: H7 strains, which is believed to primarily result in surface contamination of the pat [26]. Rectal swabs [22]: This is the matrix of choice when shedding of single animals is to be assessed. The assessment may be quantitative (i.e., enumeration of STEC bacteria) or qualitative over time (i.e., typing of isolated STEC strains) or combinations thereof. All animals are identified by their ear tag numbers. Rectal swabs are immediately transferred into sterile tubes to prevent environmental contamination. Grab samples [109]: Rectal content can be obtained from animals via palpation with a gloved hand. Fresh gloves have to be used for each individual sampling to protect from cross-contamination between animals. Such samples combine the advantage of being traceable to single animals and being of significant volume. However, the rectal ampulla may be empty at the time of sampling which particularly hampers sampling of younger animals. Grab samples may be obtained from more cranial areas of the rectum in adult animals, but this sampling method requires enhanced efforts and manipulation of animals with the accompanied risk of the sampler getting harmed. Perineal or hide swab samples [106, 110]: Bovine manure can harbor STEC at typical environmental temperatures for >49 days [111]. Dirt and feces that collect on the hides of cattle can therefore be contaminated with E. coli O157:H7 for long periods of time [112]. Hide swab samples can be collected from a 500-cm2 area of the hide around the anus or of the rump using a sterile sponge stick (e.g., 3M, St. Paul, MN, U.S.A.) moistened with 25 mL of PBS, with a new sponge stick used for each animal. Manila rope [113]: Ropes (1–1.5 m long) are fastened to bunk rails within each pen to be available overnight for cattle to rub or chew. The following morning, ropes are collected aseptically and returned to the laboratory for bacterial culture. For each pen, several ropes can be deployed in order to obtain data representative of the entire group of pen-mates. To classify pens as high or low prevalence in longitudinal studies conducted during the summer and winter feeding periods, regular sampling over a period of two full years may be necessary [113]. This sampling procedure allows for a simple handling, avoidance of animal contact but monitoring of groups of animals rather than individuals.

30

Stefanie A. Barth et al. l

Boot swabs [114, 115]: This procedure allows for a quick sampling of animal groups but is advantageous over pat or rope sampling as walking the pen by the sampler results in the collection of a composite sample likely best reflecting the shedding pattern of the entire animal group (also see Subheading 4.1.1). The boot swab sampling technique is established for environmental sampling of mycobacteria in dairy herds, an approach overcoming the issue of sampling location and further reducing effort and cost [116]. The detection limit of this approach in terms of withinherd prevalence is low [117], but depends on the laboratory methods used to detect the pathogen of interest. The technique has not yet been applied for the detection of STEC on cattle farms, but is being used routinely for monitoring the presence of antimicrobial resistant Enterobacteriaceae in pig pens [115].

A study by Stanford et al. [118] showed that collection of rectal fecal samples from all animals per pen provided superior isolation of E. coli O157:H7 compared with oral swabs, pooled fecal pats, and manila ropes, although labor and animal restraint requirements for fecal sample collection were high. Depending on the setting in the animal holding and the research question to be answered, investigators have to carefully select the sampling method if application of several methods in parallel is considered not feasible. 2.2.3 Sample Shipment

Samples are labeled and have to be kept cool during immediate transport to the laboratory. Microbiological examination ought to start within 3 h after sampling. If it takes longer, samples should be transported on dry ice and transferred to 80
C upon arrival at the laboratory for later processing. However, different bacterial strains are affected by this procedure to different extents, resulting in a shifted population of cultivable strains.

2.2.4 Sample Analysis

The laboratory workflow to be applied for prevalence estimation has to be adjusted to the principal question to be answered. For determining the intra- or interherd prevalence, simple grading of samples as STEC positive or negative may be sufficient. For a better understanding of the STEC population and its dynamics in an animal population, isolation and characterization of strains is indispensable. Thereby, the analysis may be restricted to STEC O157: H7 strains which can easily be selected by their sorbitol-fermenting inability if this is deemed suitable in the given setting and the lack of information on STEC strains of other serotypes is acceptable. In these instances, qualitative methods may be used to analyze individual (e.g., fecal swab, grab sample) or composite samples (e.g., boot swab). If the quantity of shedding is of interest, e.g., to determine the number of super-shedders in a herd or the average number of STEC bacteria shed related to diet or season, quantitative culture- or PCR-based methods have to be used.

STEC in Animals

31

In either case, prescreening of samples by PCR for the presence of stx genes ([58]; see Subheading 4.2.2) is highly advisable to narrow down the number of samples to be processed in subsequent stages of the laboratory workflow. Applying quantitative PCR protocols gives an indication of the amount of STEC present in the sample at this early stage of the workflow [50]. Of note, PCR protocols frequently give rise to positive results for stx genes, but subsequent attempts to isolate the stx-harboring bacteria can fail [50]. This may be due to the presence of genomic information from dead bacterial cells or from viable but not cultivable states of the STEC, the presence of free stx-converting bacteriophages, the sensitivity of the PCR method relative to culturing methods, or any combination thereof. Nevertheless, PCR prescreening avoids unnecessary culturing with little risk of classifying samples as false negative. Introduction of a pre-enrichment step in broth [22] or plating on Gassner agar and subsequent wash off [57, 58, 119] overcomes some of the shortcomings of PCR prescreening. As soon as colonies are visible on inoculated solid agar plates like MacConkey or Gassner, isolates can be obtained for further genetic or phenotypic typing. Isolates can be directly picked and confirmed to be STEC by testing individual colonies or colony pools for the presence of stx. Alternatively, in case the use of sorbitol MacConkey agar plates or immunomagnetic separation to particularly target E. coli O157:H7 strains is deemed insufficient, conducting a colony hybridization step allows to specifically select stx-harboring strains (see Subheading 4.2.3). Colony hybridization also has the advantage of informing on the relative abundance of STEC strains within the enterobacterial community in the sampled host [22, 57]. 2.3 Source Attribution During Human Outbreaks

Human STEC infections are mainly acquired by ingestion of contaminated food or environmental exposure. However, visits to farms, fairs, or petting zoos reportedly give rise to human infections by direct animal contact [120]. If vectors are suspected to be involved in transmission, testing of the vector, if available, is the most straightforward and promising approach. However, if direct transmission via animal contact is suspected, testing the incriminated animal population may be considered. Typing of bovine and human O26 isolates with a wide spatial–temporal relationship unveiled an association between HUS and multilocus sequencetype 21 strains and confirmed the role of stx2 in severe human disease [121]. Such studies are instrumental for grading the pathogenic potential of certain STEC lineages and help to explain the geographic clustering of seemingly sporadic cases of human disease [122, 123]. However, even if a strong epidemiological link exists between an actual human outbreak and an animal herd, e.g., after a farm visit by a group of kindergarten children, isolation of the causative strain from the animal source may be difficult to achieve. STEC are often shed intermittently [120], and a plethora of

32

Stefanie A. Barth et al.

different STEC strains may circulate in a cattle population at a certain time-point [29, 57, 58]. Retrieving a particular strain from the suspected source may require extensive and repeated sampling of animals and a tedious laboratory workflow aiming at isolation and characterization of as many different strains as possible [124]. While it is reasonable to compare isolates obtained in spatio–temporal correlation from animal sources and human patients to support the risk assessment, tracing back studies to confirm a definite source of an animal contact related outbreak are not feasible in many circumstances. 2.3.1 Study Design

Selection of the sampling location and design of the scheme will much depend on the strength of the epidemiologic link obtained by tracing back investigations to livestock in a certain geographic area, to a certain farm or even to a certain premise or to animal products derived from these sources. Daily or bi-daily sampling of a significant portion of animals kept on a given premise may be required.

2.3.2 Specimen Collection

The same sampling matrices described under Subheading 2.2.2 can be used for this purpose.

2.3.3 Sample Shipment

The same recommendations apply as those given under Subheading 2.2.3. However, even if a clear epidemiological link exists to human cases of STEC-associated disease, a number of different STEC strains may be present on the farm suspected to be the source of the outbreak. The strain identified as the causative agent in patient samples may have been transmitted by a direct animal contact or by vectors like the consumption of raw animal products. In the latter case, selective propagation of a particular strain in the vector may have occurred. Then, the causative strain is not necessarily the dominating STEC strain in samples taken from the animals or their immediate environment. All the more, immediate processing of fresh samples in the laboratory is mandatory in this scenario in order not to lose the suspected strain due to pre-analytic handling.

2.3.4 Sample Analysis

In order to trace back infection chains, the identity of isolates from food sources or patients may be confirmed by plasmid profile analysis [22], pulsed-field gel electrophoresis (PFGE [22, 58, 119, 124, 125], see Subheading 4.3.1), or multilocus sequence typing (MLST; [67, 126], see Subheading 4.3.2). With the advent of next-generation sequencing, providing information on the entire genome of strains at feasible costs, core-genome MLST (cgMLST), and core-genome single-nucleotide polymorphism analyses have become suitable tools for outbreak investigations [127].

2.4 Mitigation of STEC Shedding by Ruminants

Calves become infected orally with many different STEC strains from their dams, from pen-mates and their environment early in life, but rarely develop clinical signs of infection. Many STEC strains are able to colonize the bovine intestine [67, 128], including

STEC in Animals

33

non-O157:H7 [49, 129]. Cattle may shed these bacteria for several months in quantities that may be considerably high at some sampling points [22, 58, 130, 131]. To reduce the risk of STEC entering the food chain, interventions must be applied at several stages starting at the animal and herd levels [132, 133]. Even though previous attempts to develop vaccination strategies in cattle were promising, they only partially reduced STEC excretion and the effect was mostly restricted to single subpopulations of STEC, e.g., O157 strains [134, 135]. Therefore, further research on intervention strategies that specifically target the preslaughter critical control point is crucial to improve overall food and environmental safety [132]. 2.4.1 Study Design

Selection of the sampling location and design of the scheme will depend heavily on the anticipated mode of action and effect strength of the mitigation measure to be validated. Even though individual animals in pen groups of calves and herds of adult cattle may shed different STEC strains at certain time points [22, 29, 57, 58], strains are transmitted between animals at very low infectious doses [23]. Transmission rates may depend on features of the STEC strains correlating with their human pathogenic potential [136]. In order to evaluate the effect of intervention strategies, monitoring at the herd or group levels is advantageous over following the shedding of individual animals. Experimental infections have the advantage that they allow for studying the shedding pattern of defined strains and the impact of treatments on shedding in comparably short time periods. However, STEC shedding by ruminants particularly results from long term if not persistent colonization of the bovine intestine after repeated low-dose inoculation. Such settings can hardly be appropriately mimicked in experimental studies as long as sentinel animals are not added to groups of inoculated animals. Field studies on the opposite side are affected by many confounding factors. Because of this very reason, results obtained in such studies are more likely to provide a robust justification for the implementation of intervention strategies imposing an economic cost on animal or food producers. Two general strategies can be applied: l

Long-term monitoring under field conditions: Intervention measures may influence STEC shedding by individual animals in immediate terms but are only applicable in the field if sustained effects can be achieved which either significantly lower STEC transmission in the herd or, at least for beef cattle, reduce STEC shedding and hide contamination at the time of harvest. Any of the sampling strategies outlined under Subheading 2.2 is applicable for this purpose with a direct correlation between the numbers of samples taken, the subsequent laboratory work burden, and the meaningfulness

34

Stefanie A. Barth et al.

of the data obtained. It may thus be more appropriate to use samples which reflect shedding by groups of animals (boot swab, ropes, etc.) rather than individual sampling. Fecal samples can be collected in daily, bi-daily, weekly, or monthly intervals. As an example, when assessing the efficacy of a vaccine and direct-fed microbials for controlling E. coli O157:H7 in feces and on hides of feedlot cattle, authors collected rectal fecal samples and perineal swabs at 28-day intervals until shipment to slaughter (103–145 days on trial) of 864 cattle allocated to 48 pens [137]. l

Short-term experiments aimed at assessing the immediate events after experimental inoculation: For mechanistic studies, animals may be observed and sampled twice a day (0–4 days post inoculation [dpi]) followed by necropsy to study the distribution of the bacteria along the intestinal tract and whether STEC are associated with the intestinal wall or the ingesta [49]. Alternatively, in order to quantitatively compare the duration and the relative ability of different strains to colonize the animals, fecal samples may be collected daily in the morning for the first four days (0–4 dpi) and then every second day (6–28 dpi) to provide meaningful shedding curves. Short-term acting intervention measures (like single dose applications) may be assessed this way. Necropsy and sampling can be performed at 28 dpi and will still allow for re-isolation of the experimental strains.

2.4.2 Specimen Collection

The same sampling techniques and matrices as described under Subheading 2.2.2 can be used for this purpose. Samples allowing for monitoring individual animals are strongly recommended and preferred over pen or animal group sampling if the study is conducted under experimental conditions. If the study is conducted under field conditions like a feedlot, sampling procedures to be applied without immediate handling of the animals by the sampler are advised for safety reasons. At necropsy or after slaughter, freshly isolated samples of intestinal content (approximately 1 g) can be obtained. Sites to be sampled ought to reflect known sites of STEC colonization, sites of potential contamination, and control sites for internal validation of the aseptic sampling process in the intestinal tract of cattle. These sites may include (in alphabetical order) abomasum, caecum, distal colon, duodenum, gall bladder, ileocecal valve, Peyer’s patches of the ileum, jejunum, Peyer’s patches of the jejunum, proximal colon, recto-anal junction, rumen, and spiral colon. Suitable samples may be the intestinal content but also solid pieces of the gut wall as some STEC strains can be specifically isolated from the latter areas.

STEC in Animals

35

2.4.3 Sample Shipment

The same recommendations apply as those given under Subheading 2.2.3.

2.4.4 Sample Analysis

In order to confirm the effect of an intervention measure, meaningful readouts may be (a) the total number of STEC bacteria shed, (b) the duration of shedding of individual strains, and (c) the variety of strains shed. The same strategies for sample analysis as described under Subheading 2.2.2 can be used for the purpose of intra vitam monitoring of STEC shedding. Samples are processed as described under Subheading 2.2.4. Tissue material (ca. 1 g) obtained postmortem is cut by scissors, put into a homogenization bag with 9 mL of phosphate buffered saline, and the bag sealed and placed into a stomacher (6 min, max. 4 bags per run).

3

Materials

3.1 PCR-Based Detection of EDEC in Piglets

1. E. coli control strains. The following strains are suggested controls (relevant encoded virulence factors are presented in brackets): Abbotstown (LT-I, ST-Ip, ST-II, F4ac fimbria, F6 fimbria) [138], B41 (syn. ATCC 31619; ST-Ia, F5 fimbria, F41 fimbriae) [139], E57 (Stx2e, ST-Ia, ST-II, F18 fimbria) [139], and EDL 933 (syn. ATCC 43895; Stx1, Stx2, intimin). E. coli strain HB101 (K12- and B-derived strain; syn. ATCC 33694) encodes none of the relevant virulence factors and is used as a negative control. 2. Boot swabs (sterilized, adsorptive polyethylene overboots). 3. Cotton ropes, e.g., 3-strand twisted undyed cotton ropes (approx. length 65 cm, diameter 16 mm/strand). 4. Plastic bags (at least 40  30 cm). 5. Sterile ddH2O: Deionized, twice-distilled water, autoclaved, and stored at 4
C. 6. Agar plates. l Sheep blood agar: Dissolve sheep blood agar base according to the manufacturer’s instructions in ddH2O and autoclave (121
C, 15 min). Cool down to 45–50
C and add 5% (v/v) sterile defibrinated sheep blood. l

Gassner agar: Dissolve Gassner agar base according to the manufacturer’s instructions in ddH2O and autoclave at 121
C for 15 min.

l

Chromogenic agar for presumptive identification of E. coli, e.g., RAPID’E.coli 2/Agar agar: Dissolve 37.0 g of powder and 2 g of agar in 1 L of sterile ddH2O. Mix until a homogeneous suspension is obtained and heat gently while swirling frequently. Bring suspension to the boil until powder is dissolved completely.

36

Stefanie A. Barth et al. l

Luria Bertani (LB-Miller) agar: Dissolve 10 g of Bactotryptone, 5 g yeast extract, 10 g of NaCl, and 16.0 g of agar in 1 L of ddH2O. Add 4 mL of 1 M NaOH and autoclave (121
C, 15 min).

Let solutions cool down to approx. 50
C before pouring them into 9.0 cm plastic petri dishes (15 mL/dish). Let the dishes undisturbed for 16 h and store them at 4
C. 7. LB broth: Dissolve 10 g of Bacto-tryptone, 5 g of yeast extract, and 10 g of NaCl in 1 L of ddH2O. Add 4 mL of 1 M NaOH. Autoclave (121
C, 15 min) and store at 4
C. 8. Primers used for the identification of determinative virulence genes of STEC, EDEC, and ETEC, respectively, are listed in Tables 1 and 2. Most primers were designed and evaluated for use in multiplex PCR technology by Casey and Bosworth [85] (primers Stx2e-1, Stx2e-2, F41-1, F41-2, F4-1, F4-2, F6-1, F6-2, F18-1, F18-2, LT-I-3, LT-I-4, F5–1, F5–2, ST-I-3, ST-I-4, ST-II-1, ST-II-2). Primers Stx2e-F1 and Stx2e-R1 were designed and evaluated by Scheutz et al. [87], primers EaeA-1 and EaeA-2 by Franck et al. [140]. Each primer is dissolved in sterile ddH2O and adjusted to a stock concentration of 100 μM. Primer stock solutions are stored at 20
C (see Notes 1–3). Two primer mixes are set up on ice: l

l

The Multi-Primer mix contains 450 μL of sterile ddH2O and 50 μL of each of the stock solutions of primers Stx2e-1 and Stx2e-2 as well as 25 μL of each of the stock solutions of primers F41-1, F41-2, F4-1, F4-2, EaeA-1, EaeA-2, F6-1, F6-2, F18-1, F18-2, LT-I-3, LT-I-4, F5-1, F5-2, ST-I-3, ST-I-4, ST-II-1, and ST-II-2. The Duplex-Primer mix is composed of 800 μL of sterile ddH2O and 50 μL of each of the stock solutions of primers Stx2e-F1, Stx2e-F2, F18-1, and F18-2.

Mix solutions thoroughly and store Multi-Primer and Duplex-Primer mixes as 100 μL aliquots at 20
C. 9. Deoxyribonucleotide triphosphate (dNTP) stock solution: Adjust aqueous solution of dATP, dCTP, dGTP, and dTTP to a concentration of 4 mM each, aliquot, and store at 20
C. 10. Taq DNA polymerase, such as DreamTaq, including the respective buffer. Store at 20
C. 11. Agarose qualified for DNA electrophoresis. 12. Ethidium bromide stock solution: 10 mg/mL in ddH2O. 13. TAE stock solution (50): 0.04 M Tris–acetate, 0.001 M EDTA. Dissolve 242 g Tris base, 57.1 mL of glacial acetic acid, and 100 mL of 0.5 M EDTA (pH 8.0) in ddH2O to a final volume of 1000 mL and autoclave.

Table 1 Primers used for the porcine STEC/ETEC Multiplex PCR (Casey and Bosworth [85]; modified) Primer

PCR product

Virulence factor

Designation Sequence (50 ! 30 )

Length (bp)

Amplified site (accession no.; position)

Stx2a

Stx2e-1

AATAGTA TACGGACAGCGAT TCTGACATTCTGG TTGACTC

733

M21534; 359–1091

AGTATCTGGTTCAGTGA TGG CCACTATAAGAGG TTGAAGC

613

X14354; 298–910

GTTGGTACAGGTCTTAA TGG GAATCTGTCCGAGAATA TCA

499

M35954; 160–658

ATATCCGTTTTAATGGC TATCT AATCTTCTGCGTACTG TGTTCA

425

Z11451; 1060–1484

AAGTTACTGCCAGTCTA TGC GTAACTCCACCGTTTG TATC

409

U50547; 705–1113

Stx2e-2 F41 fimbria

F41–1 F41–2

F4 fimbria

F4–1 F4–2

intiminb

EaeA-1 EaeA-2

F6 fimbria

F6–1 F6–2

F18 fimbria

F18–1 F18–2

LT-I

LT-I-3 LT-I-4

F5 fimbria

F5–1 F5–2

ST-I

ST-I-3 ST-I-4

ST-II

ST-II-1 ST-II-1

TGGTAACGTATCAGCAAC 313 TA ACTTACAGTGCTA TTCGACG

M61713; 246–558

GGCGTTACTATCCTCTC TAT TGGTCTCGGTCAGATA TGT

272

X17873; 65–336

AATACTTG TTCAGGGAGAAA AACTTTGTGGTTAAC TTCCT

230

X05797; 488–717

CAACTGAATCACTTGAC TCTT TTAATAACA TCCAGCACAGG

158

V00612; 347–504

TGCCTATGCATC TACACAAT CTCCAGCAGTACCATC TCTA

113

M35586; 502–614

LT-I heat-labile E. coli enterotoxin type I, Stx2 Shiga toxin type Stx2, ST-I heat-stabile E. coli enterotoxin type I (syn. STa), ST-II heat-stabile E. coli enterotoxin type II (syn. STb) a Primer pair Stx2e-1/Stx2e-2 is not specific for the gene of Stx subtype Stx2e. Amplicons of approx. 730 bp are also generated from genes of subtypes Stx2a, Stx2c, and Stx2d. Each E. coli isolate yielding a 730 bp amplicon should be tested with Sx2e specific primers to substantiate classification as EDEC b Not included in the original protocol of Casey and Bosworth [85]

38

Stefanie A. Barth et al.

Table 2 Primers used for the porcine EDEC Duplex PCR

Virulence factor Stx2e

Primer

PCR product

Designation Sequence (50 ! 30 )

Length (bp)

Stx2e-F1 Stx2e-R1

F18 fimbria F18–1 F18–2

Amplified site (accession no.; position)

CGGAGTATCGGGGAGAGGC 411 CTTCCTGACACCTTCACAG TAAAGGT

M21534; 936–1347

TGGTAACGTATCAGCAACTA 313 ACTTACAGTGCTA TTCGACG

M61713; 246–558

Stx2e Shiga toxin subtype Stx2e

14. 100 bp DNA ladder and 6 loading dye. Working solution: Mix 50 μL of DNA ladder stock solution (0.5 μg/μL) with 150 μL of 6 loading dye and 600 μL of sterile ddH2O. Store at 4
C. 15. Phosphate-buffered saline (1 PBS): 10 g NaCl, 0.25 g KCl, 0.25 g KH2HPO4, 1.8 g Na2HPO4  2H2O, ad 1 L ddH2O. Autoclave at 121
C for 20 min. 16. Hinged 2.0 mL reaction tubes and 0.7 mL PCR tubes. 17. Screw-top tubes (50 mL). 18. Erlenmeyer flasks (glass, 2000 mL) and beakers (glass, 2000 mL). 19. Calibrated pipettes and disposable pipette tips. Sealed pipette tips are used for all PCR procedures. All other pipette tips are autoclaved prior to their use. 20. Personal protective equipment (PPE): Laboratory coat; disposable, ethidium bromide resistant gloves; safety glasses (chemical goggles). 21. Biochemical test kit for taxonomic identification of Enterobacteriaceae, e.g., API 20E (Api-bioMe´rieux, Nu¨rtingen, Germany). 22. Orbital shaker for Erlenmeyer flasks, beakers, and tubes. 23. Incubator equipped with an orbital shaking platform and incubator, both set at 37
C. 24. Laboratory centrifuge and rotors appropriate for the centrifugation of 0.7 and 2.0 mL reaction tubes (0–16,000  g). 25. Spectrophotometer (see Note 3). 26. Thermal cycler equipped with a heated lid.

STEC in Animals

39

27. Horizontal agarose gel electrophoresis system and compatible power supply. 28. UV transilluminator. 29. Gel documentation system. 30. MALDI-TOF mass spectrometer. 3.2 Detection and Quantification of STEC in Ruminants

1. E. coli strain EDL 933 (syn. ATCC 43895; stx1, stx2) is suggested as a positive control. 2. Gassner agar: Dissolve Gassner agar base according to the manufacturer’s instructions in ddH2O and autoclave at 121
C for 15 min. 3. 50 mL tubes with screw cap. 4. Phosphate-buffered saline (1 PBS): 10 g NaCl, 0.25 g KCl, 0.25 g KH2HPO4, 1.8 g Na2HPO4  2H2O, ad 1 L ddH2O. Autoclave at 121
C for 20 min. 5. Vortex mixer. 6. Thermoblock. 7. LB broth according to Lennox (LB broth): Dissolve 10 g of tryptone, 5 g yeast extract, and 5 g NaCl in 1 L of ddH2O. Adjust pH to 7.8  0.2 with NaOH and autoclave (121
C, 20 min). 8. LB/glycerol broth: LB broth supplemented with 30% (v/v) glycerol. 9. Multi-Primer mix “STX” consisting of each of the four primers listed in Table 3. Of a 100 μM primer stock solution, take 25 μL of each primer and add 400 μL ddH2O to have a final concentration of 5 μM of each primer in the Multi-Primer mix. Can be stored at 20
C. 10. dNTP mix: Adjust aqueous solution of dNTP mix to a concentration of 4 mM for each nucleotide, aliquot, and store at 20
C. 11. Taq Polymerase with the respective buffer system according to the individual supplier. Store at 20
C. 12. Hinged 0.2 mL DNAse-/RNAse-free PCR tubes. 13. DNA probes for stx1 and stx2 prepared with the PCR DIG Probe Synthesis Kit (Roche Diagnostics, Mannheim, Germany) using either the MP4 or the MP3 primers (see Table 3) as specified by the manufacturer (see Note 4). Store at 20
C. 14. Nylon membranes for colony and plaque hybridization (diameter 82 mm). 15. Denaturation solution: Dissolve 20.005 g NaOH (final concentration of 0.5 M) and 87.62 g NaCl (final concentration of 1.5 M) in 1 L ddH2O.

40

Stefanie A. Barth et al.

Table 3 Primers used for the bovine STEC Duplex PCR [150] as well as for the generation of stx probes

Stx

Primer

PCR product

Designation Sequence (50 ! 30 )

Length (bp)

Amplified site (accession no.; position)

Stx1 MP4stx1A-F MP4stx1A-R

CGATGTTACGGTTTGTTACTG TGACAGC AATGCCACGCTTCCCAGAATTG

244

JX206444; 536–779

Stx2 MP3stx2A-F MP3stx2A-R

GTTTTGACCATCTTCGTCTGA TTATTGAG AGCGTAAGGCTTCTGCTG TGAC

324

AB761230; 254–577

Stx Shiga toxin

16. Neutralization solution (pH 7.4): Dissolve 121.14 g Tris–HCl (final concentration of 1 M) and 87.62 g NaCl (final concentration of 1.5 M) in 1 L ddH2O. 17. 20 SSC (pH 7.0): Dissolve 88.23 g Na-citrate (final concentration of 0.3 M) and 175.24 g NaCl (final concentration of 3 M) in 1 L ddH2O. 18. 2 SSC (pH 7.0): 100 mL 20 SSC and 900 mL ddH2O. 19. Proteinase K stock solution: Dissolve 100 mg proteinase K (PCR grade) in 5 mL ddH2O (final concentration of 20 mg/ mL), aliquot, and store at 20
C. 20. Proteinase K working solution: Take 500 μL proteinase K stock solution and add 5 mL 2 SSC. 21. DIG Easy Hyb (Roche Diagnostics, Mannheim, Germany). 22. Hybridization solution: 8 μL DIG-labeled DNA probe “stx1” and 8 μL DIG-labeled DNA probe “stx2” in 8 mL DIG Easy Hyb. 23. 10% SDS solution: 10 g dodecyl sulfate sodium salt and 1 mL 1 N HCl dissolved in 100 mL ddH2O. 24. 2 SSC/0.1% SDS (low-stringency wash buffer): 99 mL 2 SSC and 1 mL 10% SDS solution. 25. 0.5 SSC/0.1% SDS (high-stringency wash buffer): 25 mL 2 SSC and 1 mL 10% SDS solution. 26. DIG Wash and Block Buffer Set (Roche Diagnostics, Mannheim, Germany) containing 10 washing buffer, 10 maleic acid buffer, 10 blocking solution, 10 detection buffer. Working solutions contain:

STEC in Animals

41

l

Washing solution: Pipette 10 mL 10 washing buffer and add ddH2O ad 100 mL. Store at room temperature.

l

Maleic acid solution: Pipette 4.5 mL 10 maleic acid buffer and add ddH2O ad 45 mL. Store at room temperature.

l

Blocking buffer: Pipette 5 mL 10 blocking solution and add 45 mL maleic acid solution (prepare fresh before use).

l

Detection solution: Pipette 4.4 mL 10 detection buffer and add ddH2O ad 44 mL. Store at room temperature.

27. Conjugate solution: 1.2 μL anti-digoxigenin-AP, Fab fragments from sheep (Roche Diagnostics, Mannheim, Germany) diluted 1:5.000 in 6 mL blocking buffer. Always prepare fresh before use. 28. Substrate solution: Dissolve 110 μL NBT (4-nitro blue tetrazolium chloride) and 82.5 μL BCIP (5-bromo-4-chloro-3indolyl phosphate) in 22 mL detection solution. Always prepare fresh before use. 29. Whatman® gel blotting paper, Grade GB003. 30. Blotting paper BloPa MN 218 B. 31. Hybridization oven with rotisserie and hybridization bottles (diameter 35 mm, length 300 mm). 32. Rocking table. 33. Photo camera. 34. Square petri dishes (120 mm). 35. Round petri dishes (94 mm). 3.3 Molecular Typing of STEC

1. Sheep blood agar: Dissolve sheep blood agar base according to the manufacturer’s instructions in ddH2O and autoclave (121
C, 15 min). Cool down to 45–50
C and add 5% (v/v) sterile defibrinated sheep blood. 2. LB broth according to Lennox (LB broth): Dissolve 10 g of tryptone, 5 g yeast extract, and 5 g NaCl in 1 L of ddH2O. Adjust pH to 7.8  0.2 with NaOH and autoclave (121
C, 20 min). 3. Spectrophotometer using visible light. 4. Hinged, sterile 1.5 and 2.0 mL reaction tubes. 5. Benchtop centrifuge for 1.5 mL reaction tubes. 6. 0.89% NaCl: 8.9 g NaCl ad 1 L ddH2O, autoclave (121
C, 15 min). 7. Agarose suitable for PFGE. 8. Microwave oven. 9. 50 mL heat-resistant glass bottle with lid and magnetic bar.

42

Stefanie A. Barth et al.

10. Heated magnetic stirrer. 11. 0.5 M EDTA solution (pH 8): 93 g EDTA in 400 mL ddH2O, adjust pH to 8.0 with NaOH pellets. Add to 0.5 L ddH2O. 12. 10 TBE (tris–borate–EDTA) buffer stock solution: 108 g Tris base (890 mM), 55 g boric acid (890 mM), 40 mL 0.5 M EDTA solution (pH 8), ad 1 L ddH2O. 13. 1 TBE: 10 mL 10 TBE buffer and 90 mL ddH2O. 14. Disposable plug molds (see Note 5). 15. Tape. 16. Refrigerator. 17. ES buffer (pH 8.0): Dissolve first 0.5 M EDTA with a part of the ddH2O and adjust pH with about 20 NaOH pellets; then add 1% N-lauroyl sarcosine sodium salt and the remaining ddH2O ad 100 mL. 18. ESP buffer: ES buffer with 1.8 mg/mL proteinase K. Prepare fresh before use. 19. 15 mL tubes with screw caps. 20. TE buffer: 10 mM Tris, 1 mM EDTA, pH 7.5 (adjust with 1 N HCl), autoclave (121
C, 15 min). 21. Restriction enzymes XbaI, NotI, BlnI (syn. AvrII), and SpeI and their respective buffer systems. Store at 20
C. 22. 0.5 TBE: 110 mL 10 TBE buffer, ad 2.2 L ddH2O. 23. CHEF Mapper XA Chiller System with cooling module and pump and CHEF Casting Stand with platform, comb, and comb holder (Bio-Rad). 24. Lambda Ladder PFG Marker. Store at 20
C. 25. Ethidium bromide stock solution: 10 mg/mL ethidium bromide solution. 26. Ethidium bromide staining solution: 20 μL ethidium bromide stock solution in 400 mL ddH2O (final concentration of 0.5 μg/mL). 27. Proofreading DNA polymerase, such as Phusion (New England Biolabs), with the corresponding High Fidelity buffer (HF) or another proofreading DNA polymerase with the corresponding buffer. Store at 20
C. 28. Deoxynucleotide (dNTP) solution mix (10 mM each). Store at 20
C. 29. 100 bp DNA ladder containing bromophenol blue dye. Store at 20
C. 30. Thermal cycler. 31. Kit for agarose gel extraction and PCR purification.

STEC in Animals

3.4 Quantification of Stx in STEC Cultures

43

1. Control strains: STEC strain EDL 933 (stx1, stx2) and E. coli K-12 without any stx gene are suggested as a positive and a negative control, respectively. 2. Sheep blood agar: Dissolve sheep blood agar base according to the manufacturer’s instructions in ddH2O and autoclave (121
C, 15 min). Cool down to 45–50
C and add 5% (v/v) sterile defibrinated sheep blood. 3. LB broth according to Lennox (LB broth): Dissolve 10 g of tryptone, 5 g yeast extract, and 5 g NaCl in 1 L of ddH2O. Adjust pH to 7.8  0.2 with NaOH and autoclave (121
C, 20 min). 4. LB-MMC broth: LB broth with 50 ng/μL mitomycin C (see Note 6). 5. 0.89% NaCl: 8.9 g NaCl, ad 1 L ddH2O, autoclave (121
C, 15 min). 6. Polymyxin B buffer: 1 mg/mL polymyxin B sulfate in sterile 0.89% NaCl. Store as aliquots at room temperature. 7. 0.2 μm sterile filter with polyethersulfone (PES) membrane. 8. BugBuster™ protein extraction reagent. 9. Nunc MaxiSorp™ microtiter plates, F bottom, 96-well. 10. Hydatid fluid of Echinococcus granulosus: Fluid recovered from cysts of sheep infected with Ec. granulosus. The fluid of several cysts can be pooled, centrifuged (3000  g, 30 min, 5
C), the supernatant aliquoted, and stored at 20
C until use. 11. Coating buffer (pH 9.5): 1.06 g Na2CO3, 2.93 g NaHCO3, ad 1 L ddH2O, store at 4
C. 12. 10 PBS (pH 7.4): 100 g NaCl, 18 g Na2HPO4  2H2O, 2.5 g KH2PO4, 2.5 g KCl, ad 1 L ddH2O. Autoclave (121
C, 15 min) and store at room temperature. 13. 1 PBS: 100 mL 10 PBS, ad 1 L ddH2O. 14. Washing buffer: 0.05% Tween 20 in 1 PBS (v/v), store at room temperature. 15. Blocking buffer: 0.25 g skimmed milk powder, 25 mL coating buffer, store at 4
C. 16. Detection antibodies: Use either peroxidase (POD)-labeled murine monoclonal antibody against Stx1 B subunit (VT109/4-E9b) or POD-labeled murine monoclonal antibody against Stx2 A subunit (VT135/6-B9) (Sifin Diagnostics GmbH, Berlin, Germany) (see Note 7). Aliquot and store at 20
C. 17. 3,30 ,5,50 -Tetramethylbenzidine (TMB) chromogen solution (for ELISA), store at 4
C.

44

Stefanie A. Barth et al.

18. Stop solution: 0.5 M H2SO4 in ddH2O, store at room temperature. 19. ELISA reader. 20. Sterile microtiter plates for cell culture, F bottom, 96-well. 21. Vero cells: Cell lineage of kidney epithelial cells from African green monkey (ATCC® CRL-1587). 22. RPMI medium: Cell culture medium RPMI-1640 with L-glutamine and 2.0 g/L NaHCO3 supplemented with 10% fetal calf serum (FCS), and 100 IE/mL penicillin/0.1 mg/mL streptomycin. Store at 4
C. 23. Pasteur pipettes. 24. Cell culture flasks, 75 cm2. 25. Trypsin solution (pH 7.2–7.3): 0.5 g Trypsin, 8 g NaCl, 0.8 g KCl, 1 g Dextrose, 0.58 g NaHCO3, 0.2 g EDTA sodium, ad 1 L ddH2O. Sterile filtrate (0.2 μm filter) and store at 4
C. 26. 50 mL tubes with screw cap. 27. 0.4% trypan blue solution in 0.89% NaCl. 28. Neubauer counting chamber, 0.1 mm depth. 29. MTT solution: 5 mg/mL MTT (3-[4,5-dimethylthiazol-2-yl]2,5-diphenyltetrazolium bromide) in 1 PBS. Sterile filtrate (0.2 μm filter), aliquot, and store at 20
C. 30. 10% SDS solution: Mix 100 g dodecyl sulfate sodium salt, 10 mL 1 N HCl, and ad 1 L ddH2O; store at room temperature. 31. 1% SDS solution: 0.5 g dodecyl sulfate sodium salt, ad 50 mL 0.89% NaCl. 32. Orbital shaker. 33. Benchtop centrifuge. 34. Inverse light microscope. 3.5 STEC Adhesion to and Invasion into Intestinal Epithelial Cells

1. Control strains: STEC strain EDL 933 (stx1, stx2, eae) and EPEC strain E2348/69 (eae) are positive controls, and E. coli K-12 strain without adhesion factors is a negative control. 2. Immortalized intestinal epithelial cell line (see Notes 8 and 9). 3. Culture medium suitable for the selected cell line (see Note 8) supplemented with 10% FCS, 1% nonessential amino acids, and 1% penicillin/streptomycin (10,000 U/10 mg). 4. Test medium for the permanent cell cultures is the respective medium (see Note 8) supplemented with 10% FCS, 1% nonessential amino acids, and 1% mannose. 5. 24-well F bottom cell culture plates, sterile. 6. Slides and coverslips, diameter 1.2 cm.

STEC in Animals

45

7. 10 PBS (pH 7.4): 100 g NaCl, 18 g Na2HPO4  2H2O, 2.5 g KH2PO4, 2.5 g KCl, ad 1 L ddH2O. Autoclave (121
C, 15 min) and store at room temperature. 8. 1 PBS: 100 mL 10 PBS, ad 1 L ddH2O. 9. 70% ethanol in ddH2O. 10. 10% Giemsa stain: 10 mL Giemsa stain for microscopy and 90 mL ddH2O (see Note 10). 11. Mounting medium for histology. 12. Light microscope with 400 magnification without and 1000 magnification with oil immersion. 13. 4% paraformaldehyde stock solution: 4 g paraformaldehyde, ad 100 mL 1 PBS (see Note 11). 14. 2% paraformaldehyde: Mix 6.5 mL paraformaldehyde stock solution and 6.5 mL 1 PBS. 15. 0.1% Triton X-100: 0.1 mL Triton X-100 (Octylphenol-polyethylene glycol ether), ad 100 mL 1 PBS. 16. Phalloidin-FITC stock solution: 0.1 mg/mL fluorescein isothiocyanate (FITC)-labeled phalloidin in methanol. Store protected from light at 20
C. 17. Phalloidin-FITC staining solution: Mix 10 μL phalloidinFITC stock solution with 190 μL 1 PBS. Prepare shortly before use and keep protected from light. 18. Mowiol mounting medium: Mix 2.4 g Mowiol 4–88, 6 g (4.918 mL) 87% glycerol, 6 mL ddH2O, 12 mL Tris–HCl (pH 8.6), and 0.25 g p-phenylenediamine (see Note 12). 19. Propidium iodide (PI) staining solution: Dilute 0.5 μL PI solution (10 mg/mL) in 15 mL 1 PBS (see Note 13). 20. Fluorescence microscope with 400 magnification without and 1000 magnification with oil immersion. 21. Sheep blood agar: Dissolve sheep blood agar base according to the manufacturer’s instructions in ddH2O and autoclave (121
C, 15 min). Cool down to 45–50
C and add 5% (v/v) sterile defibrinated sheep blood. 22. Gentamicin solution (150 μg/mL): 4.5 mg gentamicin, ad 30 mL test medium. 3.6 Virulence Gene Transcription in STEC

1. Positive control strains: E. coli strains positive for stx2, aggR, pic, and/or iha. 2. RNeasy® Mini Kit (QIAgen GmbH, Hilden, Germany) with the Protocol “Purification of Total RNA from Animal Cells Using Spin Technology.” Before starting: l

Supplement RLT buffer with 1% β-mercaptoethanol (10 μL β-mercaptoethanol in 1 mL RLT buffer).

46

Stefanie A. Barth et al. l

Add 4 vol. 96–100% ethanol to 1 vol. buffer RPE (calculate 1 mL/sample).

l

Prepare DNase I stock solution by mixing 1500 Kunitz units of DNase I with 550 μL RNase-free water. Carefully mix the solution, do not vortex. Aliquot and store at 20
C.

3. Co-infected cell culture (e.g., see Subheading 4.5.1) with a maximum of 1  107 cells/preparation. 4. QIAshredder Germany).

spin

columns

(QIAgen

GmbH,

Hilden,

5. Benchtop centrifuge for 1.5 mL reaction tubes. 6. Cell scraper. 7. Liquid nitrogen (see Note 14). 8. Hinged, sterile RNase-free 1.5 mL reaction tubes. 9. RNase free water. 10. RNAse inhibitor: e.g., RNAsin Ribonuclease Inhibitor. 11. UV spectrophotometer. 12. Omniscript Reverse Transcription Kit. 13. Random hexanucleotide primers. 14. SYBR Green PCR Mastermix. 15. Optical 96-Well Reaction Plate or optical 8-cap strips. 16. Optical adhesive film. 17. Real-time PCR system.

4

Methods

4.1 PCR-Based Detection of EDEC in Piglets 4.1.1 Processing of Boot Swabs Used for Fecal Sampling of Floors

1. Fill 300 mL of 1 PBS into a 2 L Erlenmeyer flask. 2. Transfer 1 pair of boot swabs into an Erlenmeyer flask. Agitate the flask so that the boot swabs become completely covered by buffer solution. 3. Incubate the Erlenmeyer flask for 18  2 h at 4
C on an orbital shaker (~90 rpm). 4. Decant 50 mL of the liquid into a 50 mL screw-top tube. 5. Store the harvested liquid at 4
C until further use.

4.1.2 Processing of Ropes Used for Sampling of Oral Fluids

1. Deliver the used ropes in plastic bags to the laboratory (one rope per bag). If not yet processed, press oral fluids from the rope by repeated squeezing and wringing the rope while it remains inside the bag.

STEC in Animals

47

2. Decant the recovered fluids into a 50 mL screw-top tube. Store the harvested fluids at 4
C until further use (see Note 15). 3. Fill 200 mL of 1 PBS into a 2 L beaker. 4. Transfer the rope into the beaker and agitate so that the rope becomes completely covered by buffer solution. 5. Incubate the beaker for 18  2 h at 4
C on an orbital shaker (~90 rpm). 6. Decant 50 mL of the liquid into another 50 mL screwtop tube. 7. Store the harvested liquid at 4
C until further use. 4.1.3 Isolation of Putative EDEC or EDEC/ETEC from Specimens

1. Transfer a portion from each sample (intestinal contents, feces, swabs, liquids) onto a set of agar plates consisting of sheep blood agar, Gassner agar, and RAPID’E.coli 2/Agar plate. Streak for single colonies. 2. Incubate sheep blood and Gassner agar plates at 37
C, and RAPID’E.coli 2/Agar plates at 43
C for 20 h. 3. Select, pick, and transfer putative E. coli colonies onto an LB agar plate (see Notes 16 and 17). 4. Incubate plates at 37
C for 16–24 h (37
C). 5. Proceed to Subheadings 4.1.4 and 4.1.5, or store LB agar plates at 4
C until further use. Bacteria remain viable for up to 4 weeks.

4.1.4 Porcine STEC/ETEC Multiplex PCR

1. Transfer bacteria from each subcultured putative E. coli colony into a tube containing 2 mL of LB broth. Repeat this procedure for at least eight colonies per sample. Inoculate E. coli control strains Abbotstown, B41, E57, EDL 933, and HB101 in the same manner (see Note 18). 2. Incubate these LB broth cultures aerobically at 37
C for 16–20 h on an orbital shaking platform. 3. Set a reaction tube on ice and prepare Mastermix “Multiplex” for n + 1 tests (see Note 19). Each test requires 16.8 μL of sterile ddH2O, 3 μL of DreamTaq buffer, 6 μL of MultiPrimer mix 1, 1 μL of dNTP stock solution, and 0.2 μL of DreamTaq DNA polymerase solution. 4. Set PCR tubes on ice (one tube per bacterial culture of a putative E. coli colony or control strain or reagent negative control, respectively) and add per tube in the following order: 27.0 μL of Mastermix “Multiplex” and 3 μL of the bacterial culture (or 3 μL of ddH2O in case of reagent negative control; see Note 19). 5. Spin tubes for 10 s at 10,000  g and immediately place them into the thermal cycler (see Note 20).

48

Stefanie A. Barth et al.

6. Start DNA amplification with an initial incubation step at 94
C for 5 min. Consecutively, perform 30 cycles of DNA denaturation (94
C, 30 s), primer annealing (55
C, 30 s), and primer extension (72
C, 1 min). Final elongation is accomplished by incubation at 72
C for 5 min. Subsequently, tubes are cooled and held at 10
C for up to 8 h. 7. Remove tubes from the cycler and proceed to Subheading 4.1.6 or store at 20
C until further use. 4.1.5 Porcine EDEC Duplex PCR

1. Transfer bacteria from each subcultured putative E. coli colony into a tube containing 2 mL of LB broth. Repeat this procedure for at least eight colonies per sample. Inoculate E. coli control strains E57 and HB101 in the same manner (see Note 18). 2. Incubate cultures aerobically at 37
C for 16–20 h on a shaking platform. 3. Set a reaction tube on ice and prepare Mastermix “Duplex” for n + 1 tests (see Note 19). Each test requires 19.8 μL of sterile ddH2O, 3 μL of DreamTaq buffer, 3 μL of Duplex-Primer mix, 1 μL of dNTP stock solution, and 0.2 μL of DreamTaq DNA polymerase solution. 4. Set PCR tubes on ice (one tube per bacterial culture of a putative E. coli colony or control strain or reagent negative control, respectively) and add per tube in the following order: 27.0 μL of Mastermix “Duplex” and 3 μL of the bacterial culture (or 3 μL of ddH2O in case of reagent negative control; see Note 19). 5. Spin tubes for 10 s at 10,000  g and immediately place them into the thermal cycler (see Note 20). 6. Start DNA amplification with an initial incubation step at 94
C for 5 min. Consecutively, perform 40 cycles of DNA denaturation (94
C, 30 s), primer annealing (56
C, 30 s), and primer extension (72
C, 1 min). Final elongation is accomplished by incubation at 72
C for 5 min. Subsequently, tubes are cooled and held at 10
C for up to 8 h. 7. Remove tubes from the cycler and proceed to Subheading 4.1.6 or store at 20
C until further use.

4.1.6 Analysis of PCR Products by Horizontal Agarose Gel Electrophoresis

1. Prepare a 3.0% (w/v) agarose gel with 1 TAE buffer. Approximately 60 mL agarose solution is needed for a gel of 80  120  6 mm. Heat the aqueous suspension of the agarose until it becomes completely clear. Let the solution cool down to 60
C. Add ethidium bromide to a final concentration of 0.01 μg/mL, mix thoroughly, and pour the solution into the prepared gel tray. Insert the comb and leave the gel undisturbed for at least 1 h at room temperature (see Note 21).

STEC in Animals

49

2. Place the gel into the electrophoresis tank, load tank with 1 TAE buffer, and remove comb from the gel. Transfer 8 μL/ slot from each PCR tube to the gel (see Note 22). Load at least one slot per gel with a DNA size standard, e.g., the 100 bp DNA ladder (8 μL/slot of working solution). 3. Separate DNA molecules by electrophoresis at 100 V for approx. 1:45 h. 4. Place gel on the UV transilluminator and visualize DNA fragments by UV illumination (see Note 23). 5. Record the electropherogram as an image by a gel documentation system (see Note 24). 6. Calculate the sizes of PCR products (in base pairs, bp) by comparison of their migration distances with those of the DNA size standard. 7. Identify the genotype of E. coli isolates and reference strains by their PCR products according to the schemes presented in Tables 1 and 2. Consider a test only valid if (a) the reagent negative control yielded no amplicon and (b) each control strain yielded amplicons in accordance with its genotype (see Notes 25 and 26). 4.2 Detection and Quantification of STEC in Ruminants 4.2.1 Collection of Fecal Grab Samples and Cultivation of Coliform Bacteria

1. Collect approx. 10 g feces directly from rectal lumen using sterile gloved fingers and transfer in sterile 50 mL tubes. 2. Transport to the lab on ice (cool pack in thermo box). 3. Directly process or store at 80
C (up to 1 year). 4. For quantification of coliform bacteria, thaw the fecal samples and weigh 1 g. 5. Suspend 1 g feces in 9 mL sterile 1 PBS (dilution step 101) and homogenize using a vortex. 6. Prepare four additional log10 dilution steps by transfer of 1 mL of homogenized suspension to 9 mL sterile PBS (see Note 27). 7. Plate 100 μL of each dilution step on individual Gassner agar plates and spread evenly over the surface; from dilution step 101 prepare two Gassner agar plates. 8. Incubate the Gassner agar plates at 37
C for 18 (2) h. 9. Enumerate the agar plates with approx. 30–300 single, clearly definable colonies and calculate bacterial load [cfu/g feces] ¼ number of colonies  dilution step  10 (see Note 28).

4.2.2 stx PCR from Gassner Plates Wash Offs

1. Wash all coliform bacteria from one of two 101 dilution step Gassner agar plates using 1 mL of LB/glycerol broth. 2. Freeze 400 μL of the bacterial LB/glycerol broth suspension at 80
C (serves as a retention sample); inactivate the remaining

50

Stefanie A. Barth et al.

400 μL by heating (10 min at 100
C in a thermoblock), cool it on ice (5 min), and store at 20
C until use as a PCR template (see Note 29). 3. Prepare PCR Mastermix for n + 1 reactions: One reaction requires 1 reaction buffer, 2 mM MgCl2, 3 μL Multi-Primer mix “STX” (final concentration 0.5 μM of each primer), 1 μL dNTP mix (final concentration 133 μM of each nucleotide), 0.5 U polymerase, ad 27 μL ddH2O. 4. Place the respective number of reaction tubes on a cooler (one for each fecal sample, one for a positive [E. coli strain EDL 933] and one for a no-template [ddH2O] control) and dispense 27 μL of Mastermix in each tube; add 3 μL of the heatinactivated bacterial LB/glycerol suspension as a template (see Note 30). 5. Spin tubes for 10 s at 10,000  g and immediately place them in the thermal cycler. 6. Start DNA amplification with an initial denaturation at 95
C for 5 min. Consecutively, perform 30 cycles of DNA denaturation (95
C, 30 s), primer annealing (55
C, 30 s), and primer extension (72
C, 30 s). Final elongation is accomplished at 72
C for 5 min. Subsequently, cool tubes and keep at 15
C for up to 8 h. 7. Perform agarose gel electrophoresis in 2.0% (w/v) agarose gel in 1 TAE buffer according to Subheading 4.1.6. The reaction mix with the positive control has to generate two distinct DNA fragments of 244 bp (stx1) and 324 bp (stx2), the no-template control must not contain any DNA fragment. 4.2.3 Relative Abundance of STEC Among Coliform Bacteria (Colony Hybridization)

1. Cool the enumerated Gassner agar plate (see Subheading 4.2.1, step 9) for at least 30 min at 4
C. 2. Prepare three square petri dishes with one Whatman gel blotting paper each and saturate one with denaturation solution, one with neutralization solution and one with 2 SSC (see Note 31). 3. Mark the nylon membrane (see Note 32) by cutting a small triangle with 2 mm edge length and label on the backside with a pen. Mark the Gassner plate with a respective triangle using a pen to allow a proper match of signals and colonies at the end of the assay. 4. Place the nylon membrane on the agar plate without any air bubble formation and let the membrane adhere (color changes to gray). Avoid moving the membrane, once it has attached to the agar plate. Incubate 1 min, and carefully remove the membrane. Flip the membrane to have the colonies on the upper side and briefly put it on a dry Whatman gel blotting paper (1 min).

STEC in Animals

51

5. Store the Gassner agar plate as a master plate at 4
C. 6. Place the nylon membrane with the colony material on the upside on the Whatman gel blotting paper with denaturation solution and incubate for 15 min at room temperature. 7. Put the nylon membrane on a dry Whatman gel blotting paper (1 min). 8. Move the nylon membrane with the colony material on the upside to the Whatman gel blotting paper with neutralization solution and incubate for 15 min at room temperature. 9. Put the nylon membrane on a dry Whatman gel blotting paper (1 min). 10. Move the nylon membrane with the colony material on the upside to the Whatman gel blotting paper with 2 SSC solution and incubate for 10 min at room temperature. 11. Place the nylon membrane on a Whatman gel blotting paper and allow it to dry (at least 30 min at room temperature). 12. Fix the DNA on the nylon membrane by heating in an oven at 80
C for 30–60 min (see Notes 33 and 34). 13. Place the nylon membrane with the colony material on the upside to the Whatman gel blotting paper with 2 SSC solution and equilibrate for 10 min at room temperature. 14. Preheat the hybridization oven and DIG Easy Hyb to 42
C. 15. Pipette 1.375 mL of proteinase K solution in a round petri dish and transfer the nylon membrane with the colony material at the bottom in the petri dish. Close the petri dish with the respective lid and incubate at 37
C for 60 min (see Notes 35 and 36). 16. Place the nylon membrane in a hybridization bottle with the colony material loaded on the side facing the lumen (see Note 37) and add 25 mL/100 m2 (at least 10 mL per bottle) DIG Easy Hyb in each bottle. Place the bottle in the rotisserie of the hybridization oven and equilibrate the nylon membranes at 42
C at least for 1 h with rotation (see Note 38). 17. Denature the hybridization solution by boiling (100 10 min) and cool down 5 min on ice.




C,

18. Discard DIG Easy Hyb and add 8 mL of hybridization solution per bottle. Hybridize at 42
C at least 2 h and up to 18 h (overnight) under rotation in the rotisserie (see Note 39). 19. Decant the hybridization solution and wash the nylon membranes twice with 5 mL 2 SSC/0.1% SDS (5 min, room temperature, under rotation in the rotisserie).

52

Stefanie A. Barth et al.

20. Wash the nylon membranes twice with 5 mL 0.5 SSC/0.1% SDS (15 min, 68
C, under rotation in the rotisserie) (see Note 40). 21. Remove the nylon membrane from the hybridization bottle and place it in one round petri dish with the DNA loaded side facing upward. 22. Pipette 8 mL wash solution to the petri dish and incubate (3–5 min, room temperature) on a rocking table. 23. Discard the washing solution and block unspecific binding sites on the nylon membrane by adding 6 mL of blocking buffer to the petri dish and incubating (30–60 min, room temperature) on a rocking table. Shortly before the end of the incubation time, prepare the conjugate solution. 24. Discard blocking buffer, add 6 mL of conjugate solution and incubate (30 min, room temperature) on a rocking table. 25. Discard the conjugate solution and remove unbound conjugate by washing twice with 8 mL of wash solution and incubation (15 min, room temperature) on a rocking table. Shortly before the end of the second incubation time, prepare the detection and substrate solution. 26. Discard the wash solution and equilibrate the nylon membrane with 5.5 mL of detection solution (2–5 min, room temperature) on a rocking table. 27. Prepare a fresh petri dish with 5.5 mL of freshly prepared substrate solution, place the nylon membrane with the DNA loaded side facing downwards in the petri dish and incubate (2 h [up to 16 h], room temperature, in the dark) until signals are visible. Avoid movement of the petri dishes during the incubation time. 28. Stop the staining reaction by washing the nylon membrane three times with ddH2O. 29. Document the reaction directly by photography. 30. Air-dry the nylon membranes and store them at room temperature. 31. Count the stx-positive hybridization signals per blot to determine the relative abundance of STEC in the fecal sample. 32. Using the marks on the membrane and the master plate, assign the hybridization signals to single colonies on the Gassner agar master plate; select up to ten stx-positive colonies per fecal sample and culture them in LB broth for further characterization.

STEC in Animals

4.3 Molecular Typing of STEC 4.3.1 Pulsed-Field Gel Electrophoresis (PFGE)

53

1. Prepare fresh overnight cultures of strains to be tested on sheep blood agar plates with streak inoculation using a three- to fourstreak pattern and incubate the agar plate at 37
C for 18 (2) h. 2. Select 3–4 single colonies from each plate, inoculate in 3 mL of LB broth and incubate the broth (37
C, 18  2 h) with agitation (180 rpm). 3. Measure the optical density (OD600 nm) of the culture using fresh LB broth as a blank. Adjust with sterile 0.89% NaCl to OD600 nm ¼ 1.0. 4. Dissolve with a magnetic stirrer 1.5% agarose in 1 TBE buffer in a 50 mL glass bottle for n + 1 strains by calculating 0.375 mL agarose solution for each strain. Stir the solution on a heated magnetic stirrer (80
C) until the agarose is dissolved (alternatively dissolve in a microwave oven), then keep at 55–60
C with gentle stirring (see Note 41). 5. Seal the lower side of the plug molds using a tape and number the plug molds. Calculate five molds for one strain (see Note 5). 6. Transfer 1.5 mL density-adjusted culture to one 2.0 mL reaction tube, centrifuge (13,000  g, 5 min), and discard the supernatant. 7. Wash bacterial pellet with 1 mL sterile 0.89% NaCl, centrifuge (13,000  g, 5 min), and discard the supernatant. 8. Suspend bacterial pellet with 0.5 mL sterile 0.89% NaCl and discard 0.25 mL of the suspension (see Note 42). 9. Add 375 μL melted 1.5% agarose and mix gently by pipetting up and down. Dispense the mixture in five plug molds without introducing bubbles (see Note 43) and allow to solidify in a refrigerator (4
C, 30 min). 10. Prepare one 2 mL tube for each strain. Remove the tape from the plug molds, push the agarose plugs using the punch at the end of the plug molds in the 2 mL tube (see Notes 44 and 45), add 500 μL ESP buffer (see Note 46), and incubate in a thermoblock (56
C, 18  2 h). 11. Discard the ESP buffer and transfer the plugs to 15 mL plastic tubes (see Note 47). 12. To remove the ESP buffer, wash the plugs three times; each wash step has to be performed for at least 1.5 h, with 10 mL cold (4
C) TE buffer on a rocker in a cold storage room (4
C) (see Note 48). 13. To digest with the appropriate restriction enzyme, one halfplug per enzyme is sufficient (see Note 49). Transfer the halved plug in a 1.5 mL tube and add 500 μL of the respective 1 restriction buffer to equilibrate the plug (30 min, room temperature).

54

Stefanie A. Barth et al.

14. Decant the restriction buffer and add the appropriate restriction enzyme in 150 μL of the restriction buffer to the halved plug. The required restriction time depends on the enzyme, the buffer system, and the plugs and has to be evaluated individually. We regularly use overnight digestion with 20 U enzyme per halved plug at 37
C (see Note 50). 15. Prepare 2.2 L 0.5 TBE buffer and cool down to 4
C overnight. 16. Remove the restriction enzyme buffer from the plugs and equilibrate the plugs for at least 30 min with 0.5 TBE buffer. 17. Provide the casting stand with the inserted comb (see Note 51). 18. Prepare 100 mL gel for the CHEF standard casting stand and 150 mL for the CHEF wide/long casting stand using 1% agarose in 0.5 TBE buffer by heating in a microwave oven. Cool down to 60
C before filling the casting stand without any air bubbles (see Note 52); withhold 2 mL gel solution, and keep them at 60
C. Keep the gel at least 30 min at room temperature to allow it to solidify before removing comb and casting stand (see Note 53). 19. Meanwhile, fill cooled 2.2 L 0.5 TBE buffer in the electrophoresis chamber, start the CHEF mapper system, the pump (1 L/min), and the cooling system (14
C). 20. When the agarose gel is solidified, load the restricted plugs in the slots using a small spatula and push them to the front of the slots. At least in the outermost slots, fill one halved 1 mm thick slice of the lambda ladder PFG marker. When using 30-well combs, 1–2 additional slots in the middle should be used for the marker. Seal the plugs in the slots with the agarose gel solution retained (avoid bubble formation) (see Note 54). 21. Place the gel with the platform in the frame in the electrophoresis chamber, control that the gel is completely covered with the buffer, and close the lid. 22. For XbaI-restricted DNA, select the following conditions in the two-state mode of the CHEF mapper XA system: 5 s initial switch time to 50 s final switch time with linear ramping and a gradient of 6 V/cm during 23 h and a constant angle of 120
(see Notes 55–57). 23. After the run, turn off the power supply, remove the gel, and place it in a box with ethidium bromide staining solution. Incubate for 30 min with gentle shaking in the dark (see Note 21). 24. Destain the gel by three-time incubation in 400 mL ddH2O for 20 min (protect from light). 25. Photograph the gel using a gel documentation system and a UV transilluminator as described in Subheading 4.1.6.

STEC in Animals 4.3.2 Multilocus Sequence Typing (MLST)

55

The protocol follows the method published by Wirth et al. [141]. 1. Prepare overnight cultures of the E. coli strains to be analyzed by inoculating a single colony from an LB plate in 3 mL LB medium and incubate the broth (37
C, 18  2 h) with agitation (180 rpm). 2. Prepare a boiled lysate by transferring 500 μL of the overnight culture to a fresh 1.5 mL reaction tube and incubating it for 10 min at 100
C in a thermoblock. Then incubate the culture for 5 min on ice, centrifuge (13,000  g, 5 min), and transfer 200 μL of the supernatant to a fresh 1.5 mL reaction tube. Store the boiled lysate at 20
C until use as a PCR template. 3. Prepare the PCR Mastermix for n + 1 reactions: A single reaction requires 33.5 μL ddH2O, 10.0 μL 5 Phusion HF buffer, 1 μL each of the respective forward and reverse primer (see Table 4), 10 μM stock solution (final concentration of each primer: 0.5 μM), 1 μL dNTPs (final concentration of each nucleotide: 200 μM), and 0.5 μL Phusion DNA polymerase (final concentration 1.0 U) (see Note 58). 4. Place the respective number of reaction tubes in a cooler (one for each strain and one for the no-template [ddH2O] control), dispense 47 μL of the Mastermix in each tube, and add 3 μL of the boiled lysate as template. 5. Spin tubes for 10 s at 10,000  g and place them immediately in the thermal cycler. 6. Start DNA amplification with an initial denaturation step at 98
C for 30 s. Consecutively, perform 30 cycles of DNA denaturation (98
C, 10 s), primer annealing [54
C (adk, fumC, icd, purA), 58
C (recA), 60
C (gyrB, mdh), 30 s], and primer extension (72
C, 30 s). The final extension is at 72
C for 5 min. Subsequently, cool tubes and keep at 4
C for up to 8 h or store at 20
C until gel electrophoresis. 7. Analyze the PCR reaction by performing agarose gel electrophoresis with 1.5% (w/v) agarose gels with 1 TAE buffer according to Subheading 4.1.6. The reaction mix with the sample has to generate a distinct DNA fragment of the length given in Table 4 and the no-template control must not yield any DNA fragment. 8. Remove remaining dNTPs and primers from the PCR products (Note 59). 9. Use spectrophotometry to determine the DNA concentration of the excised and purified PCR fragments. Fragments may be sent to a commercial DNA sequencing service, following their sample preparation requirements and using the amplification primers from Table 4 for sequencing (see Note 60).

56

Stefanie A. Barth et al.

Table 4 Primers used for the MLST PCRs according to Wirth et al. [141] Primer

PCR product Length Amplified site in E. coli K12 MG1655 (bp) (position in U00096)

Gene Name

Sequence (50 ! 30 )

adk

ATTCTGCTTGGCGCTCCGGG CCGTCAACTTTCGCGTATTT

584

497,184–497,767

fumC fumCF TCACAGGTCGCCAGCGCTTC fumCR GTACGCAGCGAAAAAGATTC

806

1,685,774–1,686,579

gyrB

gyrBF gyrBR

TCGGCGACACGGATGACGGC ATCAGGCCTTCACGCGCATC

880

3,880,040–3,879,161

icd

icdF

ATGGAAAGTAAAGTAGTTG TTCCGGCACA GGACGCAGCAGGATCTGTT

878

1,195,123–1,196,000

ATGAAAGTCGCAGTCC TCGGCGCTGCTGGCGG TTAACGAACTCCTGCCCCAGA GCGATATCTTTCT

932

3,384,268–3,383,337

purA purAF CGCGCTGATGAAAGAGATGA purAR CATACGGTAAGCCACGCAGA

817

4,404,920–4,405,736

recA

734

2,822,852–2,823,585

adkF adkR

icdR mdh

mdhF mdhRa

recAF CGCATTCGCTTTACCCTGACC recARb TCGTCGAAATC TACGGACCGGA

a

Nucleotides underlined and bold in the mdhR primer sequence differ from the MG1655 reference sequence The primer sequence does not correspond to the sequence given in the original publication of Wirth et al. [141], but to the sequence of the “R” primer added later to the University of Warwick MLST web page as detailed in EnteroBase (https://enterobase.readthedocs.io/en/latest/mlst/mlst-legacy-info-ecoli.html#pcr-amplification) b

10. Upload sequence data to websites, e.g., EnteroBase (https:// enterobase.warwick.ac.uk/species/ecoli/allele_st_search) or the Center for Genomic Epidemiology (https://cge.cbs.dtu. dk/services/MLST/) for analysis and assignment of the sequence type (Note 61). 4.4 Quantification of Stx in STEC Cultures 4.4.1 In Vitro Shiga Toxin Production

1. Prepare a fresh overnight culture of tested strains on sheep blood agar plates with streak inoculation using a three- to four-streak pattern and incubate the agar plate (37
C, 18  2 h). 2. Select 3–4 single colonies from the blood agar plate, inoculate in 20 mL of LB broth and in 20 mL of LB-MMC broth, and incubate both (37
C, 18  2 h) with agitation (180 rpm) (see Notes 6 and 62).

STEC in Animals

57

3. Centrifuge the culture (4000  g, 20 min, room temperature), collect and sterile filtrate the supernatant, and store aliquoted at 80
C until use. 4. Some STEC strains, e.g., the edema disease strains from pigs, secrete only low levels of Stx into the culture supernatant. In such cases, it may be useful to additionally prepare periplasmic or cytoplasmic fractions of the bacterial cell pellets.

4.4.2 Hydatid Fluid ELISA

l

For the periplasmic fraction, suspend the bacterial pellet in 1.8 mL polymyxin B buffer and incubate the suspension (37
C, 180 rpm, 30 min). After centrifugation (14,000  g, 20 min, room temperature), collect and sterile filtrate the supernatant and store in aliquots at 80
C until use.

l

For the cytoplasmic fraction, suspend the bacterial pellet in 1.8 mL BugBuster reagent and incubate the suspension (20 min, room temperature). After centrifugation (14,000  g, 20 min, room temperature), collect and sterile filtrate the supernatant and store aliquoted at 80
C until use.

1. Test each sample in duplicate. Additionally, include duplicates of a chromogen blank control (wells only filled with substrate and stop solution), of a conjugate control (wells only filled with detection antibody, substrate, and stop solution), of a negative control (periplasmic fraction of an E. coli K12 strain), and a positive control (periplasmic fraction of STEC strain EDL 933). 2. Dilute hydatid fluid 1:400 in coating buffer and add 100 μL per well in a 96-well MaxiSorp™ microtiter plate, exclude the wells for the blank. Incubate for 18  2 h at 4
C in a humidified chamber (see Note 63). 3. Discard the fluids and wash all wells four times with 200 μL washing buffer per well (see Note 64). 4. Add 200 μL blocking buffer in each well, excluding the blank wells which are filled with washing buffer instead, and incubate the microtiter plate in a humidified chamber (37
C, 1 h). 5. Discard the fluids and wash all wells four times with 200 μL washing buffer per well. 6. Add 100 μL of tested samples (see Subheading 4.4.1) and controls (see Note 65) to the wells and add only washing buffer to the blank wells. If a dilution of the sample is necessary, use washing buffer to dilute the samples. Incubate the microtiter plate in a humidified chamber (37
C, 2 h). 7. Discard the fluids and wash all wells four times with 200 μL washing buffer per well.

58

Stefanie A. Barth et al.

8. Dilute the respective POD-labeled monoclonal antibody according to the manufacturer’s instructions (normally around 1:1000) in washing buffer and add 100 μL per well, excluding the blank wells that are again filled with washing buffer instead. Incubate the microtiter plate in a humidified chamber (room temperature, 1 h). 9. Discard the liquid and wash all wells four times with 200 μL washing buffer per well. 10. Add 100 μL TMB solution per well, including the blank wells and incubate the microtiter plate (light-protected, room temperature, 15 min). 11. Add 100 μL stop solution per well, including the blank wells. 12. Read the optical densities using OD450 and OD550 nm as reference wavelength.

nm

as test wavelength

13. Calculate: l

OD value ¼ OD450nm  OD550nm.

l

ODblank ¼ mean of OD valuesblank.

l

4.4.3 Vero Cell Cytotoxicity Assay

ODsamples [ELISA value] valuessample  ODblank.

¼

mean

of

OD

1. For the layout of the microtiter plate (for cell culture), consider testing all samples and dilutions thereof in triplicate (see Note 66). Three wells of the microtiter plate are used for the positive control (1% SDS solution to cause efficient cell lysis) and three wells for the negative control (RPMI medium) (see Note 67). 2. Prepare the microtiter plate by adding 200 μL 0.89% NaCl in all 36 marginal wells (see Notes 68 and 69). 3. Pipette 50 μL RPMI medium, e.g., to the wells E-G in row 2 (negative control). Reserve wells, e.g., B-D in row 2, for the positive control, and leave empty at this stage (see Note 70). 4. Add the samples and dilutions thereof in wells B-G in row 3 through 11 at final volumes of 50 μl (see Note 71). 5. Harvest the Vero cells (see Note 72). (a) Remove the RPMI medium from the cells using a Pasteur pipette and add 10 mL 1 PBS to remove any remaining medium (given volume refers to 75 cm2 flasks). Discard the 1 PBS. (b) Add 4 mL trypsin solution and incubate (37
C, 5 min, 5% CO2). (c) Detach the Vero cells by gentle tapping on the flask, add 5 mL RPMI medium and transfer the fluid with the Vero cells to a 50 mL tube, centrifuge (900  g, 9 min, room temperature), and discard the supernatant. Suspend the Vero cells in 3 mL RPMI medium.

STEC in Animals

59

6. Adjust the Vero cell number: (a) Mix 20 μL of the Vero cell suspension with 180 μL trypan blue solution. (b) Fill the stained cells into the Neubauer counting chamber and count the Vero cells in at least 4 counting squares. Calculate the number of Vero cells with the following formula:  
Vero cells ½cells=μL ¼ ðcounted cells=4Þ= counted area mm2  chamber depth ½mm  dilution :

(c) Calculate the number of Vero cells needed: for each well, 4  104 Vero cells in 100 μL are needed, resulting in 2.6  106 Vero cells in 6.5 mL for one plate with 60 wells (suspension calculated for 65 wells including five wells in reserve). Adjust the Vero cell suspension with RPMI medium. 7. Add 100 μL of the adjusted Vero cell suspension to each well, avoid cross-contamination between wells. 8. Pipette 50 μL 1% SDS solution to wells, e.g., B-D in row 2 (positive control) (see Note 70). 9. Control in an inverse microscope for homogenous distribution of the Vero cells and the effect of the 1% SDS solution. 10. Incubate in a CO2 incubator (37
C, 96 h, 5% CO2) in a humidified chamber (see Note 63) with daily microscopic control of the microtiter plate, especially focussing on the regular growth of Vero cells in the negative control wells. 11. Record after 48 and 96 h by microscopic assessment the ratio of living and dead Vero cells, as well as bacterial or fungal contamination events if such occur. A semiquantitative score can be used (see Fig. 1). 12. Determine the metabolic activity of Vero cells after 96 h of incubation: (a) Add 20 μL MTT solution to the wells B-G in rows 2 through 11 and incubate the microtiter plate (37
C, 4 h, with gentle agitation, see Note 73). (b) To stop the enzymatic reaction, add 100 μL 10% SDS solution to the wells B-G in rows 2 through 11 and incubate the microtiter plate (37
C, 24 h) (see Note 74). (c) Record the macroscopic assessment of the color change in the wells. (d) Measure the optical densities using OD540nm as test wavelength and OD690nm as reference wavelength. Calculate the OD value ¼ OD540nm  OD690nm for each well.

60

Stefanie A. Barth et al.

Fig. 1 Microscopic appearance of Vero cells after incubation with samples containing different amounts of Stx1 for 96 h. (A) Control, (B–D) cytopathic effects ranging from score +/ (B) to +++ (D)

13. Calculate the CD50/mL of individual preparations (when tested in log10 dilution series as example): (a) Calculate the mean of triplicate determinations per sample OD[abs] ¼ (ODwell 1 + ODwell 2 + ODwell 3)/3. (b) Standardize the values using the positive [SDS] and negative [RPMI medium] control by defining OD[rel] pos. control ¼ 0% and OD[rel] neg. control ¼ 100%. Use the following formula: OD[rel][%] ¼ ((OD[abs] sample  OD[abs] pos. control)/ (OD[abs] neg. control  OD[abs] sample))  100. (c) To linearize the sigmoid curve, perform a logit-log transformation for each OD[abs] t with the formula: logit-log OD[abs] ¼ log10((OD[abs] sample  LL)/(UL  OD[abs] sample)). LL ¼ lower limit ¼ OD[abs] pos. control if all samples yield an OD[rel]  0%. If this is not the case, the lowest OD[abs]  0.001 is to be defined as LL. UL ¼ upper limit ¼ OD[abs] neg. control if all samples yield an OD[rel]  100%. If not, the highest OD[abs] + 0.001 is to be defined as UL. (d) The calculation of the slope (m) and the y-axis intercept (b) is possible with Microsoft® Excel. For this, identify the section of the logit-log OD[abs] curve which intersects the x-axis (see Fig. 2). Two values above and two values below the intercept are included for the calculations of the toxin concentration (see Note 75).

STEC in Animals

61

Fig. 2 Schematic curve progression of the OD[abs] values after logit-log transformation. For the calculation of the intercept with the x-axis (corresponds to the dilution of the toxin resulting in 50% cellular activity) two values above and two values below are included. The letters correspond to the letters in the Microsoft® Excel formulae

The calculation is as follows: m ¼ INDEX(RGP(A:B; C:D); (1) and b ¼ INDEX(RGP(A:B;C:D); (2), whereby A ¼ lowest included logit-log OD[abs], B ¼ highest included logit-log OD[abs], C ¼ exponent of the dilution step of the lowest included logit-log OD[abs], and D ¼ exponent of the dilution step of the highest included logit-log OD[abs] (see Fig. 2). 14. Calculate the Stx concentration in the sample using slope (m) and y-axis intercept (b): CD50/mL ¼ z(b/m)  20, whereby z represents the base of the logarithmic dilution, e.g., 10 in a log10 dilution series, and 20 represents the fold difference between the tested volume of 50 μL and 1 mL as reference volume. 4.5 STEC Adhesion to and Invasion into Intestinal Epithelial Cells 4.5.1 Adhesion Assay

The protocols presented for adhesion assays in the presence of mannose follow the methods published by Cravioto et al. [142] and modified by Scotland et al. [143] using a Giemsa stain or fluorescence actin staining [FAS] according to Knutton et al. [144]. 1. Seed epithelial cells (2  105 cells/1 mL/well) in culture medium on coverslips in 24-well cell culture plates and incubate (37
C, 5–8% CO2) until the cell layer reaches 90–100% confluence. 2. Exchange culture medium with 1 mL test medium (without antibiotics) and incubate 1 h (37
C, 5–8% CO2) (see Note 63).

62

Stefanie A. Barth et al.

3. For inoculation, add 6  106 bacterial cells in 150 μL test medium/well (MOI of 30) (see Notes 76 and 77) and incubate 3 h (37
C, 5–8% CO2). 4. Discard the medium with nonadhered bacteria and wash the cells three times with 500 μL 1 PBS per well. Add 1 mL fresh test medium/well and incubate for 3 h (37
C, 5–8% CO2) (see Note 78). 5. Wash the wells five times with 500 μL 1 PBS per well (see Note 78). 6. To identify the adherence pattern and intensity by Giemsa stain, proceed with step 7; if a fluorescence actin staining (FAS) is to be performed, proceed with step 12. 7. Giemsa stain: Fix the cells with 500 μL/well 70% ethanol (30 min, room temperature). 8. Stain the cells with freshly prepared 10% Giemsa stain solution (30–40 min, room temperature). 9. Remove excess staining solution by washing the wells with ddH2O (1 mL/well, 3–4 times). 10. Let the coverslips air-dry, remove them from the 24-well plate, and mount them with the cell-covered side directed downwards using one drop mounting medium on slides. 11. Analyze the specimen using a light microscope (see Fig. 3a, c): l

An E. coli strain is qualitatively classified as “adhesion positive,” if more than ten E. coli cells adhere to one host cell, independent of the number of host cells affected.

l

The adhesion pattern of the E. coli strain is assessed as summarized in Table 5 (see Note 79).

12. FAS stain: Fix the cells with 500 μL/well 2% paraformaldehyde and incubate the 24-well plate (30 min, room temperature) (see Note 11). 13. Wash the wells three times with 500 μL 1 PBS per well. 14. Add 500 μL/well 0.1% Triton X-100 to permeabilize the cells (see Note 80), incubate (5 min, room temperature), and wash the cells again three times (500 μL 1 PBS/well). 15. Center the coverslips in the wells (see Note 81). 16. Add 20 μL/well Phalloidin-FITC staining solution in the center of the coverslip and incubate (30–60 min, room temperature, light-protected). 17. Wash the wells twice with 1 mL 1 PBS (precooled to 4
C) per well. 18. Add 50 μL/well PI staining solution and incubate (2 min, room temperature, light-protected) (see Note 13).

STEC in Animals

63

Fig. 3 Adhesion of E. coli strains to immortalized cell lines visualized by Giemsa or FAS staining (40 magnification). (A) Giemsa stain, Hep2 cell infected with EPEC strain E2348/69 showing localized adherence (LA) with microcolonies (black arrow heads) on the host cell surface; (B) FAS stain of IPEC-J2 cells infected with a porcine STEC field isolate; cells showing adherent bacteria (red) either in an LA pattern and being FAS-positive with actin accumulation (green; white arrow heads) or DA and FAS-negative (open arrow head); (C) Giemsa stain, bovine colonocytes (primary cells) infected with the EAEC/EHEC strain O104:H4 showing aggregative adherence (AA) with a stack-brick pattern on the surface of the host cells (black arrow head) as well as on the glass slide (white arrow head); (D) FAS stain, IPEC-J2 cells infected with a porcine EPEC field isolate, cells showing adherent bacteria (red) with actin accumulation (green; white arrow heads)

Table 5 Classification of adhesion patterns of E. coli isolates on host cells according to Levine et al. [151] Adhesion pattern

Representative pathovar/characteristics

Localized (LA)

Enteropathogenic E. coli (EPEC); formation of microcolonies on the surface of the host cells, while the slides without host cells are free of bacterial cells

Diffuse (DA)

Diffusely adherent E. coli (DAEC); the entire host cell is diffusely covered with E. coli cells, no microcolonies visible, and the slides without host cells are free of bacteria

Aggregative (AA)

Enteroaggregative E. coli (EAEC); bacteria show stacked-brick-like formations on the surface of the host cells and on the glass slide next to attached cells

64

Stefanie A. Barth et al.

19. Wash the wells twice with 1 mL ddH2O (precooled to 4
C) per well. 20. Let the coverslips air-dry (light protected), remove them from the 24-well plate, and mount them with the cell-covered side facing downwards using one drop of Mowiol mounting medium on slides. 21. Store the slides overnight in a light-protected place at room temperature. 22. Analyze the assay using a fluorescence microscope (see Fig. 3b, d):

4.5.2 Gentamicin Protection Assay (Invasion Quantification)

l

Actin is stained in green, host cell nuclei and bacteria in red.

l

FAS signals correlate to adherent bacteria with a strong actin accumulation below the adherence site.

l

An E. coli strain is qualitatively classified as “FAS positive,” if more than 10 E. coli cells show a FAS signal on one host cell, independent of the number of host cells affected.

l

Additionally, record the number of infected host cells semiquantitatively as weakly (less than one third), medium (more than one and less than two-thirds), and strongly (more than two-thirds of host cells) infected.

The protocol follows the method published by Dibb-Fuller et al. [145]. 1. Seed epithelial cells (2  105 cells/1 mL/well) in culture medium in 24-well plates and incubate (37
C, 5–8% CO2) until the cell layer reaches 90–100% confluence. 2. Exchange culture medium to 1 mL/well test medium (without antibiotics) and incubate 1 h (37
C, 5–8% CO2) (see Note 63). 3. For inoculation, add 6  106 bacterial cells in 150 μL test medium/well (MOI of 20) (see Notes 76 and 82) and incubate 3 h (37
C, 5–8% CO2). 4. Collect the supernatant with nonadherent bacteria (for cfu determination) and wash the cells three times with 500 μL 1 PBS per well. Add 1 mL fresh test medium/well and incubate additional 3 h (37
C, 5–8% CO2) (see Note 78). 5. Collect the supernatant with nonadherent bacteria (for cfu determination) and wash the wells five times with 500 μL 1 PBS per well (see Note 78). 6. Calculate cfu/mL in three different culture compartments (supernatant, host-cell associated, and intracellular; see Note 83), when appropriate after 3 h (step 4) as well as 6 h of co-incubation (step 5) as follows: l

Bacteria in the supernatant (neither adherent nor intracellular): Remove the test medium and determine cfu counts.

STEC in Animals

65

l

Host-cell associated bacteria (adherent and/or invaded): After removal of the supernatant, wash the wells three times with 500 μL 1 PBS per well, lyse the host cells by adding 200 μL 0.1% Triton X-100/well, and incubate the microtiter plate (4 min, room temperature). Add 800 μL test medium and determine cfu counts.

l

Intracellular bacteria (invaded bacteria): After removal of the supernatant, wash the wells (separate to the aforementioned wells) three times with 500 μL 1 PBS per well and add 1 mL gentamicin solution to each well to eliminate the bacteria adhering to the host cells. After incubation (1 h, 37
C, 5% CO2), wash the wells three times with 500 μL 1 PBS per well, lyse the host cells by adding 200 μL 0.1% Triton X-100/well, and incubate the 24-well plate (4 min, room temperature). Add 800 μL test medium and determine cfu counts. The suspensions of the quadruplicates (neighboring wells of a 24-well plate) can be tested in pools.

7. Report the results as follows: l

l

l

l

4.6 Virulence Gene Transcription in STEC

Total bacterial count per well: cfutotal ¼ cfusupernatant + cfuhost-cell associated. Adherent bacteria: cfuadherent ¼ cfuhost-cell vaded bacteria.

associated

– cfuin-

Invaded bacteria: cfuinvaded, only positive if more than 1% of the inoculated bacteria (see step 3) were recovered from the intracellular compartment [146]. 3 h-invasion index [%] ¼ (cfuinvaded-3 h/cfuinoculum)  100. 6 h-invasion index [%] ¼ (cfuinvaded-6 h/cfuhost-cell associated-3 h)  100.

1. Prepare STEC inoculated cell cultures, e.g., as described in Subheading 4.5.2. 2. For RNA preparation, follow the instructions of the manufacturer. We use the following variations: l

l

After removal of the test medium, the co-infected cells are washed (500 μL 1 PBS/well). Add 350 μL RLT buffer/β-mercaptoethanol to the first well of the quadruplicate to lyse and harvest cells using a cell scraper or pipette tip, mix by pipetting up and down, and transfer to the second well, repeat the lysis and harvest step, transfer to the third well, and so on. From the fourth well, transfer the suspension to a 1.5 mL tube. Place the tube directly in liquid nitrogen (see Note 14) to shock freeze and store at 80
C until further use.

66

Stefanie A. Barth et al. l

Thaw samples gently (20 min, 37
C) and homogenize with QIAshredder spin columns by centrifugation (2 min, maximum speed in a microcentrifuge) (see Note 84).

l

Perform an on-column DNase digestion and skip the RW1 washing step.

l

When RNA from cell cultures of primary cells is prepared, pipette 1.5 μL RNase inhibitor (60 U) into the collection tube before you place the RNeasy spin column in the tube.

l

Retain a small portion of the eluate to measure the RNA concentration in a photometer (see Note 85).

l

Place the remaining eluate containing the RNA directly in liquid nitrogen (see Note 14) to shock freeze and store at 80
C until further use.

3. Perform the cDNA synthesis using the Omniscript Reverse Transcription Kit with random hexanucleotide primers according to the instructions of the manufacturer in a final volume of 40 μL. As a template, use 500 ng denatured (5 min, 65
C) RNA in 24 μL RNase-free water. Include control reaction mixes with RNA templates, but without reverse transcriptase, to exclude DNA contamination in the RNA preparations as well as an RNase-free water sample. 4. After inactivation of the reverse transcriptase (5 min, 93
C), proceed with the quantitative real-time PCR (qRT-PCR) or store the cDNA at 20
C. 5. For the qRT-PCR, mix 1 SYBR Green Mastermix, 2 μL of the cDNA template, the respective forward and reverse primers in a final concentration of 450 nM (see Table 6), and add 25 μL ddH2O in an optical 96-well plate. Each sample should be tested in duplicate, and each reaction should include negative control reaction mixes with cDNA control templates (RNA without reverse transcriptase) and water samples, as well as positive control DNA from E. coli strains with the respective virulence marker (see Table 6). 6. Seal the plate with the adhesive film. 7. Centrifuge the plate and place it in the real-time PCR system. 8. Start the thermal program with the following profile: First, start with one step of 50
C for 2 min and one step for activation of the polymerase (95
C, 10 min). Second, perform 40 cycles with denaturation (95
C, 15 s) and amplification (60
C, 1 min) with parallel data collection by fluorescence measurement. Finally, a melt curve analysis is performed to specify the PCR product: 95
C (15 s), 60
C (1 min), data collection by fluorescence measurement during temperature increase, 95
C (15 s), and 60
C (1 min). Analyze randomly selected PCR products also by agarose gel electrophoresis using 3% agarose gels (see Subheading 4.1.6).

STEC in Animals

67

Table 6 Primers used for the quantification of the expression of virulence associated genes in STEC strains and the housekeeping gene gapA for quantification Primer

Sequence (50 ! 30 )

Gene

Reference

GapA_for GapA_rev

GTTGTCGCTGAAGCAACTGG AGCGTTGGAAACGATGTCCT

gapA

[152]

pic_F3696 pic_R3842

CCTGACAGAGGACACGTTCA TCAACCCCTGTTCTTCCAAC

pic

[153]

aggR_F486 aggR_R654

TTCCGATAAGGTCAGAAACACA TGCTGCTTTGCTCATTCTTG

aggR

[153]

iha-f iha-r

CTGACTAACGCAGCCGCCAG CCTCCGGTTTTACCCGTACC

iha

modified from [154]

RT-stx2F RT-stx2R

CGACCCCTCTTGAACATA TAGACATCAAGCCCTCGTAT

stxA2a, stxA2b, stxA2c

[155]

9. Export the collected data to Microsoft Excel® for a relative quantification of the virulence gene expression. Use the ΔCt method to describe the relative expression ratio of the target gene. Thereby, the Ct value of the target gene is normalized by the Ct value of the reference housekeeping gene gapA to compensate variations in the cDNA amount/reaction and to standardize the Ct value with respect to the bacterial number. Use the following formulae: (a) Calculate the Ctmean Ctmean ¼ (Ct1 + Ct2)/2.

of

the

duplicates:

(b) Normalize with the Ct of the housekeeping gene: ΔCt ¼ (Ct mean target  Ct mean gapA). (c) Determine the [Rtarget] ¼ 2ΔCt.

relative

gene

expressiontarget

An R value greater than 2 is generally considered a biologically meaningful upregulation of the respective gene, a value of below 0.5 is interpreted as downregulation.

5

Notes 1. All reagents used are of standard molecular biology grade if not otherwise indicated. 2. Highly purified primers, e.g., by HPLC, are preferred but non-purified, salt-free primers work as well in our hands. Quality differences between lots of primers may occur independently of their purity. We recommend to check each lot of a primer pair with several positive and negative control strains

68

Stefanie A. Barth et al.

separately before setting up Duplex- and Multi-Primer mixes. We also recommend to check primer concentrations after setting up the primer stock solutions (see also Note 3). 3. Spectrophotometry is used to determine the DNA concentration of primer solutions. 4. The efficiency of DNA probes labeling can be tested using agarose gel electrophoresis. Because of the integration of DIG-UTP in the newly synthesized DNA, correctly labeled DNA probes migrate with reduced mobility in the gel compared to the unlabeled control and appear to have a larger size. 5. Disposable plug molds can be reused after cleaning with disinfectant (alcohol) and warm water. 6. Mitomycin C is acutely toxic and carcinogenic. Every item having been in contact with mitomycin C has to be collected, marked as hazardous waste, and disposed according to local and national regulations. The same applies to solutions containing mitomycin C. 7. Lab-internal validation of the specificity of the monoclonal antibodies showed that VT109/4-E9b recognizes all subtypes Stx1a, Stx1c, and Stx1d. The monoclonal antibody VT135/6B9 detects Stx2a, Stx2b, Stx2e, and Stx2f, while preparations containing Stx2c, Stx2d, and Stx2g yielded negative results. 8. Depending on the STEC strains to be tested and the question to be addressed bovine, porcine, or human immortalized cell lines of intestinal origin can be used: l

Bovine permanent cell line FKD-R 971 (fetal intestinal epithelial cells, Collection of Cell Lines in Veterinary Medicine, Isle of Riems) cultured in Ham’s F12:Iscove’s Modified Dulbecco’s Media (IMDM) (1:1 [v:v]).

l

Porcine permanent epithelial cell line from the jejunal intestine, IPEC-J2 (ACC 701, German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany), cultured in Minimum Essential Media (MEM) with 4.5 g/L glucose.

l

Human colonic epithelial cell line CaCo-2 (ACC 169, German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany), cultured in DMEM with 4.5 g/L glucose, or, as representative for the epithelium of the small intestine, INT 407 cells (fetal, 85,051,004, European Collection of Authenticated Cell Cultures, Salisbury, UK), cultured in MEM with 2.2 mg/L NaHCO3.

9. Alternatively, primary epithelial cells can also be used, e.g., based on bovine colon crypt cells from 1- to 15-month-old cattle according to the method of Fo¨llmann et al. [147] as modified by Stamm et al. [55].

STEC in Animals

69

10. The Giemsa stain solution should be filtered using folded filters to remove undissolved crystals. 11. Paraformaldehyde is a hazardous substance (harmful if swallowed or inhaled, causing skin irritation and eye damage, or also genetic defects and cancer)—protect yourself while handling it and collect waste for disposal in accordance with local and national regulations. 12. p-Phenylenediamine is added as an antifade agent to protect the fluorescently stained cells against bleaching by light. Make sure to protect yourself while handling the substance as p-phenylenediamine is acutely toxic. Collect waste for disposal in accordance with local and national regulations. 13. Prepare the PI staining solution in the dark under a fume hood and store the solution protected from light. 14. Liquid nitrogen can cause cryogenic burns and injuries. Wear cold insulating gloves and a face shield while working. In high concentrations, liquid nitrogen may cause asphyxiation. Symptoms may include loss of mobility/consciousness. 15. Sometimes no oral fluids can be recovered from the rope for several reasons. Proceed to the next step in these cases. 16. The number of EDEC bacteria in a sample can be small in comparison to concurrent commensal E. coli strains even early after onset of symptoms. Currently, no method can be recommended for specific enrichment of EDEC strains. In consequence, a valid diagnostic approach requires testing of a considerable number of individual colonies per sample. It is still an open question how many colonies should be tested. From our experience, 5–10 putative E. coli colonies per sample can be sufficient, if the sample originates from a piglet with acute ED or if herd diagnosis is required and samples from several pigs in that herd are tested. However, if single apparently healthy animals are tested, more colonies should be examined (20–50) to increase assay sensitivity. In those cases, it is advantageous to perform two rounds of PCR analysis where pools of up to 20 LB broth cultures are tested in the first round and individual cultures of positive pools in the second (see also Note 17). 17. A hemolytic phenotype on sheep blood agar can be used as a screening marker for EDEC colonies since most EDEC strains produce α-hemolysin [79]. Note that a hemolytic phenotype is no specific marker since many non-EDEC E. coli strains produce α-hemolysin as well. Do not select only hemolytic colonies for PCR analysis in order not to miss non-hemolytic EDEC strains.

70

Stefanie A. Barth et al.

18. Use positive and negative controls to ensure the reliability of the assay results. E. coli strains listed in the Materials section are well-characterized reference strains that work fine as positive and negative controls. However, other strains may be used as well. Usually, negative controls (PCR reaction mixes containing E. coli strain HB101) make at least 5% of the samples tested in the same PCR round. 19. Routine performance of the same PCR over long periods of time increases the risk that PCR products may contaminate your PCR reaction mixtures or even stock solutions. The following standard precautions are recommended to avoid contamination: l

Strictly separate all post-PCR work from all pre-PCR work. Never allow any equipment or material (PCR reaction mixes, tubes, pipettes and tips, gloves etc.) that was used in the post-PCR environment to get back into the pre-PCR laboratory. Consider the thermal cycler as post-PCR equipment.

l

Use stock solutions only for PCR procedures. Set up stock solutions in a clean (third) room separate from any pre- and post-PCR procedures.

l

In order to avoid carryover contamination, bacterial culture material is the last component added to each PCR tube during the set up.

l

Use UV radiation to routinely destroy contaminating nucleic acids on surfaces of laboratory equipment.

l

To assure clean PCR reagents, at least one additional PCR reaction mix is loaded with ddH2O instead of bacterial culture material and processed concurrently in each PCR run (“reagent negative control”).

20. A mineral oil overlay is not necessary, if a thermal cycler equipped with a heated lid is used. 21. Caution: Ethidium bromide (EtBr) is mutagenic and toxic. Because EtBr can be absorbed through the skin, strictly avoid any skin contact. Wear disposable nitrile gloves and safety glasses when working with EtBr solutions or stained gels. All solutions and agarose gels containing EtBr as well as all consumables contaminated with EtBr must be disposed as hazardous waste. 22. The rest of the PCR reaction mixture may be stored for several days at 4
C. PCR products are stable for at least 6 months when stored at 20
C. 23. Caution: UV radiation is hazardous to your eyes and skin. Make sure that the UV light source is adequately shielded. Always wear a full safety mask or use safety lids for your protection when working with UV radiation.

STEC in Animals

71

24. A gel documentation system allows the banding patterns (electropherogram) to be recorded by a video camera, transferred to a personal computer, and stored as bitmap image files. Digitized images can be transferred easily into appropriate computer programs and processed further. Usually, the system also generates photo image reprints which can be stored as hardcopies. 25. If a negative control yields a false-positive test result, repeat the whole test starting with the growth of putative E. coli isolates and reference strains in LB broth. If the negative control becomes repeatedly positive it is usually more effective and straightforward to discard all stock solutions that are currently used than to search for the particular contaminated component. 26. Note that a definitive classification of a bacterial isolate as EDEC, ETEC, STEC, STEC/ETEC, or EDEC/ETEC strain, respectively, requires bacterial species confirmation, e.g., by utilizing a biochemical test kit for taxonomic identification of Enterobacteriaceae or MALDI-TOF mass spectrometry as recommended by the suppliers. 27. Transfer the bacterial suspension to the new tube and replace the pipette tip after draining the suspension for each dilution step to avoid carryover. 28. Metachrome yellow in the Gassner agar inhibits accompanying Gram-positive bacterial flora. Most E. coli strains metabolize lactose and, therefore, their colonies appear dark green to blue on Gassner agar. In contrast, colonies of Salmonella spp. or Proteus spp. are yellow. To restrict further analysis to coliform bacteria, selection of only green/blue colonies is possible, but keep in mind that lactose negative E. coli strains are also known. 29. As the agar absorbs parts of the washing fluid, it is not possible to fully recover the 1 mL LB/glycerol broth added. 30. To ensure that no remaining fecal content inhibits the PCR, a second PCR reaction from each sample may be included which is just spiked with the positive-control strain. The overall detection limit of the enrichment/PCR assay was shown by Schmidt et al. [57] using this PCR and by Barth et al. [119] with another PCR target to be 104 cfu/g feces. 31. If you have more than one colony blot, you can use larger boxes with saturated Whatman gel blotting paper or place the Whatman gel blotting paper on a clean plastic foil (without wrinkles) on the bench and add the buffer. For each buffer, use separate petri dishes, boxes, or foils. Ensure that the paper is soaked well with the respective buffer to equilibrate the nylon membrane afterwards.

72

Stefanie A. Barth et al.

32. To decrease the risk of background signal, handle the nylon membrane always with a filter tweezer with flat ends and with glove-protected hands. 33. Instead of baking, you can also cross-link the DNA on the nylon membrane using UV light. Expose the membrane to a Stratalinker (120 mJ) for 30 s to 5 min with a maximum distance of 15 cm. The exposure time has to be determined experimentally based on the wavelength of the illuminator. 34. After fixation of the DNA on the nylon membrane, the membrane may be stored between two blotting papers BloPa at room temperature until the test can be continued. 35. The proteinase K digestion is crucial to avoid false-positive signals. Therefore, it is important to ensure that enough proteinase K solution is present for complete immersion of the nylon membrane. 36. After the incubation, cell debris may be removed. Saturate a Whatman gel blotting paper with ddH2O and place it on the top of the nylon membrane. Gently press the paper on the membrane and peel off afterwards. 37. You can place up to 4 nylon membranes (82 mm) in one hybridization bottle (diameter 35 mm, length 300 mm) without risking that they slip on top of each other. To position the nylon membrane, it may be useful to add 5 mL ddH2O to the bottle. Discard the ddH2O when all membranes have been placed. 38. The hybridization temperature of 42
C is calculated for DNA probes with a GC content of 50%. The exact temperature may be calculated using the following formulae [148]: l

Tm of the hybrid ¼ 49.82 + 0.41[%G + C]  (600/L). [where % G + C ¼ GC content of labeled probe, L ¼ length (bp) of probe–target hybrid].

l

Thyb ¼ 20–25
C below Tm of hybrid. [where Thyb ¼ optimal hybridization temperature (in DIG Easy Hyb)].

39. The hybridization solution may be reused up to four times (or until signal intensities drop). Store at 20
C and denature by heating before reuse. 40. After the wash steps, the nylon membrane can be air-dried between two blotting papers and stored at room temperature until further use. 41. Alternatively, use a water bath with gentle shaking to keep the agarose dissolved.

STEC in Animals

73

42. Working with half the volume is sufficient for most questions and saves costs. 43. Bubbles can be removed by sucking the air up with small tips. Avoid to stamp the plug molds on the bench surface as fluid can slop from one mold to another. 44. Before you push the plugs out, remove an excess of agarose on top of the plug molds using a clean scalpel. 45. Keep in mind that everything used for the handling of the plugs (plug molds, spatula, scalpel, etc.) is potentially contaminated with infectious material and has to be disinfected. 46. Make sure that all plugs are covered with ESP buffer. 47. To ensure not to lose plugs, you may decant the fluids using a small sieve like a tea strainer or CHEF screened caps. 48. After the last washing step, the plugs can be stored in TE buffer at 4
C up to 1 year. 49. The most discriminative enzyme for E. coli is, according to our experience, XbaI; additionally, NotI, BlnI (syn. AvrII), and SpeI can be used. 50. High-quality enzymes are important to avoid unrestricted DNA because of too short restriction time and degraded DNA because of star activity of the enzyme. 51. Make sure that the bench surface is horizontal and that 1 mm distance is left between the platform in the casting stand and the comb. 52. Bubbles burst when touched with a pipette tip. Use gloves throughout handling during the electrophoresis process to avoid contamination of the agarose gel, electrophoresis buffer, and devices with DNAse. 53. After having solidified at room temperature, the gel may be stored at 4
C overnight when protected against desiccation in a plastic bag. 54. Bubbles can be avoided when the agarose gel is pipetted slowly with a small tip and the tip inserted at one side of the slot. 55. The initial milliampere (mAmp) value should be between 110 and 150 mAmp, otherwise the 0.5 TBE electrophoresis buffer has to be replaced. 56. Control the air bubbles that rise from each of the individual electrodes when the current is switched on. 57. The run time has to be adapted to the gel size and may vary also from laboratory to laboratory and, therefore, has to be evaluated individually.

74

Stefanie A. Barth et al.

58. We recommend the use of a high-fidelity, proofreading DNA polymerase for generating the DNA fragments to be sequenced. Taq DNA polymerase is a more error-prone DNA polymerase which has been applied for high-frequency, broad spectrum, random mutagenesis of gene-sized DNA sequences such as the 633 nucleotide crp gene encoding the catabolite gene activator protein using standard reaction conditions [149]. Any proofreading thermostable DNA polymerase can be used with its corresponding buffer system and incubation temperatures. 59. This can be done using any commercially available PCR purification kit. If unspecific amplicons are additionally visible, the desired PCR product should instead be excised from a preparative agarose gel. For gel extraction, prepare a 1.5% (w/v) agarose gel with 1 TAE buffer. Excise the band with a fresh scalpel blade using long-wave UVA light from a UV lamp or a transilluminator. The excised agarose fragment containing the PCR fragment can then be purified using a commercial agarose gel extraction kit. We routinely use gels with 150 mL agarose and let them run for 90–120 min at 100 V or until the bromophenol blue marker has reached the middle of the gel. We do not include ethidium bromide in the gel matrix, but rather stain the gel for 30 min in the dark with the ethidium bromide staining solution. Then destain for 15 min with ddH2O to improve the contrast. This is important because the DNA image brightness is strongly reduced in the long-wave UVA light (330–400 nm) that has to be used for excising the PCR product band from the gel to prevent DNA damage which would interfere with sequencing. 60. The adk MLST fragment is only separated by 3 or 5 nucleotides from the 30 -ends of the amplification primers. Here, it is important to sequence both strands of the PCR fragment to have all the sequence information required for analysis and assignment to a sequence type. For all other primer combinations, the distances between the 30 -end of the respective primer and the first or last nucleotide of the corresponding MLST classification sequence vary between 76 and 240 bps. Therefore, sequencing of a single strand should normally be sufficient to ensure a correct allele assignment. If the sequencing quality obtained is not sufficient, then the second strand can be submitted for sequencing or the PCR reaction repeated. 61. New alleles and new STs based on Sanger sequencing are not being assigned anymore by EnteroBase. If your sequence does not fall within one of the already existing sequence types, alternative sequence types very similar to your sequences will

STEC in Animals

75

be returned as a result. Short reads obtained by nextgeneration sequencing are now the basis for defining new alleles and STs. 62. Mitomycin C is used to induce the lytic cycle of intact stxencoding bacteriophages in the bacterial cell. The increased transcription of phage DNA includes the stx genes resulting in elevated amounts of Stx expressed by the bacterial cell to facilitate detection. 63. Perform all incubation steps in closed plastic containers with one or two layers of paper towels soaked with ddH2O to increase the humidity in the container. 64. Washing of the microtiter plates can be done using either multichannel pipettes, a mechanical or an automatic washer system. 65. To standardize the ELISA, Stx1 and Stx2 may be purchased (e.g., List Biological Labs Inc., Campbell, CA, USA, or Toxin Technologies Inc., Sarasota, FL, USA), diluted and used in the assay to construct a standard curve. 66. The Vero cell assay is suitable to detect the biological activity exerted by the Stx in samples suspected to contain the toxin. For confirmation that an stx-positive E. coli isolate expresses the gene, applying the Vero cell assay in a format allowing semiquantitative measurements is sufficient. Of note, bacterial cell lysates often contain substances not compatible with viability of eukaryotic cells in vitro. It is highly advisable to test such preparations in several log10 dilutions in triplicate using RPMI medium as a diluent. Only if cytopathic effects become visible after 96 h of incubation at a dilution of at least 1:10, the sample should be graded as positive. To quantitatively assess the potential of a given strain to produce Stx, determination of the precise cytotoxic dose [CD50/mL] of a preparation is required. Dilution series can be generated by log10 dilutions but log3 dilutions in triplicate using RPMI medium as a diluent give more accurate results. In order to save resources, pre-dilutions may be applied but have to be prepared by not more than 1:10 per dilution step. As the quantity of Stx produced varies between different strains and the Stx amount in the different cell fractions within one strain, the range of concentrations to be covered by the log3 dilution series may have to be determined individually. 67. Samples and controls are added in a final volume of 50 μL/well, the Vero cells in RPMI medium are added in 100 μL/well. At least two-thirds of the volume per well should consist of RPMI medium in order not to impair viability of the Vero cells.

76

Stefanie A. Barth et al.

68. All cell culture handlings have to be performed under sterile conditions in a biological safety cabinet to avoid contamination. 69. The 0.89% NaCl added in the marginal wells should prevent evaporation loss in the reaction wells during the incubation time of the test. 70. Add 50 μL of 1% SDS solution as a positive control only at the very end of the process to the microtiter plate, i.e., after addition of the cells, to avoid any carryover of the highly lytic SDS when using a multichannel pipette to spread out the cell suspension. 71. Samples and dilutions thereof may be placed into the microtiter plates at volumes of 50 μL per well of externally prepared dilution series. Instead, dilution series can be prepared in the microtiter plate, e.g., by placing a larger than 50 μL volume of the original sample in triplicate in wells in row B and transferring part of the volume into wells of row C, prefilled with diluent, mixing and transferring to the next row until the end of the plate is reached. A final volume of 50 μL must be present in all wells. 72. Vero cells passaged 2–30 times after thawing should be used for the test. After splitting, let the cells grow for 3–4 days before harvesting to perform a Vero cell assay. 73. Use an orbital shaker set to slow speed in order to prevent spill over and foaming. 74. Different protocols for dissolving the water-insoluble formazan crystals formed exist. When using 10% SDS solution without shaking, at least an overnight incubation is required to allow the crystals to dissolve. In wells with high viability (unaffected Vero cells), full dissolving of the crystals may not be reached. 75. Only one value above or below the intercept are included, if (a) the curve descends or the upper plateau has been reached after the ascent has been completed or (b) if curve rises before the end of the lower plateau phase. 76. The optimal multiplicity of infection (MOI; up to 200) has to be evaluated beforehand and may differ between individual pathovars, strains, serotypes and host cells. 77. Perform each test in duplicate (technical replicates) and three to five biological replicates. 78. Use 1 PBS and test medium pre-warmed to 37
C to avoid stressing the cells. 79. Combinations of different adhesion patterns can be observed for the same E. coli strain.

STEC in Animals

77

80. Permeabilization of the cells can also be done by incubation with 0.005% digitonin solution (0.005 g digitonin, ad 100 mL 1 PBS). Be aware that digitonin is a hazardous substance. Protect yourself while handling and dispose the waste in accordance with local and national regulations. 81. Make sure that the coverslip does not touch the wall of the well, otherwise the staining solution can run off and the staining result will be suboptimal. 82. Test each strain in quadruplicate (technical replicates) and 3–5 biological replicates. 83. Perform a log10 dilution series in 1 PBS by taking 100 μL of the respective culture compartment (supernatant, host-cell associated, or intracellular) in 900 μL 1 PBS. Vortex 10 s, change the tip of the pipette, and transfer 100 μL to the next 900 μL of 1 PBS. The number of dilutions needed depends on several factors (e.g., the compartment tested, the strain, the host cell, the infection dose) and has to be determined individually for each test. In compartments with low numbers of bacterial cells, plate 100 μL of the undiluted suspension and the first dilution step (s) on one sheep blood agar plate. After incubation (37
C, 18  2 h), enumerate those agar plates with 30–300 single, clearly definable colonies and calculate the bacterial load [cfu/mL compartment] ¼ number of colonies  dilution step  10. In compartments with high numbers of bacterial cells, spot 10 μL of each dilution step twice onto one side of a sheep blood agar plate and allow the drop to run over the plate in a straight line just up to the opposite edge by tilting the plate. You can test two dilution steps on one agar plate. After incubation (37
C, 18  2 h), enumerate those agar plates with approx. 10–100 single, clearly definable colonies and calculate the bacterial load [cfu/mL compartment] ¼ number of colonies  dilution step  10. 84. All pipetting steps should be performed under a PCR workstation using RNase away and UV light for decontamination of the surfaces as well as the air. While pipetting and handling of the samples wear gloves to avoid contamination. 85. To include the RNA preparation for further assays, the results of the photometric analysis must meet the following criteria: the ratio of the absorbance 260 nm and 280 nm has to be approx. A260/280 ¼ 2.0, the ratio of the absorbance 260 and 230 nm has to be approx. A260/230 ¼ 2.0–2.2.

78

Stefanie A. Barth et al.

References 1. Karmali MA (1989) Infection by verocytotoxin-producing Escherichia coli. Clin Microbiol Rev 2(1):15–38 2. Moxley RA (2004) Escherichia coli O157:H7: an update on intestinal colonization and virulence mechanisms. Anim Health Res Rev 5 (1):15–33. https://doi.org/10.1079/ ahr200463 3. Brooks JT, Sowers EG, Wells JG, Greene KD, Griffin PM, Hoekstra RM, Strockbine NA (2005) Non-O157 Shiga toxin-producing Escherichia coli infections in the United States, 1983–2002. J Infect Dis 192(8):1422–1429. https://doi.org/10.1086/466536 4. Luna-Gierke RE, Griffin PM, Gould LH, Herman K, Bopp CA, Strockbine N, Mody RK (2014) Outbreaks of non-O157 Shiga toxin-producing Escherichia coli infection: USA. Epidemiol Infect 142(11):2270–2280. https://doi.org/10.1017/ S0950268813003233 5. Baker CA, Rubinelli PM, Park SH, Carbonero F, Ricke SC (2016) Shiga toxinproducing Escherichia coli in food: incidence, ecology, and detection strategies. Food Control 59:407–419. https://doi.org/10.1016/ j.foodcont.2015.06.011 6. Tseng M, Fratamico PM, Manning SD, Funk JA (2014) Shiga toxin-producing Escherichia coli in swine: the public health perspective. Anim Health Res Rev 15(1):63–75. https:// doi.org/10.1017/S1466252313000170 7. Wieler LH, Franke S, Menge C, Rose M, Bauerfeind R, Karch H, Baljer G (1995) Untersuchungen zur Immunantwort bei der ¨ demkrankheit von Absetzferkeln mit einer O rekombinanten B-Untereinheit des Shigalike-Toxins-IIe. Dtsch Tier€arztl Wochenschr 102(1):40–43 8. Barth S, Schwanitz A, Bauerfeind R (2011) Polymerase chain reaction-based method for the typing of F18 fimbriae and distribution of F18 fimbrial subtypes among porcine Shiga toxin-encoding Escherichia coli in Germany. J Vet Diagn Investig 23(3):454–464. https:// doi.org/10.1177/1040638711403417 9. Frydendahl K, Kare Jensen T, Strodl Andersen J, Fredholm M, Evans G (2003) Association between the porcine Escherichia coli F18 receptor genotype and phenotype and susceptibility to colonisation and postweaning diarrhoea caused by E. coli O138: F18. Vet Microbiol 93(1):39–51 10. Beutin L, Kruger U, Krause G, Miko A, Martin A, Strauch E (2008) Evaluation of

major types of Shiga toxin 2e-producing Escherichia coli bacteria present in food, pigs, and the environment as potential pathogens for humans. Appl Environ Microbiol 74 (15):4806–4816. https://doi.org/10.1128/ Aem.00623-08 11. Barth S, Tscholchiew A, Menge C, Weiss R, Baljer G, Bauerfeind R (2007) Virulence and fitness gene patterns of Shiga toxin-encoding Escherichia coli isolated from pigs with edema disease or diarrhea in Germany. Berl Mu¨nch Tier€arztl Wochenschr 120(7–8):307–316 12. Gyles CL, Fairbrother JM (2010) Escherichia coli. In: Gyles CL, Prescott JF, Songer G, Thoen CO (eds) Pathogenesis of bacterial infections in animals, 4th edn. Blackwell Publishing, Ames, IA 13. Moxley RA (2000) Edema disease. Vet Clin North Am Food Anim Pract 16(1):175–185 14. Osek J (1999) Prevalence of virulence factors of Escherichia coli strains isolated from diarrheic and healthy piglets after weaning. Vet Microbiol 68(3–4):209–217 15. Wray C, Woodward MJ (1997) Escherichia coli infections in farm animals. In: Sussmann M (ed) Escherichia coli – mechanisms of virulence. Cambridge University Press, Cambridge, pp 95–104 16. Fairbrother JM, Nadeau E (2019) Colibacillosis. In: Zimmerman JJ, Karriker LA, Ramirez A, Schwartz KJ, Stevenson GW, Zhang J (eds) Diseases of swine, 11th edn. Wiley-Blackwell, Hoboken, NJ, pp 807–834 17. Gyles CL (2020) Overview of edema disease. Merck Sharp and Dohme Corp, Kenilworth, NJ. https://www.msdvetmanual.com. Accessed 28 Jan 2020 18. Bertschinger HU, Nief V, Tsch€ape H (2000) Active oral immunization of suckling piglets to prevent colonization after weaning by enterotoxigenic Escherichia coli with fimbriae F18. Vet Microbiol 71(3–4):255–267 19. Nadeau E´, Fairbrother JM, Zentek J, Be´langer L, Tremblay D, Tremblay CL, Rohe I, Vahjen W, Brunelle M, Hellmann K, Cveji D, Brunner B, Schneider C, Bauer K, Wolf R, Hidalgo A (2017) Efficacy of a single oral dose of a live bivalent E. coli vaccine against post-weaning diarrhea due to F4 and F18-positive enterotoxigenic E. coli. Vet J 226:32–39. https://doi.org/10.1016/j.tvjl. 2017.07.004 20. Bosworth BT, Samuel JE, Moon HW, O’Brien AD, Gordon VM, Whipp SC (1996) Vaccination with genetically modified

STEC in Animals Shiga-like toxin IIe prevents edema disease in swine. Infect Immun 64(1):55–60 21. EMA (2020) European Medicines Agency. https://www.ema.europa.eu. Accessed 25 Jan 2020 22. Geue L, Segura-Alvarez M, Conraths FJ, Kuczius T, Bockemu¨hl J, Karch H, Gallien P (2002) A long-term study on the prevalence of Shiga toxin-producing Escherichia coli (STEC) on four German cattle farms. Epidemiol Infect 129(1):173–185 23. Besser TE, Richards BL, Rice DH, Hancock DD (2001) Escherichia coli O157:H7 infection of calves: infectious dose and direct contact transmission. Epidemiol Infect 127 (3):555–560 24. Grauke LJ, Kudva IT, Yoon JW, Hunt CW, Williams CJ, Hovde CJ (2002) Gastrointestinal tract location of Escherichia coli O157:H7 in ruminants. Appl Environ Microbiol 68 (5):2269–2277 25. Geue L, Segura-Alvarez M, Conraths FJ, Kuczius T, Bockemuhl J, Karch H, Gallien P (2002) A long-term study on the prevalence of shiga toxin-producing Escherichia coli (STEC) on four German cattle farms. Epidemiol Infect 129(1):173–185 26. Naylor SW, Low JC, Besser TE, Mahajan A, Gunn GJ, Pearce MC, McKendrick IJ, Smith DG, Gally DL (2003) Lymphoid follicledense mucosa at the terminal rectum is the principal site of colonization of enterohemorrhagic Escherichia coli O157:H7 in the bovine host. Infect Immun 71(3):1505–1512 27. Pohlenz JF, Dean-Nystrom EA (2004) Colonisation of Escherichia coli O157:H7 on squamous epithelial cells at the rectal-anal junction. Vet Rec 155(8):248 28. Stevens MP, van Diemen PM, Dziva F, Jones PW, Wallis TS (2002) Options for the control of enterohaemorrhagic Escherichia coli in ruminants. Microbiology 148 (Pt 12):3767–3778 29. Shaw DJ, Jenkins C, Pearce MC, Cheasty T, Gunn GJ, Dougan G, Smith HR, Woolhouse ME, Frankel G (2004) Shedding patterns of verocytotoxin-producing Escherichia coli strains in a cohort of calves and their dams on a Scottish beef farm. Appl Environ Microbiol 70(12):7456–7465 30. Moxley RA, Francis DH (1986) Natural and experimental infection with an attaching and effacing strain of Escherichia coli in calves. Infect Immun 53(2):339–346. https://doi. org/10.1128/Iai.53.2.339-346.1986 31. Janke BH, Francis DH, Collins JE, Libal MC, Zeman DH, Johnson DD, Neiger RD (1990) Attaching and effacing Escherichia coli

79

infection as a cause of diarrhea in young calves. J Am Vet Med Assoc 196(6):897–901 32. Smith DG, Naylor SW, Gally DL (2002) Consequences of EHEC colonisation in humans and cattle. Int J Med Microbiol 292 (3–4):169–183 33. Jonsson ME, Aspan A, Eriksson E, Vagsholm I (2001) Persistence of verocytotoxinproducing Escherichia coli O157:H7 in calves kept on pasture and in calves kept indoors during the summer months in a Swedish dairy herd. Int J Food Microbiol 66 (1–2):55–61 34. Liebana E, Smith RP, Batchelor M, McLaren I, Cassar C, Clifton-Hadley FA, Paiba GA (2005) Persistence of Escherichia coli O157 isolates on bovine farms in England and Wales. J Clin Microbiol 43(2):898–902. https://doi.org/10.1128/JCM.43.2.898902.2005 35. Cray WC Jr, Moon HW (1995) Experimental infection of calves and adult cattle with Escherichia coli O157:H7. Appl Environ Microbiol 61(4):1586–1590 36. Pirro F, Wieler LH, Failing K, Bauerfeind R, Baljer G (1995) Neutralizing antibodies against Shiga-like toxins from Escherichia coli in colostra and sera of cattle. Vet Microbiol 43 (2–3):131–141 37. Hoffman MA, Menge C, Casey TA, Laegreid W, Bosworth BT, Dean-Nystrom EA (2006) Bovine immune response to shiga-toxigenic Escherichia coli O157:H7. Clin Vaccine Immunol 13(12):1322–1327. https://doi.org/10.1128/CVI.00205-06 38. Matthews L, McKendrick IJ, Ternent H, Gunn GJ, Synge B, Woolhouse ME (2006) Super-shedding cattle and the transmission dynamics of Escherichia coli O157. Epidemiol Infect 134(1):131–142. https://doi.org/10. 1017/S0950268805004590 39. Robinson SE, Brown PE, Wright EJ, Hart CA, French NP (2009) Quantifying withinand between-animal variation and uncertainty associated with counts of Escherichia coli O157 occurring in naturally infected cattle faeces. J R Soc Interface 6(31):169–177. https://doi.org/10.1098/rsif.2008.0183 40. Matthews L, Reeve R, Gally DL, Low JC, Woolhouse ME, McAteer SP, Locking ME, Chase-Topping ME, Haydon DT, Allison LJ, Hanson MF, Gunn GJ, Reid SW (2013) Predicting the public health benefit of vaccinating cattle against Escherichia coli O157. Proc Natl Acad Sci U S A 110(40):16265–16270. https://doi.org/10.1073/pnas. 1304978110

80

Stefanie A. Barth et al.

41. EFSA and ECDC (European Food Safety Authority and European Centre for Disease Prevention and Control) (2019) The European Union one health 2018 zoonoses report. EFSA J 17(12):5926. https://doi. org/10.2903/j.efsa.2019.5926 42. Rashid RA, Tabata TA, Oatley MJ, Besser TE, Tarr PI, Moseley SL (2006) Expression of putative virulence factors of Escherichia coli O157:H7 differs in bovine and human infections. Infect Immun 74(7):4142–4148. https://doi.org/10.1128/IAI.00299-06 43. Ritchie JM, Wagner PL, Acheson DW, Waldor MK (2003) Comparison of Shiga toxin production by hemolytic-uremic syndrome-associated and bovine-associated Shiga toxinproducing Escherichia coli isolates. Appl Environ Microbiol 69(2):1059–1066. https:// doi.org/10.1128/aem.69.2.1059-1066. 2003 44. Lejeune JT, Abedon ST, Takemura K, Christie NP, Sreevatsan S (2004) Human Escherichia coli O157:H7 genetic marker in isolates of bovine origin. Emerg Infect Dis 10 (8):1482–1485. https://doi.org/10.3201/ eid1008.030784 45. Lupolova N, Dallman TJ, Matthews L, Bono JL, Gally DL (2016) Support vector machine applied to predict the zoonotic potential of E. coli O157 cattle isolates. Proc Natl Acad Sci U S A 113(40):11312–11317. https:// doi.org/10.1073/pnas.1606567113 46. Bielaszewska M, Mellmann A, Zhang W, Kock R, Fruth A, Bauwens A, Peters G, Karch H (2011) Characterisation of the Escherichia coli strain associated with an outbreak of haemolytic uraemic syndrome in Germany, 2011: a microbiological study. Lancet Infect Dis 11(9):671–676. https://doi. org/10.1016/S1473-3099(11)70165-7 47. Rasko DA, Webster DR, Sahl JW, Bashir A, Boisen N, Scheutz F, Paxinos EE, Sebra R, Chin CS, Iliopoulos D, Klammer A, Peluso P, Lee L, Kislyuk AO, Bullard J, Kasarskis A, Wang S, Eid J, Rank D, Redman JC, Steyert SR, Frimodt-Moller J, Struve C, Petersen AM, Krogfelt KA, Nataro JP, Schadt EE, Waldor MK (2011) Origins of the E. coli strain causing an outbreak of hemolytic-uremic syndrome in Germany. N Engl J Med 365 (8):709–717. https://doi.org/10.1056/ NEJMoa1106920 48. Stalb S, Barth SA, Sobotta K, LieblerTenorio E, Geue L, Menge C (2018) Pro-inflammatory capacity of Escherichia coli O104:H4 outbreak strain during colonization of intestinal epithelial cells from human and cattle. Int J Med Microbiol 308

(7):899–911. https://doi.org/10.1016/j. ijmm.2018.06.003 49. Hamm K, Barth SA, Stalb S, Geue L, LieblerTenorio E, Teifke JP, Lange E, Tauscher K, Kotterba G, Bielaszewska M, Karch H, Menge C (2016) Experimental infection of calves with Escherichia coli O104:H4 outbreak strain. Sci Rep 6. https://doi.org/10.1038/ srep32812 50. Cabal A, Geue L, Gomez-Barrero S, Barth S, Barcena C, Hamm K, Porrero MC, Valverde A, Canton R, Menge C, Gortazar C, Dominguez L, Alvarez J (2015) Detection of virulence-associated genes characteristic of intestinal Escherichia coli pathotypes, including the enterohemorrhagic/ enteroaggregative O104:H4 in bovines from Germany and Spain. Microbiol Immunol. https://doi.org/10.1111/1348-0421. 12275 51. Arimizu Y, Kirino Y, Sato MP, Uno K, Sato T, Gotoh Y, Auvray F, Brugere H, Oswald E, Mainil JG, Anklam KS, Dopfer D, Yoshino S, Ooka T, Tanizawa Y, Nakamura Y, Iguchi A, Morita-Ishihara T, Ohnishi M, Akashi K, Hayashi T, Ogura Y (2019) Large-scale genome analysis of bovine commensal Escherichia coli reveals that bovine-adapted E. coli lineages are serving as evolutionary sources of the emergence of human intestinal pathogenic strains. Genome Res 29(9):1495–1505. https://doi.org/10. 1101/gr.249268.119 52. Nataro JP, Kaper JB (1998) Diarrheagenic Escherichia coli. Clin Microbiol Rev 11 (1):142–201 53. Sonntag AK, Bielaszewska M, Mellmann A, Dierksen N, Schierack P, Wieler LH, Schmidt MA, Karch H (2005) Shiga toxin 2e-producing Escherichia coli isolates from humans and pigs differ in their virulence profiles and interactions with intestinal epithelial cells. Appl Environ Microbiol 71 (12):8855–8863 54. Mundy R, Schuller S, Girard F, Fairbrother JM, Phillips AD, Frankel G (2007) Functional studies of intimin in vivo and ex vivo: implications for host specificity and tissue tropism. Microbiology 153(Pt 4):959–967. https:// doi.org/10.1099/mic.0.2006/003467-0 55. Stamm I, Mohr M, Bridger PS, Schro¨pfer E, Ko¨nig M, Stoffregen WC, Dean-Nystrom EA, Baljer G, Menge C (2008) Epithelial and mesenchymal cells in the bovine colonic mucosa differ in their responsiveness to Escherichia coli Shiga toxin 1. Infect Immun 76 (11):5381–5391

STEC in Animals 56. Sansonetti PJ (2004) War and peace at mucosal surfaces. Nat Rev Immunol 4 (12):953–964 57. Schmidt N, Barth SA, Frahm J, Meyer U, Danicke S, Geue L, Menge C (2018) Decreased STEC shedding by cattle following passive and active vaccination based on recombinant Escherichia coli Shiga toxoids. Vet Res 49. https://doi.org/10.1186/ s13567-018-0523-0 58. Fro¨hlich J, Baljer G, Menge C (2009) Maternally and naturally acquired antibodies to Shiga toxins in a cohort of calves shedding Shiga-toxigenic Escherichia coli. Appl Environ Microbiol 75(11):3695–3704 59. Segura-Alvarez M, Richter H, Conraths FJ, Geue L (2003) Evaluation of enzyme-linked immunosorbent assays and a PCR test for detection of shiga toxins for shiga toxinproducing Escherichia coli in cattle herds. J Clin Microbiol 41(12):5760–5763 60. Clinical and Laboratory Standards Institute (CLSI) (2018) Performance standards for antimicrobial disk and dilution susceptibility tests for bacteria isolated from animals. CLSI standard VET01, 5th edn. Clinical and Laboratory Standards Institute, Pittsburgh, PA 61. Bridger PS, Mohr M, Stamm I, Fro¨hlich J, Follmann W, Birkner S, Metcalfe H, Werling D, Baljer G, Menge C (2010) Primary bovine colonic cells: a model to study strain-specific responses to Escherichia coli. Vet Immunol Immunopathol 137 (1–2):54–63. https://doi.org/10.1016/j. vetimm.2010.04.010 62. Cray WC Jr, Moon HW (1995) Experimental infection of calves and adult cattle with Escherichia coli O157:H7. Appl Environ Microbiol 61(4):1586–1590 63. Lee MS, Koo S, Jeong DG, Tesh VL (2016) Shiga toxins as multi-functional proteins: induction of host cellular stress responses, role in pathogenesis and therapeutic applications. Toxins 8(3). https://doi.org/10. 3390/toxins8030077 64. Matthias D (1969) Investigations on localisation of beta-hemolytic E. coli in several organs of swine with edema disease. Zentbl Bakteriolog 212(1):103 65. Menge C (2020) Molecular biology of Escherichia coli Shiga toxins’ effects on mammalian cells. Toxins 12(5). https://doi.org/10. 3390/toxins12050345 66. Lee MS, Tesh VL (2019) Roles of Shiga toxins in immunopathology. Toxins 11(4). https://doi.org/10.3390/toxins11040212 67. Barth SA, Menge C, Eichhorn I, Semmler T, Wieler LH, Pickard D, Belka A, Berens C,

81

Geue L (2016) The accessory genome of Shiga toxin-producing Escherichia coli defines a persistent colonization type in cattle. Appl Environ Microbiol 82(17):5455–5464. https://doi.org/10.1128/AEM.00909-16 68. Kaper JB (1998) The locus of enterocyte effacement pathogenicity island of shiga toxin-producing Escherichia coli O157:H7 and other attaching and effacing E. coli. Jpn J Med Sci Biol 51:S101–S107. https://doi. org/10.7883/yoken1952.51.Supplement1_ S101 69. Monteiro R, Ageorges V, Rojas-Lopez M, Schmidt H, Weiss A, Bertin Y, Forano E, Jubelin G, Henderson IR, Livrelli V, Gobert AP, Rosini R, Soriani M, Desvaux M (2016) A secretome view of colonisation factors in Shiga toxin-encoding Escherichia coli (STEC): from enterohaemorrhagic E. coli (EHEC) to related enteropathotypes. FEMS Microbiol Lett 363(16). https://doi.org/10. 1093/femsle/fnw179 70. Hazen TH, Michalski J, Luo Q, Shetty AC, Daugherty SC, Fleckenstein JM, Rasko DA (2017) Comparative genomics and transcriptomics of Escherichia coli isolates carrying virulence factors of both enteropathogenic and enterotoxigenic E. coli. Sci Rep 7(1):3513. https://doi.org/10.1038/s41598-01703489-z 71. Soysal N, Mariani-Kurkdjian P, Smail Y, Liguori S, Gouali M, Loukiadis E, Fach P, Bruyand M, Blanco J, Bidet P, Bonacorsi S (2016) Enterohemorrhagic Escherichia coli hybrid pathotype O80:H2 as a new therapeutic challenge. Emerg Infect Dis 22 (9):1604–1612. https://doi.org/10.3201/ eid2209.160304 72. Vygen-Bonnet S, Rosner B, Wilking H, Fruth A, Prager R, Kossow A, Lang C, Simon S, Seidel J, Faber M, Schielke A, Michaelis K, Holzer A, Kamphausen R, Kalhofer D, Thole S, Mellmann A, Flieger A, Stark K (2017) Ongoing haemolytic uraemic syndrome (HUS) outbreak caused by sorbitol-fermenting (SF) Shiga toxinproducing Escherichia coli (STEC) O157, Germany, December 2016 to May 2017. Euro Surveill 22(21). https://doi.org/10. 2807/1560-7917.ES.2017.22.21.30541 73. Scallan E, Hoekstra RM, Angulo FJ, Tauxe RV, Widdowson MA, Roy SL, Jones JL, Griffin PM (2011) Foodborne illness acquired in the United States—major pathogens. Emerg Infect Dis 17(1):7–15. https://doi.org/10. 3201/eid1701.P11101 74. Zweifel C, Schumacher S, Beutin L, Blanco J, Stephan R (2006) Virulence profiles of Shiga

82

Stefanie A. Barth et al.

toxin 2e-producing Escherichia coli isolated from healthy pig at slaughter. Vet Microbiol 117(2–4):328–332. https://doi.org/10. 1016/j.vetmic.2006.06.017 75. Wieler LH, Tigges M, Ebel F, Schaferkordt S, Djafari S, Schlapp T, Baljer G, Chakraborty T (1996) The enterohemolysin phenotype of bovine Shiga-like toxin-producing Escherichia coli (SLTEC) is encoded by the EHEChemolysin gene. Vet Microbiol 52 (1–2):153–164 76. Wieler LH, Bauerfeind R, Baljer G (1992) Characterization of Shiga-like toxin producing Escherichia coli (SLTEC) isolated from calves with and without diarrhoea. Zentralbl Bakteriol [Orig] 276(2):243–253 77. Wieler LH, Bauerfeind R, Weiß R, Pirro F, Baljer G (1995) Association of enterohemolysin and non-fermentation of rhamnose and sucrose with Shiga-like toxin genes in Escherichia coli from calves. Zentralbl Bakteriol [Orig] 282(3):265–274 78. Beutin L, Montenegro MA, Ørskov I, Ørskov F, Prada J, Zimmermann S, Stephan R (1989) Close association of verotoxin (Shiga-like toxin) production with enterohemolysin production in strains of Escherichia coli. J Clin Microbiol 27(11):2559–2564 79. Mainil JG, Fairbrother JM (2014) Pathogenic Escherichia coli in domestic mammals and birds. In: Morabito S (ed) Pathogenic Escherichia coli – molecular and cellular microbiology. caister. Academic, Norfolk, pp 19–43 80. Bertschinger HU, Pohlenz J (1983) Bacterial colonization and morphology of the intestine in porcine Escherichia coli enterotoxemia (edema disease). Vet Pathol 20(1):99–110 81. Luppi A (2017) Swine enteric colibacillosis: diagnosis, therapy and antimicrobial resistance. Porcine Health Manag 3:16. https:// doi.org/10.1186/s40813-017-0063-4 82. Pedersen KS, Okholm E, Johansen M, Angen O, Jorsal SE, Nielsen JP, Baekbo P (2015) Clinical utility and performance of sock sampling in weaner pig diarrhoea. Prev Vet Med 120(3–4):313–320. https://doi. org/10.1016/j.prevetmed.2015.04.015 83. Bjustrom-Kraft J, Christopher-Hennings J, Daly R, Main R, Torrison J, Thurn M, Zimmerman J (2018) The use of oral fluid diagnostics in swine medicine. J Swine Health Prod 26(5):262–269 84. Wieler LH, Bauerfeind R (2003) STEC as a veterinary problem. Diagnostics and prophylaxis in animals. Methods Mol Med 73:75–89 85. Casey TA, Bosworth BT (2009) Design and evaluation of a multiplex polymerase chain

reaction assay for the simultaneous identification of genes for nine different virulence factors associated with Escherichia coli that cause diarrhea and edema disease in swine. J Vet Diagn Investig 21(1):25–30 86. Kaper JB, O’Brien AD (2014) Overview and historical perspectives. Microbiol Spectr 2(6). https://doi.org/10.1128/microbiolspec. EHEC-0028-2014 87. Scheutz F, Teel LD, Beutin L, Pierard D, Buvens G, Karch H, Mellmann A, Caprioli A, Tozzoli R, Morabito S, Strockbine NA, Melton-Celsa AR, Sanchez M, Persson S, O’Brien AD (2012) Multicenter evaluation of a sequence-based protocol for subtyping Shiga toxins and standardizing Stx nomenclature. J Clin Microbiol 50(9):2951–2963. https://doi.org/10.1128/JCM.00860-12 88. Blanco M, Blanco JE, Blanco J, Gonzalez EA, Alonso MP, Maas H, Jansen WH (1996) Prevalence and characteristics of human and bovine verotoxigenic Escherichia coli strains isolated in Galicia (north-western Spain). Eur J Epidemiol 12(1):13–19. https://doi. org/10.1007/BF00144422 89. Blanco M, Blanco JE, Blanco J, Mora A, Prado C, Alonso MP, Mourino M, Madrid C, Balsalobre C, Juarez A (1997) Distribution and characterization of faecal verotoxin-producing Escherichia coli (VTEC) isolated from healthy cattle. Vet Microbiol 54 (3–4):309–319. https://doi.org/10.1016/ s0378-1135(96)01292-8 90. Richter H, Klie H, Timm M, Gallien P, Steinru¨ck H, Perlberg KW, Protz D (1997) Verotoxin-bildende E coli (VTEC) im Kot von Schlachtrindern aus Deutschland Berl Mu¨nch. Tier€arztl Wochenschr 110 (4):121–127 91. Weber A, Klie H, Richter H, Gallien P, Timm M, Perlberg KW (1997) Uber die derzeitigen Probleme zum Auffinden von Infektionsquellen und Infektionsketten beim enterohamorrhagischen E coli (EHEC) Berl Mu¨nch. Tier€arztl Wochenschr 110 (6):211–213 92. Ball HJ, Finlay D, Burns L, Mackie DP (1994) Application of monoclonal antibodybased sandwich ELISAs to detect verotoxins in cattle faeces. Res Vet Sci 57(2):225–232. https://doi.org/10.1016/0034-5288(94) 90062-0 93. Heuvelink AE, van den Biggelaar FL, Zwartkruis-Nahuis J, Herbes RG, Huyben R, Nagelkerke N, Melchers WJ, Monnens LA, de Boer E (1998) Occurrence of verocytotoxin-producing Escherichia coli

STEC in Animals O157 on Dutch dairy farms. J Clin Microbiol 36(12):3480–3487 94. Callaway TR, Carr MA, Edrington TS, Anderson RC, Nisbet DJ (2009) Diet, Escherichia coli O157:H7, and cattle: a review after 10 years. Curr Issues Mol Biol 11(2):67–79 95. Kudva IT, Hatfield PG, Hovde CJ (1995) Effect of diet on the shedding of Escherichia coli O157:H7 in a sheep model. Appl Environ Microbiol 61(4):1363–1370 96. Aslam M, Stanford K, McAllister TA (2010) Characterization of antimicrobial resistance and seasonal prevalence of Escherichia coli O157:H7 recovered from commercial feedlots in Alberta, Canada. Lett Appl Microbiol 50(3):320–326. https://doi.org/10.1111/j. 1472-765X.2010.02798.x 97. Schneider LG, Lewis GL, Moxley RA, Smith DR (2018) A four-season longitudinal study of enterohaemorrhagic Escherichia coli in beef cow-calf herds in Mississippi and Nebraska. Zoonoses Public Health 65(5):552–559. https://doi.org/10.1111/zph.12465 98. Stanford K, Reuter T, Bach SJ, Chui L, Ma A, Conrad CC, Tostes R, McAllister TA (2017) Effect of severe weather events on the shedding of Shiga toxigenic Escherichia coli in slaughter cattle and phenotype of serogroup O157 isolates. FEMS Microbiol Ecol 93(9). https://doi.org/10.1093/femsec/fix098 99. McPherson AS, Dhungyel OP, Ward MP (2015) Comparison of recto-anal mucosal swab and faecal culture for the detection of Escherichia coli O157 and identification of super-shedding in a mob of Merino sheep. Epidemiol Infect 143(13):2733–2742. https://doi.org/10.1017/ S0950268815000011 100. ISO TS 13136:2012 (revised 2019) Microbiology of food and animal feed – real-time polymerase chain reaction (PCR)-based method for the detection of food-borne pathogens – horizontal method for the detection of Shiga toxin-producing Escherichia coli (STEC) and the determination of O157, O111, O26, O103 and O145 serogroups 101. Gunn GJ, McKendrick IJ, Ternent HE, Thomson-Carter F, Foster G, Synge BA (2007) An investigation of factors associated with the prevalence of verocytotoxin producing Escherichia coli O157 shedding in Scottish beef cattle. Vet J 174(3):554–564. https://doi.org/10.1016/j.tvjl.2007.08. 024 102. Pearce MC, Chase-Topping ME, McKendrick IJ, Mellor DJ, Locking ME, Allison L, Ternent HE, Matthews L, Knight HI, Smith AW, Synge BA, Reilly W, Low JC, Reid SW, Gunn

83

GJ, Woolhouse ME (2009) Temporal and spatial patterns of bovine Escherichia coli O157 prevalence and comparison of temporal changes in the patterns of phage types associated with bovine shedding and human E. coli O157 cases in Scotland between 1998–2000 and 2002–2004. BMC Microbiol 9:276. https://doi.org/10.1186/14712180-9-276 103. Paiba GA, Wilesmith JW, Evans SJ, Pascoe SJ, Smith RP, Kidd SA, Ryan JB, McLaren IM, Chappell SA, Willshaw GA, Cheasty T, French NP, Jones TW, Buchanan HF, Challoner DJ, Colloff AD, Cranwell MP, Daniel RG, Davies IH, Duff JP, Hogg RA, Kirby FD, Millar MF, Monies RJ, Nicholls MJ, Payne JH (2003) Prevalence of faecal excretion of verocytotoxigenic Escherichia coli O157 in cattle in England and Wales. Vet Rec 153(12):347–353. https://doi.org/10. 1136/vr.153.12.347 104. Ellis-Iversen J, Smith RP, Snow LC, Watson E, Millar MF, Pritchard GC, Sayers AR, Cook AJ, Evans SJ, Paiba GA (2007) Identification of management risk factors for VTEC O157 in young-stock in England and Wales. Prev Vet Med 82(1–2):29–41. https:// doi.org/10.1016/j.prevetmed.2007.05.004 105. Henry MK, Tongue SC, Evans J, Webster C, Mc KI, Morgan M, Willett A, Reeves A, Humphry RW, Gally DL, Gunn GJ, ChaseTopping ME (2017) British Escherichia coli O157 in cattle study (BECS): to determine the prevalence of E. coli O157 in herds with cattle destined for the food chain. Epidemiol Infect 145(15):3168–3179. https://doi.org/ 10.1017/S0950268817002151 106. Stephens TP, McAllister TA, Stanford K (2008) Development of an experimental model to assess the ability of Escherichia coli O157:H7-inoculated fecal pats to mimic a super shedder within a feedlot environment. J Food Prot 71(3):648–652. https://doi. org/10.4315/0362-028x-71.3.648 107. Halliday JE, Chase-Topping ME, Pearce MC, McKendrick IJ, Allison L, Fenlon D, Low C, Mellor DJ, Gunn GJ, Woolhouse ME (2006) Herd-level risk factors associated with the presence of phage type 21/28 E coli O157 on Scottish cattle farms. BMC Microbiol 6:99. https://doi.org/10.1186/14712180-6-99 108. Chase-Topping ME, McKendrick IJ, Pearce MC, MacDonald P, Matthews L, Halliday J, Allison L, Fenlon D, Low JC, Gunn G, Woolhouse ME (2007) Risk factors for the presence of high-level shedders of Escherichia coli O157 on Scottish farms. J Clin Microbiol 45

84

Stefanie A. Barth et al.

(5):1594–1603. https://doi.org/10.1128/ JCM.01690-06 109. Dixon A, Cernicchiaro N, Amachawadi RG, Shi X, Cull CA, Renter DG (2020) Longitudinal characterization of prevalence and concentration of Shiga toxin-producing Escherichia coli serogroups in feces of individual feedlot cattle. Foodborne Pathog Dis. https://doi.org/10.1089/fpd.2019.2777 110. Stanford K, Stephens TP, McAllister TA (2011) Use of model super-shedders to define the role of pen floor and hide contamination in the transmission of Escherichia coli O157: H7. J Anim Sci 89(1):237–244. https://doi. org/10.2527/jas.2010-3088 111. Wang GD, Zhao T, Doyle MP (1996) Fate of enterohemorrhagic Escherichia coli O157:H7 in bovine feces. Appl Environ Microbiol 62 (7):2567–2570. https://doi.org/10.1128/ Aem.62.7.2567-2570.1996 112. Arthur TM, Nou XW, Kalchayanand N, Bosilevac JM, Wheeler T, Koohmaraie M (2011) Survival of Escherichia coli O157:H7 on cattle hides. Appl Environ Microbiol 77 (9):3002–3008. https://doi.org/10.1128/ Aem.02238-10 113. Smith DR, Moxley RA, Clowser SL, Folmer JD, Hinkley S, Erickson GE, Klopfenstein TJ (2005) Use of rope devices to describe and explain the feedlot ecology of Escherichia coli O157:H7 by time and place. Foodborne Pathog Dis 2(1):50–60. https://doi.org/10. 1089/fpd.2005.2.50 114. Hahn N, Failing K, Eisenberg T, Schlez K, Zschock PM, Donat K, Einax E, Kohler H (2017) Evaluation of different diagnostic methods for the detection of Mycobcterium avium subsp. paratuberculosis in boot swabs and liquid manure samples. BMC Vet Res 13 (1):259. https://doi.org/10.1186/s12917017-1173-6 115. Roschanski N, Friese A, von SalviatiClaudius C, Hering J, Kaesbohrer A, Kreienbrock L, Roesler U (2017) Prevalence of carbapenemase producing Enterobacteriaceae isolated from German pig-fattening farms during the years 2011–2013. Vet Microbiol 200:124–129. https://doi.org/ 10.1016/j.vetmic.2015.11.030 116. Eisenberg T, Wolter W, Lenz M, Schlez K, Zschock M (2013) Boot swabs to collect environmental samples from common locations in dairy herds for Mycobacterium avium ssp. paratuberculosis (MAP) detection. J Dairy Res 80(4):485–489. https://doi.org/ 10.1017/S002202991300040X 117. Donat K, Hahn N, Eisenberg T, Schlez K, Kohler H, Wolter W, Rohde M, Putzschel R,

Rosler U, Failing K, Zschock PM (2016) Within-herd prevalence thresholds for the detection of Mycobacterium avium subspecies paratuberculosis-positive dairy herds using boot swabs and liquid manure samples. Epidemiol Infect 144(2):413–424. https://doi. org/10.1017/S0950268815000977 118. Stanford K, Bach SJ, Marx TH, Jones S, Hansen JR, Wallins GL, Zahiroddini H, McAllister TA (2005) Monitoring Escherichia coli O157:H7 in inoculated and naturally colonized feedlot cattle and their environment. J Food Prot 68(1):26–33. https://doi.org/10. 4315/0362-028x-68.1.26 119. Barth S, Duncker S, Hempe J, Breves G, Baljer G, Bauerfeind R (2009) Escherichia coli Nissle 1917 for probiotic use in piglets: evidence for intestinal colonization. J Appl Microbiol 107(5):1697–1710. https://doi. org/10.1111/j.1365-2672.2009.04361.x 120. Conrad CC, Stanford K, Narvaez-Bravo C, Callaway T, McAllister T (2017) Farm fairs and petting zoos: a review of animal contact as a source of zoonotic enteric disease. Foodborne Pathog Dis 14(2):59–73. https://doi. org/10.1089/fpd.2016.2185 121. Chase-Topping ME, Rosser T, Allison LJ, Courcier E, Evans J, McKendrick IJ, Pearce MC, Handel I, Caprioli A, Karch H, Hanson MF, Pollock KG, Locking ME, Woolhouse ME, Matthews L, Low JC, Gally DL (2012) Pathogenic potential to humans of bovine Escherichia coli O26, Scotland. Emerg Infect Dis 18(3):439–448. https://doi.org/10. 3201/eid1803.111236 122. Sharma R, Stanford K, Louie M, Munns K, John SJ, Zhang YX, Gannon V, Chui L, Read R, Topp E, McAllister T (2009) Escherichia coli O157:H7 lineages in healthy beef and dairy cattle and clinical human cases in Alberta, Canada. J Food Prot 72 (3):601–607. https://doi.org/10.4315/ 0362-028x-72.3.601 123. Tostes R, Goji N, Amoako K, Chui L, Kastelic J, DeVinney R, Stanford K, Reuter T (2017) Subtyping Escherichia coli virulence genes isolated from feces of beef cattle and clinical cases in Alberta. Foodborne Pathog Dis 14(1):35–42. https://doi.org/10. 1089/fpd.2016.2199 124. Smith KE, Stenzel SA, Bender JB, Wagstrom E, Soderlund D, Leano FT, Taylor CM, Belle-Isle PA, Danila R (2004) Outbreaks of enteric infections caused by multiple pathogens associated with calves at a farm day camp. Pediatr Infect Dis J 23 (12):1098–1104. https://doi.org/10.1097/ 01.inf.0000145409.74116.e5

STEC in Animals 125. Barth S, Geue L, Hinsching A, Jenckel M, Schlosser J, Eiden M, Pietschmann J, Menge C, Beer M, Groschup M, Jori F, Etter E, Blome S (2017) Experimental evaluation of faecal Escherichia coli and hepatitis E virus as biological indicators of contacts between domestic pigs and Eurasian wild boar. Transbound Emerg Dis 64 (2):487–494. https://doi.org/10.1111/ tbed.12389 126. Geue L, Klare S, Schnick C, Mintel B, Meyer K, Conraths FJ (2009) Analysis of the clonal relationship of serotype O26:H11 enterohemorrhagic Escherichia coli isolates from cattle. Appl Environ Microbiol 75 (21):6947–6953. https://doi.org/10.1128/ AEM.00605-09 127. Treacy J, Jenkins C, Paranthaman K, Jorgensen F, Mueller-Dobliess D, Anjum M, Kaindama L, Hartman H, Kirchner M, Carson T, Kar-Purkayastha I (2019) Outbreak of Shiga toxin-producing Escherichia coli O157:H7 linked to raw drinking milk resolved by rapid application of advanced pathogen characterisation methods, England, August to October 2017. Euro Surveill 24 (16):7–13. https://doi.org/10.2807/15607917.Es.2019.24.16.1800191 128. Hussein HS, Sakuma T (2005) Prevalence of shiga toxin-producing Escherichia coli in dairy cattle and their products. J Dairy Sci 88 (2):450–465 129. Menrath A, Wieler LH, Heidemanns K, Semmler T, Fruth A, Kemper N (2010) Shiga toxin producing Escherichia coli: identification of non-O157:H7-super-shedding cows and related risk factors. Gut Pathogens 2. https://doi.org/10.1186/1757-4749-27 130. Naylor SW, Gally DL, Low JC (2005) Enterohaemorrhagic E. coli in veterinary medicine. Int J Med Microbiol 295(6–7):419–441 131. Caprioli A, Morabito S, Brugere H, Oswald E (2005) Enterohaemorrhagic Escherichia coli: emerging issues on virulence and modes of transmission. Vet Res 36(3):289–311 132. Callaway TR, Anderson RC, Edrington TS, Genovese KJ, Harvey RB, Poole TL, Nisbet DJ (2004) Recent pre-harvest supplementation strategies to reduce carriage and shedding of zoonotic enteric bacterial pathogens in food animals. Anim Health Res Rev 5 (1):35–47. https://doi.org/10.1079/ ahr200462 133. Snedeker KG, Campbell M, Sargeant JM (2012) A systematic review of vaccinations to reduce the shedding of Escherichia coli O157 in the faeces of domestic ruminants.

85

Zoonoses Public Health 59(2):126–138. https://doi.org/10.1111/j.1863-2378. 2011.01426.x 134. Vande Walle K, Vanrompay D, Cox E (2013) Bovine innate and adaptive immune responses against Escherichia coli O157:H7 and vaccination strategies to reduce faecal shedding in ruminants. Vet Immunol Immunopathol 152(1–2):109–120 135. Hoffman MA, Menge C, Casey TA, Laegreid W, Bosworth BT, Dean-Nystrom EA (2006) Bovine immune response to shiga-toxigenic Escherichia coli O157:H7. Clin Vaccine Immunol 13(12):1322–1327 136. Fitzgerald SF, Beckett AE, PalareaAlbaladejo J, McAteer S, Shaaban S, Morgan J, Ahmad NI, Young R, Mabbott NA, Morrison L, Bono JL, Gally DL, McNeilly TN (2019) Shiga toxin sub-type 2a increases the efficiency of Escherichia coli O157 transmission between animals and restricts epithelial regeneration in bovine enteroids. PLoS Pathog 15(10). https://doi. org/10.1371/journal.ppat.1008003 137. Stanford K, Hannon S, Booker CW, Jim GK (2014) Variable efficacy of a vaccine and direct-fed microbial for controlling Escherichia coli O157:H7 in feces and on hides of feedlot cattle. Foodborne Pathog Dis 11 (5):379–387. https://doi.org/10.1089/fpd. 2013.1693 138. Cahill EE, Glantz PJ (1978) Demonstration of K88ac and K88ab antigens of Escherichia coli by means of immunoelectrophoresis and immunodiffusion. Infect Immun 20 (3):811–815 139. Woodward MJ, Wray C (1990) Nine DNA probes for detection of toxin and adhesin genes in Escherichia coli isolated from diarrhoeal disease in animals. Vet Microbiol 25 (1):55–65 140. Franck SM, Bosworth BT, Moon HW (1998) Multiplex PCR for enterotoxigenic, attaching and effacing, and Shiga toxin-producing Escherichia coli strains from calves. J Clin Microbiol 36(6):1795–1797 141. Wirth T, Falush D, Lan R, Colles F, Mensa P, Wieler LH, Karch H, Reeves PR, Maiden MC, Ochman H, Achtman M (2006) Sex and virulence in Escherichia coli: an evolutionary perspective. Mol Microbiol 60 (5):1136–1151 142. Cravioto A, Tello A, Navarro A, Ruiz J, Villafan H, Uribe F, Eslava C (1991) Association of Escherichia coli HEp-2 adherence patterns with type and duration of diarrhoea. Lancet 337(8736):262–264

86

Stefanie A. Barth et al.

143. Scotland SM, Gross RJ, Rowe B (1985) Laboratory tests for enterotoxin production, enteroinvasion and adhesion in diarrhoeagenic E. coli. In: Sussman M (ed) The virulence of Escherichia coli. Reviews and methods. Academic, New York, NY, pp 359–405 144. Knutton S, Baldwin T, Williams PH, McNeish AS (1989) Actin accumulation at sites of bacterial adhesion to tissue culture cells: basis of a new diagnostic test for enteropathogenic and enterohemorrhagic Escherichia coli. Infect Immun 57(4):1290–1298 145. Dibb-Fuller MP, Allen-Vercoe E, Thorns CJ, Woodward MJ (1999) Fimbriae- and flagellamediated association with and invasion of cultured epithelial cells by Salmonella enteritidis. Microbiology 145(Pt 5):1023–1031. https://doi.org/10.1099/13500872-1455-1023 146. Sasaki M, Sitaraman SV, Babbin BA, GernerSmidt P, Ribot EM, Garrett N, Alpern JA, Akyildiz A, Theiss AL, Nusrat A, Klapproth JM (2007) Invasive Escherichia coli are a feature of Crohn’s disease. Lab Investig 87 (10):1042–1054. https://doi.org/10.1038/ labinvest.3700661 147. Fo¨llmann W, Weber S, Birkner S (2000) Primary cell cultures of bovine colon epithelium: isolation and cell culture of colonocytes. Toxicol In Vitro 14(5):435–445. https://doi. org/10.1016/S0887-2333(00)00033-3 148. Eisel D, Seth O, Gru¨newald-Janho S, Kruchen B, Ru¨ger B (2008) DIG application manual for filter hybridization. Roche Diagnostics GmbH, Mannheim 149. Zhou YH, Zhang XP, Ebright RH (1991) Random mutagenesis of gene-sized DNA molecules by use of PCR with Taq DNA polymerase. Nucleic Acids Res 19(21):6052. https://doi.org/10.1093/nar/19.21.6052 150. Mu¨ller D, Greune L, Heusipp G, Karch H, Fruth A, Tsch€ape H, Schmidt MA (2007)

Identification of unconventional intestinal pathogenic Escherichia coli isolates expressing intermediate virulence factor profiles by using a novel single-step multiplex PCR. Appl Environ Microbiol 73(10):3380–3390. https:// doi.org/10.1128/AEM.02855-06 151. Levine MM, Prado V, Robins-Browne R, Lior H, Kaper JB, Moseley SL, Gicquelais K, Nataro JP, Vial P, Tall B (1988) Use of DNA probes and HEp-2 cell adherence assay to detect diarrheagenic Escherichia coli. J Infect Dis 158(1):224–228. https://doi.org/10. 1093/infdis/158.1.224 152. Blumer C, Kleefeld A, Lehnen D, Heintz M, Dobrindt U, Nagy G, Michaelis K, Emody L, Polen T, Rachel R, Wendisch VF, Unden G (2005) Regulation of type 1 fimbriae synthesis and biofilm formation by the transcriptional regulator LrhA of Escherichia coli. Microbiol SGM 151:3287–3298. https:// doi.org/10.1099/mic.0.28098-0 153. Al Safadi R, Abu-Ali GS, Sloup RE, Rudrik JT, Waters CM, Eaton KA, Manning SD (2012) Correlation between in vivo biofilm formation and virulence gene expression in Escherichia coli O104:H4. PLoS One 7(7): e41628. https://doi.org/10.1371/journal. pone.0041628 154. Herold S, Paton JC, Srimanote P, Paton AW (2009) Differential effects of short-chain fatty acids and iron on expression of iha in Shigatoxigenic Escherichia coli. Microbiology 155 (Pt 11):3554–3563. https://doi.org/10. 1099/mic.0.029454-0 155. Zhang W, Bielaszewska M, Bauwens A, Fruth A, Mellmann A, Karch H (2012) Realtime multiplex PCR for detecting Shiga toxin 2-producing Escherichia coli O104:H4 in human stools. J Clin Microbiol 50 (5):1752–1754. https://doi.org/10.1128/ JCM.06817-11

Chapter 3 Identification of Shiga Toxin-Producing Escherichia coli Outbreaks Using Whole Genome Sequencing Stefan Bletz, Alexander Mellmann, and Barbara Middendorf-Bauchart Abstract Today, whole genome sequencing (WGS)-based typing is the gold standard approach to detect outbreaks of Shiga toxin-producing Escherichia coli (STEC) and to differentiate them from sporadic cases. Here, we describe an optimized protocol to efficiently determine the genome sequences of STEC using short read Illumina technology and provide information on helpful tools for the subsequent bioinformatic analysis. Key words Shiga toxin-producing Escherichia coli, STEC, Outbreak, WGS, Whole genome sequencing, Subtyping

1

Introduction Shiga toxin (Stx)-producing Escherichia coli (STEC) belong to the intestinal pathogenic subgroup of E. coli and are associated with different human diseases ranging from mild diarrhea to hemorrhagic colitis [1]. Furthermore, they can cause, as the most severe complication, the hemolytic uremic syndrome (HUS) [1]. These pathogens, which are frequently transmitted via contaminated food, are associated with both sporadic cases and large outbreaks that could harm hundreds of people. The most prominent examples were the devastating outbreak of STEC O104:H4 centered in Northern Germany in 2011 with more than 800 HUS cases [2], the Spinach outbreak in the United States in 2006 [3], and the outbreak in Japan in 1996 that was associated with contaminated sprouts [4, 5]. To delineate sporadic and unrelated cases from outbreak cases caused by the clonal spread of a single pathogen, whole genome sequence (WGS)-based typing methods became the gold standard typing approach during the last decade [6]. Today, next-generation sequencing (NGS) techniques enable us to determine WGS datasets within 24–48 h, and the necessary bioinformatic tools to extract sufficient typing information are also available

Stephanie Schu¨ller and Martina Bielaszewska (eds.), Shiga Toxin-Producing E. coli: Methods and Protocols, Methods in Molecular Biology, vol. 2291, https://doi.org/10.1007/978-1-0716-1339-9_3, © Springer Science+Business Media, LLC, part of Springer Nature 2021

87

88

Stefan Bletz et al.

as public or commercial software solutions [7]. Two different approaches are usually used to extract and to subsequently compare genotypic data from WGS datasets: either single nucleotide polymorphisms (SNP) are extracted in comparison to a reference genome and the resulting SNP profiles are then compared to determine their relationship or predefined genomic targets that belong to the core genome of the respective species are extracted and, depending on their allelic sequences, their profiles are compared, the so-called core genome multilocus sequence typing (cgMLST). Whereas the SNP-based approach exhibits a slightly higher discriminatory power, one major advantage of cgMLST is the convenience to establish a common typing nomenclature [8]. In this protocol, we describe the methodology to sequence STEC genomes using the short read Illumina sequencing technology (Illumina, Inc.). This protocol is based on recommendations of the manufacturer [9]. However, we have introduced various modifications to speed up the process and to reduce the costs for library preparation. At the end, we give some information on helpful tools and how to perform the subsequent bioinformatic analysis.

2

Materials All solutions are prepared with molecular biology grade reagents and nuclease-free water and stored at room temperature unless otherwise specified.

2.1

STEC Culture

1. A fresh pure culture of the STEC isolate grown overnight on MacConkey agar or another suitable solid medium to cultivate STEC.

2.2

DNA Extraction

1. Glass beads (425–600 μm), acid-washed [10].

2.2.1 Using Glass Beads for Mechanical Lysis

2. 1 μL inoculation loop. 3. 1.5 mL reaction tubes. 4. MixMate® or a similar shaker. 5. Microcentrifuge.

2.2.2 Using the Monarch Genomic DNA Purification Kit

1. Monarch Genomic DNA Purification Kit (New England Biolabs GmbH). 2. Ethanol absolute for the Monarch gDNA Wash Buffer. 3. 25 mg/mL lysozyme solution: Dissolve 1 g lysozyme in 40 mL water and store aliquots at 25 to 15  C. 4. 1 M Tris–HCl, pH 8.0 (stock solution): Weigh 30.3 g Tris– HCl and transfer to a 250 mL graduated cylinder, add water to 225 mL and mix. Adjust pH with HCl and make up to 250 mL with water.

WGS-Based Typing of STEC for Outbreak Detection

89

5. 10 mM Tris–HCl, pH 8.0: Transfer 2.5 mL 1 M Tris–HCl, pH 8.0 to a 250 mL graduated cylinder. Make up to 250 mL with water. 6. 1.5 mL reaction tubes. 7. 1 μL inoculation loop. 8. ThermoMixer® or a similar shaker with heating option. 9. Microcentrifuge. 10. Vortex mixer. 2.3 Quantification of Genomic DNA

1. Qubit™ 1-dsDNA HS Assay Kit (store at 2–8  C). 2. Qubit™ Fluorometer (Thermo Fisher Scientific, Inc.). 3. 500-μL thin-walled tubes with low autofluorescence (Thermo Fisher Scientific, Inc.). 4. Microcentrifuge. 5. Vortex mixer.

2.4 Library Preparation and Sequencing

1. Illumina® Nextera XT DNA Library Preparation Kit. (a) Box 1/2 (store at

25 to

15  C).

(b) Box 2/2 (store at 2–8  C). 2. Illumina® Nextera XT Index Kit v2 Set A (store at 15  C). 3. Illumina® PhiX Control v3 (store at

25 to

25 to

15  C).

4. Illumina® MiSeq Reagent Kit v2 (500 cycles). (a) Box 1/2 (store at

25 to

15  C).

(b) Box 2/2 (store at 2–8  C). 5. Illumina® MiSeq System. 6. Agencourt AMPure XP beads (Beckman Coulter, Inc.; store at 2–8  C). 7. Freshly prepared 80% ethanol: Mix 8 mL ethanol abs. and 2 mL water. 8. 1 M NaOH (stock solution). 9. Freshly prepared 0.1 M NaOH: Transfer 900 μL water and 100 μL 1 M NaOH to a 1.5 mL tube and mix briefly. 10. Freshly prepared 0.2 M NaOH: Transfer 800 μL water and 200 μL 1 M NaOH to a 1.5 mL tube and mix briefly. 11. 1 M Tris–HCl, pH 8.5 (stock solution): Weigh 30.3 g Tris– HCl and transfer to a 250 mL graduated cylinder. Add water to 225 mL and mix. Adjust pH with HCl and make up to 250 mL with water.

90

Stefan Bletz et al.

12. EBT buffer (elution buffer with 10 mM Tris–HCl, pH 8.5 and 0.1% Tween 20): Transfer 2.5 mL 1 M Tris–HCl, pH 8.5 and 250 μL Tween 20 to a 250 mL graduated cylinder. Make up to 250 mL with water. 13. 48-well PCR plates. 14. Magnetic stand for 96-well PCR plates (small volume). 15. Thermocycler. 16. MixMate® or a similar shaker. 17. Heating block for 1.5 mL tubes (98  C). 18. Ice bath. 19. Centrifuge (with a microplate adapter). 20. Multichannel pipette.

3

Methods

3.1 Extraction of Genomic DNA

3.1.1 Using Glass Beads

We provide two different DNA extraction methods. Depending on the needs, the rather simple mechanical lysis using glass beads might be sufficient; if a long-term storage of the DNA or additional experiments that require a higher DNA quality are planned, the column-based method is recommended. 1. Collect a single colony or a part of a single colony (if very large with a diameter of several millimeters) with a 1 μL inoculation loop and resuspend in 30 μL nuclease-free water in a 1.5 mL tube containing glass beads (at a ratio of 1:3 of beads to water; v/v) [10] (see Note 1). 2. Disrupt the bacterial suspensions mechanically for 3 min in a MixMate at a mixing frequency of 2200 rpm. 3. For heat inactivation, incubate the tubes at 95  C for 5 min. 4. Pellet disrupted bacteria by centrifugation for 3 min at 12,000  g. Transfer the supernatant with the DNA to a new tube; it can be stored at 2–8  C (see Note 2).

3.1.2 Using the Monarch Genomic DNA Purification Kit

1. Collect bacterial colonies from the plate with a 1 μL inoculation loop, stir into 90 μL cold 10 mM Tris–HCl, pH 8.0 in a 1.5 mL reaction tube, and resuspend by vortexing (see Note 3). 2. Add 10 μL lysozyme solution, vortex briefly. Then add 100 μL Tissue Lysis Buffer and vortex vigorously. 3. Incubate 5 min at 37  C and a mixing frequency of 1400 rpm in ThermoMixer. 4. Pipette 10 μL proteinase K, vortex briefly, and incubate for at least 30 min at 56  C and a mixing frequency of 1400 rpm in ThermoMixer.

WGS-Based Typing of STEC for Outbreak Detection

91

5. Add 3 μL RNase A to the lysed cells and mix for at least 5 min at 56  C and a mixing frequency of 1400 rpm. 6. Add 400 μL gDNA binding buffer to the lysate and vortex thoroughly for 10 s. 7. Insert the gDNA purification column into a collection tube and transfer the lysate mixture onto the column without touching the edge of the column. 8. Close the cap and centrifuge first for 3 min at 1000  g and then for 1 min at 12,000  g. Discard the flow-through and the collection tube. 9. Place the purification column in a new collection tube and add 500 μL gDNA Wash Buffer. Close the cap and invert several times. Centrifuge for 1 min at 12,000  g and discard the flow-through. 10. Add 500 μL gDNA Wash Buffer again and close the cap. Centrifuge at 12,000  g for 1 min and discard the flowthrough and the collection tube. 11. Place the column in a new 1.5 mL tube and add 100 μL preheated (60  C) gDNA elution buffer and incubate for 1 min at room temperature (see Note 4). 12. To elute the DNA, centrifuge for 1 min at 12,000  g. 3.2 Quantification of Genomic DNA

1. To quantify the DNA, a two-point calibration is first performed on the fluorometer using the two standards of the kit. Pipette 10 μL of Standard 1 and Standard 2 into each 190 μL Qubit 1 dsDNA HS Working Solution in a thin-walled 0.5 mL assay tube, vortex and incubate at room temperature for 2 min (see Note 5). 2. Pipette 2 μL of the extracted DNA into 198 μL Qubit 1 dsDNA HS Working Solution, vortex, and incubate for 2 min at room temperature. Measure the DNA concentration using the Qubit Fluorometer. After the measurement, the concentration (ng/μL) of the DNA is displayed (see Note 6).

3.3 Dilution of Genomic DNA

Dilute the measured genomic DNA to a concentration of 0.2 ng/μL with water.

3.4 Library Preparation and Sequencing

1. Thaw TD (Tagment DNA) buffer and transfer 5 μL of TD buffer to a 48-well PCR plate. Then add 2.5 μL of diluted sample DNA (0.2 ng/μL) and 2.5 μL ATM (Amplicon Tagment Mix). Seal the plate, mix samples briefly, and centrifuge at 280  g for 1 min. In a thermal cycler with preheated lid (100  C), keep the samples at 55  C for 5 min and hold at 10  C (see Note 7) [9, 11].

3.4.1 Tagment DNA

92

Stefan Bletz et al.

2. Add 2.5 μL NT (Neutralize Tagment) buffer immediately after the end of the cycler program. Seal the plate, mix the samples, centrifuge at 280  g for 1 min, and incubate at room temperature for 5 min. 3.4.2 Library Amplification

1. Thaw the index adapters (i5 and i7) and invert them 3–5 times. Quickly spin down the tubes (for 1 s). 2. Pipette 7.5 μL NPM (Nextera PCR Master Mix), 2.5 μL Index Adapter 1 (i7), and 2.5 μL Index Adapter 2 (i5) to each sample (see Note 8). Seal the plate, mix briefly, and centrifuge 1 min at 280  g. 3. Start the following program in a thermal cycler with preheated lid (100  C): Initial 72  C for 3 min, 95  C for 30 s; 12 cycles: 95  C for 10 s, 55  C for 30 s, 72  C for 30 s; followed by 72  C for 5 min and hold at 10  C (see Note 9).

3.4.3 Library Purification

1. Thaw RSB (resuspension buffer), bring the Agencourt AMPure XP beads to room temperature, and vortex for at least 30 s (see Note 10). 2. Pipette 13 μL of the beads to each sample. Seal the PCR plate and mix for 2 min at a mixing frequency of 1800 rpm in the MixMate (see Note 11). 3. Incubate the samples for 5 min at room temperature and place the PCR plate on a magnetic stand. Wait 2 min or until the supernatant becomes clear. Aspirate the supernatant (with a multichannel pipette) and discard. 4. Add 180 μL of 80% ethanol and incubate for 30 s. Then remove and discard the supernatant. Repeat this washing step. 5. Dry the pellet for 5 min at room temperature and remove the PCR plates from the magnetic stand. 6. Add 26.3 μL RSB and resuspend for 2 min at 1800 rpm in the MixMate (see Note 12). 7. Place the PCR plate on the magnetic stand and wait 2 min or until the supernatant becomes clear. Transfer 10 μL of the supernatant to a new PCR plate (see Note 13).

3.4.4 Libraries Normalization

1. Bring LNA1 (Library Normalization Additives 1), LNB1 (Library Normalization Beads 1), LNW1 (Library Normalization Wash 1) and LNS1 (Library Normalization Storage Buffer 1) to room temperature and vortex LNB1 for 1 min. 2. Mix for one sample 23 μL LNA1 and 4 μL LNB1. Pipette 22.5 μL of the LNA1/LNB1 mixture to each sample. 3. Seal the PCR plate and mix for 30 min at a mixing frequency of 1800 rpm in the MixMate.

WGS-Based Typing of STEC for Outbreak Detection

93

4. Place the PCR plate on a magnetic stand. Wait 2 min or until the supernatant becomes clear. Aspirate the supernatant (with a multichannel pipette) and discard. 5. Wash the samples by adding 22.5 μL LNW1. Seal the PCR plate and mix for 5 min at a mixing frequency of 1800 rpm in the MixMate. 6. Place the PCR plate on a magnetic stand. Wait 2 min or until the supernatant becomes clear. Aspirate the supernatant (with a multichannel pipette) and discard. 7. Repeat the washing step. 8. Add 15 μL freshly prepared 0.1 M NaOH to each sample. Seal the PCR plate and mix for 5 min at a mixing frequency of 1800 rpm in the MixMate. Place the PCR plate on a magnetic stand. Wait 2 min or until the supernatant becomes clear. 9. Pipette 15 μL LNS1 into a new PCR plate and transfer 15 μL supernatant (with a multichannel pipette) to the new plate. Mix the plate and quickly spin down (for 1 s) (see Note 14). 3.4.5 PhiX Control

1. Thaw HT1 (hybridization buffer) at 2–8  C. 2. Transfer 2 μL PhiX Library (10 nM) to a new 1.5 mL tube. Add 3 μL EBT buffer and mix briefly. Add 5 μL freshly diluted 0.2 M NaOH, vortex, and centrifuge 1 min at 280  g. Incubate 5 min at room temperature. 3. Add 990 μL HT1 to the denatured PhiX library and vortex briefly (20 pM final concentration). 4. Transfer 375 μL of the prediluted PhiX library into a new 1.5 mL tube. Add 225 μL HT1 buffer and vortex briefly (12.5 pM) (see Note 15).

3.4.6 Libraries Pooling and Spiking

1. Thaw HT1 (Hybridization Buffer) at 2–8  C and preheat the heating block to 98  C. 2. Thaw the ready-to-use cartridge of the MiSeq Reagent Kit in a water bath for 1 h at room temperature. 3. Pipette 5 μL of each sample into a new 1.5 mL tube (pooled amplicon library, PAL), vortex, and quickly spin down. 4. Pipette 600 μL equilibrated HT1 into a new 1.5 mL tube and add 25 μL PAL (diluted amplicon library, DAL). Vortex the tube and quickly spin down. 5. Incubate the DAL tube for 2 min at 98  C. Then invert two times and incubate 5 min on ice. 6. Add 6.31 μL PhiX Control and mix briefly. 7. Invert the defrosted ready-to-use cartridge ten times and check that there are no bubbles at the bottom of the reservoirs. Load 600 μL of diluted and spiked amplicon library DAL with PhiX into reservoir 17 of the cartridge (see Note 16).

94

Stefan Bletz et al.

8. The prepared cartridge is now ready for sequencing in the MiSeq System. As the sequencing system is frequently located in a core facility or in a different laboratory, the process how to load and start the sequencer is not described here. However, this process can be found in the manufacturer’s manual of the sequencing platform, e.g., for the MiSeq [12]. 3.5 Analysis and Interpretation of Sequencing Data

After sequencing is completed, the resulting FASTQ raw data files (two files per sample/barcode corresponding to the paired-end sequencing method) are ready for sequencing quality control, de novo assembly, and subsequent extraction of the respective genetic targets that are necessary to answer the biological question. Assuming that the sequencing run and data acquisition itself were successful, different quality control measures should be performed to assess the sequence quality for each sample. To check for sequence length distribution, base quality, adapter content, and other parameters that could affect subsequent sequence analysis, fastQC is, for example, a helpful tool [13]. After the successful sequence quality control, the de novo assembly is the next step to create, depending on the read length and sequencing coverage, contig sequences of the genomes. For an Escherichia coli genome of approximately 5 Mbp size, the number of contigs should be between 100 and 300. However, the absolute number of contigs heavily depends on the de novo assembler used; therefore, there are no general rules as also various other measures are necessary to judge an assembly process. A rather novel de novo assembler for Illumina data with very good characteristics regarding the speed, accuracy, and computational requirements is the SKESA assembler [14]. After the de novo assembly process is finished, the genes of interest are extracted from the assembled WGS datasets and compared to end up with a typing result. This process of gene extraction and subsequent allele calling can be done with open source tools like BIGSdb [15] or with commercial solutions, listed and discussed elsewhere [7]. Examples of different genome analyses of pathogenic E. coli are given here [16, 17], where not only typing information to delineate the phylogenetic relationship of different strains but also additional genes encoding various virulence determinants were extracted. A rather novel bioinformatic tool that helps to extract additional genomic information, e.g., on virulence and antibiotic resistance, is the AMRFinderPlus tool, which has merged several previous databases and initiatives into a single system to detect relevant genotypic information from WGS datasets [18]. The only challenge that remains after conducting WGS-based typing is the interpretation of the typing results to end up with the right conclusion whether isolates with similar genotypes belong to an outbreak with clonal transmission(s). For isolates, where the

WGS-Based Typing of STEC for Outbreak Detection

95

genotypes differ in hundreds of SNPs or cgMLST alleles, a clonal transmission can be ruled out easily. Also, in case of identical genotypes, the epidemiological information usually corroborates the typing results. However, it becomes more difficult when isolates differ only in a few SNPs or cgMLST alleles. In these situations, the epidemiological background information about the cases/isolates, such as the place/time of isolation and contact to the potential infection source, is crucial and must be taken into account as there are no clear threshold criteria, to which extend isolates can differ but still belong to a transmission event. These thresholds can be outbreak-specific in case of specific clones but also species-specific depending on the mutation rate of the respective pathogen.

4

Notes 1. To standardize the amount of glass beads used, they can be filled into the reaction tubes with a small spatula or spoon. 2. Since mechanical cell lysate contains proteins and other cell components in addition to DNA, its stability is limited and the samples should be used within a few days. 3. Take enough colonies so that the 1 μL inoculation loop is well filled. 4. The preheated elution buffer increases the yield. 5. The fluorescence signal in the tubes (standards or samples) is not stable for more than 3 h. 6. The concentrations of DNA should be between 2 and 20 ng/μ L. Concentrations that are too high should be diluted with water and quantified again. If the concentration is too low, the DNA extraction must be repeated. 7. In order to save reagent costs, the quantities indicated here are 50% of those of the manufacturer’s protocol. 8. Each sample is given a unique combination of index adapters, generating dual indexed libraries. For larger numbers of samples, a setup should be chosen in which the index adapter 1 (i7) is placed at the top of the PCR plate and the index adapter 2 (i5) at the left side. If possible, pipetting is done with a multichannel pipette. This approach makes pipetting easier and avoids mix-ups. 9. The library can be stored for up to two days at 2–8  C. 10. 1 mL aliquots of Agencourt AMPure XP beads can be prepared in 1.5 mL tubes for better handling. 11. The amount of Agencourt AMPure XP beads can influence the size of the inserts.

96

Stefan Bletz et al.

12. If the pellets are still visible, pipette the samples up and down until they are completely resuspended. 13. The plate can be stored for 1 week at 25 to 15  C. Transfer 10 μL of the supernatant to another PCR plate for backup. 25 to

15  C.

15. The conditioned PhiX library can be stored at for up to 3 weeks.

25 to

14. The plate can be stored for 1 week at

15  C

16. The optimal loading concentration of the bead-based normalized library for MiSeq v2 reagents is 12.5 pM, and optimal raw cluster density is 1000–1200 K clusters/mm2.

Acknowledgments This study was supported by the German Research Foundation (project Me3205/4-1) and the German Federal Ministry of Health (project IGS-Zoo, ZMVI1-2518FSB706). References 1. Karch H, Tarr PI, Bielaszewska M (2005) Enterohaemorrhagic Escherichia coli in human medicine. Int J Med Microbiol 295 (6-7):405–418. https://doi.org/10.1016/j. ijmm.2005.06.009 2. Epidemiologisches Bulletin 31/2011 (2011) Informationen zum EHEC-/HUS-Ausbruchsgeschehen von Mai bis Juli 2011 in Deutschland – Ende des Ausbruchs Robert Koch-Institut, Epidemiologie und Gesundheitsberichterstattung. doi:https://doi.org/ 10.25646/4517 3. Centers for Disease Control and Prevention (CDC). (2006). Multistate outbreak of E. coli O157:H7 infections linked to fresh spinach (FINAL UPDATE). https://www.cdc.gov/ ecoli/2006/spinach-10-2006.html. Accessed 25 Jan 2020 4. National Institute of Health and Infectious Diseases Control Division MoHaWoJ (1998) Enterohemorrhagic Escherichia coli (verocytotoxin-producing E. coli) infection, 1996—April 1998. Infect Agents Surveill Rep 19:122–123 5. National Institute of Health and Infectious Diseases Control Division MoHaWoJ (1997) Verocytotoxin-producing Escherichia coli (enterohemorrhagic E. coli) infections, Japan, 1996-June 1997. Infect Agents Surveill Rep 18:153–154 6. Salipante SJ, SenGupta DJ, Cummings LA et al (2015) Application of whole-genome

sequencing for bacterial strain typing in molecular epidemiology. J Clin Microbiol 53 (4):1072–1079. https://doi.org/10.1128/ JCM.03385-14 7. ECDC EFSA, Van Walle I et al (2019) EFSA and ECDC technical report on the collection and analysis of whole genome sequencing data from food-borne pathogens and other relevant microorganisms isolated from human, animal, food, feed and food/feed environmental samples in the joint ECDC-EFSA molecular typing database. EFSA Support Publ 16(5):1337E. https://doi.org/10.2903/sp.efsa.2019.EN1337 8. Kohl TA, Harmsen D, Rothganger J et al (2018) Harmonized genome wide typing of tubercle bacilli using a web-based gene-bygene nomenclature system. EBioMedicine 34:131–138. https://doi.org/10.1016/j. ebiom.2018.07.030 9. Illumina, Inc. (2019) Nextera XT DNA library prep reference guide. https://support. illumina.com/sequencing/sequencing_kits/ nextera_xt_dna_kit/documentation.html. Accessed 25 Jan 2020 10. Koser CU, Fraser LJ, Ioannou A et al (2014) Rapid single-colony whole-genome sequencing of bacterial pathogens. J Antimicrob Chemother 69(5):1275–1281. https://doi.org/ 10.1093/jac/dkt494 11. Mellmann A, Bletz S, Boking T et al (2016) Real-time genome sequencing of resistant

WGS-Based Typing of STEC for Outbreak Detection bacteria provides precision infection control in an institutional setting. J Clin Microbiol 54 (12):2874–2881. https://doi.org/10.1128/ JCM.00790-16 12. Illumina, Inc. (2019) MiSeq system guide. https://support.illumina.com/sequencing/ sequencing_instruments/miseq/documenta tion.html. Accessed 9 Jun 2020 13. Babraham Institute. FastQC. http://www.bio informatics.babraham.ac.uk/projects/fastqc/. Accessed 25 Jan 2020 14. Souvorov A, Agarwala R, Lipman DJ (2018) SKESA: strategic k-mer extension for scrupulous assemblies. Genome Biol 19(1):153. https://doi.org/10.1186/s13059-018-1540z 15. Jolley KA, Maiden MC (2010) BIGSdb: scalable analysis of bacterial genome variation at the population level. BMC Bioinformatics 11:595. https://doi.org/10.1186/14712105-11-595

97

16. Gati NS, Middendorf-Bauchart B, Bletz S et al (2019) Origin and evolution of hybrid Shiga toxin-producing and uropathogenic Escherichia coli strains of sequence type 141. J Clin Microbiol 58(1). https://doi.org/10.1128/ JCM.01309-19 17. Kossow A, Zhang W, Bielaszewska M et al (2016) Molecular characterization of human atypical sorbitol-fermenting enteropathogenic Escherichia coli O157 reveals high diversity. J Clin Microbiol 54(5):1357–1363. https://doi. org/10.1128/JCM.02897-15 18. Feldgarden M, Brover V, Haft DH et al (2019) Validating the AMRFinder tool and resistance gene database by using antimicrobial resistance genotype-phenotype correlations in a collection of isolates. Antimicrob Agents Chemother 63(11). https://doi.org/10.1128/AAC. 00483-19

Chapter 4 Predicting Host Association for Shiga Toxin-Producing E. coli Serogroups by Machine Learning Nadejda Lupolova, Antonia Chalka, and David L. Gally Abstract Escherichia coli is a species of bacteria that can be present in a wide variety of mammalian hosts and potentially soil environments. E. coli has an open genome and can show considerable diversity in gene content between isolates. It is a reasonable assumption that gene content reflects evolution of strains in particular host environments and therefore can be used to predict the host most likely to be the source of an isolate. An extrapolation of this argument is that strains may also have gene content that favors success in multiple hosts and so the possibility of successful transmission from one host to another, for example, from cattle to human, can also be predicted based on gene content. In this methods chapter, we consider the issue of Shiga toxin (Stx)-producing E. coli (STEC) strains that are present in ruminants as the main host reservoir and for which we know that a subset causes life-threatening infections in humans. We show how the genome sequences of E. coli isolated from both cattle and humans can be used to build a classifier to predict human and cattle host association and how this can be applied to score key STEC serotypes known to be associated with human infection. With the example dataset used, serogroups O157, O26, and O111 show the highest, and O103 and O145 the lowest, predictions for human association. The long-term ambition is to combine such machine learning predictions with phylogeny to predict the zoonotic threat of an isolate based on its whole genome sequence (WGS). Key words Machine learning, Host attribution, Zoonotic threat, STEC, Whole genome sequence (WGS)

1

Introduction In the early days of bacterial genomics, comparison of two or more bacterial genomes was carried out by aligning them to each other and extracting information about single-nucleotide polymorphisms (SNPs), insertions, and deletions. Now, with the democratization of sequencing, much larger datasets have become available which demonstrate that certain groups of bacteria, generally those with the capacity for multiple modes of horizontal gene transfer, can have very diverse genomes. To describe this, the pan-genome concept was introduced in 2005 [1]. The pan-genome consists of both

Stephanie Schu¨ller and Martina Bielaszewska (eds.), Shiga Toxin-Producing E. coli: Methods and Protocols, Methods in Molecular Biology, vol. 2291, https://doi.org/10.1007/978-1-0716-1339-9_4, © Springer Science+Business Media, LLC, part of Springer Nature 2021

99

100

Nadejda Lupolova et al.

core genes present in nearly all genomes in a dataset and accessory genes present in only some genomes. For some bacterial species, including E. coli, sometimes only 20% of the genes will be shared between all genomes in a large dataset. As such, using only SNP-based information provides a confined view of bacterial evolution and adaptation. In this methods chapter, the pan-genome for an E. coli dataset is generated, and predicted protein variants (PVs) representative of human or bovine host association are identified and used to build a machine learning classifier to determine host association scores for different STEC serotypes. This approach has been applied to STEC as we propose it can be useful to understand if certain STEC serotypes present in ruminants have higher human association scores than others and therefore may be more likely to cause infection in a human host. It is appreciated that this final point is an extrapolation of the concept and is presented here to promote discussion around prediction of zoonotic threat based on genome sequence. The methods used to extract, train, and predict from WGS datasets are general and can be applied to other genotype-to-phenotype prediction analyses.

2

Methods and Datasets The analysis requires a training dataset of bovine and human E. coli isolate sequences from which to extract gene content, in this case in the form of predicted PVs. Those PVs that provide some discrimination between the two hosts can then be used in a classifier to predict bovine and human association probabilities from genome sequences of specific STEC serotypes (Table 1). A relatively small sample set is used for this example and the accuracy and value of the assignments would increase with sample size and diversity. It is important to make sure your training dataset is balanced, i.e., the number of isolates in each class is similar. In the demonstrated example, the dataset contains 344 human and 347 bovine isolates. The training set does not include STEC isolates used in the testing phase of the analysis, and the majority of the isolates do not encode Stx. To mitigate the problems that unbalanced datasets may impose, more data should be obtained for the smallest class. If this is not possible, you can try the following strategies: 1. Down-sample the biggest class to the size of the smallest one. However, this may result in a loss of diversity and a model that does not represent the intended population. Therefore, downsampling is only recommended if a lot of data is available. 2. Oversample the small class to the size of the larger one. It is advised to introduce random modification into your oversampled data as simple multiplication of existing sequences will lead to overrepresentation of the same features that can be nonrepresentative in population. The most widely used

Predicting Host Association for STEC Serogroups

101

Table 1 Numbers of E. coli WGS of human and bovine origin used for training and testing. STEC serogroups are indicated for the test set Human

Bovine

344

347

O103

20

38

O111

19

15

O145

35

14

O157

15

10

O26

31

30

O55

28

0

Training E. coli Test STEC

approach is the Synthetic Minority Oversampling TEchnique (SMOTE), which augments data by selecting one example from the underrepresented group, finding its nearest neighbor in the feature space and generating a new sample connecting the two [2]. Oversampling is recommended when less data is available. 3. Add hard-coded weights to certain training data. This approach will ensure that the algorithm is forced to “give more attention” to underrepresented classes. 4. Reconsider choice of algorithms. The machine learning field has many algorithms available, with some able to handle unbalanced datasets better. Although balanced datasets are recommended for optimal results, decision trees like Random Forest perform well on unbalanced data. Importantly, any of the above techniques should not be blindly relied upon to increase performance. If the dataset is modified, you should compare it with the results from the unbalanced dataset model. Do not rely on accuracy as the only evaluation metric. Consider also using: 1. Confusion/error matrix: A table reporting the number of correct and incorrect predictions. 2. Precision/positive predictive value (PPV): Measures a classifier’s exactness. It is calculated by dividing true positives by the sum of true and false positives. 3. Sensitivity/true positive rate (TPR): Measures a classifier’s completeness. It is calculated by dividing true positives by the sum of true positives and false negatives. 4. F1 score: Weighted average of precision and sensitivity.

102

3

Nadejda Lupolova et al.

Data Preparation and Analysis Select assembled bacterial genomes of interest can be downloaded from specific databases including: EnteroBase (https://enterobase. warwick.ac.uk/), Pathogen detection database (https://www.ncbi. nlm.nih.gov/pathogens/organisms/), and NCBI genomes (http//ftp.ncbi.nlm.nih.gov/genomes/genbank/bacteria/). EnteroBase and Pathogen detection databases allow filtering of genomes and often provide more detailed and structured metadata about the isolates. It is important that all assembled genomes are annotated with the same version of software. If the assemblies of the dataset are gathered from different sources, they should be re-annotated with appropriate bacterial genome software, such as PROKKA [3]. It is wise to use the “--proteins” flag when running PROKKA as it results in more homogeneous annotations. Choose a wellannotated reference quality genome; in this example, we are using STEC strain Sakai [4]. Perform protein clustering using Roary (https://sangerpathogens.github.io/Roary/) [5], which allows for both core and accessory genome analyses. Some benchmarking based on the similarity of your isolates should be carried out before deciding on the final parameters. For this purpose, phylogenetic trees are useful (Fig. 1). In this example, the pink-shaded region represents STEC O157, a closely related clonal serotype. In this case, you may want to increase the granularity of pattern detection and therefore choose to run Roary with high degree of similarity (e.g., 98%). On the other hand, if the dataset is more diverse and comprised of isolates that are more distinct (e.g., all E. coli isolates in this phylogenetic tree), you may want to decrease similarity and run Roary at 95% of similarity. In the next step, enter the PVs from Roary into the selected machine learning (ML) algorithm. We have recently compared a number of ML approaches for analysis of host attribution for Salmonella Typhimurium [6]. Based on our review, Random Forest achieved the highest accuracy and therefore will be used within R studio for our STEC analysis. Open the pan-matrix in R studio. The following scripts provide an example of the workflow (Script 1): Define isolates that will form your training data and separate them from your test data. Here isolates starting “TB” and “TH” are bovine and human isolates, respectively, that were obtained from EnteroBase and will be used for training. ZB isolates are a diverse set of Zambian bovine isolates characterized elsewhere [7]. R is a reference quality genome of three different Shigella species and two reference quality genomes of STEC O157 (Sakai and TW14359), which were included as an internal control for human pathogenicity (Script 2).

Predicting Host Association for STEC Serogroups

103

Fig. 1 Clustering of E. coli isolates used in this study. Isolates were clustered according to SNP differences in the core genome. The clustering highlights the close association of the clonal E. coli O157 subcluster highlighted in pink

It is important to filter your data to avoid unnecessary computational time. In the next script, we remove columns (PVs) that are either present in all isolates (“core” genes) or present in less than 5% of isolates, mainly as singleton genes, and therefore are too scarce to determine their value as markers of a specific host or environment. While a core gene would be expected to be present in 100% of all isolates, assemblies based on short-read sequencing might not contain complete gene sequences for each strain. To account for this, the threshold could be set to include all “soft core” genes that are present in 95% of the read assemblies from the sequenced genomes (Fig. 2). In our example, there are 51,493 PVs in total with a core (set at 95% of strains) of 3236 PVs. Additional exclusion of 47,484 singletons leads to 773 remaining PVs (Script 3).

104

Nadejda Lupolova et al.

### Install and load necessary packages library("rpart") library("randomForest") library("gdata") library("data.table") library("caret") library("ROCR")

### load pan-genome matrix mdata