RNAi Strategies for Pest Management: Methods and Protocols [2360, 1 ed.] 1071616323, 9781071616321
This volume explores the latest techniques used for sustainable development of eco-friendly pest management systems. Cha
207 86 10MB
English Pages 383 [370] Year 2021
Dedication
Preface
Contents
Contributors
Chapter 1: Genome-Wide Identification and Functional Characterization of Noncoding RNAs (ncRNAs) Differentially Expressed Duri...
1 Introduction
2 Materials
2.1 General Materials
2.2 Identification of Differentially Expressed lncRNAs and circRNAs During Insect Development
2.3 Identification of Differentially Expressed miRNAs During Insect Development and Functional Characterization of ceRNAs
3 Methods (See Note 1)
3.1 Identification of Differentially Expressed lncRNAs and circRNAs During Insect Development
3.2 Identification of Differentially Expressed miRNAs During Insect Development and Functional Characterization of ceRNAs from...
4 Notes
References
Chapter 2: Identification and Functional Characterization of Argonaute (Ago) Proteins in Insect Genomes
1 Introduction
2 Materials
2.1 Sequences and Databases
2.2 Molecular Biology
2.3 Fly Stocks and Husbandry
3 Methods
3.1 Identification of Insect Ago-Like Sequences
3.2 Subcloning of the Sequence of Interest into Transposon Vector and Transgenesis
3.3 Generation of Flies Suitable for Phenotypic Functional Analyses
3.4 Genetic Crosses and Phenotypic Functional Analyses
4 Notes
References
Chapter 3: Functional Characterization of Silkworm PIWI Proteins by Embryonic RNAi
1 Introduction
2 Materials
2.1 Silkworm Rearing and Egg Preparation
2.2 Preparation of siRNAs and Injection
2.3 Preparation of DNA and RNA Extraction from Single Embryo
2.4 Preparation of PCR and Reverse Transcription
3 Methods
3.1 Silkworms Rearing and Egg Preparation
3.2 Preparation of siRNAs
3.3 Microinjection of siRNAs
3.4 Extraction of both DNA and RNA from a Single Embryo
3.5 Molecular Sexing
3.6 RT-PCR Analysis of Sex-Specific Splicing of Bmdsx
4 Notes
References
Chapter 4: Guiding RNAi Design Through Characterization of Endogenous Small RNA Pathways
1 Introduction
1.1 miRNA Biogenesis
1.2 siRNA Biogenesis
1.3 piRNA Biogenesis
2 Materials
2.1 Required Installations
2.2 Requirements for cloning and dsRNA Production
3 Methods
3.1 Quality Assessment, Library Preparation, and Sequencing
3.2 Obtaining and Processing the Sequencing Data
3.3 Computational Identification of miRNA in RNA-seq Data
3.4 Computational Identification of siRNA and Ping-Pong piRNA Expressing Loci
3.5 Computational Identification of Phasing piRNA in RNA-seq Data
3.6 Cloning and RNA Production
4 Notes
References
Chapter 5: Silencing of Molecular Targets with Relevance to Insecticide Resistance in Colorado Potato Beetle Using dsRNA
1 Introduction
2 Materials
2.1 dsRNA Synthesis
2.2 Insects Acclimation, Injection, and Treatment
2.3 PCR and RT-qPCR
3 Methods
3.1 PCR-Based Template Preparation
3.2 dsRNA Synthesis
3.3 dsRNA Injection and insect Treatment
3.4 dsRNA-Mediated Target Knockdown Evaluation Via RT-qPCR
3.4.1 RNA Isolation
3.4.2 cDNA Synthesis
3.4.3 qPCR
4 Notes
References
Chapter 6: Visualization of RNA Transcripts in Western Corn Rootworm (Diabrotica virgifera virgifera) and Plants by In Situ Hy...
1 Introduction
2 Materials
2.1 Fixation and Embedding
2.2 Sectioning and Slide Storage
2.3 RNAscope Target Recovery
2.4 RNAscope Assay
2.5 Staining and Mounting
2.6 Viewing and Common Supplies
3 Methods
3.1 Fixation, Dehydration, and Infiltration
3.1.1 Manual Protocol
3.1.2 Automated Dehydration and Infiltration
3.2 Embedding
3.3 Sectioning
3.4 Deparaffinization
3.5 RNAscope 2.5 Assay
3.5.1 Target Recovery (Pretreatments)
3.5.2 Target Probe Hybridization
3.5.3 Signal Amplification
3.5.4 Signal Detection
3.6 Visualization and Evaluation of Images
4 Notes
References
Chapter 7: In Silico Screening of Attractive Target Genes for RNAi-Based Pest Control
1 Introduction
2 Materials
3 Methods
3.1 Gene or Protein Homology Comparison
3.2 Optimizing the specificity of dsRNA
3.3 Primer Design
4 Notes
References
Chapter 8: RNAi Feeding Bioassay: A Protocol for dsRNA Screening Against Asian Citrus Psyllid and Related Hemipteran Insects
1 Introduction
2 Materials
3 Methods
4 Notes
References
Chapter 9: A Random-Screening Approach to Identify RNAi Targets for the Control of Western Corn Rootworm (Diabrotica. virgifer...
1 Introduction
2 Materials
2.1 DNA Template Production
2.1.1 Plasmid DNA Isolation and Oligo Stacking
2.1.2 PCR Amplification of Target Gene Region
2.2 In Vitro Transcription
2.3 Insect Bioassay
2.4 Equipment and Other Materials
3 Methods
3.1 DNA Template Production
3.1.1 Plasmid DNA Preparation from cDNA Library
3.1.2 DNA Template Generation from Oligo Synthesis
3.1.3 PCR Amplification of Target Gene Region
3.2 In Vitro Transcription (IVT)
3.2.1 HT IVT Set-up (96-Well)
3.2.2 Standard IVT Tube Set up
3.3 WCR Diet Assay
3.3.1 Prepare Target dsRNA (on the Same Day to Set up WCR Feeding Plate; See Note 6)
3.3.2 Screen dsRNA in 96-Well Diet Assay
4 Notes
References
Chapter 10: Rapid Screening of Myzus persicae (Green Peach Aphid) RNAi Targets Using Tobacco Rattle Virus
1 Introduction
2 Materials
2.1 Plants, Aphids, and Growth Conditions
2.2 Vector and Constructs
2.3 Cloning cDNA Fragments into TRV
2.4 Agroinfiltration of TRV VIGS Vectors in N. benthamiana
2.5 In Planta dsRNA Expression
2.6 Aphid Bioassay
2.7 qPCR
3 Methods
3.1 Fragment Selection of Target Gene and Primer Design
3.2 Cloning the Selected Fragment into VIGS Vector
3.3 Prepare Agrobacterium Tumefaciens GV3101 Competent Cells
3.4 Transformation of pQ11-TRV2-GOI into Agrobacterium
3.5 Agroinfiltration of N. benthamiana Plants
3.6 Detection of in Planta dsRNA Expression
3.7 Aphid Bioassay on Infiltrated N. benthamiana Plants
3.8 qPCR Detection of Gene Silencing in Aphids
4 Notes
References
Chapter 11: Genome-Wide Identification and Validation of Target Genes Associated with Insecticide Treatment of the Green Peach...
1 Introduction
2 Materials
2.1 Insecticide Treatment and RNA Extraction from Aphids
2.2 Sample Preparation for RNA-Seq
2.3 Sequence Analyses to Identify DEGs
2.4 qPCR Validation of DEGs
3 Methods
3.1 Insecticide Treatment and Total RNA Extraction
3.1.1 Exposure of Aphids to Insecticide
3.1.2 Total RNA Extraction from Treated Aphids
3.2 Sample Preparation for RNA-Seq
3.2.1 mRNA Isolation, Fragmentation, and Priming
3.2.2 First-Strand cDNA Synthesis
3.2.3 Second-Strand cDNA Synthesis
3.2.4 cDNA End Repair
3.2.5 Adenylation of 3′ Ends of the cDNA
3.2.6 Adapter Ligation
3.2.7 DNA Fragment Enrichment
3.2.8 Quantification and Quality Control of the dscDNA Library
3.2.9 Normalization and Pooling of cDNA Libraries
3.3 RNA-Seq Data Analyses
3.3.1 Identification of Differentially Expressed Genes
3.3.2 In Silico Characterization of Differentially Expressed Genes
3.4 qPCR Validation of Differentially Expressed Genes
4 Notes
References
Chapter 12: Inhibition of Rhopalosiphum maidis (Corn Leaf Aphid) Growth on Maize by Virus-Induced Gene Silencing with Sugarcan...
1 Introduction
2 Materials
2.1 Cloning Target Sequences into pSCMV Vector
2.2 Biolistic Inoculation of pSCMV VIGS Constructs in Maize Seedlings
2.3 In Planta dsRNA Expression and Long-Term Storage of Infected Leaves
2.4 Rub-Inoculation of SCMV VIGS Constructs in Maize Seedlings
2.5 pSCMV VIGS on Aphids
3 Methods
3.1 Cloning Target Sequences into pSCMV Vector
3.2 Biolistic Inoculation of SCMV VIGS Constructs in Maize Seedlings (See Note 7)
3.3 In Planta dsRNA Expression and Long-Term Storage of Infected Leaves
3.4 Rub-Inoculation of SCMV VIGS Constructs in Maize Seedlings
3.5 pSCMV VIGS of Corn Leaf Aphids
3.5.1 Bioassay to Measure Aphid Fecundity
3.5.2 Measurement of Gene Silencing in Aphids
4 Notes
References
Chapter 13: RT-qPCR for Detection and Expression Monitoring of Core Genes Involved in the RNA Interference Pathways of Western...
1 Introduction
2 Materials
2.1 Insect Samples
2.2 RNA Isolation and DNase Treatment
2.3 Reverse Transcription
2.4 Quantitative PCR
3 Methods
3.1 RNA Isolation
3.2 Reverse Transcription
3.3 Quantitative PCR
3.4 Data Processing
4 Notes
References
Chapter 14: Examination of the Suitability of Attractive Target Genes for RNAi-Based Pest Control
1 Introduction
2 Materials
2.1 Examining the Expression of the Genes or Proteins of Interest in Insects
2.2 Synthesis of dsRNA
2.3 Increasing the Stability and Functionality of dsRNA
2.4 dsRNA Delivery
3 Methods
3.1 Examining Gene Expression by Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)
3.2 Synthesis of dsRNA
3.3 Increasing the Stability and Functionality of dsRNA (See Note 5)
3.4 dsRNA Delivery
4 Notes
References
Chapter 15: Functional Characterization of Target Genes Associated with Insecticide Resistance of the Green Peach Aphid, Myzus...
1 Introduction
2 Materials
2.1 Maintenance of GPA Colony
2.2 Synthesis of cDNA for Amplification of GOI and Reference Genes
2.2.1 Total RNA Extraction
2.2.2 Generation of cDNA
2.3 Preparation of DNA Templates for the Synthesis of Long dsRNA and siRNAs
2.3.1 Generation of DNA Templates for Synthesis of Long dsRNA
2.3.2 Generation of DNA Templates for Synthesis of siRNAs
2.4 Synthesis and Purification of Long dsRNA
2.5 Synthesis and Purification of siRNAs
2.5.1 Confirmation of Long dsRNA and siRNA Synthesis by Agarose Gel Electrophoresis
2.6 In Vitro RNAi of GOIs and Assessment of RNAi Effects
3 Methods
3.1 Maintenance of GPA Colony
3.2 Synthesis of cDNA for Amplification of GOI and Reference Genes
3.2.1 Total RNA Extraction from GPA
3.2.2 Generation of cDNA
3.3 Preparation of DNA Templates for Synthesis of Long dsRNAs and siRNAs
3.3.1 Preparation of DNA Templates for Synthesis of Long dsRNAs
3.3.2 Preparation of DNA Templates for Synthesis of siRNAs
3.4 Synthesis and Purification of Long dsRNA
3.5 Synthesis and Purification of siRNAs
3.5.1 Synthesis of siRNAs from Long dsRNA
3.5.2 Synthesis of siRNAs from DNA Templates
3.5.3 Confirmation of Long dsRNA and siRNA Synthesis by Agarose Gel Electrophoresis
3.6 In Vitro RNAi of GOIs and Assessment of RNAi Effects
3.6.1 Delivery of dsRNA and siRNA to 2nd and 3rd Instars of GPA
3.6.2 Assessment of RNAi Phenotypes After Delivery of dsRNA
3.6.3 Assessment of Gene Knockdown in RNAi-Treated Aphids
3.6.4 Determination of GOI´s Association with Insecticide Resistance
4 Notes
References
Chapter 16: Plant-Mediated RNA Interference Expressing dsRNA in Cytoplasm for RNAi-Based Pest Control
1 Introduction
2 Materials
3 Methods
4 Notes
References
Chapter 17: RNAi Expression in Cotton for Control of Herbivorous Insects
1 Introduction
2 Materials
2.1 Agrobacterium-Mediated Cotton Transgenesis
2.1.1 Cloning of Target Gene Fragment into Binary Vector
2.1.2 Agrobacterium Strain and Cotton Tissues Culture
2.1.3 DNA Extraction for Transgenesis Confirmation
2.2 Transient dsRNA Expression in Cotton Plants via VIGS
2.2.1 Use of Tobacco Rattle Virus-Based VIGS Vectors
2.2.2 Agrobacterium Culture Transformation and Agroinfiltration of Plants
2.2.3 DsRNA Expression Confirmation by RT-PCR
3 Methods
3.1 Cotton Transgenesis
3.1.1 Cloning of Target Gene Fragment into Binary Vector
3.1.2 Preparation of Agrobacterium Inoculant and Aseptic Seed Germination
3.1.3 Explant Transformation, Calli Selection and Proliferation
3.1.4 Somatic Embryogenesis, Embryo Germination, and Plantlet Development
3.1.5 DNA Isolation from Plant Tissues
3.2 Transient dsRNA Expression in Cotton Plants via VIGS
3.2.1 Cloning of Target and Control Fragment Genes into VIGS Vectors
3.2.2 Grow Cotton Seedlings and VIGS Agroinfiltration
3.2.3 RNA Extraction and VIGS Confirmation by RT-PCR
4 Notes
References
Chapter 18: Transplastomic Tomato Plants Expressing Insect-Specific Double-Stranded RNAs: A Protocol Based on Biolistic Transf...
1 Introduction
2 Materials
2.1 Plant Tissue Culture Media Components
2.2 Plant Tissue Culture Media Preparation
2.3 Plant Material
2.4 Materials for Preparation of Gold Particle Stock
2.5 Materials and Equipment for Bombardment of Micro-Tom Leaves
2.6 Materials for Total RNA Extraction from Micro-Tom Leaves
2.7 Materials for Removal of gDNA and ssRNA from Total RNA Samples
2.8 Materials for Synthesizing cDNA from dsRNA
2.9 Materials for RT-PCR and Agarose Gel Electrophoresis to Detect dsRNA
3 Methods
3.1 Plastome Transformation Strategies
3.2 General Considerations for Plastome Transformation Constructs
3.3 dsRNA Selection for Plastome Engineering
3.4 Plastome Transformation Vector for dsRNA Production in Tomato
3.5 Preparation of Gold Particle Stock
3.6 Coating of Gold Particles with pTomCT Plasmid
3.7 Biolistic Particle Delivery and Selection of Transplastomic Micro-Tom
3.8 Total RNA Extraction from Micro-Tom Tissues
3.9 Removing gDNA and ssRNA from Total RNA Samples
3.10 cDNA Synthesis from dsRNA
3.11 RT-PCR to Detect dsRNA
4 Notes
References
Chapter 19: Double-Strand RNA (dsRNA) Delivery Methods in Insects: Diaphorina citri
1 Introduction
2 Materials
3 Methods
3.1 dsRNA: Enzymatic Synthesis from gBlock Gene Fragment
3.2 dsRNA: Enzymatic Synthesis from Genomic DNA
3.3 Feeding dsRNA Delivery in Adults (Fig. 2a)
3.4 Soaking dsRNA Delivery in Nymphs in 4-5th Instar (Fig. 2b)
3.5 Topical-Feeding dsRNA Delivery in Nymphs in 4-5th Instar and Adults (Fig. 2c)
4 Notes
References
Chapter 20: Delivery of Double-Stranded RNAs (dsRNAs) Produced by Escherichia coli HT115(DE3) for Nontransgenic RNAi-Based Ins...
1 Introduction
2 Materials
2.1 dsRNA Vectors and Transformation of E. coli JM109
2.2 Preparation of Competent E. coli HT115(DE3)
2.3 Transformation of E. coli HT115(DE3)
2.4 In vivo dsRNA Production and Food Preparation
2.5 Nontransgenic RNAi Induction in Mosquito Larvae
2.6 Nontransgenic RNAi Induction in Triatomines
2.7 Nontransgenic RNAi Induction in Tetraphids
2.8 RNAi Verification with RT-PCR
3 Methods
3.1 dsRNA Vectors and Transformation of E. coli JM109
3.2 Preparation of Competent E. coli HT115(DE3)
3.3 Transformation of E. coli HT115(DE3)
3.4 dsRNA Production and Quantification
3.5 Artificial Bacterial Diet (ABD) Preparation for Larval Feedings (A. gambiae)
3.6 dsRNA Delivery in the Bloodmeal (R. prolixus)
3.7 dsRNA Delivery Through the Water Source (A. ludens)
3.8 Knockdown Verification Through Real-Time PCR and Phenotype Observation
4 Notes
References
Chapter 21: Symbiont-Mediated RNA Interference (SMR): Using Symbiotic Bacteria as Vectors for Delivering RNAi to Insects
1 Introduction
2 Materials
2.1 Insect Husbandry
2.2 Deriving RNaseIII-Deficient BFo2 Mutant
2.3 Bacterial Expression of dsRNA
2.4 Introduction of Recombinant Bacteria into Western Flower Thrips
2.5 Verification of RNAi in Western Flower Thrips
3 Methods
3.1 Deriving RNaseIII-Deficient BFo2 Mutant
3.2 Bacterial Expression of dsRNA
3.3 Introduction of Recombinant Bacteria into Western Flower Thrips
3.4 Verification of RNAi in Western Flower Thrips
4 Notes
References
Chapter 22: Application of Nanoparticle-Mediated RNAi for Efficient Gene Silencing and Pest Control on Soybean Aphids
1 Introduction
2 Materials
2.1 RNA Extraction and cDNA Synthesis
2.2 dsRNA Synthesis
2.3 Preparation of the dsRNA- Nanocarrier-Detergent Formulation
2.4 RNAi and Lethal Effects of dsRNA- Nanocarrier-Detergent Formulation
3 Methods
3.1 RNA Extraction and cDNA Synthesis
3.2 dsRNA Synthesis
3.3 Preparation of the dsRNA- Nanocarrier-Detergent
3.4 RNAi and Lethal Effects of dsRNA- Nanocarrier-Detergent Formulation
4 Notes
References
Chapter 23: Methods for Delivery of dsRNAs for Agricultural Pest Control: The Case of Lepidopteran Pests
1 Introduction
2 Materials
2.1 Identifying an Insect Target Gene Fragment for dsRNA Production
2.2 Cloning Gene Fragment from Target Species into E. coli
2.3 In Vitro Transcription of Cloned Gene Fragment into dsRNA
2.4 dsRNA Delivery in Solution
2.4.1 Leaf Uptake of dsRNA for Larval Ingestion
2.4.2 Delivery of dsRNA Solution in Droplet Offer to D. saccharalis Larvae
2.5 Delivery of E. coli Expressing dsRNA to Insect Larvae in Artificial Diets
2.6 Developing Transgenic Plants
2.6.1 Cloning Target-Gene Fragment into a Binary Vector for Gene Silencing by RNAi
2.6.2 Plant Transformation
2.7 Evaluation of RNAi Effects in Insects
2.7.1 Evaluation of Biological Effects of Gene Silencing by RNAi
2.7.2 Analysis of Gene Expression by Quantitative Amplification of Reversed Transcripts (RT-qPCR)
3 Methods
3.1 Identifying an Insect Target Gene Fragment for dsRNA Production
3.2 Cloning the Target Gene Fragment from the Object Species into Escherichia coli
3.3 In Vitro Transcription for dsRNA Synthesis
3.4 dsRNA Delivery in Solution
3.4.1 Leaf Uptake of dsRNA to Evaluate Larval Ingestion
3.4.2 Delivery of dsRNA Solution in Droplet Offer to D. saccharalis Larvae (See Note 11)
3.5 Delivery of E. coli Expressing dsRNA to Insect Larvae in Artificial Diets
3.5.1 Cloning the Target Gene Fragment into E. coli HT115 (DE3)
3.5.2 Validation of dsRNA Production by E. coli HT115 (DE3) (See Note 17)
3.5.3 Delivery of E. coli HT115 (DE3) Expressing dsRNA to Insect Larvae in Artificial Diets
3.6 Developing Transgenic Plants
3.6.1 Plant Genetic Transformation with the RNAi Silencing Constructs
3.6.2 Genetic Analysis of the Transgenic Plants
3.7 Evaluating RNAi Effects in Insects
3.7.1 Evaluation of General Biological Parameters
3.7.2 Analysis of Gene Expression via RT-PCR
4 Notes
References
Chapter 24: CRISPR/Cas9-Mediated Genome Editing System in Insect Genomics and Pest Management
1 Introduction
2 Materials
2.1 sgRNA Synthesis
2.2 Cas9 mRNA Synthesis
2.3 Embryo Microinjection and Mutation Detection
3 Methods
3.1 Target Site Selection
3.2 sgRNA Synthesis and Purification
3.2.1 Preparation of sgRNA Template
3.2.2 sgRNA Synthesis and Purification
3.3 In Vitro Transcription and Purification of Cas9 mRNA
3.3.1 Preparation of the Template for Cas9 mRNA Synthesis
3.3.2 Synthesis of Cas9 mRNA
3.4 Microinjection of sgRNA and Cas9 mRNA
3.4.1 Preparation Before Microinjection
3.4.2 Preparation of Embryos for Microinjection
3.4.3 Microinjection of Embryos
3.4.4 Growth of Injected Embryos
3.5 Mutation Detection
4 Notes
References
Index
Recommend Papers
![Integrated Pest Management: Concepts, Tactics, Strategies and Case Studies [1 ed.]
0521875951, 9780521875950, 0521699312, 9780521699310](https://ebin.pub/img/200x200/integrated-pest-management-concepts-tactics-strategies-and-case-studies-1nbsped-0521875951-9780521875950-0521699312-9780521699310.jpg)
![Biotechnological Approaches for Pest Management and Ecological Sustainability [1 ed.]
1560221631, 9781560221630, 9781420088489](https://ebin.pub/img/200x200/biotechnological-approaches-for-pest-management-and-ecological-sustainability-1nbsped-1560221631-9781560221630-9781420088489.jpg)
![RNAi Strategies for Pest Management: Methods and Protocols [2360, 1 ed.]
1071616323, 9781071616321](https://ebin.pub/img/200x200/rnai-strategies-for-pest-management-methods-and-protocols-2360-1nbsped-1071616323-9781071616321.jpg)
- Author / Uploaded
- Luis María Vaschetto
File loading please wait...
Citation preview
Methods in Molecular Biology 2360
Luis María Vaschetto Editor
RNAi Strategies for Pest Management Methods and Protocols
METHODS
IN
MOLECULAR BIOLOGY
Series Editor John M. Walker School of Life and Medical Sciences University of Hertfordshire Hatfield, Hertfordshire, UK
For further volumes: http://www.springer.com/series/7651
For over 35 years, biological scientists have come to rely on the research protocols and methodologies in the critically acclaimed Methods in Molecular Biology series. The series was the first to introduce the step-by-step protocols approach that has become the standard in all biomedical protocol publishing. Each protocol is provided in readily-reproducible step-bystep fashion, opening with an introductory overview, a list of the materials and reagents needed to complete the experiment, and followed by a detailed procedure that is supported with a helpful notes section offering tips and tricks of the trade as well as troubleshooting advice. These hallmark features were introduced by series editor Dr. John Walker and constitute the key ingredient in each and every volume of the Methods in Molecular Biology series. Tested and trusted, comprehensive and reliable, all protocols from the series are indexed in PubMed.
RNAi Strategies for Pest Management Methods and Protocols
Edited by
Luis María Vaschetto Oncativo, Argentina
Editor Luis Marı´a Vaschetto Oncativo, Argentina
ISSN 1064-3745 ISSN 1940-6029 (electronic) Methods in Molecular Biology ISBN 978-1-0716-1632-1 ISBN 978-1-0716-1633-8 (eBook) https://doi.org/10.1007/978-1-0716-1633-8 © The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2022 Open Access Chapter 18 is licensed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/). For further details see license information in the chapter. This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. This Humana imprint is published by the registered company Springer Science+Business Media, LLC, part of Springer Nature. The registered company address is: 1 New York Plaza, New York, NY 10004, U.S.A.
Dedication ˜ ar Dedicado a los que nos dejaron en este 2020, especialmente a vos Rau´l. Te vamos a extran mucho.
Preface The RNA interference (RNAi) mechanism is a conserved gene silencing process that occurs in eukaryotic organisms across the evolutionary spectrum. This process can be triggered by both endogenous (siRNAs, miRNAs, piRNAs) and exogenous, artificially synthesized, double-stranded RNAs (dsRNAs) that bind to their target mRNAs in a sequence-specific manner. In the last few years, RNAi has rapidly emerged as a powerful technology to inhibit gene expression, and it has also provided a technique toward pest management. The use of double-stranded RNAs (dsRNAs), designed to silence target pest genes, may represent a new approach for improving crop resistance to pathogens by coopting evolutionary conserved molecular mechanisms of pest species. This approach has a series of advantages when compared with traditional pesticides, which have historically raised concerns regarding evolution of resistance, environmental pollution, and harmful effects on human health. RNAi Strategies for Pest Management: Methods and Protocols offers one of the most promising approaches to sustainable development of eco-friendly pest management systems. This volume of Methods in Molecular Biology compiles experimental procedures from leading scientists actively working in the design of novel RNAi-mediated pest control strategies and related issues. Cutting-edge tools and resources are highlighted as follows: identification and characterization of differentially expressed noncoding RNAs and core components of the RNAi machinery in insect genomes, insights to design functional small RNAs, analysis of endogenous RNAi pathways, practices for RNAi screening, identification of target genes linked to pesticide resistance, plant models for RNAi-mediated pest control, methods for dsRNA delivery, and, finally, a proof-of-concept of the CRISPR-Cas9 genome editing system for use in RNAi research and pest management. Each of the chapters in this book has been carefully selected in order to give detailed step-by-step procedures addressing how to design, implement, and evaluate effective RNAi-based control strategies for pest management. Luis Marı´a Vaschetto
Oncativo, Argentina
vii
Contents Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
vii xi
1 Genome-Wide Identification and Functional Characterization of Noncoding RNAs (ncRNAs) Differentially Expressed During Insect Development . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 Yue Wang, Minsheng You, and Weiyi He 2 Identification and Functional Characterization of Argonaute (Ago) Proteins in Insect Genomes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9 Bernard Moussian and Nicolas Casadei 3 Functional Characterization of Silkworm PIWI Proteins by Embryonic RNAi . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19 Takashi Kiuchi and Susumu Katsuma 4 Guiding RNAi Design Through Characterization of Endogenous Small RNA Pathways . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33 Jacob O. Peter, Yulica Santos-Ortega, and Alex Flynt 5 Silencing of Molecular Targets with Relevance to Insecticide Resistance in Colorado Potato Beetle Using dsRNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 49 Raed Bouafoura, Mariem Ben Youssef, and Pier Jr Morin 6 Visualization of RNA Transcripts in Western Corn Rootworm (Diabrotica virgifera virgifera) and Plants by In Situ Hybridization . . . . . . . . . . . 59 Joseph P. Steimel and Xu Hu 7 In Silico Screening of Attractive Target Genes for RNAi-Based Pest Control. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 75 Weilin Zhang 8 RNAi Feeding Bioassay: A Protocol for dsRNA Screening Against Asian Citrus Psyllid and Related Hemipteran Insects . . . . . . . . . . . . . . . . . . . . . . . . 85 Jonatha dos Santos Silva, Layanna Rebouc¸as de Santana Cerqueira, Wayne Bextine Hunter, and Eduardo Chumbinho de Andrade 9 A Random-Screening Approach to Identify RNAi Targets for the Control of Western Corn Rootworm (Diabrotica. virgifera virgifera Le Conte). . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 91 Xu Hu and Adane Kassa 10 Rapid Screening of Myzus persicae (Green Peach Aphid) RNAi Targets Using Tobacco Rattle Virus . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 105 Honglin Feng and Georg Jander 11 Genome-Wide Identification and Validation of Target Genes Associated with Insecticide Treatment of the Green Peach Aphid, Myzus persicae . . . . . . . . . 119 Sadia Iqbal, John Fosu-Nyarko, Frances Brigg, and Michael G. K. Jones 12 Inhibition of Rhopalosiphum maidis (Corn Leaf Aphid) Growth on Maize by Virus-Induced Gene Silencing with Sugarcane Mosaic Virus. . . . . . . . . 139 Seung Ho Chung and Georg Jander
ix
x
13
Contents
RT-qPCR for Detection and Expression Monitoring of Core Genes Involved in the RNA Interference Pathways of Western Corn Rootworm (Diabrotica virgifera virgifera) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Courtney A. Davis-Vogel Examination of the Suitability of Attractive Target Genes for RNAi-Based Pest Control. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Weilin Zhang Functional Characterization of Target Genes Associated with Insecticide Resistance of the Green Peach Aphid, Myzus persicae . . . . . . . . . . . . . . John Fosu-Nyarko, Sadia Iqbal, Frances Brigg, and Michael G. K. Jones Plant-Mediated RNA Interference Expressing dsRNA in Cytoplasm for RNAi-Based Pest Control . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Weilin Zhang RNAi Expression in Cotton for Control of Herbivorous Insects . . . . . . . . . . . . . . Ricardo Salvador, Laura Maskin, Jose´ Niz, Mariana Turica, Analı´a Pedarros, Esteban Hopp, and Dalia Lewi Transplastomic Tomato Plants Expressing Insect-Specific Double-Stranded RNAs: A Protocol Based on Biolistic Transformation . . . . . . . Emine Kaplanoglu, Igor Kolotilin, Rima Menassa, and Cam Donly Double-Strand RNA (dsRNA) Delivery Methods in Insects: Diaphorina citri . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Yulica Santos-Ortega and Alex Flynt Delivery of Double-Stranded RNAs (dsRNAs) Produced by Escherichia coli HT115(DE3) for Nontransgenic RNAi-Based Insect Pest Management . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Mabel L. Taracena, Isabella Garcia Caffaro, Gabriela O. Paiva-Silva, Pedro L. Oliveira, Pedro A. Rendon, Ellen M. Dotson Pamela M. Pennington Symbiont-Mediated RNA Interference (SMR): Using Symbiotic Bacteria as Vectors for Delivering RNAi to Insects . . . . . . . . . . . . . . . . . . . . . . . . . . Paul Dyson, Marcela Figueiredo, Awawing A. Andongma, and Miranda M. A. Whitten Application of Nanoparticle-Mediated RNAi for Efficient Gene Silencing and Pest Control on Soybean Aphids . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Shuo Yan and Jie Shen Methods for Delivery of dsRNAs for Agricultural Pest Control: The Case of Lepidopteran Pests . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Bruna Garbatti Factor, Flavia de Moura Manoel Bento, and Antonio Figueira CRISPR/Cas9-Mediated Genome Editing System in Insect Genomics and Pest Management . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Rihui Yan and Xianwu Lin
253
Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
367
14
15
16
17
18
19
20
21
22
23
24
155
175
187
209 217
235
279
295
307
317
347
Contributors AWAWING A. ANDONGMA • Institute of Life Science, Swansea University Medical School, Singleton Park, Swansea, UK RAED BOUAFOURA • Department of Chemistry and Biochemistry, Universite´ de Moncton, Moncton, NB, Canada FRANCES BRIGG • Western Australian State Agricultural Biotechnology Centre, College of Science, Health, Engineering and Education, Murdoch University, Perth, WA, Australia NICOLAS CASADEI • Universit€ atsklinikum Tu¨bingen, Institute for Medical Genetics and Applied Genomics, Tu¨bingen, Germany LAYANNA REBOUC¸AS DE SANTANA CERQUEIRA • Federal University of Reconcavo da Bahia, Cruz das Almas, BA, Brazil SEUNG HO CHUNG • Boyce Thompson Institute, Ithaca, NY, USA COURTNEY A. DAVIS-VOGEL • Research and Development, Corteva Agriscience, Johnston, IA, USA EDUARDO CHUMBINHO DE ANDRADE • Embrapa Cassava and Fruits, Cruz das Almas, BA, Brazil FLAVIA DE MOURA MANOEL BENTO • Escola Superior de Agricultura “Luiz de Queiroz”, Universidade de Sa˜o Paulo, Piracicaba, SP, Brazil CAM DONLY • London Research and Development Centre, Agriculture and Agri-Food Canada, London, ON, Canada; Department of Biology, University of Western Ontario, London, ON, Canada ELLEN M. DOTSON • Division of Parasitic Diseases and Malaria, Entomology Branch, Centers for Disease Control and Prevention (CDC), Center for Global Health, Atlanta, GA, USA PAUL DYSON • Institute of Life Science, Swansea University Medical School, Singleton Park, Swansea, UK HONGLIN FENG • Boyce Thompson Institute, Ithaca, NY, USA ANTONIO FIGUEIRA • Centro de Energia Nuclear na Agricultura, Universidade de Sa˜o Paulo, Piracicaba, SP, Brazil MARCELA FIGUEIREDO • Institute of Life Science, Swansea University Medical School, Singleton Park, Swansea, UK ALEX FLYNT • School of Biological, Environmental and Earth Sciences, The University of Southern Mississippi, Hattiesburg, MS, USA; Cellular and Molecular Biology, The University of Southern Mississippi, Hattiesburg, MS, USA JOHN FOSU-NYARKO • Crop Biotechnology Research Group, College of Science, Health, Engineering and Education, Murdoch University, Perth, WA, Australia; Western Australian State Agricultural Biotechnology Centre, College of Science, Health, Engineering and Education, Murdoch University, Perth, WA, Australia BRUNA GARBATTI FACTOR • Escola Superior de Agricultura “Luiz de Queiroz”, Universidade de Sa˜o Paulo, Piracicaba, SP, Brazil ISABELLA GARCIA CAFFARO • Centro de Estudios en Biotecnologı´a (CEB) Affiliated to the Centro de Estudios en Salud, Universidad del Valle de Guatemala (UVG), Guatemala, Guatemala
xi
xii
Contributors
WEIYI HE • State Key Laboratory for Ecological Pest Control of Fujian and Taiwan Crops, Institute of Applied Ecology, Fujian Agriculture and Forestry University, Fuzhou, China; International Joint Research Laboratory of Ecological Pest Control, Ministry of Education, Fujian Agriculture and Forestry University, Fuzhou, China; Key Laboratory of Integrated Pest Management for Fujian-Taiwan Crops, Ministry of Agriculture, Fuzhou, China ESTEBAN HOPP • IABIMO-Instituto de Biotecnologı´a (IB-CICVyA), INTA-CONICET, Hurlingham, Provincia de Buenos Aires, Argentina; Laboratorio de Agrobiotecnologı´a, DFBMC, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Buenos Aires, Argentina XU HU • Corteva AgriScience, Johnston, IA, USA WAYNE BEXTINE HUNTER • USDA, ARS, U.S. Horticultural Research Laboratory, Fort Pierce, FL, USA SADIA IQBAL • Crop Biotechnology Research Group, College of Science, Health, Engineering and Education, Murdoch University, Perth, WA, Australia; Western Australian State Agricultural Biotechnology Centre, College of Science, Health, Engineering and Education, Murdoch University, Perth, WA, Australia GEORG JANDER • Boyce Thompson Institute, Ithaca, NY, USA MICHAEL G. K. JONES • Crop Biotechnology Research Group, College of Science, Health, Engineering and Education, Murdoch University, Perth, WA, Australia; Western Australian State Agricultural Biotechnology Centre, College of Science, Health, Engineering and Education, Murdoch University, Perth, WA, Australia EMINE KAPLANOGLU • London Research and Development Centre, Agriculture and AgriFood Canada, London, ON, Canada ADANE KASSA • Corteva AgriScience, Johnston, IA, USA SUSUMU KATSUMA • Department of Agricultural and Environmental Biology, Graduate School of Agricultural and Life Sciences, The University of Tokyo, Tokyo, Japan TAKASHI KIUCHI • Department of Agricultural and Environmental Biology, Graduate School of Agricultural and Life Sciences, The University of Tokyo, Tokyo, Japan IGOR KOLOTILIN • Solar Grants Biotechnology Inc, London, ON, Canada DALIA LEWI • Instituto de Gene´tica (IGEAF-CICVyA), INTA, Hurlingham, Provincia de Buenos Aires, Argentina XIANWU LIN • College of Plant Protection, Hainan University, Haikou, Hainan Province, China; Key Laboratory of Green Prevention and Control of Tropical Plant Diseases and Pests (Hainan University), Ministry of Education, Haikou, Hainan Province, China LAURA MASKIN • Instituto de Gene´tica (IGEAF-CICVyA), INTA, Hurlingham, Provincia de Buenos Aires, Argentina RIMA MENASSA • London Research and Development Centre, Agriculture and Agri-Food Canada, London, ON, Canada; Department of Biology, University of Western Ontario, London, ON, Canada PIER JR MORIN • Department of Chemistry and Biochemistry, Universite´ de Moncton, Moncton, NB, Canada BERNARD MOUSSIAN • Universite´ Coˆte d’Azur, Nice, France JOSE´ NIZ • Instituto de Microbiologı´a y Zoologı´a Agrı´cola (IMYZA-CICVyA), INTA, Hurlingham, Provincia de Buenos Aires, Argentina PEDRO L. OLIVEIRA • Programa de Biologia Molecular e Biotecnologia, Instituto de Bioquı´mica Me´dica Leopoldo de Meis, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil
Contributors
xiii
GABRIELA O. PAIVA-SILVA • Programa de Biologia Molecular e Biotecnologia, Instituto de Bioquı´mica Me´dica Leopoldo de Meis, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil ANALI´A PEDARROS • Instituto de Microbiologı´a y Zoologı´a Agrı´cola (IMYZA-CICVyA), INTA, Hurlingham, Provincia de Buenos Aires, Argentina PAMELA M. PENNINGTON • Centro de Estudios en Biotecnologı´a (CEB) Affiliated to the Centro de Estudios en Salud, Universidad del Valle de Guatemala (UVG), Guatemala, Guatemala JACOB O. PETER • School of Biological, Environmental and Earth Sciences, The University of Southern Mississippi, Hattiesburg, MS, USA PEDRO A. RENDON • International Atomic Energy Agency, Technical Cooperation Projects for the Region of Latin America and the Caribbean, IAEA/TC-LAC – USDA/APHIS Moscamed Program, Guatemala, Guatemala RICARDO SALVADOR • Instituto de Microbiologı´a y Zoologı´a Agrı´cola (IMYZA-CICVyA), INTA, Hurlingham, Provincia de Buenos Aires, Argentina YULICA SANTOS-ORTEGA • School of Biological, Environmental and Earth Sciences, The University of Southern Mississippi, Hattiesburg, MS, USA; Cellular and Molecular Biology, The University of Southern Mississippi, Hattiesburg, MS, USA JIE SHEN • Department of Plant Biosecurity and MOA Key Lab of Pest Monitoring and Green Management, College of Plant Protection, China Agricultural University, Beijing, People’s Republic of China JONATHA DOS SANTOS SILVA • Federal University of Reconcavo da Bahia, Cruz das Almas, BA, Brazil JOSEPH P. STEIMEL • Corteva Agriscience, Johnston, IA, USA MABEL L. TARACENA • Division of Parasitic Diseases and Malaria, Entomology Branch, Centers for Disease Control and Prevention (CDC), Center for Global Health, Atlanta, GA, USA; Entomology Department, College of Agriculture and Life Sciences, Cornell University, Ithaca, NY, USA MARIANA TURICA • Instituto de Gene´tica (IGEAF-CICVyA), INTA, Hurlingham, Provincia de Buenos Aires, Argentina YUE WANG • State Key Laboratory for Ecological Pest Control of Fujian and Taiwan Crops, Institute of Applied Ecology, Fujian Agriculture and Forestry University, Fuzhou, China; International Joint Research Laboratory of Ecological Pest Control, Ministry of Education, Fujian Agriculture and Forestry University, Fuzhou, China; Key Laboratory of Integrated Pest Management for Fujian-Taiwan Crops, Ministry of Agriculture, Fuzhou, China MIRANDA M. A. WHITTEN • Institute of Life Science, Swansea University Medical School, Singleton Park, Swansea, UK RIHUI YAN • College of Plant Protection, Hainan University, Haikou, Hainan Province, China; Key Laboratory of Green Prevention and Control of Tropical Plant Diseases and Pests (Hainan University), Ministry of Education, Haikou, Hainan Province, China SHUO YAN • Department of Plant Biosecurity and MOA Key Lab of Pest Monitoring and Green Management, College of Plant Protection, China Agricultural University, Beijing, People’s Republic of China MINSHENG YOU • State Key Laboratory for Ecological Pest Control of Fujian and Taiwan Crops, Institute of Applied Ecology, Fujian Agriculture and Forestry University, Fuzhou, China; International Joint Research Laboratory of Ecological Pest Control, Ministry of Education, Fujian Agriculture and Forestry University, Fuzhou, China; Key Laboratory of
xiv
Contributors
Integrated Pest Management for Fujian-Taiwan Crops, Ministry of Agriculture, Fuzhou, China MARIEM BEN YOUSSEF • Department of Chemistry and Biochemistry, Universite´ de Moncton, Moncton, NB, Canada WEILIN ZHANG • College of Chemistry and Life Sciences, Zhejiang Normal University, Jinhua, Zhejiang, P. R. China
Chapter 1 Genome-Wide Identification and Functional Characterization of Noncoding RNAs (ncRNAs) Differentially Expressed During Insect Development Yue Wang, Minsheng You, and Weiyi He Abstract MicroRNAs (miRNAs) are important regulatory noncoding RNAs (ncRNAs) at the posttranscriptional level of gene expression. Linear long noncoding RNAs (lncRNAs) and circular RNAs (circRNAs) can function as competing endogenous RNAs (ceRNAs) of miRNAs and regulate the expression of proteincoding genes. This chapter presents a procedure for the bioinformatic analysis of these three ncRNAs that are differentially expressed during insect development. In the first step, lncRNAs and circRNAs are identified based on RNA-sequencing data. In the second step, miRNAs are identified based on small RNA-sequencing data and combined with the two ncRNAs from the previous step for functional characterization. Key words Noncoding RNAs, Transcriptome analysis, Target gene prediction
1
Introduction As an increasing number of insect genomes have been published, whole transcriptome analysis based on total RNA sequencing (including RNA-sequencing and small RNA-sequencing) has become a popular way to monitor the population of RNAs and their expression during insect development [1]. In addition to messenger RNAs (mRNAs) that can be translated into proteins, total RNA-sequencing has provided insights on the multiple classes of noncoding RNAs (ncRNAs) that are also transcribed from the genome. Among the classes of ncRNAs, microRNAs (miRNAs), linear long noncoding RNAs (lncRNAs) and circular RNAs (circRNAs) have received particular attention in recent years. In this chapter, we provide details for the identification of these three ncRNAs that are differentially expressed during insect development based on total RNA-sequencing data (Fig. 1).
Luis Marı´a Vaschetto (ed.), RNAi Strategies for Pest Management: Methods and Protocols, Methods in Molecular Biology, vol. 2360, https://doi.org/10.1007/978-1-0716-1633-8_1, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2022
1
2
Yue Wang et al.
Fig. 1 Workflow for identification and functional characterization of differentially expressed ncRNAs during insect development. References: [2–12]. RNA-seq: RNA-sequencing; DE: differentially expressed; >200 nt: transcripts longer than 200 nt; FPKM> ¼ 1 in >2 sets: transcripts with FPKM > ¼ 1 in more than two sequencing sets; (mapped reads/total reads)*106: the formula used to normalize the expression of miRNAs; fold change > ¼ 2: differentially expressed miRNAs between two samples were selected using a fold change > ¼ 2; The hollow arrow indicates the flow, the dotted line indicates the relationship; the solid boxes mark the tools and operations; and the dashed boxes mark the samples and data
MiRNAs are small ncRNAs with a length of 18–22 nt. They are highly conserved among species [13] and play important roles in many physiological and pathological processes by targeting mRNAs to regulate their expression [14–16]. In general, two main strategies are applied for the computational identification of miRNAs: sequence conservation, which is used to identify homologous miRNAs and secondary structure prediction of precursor sequences, which is used to identify species-specific miRNAs. The software mirdeep2 [2], which is applied in this chapter, contains these two features. Long ncRNAs are untranslated transcripts longer than 200 nt that can be divided into linear lncRNAs and circular circRNAs based on their structures [17, 18], and they are primarily identified by evaluating the encoding potential of transcripts. Multiple tools are usually selected to perform comprehensive analyses. In this chapter, three tools are used for lncRNA identification and two tools are used for circRNA identification. Both lncRNAs and circRNAs with miRNA responsive elements (MREs) can function as competing endogenous RNAs (ceRNAs) to regulate the distribution of miRNA molecules on mRNAs and thereby relieve the inhibition of miRNA on its target genes [19–
Identification and Functional Characterization of ncRNAs
3
22]. In this chapter, we also discuss the functional characterization of lncRNAs and circRNAs as ceRNAs (Fig. 1). Two tools are used to predict the MREs within lncRNAs and circRNAs.
2
Materials
2.1 General Materials
1. A computer with a Unix/Linux operating system. 2. A file of genomic sequences of the target species in Fasta format. 3. A gtf/gff3 file of protein-coding genes for the genomic sequences. 4. A file of protein-coding gene sequences of the genome in Fasta format.
2.2 Identification of Differentially Expressed lncRNAs and circRNAs During Insect Development
1. A series of clean RNA-sequencing reads from different developmental stages stored in Fasta or Fastq format files. 2. Bowtie2 [3] (available at http://bowtie-bio.sourceforge.net/ bowtie2/index.shtml) should be installed. 3. A set of ribosomal RNA (rRNA) sequences downloaded from the Rfam database [23]. 4. STAR [4] (available at https://github.com/alexdobin/STAR/) should be installed. 5. Stringtie [5] (available at http://ccb.jhu.edu/software/ stringtie/) should be installed. 6. TransDecoder (available at https://github.com/Tra nsDecoder/TransDecoder.wiki.git) should be installed. 7. BLAST+ (available at https://blast.ncbi.nlm.nih.gov/Blast. cgi?PAGE_TYPE¼BlastDocs&DOC_TYPE¼Download) should be installed. 8. Hmmer3 (available at http://hmmer.org/) should be installed. 9. UniProt (available at https://www.uniprot.org/) data downloaded from the online database. 10. Pfam (available at http://pfam.xfam.org/) data downloaded from the online database. 11. CNCI [6] (available at https://github.com/www-bioinfoorg/CNCI) should be installed. 12. Cpat [7] (available at https://sourceforge.net/projects/rnacpat/files/?source¼navbar) should be installed. 13. Feelnc [8] (available at https://github.com/tderrien/ FEELnc) should be installed. 14. CIRCexplorer2 [9] (available at https://github.com/ YangLab/CIRCexplorer2) should be installed.
4
Yue Wang et al.
15. CircRNA_finder [10] (available at https://github.com/ orzechoj/circRNA_finder) should be installed. 16. R package DEseq2 (available at https://bioconductor.org/ packages/release/bioc/html/DESeq2.html) should be installed. 2.3 Identification of Differentially Expressed miRNAs During Insect Development and Functional Characterization of ceRNAs
1. A series of clean small RNA-sequencing reads from different developmental stages stored in Fasta or Fastq format files. 2. MirDeep2 [2] (available at https://github.com/rajewsky-lab/ mirdeep2) should be installed. 3. Files of known miRNA sequences and known miRNA precursor (pre-miRNA) sequences of the target species in Fasta format. 4. A file of known miRNA sequences of closely related species in Fasta format downloaded from the miRBase (available at http://www.mirbase.org/). 5. miRanda [11] (available at http://cbio.mskcc.org/microrna_ data/miRanda-aug2010.tar.gz) should be installed. 6. RNAhybrid [12] (available at https://bibiserv.cebitec.unibielefeld.de/download/tools/rnahybrid.html) should be installed.
3
Methods (See Note 1)
3.1 Identification of Differentially Expressed lncRNAs and circRNAs During Insect Development
This pipeline assumes that the investigator starts with a series of clean RNA-sequencing reads from a series of developmental stages as well as a set of genomic sequences for mapping reads. 1. Bowtie2 is used to identify the reads from rRNAs, and delete the reads that were aligned in the file “output.sam”. The command line setup. bowtie2 --local --no-hd --no-unal -x rRNA_data -q -1 RNAseq_R1.fq -2 RNAseq_R2.fq -S output.sam 2. After mapping the RNA-sequencing reads to the genome using STAR, reads aligned to the back-splicing junction are used to identify circRNAs (command line ③) and the remaining reads are used to assemble linear transcripts (command line ②) (see Note 2). The command line setup. ① STAR --runThreadN 20 --runMode genomeGenerate -genomeDir ~/Index2 --genomeFastaFiles genome.fa ② STAR --runMode alignReads --runThreadN 20 --genomeDir ~/Index2 --readFilesIn seq_R1.fq seq_R2.fq --
Identification and Functional Characterization of ncRNAs
5
outFileNamePrefix output --outSAMtype BAM SortedByCoordinate --readNameSeparator space ③ STAR --chimSegmentMin 10 --runThreadN 20 --genomeDir ~/Index2 --readFilesIn seq_R1.fq seq_R2.fq --outFileNamePrefix ./cirRNA/output 3. The linear transcripts are assembled using stringtie. The command line setup. stringtie mapping.bam -o mapping.gff -p 20 -G known_gene. gff3 --rf -A output.tab -C output.gtf -j 2 4. After deleting the known protein-coding transcripts, TransDecoder is used to identify candidate coding regions within new transcript sequences. The command line setup. Step 1 TransDecoder.LongOrfs -t new_transcripts.fa Step 2 ① blastp -query longest_orfs.pep -db uniprot_sprot.pep -num_threads 20 -max_target_seqs 1 -outfmt 6 > blastp_uniprot.outfmt6 (see Note 3) ② hmmscan --cpu 20 --domtblout pfam.domtblout Pfam-A. hmm longest_orfs.pep > pfam.log Step 3 TransDecoder.Predict -t new_transcripts.fa --retain_pfam_hits pfam.domtblout --retain_blastp_hits blastp. outfmt6 5. The CNCI (command line ②) and cpat (command line ①) are called to evaluate the coding potential of new transcripts without candidate coding regions. If a new transcript without a candidate coding region obtains a score less than 0 from CNCI and a score less than 0.39 from cpat, it is selected as a candidate lncRNA. All the candidate lncRNAs are further filtered using feelnc to generate the final set of identified lncRNAs (command line ③). The command line setup. ① cpat.py -g transcripts.fa -d Model.RData –x Hexamer.tsv -o output (see Note 4) ② python CNCI_package/CNCI.py -f transcripts.fa -o CNCI_out -m ve -p 20 ③
FEELnc_codpot.pl -i candidate_lncRNAs.fa known_mRNA.gtf -g genome.fa
-a
6. CIRCexplorer2 (command lines ① and ②) and circRNA_finder (command line ③) are used to identify circRNAs based on the output file of STAR. The circRNAs identified by both CIRCexplorer2 and circRNA_finder are selected as the final set of circRNAs. The command line setup.
6
Yue Wang et al.
① CIRCexplorer2 parse -t STAR Chimeric.out.junction > parse.log ② CIRCexplorer2 annotate -r known_gene.gff3 -g genome.fa -b back_spliced_junction.bed -o cirRNA_known.txt > annotate.log ③ perl postProcessStarAlignment.pl --starDir star_out_dir -minLen 100 --outDir output_dir 7. Stringtie software is used to count the number of reads mapped to each lncRNA or circRNA (command lines ① and ②). Differentially expressed transcripts between two developmental stages are assessed by the R package DEseq2 using a FDR < 0.05 and a fold change > ¼ 2 (for details, see the “help” menu of DEseq2). The command line setup. ① stringtie out.bam -b ./outDir -p 20 -G transcripts.gtf --rf -j 2 -e -o ./sample.gtf ② python prepDE.py -i list.txt -l 150 (see Note 5) 3.2 Identification of Differentially Expressed miRNAs During Insect Development and Functional Characterization of ceRNAs from lncRNAs and circRNAs
1. This protocol assumes that the investigator starts with a series of clean small RNA-sequencing reads from the same samples subjected to RNA-sequencing in Subheading 3.1. MirDeep2 is used to identify miRNAs and count the number of reads mapped to each miRNA. The command line setup. ① mapper.pl small_RNA_seq.fq -e -h -j -m -p genome_index -s out_collapsedreads.fa -t out_mapping.arf (see Note 6) ② miRDeep2.pl out_collapsedreads.fa genome.fa out_mapping.arf known_mature_miRNA.fa other_mature.fa known_pre_miRNA.fa -r output -P –v 2. The normalized expression of miRNAs was calculated by this formula: Normalized expression ¼ (mapped reads/total reads) 106 Differentially expressed miRNAs between two developmental stages are selected using a fold change > ¼ 2 and a FDR out_miranda ② RNAhybrid -s 3utr_fly -t DEnocoding_seq.fa -q diff_miRNA.fa >RNAhybrid_out
Identification and Functional Characterization of ncRNAs
4
7
Notes 1. Some input files may need to be slightly formatted, and some result files may require further analysis and integration. It will be preferable for investigators to use a programming language. 2. Other mapping tools (e.g., Tophat [24]) would represent an alternative for STAR. An important consideration is the mapping rate when choosing the mapping tools. 3. The Swissprot database can be used as an alternative to the UniProt database. 4. A hexamer frequency table file (“-x”) and a logit model file (“-d”) were needed when using cpat, and then “make_hexamer_tab.py” and “make_logitModel.py” are run to generate the frequency table and logit model out of the training dataset, respectively. 5. A text file listing the sample IDs and their respective paths should be provided to “prepDE.py”. An example of the information in “list.txt” is as follows: sample1 ./sample1.gtf sample2 ./sample2.gtf sample3 ./sample3.gtf 6. A genome index (“-p”) should be built by Bowtie before using mirdeep2. 7. For the overlapping sites identified by both miRanda and RNAhybrid, which use different algorithms for mapping the 30 end of the miRNA to the binding site, a setting of 60–75% reduction in size of healthy insects); (3) Dead (100% mortality)
16. Evaluate assay plates (see Note 13) and individually score each wall 7 days after incubation (Fig. 4a, b; see Note 14). 17. Use light pad and tabletop magnifying glass for visualization and scoring of the larvae (Fig. 4b).
4
Notes 1. A preferred dsRNA size for WCR screening is between 200 to 500 bp near N-term end of a protein [or near ATG starting codon of open-reading frame (orf)]. cDNA clones representing unique gene sequence from the same or different cDNA libraries should be rearrayed into 96-well plates for HT-RNAi screening. 2. PCR primer design (version of oligo 6 software) Select specific parameters: Primer size: 20–24 nt; Tm range between 59 C and 61 C; PRIMER_SELF_ANY 5 (self-annealing by setting the Max Complementarity to 5). PRIMER_SELF_END 1 (Max 30 end Complementarity to 1).
102
Xu Hu and Adane Kassa
3. Criteria for WCR target gene selection including [1] homology to essential gene or reproductive genes listed in FlyBase [19] or to RNAi lines showing lethal or sterile phenotype [20]. 4. PCR amplification using oligo as template: Use external oligos at standard concentration (0.2 μM) and use internal oligos at 1/200 dilution in per reaction. This approach is more economical than gBlock and fits for HT-RNAi screening. 5. IVT template amount depends on the length of the transcript, shorter the transcript more the amount of template. 100 to 175 bp uses 3 μg of template; 200 to 400 bp uses 2 μg of template. 6. Stored dsRNA at 20 C freezer in a concentrated form and diluted to desired concentration before bioassay experiment. 7. Nondiapausing Western corn rootworm can be obtained either from internal or external source. Regardless of the source the eggs should be washed thoroughly and suspended in water agar containing antimicrobial agent (for example 1% vol/vol) formaldehyde to discourage growth of fungal contamination. 8. When the larvae are ready, they can be transferred to previously prepared Western corn rootworm larval diet. 9. Artificial diet used for bioassay can be obtained from Frontier Agricultural Science (Frontier, Newark, DE) and prepared according to manufacturer’s guideline for Diabrotica diet. 10. Use 12-channel electronic pipettor for sample dispensing into the assay plates. 11. Diet can be dispensed into assay plates manually using a repeater pipettor. 12. WCR larval infestation can be performed using a pipe cleaner or fine insect brush. Extra care should be given not to damage the larvae. Observe all assay plates before incubation for any dead larvae and take a note. 13. For dsRNA insect bioassay, make sure to add buffer (negative) control and known active as a positive control for every assay. 14. Sample pass or fail criteria is based on the average scores of all eight replicates of a given sample. Test samples showing 1 average score are selected for further confirmatory assays.
Acknowledgments We thank Nina M. Richtman and Bliss Kernodle for DNA and RNA preparations and Lisa Procyk for insect bioassay support.
Screening RNAi Targets for Western Corn Rootworm Control
103
References 1. Gray ME, Sappington TW, Miller NJ et al (2009) Adaptation and invasiveness of western corn rootworm: intensifying research on a worsening pest. Annu Rev Entomol 54:303–321. . Epub 2008/12/11. https:// doi.org/10.1146/annurev.ento.54.110807. 090434 2. Narva KE, Siegfried BD, Storer NP (2013) Transgenic approaches to western corn rootworm control. Adv Biochem Eng Biotechnol 136:135–162 3. Levine E, Oloumi-Sadeghi H (1991) Management of Diabroticite Rootworms in corn. Annu Rev Entomol 36(1):229–255. https:// doi.org/10.1146/annurev.en.36.010191. 001305 4. Gassmann AJ, Petzold-Maxwell JL, Keweshan RS et al (2011) Field-evolved resistance to Bt maize by western corn rootworm. PLoS One 6 (7):e22629. https://doi.org/10.1371/jour nal.pone.0022629 5. Andow DA, Pueppke SG, Schaafsma AW et al (2016) Early detection and mitigation of resistance to Bt maize by Western corn rootworm (Coleoptera: Chrysomelidae). J Econ Entomol 109(1):1–12. https://doi.org/10.1093/jee/ tov238 6. Fire A, Xu S, Montgomery M et al (1998) Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391:806–811. https://doi.org/ 10.1038/35888 7. Kurreck J (2009) RNA interference: from basic research to therapeutic applications. Angew Chem Int Ed Engl 48:1378–1398. https:// doi.org/10.1002/anie.200802092 8. Price DR, Gatehouse JA (2008) RNAimediated crop protection against insects. Trends Biotechnol 26:393–400. https://doi. org/10.1016/j.tibtech.2008.04.004 9. Timmons L, Court DL, Fire A (2001) Ingestion of bacterially expressed dsRNAs can produce specific and potent genetic interference in Caenorhabditis elegans. Gene 263:103–112. https://doi.org/10.1016/S0378-1119(00) 00579-5 10. Huvenne H, Smagghe G (2010) Mechanisms of dsRNA uptake in insects and potential of RNAi for pest control: a review. J Insect Physiol 56:227–235. https://doi.org/10.1016/j.jin sphys.2009.10.004
11. Baum J, Bogaert T, Clinton W et al (2007) Control of coleopteran insect pests through RNA interference. Nat Biotechnol 25:1322–1326. https://doi.org/10.1038/ nbt1359 12. Hu X, Richtman N, Zhao J et al (2016) Discovery of midgut genes for the RNA interference control of corn rootworm. Sci Rep 6:30542. https://doi.org/10.1038/ srep30542 13. Niu X, Kassa A, Hu X et al (2017) Control of Western corn rootworm (Diabrotica virgifera virgifera) reproduction through plantmediated RNA interference. Sci Rep 7:12591. https://doi.org/10.1038/s41598-01712638-3 14. Kaya-C ¸ opur A, Schnorrer F (2016) A guide to genome-wide in vivo RNAi applications in drosophila. Methods Mol Biol 1478:117–143. https://doi.org/10.1007/978-1-4939-63713_6 15. Tabara H, Grishok A, Mello CC (1998) RNAi in C. elegans: soaking in the genome sequence. Science 282(5388):430–431. https://doi. org/10.1126/science.282.5388.430 16. Hammell CM, Hannon GJ (2012) Inducing RNAi in C. elegans by feeding with dsRNAexpressing E. coli. Cold Spring Harb Protoc 2012(12):pdb.prot072348. https://doi.org/ 10.1101/pdb.prot072348 17. Ludwick DC, Meihls LN, Huynh MP et al (2018) A new artificial diet for western corn rootworm larvae is compatible with and detects resistance to all current Bt toxins. Sci Rep 8:5379. https://doi.org/10.1038/s41598018-23738-z 18. Zhao JZ, Oneal MA, Richtman NM et al (2016) mCry3A-selected western corn rootworm (Coleoptera: Chrysomelidae) Colony exhibits high resistance and has reduced binding of mCry3A to midgut tissue. J Econ Entomol 109(3):1369–1377. https://doi. org/10.1093/jee/tow049 19. Gramates LS, Marygold SJ, Santos G et al (2017) FlyBase at 25: looking to the future. Nucleic Acids Res 45(D1):D663–D671 20. Dietzl G, Chen D, Schnorrer F et al (2007) A genome-wide transgenic RNAi library for conditional gene inactivation in drosophila. Nature 448(7150):151–156
Chapter 10 Rapid Screening of Myzus persicae (Green Peach Aphid) RNAi Targets Using Tobacco Rattle Virus Honglin Feng and Georg Jander Abstract Plant-mediated RNA interference (RNAi) can be used to reduce the growth of insect pests, including Myzus persicae (green peach aphid), a prolific pest of numerous dicot crop species. In one approach, viruses that have been engineered to carry an aphid gene fragment are used to infect plants and thereby silence target gene expression in the aphids feeding on these plants, a process called virus-induced gene silencing, or VIGS. Tobacco Rattle Virus (TRV) in the model plant, Nicotiana benthamiana, was the first of many VIGS systems that have been developed for different plant species. In this chapter, we describe a method for silencing M. persicae gene expression using an established TRV-VIGS vector that infects and spreads in N. benthamiana. The two parts of the TRV genome, RNA1 and RNA2, have been cloned into Agrobacterium T-DNA vectors for initiation of plant infections. The RNA2 construct is modified with a Gatewaycompatible cloning site to allow insertion of aphid genes. When feeding on TRV-infected N. benthamiana plants, aphids ingest dsRNAs that silence specific target genes. TRV-VIGS of aphid genes allows rapid identification of essential gene targets that can be used for the control of M. persicae by this and other RNAi methods. Key words Tobacco Rattle Virus, Green peach aphid, Myzus persicae, Nicotiana benthamiana, Virusinduced gene silencing, VIGS
1
Introduction Ever since the discovery that in planta expression of dsRNAs can decrease target gene expression in insect pests and thereby reduce their growth [1, 2], plant-mediated RNAi has been explored as a mechanism for aphid population control. Myzus persicae (green peach aphid, Fig. 1), an important pest on many agricultural crops [3], has been a frequent target of RNAi studies. Aphid genes that have been successfully inhibited by plant-mediated RNAi include those encoding salivary proteins (e.g., C002 [4], PIintO1/O2 [5], Mp55 [6], and migration inhibitory factor [7]), gut associated proteins (e.g., Rack 1 [4], aquaporin [8],
Luis Marı´a Vaschetto (ed.), RNAi Strategies for Pest Management: Methods and Protocols, Methods in Molecular Biology, vol. 2360, https://doi.org/10.1007/978-1-0716-1633-8_10, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2022
105
106
Honglin Feng and Georg Jander
Fig. 1 Red and green morphs of Myzus persicae (green peach aphid)
sucrase-transglucosidase [8], sugar transporter [8], cathepsin L [9]), V-ATPase E [10], tubulin folding cofactor D [10], serine protease [11], hunchback [12], and acetylcholinesterase 1 [13]. Most of those studies involved either leaf disks transiently expressing dsRNAs from Agrobacterium T-DNA constructs or stable transgenic plants [4–7, 9–13]. Whereas persistence of the RNAi signal is a major concern for leaf disk assays, the production of stable transgenic plants can be laborious and time-consuming. By contrast, virus-mediated dsRNA amplification and systemic spread among plant cells provides both a persistent RNAi signal and a rapid method for screening effective RNAi targets in aphids [8]. Tobacco Rattle Virus (TRV)-based virus-induced gene silencing (VIGS) has been widely used for functional analyses of target plant genes, including the model plant Nicotiana benthamiana [14, 15]. Our lab has adopted TRV vectors and established an efficient plant-mediated VIGS system for aphid gene function analyses [8]. TRV has a bipartite genome, encoding two positive sense, single strand RNAs, TRV1 and TRV2 [16]. TRV1 encodes essential components for viral replication (e.g., replicase and RNA-dependent RNA polymerase) and movement (e.g., movement protein) [16]. TRV2 encodes the coat protein and nonessential proteins. Nonessential TRV2 genes were replaced with a Gateway cloning site for introducing fragments of targeted genes [17, 18]. Both TRV1 and TRV2 have been cloned into a T-DNA plasmids for Agrobacterium tumefaciens-mediated leaf infiltration to initiate virus infections [17]. As TRV replicates and spreads in plant tissue, there is accumulation of a systemic RNAi signal [17]. Thus, TRV-based VIGS has been used in a broad range of plants, with high-efficiency gene silencing in most plant tissues [19]. Furthermore, by inserting a fragment of an aphid gene
TRV-based Plant-Mediated RNAi in M. persicae
107
(instead of plant gene) in the TRV2 genome and infiltrating N. benthamiana leaves, aphid associated gene expression has been successfully silenced using TRV-based VIGS [8, 20]. In this chapter, we describe a protocol for using plant-mediated TRV-based VIGS in N. benthamiana for rapid screening of RNAi targets in M. persicae.
2
Materials
2.1 Plants, Aphids, and Growth Conditions
1. Nicotiana benthamiana seeds. 2. Cornell Mix Plus Osmocote (see Note 1) or similar soil mix. 3. Pots, trays, and growth chamber. 4. Green peach aphids, Myzus persicae (see Note 2). 5. Insect cages for aphid culture.
2.2 Vector and Constructs
1. pDONR™-207 (Invitrogen, USA). 2. pTRV1 (Tobacco rattle virus RNA1) [15]. 3. pQ11-TRV2 (Tobacco rattle virus RNA2) destination vector [15]. 4. pTRV2-PDS for positive control [19]. 5. pTRV2-GFP for negative control [21].
2.3 Cloning cDNA Fragments into TRV
1. SV Total RNA Isolation System (Promega, USA). 2. High-Capacity cDNA Reverse Transcription Kits (Applied Biosystems, USA). 3. Phusion DNA polymerase and buffer for PCR (ThermoFisher Scientific, USA). 4. Wizard® SV Gel and PCR Clean-Up System (Promega, USA). 5. Wizard® Plus SV Minipreps DNA Purification System (Promega, USA). 6. Gateway® BP Clonase™ II enzyme mix (Invitrogen, USA). 7. Gateway® LR Clonase™ Plus enzyme (Invitrogen, USA). 8. Escherichia coli Top10 competent cells. 9. Agrobacterium tumefaciens strain GV3101 competent cells. 10. attB sequences for Gateway cloning attB1: 50 -GGGGACAAGTTTGTACAAAAAAGCAGGCTTA-30 . attB2: 50 -GGGGACCACTTTGTACAAGAAAGCTGGGTG-30 . 11. pDONR™-207 entry cloning primers p207-forward: 50 -TCGCGTTAACGCTAGCATGGATCTC-30 . p207-reverse: 50 -GTAACATCAGAGATTTTGAGACAC-30 .
108
Honglin Feng and Georg Jander
12. pQ11-TRV2 sequencing primers. pQ11-TRV2-forward: 50 -GAGTGGAGGTCCGATACGTC-30 . pQ11-TRV2-reverse: 50 -AGACAATGAGTCGGCCAAAC-30 . 13. NanoDrop ND-1000 spectrophotometer (ThermoFisher Scientific, USA). 14. Incubator shaker with temperature control for 28 C and 37 C. 15. LB broth. 16. LB agar. 17. 50 mg/ml gentamycin stock solution. 18. 50 mg/ml kanamycin stock solution. 19. 50 mg/ml rifampicin stock solution. 20. 1 M CaCl2. 21. 50% glycerol. 22. ddH2O. 23. 50 ml 20 mM CaCl2: 1 ml 1 M CaCl2, 15 ml 50% glycerol, and 34 ml ddH2O. 24. Liquid nitrogen. 25. Conical flasks. 2.4 Agroinfiltration of TRV VIGS Vectors in N. benthamiana
1. 1 ml NORM-JECT® syringes (Henken Sass Wolf, Germany). 2. 1 M MgCl2 stock solution. 3. 0.1 M MES (2-(N-morpholino)ethanesulfonic acid) stock solution. 4. 200 mM acetosyringone stock solution. 5. Induction buffer (infiltration buffer): 10 mM MES, 10 mM MgCl2, 200μM acetosyringone. 6. BioPhotometer (Eppendorf, Germany). 7. Centrifuge (Eppendorf, for 1.5 ml/50 ml, with temperature control). 8. Gloves.
2.5 In Planta dsRNA Expression
1. 1600 MiniG® Automated Tissue Homogenizer and Cell Lyser (SPEX® SamplePrep, USA). 2. Liquid nitrogen. 3. SV Total RNA Isolation System (Promega, USA). 4. High-Capacity cDNA Reverse Transcription Kits (Applied Biosystems, USA). 5. Phusion DNA polymerase and buffer for PCR (ThermoFisher Scientific, USA).
TRV-based Plant-Mediated RNAi in M. persicae
109
6. dsRNA specific VIGS primers. 7. pTRV1 primers. pTRV1-forward: 50 -GAGAATCCGTGCCGCTATTAT-30 . pTRV1-reverse: 50 -TCTCCTCATCGTCTACCTTTCT-30 . 8. 100 bp DNA ladder (ThermoFisher Scientific, USA), or equivalent. 2.6
Aphid Bioassay
1. Aphid cages (see Note 3, Fig. 1). 2. pQ11-TRV2-GOI (gene of interest) infiltrated N. benthamiana plants.
2.7
qPCR
1. 1600 MiniG®—Automated Tissue Homogenizer and Cell Lyser (SPEX® Sample Prep, USA). 2. SV Total RNA Isolation System (Promega, USA). 3. High-Capacity cDNA Reverse Transcription Kits (Applied Biosystems, USA). 4. PowerUp™ SYBR™ Biosystems, USA).
Green
Master
Mix
(Applied
5. qPCR primers for target genes and internal controls (β-actin and/or EF1α). qPCR primers for M. persicae β-actin. Mpβ-actin-F: 50 -ACGACCAGCCAAGTCCAAACG-30 . Mpβ-actin-R: 50 -GGCATCACACTTTCTACAATG-30 . qPCR primers for M. persicae EF1α. MpEF1α-F: 50 -CCGATTGTGCTGTGCTTATTG-30 . MpEF1α-R: 50 -CAAGGTGAAAGCCAATAGAGC-30 . 6. qPCR plates. 7. Multichannel pipette. 8. Applied Biosystems™ QuantStudio™ 6 Flex Real-Time PCR System.
3
Methods
3.1 Fragment Selection of Target Gene and Primer Design
1. Obtain sequences of your gene of interest (GOI) from NCBI (https://www.ncbi.nlm.nih.gov) or another genomic database. 2. Generate candidates fragments of target gene using ERNAi (https://www.dkfz.de/signaling/e-rnai3/), select a unique region of ~300 bp of the target gene. 3. Blast candidate fragments against N. benthamiana genome (https://solgenomics.net/) to avoid off-targets in N. benthamiana (see Note 4).
110
Honglin Feng and Georg Jander
4. Blast candidate fragments against M. persicae genome [22] to avoid off-targets in aphids. 5. Design forward and reverse primers that will specifically amplify the entire fragments. 6. Incorporate attB1 sequence to the 50 end of forward primer and the attB2 sequence to the 50 end of reverse primer (called dsRNA specific VIGS primers) to facilitate cloning of your fragments into pDONR™-207 vector via homologous recombination using the Gateway Cloning System. 3.2 Cloning the Selected Fragment into VIGS Vector
1. Isolate total RNA from M. persicae samples using the SV Total RNA Isolation System following the manufacturer’s instructions. 2. Reverse-transcribe the total RNA using the High-Capacity cDNA Reverse Transcription Kits following the manufacturer’s instructions. 3. Amplify a fragment of your target gene with the VIGS primers using Phusion DNA polymerase to generate attB-flanked DNA fragments (see Note 5). 4. Check for specific amplifications on a 1.2% agarose gel and purify your reactions with the Wizard® SV Gel and PCR Clean-Up System following the manufacturer’s instructions. 5. Measure the DNA concentration of your fragment and pDONR™-207 vector using a NanoDrop. 6. Perform a BP recombination reactions using BP Clonase™ II between each attB-flanked DNA fragment (15–150 ng) and the appropriate attP-containing pDONR™-207 vector (~150 ng) to generate an entry clone. 7. Transform 5μl of the BP reaction into 50μl One Shot® Top10 competent cells using the heat shock method and select for positive clones on 50μg/ml gentamycin-containing LB agar plates overnight at 37 C. 8. Amplify a few colonies in LB broth overnight, isolate plasmids using the Wizard® Plus SV Minipreps DNA Purification System, and sequence the target fragment to verify correct clones using either of the pDONR™-207 specific p207-forward or p207-reverse entry cloning primers (see Note 6). 9. Perform an LR recombination reaction using LR Clonase™ II Plus between your pDONR™-207-GOI (~150 ng) and the destination vector pQ11-TRV2 (~150 ng) (see Note 7). 10. Transform 2μl of the reaction into 50μl One Shot® Top10 competent cells. Select positive clones on LB plates supplemented with 50μg/ml kanamycin. To verify positive clones, follow the workflow in step 7, except using kanamycin for selection and pQ11-TRV2-forward or pQ11-TRV2-reverse primers for Sanger sequencing.
TRV-based Plant-Mediated RNAi in M. persicae
111
11. Amplify a positive colony in 5 ml LB broth overnight at 37 C. 12. Extract plasmids from overnight culture using the Wizard® Plus SV Minipreps DNA Purification System, measure the DNA concentration using a NanoDrop. Now you have generated pQ11-TRV2-GOI. 3.3 Prepare Agrobacterium Tumefaciens GV3101 Competent Cells
1. Streak an LB plate with Agrobacterium strain GV3101 under 50μg/ml gentamycin and 50μg/ml rifampicin selection, and incubate for 2 days at 28 C. 2. Amplify a single colony in 5 ml LB broth with 50μg/ml gentamycin and 50μg/ml rifampicin in an incubator shaker at 28 C overnight. 3. Add 1 ml of the overnight culture into 100 ml LB broth with 50μg/ml gentamycin and 50μg/ml rifampicin in a 250 ml conical flask, grow the culture for ~6–7 h until the bacterial culture optical density at 600 nm (OD600) to 0.5–1.0. 4. Transfer culture to 50 ml prechilled Falcon tubes and place on ice for 10 min. 5. Centrifuge at 4 C, 3000 g for 10 min to pellet the bacteria. 6. Discard supernatant and gently resuspend pellet in 50 ml of ice-cold 20 mM CaCl2. 7. Centrifuge at 4 C, 3000 g for 10 min, gently resuspend in 5 ml ice-cold 20 mM CaCl2. 8. Gently aliquot 100μl to prechilled 1.5 ml microcentrifuge tubes. 9. Flash-freeze in liquid nitrogen and store at 80 C for future use following a freeze-thaw transformation protocol (see Subheading 3.4).
3.4 Transformation of pQ11-TRV2-GOI into Agrobacterium
1. Add 100–500 ng of pQ11-TRV2-GOI plasmid to 50μl of ice-thawed GV3101 competent cells, mix by tapping. Place on ice for 5 min. 2. Freeze the reaction in liquid nitrogen for 5 min, and heat shock for 5 min at 37 C. 3. Add 1 ml LB broth with no antibiotics, shake at 28 C, 220 rpm for 2–4 h. 4. Centrifuge at 12,000 to 16,000 g for 1 min to pellet the Agrobacterium, resuspend with the 100μl supernatant and plate on LB plates containing 50μg/ml gentamycin, 50μg/ml rifamycin, and 50μg/ml kanamycin. Incubate at 28 C for 2 days. 5. Screen positive colonies by colony PCR or Sanger sequencing, prepare glycerol stocks by mixing bacterial cultures in LB with an equal volume of 50% glycerol, and store at 80 C in screwcap vials.
112
Honglin Feng and Georg Jander
3.5 Agroinfiltration of N. benthamiana Plants
1. Prepare N. benthamiana plants with 4–6 true leaves for infiltration in growth chambers under 16:8 light–dark period at 23 C and 60% humidity (see Note 8). 2. Streak the stored Agrobacterium culture on LB plates with gentamycin, rifamycin, and kanamycin (50μg/ml each), incubate at 28 C for 2 days. 3. Pick a single colony and make a 5 ml primary liquid LB culture with gentamycin, rifamycin, and kanamycin (50μg/ml each), shake at 220 rpm overnight at 28 C. 4. Make secondary cultures by adding 50μl of primary cultures into 50 ml LB broth with gentamycin, rifamycin, and kanamycin (50μg/ml each) for pQ11-TRV2-GOI, shake overnight at 220 rpm at 28 C. At the same time, make cultures for TRV1 and the control vectors pQ11-TRV2-PDS, pQ11-TRV2-GFP (see Note 9). 5. Pellet the cells at 3000 g at 4 C for 20 min and resuspend in 5 ml Agrobacterium infiltration buffer. 6. Pellet the cells again at 3000 g, at 4 C for 10 min, resuspend in 5 ml induction buffer, vortex suspension until no cell clumps or strings are visible. 7. Measure the bacterial culture optical density at 600 nm (OD600), and adjust each culture to an OD600 of 0.6. 8. Mix each pQ11-TRV2-GOI culture with TRV1 at 1:1 ratio, and final OD600 of 0.3 (see Note 10). 9. Incubate the mixed suspensions room temperature for >3 h. 10. To inoculate plants, plugging the back of leaf with a gloved finger, infiltrate from the top down using a 1 ml needleless syringe (see Fig. 2). Infiltrate three leaves per plant, fully saturating each leaf (see Note 11). 11. Place the infiltrated plants in a growth chamber (in separate trays to avoid cross-contamination).
3.6 Detection of in Planta dsRNA Expression
1. In ~2 weeks, when the photobleaching phenotype appears for control plants infiltrated with pQ11-TRV2-PDS (see Fig. 2), collect young leaf samples of each infiltrated N. benthamiana plant and immediately place them in liquid nitrogen. 2. Grind the leaves thoroughly using a tissue homogenizer (see Note 12). 3. Isolate total RNA using the SV Total RNA Isolation System following the manufacturer’s instructions. 4. Reverse-transcribe the total RNA using the High-Capacity cDNA Reverse Transcription Kits following the manufacturer’s instructions.
TRV-based Plant-Mediated RNAi in M. persicae
113
Fig. 2 Plant infiltration for aphid bioassays. Two weeks postinfiltration, plants infiltrated with pQ11-TRV2-PDS show photobleaching phenotypes. After confirming the in planta expression of the dsGOI (gene of interest), plants infiltrated with pQ11-TRV2-GOI can be used for aphid bioassays
Fig. 3 An example of detecting GOI expression in planta after leaf infiltration. (a) Detection of TRV1 in two plants of each treatment. TRV1 primers amplify a ~300 bp fragment from TRV1 vector. (b) Detection of in planta expression of a GOI dsRNA fragment. GOI specific primers amplify the ~300 bp of GOI fragments expressed from the pQ11-TRV2-GOI vector. M Fisher BioReagents exACTGene 100 bp DNA ladder, EV samples from plants infiltrated with empty pQ11-TRV2 control, GFP samples from plants infiltrated with pQ11-TRV2GFP, GOI samples from plants infiltrated with pQ11-TRV2-GOI, NoRT controls that have no reverse transcriptase added in during cDNA synthesis from two of the five pQ11-TRV2-GOI plants
5. Amplify a fragment of the target gene(s) with the dsRNA specific VIGS primers using Phusion DNA polymerase (see Note 13). In parallel, amplify a fragment of TRV1 to confirm the presence of TRV1 in the infected plants using pTRV1forward and pTRV1-reverse primers. 6. Separate PCR reactions on a 1.2% agarose gel to detect the expression of the GOI (see Fig. 3). 3.7 Aphid Bioassay on Infiltrated N. benthamiana Plants
1. Place two leaf cages on newly expanded leaves of each plant (see Fig. 2). 2. Place 20 adult aphids in each cage and allow them to produce nymphs for 24 h (see Note 14). 3. Leave 25 newborn nymphs in each cage and monitor aphid growth, survivorship, or any phenotypic changes over time (see Note 15).
114
Honglin Feng and Georg Jander
4. After ~5 days, when nymphs reach adulthood, five aphids can be left in each cage to monitor reproduction over time from this synchronized population. 3.8 qPCR Detection of Gene Silencing in Aphids
1. Collect ~15 aphids from the cages on each plant and immediately place them into liquid nitrogen. 2. Grind samples thoroughly using a tissue homogenizer. 3. Isolate total RNA using the SV Total RNA Isolation System following the manufacturer’s instructions. 4. Reverse transcribe samples with 200–1000 ng of total RNA using the High-Capacity cDNA Reverse Transcription Kits following the manufacturer’s instructions. 5. Perform qPCR with ten-fold dilution of cDNA samples, qPCR primers, and PowerUp™ SYBR™ Green Master Mix. Use M. persicae β-actin and/or EF1α as internal control(s) to normalize transcript levels across samples. 6. Compare the gene expression of aphid samples using the 2ΔΔCT method [23].
4
Notes 1. Recipe for Cornell Plus Osmocote: 5.7 cu. ft. peat moss, 12 cu. ft. vermiculite, 1.3 pounds Peters Uni-mix 11-5-11, 5 pounds Dolomitic Lime, 5 pounds Osmocote fertilizer 15-9-12. 2. We use a tobacco-adapted strain of M. persicae that has a higher nicotine tolerance [24, 25]. However, TRV-VIGS of aphid genes should work equally with other aphid strains. 3. Aphid cages (see Fig. 2) can be assembled using 50 ml disposable plastic centrifuge tubes (Falcon tubes, or similar). Tubes can be cut at the 40 ml scale mark, then two nails can be heated and melted into the tubes, half-way on the opposite sides of each tube. A flat foam ring is glued along the opening edge to reduce insect escapes. The cap is cut open and replaced with mesh to allow ventilation. 4. Nonexpected sites with 19 bp full matches to any fragments of the long dsRNA will be treated as potential off-targets. 5. Add betaine as an additive to enhance PCR amplification of GC-rich sequences, as betaine can dissolve secondary structure that blocks DNA polymerase action. 6. Colony PCR can be done to exclude false positives before sending samples for Sanger sequencing. 7. pQ11-TRV2 is a modified TRV2 plasmid compatible for Gateway cloning.
TRV-based Plant-Mediated RNAi in M. persicae
115
8. It will take 5–6 weeks after sowing seeds in a growth chamber for plants to reach the six-leaf stage. Prepare 6–8 plants for each construct as biological replicates in each experiment. 9. Prepare a bigger TRV1 secondary culture as TRV1 is needed for each of the GOI (gene of interest) constructs. 10. Preparing 15 ml infiltration buffer will be enough for 6 to 8 plants. 11. If you have difficulty performing the infiltration, you may find it easier to infiltrate the bottom side of the leaves. If plants are larger than ideal, infiltrate more leaves to compensate. You must change gloves between each gene of interest, and infiltrate PDS control plants last to avoid viral contamination. 12. Put metal beads in tubes before collecting samples to allow use of the tissue homogenizer. 13. To detect dsRNA expression in planta, you may also design the fragment-specific primers without the attB sites. 14. We have observed a high aphid death rate when transferring aphids from N. tabacum to N. benthamiana. To avoid this, the aphid colony can be maintained on N. benthamiana instead of N. tabacum. As aphids do not like feeding on wild-type N. benthamiana, more plants are needed to provide enough adults for the bioassay setup. Use of an N. benthamiana asat2 (acylsucrose acyltransferase 2) mutant line, which is deficient in acyl sugars, will allow improved aphid growth [26]. 15. As M. persicae are small, it is hard to measure their weight. You can use a microscope to take images of aphids and measure the aphid size using Fiji [27] or a similar image-processing software program.
Acknowledgments We thank Mariko Alexander and Michelle Heck for sharing of a TRV1 Agrobacterium culture, and Robyn Roberts and Greg Martin for providing TRV2-PDS control construct. Thanks to the previous and current members of the Jander lab for their help in developing the aphid TRV-VIGS protocol. This research was supported by US Department of Agriculture Biotechnology Risk Assessment Grant 2017-33522-27006 to G. J. References 1. Baum JA, Bogaert T, Clinton W et al (2007) Control of coleopteran insect pests through RNA interference. Nat Biotechnol 25 (11):1322–1326. https://doi.org/10.1038/ nbt1359
2. Mao YB, Cai WJ, Wang JW et al (2007) Silencing a cotton bollworm P450 monooxygenase gene by plant-mediated RNAi impairs larval tolerance of gossypol. Nat Biotechnol 25(11):1307–1313. https://doi.org/10.1038/nbt1352
116
Honglin Feng and Georg Jander
3. Blackman RL, Eastop VF (2000) Aphids on the World’s crops. Wiley, Chichester 4. Pitino M, Coleman AD, Maffei ME et al (2011) Silencing of aphid genes by dsRNA feeding from plants. PLos One 6(10):e25709. https://doi.org/10.1371/journal.pone. 0025709 5. Pitino M, Hogenhout SA (2013) Aphid protein effectors promote aphid colonization in a plant species-specific manner. Mol Plant Microbe Interact 26(1):130–139. https://doi. org/10.1094/Mpmi-07-12-0172-Fi 6. Elzinga DA, De Vos M, Jander G (2014) Suppression of plant defenses by a Myzus persicae (green peach aphid) salivary effector protein. Mol Plant-Microbe Interact 27(7):747–756. https://doi.org/10.1094/MPMI-01-140018-R 7. Naessens E, Dubreuil G, Giordanengo P et al (2015) A secreted MIF cytokine enables aphid feeding and represses plant immune responses. Curr Biol 25(14):1898–1903. https://doi. org/10.1016/j.cub.2015.05.047 8. Tzin V, Yang X, Jing X et al (2015) RNA interference against gut osmoregulatory genes in phloem-feeding insects. J Insect Physiol 79:105–112. https://doi.org/10.1016/j.jin sphys.2015.06.006 9. Rauf I, Asif M, Amin I et al (2019) Silencing cathepsin L expression reduces Myzus persicae protein content and the nutritional value as prey for Coccinella septempunctata. Insect Mol Biol 28(6):785–797. https://doi.org/ 10.1111/imb.12589 10. Guo HY, Song XG, Wang GL et al (2014) Plant-generated artificial small RNAs mediated aphid resistance. PLoS One 9(5):e97410. https://doi.org/10.1371/journal.pone. 0097410 11. Bhatia V, Bhattacharya R, Uniyal PL et al (2012) Host generated siRNAs attenuate expression of serine protease gene in Myzus persicae. PLoS One 7(10):e46343. https:// doi.org/10.1371/journal.pone.0046343 12. Mao JJ, Zeng FR (2014) Plant-mediated RNAi of a gap gene-enhanced tobacco tolerance against the Myzus persicae. Transgenic Res 23 (1):145–152. https://doi.org/10.1007/ s11248-013-9739-y 13. Faisal M, Abdel-Salam EM, Alatar AA et al (2019) Genetic transformation and siRNAmediated gene silencing for aphid resistance in tomato. Agronomy 9(12):893. https://doi. org/10.3390/agronomy9120893 14. Hayward A, Padmanabhan M, Dinesh-Kumar SP (2011) Virus-induced gene silencing in
Nicotiana benthamiana and other plant species. Methods Mol Biol 678:55–63. https:// doi.org/10.1007/978-1-60761-682-5_5 15. Senthil-Kumar M, Mysore KS (2014) Tobacco rattle virus-based virus-induced gene silencing in Nicotiana benthamiana. Nat Protoc 9 (7):1549–1562. https://doi.org/10.1038/ nprot.2014.092 16. MacFarlane SA (1999) Molecular biology of the tobraviruses. J Gen Virol 80:2799–2807. https://doi.org/10.1099/0022-1317-80-112799 17. Ratcliff F, Martin-Hernandez AM, Baulcombe DC (2001) Tobacco rattle virus as a vector for analysis of gene function by silencing. Plant J 25(2):237–245. https://doi.org/10.1046/j. 0960-7412.2000.00942.x 18. Liu YL, Schiff M, Dinesh-Kumar SP (2002) Virus-induced gene silencing in tomato. Plant J 31(6):777–786. https://doi.org/10.1046/j. 1365-313X.2002.01394.x 19. Senthil-Kumar M, Hema R, Anand A et al (2007) A systematic study to determine the extent of gene silencing in Nicotiana benthamiana and other Solanaceae species when heterologous gene sequences are used for virus-induced gene silencing. New Phytol 176(4):782–791. https://doi.org/10.1111/j. 1469-8137.2007.02225.x 20. Mulot M, Boissinot S, Monsion B et al (2016) Comparative analysis of RNAi-based methods to down-regulate expression of two genes expressed at different levels in Myzus persicae. Viruses 8(11):316. https://doi.org/10.3390/ v8110316 21. Ryu CM, Anand A, Kang L et al (2004) Agrodrench: a novel and effective agroinoculation method for virus-induced gene silencing in roots and diverse Solanaceous species. Plant J 40(2):322–331. https://doi.org/10.1111/j. 1365-313X.2004.02211.x 22. Mathers TC, Chen Y, Kaithakottil G et al (2017) Rapid transcriptional plasticity of duplicated gene clusters enables a clonally reproducing aphid to colonise diverse plant species. Genome Biol 18(1):27. https://doi.org/10. 1186/s13059-016-1145-3 23. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-Delta Delta C) method. Methods 25(4):402–408. https://doi.org/10.1006/meth.2001.1262 24. Ramsey JS, Elzinga DA, Sarkar P et al (2014) Adaptation to nicotine feeding in Myzus persicae. J Chem Ecol 40:869–877. https://doi. org/10.1007/s10886-014-0482-5
TRV-based Plant-Mediated RNAi in M. persicae 25. Ramsey JS, Wilson AC, De Vos M et al (2007) Genomic resources for Myzus persicae: EST sequencing, SNP identification, and microarray design. BMC Genomics 8:423 26. Feng H, Acosta-Gamboa L, Kruse LH, et al. (2020) An improved Nicotiana benthamiana strain for aphid and whitefly research. bioRxiv.
117
https://doi.org/10.1101/2020.08.04. 237180 27. Schneider CA, Rasband WS, Eliceiri KW (2012) NIH image to ImageJ: 25 years of image analysis. Nat Methods 9(7):671–675. https://doi.org/10.1038/nmeth.2089
Chapter 11 Genome-Wide Identification and Validation of Target Genes Associated with Insecticide Treatment of the Green Peach Aphid, Myzus persicae Sadia Iqbal, John Fosu-Nyarko, Frances Brigg, and Michael G. K. Jones Abstract Next-generation sequencing and analyses of whole-genome transcripts can be used to identify genes and potential mechanisms that may be responsible for the development of resistance to insecticides. Such genes can be identified by isolating and sequencing high-quality messenger RNA and identifying differentially expressed genes (DEGs), and gene variants from insecticide-treated and untreated colonies of the Green peach aphid (GPA) or resistant and susceptible GPA populations. Datasets generated would reveal a set of genes whose expression may be associated with the insecticide treatment. The DEGs can then be validated using quantitative PCR assays. Key words Next-generation sequencing, Whole-genome transcriptome, RNA-seq, Insecticide resistance, Insects, Transcriptome, Differential gene expression, Differentially expressed genes (DEGs)
1
Introduction Insecticide resistance impedes successful control of plant pests that threaten global food security. Resistance to some insecticides has been attributed to the expression or mutations in some genes coding for target proteins of insecticides [1]. Such genes may be differentially expressed in resistant strains of target insects or are activated in response to particular insecticides. Sequencing of whole-genome transcripts can be used to identify such genes in target insects in laboratory experiments [2]. Because some of these genes may be generally involved in defense and detoxification, candidate genes will have to be functionally characterized to ascertain their roles in the development of resistance to particular insecticides [3].
Luis Marı´a Vaschetto (ed.), RNAi Strategies for Pest Management: Methods and Protocols, Methods in Molecular Biology, vol. 2360, https://doi.org/10.1007/978-1-0716-1633-8_11, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2022
119
120
Sadia Iqbal et al.
This chapter describes how RNA-seq technology can be applied to the Green peach aphid (GPA) to discover transcripts that may be associated with insecticide resistance through analyses of differential expression and validation of DEGs using quantitative PCR (qPCR).
2
Materials
2.1 Insecticide Treatment and RNA Extraction from Aphids
1. GPA cultured on tobacco plants; strains resistant to known insecticide(s) (if available) or those susceptible to insecticide (if available) and wild type. 2. Commercially available insecticides or their active ingredients. 3. Artificial feed: 30% sucrose mixed with 0.02% neutral red to trace uptake of feed. 4. Petri dishes. 5. Liquid nitrogen to snap-freeze or store tissues/insect samples until RNA extraction. 6. Fridge (4 C) and freezers (20 C, 80 C) to store or return reagents to immediately after use. 7. Microcentrifuge and nuclease-free microcentrifuge tubes (1.5 mL). 8. 3 mm Stainless steel beads and TissueLyser (Qiagen Pty. Ltd). 9. PicoPure RNA Isolation kit (Thermo Fisher Scientific): Extraction Buffer, Conditioning Buffer, Wash Buffer 1, Wash Buffer 2, Elution Buffer. 10. Heating block. 11. RNase-free DNase set (Qiagen Pty. Ltd): DNase I, Buffer RDD. 12. Spectrophotometer Scientific).
(NanoDrop
One,
Thermo
Fisher
13. Bioanalyzer (Agilent 2100). 14. Agilent RNA 6000 Nano kit (Agilent Technologies). 2.2 Sample Preparation for RNA-Seq
1. TruSeq RNA Library Prep Kit v2 (Illumina). (a) Box A: Resuspension Buffer, End Repair Mix, A-Tailing Mix, Ligation Mix, End Repair Control, A-Tailing Control, Ligation Control, Stop Ligation Buffer, eight tubes of RNA Adapter Indexes. (b) Box 1: RNA purification beads, End Repair Control Dilution tube, A-Tailing Control Dilution tube, Ligation Control Dilution tube.
Identification of Insecticide-associated Genes
121
(c) Box 2: Bead Binding Buffer, Elution Buffer, Bead Washing Buffer, Elute Prime Fragment Mix, First Strand Master Mix, Second Strand Master Mix. (d) 48 Samples-PCR Box: PCR Master Mix, PCR Primer Cocktail. 2. 96-well 0.3 mL PCR plates (Seven required) and 96-well MIDI plates 3. Magnetic plate stand. 4. Microseal ‘B’ adhesive seals (Bio-Rad) used in all cases when a plate is to be sealed. 5. Multichannel pipette and RNase/DNase-free reagent reservoirs (boats) for solutions pipetted into plates. All thorough mixing of reagents mentioned in the methods should involve pipetting up and down six to ten times. 6. Nuclease-free microcentrifuge tubes (1.5 mL). 7. SuperScript Scientific).
II
Reverse
Transcriptase
(Thermo
Fisher
8. AMPure XP beads (Beckman Coulter Life Sciences). 9. 10 mM Tris–HCl (pH 8.5). 10. Tween 20. 11. Laminar flow cabinet. 12. Storage freezers (20 C, 80 C) to store and return all reagents to immediately after use. 13. Analytical Fragment Analyzer. 14. Standard Sensitivity NGS Fragment Analysis Kit. 2.3 Sequence Analyses to Identify DEGs
1. Qiagen’s CLC Genomics Workbench (https://digitalinsights. qiagen.com) to assess read count, analyze and identify DEGs and gene variants using the “RNA-Seq Analysis” and “Resequencing Analysis” platforms. 2. Access to the National Center for Bioinformatics Information (NCBI, www.ncbi.nlm.nih.gov/). 3. Access to Pfam (https://pfam.sanger.ac.uk/) or the NCBI Conserved Domain Database CDD (www.ncbi.nlm.nih.gov/ Structure/cdd/wrpsb.cgi).
2.4 qPCR Validation of DEGs
1. Access to Primer 3 (https://primer3.ut.ee/). 2. QPCR primers for DEGs and reference gene (e. g. 18S rRNA, Tubulin or GAPDH). 3. High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems): 10 RT Buffer, 10 RT Random Primers, 25 dNTP mix, 50 U/μL MultiScribe Reverse Transcriptase.
122
Sadia Iqbal et al.
4. Sterile nuclease-free microcentrifuge tubes (0.2 mL, 0.6 mL). 5. Thermocycler. 6. 2 Go Taq Green Master Mix (Promega Corp.) 7. Agarose. 8. 1 TAE buffer: 40 mM Tris–HCl, 20 mM acetic acid, 1 mM EDTA, pH 8.0. 9. Electrophoresis equipment (gel tray, combs, and voltmeter). 10. SYBR Safe DNA gel stain (Thermo Fisher Scientific). 11. 100 bp DNA marker 12. 2 SensiFAST™ SYBR® No-ROX Kit for qPCR (Bioline Pty. Ltd). 13. Rotor gene Q Thermocycler for qPCR and software (https:// www.qiagen.com/au/resources) (Qiagen Pty. Ltd.). 14. Aerosol-barrier pipette tips and pipette set. 15. Storage freezers (20 C and 80 C) to store and return all reagents to immediately after use. 16. Ice to set up reactions.
3
Methods The methods for identifying genes associated with insecticide resistance involves careful exposure of resistant and susceptible strains of target insects to appropriate doses of an insecticide of choice, purification of mRNA from total RNA isolated from surviving insects, synthesis of double-stranded cDNA (dscDNA) from the mRNA following a series of modifications required for Next-Generation Sequencing. The RNA-seq data obtained is then processed through a pipeline to trim adapter sequences, remove low-quality reads followed by assembly and mapping of reads to reference genes of GPA and comparison of transcript abundance and variants in the experimental and control datasets to reveal DEGs potentially expressed in response to an insecticide treatment. The DEGs are then validated using qPCRs.
3.1 Insecticide Treatment and Total RNA Extraction 3.1.1 Exposure of Aphids to Insecticide
1. Collect 20 aphids from each of the first, second, third instars and adult stages onto a tobacco leaf placed in a petri dish ready for insecticide treatment. Subject to cost, at least one technical as well as biological replicate should be included for each treatment (see Note 1). 2. Use the LC50 (Lethal concentration required to kill 50% of insect population) of insecticide of choice for the treatment. If unavailable, determine LC50 by exposing insects to incremental doses until 50% of aphids are severely affected.
Identification of Insecticide-associated Genes
123
3. If resistant and susceptible populations of aphids are available, treat each population, separately, with the LC50 of insecticide by mixing with artificial feed or by spraying in a chamber for an appropriate length of time. If resistant and susceptible strains of aphids are not available, use wild type or lab strains for the treatment and the same populations kept under similar conditions without treatment as the control (see Note 2). 4. Collect surviving aphids from each treatment in separate tubes for RNA extraction immediately or snap-freeze in liquid nitrogen and store at 80 C until required. 3.1.2 Total RNA Extraction from Treated Aphids
1. Extract total RNA from the frozen treated samples in Subheading 3.1.1 using the PicoPure RNA isolation kit (see Note 3). 2. Add two 3 mm stainless steel beads to aphid tissue, snap-freeze in liquid nitrogen and lyse using a TissueLyser at 20 Hz for a minute at a time, for up to 3 min. 3. Add 50 μL of the Extraction Buffer, vortex for 30 s and incubate at 42 C for 30 min on a heating block. Centrifuge tube at 3000 g for 2 min and collect the supernatant into a fresh 1.5 mL tube. Avoid any solid material. 4. Precondition the RNA purification column (placed in a collection tube) by adding 250 μL of Conditioning Buffer to the filter membrane, leave at room temperature for 5 min. Centrifuge the assembly in a microcentrifuge at 16,000 g for 1 min. 5. Add 50 μL of 70% ethanol to the homogenate and mix by pipetting. Transfer the mixture to the preconditioned purification column and centrifuge at 100 g for 2 min to bind RNA to the column. Centrifuge again immediately at 16,000 g for 30 s and discard flow through. 6. Pipet 100 μL of Wash Buffer 1 to the purification column and centrifuge at 8000 g for 1 min to wash the column. 7. DNase I treatment (see Note 4): For each RNA sample, prepare 40 μL DNase I solution mix by adding 5 μL of DNase I stock solution to 35 μL of Buffer RDD from the RNase-free DNase I kit and mix gently by inversion. Pipet the DNase solution mix to the purification column membrane and incubate at room temperature for 15 min. 8. Add 40 μL of Wash Buffer 1 to the column and centrifuge at 8000 g for 15 s. 9. Perform two washes with Wash Buffer 2 by adding 100 μL each time to the purification column. For the first wash, centrifuge at 8000 g for 1 min and for the second wash at 16,000 g for 2 min. Discard flow through.
124
Sadia Iqbal et al.
10. To remove any residual wash buffer, centrifuge the purification column assembly at 16,000 g for 1 min and place the purification column into a new 0.6 mL microcentrifuge tube. 11. Pipet 20 μL of the Elution Buffer to the purification column and incubate at room temperature for 1 min. Centrifuge first at 1000 g for 1 min to distribute the buffer in the column and then immediately at 16,000 g for 1 min to elute the RNA. 12. Prepare a one in ten dilution with RNase-free water for quantification and quality check. Immediately store the remaining at 80 C. Quantify the RNA using the NanoDrop spectrophotometer. 13. Analyze the quality on the Bioanalyzer using the Agilent RNA 6000 Nano kit. Proceed with RNA with A260/280 ~ 2.0 and RNA integrity number (RIN) of 8. 3.2 Sample Preparation for RNA-Seq 3.2.1 mRNA Isolation, Fragmentation, and Priming
1. Generate cDNA libraries from 0.1 to 1.0 μg of total RNA using the TruSeq RNA Library Prep Kit following isolation, fragmentation, and priming of polyA mRNA, and cDNA synthesis (see Note 5). 2. Thaw the following components from the kit at room temperature: Bead Binding Buffer, Bead Washing Buffer, Elution Buffer, Elute Prime Fragment Mix, Resuspension Buffer, and RNA Purification Beads tube. 3. Bring total RNA samples from 80 C and dilute 0.1–1.0 μg of each sample with nuclease-free water to a final volume of 50 μL in a nuclease-free 96-well 0.3 mL PCR plate (see Note 6). 4. Vortex the RNA Purification Beads vigorously to resuspend oligo-dT beads and add 50 μL of this solution to each sample. Gently mix thoroughly to facilitate binding of the polyA RNA to the oligo-dT beads (see Note 7). 5. Seal the plate and place in a thermocycler with heated lid (100–105 C) and run at 65 C for 5 min, 4 C for 2 min to denature RNA and to allow binding of polyA mRNA to the beads. Bring the plate to room temperature for 5 min to continue the RNA-bead binding. 6. Transfer the plate to the magnetic stand for 5 min to separate the polyA RNA-bound beads from the solution. Remove the adhesive seal and pipet and discard the supernatant while the 96-well plate is still on the magnetic stand. 7. Remove the plate from the magnetic stand and wash the beads by adding 200 μL of Bead Washing Buffer and mixing thoroughly. 8. Place the plate back on the magnetic stand at room temperature for 5 min and pipet all supernatant which contains ribosomal and nonmessenger RNA and discard.
Identification of Insecticide-associated Genes
125
9. Centrifuge the thawed Elution Buffer at 600 g for 5 s and add 50 μL to each sample. Gently mix thoroughly. Seal the plate. 10. Place the sealed plate in the thermocycler with heated lid (100–105 C) and run at 80 C for 2 min followed by 25 C for 5 min to release mRNA and any contaminant rRNA which may have nonspecifically bound to the beads. 11. Remove the plate from the thermocycler. Centrifuge the thawed Bead Binding Buffer at 600 g for 5 s and add 50 μL Bead Binding Buffer to each sample to specifically rebind polyA mRNA to the beads. The aim is to reduce the amount of rRNA that was nonspecifically bound. Gently mix thoroughly and incubate at room temperature for 5 min. 12. Place the plate on the magnetic stand again at room temperature for 5 min. Remove and discard all supernatant from the samples. 13. Remove the plate from the magnetic stand and add 200 μL of Bead Washing Buffer to each sample. Gently mix thoroughly. Place the plate back on the magnetic stand, leave at room temperature for 5 min, then remove and discard the supernatant. 14. Remove the plate from the magnetic stand and add 19.5 μL of the Elute, Prime, Fragment Mix to each sample. Gently mix thoroughly. The Mix serves as the first-strand cDNA synthesis reaction buffer as it contains random hexamers for Reverse Transcription priming. 15. Seal the plate and place in the thermocycler with heated lid (100–105 C) and run at 94 C for 8 min followed by 4 C for 10 min to elute, fragment, and prime the RNA (see Note 8). Centrifuge the plate with the primed mRNA at 4 C and proceed immediately to the next step to synthesize cDNA. 3.2.2 First-Strand cDNA Synthesis
1. For first-strand cDNA synthesis, thaw one tube of the First Strand Master Mix (kept at 20 C) at room temperature (see Note 9). Preprogram the thermocycler with heated lid (100–105 C) at 25 C for 10 min, 42 C for 50 min, 70 C for 15 min and at 4 C for 1 min. 2. Place the plate containing the fragmented and primed mRNA on the magnetic stand for 5 min at room temperature. Remove the adhesive seal and transfer 17 μL of the mRNA of each sample to corresponding wells in a new 96-well 0.3 mL PCR plate. 3. Centrifuge the thawed First Strand Master Mix tube at 600 g for 5 s. Pipet 50 μL of SuperScript II to the First Strand Master Mix tube (1 μL of SuperScript II for 9 μL of First Strand Master Mix). Gently mix thoroughly and centrifuge briefly.
126
Sadia Iqbal et al.
4. Add 8 μL of the mixture of First Strand Master Mix and SuperScript II to each sample. Gently mix thoroughly. Seal the plate and centrifuge briefly. 5. Place the sealed plate in the thermocycler and run the program setup in step 1. Proceed immediately to second-strand cDNA (dscDNA) synthesis. 3.2.3 Second-Strand cDNA Synthesis
1. Bring the AMPure XP beads and Resuspension Buffer from 4 C to room temperature at least 30 min before use. Also, thaw the Second Strand Master Mix (20 C) at room temperature. 2. Centrifuge the thawed Second Strand Master Mix at 600 g for 5 s and add 25 μL to each sample now containing the firststrand cDNA. Mix thoroughly. 3. Seal the plate and incubate in thermocycler at 16 C for 1 h. Bring plate to room temperature. 4. Thoroughly vortex the AMPure XP beads to disperse well and add 90 μL to each sample now containing 50 μL of dscDNA. Mix thoroughly and leave at room temperature for 15 min. 5. Transfer plate to the magnetic stand for 5 min at room temperature to bring the beads to the side of the wells. Remove and discard 135 μL of the supernatant from samples. 6. Keep the plate on the magnetic stand and add 200 μL of freshly prepared 80% ethanol to each sample without disturbing the beads. Incubate the plate at room temperature for 30 s, then remove and discard all supernatant from each sample well by pipetting. 7. Repeat the ethanol wash in step 6. Leave the plate at room temperature for 15 min to dry and then remove it from the magnetic stand. 8. Centrifuge the Resuspension Buffer (now at room temperature) at 600 g for 5 s and add 52.5 μL to each sample, now containing dscDNA. Gently mix thoroughly and incubate the plate at room temperature for 2 min. 9. Place the plate on the magnetic stand at room temperature for 5 min and then transfer 50 μL of the supernatant (dscDNA) from each sample well to corresponding wells of a new 96-well 0.3 mL PCR plate. The plate can be stored at 20 C and the procedure halted at this point without any negative impact on the quality of the dscDNA.
3.2.4 cDNA End Repair
1. Bring the AMPure XP beads and Resuspension Buffer from 4 C to room temperature at least 30 min before use. Remove the End Repair Control (optional, can be replaced with the same volume of Resuspension Buffer) and End Repair Mix from 20 C and thaw at room temperature. Preheat a thermocycler to 30 C with heated lid (100–105 C).
Identification of Insecticide-associated Genes
127
2. If samples were stored at 20 C, thaw to room temperature and centrifuge at 280 g for 1 min. 3. Centrifuge the thawed End Repair Control tube at 600 g for 5 s and dilute 1/100 in the Resuspension Buffer (1 μL End Repair Control + 99 μL Resuspension Buffer) before use (see Note 10). Discard the diluted End Repair Control after use. 4. Add 10 μL of the diluted End Repair Control to each sample containing 50 μL dscDNA (if not using End Repair Control, add 10 μL of Resuspension Buffer to each well). 5. Add 40 μL of the End Repair Mix to each sample. The 30 to 50 exonuclease activity of this mix removes the 30 overhangs, and the polymerase activity fills in the 50 overhangs. Mix thoroughly, seal the plate, and incubate in thermocycler at 30 C for 30 min. 6. Bring plate to room temperature. Vortex the AMPure XP beads until well dispersed and add 160 μL to each sample. Gently mix thoroughly and incubate at room temperature for a further 15 min. 7. Place the plate on the magnetic stand at room temperature for 5 min or until the liquid is clear. Then remove and discard the supernatant, pipetting a maximum 127.5 μL at a time. 8. Keep the plate on the magnetic stand while performing an ethanol wash. Add 200 μL of freshly prepared 80% ethanol to each sample without disturbing the beads. Incubate the plate at room temperature for 30 s, then remove and discard all supernatant. 9. Repeat the ethanol wash and, after removing all the liquid carefully without disturbing the beads, let the plate stand at room temperature for 15 min to dry. 10. Remove the plate from the magnetic stand and add 17.5 μL of Resuspension Buffer to each sample and mix thoroughly. Leave at room temperature for 2 min and then return to the magnetic stand for 5 min or until the liquid becomes clear. 11. Transfer 15 μL of the supernatant from each sample to the corresponding well of a new 96-well 0.3 mL PCR plate. Store at 20 C for up to 7 days if processing has to be paused. 3.2.5 Adenylation of 30 Ends of the cDNA
1. Bring the A-Tailing Control (can be replaced with the same volume of Resuspension Buffer) and A-Tailing Mix from 20 C and thaw at room temperature. Also, bring the Resuspension Buffer from 4 C to room temperature. 2. Centrifuge the plate with samples at 280 g for 1 min and remove the adhesive seal from the plate. If it was previously stored at 20 C, thaw to room temperature before centrifuging.
128
Sadia Iqbal et al.
3. Keep samples on ice while performing the following steps. Centrifuge the A-Tailing Control tube at 600 g for 5 s and dilute 1/100 in Resuspension Buffer (1 μL A-Tailing Control + 99 μL Resuspension Buffer) before use. Discard the diluted A-Tailing Control after use. 4. Add 2.5 μL of the diluted A-Tailing Control to each sample (if not using End Repair Control, add 2.5 μL of Resuspension Buffer to each sample) to make up the volume. 5. Add 12.5 μL of the A-Tailing Mix to each sample. Mix thoroughly, seal the plate, place in thermocycler, and run at 37 C for 30 min, 70 C for 5 min and at 4 C for 5 min. Proceed to Adapter Ligation. 3.2.6 Adapter Ligation
1. Bring the Ligation Control, RNA Adapter Index tubes for the indexes being used and the Stop Ligation Buffer to room temperature. Also, bring the Resuspension buffer from 4 C storage to room temperature. The AMPure XP beads should be left at room temperature at least 30 min before use. Preheat thermocycler to 30 C. 2. Centrifuge the RNA Adapter Index, Ligation Control (if it to be used) and Stop Ligation Buffer tubes at 600 g for 5 s. Make a 1/100 dilution of the Ligation Control (1 μL) with Resuspension Buffer (99 μL) and add 2.5 μL to each sample, otherwise add 2.5 μL of Resuspension Buffer. Discard the diluted Ligation Control after use. 3. Bring the Ligation Mix tube from 20 C and add 2.5 μL to each sample. 4. Add 2.5 μL of the RNA Adapter Index to each sample (see Note 11). Gently mix thoroughly. Seal the plate and incubate in the thermocycler at 30 C for 10 min. 5. Remove the adhesive seal from the plate and add 5 μL of the Stop Ligation Buffer to each sample to inactivate the ligation reaction. Gently mix thoroughly. 6. Vortex the AMPure XP beads for at least 1 min to disperse them thoroughly and add 42 μL to each sample, mix thoroughly and leave at room temperature for 15 min. 7. Place the plate on the magnetic stand at room temperature for 5 min or until the liquid is clear. Remove and discard 79.5 μL of supernatant from each sample, avoiding the beads. 8. With the plate on the magnetic stand, add 200 μL of freshly prepared 80% ethanol to each sample without disturbing the beads. Leave plate on the magnetic stand for 30 s, and then pipet all the supernatant from each sample without disturbing the beads. 9. Repeat step 8. Leave plate on the magnetic stand to dry at room temperature for 15 min.
Identification of Insecticide-associated Genes
129
10. Remove the plate from the magnetic stand and add 52.5 μL of Resuspension Buffer to each sample. Mix thoroughly and incubate the plate at room temperature for 2 min. 11. Return the plate to the magnetic stand, leave at room temperature for 5 min or until the liquid is clear and then transfer 50 μL of the supernatant from each sample to the corresponding well of a new 0.3 mL PCR plate without disturbing the beads. 12. Vortex the AMPure XP beads until they are well dispersed and add 50 μL of the beads to each sample in the new plate. Mix thoroughly and let stand at room temperature for 15 min. 13. Place the plate on the magnetic stand for 5 min or until the liquid is clear and remove and discard 95 μL of the supernatant from each well without disturbing the beads. 14. With the plate on the magnetic stand, add 200 μL of freshly prepared 80% ethanol to each sample well without disturbing the beads. Leave on lab bench at room temperature for 30 s, and then remove and discard all the supernatant from each well without disturbing the beads. 15. Repeat step 14. Leave plate to dry while still on the magnetic stand (see Note 12). 16. Add 22.5 μL of the Resuspension Buffer to each sample, mix gently or until the beads are fully resuspended. Incubate the plate at room temperature for 2 min. 17. Place the plate on the magnetic stand at room temperature for 5 min or until the liquid is clear and transfer 20 μL of the supernatant from each sample to the corresponding well of a new 0.3 mL PCR plate taking care not to disturb the beads. If the processing has to be paused at this stage, keep the samples at 20 C for up to 7 days. 3.2.7 DNA Fragment Enrichment
1. Remove PCR Master Mix and PCR Primer Cocktail from 20 C storage, and thaw on ice. Also, bring the Resuspension Buffer and the AMPure XP beads (4 C) to room temperature. 2. Bring the plate containing adapter-ligated cDNA from 20 C (if stored) and let it thaw at room temperature, and then centrifuge at 280 g for 1 min. 3. Centrifuge the thawed PCR Master Mix and PCR Primer Cocktail tubes at 600 g for 5 s. Preprogram the thermocycler with heated lid (100–105 C) to run at 98 C for 30 s followed by 15 cycles of 98 C for 10 s, 60 C for 30 s, and 72 C for 30 s, and a final extension at 72 C for 5 min and 10 C hold. 4. Add 5 μL of the PCR Primer Cocktail and 25 μL of the PCR Master Mix to each sample. Mix thoroughly, seal the plate, place in the thermocycler, and run the program in step 3 (see Note 13).
130
Sadia Iqbal et al.
5. Vortex the AMPure XP beads until they are well dispersed and add 50 μL to each sample. Gently mix thoroughly and incubate at room temperature for 15 min. 6. Place the PCR plate on the magnetic stand at room temperature for 5 min or until the liquid becomes clear. Remove 95 μL of the supernatant from each well and discard. 7. With the plate on the magnetic stand, add 200 μL of freshly prepared 80% ethanol to each sample well without disturbing the beads. Incubate the plate at room temperature for 30 s, and then remove and discard all supernatant from each sample. 8. Repeat step 7. Let the plate dry at room temperature for 15 min while on the magnetic stand. 9. Add 32.5 μL of the Resuspension Buffer to the dried pellet for each sample. Gently mix thoroughly and incubate the plate at room temperature for 2 min. 10. Place the plate on the magnetic stand at room temperature for 5 min or until the liquid is clear and transfer 30 μL of clear supernatant from each sample to the corresponding well of a new 0.3 mL PCR plate. Store dscDNA at 20 C if the procedure is to be paused. 3.2.8 Quantification and Quality Control of the dscDNA Library
1. Load 1 μL of the dscDNA library for each sample on a Bioanalyzer DNA chip. 2. Dilute 1 μL of the resuspended dscDNA library with 1 μL Resuspension Buffer and load on an Advanced Analytical Fragment Analyzer using Standard Sensitivity NGS Fragment Analysis Kit. 3. Check the size and purity of the samples. The final product should be a band at ~260 bp (for single-read libraries) (see Note 14). 4. Proceed to normalization and pooling of cDNA libraries.
3.2.9 Normalization and Pooling of cDNA Libraries
1. Centrifuge the resuspended dscDNA libraries at 280 g for 1 min. If the sample was stored at –20 C, let it thaw at room temperature before the centrifugation step. 2. For non–pooled library sequencing, transfer 10 μL (or up to 400 μL based on concentration) from each sample to the corresponding well of a new 96-well MIDI plate (see Note 15). 3. Normalize the concentration of each sample library to 10 nM using 10 mM Tris–HCl, pH 8.5 with 0.1% Tween 20 and mix thoroughly. Seal the plate and store at 20 C until Next Generation Sequencing. 4. For pooled libraries, transfer 10 μL of each normalized sample library to be pooled from the plate prepared in step 3 to one well of a new 0.3 mL PCR plate. Up to 24 libraries can be pooled, with a total volume of 240 μL in a well.
Identification of Insecticide-associated Genes
131
5. Gently mix thoroughly, seal the plate and store at 20 C until Next Generation Sequencing. 6. Submit plate to a Next-Generation Sequencing facility or technician in a Research centre or commercial company. 3.3 RNA-Seq Data Analyses 3.3.1 Identification of Differentially Expressed Genes
1. Most commercial companies that provide Next Generation Sequencing services also have bioinformatics platforms that can trim, filter, assemble RNA-seq data and analyze DEGs and gene variants at a cost. If the option is unfeasible, follow the steps below, which employs the Qiagen CLC Genomics Workbench (abbreviated CLC from hereon), to process the data. 2. Obtain all available reference genes (Refseq) of GPA from NCBI databases. Also, download and add ESTs and other nucleotide sequences which are not fully annotated to the Refseq sequences to create a local GPA Refseq database in CLC. Remove redundancy in your database by performing a local BLASTN using the sequences in your database as both the subject and query. Alternatively, use the CD-HIT suite program (http://weizhong-lab.ucsd.edu/cdhit_suite/cgi-bin/ index.cgi) to reduce redundancy. 3. Use CLC to remove adapters and low-quality reads, and then by following the “RNA-Seq Analysis” feature, map reads to transcripts or genes of GPA, to obtain read counts and to compare between libraries to identify DEGs (see Note 16). 4. Appropriate comparisons between the following pairs of libraries will reveal DEGs associated with the insecticide treatment: (1) Data from treated and untreated lab strains of aphids, (2) Data from treated susceptible and resistant populations, (3) Data from treated susceptible colonies and untreated lab strains of aphids, (4) Data from treated resistant and untreated lab strains of aphids, and (5) Data from treated lab strains of aphids and either of the treated susceptible or resistant aphids. 5. Select DEGs with >4-fold change in RPKM (reads per kilobase per million reads) as significantly ( p < 0.05, q < 0.05) affected by the insecticide treatment. 6. Identify gene variants in DEGs using the “Resequencing Analysis” platform of CLC.
3.3.2 In Silico Characterization of Differentially Expressed Genes
1. Ascertain the identity of DEGs by comparing the gene products they encode to similar characterized proteins in NCBI protein databases using BLASTX [4]. 2. Predict functional domains and motifs of gene products of DEGs using the NCBI CDD or Pfam [5].
132
Sadia Iqbal et al.
3. Using the Kyoto Encyclopedia of Genes and Genomes (https://www.genome.jp/kegg/) databases, predict the function(s) of the gene products of DEGs and the metabolic processes they may be involved in. 3.4 qPCR Validation of Differentially Expressed Genes
1. Synthesize cDNA from the DNase-free total RNA isolated from insecticide-treated and control aphids using the HighCapacity cDNA Reverse Transcription kit. Bring the 10 RT buffer, 25 dNTP mix, 10 RT Random primers from 20 C and thaw on ice (see Note 17). 2. Prepare 10 μL solutions of RNA (dissolved in nuclease-free water) in PCR tubes for each of the insecticide-treated and control samples, making sure equal amounts of RNA from each treatment is used. 3. In a separate nuclease-free microfuge tube, prepare a 10 μL 2 RT reaction mix for each RNA sample on ice. Each reaction should comprise 2 μL of the 10 RT buffer, 0.8 μL of the 25 dNTP mix, 2 μL of the 10 Random primers and 4.2 μL of nuclease-free water. Remove the 50 U/μL of MultiScribe Reverse Transcriptase from 20 C and add 1 μL to the reaction. Mix gently but thoroughly (see Note 18). 4. Add the RT reaction mix to each of the 10 μL RNA solution. Gently mix thoroughly, place in a thermocycler, and run at 25 C for 10 min, 37 C for 120 min, 85 C for 5 min, and at 4 C for 10 min. Store cDNA at 20 C (see Note 19). 5. Prepare 1:10 dilution of each cDNA in a 0.6 mL tube using nuclease-free water to be used as the template for assessing amplification efficiency of qPCR primers. Store at 20 C. 6. Select 18S rRNA, Tubulin or GAPDH genes from the NCBI database as reference genes for qPCR assays (see Note 20). 7. Design qPCR primers for selected DEGs and a reference gene using Primer 3 [6] ensuring the melting temperatures are 60 C and expected amplicons are between 90 and 150 bp (see Note 21). Send primers to a commercial company of choice for synthesis. Resuspend primers with nuclease-free water at 10 pmol/μL. Store at 20 C until ready to use. 8. Assess the efficiency of primers in a 20 μL PCR reaction containing 10 μL of the 2 Go Taq Green Master Mix, 1 μL of each of the primers for a DEG or reference gene, 1 μL of 1:10 diluted cDNA, and 7 μL of nuclease-free water. Negative control reactions, one without cDNA and the other with no primers are recommended. 9. Conduct the PCR in a thermocycler at 95 C for 3 min followed by 30 cycles of 95 C for 30 s, 60 C for 30 s, 72 C for 30 s, a final extension at 72 C for 10 min, hold at 14 C.
Identification of Insecticide-associated Genes
133
10. Prepare a 2% agarose gel in 1 TAE buffer (w/v); add agarose to buffer, heat in a microwave for about 1.5 min or until the agarose completely dissolves. Add 1 μL of SYBR SafeTM DNA gel stain to 100 mL of agarose gel and pour in a gel casting tray with appropriate combs. Let the gel set for approximately 30 min. 11. Run gel electrophoresis: set up the apparatus, load the PCR samples in wells in the agarose gel along with a 100 bp DNA marker placed in a 1 TAE buffer and run the gel at 80 V for about 1 h. View the gel in a transilluminator. Primers that amplified the single expected amplicon can be used for qPCR assays. 12. Assess the efficiency of the primers in a qPCR assay and determine the appropriate amount of cDNA as templates by generating standard curves. For each qPCR primer set, prepare seven to nine dilutions of cDNA as templates for qPCR using nuclease-free water and 0.6 mL tubes. The dilutions can be made from the 1:10 dilution of the cDNA to created for example 101 to 109 dilutions with each previous dilution being ten times more. The dilution series is best done by adding from previous dilutions, vortexing and centrifuging each time before the next dilution is made as shown in Fig. 1 (see Note 22). Prepare qPCR reactions in duplicates or triplicates. 13. Thaw the 2 SensiFAST™ SYBR® No-ROX mix, qPCR primer aliquots and cDNA samples on ice. For each 20 μL qPCR reaction, combine 10 μL of the 2 SensiFAST™ SYBR® No-ROX mix, 1 μL each of the forward and reverse primers, 1 μL each from the cDNA dilutions, and 7 μL of nuclease-free water in a PCR tube. Also, set up “no primer” and “no cDNA” controls. 14. Place reactions in the Rotor-Gene Q Rotor disc, fit the locking ring and set up a two-step cycling program with a polymerase activation step at 95 C for 2 min followed by 35–45 cycles of 95 C for 5 s and 60 C (annealing temperature of primers) for
Fig. 1 Schematic diagram of the setup for preparing serial dilutions for generating standard curves required for assessing the efficiency of qPCR primers
134
Sadia Iqbal et al.
15 s. Acquire data on the green channel. Also include a Melt Profile at the end of cycling ranging from 50 C to 90 C, to determine primer efficiency. 15. Retrieve the data from the Rotor-Gene Q software after the run has ended and analyze results by selecting a suitable threshold value using the Rotor-Gene Q Series Software 1.7. Make sure there was no amplification in the negative control reactions, and the melt curve for each primer selected for further analyses of gene expression had a single distinct peak in each reaction with amplification (see Note 23). 16. Using the mean CT values (mean for replicate reactions) generate a standard curve separately for each primer pair in Microsoft Excel by plotting the CT values against the cDNA dilutions. Generate an equation of the curve with an expected gradient of –3.3 and the R-squared value representing the Primer efficiency, with ~1.0 being 100% efficiency as in the example in Fig. 2. Select primers with efficiencies between 95% and 100% for validation of DEGs in subsequent qPCRs. 17. Set up separate 20 μL qPCR reactions for a reference gene and DEGs using cDNAs obtained from pairs of treatments from which the DEG was identified. Use the same volume of the cDNA dilution at which all the primers amplified the expected amplicons for each DEG and the reference gene in the reactions used to generate standard curves. The reactions should be set up as in step 8, run as in step 9 and analyzed as in step 10.
Fig. 2 An example of a standard curve generated using cDNA and eight serial dilutions with a qPCR primer pair. A good curve should have a gradient and R2 close to 3.33 and ~1.0 respectively
Identification of Insecticide-associated Genes
135
18. Retrieve results and determine the mean CT value and standard deviation using the Rotor-Gene Q Series Software 1.7. 19. Calculate the fold change in expression, for example, between insecticide-treated and control untreated sample, using the ΔΔCT method [7] as follows: ΔC T of treatment ¼ ðMean C T of target gene Mean C T of reference geneÞ ΔC T of control ¼ ðMean C T of target gene Mean C T of reference geneÞ The calibrated value (ΔΔCT) is calculated by ΔΔC T ¼ ðΔC T of treatment ΔC T of controlÞ Fold change in DEG between treatments is calculated as. Fold change ¼ 2ðΔΔCTÞ
4
Notes 1. If cost is an issue, the number of insecticide treatments can be reduced. For example, using one of the instar stages and an adult stage will reduce the number of treatments and cost. 2. If the LC50 for an insecticide is unknown, determine it by exposing susceptible aphids to known concentrations and calculate LC10 to LC50. Note time of exposure for each LC as these will guide the collection of aphids for RNA isolation following insecticide treatment. 3. Total RNA can also be isolated using other methods such as phenol/chloroform-based methods followed by ethanol/salt precipitation or commercial kits such as the TRIzol Reagent (Thermo Fisher Scientific) or Qiagen RNeasy Micro or Mini Kit (Qiagen Pty. Ltd). 4. Dissolve the lyophilized DNase I in 550 μL of nuclease-free water and mix gently. Do not vortex, as the enzyme is prone to shearing. In order not to lose activity over time, aliquot into single-use tubes (10 μL) and store at 20 C. 5. To avoid contamination of reagents or reaction mixes, conduct all steps using RNase-free aerosol-barrier pipette tips, wipe pipettes with 70% ethanol or autoclave where possible, keep plates containing samples sealed and clean laminar flow hood with 70% ethanol before and between reaction setups. If your lab can afford, section a bench and a set of pipettes for only RNA-seq preparations or for at least the period when RNA-seq reactions are scheduled. 6. If only a few samples are being processed, 1.5 mL RNase-free low retention Eppendorf tubes can be used with a magnet such as the Thermofisher DynaMag-212321 D instead of the
136
Sadia Iqbal et al.
96-well PCR plate and the magnetic stand. Opening only one tube at a time minimizes cross-contamination, and the bead steps are much easier and more accurate with the greater visibility afforded by the individual tubes. 7. Gently vortexing and spinning down briefly is often preferable with processes involving beads as any liquid splashed on the sides can dry out and be left out of subsequent steps. Ensure the solution is a homogenous brown color after mixing. 8. If time and facilities permit, you can check the extent of degradation of the RNA before proceeding to the next step. If the starting material was more degraded than recommended, reducing the 94 C incubation time will decrease further fragmentation of the RNA. 9. The First Strand Master Mix with SuperScript II is stable only up to six freeze–thaw cycles. So, make enough for use per experiment. 10. If input RNA was less than recommended, and End Repair, A-Tailing and Ligation controls were used, dilute down further in proportion to the reduction in input RNA, or the process controls will comprise a higher proportion of the sequencing run than necessary. 11. When indexing libraries, arrange samples that will be combined into a common pool in the same row. Include a common index in each column. This arrangement facilitates pipetting when dispensing indexed adapters and pooling of indexed libraries later in the protocol. 12. The purpose of the bead clean up is to remove adapters, concatenated adapters and small cDNA fragments which if present, will be amplified preferentially in the enrichment PCR step. An extra microliter can be added to the elution volume and used in the quality control step on the Bioanalyzer to check that there are no fragments below 160 bp. 13. The amplified indexed cDNA libraries should be treated as post-PCR products and processed in a different place with different pipettes to the rest of the library steps, preferably in a fume hood and the surface decontaminated after the bead clean with bleach to prevent cross-contamination of future experiments. 14. If adapter or adapter dimer peaks are present (below 200 bp) conduct two more cleaning steps with the AMPure beads using a more stringent ratio (e.g., 0.8 ratio of AMPure beads to the library). Free adapter can cause assignment of reads to the incorrect bar code, and adapter dimer causes overclustering, short reads, and wasted sequencing runs.
Identification of Insecticide-associated Genes
137
15. If exact concentrations of the library are to be known, quantify each cDNA library using a Qubit dsDNA High Sensitivity kit or equivalent (spectrophotometric methods such as nanodrop are not recommended). Initial library concentration is calculated from the following formula. cDNA library ¼
ng μL
660=average size of cDNA library in bp
1, 000, 000
where 660 is the average g/mole of dsDNA. 16. Separate programs can be used to conduct steps in the processing of the data such as the use of SeqPrep (https://github. com/jstjohn/SeqPrep) for adapter removal and quality control, Geneious (https://www.geneious.com) for assembly of reads and DESeq2 [8] for read count and DEG identification. 17. Total RNA extracted for the RNA-seq in Subheading 3.1.2 must be used for this assessment so the expression levels of genes calculated for the DEGs will accurately reflect the results of the qPCR validation of selected DEGs. Also, to accurately compare the expression of a DEG in two treatments, equal amounts of the total RNA for the different treatments must be used for cDNA synthesis. 18. To encourage homogeneity in reaction mixes, increase confidence in the interpretation of PCR results, and to reduce pipetting error, the use of master mixes, quick vortex and a brief spin of reagents (before use) and reaction mixes are recommended. 19. The synthesized cDNA can be kept at 4 C for short term storage (up to 24 h). For longer-term storage at 4 C, add EDTA to a final concentration of 1 mM to chelate cations and to prevent nucleic acid degradation. Alternatively, store at 20 C. 20. Some widely used reference genes can be affected by some treatments. It is, therefore, advised that more than one endogenous gene is identified and used for the qPCR assays and the one that demonstrates stability used for assessing relative gene expression. 21. The qPCR primers can also be designed using other software. Generally, the primers should have (1) an optimum melting temperature of 60 C, (2) a GC% percentage of between 35% and 65%, (3) amplify amplicon of 200 nt and 0.250 standard deviation among technical replicates (see Note 22) or that are below the assay LOD (see Table 4). At least one value per standard level should be included in the calculation (see Note 23), unless an identifiable source of variation calls for masking all values from that level such as visible air bubbles.
RT-qPCR Detection of Core WCR RNAi Genes
167
5. Allow software to calculate Cq values and reaction efficiencies for each target using standard curve wells. Verify reaction efficiency is between 90% and 110%, and R2 values are 0.9800 (see Note 24). 6. Examine each Cq value for each gene target in the “no amplification control” (NAC) wells. If necessary, mask values that cause >0.250 standard deviation among technical replicates, or use the two values resulting in lowest standard deviation (see Note 22). Both NTCs and NRTCs should ideally show no signal detection or should show values below the assay LODs for one or more targets (see Table 4, Note 25). 7. If NACs show measurable Cq values (defined as 2 replicates per sample with standard deviation 0.250 and above assay LOD for each target in each sample), check that these amplified >5 Cq values later than either any unknown sample (NTC), or the corresponding unknown sample type (NRTC) (see Note 25). 8. If standard curves or NACs do not meet acceptability parameters for each gene target in each sample, do not proceed with further analysis. This indicates a problem with the plate that must be further evaluated, depending on the specific issue (s) observed (see Notes 24 and 25). 9. Examine each Cq value for each gene target in each replicate of unknown sample wells. If necessary, mask values that cause >0.250 standard deviation among technical replicates, or that are below the assay LODs (see Table 4, Note 22). If at least two values per gene target per sample do not meet the standard deviation and LOD parameters, the sample should be excluded from further analysis. 10. If plate controls and unknown data meet acceptability parameters outlined in Subheading 3.4 following data processing, proceed with gene expression calculations as previously described using absolute [13] or relative [4, 14] methods, as appropriate to meet experimental goals (see Notes 26 and 27).
4
Notes 1. Problems with nucleic acid adherence to several brands of low-binding plastics have been experienced with this procedure. This can negatively affect low-abundance genes, such as the core WCR RNAi machinery genes throughout all or at certain life stages, or can cause inconsistent performance of qPCR standards. BIOplastics/CYCLERtest, Inc. has been confirmed to produce plastics that do not interfere with accurate measurements of low (picogram) nucleic acid amounts.
168
Courtney A. Davis-Vogel
Table 4 Limits of detection for optimized WCR qPCR assays Limits of detection
Assay
Target
Target type
UL standard (pg/rxn)
Drosha
drosha α-tubulin ef1α
GOI Reference Reference
3.13E+02 3.13E+02 3.13E+02
Dicer-1
dcr-1 α-tubulin ef1α
GOI Reference Reference
Dicer-2
dcr-2 α-tubulin ef1α
Pasha
LL standard (pg/rxn)
LLOD Cq
(% CV)
(s)
1.96E-06 7.83E-06 3.91E-06
34.769 34.372 34.665
2.22 1.86 2.47
0.773 0.793 0.856
3.13E+02 3.13E+02 3.13E+02
1.26E-06 1.57E-05 1.57E-05
35.812 35.278 34.606
1.55 2.81 2.82
0.554 0.993 0.977
GOI Reference Reference
3.13E+02 3.13E+02 3.13E+02
6.26E-05 1.57E-05 1.57E-05
33.845 34.317 34.471
2.74 2.52 2.57
0.928 0.864 0.886
pasha α-tubulin ef1α
GOI Reference Reference
3.13E+02 3.13E+02 3.13E+02
1.96E-06 7.83E-06 3.91E-06
33.456 34.095 34.361
2.56 1.80 2.06
0.858 0.614 0.709
Loquacious
loqs α-tubulin ef1α
GOI Reference Reference
3.13E+02 3.13E+02 3.13E+02
1.96E-06 1.96E-06 3.91E-06
33.027 34.466 33.919
2.56 3.49 2.43
0.846 1.204 0.824
R2D2
r2d2 α-tubulin ef1α
GOI Reference Reference
3.13E+02 3.13E+02 3.13E+02
1.96E-06 1.96E-06 1.96E-06
34.757 35.689 34.863
2.37 2.57 2.56
0.822 0.917 0.894
Argonaute 1
ago1 α-tubulin ef1α
GOI Reference Reference
3.13E+02 3.13E+02 3.13E+02
1.96E-06 1.96E-06 1.96E-06
35.575 35.468 34.498
1.88 2.34 2.10
0.668 0.829 0.723
Argonaute 2
ago2 α-tubulin ef1α
GOI Reference Reference
3.13E+02 3.13E+02 3.13E+02
9.78E-07 3.91E-06 3.91E-06
34.245 33.531 34.196
2.34 2.09 2.75
0.792 0.697 0.926
Upper limit of each target in each WCR qPCR assay was arbitrarily assigned as curve standard 1 of 9 for pure DNA species. Follow typical rules for monitoring early amplification of targets in samples [10]. Lower limit of detection (LLOD) for each assay is set at the listed Cq; samples registering signal below this Cq value cannot be used and should instead be reported as below the LOD of the assay. GOI gene of interest, pg/rxn picograms per reaction, UL upper limit, LL lower limit, Cq quantification cycle, % CV percent coefficient of variation, s standard deviation at the LLOD
2. Production and handling of RNA for analysis of WCR genes was considered carefully, as accurate RT-qPCR results heavily depend on RNA quality [11, 15]. If live insect samples cannot be processed immediately and stored as homogenates, they should be flash-frozen alive in liquid nitrogen and stored at 80 C—storage in an RNA preserving solution such as RNALater™ has not been evaluated and is not preferred. Use of an RNA preserving solution should be treated as a new sample type and undergo validation (see Fig. 1). Stored frozen samples
RT-qPCR Detection of Core WCR RNAi Genes
169
should be processed in kit Lysis/Binding Buffer as soon as possible, as outlined beginning in Subheading 3.2. Ensure all samples within an experiment are treated identically—either all samples should be frozen before homogenization, or none should be. 3. Maintain this ratio strictly, as it helps normalize across samples and sample types. If samples are smaller than 10 mg due to difficulty of collection, use the same number of individuals per sample replicate and a straight 350μL buffer per sample for homogenization. This differs from instructions included with the RNA isolation kit, but is recommended due to technical difficulty associated with cleanly removing less than 100μL from a phenol–chloroform extraction—the first step in the RNA isolation procedure. If samples are larger than 250 mg, continue to use the required amount of Lysis/Binding Buffer even if it becomes necessary to order extra kits to obtain the necessary buffer volume. However, only a subsample of these larger volume samples need be carried through the remainder of the isolation. Additionally, always ensure whatever physical disruption tool used for homogenization completely grinds the sample. 4. RNA samples have been confirmed as stable by fragment analysis and RT-qPCR when isolated from homogenates flashfrozen and stored at 80 C for at least four to six months. If samples are stored longer, stability should be reverified. 5. It may yield cleaner RNA to order and use additional tubes for the wash steps rather than aspirate the column flow-through and reuse the same tube at nearly all spin steps. In this case, please order Elution Tubes (Cat#AM12480). Additional kit-compatible columns may also be ordered if necessary (Spin Cartridges, Cat#AM10051G). 6. On the final centrifugation step after incubating columns with hot nuclease-free water, ensure recovery of all 100μL water before discarding column. Slight speed increase (2000–3000 RCF) or up to 10 min additional spin may be necessary to elute samples with a large amount of columnbound RNA. 7. RNA samples were confirmed as contaminated with ~50% DNA following silica-based column isolations. This level of DNA contamination is incompatible with the ef1a reference gene primers utilized in these RT-qPCR assays. Due to this increased primer sensitivity, DNase treatment steps are much longer than manufacturer recommendations and require in-solution—rather than on-column—DNase treatment. 8. The columns in this procedure are very susceptible to lifting out of their Collection Tubes. It is important that these
170
Courtney A. Davis-Vogel
columns are handled one-at-a-time, carefully and slowly while placing into and removing from centrifuges, to ensure final samples are not contaminated with wash reagents. 9. It is strongly recommended to proceed with reverse transcription on the same day as RNA isolation, and the number of samples processed per day should be calibrated for ability to perform both procedures. RNA at this stage will be at its highest quality and will yield the best results for low-expressing genes (see Note 2). If reverse transcription cannot be done on the day of RNA isolation, store RNA flash-frozen at 80 C. Conduct reverse transcription as soon as possible; thaw RNA samples on wet ice, if starting from frozen samples. Long-term (>4 months) storage of RNA is recommended to be in pelleted form under ethanol at 80 C. Use of RNA stored under ethanol for this procedure must undergo revalidation prior to use (see Fig. 1) [12]. Ensure all samples within an experiment are treated identically—either all samples should be frozen before RT, or none should be. 10. RNA samples for this procedure have been typically measured spectrophotometrically, to allow purity checks via A260–A280 and A260–A230 ratios. These ratios for pure RNA should be ~2.0–2.2, and the A230:A260:A280 ratio should be ~1:2:1 [16]. However, any RNA assessment method can be used. 11. RNA amounts listed in Table 2 for RT reactions have been validated for both reaction efficiency (90–110%) and dilution agreement of RT capacity (i.e., stability of difference in Cq (ΔCq) between WCR target and reference genes across all genes and all samples simultaneously) [12]. Alternative amounts of RNA into RT reactions must undergo validation prior to use (see Fig. 1) [12]. 12. Accurate detection of the WCR RNAi target genes depends on specific use of the SuperScript™ II kit. The kit outperformed four other cDNA synthesis kits on multiple parameters when measuring low abundance genes [17], and two others on both RT reaction efficiency and capacity (see Note 11) [12]. Use of alternative reverse transcription protocols for the genes and sample types within this protocol would have to undergo validation prior to use (see Fig. 1) [12]. 13. cDNA must undergo a mandatory 1:10 dilution to avoid interference with qPCR accuracy. The cDNA dilutions listed in Table 2 for qPCR reactions have been validated for both reaction efficiency (90–110%) and qPCR linearity (i.e., stability of ΔCq between WCR target and reference genes across all genes and all samples simultaneously) [12]. Alternative amounts of cDNA into qPCR reactions would have to undergo validation prior to use (see Fig. 1) [12].
RT-qPCR Detection of Core WCR RNAi Genes
171
14. Best practice would be to make standards in the same background solution as the unknown samples. Because the cDNA reactions in this protocol are diluted at least 1:10, water is considered an acceptable background solution. 15. This procedure was developed using a 10μL reaction volume and 384-well qPCR plates. If the qPCR reaction master mix ratios are maintained as described in Subheading 3.3, larger reaction and plate volumes can likely be used. Recommendation is to assay standard curves in qPCR using the desired larger reaction volumes and plate wells and verify reaction efficiency follows previously reported values [12, 13]. 16. This will protect the bottom of the plate from picking up any contaminating fluorescent signal or debris until thermocycler loading. Only remove plates from their protective packaging as they are being used. 17. It is critical that pipette tips go directly into intended wells without touching the plate’s surface anywhere else. Any crosscontamination can potentially be detected and affect results. 18. A film applicator designed specifically for applying optical adhesive film to qPCR plates can be used, but any clean flat tool that will not scuff or contaminate the film may be used, such as a rubber ruler. 19. Reference parameters for centrifugation are 5 min at anywhere from 2250 to 6189 RCF. It is recommended to always visually inspect plates for air bubbles or other problems prior to loading. 20. Depending on which real-time PCR system is used, the experiment file may have to be prelabeled correctly with standards, unknown and control samples, and blank wells (see Fig. 3). It is preferred to treat all 384 wells as unknown samples with detection for all three probes and relabel after qPCR completion, if allowed by the software, so mis-labeling of wells will not result in missed data collection. 21. The threshold line is a level of fluorescent signal intensity reliably distinguishable above background and comfortably within the geometric phase of each reaction—automatically detected unless empirical use of these assays over time warrants manually adjusting this setting. Ideal thresholds are set where amplification curves are parallel and precision of all technical replicates is highest [10]. 22. Utilizing a typical qPCR technical replicate number of three, standard deviation in this context does not have proper statistical meaning. It is useful only as a data screening tool. 23. Use of correctly prepared standard curves made as a ten-fold dilution series with known amounts of pure standard DNA are
172
Courtney A. Davis-Vogel
beneficial because the analyst knows what value to expect at each concentration level. Reaction efficiencies of 100% should show an increase in Cq between each level of 3.3. Values that do not match expected outcomes may be masked, so long as at least one value exists at each concentration level and R2 is 0.9800—ideally two values with standard deviation 0.250 should be used. When screening data, preference should be given to agreement between replicate values over agreement with expected values. 24. Plates with standard curves not meeting these parameters may have problems with incorrect preparation of the standards, master mix, or plates, among other causes—especially if more than one curve exhibits problems. Depending on performance of other technical parameters, data from these plates may not be usable or the type of eligible analysis may be restricted (see Subheading 3.4, Notes 25–27). 25. Problems with NACs will typically automatically disqualify all data on the affected plate(s) from use or may restrict the type of eligible analysis, depending on the specific problem (see Notes 26 and 27). An interfering level of contamination is defined as 5 Cq between the NAC and corresponding unknown sample. A ΔCq ¼ 5 represents 3.125% (25 100) signal contribution of the contaminating factor. Contributions above this cutoff are considered unacceptable. For example, an NRTC prepared from WCR eggs should amplify >5 Cq values later than all unknown WCR egg samples. No level of measurable amplification (defined as 2 replicates per sample with standard deviation 0.250 and above assay LOD) is typically acceptable for NTCs, as this usually indicates contamination of reagent stocks. However, a round of data may be saved if ΔCq >5 between NTCs and any unknown sample, with the caveat that all wells are assumed to be affected equally by the contamination. Plates with NACs not meeting these parameters may have problems such as contamination of primers, probes, RT or qPCR master mixes, plate or sample handling issues, or incomplete sample DNase treatment, among other causes. 26. Use values interpolated from standard curves (in pg) for: (1) Absolute measurements of RNA detected from reversetranscribed samples; (2) Relative gene expression calculations that normalize by ratio of target gene (pg) to the geometric mean of all reference genes (pg) [13]; or (3) Dilutioncorrected values that can then be used in relative gene expression calculations that normalize by ratio of target gene (pg) to the geometric mean of all reference genes (pg) [13]. Absolute values generated by fully optimized RT and qPCR reactions and interpolated from a standard curve can be corrected to
RT-qPCR Detection of Core WCR RNAi Genes
173
account for different assay targets being run at different dilutions, even within the same samples. 27. Use Cq values for: (1) Relative gene expression calculations that normalize using ΔCq [4, 14]. Cq values cannot be corrected for use of different dilutions, so all assay targets must be run at the same dilution. If a certain plate(s) shows 5 Cqs between NACs and the appropriate unknown samples (see Note 25) for one of the reference genes, Cq values for that one gene may be excluded and only Cq values from the other reference gene may be used as the sole normalizer in a ΔCqbased relative gene expression calculation [4, 14]. This type of data handling is not advised for critical or published experiments and should not be done routinely. This chapter’s protocol used with the appropriate whole insect WCR sample types should not normally produce this issue. References 1. Bolognesi R, Ramaseshadri P, Anderson J et al (2012) Characterizing the mechanism of action of double-stranded RNA activity against western corn rootworm (Diabrotica virgifera virgifera LeConte). PLoS One 7(10):e47534. https://doi.org/10.1371/journal.pone. 0047534 2. Khajuria C, Velez AM, Rangasamy M et al (2015) Parental RNA interference of genes involved in embryonic development of the western corn rootworm, Diabrotica virgifera virgifera LeConte. Insect Biochem Mol Biol 63:54–62. https://doi.org/10.1016/j.ibmb. 2015.05.011 3. Hu X, Richtman NM, Zhao JZ et al (2016) Discovery of midgut genes for the RNA interference control of corn rootworm. Sci Rep 6:30542. https://doi.org/10.1038/ srep30542 4. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2^(-ΔΔCT) method. Methods 25:402–408. https://doi.org/10. 1006/meth.2001.1262 5. Vandesompele J, De Preter K, Pattyn F et al (2002) Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 3(7):RESEARCH0034. https://doi.org/10.1186/gb-2002-3-7research0034 6. Cronin M, Ghosh K, Sistare F et al (2004) Universal RNA reference materials for gene expression. Clin Chem 50(8):1464–1471.
https://doi.org/10.1373/clinchem.2004. 035675 7. Novoradovskaya N, Whitfield ML, Basehore LS et al (2004) Universal reference RNA as a standard for microarray experiments. BMC Genomics 5(1):20. https://doi.org/10. 1186/1471-2164-5-20 8. Gingeras TR (2004) RNA reference materials for gene expression studies. Difficult first steps. Clin Chem 50(8):1289–1290. https://doi. org/10.1373/clinchem.2003.030072 9. Joseph LJ (2004) RNA reference materials for gene expression studies. RNA metrology: forecast calls for partial clearing. Clin Chem 50 (8):1290–1292. https://doi.org/10.1373/ clinchem.2004.032441 10. Applied Biosystems (2016) Real-time PCR Handbook. ThermoFisher Scientific. https:// www.thermofisher.com/us/en/home/ global/forms/real-time-pcr-handbook-down load.html 11. Bustin SA, Benes V, Garson JA et al (2009) The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem 55(4):611–622. https://doi.org/10.1373/clinchem.2008. 112797 12. Davis-Vogel C (2018) Exploring RNA interference in the agricultural pests western corn rootworm, fall armyworm, and southern green stink bug. Iowa State University. https://lib.dr.iastate.edu/etd/16916
174
Courtney A. Davis-Vogel
13. Davis-Vogel C, Ortiz A, Procyk L et al (2018) Knockdown of RNA interference pathway genes impacts the fitness of western corn rootworm. Sci Rep 8(1):7858. https://doi.org/10. 1038/s41598-018-26129-6 14. Riedel G, Ru¨drich U, Fekete-Drimusz N et al (2014) An extended ΔCT-method facilitating normalisation with multiple reference genes suited for quantitative RT-PCR analyses of human hepatocyte-like cells. PLoS One 9:2–6. https://doi.org/10.1371/journal.pone. 0093031 15. Vermeulen J, De Preter K, Lefever S et al (2011) Measurable impact of RNA quality on gene expression results from quantitative PCR. Nucleic Acids Res 39:e63. https://doi.org/10. 1093/nar/gkr065 16. Glasel JA (1995) Validity of nucleic acid purities monitored by 260nm/280nm absorbance ratios. BioTechniques 18(1):62–63
17. Levesque-Sergerie J-P, Duquette M, Thibault C et al (2007) Detection limits of several commercial reverse transcriptase enzymes: impact on the low- and high-abundance transcript levels assessed by quantitative RT-PCR. BMC Mol Biol 8:93. https://doi.org/10.1186/ 1471-2199-8-93 18. Miyata K, Ramaseshadri P, Zhang Y et al (2014) Establishing an in vivo assay system to identify components involved in environmental RNA interference in the western corn rootworm. PLoS One 9:1–15. https://doi.org/ 10.1371/journal.pone.0101661 19. Rodrigues TB, Khajuria C, Wang H et al (2014) Validation of reference housekeeping genes for gene expression studies in Western corn rootworm (Diabrotica virgifera virgifera). PLoS One 9:e109825. https://doi.org/ 10.1371/journal.pone.0109825
Chapter 14 Examination of the Suitability of Attractive Target Genes for RNAi-Based Pest Control Weilin Zhang Abstract In the past two decades, studies investigating RNAi-based pest control have continued as a major focus of research. In this chapter, I describe the crucial procedure of examining the suitability of attractive target genes in insects for RNAi-based pest control, including preliminarily examining the suitability of the candidate genes by gene expression analysis, encapsulating dsRNA using nanoparticles to avoid degradation caused by insect digestive systems, and introducing exogenous dsRNAs into pests through micro-injection to rapidly and effectively examine the suitability of dsRNA in vivo in insects. Key words RNAi, Pest control, dsRNA, Micro-injection, Suitability
1
Introduction In contrast to employing chemicals to control pests, utilizing hostplant resistance has been considered to be a more practical and economical strategy to control pests; therefore, identifying hostplant resistance genes has been a focus of research for decades. However, the lack of novel germplasm sources of host-plant resistance to pests may have hindered efforts to identify novel host-plant resistance genes [1]; meanwhile, some species of pests may adapt rapidly to host-plant resistance genes and then cause heavy pest outbreaks and crop loss, necessitating the development of novel strategies of pest control [2]. Among the novel potential approaches for pest control, RNA interference (RNAi)-based pest control has been reported to be a highly promising approach [3]. RNAi is a method for achieving post-transcriptional gene silencing induced by exogenous double-stranded RNA (dsRNA), which mediates the degradation of homologous mRNA in pests. Therefore, based on in silico screening, the gene expression analysis
Luis Marı´a Vaschetto (ed.), RNAi Strategies for Pest Management: Methods and Protocols, Methods in Molecular Biology, vol. 2360, https://doi.org/10.1007/978-1-0716-1633-8_14, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2022
175
176
Weilin Zhang
of the gene or protein of interest in pests is considered the most important step to preliminarily examine whether the in silico– screened target genes are good candidates to be targeted in pests. Meanwhile, the introduced exogenous dsRNA may be rapidly degraded by the insect digestive system; therefore, the exogenous dsRNA’s stability in vivo in pests is another crucial issue to be considered when examining the suitability of the target gene in insects. Encapsulating dsRNA using nanoparticles [3] can be employed to reduce the rapid degradation of ingested dsRNA in the insect digestive system and ensure long-lasting RNAi. The data available to date suggest that there are only a small number of successful instances of systemic RNAi responses that are triggered in insects by directly introducing exogenous short interfering RNAs [4, 5]. Rather, exogenous dsRNAs must be introduced to cause systemic RNAi responses. Micro-injection can directly and rapidly deliver precise amounts of dsRNA to the target tissue or hemolymph and can avoid the physical barrier of intestinal epithelial cells and epicuticles; therefore, micro-injection has been widely employed in model and non-model insect pests for gene function studies in the laboratory and can be employed to examine the suitability of target genes in insects on a large scale to achieve RNAi-based pest control. In this chapter, I describe the analysis of the suitability of target genes for RNAi-based pest control.
2
Materials
2.1 Examining the Expression of the Genes or Proteins of Interest in Insects
1. TissueLyser II (QIAGEN). 2. Liquid nitrogen. 3. Total RNA extraction reagent. 4. Diethyl pyrocarbonate (DEPC). 5. Chloroform for RNA extraction. 6. Isopropanol for RNA extraction. 7. 75% ethanol for RNA extraction (prepared with DEPC-treated water). 8. RNase-free water. 9. SuperScript™ III First-Strand Synthesis System (Invitrogen), which contains 50 μM Oligo(dT)20, 10 RT buffer, 0.1 M DTT, 25 mM MgCl2, 10 mM dNTP mix, 200 U/μL SuperScript™ III RT, 40 U/μL RNaseOUT™, 2 U/μL RNase H, DEPC-treated water, stored at 20 C. 10. Microspectrophotometer Scientific).
(NanoDrop
11. Beacon Designer™ software.
2000,
Thermo
Validation of RNAi Target Genes for Pest Control
177
12. StepOnePlus™ Real-Time PCR System (Applied Biosystems). 13. Power SYBR® Green Master Mix (Applied Biosystems®). 14. StepOne Software version 2.1. 15. Gel Imaging System (GelDoc-It TS). 16. 80 C freezer for RNA sample storage. 2.2 Synthesis of dsRNA
1. PCR primer design software (Primer premier6.25, Premier Biosoft International). 2. Pfu polymerase (Thermo Scientific™). 3. dNTPs. 4. PCR thermal cycler (Applied Biosystems). 5. Gel Imaging System (GelDoc-It TS). 6. High Pure PCR Product Purification Kit (Roche). 7. Escherichia coli DH5α competent cells (Novagen, Darmstadt). 8. Ampicillin. 9. Petri dish. 10. Shaker. 11. Microspectrophotometer Scientific).
(NanoDrop
2000,
Thermo
12. 6 loading dye (NEB). 13. PureLink HiPure plasmid extract Kit (Invitrogen). 14. pGEM-T Easy vector (Promega), 15. MEGAscript T7 Transcription Kit (Thermo Scientific), which contains T7 Enzyme Mix, 10 Reaction Buffer, ATP Solution, CTP Solution, GTP Solution, and UTP Solution, which are all stored at 20 C, and nuclease-free water, which may be stored at any temperature. 16. MEGAclear™ Kit (Invitrogen). 17. 80 C freezer. 18. Nuclease-free deionized water (diH2O). 19. Centrifuge. 20. Incubator. 21. M13 forward primer: 50 -GTAAAACGACGGCCAG-30 . and M13 reverse primer: 50 -CAGGAAACAGCTATGAC-30 . 22. 10 PCR buffer: 15 mM MgCl2, 500 mM KCl and 100 mM Tris–HCl. 23. 50 TAE buffer: 2 M Tris, 1 M acetic acid, 50 mM EDTA, adjust the pH to 8.4 using NaOH.
178
Weilin Zhang
24. LB medium: place 5 g yeast extract, 10 g of peptone and 10 g of NaCl into a beaker, add H2O to 1000 mL of liquid LB medium, add 2.4–2.7 phytagel and H2O to 1000 mL of solid LB medium, pH ¼ 7.0. Autoclave the medium prior to use. 25. 1 TE buffer: 10 mM Tris–HCl (pH 7–8), 1 mM EDTA. 2.3 Increasing the Stability and Functionality of dsRNA
1. 0.05% (w/v) 30 kDa polyacrylic acid solution. 2. 0.1 M calcium nitrate solution. 3. Digital magnetic stirrer. 4. 0.06 M (pH ¼ 12) ammonium phosphate solution. 5. Dropper. 6. Cup horn sonicator (Qsonica). 7. Deionized water (diH2O). 8. 50 kDa dialysis membrane. 9. Teflon bomb. 10. 5 mg/mL poly-L-arginine. 11. 15 mL centrifuge tube. 12. Ultracentrifuge (Thermo Scientific™ Sorvall™ WX+).
2.4
dsRNA Delivery
1. Glass capillary (outer diameter: 1.0 mm, inner diameter: 0.75 mm). 2. Micropipette puller (P-97, Sutter Instrument). 3. Fine tweezers. 4. Food dyes, such as FD&C Blue No. 1 (CAS: 3844-45-9). 5. Carbon dioxide (CO2). 6. Ice. 7. Rubber table. 8. Microinjector (IM-9B, Narishige). 9. Double-sided tape. 10. Stereomicroscope (OLYMPUS). 11. Chamber. 12. Artificial diets. 13. Plant seedlings.
3
Methods 1. Prepare samples, for example, whole pest bodies of different developmental stages and different pest tissues (see Note 1). Immediately snap-freeze the samples in liquid nitrogen and
Validation of RNAi Target Genes for Pest Control
3.1 Examining Gene Expression by Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)
179
then grind them to fine powder using TissueLyser II (see Note 2). 2. Extract total RNA from the samples using total RNA extraction reagent according to the manufacturer’s instructions (see Note 2). 3. Quantify the total RNA using a microspectrophotometer. 4. Prepare first-strand cDNA by reverse transcription with the SuperScript III First-Strand Synthesis System according to the manufacturer’s instructions as follows. Add 1 μg of total RNA, 1 μL of 50 μM Oligo(dT)20, and 1 μL of 10 mM dNTP mix to a 0.5-mL centrifuge tube, and add DEPC-treated water to 10 μL. Denature for 10 min at 65 C and then chill on ice for 2 min. Add 10 μL of cDNA Synthesis Mix to the 0.5-mL centrifuge tube. The 10 μL cDNA synthesis mix contained 2 μL of 10 RT buffer, 4 μL of 25 mM MgCl2, 2 μL of 0.1 M DTT, 1 μL of 40 U/μL RNaseOUT™, and 1 μL of 200 U/μL SuperScript™ III RT. Mix gently and centrifuge briefly. Synthesize for 50 min at 50 C. Terminate the reaction at 85 C for 5 min. Cool the mixture to room temperature. Add 1 μL of 2 U/μL RNase H and incubate at 37 C for 20 min to remove RNA. 5. Quantify the first-strand microspectrophotometer.
cDNA
using
a
6. Store the first-strand cDNA at 20 C or 80 C. 7. Design primer sets with Beacon Designer™ software as follows. Order and install the Beacon Designer™ software. Open the Beacon Designer™ software. Next, in order, click the File, New, and Sequence. In the input sequence window, enter the specific or whole sequence of genes or proteins of interest and click the Add button. In order, click the Assays and SYBR® Green Design into the primer window. Click the Primer Search button and then click the Search button to start the automatic search software. In the search parameters, set the corresponding parameters. In general, the parameter selection default can be employed. Click OK, and the default search results automatically jump out of the window. Generally, the primers shown in the primer window are satisfied. 8. Open the StepOnePlus™ software on the desktop of the computer that is connected to the ABI StepOnePlus™ system. In the Login dialog box, create a username and click OK. From the Home screen, click the Set Up button to open the Design Wizard. Set up the experiment and PCR program on the StepOnePlus™ Real-Time PCR System. Employ the following PCR program: holding stage, 2 min at 95 C, followed by the cycling stage, 15 s at 95 C, and 30 s at 60 C for 40 cycles.
180
Weilin Zhang
9. Add appropriate amount of the first-strand cDNA and primers to the Power SYBR® Green Master Mix according to the manufacturer’s instructions as follows. The 20-μL PCR volume contains 2 μL of first-strand cDNA, 10 μM of forward and reverse primers, 10 μL of SYBR® Green Master Mix, and 20 μL of DEPC-treated water. 10. Analyze the real-time PCR result using StepOne Software version 2.1. Utilize reference genes, for example, Ld_arf1 and Ld_rp4 for Leptinotarsa decemlineata [6], Sg_rp49 and Sg_gapdh for Schistocerca gregaria [7], rps11 and rps15 for N. lugens [8], as internal controls to standardize the results (see Note 3). 11. Examine the PCR specificity by melting curve analysis. Alternatively, the PCR specificity can be examined by ethidium bromide-stained 1% agarose gel under ultraviolet light with a gel imaging system using 5 μL from each reaction. 3.2 Synthesis of dsRNA
1. Use Primer Premier 6.25 software to design PCR primers that will amplify sequence-specific fragments corresponding to the gene of interest. 2. Use the appropriate primers in a 20-μL PCR volume to amplify the CDS sequence corresponding to the gene of interest (see Note 4) using a PCR thermal cycler. The 20-μL PCR volume contains 20 ng of first-strand cDNA, 50 pM of forward and reverse primers, 100 μM of dNTPs, 2 μL 10PCR buffer and 1 unit of Pfu Polymerase. The PCR conditions are as follows: 5 min at 94 C, 30 s at 94 C, 30 s at 60 C and 40 s at 72 C for 34 cycles followed by final extension at 72 C for 7 min. 3. For synthesis of the GFP dsRNA as a negative control, access the NCBI home page at www.ncbi.nlm.nih.gov, select “Nucleotide” from the pull-down menu in the database search bar, enter the accession number U76561 of the cDNA sequence of GFP for the query, and download the FASTA formatted gene sequence of the GFP gene and design primers. Use a vector containing the GFP gene as the template in a 20-μL PCR volume to amplify the CDS sequence corresponding to the GFP gene. 4. After PCR, add 3.3 μL of 6 loading dye to each PCR. Analyze 5 μL of the PCR products by electrophoresis on an ethidium bromide–stained 1% agarose gel. Visualize the agarose gel under ultraviolet light with a gel imaging system. If a robust band of the appropriate size is not apparent on the gel, re-amplify the reaction using a second PCR. 5. Purify the PCR product using a High Pure PCR Product Purification Kit.
Validation of RNAi Target Genes for Pest Control
181
6. Ligate the purified PCR product into the pGEM-T Easy vector and sequence it for verification. Next, transform the recombinant plasmid into ultracompetent E. coli DH5α cells. 7. Use plates containing 50 μg/mL ampicillin for positive colony selection. 8. Pick a positive colony off the plate using a sterile toothpick and culture the colony harboring recombinant plasmid at 37 C in LB liquid medium with 50 μg/mL ampicillin in a shaker at 200 rpm for 12 h. 9. Extract the plasmid using a PureLink HiPure plasmid extract Kit. 10. Quantify the extracted microspectrophotometer.
plasmid
using
a
11. Verify the PCR product by sequencing using the M13 forward primer and M13 reverse primer. 12. Use the recombinant plasmid as template to generate PCR products. Add the T7 RNA polymerase promoter sequence (50 -TAATACGACTCACTATAGGGAGA-30 ) upstream of the PCR products to express the gene of interest under the control of this promoter. In other words, the forward primer includes the T7 RNA polymerase promoter sequence (50 - TAATAC GACTCACTATAGGGAGA -30 ) at the 50 end followed by 18-25-bp gene-specific sequences of the gene of interest or GFP gene, and the reverse primer includes the T7 RNA polymerase promoter sequence (50 -TAATACGACTCACTATAGG GAGA -30 ) at the 50 end followed by 18-25-bp gene-specific sequences of the gene of interest or the GFP gene. 13. Use these primers in a 20-μL PCR volume to amplify the CDS sequence corresponding to the gene of interest or the GFP gene using a PCR thermal cycler. 14. Purify the PCR product using a High Pure PCR Product Purification Kit. 15. Quantify the purified PCR product using a microspectrophotometer. Adjust the concentration of the purified PCR product to 0.5 μg/μL using 1 TE buffer. 16. Perform in vitro transcription of dsRNA using the MEGAscript T7 Transcription Kit according to the manufacturer’s instructions as follows. Use a 20-μL reaction volume to perform in vitro transcription of dsRNA. In a 0.5-mL centrifuge tube on ice, add 2 μL of the ATP solution, CTP solution, GTP solution and UTP solution. Mix and centrifuge briefly. Then, add 0.1–0.2 μg of the purified PCR product and 2 μL of the Enzyme Mix. Add nuclease-free water to a volume of 18 μL. Mix and centrifuge shortly. Add 2 μL of 10 Reaction Buffer. Mix and centrifuge shortly. Incubate at 37 C for 2–4 h.
182
Weilin Zhang
17. Purify the dsRNA using the MEGAclear™ Kit according to the manufacturer’s instructions. 18. Quantify the dsRNA products using a microspectrophotometer and ethidium bromide-stained 1% agarose gel electrophoresis. 19. Store the dsRNA products at 80 C. 3.3 Increasing the Stability and Functionality of dsRNA (See Note 5)
1. Add 1 mL of 0.05% (w/v) 30 kDa polyacrylic acid (PAA) solution to 22.5 mL of 0.1 M calcium nitrate solution. 2. Stir the solution at moderate speed overnight at 40 C to produce a calcium nitrate-PAA solution. 3. Under continuous stirring, perform dropwise addition of 25 mL of ammonium phosphate solution (0.06 M, pH ¼ 12) to the calcium nitrate-PAA solution. Continue the reaction for 1 h. 4. Ultrasonicate the resulting slurry at 100% amplitude for 45 min using a cup horn sonicator. Keep the resulting suspension overnight. 5. Dialyze the suspension against diH2O using a 50-kDa dialysis membrane. 6. Change the diH2O daily until the pH of the diH2O is stabilized (3 days). 7. Transfer the suspension to a sealed Teflon bomb and heat the transferred suspension for 2 days at 100 C to produce PAA-coated hydroxyapatite nanoparticles (HA-NPs). 8. Under gentle vortexing, add 0.8 mL of 5 mg/mL poly-Larginine (PLR10) to 4 mL of diH2O in a 15-mL centrifuge tube. 9. Quickly add 1 mL of 500 mg/L PAA-HA NP solution to the PLR10 solution, and immediately ultracentrifuge at 149,632 g for 10 min two times to synthesize PLR10PAA-HA NPs. 10. Take appropriate amounts of PLR10-PAA-HA NPs and dsRNA with a molar ratio of 10:1 (PLR10-PAA-HA NPs/dsRNA ¼ 10:1). 11. Add dsRNA solution in a dropwise manner to PLR10-PAAHA NPs. 12. Gently vortex at 40 rpm at room temperature for 1 h. 13. Centrifuge at 16,813 g for 10 min and discard the supernatant.
3.4
dsRNA Delivery
1. Place a glass capillary (outer diameter: 1.0 mm, inner diameter: 0.75 mm) in a micropipette puller with appropriate settings (e.g., heat 750, pull 150, velocity 150, time 90). Start the
Validation of RNAi Target Genes for Pest Control
183
micropipette puller and subsequently pull the glass capillary into a micro-injection needle with a thin tip. 2. Use fine tweezers to break off the tip of the pulled needle, causing the tip to open with an approximate diameter for injection. 3. Take a small amount of food dye and mix the food dye with the encapsulated dsRNA using nanoparticles. Pipet 5 μL of dsRNA with food dye into the glass capillary tube and fix the glass capillary tube on the microinjector. 4. Anesthetize insects with CO2 or place the insects on ice until they cannot move prior to injection. 5. Place the insect abdomen up on a precooled rubber table and fix the insects on the rubber table, for example, by gluing the wings or legs using double-sided tape. In general, select low-instar larvae or pupae to inject dsRNA. Because females can produce offspring, the egg production and egg hatching rate can be statistically analyzed; therefore, if the pests can be divided into males and females by obvious characteristics, such as the posterior tips of the genitalia of the red flour beetle (Tribolium), female pupae or low-instar larvae can be selected to inject dsRNA. 6. Place the rubber table with the fixed insects under a stereomicroscope. 7. Re-adjust the microinjector to orient the needle at an angle of 60 . 8. Move the rubber table slowly and bring the needle tip and the expected injection point into the same focal plane under a stereomicroscope. 9. Insert the needle just far enough to penetrate the expected injection point of the insect. Usually, the expected injection point of insects is the soft part of the abdomen. If the needle remains unbroken and unblocked, it is good to inject as much as possible (see Note 6). 10. After injecting an approximate amount of dsRNA into the insects, place the insects in a covered moist chamber at 18–22 C until the insects are revived. 11. Rear the revived insects on artificial diets or plant seedlings in a covered moist chamber under approximate conditions. 12. Inject the same amount of dsRNA against the GFP gene into other insects as a negative control. 13. Generally, 1 day after the pests are injected with dsRNA, due to mechanical damage when injecting, some pests may die. Remove these dead pests from the chamber.
184
Weilin Zhang
14. Perform the behavioral analyses, including analyses of egg production and egg-hatching rates for female pests, changes in body weight, and mortality (see Note 7). 15. Perform the statistical analyses. 16. Based on the behavioral assay and statistical analyses, estimate the suitability of dsRNA in vivo in insects. If dsRNA in vivo in insects does not cause phenotypic disturbance of pests, this dsRNA is not a good target gene in RNAi-based pest control.
4
Notes 1. Some genes are expressed transiently or only in certain tissues, which is the most likely cause for negative results; therefore, it is recommended to measure the gene expression patterns in each tissue. 2. When performing these RNA-related experiments, the solutions and materials and the workplace conditions should be sterile and RNase-free. Wear gloves and a mask to reduce contamination. 3. If no or very low gene expression of the genes or proteins of interest is detected in each tissue, the genes or proteins of interest, as identified by gene or protein homology comparison, are not good candidate target genes in pests. 4. Although genomic DNA can be employed as a template for generating dsRNA, this method is less efficient, especially for large-scale work. 5. Naked dsRNA is not recommended to be directly introduced into pests. 6. If the needle is broken too large, a fresh needle should be utilized. 7. The behavioral assay analysis should be performed every day after the pests are injected with dsRNA for 2 days.
Acknowledgments This work was supported by Zhejiang Provincial Natural Science Foundation of China under Grant No. LY20C130002. References 1. Yang L, Zhang W (2016) Genetic and biochemical mechanisms of rice resistance to planthopper. Plant Cell Rep 35(8):1559–1572
2. Yang L, Li A, Zhang W (2019) Current understanding of the molecular players involved in resistance to rice planthoppers. Pest Manag Sci 75(10):2566–2574
Validation of RNAi Target Genes for Pest Control 3. Elhaj BZ, Gurusamy D, Laisney J et al (2020) A polymer-coated hydroxyapatite nanocarrier for double-stranded RNA delivery. J Agric Food Chem 68(25):6811–6818 4. Yamaguchi J, Mizoguchi T, Fujiwara H (2011) siRNAs induce efficient RNAi response in Bombyx mori embryos. PLoS One 6(9):e25469 5. Thairu MW, Skidmore IH, Bansal R et al (2017) Efficacy of RNA interference knockdown using aerosolized short interfering RNAs bound to nanoparticles in three diverse aphid species. Insect Mol Biol 26(3):356–368 6. Shi XQ, Guo WC, Wan PJ et al (2013) Validation of reference genes for expression analysis by
185
quantitative real-time PCR in Leptinotarsa decemlineata (Say). BMC Res Notes 6:93 7. Van Hiel MB, Van Wielendaele P, Temmerman L et al (2009) Identification and validation of housekeeping genes in brains of the desert locust Schistocerca gregaria under different developmental conditions. BMC Mol Biol 10:56 8. Yuan M, Lu Y, Zhu X et al (2014) Selection and evaluation of potential reference genes for gene expression analysis in the brown planthopper, Nilaparvata lugens (Hemiptera: Delphacidae) using reverse-transcription quantitative PCR. PLoS One 9(1):e86503
Chapter 15 Functional Characterization of Target Genes Associated with Insecticide Resistance of the Green Peach Aphid, Myzus persicae John Fosu-Nyarko, Sadia Iqbal, Frances Brigg, and Michael G. K. Jones Abstract Identifying genes responsive to insecticide treatment is the first step towards understanding the mechanism (s) of insecticide resistance and the development of effective insecticides against economic insect pests such as the Green peach aphid (GPA). Functional and Reverse Genetics approaches such as the RNA interference (RNAi) technology can be used to assess the possible involvement of genes whose expression is associated with an insecticide treatment. For GPA, this can be done by comparing the behavior and development of the insect following RNAi of a putative gene associated with insecticide treatment and exposure of the RNAi-treated insects to lethal doses of insecticides. In a case where knockdown of a gene or genes increases the susceptibility of RNAi-treated populations compared to controls, the target gene may have a direct role in the development of resistance to the insecticide or the gene may be involved in other metabolic processes that may be required for resilience against the insecticide. Key words Insecticide resistance, Double-stranded RNA, RNA interference, Green peach aphid, Myzus persicae, Aphids, Functional Genomics, Reverse Genetics, Gene silencing
1
Introduction Expression of some genes or mutations in sequences of different copies is now known to be associated with the development of insecticide resistance in some insects [1, 2]. The continuous identification of such genes in economically important insects is an important aspect of research in that it provides crucial information for modifications in the design of strategies for new insecticide development. Genes with potential roles in the development of insecticide resistance can be identified using next-generation sequencing approaches [3]. The knowledge on the function(s) of such genes and their possible role(s) in the development of insecticide resistance then need to be ascertained so the information can
Luis Marı´a Vaschetto (ed.), RNAi Strategies for Pest Management: Methods and Protocols, Methods in Molecular Biology, vol. 2360, https://doi.org/10.1007/978-1-0716-1633-8_15, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2022
187
188
John Fosu-Nyarko et al.
be applied to the development of insecticides. Such functional analyses can be undertaken with Reverse Genetics approaches such as the RNAi technology, which uses double-stranded RNA to trigger the degradation of complementary target mRNA of a gene of interest (GOI) resulting in the abolition of protein activity [4]. This chapter describes how RNAi can be used to characterize and possibly quantify the extent of a gene’s role in the development of resistance of the GPA to insecticides.
2
Materials
2.1 Maintenance of GPA Colony
1. A colony of GPA (Myzus persicae). 2. Tobacco (Nicotiana tabacum) plants to maintain GPA colony. 3. Cages (made of cloth mesh or acrylic material) to keep aphid colony. 4. Temperature-controlled growth room at 23–24 C with a 16:8-h light–dark cycle.
2.2 Synthesis of cDNA for Amplification of GOI and Reference Genes 2.2.1 Total RNA Extraction
1. Aphid colony for RNA extraction. 2. Nuclease-free microcentrifuge tubes (1.5 mL, 0.6 mL). 3. 3 mm stainless steel beads (Qiagen Pty. Ltd) for lysing tissues. 4. TissueLyser (Qiagen Pty. Ltd) for lysing tissues. 5. Liquid Nitrogen for snap-freezing aphid samples before storage. 6. PicoPure RNA Isolation kit (Thermo Fisher Scientific): Extraction Buffer, Conditioning Buffer, Wash Buffer 1, Wash Buffer 2, Elution Buffer, RNA purification columns with collection tubes, Microcentrifuge tubes. 7. Heat block. 8. Microcentrifuge. 9. 70% ethanol 10. RNase-Free DNase set (Qiagen Pty Ltd): DNase I, Buffer RDD. 11. A set of pipettes and aerosol barrier tips. 12. Storage freezer (80 C and 20 C). 13. Nuclease-free water. 14. Spectrophotometer Scientific).
(NanoDrop
One,
Thermo
Fisher
Functional Characterization of Target Genes Associated with Insecticide. . . 2.2.2 Generation of cDNA
189
1. Ice to set up reactions. 2. DNA-free RNA isolated from GPA. 3. High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems): 10 RT Buffer, 10 RT Random Primers, 25 dNTP mix, 50 U/μL MultiScribe Reverse Transcriptase. 4. Freezer (at 20 C). 5. Nuclease-free microcentrifuge tubes (0.2 mL). 6. A set of pipettes and aerosol barrier tips. 7. Thermocycler.
2.3 Preparation of DNA Templates for the Synthesis of Long dsRNA and siRNAs 2.3.1 Generation of DNA Templates for Synthesis of Long dsRNA
1. Ice to set up reactions. 2. Nuclease-free water. 3. Thermocycler. 4. Laboratory Concentrator RVC 2–18 Cdplus (John Morris Group). 5. Spectrophotometer Scientific).
(NanoDrop
One,
Thermo
Fisher
6. Sterile nuclease-free microcentrifuge tubes (0.2 mL, 1.5 mL). 7. Storage freezer (20 C) to store and return reagents to immediately after use. 8. Gene-specific primers (GSP) for each GOI—to amplify gene from cDNA. 9. T7-GSP—primer with T7 promoter sequence (TAATACGACTCACTATAG) to prepare template for dsRNA synthesis. 10. GSP-Actin (GenBank Accession number EE261235) for checking cDNA quality. 11. T7-GFP—for generating GFP DNA template for synthesis of dsRNAs/siRNAs. 12. 2 Go Taq Green Master Mix (Promega Corp.). 13. Wizard® SV Gel and PCR cleanup kit (Promega Corp.): Membrane Binding Solution, Membrane Wash Solution, Wizard® SV Mini columns, Collection tubes, nuclease-free water. 14. Sterile blade. 15. Microcentrifuge. 16. Access to Primer 3 (https://primer3.ut.ee/) to design primers. 17. A set of pipettes and aerosol barrier tips. 18. Agarose. 19. 1 TAE buffer: 40 mM Tris-HCl, 20 mM acetic acid, 1 mM EDTA, pH 8.0. 20. Electrophoresis equipment (gel tray, combs, gel casting tray, and voltmeter).
190
John Fosu-Nyarko et al.
21. SYBR™ Safe DNA gel stain (Invitrogen, Thermo Fisher Scientific). 22. 100 bp DNA marker. 23. Microwave. 24. Transilluminator. 25. 100% ethanol. 2.3.2 Generation of DNA Templates for Synthesis of siRNAs
1. Ice to set up reactions. 2. Thermocycler. 3. Sterile nuclease-free microcentrifuge tubes (0.2 mL). 4. Storage freezer (20 C). 5. Modified T7 DNA oligonucleotide (T7 with 8 nt leader sequence). 6. Two 29-mer DNA oligonucleotides as DNA template for synthesis of each siRNA. 7. TE buffer: 10 mM Tris-HCl pH 8.0, 1 mM EDTA. 8. 10 hybridization buffer: 100 mM Tris-HCl (pH 7.5–8.0), 500 mM NaCl, 10 mM EDTA. 9. Water bath. 10. DNA Polymerase I, Large (Klenow) Fragment (New England Biolabs): 5 units/μL DNA Polymerase I, Large (Klenow) Fragment, 10 NEBuffer 2. 11. Microcentrifuge. 12. A set of pipettes and aerosol barrier tips. 13. Nuclease-free water.
2.4 Synthesis and Purification of Long dsRNA
1. A set of pipettes. 2. Sterile nuclease-free microcentrifuge tubes (0.2 mL). 3. HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs): 10 T7 Reaction Buffer, 100 mM CTP, 100 mM UTP, 100 mM ATP, 100 mM GTP, T7 RNA Polymerase Mix, FLuc Control Template. 4. Microcentrifuge. 5. Thermocycler. 6. RNase-Free DNase set (Qiagen Pty Ltd): DNase I, Buffer RDD. 7. Nuclease-free water. 8. Storage freezer (20 C). 9. Monarch® RNA Cleanup Kit (New England Biolabs): RNA Cleanup Binding Buffer, ethanol ( 95%), nuclease-free
Functional Characterization of Target Genes Associated with Insecticide. . .
191
water, spin columns, collection tubes, RNA Cleanup Wash Buffer. 2.5 Synthesis and Purification of siRNAs
1. A set of pipettes and aerosol barrier tips. 2. Sterile nuclease-free microcentrifuge tubes (0.2 mL, 1.5 mL). 3. HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs): 10 T7 Reaction Buffer, 100 mM CTP, 100 mM UTP, 100 mM ATP, 100 mM GTP, T7 RNA Polymerase Mix, FLuc Control Template. 4. Microcentrifuge. 5. Thermocycler. 6. Turbo DNA-free DNase kit (Life Technologies): 10 TURBO DNase Buffer, TURBO DNase, DNase Inactivation Reagent, nuclease-free water. 7. Shortcut® RNase III (New England Biolabs): 2 units/μL Shortcut® RNase III, 10 Shortcut Reaction Buffer, 10 EDTA, 200 mM MnCl2, 10 mg/mL RNase-free Glycogen. 8. RNase T1 digestion (Thermo Fisher Scientific): RNase T1, 100 mM Tris-HCl (pH 7.5), 100 mM EDTA. 9. TE buffer: 10 mM Tris-HCl pH 8.0, 1 mM EDTA. 10. Spectrophotometer Scientific).
(NanoDrop
One,
Thermo
Fisher
11. Monarch® RNA Cleanup Kit (New England Biolabs): RNA Cleanup Binding Buffer, ethanol ( 95%), nuclease-free water, spin columns, collection tubes, RNA Cleanup Wash Buffer. 2.5.1 Confirmation of Long dsRNA and siRNA Synthesis by Agarose Gel Electrophoresis
1. Agarose. 2. Electrophoresis equipment (gel tray, combs, gel casting tray, and voltmeter). 3. SYBR™ Safe DNA gel stain (Invitrogen, Thermo Fisher Scientific). 4. Sterile nuclease-free microcentrifuge tubes (0.2 mL). 5. Microwave. 6. 1 TBE buffer: 0.9 M Tris base, 0.9 M boric acid, 2 mM EDTA, pH 8.0. 7. Nuclease-free water. 8. 6 nondenaturing gel loading buffer: 37% glycerol, 0.025% bromophenol blue, 0.025% xylene cyanol, 20 mM Tris-HCl, pH 8.0, 5 mM EDTA. 9. dsRNA ladder (21–500 bp, New England Biolabs). 10. Transilluminator.
192
John Fosu-Nyarko et al.
2.6 In Vitro RNAi of GOIs and Assessment of RNAi Effects
1. Artificial feed: 30% sucrose mixed with 0.02% neutral red to trace uptake of feed. 2. 5 mL clear yellow cap plastic vials with yellow caps (Sarstedt). 3. Parafilm M (Pechiney Plastic Packaging). 4. Liquid Nitrogen to snap-freeze tissues/insect samples until RNA extraction. 5. Microcentrifuge. 6. Nuclease-free microcentrifuge tubes (0.2 mL, 1.5 mL). 7. Freezer (80 C) to store aphid samples until needed for RNA extraction. 8. RNaseZap (Thermo Fisher Scientific) to get rid of RNases from working bench, gloves and glassware. 9. Fine paintbrush to transfer aphids. 10. Dissecting microscope to confirm neutral red in aphid body after artificial feeding. 11. Commercial Insecticides or their active ingredients. 12. 60% sucrose: sucrose dissolved in nuclease-free water. 13. Two-week-old tobacco seedlings. 14. Clear 620 mL plastic cups and lid for growing tobacco plants for aphid reproduction assay. 15. Sharp blade to cut 2 cm 2 cm window on plastic lid to allow gas exchange. 16. 2 Go Taq Green Master Mix (Promega Corp.). 17. Agarose. 18. 1 TAE buffer: 40 mM Tris-HCl, 20 mM acetic acid, 1 mM EDTA, pH 8.0. 19. Electrophoresis equipment (gel tray, combs, gel casting tray, and voltmeter). 20. SYBR™ Safe DNA gel stain (Invitrogen, Thermo Fisher Scientific). 21. 100 bp DNA marker. 22. Microwave. 23. Transilluminator. 24. Quantitative PCR (qPCR) primers for GOI and Actin as a reference gene. 25. 2 SensiFAST™ SYBR® No-ROX Kit for qPCR (Bioline Pty Ltd). 26. Rotor gene Q Thermocycler for qPCR and software (https:// www.qiagen.com/au/resources) (Qiagen Pty. Ltd.). 27. A set of pipettes and aerosol barrier tips.
Functional Characterization of Target Genes Associated with Insecticide. . .
3
193
Methods The procedures for assessing the association of a gene of GPA to insecticide treatment involves generating and delivering long double-stranded RNA (dsRNA) or short interfering RNAs (siRNAs) to target GOIs that have been identified from genome-wide transcriptional studies in response to an insecticide. After delivery of dsRNA or siRNA triggers, the extent of gene knockdown in the GPA is determined through quantitative PCR (qPCR) and insect behavior. The treated insects are then exposed to various concentrations of insecticides to assess their level of tolerance through their behavior and biology. Increased sensitivity of the RNAi-treated GPAs to insecticide treatment compared to controls indicate the expression of the target genes is associated with insecticide treatment or that the gene may play a role in the development of insecticide resistance.
3.1 Maintenance of GPA Colony
1. Maintain GPA colony (starting with a single aphid) on potted tobacco plants. 2. Keep plants with aphids in a mesh cage or acrylic cage in a temperature controlled growth room at 23–24 C under a 16:8-h light–dark cycle. 3. Keep tobacco seedlings at different stages of growth at all times. 4. Maintain different stages of aphids on tobacco plants at all times.
3.2 Synthesis of cDNA for Amplification of GOI and Reference Genes 3.2.1 Total RNA Extraction from GPA
1. Collect live nymphs (10) and adult aphids (10) from tobacco plants and put together in a 1.5 mL centrifuge tube. These are to be used for RNA isolation using the PicoPure RNA Isolation Kit (see Note 1). 2. Add two 3 mm stainless steel beads to the tube with aphids, snap-freeze in liquid nitrogen and lyse using a TissueLyser at 20 Hz for a minute at a time, for up to 3 min. 3. Add 50μL of the Extraction Buffer, vortex for 30 s and incubate at 42 C for 30 min on a heating block. Centrifuge tube at 3000 g for 2 min and collect the supernatant into a fresh 1.5 mL tube. Avoid any solid material. 4. Precondition the RNA purification column (placed in a collection tube) by adding 250μL of Conditioning Buffer to the filter membrane, leave at room temperature for 5 min. Centrifuge the assembly in a microcentrifuge at 16,000 g for 1 min. 5. Add 50μL of 70% ethanol to the aphid homogenate and mix by pipetting. Transfer the mixture to the preconditioned purification column and centrifuge at 100 g for 2 min to bind RNA
194
John Fosu-Nyarko et al.
to the column. Centrifuge again immediately at 16,000 g for 30 s and discard flow through. 6. Pipet 100μL of Wash Buffer 1 to the purification column and centrifuge at 8000 g for 1 min to wash the column. 7. Remove DNA using the RNase-free DNase kit (see Note 2): For each RNA sample, prepare 40μL DNase I solution mix by adding 5μL of DNase I stock solution to 35μL of Buffer RDD from the RNase-free DNase kit and mix gently by inversion. Pipette the DNase I solution mix to the purification column membrane and incubate at room temperature for 15 min. 8. Add 40μL of Wash Buffer 1 to the column and centrifuge at 8000 g for 15 s. 9. Perform two washes with Wash Buffer 2 by adding 100μL each time to the purification column. For the first wash, centrifuge at 8000 g for 1 min and for the second wash at 16,000 g for 2 min. Discard flow through. 10. To remove any residual Wash Buffer, centrifuge the purification column assembly at 16,000 g for 1 min and place the purification column into a new 0.6 mL microcentrifuge tube. 11. Pipet 20μL of the Elution Buffer to the purification column and incubate at room temperature for 1 min. Centrifuge first at 1000 g for 1 min to distribute the buffer in the column and then immediately at 16,000 g for 1 min to elute the RNA. 12. Prepare a one in ten dilution with nuclease-free water for quantification and quality check. Quantify the RNA using the NanoDrop One Spectrophotometer. Proceed with RNA with A260/280 ~ 2.0 to generate cDNA or store the stock RNA at 80 C. 3.2.2 Generation of cDNA
1. Synthesize cDNA from the DNA-free total RNA isolated from the mixed stage GPA using the High-Capacity cDNA Reverse Transcription kit. Bring the 10 RT buffer, 25 dNTP mix, 10 RT Random primers from 20 C and thaw on ice. 2. Prepare 10μL solutions of RNA with nuclease free water in nuclease-free 0.2 mL tubes for each of the insecticide-treated and control aphid samples, making sure equal amounts of RNA from each treatment is used. 3. In a separate nuclease-free microfuge tube, prepare a 10μL 2 RT reaction mix for each RNA sample on ice. Each reaction should comprise 2μL of the 10 RT buffer, 0.8μL of the 25 dNTP mix, 2μL of the 10 Random primers and 4.2μL of nuclease-free water. Remove the 50 U/μL of MultiScribe Reverse Transcriptase from 20 C and add 1μL to the reaction. Mix gently but thoroughly by pipetting.
Functional Characterization of Target Genes Associated with Insecticide. . .
195
4. Add the RT reaction mix to each of the 10μL RNA solution. Gently mix thoroughly, place in a Thermocycler, and run at 25 C for 10 min, 37 C for 120 min, 85 C for 5 min and at 4 C for 10 min. Store cDNA at 20 C. 3.3 Preparation of DNA Templates for Synthesis of Long dsRNAs and siRNAs
1. Select a portion of the mRNA sequence of GOI to generate a DNA template for the synthesis of dsRNAs via in vitro transcription. The length of the dsRNAs could be between 100 bp and 750 bp long.
3.3.1 Preparation of DNA Templates for Synthesis of Long dsRNAs
2. Design primers (GSPs and T7-GSPs) for each GOI using Primer 3 [5] ensuring the melting temperatures are between 55 C and 60 C. Send primers to a commercial company for synthesis. Resuspend primers at 10 pmol/μL with nucleasefree water. Store at 20 C until ready to use. 3. Set up a 20μL PCR reaction on ice to amplify GOIs from cDNA. For each reaction, add 10μL of the 2 Go Taq Green Master Mix, 1μL of each pair of GSP for GOI, 1μL of 1:10 diluted cDNA and 7μL of nuclease-free water in a 0.2 mL nuclease-free microcentrifuge tube. Control reactions, one without cDNA the other with no primers, are recommended. Conduct PCR in a Thermocycler at 95 C for 3 min followed by 30 cycles of 95 C for 30 s, 55 or 60 C for 30 s, 72 C for 30 s, a final extension at 72 C for 10 min and a hold at 14 C. 4. Assess PCR success via agarose gel electrophoresis: prepare a 1% agarose gel in 1 TAE buffer (w/v); add agarose to buffer, heat in a microwave for about 1.5 min or until the agarose completely dissolves. Add 1μL of SYBR™ Safe DNA gel stain to 100 mL of agarose gel and pour in a gel casting tray with appropriate combs. Let the gel set for approximately 30 min at room temperature. 5. Run gel electrophoresis: set up the apparatus, load the PCR samples in wells in the agarose gel along with a 100 bp DNA marker placed in a 1 TAE buffer and run the gel at 80 V for about 1 h. View the gel in a transilluminator. 6. Obtain pure amplicons from the 1% agarose gel for Sanger Sequencing to confirm the identity of the amplicon. To do this, cut the DNA bands from the agarose gel with a clean, sterile blade and clean up the DNA using the Wizard® SV Gel and PCR cleanup kit as follows: add 100μL of Membrane Binding Solution per 100 mg of gel slice containing the DNA template, heat at 55 C until the gel is completely melted, transfer solution onto the Wizard® SV Mini column placed in a Collection tube and centrifuge at 16,000 g for 1 min. Discard flow-through, wash by adding 700μL of Membrane Wash Solution (ethanol added) to the column, centrifuge at 16,000 g for 1 min and discard flow through. Repeat wash
196
John Fosu-Nyarko et al.
with 500μL of the Membrane Wash Solution and elute DNA with 30μL of nuclease-free water. To obtain higher concentration at the end, combine gel slices from replicate PCRs and process through one column (see Note 3). Quantify the DNA with the NanoDrop One Spectrophotometer. 7. Obtain the sequence of amplicon for a GOI through Sanger Sequencing from a commercial company or a service provider. 8. For each GOI successfully amplified, follow steps 3–6 to generate a new DNA template with T7 sequences at the 50 and 30 ends using the T7-GSP primers pairs and 20–30 ng of amplicons of GOI as a template in a PCR. The T7-appended, cleaned and quantified amplicons should be stored at 20 C until required for in vitro transcription (see Note 4). 9. Prepare appropriate concentrations of the DNA template in step 8 for in vitro transcription: concentrations of 1μg/μL is desirable. If eluted DNA is not up to 1μg/μL, concentrate using the Laboratory Concentrator or repeat PCRs to obtain more template. 3.3.2 Preparation of DNA Templates for Synthesis of siRNAs
1. To generate DNA template for in vitro siRNA synthesis, select up to five 21 nucleotide sequence regions for each target GOI that begin with the dinucleotide AA. These sequences will be used as templates to generate siRNAs. 2. For each siRNA template, design two 29-mer DNA oligonucleotides (for the sense and antisense sequence of siRNAs); 21 nt encoding the siRNA and a leader 8 nt (CCTGTCTC) which can increase transcription efficiency and can be removed from the synthesized dsRNA. For example, for a target mRNA 50 AAUGGACUGCUGCAUGAAACU 30 , use the same sequence of the mRNA as the Antisense DNA oligonucleotide template except the “U” should be replaced with “T” and append the leader sequence. This template will generate siRNA complementary to the target mRNA, that is 50 AATG GACTGCTGCATGAAACTCCTGTCTC 30 . Reverse complement the sequence to obtain the Sense DNA oligonucleotide, which will generate the antisense siRNA. 3. Modify the oligonucleotide as follows: (1). Add “AA” to the 50 end of the oligonucleotide and remove the 30 terminal “UU” before adding the leader sequence. These modifications will not affect the efficiency of gene knockdown because the sense siRNA does not have a function in RNAi. For the mRNA sequence used as an example above, the sense DNA oligonucleotide will be 50 AAAGTTTCATGCAGCAGTCCA CCTGTCTC 30 . 4. Together with the DNA oligonucleotides above, also order a DNA oligonucleotide of the T7 promoter sequence (referred
Functional Characterization of Target Genes Associated with Insecticide. . .
197
to as modified T7 primer from hereon) with the complement of the leader sequence as 50 TAATACGACTCACTATAGGGGA GACAGG 30 . For the GSP DNA oligonucleotide, 40 nM scale of synthesis is enough for further work. Standard desalting offered by most synthesis companies ensures the DNA oligonucleotides are of sufficient quality. 5. To convert the sense and antisense DNA template oligonucleotides to dsDNA with a T7 promoter sequence at the 50 end, hybridize each of the oligonucleotides to the modified T7 primer separately: Using the specifications supplied by the manufacturer, make 20μL of 100μM dilutions of the oligonucleotides from a 200μM or higher stock using nuclease-free water or TE buffer. 6. Hybridize the oligonucleotides by adding the following in a 0.2 mL microcentrifuge tube; 2μL of the sense or antisense DNA oligonucleotide, 2μL of the modified T7 primer, 2μL of 10 DNA hybridization buffer and water to make it up to 20μL. Close the lid, heat the mixture to 95 C for 5 min in a water bath and then allow to cool slowly to room temperature ( 0.3 kb), add nuclease-free water, 1 T7 Reaction Buffer, ATP, GTP, UTP and CTP each to a final concentration of 10 mM, 1μg template DNA, and 1000 units of T7 RNA Polymerase Mix. Mix the reagents thoroughly, quick spin in a microcentrifuge and incubate at 37 C for 2 h in a Thermocycler. For transcripts