Ribozymes: Methods and Protocols [1st ed.] 9781071607152, 9781071607169

Citation preview

Methods in Molecular Biology 2167

Robert J. Scarborough Anne Gatignol Editors

Ribozymes Methods and Protocols

METHODS

IN

MOLECULAR BIOLOGY

Series Editor John M. Walker School of Life and Medical Sciences University of Hertfordshire Hatfield, Hertfordshire, UK

For further volumes: http://www.springer.com/series/7651

For over 35 years, biological scientists have come to rely on the research protocols and methodologies in the critically acclaimed Methods in Molecular Biology series. The series was the first to introduce the step-by-step protocols approach that has become the standard in all biomedical protocol publishing. Each protocol is provided in readily-reproducible step-bystep fashion, opening with an introductory overview, a list of the materials and reagents needed to complete the experiment, and followed by a detailed procedure that is supported with a helpful notes section offering tips and tricks of the trade as well as troubleshooting advice. These hallmark features were introduced by series editor Dr. John Walker and constitute the key ingredient in each and every volume of the Methods in Molecular Biology series. Tested and trusted, comprehensive and reliable, all protocols from the series are indexed in PubMed.

Ribozymes Methods and Protocols

Edited by

Robert J. Scarborough and Anne Gatignol Department of Microbiology and Immunology, Lady Davis Institute for Medical Research, Montréal, QC, Canada

Editors Robert J. Scarborough Department of Microbiology and Immunology Lady Davis Institute for Medical Research Montre´al, QC, Canada

Anne Gatignol Department of Microbiology and Immunology Lady Davis Institute for Medical Research Montre´al, QC, Canada

ISSN 1064-3745 ISSN 1940-6029 (electronic) Methods in Molecular Biology ISBN 978-1-0716-0715-2 ISBN 978-1-0716-0716-9 (eBook) https://doi.org/10.1007/978-1-0716-0716-9 © Springer Science+Business Media, LLC, part of Springer Nature 2021 All rights are reserved by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. This Humana imprint is published by the registered company Springer Science+Business Media, LLC, part of Springer Nature. The registered company address is: 1 New York Plaza, New York, NY 10004, U.S.A.

Preface Once thought to be merely the messenger between DNA codes and their protein products, discoveries of functional RNAs have been changing the way we understand biology. Ribozymes are RNAs with catalytic activity. Since their discovery in the early 1980s, a lot of studies have been completed, not only to understand how diverse ribozymes function in biological processes but also how they can be used as research tools or therapeutics. The study of ribozymes has required the development of novel biological, biochemical, and computational methods that have contributed major advances to the study of RNA in general. Creative techniques have also been developed to utilize ribozymes to study or alter the function of other RNAs. This volume begins with a series of protocols designed to study the function and/or the structure of diverse ribozymes. The next set of protocols include different techniques to identify and characterize new ribozymes, both those that are naturally occurring and those that are engineered in the laboratory. The last set of protocols include methods to use ribozymes to alter the function of CRISPR-based guide RNAs, AgoshRNAs, and aptamers or to study RNA capping and long noncoding RNAs. This volume contains methods and protocols that would be of interest to biochemists, biologists, and computational biologists. The breadth of the protocols highlights the diverse expertise that has been useful in advancing ribozyme research, and we would like to thank all the authors for their valuable contributions. We hope that this collection helps in accelerating ribozyme research and inspires others to develop new methods to study ribozyme structure and function or to use ribozymes as tools for other applications. Montre´al, QC, Canada

Robert J. Scarborough Anne Gatignol

v

Contents Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

PART I

RIBOZYME FUNCTION

1 Conjugation as a Highly Sensitive Assay to Study Group II Intron Splicing In Vivo . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Fe´lix LaRoche-Johnston, Caroline Monat, and Benoit Cousineau 2 Co-transcriptional Analysis of Self-Cleaving Ribozymes and Their Ligand Dependence. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Luiz F. M. Passalacqua and Andrej Lupta´k

PART II

v ix

3

13

RIBOZYME IDENTIFICATION AND CHARACTERIZATION

3 Cloning and Detection of Genomic Retrozymes and Their circRNA Intermediates . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27 ˜a Amelia Cervera and Marcos de la Pen 4 Demonstration of a Ribozyme in Epsilon Domain of Hepatitis B Virus RNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 45 Dibyajnan Chakraborty and Sagarmoy Ghosh 5 In Vitro Selection of Varkud Satellite Ribozyme Variants that Cleave a Modified Stem-Loop Substrate . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 61 Pierre Dagenais and Pascale Legault 6 Characterization and Optimization of a Deoxyribozyme with a Short Left Binding Arm . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 79 Yueyao Wang and Hanyang Yu 7 Computer-Aided Design of Active Pseudoknotted Hammerhead Ribozymes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 91 Sabrine Najeh, Kasra Zandi, Samia Djerroud, Nawwaf Kharma, and Jonathan Perreault 8 Inverse RNA Folding Workflow to Design and Test Ribozymes that Include Pseudoknots . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 113 Mohammad Kayedkhordeh, Ryota Yamagami, Philip C. Bevilacqua, and David H. Mathews

PART III

RIBOZYME STRUCTURE

9 Using an L7Ae-Tethered, Hydroxyl Radical-Mediated Footprinting Strategy to Identify and Validate Kink-Turns in RNAs . . . . . . . . . . . . . . . . . . . . . . . 147 Stella M. Lai and Venkat Gopalan 10 SHAPE Profiling to Probe Group II Intron Conformational Dynamics During Splicing. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 171 Timothy Wiryaman and Navtej Toor

vii

viii

11

Contents

Dynamics-Function Analysis in Catalytic RNA Using NMR Spin Relaxation and Conformationally Restricted Nucleotides . . . . . . . . . . . . . . . . . . . . 183 ˜ o, Charles G. Hoogstraten, Montserrat Terrazas, Anna Avin Neil A. White, and Minako Sumita

PART IV 12

13

14

Design and Evaluation of Guide RNA Transcripts with a 30 -Terminal HDV Ribozyme to Enhance CRISPR-Based Gene Inactivation. . . . . . . . . . . . . . . 205 Ben Berkhout, Zongliang Gao, and Elena Herrera-Carrillo Design and Evaluation of AgoshRNAs with 30 -Terminal HDV Ribozymes to Enhance the Silencing Activity. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 225 Ben Berkhout and Elena Herrera-Carrillo Cloning and Detection of Aptamer-Ribozyme Conjugations . . . . . . . . . . . . . . . . . 253 Ryan P. Goguen, Anne Gatignol, and Robert J. Scarborough

PART V 15

16

RIBOZYME CONJUGATIONS

RIBOZYME AS TOOLS TO STUDY OTHER RNAS

Use of a Lariat Capping Ribozyme to Study Cap Function In Vivo . . . . . . . . . . . 271 Max Pietschmann, Gregor Tempel, Maral Halladjian, Nicolai Krogh, and Henrik Nielsen Long Non-coding RNA Depletion Using Self-Cleaving Ribozymes . . . . . . . . . . . 287 ¨ hler Alex C. Tuck and Marc Bu

Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

303

Contributors ANNA AVIN˜O´ • Institute for Advanced Chemistry of Catalonia (IQAC), Spanish Council for Scientific Research (CSIC), Barcelona, Spain; Networking Center on Bioengineering, Biomaterials and Nanomedicine (CIBER-BBN), Barcelona, Spain BEN BERKHOUT • Laboratory of Experimental Virology, Department of Medical Microbiology, Amsterdam UMC, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands PHILIP C. BEVILACQUA • Department of Chemistry, Pennsylvania State University, University Park, PA, USA; Department of Biochemistry and Molecular Biology, Pennsylvania State University, University Park, PA, USA MARC BU¨HLER • Friedrich Miescher Institute for Biomedical Research, Basel, Switzerland; University of Basel, Basel, Switzerland AMELIA CERVERA • Instituto de Biologı´a Molecular y Celular de Plantas (IBMCP), Consejo Superior de Investigaciones Cientı´ficas-Universitat Polite`cnica de Vale`ncia (CSIS-UPV), Valencia, Spain DIBYAJNAN CHAKRABORTY • Dr. KPC Life Sciences Pvt. Ltd., Kolkata, West Bengal, India BENOIT COUSINEAU • Department of Microbiology and Immunology, McGill University, Montreal, QC, Canada PIERRE DAGENAIS • De´partement de Biochimie et Me´decine Mole´culaire, Universite´ de Montre´al, Montreal, QC, Canada MARCOS DE LA PEN˜A • Instituto de Biologı´a Molecular y Celular de Plantas (IBMCP), Consejo Superior de Investigaciones Cientı´ficas-Universitat Polite`cnica de Vale`ncia (CSIS-UPV), Valencia, Spain SAMIA DJERROUD • Centre Armand-Frappier Sante´ Biotechnologie, Institut National de la Recherche Scientifique (INRS), Laval, QC, Canada ZONGLIANG GAO • Laboratory of Experimental Virology, Department of Medical Microbiology, Amsterdam UMC, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands ANNE GATIGNOL • Lady Davis Institute for Medical Research, Montre´al, QC, Canada; Department of Microbiology and Immunology, McGill University, Montre´al, QC, Canada; Department of Medicine, Division of Experimental Medicine, McGill University, Montre´al, QC, Canada SAGARMOY GHOSH • Department of Microbiology, University of Calcutta, University College of Science and Technology, Kolkata, India RYAN P. GOGUEN • Lady Davis Institute for Medical Research, Montre´al, QC, Canada; Department of Microbiology and Immunology, McGill University, Montre´al, QC, Canada VENKAT GOPALAN • Department of Chemistry and Biochemistry and Center for RNA Biology, The Ohio State University, Columbus, OH, USA; Center for RNA Biology, The Ohio State University, Columbus, OH, USA MARAL HALLADJIAN • Department of Cellular and Molecular Medicine, University of Copenhagen, Copenhagen, Denmark ELENA HERRERA-CARRILLO • Laboratory of Experimental Virology, Department of Medical Microbiology, Amsterdam UMC, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands

ix

x

Contributors

CHARLES G. HOOGSTRATEN • Department of Biochemistry and Molecular Biology, Michigan State University, East Lansing, MI, USA MOHAMMAD KAYEDKHORDEH • Department of Biochemistry and Biophysics and Center for RNA Biology, University of Rochester Medical Center, Rochester, NY, USA NAWWAF KHARMA • Electrical and Computer Engineering Department, Concordia University, Montreal, QC, Canada NICOLAI KROGH • Department of Cellular and Molecular Medicine, University of Copenhagen, Copenhagen, Denmark STELLA M. LAI • Department of Chemistry and Biochemistry and Center for RNA Biology, The Ohio State University, Columbus, OH, USA FE´LIX LAROCHE-JOHNSTON • Department of Microbiology and Immunology, McGill University, Montreal, QC, Canada PASCALE LEGAULT • De´partement de Biochimie et Me´decine Mole´culaire, Universite´ de Montre´ al, Montreal, QC, Canada ANDREJ LUPTA´K • Department of Pharmaceutical Sciences, University of California, Irvine, CA, USA; Department of Molecular Biology and Biochemistry, University of California, Irvine, CA, USA; Department of Chemistry, University of California, Irvine, CA, USA DAVID H. MATHEWS • Department of Biochemistry and Biophysics and Center for RNA Biology, University of Rochester Medical Center, Rochester, NY, USA; Center for RNA Molecular Biology, Pennsylvania State University, University Park, PA, USA; Department of Biochemistry and Biophysics, University of Rochester Medical Center, Rochester, NY, USA; Department of Biostatistics and Computational Biology, University of Rochester Medical Center, Rochester, NY, USA CAROLINE MONAT • Department of Microbiology and Immunology, McGill University, Montreal, QC, Canada SABRINE NAJEH • Centre Armand-Frappier Sante´ Biotechnologie, Institut National de la Recherche Scientifique (INRS), Laval, QC, Canada HENRIK NIELSEN • Department of Cellular and Molecular Medicine, University of Copenhagen, Copenhagen N, Denmark LUIZ F. M. PASSALACQUA • Department of Pharmaceutical Sciences, University of California, Irvine, CA, USA JONATHAN PERREAULT • Centre Armand-Frappier Sante´ Biotechnologie, Institut National de la Recherche Scientifique (INRS), Laval, QC, Canada MAX PIETSCHMANN • Department of Cellular and Molecular Medicine, University of Copenhagen, Copenhagen N, Denmark ROBERT J. SCARBOROUGH • Lady Davis Institute for Medical Research, Montre´al, QC, Canada; Department of Microbiology and Immunology, McGill University, Montre´al, QC, Canada MINAKO SUMITA • Department of Biochemistry and Molecular Biology, Michigan State University, East Lansing, MI, USA; Department of Chemistry, Southern Illinois University Edwardsville, Edwardsville, IL, USA GREGOR TEMPEL • Department of Cellular and Molecular Medicine, University of Copenhagen, Copenhagen N, Denmark MONTSERRAT TERRAZAS • Institute for Advanced Chemistry of Catalonia (IQAC), Spanish Council for Scientific Research (CSIC), Barcelona, Spain; Joint IRB-BSC Program in Computational Biology, The Barcelona Institute of Science and Technology (BIST), Barcelona, Spain

Contributors

xi

NAVTEJ TOOR • Department of Chemistry and Biochemistry, University of California, San Diego, La Jolla, CA, USA ALEX C. TUCK • Friedrich Miescher Institute for Biomedical Research, Basel, Switzerland YUEYAO WANG • Department of Biomedical Engineering, College of Engineering and Applied Sciences, Nanjing University, Nanjing, Jiangsu, China NEIL A. WHITE • Department of Biochemistry and Molecular Biology, Michigan State University, East Lansing, MI, USA; Molecular, Cellular, and Developmental Biology, Yale University, New Haven, CT, USA TIMOTHY WIRYAMAN • Department of Chemistry and Biochemistry, University of California, San Diego, La Jolla, CA, USA RYOTA YAMAGAMI • Department of Chemistry, Pennsylvania State University, University Park, PA, USA; Center for RNA Molecular Biology, Pennsylvania State University, University Park, PA, USA HANYANG YU • Department of Biomedical Engineering, College of Engineering and Applied Sciences, Nanjing University, Nanjing, Jiangsu, China KASRA ZANDI • Software Engineering and Computer Science Department, Concordia University, Montreal, QC, Canada

Part I Ribozyme Function

Chapter 1 Conjugation as a Highly Sensitive Assay to Study Group II Intron Splicing In Vivo Fe´lix LaRoche-Johnston, Caroline Monat, and Benoit Cousineau Abstract Group II introns are noncoding sequences that interrupt genes, and that must be removed or spliced-out at the RNA level during gene expression. Following the transcription of interrupted genes, group II introns self-splice while concurrently ligating their flanking exons to generate mature mRNAs ready for translation. Ll.LtrB, the model group II intron from the gram-positive bacterium Lactococcus lactis, interrupts the gene coding for a relaxase enzyme that initiates the transfer of mobile elements by conjugation. This functional link between group II intron splicing and conjugative transfer enabled us to engineer highly sensitive splicing assays using the native biological context of Ll.LtrB. The splicing efficiency/conjugation assay was developed to determine the splicing competence of various Ll.LtrB mutants, whereas the splicing selection/conjugation assay was established to isolate splicing-proficient variants from a randomly generated bank of mutated introns. Key words Group II intron, Ll.LtrB, Splicing, trans-Splicing, Bacteria, Lactococcus lactis, Conjugation, Sex factor, Relaxase, Tn5 transposon

1

Introduction Group II introns are large autocatalytic RNAs or ribozymes that self-splice from interrupted transcripts while simultaneously ligating their flanking exons [1–3]. High accuracy and efficiency of intron splicing from intron-interrupted pre-mRNAs are thus two essential prerequisites for the proper ligation of coding exons and translation of active proteins. Over the years, we first developed a simple, quantitative, and highly sensitive (108-fold) conjugation assay to monitor group II intron self-splicing efficiency in vivo (Fig. 1, splicing efficiency/conjugation assay) [4–8]. We also exploited the power of bacterial conjugation to select for splicingproficient introns from large populations of randomly generated group II intron mutants (Fig. 2, splicing selection/conjugation assay) [9, 10].

Robert J. Scarborough and Anne Gatignol (eds.), Ribozymes: Methods and Protocols, Methods in Molecular Biology, vol. 2167, https://doi.org/10.1007/978-1-0716-0716-9_1, © Springer Science+Business Media, LLC, part of Springer Nature 2021

3

4

Fe´lix LaRoche-Johnston et al.

A)

Recipient cell

Donor cell

Transconjugant cell

oriT

Sex 4

Tet

Factor

5

A

x

E1 E2 + 2

3

E1

LtrB

A E2

Sex

Tet

Factor

1

E1

A E2

Spc

NZ9800 ltrB / pDL278

LM0231

LM0231

(Tet / Spc)

(Fus)

(Fus / Tet)

B)

Lactococcus lactis donor strain NZ9800 ltrB::tet / pDL-P232-empty (5) NZ9800 ltrB::tet / pDL-P232-Ll.LtrB-WT (5)

SF conjugation efficiency (1.13 ± 0.38) X 10-9 (1.08 ± 0.21) X 10-1

Fig. 1 Splicing efficiency/conjugation assay. (a) Schematic of the Ll.LtrB group II intron splicing efficiency/ conjugation assay in L. lactis [4–8]. The donor strain of L. lactis used in this assay is NZ9800ΔltrB::tet, where the chromosomal sex factor carries a deletion of the Ll.LtrB intron and portions of its flanking exons, specifically inactivating the relaxase gene (ltrB) and leaving all the other components of the sex factor conjugation machinery intact [18]. Following transcription of the interrupted ltrB gene from a plasmid (pDL278based), under the control of the constitutive P23 promoter (step 1), the Ll.LtrB intron self-splices as a lariat from the pre-mRNA while concurrently ligating its flanking exons (E1–E2) (step 2). The mature mRNA can then be translated into the LtrB relaxase enzyme (step 3), which in turn can recognize and nick the origin of transfer (oriT) of the chromosomal sex factor (step 4) leading to its subsequent transfer to a recipient cell by conjugation (step 5) [11–13, 15]. The intron splicing efficiency from the relaxase transcript was shown to be directly proportional to sex factor conjugation efficiency [16]. (b) In the absence of relaxase, the sex factor transfer efficiency from NZ9800 (donor strain) to LM0231 (recipient strain) drops from 7.33
103 (NZ9800) [7] to 1.13
109 (NZ9800ΔltrB/pDL-P232) [5]. In a complementation system where the intron-interrupted ltrB gene was cloned in the pDL-P232 plasmid and expressed under the control of the P23 constitutive promoter (pDL-P232-Ll.LtrB-WT), the transfer of the relaxase-deficient sex factor is restored from 1.13
109 to 1.08
101 (~100,000,000-fold, 108-fold or 8 logs) [5]. Importantly, the plasmid complementation system was found to be saturated in relaxase enzyme, suggesting that the conjugation efficiency observed for the complemented sex factor underestimates the real splicing efficiency of Ll.LtrB [6]. Therefore, the conjugation efficiencies observed should be interpreted as increases from the background level rather than decreases from the saturated maximum level. Conjugation efficiencies are calculated as the ratio of transconjugant cells (LM0231/sex factor) (Fus/Tet) to donor cells (NZ9800ΔltrB/pDL278 (Tet/Spc)), for three independent assays. Ll.LtrB group II intron, black; branch point adenosine, circled A; ltrB exons flanking Ll.LtrB, E1 and E2; relaxase enzyme (LtrB), black oval; origin of conjugative transfer (oriT), open circle; spectinomycin resistance gene (Spc), black circle. Figure adapted from [7]

In both of our splicing/conjugation assays, we took advantage of the fact that the Ll.LtrB model group II intron, from the grampositive bacterium Lactococcus lactis, interrupts the ltrB relaxase gene of the chromosomal sex factor, an integrative and conjugative element (ICE) [11–13]. The LtrB relaxase enzyme is essential for both the initiation and conjugative transfer of the sex factor between L. lactis strains [6–8, 14]. The enzyme is first involved in

Ll.LtrB Splicing/Conjugation Assays

Recipient cell

Donor cell Sex

4

oriT

A 2

LtrB

Transconjugant cell

Factor

Tet

E1 E2 + 3

5

E1

A E2

x

oriT

E1

A E2

Cam

1

E1

A E2

Cam

5

NZ9800 ltrB / pLE12

LM0231

LM0231 / pLE12

(Tet / Cam)

(Fus)

(Fus / Cam)

Fig. 2 Splicing selection/conjugation assay. Schematic of the Ll.LtrB group II intron splicing selection/ conjugation assay in L. lactis [7–10]. The donor strain of L. lactis used in this assay is NZ9800ΔltrB::tet, where the chromosomal sex factor carries a deletion of the Ll.LtrB intron and portions of its flanking exons specifically inactivating the relaxase gene (ltrB) and leaving all the other components of the sex factor conjugation machinery intact [18]. Following transcription of the interrupted ltrB gene from a plasmid (pLE12based), under the control of its natural promoter (step 1), the Ll.LtrB intron self-splices as a lariat from the pre-mRNA while concurrently ligating its flanking exons (E1-E2) (step 2). The mature mRNA can then be translated into the LtrB relaxase enzyme (step 3) which in turn can recognize and nick the origin of transfer (oriT) of the pLE12 conjugative plasmid (step 4) leading to its subsequent transfer to a recipient cell by conjugation (step 5). Consequently, in this assay, only the plasmids containing a splicing-proficient copy of the intron can be transferred by conjugation and subsequently recovered from transconjugant cells [9, 10]. Ll.LtrB group II intron, black; branch point adenosine, circled A; ltrB exons flanking Ll.LtrB, E1 and E2; relaxase enzyme (LtrB), black oval; origin of conjugative transfer (oriT), open circle; spectinomycin resistance gene (Spc), black circle. Figure adapted from [7]

recognizing and nicking the origin of transfer (oriT). Following the strand-specific endonuclease cut at the oriT, LtrB associates covalently with the 50 end of the single-stranded DNA, carries it from the donor to the recipient cell through the conjugative pore and ligates both ends of the conjugative element in the transconjugant cell [15]. As a consequence, the efficient and accurate self-splicing of Ll.LtrB from the interrupted ltrB pre-mRNA transcript controls relaxase expression levels and sex factor conjugation efficiency. Moreover, it was previously shown that the transfer efficiency of a conjugative plasmid is directly proportional to the splicing efficiency of Ll.LtrB from its relaxase transcript in L. lactis [16]. We thus developed a first genetic assay to monitor Ll.LtrB splicing efficiency by measuring the conjugation rate of the chromosomal sex factor between L. lactis strains [4–8] (Fig. 1, splicing efficiency/ conjugation assay). This simple and quantitative assay is highly sensitive, allowing for the detection and the study of group II intron splicing efficiency on a very broad detection range (108fold) [5]. A similar conjugation-based assay was also designed to screen for splicing-proficient introns from a large population of group II intron mutants. In this selection assay, only the plasmids harboring splicing-proficient introns are transferred by conjugation and recovered from transconjugant cells (Fig. 2, splicing selection/ conjugation assay) [9, 10].

6

2 2.1

Fe´lix LaRoche-Johnston et al.

Materials Bacterial Growth

1. GM17 liquid medium for Lactococcus lactis strains: Add 18.625 g of M17 medium and 400 mL dH2O into a 1 L Beaker and stir with a magnetic bar until dissolved. Using a graduated cylinder, adjust the volume to 487.5 mL with dH2O, transfer into a 500 mL Pyrex bottle and autoclave. Once cooled to room temperature, add 12.5 mL of 20% glucose. 2. GM17 plates for L. lactis strains: Add 18.625 g of M17 medium and 400 mL dH2O into a 1 L Erlenmeyer flask and stir with a magnetic bar until dissolved. Using a graduated cylinder, adjust the volume to 487.5 mL with dH2O, transfer back into the original 1 L Erlenmeyer flask, add 7.5 g of Agar and autoclave. Once cooled at ~50  C, add 12.5 mL of 20% glucose, the appropriate amount of antibiotic(s) if required (see Note 1), mix well with a magnetic bar (see Note 2) and pour ~20 mL of the sterilized liquid medium in petri dishes before it solidifies. 3. Milk plates for L. lactis conjugation assays: Add 14 g of non-fat dried milk powder and 140 mL of dH2O into a 0.5 L Erlenmeyer flask and stir well with a magnetic bar. In a separate 0.5 L Erlenmeyer flask, add 2.8 g of dextrose and 4.2 g of agar to 140 mL of dH2O, then stir well with a magnetic bar. Place both flasks in an autoclavable tray, fill the tray with water until the level surpasses the contents of both flasks and autoclave. Rapidly transfer the dissolved milk into the flask containing the dextrose and agar; mix using the magnetic bar and pour ~20 mL of the sterile liquid medium in petri dishes before it solidifies (see Note 3). 4. Inoculation loop. 5. Glycerol frozen stocks of the required L. lactis strains (25% glycerol). 6. 15 mL screw-cap tubes (L. lactis, 10 mL culture). 7. 30  C incubator (no shaking) for all L. lactis cultures (liquid and plates). 8. Bench top centrifuge for 15 mL screw-cap and 17 mm
95 mm snap-cap culture tubes. 9. Magnetic stir bar and stirring plate.

2.2 L. lactis Conjugation Assay

1. 1.5 mL microcentrifuge tubes. 2. Phosphate Buffer Saline (PBS) 1
, sterile. 3. Cell spreaders (see Note 4). 4. Alcohol denatured.

Ll.LtrB Splicing/Conjugation Assays

7

5. Vortex mixer. 6. Handheld tally counter. 7. Fine-pointed permanent sharpie.

3

Methods

3.1 Growth of the Donor and Recipient Lactococcus lactis Bacterial Strains (See Note 5)

All of the following steps need to take place independently for both the donor and recipient L. lactis strains and near the flame of a Bunsen burner to avoid contaminating bacterial cultures. 1. Sterilize an inoculation loop by holding it in a Bunsen burner flame until it turns bright red. Remove it from the flame and wait for 10 s. Scratch the surface of a frozen L. lactis strain glycerol stock (25%) and streak the recovered bacteria across a GM17 plate containing the appropriate concentration of antibiotic(s) (see Note 1). Incubate the GM17 plate upside down at 30  C overnight. 2. Sterilize an inoculation loop as previously described above (see step 1), then inoculate an L. lactis isolated colony from step 1 into 10 mL of fresh sterile GM17 medium (15 mL screw-cap tube) containing the appropriate concentration of antibiotic(s) (see Note 1). Incubate the bacterial culture at 30  C without shaking overnight. 3. Vortex thoroughly the overnight culture from step 2 to properly resuspend the cells, then transfer 400 μL (if the new growth media contains a single antibiotic) or 800 μL (if the new growth media contains two antibiotics) of the saturated L. lactis overnight culture into 10 mL of fresh sterile GM17 medium (15 mL screw-cap tube) containing the appropriate concentration of antibiotic(s) (see Note 1) and incubate without shaking for 7 h at 30  C. 4. Centrifuge the log-phase bacterial culture from step 3 at room temperature for 5 min at 3270
g in a bench top centrifuge. Discard the culture supernatant by inverting the tube next to the flame of a Bunsen burner to avoid contamination, leaving the cell pellet at the bottom of the tube and a small volume of the culture supernatant to resuspend the cells (see step 1 in Subheading 3.2).

3.2 L. lactis Conjugation Assay (See Notes 6 and 7)

All of the following steps need to take place near the flame of a Bunsen burner to avoid contaminating bacterial cultures. 1. Resuspend the recipient bacterial cell pellet at the bottom of the tube (see step 4 in Subheading 3.1) by pipetting up and down the leftover media. Transfer the resuspended recipient cells into the 15 mL tube containing the donor cells (see step 4

8

Fe´lix LaRoche-Johnston et al.

in Subheading 3.1) and resuspend by pipetting up and down slowly to avoid creating bubbles. 2. Transfer the resuspended mix of donor and recipient cells onto a fresh milk plate. Spread evenly the cell mixture using a cell spreader (see Note 4), then incubate overnight at 30  C. 3. Add 1 mL of sterile PBS (1
) onto the milk plate, then recover the cells by gently rubbing the surface of the milk plate using a cell spreader (see Note 4). Slightly tilt the milk plate, bringing all the resuspended bacterial cells to one side, then use a pipet to transfer the cell mixture into a sterile microcentrifuge tube (dilution 0) (see Note 8). 4. Add 900 μL of sterile PBS (1
) to eight sterile microcentrifuge tubes (dilutions 1 to 8). 5. Perform serial dilutions on the recovered bacterial cell mix (dilution 0) by first vortexing thoroughly, then by transferring 100 μL of total bacterial cells (dilution 0) into a microcentrifuge tube containing 900 μL of sterile PBS (1
) (dilution 1). 6. Vortex dilution 1 thoroughly to resuspend the diluted bacterial cells (see Note 9), then transfer 100 μL into a microcentrifuge tube containing 900 μL of sterile PBS (1
) (dilution 2). Repeat this process until reaching the ninth tube (dilution 8). 7. Plate the serial dilutions obtained in steps 5 and 6 in triplicates on GM17 plates containing the appropriate antibiotics (see Note 1) to allow the selective growth of either the donor, recipient, or transconjugant cells from the bacterial cell mix (see Note 10). Begin by vortexing adequately the bacterial cell dilution, then pipet 50 μL and spread evenly using a cell spreader (see Notes 4 and 11). Incubate the plates for 1 (no antibiotic) or 2 overnights (one or two antibiotics) at 30  C. 8. Count the number of bacterial colonies using a handheld tally counter and a sharpie to mark off each counted colony. Repeat for all the plates showing an optimal number of isolated colonies (see Note 12) and calculate averages of isolated colonies for each triplicate. 9. Conjugation efficiency is calculated as the ratio of transconjugant cells to donor cells (Fig. 1b). The overall formula for calculating conjugation efficiency is: Number of transconjugant cells ðaverage of 3 platesÞ
10jDilution factorj Number of donor cells ðaverage of 3 platesÞ
10jDilution factorj

Ll.LtrB Splicing/Conjugation Assays

4

9

Notes 1. The final concentration of antibiotics to be used in both liquid and solid GM17 medium for selection of various L. lactis strains are as follows: pLE-based plasmids, Chloramphenicol (Cam) 10 μg/mL; pDL-based plasmids, Spectinomycin (Spc) 300 μg/mL; Tetracycline (Tet) 3 μg/mL; Fusidic acid (Fus) 25 μg/mL. 2. Leave magnetic stir bar in the Erlenmeyer flask for the entire procedure. After autoclaving, use the magnetic bar to gently stir the warm medium containing the melted agar, but not too fast to avoid the formation of bubbles. Once cooled at ~50  C, add additional components next to the flame of a Bunsen burner, put back on stir plate to allow the magnetic stir bar to gently mix all the components. After about 1 min of mixing, pour into sterile petri dishes next to the flame of a Bunsen burner. For plates containing tetracycline, place a box over poured plates to avoid contact with light. Once all plates have solidified, store them at 4  C wrapping plates containing tetracycline in aluminum foil. 3. When making milk plates, a lot of agar (4.2 g) is put into the flask with dextrose to compensate for the absence of agar in the flask containing the milk. Once the autoclave cycle is finished, the dextrose/agar solution rapidly starts solidifying and forms clumps. To avoid clumping of the dextrose/agar solution and obtain homogeneous milk plates, transfer the milk into the dextrose/agar solution next to the flame of a Bunsen burner as soon as the autoclave cycle is finished. Put back on the magnetic stir plate and mix for 1 min or until the solution becomes homogeneous. Immediately pour ~20 mL per petri dish. 4. To spread cells on petri dishes, use disposable 900 Pasteur pipets. First, hold the smaller outer opening over a Bunsen burner flame ~5 s to seal the opening and bend it. Next, hold it perpendicularly to the flame ~5 cm from the sealed opening, until the flame bends the glass, giving it a 90-degree angle. 5. The donor strain used for conjugation will differ according to the type of conjugation assay performed (see Note 6): NZ9800ΔltrB::tet containing a pDL278-based plasmid (Fig. 1, splicing efficiency/conjugation assay) or a pLE-based plasmid (Fig. 2, splicing selection/conjugation assay). 6. To assess intron splicing efficiency, when specific modifications are done to the intron (e.g., mutating a specific nucleotide, removing the catalytic domain (DV), removing the intronencoded protein, or fragmenting the intron into specific pieces [4–8]) it is useful to exploit a system where accurate and efficient splicing of the intron is linked to the conjugative

10

Fe´lix LaRoche-Johnston et al.

transfer of a trans element such as the chromosomal sex factor (Fig. 1, splicing efficiency/conjugation assay). This approach allows for a comprehensive comparison of splicing efficiency between group II intron mutants based on increases of sex factorconjugation efficiency from background levels (Fig. 1b). However, to perform a screen and select for proficient introns from a large population of random mutants (e.g., ribozymes interrupted by Tn5 insertions that generate breaks at random locations [9, 10]), it is useful to exploit a system where accurate and efficient splicing of the intron is linked in cis to its own transfer by conjugation (Fig. 2, splicing selection/conjugation assay). This assay thus enables the selection of fit variants that can self-splice at levels high enough to support conjugation, which can then be isolated from transconjugant cells. 7. When conjugation efficiencies on milk plates are low and too close to background level, we perform our conjugation assays by filter mating, which generally yields higher conjugation efficiencies [8, 17]. 8. We label each of our microcentrifuge tubes and agar plates using only the dilution factor for clarity and speed. Dilution 0 thus corresponds to undiluted cells taken directly from the milk plate. Dilution 1 corresponds to a 1:10 dilution in sterile PBS 1
. 9. To ensure that cells in each microcentrifuge tube are properly resuspended, we vortex each tube for 2–3 s just before taking an aliquot for both serial dilutions and plating. 10. To avoid wasting agar plates, we only plate dilutions in the range that will give an accurate representation of isolated bacterial colonies. To enumerate the total amount of cells (donor, recipient, and transconjugant), we plate on GM17 without antibiotics (dilutions 7 and 8). Donor cells are plated on GM17 containing either Tet/Spc (Fig. 1) or Tet/Cam (Fig. 2) (dilutions 6 and 7) while recipient cells are plated on GM17 containing Fus (dilutions 6 and 7). Transconjugant cells are plated on GM17 containing either Fus/Tet (Fig. 1) or Fus/Cam (Fig. 2) and the dilutions used greatly vary depending on the splicing efficiency of the construct (dilutions 0 to 5). 11. To avoid contamination arising from either the previous plate or the surrounding environment, we sterilize our cell spreaders before use for each plate. This is done by swirling the spreader in alcohol for 2–3 s, then passing the spreader through the flame of a Bunsen burner to burn the alcohol. For any specific conjugation assay, we use the same disposable cell spreader for GM17 plates containing the same antibiotic, but it is sterilized between each plate and is always used to plate the more diluted samples first, moving along to the more concentrated samples.

Ll.LtrB Splicing/Conjugation Assays

11

12. We use the average number of isolated colonies from the dilution factor that shows between 20 and 200 isolated colonies per plate. Conjugation efficiency is not as accurate when the number of isolated colonies is below 20 or above 200. References 1. Pyle AM (2016) Group II intron self-splicing. Annu Rev Biophys 45:183–205. https://doi. org/10.1146/annurev-biophys-062215011149 2. Lambowitz AM, Zimmerly S (2011) Group II introns: mobile ribozymes that invade DNA. Cold Spring Harb Perspect Biol 3(8): a003616. https://doi.org/10.1101/ cshperspect.a003616 3. Fedorova O, Zingler N (2007) Group II introns: structure, folding and splicing mechanism. Biol Chem 388(7):665–678. https:// doi.org/10.1515/BC.2007.090 4. Monat C, Cousineau B (2016) Circularization pathway of a bacterial group II intron. Nucleic Acids Res 44(4):1845–1853. https://doi.org/ 10.1093/nar/gkv1381 5. Quiroga C, Kronstad L, Ritlop C, Filion A, Cousineau B (2011) Contribution of basepairing interactions between group II intron fragments during trans-splicing in vivo. RNA 17(12):2212–2221. https://doi.org/10. 1261/rna.028886.111 6. Belhocine K, Mak AB, Cousineau B (2007) Trans-splicing of the Ll.LtrB group II intron in Lactococcus lactis. Nucleic Acids Res 35 (7):2257–2268. https://doi.org/10.1093/ nar/gkl1146 7. Belhocine K, Yam KK, Cousineau B (2005) Conjugative transfer of the Lactococcus lactis chromosomal sex factor promotes dissemination of the Ll.LtrB group II intron. J Bacteriol 187(3):930–939. https://doi.org/10.1128/ JB.187.3.930-939.2005 8. Belhocine K, Plante I, Cousineau B (2004) Conjugation mediates transfer of the Ll.LtrB group II intron between different bacterial species. Mol Microbiol 51(5):1459–1469. https://doi.org/10.1111/j.1365-2958.2004. 03923.x 9. Ritlop C, Monat C, Cousineau B (2012) Isolation and characterization of functional tripartite group II introns using a Tn5-based genetic

screen. PLoS One 7(8):e41589. https://doi. org/10.1371/journal.pone.0041589 10. Belhocine K, Mak AB, Cousineau B (2008) Trans-splicing versatility of the Ll.LtrB group II intron. RNA 14(9):1782–1790. https:// doi.org/10.1261/rna.1083508 11. Mills DA, McKay LL, Dunny GM (1996) Splicing of a group II intron involved in the conjugative transfer of pRS01 in lactococci. J Bacteriol 178(12):3531–3538 12. Shearman C, Godon JJ, Gasson M (1996) Splicing of a group II intron in a functional transfer gene of Lactococcus lactis. Mol Microbiol 21(1):45–53 13. Mills DA, Choi CK, Dunny GM, McKay LL (1994) Genetic analysis of regions of the Lactococcus lactis subsp. lactis plasmid pRS01 involved in conjugative transfer. Appl Environ Microbiol 60(12):4413–4420 14. Belhocine K, Mandilaras V, Yeung B, Cousineau B (2007) Conjugative transfer of the Lactococcus lactis sex factor and pRS01 plasmid to Enterococcus faecalis. FEMS Microbiol Lett 269(2):289–294. https://doi.org/10.1111/j. 1574-6968.2007.00641.x 15. Byrd DR, Matson SW (1997) Nicking by transesterification: the reaction catalysed by a relaxase. Mol Microbiol 25(6):1011–1022 16. Klein JR, Chen Y, Manias DA, Zhuo J, Zhou L, Peebles CL, Dunny GM (2004) A conjugation-based system for genetic analysis of group II intron splicing in Lactococcus lactis. J Bacteriol 186(7):1991–1998 17. Sasaki Y, Taketomo N, Sasaki T (1988) Factors affecting transfer frequency of pAM beta 1 from Streptococcus faecalis to Lactobacillus plantarum. J Bacteriol 170(12):5939–5942 18. Ichiyanagi K, Beauregard A, Lawrence S, Smith D, Cousineau B, Belfort M (2002) Retrotransposition of the Ll.LtrB group II intron proceeds predominantly via reverse splicing into DNA targets. Mol Microbiol 46 (5):1259–1272

Chapter 2 Co-transcriptional Analysis of Self-Cleaving Ribozymes and Their Ligand Dependence Luiz F. M. Passalacqua and Andrej Lupta´k Abstract Self-cleaving ribozymes are RNA molecules that catalyze a site-specific self-scission reaction. Analysis of selfcleavage is a crucial aspect of the biochemical study and understanding of these molecules. Here we describe a co-transcriptional assay that allows the analysis of self-cleaving ribozymes in different reaction conditions and in the presence of desired ligands and/or cofactors. Utilizing a standard T7 RNA polymerase in vitro transcription system under limiting Mg2+ concentration, followed by a 25-fold dilution of the reaction in desired conditions of self-cleavage (buffer, ions, ligands, pH, temperature, etc.) to halt the synthesis of new RNA molecules, allows the study of self-scission of these molecules without the need for purification or additional preparation steps, such as refolding procedures. Furthermore, because the transcripts are not denatured, this assay likely yields RNAs in conformations relevant to co-transcriptionally folded species in vivo. Key words Ribozymes, Catalytic RNA, Self-cleaving ribozymes, Co-transcriptional analysis, Cotranscriptional kinetics, In vitro transcription, Metal-ion dependence, Ligand dependence

1

Introduction Discovered over 30 years ago [1–5], self-cleaving ribozymes are catalytic RNA molecules that promote a site-specific self-scission reaction. The most common mechanism of the self-scission reaction is a general acid-base catalysis, where a transesterification involves a nucleophilic attack by a 20 -oxygen on the adjacent phosphodiester bond, producing a 20  30 cyclic phosphate and a 50 -hydroxyl product [6–9], with metal ions and metabolites employed as potential cofactors [6, 7, 10, 11]. To date, nine selfcleaving ribozyme families have been discovered in nature, comprising the hammerhead [1, 2], hairpin [3], hepatitis delta virus (HDV) [4, 12], glucosamine-6-phosphate synthase (glmS) [11], Neurospora Varkud satellite (VS) [5], twister [13], twister sister (TS), pistol, and hatchet motifs [14].

Robert J. Scarborough and Anne Gatignol (eds.), Ribozymes: Methods and Protocols, Methods in Molecular Biology, vol. 2167, https://doi.org/10.1007/978-1-0716-0716-9_2, © Springer Science+Business Media, LLC, part of Springer Nature 2021

13

14

Luiz F. M. Passalacqua and Andrej Lupta´k

Self-cleaving ribozymes are broadly distributed throughout all branches of life [13–16]. Likely involved in several roles in biology, some of the known functions include self-scission during rollingcircle replication of RNA genomes, co-transcriptional processing of retrotransposons, and metabolite-dependent gene expression regulation in bacteria [1, 2, 4, 5, 11, 17–25]. Recently, it has also been shown that metabolites may modulate the activity of self-scission of some ribozymes [26]. Genomic locations of these ribozymes suggest that they affect many other biological processes, some of which may not be directly associated with RNA scission. Other examples, including highly conserved mammalian ribozymes [27, 28], suggest that many new biological roles are yet to be discovered. The discovery and understanding of self-cleaving ribozymes and their roles depend on the biochemical characterization of these molecules. An important aspect of this characterization is the kinetics investigation of self-scission under different conditions and in the presence of metabolites, cofactors, and other potential ligands, such as protein chaperones. The most common options in the investigation of the kinetics of ribozymes are the study of pre-purified ribozymes and the co-transcriptional self-cleavage analysis. The first method typically uses denaturing PAGE to fractionate transcripts of isolate uncleaved ribozymes, precipitation, and a refolding step, although less harsh conditions such as non-denaturing chromatography and precipitation-less concentration of the purified samples have been utilized [29]. A denaturing step is best avoided as refolding of the ribozymes can lead to conformations different from the co-transcriptional folding. This may happen when the RNA loses the directional order of folding (50 to 30 ) and the co-existence of different folding states is likely to increase. For example, a comparison of the co-transcriptional folding and Mg2+-initiated refolding after precipitation of the RNase P ribozyme revealed that even though all folding processes have kinetic traps and misfold, the Mg2+-initiated refolding involves residues in different regions of the molecule, while the co-transcriptional folding allows the 50 region to fold before the 30 region, eliminating major misfold traps [30]. Furthermore, it has been shown that the co-transcriptional folding notably enhances the self-scission of the human HDV-like ribozyme CPEB3 when compared to a pre-purified sample [31], and that self-cleavage transcripts of the HDV ribozyme with an attenuator in the 30 end could not be restored efficiently by renaturation [32]. Hence, the use of the co-transcriptional self-cleavage analysis is preferred when possible. Standard co-transcriptional analysis relies on the study of the self-cleavage reaction in transcriptional buffer, while transcription occurs. This methodology is limited to the experimental conditions compatible with RNA polymerase activity. Additionally, the concurrent synthesis of new molecules of RNA has to be accounted for,

Co-Transcriptional Analysis of Self-Cleaving Ribozymes

15

adding a second kinetic element to the analysis. Herein, we provide an alternative co-transcriptional assay that allows the analysis of selfcleaving ribozymes in different reaction conditions and in the presence of desired ligands. The in vitro transcription is performed under limiting amount of Mg2+, and the reaction is followed by a 25-fold dilution in desired condition of self-cleavage (buffer, ions, ligand, pH, temperature, etc.). The limiting amount of Mg2+ reduces the self-scission reaction during the initial transcription. Control experiments showed that a 25-fold dilution efficiently prevents any new RNA synthesis; therefore, our co-transcriptional kinetic analysis does not need to account for the kinetics of transcription, contrasting with the previously described analysis of co-transcriptional cleavage by Long and Uhlenbeck [33]. This method allows study of self-scission of these RNAs without the need of purification and a second kinetic parameter. This approach is also useful to synthetic biology, as self-cleaving ribozyme can be used as platforms to the development of new molecular biology tools, particularly gene expression-regulating aptazymes [34]. The method is also applicable to the study of other types of ribozymes, such as self-splicing introns [35, 36]. For the illustration of the methodology, we present an example of the HDV-like ribozyme drz-Fprau-1. Found in the human gut bacterium Faecalibacterium prausnitzii, the ribozyme cleavage site maps 106 nucleotides upstream of the phosphoglucosamine mutase (glmM) open reading frame [15]. The enzyme glmM catalyzes the transformation of glucosamine 6-phosphate (GlcN6P) into glucosamine 1-phosphate (GlcN1P) [37]. It was shown that GlcN6P, a natural metabolite, increases the self-scission rate of the ribozyme when compared to a no metabolite control [26].

2

Materials Working with RNA requires care to avoid contamination by RNases. All solutions should be prepared using double-distilled RNase-free water (ddH2O) and analytical grade reagents. All solutions should be tested for the presence of RNases before use. Chemicals and reagents are purchased from commercial suppliers. Radioactive [α-32P] ATP should be handled and disposed with safety and according to current regulations of purchase, use, and disposal.

2.1 In Vitro Transcription

1. 10 transcription buffer: 400 mM Tris-HCl or HEPES pH 7.5, 100 mM DTT (dithiothreitol), 20 mM spermidine, 1% Triton X-100 (see Notes 1 and 2). 2. 100 mM MgCl2 stock. 3. 25 mM stocks of each rGTP, rUTP, and rCTP.

16

Luiz F. M. Passalacqua and Andrej Lupta´k

4. 2.5 mM stock of rATP. 5. [α-32P] rATP. 6. T7 RNA polymerase. 7. Purified stock of DNA template of the ribozyme to be studied with T7 promoter (see Note 3). 2.2 Self-Cleavage Assay

The cleavage buffer depends on the system to be studied and also on the experiment proposed. For the example illustrated here, a physiological-like buffer is used. 1. 2 self-cleavage buffer: 100 mM Tris-HCl or HEPES (pH 7.4), 20 mM NaCl, 280 mM KCl (see Note 4). 2. 100 mM MgCl2 stock. 3. Stocks of the metabolite(s) of interest (if applicable). 4. 2 denaturing loading buffer: 8 M urea, 20 mM EDTA (see Note 5) (ethylenediaminetetraacetic acid), 0.05% (w/v) bromophenol blue, and 0.05% (w/v) xylene cyanol.

2.3 Denaturing Polyacrylamide Gel Electrophoresis (PAGE)

1. 40% bis-acrylamide 19:1. 2. Urea. 3. 10 TBE: 890 mM Tris-borate, 890 mM boric acid, 20 mM EDTA, pH 8.3. 4. TEMED (N,N,N0 ,N0 -tetramethylethylenediamine). 5. 10% (w/v) ammonium persulfate (APS). 6. Polyacrylamide gel solution: 8 M urea, 0.5 TBE, 15% bis-acrylamide 19:1 (store away from light). 7. Diluent gel solution: 8 M urea, 0.5 TBE. 8. Set of small glass plates (16.5  22 cm) or medium glass plates (16.5  28 cm) for PAGE, 1.5- and 0.8-mm Teflon spacers, wide-toothed and narrow toothed combs to cast wells, cellulose chromatography paper, and plastic wrap. 9. Electrophoresis power supply. 10. Storage phosphor image screen.

3

Methods

3.1 In Vitro RNA Transcription Under Minimal Mg2+ Conditions

1. Prepare 100 μL in vitro transcription mix by adding: 10 μL of the 10 transcription buffer, 3.5 μL of the 100 mM MgCl2 stock, 4 μL of the 25 mM stock of each rGTP, rUTP, and rCTP, 10 μL of 2.5 mM stock of rATP, 1 μL of [α-32P] rATP, 1 unit of T7 RNA polymerase, complete volume to 90 μL with ddH2O.Note that 10% of the solution is accounted for the DNA template to be added in the next step. This mix can be saved

Co-Transcriptional Analysis of Self-Cleaving Ribozymes

17

at 20  C prior to T7 RNA polymerase addition or at 4  C after T7 RNA polymerase addition for later use. The goal of this step is to prepare an efficient transcription reaction under conditions with most of Mg2+ chelated by the rNTPs, leaving minimal Mg2+ to promote ribozyme catalysis. 2. Initiate transcription by adding 0.5 μL of the DNA template with a T7 promoter of the ribozyme construct to be studied (~0.5 pmol) into 4.5 μL of the in vitro transcription mix. 3. Incubate the reaction at 24  C (room temperature) for 10 min, to initiate transcription (see Note 6). 3.2

Kinetics Assay

1. Prepare the self-cleavage mix by adding: 50 μL of the 2 selfcleavage buffer, 5 μL of the 100 mM MgCl2 stock, and desired concentration of any metabolite(s) if applicable. Complete volume to 96 μL with ddH2O. Incubate at desired temperature of self-scission assay (see Note 7). 2. Set up a cone-bottom well-plate to aliquot time-point fractions and terminate reactions. Each well should contain 5 μL of 2 denaturing loading buffer. 3. After 10 min of the in vitro transcription, withdraw a 1 μL aliquot of the reaction mixture, and terminate its transcription and self-scission by the addition of the 2 denaturing loading buffer. This is the zero time-point, used as reference for the kinetic analysis, showing the extent of the RNA production and self-scission that occurred during the transcription period. Control experiments showed that 10 min in vitro transcription is enough time to make sufficient 32P-labeled RNA without significant self-scission catalysis. 4. Transfer the remaining 4.0 μL volume of the transcription reaction into the pre-incubated 96 μL of self-cleavage mix (25-fold dilution) and start timing the self-cleavage reaction under the new conditions. Collect aliquots of 5 μL at the desired time-points, and terminate the self-scission by depositing the aliquots into the pre-prepared cone-bottom well-plate with 5 μL of the 2 denaturing loading buffer.

3.3 Resolving the Results

Results are resolved using denaturing PAGE. 1. Prepare 50 mL of bis-acrylamide gel solution of the appropriate percentage for the RNA sample. For a 10% polyacrylamide gel solution, dilute the 15% bis-acrylamide gel stock solution with the diluent gel solution (see Note 8). 2. Wash the glass plates, 0.8 mm spacers, and small-tooth combs thoroughly with distilled water, then 70% ethanol solution. With bottom and side spacers properly placed, clip the plates together with clamps, making sure that there are no gaps between spacers in the bottom corners of the plates.

18

Luiz F. M. Passalacqua and Andrej Lupta´k

3. In a 15 mL tube, add 3 mL of the 15% bis-acrylamide gel solution. Add 20 μL of TEMED and mix. To this, add 30 μL of the 10% APS solution to initialize polymerization. Rapidly mix and pour into the gel plate assembly to create a plug at the bottom of the gel. Allow ~2 min for polymerization. 4. Once the plug is polymerized, to the 50 mL of the bis-acrylamide gel solution, add 50 μL of TEMED and mix. Next, add 500 μL of the 10% APS solution and mix to initialize polymerization. Pour into the gel plate assembly. Insert combs at desired depth and allow the gel to polymerize completely. 5. Take off clamps and carefully remove the combs and the bottom spacer. Move the assembly to an electrophoresis gel box. Add 0.5 TBE buffer to cover the top and bottom of the gel. Rinse the wells and the room left by the bottom spacer to remove air bubbles. Pre-run the gel at least for 30 min at 20 W (small plates) or 40 W (medium plates) before loading the samples (ideally, the gel has to be hot when touching for loading—this assures that the samples keep denatured during loading). 6. Turn off the power supply. Rinse the wells and load samples. Run the gel at 20 W (small plates) or 40 W (medium plates). The time of run may vary according to the length of the transcription product and fragments, and both dyes of the loading buffer can be used to estimate where the RNA products are in the gel. In general, a 40 min run is enough for constructs less than 110 nucleotides (see Note 9). 7. After the electrophoresis separation is done, turn off the power supply, remove the plate assembly, and uncast the set of plates carefully. Cover one side of the gel with cellulose chromatography paper (this removes excess liquid in the gel, preventing excessive sample diffusion during storage). Cover the entire gel in plastic wrap and expose it to a phosphor screen. Place the phosphor image screen cassette in a refrigerator during exposure (up to an overnight exposure). If a longer exposure is needed, the gel should be dried and then exposed to the phosphor image screen (see Notes 10 and 11). 8. Use a biomolecular imager system (like Typhoon series from GE Healthcare) to retrieve the gel image from the exposed phosphor image screen. Analyze the gel image by creating lane profiles of each lane and measuring band intensities using an appropriate software, such as ImageQuant (GE Healthcare) or Image J (Open source—NIH). For self-cleaving ribozymes, the single precursor RNA band (full length product) cleaves into two visible bands (50 and 30 products), which increases in intensity over time as the self-scission reaction is allowed to proceed.

Co-Transcriptional Analysis of Self-Cleaving Ribozymes

15 min

6 min

3 min

1 min

20 sec

10 sec

0

15 min

30 mM GlcN6P 6 min

3 min

1 min

20 sec

10 sec

Time

0

Control

19

Precursor 3’ product (ribozyme) 5’ product Fig. 1 Resolved denaturing (urea) PAGE gel of co-transcriptional self-scission of the drz-Fpra-1 ribozyme. In vitro co-transcriptional cleavage kinetics were performed in absence (control) and presence of 30 mM GlcN6P at a constant Mg2+ concentration (10 mM)

Figure 1 provides an illustration of a resolved gel image. In vitro co-transcriptional cleavage kinetics of drz-Fprau-1 were performed in presence and absence of GlcN6P. 3.4

Data Analysis

Several data-fitting software packages are currently available to perform data analysis. Herein, we explain how to analyze the data utilizing Microsoft Office Excel (MS Excel). We utilize linear leastsquares optimization and the solver module of MS Excel to fit the data. The retrieved band intensities of the self-scission experiment are used to solve for the observed rates of self-cleavage (kobs) using linear regression analysis of a mono-exponential decay function, as shown below: Fraction intact ¼ A  e kt þ C where A and C represent the relative fractions of the ribozyme population cleaving with a rate constant k and remaining uncleaved population, respectively. 1. In a MS Excel spreadsheet, horizontally, insert the band intensities values for each time-point, starting at column B. Leave column A for labeling the rows utilized: one for the single precursor RNA band, and two for the cleaved bands. Use row 1 to label and reference each lane from the gel. 2. In a convenient location on the spreadsheet, print arbitrary values corresponding to “A”, “k”, and “C” for the monoexponential decay and residuals model. For this example, the function and the cells used are: ¼$K$3∗EXP($L $3∗B8) + $M$3. Where $K$3 represents the value for “A”, $L$3 represents the value for “k”, B8 represents the time, and $M$3 represents the value for “C”. The dollar sign ensures

20

Luiz F. M. Passalacqua and Andrej Lupta´k

that the value in that cell is used regardless of where the formula is pasted in the spreadsheet. Therefore, the time value will change as the formula is pasted across the time-point columns. This programming is important for utilizing the “Solver” tool. 3. On the fifth row (¼sum of bands), calculate the sum of the bands (precursor + cleaved ones). 4. On the sixth row (¼time), insert the time-point for each aliquot withdrawn (use the same units for all time-points). 5. On the seventh row (¼fraction), calculate the fraction of precursor RNA band (full length) for each time-point by dividing the value of the precursor band by the sum of the precursor and cleaved bands at a single time-point (¼ precursor band/sum of bands). The formula can be pasted into subsequent cells for each time-point without retyping. 6. On the eighth row (¼model), as previously introduced, calculate the model for each time-point where “t” is the time and “A”, “k”, and “C” are arbitrary values for a mono-exponential decay model: ¼$K$3∗EXP($L$3∗B8) + $M$3. The formula can be pasted into subsequent cells for each time-point without retyping, because time is the variable that will change. 7. On the ninth row (¼square difference), calculate the square of the difference at each time-point between the model value and the fraction cleaved [¼ (fraction – model)2]. 8. Calculate the sum of all square differences by programming using the SUM function in a new cell $J$11 (¼sum of values of row 9). 9. Solver tool is an add-in which may need to be loaded into MS Excel via the Excel options and Add–ins tab menu. Solver is a tool for optimization and equation solving that finds the optimum value in one cell by adjusting the values in the cells the user specifies. Therefore, this tool can be used to solve the regression of the data points to the model, resulting in the kobs value for the particular ribozyme. (a) In MS Excel under the Data menu, select Solver in the Analyze subset. (b) Set the target cell to the sum of the square differences by selecting the cell containing that value ($J$11). (c) The goal is to minimize the value of that selected cell (sum of square differences), therefore, set “To:” to “min.” (d) “By changing variable cells”: should be set to the arbitrary model values (A, k, C; $K$3-$M$3 in our example). (e) Click “Solve”. Allow the process to complete. The model value cell $L$3 should now contain the kobs value for the particular ribozyme (the value for k).

Co-Transcriptional Analysis of Self-Cleaving Ribozymes

21

(f) The “Solve” processing can be visualized if both the calculated model values and the fraction cleaved values are plotted vs. time. 10. Alternatively, Solver tool is also available as an add-in for Google docs spreadsheet. Figure 2 shows the MS Excel spreadsheet used for the data analysis of both kinetics experiments presented on Fig. 1.

4

Notes 1. Make all buffers in a 5 or 10 concentration to facilitate the preparation of the reactions. Store premade buffers at appropriate temperature. 2. The in vitro transcription buffer used usually cannot be the commercially available buffer supplied with the enzyme because of the high amounts of Mg2+. However, the rNTPs can be stretched to concentrations matching the Mg2+ concentration in the buffer to prevent significant ribozyme activity during the initial transcription reaction. 3. Do not forget to insert the T7 promoter sequence upstream of the DNA templates. To increase transcription yield, consider the sequence immediately downstream of the T7 RNA promoter. The +1 to +3 promoter sequence with nucleotides GGG or GGC affords the highest yield [38]. 4. For conditions requiring a consistent ionic strength, the buffer and metabolite(s) stocks may have to be pH-adjusted by the addition of KOH or HCl. Additionally, the contribution of ions from the metabolite(s) stocks has to be tracked and considered in the final reaction composition. For example, glcN6P is typically available as sodium salt. Thus, titration of this metabolite has to be accounted for when determining the ionic strength. 5. Increase the EDTA concentration accordingly if reaction to be quenched has more than 10 mM Mg2+ and/or another divalent ion. 6. You can reduce the in vitro transcription temperature (down to 16  C) to decrease the self-cleavage reaction during transcription. Note that the transcription yield will be reduced as well. 7. Use a thermocycler with a heated lid to avoid condensation of water on the lid of the tube. Solvent evaporation can drastically change the concentration of solutes.

Fig. 2 Data analysis of co-transcriptional kinetics using MS Excel. Calculated kobs is highlighted at cell L3 for both the no metabolite control (a) and the 30 mM GlcN6P experiments (b). Solver tool was used to find the best parameters to fit a simple monoexponential decay (A—fraction reacted, kobs—self-scission rate constant) with an unreacted fraction (C) equation. The two graphs in each panel show identical data presented on log-linear (early time-points for visual comparison of initial self-scission rate) and log-log scales. The data derived from the PAGE images are shown with squares. The best-fit models are shown as dashed lines

Co-Transcriptional Analysis of Self-Cleaving Ribozymes

23

8. Polyacrylamide gel percentage may differ according to the length of products and fragments generated by the self-scission reaction. In general, lower percentages of gels are used to have greater separation of fragments with similar lengths. 9. It is important to design constructs in a way that will allow the two product bands to be distinguishable by size separation. 10. Exposure time of the gel to the phosphor screen depends on the amount of 32P-labeled material on the gel. To increase the labeling yield of [α-32P] rATP, you may reduce the concentration of the non-radioactive rATP to 0.1 mM or even 0.05 mM in the in vitro transcription mix. Adjust the Mg2+ concentration accordingly. 11.

P is a high energy β-emitter. Avoid exposure to the radiation and radioactive contamination. Wear proper PPE to minimize exposure to radiation. Dispose of radioactive waste in accordance with the rules and regulations. 32

References 1. Prody GA, Bakos JT, Buzayan JM et al (1986) Autolytic processing of dimeric plant virus satellite RNA. Science 231:1577–1580 2. Hutchins CJ, Rathjen PD, Forster AC et al (1986) Self-cleavage of plus and minus RNA transcripts of avocado sunblotch viroid. Nucleic Acids Res 14:3627–3640 3. Buzayan JM, Gerlach WL, Bruening G (1986) Non-enzymatic cleavage and ligation of RNAs complementary to a plant virus satellite RNA. Nature 323:349–353 4. Sharmeen L, Kuo MY, Dinter-Gottlieb G et al (1988) Antigenomic RNA of human hepatitis delta virus can undergo self-cleavage. J Virol 62:2674–2679 5. Saville BJ, Collins RA (1990) A site-specific self-cleavage reaction performed by a novel RNA in neurospora mitochondria. Cell 61:685–696 6. Jimenez RM, Polanco JA, Lupta´k A (2015) Chemistry and biology of self-cleaving ribozymes. Trends Biochem Sci 40:648–661 7. Wilson TJ, Liu Y, Lilley DMJ (2016) Ribozymes and the mechanisms that underlie RNA catalysis. Front Chem Sci Eng 10:178–185 8. Ren A, Micura R, Patel DJ (2017) Structurebased mechanistic insights into catalysis by small self-cleaving ribozymes. Curr Opin Chem Biol 41:71–83 9. Seith DD, Bingaman JL, Veenis AJ et al (2018) Elucidation of catalytic strategies of small

nucleolytic ribozymes from comparative analysis of active sites. ACS Catal 8:314–327 10. Fedor MJ (2009) Comparative enzymology and structural biology of RNA self-cleavage. Annu Rev Biophys 38:271–299 11. Winkler WC, Nahvi A, Roth A et al (2004) Control of gene expression by a natural metabolite-responsive ribozyme. Nature 428:281–286 12. Wu HN, Lin YJ, Lin FP et al (1989) Human hepatitis delta virus RNA subfragments contain an autocleavage activity. Proc Natl Acad Sci 86:1831–1835 13. Roth A, Weinberg Z, Chen AGY et al (2014) A widespread self-cleaving ribozyme class is revealed by bioinformatics. Nat Chem Biol 10:56–60 14. Weinberg Z, Kim PB, Chen TH et al (2015) New classes of self-cleaving ribozymes revealed by comparative genomics analysis. Nat Chem Biol 11:606–610 15. Webb CHT, Riccitelli NJ, Ruminski DJ et al (2009) Widespread occurrence of self-cleaving ribozymes. Science 326:953 16. Hammann C, Luptak A, Perreault J et al (2012) The ubiquitous hammerhead ribozyme. RNA 18:871–885 17. Martick M, Horan LH, Noller HF et al (2008) A discontinuous hammerhead ribozyme embedded in a mammalian messenger RNA. Nature 454:899

24

Luiz F. M. Passalacqua and Andrej Lupta´k

18. Vazquez-Tello A, Rojas AA, Paquin B et al (2000) Hammerhead-mediated processing of satellite pDo500 family transcripts from Dolichopoda cave crickets. Nucleic Acids Res 28:4037–4043 19. Ruminski DJ, Webb C-HT, Riccitelli NJ et al (2011) Processing and translation initiation of non-long terminal repeat retrotransposons by hepatitis delta virus (HDV)-like self-cleaving ribozymes. J Biol Chem 286:41286–41295 20. Eickbush DG, Eickbush TH (2010) R2 retrotransposons encode a self-cleaving ribozyme for processing from an rRNA cotranscript. Mol Cell Biol 30:3142–3150 21. Sa´nchez-Luque FJ, Lo´pez MC, Macias F et al (2011) Identification of an hepatitis delta virus-like ribozyme at the mRNA 50 -end of the L1Tc retrotransposon from Trypanosoma cruzi. Nucleic Acids Res 39:8065–8077 ˜ a M (2014) Eukaryotic 22. Cervera A, De la Pen penelope-like retroelements encode hammerhead ribozyme motifs. Mol Biol Evol 31:2941–2947 23. Forster AC, Symons RH (1987) Self-cleavage of plus and minus RNAs of a virusoid and a structural model for the active sites. Cell 49:211–220 24. Epstein LM, Gall JG (1987) Transcripts of Newt satellite DNA self-cleave in vitro. Cold Spring Harb Symp Quant Biol 52:261–265 25. Ferbeyre G, Smith JM, Cedergren R (1998) Schistosome satellite DNA encodes active hammerhead ribozymes. Mol Cell Biol 18:3880–3888 26. Passalacqua LFM, Jimenez RM, Fong JY et al (2017) Allosteric modulation of the Faecalibacterium prausnitzii hepatitis delta virus-like ribozyme by glucosamine 6-phosphate: the substrate of the adjacent gene product. Biochemistry 56:6006–6014 27. Salehi-Ashtiani K, Lupta´k A, Litovchick A et al (2006) A genomewide search for ribozymes reveals an HDV-like sequence in the human CPEB3 gene. Science 313:1788–1792

˜ a M, Garcı´a-Robles I (2010) Intronic 28. De la Pen hammerhead ribozymes are ultraconserved in the human genome. EMBO Rep 11:711–716 29. Lupta´k A, Ferre´-D’Amare´ AR, Zhou K et al (2001) Direct pKa measurement of the activesite cytosine in a genomic hepatitis delta virus ribozyme. J Am Chem Soc 123:8447–8452 30. Pan T, Artsimovitch I, Fang X et al (1999) Folding of a large ribozyme during transcription and the effect of the elongation factor NusA. Proc Natl Acad Sci 96:9545–9550 31. Chadalavada DM, Gratton EA, Bevilacqua PC (2010) The human HDV-like CPEB3 ribozyme is intrinsically fast-reacting. Biochemistry 49:5321–5330 32. Diegelman-Parente A, Bevilacqua PC (2002) A mechanistic framework for co-transcriptional folding of the HDV genomic ribozyme in the presence of downstream sequence. J Mol Biol 324:1–16 33. Long DM, Uhlenbeck OC (1994) Kinetic characterization of intramolecular and intermolecular hammerhead RNAs with stem II deletions. Proc Natl Acad Sci 91:6977–6981 34. Carothers JM, Goler JA, Juminaga D et al (2011) Model-driven engineering of RNA devices to quantitatively program gene expression. Science 334:1716–1719 35. Cech TR (1990) Self-splicing of group I introns. Annu Rev Biochem 59:543–568 36. Zhao C, Pyle AM (2017) Structural insights into the mechanism of group II intron splicing. Trends Biochem Sci 42:470–482 37. Mengin-lecreulx D, Van Heijenoort J (1996) Characterization of the essential gene glmM encoding phosphoglucosamine mutase in Escherichia coli. Mol Biol 271:32–39 38. Imburgio D, Rong M, Ma K et al (2000) Studies of promoter recognition and start site selection by T7 RNA polymerase using a comprehensive collection of promoter variants. Biochemistry 39:10419–10430

Part II Ribozyme Identification and Characterization

Chapter 3 Cloning and Detection of Genomic Retrozymes and Their circRNA Intermediates Amelia Cervera and Marcos de la Pen˜a Abstract Retrozymes are a novel family of non-autonomous retrotransposable elements that contain hammerhead ribozyme motifs. These retroelements are found widespread in eukaryotic genomes, with active copies present in many species, which rely on other autonomous transposons for mobilization. Contrary to other retrotransposons, transcription of retrozymes in vivo leads to the formation and accumulation of circular RNAs, which can be readily detected by RNA blotting. In this chapter, we describe the procedures needed to carry out the cloning of genomic retrozymes, and to detect by northern blot their circular RNA retrotransposition intermediates. Key words Hammerhead ribozyme, Catalytic RNA, Retrozyme, Retrotransposon, Retroelement, Molecular cloning, Transcription, Northern blot

1

Introduction The hammerhead ribozyme (HHR) is a catalytic RNA motif that belongs to the family of the small self-cleaving ribozymes [1]. Once thought to be exclusive of small RNA infective agents, HHRs are known to be present ubiquitously in prokaryotic and eukaryotic genomes [2–6]. In many cases, these small ribozymes are associated with selfish genetic elements, as is the case of Penelope-like elements [7], or the more recently described family of Retrozymes (for retrotransposons with hammerhead ribozymes) [8]. Retrozymes are non-autonomous and non-coding retroelements, which propagate throughout animal and plant genomes by means of a retrotranscription intermediary of circular RNA (Fig. 1) [9]. Copies of retrozymes exist in many plant and animal species, although they present different structures. Plant retrozymes contain two direct long terminal repeats (LTRs), which harbour type-III HHRs. In addition, they possess other conserved motifs required for their mobilization by autonomous LTR retrotransposons, such as a primer binding site (PBS) and poly-purine tract (PPT). Animal retrozymes, on the

Robert J. Scarborough and Anne Gatignol (eds.), Ribozymes: Methods and Protocols, Methods in Molecular Biology, vol. 2167, https://doi.org/10.1007/978-1-0716-0716-9_3, © Springer Science+Business Media, LLC, part of Springer Nature 2021

27

28

Amelia Cervera and Marcos de la Pen˜a a

PPT

HHR

PBS

HHR

HHR

circRtz RNA

LTR

LTR

b HHR

HHR

HHR

HHR

circRtz RNA

Fig. 1 Schematic representation of genomic retrozymes and their derived circular RNAs. (a) Plant genomic retrozyme (left) and circular retrozyme RNA (right) with conserved hammerhead motifs (HHR), long terminal repeats (LTR), primer binding site (PBS), and polypurine tract (PPT). The self-cleavage sites delimiting the retrozyme RNA (horizontal arrow) are marked with arrowheads. (b) Animal retrozyme (left) and circular retrozyme RNA (right) with conserved hammerhead motifs (HHR). The self-cleavage sites delimiting the retrozyme RNA (horizontal arrow) are marked with arrowheads

other hand, are non-LTR retrotransposons that contain no conserved motifs other than tandem repeats of type-I HHRs. Circular transposition intermediates of both types of retrozymes, formed by the region encompassed by the HHRs, are readily detected by northern blot analysis. In this chapter, we describe the methodology for cloning genomic retrozymes, as well as for the detection of the circular RNAs of retrozymes by northern blot analysis.

2

Materials All solutions should be prepared wearing gloves to avoid contamination with RNases, using deionized ultrapure water and analyticalgrade reagents (see Note 1).

2.1 Cloning of Genomic Retrozymes

1. Genomic DNA of the organism(s) under investigation. DNA can be extracted using one of the many traditional extraction protocols, or using any commercially available kit. 2. Primers to amplify genomic retrozymes. Desalted DNA oligonucleotides can be purchased from any suitable supplier. Prepare 100 μM stock solutions of the primers. 3. Hot-start DNA polymerase with proofreading (30 ! 50 exonuclease) activity, and the dNTPs, MgCl2, and buffer solutions supplied with the polymerase. 4. Thermal cycler and sterile, DNase-free PCR tubes.

Cloning and Detection of Retrozymes

29

5. Benchtop centrifuge for microtubes (0.2–1.5 ml) and cell culture tubes (15–30 ml). 6. Stock of 10 Tris-acetate (TAE) buffer: 40 mM Tris-acetate, 10 mM ethylenediaminetetraacetic acid (EDTA). The stock solution should be diluted to 1 working solution (see Note 2). 7. 1% (w/v) agarose solution in 1 TAE buffer (or the buffer in which the electrophoresis is carried out). 8. DNA loading dye. 9. DNA size marker(s) in the range of the expected PCR product size. 10. Horizontal gel electrophoresis system. 11. Electrophoresis power supply. 12. Stock of 10 mg/ml ethidium bromide. Dilute to 10 ng/μl working solution to stain agarose or polyacrylamide gels. 13. Orbital shaker. 14. Gel documentation system with UV transilluminator. 15. PCR reaction purification kit, such as MSB Spin PCRapace. 16. Sterile scalpels. 17. Agarose DNA extraction kit. 18. Cloning vector that contains both the T7 and T3 promoter sequences, such as the pBluescript II KS() phagemid (Agilent). 19. Restriction endonucleases that cut in the multiple cloning site of the selected cloning vector, together with their incubation buffer (see Note 3). 20. 3 M sodium acetate (pH 5.5) and 100% ethanol for nucleic acid precipitation. 21. NanoDrop microvolume spectrophotometer or conventional UV spectrophotometer. 22. T4 DNA ligase with ligation buffer. 23. Chemically competent E. coli cells, prepared using standard procedures [10], or obtained from a commercial supplier. Store them at 80  C. 24. Dry block heater. A PCR thermal cycler or water bath can also be used. 25. Lysogeny Broth (LB) medium: 1% (w/v) tryptone, 0.5% (w/v) yeast extract, and 1% (w/v) NaCl in water, pH 7.5. Sterilize by autoclaving. 26. Antibiotics for selection of transformed bacteria. The specific antibiotic will depend on the resistance gene carried by the cloning vector. Prepare filter-sterilized 1000 stocks and store them at 20  C.

30

Amelia Cervera and Marcos de la Pen˜a

27. LB/agar plates: Add 1.5% (w/v) bacteriological agar to LB medium, autoclave, and supplement with the selection antibiotic at 1 final concentration after cooling down. 28. Blue-white screening plates: 25 mg/ml (w/v) 5-bromo-4chloro-3-indolyl-β-D-galactopyranoside (X-gal) in dimethyl sulfoxide (DMSO), and 250 mM isopropyl β-D-1-thiogalactopyranoside (IPTG). Add 40 μl of X-gal solution and 10 μl of IPTG onto the surface of each 9 cm LB/agar plate after the medium has solidified. 29. Sterile cell culture tubes (13–15 ml). 30. Kit for plasmid mini-preparations. Plasmids can also be isolated using standard protocols [10]. 2.2 RetrozymeRNA Detection by Northern Blot

1. For RNAextraction from animal tissues or plants poor in polyphenols and polysaccharides, TRIzol Reagent (Invitrogen), or any similar commercial reagent. 2. For RNA extraction from plants with a high content in polyphenols and polysaccharides, CTAB-RNA extraction buffer [15] 2% (w/v) cetyltrimethylammonium (CTAB), 100 mM Tris-HCl pH 8, 25 mM EDTA, 2 M NaCl, 2% (w/v) polyvinylpyrrolidone 40 kDa polymer (PVP-40), 0.1% (v/v) spermidine, 2% (v/v) 2-mercaptoethanol (see Note 4). 3. Water bath. 4. Polytron homogenizer (PT 3100 D, Kinematica) and probe (PT-DA 12/EC-B154 Dispersing Aggregate, Kinematica). 5. Chloroform:isoamyl alcohol (24:1, v:v) mixture. 6. 6 M sodium iodide, with 150 mM sodium sulfate, for silica purification of RNA [11]. 7. Suspension of silica particles: approximately 100% (v/v), pH 2. Add 200 ml of water to 22 g of silica particles (SiO2) and mix until a slurry is obtained. Centrifuge at 2500  g for 10 min at room temperature, remove and discard the supernatant. Add 200 ml of water, mix well, and centrifuge again. Remove and discard the supernatant, and add 22 ml of water. Mix again to obtain a slurry, and adjust the pH to 2 with 5 M HCl (about 130 μl will be needed) with the aid of pH-indicator paper. Store the silica suspension at 4  C in a dark flask [11]. 8. Silica wash buffer: 10 mM Tris-HCl, pH 7.5, 0.5 mM EDTA, 50 mM NaCl, 50% (v/v) ethanol. 9. Genopure Plasmid Midi Kit (Roche) (see Note 5). 10. Restriction endonucleases that cut in the multiple cloning site of the selected cloning vector, together with their incubation buffer.

Cloning and Detection of Retrozymes

31

11. Phenol:chloroform:isoamyl alcohol (PCI) mixture (25:24:1, v: v:v; saturated with 100 mM Tris-HCl buffer, pH 7.8). 12. T7 RNA polymerase, T3 RNA polymerase, and their supplied transcription buffers. 13. Ribonucleoside solution, 10 mM each NTP. Prepare by mixing and diluting 100 mM stocks of ribonucleoside triphosphate set. 14. Digoxigenin-11-UTP for digoxigenin (DIG) labeling of RNA probes. 15. RNase inhibitor, such as ribonuclease inhibitor from porcine liver. 16. Kit for RNA purification from solutions. 17. Stock of 10 Tris-borate (TBE) buffer for denaturing PAGE: 0.89 M Tris-borate, 0.2 M EDTA. Dilute to 1 working solution. Discard when a precipitate is formed in the stock or working solution. 18. Vertical acrylamide gel electrophoresis system. 19. Stock solution of 40% acrylamide:bisacrylamide (37.5:1). 20. Solution for denaturing polyacrylamide gel electrophoresis (PAGE): 5% acrylamide:bisacrylamide (37.5:1) solution containing 8 M urea and 1 TBE buffer. Dissolve the urea in the buffer by heating for a few seconds in a microwave oven, and add the polyacrylamide:bisacrylamide stock when the buffer has cooled down. 21. Tetramethylethylenediamine (TEMED). 22. 10% (w/v) ammonium persulfate (APS). Store at 4  C and replace every few weeks, or when polyacrylamide gels fail to polymerize. 23. Denaturing RNA loading buffer: 50% (v/v) formamide, 8 M urea, 50 mM EDTA, 0.03% (w/v) bromophenol blue, 0.03% (w/v) xylene cyanol. 24. RNA size marker(s) in the range of the retrozymeRNA. 25. Stock of 20 electroblotting buffer: 25 mM sodium phosphate, pH 6.5. Dilute to 1 working concentration. 26. Neutral nylon membrane for RNA blotting. 27. Tank electroblotting system, with electroblotting cassettes and foam sponges. 28. Gel blotting paper. 29. Disposable syringe needle, glass rod, and pair of forceps. 30. UV crosslinker. 31. Hybridization oven with rotisserie, and glass hybridization tube that fits the size of the blotting membrane.

32

Amelia Cervera and Marcos de la Pen˜a

32. Maleic acid buffer: 0.1 M maleic acid, 0.15 M NaCl, pH 7.5. 33. Stock of 10% (w/v) blocking reagent (e.g., Roche blocking reagent for nucleic acid hybridization and detection) in maleic acid buffer. Carefully heat the solution to help dissolving the blocking reagent. 34. Stock of 20 SSC buffer: 3 M NaCl, 0.3 M sodium citrate, pH 7. 35. Stock of 10% (w/v) sodium dodecyl sulfate (SDS). 36. Hybridization buffer: 50% (v/v) formamide, 5% (v/v) SSC buffer, 2% (v/v) blocking reagent, 0.1% N-lauroylsarcosine, 0.02% (w/v) sodium dodecyl sulfate (SDS). 37. Low stringency wash solution: 2 SSC buffer, 0.1% SDS. 38. High stringency wash solution: 0.1 SSC buffer, 0.1% SDS. 39. Probe wash solution: 0.3% (v/v) Tween-20 in maleic acid buffer. 40. Probe blocking solution: 1% blocking reagent (w/v) in maleic acid buffer. 41. Alkaline phosphatase-conjugated anti-digoxigenin antibody. 42. Chemiluminescence substrate. 43. Alkaline phosphatase (AP) reaction buffer: 0.1 M Tris-HCl pH 9.5, 0.1 M NaCl. 44. Transparent polyethylene bags that can accommodate a blotting membrane. 45. Chemiluminescence image acquisition system.

3

Methods

3.1 Cloning of Genomic Retrozymes

1. Extract DNA from the desired animal or plant tissues. We find phenol-chloroform extraction [12] works well for most animal tissues, whereas CTAB-based protocols [13] are better suited for plants with a high content in polyphenols and polysaccharides. 2. Design primers to amplify a fragment of genomic retrozyme of the species of interest. The primers should be selected to bind the most conserved motifs of the retrozyme sequence, given the high variability between individual copies, even within a single species. If working with a group of closely related species, some degeneracy can be added to the primers to try to amplify retrozymes from all the species with the same set of primers. Ideally, the primers should span the length of the circular RNA of the retrozyme (retrozymemonomer from now on), and leave the HHR motif mid-sequence. This is possible given the presence of the two LTRs at both ends of the genomic retrozyme (Fig. 1) (see Note 6).

Cloning and Detection of Retrozymes

33

Depending on the method chosen for cloning the amplified retrozyme, primers may need some modifications. For restriction cloning [14] (see Note 7), restriction sites (recognized by endonucleases that also cut in the multiple cloning site of the cloning vector) need to be added 50 to the retrozymespecific sequence, as well as a few additional nucleotides (see Note 8). 3. Set up the PCR reactions required to amplify the retrozyme monomer following the proof-reading DNA polymerase instructions. We routinely prepare 50 μl reactions in 0.2 ml PCR tubes with 200 μM NTPs, 2 μM of each oligo, 0.5 μl of PrimeStar HS DNA polymerase (2.8 U/μl), and 200 ng of genomic DNA. We carry out an initial heating step in the thermal cycler of 1 min at 98  C, then 30 amplification cycles (10 s at 98  C, 10 s at the annealing temperature, 1 min/kb at 72  C), and a final extension step of 10 min at 72  C. With this particular DNA polymerase an annealing temperature of 60  C, irrespective of the Tm of the primers, works well usually. Always set up negative controls with all the PCR components with the exception of the genomic DNA sample, and do not amplify for more than 30 cycles, to avoid unspecific products. 4. Prepare a 1% agarose gel by adding the agarose to 1 TAE buffer and heating in a microwave oven (see Note 9). When the solution has cooled down to 60  C, pour it into a gel-casting tray, and insert a comb with an adequate number of wells. 5. Once the gel has set, place it in the electrophoresis cell and cover it with 1 TAE buffer. Add the required amount of loading buffer to the PCR reactions (for instance, 2 μl of 6 loading buffer to a 10 μl PCR reaction), and load the samples, together with the DNA size marker(s), into the gel. Connect the cell to a power supply, and carry out the electrophoresis at a constant electric field strength of 10 V/cm (see Note 10), until the bromophenol blue marker has reached two-thirds of the length of the gel. 6. To visualize the DNA bands, incubate the gel in an orbital shaker with a solution of 10 ng/μl ethidium bromide (see Note 11) for 10 min, and incubate again for 10 min with water. Take a photograph of the gel in a documentation system under UV light. If a clear band of a size corresponding to that of the retrozyme monomer or fragment can be seen, proceed to the next step (see Note 12). 7. Repeat the PCR so as to have at least 2 μg (ideally 10 μg) of amplified retrozyme monomer. The amount of PCR product can be roughly calculated by comparison with a DNA marker band of similar size in the agarose gel. Purify the PCR reaction with a commercial kit.

34

Amelia Cervera and Marcos de la Pen˜a

8. Digest both the purified PCR product and cloning vector (at least 1 μg, ideally 10 μg) with compatible restriction endonucleases, following the manufacturer’s instructions. Incubate for at least 4 h at the indicated temperature (see Note 13). 9. Run the digestions in an agarose gel according to steps 4–6. Besides the DNA size marker, it is useful to also load uncut insert and vector controls. After photodocumentation of the gel, cut out the bands corresponding to the vector and retrozyme monomer with a sterile scalpel, taking care to remove all excess gel material (see Note 14). 10. Extract the digested retrozyme monomer and cloning vector from the agarose slice using a commercially available kit, or any other suitable method (see Note 15), and determine the concentration of recovered DNA with a NanoDrop or conventional spectrophotometer. 11. Set up a ligation reaction with the digested insert and vector following the instructions of the T4 DNA ligase manufacturer. We normally use an insert to vector molar ratio of 10:1 (usually 0.2:0.002 pmol), and incubate the reaction for 4 h at 16  C. 12. Transform the ligation into the bacterial strain of choice, following the protocol provided by the manufacturer of the competent cells. When working with chemocompetent DH5alpha E. coli, we incubate 100 μl of cell suspension on ice with 5 μl of ligation for 5 min, and then heat-shock the cells with a 60 s incubation at 42  C in a dry block heater. Afterwards, we cool down the cells on ice for 5 min, add 600 μl of LB medium, and incubate at 37  C for 30 min. We spin briefly the cells, resuspend them in 200 μl of LB, and spread the suspension on an LB/agar plate containing 1 selection antibiotic, and 40 μl of 25 mg/ml X-gal plus 10 μl of 250 mM IPTG for blue-white screening. We incubate the plates overnight at 37  C, and check them the following morning for white colonies (see Note 16). 13. Inoculate four separate white colonies in 6 ml of LB medium supplemented with 1 selection antibiotic in a cell culture tube. Incubate overnight at 37  C in an orbital shaker, at 200–220 rpm. Pellet the cells by centrifugation (3000  g for 15 min at room temperature), and isolate the plasmid DNA using any commercially available kit for mini-preparations. Measure the DNA concentration obtained using a NanoDrop or a conventional spectrophotometer. 14. Carry out an analytical digestion of the plasmids (500 ng; see step 8), and run them in a 1% agarose gel (see steps 4–6) to check that the size of the inserts is as expected. Sequence the plasmids that contain an insert of the right size at any company that offers commercial sequencing. Inspect the retrozyme

Cloning and Detection of Retrozymes

35

monomer sequences (some variability among different clones is to be expected), and choose one that has a functional HHR to be used as the template for probe synthesis. 3.2 RetrozymeRNA Detection by Northern Blot

1. Transform chemically competent E. coli cells (see Subheading 3.1, step 12) with 100 ng of the plasmid carrying the retrozyme monomer. Inoculate the following day one colony in 200 ml of LB medium supplemented with 1 selection antibiotic in a conical flask. Incubate overnight at 37  C (see Subheading 3.1, step 13), and isolate the plasmid DNA with the Genopure Plasmid Midi Kit from Roche, following the manufacturer’s instructions (see Note 5). Measure the DNA concentration in the samples using a NanoDrop or a conventional spectrophotometer. 2. Linearize the vector for in vitro run-off transcriptions of the positive (containing the HHR) and negative strands of the retrozyme by cutting in the multiple cloning site downstream of the insert (see Note 17). To this end, set up two separate digestions of 10 μg of midi-isolated vector with a restriction endonuclease that cuts at any of the two sides of the insert in the multiple cloning site of the vector. In the case of the pBluescript II KS() phagemid, we use EcoRI for transcriptions of the strand harboring the T7 promoter, and XbaI for transcriptions of the strand with the T3 promoter. 3. Following incubation at 37  C for at least 4 h, purify the digested DNA by phenol extraction (see Note 18). Add water to the digestion to a final volume of 200 μl, and add an equal volume of PCI mixture. Vortex for a few seconds and centrifuge at 20,000 g for 5 min at room temperature. 4. Transfer 125 μl of the upper aqueous phase to a fresh microcentrifuge tube, and add 200 μl of water to the original tube with the remaining of the organic phase. Vortex for a few seconds and centrifuge again at 20,000 g for 5 min at room temperature. Collect 200 μl of the upper aqueous phase and add them to the 125 μl of supernatant previously collected. 5. Add 20 μl of 3 M sodium acetate (pH 5.5) and 550 μl of 100% ethanol. Incubate at 20  C at least for an hour, and centrifuge at 20,000  g for 30 min at 4  C. Discard the supernatant, dry the tubes by leaving them open for 10 min, resuspend the DNA in 30 μl of water, and calculate the concentration with a NanoDrop or conventional spectrophotometer. 6. Transcribe the negative strand of the retrozyme monomer, using the linearized vector as a template, to synthesize a digoxigenin-labeled probe for northern blot detection of positive strand retrozymeRNA. Set up a 20 μl run-off transcription that contains 1 μg of vector template, 1 mM of each NTP,

36

Amelia Cervera and Marcos de la Pen˜a

0.5 mM digoxigenin-11-UTP (DIG-UTP), 20 U of RNase inhibitor, 1 transcription buffer, and 50 U of phage RNA polymerase. Incubate the reaction for 4 h at 37  C, and purify the transcript with a kit for RNA purification from solutions, following the instructions of the manufacturer (see Note 19). 7. Transcribe the positive strand (containing the HHR) of the retrozyme monomer to obtain a size marker for northern blot analysis (see Note 20). Set up a 20 μl run-off transcription with all the components mentioned in step 6, except for DIG-UTP. Incubate and purify the reaction in the way explained in step 6 (see Note 21). 8. Extract RNA from the desired animal or plant tissue(s). For animal tissues, and for plants with a low content in fatty acids, polyphenols, and polysaccharides, Trizol (or an equivalent reagent) can be used, following the manufacturer’s instructions. Between 0.1 and 2 g of tissue usually give enough RNA to detect retrozymeRNA in a northern blot hybridization using a DIG-labeled probe. If the starting material is rich in secondary metabolites, the protocol explained in step 9 should be used. 9. To isolate RNA from recalcitrant plant material, an extraction protocol based on the detergent CTAB [15] followed by silica purification [11] provides RNA of better quality. Preheat the CTAB-RNA extraction buffer at 65  C in a water bath, and add 12 ml to 2 g of plant tissue in a 30 ml tube. 10. Homogenize with a Polytron (12,000–18,000 rpm for a couple of minutes) while maintaining the tubes on ice (see Note 22). Incubate the samples for 30 min at 65  C in a water bath, vortexing the tubes from time to time, and cool down on ice for 10 min (see Note 23). 11. Add 12 ml of chloroform:isoamyl alcohol, centrifuge at 8000  g for 15 min at 4  C, and transfer 10 ml of the upper aqueous phase to a fresh 30 ml tube. Add 10 ml of chloroform: isoamyl alcohol, vortex, and centrifuge again at 8000  g for 15 min at 4  C, and transfer 8 ml of the upper aqueous phase to another fresh 30 ml tube. 12. To purify the RNA with silica, add to the samples 4 ml of 100% ethanol, 8 ml of 6 M sodium iodide, and 1.4 ml of ~100% silica suspension (pH 2). Incubate at room temperature in an orbital shaker (about 200 rpm) for 30 min, and centrifuge at 8000  g for 2 min at 4  C to precipitate the silica. 13. Remove and discard the supernatant, add 10 ml of silica wash solution, and resuspend by vortexing. Centrifuge at 8000  g for 2 min at 4  C, remove and discard the supernatant, and repeat the washing step three more times.

Cloning and Detection of Retrozymes

37

14. To elute the RNA bound to the silica matrix, add 2.8 ml of water, mix by vortexing, and incubate at 70  C for 4 min in a water bath. Centrifuge at 8000  g for 5 min at 4  C, transfer the supernatant to a fresh 13 ml tube, and centrifuge again at 12,000  g for 5 min at 4  C to remove silica traces. 15. Transfer 2.8 ml of supernatant to a fresh 13 ml tube, and precipitate the RNA by adding 280 μl of 3 M sodium acetate (pH 5.5) and 7.7 ml of 100% ethanol. Incubate at 20  C at least for an hour, and centrifuge at 20,000  g for 30 min at 4  C. Discard the supernatant, dry the tubes by leaving them open for 10 min, resuspend in 200–500 μl of water, and calculate the RNA concentration in the samples with a NanoDrop or conventional spectrophotometer. The samples should be stored at 80  C until used (see Note 24). 16. Run the RNA samples in a denaturing urea polyacrylamide gel. To cast the gel, prepare a solution of 5% acrylamide and 8 M urea in 1 TBE buffer. Just before casting the gels, add TEMED and 10% PSA to a final concentration of 0.15% (v/v for TEMED, w/v for PSA), swirl carefully without aerating the solution, and pour slowly into the gel casting gasket. Insert a well-forming comb with the adequate number of wells, and allow to polymerize for at least 1 h at room temperature. 17. Add an equal volume of denaturing RNA loading buffer to the RNA samples, the RNA size marker, and the positive strand retrozyme transcript (see Note 25), and incubate the tubes at 98  C for 2 min. Once the gel is set and placed in the vertical electrophoresis cell, flush the slots with the running 1 TBE buffer, and immediately load the samples and markers. Run the gel at a constant field strength of 20 V/cm of gel, until the xylenol blue marker is mid gel (for a ~300 nt retrozyme monomer) or about to leave the gel (for a ~700 nt retrozyme monomer). 18. Incubate the gel in an orbital shaker with a solution of 10 ng/μ l ethidium bromide for 10 min, and photograph the gel in a documentation system under UV light. 19. Trim away all the unused acrylamide material from the gel, and incubate it for 10 min in 1 electroblotting buffer on an orbital shaker. Cut a piece of nylon membrane that is 2 cm larger in length and width than the gel membrane, and immerse it in 1 electroblotting buffer, together with two pieces of blotting paper large enough to cover the gel and membrane, and the two foam sponges. Assemble the blotting stack by placing the blotting cassette on a horizontal surface, then place a piece of buffer-soaked sponge, a piece of soaked blotting paper, the acrylamide gel, and the soaked nylon membrane on top. Make sure that there are no air bubbles trapped

38

Amelia Cervera and Marcos de la Pen˜a

between the gel and the membrane by gently rolling a glass rod over the surface. Place another piece of soaked blotting paper, another piece of sponge, and close the cassette. Place the cassette carefully inside the blotting tank filled with 1 electroblotting buffer, with the gel side facing the cathode and the membrane side facing the anode. Perform the electrotransference at a constant current of 1 A for at least one and a half hours at 4  C. 20. Dismantle the blotting stack in the reverse order so as to leave the acrylamide gel on top of the membrane. Mark the silhouette of the gel onto the membrane surface with a syringe needle, and cut out the unused parts. Visualize the gel in a documentation system to make sure that the RNA has been transferred. 21. Dry the membrane at 37  C for 15 min, and irradiate it with UV light in a crosslinker (70 mJ/cm2 for 2 min), to covalently bind the RNA to the membrane. Roll the membrane and introduce it into a glass hybridization tube, and add 10 ml of pre-heated (68  C) hybridization buffer. Incubate the tube in the hybridization oven with rotation (3 rpm) at 68  C for at least 30 min. 22. Add 200 μl of hybridization buffer to the DIG-labeled riboprobe (see step 6) and incubate it at 98  C for 1 min. Add the probe to the tube, and incubate the membrane overnight in the oven at 68  C (see Note 26). 23. Remove the probe the following day, and wash the membrane by incubating it twice at room temperature with 10 ml of low stringency wash solution (2 SSC, 0.1% SDS) in the hybridization oven. Discard the solution and incubate the membrane twice at 68  C with 10 ml of high stringency wash solution (0.1 SSC, 0.1% SDS). Discard the solution afterwards. 24. Detect the DIG-labeled probe in a hybridization oven set at room temperature and with rotation (3 rpm). First wash the membrane for 10 min with 10 ml of probe wash solution, and then block it by incubation with 10 ml of probe blocking solution for at least 30 min. 25. Dissolve 1 μl of alkaline phosphatase-conjugated anti-digoxigenin antibody (0.75 U of anti-digoxigenin-AP Fab fragments) in 200 μl of probe blocking solution, and add it to the hybridization tube (1:10,000 dilution). Incubate the membrane with the antibody for 30 min, discard the solution, and wash it twice for 15 min with 10 ml of probe wash solution. 26. Discard the solution, and equilibrate the membrane with 10 ml of AP reaction buffer for 5 min. Discard the buffer, add 25 μl of the substrate CDP-Star to 5 ml of AP reaction buffer, and start the chemiluminescence reaction by adding the solution to the

Cloning and Detection of Retrozymes

Fa

RN

A

le

av

es

z Rt lin

m

ar

ke c

r

R irc

tz

m

ar

ke

39

r

HHR

circRtz

linRtz

HR

H

Fig. 2 Northern blot analysis of a strawberry (Fragaria  ananassa) leaf RNA extract (60 μg). The linRtz marker lane contains 100 pg of linear F. ananassa retrozyme RNA that was obtained by in vitro transcription and self-cleavage of a full genomic retrozyme. The circRtz marker lane contains 100 pg of circularized retrozyme; the self-cleaved linear retrozyme RNA was ligated in vitro with the chloroplastic isoform of a tRNA ligase from Solanum melongena [1]. The samples were fractionated in a 5% denaturing polyacrylamide gel, transferred to a neutral nylon membrane, and detected using a DIG-labeled F. ananassa retrozyme monomer of the negative polarity as a probe. The positions of the linear and circular retrozyme RNAs are indicated

hybridization tube. Incubate for 5 min in the oven (see Note 27), remove the membrane from the tube with a pair of forceps, taking care to carry on as little buffer as possible, and place it inside a transparent polyethylene bag. Visualize the membrane inside the plastic bag in a LAS-3000 imaging system set to chemiluminescence detection (Fig. 2) (see Note 28).

4

Notes 1. Gloves should be worn at all times when working with RNA to avoid degradation by the RNases found on the skin. We do not use diethylpyrocarbonate (DEPC) to deactivate RNases by alkylation, since we find it unnecessary as long as standard laboratory cleaning procedures are followed. 2. Alternatively, agarose gels can be prepared with 1 Tris-borate (TBE) buffer (89 mM Tris-borate, 20 mM EDTA, see Subheading 2.2), or with any other buffer system that provides good separation of DNA bands.

40

Amelia Cervera and Marcos de la Pen˜a

3. Restriction enzymes that cut at staggered positions leaving cohesive ends should be used preferentially, since they allow to place the insert into the vector in the proper orientation. It is also advantageous to choose enzymes that can be used in a double digestion with the same restriction buffer. 4. An RNA-CTAB extraction buffer containing all reagents but PVP-40, spermidine, and 2-mercaptoethanol can be stored at room temperature for months. The three remaining components should be added fresh prior to use. 5. We strongly recommend using the Midi Kit from Roche (Genopure Plasmid Midi kit, Ref No 031434146021), since we have found a clear difference in the quality of the DNA obtained, as compared with any other midi- or minipreparation kits. The quality of the plasmid DNA is key to downstream run-off transcriptions. 6. A good strategy is to place the primers, in the case of plant retrozymes, on the conserved 50 box of the LTR, the conserved 30 box, or on the HHR motif. When trying to clone an animal retrozyme, however, it is necessary to look at the less variable regions in the retrozymes of each species, since there are not conserved motifs other than the HHR. It is not advisable to amplify a fragment larger than the retrozyme monomer, because primers would hybridize twice within the genomic retrozyme sequence, and this would likely result in a more efficient amplification of the shorter fragments, as well as possible PCR artifacts. If the amplification of the retrozyme monomer is unsuccessful, cloning a shorter fragment should be enough if the goal is to obtain a probe for detection of the RNA of the retrozyme by northern blot. This approach, however, prevents further studies using the circRtz (see Note 7). 7. Another cloning method, blunt-end cloning, has the disadvantage of requiring sequencing or an additional PCR to know the orientation of the insert. This technique, however, allows to prepare dimers of the retrozyme monomer easily, which can be used to produce a retrozyme transcript with two functional HHRs. This RNA will self-cleave at the two HHR motifs during transcription, and can be subsequently ligated [8, 16] to obtain a circRtz. The circRtz can be used as a marker to ascertain the position of the circular retrozyme bands in northern blots. If the PCR products are to be cloned by blunt-end ligation to a PCR-synthesized vector, the oligos need to be phosphorylated with T4 polynucleotide kinase in advance. 8. Advice regarding how many base pairs to add upstream of the restriction endonuclease recognition sequence can be found in [17].

Cloning and Detection of Retrozymes

41

9. PCR products can also be separated in native polyacrylamide gels, which is especially convenient when working with retrozyme monomers or retrozyme fragments of small size (200–700 bp). To cast the gels, prepare a solution containing 5% acrylamide:bisacrylamide (37.5:1) and 1 TAE buffer (see Subheading 2.2). Just before casting the gels, add TEMED and 10% PSA to a final concentration of 0.15% (v/v for TEMED, w/v for PSA), swirl carefully without aerating the solution, and pour slowly into the gel casting gasket. Insert a well-forming comb with the adequate number of wells, and allow to polymerize for at least 1 h at room temperature. Once set, the gel is run in a vertical electrophoresis system with 1 TAE running buffer at a constant current of 5 mA/cm of gel. 10. If the distance between the electrodes in the cell is 10 cm, run the gel at a constant 100 V, and so on. 11. Make sure to wear appropriate protective equipment against ethidium bromide and UV radiation when manipulating the stained gels and visualizing them in the transilluminator of the documentation system. 12. If there is no visible amplification, try reducing the amount of DNA in the PCR reaction, adjusting the annealing temperature of the primers (use a gradient PCR for that matter), and splitting the PCR reaction into several tubes to reduce the volume that undergoes thermal cycling. If a faint band is obtained, it can be extracted and used to reamplify the PCR products. If everything mentioned fails, try redesigning the primers. 13. In the case that the two reactions cannot be carried out in the same buffer or at the same temperature, first digest with one of the enzymes, purify the digested DNA by phenol:chloroform extraction (see Subheading 3.2, steps 3–5), and then digest with the second enzyme. 14. If no digested plasmid or PCR product bands are detected, or if the digestion is incomplete, try increasing the incubation time and amount of restriction enzyme. Additionally, the two digestions can be performed one after the other (see Note 7). 15. We have had problems with some agarose gel extraction kits. If the isolation is not successful, first try an extraction kit from another supplier. Another approach is to separate the PCR products by native PAGE, and recover the retrozyme DNA band from the polyacrylamide gel slice (see Note 8). In that case, the procedure would be as follows. Excise the polyacrylamide gel slice containing the PCR amplicon of interest with a sterile scalpel, taking care to remove all excess gel material, and introduce it in a 1.5 ml microcentrifuge tube. Crush the band with a pellet pestle until a paste is obtained. Add 200 μl of phenol:chloroform:isoamyl alcohol (PCI) mixture (see

42

Amelia Cervera and Marcos de la Pen˜a

Subheading 2.2) and grind again the slurry with the pestle (see Note 18). Add 200 μl of DNA extraction buffer (0.1 M TrisHCl pH 8.9, 0.5% SDS, 10 mM EDTA). Mix well and centrifuge at 20,000  g for 15 min at room temperature. Transfer 100 μl of the upper aqueous phase to a clean microcentrifuge tube. Add 185 μl of the extraction buffer to the remaining acrylamide slurry and mix well. Repeat the centrifugation step, remove 200 μl of the aqueous phase, and add them to the tube already containing the supernatant of the first centrifugation step. Precipitate the DNA in the supernatant by adding 30 μl of 3 M sodium acetate, pH 5.5, and 825 μl of 100% ethanol. Incubate for at least 1 h at 20  C, and centrifuge the tubes at 20,000  g and 4  C, for 30 min at least. Pour carefully and discard the supernatant. Dry the tubes by leaving them open for 10 min, and resuspend the precipitate in 50 μl of water. 16. If no colonies are obtained, or all of them are blue, try increasing the volume of ligation added to the cells, increasing the ligation time, and increasing the insert to vector molar ratio. 17. Enzymes that produce blunt ends or 50 -overhangs should be preferred over those leaving 30 -overhangs, since the latter increases the probability of an extended transcription. 18. Working with Trizol, PCI mixture, or any other reactive that contains phenol or chloroform requires taking appropriate protective measures and should be performed under a fume hood. 19. Alternatively, transcripts can be purified by ethanol precipitation (Subheading 3.2, step 15), although with a lower yield. 20. Positive strand transcripts can also be used to check the selfcleaving activity of the HHR. Run the transcription in a denaturing urea polyacrylamide gel, and visualize it with ethidium bromide staining. 21. It is advisable to check the concentration of the marker in a denaturing PAGE gel (see Subheading 3.2, steps 16–18) if it is going to be used to quantify the amount of retrozymeRNA in northern blots. The concentration can be calculated by adjusting a regression curve to a serial dilution of a RNA size marker (see Subheading 2.2). 22. Tissues can also be ground in liquid nitrogen with a mortar and pestle and homogenized in the CTAB-RNA buffer with a hand-held homogenizer. 23. If chloroform is added when the samples are still hot it will quickly evaporate, and the build-up of vapor in the tubes can cause them to explode. Make sure that the samples have cooled down at least to room temperature before adding chloroform, and open the tubes a couple of times to allow the fumes evaporate.

Cloning and Detection of Retrozymes

43

24. The protocol may be scaled up or down as needed. 0.1–2 g of tissue usually provide enough RNA for the retrozyme to be detected by northern blot with a DIG probe. 25. The amount of positive strand retrozyme transcript suitable to be used as a marker will depend on the retrozymeRNA concentration of the samples, but it is good advice to start with 5, 10, 50, and 100 pg. 26. The DIG-labeled probe dissolved in hybridization buffer can be stored at 20  C and reused several times. We normally add the whole transcription reaction (1 μg of template) (see Subheading 3.2, step 6) to the hybridization tube. 27. The instructions of the CDP-Star substrate state that the reaction should be carried out in the dark, but we have not seen any difference if this precaution is not taken. 28. For an increased sensitivity, northern blots can be detected with a 32P-labeled radioactive probe [18].

Acknowledgements We wish to thank Marı´a Pedrote for her excellent technical assistance. This work was funded by the Ministerio de Ciencia, Innovacio´n y Universidades of Spain and FEDER (grant BFU201787370-P). References ˜ a M, Garcia-Robles I, Cervera A 1. de la Pen (2017) The hammerhead ribozyme: a long history for a short RNA. Molecules 22(1). https://doi.org/10.3390/ molecules22010078 ˜ a M, Garcia-Robles I (2010) Ubiqui2. de la Pen tous presence of the hammerhead ribozyme motif along the tree of life. RNA 16 (10):1943–1950. https://doi.org/10.1261/ rna.2130310 3. Seehafer C, Kalweit A, Steger G, Graf S, Hammann C (2011) From alpaca to zebrafish: hammerhead ribozymes wherever you look. RNA 17(1):21–26. https://doi.org/10.1261/rna. 2429911 4. Perreault J, Weinberg Z, Roth A, Popescu O, Chartrand P, Ferbeyre G, Breaker RR (2011) Identification of hammerhead ribozymes in all domains of life reveals novel structural variations. PLoS Comput Biol 7(5):e1002031. https://doi.org/10.1371/journal.pcbi. 1002031 ˜a 5. Hammann C, Luptak A, Perreault J, de la Pen M (2012) The ubiquitous hammerhead

ribozyme. RNA 18(5):871–885. https://doi. org/10.1261/rna.031401.111 ˜ a M, Garcia-Robles I (2010) Intronic 6. de la Pen hammerhead ribozymes are ultraconserved in the human genome. EMBO Rep 11 (9):711–716. https://doi.org/10.1038/ embor.2010.100 ˜ a M (2014) Eukaryotic 7. Cervera A, de la Pen penelope-like retroelements encode hammerhead ribozyme motifs. Mol Biol Evol 31 (11):2941–2947. https://doi.org/10.1093/ molbev/msu232 ˜ a M (2016) 8. Cervera A, Urbina D, de la Pen Retrozymes are a unique family of non-autonomous retrotransposons with hammerhead ribozymes that propagate in plants through circular RNAs. Genome Biol 17 (1):135. https://doi.org/10.1186/s13059016-1002-4 ˜ a M, Cervera A (2017) Circular RNAs 9. de la Pen with hammerhead ribozymes encoded in eukaryotic genomes: the enemy at home. RNA Biol 14(8):985–991. https://doi.org/ 10.1080/15476286.2017.1321730

44

Amelia Cervera and Marcos de la Pen˜a

10. Green MR, Sambrook J (2012) Molecular cloning: a laboratory manual, 4th edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY 11. Pallas V, Sanchez-Navarro J, Varga A, Aparicio F, James D (2009) Multiplex polymerase chain reaction (PCR) and real-time multiplex PCR for the simultaneous detection of plant viruses. Methods Mol Biol 508:193–208. https://doi.org/10.1007/ 978-1-59745-062-1_16 12. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K (2003) Current protocols in molecular biology. Wiley, New York 13. Rogers SO, Bendich AJ (1985) Extraction of DNA from milligram amounts of fresh, herbarium and mummified plant tissues. Plant Mol Biol 5(2):69–76. https://doi.org/10.1007/ BF00020088 14. The Addgene Team (2017) Common cloning techniques. Plasmids 101: a desktop resource (3rd Ed.)

15. Sangha JS, Gu K, Kaur J, Yin Z (2010) An improved method for RNA isolation and cDNA library construction from immature seeds of Jatropha curcas L. BMC Res Notes 3:126. https://doi.org/10.1186/17560500-3-126 16. Nohales MA, Molina-Serrano D, Flores R, Daros JA (2012) Involvement of the chloroplastic isoform of tRNA ligase in the replication of viroids belonging to the family Avsunviroidae. J Virol 86(15):8269–8276. https://doi. org/10.1128/JVI.00629-12 17. BioLabs NE (2019) Cleavage close to the end of DNA fragments. https://www.neb.com/ tools-and-resources/usage-guidelines/cleav age-close-to-the-end-of-dna-fragments#chartE. Accessed 25 Feb 2019 18. Kalweit A, Przybilski R, Seehafer C, de la ˜ a M, Hammann C (2012) Characterization Pen of hammerhead ribozyme reactions. Methods Mol Biol 848:5–20. https://doi.org/10. 1007/978-1-61779-545-9_2

Chapter 4 Demonstration of a Ribozyme in Epsilon Domain of Hepatitis B Virus RNA Dibyajnan Chakraborty and Sagarmoy Ghosh Abstract The epsilon domain of Hepatitis B virus plays a crucial role in encapsidation of viral pregenomic RNA and its partial NMR structure has been determined. However, we recently described a potassium-dependent ribonucleolytic activity associated with this region, so that a 53 nt long RNA containing the epsilon domain could release itself and cleaved other RNAs. We describe here the experimental methodologies for setting up the reactions and outline a general strategy for initial demonstration of this self-cleaving ribozyme activity. Key words HBV, Epsilon, Ribozyme, Potassium

1

Introduction Small self-cleaving ribozymes are typically less than 100 nucleotides in length and general acid base catalysis by nucleobases results in nucleolytic cleavage through an in-line SN2 mechanism [1– 3]. Divalent and monovalent cations act to stabilize the active ribozyme conformation without actually taking part in catalysis [4]. The small trans-acting endonucleolytic ribozyme present in the epsilon domain of HBV RNA (HBV-Rz) is unique in its ability to be activated in the physiological potassium ion concentration (150 mM) [5]. Conditions for HBV-Rz assay are similar to the ones already reported for other nucleolytic ribozymes [6–8]. The cation dependence of HBV-Rz was ascertained first among several divalent and monovalent cations over a wide range of concentrations (Fig. 1a). Once the role of potassium was established in the sponsorship of cleavage activity, a thorough analysis was carried out to find the optimum potassium concentration (Fig. 1b). We also described a detail protocol to carry out a temporal analysis of ribozyme activity (Fig. 1c). Since it was established that HBV-Rz could release itself from its neighboring sequences, the protocol for completely

Robert J. Scarborough and Anne Gatignol (eds.), Ribozymes: Methods and Protocols, Methods in Molecular Biology, vol. 2167, https://doi.org/10.1007/978-1-0716-0716-9_4, © Springer Science+Business Media, LLC, part of Springer Nature 2021

45

46

Dibyajnan Chakraborty and Sagarmoy Ghosh

Fig. 1 Potassium induces cleavage in HBV RNA. 50 pg (174 nt) was synthesized in vitro by T7 RNA polymerase. The inserted HBV sequence (154 nt: 1817–1970) contained the 50 end of pgRNA with the ε motif (1847–1907 nt) and non-canonical polyadenylation signal (pA, UAUAAA, 1916–1921 nt). Terminal nucleotides were from the vector pcDNA3.1(+). Location of 32P label in the RNA after radiolabeling is indicated. Radiolabeled GeneRuler™ Ultra low range DNA ladder (Thermo Scientific) was used as size marker. (a) K+ ions at low concentrations elicited cleavage. Other di- or monovalent cations were ineffective. 50 pg was stable in reaction buffer under the conditions of the experiment (lane 1, control). (b) 30 radiolabeled 50 pg was cleaved upon incubation with KCl and

Nucleolytic Ribozyme Activity in HBV RNA

47

obliterating release of HBV-Rz by annealing the scissile sites with oligodeoxyribonucleotides is also included (Fig. 2a). Moreover, when added externally, the ribozyme cleaved RNAs of both HBV and non-HBV origins with equal efficiency. A protocol for demonstration of this trans activity is included (Fig. 2b).

Fig. 2 (a) Cleavage is susceptible to alterations in 50 pg. Interference binding to 50 pg by the deoxyoligonucleotides complementary to the boundaries of the central region (1685-1918 nt) blocked KCl activated cleavage. The cartoon depicts a Mfold generated structure of 50 pg with the 1850–1870 nt region in red and 1900–1920 nt region in blue against which the primers were targeted. (b) HBV-Rz can act in trans to cleave other RNAs. A [α-32P]UTP-labeled RNA substrate (substrate P2) was degraded in presence of 150 mM KCl by exogenously added 1865–1918 nt region of HBV (HBV-Rz). An RNA with antisense sequence to HBV-Rz (HBV-Rzas) was inactive. Addition of 50 pgmut where release of HBV-Rz was blocked by mutating U1916/U1918, also could not degrade substrate P2. In control lane, substrate P2 did not receive any external RNA ä Fig. 1 (continued) scissile sites varied with KCl concentrations. (c) Temporal analysis showed that 30 radiolabeled 50 pg was initially processed into two major cleavage products, (approximately 60 nt from 30 end) which were also subsequently degraded

48

Dibyajnan Chakraborty and Sagarmoy Ghosh

The experimental protocol described here should make it facile for any researcher to attempt a nucleolytic ribozyme assay and subsequent investigation on any ribozyme of his/her choice, not limited to HBV-Rz alone.

2

Materials All reagents are prepared with ultrapure water, showing 18.2 MΩ-cm resistivity at 25  C. Reagents are generally prepared and stored at room temperature, unless otherwise indicated (see Note 1). While disposing waste materials, regulatory guidelines should be strictly adhered to.

2.1 Gel Running Solution and Diluents

To maintain the uniformity and the reproducibility of the gels, a stock solution of acrylamide [30% acrylamide: bis-acrylamide (19:1) solution, 8 M urea, 0.5 TBE] and diluent (8 M urea, 0.5 TBE) should be prepared (see Note 2). 1. Acrylamide stock: Add 50 ml of deionized water to a clean and dry 1000 ml beaker and place a magnetic bar inside. Weigh 114 g acrylamide and 6 g bis-acrylamide (both molecular biology grade) and pour into the beaker against gentle stirring over a magnetic base. Take precautions while weighing acrylamide, a neurotoxin. Weigh 192.19 g urea (molecular biology grade), add to the beaker. Add 40 ml of 5 TBE and approximately 100 ml of deionized water. Remove the magnetic bar. Place the beaker in a microwave oven, heat for 2 min at 800 W power. After every minute, take the beaker out of the microwave and shake to mix the solutions. After 5 min, mix the solution using a magnetic stirrer until the salts are solubilized completely. Transfer the solution into a fresh glass measuring cylinder and top up with deionized water to 400 ml. Mix by magnetic stirrer for another 5 min and filter the solution through Whatman No. 1 filter paper (see Note 3). Transfer the solution to a clean and dry amber glass bottle, wrap the bottle with aluminium foil if amber bottle is unavailable, to protect from light. 2. Preparation of diluents: Measure 40 ml of 5 TBE and transfer to a 1000 ml glass beaker with a magnetic bar. Weigh 192.19 g urea (molecular biology grade) and mix over a magnetic base. Add approximately 150 ml of deionized water, remove the magnetic bar, and warm the contents using a microwave oven at 800 W power for 2–3 min. Mix the solution until the urea is solubilized completely using a magnetic stirrer. Transfer the solution to a glass measuring cylinder and top up the volume to 400 ml using deionized water and mix for another 2–3 min. Filter through Whatman No. 1 filter paper, transfer to an amber glass bottle.

Nucleolytic Ribozyme Activity in HBV RNA

49

3. Gel running buffer (5 TBE): Take a 1000 ml graduated glass beaker with a magnetic bar and add approximately 50 ml of deionized water. Weigh 54 g Tris base (FW ¼ 121.14) and 27.5 g boric acid (FW ¼ 61.83), pour into the beaker. Add 600 ml deionized water and allow to mix at room temperature using magnetic stirrer. Once the solids are solubilized completely, add 20 ml of 0.5 M EDTA (pH 8.0). Transfer the solution to a 1000 ml glass measuring cylinder and top up the volume to 1000 ml by adding deionized water. Allow the solution to mix for another few minutes using magnetic stirrer and filter using Whatman No. 1 filter paper. Store in a glass bottle. 4. 10% ammonium persulfate. 5. N,N,N0 ,N0 -tetramethylethane-1,2-diamine (TEMED). 6. Sequencing gel apparatus and power supply. 7. Gel dryer. 8. Phosphorimager. 2.2 In Vitro Transcription and Purification of Synthesized RNA

1. 5 transcription buffer: 200 mM Tris-HCl (pH 8.0), 40 mM MgCl2, 10 mM spermidine, 125 mM NaCl. 2. 10 mM NTP mix: 10 mM each of rATP, rUTP, rGTP, rCTP. 3. RNase inhibitor: 40 U/μl. 4. Linearized template: DNA template with the T7 polymerase promoter followed by the sequence of the RNA that you want to express. 5. T7 RNA polymerase. 6. 2 RNA gel loading dye: 0.025% xylene cyanol, 95% formamide. 7. Ethidium bromide solution. 8. 2-mercaptoethanol. 9. 10 M ammonium acetate. 10. Absolute alcohol.

2.3 30 End Labeling and Purification of RNA

1. Klenow fragment, exo. 2. 30 end specific antisense primer: aagaattcAGAAGTCAGAA GGCAAA. 3. 10 reaction buffer: 50 mM Tris-HCl (pH 8.0), 5 mM MgCl2, 1 mM DTT. 4. [α-32P]dCTP (10 μCi/μl). 5. β-mercaptoethanol. 6. Liquid scintillation counter.

50

Dibyajnan Chakraborty and Sagarmoy Ghosh

2.4 Ribozyme Activity Characterization

1. 100 mM Tris-HCl, pH 7.0. 2. 1 M KCl. 3. Lyophilized antisense oligonucleotides. 4. [α-32P]UTP.

3

Methods

3.1 Gel Electrophoresis and Imaging

1. Take a sequencing gel apparatus and rinse the glass plates thoroughly with absolute alcohol. Rinse one side of each glass plate with 15% dichlorodimethylsilane in chloroform, rinse again with alcohol. Assemble the glass plates using a 0.5 mm spacer. Place the casting tray on a horizontal surface ascertained by a spirit level. Take a clean and dry 50 ml beaker, add appropriate amount of acrylamide stock and diluent solutions for a final volume of 30 ml as shown in Table 1. Mix properly by rotating the beaker and add 80 μl of 10% ammonium persulfate and 10 μl of TEMED, mix immediately. Pour into the gel assembly and allow the acrylamide to crosslink for 30 min at room temperature. Remove the comb and place the gel in the running apparatus. Add 0.5 TBE to the upper and lower buffer chambers. Always equilibrate the gel with a pre-run for 30 min and before loading, clean the lanes by flushing them with buffers through a 10 ml syringe fitted with a 22G needle (see Note 3). Start electrophoresis at a constant volt difference of 300 V and allow electrophoresis for 60 min.

Table 1 The percentage of acrylamide concentration in the gel could be varied by changing the acrylamide and diluent volumes Required volumes of stock acrylamide and diluent for different concentrations of acrylamide-8 M urea gel Desired acrylamide concentration

Volume of acrylamide (ml)

Volume of diluent (ml)

Gel volume (ml)

6%

6

24

30

8%

8

22

30

10%

10

20

30

12%

12

18

30

15%

15

15

30

20%

20

10

30

Nucleolytic Ribozyme Activity in HBV RNA

51

2. Carefully remove the notched glass plate from the assembly and place the rectangular plate under tap water for few seconds, drain out residual water from the gel surface (see Note 4). Place a 3 MM Whatman filter paper on top of the gel and press gently, carefully pull the Whatman paper, so that the gel comes evenly with the paper. Put the assembly in a gel dryer, cover the gel surface with a cling wrap carefully (see Note 5). Allow the gel to dry for 45 min at 80  C under vacuum and expose to phosphorimager screen for 16 h. 3.2 In Vitro Transcription and Purification of Synthesized RNA

1. Thaw frozen 5 transcription buffer and 10 mM NTP mix by placing in ice. Briefly vortex the thawed reagents and centrifuge briefly at room temperature. 2. Take 500 ng of linearized template in a micro centrifuge tube (1.5 ml), add 4 μl of 5 transcription buffer, mix by tapping. Add 4 μl of 10 mM NTP mix and 0.5 μl of RNase Inhibitor, tap to mix the solution. Make up the volume of the reaction mix with nuclease-free water to 19 μl. 3. Add 1 μl of T7 RNA polymerase (20 U) and tap mix the solution carefully. Briefly centrifuge at room temperature and place the microfuge tube in a floater and incubate at 37  C water bath for 2 h (see Note 6). 4. Add equal volume (20 μl) of 2 RNA gel loading dye to the in vitro transcription reaction mix and vortex vigorously to mix the loading dye, centrifuge briefly. Incubate at 95  C in a heat block for 10 min and chill immediately by placing in ice. 5. Use 6% polyacrylamide gels for purification of in vitro synthesized RNA (see Subheading 3.1, step 1). Load 38 μl in one lane and load remaining 2 μl reaction mix in another lane, leaving 2 lanes in between. Load 2 μl of 2 loading dye in all remaining lanes. Start electrophoresis at constant current of 40 mA. Continue electrophoresis till the xylene cyanol reaches the bottom of the gel. 6. Remove the gel casting apparatus out of the running chamber and carefully remove the notched plates keeping the gel intact. Do not remove the square glass plate from the gel and place a metal scale vertically between the lanes where samples were loaded. Cut the gel using a sharp scalpel and remove the gel slice containing 2 μl reaction mix. 7. Place the gel slice from step 6 in a plastic tray containing 5 μg/ ml ethidium bromide in 0.5 TBE buffer and put the other slice of the gel in 0.5 TBE buffer. Incubate at room temperature for 15 min. Place the gel slice from the ethidium bromide solution on a transilluminator and mark the RNA band. Place this gel on a clean and dry surface, place a glass plate on top of

52

Dibyajnan Chakraborty and Sagarmoy Ghosh

the gel slice. Remove the gel slice from 0.5 TBE buffer, place on the glass plate, confirm exact position by matching top and bottom edges. 8. Excise the RNA containing the gel part corresponding to the RNA band marked in step 7. Chop the gel slice in small pieces using a sterile scalpel and collect in a microfuge tube. Add 300 μl nuclease-free water and 100 μl 2-mercaptoethanol, vortex vigorously. Place the tube at 70  C for 2 h. 9. Centrifuge the tube at 10,000  g for 5 min at room temperature (see Note 7). Collect the supernatant in a fresh tube, and deproteinize twice by chloroform extraction at room temperature (25  C). 10. Collect the aqueous phase after chloroform extraction in fresh 1.5 ml microfuge tube. Add 1/10th volume of 10 M ammonium acetate, 3 volume absolute alcohol and vortex vigorously. Store at 20  C for 30 min and centrifuge at 14,000  g at 4  C for 10 min. Carefully remove the supernatant, add 70% alcohol (chilled) and vortex the tube. Centrifuge again at the same condition and aspirate the supernatant carefully leaving the pellet intact. Allow the pellet to dry at room temperature, add 30 μl nuclease-free water, vortex vigorously. Keep the gel purified RNA at 20  C. 3.3 Quantification of Gel Purified RNA

1. Cast a 6% polyacrylamide-8 M urea gel (see Subheading 3.1, step 1) and electrophorese 2 μl of gel purified RNA at 40 mA fixed current for 30 min. Run 100 ng of 100 bp DNA ladder in another lane. After electrophoresis, stain the gel with ethidium bromide (see Subheading 3.2, step 7) and visualize RNA on transilluminator to check its integrity and quantity. 2. Compare band intensity of the purified RNA with a similar sized DNA band of the ladder to estimate the RNA amount. Keep in mind that DNA is double-stranded, so that DNA and RNA bands of similar size showing similar ethidium bromide fluorescence would mean RNA present is double the amount of DNA.

3.4 30 End Labeling and Purification of RNA

1. RNA synthesized in vitro can be 30 end-labeled using primer hybridization base extension method [9]. Incubate the gel purified 50 pg RNA (1817–1970 nucleotide positions of HBV genome) with Klenow fragment, exo in presence of a 30 end specific antisense primer with a non-complementary aag at its 50 end (aagaattcAGAAGTCAGAAGGCAAA; complementarity with 30 end of 50 pg RNA is denoted in italics with HBV-specific sequence capitalized, for details see [5]). Annealing of this primer with 50 pg RNA allows template-dependent incorporation of a dCTP residue at the 30 end of 50 pg by Klenow polymerase.

Nucleolytic Ribozyme Activity in HBV RNA

53

2. Take 200 ng of gel purified RNA in a fresh microfuge tube (1.5 ml) and add 1 μl of antisense primer (40 pmol/μl), 2 μl of 10 reaction buffer (50 mM Tris-HCl (pH 8.0), 5 mM MgCl2, 1 mM DTT). Add 4 μl [α-32P]dCTP (10 μCi/μl) and adjust reaction volume to 19 μl using nuclease-free water. Tap the tube gently to mix all the components. Add 1 μl Klenow polymerase, exo (10 u). Tap mix and centrifuge the reaction tube briefly and incubate at 37  C in a water bath for 16 h. 3. Follow steps in Subheading 3.1. Keep the gel on the square glass plate. Place the square plate and gel assembly on a clean and fresh cling film. Cover the gel and glass plate with film properly, so that no residual buffer and/or gel piece can come out of the wrap. Place the wrapped gel assembly in an X-ray cassette keeping the gel upwards and place a phosphor screen on the top of the gel (phosphor screen should face the gel). 4. Expose the phosphor screen for 15 s (strictly maintain the time) and scan the full area of the phosphor screen in Phosphorimager (see Note 8). Measure the gel height and width and open the phosphorimager scan file in Adobe Photoshop®. Crop the gel picture from lane to end, and while cropping, fix the height of the gel as measured. Take a print of the cropped gel picture. 5. Place the cling wrapped gel assembly on top of the printed page, align the actual gel height with the print. Cut the labeled RNA band by a sharp scalpel, and remove the cling wrap from the excised gel slice. 6. Place the excised gel slice in a microfuge tube, crush properly using micro tip (20–200 μl). Add 400 μl of nuclease-free water and 100 μl of β-mercaptoethanol. Vortex vigorously and place the tube at 65  C for 2 h with vortexing at every 15 min interval. After completion of incubation, centrifuge at 10,000  g for 5 min at 4  C. 7. Carefully collect 400 μl supernatant leaving the gel pieces in pellet. Transfer the supernatant to a fresh tube and centrifuge again at 10,000  g for 5 min at room temperature. Aspirate 350 μl supernatant in another fresh tube. Add 350 μl chloroform and mix vigorously by continuous vortexing for at least 30 s. Centrifuge at 10,000  g for 5 min at room temperature. 8. Carefully transfer the aqueous phase (300 μl) in a fresh microfuge tube. Extract again with chloroform (300 μl). Collect 250 μl of aqueous phase very carefully. 9. Add 25 μl of 10 M ammonium acetate and 750 μl of absolute alcohol. Vortex to mix and keep at 20  C for 30 min. Centrifuge the sample at 14,000  g for 10 min at 4  C. Remove the

54

Dibyajnan Chakraborty and Sagarmoy Ghosh

supernatant by decanting and wash the RNA pellet twice with chilled 70% ethanol. Aspirate the residual alcohol from the pellet by micro pipette and allow the pellet to air-dry for 15 min. 10. Dissolve the pellet in 40 μl of nuclease-free water and quantify in liquid scintillation counter. 3.5 Ribozyme Self-Cleavage in Different Cations at a Range of Concentrations (Fig. 1a)

1. We prefer addition of equal volume of stock solution to every tube. For example, for ten reaction tubes, take 20,000 cpm of 30 end-labeled RNA in a fresh tube, 10 μl 100 mM Tris-HCl, pH 7.0 followed by required amount of nuclease-free water to make 90 μl. Mix well by tapping the tube and place in ice. 2. Mark 1.5 ml microfuge tubes according to the salts and their different concentrations to be tested. Prepare salt solutions at 10 strength and dispense 1 μl to the designated tube for 10 μl reaction in each tube. 3. Add 9 μl of the ice stored reaction mix from step 1 (containing 30 end-labeled RNA) in each and every tube, mix well and centrifuge briefly. Incubate the tubes at 37  C for 3 h. 4. Add 10 μl 2 RNA gel loading dye in each tube to stop the reaction, incubate at 95  C for 10 min and place immediately in ice and keep for 2 min. Centrifuge the tubes briefly to collect the reaction mix at the bottom of the tube and follow the steps in Subheading 3.1 for electrophoresis.

3.6 Determination of Optimum Potassium Ion Concentration for Ribozyme Activity (Fig. 1b)

1. Individually mark microfuge tubes (1.5 ml) depending on the number of potassium concentrations to be tested. 2. Prepare stock solutions of KCl in nuclease-free water and further sterilize the solution by passing through 0.2 μm syringe filter. 3. We prefer making a master mix of 30 end-labeled RNA in buffer and dispense from there for every reaction. For every reaction tube, take 2000 cpm of 30 end-labeled RNA and 1 μl of 100 mM Tris-HCl, pH 7.0 buffer. Mix by tapping and centrifuge briefly to collect the solutions at the bottom of the tube. 4. Distribute evenly to each tube and add KCl stock solutions and nuclease-free water at different tubes to a final volume of 10 μl. Mix the solutions by gentle vortexing and centrifuge briefly to collect all the solutions at the bottom of the tube. Incubate all the tubes at 37  C for 180 min. 5. Follow steps described in Subheading 3.1 for electrophoresis. 1. Take required number of microfuge tubes. Prepare a master reaction mix taking 2000 cpm of 30 end-labeled RNA, 1 μl of 100 mM Tris-HCl, pH 7.0 buffer, requisite volume of

Nucleolytic Ribozyme Activity in HBV RNA

3.7 Temporal Effect of Potassium on Ribozyme Activity (Fig. 1c)

55

nuclease-free water and 1.5 μl 1 M KCl, per reaction tube. Mix by pipetting the solution a few times and centrifuge briefly to collect the solutions at the bottom of the tube. Place all the tubes in ice. Add ice cold 10 μl 2 RNA gel loading dye in the tube marked as 0 min. Distribute 10 μl aliquots of the reaction mix in each of the remaining tubes starting from tube marked 180 min, end with the tube marked 1 min. Immediately aliquot 10 μl of the reaction mix in the tube labeled 0 min and incubate at 95  C for 10 min. Put other tubes in a 37 ºC water bath. 2. Collect the tubes after marked time from the water bath, add 2 RNA gel loading dye and incubate at 95  C for 10 min. After heat incubation, keep the tubes at 20  C immediately. After processing of the last time point, place all the 20  C stored tubes at room temperature. 3. Allow the contents in the tube to thaw, centrifuge all tubes at 10,000  g for 30 s. Fractionate on 8% acrylamide-8 M urea gel as in Subheading 3.1.

3.8 Inhibition of Cleavage by Antisense Oligonucleotide (Fig. 2a)

1. Antisense oligonucleotides can be designed against ribozyme sequences. For example, design antisense oligonucleotides against HBV sequence positions 1900–1920 and 1850–1870 to inhibit the initial cleavage sites. Lyophilized oligos were dissolved in nuclease-free water at a final concentration of 100 pmol/μl (see Note 8). 2. Take two microfuge tubes and mark them appropriately alongside a positive control tube, which receives no oligonucleotide. In a separate tube, prepare a mix containing 3 μl of 100 mM Tris-HCl, pH 7.0 buffer and 9 μl nuclease-free water. To this, add 800 cpm 30 end-labeled RNA (approximately 8 μl) from Subheading 3.4. Mix by tapping, and centrifuge briefly to collect the contents at the bottom of the tube. 3. Distribute 6.5 μl of the reaction mix in each labeled tube. Add 2 μl of the oligo in appropriately marked tubes. Add 2 μl of nuclease-free water in control tube. Mix the solutions by vortexing and keep at room temperature for 5 min. Add 1.5 μl of 1 M KCl in each tube, mix by tapping, and incubate at 37  C for 30 min. After completion of the reaction, add 10 μl of 2 RNA gel loading dye. 4. Follow the steps in Subheading 3.1 for gel electrophoresis and phosphorimaging.

3.9 Trans Cleavage Reaction by HBV-Rz (Fig. 2b)

1. Prepare [α-32P]UTP-labeled substrateRNA P2: For example, we cloned the 1919–1970 nucleotide region of the HBV genome (NCBI accession no.: AY945307) under control of the T7 RNA polymerase promoter. Linearize the plasmid DNA

56

Dibyajnan Chakraborty and Sagarmoy Ghosh

by digestion with an appropriate restriction enzyme (for example, EcoRI) and transcribe in vitro using T7 RNA polymerase in the presence of [α-32P]UTP. Purify and quantify RNA from a 6% acrylamide-8 M urea gel as in Subheading 3.4. 2. Prepare ribozyme RNA: For example, in the case of the HBVRz RNA, we PCR amplified 1865–1918 nucleotides of the HBV genome keeping a T7 RNA polymerase promoter at the 50 end of the 50 end specific primer. The PCR product was gel purified and used as a template for in vitro transcription using T7 RNA polymerase. Synthesized RNA was purified and quantified as in Subheading 3.4. 3. Prepare of antisense (as) ribozyme RNA: For example, in the case of the HBVRzasRNA, we PCR amplified 1865–1918 nucleotide coordinate of HBV genome with a 30 end specific primer containing a T7 RNA polymerase promoter sequence at its 50 end. Synthesized RNA was purified and quantified as in Subheading 3.4. 4. Preparation of mutated (mut) 50 pgmutRNA: For example in the case of HBV ribozyme, the 50 pg region (1817–1970 nucleotide positions of HBV genome) was amplified in two separate but overlapping pieces. Targeted base changes were introduced while designing the reverse primer of the upstream region and forward primer of the downstream region, so that these sequences overlapped each other. Annealing of these regions followed by PCR with primers binding to other flanks produced 1817–1970 region with two targeted mutations at 1916 and 1918 base positions. Re-amplify this template with a forward primer with T7 RNA polymerase promoter and a reverse primer designed against HBV nucleotide position 1950–1970. Purify the amplified PCR product and use it as template for in vitro transcription. Purify the transcribed RNA as in Subheading 3.4. 5. Reaction setup: Mark microfuge tubes, for example we have tubes for control, HBV-Rz, HBV-Rzas, and 50 pgmut. Place them in ice while setting up the reaction. Dispense 1 pmol (50 ng) of HBV-Rz, HBV-Rzas, 50 pgmutRNA in the appropriately labeled tube, and make the total volume to 4 μl by adding nuclease-free water in each tube. Add 4 μl of nuclease-free water in the tube marked as control. 6. In another tube, prepare the reaction mix with 1000 cpm [α-32P]UTP-labeled P2 RNA from step 1 (approximately 10 μl), 5 μl 100 mM Tris-HCl, pH 7.0 buffer, 7.5 μl nuclease-free water, and 7.5 μl of 1 M KCl, and tap mix the reaction immediately. Aliquot 6 μl of the reaction mix in each marked tube, mix and incubate at 37  C in a water bath for 15 min.

Nucleolytic Ribozyme Activity in HBV RNA

57

7. After completion of reaction, add 10 μl ice cold 2 RNA gel loading dye, run the reaction products in 15% acrylamide-8 M urea gel as described in Subheading 3.1.

4

Notes 1. General suggestions while making solutions: Always pour some water in the beaker before addition of solids to aid in faster dissolution. While adding water, never rely on the graduation of the beaker, use glass measuring cylinder only. If possible, rinse the measuring cylinder with 15% dichlorodimethylsilane. Rinse twice with chloroform followed by deionized water. This will help to not retain any residual amount of water in the cylinder. 2. Strictly keep the gel buffers and acrylamide stock solutions at room temperature. As they contain high concentrations of salts and urea, a little decrease in storage temperature will result in salting out of the solutes. If the salts get precipitated, warm the bottle either in microwave oven or by placing in a hot water bath to dissolve the salts completely. 3. Change the filter paper after every 200 ml of solution or else filter under vacuum. During casting of thin gels (0.5 mm) described here, removal of comb should be done with utmost care. While removing the comb, the lanes may tear. Rinse the comb teeth properly with 15% dichlorodimethylsilane, followed by chloroform before use. After crosslinking, residual amount of unpolymerized acrylamide and urea will still remain in the lane. If not cleaned properly, this may hamper the loading and subsequent migration of the sample. The wells should be meticulously flushed by buffer passed through a 22G needle fitted to a 10 ml syringe. The removal of residual urea and acrylamide should be visible while cleaning the lanes. Immediately after cleaning, load the samples. In our experience, this step is the most vital in getting a perfect gel in terms of sharpness and migration of the bands. 4. While removing the glass plates, if required, immerse the gel assembly in deionized water for few seconds. This will help to remove the notched plate easily. If the gel remains stuck with the glass plate, carefully dislodge a small part of the gel from the glass plate and flush deionized water on that region. This will help to remove glass plates more easily without damaging the gel. 5. Gel drying is an extremely important and sensitive step. After you place the gel on Whatman paper on the dryer, carefully lay a cling wrap over it making sure its ends do not extend over the boundary of the dryer area. Any protruding film hanging out

58

Dibyajnan Chakraborty and Sagarmoy Ghosh

will prevent the vacuum seal during drying. Cover the gel assembly with diaphragm and start the vacuum pump. Once the pump is on for a minute and a proper vacuum seal is ensured, start the heater set at 80  C with a preset drying time. Drying time should be standardized as under- and overdrying both can crack the gel and we generally wait for 10 min after the heater is turned off before taking the gel out of the dryer. When drying is complete, release vacuum by removing the diaphragm from one end and at the very last, turn off the vacuum pump. 6. As the water used in the bath is a potential source of nuclease contaminating aerosol, maintain a good distance of the tube head from the water level. Preferably, seal the tube with parafilm. 7. While isolating RNA from acrylamide gel, a residual amount of acrylamide may remain with RNA which may inhibit further downstream application. Before proceeding with the purified RNA, always centrifuge at 10,000  g for 5 min to precipitate remaining acrylamide. Carefully aspirate the RNA present in supernatant without disturbing the pellet. 8. Longer incubation of the radiolabeled gel will overexpose the screen, resulting in a dark impression of the whole gel. Overexposure will preclude identification of the specific RNA band. After every purification, extensively bleach the phosphor screen with extended time. If any buffer contaminates the screen from wrapped gel, a permanent spot on the screen will appear. When such a thing happens, clean the phosphor screen with 10 mM phosphate buffer and expose overnight to make sure your phosphor screen is absolutely clean. Repeat this step till you get a perfectly clean phosphor screen. While working with the oligonucleotides, first centrifuge the tube to collect the lyophilized DNA at the bottom. Follow manufacturer’s instruction to prepare 100 pmol/μl stock solution. After addition of nuclease-free water, vigorously vortex the tube at least for 5 min. Centrifuge briefly to collect the contents at bottom of the tube. Vortex again for another 5 min, followed by brief centrifugation before using the oligonucleotide.

Acknowledgments S.G. acknowledges partial support of this work by Department of Science and Technology (Government of India) grant no. SR/FT/ L-100/2004. Department of Biotechnology-BUILDER facility in University of Calcutta was used for Phosphorimager analysis. D.C. was supported by research fellowships from CSIR (9/28(664)/ 2006 EMR-I) and DBT (BT/01/CEIB/09/VI/10), Govt. of India.

Nucleolytic Ribozyme Activity in HBV RNA

59

References 1. Cochrane JC, Strobel SA (2008) Catalytic strategies of self-cleaving ribozymes. Acc Chem Res 41:1027–1035. https://doi.org/10.1021/ ar800050c 2. Lilley DMJ (2011) Catalysis by the nucleolytic ribozymes. Biochem Soc Trans 39:641–646. https://doi.org/10.1042/BST0390641 3. Lilley DMJ (2011) Mechanisms of RNA catalysis. Philos Trans R Soc B Biol Sci 366:2910–2917. https://doi.org/10.1098/ rstb.2011.0132 4. Fedor MJ (2009) Comparative enzymology and structural biology of RNA self-cleavage. Annu Rev Biophys 38:271–299. https://doi.org/10. 1146/annurev.biophys.050708.133710 5. Chakraborty D, Ghosh S (2017) The epsilon motif of hepatitis B virus RNA exhibits a potassium-dependent ribonucleolytic activity.

FEBS J 284:1184–1203. https://doi.org/10. 1111/febs.14050 6. Wu HN, Lin YJ, Lin FP et al (1989) Human hepatitis delta virus RNA subfragments contain an autocleavage activity. Proc Natl Acad Sci U S A 86:1831–1835. https://doi.org/10.1073/ pnas.86.6.1831 7. Uhlenbeck OC (1987) A small catalytic oligoribonucleotide. Nature 328:596–600. https:// doi.org/10.1038/328596a0 8. Nesbitt S, Hegg LA, Fedor MJ (1997) An unusual pH-independent and metal-ion-independent mechanism for hairpin ribozyme catalysis. Chem Biol 4:619–630. https://doi.org/10. 1016/S1074-5521(97)90247-7 9. Huang Z, Szostak JW (1996) A simple method for 30 -labeling of RNA. Nucleic Acids Res 24:4360–4361. https://doi.org/10.1093/ nar/24.21.4360

Chapter 5 In Vitro Selection of Varkud Satellite Ribozyme Variants that Cleave a Modified Stem-Loop Substrate Pierre Dagenais and Pascale Legault Abstract In vitro selection is an established approach to create artificial ribozymes with defined activities or to modify the properties of naturally occurring ribozymes. For the Varkud satellite ribozyme of Neurospora, an in vitro selection protocol based on its phosphodiester bond cleavage activity has not been previously reported. Here, we describe a simple protocol for cleavage-based in vitro selection that we recently used to identify variants of the Varkud satellite ribozyme able to target and cleave a non-natural stem-loop substrate derived from the HIV-1 TAR RNA. It allows quick selection of active ribozyme variants from the transcription reaction based on the size of the self-cleavage product without the need for RNA labeling. This results in a streamlined procedure that is easily adaptable to engineer ribozymes with new activities. Key words In vitro selection, Varkud satellite ribozyme, Stem-loop substrate, Ribozyme engineering, HIV-1 TAR RNA

1

Introduction In vitro selection is an extremely powerful approach that has been applied to the field of ribozyme engineering to create RNA molecules with new enzymatic activities. In vitro selection schemes have allowed both de novo design of artificial ribozymes with defined activities and modification of known ribozymes to impart them with new activities [1–4]. These new activities are diverse and range from simple phosphodiester bond cleavage or ligation reactions, to RNA sequence editing [5, 6], gain or loss of cofactor activity [7], gain of allosteric regulation [8–10], activity rate enhancements [11], and change in substrate specificity [12, 13]. With the growing interest in ribozyme engineering, there is a need for fast and simple selection schemes that allow the discovery of new activities. The Varkud satellite (VS) ribozyme of Neurospora is a selfcleaving and self-ligating RNA molecule that has been extensively investigated, both mechanistically and structurally [14–16].

Robert J. Scarborough and Anne Gatignol (eds.), Ribozymes: Methods and Protocols, Methods in Molecular Biology, vol. 2167, https://doi.org/10.1007/978-1-0716-0716-9_5, © Springer Science+Business Media, LLC, part of Springer Nature 2021

61

62

Pierre Dagenais and Pascale Legault

However, only a few in vitro selection protocols have been established for this ribozyme. Several years ago, two ligation-based in vitro selections were described: the first one aimed to define the sequence and structural requirements for the stem-loop I substrate of the natural ribozyme [17], whereas the second one was designed to identify an extended ribozyme with a truncated helix VII that could ligate with greater efficiency [18]. More recently, we designed an in vitro selection protocol based on the cleavage reaction to identify variants of the Varkud satellite ribozyme with new substrate specificity [19]. A simple and fast selection scheme was developed to accelerate the discovery process. Here, we describe this streamlined, cleavage-based protocol for in vitro selection of VS ribozyme variants that can specifically recognize and cleave a modified substrate. Active ribozyme variants are selected directly from the transcription reaction by denaturing polyacrylamide gel electrophoresis (dPAGE) without the need for labeling the RNA, and each selection round can be performed in less than 3 days. This protocol was previously used to identify VS ribozyme variants that recognize and cleave a modified stem-loop I (SLI) substrate containing the apical stem-loop region of the HIV-1 transactivation response element (TAR), while preserving the natural G638 loop required for the formation of the active site (Fig. 1a; [19]). To explore ribozyme sequences that could cleave this TAR-derived SLI substrate, part of the stem-loop V (SLV) sequence of the initial RNA library was replaced by a stretch of ten randomized nucleotides, thus creating a library of 410 different sequences (Fig. 1a). The selection scheme was devised to select ribozyme variants that allow for efficient self-cleavage via formation of a kissing-loop interaction (KLI) between SLV and the modified SLI substrate, since efficient cleavage in the VS ribozyme depends on the formation of a stable I/V kissing-loop interaction [20– 23]. In fact, selection conditions were optimized to allow cleavage of a positive control ribozyme that can form a stable I/V kissingloop interaction (Fig. 1b) and minimize cleavage of a negative control ribozyme in which this interaction is disrupted (Fig. 1c). The in vitro selection protocol starts with the amplification of the initial DNA library by polymerase chain reaction (PCR), followed by phenol-chloroform extractions, in vitro transcription, dPAGE purification of the active ribozyme variants, reverse transcription (RT) and PCR to yield a new DNA library for the next round of selection (Fig. 1d). After several rounds of in vitro selection, next-generation sequencing of the enriched library is performed as spike-in mixtures. Finally, simple bioinformatics tools can be used to analyze the large dataset and find consensus sequences. This protocol can be adapted to engineer other ribozymes with new activities, provided that the cleaved active ribozyme variants differ in size from the initial ribozyme pool.

Streamlined in Vitro Selection of the VS Ribozyme

A

TAR-derived substrate 630

5'- PBS

G U C C G A G A A G 620 A G A C G

3'-

B

I/V kissing-loop interaction IV

G

690

V

SLV

G NNN N U G GA CG G U C G U A G C A N with A U G C C U GC C G U A U U G U N N N N N randomized C Ib loop C 710 U G 670 U 700 U U UA C C G G III C G A A U U 640 A 660 C G C Ia U A 720 II VI U 730 650 740 C G G A A AA A C G G U A U U G G CU U A A A G C A A G C G GG A GCU GU G PBS G C G U U C G C C C G A A C A C G A C A CG CGU U A U G A C UG GC A 770 750 760

D

Positive control

63

C Negative control

A G C A GU U G A UU G U C A U C

A G C A G UU C G UU G U C A U U

SLV

SLV loop mutant

C U A C G G G A A G C G U C

G

C U A C G G G A A G C G U C

U C G G C C C G A G C G G

G

U C G G C C C G A G C G G

SLI

SLI

Initial dsDNA library Sequencing and evaluation

dsDNA library (enriched pool)

In vitro transcription (low [Mg2+])

In vitro selection rounds Amplification (RT-PCR)

G U C C G A G A 5'- A

3'-

G

IV

V

G NNN N U G GA CG G U C G U A G C A N A U G C C U GC C G U A U U G U N N N N N C Ib UG C U U U UA C C G G III C G A A U U A C G C Ia U A II VI U C G G A A AA A C G G U A U U G G CU U A A A G C A A G C G GG A GCU GU G PBS G C G U U C G C C C G A A C A C G A C A CG CGU U A U G A C UG GC A

Selection of active RNA molecules (cleaved ribozyme by dPAGE)

5'- PBS

G U C C G A G A A G A G A C G

3'-

G

IV

V

G NNN N U G GA CG G U C G U A G C A N A U G C C U GC C G U A U U G U N N N N N C Ib UG C U A U U U C C G G III C G A A U U A C G C Ia U A II VI U C G G A A AA A C G G U A U U G G CU U A A A G C A A G C G GG A GCU GU G PBS G C G U U C G C C C G A A C A C G A C A CG CGU U A U G A C UG GC A

RNA Library

Cleavage reaction (addition of Mg2+)

Fig. 1 In vitro selection of a TAR-derived VS ribozyme library. (a) Primary and secondary structures of the VS ribozyme library previously used for in vitro selection [19]. The 50 -primer binding sequence (PBS) is composed of a 20-nt sequence (50 -GGC ACA GCA CAU AUG ACA UG-30 ) and the 30 -PBS is composed of an 18-nt sequence (50 -ACA GUG CAG GCA UCU UGG-30 ). The randomized nucleotides in SLV are represented by the letter N. The specific cleavage site is located between G620 and A621 (black circle). (b, c) Regions that were modified in the sequence shown in (a) to create (b) an active VS ribozyme (positive control) and (c) a VS ribozyme in which the KLI is disrupted by mutations of the SLV loop (negative control). (d) Workflow of the in vitro selection

2

Materials Prepare all solutions with milliQ-water and analytical grade reagents under strict RNase-free conditions. Sterilize all solutions either by autoclaving or filtering using a 0.22-μm filter.

64

Pierre Dagenais and Pascale Legault

2.1 Amplification of the Initial Single-Stranded DNA (ssDNA) Library by PCR

All DNA sequences are obtained from a trusted DNA synthesis provider. 1. Forward primer P1: 50 -TAA TAC GAC TCA CTA TAG GCA CAG CAC ATA TGA CAT GCA GAG AAG AG-30 . 2. Reverse primer: 50 -CCA AGA TGC CTG CAC TGT CGC AAG-30 . 3. Initial ssDNA library (Fig. 1a): 50 -CCA AGA TGC CTG CAC TGT CGC AAG CGG GCT TGT GCT GTG CTG CAA TAC TGA CCG AAG CCA ATA CCG TCA CTT AGC CTC TAC CAA TCA CAT AAC ANN NNN NNN NNT GCT ACG ACC GTC CAA GGA CGG GAG GTG AGT TCC CTG CTT GCT TTC AGA TCG AGC TCC CAG GCT CTT CTC TGC ATG TCA TAT GTG CTG TGC C-30 . 4. Positive DNA control (for synthesis of an active VS ribozyme; Fig. 1b): 50 -CCA AGA TGC CTG CAC TGT CGC AAG CGG GCT TGT GCT GTG CTG CAA TAC TGA CCG AAG CCA ATA CCG TCA CTT AGC CTC TAC CAA TCA CAT AAC AGT AGT CAA CTG CTA CGA CCG TCC AAG GAC GGG AGG TGA GTT CCC TGC TTG CTT TCC GCT CGG GCC GAC GAT GCC CTT CGC AGC ATG TCA TAT GTG CTG TGC C-30 . 5. Negative DNA control (for synthesis of a VS ribozyme in which the KLI is disrupted by mutation of the SLV loop; Fig. 1c): 50 CCA AGA TGC CTG CAC TGT CGC AAG CGG GCT TGT GCT GTG CTG CAA TAC TGA CCG AAG CCA ATA CCG TCA CTT AGC CTC TAC CAA TCA CAT AAC AGT AAC GAA CTG CTA CGA CCG TCC AAG GAC GGG AGG TGA GTT CCC TGC TTG CTT TCC GCT CGG GCC GAC GAT GCC CTT CGC AGC ATG TCA TAT GTG CTG TGC C-30 . 6. 10 mM dNTP mix (10 mM of each dNTP). 7. Pfu DNA polymerase (5.8 mg/mL or ~2 U/μL) and 10 Pfu buffer: 200 mM Tris-HCl, pH 8.8, 100 mM KCl, 100 mM (NH4)2SO4, 20 mM MgSO4, 1% Triton X-100, 1 mg/ mL BSA. 8. Exonuclease I (20 U/μL) and 10 exonuclease buffer: 670 mM glycine-KOH, 67 mM MgCl2, 10 mM 2-mercaptoethanol, pH 9.5. 9. 10 TAE buffer: 400 mM Tris-Base, 200 mM acetic acid, 10 mM EDTA. 10. 0.5 mg/mL ethidium bromide solution.

Streamlined in Vitro Selection of the VS Ribozyme

2.2 Purification of the Double-Stranded DNA (dsDNA) Template by Phenol/Chloroform Extractions

1. Phenol:chloroform:isoamyl alcohol (25:24:1) solution.

2.3 Small-Scale Transcription Optimization of the dsDNA Library

1. 1 M Tris-HCl, pH 7.6.

65

2. 3 M sodium acetate (NaAc), pH 5.3. 3. Cold 95% ethanol.

2. 1 M freshly prepared dithiothreitol (DTT). 3. 100 mM NTP mix (100 mM of ATP, GTP, UTP and CTP, pH 8.0). 4. 25 mM spermidine. 5. 1% Triton X-100 solution. 6. 500 mM MgCl2 solution. 7. T7 RNA polymerase (6 mg/mL). 8. RNAsin® ribonuclease inhibitors (40 U/μL). 9. TBE buffer: 50 mM Tris-Base, 50 mM boric acid,1 mM EDTA, pH 8.0 (Prepare as a 10 stock solution). 10. 10% denaturing polyacrylamide gels (dPAGE): 1:19 bisacrylamide:acrylamide ratio and 7 M urea in TBE buffer. 11. 1 SYBR® Gold nucleic acid gel stain solution prepared in TBE buffer.

2.4 Large-Scale Transcription of the dsDNA Library and Positive Control

1. RNAse-free DNAse I.

2.5 Gel Purification of the Active Ribozyme Pool

1. TEN buffer: 10 mM Tris-HCl pH 7.6, 1 mM EDTA, pH 8.0, 0.3 M NaCl.

2.6 Reverse Transcription of the Active Ribozyme Pool

1. RT primer: 50 -CCA AGA TGC CTG CAC TGT-30 . 2. Superscript III reverse transcriptase (200 U/μL) and 5 firststrand buffer: 50 mM Tris-HCl, pH 8.3, 375 mM KCl, 15 mM MgCl2. 3. 1 M NaOH. 4. 1 M HCl.

2.7 Amplification of the Enriched, Active Ribozyme Pool by PCR

1. Forward primer P2: 50 -TAA TAC GAC TCA CTA TAG GCA CAG CAC ATA TGA CAT GCA GAG AAG AGC CTG GGA GCT CGA TCT GAA AGC AAG-30 .

66

Pierre Dagenais and Pascale Legault

2.8 Next-Generation Sequencing of the Final Library

1. +seq primer: 50 -ACA CTG ACG ACA TGG TTC TAC ATA ATA CGA CTC ACT ATA GGC ACA GCA CAT ATG ACA TGC AGA GAA GAG CCT GGG AGC TCG ATC TGA AAG CAA G-30 . 2. seq primer: 50 -TAC GGT AGC AGA GAC TTG GTC TCC AAG ATG CCT GCA CTG TCG CAA G-30 . 3. Galaxy project tools (FASTA/FASTQ: filter by quality, reversecomplement, barcode splitter, cutadapt, collapse sequences. Convert Formats: FASTQ to FASTA, FASTA to tabular. Text Manipulation: convert, cut, paste, unique lines). 4. SeqLogo software [24].

3

Methods

3.1 Amplification of the Initial ssDNA Library by PCR 3.1.1 PCR Optimization

1. Set up multiple 50 μL PCR reactions with 5 pmol of the initial ssDNA library, 2 μM forward primer P1, 2 μM reverse primer, 0.8 mM dNTP mix, 5 μL 10 Pfu buffer, 2 U of Pfu DNA polymerase and milliQ-water (see Note 1). 2. Run the following temperature steps in a thermal cycler: Initial denaturation step: 95  C for 5 min. Cycling steps: (a) Denaturation: 95  C for 30 s. (b) Annealing: 62  C for 1 min (see Note 2). (c) Extension: 72  C for 3 min. Repeat cycling steps a–c for a total of 10 cycles. Final steps: 55  C for 1 min and 72  C for 1 min. 3. During the PCR reaction, pause the thermal cycler at the very end of the extension step and take aliquots: 12 μL of cycle 1; 6 μL of cycles 2 and 4; and 2 μL of cycles 6 and 8. 4. Cast a stain-free 1.5% agarose gel in 1 TAE buffer. 5. Verify doubling of the PCR product at each cycle by loading 12 μL of cycle 1, 6 μL of cycle 2, 6 μL of 1:4 dilution of cycle 4, 6 μL of 1:16 dilution of cycle 6, and 6 μL of 1:64 dilution of cycle 8 in individual wells of a 1.5% agarose gel. 6. Run the gel at 140 V for 80 min. Stain the gel with a solution of 0.5 mg/mL ethidium bromide for 30 min. 7. Wash the gel once with 1 TAE. 8. Scan and quantify nucleic acid bands using a phosphorimager. Select the number of cycles to be used for the large-scale PCR reaction by analyzing the results of the PCR optimization (Fig. 2), as per the following principles. Given the loaded quantities of PCR reaction samples from step 5, the same percentage of PCR product (90% or more) should be observed

Streamlined in Vitro Selection of the VS Ribozyme

67

Cycles bp

Ladder

1

2

4

6

8

1000

500

PCR products primers (dimers)

200 100

primers (monomers)

100% 97% 96% 98% 91%

Fig. 2 Verification of PCR product doubling following the PCR reaction. Aliquots of the PCR reaction for cycles 1, 2, 4, 6, and 8 were loaded as described in the text (Subheading 3.1.1, step 5). The percentage of PCR doubling indicated below the gel was calculated by taking the percentage of the band intensity for the PCR product at a given cycle with respect to that of the first cycle

in each lane if the amount of product doubles at each PCR cycle. The number of cycles corresponding to the last cycle showing product doubling should be selected for the largescale PCR reaction (for example, cycle 8 in Fig. 2). 3.1.2 Large-Scale PCR Reaction

1. Determine the amount of dsDNA template required for the first round of selection. As a rule of thumb, the initial amount of dsDNA template should be at least five to ten times greater than the sequence diversity of the pool (see Note 3). This is necessary to preserve the sequence diversity present in the initial ssDNA pool throughout the whole selection round [25]. Divide the total amount of dsDNA template required by 5 pmol to determine how many 50 μL PCR reactions are required for step 2. 2. Proceed to the large-scale PCR reaction with the number of reactions determined from step 1 using the conditions from PCR optimization (see steps 1 and 2 in Subheading 3.1.1) with the optimized number of cycles (see step 8 in Subheading 3.1.1). Ten 50 μL PCR reactions of the positive and negative controls should be performed alongside the library to create enough template for the transcription of these controls. 3. Pool PCR reaction mixtures and degrade single-stranded primers by adding 5 U of exonuclease I per 50 μL of PCR reaction. Add 1 exonuclease buffer by dilution of the 10 stock solution and incubate at 37  C for 2 h.

68

Pierre Dagenais and Pascale Legault

3.2 Purification of the dsDNA Template by Phenol/Chloroform Extractions

1. Add an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1) to the exonuclease-treated PCR reaction. 2. Vortex tubes for 30 s and centrifuge at 16,200  g for 2 min. 3. Carefully remove the aqueous phase by pipetting (see Note 4). 4. Extract the DNA two more times by adding an equal volume phenol:chloroform:isoamyl alcohol (25:24:1) to the aqueous phase and repeat steps 2 and 3. 5. Add 1/10 volume of 3 M NaAc, pH 5.3 and 3 volumes of cold 95% ethanol to the aqueous phase. Precipitate DNA by incubating at 80  C for 30 min. 6. Centrifuge at 16,200  g for 30 min at 4  C. 7. Remove the supernatant. Wash the pellets with a minimal amount of cold 95% ethanol and dry the pellet using a Speedvac. 8. Resuspend the DNA in a minimal volume of milliQ-water (~100 μL). 9. Quantify the DNA library by taking an optical density readout at 260 nm.

3.3 Small-Scale Transcription Optimization of the dsDNA Library

1. Optimize small-scale transcription conditions by testing four different dsDNA library concentrations (10 nM, 20 nM, 40 nM, and 100 nM) along with the positive and negative controls (40 nM each). In a total volume of 50 μL, start the transcription reactions by combining the dsDNA template, 40 mM Tris-HCl, pH 8.0, 50 mM DTT, 1 mM spermidine, 0.1% triton X-100, 10 mM MgCl2 (see Note 5), 4 mM NTP mix, 0.2 U RNAsin® ribonuclease inhibitors, and 6 mg T7 RNA polymerase. 2. Incubate at 37  C for 90 min (see Note 5). 3. Set up the cleavage reaction: Take a 20-μL aliquot of the transcription reaction mixture, add MgCl2 for a final concentration of 20 mM, and incubate at 37  C for 5 min (see Note 5). 4. Prepare 1:20 dilutions of the transcription and cleavage reaction mixtures and load 1 μL of each dilution onto a 10% dPAGE for analysis. 5. Stain the gel by soaking it in a 1 SYBR® Gold solution and quantify bands using a phosphorimager. 6. Analyze the results from the transcription and cleavage reactions (an example is provided in Fig. 3). There should be a minimal amount of self-cleavage product for the negative control. For the transcription of the first round of selection, there should be an undetectable or minimal amount of self-cleavage

Streamlined in Vitro Selection of the VS Ribozyme

Rnd 1

+ control

69

- control

Tx

Clv

Tx

Clv

Tx

1%

3%

1%

15%

1%

Clv

Full-length Cleaved

Cleavage

1%

Fig. 3 Transcription and cleavage reactions for the first round of selection. The products of the transcription reaction (Tx) and subsequent cleavage reaction (Clv) from the initial dsDNA library, positive control (+ control) and negative control ( control) were analyzed by dPAGE to estimate the amount of full-length ribozyme (Full-length) and self-cleavage products (Cleaved). For each condition, the percentage of cleavage is indicated below the gel

product prior to the cleavage reaction and a small increase of this product after the cleavage reaction. Select the dsDNA library concentration that gives the best transcription and cleaved product yields. 3.4 Large-Scale Transcription of the dsDNA Library and Positive Control

1. Given the molar amount of dsDNA template required for the first selection round (see step 1 in Subheading 3.1.2) and the optimal template concentration for transcription (see step 6 in Subheading 3.3), calculate the volume of the large-scale transcription (see Note 6). 2. Set up the large-scale transcription reaction using the optimized conditions and proportionally scale up to the volume determined in step 1. Also set up a smaller transcription reaction (1/5 volume) of the positive control. 3. Incubate at 37  C for 90 min. 4. Add 10 U DNAse I per 100 μL of transcription. 5. Incubate at 37  C for 20 min. 6. Set up the cleavage reaction: Add MgCl2 for a final concentration of 20 mM and incubate at 37  C for 5 min.

70

Pierre Dagenais and Pascale Legault

7. Centrifuge sample at 16,200  g for 1 min to pellet the insoluble magnesium pyrophosphate salts and remove the supernatant by pipetting. 8. Add 1/10 volume of 3 M NaAc (pH 5.3) and 3 volumes of cold 95% ethanol to the supernatant and precipitate the RNA by incubating at 80  C for 30 min. 9. Centrifuge at 16,200  g for 30 min at 4  C. 10. Remove the supernatant and dry the pellet using a Speedvac. 11. Resuspend the RNA pellet in a minimal volume of milliQwater (~500 μL) and add 0.5 volume of RNA gel loading buffer. 3.5 Gel Purification of the Active Ribozyme Pool

1. Cast one 10% denaturing polyacrylamide gel (20 cm by 20 cm by 1.5 mm) per 5 mL of transcription (or less). Load the active ribozyme pool in a 10-cm well and the positive control in a 2-cm well, making sure to leave at least 2 cm between the two wells to avoid cross-contamination. 2. Run the gels until sufficient band separation is achieved. For convenience, we ran the gel for 15 h at 185 V. 3. Reveal the bands by UV shadowing, being careful to limit exposure of the RNA to UV light and excise the self-cleavage product from the gel (see Note 7). 4. Sterilize a small mortar and pestle (~200 mL) with 95% ethanol and a flame. Cool at 4  C for 15 min. 5. Using the sterilized mortar and pestle, thoroughly crush the pieces of polyacrylamide gel containing the self-cleavage product. 6. Add a minimal quantity of TEN buffer to the crushed gel in order to form a slurry and mix well. 7. Incubate the gel slurry at 37  C for 5 min. 8. Centrifuge at 10,500  g for 10 min. 9. Collect the supernatant and filter it on a 0.22 μm filter, making sure it is free of acrylamide particles. 10. Repeat steps 6–9. 11. Precipitate the active ribozyme samples by adding 1/10 volume 3 M NaAc, pH 5.3 and 3 volumes cold 95% ethanol. Mix thoroughly and incubate at 80  C for 30 min. 12. Centrifuge at 16,200  g for 30 min at 4  C. 13. Remove the supernatant and dry the RNA pellet on a Speedvac. 14. Resuspend the RNA pellets in a minimal volume of milliQwater (~15 μL, see Note 8).

Streamlined in Vitro Selection of the VS Ribozyme

3.6 Reverse Transcription of the Active Ribozyme Pool

71

1. Prepare two reverse transcription (RT) reactions by adding 0.5 mM dNTP mix and 5 μM RT primer to two fractions of the active ribozyme pool: a 10-μL fraction for the +RT reaction and a 5-μL fraction for the RT control reaction. Incubate for 5 min at 65  C. 2. Initiate the RT reactions by adding 4 μL of 5 first-strand buffer, 5 μM fresh DTT and superscript III reverse transcriptase (200 U for +RT and 0 U for RT reactions). Complete the volume to 20 μL with milliQ-water (see Note 9). 3. Incubate for 3 h at 50  C. 4. Take a 2 μL aliquot of each RT reaction and keep on ice for gel analysis. 5. Add 2 μL of 1 M NaOH to the remaining 18 μL of each RT reaction and incubate for 10 min at 90  C to degrade the RNA. 6. Add 2 μL of 1 M HCl to neutralize the solution. 7. To make sure that the reverse-transcribed ssDNA products are of the right size after degrading the RNA, analyze 1 μL of each RT reactions before and after RNA degradation by dPAGE. Stain with 1 SYBR® Gold solution and scan using a phosphorimager. The reverse-transcribed ssDNA products are revealed from the RNA lanes of the gel; it should be present in the +RT reaction but not in the RT control lane (an example is shown in Fig. 4) and migrate lower than the main band in the +RNA lane.

- RT

+ RT RNA

+

-

+

-

control

Fig. 4 Reverse transcription of the first round of selection. The reverse transcription reaction (+RT) and control reaction (RT) were analyzed by dPAGE before (+ RNA) and after RNA degradation ( RNA). The control used is the full-length positive RNA control

72

Pierre Dagenais and Pascale Legault

3.7 Amplification of the Enriched, Active Ribozyme Pool by PCR

1. Optimize PCR amplification conditions using several quantities of the +RT reaction (1–5 μL), as well as 2 μL of the RT control. In a total volume of 50 μL, add 2 μM forward primer P2, 2 μM reverse primer, 0.8 μM dNTPs mix, 5 μL 10 Pfu buffer, and 2 U Pfu DNA polymerase. 2. Run the following temperature steps in a thermal cycler: Initial denaturation step: 95  C for 5 min. Cycling steps: (a) Denaturation: 95  C for 30 s. (b) Annealing: 62  C for 1 min (see Note 2). (c) Extension: 72  C for 3 min. Repeat cycling steps a–c for a total of 10 cycles. Final steps: 55  C for 1 min and 72  C for 1 min. 3. Take aliquots at the end of the extension step for cycles 1, 2, 4, 6, and 8 and verify product doubling on a 1.5% agarose gel (see steps 3–8 in Subheading 3.1.1). 4. Determine the best PCR condition by choosing the last cycle showing product doubling. Perform at least ten other PCR reactions of 50 μL using the best PCR condition to obtain enough template for the next round of selection (see Note 10). 5. Pool the PCR reactions and extract the enriched dsDNA library by phenol/chloroform extraction and ethanol precipitation as described in steps 1–9 in Subheading 3.2. 6. Resuspend the dsDNA library in 30 μL milliQ-water. 7. The resulting enriched dsDNA library can now be used as a template for the subsequent round of selection.

3.8 Completion of Several Rounds of Selection and Assessment of the Selection

1. For each subsequent selection rounds, perform selection and amplification by repeating all the steps described in Subheadings 3.3–3.7. To restrain the sequence diversity of the final pool to ribozymes with high catalytic activity [26], the stringency of the selection can be increased from one round to the next by decreasing the cleavage reaction time of step 6 in Subheading 3.4. For example, we have previously decreased the cleavage reaction time at each round, starting from 5 min for round 1 to 30 s for round 6. 2. Analyze 1 μL of a 1:10 dilution of each transcription and cleavage reactions by dPAGE, as described in steps 4–6 in Subheading 3.3. 3. Stop the rounds of selection once the ribozyme activity stops increasing from one round to the next. In the example shown in Fig. 5, the selection was stopped after round 7 and the DNA library generated from round 6 was sequenced as described in Subheading 3.9.

Streamlined in Vitro Selection of the VS Ribozyme Rnd 1

Rnd 2

Rnd 3

Rnd 4

Rnd 5

Rnd 6

Rnd 7

+ control

73 - control

Tx

Clv

Tx

Clv

Tx

Clv

Tx

Clv

Tx

Clv

Tx

Clv

Tx

Clv

Tx

Clv

Tx

Clv

GGUAUAAGAUGAUGGCGGUACGGCUCGAAGCCGUUAG 0.540540540541 ooooooooooooooooooooooooooooooooooooo ooooooooooooooooooooooooooooooooooooo

seed GC ->

iteration: 1 defect: 0.110726756757 mutations: 3 time: 07:13:05 sequence: GGUAUAAGAUGAGGGGCGUACAGCUGCAAGCUGAUAG iteration: 2 defect: 0.110726756757 mutations: 1 time: 07:13:05 . iteration: 25 defect: 0.0864916216216 mutations: 2 time: 07:13:09 sequence: GGUAUAAGAUGAUGGGCGAACCGCUGCAAGCGGAAAG -------------------------------------------------------------------------target structure -> ...............[[[..((((]]]..)))).... sequence -> GGUAUAAGAUGAUGGGCCAACCGCGGCAAGCGGAAAG sequence normalized ensemble defect -> 0.00559189189189 free energy -> -12.80000000000000 sequence G/C content -> 0.567567567568 temperature -> -T 37 material -> rna1999 max iterations -> 400 used iterations 25 C_design in seconds 4.30981206894 C_eval in seconds 0.192348003387 C_design / C_eval 22.4063259979

4. Once the program starts, it displays relevant information about each iteration of the design process, such as the current normalized ensemble defect of the current RNA sequence, the number of mutations that will be applied to the current sequence,

Pseudoknotted Ribozyme Design

101

and the local time stamp. Notice that as the number of iterations grows, the normalized ensemble defect of the sampled RNA decreases. Iteration continues until either the target normalized_ensemble_defect value is reached or the maximum number of iterations (max_iterations) is exhausted. Once either one of the two termination criteria is met, Enzymer will print out the final RNA sequence together with relevant information such as folding energy and other performance measures. A summary of the run will be found in the “./results” folder in a file with the same as the input file but with a time stamp suffix attached to it. 3.3 In Vitro Testing of cis-Acting Ribozymes

To prove the efficiency of Enzymer to design pseudoknotted RNAs by inverse folding, hammerhead ribozyme structure can be used as a model to generate sequences to assay and to compare their cleavage activity to the WT ribozyme. The cleavage activity of the cis-acting ribozymes can be detected during transcription, but to determine the rate constant that gives a better idea on the ribozyme activity and the cleavage efficiency the use of trans-acting version of ribozymes is preferred (Subheading 3.4).

3.3.1 DNA Template Production

The first step to start with is the production of the DNA templates for the transcription to generate the RNAs. 1. Thaw the frozen reactants at room temperature and once thawed put them on ice. 2. Prepare the PCR master mix by putting the buffer, dNTPs, and the water together; add the enzyme last (see Note 3). 3. Depending on the DNA template, if the primer is the same for many DNA oligonucleotides, add the primers to the master mix, this can be the case for the forward primer consisting of the T7 promoter (like for the hammerhead ribozymes given as examples in Table 2). Otherwise add the primers individually before the next step. 4. Add 1 μl of the DNA oligonucleotide used as a template (see Notes 4–6). 5. Run your PCR. For the hammerhead ribozyme sequences in Table 2, the Tm (annealing temperature) is 49  C since the T7 promoter sequence is used as a primer.

3.3.2 Agarose Gel Electrophoresis and DNA Precipitation

When the PCR is about to finish (10–15 min before it ends), prepare an agarose gel to verify the size of the PCR products. 1. Prepare a 2% agarose gel (assuming PCR products ,” usually followed by information about the sequence, such as length and name. The second line is the RNA sequence written from 50 to

Inverse RNA Folding Workflow to Design and Test Ribozymes that Include. . .

121

Mac OS X, and Linux. An example of a finished structure is provided in Fig. 2a. From the Structure Editor program, choose the menu item “File|New File.” This will open the dialog box to make a new drawing from sequence. You can optionally provide a title for your structure. You should then provide the sequence (by typing or cut and paste), using N for nucleotides that can vary and nucleotides or ambiguity codes for nucleotides that are invariant. There is no need to provide structure information. Then click “OK – Create Drawing” to create an empty structure drawing. From the drawing window, base pairs can be added to the secondary structure. To make a new pair, click on the first nucleotide, press control, and draw a line to the second with the mouse while holding the left mouse button and holding the control key. If the target structure has pseudoknotted pairs, those should be added last. Figure 3 shows the drawing editor, with the structure from Fig. 2 partially specified. After adding base pairs, the structure can be automatically redrawn by choosing “Format|Redraw” (or clicking “cntrl-R” as a keyboard shortcut). Once all the pairs have been added, a dot-bracket file can be written to disk by choosing “File|Export.” Then choose “Bracket File (∗.dbn, ∗.bracket, ∗.dot)” as the file type. The dot-bracket file will not contain pseudoknotted base pairs; this obviates the need to perform steps in Subheading 3.4. Alternatively, CT files can also be written by the drawing program. CT files also do not contain pseudoknotted base pairs. The drawing program is also a convenient software tool for illustrating the structure descriptor for publication. Using the mouse for point and click, the loops and helices can be placed on the page. The program help, found on the menu at “Help|Program Help”, discusses the available drawing methods. There is also a workshop available at: https://rna.urmc.rochester.edu/tutorials/ editor/color-annotate.html. Once the drawing is finalized, it is convenient to save an svg file of the image because svg is a vector format that can be edited by other software, such as Adobe Illustrator. To save an svg file, choose the “File|Export” menu option and choose “SVG – Scalable Vector Graphics File (∗.svg)” as the file type.

ä Fig 2. (continued) 30 . And the third line has the base pairing information where “.” represents an unpaired nucleotide and open and close brackets are for the beginning and end of base pairs, i.e., the 50 and 30 nucleotides in a given stem. Pseudoknot-free structures use the parenthesis symbol. Additional symbols like the square bracket are needed for pseudoknots. Both the CT and dot-bracket formats are plain text files

122

Mohammad Kayedkhordeh et al.

Fig. 3 Screenshot of RNAstructure Structure Editor on Windows 10. The structure from Fig. 2a is being drawn. The base pairs aside from the pseudoknot were selected first. The structure was then redrawn by choosing the redraw button (or pressing cntrl-R) and the first pair in the pseudoknot was added. Note that the pseudoknotted pair is shown in red, and it will not be written to the dot-bracket file 3.4 Removing Pseudoknots

If the structure descriptor contains pseudoknots, the pseudoknotted pairs need to be identified and temporarily removed in order to continue with the design procedure. This section discusses approaches to identify and remove pseudoknots, although the Structure Editor (Subheading 3.3.2) automatically identifies pseudoknots and does not write them to the dot-bracket file as mentioned above.

3.4.1 RemovePseudoknot Program

The RemovePseudoknot program from RNAstructure can be used to remove pseudoknots from a CT file. On the command line, use: RemovePseudoknots [options]

where is the name of the input CT file for a secondary structure containing pseudoknots. is the name of the final CT file that will no longer contain pseudoknots.

Inverse RNA Folding Workflow to Design and Test Ribozymes that Include. . .

C

A

C

C

C

C

C

G G 20

C A

A

A

A

G G

G

123

A

G

G G G G

C

C

10

Fig. 4 Circular plot from the RNAstructure draw program. This is the same structure as Fig. 2a, the H-type pseudoknot. The pseudoknotted pairs are identified by the crossing arcs

By default, RemovePseudoknots creates output structures that will have minimum free energies. If “-m” option is specified as an option, RemovePseudoknots will maximize the remaining base pairs in the pseudoknot-free structure. We recommend using the -m option because typically the pseudoknot is considered to be the shortest helix that can be removed to generate the pseudoknot-free structure. For a simple pseudoknot such as the one in Fig. 2a, however, both approaches will result in the same pseudoknot-free structure where the base pairs in green are removed. 3.4.2 Draw Program

Draw is another software tool in RNAstructure to represent secondary structures. This can be used to easily visualize pseudoknots. In order to do that, users need to use “-c” option in draw: draw [options]

where is the name of a CT file and is the name of a postscript file that will be output. For options, the “-c” should be specified to represent the secondary structure in the circular format in which the sequence is drawn on a circle and each base pair is shown by an arc between the nucleotides in the pair. A pseudoknot therefore can be easily identified by crossing arcs. Figure 4 shows the secondary structure from Fig. 2a drawn in a circular format. The pseudoknot is identified by crossing base pair arcs. Base pairs annotated in green are highlighted in both representations where, if removed, a pseudoknot-free structure is obtained that maximizes the number of remaining base pairs (Subheading 3.4.1).

124

Mohammad Kayedkhordeh et al.

Pseudoknot helix 1

Pseudoknot helix 2 N

N G

25

N

C

G

N

N

C

10

G

C N N N N N

N N N N N

N

20

1 N

N

‘NNNNNNNCCCCNNNNNNNNNGGGGN’

C

G N

C

G N N N N N

N N N N N

N

20 1

N

N

‘NNNNNNNCCCGNNNNNNNNNCGGGN’

C

G

N

N N N N N

N N

20

1 N

N

‘NNNNNNNCCCANNNNNNNNNUGGGN’

C

G C

10

N

U

A N N N N N

G C

C

10

N

N

G

25

G C

C

10

N

N

N G

25

G C

Pseudoknot helix 4

N

G

25

G C

1

Pseudoknot helix 3

A

U N N N N N

N N N N N

N N

N

20

N

‘NNNNNNNCCCUNNNNNNNNNAGGGN’

Fig. 5 Examples of possible helix sequences in the pseudoknot. RNAiFold is run (step 6 in Fig. 1) for each possible pseudoknot helix sequence by using sequence constraints for the green nucleotides. Below each structure, in single quotes, is the value of -RNAseqcon option for RNAiFold. The structures are shown for illustration purposes, but the sequence strings need to be generated for use with RNAiFold 3.5 Create a List of All Possible Base Pairs of Pseudoknot Helices (Step 5 in Fig. 1)

In order to explicitly account for pseudoknotted pairs removed from the initial structure descriptor, a list of all possible combination of base pairs in the pseudoknot sections needs to be made. For example, the secondary structure in Fig. 2a is made pseudoknotfree by removing the base pairs shown in green. Because four base pairs were removed in this process and each base position has 6 pairing possibilities (A-U, U-A, C-G, G-C, GU, and UG pairs), there are 64 ¼ 1296 total possible combinations of base pairs in the removed helix. Each of these combinations of pairs will later be used as constraints in a calculation of the RNAiFold program during the initial sequence design step (step 6 in Fig. 1). One way to simplify the list and reduce the RNAiFold overall design time is to not include GU and UG base pairs. Doing that reduces the 1296 possible pairs to 44 ¼ 256. We call this list the constraint pairs list. Figure 5 shows four examples of the possible base pair combination in the pseudoknot helix. Most pseudoknots are relatively short, making this process manageable.

3.6 Run RNAiFold for Each Entry in the Constraint Pairs List (Step 6 in Fig. 1)

In this step, RNAiFold needs to be run for each entry in the constraint pairs list. Here is an example command line entry to use RNAiFold to design sequences for the secondary structure in Fig. 2a, using one of the possible base pair combinations from the constraint pair list in Fig. 5 (helix 1): RNAiFold -RNAscdstr ‘(((((......))))).........’ -RNAseqcon ‘NNNNNNNCCCCNNNNNNNNNGGGGN’ -MAXsol 1000000000 -RandomAssignment 1 -TimeLimit 21600

“RNAscdstr” expects a secondary structure target input file in dot-bracket format. This is the pseudoknot-free dot-bracket representation of the structure. The “MAXsol” option specifies the

Inverse RNA Folding Workflow to Design and Test Ribozymes that Include. . .

125

Fig. 6 RNAiFold throughput as a function of time. RNAiFold was run without a time limit, and the number of sequences generated as a function of time is plotted. The H-type pseudoknot in Fig. 2a was designed using the helix 1 constraint in Fig. 5. The throughput will vary as a function of sequence length and also design difficulty. We recommend testing the throughput to choose a calculation time for each RNAiFold calculation

maximum number of solutions, i.e., the number of designed sequences (the default value is 8). The “RandomAssignment” option uses a random value heuristic to test sequences in a random order. This is important if the program is not allowed enough time to test all sequences. It is time prohibitive to test all sequences for sequences longer than about 30 nucleotides. The “TimeLimit” option assigns the runtime limit for RNAiFold in seconds (the default value is 600 s). RNAiFold will return the sequences it has found within the time limit that fold with lowest free energy change to the target structure. Note that, depending on the available resources and the size of the structure descriptor, RNAiFold calculations take variable time. Users can either modify the “MAXsol” value to fit their needs or use the “TimeLimit” option to specify how long RNAiFold is allowed to run. In our designs for the HDV ribozyme, we ran each RNAiFold calculation for 6 hours, using a computer cluster to run each of 8192 constraints in the constraint pairs list. To provide a sense of how many sequences RNAiFold can generate in a given time, the design process of RNAiFold for the longer helix in Fig. 5 was tracked over the runtime. Figure 6 shows the number of sequences RNAiFold designed as a function of runtime. This rate of throughput will vary both as a function of sequence length and also the intrinsic design difficulty of the structure, which can vary considerably [26, 38]. The number of structures returned as a function of time is not linear because sequences are tested in a random order, and most sequences are rejected

126

Mohammad Kayedkhordeh et al.

because they do not fold to the desired structure for their minimum free energy structure. We recommend that tests be run to determine the throughput for each structure designed. The RNAiFold runtime must be chosen to be long enough to provide enough sequences so that some will pass the subsequent stringency tests (Subheadings 3.7–3.9). 3.7 Calculate Normalized Ensemble Defect (NED) Values for All Designed Sequences (Step 7 in Fig. 1)

Once all RNAiFold sequence designs for the constraint pairs list are finished, the designed sequences need to be collected and their NED values calculated. To calculate NED for a given sequence, the EDcalculator program from RNAstructure is used [38]. EDcalculator requires a target secondary structure as input, either in CT or dot-bracket format. There are two ways to use EDcalculator, either in serial or parallel: EDcalculator [options] or EDcalculatorsmp [options]

where EDcalculator-smp is the parallel version that runs on multiple CPU cores on the same computer. By default, it uses all the available cores. The structure file is the pseudoknot-free structure. EDcalculator and EDcalculator-smp have multiple options that can be used for specific cases, and the option “-c” is required here. “-c” or “-C” or “--constraint” option is used when there are constraints on the base pairing (see section 3.7.1). In this case, we forbid the specific base pairs in the pseudoknot from forming, but allow the nucleotides to form other base pairs. This lets EDcalculator check that alternative base pairings are not forming for these nucleotides. 3.7.1 Constraint File Format

A number of RNAstructure programs can use constraints in structure prediction. Those constraints are input with a constraint file, which is a plain text file with a specific format. Figure 7 shows an example of a constraint file for the h-type pseudoknot in where the base pairs in the pseudoknot helix (shown in green) need to be prohibited. Note that there are multiple sections in the constraint file, each identified with a specifier (SS, DS, Mod, Pairs, FMN, and Forbids). Each section ends with either “-1” or “-1 -1”, depending on whether the constraint section requires one or two arguments. When there are two arguments for a section, each should be listed from 50 to 30 direction. Also note that nucleotide positions are indexed from 50 end and the first nucleotide position is 1. The complete documentation for the constraint file format is available at: https://rna.urmc.rochester.edu/Text/File_ Formats.html.

Inverse RNA Folding Workflow to Design and Test Ribozymes that Include. . .

A

B A

C

25

C G A

G

10

A

1

G C G

C C C C C C

G G G G G

A A

A

G

20

127

DS -1 SS: -1 Mod: -1 Pairs: -1 -1 FMN: -1 Forbids: 8 24 9 23 10 22 11 21 -1 -1

Fig. 7 Example of a constraint file used in calculating NED values. The pseudoknotted pairs need to be forbidden in the calculation. Panel A shows the H-type pseudoknot and panel B shows the constraint file content 3.7.2 Make the Constraint File for EDcalculator

Now, create the constraint file suitable for the specific structure descriptor used in the RNAiFold designs. First, list all of the base pairs, from 50 to 30 direction, that were broken in order to remove the pseudoknot. Create a constraint file in the format of Fig. 7b by inserting the listed base pairs under the “Forbids” section.

3.7.3 Make Input Dot-Bracket Files for Designed Sequence for EDcalculator

Create the input in dot-bracket file format. As stated in Subheading 3.3.1, a dot bracket-formatted structure contains three lines. Because all of RNAiFold designed sequences are for the same structure, in order to create the dot-bracket file for each sequence, only the second line, sequence, needs to be changed to create separate dot-bracket files for each designed sequence. The third line, the structure line, is the same string used for parameter -RNAscdstr in the RNAiFold calculation.

3.7.4 Run EDcalculator for Each Sequence

Once these steps are taken, run EDcalculator to obtain NED values for each designed sequence. Here is an example of using EDcalculator for the structure in Fig. 7a: EDcalculator h-pseudoknot.dot -c constraint-file.CON

EDcalculator outputs both ensemble defect (ED) and NED to the screen. If you prefer to have the output saved to a file, you can use “-f” option followed by the name of output file such as: EDcalculator h-pseudoknot.dot -c constraint-file.CON -f output-file.txt

128

Mohammad Kayedkhordeh et al.

Fig. 8 NED as a function of folding free energy change for a set of structures generated by RNAiFold. Panel A shows the first 1  105 sequences and Panel B shows a full 1  106 sequences. Sequences should be chosen to have low NED, where the stringency needs to be chosen based on the system. Here, an NED stringency of h-pseudo.fasta

Now, ProbKnot can be run with: ProbKnot --sequence h-pseudo.fasta h-pseudo-probknot.ct

Note: It is necessary to use “--sequence” when the input file for ProbKnot is a sequence file. Next, the ProbKnot predictions need to be evaluated for consistency to the target structure. The scorer program from RNA structure compares the predicted structure to the accepted structure and calculates two quality metrics: the sensitivity and positive predicted value (PPV). Note that this works even for pseudoknotcontaining structures. In this case, the PPV, which is the fraction of predicted pairs that are in the desired structure, is the figure of merit for a sequence. The scorer command line is: scorer [options]

For this work, is the predicted CT file from ProbKnot, is the CT file for the initial structure

130

Mohammad Kayedkhordeh et al.

(%)

Fig. 9 Number of designed sequences remaining as a function of ProbKnot Positive Predicted Value (PPV) cutoff for HDV ribozymes. The 93% value cutoff is shown by a red line [33]. In other words, we chose sequences with a PPV of 93–100%

descriptor including pseudoknots, and the is where the sensitivity and PPV results will be stored. Sequences with high PPV values should be retained for further analysis. The threshold that is used to filter out low PPV sequences is empirical and depends on the exact design problem. In our work [33], we were able to use a threshold of 0.93 and still have a large number of sequences. Figure 9 is an example of the number of remaining designed sequences for our HDV ribozyme designs. The same method can be used to determine a PPV threshold for other systems. 3.9 Filter Results Using Quadbase to Remove G-Quadruplexes

The next stringency test is used to remove sequences that have a propensity to form G-quadruplexes [40] because these can fold the RNA into the wrong structure. Quadbase is a webserver that can predict possible formation of G-quadruplexes in sequence [41]. It is available at: http://quadbase.igib.res.in/. We used Quadbase to filter out sequences that were predicted to form G-quadruplexes. We changed the default parameters of Quadbase to identify sequences with any propensity to form quadruplexes by using low stringency configuration: stem length ¼ 2, minimum loop length ¼ 1, and maximum loop length ¼ 12 using the Greedy search algorithm on both + and  strands. Figure 10 shows a screenshot of the Quadbase webserver. Quadbase can take multiple sequences as input at the same time. Users can either select a file containing sequences or paste the sequence information in a designated box in the main page shown in Fig. 10. Sequences are input in FASTA format. Each sequence should start with “>” followed by a unique name and on the following line the sequence identity.

Inverse RNA Folding Workflow to Design and Test Ribozymes that Include. . .

131

Fig. 10 Quadbase webserver main page

Once the sequences are selected, click on the Submit button. Once Quadbase is finished and has found candidate sequences that can form G-quadruplexes, it will show a result page like the one in Fig. 11. On the bottom left corner of the page, you can download the list of sequences without a propensity to form quadruplexes. Quadbase uses the sequence names from the FASTA input file to report the results. 3.10 Overview of Experimental Section

In this experimental section, we focus on how to evaluate the function of the designed HDV ribozymes. In brief, we describe how to select candidate ribozyme sequences for biochemical analyses, how to prepare DNA templates and RNAs, how to perform and analyze the ribozyme reaction, and how to compare structural similarity between a natural ribozyme and the designed ribozyme. Note that these are common techniques for self-cleaving ribozymes

132

Mohammad Kayedkhordeh et al.

Fig. 11 Quadbase results page

and are applicable to all ribozymes (i.e., not just the HDV ribozyme) by considering RNA constructs, rate constants, and reaction conditions. In principle, ribozymes that involve just a single pseudoknot, rather than a double pseudoknot like in HDV, should be simpler to design. 3.11 Selection of the Designed Ribozymes for Biochemical Analysis

To identify active designed ribozymes efficiently, filtration by NED values obtained in Subheading 3.7 should be considered. Designed ribozymes that have low NED values, which depict the correct structure and absence of misfolding, are highly expected to have catalytic activity and thus be candidates for biochemical analysis. By using the following procedure, over 90% of the designed HDV ribozymes had catalytic activity that were selected and examined. 1. To avoid selecting the ribozymes with similar sequences, execute the following procedures: (a) Make a fasta file in each GC count subgroup and analyze by CLUSTAL W with default parameters.

Inverse RNA Folding Workflow to Design and Test Ribozymes that Include. . .

133

(b) Make a rooted phylogenetic tree (UPGMA) for each GC count subgroup using the CLUSTAL W. Group into ~10 branches for each GC subgroup and pick a sequence randomly from the ~10 branches (~10 sequences in total for each GC subgroup). (c) Sort the 10 sequences by NED value and use the lowest and second lowest scored ribozymes for biochemical analysis. 2. To check the sequence similarity of the selected designed ribozymes, use WebLogo. 3. Go to the WebLogo 3 web site (http://weblogo.threeplusone. com) and select “create.” Paste your selected sequence data and choose “Create WebLogo” to evaluate sequence similarity. 3.12 Preparation of Double-Stranded DNA Template

1. For transcription, oligonucleotides should be designed as follows. 2. For preparation of precursor ribozymes, add precursor sequence at 50 end of the designed RNA (see Note 2). For preparation of cleaved ribozymes, remove the precursor sequence. 3. Add 50 -d(GCGAAATTTAATACGACTCACTATA ) sequence at 50 end of the forward primer, where the underlined region is the T7 promoter. (See Note 3). 4. Design forward primer and reverse primer, where forward primer and reverse primer should have complementary overlapped nucleotides where the overlapped region should have an estimated melting temperature (TM) of at least 60  C. GC and AT base pairing are approximated as having Tm of 4  C and 2  C, respectively. For example, the CPEB3 ribozyme has the sequence 50 -(GGGGGCCACAGCAGAAGCGUUCACGUC GCAGCCCCUGUCAGAUUCUGGUGAAUCUGCGAAUU CUGCUG). The forward primer and reverse primer for precursor CPEB3 ribozyme are designed to be 50 -d(GCGAAATTTAATACGACTCACTATAggatcaaggggataacaGGGGGCCACAGC AGAAGCGTTCACGTCGCAGCC ) and 50 -d(CAGCAGA ATTCGCAGATTCACCAGAATCTGACAGGGGCTGCGAC GTGAACGCTTCTG), respectively, where the underlined region is T7 promoter, lower case is the precursor sequence from a native CPEB3 ribozyme, and the bold region is the overlapped sequence. 5. For overlap extension, set up a reaction mixture containing 1 μM forward primer, 1 μM reverse primer, 1 PCR buffer, 50 μM each dNTP, 0.5 μL of Taq DNA polymerase, and 85.5 μL RNase-free water in a total volume of 100 μL in a PCR tube. Start the overlap extension reaction in thermal cycler with the following cycles.

134

Mohammad Kayedkhordeh et al.

Step

Cycle number

Program

First step

1

95  C for 3 min

Second step

5

95  C for 30 s (Tm-5  C) for 30 s 72  C for 30 s

Third step

1

72  C for 3 min

6. After overlap extension, purify the now double-stranded template DNA by phenol/chloroform/isoamyl alcohol treatment, and recover the DNA by ethanol precipitation with standard protocols. In brief, add one volume of phenol/chloroform/ isoamyl alcohol (25:24:1) to the sample (in this case, the PCR product), vortex the sample, separate aqueous phase from organic phase by centrifugation at 16,000  g for 5 min, take the aqueous phase (top layer), and dispense into a new microcentrifuge. Add one volume of chloroform/isoamyl alcohol (24:1) to the sample, vortex the sample, separate aqueous phase from organic phase by centrifugation at 16,000  g for 1 min, take the aqueous phase (top layer), and dispense into a new microcentrifuge. Add 1/10 volume of 3 M sodium acetate and 2.5-fold volume of cold ethanol into the sample, vortex the sample, incubate the sample at 80  C for 30 min, then centrifuge at 16,000  g for 15 min to make a DNA (or RNA) pellet. After centrifugation, discard the supernatant, and dry the pellet using a vacuum concentrator. 7. Resuspend the pellet in 100 μL water and quantify DNA concentration by UV absorbance. 8. Store templates DNA at 20  C. 3.13 In Vitro RNA Transcription, Internal Labeling, and Purification

1. For non-radioactive transcription, set up a reaction mixture with 20 ng/μL of template DNA and 1–10% (v/v) T7 RNA Polymerase in 1 transcription buffer in a total volume of 100–400 μL in a microcentrifuge tube. Incubate the reaction mixture at 37  C for 2–4 h (see Note 4). 2. For internal labeling transcription, set up a reaction mixture with 0.1 μg/μL DNA template and 1 μL of [α-32P]-GTP in the 1 labeling transcription buffer in a total volume of 10–20 μL in a PCR tube. Incubate the reaction mixture at 37  C for 2 h. 3. After the transcription, add an equal volume of formamide loading dye. Load on a 10% denaturing gel, and run with 1 TBE at 30 W for 1–2 h. After the dyes have moved the appropriate distances, separate the glass plates and transfer the gel to plastic wrap.

Inverse RNA Folding Workflow to Design and Test Ribozymes that Include. . .

135

4. Visualize the RNA by UV-shadowing as follows. In a darkroom, place the wrapped gel on top of a TLC plate. Visualize the RNA bands by UV at 254 nm above the gel (see Note 5). 5. In case of internal labeling, expose an X-ray film to the gel with the radiolabeled RNA in a darkroom and develop. Or expose an imaging plate to the gel for 10 min and visualize the gel image with a PhosphorImager. 6. Cut a gel piece containing your RNA and crush/soak the gel in the gel elution buffer at 4  C for 4 h to overnight. Recover the purified RNA by ethanol precipitation as in Subheading 3.12 step 6. 7. Resuspend in 50 μL water and check transcription yields by UV absorbance. 8. Store the RNA at 20  C. 3.14 Kinetic Analysis of the Designed Ribozymes

1. An example of a designed ribozyme (DHRz 2859) is shown in Fig. 12a. Before starting the reaction, renature 1000 cpm/μL of the internally labeled precursor RNA (total count: 25,000 cpm) at 85  C for 2 min in the 1 reaction buffer in a final volume of 23.75 μL in a PCR tube. Cool the RNA to room temperature for 10 min by placing in a rack on the bench. Set a heat block at 37  C and place the PCR tube on the block. Withdraw 1.9 μL of aliquot from the tube and mix with 8.1 μL of the formamide loading dye for the 0 time point. Separately, add 1.15 μL of 1 M MgCl2 into the reaction mixture to initiate the self-cleaving reaction (50 mM MgCl2 final). Withdraw 2.0 μL of aliquot at specific time points and stop the reaction by mixing with 8.0 μL of the formamide loading dye. Store the template DNAs at 20  C.

A

B

J1/2 5’

gg ga gc

gc

G C U A G P1 G G P3 C G G C P1.1 G C A C G U C G G C U A G C C G A U P4 G C A A AAA

ca

aa

ca

u

A U A U A U G G

A U A U A C C

C 3’ G G U P2 C C C

A A A C

C time 0.8 intact 3’-fragment

fcleaved

DHRz 2859

Curve fitting f=A+B•e-kt

0.6 0.4 0.2

J4/2

0 5’-fragment

0

1000 2000 3000 time (min)

Fig. 12 Sample kinetic analysis of the designed HDV ribozyme. (A) Secondary structure of DHRz 2859. Lower case is precursor sequence. (B) Self-cleaving reaction of DHRz 2859 where fraction of intact (unreacted RNA) decreases and fractions of cleaved products (30 -fragment and 50 -fragment) increase in a time-dependent fashion. (C) Scatter plot of fcleaved versus time for DHRz 2859. Kinetics data from four trials are plotted and analyzed by single exponential curve fitting

136

Mohammad Kayedkhordeh et al.

2. Load 2 μL of the sample on a 10% denaturing gel, and run the gel with 1 TBE at 30 W for 30 min. 3. After gel running, transfer the gel to a blotting paper and cover with plastic wrap. 4. Dry the gel using a gel dryer at 80  C for 1 h. Expose the gel to an imaging plate for overnight, and visualize the reaction products with a PhosphorImager (Fig. 12b). 5. Open the gel image on ImageQuant and quantify each band intensity. Calculate fraction cleaved ( fcleaved), where fcleaved for an internally labeled RNA is defined as. fcleaved ¼

I 50 ‐cleaved þ I 30 ‐cleaved I 50 ‐cleaved þ I 30 ‐cleaved þ I intact

where I50 -cleaved is band intensity of 50 -fragment, I30 -cleaved is band intensity of 30 -fragment, and Iintact is band intensity of uncleaved RNA. 6. Export the data to Kaleidagraph, and determine the observed first-order rate constants for the ribozymes (kobs) by single exponential curve fitting of fcleaved versus time plots to: fcleaved ¼ A þ Be kobs t where A is the fraction of ribozyme cleaved at completion, –Bis the amplitude of the observable phase, kobs is the observed first-order rate constant for self-cleaving for the non-burst phase, and t is time (Fig. 12c). 3.15 50 -end Labeling of RNA

1. Prepare 10 μM cleaved ribozymes by in vitro transcription (see Subheadings 3.12 and 3.13). 2. Dephosphorylate the 50 triphosphate present on transcribed RNAs as follows. (a) Add 10 μL of 10 μM RNA (100 pmol total) into 1 rSAP buffer (final) and 1 unit of rSAP in a total volume of 20 μL. (b) Incubate at 37  C for 30 min. Deactivate the phosphatase by heating at 65  C for 5 min. 3. Phosphorylate the 50 -OH of the RNA as follows. (a) Add 2 μL of the dephosphorylated RNA (10 pmol), 1 μL of fresh [γ-32P]-ATP, and 10 units of T4 polynucleotide kinase into 1 T4 PNK buffer in a total volume of 10 μL. (b) Incubate at 37  C for 30–60 min and stop the reaction by addition of 10 μL of formamide loading dye.

Inverse RNA Folding Workflow to Design and Test Ribozymes that Include. . .

137

4. Load 20 μL of loading sample on 10% denaturing gel and fractionate the RNA with 1 TBE at 30 W for 1–2 h. 5. Visualize the radiolabeled RNA by X-ray film (see Subheading 3.13, step 5). Cut a gel piece containing your RNA and crush/ soak the gel in the gel elution buffer at 4  C for 4 h to overnight. Recover the purified RNA by ethanol precipitation as in Subheading 3.12 step 6. 6. Resuspend in 100 μL water. Measure specific activity of the labeled RNA with a liquid scintillation counter. 7. Store the labeled RNA at 20  C. 3.16 Confirmation of Secondary Structure of the Designed Ribozyme by In-Line Probing Analysis

It is important to assess whether the designed RNAs are able to fold into their catalytic structure. In-line probing analysis is a wellestablished method that enables comparison of secondary structures between designed and naturally occurring RNAs [42]. In-line probing analysis exploits spontaneous RNA cleavage by Mg2+induced chemical reaction at each RNA linkage. The principle of in-line probing is that a deprotonated 20 -O attacks on the adjacent phosphorus center with the assistance of Mg2+ (general base), and the 50 -oxygen of the leaving group is protonated by a general acid, likely H2O, promoting the cleavage reaction, which results in generation of 20 ,30 -cyclic phosphate (Fig. 13a). The cleavage speeds strongly depend on local structure and solvent accessibility where highly structured regions have low in-line reactivity due to the structural rigidity and limitation of solvent accessibility whereas single-stranded regions are flexible and have high in-line reactivity (Fig. 13b). Thus, similar structures should have similar in-line reactivities (similar RNA cleavage patterns). 1. Set up a mixture of 5.0 μL of the 50 -end labeled RNA (100–200 kcpm/μL) and 7.5 μL of water in a total volume of 12.5 μL in a PCR tube. 2. Renature the RNA at 90  C for 2 min and cool to room temperature for 10 min. 3. Place the PCR tube on ice and add 12.5 μL of 2 in-line probing buffer into the mixture (total volume of 25 μL in a PCR tube). After adding the buffer, immediately take out a 5 μL aliquot for the 0 time point, and mix with 5 μL of formamide loading dye to quench the reaction. Incubate the reaction mixture at 37  C for ~48 h. During the reaction, take out an aliquot of 5 μL at several time points such as 12, 24, and 40 h, and mix with 5 μL of the formamide loading dye. Store at 20  C. 4. Prepare a 10% denaturing sequencing gel (43 cm  38.2 cm  0.5 mm with 8 mm  5 mm wells, 0.5 mm thick), and pre-run the gel at 50 W for 30 min.

138

Mohammad Kayedkhordeh et al.

A Base N

O

Base N

O

O

O 3’

O

O

O

O P

Mg2+

O

O

2

O H

2’

H

2’

HO

3’

Mg2+

O P O HO

H

Base N+1

O 5’

B

NR

O

Base N+1

HO

O

O

OH

O

OH

time Stem & loop RNA Unreacted RNA Low reactivity High reactivity

Low reactivity

5’

3’

Fig. 13 Mechanism of in-line probing experiment. (A) Water molecule-coordinated magnesium ion activates the 20 -OH nucleophile, which promotes nucleophilic attack on the adjacent phosphorus center. 50 -OH of the leaving group is generated by protonation from water molecules in solvent. (B) In-line probing gel shows in-line reactivity at every nucleotide position. Highly structured regions have less in-line reactivity, whereas less structured regions have high in-line reactivity. For example, stem and loop RNA would show the reactivity pattern (50 to 30 ) of low, high, and low as indicated in the figure

5. Just before loading the reacted samples, make an RNase T1 ladder and RNA alkaline ladder as follows. (a) For preparation of an RNase T1 ladder, set up a mixture of 1 μL of 50 -end labeled RNA (100–200 kcpm/μL), 8 μL of RNase T1 cocktail, and 1 μL of RNase T1 (0.5 unit/μL and 0.05 unit/μL) in a total volume of 10 μL in a PCR tube.

Inverse RNA Folding Workflow to Design and Test Ribozymes that Include. . .

139

(b) Incubate the reaction mixture at 55  C for 2–4 min, and place on dry ice to stop the reaction. (c) For preparation of RNA alkaline ladder, set up a mixture of 1 μL of 50 -end labeled RNA (100–200 kcpm/μL) and 9 μL of the RNA alkaline hydrolysis buffer in a total volume of 10 μL in a PCR tube. 6. Incubate the reaction mixture at 95  C for 2–3 min, place on ice, and add 10 μL of the formamide loading dye into the tube. 7. Separately load 4.5 μL of the in-line probing samples, 2 μL of RNase T1 ladders, and 4.5 μL of RNA alkaline hydrolysis ladder on the sequencing gel, and fractionate at 50 W for 2–3 h until the bromophenol blue dye is at the 1/3 position from the bottom of the gel. 8. Separate the glass plates and transfer the gel to a blotting paper. Cover with plastic wrap. 9. Dry the gel at 80  C for 1 h, and expose an imaging plate to the gel for overnight. 10. Visualize the RNA with a PhosphorImager (Fig. 14). 11. Open the image on ImageQuant and quantify band intensities of interest. Compare the cleavage patterns between designed and naturally occurring HDV ribozyme (see Note 6).

4

Notes 1. We found that the lowest NED values tend to occur for sequences with moderate relative folding free energy change, which can be seen by the ’v-shape’ to the base of the plot in Fig. 8. Note that the lowest free energy structures (left in Fig. 8a, b) do not have any representatives with NED below the indicated threshold. This can be understood in that the lowest folding free energy change structures have more GC base pairs, and a large number of GC pairs can allow a sequence to fold to a large number of alternative relatively low free energy structures. We also observed that natural sequences and low-NED designed sequences tend to use helices with relatively moderate folding free energy change [38]. 2. If you do not have any particular precursor sequences, we recommend 10–20 nt of a precursor sequence from a naturally occurring HDV ribozymes such as CPEB3, Spur-3, and so on. Many HDV ribozymes have been identified and summarized in the literature [36, 43, 44]. 3. T7 RNA polymerase initiates after the T7 promoter sequence. To improve transcription yields, the initiation site should start with “G.”

140

Mohammad Kayedkhordeh et al.

DHRz 2859 time (h) T1 A 0 24 46

CPEB3 time (h) T1 A 0 24 46

J4/2 P4 P1.1 P’1 P3 P1.1 P3

P2 J1/2

P1

Fig. 14 Examples of in-line probing experiments of a designed ribozyme (DHRz 2859) and a naturally occurring ribozyme (CPEB3 ribozyme). The sequencing gels show site-specific in-line reactivity, where strongly structured regions are highly protected (less band intensity) and weakly structured and single-stranded region are not protected (high band intensity). G-specific RNase T1 ladders and alkaline hydrolysis ladders (OH) are denoted by “T1” and “A,” respectively

4. If you prepare a precursor ribozyme, transcription time should be short (less than 2 h) to minimize cotranscriptional selfcleaving reaction. The actual amount of T7 RNA should be determined empirically in pilot reactions after each T7 preparation, assuming you are making it in-house. 5. Acrylamide solution: Some standard precautions are needed for acrylamide solution. 6. If the cleavage patterns of the designed ribozyme are similar to the control ribozyme (naturally occurring ribozymes), the

Inverse RNA Folding Workflow to Design and Test Ribozymes that Include. . .

141

designed ribozyme is expected to form the control ribozymelike structure. In contrast, if there are significantly cleaved- or protected regions as compared with the control ribozyme, the regions might not fold into the control ribozyme-like structure. If the more cleaved- or protected nucleotides are involved in ribozyme reaction, introducing mutations into the nucleotides potentially improves the function. For example, the reaction of DHRz 2859 was 50-fold slower than the CPEB3 ribozyme [33]. The in-line probing gel shows that the band intensity for the J4/2 of DHRz 2859 is significantly higher than the band intensity for the J4/2 of CPEB3 ribozyme, suggested that the DHRz 2859 forms slightly different, more flexible configuration of J4/2 than CPEB3 ribozyme (Fig. 14, see J4/2 regions). Because the first cytidine in J4/2 acts as a general acid in the self-cleavage reaction (Fig. 12a), folding of the region is critical for the reaction. Indeed, substitution of the J4/2 sequence in the DHRz 2859 by the analogous sequences in the CPEB3 ribozyme greatly improved the rate, where the DHRz 2859 mutant was just four-fold slower than the CPEB3 ribozyme. Thus, it is important to assess local structural differences between the designed and naturally occurring RNAs as described in this section.

Acknowledgements This study was supported by National Institutes of HealthGrants R35GM127064 to P.C.B. and R01GM076485 to D.H.M. R.Y. was supported by a JSPS Overseas Research Fellowship. References 1. Weber W, Fussenegger M (2011) Emerging biomedical applications of synthetic biology. Nat Rev Genet 13(1):21–35. https://doi. org/10.1038/nrg3094 2. Smanski MJ, Zhou H, Claesen J, Shen B, Fischbach MA, Voigt CA (2016) Synthetic biology to access and expand nature’s chemical diversity. Nat Rev Microbiol 14(3):135–149. https://doi.org/10.1038/nrmicro.2015.24 3. Glasscock CJ, Lucks JB, DeLisa MP (2016) Engineered protein machines: emergent tools for synthetic biology. Cell Chem Biol 23 (1):45–56. https://doi.org/10.1016/j. chembiol.2015.12.004 4. Baker D (2019) What has de novo protein design taught us about protein folding and biophysics? Protein Sci 28(4):678–683. https://doi.org/10.1002/pro.3588

5. Wolfe BR, Porubsky NJ, Zadeh JN, Dirks RM, Pierce NA (2017) Constrained multistate sequence design for nucleic acid reaction pathway engineering. J Am Chem Soc 139 (8):3134–3144. https://doi.org/10.1021/ jacs.6b12693 6. Gu H, Chao J, Xiao SJ, Seeman NC (2009) Dynamic patterning programmed by DNA tiles captured on a DNA origami substrate. Nat Nanotechnol 4(4):245–248. https://doi.org/ 10.1038/nnano.2009.5 7. Douglas SM, Marblestone AH, Teerapittayanon S, Vazquez A, Church GM, Shih WM (2009) Rapid prototyping of 3D DNA-origami shapes with caDNAno. Nucleic Acids Res 37(15):5001–5006. https://doi. org/10.1093/nar/gkp436 8. Chappell J, Watters KE, Takahashi MK, Lucks JB (2015) A renaissance in RNA synthetic

142

Mohammad Kayedkhordeh et al.

biology: new mechanisms, applications and tools for the future. Curr Opin Chem Biol 28:47–56. https://doi.org/10.1016/j.cbpa. 2015.05.018 9. Chworos A, Severcan I, Koyfman AY, Weinkam P, Oroudjev E, Hansma HG, Jaeger L (2004) Building programmable jigsaw puzzles with RNA. Science 306 (5704):2068–2072. https://doi.org/10. 1126/science.1104686 10. Jain S, Laederach A, Ramos SBV, Schlick T (2018) A pipeline for computational design of novel RNA-like topologies. Nucleic Acids Res 46(14):7040–7051. https://doi.org/10. 1093/nar/gky524 11. Jaeger L, Leontis NB (2000) Tecto-RNA: one-dimensional self-assembly through tertiary interactions. Angew Chem Int Ed Engl 39 (14):2521–2524. https://doi.org/10.1002/ 1521-3773(20000717)39:14%3C2521::aidanie2521%3E3.0.co;2-p 12. Tuerk C, Gold L (1990) Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 249(4968):505–510. https://doi. org/10.1126/science.2200121 13. Ellington AD, Szostak JW (1990) In vitro selection of RNA molecules that bind specific ligands. Nature 346(6287):818–822. https:// doi.org/10.1038/346818a0 14. Gold L (2015) SELEX: how it happened and where it will go. J Mol Evol 81(5–6):140–143. https://doi.org/10.1007/s00239-015-97059 15. Hofacker IL (2014) Energy-directed RNA structure prediction. Methods Mol Biol 1097:71–84. https://doi.org/10.1007/9781-62703-709-9_4 16. Seetin MG, Mathews DH (2012) RNA structure prediction: an overview of methods. Methods Mol Biol 905:99–122. https://doi. org/10.1007/978-1-61779-949-5_8 17. Markham NR, Zuker M (2008) UNAFold: software for nucleic acid folding and hybridization. Methods Mol Biol 453:3–31. https:// doi.org/10.1007/978-1-60327-429-6_1 18. Churkin A, Retwitzer MD, Reinharz V, Ponty Y, Waldispuhl J, Barash D (2018) Design of RNAs: comparing programs for inverse RNA folding. Brief Bioinform 19 (2):350–358. https://doi.org/10.1093/bib/ bbw120 19. Andronescu M, Fejes AP, Hutter F, Hoos HH, Condon A (2004) A new algorithm for RNA secondary structure design. J Mol Biol 336 (3):607–624. https://doi.org/10.1016/j. jmb.2003.12.041

20. Busch A, Backofen R (2006) INFO-RNA—a fast approach to inverse RNA folding. Bioinformatics 22(15):1823–1831. https://doi. org/10.1093/bioinformatics/btl194 21. Zadeh JN, Wolfe BR, Pierce NA (2011) Nucleic acid sequence design via efficient ensemble defect optimization. J Comput Chem 32:439–452. https://doi.org/10. 1002/jcc.21633 22. Hofacker IL, Fontana W, Stadler PF, Bonhoeffer LS, Tacker M, Schuster P (1994) Fast folding and comparison of RNA secondary structures. Monatsh Chem 125:167–168 23. Taneda A (2011) MODENA: a multi-objective RNA inverse folding. Adv Appl Bioinform Chem 4:1–12. https://dx.doi.org/10.2147% 2Faabc.s14335 24. Garcia-Martin JA, Clote P, Dotu I (2013) RNAiFOLD: a constraint programming algorithm for RNA inverse folding and molecular design. J Bioinforma Comput Biol 11 (2):1350001. https://doi.org/10.1142/ S0219720013500017 25. Aguirre-Hernandez R, Hoos HH, Condon A (2007) Computational RNA secondary structure design: empirical complexity and improved methods. BMC Bioinformatics 8:34. https://doi.org/10.1186/1471-21058-34 26. Anderson-Lee J, Fisker E, Kosaraju V, Wu M, Kong J, Lee J, Lee M, Zada M, Treuille A, Das R, Eterna P (2016) Principles for predicting RNA secondary structure design difficulty. J Mol Biol 428(5 Pt A):748–757. https://doi. org/10.1016/j.jmb.2015.11.013 27. Andronescu M, Condon A, Turner DH, Mathews DH (2014) The determination of RNA folding nearest neighbor parameters. Methods Mol Biol 1097:45–70. https://doi.org/10. 1007/978-1-62703-709-9_3 28. Garcia-Martin JA, Dotu I, Clote P (2015) RNAiFold 2.0: a web server and software to design custom and Rfam-based RNA molecules. Nucleic Acids Res 43(W1): W513–W521. https://doi.org/10.1093/ nar/gkv460 29. Garcia-Martin JA, Clote P, Dotu I (2013) RNAiFold: a web server for RNA inverse folding and molecular design. Nucleic Acids Res 41 (Web Server issue):W465–W470. https://doi. org/10.1093/nar/gkt280 30. Liu B, Mathews DH, Turner DH (2010) RNA pseudoknots: folding and finding. F1000 Biol Rep 2:8. https://doi.org/10.3410/B2-8 31. Reuter JS, Mathews DH (2010) RNAstructure: software for RNA secondary structure prediction and analysis. BMC Bioinformatics

Inverse RNA Folding Workflow to Design and Test Ribozymes that Include. . . 11:129. https://doi.org/10.1186/14712105-11-129 32. Dotu I, Garcia-Martin JA, Slinger BL, Mechery V, Meyer MM, Clote P (2014) Complete RNA inverse folding: computational design of functional hammerhead ribozymes. Nucleic Acids Res 42(18):11752–11762. https://doi.org/10.1093/nar/gku740 33. Yamagami R, Kayedkhordeh M, Mathews DH, Bevilacqua PC (2019) Design of highly active double-pseudoknotted ribozymes: a combined computational and experimental study. Nucleic Acids Res 47(1):29–42. https://doi.org/10. 1093/nar/gky1118 34. Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22:4673–4680. https:// doi.org/10.1186/1471-2105-11-129 35. Crooks GE, Hon G, Chandonia JM, Brenner SE (2004) WebLogo: a sequence logo generator. Genome Res 14(6):1188–1190. https:// doi.org/10.1101/gr.849004 36. Webb CH, Riccitelli NJ, Ruminski DJ, Luptak A (2009) Widespread occurrence of selfcleaving ribozymes. Science 326(5955):953. https://doi.org/10.1126/science.1178084 37. Kalvari I, Argasinska J, Quinones-Olvera N, Nawrocki EP, Rivas E, Eddy SR, Bateman A, Finn RD, Petrov AI (2018) Rfam 13.0: shifting to a genome-centric resource for non-coding RNA families. Nucleic Acids Res 46(D1): D335–D342. https://doi.org/10.1093/nar/ gkx1038

143

38. Bellaousov S, Kayedkhordeh M, Peterson RJ, Mathews DH (2018) Accelerated RNA secondary structure design using pre-selected sequences for helices and loops. RNA 24:1555–1567. https://doi.org/10.1261/ rna.066324.118 39. Bellaousov S, Mathews DH (2010) ProbKnot: fast prediction of RNA secondary structure including pseudoknots. RNA 16:1870–1880. https://doi.org/10.1261/rna.2125310 40. Fay MM, Lyons SM, Ivanov P (2017) RNA G-quadruplexes in biology: principles and molecular mechanisms. J Mol Biol 429 (14):2127–2147. https://doi.org/10.1016/j. jmb.2017.05.017 41. Dhapola P, Chowdhury S (2016) QuadBase2: web server for multiplexed guanine quadruplex mining and visualization. Nucleic Acids Res 44 (W1):W277–W283. https://doi.org/10. 1093/nar/gkw425 42. Regulski EE, Breaker RR (2008) In-line probing analysis of riboswitches. Methods Mol Biol 419:53–67. https://doi.org/10.1007/978-159745-033-1_4 43. Webb CH, Luptak A (2011) HDV-like selfcleaving ribozymes. RNA Biol 8(5):719–727. https://doi.org/10.4161/rna.8.5.16226 44. Salehi-Ashtiani K, Luptak A, Litovchick A, Szostak JW (2006) A genomewide search for ribozymes reveals an HDV-like sequence in the human CPEB3 gene. Science 313 (5794):1788–1792. https://doi.org/10. 1126/science.1129308

Part III Ribozyme Structure

Chapter 9 Using an L7Ae-Tethered, Hydroxyl Radical-Mediated Footprinting Strategy to Identify and Validate Kink-Turns in RNAs Stella M. Lai and Venkat Gopalan Abstract Kink-turns are important RNA structural modules that facilitate long-range tertiary interactions and form binding sites for members of the L7Ae family of proteins. Present in a wide variety of functional RNAs, kink-turns play key organizational roles in many RNA-based cellular processes, including translation, modification, and tRNA biogenesis. It is important to determine the contribution of kink-turns to the overall architecture of resident RNAs, as these modules dictate ribonucleoprotein (RNP) assembly and function. This chapter describes a site-directed, hydroxyl radical-mediated footprinting strategy that utilizes L7Ae-tethered chemical nucleases to experimentally validate computationally identified kink-turns in any RNA and under a wide variety of conditions. The work plan described here uses the catalytic RNase P RNA as an example to provide a blueprint for using this footprinting method to map RNA–protein interactions in other RNP complexes. Key words hydroxyl radical footprinting, L7Ae, kink-turn, RNA–protein interactions, RNase P, ribonucleoprotein complex

1

Introduction The striking functional versatility of RNAs in ribonucleoprotein (RNP) complexes relies on the exquisite coordination between constituent RNA and protein subunits. To understand this functional interplay within RNPs, it is important to uncover the structural and dynamic changes that accompany RNP assembly. While chemical- and nuclease-based protection assays are traditionally used to map RNA–protein contacts, their results must be interpreted with caution, as it can be difficult to differentiate between RNA cleavage pattern changes that arise from direct protein binding versus RNA structural rearrangements that are associated with RNP assembly. This chapter describes an alternative, sequence- and structure-unbiased approach that utilizes tethered chemical nucleases and hydroxyl radical (OH
)-mediated footprinting to

Robert J. Scarborough and Anne Gatignol (eds.), Ribozymes: Methods and Protocols, Methods in Molecular Biology, vol. 2167, https://doi.org/10.1007/978-1-0716-0716-9_9, © Springer Science+Business Media, LLC, part of Springer Nature 2021

147

148

Stella M. Lai and Venkat Gopalan

localize the binding sites of RNA-binding proteins on their cognate RNAs. The utility of this strategy is highlighted using L7Ae, a multi-functional protein that binds kink-turns, and an RNase P RNA (RPR) as exemplars. The kink-turn is a well-characterized, widespread RNA structural module that induces pronounced axial bending of the RNA helix [1–3]. Standard kink-turns are defined by a 50 canonical (C) helix with Watson–Crick base pairing, a three-nucleotide bulge, and a 30 non-canonical (NC) helix with two consecutive trans G(sugar-edge)lA(Hoogsteen-edge) base pairs (see Fig. 1, inset). The RNA kinks and twists due to the juxtaposition of the two minor grooves of the duplex RNA, hydrogen bonding between L1 and A1n as well as 1n and A2b, and stacking interactions between L1 and L2 and the ends of the C and NC helices, respectively [4]. Kink-turn-containing RNAs, which include ribosomal (r)RNAs [5–7], riboswitches [8], C/D and H/ACA guide small nucleolar (sno)RNAs [9–11], human U4 small nuclear (sn)RNA [12], and RPRs [13–16], sample two distinct conformations [17, 18]: a standard three-nucleotide bulge within an RNA duplex [19] and a sharply kinked structure with an included angle of ~50 , which is stabilized by mono- or divalent cations (particularly magnesium) [17, 20, 21], long-range tertiary interactions [8], and/or protein binding [1–3, 10, 11, 22]. Though some putative kink-turns have been identified based on sequence homology [14], others have been identified from nuclear magnetic resonance (NMR) spectroscopy- and X-ray crystallography-based studies of proteins bound to kink-turn-containing RNAs [1, 9–12, 22, 23]. L7Ae and its homologs, including L30e, S12e [24], Nhp2p [25], Snu13p [26], and human 15.5-kDa protein [12], are the archetypical proteins that specifically recognize and bind kink-turns with high affinity. A universally conserved NEXXK motif utilizes side-chain and backbone contacts to hydrogen bond to G1b and G2n in the NC helix of the kink-turn (see Fig. 1, inset). While mutating the sheared GlA base pairs results in loss of L7Ae binding and RNP complex assembly [27, 28], collectively mutating all three key residues of the NEXXK motif abolishes function [13]. In addition, Arg46 and Val95 [Pyrococcus furiosus (Pfu) L7Ae numbering] are two highly conserved residues ( 97%) [29] that play important roles in RNA recognition (see Fig. 1) [1, 9, 10, 14]. Arg46 contributes to the electrostatic stabilization of the RNA–protein complex, hydrogen bonds to the proS non-bridging oxygen atoms of the 3n/4n and 4n/5n phosphates of the RNA backbone [1, 2], and interacts with A1n and G2n of the GlA base pairs [14]. Situated on the opposite end of the RNA-binding interface, Val95 forms one side of a hydrophobic pocket that binds an extruded L3 [9, 10] and makes close van der Waals contacts with L1 and L2 [1, 2, 14].

Using an L7Ae-Tethered, Hydroxyl Radical-Mediated Footprinting Strategy to. . .

149

Fig. 1 Tertiary structure of Pfu L7Ae in complex with RNA [PDB: 3NVI [22]]. (Inset) Standard kink-turn module with a canonical (C) helix, a three-nucleotide bulge, two sheared GlA base pairs, and a non-canonical (NC) helix; these structural elements are color-coded in both the inset and the tertiary structure. Bulge nucleotides are denoted with an L and numbered sequentially 50 ! 30 , whereas other nucleotides are identified based on their position within each helix of the kink-turn and their resident strand (b, bulge-containing strand; n, non-bulged strand) [21]. Nucleotides in the NC helix are indicated with positive integers and numbered 50 ! 30 from the first GlA base pair while nucleotides in the C helix are designated with negative integers and numbered in descending order 30 ! 50 . Positions where single-cysteine substitutions were made in Ref. 14
for OH -mediated footprinting experiments are highlighted. (Reproduced from [14] with permission from Oxford University Press)

Given the specificity with which L7Ae binds kink-turns and the highly conserved nature of that interaction, it is an ideal tool for experimentally validating computationally identified kink-turns, particularly those that deviate from the consensus sequence/structure or are formed by nucleotides that are distal in sequence and space [30, 31]. By covalently attaching an ethylenediaminetetraacetic acid (EDTA)-Fe moiety to engineered single-cysteine residues

150

Stella M. Lai and Venkat Gopalan

at or near the protein’s RNA-binding interface, L7Ae can be utilized in site-directed OH
-mediated footprinting experiments to identify its binding sites in an RNA of interest and, by extension, the location of kink-turns with single-nucleotide resolution. This OH
-probing approach is appealing because it is a solution-based method that does not require large volumes or high concentrations of the species of interest, it will proceed under a variety of assay conditions (e.g., wide-ranging mono- and divalent ion concentrations), and it can be performed in isolation (i.e., RNA of interest + L7Ae alone) or in the presence of either partial assemblies (to parse the role and contribution of each subunit and/or identify minimal functional complexes) or entire RNP complexes (e.g., box C/D or H/ACA snoRNPs, RNase P). OH
-mediated footprinting is predicated on the Fenton reaction [32], wherein the addition of hydrogen peroxide and ascorbate following assembly of the RNP of interest leads to the irondependent generation of hydroxyl radicals and subsequent RNA cleavage. In the footprinting method described here, ascorbate reduces the EDTA-Fe(III) that is covalently tethered to a single cysteine in L7Ae to EDTA-Fe(II), which then reacts with hydrogen peroxide to generate Fe(III) and a highly reactive OH
. While ascorbate again reduces Fe(III) to Fe(II) for additional rounds of OH
generation, highly reactive radicals induce oxidative degradation of proximal ribose units, thereby cleaving the phosphodiester backbone in a sequence- and secondary structure-independent manner. Due to the short lifetime of radicals in solution, OH
-mediated ˚ radius of the site of attack on the RNA is limited to within a ~10 A ˚ generation: the Fe atom located only ~14 A away from the Cα of the tethered cysteine. Thus, the OH
-mediated cleavages can localize L7Ae’s binding site on the RNA with single-nucleotide resolution. (Non-specific hydroxyl radical footprinting proceeds in a similar fashion, albeit with direct addition of chelated EDTA-Fe (III) and the associated differences in read-out and data analysis [33–35].) This site-specific, protein-tethered footprinting strategy has been previously used with EDTA-2-aminoethyl 2-pyridyl disulfide-Fe (EPD-Fe) to examine the tertiary fold of staphylococcal nuclease [36–38], characterize DNA–protein complexes [39–41], and localize the binding sites of Escherichia coli C5 protein on its cognate M1 RNA [42]. A similar sulfhydryl-specific EDTA-Fe analog, 1-( p-bromoacetamidobenzyl)-EDTA-Fe (BABE-Fe), has been used to map RNA–protein interactions within the translation machinery [43–47] and HIV-1 Tat-TAR complex [48, 49] and determine the orientation of human U1A protein bound to the U1 snRNA [50]. Here, we describe a site-directed, L7Ae-tethered, hydroxyl radical-mediated footprinting strategy for the robust and sensitive identification and validation of kink-turns in RNAs; the catalytic RNase P RNA has been used here as an example. Required starting

Using an L7Ae-Tethered, Hydroxyl Radical-Mediated Footprinting Strategy to. . .

151

materials include the in vitro transcribed [51] or chemically synthesized [52, 53] RNA of interest as well as L7Ae derivatives with single-cysteine substitutions at or proximal to the RNA-binding surface (e.g., Arg46Cys, Val95Cys) that have been purified to near homogeneity and free of nucleic acids [14, 54]. In this protocol, EPD-Fe is covalently tethered to single-cysteine residues to generate chemical nucleases that can be used to interrogate any number of RNAs for the presence of kink-turns. EDTA-Fe(II)-catalyzed scissions in the RNA backbone are then detected using primer extension with appropriate 32P-labeled primers before the resultant cDNAs are resolved using denaturing polyacrylamide gel electrophoresis and analyzed. This method has been successfully used to characterize the binding of Pfu L7Ae on wild-type and mutant kink-turn-containing variants of Pfu RPR with Pfu L7Ae Lys42Cys/Cys71Val, Arg46Cys/Cys71Val, and Val95Cys/ Cys71Val as site-specific chemical nucleases [14, 15].

2

Materials Prepare all solutions using autoclaved ultrapure water (ddH2O; i.e., reverse osmosis-filtered or double distilled/deionized water purified to a resistivity of 18.2 MΩlcm at 25 C) and appropriate analytical-grade reagents (see Note 1). Store all prepared reagents at room temperature (20–25 C, henceforth denoted as RT) unless otherwise indicated below.

2.1 Modification of L7Ae with EDTA-2-aminoethyl 2-pyridyl disulfide-Fe (EPD-Fe)

1. Single-cysteine L7Ae derivatives (see Notes 2 and 3). 2. Buffer F+: 10 mM Tris–HCl (pH 8), 5 mM dithiothreitol (DTT) (see Note 4). 3. Buffer F: 10 mM Tris–HCl (pH 8). 4. 20 mM EDTA-2-aminoethyl 2-pyridyl disulfide (EPD) (Toronto Research Chemicals) (see Note 5): Dissolve in ddH2O and store at 20 C. 5. 50 mM ferric chloride (FeCl3): Dissolve in ddH2O. 6. MicroSpin G-25 Sephadex columns.

2.2 EDTA-Fe(II)Catalyzed Hydroxyl Radical Footprinting

1. Unlabeled RNA of interest. 2. 2 binding buffer specific for the L7Ae and RNA of interest (see Note 6). 3. Optional. Other proteins in the RNP complex (see Note 7). 4. 3% (v/v) hydrogen peroxide (H2O2): Freshly dilute a 30% (v/v) commercial stock with ddH2O immediately prior to use and discard at the end of the experiment; keep the commercial stock tightly capped and store at 4 C.

152

Stella M. Lai and Venkat Gopalan

5. 0.3 M L-ascorbic acid: Prepare fresh immediately prior to use and discard at the end of the experiment (see Note 8). 6. 0.2 M thiourea: Prepare fresh immediately prior to use and discard at the end of the experiment. 7. Thin-walled PCR tubes. 8. Liquid nitrogen. 9. 20 mg/mL (w/v) proteinase K. 10. Buffer-saturated phenol (pH 7.9) (see Note 9). 11. Chloroform. 12. 20 mg/mL (w/v) glycogen. 13. 3 M sodium acetate (pH 5.2). 14. 100% (v/v) ethanol. 15. 75% (v/v) ethanol. 2.3 Primer Extension and Analysis
of OH -Cleaved RNAs

1. 10 μM GSPs complementary to different regions of the RNA (see Note 10).

2.3.1 5 0 -Labeling of Gene-Specific Primers (GSPs) with [γ-32P]Adenosine5 0 -Triphosphate (ATP)

3. 10 U/μL T4 polynucleotide kinase (PNK) and 10 T4 PNK reaction buffer (see Note 11).

2. [γ-32P]-ATP (4500 Ci/mmol, 10 μCi/μL).

4. 2 urea dye: 7 M urea, 1 mM EDTA, 0.05% (w/v) xylene cyanol, 0.05% (w/v) bromophenol blue, 10% (v/v) phenol (see Note 12). 5. 8% (w/v) acrylamide:bisacrylamide (19:1)/7 M urea gel solution: Combine 420 g urea, 10.8 g Tris, 5.5 g boric acid, 4 mL 0.5 M EDTA (pH 8), 76 g acrylamide, and 4 g N-N 0 -methylene-bis-acrylamide; add ddH2O to 1 L; filter; and store (wrapped in foil) at 4 C. 6. 10% (w/v) ammonium persulfate (APS). 7. Tetramethylethylenediamine (TEMED). 8. Autoradiography film. 9. Phosphorescent marker-containing stickers. 10. Gel elution buffer: 20 mM Tris–HCl (pH 7.5), 100 mM NaCl, 1 mM EDTA, 0.01% (w/v) sodium dodecyl sulfate (SDS). 11. Cellulose acetate-based centrifuge tube filters. 12. 20 mg/mL (w/v) glycogen. 13. 3 M sodium acetate (pH 5.2). 14. 100% (v/v) ethanol. 15. 75% (v/v) ethanol.

Using an L7Ae-Tethered, Hydroxyl Radical-Mediated Footprinting Strategy to. . . 2.3.2 Generation of Reference DNA Sequencing Ladders

153

1. 50 -32P-labeled GSPs. 2. 10 mM deoxynucleoside triphosphates (dNTPs). 3. 1 μM unlabeled GSPs. 4. 3 μM unlabeled RNA. 5. 5 mM dideoxynucleoside triphosphates (ddNTPs). 6. 200 U/μL Maxima H Minus Reverse Transcriptase (RTase) and 5 RT Buffer (Thermo Scientific) (see Note 13). 7. 20 U/μL terminal (deoxynucleotidyl) transferase (TdT) (see Note 14). 8. 4 N sodium hydroxide (NaOH): Dissolve 160 mg NaOH in a final volume of 1 mL ddH2O. 9. 2.5 Tris/Borate/EDTA (TBE) buffer: 222.5 mM Tris, 222.5 mM boric acid, 5 mM EDTA. 10. Stop dye: 85% (v/v) formamide, 0.25 TBE buffer, 50 mM EDTA (pH 8), 0.05% (w/v) bromophenol blue, 0.05% (w/v) xylene cyanol. 11. Acid stop mix: 4:25 (v/v) mixture of 1 M unbuffered Tris–HCl and stop dye.

2.3.3 Revers Transcription (RT) of Cleared RNAs 2.3.4 Denaturing Polyacrylamide Sequencing Gel-Based Separation of cDNAs

See 2.3.2 for the list of required materials.

1. Siliconizing reagent (see Note 15). 2. 95% (v/v) ethanol. 3. 100% (v/v) acetone. 4. SequaGel UreaGel (acrylamide:bisacrylamide 19:1) System (see Note 16). 5. 10% (w/v) APS. 6. TEMED. 7. 0.5 TBE buffer: 44.5 mM Tris, 44.5 mM boric acid, 1 mM EDTA. 8. Fixing solution: 10% (v/v) glacial acetic acid, 10% (v/v) methanol. 9. Filter paper (33 cm  43 cm).

3

Methods

3.1 Modification of L7Ae with EDTA2-aminoethyl 2-pyridyl disulfide-Fe (EPD-Fe) (See Fig. 2)

1. Dialyze single-Cys L7Ae mutant derivative against 1 L of Buffer F+ for 1 h at RT to reduce any disulfide bonds (see Note 17) before dialyzing the reduced L7Ae sample against 3  1-L Buffer F (~20 min each at RT) (see Note 18). 2. Recover the dialyzed sample, and quantitate the protein concentration by measuring A280.

154

Stella M. Lai and Venkat Gopalan

Fig. 2 Reaction scheme for the modification of single-cysteine-containing L7Ae derivatives (L7Ae-EPD-M). EDTA-2-aminoethyl 2-pyridyl sulfide (EPD) chelates metals (M) such as iron with high affinity and reacts with surface-exposed thiols in the target protein to generate a site-specific nuclease for OH
-mediated footprinting. 2-Pyridylthiol is generated as a product. (Reproduced from [14] with permission from Oxford University Press)

3. Calculate the amount of protein, EPD, and FeCl3 needed for a ten-fold molar excess of EPD-Fe over L7Ae in a final reaction volume of 50 μL. Calculate the protein concentration following modification (see Note 19). 4. In a separate tube, charge the appropriate amount of EPD with an equimolar amount of FeCl3 by pipetting up and down for 3 min and letting the sample incubate for an additional 12 min at RT. 5. Add the resultant EPD-Fe complex to the appropriate amount of protein, pipet up and down for 3 min, and allow the sample to incubate for an additional 12 min at RT. 6. Prepare a MicroSpin G-25 Sephadex column per manufacturer’s instructions immediately prior to use (see Note 20). 7. Carefully load the modified sample on the column (see Note 21), and collect the void volume by spinning at 735  g for 2 min (see Note 22). 8. Store the modified L7Ae sample as 5-μL aliquots at 80 C until use. 9. Use mass spectrometry to verify successful modification (see Note 23). 10. Use functional assays appropriate for the RNP complex of interest to assess the ability of each unmodified and EPD-Femodified L7Ae derivative to support assembly and/or activity. Compare with the activities of RNP complexes assembled with the wild-type and cysteine-less “parental” references (where appropriate) (see Note 24). 3.2 EDTA-Fe(II)Catalyzed Hydroxyl Radical Footprinting

The concentrations (e.g., a ten-fold excess of protein over RNA) and conditions indicated below have been optimized for assembly, activity, and footprinting of Pfu RNase P at 55 C [14, 15, 55]. Modify as needed to reflect optimal binding parameters for

Using an L7Ae-Tethered, Hydroxyl Radical-Mediated Footprinting Strategy to. . .

155

L7Ae and the RNA of interest (see Note 6), and conduct pilot footprinting experiments to identify optimal footprinting conditions for the system of interest (see Note 25). 1. For each footprinting reaction (50 μL total), incubate 10 μL 0.25 μM (or 2.5 pmol) RNA in ddH2O for 50 min at 50 C and 10 min at 37 C. Then add 10 μL 2 binding buffer, and incubate for an additional 30 min at 37 C. (Folded RNA can be stored at RT until use.) 2. While the RNA is folding, freshly prepare: l

l

l

l

25 μM working stocks of unmodified and modified L7Ae in 1 binding buffer Reaction master mix (29 μL/reaction) containing 1 binding buffer and, if needed, 0.86 μM (or 25 pmol) of any other proteins in the RNP complex (see Note 7). 0.3 M L-ascorbic acid, 3% (v/v) H2O2, and 0.2 M thiourea (see Note 8). Initiation mix (enough for 54 reactions) containing 175 μL ddH2O, 100 μL 3% (v/v) H2O2, and 25 μL 0.3 M Lascorbic acid (final concentrations: 1% (v/v) H2O2, 25 mM L-ascorbic acid).

3. Aliquot 29 μL master mix into thin-walled PCR tubes labeled for each unmodified or modified L7Ae derivative. 4. Immediately prior to reconstitution of each RNP complex, add 1 μL 25 μM unmodified or modified L7Ae derivative to the appropriate PCR tube, and pipet up and down to mix. 5. Add 20 μL folded RNA to the PCR tube, and pipet up and down to mix. 6. To reconstitute the RNP complex, incubate the 50-μL reaction for an appropriate amount of time at the temperature optimal for RNP assembly and function (see Notes 6 and 24). 7. Initiate OH
-mediated cleavages by adding 5.5 μL of the freshly prepared initiation mix and vortexing gently. 8. Incubate the reaction for 2 min at the temperature used for reconstitution of the RNP complex. 9. Terminate the reaction by adding 6.2 μL of freshly prepared 0.2 M thiourea, a OH
scavenger, and immersing the entire tube in liquid nitrogen. 10. Thaw the reaction carefully (see Note 26), and add 2 μL 20 mg/mL (w/v) proteinase K prior to incubation for 30 min at 65 C. 11. Transfer each reaction to a 1.5-mL tube. 12. Remove proteins from the footprinting reaction using a two-step phenol-chloroform/chloroform extraction:

156

Stella M. Lai and Venkat Gopalan l

l

Add 35 μL each of buffer-saturated phenol (pH 7.9) and chloroform, vortex vigorously for 30 s, centrifuge at ~20,000  g for 10 min, and carefully transfer the aqueous phase (top layer) to a clean 1.5-mL tube. Add 70 μL chloroform, vortex vigorously for 30 s, centrifuge at ~20,000  g for 10 min, and carefully transfer the aqueous phase (top layer) to a clean 1.5-mL tube.

13. Recover the RNA via ethanol precipitation by adding 8 μL 3 M sodium acetate (pH 5.2), 2 μL 20 mg/mL (w/v) glycogen, and 200 μL 100% (v/v) ethanol. 14. Mix well, and incubate at 80 C overnight (~16 h) (see Note 27). 15. Centrifuge at ~20,000  g for 15 min, and discard the supernatant. 16. Add 1 mL 75% (v/v) ethanol, and vortex the pellet vigorously. 17. Centrifuge at ~20,000  g for 15 min, and discard all of the supernatant. 18. Allow the pellet to air dry, and resuspend in 11 μL ddH2O. 19. Store at 20 C until use. 3.3 Primer Extension and Analysis of
OH -Cleaved RNAs 3.3.1 5 0 -Labeling of Gene-Specific Primers (GSPs) with [γ-32P]-Adenosine5 0 -Triphosphate (ATP)

1. Transfer 1.5 μL 10 μM GSP to a thin-walled PCR tube, and incubate for 3 min at 100 C before snap cooling on ice for ~20 min. 2. Add 2 μL ddH2O, 1 μL 10 T4 PNK buffer, 1 μL 10 U/μL T4 PNK, and 4.5 μL [γ-32P]-ATP to the heat-denatured primer, and incubate for ~1 h at 37 C. 3. Quench the labeling reaction with an equal volume of 2 urea dye, and separate the labeled GSPs from unincorporated nucleotides using 8% (w/v) polyacrylamide/8 M urea gel electrophoresis (see Notes 28 and 29). 4. Pry apart the gel plates carefully, and remove the top glass plate from the gel. 5. Cover the exposed side of the gel with plastic wrap. 6. Place phosphorescent marker-containing stickers (that have been exposed to light for an empirically determined amount of time before use) over a region of the gel where labeled primers are not expected to migrate. 7. Visualize the 50 -labeled primers by exposing the gel to autoradiography film for 30–90 s (depending on the amount of radioactivity used per reaction). The GSPs and phosphorescent marker will appear as dark bands on film, and the bands corresponding to the marker can be used to precisely position

Using an L7Ae-Tethered, Hydroxyl Radical-Mediated Footprinting Strategy to. . .

157

the film on top of the gel. Once properly positioned, tape the film to the gel to keep it firmly in place. 8. Excise the band corresponding to each GSP using a new razor blade, and carefully transfer it, without the plastic wrap, to a 1.5-mL tube. 9. Crush the band using a pipette tip, and elute each labeled GSP in 350 μL gel elution buffer at 37 C (2 h to overnight). 10. Remove gel fragments using a cellulose acetate-based centrifuge tube filter, and recover the labeled DNA via ethanol precipitation. 11. Use a benchtop instrument or liquid scintillation analyzer to quantitate the recovered radioactivity. 3.3.2 Generation of Reference DNA Sequencing Ladders

1. Prepare a 4.5 master primer mix containing 4.5 μL 1 μM unlabeled GSP, 2.25 μL 10 mM dNTPs, and 5  105 disintegrations per minute (dpm) 50 -32P-labeled GSP, and add ddH2O to a final volume of 13.5 μL. 2. In four separate thin-walled PCR tubes (one per sequencing reaction: A, C, G, and T), add 3 μL master primer mix to 6 μL ddH2O, 2 μL 3 μM unmodified (i.e., full-length) RNA, and 2 μL 5 mM respective ddNTP. 3. Incubate each reaction for 3 min at 100 C, and snap cool on ice. 4. Prepare a 4.5 master RT mix containing 11.25 μL ddH2O, 18 μL 5 RT buffer, and 2.25 μL 200 U/μL Maxima H Minus RTase (see Note 13), and add 7 μL to each of the sequencing reactions. 5. After incubation in a thermal cycler for 1 min at 42 C and 30 min at 50 C, add 1 μL 20 U/μL TdT to each reaction, and incubate for 30 min at 37 C (see Note 14). 6. Add 1 μL 4 N NaOH to each reaction, and incubate for 5 min at 95 C to hydrolyze the RNA. 7. Add 29 μL acid stop mix to each reaction, mix well, and store at 20 C until use.

3.3.3 Reverse Transcription of Cleaved RNAs

1. Prepare a master primer mix for the appropriate number of cleaved RNA samples. For each reaction, combine 0.5 μL 1 μM unlabeled GSP, 0.5 μL 10 mM dNTPs, and 1–3  105 dpm 50 -32P-labeled GSP (see Note 30), and add ddH2O to a final volume of 1.5 μL. 2. For each cleaved RNA sample, aliquot 5 μL cleaved RNA (see Note 31) in a thin-walled PCR tube, and add 1.5 μL master primer mix.

158

Stella M. Lai and Venkat Gopalan

3. Incubate each reaction for 3 min at 100 C, and snap cool on ice. 4. Prepare a master mix, adjusting the volume for the appropriate number of samples. For each RT reaction, combine 1 μL ddH2O, 2 μL 5 RT buffer, and 0.5 μL 200 U/μL Maxima H Minus RTase. 5. Add 3.5 μL master RT mix to each reaction, and incubate in a thermal cycler for 1 min at 42 C and 30 min at 50 C. 6. Add 0.5 μL 4 N NaOH to each reaction, and incubate for 5 min at 95 C to hydrolyze the RNA. 7. Add 14.5 μL acid stop mix to each reaction, mix well, and store at 20 C until use. 3.3.4 Denaturing Polyacrylamide Sequencing Gel-Based Separation of cDNAs

1. Clean both glass sequencing gel plates thoroughly using a Kimwipe and 95% (v/v) ethanol. 2. Siliconize the smaller of the two plates by using a Kimwipe to spread a thin, even layer of siliconizing reagent over the entire surface (see Note 15). 3. Remove excess siliconizing agent by cleaning the glass twice with 95% (v/v) ethanol and once with 100% (v/v) acetone. Use a fresh Kimwipe for each cleaning step. 4. Assemble the gel-plate sandwich using spacers and a comb of 0.2-mm thickness. 5. Combine 800 μL 10% (w/v) APS, 58 mL cold UreaGel Diluent, 10 mL UreaGel Buffer, 32 mL UreaGel Concentrate, and 80 μL TEMED (in that order) in a 150-mL beaker on ice (see Note 16), and carefully mix using a 60-mL syringe. This mixture yields 100 mL of 8% (w/v) polyacrylamide/8 M urea gel mix. 6. Proceed quickly, and carefully pour the gel. Allow to polymerize for 1–2 h. 7. Optional. After removing the comb and setting up the gel on the electrophoresis apparatus, thoroughly clean out the wells, and load 5 μL 2 urea dye in each well (see Note 32). 8. Pre-run the gel in 0.5 TBE buffer for 20 min at 1500 V (see Note 33). 9. Meanwhile, incubate the products of the reverse transcription reactions for 20 min at 85 C to denature any cDNA secondary structure. 10. Load 5 μL of each cDNA sample alongside its respective DNA sequencing ladder, and electrophorese at 1500 V for an appropriate amount of time (see Note 28).

Using an L7Ae-Tethered, Hydroxyl Radical-Mediated Footprinting Strategy to. . .

159

11. Following electrophoresis, allow the gel to cool to RT (10–15 min) prior to disassembly. 12. Pry apart the gel-plate sandwich carefully, and remove the siliconized smaller plate. 13. Immerse the sequencing gel, which should still be adhered to the large plate, in a deep tray containing the pre-mixed fixing solution. 14. Incubate for 15 min at RT before carefully removing the assembly and decanting any remaining fixing solution. 15. Lay the filter paper on the gel, and smooth out any bubbles to ensure that the gel fully adheres to the filter paper. 16. Pull the filter paper back slowly, ensuring that the entire gel peels away with the paper. 17. Cover the exposed gel with plastic wrap, and dry it under vacuum for 2 h at 80 C using a gel dryer-vacuum pump setup (see Note 34). 18. Place the dried gel in an exposure cassette, and expose to a phosphorimager screen for several hours (see Note 35) before scanning using a phosphorimager. Reverse transcription products will appear as dark bands in the scanned image. 3.3.5 Analysis
of OH -Mediated Footprinting Data

1. Use image analysis software to compare band intensities of modified sample lanes to those of unmodified sample lanes. For each pair of reactions (e.g., unmodified vs. modified Arg46Cys), intense bands (i.e., cleavages) that are present in the modified sample lane but not in the unmodified sample lane are indicative of OH
-mediated footprints (i.e., L7Ae binding; see Fig. 3). 2. Map any footprints to the sequence of the RNA using their respective sequencing ladders. ddNTP-containing reactions report on the complementary base (i.e., a band in the ddATP sequencing reaction corresponds to a U in the RNA sequence). 3. For a more quantitative approach, use image and data analysis software to quantitate, plot, and overlay the radioactivity profile at every position in each lane, including those for the sequencing ladder (see Fig. 4). For each pair of reactions (e.g., unmodified vs. modified Arg46Cys), peaks that are taller in the modified sample trace than in the unmodified sample trace are indicative of OH
-mediated footprints (i.e., L7Ae binding). 4. Map any footprints to the sequence of the RNA by using the overlaid sequencing ladder traces as reference.

160

Stella M. Lai and Venkat Gopalan

Fig. 3 Representative denaturing polyacrylamide sequencing gel-based analysis
of OH -mediated cleavages of the Pfu RPR by EPD-Fe-modified L7Ae mutant derivatives. Intense bands that are only present in the modified sample lane
indicate OH -mediated scissions of the RNA backbone. Nucleotide numbers are indicated on the left. U, unmodified; M, EPD-Fe-modified. (Reproduced from [14] with permission from Oxford University Press)

Using an L7Ae-Tethered, Hydroxyl Radical-Mediated Footprinting Strategy to. . .

161




Fig. 4 Representative plot comparing the band intensities of OH -mediated cleavages by unmodified and EPDFe-modified L7Ae derivatives. Nucleotide positions in the Pfu RPR (identified using the sequencing ladder) are plotted on the x-axis while individual band intensities (in arbitrary units) are plotted on the y-axis. Taller peaks
in the modified sample trace indicate OH -mediated cleavages of the Pfu RPR backbone. (Reproduced from [14] with permission from Oxford University Press)

4

Notes 1. Diethyl polycarbonate (DEPC)-treated water is not necessary for most, if any, RNA-based experiments, provided that reasonable efforts are made to minimize RNase contamination. Commercially available RNase decontamination reagents or 0.1 N NaOH can be used to decontaminate labware prior to starting RNA-based experiments and/or after suspected RNase contamination. 2. While glycerol is often included in storage buffers to promote long-term protein stability and prevent ice formation upon cold storage, it is an efficient OH
scavenger and can inhibit the OH
-mediated cleavage reaction at concentrations as low as 0.5% [33, 56, 57]. Minimize its presence in footprinting experiments by either (a) omitting glycerol from storage buffers when it has been empirically determined that optimal storage conditions do not require its presence or (b) fully exchanging any proteins stored in the presence of glycerol into a glycerol-free buffer prior to modification. 3. To ensure that unmodified and modified L7Ae samples are sufficiently concentrated enough for subsequent dilution with

162

Stella M. Lai and Venkat Gopalan

binding buffer for footprinting experiments (see Subheading 3.2), ~100 μM starting stocks of L7Ae are recommended. 4. While dependent on pH and temperature, the recorded halflife of DTT in aqueous solution can be measured in hours. Minimize thawing and exposure to RT and air to prolong DTT’s reducing ability, and only add to buffers immediately prior to use. 5. EPD is also referred to as N-[S-(2-Pyridylthio)cysteaminyl] ethylenediamine-N,N,N0 ,N0 -tetraacetic acid, monoamide. 6. If not already defined in the literature, optimal binding parameters for the L7Ae and RNA of interest (e.g., buffer, temperature, RNA and protein concentrations) must be empirically determined using, for example, electrophoretic mobility shift assays (EMSAs) [58] or filter binding assays [59]. Omit polyhydroxylated compounds such as glycerol, alcohols, and sugars, as they are efficient OH
scavengers [56, 57]. Phosphate and Tris buffers should also be avoided [60]; while phosphate buffer significantly decreases OH
generation via the Fenton reaction, Tris also weakly chelates iron and can act as a OH
scavenger. HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) can also inhibit the OH
-mediated cleavage reaction, albeit to a lesser extent than phosphate or Tris buffers [60]. 7. The goal of the experiment dictates whether the inclusion of other proteins from the RNP complex is necessary. If the purpose of the experiment is to study the structure and dynamics of the RNP complex, then determining whether L7Ae’s footprints on the RNA change in the absence or presence of the other proteins is important, as binding of the other proteins may affect L7Ae binding through steric effects, spatial rearrangements, and/or structural changes in the RNA. However, if the goal is to simply validate the presence of kink-turns in the RNA, addition of L7Ae alone is sufficient. 8. One of the most common causes of low/no OH
-mediated cleavage is oxidized ascorbic acid. Ascorbic acid is used to reduce the oxidized Fe(III) product of the Fenton reaction back to Fe(II) for additional rounds of OH
generation. However, it becomes inactive as it oxidizes in aqueous solution, particularly at pH values > 4, so it should be freshly prepared immediately prior to use and discarded at the end of the experiment. 9. Following phenol-chloroform extraction, DNA will partition to the organic phase when acidic phenol (pH ~4.5) is used, which can be useful for RNA purification, while both DNA and RNA will partition to the aqueous phase when slightly alkaline phenol (pH ~8) is used. Thus, phenol buffer-saturated to

Using an L7Ae-Tethered, Hydroxyl Radical-Mediated Footprinting Strategy to. . .

163

pH 7.9 often has broader utility in the laboratory. Isoamyl alcohol is an inert and optional additive to the extraction mixture, as it primarily serves as an anti-foaming agent. 10. Multiple GSPs complementary to different regions of the RNA should be used for run-off reverse transcription to identify cleavages along the entire length of the RNA. For efficient annealing, target regions of the RNA that are single-stranded and lack any stable secondary structure, and try to design primers that (a) have a guanosine (G) or cytosine (C) at the 30 end to promote stronger primer clamping, (b) are 16–20 nucleotides long to promote adequate specificity, and (c) lack di-nucleotide repeats and long runs of a single base to limit mispriming. It may be necessary to test multiple primers before choosing the ones that yield the most consistent cDNA profiles and the fewest false stops or termination sites (i.e., positions where the reverse transcriptase has a high probability of dissociating from the template due to sequence or secondary structure [61, 62]), which are particularly important considerations for GC-rich RNAs (also see Note 11). 11. The labeling efficiency of T4 PNK is dependent on the nucleotide at the 50 end of the phosphorylation target (i.e., oligonucleotide): 60  5% when it is a G, 45  5% when it is an A or T, and 10  5% when it is a C. Thus, when possible, design reverse transcription primers that have a G at the 50 end [63]. 12. Phenol disrupts protein binding to nucleic acids and thus affords better separation of products during gel electrophoresis. Because phenol is volatile and subject to oxidation, its efficacy can be maximized by assembling the rest of the urea dye ahead of time and then supplementing with 10% (v/v) phenol immediately prior to use. 13. Determining which RTase works best for the RNA of interest may require some optimization, as it is difficult to predict a priori whether a particular enzyme will have difficulty reverse transcribing a given template. However, if the RNA’s GC content is high, there is a greater probability of false stops or premature termination due to sequence- or structure-based roadblocks [61, 62, 66–68]. To address this issue, there are thermostable RTases capable of synthesis at elevated temperatures as well as RTases that have been engineered to be more efficient at moving through secondary structure. After testing eight different RTases under different reaction conditions with Pfu RPR (~68% GC-rich), we found that PrimeScript (TaKaRa) and especially Maxima H Minus (Thermo Scientific) RTases yielded the cleanest and most consistent cDNA profiles with the fewest false stops or termination sites. 14. TdT is used to resolve ambiguities that arise due to the termination of reverse transcription for reasons other than the

164

Stella M. Lai and Venkat Gopalan

incorporation of a ddNTP. TdT is a template-independent DNA polymerase that catalyzes the addition of nucleotides to the 30 -OH of DNAs. 15. Siliconization prevents the gel from sticking to the plate during disassembly following electrophoresis. Either Sigmacote (Sigma Aldrich) or Rain-X®, which contain polysiloxane and form a thin, water-repellent film on glass, may be used. 16. Lab-prepared gel mix can also be used (see Subheading 2.3.1), but the SequaGel UreaGel System is convenient and consistently produces high-quality sequencing gels. 17. The protein must be dialyzed against DTT to fully reduce disulfide bonds and ensure that the thiol is accessible for subsequent modification. Because the pKa of DTT’s thiols are 9.2 and 10, its reducing power is effectively limited to pH values > 7 (due to the presence of its negatively charged reactive thiolate form). 18. DTT must be completely removed to ensure that EPD-Fe reacts with the protein and not any remaining reducing agent. 19. It is difficult to obtain accurate A280 measurements for the modified protein due to interference from EPD’s strong absorbance at 290 nm [36, 50, 64]. Therefore, an upper concentration threshold can be determined using the amounts of protein, EPD, and FeCl3 in the 50-μL modification reaction. 20. Use equilibrated MicroSpin G-25 Sephadex columns immediately to avoid drying out the resin, which will adversely affect sample purity. If the resin is dry or cracked following centrifugation, re-hydrate the resin with 250 μL ddH2O, vortex, and re-centrifuge, ensuring that the appropriate centrifugation speed for the specific rotor is used. 21. To maximize purification efficiency, ensure that the sample is slowly and carefully applied to the top-center of the resin. Do not allow the sample to run down the sides of the resin bed, and avoid touching the resin with the pipette tip. 22. The purpose of the column purification is to remove 2-pyridylthiol, a product of the modification reaction, as well as any remaining DTT and unreacted EPD-Fe, which can generate non-specific scissions of the RNA backbone and confound interpretation of the directed cleavages. 23. The mass of each L7Ae derivative should increase by 402 Da following successful modification. However, because iron can dissociate during sample ionization, the observed mass of the modified derivative may only be ~346 Da higher than the mass of the unmodified derivative. 24. It is difficult to predict a priori whether removal of the native cysteine(s) (e.g., Cys71Val), introduction of single-cysteine

Using an L7Ae-Tethered, Hydroxyl Radical-Mediated Footprinting Strategy to. . .

165

substitutions (e.g., Arg46Cys/Cys71Val), and/or EPD-Febased modification of these residues (e.g., Arg46Cys/ Cys71Val-EPD-Fe) will significantly perturb the structure and function of L7Ae such that assembly and/or activity of the RNP complex is disrupted. Thus, assays are essential to ensure that footprinting results report on functional complexes. 25. Optimal footprinting conditions for the system of interest must be empirically determined. Parameters to consider include (a) reaction temperature and (b) incubation time, with desirable reaction conditions yielding no more than one cleavage per RNA molecule: (a) While conducting footprinting experiments at the optimal temperature for binding permits interrogation of a more native complex, the reaction can also be performed at RT or 4 C if protein and/or RNA stability are a concern, though modifications to the reaction conditions will need to be made to increase the rate of cleavage. (b) Longer incubation times may lead to loss of protein function, as some proteins are more sensitive than others to free radicals or the chemicals used to generate them. However, shorter incubation times may yield little to no cleavage. Therefore, conducting pilot time courses (1–5 min) may help identify an optimal incubation time for the complex of interest. 26. Liquid nitrogen can enter the tube during flash freezing, causing it to explode as it thaws, which may lead to sample loss. To minimize the risk of an explosion, pop open the lid of the tube after removing it from the liquid nitrogen. 27. The recovery efficiency for small RNA fragments increases significantly if the precipitation reaction is incubated overnight at 80 C. 28. The time required to achieve the desired resolution must be experimentally determined. Migration of the bromophenol blue and xylene cyanol tracking dyes can be used to determine when to terminate electrophoresis. In an 8% (w/v) polyacrylamide/8 M urea gel, xylene cyanol and bromophenol blue migration correspond to ~75 and ~19 nucleotides, respectively [65]. 29. An alternative method for purifying labeled oligonucleotides utilizes small size-exclusion chromatography columns per manufacturer’s instructions. Instead of terminating the labeling reaction with quench dye, heat inactivate PNK via incubation for 20 min at 65 C before diluting the sample to 50 μL with ddH2O, applying it to an equilibrated column, and eluting via centrifugation. To ensure near-complete removal of all

166

Stella M. Lai and Venkat Gopalan

unincorporated [γ-32P]-ATP, purification through two columns is required. 30. The amount of 50 -32P-labeled GSP required per reaction is dependent on the efficiency with which each GSP anneals to the RNA, which must be empirically determined. 31. Use of 5 μL cleaved RNA/RT reaction allows for primer extension-based analysis of each footprinted sample using two different 50 -32P-labeled GSPs. 32. While this step is optional, it allows for the identification of gel-electrophoretic anomalies prior to loading precious sample. 33. Closely monitor the surface temperature of the gel plates, as the gel temperature should remain between 45–50 C. Several companies manufacture and sell adhesive gel-temperature indicators, which provide real-time temperature monitoring. Excessive heat during electrophoresis can result in smeared bands and/or poor resolution due to the sample’s rapid migration through the gel. Overheated gel plates can also crack, which could potentially lead to a total loss of the entire experiment. 34. Drying time may vary depending on the polyacrylamide content of the gel, the gel dryer apparatus used, and the strength of the vacuum applied. 35. Because the gels are dried, band diffusion is not a concern. Therefore, gels can be exposed multiple times for varying lengths of time to obtain optimal images.

Acknowledgments We thank Lien Lai (The Ohio State University) for her initial efforts toward the development and optimization of the OH
-mediated footprinting protocol described herein. We also gratefully acknowledge research support from the Behrman Research Fund (to V.G.) and National Institutes of Health (R01-GM120582 to V.G., Mark P. Foster, Julius B. Lucks, Michael G. Poirier, and Vicki H. Wysocki). References 1. Huang L, Lilley DMJ (2013) The molecular recognition of kink-turn structure by the L7Ae class of proteins. RNA 19:1703–1710 2. Lilley DMJ (2014) The K-turn motif in riboswitches and other RNA species. Biochim Biophys Acta 1839:995–1004

3. Lilley DMJ (2012) The structure and folding of kink turns in RNA. Wiley Interdiscip Rev RNA 3:797–805 4. Huang L, Lilley DMJ (2016) The kink turn, a key architectural element in RNA structure. J Mol Biol 428:790–801

Using an L7Ae-Tethered, Hydroxyl Radical-Mediated Footprinting Strategy to. . . 5. Klein DJ, Schmeing TM, Moore PB, Steitz TA (2001) The kink-turn: a new RNA secondary structure motif. EMBO J 20:4214–4221 6. Wimberly BT, Brodersen DE, Clemons WJ Jr, Morgan-Warren RJ, Carter AP, Vonrhein C, Hartsch T, Ramakrishnan V (2000) Structure of the 30S ribosomal subunit. Nature 407:327–339 7. Schuwirth BS, Borovinskaya MA, Hau CW, Zhang W, Vila-Sanjurjo A, Holton JM, Cate JH (2005) Structures of the bacterial ribosome ˚ resolution. Science 310:827–834 at 3.5A 8. Heppell B, LaFontaine D (2008) Folding of the SAM aptamer is determined by the formation of a K-turn-dependent pseudoknot. Biochemistry 47:1490–1499 9. Charron C, Manival X, Cle´ry A, SentySe´gault V, Charpentier B, Marmier-Gourrier N, Branlant C, Aubry A (2004) The archaeal sRNA binding protein L7Ae has a 3D structure very similar to that of its eukaryal counterpart while having a broader RNA-binding specificity. J Mol Biol 342:757–773 10. Hamma T, Ferre´-D’Amare´ AR (2004) Structure of protein L7Ae bound to a K-turn derived from an archaeal box H/ACA sRNA at 1.8 A˚ resolution. Structure 12:893–903 11. Moore T, Zhang Y, Fenley MO, Li H (2004) Molecular basis of box C/D RNA-protein interactions: cocrystal structure of archaeal L7Ae and a box C/D RNA. Structure 12:807–818 12. Vidovic I, Nottrott S, Hartmuth K, Lu¨hrmann R, Ficner R (2000) Crystal structure of the spliceosomal 15.5 kD protein bound to a U4 snRNA fragment. Mol Cell 6:1331–1342 13. Cho I-M, Lai LB, Susanti D, Mukhopadhyay B, Gopalan V (2010) Ribosomal protein L7Ae is a subunit of archaeal RNase P. Proc Natl Acad Sci U S A 107:14573–14578 14. Lai SM, Lai LB, Foster MP, Gopalan V (2014) The L7Ae protein binds to two kink-turns in the Pyrococcus furiosus RNase P RNA. Nucleic Acids Res 42:13328–13338 15. Lai LB, Tanimoto A, Lai SM, Chen W-Y, Marathe IA, Westhof E, Wysocki VH, Gopalan V (2017) A novel double kink-turn module in euryarchaeal RNase P RNAs. Nucleic Acids Res 45:7432–7440 16. Oshima K, Kakiuchi Y, Tanaka Y, Ueda T, Nakashima T, Kimura M, Yao M (2016) Structural basis for recognition of a kink-turn motif by an archaeal homologue of human RNase P protein Rpp38. Biochem Biophys Res Commun 474:541–546

167

17. Goody TA, Melcher SE, Norman DG, Lilley DMJ (2004) The kink-turn motif in RNA is dimorphic, and metal ion-dependent. RNA 10:254–264 18. Daldrop P, Lilley DMJ (2013) The plasticity of a structural motif in RNA: structural polymorphism of a kink turn as a function of its environment. RNA 19:357–364 19. Lilley DMJ (1995) Kinking of DNA and RNA by base bulges. Proc Natl Acad Sci U S A 92:7140–7142 20. McPhee SA, Huang L, Lilley DMJ (2014) A critical base pair in k-turns that confers folding characteristics and correlates with biological function. Nat Commun 5:5127 21. Liu J, Lilley DMJ (2007) The role of specific 20 -hydroxyl groups in the stabilization of the folded conformation of kink-turn RNA. RNA 13:200–210 22. Xue S, Wang R, Yang F, Terns RM, Terns MP, Zhang X, Maxwell ES, Li H (2010) Structural basis for substrate placement by an archaeal box C/D ribonucleoprotein particle. Mol Cell 39:939–949 23. Moschen T, Wunderlich C, Kreutz C, Tollinger M (2015) NMR resonance assignments of the archaeal ribosomal protein L7Ae in the apo form and bound to a 25 nt RNA. Biomol NMR Assign 9:177–180 24. Koonin EV, Bork P, Sander C (1994) A novel RNA-binding motif in omnipotent suppressors of translation termination, ribosomal proteins and a ribosome modification enzyme? Nucleic Acids Res 22:2166–2167 25. Watkins NJ, Gottschalk A, Neubauer G, Kastner B, Fabrizio P, Mann M, Lu¨hrmann R (1998) Cbf5p, a potential pseudouridine synthase, and Nhp2p, a putative RNA-binding protein, are present together with Gar1p in all H BOX/ACA-motif snoRNPs and constitute a common bipartite structure. RNA 4:1549–1568 26. Oruganti SV, Zhang Y, Li H (2005) Structural comparison of yeast snoRNP and spliceosomal protein Snu13p with its homologs. Biochem Biophys Res Commun 333:550–554 27. Kuhn JF, Tran EJ, Maxwell ES (2002) Archaeal ribosomal protein L7 is a functional homolog of the eukaryotic 15.5 kD/Snu13p snoRNP core protein. Nucleic Acids Res 30:931–941 28. Rozhdestvensky TS, Tang TH, Tchirkova IV, Brosius J, Bachellerie J-P, Hu¨ttenhofer A (2003) Binding of L7Ae protein to the K-turn of archaeal snoRNAs: a shared RNA binding motif for C/D and H/ACA box snoRNAs in Archaea. Nucleic Acids Res 31:869–877

168

Stella M. Lai and Venkat Gopalan

29. Samanta MP, Lai SM, Daniels CJ, Gopalan V (2016) Sequence analysis and comparative study of the protein subunits of archaeal RNase P. Biomolecules 6:E22 30. Wang J, Daldrop P, Huang L, Lilley DMJ (2014) The k-junction motif in RNA structure. Nucleic Acids Res 42:5322–5331 31. Daldrop P, Masquida B, Lilley DMJ (2013) The functional exchangeability of pk- and k-turns in RNA structure. RNA Biol 10:445–452 32. Fenton HJH (1894) Oxidation of tartaric acid in presence of iron. J Chem Soc Trans 65:899–910 33. Tullius TD, Dombroski BA, Churchill MEA, Kam L (1987) Hydroxyl radical footprinting: a high-resolution method for mapping proteinDNA contacts. Methods Enzymol 155:537–558 34. Jain SS, Tullius TD (2008) Footprinting protein-DNA complexes using the hydroxyl radical. Nat Protoc 3:1092–1100 35. Nilsen TW (2014) Mapping RNA-protein interactions using hydroxyl-radical footprinting. Cold Spring Harb Protoc 2014:1333–1336 36. Erma´cora MR, Delfino JM, Cuenoud B, Schepartz A, Fox RO (1992) Conformationdependent cleavage of staphylococcal nuclease with a disulfide-linked iron chelate. Proc Natl Acad Sci U S A 89:6383–6387 37. Erma´cora MR, Ledman DW, Hellinga HW, Hsu GW, Fox RO (1994) Mapping staphylococcal nuclease conformation using an EDTAFe derivative attached to genetically engineered cysteine residues. Biochemistry 33:13625–13641 38. Erma´cora MR, Ledman DW, Fox RO (1996) Mapping the structure of a non-native state of staphylococcal nuclease. Nat Struct Biol 3:59–66 39. Tullius TD, Dombroski BA (1986) Hydroxyl radical “footprinting”: high-resolution information about DNA-protein contacts and application to lambda repressor and Cro protein. Proc Natl Acad Sci U S A 83:5469–5473 40. Ebright YW, Chen Y, Pendergrast PS, Ebright RH (1992) Incorporation of an EDTA-metal complex at a rationally selected site within a protein: application to EDTA-iron DNA affinity cleaving with catabolite gene activator protein (CAP) and Cro. Biochemistry 31:10664–10670 41. Mazzarelli JM, Erma´cora MR, Fox RO, Grindley NDF (1993) Mapping interactions between the catalytic domain of resolvase and its DNA

substrate using cysteine-coupled EDTA-iron. Biochemistry 32:2979–2986 42. Biswas R, Ledman DW, Fox RO, Altman S, Gopalan V (2000) Mapping RNA-protein interactions in ribonuclease P from Escherichia coli using disulfide-linked EDTA-Fe. J Mol Biol 296:19–31 43. Heilek GM, Marusak R, Meares CF, Noller HF (1995) Directed hydroxyl radical probing of 16S rRNA using Fe(II) tethered to ribosomal protein S4. Proc Natl Acad Sci U S A 92:1113–1116 44. Heilek GM, Noller HF (1996) Directed hydroxyl radical probing of the rRNA neighborhood of ribosomal protein S13 using tethered Fe(II). RNA 2:597–602 45. Wilson KS, Noller HF (1998) Mapping the position of translational elongation factor EF-G in the ribosome by directed hydroxyl radical probing. Cell 92:131–139 46. Heilek GM, Noller HF (1996) Site-directed hydroxyl radical probing of the rRNA neighborhood of ribosomal protein S5. Science 272:1659–1662 47. Holmberg L, Noller HF (1999) Mapping the ribosomal RNA neighborhood of protein L11 by directed hydroxyl radical probing. J Mol Biol 289:223–233 48. Rana TM, Meares CF (1991) Transfer of oxygen from an artificial protease to peptide carbon during proteolysis. Proc Natl Acad Sci U S A 88:10578–10582 49. Huq I, Rana TM (1997) Probing the proximity of the core domain of an HIV-1 Tat fragment in a Tat-TAR complex by affinity cleaving. Biochemistry 36:12592–12599 50. Beck DL, Stump WT, Hall KB (1998) Defining the orientation of the human U1A RBD1 on its UTR by tethered-EDTA(Fe) cleavage. RNA 4:331–339 51. Gruegelsiepe H, Scho¨n A, Kirsebom LA, Hartmann RK (2005) Enzymatic RNA synthesis using bacteriophage T7 RNA polymerase. In: Hartmann RK, Bindereif A, Scho¨n A, Westhof E (eds) Handbook of RNA Biochemistry, vol 1. WILEY-VCH Verlag GmbH & Co, KGaA, Weinheim, Germany, pp 3–21 52. Beaucage SL, Reese CB (2009) Recent advances in the chemical synthesis of RNA. Curr Protoc Nucleic Acid Chem 38:2.16.1–2.16.31 53. Dellinger DJ, Tima´r Z, Myerson J, Sierzchala AB, Turner J, Ferreira F, Kupiha´r Z, Dellinger G, Hill KW, Powell JA, Sampson JR, Caruthers MH (2011) Streamlined process for the chemical synthesis of RNA using 20 -Othionocarbamate-protected nucleoside

Using an L7Ae-Tethered, Hydroxyl Radical-Mediated Footprinting Strategy to. . . phosphoramidites in the solid phase. J Am Chem Soc 133:11540–11556 54. Wang J, Fessi T, Schroeder KT, Ouellet J, Liu Y, Freeman ADJ, Lilley DMJ (2012) Single-molecule observation of the induction of k-turn RNA structure on binding L7Ae protein. Biophys J 103:2541–2548 55. Tsai H-Y, Pulukkunat DK, Woznick WK, Gopalan V (2006) Functional reconstitution and characterization of Pyrococcus furiosus RNase P. Proc Natl Acad Sci U S A 103:16147–16152 56. Miller JS, Cornwell DG (1978) The role of cryoprotective agents as hydroxyl radical scavengers. Cryobiology 15:585–588 57. Scholes G, Willson RL (1967) γ-Radiolysis of aqueous thymine solutions. Determination of relative reaction rates of OH radicals. Trans Faraday Soc 63:2983–2993 58. Shen M, Fried MG (2012) Detection of RNA-protein complexes by electrophoretic mobility shift assay. In: Stamm S, Smith C, Lu¨hrmann R (eds) Alternative pre-mRNA splicing: theory and protocols. WileyBlackwell, Weinheim, Germany, pp 182–198 59. Rio DC (2012) Filter-binding assay for analysis of RNA-protein interactions. Cold Spring Harb Protoc 2012:1078–1081 60. Yoshimura Y, Matsuzaki Y, Watanabe T, Uchiyama K, Ohsawa K, Imaeda K (1992) Effects of buffer solutions and chelators on the generation of hydroxyl radical and the lipid peroxidation in the Fenton reaction system. J Clin Biochem Nutr 13:147–154 61. DeStefano JJ, Buiser RG, Mallaber LM, Fay PJ, Bambara RA (1992) Parameters that influence

169

processive synthesis and site-specific termination by human immunodeficiency virus reverse transcriptase on RNA and DNA templates. Biochim Biophys Acta 1131:270–280 62. Abbotts J, Bebenek K, Kunkel TA, Wilson SH (1993) Mechanism of HIV-1 reverse transcriptase. Termination of processive synthesis on a natural DNA template is influenced by the sequence of the template-primer stem. J Biol Chem 268:10312–10323 63. van Houten V, Denkers F, van Dijk M, van den Brekel M, Brakenhoff R (1998) Labeling efficiency of oligonucleotides by T4 polynucleotide kinase depends on 50 -nucleotide. Anal Biochem 265:386–389 64. Hall KB, Fox RO (1999) Directed cleavage of RNA with protein-tethered EDTA-Fe. Methods 18:78–84 65. Sambrook J, Fritsch E, Maniatis T (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY 66. Harrison GP, Mayo MS, Hunter E, Lever AML (1998) Pausing of reverse transcriptase on retroviral RNA templates is influenced by secondary structures both 50 and 30 of the catalytic site. Nucleic Acids Res 26:3433–3442 67. Zhang Y-J, Pan H-Y, Gao S-J (2001) Reverse transcription slippage over the mRNA secondary structure of the LIP1 gene. BioTechniques 31:1286–1294 68. Sexton AN, Wang PY, Rutenberg-SchoenbergM, Simon MD (2017) Interpreting reverse transcriptase termination and mutation events for greater insight into the chemical probing of RNA. Biochemistry 56:4713–4721

Chapter 10 SHAPE Profiling to Probe Group II Intron Conformational Dynamics During Splicing Timothy Wiryaman and Navtej Toor Abstract Selective 20 -hydroxyl acylation analyzed by primer extension (SHAPE) is a widely used technique for studying the structure and function of RNA molecules. It characterizes the flexibility of single nucleotides in the context of the local RNA structure. Here we describe the application of SHAPE-MaP (mutational profiling) to study different conformational states of the group II intron during the self-splicing reaction. Key words RNA structure, SHAPE-MaP, Group II intron, Chemical structure probing, Next-generation sequencing

1

Introduction Chemical probing of RNA structure was first developed in the 1970s and 1980s to determine the secondary structure of RNA [1]. It is widely used today in RNA biochemistry to gain insight into the structure and function of RNA molecules [2]. This method involves the chemical modification of RNA with a probing reagent, whose reactivity with a particular nucleotide depends on the local environment of this residue. These reactivities are encoded as a chemical adduct on each nucleotide. The position of these adducts in the sequence can then be detected by primer extension, in which the reverse transcriptase (RT) stops at modified nucleotides that have reacted with the probe. This allows for relatively accurate secondary structure determination of any given RNA. Currently, the most widely used technique for RNA chemical probing is selective 20 -hydroxyl acylation analyzed by primer extension (SHAPE) [3]. SHAPE chemical probes react with the 20 -hydroxyl of flexible nucleotides, but not conformationally restrained nucleotides such as those found in A-form helices [4]. The major advantage of SHAPE chemistry is that it can modify all four nucleotides—A, G, C, or U. This is in contrast to other chemical

Robert J. Scarborough and Anne Gatignol (eds.), Ribozymes: Methods and Protocols, Methods in Molecular Biology, vol. 2167, https://doi.org/10.1007/978-1-0716-0716-9_10, © Springer Science+Business Media, LLC, part of Springer Nature 2021

171

172

Timothy Wiryaman and Navtej Toor

Fig. 1 Overview of SHAPE-MaP experiment on a group II intron. (a) Group II introns at different stages of splicing were probed separately. (b) Reverse transcription of modified RNA under mutational profiling conditions. The Mn2+ in the MaP buffer causes the reverse transcriptase to read through 1-methyl-7nitroisatoic anhydride adducts on the RNA and introduce a mutation at that residue

probes such as dimethyl sulfate, CMCT, and kethoxal that react with only a subset of nucleobases [5]. Since the development of the SHAPE protocol, it has become the most common technique for experimental determination of RNA secondary structures. Beyond just base-pairing information, it can also capture conformational changes in RNA, such as riboswitches, RNaseP, lncRNAs, ribosomes, and spliceosomes [6–10]. Here we describe the application of SHAPE to understand the dynamics of group II intron splicing. Group II introns are structured ribozymes that perform a self-splicing reaction [11]. Both the mechanism and structure of group II introns are analogous to the eukaryotic spliceosome, suggesting that they evolved from a common ancestor [12, 13]. By performing SHAPE on a group II intron [14] at different stages of splicing, we were able to demonstrate the dynamic role of junction regions in the group II intron during the second step of RNA splicing (Fig. 2c) [15]. The method described below is a modification of the SHAPE-MaP protocol developed by Smola et al. with adaptations to make it suitable for group II introns [16]. This method combines SHAPE modification with high-throughput sequencing to facilitate structure analysis of large RNAs (Fig. 1).

2 2.1

Materials Constructs

1. P.li.LSU2 wild-type group II intron (WT intron), cloned into pUC57 with a 250-nt 50 exon and a 150 nt-30 exon and a BamHI cut site at the end of the RNA sequence.

SHAPE Profiling of Group II Introns

173

Fig. 2 SHAPE-MaP differences in the core of the group II intron (PDB 4R0D). (a) Example SHAPE reactivity profile for the spliced intron from ShapeMapper 2. Red corresponds to nucleotides with reactivities greater than 0.85 and orange corresponds to nucleotides with reactivities between 0.4 and 0.85. The six domains of the intron are also labeled. (b) Example deltaSHAPE profile showing differences between 2s mut and spliced introns. Nucleotides colored green have increased SHAPE reactivity; purple have decreased SHAPE reactivity. (c) SHAPE reactivity differences between 2s mut and spliced introns in the junction regions. Junction 2/3 is colored dark green, junction 3/4 is colored yellow, junction 4/5 is colored orange, and junction 5/6 is colored red. Green and purple spheres represent the 20 -hydroxyls of residues showing significant SHAPE reactivity increases and decreases, respectively. Light orange spheres correspond to the catalytic Mg2+ ions (M1/M2)

2. P.li.LSU2 second-step mutant (2s mut intron), generated from Pli WT by mutating G296 (exon-binding sequence 3) to A, U622 to A, and all U’s within the first 39 nucleotides of the 30 exon to A’s. The 2s mut can undergo the first step of splicing but is blocked from the second step of splicing due to the mutations in the 30 splice site. 2.2 Template Preparation

1. Plasmid maxiprep kit. 2. 3 M sodium acetate, pH 5.2. 3. Isopropanol. 4. 70% and 100% ethanol. 5. High-fidelity BamHI with enzyme buffer. 6. Phenol:chloroform:isoamyl alcohol (25:24:1, v/v).

174

Timothy Wiryaman and Navtej Toor

2.3 In Vitro Transcription and Non-denaturing Purification

1. 10 transcription buffer: 400 mM Tris–HCl, pH 7.5, 250 mM MgCl2, 50 mM DTT, 20 mM spermidine. 2. 10 low-Mg2+ transcription buffer: 400 mM Tris–HCl, pH 7.5, 50 mM MgCl2, 50 mM DTT, 20 mM spermidine. 3. 100 mM each ribonucleotide triphosphate (NTPs). 4. 20% Triton X-100. 5. T7 RNA polymerase. 6. Thermostable inorganic pyrophosphatase. 7. 0.1 M calcium chloride. 8. Turbo DNase. 9. Proteinase K. 10. 0.22 μm syringe filters. 11. 10-ml plastic syringe. 12. 15 ml centrifugal filter, 100 kDa NMWL. 13. RNA storage buffer: 5 mM sodium cacodylate, pH 6.5, 10 mM MgCl2. 14. Ca2+ storage buffer: 5 mM sodium cacodylate, pH 6.5, 10 mM CaCl2. 15. 2 intron splicing buffer: 20 mM MgCl2, 2 M NH4Cl, 80 mM Tris-HCl (pH 7.5) and 0.04% SDS.

2.4 SHAPE Modification

1. 100 mM 1-methyl-7-nitroisatoic anhydride (1M7) dissolved in DMSO, stored in small aliquots at 20  C. 2. Dimethyl sulfoxide (DMSO). 3. 10 denaturing control (DC) buffer: 500 mM HEPES, pH 8.0, 40 mM EDTA. 4. E. histolytica Dbr1 (generous gift of Dr. John Hart). Commercially available Dbr1 enzyme should also work, though they have not been tested by the authors. 5. 2 Dbr1 buffer: 100 mM HEPES, pH 7.0, 200 mM NaCl, 2 mM DTT. 6. RNA miniprep kit. 7. Formamide.

2.5 Reverse Transcription

1. Reverse transcription primer (see Table 1). 2. 2.5 MaP buffer: 125 mM Tris, pH 8.0, 187.5 mM KCl, 15 mM MnCl2, 25 mM DTT, 1.25 mM dNTPs. Prepare fresh for every experiment with 1 volume of 5 pre-MaP buffer containing all ingredients except MnCl2 and 1 volume of freshly prepared 30 mM MnCl2. 3. SuperScript II (Thermo Fisher). Be sure to use this particular reverse transcriptase, as others may not have the same properties for mutational profiling. 4. DNA clean-up spin columns.

SHAPE Profiling of Group II Introns

175

Table 1 Primers used for sequencing #

Primer name

1

Pli_RT_588

agttggataggtagacgatc

2

Pli_RT_30 Exon

catagttacagccgccgttt

3

Pli_MaP_F_89

GACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNN taatcgctaggtgagaagc

4

Pli_MaP_R_588

CCCTACACGACGCTCTTCCGATCTNNNNNagttggataggt agacgatc

5

Pli_MaP_F_246

GACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNN accctcctttttatggggtaa

6

Pli_MaP_R_30 Exon

CCCTACACGACGCTCTTCCGATCTNNNNNcatagttacagc cgccgttt

7

Pli_MaP_F_1

GACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNN gtgcgacaagaagttcagg

8

Pli_MaP_R_427

CCCTACACGACGCTCTTCCGATCTNNNNNctcgatcgttacaaccaagc

9

UniFwd

CAAGCAGAAGACGGCATACGAGAT[Barcode]GTGACT GGAGTTCAGAC

10

UniRev

AATGATACGGCGACCACCGAGATCTACACTCTTTCCC TACACGACGCTCTTCCG

2.6 Library Preparation and Sequencing

1. 2 Q5 master mix (made in-house): 2.5 Q5 reaction buffer, 400 μM dNTPs, 0.04 U/μl Q5 Hot Start DNA polymerase. Store at 4  C and it will work for at least a month. 2. Primers: See Table 1. Barcodes for the UniFwd primer are from Smola et al. [16] and are the same as the barcodes from the TruSeq Small RNA Library Preparation Kit (https://support. illumina.com/content/dam/illumina-support/documents/ documentation/chemistry_documentation/experimentdesign/illumina-adapter-sequences-1000000002694-09.pdf). 3. PCR purification kit (use one that elutes DNA with 10 μl volumes). 4. AMPure XP beads (Beckman Coulter). 5. Magnetic stand for 96-well plate. 6. 80% ethanol, freshly prepared. 7. Qubit fluorometer (Thermo Fisher) 8. PippinHT (Sage Science). 9. SpeedVac (Thermo Fisher). 10. TapeStation (Agilent).

176

2.7

Timothy Wiryaman and Navtej Toor

Software

1. ShapeMapper 2 (https://github.com/Weeks-UNC/shapemapper2). 2. deltaSHAPE (https://weeks.chem.unc.edu/software-files/deltaSHAPE_ v1.0.tar.gz).

3

Methods

3.1 Template Preparation

1. Purify plasmids from DH5α cells with WT intron or 2s mut intron with a plasmid maxiprep kit. 2. Split each maxiprep elution into three 1-ml aliquots in 2-ml microcentrifuge tubes (see Note 1). 3. To each tube, add 100 μl of 3 M sodium acetate, pH 5.2, 700 μl isopropanol and spin down in a microcentrifuge 30 min, maximum speed (>15,000  g) at 4  C. 4. Remove the isopropanol and add 500 μl 70% ethanol. Spin down at maximum speed for 10 min at 4  C. 5. Remove the ethanol and air dry for 10 min. 6. Resuspend each pellet in 100 μl H2O and combine the three tubes containing the same plasmid. 7. Measure the concentration of plasmid on a Nanodrop. 8. Add 40 μl enzyme buffer, 1 U/μg plasmid of high-fidelity BamHI, and H2O up to 400 μl. Incubate at 37  C for 2 h to overnight. 9. Add 50 μl H2O, 50 μl 3 M sodium acetate, pH 5.2, and 500 μl phenol-chloroform-isoamyl alcohol. 10. Vortex for 15 s, and spin down for 1 min, maximum speed at room temperature. 11. With a P200 pipette set to 200 μl, transfer the top layer to a new tube twice, being careful not to disturb the interface between the two layers. 12. Add 400 μl phenol-chloroform-isoamyl alcohol and repeat steps 10 and 11, setting the P200 to 140 μl this time instead. 13. Add 700 μl ethanol and incubate for 10 min in a 80  C freezer. 14. Spin down 10 min, maximum speed at 4  C. 15. Remove ethanol and wash with 400 μl 70% ethanol and spin down for 10 min, maximum speed. 16. Air dry for 10 min and resuspend in 300 μl H2O. 17. Check the concentration of linearized plasmid on Nanodrop and adjust to 500 ng/μl by adding H2O.

SHAPE Profiling of Group II Introns

3.2 In Vitro Transcription and Non-denaturing Purification

177

1. In a 1.7-ml microcentrifuge tube, add 100μl 10 transcription buffer, 25 μl NTPs, 100 μl linearized template, 2 μl 20% Triton X-100, 5 μl T7 RNA polymerase, 0.5 μl thermostable inorganic pyrophosphatase. Incubate at 37  C for 3 h to overnight. To make pre-catalytic intron, use low-Mg2+ 10 transcription buffer instead (see Note 2). 2. Add 12 μl 0.1 M CaCl2 and 10 μl Turbo DNase and incubate at 37  C for 45 min (see Note 3). 3. Add 10 μl Proteinase K and incubate at 37  C for 1 h (see Note 4). 4. For spliced and 2s mut, transfer to a 2-ml centrifuge tube and add 1 ml of 2 intron splicing buffer. Incubate at 45  C for 20 min. Omit step for pre-catalytic. 5. Equilibrate tubes to room temperature for 20 min, then place in a 4  C refrigerator for 1 h to overnight. 6. Spin down 10 min, 4  C at maximum speed to pellet white precipitate (see Note 5). 7. Transfer supernatant to 10-ml plastic syringe with a 0.22 μm syringe filter attached and push down plunger to filter. 8. Transfer filtered RNA to Amicon Ultra-15 centrifugal filter and spin down 20 min maximum speed at room temperature in a swinging bucket rotor. 9. Add 15 ml RNA storage buffer and spin down 20 min again. Repeat five more times (see Note 6). 10. Use a P200 to draw up the retentate from the filter and wash the filter membrane three times each side. Transfer into a 1.7ml centrifuge tube. 11. RNA is stored at room temperature or 4  C (see Note 7).

3.3 SHAPE Modification

1. Add RNA storage buffer to 10 pmol of RNA for 18 μl final volume. 2. Add 1 μl 100 mM 1M7 (modified) or 1 μl DMSO (untreated control) to separate PCR tubes. 3. Transfer 9 μl of RNA to 1M7 and DMSO tubes and incubate at 37  C for 1 min, 15 s. 4. Place tubes on ice. 5. Add H2O to 5 pmol of RNA for 3 μl final volume in a new PCR tube, then add 5 μl formamide and 1 μl of 10 DC buffer. Incubate at 95  C for 1 min (see Note 8). 6. Add 1 μl of 100 mM 1M7 to a PCR tube. 7. Add 9 μl denatured RNA to the 1M7 tube and incubate at 95  C for 1 min. Place tubes on ice.

178

Timothy Wiryaman and Navtej Toor

8. For spliced and 2s mut, add 11 μl 2 Dbr1 buffer and 1 μl of 5 μM Dbr1. Incubate at room temperature for 1 h (see Note 9). 9. Add H2O to make the final volume of each tube 100 μl. 10. Use an RNA purification kit to purify RNA, eluting with 30 μl H2O. 11. Store modified RNA in a 20  C freezer. 3.4 Reverse Transcription with Mutational Profiling Conditions

1. Add 1 μl 2 μM reverse transcription primer to PCR strips for each RNA sample. 2. Transfer 10 μl of modified RNA into PCR strips. In thermocycler, incubate at 65  C for 5 min, then cool to 4  C. 3. Add 8 μl MaP buffer and incubate at 42  C for 2 min. 4. Add 1 μl of Superscript II (SSII) and incubate at 42  C for 3 h. 5. Heat to 70  C for 15 min to inactivate SSII and degrade RNA, then hold at 4  C. 6. Transfer reverse transcription reactions to G-25 spin columns and spin down to collect purified cDNA. 7. Store cDNA at 20  C.

3.5 Library Preparation and Sequencing

1. Combine 5 μl cDNA, 1 μl of 25 μM Step1Fwd primers, 1 μl of 25 μM Step1Rev primer, 18 μl H2O, and 25 μl 2 Q5 master mix in 96-well PCR plate for each sample. To cover entire cDNA with two 500 bp amplicons, two different primer pairs are needed (see Note 10 and Tables 1 and 2). 2. Run thermocycler with the following program: 98  C 30 s; 5 cycles of 98  C 10 s, 65  C 30 s, 72  C 20 s; 72  C 2 min (see Note 11). 3. Use PCR purification kit to purify PCR products, eluting with 10 μl H2O.

Table 2 Step 1 primers for different group II intron conformational states State

Sequence

Reverse transcription

Step1Fwd Step1Rev

Spliced

89–588 1–427

1 1

3 7

4 8

2s mut

246–3’Exon 1–427

2 2

5 7

6 8

Pre-catalytic

246–3’Exon 1–427

2 2

5 7

6 8

Refer to Table 1 for numbering

SHAPE Profiling of Group II Introns

179

4. Combine 1 μl of 25 μM barcoded UniFwd primer, 1 μl of 25 μM UniRev primer, 10 μl purified PCR product, 13 μl H2O, and 25 μl 2 Q5 master mix. For each sample, use a different barcoded UniFwd primer. 5. Run thermocycler with the following program: 98  C 30 s; 25 cycles of 98  C 10 s, 65  C 30 s, 72  C 20 s; 72  C 2 min. 6. Add 45 μl AMPure XP beads that have been equilibrated to room temperature to each PCR reaction. Mix and incubate for 5 min at room temperature (see Note 12). 7. Place the plate on the magnetic stand until beads stick to the side of the tube (about 30 s). Pipet off the supernatant. 8. Add 200 μl 80% ethanol, incubate at 30 s, and pipet off ethanol. 9. Repeat step 8 two more times. 10. Air dry beads 15 min. 11. Take the plate off the magnetic stand, resuspend beads with 17 μl H2O, and incubate at room temperature for 2 min. 12. Place the plate on the magnetic stand until beads stick to the side of the tube. Transfer 15 μl DNA to new plate or tubes. 13. Run samples on TapeStation with D1000 ScreenTape to ensure each PCR product is the correct size (see Note 13). 14. Quantify each sample with Qubit fluorometer (see Note 14). 15. Pool 0.1 pmol of each library into a 1.7-ml tube. Spin down in SpeedVac until the volume is reduced to 20 μl. 16. Extract DNA with sizes between 550 and 850 bp with PippinHT system using a 1.5% agarose gel cassette. 17. Check pool on TapeStation as in step 13 and measure library DNA concentration with Qubit. 18. Sequence on MiSeq with 2  300 bp paired-end configuration, spiking in 15% PhiX (see Note 15). 3.6

Data Analysis

1. Prepare a FASTA file containing the target RNA sequence (formatted as DNA with T instead of U). 2. Run ShapeMapper 2 command with the --amplicon flag, with the target sequence, primer sequences, and the adaptertrimmed FASTQ files corresponding to the modified, untreated, and denatured samples as inputs (Fig. 2a). 3. Run deltaSHAPE.py with resulting .map files as input, using -p 0 and -f 0,1 flags (see Note 16) (Fig. 2b).

180

4

Timothy Wiryaman and Navtej Toor

Notes 1. We use 1.7-ml microcentrifuge tubes instead of 50-ml centrifuge tubes because our 50-ml centrifuge tubes are only rated for 10,000  g, whereas the maxiprep kit manual for the kit we use (Sigma GenElute HP) asks to centrifuge at >15,000  g. 2. The low-Mg2+ transcription buffer suppresses group II intron splicing during the transcription reaction. The yield is lower than with the regular transcription buffer, so we normally pool four 1-ml low-Mg2+transcriptions for non-denaturing purification. 3. Turbo DNase stops the transcription by degrading the DNA template. 4. Proteinase K degrades the enzymes and any contaminating proteins. 5. White pyrophosphate precipitates usually form in large-scale transcription reactions such as the one described in this protocol. The purpose of cooling tubes and filtering is to remove the precipitate to prevent the centrifugal filter from getting clogged. 6. Repeated filtering the transcribed RNA removes the free nucleotides and amino acids leftover from the transcription workup and exchanges the buffer to the RNA storage buffer. The RNA storage buffer was chosen based on its suitability for crystallography. Use Ca2+ RNA storage buffer instead for the pre-catalytic intron to prevent splicing during storage. 7. Our lab has a designated RNA workspace and we do not normally see RNase contamination. We do not add RNase inhibitors and our RNA seems to be free of degradation for at least 2 weeks at room temperature, as judged on a denaturing polyacrylamide gel. 8. The latest ShapeMapper 2 publication suggests the denaturing control can be omitted to save on sequencing costs, but it may be important for structured RNAs such as the group II intron to control for biases in reverse transcription due to its structure. 9. Dbr1 removes the 20 –50 lariat linkage between the first intron nucleotide and the branchpoint adenosine. The readthrough of the branchpoint adenosine may be worse without this step, and it will likely cause the reverse transcriptase to introduce spurious mutations around the branch point. It may also interfere with primer binding. 10. For this sequencing configuration, the maximum desired amplicon size is 500 bp. Since the intron is 588 nucleotides,

SHAPE Profiling of Group II Introns

181

we use two overlapping primer pairs to cover the entire intron sequence. 11. For a pilot experiment, we increase the number of cycles to 25 and check the PCR product on a 2% agarose gel. For problematic PCR reactions, we have found success with touchdown PCR or adding 1 M betaine, although this may increase PCR error rates. Another troubleshooting option is to treat the cDNA with 1 ul RNase H to remove RNA from the cDNA. 12. The amount of AMPure XP in this protocol corresponds to a 0.9 AMPure XP: DNA ratio. A 0.7 0.8 ratio may be superior in reducing carryover of small PCR artifacts. 13. Remember that the size of the DNA should be the sequence bounded by the primers plus the additional adapter sequence. 14. Qubit quantification is essential for accurate concentration determination. Do not substitute with spectrophotometric methods (e.g., Nanodrop). 15. Because only one amplicon is sequenced, the PhiX control helps balance the fluorescent signals to improve sequencing quality. 16. deltaSHAPE was originally intended to detect protein-binding sites in the RNA spanning multiple nucleotides. For that purpose, it averages SHAPE signals over multiple adjacent nucleotides and detects binding sites over three nucleotide windows by default. Because changes in conformations in a protein-free context may not be correlated among adjacent nucleotides, these assumptions do not hold true and we changed the deltaSHAPE settings to not average over multiple nucleotides and show differences over single nucleotide positions.

Acknowledgement This work was supported by NIH grant 1R01GM123275 awarded to N.T. T.W. was supported by the UCSD Cell, Molecular, and Genetics Training Program funded by NIH predoctoral training grant 5T32GM007240. Sequencing was conducted at the IGM Genomics Center, University of California, San Diego, La Jolla, CA. Dr. Kristen Jepsen and the IGM staff made helpful suggestions for library preparation and sequencing. References 1. Malbon RM, Parish JH (2003) Fractions of RNA and ribonucleoprotein from bacterial polysomes. Biochim Biophys Acta 246:542–552. https://doi.org/10.1016/ 0005-2787(71)90791-x

2. Xu Z, Culver GM (2009) Chemical probing of RNA and RNA/protein complexes. In: Methods in enzymology. Academic, Cambridge, MA, pp 147–165 3. Wilkinson K, Merino EJ, Weeks KM (2006) Selective 20 -hydroxyl acylation analyzed by

182

Timothy Wiryaman and Navtej Toor

primer extension (SHAPE): quantitative RNA structure analysis at single nucleotide resolution. Nat Protoc 1:1610–1616. https://doi. org/10.1038/nprot.2006.249 4. McGinnis JL, Dunkle JA, Cate JHD, Weeks KM (2012) The mechanisms of RNA SHAPE chemistry. J Am Chem Soc 134:6617–6624. https://doi.org/10.1021/ja2104075 5. Sachsenmaier N, Handl S, Debeljak F, Waldsich C (2014) Mapping RNA structure in vitro using nucleobase-specific probes. Methods Mol Biol 1086:79–94. https://doi.org/10. 1007/978-1-62703-667-2_5 6. Tyrrell J, McGinnis JL, Weeks KM, Pielak GJ (2013) The cellular environment stabilizes adenine riboswitch RNA structure. Biochemistry 52:8777–8785. https://doi.org/10.1021/ bi401207q 7. Mortimer SA, Weeks KM (2008) Timeresolved RNA SHAPE chemistry. J Am Chem Soc 130:16178–16180. https://doi.org/10. 1021/ja8061216 8. Smola MJ, Christy TW, Inoue K et al (2016) SHAPE reveals transcript-wide interactions, complex structural domains, and protein interactions across the Xist lncRNA in living cells. Proc Natl Acad Sci 113:10322–10327. https://doi.org/10.1073/pnas.1600008113 9. McGinnis JL, Liu Q, Lavender CA et al (2015) In-cell SHAPE reveals that free 30S ribosome subunits are in the inactive state. Proc Natl Acad Sci U S A 112:2425–2430. https://doi. org/10.1073/pnas.1411514112 10. Bao P, Ho¨bartner C, Hartmuth K, Lu¨hrmann R (2017) Yeast Prp2 liberates the 50 splice site

and the branch site adenosine for catalysis of pre-mRNA splicing. RNA 23:1770–1779. https://doi.org/10.1261/rna.063115.117 11. Pyle AM (2016) Group II intron self-splicing. Annu Rev Biophys 45:183–205. https://doi. org/10.1146/annurev-biophys-062215011149 12. Peters JK, Toor N (2015) Group II intron lariat: structural insights into the spliceosome. RNA Biol 12:913–917. https://doi.org/10. 1080/15476286.2015.1066956 13. Galej WP, Toor N, Newman AJ, Nagai K (2018) Molecular mechanism and evolution of nuclear pre-mRNA and group II intron splicing: insights from cryo-electron microscopy structures. Chem Rev 118:4156–4176. https://doi.org/10.1021/acs.chemrev. 7b00499 14. Robart AR, Chan RT, Peters JK et al (2014) Crystal structure of a eukaryotic group II intron lariat. Nature 514:193–197. https:// doi.org/10.1038/nature13790 15. Chan RT, Peters JK, Robart AR et al (2018) Structural basis for the second step of group II intron splicing. Nat Commun 9:4676. https:// doi.org/10.1038/s41467-018-06678-0 16. Smola MJ, Rice GM, Busan S et al (2015) Selective 20 -hydroxyl acylation analyzed by primer extension and mutational profiling (SHAPE-MaP) for direct, versatile and accurate RNA structure analysis. Nat Protoc 10:1643–1669. https://doi.org/10.1038/ nprot.2015.103

Chapter 11 Dynamics-Function Analysis in Catalytic RNA Using NMR Spin Relaxation and Conformationally Restricted Nucleotides Charles G. Hoogstraten, Montserrat Terrazas, Anna Avin˜o´, Neil A. White, and Minako Sumita Abstract A full understanding of biomolecular function requires an analysis of both the dynamic properties of the system of interest and the identification of those dynamics that are required for function. We describe NMR methods based on metabolically directed specific isotope labeling for the identification of molecular disorder and/or conformational transitions on the RNA backbone ribose groups. These analyses are complemented by the use of synthetic covalently modified nucleotides constrained to a single sugar pucker, which allow functional assessment of dynamics by selectively removing a minor conformer identified by NMR from the structural ensemble. Key words Conformational restriction, NMR dynamics, Noncoding RNA, Dynamics-function, Sugar pucker

1

Introduction A complete understanding of the function of biological macromolecules and their assemblies requires detailed study of both threedimensional structures and of the time-dependent properties of those structures, i.e., molecular dynamics, as well as the correlation of both types of properties with biological function. The structurefunction paradigm, in which three-dimensional structural information guides subsequent mutagenesis and other experiments to probe the functional relevance of particular structural features, is now well established. As experimental and computational studies of conformational dynamics grow in power and scope, however, the generalization to what might be termed dynamics-function studies has remained challenging. A particular dynamic mode is more difficult to experimentally remove than is, for example, a particular functional group near the active site of an enzyme. These questions

Robert J. Scarborough and Anne Gatignol (eds.), Ribozymes: Methods and Protocols, Methods in Molecular Biology, vol. 2167, https://doi.org/10.1007/978-1-0716-0716-9_11, © Springer Science+Business Media, LLC, part of Springer Nature 2021

183

184

Charles G. Hoogstraten et al.

are of particular interest for ribozymes and other noncoding RNA molecules, for which evidence indicates a particularly prominent role for conformational transitions in molecular function [1–7]. This chapter is concerned with dynamics-function analysis for backbone ribose groups in nucleic acids, for which the most prominent dynamic mode is the interconversion of C30 -endo (A-form) and C20 -endo (B-form) sugar puckers [8, 9]. The correlation of conformational dynamics with function requires two types of analysis: The detection of structural disorder and/or sampling of minor conformations at the atom-specific level, and the assessment of the functional importance of the detected motions. Both of these goals have required methodological advances beyond standard technologies (Fig. 1). NMR spectroscopic techniques including spin relaxation are powerful methods for the site-specific experimental analysis of dynamics in both proteins and RNA [10–14]. In uniformly 13 C-labeled RNA molecules, the standard isotope pattern in samples prepared for NMR spectroscopy, 13C-13C magnetic interactions among the various ribose carbons place severe limits on the applicability of spin-relaxation and related NMR techniques for the analysis of dynamics at those sites. Thus, for valid NMR spinrelaxation analysis of ribose carbon backbone atoms in RNA, 13C isotope labels must be introduced in such a fashion that no one-bond 13C-13C interactions are present [15]. A broadly applicable solution to such limitations is the manipulation of bacterial metabolic pathways in order to place 13C labels at high levels at particular chosen atoms such that all of the directly bonded carbon atoms are the magnetically inert isotope 12C [16–18]. We make use of a metabolic labeling procedure resulting in RNA containing 20 ,40 -13C2 nucleotides, providing two appropriate 13C probes per nucleotide. Labeling can be performed for all nucleotides in the molecule or, to help alleviate spectral overlap, for all nucleotides of a particular type (all cytosines, in the example given). We have applied this alternate-site pattern to systems including the GNRA tetraloop [19] and the lead-dependent ribozyme [20]. Functional probing requires the assay of activity (catalysis, ligand binding, or other appropriate parameter) in a molecule containing a mutation or modification specifically quenching the dynamic modes of interest. For RNA ribose groups, for which all naturally occurring nucleotides have identical structures, this is most effectively obtained using chemically modified nucleotides that are covalently restricted to particular regions of the pseudorotation cycle, that is, to particular sugar pucker conformations. In cases where the 20 -hydroxy group is functionally dispensable, this can be done with commercially available locked nucleic acid (LNA) nucleotides [21]. Where the 20 -hydroxyl must be retained, such as at the active site of self-cleaving RNA molecules, more specialized synthetic nucleotides that lock the sugar pucker with retention of

Dynamics-Function Analysis in Catalytic RNA Using NMR Spin Relaxation and. . .

Which Nucleotides Sample Minor Conformations (Invisible States)?

Are the Dynamics Functionally Relevant (is the invisible state the active state)?

Metabolically-Driven Specific Isotope Labeling

Conformationally Restricted Nucleotides

O

12CH 13C

H

Base 2

H

H

13C

Base

4'

5'

O

H

2'

O

OH

LNA

NMR Spin Relaxation

RP O

3' 12C

12C

O

Base

C5'

O

1'

185

3'

1'

4' O R'P

2' OH

N-MC

Oligonucleotide Synthesis Functional Probing

DYNAMICS-FUNCTION CORRELATION Fig. 1 Schematic view of integrated dynamics-function analysis in noncoding RNA systems. The dashed line indicates that sites of interest for functional probing may in some cases be chosen based on the results of NMR analyses. Double boxes indicate detailed protocols provided in this chapter

the 20 -hydroxyl are required. We describe here the use of synthetic, North-locked bicycle[3.1.0]hexane methanocarba (N-MC) ribonucleotides [22–26] at the active site of a model ribozyme. 1.1 NMR Studies of Conformational Dynamics: Principles

NMR spin-relaxation and, more recently, chemical exchange saturation transfer (CEST) [27–29] techniques are a rich source of detailed information on conformational dynamics in macromolecules. We describe here the analysis of a single parameter, the 13C transverse relaxation rate measured in the rotating frame (R1ρ), which provides a highly informative window into the fundamental properties of the system as well as a foundation for any more detailed analyses [30, 31]. For a hypothetical case in which no internal motion is present, i.e., the molecule is undergoing only

Charles G. Hoogstraten et al.

rigid-molecule Brownian tumbling, very similar R1ρ values will be measured for all resonances of a given chemical type (all 13C20 or 13 C40 , for example) (see Note1). Information on the internal dynamics of the molecule is encoded in R1ρ values that deviate from this globally typical range. For regions of the molecule that display disorder on a sub-nanosecond timescale, transverse relaxation is slower and decreased R1ρ values (longer relaxation times T1ρ; see Note 2) will be observed. By contrast, in the presence of multiple distinct conformations of the molecule that are sampled on timescales of microseconds to milliseconds (“exchange,” in NMR parlance), the sampling of states with multiple chemical shifts gives rise to an additional relaxation contribution that can cause R1ρ to be increased (shorter T1ρ), sometimes to a dramatic extent. In a typical R1ρ dataset for a molecule, therefore, a well-defined plateau of very similar values will be observed, corresponding to the rigid framework of the molecule. In nucleic acids, Watson–Crick double helices most typically define that plateau. Individual resonances that show significantly lower R1ρ values then indicate disordered regions of the molecule, whereas significantly increased R1ρ values indicate the presence of multiple conformations, potentially including the sampling of low-probability “invisible states” that are important for molecular function. Example data for 13C20 and 13 C40 resonances for cytidine resonances in the lead-dependent ribozyme are shown in Fig. 2. Inflated values of R1ρ are observed

A

• − − − − −

50 45 40 35 30 25 20 15 10 5 0

− • − − −

15 G7 G9 G C G A C C 6 A8 C C A G C A + A 3' C30G C U G A25G 24 G G U U20G A

5'G

R1ρ (s-1)

186

B C2' C4'

C2

C5

C6

C10 C11 Residue

C14

C28

C30

Fig. 2 (a) Secondary structure of the lead-dependent ribozyme, indicating the adenosine residue (Ade-25) with a shifted pKa of 6.5 as positively charged [32], the noncanonical dynamic A-G base pairing interaction (Ade-8 Gua-24), and the self-cleavage site (arrow). (b) Transverse relaxation rates (R1ρ) for the 20 ,40 -13C2Cytidine-Leadzyme (Data reproduced from Ref. [20], copyright 2018 Cold Spring Harbor Laboratory Press. Used by permission)

Dynamics-Function Analysis in Catalytic RNA Using NMR Spin Relaxation and. . .

187

at several sites, notably including the active-site resonance Cyt-6. Since NMR coupling-constant analysis unambiguously indicated the presence of a single major C30 -endo sugar pucker at this site [33], the spin-relaxation results demonstrated the sampling of a low-population C20 -endo state, which was identified with the activated form of the ribozyme [20]. 1.2 Scope of This Chapter

2

Detailed descriptions of methods for the production of isotopically labeled nucleotides from E. coli grown in culture and for the incorporation of those nucleotides into defined-sequence RNA via in vitro transcription from synthetic DNA templates have been published and are not reiterated here [34, 35]. For specific isotope labeling using metabolic pathways, identical procedures are followed with the substitution of appropriate bacterial strains and carbon sources. For the 20 ,40 -13C2 labeling pattern in this work, a kanamycin-resistant, glucose-6-phosphate negative (zwf) E. coli strain (JW1841-1, Coli Genetic Stock Center, Yale) was grown on 2-13C-glycerol as the sole carbon source. A wide variety of complementary metabolically driven isotope patterns are available for both amino acids and nucleotides [16, 36]. Similarly, the synthetic route to the North-locked ribomethanocarbacytidine phosphoramidite precursor is beyond the scope of this chapter and has been described in detail elsewhere [26]. This protocol describes the modifications to standard solid-phase synthesis necessary to accommodate the modification in the synthesis of the modified ribozyme, as well as subsequent deprotection and purification steps and the assay of self-cleavage activity. The double-outlined boxes in Fig. 1 indicate the stages of a dynamics-function project for which detailed protocols are included herein.

Materials All reagents used should be the highest purity available. Prepare solutions in double-distilled DNase/RNase free molecular biology grade water (ddH2O).

2.1 NMR Analysis of RNA Dynamics

1. 2-13C-glycerol. 2. E. coli strain JW1841-1 (zwf genotype, kanamycin-resistant) (Coli Genetic Stock Center, Yale). 3. Standard reagents for molecular biology, sample handling, and large-scale nucleic acid purification. 4. High-resolution NMR spectrometer operating at 500 MHz 1 H frequency or greater with variable temperature control, pulsed field gradient unit, and a 1H-detect probe with at least one broadband decoupler channel (see Note 3).

188

Charles G. Hoogstraten et al.

5. Linux computer with NMRPipe, NMRDraw, and Sparky or NMRFAM-Sparky software packages installed (see Note 4). 2.2 Modified Ribozyme Kinetic Analysis 2.2.1 Solid-Phase RNA Synthesis

1. Phosphoramidite of the North pseudosugar modification (Nmethanocarba derivative) of the desired nucleotide containing a 20 -O-(2-cyanoethoxymethyl) (CEM) protecting group. The synthetic procedure is described in detail by Terrazas et al. [26]. 2. Unmodified nucleotide precursors: 50 -O-(4,40 -dimethoxytrityl)-20 -O-tert-butyldimethylsilyl-30 -O-(2-cyanoethyl)-N,N-diisopropyl phosphoramidites: N 2dimethylformamidine-guanosine (dmf-G-CE phosphoramidite); N6-Benzoyl-adenosine (Bz-A-CE phosphoramidite); Uridine (U-CE phosphoramidite); N4-Benzoyl-cytidine (Bz-C-CE phosphoramidite). 3. Substrate: RNA controlled-pore glass (CPG) DMT-C-support. 4. Fluorophore label: 50 -fluorescein-CE phosphoramidite of the 50 -terminal nucleotide. 5. Solid-phase RNA synthesis reagents: Acetic anhydride in THF/pyridine; 16% 1-methylimidazole in THF; 0.02 M iodine in THF/pyridine/water; 1H-tetrazole in anhydrous acetonitrile; 3% trichloroacetic acid in CH2Cl2; Anhydrous CH2Cl2; Anhydrous acetonitrile; 10% t-butylhydroperoxide in acetonitrile/water (96:4); 0.01 M iodine in tetrahydrofuran/pyridine/water (7:2:1). 6. Instrumentation: DNA synthesizer (e.g., Applied Biosystems Model 3400); Argon source; HPLC column Nucleosil 120 C18 (250  8 mm); Heating block; SpeedVac concentrator; Hamilton gas-tight syringe; 3-mL glass vials.

2.2.2 RNA Deprotection and Purification

1. Deprotection reagents: Concentrated ammonia, ethanol, npropylamine, bis(2-mercaptoethyl) ether; tetra-n-butylammonium fluoride (TBAF); triethylammonium acetate (TEAA); NAP-5 or similar desalting column. 2. Reversed-phase chromatography solutions: A, 5% CH3CN in 100 mM triethylammonium acetate (TEAA) pH 6.5; B, 70% CH3CN in 100 mM TEAA pH 6.5.

2.2.3 Ribozyme Activity Assay

1. MOPS, or appropriate buffer for the activity assay of interest. 2. Pb(OAc)2, freshly prepared stock solution. 3. Stock solutions for denaturing PAGE: 5 TBE, 40% 19:1 acrylamide:bisacrylamide, 10 M urea [37]. 4. Fluorescence gel quantitation system (Bio-Rad Fluor-S MAX MultiImager or similar).

Dynamics-Function Analysis in Catalytic RNA Using NMR Spin Relaxation and. . .

3

189

Methods

3.1 NMR Analysis of Ribose Dynamics 3.1.1 NMR Data Acquisition

1. Prepare the specifically isotope-labeled NMR sample according to published procedures (see Subheading 1). For the 20 ,40 -13C2 nucleotide labeling pattern, use the JW1841–1 (zwf genotype, kanamycin-resistant) strain of E. coli and grow the bacteria on 2-13C-glycerol as the sole carbon source. Perform in vitro transcription using the resulting specifically labeled nucleotide (s) for nucleotide type(s) of interest and unlabeled nucleotides for all others. Purify the sample on a size exclusion column [35, 38] and dialyze extensively into the final buffer (see Note 5). 2. Anneal the sample in the NMR tube at 85  C for 2 min followed by slow cooling to room temperature (see Note 6). 3. Insert the NMR sample into the magnet, tune the 1H and 13C channels, and shim the field to homogeneity (see Note 7). 4. From the VnmrJ “Experiments” menu, run the setup macro for the RNA/DNA two-dimensional 1H/13C HSQC. This will load the basic parameters for the experiment along with the standard amplifier powers and pulse widths according to the probefile maintained by the NMR system administrator. 5. Optionally, calibrate the 90 pulse widths. If the probefile is accurate, the default pulse widths should be close to optimal, but this procedure will optimize sensitivity and identify any problems with system configuration. Set the pulse sequence to 1D mode (phase ¼ 0, ni ¼ 0). Acquire a 1D spectrum, phase, and expand the region of interest. For 1H, set the calH parameter to an array of three values, calH ¼ 1.8, 2, 2.2. Increase nt to at least 128 to achieve sufficient signal to noise at close to the null. Acquire data and display the results as a horizontal array (“wft dssh”). If the pulse width is accurate, the first spectrum should be of small magnitude and positive, the second should be null with possibly some residual dispersive intensity, and the third should be of the same magnitude as the first but negative. If this is not the case, adjust “pw” until this pattern is seen, and use that pw for the acquisition. Return calH ¼ 1.0. For 13C, repeat this procedure, using calC to optimize pwC. 6. If desired, acquire a standard HSQC spectrum for reference using the default parameters. 7. Adjust the acquisition for relaxation measurements by choosing the “C13 T1rho” and “ribose” radio buttons under the Acquire>Pulse Sequence tab. Set the remaining acquisition parameters according to Table 1 (Table 1 gives both the parameter descriptions shown in the GUI and the Vnmr parameter names for entry at the command line).

190

Charles G. Hoogstraten et al.

Table 1 VnmrJ parameters for acquisition of Parameter label from GUI

13

C R1ρ data on

13

C20 and

13

C40 resonances

VnmrJ parameter name

Value

sw

2400

Data size

np

1024 (see Note 23)

Number of scans

nt

See main text

Steady-state scans

ss

64

Relaxation delay

d1

1 sec

Observe pulse width

pw

Set by probefile

Pulse power

tpwr

Set by probefile

Decoupler pulse width

pwC

Set by probefile

Decoupler pulse power

pwClvl

Set by probefile

13

sw1

14 ppm (2100 Hz)

Number of increments

ni

80

Acquisition mode

phase

Hypercomplex 2D (phase ¼ 1,2)

Half-dwell delay in t1

f1180

on (y)

N15 refocus in t1

N15refoc

off (n)

Mode radio button: ribose

ribose aromatic allC

on (y) off (n) off (n)

Observe only CH2s

CH2only

off (n)

F1 detection mode radio button

Sensitivity-enhanced

SE ¼ “y” (see Note 24) ZZ ¼ “n”

Relaxation radio button

T1rho

On (y)

Mixing time

relaxT

See main text

Maximum mix time

maxrelaxT

See main text

J(13C-1H)

JCH

145 (see Note 25)

Refocusing time

tCH

0.00172

Constant time

CT

off (n)

1H Offset

tof

Set to HDO resonance

13C Offset

dof

104 ppm (see Notes 26 and 27)

Decoupler mode

dm

nny

Decoupler modulation mode

dmm

ccp

Decoupler sequence

dseq

wurst80

Acquisition tab 1

H Sweep Width (Hz)

C spectral width

Pulse sequence tab

Channels tab

Dynamics-Function Analysis in Catalytic RNA Using NMR Spin Relaxation and. . .

191

8. Set the relaxation time relaxT to one of the shorter relaxation times to be acquired, in seconds (e.g., relaxT ¼ 0.010 for 10 ms). Set maxrelaxT to the longest relaxation time to be used, also in seconds (see Note 8). 9. Set the number of transients (nt) to a multiple of the phase cycle length (8 for “rna_gChsqc”) sufficient to achieve good signal to noise, remembering that signal intensity will decrease substantially for longer relaxT time points. The exact value needed will depend on sample concentration, molecular size, available time, and other factors. We generally find that an experimental duration of between two and four hours provides reasonable results for typical samples. 10. Copy the final parameters to the desired number of other experimental workspaces (“exp” values, in Vnmr). In each of those workspaces, adjust only the relaxT parameter. In general, between 8 and 12 values of relaxT, with several falling both shorter and longer than the expected R1ρ values, will define the rates well. Variation between 0 ms and 120 ms is sufficient for typical systems (see Note 9). relaxT must be set to a multiple of 5 ms. Short and long relaxT values must be distributed randomly rather than in simple descending or ascending order to prevent errors in measured rates arising from instrumental or sample instability. Repeat one relaxT value (we often use 10 ms) at least three times to allow error analysis, interspersed throughout the series. 11. Acquire data in one uninterrupted series, i.e., without removing the sample from the magnet, adjusting the tuning or shimming, or filling cryogens. Save each dataset to disk and, if not to be analyzed directly on the spectrometer console, transfer to the offline workstation for processing and analysis. 3.1.2 Data Format Conversion

1. Processing should be performed on a Linux computer with NMRPipe, NMRDraw, and Sparky or NMRFAM-Sparky [39, 40] installed (see Note 4). Consult with the local system administrator for proper installation and configuration of these packages and associated utilities. 2. In a unix shell window, use the command “varian” to invoke a graphical user interface (GUI) for file conversion. 3. Click the green arrow (Spectrometer Input) to select the appropriate time-domain free induction decay (fid) file. 4. Click “Read Parameters.” The parameters in the GUI should now reflect the input data. If the NMR data was obtained in sensitivity-enhanced mode (SE ¼ “y”), use the “Rance-Kay” option for the indirect dimension. Otherwise (SE ¼ “n,” ZZ ¼ “y”), select “Complex” (see Note 10).

192

Charles G. Hoogstraten et al.

A

#!/bin/csh var2pipe -in ./fid -noaswap -xN 1024 -xT 512 -xMODE -xSW -xOBS -xCAR -xLAB -ndim

Complex 2400.240 599.732 4.773 1H 2

-yN -yT -yMODE -ySW -yOBS -yCAR yLAB -aq2D

160 80 Rance-Kay 2111.741 150.827 104.163 C13 Complex

-out ./test.fid -verb -ov #!/bin/csh # # Basic 2D Phase-Sensitive Processing: # # Use of "ZF -auto" doubles size, then rounds to power of 2. # Use of "FT -auto" chooses correct Transform mode. # Imaginaries are deleted with "-di" in each dimension. # Phase corrections should be inserted by hand. nmrPipe -in test.fid | nmrPipe -fn EM -lb 8.0 -c 1.0 | nmrPipe -fn ZF -auto | nmrPipe -fn FT -auto | nmrPipe -fn PS -p0 247.4 -p1 -1.6 -di -verb | nmrPipe -fn TP -auto | nmrPipe -fn LP -pred 48 | nmrPipe -fn SP -off 0.5 -end 1.0 -pow 2 | nmrPipe -fn ZF -auto | nmrPipe -fn FT -auto | nmrPipe -fn PS -p0 -90 -p1 180 -di -verb | nmrPipe -fn TP -auto -ov -out test.ft2

B

#window function in t2

#phases set empirically

#window function in t1

#appropriate half-dwell phases

Fig. 3 Example Linux shell scripts for data handling. (a) Format conversion from Varian/Agilent to NMRPipecompatible raw data. (b) Two-dimensional Fourier transformation

5. Click “Save Script.” By default, this creates a file “fid.com” in the home folder. The name or destination can be changed if desired, but it often smoothes the workflow in later steps to use the default. A typical shell script invoking the “var2pipe” utility is shown in Fig. 3a.

Dynamics-Function Analysis in Catalytic RNA Using NMR Spin Relaxation and. . .

193

6. Click “Execute Script.” A reformatted “test.fid” file will be generated. If the default filenames have been used, rename and move the .com and .fid files into a separate folder, as they will otherwise be overwritten by the next file conversion. 7. Repeat the file conversion for each dataset. 3.1.3 Data Processing and Visualization

1. Choose a single spectrum at relatively short relaxation delay to develop and optimize processing. Open the corresponding test.fid file with NMRDraw. All dimensions should be in units of time at this point. The following steps will perform a two-dimensional Fourier transformation yielding an HSQCtype spectrum with two frequency axes (see Note 11). 2. If a previously used NMRPipe processing script is not available as a template, use “macro edit” (File menu) in NMRDraw to generate one. For initial processing, use pre-formulated processing schemes, i.e., Process-2D and then Basic-2D. Save and move the script file (by default, “nmrproc.com”) to the folder with previous files (see Note 12). A model processing script is shown in Fig. 3b (see Note 13). 3. Close NMRDraw “shft+q.” 4. Copy and paste the nmrproc.com file to folder with previously generated files. 5. Execute the nmrproc.com file (see Note 14). 6. Open ft2.test with NMRDraw. 7. Inspect the processed result and phase by hand (see Note 15). 8. Process each spectrum using identical versions of the processing macro. This can be done by making copies of the macro with the input and output filenames changed.

3.1.4 Relaxation Analysis

1. Convert the NMRPipe files to Sparky format. Use the following example command as a template: pipe2ucsf rho120.pipe rho120.ucsf. This command converts the processed data file rho120.pipe (equivalent to ft2.test in the above example) into the Sparky-readable output file rho120.ucsf. It is efficient to put the relaxation time in the output filename as shown (120 ms in this example) because Sparky will be able to automatically detect it later (see Note 16). 2. Create a folder in “Projects” in the Sparky directory for the files. 3. Assign peaks in one spectrum and copy and paste the assignments through to all spectra (see Note 17). 4. Extract relaxation rates for each peak in the dataset using the rh command (see Note 18).

194

Charles G. Hoogstraten et al.

3.2 Modified Ribozyme Kinetic Analysis 3.2.1 Solid-Phase RNA Synthesis (See Note 19)

1. Dissolve 0.1 mmol of North-ribomethanocarba phosphoramidite for the nucleotide of interest in anhydrous acetonitrile to obtain a 0.1 M solution in a 10-mL synthesizer vial capped with a rubber septum using a gas-tight syringe. Load the vial in the synthesizer using the change bottle protocol. 2. Load the remaining phosphoramidites including the 50 -fluorescein-CE phosphoramidite and the rest of the RNA synthesis reagents into the synthesizer. Mount an RNA synthesis column with 1 μmol of RNA controlled-pore glass (CPG) support corresponding to the first nucleoside at the 30 -end of the RNA sequence onto the synthesis port of the synthesizer. 3. Perform the automated solid-phase assembly of the oligonucleotide from the 30 terminus through the nucleotide immediately 30 to the modification site using DMT-off protocols. Use standard 0.01 M iodine in tetrahydrofuran/pyridine/water (7:2:1) as the oxidizer and a 15 min coupling time. 4. Incorporate the North pseudosugar modification (C*) using the corresponding phosphoramidite derivative. Next, incorporate the remaining natural nucleotide units using the same procedure as the first part, with the exception of the oxidation solution. In order to avoid cleavage at the modification site [23], use 10% t-butylhydroperoxide in acetonitrile/water (96:4) as the oxidizing solution in these steps, replacing the iodine solution used in the previous steps. Use a 15 min phosphoramidite coupling time at all steps. Yield should exceed 90% for the modified-nucleotide step and 98% for all other steps. 5. Incorporate the fluorescein label at the 50 -end of the strand using 50 -fluorescein-CE phosphoramidite. Coupling time: 5 min. 6. Remove the column from the synthesizer and dry the column with a stream of argon or nitrogen. 7. Transfer the CPG-oligonucleotide support to a 3-mL vial, add 1.5 mL of concentrated aqueous ammonia and 0.5 mL of ethanol, and incubate the vial at 55  C for 1 h. 8. Cool the vial on ice and transfer the supernatant into a 2 mL Eppendorf tube. 9. Rinse the solid support and the vial with 50% ethanol (2  0.25 mL). 10. Evaporate the combined solutions to dryness using an evaporating centrifuge (see Note 20).

3.2.2 Ribozyme 20 -Deprotection and Purification

1. Dissolve the residue from Subheading 3.2.1, step 10 in a mixture formed by 10 μL of n-propylamine, 1 μL of bis (2-mercaptoethyl) ether, and 100 μL of 1 M TBAF in THF and rock at room temperature for 24 h.

Dynamics-Function Analysis in Catalytic RNA Using NMR Spin Relaxation and. . .

195

2. Add 100 μL of 1 M triethylammonium acetate (TEAA) and 289 μL of water to the solution. 3. Desalt the oligonucleotide on a NAP-5 column using water as the eluent and evaporate to dryness. 4. Purify the sample by reversed-phase high performance liquid chromatography (RP-HPLC) using a Nucleosil 120 or comparable C18 column eluted at a flow rate of 3 mL/min with a 20 min linear gradient from 0% to 50% B and 5 min isocratic at 50% B. 5. Pool the fractions containing the desired oligonucleotide, concentrate the solution using a SpeedVac concentrator, and desalt by passing through a Sephadex NAP-25 column. 6. Analyze the molecular weight by mass spectrometry (MALDIToF) for quality control. 3.2.3 Ribozyme Activity Assay

1. Procedures are given here for activity assays in the self-cleaving lead-dependent ribozyme system. For other ribozymes such as the Mg2+-activated hammerhead or hairpin motifs, these procedures will vary in the use of activating metal ion and in the details of assay procedures, and the literature in the appropriate system should be consulted. For functional analysis of RNAs of different classes (self-splicing ribozymes, riboswitches, aptamers binding small molecules or proteins, etc.), assays appropriate to the system will of course be used, but the synthesis and handling of N-MC modified RNA molecules will be as described in Subheadings 3.2.1 and 3.2.2. 2. Using Amicon Ultra-15 centrifugal filtration units, exchange the synthesized RNAs against ddH2O at least three times followed by exchange into 15 mM MOPS Buffer (pH 7.0) (see Note 5). 3. Verify the RNA purity using denaturing polyacrylamide electrophoresis with a gel composition of 20% 19:1 polyacrylamide:bispolyacrylamide, 7 M urea, 1 TBE. Run the gel at 150 V with a one-hour pre-run, typical run time 40 minutes. Visualize the gel using UV shadowing on a fluorescent TLC plate with a hand-held ultraviolet lamp or a gel documentation system. RNA should run as a single band of appropriate size. 4. Determine RNA concentrations using ultraviolet spectrophotometry at 260 nm. For the leadzyme, the single-stranded extinction coefficient (ε) is 2.95  105 M1 cm1 for both unmodified and modified RNAs (see Note 21). 5. Perform steps 6 through 14 in parallel with modified and unmodified RNA sequences. 6. Renature RNA samples via heating at 85  C for 2 min and allow them to cool slowly to room temperature (see Note 6).

196

Charles G. Hoogstraten et al.

7. Prepare fresh stock 50 μM Pb(OAc)2, 15 mM MOPS solution (see Note 22). 8. In an ultracentrifuge tube, mix sufficient RNA stock to bring the 50 μL reaction mixture to 1 μM RNA with sufficient 15 mM MOPS (pH 7.0) buffer to reach 50 μL once Pb(II) is added. For leadzyme kinetics, typical target concentrations of Pb(OAc)2 are 10, 25, 50, 100, 200, and 300 μM. Higher concentrations may be omitted if needed as they are typically beyond the point where the poor solution behavior of Pb(II) at neutral pH leads to decreasing activity. 9. Equilibrate the buffered RNA and freshly made Pb(OAc)2 stock solution at the assay temperature (27  C) for 15 min. 10. Initiate the cleavage reaction by the addition of Pb(OAc)2 to the appropriate final concentration. Mix briefly. Return to the equilibration bath. 11. At time points of 20 s (or as soon as can be reproducibly obtained with manual pipetting), 1, 5, 15, 30, 60, 120, and 180 min, remove a 5 μL aliquot of the reaction mixture for analysis. 12. Immediately quench each aliquot via addition to 5 μL of a 9 M urea/50 mM EDTA mixture followed by freezing on dry ice. 13. Analyze the cleavage reactions via denaturing 20% polyacrylamide gels as in step 3 above. Visualize using a Bio-Rad FluorS MAX MultiImager or similar instrument with fluorescence excitation at 494 nm and detection at 518 nm. 14. Quantitate substrate and 50 -cleavage product gel bands and background signals using software supplied by the manufacturer (e.g., Bio-Rad Quantity One). Subtract background intensity from all band intensities. Calculate the percentage of cleavage product as (product/[product + substrate]) at each time point. 15. Determine the exponential decay rate for the data via nonlinear fitting in a standard data analysis software package (e.g., Origin, SigmaPlot, Igor Pro) or spreadsheet. Manual inspection of the fits and residuals is critical since catalytic RNA constructs often give rise to multiexponential behavior, attributed to a misfolded or degraded fraction of the ribozyme. In this case, fit the data to a double-exponential function and report the fastercleaving fraction for functional comparisons. If the singleversus double-exponential character of the data is ambiguous, assess the statistical significance of the improvement in the fit using standard statistical techniques such as the “F” test [41].

Dynamics-Function Analysis in Catalytic RNA Using NMR Spin Relaxation and. . .

4

197

Notes 1. Dramatic deviations of the molecule from isotropic (spherically symmetric) overall tumbling can also cause variations in relaxation parameters, albeit generally of smaller magnitude than those observed here. If the structure of the molecule is known, these effects may be taken into account with a more sophisticated computational analysis than is described here [30, 42]. 2. NMR relaxation experiments may be reported as either relaxation rates or relaxation times, related as simple reciprocals (e.g., T1ρ ¼ 1/R1ρ). Since both terms are in common use, care must be taken to avoid confusion in interpretation. 3. We have successfully performed relaxation experiments at fields ranging from 500 to 900 MHz (125–225 MHz in 13C) [3, 19, 20, 43]. In addition to achieving adequate sensitivity and resolution for the sample of interest, the key consideration in the choice of field used is that the exchange contributions to transverse relaxation (Rex) that are of fundamental interest here scale as the square of the static field. Relatively weak effects may be undetectable at lower fields; conversely, very strong Rex contributions may lead to sufficiently fast relaxation that the curve cannot be analyzed, or the NMR peak itself may broaden to undetectability [19]. Acquisition of pilot data at multiple static fields may be of use to determine the optimum field strength. 4. Links to the most current versions of these and many other NMR software routines are maintained by the National Center for Biomolecular NMR Data Processing and Analysis at http:// www.nmrbox.com. 5. RNA is a polyanion, and solutions of RNA molecules, especially at biophysical and spectroscopic concentrations, are therefore prone to counterion condensation effects that deplete cations from bulk solution and can lead to irregular results if RNA is simply brought up in a buffer of a given ionic strength. It is critical for RNA stocks to be prepared via extensive dialysis against the desired buffer in order to define the correct bulksolution ion concentrations. We commonly achieve this using repeated dilution cycles into the desired buffer using Amicontype centrifugal concentrators. To optimize sample recovery, two concentrators can be used in a sequential fashion, i.e., the flow-through of the first unit can be used as input to a second unit. The final retentates of the two units are then combined to yield the stock solution. 6. Annealing protocols designed to bring RNA preparations with different thermal histories to a consistent conformational state are developed empirically for each RNA construct and can vary

198

Charles G. Hoogstraten et al.

widely. In the absence of stabilizing elements such as the GAAA tetraloop, best results may be obtained in the absence of any annealing steps at all. The literature in the system of interest should be consulted and sample-handling protocols scrupulously followed in order to obtain consistent results. 7. Procedures for instrument tuning and adjustment should follow the documentation for the particular system in use. For experimental setup, spectrometers from different manufacturers and to some extent different software versions will use different command and parameter names to accomplish very similar tasks. We describe here instrument setup at 600 MHz using VnmrJ 3.2A on a Varian (now Agilent) spectrometer with pulse programs from Varian BioPack/RNAPack [44]. Setup on other systems can be done in largely parallel fashion. 8. The maxrelaxT parameter is designed to compensate for any errors introduced by heating of the sample arising from the 13C spin lock pulse. It applies irradiation for a period of (maxrelaxT  relaxT) prior to each execution of the pulse sequence, resulting in a constant RF power deposition in the sample for all values of relaxT. 9. In general, a zero-time point will yield distorted results due to off-axis magnetization that is dephased during the first few millisecond of the spin lock. The Biopack rna_gChsqc pulse sequence, however, hardwires a 5 ms delay preceding relaxT, and a relaxT ¼ 0.0 point is therefore useful. 10. Either at this point or following transformation, the 13C carrier frequency should be adjusted from 104 to 79 ppm to account for the effects of the Biopack pulse sequences (see Table 1, Note 26). 11. When calling NMRPipe routines from its graphical interface, NMRDraw uses virtual memory rather than saving every processing step to disk. This is useful for development and debugging, but the final script should be re-executed from the command line to ensure that data is retained for downstream analysis. 12. Detailed documentation of NMRPipe is available at the developer’s website, http://spin.niddk.nih.gov/NMRPipe/doc1/, currently supported at https://www.ibbr.umd.edu/nmrpipe/ index.html. Commands found in processing scripts are documented in full at http://www.nmrscience.com/ref/index. html. 13. The choice of window functions to be applied to the data in each dimension can substantially affect the properties of the processed data. We typically use an exponential multiplication window in the directly detected dimension, with a line

Dynamics-Function Analysis in Catalytic RNA Using NMR Spin Relaxation and. . .

199

broadening of between 4 and 12 Hz depending on the dataset (in Fig. 3b, EM –lb 8.0 gives an 8 Hz broadening). Stronger windows (higher broadening values) improve the signal to noise of the spectrum at the cost of worsening spectral overlap between neighboring peaks. In the indirect dimension, a cosine (in Fig. 3b, SP –off 0.5) or cosine-squared window generally gives good results. It is critical that identical processing parameters be used for each spectrum in a single relaxation dataset. 14. Running the nmrproc.com script from the command line in a terminal window, rather than double clicking it in the LINUX GUI, provides a readout of the progress as the file is being processed. This is very helpful in identifying the specific component of the processing script that is leading to execution errors or other problems. 15. Phase parameters must be adjusted manually by examination of the transformed spectrum. The phase values (PS) are adjusted in gedit or another text editor and nmrproc.com is then re-executed. If f1180 is set to “y,” the phasing in the indirect dimension should be very close to p0 ¼ +90, p1 ¼ 180 for SE ¼ “n” and p0 ¼ 90, p1 ¼ +180 for SE ¼ “y.” Once phase parameters are optimized on the test spectrum, identical values of p0 and p1 should be used for all spectra in the relaxation series. 16. For converting NMRPipe-processed spectra to Sparky compatible files, refer to the following link: https://www.cgl.ucsf. edu/home/sparky/manual/files.html#ConvertNMRPipe. 17. The process of assigning individual peaks and copying and pasting the assignments is documented in the manual for Sparky, https://www.cgl.ucsf.edu/home/sparky/manual/ peaks.html. 18. Performing relaxation analysis using the rh command is documented in the Sparky manual, https://www.cgl.ucsf.edu/ home/sparky/manual/extensions.html#RelaxFit. 19. For commercially available locked nucleic acid nucleotides, standard oligo synthesis performed by the vendor or other available facilities may be used. 20. Long-term storage and (if necessary) shipping of RNA should be at this step, prior to 20 -deprotection. Overnight shipping can be performed in tightly sealed containers at room temperature, but storage should be at 20  C or below. Following 20 -deprotection, RNA should always be maintained at 20  C or below and handled on ice or in a cold chamber. 21. Extinction coefficients calculated using standard nearestneighbor approaches will be slightly different for the modified nucleotide-containing sequence, but this difference is of no

200

Charles G. Hoogstraten et al.

functional consequence for the present purpose. For example, the presence of five pseudouridine modifications was found to lead to no experimentally detectable change in the extinction coefficient of a 19-nucleotide oligo (M.S., unpublished results). If precise concentrations are needed, the experimental extinction coefficient can be determined via RNA digestion with P1 nuclease [45]. 22. The use of freshly prepared Pb(OAc)2 solutions is critical for reliable results. 23. NMR data are reported in complex (pairs of real and imaginary) points. In VnmrJ, an “np” value of 1024 yields 512 complex points in the acquisition (1H) dimension. In contrast, an “ni” value of 80 yields 80 complex points in the indirectly acquired (13C) dimension. Care should be taken to ensure that the parameters used by the processing software correspond to these conventions. 24. The “SE” option invokes sensitivity-enhanced pulse sequence elements that retain complementary coherence transfer pathways [46]. These often yield improved results, but when used in larger molecules these advantages may disappear or reverse owing to the increased numbers of pulses and delays. If in doubt, a comparison of the signal obtained for the first slice of an HSQC (ni ¼ 0, phase ¼ 1) for ZZ ¼ “n”/SE ¼ “y” versus ZZ ¼ “y”/SE ¼ “n” will indicate the optimal setup. 25. Due to an error in the VnmrJ3.2A macros, changing the “J (13C-1H)” parameter in the GUI does not affect the actual value of the JCH parameter used for acquisition. This parameter should always be adjusted and verified at the command line. 26. The Biopack pulse sequences installed on many Varian/Agilent spectrometers assume that the 13C carrier is always set by the user to 110 ppm, and the pulse programs then adjust the carrier to the appropriate chemical shift for a given experiment. The rna_gChsqc pulse sequence with the ribose ¼ “y” flag set subtracts 25 ppm from the preset carrier to yield a spectrum centered at 85 ppm. For 20 ,40 -13C2 samples, however, the optimal carrier setting is ca. 79 ppm, midway between the 13 C20 and 13C40 resonances. The user should thus set the carrier to the fictitious value of 104 ppm, which the pulse sequence will then adjust to 79 ppm. 27. At ultrahigh static magnetic field strengths, it may be advantageous to acquire separate datasets for 13C20 and 13C40 resonances, with the carrier placed at the center of each spectral region, in order to avoid effects from resonance offset [19].

Dynamics-Function Analysis in Catalytic RNA Using NMR Spin Relaxation and. . .

201

Acknowledgments The authors are grateful to Dr. Victor Marquez and Dr. Ramon Eritja for helpful discussions and the U.S. National Science Foundation (MCB-1413356 to C.G.H.) and the Spanish Ministry of Economy (MINECO) (CTQ2017-84415-R to Ramon Eritja) for funding support. References 1. Hoogstraten CG, Sumita M (2007) Structurefunction relationships in RNA and RNP enzymes: Recent advances. Biopolymers 87:317–328 2. Lee TS, Radak BK, Harris ME et al (2016) A two-metal-ion-mediated conformational switching pathway for HDV ribozyme activation. ACS Catal 6:1853–1869 3. Legault P, Hoogstraten CG, Metlitzky E et al (1998) Order, dynamics, and metal binding in the lead-dependent ribozyme. J Mol Biol 284:325–335 4. Lemieux S, Chartrand P, Cedergren R et al (1998) Modeling active RNA structures using the intersection of conformational space: application to the lead-activated ribozyme. RNA 4:739–749 5. Martick M, Scott WG (2006) Tertiary contacts distant from the active site prime a ribozyme for catalysis. Cell 126:309–320 6. Murray JB, Dunham CM, Scott WG (2002) A pH-dependent conformational change, rather than the chemical step, appears to be ratelimiting in the hammerhead ribozyme cleavage reaction. J Mol Biol 315:121–130 7. Yajima R, Proctor DJ, Kierzek R et al (2007) A conformationally restricted guanosine analog reveals the catalytic relevance of three structures of an RNA enzyme. Chem Biol 14:23–30 8. Altona C, Sundaralingam M (1972) Conformational analysis of the sugar ring in nucleosides and nucleotides. A new description using the concept of pseudorotation. J Am Chem Soc 94:8205–8212 9. Wijmenga SS, Van Buuren BNM (1998) The use of NMR methods for conformational studies of nucleic acids. Prog Nucl Magn Reson Spectrosc 32:287–387 10. Al Hashimi HM, Walter NG (2008) RNA dynamics: it is about time. Curr Opin Struct Biol 18:321–329 11. Bothe JR, Nikolova EN, Eichhorn CD et al (2011) Characterizing RNA dynamics at atomic resolution using solution-state NMR spectroscopy. Nat Methods 8:919–931

12. Dethoff EA, Petzold K, Chugh J et al (2012) Visualizing transient low-populated structures of RNA. Nature 491:724–728 13. Furtig B, Buck J, Richter C et al (2012) Functional dynamics of RNA ribozymes studied by NMR spectroscopy. Methods Mol Biol 848:185–199 14. Latham MP, Brown DJ, Mccallum SA et al (2005) NMR methods for studying the structure and dynamics of RNA. Chembiochem 6:1492–1505 15. Johnson JE Jr, Julien KR, Hoogstraten CG (2006) Alternate-site isotopic labeling of ribonucleotides for NMR studies of ribose conformational dynamics in RNA. J Biomol NMR 35:261–274 16. Hoogstraten CG, Johnson JE Jr (2008) Metabolic labeling: taking advantage of bacterial pathways to prepare spectroscopically useful isotope patterns in proteins and nucleic acids. Concepts Magn Resonan A 32:34–55 17. Leblanc RM, Longhini AP, Tugarinov V et al (2018) NMR probing of invisible excited states using selectively labeled RNAs. J Biomol NMR 71:165–172 18. Longhini AP, Leblanc RM, Becette O et al (2016) Chemo-enzymatic synthesis of sitespecific isotopically labeled nucleotides for use in NMR resonance assignment, dynamics and structural characterizations. Nucl Acids Res 44: e52 19. Johnson JE Jr, Hoogstraten CG (2008) Extensive backbone dynamics in the GCAA RNA tetraloop analyzed using 13C NMR spin relaxation and specific isotope labeling. J Am Chem Soc 130:16757–16769 20. White NA, Sumita M, Marquez VE et al (2018) Coupling between conformational dynamics and catalytic function at the active site of the lead-dependent ribozyme. RNA 24:1542–1554 21. Julien KR, Sumita M, Chen P-H et al (2008) Conformationally restricted nucleotides as a probe of structure-function relationships in RNA. RNA 14:1632–1643

202

Charles G. Hoogstraten et al.

22. Ketkar A, Zafar MK, Banerjee S et al (2012) A nucleotide-analogue-induced gain of function corrects the error-prone nature of human DNA polymerase iota. J Am Chem Soc 134:10698–10705 23. Maier MA, Choi Y, Gaus H et al (2004) Synthesis and characterization of oligonucleotides containing conformationally constrained bicyclo[3.1.0]hexane pseudosugar analogs. Nucleic Acids Res 32:3642–3650 24. Marquez VE, Ezzitouni A, Siddiqui MA et al (1997) Conformational analysis of nucleosides constructed on a bicyclo[3.1.0]hexane template. Structure-antiviral activity analysis for the northern and southern hemispheres of the pseudorotational cycle. Nucleosides Nucleotides 16:1431–1434 25. Saneyoshi H, Mazzini S, Avino A et al (2009) Conformationally rigid nucleoside probes help understand the role of sugar pucker and nucleobase orientation in the thrombinbinding aptamer. Nucleic Acids Res 37:5589–5601 26. Terrazas M, Avino A, Siddiqui MA et al (2011) A direct, efficient method for the preparation of siRNAs containing ribo-like North bicyclo [3.1.0]hexane pseudosugars. Org Lett 13:2888–2891 27. Vallurupalli P, Bouvignies G, Kay LE (2012) Studying “invisible” excited protein states in slow exchange with a major state conformation. J Am Chem Soc 134:8148–8161 28. Zhao B, Hansen AL, Zhang Q (2014) Characterizing slow chemical exchange in nucleic acids by carbon CEST and low spin-lock field R(1rho) NMR spectroscopy. J Am Chem Soc 136:20–23 29. Zhao B, Zhang Q (2015) Measuring residual dipolar couplings in excited conformational states of nucleic acids by CEST NMR spectroscopy. J Am Chem Soc 137:13480–13483 30. Palmer AG III (2004) NMR characterization of the dynamics of biomacromolecules. Chem Rev 104:3623–3640 31. Palmer AG III, Massi F (2006) Characterization of the dynamics of biomacromolecules using rotating-frame spin relaxation NMR spectroscopy. Chem Rev 106:1700–1719 32. Legault P, Pardi A (1997) Unusual dynamics and pKa shift at the active site of a leaddependent ribozyme. J Am Chem Soc 119:6621–6628 33. Hoogstraten CG, Legault P, Pardi A (1998) NMR solution structure of the lead-dependent

ribozyme: evidence for dynamics in RNA catalysis. J Mol Biol 284:337–350 34. Batey RT, Battiste JL, Williamson JR (1995) Preparation of isotopically enriched RNAs for heteronuclear NMR. Methods Enzymol 261:300–322 35. Mckenna SA, Kim I, Puglisi EV et al (2007) Purification and characterization of transcribed RNAs using gel filtration chromatography. Nat Protoc 2:3270–3277 36. Longhini AP, Leblanc RM, Dayie TK (2016) Chemo-enzymatic labeling for rapid assignment of RNA molecules. Methods 103:11–17 37. Green MRS, J. (2012) Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY 38. Kim I, Mckenna SA, Viani PE et al (2007) Rapid purification of RNAs using fast performance liquid chromatography (FPLC). RNA 13:289–294 39. Delaglio F, Grzesiek S, Vuister GW et al (1995) NMRPipe: a multidimensional spectral processing system based on UNIX pipes. J Biomol NMR 6:277–293 40. Lee W, Tonelli M, Markley JL (2015) NMRFAM-SPARKY: enhanced software for biomolecular NMR spectroscopy. Bioinformatics 31:1325–1327 41. Bevington PR, Robinson DK (2003) Data reduction and error analysis for the physical sciences, 3rd edn. McGraw-Hill, New York, NY 42. Kay LE, Torchia DA, Bax A (1989) Backbone dynamics of proteins as studied by 15N inverse detected heteronuclear NMR spectroscopy: application to staphylococcal nuclease. Biochemistry 28:8972–8979 43. Hoogstraten CG, Wank JR, Pardi A (2000) Active site dynamics in the lead-dependent ribozyme. Biochemistry 39:9951–9958 44. Lukavsky PJ, Puglisi JD (2001) RNAPack: an integrated NMR approach to RNA structure determination. Methods 25:316–332 45. Kallansrud G, Ward B (1996) A comparison of measured and calculated single- and doublestranded oligodeoxynucleotide extinction coefficients. Anal Biochem 236:134–138 46. Stonehouse J, Clowes RT, Shaw GL et al (1995) Minimisation of sensitivity losses due to the use of gradient pulses in triple-resonance NMR of proteins. J Biomol NMR 5:226–232

Part IV Ribozyme Conjugations

Chapter 12 Design and Evaluation of Guide RNA Transcripts with a 30 -Terminal HDV Ribozyme to Enhance CRISPR-Based Gene Inactivation Ben Berkhout, Zongliang Gao, and Elena Herrera-Carrillo Abstract The recently discovered clustered regularly interspaced short palindromic repeats (CRISPR)-Cpf1 system, now reclassified as Cas12a, is a DNA-editing platform analogous to the widely used CRISPR-Cas9 system. The Cas12a system exhibits several distinct features over the CRISPR-Cas9 system, such as increased specificity and a smaller gene size to encode the nuclease and the matching CRISPR guide RNA (crRNA), which could mitigate off-target and delivery problems, respectively, described for the Cas9 system. However, the Cas12a system exhibits reduced gene editing efficiency compared to Cas9. A closer inspection of the crRNA sequence raised some uncertainty about the actual 50 and 30 -ends. RNA Polymerase (Pol) III promoters are generally used for the production of small RNAs with a precise 50 terminus, but the Pol III enzyme generates small RNAs with 3’ U-tails of variable length. To optimize the CRISPRCas12a system, we describe the inclusion of a self-cleaving ribozyme in the vector design to facilitate accurate 30 -end processing of the crRNA transcript to produce precise molecules. This optimized design enhanced not only the gene editing efficiency, but also the activity of the catalytically inactive Cas12a-based CRISPR gene activation platform. We thus generated an improved CRISPR-Cas12a system for more efficient gene editing and gene regulation purposes. Key words Gene therapy, CRISPR-Cas, Cas12a, HDV ribozyme, Luciferase reporter assay, FACS, northern blot, Surveyor nuclease assay

1

Introduction The CRISPR system with the CRISPR-associated (Cas) protein is part of the adaptive immune system present in some bacteria and archaea that protects against invasion by viruses and foreign DNA [1, 2]. Optimization of the CRISPR system included optimization of the codon usage in the Cas gene and the generation of a chimeric guide RNA (gRNA) by fusion of the crRNA and the transactivating crRNA (tracrRNA) components (Fig. 1a) [3–6]. CRISPR technology is a powerful molecular tool that allows researchers to target any specific nucleotide sequences and to modify the gene

Robert J. Scarborough and Anne Gatignol (eds.), Ribozymes: Methods and Protocols, Methods in Molecular Biology, vol. 2167, https://doi.org/10.1007/978-1-0716-0716-9_12, © Springer Science+Business Media, LLC, part of Springer Nature 2021

205

206

Ben Berkhout et al.

Fig. 1 Schematic representation of CRISPR-Cas systems. (a) Cas9–gRNA complex formation and activity. A chimeric gRNA can be expressed as a single transcript in which tracrRNA- and crRNA-derived segments (yellow) are fused by a short loop. When Cas9 recognizes a PAM (red) in a DNA target, the gRNA base pairs with the complementary target DNA strand (green). DNA cleavage by Cas9 (pink) generates a PAM-proximal blunt-end cut. (b) The repeat-derived segment of the crRNA (yellow) forms a pseudoknot that is recognized by Cas12a (light blue). Upon crRNA binding, Cas12a recognizes a PAM (red) in a DNA target (green), the crRNA will base pair with complementary target DNA. Target DNA cleavage by Cas12a results in a PAM-distal dsDNA break with 50 overhangs

function. The most widely used CRISPR-Cas9 system requires a Streptococcus pyogenes Cas9 (spCas9) nuclease and a gRNA. Cas9 is instructed by the gRNA to induce precise cleavage at endogenous genomic loci in mammalian cells in a sequence-specific manner. A 20 nucleotide sequence in the 50 -end of the gRNA is designed to be complementary to the target DNA site, which also needs to have a protospacer adjacent motif (PAM) immediately downstream of the target site (for instance, NGG for spCas9). However, the large size of CRISPR-Cas transgene cassettes impedes their implementation in gene therapy applications with viral vectors that have a limited packaging capacity, which is for instance the case for adenoassociated virus (AAV) vectors. There is a serious need for smaller Cas orthologues from other bacterial and archaeal species. Differences among the many natural CRISPR-Cas systems available have indeed facilitated diverse applications in mammalian cells. Recently, the Cpf1 system, now renamed Cas12a, was reported to expand the genome editing possibilities because the Cas12a protein and the matching crRNA are smaller than the Cas9 counterparts, which is beneficial for gene delivery (Fig. 1b). Furthermore, the Cas12a system possesses several unique features [7–9]. Cas12a targets a T-rich PAM sequence, thus expanding the potential target sequences over those that can be recognized by Cas9. CRISPRCas9 induced DNA cleavage occurs in the PAM-proximal sequence region that is critical for gRNA binding and target DNA cleavage, while CRISPR-Cas12a triggers DNA cleavage in the distal region of the PAM sequence that is less critical for target binding and

Design and Evaluation of Guide RNA Transcripts with a 30 -Terminal. . .

207

cleavage (Fig. 1b). This feature of Cas12a is potentially useful for gene inactivation as the cleaved and subsequently repaired DNA sequence, usually with insertions or deletions (indels), can likely be re-cleaved by Cas12a as the critical recognition motifs are maintained. Thus, a subsequent round of Cas12a cleavage and DNA repair would be more prone to create a larger indel, which may be extremely valuable for attempts to inactivate HIV-1 proviruses [Ref PMID 32282899 Nucleic Acids Res. 2020 Apr 13. pii: gkaa226. doi: 10.1093/nar/gkaa226]. Specifically, the generation of more dramatic indel mutations could theoretically prevent viral escape that is possible via more subtle mutations. Thus, Cas12a may become an important tool in HIV genome inactivation towards the realization of a cure. However, a serious disadvantage of the CRISPR-Cas12a system is that it exhibits reduced editing activity compared to CRISPR-Cas9 [10–12], which limits potential applications. In an attempt to optimize the CRISPR-Cas12a system, we focused on the Cas12a orthologues from Acidaminococcus sp. (AsCas12a) and Lachnospiraceae bacterium (LbCas12a) that have been used for genome editing in human cells [7, 11]. It thus far remains unknown whether the exact 50 and 30 end of the matching crRNA molecules influence the editing efficiency [13, 14]. Pol III promoters are commonly used for small RNA expression and are responsible for the positioning of the exact 50 end of the transcript. At the 30 end, Pol III will terminate at heterogeneous positions within a T-stretch terminator, thus creating crRNAs with a variable U-tail of 1–6 nucleotides [15]. This U-tail was suggested to have a negative effect on the crRNA activity of AsCas12a because it is juxtaposed to the guide sequence that facilitates DNA target recognition [15]. Therefore, expressing the exact crRNA molecule with precise ends might be critical for optimal Cas12a activity. We generated crRNA molecules with the exact 30 end by insertion of the self-cleaving hepatitis delta virus (HDV) ribozyme that instructs site-specific RNA processing (Fig. 2) [16]. The effect of ribozyme addition on crRNA production and activity was systematically investigated. We demonstrated that the 30 -positioned HDV element can significantly boost the CRISPR-Cas12a activity. We also demonstrated that this crRNA-HDV design enhances the performance of CRISPR-based gene activation systems.

2

Materials

2.1 Vector Construction

1. pY010 (Addgene# 69982). 2. pY016 (Addgene# 69988). 3. WN10150 (Addgene# 80443). 4. WN10151 (Addgene# 80441). 5. pSilencer2.0-U6 vector (Ambion #7209).

208

Ben Berkhout et al.

Fig. 2 Schematic of ribozyme-processed crRNA. (a) The crRNA structures of the As and LbCas12a systems. Both crRNA molecules consist of a ~20 nucleotides scaffold and a 23 nucleotides guide (N23). The variable U1–6 tail at the 30 -end is generated when a standard Pol III promoter cassette is used. The variable loop nucleotide positions are marked in gray and green boxes. The first crRNA nucleotide is marked as +1A. (b) Schematic of two crRNA expression constructs. The Pol III human promoter drives crRNA transcription up to the T6 (TTTTTT) termination signal. The HDV ribozymes is introduced to guide crRNA processing exactly at the crRNA border (marked as scissor). The +1A represents the first crRNA nucleotide

Design and Evaluation of Guide RNA Transcripts with a 30 -Terminal. . .

209

6. Control Firefly Luciferase Reporter (pGL3) (Promega #E1741). 7. Renilla Luciferase Control (pRL) (Promega #E2231). 8. pCMV-rtTA-V10 plasmid [17]. 9. pRRLSIN.cPPT.PGK-GFP.WPRE (Addgene# 12252). 10. One Shot Stbl3 chemically competent E. coli. 11. SOC medium. 12. LB medium. 13. LB agar medium. 14. Ampicillin, 100 mg/ml, sterile filtered. 15. DNA oligonucleotides encoding the crRNA targeting sequences. 16. DNA fragments sequences.

encoding

the

promoter-crRNA-HDV

17. Annealing buffer 10: 100 mM Tris–HCl (pH 8), 500 mM NaCl, and 10 mM EDTA. 18. BsmBI restriction enzyme. 19. Gibson Assembly Cloning Kit. 20. T4 DNA Ligase (1 U/μl). 21. Taq Green PCRMaster Mix (2). 22. 100 bp DNA Ladder. 23. SeaKem LE agarose. 24. UltraPure Ethidium Bromide, 10 mg/ml. 25. BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems). 26. Digital gel imaging system Proxima. 27. UV spectrophotometer. 2.2 Mammalian Cell Culture

1. Human embryonic kidney (HEK) 293T cells. 2. HeLa X1/6 cells [18] are derived from the HeLa cervix carcinoma cell line and harbor chromosomally integrated copies of the CMV-7tetO-promoter/firefly luciferase construct pUHC13-3 [19]. 3. TZM-bl cells (NIH AIDS reagent program #8129). 4. Dulbecco’s modified Eagle’s medium (DMEM). 5. Fetal Bovine Serum (FBS) heat inactivated. 6. MEM non-essential amino acid solution (NEAA) 100. 7. Penicillin-streptomycin, 100. 8. Dulbecco’s PBS (DPBS).

210

Ben Berkhout et al.

9. Trypsin-EDTA (0.05%). 10. Lipofectamine Technologies).

2000

Transfection

Reagent

(Life

11. Opti-MEM I Reduced Serum Medium (Life Technologies). 12. 75 cm2 cell culture flask (T75 flask), filter cap. 13. Disposable hemocytometer. 14. Trypan blue. Cells are grown as a monolayer in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% FBS, 1% NEAA, penicillin (100 U/ml), and streptomycin (100 μg/ml) at 37  C and 5% CO2 (see Notes 1 and 2). 2.3 Dual-Luciferase Reporter Assay

1. Dual-luciferase reporter assay system (Promega # E1960). 2. 12-Well plate, cell culture treated, lid with condensation ring, sterile. 3. 96-Well plate, half area, white. 4. 96 Microplate Luminometer (see Note 3).

2.4

Northern Blot

1. miRNA Isolation Kit. 2. Acid-Phenol:Chloroform. 3. ACS grade 100% ethanol. 4. RNase-free 1.5 ml polypropylene microfuge tubes. 5. 15% TBE-Urea Gels, 1.0 mm, 15-well. 6. Decade Marker. 7. LNA oligonucleotide. The following oligonucleotides are used (LNA positions are underlined): Luc2 probe (50 -GAGATCCTATTTTTGG CAA-30 ) and Lb probe (50 -TCTACACTTAGTAGAAATT-30 ). 8. KinaseMax 50 End-Labeling Kit. 9. TBE buffer 10: 1 M Tris, 1 M Boric acid, and 0.02 M EDTA. 10. UltraPure Ethidium Bromide, 10 mg/ml. 11. Sephadex G-25 spin column. 12. ULTRAhyb Ultrasensitive Hybridization Buffer. 13. Low stringency (2 SSC + 0.1% SDS) and high stringency wash buffer (0.1 SSC + 0.1% SDS). Prepare: 20 SSC (Saline-sodium citrate buffer): 3 M sodium chloride, 0.3 M sodium citrate, pH 7.0 and 10% SDS (sodium dodecyl sulfate). 14. Whatman paper. 15. Nylon membrane positively charged. 16. Typhoon FLA 9500 Scanner.

Design and Evaluation of Guide RNA Transcripts with a 30 -Terminal. . .

211

17. XCell II Mini-Cells and XCell II Blot Module. 18. Gel quantification software (Bio-Rad, ImageLab or opensource ImageJ from the National Institutes of Health (NIH), USA, available at http://rsbweb.nih.gov/ij/). 2.5 Surveyor Nuclease Assay

1. DNA Mini Kit. 2. SURVEYOR mutation detection kit for standard gel electrophoresis (Transgenomic #706025). 3. Phusion High-Fidelity DNA Polymerase. 4. Oligonucleotide primers. 5. dNTP solution mix, 25 mM each dNTP.

2.6 Chromosomal Gene Editing: CCR5 Knockout Efficiency

1. PE/Cy7 anti-human CD195 (CCR5) antibody (Biolegend #359108). 2. FACS buffer (DPBS + 2% FBS). 3. FACS cell analyzer. 4. FlowJo_V10 software package.

3

Methods

3.1 Vector Construction 3.1.1 Glycerol Stock

1. Plasmids are shipped either as transformed bacteria in stab culture format or as DNA on a filter paper or in a tube. First, a glycerol stock should be created. 2. Bacterial stabs (see Note 4). Use the bacterial stab to streak bacteria onto an agar plate, incubate overnight, and isolate single colonies. Inoculate an overnight liquid culture (LB + selective antibiotic) to grow sufficient bacteria for plasmid DNA extraction/purification and for creating 15% glycerol stocks. Store glycerol stocks at 80  C. 3. DNA on filter paper (see Note 5) or in a tube. Transform DNA into bacteria (see Note 6). Plate on an agar plate with the appropriate antibiotic and grow overnight. Streak bacteria to obtain individual colonies. Isolate single colonies and inoculate a liquid culture (LB + selective antibiotic) and incubate overnight in a shaker. Create a 15% glycerol stock and store at 80  C.

3.1.2 Design of cr and cr-HDV DNA Fragments and Cloning

1. To express crRNA molecules with a precise 30 -end, an HDV ribozyme that mediates precise intramolecular RNA cleavage has to be inserted immediately downstream of the crRNA sequence (Fig. 2b). Design the cr and cr-HDV fragments with two BsmBI enzyme sites. Add a T-6 stretch immediately downstream of the HDV ribozyme. Clone the cr and cr-HDV DNA fragments into the pSilencer2.0-U6 vector using the

212

Ben Berkhout et al.

Table 1 Target sequences (PAM underlined) Name

Target sequence (50 !30 ) and PAM

crLuc1

TTTATAATGAACGTGAATTGCTCAACA

crLuc2

TTTGATTGCCAAAAATAGGATCTCTGG

crLuc3

TTTCAGTCGATGTACACGTTCGTCACA

CCR5 crRNA1

TTTAGGATTCCCGAGTAGCAGATGACC

CCR5 crRNA2

TTTCCAAAGTCCCACTGGGCGGCAGCA

CCR5 crRNA3

TTTATCAGGATGAGGATGACCAGCATG

CCR5 crRNA4

TTTTTGGCAGGGCTCCGATGTATAATA

CCR5 crRNA5

TTTGAGATCTGGTAAAGATGATTCCTG

CCR5 crRNA6

TTTTCCATACAGTCAGTATCAATTCTG

CCR5 crRNA7

TTTGGCCTGAATAATTGCAGTAGCTCT

CCR5 crRNA8

TTTCTGAACTTCTCCCCGACAAAGGCA

Luc activation crRNA1

TTTCTCTATCACTGATAGGGAGTGGTA

Luc activation crRNA2

TTTTCTCTATCACTGATAGGGAGTGGT

Luc activation crRNA3

TTTCACTTTTCTCTATCACTGATAGGG

Luc activation crRNA4

TTTACCACTCCCTATCAGTGATAGAGA

Luc activation crRNA5

TTTAGTGAACCGTCAGATCGCCTGGAG

Luc activation crRNA6

TTTTGACCTCCATAGAAGACACCGGGA

PmII and HindIII restriction enzyme sites by the Gibson cloning method according to the manufacturer’s protocol. 2. Design and cloning of crRNAs with 23 nucleotides (see Note 7). Use the pSilencer2.0-U6 vector as the crRNA expression backbone. A crRNA can be designed via the online design tool Benchling (https://www.benchling.com), which takes any gene sequence of interest to identify suitable target sites. It also provides computationally predicted off-target sites for each intended target and ranks them according to the number of off-target sites and the effects of base-pairing mismatch identity. Design the oligonucleotides with flanks that constitute BsmBI restriction enzyme sites. For example, we designed different crRNAs targeting the Luciferase and the CCR5 co-receptor genes (Table 1) [16]. 3. To study CRISPR-based activation, a doxycycline (dox)inducible Tet-On luciferase system that is present in the Hela X1/6 cell line can be employed [20]. For example, we designed Tet-On targeting crRNAs: we made four crRNA constructs

Design and Evaluation of Guide RNA Transcripts with a 30 -Terminal. . .

213

(crRNA1–4) against the tetracycline response element (TRE) that is positioned upstream of the minimal CMV promoter and two constructs (crRNA5 and 6) against the untranslated leader of the Luciferase gene [20]. The PAM sequence (underlined) was not included in the design of the oligonucleotide. 4. Dissolve each dried and de-salted oligonucleotide in Milli-Q water to the same concentration (for instance, 3 μg/μl). Mix 1 μl of each oligonucleotide and 48 μl of 1 annealing buffer in a microtube. Incubate the microtube at 95  C for 5 min. Allow the microtube to slowly cool to room temperature over approximately 60 min. Store the annealed oligonucleotides on ice or at 4  C until ready for use. 5. Ligate the annealed oligonucleotide into the crRNA expression vectors via the BsmBI sites. Dilute annealed oligonucleotides 1:50 in Milli-Q water. Mix 100 ng of digested vector, 1 μl of diluted annealed oligonucleotides, 1 μl of T4 DNA Ligase (1 U/μl), 2 μl of 5 ligase buffer and add Milli-Q water to a total volume of 10 μl. Ligate overnight at 16  C. 6. Design and cloning of dCas12a-VP64 constructs. Design and clone a DNA fragment encoding three tandem HA epitope tags (3  HA) and one VP64 transcriptional activation domain into WN10150 and WN10151 plasmids using the BamHI and EcoRI sites by Gibson cloning according to the manufacturer’s instructions. 3.1.3 Transformation and Sequence Validation of Constructs

1. Transform the vector constructs into a competent E. coli strain according to the protocol supplied with the cells. We recommend the Stbl3 strain (see Note 6). 2. Inspect the plates for colony growth. From each plate, pick four to eight colonies to check for the correct DNA insert. Use a sterile pipette tip to inoculate a single colony into a 50 μl culture of LB medium. Incubate the culture while shaking at 30  C for 1 h. Save the remaining bacteria at 4  C to start fresh cultures when positive clones have been identified. 3. Perform colony PCR: 2.5 μl diluted colony, 0.25 μl of forward primer (10 μM), 0.25 μl of reverse primer (10 μM), 6.25 μl of Dream Taq, and 3.25 μl of Milli-Q water. The Thermofisher calculator provides the recommended Tm (melting temperature) of the designed primers and the PCR-annealing temperature based on the sequence of the primer pair, primer concentration, and the type of DNA polymerase used in the PCR. The primer pairs for the different vectors are as follows: PSilencer: Fwd 5’-AGGCGATTAAGTTGGGTA-3’. Rev. 5’-TAATACGACTCACTATAGGG-3’.

214

Ben Berkhout et al.

WN10150: Fwd 5’-AGAGCAAGGATCTGAAGCTGCA-3’. Rev.: 5’-GGGAAGACAATAGCAGGCATGC-3’. WN10151: Fwd: 5’-TGAAGAACTCCGACGGCATCTT-3’. Rev.: 5’-GGGAAGACAATAGCAGGCATGC-30 . 4. Determine the approximate length of the DNA fragment by running it on an agarose gel alongside the DNA ladder. Pour a standard 1% (wt/vol) agarose gel in TBE buffer. Add ethidium bromide to a final concentration of 0.2 μg/ml. The ethidium bromide binds to the DNA and allows DNA visualization under ultraviolet (UV) light. 5. Verify the sequence of each colony using the BigDye Terminator v1.1 Cycle Sequencing Kit: 1.5 μl of DNA template (1:10 diluted), 1 μl of Fwd primer (2 μM), 1 μl of BDT, 2 μl of BDT Buffer, 4.5 μl of Milli-Q water to a total volume of 10 μl. Run the following PCR cycling program: Step

Condition

1

96  C, 5 s

2

96  C, 30 s

3

55  C, 10 s

4

60  C, 4 min

5

4  C, hold

Repeat steps 2, 3, and 4 for another 29 cycles. 3.1.4 DNA Isolation and Glycerol Stocks

1. Start cultures of the positive clones: Add 25 μl of the stored culture to 3 ml LB medium with Ampicillin (100 mg/ml). Incubate while shaking at 30  C for at least 6 h. Make a glycerol stock of the verified clones (15% glycerol) and inoculate 1 ml of the growth culture into 150 ml LB medium with Ampicillin and incubate the culture while shaking at 30  C overnight. 2. Isolate the plasmid DNA from these cultures using a DNA midiprep kit according to the manufacturer’s instructions.

3.2 Dual-Luciferase Reporter Assay

To evaluate if the inclusion of flanking ribozymes benefits the activity of the CRISRP-Cas12a system, a dual-luciferase reporter assay can be performed. We recommend to design and test at least three crRNAs with different anti-Luciferase guides for both the As and LbCas12a system.

Design and Evaluation of Guide RNA Transcripts with a 30 -Terminal. . .

215

1. Seed 3  105 HEK293T cells per well in a 12-well plate in a total volume of 1 ml one day prior to transfection (see Note 2). 2. Co-transfect an equimolar amount of the crRNA constructs (equivalent to 100 ng cr plasmid) and a fixed molar amount of their cognate Cas12a plasmids (equivalent to 200 ng AsCas12a plasmid) with 200 ng pGL3 Luciferase reporter plasmid (pGL3) and 2 ng of Renilla control plasmid (pRL) into cells using Lipofectamine 2000 according to the manufacturer’s instructions. The Renilla luciferase plasmid is used as a control for comparing the transfection efficiency among different wells. 3. At two days post-transfection, remove growth media from cultured cells and rinse the cells with 1 DPBS. 4. Remove all rinse solution and dispense 250 μl of 1 passive lysis buffer into each well. 5. Gently rock the culture plate for 20 min at room temperature and transfer the lysate to a new plate. 6. Transfer 5 μl of supernatant to an opaque white half area 96-well plate. 7. Measure Luciferase and Renilla values in a luminometer (see Note 3). 8. Calculate the ratio of Luciferase to Renilla as the relative Luciferase activity. Perform at least three independent transfections in duplicate (see Note 8). Set the control transfection at 100%. 9. Compare the level of suppression of Luciferase gene expression triggered by the cr constructs to the control. Perform statistical analyses. LbCas12a generally mediated more robust Luciferase knockdown than AsCas12a using our experimental settings [16], consistent with previous reports [21, 22]. Most importantly, improved knockdown was achieved by the cr-HDV design compared to the cr control, confirming the positive role of the 30 -terminal HDV motif [16]. 3.3 Expression and Processing of the crRNA-Ribozyme Transcripts

Perform Northern blot analysis to examine crRNA expression from the different vector backbones. This will demonstrate the cleavage activity of the HDV ribozyme and will allow an estimation of the crRNA transcript length with or without the variable U-tail [16]. 1. One day prior to transfection, seed 9  105 HEK293T cells per well in a 6-well plate in a total volume of 1.5 ml medium (see Note 2). 2. Co-transfect an equimolar amount of crRNA constructs (equivalent to 1 μg of cr vector) and a fixed molar amount of the cognate Cas12a plasmids (equivalent to 2 μg of Cas12a vector) into HEK293T cells using Lipofectamine 2000 according to the manufacturer’s instructions.

216

Ben Berkhout et al.

3. Harvest the cells at two days post-transfection. Transfer the cells to sterile 15 ml conical tubes and pellet the cells by centrifugation at 300 g for 5 min. Decant the supernatant and resuspend the cells in 5 ml of ice-cold DPBS. 4. Keep the tubes on ice during processing. Discard the supernatant and add 800 μl of ice-cold DPBS. Pipette up/down and transfer the suspension of cells into an Eppendorf tube. 5. Pellet the cells by centrifugation at 300 g for 5 min. Discard the DPBS and place the washed cells on ice. 6. Extract total cellular RNA using a miRNA isolation kit according to the manufacturer’s instructions. Measure the RNA concentration using a nano-drop spectrophotometer. The ratio OD 260/OD 280 will indicate whether the sample is contaminated with protein or phenol. A result of 1.8 to 2.0 indicates quality RNA. 7. Prepare a 15% TBE-urea gel. 8. Pipet a volume corresponding to 5 μg Total RNA in an Eppendorf. Dissolve the RNA in 5 μl of RNA free Milli-Q water and 5 μl of loading buffer and heat at 95  C for 5 min. 9. Fill the inner and outer buffer chambers with 1 TBE. 10. Flush wells several times with 1 TBE Running Buffer to remove urea just before sample loading. Load samples quickly and avoid the gel to stand for too long during/after loading to prevent diffusion of the samples. Load 2.5 μl of γ[32P]-labeled decade RNA marker for size estimation. 11. Run the TBE-Urea Gel using the XCell II Blot Module. Run the gel at a constant 70 V for 2 h. 12. Stain the gel in 2 μg/ml ethidium bromide for 20 min to check for equal sample loading. Rinse the gel with Milli-Q water and visualize the gel under UV light. 13. Transfer RNA from the gel to a positively charged nylon membrane. Activate the membrane in a tray with Milli-Q water. Assemble the sandwich cassette following the scheme in Fig. 3. Pre-soak the blotting pads and filter papers in transfer buffer. Remove all trapped air bubbles by gently rolling over the surface using a pipette as a roller. Close the XCell II minicell cassette and place it in the XCell II blot module. Fill the inner chamber with 0.5 TBE and the outer chamber with Milli-Q water. Close the blot module and transfer for 1 h at 30 V. 14. Label the 50 end of locked nucleic acid (LNA) oligonucleotides with the KinaseMax kit in the presence of γ[32P]-ATP. Prepare the following reaction mixture: 1 μl of probe LNA (10 μM), 2 μl of PNK buffer, 1 μl of T4 PNK, 1 μl of [γ-32P]ATP (7000 Ci/mmol, 150 mCi/ml), and 15 μl of Milli-Q water. Incubate for 1 h at 37  C and remove unincorporated nucleotides over a Sephadex G-25 spin column.

Design and Evaluation of Guide RNA Transcripts with a 30 -Terminal. . .

217

Fig. 3 Northern transference using the XCell Blot Module

15. Pre-warm 10 ml of ULTRAhyb hybridization buffer for 30 min at 42  C and then pre-hybridize the blot for 30 min at 42  C in 10 ml of UltraHyb buffer. 16. Add RNA probe to the pre-hybridized blot and hybridize at 42  C overnight. 17. Discard the hybridization buffer and wash the nylon membrane with 15 ml of pre-warmed low stringency wash buffer (2 SSC + 0.1% SDS) until there is no radioactivity detectable anymore in the washing buffer with a scintillation counter. Next wash the membrane with 20 ml of pre-warmed high stringency wash buffer (0.1 SSC + 0.1% SDS) for 5 min. 18. Detect the probes in the nylon membrane by Typhoon FLA 9500 and quantitated using ImageJ software. 3.4 Chromosomal Gene Editing

3.4.1 Luciferase Gene Editing: Indel Detection with the Surveyor Nuclease Assay

Validate the effect of the addition of a 30 -end HDV ribozyme moiety in the context of chromosomal gene editing. To do so, compare the cr and cr-HDV constructs for the efficiency of Luciferase and CCR5 gene editing. 1. Seed 4.5  105 HeLa X1/6 cells per well in a 6-well plate one day prior to transfection. 2. Co-transfect equimolar amount of crRNA constructs (equivalent to 1 μg of cr plasmid) and 2 μg LbCas12a plasmid using Lipofectamine 2000. 3. Extract the genomic DNA two days after transfection by using a DNA Mini Kit.

218

Ben Berkhout et al.

4. PCR amplify the genome region flanking the designated cleavage site using two primers. To minimize PCR-errors, it is important to use a high-fidelity polymerase. We used Phusion High-Fidelity DNA Polymerase, but other high-fidelity polymerases can also be used. The primers are designed based on the genome region of interest. Use a Tm Calculator to estimate the appropriate annealing temperature for the high-fidelity polymerase. In our experimental setting, we used the following primers: Fwd: 50 -AAGACGCCAAAAACATAAAGAAAG-30 Rev.: 50 -AAGAGGTGCGCCCCCAGAAG-30 . 5. Run the PCR products on a 1% (wt/vol) agarose gel in TBE buffer gel to verify successful amplification. Use the 100 bp gene ruler DNA ladder for size identification. Purify the PCR product by using a DNA Mini Kit according to the manufacturer’s directions and normalize the eluted DNA product to 20 ng/μl. 6. Subject the purified PCR products to Surveyor nuclease using the Surveyor mutation detection kit according to the manufacturer’s instructions. Surveyor cleavage results can identify naturally occurring single-nucleotide sequence polymorphisms. Therefore, it is important to run negative control samples of untransfected/unmodified cells. 7. DNA heteroduplex formation. Include a reference PCR product as negative control. Set up the annealing reaction as follows: 2 μl of 10 PCR buffer, 18 μl of normalized PCR product (20 ng/ μl) in a total volume of 20 μl. Anneal the reaction by using the following conditions: Cycle number

Condition

1

95  C, 10 min

2

95–85  C, 2  C/s

3

85  C, 1 min

4

85–75  C, 0.3  C/s

5

75  C, 1 min

6

75–65  C, 0.3  C/s

7

65  C, 1 min

8

65–55  C, 0.3  C/s

9

55  C, 1 min

10

55–45  C, 0.3  C/s

11

45  C, 1 min

12

45–35  C, 0.3  C/s

13

35  C, 1 min

14

35–25  C, 0.3  C/s (continued)

Design and Evaluation of Guide RNA Transcripts with a 30 -Terminal. . .

219

Cycle number

Condition

15

25  C, 1 min

16

25–4  C, 0.3  C/s

17

4  C, hold

8. Surveyor nuclease S digestion. Prepare the following reaction mixture: 20 μl of annealed heteroduplex, 2.5 μl of MgCl2 stock solution supplied with the kit (0.15 M), 0.5 μl of Milli-Q water, 1 μl of Surveyor nuclease S and 1 μl of Surveyor enhancer S in a total volume of 25 μl. Vortex the mixture well and quick-spin the liquid to the bottom of the tube. Incubate for 30 min at 42  C. Add 2 μl of the Stop Solution supplied with the kit to block the reaction. These products can be stored at 20  C for at least two days for subsequent analysis. 9. Visualize the Surveyor reaction on a 1% (wt/vol) agarose gel by ethidium bromide staining. Include the DNA ladder and the negative (untransfected) control samples on the same gel. 10. Estimation of the indels percentage (%). Measure the integrated intensity of the full-length PCR amplicon and the cleaved DNA products by ImageJ or other gel quantification software. The indel percentage (%) can be calculated as described in the legend to Fig. 4 [23]. 3.4.2 CCR5 Gene Editing: Determination of the CCR5 Knockout Efficiency by FACS

1. Seed 1.5  105 TZM-bl cells per well in a 12-well plate in a total volume of 1 ml one day prior to transfection (see Note 2). 2. Co-transfect an equimolar amount of crRNA constructs (equivalent to 500 ng cr vector), 1 μg LbCAs12a plasmid, and 500 ng JS1 plasmid (GFP expression vector) using Lipofectamine 2000. The “empty” cr construct can be included as negative control. Replace the medium by fresh medium 6 h after transfection. 3. Harvest the cells two days after transfection. First, aspirate the medium and wash the cells with 1 ml DPBS. Aspirate the DPBS and add 100 μl of pre-warmed trypsin/EDTA solution. Transfer the plate to the 37  C incubator for 5 min. 4. Tap the side of the plate and examine the cells under the microscope for detachment. If necessary, return the cells to the incubator for an additional 5–10 min. When cell detachment is complete, add 900 μl of fresh culture medium to block further trypsin action and resuspend the cells by careful pipetting up/down for several times. 5. Transfer the cell solution to an Eppendorf and spin at 300  g for 5 min. Decant the supernatant and wash with DPBS. Spin at 300  g for 5 min and decant DPBS.

220

Ben Berkhout et al.

Fig. 4 Schematic of Surveyor assay for detection of insertions and/or deletions (indels). First, genomic PCR is used to amplify the Cas12a target region from a heterogeneous population of modified and unmodified cells. Then the PCR products are reannealed to generate heteroduplexes. These heteroduplexes are cleaved by Surveyor nuclease S, whereas homoduplexes are left intact. Cas12a-mediated cleavage efficiency (% indels) is calculated based on the fraction of cleaved DNA

6. Stain the cells with PE/Cy7 anti-human CD195 (CCR5) antibody in 25 μl of FACS buffer for 1 h at 4  C (see Note 9). Wash the stained cells twice with 100 μl FACS buffer and pellet the cells by centrifugation at 300  g for 5 min. Add 200 μl of FACS buffer and slowly vortex the cells. 7. Determine the level of CCR5 gene disruption by FACS analysis of cell surface expression of CCR5 protein with the FACS cell analyzer and the FlowJo_V10 software package. Measure the CCR5 disruption efficiency for the GFP-positive fraction. The empty cr construct served as negative control. The fold increase in editing efficiency of the novel cr-HDV construct versus the standard cr vector can subsequently be calculated.

Design and Evaluation of Guide RNA Transcripts with a 30 -Terminal. . .

3.5 Determination of the CRISPRMediated Gene Activation Efficiency

221

1. Seed 1.5  105 HeLa X1/6 cells in a total volume of 1 ml per well in a 12-well plate a single day prior to transfection (see Note 2). To demonstrate reproducibility, one should perform at least three independent transfections in duplicate (see Note 8). 2. Luciferase induction can be achieved by dox addition or by the CRISPR-based gene activation system. 3. Luciferase induction by dox serves as a positive control. Add 1 μg/ml dox to the culture medium and co-transfect 40 ng of pCMV-rtTA-V10 plasmid expressing rtTA and 2 ng Renilla luciferase plasmid using Lipofectamine 2000. 4. Luciferase induction by the CRISPR-based system. Co-transfect equimolar amounts of crRNA construct (equivalent of 100 ng cr vector), a fixed molar amount of dCpf1-VP64 construct (equivalent to 200 ng dAsCpf1 plasmid) and 2 ng Renilla Luciferase plasmid using Lipofectamine 2000. Transfection of the empty cr vector and the dCpf1-VP64 vector serves as negative controls. 5. Harvest the cells and perform the Dual-luciferase reporter assay two days after transfection (see Subheading 3.2). Calculate the relative Luciferase activity (Luciferase/Renilla) and perform a statistical analysis [24].

4

Notes 1. Cells are cultured in T75 flasks. Perform a daily check on the cells by microscope to ensure rapid proliferation and proper detachment to the bottom of the flask. The dilution factor for splitting cultured cells differs among cell lines. We recommend sub-culturing cells twice a week to prevent overgrowth of the culture. Otherwise, cells will not be in logarithmic phase of growth. When the cells are approximately 80% confluent (80% of surface of flask covered by the cell monolayer), the culture should be split. To split the culture, first warm the fresh culture medium to 37  C in a water bath. The cell lines we use require prior trypsinization. Aspirate the medium from the well/flask and wash the attached cells with 10 ml DPBS (pipet to the side of the flask so as not to dislodge the cells). Aspirate DPBS and add 1 ml pre-warmed trypsin/EDTA solution. Transfer the flask to the 37  C incubator for 5 min, tap the side of the flask, and examine the cells under the microscope for detachment (“lifting”). If necessary, return the cells to the incubator for an additional period until detachment is complete. Add 9 ml of pre-warm complete cell culture media to quench the trypsin reaction. Transfer the cells to sterile 15 ml conical tubes

222

Ben Berkhout et al.

and pellet the cells by centrifugation at 300  g for 5 min. Decant the supernatant and carefully resuspend the cells in complete cell culture medium. The passage number—the number of splitting events the cells have experienced—should be recorded and should not get too high to prevent genetic drift of the cells and consequently experimental variation. 2. Cells are seeded in plates a single day prior to transfection in DMEM supplemented with 10% FBS and NEAA without antibiotics. The cell density will affect the transfection performance. For example, Lipofectamine 2000 provides an optimal transfection performance at a cell confluence of 70–90%. Determine the cell density of the cell line suspension using the hemacytometer and trypan blue in buffered isotonic salt solution (for instance, DPBS). Load the hemacytometer and examine immediately under a microscope at low magnification. Calculate cell viability by counting the number of stained cells and the number of total cells. Cell viability should be around 90–95% for log-phase cultures. Calculate the number of viable cells per ml of culture: number of viable cells  104  dilution factor. 3. We use the GloMax 96 Microplate Luminometer. If using this machine, turn the GloMax machine on and open the GloMax interface. Run Promega protocol/ DRL/ two injectors. Flush both injectors three times with demineralized water and subsequently with air. Then insert tube 1 in LAR II and tube 2 in Stop & Glo solution. Prime both injectors. Choose the plate setup (delay 0 s) and select injector 1 and 2 and set the following parameters: Inject volume: 25 μl. Delay: 2 s. Interval: 5 s. After measuring the plate, flush the unused reagent. Then, flush both injectors three times with demineralized water, ethanol, and finally air. 4. A stab is a type of Luria Broth (LB) agar media created by piercing the LB agar with the bacteria instead of spreading it on the surface. The bacteria grow in the puncture point. 5. To recover DNA on filter paper, use a clean razor blade to cut out the filter paper with the DNA. Immerse the piece of paper in 30 μl Milli-Q water and pipet up/down to mix. Wait 10 min and use 2 μl of the mixture to transform competent bacteria. 6. The DNA (2 μl of DNA suspension at 10–50 ng/μl) can be transformed into bacteria. We have selected One Shot Stbl3 chemically competent cells. Thaw Stbl3 competent cells on ice and transform cells immediately upon thawing. Add the DNA

Design and Evaluation of Guide RNA Transcripts with a 30 -Terminal. . .

223

to the bacteria and mix by gently tapping of the tube. Do not mix cells by pipetting up/down or by mixing on the vortex! Incubate the vials on ice for 30 min, then heat-shock the cells for 45 s at 42  C without shaking. Place the cells on ice for 2 min and subsequently add 250 μl of pre-warmed SOC medium to each vial and incubate for 1 h at 30  C in a shaking incubator (225 rpm). Spread 25 and 100 μl of each transformation mixture on a pre-warmed antibiotic-selective plate and incubate overnight at 30  C. We recommend that you plate two different volumes to ensure that at least one plate will develop isolated colonies. 7. Cas12a requires only a single crRNA without the need for a second tracrRNA. Cas12a recognizes a T-rich PAM motif (TTTN) on the 50 side of the guide and produces a staggered cut (Fig. 2b). In AsCas12a and LbCas12a, DNA cleavage occurs on the targeted strand at a 19 bp distance from the PAM and at a 23 bp distance on the other strand. The crRNA design with 23 nucleotides (sequences in the 30 -end of the crRNA that recognize and bind the target DNA) seems the best choice for optimal DNA cleavage with the AsCas12a and LbCas12a systems [16]. 8. The relative luciferase activity is calculated as the ratio between Luciferase and Renilla activities and corrected for between session variation [24]. 9. Determine the optimal concentration of the antibody. Titration allows one to determine the antibody concentration that yields signals with an optimal signal-to-background ratio. Too much antibody will increase the level of non-specific binding events (raising the background signal of negative cells), while too little antibody will result in sub-optimal cell staining and sub-optimal separation of the different cell populations.

Acknowledgments This research was supported by the National Institutes of Health (NIH) under award number 1R01AI145045-01. References 1. Barrangou R, Fremaux C, Deveau H, Richards M, Boyaval P, Moineau S et al (2007) CRISPR provides acquired resistance against viruses in prokaryotes. Science 315:1709–1712 2. Marraffini LA (2015) CRISPR-Cas immunity in prokaryotes. Nature 526:55–61

3. Mali P, Yang L, Esvelt KM, Aach J, Guell M, DiCarlo JE et al (2013) RNA-guided human genome engineering via Cas9. Science 339:823–826 4. Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N et al (2013) Multiplex genome engineering using CRISPR/Cas systems. Science 339(6121):819–823

224

Ben Berkhout et al.

5. Jiang W, Zhou H, Bi H, Fromm M, Yang B, Weeks DP (2013) Demonstration of CRISPR/ Cas9/sgRNA-mediated targeted gene modification in Arabidopsis, tobacco, sorghum and rice. Nucleic Acids Res 41:e188 6. Yin H, Xue W, Chen S, Bogorad RL, Benedetti E, Grompe M et al (2014) Genome editing with Cas9 in adult mice corrects a disease mutation and phenotype. Nat Biotechnol 32:551 7. Zetsche B, Gootenberg JS, Abudayyeh OO, Slaymaker IM, Makarova KS, Essletzbichler P et al (2015) Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system. Cell 163:759–771 8. Fagerlund RD, Staals RH, Fineran PC (2015) The Cpf1 CRISPR-Cas protein expands genome-editing tools. Genome Biol 16:251 9. Shmakov S, Smargon A, Scott D, Cox D, Pyzocha N, Yan W et al (2017) Diversity and evolution of class 2 CRISPR-Cas systems. Nat Rev Microbiol 15:169–182 10. Port F, Bullock SL (2016) Augmenting CRISPR applications in Drosophila with tRNA-flanked sgRNAs. Nat Methods 13:852 11. Kleinstiver BP, Tsai SQ, Prew MS, Nguyen NT, Welch MM, Lopez JM et al (2016) Genomewide specificities of CRISPR-Cas Cpf1 nucleases in human cells. Nat Biotechnol 34:869 12. Kim D, Kim J, Hur JK, Been KW, S-h Y, Kim J-S (2016) Genome-wide analysis reveals specificities of Cpf1 endonucleases in human cells. Nat Biotechnol 34:863 13. Fonfara I, Richter H, Bratovicˇ M, Le Rhun A, Charpentier E (2016) The CRISPR-associated DNA-cleaving enzyme Cpf1 also processes precursor CRISPR RNA. Nature 532:517 14. Zetsche B, Heidenreich M, Mohanraju P, Fedorova I, Kneppers J, DeGennaro EM et al (2017) Multiplex gene editing by CRISPRCpf1 using a single crRNA array. Nat Biotechnol 35:31 15. Gao Z, Herrera-Carrillo E, Berkhout B (2018) Delineation of the exact transcription

termination signal for type 3 polymerase III. Mol Ther Nucl Acids 10:36–44 16. Gao Z, Herrera-Carrillo E, Berkhout B (2018) Improvement of the CRISPR-Cpf1 system with ribozyme-processed crRNA. RNA Biol 15:1458–1467 17. Kleibeuker W, Zhou X, Centlivre M, Legrand N, Page M, Almond N et al (2009) A sensitive cell-based assay to measure the doxycycline concentration in biological samples. Hum Gene Ther 20:524–530 18. Baron U, Schnappinger D, Helbl V, Gossen M, Hillen W, Bujard H (1999) Generation of conditional mutants in higher eukaryotes by switching between the expression of two genes. Proc Natl Acad Sci U S A 96:1013–1018 19. Gossen M, Freundlieb S, Bender G, Mu¨ller G, Hillen W, Bujard H (1995) Transcriptional activation by tetracyclines in mammalian cells. Science 268:1766–1769 20. Kleibeuker W, Zhou X, Centlivre M, Legrand N, Page M, Almond N et al (2009) A sensitive cell-based assay to measure the doxycycline concentration in biological samples. Hum Gene Ther 20:524–530 21. Kim D, Kim J, Hur JK, Been KW, Yoon SH, Kim JS (2016) Genome-wide analysis reveals specificities of Cpf1 endonucleases in human cells. Nat Biotechnol 34:863–868 22. Moreno-Mateos MA, Fernandez JP, Rouet R, Vejnar CE, Lane MA, Mis E et al (2017) CRISPR-Cpf1 mediates efficient homologydirected repair and temperature-controlled genome editing. Nat Commun 8:2024 23. Cong L, Ran FA, Cox D, Lin SL, Barretto R, Habib N et al (2013) Multiplex genome engineering using CRISPR/Cas systems. Science 339:819–823 24. Ruijter JM, Thygesen HH, Schoneveld OJ, Das AT, Berkhout B, Lamers WH (2006) Factor correction as a tool to eliminate betweensession variation in replicate experiments: application to molecular biology and retrovirology. Retrovirology 3:1–8

Chapter 13 Design and Evaluation of AgoshRNAs with 30 -Terminal HDV Ribozymes to Enhance the Silencing Activity Ben Berkhout and Elena Herrera-Carrillo Abstract Since the first application of RNA interference (RNAi) in mammalian cells, the expression of short hairpin RNA (shRNA) molecules for targeted gene silencing has become a benchmark technology. Plasmid and viral vector systems can be used to express shRNA precursor transcripts that are processed by the cellular RNAi pathway to trigger sequence-specific gene knockdown. Intensive RNAi investigations documented that only a small percentage of computationally predicted target sequences can be used for efficient gene silencing, in part because not all shRNA designs are active. Many factors influence the shRNA activity and guidelines for optimal shRNA design have been proposed. We recently described an alternatively processed shRNA molecule termed AgoshRNA with a ~18 base pairs (bp) stem and a 3–5 nucleotides (nt) loop. This molecule is alternatively processed by the Argonaute (Ago) protein into a single guide RNA strand that efficiently induces the RNAi mechanism. The design rules proposed for regular shRNAs do not apply to AgoshRNA molecules and therefore new rules had to be defined. We optimized the AgoshRNA design and managed to create a set of active AgoshRNAs targeted against the human immunodeficiency virus (HIV). In an attempt to enhance the silencing activity of the AgoshRNA molecules, we included the hepatitis delta virus (HDV) ribozyme at the 30 terminus, which generates a uniform 30 end instead of a 30 U-tail of variable length. We evaluated the impact of this 30 -end modification on AgoshRNA processing and its gene silencing activity and we demonstrate that this novel AgoshRNA-HDV design exhibits enhanced antiviral activity. Key words HIV, RNAi, Dicer, Ago2, HDV ribozyme, Dicer-independent shRNA, miR-451

1

Introduction RNA interference (RNAi) is an evolutionarily conserved posttranscriptional gene silencing mechanism in eukaryotes that uses microRNAs (miRNAs) to control gene expression in a sequencespecific manner [1]. The RNAi pathway can also be induced by artificial small interfering RNAs (siRNAs) [2] and by plasmids or (viral) vectors that express short hairpin RNAs (shRNAs), which are processed intracellularly by the RNAi machinery into the active siRNA species [3]. The shRNAs typically have a stem of 20–29 bp, a small loop of 5–9 nt, and a 30 -terminal UU overhang. The shRNAs expressed in the nucleus are exported from the

Robert J. Scarborough and Anne Gatignol (eds.), Ribozymes: Methods and Protocols, Methods in Molecular Biology, vol. 2167, https://doi.org/10.1007/978-1-0716-0716-9_13, © Springer Science+Business Media, LLC, part of Springer Nature 2021

225

226

Ben Berkhout and Elena Herrera-Carrillo

Fig. 1 Schematic of two RNAi pathways available for shRNA processing. The shRNA transcripts can be expressed from an episomal or stably integrated expression cassette. The shRNAs are then exported from the nucleus to the cytoplasm for processing: regular shRNAs are processed by Dicer (left) and the shorter AgoshRNAs by Ago2, followed by PARN trimming (right). Both molecules end up in the RISC complex to trigger cleavage of a complementary mRNA

nucleus by Exportin-5 for subsequent processing [4] (Fig. 1). The shRNAs are processed in the cytoplasm by Dicer into a siRNA duplex of ~20 bp, of which one strand is preferentially loaded into the Argonaute 2 protein (Ago2) to form the RNA-induced silencing complex (RISC) (Fig. 1, left side). The thermodynamic properties of the RNA duplex determine which strand is selected as the guide strand, while the passenger strand is cleaved by Ago2 and degraded [5–7]. The guide strand is designed to have perfect complementarity to the target gene and should trigger cleavage of the messenger RNA (mRNA) by Ago2 [8, 9].

Optimization of Therapeutic AgoshRNAs by HDV Ribozyme Inclusion

227

We and others recently described an alternatively processed shRNA molecule termed AgoshRNA with a ~18 bp stem and a 3–5 nt loop [10–17]. This molecule bypasses Dicer because it is simply too short to be recognized. Instead, it is recognized and processed by Ago2, which cleaves in between 10 and 11 bp at the 30 side of the base paired stem to generate a single ~30-nt guide RNA strand that efficiently induces the RNAi mechanism (Fig. 1, right side). This new AgoshRNA design has the major advantage over regular shRNAs in that no passenger strand is produced that may cause unwanted off-target effects. We previously listed several additional advantages [12], including the ability of AgoshRNA molecules to function in Dicer-minus cells such as monocytes [18]. RNAi is also a powerful screening method to determine the function of a cellular protein or to validate putative drug targets. A major problem is that these methods will only work in organisms that possess the basic RNAi machinery. For instance, in protozoan parasites like the malaria parasite Plasmodium, the RNAi machinery is not present and these cells thus lack both Dicer and Ago2 [19, 20]. The discovery of AgoshRNA design that requires only Ago2 for processing and silencing may facilitate the introduction of an exogenous minimal RNAi machinery (shRNA + Ago2) into such cells or organisms [ref PMC7145648]. This will facilitate the analysis of gene functions using RNAi methods and may be used for the screening of new anti-malarial drugs and vaccine candidates. RNA Polymerase III (Pol III) promoters function in cells to express small RNA transcripts and several of them are commonly used to drive the expression of transgenes encoding shRNA and AgoshRNA molecules. Pol III transcripts are usually terminated at a heterogeneous position within the T6 transcription termination signal. This creates transcripts with a variable U-tail of 1–6 nt [21]. Using chemically synthetized AgoshRNA molecules with 30 overhangs larger than 1–3 nt, we could demonstrate that this extension has a negative influence on the silencing activity, likely due to impaired Ago2 binding [22]. In an attempt to further optimize the AgoshRNA design, a 30 terminal ribozyme of the hepatitis delta virus (HDV) was inserted. This ribozyme will generate a discrete 30 -overhang in the context of the AgoshRNA duplex. We demonstrate that this modification translates into enhanced silencing activity of these molecules. Optimized AgoshRNAs against the RNA genome of the HIV pathogen were successfully created [18, 23].

228

2

Ben Berkhout and Elena Herrera-Carrillo

Materials

2.1 Plasmid and Vector Construction

1. pSUPER.basic (Oligoengine #VEC-pBS-0002). This vector uses the human Pol III H1 promoter to express the AgoshRNA transcript. 2. Control plasmids Luciferase Reporter (pGL3) and Renilla Luciferase Control (pRL) (Promega #E1741 and #E2231, respectively). 3. pBluescript II SK (pBS) (Chem-agilent #212205). 4. pRRLSIN.cPPT.PGK-GFP.WPRE (Addgene #12252). This plasmid has a third generation lentiviral backbone in which the insert of interest can be cloned[24–26]. 5. ChemiComp GT116 (Invivogen #GT116-21). These cells were specifically designed for propagation of plasmids that contain inserts encoding highly structured transcripts like shRNAs and AgoshRNAs, which can also form unwanted DNA structures. 6. One Shot Stbl3 chemically competent E. coli (Life Technologies #C7373-03). 7. SOC medium. 8. Luria-Bertani (LB) broth and agar. 9. Ampicillin, 100 mg/ml, sterilized by passing through a filter. 10. DNA oligonucleotides encoding the AgoshRNA and HDV ribozymesequences. 11. Annealing buffer 10: 100 mM Tris–HCl (pH 8), 500 mM NaCl, and 10 mM EDTA. 12. BamHI, HindIII, EcoRI, PstI, and XhoI restriction enzymes. 13. T4 DNA Ligase (1 U/μl). 14. FastAP thermosensitive alkaline phosphatase (1 U/μl). 15. DreamTaq Green PCRMaster Mix (2). 16. Agarose gel. Standard 1% (wt/vol) agarose gels are made in TBE buffer. Prepare a stock solution of TBE buffer 10 (1 M Tris, 1 M Boric acid, and 0.02 M EDTA). Add ethidium bromide (stock 10 mg/ml) to a final concentration of approximately 0.2–0.5 μg/ml. The ethidium bromide binds to DNA and allows its visualization under ultraviolet (UV) light. Determine the approximate length of the DNA fragments by running the samples on the agarose gel alongside a DNA ladder. 17. BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems #4337450). 18. Digital gel imaging system Proxima (Isogen). 19. UV spectrophotometer.

Optimization of Therapeutic AgoshRNAs by HDV Ribozyme Inclusion

2.2 Mammalian Cell Culture

229

1. Human embryonic kidney (HEK) 293T cells (ATCC #CRL11268) grow as monolayer in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% heat-inactivated Fetal Bovine Serum (FBS), MEM Non-essential Amino Acid Solution (NEAA) 100, penicillin (100 U/ml), streptomycin (100 μg/ml) in a humidified chamber at 37  C, and 5% CO2 (see Note 1). 2. SupT1 T cells (ATCC #CRL-1942) grow in Advanced RPMI1640 supplemented with L-glutamine, 1% FBS and penicillin (30 U/ml) and streptomycin (30 μg/ml) in a humidified chamber at 37  C and 5% CO2 (see Note 2). 3. Dulbecco’s PBS (DPBS). 4. Trypsin-EDTA (0.05%). 5. CELLSTAR cell culture flask (T25 and T75 flask) with filter cap. 6. INCYTO C-Chip disposable hemacytometer. 7. Trypan blue.

2.3 Dual-Luciferase Reporter Assay

1. Dual-luciferase reporter assay system (Promega # E1960). 2. 24-Well plate, cell culture treated, lid with condensation ring, sterile. 3. 96-Well plate, half area, white. 4. Opti-MEM I Reduced Serum Medium. 5. Lipofectamine 2000 Transfection Reagent. 6. 96 Microplate Luminometer.

2.4

Northern Blot

1. miRNA Isolation Kit. 2. Acid-Phenol: Chloroform. 3. ACS grade 100% ethanol. 4. RNase-free 1.5 ml polypropylene microfuge tubes. 5. 15% TBE-Urea gels 1.0 mm, 15-well. 6. Decade Marker. 7. LNA oligonucleotide. 8. Ambion KinaseMax 50 End-Labeling Kit. 9. TBE buffer 10 (1 M Tris, 1 M Boric acid, and 0.02 M EDTA). 10. UltraPure Ethidium Bromide, 10 mg/ml. 11. Sephadex G-25 spin column. 12. ULTRAhyb Ultrasensitive Hybridization Buffer. 13. Low stringency (2 SSC + 0.1% SDS) and high stringency wash buffer (0.1 SSC + 0.1% SDS). Prepare: 20 SSC

230

Ben Berkhout and Elena Herrera-Carrillo

(saline-sodium citrate buffer): 3 M sodium chloride, 0.3 M sodium citrate, pH 7.0 and 10% SDS (Sodium dodecyl sulfate). 14. Whatman paper. 15. Nylon membrane positively charged. 16. Typhoon FLA 9500 Scanner (GE Healthcare Life Science). 17. XCell II Mini-Cells and XCell II Blot Module. 18. Gel quantification software (Bio-Rad, ImageLab, or opensource ImageJ provided by the National Institutes of Health (NIH), USA, available at http://rsbweb.nih.gov/ij/). 2.5 Lentiviral Vector Production and Transduction

1. Lentiviral backbone: (Addgene #12252).

pRRLSIN.cPPT.PGK-GFP.WPRE

2. Lentiviral vector packaging constructs: – pSYNGP [27] for expression of a human codon-optimized gag-pol sequence without RRE. It can be substituted by pMDLg/pRRE (Addgene #12251), which is not human codon-optimized. pMDLg/pRRE was described to produce higher viral titers than pSYNGP [28]. – pRSV-rev (Addgene # 12253). This plasmid expresses Rev. protein which interacts with the RRE signal on the vector RNA genome. – pCMV-VSV-G (Addgene # 8454). This plasmid expresses the spike glycoprotein of the vesicular stomatitis virus (VSV-G). The VSV-G protein is compatible with high titer production of lentiviral particles and confers a broad host cell tropism that can facilitate gene transfer into the majority of human cell types. However, hematopoietic stem and progenitor cells (HSPCs) are poorly permissive for VSV-G pseudotyped lentiviral particles because the majority of these cells reside in the G0 phase of the cell cycle [28]. If resting HSPCs are to be transduced, we recommend using modified measles virus envelope glycoproteins instead of VSV-G [29]. 3. Opti-MEM I Reduced Serum Medium. 4. Lipofectamine 2000 Transfection Reagent. 5. 0.45 μm cellulose acetate filter. 6. 6- and 96-well plates, cell culture treated, lid with condensation ring, sterile. 7. Amicon Ultra-15 centrifugal filter. 8. Cryovials. 9. FACS buffer: D-PBS supplemented with 2% FBS. 10. Flow cytometer.

Optimization of Therapeutic AgoshRNAs by HDV Ribozyme Inclusion

231

2.6

HIV Infection

1. The pLAI infectious molecular HIV clone (NIH AIDS Reagent Program # 2532) expresses the full-length HIV genome that generates replication-competent and infectious HIV-1. This is a subtype B HIV variant and represents a primary virus isolate that uses CXCR4 as co-receptor for cellular entry.

2.7

CA-p24 ELISA

1. Coating antibody: sheep anti HIV-1 CA-p24 gag (Aalto Bio Reagents #D7230). Reconstitute a vial of anti-HIV CA-p24 gag antibody in 2 ml of Milli-Q water. Use a syringe with a needle to inject the Milli-Q water through the rubber lid into the glass vial. Vortex the solution thoroughly. Aliquot the antibody in Eppendorf tubes and store them at 20  C (see Note 3). 2. Coating buffer: 0.05 M NaHCO3 pH 8.5. Dilute 4.2 g of NaHCO3 in 500 ml of Milli-Q water. 3. 10 TBS pH 7.4: Dissolve 80 g NaCl, 2 g KCl, and 30 g Tris in 1 l of Milli-Q water. 4. Heat inactivated sheep serum (see Note 4). 5. HIV-1 CA-p24 recombinant protein (Aalto Bio Reagents #AG6054). Reconstitute the CA-p24 protein in 1 TBS (pH adjusted to 7.4), 20% sheep serum, 1% empigen to a 10 master stock solution of 10 μg/ml (see Notes 5 and 6). You can store part of this 10 master mix at 80  C and use part to prepare a 1 stock solution. To do so, dilute this master stock 10 with 1 TBS + 1% empigen to 1 μg/ml. Make aliquots of 25 μl in Eppendorf tubes and store the aliquots at 80  C. 6. 1 TBS, 0.05% empigen: 71 μl 35% empigen in 50 ml 1 TBS. 7. 10 DPBS + 1% Tween 20. Dissolve 20 DPBS tablets in a total volume of 1 l of Milli-Q water. Add 10 ml Tween 20 (see Note 6). 8. Conjugate: mouse monoclonal anti-HIV-1 CA-p24 (Aalto Bioreagents #BC1071-AP). Dilute the protein 1:5 in triethanolamine. 9. Lumiphos Plus. 10. 96-well plates, half area, white. 11. 96 microplate luminometer.

2.8 Sequencing Proviral Target Regions

1. DPBS. 2. TLE (10 mM Tris–EDTA—0.1 mM EDTA). 3. Proteinase K (20 mg/ml). 4. Tween 20.

232

Ben Berkhout and Elena Herrera-Carrillo

5. BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems #4337450). 6. Primer pairs (50 -3, the position within pLAI is indicated):

l

l

l

l

3

Gag: Fwd 50 -CAGACCATCAATGAGGAAGCTGCAGAATG GGAT-30 ; position 1445. Rev. 50 -CCCTGGCCTTCCCTTGTAGGAAAACCAGAT CTTCCC-30 ; position 2141. Protease: Fwd 50 -GTCAGAGCAGACCAGAGCCAACAG-30 ; position 2183. Rev. 50 -GATATTTCTCATGTTCATCTTGGGCCTTAT CTATTCC-30 ; position 2659. Integrase: Fwd 50 -GGCAACTAGATTGTACACATTTAGAAGG-30 ; position 4499. Rev. 50 -CTCTTTTTCCTCCATTCTATGGAGA-30 ; position 5377. Tat-Rev: Fwd 50 -ATATCAAGCAGGACATAACAAGG-30 ; position 5525. Rev. 50 -TGCTTTAGCATCTGATGCACAAAATA-30 ; position 6458.

Methods

3.1 Vector Construction 3.1.1 Glycerol Stock

Plasmids are shipped either as transformed bacteria in stab culture format or as DNA in a filter paper or in a tube. First, a glycerol stock should be created. – Bacterial stabs (see Note 7). Use the bacterial stab to streak bacteria onto a plate and isolate single colonies. Inoculate an overnight liquid culture to grow a sufficient amount of bacteria for plasmid DNA purification and for creating glycerol stocks. Store glycerol stocks at 80  C. – DNA in filter paper (see Note 8) or in a tube. Transform DNA into bacteria (see Note 9). Plate on an appropriate antibiotic agar plate and grow overnight. Streak bacteria for single colonies. Isolate single colonies and inoculate an overnight liquid culture (LB + selective antibiotic). Create a 15% glycerol stock. Store the glycerol stock at 80  C.

Optimization of Therapeutic AgoshRNAs by HDV Ribozyme Inclusion

233

Fig. 2 Design of AgoshRNA-T6 and AgoshRNA-HDV. Secondary structure model of the regular AgoshRNA (now named AgoshRNA-T6) and the novel AgoshRNA-HDV design with the guide strand boxed in grey. The Ago2 cleavage site on the regular AgoshRNA-T6 is indicated by a black triangle (bp 10–11). The 50 -end nucleotide of AgoshRNA constructs and the basepairing partner were replaced by A C (black circles). The human polymerase III H1 promoter drives AgoshRNA transcription up to the T-6 termination signal, creating a U-tail of variable length. The novel AgoshRNA-HDV design contains the 30 -terminal ribozyme structure from the hepatitis delta virus (HDV, marked in blue). The star marks the ribozyme-mediated cleavage site 3.1.2 Design of AgoshRNA Constructs

Design AgoshRNA molecules with an 18 base paired stem and a 3–5 nt single-stranded loop [10–17]. Figure 2 depicts the secondary RNA structure of a designed AgoshRNA molecule as predicted by Mfold (http://unafold.rna.albany.edu). The anti-HIV guide is located on the 50 side (grey box). The predicted Ago2 cleavage site on the 30 side of the duplex is indicated. The bottom bp of AgoshRNA molecules is replaced by an unpaired A C (circled) for

234

Ben Berkhout and Elena Herrera-Carrillo

optimal AgoshRNA activity [10]. The HDV ribozyme that can mediate precise intramolecular RNA cleavage without requiring a specific sequence upstream of the cleavage site is inserted immediately downstream of the CUU overhang. We recommend adding a T-6 stretch immediately downstream of the HDV ribozyme as a back-up termination signal. Insertion of the HDV ribozyme facilitates the expression of AgoshRNA molecules with a precise 30 end [23]. Theoretically, the HDV ribozyme should mediate self-cleavage exactly at the border of the AgoshRNA-ribozyme fusion, thus releasing the AgoshRNA molecule with an AgoshRNA-encoded 30 CUU overhang (Fig. 2). Design the AgoshRNA-T6 and AgoshRNA-HDV fragments flanked by BamHI and HindIII restriction enzyme sites (see Note 10). 3.1.3 Cloning of AgoshRNA Constructs in the pSuper.Basic Vector

1. Digest the AgoshRNA DNA duplexes and the pSuper.basic vector with BamHI and HindIII to create sticky ends.

3.1.4 Cloning of AgoshRNA Constructs in a Third-Generation Self-Inactivating Lentiviral Vector (LV)

1. Excise the AgoshRNA cassette from the Psuper.basic plasmid with PstI/XhoI.

3.1.5 Cloning of the Luciferase Reporter Constructs in the pGL3 Vector

The pGL3 vector was previously modified by insertion of a 50–70 nt HIV sequence containing the EcoRI and PstI sites into the XbaI site located downstream of the luciferase gene in pGL3 control [30]. Clone the 18-nt target sequence via the EcoRI and PstI sites. Alternatively, the original pGL3.control vector can be used. To do so, design and clone 18-nt target sequences via the XbaI site and check the orientation (see Note 11).

3.1.6 Transformation and Sequence Validation of Constructs

1. Transform the vector constructs into a competent E. coli strain according to the protocol supplied with the cells (see Note 12).

2. Clone the fragments into the pSuper.basic vector using T4 DNA Ligase (1 U/μl) according to manufacturer’s instructions. This vector expresses the AgoshRNA from the human Pol III H1 promoter.

2. Insert the excised fragment into the multiple cloning site (PstI/XhoI) of the LV, thus creating LV-AgoshRNA. We use the LV vector pRRLSIN.cPPT.PGK-GFP.WPRE [24], which expresses the AgoshRNA from the human Pol III H1 promoter and the green fluorescent protein (GFP) reporter from the human Pol II PGK promoter.

2. Inspect the plates for colony growth. From each plate, pick four to eight colonies to check for the correct DNA insert. Use a sterile pipette tip to inoculate a single colony into a 50 μl culture of LB medium. Incubate the culture while shaking at 37 or 30  C depending on the bacterial strain for 1 h. Store the remaining bacteria at 4  C to start fresh cultures in case no positive clones are identified.

Optimization of Therapeutic AgoshRNAs by HDV Ribozyme Inclusion

235

3. Perform colony PCR: 2.5 μl diluted colony, 0.25 μl of Fwd primer (10 μM), 0.25 μl of Rev. primer (10 μM), 6.25 μl of DreamTaq, and 3.25 μl of Milli-Q water. The Thermofisher calculator provides the recommended Tm (melting temperature) of the designed primers and the PCR-annealing temperature based on the sequence of the primer pair, primer concentration, and the type of DNA polymerase used in the PCR. pSuper: Fwd 50 -AATACGACTCACTATAG-30 . Rev. 50 -AACAGCTATGACCATG-30 . pGL3: Fwd 50 -TGCGCGGAGGAGTTGTGTTTGT-30 . Rev.: 50 -AAACCTCCCACACCTCCCCCTG-30 . LV: Fwd: 50 -TTCAGACCCACCTCCCAACCCC-30 . Rev.: 50 -CTTTCCCCTGCACTGTACCCCC-30 . 4. Determine the approximate length of the DNA fragment by running it on an agarose gel alongside the DNA ladder. Pour a standard 1% (wt/vol) agarose gel in TBE buffer. Add ethidium bromide to a final concentration of 0.2 μg/ml. The ethidium bromide binds to the DNA and allows DNA visualization under ultraviolet (UV) light. 5. Verify the sequence of each colony using the BigDye Terminator v1.1 Cycle Sequencing Kit: 1.5 μl of DNA template (1:10 diluted), 1 μl of Fwd primer (2 μM), 1 μl of BDT, 2 μl of BDT Buffer, 4.5 μl of Milli-Q water to a total volume of 10 μl. Run the following PCR cycling program: Step

Condition

1

96  C, 5 s

2

96  C, 30 s

3

55  C, 10 s

4

60  C, 4 min

5

4  C, hold

Repeat steps 2, 3, and 4 for another 29 cycles. For sequencing of hairpin RNA constructs, a sample denaturation temperature of 98  C is used and 1 M betaine is added to the reaction.

236

Ben Berkhout and Elena Herrera-Carrillo

3.1.7 DNA Isolation and Glycerol Stocks

1. Start cultures of the positive clones: Add 25 μl of the stored culture to 3 ml LB medium with Ampicillin (100 mg/ml). Incubate while shaking for at least 6 h at 37 or 30  C depending on the bacterial strain used. 2. Make a glycerol stock of the verified clones (15% glycerol) and inoculate 1 ml of the growth culture into 150 ml LB medium with Ampicillin and incubate the culture while shaking at 37 or 30  C overnight depending on the strain used. 3. Isolate the plasmid DNA from these cultures using a spin midiprep kit according to the manufacturer’s instructions.

3.2 Transient HIV Inhibition Assay 3.2.1 Transfection of HEK293T Cells

Quantitate inhibition of virus production as follows: 1. Seed HEK293T cells one day before transfection in 24-well plates at a density of 1.2  105 cells/well in 500 μl DMEM/ 10% FBS without antibiotics. 2. Co-transfect the seeded cells with 250 ng of the full-length HIV molecular clone pLAI [31], 1 ng of Renilla luciferase plasmid (pRL), and 25 ng of AgoshRNA construct using Lipofectamine 2000 following the manufacturer’s instructions. pRL is included to control for variation in the transfection efficiency. pBluescript (pBS) is added to ensure equal DNA concentration per transfection. 3. Harvest the culture supernatant at two days post-transfection to determine virus production by measuring the CA-p24 level (see Subheading 3.2.2) and lyse the cells to measure renilla luciferase activity (see Subheading 3.2.3).

3.2.2 CA-p24 Enzyme-Linked Immunosorbent Assay (ELISA)

1. Reconstitute D7320 antibody in water at 1 mg/ml and store 100 μl aliquots at 20  C. 2. Coat white, half-volume 96-well plates with D7320 antibody overnight at room temperature. For each plate, use 25 μl of reconstituted D7320 antibody and 2475 μl 0.05 M NaHCO3 pH 8.5 (see Note 13). Dispense 25 μl of coating mixture per well. Seal the plates with cling film. 3. Wash the plates three times with 100 μl of TBS (144 mM NaCl, 25 mM Tris pH 7.5). Dry plates by hitting them against paper towels. 4. Prepare a standard curve using HIV-1 CA-p24 recombinant protein stored at 80  C. Mix 25 μl of this aliquot with 225 μl TBS + 0.05% empigen, use this as a stock to prepare the standard curve according to the scheme below:

Optimization of Therapeutic AgoshRNAs by HDV Ribozyme Inclusion

237

1 TBS + 0.05% empigem

Stock

CA-p24 ng/ml

1

1 ml

0

0

2

900 μl

100 μl from 4

0.1 ng

3

900 μl

100 μl from 8

0.5 ng

4

990 μl

10 μl

1 ng

5

980 μl

20 μl

2 ng

6

970 μl

30 μl

3 ng

7

960 μl

40 μl

4 ng

8

950 μl

50 μl

5 ng

5. Transfer 25 μl sample or the standard curve on each well of the washed plate and incubate rocking for 2 h at room temperature. 6. Prepare the conjugate per plate as followed: 0.05 g milk powder, 2 ml TBS, 0.5 ml sheep serum, 25 μl Tween, and 0.31 μl BC1071-AP previously diluted and stored at 80  C. 7. Wash plates three times with 100 μl TBS. Dry plates by hitting them against paper towels. Add 25 μl of conjugate in each well and incubate by rocking for 1 h. 8. Wash the plates three times with 100 μl PBS + 0.1% tween. Dry plates by hitting them against paper towels. Add 25 μl Lumiphos to each well and measure chemiluminescence after 30 min. Light emission is maximal at 470 nm. 3.2.3 Renilla Luciferase Assay

1. Rinse the cells with 100 μl DPBS. Remove all rinse solution. 2. Dispense 100 μl of 1 lysis buffer into each well. 3. Gently rock the culture plate for 20 min at room temperature. 4. Transfer the lysate to a new plate. 5. Transfer 5 μl of supernatant to an opaque white half area 96-well plate. 6. Measure Renilla values in a luminometer (see Note 14). 7. Calculate the relative CA-p24 production as the ratio between the CA-p24 level and the renilla luciferase activity. Set the control transfection at 100%. Compare the level of suppression of CA-p24 production triggered by the AgoshRNA constructs compared to the control. We recommend performing at least three independent transfections, each in duplicate. Values can be corrected for between-session variation as described previously [32]. Perform statistical analyses (for instance, two-way ANOVA followed by Tukey’s post hoc tests). AgoshRNA-

238

Ben Berkhout and Elena Herrera-Carrillo

HDV generally mediated more robust inhibition of HIV production than AgoshRNA-T6, demonstrating a positive effect of inclusion of the 30 -terminal HDV motif [33]. 3.3 Dual-Luciferase Reporter Assay

1. Seed HEK293T cells a day before transfection in 24-well plates at a density of 1.2  105 cells/well in 500 μl DMEM/10% FBS without antibiotics. 2. Co-transfect seeded cells with 100 ng of the firefly luciferase expression plasmid, 1 ng of renilla luciferase expression plasmid (pRL) and 1, 5, or 25 ng of AgoshRNA vector using Lipofectamine 2000 reagent according to the manufacturer’s instructions. Add pBS plasmid to have an equal DNA concentration for each transfection. The Renilla luciferase plasmid is used as a control for comparing the transfection efficiency among different wells. 3. Lyse the cells 2 days post-transfection to measure firefly and renilla luciferase activities using the dual-luciferase reporter assay system. To do so, remove growth media from cultured cells, rinse the cells with 100 μl DPBS, remove all rinse solution, and dispense 100 μl of passive lysis buffer in each well. Gently rock the culture plate for 20 min at room temperature. Then, transfer the lysate to a new plate. Transfer 5 μl supernatant to an opaque white half area 96-well plate and measure Luciferase and Renilla values in a luminometer (see Note 15). 4. Calculate the ratio of Luciferase to Renilla as the relative Luciferase activity. Perform at least three independent transfections in duplicate. Set the control transfection at 100%. Compare the level of suppression of Luciferase gene expression triggered by the AgoshRNA constructs compared to the control. Perform statistical analyses. In our experimental settings, AgoshRNAHDV variants consistently mediated more robust inhibition than the original AgoshRNA-T6 variants [33].

3.4 Intracellular Processing of the AgoshRNA Transcripts

Perform Northern blot analysis to examine AgoshRNA expression for the different vector designs. This should document the actual cleavage of the AgoshRNA transcript by the HDV ribozyme and the cleavage efficiency. It will also allow one to estimate the AgoshRNA transcript length with or without the variable U-tail [33]. 1. Seed 1.5  106 HEK293T cells in T25 flasks in 4 ml of DMEM/10% FBS without antibiotics 1 day prior transfection. 2. Transfect the cells with 1 μg of the AgoshRNA constructs using Lipofectamine 2000 reagent according to manufacturer instructions. 3. Isolate small RNAs 2 days post-transfection with the mirVana miRNA isolation kit according to the manufacturer’s protocol.

Optimization of Therapeutic AgoshRNAs by HDV Ribozyme Inclusion

239

To do so, harvest the cells at two days post-transfection. Transfer the cells to sterile 15 ml conical tubes and pellet the cells by centrifugation at 300  g for 5 min. Decant the supernatant and resuspend the cells in 5 ml of ice-cold DPBS. Keep the tubes on ice during processing. Discard the supernatant and add 800 μl ice-cold DPBS. Pipette up/down and transfer the suspension of cells into an Eppendorf tube. Pellet the cells by centrifugation at 300  g for 5 min. Discard the DPBS and place the washed cells on ice. 4. Determine RNA concentrations on the spectrophotometer. The OD260:OD280 ratio will indicate whether the sample is contaminated with protein or phenol and a value of 1.8–2.0 indicates good quality RNA. 5. Resolve the RNA transcripts in a 15% TBE-urea gel. Pipet a volume corresponding to 5 μg Total RNA in an Eppendorf tube. Dissolve the RNA in 5 μl of RNase-free Milli-Q water and 5 μl of loading buffer and heat at 95  C for 5 min. Fill the inner and outer buffer chambers with 1 TBE. Flush the wells several times with 1 TBE Running Buffer to remove urea just before sample loading. Load samples quickly and avoid letting the gel stand for too long during/after loading to prevent diffusion of the samples. Load 2.5 μl of γ[32P]-labeled decade RNA marker for size estimation. Run the TBE-Urea Gel using the XCell II Blot Module. Run the gel at a constant 70 V for 2 h. Stain the gel in 2 μg/ml ethidium bromide for 20 min to check for equal sample loading. Rinse the gel with Milli-Q water and visualize the gel under UV light. 6. Transfer RNA from the gel to a positively charged nylon membrane. Activate the membrane in a tray with Milli-Q water. Assemble the sandwich cassette following the scheme in Fig. 3. Pre-soak the blotting pads and filter papers in transfer buffer. Remove all trapped air bubbles by gently rolling over the surface using a pipette as a roller. Close the XCell II mini-

Fig. 3 Northern blot transfer using the XCell Blot Module

240

Ben Berkhout and Elena Herrera-Carrillo

cell cassette and place in the XCell II blot module. Fill the inner chamber with 0.5 TBE and the outer chamber with Milli-Q water. Close the blot module and transfer for 1 h at 30 V. 7. Label the 50 end of locked nucleic acid (LNA) oligonucleotides with the KinaseMax kit in the presence of 1 μl γ[32P]-ATP (0.37 MBq/μl). Prepare the following reaction mixture: 1 μl of probe LNA (10 μM), 2 μl of PNK buffer, 1 μl of T4 PNK, 1 μl of [γ-32P]ATP (7000 Ci/mmol, 150 mCi/ml), and 15 μl of Milli-Q water. Incubate for 1 h at 37  C and remove unincorporated nucleotides over a Sephadex G-25 spin column. 8. Pre-warm 10 ml of hybridization buffer for 30 min at 42  C and then pre-hybridize the blot for 30 min at 42  C in 10 ml of hybridization buffer. 9. Add the probe to the pre-hybridized blot and hybridize at 42  C overnight. 10. Discard the hybridization buffer and wash the nylon membrane with 15 ml of pre-warmed low stringency wash buffer (2 SSC + 0.1% SDS) until there is no radioactivity detectable anymore in the washing buffer with a scintillation counter. Next wash the membrane with 20 ml of pre-warmed high stringency wash buffer (0.1 SSC + 0.1% SDS) for 5 min. 11. Detect the probes in the nylon membrane by Typhoon FLA 9500 and quantitate bands using ImageJ software. In our study, the inserted ribozymes efficiently cleaved the precursor transcript to generate the precise AgoshRNA duplex [33]. The addition of a HDV ribozyme to the 30 terminus of the AgoshRNA sequence did not interfere with Ago2-mediated processing of the AgoshRNA molecules. 3.5 Lentiviral Vector Production

HEK293T producer cells are co-transfected with the lentiviral vector plasmid and three packaging plasmids expressing gag-pol, rev, and VSV-g envelope protein (Fig. 4). Lentiviral vector particles are produced and secreted in the supernatant. 1. Seed 6  105 HEK293T cells in a 6-well plate in 2 ml of DMEM/10% FBS without antibiotics 1 day prior transfection (see Note 16). 2. Transfect seeded cell in the afternoon using Lipofectamine 2000 following manufacturer’s instructions. Prepare the DNA-Lipofectamine complexes in Opti-MEM I medium for each transfection as follows: – Dilute 0.95 μg of lentiviral vector construct, 0.6 μg of pSYNGP, 0.25 μg of pRSV-Rev, and 0.33 μg of pVSV-G in 250 μl Opti-MEM medium (see Note 17).

Optimization of Therapeutic AgoshRNAs by HDV Ribozyme Inclusion

241

Fig. 4 Lentiviral vector production and transduction of target cells. HEK293T producer cells are co-transfected with the lentiviral vector plasmid and three packaging plasmids expressing gag-pol (pSYNGP), rev (pRSV-rev), and VSV-g envelope protein (pVSV-g). Lentiviral vector particles are produced and secreted in the supernatant. The vector particles are then used for transduction of target cells, which results in viral DNA integration into the host cell genome

– Dilute 6 μl of Lipofectamine 2000 in 250 μl Opti-MEM medium for each well and incubate for 5 min at room temperature. – Combine the DNA and Lipofectamine solutions and mix gently. Incubate for 20 min at room temperature to allow DNA-Lipofectamine complexes to be formed. – Add the DNA-Lipofectamine-Opti-MEM mix dropwise to the cells. 3. Replace the transfection medium with 1.6 ml of Opti-MEM medium the next morning (see Note 18). 4. Harvest the produced lentiviral vector after 2 days of transfection. Transfer the supernatant to sterile 15 ml conical tubes and centrifuge at 300  g for 5 min. Filter the supernatant over a 0.45 μM filter. The highest transduction titer are obtained after 2 days post-transfections. Optionally, additional media can be added on the cells to perform another harvest at day 3 posttransfection.

242

Ben Berkhout and Elena Herrera-Carrillo

5. The viral supernatant can be concentrated with a centrifugal filter at 4000  g according to the manufacturer’s instructions (see Note 19). 6. Aliquot the viral supernatant in cryovials and store the stocks at 80  C (see Note 20). 7. The production of lentiviral vector particles can be determined by CA-p24 ELISA as described in Subheading 3.2.2. 3.6 Lentiviral Vector Transduction

The vector particles are used for transduction of target cells, which results in viral DNA integration into the host cell genome (Fig. 4). Lentiviral vector stocks can be titrated on the desired cell type to determine the vector titer. 1. Seed 5  104 SupT1 T cells in each well of a flat bottom 96-well plate in 100 μl of Advanced RPMI-1640 supplemented with Lglutamine, 1% FBS and penicillin and streptomycin (growth medium). 2. Transduce the cells with 100, 10, 1, and 0.1 μl of lentiviral vector. Make dilutions such that 100 μl of vector can be added to each well. 3. Incubate the cells for at least 6 h in a humidified CO2 chamber at 37  C to allow efficient transduction of the target cells. 4. Wash the cells by carefully replacing most of the supernatant with fresh advanced growth medium. 5. Incubate for 72 h at 37  C and 5% CO2. 6. Replace most of the supernatant with FACS buffer. 7. Determine the transduction efficiency of the vector by detecting the percentage of GFP+ cells by FACS (see Note 21). 8. To calculate the transduction titer per ml of vector, use the following formula: Titer/ml: cell number on the day of transduction  ((percentage of fluorescent cells/100)/dilution factor of the vector). For instance, if 10% of the cells become GFP+ when a transduction was performed on 50,000 cells with 1 μl of vector, the titer is calculated as follows: 50,000  (0.1/ 0.001) ¼ 5  106 transducing units/ml (TU/ml). Note that the titers should be calculated at conditions that yield around 30% GFP-positive cells (see Note 22). 9. Transduce SupT1 T cells at a multiplicity of infection (moi) of 0.15 (see Note 23). 10. Select live cells by fluorescence-activated cell sorting (FACS) for GFP expression at three days after transduction.

Optimization of Therapeutic AgoshRNAs by HDV Ribozyme Inclusion

3.7

HIV Infection

3.7.1 Production of the HIV Stock by Transfection of HEK293T Cells with the pLAI Clone

243

1. Seed 1.5  106 HEK293T cells in T25 flasks in 4 ml of DMEM/10% FBS without antibiotics one day prior to transfection. 2. Transfect seeded cells with 5 μg of pLAI clone using Lipofectamine 2000 reagent according to manufacturer instructions. 3. Harvest the supernatant after two days of transfection. 4. Transfer the supernatant to sterile 15 ml conical tubes and centrifuge at 300  g for 5 minutes. Filter the supernatant over a 0.2 μM filter. 5. Aliquot the viral supernatant in cryovials and store the stocks at 80  C.

3.7.2 Virus Titration (TCID50 Determination)

Estimate the TCID50 (50% tissue culture infectious dose) of HIV virus stocks on SupT1 T cells by measuring virus production by CA-p24 ELISA. 1. Seed 5  104 SupT1 T cells in each well of a flat bottom 96-well plate in 100 μl of growth medium one day prior to infection. To avoid the “edge effect,” avoid using the peripheral wells of the plate for titration of the stock (see Note 24). 2. Place 100 μl of growth medium in each well of a 96-well U-bottom culture plate from column 2 to 11. 3. Add 25 μl of virus to column 2, rows B–D. Rows E–G can be used for a second virus stock. 4. Mix by pipetting up and down at least 5 times in column 2 and transfer 25 μl to column 3. Repeat the mixing and virus transfer through column 10, thus creating serial fivefold dilutions. Column 11 will serve as control for background luminescence of non-transduced cells. 5. Transfer 100 μl of each dilution to the plate that contains the cells. 6. Incubate the plate at 37  C and 5% CO2. 7. On day 3, remove 150 μl of media and add 150 μl of fresh growth medium to each well. Return the plate to the incubator. 8. On day 5–11 harvest the cell-free supernatant and test the supernatant for HIV CA-p24 antigen as described in Subheading 3.2.2 (see Note 25). 9. Correct values for background luminescence (column 11). A well is scored “positive” if the corrected value is 100 pg/ml. 10. Estimate the infectious units (IU) per ml or TCID50 of HIV virus stocks using Spearman–Karber formula: M ¼ xk + d [00 5  (1/n) (r)]. The TCID50 calculation considers the dose of highest dilution (xk), the spacing between dilutions

244

Ben Berkhout and Elena Herrera-Carrillo

(d), the number of wells per dilution (n), and the total number of negative wells (r). In this example, M ¼ 9 + 1[0.5  (1/3) (r)]. For instance, if scoring the plate for HIV CA-p24 antigen positivity results r ¼ 16: M ¼ 9 + 1[0.5  (1/3) (16)]. M ¼ 4.17. The 50% endpoint is 5–4.17, converting to 10x: x ¼ 4.17  log5 ¼ 4.17  0.70. Thus, 50% titer is 102.92. To calculate the TCID50/ml of virus stock, the dilution must be corrected by multiplying by 10 (100 μl of 1 ml). TCID50/ml ¼ 10  102.92. 10  5 [9 + (0.5  (1/3) (r)]. 11. Calculate the multiplicity of infection (moi) for the experimental conditions. The moi is the ratio of the number of infectious units to the number of cells (moi ¼ IU/cell). 3.7.3 Infection of Transduced SupT1 T Cells

1. Seed 1  106 of FACS-sorted SupT1 T cells in each well of a 6-well plate in 3 ml of growth medium (see Note 26). Compare to AgoshRNA and HDV-AgoshRNA transduced cells to measure their inhibitory activity. 2. Challenge SupT1 T cells with HIV LAI at moi of 0.1. Perform six infections per construct (see Note 27). 3. Split cells twice a week. Monitor virus spread by scoring of syncytia formation every 2 days and by measuring CA-p24 production up to approximately 80 days (see Subheading 3.2.2).

3.8 Phenotypic and Genotypic Assay 3.8.1 Phenotypic Assay

3.8.2 Genotypic Assay

To detect the presence of AgoshRNA-resistant HIV-1 variants, 5 μl of cell-free virus supernatant is passaged onto 1 106 SupT1AgoshRNA cells in 1 ml of growth medium. This step removes the contaminating non-resistant viruses, including the input wildtype virus, and selects for AgoshRNA-resistant variants. Further details on in vitro HIV evolution techniques are presented in [34]. Isolate total cellular DNA that contains the integrated HIV proviruses when virus replication is observed in the restricted AgoshRNA cells as follows: 1. Harvest infected cells in Eppendorf tubes and centrifuge the tubes at 300  g for 5 min. 2. Discard the supernatant, wash the cellular debris with DPBS and centrifuge at 300  g for 5 min, discard the supernatant. 3. Add 150 μl of TLE, 1.5 μl of proteinase K, and 0.75 μl Tween 20 per sample. Vortex the sample thoroughly. 4. Incubate the sample for 1 h at 56  C.

Optimization of Therapeutic AgoshRNAs by HDV Ribozyme Inclusion

5. Incubate the sample for 10 min at 95 proteinase K.



245

C to inactivate

6. Store the DNA samples at 80  C. 7. Amplify integrated proviral DNA sequences by PCR with the primer pairs described in Subheading 2.7. Calculate the PCR-annealing temperature based on the sequence and concentration of the primer pair. Perform the PCR as follows: 12.5 μl DreamTaq, 0.5 μl forward primer, 0.5 μl reverse primer, 1 μl DNA sample, and 10.5 μl Milli-Q water to a total volume of 25 μl. Run the following PCR cycling program: Step

Condition

1

96  C, 5 min

2

96  C, 1 min

3

Annealing temperature, 1 min

4

72  C, 2 min

5

72  C, 10 min

6

4  C, hold

Repeat steps 2, 3, and 4 for another 29 cycles. 8. Verify the sequence of each sample using the BigDye Terminator v1.1 Cycle Sequencing Kit: 1.5 μl of DNA template (1:10 diluted), 1 μl of forward primer (2 μM), 1 μl of BDT, 2 μl of BDT Buffer, 4.5 μl of Milli-Q water to a total volume of 10 μl. Run the following PCR cycling program: Step

Condition

1

96  C, 5 s

2

96  C, 30 s

3

55  C, 10 s

4

60  C, 4 min

5

4  C, hold

Repeat steps 2, 3, and 4 for another 29 cycles. 3.9 Competitive Cell Growth Assay (CCG)

1. Transduce SupT1 T cells at an moi of 0.15 and 1.5. 2. Screen transduced SupT1 T cells for a negative impact on cell growth (induced by lentiviral integration and/or AgoshRNA expression) by simply monitoring the composition of a mixed culture of transduced (GFP+/AgoshRNA+) and untransduced

246

Ben Berkhout and Elena Herrera-Carrillo

(GFP) cells for up to 50 days. The GFP+/ ratio as measured by FACS is plotted. A straight line demonstrates that there is no growth deficit induced by the transgene. 3. Quantitate the impact on cell growth as the change in proportion of GFP+ cells (%) as described in detail [35] (see Note 28).

4

Notes 1. HEK293T cells cultured in T75 flasks are attached to the bottom of the flask. We recommend splitting the cells twice per week 1 in 20. Do not overgrow the flask to maintain the cells in the logarithmic growth phase. To sub-culture, first warm the fresh culture medium and the Trypsin/EDTA solution in a 37  C water bath. Aspirate the medium of the cells and add 10 ml DPBS to the side of the flask so as not to detach the cells. Aspirate the DPBS and add 1 ml trypsin/EDTA solution. Transfer the flask to a 37  C incubator. After 5 min, tap the side of the flask, and examine the flask under a microscope for lifting of the cells. Transfer the cells to sterile 15 ml conical tubes and pellet the cells by centrifugation at 300  g for 5 min. Decant the supernatant and resuspend the cells in complete cell culture medium. 2. SupT1 T cells grow in suspension in T25 flasks. We recommend splitting these cells twice per week 1 in 10. 3. Aliquoting of the cells minimizes damage due to repeated cycles of freezing and thawing, as well as the danger of contaminations. The size of the aliquots depends on how many cells are typically used in an experiment. We recommend 25 μl aliquots for subsequent HIV-1 CA-p24 ELISA measurements as that is needed to coat one 96-well plate (half area). 4. Heat-inactivate the serum by placing the bottle of serum into a 56  C water bath containing sufficient water to at least the serum level. Thoroughly swirl to homogenize. Swirl the bottle every 5 min to ensure uniform heating of the serum. After 30 min, remove the serum bottles and cool slowly to room temperature. Filter through a 0.45 μm cellulose acetate filter to remove the precipitate that may have formed. Store the heatinactivated serum at 20  C in small aliquots (for instance, 5 ml) that can be thawed individually as needed. We do not recommend more than one freeze-thaw cycle. 5. Empigen is a detergent that solubilizes membrane proteins. Check the concentration of the supplied empigen as it differs among suppliers.

Optimization of Therapeutic AgoshRNAs by HDV Ribozyme Inclusion

247

6. Pipetting of viscous liquids requires a slow pipetting speed and reverse pipetting to reduce the effect of liquid retention on the tip. 7. A stab consists of Luria Broth (LB) agar media that is pierced by the bacterial stock instead of spreading it on the surface of an agar plate. The bacteria grow in the puncture point. 8. To recover DNA on filter paper, use a clean razor blade to cut the marked DNA-spot from the filter paper. Immerse the piece of paper in 30 μl Milli-Q water and pipet up/down to mix. Wait for 10 min and use 2 μl of the mixture to transform competent bacteria. 9. The DNA (2 μl of DNA suspension at 10–50 ng/μl) can be transformed into bacteria. We have selected One Shot Stbl3 chemically competent cells. Thaw Stbl3 competent cells on ice and transform them immediately. Add the DNA to the bacteria and mix by gently tapping of the tube. Do not mix cells by pipetting up/down or by mixing on the vortex! Incubate the vials on ice for 30 min, then heat-shock the cells for 45 s at 42  C without shaking. Place the cells on ice for 2 min and subsequently add 250 μl of pre-warmed SOC medium to each vial and incubate for 1 h at 30  C in a shaking incubator (225 rpm). Spread 25 and 100 μl of each transformation mixture on a pre-warmed antibiotic-selective plate and incubate overnight at 30  C. We recommend that you plate two different volumes to ensure that at least one plate will develop isolated colonies. 10. AgoshRNA fragments can be designed flanked by BamHI and HindIII restriction enzyme sites. Alternatively, a HDV ribozyme fragment can be designed and amplified by PCR in a second step. The forward primer (50 -end primer) must contain the AgoshRNA sequence followed by the 50 -end sequence of the HDV ribozyme. The overlap between the primer and the gene of interest should be long enough (18–21 nucleotides) to give a Tm of 60  C or more. The forward primer contains the BamHI restriction site and a 50 -extension of the restriction site with 6–10 bases in order to optimize the cleavage efficiency. The reverse primer (30 -end primer) must overlap with the DNA strand complementary to the 30 end of the HDV ribozyme. This primer must contain the HindIII restriction enzyme site and a 50 extension of the restriction site with 6–10 bases to increase the cleavage efficiency. The Thermofisher calculator can be used to calculate the melting temperature (Tm) of the designed primers and the PCR-annealing temperature based on the sequence of the primer pair, primer concentration, and the type of DNA polymerase used in the PCR.

248

Ben Berkhout and Elena Herrera-Carrillo

11. Dephosphorylating of the vector should be performed when using a single restriction site to clone the insert of interest to prevent re-ligation of the vector without any insert. FastAP thermosensitive alkaline phosphatase can be used to remove the 50 - and 30 -phosphate groups from DNA in any of the Thermo Scientific restriction enzyme buffers. Thus, you can digest and dephosphorylate the vector at the same time. FastAP dephosphorylates DNA ends in 10 min at 37  C. The enzyme is inactivated for 5 min at 75  C. Follow the manufacturer’s instructions to digest and dephosphorylate the vector. Isolate the vector by gel purification. Determine by sequencing whether the insert is in the 50 –30 orientation in relation to the promoter. 12. We recommend ChemiComp GT116 cells for cloning and propagation of plasmids that contain structured inserts (folding DNA cruciform and RNA hairpins). We use Stbl3 or NEB Stable competent cells when cloning unstable inserts such as lentiviral DNA containing direct repeats. The DNA (2 μl of DNA suspension at 10–50 ng/μl) can be transformed into bacteria. Thaw competent cells on ice, and transform the cells immediately upon thawing. Add the DNA to the bacteria and mix by gently tapping of the tube. Do not mix cells by pipetting up/down or by mixing on the vortex! Incubate the vials on ice for 30 min, then heat-shock the cells for 45 s at 42  C without shaking. Place the cells on ice for 2 min and subsequently add 250 μl of pre-warmed SOC medium to each vial and incubate GT116 at 37  C and Stbl3 at 30  C in a shaking incubator (225 rpm) for 1 h. Spread 25 and 100 μl of each transformation mixture on a pre-warmed antibiotic-selective plate. Incubate GT116 and Stbl3 overnight at 37 and 30  C, respectively. We recommend that you plate two different volumes to ensure that at least one plate will develop isolated colonies. 13. The optimal D7320 antibody concentration is 5–10 μg/ml. The coating buffer pH should be 8.5. The stock solution tends to drift alkaline over a few weeks because of carbon dioxide absorption. Above about pH 9.5, the stability of the antibody is compromised. 14. We use the GloMax 96 Microplate Luminometer. If using this machine, turn the GloMax machine on and open the GloMax interface. We use the Promega protocol/pRL/one injector. Flush the injector three times with demineralized water and subsequently with air. Then insert tube 1 in Renilla Luciferase Assay Reagent and prime the injector. Choose the plate setup (delay 0 s), select injector 1, and set the following parameters: Inject volume: 25 μl.

Optimization of Therapeutic AgoshRNAs by HDV Ribozyme Inclusion

249

Delay: 2 s. Interval: 5 s. After measuring the plate, flush the unused reagent. Then, flush the injector three times with demineralized water, ethanol, and finally air. 15. Turn the machine on and open the GloMax interface. Run: Promega protocol/DRL/two injectors. Flush both injectors three times with demineralized water first and then with air. Then insert tube 1 in LAR II and tube 2 in Stop & Glo solution. Prime both injectors. Choose plate setup: delay 0 seconds. Select injector 1 and 2 and set the following parameters: Inject volume: 25 μl. Delay: 2 s. Interval: 5 s. After measuring the plate, flush the unused reagent. Then, flush both injectors three times with demineralized water, ethanol, and air. 16. Infectious material such as the lentiviral vectors should be handled in appropriate biosafety facilities (BSL-2). 17. To reduce pipetting variations, we recommend the preparation of a master mix of the packaging constructs when performing transfections to produce lentiviral vectors. Similarly, make a master mix for the Lipofectamine 2000-Opti-MEM mix. 18. Vector production in Opti-MEM medium improves the titer compared to standard DMEM medium. In addition, this medium facilitates the subsequent filtration and concentration steps. Replace the media carefully to avoid detachment of the cells. 19. Ultracentrifugation can be used to concentrate the lentiviral vector particles. 20. Freeze aliquots to prevent multiple freeze-thaw cycles that can cause a significant drop in the lentiviral titer. 21. Another method to determine the vector titers is to assess DNA sequences in transduced cells using qPCR [36]. 22. For SupT1 T cells, we generally obtain titers of 10  106 transducing units/ml (TU/ml). For primary cells like PBMCs and CD4+ T cells, the titer is usually reduced approximately 100-fold. 23. Multiplicity of infection (moi) is a parameter to describe the infectivity for a particular target cell type. An infectious unit refers to the smallest amount of virus capable of initiating a productive infection of a susceptible cell type. The LV titer is defined as the transfecting units per unit volume. Theoretically,

250

Ben Berkhout and Elena Herrera-Carrillo

an moi of less than one (such as moi ¼ 0.15) should be used to guarantee single-copy integrations. Practically, at moi ¼ 0.15 only 5%–10% of the cells will be transduced (depending on the cell type) and the majority of transduced cells will have a single copy of the provirus with the transgene insert. 24. Evaporation effects in the wells near the edge of a plate have been described when extended incubation periods were used. This may cause irregular patterns of cell growth and consequently lead to variation between replicates. A method to circumvent the edge effect is to avoid seeding cells in the peripheral wells, but these wells should be filled with PBS or media as otherwise the evaporation effect is moved to a new, more central position on the plate. By discarding the outer wells of a 96-well plate, the number of wells for analysis is reduced to 60, which results in serial dilutions of virus stock in triplicates instead of quadruples. 25. One should daily check for direct cytopathic effects of the virus (syncytia formation or cell death) starting at day 3 postinfection. Once peak virus production is apparent, the culture supernatant can be harvested as described. 26. Always use cells transduced with the empty LV vector and GFP-sorted as the negative control. Depending on the exact nature of the experiment, additional controls may be required. Compare the HIV-inhibitory activity of the AgoshRNA and HDV-AgoshRNA vectors. We observed a delay HIV replication in all AgoshRNA-expressing cells compared to control cells. HIV replication was much delayed or even prevented in the AgoshRNA-HDV cultures compared to the control AgoshRNA (AgoshRNA-T6) cultures. 27. Replication of HIV-1 under selective pressure of the AgoshRNA inhibitor can result in the evolution of virus variants that are resistant to the inhibitor, thus frustrating the therapy. To drive virus evolution, genetic variants should first be produced, from which the virus variants with the resistant phenotype are subsequently selected [34]. The error-prone reverse transcription step during HIV replication is the major cause of the rapid generation of HIV-1 variants. Because evolution is a chance process, every experimental condition is probed in six replicates. 28. A mixed transduction culture, containing both transduced GFP+ and untransduced GFP cells, can simply be passaged to monitor the GFP+/GFP ratio by longitudinal FACS analysis to score minor cell growth defects as a gradual loss of the percentage GFP+ cells. This assay is based on the competitive cell growth of transduced and non-transduced cells.

Optimization of Therapeutic AgoshRNAs by HDV Ribozyme Inclusion

251

Acknowledgments This research was supported by the Nederlandse Organisatie voor Wetenschappelijk Onderzoek–Chemische Wetenschappen (NWO-CW, Top Grant) and Zorg Onderzoek Nederland–Medische Wetenschappen (ZonMw, Translational Gene Therapy Grant). References 1. Hannon GJ (2002) RNA interference. Nature 418:244–251 2. Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, Tuschl T (2001) Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411:494–498 3. Brummelkamp TR, Bernards R, Agami R (2002) A system for stable expression of short interfering RNAs in mammalian cells. Science 296:550–553 4. Yi R, Doehle BP, Qin Y, Macara IG, Cullen BR (2005) Overexpression of exportin 5 enhances RNA interference mediated by short hairpin RNAs and microRNAs. RNA 11:220–226 5. Khvorova A, Reynolds A, Jayasena SD (2003) Functional siRNAs and miRNAs exhibit strand bias. Cell 115:209–216 6. Schwarz DS, Hutvagner G, Du T, Xu Z, Aronin N, Zamore PD (2003) Asymmetry in the assembly of the RNAi enzyme complex. Cell 115:199–208 7. Noland CL, Ma E, Doudna JA (2011) siRNA repositioning for guide strand selection by human Dicer complexes. Mol Cell 43:110–121 8. Jaskiewicz L, Filipowicz W (2008) Role of Dicer in posttranscriptional RNA silencing. Curr Top Microbiol Immunol 320:77–97 9. Siomi H, Siomi MC (2010) Posttranscriptional regulation of microRNA biogenesis in animals. Mol Cell 38:323–332 10. Herrera-Carrillo E, Gao ZL, Harwig A, Heemskerk MT, Berkhout B (2017) The influence of the 5-terminal nucleotide on AgoshRNA activity and biogenesis: importance of the polymerase III transcription initiation site. Nucleic Acids Res 45:4036–4050 11. Herrera-Carrillo E, Harwig A, berkhout B. (2017) Influence of the loop size and nucleotide composition on AgoshRNA biogenesis and activity. RNA Biol 14:1559–1569 12. Herrera-Carrillo E, Berkhout B (2017) Dicerindependent processing of small RNA

duplexes: mechanistic insights and applications. Nucleic Acids Res 45:10369–10379 13. Liu YP, Karg M, Harwig A, Herrera-Carrillo E, Jongejan A, van Kampen A et al (2015) Mechanistic insights on the Dicer-independent AGO2-mediated processing of AgoshRNAs. RNA Biol 12:92–100 14. Herrera-Carrillo E, Harwig A, Liu YP, Berkhout B (2014) Probing the shRNA characteristics that hinder Dicer recognition and consequently allow Ago-mediated processing and AgoshRNA activity. RNA 20:1410–1418 15. Cheloufi S, Dos Santos CO, Chong MM, Hannon GJ (2010) A dicer-independent miRNA biogenesis pathway that requires Ago catalysis. Nature 465:584–589 16. Cifuentes D, Xue H, Taylor DW, Patnode H, Mishima Y, Cheloufi S et al (2010) A novel miRNA processing pathway independent of Dicer requires Argonaute2 catalytic activity. Science 328:1694–1698 17. Yang JS, Lai EC (2010) Dicer-independent, Ago2-mediated microRNA biogenesis in vertebrates. Cell Cycle 9:4455–4460 18. Herrera-Carrillo E, Harwig A, Berkhout B (2017) Silencing of HIV-1 by AgoshRNA molecules. Gene Ther 24:453–461 19. Mueller AK, Hammerschmidt-Kamper C, Kaiser A (2014) RNAi in Plasmodium. Curr Pharm Des 20:278–283 20. Baum J, Papenfuss AT, Mair GR, Janse CJ, Vlachou D, Waters AP et al (2009) Molecular genetics and comparative genomics reveal RNAi is not functional in malaria parasites. Nucleic Acids Res 37:3788–3798 21. Gao Z, Herrera-Carrillo E, Berkhout B (2018) Delineation of the exact transcription termination signal for type 3 polymerase III. Mol Ther Nucl Acids 10:36–44 22. Sun G, Yeh SY, Yuan CW, Chiu MJ, Yung BS, Yen Y (2015) Molecular properties, functional mechanisms, and applications of sliced siRNA. Mol Ther Nucleic Acids. 4:e221

252

Ben Berkhout and Elena Herrera-Carrillo

23. Gao Z, Berkhout B, Herrera-Carrillo E (2019) Boosting AgoshRNA activity by optimized 50 -terminal nucleotide selection. RNA Biol 16:890–898 24. Seppen J, Rijnberg M, Cooreman MP, Oude Elferink RP (2002) Lentiviral vectors for efficient transduction of isolated primary quiescent hepatocytes. J Hepatol 36:459–465 25. Zufferey R, Dull T, Mandel RJ, Bukovsky A, Quiroz D, Naldini L et al (1998) Selfinactivating lentivirus vector for safe and efficient in vivo gene delivery. J Virol 72:9873–9880 26. Dull T, Zufferey R, Kelly M, Mandel RJ, Nguyen M, Trono D et al (1998) A thirdgeneration lentivirus vector with a conditional packaging system. J Virol 72:8463–8471 27. Kotsopoulou E, Kim VN, Kingsman AJ, Kingsman SM, Mitrophanous KA (2000) A Rev-independent human immunodeficiency virus type 1 (HIV-1)-based vector that exploits a codon-optimized HIV-1 gag-pol gene. J Virol 74:4839–4852 28. Sutton RE, Reitsma MJ, Uchida N, Brown PO (1999) Transduction of human progenitor hematopoietic stem cells by human immunodeficiency virus type 1-based vectors is cell cycle dependent. J Virol 73:3649–3660 29. Levy C, Amirache F, Girard-Gagnepain A, Frecha C, Roman-Rodriguez FJ, Bernadin O et al (2017) Measles virus envelope pseudotyped lentiviral vectors transduce quiescent human HSCs at an efficiency without precedent. Blood Adv 1:2088–2104

30. Westerhout EM, Ooms M, Vink M, Das AT, Berkhout B (2005) HIV-1 can escape from RNA interference by evolving an alternative structure in its RNA genome. Nucleic Acids Res 33:796–804 31. Peden K, Emerman M, Montagnier L (1991) Changes in growth properties on passage in tissue culture of viruses derived from infectious molecular clones of HIV-1LAI, HIV-1MAL, and HIV-1ELI. Virology 185:661–672 32. Ruijter JM, Thygesen HH, Schoneveld OJ, Das AT, Berkhout B, Lamers WH (2006) Factor correction as a tool to eliminate betweensession variation in replicate experiments: application to molecular biology and retrovirology. Retrovirology 3:1–8 33. Herrera-Carrillo E, Gao Z, Berkhout B (2019) Influence of a 30 terminal ribozyme on AgoshRNA biogenesis and activity. Mol Ther Nucl Acids 16:452–462 34. Das AT, Berkhout B (2010) HIV-1 evolution: frustrating therapies, but disclosing molecular mechanisms. Philos Trans R Soc Lond Ser B Biol Sci 365:1965–1973 35. Eekels JJ, Pasternak AO, Schut AM, Geerts D, Jeeninga RE, Berkhout B (2012) A competitive cell growth assay for the detection of subtle effects of gene transduction on cell proliferation. Gene Ther 19:1058–1064 36. Sastry L, Johnson T, Hobson MJ, Smucker B, Cornetta K (2002) Titering lentiviral vectors: comparison of DNA, RNA and marker expression methods. Gene Ther 9:1155–1162

Chapter 14 Cloning and Detection of Aptamer-Ribozyme Conjugations Ryan P. Goguen, Anne Gatignol, and Robert J. Scarborough Abstract RNA aptamers can be used to target proteins or nucleic acids for therapeutic purposes and are candidates for RNA-mediated gene therapy. Like other small therapeutic RNAs, they can be expressed in cells from DNA templates that include a cellular promoter upstream of the RNA coding sequence. Secondary structures flanking aptamers can be used to enhance the activity or stability of these molecules. Notably, flanking selfcleaving ribozymes to remove extraneous nucleotides included during transcription as well as flanking hairpins to improve RNA stability have been used to increase the effect of therapeutic aptamers. Here we describe the cloning procedure of aptamers containing different flanking secondary structures and methods to compare their expression levels by a northern blot protocol optimized for the detection of small RNA molecules. Key words RNA aptamers, Aptamer-ribozyme conjugations, Northern blot, Overlapping PCR, Small RNAs, Self-cleavage, RNA stability

1

Introduction RNA aptamers have been designed to target proteins or nucleic acids for different therapeutic indications including HIV infection [1], cancer [2], and vascular diseases [3]. For some indications, such as HIV infection [4, 5], it is desirable to engineer cells to continuously express therapeutic aptamers from a gene inserted into the cell’s chromosomes. In those cases, expression of the aptamer is driven by a cellular promoter and includes sequences appended during transcription such as a poly-A tail and 50 cap that may affect the intended activity of the aptamer. Several intentional flanking structures, including ribozymes and hairpins, have been added to the 50 and 30 end of aptamers to remove sequences included during transcription or to improve the activity of the aptamer by altering its stability, respectively. Ribozymes are defined as RNA molecules that catalyze biological reactions. The catalytic property of ribozymes allows for a diverse array of intracellular events to take place, without which life would not exist. This includes but is not limited to

Robert J. Scarborough and Anne Gatignol (eds.), Ribozymes: Methods and Protocols, Methods in Molecular Biology, vol. 2167, https://doi.org/10.1007/978-1-0716-0716-9_14, © Springer Science+Business Media, LLC, part of Springer Nature 2021

253

254

Ryan P. Goguen et al.

protein synthesis through translation by the ribosome [6], selfsplicing introns which participate in RNA splicing [7], and the biogenesis of transfer RNAs (tRNA) by cleaving precursor tRNA molecules [8]. Various types of ribozymes have been identified which participate in these reactions. Each type possesses its own unique three-dimensional molecular structure and mechanism of action. Of particular importance for therapeutic applications are self-cleaving ribozymes. Examples of this specific group of molecules are hammerhead (HH) ribozymes [9, 10], hairpin ribozymes [11, 12], and hepatitis delta virus (HDV) ribozymes [13, 14]. Although naturally self-cleaving, all of these ribozymes have been designed to cleave a target RNA in trans and have been developed as therapies to target pathogenic RNAs [15– 17]. Another application of these ribozymes is to exploit their self-cleaving capabilities to remove extraneous sequences that are included during transcription. For example, the transcription termination signal of RNA polymerase III causes the inclusion of 3’ U nucleotides in transcripts and the HDV ribozyme has been used to remove these nucleotides from Ago short hairpin RNAs (shRNAs) [18] as well as clustered regularly interspaced short palindromic repeats (CRISPR) guide RNAs [19]. Hammerhead ribozymes have also been used to remove both 50 and 30 extraneous sequences from therapeutic RNAs following transcription [20]. In addition to the use of flanking ribozymes for the removal of nucleotides, hairpins have also been used to increase stability. As with other RNA therapies, such as shRNAs [21] and U1 interference (U1i) RNAs [22], several different formats and expression strategies for therapeutic aptamers need to be evaluated to identify the most effective design for any given target. Here we present methods that we have used to generate plasmids expressing a previously described anti-HIV aptamer, RNApt16 [23], from an RNA polymerase III promoter with different flanking hairpins and ribozymes. Some of the cloning methods are adapted from a previously described methodology by Rosen and Dillon [24]. The different aptamer constructs we describe are illustrated in Fig. 1 and the procedures can be used to express any aptamer with different flanking structures. We also describe a northern blot protocol, adapted from methodology previously described by Pall and Hamilton [25], to evaluate the cleavage efficiency of flanking ribozymes. This northern blot protocol is described in depth since distinctive steps must be carried out when detecting small RNAs. Using this protocol, it is possible to detect clear bands of the RNApt16 and its conjugations of sizes ranging from 16 to 50 nucleotides with minimal residual background signal (Fig. 3).

Aptamer-Ribozyme Conjugations

A

255

3’ 5’ HH 3’HDV

5’

3’

B 3’ HDV

5’

C HP

D

3’

5’

No flanking structures

5’

3’

Fig. 1 Schematic representation of secondary structures flanking the aptamer RNApt16. The RNApt16 molecule is depicted in red with either flanking 50 HH and 30 HDV ribozymes (a), 30 HDV ribozyme (b), flanking hairpins (c), or no flanking structures (d)

2

Materials

2.1 Vector Construction 2.1.1 Synthesis of DNA Fragments by Overlapping Polymerase Chain Reaction (PCR)

1. Design and synthesize the four following DNA oligonucleotides to construct aptamers with flanking 50 HH and 30 HDV ribozymes (Fig. 1a), where (X) is the complement of (N). N and X represent the nucleotides in the sense and antisense sequence of the aptamer, respectively (see Note 1): (A) HH aptamer oligonucleotide: GCGGCCGCGCCGGGG CTGATGAGTCCGTGAGGACGAAACGGTACCCGG TACCGTC(N). . .n. (B) HDV aptamer oligonucleotide: AAAGTCCCATTCGCCATGCCGAAGCATGTTGCCCAGCCGGCGCCAGCGAGGAGGCTGGGACCATGCCGGCC(X). . .x. (C) Flanking forward: GAGTTCACGGAAGACCGACCT CGCGGCCGCGCCGGG. (D) Flanking reverse: TGATGCTATGAAGACTCCAAAAAAAAGTCCCATTCGCCA. 2. Taq polymerase 2 master mix. 3. PCR purification kit. 4. Gel extraction kit. 5. BbsI restriction enzyme and enzyme buffer.

256

Ryan P. Goguen et al.

6. 50 TAE: Dissolve 242 g of Tris in 500 mL water followed by adding 100 mL of 0.5 M Na2EDTA (pH 8.0) as well as 57.1 mL of glacial acetic acid. Finally, adjust with water the volume of the solution to 1 L. 7. Agarose gel: Add 1 g of agarose to 100 mL of 1 TAE and microwave until the agarose is dissolved. Add 10 μL of nucleic acid stain (i.e., RedSafe) immediately before casting the gel. 8. Sterile water. 2.1.2 Synthesis of DNA Fragments by Annealing

1. Design and synthesize the appropriate DNA oligonucleotides, where (X) is the complement of (N). N and X represent the nucleotides in the sense and antisense sequence of the aptamer, respectively (see Note 2). To synthesize aptamers with a 30 HDV ribozyme (Fig. 1b), use the oligonucleotides listed below: (E) 30 HDV ribozyme aptamer forward oligonucleotide: ACCTC (Nn)GGCCGGCATGGTCCCAGCCTCCTCGCTGGCGC CGGCTGGGCAACATGCTTCGGCATGGCGAATGGGA CTTT. (F) 30 HDV ribozyme aptamer reverse oligonucleotide: CAAAAAAGTCCCATTCGCCATGCCGAAGCATGTT GCCCAGCCGGCGCCAGCGAGGAGGCTGGGACCAT GCCGGCC(Xn)G. To synthesize aptamers with flanking hairpins (Fig. 1c), use the oligonucleotides listed below: (G) HP aptamer forward oligonucleotide: ACCTCGTGCTCGC TTCGGCAGCACATATACATGAATTC(Nn)GGGCCC AGAGCGGACTTCGGTCCGCTTT. (H) HP aptamer reverse oligonucleotide: CAAAAAAGCGGACC GAAGTCCGCTCTGGGCCC(Xn)GAATTCATGTATATGTGCTGCCGAAGCGAGCACG. To synthesize aptamers without flanking constructs (Fig. 1d), use the oligonucleotides listed below: (I) Aptamer no construct forward oligonucleotide: ACCTC(Nn) TTT. (J) Aptamer no construct reverse oligonucleotide: CAAAAAA (Xn)G. 2. 5 M sodium chloride (NaCl). 3. Sterile water.

2.1.3 Construction of Expression Vector

1. psiRNA-7SKGFP::Zeo (InVivogen). 2. BbsI restriction enzyme and buffer. 3. Gel extraction kit. 4. T4 DNA ligase and buffer.

Aptamer-Ribozyme Conjugations

257

5. Subcloning efficiency DH5α chemically competent cells. 6. Super optimal broth with catabolite repression (SOC) medium. 7. Zeocin/X-Gal/IPTG agar plate: Add 62.5 μL Zeocin to melted agar, spread 40 μL 5-bromo-4-chloro-3-indolyl-β-Dgalactopyranoside (X-Gal) (20 μg/μL) and 40 μL Isopropyl β-D-1-thiogalactopyranoside (IPTG) (0.1 M) onto agar once solidified. 8. DNA plasmid miniprep kit. 9. DNA plasmid maxi kit. 10. Sterile water. 2.2 Recovering RNA Transcripts from Constructed Expression Vectors

1. TransIT-LT1 (Mirus). 2. Opti-MEM. 3. TRIzol reagent or similar. 4. Chloroform. 5. Small RNA cleanup kit.

2.3 Northern Blot for the Detection of Small RNAs

1. Acrylamide/bis solution 19:1.

2.3.1 Separation of RNA Using Gel Electrophoresis

4. 10% Ammonium persulfate (APS).

2. Urea. 3. 10 3-(N-morpholino)propanesulfonic acid (MOPS). 5. Tetramethylethylenediamine (TEMED). 6. Gel loading buffer: 95% formamide, 18 mM EDTA, 0.025% SDS, xylene cyanol, and bromophenol blue. 7. RNase-free water. 8. 2% Sodium dodecyl sulfate (SDS).

2.3.2 Quality Check of RNA Samples

1. RedSafe nucleic acid staining solution. 2. 10 MOPS. 3. RNase-free water. 4. 2% SDS.

2.3.3 RNA Transfer to Nylon Membrane

1. Neutral nylon membrane (i.e., Hybond-N). 2. Whatman paper. 3. RNase-free water.

2.3.4 Cross-Linking with EDC

1. Whatman paper. 2. 1-Methylimidazole. 3. 1-Ethyl-3-3(3-dimethylaminopropyl) carbodiimide (EDC). 4. Hydrochloric acid (HCl).

258

Ryan P. Goguen et al.

5. RNase-free water. 6. Plastic wrap. 2.3.5 Probing of Northern Blot

1. Design and synthesize a DNA oligonucleotide of ~20 nucleotides which is complementary (antisense) to the RNA molecule to be visualized, this will serve as the detection probe. 2. 20 Saline-sodium citrate (SSC): 3 M sodium chloride, 300 mM trisodium citrate, adjusted to pH 7 with HCl. 3. 2% SDS. 4. 50 Denhardt’s solution: 1% ficoll (type 400), 1% polyvinylpyrrolidone, and 1% bovine serum albumin. 5. Pre/Hybridization buffer: 6 SSC, 2 Denhardt’s solution and 0.1% SDS. 6. RNase-free water. 7. γ[32P] ATP (800 Ci/mmol, 10 mCi/mL). 8. T4 polynucleotide kinase (PNK) enzyme and enzyme buffer. 9. Purification columns kit for the removal of unincorporated nucleotides from DNA labeling reactions.

2.3.6 Detection and Visualization

1. 20 SSC. 2. RNase-free water. 3. X-Ray films. 4. 2% SDS.

3

Methods

3.1 Vector Construction 3.1.1 Synthesis of DNA Fragments by Overlapping PCR

1. Prepare the following PCR mixture to generate the desired template DNA: 25 μL of Taq 2 master mix, 5 μL of 0.1 μg/ μL (0.5 μg) each of oligonucleotide A and B, and sterile water to adjust the total volume to 50 μL. 2. Set up the following PCR program to generate template DNA: 94  C, 5 min; (94  C, 1 min; 55  C, 1 min; 72  C, 1 min)10; 72  C, 5 min. 3. Prepare the following PCR mixture to amplify the template DNA: 25 μL of Taq 2 master mix, 1 μL of the first PCR solution to act as template, 5 μL of 0.2 μg/μL (1 μg) each of oligonucleotides C and D, and sterile water to adjust the total volume to 50 μL. 4. Set up the following PCR program to amplify template DNA: 94  C, 5 min; (94  C, 1 min; 55  C, 1 min; 72  C, 1 min)25; 72  C, 5 min. (see Note 3).

Aptamer-Ribozyme Conjugations

259

5. Use a PCR purification kit to purify the generated DNA fragments from the second PCR by removing all other components of the PCR solution. 6. Digest the BbsI restriction sites of the purified DNA fragments with the following mixture: 30 μL PCR purification product, 3 μL BbsI enzyme, 5 μL 10 BbsI enzyme buffer, and 12 μL sterile water. Incubate the digestion mixture at 37  C for 60 min. 7. To remove the other components of the digestion mixtures, migrate the BbsI-digested PCR amplified fragments in an agarose gel by electrophoresis. Visualize the corresponding band under UV to cut out the gel slice which contains the DNA and use gel extraction kit to purify the DNA band. 3.1.2 Synthesis of DNA Fragments by Annealing

1. Prepare the following mixture: 5 μL of 10 μM each of oligonucleotides combination E and F; G and H; or I and J, 6 μL of 0.5 M NaCl, and 24 μL sterile water. 2. Incubate the mixture at 80  C for 2 min and allow the mixture to cool gradually until 37  C.

3.1.3 Construction of Expression Vector

1. Digest 15 μg of psiRNA-7SKGFP::Zeo with the following mixture: 15 μL psiRNA-7SKGFP::Zeo (1000 ng/μL), 4 μL BbsI, and 2 μL 10 BbsI enzyme buffer. Incubate the digestion mixture at 37  C for 60 min. 2. Migrate the BbsI-digested psiRNA-7SKGFP::Zeo plasmid in an agarose gel by electrophoresis. Visualize the corresponding band under UV to cut out the gel slice which contains the largest fragment of digested plasmid DNA and use a gel extraction kit to purify the DNA band. 3. Ligate the gel purified DNA fragments into gel purified BbsIdigested psiRNA-7SKGFP::Zeo by preparing the following mixture: 100 ng DNA fragment, 100 ng BbsI-digested psiRNA-7SKGFP::Zeo, 1 μL T4 DNA ligase, 2 μL 5 T4 DNA ligase buffer, and sterile water to adjust the volume to 10 μL. Incubate the mixture at room temperature for 60 min. 4. Begin transforming the ligated plasmid into subcloning efficiency DH5α chemically competent cells by mixing the psiRNA-7SKGFP::Zeo ligation reaction with 40 μL of DH5α chemically competent cells. 5. Place the transformation tube on ice for 30 min followed by heat shocking the bacteria by placing the tube at 42  C for 30 s. After the heat shock, place the tube on ice again for 2 min. 6. Add 360 μL of SOC medium to the tube and incubate for 1 h at 37  C with agitation. 7. Spread the transformed cells onto a Zeocin/X-Gal/IPTG agar plate to ensure selection of the plasmid. Incubate the plate

260

Ryan P. Goguen et al.

overnight at 37  C. Colonies growing on the plate will be white if their plasmid contains the ligated DNA fragment and will be blue if their plasmid does not contain the ligated DNA fragment. 8. Set up a bacteria mini-culture with a white colony from the Zeocin/X-Gal/IPTG agar plate and incubate the mini-culture overnight at 37  C with agitation. Use a miniprep kit to isolate a plasmid DNA sample from the mini-culture and sequence this sample to ensure that the Taq polymerase did not generate nucleotide errors during the PCR protocols. 9. Using subcloning efficiency DH5α chemically competent cells containing the sequence confirmed plasmid DNA, set up a bacteria culture and incubate the culture overnight at 37  C with agitation. Use a plasmid maxi kit to isolate a large amount of the plasmid for further experiments (see Note 4). 3.2 Recovering RNA Transcripts from Constructed Expression Vectors

1. Seed 3.5  106 HEK 293 T cells in 10 cm2 cell culture dish, incubate cells for 24 h at 37  C, 5% CO2. 2. Prepare 5 μg of plasmid DNA in 250 μL sterile water, add 15 μL TransIT-LT1 and 235 μL Opti-MEM. Let the mix sit for 15 min to allow the TransIT-LT1 and plasmid DNA to complex sufficiently. Add the solution dropwise over the cells and swirl the dishes to mix. 3. 48 h after transfection, isolate the RNA by resuspending cells in TRIzol reagent. Add 200 μL of chloroform for every 1 mL of TRIzol reagent, and vigorously shake the tubes to properly mix the TRIzol reagent and chloroform. 4. Spin the TRIzol/chloroform-treated cells at 12,000  g for 15 min and purify the RNA within the aqueous phase using a small RNA cleanup kit.

3.3 Northern Blot for the Detection of Small RNAs 3.3.1 Separation of RNA Using Gel Electrophoresis

1. Clean all instruments used during gel electrophoresis with 2% SDS, including the electrophoresis bucket and all pieces used to hold the gel during its solidification. Also, clean glass plates with 70% ethanol afterwards (see Note 5). 2. Prepare the 15% acrylamide gel with the following mixture: 11.25 mL 40% acrylamide/bis solution 19:1, 12.6 g urea, 3 mL 10 MOPS, and RNase-free water to adjust the volume to 30 mL. Once the urea has dissolved into the mixture, add 180 μL 10% APS and 10.5 μL TEMED (see Note 6). Immediately pour this mixture between the glass plates (see Note 7). Wrap the solidified gel in RNase-free water-soaked plastic wrap to avoid gel desiccation and leave gel to set overnight at 4  C. 3. Fill the electrophoresis bucket with 1 MOPS running buffer until the wells of the gel are completely submerged and pre-run the gel at 90 V for at least 10 min.

Aptamer-Ribozyme Conjugations

261

4. Prepare the RNA samples by mixing 15 μg of RNA with an equal volume of gel loading buffer and heat these samples at 95  C for 4 min followed by chilling on ice (see Note 8). 5. Prior to loading the RNA samples into the gel wells, flush out the urea that accumulates at the bottom of the wells during the pre-run by pipetting small amounts of running buffer into the well. 6. Load the RNA samples into the gel wells, and run the gel at 90 V (see Note 9). 3.3.2 Quality Check of RNA Samples

1. Disassemble the gel apparatus and place the gel in a solution of freshly prepared 1 MOPS running buffer and nucleic acid stain for 10 min in a shaker. 2. Visualize the RNA with an ultraviolet lamp to assess the condition of the sample after gel electrophoresis, and ensure that all surface areas are cleaned with 2% SDS. An aggregate of bands should be visible near the top of the gel which include the 5S and 5.8S ribosomal RNAs (rRNA) and tRNAs (Fig. 2). A smear along the top of the gel instead of discrete bands may indicate the occurrence of degradation of the RNA sample. This image can also be used to confirm equal loading of total RNA between different lanes. 3. Place the gel in RNase-free water in a shaker for 5 min. Repeat three times, replacing the RNase-free water every 5 min.

1

2

3

4

5.8S rRNA 5S rRNA

tRNAs

Fig. 2 Redsafe stain for quality check of RNA. RNA was migrated in a 15% polyacrylamide-urea gel, stained with Redsafe and visualized with a UV lamp. Total RNA harvested from HEK293T cells following transfection with the aptamer RNApt16 without flanking structures (lane 1), RNApt16 with 30 HDV ribozyme (lane 2), RNApt16 with 50 HH and 30 HDV ribozyme (lane 3), or RNApt16 with flanking HPs (lane 4) is shown. Prominent bands include the 5.8S and 5S ribosomal (r) RNAs and transfer RNAs (tRNAs)

262

Ryan P. Goguen et al.

3.3.3 RNA Transfer to Nylon Membrane

1. Cut out pieces of neutral nylon membrane and Whatman paper, using a 10  8.2 cm2 glass plate as a measurement for proper size so that both the membrane and Whatman paper completely cover the gel. Prewet the membrane with RNasefree water (see Note 10). 2. Place three water-soaked Whatman papers onto the positive electrode of a semi-dry electroblotter. Place the cut segment of nylon membrane onto the Whatman paper, followed by the gel on top of the membrane. Finally, place another three watersoaked Whatman paper over the gel. With each layer added to the transfer stack, roll out bubbles. 3. Transfer RNA to the nylon membrane by applying 20 V for 40 min with the electroblotter (see Note 11). Carry out the transfer in a cold room or on ice to minimize RNA degradation from overheating (see Note 12). 4. Once the transfer is complete, disassemble the electroblotter and the transfer stack to remove the nylon membrane from the whole transfer unit. Avoid any contact with the side of the membrane containing the RNA samples.

3.3.4 Cross-Linking with EDC

1. Prepare cross-linking EDC reagent by adding 1.225 μL of stock 12.5 M 1-methylimidazole to 45 mL RNase-free water, followed by adjusting the pH of the solution to 8.0 with 1 M HCl (see Note 13). Immediately prior to cross-linking the RNA present on the nylon membrane, add 0.735 g EDC to 9 mL of the prepared 1-methylimidazole solution and adjust the total volume to 24 mL with RNase-free water. 2. Place a Whatman paper in a container and pour freshly prepared cross-linking EDC reagent and deposit the nylon membrane on top of the Whatman paper with the RNA side facing upwards (see Note 14). 3. Wrap the entire container in plastic wrap to avoid evaporation of cross-linking EDC reagent, and incubate at 60  C for 80 min (see Note 15). 4. Once cross-linking is complete, rinse the nylon membrane with RNase-free water. At this point, the membrane can be placed between a plastic page protector and stored at 80  C for later use.

3.3.5 Probing of Northern Blot

1. Prepare prehybridization buffer with a final concentration of 6 SSC, 2 Denhardt’s solution and 0.1% SDS. 2. Place the nylon membrane in a glass cylindrical bottle and pour prehybridization buffer until the entire membrane is submerged in buffer. Prehybridize the membrane by incubating with rotation at 37  C for at least 2 h.

Aptamer-Ribozyme Conjugations

263

3. Prepare the following mixture to radioactively label the oligonucleotide DNA probe: 30 pmol DNA probe, 20 pmol γ[32P] ATP, 2 μL 10 PNK buffer, 10 U PNK enzyme, top up volume to 20 μL with RNase-free water (see Note 16). 4. Incubate the mixture at 37  C for 1 h. Following the incubation, add 1 μL of 0.5 M EDTA and incubate at 75  C for 10 min. 5. Remove unincorporated nucleotides from the DNA labeling reaction using purification columns. Determine the counts per minute (cpm)/μL of the labeled probe following purification using a liquid scintillation counter to measure the cpm of 2 μL of probe. 6. Boil the probe at 100  C for 5 min, followed by snap cooling on ice. 7. Replace the prehybridization buffer with freshly prepared hybridization buffer of identical composition. Add an appropriate amount of radioactive labeled probe to achieve a probe concentration of 106 cpm/mL. Hybridize the membrane by incubating with rotation overnight at 37  C. 3.3.6 Detection and Visualization

1. Remove the radioactive hybridization buffer, and dispose appropriately of the radioactive waste. 2. Wash the nylon membrane with a set of three 15 min washes, each incubated at 37  C with rotation using the following wash solutions (see Note 17): (a) 2 SSC (b) 1 SSC (c) 0.1 SSC. 3. Place the membrane between a plastic page protector or any other storage device that is RNase-free to protect the membrane and expose it to an X-ray film for 3–7 days at 80  C in a radiation protected cassette, the exposure time varying based on the desired level of intensity of the visualized bands. 4. Develop the X-ray film to visualize the bands. A single band should appear for the aptamer expressed without secondary structures as well as for the aptamer with flanking hairpins. 2–3 bands should appear for the aptamer with flanking ribozymes, depending on the cleavage efficiency of the ribozymes (Fig. 3). 5. After visualization of the bands, it is possible to strip the radioactive probe from the nylon membrane. This is useful for when the detection of a secondary band (such as the 5S rRNA for loading control) is desired or when visualization of the bands on the X-ray film is not satisfactory, which can be resolved by altering the stringency. To strip probes from the nylon membrane, incubate at 80  C with rotation for 20 min with a wash solution composed of 0.1 SSC/0.1% SDS. After stripping, probe the northern blot as previously described.

264

Ryan P. Goguen et al.

A

1

2

3

4

B

5’ 5’

5’

5’

3’

1 ~21 nt

3’

2

3’

3

3’

4

~21 nt

Fig. 3 Visualization of the aptamer RNApt16 with flanking secondary structures. RNA harvested from RNApt16 transfected HEK293T cells was migrated in a 15% polyacrylamide-urea gel. RNApt16 was detected with a 32 P-labeled DNA probe consisting of the sequence CCCCTCCTTGCCGGGG. Band sizes were estimated from a synthetic siRNA of known length, which was also subjected to northern blot to be used as a marker. Migration patterns are shown for RNApt16 without flanking structures (lane 1), RNApt16 with 30 HDV ribozyme (lane 2), RNApt16 with 50 HH and 30 HDV ribozymes (lane 3), as well as RNApt16 with flanking HPs (lane 4). Both a low exposure (a) and high exposure (b) film is shown. Schematic representations of the molecules are shown above each lane of the high exposure film. Faint bands of sizes smaller than 21 nucleotides can be seen in lanes 2 and 3, representing the aptamer RNApt16 following cleavage from the flanking ribozymes

4

Notes 1. Oligonucleotides A and B should be of lengths of 60–120 nucleotides and should have overlaps of 15–30 nucleotides. The oligonucleotides must span the entire length of both the ribozymes and the aptamer, if this is not possible then an additional two oligonucleotides must be designed and synthesized with appropriate overlaps. 2. Synthesis of DNA fragments by annealing is quicker and easier but is not ideal if oligonucleotides larger than 100 bp are necessary to generate the desired DNA fragments. This is because of the large cost imposed by manufacturers to produce oligonucleotides larger than 100 bp. In this case, synthesis of the desired DNA fragments by overlapping PCR is preferable as a set of smaller oligonucleotides (