Recent Advancements in Microbial Diversity [1 ed.] 0128212659, 9780128212653

Citation preview

Recent Advancements in Microbial Diversity

Edited by

Surajit De Mandal Pankaj Bhatt

Academic Press is an imprint of Elsevier 125 London Wall, London EC2Y 5AS, United Kingdom 525 B Street, Suite 1650, San Diego, CA 92101, United States 50 Hampshire Street, 5th Floor, Cambridge, MA 02139, United States The Boulevard, Langford Lane, Kidlington, Oxford OX5 1GB, United Kingdom Copyright © 2020 Elsevier Inc. All rights reserved. No part of this publication may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopying, recording, or any information storage and retrieval system, without permission in writing from the publisher. Details on how to seek permission, further information about the Publisher’s permissions policies and our arrangements with organizations such as the Copyright Clearance Center and the Copyright Licensing Agency, can be found at our website: www.elsevier.com/permissions. This book and the individual contributions contained in it are protected under copyright by the Publisher (other than as may be noted herein). Notices Knowledge and best practice in this field are constantly changing. As new research and experience broaden our understanding, changes in research methods, professional practices, or medical treatment may become necessary. Practitioners and researchers must always rely on their own experience and knowledge in evaluating and using any information, methods, compounds, or experiments described herein. In using such information or methods they should be mindful of their own safety and the safety of others, including parties for whom they have a professional responsibility. To the fullest extent of the law, neither the Publisher nor the authors, contributors, or editors, assume any liability for any injury and/or damage to persons or property as a matter of products liability, negligence or otherwise, or from any use or operation of any methods, products, instructions, or ideas contained in the material herein. Library of Congress Cataloging-in-Publication Data A catalog record for this book is available from the Library of Congress British Library Cataloguing-in-Publication Data A catalogue record for this book is available from the British Library ISBN: 978-0-12-821265-3 For information on all Academic Press publications visit our website at https://www.elsevier.com/books-and-journals

Publisher: Andre Gerhard Wolff Acquisitions Editor: Linda Versteeg-buschman Editorial Project Manager: Mona Zahir Production Project Manager: Sreejith Viswanathan Designer: Miles Hitchens Typeset by Thomson Digital

Contents Contributorsxvii

  1. Biodiversity of microbial life: Indian Himalayan region Khushboo Dasauni and Tapan Kumar Nailwal

1. Introduction 1 2. Microbial diversity of IHR region 2 2.1. Distribution and types 2 2.2. Conditions 3 2.3. Importance 3 3. Indian Himalayan region (IHR): psychrophilic microorganisms 5 3.1. Habitat 5 3.2. Taxonomy of psychrophiles 5 4. Applications of psychrophilic microbes 7 5. Diversity of aquatic microorganisms in IHR 10 6. Challenges for micro-diversity conservation 10 7. Factors responsible for functioning of ecosystem of Indian Himalaya 11 8. Conclusion and future vision 13 References 13

  2. Microbial endophytes of plants: diversity, benefits, and their interaction with host Anwesha Gohain, Chowlani Manpoong, Boppa Linggi, Ratul Saikia and Surajit De Mandal

1. Introduction 19 2. Isolation of endophytes 20 3. Biodiversity of endophytic microorganism 20 4. Plant-microbe interactions and benefits to the plant 22 4.1. Phytostimulation 24 4.2. Pigment production 24 4.3. Endophytes as a source of bioactive and novel compounds 25 4.4. Enzyme production 28 4.5. Role of endophytes in the field of biodegradation/ bioremediation 28 4.6. Endophytes with multiple roles 29 5. Conclusion 29 References 29

v

vi

Contents

  3. A spotlight on the recent advances in bacterial plant diseases and their footprint on crop production

Tushar Joshi, Priyanka Sharma, Tanuja Joshi, Satish Chandra Pandey, Veni Pande, Anupam Pandey, Diksha Joshi, Priyanka Maiti, Mahesha Nand and Subhash Chandra 1. Introduction 37 2. Bacterial communities 39 2.1. Bacterial community association 39 3. Mechanisms of bacterial plant disease 45 3.1. Overview of bacterial virulence factors 46 4. Impact of bacterial disease in crop production 47 4.1. Impact of bacterial disease on vegetables 49 4.2. Impact of bacterial disease on cereal crops 50 4.3. Impact of bacterial disease on Pulses 51 4.4. Impact of bacterial disease on fruits 51 5. Bacterial disease detection methods 52 5.1. Direct methods 53 5.2. Indirect methods 54 5.3. Computational techniques 54 6. Bacterial disease management and resistance 55 6.1. Use of copper and antibiotics 55 6.2. Biocontrol 57 6.3. Antimicrobial peptides, SAR and induced systemic resistance (ISR) 57 7. Recent techniques to overcome plant diseases 58 7.1. Gene transfer 59 7.2. Transcriptomics 59 7.3. Genome editing 59 7.4. RNA interference 60 7.5. Proteomics 60 7.6. Metabolomics 61 7.7. Tissue culture as an approach for managing plant diseases 61 8. Conclusion 62 References 62

  4. Bacterial diseases of banana: detection, characterization, and control management Thangjam Premabati and Surajit De Mandal

1. Background 71 2. Bacterial diseases of banana 71 3. Isolation and identification of the causal bacterial agents of the diseased banana 77 4. Control management 78 4.1. Before planting 78 4.2. During growth 78 4.3. Chemical control 81 4.4. Biological control 81 References 81

Contents

vii

  5. Toward an enhanced understanding of plant growth promoting microbes for sustainable agriculture

Diksha Sati, Satish Chandra Pandey, Veni Pande, Shobha Upreti, Vinita Gouri, Tushar Joshi, Saurabh Gangola, Prasenjit Debbarma, Anupam Pandey and Mukesh Samant 1. Introduction 87 2. Microbial communities 88 2.1. Plant growth promoting rhizobacteria (PGPR) 88 2.2. Plant growth-promoting fungi 90 2.3. Plant growth promoting algae 93 2.4. Plant growth promoting protozoa 94 3. Mechanistic approach of various PGPMs 94 3.1. Siderophore production 94 3.2. Phosphate solubilization 97 3.3. Phyto-hormone production 98 3.4. Biological nitrogen fixation (BNF) 101 3.5. Ammonia and hydrogen cyanide production 101 3.6. Antibiotics and lytic enzymes 102 3.7. Competition 102 4. Applications of PGPMs 102 4.1. As biofertilizers: for sustainable agriculture 102 4.2. As soil fertility enhancers 103 4.3. As phytoextractors and bioremediators 103 4.4. As biofortifying agents: improving food quality 104 4.5. As stress managers 104 4.6. As phytostimulators 105 4.7. As disease control agent 105 5. Conclusion 105 References 106

  6. Multifaceted beneficial effects of plant growth promoting bacteria and rhizobium on legume production in hill agriculture Anupam Pandey, Priyanka H. Tripathi, Satish Chandra Pandey and Tushar Joshi

1. Introduction 113 2. Rhizobium-legume symbiotic relationship 115 3. Rhizobium-legume symbiosis: mechanism 117 4. Legume–rhizobium interaction: advantages to non-legumes 118 5. PGPR and its effect on rhizobial-legume interaction 119 6. Effect of PGPRs on rhizobial- legume interaction 119 7. Establishment of additional infection sites 128 8. Release of plant growth-promoting substances 129 9. Biological nitrogen fixation (BNF) 130 10. Decreasing ethylene level (ACC deaminase) 132 11. Nutrient solubilisation and its uptake by plants 133 12. Siderophore production 134

viii

Contents

13. Biological control 135 14. Improved water-use efficiency 136 15. Conclusion 137 16. Future perspectives 138 References 138

  7. Role of rhizospheric microbial diversity in plant growth promotion in maintaining the sustainable agrosystem at high altitude regions Jyoti Rawat, Nirmal Yadav and Veena Pande

1. Introduction 147 2. Microbial diversity at high altitude regions 149 3. Microbial adaptations in cold high altitude regions 152 3.1. Mechanisms involved in the endurance of cold 152 4. Plant-microbes (PM) interaction 155 5. The role of rhizosphere microorganisms in hilly agricultural area 156 6. Enhancement of growth and yield of crops grown in hilly areas 157 7. Mechanisms involved in plant growth promotions 159 7.1. Biological nitrogen fixation 160 7.2. Phosphate, potassium and zinc solubilization 168 7.3. Phytohormone production (IAA production) 169 7.4. ACC deaminase activity 170 7.5. Siderophore 171 7.6. Biocontrol activity 172 7.7. HCN production 173 8. Biofertilizers as a tool for sustainable agriculture 173 9. Use of carriers for biofertilizers production 174 10. Liquid bio-inoculums as biofertilizers 176 11. The current status of effectiveness of bioinoculants developed from native PGPM 177 12. Conclusion 179 References 179

  8. Microbes adapted to cold and their use as biofertilizers for mountainous regions Geeta Bhandari

1. Introduction 197 2. Mechanism of plant growth promotion at low temperature 201 2.1. Phytostimulation and production of phytohormones 201 2.2. Siderophore production 203 2.3. Phosphate solubilization 204 2.4. Nitrogen fixation 206 2.5. Ice– bacteria for frost management 207 3. Conclusion 208 References 209

Contents

ix

  9. Actinobacteria: diversity and biotechnological applications Anwesha Gohain, Chowlani Manpoong, Ratul Saikia and Surajit De Mandal

1. Introduction 217 2. Occurrence and habitats 217 2.1. Soil habitat 218 2.2. Plant habitat 218 2.3. Marine habitat 218 3. Diversity of actinobacteria 219 4. Biotechnology and importance of actinobacteria 219 5. Actinobacteria as a source of natural products 222 5.1. As a source of antibiotics 220 5.2. As a source of insecticides 222 5.3. As a source of bioherbicide and bioinsecticide agents 223 5.4. As a source of antifungal and antibacterial agents 223 5.5. Immunomodifers 223 6. Actinobacteria as a source of enzymes 223 6.1. Amylase 224 6.2. Cellulase 224 6.3. Xylanases 225 6.4. Pectinases 225 6.5. Proteases 225 6.6. Chitinases 225 7. Other aspects of actinomycetes having biotechnological applications 226 8. Conclusion 226 References 227

10. Quorum sensing: the microbial linguistic Vikas Kumar and Jyoti Rawat

1. The world of microbes 233 2. Overview of Quorum sensing: social engagement of microbes 235 3. Mechanism of Quorum sensing 236 3.1. Quorum sensing in Gram-negative bacteria 238 3.2. Quorum sensing in Gram-positive bacteria 239 4. Biofilm: a shield against the challenging environment 239 4.1. What are biofilms? 239 4.2. How many archaea and bacteria live in biofilms? 240 4.3. Archaeal biofilm production 241 5. Applications of Quorum sensing 242 5.1. Engineered QS system 243 5.2. Biosensor 243 5.3. Pathogen diagnostics and therapeutics 244 5.4. Biocontrol 245 5.5. Prevention of biofouling 245 5.6. Biofilm in wastewater treatment 245 6. Conclusion 246 References 246

x

Contents

11. Exploration of microbial communities of Indian hot springs and their potential biotechnological applications Sneha Bhandari and Tapan Kumar Nailwal

1. Introduction 251 2. Hot springs: formation and distribution 252 2.1. Formation 252 2.2. Distribution 253 3. India: a hot spring hub 255 4. Microbial diversity of Indian hot springs 257 4.1. Microbial diversity analysis via culture-dependent method from Indian hot springs 258 4.2. Microbial diversity analysis via culture-independent method from Indian hot springs 260 5. Biotechnological applications of thermophiles 269 6. Conclusion 278 References 279

12. Microbial diversity and functional potential in wetland ecosystems Surajit De Mandal, Folguni Laskar, Amrita Kumari Panda and Rojita Mishra

1. Introduction 289 2. Microbial communities in wetland 292 2.1. Techniques to analysis the microbial communities in wetland 292 2.2. Microbial diversity in wetland 294 3. Biogeochemical transformations driven by microbes in wetlands 299 3.1. Methanogenesis in sediments of wetland 299 3.2. Methane oxidation 300 3.3. Sulfate cycle in wetland 301 3.4. Metal reduction 302 3.5. Denitrification 302 3.6. Fermentation 303 3.7. Role of phosphate solubilising bacteria in wetland 303 4. Conclusion 305 Reference 306

13. Effect of climate change on microbial diversity and its functional attributes

Pankaj Kumar Jain, Sumi Das Purkayastha, Surajit De Mandal, Ajit Kumar Passari and Rasiravathanahalli Kaveriyappan Govindarajan 1. Introduction 315 2. Climate change and its causes 316 3. Impacts of climate changes on microbial diversity 318 3.1. Terrestrial biome 319

Contents

xi

3.2. Aquatic ecosystem 322 4. Conclusion 325 References 326

14. Spatial variation of the microbial diversity in the mangrove dominated Sundarban Forest of India Tapti Sengupta and Abhijit Mitra

1. Indian Sundarbans at a glance 333 2. Physiography of the area 334 3. Microbial diversities in Sundarban Biosphere Reserve (SBR) 336 4. Study approach 336 5. Results 338 6. Discussion 342 7. Future prospective 348 References 348

15. Microbe assisted plant stress management

Purva Dubey, Vinay Kumar, Karthika Ponnusamy, Rajendra Sonwani, Anup Kumar Singh, Deep Chandra Suyal and Ravindra Soni 1. Introduction 351 1.1. Salt stress 351 1.2. Drought stress 354 1.3. Flooding 355 1.4. Nutrient stress 355 1.5. Metal and other contaminants 356 2. Fungi for mitigation of plant abiotic stress 358 3. Microbes in mitigating biotic stresses 358 4. Mechanisms of plant stress management through microbes 359 4.1. Plant stress and ethylene 360 4.2. Cellular level adaptation in microbes for abiotic stress 361 5. Conclusion 364 References 365

16. Insect gut microbiome and its applications

Sathya Narayanan Govindarajulu, Krishnapriya M. Varier, Dheepthi Jayamurali, Wuling Liu, Juan Chen, Nivedita Manoharan, Yanmei Li and Babu Gajendran 1. Introduction 379 2. Structure of insect gut 380 3. The gut as a medium for microbial colonization 380 4. Insect gut symbionts 381 5. Role of insect symbiotic microbiota 381 6. Methods to investigate insect gut microbiome 381 6.1. Metagenomics strategies 382 7. The microbiome of common insects gut 383 7.1. Cockroach 383

xii

Contents

7.2. Nematodes 385 7.3. Aphids 386 8. Applications of insect gut microbiome 388 8.1. Cellulose and xylan hydrolysis 388 8.2. Signal mimics 388 8.3. Vitamin production 388 8.4. Nitrogen fixation and phenolics metabolism 389 9. Conclusion 389 References 390

17. Diversity and the antimicrobial activity of vaginal lactobacilli: current status and future prospective Sumi Das Purkayastha, Mrinal K. Bhattacharya, Himanshu K. Prasad and Surajit De Mandal

1. Introduction 397 2. Normal vaginal flora 400 3. Diversity in lactic acid bacteria (LAB) 401 3.1. The genus Aerococcus 403 3.2. The genus Carnobacterium 403 3.3. The genus Enterococcus 404 3.4. The genus Lactobacillus 405 3.5. The genus Lactococcus 405 3.6. The genus Leuconostoc 405 3.7. The genus Pediococcus 406 3.8. The genus Streptococcus 406 3.9. The genus Bifidobacterium 406 3.10. Glycogen metabolism by vaginal Lactobacillus 407 4. Influence of age on vaginal microbiota 407 5. Defense mechanism by LAB 409 5.1. Bacteriocins 409 5.2. Probiotic nature of LAB 410 6. Current status and future prospective 412 6.1. In urinary tract infections (UTIs) 412 6.2. Bacterial vaginosis (BV) and lactobacillus 412 6.3. Use of probiotic organisms in the human vagina 413 6.4. Role of vaginal microbiome against cervical cancer 413 6.5. Cancer and probiotics 414 References 415

18. Gut microbiota and brain development: A review

Krishnapriya M. Varier, Arpita Karandikar, Wuling Liu, Juan Chen, Yaacov Ben-David, Xiangchun Shen, Arulvasu Chinnasamy and Babu Gajendran 1. Introduction 423 1.1. Factors influencing colonization of bacteria 424 2. Various pathways involved in a microbiota- gut communication 427

Contents

xiii

2.1. Neural pathway/the vagal pathway 427 2.2. Neuroendocrine gut hormone signaling 428 2.3. Neuroendocrine- hypothalamic- pituitary- adrenal axis (HPA Axis) 429 2.4. Development of HPA axis 429 2.5. Gut microbiota and HPA axis 430 2.6. Glucocorticoids and the HPA axis 431 2.7. Interference with serotonin and tryptophan metabolism 431 3. Immune system 434 4. Gut microbiome and microglia 435 5. Synthesis of microbial metabolites 437 6. Conclusion 438 References 438

19. Role of microbial communities in traditionally fermented foods and beverages in North East India Indu Sharma and Sagolsem Yaiphathoi

1. Introduction 445 1.1. Traditional Fermented foods and its history 446 2. Various traditionally fermented foods consumed in North East India 446 2.1. Fermented vegetables 446 2.2. Fermented fish 451 2.3. Fermented beans 453 2.4. Fermented alcoholic beverages 454 2.5. Fermented dairy products 457 3. Health benefits and importance of different types of traditionally fermented foods 458 4. Health risks of fermented foods 460 5. Future aspects of microbes involved in fermentation 460 6. Conclusion 461 References 465

20. Metagenomics: Applications of functional and structural approaches and meta-omics Lokesh Kumar Tripathi and Tapan Kumar Nailwal 1. Introduction 471 1.1. Metagenomics 472 2. Culture-dependent approaches 472 3. Culture-independent approaches ‘evolution of metagenomics’ 473 4. Next-generation sequencing 474 4.1. Illumina platform 474 4.2. Ion torrent-(Thermofisher) 475 4.3. Pacific biosystems 475 4.4. BGI 476 4.5. Oxford nanopore 476 4.6. Genia-Roche 476

xiv

Contents

4.7. Bionano genomics 477 4.8. RNAP sequencing technique 477 4.9. FRET-based sequencing 477 5. Enrichment of metagenome 477 5.1. Bromo-deoxyuridine enrichment 478 5.2. Stable-isotope probing (SIP) 478 6. Taxonomic classification of metagenomes 478 7. Binning 481 7.1. Taxonomy-dependent methods 481 7.2. Taxonomy-independent method 483 8. Metagenomics approaches 484 8.1. Sequence-based approaches 484 8.2. Function-based approaches 485 9. “Meta-omics” approaches 489 9.1. Low diversity environment 492 9.2. Highly complex communities 493 10. Conclusion 494 References 495

21. Metagenomics: a vital source of information for modeling interaction networks in bacterial communities Jithin S. Sunny and Lilly M. Saleena 1. Introduction 507 2. Community level dynamics 508 2.1. Exchange of metabolites 508 2.2. Exchange of signals 509 2.3. Horizontal gene transfer (HGT) 510 2.4. Indirect interactions 510 2.5. Spatial structure 511 3. Mathematical modeling in bacterial systems 512 3.1. Different models used to study microbial ecosystems 513 3.2. Population and individual based models 513 4. Complexities in building predictive models for bacterial ecologies 515 5. Metagenomics 517 5.1. DNA extraction, sequencing 517 5.2. Assembly 518 5.3. Shot-gun metagenome assembly 519 5.4. Annotation and functional metagenomics 520 5.5. Single-cell metagenomics 522 6. Metagenomics and bacterial evolution 522 7. A metagenomics perspective on bacterial interaction 523 7.1. Data processing 523 7.2. Graph theory 524 7.3. Predicting interactions 525 7.4. Mathematical modeling 526 8. Biodiversity analysis 527 9. Experiments and metagenomics 528 References 530

Contents

xv

22. Metagenomics based approach to reveal the secrets of unculturable microbial diversity from aquatic environment Pooja Arya and Ravindra

1. Introduction 537 2. Cultivation- dependent methods in exploring bacterial diversity 538 3. Cultivation-independent detection methods 539 4. Need of metagenomics 539 5. Metagenomics 540 6. History of metagenomics 540 7. Types of metagenomic approaches 541 8. Metagenomics: aquatic ecosystem 542 9. Bacterial biodiversity 543 10. Fungal biodiversity 543 11. Viral biodiversity 543 12. Methodology 544 12.1. Approach, strategy and tools for successful metagenomics analysis 544 12.2. Sampling, isolation and cloning of metagenomic DNA 545 12.3. Screening of metagenomic clones 546 12.4. Sequencing and bioinformatics 546 12.5. Current limitations of metagenomics 549 13. Conclusion 550 References 550

23. Metagenomic-based approach to a comprehensive understanding of cave microbial diversity Apirak Wiseschart and Kusol Pootanakit

1. Introduction 561 2. Cave–a unique natural habitat for microorganisms 564 3. Taxonomic profiling analysis of microbial communities in the era of metagenomics and high-throughput sequencing 566 4. Taxonomic distribution of cave microbiomes based on targeted 16S rRNA metagenomic sequencing 570 5. Taxonomic distribution based on whole metagenome shotgun (WMS) sequencing 576 6. Metabolic potential of cave microbiomes based on whole metagenome shotgun (WMS) sequencing 577 7. The neglected world of fungi in cave microbiomes 578 8. Concluding remarks 579 References 580

Index

587

Page left intentionally blank

Contributors Pooja Arya, ICAR-National Bureau of Fish Genetic Resources, Lucknow, Uttar Pradesh, India Yaacov Ben-David, State Key Laboratory of Functions and Applications of Medicinal Plants, Guizhou Medical University, Guiyang, Guizhou; The Key Laboratory of Chemistry for Natural Products of Guizhou Province and Chinese Academy of Sciences, Guiyang, Guizhou, P.R. China Geeta Bhandari, Sardar Bhagwan Singh University, Balawala, Dehradun, Uttarakhand, India Sneha Bhandari, Department of Biotechnology, Kumaun University Nainital, Bhimtal Campus, Bhimtal, Uttarakhand, India Mrinal K. Bhattacharya, Department of Botany & Biotechnology, Karimganj College, Karimganj, Assam, India Subhash Chandra, Department of Botany, Kumaun University, SSJ Campus, Almora, Uttarakhand, India Juan Chen, XinQiao Hospital, Army Medical University, Chongqing, P.R. China Arulvasu Chinnasamy, Department of Zoology, University of Madras, Guindy Campus, Chennai, Tamil Nadu, India Khushboo Dasauni, Department of Biotechnology, Kumaun University Nainital, Bhimtal Campus, Bhimtal, Uttarakhand, India Surajit De Mandal, Key Laboratory of Bio-Pesticide Innovation and Application of Guangdong Province, College of Agriculture, South China Agricultural University, Guangzhou, P.R. China Prasenjit Debbarma, School of Agriculture, Graphic era Hill University, Dehradun, Uttarakhand, India Purva Dubey, Department of Agricultural Microbiology, College of Agriculture, Indira Gandhi Krishi Vishwavidhyalaya, Raipur, Chhattisgarh, India Babu Gajendran, State Key Laboratory of Functions and Applications of Medicinal Plants, Guizhou Medical University, Guiyang, Guizhou; The Key Laboratory of Chemistry for Natural Products of Guizhou Province and Chinese Academy of Sciences, Guiyang, Guizhou, P.R. China Saurabh Gangola, School of Agriculture, Graphic era Hill University, Bhimtal, Uttarakhand, India Anwesha Gohain, Department of Botany, Arunachal University of Studies, Namsai, Arunachal Pradesh, India xvii

xviii

Contributors

Vinita Gouri, Cell and Molecular Biology Laboratory, Department of Zoology, Kumaun University, SSJ Campus, Almora, Uttarakhand, India Rasiravathanahalli Kaveriyappan Govindarajan, Guangdong Province Key Laboratory of Microbial Signals and Disease Control and Integrative Microbiology Research Centre, South China Agricultural University, Guangzhou, Guangdong, P.R. China Sathya Narayanan Govindarajulu, Department of Physiology, Dr. ALM PGIBMS, University of Madras, Taramani Campus, Chennai, Tamil Nadu, India Pankaj Kumar Jain, Indira Gandhi Centre for Human Ecology, Environmental and Population Studies, University of Rajasthan, Jaipur, Rajasthan, India Dheepthi Jayamurali, Department of Physiology, Dr. ALM PGIBMS, University of Madras, Taramani Campus, Chennai, Tamil Nadu, India Diksha Joshi, Cell and Molecular Biology Laboratory, Department of Zoology, Kumaun University, SSJ Campus, Almora, Uttarakhand, India Tanuja Joshi, Department of Botany, Kumaun University, SSJ Campus, Almora, Uttarakhand, India Tushar Joshi, Department of Biotechnology, Kumaun University, Bhimtal Campus, Bhimtal, Uttarakhand; Department of Botany, Kumaun University, SSJ Campus, Almora, Uttarakhand, India Arpita Karandikar, Department of Medical Biochemistry, Dr. ALM PGIBMS, University of Madras, Taramani Campus, Chennai, Tamil Nadu, India Vikas Kumar, School of Engineering, The University of British Columbia Okanagan, Kelowna, BC, Canada Vinay Kumar, ICAR-National Institute of Biotic Stress Management, Baronda, Raipur, Chhattisgarh, India Folguni Laskar, Department of Botany and Biotechnology, Karimganj College, Karimganj, Assam, India Yanmei Li, State Key Laboratory of Functions and Applications of Medicinal Plants, Guizhou Medical University, Guiyang, Guizhou; The Key Laboratory of Chemistry for Natural Products of Guizhou Province and Chinese Academy of Sciences, Guiyang, Guizhou, P.R. China Boppa Linggi, Faculty of Agriculture Sciences, Arunachal University of Studies, Namsai, Arunachal Pradesh, India Wuling Liu, State Key Laboratory of Functions and Applications of Medicinal Plants, Guizhou Medical University, Guiyang, Guizhou; The Key Laboratory of Chemistry for Natural Products of Guizhou Province and Chinese Academy of Sciences, Guiyang, Guizhou, P.R. China Priyanka Maiti, Department of Botany, Kumaun University, SSJ Campus, Almora, Uttarakhand, India Nivedita Manoharan, Department of Physiology, Dr. ALM PGIBMS, University of Madras, Taramani Campus, Chennai, Tamil Nadu, India

Contributors

xix

Chowlani Manpoong, Faculty of Agriculture Sciences, Arunachal University of Studies, Namsai, Arunachal Pradesh, India Rojita Mishra, Department of Botany, Polasara Science College, Polasara, Ganjam, Odisha, India Abhijit Mitra, Department of Marine Science, University of Calcutta, Kolkata, West Bengal, India Tapan Kumar Nailwal, Department of Biotechnology, Kumaun University Nainital, Bhimtal Campus, Bhimtal, Uttarakhand, India Mahesha Nand, G.B. Pant National Institute of Himalayan Environment & Sustainable Development, Kosi-Katarmal, Almora, Uttarakhand, India Amrita Kumari Panda, Department of Biotechnology, Sarguja University, Ambikapur, Chhattisgarh, India Veena Pande, Department of Biotechnology, Kumaun University Nainital, Bhimtal Campus, Bhimtal, Uttarakhand, India Veni Pande, Cell and Molecular Biology Laboratory, Department of Zoology, Kumaun University, SSJ Campus, Almora, Uttarakhand, India Anupam Pandey, ICAR-Directorate of Coldwater Fisheries Research, Bhimtal, Uttarakhand; Department of Biotechnology, Bhimtal Campus, Kumaun University, Nainital, Uttarakhand, India Satish Chandra Pandey, Cell and Molecular Biology Laboratory, Department of Zoology, Kumaun University, SSJ Campus, Almora; Department of Biotechnology, Bhimtal Campus, Kumaun University, Nainital, Uttarakhand, India Ajit Kumar Passari, Instituto de Investigaciones Biomedicas, Universidad Nacional Autonoma de Mexico, Ciudad de Mexico, Mexico City, Mexico Karthika Ponnusamy, Department of Agricultural Microbiology, College of Agriculture, Indira Gandhi Krishi Vishwavidhyalaya, Raipur, Chhattisgarh, India Kusol Pootanakit, Institute of Molecular Biosciences, Mahidol University, Nakhorn, Pathom, Thailand Himanshu K. Prasad, Department of Life Science & Bioinformatics, Assam University, Silchar, Assam, India Thangjam Premabati, Department of Biotechnology, Mizoram University, Aizawl, Mizoram, India Sumi Das Purkayastha, Department of Botany & Biotechnology, Karimganj College, Karimganj, Assam; Department of Life Science & Bioinformatics, Assam University, Silchar, Assam, India Ravindra, ICAR-National Bureau of Fish Genetic Resources, Lucknow, Uttar Pradesh, India Jyoti Rawat, Department of Biotechnology, Kumaun University Nainital, Bhimtal Campus, Bhimtal, Uttarakhand, India Ratul Saikia, Biotechnology Group, Biotechnological Science & Technology Division, CSIR-North East Institute of Science & Technology, Jorhat, Assam, India

xx

Contributors

Lilly M. Saleena, Department of Biotechnology, SRM Institute of Science & Technology, Kattankulathur, India Mukesh Samant, Cell and Molecular Biology Laboratory, Department of Zoology, Kumaun University, SSJ Campus, Almora, Uttarakhand, India Diksha Sati, Cell and Molecular Biology Laboratory, Department of Zoology, Kumaun University, SSJ Campus, Almora, Uttarakhand, India Tapti Sengupta, Department of Microbiology, West Bengal State University, Berunanpukuria, Malikapur, Kolkata, West Bengal, India Indu Sharma, Department of Microbiology, Assam University, Silchar, Assam, India Priyanka Sharma, Department of Botany, Kumaun University, DSB Campus, Nainital, Uttarakhand, India Xiangchun Shen, School of Pharmaceutical Sciences, Guizhou Medical University, Guiyang, P.R. China Anup Kumar Singh, Department of Agricultural Microbiology, College of Agriculture, Indira Gandhi Krishi Vishwavidhyalaya, Raipur, Chhattisgarh, India Ravindra Soni, Department of Agricultural Microbiology, College of Agriculture, Indira Gandhi Krishi Vishwavidhyalaya, Raipur, Chhattisgarh, India Rajendra Sonwani, Department of Agricultural Microbiology, College of Agriculture, Indira Gandhi Krishi Vishwavidhyalaya, Raipur, Chhattisgarh, India Jithin S. Sunny, Department of Biotechnology, SRM Institute of Science & Technology, Kattankulathur, India Deep Chandra Suyal, Department of Microbiology, Eternal University, Baru Sahib, Sirmaur- Himachal Pradesh, India Lokesh Kumar Tripathi, Department of Biotechnology, Kumaun University Nainital, Bhimtal Campus, Bhimtal, Uttarakhand, India Priyanka H. Tripathi, ICAR-Directorate of Coldwater Fisheries Research, Bhimtal, Uttarakhand; Department of Biotechnology, Bhimtal Campus, Kumaun University, Nainital, Uttarakhand, India Shobha Upreti, Cell and Molecular Biology Laboratory, Department of Zoology, Kumaun University, SSJ Campus, Almora, Uttarakhand, India Krishnapriya M. Varier, Department of Medical Biochemistry, Dr. ALM PGIBMS, University of Madras, Taramani Campus, Chennai, Tamil Nadu; Department of Zoology, University of Madras, Guindy Campus, Chennai, Tamil Nadu, India Apirak Wiseschart, Institute of Molecular Biosciences, Mahidol University, Nakhorn, Pathom, Thailand Nirmal Yadav, Department of Biotechnology, Kumaun University Nainital, Bhimtal Campus, Bhimtal, Uttarakhand, India Sagolsem Yaiphathoi, Department of Microbiology, Assam University, Silchar, Assam, India

Chapter 1

Biodiversity of microbial life: Indian Himalayan region Khushboo Dasauni and Tapan Kumar Nailwal Department of Biotechnology, Kumaun University Nainital, Bhimtal Campus, Bhimtal, Uttarakhand, India

1 Introduction Himalayas are major “hotspots’ of microbial biodiversity, with an enormous but mostly underexplored genetic and biological pool, which can be exploited for novel genes, their products and metabolic pathways. Microbial diversity is varied with living organisms due to evolution, which represents structural and functional diversity (Rampelotto, Ferreira, Barboza, & Roesch, 2013). It comprehends the spectrum of variability among all types of microorganisms in nature and as transformed by human intervention. The probable subsistence of hidden microbial life has been reported from ancient times, such as in Jain scriptures of sixth century BC in India and in first century book On Agriculture by Marcus Terentius Varro. Microbiology, the scientific research on microorganisms begins with their observation under the microscope in the 1670s by Antoine van Leeuwenhoek. In 1850s, Louis Pasteur isolated microorganisms in culture-dependent fashion. This culture dependent method helped in exploration of microorganisms for potential biotechnological practices moreover, it also opened a way for discovery of novel isolates for future studies (Kumar, Yadav, Tiwari, Prasanna, & Saxena, 2014; Piterina & Pembroke, 2010; Barea, Pozo, Azcon, & Aguilar, 2005). Microorganism is a microscopic organism, which survives as single-celled or as a colony of cells. Microorganisms are found in more or less every habitat present in nature, including hostile environments such as the North and South poles, deserts, geysers, rocks and Himalayas. Himalayan mountain region in the subcontinent of India extends from 2500 Km from east to west (Altitudinal range (over 3000 m), rapid change in altitude (Chitale, Behera, & Roy, 2014) makes it an interesting and one of the richest sources of microflora predominantly fungi, algae, actinomycetes and bacteria (psychrophilic/psychrotolerant bacteria). The Himalayas are divided into (1) Greater Himalaya, (2) Inner Himalayas or Central or Lesser Himalayas Recent Advancements in Microbial Diversity. http://dx.doi.org/10.1016/B978-0-12-821265-3.00001-3 Copyright © 2020 Elsevier Inc. All rights reserved.

1

2

Recent Advancements in Microbial Diversity

and (3) the Sub-Himalayan foothills and nearby areas of Terai and Bhabhar plains. Mountains inhabit approximately 24% of the world's land area and support 12% of the world populations that are living within mountain areas and depend directly on Himalaya for their lives and livelihoods (Sharma, Chettri, & Oli, 2010). Microbes Isolated from the Himalayas of India could be valuable in agriculture, food and pharmaceuticals industries and these microorganisms are also sensitive indicators of environmental quality, thus microbial diversity may be helpful in determining the environmental status of a given ecosystem habitat. These microorganisms also play an important role as a causative agent for various disease thus they could potentially serve as biological weapons, further this can also be used for removing unwanted materials from environment (Yadav, Sachan, Verma, Kaushik, & Saxena, 2016). In temperate, subtropical, tropical and cold environments, microbial diversity in the Indian Himalayas will give insight into various biological products and processes that may be developed in future.

2  Microbial diversity of IHR region 2.1  Distribution and types Indian Himalayan Region (IHR) starts from foothills of Shiwaliks in the south and extends up to Tibetan Plateau in the north and spreads between latitudes 26° 20'N and 35° 40'N, and between longitudes 74° 50'E and 95° 40'E. IHR is blessed with affluent natural resources in the form of forest, water, climate, soil and beautiful landscapes. The Indian cold desert is suitable for selection of psychrophiles, fungi, archae with biotechnological application in diverse sectors (Sharma et al., 2010; Singh et al., 2016). Mountain ecosystems are most delicate in world and are susceptible to climate change, urbanization, invasive alien species and other anthropogenic changes (Yadav, Verma, Sachan, Kaushik, & Saxena, 2018). Northwestern Himalayan region which passes through Jammu and Kashmir up to Ladakh consists of various climatic zones with changeable high-altitude peaks and diverse soil textures. These characteristic features like different altitudes with green meadow, valleys, alpine glaciers and string of different elevation zones harbor remarkable plethora of microorganisms. Microorganisms have been evolving for nearly four billion years and have ability to exploit a vast range of energy sources flourishing in almost every habitat. Alpine glaciers are a rich reservoir of extremophilic microorganisms, particularly psychrophilic/psychrotolerant bacteria and actinomycetes. Some of the major high-altitude areas of Kashmir Himalaya like Thajiwas glacier, Kolahoi, Haramukh, Amarnath glacier and the Apharwatare are a rich source of psychrophilic microorganisms. Its climatic conditions and topological characteristics have been home for thousands of psychrophiles or cold-adapted microbes. Glaciers and the ice cover is the largest freshwater reservoirs which embody about 10% of the surface of

Biodiversity of microbial life: Indian Himalayan region Chapter | 1

3

Earth. These topological and climatic conditions are vital components of the Earth's atmosphere, still global warming has led to increase in melting rate melting rate of these freshwater reservoirs (Cazenave & Le Cozanne , 2014). High saline soils and dry elevated plains of Ladakh region of IHR are a massive resource of halophilic and radio resistant bacteria and fungi. These organisms have resistance to high levels of ionizing radiation, most commonly ultraviolet radiation. The greater part of the Himalayas, however, lies below the snow line where mostly mesophilic bacteria, fungi, actinomycetes and endophytes are found. These low elevation areas and slopes usually have a thick soil cover, supporting dense forests along with a diversity of medicinal plants and grasses. All these medicinal plants in different elevations of this zone are an incredible source of bioactive endophytic bacteria and fungi.

2.2 Conditions Extreme environmental conditions of IHR generally considered unfavorable for growth and survival of plants and animals are usually colonized by microorganisms capable of growth and survivability under the prevailing severe climate. Due to the presence of extremophilic enzymes, proteins and biomolecules in these cold-adapted microorganisms are of great importance in industrial, agriculture and biotechnological applications. Bacteria associated with various phyla have been reported from Indian Himalayan trees such as Proteobacteria, Firmicutes, Actinobacteria, Bacteroidetes, Acidobacteria, Gemmatimonadetes, Planctomycetes, Chlamydiae, Chlorobi, Chloroflexi, Dictyoglomi, Fibrobacteres, Nitrospirae and Verruco microbia. Temperature has a major impact on whether an organism can survive and/or reproduce, and the impact can be direct, indirect or both. Cold environments of Himalayas signify a foremost section of Earth's biosphere which has been occupied by cold-adapted microbes, usually term as “psychrophiles”. These microorganisms can be cultured at low temperature. In the present scenario, biodiversity across all the major systems like terrestrial or freshwater and levels (genetic, species, and ecosystem) is undergoing major changes and resulting in altered biodiversity, circulation of various ecosystem services downstream and affecting the welfare of people linked to them. Psychrophiles have evolved a complete set of complex morphological and physiological adaptations for their survival. As an outcome, there is evidence of varied metabolic activities in cold ecosystems (Pandit, Manish, & Koh, 2014; De Maayer, Anderson, Cary, & Cowan, 2014).

2.3 Importance According to ZSI (Zoological survey of India) The Indian Himalaya, acquires 12% of countries landmass, and about 30.16% of its fauna (Pandey & Negi, 1995). Looking into the microbial biodiversity of entire IHR, the chance of finding novel enzyme producing microorganisms which could be exploited

4

Recent Advancements in Microbial Diversity

for their use in biotechnological applications is certain. IHR is blessed with abundant natural resources in form of forest, water, climate, soil and beautiful landscapes. One-fifth of mankind gets a wide array of ecosystem services from it. They also fulfill the freshwater needs of greater than half of humanity and are regarded as one of the most important water storage reservoirs. Their ecological, aesthetic and socio-economic significance is not only important and beneficial to the people living in them but also to those living downstream and beyond them. Besides this, the management and proper exploitation of microbial diversity of Himalayas which includes mainly bacteria, fungi and actinomycetes, mostly soil inhabiting, have a significant role in sustainable industrial and commercial applications. Further, study of dry mountains of Ladakh revealed the dominance of phototrophic microbial communities with wide diversity of soil cyanobacteria and microalga (Řeháková, Chlumská, & Doležal, 2011; Srinivas et al., 2011). Analysis of the bacterial diversity of the Kafni Glacier in Kumoan Himalayas (altitude of about 3853 m) based on the 16S rRNA gene clone libraries suggests that majority of bacterial genera belonged to the phylum Proteobacteria (Jain, Reza, & Pal, 2014). Microorganisms living in soil ecosystem control carbon and nitrogen cycle and establish a link between plant diversity and soil ecosystem. Similarly, plant diversity also has an impact on microbial community structure of soil surrounding plant roots. Plant roots secrete root exudates which are used by microorganism for their growth and development. Rhizospheric effect is caused by 5–21% of carbon fixed by plant which is secreted mainly as root exudate (Lugtenberg & Kamilova, 2009; Pala et al., 2011; Sharma, Gosai, Dutta, Arunachalam, & Shukla, 2015). Ascomycota was the dominant phylum, followed by Zygomycota, Basidiomycota and Heterokontophyta. Other dominant group of microorganisms inhabiting Himalayan soil other than bacteria is fungi. Fungi are the most diverse group of organisms, which are the largest group of living organism in terms of species richness. Besides this fact, fungi also constitute more soil biomass compared to bacteria and maintain global carbon cycle by decomposing plant-derived polymeric substances like cellulose, soil organic content, soil texture, surface vegetation and other physiochemical properties of soil. Fungal diversity in soil at higher altitudes of Sikkim and Uttarakhand Himalaya has shown that Penicillium is most abundant and diverse genus present over there. P. raistrickii, P. janthinellum, P. pinophillum, P. javanicum, P. chrysogenum, P. oxalicum, P. purpurogenum and P. aurantiogriseum are some of the commonly occurring species of Penicillium. Aspergillus, Epicoccum, Fusarium, Myrothecium, Cladosporium, Paecilomyces, Gangronella and Trichoderma are other genera contributing to fungal flora of this Himalayan region (Rai & Kumar, 2015). Various Himalayan glaciers have been explored for microbial diversity, documentation and conservation of psychrophilic and psychrotolerant microorganisms (Řeháková et al., 2011; Shivaji et al., 2011). Studies of these Himalayan glaciers reported

Biodiversity of microbial life: Indian Himalayan region Chapter | 1

5

that Proteobacteria viz., Cytophaga–Flavobacterium–Bacteroides (CFB) and high G + C gram-positive bacteria are common inhabitant of such cold habitats (Srinivas et al., 2011).

3  Indian Himalayan region (IHR): psychrophilic microorganisms Psychrophiles are extremophilic organisms that are capable of growth and reproduction in extreme low temperatures, ranging from −20 °C to +10 °C. They are found in places that are permanently cold, regions of poles and deep sea. Many such organisms are bacteria or archaea, but some eukaryotes such as lichens, snow algae, fungi, and wingless midges, are also classified as psychrophiles for their ability to grow at low temperature. Presence of more unsaturated fatty acids in phospholipids of cell membrane makes it more liquid, and the protein conformation functional at low temperature. Psychrophiles grow and divide at freezing temperatures. This unique property of them means that they have successfully overcome two main challenges: viscosity at low temperatures. Significant adaptations of certain organisms have been observed such as Moritella profunda, thermophilic microorganisms suitable for cold and living in the deep ocean. Its optimal growth rate is exhibited at 2 °C with a maximum growth temperature of only 12 °C (Xu et al., 2003). This suggests that certain enzymes or supra-molecular structures have shown conformational changes at temperatures as low as 2 °C with a negative impact on metabolic flux. Psychrophilic microbes have successfully faced two main physical challenges: low heat and high viscosity, both of which slow down metabolic flux.

3.1 Habitat The cold environments that psychrophiles live in are ubiquitous on Earth, as a large fraction of our planetary surface experiences temperatures lower than 15 °C. They are present in permafrost, polar ice, glaciers, snowfields and deep ocean waters. These organisms can also be found in pockets of sea ice with high salinity content. Microbial activity has been measured in soils frozen below −39 °C. In addition to their temperature limit, psychrophiles must also adapt to other extreme environmental constraints that may arise as a result of their habitat. These constraints include high pressure in the deep sea, and high salt concentration on some sea ice (Saikia et al., 2011).

3.2  Taxonomy of psychrophiles Psychrophiles comprises bacteria, lichens, fungi, and insects. Among the bacteria that can tolerate extreme cold are Arthrobacter sp. Psychrobacter sp. and

6

Recent Advancements in Microbial Diversity

members of the genera Halomanas, Pseudomonas, Hyphomonas and Sphingomonas. Another example is Chryseobacterium greenlandensis, found in 120,000-year-old ice. Penicillium is a genus of fungi found in a wide range of environments including extreme cold. Many novel microbes have been sort out from cold environments worldwide including Sphingobacterium antarcticus, Psychromonas ingrahamii, Exiguobacterium soli, Cryobacterium roopkundense, Sphingomonas glacialis, Pedobacterarcticus Sphingobacterium psychroaquaticum Pedobacterarcticus, Sphingobacterium psychroaquaticum Lacinutrix jangbogonensis (Yadav et al., 2015; Chaturvedi et al., 2008; Reddy Pradhan, Manorama, & Shivaji, 2010; Shivaji et al., 2011; Zachariah, Kumari, & Das, 2017; Yadav et al., 2016). Along with novel species of psychrotrophic microbes, some microbial species including Arthrobacter nicotianae, Brevundimonas terrae, Paenibacillus tylopili and Pseudomonas cedrina have been reported first time from cold deserts of North Western Himalayas and exhibited multifunctional plant growth promoting (PGP) attributes at low temperatures (Yadav et al., 2015). The psychrotrophic microbial species Aurantimona saltamirensis, Bacillus baekryungensis, B. marisflavi, Paenibacillus xylanexedens, Pontibacillus sp., Providencia sp., Pseudomonas frederiksbergensis and Vibrio metschnikovii have been reported first time from high altitude and low temperature environments of Indian Himalayas. Biodiversity of psychrotrophic microbes inhabiting cold habitats has been extensively investigated worldwide and has been reported from phylum, namely Actinobacteria, Gemmatimonadetes, Ascomycota, Acidobacteria, Bacteroidetes, Basidiomycota, Chlamydiae, Chloroflexi, Proteobacteria, Cyanobacteria, Firmicutes, Mucoromycota, Verrucomicrobia, Nitrospirae, Planctomycetes, Spirochaetes, Thaumarchaeota, and Euryarchaeota. Cold habitats of microbiomes includes subglacial lakes, Antarctic, Arctic glacier, permanently ice-covered sea, permafrost, and Himalayan and Mountain lakes and have diverse psychrotrophic, psychrophilic, and psychrotolerant microbes (Rai & Kumar, 2015). Generally, the distribution of psychrotrophic microbes varied in all bacterial phyla, Proteobacteria were most dominant followed by firmicutes and actinobacteria. Least number of microbes was reported from phylum Chlamydiae followed by Chloroflexi. On review of different cold environments in IHR (permanently ice-covered lakes, ice caped rivers and glaciers), 8 different phylum were found viz., Proteobacteria (42.57%), Firmicutes (32.94%), Actinobacteria (17.78%), Bacteroidetes (2.62%), Basidiomycota (1.75%), Cyanobacteria (1.17%), Chlamydiae (0.58%) and Chloroflexi (0.58%). There are fifteen different extreme cold environments in the IHR including glacier (Roopkund glacier, Pindari glacier, Gangotri glacier, Lahaul and Spiti); Sub-glacial lakes (Chandratal Lake, Dal Lake, Dashair Lake, Gurudongmar lake, Pangong Lake); the Cold desert of Himalayas (Chumathang, Khardungla Pass, Rohtang Pass); Ice-coped revivers (Indus River, Zanskar River, Beas River) (Bhardwaj, Tiwari, & Bahuguna, 2010).

Biodiversity of microbial life: Indian Himalayan region Chapter | 1

7

4  Applications of psychrophilic microbes The Psychrophilic microbes from IHR have engrossed in scientific society due to having the potential valuable in industries, food and medical process and in PGP at low temperatures, additionally have use as biofertilizers, biocontrol agents, bioremediation as well as have various biotechnological applications in agriculture, medicine, industry, food, and allied sectors. (Verma, Yadav, Shukla, Saxena, & Suman, 2015) The psychrophilic/psychrotolerant/psychrotrophic microbes are important for many reasons, particularly because they contain antifreezing, antibiotics, and bioactive compounds (Yadav et al., 2015) and produce extracellular hydrolytic enzymes useful for various biotechnological applications for different processes in industry, pharmaceuticals, medicine, food and feed industry as shown in Table 1.1 Enzymes from psychrophiles has been fascinating for industrial applications, These enzymes offer opportunities to study the adaptation of life at very low temperature and the potential for biotechnological exploitation (Robb & Maeder, 1998). Most of the work focused on cold-adapted enzymes (amylase, protease, lipase, pectinase, xylanase, cellulase, β-galactosidase and chitinase) produced by psychrophilic microbes, namely Acinetobacter, Aquaspirillum, Arthrobacter, Moraxella, Bacillus, Moritella, Carnobacterium, Planococcus, Clostridium, Cytophaga, Shewanella, Vibrio, Flavobacterium, Marinomonas,

TABLE 1.1 List of various psychrophilic enzymes useful for various applications. Applications

Enzymes

• Food and Feed industly: improvement of digestibility, assimilation and removal of hemicellulosic material from feed, Meat tenderizing, Cheese ripening bake1y products Removal oflactose from milk,

Lipase, protease, phytase, glucanases, xylanase, Chitinase, P-galactosidase a- amylase, Pectate lyase, Laccase

• Wine and beverage stabilization

Fem!oyl esterase

• Detergents and cleaning industly

Lipase, protease

• Envirolllllental Biotechnology: Bioremediation, degradation and removal of xenobiotics and toxic compounds Bio-bleaching in paper and pulp industly, Biofuels and energy production

Lipase, protease, hydrocarbon degrading enzyme, xylanase, peroxidase Lipase

• Phannaceutical, medical and domestic industly: Manufactureof anti-cancer diugs Anti-bacterial agent Antibiotic degradation Anti-microbial, antioxidant, photo protectant (ferulic acid), cosmetics

Chitinase, Lipase, laccase, Lysozyme Femloyl esterase, P-lactamase

• Textile industly: Stone washing

Cellulase, a-amylase, Xylanase

8

Recent Advancements in Microbial Diversity

Paenibacillus, Pseudoalteromonas, Pseudomonas, Psychrobacter and Xanthomonas (Yadav, Verma, Kumar, Sachan, & Saxena, 2017). Antifreezing compounds from psychrophilic microbes are helpful in cryosurgery, cryopreservation of whole organisms, isolated organs, cell lines, and tissues. In food industry, anti-freezing protein (AFPs) can be used to maintain the quality of frozen food. Enhanced cold tolerance in fishes has been achieved in some cases by direct injection of AFPs (Singh et al., 2016; Gerday et al., 2000; Groudieva et al., 2004). Cold-adapted microbes possess varied genes responsible for cold adaptation and genes for various molecules and alleles with possible applications in various fields. The entire genome sequences of cold-adapted microbes helps us to understand the adaptation of microbes under the intense cold habitats and also potential genes for functional attributes, for example, A. agilis L77, is an important psychrophilic bacterium isolated from Pangong lake, Northwest (NW) Himalayas, India. The whole genome sequences of psychrophilic bacteria revealed different genes for adaptation and metabolic activities (Singh et al., 2016). The PGP psychrotrophic bacilli were investigated from different sites in North-Western Himalayas of India and bacteria have been reported from different genera, namely Desemzia, Exiguobacterium, Lysinibacillus, Sporosarcina, Jeotgalicoccus, Planococcus, Paenibacillus, Sinobaca, Pontibacillus, Staphylococcus, and Virgibacillus (Verma et al., 2015). Among all known bacterial strains, Bacillus muralis, Bacillus licheniformis, Sporosarcinaglobispora, P. tylopili, and Desemzia incerta, were found to be an important biofertilizers for Indian Himalayan agriculture (Yadav et al., 2016). Psychrotrophic microbes exhibited multifarious PGP attributes such as ACC deaminase activity, potassium zinc and phosphate solubilization, biological N2 fixation, and production of different bioactive compounds such as gibberellic acids, ammonia, cytokinins, Fe-chelating compounds, hydrogen cyanide, and indole-3-acetic acid. PGP microbes improve plant growth by supplying plant nutrients, which can help maintain environmental health and soil productivity (Yadav et al., 2018) (Table 1.2). Psychrotrophic PGP microbes were found in several genera, including Arthrobacter, Bacillus, Burkholderia, Pseudomonas, Exiguobacterium, Janthinobacterium, Lysinibacillus, Methylobacterium, Microbacterium, Paenibacillus, Providencia, and Serratia (Yadav, Tiwari, Kumar, Prasanna, and Saxena, 2014). Microbes having ACC deaminase activity help plant to improve cold stress tolerance (Verma et al., 2015; Yadav et al., 2015; Yadav et al., 2017). Indian cold deserts are suitable for selection of psychrotrophic and psychrotolerant bacteria, archaea, and fungi with potential biotechnological application in diverse sectors. One report (Yadav et al., 2017) shows the presence of Pseudomonas cedrina, Brevundimonas terrae, Arthrobacter nicotianae, and Paenibacillus tylopili in cold habitats for the first time and exhibitions multifarious PGP attributes at low-temperature conditions. In another investigation by (Yadav et al., 2015) the culturable biodiversity of microbiomes

Biodiversity of microbial life: Indian Himalayan region Chapter | 1

9

TABLE 1.2 Classification of psychrotrophic microbes. Division

Class

Genus

References

Firmicutes

Bacilli

Bacillus Sporosarcina

Yadav et al., 2016

Exiguobactierium

Singh et al., 2013

Staphylococcus

Spergser et al., 2003

Arthrobacter

Gangwar, Alam, & Singh, 2011

Rhodococcus

De Mandal, Sanga, & Kumar, 2015

Sanguibacter

Yadav et al., 2015

α Proteobacteria

Brevundimonas. Methylobacterium

Yadav et al., 2015

β Proteobacteria

Janthinobacterium Burkholderia

Suman, Sharma, Gupta, Sourirajan, & Dev, 2015

γ Proteobacteria

Aeromaonas

Yadav et al., 2015

Pseudomonas Yersina

Sangwan et al., 2015

Psychrobacter

Latha, Soni, Khan, Marla, & Goel, 2009

Sphingobacterium

Yadav et al., 2015

Actinobacteria

Proteobacteria

Bacteroidetes

Actinobacteria

Sphingobacteria

in Leh Ladakh region included four phyla, namely Proteobacteria, Firmicutes, Bacteroidetes, and Actinobacteria with different genera; Bacillus, Desemzia, Pseudomonas, Sporosarcina, Arthrobacter, Psychrobacter, Exiguobacterium, Flavobacterium, Alishewanella, Staphylococcus, Brachybacterium, Klebsiella, Providencia, Paracoccus, Planococcus, Sinobaca, Janthinobacterium, Sphingobacterium, Kocuria, Aurantimonas, Citricoccus, Cellulosimicrobium, Brevundimonas, Stenotrophomonas, Vibrio, and Sanguibacter. These microbes possess PGP attributes and may be applicable as bioinoculants. These microorganisms are known for their degrading activity in feed. Some are pathogenic or toxic to humans, animals or plants. However, in natural microbial ecosystem, during cold season, psychotrophic and psychrophilic microorganisms can play a huge role in biodegradation of organic matter. Psychotrophic microorganisms have been reported as plant growth promoters and biological control agents for sustainable agriculture, as cold-adapted hydrolase in industry, and as secondary metabolites in medicine. Persistent cold conditions in this habitat lead to reduced nutrient bioavailability, reduced enzyme activity, and changes in soil pH, water activity, and soil salinity. These microorganisms have cold

10

Recent Advancements in Microbial Diversity

shock proteins (CSPs) which provide protection against cold stress, and the presence of CSPs in these microorganisms has been confirmed by the previously done genomic and proteomic analysis of bacterial isolates from Western Indian Himalayas (Suyal, Yadav, Shouche, & Goel, 2014; Soni et al., 2015).

5  Diversity of aquatic microorganisms in IHR Microbial diversity of Indian Himalayan hot springs was extensively studied using metagenomics and culture-dependent approaches (Sharma et al., 2015; Bhardwaj et al., 2010). Culturable diversity of aquatic microorganisms in soldhar and Ringigad hot springs in the chamoli area of Garhwal Himalaya were studied. Bacteria, filamentous organisms and yeast were the major groups observed. 16S rRNA gene cloning library, denaturing gradient gel electrophoresis (DGGE) and band sequencing of DGGE were used to study the bacterial diversity of Soldhar Hot Springs. Results showed that Proteus was the main population in this habitat, followed by Deinococcus, Thermos and Aquificae. The only archaea found in this hot spring was Pyrobaculum (Sharma et al., 2015). In addition, several cyanobacterial species have been reported from Soldhar and Ringigad hot springs like, Micrococcus, Chroococcus turgidus, Chroococcustenax, Synecococcus elongatus, Synecococcussallensis, Gloeocapsalivida, Myxosarcina sp. Animal Oscillatoria animalis and Oscillatoria limnosa (Kumar, Gupta, Bhatt, & Tiwari, 2011).

6  Challenges for micro-diversity conservation

• Increasing Temperature: Mountains are significant indicators of climate

• •

change (Singh, Singh, & Skutsch, 2010). Green house effect has carried increase in temperature and (Cook, Smerdon, Seager, & Coats, 2014) rise in temperature over last 100 years is larger than the overall average of 0.74°C (Joshi, Kumar, & Palni, 2015). Major problem is its least predictability and the effects are detrimental in the long run. Variation in precipitation pattern: The Himalayas form major natural water resource of the major river systems of India (Nandargi & Dhar, 2011). Variable rainfall trend has been prevalent across Asia during the last few decades. Both increasing and decreasing precipitation patterns were observed in the Himalayan region Retreating glaciers: Himalayan glaciers are receding at a very fast rate (Kulkarni, Rathore, Singh, & Bahuguna, 2011). It is generally a combination of precipitation decrease and temperature increase in the Himalayas. According to an estimate the decrease of glaciers will accelerate if global warming persist for extended period, and many glaciers will retreat even more in the coming years (Li et al., 2015), while smaller ones may completely vanish. It will be severe threat to microbiota native to these glaciers.

Biodiversity of microbial life: Indian Himalayan region Chapter | 1

11

7  Factors responsible for functioning of ecosystem of Indian Himalaya Species richness, functional and phylogenetic diversity and changing abiotic and biotic factors are responsible for normal functioning of ecosystem. Throughout the world, species richness of these micro-organisms needs to be explored and utilized for better use of humankind in particular, and for the environment. Microbial evolution has entered a new era with the use of molecular phylogenies to determine relatedness. Phylogenetic analysis has opened up possibility of comparing very diverse microbes. Therefore, microbial culture collections are encouraged worldwide to create novel and better techniques for bioprospecting of these novel microorganisms. Microbial diversity had addressed biological diversity at three levels: the genetic diversity within species, the species diversity in numerical terms, and the ecological diversity of the community Fig. 1.1. The Himalayas of Arunachal Pradesh, India have species and phylogenetic diversity which provides shift in tree community. In general, elevational declines in richness are due to factors similar to those driving the decline in richness observed along the latitudinal gradient, such as the reduced availability of resources, colder temperatures, and increased extinction rates at regional scales (Lomolino, 2001, McCain & Grytnes, 2010). A reduction of resources (lush soils and nutrients, for example) and colder temperatures at high raises can limit the number of individuals and select for species with specific niche attributes (McCain & Grytnes, 2010), and only those species possessing the appropriate traits and adaptations will be able to establish and flourish in these environments (Jin, Cadotte, & Fortin, 2015; Webb, Ackerly, McPeek, & Donoghue, 2002).

FIGURE 1.1  Functional diversity of microorganisms for better use of humankind.

12

Recent Advancements in Microbial Diversity

The presence of glacial relicts has roles in determining phylogenetic clustering at high elevations in strongly filtered communities and also contributes to the uniqueness or β diversity of those communities. There is no strong evidence for higher phylogenetic diversity within higher elevation plots in Arunachal Pradesh; it is shown that high elevation plots do indeed contribute disproportionately to regional β diversity, because highly contributing plots are those that contain communities with relatively greater species uniqueness (Legendre & De Cáceres, 2013), this would be consistent with the presence of narrow ranged and evolutionarily distinct endemics at higher elevations. There is a relationship between elevation and its contribution to beta diversity. It was suggested that there may be a greater incidence of landscape modification and anthropogenic influence (Menon, Pontius, Rose, Khan, & Bawa, 2001; Bhuyan, Khan, & Tripathi, 2003; Roy & Behera, 2005), which may have reformed community structure (Puri et al., 2011; Saqib et al., 2013), which are endemic to the region. The regions with unique species, high endemicity, and distinct geography should become priorities for research and conservation. Nearly 99% of the microbial group of certain environments cannot be cultivated by standard laboratory techniques and hence there is a necessity for culture-independent methods to know the genetic diversity, population structure and ecological roles of this microbiota. DNA is the most elemental level of biodiversity, drives the process of speciation, and reinforces other levels of biodiversity, comprises functional traits, species and ecosystems (Jobbágy & Jackson, 2000; Kraft, Cornwell, Webb, & Ackerly, 2007; Losos, 2011; Read, Moorhead, Swenson, Bailey, & Sanders, 2014) (Fig. 1.2). Effect of abiotic factors; drought, heat and salinity on the growth and development of Gluconacetobacter diazotrophicus, and the impact of salt stress on some enzymes involved in carbon metabolism of these bacteria was observed. Enzymes glucose dehydrogenase, alcohol dehydrogenase, fumarase, isocitrate dehydrogenase, malate dehydrogenase and Gluconacetobacter diazotrophicus,

FIGURE 1.2  Elemental levels of microbial and functional diversity.

Biodiversity of microbial life: Indian Himalayan region Chapter | 1

13

regardless of its endophytic nature, tolerated heat treatments and salinity stress, while nitrogenase activity and carbon metabolism enzymes were affected by high NaCl dosage. Examination of the biological activity of G. diazotrophicus in response to different abiotic factors led to more knowledge of this endophyte and may help to elucidate pathways involved in its spread into the host plant (Verma et al., 2015; Yadav et al., 2016).

8  Conclusion and future vision Psychrophilic microbes from IHR produced industrially significant cold-active extracellular hydrolytic enzymes which have diverse role in industrial, agricultural and medical processes. Diversity analyses of different genera by searching extreme cold environments assisted in the development of an enormous database including baseline information on the distribution of psychotropic microbes in different niches and identifying niche-specific microbes. This database also helped in identifying novel microbes with plant growth promoting attributes and biomolecules. The cultures tolerant to low temperatures signify an affluent bioresources for useful genes and alleles, which can aid in the generation of abiotic cold-tolerant transgenics. Microbial diversity of cold environments has attracted the scientific community for production of cold active enzymes production, anti-freezing compounds, secondary metabolites and bioactive compounds. Psychrophilic microbes with multifarious PGP attributes could be used as biofertilizers and biocontrol agents in hilly and low temperature condition for enhanced and sustainable agriculture. Psychrophilic microbes having biodegradation capacity could be used for bioremediation, and waste water treatments for sustainable environments. Psychrophilic microbiomes are widely distributed and have been reported to raise plant growth and alleviation of cold stress in plants. These cold-adapted microbes may be used for biofuels and biodiesel production for future energy systems.

References Barea, J. M., Pozo, M. J., Azcon, R., & Aguilar, C. A. (2005). Microbial co-operation in the rhizosphere. Journal of Experimental Botany, 56, 1761–1778. Bhardwaj, K. N., Tiwari, S. C., & Bahuguna, Y. M. (2010). Screening of thermophilic cyanobacteria isolated from Tapoban geothermal field, Uttarakhand Himalaya for the production of antibacterial compounds. Asian Journal of Experimental Biological Sciences, 4(1), 787–794. Bhuyan, P., Khan, M. L., & Tripathi, R. S. (2003). Tree diversity and population structure in undisturbed and human-impacted stands of tropical wet evergreen forest in Arunachal Pradesh, Eastern Himalayas, India. Biodiversity & Conservation, 12(8), 1753–1773. Cazenave, A., & Le Cozannet, G. (2014). Sea level rise and its coastal impacts. Earth's Future, 2(2), 15–34. Chaturvedi, P., Prabahar, V., Manorama, R., Pindi, P. K., Bhadra, B., Begum, Z., et al. (2008). Exiguobacterium soil nov., a psychrophilic bacterium from the McMurdo Dry Valleys, Antarctica. Systematic and Evolutionary Microbiology, 58(10), 2447–2453.

14

Recent Advancements in Microbial Diversity

Chitale, V. S., Behera, M. D., & Roy, P. S. (2014). Future of endemic flora of biodiversity hotspots in India. PloS one, 9(12), e115264. Cook, B. I., Smerdon, J. E., Seager, R., & Coats, S. (2014). Global warming and 21 st century drying. Climate Dynamics, 43(9–10), 2607–2627. De Mandal, S., Sanga, Z., & Kumar, N. S. (2015). Metagenome sequencing reveals Rhodococcus dominance in Farpuk Cave, Mizoram, India, an Eastern Himalayan biodiversity hot spot region. Genome Announcements, 3(3), e00610–e615. Gangwar, P., Alam, S. I., & Singh, L. (2011). Metabolic characterization of cold active Pseudomonas, Arthrobacter, Bacillus, and Flavobacterium spp. from Western Himalayas. Indian Journal of Microbiology, 51(1), 70–75. Gerday, C., Aittaleb, M., Bentahir, M., Chessa, J-P., Claverie, P., Collins, T., et al. (2000). Cold-adapted enzymes: from fundamentals to biotechnology. Trends in Biotechnology, 18(3), 103–107. Groudieva, T., Kambourova, M., Yusef, H., Royter, M., Grote, R., Trinks, H., et al. (2004). Diversity and cold-active hydrolytic enzymes of culturable bacteria associated with Arctic sea ice. Spitzbergen. Extremophiles, 8(6), 475–488. Jain, P., Reza, H. M., & Pal, S. (2014). Molecular phylogenetic analysis of bacterial community and characterization of Cr (VI) reducers from the sediments of Tantloi hot spring, India. Aquatic Biosystems, 10(1), 7. Jin, L. S., Cadotte, M. W., & Fortin, M. J. (2015). Phylogenetic turnover patterns consistent with niche conservatism in montane plant species. Journal of Ecology, 103(3), 742–749. Jobbágy, E. G., & Jackson, R. B. (2000). Global controls of forest line elevation in the northern and southern hemispheres. Global Ecology and Biogeography, 9(3), 253–268. Joshi, R., Kumar, K., & Palni, L. M. S. (Eds.). (2015). Dynamics of climate change and water resources of northwestern Himalaya. Springer. Kraft, N. J., Cornwell, W. K., Webb, C. O., & Ackerly, D. D. (2007). Trait evolution, community assembly, and the phylogenetic structure of ecological communities. The American Naturalist, 170(2), 271–283. Kulkarni, A. V., Rathore, B. P., Singh, S. K., & Bahuguna, I. M. (2011). Understanding changes in the Himalayan cryosphere using remote sensing techniques. International Journal of Remote Sensing, 32(3), 601–615. Kumar, M., Gupta, R. K., Bhatt, A. B., & Tiwari, S. C. (2011). Epiphytic cyanobacterial diversity in the sub-Himalayan belt of Garhwal region of Uttarakhand, India. Botanica Orientalis: Journal of Plant Science, 8, 77–89. Kumar, M., Yadav, A. N., Tiwari, R., Prasanna, R., & Saxena, A. K. (2014). Deciphering the diversity of culturable thermotolerant bacteria from Manikaran hot springs. Annals of Microbiology, 64(2), 741–751. Sangwan, N., Lambert, C., Sharma, A., Gupta, V., Khurana, P., Khurana, J. P., et al. (2015). Arsenic rich Himalayan hot spring metagenomics reveal genetically novel predator–prey genotypes. Environmental Microbiology Reports, 7(6), 812–823. Latha, P. K., Soni, R., Khan, M., Marla, S. S., & Goel, R. (2009). Exploration of Csp genes from temperate and glacier soils of the Indian Himalayas and in silico analysis of encoding proteins. Current Microbiology, 58(4), 343. Legendre, P., & De Cáceres, M. (2013). Beta diversity as the variance of community data: dissimilarity coefficients and partitioning. Ecology Letters, 16(8), 951–963. Li, Z., Fan, K., Tian, L., Shi, B., Zhang, S., & Zhang, J. (2015). Response of glacier and lake dynamics in four inland basins to climate change at the transition zone between the Karakorum and Himalayas. PloS One, 10(12), e0144696.

Biodiversity of microbial life: Indian Himalayan region Chapter | 1

15

Lomolino, M. V. (2001). Elevation gradients of species-density: historical and prospective views. Global Ecology and Biogeography, 10(1), 3–13. Losos, J. B. (2011). Convergence, adaptation, and constraint. Evolution: International Journal of Organic Evolution, 65(7), 1827–1840. Lugtenberg, B., & Kamilova, F. (2009). Plant-growth-promoting rhizobacteria. Annual Review of Microbiology, 63, 541–556. De Maayer, P., Anderson, D., Cary, C., & Cowan, D. A. (2014). Some like it cold: understanding the survival strategies of psychrophiles. EMBO Reports, 15(5), 508–517. McCain, C. M., & Grytnes, J. A. (2010). Elevational gradients in species richness. e LS, 2001. Menon, S., Pontius, R. G., Jr., Rose, J., Khan, M. L., & Bawa, K. S. (2001). Identifying conservation-priority areas in the tropics: a land-use change modeling approach. Conservation Biology, 15(2), 501–512. Nandargi, S., & Dhar, O. N. (2011). Extreme rainfall events over the Himalayas between 1871 and 2007. Hydrological Sciences Journal, 56(6), 930–945. Pala, S. A., Wani, A. H., Bodha, R. H., Wani, B. A., Bhat, M. Y., Mir, R. A., et al. (2011). Two hitherto unreported macro fungi from Kashmir; Himlaya. Bioresources Bulletin, 2, 130–134. Pandey, O.P., & Negi, J.G. (1995). Geothermal fields of India: a latest update. In Proc. World Geothermal Congress, Florence, Italy (pp. 163-171). Pandit, M. K., Manish, K., & Koh, L. P. (2014). Dancing on the roof of the world: ecological transformation of the Himalayan landscape. BioScience, 64(11), 980–992. Piterina, A. V., & Pembroke, T. J. (2010). Preparation and analysis of environmental DNA: Optimisation of techniques for phylogenetic analysis of ATAD sludge. . Puri, A., Srivastava, A. K., Singhal, B., Mishra, S. K., Srivastava, S., & Lakshmi, V. (2011). Antidyslipidemic and antioxidant activity of Pinus roxburghii needles. Medicinal Chemistry Research, 20(9), 1589–1593. Rai, A. K., & Kumar, R. (2015). Potential of microbial bio-resources of Sikkim Himalayan region. ENVIS Bulletin, 23, 99–105. Rampelotto, Ferreira, P. H., Ferreira, Adão de, S., Barboza, A. D. M., & Roesch, L. F. W. (2013). Changes in diversity, abundance, and structure of soil bacterial communities in Brazilian Savanna under different land use systems. Microbial Ecology, 66(3), 593–607. Read, Q. D., Moorhead, L. C., Swenson, N. G., Bailey, J. K., & Sanders, N. J. (2014). Convergent effects of elevation on functional leaf traits within and among species. Functional Ecology, 28(1), 37–45. Reddy, G., Pradhan, S., Manorama, R., & Shivaji, S. (2010). Cryobacterium roopkundense sp. nov., a psychrophilic bacterium isolated from glacial soil. International Journal of Systematic and Evolutionary Microbiology, 60(4), 866–870. Řeháková, K., Chlumská, Z., & Doležal, J. (2011). Soil cyanobacterial and microalgal diversity in dry mountains of Ladakh, NW Himalaya, as related to site, altitude, and vegetation. Microbial Ecology, 62(2), 337–346. Robb, F. T., & Maeder, D. L. (1998). Novel evolutionary histories and adaptive features of proteins from hyperthermophiles. Current Opinion in Biotechnology, 9(2), 288–291. Roy, P. S., & Behera, M. D. (2005). Assessment of biological richness in different altitudinal zones in the Eastern Himalayas, Arunachal Pradesh, India. Current Science, 250–257. Saikia, R., Gogoi, D. K., Mazumder, S., Yadav, A., Sarma, R. K., Bora, T. C., et al. (2011). Brevibacillus laterosporus strain BPM3, a potential biocontrol agent isolated from a natural hot water spring of Assam, India. Microbiological Research, 166(3), 216–225. Singh, S. P., Singh, V., & Skutsch, M. (2010). Rapid warming in the Himalayas: Ecosystem responses and development options. Climate and Development, 2(3), 221–232.

16

Recent Advancements in Microbial Diversity

Saqib, A. N. S., Waseem, A., Khan, A. F., Mahmood, Q., Khan, A., Habib, A., et al. (2013). Arsenic bioremediation by low cost materials derived from Blue Pine (Pinus wallichiana) and Walnut (Juglans regia). Ecological Engineering, 51, 88–94. Sharma, D., Gosai, K., Dutta, J., Arunachalam, A., & Shukla, A. K. (2015). Fungal diversity of twelve major vegetational zones of Arunachal Himalaya, India. Current Research in Environmental & Applied Mycology, 5(2), 101–119. Sharma, E., Chettri, N., & Oli, K. P. (2010). Mountain biodiversity conservation and management: a paradigm shift in policies and practices in the Hindu Kush-Himalayas. Ecological Research, 25(5), 909–923. Shivaji, S., Pratibha, M., Sailaja, B., Kishore, K. H., Singh, A. K., Begum, Z., et al. (2011). Bacterial diversity of soil in the vicinity of Pindari glacier, Himalayan mountain ranges, India, using culturable bacteria and soil 16S rRNA gene clones. Extremophiles, 15, 1–22. Singh, N. K., Raichand, R., Kaur, I., Kaur, C., Pareek, S., & Mayilraj, S. (2013). Exiguobacterium himgiriensis sp. nov. a novel member of the genus Exiguobacterium, isolated from the Indian Himalayas. Antonie Van Leeuwenhoek, 103(4), 789–796. Singh, R. N., Gaba, S., Yadav, A. N., Gaur, P., Gulati, S., Kaushik, R., et al. (2016). First high quality draft genome sequence of a plant growth promoting and cold active enzyme producing psychrotrophic Arthrobacter agilis strain L77. Standards in Genomic Sciences, 11(1), 54. Soni, R., Suyal, D. C., Agrawal, K., Yadav, A., Souche, Y., & Goel, R. (2015). Differential proteomic analysis of Himalayan psychrotolerant diazotroph Pseudomonas palleroniana N26 Strain under low temperature diazotrophic conditions. CryoLetters, 36(2), 74–82. Spergser, J., Wieser, M., Täubel, M., Rossello-Mora, R. A., Rosengarten, R., & Busse, H. J. (2003). Staphylococcus nepalensis sp. nov., isolated from goats of the Himalayan region. International Journal of Systematic and Evolutionary Microbiology, 53(6), 2007–2011. Srinivas, T. N. R., Singh, S. M., Pradhan, S., Pratibha, M. S., Kishore, K. H., Singh, A. K., et al. (2011). Comparison of bacterial diversity in proglacial soil from Kafni Glacier, Himalayan Mountain ranges, India, with the bacterial diversity of other glaciers in the world. Extremophiles, 15(6), 673. Suman, R., Sharma, P., Gupta, S., Sourirajan, A., & Dev, K. (2015). A novel psychrophilic Janthinobacterium lividum MMPP4 isolated from Manimahesh Lake of Chamba district of Himachal Pradesh, India. Journal of Biochemical Technology, 6(1), 846–851. Suyal, D. C., Yadav, A., Shouche, Y., & Goel, R. (2014). Differential proteomics in response to low temperature Diazotrophy of Himalayan psychrophilic nitrogen fixing Pseudomonasmigulae S10724 strain. Current Microbiology, 68(4), 543–550. Verma, P., Yadav, A. N., Shukla, L., Saxena, A. K., & Suman, A. (2015). Alleviation of cold stress in wheat seedlings by Bacillus amyloliquefaciens IARI-HHS2-30, an endophytic psychrotolerantK-solubilizing bacterium from NW Indian Himalayas. National Journal of Life Sciences, 12(2), 105–110. Webb, C. O., Ackerly, D. D., McPeek, M. A., & Donoghue, M. J. (2002). Phylogenies and community ecology. Annual review of ecology and systematics, 33(1), 475–505. Xu, Y., Nogi, Y., Kato, C., Liang, Z., Ruger, H. J., De Kegel, D., et al. (2003). Moritella profunda sp. nov. and Moritella abyssi sp. nov., two psychropiezophilic organisms isolated from deep Atlantic sediments. Systematic and Evolutionary Microbiology, 53, 533–538. Yadav, A. N., Tiwari, R., Kumar, M., Prasanna, R., & Saxena, A. K. (2014). Evaluating the diversity of culturable thermotolerant bacteria from four hot springs of India. Journal of Biodiversity, Bio-prospecting and Development, 127(1).

Biodiversity of microbial life: Indian Himalayan region Chapter | 1

17

Yadav, A. N., Sachan, S. G., Verma, P., Kaushik, R., & Saxena, A. K. (2016). Cold active hydrolytic enzymes production by psychrotrophic Bacilli isolated from three sub-glacial lakes of NW Indian Himalayas. Journal of Basic Microbiology, 56(3), 294–307. Yadav, A. N., Sachan, S. G., Verma, P., & Saxena, A. K. (2016). Bioprospecting of plant growth promoting psychrotrophic Bacilli from the cold desert of north western Indian Himalayas. Yadav, A. N., Sachan, S. G., Verma, P., Tyagi, S. P., Kaushik, R., & Saxena, A. K. (2015). Culturable diversity and functional annotation of psychrotrophic bacteria from cold desert of Leh Ladakh (India). World Journal of Microbiology and Biotechnology, 31(1), 95–108. Yadav, A. N., Verma, P., Kumar, V., Sachan, S. G., & Saxena, A. K. (2017). Extreme cold environments: a suitable niche for selection of novel psychrotrophic microbes for biotechnological applications. Advances in Biotechnology and Microbiology, 2(2), 1–4. Yadav, A. N., Verma, P., Sachan, S. G., Kaushik, R., & Saxena, A. K. (2018). Psychrotrophic microbiomes: molecular diversity and beneficial role in plant growth promotion and soil health. In Microorganisms for green revolution. Singapore: Springer (197-240). Zachariah, S., Kumari, P., & Das, S. K. (2017). Psychrobacter pocilloporae sp. nov., isolated from a coral, Pocillopora eydouxi. Systematic and Evolutionary Microbiology, 66(12), 5091–5098.

Chapter 2

Microbial endophytes of plants: diversity, benefits, and their interaction with host Anwesha Gohaina, Chowlani Manpoongb, Boppa Linggib, Ratul Saikiac and Surajit De Mandald a

Department of Botany, Arunachal University of Studies, Namsai, Arunachal Pradesh, India; Faculty of Agriculture Sciences, Arunachal University of Studies, Namsai, Arunachal Pradesh, India; cBiotechnology Group, Biotechnological Science & Technology Division, CSIR-North East Institute of Science & Technology, Jorhat, Assam, India; dKey Laboratory of Bio-Pesticide Innovation and Application of Guangdong Province, College of Agriculture, South China Agricultural University, Guangzhou, P. R. China b

1 Introduction The term “endophytes” is derived from the Greek ‘endo’ >< ‘endon’ meaning within, and ‘phyte’>< ‘phyton’ meaning plant in the year 1866 and includes microorganisms (mostly bacteria and fungai) that colonizes in the inner tissues of plants and exhibits a symbiotic relationship during a variable period of time (De Bary, 1986). However pathogens and nodule-producing microbes are not included under endophytes. During their life cycle, they draw nutrition and protect the host against pathogen, pests, and insects by synthesizing bioactive metabolites (Strobel & Daisy, 2003). Vogl (1898) was the first person who had reported the presence of endophytes in the grass seed of Lolium temulentum. However, presence of endophytic fungus came into existence in annual grass in Germany (Freeman, 1904). However, the promising niche for isolation of endophytes is the inner tissues of higher plants. There is hardly any plant species where endophytes are not available. The probability of occurrence of endophytic bacteria increases at lower population densities than rhizospheric microorganisms or bacterial pathogens (Hallmann, Quadt-Hallmann, Mahaffee, & Kloepper, 1997; Rosenblueth and Martinez Romero, 2004). However, question may arise that whether endophytes are more beneficial to plants or rhizospheric microorganism. The question is not yet resolved, though, this chapter elucidate the benefits confer by endophytes.

Recent Advancements in Microbial Diversity. http://dx.doi.org/10.1016/B978-0-12-821265-3.00002-5 Copyright © 2020 Elsevier Inc. All rights reserved.

19

20

Recent Advancements in Microbial Diversity

2  Isolation of endophytes Isolation of endophytes from different plant tissues has always been a challenge for the researchers since the studies on endophytes started. For isolation of endophytes extensively different methods have studied (Reinhold-Hurek & Hurek, 1998, Coombs & Franco, 2003, Taechowisan & Lumyong, 2003). Apart from root, stem, bark, leaf blade, petiole (Hata & Sone, 2008), isolation of endophytes has been also carried out from scale primordia, meristem and resin ducts, leaf segments with midrib (Hata & Sone, 2008). To avoid contamination by surface microbes, surface sterilization of plant tissues is the first and mandatory step for endophyte isolation. The common surface disinfectants used in the process is ethanol (70–95%), sodium hypochlorite (1–10%), hydrogen peroxide, Tween 20 and sometimes Tween 80 and Triton X-100 can also be used to improve the efficacy surface sterilization process (Hallmann, Gabriele, & Schulz, 2006). Coombs and Franco (2003) described a common three-step procedure protocol for surface sterilization; however, Qin et al. (2009) recommended a five-step surface sterilization procedure. Use of sodium hypochlorite as a plant surface disinfectant is beneficial, but sometimes residual sodium hypochlorite solution may kill or effect the growth of endophytes. That is why to improve cultivation efficiency on media plates, addition of sodium thiosulfate solution is necessary to minimize the effects of residual NaOCl on plant material surfaces. Since the sensitivity varies with plant species, age and organs, generally the sterilization procedure should be optimized for each plant tissue. Reinhold-Hurek and Hurek (1998) validated the key rules to recognize “true” endophytic bacteria. According to his report, to be a true endophytic bacterium microscopic evidence is also necessary. Growth of Endophytic bacteria had studied in the laboratory and revealed that it is dependent on the composition of the media and the cultivation conditions. Mishra et al. (2012) reported that mycological agar (MCA) medium was the most suitable medium for isolation of endophytes with the greatest species richness. Even so, instead of culturing, a new approach is emerging now days. In this context, Araujo et al. (2002) reported that endophytes isolated from citrus plant had not cultured, but were obtained by denaturing gradient gel electrophoresis profiles of 16S rRNA gene fragments amplified from total plant DNA. However, both cultured and culture-independent isolation methods gave similar type of bacteria from genera Pseudomonas and Rahnella in Norway spruce seeds (Cankar, Kreiger, Ravnikar, & Rupnik, 2005).

3  Biodiversity of endophytic microorganism Among the varied types of ecosystems on Earth, the most diverse microorganisms may be isolated from the one having greatest biodiversity. The most biologically diverse and species rich ecosystems on earth is the tropical and temperate rainforests (Strobel et al., 2002). They reported that tropical and temperature regions are the most effective reservoir for the greatest diversity of endophytes. A total of 123 endophytic actinomycetes were isolated from tropical plants

Microbial endophytes of plants Chapter | 2

21

collected from a number of sites in Papua New Guinea and Mborokua Island, Solomon Islands (Janso & Carter, 2010). Though these sites cover only 1.44% of surface of land, yet they yield more than 60% of the world’s terrestrial biodiversity (Mittermeier, Meyers, Gil, & Mittermeier, 1999) such that variation within endophytic population can also be obtained. Yu et al. (2010) also reported that ethno-botanical medicinal plants are potential repertoire for the isolation of endophytic microbes. For example, Zhao et al. (2011) isolated 560 endophytic actinomycetes from Chinese medicinal plants and confirmed the broad-spectrum antimicrobial activities in them. Du, Su, Yu, & Zhang (2013) studied the endophytic diversity among 37 medicinal plants and consequently reported 600 actinobacteria which belong to 34 genera and 7 unknown taxa. Likewise, enormous evidences were obtained on endophytic fungi (Hasegawa, Meguro, Shimizu, Nishimura, & Kunoh, 2006; Gunatilaka, 2006; Ryan, Germaine, Franks, Ryan, & Dowling, 2008; Verma, Kharwar, & Strobel, 2009a; Verma et al., 2009b). Endophytic populations had already been studied from 2400 segments of Oryza sativa where nineteen different fungal taxa, a Streptomyces sp. and bacterial species were isolated. Interestingly, diversity of endophytes population varies depending on bacterial species and host genotypes; the host developmental stage as well as inoculum density also influences endophytic population (Pillay & Nowak, 1997; Tan, Hurek, & Reinhold-Hurek, 2003). However, the different environmental conditions may also affect the diversity and species distribution among the host plants (Hou et al., 2009). It has been reported that only 1% of bacteria are presently identified (Davis, Joseph, & Janssen, 2005) which indicate that there are still millions of microbial species left to be discovered and identified. To find out the complex endophytic microbial community, applications of 16S rRNA gene-based culture independent molecular approaches, viz. polymerase chain reaction (PCR)-based 16S rRNA gene clone library, denaturing gradient gel electrophoresis and terminal restriction fragment length polymorphism (T-RFLP) analysis are convenient tools. But, to explore the endophytic community, both culturing methods and culture-independent methods are essential. A large diversity of actinobacteria was obtained from wheat root using the T-RFLP cultured independent method (Conn & Franco, 2004). Tian et al. (2007) reported the diversity of endophytic actinomycetes within stem and root of rice. The idea of enriching uncultured bacterial cells from plant tissues was first introduced by Jiao, Wang, Zeng, & Shen (2006). It was carried out by the enzymatic hydrolysis of the cell wall of plants with subsequent differential centrifugation. Later, using enzymatic hydrolysis and differential centrifugation method a large diversity of uncultured endophytic microbes was found to be associated with medicinal plant Mallotus nudiflorus (Wang, Geng, Zeng, & Shen, 2008). The study found actinobacteria as the most dominant microbial group, covering 37.7% in the 16S rRNA gene library. Successively, using this method Bulgari et al. (2009) studied diversity of endophytic bacteria in grapevine leaf tissues. Later, Ikeda et al. (2009, 2010) modified the protocol and successfully analyse the diversity endophytic actinobacterial communities in stems and leaves of soybeans and rice.

22

Recent Advancements in Microbial Diversity

4  Plant-microbe interactions and benefits to the plant It has always been an interesting field of research to know whether endophytic communities are more beneficial to plants or the rhizospheric bacterium. However, plant endosphere contains a large variety of microbial endophytes constituting a complex micro-ecosystem (El-Shatoury et al., 2013). As a result of this symbiotic association of endophytes with plants, endophytes may gain some genetic information to produce specific bioactive compound similar to the host plant through horizontal gene transfer and involves in metabolic pathway. Thus, in this host-endophyte interaction, the host provide nutrition to microbial endophytes and in return microbial community offers their potential application in plant protection and biological control (Hamayun et al., 2009, Shimizu, 2011, Dochhil, Dkhar, & Barman, 2013). However, there is enough information in the literature about plant-microbe molecular interactions (Lugtenberg, 2015; Kawaguchi and Minamisawa, 2010), but data are very limited regarding the molecular mechanism of relationship between endophyte-host. Plant response to the host is an important criterion in this interaction. Depending on plant genotype, plant responses to the endophytes varies. Some plant varieties viz. rice, sugarcane and maize provide suitable living conditions to the endophytes so that they stimulate nitrogen fixation and provide nutrition to plants (Boddey et al., 1995; Engelhard, Hurek, & ReinholdHurek, 2000; Iniguez, Dong, & Triplett, 2004). In presence of bacteria, expression of plant genes viz. nod genes, nif+ genes may be modified and affect the colonization of endophytes. de Matos Nogueira et al. (2001) studied the genes in relation to colonization of endophytic community in Gluconaceto bacterdia zotrophicus and Herbaspirillum rubrisubalbicans. Iniguez et al. (2005) took Arabidopsis thaliana and Medicago truncatula as model plants to study the plant-microbe interactions. These plants have defined mutation properties and may be tested for colonization of endophytes. By regulating the colonization frequency of endophytes, they determined the role of plant defence metabolism. Interestingly, they found that endophytic colonization was decreased by Klebsiella sp. strain Kp342 and Salmonella typhimurium strains after inducing a signal molecule called ethylene. They found that this molecule increases the systemic resistance in plants. However, Burkholderia strain, an endophytic bacterium residing in Vitis vinifera is an example of local host-defence mechanism (Compant et al., 2008). But then again, previously it has been undetermined whether plant’s innate immunity affects the endophytic community or not like the animal-bacterial interactions (McPhee, Scott, & Hancock, 2005). Duvick, Rood, Raro, & Marshak (1992) isolated some antimicrobial peptides from maize and rice that may control the colonization of endophytic community. Studying expression analysis of bacterial genes inside plants would clearly help to understand their molecular interaction with plants. Nevertheless, research on this field is very limited. Taking certain endophytic bacteria viz.

Microbial endophytes of plants Chapter | 2

23

Azoarcus spp. (Battistoni et al., 2005), Herba spirillum spp. and Klebsiella spp., genomic projects had already been initiated which will guide the researchers to evaluate the molecular interaction of endophytes with plants. According to Rediers, Rainey, Vanderleyden, & De Mot (2005), in vivo expression technology would also be very helpful to study gene expression in different niches like rhizosphere during the life cycle of endophytes (Ramos-Gonzalez, Campos, & Ramos, 2005). During their life cycle, endophytic microorganisms confer many beneficial effects to the plant (Barka, Gognies, Nowak, Audran, & Belarbi, 2002; Bailey et al., 2006). Endophytes are known for their ability to induce resistance of host plants against pathogens (Waller et al., 2005; Bhore, Nithya, & Loh, 2010). Likewise, they are also known as they enhance the growth and development of host plants in different diverse environmental and ecological conditions (Feng, Shen, & Song, 2006; Dudeja, Giri, Saini, Suneja-Madan, & Kothe, 2012). Their ability to produce bioactive compounds has a great potential application not only in pharmaceutical industry but also in agrochemical, pharmaceutical as well as and biotechnology industries (Walsh, 1992; Zhao et al., 2011). Some of the beneficial roles of endophytes on plants are described below (Fig. 2.1).

FIGURE 2.1  Beneficial roles of microbial endophytes.

24

Recent Advancements in Microbial Diversity

4.1 Phytostimulation Among the sixteen basic elements, plants mainly need C, H, N, O, and P for their growth and development. These elements are available in the form of chemical compounds and can be recovered from the atmosphere, soil, water, inorganic waste, etc. The endophytic microorganism associated with plants, including bacteria and fungi, helps absorb these elements through a variety of mechanisms. Nitrogen fixation or phytohormone production such as auxins, cytokinins and gibberellic acids by these endophytes can promote plant growth and nourishment (Hurek, Handley, Reinhold-Hurek, & Piche, 2002; Iniguez et al., 2004; Sevilla et al., 2011; Nair & Padmavathy, 2014; Xin, Zhang, Kang, Staley, & Doty, 2009). However, among the plant promoting microbes, plant growth prompting bacteria (PGPR) are widely studied for their effective field application under varied biotic and abiotic stress conditions (Mayak, Tirosh, & Glick, 2004; Sarma & Saikia, 2014). According to Cattelan, Hartel, & Fuhrmann (1999), phytohormones such as indole acetic acid (IAA), gibberellic acid, cytokinins and ethylene produced by the endophytes, and their symbiotic N2-fixation were associated with the plant growth promotion. Likewise, production of siderophore, b-1,3 glucanase, chitinase, antibiotics and cyanide by endophytes helps to enhance the antagonistic activity against the phytopathogenic microorganisms. Uptake of solubilized and other mineral nutrients also helps in the mechanism of plant growth promotion. Xin et al. (2009) isolated diazotrophic endophytic bacterium called Burkholderia vietnamiensis, from a wild variety of cottonwood (Populus trichocarpa) which produced indole acetic acid (IAA) and promotes plant growth. This was further confirmed by comparing both uninoculated control and plants inoculated with B. vietnamiensis on nitrogen free media. Interestingly, more dry weight as well as more nitrogen content was found in inoculated plant. In contrast, bioactive compounds, viz. GA3, GA4 and GA7 induces maximum plant growth in both rice and soybean varieties (Hamayun et al., 2009). These compounds are found in a new strain of fungus Cladosporium sphaerospermum and were isolated from roots of Glycine max (L) Merr. In addition, other beneficial effects such as osmotic adjustment, stomatal regulation, modification of root morphology, enhanced uptake of minerals, alteration of nitrogen accumulation, which play an important role in plant growth are also attributed to endophytes (Compant et al., 2005).

4.2  Pigment production In recent decades, natural pigments have gained interest because of the growing evidence of the harmful effects of synthetic or chemical pigments. Natural pigments are produced by organisms, including algae, fungi, and bacteria, as part of their survival mechanism (Rajagopal, Sundari, Balasubramanian, & Sonti, 1997; Tan, Long, Nagahawatte, & Mueller, 2018). Microbial pigments are more soluble than pigments obtained from plants or animals, which

Microbial endophytes of plants Chapter | 2

25

makes them an ideal source for the industrial production of various pigments. Endophytic microorganisms, mainly fungi, are well known for their pigment production abilities and potential source for the natural food colorant. An endophytic fungus belonging to Penicilium spp. was reported to produce an orange coloured pigment and was identified as quercetin glycoside (Liu, Chen, & Gong, 2008). It has been reported that Phyllosticta capitalensis (teleomorph Guignardia mangiferae), a woody endophyte, has been reported to produce black pigment. This pigment was further identified as melanin and may play an important role in host survival in a stressful environment (Suryanarayanan, Ravishankar, Venkatesan, & Murali, 2004). Another active pigment was isolated from the endophytic fungus Monodictys castaneae. This pigment was found to be more active than Streptomycin and have antagonistic activity against certain human pathogenic bacteria such as Staphylococcus aureus, Klebsiella pneumonia, Salmonella typhi and Vibriocholera (Visalakchi & Muthumary, 2009). The endophytic strain of the fungus Penicillium purpurogenum SX01 isolated from the twigs of Ginkgo biloba L was associated with the production of red colored pigment (Qiu et al., 2010). On the other hand, Qin, Xing, Jiang, Xu, & Li (2011) identified another soluble red coloured pigment from P. purpurogenum, an endophytic fungus which is isolated from twigs of Ginkgo biloba L. The endophytic genera Monascus under Ascomycetas was widely applied for the production of pigments used as red rice and red soy bean beans (Patakova, 2013; Vendruscolo et al., 2016; Tan et al., 2018). Lawsone (2-hydroxy-1, 4-napthoquinone) is an orange red dye that found in the leaves of Lawsonia inermis L and has is widely used as a skin and hair colorant. Sarang et al. (2017) revealed the present of this dye Lawsone from the endophytic fungus, Gibberella moniliformis. This reports also signifies the presence of novel biosynthetic pathways in the endophytic actinomycetes (Sarang et al., 2017). However, less reports were available for the pigment producing bacterial endophytes as compared with the fungal endophytes. The bacterial strain Serratia marcescens KC-1, an endophyte of Beta vulgaris L has been reported to secretes red pigment prodigiosins, an promising agents for textile and food colorant (Darshan & Manonmani, 2015; Khanam & Chandra, 2015).

4.3  Endophytes as a source of bioactive and novel compounds Endophytes are well known for their ability to produce bioactive compounds. These compounds could be used in the defence mechanism against the microbial pathogens viz. bacteria, fungi, viruses and protozoans by plants. These bioactive compounds have also a great application in the field of drug discovery. These compounds play their role as antibiotics, immune suppressants, anticancer agents, biological control agents etc. (Joseph & Mini Priya, 2011). However, more than a hundred natural products isolated from endophytes are reported (alkaloids, terpenoids, flavonoids, and steroids) (Wagenaar, Corwin,

26

Recent Advancements in Microbial Diversity

Strobel, & Clardy, 2000; Zhou et al., 2013; Wang et al., 2014). Earlier studies had already reported a lot of new antibiotics, viz. munumbicins A-D (Castillo et al., 2002), celastramycins A-B (Pullen et al., 2002), kakadumycins (Castillo et al., 2003), demethyl novobiocins (Igarashi, 2004) and many anti-inflamatory and anticancer drugs. Accordingly, two strains of endophytic Streptomyces were reported by Zhu, Zhao, & Shen (2009) which produces may tansinoids and have the potential of producing ansamycins. These endophytic actinomycetes were recovered from Trewia nudiflora. Another example is the naphthomycin K showed effective cytotoxic activity against P388 and A-549 cell lines at IC50 0.07 and 3.17 µM, but they did not inhibit the growth of Staphylococcus aureus and Mycobacterium tuberculosis (Lu & Shen, 2007). Naphthomycin K is a chlorine containing ansamycin produces by an endophytic Streptomyces strain. But then again, certain endophytic bacteria were also reported to reduce in vitro growth of Streptomyces scabies and Xanthomonas campestris through siderophore as well as antibiotic compounds production (Sessitsch, Reiter, & Berg, 2004). Siderophores are active biological compounds with chelating iron ions. These compounds promote plant growth and have antagonistic activities to phytopathogen (Cao, Qiu, You, Tan, & Zhou, 2005; Tan et al., 2006; Rungin et al., 2012). Certain actinobacteria isolated from Achillea fragrantissima were reported which had a remarkable capacity to inhibit phytopathogenic fungi either by chitinase or siderophore production. It has been reported that different biologically active compounds produced by various endophytic microorganisms have high anticancer activity. Plantmicrobe symbiotic relationship often results in production of taxol. This can be called as plant-derived drug by microbe and used as anticancer agents. Taxol could be used to cure breast cancer, ovarian cancer and lung cancer (Nair & Padmavathy, 2014). The paclitaxel-producing endophytic fungus, Taxomyces andreanae, was isolated in Pacific yew Taxus brevifolia (Strobel et al., 1993). However, the first taxol was extracted from Kitasatospora spp., an endophytic actinomycetes isolated from Taxus baccata in Italy (Caruso et al., 2000; Janso & Carter, 2010). Likewise, many studies reported production of taxol from endophytic microorganisms (Gangadevi & Muthumary, 2008; Liu, Ding, Deng, & Chen, 2009). An endophytic fungus Alternaria alternate was reported to produce nine bioactive molecules (Ma, Qiao, Shi, Zhang, & Gao, 2010). Another anticanceral agent ‘Torreyanic acid” a selectively cytotoxic quinone dimer was isolated from the endophytic fungus Pestalotiopsis microspore (Lee, Strobel, Lobkovsky, & Clardy, 1996). Antitumor compound identified as 22-oxa-[12]cytochalasins were reported from the endophytic fungus Rhinocladiella sp. associated with Tripterygium wilfordii (Wagenaar et al., 2000). It has also been reported that the camptothecin alkaloid, a potential antitumor agent, is produced by various endophytes including Fusarium solani, Xylaria sp., Neurospora sp. etc. (Kusari, Zühlke, & Spiteller, 2009; Shweta et al., 2010; Liu, Ding, Deng,

Microbial endophytes of plants Chapter | 2

27

& Chen, 2010). Deshmukh et al. (2009) reported the presence of ergoflavin belongs to the compound class ergochromes by the endophytic fungus isolated from the Indian medicinal plant Mimosops elengi (bakul). They also reported that the isolated compound has good anti-inflammatory and anti-cancer activity. Analysis of secondary metabolites of the mangrove endophytic fungus No. ZSU44 revealed the presence of secalonic acid D, a mycotoxin belonging to ergochromes and contains high cytotoxicity to HL60 and K562 cells (Zhang et al., 2009). Jung, Kim, Lee, & Kwon (2015) reported that the endophytic bacterial strain EML-CAP3 isolated from the leaf of C. annuum L. produces lipophilic peptides and showed have high anti-angiogenic activity in tumor progression (Singh, Kumar, Singh, & Pandey, 2017).Taken together, these reports suggests that bioactive compounds produced by different endophytic microorganisms could be an alternative source for the discovery of novel anticanceral drugs (Joseph & Mini Priya, 2011). Later, other investigators had made remarkable observations on the antioxidant property of the metabolites obtained from different endophytes. Harper et al. (2003) and Strobel et al. (2002) reported two compounds namely pestacin and isopestacin from culture fluids of Pseudomonas microspore and an endophyte residing in Terminalia morobensis which has antioxidant as well as antimicrobial property. The antioxidant activities of the exopolysaccharides (EPS) produced by the endophytic bacterium Paenibacillus polymyxa EJS-3 were investigated by Liu et al. (2009). They demonstrated a strong scavenging activities on superoxide and hydroxyl radicals by both crude and purified EPS (Liu et al., 2009). Similarly analysis of the extracts obtained from 1626 endophytic strains showed that presence of high bioactive metabolite graphislactone A in the endophyte Cephalosporium sp. IFB-E001 with free radical-scavenging and antioxidant activities. This compound can be further exploits as a potential agent for the management of oxidative damage-initiated diseases (Song, Huang, Sun, Wang, & Tan, 2005). Furthermore, antidiabetic as well as immunosuppressive compounds were also isolated from endophytes. From an endophytic fungus, Pseudomonas sp., a non-peptidyl fungal metabolite (L-783,281) was recovered which act as an insulin mimetic. The main characteristics of this compound are that it can be given orally and unlike insulin, it is not destroyed in digestive tract (Zhang et al., 1999). Two endophytic actinomycetes, Streptomyces longisporoflavus and Streptomyces sp., isolated from antidiabetic medicinal plants Leucas ciliate and Rauwolfia densiflora proved to secrete alpha-amylase inhibitors (Akshatha, Nalini, Souza, & Prakash, 2014). These extracts did not release insulin, but helped to pass glucose into muscles. Similarly, the non-cytotoxic diterpene pyrones immunosuppressive compounds were isolated from the endophytic fungus Fusarium subglutinans, residing in Tripterygium wilfordii (Lee, Lobkovsky, Pliam, Strobel, & Clardy, 1995). Thus, endophytes are rich and potential source of bioactive and chemically novel compounds which have a great application in the field of medical, agricultural, and industrial areas.

28

Recent Advancements in Microbial Diversity

4.4  Enzyme production Apart from its ability to produce bioactive compounds, endophytes also have the potential to yield a few vital enzymes. Certain endophytic fungus viz. Acremonium terricola, Aspergillus japonicas, Cladosporium cladosporioides, Cladosporium sphaerospermum, Fusarium lateritium, Monodictys castaneae, Nigrospora sphaerica, Penicillium aurantiogriseum, Penicillium glandicola, Pestalotiopsis guepinii, Phomopsis archeri,Tetraploa aristata and Xylaria sp. was found to be associated with the production of cellulases, pectinases, xylanases and proteases (Bezerra et al., 2012). Bischoff et al. (2009) depicted that the hydrolytic enzyme hemicellulose, produced by an endophyte Acremoniumzeae have a great application in the field of bioconversion of lignocellulosic biomass into fermentable sugars. However, certain endophytic bacteria offer additional fungal antagonism through production of chitin enzymes. El-Tarabily and Sivasithamparam (2006) had proved that endophytic actinobacteria have the ability to produce chitinase which degrade the fungal cell wall.

4.5  Role of endophytes in the field of biodegradation/ bioremediation Endophytes are also plays an important role in the degradation of plant materials as well as other organic pollutants (Wang & Dai, 2011).The endophyte Acremonium zeae helps in bioconversion of lignocellulosic biomass through production of hemicellulose. In addition to this, role of endophytes in the field of bioremediation had also been studied and found that Nicotia natabaccum inoculated with endophytes increases the biomass production even under stress condition of cadmium. Endophytes were also screened for their ability to breakdown complex compounds such as synthetic polymer polyester (PUR) (Russell et al., 2011). Nevertheless, several studies demonstrated the PUR degrading capacity of endophytes, but among them Pestalotiopsis microspora showed incredible degrading activity of PUR. They can grow on in both aerobic as well as anaerobic conditions by taking only carbon as single source. In addition, the enzyme serine hydrolase produced by P. microspora is responsible for degradation of PUR (Russell et al., 2011). The endophytic fungus genus Verticillium sp. and Xylaria sp were reported to the removal of biodegradation of crude oil hydrocarbons (Marín, Navarrete, & Narvaez-Trujillo, 2018). Results from the demonstrates that endophytic bacteria isolated from the Fresh leaves of American grass and broad beans, under the genera Rhodococcus and Pseudomonas were capable of degrading crude oil, n-hexadecane, or phenanthrene degradation potential of those bacteria (Sorkhoh et al., 2011). Zhu at al. (2016) identified two endophytic bacterial strains under Stenotrophomonas sp. and Pseudomonas sp. capable of the decomposition of polycyclic aromatic hydrocarbons (PAHs). Both strains were found to use naphthalene (NAP), PHE, fluorene, pyrene, and benzo (a) pyrene as the sole source of C and energy. They concluded that inoculating plants with endophytic bacteria with a high degree of

Microbial endophytes of plants Chapter | 2

29

PAH degradation activities can be used as a novel strategy to reduce PAH residues in polluted sites (Zhu et al., 2016).Moreover, rare endophytes associated with the medicinal plants such as the isolate A9 under Nocardiopsis sp were shown to possess significant biosurfactant as well as biodegradation activities (Singh & Sedhuraman, 2015).

4.6  Endophytes with multiple roles Some endophytes are known for their multiple roles within the host. For example, plant growth-promoting endophyte, Bacillus sp. SLS18 was also examined for production of biomass, IAA, siderophores and 1-aminocyclopropane-1-carboxylic acid deaminase. Certain plant namely, Sorghum bicolour L., Phytolacca acinosa Roxb. and Solanum nigrum increases the ability to absorb cadmium due to its association with Bacillus sp. (Luo et al., 2012).

5 Conclusion Currently, researches on endophytic microorganism has been dramatically increased as it is the most interesting and potent field of finding novel species, bioactive compounds from these tiny microbes, their application in agriculture, pharmaceutical industries, human health and many more. As reviewed in this study, past achievements in endophytic environment gives a new horizon to the scientific community. Endophytes, whether it is bacteria, fungi or actinomycetes, seem to play a significant role in enhancing the crop yields, remove contaminants, inhibit growth of pathogens and produce novel biologically active products. This review may conclude that endophytes associated with medicinal plants are potent candidates for producing bioactive compounds and mostly actinomycetes are involved in production of novel bioactive products which has a great application in pharmaceutical industries. The study depicted that endophytic community do have a great potential in the field of bioprospecting and are beneficial to plant community. In near future, many novel unidentified endophytic microorganisms will be discovered and definitely these endophytes will boost up the researchers to carry out their research and set up a new horizon in this field.

References Akshatha, V. J., Nalini, M. S., Souza, C. D., & Prakash, H. S. (2014). Streptomycete endophytes from anti-diabetic medicinal plants of the Western Ghats inhibit alpha-amylase and promote glucose uptake. Letters in Applied Microbiology, 58, 433–439. Araujo, W. L., Marcon, J., Maccheroni, W. J., Van Elsas, J. D., Van Vuurde, J. W., & Azevedo, J. L. (2002). Diversity of endophytic bacterial populations and their interaction with Xylella fastidiosa in citrus plants. Applied and Environmental Microbiology, 68(10), 4906–4914. Bailey, B. A., Bae, H., Strem, M. D., Roberts, D. P., Thomas, S. E., Crozier, J., et al. (2006). Fungal and plant gene expression during the colonization of cacao seedlings by endophytic isolates of four Trichoderma species. Planta, 224(6), 1149–1164.

30

Recent Advancements in Microbial Diversity

Barka, E. A., Gognies, S., Nowak, J., Audran, J. C., & Belarbi, A. (2002). Inhibitory effect of endophytic bacteria on Botrytis cinerea and its influence to promote the grapevine growth. Biological Control, 24, 135–142. Battistoni, F., Bartels, D., Kaiser, O., Marie Reamon-Buettner, S., Hurek, T., & Reinhold-Hurek, B. (2005). Physical map of the Azoarcus sp. strain BH72 genome based on a bacterial artificial chromosome library as a platform for genome sequencing and functional analysis. FEMS Microbiology Letters, 249, 233–240. Bezerra, J. D., Santos, M. G., Svedese, V. M., Lima, D. M., Fernandes, M. J., Paiva, L. M., et al. (2012). Richness of endophytic fungi isolated from Opuntia ficus-indica Mill. (Cactaceae) and preliminary screening for enzyme production. World Journal of Microbiology and Biotechnology, 28(5), 1989–1995. Bhore, S. J., Nithya, R., & Loh, C. Y. (2010). Screening of endophytic bacteriaisolated from leaves of Sambung Nyawa [Gynura procumbens (Lour.) Merr.] for cytokinin like compounds. Bioinformation, 5, 191–197. Bischoff, K. M., Wicklow, D. T., Jordan, D. B., de Rezende, S. T., Liu, S., Hughes, S. R., et al. (2009). Extracellular hemicellulolytic enzymes from the maize endophyte Acremoniumzeae. Current Microbiology, 58(5), 499–503. Boddey, R. M., de Oliveira, O. C., Urquiaga, S., Reis, V. M., Olivares, F. L., Baldani, V. L. D., et al. (1995). Biological nitrogen fixationassociated with sugar cane and rice: Contributions and prospectsfor improvement. Plant and Soil, 174, 195–209. Bulgari, D., Casati, P., Brusetti, L., Quaglino, F., Brasca, M., Daffonchio, D., et al. (2009). Endophytic bacterial diversity in grapevine (Vitis vinifera L.) leaves described by 16S rRNA gene sequence analysis and length heterogeneity-PCR. Journal of Microbiology, 47, 393–401. Cankar, K., Kreiger, H., Ravnikar, M., & Rupnik, M. (2005). Bacterial endophytes from seeds of Norway spruce (Picea abies L.Karst). FEMS Microbiology Letters, 244, 341–345. Cao, L., Qiu, Z., You, J., Tan, H., & Zhou, S. (2005). Isolation and characterization of endophytic Streptomyces antagonists of Fusarium wilt pathogen from surface sterilized banana roots. FEMS Microbiology Letters, 247, 147–152. Caruso, M., Colombo, A. L., Fedeli, L., Pavesi, A., Quaroni, S., Saracchi, M., & Ventrella, G. (2000). Isolation of endophytic fungi and actinomycetes taxane producers. Annals of Microbiology, 50, 3–13. Castillo, U. F., Harper, J. K., Strobel, G. A., Sears, J., Alesi, K., Ford, E., et al. (2003). Kakadumycins, novel antibiotics from Streptomyces sp. NRRL30566, an endophyte of Grevillea pteridifolia. FEMS Microbiology Letters, 234, 183–190. Castillo, U. F., Strobel, G. A., Ford, E. J., Hess, W. M., Porter, H., Jensen, J. B., et al. (2002). Munumbicins, wide-spectrum antibiotics produced by Streptomyces NRRL 30562, endophytic on Kennedianigriscans. Microbiology, 148, 2675–2685. Cattelan, A. J., Hartel, P. G., & Fuhrmann, J. J. (1999). Screening for plant growth-promoting rhizobacteriato promote early soybean growth. Soil Science Society of America Journal, 63, 1670–1680. Compant, S., Reiter, B., Sessitsch, A., Nowak, J., Clement, C., & Barka, E. A. (2005). Endophytic colonization of Vitis vinifera L. by plant growth-promoting bacterium Burkholderia sp. Strain PsJN. Applied and Environmental Microbiology, 71, 1685–1693. Compant, Stéphane, Kaplan, Hervé, Sessitsch, Angela, Nowak, Jerzy, Ait Barka, Essaïd, & Clément, Christophe (2008). Endophytic colonization of Vitis vinifera L. by Burkholderia phytofirmans strain PsJN: From the rhizosphere to inflorescence tissues. FEMS Microbiology Ecology, 63, 84–93. Conn, V. M., & Franco, C. M. M. (2004). Analysis of the endophytic actinobacterial population in the roots of wheat (Triticum aestivum L.) by Terminal Restriction Fragment Length

Microbial endophytes of plants Chapter | 2

31

polymorphism and sequencing of 16S rRNA clones. Applied and Environmental Microbiology, 70(3), 1787–1794. Coombs, J. T., & Franco, C. M. M. (2003). Isolation and identification of actinobacteria isolated from surface-sterilized wheat roots. Applied and Environmental Microbiology, 69, 5303–5308. Darshan, N., & Manonmani, H. K. (2015). Prodigiosin and its potential applications. Journal of Food Science and Technology, 52(9), 5393–5407. Davis, K. E., Joseph, S. J., & Janssen, P. H. (2005). Effects of growth medium, inoculum size, and incubation time on culturability and isolation of soil bacteria. Applied and Environmental Microbiology, 71, 826–834. De Bary, H.A. (1986). Leipzig: Verlag von Wilhelm Engelmann Hofmeister’s handbook of physiological botany. de Matos Nogueira, E., Vinagre, F., Masuda, H. P., Vargas, C., de Pádua, V. L. M., da Silva, F. R., et al. (2001). Expression of sugarcane genes induced byinoculation with Gluconacetobacter diazotrophicus and Herbaspirillum rubrisubalbicans. Genetics and Molecular Biology, 24, 199–206. Deshmukh, S. K., Mishra, P. D., Kulkarni-Almeida, A., Verekar, S., Sahoo, M. R., Periyasamy, G., et al. (2009). Anti-inflammatory and anticancer activity of ergoflavin isolated from an endophytic fungus. Chemistry & Biodiversity, 6(5), 784–789. Dochhil, H., Dkhar, M. S., & Barman, D. (2013). Seed germination enhancing activity of endophytic Streptomyces isolated from indigenous ethno-medicinal plant. Centella asiatica International Journal of Pharmacy and Biological Sciences, 4(1), 256–262. Du, H., Su, J., Yu, L., & Zhang, Y. (2013). Isolation and physiological characteristics of endophytic actinobacteria from medicinal plants. Wei Sheng Wu Xue Bao., 53(1), 15–23. Dudeja, S. S., Giri, R., Saini, R., Suneja-Madan, P., & Kothe, E. (2012). Interaction of endophytic microbes with legumes. Journal of Basic Microbiology, 52(3), 248–260. Duvick, J. P., Rood, T., Raro, A. G., & Marshak, D. R. (1992). Purificationand characterization of a novel antimicrobial peptide from maize (Zea mays L.) kernels. Journal of Biological Chemistry, 267, 18814–18820. El-Shatoury, S. A., El-Kraly, O. A., Trujillo, M. E., El-Kazzaz, W. M., El-Din, el-S. G., & Dewedar, A. (2013). Generic and functional diversity in endophytic actinomycetes from wild Compositae plant species at South Sinai-Egypt. Research in Microbiology, 164(7), 761–769. El-Tarabily, K. A., & Sivasithamparam, K. (2006). Non-streptomyceteactinomycetes as biocontrol agents of soil-borne fungal plant pathogens and as plant growth promoters. Soil Biology and Biochemistry, 38, 1505–1520. Engelhard, M., Hurek, T., & Reinhold-Hurek, B. (2000). Preferential occurrenceof diazotrophic endophytes, Azoarcus spp., in wild rice speciesand land races of Oryza sativa in comparison with modern races. Environmental Microbiology, 2, 131–141. Feng, Y., Shen, D., & Song, W. (2006). Rice endophyte Pantoea agglomerans YS19 promotes host plant growth and affects allocations of host photosynthates. Journal of Applied Microbiology, 100, 938–945. Freeman, E. M. (1904). The seed-fungus of Lolium temulentum, L., the Darnel. Philosophical Transactions of the Royal Society B, 196, 1–27. Gangadevi, V., & Muthumary, J. (2008). Isolation of Colletotrichum gloeosporioides, a novel endophytic taxol-producing fungus from the leaves of a medicinal plant, Justicia gendarussa. Mycologia Balcanica, 1–4. Gunatilaka, A. A. L. (2006). Natural products from plant-associated microorganisms: distribution, structural diversity, bioactivity, and implications of their occurrence. Journal of Natural Products, 69, 509–526.

32

Recent Advancements in Microbial Diversity

Hallmann, J., Gabriele, B., & Schulz, B. (2006). Isolation procedures for endophytic microorganisms. Microbial Root Endophytes, 9, 299–319. Hallmann, J., Quadt-Hallmann, A., Mahaffee, W. F., & Kloepper, J. W. (1997). Bacterial endophytes in agricultural crops. Canadian Journal of Microbiology, 43, 895–914. Hamayun, M., Afzal Khan, S., Ahmad, N., Tang, D. S., Kang, S. M., Na, C. I., et al. (2009). Cladosporium sphaerospermum as a new plant growth-promoting endophyte from the roots of Glycine max (L.) Merr. World Journal of Microbiology and Biotechnology, 25(4), 627–632. Harper, J. K., Ford, E. J., Strobel, G. A., Arif, A., Grant, D. M., Porco, J., Tomer, D. P., & Oneill, K. (2003). Pestacin: a 1,3-dihydro isobenzofuran from Pestalotiopsis microspora possessing antioxidant and antimycotic activities. Tetrahedron, 59, 2471–2476. Hasegawa, S., Meguro, A., Shimizu, M., Nishimura, T., & Kunoh, H. (2006). Endophytic actinomycetes and their interactions with host plants. Actinomycetologica, 20, 72–81. Hata, K., & Sone, K. (2008). Isolation of endophytes from leaves of Neolitsea sercea in broad leaf and conifer stans. Mycoscience, 49(4), 229–232. Hou, B. C., Wang, E. T., Li, Y., Jia, R. Z., Chen, W. F., Man, C. X., et al.(2009). Rhizobial resource associated with epidemic legumes in Tibet. Microbial Ecology, 57(1), 69–81. Hurek, T., Handley, L. L., Reinhold-Hurek, B., & Piche, Y. (2002). Azoarcus grass endophytes contribute fixed nitrogen to the plant in an unculturable state. Molecular Plant-Microbe Interactions, 15, 233–242. Igarashi, Y. (2004). Screening of novel bioactive compounds from plant-associated actinomycetes. Actinomycetologica, 18, 63–66. Ikeda, S., Kaneko, T., Okubo, T., Rallos, L. E. E., Eda, S., Mitsui, H., et al. (2009). Development of a bacterial cell enrichment method and its application to the community analysis in soybean stems. Microbiology Ecology, 58, 703–714. Ikeda, S., Kaneko, T., Okubo, T., Rallos, L. E. E., Eda, S., Mitsui, H., et al. (2010). Community shifts of soybean stem-associated bacteria responding to different nodulation phenotypes and N levels. ISME Journal, 4, 315–326. Iniguez, A. L., Dong, Y., & Triplett, E. W. (2004). Nitrogen fixation in wheat provided by Klebsiella pneumonia 342. Molecular Plant-Microbe Interactions, 17, 1078–1085. Iniguez, A. L., Dong, Y., Carter, H. D., Ahmer, B. M. M., Stone, J. M., & Triplett, E. W. (2005). Regulation of enteric endophytic bacterial colonization by plant defenses. Molecular PlantMicrobe Interactions, 18, 169–178. Janso, J. E., & Carter, G. T. (2010). Biosynthetic potential of phylogenetically unique endophytic actinomycetes from tropical plants. Applied and Environmental Microbiology, 76(13), 4377–4386. Jiao, J. Y., Wang, H. X., Zeng, Y., & Shen, Y. M. (2006). Enrichment for microbes living in association with plant tissues. Journal of Applied Microbiology, 100, 830–837. Joseph, B., & Mini Priya, R. (2011). Bioactive compounds from endophytes and their potential in pharmaceutical effect: a review. The American Journal of Biochemistry and Molecular Biology, 1(3), 291–309. Jung, H. J., Kim, Y., Lee, H. B., & Kwon, H. J. (2015). Antiangiogenic activity of the lipophilic antimicrobial peptides from an endophytic bacterial strain isolated from red pepper leaf. Molecules and Cells, 38(3), 273. Kawaguchi, M., & Minamisawa, K. (2010). Plant–microbe communications for symbiosis plant and cell physiology. Plant Cell Physiology, 51(9), 1377–1380. Khanam, B., & Chandra, R. (2015). Isolation and identification of endophytic bacteria producing bright red pigment from the dye yielding plant Beta vulgaris L. International Journal of Pharmacy and Pharmaceutical Sciences 7. (5), 220–224.

Microbial endophytes of plants Chapter | 2

33

Kusari, S., Zühlke, S., & Spiteller, M. (2009). An endophytic fungus from Camptotheca acuminata that produces camptothecin and analogues. Journal of Natural Products, 72(1), 2–7. Lee, J. C., Strobel, G. A., Lobkovsky, E., & Clardy, J. (1996). Torreyanic acid: a selectively cytotoxic quinone dimer from the endophytic fungus Pestalotiopsis microspora. The Journal of Organic Chemistry, 61(10), 3232–3233. Lee, J., Lobkovsky, E., Pliam, N. B., Strobel, G. A., & Clardy, J. (1995). Subglutinols A and B: immunosuppressive compounds from the endophytic fungus Fusarium subglutinans. The Journal of Organic Chemistry, 60, 7076–7077. Liu, J.J., Chen, S.J., & Gong, H.X. (2008). Study on endophytic fungi producing orange pigment isolated from Ginkgo Biloba L. Liu, K., Ding, X., Deng, B., & Chen, W. (2009). Isolation and characterization of endophytic taxolproducing fungi from Taxus chinensis. Journal of Industrial Microbiology and Biotechnology, 36(9), 1171–1177. Liu, K., Ding, X., Deng, B., & Chen, W. (2010). 10-Hydroxycamptothecin produced by a new endophytic Xylaria sp., M20, from Camptotheca acuminata. Biotechnology Letters, 32(5), 689–693. Lu, C., & Shen, Y. (2007). A novel ansamycin, naphthomycin K from Streptomyces sp. The Journal of Antibiotics, 60(10), 649–653. Lugtenberg, B. (2015). Principles of plant-microbe interactions. 10.1007/978-3-319-08575-33. Luo, S., Xu, T., Chen, L., Chen, J., Rao, C., Xiao, X., et al. (2012). Endophyte-assisted promotion of biomass production and metal-uptake of energy crop sweet sorghum by plant-growth-promoting endophyte Bacillus sp.SLS18. Applied Microbiology and Biotechnology, 93(4), 1745–1753. Ma, Y. T., Qiao, R., Shi, W. Q., Zhang, A. L., & Gao, J. M. (2010). Metabolites produced by an endophyte Alternaria alternate isolated from Maytenus hookeri. Chemistry of Natural Compounds, 504–506. Marín, F., Navarrete, H., & Narvaez-Trujillo, A. (2018). Total petroleum hydrocarbon degradation by endophytic fungi from the Ecuadorian Amazon. Advances in Microbiology, 8(12), 1029. Mayak, S., Tirosh, T., & Glick, B. R. (2004). Plant-growth promoting bacteria that confer resistance to water stress in tomato and pepper. Plant Science, 166, 525–530. McPhee, J. B., Scott, M. G., & Hancock, R. E. (2005). Design of host defence peptides for antimicrobial and immunity enhancing activities. Combinatorial Chemistry & High Throughput Screening, 8, 257–272. Mishra, A., Gond, S. K., Kumar, A., Sharma, V. K., Verma, S. K., Kharwar, R. N., et al. (2012). Season and tissue type affect fungal endophyte communities of the Indian medicinal plant Tinospora cordifolia more strongly than geographic location. Microbial Ecology, 64, 3288–3398. Mittermeier, R. A., Meyers, N., Gil, P. R., & Mittermeier, C. G. (1999). Hotspots: Earth’s biologically richest and most endangered ecoregions. Tokyo, Japan: Toppan Printing Co. CEMEX S.A. and Conservation International, Mexico City, pp 430. Nair, D. N., & Padmavathy, S. (2014). Impact of Endophytic Microorganisms on Plants, Environment and Humans. The Scientific World Journal Article ID 250693. Patakova, P. (2013). Monascus secondary metabolites: production and biological activity. Journal of industrial microbiology & biotechnology, 40(2), 169–181. Pillay, V. K., & Nowak, J. (1997). Inoculum density, temperature, and genotype effects on in vitro growth promotion and epiphytic and endophytic colonization of tomato (Lycopersicon esculentum L.) seedlings inoculated with a pseudomonad bacterium. Canadian Journal of Microbiology, 43, 354–361. Pullen, C., Schmitz, P., Meurer, K., Bamberg, D. D., Lohmann, S., Franc, S. D. C., et al. (2002). New and bioactive compounds from Streptomyces strains residing in the wood of Celastraceae. Planta, 216, 162–167.

34

Recent Advancements in Microbial Diversity

Qin, S., Li, J., Chen, H. H., Zhao, G. Z., Zhu, W. Y., Jiang, C. L., et al. (2009). Isolation, diversity, and antimicrobial activity of rare actinobacteria from medicinal plants of tropical rain forests in Xishuangbanna, China. Applied and Environmental Microbiology, 75, 6176–6186. Qin, S., Xing, K., Jiang, J., Xu, L. H., & Li, W. J. (2011). Biodiversity, bioactive natural products and biotechnological potential of plant-associated endophytic Actinobacteria. Applied Microbiology and Biotechnology, 89(3), 457–473. Qiu, M., Xie, R., Shi, Y., Chen, H., Wen, Y., Gao, Y., & Hu, X. (2010). Isolation and identification of endophytic fungus SX01, a red pigment producer from Ginkgo biloba L. World Journal of Microbiology and Biotechnology, 26(6), 993–998. Rajagopal, L., Sundari, C. S., Balasubramanian, D., & Sonti, R. V. (1997). The bacterial pigment xanthomonadin offers protection against photodamage. FEBS Letters, 415(2), 125–128. Ramos-Gonzalez, M. I., Campos, M. J., & Ramos, J. L. (2005). Analysis of Pseudomonas putida KT2440 gene expression in the maize rhizosphere: In vivo expression technology capture and identification of root-activated promoters. Journal of Bacteriology, 187, 4033–4041. Rediers, H., Rainey, P. B., Vanderleyden, J., & De Mot, R. (2005). Unraveling the secret lives of bacteria: Use of in vivo expression technologyand differential fluorescence induction promoter traps as tools for exploring niche-specific gene expression. Microbiology and Molecular Biology Reviews, 69, 217–261. Rehman, S., Shawl, A. S., Kour, A., Andrabi, R., Sudan, P., Sultan, P., et al. (2008). An endophytic Neurospora sp. from Nothapodytes foetida producing camptothecin. Applied biochemistry and microbiology, 44(2), 203–209. Reinhold-Hurek, B., & Hurek, T. (1998). Interactions of gramineous plants with Azoarcus spp. and other diazotrophs: Identification, localization, and perspectives to study their function. Critical Reviews in Plant Sciences, 17, 29–54. Rosenblueth, M., & Martinez Romero, E. (2004). Rhizobium etli maize populations and theier competitiveness for root colonization. Archives of Microbiology, 181, 337–344. Rungin, S., Indanand, C., Suttiviriya, P., Kruasuwan, W., Jaemsaeng, R., & Thamchaipenet, A. (2012). Plant growth enhancing effects by a siderophore producing endophytic streptomycete isolated from a Thai jasmine rice plant (Oryza sativa L. cv. KDML105). Antonie van Leeuwenhoek, 102, 463–472. Russell, J. R., Huang, J., Anand, P., Kucera, K., Sandoval, A. G., Dantzler, K. W., et al. (2011). Biodegradation of polyester polyurethane by endophytic fungi. Applied and Environmental Microbiology, 77(17), 6076–6084. Ryan, R. P., Germaine, K., Franks, A., Ryan, D. J., & Dowling, D. N. (2008). Bacterial endophytes: recent development and applications. FEMS Micribiology Letters, 278, 1–9. Sarang, H., Rajani, P., Vasanthakumari, M. M., Kumara, P. M., Siva, R., Ravikanth, G., et al. (2017). An endophytic fungus, Gibberella moniliformis from Lawsonia inermis L. produces lawsone, an orange-red pigment. Antonie van Leeuwenhoek, 110(7), 853–862. Sarma, R. K., & Saikia, R. (2014). Alleviation of drought stress in mung bean by strain Pseudomonas aeruginosa GGRJ21. Plant and Soil, 377, 111–126. Sessitsch, A., Reiter, B., & Berg, G. (2004). Endophytic bacterial communities of field-grown potato plants and their plant-growth-promoting and antagonistic abilities. Canadian Journal of Microbiology, 50, 239–249. Sevilla, M., Burris, R. H., Gunapala, N., & Kennedy, C. (2011). Comparison of benefit to sugarcane plant growth and 15N2 incorporation following inoculation of sterile plants with Acetobacter diazotrophicus wild type and Nif–mutants strains. Molecular Plant-Microbe Interaction, 14, 358–366.

Microbial endophytes of plants Chapter | 2

35

Shimizu, M. (2011). Endophytic actinomycetes: biocontrol agentsand growth promoters. In D. K. Maheshwari (Ed.), Bacteria in agrobiology: plant growth responses (pp. 201–220). San Diego: Elsevier Academic Press. Shweta, S., Zuehlke, S., Ramesha, B. T., Priti, V., Kumar, P. M., Ravikanth, G., et al. (2010). Endophytic fungal strains of Fusarium solani, from Apodytes dimidiata E. Mey. ex Arn (Icacinaceae) produce camptothecin, 10-hydroxycamptothecin and 9-methoxycamptothecin. Phytochemistry, 71(1), 117–122. Singh, M. J., & Sedhuraman, P. (2015). Biosurfactant, polythene, plastic, and diesel biodegradation activity of endophytic Nocardiopsis sp. mrinalini9 isolated from Hibiscus rosasinensis leaves. Bioresources and Bioprocessing, 2(1), 2. Singh, M., Kumar, A., Singh, R., & Pandey, K. D. (2017). Endophytic bacteria: a new source of bioactive compounds. 3 Biotech, 7(5), 315. Song, Y. C., Huang, W. Y., Sun, C., Wang, F. W., & Tan, R. X. (2005). Characterization of graphislactone A as the antioxidant and free radical-scavenging substance from the culture of Cephalosporium sp. IFB-E001, an endophytic fungus in Trachelospermum jasminoides. Biological and Pharmaceutical Bulletin, 28(3), 506–509. Sorkhoh, N. A., Al-Mailem, D. M., Ali, N., Al-Awadhi, H., Salamah, S., Eliyas, M., et al. (2011). Bioremediation of volatile oil hydrocarbons by epiphytic bacteria associated with American grass (Cynodon sp.) and broad bean (Vicia faba) leaves. International Biodeterioration & Biodegradation, 65(6), 797–802. Strobel, G., Stierle, A., Stierle, D., & Hess, W. M. (1993). Taxomyces andreanae, a proposed new taxon for a bulbilliferous hyphomycete associated with Pacific yew (Taxus brevifolia). Mycotaxon, 47, 71–80. Strobel, G. A., & Daisy, B. (2003). Bioprospecting for microbial endophytes and their natural products. Microbiology and Molecular Biology Reviews, 67, 491–502. Strobel, G. A., Ford, E., Worapong, J., Harper, J. K., Arif, A. M., Grant, D. M., et al. (2002). Ispoestacin, an isobenzofuranone from Pestalotiopsis microspora, possessing antifungal and antioxidant activities. Phytochemistry, 60, 179–183. Suryanarayanan, T. S., Ravishankar, J. P., Venkatesan, G., & Murali, T. S. (2004). Characterization of the melanin pigment of a cosmopolitan fungal endophyte. Mycological Research, 108(8), 974–978. Taechowisan, T., & Lumyong, S. (2003). Activity of endophytic actinomycetes from roots of Zingiber officinale and Alpinia galanga against phytopathogenic fungi. Annals of Microbiology, 53(3), 291–298. Tan, A. F., Long, L. Y., Nagahawatte, K., & Mueller, M. (2018). Shades of fungi-A review of pigments from endophytic fungi. Malaysian Journal of Microbiology, 14(1), 70–79. Tan, H. M., Cao, L. X., He, Z. F., Su, G. J., Lin, B., & Zhou, S. N. (2006). Isolation of endophytic actinomycetes from different cultivars of tomato and their activities against Ralstonia solanacearumin vitro. World Journal of Microbiology and Biotechnology, 22, 1275–1280. Tan, Z., Hurek, T., & Reinhold-Hurek, B. (2003). Effect of N-fertilization, plant genotype and environmental conditions on nifH gene pools inroots of rice. Environmental Microbiology, 5, 1009–1015. Tian, X. L., Cao, L. X., Tan, H. M., Han, W. Q., Chen, M., Liu, Y. H., et al. (2007). Diversity of cultivated and uncultivated actinobacterial endophytes in the stems and roots of rice. Microbiology Ecology, 53, 700–707. Vendruscolo, F., Bühler, R. M. M., de Carvalho, J. C., de Oliveira, D., Moritz, D. E., Schmidell, W., et al. (2016). Monascus: a reality on the production and application of microbial pigments. Applied Biochemistry and Biotechnology, 178(2), 211–223.

36

Recent Advancements in Microbial Diversity

Verma, V. C., Gond, S. K., Kumar, A., Mishra, A., Kharwar, R. N., & Gange, A. C. (2009b). Endophytic actinomycetes from Azadirachta indica A. Juss: isolation, diversity, and anti-microbial activity. Microbial Ecology, 57, 749–756. Verma, V. C., Kharwar, R. N., & Strobel, G. A. (2009a). Chemical andfunctional diversity of natural products from plant associated endophytic fungi. Natural Product Communications, 11, 1511–1532. Visalakchi, S., & Muthumary, J. (2009). Antimicrobial activity of the new endophytic Monodictys castaneae SVJM139 pigment and its optimization. African Journal of Microbiology Research, 4(9), 550–556. Vogl, A. E. (1898). Mehl und die anderen Meblprodukte der Cerealien und Leguminosen. Nahrungsm. Unters. Hyg. Warenk., 12, 25–29. Wagenaar, M. M., Corwin, J., Strobel, G., & Clardy, J. (2000). Three new cytochalasins produced by an endophytic fungus in the genus Rhinocladiella. Journal of Natural Products, 63(12), 1692–1695. Waller, F., Achatz, B., Baltruschat, H., Fodor, J., Becker, K., Fischer, M., et al. (2005). The endophytic fungus Piriformospora indica reprograms barley to salt-stress tolerance, disease resistance, and higher yield. Proceedings of National Academy of Sciences of the United State of America, 102, 13386–13391. Walsh, T. A. (1992). Inhibitors of β glucansynthesis. In J. A. Sutcliffe, & N. H. Georgopapadakou (Eds.), Emerging targets in antibacterial and antifungal chemotherapy (pp. 349–373). London: Chapman and Hall. Wang, H. X., Geng, Z. L., Zeng, Y., & Shen, Y. M. (2008). Enrichment plant microbiota for a metagenomic library construction. Environmental Microbiology, 10, 2684–2691. Wang, P., Kong, F., Wei, J., Wang, Y., Wang, W., Hong, K., & Zhu, W. (2014). Alkaloids from the mangrove-derived actinomycetes Jishengella endophytica 161111. Mar Drugs, 12(1), 477–490. Wang, Y., & Dai, C. C. (2011). Endophytes: a potential resource for biosynthesis, biotransformation, and biodegradation. Annals of Microbiology, 61(2), 207–215. Xin, G., Zhang, G., Kang, J. W., Staley, J. T., & Doty, S. L. (2009). A diazotrophic, indole-3-acetic acid-producing endophyte from wild cottonwood. Biology and Fertility of Soils, 669–674. Yu, H., Zhang, L., Li, L., Zheng, C., Guo, L., Li, W., et al. (2010). Recent developments and future prospects of antimicrobial metabolites produced by endophytes. Microbiological Research, 165, 437–449. Zhang, B., Salituro, G., Szalkowski, D., Li, Z., Zhag, Y., Royo, I., et al. (1999). Discovery of small molecule insulin mimetic with antidiabetic activity in mice. Science, 284, 974–981. Zhang, J. Y., Tao, L. Y., Liang, Y. J., Yan, Y. Y., Dai, C. L., Xia, X. K., et al. (2009). Secalonic acid D induced leukemia cell apoptosis and cell cycle arrest of G1 with involvement of GSK3β/β-catenin/c-Myc pathway. Cell Cycle, 8(15), 2444–2450. Zhao, K., Penttinen, P., Guan, T., Xiao, J., Chen, Q., Xu, J., et al. (2011). The diversity and antimicrobial activity of endophytic actinomycetes isolated from medicinal plants in Panxi Plateau China. Current Microbiology, 62(1), 182–190. Zhou, H., Yang, Y., Zhang, J., Peng, T., Zhao, L., Xu, L., & Ding, Z. (2013). Alkaloids from an endophytic Streptomyces sp.YIM66017. Natural Product Communications, 8(10), 1393–1396. Zhu, N., Zhao, P., & Shen, Y. (2009). Selective isolation and ansamycin-targeted screenings of commensal actinomycetes from the “maytansinoids-producing” arboreal Trewia nudiflora. Current Microbiology, 58, 7–94. Zhu, X., Ni, X., Waigi, M., Liu, J., Sun, K., & Gao, Y. (2016). Biodegradation of mixed PAHs by PAH-degrading endophytic bacteria. International Journal of Environmental Research and Public Health, 13(8), 805.

Chapter 3

A spotlight on the recent advances in bacterial plant diseases and their footprint on crop production Tushar Joshia,b, Priyanka Sharmac, Tanuja Joshib, Satish Chandra Pandeyd, Veni Panded, Anupam Pandeye, Diksha Joshid, Priyanka Maitib, Mahesha Nandf and Subhash Chandrab a

Department of Biotechnology, Kumaun University, Bhimtal Campus, Bhimtal, Uttarakhand, India; bDepartment of Botany, Kumaun University, SSJ Campus, Almora, Uttarakhand, India; c Department of Botany, Kumaun University, DSB Campus, Nainital, Uttarakhand, India; d Cell and Molecular Biology Laboratory, Department of Zoology, Kumaun University, SSJ Campus, Almora, Uttarakhand, India; eICAR-Directorate of Coldwater Fisheries Research, Bhimtal, Uttarakhand, India; fG.B. Pant National Institute of Himalayan Environment & Sustainable Development, Kosi-Katarmal, Almora, Uttarakhand, India

1 Introduction Microbes are important organisms of the ecosystem and play various key roles in the environment. The diversity of microbes includes viruses, bacteria, fungi, nematodes, and insects, which approximates 7100 species. Some microbes are essential for plant growth while some microbes are harmful to plants. Among these, approximately 150 microbes belong to bacterial species that cause diseases in plants (Kannan, Bastas, & Antony, 2015). Bacteria appeared on Earth long before plants, birds, human beings as well as water or land-based animals, and they are present everywhere in the environment, ranging from the surface of living beings, dead material to the rhizosphere. These are also involved in various kinds of activities. Bacteria have employed harmful as well as beneficial effects on their hosts (Borkar & Yumlembam, 2017). The beneficial bacteria play a different kind of roles in animals and plants. In animals, beneficial bacteria are involved in diverse processes as digestion whereas, in some plants, bacteria fixed nitrogen in the roots of certain legumes. On the other hand, pathogenic bacteria spread dangerous and deadly diseases in humans, animals as well as in plants (Williams, Boehm, & Peduto, 2017). Plant disease is a defacement of a plant’s normal state that affects or changes its necessary functions. Plant pathogenic Recent Advancements in Microbial Diversity. http://dx.doi.org/10.1016/B978-0-12-821265-3.00003-7 Copyright © 2020 Elsevier Inc. All rights reserved.

37

38

Recent Advancements in Microbial Diversity

bacteria may spread serious and economically damaging diseases, ranging from spots, mosaic patterns or pustules on leaves and fruits, or smelly tuber rots to plant death. Bacterial and fungal disease symptoms are almost (Gangola Joshi, Kumar, & Pandey, 2019). Plant pathogenic bacteria develop as parasites on host plants known as heterotrophic organisms. Plant pathogenic bacteria are unable to penetrate directly into plant tissue. Bacterial Infection generally takes place from natural openings like stomata, hydathodes, nectaroides as well as through injuries. The major spot of infection seen to be leaf scars (Sobiczewski, 2008). The bacterial infection symptoms are namely; wilts, scabs, cankers, leaf spots, blights and soft rots of roots, storage organs and fruit, and overgrowth. These diseases do major loss of many crops like cucumbers, potatoes, tobacco, cabbage, tomatoes, and cotton. Based on the extent of damage to plant tissue bacterial diseases characterized into four broad can be categories and the symptoms they cause, which include necrosis, soft rot, vascular wilt, and tumors. Vascular wilt results from bacterial invasion of the vascular system of the plant. Some bacterial groups interfere with the transport of water and nutrients in the plant by growing in either the xylem or phloem tissues. Bacterial diseases can result in systemic death of the whole plant or individual parts. They may appear on the roots or in the vascular system or locally limited to infection of individual parts or organs of the plant and also appearing in parenchymatous tissues or they may be of a mixed nature. About 42% of the world’s agricultural crop is destroyed by diseases yearly (Chandrashekara, Raju, & Chandrashekara, 2012). The pathogens causing plant disease mainly belong to the family viz. Xanthomonadaceae, Pseudomonadaceae, and Enterobacteriaceae. They target all types of plants that can supply appropriate food and shelter on their surfaces as well as in their tissue regions. The most common phytopathogenic genera are Erwinia, Pectobacterium, Pantoea, Agrobacterium, Pseudomonas, Ralstonia, Burkholderia, Acidovorax, Xanthomonas, Clavibacter, Streptomyces, Xylella, Spiroplasma, andPhytoplasma. The Phytopathogenic bacteria often cause hormonal imbalances that result in stunting, overgrowth, galls, root branches, defoliation, resetting, leaf epinasty, and others in infected plants. Farmers often struggle with more than one pest or disease as well as new pesticide-resistant pathogenic strains attacking the same crop. However, crop losses can be minimized and specific treatments through natural sources can be attaining to combat specific pathogens if plant diseases are correctly diagnosed and identified early. These need-based treatments also become helpful economically and at the environmental level (Chandrashekara et al., 2012). Management of these diseases mainly relies on applications of bactericides containing copper compounds or antibiotics (Cameron & Sarojini, 2014; Lamichhane, 2014). However, the selection of resistant pathogen populations and phytotoxicity are the main drawbacks of this practice (Lalancette & McFarland, 2007; McManus, Stockwell, Sundin, & Jones, 2002). To detect and treat the plant diseases, some advanced techniques are used in molecular biology, plant pathology, and biotechnology. These techniques require minimum processing time and are more accurate in identifying

A spotlight on the recent advances in bacterial plant diseases Chapter | 3

39

these pathogens. In this chapter, we will discuss the major bacterial disease associated with plant disease caused by the bacterial community and the several advanced techniques to overcome the problem of bacterial diseases in plants.

2  Bacterial communities Bacterial communities are the different groups of bacteria that interact with each other and occupy the same physical location. It has been found that these communities vary in species composition and niches where they live. They influence on different environments differently by interactive processes. In this process, many times they exert a negative impact by causing disease to a living organism. Robert Koch was a pioneering scientist who established the relationship between a microorganism and disease (Koch, 1876). For macroscopic organisms, it is easy to draw physical boundaries and envisions a community as the assemblage of fish in a pond or insects living in a tree (Stubbendieck, Vargas-Bautista, & Straight, 2016). Some of the plant diseases caused by bacteria are summarized in Table 3.1.

2.1  Bacterial community association 2.1.1  With leaves Association of bacterial species with plant leaves known as phyllobacteria. Leaves are common residents of bacterial communities known as phyllosphere communities. Some phyllosphere communities show variation in species consisting of more than 78 bacterial species which represent about 37 bacterial genera (Legard et al., 1994). The diversity of bacterial collection found on plant leaves can visibly affect the health of host plants under suitable conditions, such as by inciting disease or ice formation or by producing plant hormones that alter plant growth. There are the following types of diseases caused by bacteria in plant leaves. 2.1.1.1  Leaf spots Leaf spots (other names: anthracnose, scab, leaf blotch, shot hole) are usually rather definite spots of varying sizes, shapes and colors. Bacterial leaf spot, caused by four distinct species of Xanthomonas (X. vesicatoria, X. euvesicatoria, X. perforans, and X. gardneri), can affect tomato and one of these species (X. vesicatoria) also can affect pepper (Mwendo, Ochwo-ssemakula, Lamo, Gibson, & Edema, 2017). Xanthomonascampestrispv. affects araliaceous plants and cause leaf spot disease (Tolba, 2017). There is nearly always a distinctive margin, sometimes the spot. Bacterial leaf spot (Fig. 3.1A) can occur on all aboveground parts: leaves, stems, and fruit. On leaves, Spots have generally water-soaked (or greasy) appearance, particularly during heavy and wet periods. The common sizes of spots are 3–5 mm but spots may be mobilized and result in a blighted appearance of the lower or affected leaves and it eventually turns

Causing bacteria

Hosts

Symptoms and signs

Additional features

Granville Wilt

Pseudomonas solanacearum

Tobacco, tomato, potato, eggplant, pepper, banana, geranium, ginger, olive, rose, and soybean.

stunting, yellowing, and wilting of parts above ground; roots decay and become black or brown

Occurs in most countries in temperate and semitropical zones; causes crop losses of hundreds of millions of dollars

Fire blight

Erwinia amylovora

Apple and Pear

blossoms appear water-soaked and shrivel; spreads to leaves and stems, causing rapid dieback

First plant disease proved to be caused by a bacterium

Wildfire Of Tobacco

Pseudomonas syringae

Tobacco

yellowish green spots on leaves

Wildfire of tobacco occurs worldwide; causes losses in seedlings and field plants

Blight of Beans

Xanthomonas campestris

Beans

(common blight) yellowish green spots on leaves

Most phytopathogenic xanthomonads and pseudomonads cause necrotic spots on green parts of susceptible hosts; may be localized or systemic

Brown spot and halo blight disease

Pseudomonas syringae

Beans (brown spot), tomatoes (halo blight disease)

small water-soaked spots on lower side of leaves enlarge

Coalesce, and become necrotic

Soft rot

Erwinia carotovora

Many fleshy tissue fruits —e.g., cabbage, carrot, celery, onion

soft decay of fleshy tissues that become mushy and soft

occurs worldwide; causes major economic losses

Crown Gall

Agrobacterium tumefaciens

More than 100 genera of woody and herbaceous plants

initially a small enlargement of stems or roots usually at or near the soil line, increasing in size, becoming wrinkled, and turning brown to black

The conversion of a normal cell to one that produces excessive cell multiplication is caused by a plasmid (a small circular piece of DNA) carried by the pathogenic bacterium

Recent Advancements in Microbial Diversity

Disease

40

TABLE 3.1 Some bacteria causing plant diseases, their hosts, Symptoms, signs and additional features.

Causing bacteria

Hosts

Symptoms and signs

Additional features

Aster Yellows

Mycoplasmalike organism (MLO)

Many vegetales, ornamentals and weeds.

Chlorosis dwarfing malformations

Greatest losses suffered by carrots; transmission by leafhoppers

Citrus Stubborn Disease

Spiroplasma citri (MLO)

Citrus and stone fruits and vegetables

Chlorosis, yellowing of leaves, shortened internodes, wilting

First MLO pathogen of plant disease cultured

Bacterial blight (BB) Disease

Xanthomonas oryzae pv. oryzae

Rice, Buffelgrass, Chinese sprangletop

leaves of young plants as palegreen to grey-green, watersoaked streaks near the leaf tip and margins, lesions coalesce

Occur in tropical rice producing countries of Asia during rainy season

Leafy gall disease

Rhodococcus fascians

Tobacco, small fruits (caneberries, strawberries) and ornamental plants (butterflyflowers, Primula, kalanchoes, Impatiens, geraniums, carnations)

Distorted leafy shoots

Generally summer, but depends on plant affected

Bacterial wilt or Granville wilt, Moko

Ralstonia solanacearum

Tobacco, Banana

Affected leaves turn yellow and remain wilted after a time. The area between leaf veins dies and browns

Occurs in averages rainfall and average winter temperatures (< 10 °C), average summer temperatures(< 21 °C) and the average yearly temperature(> 23 °C)

Infecting the roots

Pseudomonas aeruginosa

Sweet basil

Black necrotic regions at the root tips

Optimum temperature for growth is 37 °C, but P. aeruginosa also grows at temperatures as high as 42 °C

Beet vascular necrosis and blackleg

Pectobacterium carotovorum

Carrot, Potato, Tomato

Petioles become necrotic and demonstrate vascular necrosis

Occurs in tropical and temperate regions

A spotlight on the recent advances in bacterial plant diseases Chapter | 3

Disease

41

42

Recent Advancements in Microbial Diversity

FIGURE 3.1  Plant associated bacterial diseases in various parts of the plants.

dark brown in the wounded area and the area around the spots will turn yellow. The common names of leaf spot diseases like bacterial leaf spot; descriptive, such as frog-eye leaf spot. 2.1.1.2  Leaf blights The areas of leaf blights diseased are larger than leaf spots and more irregularly shaped. Among of all disease, a major hazardous disease to rice is leaf blight disease caused by Xanthomonas oryzae pv. oryzae (Xoo) (Wen, Chu, & Wang, 2003). Sometimes the “blighting” appearance of leaves is the result of the coalescence of numerous small spots (Fig. 3.1B & C). Usually, bacterial blight resistances are two types: (1) vertical resistance (2) horizontal inheritance. Vertical resistance is race-specific, can easily intersect and has a monogenic inheritance(Mew, Vera Cruz, & Medalla, 1992); and (2) horizontal inheritance is a complex, non-race-specific polygenic inheritance (Nelson, 1972). It has been observed that because of blight disease, each year 15 to 25% of yield losses anomaly. Usually, the common name includes the word “blight” such as Southern corn leaf blight or early blight.

2.1.2  With root Root diseases are caused in the plant system by a wide range of pathogenic bacteria. Soil-borne root diseases are one of the most complex problems associated

A spotlight on the recent advances in bacterial plant diseases Chapter | 3

43

with achieving agriculture sustainability. Pathogenic bacteria are always active in the soils and environments and are an extreme challenge for farmers. It can also favor plant root diseases by combining plant material, moisture, and certain environmental conditions. There are the following types of diseases in plant roots produce by pathogenic bacteria. 2.1.2.1  Hairy root disease Agrobacterium rhizogenes bacterium is a Gram-negative soil bacterium, causes hairy root disease in plants and it occurs in many dicotyledonous plants. It was first described in the early 20th century as an economic importance pathogen on apples. When Agrobacterium rhizogenes, infects plants, adventitious roots called ‘hairy roots’ are stimulated from the wounded site (Fig. 3.1D & E). These incidents happen because of the transfer of the specific DNA region called transfer DNA (T-DNA) containing the loci between the TR and TL regions of the root-inducing (Ri) plasmid of the bacterium into the plant genome(Muranaka & Saito, 2010). 2.1.2.2  Granville wilt Granville Wilt disease induces by Pseudomonas solanacearum and Ralstonia solanacearum bacteria. This disease generally affects the eggplant, tobacco, pepper, potato, tomato, and other plants. The symptoms and signs of disease are stunting, yellowing, and wilting of parts above the ground (Fig. 3.1F) roots decay and become black or brown. This disease occurs in the temperate and semi-tropical areas in most countries, it causes hundreds of millions of dollars in crop losses. 2.1.2.3  Root rot disease Root rot disease generally caused by Erwinia chrysanthemi can be economically important because it destroys plants and fleshy roots. The amounts of losses due to the disease have not been reported. This disease is more common in storage but can also affect field plants and seedlings. The first symptom is the plant’s partial wilting; one or two branches can wilt, and the entire plant can collapse and die. Under certain conditions, tissue discoloration within the stem may also occur. At the base of stems and on petioles Water-soaked, sunken brown to black lesions are found. The disease starts with small spots developing overnight and becoming larger lesions. Localized lesions are found on fibrous roots, but it is possible to affect the entire root system, giving the distinctive dark, water-soaked appearance. The root of vascular tissue also has a dark streak (Fig. 3.1G & H). Tiny, sunken brown lesions with black margins can be found on the surface on storage roots, but rotting occurs internally more often without external evidence. The tissue affected becomes watery. In storage, the disease is more common than in field.

44

Recent Advancements in Microbial Diversity

2.1.3  With fruit Fruits are an important part of any trees and from a social aspect, fruits help people become connected to the growing process while also providing a nutritious food source and food security but some disease caused by bacteria and other pathogens that destroys fruits yields (A. Pandey et al., 2019; A. Pandey et al., 2019). Some of the bacterial diseases associated with fruits are as follow. 2.1.3.1  Fire blight disease Fire blight is a widespread bacterial disease of apples and pears and that is very destructive (Fig. 3.1). The disease is produced by the Erwinia amylovora bacterium, which can infect several plants in the rose family (Rosaceae) and cause severe damage. The disease will destroy blossoms, fruit, shoots, twigs, branches and whole trees on apples and pears (Fig. 3.1I). Although young trees can be destroyed in one season, older trees can live for several years, even if the dieback continuous (Ivey, 2016). Fire blight always emerges in the spring when temperatures are above 65 degrees F. infection happens generally in Prefer precipitation, heavy dews, and high humidity. For infection to occur specific environmental conditions are required and as a result, the occurrence of the disease varies considerably from year to year. 2.1.3.2  Bacterial spot of stone fruits Bacterial spot disease affects many fruits like peaches, nectarines, apricots, plums, prunes, and cherries. This disease is caused by bacterium Xanthomonas pruni. The symptoms appear in fruits are Small, round olive-brown to black spots (Fig. 3.1J). They are usually puffy and often surrounded by a watersoaked rim. Usually, spots appear on the side exposed to the sun On peaches. Spots will slowly expand and combine to cover large abnormal areas on the fruit. The spots can exude a yellowish gum on some species after rainy periods. During fruit enlargement, skin cracking and pitting can appear across the spots. Infected fruit is typically the most malformed at an early stage of development. On plums, symptoms are different than on peaches. Large, sunken, black spots form on some varieties; on others, small pit-like lesions are common.

2.1.4  With bark The bark is a necessary part of a tree, and bark provides key nutrients and moisture it needs to grow. Barks also protect the tree from outside dangerous and act like a tree guard, especially over the winter months when rodents are hidden under the snow and eat the bark of the tree. If a in a continuous band (girdled) the bark of the tree is deeply eaten, possibilities are that tree will not grow. Some bacterial communities also infect the tree bark and cause diseases like bacterial canker and Bacterial wet wood.

A spotlight on the recent advances in bacterial plant diseases Chapter | 3

45

2.1.4.1  Bacterial canker Bacterial canker is most prevalent on cherries and plums, but it can also affect apricots, peaches and many other kinds of stone fruits and diseases caused by Pseudomonas syringae. This bacterium enters trees through an infected bark or an existing injury, such as a pruning cut on a twig or branch. The disease generally occurs during fall, winter and early spring (during cool, wet weather) and are spread by rain or water, and pruning tools. The canker symptoms mostly appear in the bark. The tumors are darker than the healthy bark that covers them and the underlying tissue becomes reddish-brown to black and sticky and soursmelling sap can ooze from these wounded areas (Fig. 3.1K). This disease can be suspect by some signs like sunken, water-soaked or “gummy” lesions form on the trunk or twigs. 2.1.4.2  Bacterial wet wood Bacterial wet wood (bacterial slime, slime flux) is a common disease caused by several bacteria; including species of Enterobacter, Klebsiella, and Pseudomonas that affect the central core of many shades and forest trees. In Colorado, the disease is most prevalent in aspen, cottonwood, elm, and willow. This disease also infects plant species of apple, ash, birch, cherry, fir, honey locust, linden, maple, oak, sycamore, plum, and poplars. Wet wood-related bacteria are common in soil and water and likely to enter trees through root wounds while still young. The bacteria may be moved to a new stem or branch wounds where oozing occurs. Symptoms of the wet wood disorder include a yellow-brown discoloration of the wood, generally confined to the central core of the tree (Fig. 3.1L). This infected wood is wetter than the wood surrounding it and is under strong inner gas pressure. Gas pressure build-up is a by-product of bacterial activity. In elms, the gas consists mainly of methane and nitrogen. 2.1.4.3  Bamboo wilt disease Bamboo wilt disease affects bamboo plants and bamboo is susceptible to several diseases and disorders that affect bamboo plants in nurseries, plantations, and natural stands. It is estimated that about 170 species of bamboos belonging to 26 genera were affected by numerous diseases and disorders (Mohanan, 1997). These diseases and disorders have been associated with a total of 440 fungi, three bacteria, two viruses, one phytoplasma (mycoplasma-like organism) and one bacteria-like organism (Mohanan, 2004). Bacterial wilt of Taiwan giant bamboo, Sinocalamus latiflorus (Munro) McClure caused by Erwinia sinoaalami Lo, Ghon and Huang has been reported from Taiwan.

3  Mechanisms of bacterial plant disease Susceptibility to microorganism infectious disease depends on the physiological and immunological condition of the host and the bacterial virulence. Factors that are generating by bacteria and cause disease are referred to as virulence

46

Recent Advancements in Microbial Diversity

factors. Virulence factors namely; Adherence Factors, Invasion Factors, Capsules, Endotoxins Exotoxins Siderophores help bacteria to (1) invade the host, (2) cause disease, and (3) evade host defenses (Peterson, 1996).

3.1  Overview of bacterial virulence factors 3.1.1  Secreted proteins Pathogenic bacteria produce a well-stocked armory of virulence factors that encourage bacterial growth and disease-causing abilities in plant tissues. A crucial step of the pathogenesis of microorganisms is the delivery of virulence proteins from the microorganism into the plant’s apoplast or protoplasm. Three different protein-secretion pathways are extensively used for the studies in plant pathogens. The type II secretion system (T2SS), or the out system, is crucial for bacteria with a soft rotting lifestyle, feature of bacteria in Erwiniagenus (Jha, Rajeshwari, & Sonti, 2005; Toth & Birch, 2005) shown in Fig. 3.2. T2SS exports enzymes by using a two-step process that is associated in degrading the plant cell membrane well as pectinases, endoglucanases, and cellulases. Different types of exo-enzymes are believed to the responsible for rotting and macerating phenotypes that are concerned with this microorganisms.T3SS is the most broadly studied secretion system in plant microbes. This secretion system is related to the bacterial flagellum and creates a pilus that inserts effectors into the plant cell and inside it, these

FIGURE 3.2  Disease symptoms of the plant caused by bacterial pathogens and representative virulence mechanisms of pathogen (Abramovitch, Anderson, & Martin, 2006).

A spotlight on the recent advances in bacterial plant diseases Chapter | 3

47

effectors modulate the plant’s physiology to profit the bacteria. Various lifestyle microbes, like soft-rotting bacterial pathogens, biotrophic, and even some symbiotic bacteria depend on the T3SS to effectively associate with their hosts. There is an excellent variety of effectors both inside and among microbial species basis on sequence-level comparisons (Chang et al., 2005) more than thirty effectors are probably going to be conveyed by Pseudomonas syringae pathovar (pv.) tomato (Pst) (Chang et al., 2005; Petnicki-Ocwieja et al., 2002). The type IV secretion system (T4SS) plays a crucial role in the pathogenesis of Agrobacterium tumefacient andtumefacient and its ability to create galls on plants. The T4SS intercedes the dealing of bacterial proteins and DNA into the plant cell by associated with the bacterial F-pilus, (Christie, Atmakuri, Krishnamoorthy, Jakubowski, & Cascales, 2005). The DNA of bacteria is coordinate into the host genome and generates plant hormones that initiate the characteristic gall symptoms.It also encourages the biosynthesis of nutrient-rich opine compounds that can be catabolized by A. tumefaciens but not by most of the different microorganisms. It is imperative to take note of that numerous pathogenic bacteria to depend on several mechanisms of protein secretion (Preston, Studholme, & Caldelari, 2005). For example, various Erwinia species need both a T2SS and a T3SS to create disease (Toth & Birch, 2005) and multiple strains of Xanthomonas species have T2SS, T3SS, and T4SS (da Silva et al., 2002).

3.1.2  Small molecules as virulence factors Bacteria use small molecules to spread disease metabolites like toxins, plant hormones, autoinducers and exopolysaccharides (EPS). Bacterial toxins namely; Coronatine, syringomycin, syringopeptin, tabtoxin, and phaseolo toxin play a major role in virulence and symptom development (Bender, Alarcon-Chaidez, & Gross, 1999). Microorganisms utilize unique and different mechanisms of action to influence the plants like, including forming pores in plant membranes, mimicking plant hormones or inhibiting host metabolic enzymes and these toxins can trigger necrotic or chlorotic symptoms. Numerous strains of Pseudomonas and Xanthomonas generate the plant hormone auxin (Glickmann et al., 1998). Auto-inducers are generated by microbes and these are hormonelike molecules to identify the nearby population density of a specific bacterial strain or species (Von Bodman, Bauer, & Coplin, 2003).

4  Impact of bacterial disease in crop production Moreover, 80% of plants are used as the food of the human as well as an animal meal. As such, plants are necessary for food security or continuous access to adequate, moderate, protected and nutritious nourishment for us all to live an active and healthy life. Plant pests and diseases are creating the risk for food security because they can harm crops, hence diminishing the accessibility and access to food expanding the food cost. Pests and diseases

48

Recent Advancements in Microbial Diversity

of plants can also adversely affect the nutrition quality of foods leading to changes to the traditional food preferences of populations (https://www.ippc. int).(FAO,2017). The broad range of facets of crop losses, as a problematic, encompassing biological, ecological, economic, and sociological considerations (Hollier, 2011), expanding far beyond the attainable-actual yield gap (Teng & James, 2002), connected to the mismatch between global food production and human population (e.g., FAO 2011), and affecting social networks of farm, rural communities, produce companies, exporters, governments is particularly well illustrated by wheat production in the United States. The greater part of the agricultural research led in the 20th century concentrated on expanding crop profitability as the world population and its food needs developed (Evans, 1998; Smil, 2000). Ranging between 20 and 40% of global agricultural productivity are losses by pathogens, animals, and weeds (Teng & Krupa, 1980).Plant assurance then primarily focused on saving crops from yield damage due to biological and non-biological causes. These problems stay tuned as challenging today as in the 20th century, with additional complexity generated by the reduced room for maneuver available environmentally, economically, and socially (Brown & Thorpe, 1995). This results from shrinking natural resources that are available to agriculture: these include water, agricultural land, arable soil, biodiversity, the availability of non-renewable energy, human labor, fertilizers (Pande et al., 2019) and the deployment of some key inputs, such as high-quality seeds and planting material. Pathogenic microbes cause several serious diseases in crop production. They do not infiltrate legitimately into plant tissue but need to enter through injuries or natural plant openings area. Wounds in plants can create from damage by insects, other pathogens, and tools during operations such as pruning and picking. Microbes possibly become active and create issues when components are favorable for them to multiply and bacteria can multiply rapidly. In a plant diagnostics laboratory, it is essential to have diseased tissue examined to confirm the type of pathogen that causes the disease. Various strains of bacterial diseases influence many varieties of vegetable crops and plants or cause major diseases in certain crops. For example Xanthomonas campestris pv. vitians in lettuce and X. campestris pv. cucurbitae in cucurbits; and beans Psuedomonas syringae pv. syringae and P. syringae pv. phaseolicola causes different diseases and other impacts are summarized in Fig. 3.3. Plant pathogenic bacteria adjust such connections by influencing plant wellness, decreasing the development and aggressive capacity of diseased plants which can affect heavily upon plant population and community structure (Bradley, Gilbert, & Martiny, 2008; Burdon, Thrall, & Ericson, 2006). Pathogens can increase plant biodiversity by avoiding competitive exclusion if they have a large adversely affect upon the dominant species in a community, such that a trade-off exists between plant competitive ability and susceptibility to pathogens (Alexander & Holt, 1998; Allan, Van Ruijven, & Crawley, 2010; Bradley et al., 2008).

A spotlight on the recent advances in bacterial plant diseases Chapter | 3

49

FIGURE 3.3  Various Impacts of plant pathogenic bacteria.

4.1  Impact of bacterial disease on vegetables The financial impact of the microbial disease on the vegetable is growing daily. The P. syringae is expending in a bacterial speck of tomato concerning old diseases. pv. tomato (Shenge, Mabagala, Mortensen, Stephan, & Wydra, 2007). Various studies spotlights the seed-borne nature of P. syringae, yet it is a surprisingly versatile pathogenic bacteria, rising in some bizarre sites, for example, snow meltwaters (Morris, Kinkel, Xiao, Prior, & Sands, 2007). R. solanacearum is likely the most dangerous plant pathogenic bacterium around the world. One of the reasons for this is that the R. solanacearum species is made up of a massive cluster of strains altering in their geographical origin, host range and pathogenic behavior (Denny, 2006; Genin, 2010). This heterogeneous organization is presently diagnosed as a ‘species complex’ that has been divided into four main phylotypes (phylogenetic grouping of strains). The species as an entire has a totally broad host range, infecting 200 plant species in over 50 households, and is the causative agent of bacterial wilt of tomato, potato brown rot, eggplant, and tobacco. R. solanacearum is a soil-borne bacterium which infects vegetables and plants through infected sites, root tips or cracks at the sites of lateral root emergence. The bacterium, in the end, colonizes the root cortex, invades the xylem vessels and reaches the stem and aerial parts of the plant via the vascular system. R. solanacearum mayun expectedly multiply in the xylem up to very excessive cellular densities, conduct to wilting symptoms and plant death.

50

Recent Advancements in Microbial Diversity

The direct monetary effect of R. solanacearumis difficult to quantify, however, due to its wide geographical distribution and host range the pathogen is highly damaging; on potato alone, it accounts for an estimated US$1 billion in losses worldwide every year (Elphinstone, 2005). The rate of the damaging is especially sensational for horticulture in many developing nations in inter-tropical areas in which R. solanacearumis endemic. In reason in which the microorganism has quarantine status, it is additionally liable for crucial damage due to administrative destruction measures and limitations on further production on infected land. Disease management stays constrained and is hampered by the faculty of the pathogenic bacteria to live through for years in wet soil, water ponds, on plant debris or in asymptomatic weed hosts, which act as an inoculum reservoir. Resistance breeding, while effective in some situations, is hampered by a wide range of the pathogenic strains. R. solanacearum is a model organism for the study of bacterial pathogenicity as root and vascular pathogen. The bacterium was one of the first fully sequenced plant pathogen genomes (Salanoubat et al., 2002), and the advancement of patho systems with model plants like Arabidopsis, or the legume Medicago truncatulahas supported genetic and molecular studies on both the plant and bacterial partners. The R. solanacearum bacterium pathogenicity relies on a type III secretion system, and lots of research was performed in this subject matter since the first description of a hrp mutant phenotype by (Boucher, Barberis, Trigalet, & Demery, 1985). Various pathogenicity factors whose expression is orchestrated by an atypical quorum-sensing molecule structurally related to the diffusible signal factor (DSF) family were identified and characterized (Flavier, Clough, Schell, & Denny, 1997). Bacterial soft rot caused by Erwinia carotovora, it occurs in all onion-growing districts in the United States but is most common in onions harvested during warm, rainy seasons or in those that develop sunscald during the curing process. It is often a serious impact in Spanish onions, especially after the sprouting tops are cut off. This decay occurs in the field, where it causes some losses, and in transit and storage, where the losses frequently are very heavy. The affected tissues are glassy or water-soaked at first, later becoming soft and mushy (pi. 3, A). The rot usually is accompanied by a very repulsive odor. The bacteria that cause it apparently cannot penetrate the dry unbroken skin of the onion.

4.2  Impact of bacterial disease on cereal crops Cereal crops namely; wheat, maize, rice, barley, sorghum, and millets, represent the greater part of the worldwide and provide staple meals around the whole world. However, a few bacteria may decrease to nutrients, reduce yields and may even cause whole crops to fail. Certain bacterial diseases can also deliver toxins that are harmful to humans as well as animals. Bacterial leaf blight (BLB) disease of rice is caused by Xanthomonas oryzae pv. oryzae (Xoo).BLB disease is efficaciously managed through using resistant rice cultivars. However, because Xoo can produces effectors that inhibit few responses to the host

A spotlight on the recent advances in bacterial plant diseases Chapter | 3

51

defense, often this resistance is subsequently conquered (Verdier, Vera Cruz, & Leach, 2011). It has been proven effective to manage the infection with copper compounds, antibiotics and other chemicals (Mew et al., 1992). Xoo is spread by the water system, sprinkling or wind-blown downpour, just as by sullied rice stubble from the past yield season, which is the most significant wellspring of essential inoculum(Mizukami & Wakimoto, 1969; Murthy & Devadath, 1984). Xoo affects the rice leaves usually through hydathodes at the tip of the leaf, broken trichomes, leaf margins, and wounds in the leaves or roots, multiplies in the intercellular spaces and enters into xylem vessels (Noda & Kaku, 1999). Bacterial Black Chaff and bacterial Stripe are types of wheat bacterial diseases caused by different bacteria namely; Xanthomonas campestris pv. translucens Syn. X.translucens, X. translucens flsp. undulosa, X. campestris pv. Undulosa. Black chaff and bacterial stripe diseases are both produced by the same bacteria; the site and extent of the disease characteristics based on the bacterium strain, the cultivar affected, and environmental factors. “Bacterial black chaff” mostly occurs on the glumes and “bacterial stripe” occurs mainly on the sheaths and/or leaf. Black chaff and bacterial stripe diseases occasionally create severe damage, although symptoms may often be serious. These diseases occur worldwide on all small grain cereals and many kinds of grass. The wheat leaves, culms, and spikes and triticale can be suffered by the diseased. Basal glume rot is not highly important for economically but is often recorded in humid cerealgrowing areas. Bacterial spike blight (Yellow Ear Rot) caused by Coryne bacterium tritici. Only cultivated host Wheat and some wild grasses are susceptible to attack. This disease is often reported in the Asian Subcontinent. Bacterial spike blight is not economically important.

4.3  Impact of bacterial disease on Pulses Bacterial blight disease is induced by the pathogenic bacteria Pseudomonas syringae pv. pisi and P. syringae pv. syringae. These pathogenic bacteria may grow on seed or pea trash, whilst P. syringae pv. syringae can grow on several types of host plants. The disease generally developed by sowing infected seed within a field. During moist environment, bacteria spread from contaminated plants to healthy plants by rain splash, wind-borne water droplets, and plant to plant contact. Peas field in Victoria, Bacterial blight is common, but its intensity varies widely from plant to crop and between seasons. Severe epidemics can lead to crop failure; but, losses are generally less than 20%. The disease can restrict exports as some countries will only import field pea seed from regions where bacterial blight does not occur.

4.4  Impact of bacterial disease on fruits Bacterial fruit blotch (BFB) is a relatively new disease in the U.S but it has resulted in massive yield failure in commercial watermelon plantings.BFB

52

Recent Advancements in Microbial Diversity

is caused by the bacterium Acidovorax citrulli, first observed on watermelon seedlings in the United States in 1965. The disease is especially problematic because it can be seed-borne, is easily spread, and can cause yield losses of up to 90% when severe. Watermelon is highly vulnerable for Bacterial fruit blotch, but other cucurbits, such as melon, cucumber, pumpkin, squash, and gourds, are also susceptible and can be used as inoculum sources of for watermelon epidemics (Walcott, 2005). The pathogen is seed-borne, and it is possible to observe symptoms on seedlings as soon as five to eight days after planting. Bacterial fruit blotch symptoms include dark, reddish-brown lesions on mature leaves that form along the leaf veins. These lesions can be difficult to see and may look similar to those caused by other foliar diseases. Leaf tissue infection unlikely to have much of a direct influence on yield, but it provides inoculums that can spread the disease in fruits.

5  Bacterial disease detection methods Production and economic losses in the agricultural industry due to bacterial disease are persistence issues across the globe. This is one of the reasons; to minimize the damage in crops during growth, postharvest processing, and harvest, as well as to maximize productivity and ensure agricultural sustainability it’s mandatory to detect the disease for the prevention of crops and plants (Fang & Ramasamy, 2015) Monitoring of health and detection of bacterial diseases in plants, trees, and crops is critical for sustainable agriculture but if proper care is not taken in this area then it causes serious effects and bacterial and microbes disease on plants, trees crops, and other fruity plants and due to these disease product quality, quantity or productivity is affected (Sankarana, Mishraa, Ehsania, & Davisb, 2010). In plants, bacterial diseases are diagnosed based on several factors, including laboratory tests for pathogen identification. Over the past decade, the rapid growth of genomic techniques to identify bacteria has greatly simplified and enhanced pathogen identification and detection (Alvarez, 2004) but some advance techniques are also using to detect bacterial disease in plants like computing techniques. Automatic detection of plant disease is useful because it eliminates a large monitoring job in large crop farms and takes less time, and it detects the signs of diseases at the very early stage i.e. when they appear on plant leaves (Singh & Misrab, 2016). Apart from computing techniques many other techniques (Fig. 3.4) are used for identification plant disease like enzyme-linked immunesorbent assay (ELISA), based on proteins create by the pathogen, and polymerase chain reaction (PCR), based on specific deoxyribose nucleic acid (DNA) sequences of the pathogen (Liu, Ronald, & Bogdanove, 2006; Prithiviraj, Vikram, Kushalappa, & Yaylayam, 2004; Ruiz-Ruiz et al., 2009; Saponari, Manjunath, & Yokomi, 2008; R. Singh, Das, Ahmed, & Pal, 1980; Yvon, Thébaud, Alary, & Labonne, 2009). Plant diseases can be detected using various methods.

A spotlight on the recent advances in bacterial plant diseases Chapter | 3

53

FIGURE 3.4  Methods of plant disease detection.

5.1  Direct methods In Direct methods, several techniques are used to detect plant diseases. Techniques like namely: molecular and serological methods are used for the analysis large number of samples. The disease-causing pathogens in plants such as bacteria, fungi, and viruses are directly detected by these methods and provide accurate identification of the disease/pathogen. Polymerase Chain Reaction (PCR), Fluorescence in-situ Hybridization (FISH), Enzyme-Linked Immunosorbent Assay (ELISA), Immunofluorescence (IF) and flow cytometry methods (FCM) are used to detect pant disease (Fang & Ramasamy, 2015). PCR was initially used for the detection of highly specific diseases caused by bacteria and viruses based on the fidelity of DNA hybridization and replication. Now PCR has been broadly used to detect plant disease pathogens (Cai, Caswell, & Prescott, 2014). The FISH technique is applied in combination with microscopy and hybridization of DNA probes and target genes from plant samples for bacterial detection (Kempf, Trebesius, & Autenrieth, 2000). Pathogen-specific sequences of ribosomal RNA (rRNA) in plants help detect the presence of pathogen infections in plants. Other pathogens like fungi, viruses and other endosymbiotic bacteria FISH could also be used to detect that infect the plant (Hijri, 2009; Kliot et al., 2014). Another molecular method for the identification of diseases based on antibodies and color change in the sample is also used by ELISA (Clark & Adams, 1977). In this process, the target epitopes (antigens) of the viruses, bacteria, and fungi are made to specifically to associated enzyme-conjugated

54

Recent Advancements in Microbial Diversity

antibodies the effect can be visualized based on color changes resulting from the interaction between the substrate and the immobilized enzyme. The immunofluorescence (IF) technique is fluorescence microscopy-based optical and used for microbiological samples study. Pathogen infections in plant tissues can also be observed using the technique. The detection is achieved by combining a fluorescent color with the specific antibody to visualize the distribution of the target molecule distribution throughout the sample (Ward, Foster, Fraaije, & Mccartney, 2004). FCM has been mainly used to study cell cycle kinetics and antibiotic resistance, to classify bacteria, to distinguish viable from nonviable bacteria, and to characterize bacterial DNA and fungal spores. it is still a relatively new tool for the identification of plant disease (Chitarra & van den Bulk, 2003).

5.2  Indirect methods Indirect methods have been used for the detection of biotic and abiotic stress as well as pathogenic diseases in crops. These methods are generally based on plant stress profiling and plant volatile profiling. Biotic and abiotic stress detection in plants has evolved and documented new types of optical sensors in the literature (West et al., 2003). The optical sensors allow for plant health prediction and provide detailed data based on different electromagnetic spectra (Mahlein, Oerke, Steiner, & Dehne, 2012). Thermography, fluorescence imaging, and hyperspectral techniques are among the best indirect methods for detecting plant disease (Chaerle & Van Der Straeten, 2000). Thermographic imaging can be monitored the resulting disease through and without the external temperature factors, the amount of water transpired may be measured (Oerke, Steiner, Dehne, & Lindenthal, 2006). Another technique that has been extensively used for the detection of plant disease is Hyperspectral techniques. This technique detects disease by measuring the reflectance changes resulting from changes in biophysical and biochemical characteristics after infection. Magnaporthe grisea infection of rice, Phytophthora infestans infection of tomato and Venturia inaequalis infection of apple trees have been recognized and published using hyperspectral imaging techniques (Chaerle et al., 2009).

5.3  Computational techniques Computational techniques used by some automatic techniques to detect plant disease. These techniques are beneficial because they reduce a large monitoring work in large crop farms and detect the symptoms of the disease at a very early stage, i.e. when they appear on leaves of the plant. Automatic detection techniques are used to detect bacterial disease it will take less effort, less time and become more accurate. Many common diseases found in plants are brown and yellow spots, early and late scorching, and others are fungal, viral, and bacterial diseases. Image processing is a process that used for measuring the infected area of disease and determining the difference in the color of the infected area (Dhaygude & Kumbhar, 2013;

A spotlight on the recent advances in bacterial plant diseases Chapter | 3

55

Ghaiwat & Arora, 2014). Many different classification algorithms of machine learning technologies have been used for plant disease management. For example, support vector machine (SVM), probabilistic neural network, K-means clustering algorithm, and neural networks, artificial neural network (ANN) and diverse image processing techniques are used for automatic detection of diseases in plants (Ghaiwat & Arora, 2014; Mrunalini Badnakhe, & Prashant, 2011).

6  Bacterial disease management and resistance Plant diseases caused by pathogenic bacteria entail foremost constraints on crop productivity and cause significant annual losses globally. Regular and efficient supervision of these diseases is an intricate process and also influenced by environmental conditions and consumer choice (Samant, Pandey, & Pandey, 2018). Much research incorporating basic research for the identification of important pathogen targets involved in control, novel methods and methods of delivery are emerging that may render a pathway for effective management of the bacterial disease. Some of the most prominently involved practices for bacterial disease management (Fig. 3.5) are summarized below.

6.1  Use of copper and antibiotics Certain factors chiefly determine the potency of the chemical operation of specific bacterial diseases e.g., the accessibility of successful mode of action,

FIGURE 3.5  Various types of management and control of plant pathogenic bacteria.

56

Recent Advancements in Microbial Diversity

the possibility to contact pathogen on plant surface as well as pathogen’s sensitivity to the particular chemical, the monetary significance of the imperiled crop and also the market perspective of the chemical application from an industrial point of view. Initial studies have established copper compounds (the 1880s) and the antibiotic streptomycin (1950s) to be the most efficient in the management of bacterial disease on plants and these were the most frequently used bactericide spray essentially focusing on Xanthomonas spp, E. amylovora and Pseudomonas spp (McManus et al., 2002). Despite being a comparatively flourishing disease managing tool, the widespread application of these bactericides has been impacted by the development of resistance in a population of plant pathogens (Cooksey, 1990). There persistent application over numerous years and also large utilization within particular seasons are linked with the selection of resistance pathogen population. Furthermore, in most cases, resistance has emerged due to the attainment of genes encoding resistance determinants, thus in the horizontal transmission of resistance determinants within agricultural environments non-target microbiota also involving. Horizontal gene transfer involves the transfer of copper resistance genes via the conjugation of copper resistance plasmids. Copper resistance caused by copper-inducible operon (copABCD) has been reported in P. syringae pv. tomato (Mellano & Cooksey, 1988), P. syringae pathovars (GutierrezBarranquero, de Vicente, Carrion, Sundin, & Cazorla, 2013), Xanthomonas campestris pv. jugl and is and in the citrus pathogens Xanthomonas citris sp. citri and Xanthomonas alfalfae ssp. citrumelonis (Behlau, Canteros, Minsavage, Jones, & Graham, 2011). Among the antibiotics, Streptomycin is widely applicable for both human and plant disease management. Studies have suggested that strAB genes were responsible for the resistance in P. Syringae, E. amylovora, and X. campestris pv. Vesicatoria. As a substitute to streptomycin, some other supplementary antibiotics have also been employed either due to the selection of resistance pathogen population or because of the ineffectiveness of streptomycin in a few pathosystems. Oxytetracycline has been widely employed in different countries for the management of several types of plant diseases viz, bacterial spots on peach (Xanthomonas arboricola pv. pruni) in USA, fire blight of pome fruit (E. amylovora) in USA and Mexico, and to target vegetable disease caused by Xanthomonas and Pseudomonas spp. in Latin American countries. To manage fire blight and distinct diseases of vegetable gentamicin have been utilized in Latin America whereas oxilinic acid has been exploited in Israel to cope up with fire blight (Shtienberg et al., 2001). In the USA, kasugamycin has been recorded to fight the fire blight in recent times, particularly in plantation having streptomycin-resistant E. amylovora (McGhee & Sundin, 2011). Though, antibiotics applications are not approved in some parts of the world as its utilization is responsible for the transmittance of antibiotic resistance into clinical pathogens.

A spotlight on the recent advances in bacterial plant diseases Chapter | 3

57

6.2 Biocontrol Another approach to control plant diseases is based upon the application of useful microorganisms or by-products by them or the extracts (byproducts) of plants/ animals and this is known as Biological control. Strategies to manipulate populations of biological control agents (BCAs) in field situations are typically either inundative, in this strategy the BCA is dredge in an adequate quantity to prevent disease, even without reproduction, or augmentative, and BCA is generating a stable, replicating population suitable for disease suppression (Johnson, 2010). Also, as a substitute to the microorganisms themselves, the molecules produced from hostile microorganisms, characteristically antimicrobials are employed under some circumstances. Agrobacterium radiobacter strain K84, the most prominent examples of successful biological control has been exploited for the defense of bare surfaces of woody plant cuttings from crown gall disease caused due to Agrobacterium tumefaciens (Kerr, 2016). Infection time for various diseases caused by bacteria is longer, mostly soil produced pathogens and pathogens causing fruits- and leaf-spot which tends to reduce the probability of successful biological control. Under these circumstances, hypersensitive response and pathogenicity (hrp) mutants have attained success as challenging antagonist (Hert et al., 2009). Some of the bacteria used in biocontrol have biosafety issues for eg. Pantoeaagglomerans, Burkholderia spp. are also opportunistic human pathogens and this necessitates the detection of new strains to function as biological control and that can be regarded as generally regarded as safe/qualified presumption of safety GRAS/QPS. Another method of biological control is the use of bacteriophage in the management of disease caused by bacteria that have been the focus of research activity over the past four decades at different times (Jones et al., 2007). The bacterial species that are pathogenic to plants can be lysed with the application of bacteriophages which can be removed easily from the host plant tissue/soil. However, the permanence of bacteriophages in the environment and their impulsive resistance mutations in target pathogenic bacteria species are two factors that affect the efficiency of bacteriophages. Therefore, to speed up the successful deployment of bacteriophages, additional field studies and optimization of spray timings and formulations are requisite. Moreover, the evaluation of functional genomics renders a possible direction towards recent biocontrol agents (Massart, Perazzolli, Hofte, Pertot, & Jijakli, 2015). But the work requires considerable field efforts for example; the organism’s nature could be evaluated with different plant host arrangements under diverse environmental conditions.

6.3  Antimicrobial peptides, SAR and induced systemic resistance (ISR) Bacteria, fungi produce small antimicrobial peptides also known as AMPs, generally composed of 50 or fewer amino acid residues which help in

58

Recent Advancements in Microbial Diversity

inter-microbial antagonism. Animals and plants also synthesize these peptides against microbial action. Usually, these are cationic and functions either by disturbing cell membranes or by inhibiting cell’s nucleic acid or synthesis of protein (Brogden, 2005). General approaches that have been employed in the study of prospective peptides in bacterial plant disease management involves the AMPs application to plant surfaces, deployment of bacterial and fungal antagonist that excludes AMPs, the expression of cecropin, an animal defensin in a transgenic plant (Montesinos, 2007). Further, spraying AMP onto crops is also an advantageous means compared to the application of transgenic plants. However, despite being fruitful in disease management of plants, the work guarantee of AMP is still developing and is still prevalent by screening efforts looking for new candidates (Breen, Solomon, Bedon, & Vincent, 2015). Moreover, the introduction of SAR in plants using a chemical inducer acibenzolarS-methyl (ASM), is responsible for huge success for concluding basic research in the application of plant disease management (Durrant & Dong, 2004). This process of preparing plants for a subsequent action of the pathogen by the foliar application of ASM has been applied in various pathosystems viz. bacterial wilting of tomato, the bacterial canker of tomato (Pradhanang et al., 2005). Besides this various other SAR inducers and ASM have also been reported for controlling citrus canker on young grapefruit trees (Graham & Myers, 2011). Furthermore, for the effective management of Huanglongbing disease in Florida SAR inducers have also been investigated (Nwugo, Doud, Duan, & Lin, 2016). ISR involves the use of various plant growthpromoting rhizosphere bacteria and fungi viz. Pseudomonas spp., Bacillus spp., Trichoderma spp. etc., in plant defense through signaling mediated by phytohormones(Pieterse, Zamioudis, Berensen, Weller, & Van Wees, 2014). ISR is known to play an efficient role in the management of a variety of bacterial pathogens, including Xanthomonasoryzaepv. Oryzae, R. Solanacearum and P. Syringae (Kloepper, Ryu, & Zhang, 2004). Further, the quality of plant defense against pathogenic bacteria can also be enhanced by using inorganic elements, for example, the use of silicon against R. Solanacearum. Similar to SIR silicon is known to provide structural barriers against the action of the pathogen. Thus help in protecting against various plant pathogens (Ghareeb et al., 2011).

7  Recent techniques to overcome plant diseases Such new technologies such as tissue culture and genetic engineering have now been introduced for the management of plant bacterial disease, resulting in the development of modified or new species and products that can be used in a variety of ways. Molecular and biotechnology two techniques have mostly used for plant disease management (Pande et al., 2019; A. Pandey, Tripathi, Pandey, Pathak, & Nailwal, 2018; A. Pandey et al., 2019). Some of the important techniques for plant disease management are briefly described below.

A spotlight on the recent advances in bacterial plant diseases Chapter | 3

59

7.1  Gene transfer Genetic transfer techniques can be used for improving the disease resistance of crop plants in sustainable ways, including the potential for reduced pesticide usage. For example, transferring of Stilbene synthase gene to rice has increased resistance to blast caused by Pyricularia oryzae (Stark-Lorenzen, Nelke, Hänßler, Mühlbach, & Thomzik, 1997). In another example transferring of PRSV HA 5-1 coat protein gene has shown resistance against the ring spot virus in pawpaw. Such methods can be applied to many other crops and plants to enhanced resistance against pathogenic diseases.

7.2 Transcriptomics The study of RNA transcripts produced by the genome within a specific cell using high throughput approaches such as Illumina sequencing called Transcriptomics. Various techniques like Genome editing play a vital role in plant disease elimination to improved understanding of the cell genome. This technology has been used successfully in enhancing plant resistance to phytopathogens (Andolfo, Iovieno, Frusciante, & Ercolano, 2016). Through transcriptomics, many disease resistance genes have been identified leading to a significant breakthrough in the management of plant diseases (Lowe, Shirley, Bleackley, Dolan, & Shafee, 2017). Transcriptomics has been used successfully in the management of Xanthomonas oryzaeon rice (Cheng et al., 2016) by identifying important genes that are involved in molecular pathogenesis.

7.3  Genome editing Genome editing is a way to make correct modifications to a cell or an organism’s genomic DNA. The center of genome editing technology is the use of sequence-specific nucleases to identify specific DNA sequences and generate targeted sites with double-stranded DNA breaks (DSBs). DSBs are repaired mainly via two pathways (1) the nonhomologous ending-joining (NHEJ) pathway and (2) the homologous recombination (HR) pathway (Voytas & Gao, 2014). Gene editing techniques also used for bacterial disease resistance mechanisms, however, due to the marked effects on elucidating the molecular mechanisms of host–bacterial pathogen interactions, many host plant genes, and including some S genes that participate in these complex processes have been identified. Since S genes can be more resilient in the field, they become common targets for crops resistant to bacterial diseases through genome editing (Yin & Qiu, 2019). Most of the economically important crops have been widely influenced by the effect of several major pathogens, including Pseudomonas syringae, Phytophthoraspp. and Xanthomonas spp. Since the bacterial disease is the outcome of complex molecular interaction of pathogenic molecule and host plant. Hence by breaking down the molecular interaction, the resistance in the plant against the pathogen can be achieved successfully. Breaking down

60

Recent Advancements in Microbial Diversity

the molecular interaction between pathogens and plants can be achieved by genome editing technology using CRISPR/Cas9 system to create knockout such genes or promoters which are essential for pathogen- plant interaction but not essential for plant development. For example, creating Knockout mutants of OsSWEET13 by targeting the coding region via the CRISPR/ Cas9 system has generated enhance resistance to blight disease caused by Xanthomonas oryzae pv. Oryzae (Zhou et al., 2015). In another example, the CsLOB1 promoter EBE and coding region of CsLOB1 were targeted via CRISPR/ Cas9. Both studies reveal that editing CsLOB1 provided resistance to Xanthomonas citris sp. citri bacteria (Jia et al., 2017).

7.4  RNA interference RNA interference (RNAi) is a molecular technology that uses gene down regulation principle via transcriptional gene silencing (TGS) or posttranscriptional gene silencing (Dayou, Mwangi, Egesa, Muteti, & Chumba, 2018) and this approach reflects an incredible revolution in functional genomics, a breakthrough in plant molecular genetics (Puyam, Sharma, & Kashyap, 2017). RNAi technique first time was reported by (Escobar, Civerolo, Summerfelt, & Dandekar, 2001) to increase resistance in plants against bacterial pathogen causing crown gall disease. With the help of RNAi technology, it has been shown that transgenic plants (Arabidopsis thaliana and Lycopersicon esculentum) containing a modified construct of two iaaM and ipt oncogene of bacteria responsible for the induction of crown galls showed resistance against crown gall disease. One more example of RNAi-mediated technology in the bacterial pathogen is Xanthomonas oryzae, the leaf blight bacterium In which resistance has been enhanced due to the successful knockdown of a rice homolog of OsSSI2 (Jiang et al., 2009).

7.5 Proteomics Proteomics analysis is the study of various proteins and their functions as well as their interaction in an organism (Zulkarnain, Tapingkae, & Taji, 2015). Common techniques used in proteomics analysis are Two-dimensional Electrophoresis (2DE), Fluorescence 2D Difference Gel Electrophoresis (2D-DGE), Mass Spectrometry (MS) and Multidimensional Protein Identification Technology (MudPIT) also known as “shotgun” approach (Chandramouli and Qian, 2009). Such methods are useful to establish the pattern and specificity of a specific protein produced in plants when pathogenic stress occurs. For example, 2-DE and MS have been used to identify the different proteins expressed during the heat treatment which are involved in host defense mechanisms (Nwugo et al., 2016). This technique has been used to management of L. asiaticus disease commonly known as Citrus Huanglongbing (HBL) by using heat treatment.

A spotlight on the recent advances in bacterial plant diseases Chapter | 3

61

7.6 Metabolomics Plant-pathogen interaction could be better understood based on the identification and quantification of small molecules called metabolites (Rojas, SenthilKumar, Tzin, & Mysore, 2014). Several techniques have been used in the past in metabolomics analysis. To-date the commonly used are high-performance liquid chromatography (HPLC), gas chromatography (GC), mass spectrometry (MS) as well as nuclear magnetic resonance spectroscopy (NMRS). Using the GCMS –approach, (Warth et al., 2015) showed that wheat metabolome is modified by deoxynivalenol (DOIN) secreted by Fusariumgraminearumthat causes Fusarium Head Blight (FBH) disease. Earlier, (Levenfors, Eberhard, Levenfors, Gerhardson, & Hökeberg, 2008) investigated the biological management of snow pink mould (Micrcodochiumnivale) on wheat and rye using Pseudomonas brassicacearumMA250. The study found a significant biocontrol effect of P. brassica cearumon M.nivale. Later, (Anderson, 2012) discovered that the biocontrol activity of P. brassica cearumon M. nivale was associated with the secondary metabolites Piliferolide A and SB0253514.

7.7  Tissue culture as an approach for managing plant diseases Propagation of plant cells, tissues, and organs in vitro under aseptic conditions on an artificial medium called plant tissue culture (Hussain, Qarshi, Nazir, & Ullah, 2012). Plant tissue culture has various importance in plant disease management scale, plant multiplication and plant improvement (Ogero, Gitonga, Mwangi, Ngugi, & Ombori, 2012) as well as in the production of secondary metabolites. Various techniques like meristem-tip culture and meristem heat therapy, In vitro shoot grafting, callus culture, somatic embryogenesis, protoplast fusion, somaclonal variation, haploid, and polyploid plants are used in tissue culture techniques to obtain disease-free and disease-resistant plants. During a couple of years, plant tissue culture techniques have been quite impressive to manage plant diseases. Through somaclonal variation techniques, an array of disease-resistant plants has been developed. For example, disease management of late blight(P. infestans) resistant potato plants and calli resistant to bacterial blight of rice have been developed. Different pathogens produce different secondary metabolites that may be used to screen different calli for disease resistance. In the presence of toxins, resistant calli will survive, hence the development of disease-resistant plants. Different disease-resistant plants such as rice resistant to the brown spot pathogen Helmintho sporiumoryzae were developed using this technique (Mwendo et al., 2017). Micropropagation is another technique of plant tissue culture which has taken the lead as the most exciting field of application for agriculture biotechnological devices. This technique is used to produce high-quality, disease-free and standardized planting stock and has significant potential to produce high-quality crops, isolating useful variants in well-adapted high-yielding genotypes with better disease resistance and stress tolerance capabilities. The most significant advantages offered

62

Recent Advancements in Microbial Diversity

by micropropagation are the production of large of disease-free propagules from a single plant in a short period (Suman, 2017).

8 Conclusion Bacterial communities are present everywhere which affects the plants causing various diseases. Climate change is another problem that influences the occurrence, prevalence, and severity of plant disease which affect disease management concerning timing, preference, and efficacy of chemical, physical and biological measures of control. The management of these diseases has been in practice for decades but the resistance of bacteria is a major challenge. To combat bacterial diseases, various biological and chemical controls are generally used successfully. In this regard, several new techniques of biotechnology and molecular biology are also being used for management. We hope that these techniques will be more effective in the future to develop plant disease resistance. However, these techniques are more expensive but in the future, these will be useful to get the disease-free plants and will help increase the yield of crops. This chapter presents up to date matter on plant bacterial community and management of disease which will greatly help researchers working in the bacterial disease and control to give an idea to develop new disease-free plants as well as techniques for the successful management of bacterial disease of plants.

References Abramovitch, R. B., Anderson, J. C., & Martin, G. B. (2006). Bacterial elicitation and evasion of plant innate immunity. Nature Reviews Molecular Cell Biology, 7(8), 601–611. Alexander, H. M., & Holt, R. D. (1998). The interaction between plant competition and disease. Perspectives in Plant Ecology, Evolution and Systematics, 1, 206–220. Allan, E., Van Ruijven, J., & Crawley, M. J. (2010). Foliar fungal pathogens and grassland biodiversity. Ecology, 91, 2572–2582. Alvarez, A. M. (2004). Integrated approaches for detection of plant pathogenic bacteria and diagnosis of bacterial diseases. Annual Review of Phytopathology, 42, 339–366. Anderson, P. F. (2012). Secondary metabolites associated with plant disease, plant defense and biocontrol. diss. (sammanfattning/summary) Uppsala: Sveriges lantbruksuniv. Acta Universitatis Agriculturae Sueciae, 52, 1652–6880. Andolfo, G., Iovieno, P., Frusciante, L., & Ercolano, M. R. (2016). Genome-editing technologies for enhancing plant disease resistance. Frontiers in Plant Science, 7, 1813. Behlau, F., Canteros, B. I., Minsavage, G. V., Jones, J. B., & Graham, J. H. (2011). Molecular characterization of copper resistance genes from Xanthomonas citri subsp. citri and Xanthomonas alfalfae subsp. citrumelonis. Applied and Environmental Microbiology, 77, 4089–4096. Bender, C. L., Alarcon-Chaidez, F., & Gross, D. C. (1999). Pseudomonas syringae phytotoxins: mode of action, regulation, and biosynthesis by peptide and polyketide synthetases. Microbiology and Molecular Biology Reviews, 63(2), 266–292. Borkar, S. G., & Yumlembam, R. A. (2017). Bacterial diseases of crop plants. Taylor & Francis Group.

A spotlight on the recent advances in bacterial plant diseases Chapter | 3

63

Boucher, C. A., Barberis, P., Trigalet, A. P., & Demery, D. A. (1985). Transposon mutagenesis of Pseudomonas solanacearum: isolation of Tn5-induced avirulent mutants. Journal of General Microbiology, 131, 2449–2457. Bradley, D. J., Gilbert, G. S., & Martiny, J. B. H. (2008). Pathogens promote plant diversity through a compensatory response. Ecology Letters, 11, 461–469. Breen, S., Solomon, P. S., Bedon, F., & Vincent, D. (2015). Surveying the potential of secreted antimicrobial peptides to enhance plant disease resistance. Frontiers in Plant Science, 6, 900. Brogden, A. (2005). Antimicrobial peptides: pore formers or metabolic inhibitors in bacteria? Nature Reviews Microbiology, 3, 238–250. Brown, D. C. W., & Thorpe, T. A. (1995). Crop improvement through tissue culture. World Journal of Microbiology & Biotechnology, 11, 409–415. Burdon, J. J., Thrall, P. H., & Ericson, L. (2006). The current and future dynamics of disease in plant communities. Annual Review of Phytopathology, 44, 19–39. Cai, H. Y., Caswell, J. L., & Prescott, J. F. (2014). Nonculture molecular techniques for diagnosis of bacterial disease in animals: a diagnostic laboratory perspective. Veterinary Pathology, 51(2), 341–350. Cameron, A., & Sarojini, V. (2014). Pseudomonas syringae pv. actinidiae: Chemical control, resistance mechanisms and possible alternatives. Plant Pathology, 63, 1–11. Chaerle, L., Lenk, S., Leinonen, I., Jones, H. G., Van Der Straeten, D., et al. (2009). Multi-sensor plant imaging: Towards the development of a stress-catalogue. Biotechnology Journal, 4(8), 1152–1167. Chaerle, L., & Van Der Straeten, D. (2000). Imaging techniques and the early detection of plant stress. Trends in Plant Science, 5(11), 495–501. Chandrashekara, K. N., Raju, S. R., & Chandrashekara, C. (2012). Molecular, biotechnological approaches in plant disease management. in Eco-friendly innovative approaches in plant disease management. Chang, J. H., Urbach, J. M., Law, T. F., Arnold, L. W., Hu, A., Gombar, S., et al. (2005). A highthroughput, near-saturating screen for type III effector genes from Pseudomonas syringae. Proceedings of the National Academy of Sciences of the United States of America, 102(7), 2549–2554. Cheng, X. J., He, B., Chen, L., Xiao, S. Q., Fu, J., Chen, Y., et al. (2016). Transcriptome analysis confers a complex disease resistance network in wild rice Oryza meyeriana against Xanthomonas oryzae pv. oryzae. Scientific Reports, 6, 38215. Chitarra, L. G., & van den Bulk, R. W. (2003). The application of flow cytometry and fluorescent probe technology for detection and assessment of viability of plant pathogenic bacteria. European Journal of Plant Pathology, 109, 407–417. Christie, P. J., Atmakuri, K., Krishnamoorthy, V., Jakubowski, S., & Cascales, E. (2005). Biogenesis, architecture, and function of bacterial type IV secretion systems. Annual Review of Microbiology, 59, 451–485. Clark, M. F., & Adams, A. N. (1977). Characteristics of the microplate method of enzyme-linked immunosorbent assay for the detection of plant viruses. Journal of General Virology, 34(3), 475–483. Cooksey, D. A. (1990). Genetics of bactericide resistance in plant pathogenic bacteria. Annual Review of Phytopathology, 28, 201–219. da Silva, A. C., Ferro, J. A., Reinach, F. C., Farah, C. S., Furlan, L. R., Quaggio, R. B., et al. (2002). Comparison of the genomes of two Xanthomonas pathogens with differing host specificities. Nature, 417(6887), 459–463. Dayou, O., Mwangi, M., Egesa, A. O., Muteti, P. M., & Chumba, C. I. (2018). Application of molecular and biotechnological techniques in plant disease management: A review. African Journal of Biotechnology, 17(31), 938–948. Denny, T. P. (2006). Plant pathogenic Ralstonia species. In S. S. Gnanamanickam (Ed.), Plantassociated bacteria (pp. 573–644). Dordrecht: Springer Publishing.

64

Recent Advancements in Microbial Diversity

Dhaygude, S. B., & Kumbhar, N. P. (2013). Agricultural plant leaf disease detection using image processing. International journal of Advanced Research in Electrical, Electronics and Instrumentation Engineering, 2(1). Durrant, W. E., & Dong, X. (2004). Systemic acquired resistance. Annual Review of Phytopathology, 42, 185–209. Elphinstone, J. G. (2005). The current bacterial wilt situation: a global overview. In C. Allen, P. Prior, & A. C. Hayward (Eds.), Bacterial wilt disease and the ralstonia solanacearum Species Complex (pp. 9–28). St Paul, MN: APS Press. Escobar, M. A., Civerolo, E. L., Summerfelt, K. R., & Dan-dekar, A. M. (2001). RNAi-mediated oncogene silenc-ing confers resistance to crown gall tumorigenesis. PNAS, 98, 13437–13442. Evans, L. T. (1998). Feeding the ten billion. Plants and population growth. Cambridge: Cambridge University Press. Fang, Y., & Ramasamy, R. P. (2015). Current and prospective methods for plant disease detection. Biosensors (Basel), 5(3), 537–561. Flavier, A. B., Clough, S. J., Schell, M. A., & Denny, T. P. (1997). Identification of 3-hydroxypalmitic acid methyl ester as a novel autoregulator controlling virulence in Ralstonia solanacearum. Molecular Microbiology, 26, 251–259. Gangola, S., Joshi, S., Kumar, S., & Pandey, S. C. (2019). Comparative analysis of fungal and bacterial enzymes in biodegradation of xenobiotic compounds. In Smart bioremediation technologies (169-189). Genin, S. (2010). Molecular traits controlling host range and adaptation to plants in Ralstonia solanacearum. New Phytologist, 187, 920–928. Ghaiwat, S. N., & Arora, P. (2014). Detection and Classification of Plant Leaf Diseases Using Image processing Techniques: A Review. International Journal of Recent Advances in Engineering & Technology, 2(3). Ghareeb, H., Bozso, Z., Ott, P. G., Repenning, C., Stahl, F., & Wydra, K. (2011). Transcriptome of silicon-induced resistance against Ralstonia solanacearum in the silicon non-accumulator tomato indicates priming effect. Physiological and Molecular Plant Pathology, 75, 83–89. Glickmann, E., Gardan, L., Jacquet, S., Hussain, S., Elasri, M., Petit, A., et al. (1998). Auxin production is a common feature of most pathovars of Pseudomonas syringae. Molecular PlantMicrobe Interactions, 11, 156–162. Graham, J. H., & Myers, M. E. (2011). Soil application of SAR inducers imidacloprid, thiamethoxam, and acibenzolar-S-methyl for citrus canker control in young grapefruit trees. Plant Disease, 95, 725–728. Gutierrez-Barranquero, J. A., de Vicente, A., Carrion, V. J., Sundin, G. W., & Cazorla, F. M. (2013). Recruitment and rearrangement of three different genetic determinants into a conjugative plasmid increase copper resistance in Pseudomonas syringae. Applied and Environmental Microbiology, 79, 1028–1033. Hert, A. P., Marutani, M., Momol, M. T., Roberts, P. D., Olson, S. M., & Jones, J. B. (2009). Suppression of the bacterial spot pathogen Xanthomonas euvesicatoria on tomato leaves by an attenuated mutant of Xanthomonas perforans. Applied and Environmental Microbiology, 75, 3323–3330. Hijri, M. (2009). The use of f luorescent in situ hybridisation in plant fungal identification and genotyping. Plant Pathology. Berlin, Germany: Springer 131–145. Hollier, C. A. (2011). Impact of crop loss in the United States, symposium at the annual meeting of the American Phytopathological Society: Why do we care about crop losses? Honolulu. Phytopathology, 101, s223.

A spotlight on the recent advances in bacterial plant diseases Chapter | 3

65

Hussain, A., Qarshi, I. A., Nazir, H., & Ullah, I. (2012). Plant tissue culture: current status and opportunities. In Annarita Leva (Ed.), Recent advances in plant in vitro culture. InTech ISBN:978-953-51-0787-3. Ivey, M. L. (2016). Fire blight of apples and pears. Wooster, OH, USA: Department of Plant Pathology, The Ohio State University-Ohio Agricultural Research and Development Center. Jha, G., Rajeshwari, R., & Sonti, R. V. (2005). Bacterial type two secretion system secreted proteins: double-edged swords for plant pathogens. Molecular Plant Microbe Interactions, 18, 891–898. Jia, H., Zhang, Y., Orbovic, V., Xu, J., White, F. F., Jones, J. B., et al. (2017). Genome editing of the disease susceptibility gene CsLOB1 in citrus confers resistance to citrus canker. Plant Biotechnology Journal, 15(7), 817–823. Jiang, C. J., Shimono, M., Maeda, S., Inoue, H., Mori, M., Hasegawa, M., et al. (2009). Suppression of the rice fatty-acid desaturase gene Os-SSI2 enhances resistance to blast and leaf blight diseas-es in rice. Molecular Plant-Microbe Interactions, 22(7), 820–829. Johnson, K. B. (2010). Pathogen refuge: a key to understanding biological control. Annual Review of Phytopathology, 48, 141–160. Jones, J. B., Jackson, L. E., Balogh, B., Obradovic, A., Iriarte, F. B., & Momol, M. T. (2007). Bacteriophages for plant disease control. Annual Review of Phytopathology, 45, 245–262. Kannan, V.R., Bastas, K.K., & Antony, R. (2015). Plant Pathogenic Bacteria: An Overview. Kempf, V. A., Trebesius, K., & Autenrieth, I. B. (2000). Fluorescent In situ hybridization allows rapid identification of microorganisms in blood cultures. Journal of Clinical Microbiology, 38(2), 830–838. Kerr, A. (2016). Biological control of crown gall. Plant Pathology, 45, 15–18. Kliot, A., Kontsedalov, S., Lebedev, G., Brumin, M., Cathrin, P. B., Marubayashi, J. M., et al. (2014). Fluorescence in situ hybridizations (FISH) for the localization of viruses and endosymbiotic bacteria in plant and insect tissues. Journal of Visualized Experiments (84), e51030. Kloepper, J. W., Ryu, C. M., & Zhang, S. (2004). Induced systemic resistance and promotion of plant growth by Bacillus spp. Phytopathology, 94, 1259–1266. Koch, R. (1876). Untersuchungen ueber Bakterien V. Die Aetiologie der MilzbrandKrankheit,begruendent auf die Entwicklungsgeschichte des Bacillus anthracis. Beiträge zur Biologie einiger geokarper Pflanzen, 2, 277–310. Lalancette, N., & McFarland, K. A. (2007). Phytotoxicity of copper-based bactericides to peach and nectarine. Plant Disease, 91(9), 1122–1130. Lamichhane, J. R. (2014). Xanthomonas arboricola diseases of stone fruit, almond, and walnut trees: Progress toward understanding and management. Plant Disease, 98(12), 1600–1610. Legard, D. E., McQuilken, M. P., Whipps, J. W., Fenlon, J. S., Fermor, T. R., Thompson, I. P., et al. (1994). Studies of seasonal changes in the microbial populations on the phyllosphere of spring wheat as a prelude to the release of a genetically modified microorganism. Agriculture Ecosystems & Environment Abbreviation, 50, 87–101. Levenfors, J. P., Eberhard, T. H., Levenfors, J. J., Gerhardson, B., & Hökeberg, M. (2008). Biological control of snow mould (Mcirodochium nivale) in winter cereals by Pseudomonas brassicacearum, MA250. BioControl, 53(4), 651–665. Liu, D. O., Ronald, P. C., & Bogdanove, A. J. (2006). Xanthomonas oryzae pathovars: model pathogens of a model crop. Molecular Plant Pathology, 7, 303–324. Lowe, R., Shirley, N., Bleackley, M., Dolan, S., & Shafee, T. (2017). Transcriptomics technologies. PLOS Computational Biology, 13(5), e1005457. Mahlein, A. K., Oerke, E., Steiner, U., & Dehne, H. (2012). Recent advances in sensing plant diseases for precision crop protection. European Journal of Plant Pathology, 133, 197–209.

66

Recent Advancements in Microbial Diversity

Massart, S., Perazzolli, M., Hofte, M., Pertot, I., & Jijakli, M. H. (2015). Impact of the omic technologies for understanding the modes of action of biological control agents against pathogens. BioControl, 60, 725–746. McGhee, G. C., & Sundin, G. W. (2011). Evaluation of kasugamycin for fire blight management, effect on nontarget bacteria, and assessment of kasugamycin resistance potential in Erwinia amylovora. Phytopathology, 101, 192–204. McManus, P. S., Stockwell, V. O., Sundin, G. W., & Jones, A. L. (2002). Antibiotic use in plant agriculture. Annual Review of Phytopathology, 40, 443–465. Mellano, M. A., & Cooksey, D. A. (1988). Nucleotide sequence and organization of copper resistance genes from Pseudomonas syringae pv. tomato. Journal of Bacteriology, 170, 2879–2883. Mew, T. W., Vera Cruz, C. M., & Medalla, E. S. (1992). Changes in race frequency of Xanthomonas oryzae pv. oryzae in response to the planting of rice cultivars in Philippines. Plant Disease, 76, 1029–1032. Mizukami, T., & Wakimoto, S. (1969). Epidemiology and control of bacterial leaf blight of rice. Annual Review of Phytopathology, 7, 51–72. Mohanan, C. (1997). Diseases of bamboos in Asia: An illustrated manual. INBAR 228p. Mohanan, C. (2004). Witches’ broom disease of reed bamboo in Kerala, India. Forest Pathology., 34(5), 329–333. Montesinos, E. (2007). Antimicrobial peptides and plant disease control. FEMS Microbiol Letters, 270, 1–11. Morris, C. E., Kinkel, L. L., Xiao, K., Prior, P., & Sands, D. C. (2007). Surprising niche for the plant pathogen Pseudomonas syringae. Infection, Genetics and Evolution, 7, 84–92. Mrunalini, R., Badnakhe, & Prashant, R.D. (2011). An Application of K-Means Clustering and Artificial Intelligence in Pattern Recognition for Crop Diseases. International Conference on Advancements in Information Technology, 20. Muranaka, T., & Saito, K. (2010). Production of pharmaceuticals by plant tissue cultures comprehensive natural products ii, 3, 615-628. Murthy, V., & Devadath, S. (1984). Role of seed in survival and transmission of Xanthomonas campestris pv. oryzae causing bacterial blight of rice. Phytopathology, 110, 15–19. Mwendo, M., Ochwo-ssemakula, M., Lamo, J., Gibson, P., & Edema, R. (2017). Reaction of upland rice genotypes to the brown spot disease pathogen Bipolaris oryzae. African Journal of Rural Development, 2(1), 127–133. Nelson, R. R. (1972). Stabilizing racial populations of plant pathogens by use of resistance genes. Journal of Environmental Quality, 1(3), 220–227. Noda, T., & Kaku, H. (1999). Growth of Xanthomonas oryzae pv. oryzae in planta and in guttation fluid of rice. Annals of the Phytopathological Society of Japan, 65, 9–14. Nwugo, C. C., Doud, M. S., Duan, Y. P., & Lin, H. (2016). Proteomics analysis reveals novel host molecular mechanisms associated with thermotherapy of ‘Ca. Liberibacter asiaticus’-infected citrus plants. BMC Plant Biology, 16(1), 253. Oerke, E. C., Steiner, U., Dehne, H. W., & Lindenthal, M. (2006). Thermal imaging of cucumber leaves affected by downy mildew and environmental conditions. Journal of Experimental Botany, 57(9), 2121–2132. Ogero, K., Gitonga, N. M., Mwangi, M., Ngugi, M., & Ombori, O. (2012). Low cost tissue culture technology in the regeneration of sweet potato (Ipomoea batatas (L) Lam). Research Journal of Biological, 2(2), 71–78. Pande, V., Pandey, S.C., Joshi, T., Sati, D., Gangola, S., Kumar, S., et al. (2019). Biodegradation of toxic dyes, a comparative study of enzyme action in a microbial system. In Smart bioremediation technologies, microbial enzymes (pp. 255).

A spotlight on the recent advances in bacterial plant diseases Chapter | 3

67

Pandey, A., Tripathi, P. H., Paliwal, A., Tripathi, A. H., Pandey, S. C., Joshi, T., et al. (2019). Various approaches for food waste processing and its management. In Global initiatives for waste reduction and cutting food loss (pp. 191–211). IGI Global. Pandey, A., Tripathi, P. H., Pandey, S. C., Pathak, V. M., & Nailwal, T. K. (2018). Removal of Toxic Pollutants From Soil Using Microbial Biotechnology. In Microbial Biotechnology in Environmental Monitoring and Cleanup. IGI Global. Pandey, A., Tripathi, P.H., Tripathi, A.H., Pandey, S.C., & Gangola, S. (2019). Omics technology to study bioremediation and respective enzymes. In Smart bioremediation technologies: microbial enzymes (pp. 23). Pandey, S.C., Pande, V., Sati, D., Gangola, S., Kumar, S., Pandey, A., et al. (2019). Microbial keratinase: a tool for bioremediation of feather waste. In Smart bioremediation technologies: microbial enzymes (pp. 217). Pandey, S. C., Pandey, A., Joshi, T., Pande, V., Sati, D., & Samant, M. (2019). Microbiological Monitoring in the Biodegradation of Food Waste. In Global Initiatives for Waste Reduction and Cutting Food Loss (Vol. 116-140). IGI Global. Peterson, J. W. (1996). Bacterial pathogenesis (fourth ed.). Galveston (TX): University of Texas Medical Branch at Galveston. Petnicki-Ocwieja, T., Schneider, D. J., Tam, V. C., Chancey, S. T., Shan, L., Jamir, Y., et al. (2002). Genomewide identification of proteins secreted by the Hrp type III protein secretion system of Pseudomonas syringae pv. tomato DC3000. Proceedings of the National Academy of Sciences of the United States of America, 99(11), 7652–7657. Pieterse, C. M. J., Zamioudis, C., Berensen, R. L., Weller, D. M., & Van Wees, S. C. M., (2014). Induced systemic resistance by beneficial microbes. Annual Review of Phytopathology, 52, 347–375. Pradhanang, P. M., Ji, P., Momol, M. T., Olson, S. M., Mayfield, J. L., & Jones, J. B. (2005). Application of acibenzolar-S-methyl enhances host resistance in tomato against Ralstonia solanacearum. Plant Disease, 89, 989–993. Preston, G. M., Studholme, D. J., & Caldelari, I. (2005). Profiling the secretomes of plant pathogenic proteobacteria. FEMS Microbiology Reviews, 29(2), 331–360. Prithiviraj, B., Vikram, A., Kushalappa, A. C., & Yaylayam, V. (2004). Volatile metabolite profiling for the discrimination of onion bulbs infected by Erwinia carotovora ssp. carotovora, Fusarium oxysporum and Botrytis allii. European Journal of Plant Physiology, 110, 371–377. Puyam, A., Sharma, S., & Kashyap, P. L. (2017). RNA interference-a novel approach for plant disease management. Journal of Applied and Natural Science, 9(3), 1612–1618. Rojas, C. M., Senthil-Kumar, M., Tzin, V., & Mysore, K. S. (2014). Regulation of primary plant metabolism during plant-pathogen interactions and its contribution to plant defense. Front Plant Sci, 5, 17. Ruiz-Ruiz, S., Ambrós, S., Carmen Vives, M., Navarro, L., Moreno, P., & Guerri, J. (2009). Detection and quantification of Citrus leaf blotch virus by TaqMan real-time RTPCR. Journal of Virological Methods, 160(1–2), 57–62. Salanoubat, M., Genin, S., Artiguenave, F., Gouzy, J., Mangenot, S., Arlat, M., et al. (2002). Genome sequence of the plant pathogen Ralstonia solanacearum. Nature, 415, 497–502. Samant, M., Pandey, S. C., & Pandey, A. (2018). Impact of hazardous waste material on environment and their management strategies. In Microbial Biotechnology in Environmental Monitoring and Cleanup (Vol. 175-192). IGI Global. Sankarana, S., Mishraa, A., Ehsania, R., & Davisb, C. (2010). A review of advanced techniques for detecting plant diseases. Computers and Electronics in Agriculture, 72(1), 1–13. Saponari, M., Manjunath, K., & Yokomi, R. K. (2008). Quantitative detection of citrus tristeza virus in citrus and aphids by real-time reverse transcription-PCR (TaqMan®). Journal of Virological Methods, 147(1), 43–53.

68

Recent Advancements in Microbial Diversity

Shenge, K. C., Mabagala, R. B., Mortensen, C. N., Stephan, D., & Wydra, K. (2007). First report of bacterial speck of tomato caused by Pseudomonas syringae pv. tomato in Tanzania. Plant Disease, 91, 462. Shtienberg, D., Zilberstaine, M., Oppenheim, D., Herzog, Z., Manulis, S., Shwartz, H., et al. (2001). Efficacy of oxolinic acid and other bactericides in suppression of Erwinia amylovora in pear orchards in Israel. Phytoparasitica, 29, 143–154. Singh, R., Das, B., Ahmed, K., & Pal, V. (1980). Chemical control of bacterial leaf blight of rice. International Journal of Pest Management, 26, 21–25. Singh, V., & Misrab, A. K. (2016). Detection of plant leaf diseases using image segmentation and soft computing techniques. Information Processing in Agriculture, 4(1), 41–49. Smil, V. (2000). Feeding the world: a challenge for the twenty-first century. Cambridge: The Massachusetts Institute of Technology Press. Sobiczewski, P. (2008). Bacterial diseases of plants: epidemiology, diagnostics and control. Zemdirbyste-Agriculture, 95(3), 151–157. Stark-Lorenzen, P., Nelke, B., Hänßler, G., Mühlbach, H. P., & Thomzik, J. E. (1997). Transfer of a grapevine stilbene synthase gene to rice (Oryza sativa L.). Plant Cell Reports, 16(10), 668–673. Stubbendieck, R. M., Vargas-Bautista, C., & Straight, P. D. (2016). Bacterial communities: Interactions to scale. Frontiers in Microbiology, 7, 1234. Suman, S. (2017). Plant tissue culture: A promising tool of quality material production with special reference to micropropagation of banana. Biochemical and Cellular Archives, 17(1), 1–26. Teng, P. S., & James, W. C. (2002). Disease and yield loss assessment. In J. M. Waller, J. M. Lenné, & S. J. Waller (Eds.), Plant Pathologist’s pocketbook (pp. 25–38). Teng, P. S., & Krupa, S. V. (1980). Assessment of losses which constrain production and crop improvement in agriculture and forestry. Proceedings of the E. C. Stackman. Tolba, I. H. (2017). Bacterial Leaf Spot of Araliaceous Plants Caused by Xanthomonas campestris pv. hederae in Egyp. Journal of Plant Protection and Pathology, 8(6), 287–295. Toth, I. K., & Birch, P. R. (2005). Rotting softly and stealthily. Current Opinion in Plant Biology, 8, 424–429. Verdier, V., Vera Cruz, C., & Leach, J. E. (2011). Controlling rice bacterial blight in Africa: needs and prospects. Journal of Biotechnology. Von Bodman, S. B., Bauer, W. D., & Coplin, D. L. (2003). Quorum sensing in plant-pathogenic bacteria. Annual Review of Phytopathology., 41, 455–482. Voytas, D. F., & Gao, C. (2014). Precision genome engineering and agriculture: opportunities and regulatory challenges. PLOS Biology, 12(6), e1001877. Walcott, R. R. (2005). Bacterial fruit blotch of cucurbits. The Plant Health Instructor. Ward, E., Foster, S. J., Fraaije, B. A., & Mccartney, H. A. (2004). Plant pathogen diagnostics: Immunological and nucleic acid-based approaches. Annals of Applied Biology, 145, 1–16. Warth, B., Parich, A., Bueschl, C., Schoefbeck, D., Neumann, N. K., Kluger, B., et al. (2015). GCMS based targeted metabolic profiling identifies changes in the wheat metabolome following deoxynivalenol treatment. Metabolomics, 11(3), 722–738. Wen, N., Chu, Z., & Wang, S. (2003). Three types of defence-response genes are involved in resistance to bacterial blight and fungal blast disease in rice. Molecular Genetics and Genomics, 269, 331–339. West, J. S., Bravo, C., Oberti, R., Lemaire, D., Moshou, D., & McCartney, H. A. (2003). The potential of optical canopy measurement for targeted control of field crop diseases. Annual Review of Phytopathology, 41, 593–614. Williams, S. D., Boehm, M. J., & Peduto, F. (2017). Bacterial diseases of plants. Columbus: The Ohio State University, college of food, agriculture and environmental science.

A spotlight on the recent advances in bacterial plant diseases Chapter | 3

69

Yin, K., & Qiu, J. L. (2019). Genome editing for plant disease resistance: applications and perspectives. Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences, 374(1767), 20180322. Yvon, M., Thébaud, G., Alary, R., & Labonne, G. (2009). Specific detection and quantification of the phytopathogenic agent ‘Candidatus Phytoplasma prunorum. Molecular and Cellular Probes, 23(5), 227–234. Zhou, J., Peng, Z., Long, J., Sosso, D., Liu, B., Eom, J. S., et al. (2015). Gene targeting by the TAL effector PthXo2 reveals cryptic resistance gene for bacterial blight of rice. Plant Journal, 82(4), 632–643. Zulkarnain, Z., Tapingkae, T., & Taji, A. (2015). Applications of in vitro techniques in plant breeding. Advances in Plant Breeding Strategies: Breeding, Biotechnology and Molecular Tools, 293–328.

Chapter 4

Bacterial diseases of banana: detection, characterization, and control management Thangjam Premabatia and Surajit De Mandalb a

Department of Biotechnology, Mizoram University, Aizawl, Mizoram, India; bKey Laboratory of Bio-Pesticide Innovation and Application of Guangdong Province, College of Agriculture, South China Agricultural University, Guangzhou, P. R. China

1 Background Banana and ensete (Musa spp.) are monocotyledonous herbs of the family Musaceae; order Zingiberales. These herbs are available in more than 130 countries in the tropical as well as in some subtropical regions, such as Asia, Africa, Latin America, the Caribbean and the Pacific regions (Uma et al., 2005). Banana is one of the most valuable fruits in the world and is considered a staple food for millions of people in developing countries (Denham et al., 2003). The banana and plantain industry contributes to the food security of the peoples and helps in generating foreign currency. Ecuador is the world’s leading exporter and Costa Rica ranking third. The banana and plantain industry also creates thousands of direct and indirect jobs throughout the year in the tropical and subtropical regions (Pocasangre Ploetz, Molina, & Perez Vicente, 2009). As a center of origin of Musaceae, Asia has the largest number of Musa species. It is also the largest producer followed by Africa and Latin America. Although banana is a very important fruit, research in this field is limited. Banana production is largely affected by various biotic factors including bacteria, fungi, viruses etc. Rapid detection and accurate identification of these pathogens are critical steps to prevent pathogens dissemination, leading to the successful management of the plant disease.

2  Bacterial diseases of banana Bacterial wilt (BW) diseases impose a great threat to the world banana production, especially in poor countries. While there are only few sources of resistance to BW disease in wild diploids, triploid varieties are all susceptible. Three major categories of bacterial diseases in bananas are: i) Xanthomonas Recent Advancements in Microbial Diversity. http://dx.doi.org/10.1016/B978-0-12-821265-3.00004-9 Copyright © 2020 Elsevier Inc. All rights reserved.

71

72

Recent Advancements in Microbial Diversity

FIGURE 4.1  Symptoms of bacterial diseases in banana.

wilt (BXW) caused by Xanthomonas vasicola pv. musacearum (formerly Xanthomonas campestris pv. musacearum); ii) Ralstonia-associated diseases (Moko/Bugtok disease and banana blood disease) caused by Ralstonia solanacearum species complex and Ralstonia syzygii subsp. Celebesensis (Blood Disease Bacterium); iii) Erwinia-associated diseases (bacterial head rot or tipover disease; and bacterial rhizome and pseudostem wet rot) caused by Pectobacterium (formerly Erwinia) carotovora ssp. Carotovora; and Dickeya paradisiaca (formerly E. chrysanthemi pv. Paradisiaca) (Fig. 4.1) (Table 4.1). Other bacterial diseases, such as Javanese vascular wilt, bacterial wilt of abaca and bacterial finger-tip rot, are little known/widespread. BXW is a vascular disease that infects bananas and ensete. Symptoms of BXW include yellowing and wilting of leaves leading to collapsing of the petiole. It also causes yellowing of both immature and mature fruits, which are cultivar-specific and are also determined by the route and stage of infection (Spring et al., 1997). Foliar symptoms are quite similar to those of Fusarium wilting, but a yellowish bacterial ooze of the cut tissues is characteristic of the bacterial wilt (Thwaites, Eden-Green, & Black, 2000; Tushemereirwe et al., 2003; Tushemereirwe et al., 2004). In Moko/Bugtok disease, wilting begins with the youngest leaves and necrosis of the flag leaf which progress towards the older leaves. When a diseased plant is chopped off, the central region of the pseudostem become necrotic. Symptoms also include yellow and hollow immature fruit due to dry rot of the pulp (Silva et al., 2000). Moko/Bugtok disease is a systemic disease in which the pathogen travels through the vascular bundles of the plant. A series of red spots or brown lines are seen in the vascular bundles of the infected tree cut pseudostem, which represents the degraded tissue. The rachis, fruits, or corm of the diseased plant first shows a pale yellowish lesion followed by reddish brown and black (Vásquez, 2008). Symptoms of banana blood disease include yellowing and necrotic leaves as the disease progresses, which ultimately leads to wilting, collapse and drooping from the petiole (Stover & Espinoza, 1992). Transverse sections of the pseudostem and/or peduncle show red or brown necrotic marks towards the center. An unripe fruit that looks green and healthy from the outside shows red to brown dry shriveled pulp or the flesh can be gradually dissolved, filling the cavity with slimy fluid of brownish-red color containing bacterium

TABLE 4.1 Major bacterial diseases of banana. Host

Symptoms

Causal agent

Characteristic features

Transmission

References

1

Xanthomonas wilt

All banana cultivars and enset

Yellowing and wilting of leaves, collapsing the petiole, yellowish bacterial ooze from cut tissues

Xanthomonas vasicola pv. musacearum (Xvm)

Yellow, convex and mucoid colonies; motile; strictly aerobes

Insects, contaminated tools

Valentine et al., 2006

2

Blood disease of banana

Banana cultivar (especially ABB/BBB genotype)

Red or brown necrotic marks towards pseudostem /peduncle centre, red/ brown dry shriveled pulp or flesh dissolved filling the cavity with slimy fluid of brownish-red color containing the bacterium

Blood Disease Bacterium (BDB)

Smooth margins colonies with darkred centres; not motile

Insects, contaminated soils & tools

EdenGreen, 1994; Gäumann, 1921

3

Moko/bugtok

Banana and other (solanaceous ) crop plants

Youngest leaves wilt first and flag leaf necrosis that progress towards older leaves, necrosis of center of the pseudostem

Ralstonia solanacearum species complex (RSSC)

Wide host and geographical range; aerobes; no endospore

Insects, contaminated soils, plant parts & tools, water run-off

Hayward & Hartman, 1994; Fegan & Prior, 2006

4

Wet rot of banana

Banana and other tuberous crops

Rotten rhizome of newly planted suckers with foul smell and pseudostem rot of established plant

Pectobacterium carotovora ssp. carotovora and Dickeya paradisiaca

Occur mostly alone or in pairs, but sometimes they are seen in chains too; motile; facultatively anaerobic

Splashing of the bacteria from soil in to the throat or funnel made by the leaves

Dickey, & Victoria, 1980; Dickey, 1979; Tomlinson et al., 1987

73

Disease

Bacterial diseases of banana Chapter | 4

S. No.

74

Recent Advancements in Microbial Diversity

FIGURE 4.2  Protocol for the characterization of bacterial diseases in banana.

(Gäumann, 1921; Gäumann, 1923). Bacterial head rot or tip-over disease (simply banana wilt) occurs on mature plants, which leads to wilting and death of leaves that hang around the pseudostem like a skirt. A rotten pseudostem with an unpleasant odor is visible in the transverse section. In newly planted suckers, rhizome rot is accompanied by characteristic foul smell, while in older plants, rotting was observed at the collar (base of the pseudostem in contact with soil) which led to the fall of plants after splitting at the base. Rots in rhizomes are sometimes accompanied by cavities of dark margins (Fig. 4.2). Some of the causative agents of bacterial wilt diseases of banana are discuss below: (1) Xanthomonas vasicola pv. musacearum (Xvm)

X. vasicola pv. Musacearum (formerly Xanthomonas campestris pv musacearum) causes Banana Xanthomonas wilt (BXW) also known as banana bacterial wilt (BBW) and its close relative ensete (Valentine et al., 2006). Xvm is a gram-negative rod-shaped motile bacterium with a single polar flagellum. They produce yellow, convex and mucoid colonies in nutrient glucose agar and other medium. These cultures are strictly aerobic, and do not show fluorescence on King’s B medium. They also showed a negative result with respect to the reduction of nitrates, tyrosinase, oxidase, hydrolysis of starch and gelatinase, and also cause a hypersensitive response in tobacco leaves, but it does not induce symptoms in solanaceous hosts (Yirgou & Bradbury, 1968). In addition, the isolates did not grow in Dye asparagine medium and nutrient agar containing 0.01% triphenyl tetrazolium

Bacterial diseases of banana Chapter | 4

75

chloride, and didn’t produce acid or gas from glycerol or meso-inositol. Xanthomonas wilt is an emerging banana disease that seriously damages banana production worldwide serious damage to banana production throughout the world. (2) Ralstoniasolanacearum species complex (RSSC) Ralstonia solanacearum is a soil-borne pathogen that causes vascular wilt disease in over 200 plant species, including solanaceous vegetable such as potato (Solanum tuberosum), tomato (Solanum lycopersicum), banana (Musa spp.), ginger, peanut and many other crop plants (Buddenhagen & Kelman, 1964; Hayward & Hartman, 1994). R. solanacearum is a species complex consisting of different strains with wide metabolic requirements. These strains have different host range, centers of origin, and require specific environmental conditions for infection. Ralstonia solanacearum is a gram-negative motile rod-shaped bacterium. The organism is aerobe and does not form endospores (Stevenson, Loria, Franc, & Weingartner, 2001). Due to its lethality, wide host range persistence and extensive geographical distribution, RSSC is considered as one of the most destructive plant pathogens (Elphinstone, 2005; Fegan & Prior, 2005; Fegan & Prior, 2006; Fegan, Taghavi, Sly, & Hayward, 1998). Vascular wilt caused by R. solanacearum is the major disease affecting crop plants. This bacterial plant pathogen is a natural inhabitant of the soil and is present on all continents and on many islands (Elphinstone, 2005). RSSC causes Moko/Bugtok disease and banana blood disease. Four phylotypes are recognized within the R. solanacearum species complex based on analysis of their 16S-23S rRNA gene, intergenic spacer region (ITS) and hrpB and egl gene sequences and comparative genomic hybridization (Guidot et al., 2007). Phylotypes I, II and III consist of strains, mainly from Asia, America and Africa, respectively, and their surrounding islands. The phylotype IV primarily consists of strains from Indonesia and Japan, Australia and Philippines. They are also considered to be the most diverse group among the four phylotypes. The strain R. solanacearum, causing Moko and Bugtok, belongs to phylotype II while Blood disease bacterium (BDB), known as Ralstonia syzygii subsp. celebensis (Safni et al., 2014), which causes the banana blood disease, is of phylotype IV. (3) Blood disease bacterium (BDB) BDB is the causative agent of banana blood disease, one of the most destructive bacterial wilt diseases affecting bananas (Musa acuminata) and plantains (Eden-Green, 1994). These bacteria are small, straight, gram-negative rod-shaped, non-motile. In Kelman’s (1954) TZC medium colonies of BDB are slow-growing, non-fluidal and showed smooth margins with dark-red centers (Kelman, 1954). Typically, colonies are non-fluorescent on King’s B medium and cannot produce brown pigment on tyrosinase medium, but after a long incubation they turn into brown colour. BDB was first isolated around 20th century and was named ‘Pseudomonas celebensis’ (Gäumann, 1923).

76

Recent Advancements in Microbial Diversity

However, this name was not included in the Approved Lists of Bacterial Names and, as type or reference cultures of ‘P. celebensis’ no longer exist, and therefore the name does not appear in the nomenclature. The bacterium is currently known BDB and classified as a member of the phylotype IV of the species complex R. solanacearum. BDB invades the vascular tissues in banana (Musa spp) resulting in wilting. The cut vascular tissues of infected plants often ooze droplets of thick milky white, yellow or red-brown liquid therefore the name blood disease was given. The disease affects banana cultivars of both AAA and ABB genome groups. These bacteria can survive for more than a year in soils infested with decaying diseased plant tissues and may cause infection to the banana plant through wounds on suckers, pseudostem and fruits. The development of symptoms depends on the site of infection as well as the growth stage of the plant. It is believed that the disease is transmitted by insects through male flowers. The Pisang Kepok or Pisang Kapok (ABB group) in Indonesia and Malaysia is thought to be highly sensitive due to the high sugar content in the male flower nectar, which attracts insects that spread bacteria from the male bud. Blood disease is common in the Pisang Kepok cultivar but it is not exclusive, other genome groups are also affected. (4) Pectobacterium carotovorum subsp. carotovorum It is a soil borne, gram-negative, rod-shaped, non-spore forming with rounded ends bacterium. The bacteria occur mostly alone or in pairs, but sometimes they appear in chains. Cells are motile with peritrichous flagella (4-6 flagella), facultatively anaerobic and catabolize glucose through fermentative pathway. After 24 h (27°C) in the nutrient agar, the colonies were convex, irregular and undulate with pale cream color while in yeast extractdextrose agar, the colonies were convex or somewhat umbonate, irregular, undulate, light tan and slightly bigger in diameter. This bacterium can reduce nitrates to nitrites. The bacterium causes vascular wilts or soft rots on a range of host plants. This bacterial attack is usually mistaken by farmers as fungal attack. Different names have been given to this bacterial attack such as Erwinia attack, Head rot, Soft rot, Snap off and Tip Over (Dickey & Victoria, 1980; Maisuria & Nerurkar, 2013). Banana plants regenerated through tissue culture are prone to this bacterial attack. The bacterium, Erwinia carotovora ssp. Carotovora enters into the young banana plants during planting through wounds at roots leading to the development of disease. Infected underground stem of young plants show extensive rotting along with foul odor. Older plants show rotting at the collar region (the region of stem and rhizome joining) and leaf bases. The affected plant parts become so weak that the normal wind will snap off the corm easily. In some severe cases, it is observed that the base of the pseudostem becomes swollen and splits. The affected tissues become yellowish brown along with brown margins. This disease can also be spread to the daughter suckers of the diseased clump (Dickey, 1979; Dickey & Victoria, 1980).

Bacterial diseases of banana Chapter | 4

77

(5) Dickeya paradisiaca This phytopathogen is a gram-negative rod-shaped, motile (with peritrichous flagella), facultatively anaerobic, catalase positive, and oxidase negative bacterium. It produces β- galactosidase, reduces nitrate, produces H2S, and tested positive for acid production from L-(+)-arabinose, D-(-)-ribose, L-(+)-rhamnose, D-(-)- fructose, D-(+)-galactose, D-(+)-mannose, D-(+)cellobiose, glycerol, D-mannitol, D-sorbitol, esculin, and salicin but negative from palatinose, glucopyranoside, and trehalose. It has been tested to be negative for the production of urease or acid from adonitol (Dickey, 1979). It causes rhizome and pseudostem wet rot in banana which is characterized by foul smell soft rot of the rhizome and progress the rot to the pseudostem, causing the growing point to be destroyed and internal decay which is often accompanied by vascular discoloration. Characteristic symptoms also include yellowing and wilting of the leaves. It also resulted in failure of newly planted corms to fully establish whilst in established plants, dark brown pockets of rotting tissue occurred at any point in the pseudostem (Tomlinson, King, & Ovia, 1987). Disease incidence were apparently different in different cultivars for example the diploid (AA) cultivars showed significantly higher levels of rot, than the triploid cultivars (Tomlinson et al., 1987).

3  Isolation and identification of the causal bacterial agents of the diseased banana Isolation: Proper identification of the causal agents of a diseased plant depends on the isolation and purification of the agents. Standard Trypticase Soy Broth Agar (TSBA), Nutrient Agar (NA) and Yeast Dextrose Carbonate Agar (YDC) are some of the media commonly used to isolate bacteria from infected plants (Dadas¸og˘lu & Kotan, 2017). Isolation of the pathogenic agents from symptomatic plant samples is easily achievable using non-selective media due to the high density of the pathogen in the tissues. For example casamino peptone glucose (CPG) and Kelman’s Tetrazolium-chloride (TZC) media (Chaudhry & Rashid, 2011) are used to isolate R. solanacearum from symptomatic plant tissues. Isolation from non-symptomatic plant tissues is very difficult due to the low copy number of the cells. Isolation from the soil is very problematic due to the presence of other microbial inhabitants; many of them are fast-growing bacteria (Schaad, Jones, & Chun, 2001). Several semi-selective and modified semi-selective media have been described for the isolation of R. solanacearum (Aley & Elphinstone, 1995; Elphinstone, 2005; Ito et al., 1998; Wenneker et al., 1999). Semi-selective media: Yeast extract peptone glucose agar (YPGA), cellobiose cephalexin agar and yeast extract tryptone sucrose agar (YTSA) containing antibiotics cephalexin, 5-fluorouracil and cycloheximide is employed to isolate Xvm from infected banana (Mwangi, 2007; Nakato, Mahuku, & Coutinho, 2018; Schaad, Jones & Lacy, 2001). Briefly, infected plant tissues

78

Recent Advancements in Microbial Diversity

(surface sterilization) or bacterial exudates are used to isolate bacterial strains. The observed colonies were sub cultured and pure single colonies were isolated. Once a single colony is obtained, the strain is subjected to a number of tests (phenotypes and/or molecules) for accurate identification of the strain. Identification: Different methods have been employed for the identification and characterization of the bacterial strain. Some methods employed are: Microbial Identification System (MIS) based on fatty acid analysis, BIOLOG based on metabolic enzyme profiling, SDS-PAGE based on protein profiles, Immunofluorescence, Radioimmunoassay, Immuno Blot, Dot Immunobinding Assay and Enzyme Linked Immunosorbent Assay (ELISA) (serological reactions) and rDNA-PCR, Rep-PCR, Eric-PCR, Box-PCR and Specific PCR based on genetic profiling (see Table 4.2 for primers details) (Guillorit-Rondeau, Malandrin, & Samson, 1996; Kersters, 1985; Miller & Berger, 1985; Miller & Martin, 1988; Zhang & Geider, 1997). Classical identification methods are primarily based on the phenotypic properties such as morphological, physiological, biochemical and pathological features. These methods have some disadvantages as it needs other systems to support its claim and these are labor intensive, and also gives information only up to the genus level and morphological and other such features are environment dependant so, are prone to give different results in different growth environments (Miller and Joaqium, 1993). Other common methods including MIS, BIOLOG, ELISA, and PCR are the most popular because they are more accurate than traditional methods. However, any one single method is not sufficient in alone for identification purposes. Thus, molecular and classical methods should complement each other for microbial identification.

4  Control management 4.1  Before planting Disease-free planting materials collected only from healthy stools (i.e. clumps of plants formed from the same parent plant) should be used for plantation. Knives and other tools used should be disinfected with bleach/sodium hypochlorite after removing the suckers.

4.2  During growth If any symptoms of banana wilt or rhizome rot are observed, the diseased mats or stools should be uprooted, chopped off and burnt down. The male bud should be removed with a forked stick after the last cluster of fruit formed to limit the insect transmission and disinfect the farming implements with sodium hypochlorite (Thwaites et al., 2000; Tushemereiwe et al., 2006). If the suckers are to be left as these may be healthy, they should be monitor for infection very regularly. Water stress should be avoided as plants tend to be more susceptible to rhizome rots when hot and dry condition is followed by heavy rainfall. The plantation areas should have a well drainage system.

TABLE 4.2 Details of primers used for characterization of banana bacterial diseases. Product size (bp)

Sequence

Target region

Organism

Universal 16S primer

GGTGCGGCTGGATCACCTCCTT & TCGCCTTTCCCTCACGGTACT

16-23 ITS region

Xanthomonas, Pectobacterium carotovorum, Ralstonia solanacearum

1500

References Taghavi, Hayward, Sly, & Fegan, 1996; Kang, Kwon, & Go, 2003; Adriko, 2011

GspDm- F2 & GspDm-R3

GCGGTTACAACACCGTTCAAT & AGGTGGAGTTGATCGGAATG

Protein GspD (ZP_06489699)

Xanthomonas (Xvm)

265

Adriko et al., 2012

NZ085-F3 & NZ085-R3

CGTGCCATGTATGCGCTGAT & GAGCGGCATAGTGCGACAGA

Hypothetical protein (ZP_06488508)

Xvm

349

Adriko et al., 2012

759/760

GTCGCCGTCAACTCACTTTCC / GTCGCCGTCAGCAATGCGGAATCG

16S rDNA region

Ralstonia solanacearum species complex

280

Opina et al., 1997; Villa et al., 2003

Y1 & Y2

TTA CCG GAC GCC GAG CTG TGG CGT & 5CAG GAA GAT GTC GTT ATC GCG AGT

Pectobacterium carotovorum

434

Dadas¸og˘lu1 & Kotan, 2017

Endo-F & Endo-R

ATGCATGCCGCTGGTCGCCGC & GCGTTG CCCGGCACGAACACC

Endoglucanase gene region

R. solanacearum and blood disease bacterium (BDB)

750bp

Fegan et al., 1998

Nmult21:1F & Nmult22:RR

CGTTGATGAGGCGCGCAATTT & TCGCTTGACCCTATAACGAGTA

ITS region

RSSC Phylotype I

144

Fegan & Prior, 2005

Nmult21:2F & Nmult22:RR

AAGTTATGGACGGTGGAAGTC & TCGCTTGACCCTATAACGAGTA

ITS region

RSSC Phylotype II

372

Fegan & Prior, 2005

Bacterial diseases of banana Chapter | 4

Primer

(Continued)

79

80

TABLE 4.2 Details of primers used for characterization of banana bacterial diseases. (Cont.) Sequence

Target region

Organism

Product size (bp)

References

Nmult23:AF & Nmult22:RR

ATTACSAGAGCAATCGAAAGATT & TCGCTTGACCCTATAACGAGTA

ITS region

RSSC Phylotype III

91

Fegan & Prior, 2005

Nmult22:InF & Nmult22:RR

ATTGCCAAGACGAGAGAAGTA & TCGCTTGACCCTATAACGAGTA

ITS region

RSSC Phylotype IV

213

Fegan & Prior, 2005

REP1R-I & REP2-I

IIIICGICGI CATCIGGC & ICGICTTATCIGGCCTAC

REP

Xanthomonas

Louws, Fulbright, Stephens, & De Bruijn, 1994

ERICIR & ERIC2

ATGTAAGCTCCTGGGGATTCAC & AAGTAAGTGACTGGGGTGAGCG

ERIC

Xanthomonas

Louws et al., 1994

BOXAlR

CTACGGCAAGGCGACGCTGACG

BOX element

Xanthomonas

Louws et al., 1994

X.Gyr.fsp1 & X.Gyr.rsp1

(5’-CAGGGCAAGAGCGAGCTGTA & CAAGGTGCTGAAGAT CTG GTC

gyrase sub unit B gene (gyrB)

Xanthomonas vasicola

Aritua et al., 2007

EXPCCF & EXPCCR

GCCGTAATTGCCTACCTGCTTAAG & GAACTTCGCACCGCCGACCTTCTA

pel gene

Pectobacterium carotovorum

550

Kang et al., 2003

Recent Advancements in Microbial Diversity

Primer

Bacterial diseases of banana Chapter | 4

81

4.3  Chemical control Earlier before methyl bromide was banned, it was used for the control of Moko disease. The infected mat was dug out and methyl bromide was applied as a measure to control Moko disease. Later Dazomet (Basamid® granular 97%) was used to sterilize the soil which was proved as a good measure to control Moko/Bugtok disease. This method is advantageous because dazomet does not have any harmful impact to the soil or environment (Cronshaw, 1998). In Philippines, formalin was used as a control measure against Ralstonia infected Cavendish banana, by drenching the nearby soils with formalin solution. This practice helped in lowering the bacterial counts of the area (Pava, Franje, & Timario, 2003). Farmers in Philippines also used Furadan® (a.i. carbofuran 48%); an insecticide and nematicide on the mats of harvested, Bugtok-infected plants and reported that new bunches harvested from the treated mat were free from Bugtok disease (Pava et al., 2003). Disease control measures using chemicals like herbicides is a less labor intensive as compare with roguing (Blomme, Turyagyenda, Mukasa, & Eden-Green, 2008). However, small-scale farmers in east and central Africa used herbicides very rarely against Xanthomonas wilt due to scarcity of herbicides in the rural areas, high cost of herbicides and the farmers were also worried that the injection to the symptomatic plants, might also affect the physically attached asymptomatic plants (Blomme et al., 2014). In Central America, herbicidal sprays were used as a control measure against Moko disease (Lehmann-Danzinger, 1987). Moko disease was effectively eradicated in Belize, using glyphosate treatment to all infected mats and adjacent mats around infected ones (within a 5 m radius) along with systematic surveys of ABB type Bluggoe mats and dessert banana cultivars (Thwaites et al., 2000).

4.4  Biological control Use of antagonistic bacteria as a control measure against Xvm is still in its early phase however, initial pot experiments of four bacterial antagonists against Xanthomonas wilt showed reduced in disease incidence (56 to 75%) in Ethiopia, (Abayneh, 2010). Laboratory studies in Uganda showed suppression of Xvm by bacterial isolates namely Burkholderia spp., Herbaspirillum spp., and Enterobacter spp. which were isolated from tissues of banana collected from different parts of Uganda (Were, 2016).

References Abayneh, T. B. (2010). Evaluation of biological control agents against bacterial wilt pathogen (Xanthomonas campestris pv. musacearum) of ensete (Ensete ventricosum). Addis Ababa University Doctoral dissertation. Adriko, J., (2011). Multiplex PCR based on multiple and single gene targets. PhD thesis, University of Copenhagen, Denmark.

82

Recent Advancements in Microbial Diversity

Adriko, J., Aritua, V., Mortensen, C. N., Tushemereirwe, W. K., Kubiriba, J., & Lund, O. S. (2012). Multiplex PCR for specific and robust detection of Xanthomonas campestrispv.musacearum in pure culture and infected plant material. Plant Pathology, 61(3), 489–497. Aley, E., & Elphinstone, J. (1995). Culture media for Ralstonia solanacearum isolation, identification and maintenance. Fitopatologia, 30, 126–130. Aritua, V., Parkinson, N., Thwaites, R., Heeny, J. V., Crozier, E., Tushemereirwe, W., et al. (2007). Characterisation of bacteria causing Xanthomonas wilt of banana and enset supports their reclassification as a pathovar of Xanthomonas vasicola. Plant Pathology, 56, 383–390. Blomme, G., Jacobsen, K., Ocimati, W., Beed, F., Ntamwira, J., Sivirihauma, C., et al. (2014). Fine-tuning banana Xanthomonas wilt control options over the past decade in East and Central Africa. European Journal of Plant Pathology, 139(2), 271–287. Blomme, G., Turyagyenda, L. F., Mukasa, H., & Eden-Green, S. (2008). The effectiveness of different herbicides in the destruction of banana Xanthomonas wilt infected plants. Special Issue. Research Advances in Banana and Enset in Eastern Africa. Africa Crop Science Journal, 16, 103–110. Buddenhagen, I., & Kelman, A. (1964). Biological and physiological aspects of bacterial wilt caused by Pseudomonas solanacearum. Annual Review of Phytopathology, 2(1), 203–230. Chaudhry, Z., & Rashid, H. (2011). Isolation and characterization of Ralstonia solanacearum from infected tomato plants of soan skesar valley of Punjab. Pakistan Journal of Botany, 43(6), 2979–2985. Cronshaw, D. K. (1998). Basamid granular for the control of Moko disease,” in Memorias XII Reunión Internacional de ACORBAT, ed. J. A. Guzmán Chaves, SanJosé. Dadas¸og˘lu, F., & Kotan, R. (2017). Identification and characterization of Pectobacterium carotovorum. Journal of Animal and Plant Sciences, 27, 647–654. Denham, T. P., Haberle, S. G., Lentfer, C., Fullagar, R., Field, J., Therin, M., et al. (2003). Origins of agriculture at Kuk Swamp in the highlands of New Guinea. Science, 301(5630), 189–193. Dickey, R. S. (1979). Erwinia chrysanthemi: a comparative study of phenotypic properties of strains from several hosts and other Erwinia species. Phytopathology, 69(4), 324. Dickey, R. S., & Victoria, J. I. (1980). Taxonomy and emended description of strains of Erwinia isolated from Musa paradisiaca Linnaeus. International Journal of Systematic and Evolutionary Microbiology, 30(1), 129–134. Eden-Green, S. (1994). Banana blood disease. INIBAP Musa disease fact sheet no 3. Elphinstone, J. (2005). The current bacterial wilt situation: a global overview. Bacterial Wilt Disease and the Ralstonia Solanacearum Species Complex, 9–28. Fegan, M., & Prior, P. (2005). How complex is the Ralstonia solanacearum species complex. Bacterial Wilt Disease and the Ralstonia Solanacearum Species Complex, 1, 449–461. Fegan, M., & Prior, P. (2006). Diverse members of the Ralstonia solanacearum species complex cause bacterial wilts of banana. Australasian Plant Pathology, 35(2), 93–101. Fegan, M., Taghavi, M., Sly, L., & Hayward, A. (1998). Phylogeny, diversity and molecular diagnostics of Ralstonia solanacearum. In Bacterial wilt disease (19-33). Springer. Gäumann, E. (1921). Onderzoekingen over de bloedziekte der bananen op Celebes I.(Investigations into the blood disease of bananas on Celebes Island) Mededeelingen van het Instituut voor Plantenziekten No. 50, 47p. Review of Applied Micrology, 1, 225–227. Gäumann, E. (1923). Onderzoekingen over de Bloedziekte der Bananen op Celebes. II.:(Investigations of the blood-disease of bananas in Celebes. II). Ruygrok & Company.

Bacterial diseases of banana Chapter | 4

83

Guidot, A., Prior, P., Schoenfeld, J., Carrere, S., Genin, S., & Boucher, C. (2007). Genomic structure and phylogeny of the plant pathogen Ralstonia solanacearum inferred from gene distribution analysis. Journal of Bacteriology, 189(2), 377–387. Guillorit-Rondeau, C., Malandrin, L., & Samson, R. (1996). Identification of two serological flagellar types (H1 and H2) in Pseudomonas syringae pathovars. European Journal of Plant Pathology, 102(1), 99–104. Hayward, A., & Hartman, G. L. (1994). Bacterial wilt: the disease and its causative agent, Pseudomonas solanacearum. In Bacterial wilt: the disease and its causative agent, Pseudomonas solanacearum. Wallingford: CAB International. Ito, S., Ushuima, Y., Fujii, T., Tanaka, S., Kameya-Iwaki, M., Yoshiwara, S., et al. (1998). Detection of viable cells of Ralstonia solanacearum in soil using a semiselective medium and a PCR technique. Journal of Phytopathology, 146(8-9), 379–384. Kang, H. W., Kwon, S. W., & Go, S. J. (2003). PCR-based specific and sensitive detection of Pectobacterium carotovorum ssp. carotovorum by primers generated from a URP-PCR fingerprinting-derived polymorphic band. Plant Pathology, 52, 127–133. Kelman, A. (1954). The relationship of pathogenicity of Pseudomonas solanacearum to colony appearance in a tetrazolium medium. Phytopathology, 44(12). Kersters, K. (1985). Numerical methods in the classification of bacteria by protein electrophoresis. Computer assisted bacteria systematics, 337–368. Lehmann-Danzinger, H. (1987). “The distribution of Mokodisease in Central and South America and its control on plantains and bananas,” in Proceedings of the CTA Seminar: Improving citrus and Banana Production in the Caribbean through Phyto-Sanitation, StLucia, 130–152. Louws, F. J., Fulbright, D. W., Stephens, C. T., & De Bruijn, F. J. (1994). Specific genomic fingerprints of phytopathogenic Xanthomonas and Pseudomonas pathovars and strains generated with repetitive sequences and PCR. Applied. Environment of Microbiology, 60(7), 2286–2295. Maisuria, V. B., & Nerurkar, A. S. (2013). Characterization and differentiation of soft rot causing Pectobacterium carotovorum of Indian origin. European Journal of Plant Pathology, 136(1), 87–102. Miller, L., & Berger, T. (1985). Bacteria identification by gas chromatography of whole cell fatty acids. Hewlett-Packard Application Note, 228(41), 1–8. Miller, S. A., & Martin, R. R. (1988). Molecular diagnosis of plant disease. Annual Review of Phytopathology, 26(1), 409–432. Miller, S. A., & Joaquim, T. R. (1993). Diagnostic techniques for plant pathogens. Biotechnology in Plant Disease Control, 17, 321–339. Mwangi, M. (2007). Removing infected banana mats to contain Xanthomonas wilt: Experiences in Uganda, Rwanda and the Democratic Republic of Congo. A brief prepared for the Crop Crisis Control Project. IITA-C3P, Kampala, Uganda, 13p. Nakato, V., Mahuku, G., & Coutinho, T. (2018). Xanthomonas campestris pv. musacearum: a major constraint to banana, plantain and enset production in central and east Africa over the past decade. Molecular Plant Pathology, 19(3), 525–536. Opina, N., Tavner, F., Holloway, G., Wang, J. -F., Li, T. H., Maghirang, R., et al. (1997). A novel method for development of species and strain-specific DNA probes and PCR primers for identifying Burkholderia solanacearum (formerly Pseudomonas solanacearum). Asia-Pacific Journal of Molecular Biology, 5, 19–33. Pava, H. M., Franje, N. F., & Timario, T. J. (2003). Banana pilot demonstration studiesforbukidno n:tablesaltandearlydebuddingtocontrol‘Bugtok’disease of cooking banana cultivars ‘Saba’ and ‘Cardaba’philippines. Journal of Crop Science, 28, 31–43.

84

Recent Advancements in Microbial Diversity

Pocasangre, L., Ploetz, R., Molina, A., & Perez Vicente, L. (2009). Raising awareness of the threat of Fusarium wilt tropical race 4 in Latin America and the Caribbean. Paper presented at the V International Symposium on Banana: ISHS-ProMusa Symposium on Global Perspectives on Asian Challenges 897. Safni, I., Cleenwerck, I., De Vos, P., Fegan, M., Sly, L., & Kappler, U. (2014). Polyphasic taxonomic revision of the Ralstonia solanacearum species complex: proposal to emend the descriptions of Ralstonia solanacearum and Ralstonia syzygii and reclassify current R. syzygii strains as Ralstonia syzygii subsp. syzygii subsp. nov., R. solanacearum phylotype IV strains as Ralstonia syzygii subsp. indonesiensis subsp. nov., banana blood disease bacterium strains as Ralstonia syzygii subsp. celebesensis subsp. nov. and R. solanacearum phylotype I and III strains as Ralstonia pseudosolanacearum sp. nov. International Journal of Systematic and Evolutionary Microbiology, 64(9), 3087–3103. Schaad, N., Jones, J., & Chun, W. (2001). Laboratory guide for identification of plant pathogenic bacteria (third eds). Minnesota, USA: Phytopathological Society St. Paul. Schaad, N., Jones, J., & Lacy, G. (2001). Gran-Negative Bacteria. In Xanthomonas. E n: Laboratory Guide for identification of plant pathogenic bacteria (Third Edition). St. Paul, Minesota, USA: The American Phytopathological Society. Silva, S. d. O., Veras, S. d. M., Gasparotto, L., de Matos, A. P., Cordeiro, Z., & Boher, B. (2000). Evaluation of Musa spp. for resistance to moko disease (Ralstonia solanacearum, race 2). Embrapa Amazônia Ocidental-Artigo em periódico indexado (ALICE). Spring, A., Diro, M., A Brandt, S., Tabogie, E., Wolde-Michael, G., McCabe, J.T., et al. (1997). Tree against hunger: Enset-based agricultural systems in Ethiopia. Stevenson, W.R., Loria, R., Franc, G.D., & Weingartner, D.P. (2001). Compendium of potato diseases. Stover, R., & Espinoza, A. (1992). Blood disease of bananas in Sulawesi. Fruits (Paris), 47(5), 611–613. Taghavi, M., Hayward, C., Sly, L. I., & Fegan, M. (1996). Analysis of the phylogenetic relationships of strains of Burkholderia solanacearum, Pseudomonas syzygii, and the blood disease bacterium of banana based on 16S rRNA gene sequences. International Journal of Systematic and Evolutionary Microbiology, 46(1), 10–15. Thwaites, R., Eden-Green, S., & Black, R. (2000). Diseases caused by bacteria. In ‘Diseases of Banana, Abaca and Enset’. (Ed. DR Jones) 213-239. Wallingford: In: CABI Publishing. Tomlinson, D., King, G., & Ovia, A. (1987). Bacterial corm and rhizome rot of banana (Musa spp.) in Papua New Guinea caused by Erwinia chrysanthemi. International Journal of Pest Management, 33(3), 196–199. Tushemereirwe, W., Kangire, A., Smith, J., Ssekiwoko, F., Nakyanzi, M., Kataama, D., et al. (2003). Outbreak of bacterial wilt on banana in Uganda. Tushemereirwe, W., Kangire, A., Ssekiwoko, F., Offord, L., Crozier, J., Boa, E., et al. (2004). First report of Xanthomonas campestris pv. musacearum on banana in Uganda. Plant Pathology, 53(6), 802–1802. Tushemereiwe, W., Okaasai, O., Kubiriba, J., Nankinga, C., Muhangi, J., Odoi, N., et al. (2006). Status of banana bacterial wilt in Uganda. African Crop Science Journal, 14(2), 73–82. Uma, S., Siva, S. A., Saraswathi, M. S., Durai, P., Sharma, T. V. R. S., Singh, D. B., et al. (2005). Studies on the origin and diversification of Indian wild banana (Musa balbisiana) using arbitrarily amplified DNA markers. Journal of Horticultural Science & Biotechnology, 80, 575–580.

Bacterial diseases of banana Chapter | 4

85

Valentine, A., Parkinson, N., Thwaites, R., Heeney, J., Jones, D., Tushemereirwe, W., et al. (2006). Molecular characterization of Xanthomonas campestris pv. musacearum. Paper presented at the Proceedings of the fourth International Bacterial wilt symposium. Vásquez, C. (2008). Moko bacteriano del plátano (Ralstonia solanacearum EF Smith). Colima, Mexico: Comité Estatal de Sanidad Vegetal de Colima, Secretaría de Desarrollo Rural. Villa, J., Tsuchiya, K., Horita, M., Natural, M., Opina, N., & Hyakumachi, M. (2003). DNA analysis of Ralstonia solanacearum and related bacteria based on 282-bp PCR- amplified fragment. Plant Disease, 87(11), 1337–1343. Wenneker, M., Verdel, M., Groeneveld, R., Kempenaar, C., Van Beuningen, A., & Janse, J. (1999). Ralstonia (Pseudomonas) solanacearum race 3 (biovar 2) in surface water and natural weed hosts: First report on stinging nettle (Urtica dioica). European Journal of Plant Pathology, 105(3), 307–315. Were, E. (2016). Endophytic bacteria associated with banana and their potential forcontrollingbananaxanthomonaswilt. A thesis for the award of the degree of masters in molecular biology and biotechnology. Kampala: Makerere University. Yirgou, D., & Bradbury, J. (1968). Bacterial wilt of Enset (Enset ventricosa) incited by Xanthomonas pv mussearum. Phytopathology, 58, 11–112. Zhang, Y., & Geider, K. (1997). Differentiation of Erwinia amylovora strains by pulsed-field gel electrophoresis. Applied Environment of Microbiology, 63(11), 4421–4426.

Chapter 5

Toward an enhanced understanding of plant growth promoting microbes for sustainable agriculture Diksha Satia, Satish Chandra Pandeya, Veni Pandea, Shobha Upretia, Vinita Gouria, Tushar Joshib, Saurabh Gangolac, Prasenjit Debbarmad, Anupam Pandeye and Mukesh Samanta a

Cell and Molecular Biology Laboratory, Department of Zoology, Kumaun University, SSJ Campus, Almora, Uttarakhand, India; bDepartment of Botany, Kumaun University, SSJ Campus, Almora, Uttarakhand, India; cSchool of Agriculture,Graphic era Hill University, Bhimtal, Uttarakhand, India; dSchool of Agriculture, Graphic era Hill University, Dehradun, Uttarakhand, India; eICAR-Directorate of Coldwater Fisheries Research, Bhimtal, Uttarakhand, India

1 Introduction Maneuvering soil microbiota to increase crop productivity is a traditional practice, dated back to∼ 300 BC (Vessey, 2003). However, their use as key elements for the next green revolution is relatively new (Parnell et al., 2016). The growing demand for such cooperative microbes results due to the rapid growth of the world’s population and partly to the reduction of arable land. Beside the escalating world population, there has been no increase in agricultural land, which pose a serious threat to global food security. This situation will further intensify in 2050, when the world’s population is supposed to attain a figure of 10 billion. In addition to increasing population, some of the major dangers to reliable food sources are ongoing climate change and its associated extreme weather, shift in dietary habits and increased demand for biofuels (Pandey et al., 2019). All of the above mentioned problems require an environment-friendly and sustainable approach to enhance crop productivity. Soil microbiota can be a putative solution for this issue and are categorized into 4 classes, depending on their function (1) biofertilisers (increasing the nutrient bio-availability to plant), (2) phytostimulators (growth enhancers, usually work by modulating the phytohormones level). (3) biopesticides (controlling diseases, mainly through antibiotics synthesis, enzymes and induced systemic resistance) and (4) stress controllers Recent Advancements in Microbial Diversity. http://dx.doi.org/10.1016/B978-0-12-821265-3.00005-0 Copyright © 2020 Elsevier Inc. All rights reserved.

87

88

Recent Advancements in Microbial Diversity

(Antoun & Prévost, 2005). However, in soil ecosystem, a single plant growth promoting microorganism (PGPM) often use several mode of action to positively influence the plant growth (Vessey, 2003). This chapter briefly discusses PGPM’s, their various mechanisms for increasing plant productivity, and their applications in a practical scenario. Out of the total soil inhabitants, most microbes do not affect the plants. They are mere constituents of a multifaceted food web, utilizing large amount of carbon, which was originally fixed by plants and later released into rhizosphere as rhizodeposits. Rhizospheric microbial diversity also envisages some of the harmful members that exhibit deleterious effects on plants (Raaijmakers, Paulitz, Steinberg, Alabouvette, & Moënne-Loccoz, 2009) and, therefore, negatively affect the plant.

2  Microbial communities Soil inhabits a number of microbial genera which are crucial for its functions. The main residents of rhizosphere encompass bacteria, fungi, protozoans, nematodes, algae and microarthropods. Due to diverse interaction between microbes, plants and soil organisms, the rhizospheric region is also designated as “microbial hotspots”. Rhizosphere is defined as any region of soil in close vicinity of plant roots and/or hairs, and plant generated material. The rhizosphere contain higher microbial population than outside soil, as plant exudates in the rhizosphere release, amino acids and sugars, which are a rich source of nutrients and energy. Overall, the rhizosphere is a central place for microbial activities imparted chiefly by native bacteria and fungi (Nelson, 2004). Microbial activities aid in enhancement of plant growth such as solubilization of inorganic compounds, degradation and mineralization of organic compounds, and secretion of bioactive components e.g. plant hormones, antibiotics and ion chelators and hence make soil ecosystem more productive (Ahemad, Khan, Zaidi, & Wani, 2009; Pande et al., 2020; Pande et al., 2019). Taxonomically, PGPMs are categorized into: plant growth-promoting rhizobacteria (PGPR) and plant growth-promoting fungi (PGPF). However, some other groups like protozoa and algae, also harbor PGP activities (Oancea, Velea, Fãtu, Mincea, & Ilie, 2013) (Bonkowski, Griffiths, & Scrimgeour, 2000;Bhatt and Maheshwari, 2019)

2.1  Plant growth promoting rhizobacteria (PGPR) Kloepper in 1980 used the term PGPR for the first time to define a luminescent Pseudomonas strain showing growth promoting and biocontrol activity. Subsequently, this term was extended to all the rhizospheric bacteria having any direct growth promoting potential. Currently, PGPR includes all rhizospheric bacteria playing vital role in growth promotion through varied mechanisms. During the entire stage of plant development, they can colonize all available ecological niches of roots, without being affected by any competing microflora. PGPR show growth promotion directly either by enhancing nutrient acquirement for

Toward an enhanced understanding of plant growth Chapter | 5

89

e.g. fixation of atmospheric nitrogen (N), solubilization of inorganic phosphate, sequestration of iron (Fe), and production of plant hormones or indirectly by competing for ecological position, by synthesizing repressive allelochemicals, by stimulating systemic resistance (ISR) in host plants against a wide range of pathogens and/or abiotic stresses, by diminishing the negative impacts of various pathogens on plant growth as biocontrol agents (B. R. Glick, 2012). PGPR comprises of about 2 to 5% of total rhizospheric bacterial diversity. Besides, several variables influencing PGPR are environmental, edaphic factors, species, age and developmental phase of the plant. Depending upon their strength of association with plants root cells PGPRs are further divided as extracellular plant growth promoting rhizobacteria (ePGPR) and intracellular plant growth promoting rhizobacteria (iPGPR) (Martínez-Viveros, Jorquera, Crowley, Gajardo, & Mora, 2010). Extracellular PGPR (ePGPR) live outside the plant cells and generally do not form nodules. They augment plant growth by synthesizing key compounds that directly trigger plant growth, improve nutrient acquisition from soil, or develop disease resistance. ePGPRs are further categorized as: those living in close proximity to root but not in direct contact with the roots; those inhabiting and later colonizing the root surface; and those living inside the plants, specifically in the apoplastic regions of root cortex cells (Gray & Smith, 2005). The rhizobacterial genera included as ePGPR Agrobacterium, Azospirillum, Arthrobacter, Bacillus, Burkholderia, Caulobacter, Erwinia, Micrococcous, Flavobacterium, Pseudomonas and Serratia (Gray & Smith, 2005). The intracellular PGPRs (iPGPR) inhabit plant cells, are nodule-forming and get localized into this special structure. Soil bacteria in the genera rhizobium, Sinorhizobium, Bradyrhizobium Mesorhizobium, Azorhizobium, Allorhizobium and Frankia are some common e.g. of iPGPRs (Bhattacharyya & Jha, 2012). These root nodule forming N-fixing bacteria, are altogether termed as rhizobia and maintain obligate symbiotic relationship with leguminous plants. Generally, iPGPR are gram-negative and rod shaped, but a few forms are gram-positive, cocci and pleomorphic shapes. The evolution of symbiotic association of rhizobia with leguminous host plant is so complex that a particular Rhizobium will only modulate a selected number of plant genera. Rhizobial biofertilizers are reported to be used worldwide for many of the legume crops especially pulses. Mostly, ePGPR and iPGPR employ relatable, if not identical, mechanism to augment plant growth. However the main dissimilarity lies in the fact that endophytic PGPB, once entrenched inside the tissues of the host plant, become impervious to the fluctuating soil conditions. These variable conditions, which may hamper the functioning and proliferation of rhizospheric PGPB, includes variations in temperature, pH, water content, edaphic factors and the presence of some other soil bacteria that may compete for binding sites on root surface of host plants. (B. R. Glick, 2012; Bhatt and Maheshwari, 2020). Generally speaking, these PGPR bacteria amend plant-soil chemistry, which in turn head towards the plant growth and agriculture sustainability (Table 5.1).

90

Recent Advancements in Microbial Diversity

TABLE 5.1 Prominently involved plant growth promoting rhizobacteria along with respective host and their utilization. Bacterial species

Host plant

Utilization

References

Herbaspirillum seropedicae

Oryza sativa

Enhanced production of Gibberellins

(Araujo, Leite, Santos, & Carneiro, 2009)

Azotobacter chroococcum

Triticum aestivum

Phosphate Solubilization

(Bhattacharyya & Jha, 2012)

Azotobacter aceae

Fagopyrum esculentum

N2 fixation

(Bhattacharyya & Jha, 2012)

Azospirillum brasilence

Zea mays

IAA production

(Orlandini et al., 2014)

Rhizobium leguminosarum

Phaseolus vulgaris

Phosphate production

(Ahemad and Kibret (2014)., 26(1), 1–20., 2014)

Bacillus subtilis

Hordeum vulgare

Prevenion of powdery Mildews

(Prathap & Ranjitha Kumari, 2015)

Paenibacillus polymyxa

Sesamum indicum

Prevention of fungal Disease

(Ngumbi & Kloepper, 2016)

Pseudomonas

Cassia tora

Auxin production

(Kumar et al., 2016)

Pseudomonas, Bacillus

Cucurma longa

Auxin production

(Kumar et al., 2016)

Sphingomonas sp

Lycopersicon esculentum

Preventing Pseudomonas syringae pv. Tomato

(Frankowski et al., 2001)

Sinorhizobium meliloti strain CCNWSX0020

Medicago lupulina

Enhanced metal uptake and induction of plant’s anti-oxidant defence response

(Kong et al., 2015)

Azospirillum and Azotobacter

Zea mays

Improved growth and nutrient content of maize

(Biari et al., 2008)

2.2  Plant growth-promoting fungi PGPF are non-infectious organism feeding on dead and decaying organic matter and are accounted as fungal and bacterial disease suppressors in several crop plants (Koike, Hyakumachi, Kageyama, Tsuyumu, & Doke, 2001). Colonization of root by PGPF can result into broad-spectrum resistance in distal parts of the plant. The PGPF amalgamation with roots of various plant species and infection has proven to transform growth, morphology, nitrogen

Toward an enhanced understanding of plant growth Chapter | 5

91

incorporation, mineral assimilation and resource distribution of the host plant and also raise reproductive fitness of the host by improving plant growth, increase biomass and grain produce of crop plants (Deshmukh et al., 2006). The various common hosts of PGPF include the cereal crops rice, wheat, maize, barley as well as tobacco, bacopa, Artemisia, parsley, poplar and Arabidopsis (Peškan-Berghöfer et al., 2004). PGP attributes of rhizospheric fungi have been calculated by several researchers. Within PGPF, species of Phoma, Aspergillus, Penicillium, Trichoderma, Fusarium and arbuscular mycorrhizal fungus (AMF) have attained popularity due to their efficient performance in growth promotion and disease suppression (Table 5.2). The various direct means employed by PGPF to improve plant growth are phytohormone production, organic matter decomposition, solubilization of soil-bound nutrient elements and protection of plants from animate and inanimate stresses (Khan et al., 2012; Bhatt et al.,2020). Among indirect means of growth promotion comes habitat exclusion, antibiosis, predation, mycoparasitism, and Induced systemic response (Bent, 2006). Employing multiple mechanisms to promote growth is also common in PGPF.

2.2.1  Arbuscular mycorrhizal fungi (AMF) Since ancient times, the role of AMF in growth promotion and disease suppression in plants has been known. Almost 90% of land plants are symbiotically associated with AMF.AMF do not show specificity towards their host. Aggregation of AMF with roots of plants can result into massive underground networks. Mycorrhizae increasingly contribute to P-uptake through P-solubilization, seeing that exudates of fungal origin are responsible to solubilize P up to a higher extent than plant root exudates alone (Bhatt et al., 2019). AMF primarily work in functionally extending the root system. Owing to their lesser width, the fungal hyphae can easily access the places which are difficult to be penetrated by roots. Consequently, the area near root vicinity including associated AMF is termed as mycorrhizosphere. Recent studies also framed fungal Hyphae as potent vectors for efficient bacterial colonization of rhizosphere. Apart from gaining access to nutrients released by the fungi, bacteria also gain substantial defense and transit on fungal hyphae to locations which are unreachable by the bacterial cells alone. AMFs are also advantageous for soil structure because they cause aggregate formation. Strigolactones (SLs), much newly identified members of shoot-branching hormones, are concerned with early stages of the plant–AMF interaction. Strigolactones are discharged from root exudates of both monocot and dicot plants. Under phosphate deficiency, their synthesis is upregulated. On their release from root exudates SL’s causes branching of nearby AMF spores, thus, rising their probability to come across a plant root. AMF can increase plant colonization and enhance water and nutrient absorption, particularly of P, Zn, and Cu (Clark & Zeto, 2000). AMF also works in protecting plants from animate and inanimate stresses.

92

Recent Advancements in Microbial Diversity

TABLE 5.2 Impact of plant growth promoting fungus for sustainable agriculture. PGPF

Effect on plant

Reference

Penicillium simplicissimum GP17-2

Resistance to pseudomonas syringae pv. tomato DC3000 (Pst)

(Hossain, Sultana, Kubota, Koyama, & Hyakumachi, 2007)

Penicillium spp. GP15-1

Growth enhancement and increased systemic resistance against leaf infection by the anthracnose pathogen Colletotrichum orbiculare

(Hossain, Sultana, Miyazawa, & Hyakumachi, 2014)

Penicillium citrinumstrain BHUPC01 And Aspergillus niger strain BHUAS01

In vitro phosphate-solubilizing and IAA production

(Yadav, Verma, & Tiwari, 2011)

Penicillium sp. (UOMPGPF 27)

Seed quality enhancement of pearl millet and induce resistanc to downy mildew disease

(Murali, Amruthesh, Sudisha, Niranjana, & Shetty, 2012)

Penicillium oxalicum

Plant growth and induces resistance in pearl millet against Downy mildew disease

(Murali & KN, 2015)

Trichoderma virens and T. atroviride

Biomass production and stimulated lateral root development by the production of auxin-related compounds: indole-3-acetic acid, indole-3acetaldehyde, and indole-3ethanol

(Contreras-Cornejo, Macias-Rodriguez, Cortes-Penagos, & Lopez-Bucio, 2009)

Trichoderma koningi

Biosynthesis of the isoflavonoid phytoalexin vestitol, a major defensive response of leguminous plant

(Masunaka, Hyakumachi, & Takenaka, 2011)

Trichoderma sp. (UOM PGPF 37)

Induce resistance against downy mildew disease in pearl millet

(Murali et al., 2012)

Fusarium equiseti GF18-3

Biocontrol of Fusarium wilt of spinach caused by Fusarium oxysporum f. sp. spinaciae

(Horinouchi, Muslim, & Hyakumachi, 2010)

Cucumber growth and the biocontrol of the yellow strain of cucumber mosaic virus(CMV-Y)

(Elsharkawy, Shimizu, Takahashi, & Hyakumachi, 2012)

F. equiseti GF18-3 and GF19- 1

Root and rhizosphere colonization and biocontrol of anthracnose (C. orbiculare) and damping-off (Rhizoctonia solani AG-4) disease

(Saldajeno, 2011)

Cladosporium sp.MH-6

Gibberellin production and plant growth promotion

(Hamayun et al., 2010)

Toward an enhanced understanding of plant growth Chapter | 5

93

TABLE 5.2 Impact of plant growth promoting fungus for sustainable agriculture (Cont.) PGPF

Effect on plant

Reference

Aspergillus ustus

Phytohormone production and induced systemic resistance against the necrotrophic fungus Botrytis cinerea and the hemibiotrophic bacterium Pseudomonas syringae DC3000

(Salas-Marina et al., 2011)

Phoma glomerata LWL2 and Penicillium sp. LWL3

Growth promotion by gibberellins and IAA

(Waqas et al., 2012)

Phoma sp. GS8-1

Systemic resistance to bacterial leaf speck pathogen P. syringae pv. tomato DC3000 (Pst)

(Hossain, Sultana, Kubota, Koyama, & Hyakumachi, 2008)

Phoma sp. (GS6-2 and GS7-3)

Systemic resistance to bacterial leaf speck pathogen P. syringae pv. tomato DC3000 (Pst)

(Sultana, Hossain, Kubota, & Hyakumachi, 2008)

Phoma sp. GS8-3

Growth promotion in tobacco in vitro by th emission of volatile organic compounds (VOCs)

(Naznin, Kimura, Miyazawa, & Hyakumachi, 2013)

Penicillium menonorum

indole acetic acid (IAA), siderophore production, and P solubilization in Cucumber plants.

(Babu et al., 2015)

Colletotrichum tofieldiae

Increase Phosphate solubilization

(Hiruma et al., 2016)

Trichoderma harzianum Rifai 1295-22 (T-22)

In vitro properties of chelating metabolites, redox activity and solubilization of MnO2, metallic zinc, and rock phosphate (mostly calcium phosphate).

(Altomare et al., 1999)

P. indica

Improve commercial plant production.

(Varma, Verma, Sahay, Bütehorn, & Franken, 1999)

Piriformospora indica

IAA production in Arabidopsis thaliana

(Sirrenberg et al., 2007)

2.3  Plant growth promoting algae Apart from rhizobacteria and mycorrhizal fungi, members of algae and protozoa are also playing vital role in plant growth promotion. Microalgae are important part of xeric and semi-xeric ecosystem. Furthermore, their distribution and condition may indicate robustness of the environment. Additionally, their role in renovating the soil, increasing its productivity, managing agricultural contagion, management of agricultural waste water and development of microbiological crust. (Samant, Pandey, & Pandey, 2018). Microalgae are helping

94

Recent Advancements in Microbial Diversity

in agriculture by performing various functions such as, carbon content, texture, aeration (Ibraheem, 2007), nitrogen fixation (Hamed, 2007), bio-fertilizers and soil conditioning. Green algae such as Chlorella sp., Acutodesmus sp., Scenedesmus sp., Dunaliella sp., Nannochloris sp. etc. are facilitating sustainable agriculture. Phytohormones viz. auxins, gibberellins, cytokinins, ethylene, abscisic acid (ABA), polyamines, brassinosteroids, jasmonides, salicylates, and signal peptides, are also present in a variety of algae (Tarakhovskaya, Maslov, & Shishova, 2007). Auxins and cytokinins are the most abundant phytohormones in Chlorella sp. former endorse plant growth while the latter stimulate cell division and increase the dry weight. Several studies suggested that biomass of Acutodesmus dimorphus a green alga augmented production of flowers, growth and seed germination in plants (Garcia-Gonzalez & Sommerfeld, 2016). El Arroussi (Arroussi et al., 2018) reported that Dunaliella salins produce exopolysaccharides which induces a surge in the antioxidant enzymatic activity, phenolic compounds, and some major metabolites viz. 2,4-ditert-butylphenol, tocopherol, neophytadiene and stigmasterol, which alleviate the effect of different salinity levels in tomato. Chlorella ellipsoida aqueous extract when applied on wheat (Abd El-Baky, El-Baz, & El Baroty, 2010) and Nannochloris on toato (Oancea et al., 2013) also alleviated the impact of salt stress. The use of algae as bio-fertilizers has been boosted in recent years. Marine algae, brown and red algae and some other algae such as Chlorella vulgaris, Chlorella pyrenoidosa, Phaeodactylum tricornutum and Acutodesmus dimorphus etc. are widely used as an organic fertilizers in agriculture and direct help in sustainable agriculture by promoting plant growth and health.

2.4  Plant growth promoting protozoa Due to interaction between protozoa and bacteria in plant rhizospheric soil there is an increase in plant growth which is well documented (Bonkowski et al., 2000). In 1995 Jentschke (Jentschke, Bonkowski, Godbold, & Scheu, 1995), observed enhanced branching pattern and fineness of the roots in spruce seedlings due to the influence of protozoans. Further effects of certain hormones were found liable for the remarkable alterations in spruce development. Incidence of amoebal culture fluid augmented the biomass of pea seedlings. On the other hand, protozoa plundering on bacteria are assumed to discharge onethird- of the nitrogen consumed from the bacterial which then becomes available for plant growth (Griffiths, 1994). Thus, protozoans have also been reported to increase plant growth.

3  Mechanistic approach of various PGPMs 3.1  Siderophore production Siderophores are low-molecular-weight iron chelating agents (200-2000 Daltons) synthesized by bacteria, plants and fungi (Goswami, Thakker, &

Toward an enhanced understanding of plant growth Chapter | 5

95

FIGURE 5.1  Diagrammatic representation of iron-siderophore complex and its transport inside the plant cell.

Dhandhukia, 2016). Iron is essential for various metabolic processes, such as photosynthesis, respiration, and chlorophyll biosynthesis, and is also important component in heme, the Fe–sulfur cluster, and other Fe-binding sites. Iron is present in complex insoluble, Fe3+ (ferric) forms while, plant uptake Fe in Fe2+(ferrous) form. To overcome low availability, foliar and root delivery of Fe in inorganic form (FeSO4) or as Fe chelates is employed worldwide, but their haphazardous use causes an undesirable effect on plant growth. To prevail over this problem, PGPM use siderophore as Fe solubilizing instrument and chelating it from available complex organic or inorganic iron (Singh, Pandey, Kumar, & Singh, 2017) (Fig. 5.1). On the basis of chemical entities concerned with iron chelation, siderophores are of following three types: phenol/catechol, hydroxamate and hydroxycarboxylique acid. The molecular mechanism behind Siderophore production is mentioned below and is especially well illustrated for gram negative bacteria.

3.1.1  Siderophore production in gram-negative bacteria There are 3 transport proteins involved in transport of iron-siderophore complex to the cell. Specific outer membrane receptors, periplasmic binding proteins (PBPs) and ABC transporters are employed to cross outer membrane, periplasmic space and inner membrane respectively (Fig. 5.2). The outer membrane receptors are of β-barrel type comprised of 22 β sheets. This β-barrel, with its large extracellular loop mediates initial interaction and binding with Fe-siderophore complex. N-terminus of the β-barrel occupies the central space within the barrel and acts as a cork. When substrate binds to it, an α-helix present in cork domain (called the switch helix or TonB box) unwinds and binds to C terminus

96

Recent Advancements in Microbial Diversity

FIGURE 5.2  Diagrammatic representation of various mechanisms involved in phosphate solubilization by PSMs.

of another periplasm-spanning protein, TonB. The conformational change (occurring in the switch helix due to substrate binding) is thought to signal TonB, which consequently provides energy to transport the iron– siderophore complex along the outer membrane. The TonB complex is an energy transducer, transferring metabolic energy from cytoplasmic to the exoplasmic membrane. The TonB complex is made of 3 subunits: TonB, ExbB and ExbD. Till date, about 65 bacterial genera are reported of having TonB genes. In a recent study, it has been shown that Ton B system is also involved in exoplasmic transfer of lignin-derived biphenyl compound in sphingobium sp. strain SKY-6 (Fujita et al., 2019). PBPs bind with the Fe-siderophore complex and guides it to the correct ABC transporter. There are various types of PBPs having a large scale of diversity among their amino acid sequences. However, they have related tertiary structures due to a characteristic similar fold in most of PBP proteins. PBP direct the substrate to cytoplasmic membrane. ABC transporter helps the Fesiderophore complex in crossing inner membrane. Many ABC transporters have four structural domains: two channel forming trans-membrane domains and two ATP binding Domains (Raines, Sanderson, Wilde, & Duhme-Klair, 2015).

3.1.2  Siderophore production in gram-positive bacteria There is very less information on iron (III) uptake in Gram-positive bacteria, with the greater part of studies targeting on Bacillus subtilis. The extraction system Gram-positive bacteria show immense similarity to the inner membrane transport system found in Gram-negative bacteria, as there is no outer

Toward an enhanced understanding of plant growth Chapter | 5

97

membrane present in them. Here lipoprotein analogous to PBPs, interact with an ABC transporter to achieve iron uptake. To sequester Fe from the Fe-siderophore complex, degradation of Siderophore by esterase enzyme or reduction of coordinated iron (III) to iron is (II) done (Cohen, Bottini, & Piccoli, 2008).

3.2  Phosphate solubilization After Nitrogen, Phosphorus is the next vital nutrient for growth and nutrition of plants. It is involved on almost all major metabolic processes, including energy transmission as energy currency of the cell, signal transduction as phosphatases and kinases, respiration, macromolecular biosynthesis for e.g. DNA and RNA, and photosynthesis (Anand, Kumari, & Mallick, 2016). Out of total phosphorous present naturally, about 95-99% is present in the impenetrable forms, viz. rock phosphate, hydroxyapatite, mineral salts, di-calcium phosphate, tricalcium, or organic compounds. Plants absorb phosphate only as monobasic (H2PO4−) and dibasic (HPO42−) ions. Insufficient bio-availability of inorganic phosphate (orthophosphate) in soil critically limits the crop productivity (Wang, Lv, Jiang, & Li, 2017). In this aspect, PGPR and mychorriza, can be a useful solution as they have potential of liberating organic phosphates, solubilizing insoluble inorganic phosphate and mineralizing phosphorus and make it available to plants. (Otieno et al., 2015). Several Phosphate solubilising bacteria (PSB) and Arbuscular Mycorrhizal Fungi (AMF) are well known for their role in exchanging insoluble forms of P to accessible forms. Several PSB genera e.g.Pseudomonas, Bacillus, Arthrobacter, Rhodococcus, Serratia, Gordonia, Phyllobacterium, Flavobacterium, Microbacterium, Delftia, Burkholderia, Beijerinckia, Azotobacter, Xanthomonas, Chryseobacterium, Enterobacter, Pantoea, Klebsiella, Xanthobacter, Erwinia,Rhizobium and Mesorhizobiumare marketed as inoculant in various countries (Mishra & Arora, 2012). Aspergillus and Penicillium are the 2 notable genera of PGPF which are leading as good P solubilizers whereas, some strains of Trichoderma and Rhizoctonia have also been reported as P solubilizers. PGPMs adopt a variety of strategies to help plants in supplying phosphorous, which are enlisted below and diagrammatically represented in Fig. 5.2.

3.2.1  Inorganic phosphate solubilization by PSM Several hypotheses were put forward to elucidate the method of inorganic phosphate solubilization. Out of these, production of mineral dissoluting compounds e.g. organic acids, siderophores, protons, hydroxyl ions and CO2, is of primary importance (Sharma, Sayyed, Trivedi, & Gobi, 2013). Organic acid when released from the periplasmic space, chelates cations such as Ca2+ by substituting H+ (Zhao et al., 2014). Release of these H+ is associated with cation absorbtion. For e.g., incorporation of NH4+ together with H+ secretion results into P solubilization. One of the most common mineral phosphate solubilizating organic acid, gluconic acid works by chelating cations attached to phosphate,

98

Recent Advancements in Microbial Diversity

therefore easing phosphate availability. Gram-negative bacteria dissolve mineral phosphate by directly oxidising glucose into gluconic acid. This reaction is catalysed by glucose dehydrogenases (GDH) containing a redox cofactor, Pyrroloquinoline quinine (PQQ) (Rodríguez et al., 2000). These studies were further supported by the presence of pyrroloquinoline quinone (PQQ) biosynthetic genes in several PGP strains having P-solubilization potential (Choi et al., 2008). Microbes solubilize mineral phosphates by producing various inorganic acids (for e.g. sulphuric, nitric, and carbonic acids) as well but they are less effective than organic ones. Additionally in mycorrhizal fungi, mycelia work as extension of plant roots, increasing the volume of soil from which phosphate may be absorbed. In a lecithin including medium, PSM release enzymes acting on lecithin and transform it to choline (Zhu, Qu, Hong, & Sun, 2011). Thus, enzymolysis is yet another means of phosphate dissolution by microbes.

3.2.2  Organic phosphorus mineralization Soil Organic Matter (SOM), is the primary source of natural phosphorous in soil with 30%–40% abundance. Organic P is present in various forms in soil like inositol phosphate (soil phytate), mono-phosphoesters, di-phosphoesters, phospholipids, DNA, RNA, tri-phosphoesters and some unnatural phosphonates (antibiotics, pesticides, detergent supplements, etc). Most often they are high molecular-weight compounds, immune to chemical degradation and should be biologically transformed to either soluble ionic phosphate (Pi, HPO4 2− , H2PO4−), or low molecular-weight organic phosphate, which can directly be absorbed by the cell (Peix, Mateos, Rodriguez-Barrueco, Martinez-Molina, & Velazquez, 2001). The solvation of organic phosphorous and destruction of residual molecule is called as Phosphorus mineralization. Halvorson in (1990) (Halvorson, Keynan, & Kornberg, 1990) reported that due to the action of PSM, there is continuous removal of organic P that ultimately disintegrates Ca-P compounds. Hence, the breakdown of P in organic substrates can be estimated by the P content present in the biomass of PSM. This biological process is important in phosphorus cycling. Microbes release several enzymes to mineralize organic P among which, non-specific acid phosphatases (NSAPs) are the most studied (Nannipieri, Giagnoni, Landi, & Renella, 2011). Phosphomonoesterase/ phosphatases being the most common type of NSAPs. They may be acid or alkaline depending on the pH of surrounding medium. Phytase, is a yet another important enzyme releasing P from plant seeds and pollens. PSM acquire P directly from phytate and transfer it to plants. 3.3  Phyto-hormone production These are plant growth regulating organic substances, which can sponsor, restrain, or alter plant growth and development, even at vanishingly low concentrations (1 mM). PGPMs produce includes indole acetic acid, cytokinins, gibberellins and inhibitors of ethylene production.

Toward an enhanced understanding of plant growth Chapter | 5

99

3.3.1 Auxin Plant hormone production (majorly auxin, cytokinin and gibberellin) is a prominent means of growth enhancement by ePGPR; with auxin being most important. Tryptophan is the starting molecule for auxin production in bacteria and is generally present in root exudates. The IAA permits bacteria to detoxify additional tryptophan and its counterparts which are injurious to the bacteria. Phytobacteria are well-known for auxin biosynthesis (Ludwig-Müller, 2015). A total of 5 different auxin biosynthetic pathways have been elucidated till date. Among these IAA biosynthetic pathways, which begin through indole-3-acetamide (IAM) and indole-3-pyruvate (IPyA) are the most prevalent and best characterized. The IAM pathway is common in three Kingdoms of life and is a two-step process, where, tryptophan is first converted into IAM, by the action of enzyme tryptophan-2-monooxygenase (encoded by iaaM), and finally to IAA by another enzyme IAM hydrolase (coded by iaaH) (Lehmann, Hoffmann, Hentrich, & Pollmann, 2010). In bacteria the IPyA biosynthetic pathway involves a three step process where indole-3-acetaldehyde is transformed to indole-3-pyruvate with the help of enzyme indole-3-pyruvate decarboxylase (encoded by ipdC). Later Indole-3-acetaldehyde is converted into IAA. There can be existence of more than one pathway for auxin biosynthesis in any given phytobacterial species, probably suggesting, the multi-dimensional benefits of auxin production viz. cell extension, cell multiplication, rooting, growth enhancement, trophic movement towards light, geotropisms, apical dominance (Patten, Blakney, & Coulson, 2013). 3.3.2 Cytokinin Another important group of phytohormone is cytokinins, the N6-substituted aminopurines. Their major function is inducing multiplication of cells together with auxin. Its roles include cell division, seed germination, root elongation, chlorophyll accumulation, leaf expansion and delaying senescence. Agrobacterium, Arthrobacter, Burkholderia, Bacillus, Erwinia, Pantoeaagglomerans, Pseudomonas, Rhodospirillum rubrum, Serratia, and Xanthomonas are some e.g. of cytokinin producing bacteria (García de Salamone, Hynes, & Nelson, 2001). The synthesis of cytokinins in higher plants become clear after the discovery of genes coding isopentenyl transferases (IPTs) in Arabidopsis. These IPTs catalyse the addition of ATP/ADP, with di-methyl,allyl-pyrophosphate (DMAPP), and forms isopentenyladenine monophosphate (iPMP), which ultimately gives rise to zeatin and other naturally occurring adenine cytokinins. The various types of cytokinins produced by rhizobacteria are isopentenyladenine, trans-zeatin, cis-zeatin, and their ribosides and are similar to that formed by the plant (García de Salamone et al., 2001). 3.3.3  Abscisic acid Abscisic acids (ABAs) are primary hormones involved in syncing plant’s response to varied environmental stresses and also affects plant defense against

100

Recent Advancements in Microbial Diversity

multiple pathogens. ABA is a 15-carbon compound, is involved in plant responses to biotic and abiotic stresses. It inhibits seed germination and flowering, closes stomata, induce callose deposition in cell wall. It is involved in protection against drought, salt stress, and toxic metals. Very few bacterial genera have been reported to show ABA production. A few ABAs producers include Azospirillium brasilense (Cohen et al., 2008) and Bradyrhizobium japonicum (Boiero et al., 2007). Since ABA and cytokinins are antagonistic in nature, it was hypothesized that ABA increases plant growth by interfering with the cytokinin pool. It could also ameliorate plant stress by augmenting the root/shoot ratio.

3.3.4  Gibberlic acid Chemically these hormones are terpenoids with 20 carbon atoms, but contain only 19 carbon atoms in biologically active form. A major function of GAs is internodal elongation by activating cell division and cell elongation within the sub-apical meristem. Beside this seed germination, pollen tube growth, and flowering in rosette plants are some other roles of GAs. GAs mainly works synergistically with other hormones. Acinetobacter, Agrobacterium, Arthrobacter, A. brasilense, Azospirillumlipoferum, Azotobacter, Bacillus, Bradyrhizobium japonicum, Clostridium, Flavobacterium, Micrococcus, Pseudomonas, Rhizobium, and Xanthomonas, are some commonly reported GAs producing genera (Tsavkelova, Klimova, Cherdyntseva, & Netrusov, 2006). Apart from GA production, microbes may also enhance GA status in plants either by releasing GAs commonly conjugated with root exudates, or chemically, by hydroxylating inactive GA to active forms (Bottini, C, & Piccoli, 2004). 3.3.5 Ethylene Ethylene (ET) is a gaseous hormone greatly acknowledged for its ability to prepare the plant in combating various biogenic and abiogenic stresses e.g. pathogenic infection, drought etc. It is therefore called as the stress hormone as well. In response to pathogen attack, heat and cold stress, water-logging, drought, excess heavy metals, high soil salinity, and soil compaction, ET expression is increased in plants (Dodd, Zinovkina, Safronova, & Belimov, 2010). Inside the plant system, S-adenosyl methionine (SAM) is changed to ACC and 5-deoxy-5 methylthioadenosine (MTA) by ACC synthase which finally leads to ethylene synthesis (Giovanelli, Mudd, & Datko, 1980). Microbes which possess 1-aminocyclopropane-1-carboxylate (ACC) deaminase activity are central in facilitating plant growth and mitigating various harmful effects of abiotic and biotic stress in plants. The genes responsible for ACC deaminase activity are now known and are called as ACC deaminase structural genes (acdS). ACC deaminase enzyme cleaves the plant ethylene precursor, ACC, into ammonia and alpha -ketobutyrate. By decreasing ACC levels in plants, ACC deaminase- producers keep a check on plant ethylene levels (B. R. Glick,

Toward an enhanced understanding of plant growth Chapter | 5

101

Biljana Todorovic, Jennifer Czarny, Zhenyu Cheng, Jin Duan, and Brendan McConkey., 2007), which when present in high concentrations can lead to complete stoppage of plant growth or even death. Various rhizobacteria, e.g. Achromobacter, Variovorax, and Psuedomonas and some fungus e.g. Trichoderma possess ACC deaminase activity. Co-inoculating ACC deaminase positive microbes with plants can help plants in bypassing various biotic and abiotic stress caused by floods, salinity, drought, water-logging, pathogens and contamination of heavy metals and toxic organic compounds (Berg & Smalla, 2009).

3.4  Biological nitrogen fixation (BNF) The conversion of atmospheric nitrogen into ammonium (NH4+) and nitrate (NO3−) by symbiotic, associative, and free-living bacteria is termed as Biological nitrogen fixation (BNF) or diazotrophy. Enzyme responsible for this conversion is nitrogenase complex which mostly contains molybdenum–iron (Mo–Fe) cofactor, though Vanadium cofactor is also found in some bacterial strains. Mainly, Nif and Nod are 2 gene clusters, involved in nitrogen fixation. Out of total biologically fixed nitrogen, 83% is obtained from symbiotic associations, while rest 17% is provided by free living or associative systems. Symbiotic PGPRs include Rhizobium, Bradyrhizobium, Sinorhizobium, and Mesorhizobium, generally found associated with leguminaceae family, Frankia is among few members showing association with non-legume trees and shrubs (Zahran, 2001). Some free- living diazotrophs carry out the processs of non-symbiotic nitrogen fixation viz. Azoarcus, Azotobacter, Acetobacter, Azospirillum, Burkholderia, Diazotrophicus, Enterobacter, Gluconacetobacter, Pseudomonas and cyanobacteria (Anabaena, Nostoc) (Bhattacharyya & Jha, 2012). The symbiotic nitrogen fixers are well employed as biofertilizers to boost plant productivity in agricultural systems.

3.5  Ammonia and hydrogen cyanide production Hydrogen cyanide (HCN) and ammonia (NH3) production are believed as crucial growth promotion activities. HCN due to its considerable toxicity against plant pathogens is a potent biocontrol agent. Also HCN has a role in chelation of metals ions and indirectly concerned with phosphate availability (Rijavec & Lapanje, 2016). Generally bacteria having ACC deaminase activity are also thought as HCN producers. HCN production by PGPR is not restrictive to any genus, and by making use of these potent biofertilizers, productivity can be improved. Apart from HCN, by virtue of ammonia production, PGPMs provides nitrogen, encourage root and shoot elongation and increase their biomass (Agbodjato et al., 2015). A few PGPB strains are capable of synthesizing both HCN and ammonia and bring a positive change on growth rate and also modulate various plant metabolites

102

Recent Advancements in Microbial Diversity

3.6  Antibiotics and lytic enzymes Some PGPMs capable of antibiotics production are used to nullify the dangerous effects of phytopathogens. Various compounds like amphisin, 2,4-diacetylphloroglucinol (DAPG), phenazine, tropolone, pyrrolnitrin, hydrogen cyanide, pyoluteorin, oomycin A, tensin, and cyclic lipopeptides synthesized by Pseudomonads, and kanosamine, oligomycin A, xanthobaccin and zwittermicin produced by Streptomyces, Bacillus, and Stenotrophomonas spp. are recognized as antibiotics that have antibacterial, antifungal, antiviral, antihelminthic, antimicrobial and antitumor properties. Various PGPMs producing hydrolyzing enzymes such as cellulases, chitinases, proteases etc digest cellulose, chitin, and proteins, and hence inhibit phytopathogen activity (Gangola et al., 2019). Chitinase from Serratia plymuthica C48, Serratia marcescens, Paenibacillus sp., Streptomyces sp. and Pseudomonas stutzeri is shown to dissolve mycelia of various fungal phytopathogens. The β-1,3-glucanase employed to break fungal cell wall is obtained from Streptomyces, Paenibacillus, and Bacillus sp. In the same way, protease and lipase formed by PGPB could destroy proteins and lipids related to cell wall (Frankowski et al., 2001).

3.7 Competition Soil ecosystem is a multi-dimensional, complex niche. Various biogenic and abiogenic factors come into play in soil biology. Due to complex diversity of soil, it is difficult to display competition directly, but there are some indirect evidence indicating that competition between pathogens and beneficial microbes (PGPB) can lessen the incidence of disease and severity. It is believed that abundant non-pathogenic soil microbes quickly occupy inhabitable plant surfaces and utilize major accessible nutrients, limiting the growth of pathogens. For example, scientists have experimentally shown that treating plants with leaf bacterium Sphingomonas sp. barred the bacterial pathogen Pseudomonas syringae pv. tomato from causing disease (Innerebner, Knief, & Vorholt, 2011).

4  Applications of PGPMs 4.1  As biofertilizers: for sustainable agriculture PGPRs help by providing nutrients to the plants from the soil in an absorbable form thus, making them a sustainable option in agriculture. The role of N2 fixing root nodule forming rhizobacteria in plants is commercially exploited as biofertilizers to enhance the growth of plants significantly. The process includes bacterial conversion of un-utilizable nitrogen forms i.e. inert nitrogen into the absorbable form such as ammonium and nitrate, and here plant which act as a carbon source. The bacteria exploit the carbon produced from the particular host plant while the plants use the utilizable nitrogen produced by the bacteria. Use of PGPM’s as biofertilizers instead of synthetic fertilizers (N, P and K)

Toward an enhanced understanding of plant growth Chapter | 5

103

can be extremely obliging and sustainable for agricultural ecosystem (Maheshwari et al., 2012; Pandey et al., 2019). Still, more research and development is needed to invent in-vitro agonistic microbial consortium under different stress conditions to enhance the soil productivity and effectiveness of biofertilization system.

4.2  As soil fertility enhancers Productive soil is chemically, biologically and physically sound thus providing favorable environment for the plants to shown optimum growth. The factors which usually degrade the quality of soil are extensive use of synthetic fertilizers, ploughing, sowing, raising crops to a great extent and disturbing the biological and chemical aspects of soil (Liang, Lin, Yamada, Inoue, & Inosako, 2013), Soil has some significant characteristics which make it suitable for the plants to grow viz., porosity, Soil Organic Matter (SOM), crumb organization and biological activity. When soil is put under high pressure of various cultivation processes it recedes the actual level of SOM which results in the loss of all important characteristics of the soil (Wander, 2004). SOM contributes towards soil fertility and to maintain this PGPMs has been playing a great role (Trabelsi & Mhamdi, 2013). For enduring re-establishment and maintenance of soil SOM plays a key role. Ammonia (NH4+) can be supplemented to the soil with the help of Dissolved organic compound (DOM), which modulates the microbes based conversion of nitrogen and thus aids in harmonizing the ratio of nitrogen to carbon in soil. It has also been investigated that when PGPM are inoculated with soil possessing meager amount of SOM produces enhanced output (Cakmakçi, Dönmez, Aydın, & Şahin, 2006). One of the major factors which regulate the productivity of soil is its property to aggregate and thus retain water. This property is thought to be enhanced by a few PGPR by producing exopolysaccharides (EPS). PGPR which produce EPS are thought aid in enhancing the production of crops undergoing salt and drought stress. Application to enhance soil fertility for agricultural purpose includes physical and chemical factors of the soil, while neglecting the biological component. Ignorance of such an important factor is due to the lack of indulgence into how these factors are interrelated.

4.3  As phytoextractors and bioremediators Some plant species can grow even in contaminated soils by employing bacteria that act as endophytes. These bacterial endophytes along with having PGP traits can also resist high concentration of pollutants. In a recent study, endophytic bacteria Bacillus pumilus strain E2S2 isolated from a plant Sedum plumbizincicola (hyperaccumulator of Zn or Cd), was observed to improve its phytoextraction capacity and simultaneously promoted plant growth. Further a plant Medicago lupulina a plant when under copper stress was evaluated for the effect of Sinorhizobium meliloti (CCNWSX0020 strain) a rhizobium endosymbiont

104

Recent Advancements in Microbial Diversity

which enhanced plant growth, metal uptake and induced plant’s anti-oxidant defense response (Kong et al., 2015). By detoxifying pollutants like heavy metals and pesticides, PGPR can also clean environment, and aid in phytoremediation (Pandey et al., 2018; Pandey et al., 2019).

4.4  As biofortifying agents: improving food quality FAO in 2015 has provided an estimate that approximately one in nine people around the world are suffering from ordeals by hunger (FAO, 2015). Over three billion people around the world are undernourished with respect to vitamins and other nutrients. Malnourishment has been an area of major concern worldwide. Cu, I, Zn, Se, Ca, Mg, and Fe are the elements which have been generally found to be deficient in daily regimen (Stein, 2014). Nutrition and productivity of a crop are the two interrelated terms for mineral nutrition. Mostly producers consider only the high yield varieties of crops neglecting the nutritional content in them. More investigation is needed in this area to enhance the nutritional content of the chief dietary sources. HarvestPlus and BioCassava Plus (BC Plus) are among few biofortification programs to increase alimental rate of crops. Presently, biofortification can be employed at the gene level or at the agronomic level or by employing good soil management practices to battle nutrient scarcity by increasing micronutrient contents in staple food crops such as rice, wheat, maize, pearl millet, and others. However, the approach of using PGPM to supplement minerals and vitamins in chief food crops has gained attention of agriculturists over the past decade. The use of PGPM may largely reduce the continual costs concerned with various fortification schemes (Pandey et al., 2019). Rana et al. in 2012 (Rana, Saharan, Nain, Prasanna, & Shivay, 2012) showed that by applying PGPR consortium, about 28–60% micronutrient content can be escalated in wheat. In a related experiment, co- inoculation of cyanobacterium (Anabaena oscillarioides CR3) and PGPR (Brevundimonas diminuta PR7; Ochrobactrum anthropi PR10) drastically enhanced N, K, and P level and micronutrient content. (Biari, Gholami, & Rahmani, 2008) demonstrated the positive effect of Azotobacter and Azospirillum on the development and alimental content of maize (Zea mays) in- vivo. (Khalid, Asghar, Akhtar, Aslam, & Zahir, 2015) described the augmented Fe content in chickpea by using PGPR. PGPR has also been prospected in biofortification of rice and wheat. In recent future, PGPM can be ideally popularized as biofortification agents in an ecofriendly and economical manner.

4.5  As stress managers Any aspect which impedes the well-being of plants in terms of growth and development is said to be stress. Growth and development of plants is influenced by the soil’s environment and various stresses generated by it. These can be of two types, biotic and abiotic. Pathogens such as, bacteria, nematodes, fungi, protists,

Toward an enhanced understanding of plant growth Chapter | 5

105

insects, viroids, and viruses which are included in biotic stress affect the yield of the crops. Whereas Abiotic stress like drought, temperature and salinity are the main factors resulting in the loss of crops, all over the world by 30%, these stresses give rise to aridity, stress, which is a leading cause of impeding plant development and productivity (Vejan, Abdullah, Khadiran, Ismail, & Nasrulhaq Boyce, 2016). To overcome problem caused by various categories of stresses PGPR strains like RMPB44 of B. subtilis, B2, B3, B4 strains of Paenibacillus polymyxa, HYDGRFB19 strain of B. thuringiensis, HYD- B17strain of Bacillus amyloliquefaciens, BKB30 strain of P. favisporus, and HYTAPB18 strain of B. licheniformis, has been playing an important role. It has been studied that plants undergoing any form of biotic stress with roots or seeds placed and inoculated in cultures of PGPR develop resistance towards it (Ngumbi & Kloepper, 2016).

4.6  As phytostimulators The various plant hormones produced by PGPR with their common functions and mechanisms have been discussed earlier in this chapter. Concludingly, it can be said that phytostimulators provided by PGPMs helps in overall improving overall growth, robustness and productivity of plant systems, mitigating the haphazardous exploitation of chemical fertilizers and reducing the carbon footprint globally.

4.7  As disease control agent PGPM’s play a vital role in controlling diseases in plants. Various examples of commercialized PGPM’s given by (Velivelli, De Vos, Kromann, Declerck, & Prestwich, 2014)are B. subtilis QST 713 targets pathogen (Venturia inaequalis Orchards, stone fruits) of Orchards, apple, pear, B. firmus I-1582 targets nematode in cucumber and carrots. Rhizobacteria release some compounds like antibiotics which are hostile to the plant pathogen to protect themselves acquire resistance against antibiotic thus increasing their life span. Therefore multiple schemes to manage pathogens should be applied rather than a single method (Velivelli et al., 2014).

5 Conclusion Considering the advantageous roles of PGPR (in terms of biofertilization, biopesticide, phytostimulators and bioremediation) we should encourage their implementation in the global agriculture for reducing the global carbon footprint and increasing the green cover of earth. With better research and in-field trials, PGPR use can become an actual practice and can play a decisive role in enhancing agro-ecosystem yield, without compromising agricultural sustainability, thus paving a way towards a model agricultural system which is sustainable, eco-friendly and produces micro-nutrients enriched food and hence, improves

106

Recent Advancements in Microbial Diversity

human health. While the use of PGPMs, as biofertilizers, and biopesticides is on the rise. Extensive research and development is also needed to fill the knowledge gaps preventing their large-scale exploitation. By developing region-wise microbial community maps and next generation simulation models, new PGPM strains can be accessed. Keeping in mind the various beneficial tasks of PGPMs, it is clear that employing these PGPM is a striking as well as cost-effective measure for agricultural sustainability. Familiarizing farmers about the potential benefits of using PGPMs and their large-scale commercialization should be encouraged. Concludingly, it can be said that, till now we have gained much by applying microbial biotechnology in agriculture but many challenges as well as opportunities are still to be investigate paving a way towards future sustainable agricultural developments.

References Abd El-Baky, H. H., El-Baz, F. K., & El Baroty, G. S. (2010). Enhancing antioxidant availability in wheat grains from plants grown under seawater stress in response to microalgae extract treatments. Journal of the Science of Food and Agriculture, 90(2), 299–303. Agbodjato, N. A., Noumavo, P. A., Baba-Moussa, F., Salami, H. A., Sina, H., Sèzan, A., et al. (2015). Characterization of potential plant growth promoting rhizobacteria isolated from Maize (Zea mays L.) in central and Northern Benin (West Africa). Applied and Environmental Soil Science. Ahemad, M., & Kibret, M. (2014). Mechanisms and applications of plant growth promoting rhizobacteria: current perspective. Journal of King saud University-science, 26(1), 1–20 26(1), 1–20. (2014). Ahemad, M., Khan, M. S., Zaidi, A., & Wani, P. A. (2009). Remediation of herbicides contaminated soil using microbes. Microbes in Sustainable Agriculture, 261–284. Altomare, A., Burla, M. C., Camalli, M., Cascarano, G. L., Giacovazzo, C., Guagliardi, A., et al. (1999). SIR97: a new tool for crystal structure determination and refinement. Journal of Applied Crystallography, 32(1), 115–119. Anand, K. U. M. A. R., Kumari, B. A. B. Y., & Mallick, M. A. (2016). Phosphate solubilizing microbes: an effective and alternative approach as biofertilizers. J Pharm Pharm Sci, 8, 37–40. Antoun, H., & Prévost, D. (2005). Ecology of plant growth promoting rhizobacteria. In PGPR: Biocontrol and biofertilization (pp. 1–38). Dordrecht: Springer. Araujo, A. S. F., Leite, L. F. C., Santos, V. B., & Carneiro, R. F. V. (2009). Soil microbial activity in conventional and organic agricultural system. Sustainability, 1, 268276. Arroussi, H. E., Benhima, R., Elbaouchi, A., Sijilmassi, B., Mernissi, N. E., Aafsar, A., et al. (2018). Dunaliella salina exopolysaccharides: a promising biostimulant for salt stress tolerance in tomato (Solanum lycopersicum). Journal of Applied Phycology, 30(5), 2929–2941. Babu, A. G., Kim, S. W., Yadav, D. R., Hyum, U., Adhikari, M., Lee, Y. S., et al. (2015). Penicillium menonorum: a novel fungus to promote growth and nutrient management in cucumber plants. Mycobiology, 43(1), 49–56. Bent, E. (2006). Induced systemic resistance mediated by plant growth-promoting rhizobacteria (PGPR) and fungi (PGPF). In Multigenic and induced systemic resistance in plants (225–258). Boston, MA: Springer. Berg, G., & Smalla, K. (2009). Plant species and soil type cooperatively shape the structure and function of microbial communities in the rhizosphere. FEMS Microbiology Ecology, 68(1), 1–13.

Toward an enhanced understanding of plant growth Chapter | 5

107

Bhatt, K., & Maheshwari, D. K. (2019). Decoding multifarious role of cow dung bacteria in mobilization of zinc fractions along with growth promotion of C. annuum L. Scientific Reports, 9, 14232. Bhatt, K., & Maheshwari, D. K. (2020). Zinc solubilizing bacteria (Bacillus megaterium) with multifarious plant growth promoting activities alleviates growth in Capsicum annuum L. 3. Biotechnology, 10, 36. Bhatt, P., Huang, Y., Zhang, W., Sharma, A., & Chen, S. (2020). Enhanced Cypermethrin Degradation Kinetics and Metabolic Pathway in Bacillus thuringiensis strain SG4. Microorganisms, 8, 223. Bhatt, P., Joshi, D., Kumar, N., & Kumar, N. (2019). Recent trends to study the functional analysis of Mycorrhizosphere. In A. Varma, & D. Choudhary (Eds.), Mycorrhizosphere and pedogenesis. Singapore: Springer 181–190. Bhattacharyya, P. N., & Jha, D. K. (2012). Plant growth-promoting rhizobacteria (PGPR): emergence in agriculture. World Journal of Microbiology and Biotechnology, 28(4), 1327–1350. Biari, A., Gholami, A., & Rahmani, H. A. (2008). Growth promotion and enhanced nutrient uptake of maize (Zea mays L.) by application of plant growth promoting rhizobacteria in arid region of Iran. Journal of Biological Sciences, 8(6), 1015–1020. Boiero, L., Perrig, D., Masciarelli, O., Penna, C., Cassán, F., Luna, V., et al. (2007). Phytohormone production by three strains of Bradyrhizobium japonicum and possible physiological and technological implications. Applied Microbiology and Biotechnology, 74(4), 874–880. Bonkowski, M., Griffiths, B., & Scrimgeour, C. (2000). Substrate heterogeneity and microfauna in soil organic ‘hotspots’ as determinants of nitrogen capture and growth of ryegrass. Applied Soil Ecology, 14(1), 37–53. Bottini, R., C.F., & Piccoli, P. (2004). Giberellin production by bacteria and its involvement in plant growth promotion and yield increase. Applied Microbiology and Biotechnology, 65, 497–503. Cakmakçi, R., Dönmez, F., Aydın, A., & Şahin, F. (2006). Growth promotion of plants by plant growth-promoting rhizobacteria under greenhouse and two different field soil conditions. Soil Biology and Biochemistry, 38(6), 1482–1487. Choi, O., Kim, J., Kim, J. G., Jeong, Y., Moon, J. S., Park, C. S., et al. (2008). Pyrroloquinoline quinone is a plant growth promotion factor produced by Pseudomonas fluorescens B16. Plant Physiology, 146(2), 657–668. Clark, R. B., & Zeto, S. K. (2000). Mineral acquisition by arbuscular mycorrhizal plants. Journal of Plant Nutrition, 23(7), 867–902. Cohen, A. C., Bottini, R., & Piccoli, P. N. (2008). Azospirillum brasilense Sp 245 produces ABA in chemically-defined culture medium and increases ABA content in Arabidopsis plants. Plant Growth Regulation, 54(2), 97–103. Contreras-Cornejo, H. A., Macias-Rodriguez, L., Cortes-Penagos, C., & Lopez-Bucio, J. (2009). Trichoderma virens, a plant beneficial fungus, enhances biomass production and promotes lateral root growth through an auxin-dependent mechanism in Arabidopsis. Plant Physiology, 149, 1579–1592. Deshmukh, S., Hückelhoven, R., Schäfer, P., Imani, J., Sharma, M., Weiss, M., et al. (2006). The root endophytic fungus Piriformospora indica requires host cell death for proliferation during mutualistic symbiosis with barley. Proceedings of the National Academy of Sciences, 103(49), 18450–18457. Dodd, I. C., Zinovkina, N. Y., Safronova, V. I., & Belimov, A. A. (2010). Rhizobacterial mediation of plant hormone status. Annals of Applied Biology, 157(3), 361–379. Elsharkawy, M. M., Shimizu, M., Takahashi, H., & Hyakumachi, M. (2012). The plant growth-promoting fungus Fusarium equiseti and the arbuscular mycorrhizal fungus Glomus mosseae induce systemic resistance against Cucumber mosaic virus in cucumber plants. Plant Soil, 361, 397–409.

108

Recent Advancements in Microbial Diversity

FAO. (2015). The state of food insecurity in the world meeting the 2015 international hunger targets:taking stock of uneven progress. Frankowski, J., Lorito, M., Scala, F., Schmid, R., Berg, G., Bahl, H., et al. (2001). Purification and properties of two chitinolytic enzymes of Serratia plymuthica HRO-C48. Archives of Microbiology, 176(6), 421–426. Fujita, M., Mori, K., Hara, H., Hishiyama, S., Kamimura, N., Masai, E., et al. (2019). A TonB-dependent receptor constitutes the outer membrane transport system for a lignin-derived aromatic compound. Communications Biology, 2(1), 1–10. Gangola, S., Joshi, S., Kumar, S., & Pandey, S.C. (2019). Comparative analysis of fungal and bacterial enzymes in biodegradation of xenobiotic compounds. In Smart bioremediation technologies: Microbial enzymes (pp. 169–189). Garcia-Gonzalez, J., & Sommerfeld, M. (2016). Biofertilizer and biostimulant properties of the microalga Acutodesmus dimorphus. Journal of Applied Phycology, 28(2), 1051–1061. García de Salamone, I. E., Hynes, R. K., & Nelson, L. M. (2001). Cytokinin production by plant growth promoting rhizobacteria and selected mutants. Canadian Journal of Microbiology, 47(5), 404–411. Giovanelli, J. S., Mudd, S. H., & Datko, A. H. (1980). Sulphur amino acids in plants. In B. Miftin (Ed.), In the biochemistry of plants (vol. 5). Glick, B. R. (2012). Plant growth-promoting bacteria: mechanisms and applications. Scientifica. Glick, B. R., Todorovic, Biljana, Czarny, Jennifer, Cheng, Zhenyu, Duan, Jin, McConkey, Brendan, et al. (2007). Promotion of plant growth by bacterial ACC deaminase. Critical Reviews in Plant Sciences, 26(5–6), 227–242. Goswami, D., Thakker, J. N., & Dhandhukia, P. C. (2016). Portraying mechanics of plant growth promoting rhizobacteria (PGPR): A review. Cogent Food & Agriculture, 2(1), 1127500. Gray, E. J., & Smith, D. L. (2005). Intracellular and extracellular PGPR: commonalities and distinctions in the plant–bacterium signaling processes. Soil Biology and Biochemistry, 37(3), 395–412. Griffiths, B. S. (1994). Soil nutrient flow. Soil Protozoa, 65–91. Halvorson, H. O., Keynan, A., & Kornberg, H. L. (1990). Utilization of calcium phosphates for microbial growth at alkaline pH. Soil Biology and Biochemistry, 22(7), 887–890. Hamayun, M., Khan, S. A., Khan, A. L., Rehman, G., Kim, Y. H., Iqbal, I., et al. (2010). Gibberellin production and plant growth promotion from pure cultures of Cladosporium sp. MH–6 isolated from cucumber (Cucumis sativus L.). Mycologia, 102, 989–995. Hamed, S. M. M. (2007). Studies on nitrogen fixing Cyanobacteria. Beni-Suef, Egypt: Beni-Suef University (Doctoral dissertation, M. Sc. Thesis). Hiruma, K., Gerlach, N., Sacristán, S., Nakano, R. T., Hacquard, S., Kracher, B., et al. (2016). Root endophyte Colletotrichum tofieldiae confers plant fitness benefits that are phosphate status dependent. Cell, 165(2), 464–474. Horinouchi, H., Muslim, A., & Hyakumachi, M. (2010). Biocontrol of fusarium wilt of spinach by the plant growth promoting fungus Fusarium equiseti GF183. Journal of Plant Pathology, 92(1), 249–254. Hossain, M. M., Sultana, F., Kubota, M., Koyama, H., & Hyakumachi, M. (2007). The plant growthpromoting fungus Penicillium simplicissimum GP17-2 induces resistance in Arabidopsis thaliana by activation of multiple defense signals. Plant Cell Physiology, 48(12), 1724–1736. Hossain, M. M., Sultana, F., Kubota, M., Koyama, H., & Hyakumachi, M. (2008). Systemic resistance to bacterial leaf speck pathogen in Arabidopsis thaliana induced by the culture filtrate of a plant growth-promoting fungus (PGPF) Phoma sp. GS8–1. Journal of General Plant Pathology, 74, 213–221.

Toward an enhanced understanding of plant growth Chapter | 5

109

Hossain, M. M., Sultana, F., Miyazawa, M., & Hyakumachi, M. (2014). Plant growth-promoting fungus Penicillium spp. GP15-1 enhances growth and confers protection against damping-off and anthracnose in the cucumber. Journal of Oleo Science, 63, 391–400. Ibraheem, I. B. (2007). Cyanobacteria as alternative biological conditioners for bioremediation of barren soil. Egyptian Journal of Phycology, 8(100), 99–116. Innerebner, G., Knief, C., & Vorholt, J. A. (2011). Protection of Arabidopsis thaliana against leafpathogenic Pseudomonas syringae by Sphingomonas strains in a controlled model system. Applied and Environmental Microbiology, 77(10), 3202–3210. Jentschke, G., Bonkowski, M., Godbold, D. L., & Scheu, S. (1995). Soil protozoa and forest tree growth: non-nutritional effects and interaction with mycorrhizae. Biology and Fertility of Soils, 20(4), 263–269. Khalid, S., Asghar, H. N., Akhtar, M. J., Aslam, A., & Zahir, Z. A. (2015). Biofortification of iron in chickpea by plant growth promoting rhizobacteria. Pakistan Journal of Botany, 47(3), 1191–1194. Khan, A. L., Hamayun, M., Radhakrishnan, R., Waqas, M., Kang, S. M., Kim, Y. H., et al. (2012). Mutualistic association of Paecilomyces formosus LHL10 offers thermotolerance to Cucumis sativus. Antonie van Leeuwenhoek, 101(2), 267–279. Koike, N., Hyakumachi, M., Kageyama, K., Tsuyumu, S., & Doke, N. (2001). Induction of systemic resistance in cucumber against several diseases by plant growth-promoting fungi: lignification and superoxide generation. European Journal of Plant Pathology, 107(5), 523–533. Kong, Z., Mohamad, O. A., Deng, Z., Liu, X., Glick, B. R., Wei, G., et al. (2015). Rhizobial symbiosis effect on the growth, metal uptake, and antioxidant responses of Medicago lupulina under copper stress. Environmental Science and Pollution Research, 22(16), 12479–12489. Kumar, A., Singh, V., Singh, M., Singh, P. P., Singh, S. K., Singh, P. K., et al. (2016). Isolation of plant growth promoting rhizobacteria and their impact on growth and curcumin content in Curcuma longa L. Biocatalysis and Agricultural Biotechnology, 8, 1–7. Lehmann, T., Hoffmann, M., Hentrich, M., & Pollmann, S. (2010). Indole-3-acetamide-dependent auxin biosynthesis: a widely distributed way of indole-3-acetic acid production. European Journal of Cell Biology, 89(12), 895–905. Liang, Y., Lin, X., Yamada, S., Inoue, M., & Inosako, K. (2013). Soil degradation and prevention in greenhouse production. SpringerPlus, 2. Ludwig-Müller, J. (2015). Bacteria and fungi controlling plant growth by manipulating auxin: balance between development and defense. Journal of Plant Physiology, 172, 4–12. Maheshwari, D. K., Dubey, R. C., Aeron, A., Kumar, B., Kumar, S., Tewari, S., et al. (2012). Integrated approach for disease management and growth enhancement of Sesamum indicum L. utilizing Azotobacter chroococcum TRA2 and chemical fertilizer. World Journal of Microbiology and Biotechnology, 28(10), 3015–3024. Martínez-Viveros, O., Jorquera, M. A., Crowley, D. E., Gajardo, G. M. L. M., & Mora, M. L. (2010). Mechanisms and practical considerations involved in plant growth promotion by rhizobacteria. Journal of Soil Science and Plant Nutrition, 10(3), 293–319. Masunaka, A., Hyakumachi, M., & Takenaka, S. (2011). Plant growth-promoting fungus, Trichoderma koningi suppresses isoflavonoid phytoalexin vestitol production for colonization on/in the roots of Lotus japonicus. Microbes and Environments, 26, 128–134. Mishra, S., & Arora, N. K. (2012). Evaluation of rhizospheric Pseudomonas and Bacillus as biocontrol tool for Xanthomonas campestris pv campestris. World Journal of Microbiology and Biotechnology, 28(2), 693–702. Murali, M., Amruthesh, K. N., Sudisha, J., Niranjana, S. R., & Shetty, H. S. (2012). Screening for plant growth promoting fungi and their ability for growth promotion and induction of resistance in pearl millet against downy mildew disease. Journal of Phytology, 4(5), 30–36.

110

Recent Advancements in Microbial Diversity

Murali, M. A. (2015). Plant growth-promoting fungus penicillium oxalicum enhances plant growth and induces resistance in pearl millet against Downy mildew disease. Journal of Phytopathology, 163, 743–754. Nannipieri, P., Giagnoni, L., Landi, L., & Renella, G. (2011). Role of phosphatase enzymes in soil. In A. O. E. Bunemann, & E. Frossard (Eds.), Soil Biology (pp. 215–243). Springer. Naznin, H. A., Kimura, M., Miyazawa, M., & Hyakumachi, M. (2013). Analysis of volatile organic compounds emitted by plant growth-promoting fungus Phoma sp. GS8-3 for growth promotion effects on tobacco. Microbes and Environments, 28, 42–49. Nelson, L. M. (2004). Plant growth promoting rhizobacteria (PGPR): prospects for new inoculants. Crop Management, 3(1). Ngumbi, E., & Kloepper, J. (2016). Bacterial-mediated drought tolerance: current and future prospects. Applied Soil Ecology, 105, 109–125. Oancea, F., Velea, S., Fãtu, V., Mincea, C., & Ilie, L. (2013). Micro-algae based plant biostimulant and its effect on water stressed tomato plants. Journal of Plant Protection, 6, 104–117. Orlandini, V., Emiliani, G., Fondi, M., Maida, I., Perrin, E., Fani, R., et al. (2014). Network analysis of plasmidomes: The Azospirillum brasilense Sp245 case. International Journal of Evolutionary Biology. Otieno, N., Lally, R. D., Kiwanuka, S., Lloyd, A., Ryan, D., Germaine, K. J., et al. (2015). Plant growth promotion induced by phosphate solubilizing endophytic Pseudomonas isolates. Frontiers in Microbiology, 6, 745. Pande, V., Pandey, S.C., Joshi, T., Sati, D., Gangola, S., Kumar, S., & Samant, M. (2019). Biodegradation of toxic dyes: a comparative study of enzyme action in a microbial system. In Smart bioremediation technologies: Microbial enzymes (pp. 255). Pande, V., Pandey, S. C., Sati, D., Pande, V., & Samant, M. (2020). Bioremediation: an emerging effective approach towards environment restoration. Environmental Sustainability, 1–13. Pandey, A., Tripathi, P. H., Paliwal, A., Tripathi, A. H., Pandey, S. C., Joshi, T., et al. (2019). Various Approaches for Food Waste Processing and Its Management. In Global initiatives for waste reduction and cutting food loss (pp. 191–211). IGI Global. Pandey, A., Tripathi, P.H., Pandey, S.C., Pathak, V.M., & Nailwal, T.K. (2018). Removal of toxic pollutants from soil using microbial biotechnology. In Microbial biotechnology in environmental monitoring and cleanup. IGI Global. Pandey, A., Tripathi, P.H., Tripathi, A.H., Pandey, S.C., & Gangola, S. (2019). Omics technology to study bioremediation and respective enzymes. In Smart bioremediation technologies: Microbial enzymes (pp. 23). Pandey, S. C., Pande, V., Sati, D., Gangola, S., Kumar, S., Pandey, A., & Samant, M. (2019). Microbial keratinase: a tool for bioremediation of feather waste. In Smart bioremediation technologies: Microbial enzymes (pp. 217). Pandey, S. C., Pandey, A., Joshi, T., Pande, V., Sati, D., Samant, M., et al. (2019). Microbiological Monitoring in the Biodegradation of Food Waste. In Global Initiatives for Waste Reduction and Cutting Food Loss (vol. 116-140). IGI Global. Parnell, J. J., Berka, R., Young, H. A., Sturino, J. M., Kang, Y., Barnhart, D. M., et al. (2016). From the lab to the farm: an industrial perspective of plant beneficial microorganisms. Frontiers in Plant Science, 7, 1110. Patten, C. L., Blakney, A. J., & Coulson, T. J. (2013). Activity, distribution and function of indole3-acetic acid biosynthetic pathways in bacteria. Critical Reviews in Microbiology, 39(4), 395–415. Peix, A., Mateos, P. F., Rodriguez-Barrueco, C., Martinez-Molina, E., & Velazquez, E. (2001). Growth promotion of common bean (Phaseolus vulgaris L.) by a strain of Burkholderia cepacia under growth chamber conditions. Soil Biology and Biochemistry, 33(14), 1927–1935.

Toward an enhanced understanding of plant growth Chapter | 5

111

Peškan-Berghöfer, T., Shahollari, B., Giong, P. H., Hehl, S., Markert, C., Blanke, V., et al. (2004). Association of Piriformospora indica with Arabidopsis thaliana roots represents a novel system to study beneficial plant–microbe interactions and involves early plant protein modifications in the endoplasmic reticulum and at the plasma membrane. Physiologia Plantarum, 122(4), 465–477. Prathap, M., & Ranjitha Kumari, B. D. (2015). A critical review on plant growth promoting rhizobacteria. Journal of Plant Pathology and Microbiology, 6(266), 2. Raaijmakers, J. M., Paulitz, T. C., Steinberg, C., Alabouvette, C., & Moënne-Loccoz, Y. (2009). The rhizosphere: a playground and battlefield for soilborne pathogens and beneficial microorganisms. Plant and Soil, 321(1–2), 341–361. Raines, D. J., Sanderson, T. J., Wilde, E. J., & Duhme-Klair, A. K. (2015). Siderophores. Rana, A., Saharan, B., Nain, L., Prasanna, R., & Shivay, Y. S. (2012). Enhancing micronutrient uptake and yield of wheat through bacterial PGPR consortia. Soil Science and Plant Nutrition, 58(5), 573–582. Rijavec, T., & Lapanje, A. (2016). Hydrogen cyanide in the rhizosphere: not suppressing plant pathogens, but rather regulating availability of phosphate. Frontiers in Microbiology, 7, 1785. Rodrıguez, H., Gonzalez, T., & Selman, G. (2000). Expression of a mineral phosphate solubilizing gene from Erwinia herbicola in two rhizobacterial strains. Journal of Biotechnology, 84(2), 155–161. Salas-Marina, M. A., Silva-Flores, M. A., Cervantes-Badillo, M. G., Rosales-Saavedra, M. T., IslasOsuna, M. A., Casas-Flores, S., et al. (2011). The plant growth-promoting fungus Aspergillus ustus promotes growth and induces resistance against different lifestyle pathogens in Arabidopsis thaliana. Journal of Microbiology and Biotechnology, 21(7), 686–696. Saldajeno, M. G. B. H. M. (2011). The plant growth-promoting fungus Fusarium equiseti and the arbuscular mycorrhizal fungus Glomus mosseae stimulate plant growth and reduce severity of anthracnose and damping-off diseases in cucumber (Cucumis sativus) seedlings. Annals of Applied Biology, 159, 28–40. Samant, M., Pandey, S. C., & Pandey, A. (2018). Impact of hazardous waste material on environment and their management strategies. In Microbial biotechnology in environmental monitoring and cleanup (Vol. 175–192). IGI Global. Sharma, S. B., Sayyed, R. Z., Trivedi, M. H., & Gobi, T. A. (2013). Phosphate solubilizing microbes: sustainable approach for managing phosphorus deficiency in agricultural soils. SpringerPlus, 2(1), 587. Singh, R., Pandey, D. K., Kumar, A., & Singh, M. (2017). PGPR isolates from the rhizosphere of vegetable crop Momordica charantia: characterization and application as biofertilizer. International Journal of Current Microbiology and Applied Sciences, 6(3), 1789–1802. Sirrenberg, A., Göbel, C., Grond, S., Czempinski, N., Ratzinger, A., Karlovsky, P., et al. (2007). Piriformospora indica affects plant growth by auxin production. Physiologia plantarum, 131(4), 581–589. Stein, A. J. (2014). Rethinking the measurement of undernutrition in a broader health context: Should we look at possible causes or actual effects? Global Food Security, 3(3–4), 193–199. Sultana, F., Hossain, M. M., Kubota, M., & Hyakumachi, M. (2008). Elicitation of systemic resistance against the bacterial speck pathogen in Arabidopsis thaliana by culture filtrates of plant growth-promoting fungi. Canadian Journal of Plant Pathology, 30, 196–205. Tarakhovskaya, E. R., Maslov, Y. I., & Shishova, M. F. (2007). Phytohormones in algae. Russian Journal of Plant Physiology, 54(2), 163–170. Trabelsi, D., & Mhamdi, R. (2013). Microbial inoculants and their impact on soil microbial communities: a review. BioMed Research International.

112

Recent Advancements in Microbial Diversity

Tsavkelova, E. A., Klimova, S. Y., Cherdyntseva, T. A., & Netrusov, A. I. (2006). Microbial producers of plant growth stimulators and their practical use: a review. Applied Biochemistry and Microbiology, 42(2), 117–126. Varma, A., Verma, S., Sahay, N., Bütehorn, B., & Franken, P. (1999). Piriformospora indica, a cultivable plant-growth-promoting root endophyte. Applied and Environmental Microbiology, 65(6), 2741–2744. Vejan, P., Abdullah, R., Khadiran, T., Ismail, S., & Nasrulhaq Boyce, A. (2016). Role of plant growth promoting rhizobacteria in agricultural sustainability—a review. Molecules, 21(5), 573. Velivelli, S. L., De Vos, P., Kromann, P., Declerck, S., & Prestwich, B. D. (2014). Biological control agents: from field to market, problems, and challenges. Trends in Biotechnology, 32(10), 493–496. Vessey, J. K. (2003). Plant growth promoting rhizobacteria as biofertilizers. Plant and Soil, 255(2), 571–586. Wander, M. (2004). Soil organic matter fractions and their relevance to soil function. Soil Organic Matter in Sustainable Agriculture, 67–102. Wang, D., Lv, S., Jiang, P., & Li, Y. (2017). Roles, regulation, and agricultural application of plant phosphate transporters. Frontiers in Plant Science, 8, 817. Waqas, M., Khan, A. L., Kamran, M., Hamayun, M., Kang, S. M., Kim, Y. H., et al. (2012). Endophytic fungi produce gibberellins and indoleacetic acid and promotes host-plant growth during stress. Molecules, 17, 10754–10773. Yadav, J., Verma, J. P., & Tiwari, K. N. (2011). Plant growth promoting activities of fungi and their effect on chickpea plant growth. Asian Journal of Biological Sciences, 4, 291–299. Zahran, H. H. (2001). Rhizobia from wild legumes: diversity, taxonomy, ecology, nitrogen fixation and biotechnology. Journal of Biotechnology, 91(2), 143–153. Zhao, K., Penttinen, P., Zhang, X., Ao, X., Liu, M., Yu, X., et al. (2014). Maize rhizosphere in Sichuan, China, hosts plant growth promoting Burkholderia cepacia with phosphate solubilizing and antifungal abilities. Microbiological Research, 169(1), 76–82. Zhu, F., Qu, L., Hong, X., & Sun, X. (2011). Isolation and characterization of a phosphate-solubilizing halophilic bacterium Kushneria sp. YCWA18 from Daqiao Saltern on the coast of Yellow Sea of China. Evidence-Based Complementary and Alternative Medicine, 2011.

Chapter 6

Multifaceted beneficial effects of plant growth promoting bacteria and rhizobium on legume production in hill agriculture Anupam Pandeya,b, Priyanka H. Tripathia,b, Satish Chandra Pandeyb,c and Tushar Joshib,d a

ICAR-Directorate of Coldwater Fisheries Research, Bhimtal, Uttarakhand, India; bDepartment of Biotechnology, Bhimtal Campus, Kumaun University, Nainital, Uttarakhand, India; cCell and Molecular Biology Laboratory, Department of Zoology, Kumaun University, SSJ Campus Almora, Nainital, Uttarakhand, India; dDepartment of Botany, Kumaun University, SSJ Campus Almora, Nainital, Uttarakhand, India

1 Introduction About 15% of the world’s population directly depends for its sustenance on mountains. Himalayas and Western Ghats are the major mountain ranges present in India covering a distance of about 2500 km between the Indus and the Brahmaputra rivers. The rich environmental heritage of the Himalayas is under stress and pressure due to human activities and natural calamities. As the possibilities of industrialization in the mountains is very low, the only option left for livelihood and economic growth is agriculture. Hill agriculture has great potential for development of rural sector and economic growth, so it should be promoted by government and voluntary agencies in this area. Under-exploitation of hill agriculture in India so far can be attributed to factors like difficult terrain, inadequate infrastructure, fragility, inaccessibility and marginal societies, lack of irrigation, severe top soil erosion, and overall external inputs to the system. In addition to these factors agricultural production in these areas is affected by low organic matter, status of soil moisture and the cold conditions. Further, application of synthetic pesticides, insecticides or chemicals for rapid plant production and disease management can pose serious threat. In comparison to India, the advanced countries are credited with the accessible technology, advanced agricultural skills and modern techniques which are used for preparation of infrastructures, agricultural field, sowing, cultivation, Recent Advancements in Microbial Diversity. http://dx.doi.org/10.1016/B978-0-12-821265-3.00006-2 Copyright © 2020 Elsevier Inc. All rights reserved.

113

114

Recent Advancements in Microbial Diversity

harvesting, processing, and storage; which makes hill agriculture a lot easier and feasible (Pandey et al., 2019). But despite of all these limitations, Indian hilly states have great potential to accelerate agricultural growth through diversification from low to high value crop. Low input agriculture is generally practiced in these areas by the farming communities in order to achieve agricultural sustainability; but infertile, fragile, rainfed agricultural land remains to be a great hindrance (Bisht et al., 2006). To obtain good yield and proper plant growth the infertile land need nitrogen, this is the reason why the demand for soil nitrogen in hills is increasing day-by-day. The scenario is the same for the world agriculture where the demand for nitrogen is increasing with the growing world population i.e. about 2% per annum (FAO statistics series, 1992). Legumes are the crops that have the capability to fix nitrogen present in the molecular N2 form in the atmosphere and hence can be considered as its viable source in hilly areas, where landholding is small and traditional agriculture is entirely practiced on rain fed terraces under low-input system (Peoples & Craswell, 1992; Humphreys, 1994). Therefore, legume being the biological nitrogen source play a key role in sustainable hill agriculture. It can also maintain fertility of soil and help poor farmers of these region which are unable to afford nitrogen fertilizers. Since atmospheric nitrogen is a renewable resource, biological nitrogen fixation (BNF) by legume crops is an ecologically viable source of nitrogen in agricultural system, which increases food production without compromising for food quality as compared to inorganic fertilizers which provide an unsustainable nitrogen source to the crop and soil (Thomas, Fisher, Ayarza, & Sanz, 1995). Thus, legume crops have great relevance in increasing soil fertility and can fix up to 40–48 million tons of N/year thereby contributing to a low-input sustainable farming system (Galloway, Schlesinger, Levy, Michaels, & Schnoor, 1995; Jenkinson, 2001). Grain legumes include all the pulse crops like peas, lentils, chickpea, pigeon pea, beans, green gram, etc. and also some major oilseed crops like groundnut and soybeans. Apart from their remarkable property of biological nitrogen fixation, these crops are part of daily diet contributing to human nutrition (both protein and fats) plus contribution to farmer’s income. During the last four decades (1975-2015), marginal increase of approximately 10% for pulse cultivation has been observed in the hilly areas with an insignificant gain of total production whereas the yield remained almost the same for the last two decades. Despite of increase in the consumption of pulses over the years, fewer efforts have been made so far to promote and increase the area under cultivation of these crops particularly in the hilly region (Maikhuri, Rao, & Semwal, 2001). The use of microbial inoculants/co-inoculants as biofertilizers or for bio-control may prove of great benefit. Soil forms a crucial part of our natural environment and is of great importance in day-to-day human life (Pandey, Tripathi, Pandey, Pathak, & Nailwal, 2018). Agricultural productivity majorly depends upon the fact that the soil is fertile or not. As the more the soil is fertile the more will be food production.

Multifaceted beneficial effects of plant growth promoting bacteria Chapter | 6

115

Besides the presence of all the minerals and nutrients; what makes soil fertile are micro-organisms that reside in it and enrich the content by various processes thereby helping the crops to grow. Studies based on the soil–plant– microbe interaction has got much importance in recent decades. Legume N2 fixation results in increased plant protein levels and a decrease in soil nitrogen levels. This nitrogen deficiency in soil often limits plant growth giving rise to a symbiotic relationship among plants and a variety of nitrogen-fixing organisms present in the soil (Freiberg et al., 1997). The soil surrounding the root system (especially rhizosphere) is abundant in microbial population resulting in high microbial activity in this area (due to root exudates and rhizodeposits). This phenomenon is known as “rhizosphere effect” where microbes are attracted to the plant exudates (Hiltner, 1904). Some of these microorganisms use the nutrients secreted by the plant roots and in return they beneficially influence the plant growth and development. Rhizobium is a class of such soil microorganisms that play a vital role in soil processes and may have direct bearing on productivity of crop plants. In order to enhance the production of legumes in hilly areas; introduction of Rhizobium or PGPRs or co-inoculants of both may prove beneficial. Here in this book chapter we have tried to highlight the effects of Rhizobium and PGPRs on legumes production in hill agriculture.

2  Rhizobium- legume symbiotic relationship Fabaceae or Leguminosae family is among the largest families of angiosperms, plants of which are generally called as legumes. Legumes are very well known to have a symbiotic association with nitrogen-fixing (N2-fixing) soil rhizobacteria, also known as rhizobia, e.g., Rhizobium, Sinorhizobium, Azorhizobium, Bradyrhizobium, Allorhizobium, or Mesorhizobium, (Velázquez, García-Fraile, Ramírez-Bahena, Rivas, & Martínez-Molina, 2010). This unique group of bacteria among the soil has advantageous effect on legumes. It is believed from over 100 years that rhizobia are symbiotic nitrogen-fixing bacteria that can improve the growth of legumes under nitrogen limiting conditions (Mehboob, Naveed, & Zahir, 2009). In a study conducted by Oyaizu et al, rhizobial distribution was surveyed in about 91 species from Leguminoaceae family. Their analyses revealed that the rhizobia generally fall in to three major groups which correspond to the genera Rhizobium, Bradyrhizobium and Azorhizobium and the presence of 17 varieties (eight varieties for the genus Rhizobium, eight for the genus Bradyrhizobium, and one for the genus Azorhizobium) (Oyaizu, Matsumoto, Minamisawa, & Gamou, 1993). Rhizobia either reside in soil or inside the root nodules of leguminous host. When the root hair of the germinating leguminous seeds interacts with these bacteria and if there is compatibility between the legume and rhizobia, then the bacteria enters the plant’s root hair and results in root nodule formation. However, not all the leguminous plants participate in the nitrogen fixing process with

116

Recent Advancements in Microbial Diversity

rhizobia. Till date about 12,000 nodulated leguminous species are discovered and each one having their Rhizobium partner(s). Nitrogen starved host plants secrete flavonoid molecules as chemical signal which attracts a Rhizobium partner (the symbiont) among the billions of bacteria present in the rhizosphere. This initiates the expression of Rhizobium nodulation genes (Oldroyd, 2013). Once the connection between them is established, the rhizobia starts obtaining energy from the plant via photosynthesis and performs atmospheric nitrogen fixation in the root nodules thereby converting it in a form that is usable for plant. In this way, both the leguminous plant and rhizobia get benefitted from each other and such a relationship is called symbiosis. The complex process by which the rhizobia fixes atmospheric nitrogen and converts it in to usable form for the legume is called biological nitrogen fixation, or BNF (Fig. 6.1). The root nodulation process takes place only when the rhizobia is compatible with a particular legume species. As great economic advantages may be achieved for legume production through BNF, rhizobial inoculants are being commercially produced in many countries. These rhizobial inoculants are isolated from root nodules of plants and are further artificially grown (cultured) in the laboratory (Fig 6.2).

FIGURE 6.1  Biological Nitrogen Fixation mechanism: Nitrogen fixing bacteria, Rhizobium sps. entering the plant cell and forming root nodules where the nitrogen fixation takes place.

Multifaceted beneficial effects of plant growth promoting bacteria Chapter | 6

117

FIGURE 6.2  Mechanisms displaying effects of PGPR inoculations on Rhizobium-legume symbiosis) shows the different effects of PGPR when inoculated in combination with rhizobia.

3  Rhizobium-legume symbiosis: mechanism This starts when the leguminous plant releases flavonoids in to the rhizosphere (Redmond et al., 1986) that activates nod D, specific rhizobial receptor, which separates the rhizobia from other nitrogen fixing and endophytic bacteria. The nod D is further classified into three groups, i.e., regulatory, common, or host specific depending upon their respective functions. The host specific genes differ among the species in accordance with their function, copy number, and control mechanisms. The response of nod D also varies according to the type and quantity of host flavonoids that is released (Spaink, 2000). So, for initiation of nodulation at least one functional nod D is required (Schlaman, Okker, & Lugtenberg, 1992). In response to plants flavonoids released, the rhizobial nod D produces a “lipo-chitooligosaccharide or nodulation factors (nod factors)” which is a protein that act as a sensor for recognizing chemicals excreted by host plant roots (Russelle, 2008). The release of nod factor results in activation of a set of plant genes, called as nodulins (Geurts & Bisseling, 2002), that further leads in induction of a numerous biochemical and morphological changes which initiates the cortical cell division (Oldroyd & Downie, 2008) and results in a nodule meristem formation within the root. This causes the growing root hair to curl on to the side where the bacteria are attached and deforms forming a “shepherd’s crook” which serves to entrap/encapsulate the rhizobia. An infection is initiated by the entrapped rhizobia that induce the plant to produce an

118

Recent Advancements in Microbial Diversity

infection thread (a tube that facilitates the entry of rhizobia into deeper layers). The infection thread grows through cells of the root hair into the basal part of epidermal cells then entering into the root cortex and finally in to the nodule primordia. This is the site where free living rhizobia are delivered into plant cells and converted to bacteroids. Another mode of nodulation is “crack entry” i.e. infection through cracks in the root; its presence is also seen in many crop plants of agronomic importance. Once the rhizobia reach inside of the nodule, they are released from the infection thread in the form of a polysaccharide droplet, or when it enters via crack entry, a plant derived peri-bacteroid membrane quickly develops around this droplet via endocytosis. The entire unit of this membrane surrounding the bacteroid is referred to as the symbiosome within which the bacteroids fix nitrogen. Here, the atmospheric nitrogen (N2) is converted to ammonia (NH3) and the reaction is catalyzed by the enzyme nitrogenase. The reaction for BNF is: N2 + 8H+ + 8e− + 16MgATP → 2NH3 + H2 + 16MgADP + 16Pi The ATP requirement is too high and is fulfilled by the plant in the form of sugars via photosynthesis to make their ATP [16 mol of ATP is used up for reduction of each mole of nitrogen (Hubbell & Kidder, 2009)]. As, nitrogenase enzyme is oxygen sensitive, plant leghemoglobin supplies just the optimum concentration of oxygen that is sufficient for the bacteroids to satisfy their conflicting requirements.

4  Legume –rhizobium interaction: advantages to nonlegumes Ever since the rhizobial population was identified [Hellriegel and Wilfarth (1888)] as the fixed nitrogen source in nodulated roots of legumes, researchers have been manipulating plants outside the Fabaceae family so that an association can be established with rhizobia for nitrogen fixation. The development of nodules that was considered as the key finding of Hellriegel and Wilfarth’s, has since become a great achievement in the field of BNF. Some studies has been reported where it was found that certain rhizobial strains can nodulate only certain leguminous plants. For example, the species of Medicago, Melilotus, and Trigonella are effectively nodulated by Sinorhizobium meliloti, whereas nitrogen fixing nodules are induced on Pisum, Lens, Vicia, and Lathyrus spp by Rhizobium leguminosarum. However, not all the association of rhizobia strain-legumes are that stringent. For example, research study by Pueppke and Broughton showed that out of 112 genera tested, 232 legume species were nodulated by Rhizobium strain NGR234 and even nonlegume member of elm family, Parasponia andersonii was seen to be nodulated by this strain (Pueppke & Broughton, 1999). So, in a broader sense association of legumes with Rhizobium spp. have agronomically been considered extremely important. The use of crop rotations to enhance the productivity of non-legume crops was

Multifaceted beneficial effects of plant growth promoting bacteria Chapter | 6

119

vividly described by the Romans, who were probably aware of an even older tradition in Greece. Biological nitrogen fixation from legumes offers more pliable management than fertilizer nitrogen because the pool of organic nitrogen also slowly becomes available to non-leguminous species (Peoples, Herridge, & Lahda, 1995). Concurrent with N2-fixation, using legumes in rotations provides control of crop diseases and pests (Robson, 1990; Graham & Vance, 2000). So, selecting rhizobial strains capable of fixing high levels of N2 and then inoculating these strains in legumes can ameliorate nitrogen fixation in agronomy, particularly when soil is deficient in local rhizobial strains. In many agricultural systems legumes are not grown as continuous crops or pastures, but are rotated with a non-leguminous crop. As reported by several research groups it was seen that when cereals, oilseeds, grasses, and herbs are grown after or in combination with legumes there is higher yield of the protein grains. Using modern isotopic techniques, the transfer of symbiotic N to non-legumes through soil can readily be quantified (Van Kessel & Hartley, 2000).

5  PGPR and its effect on rhizobial-legume interaction Plant Growth Promoting Rhizobacteria (PGPR) is a class of bacteria that are derived from the root and exert beneficial effect on the root. PGPR are associated with plant roots, residing in the rhizospheric region and heterogeneous in population. They promote plant growth and development and improve the quality and yield of plants. Their direct contribution in the enhancing plant growth is through production of phytohormone like auxins, gibberellins and cytokinins, which augment mineral solubilization (like iron and phosphorus), enzymes and siderophore production, reduction of ethylene levels whereas induces systemic resistance (Bhattacharyya & Jha, 2012). The indirect benefits to the plant involves the biocontrol of root pathogens and deleterious microorganisms that hinder plant growth (Zahir, Arshad, & Frankenberger, 2003). Generally, PGPR constitute about 2 to 5% of rhizospheric bacteria (Antoun & Prevost, 2005). These bacteria may be categorised under the following genera: Azotobacter, Azoarcus, Acetobacter, Alcaligenes, Acinetobacter, Arthrobacter, Azospirillum, Derxia, Bacillus, Burkholderia, Beijerinckia, Gluconacetobacter, Enterobacter, Herbaspirillum, Klebsiella, Serratia, Ochrobactrum, Rhodococcus, Pantoae, Pseudomonas, Stenotrophomonas and Zoogloea and have been extensively studied throughout these years (Babalola, 2010). The expression “PGPR” was firstly proposed by Kloepper et al., where he used it specifically for the fluorescent Pseudomonas involved in biocontrol of pathogens and the improvement of plant growth (Kloepper, Leong, Teintze, & Schroth, 1980).

6  Effect of PGPRs on rhizobial- legume interaction Plant growth promoting rhizobacteria (PGPR) have gained worldwide prominence and approval for agricultural benefits. This is due to the growing demand for discovery of a reliable method that diminishes the dependence on synthetic

120

Recent Advancements in Microbial Diversity

chemical products, to fulfill the growing necessity of sustainable agriculture with a vision of development and environmental protection. Multidisciplinary approaches have been undertaken to understand: PGPR adaptation mechanism, induced systemic resistance, their effect on plant growth and physiology, their ability to impart protection against plant pathogens, their use as biofertilizers; in order to explore their potential as an alternative to increase plant productivity. As they have an amazing capability of rapid rhizosphere colonization and plant growth stimulation, currently considerable interest is growing in exploiting them for increasing crop production. Improvement of crop yield as well as growth by application of PGPR has been investigated for several years, with recent attention primarily focused on co-inoculation of PGPR with rhizobia having different growth qualities for plant growth promotion. It is increasingly evident that in nature, bacterial functions are less when they grow as individuals and are more when they grow as unified groups that are capable to reside in multiple ecological niches. When an inoculating consortium is made from these strains, each of the constituent strains of the consortium not only contends with one another for rhizospheric settlements, but complement functionally for plant growth promotion. Another study by Pandey and Maheswari (2007) described that when a combination of Burkholderia sp. MSSP alongwith Sinorhizobium meliloti PP3 (two distantly related isolates) was used, the growth of host plants significantly increased. The reason behind this increase was the increased indole-3-acetic acid (IAA) production and phosphate solubilization than single inoculation under laboratory conditions. An increase of 25% in mean growth rate was recorded for S. meliloti PP3 when grown in two-species culture in comparison to single species culture. This interaction also indicates that microbial co-inoculation and co-culture helps to perform the tasks better than the individual microbe culture, a strategy used to thrive better in communities. The effect of PGPRs when used in association with rhizobia can rise the expression of nod gene products inducing flavonoids, stimulating the development of root hair, secreting vitamin B by PGPR, enhancement of the rhizobial population in the rhizosphere, production of plant growth regulators, improvisation of mineral uptake, mobilization of insoluble nutrients, and suppression of pathogens (Spaepen, Vanderleyden, & Remans, 2007; Weller, 2007). These PGPRs residing in the immediate vicinity of plant roots have shown an encouraging effect on Rhizobium –legume symbiosis (Marek-Kozaczuk, Kopcińska, Łotocka, Golinowski, & Skorupska, 2000). Thus, the abovementioned effective traits of PGPRs contribute in modifying legume growth and productivity if they are co-inoculated with rhizobia (Pankaj, Bansal, & Dabur, 2011). Numerous mechanisms have been proposed by various investigators from their research studies based on analyzing the responses of symbiotic legumes to PGPR co-inoculation (Table 6.1). Some of the mechanisms are discussed in the following subsections.

Mechanism of PGPR

Rhizobium PGPR co-inoculants species

Establishment of Additional Infection Sites

P. fluorescens Luc 1, P. putida Luc 2, P. fl uorescens Luc 3, P. putida Luc 4, B. thuringiensis Luc 5

Results obtained on co-inoculation

References

Lupinus albus L.

The co-inoculation of strain Luc 4 and B. japonicum resulted in increase of plant dry matter and grain N content up to 31 and 39%, respectively, in comparison to control

Garcia, Probanza, Ramos, Barriuso, & Mañero, (2004a)

A. chroococcum, Rhizobium sp. A. brasilense, P. AR-2–2k fluorescens, P. putida, B. cereus

Cajanus cajan L.

The dual inoculation of Rhizobium and P. putida augmented plant biomass, grain yield, and nodule occupancy up to 37, 67, and 85%, respectively, in comparison to control

Tilak et al. (2006)

Bacillus subtilis OSU142, B. megaterium M-3

Rhizobium sp.

Cicer arietinum L.

Combined inoculation resulted in increased seed yield up to 30% compared to control

Elkoca, Kantar, & Sahin, (2008)

P. fluorescens WSM3457

Ensifer (Sinorhizobium) medicae WSM419

Medicago truncatula L.

Co-inoculation of plants resulted in increased rate of nodule initiation (25%) over control

Fox, O’Hara, & Bräu (2011)

B. subtilis, K. planticola, P. vulgaris

B. japonicum, R. leguminosarum bv. viciae

Lens culinaris L.

Co-inoculation results in increase of nodule dry weight of lentil plants by 48% compared to sole Rhizobium inoculation

Tsigie, Tilak, & Saxena, (2011)

B . subtilis, Klebsiella planticola, Proteus vulgaris

B . japonicum, Rhizobium leguminosarum bv. viciae

Glycine max L.

Co-inoculation increases the nodule dry weight of soybean plants by 26% in comparison to Rhizobium inoculation alone

Tsigie et al. (2011)

121

Plant

B. japonicum strain ISLU-21

Multifaceted beneficial effects of plant growth promoting bacteria Chapter | 6

TABLE 6.1 Numerous classified mechanisms by PGPR co-inoculation and their effect on different plants.

(Continued)

122

TABLE 6.1 Numerous classified mechanisms by PGPR co-inoculation and their effect on different plants. (Cont.) Rhizobium PGPR co-inoculants species

Plant

Results obtained on co-inoculation

References

Release of Plant GrowthPromoting Substances

P. fluorescens strain 267, 267.4

R. leguminosarum bv. trifolii strain 24.1

Trifolium pratense L.

Co-inoculation of Rhizobium and P. fl uorescens increased the nodule number and shoot weight up to 119 and 45%, in comparison to Rhizobium inoculation alone

Marek-Kozaczuk et al. (2000)

P. fl uorescens 2137, P. fl uorescens WCS365, Azomonas agilis 125, Azospirillum lipoferum 137

B. japonicum A1017

Glycine max L.

Increase in nodule number, acetylene reduction activity (ARA) and also colonization of B. japonicum A1017 on soybean roots when co-inoculated with P. fluorescens 2137 and B. japonicum at 10 and 20 days after inoculation

Chebotar, Asis, & Akao, (2001)

Pseudomonas striata

Bradyrhizobium sp. (vigna)

Vigna radiata L.

The dual inoculation of Pseudomonas in combination with Bradyrhizobium increased nodule number, nodule weight, and grain yield, i.e., 46, 50, and 44%, respectively, as compared to Bradyrhizobium inoculation alone

Zaidi, Khan, & Aamil, (2004)

P. fl uorescens Aur6, C. balustinum Aur9, S. fonticola Cell 4

Sinorhizobium fredii strain SMH12

Glycine max L.

Significant changes on growth parameters were observed on inoculations with PGPR and S. fredii were at different times

Garcia, Probanza, Ramos, Flores, & Mañero, (2004b)

Pseudomonas jessenii PS06

M. ciceri C-2/2

Cicer arietinum L.

Dual inoculation resulted in increase in the nodule number, nodule weight, and seed yield, i.e., 19, 12, and 52% greater than the control under field conditions

Valverde et al. (2006)

Recent Advancements in Microbial Diversity

Mechanism of PGPR

Mechanism of PGPR

Plant

Results obtained on co-inoculation

References

M. ciceri RC4

Cicer arietinum L.

Co- inoculation of M. ciceri RC4 and Bacillus PSB9 results in increased plant dry matter, nodule weight, and grain yield, i.e., 12, 47, and 17%, respectively

Wani, Khan, & Zaidi, (2007b)

Pseudomonas strains CPS63 and MPS78

Bradyrhizobium strain S24

Vigna radiata L.

Co-inoculation resulted in considerable gains in plant dry weights, i.e., 2.0–3.06 times in comparison to un-inoculated control plants.

Malik and Sindhu (2008)

Azospirillum brasilense Az39

B. japonicum strain E109

Glycine max L.

Dual inoculation of Az39 and E109 in combination, showed the capacity to promote seed germination, nodule formation, and early development of soybean seedlings

Cassan et al. (2009)

Bacillus thuringiensis -KR1

R. leguminosarum -PR1

Lens culinaris L.

Enhanced nodulation due to co-inoculation was 73.3% compared to R. leguminosarum -PR1 treatment alone

Mishra et al. (2009a)

Pseudomonas sp. MRS13

Mesorhizobium sp. Cicer strain Ca181

Cicer arietinum L.

The plant dry weights of co-inoculated treatments showed 1.10–1.28 times increase in comparison to sole inoculation of Mesorhizobium

Malik and Sindhu (2011)

Serratia B. japonicum proteamaculans 1–102, strain 532C S. liquefaciens 2-68

Glycine max L.

Co-inoculation resulted in increase in nodule number and specific nodule dry weight (16 and 49%, respectively) in comparison to sole inoculation of B. japonicum

Bai, Souleimanov, & Smith, (2002)

Serratia proteamaculans 1–102, S. liquefaciens 2-68

B. japonicum

Glycine max L.

Co-inoculation of PGPR at their optimal dose increased nodule number, plant dry weight, and fixed nitrogen up to 38, 37, and 49%, respectively, over control

Bai et al. (2002)

A. brasilense Sp245, B. subtilis LMG7135, P. putida UW4, P. fluorescens SBW25

Rhizobium etli CNPAF512

Phaseolus vulgaris L.

Enhance nodulation and plant growth under P deficiency by co-inoculation with Rhizobium and PGPR

Remans et al. (2007)

123

Azotobacter chroococcum A10, Pseudomonas PSB5, and Bacillus PSB9

Multifaceted beneficial effects of plant growth promoting bacteria Chapter | 6

Biological Nitrogen Fixation (BNF)

Rhizobium PGPR co-inoculants species

(Continued)

124

TABLE 6.1 Numerous classified mechanisms by PGPR co-inoculation and their effect on different plants. (Cont.) Rhizobium PGPR co-inoculants species

Plant

Results obtained on co-inoculation

References

Bacillus/ Paenibacillus spp.strains DSM 13796, DSM 27, DSM 704, DSM 13411, DSM 24, Loutit (L), DSM 36, 65E180

R. tropici strain CIAT899

Phaseolus vulgaris L.

Higher leghemoglobin conc., nitrogenase activity, and N2 fixation efficiency in beans co-inoculated with R. tropici (CIAT899) and P. polymyxa (DSM36) in comparison to control

Figueiredo, Martinez, Burity, & Chanway, (2008)

Bacillus megaterium strains NR2, NR4, and NR6

Rhizobium spp. IC3123

Cajanus cajan L.

Co- inoculation of Bacillus sp. with Rhizobium spp. IC3123 showed plant growth promoting activity and improvement in C. cajan nodulation under Nitrogen-free culture conditions

Rajendran, Sing, Desai, & Archana, (2008)

Azospirillum sp.

Rhizobium etli CNPAF512

Phaseolus vulgaris L.

Co-inoculation with Rhizobium and Azospirillum enhanced the N2 fixation capacity from 1.8 to 22.4 kg ha–1 and yield from 8% to 29% in comparison to single Rhizobium or no inoculation.

Remans et al. (2008)

B. thuringiensis -KR1

R. leguminosarum -PR1

Pisum sativum L.

Enhanced nodulation due to co-inoculation was 84.6% compared to R. leguminosarum -PR1 treatment alone

Mishra et al. (2009a)

Streptomyces sp. strain, P4

Bradyrhizobium japonicum USDA 110

Glycine max L.

Dual inoculation of USDA 110 and P4 showed the highest shoot nitrogen accumulation and seed weight among treatments

Soe, Bhromsiri, Karladee, & Yamakawa, (2012)

Pseudomonas fluorescens BHUPSB06

Mesorhizobium sp. BHURC02

Cicer arietinum L.

Maximum increase recorded in nodule number, dry matter, and nutrient content on co-inoculation of BHURC02 and BHUPSB06

Verma, Yadav, & Tiwari, (2012)

Recent Advancements in Microbial Diversity

Mechanism of PGPR

Rhizobium PGPR co-inoculants species

Decreasing Ethylene Level (ACC Deaminase)

P. putida biotype AQ7, P. fluorescens Q14

Nutrient solubilisation and its uptake by plants

Biological control

Results obtained on co-inoculation

References

Bradyrhizobium japonicum

Vigna radiata L.

Co- inoculation increased total plant biomass and nodule weight up to 19 and 100%, respectively

Shaharoona, Arshad, & Zahir, (2006)

Pseudomonas jessenii , P. fragi , Serratia fonticola

R. leguminosarum

Lens culinaris L.

Co-inoculation resulted in an increase in the dry nodule weight and grain yield up to 109 and 150% and up to 100 and 82%, respectively, underpot and field conditions compared to control

Zahir Zafar-ulHye, Sajjad, & Naveed, (2011)

Pseudomonas syringae,Mk1; P. f uorescens, Mk20 and Mk25

Rhizobium phaseoli (M6and M9)

Vigna radiata L.

Co-inoculation increased the shoot fresh weight (145%), root fresh weight (173%), pod fresh weight (182%), and total dry matter (269%) over control

Ahmad, Zahir, Asghar, & Arshad, (2012)

Thiobacillus Rhizobium sp. thiooxidans strain, LCH, strain TNAU14 SWA5, and SWA4

Arachis hypogaea L.

Co-inoculation of Thiobacillus sp. strain LCH with Rhizobium enhanced pod yield by 18% when under field condition compared to control

Anandham, Sridar, Nalayini, Poonguzhali, & Madhaiyan, (2007)

Pseudomonas sp. strain PGERs17

R. leguminosarum -PR1

Pisum sativum L.

Co-inoculation resulted in a significant increase in nodulation and plant biomass i.e., 156.2% and 57.1% respectively over control

Mishra et al. (2012)

P. fluorescens strains

R. leguminosarum biovar. viciae

Pisum sativum L.

Dual inoculation improved the plant growth in terms of shoot height, root length, and dry weight, i.e., 24, 20, and 22%, respectively, in comparison to control

Kumar, Berggren, & Mårtensson, (2001)

Pseudomonas strain 6N and PM-4

Mesorhizobium ciceri

Cicer arietinum L.

Dual inoculation with PM-4 strain resulted in an increase in the nodule weight and grain yield up to 54 and 40%, respectively, compared to control

Pathak, Kumar, Sharma, Kumar, & Sharma, (2007)

Bacillus sp., Pseudomonas sp. CDB 35 and BWB 21

Rhizobium sp. IC 59 and IC 76

Cicer arietinum L.

Co-inocualtion of Rhizobium sp. IC 59 and Pseudomonas sp. CDB 35 increased shoot weight by 36 and 39% by seed coating/priming with when compared to control

Hameeda, Harini, Rupela, Rao, & Reddy, (2010)

125

Plant

Multifaceted beneficial effects of plant growth promoting bacteria Chapter | 6

Mechanism of PGPR

(Continued)

126

TABLE 6.1 Numerous classified mechanisms by PGPR co-inoculation and their effect on different plants. (Cont.) Rhizobium PGPR co-inoculants species

Other mechanisms

A. brasilense (Sp7)

Plant

Results obtained on co-inoculation

References

R. leguminosarum bv. viciae (Rlv)

Vicia sativa L.

Co-inoculation increased nodule weight and plant dry weight up to 32 and 14%, respectively, compared to control

Star et al. (2012)

Serratia marcescens

Bradyrhizobium spp.

Arachis hypogaea L.

The combined inoculation increased nodule weight up to 178% over control

Badawi, Badawi, Biomy, & Desoky, (2011)

Pseudomonas sp. FM7d and Bacillus sp. M7c

Sinorhizobium meliloti B399

Medicago sativa L.

Co-inoculation increased nodule weight and root and shoot weight up to 1.4-, 1-, and 1.3-fold compared to control

Guiñazu, Andres, DelPapa, Pistorio, & Rosas, (2010)

Pseudomonas putida strain Å 313

R. leguminosarum bv. viciae

Pisum sativum L.

Mixed inoculation gave a higher proportion of small evenly distributed nodules when compared with a single rhizobial inoculation

Berggren, Alstrom, van Vuurde, & Martenson, (2005)

C. balustinum Aur9

R. tropici CIAT899 R. etli ISP42; E. fredii SMH12 and HH103

Phaseolus vulgaris L.

Dual inoculation resulted in an improved nodule primordia formation when compared with single inoculation

Estévez, Dardanelli, & Megías, (2009)

Agrobacterium sp. 10C2

E. meliloti RCR 2011 and A321

Phaseolus vulgaris L.

Co-inoculation increased shoot dry weight with both strains and enhanced nodule number

Salem, Saidi, Chihaoui, & Mhamdi, (2012)

Pseudomonas sp. strains (NARs1, PGERs17)

R. leguminosarum -PR1

Lens culinaris L.

Increase in nodulation 27.5%, leghemoglobin content 45.9%, total iron 115.7%, N uptake 52.1%, total chlorophyll content 21.3% and P uptake 88.9% on co-inoculation over R. leguminosarum -PR1 alone

Mishra et al. (2011)

Recent Advancements in Microbial Diversity

Mechanism of PGPR

Mechanism of PGPR

Rhizobium PGPR co-inoculants species

References

Serratia B. japonicum proteamaculans 1–102, USDA 110 S. liquefaciens 2-68

Glycine max L.

Combined inoculation of S. proteamaculans 1–102 plus B. japonicum USDA 110 had most stimulatory effect in term of fixed N (86%) in comparison to control

Dashti, Prithiviraj, Zhou, Hynes, & Smith, (2000)

Bacillus thuringiensis -KR1

B. japonicum -SB1

Glycine max L.

Co-inoculation provided the highest increase in nodule number, shoot weight, and root weight up to 73%, 47% and 40% respectively, over rhizobial inoculation and control, under in vitro conditions

Mishra et al. (2009b)

Chryseobacterium balustinum Aur9

Rhizobium tropici CIAT899 and R. etli ISP42; Ensifer fredii SMH12 and HH103

Glycine max L.

Double inoculation (E . fredii SMH12 and C. balustinum Aur9) showed better symbiotic performance, than with a single inoculation

Estevez et al. (2009)

Azospirillum canadense

B. japonicum

Glycine max L.

Increase in total plant biomass of soybean (root + shoot) was observed with the double inoculation of Azospirillum and Bradyrhizobium compared to control

Juge, Prévost, Bertrand, Bipfubusa, & Chalifour, (2012)

B. subtilis

B. japonicum , 532c and RCR 3407

Glycine max L.

Dual inoculation increased the fresh weight of nodule by up to 4 g plant–1

Atieno, Herrmann, Okalebo, & Lesueur, (2012)

Pseudomonas striata Rhizobium sp. or Penicillium variable

Cicer arietinum L.

The co-inoculation increased plant dry matter, nodule number and weight i.e., 87%, 181% and 188%, respectively in comparison to Rhizobium sp. treatment only

Zaidi, Khan, & Amil, (2003)

Bacillus sp. strains CBS106, CBS127, and CBS155

Cicer arietinum L.

Combined inoculation resulted in an increased shoot dry weight and nodule fresh weight up to 73 and 51%, respectively, compared to Mesorhizobium treatments alone

Sivaramaiah, Malik, & Sindhu, (2007)

Mesorhizobium sp. Cicer strain Ca181

127

Results obtained on co-inoculation

Multifaceted beneficial effects of plant growth promoting bacteria Chapter | 6

Plant

128

Recent Advancements in Microbial Diversity

7  Establishment of additional infection sites Roots are the beginning point for the nodule formation. So, any stimulus that augments root growth may result in creating more sites for rhizobial colonization sites (Fox et al. 2011). Research studies show that growth as well as yield of legumes could be increased by developing or creating additional infection sites through inoculating rhizobia in combination with rhizosphere bacteria with beneficial traits (Plazinski & Rolfe, 1985; Yahalom, Okon, & Dovrat, 1987; Yahalom, Okon, & Dovrat, 1990). A study by Tchebotar, Kang, Asis, & Akao (1998), observed that mixed inoculation of rhizobia with Azospirillum lipoferum resulted in creation of numerous infection sites that were then later occupied by rhizobia. Also, in another study by Garcia et al. (2004a), they found that co-inoculation of PGPR (i.e., Pseudomonas fluorescens, Chryseobacterium balustinum, and Serratia fonticola) with Sinorhizobium fredii had prominent effects on the yield of soybean cv. Osumi. They explained that the increase in the infection sites and its availability for Rhizobium infection can be a result of the beneficial effect exerted by the Rhizobacteria in order to improve the Rhizobium-legume symbiotic realtionship. Tilak, Ranganayaki, & Manoharachari (2006) also showed that inoculation of PGPR in combination with the efficient Rhizobium affects the growth, yield as well as nitrogen fixation capacity in pigeon pea by increasing the infection sites for Rhizobium in the plant nodules. Another investigation by Elkoca and his colleagues (2008) showed a considerable increase in dry weight of root and yield of chickpea seeds due to dual inoculation of Rhizobium with Bacillus subtilis OSU- 142 and Bacillus megaterium M-3 and according to them the reason for the increase in plant root growth was added to the number of potential colonization sites. Enhanced root infection by the rhizobia alongwith increased nodule initiation rate was observed by Fox et al. (2011) in Medicago truncatula cv. Caliph when the plant was co-inoculated with Ensifer (Sinorhizobium) medicae WSM419 and P. fluorescens WSM3457. In another analysis done by Tsigie et al. (2011); it was reported that the nodule number and biomass was significantly influenced by inoculation of soybean cultivar Pusa 22 with PGPR in combination with B. japonicum strains SB 271. The reason behind this significant increase was explained due to the IAA production by rhizobacteria which enhanced root hair formation. So, from numerous evidences finally, it was concluded that root hairs are infection sites for rhizobia and the increase in root nodulation may be a result of increased number of infection sites which may further explain the underlying the mechanism for augmenting the nitrogen fixation ability by legumes. So therefore, it could be concluded that using PGPR as co-inoculant alongwith Rhizobium could really be effective for Rhizobiumlegume symbiosis through enhancing the infection sites but further validation is needed by extensive studies.

Multifaceted beneficial effects of plant growth promoting bacteria Chapter | 6

129

8  Release of plant growth-promoting substances The rhizospheric bacteria are considered beneficial as they have the special ability of producing phytohormones and other plant growth-promoting substances. Introduction of such bacteria in agriculture can reduce the usage of chemical fertilizers and can reduce the damage they pose thus supporting ecofriendly legume production. It has been discovered so far, that some bacteria living in the rhizosphere are capable of promoting root nodule formation and nitrogen fixation when they are co-inoculated with rhizobia (De Freitas, Gupta, & Germida, 1993; Zhang, Dashti, Hynes, & Smith, 1996; Dashti, Zhang, Hynes, & Smith, 1998) directly or indirectly via systemic induction of secondary metabolites such as flavonoids (Andrade, De Leij, & Lynch, 1998; Schultze & Kondorosi, 1998), tabtoxinine-beta-lactam (Knight & LangstonUnkefer, 1988), and B-group vitamins (Marek-Kozaczuk & Skorupska, 2001) and release of phytohormones such as auxins, cytokinin, ethylene, and gibberellins (Garcia et al. 2004b). A study conducted by Chebotar et al. (2001) showed that the biological nitrogen fixation levels of soybean increased drastically when co-inoculated with B. japonicum A1017 and P. fluorescens 2137 due to the highly colonizing capability of P. fluorescens 2137 and synthesis of growth promoting compound. Another report by Zaidi et al. (2004) illustrated that the considerable increase observed in yield and root nodule formation of green gram when treated with a mixed inoculant of Pseudomonas striata or Penicillium variable with Bradyrhizobium sp. was likely to be due to the release of growth promoting substances. Analysis done by MarekKozaczuk et al. (2000) showed an improvement in clover growth when coinoculated with Rhizobium leguminosarum by. trifolii strain 24.1 and P. fluorescens strain 267 due to secretions of several B-group vitamins. Several studies have revealed that PGPR improvises the release of flavonoids when used in together with Rhizobium thereby increasing nodulation of leguminous plants. For example, increase in the weight of nodule, length of root, total nitrogen content and shoot biomass were observed when chickpea was co-inoculated with Rhizobium strains along with Pseudomonas and Bacillus species (Parmer & Dadarwal, 1999). Somewhat similar results like increased plant dry weight and nodule number were obtained when green gram was co-inoculated with Pseudomonas strains and Bradyrhizobium strain S24 (Malik & Sindhu, 2008). Likewise, when Vicia sativa (vetch) was co-inoculated with R. leguminosarum bv. viciae (Rlv) and wild-type strain (Sp7) or mutant strains (napA−, acdS+ and ipdC−) of Azospirillum brasilense in pots, in pouches and in hydroponic system there was a considerable rise in nodulation (Star et al., 2012) due to high plant root flavonoids production. Valverde et al. (2006) made an inference that phytohormones produced by Pseudomonas jessenii PS06 are responsible for the increase in size of the nodule, weight, N contents in shoot, and yield of chickpea seeds when Mesorhizobium ciceri C-2/2 was co-inoculated

130

Recent Advancements in Microbial Diversity

with Pseudomonas sps. Another research group, Pan, Vessey, & Smith (2002) revealed that when PGPR was co-inoculated in combination with rhizobia, it often resulted in overall growth of plant resulting from the phytohormonal interactions among the plant and rhizobia. Dardanelli et al. (2008) observed that co-inoculation of R. tropici strain CIAT899 with A. brasilense, or R. etli ISP42 on P. vulgaris cv. Negro jamapa plant had beneficial effect at the level of development of roots and also nitrogen fixation due to the IAA (indole-3-acetic acid)production by Azospirillum. Analysis done by Mishra et al. (2009a) showed an elevated and most regular increase in level of nodulation, shoot dry weight, root volume of soybean and root fresh weight through the synthesis of IAA when Bradyrhizobium japonicum -SB1 was co-inoculated with Bacillus thuringiensis-KR1. Malik and Sindhu (2011) also suggested that IAA production by Pseudomonas strains enhances nodule formation and stimulates plant growth, while studying the effects of co-inoculation of Mesorhizobium sp. Cicer strain Ca181 and Pseudomonas sp. on chickpea. Another study by Garcia et al. (2004b) reported major effects of auxin on growth parameters of Glycine max cv. Osumi (soybean) when S. fredii was co-inoculated with three PGPR. Co-inoculation of B. japonicum E109 with A. brasilense Az39 is responsible in promoting germination of seeds, early development and nodulation of soybean seedlings due to biosynthesis of various plant hormones such as IAA, gibberellic acid, and zeatin by bacteria was reported by Cassan et al. (2009). Synthesis of indole lactic acid and gibberellic acid by A. brasilense when co-inoculated with B. japonicum on soybean stimulated the growth of roots was observed by Molla, Shamsuddin, Halimi, Morziah, & Puteh (2001a). Likewise, Wani, Khan, & Zaidi (2007a) demonstrated that nodulation, growth, and chickpea yield significantly increased due to the synthesis of growth promoting substances like auxins and gibberellins when PSP 9 strain of Bacillus spp. was used as coinoculant with Rhizobium. Egamberdieva, Berg, Lindström, & Räsänen (2010) reported that the production of Indole-3-acetic acid/cellulose by Pseudomonas strains when co-inoculated with R. galegae bv. orientalis HAMBI 540 resulted in increased nodulation, shoot and root growth, and N content of root and shoot of Galega orientalis. Therefore, abundant studies done so far conclude that PGPR promotes Rhizobium-legume interactions, by acting as “rhizobium helper bacteria.” Thus, it is concluded that Rhizobia in combination with PGPR could further pump up the growth and performance of legumes via production of substances that promote plant growth.

9  Biological nitrogen fixation (BNF) In order to determine the BNF potential of a particular inoculant strain, number of nodules has been considered as a good measure to rely on. Several research studies have reported that PGPR enhanced the process of nodulation thereby enhancing symbiotic nitrogen fixation ability when inoculated along with

Multifaceted beneficial effects of plant growth promoting bacteria Chapter | 6

131

rhizobial strain (Yahalom et al., 1987; Zhang et al., 1996). Therefore, PGPR strains that are capable of producing greater nodulation and hence greater BNF when co-inoculated with rhizobia have been receiving much more attention, in order to improve nitrogen availability for sustainable agriculture (Bai, et al. 2002; Abdel-Wahab, Mekhemar, Badawi, & Shehata, 2008). Alagawadi and Gaur (1988) reported that by increasing the nitrogenase enzyme activity as well as root nodulation certain PGPR when co-inoculated with Bradyrhizobium positively affect symbiotic biological nitrogen fixation. Also, an increase in BNF and grain yield of various legumes was shown when PGPR was inoculated in combination with Rhizobium/Bradyrhizobium spp. (Valverde et al., 2006; Yadegari, Rahmani, Noormohammadi, & Ayneband, 2008). Similarly, Verma et al. (2012) inferred that enhanced fixation of atmospheric nitrogen in chickpea was because of significant increase in its root nodule number and dry matter due to co-inoculation of P. fluorescens BHUPSB06 and Mesorhizobium sp. BHURC02. Co-inoculation of soybean with PGPR [at an optimal dosage (1 × 108 cells per seedling)] and rhizobia resulted in increased nodule number, plant dry weight, and efficient nitrogen fixation as reported by Bai et al. (2002). Wasule, Wadyalkar, & Buldeo (2003) showed that co-inoculation of soybean with B. japonicum and phosphate-solubilizing P. striata resulted in rise of the dry weight of its root nodules. Similarly, combined inoculation of endophytic bacteria/PGPR with rhizobia resulted in an increase in fresh weight of root nodules and BNF potential of soybean when grown under greenhouse conditions (Atieno et al. 2012; Soe et al. 2012). Analysis by Remans et al. (2008) showed that co-inoculation of Azospirillum - Rhizobium increased BNF capacity and also the level of total nitrogen obtained by nitrofen fixation from common bean genotype DOR364 when grown in different environments in comparison with Rhizobium treatment alone. Figueiredo, et al. (2008) reported greater level of nitrogen due to increased root nodulation in common bean when Paenibacillus polymyxa DSM 36 when co-inoculated with R. tropici CIAT899. Analysis done separately by Rajendran et al. (2008) and Roseline et al. (2008) showed enhanced nitrogen fixation and root nodules formation in pigeon pea when Bacillus sp. and Azospirillum sp. were added together with the rhizobial inoculants. Marek-Kozaczuk, Derylo, & Skorupska (1996) and Derylo and Skorupska (1993) in separate studies reported that symbiotic nitrogen fixation and growth of clover infected with R. leguminosarum bv. trifolii strain 24.1 significantly improved by P. fluorescens strain 267 under gnotobiotic conditions, whereas analysis done by Chanway, Hynes, & Nelson (1989) showed that Pseudomonas strains having ability of promoting plant growth when given in combination with rhizobial strains enhanced the BNF potential and growth of lentils and pea cultivars in different field and laboratory conditions. In entirety, the above discussion emphasizes that PGPR could act as an effective stimulator of growth, development and yield of legumes when used together with rhizobia by improving fixation of atmosphere nitrogen by them.

132

Recent Advancements in Microbial Diversity

10  Decreasing ethylene level (ACC deaminase) Ethylene is considered as an important plant hormone that plays prominent role in the regulation of many physiological responses (Reid, 1995). Many plant species need ethylene specifically for seed germination. Generally, the rate of production of ethylene shoots up high during germination and seedling growth (Abeles, Morgan, & Saltveit, 2012). Usually, at lower level it shows up enhanced root initiation and growth, but higher level of ethylene can lead to suppression of elongated roots (Shaharoona et al. 2006). An analysis done by Arshad and Frankenberger (2002) revealed that any stimulus that is capable of changing the endogenous ethylene level in plants could result in their modified growth and development. The concentration of ACC (1-aminocyclopropane-1-carboxylic acid) which is ethylene precursor and derived from methionine in plants (Yang & Hoffman, 1984) directly controls the synthesis of ethylene in plants (Machackova, Chavaux, Dewitte, & Onckelen, 1997). ACC deaminase enzyme present in certain microorganisms hydrolyze ACC into α-ketobutyrate and ammonia (Shaharoona et al., 2006). Hence, the rhizobacteria containing ACC-deaminase can reduce the amount of ACC production thus resulting in reduced level of ethylene, outside the germinating seeds which thereby excludes the potential halting effect of higher ethylene concentrations (Glick, Pentrose, & Li, 1998). Therefore, PGPR synthesizing ACC deaminase and present on the roots of leguminous plant infected by rhizobia could decrease the endogenously produced ethylene and could help in increased root nodulation, growth and yield. Holguin and Glick (2001) demonstrated that there is an increase in root elongation and plant growth when there is reduced ethylene synthesis due to the release of ACC deaminase by various PGPR in the rhizosphere. Iqbal et al. (2012) reported that co inoculation of lentil grains with R. leguminosarum and PGPR Pseudomonas spp. having ACC deaminase activity resulted in reduced ethylene levels and also increased nitrogen content, grain and straw yield and improved nodulation and nodule dry weight. Likewise, Babar, Mirza, Bano, & Malik (2007) also reported that co-inoculation with ACC deaminase containing strains of Rhizobium and Enterobacter resulted in improved nodulation of chickpea due to adjustment of the ethylene levels in legumes. Analysis by Zahir et al. (2011) also showed that P. jessenii containing ACC deaminase adjusted the ethylene levels and improved growth, nodulation and yield of lentil when co-inoculated with Rhizobium. Similarly, Ahmad, Zahir, Asghar, & Asghar (2011), while studying the combined effects of PGPR strains containing ACC deaminase coinoculated with Rhizobium phaseoli on mung bean explained that augmented root and shoot growth could be due to reduction in ethylene levels by the PGPR inoculant. Briefly, ACC deaminase containing PGPR strains could be beneficial for use as a successful coinoculant because of having the special ability of lowering the ethylene levels and thereby improving the growth as well as yield of legumes.

Multifaceted beneficial effects of plant growth promoting bacteria Chapter | 6

133

11  Nutrient solubilisation and its uptake by plants Typically, plant growth could be achieved by directly applying nutrients or helpful bacteria to the seed (Linderman, 1994). But as PGPR are efficient to colonize plant roots through elevated mobilization of insoluble nutrients and their increased uptake by plants (Richardson, Barea, McNeill, & PrigentCombaret, 2009; Adesemoye Torbert, & Kloepper, 2010), using them can be an eco-friendly and sustainable crop production alternative to chemical fertilizers (Requena, Jimenez, Toro, & Barea, 1997). Thus utilizing a combination of microbial mixture has attained greater interest in past years (Bashan & De-Bashan, 2005). It has generally been observed that using mixed inoculants provide superior nutritional balance and increases the uptake of N, P, K, and microelements by plants (Dobbelaere & Okon, 2007) and thus promotes greater development, growth and health of plant (Sindhu, Suneja, Goel, Parmar, & Dadarwal, 2002; Rosas, Andrés, Rovera, & Correa, 2006). However, it is very important to ensure the PGPR is compatible with host specific rhizobia so that they have positive effect on symbiotic performance and plant growth (Egamberdieva et al., 2010). Generally, PGPR efficiently enhance the plant’s capacity of nutrient uptake from the soil by either improving the plants root system or by solubilizing insoluble nutrients so that plant can easily uptake the nutrients made available by them (Bucio et al., 2007). Analysis by Rodelas, González-López, Martínez-Toledo, Pozo, & Salmerón (1999) indicated that manipulation of nodulation and uptake of nutrient other than nitrogen can be achieved when Rhizobium is co-inoculated with some other PGPR. Gull, Hafeez, Saleem, & Malik (2004) reported that coinoculation of phosphate solubilizing bacteria (PSB) with Rhizobium helped improved the growth and yield as well as root nodulation and nitrogen fixation potential of chickpea which may be possibly due to better phosphorus uptake by PSB. A study by Wani et al. (2007b) explained that the increase in P uptake by chickpea plants when inoculated with phosphate-solubilizing strain of Bacillus sp. and nitrogen-fixing Mesorhizobium sp. probably resulted in significant growth and development of chickpea plant. Likewise, another study showed that combined inoculation of chickpea plant with Rhizobium and PSB enhanced its growth thus increasing its yield by providing a much more balanced nutrition (Rudresh, Shivaprakash, & Prasad, 2005). Analysis by Radwan, Dashti, & El-Nemr (2005) were also in agreement about PGPR that are capable of mobilizing insoluble nutrients when used as co-inoculants with R. leguminosarum,P. aeruginosa and S. liquefaciens causing an enhanced uptake of nutrients by the Vicia faba growing in clean sandy soil. A similar increase was observed by Anandham et al. (2007) in root nodule formation, its dry weight, and biomass of groundnut cv. ALR-2 plant when co-inoculated with sulfur-oxidizing Thiobacillus sp. strain LCH and Rhizobium sp. strain TNAU14 that is not having S or thiosulfate oxidation property. The observed increases were credited to the overall effects, such as increase in the supply

134

Recent Advancements in Microbial Diversity

of S, N and P and some other insoluble nutrients that are made available in the rhizosphere by the specialized bacteria. Likewise, Elkoca, Turan, & Donmez (2010) also obtained considerable improvement in growth and yields of Phaseolus vulgaris when co-inoculated with R. leguminosarum in combination of P-solubilizing B. subtilis or B. megaterium. They explained that B. subtilis was of significant importance due to the potential of providing a much more efficient and balanced nutrition to plants as compared to individual inoculations. Studies done by Mishra et al. (2012) reported an increase in root nodulation, chlorophyll levels, leghemoglobin content and total iron content of lentil plant alongwith increase in P and N uptake when Pseudomonas spp. was co-inoculated with R . leguminosarum -PR1. They suggested a strong cooperative relationship between Pseudomonas sp. strain NARs1 and R. leguminosarum- PR1. They further explained that the increase in the nutrient uptake by the plantlets was mainly due to auxin production by the PGPR which stimulates root growth, thereby resulting in an increased uptake of nutrients from the soil. Zaidi et al. (2003) used different combination of dual inoculants such as Rhizobium sp. + P. striata, Rhizobium sp. + P. variable, and Rhizobium sp. + Glomus fasciculatum and recorded that in comparison to single inoculation an increased N and P contents was seen in straw and grains of chickpea that was grown in a sandy loam soil that was deficient in phosphorus. In his another experiment, Zaidi et al. (2004) suggested that in order to enhance the yield of green gram; root nodulation and uptake of nutrients by plant could be enhanced by introducing synergistically interacting rhizospheric bacteria in combination with rhizobia. Analysis by Belimov, Kojemiakov, & Chuvarliyeva (1995) inferred that instead of single inoculation, using combined inoculations of P-solubilizing and N2 -fixing bacteria was much more promising and effective in providing stable nutrition to plants. It can be concluded from the above discussions, that PGPR when used in combination with rhizobia promotes the ability of legumes to obtain nutrients from soil by either increasing nutrient availability or by improving the root system.

12  Siderophore production Iron is the fourth abundant transition element on earth’s crust, but still bioavailability is low as the ionic concentrations of Fe3+ and Fe2+ remains to be low as it is less soluble. Various organisms (bacteria and fungi) have evolved mechanisms to overcome this scarcity by producing siderophores which are a low molecular weight (400-1500 Da) iron chelating peptidic molecules due to their remarkable ability to form stable and soluble complexes with iron and transport them in to their cells. Presence of side chains along with functional groups make them high affinity ligands that bond with ferric ions (Crosa & Walsh, 2002) thus are able to correct the iron availability in the rhizosphere (Loper and Henkels, 1999). So, when plants are under stress due to poor availability of iron, the siderophore-producing rhizospheric microorganisms can chelate iron

Multifaceted beneficial effects of plant growth promoting bacteria Chapter | 6

135

by forming complexes and provide it to plants thus improving their growth. It has been discovered that special receptor or channels are present on plants for receiving microbial siderophore and enzyme ferric reductase is present to separate iron from siderophore and convert it into usable ferrous form, (Duffy & Défago, 1999; Masalha, Kosegarten, Elmaci, & Mengel, 2000). Analysis done by Parmar and Dadarwal (1999) on the effects of rhizobacterial inoculation on chickpea showed a relationship between production of siderophore and the level of induction of flavonoid-like compounds in the root, with an overall significant increase in total plant nitrogen content in chickpea. Similarly, Wani et al. (2007a) showed a considerable increase in the yield of chickpea and its phosphorus and nitrogen uptake when Mesorhizobium was inoculated in combination with P-solubilizing Bacillus and Pseudomonas spp. There explanation for this observation was that the bacterial cultures produced significant amount of siderophore which could have resulted in the stimulated chickpea growth. Rajendran et al. (2008) in their study used three Bacillus strains, NR2, NR4, and NR6 for inoculation in combination with Rhizobium spp. strain IC3123 and reported that the growth of pigeon pea was promoted with considerable rise in fresh weight of the plant, chlorophyll content, nodulation, and fresh weight of nodule. The possible explanation given was that siderophore- mediated interactions could be the mechanism underlying the beneficial effect of the NR isolates on nodulation by IC3123. Another research by Gupta, Saxena, Gopal, & Tilak (1998) inferred that using Bradyrhizobium strains in combination with siderophore producing Enterobacter isolates increased occupancy of the nodule by Bradyrhizobium strains allowing them to successfully occupy the nodulation sites. Hence, various studies did so far report that siderophore-producing PGPR strains can be subjected as co-inoculants with rhizobia to bring enhancement in growth and development of legumes.

13  Biological control PGPR indirectly affects the growth of plant by the suppressing the growth of phytopathogens, as phytopathogens are a chronic threat to sustainable agriculture and degrade soil fertility disrupting the environment and having harmful effects on human health. Indirect mechanisms by PGPR include induced systemic resistance (ISR), production of metabolites (Siderophores, Hydrogen cyanide, etc), antibiosis, parasitism, competition for nutrients and expression of lytic enzymes (Lugtenberg & Kamilova, 2009). Study done by Kloepper (1993) inferred that PGPR mostly act as biological control agent when inoculated with rhizobia. Analysis was done by Villacieros et al. (2003), to study the colonization of Sinorhizobium meliloti and P. fluorescens in the rhizospheric region of alfafa, which explained the efficacy of the strains for biocontrol. Another study by Pathak et al. (2007) reported that the collective effect of Pseudomonas maltophilia, Mesorhizobium and PSB was more advantageous as it decreased the incidence of root rotting and also significantly increased the nodule number,

136

Recent Advancements in Microbial Diversity

nodule biomass, and nodule occupied sites as well as growth of chickpea cv. H208 which in turn augmented seed productivity. In the same way, Sindhu and Dadarwal (2001) also reported that Mesorhizobium when co-inoculated with PGPR resulted in repression of disease in plant by growth inhibition of phytopathogenic fungi and endorsing nodulation. Hameeda et al. (2010) also reported that combined inoculation of Rhizobium sp. IC 76 and IC 59 and Pseudomonas sp. CDB 21 and BWB 35 decreased the incidences of collar rot disease by Sclerotium sps. Whereas, Kumar et al. (2001) investigated the consequences of co-inoculation of pea with fluorescent PGPR Pseudomonas and Rhizobium, and observed that the strains were highly inhibitory to the investigated plant pathogens causing fusarium wilt. Likewise, Sindhu et al. (2002) reported that using Pseudomonas strains co-inoculant with Mesorhizobium sp. repressed growth of pathogens causing disease in chickpea i.e., Aspergillus sp., Curvularia sp., Fusarium oxysporum, and Rhizoctonia solani. The PGPR has potential of producing one or more than one antibiotic acts as antagonistic agents against phytopathogens (Glick, Cheng, Czarny, & Duan, 2007). Similarly, Tilak et al. (2006) experienced a significant rise in plant growth, nodulation, and in the activity of nitrogenase enzyme due to dual inoculation of Rhizobium with PGPR Bacillus cereus, P. fluorescens and Pseudomonas putida and also showed that the nodule occupied sites of Rhizobium was increased due to induced systemic resistance (ISR) by PGPR against phytopathogens in host plant. So as to achieve protection against the plant pathogens and to improve yield and growth of legumes, PGPR having capability to biologically control pathogens can be co-inoculated with rhizobia.

14  Improved water-use efficiency PGPR also have the remarkable ability of increasing the water use efficiency (WUE) in plants that are under stress thereby using them as co-inoculants along with rhizobia may improve the plant growth as well as its yield (Vivas, Barea, Biro, & Azcon, 2006). Ahmad et al. (2011) reported that combined inoculation of R. phaseoli with Pseudomonas sp. augmented water-use efficiency and relative water content of mung bean. They explained that the observed increase in water-use efficiency might be because of longer roots of plants which could have helped them to go deeper in to the soil and uptake comparatively larger volume of water under stressed conditions. Rosas et al. (2006) showed that co-inoculation of leguminous seeds with rhizobia and phosphate-solubilizing Pseudomonas sp. has augmented the growth of legumes and their yield following an increase in water and nutrients uptake, early and increased root nodulation and higher nitrogenase enzyme activity by the roots. On the whole, enhancement in water-use efficiency in leguminous plants co-inoculated with PGPR and rhizobia could be demonstrated as a gain; however, before coming to a firm conclusion there is still a lot to explore using effective combinations of PGPR and rhizobia.

Multifaceted beneficial effects of plant growth promoting bacteria Chapter | 6

137

15 Conclusion It has been observed that hill agriculture is slowly expanding in favour of fruits, pulses and vegetables. Hill states have potential for production of pulses, crops and vegetables in off-season that has higher demand in neighboring plains when there is scarcity of supply. The canonical approach to augment the agricultural output of hilly areas through massive inputs of chemical fertilizers/pesticides is not sustainable because of high costs and concerns about global warming, environmental pollution, and safety. Therefore, the hunt for microbes that improve soil health and also in addition augment plant nutrition has become imperative for researchers due to the high cost of fertilizers and their detrimental effects on the environment. Legumes as already discussed in this book chapter have been an essential part of agriculture for generations because of their remarkable property of fixing atmospheric nitrogen and their capability to curtail the impacts of disease, pests, and soil infertility when used in rotation with crops. Growing of legumes in hills can be seen as a profitable venture as demand for quality-based products that can be produced on a greater scale in hill ecosystem is rising rapidly. Hill agriculture has several niche areas having comparative advantage for better exploitation of resources for better agriculture thus encouraging a better livelihood opportunity and offering tremendous scope for enhancing the farm income. So, in order to increase the legume production in these areas, rhizobial inoculants may to a great extent contribute to N2-fixation by legumes if suitable strains are applied that nodulate their host efficiently and suit their edaphic environment. For a more thorough enlargement and employment of rhizobial inoculants, there are several issues/recommendations which are needed to be taken care of in future research. The collection of rhizobial effects and functions mentioned before in this book chapter clearly suggests that they would be promising to increase crop yield, remove contaminants, inhibit pathogens, and produce fixed nitrogen or novel substances if we are able to manage helpful communities to favor plant colonization by rhizobial bacteria. It also demonstrates that switching from chemical fertilizers to biofertilizers, will in turn help to reduce the major global problem of environmental pollution and also fetch finest in the agriculture market. In those regions where legumes do not respond to inoculation with rhizobia, co-inoculant PGPR may be used as an alternative for the augmenting the crop production. Co-inoculation with other PGPR is an efficient strategy that would have better prospects to act synergistically with rhizobia for better productivity of legumes compared to simple inoculation under sustainable agriculture system. Moreover, there are commercial inoculant products beginning to emerge that could prove useful in a commercial agriculture setting. Exploitation of multifunctional microbial inoculants seems feasible to enable plants to survive under stress conditions/ environments. Nitrogen fixation is a biologically important process on earth and exploring the potential of legume/ rhizobia interaction may prove helpful to sustain agriculture in hills.

138

Recent Advancements in Microbial Diversity

16  Future perspectives Various studies stated above reveal that cultivation of legumes in hills has great potential for nitrogen fixation and soil fertility improvement. Though this ability is greatly influenced by variation in cropping pattern, plant phenology and other environmental factors, yet their incorporation into farming system, for agriculture can provide ecological stability to fragile rainfed agriculture land of hilly region and can orient hill farming towards sustainability. The foundation of any agricultural system depends exclusively on its sustainability. So, biological nitrogen fixation, particularly by cultivated legumes can help in maintaining a productive and sustainable agriculture system in these areas. The use of legume crops in farming system is an eco-friendly and profitable approach to arrest the decline in soil fertility. In addition, comprehensive studies on the analysis of nodulation kinetics by rhizobium are needed which could enable to explore the role of specific substances as signals or molecular components involved in the nodulation process. Further, various ways in which PGPR may communicate with the plant to augment their growth and interfere with each other when used in consortium needs to be elucidated to harness the real potential of multi-strain inoculants. Studies on characterization of the interaction between sets of PGPR and rhizobia under various ecological soil environments of hilly areas and the changes in metabolic activities caused by co-inoculants affecting plant performance are also needed to be researched for achieving commercially realistic and effective co-inoculants.

References Abdel-Wahab, A. F. M., Mekhemar, G. A. A., Badawi, F. S. F., & Shehata, H. S. (2008). Enhancement of nitrogen fixation, growth and productivity of Bradyrhizobium -lupinus symbiosis via co-inoculation with rhizobacteria in different soil types. Journal of Agricultural Science, Mansoura University, 33, 469–484. Abeles, F. B., Morgan, P. W., & Saltveit, M. E., Jr. (2012). Ethylene in plant biology. Academic Press. Adesemoye, A. O., Torbert, H. A., & Kloepper, J. W. (2010). Increased plant uptake of nitrogen from 15N-depleted fertilizer using plant growth-promoting rhizobacteria. Applied Soil Ecology, 46(1), 54–58. Ahmad, M., Zahir, Z. A., Asghar, H. N., & Arshad, M. (2012). The combined application of rhizobial strains and plant growth promoting rhizobacteria improves growth and productivity of mung bean (Vigna radiata L.) under salt-stressed conditions. Annals of Microbiology, 62(3), 1321–1330. Ahmad, M., Zahir, Z. A., Asghar, H. N., & Asghar, M. (2011). Inducing salt tolerance in mung bean through coinoculation with rhizobia and plant-growth-promoting rhizobacteria containing 1-aminocyclopropane-1-carboxylate deaminase. Canadian Journal of Microbiology, 57(7), 578–589. Alagawadi, A. R., & Gaur, A. C. (1988). Associative effect of Rhizobium and phosphate-solubilizing bacteria on the yield and nutrient uptake of chickpea. Plant Soil., 105, 241–246. Anandham, R., Sridar, R., Nalayini, P., Poonguzhali, S., & Madhaiyan, M. (2007). Potential for plant growth promotion in groundnut (Arachis hypogaea L.) cv. ALR-2 by co-inoculation of sulfur-oxidizing bacteria and Rhizobium. Microbiological Research, 162(2), 139–153.

Multifaceted beneficial effects of plant growth promoting bacteria Chapter | 6

139

Andrade, D., De Leij, F. A. A. M., & Lynch, J. M. (1998). Plant mediated interactions between Pseudomonas fluorescens, Rhizobium leguminosarum and arbuscular mycorrhizae on pea. Letters in Applied Microbiology, 26, 311–316. Antoun, H., & Prevost, D. (2005). Ecology of plant growth promoting rhizobacteria. In Z. A. Siddiqui (Ed.), PGPR: Biocontrol and biofertilization (pp. 1–39). The Netherlands: Springer. Atieno, M., Herrmann, L., Okalebo, R., & Lesueur, D. (2012). Efficiency of different formulations of Bradyrhizobium japonicum and effect of co- inoculation of Bacillus subtilis with two different strains of Bradyrhizobium japonicum. World Journal of Microbiology & Biotechnology, 28, 2541–2550. Babalola, O. O. (2010). Beneficial bacteria of agricultural importance. Biotechnology Letters, 32, 1559–1570. Babar, S. M., Mirza, M. S., Bano, A., & Malik, K. A. (2007). Co-inoculation of chickpea with rhizobium isolates from roots and nodules and phytohormone producing Enterobacter strains. Australian Journal of Agricultural Research, 47, 1008–1015. Badawi, F. S. F., Biomy, A. M. M, & Desoky, A. H. (2011). Peanut plant growth and yield as influenced by co-inoculation with Bradyrhizobium and some rhizo-microorganisms under sandy loam soil conditions. Annals of Agricultural Sciences, 56(1), 17–25. Pan, B., Charles, T. C., & Smith, D. L. (2002). Co-inoculation dose and root zone temperature for plant growth promoting rhizobacteria on soybean [Glycine max L.Merr] grown in soil-less media. Soil Biology and Biochemistry, 34, 1953–1957. Bai, Y., Souleimanov, A., & Smith, D. L. (2002). An inducible activator produced by a Serratia proteamaculans strain and its soybean growth-promoting activity under greenhouse conditions. Journal of Experimental Botany, 53, 149–502. Bashan, Y., & De-Bashan, L. E. (2005). Plant growth-promoting. Encyclopedia of Soils in the Environment, 1, 103–115. Belimov, A. A., Kojemiakov, A. P., & Chuvarliyeva, C. N. (1995). Interaction between barley and mixed cultures of nitrogen fixing and phosphate-solubilizing bacteria. Plant and Soil, 173(1), 29–37. Berggren, I., Alstrom, S., van Vuurde, J. W. L., & Martenson, A. M. (2005). Rhizoplane colonisation of peas by Rhizobium leguminosarum bv. viceae and a deleterious Pseudomonas putida. FEMS Microbiology Ecology, 52, 71–78. Bhattacharyya, P., & Jha, D. (2012). Plant growth-promoting rhizobacteria PGPR: emergence in agriculture. World Journal of Microbiology and Biotechnology, 1–24. Bisht, I. S., Rao, K. S., Bhandari, D. C., Nautiyal, S., Maikhuri, R. K., & Dhillon, B. S. (2006). A suitable site for in situ on-farm management of plant diversity in traditional agroecosystems of western Himalaya in Uttaranchal state: A case study. Genetic Resources and Crop Evolution, 537, 1333–1350. Cassan, F., Perrig, D., Sgroy, V., Masciarelli, O., Penna, C., & Luna, V. (2009). Azospirillum brasilense Az39 and Bradyrhizobium japonicum E109, inoculated singly or in combination, promote seed germination and early seedling growth in corn Zea mays L. and soybean Glycine max L. European Journal of Soil Biology, 45, 28–35. Chanway, C. P., Hynes, R. K., & Nelson, L. M. (1989). Plant growth-promoting rhizobacteria: effects on growth and nitrogen fixation of lentil Lens esculenta Moench and pea Pisum sativum L. Soil Biology and Biochemistry, 21, 511–517. Chebotar, V. K., Asis, C. A., & Akao, S. (2001). Production of growth-promoting substances and high colonization ability of rhizobacteria enhance the nitrogen fi xation of soybean when coinoculated with Bradyrhizobium japonicum. Biology and Fertility of Soils, 34, 427–432. Crosa, J. H., & Walsh, C. T. (2002). Genetics and assembly line enzymology of siderophore biosynthesis in bacteria. Microbiology and Molecular Biology Reviews, 66(2), 223–249.

140

Recent Advancements in Microbial Diversity

Dardanelli, M. S., de Cordoba, F. J. F., Espuny, M. R., Carvajal, M. A. R., Diaz, M. E. S., Serrano, A. M. G., et al. (2008). Effect of Azospirillum brasilense coinoculated with Rhizobium on Phaseolus vulgaris flavonoids and Nod factor production under salt stress. Soil Biology and Biochemistry, 40, 2713–2721. Dashti, N., Prithiviraj, B., Zhou, X., Hynes, R. K., & Smith, D. L. (2000). Combined effects of plant growth- promoting rhizobacteria and genistein on nitrogen fixation in soybean at suboptimal root zone temperatures. Journal of Plant Nutrition, 23, 593–604. Dashti, N., Zhang, F., Hynes, R., & Smith, D. L. (1998). Plant growth promoting rhizobacteria accelerate nodulation and increase nitrogen fixation activity by field grown soybean [Glycine max L. Merr. ] under short season conditions. Plant Soil., 200, 205–213. De Freitas, J. R., Gupta, V. V. S. R., & Germida, J. J. (1993). Influence of Pseudomonas syringae R25 and P. putida R105 on the growth and N 2 fixation (acetylene reduction activity) of pea (Pisum sativum L.) and field bean (Phaseolus vulgaris L.). Biology and Fertility of Soils, 16(3), 215–220. Derylo, M., & Skorupska, A. (1993). Enhancement of symbiotic nitrogen fixation by vitamin-secreting fluorescent Pseudomonas. Plant Soil., 54, 211–217. Dobbelaere, S., & Okon, Y. (2007). The plant growth-promoting effect and plant responses. In In Associative and endophytic nitrogen-fixing bacteria and cyanobacterial associations. Dordrecht: Springer (pp. 145-170). Duffy, B. K., & Défago, G. (1999). Environmental factors modulating antibiotic and siderophore biosynthesis by Pseudomonas fluorescens biocontrol strains. Applied and Environmental Microbiology, 65(6), 2429–2438. Egamberdieva, D., Berg, G., Lindström, K., & Räsänen, L. A. (2010). Co-inoculation of Pseudomonas spp. with Rhizobium improves growth and symbiotic performance of fodder galega Galega orientalis Lam. European Journal of Soil Biology, 46, 269–272. Elkoca, E., Kantar, F., & Sahin, F. (2008). Influence of nitrogen fixing and phosphorus solubilizing bacteria on the nodulation, plant growth and yield of chickpea. Journal of Plant Nutrition, 31, 157–171. Elkoca, E., Turan, M., & Donmez, M. F. (2010). Effects of single, dual and triple inoculations with Bacillus subtilis, Bacillus megaterium and Rhizobium leguminosarum bv. Phaseoli on nodulation, nutrient uptake, yield and yield parameters of common bean (Phaseolus vulgaris l. cv.’elkoca-05’). Journal of Plant Nutrition, 33(14), 2104–2119. Estévez, J., Dardanelli, M. S., & Megías, M. (2009). Symbiotic performance of common bean and soybean co-inoculated with rhizobia and Chryseobacterium balustinum Aur9 under moderate saline conditions. Symbiosis, 49, 29–36. FAO (1992). Production Yearbook, FAO Statistics Series No. 112. FAO Rome 46p. Figueiredo, M. V. B., Martinez, C. R., Burity, H. A., & Chanway, C. P. (2008). Plant growth-promoting rhizobacteria for improving nodulation and nitrogen fi xation in the common bean Phaseolus vulgaris L. World Journal of Microbiology & Biotechnology, 24, 1187–1193. Fox, S. L., O’Hara, G. W., & Bräu, L. (2011). Enhanced nodulation and symbiotic effectiveness of Medicago truncatula when co-inoculated with Pseudomonas fluorescens WSM3457 and Ensifer Sinorhizobium medicae WSM419. Plant and Soil, 3481-2, 245. Freiberg, C., Fellay, R., Bairoch, A., Broughton, W. J., Rosenthal, A., & Perret, X. (1997). Molecular basis of symbiosis between Rhizobium and legumes. Nature, 3876631, 394. Galloway, J. N., Schlesinger, W. H., Levy, H., Michaels, A., & Schnoor, J. L. (1995). Nitrogen fixation: Anthropogenic enhancement-environmental response. Global Biogeochemical Cycles, 92, 235–252. Guiñazu, L. B., Andres, J. A., DelPapa, M. F., Pistorio, M., & Rosas, S. B. (2010). Response of alfalfa (Medicago sativa L.) to single and mixed inoculation with phosphate-solubilising bacteria

Multifaceted beneficial effects of plant growth promoting bacteria Chapter | 6

141

and Sinorhizobium meliloti. Biology and Fertility of Soil, 46, 185–190. doi: 10.1007/s00374009-0408-. Garcia, J. A. L., Probanza, A., Ramos, B., Barriuso, J., & Mañero, F. J. G. (2004a). Effects of inoculation with plant growth promoting rhizobacteria PGPRs and Sinorhizobium fredii on biological nitrogen fixation, nodulation and growth of Glycine max cv. Osumi. Plant Soil., 267, 143–153. Garcia, J. A. L., Probanza, A., Ramos, B., Flores, J. J. C., & Mañero, F. J. G. (2004b). Effects of plant growth promoting rhizobacteria PGPRS on the biological nitrogen fi xation, nodulation, and growth of Lupinus albus L. cv. Multolupa. Engineering in Life Sciences, 4, 71–77. Geurts, R., & Bisseling, T. (2002). Rhizobium nod factor perception and signaling. Plant Cell, 14, S239–S249. Glick, B. R., Pentrose, D. M., & Li, J. (1998). A model for lowering plant ethylene concentration by plant growth promoting rhizobacteria. Journal of Theoretical Biology, 190, 63–68. Glick, B. R., Cheng, Z., Czarny, J., & Duan, J. (2007). Promotion of plant growth by ACC deaminase-producing soil bacteria. In New perspectives and approaches in plant growth-promoting Rhizobacteria Research (pp. 329–339). Graham, P. H., & Vance, C. P. (2000). Nitrogen fixation in perspective: an overview of research and extension needs. Field Crops Research, 65, 93–106. Gull, M., Hafeez, F. Y., Saleem, M., & Malik, K. A. (2004). Phosphorus uptake and growth promotion of chickpea by co-inoculation of mineral phosphate solubilising bacteria and a mixed rhizobial culture. Australian Journal of Experimental Agriculture, 44(6), 623–628. Gupta, A., Saxena, A. K., Gopal, M., & Tilak, K. V. B. R. (1998). Effect of plant growth promoting rhizobacteria on competitive ability of introduced Bradyrhizobium sp. (Vigna) for nodulation. Microbiological Research, 153(2), 113–117. Hameeda, B., Harini, G., Rupela, O. P., Rao, J. K., & Reddy, G. (2010). Biological control of chickpea collar rot by co-inoculation of antagonistic bacteria and compatible rhizobia. Indian Journal of Microbiology, 50(4), 419–424. Hellriegel, H., & Wilfarth, H. (1888). Untersuchungen ü ber die Stickstoffnahrung der Gramineon und Leguminosen. Beilageheft zu der Ztschr. Ver. Rü benzucker-Industrie Deutschen Reichs. Hiltner, L. T. (1904). Uber nevere Erfahrungen und Probleme auf dem Gebiet der Boden Bakteriologie und unter besonderer Beurchsichtigung der Grundungung und Broche. Arbeit. Deut. Landw. Ges. Berlin, 98, 59–78. Holguin, G., & Glick, B. R. (2001). Expression of the ACC deaminase gene from Enterobacter cloacae UW4 in Azospirillum brasilense. Microbial Ecology, 41, 281–288. Hubbell, D. H., & Kidder, G. (2009). Biological nitrogen fixation. Univ Fla IFAS Ext Publ SL., 16, 1–4. Humphreys, L. R. (1994). In tropical forages; their role in sustainable agriculture. Harlow: Longman Scientific and Technical, pp. 414. Iqbal, M. A., Khalid, M., Shahzad, S. M., Ahmad, M., Soleman, N., & Akhtar, N. (2012). Integrated use of Rhizobium leguminosarum, plant growth promoting rhizobacteria and enriched compost for improving growth, nodulation and yield of lentil Lens culinaris Medik. Chilean Journal of Agricultural Research, 72, 104–110. Jenkinson, D. A. (2001). The impact of humans on the nitrogen cycle, with focus on temperate arable agriculture. Plant and Soil, 228, 3–15. Juge, C., Prévost, D., Bertrand, A., Bipfubusa, M., & Chalifour, F. P. (2012). Growth and biochemical responses of soybean to double and triple microbial associations with Bradyrhizobium, Azospirillum and arbuscular mycorrhizae. Applied Soil Ecology, 61, 147–157. Kloepper, J. W. (1993). Plant growth promoting rhizobacteria as biological control agents. In F. B. Metting, Jr (Ed.), In Soil microbial ecology (pp. 255–274). New York.: Dekker.

142

Recent Advancements in Microbial Diversity

Kloepper, J. W., Leong, J., Teintze, M., & Schroth, M. N. (1980). Pseudomonas siderophores: A mechanism explaining disease-suppressive soils. Current Microbiology, 4, 317–320. Knight, T. J., & Langston-Unkefer, P. J. (1988). Enhancement of symbiotic dinitrogen fixation by a toxin releasing plant pathogen. Science, 241, 951–954. Kumar, B. D., Berggren, I., & Mårtensson, A. M. (2001). Potential for improving pea production by co-inoculation with fluorescent Pseudomonas and Rhizobium. Plant and Soil, 229(1), 25–34. Linderman, R. G. (1994). Role of VAM fungi in biocontrol. Mycorrhizae and Plant Health. Loper, J. E., & Henkels, M. D. (1999). Utilization of heterologous siderophores enhances levels of iron available to Pseudomonas putida in the rhizosphere. Applied and Environmental Microbiology, 65, 5357–5363. López-Bucio, J., Campos-Cuevas, J. C., Hernández-Calderón, E., Velásquez-Becerra, C., Farías-Rodríguez, R., Macías-Rodríguez, L. I., et al. (2007). Bacillus megaterium rhizobacteria promote growth and alter root-system architecture through an auxin-and ethylene-independent signaling mechanism in Arabidopsis thaliana. Molecular Plant-Microbe Interactions, 20(2), 207–217. Lugtenberg, B., & Kamilova, F. (2009). Plant-growth-promoting rhizobacteria. Annual Review of Microbiology, 63, 541–556. doi: 10.1146/annurev.micro.62.081307.162918. Machackova, I., Chavaux, N., Dewitte, W., & Onckelen, H. V. (1997). Diurnal fluctuations in ethylene formation in Chenopodium rubrum. Plant Physiology, 113, 981–985. Maikhuri, R. K., Rao, K. S., & Semwal, R. L. (2001). Changing scenario of Himalayan agroecosystems: loss of agrobiodiversity, an indicator of environmental change in Central Himalaya, India. Environmentalist, 211, 23–39. Malik, D. K., & Sindhu, S. S. (2008). Transposon-derived mutants of Pseudomonas strains altered in indole acetic acid production: effect on nodulation and plant growth in green gram Vigna radiata L. Physiology and Molecular Biology of Plants, 4, 315–320. Malik, D. K., & Sindhu, S. S. (2011). Production of indole acetic acid by Pseudomonas sp.: effect of coinoculation with Mesorhizobium sp. Cicer on nodulation and plant growth of chickpea Cicer arietinum. Physiology and Molecular Biology of Plants, 17, 25–32. Marek-Kozaczuk, M., & Skorupska, A. (2001). Production of B-group vitamins by plant growth promoting Pseudomonas fluorescens strain 267 and the importance of vitamins in the colonization and nodulation of red clover. Biology and Fertility of Soils. 33, 146–151. Marek-Kozaczuk, M., Derylo, M., & Skorupska, A. (1996). Tn5 insertion mutants of Pseudomonas sp. 267 defective in siderophore production and their effect on clover Trifolium pratense nodulated with Rhizobium leguminosarum bv. trifolii. Plant and Soil, 179, 269–274. Marek-Kozaczuk, M., Kopcińska, J., Łotocka, B., Golinowski, W., & Skorupska, A. (2000). Infection of clover by plant growth promoting Pseudomonas fluorescens strain 267 and Rhizobium leguminosarum bv. trifolii studied by mTn5-gusA. Antonie Van Leeuwenhoek., 781, 1–11. Masalha, J., Kosegarten, H., Elmaci, Ö., & Mengel, K. (2000). The central role of microbial activity for iron acquisition in maize and sunflower. Biology and Fertility of Soils, 30(5–6), 433–439. Mehboob, I., Naveed, M., & Zahir, Z. A. (2009). Rhizobial association with non-legumes: mechanisms and applications. Critical Reviews in Plant Science, 286, 432–456. Mishra, P. K., Mishra, S., Selvakumar, G., Kundu, S., & Shankar Gupta, H. (2009). Enhanced soybean (Glycine max L.) plant growth and nodulation by Bradyrhizobium japonicum-SB1 in presence of Bacillus thuringiensis-KR1. Acta Agriculturae Scandinavica Section B–Soil and Plant Science, 59(2), 189–196. Mishra, P. K., Mishra, S., Selvakumar, G., Bisht, J. K., Kundu, S., & Gupta, H. S. (2009a). Coinoculation of Bacillus thuringeinsis -KR1 with Rhizobium leguminosarum enhances plant growth and nodulation of pea Pisum sativum L. and lentil Lens culinaris L. World Journal of Microbiology & Biotechnology, 25, 753–761.

Multifaceted beneficial effects of plant growth promoting bacteria Chapter | 6

143

Mishra, P. K., Bisht, S. C., Ruwari, P., Joshi, G., Singh, G., Bisht, J. K., et al. (2011). Bioassociative effect of cold tolerant Pseudomonas spp. and Rhizobium leguminosarum-PR1 on acdquisition, nutrient uptake and growth of lentil (Lens culinaris L.). European Journal of Soil Biology, 47, 35–43. Mishra, P. K., Bisht, S. C., Mishra, S., Selvakumar, G., Bisht, J. K., & Gupta, H. S. (2012). Coinoculation of Rhizobium leguminosarum-PR1 with a cold tolerant Pseudomonas sp. improves iron acquisition, nutrient uptake and growth of field pea (Pisum sativum L.). Journal of Plant Nutrition, 35(2), 243–256. Molla, A. H., Shamsuddin, Z. H., Halimi, M. S., Morziah, M., & Puteh, A. B. (2001a). Potential for enhancement of root growth and nodulation of soybean co-inoculated with Azospirillum and Bradyrhizobium in laboratory systems. Soil Biology and Biochemistry, 33, 457–463. Oldroyd, G. E. (2013). Speak, friend, and enter: signalling systems that promote beneficial symbiotic associations in plants. Nature Reviews Microbiology, 114, 252. Oldroyd, G. E., & Downie, J. A. (2008). Coordinating nodule morphogenesis with rhizobial infection in legumes. Annual Review of Plant Biology, 59, 519–546. Oyaizu, H., Matsumoto, S., Minamisawa, K., & Gamou, T. (1993). Distribution of rhizobia in leguminous plants surveyed by phylogenetic identification. The Journal of General and Applied Microbiology, 39(4), 339–354. Pan, B., Vessey, J. K., & Smith, D. L. (2002). Response of field-grown soybean to co-inoculation with the plant growth promoting rhizobacteria Serratia proteamaculans or Serratia liquefaciens, and Bradyrhizobium japonicum pre-incubated with genistein. European Journal of Agronomy, 17, 143–153. Pandey, A., Tripathi, P. H., Pandey, S. C., Pathak, V. M., & Nailwal, T. K. (2018). Removal of Toxic Pollutants From Soil Using Microbial Biotechnology. In Microbial biotechnology in environmental monitoring and cleanup (pp. 86–105). In IGI Global. Pandey, P., & Maheshwari, D. K. (2007). Bioformulation of Burkholderia sp. MSSP with a multispecies consortium for growth promotion of Cajanus cajan. Canadian Journal of Microbiology, 532, 213–222. Pandey, A., Tripathi, P. H., Paliwal, A., Tripathi, A. H., Pandey, S. C., Joshi, T., et al. (2019). Various Approaches for Food Waste Processing and Its Management. In Global initiatives for waste reduction and cutting food loss (pp. 191–211). In IGI Global. Pankaj, K., Bansal, R. K., & Dabur, K. R. (2011). Effect of rhizobacteria as seed inoculation on root-knot nematode and plant growth in rice-nursery. Indian Journal of Nematology., 411, 41–46. Parmar, N., & Dadarwal, K. R. (1999). Stimulation of nitrogen fixation and induction of flavonoid like compounds by rhizobacteria. Journal of Applied Microbiology, 86, 3–44. Pathak, D. V., Kumar, M., Sharma, S. K., Kumar, N., & Sharma, P. K. (2007). Crop improvement and root rot suppression by seed bacterization in chickpea. Archives of Agronomy and Soil Science, 53(3), 287–292. Peoples, M. B., & Craswell, E. T. (1992). Biological nitrogen fixation: investments, expectations and actual contributions to agriculture. Plant and soil., 1411-2, 13–39. Peoples, M. B., Herridge, D. F., & Lahda, J. K. (1995). Biological nitrogen fixation: an efficient source of nitrogen for sustainable agricultural production? Plant and Soil, 174, 3–28. Plazinski, J., & Rolfe, B. G. (1985). Influence of Azospirillum strains on the nodulation of clovers by Rhizobium strains. Applied and Environmental Microbiology, 49, 984–989. Pueppke, S. G., & Broughton, W. J. (1999). Rhizobium sp. strain NGR234 and R. fredii USDA257 share exceptionally broad, nested host ranges. Molecular Plant-Microbe Interactions, 12, 293–318.

144

Recent Advancements in Microbial Diversity

Radwan, S. S., Dashti, N., & El-Nemr, I. M. (2005). Enhancing the growth of Vicia faba plants by microbial inoculation to improve their phytoremediation potential for oily desert areas. International Journal of Phytoremediation, 7(1), 19–32. Rajendran, G., Sing, F., Desai, A. J., & Archana, G. (2008). Enhanced growth and nodulation of pigeon pea by co-inoculation of Bacillus strains with Rhizobium spp. Bioresource Technology, 99, 544–550. Redmond, J. W., Batle, M., Djjordjevic, M. A., Innes, R. W., Keumpel, P. L., & Rolfe, B. G. (1986). Flavones induce expression of nodulation genes in Rhizobium. Nature London, 323, 63–635. Reid, M. S. (1995). Ethylene in plant growth, development and senescence. In P. J. Davies (Ed.), Plant hormone: physiology biochemistry and molecular biology (pp. 486–508). Dordrecht: Kluwer Academic Publishers. Remans, R., Croonenborghs, A., Gutierrez, R. T., Michiels, J., & Vanderleyden, J. (2007). Effects of plant growth-promoting rhizobacteria on nodulation of Phaseolus vulgaris L. are dependent on plantP nutrition. European Journal of Plant Pathology, 119, 341–351. Remans, R., Ramaekers, L., Schelkens, S., Hernandez, G., Garcia, A., Reyes, J. L., et al. (2008). Effect of Rhizobium – Azospirillum coinoculation on nitrogen fi xation and yield of two contrasting Phaseolus vulgaris L. genotypes cultivated across different environments in Cuba. Plant and Soil, 312, 25–37. Requena, N., Jimenez, I., Toro, M., & Barea, J. M. (1997). Interactions between plant-growthpromoting rhizobacteria (PGPR), arbuscular mycorrhizal fungi and Rhizobium spp. in the rhizosphere of Anthyllis cytisoides, a model legume for revegetation in mediterranean semi-arid ecosystems. The New Phytologist, 136(4), 667–677. Richardson, A. E., Barea, J. M., McNeill, A. M., & Prigent-Combaret, C. (2009). Acquisition of phosphorus and nitrogen in the rhizosphere and plant growth promotion by microorganisms. Plant and Soil, 321(1–2), 305–339. Robson, A. D. (1990). The role of self-regenerating pasture in rotation with cereals in Mediterranean areas. In A. E. Osman et al.,(Ed.), In: The role of legumes in the farming systems of the mediterranean areas (pp. 217–236). The Netherlands: ICARDA. Rodelas, B., González-López, J., Martínez-Toledo, M. V., Pozo, C., & Salmerón, V. (1999). Influence of Rhizobium/Azotobacter and Rhizobium/Azospirillum combined inoculation on mineral composition of faba bean (Vicia faba L.). Biology and Fertility of Soils, 29(2), 165–169. Rosas, S. B., Andrés, J. A., Rovera, M., & Correa, N. S. (2006). Phosphate-solubilizing Pseudomonas putida can influence the rhizobia–legume symbiosis. Soil Biology and Biochemistry, 38(12), 3502–3505. Roseline, R., Lara, R., Sarah, S., German, H., Aurelio, G., Jorge, R., et al. (2008). Effect of Rhizobium - Azospirillum coinoculation on nitrogen fixation and yield of two contrasting Phaseolus vulgaris L. genotypes cultivated across different environments in Cuba. Plant and Soil, 312, 25–37. Rudresh, D. L., Shivaprakash, M. K., & Prasad, R. D. (2005). Effect of combined application of Rhizobium, phosphate solubilizing bacterium and Trichoderma spp. on growth, nutrient uptake and yield of chickpea (Cicer aritenium L.). Applied Soil Ecology, 28(2), 139–146. Russelle, M. P. (2008). Biological dinitrogen fixation in agriculture. In J. S. Schepers, & W. R. Raun (Eds.), Nitrogen in agricultural systems (second ed., pp. 281–359). Madison: Agronomy monograph 22. American Society of Agronomy. Salem, S., Saidi, S., Chihaoui, S. A, & Mhamdi, R. (2012). Inoculation of Phaseolus vulgaris, Medicago laciniata and Medicago polymorpha with Agrobacterium sp. strain 10C2 may enhance nodulation and shoot dry weight but does not affect host range specificity. Annals of Microbiology, 62(4), 1811–1817.

Multifaceted beneficial effects of plant growth promoting bacteria Chapter | 6

145

Schlaman, H. R., Okker, R. J. H., & Lugtenberg, B. J. J. (1992). Regulation of nodulation gene expression by nod D in rhizobia. Journal of Bacteriology, 174, 5177–5182. Schultze, M., & Kondorosi, A. (1998). Regulation of symbiotic root nodule development. Annual Review of Genetics, 32, 33–57. Shaharoona, B., Arshad, M., & Zahir, Z. A. (2006). Effect of plant growth promoting rhizobacteria containing ACC-deaminase on maize (Zea mays L.) growth under axenic conditions and on nodulation in mung bean (Vigna radiata L.). Letters in Applied Microbiology, 42(2), 155–159. Sindhu, S. S., & Dadarwal, K. R. (2001). Chitinolytic and cellulolytic Pseudomonas sp. antagonistic to fungal pathogens enhances nodulation by Mesorhizobium sp. Cicer in chickpea. Microbiological Research, 156(4), 353–358. Sindhu, S. S., Suneja, S., Goel, A. K., Parmar, N., & Dadarwal, K. R. (2002). Plant growth promoting effects of Pseudomonas sp. on coinoculation with Mesorhizobium sp. Cicer strain under sterile and “wilt sick” soil conditions. Applied Soil Ecology, 19(1), 57–64. Sivaramaiah, N., Malik, D. K., & Sindhu, S. S. (2007). Improvement in symbiotic efficiency of chickpea (Cicer arietinum) by co-inocualtion of Bacillus strains with Mesorhizobium sp. Cicer. Indian Journal of Medical Microbiology, 47, 51–56. Soe, K. M., Bhromsiri, A., Karladee, D., & Yamakawa, T. (2012). Effects of endophytic actinomycetes and Bradyrhizobium japonicum strains on growth, nodulation, nitrogen fi xation and seed weight of different soybean varieties. Soil Science and Plant Nutrition, 58, 319–325. Spaepen, S., Vanderleyden, J., & Remans, R. (2007). Indol-3-acetic acid in microbial and microorganism- plant signaling. FEMS Microbiology Reviews, 31, 425–448. Spaink, H. P. (2000). Root nodulation and infection factors produced by rhizobial bacteria. Annual Review of Microbiology, 54, 257–288. Star, L., Matan, O., Dardanelli, M. S., Kapulnik, Y., Burdman, S., & Okon, Y. (2012). The Vicia sativa spp. nigra – Rhizobium leguminosarum bv. viciae symbiotic interaction is improved by Azospirillum brasilense. Plant and Soil, 356, 165–174. Tchebotar, V. K., Kang, U. G., Asis, C. A., Jr., & Akao, S. (1998). The use of GUS-reporter gene to study the effect of Azospirillum - Rhizobium coinoculation on nodulation of white clover. Biology and Fertility of Soils, 27, 349–352. Thomas, R. J., Fisher, M. J., Ayarza, M. A., & Sanz, J. I. (1995). The role of forage grasses and legumes in maintaining the productivity of acid soils in: Soil management: experimental basis for sustainability and environmental quality, 4, 61. Tilak, K. V. B. R., Ranganayaki, N., & Manoharachari, C. (2006). Synergistic effects of plantgrowth promoting rhizobacteria and Rhizobium on nodulation and nitrogen fixation by pigeon pea Cajanus cajan. European Journal of Soil Science, 57. Tsigie, A., Tilak, K. V. B. R., & Saxena, A. K. (2011). Field response of legumes to inoculation with plantgrowth-promoting rhizobacteria. Biology and Fertility of Soils, 47, 971–974. Valverde, A., Burgos, A., Fiscella, T., Rivas, R., Velazquez, E., Rodriguez-Barrueco, C., et al. (2006). Differential effects of coinoculations with Pseudomonas jessenii PS06 a phosphatesolubilizing bacterium and Mesorhizobium ciceri C-2/2 strains on the growth and seed yield of chickpea under greenhouse and field conditions. Plant and Soil, 287, 43–50. Van Kessel, C., & Hartley, C. (2000). Agricultural management of grain legumes: has it led to an increase in nitrogen fixation? Field Crops Research, 65, 165–181 https://doi.org/10.1016/ S0378-42909900085-4. Velázquez, E., García-Fraile, P., Ramírez-Bahena, M. H., Rivas, R., & Martínez-Molina, E. (2010). Bacteria involved in nitrogen-fixing legume symbiosis: current taxonomic perspective. In InMicrobes for legume improvement (pp. 1–25). Vienna: Springer.

146

Recent Advancements in Microbial Diversity

Verma, J. P., Yadav, J., & Tiwari, K. N. (2012). Enhancement of nodulation and yield of chickpea by coinoculation of indigenous Mesorhizobium spp. and plant growth-promoting rhizobacteria in eastern Uttar Pradesh. Communications in Soil Science and Plant Analysis, 43, 605–621. Villacieros, M., Power, B., Sánchez-Contreras, M., Lloret, J., Oruezabal, R. I., Martín, M., et al. (2003). Colonization behaviour of Pseudomonas fluorescens and Sinorhizobium meliloti in the alfalfa (Medicago sativa) rhizosphere. Plant and Soil, 251(1), 47–54. Vivas, A., Barea, J. M., Biro, B., & Azcon, R. (2006). Effectiveness of autochthonous bacterium and mycorrhizal fungus on Trifolium growth, symbiotic development and soil enzymatic activities in Zn contaminated soil. Journal of Applied Microbiology, 100(3), 587–598. Wani, P. A., Khan, M. S., & Zaidi, A. (2007a). Synergistic effects of the inoculation with nitrogenfixing and phosphate-solubilizing rhizobacteria on the performance of field-grown chickpea. Journal of Plant Nutrition and Soil Science, 170(2), 283–287. Wani, P. A., Khan, M. S., & Zaidi, A. (2007b). Co-inoculation of nitrogen-fi xing and phosphate-solubilizing bacteria to promote growth, yield and nutrient uptake in chickpea. Acta Agronomica Hungarica, 55, 315–323. Wasule, D. L., Wadyalkar, S. R., & Buldeo, A. N. (2003). Effect of phosphate solubilizing bacteria on role of Rhizobium on nodulation by soybean. In E. Velazquez (Ed.), First international meeting on microbial phosphate solubilization, Salamanca, Spain (pp. 139–142). Dordrecht: Springer. Weller, D. M. (2007). Pseudomonas biological control agents of soilborne pathogens: looking back over 30 years. Phytopathology., 97, 250–256. Yadegari, M., Rahmani, H. A., Noormohammadi, G., & Ayneband, A. (2008). Evaluation of bean Phaseolus vulgaris seed inoculation with Rhizobium phaseoli and plant growth-promoting rhizobacteria on yield and yield components. Pakistan Journal of Biological Sciences, 11, 1935–1939. Yahalom, E., Okon, Y., & Dovrat, A. (1987). Azospirillum effects on susceptibility to Rhizobium nodulation and on nitrogen fi xation of several forage legumes. Canadian Journal of Microbiology, 33, 510–514. Yahalom, E., Okon, Y., & Dovrat, A. (1990). Possible mode of action of Azospirillum brasilense strain on the root morphology and nodule formation in burr medic Medicago polymorpha. Canadian Journal of Microbiology, 36, 10–14. Yang, S. F., & Hoffman, N. E. (1984). Ethylene biosynthesis and its regulation in higher plants. Annual Review of Plant Physiology, 35(1), 155–189. Zahir, Z. A., Arshad, M., & Frankenberger, W. T. J. (2003). Plant growth promoting rhizobacteria: applications and perspectives in agriculture. Advances in Agronomy, 81, 97–168. Zahir, Z. A., Zafar-ul-Hye, M., Sajjad, S., & Naveed, M. (2011). Comparative effectiveness of Pseudomonas and Serratia sp. containing ACC-deaminase for coinoculation with Rhizobium leguminosarum to improve growth, nodulation, and yield of lentil. Biology and Fertility of Soils, 47, 457–465. Zaidi, A., Khan, M. S., & Amil, M. D. (2003). Interactive effect of rhizotrophic microorganisms on yield and nutrient uptake of chickpea (Cicer arietinum L.). European Journal of Agronomy, 19(1), 15–21. Zaidi, A., Khan, M. S., & Aamil, M. (2004). Bioassociative effect of rhizospheric microorganisms on growth, yield, and nutrient uptake of greengram. Journal of Plant Nutrition, 27(4), 601–612. Zhang, F., Dashti, N., Hynes, R. K., & Smith, D. L. (1996). Plant growth promoting rhizobacteria and soybean [Glycine max L. Merr.] nodulation and nitrogen fixation at suboptimal root zone temperatures. Annals of Botany, 77, 453–460.

Chapter 7

Role of rhizospheric microbial diversity in plant growth promotion in maintaining the sustainable agrosystem at high altitude regions Jyoti Rawat, Nirmal Yadav and Veena Pande Department of Biotechnology, Kumaun University Nainital, Bhimtal Campus, Bhimtal, Uttarakhand, India

1 Introduction Microbial diversity in the soil is always crucial for any ecosystem as they play vital role in improving soil health, plant growth and yield, and maintaining the sustainability of that ecosystem, as well as reducing the use of chemical fertilizers (Rashid et al., 2016). High altitude region or glaciers represents a long-term reservoirs of an enormous microbial diversity with huge metabolic potential (Miteva, 2008). It is the major factor that has confounded effects on both biodiversity and soil physicochemical properties. Thus, microbial communities of cold habitat have reached the applied research centre not only in biotechnological perspectives but also to understand the use of primitive analogs of biomolecules at the beginning of the Earth’s environments (Chen & Jiang, 2018). Extreme cold environments are the hot spots of biodiversity of diverse groups of microbes including archaea, bacteria, and fungi (Yadav et al., 2017a). There are certain microbes that influence the growth and productivity of the plants and these are termed as PGPMs, i.e. plant growth-promoting microorganisms (Kumar et al., 2015a). Some of these microbes act as biofertilizers (preparations containing living microorganisms), that provide important nutrients to the plants (nitrogen, phosphorus, potassium, and Zinc); some protect plants from pathogens (biocontrol) and others produce various chemical compounds that directly stimulate plant growth (phytostimulators) (Mohammadi & Sohrabi, 2012; Glick, 2012). Very often, the same microbe exhibits indeed a combination of these abilities. Recent Advancements in Microbial Diversity. http://dx.doi.org/10.1016/B978-0-12-821265-3.00007-4 Copyright © 2020 Elsevier Inc. All rights reserved.

147

148

Recent Advancements in Microbial Diversity

These PGPMs have been reported to enhance the growth and yield of plants through several direct and indirect mechanisms. They directly increase nutrient cycling such as biological nitrogen fixation, phosphorus solubilization, production of siderophores (iron chelation) thus making the nutrients available to the plant, phytohormones synthesis of like auxins and indirect mechanisms such as the synthesis of certain biocontrol compounds (Ahemad and Kibret, 2014). Mountain agroecosystems require specific microbial inoculants, able to endure the challenges imposed by cold temperatures and also able to retain their ability to promote plant growth (Trivedi, Pandey, & Palni, 2012). The bioprospection of such environments started almost two decades ago and has mainly been focused on detecting microorganisms that can promote growth and yield of crops. The exploration of the cold habitats of the Indian Himalayas allowed isolating a great diversity of psychrotropic microbes (microbes that are able to grow rapidly at 7°C and below) (Joshi, Joshi, Mishra, Bisht, & Bhatt, 2014). The psychrotrophic microbes play important role in alleviation of cold stress in plants growing at high altitude and low temperature conditions (Yadav, Sachan, Verma, & Saxena, 2016). They have been reported as plant growth promoters and biocontrol agents for sustainable agriculture (Yadav et al., 2018a). A metagenomic study demonstrated that Proteobacteria, Acidobacteria, and Actinobacteria are dominant phyla in high altitude soils (Singh, Takahashi, Kim, Chun, & Adams, 2012) while Bacteroidetes and Firmicutes were found dominant at low altitude regions (Shtarkman, 2015; Kumar, Soni, Kanwar, & Pabbi, 2019). Previous studies of high-altitude soils in IHR suggest a predominance of psychrotolerant species of Pseudomonas (Mishra et al., 2009). Uttarakhand regions are characterized by terraced and rainfed farming. Hill soils are generally considered acidic in nature with a high content of organic matter and are subject to erosion (Sati, 2007). Agriculture in mountainous areas has been affected by soil erosion, depletion of soil fertility that has reduced yields and income (Tiwari, Sitaula, Bajracharya, & Børresen, 2010). Soil physiochemical investigations have shown that altitude correlates positively with soil organic matter, pH and total nitrogen content. However, mineral nutrients and soil phosphorus were negatively correlated to the altitude (Kumar et al., 2019). A large variety of traditional crops generally occurs in the Himalayas and particularly in the central Himalayan region. Traditional crops that grow during the Kharif and Rabi seasons in mixed and pure forms at different altitudes include Macrotyloma uniforum (high altitude), Parilla frutescens and Vigna mungo (medium altitude) and Panicum miliaceum (lower altitude) that has proven to be energetically efficient (Maikhuri, Rao, & Saxena, 1996). Many commercial biofertilizers have been developed and are presently sold worldwide (Glick, 2012), whereas, their use in cold climates such as those prevailing in mountain ecosystems has proven ineffective (Trivedi et al., 2012). This is mainly because low-temperatures impose severe restrictions on the metabolic activity of microorganisms. Consequently, a decrease in temperature leads to a 2–4 fold decrease in enzyme activity (Feller, 2003). Therefore, to develop

Role of rhizospheric microbial diversity in plant growth Chapter | 7

149

excellent biofertilizers (cold-active), it is essential to find microorganisms that are well adapted to low temperatures (psychrotolerant or psychrophilic). The cold-tolerant psychrotrophic microbes can be valuable in agriculture as biofertilizers and biocontrol agents to maintain sustainable agriculture. Inoculation with psychrotrophic/psychrotolerant strains significantly enhanced root/shoot fresh and dry weight and nutrients uptake against uninoculated control. The microbial diversity in the cold environment could serve as a database for the selection of bio-inoculants with plant growth-promoting (PGP) capability and could be used to improve growth and yield of crops grown at high elevation with existing low temperatures (Yadav, Verma, Sachan, Kaushik, & Saxena, 2018c; Yadav, Yadav, Sachan, & Saxena, 2019). Psychrophilic bacteria with remarkable plant-growth-promoting characters are immersed in tropical glacial ice (Balcazar et al., 2015; Hassan, Rafiq, Hayat, Shah, & Hasan, 2016). The isolates recovered from these extreme environments represent a vast deposit of microbial diversity that deserves to be thoroughly explored and properly preserved. The potential use of these microbes for the development of eco-friendly products like cold-active biofertilizers is certainly a reality. Therefore, to maintain sustainability, the possible use of the cold active microbial strains to develop biofertilizers for effective growth and yield of crops and improvement in soil fertility in mountainous agriculture.

2  Microbial diversity at high altitude regions Cold-adapted microbes are ubiquitous in nature and can be isolated from everlastingly ice-covered lakes, cloudy glaciers, and hilly regions (Paenibacilius, 2016; Anesio, Lutz, Chrismas, & Benning, 2017; Margesin & Collins, 2019). Temperature can directly or indirectly affect the response of a microorganism such as decreased growth rate, enzymatic activities, changes in cell composition, and differential nutritional requirements (Beales, 2004). Extreme cold region represents the hot spots of microbial biodiversity for psychrotrophic, psychrophilic, and psychrotolerant microbiomes (Yadav, Verma, Kumar, Sachan, & Saxena, 2017d; Saxena et al., 2016; Yadav et al., 2017b). Cold tolerant microbes are able to grow in cold places; however, there is an important difference between cold-tolerant and cold-loving. The microbes which grow at 15°C are Psychrophiles (cold-loving) while psychrotolerant or psychrotrophs (cold tolerant) have an optimum temperature between 20°C and 40°C or analogous to those of mesophiles, but are also able to tolerate at 0°C although with slower growth rate (Moyer & Morita, 2001). Though psychrotolerant microorganisms do grow at 0°C, they have highly extended lag periods, before they appear on growth media under in vitro conditions. Based on morphology, microbes found in a cold environment are classified as spore-formers, non spore formers, and filamentous bacteria. Whereas, depending upon their metabolism they vary from aerobic to anaerobic and include both heterotrophs and autotrophs. The effect of cold temperatures is chiefly felt in

150

Recent Advancements in Microbial Diversity

the solute transport system. The lipid bilayer, which is the basic structure of the microbial membranes, must have appropriate fluidity to maintain the cell permeability and the movement of essential solutes. The microbial diversity in cold environments has drawn attention to the scientific community for the production of cold-active enzyme production, anti-freezing compounds, secondary metabolites and bioactive compounds by psychrotrophic microbes (Yadav et al., 2019). Psychrotrophic microbes have been reported in cold habitats worldwide and belong to three domain archaea, bacteria, and eukaryote including different phylum such as Actinobacteria, Bacteroidetes, Basidiomycota, Ascomycota, Chloroflexi, Chlamydiae, Planctomycetes, Cyanobacteria, Euryarchaeota, Firmicutes, Gemmatimonadetes, Verrucomicrobia, Mucoromycota, Proteobacteria, Spirochaetes, Thaumarchaeota, and Nitrospirae. The most dominant genera belong to Serratia, Bacillus, Paenibacillus, Pseudomonas, Arthrobacter, Exiguobacterium, and Providencia, which have been reported in cold habitats (Fruhling, Schumann, Hippe, Straubler, & Stackebrandt, 2002; Kishore, Begum, Pathan, & Shivaji, 2010; Mayilraj, Krishnamurthi, Saha, & Saini, 2006; Shivaji et al., 2005; Zachariah, Kumari, & Das, 2016; Yadav et al., 2017a; Yadav, Verma, Kumar, Sachan, & Saxena, 2017b, Yadav, Kumar, Dhaliwal, Prasad, & Saxena, 2018a; Yadav, Verma, Sachan, & Saxena, 2017c). The psychrotrophic microbial species; Alishewanella sp., Aurantimonas altamirensis, Bacillus baekryungensis, B. marisflavi, Desemzia incerta, Paenibacillus xylanexedens, Pontibacillus sp., Providencia sp., Pseudomonas frederiksbergensis, Sinobaca beijingensis, and Vibrio metschnikovii have been reported first time from high altitude and low-temperature environments of Indian Himalayas (Verma et al., 2015; Yadav et al., 2015). In another study on wheat microbiome, diverse agro-ecological ecosystem in India, the two psychrotrophic bacteria were first time identified namely Arthrobacter methylotrophus and Pseudomonas rhodesiae (Verma et al., 2015). Extreme low temperature represents unique ecosystems which harbor novel biodiversity which has been extensively investigated in the past few years. Novel species of psychrotrophic microbes including Arthrobacter nicotianae, Brevundimonas terrae, Paenibacillus tylopili, and Pseudomonas cedrina were reported first time from cold deserts of North Western (NW) Himalayas and exhibited multifunctional PGP traits at low temperatures (Yadav et al., 2015). The psychrophilic and psychrotrophic Bacillus and Bacillus derived genera such as Bacillus altitudinis, B. amyloliquefaciens, B. muralis, B. psychrosaccharolyticus, Paenibacillus lautus, Paenibacillus pabuli, Paenibacillus terrae have been reported first time by Yadav et al. (2015). There are several reports on whole genome sequences of novel and potential psychrotrophic microbes (Kim, Shin, Hong, Lee, & Choi, 2012; Singh, Gaba, Yadav, Gaur, & Gulati, 2016). Complete genome sequences of cold-adapted microbes helps to know the adaptation of microbes in extreme cold habitats and also potential genes for functional attributes, for example, A. agilis L77, is an important psychrophilic bacterium isolated from Pangong Lake, Northwest (NW) Himalayas, India. The strain L77 is capable

Role of rhizospheric microbial diversity in plant growth Chapter | 7

151

of producing cold-adapted hydrolytic enzymes and showed different PGP attributes at different low-temperature conditions. The whole genome sequences of psychrophilic bacteria revealed different genes for adaptation and metabolic activities (Singh et al., 2016). On the study of microbiome from cold environments of IHR including, Glacier (Roopkund glacier, Pindari glacier, Gangotri glacier, Lahaul and Spiti); Sub-glacial lakes (Chandratal Lake, Dal Lake, Dashair Lake, Gurudongmar Lake, Pangong Lake); cold desert of Himalayas (Chumathang, Khardungla Pass, Rohtang Pass); ice-coped revivers (Indus River, Zanskar River, Beas River), it was found that more than 66 different genera of 8 different phyla have been sorted out and characterized for different biotechnological perspective (Yadav et al., 2017c). Many studies have been documented in the bacterial and psychrophilic diazotrophic diversity at high altitude and an effort has been made to explore the potential of cold tolerant microbes in agricultural productivity with the target for sustainable hill agriculture (Kumar et al., 2019). A unique diversity of Penicillium species having extremophilic characteristics, isolated from Indian Himalayan soils has been reported by Dhakar, Jain, Tamta, & Pandey (2014a), Dhakar, Sharma, & Pandey (2014b). Penicillium, being a dominant fungal genera in Indian Himalayan soils possess several applications e.g. phosphate solubilization (p-solubilization), enzyme production, biodegradation etc. (Pandey et al., 2008; Pandey, Dhakar, Jain, & Pandey, 2016). Dominance of species of Bacillus in extreme environment is attributed to the capability to resist the environmental stresses owing spore forming nature (Nicholson et al., 2000; 2002). Similarly, cold tolerant species of Pseudomonas have been also characterized for their growth promotion with particular reference to p-solubilization and biocontrol activities (Zaidi, Khan, Ahemad, & Oves, 2009; Jha, Pragash, Cletus, Raman, & Sakthivel, 2009; Qessaoui et al., 2019). Cold adapted fungi are progressively getting more attention due to their ecological and biotechnological significance (Hassan et al., 2016). Hence, diversity of psychrotolerant fungi in hilly regions has been investigated at times. The cold habitats such as cold deserts, glaciers, and subglacial lakes are hot spots of a huge microbial diversity of psychrophilic, psychrotolerant, and psychrotrophic microbiomes. The cold-adapted microbes possess many genes responsible for cold adaptation and alleles with potential applications in various fields. There are several findings on whole genome sequences of novel and potential psychrotrophic microbes such as Arthrobacter agilis (Singh et al., 2016), Cenarchaeum symbiosum (Hallam et al., 2006, Clavibacter sp. (Du et al., 2015), Colwellia chukchansi (Zhang, Guo, Wang, & Chen, 2018), Colwellia psychrerythraea (Methe et al., 2005), Exiguobacterium antarcticum (Carneiro et al., 2012), Exiguobacterium oxidotolerans (Cai, Ye, Chen, & Zhang, 2017, Exiguobacterium sibiricum (Rodrigues et al., 2008), Methanococcoides burtonii (Allen et al., 2009), Octadecabacter antarcticus (Vollmers et al., 2013), Paenibacillus sp. (Dhar et al., 2016), Planomicrobium glaciei (Salwan, Swarnkar, Singh, & Kasana, 2014), and Rheinheimera sp. (Gupta, Gupta, Singh, Chauhan, & Sharma, 2011).

152

Recent Advancements in Microbial Diversity

3  Microbial adaptations in cold high altitude regions Stresses are considered as the major factor for limiting agricultural productivity (Wani, Kumar, Shriram, & Sah, 2016). The microbial diversity of the soil is mainly affected by the soil composition, salinity, pH, nutrient availability, organic inputs, temperature, water-content and other edaphic factors like soil alkalinity and acidity which in turn control the soil quality for sustainable agriculture (Bronick & Lal, 2005). The colonization of extreme temperature environments (low) by various microorganisms in the Himalayan region has already been well reported (Dhakar et al., 2014a; Dhakar et al., 2014b). High altitude ecosystems are generally characterized by low temperature, variable rainfall, reduced atmospheric pressure and soil nutritional stress that has a great impact on biodiversity. High altitude cold environments signify the majority of the Earth’s biosphere and have been successfully colonized by cold-adapted microorganisms that are capable to thrive, survive and even preserve metabolic activity at freezing temperatures (Kumar et al., 2019). The microbes from colder region of the Himalayan soil have several mechanisms that help them in better adaptation to the harsh environmental condition (Joshi, Kumar, Suyal, & Goel, 2017). Microbes present in the soil of the cold region have the ability to grow at 0°C by using several cold tolerance mechanisms that aids and helps in better adaptability and survivability in the cold regions (Mishra, Joshi, Bisht, Bisht, & Selvakumar, 2010). To overcome stress induced by low temperatures, they have developed a variety of adaptive responses at the cellular and molecular level.

3.1  Mechanisms involved in the endurance of cold The extreme environment of low temperature is one of the chief abiotic stresses that act as a limiting factor affecting the agricultural productivity (Zaidi, Dar, Singh, & Singh, 2014). Cold-adapted (psychrophilic) microbes have evolved a number of adaptive strategies in order to sustain their vital metabolic functions under severe conditions. Some of these strategies are the regulation of membrane fluidity, the synthesis of specialized molecules (cold-shock proteins, cryoprotectants, and antifreeze molecules), the regulation of ion channels permeability (osmoregulation), seasonal dormancy, and perhaps the most imperative adaptation to the frost, and the modification of enzyme kinetics (Russell, 1997; Georlette et al., 2004; D’Amico, Collins, Marx, Feller, & Gerday, 2006). Traditional characteristics involved in cold adaptation are:

• Cell Membrane-Associated Changes • Cryoprotectants • Cold acclimation proteins (Caps) • Cold-shock proteins (CSPs) • Ice nucleators factors and antifreeze protein • Cold-adapted enzymes

Role of rhizospheric microbial diversity in plant growth Chapter | 7

153

• RNA degradosomes • Other Substances 3.1.1  Cell membrane-associated changes The fluidity of membrane depends on the degree of saturation of the polar lipids; psychrophilic membranes contain an elevated amount of unsaturated and polyunsaturated and branched fatty acids, with methyl groups and a higher percentage of cis type double bonds (Chintalapati, Kiran, & Shivaji, 2004). The changes in amount and type of methyl-branched fatty acids of Gram-positive bacteria are a possibility to increase membrane fluidity at low temperatures (Russell, 1998). The amount of unsaturated fatty acids contributes to the flexibility of the membrane structure of cold-adapted microorganisms, including eukaryotic photobionts such as diatoms and algae (Morgan-Kiss, Priscu, Pocock, Gudynaite-Savitch, & Huner, 2006). Low temperatures mainly affect the lipid bi-layer of the bacterial cell, making it impermeable to solutes diffusion; the fluidity of the lipid bi-layer must be maintained for the cell to function properly. Microorganisms adjust their cell membrane constituents based on their growth temperatures to certify membrane functions such as solute transport (Russell et al., 1995; Mastronicolis et al., 1998). 3.1.2 Cryoprotectants Cold-tolerant microorganisms are endowed to accumulate several cryoprotectants substances inside their cells, such as glycine betaine (a bacterial cryoprotectant), glycerol, sucrose/bovine serum albumin (S/BSA) and trehalose/dextran (T/D) (Cleland, Krader, McCree, Tang, & Emerson, 2004), sorbitol, mannitol, glucose, and fructose. To overcome the ill effects of cold temperature induced stress, microbes stabilize cellular proteins or prevent cold induced aggregation of proteins, removing free radicals, and membrane fluidity at low temperature. 3.1.3  Cold acclimation proteins Cold-tolerant bacteria produce a set of 20 permanent proteins called cold acclimation proteins (Caps) in response to continuous growth at low temperature. They are essential for the maintenance of both growth and cell cycle at low temperatures. 3.1.4  Cold-shock proteins The synthesis of cold shock proteins (Csps) occur in response to cold shock. A sudden decrease in temperature from the mesophilic range to cold temperatures (10-15°C) creates a stress situation. Therefore, microbial cells respond to such situation by a specific adaptative mechanism, which allows their survival and subsequent growth at lower temperatures. The functional importance of bacterial Csps is directly associated to the formation of stable secondary RNA structures in response to low temperature stress (Polissi et al., 2003). The cold-shock

154

Recent Advancements in Microbial Diversity

proteins Csp A, Csp C, and Csp E were confirmed to possess in vivo and in vitro transcription anti termination activity (Bae, Xia, Inouye, & Severinov, 2000). The regulation of the expression of Csps and their homologues is complex involving auto regulation and is controlled at the level of transcription and translation as well as by the stability of mRNA and proteins. CspA is also thought to enhance translation at low temperature through the elimination of stabilized RNA secondary structures (Jiang, Hou, & Inouye, 1997).

3.1.5  Role of ice nucleators and antifreeze proteins Ice nucleators are ANPs (antinucleating proteins) which either limit super cooling or induce freezing at temperatures below 0°C by mimicking the structure of an ice crystal surface thereby avoiding the damage of cells. They impose an ice crystal like arrangement on the water molecule with their surface and reduce the energy necessary for the initiation of ice formation. Acinetobacter aceticus can release such antinucleating proteins with a mass of 550 kDa. An ice-binding protein of a mass of 54 kDa, isolated from a bacterial strain from an ice core of over 3000 m depth, was able to slow down the recrystallization of ice (Raymond, Fritsen, & Shen, 2007). 3.1.6  Cold-adapted enzymes The most important selective pressure of low temperatures is applied at chemical reaction rates, most of which decrease exponentially as the temperature decreases. Despite this, Psychrophiles produce cold-adapted enzymes that have high specific activities at low temperatures. The usually accepted hypothesis for this cold adaptation is the activity-stability-flexibility relationship, which suggests that psychrophilic enzymes increase the flexibility of their structure to compensate for the “freezing effect” of cold habitats (Johns & Somero, 2004). 3.1.7  Role of RNA degradosomes The degradosome, a protein-complex of several ribonucleases, is the major determinant factor for stability of cellular RNA but it is believed that RNAse R can degrade RNA molecules with extensive secondary structures. This eliminates the necessity of ATP, required by helicase, thereby helping the cell conserve energy at low temperatures (Purusharth, Klein, Sulthana, Jäger, & Jagannadham, 2005). 3.1.8  Other substances Other substances which can play a role in cold adaptation and cryoprotection are carotenoids, which contribute to the stability of cellular membranes (Russell, 2008) extracellular polymeric substances (EPSs), some of them of high molecular weight or heteropolysaccharides (with additions of proteins), which are released by some microorganism into the neighbouring environment and form a kind of gel with cryoprotective effects (Krembs & Deming, 2008); Several bacteria indigenous to cold environments can synthesize PHAs

Role of rhizospheric microbial diversity in plant growth Chapter | 7

155

(Polyhydroxyalkanoates), as a reserve polymer that plays an important physiological role. These polymers are accumulated under unbalanced growth conditions, such as an excess of carbon source with respect to other nutrients such as nitrogen or phosphorus, acting as dynamic reservoirs of carbon and reducing equivalents (Lopez, Pettinari, Nikel, & Méndez, 2015). Genome analysis of C. psychrerythraea revealed an ability to produce PHA linked with its significant ability to produce and degrade fatty acids. S. Alaskensis and P. extremaustralis showed important traits associated to the role of PHAs for low temperature adaptability. Proteome analysis revealed an increased quantity of enzymes linked to PHA synthesis at low temperatures, probably indicating that it may compensate for reduced level of enzyme activity and nutrient transport, as an adaptive strategy, to ensure that this pathway remains functional in the cold climates (Ting et al., 2010). In particular, polyhydroxy butyrate (PHB) production was found to be fundamental for cold growth and freezing survival.

4  Plant-microbes (PM) interaction Plants and microbes are co-evolved and interact with each other in environment. Plant-associated microbes, often referred to as plant microbiota, are an integral part of plants life. The volume of the soils surrounding the roots is influenced chemically, physically, and biologically by the plant root and is commonly referred to as the rhizosphere (Barea, Pozo, Azcon, & Azcon-Aguilar, 2005). It is an extremely favourable habitat for the proliferation of microorganisms which exert a positive impact on plant health and soil fertility. The rhizosphere is rich in nutrients due to the accumulation of plant exudates containing amino acids and sugars that provides a rich source of energy and nutrients for colonizing bacteria (Beneduzi, Ambrosini, & Passaglia, 2012). To be effective, PGPMs must establish and maintain a sufficient population in the rhizosphere region. These microbes induce plant growth through regulating cell division, enlargement, and differentiation (Glick, 2012). However, complex interactions at different level in plant involve such as genetics, physiological, ecological, and morphological events (Islam et al., 2014). These interactions vary and depend upon plant and microbes. Plant-microbial interactions can be performed through a number of direct or indirect mechanisms: nutrient transfer (stemming from vitamin or siderophore production, atmospheric nitrogen fixation, enzymatic decomposition of litter in soil, or conversion of inorganic minerals to soluble compounds, especially phosphorous), direct stimulation of growth through phytohormones (ethylene or indole acetic acid), antagonism towards pathogenic microorganisms (Babalola, 2010; Saleem, Arshad, & Hussain, 2007; Glick, 2012; Van Der Heijden, De Bruin, Luckerhoff, Van Logtestijn, & Schlaeppi, 2016; Zak, Homes, & White 2003). These days, to make agriculture more sustainable and efficient, an alternative method is needed to introduce the agriculture system. Therefore, to explore PM interactions recently clustered regularly interspaced short palindromic repeats (CRISPR)/Cas-mediated genome editing (GE) tools

156

Recent Advancements in Microbial Diversity

has been discovered as of great interest (Shelake, Pramanik, & Kim, 2019). A systematic understanding of the plant-microbes interactions will enable the application of genetic engineering tools to improve the ability of microbes or plants for agronomic trait improvement (Shelake et al., 2019).

5  The role of rhizosphere microorganisms in hilly agricultural area The agricultural importance of cold-tolerant microorganisms arises due to the fact that the cropping cycle in several parts of the world is subject to transient cold periods, which are deleterious to microbial processes such as symbiotic and a symbiotic nitrogen fixation, plant growth promotion, and disease suppression. Rhizosphere competence is essentially a process of niche competition between PGPRs and other microbes present in the vicinity of plant roots, in which resource partitioning, competitive exclusion, and co-existence can all play a part. It is reported that PGPRs colonize more efficiently in poorer microbial communities than in richer soils. The indigenous rhizosphere microbial community can be influenced by large-scale application of PGPRs in field trials. Thus, the use of soil microorganisms, which can stimulate plant growth, will form part of environmentally benign approach for nutrient management and sustaining the ecosystem functions. Agricultural production in the mountains is largely influenced by soil moisture, low organic matter and colder conditions. Microbial inoculants are beneficiary microorganisms that are applied to soil, to improve soil properties, health and productivity of agriculture crops. Thus, the hill agriculture is a low input, low production and survival but a sustainable system (Trivedi et al., 2012). The soils found in the Himalayas have different characters depending on the altitude, the vegetation cover, the slope, the structure and the scenery. The main groups of soils in the Himalayas are brown hills, sub-mountainous soils, mountain pastures and red soils, with the exception of other less important types. Acid soils are generally found in high altitude areas, but may vary from acid to neutral of the western Himalayas, at mid and high altitude regions of the central Himalayas and across all altitudinal ranges in the eastern Himalayas. The subtropical and hill soils are very thin, fertile and may be less than a centimetre deep on steep slopes. These soils are mixed with pebbles and gravel in many areas and the texture varies from sand to sandy loam. The soil contains a large amount of organic matter and nitrogen compounds, but not phosphate compounds. Melanisation (darkening of surface horizon) of landforms in the hill top, side hill slopes and inter hill valley are indicated by higher concentrations of organic carbon with very dark greyish brown to brown and dark brown colour in the surface horizons which is in agreement by Dhir (1967). Millions of people depend on agriculture for their subsistence in IHR, crop production is severely limited in these mountains by environmental factors including low soil fertility, rugged terrains, water deficit, and cold climates.

Role of rhizospheric microbial diversity in plant growth Chapter | 7

157

Mountainous soils are often nutrient deficient, for this reason, mountain agriculture is a low-input, low-production, and subsistence activity, although sustainable one (Trivedi et al., 2012). Therefore, to improve crop productivity without harming soil health, organic farming has been traditionally a preferred option adopted by hill societies worldwide. In this context, the development and use of bio-inoculants (agricultural amendments that use beneficial microorganisms to promote plant growth and health) can be considered as a rewarding alternative for less-intensive and low-input agricultural mountain ecosystems in all tropical, subtropical, and alpine zones. The microbial resource of mountain regions is, therefore of great interest due to its potential beneficial effects on plant productivity and its adaptability to the stressful conditions prevailing in these environments (King, Kostka, Hazen, & Sobecky, 2015). Microbial inoculants are the formulations composed of beneficial microorganisms that hold a great promise to improve crop yield (Isfahani & Besharati, 2012) and play important role in each ecosystem. IHR being one of the hot spots of biodiversity and extreme climatic conditions, which might have vast potential to isolate unique microbiota with rich biotechnological applications. Additionally, the use of bio inoculants also minimizes the production costs of agrochemicals, as well as the serious environmental hazards and the threats to human health posed by their use (Tewari & Arora, 2013). More recently, the importance of rhizosphere microbiome and the possibility of manipulating it to achieve future productivity gains has been highlighted, in relation with emerging concerns on environmental damage, conservation of ecosystems, mitigation of climate change, and food security (Philippot, Raaijmakers, Lemanceau, & Van Der Putten, 2013; Glick, 2014; Velivelli et al., 2015; Adl, 2016; Singh & Trivedi, 2017; Kumar & Verma, 2018). Microbial bioformulations that increase plant performance are essential, especially bioformulations that have complementary and synergistic effects with mineral fertilization (Bargaz, Lyamlouli, Chtouki, Zeroual, & Dhiba, 2018). The microbial flora naturally present in the soil in its native region can be exploited for agricultural productivity and natural conservation. Currently, the cold-adapted microbes have attracted the interest of the scientific community due to their ability to promote plant growth at low-temperatures. In a paramount work in the field, Margesin (2009) clearly demonstrated that slow growth rates of psychrophiles at so-called suboptimal, lower temperatures are compensated by high growth yields and maximized cellular fitness.

6  Enhancement of growth and yield of crops grown in hilly areas The rhizosphere soil supports huge and active microbial populations capable of having beneficial, neutral, or detrimental effects on plant growth. These microorganisms play a considerable role in the life cycle of plants through a series of processes as described in previous sections. A potent microbial strain with

158

Recent Advancements in Microbial Diversity

multiple traits could be used as bioinoculants in the hill and mountain agro ecosystems, where temperature is a determining factor in plant and microbial activity. The selection of native microbes for plant growth is an essential step to reduce the use of energy intensive chemical fertilizers. In general, it is believed that more extreme the environmental conditions of a niche, the lower the diversity of organisms but this is not the case, since the most cold inhospitable environments are dominated by a variety of microorganisms, thereby making them the most versatile of all life forms. When considering agriculture in mountainous area, special attention must be paid to the challenges which it faces such as a dramatic growth in populations which is causing an unprecedented pressure on natural resources. In the climatic context, it is mainly characterized by low soil and atmospheric temperatures especially during the winter months, low soil fertility, limited availability of nutrients and an increased demand for commercial products (crops and livestock) that intensify the use of resources to ensure high yields. For enhancing the production of hilly crops, which are crucial for human diet either there are no improved technologies available or, even if available, they are not affordable to small farmers. Therefore, application of microorganism as a bioinoculum in an agriculture fields seems to be one of the most promising ways to improve the soil consistency and maintenance of the natural flora of soil due to its cost-efficient and eco-friendly nature. The culturable microflora in rhizosphere/ bulk soils along the altitudinal gradient in the IHR was dominated by microbial species belonging to Bacillus and Pseudomonas (bacteria); Streptomyces and Nocardia (actinobacteria); and Aspergillus, Penicillium, and Trichoderma (fungi) (Pandey and Palni, 1998a; Devi, Polashree Khaund, Fenella, Nongkhlaw, & Joshi, 2012; Lyngwi, Koijam, Sharma, & Joshi, 2013). Besides, the microbial communities colonizing a number of tree species belonging to Abies, Betula, and Rhododendron in the IHR was also investigated along an altitudinal gradient that were dominated by antagonistic species of bacteria, actinobacteria, and fungi (Pandey & Palni, 2007). Mishra et al. (2009) examined the effect of seed inoculation with 12 cold tolerant plant growth promoting Pseudomonas strains on wheat growth at 10°C. It was observed that soil inoculated with Pseudomonads significantly improved root length (27.9–70.5%), shoot length (4.7–26.1%), dry root biomass (1.69–3.19-fold increases), dry shoot biomass (1.27–1.66-fold increase) compared with uninoculated control. Rinu and Pandey (2009) isolated B. subtilis, which was found to be compatible with Rhizobium, when used as bioinoculant, the combination enhanced the symbiotic efficiency of lentil when grown under field conditions at a Himalayan location. Other growth parameters like growth, yield, nodulation, root colonization by arbuscular mycorrhizal, and endophytic fungi, were also positively influenced by inoculation with B. subtilis. Similarly, inoculation of soil with another B. subtilis isolate promoted the growth of three crops, one cereal (Oryza sativa) and two millets (Eleusine coracana and Echinochloa frumentacea), in a field study conducted at a mountain location in Uttarakhand (Malviya et al., 2012). Verma, Sharma, &

Role of rhizospheric microbial diversity in plant growth Chapter | 7

159

Chauhan (2018) identified rhizobacterial strains isolated from tomato growing regions falling under mid ranges of Himachal Pradesh viz., Pseudomonas sp., Enterobacter sp., Acinetobacter sp. on and documented that these bacteria were showing plant growth promoting activity and have biocontrol potential against two fungal pathogens of tomato i.e., Fusarium oxysporum and Rhizoctonia solani. Selvakumar et al. (2008a); Selvakumar et al. (2008b) reported the occurrence of cold-tolerant plant growth promoting bacterial strains Pantoea dispersa strain 1A and Serratia marcescens strain SRM from the NW Indian Himalayas. Seed bacterization with these bacterial strains significantly enhanced plant biomass and nutrient uptake of wheat seedling grown at cold temperatures.

7  Mechanisms involved in plant growth promotions For the production of effective fertilizers, different type of soil microorganisms (especially rhizospheric bacteria and fungi) that possess PGP traits usually used for the production of efficient biofertilizers (Vessey, 2003; Lucy, Reed, & Glick, 2004; Smith & Read, 2008; Khalid, Arshad, Shaharoona, & Mahmood, 2009). Bio fertilizer, when applied to the seeds or soil, microbial inoculants directly or indirectly improve the availability of nutrients by fixing thus preventing them from leaching out and enhance plant growth. In general, microbial bioformulation can be categorized into several types such as NF (nitrogen fixers) bacteria; P, K and Zn-solubilization/mobilizing microorganisms; Phytohormone production (production of IAA); Siderophore production; and Biocontrol. The combined use of beneficial microorganisms of multi-traits to develop effective microbial formulations that are highly compatible with mineral inputs, with positive effects on soil, crops and environment, is currently in investigation. It has been documented that psychrotrophic microbes exhibited many PGP attributes such as 1-aminocyclopropane-1-carboxylate (ACC) deaminase activity, nutrients solubilization, N2-fixation, and production of different bioactive compounds such as gibberellic acids, ammonia, cytokinins, Fe-chelating compounds, hydrogen cyanide, and indole-3-acetic acid. The principal mechanism of solubilization of mineral phosphate by phosphate solubilizing bacteria (PSB) is the release of low molecular weight organic acids such as formic, acetic, propionic, lactic, glycolic, fumaric, and succinic acids and acidic phosphatases like phytase synthesized by soil microorganisms in soil (Lee, Mok, Yoon, Kim, & Chung, 2012). Hydroxyl and carboxyl groups from the organic acids can chelate the cations bound to phosphate, thereby converting it into soluble forms. Growth enhancement through enzymatic activity is another mechanism used by plant growth promoting bacteria. PGP strains can produce certain enzymes such as chitinases, dehydrogenase, β-glucanase, lipases, phosphatases, proteases etc. exhibit hyperparasitic activity, attack pathogens by excreting cell wall hydrolases (Choudhary, Sharma, & Gaur, 2011; Garcia-Fraile et al., 2015). Through the activity of these enzymes, plant growth promoting bacteria play a significant role in plant growth promotion particularly to protect them from

160

Recent Advancements in Microbial Diversity

biotic and abiotic stresses by suppression of pathogenic fungi including Botrytis cinerea, Sclerotium rolfsii, Fusarium oxysporum, Phytophthora sp., Rhizoctonia solani, and Pythium ultimum (Gupta, Parihar, Ahirwar, Snehi, & Singh, 2015). PGP bacteria are able to solubilize potassium rock through production and secretion of organic acids (Bechtaoui et al., 2019). Dissolution of the zinc carbonate and zinc oxide may be due to production of organic acids, like gluconic acids. Gluconic acid, and its 2- and 2,5- keto-derivatives are produced by fungi, such as P. luteum and A. niger and bacteria belonging to Pseudomonas or related genera as a result of an external oxidative pathway effective on glucose and other aldose sugars (Bapiri, Asgharzadeh, Mujallali, Khavazi, & Pazira, 2012; Babu-Khan et al., 1995; Williams, Greenwood, & Jones, 1996). Studies done on mechanisms of PGPM traits and their effect on different crops are briefly summarized in Fig 7.1 and Table 7.1

7.1  Biological nitrogen fixation Biological nitrogen fixation (BNF) is a proficient source of nitrogen and it is one of the possible biological alternatives to Nitrogen fertilizers. It could lead to more productive and sustainable agriculture without damaging the environment. It is well known that many associative bacteria fix atmospheric N and supply it to the associated host plants. A variety of nitrogen fixing microbes such as Arthrobacter, Azoarcus, Azospirillum, Azotobacter, Bacillus, Enterobacter, Gluconoacetobacter, Herbaspirillum, Klebsiella, Pseudomonas, and Serratia

FIGURE 7.1  Possible mechanisms of nutrients solubilization by microorganisms.

TABLE 7.1 Traits of pant growth promoting rhizospheric microbes isolated from different hilly regions and their effect on different crops. Features

Locations

Crops

References

Pantoea dispersa 1A and Serratia marcescens

IAA production

IHR

-

Selvakumar et al. (2008a); Selvakumar et al. (2008b)

Pseudomonas sp. strain PGERs17 and NARs9

IAA production and P- solubilization

NW Himalayas

Wheat (Triticum aestivum)

Mishra et al. (2008), Mishra et al. (2009)

P. corrugata

P-solubilization

IHR

Maize (Zea mays)

Trivedi, Pandey, & Palni (2008b)

Pseudomonas

Siderophore production and Biocontrol activity

Garhwal region (Indian Himalaya)

Pea (Pisum sativum)

Negi et al. (2005)

Arthrobacter sp.

P-solubilization, IAA and N2 -fixation

Garhwal region

Rice (Oryza sativa)

Gusain et al. (2015)

Fusarium fusarioides and Trichoderma pseudokoningii

P-solubilization, Siderophore, HCN, Ammonia and IAA production

Central Himalayan region of India

Tomato (Solanum lycopersicum)

Chadha, Prasad, & Varma (2015)

Stenotrophomonasi sp. and Acetobacter

P-solubilization

Himachal Pradesh

Wheat (Triticum aestivum)

Majeed, Abbasi, Hameed, Imran, & Rahim (2015)

Acinetobacter rhizosphaerae

P-solubilization

Cold deserts of the IHR

-

Gulati et al. (2009)

Burkholderia strain AU4I

IAA Production

Himachal Pradesh

Pea (Pisum sativum)

Devi et al. (2012)

Bacillus sp., and Pseudomonas sp.

IAA production

North Himalaya

Wheat (Triticum aestivum)

Joshi, & Bhatt, (2011)

161

(Continued)

Role of rhizospheric microbial diversity in plant growth Chapter | 7

Microorganisms

Features

Locations

Crops

References

Bacillus subtilis CB8A

IAA Production

Himachal Pradesh (TransHimalaya)

Apple (Malus domestica)

Mehta, Walia, Chauhan, Kulshrestha, & Shirkot (2013)

B. subtilis; B. Licheniformis; B. Pumilus; B. Methylotrophicus; B. firmus and B. altitudinis

P-solubilization and other PGP traits

Himachal Pradesh

Tomato (Solanum lycopersicum)

Mehta, Walia, & Shirkot (2015)

B. megaterium

P-Solubilization and IAA

Uttarakhand (Temperate IHR)

Maize (Zea mays) and wheat (Triticum aestivum)

Trivedi et al. (2008a)

Aspergillus niger; trichoderma aperellum and Trichoderma citrinoviride

P-solubilization

North east India

Tea (Camellia sinensis)

Das , Dutta & Barooah (2013)

Pseudomonas aeruginosa PM 105

Biocontrol activity

Assam

Tea (Camellia sinensis)

Morang, Dutta, Kumar, & Kashyap (2012)

Enterobacter hormaechei RCE; E. Asburae RCE 2; E. Ludwogii RCE 5 and K. Pneumonaiae RCE 7

N-fixation, IAA, Psolubilization and Biocontrol activity

Assam and Shillong

Mandarian orange

Thokchom , Kalita, & Talukdar (2013)

Pseudomonas sp. GUDBPKA301

IAA and Biocontrol activity

Assam

Persea bombycina Kost.

Rabha et al. (2014)

Recent Advancements in Microbial Diversity

Microorganisms

162

TABLE 7.1 Traits of pant growth promoting rhizospheric microbes isolated from different hilly regions and their effect on different crops. (Cont.)

Locations

Crops

References

Azospirillum brasilense; A. Amazonense, Bacillus pantothenticus and Pseudomonas pieketti

IAA

Assam

Rice (Oryza sativa)

Thakuria et al. (2004)

Pseudomonas jesenii MP 1

P-solubilization and N2 -fixation

IHR

Cicer arietinum L. (Chickpea), Vigna mungo (L.) Hepper. (Black gram), Vigna radiata (L.) Wilczek. (Green gram), Cajanus cajan (L.) Millsp. (Pigeon pea) and Eleusine coracana (L.) Gaertn. (Finger millet)

Kumar, Suyal, Dhauni, Bhoriyal, & Goel (2014)

Azotobacter chroococcum and Azospirillum brasilense

N2-fixation

Sikkim

Maize (Zea mays) and Tea (Camellia sinensis)

Pandey, Sharma, & Palni (1998)

A. rhizosphhaerae BIHB 723

Growth stimulation and nutrient uptake

Himalayan cold desert

Pea (Pisum sativum), Chickpea, Maize (Zea mays), and Barley (Hordeum vulgare)

Gulati et al. (2009)

P. corrugata

N2 -fixation, Biocontrol activity

Sikkim Himalaya

Maize (Zea mays)

Pandey, Palni, & Hebbar (2001)

Rhizobacteria

P-solubilization; IAA production; N2 fixation

Kashmir

Maize (Zea mays)

Zahid (2015)

163

Features

Role of rhizospheric microbial diversity in plant growth Chapter | 7

Microorganisms

(Continued)

Features

Locations

Crops

References

Serratia fonticola AU-P3

Biocontrol activity

IHR

Wheat (Triticum aestivum)

Devi et al. (2013)

Bacillus sp. BPR7

Biocontrol activity

Uttarakhand

Bean (Phaseolus vulgaris)

Kumar & Dubey, (2012)

RS1-RS 10

Siderophore production

Shimla and Shirmour

-

Gupta et al. (2015)

Bacillus subtilis

Biocontrol activity

Himachal Pradesh

Tomato (Solanum lycopersicum)

Sharma, Sharma, Chauhan, Walia, & Shirkot (2017a)

Exiguobacterium acetylicum 1P

P-solubilization, IAA, Siderophore and HCN production

Uttarakhand

Wheat (Triticum aestivum)

Selvakumar et al. (2010)

Acinetobacter rhizosphaerae BHIB72

P-solubilization, ACC deaminase, IAA, ammonia and siderophore production

IHR

Pea (Pisum sativum)

Gulati et al. (2009)

Pseudomonas corrugata

Ammonia, siderophore and Biocontrol activity

IHR

Pseudomonas sp. FQP PB-3,FQAPB-3and GRP3

P-solubilization, siderophore, ACC deaminase, HCN, IAA production and Biocontrol activity

IHR

Chili and Tomato (Solanum lycopersicum)

Sharma, Jansen, Nimtz, Johri, & Wray (2007)

Pseudomonas fluorescens strain Pf102,Pf-103, Pf-110,Pf173

PGP traits

IHR

Pea (Pisum sativum)

Negi et al. (2005)

Trivedi et al. (2008b)

Recent Advancements in Microbial Diversity

Microorganisms

164

TABLE 7.1 Traits of pant growth promoting rhizospheric microbes isolated from different hilly regions and their effect on different crops. (Cont.)

Locations

Crops

References

Pseudomonas sp. JJS2 and Enterobacter sp. AAB8

N2 -fixation

Indian Western Himalaya

E. coracana

Shukla, Dhauni, Suyal, Kumar, & Goel (2015)

Pseudomonas, Bacillus, Arthrobacter and Rhizobium

PGP traits

Indian Himalaya

Peanut (Arachis hypogaea L.) maize (Zea mays L.), soybean (Glycine max L.) (fodder galega (Galega orientalis L.) and sweet basil (Ocimum basilicum L.)

(Dey, Pal, Bhatt, & Chauhan, 2004), Cassan et al., 2009), (Egamberdieva, 2011), (Hemavathi, Sivakumar, Suresh, & E, 2006)

Pseudomonas aeruginosa strain An-15-Mg

P-solubilization

Himachal Pradesh

Apple (Malus domestica)

Sharma, Pal, & Kaur (2017b)

Exiguobacterium indicum sp. nov.

Multiple plant growthpromoting rhizobacteria (PGPR) traits

Hamta glacier (Himalayan mountain)

Any crop

Chaturvedi & Shivaji, (2006)

Bacillus cecembensis sp. nov

Multiple PGPR traits

Pindari glacier of the Indian Himalayas

Any crop

Reddy, Uttam, & Shivaji (2008)

Pseudomonas chlororaphis GBPI_507

P-solubilization; Biocontrol activity, Siderophores production; HCN, Ammonia; lytic enzymes (lipase and protease)

IHR

Any crop

Jain & Pandey,. (2016)

Stenotrophomonas sp., Herbaspirillum sp and Burkholderia sp,

Biocontrol activity

North Bengal

Tea (Camellia sinensis)

Bhaduri & Roy (2018)

165

Features

Role of rhizospheric microbial diversity in plant growth Chapter | 7

Microorganisms

(Continued)

Features

Locations

Crops

References

Pseudomonas sp., Bacillus sp., Flavobacterium sp., Klebsiella sp., Enterobacter sp., Serratia sp. and Azotobacter sp

P-solubilization

Garhwal Himalaya

Zanthoxylum armatum DC

Srivastava, Bhandari, & Bhatt (2014)

Stenotrophomonas rhizophila

N2 -fixation, IAA Siderophore and Ammonia production

Palampur, HP,India

Triticum aestivum

Kumar et al. (2019)

Bacillus subtilis NRRL B-30408

PGPR traits and Bicontrol activity

IHR

Oryza sativa; Eleusine coracana; Echinochloa frumentacea

Malviya et al. (2012)

Bacillus subtilis CKS1

P-solubilization

Lahul and Spiti

Tomato (Solanum lycopersicum)

Kumar et al. (2015b)

Bacillus thuringiensis KR1, Enterobacter asburiae KR-3, and Serratia marcescens KR-4

IAA, P-solubilization, HCN and Ammonia production

NW Himalaya

Wheat (Triticum aestivum)

Selvakumar et al. (2008c)

Rahnella sp.

P-solubilization, ACCdeaminase activity, Ammonia and Siderophore production

Lahaul and Spiti (Indian trans-Himalayan region)

Pisum sativum, Zea mays,Hordeum vulgare, and Cicer arietinum

Vyas et al. (2010)

Serratia marcescens SRM

IAA, HCN and Siderophore production

Almora

Wheat (Triticum aestivum)

Selvakumar et al. (2008b)

Recent Advancements in Microbial Diversity

Microorganisms

166

TABLE 7.1 Traits of pant growth promoting rhizospheric microbes isolated from different hilly regions and their effect on different crops. (Cont.)

Features

Locations

Crops

References

Acromobacter sp. PB-01, Tetrathiobacter sp. PB-03 and Bacillus sp. PB-13.

P-solubilization, IAA and siderophore

Uttarakhand (Northern India)

Indian mustard

Kumar et al. (2013)

E. acetilycum 1P

P-solubilization, IAA and HCN siderophore production

Uttarakhand NW- IHR

Pea (Pisum sativum) and wheat (Triticum aestivum)

Selvakumar et al. (2009b); Selvakumar et al. (2010)

Pseudomonas lurida M2RH3

P-solubilization

Uttarakhand (Munsiyari and Pithoragarh)

Wheat (Triticum aestivum)

Selvakumar et al. (2011)

Pseudomonas corrugata

P-solubilization

Sikkim

-

Pandey, Palni, Mulkalwar, & Nadeem (2002b)

Bacillus subtilis

Biocontrol activity

Uttaranchal Himalaya

Tea (Camellia sinensis)

Chaurasia et al. (2005)

Pseudomonas strain GRP3A

Siderophore production

IHR

Mung bean (Vigna radiata L)

Sharma ,Johri, Sharma, & Glick, (2003)

Pseudomonas migulae S10724

N2 -fixation

IHR

Green gram (Vigna radiata (L.)

Suyal, Shukla, & Goel (2014)

Lysinibaccilus macroides ST-30

P-solubilization

Uttarakhand (Munsyari, Kandakhal and Nainital)

Chickpea (Cicer arietrinum L.)

Tomer et al. (2017)

Azotobacter sp.

N2 -fixation

Sikkim

Maize (Zea mays)

Pandey et al. (1998)

Abbreviations: IHR: Indian Himalayan regions; P: Phosphate; IAA: Indole Acetic acid; HCN: Hydrogen cyanide; ACC: 1-aminocyclopropane-1-carboxylate deaminase; -: no crops study; NW: North Western.

Role of rhizospheric microbial diversity in plant growth Chapter | 7

Microorganisms

167

168

Recent Advancements in Microbial Diversity

have been isolated. The twin combination of mineral fertilizer and inoculation with NF bacteria (A. cholococcum, Azospirilum brasilense, Azospirilum lipoferum, Sinorhizobium spp., Burkholderia spp., and Pseudomonas spp.) significantly improved yield of numerous agriculturally important crops including legumes (Gupta, Dubey, & Maheshwari, 2002; Pandey & Maheshwari, 2007; Shata, Mahmoud, & Siam, 2007; Yasari, Azadgoleh, Mozafari, & Alashti, 2009; Shoghi-Kalkhoran, Ghalavand, Modarres-Sanavy, Mokhtassi-Bidgoli, & Akbari, 2013). While, diazotrophic endophytes fix nitrogen and make it available to non-leguminous crops (Boddey, Polidoro, Resende, Alves, & Urquiaga, 2001; Yoneyama et al., 2017). Previous research on symbiotic nitrogen fixation (SNF) at low temperatures focused more frequently on cash or forage crop plants and little is known about the effect of cold on SNF on annual legume cover crops or their performance in high tunnels during the winter. In the upper Midwest and other cold climates, commonly grown winter annual legumes include hairy vetch (Vicia villosa), red clover (Trifolium pratense), and field peas (Pisum sativum), with other species of clover and medics used less frequently (Brandsæter, Heggen, Riley, Stubhaug, & Henriksen, 2008; Holderbaum, Decker, Messinger, Mulford, & Vough, 1990; Silva & Delate, 2017). The cultivation of cover crop mixtures can also help to achieve more than one ecosystem function at a time, depending on the producer’s objectives, planting period, and soil conditions (Blesh, 2018). For example, a fall-planted mix of winter rye, hairy vetch and tillage radish (Raphanus sativa) can scavenge the excess nitrogen didn’t used by the prior cash crop (rye) (Ranells & Wagger, 1997), fix more nitrogen to be released in the spring and fertilize the next commercial crop (vetch) (Couëdel et al., 2018), and break the soil compaction (radish) (Abdollahi & Munkholm, 2014).

7.2  Phosphate, potassium and zinc solubilization Phosphorus (P) is one of the essential elements necessary for the development and growth of plants; it represents approximately 0.2% of the dry weight of a plant (Linu, Sreekumar, Asok, & Jisha, 2018). It is next to nitrogen among mineral nutrients that often limit the growth of crops (Azziz et al., 2012; Tak, Ahmad, Babalola, & Inam, 2012). Phosphate solubilization by rhizospheric microflora is considered as one of the most important means to promote plant growth. P can be either close up within or else fixed at the surface of soil minerals like Fe and Al hydrous oxides (sesquioxides) (Schaller, Taylor, Rodelas, & Schindelholz, 2017). Free cations of Al and Fe react easily with inorganic forms of P, which leads to relatively insoluble precipitates and this reversible process is known as “P fixation” (Johnson & Loeppert, 2006; Oswald, Calvo Velez, Zúñiga Dávila, & Arcos Pineda, 2010). The primary report of P solubilization at low temperatures was previously made by Das, Katiyar, & Goel (2003) who deliberate cold-tolerant Pseudomonas mutants for their phosphate solubilization activity at low temperature (10°C). They found that all the cold-tolerant mutants

Role of rhizospheric microbial diversity in plant growth Chapter | 7

169

were more effective than their respective wild type counterparts for phosphate solubilization activity at 10°C in contrast to 25°C. After that, a rhizospheric phosphate solubilizing strain of Acinetobacter was isolated from the cold deserts of the IHR by Gulati, Vyas, Rahi, & Kasana (2009). Pandey, Trivedi, Kumar, & Palni (2006) isolated a cold-tolerant P-solubilizing and antagonistic strain of P. putida, from a subalpine site of Indian central Himalaya. This strain was able to solubilise P in the range of 4–28°C temperature. Recently, Selvakumar et al. (2009a) identified cold-tolerant P-solubilizing P. fragi strain. This bacterial strain has capacity to solubilize P at temperatures ranging from 4 to 30°C. In addition, a significant increase in the germination percent, germination rate, biomass, and nutrient uptake of wheat seedlings was found under cold temperature conditions was also observed by Suleman et al. (2018). Potassium (K) is the third major macronutrient crucial for plant growth and development. The soluble potassium concentrations in the soil are generally very low and more than 90% of potassium in the soil exists as insoluble rocks and silicate minerals forms (Rawat, Sanwal, & Saxena, 2016). Additionally, due to unbalanced application of chemical fertilizer, K deficiency is becoming one of the key limitations in agricultural crop production. Without adequate potassium, the plants will have poorly developed roots, slow growth, small seeds and have lower yields. Rhizobacteria that promote K-solubilization such as Acidothiobacillus ferrooxidans, Bacillus edaphicus, Bacillus mucilaginosus, Burkholderia, Paenibacillus sp. and Pseudomonas has been accounted to release K in accessible form from K bearing minerals in soils (Sheng, 2005; Liu, Lian, & Dong, 2012; Meena, Maurya, & Verma, 2014; Kumar et al., 2015a; Kumar et al., 2015b). Zinc (Zn) is an another essential micronutrient since it is involved in various plant metabolic processes, such as protein synthesis, carbohydrate, lipid and nucleic acid metabolism, as well as the activation of enzymes such as RNA polymerase, superoxide dismutase, alcohol dehydrogenase, carbonic anhydrase, etc. (Palmer & Guerinot, 2009). Moreover, Zn is also essential for the production of proteins and auxins (Mandavgade, Waikar, Dhamak, & Patil, 2015). The amount of available Zn in the soils of Uttarakhand is 0.03–25.86 mg kg−1 (Fertilizer Association of India, 2011). However, often K and Zn have received less attention than N and P in most of the crop production systems. Unavailable zinc can be reverted back to available form by inoculating fungal strains to the soil. The genera Burkholderia and Acinetobacter were investigated for the growth promotion, yield and Zn uptake in grains of rice (Oryza sativa) plants (Vaid, Gangwar, Sharma, Srivastava, & Singh, 2014).

7.3  Phytohormone production (IAA production) Microorganisms are also known for synthesis of plant hormone IAA (Spaepen, Vanderleyden, & Remans, 2007), an auxin, a member of phytohormone group that is generally considered as an important native auxin (Fu et al., 2015).

170

Recent Advancements in Microbial Diversity

These plant hormones acts as chemical messengers and are responsible for plant growth and maintenance with respect to cold environment. As a signaling molecule for regulation of plant growth that also includes organogenesis, cell division, expansion, differentiation and regulation of genes. Rhizobacteria that produces auxin has been known improve growth and yield of plant (Patten & Glick, 2002). As reciprocal signaling molecule, IAA is involved in gene expression in some microorganisms and have important role in plant and rhizobacterial interactions. With respect to plant defense against numerous phyto pathogens, IAA is down regulated as signaling molecule, as has been evident to enhance the susceptibility of plants to pathogenic bacteria by application of IAA exogenously. The presence of cold-tolerant PGP microbial strains (Pantoea dispersa 1A and Serratia marcescens SRM) had been reported by Selvakumar et al. (2008a), Selvakumar et al. (2008b) from the North-West of Indian Himalaya Region (IHR) that was observed to synthesize IAA at 4 and 15°C. Inoculation of seeds with such microbial strains considerably enhanced nutrient absorption and increased biomass of wheat grown at low temperature. Pseudomonas sp. strain PGERs17 and NARs9 were described to tolerate cold as well as for produce IAA at cold temperature were described by (Mishra et al., 2008; Mishra et al., 2009). Seed inoculation with these strains improved the germination of seeds as well as the length of root and shoots of seedlings of wheat that were grown at low temperatures. Little attention has been received in past to synthesis of IAA by cold tolerant bacterial species, but certain studies have been focused to develop biofertilizers for hilly terrains of Himalayan regions. High concentration of IAA synthesized by P. dispersa cultivated at 4°C was reported by (Selvakumar et al., 2008a). Pseudomonas strain PGERs17 was observed to produce 1.38, 8.33 and 13.15 mg ml-1 of IAA at 4, 15, and 28°C respectively, incubated for 72 hrs by (Mishra et al., 2009). Cold tolerant strain of Rahnella sp. Production of various auxin hormones (Indole acetic acid, indole-3-acetaldehyde, indole-3-acetamide, indole-3-acetonitrile, indole-3-lactic acid, and indole-3-pyruvic acid) was observed in nutrient media that was supplemented with tryptophan, by cold tolerant Rahnella species by (Vyas et al., 2010). E. acetylicum produced 10.04 mg ml-1 of IAA in tryptone supplemented media at 4°C (Selvakumar et al., 2009b). It has been also reported that production of IAA at different growth temperatures in medium supplemented with tryptophan from Bacillus megaterium was reported by (Trivedi & Pandey, 2008a).

7.4  ACC deaminase activity Ethylene is an important plant signalling molecule that plays a role in several plant functions including seed germination, root hair development, root nodulation, flower senescence, leaf abscission and fruit ripening (Wang, Li, & Ecker, 2002). Ethylene production in plants increases after exposure to biotic and abiotic stress, including extreme salinity, temperature, drought, and infection by viral, bacterial and fungal pathogens (Iqbal et al., 2017). It has been explored

Role of rhizospheric microbial diversity in plant growth Chapter | 7

171

that some microbes have an ACC-deaminase enzyme that hydrolyses ACC, the precursor of ethylene into ammonia and α-ketobutyrate, thus reducing ethylene levels that can inhibit plant growth (Singh, Shelke, Kumar, & Jha, 2015). Therefore, it positively influences plant growth by producing ACC deaminase. Currently, bacterial strains showing ACC deaminase activity have been found in a wide range of genera such as Achromobacter, Acinetobacter, Agrobacterium, Alcaligenes, Bacillus, Azospirillum, Enterobacter, Burkholderia, Ralstonia, Pseudomonas, Rhizobium and Serratia (Ahemad & Kibret, 2014; Shaharoona, Arshad, & Khalid, 2007a; Shaharoona, Jamro, Zahir, Arshad, & Memon, 2007b; Nadeem, Zahir, Naveed, & Arshad, 2007; Zahir, Munir, Asghar, Shaharoona, & Arshad, 2008; Zahir, Ghani, Naveed, Nadeem, & Asghar, 2009; Kang, Kim, Yun, & Chang, 2010). Vyas et al. (2010) reported ACC deaminase activity of Rahnella sp., isolated from Trans Himalaya. Acinetobacter rhizosphaerae strain BIHB 723 isolated from rhizosphere of Hippophae rhamnoides was also found to have ACC deaminase activity at lower temperature (Gulati et al., 2009). Bacterial strains containing ACC deaminase can at least mitigate the negative impact of alleviated stress-induced by ethylene on plants. Like many other abiotic and biotic factors, speed up ethylene production under high and chilling temperatures, which has been widely reported by researchers in both the case of plant tissues and rhizospheric microbial species. Plants with the expressions of ACC deaminase possibly survive in this unfavourable situation by lowering the level of ethylene under other environmental stresses (Saleem et al., 2007). A psychrotolerant ACC deaminase producing bacterium P. putida UW4 was found to promote canola plant growth at low temperature under salt stress (Cheng, Park, & Glick, 2007). In this view, the role of ethylene in stress physiology much more efforts are needed to make out the role of ACC deaminase producing microbial strains in the growth promotion of plants inhabiting the cold regions.

7.5 Siderophore Iron (Fe) plays a considerable role in different physiological and biochemical pathways in plants (Aguado-Santacruz, Moreno-Gomez, Jiménez-Francisco, García-Moya, & Preciado-Ortiz, 2012). Microbes have developed specialized mechanisms for the absorption of Fe under Fe-limiting conditions; consist of the production of low molecular weight iron chelating compound, known as siderophores (Iron carrier), to competitively acquire the ferric ion (Ahmed and Holmström , 2014). Microbes release siderophores to trap iron from mineral phases by the formation of soluble Fe3+ complexes that can be absorbed by active transport mechanisms. However, its availability is limited due to the rapid oxidation of ferrous (Fe2+) to ferric (Fe3+) state (Wilson, Bogdan, Miyazawa, Hashimoto, & Tsuji, 2016). Siderophores offers plants and bacterial survival as they induce competition that results in exclusion of fungal pathogens and other microbial competitors in the rhizosphere by reducing the availability of iron for survival (Masalha, Kosegarten, Elmaci, & Mengel, 2000; Wang, Knill, Glick,

172

Recent Advancements in Microbial Diversity

& Défago, 2000). The role of siderophores in the biocontrol of phytopathogens has also been demonstrated with pseudobactin, the siderophore produced by PGP Pseudomonas strain B10 (Kloepper, Leong, Teintze, & Schroth, 1980). It was found that Acinetobacter rhizosphaerae, Pantoea dispersa, Rahnella sp., Bacillus megaterium, and various Pseudomonas spp. formed a halo in CAS agar, indicative of siderophore production at lower temperature (Negi, Garg, & Kumar, 2005; Tripathi, Munot, Shouche, Meyer, & Goel, 2005; Pandey et al., 2006b; Selvakumar et al., 2008b; Selvakumar et al., 2010; Trivedi et al., 2008b; Trivedi & Pandey, 2008a; Gulati et al., 2009; Mishra et al., 2009; Vyas et al., 2010). Katiyar and Goel (2004) developed a cold-tolerant Pseudomonas fluorescens mutant, whose rhizosphere colonization increased with 17 times increased siderophore production. This mutant strain positively promoted the growth of Vigna radiata at 25 and 10°C. Still, the studies on siderophore-mediated growth promotion by psychrotolerant bacteria still remain in its infancy and need to be probed further.

7.6  Biocontrol activity World agriculture face a huge loss every year incurred due to infection by pathogenic organisms. The application of microorganisms for diseases control seems to be one of the most promising ways. Biocontrol systems are ecofriendly, costeffective and involved in maintenance of innate soil flora and improving the soil consistency. Biocontrol agents restrict growth of pathogen as well as few nematodes and insects (Postma, Montanari, & van den Boogert, 2003; Welbaum, Sturz, Dong, & Nowak, 2004). Recent studies signify that biological control of bacterial wilt disease could be attained using antagonistic bacteria (Chen, Bauske, Musson, Rodriguez-Kabana, & Kloepper, 1995). The competitiveness of a biocontrol agent is an important aspect which is its ability to persist and proliferate. However, the behaviour of a particular microbe in the soil is often difficult to predict because of its persistence in the soil might get influenced by several different factors. Hence, to act effectively, the biocontrol agent must remain active in a wide range of conditions viz., pH, different ions concentrations and temperature. Many fungal phytopathogens are the most destructive when the soil temperature is low; hence it is reasonable to expect biocontrol agents to be equally cold-tolerant. McBeath (1995) stated the isolation of several strains of Trichoderma sp. that acted as biocontrol agents at low temperatures (4-10°C) against various pathogenic fungi. Negi et al. (2005) characterized a group of cold tolerant Pseudomonads from the Garhwal region of the Indian Himalayas. These strains produced siderophores and showed PGP activity at temperatures ranging between 4-25°C. Seeds inoculation with these isolates resulted in the suppression of the root borne diseases of garden pea. A novel bacterium Exiguobacterium acetylicum strain 1P which is capable of producing siderophores at 4°C have been isolated from a high altitude soil in the NW Indian Himalaya additionally inhibiting the growth and development

Role of rhizospheric microbial diversity in plant growth Chapter | 7

173

of Rhizoctonia solani, Sclerotium rolfsii, Phythium, and Fusarium oxysporium under in vitro and pot culture conditions has been described by Selvakumar et al. (2009b). Malviya, Pandey, Trivedi, Gupta, & Kumar (2009) have isolated antagonistic, chitinolytic, psychrotolerant strains of Streptomyces from glacial sites of the Indian Himalayas and found that these strains inhibit the growth of several plant pathogenic fungi. Therefore, application of microbes to control of disease seems to be one of the most promising ways to improve the soil consistency and maintain the natural flora of soil due to its ecofriendly and cost effective nature.

7.7  HCN production HCN is a common secondary metabolite produced by many rhizobacteria and is hypothesize to play a role in biological control agent (De fago & Haas, 1990). The production of HCN by some strains of Pseudomonas fluorescens can suppress soil borne pathogens (Voisard, Keel, Haas, & Dèfago, 1989). In the past, several scientists have demonstrated role of HCN in disease inhibition in various crops (Stutz, Défago, & Kern, 1986; Voisard et al., 1989; De fago & Haas, 1990). PGERs17 (MTCC 9000) isolated from North Western Indian Himalayas was also found with HCN producing ability with other features that promote plant growth (Mishra et al., 2008). The isolated culture was showing maximum similarity with Pseudomonas vancouverensis. Pantoea dispersa strain 1A strain isolated from NW Indian Himalayas, endowed with several plant growth promotion traits along with HCN production was found to be positive for nutrient uptake and growth enhancement of wheat. In another study, Yadav et al. (2015) bacteria Exiguobacterium acetylicum strain 1P isolated from rhizosphere soil of the NW Indian Himalayas also showed positive results for HCN production. However, many researchers have documented contradictory results regarding growth promotion of plants through cyanide production. Cyanide is a potential inhibitor of enzymes involved in main metabolic processes of plants, including respiration, CO2 and nitrate absorption, carbohydrate metabolism, and may also bind with the protein plastocyanin to block photosynthetic electron transport (Owen & Zdor, 2001). The biocontrol hypothesis has been disproved as the level of HCN produced by the rhizobacteria in vitro does not correlate with the observed biocontrol effects but rather indirectly increase the availability of phosphate by geochemical processes in the substrate (e.g., chelation of metals) (Rijavec & Lapanje, 2016).

8  Biofertilizers as a tool for sustainable agriculture Excessive use of chemical fertilizers, insecticides and pesticides by farmers in a agriculture field to enhance crop growth and yield is detrimental to environment and to human helth as well which ultimately harms the crop productivity. Hence, the prompt need for suitable alternatives arises to overcome the negative

174

Recent Advancements in Microbial Diversity

effects of chemical fertilizers. That is why many mountain families are facing food scarcity which contributes to the chain reaction process of povertyresource deterioration-scarcity-poverty (Jodha & Shrestha, 1993) and to feed the increasing world population, novel and potential approach should need to boot agriculture productivity sustainably. It is, therefore, imperative to explore new options for increasing the yield and carrying capacity of farms, in order to develop the livelihoods of marginal mountain households (Partap, 1999). Application of beneficial microbes in an agriculture land has potential alternative to harmful chemical fertilizers and pesticides. In a broad sense, the term biofertilizer is referred as all organic resources that are utilized for plant growth and development, and are rendered in available form for nutrients absorption through microorganisms or plant associations or interactions. Use of biofertilizers is very promising approach for improving the agricultural productivity of farmers without serious economic or environmental impacts. In another definition, a biofertilizer can be defined as a product containing live or latent cells of agriculturally beneficial strains of microorganisms that are applied to seeds or soils to build up the numbers of such microorganisms and accelerate certain microbial processes to augment nutrient acquisition by plants (Motsara & Roy, 2008). It consist of nitrogen fixers (N-fixers) (Rhizobium, Azotobacter, Azospirillum, cyanobacteria/blue-green algae, Azolla), nutrients solubilizing bacteria (N, P, K and Zn), and mycorrhizal fungi. Improvement in agriculture is done through the application of PGPM’s which is beneficial for soil health and farmers is a cost-effective and sustainable approach.

9  Use of carriers for biofertilizers production Biofertilizers are usually carrier-based inoculants having effective microorganisms. The survival and colonization of microbial inoculants in the plant root is important for them to be able to have noteworthy effect on plant growth and health of crops under hostile environments (Rekha, Lai, Arun, & Young, 2007; Khavazi, Rejali, Seguin, & Miransari, 2007) and having low or high temperatures and poor nutrients is an additional problem for the survival of bioinoculants. Therefore, improved methods of formulating and using means to ensure efficient distribution of bioinoculants in agricultural production systems under difficult conditions should be considered. Addition of microorganisms in carrier material allows easy-handling, long-term storage and high efficiency of biofertilizers. A suitable carrier material have to be cheap, easily obtainable, and should have a high water-holding ability and high in organic matter content, and a favourable H+ concentration (Gaind & Gaur, 1990). The carrier is the main part (by weight or volume) of the inoculants that aids to supply a proper quantity of PGPM in a good physiological condition (Smith, 1992). The designed should be able to provide an appropriate microenvironment for the PGPM and should ensure an adequate shelf life of the product (at least 2–3 months for commercial purposes, possibly at room temperature). Carriers

Role of rhizospheric microbial diversity in plant growth Chapter | 7

175

used for bacterial inoculants protect them from various stresses and prolong their life (Kumar, Trivedi, & Pandey, 2007; Ardakani, Heydari, Khorasani, & Arjmandi, 2010). Therefore, carrier is important for the viability of inoculums in an appropriate formulation. The carrier constitue materials which can be of various sources: inorganic, organic or synthesized from specific molecules. Availability and cost are the main aspects influencing the choice of a carrier. A good carrier should have following properties: low cost and availability in adequate amounts, good pH buffering capacity, easy to process and free of lump-forming materials, near-sterile or easy to sterilize by autoclaving or by other methods (e.g., gamma-irradiation), and good moisture absorption capacity (Keyser, Somasegaran, & Bohlool, 1993). In addition a carrier that shall be used for seed coating, a good adhesion property to seeds is also important (Hegde & Brahmaprakash, 1992). Several materials have been evaluated as possible carriers of bacterial inoculants, including alginate beads (Trivedi, Pandey, & Palni, 2005), peat (Albareda, Rodríguez-Navarro, Camacho, & Temprano, 2008), biochar (Hale, Luth, & Crowley, 2015), perlite (Daza et al., 2000, Khavazi et al., 2007) and vermiculite (Sangeetha & Stella , 2012). Arora, Tiwari, & Singh (2014) studied other materials, such as bagasse, sawdust and wood ashes, which may contain microbial inoculants. It has been also discovered that coriander; sawdust and bagasse shells could support the greatest amount of viable cells of rhizobia and Pseudomonas strains (Trivedi et al., 2005). Alginate beads can support a sufficient amount of live cells to assure inoculation up to several months (Trzcinski, Malusa, & Sas Paszt 2011; Van Veen, van Overbeek, & van Elsas, 1997). Calcium alginate gel (CA), a biodegradable microcapsule, is another material widely used as a medium for bacterial immobilization, which can protect cells and have long-term effects in hostile environments (Wu, Zhao, Kaleem, & Li, 2011). Besides, survival rates of microbial inoculum in support material are different. For example, perlite-based inoculums can maintain a larger population of microorganisms such as Rhizobium leguminosalam bv. Phaseoli, Rhizobium tropici, Bradyrhizobium japonicum and Bacillus megaterium are used as peat inoculum for 6 months at room temperature (Daza et al., 2000). Trivedi et al. (2005) observed a maximum number of PGPR Bacillus subtilis and Pseudomonas corrugata based on alginate in the rhizosphere of corn (Zea mays) grown six weeks, compared with a carbonbased formulation. However, it is not effortless to get a carrier that meets the desired qualities but a carrier should be free from microbial contamination, and can optimise the growth of the biofertilizer microorganisms (Phua, Khairuddin, & Ahmad, 2009). Trivedi et al. (2005) studied large numbers of alginate-based PGPR Pseudomonas corrugata and Bacillus subtilis in the rhizosphere of 6-week grown maize (Zea mays) as compared to a charcoal-based formulation. On the other hand, Peat moss which contains huge availability of high nitrogen and labile carbon content was found to be the best for survival of E. cloacae

176

Recent Advancements in Microbial Diversity

UW5 after 4 weeks in non-sterile soil (Hale et al., 2015). The talc powders containing 1% carboxy methyl cellulose have broad-spectrum antifungal activity and suppression of fungal pathogens can be done if employed as carrier for bacterial inoculants (Negi et al., 2005). Albareda et al. (2008) investegated the survival of several PGPR strains including Bradyrhizobium, Mesorhizobium and Sinorhizobium strains in different carrier materials and liquid formulations such as bagasse, cork compost, attapulgite, sepiolite, perlite and amorphous silica. Rebah, Tyagi, & Prevost, 2002) studied sewage sludge as a carrier for Sinorhizobium meliloti and observed that dehydrated sludge is a survival factor for rhizobia. Sludge was considered as a non-toxic and economical raw material for microbial inoculation. Whereas, Ardakani et al. (2010) used bentonite as a mineral carrier for the preparation of Pseudomonas fluorescens, which had more stimulatory effect compared to peat and rice bran formulated inoculants. Bacterial Biofilms are also used as a possible carrier, biofilms can grow onto inert supports (brick, concrete, resin, clay charcoal and sand particles) or biofilms can grow all around the particles, and the size of the biofilm particles enlarges with time usually to several mm in diameter and biofilms that are formed as a result of aggregate formation also called granular.

10  Liquid bio-inoculums as biofertilizers Liquid formulations (LFs) are being developed that certify more quality over the traditional carrier based biofertilizers initiating a new era in the biological input technology. Liquid inoculants can be based on broth cultures, mineral or organic oils, or on oil-in-water suspensions. Liquid bioinoculant preparation is cyst based and can be stored at room temperatures. It has a very high microbial load of more than 1012 cells ml-1 and has a significantly enhanced shelf life of more than 3 years as compared to 6 months of carrier based formulation. At present, Azotobacter liquid biofertilizer is used as inoculants for most of field crops viz. Fibre, cereals, fruits, millets, vegetables and oil producing commercial crops. Liquid biofertilizer is the solution to the problems where no solid carrier is needed. Vendan and Thangaraju (2007) accounted liquid and cyst formulation of Azospirillum showed improved adherence, survival on seeds, roots and in the rhizosphere than the other carrier-based forms, which shows that liquid biofertilizer has greater potential than carrier-based biofertilizer. Previous it has been perceived that liquid biofertilizers increase the yield of chickpea (Kyaw & Khin, 2008); soybean (Son, Thu, Duong, & Hiraoka, 2007; Tittabutr, Payakapong, Teaumroong, Singleton, & Boonkerd, 2007); tomato, Chinese cabbage, lettuce and hot pepper (Jee, 2009); pepper and cucumber (Han & Lee, 2006). Similarly, Jee (2009) documented that liquid biofertilizer EXTN-1 was able to control bacterial wilt of tomato caused by Ralstonia solanacearum in hydroponics with increased yield. Traditionally, liquid biofertilizer is prepared from fermentation of effective microorganisms, which was suggested to be utilized

Role of rhizospheric microbial diversity in plant growth Chapter | 7

177

within three months (Hasarin and Vidaya , 2008). Therefore, development of low-cost and long shelf-life liquid biofertilizers was conducted at Malaysian Nuclear Agency (Nuclear Malaysia). Nutrient Broth liquid biofertilizer retained at low temperatures showed considerably high survival rates after storage for six months as compared to other formulations and treatments. Since, no carrier is needed for these liquid biofertilizers they have great potential to be promoted as low-cost and long shelf-life products suitable for cultivation system and agricultural industry.

11  The current status of effectiveness of bioinoculants developed from native PGPM Microbes function as biofertilizers, bio pesticides, and plant growth promoting agents and have been employed to improve crop growth in many countries around the world, but especially in emerging and developing nations (Bashan, de-Bashan, Prabhu, & Hernandez, 2014). Plant growth promotion, suppression of plant diseases and rhizosphere competence (colonization and survival on plant roots) by PGPR, especially Bacilli, have been considered as critical requisites for the development of commercial products (Borriss, 2011; Chowdhury et al., 2013). Currently, bioinoculants are formulated mostly as single entities (Bashan et al., 2014) as well as consortia of multiple bacteria and fungi, which have synergistic PGP attributes to promote the growth of different crops. In some cases, PGPB helps the plant grow under extreme conditions, such as aridity, salinity, drought and nutrient deficiency and (Vilchez & Manzanera, 2011; Wang et al., 2012; Khan et al., 2017; Shinde, Cumming, Collart, Noirot, & Larsen, 2017). To discover the most effective bacteria; they must first be isolated from their original source; identified, and analyzed for PGP traits they own to support plant growth. Moreover, their success under both natural conditions and laboratory needs to be verified, and their potential risks to other plants, animals, and humans must be firmly evaluated. At last, the issue of whether natural soil microbiomes are negatively affected by adding foreign microbes must also addressed (Fig 7.2). As mentioned earlier, the characterization of the strains is done thoroughly which is crucial along with tests for pathogenicity and toxicity tests to eliminate strains that posses even a minimal risk. In the lab, Caenorhabditis elegans has been used as a model organism to obtain insight into whether certain bacterial strains of Burkholderia, Pseudomonas, Serratia, and Stenotrophomonas were or were not harmful to the nematodes (Aballay & Ausubel, 2002; Zachow, Pirker, Westendorf, Tilcher, & Berg, 2009; Angus et al., 2014). Ecological toxicity must also be considered because a wide range of microand macroscopic organisms could be affected by inoculating novel PGP strains (Stephens & Rask, 2000; Köhler and Triebskorn, 2013). Vílchez, Navas, González-López, Arcos, & Manzanera (2016) proposed the Environmental and Human Safety Index (EHSI) that evaluates the bio safety of the bacterial strains

178

Recent Advancements in Microbial Diversity

FIGURE 7.2  Major steps for Bioformulation.

used as bioinoculants. Many microbes are already observed as non-pathogenic (Risk Group 1/BSL1), including most species of Rhizobium and allied genera as well as Azospirillum and Azotobacter species, which fix nitrogen and also exhibit numerous PGPB traits. Rhizobial species and Azospirillum are well formulated to be used as the commercial inoculants such as Monsanto BioAg (Monsanto BioAg, 2015a) or Seedland (Seedland, 2013). Moreover, many Bacillus, Paenibacillus and Brevibacillus species are commonly used as biocontrol agents and may also be employed for their PGP ability. Bacillus species are frequently coinoculated with rhizobia or mycorrhizal fungi to establish effective tripartite symbioses with plants (Francis, Holsters, & Vereecke, 2010; Schwartz et al., 2013). A number of Bacillus species are already available as bioinoculants (Monsanto BioAg, 2015b). Nonetheless, some Bacillus, Paenibacillus, and Brevibacillus species are animal pathogens, namely Bacillus anthracis, Paenibacillus larvae, and Brevibacillus laterosporus (Francis et al., 2010; Grady, MacDonald, Liu, Richman, & Yuan, 2016; Marche, Mura, Falchi, & Ruiu, 2017) and, hence, should not be used as PGPB. Micromonospora strains are important agents for biocontrol and plant growth promotion (Martinez-Hidalgo, Galindo-Villardón, Trujillo, Igual & Martínez-Molina, 2014; Martinez-Hidalgo, García, & Pozo, 2015). Like the Firmicutes, Actinobacteria have been used for co-inoculation onto legumes with nitrogen-fixing rhizobia to enhance the mutualistic interaction (Solans, Vobis, & Wall, 2009; Benito et al., 2017). So far, no human disease-causing isolates have been detected in the genus Micromonospora nor have any plant pathogens been described, which strongly suggests that this BSL1 genus consists of biologically safe microorganisms. Interestingly, only 1% of Streptomyces species are

Role of rhizospheric microbial diversity in plant growth Chapter | 7

179

pathogenic to plants (Wanner & Kirk, 2015), and to our knowledge, only one human pathogen, Streptomyces somaliensis, has been reported in the literature; its genome has been sequenced (Kirby et al., 2012). Bionanotechnology employ nanoparticles made of inorganic or organic materials could also provide new avenues for the development of carrier-based microbial inoculums (Han et al., 2018). The use of nanoformulations can improve the stability of biofertilizers and biostimulators with respect to desiccation, heat and ultra-violet ray’s inactivation. Recently, to achieve sustainable agriculture production, ‘omics’ is a promising tool to understand the plant– microbes interaction that contributes to sustainable agriculture. This includes genomics, which is the study of structural and functional aspects of genes and also the comparision of degree of gene expression in different genotypes, in transcriptomics the mRNA transcripts are quantified and in the proteomics that analysis of metabolomics and protein composition is carried out which can be used further to identify and quantify cellular metabolites (Swarupa, Pavitra, Shivashankara, & Ravishankar, 2016).

12 Conclusion The potential of biofertilizers is now seriously considered as a means to minimize the use of chemical fertilizer that has been exploited to develop eco-friendly and secure alternatives. The use of PGPR thus will help in thereby reducing unwanted chemical leftovers in the agriculture field. Several new groups of bacteria and fungi with ability of plant growth promotion and bio control ability have been discovered but their taxonomic characterization and the determination of bio safety classes have been poorly done. The Indian Himalayan region represents a unique ecological niche in which microbes have evolved and adapted to the prevailing climatic factors and edaphic over the years. Yet, exploration of cold adopted or psychrophilic or region-specific microbial strains is an effort in agricultural productivity with the objective of sustainable hill agriculture. Therefore, a further extensive study, concerning the microbial wealth of mountainous ecosystems, the prospection to find potent locally adapted PGPR inoculants will help in the commercial development of biofertilizers.

References Aballay, A., & Ausubel, F. M. (2002). Caenorhabditis elegans as a host for the study of host–pathogen interactions. Current opinion in Microbiology, 5(1), 97–101. Abdollahi, L., & Munkholm, L. J. (2014). Tillage system and cover crop effects on soil quality: I. chemical, mechanical, and biological properties. Soil Science Society of America Journal, 78, 262–270. Adl, S. (2016). Rhizosphere, food security, and climate change: A critical role for plant-soil research. Aguado-Santacruz, G. A., Moreno-Gomez, B., Jiménez-Francisco, B., García-Moya, E., & Preciado-Ortiz, R. E. (2012). Impact of the microbial siderophores and phytosiderophores on the iron assimilation by plants: a synthesis. Revista Fitotecnia Mexicana, 35(1), 9–21.

180

Recent Advancements in Microbial Diversity

Ahemad, M., & Kibret, M. (2014). Mechanisms and applications of plant growth promoting rhizobacteria: current perspective. Journal of King Saud University-science, 26(1), 1–20. Ahmed, E., & Holmström, S. J. (2014). Siderophores in environmental research: roles and applications. Microbial biotechnology, 7(3), 196–208. Albareda, M., Rodríguez-Navarro, D. N., Camacho, M., & Temprano, F. J. (2008). Alternatives to peat as a carrier for rhizobia inoculants: solid and liquid formulations. Soil Biology and Biochemistry, 40(11), 2771–2779. Allen, M. A., Lauro, F. M., Williams, T. J., Burg, D., Siddiqui, K. S., De Francisci, D., et al. (2009). The genome sequence of the psychrophilic archaeon, Methanococcoides burtonii: the role of genome evolution in cold adaptation. The ISME Journal, 3(9), 1012. Anesio, A. M., Lutz, S., Chrismas, N. A., & Benning, L. G. (2017). The microbiome of glaciers and ice sheets. NPJ biofilms and microbiomes, 3(1), 10. Angus, A. A., Agapakis, C. M., Fong, S., Yerrapragada, S., Estrada-de Los Santos, P., Yang, P., et al. (2014). Plant-associated symbiotic Burkholderia species lack hallmark strategies required in mammalian pathogenesis. PloS One, 9(1), e83779. Ardakani, S. S., Heydari, A., Khorasani, N., & Arjmandi, R. (2010). Development of new bioformulations of Pseudomonas fluorescens and evaluation of these products against damping-off of cotton seedlings. Journal of Plant Pathology, 83–88. Arora, N. K., Tiwari, S., & Singh, R. (2014). Comparative study of different carriers inoculated with nodule forming and free living plant growth promoting bacteria suitable for sustainable agriculture. Journal of Plant Pathology & Microbiology, 5(2), 1. Azziz, G., Bajsa, N., Haghjou, T., Taulé, C., Valverde, Á., Igual, J. M., et al. (2012). Abundance, diversity and prospecting of culturable phosphate solubilizing bacteria on soils under crop–pasture rotations in a no-tillage regime in Uruguay. Applied Soil Ecology, 61, 320–326. Babalola, O. O. (2010). Beneficial bacteria of agricultural importance. Biotechnology Letters, 32(11), 1559–1570. Babu-Khan, S., Yeo, T. C., Martin, W. L., Duron, M. R., Rogers, R. D., & Goldstein, A. H. (1995). Cloning of a mineral phosphate-solubilizing gene from Pseudomonas cepacia. Applied Environment of Microbiology, 61(3), 972–978. Bae, W., Xia, B., Inouye, M., & Severinov, K. (2000). Escherichia coli CspA-family RNA chaperones are transcription antiterminators. Proceedings of the National Academy of Sciences, 97(14), 7784–7789. Balcazar, W., Rondón, J., Rengifo, M., Ball, M. M., Melfo, A., Gómez, W., et al. (2015). Bioprospecting glacial ice for plant growth promoting bacteria. Microbiological Research, 177, 1–7. Bapiri, A., Asgharzadeh, A., Mujallali, H., Khavazi, K., & Pazira, E. (2012). Evaluation of Zinc solubilization potential by different strains of Fluorescent Pseudomonads. Journal of Applied Sciences and Environmental Management, 16(3). Barea, J. M., Pozo, M. J., Azcon, R., & Azcon-Aguilar, C. (2005). Microbial co-operation in the rhizosphere. Journal of Experimental Botany, 56(417), 1761–1778. Bargaz, A., Lyamlouli, K., Chtouki, M., Zeroual, Y., & Dhiba, D. (2018). Soil microbial resources for improving fertilizers efficiency in an integrated plant nutrient management system. Frontiers in Microbiology, 9. Bashan, Y., de-Bashan, L. E., Prabhu, S. R., & Hernandez, J. P. (2014). Advances in plant growthpromoting bacterial inoculant technology: formulations and practical perspectives (19982013). Plant and Soil, 378(1–2), 1–33. Beales, N. (2004). Adaptation of microorganisms to cold temperatures, weak acid preservatives, low pH, and osmotic stress: a review. Comprehensive reviews in food science and food safety, 3(1), 1–20.

Role of rhizospheric microbial diversity in plant growth Chapter | 7

181

Bechtaoui, N., Raklami, A., Tahiri, A. I., Benidire, L., El Alaoui, A., Meddich, A., & Oufdou, K. (2019). Characterization of plant growth promoting rhizobacteria and their benefits on growth and phosphate nutrition of faba bean and wheat. Biology Open, 8(7), bio043968. Beneduzi, A., Ambrosini, A., & Passaglia, L. M. (2012). Plant growth-promoting rhizobacteria (PGPR): their potential as antagonists and biocontrol agents. Genetics and molecular biology, 35(4), 1044–1051. Benito, P., Alonso-Vega, P., Aguado, C., Luján, R., Anzai, Y., Hirsch, A. M., et al. (2017). Monitoring the colonization and infection of legume nodules by Micromonospora in co-inoculation experiments with rhizobia. Scientific reports, 7(1), 11051. Bhaduri, J., & Roy, S. K. (2018). Evaluating the efficacy of six novel indigenous free-living soil bacteria on tea plant of North Bengal tea gardens of West Bengal India and their antagonistic effect on some tea pathogenic fungi. Journal of Applied Biology & Biotechnology, 6(05), 24–30. Blesh, J. (2018). Functional traits in cover crop mixtures: Biological nitrogen fixation and multifunctionality. Journal of Applied Ecology, 55(1), 38–48. Boddey, R. M., Polidoro, J. C., Resende, A. S., Alves, B. J., & Urquiaga, S. (2001). Use of the15N natural abundance technique for the quantification of the contribution of N2 fixation to sugar cane and other grasses. Functional Plant Biology, 28(9), 889–895. Borriss, R. (2011). Use of plant-associated Bacillus strains as biofertilizers, biocontrol agents in agriculture. In Bacteria in agrobiology, Plant growth responses (pp. 41-76). Springer, Berlin, Heidelberg, Brandsæter, L. O., Heggen, H., Riley, H., Stubhaug, E., & Henriksen, T. M. (2008). Winter survival, biomass accumulation and N mineralization of winter annual and biennial legumes sown at various times of year in Northern Temperate Regions. European Journal of Agronomy, 28(3), 437–448. Bronick, C. J., & Lal, R. (2005). Soil structure and management: a review. Geoderma, 124(1–2), 3–22. Cai, Q., Ye, X., Chen, B., & Zhang, B. (2017). complete genome sequence of exiguobacterium sp. strain N4-1P, a psychrophilic bioemulsifier producer isolated from a cold marine environment in North Atlantic Canada. Genome Announcements, 5(44), e01248–17. Carneiro, A.R., Ramos, R.T. J., Dall’Agnol, H., Pinto, A.C., de Castro Soares, S., Santos, A.R. et al. (2012). Genome sequence of Exiguobacterium antarcticum B7, isolated from a biofilm in Ginger Lake, King George Island, Antarctica. Cassan, F., Perrig, D., Sgroy, V., Masciarelli, O., Penna, C., & Luna, V. (2009). Azospirillum brasilense Az39 and Bradyrhizobium japonicum E109, inoculated singly or in combination, promote seed germination and early seedling growth in corn (Zea mays L.) and soybean (Glycine max L.). European Journal of Soil Biology, 45(1), 28–35. Chadha, N., Prasad, R., & Varma, A. (2015). Plant promoting activities of fungal endophytes associated with tomato roots from central Himalaya, India and their interaction with Piriformospora indica. International Journal of Pharma and Bio Sciences, 6(1), 333–343. Chaturvedi, P., & Shivaji, S. (2006). Exiguobacterium indicum sp. nov., a psychrophilic bacterium from the Hamta glacier of the Himalayan mountain ranges of India. International Journal of Systematic and Evolutionary Microbiology, 56(12), 2765–2770. Chaurasia, B., Pandey, A., Palni, L. M. S., Trivedi, P., Kumar, B., & Colvin, N. (2005). Diffusible and volatile compounds produced by an antagonistic Bacillus subtilis strain cause structural deformations in pathogenic fungi in vitro. Microbiological Research, 160(1), 75–81. Chen, C., Bauske, E. M., Musson, G., Rodriguez-Kabana, R., & Kloepper, J. W. (1995). Biological control of Fusarium wilt on cotton by use of endophytic bacteria. Biology Control, 5, 83–91.

182

Recent Advancements in Microbial Diversity

Chen, G. Q., & Jiang, X. R. (2018). Next generation industrial biotechnology based on extremophilic bacteria. Current Opinion in Biotechnology, 50, 94–100. Cheng, Z., Park, E., & Glick, B. R. (2007). 1-Aminocyclopropane-1-carboxylate deaminase from Pseudomonas putida UW4 facilitates the growth of canola in the presence of salt. Canadian Journal of Microbiology, 53(7), 912–918. Chintalapati, S., Kiran, M. D., & Shivaji, S. (2004). Role of membrane lipid fatty acids in cold adaptation. Cellular and Molecular Biology (Noisy-le-Grand, France), 50(5), 631–642. Choudhary, D. K., Sharma, K. P., & Gaur, R. K. (2011). Biotechnological perspectives of microbes in agro-ecosystems. Biotechnology Letters, 33(10), 1905–1910. Chowdhury, S. P., Dietel, K., Rändler, M., Schmid, M., Junge, H., Borriss, R., et al. (2013). Effects of Bacillus amyloliquefaciens FZB42 on lettuce growth and health under pathogen pressure and its impact on the rhizosphere bacterial community. Plos One, 8(7), e68818. Cleland, D., Krader, P., McCree, C., Tang, J., & Emerson, D. (2004). Glycine betaine as a cryoprotectant for prokaryotes. Journal of Microbiological Methods, 58(1), 31–38. Couëdel, A., Alletto, L., Tribouillois, H., & Justes, É. (2018). Cover crop crucifer-legume mixtures provide effective nitrate catch crop and nitrogen green manure ecosystem services. Agriculture, Ecosystems & Environment, 254, 50–59. D’Amico, S., Collins, T., Marx, J. C., Feller, G., & Gerday, C. (2006). Psychrophilic microorganisms: challenges for life. EMBO Reports, 7(4), 385–389. Das, A., Dutta, B. K., & Barooah, A. K. (2013). In vitro solubilization of inorganic phosphate by phosphate solubilizing fungi isolated from tea agroecosystem soil of Barak Valley, Southern Assam. International Journal of Microbiology Research, 4, 336–341. Das, K., Katiyar, V., & Goel, R. (2003). ‘P’solubilization potential of plant growth promoting Pseudomonas mutants at low temperature. Microbiological Research, 158(4), 359–362. Daza, A., Santamarıa, C., Rodrıguez-Navarro, D. N., Camacho, M., Orive, R., et al. (2000). Perlite as a carrier for bacterial inoculants. Soil Biology and Biochemistry, 32(4), 567–572. De fago, G., & Haas, D. (1990). Pseudomonads as antagonists of soilborne plant pathogens: Modes of action and genetic analysis. In J. M. Bollag, & G. Stotzky (Eds.), Soil Biochemistry, 6 (pp. 249–291.). New York: Marcel Dekker. Devi, L. S., Khaund, P., Nongkhlaw, F. M., & Joshi, S. R. (2012). Diversity of culturable soil microfungi along altitudinal gradients of Eastern Himalayas. Mycobiology, 40(3), 151–158. Devi, U., Khatri, I., Kumar, N., Kumar, L., Sharma, D., Subramanian, S., et al. (2013). Draft genome sequence of a plant growth-promoting rhizobacterium, Serratia fonticola strain AU-P3 (3). Genome Announcements, 1(6), e00946–13. Dey, R. K. K. P., Pal, K. K., Bhatt, D. M., & Chauhan, S. M. (2004). Growth promotion and yield enhancement of peanut (Arachis hypogaea L.) by application of plant growth-promoting rhizobacteria. Microbiological Research, 159(4), 371–394. Dhakar, K., Jain, R., Tamta, S., & Pandey, A. (2014a). Prolonged laccase production by a cold and pH tolerant strain of Penicillium pinophilum (MCC 1049) isolated from a low temperature environment. Enzyme Research, 2014. Dhakar, K., Sharma, A., & Pandey, A. (2014b). Cold, pH and salt tolerant Penicillium spp. inhabit the high altitude soils in Himalaya, India. World Journal of Microbiology and Biotechnology, 30(4), 1315–1324. Dhar, H., Swarnkar, M. K., Rana, A., Kaushal, K., Singh, A. K., Kasana, R. C., et al. (2016). Complete genome sequence of a low-temperature active and alkaline-stable endoglucanaseproducing Paenibacillus sp. strain IHB B 3084 from the Indian Trans-Himalayas. Journal of Biotechnology, 230, 1–2. Dhir, R. P. (1967). Pedological characteristics of some soils of the northwest Himalaya. Journal of the Indian Society of Soil Science, 15, 61–69.

Role of rhizospheric microbial diversity in plant growth Chapter | 7

183

Du, Y., Yuan, B., Zeng, Y., Meng, J., Li, H., Wang, R., et al. (2015). Draft genome sequence of the cellulolytic bacterium Clavibacter sp. CF11, a strain producing cold-active cellulase. Genome Announcements, 3(1), e01304–14. Egamberdieva, D. (2011). Survival of Pseudomonas extremorientalis TSAU20 and P. chlororaphis TSAU13 in the rhizosphere of common bean (Phaseolus vulgaris) under saline conditions. Plant, Soil and Environment, 57(3), 122–127. Feller, G. (2003). Molecular adaptations to cold in psychrophilic enzymes. Cellular and Molecular Life Sciences CMLS, 60(4), 648–662. Francis, I., Holsters, M., & Vereecke, D. (2010). The Gram-positive side of plant–microbe interactions. Environmental Microbiology, 12(1), 1–12. Fruhling, A., Schumann, P., Hippe, H., Straubler, B., & Stackebrandt, E. (2002). Exiguobacterium undae sp. nov. and Exiguobacterium antarcticum sp. nov. International Journal of Systematic and Evolutionary Microbiology, 52(4), 1171–1176. Fu, S. F., Wei, J. Y., Chen, H. W., Liu, Y. Y., Lu, H. Y., & Chou, J. Y. (2015). Indole-3-acetic acid: A widespread physiological code in interactions of fungi with other organisms. Plant Signaling & Behavior, 10(8), e1048052. Gaind, S., & Gaur, A. C. (1990). Shelf life of phosphate-solubilizing inoculants as influenced by type of carrier, high temperature, and low moisture. Canadian Journal of Microbiology, 36(12), 846–849. García-Fraile, P., Menéndez, E., & Rivas, R. (2015). Role of bacterial biofertilizers in agriculture and forestry. Georlette, D., Blaise, V., Collins, T., D’Amico, S., Gratia, E., Hoyoux, A., et al. (2004). Some like it cold: biocatalysis at low temperatures. FEMS Microbiology Reviews, 28(1), 25–42. Glick, B. R. (2012). Plant growth-promoting bacteria: mechanisms and applications. Scientifica. Glick, B. R. (2014). Bacteria with ACC deaminase can promote plant growth and help to feed the world. Microbiological Research, 169(1), 30–39. Grady, E. N., MacDonald, J., Liu, L., Richman, A., & Yuan, Z. C. (2016). Current knowledge and perspectives of Paenibacillus: a review. Microbial Cell Factories, 15(1), 203. Gulati, A., Vyas, P., Rahi, P., & Kasana, R. C. (2009). Plant growth-promoting and rhizospherecompetent Acinetobacter rhizosphaerae strain BIHB 723 from the cold deserts of the Himalayas. Current Microbiology, 58(4), 371–377. Gupta, C., Dubey, R., & Maheshwari, D. (2002). Plant growth enhancement and suppression of Macrophomina phaseolina causing charcoal rot of peanut by fluorescent Pseudomonas. Biology and Fertility of soils, 35(6), 399–405. Gupta, G., Parihar, S. S., Ahirwar, N. K., Snehi, S. K., & Singh, V. (2015). Plant growth promoting rhizobacteria (PGPR): current and future prospects for development of sustainable agriculture. Journal of Microbial and Biochemical Technology, 7(2), 096–102. Gupta, H.K., Gupta, R.D., Singh, A., Chauhan, N.S., & Sharma, R. (2011). Genome sequence of Rheinheimera sp. strain A13L, isolated from Pangong Lake, India. Gupta, S., Kaushal, R., Kaundal, K., Chauhan, A., & Spehia, R. S. (2015). Efficacy of indigenous plant growth promoting rhizobacteria on capsicum yield and soil health. Research on crops, 16(1). Gusain, Y. S., Kamal, R., Mehta, C. M., Singh, U. S., & Sharma, A. K. (2015). Phosphate solubilizing and indole-3-acetic acid producing bacteria from the soil of Garhwal Himalaya aimed to improve the growth of rice. Journal of Environmental Biology, 36(1), 301. Hale, L., Luth, M., & Crowley, D. (2015). Biochar characteristics relate to its utility as an alternative soil inoculum carrier to peat and vermiculite. Soil Biology and Biochemistry, 81, 228–235.

184

Recent Advancements in Microbial Diversity

Hallam, S. J., Konstantinidis, K. T., Putnam, N., Schleper, C., Watanabe, Y. I., Sugahara, J., et al. (2006). Genomic analysis of the uncultivated marine crenarchaeote Cenarchaeum symbiosum. Proceedings of the National Academy of Sciences, 103(48), 18296–18301. Han, H. S., & Lee, K. D. (2006). Effect of co-inoculation with phosphate and potassium solubilizing bacteria on mineral uptake and growth of pepper and cucumber. Plant Soil and Environment, 52(3), 130. Han, J., Zhao, D., Li, D., Wang, X., Jin, Z., & Zhao, K. (2018). Polymer-based nanomaterials and applications for vaccines and drugs. Polymers, 10(1), 31. Hasarin, N., & Vidaya, K. (2008). The study of shelf life for liquid biofertilizer rom vegetable waste. AUJ.T., 11(4), 204–208. Hassan, N., Rafiq, M., Hayat, M., Shah, A. A., & Hasan, F. (2016). Psychrophilic and psychrotrophic fungi: a comprehensive review. Reviews in Environmental Science and Bio/Technology, 15(2), 147–172. Hegde, S. V., & Brahmaprakash, G. P. (1992). A dry granular inoculant of Rhizobium for soil application. Plant and Soil, 144(2), 309–311. Hemavathi, V. N., Sivakumar, B. S., Suresh, C. K., & Earanna N (2006). Effect of Glomus fasciculatum and plant growth promoting rhizobacteria on growth and yield of Ocimum basilicum. Karnataka Journal of Agricultural Sciences, 19, 17–20. Holderbaum, J. F., Decker, A. M., Messinger, J. J., Mulford, F. R., & Vough, L. R. (1990). Fall-seeded legume cover crops for no-tillage corn in the humid East. Agronomy Journal, 82(1), 117–124 http://ztmbpd.iari.res.in/technologies/crop-production/biofertilizer/liquid-biofertilizers/. Iqbal, N., Khan, N. A., Ferrante, A., Trivellini, A., Francini, A., & Khan, M. I. R. (2017). Ethylene role in plant growth, development and senescence: interaction with other phytohormones. Frontiers in Plant Science, 8, 475. Isfahani, F. M., & Besharati, H. (2012). Effect of biofertilizers on yield and yield components of cucumber. Journal of Biology and Earth Sciences. 2(2), B83–92. Islam, F., Yasmeen, T., Ali, Q., Ali, S., Arif, M. S., Hussain, S., & Rizvi, H. (2014). Influence of Pseudomonas aeruginosa as PGPR on oxidative stress tolerance in wheat under Zn stress. Ecotoxicology and Environmental Safety, 104, 285–293. Jain, R., & Pandey, A. (2016). A phenazine-1-carboxylic acid producing polyextremophilic Pseudomonas chlororaphis (MCC2693) strain, isolated from mountain ecosystem, possesses biocontrol and plant growth promotion abilities. Microbiological Research, 190, 63–71. Jee, H.J. 2009. Current status of biofertilizers and bio-pesticides development, farmer’s acceptance and their utilization in korea. http//:www.agnet.org. Jha, B. K., Pragash, M. G., Cletus, J., Raman, G., & Sakthivel, N. (2009). Simultaneous phosphate solubilization potential and antifungal activity of new fluorescent pseudomonad strains, Pseudomon asaeruginosa, P. plecoglossicida and P. mosselii. World Journal of Microbiology and Biotechnology, 25(4), 573–581. Jiang, W., Hou, Y., & Inouye, M. (1997). CspA, the major cold-shock protein of Escherichia coli, is an RNA chaperone. Journal of Biological Chemistry, 272(1), 196–202. Jodha, N. S., & Shrestha, S. (1993). Sustainable and more productive mountain agriculture: problems and prospects. Mountain Environment and Development–part, 3, 1–65. Johns, G. C., & Somero, G. N. (2004). Evolutionary convergence in adaptation of proteins to temperature: A4-lactate dehydrogenases of Pacific damselfishes (Chromis spp.). Molecular Biology and evolution, 21(2), 314–320. Johnson, S. E., & Loeppert, R. H. (2006). Role of organic acids in phosphate mobilization from iron oxide. Soil Science Society of America Journal, 70(1), 222–234. Joshi, D., Kumar, S., Suyal, D.C., Goel, R. (2017). The microbiome of the Himalayan ecosystem. In Mining of Microbial Wealth, MetaGenomics (pp. 101-116). Springer, Singapore,

Role of rhizospheric microbial diversity in plant growth Chapter | 7

185

Joshi, P., & Bhatt, A. B. (2011). Diversity and function of plant growth promoting rhizobacteria associated with wheat rhizosphere in North Himalayan region. International Journal of Environmental Sciences, 1(6), 1135. Joshi, P., Joshi, G.K., Mishra, P.K., Bisht, J.K., & Bhatt, J.C. (2014). Diversity of cold tolerant phosphate solubilizing microorganisms from North Western Himalayas. In Bacterial Diversity in Sustainable Agriculture (pp. 227-264). Springer, Cham. Kang, B. G., Kim, W. T., Yun, H. S., & Chang, S. C. (2010). Use of plant growth-promoting rhizobacteria to control stress responses of plant roots. Plant Biotechnology Reports, 4(3), 179–183. Katiyar, V., & Goel, R. (2004). Siderophore mediated plant growth promotion at low temperature by mutant of fluorescent pseudomonad*. Plant Growth Regulation, 42(3), 239–244. Keyser, H. H., Somasegaran, P., & Bohlool, B. B. (1993). Rhizobial ecology and technology. In F. B. Metting, Jr. (Ed.), Soil microbial ecology: applications in agricultural and environmental management (pp. 205–226). New York: Marcel Dekker Inc. Khalid, A., Arshad, M., Shaharoona, B., Mahmood, T. (2009). Plant growth promoting rhizobacteria, sustainable agriculture. In Microbial strategies for crop improvement (pp. 133–160). Springer, Berlin, Heidelberg, Khan, A. L., Waqas, M., Asaf, S., Kamran, M., Shahzad, R., Bilal, S., & Al-Rawahi, A. (2017). Plant growth-promoting endophyte Sphingomonas sp. LK11 alleviates salinity stress in Solanum pimpinellifolium. Environmental and Experimental Botany, 133, 58–69. Khavazi, K., Rejali, F., Seguin, P., & Miransari, M. (2007). Effects of carrier, sterilization method, and incubation on survival of Bradyrhizobium japonicum in soybean (Glycine max L.) inoculants. Enzyme and Microbial Technology, 41, 780–784. Kim, S. J., Shin, S. C., Hong, S. G., Lee, Y. M., Choi, I. G., et al. (2012). Genome sequence of a novel member of the genus Psychrobacter isolated from Antarctic soil. Journal of Bacteriology, 194(9), 2403.27. King, G. M., Kostka, J. E., Hazen, T. C., & Sobecky, P. A. (2015). Microbial responses to the Deepwater Horizon oil spill: from coastal wetlands to the deep sea. Annual Review of Marine Science, 7, 377–401. Kirby, R., Sangal, V., Tucker, N.P., Zakrzewska-Czerwińska, J., Wierzbicka, K., Herron, P.R., & Hoskisson, P.A. (2012). Draft genome sequence of the human pathogen Streptomyces somaliensis, a significant cause of actinomycetoma. Kishore, K. H., Begum, Z., Pathan, A. A. K., & Shivaji, S. (2010). Paenibacillus glacialis sp. nov., isolated from the Kafni glacier of the Himalayas, India. International Journal of Systematic and Evolutionary Microbiology, 60(8), 1909–1913. Kloepper, J. W., Leong, J., Teintze, M., & Schroth, M. N. (1980). Enhanced plant growth by siderophores produced by plant growth-promoting rhizobacteria. Nature, 286(5776), 885. Köhler, H. R., & Triebskorn, R. (2013). Wildlife ecotoxicology of pesticides: can we track effects to the population level and beyond? Science, 341(6147), 759–765. Krembs, C., & Deming, J.W. (2008). The role of exopolymers in microbial adaptation to sea ice. In Psychrophiles: from biodiversity to biotechnology (pp. 247-264). Springer, Berlin, Heidelberg. Kumar, A., & Verma, J. P. (2018). Does plant—microbe interaction confer stress tolerance in plants: a review? Microbiological Research, 207, 41–52. Kumar, A., Bahadur, I., Maurya, B. R., Raghuwanshi, R., Meena, V. S., Singh, D. K., et al. (2015a). Does a plant growth-promoting rhizobacteria enhance agricultural sustainability. Journal of Pure and Applied Microbiology, 9(1), 715–724. Kumar, A., Guleria, S., Mehta, P., Walia, A., Chauhan, A., & Shirkot, C. K. (2015b). Plant growthpromoting traits of phosphate solubilizing bacteria isolated from Hippophae rhamnoides L.

186

Recent Advancements in Microbial Diversity

(Sea-buckthorn) growing in cold desert Trans-Himalayan Lahul and Spiti regions of India. Acta physiologiae plantarum, 37(3), 48. Kumar, A., Soni, R., Kanwar, S. S., & Pabbi, S. (2019). Stenotrophomonas: a versatile diazotrophic bacteria from the rhizospheric soils of Western Himalayas and development of its liquid biofertilizer formulation. Vegetos, 32(1), 103–109. Kumar, B., Trivedi, P., & Pandey, A. (2007). Pseudomonas corrugata: A suitable bacterial inoculant for maize grown under rainfed conditions of Himalayan region. Soil Biology and Biochemistry, 39(12), 3093–3100. Kumar, P., & Dubey, R. C. (2012). Plant growth promoting rhizobacteria for biocontrol of phytopathogens and yield enhancement of Phaseolus vulgaris. J Curr Pers Appl Microbiol, 1, 6–38. Kumar, S., Suyal, D. C., Dhauni, N., Bhoriyal, M., & Goel, R. (2014). Relative plant growth promoting potential of Himalayan Psychrotolerant Pseudomonas jesenii strain MP1 against native Cicer arietinum (L.)., Vigna mungo (L.) Hepper; Vigna radiata (L.) Wilczek., Cajanus cajan (L.) Millsp. and Eleusine coracana (L.) Gaertn. African Journal of Microbiology Research, 8(50), 3931–3943. Kumar, V., Singh, P., Jorquera, M. A., Sangwan, P., Kumar, P., Verma, A. K., et al. (2013). Isolation of phytase-producing bacteria from Himalayan soils and their effect on growth and phosphorus uptake of Indian mustard (Brassica juncea). World Journal of Microbiology and Biotechnology, 29(8), 1361–1369. Kyaw, M. W and Khin, M. S. 2008. Effective microorganisms in liquid carrier of biogas effluent to improve the chickpea yield in field trial. GMSARN International conference on Sustainable Development: Issues and Prospects for the GMS, 12–14 Nov. 2008. Lee, K. K., Mok, I. K., Yoon, M. H., Kim, H. J., & Chung, D. Y. (2012). Mechanisms of phosphate solubilization by PSB (Phosphate-solubilizing Bacteria) in soil. Korean Journal of Soil Science and Fertilizer, 45(2), 169–176. Linu, M. S., Sreekumar, J., Asok, A. K., & Jisha, M. S. (2018). Mineral phosphate solubilization by Pseudomonas aeruginosa isolates from chilli (Capsicum annuum L.) fields. Journal of Tropical Agriculture, 55(2), 134–144. Liu, D., Lian, B., & Dong, H. (2012). Isolation of Paenibacillus sp. and assessment of its potential for enhancing mineral weathering. GeoMicrobiology Journal, 29(5), 413–421. Lopez, N.I., Pettinari, M.J., Nikel, P.I., & Méndez, B.S. (2015). Polyhydroxyalkanoates: much more than biodegradable plastics. In Advances in applied Microbiology (Vol. 93, pp. 73-106). Academic Press. Lucy, M., Reed, E., & Glick, B. R. (2004). Applications of free living plant growth-promoting rhizobacteria. Antonie Van Leeuwenhoek, 86(1), 1–25. Lyngwi, N. A., Koijam, K., Sharma, D., & Joshi SR (2013). Cultivable bacterial diversity along the altitudinal zonation and vegetation range of tropical eastern Himalaya. International Journal of Tropical Biology, 61, 467–490. Maikhuri, R. K., Rao, K. S., & Saxena, K. G. (1996). Traditional crop diversity for sustainable development of Central Himalayan agroecosystems. The International Journal of Sustainable Development & World Ecology, 3(3), 8–31. Majeed, A., Abbasi, M. K., Hameed, S., Imran, A., & Rahim, N. (2015). Isolation and characterization of plant growth-promoting rhizobacteria from wheat rhizosphere and their effect on plant growth promotion. Frontiers in Microbiology, 17, 6, 198. Malviya, M. K., Sharma, A., Pandey, A., Rinu, K., Sati, P., & Palni LMS (2012). Bacillus subtilis NRRL B-30408: a potential inoculant for crops grown under rainfed conditions in the mountains. Journal of Soil Science and Plant Nutrition, 12, 811–824.

Role of rhizospheric microbial diversity in plant growth Chapter | 7

187

Malviya, M. K., Pandey, A., Trivedi, P., Gupta, G., & Kumar, B. (2009). Chitinolytic activity of cold tolerant antagonistic species of Streptomyces isolated from glacial sites of Indian Himalaya. Current Microbiology, 59(5), 502. Mandavgade, R. R., Waikar, S. L., Dhamak, A. L., & Patil, V. D. (2015). Evaluation of micronutrient status of soils and their relation with some chemical properties of soils of northern Tahsils (Jintur, Selu and Pathri) of Parbhani district. Journal of Agriculture and Veterinary Science, 8(2), 38–41. Marche, M. G., Mura, M. E., Falchi, G., & Ruiu, L. (2017). Spore surface proteins of Brevibacillus laterosporus are involved in insect pathogenesis. Scientific Reports, 7, 43805. Margesin, R. (2009). Effect of temperature on growth parameters of psychrophilic bacteria and yeasts. Extremophiles, 13(2), 257–262. Margesin, R., & Collins, T. (2019). Microbial ecology of the cryosphere (glacial and permafrost habitats): current knowledge. Applied Microbiology and Biotechnology, 103(6), 2537–2549. Martinez-Hidalgo, P., Galindo-Villardón, P., Trujillo, M. E., Igual, J. M., & Martínez-Molina, E. (2014). Micromonospora from nitrogen fixing nodules of alfalfa (Medicago sativa L.). A new promising Plant Probiotic Bacteria. Scientific Reports, 4, 6389. Martínez-Hidalgo, P., García, J. M., & Pozo, M. J. (2015). Induced systemic resistance against Botrytis cinerea by Micromonospora strains isolated from root nodules. Frontiers in Microbiology, 6, 922. Masalha, J., Kosegarten, H., Elmaci, Ö., & Mengel, K. (2000). The central role of microbial activity for iron acquisition in maize and sunflower. Biology and Fertility of Soils, 30(5–6), 433–439. Mastronicolis, S. K., German, J. B., Megoulas, N., Petrou, E., Foka, P., et al. (1998). Influence of cold shock on the fatty-acid composition of different lipid classes of the food-borne pathogenListeria monocytogenes. Food Microbiology, 15(3), 299–306. Mayilraj, S., Krishnamurthi, S., Saha, P., & Saini, H. S. (2006). Rhodococcus kroppenstedtii sp. nov., a novel actinobacterium isolated from a cold desert of the Himalayas, India. International Journal of Systematic and Evolutionary Microbiology, 56(5), 979–982. McBeath, J.H. (1995). U.S. Patent No. 5,418,165. Washington, DC: U.S. Patent and Trademark Office. Meena, V. S., Maurya, B. R., & Verma, J. P. (2014). Does a rhizospheric microorganism enhance K+ availability in agricultural soils? Microbiological Research, 169(5–6), 337–347. Mehta, P., Walia, A., & Shirkot, C. K. (2015). Functional diversity of phosphate solubilizing plant growth promoting rhizobacteria isolated from apple trees in the trans Himalayan region of Himachal Pradesh, India. Biological Agriculture & Horticulture, 31(4), 265–288. Mehta, P., Walia, A., Chauhan, A., Kulshrestha, S., & Shirkot, C. K. (2013). Phosphate solubilisation and plant growth promoting potential by stress tolerant Bacillus sp. isolated from rhizosphere of apple orchards in trans Himalayan region of Himachal Pradesh. Annals of Applied biology, 163(3), 430–443. Methe, B. A., Nelson, K. E., Deming, J. W., Momen, B., Melamud, E., Zhang, X., (2005). The psychrophilic lifestyle as revealed by the genome sequence of Colwellia psychrerythraea 34H through genomic and proteomic analyses. Proceedings of the National Academy of Sciences, 102(31), 10913–10918. Mishra, P. K., Mishra, S., Selvakumar, G., Bisht, S. C., Bisht, J. K., & Gupta HS (2008). Characterization of a psychrotolerant plant growth promoting Pseudomonas sp. strain PGERs17 (MTCC 9000) isolated from North Western Indian Himalayas. Annals of Microbiology, 58, 561–568. Mishra, P.K., Joshi, P., Bisht, S.C., Bisht, J.K., & Selvakumar, G. (2010). Cold-tolerant agriculturally important microorganisms. In Plant growth and health promoting bacteria (pp. 273-296). Springer, Berlin, Heidelberg.

188

Recent Advancements in Microbial Diversity

Mishra, P. K., Mishra, S., Bisht, S. C., Selvakumar, G., Kundu, S., Bisht, J. K., (2009). Isolation, molecular characterization and growth-promotion activities of a cold tolerant bacterium Pseudomonas sp. NARs9 (MTCC9002) from the Indian Himalayas. Biological Research, 42(3), 305–313. Miteva, V. (2008). Bacteria in snow and glacier ice. In Psychrophiles: From biodiversity to biotechnology (pp. 31-50). Springer, Berlin, Heidelberg. Mohammadi, K., & Sohrabi, Y. (2012). Bacterial biofertilizers for sustainable crop production: a review. Journal of Agricultural and Biological Science, 7, 307–316. Monsanto BioAg. 2015a. Catálogo de productos [online]. Available from http://www.monsantobioag.com/global/las/ Products/Pages/default.aspx [accessed 25 July 2018]. Monsanto BioAg. 2015b. Acceleron BioAg Canada [online]. Available from http://www.acceleronsas.ca/bioag [accessed 25 July 2018]. Morang, P., Dutta, B. K., Kumar, B. S. D., & Kashyap, M. P. (2012). Growth promotion and bicontrol approaches of brown root rot disease of tea by Pseudomonas aeruginosa (PM 105). Journal of Plant Pathology and Microbiology, 3, 1–4. Morgan-Kiss, R. M., Priscu, J. C., Pocock, T., Gudynaite-Savitch, L., & Huner, N. P. (2006). Adaptation and acclimation of photosynthetic microorganisms to permanently cold environments. Microbiology and Molecular Biology Reviews, 70(1), 222–252. Motsara, M. R., & Roy, R. N. (2008). Guide to laboratory establishment for plant nutrient analysis (vol. 19). Rome: Food and Agriculture Organization of the United Nations. Moyer, C.L., & Morita, R.Y. (2001). Psychrophiles and psychrotrophs. e LS. Nadeem, S. M., Zahir, Z. A., Naveed, M., & Arshad, M. (2007). Preliminary investigations on inducing salt tolerance in maize through inoculation with rhizobacteria containing ACC deaminase activity. Canadian Journal of Microbiology, 53(10), 1141–1149. Negi, Y. K., Garg, S. K., & Kumar, J. (2005). Cold-tolerant fluorescent Pseudomonas isolates from Garhwal Himalayas as potential plant growth promoting and biocontrol agents in pea. Current Science, 2151–2156. Nicholson, W. L., Fajardo-Cavazos, P., Rebeil, R., Slieman, T. A., Riesenman, P. J., Law, J. F., (2002). Bacterial endospores and their significance in stress resistance. Antonie Van Leeuwenhoek, 81(1–4), 27–32. Nicholson, W. L., Munakata, N., Horneck, G., Melosh, H. J., & Setlow, P. (2000). Resistance of Bacillus endospores to extreme terrestrial and extraterrestrial environments. Microbiology and Molecular Biology Reviews, 64(3), 548–572. Oswald, A., Calvo Velez, P., Zúñiga Dávila, D., & Arcos Pineda, J. (2010). Evaluating soil rhizobacteria for their ability to enhance plant growth and tuber yield in potato. Annals of Applied Biology, 157(2), 259–271. Owen, A., & Zdor, R. (2001). Effect of cyanogenic rhizobacteria on the growth of velvetleaf (Abutilon theophrasti) and corn (Zea mays) in autoclaved soil and the influence of supplemental glycine. Soil Biology and Biochemistry, 33(6), 801–809. Paenibacilius, B. (2016). Microbial diversity of extreme regions: an unseen heritage and wealth. Indian Journal of Plant Genetic Resources, 29, 246–248. Palmer, C. M., & Guerinot, M. L. (2009). Facing the challenges of Cu, Fe and Zn homeostasis in plants. Nature Chemical Biology, 5(5), 333. Pandey, A., & Palni, L. M. S. (2007). The rhizosphere effect in trees of the Indian Central Himalaya with special reference to altitude. Applied Ecology and Environmental Research, 5(1), 93–102. Pandey, A., Palni, L. M. S., & Hebbar, K. P. (2001). Suppression of damping-off in maize seedlings by Pseudomonas corrugata. Microbiological Research, 156(2), 191–194.

Role of rhizospheric microbial diversity in plant growth Chapter | 7

189

Pandey, A., Palni, L. M. S., Mulkalwar, P., & Nadeem, M. (2002b). Effect of temperature on solubilization of tricalcium phosphate by Pseudomonas corrugata. Journal of Scientific and Industrial Research, 61(6), 457–460. Pandey, A., Sharma, E., & Palni, L. M. S. (1998). Influence of bacterial inoculation on maize in upland farming systems of the Sikkim Himalaya. Soil Biology and Biochemistry, 30(3), 379–384. Pandey, A., Trivedi, P., Kumar, B., & Palni, L. M. S. (2006). Characterization of a phosphate solubilizing and antagonistic strain of Pseudomonas putida (B0) isolated from a sub-alpine location in the Indian Central Himalaya. Current Microbiology, 53(2), 102–107. Pandey, N., Dhakar, K., Jain, R., & Pandey, A. (2016). Temperature dependent lipase production from cold and pH tolerant species of Penicillium. Mycosphere, 7(10), 1533–1545. Pandey, P., & Maheshwari, D. K. (2007). Commensalism between Sinorhizobium and Burkholderia in binary-culture consortium for plant growth promotion. Current Science, 92, 1137–1142. Pandey, A., Das, N., Kumar, B., Rinu, K., & Trivedi, P. (2008). Phosphate solubilization by Penicillium spp. isolated from soil samples of Indian Himalayan region. World Journal of Microbiology and Biotechnology, 24(1), 97–102. Partap, T. (1999). Sustainable land management in marginal mountain areas of the Himalayan region. Mountain Research and Development, 19, 251–260. Patten, C. L., & Glick, B. R. (2002). Role of Pseudomonas putida indoleacetic acid in development of the host plant root system. Applied and Environmental Microbiology, 68(8), 3795–3801. Philippot, L., Raaijmakers, J. M., Lemanceau, P., & Van Der Putten, W. H. (2013). Going back to the roots: the microbial ecology of the rhizosphere. Nature Reviews Microbiology, 11(11), 789. Phua, C. K. H., Khairuddin, A. R., & Ahmad, N. A. W. (2009). Evaluation of gamma irradiation and heat treatment by autoclaving in the preparation of microorganism-free carriers for biofertilizer products. Jurnal Sains Nuklear Malaysia, 21(1), 1–5. Polissi, A., De Laurentis, W., Zangrossi, S., Briani, F., Longhi, V., Pesole, G., (2003). Changes in Escherichia coli transcriptome during acclimatization at low temperature. Research in Microbiology, 154(8), 573–580. Postma, J., Montanari, M., & van den Boogert, P. H. J. F. (2003). Microbial enrichment to enhance the disease suppressive activity of compost. The European Journal of Soil Biology, 39, 157–163. Purusharth, R. I., Klein, F., Sulthana, S., Jäger, S., & Jagannadham, M. V. (2005). EvguenievaHackenberg E, Ray MK, Klug G. Exoribonuclease R interacts with endoribonuclease E and an RNA helicase in the psychrotrophic bacterium Pseudomonas syringae Lz4W. Journal of Biological Chemistry., 280(15), 14572–14578. Qessaoui, R., Bouharroud, R., Furze, J. N., El Aalaoui, M., Akroud, H., Amarraque, A., et al. (2019). Applications of new Rhizobacteria Pseudomonas isolates in Agroecology via Fundamental Processes Complementing Plant Growth. Scientific Reports, 9(1), 1–10. Rabha, J., Jha, D. K., sarma, H. K., Acharya, A., Chakraborty, U., & Chakraborty, B. (2014). Characterization of bacteria from the rhizosphere of Som tree with multiple growth promoting traits. Indian Phytopathology, 67(2), 126–133. Ranells, N. N., & Wagger, M. G. (1997). Grass-legume bicultures as winter annual cover crops. Agronomy Journal, 89(4), 659–665. Rashid, M. I., Mujawar, L. H., Shahzad, T., Almeelbi, T., Ismail, I. M., & Oves, M. (2016). Bacteria and fungi can contribute to nutrients bioavailability and aggregate formation in degraded soils. Microbiological Research, 183, 26–41.

190

Recent Advancements in Microbial Diversity

Rawat, J., Sanwal, P., & Saxena, J. (2016). Potassium and its role in sustainable agriculture. In Potassium solubilizing microorganisms for sustainable agriculture (pp. 235-253). Springer, New Delhi. Raymond, J. A., Fritsen, C., & Shen, K. (2007). An ice-binding protein from an Antarctic sea ice bacterium. FEMS Microbiology Ecology, 61(2), 214–221. Rebah, F. B., Tyagi, R. D., & Prevost, D. (2002). Wastewater sludge as a substrate for growth and carrier for rhizobia: the effect of storage conditions on survival of Sinorhizobium meliloti. Bioresource Technology, 83(2), 145–151. Reddy, G. S. N., Uttam, A., & Shivaji, S. (2008). Bacillus cecembensis sp. nov., isolated from the Pindari glacier of the Indian Himalayas. International Journal of Systematic and Evolutionary Microbiology, 58(10), 2330–2335. Rekha, P. D., Lai, W. A., Arun, A. B., & Young, C. C. (2007). Effect of free and encapsulated Pseudomonas putida CC-FR2-4 and Bacillus subtilis CC-pg104 on plant growth under gnotobiotic conditions. Bioresource Technology, 98(2), 447–451. Rijavec, T., & Lapanje, A. (2016). Hydrogen cyanide in the rhizosphere: not suppressing plant pathogens, but rather regulating availability of phosphate. Frontiers in Microbiology, 7, 1785. Rinu, K., & Pandey, A. (2009). Bacillus subtilis NRRL B-30408 inoculation enhances the symbiotic efficiency of Lens esculenta Moench at a Himalayan location. Journal of Plant Nutrition and Soil Science, 172, 134–139. Rodrigues, D. F., Ivanova, N., He, Z., Huebner, M., Zhou, J., & Tiedje, J. M. (2008). Architecture of thermal adaptation in an Exiguobacterium sibiricum strain isolated from 3 million year old permafrost: a genome and transcriptome approach. BMC genomics, 9(1), 547. Russell, N. J. (1997). Psychrophilic bacteria—molecular adaptations of membrane lipids. Comparative Biochemistry and Physiology Part A: Physiology, 118(3), 489–493. Russell, N.J. (1998). Molecular adaptations in psychrophilic bacteria: potential for biotechnological applications. In Biotechnology of Extremophiles (pp. 1-21). Springer, Berlin, Heidelberg. Russell, N. J., Evans, R. I., Ter Steeg, P. F., Hellemons, J., Verheul, A., & Abee, T. (1995). Membranes as a target for stress adaptation. International Journal of Food Microbiology, 28(2), 255–261. Russell, N. J. (2008). Membrane Components and Cold Sensing. In R. Margesin, F. Schinner, J. C. Marx, & C. Gerday (Eds.), Psychrophiles: from biodiversity to biotechnology (pp. 177–190). Berlin Heidelberg: Springer Verlag. Saleem, M., Arshad, M., Hussain, S., et al. (2007). Perspective of plant growth promoting rhizobacteria (PGPR) containing ACC deaminase in stress agriculture. Journal of Industrial Microbiology and Biotechnology, 2007, 34, 635–648. Salwan, R., Swarnkar, M. K., Singh, A. K., & Kasana, R. C. (2014). First draft genome sequence of a member of the genus Planomicrobium, isolated from the Chandra River, India. Genome Announcements, 2(1), e01259–13. Sangeetha, D., & Stella, D. (2012). Survival of plant growth promoting bacterial inoculants in different carrier materials. International Journal of Pharmaceutical and Biological Archives, 3(1), 170–178. Sati, V. P. (2007). Role of off-season vegetables in the sustainable livelihood of hill people: a case in the Pindar Basin, Uttarakhand Himalaya. Himalayan Ecology, 15(1&2), 35. Saxena, A. K., Yadav, A. N., Rajawat, M., Kaushik, R., Kumar, R., Kumar, M., et al. (2016). Microbial diversity of extreme regions: An unseen heritage and wealth. Indian Journal of Plant Genetic Resources, 29, 246–248. Schaller, R. F., Taylor, J. M., Rodelas, J., & Schindelholz, E. J. (2017). Corrosion properties of powder bed fusion additively manufactured 17-4 PH stainless steel. Corrosion, 73(7), 796–807.

Role of rhizospheric microbial diversity in plant growth Chapter | 7

191

Schwartz, A., Ortiz, I., Maymon, M., Herbold, C., Fujishige, N., Vijanderan, J., (2013). Bacillus simplex—a little known PGPB with anti-fungal activity—alters pea legume root architecture and nodule morphology when coinoculated with Rhizobium leguminosarum bv. viciae. Agronomy, 3(4), 595–620. Seedland. 2013. Inoculants [online]. Available from http:// www.seedland.com/mm5/merchant. mvc?Screen= CTGY&Store_Code=Seedland&Category_Code=wg-inoc [accessed 25 July 2018. Selvakumar G, Joshi P, Nazim S, Mishra PK, Bisht JK, Gupta HS (2009a) Phosphate solubilization and growth promotion by Pseudomonas fragi CS11RH1 (MTCC 8984) a psychrotolerant bacterium isolated from a high altitude Himalayan rhizosphere. Selvakumar, G., Kundu, S., Joshi, P., Nazim, S., Gupta, A., Mishra, P., et al. (2008a). Characterization of a cold-tolerant plant growth-promoting bacterium Pantoea dispersa 1A isolated from a sub-alpine soil in the North Western Indian Himalayas. World Journal of Microbiology & Biotechnology, 24, 955–960. Selvakumar, G., Joshi, P., Nazim, S., Mishra, P. K., Kundu, S., & Gupta, H. S. (2009b). Exiguobacterium acetylicum strain 1P (MTCC 8707) a novel bacterial antagonist from the North Western Indian Himalayas. World Journal of Microbiology and Biotechnology, 25(1), 131–137. Selvakumar, G., Joshi, P., Suyal, P., Mishra, P. K., Joshi, G. K., Bisht, J. K., (2011). Pseudomonas lurida M2RH3 (MTCC 9245), a psychrotolerant bacterium from the Uttarakhand Himalayas, solubilizes phosphate and promotes wheat seedling growth. World Journal of Microbiology and Biotechnology, 27(5), 1129–1135. Selvakumar, G., Kundu, S., Gupta, A. D., Shouche, Y. S., & Gupta, H. S. (2008c). Isolation and characterization of nonrhizobial plant growth promoting bacteria from nodules of Kudzu (Pueraria thunbergiana) and their effect on wheat seedling growth. Current Microbiology, 56(2), 134–139. Selvakumar, G., Kundu, S., Joshi, P., Nazim, S., Gupta, A. D., & Gupta, H. S. (2010). Growth promotion of wheat seedlings by Exiguobacterium acetylicum 1P (MTCC 8707) a cold tolerant bacterial strain from the Uttarakhand Himalayas. Indian Journal of Microbiology, 50(1), 50–56. Selvakumar, G., Mohan, M., Kundu, S., Gupta, A. D., Joshi, P., Nazim, S., et al. (2008b). Cold tolerance and plant growth promotion potential of Serratia marcescens strain SRM (MTCC 8708) isolated from flowers of summer squash (Cucurbita pepo). Letters in Applied Microbiology, 46(2), 171–175. Shaharoona, B., Arshad, M., & Khalid, A. (2007a). Differential response of etiolated pea seedlings to inoculation with rhizobacteria capable of utilizing 1-aminocyclopropane-1-carboxylate or L-methionine. The Journal of Microbiology, 45(1), 15–20. Shaharoona, B., Jamro, G. M., Zahir, Z. A., Arshad, M., & Memon, K. S. (2007b). Effectiveness of various Pseudomonas spp. and Burkholderia caryophylli containing ACC-Deaminase for improving growth and yield of wheat (Triticum aestivum I.). Journal of Microbiology and Biotechnology, 17(8), 1300. Sharma, A., Jansen, R., Nimtz, M., Johri, B. N., & Wray, V. (2007). Rhamnolipids from the rhizosphere bacterium Pseudomonas sp. GRP3 that reduces damping-off disease in chilli and tomato nurseries. Journal of Natural Products, 70(6), 941–947. Sharma, A., Johri, B. N., Sharma, A. K., & Glick, B. R. (2003). Plant growth-promoting bacterium Pseudomonas sp. strain GRP3 influences iron acquisition in mung bean (Vigna radiata L. Wilzeck). Soil Biology and Biochemistry, 35(7), 887–894.

192

Recent Advancements in Microbial Diversity

Sharma, R., Pal, J., & Kaur, M. (2017b). Isolation of phosphate solubilizing Pseudomonas strains from apple rhizosphere in the Trans Himalayan region of Himachal Pradesh, India. BioRxiv, 193672. Sharma, R., Sharma, P., Chauhan, A., Walia, A., & Shirkot, C. K. (2017a). Plant growth promoting activities of rhizobacteria isolated from Podophyllum hexandrum growing in North-West regions of the Himalaya. Proceedings of the National Academy of Sciences, India Section B: Biological Sciences, 87(4), 1443–1457. Shata, S. M., Mahmoud, A., & Siam, S. (2007). Improving calcareous soil productivity by integrated effect of intercropping and fertilizer. Research Journal of Agriculture and Biological Sciences, 3(6), 733–739. Shelake, R. M., Pramanik, D., & Kim, J. Y. (2019). Exploration of Plant-Microbe Interactions for Sustainable Agriculture in CRISPR Era. Microorganisms, 7(8), 269. Sheng, X. F. (2005). Growth promotion and increased potassium uptake of cotton and rape by a potassium releasing strain of Bacillus edaphicus. Soil Biology and Biochemistry, 37(10), 1918–1922. Shinde, S., Cumming, J. R., Collart, F. R., Noirot, P. H., & Larsen, P. E. (2017). Pseudomonas fluorescens transportome is linked to strain-specific plant growth promotion in aspen seedlings under nutrient stress. Frontiers in Plant Science, 8, 348. Shivaji, S., Reddy, G. S., Suresh, K., Gupta, P., Chintalapati, S., Schumann, P., et al. (2005). Psychrobacter vallis sp. nov. and Psychrobacter aquaticus sp. nov., from Antarctica. International Journal of Systematic and Evolutionary Microbiology, 55(2), 757–762. Shoghi-Kalkhoran, S., Ghalavand, A., Modarres-Sanavy, S. A. M., Mokhtassi-Bidgoli, A., & Akbari, P. (2013). Integrated fertilization systems enhance quality and yield of sunflower (Helianthus annuus L.). Journal of Agricultural Science and Technology, 15(7), 1343–1352. Shtarkman, Y.M. (2015). Metagenomic and metatranscriptomic analyses of lake vostok accretion ice (Doctoral dissertation, Bowling Green State University). Shukla, A., Dhauni, N., Suyal, D. C., Kumar, S., & Goel, R. (2015). Comparative plant growth promoting potential of psychrotolerant diazotrophs, Pseudomonas sp. JJS2 and Enterobacter sp. AAB8 against native Cajanus cajan (L.) and Eleusine coracana (L.). African Journal of Microbiology Research, 9(20), 1371–1375. Silva, E., & Delate, K. (2017). A decade of progress in organic cover crop-based reduced tillage practices in the upper midwestern USA. Agriculture, 7(5), 44. Singh, B. K., & Trivedi, P. (2017). Microbiome and the future for food and nutrient security. Microbial Biotechnology, 10(1), 50–53. Singh, D., Takahashi, K., Kim, M., Chun, J., & Adams, J. M. (2012). A hump-backed trend in bacterial diversity with elevation on Mount Fuji, Japan. Microbial Ecology, 63(2), 429–437. Singh, R. N., Gaba, S., Yadav, A. N., Gaur, P., Gulati, S., Kaushik, R., et al. (2016). First high quality draft genome sequence of a plant growth promoting and cold active enzyme producing psychrotrophic Arthrobacter agilis strain L77. Standards in Genomic Sciences, 11(1), 54. Singh, R. P., Shelke, G. M., Kumar, A., & Jha, P. N. (2015). Biochemistry and genetics of ACC deaminase: a weapon to “stress ethylene” produced in plants. Frontiers in Microbiology, 6, 937. Smith, S. E., & Read, D. J. (2008). In Mycorrhizal symbiosis (third ed., pp. 605). New York, NY: Elsevier/Academic. Smith, R. S. (1992). Legume inoculant formulation and application. Canadian Journal of Microbiology, 38(6), 485–492. Solans, M., Vobis, G., & Wall, L. G. (2009). Saprophytic actinomycetes promote nodulation in Medicago sativa-Sinorhizobium meliloti symbiosis in the presence of high N. Journal of Plant Growth Regulation, 28(2), 106–114.

Role of rhizospheric microbial diversity in plant growth Chapter | 7

193

Son, T. N., Thu, V. V., Duong, V. C., & Hiraoka, H. (2007). Effect of organic and biofertilizers on soybean and rice cropping system. Tsukuba, Ibaraki, Japan: Japan International Research Center for Agricultural Sciences. Son, T. T. N., Diep, C. N., Giang, T. T. M., & Thu, T. T. (2007). Effect of co-inoculants (Bradyrhizobia and phosphate solubilizing bacteria) liquid on soybean under rice based cropping system in the mekong delta. Omon Rice, 15, 135–143. Spaepen, S., Vanderleyden, J., & Remans, R. (2007). Indole-3-acetic acid in microbial and microorganism-plant signaling. FEMS Microbiology Reviews, 31(4), 425–448. Srivastava, N., Bhandari, B., & Bhatt, A. B. (2014). PGPR isolated from rhizospheric soil of Zanthoxylum armatum DC in Garhwal Himalaya. International Journal of Herbal Medicine, 2(1), 100–108. Stephens, J. H. G., & Rask, H. M. (2000). Inoculant production and formulation. Field Crops Research, 65(2–3), 249–258. Stutz, E., Défago, G., & Kern, H. (1986). Naturally occuring fluorescent pseudomonads involved in suppression of black root rot of tobacco. Phytopathology, 76, 181–185. Suleman, M., Yasmin, S., Rasul, M., Yahya, M., Atta, B. M., & Mirza, M. S. (2018). Phosphate solubilizing bacteria with glucose dehydrogenase gene for phosphorus uptake and beneficial effects on wheat. PloS One, 13(9), e0204408. Suyal, D. C., Shukla, A., & Goel, R. (2014). Growth promotory potential of the cold adapted diazotroph Pseudomonas migulae S10724 against native green gram (Vigna radiata (L.) Wilczek). 3 Biotech, 4(6), 665–668. Swarupa, V., Pavitra, K., Shivashankara, K.S., & Ravishankar, K.V. (2016). Omics-driven approaches in plant–microbe interaction. In Microbial inoculants in sustainable agricultural productivity (pp. 61-84). Springer, New Delhi. Tak, H. I., Ahmad, F., Babalola, O. O., & Inam, A. (2012). Growth, photosynthesis and yield of chickpea as influenced by urban wastewater and different levels of phosphorus. International Journal of Plant Research, 2(2), 6–13. Tewari, S., & Arora, N. K. (2013). Plant growth promoting rhizobacteria for ameliorating abiotic stresses triggered due to climatic variability. Climate Change and sustainable Environment, 1(2), 95–103. Thakuria, D., Talukdar, N. C., Goswami, C., Hazarika, S., Boro, R. C., & Khan, M. R. (2004). Characterization and screening of bacteria from rhizosphere of rice grown in acidic soils of Assam. Current Science, 978–985. Thokchom, E., Kalita, M. C., & Talukdar, N. C. (2013). Isolation, screening, characterization, and selection of superior rhizobacterial strains as bioinoculants for seedling emergence and growth promotion of Mandarin orange (Citrus reticulata Blanco). Canadian Journal of Microbiology, 60(2), 85–92. Ting, L., Williams, T. J., Cowley, M. J., Lauro, F. M., Guilhaus, M., Raftery, M. J., et al. (2010). Cold adaptation in the marine bacterium, Sphingopyxis alaskensis, assessed using quantitative proteomics. Environmental Microbiology, 12(10), 2658–2676. Tittabutr, P., Payakapong, W., Teaumroong, N., Singleton, P. W., & Boonkerd, N. (2007). Growth, survival and field performance of bradyrhizobial liquid inoculant formulations with polymeric additives. Science Asia, 33(1), 69–77. Tiwari, K. R., Sitaula, B. K., Bajracharya, R. M., & Børresen, T. (2010). Effects of soil and crop management practices on yields, income and nutrients losses from upland farming systems in the Middle Mountains region of Nepal. Nutrient Cycling in Agroecosystems, 86(2), 241–253.

194

Recent Advancements in Microbial Diversity

Tomer, S., Suyal, D. C., Shukla, A., Rajwar, J., Yadav, A., Shouche, Y., (2017). Isolation and characterization of phosphate solubilizing bacteria from Western Indian Himalayan soils. 3 Biotech, 7(2), 95. Tripathi, M., Munot, H. P., Shouche, Y., Meyer, J. M., & Goel, R. (2005). Isolation and functional characterization of siderophore-producing lead-and cadmium-resistant Pseudomonas putida KNP9. Current Microbiology, 50(5), 233–237. Trivedi, P., & Pandey, A. (2008a). Plant growth promotion abilities and formulation of Bacillus megaterium strain B 388 (MTCC6521) isolated from a temperate Himalayan location. Indian Journal of Microbiology, 48(3), 342–347. Trivedi, P., Pandey, A., & Palni, L. M. S. (2005). Carrier-based preparations of plant growth-promoting bacterial inoculants suitable for use in cooler regions. World Journal of Microbiology and Biotechnology, 21(6–7), 941–945. Trivedi, P., Pandey, A., & Palni, L. M. S. (2008b). In vitro evaluation of antagonistic properties of Pseudomonas corrugata. Microbiological Research, 163(3), 329–336. Trivedi, P., Pandey, A., & Palni, L. M. S. (2012). Bacterial inoculants for field applications under mountain ecosystem: present initiatives and future prospects. In Bacteria in agrobiology: Plant probiotics (15-44). Trzcinski P., Malusa E., and Sas Paszt L., (2011). “Survival of PGPR ́ in beads of biodegrdable polimer,” in Proceedings of the Ogolnopolska¸ Naukowa¸ Konferencje¸ Ekologiczna, Osia¸gnie¸cia i Mozliwosci Rozwoju Badan i Wdro zen w Ekologicznej Pro- ́ dukcji Ogrodniczej, pp. 181– 182, Skierniewice, Poland. Vaid, S. K., Gangwar, B. K., Sharma, A., Srivastava, P. C., & Singh, M. V. (2014). Effect of zinc solubilizing bioinoculants on zinc nutrition of wheat (Triticum aestivum L.). International Journal of Advanced Research, 1(9), 805–820. Van Der Heijden, M. G., De Bruin, S., Luckerhoff, L., Van Logtestijn, R. S., & Schlaeppi, K. (2016). A widespread plant-fungal-bacterial symbiosis promotes plant biodiversity, plant nutrition and seedling recruitment. The Multidisciplinary Journal of Microbial Ecology Journal, 10(2), 389. Van Veen, J. A., van Overbeek, L. S., & van Elsas, J. D. (1997). Fate and activity of microorganisms introduced into soil. Microbiology and Molecular Biology Reviews, 61(2), 121–135. Velivelli, S. L., Kromann, P., Lojan, P., Rojas, M., Franco, J., Suarez, J. P., et al. (2015). Identification of mVOCs from Andean rhizobacteria and field evaluation of bacterial and mycorrhizal inoculants on growth of potato in its center of origin. Microbial Ecology, 69(3), 652–667. Vendan, R., & Thangaraju, M. (2007). Development and standardization of cyst based liquid formulation of Azospirillum bioinoculant. Acta Microbiologica et Immunologica Hungarica, 54(2), 167–177. Verma, P., Yadav, A. N., Khannam, K. S., Panjiar, N., Kumar, S., Saxena, A. K., et al. (2015). Assessment of genetic diversity and plant growth promoting attributes of psychrotolerant bacteria allied with wheat (Triticum aestivum) from the northern hills zone of India. Annals of Microbiology, 65(4), 1885–1899. Verma, S., Sharma, R., & Chauhan, A. (2018). Plant growth promoting and antagonistic potential of indigenous PGPR from tomato seedlings grown in mid hill regions of Himachal Pradesh. Journal of Pharmacognosy and Phytochemistry, 7(1), 968–973. Vessey, J. K. (2003). Plant growth promoting rhizobacteria as biofertilizers. Plant and Soil, 255(2), 571–586. Vílchez, J. I., Navas, A., González-López, J., Arcos, S. C., & Manzanera, M. (2016). Biosafety test for plant growth-promoting bacteria: Proposed environmental and human safety index (EHSI) protocol. Frontiers in Microbiology, 6, 1514.

Role of rhizospheric microbial diversity in plant growth Chapter | 7

195

Vilchez, S., & Manzanera, M. (2011). Biotechnological uses of desiccation-tolerant microorganisms for the rhizoremediation of soils subjected to seasonal drought. Applied Microbiology and Biotechnology, 91(5), 1297. Voisard, C., Keel, C., Haas, D., & Dèfago, G. (1989). Cyanide production by Pseudomonas fluorescens helps suppress black root rot of tobacco under gnotobiotic conditions. The EMBO Journal, 8(2), 351–358. Vollmers, J., Voget, S., Dietrich, S., Gollnow, K., Smits, M., Meyer, K., et al. (2013). Poles apart: Arctic and Antarctic Octadecabacter strains share high genome plasticity and a new type of xanthorhodopsin. PLoS One, 8(5), e63422. Vyas, P., Joshi, R., Sharma, K. C., Rahi, P., Gulati, A., & Gulati, A. (2010). Cold-adapted and rhizosphere-competent strain of Rahnella sp. with broad-spectrum plant growth-promotion potential. J Microbiol Biotechnol, 20(12), 1724–1734. Wang, C. J., Yang, W., Wang, C., Gu, C., Niu, D. D., Liu, H. X., et al. (2012). Induction of drought tolerance in cucumber plants by a consortium of three plant growth-promoting rhizobacterium strains. PLoS One, 7(12), e52565. Wang, C., Knill, E., Glick, B. R., & Défago, G. (2000). Effect of transferring 1-aminocyclopropane1-carboxylic acid (ACC) deaminase genes into Pseudomonas fluorescens strain CHA0 and its gac A derivative CHA96 on their growth-promoting and disease-suppressive capacities. Canadian Journal of Microbiology, 46(10), 898–907. Wang, K. L. C., Li, H., & Ecker, J. R. (2002). Ethylene biosynthesis and signaling networks. The Plant Cell, 14(suppl 1), S131–S151. Wani, S. H., Kumar, V., Shriram, V., & Sah, S. K. (2016). Phytohormones and their metabolic engineering for abiotic stress tolerance in crop plants. The Crop Journal, 4(3), 162–176. Wanner, L. A., & Kirk, W. W. (2015). Streptomyces–from basic Microbiology to role as a plant pathogen. American Journal of Potato Research, 92(2), 236–242. Welbaum, G., Sturz, A. V., Dong, Z., & Nowak, J. (2004). Fertilizing soil microorganisms to improve productivity of agroecosystems. Critical Reviews in Plant Sciences, 23, 175–193. Williams, S. G., Greenwood, J. A., & Jones, C. W. (1996). Physiological and biochemical changes accompanying the loss of mucoidy by Pseudomonas aeruginosa. Microbiology, 142(4), 881–888. Wilson, B. R., Bogdan, A. R., Miyazawa, M., Hashimoto, K., & Tsuji, Y. (2016). Siderophores in iron metabolism: from mechanism to therapy potential. Trends in Molecular Medicine, 22(12), 1077–1090. Wu, Z., Zhao, Y., Kaleem, I., & Li, C. (2011). Preparation of calcium–alginate microcapsuled microbial fertilizer coating Klebsiella oxytoca Rs-5 and its performance under salinity stress. European Journal of Soil Biology, 47(2), 152–159. Yadav, A. N., Yadav, N., Sachan, S. G., & Saxena, A. K. (2019). Biodiversity of psychrotrophic microbes and their biotechnological applications. Journal of Applied Biology & Biotechnology, 7(04), 99–108. Yadav, A.N., Kumar, V., Dhaliwal, H.S., Prasad, R., & Saxena, A.K. (2018a). Microbiome in crops: diversity, distribution, and potential role in crop improvement. In crop improvement through microbial biotechnology (pp. 305-332). Elsevier. Yadav, A. N. (2018b). Biodiversity and biotechnological applications of host-specific endophytic fungi for sustainable agriculture and allied sectors. Acta Scientific Microbiology, 1, 01–05. Yadav, A.N., Verma, P., Sachan, S.G., Kaushik, R., & Saxena, A.K. (2018c). Psychrotrophic microbiomes: molecular diversity and beneficial role in plant growth promotion and soil health. In Microorganisms for green revolution (pp. 197-240). Springer, Singapore. Yadav, A. N., Kumar, R., Kumar, S., Kumar, V., Sugitha, T., & Singh, B., (2017a). Beneficial microbiomes: biodiversity and potential biotechnological applications for sustainable agriculture and human health. Journal of Applied Biology & Biotechnology, 5(6), 45–57.

196

Recent Advancements in Microbial Diversity

Yadav, A. N., Verma, P., Kumar, V., Sachan, S. G., & Saxena, A. K. (2017b). Extreme cold environments: a suitable niche for selection of novel psychrotrophic microbes for biotechnological applications. Advances in Biotechnology & Microbiology, 2(2), 1–4. Yadav, A. N., Verma, P., Sachan, S. G., & Saxena, A. K. (2017c). Biodiversity and biotechnological applications of psychrotrophic microbes isolated from Indian Himalayan regions. EC Microbiology ECO, 1, 48–54. Yadav, A. N., Verma, P., Kumar, V., Sachan, S. G., & Saxena, A. K. (2017d). Extreme cold environments: A suitable niche for selection of novel psychrotrophic microbes for biotechnological applications. Advances in Biotechnology & Microbiology, 2, 1–4. Yadav, A.N., Sachan, S.G., Verma, P., & Saxena, A.K. (2016). Bioprospecting of plant growth promoting psychrotrophic Bacilli from the cold desert of north western Indian Himalayas. Yadav AN., et al. (2015). “Psychrotrophic microbes: Diversity analysis and bioprospecting for industry and agriculture”. In: 85th annual session of nasi and the symposium on “marine and fresh water ecosystems for national development”. Yasari, E., Azadgoleh, M. E., Mozafari, S., & Alashti, M. R. (2009). Enhancement of growth and nutrient uptake of rapeseed (Brassica napus L.) by applying mineral nutrients and biofertilizers. Pakistan Journal of Biological Sciences, 12(2), 127. Zachariah, S., Kumari, P., & Das, S. K. (2016). Psychrobacter pocilloporae sp. nov., isolated from a coral, Pocillopora eydouxi. International Journal of Systematic and Evolutionary Microbiology, 66(12), 5091–5098. Zachow, C., Pirker, H., Westendorf, C., Tilcher, R., & Berg, G. (2009). The Caenorhabditis elegans assay: a tool to evaluate the pathogenic potential of bacterial biocontrol agents. European Journal of Plant Pathology, 125(3), 367–376. Zahid, M. (2015). Isolation and identification of indigenous plant growth promoting rhizobacteria from Himalayan region of Kashmir and their effect on improving growth and nutrient contents of maize (Zea mays L.). Frontiers in Microbiology, 6, 207. Zahir, Z. A., Ghani, U., Naveed, M., Nadeem, S. M., & Asghar, H. N. (2009). Comparative effectiveness of Pseudomonas and Serratia sp. containing ACC-deaminase for improving growth and yield of wheat (Triticum aestivum L.) under salt-stressed conditions. Archives of Microbiology, 191(5), 415–424. Zahir, Z. A., Munir, A., Asghar, H. N., Shaharoona, B., & Arshad, M. (2008). Effectiveness of rhizobacteria containing ACC deaminase for growth promotion of peas (Pisum sativum) under drought conditions. Journal of Microbiology and Biotechnology, 18(5), 958–963. Zaidi, A., Khan, M., Ahemad, M., & Oves, M. (2009). Plant growth promotion by phosphate solubilizing bacteria. Acta Microbiologica et Immunologica Hungarica, 56(3), 263–284. Zaidi, N.W., Dar, M.H., Singh, S., & Singh, U.S. (2014). Trichoderma species as abiotic stress relievers in plants. In biotechnology and biology of trichoderma (pp. 515-525). Elsevier. Zak, D. R., Homes, W. E., White, D. C., (2003). Plant diversity, soil microbial communities, and ecosystem function: are there any links? Ecology, 84, 2042–2050. Zhang, C., Guo, W., Wang, Y., & Chen, X. (2018). Draft genome sequences of two psychro-

tolerant strains, Colwellia polaris MCCC 1C00015T and Colwellia chukchiensis CGMCC 1. 9127 T. Genome Announcements, 6(4), e01575–17.

Chapter 8

Microbes adapted to cold and their use as biofertilizers for mountainous regions Geeta Bhandari Sardar Bhagwan Singh University, Balawala, Dehradun, Uttarakhand, India

1 Introduction Soil is a complex, dynamic, living matrix and is a critical resource for agriculture production and food security and maintenance of most life processes. The rhizosphere is a soil volume surrounding roots that is affected by the plant root chemically, physically and biologically. It is the zone of soil having maximum microbial activity. Of different microbial populations (algae, fungi, bacteria and protozoa) found in the rhizosphere, bacteria are the most abundant ones (Kaymak, 2010). An important group of microbial communities residing in the rhizosphere and exerting beneficial effects on plant growth are termed as plant growth promoting rhizobacteria (PGPR) (Kloepper & Schroth, 1978). Root exudates can be used as nutritional source for growth and proliferation of microbes and in return these microbes exert a potential impact on plant health and soil fertility (Burdman, Jurkevitch, & Okon, 2000). PGPR enhance growth and development of plants through direct and indirect mechanisms (Glick, 1995). The indirect growth promotion mechanisms include: inhibition of plant pathogens, Induced systemic resistance (Glick & Bashan, 1997; Cartieaux, Nussaume, & Robaglia, 2003; Nehl, Allen, & Brown, 1997). PGPR work by producing certain metabolites which affect the pathogen population and/or by producing siderophores which capture iron and thus isn’t available for pathogens (Arora, Kang, & Maheshwari, 2001; Bhattacharyya & Jha, 2012; Kloepper, 1996). PGPR also enhance plant resistance against plant pathogens by influencing the host-plant vulnerability, through induced systemic resistance (Saravanakumar, Vijayakumar, Kumar, & Samiyappan, 2007). Direct growth promoting mechanisms include: biological nitrogen fixation, siderophore production for iron sequestration, phosphate solubilization, phytohormone production (Kloepper et al., 1987; Glick, 1995; Kloepper, Lifshitz, & Zablotowicz, 1989; Patten & Glick, 2002). PGPR may also affect plant growth Recent Advancements in Microbial Diversity. http://dx.doi.org/10.1016/B978-0-12-821265-3.00008-6 Copyright © 2020 Elsevier Inc. All rights reserved.

197

198

Recent Advancements in Microbial Diversity

and development by producing various key enzymes such as, ACC-deaminase, chitinase and by producing exopolysaccharides and rhizobitoxine for resistance in stress conditions (Ashraf, Berge, & Mahmood, 2004; Glick, Cheng, Czarny, Cheng, & Duan, 2007; Sandhya, Ali, G, Reddy, & Venkateswarlu, 2009). Rhizobitoxine is an ethylene biosynthesis inhibitor that enhances nodulation (Vijayan, Palaniappan, Tongmin, Elavarasi, & Manoharan, 2013). Plant growth promotion abilities of PGPR are also affected by interaction of PGPR with host plant and the soil environment apart from their inherent mechanisms (Gamalero, Berta, Massa, Glick, & Lingua, 2010). Various biotic and abiotic stresses present in the soil environment influence plant growth and development. The biotic stresses include plant pathogenic organisms and pests (bacteria, fungi, viruses, insects, nematodes, etc.) and abiotic stresses include temperature, soil pH, drought, gases, heavy metals, flooding and nutrient imbalance. The temperate agro-ecosystems throughout the world have short growing durations, with intermittent periods of suboptimal temperatures. The activities of the PGPRs are dictated by the root zone temperature, since most physiological and biochemical activities that affect plant growth get inhibited at such low temperatures, thus resulting in short cropping periods and ultimately affecting the crop productivity (Robertson & Grandy, 2005; Mishra, Joshi, Bisht, Bisht, & Selvakumar, 2011). This inhibitory effect is highly prominent in the cases of nutrient cycling where microorganisms play an important role. Genetic modifications and transfer of low temperature tolerance into commercially important plants is a complex and time consuming process since cold resistance isn’t expressed using a single gene only but includes complex mechanisms working together to develop cold resistance (Kasuga, Liu, Miura, Yamaguchi-Shinozaki, & Shinozaki, 1999; Beck, Heim, & Hansen, 2004). Therefore, a solution for the protection of plants from chilling and for their growth enhancement involves the application of cold-adapted and cold loving PGPR, which are able of tolerating the low temperature and remain active even under low temperatures. Forster (1887) was the first to report the capability of microorganisms to tolerate (and even proliferate) at low temperatures. This is due to various mechanisms employed by these organisms that have evolved them to face the difficulties imposed by permanently cold environments. Some of these strategies employed involve regulating the fluidity of cell membranes, synthesizing special molecules (e.g., cold-shock proteins, cryoprotectors, and antifreeze molecules), regulating permeability of ion channels (osmoregulation), seasonal dormancy, and perhaps the most important adaptation to freezing temperatures is modifying the enzyme kinetics (Georlette et al., 2004; D’ Amico, Collins, Marx, Feller, & Gerday, 2006). Bacteria growing in low temperature conditions are located in abundance in different polar regions of earth's surface. High altitude microbiomes being hot spots of microbial diversity are habitat of various psychrophiles and psychrotolerant microorganisms, which have been reported by several authors (Miteva & Brenchley, 2005; Pradhan et al., 2010; Sahay et al., 2013; Prasad et al., 2014).

Microbes adapted to cold and their use as biofertilizers Chapter | 8

199

The psychrotrophic PGP microorganisms reported till date consists of Bacillus, Kocuria, Pseudomonas, Arthrobacter, Flavobacterium, Hydrogenophaga, Burkholderia, Enterobacter, Janthinobacterium, Brevundimonas Serratia, Citricoccus, Lysinibacillus, Clostridium, Exiguobacterium, Methylobacterium, Microbacterium, Paenibacillus, Providencia, Azotobacter, and Azospirullum. These cold adapted PGP microbes are capable of enhancing plant yield by furnishing plant growth promoting compounds (Table 8.1). TABLE 8.1 Psychrotolerant plant growth promoting bacteria. Microorganism

Source

Function

References

P. syringae

Tomato and soybean

Anderson, Buchanan, Stall, & Hall, (1982)

Azospirillum brasilense

Finger millet, sorghum, pearl millet Spring wheat field

Increase in frost susceptibility by ice nucleating strains of P. syringae Increase in yield

Increased seedling emergence Increased germination rate Increase in yield

Freitas and Germida (1992) Fages and Arsac (1991) Okon and LabanderaGonzalez (1994) Kropp, Thomas, Pounder, & Anderson, (1996) Mayak, Tirosh, & Glick (1999) Zhang, Prithiviraj, Charles, Driscoll, & Smith, (2003) Prévost et al. (2003)

Pseudomonas chlororaphis 2E3, O6 Sunflower Xanthomonas maltophila Maize, wheat Azospirillum local isolates

Plant growth and nitrogen content increased Mungbean tomato, Positive seedling growth pepper Soybeans Improved nodulation and nitrogen fixation

Pseudomonas putida R111, Pseudomonas corrugate, Enterobacter cloacae CAL3 Bradyrhizobium japonicum

Amaranthus paniculatus

Sinorhizobium meliloti

Alfalfa

Mycobacterium sp. 44 Mycobacterium phlei MbP18 Mycobacterium bullata MpB46 A cold-tolerant mutant of Pseudomonas fluorescens

Triticum aestivum cv. Bussard

Vigna radiata

Growth improvement under cold and anaerobic (ice encasement) stresses Increase root and shoot dry mass and enhance N, P,K uptake

Subba Rao (1986)

Egamberdiyeva and Höflich (2003)

Growth promotion at 25 Katiyar and Goel and 10°C and a 17-fold (2004) increase in siderophore production and increased rhizosphere colonization (Continued)

200

Recent Advancements in Microbial Diversity

TABLE 8.1 Psychrotolerant plant growth promoting bacteria. (Cont.) Microorganism

Source

Function

References

Burkholderia phytofirmans PsIN

Glomus vesiculiferum – infected onion roots

Cold stress tolerance and increase in total phenolics, photosynthetic activity in Vitis vinifera

Barka, Nowak, & Clément, (2006)

Pseudomonas putida (B0)

Soil from central Himalayas

P-solubilization, Pandey, Trivedi, antagonistic to Alternaria Kumar, & Palni,. alternaria, fusarium (2006) oxysporum

P. putida UW4

Canola plant

Promotes plant growth at Cheng et al. low temperature under (2007) salt stress and produces ACC deaminase

Rhodococcus erythropolis MtCC 7905

Pisum sativum var Arkel

Promotes plant growth at low temperature under Chromium stress conditions

Pseudomonas sp. PGERs17

Garlic root

P-solubilization, Mishra et al. antagonistic to pathogen (2008)

Pantoea dispersa IA

NW Indian Himalayas

Selvakumar et al. Involved in P(2008a) solubilization, IAA production, HCN production,increase in root and shoot lengths in Triticum sp.

Serratia marcescens SRM (MTCC 8708)

Flowers of summer Increase root and shoot squash (Cucurbita lengths and N, P, K pepo) uptakein Triticum sp.

Selvakumar et al. (2008b)

Pseudomonas sp. NARs9

Rhizosheric soil Amarnath, NW Indian Himalayas

Increase germination rate, shoot and root lengths in Triticum sp.

Mishra et al. (2009)

Acinatobacter rhizosphaerae BIHB 723

Rhizosphere of Hippophae rhamnoides

P-solubilization, IAA, ACC deaminase production Hordeum vulgare

Gulati, Vyas, Rahi, & Kasana, (2009)

Pseudomonas lurida M2RH3

Rhizosphere of radish plant

P-solubilization, root and shoot length increased and N, P, K uptake

Selvakumar et al. (2011)

Rahnella sp. BHIB783

Rhizosphere of Hippophae rhamnoides

P-solublization, Siderophore, IAA, ACC deaminase production

Vyas, Joshi, Sharma, Rahi, & Gulati (2010)

Pseudomonas lurida

Rhizosphere of Himalayan plants

Protects plant from chilling stress

Bisht, Joshi, & Mishra, 2014

Trivedi, Pandey, & Sa (2007)

Microbes adapted to cold and their use as biofertilizers Chapter | 8

201

Based on their requirements of low temperatures for growth, they are divided into psychrophiles (cold loving) and psychrotolerant (cold tolerant). Psychrophiles inhabit areas of permanent low temperatures, such as deep sea areas, high attitude soils and Polar Regions. They survive at temperature range between subzero to 15 °C. Environments showing seasonal, periodic or diurnal temperature fluctuations (e.g., areas with high summer temperatures and low winter temperatures) are inhabited by the psychrotolerant (cold tolerant) microorganisms, growing at temperature range from 4 to 42°C with temperature optima above 20°C (Morita, 1975). In high altitude agriculture, the psychrotolerant microorganisms are of great importance due to better survival and adaptation to cold conditions and ability to also grow optimally at higher temperature. Thus, these cold adapted microbes can be used to develop proficient CT-biofertilizers for use in mountain agriculture.

2  Mechanism of plant growth promotion at low temperature Under low temperature stress plant developments is adversely affected due to limited metabolic reactions and inhibited water uptake which is due to chilling, chlorosis, wilting, necrosis, damage of biomolecules and reduction in osmotic potential of cell. Chilling stress results in rigidification of cell membrane of plant cells due to reduced fluidity of the cellular membranes, accumulation of cryoprotectants and increased potential to tolerate oxidative stress. Plants use several mechanisms for survival in cold temperature conditions, however net decrease in plant growth and production is observed in such conditions (Haldiman, 1998). PGPRs play important role by helping plants to withstand cold tolerance, as several genes are induced by PGPR activities which allow plants to tolerate various abiotic stresses. PGPRs adapted to cold environments can also principally help in promoting plant growth in low temperature condition by various direct and indirect mechanisms.

2.1  Phytostimulation and production of phytohormones Phytohormones are organic molecules, which affect various physical and metabolic processes of plants and act as chemical messengers (Fuentes-Ramírez and Caballero-Mellado 2006). Several rhizobacteria (Proteus mirabilus, Pseudomonas vulgaris, Klebsiella pneumoniae, Bacillus cereus, Escherichia coli) are capable of producing various phytohormones such as auxins (IAA) (Spaepen, Dobbelaere, Croonenborghs, & Vanderleyden, 2008), gibberellines (Bottini, Cassán, & Piccoli, 2004) and cytokinins (Timmusk, Nicander, Granhall, & Tillberg, 1999) or regulate the increased amount of ethylene in plants (Glick and Bashan, 1997) and thus help in plant growth promotion. Phytohormones released in the rhizosphere, increase the root hair length, surface area and density, thus resulting in enhanced water and mineral by plant roots (Bric, Bostock, & Silverstone, 1991).

202

Recent Advancements in Microbial Diversity

2.1.1  Indole acetic acid Indole-3-acetic acid (IAA) or auxin is one of the most important phytohormone produced by PGPR which enhances plant growth. It regulates division, expansion and differentiation of plant cells and tissues and stimulates root elongation. Auxin can be synthesized using tryptophan or without it (Spaepen, Vanderleyden, & Remans, 2007) and its synthesis in microbes is under the regulation of pentose phosphate pathway (McCue, Zheng, Pinkham, & Shetty, 2000). Two microbial strains Pantoea dispersa strain 1A and Serratia marcescens strain SRM isolated from the North-Western Indian Himalayas and capable of producing IAA at 4 and 15°C were reported by Selvakumar et al. (2008a), Selvakumar et al. (2008b). These cold tolerant strains were found to enhance plant growth and biomass at low temperatures in wheat and summer squash (Cucurbita pepo). Mishra et al. (2008, 2009) have reported cold tolerant and IAA producing Pseudomonas sp. strain PGERs17 and NARs9. These strains also increased seed germination, plant length of wheat seedlings growing at low temperature. Gulati and co-workers (2009) have isolated Acinetobacter rhizosphaerae from common sea-buckthorn (Hippophae rhamnoides) of cold deserts of Himalayas. The isolate was capable of IAA production and plant growth enhancement in a maize, pea, chickpea and barley under in vitro and field conditions. Selvakumar et al. (2009b) reported Exiguobacterium acetylicum 1P (MTCC 8707) from the rhizosphere of apple trees of North Western Indian Himalayan Region. The strain showed growth in the temperature range of 4–42°C and also tolerated a wide pH range (4–10) and also high salt concentrations (up to 8% NaCl) and found to produce IAA. Kumar, Suyal, Dhauni, Bhoriyal, & Goel (2014) evaluated a psychrotolerant IAA producing strain Pseudomonas jesenii strain MP1 for plant growth promotion of indigenous Cicer arietinum (L.)., Vigna mungo (L.) Hepper., Vigna radiata (L.) Wilczek., Cajanus cajan (L.) Millsp. and Eleusine coracana (L.) Gaertn. 2.1.2 ACC-deaminase PGPRs also facilitate plant growth by synthesizing enzyme, 1-aminocyclopropane-1-carboxylate (ACC) deaminase, which plays a significant role in the regulation of the plant hormone, ethylene. ACC deaminase helps alleviating the stress induced by ethylene-mediated negative impact on plants. Extent of ethylene and its production is under tight regulation of various transcriptional and post-transcriptional factors, which in turn are controlled by the conditions of surrounding environment (Hardoim, Van Overbeek, & Elsas, 2008). At high and low temperatures, accelerated ethylene production results in decreased plant growth and development. Microbes capable of synthesizing ACC deaminase, arrest plant ACC and cleave it to form ammonia and a-ketobutyrate, which can be easily metabolized by the bacteria. Thus, detrimental effects of ethylene are lowered, plant growth (root, shoot and biomass) and stress tolerance is enhanced (Glick et al., 2007). In response to root exudates,

Microbes adapted to cold and their use as biofertilizers Chapter | 8

203

epiphytes and endophytes capable of ACC deaminase-production also form IAA. Barka et al. (2006) have reported improved cold resistance and ACC deaminase activity by Burkholderia phytofirmans in grapevine. Cheng, Park, & Glick (2007) have reported a psychrotolerant ACC deaminase-producing bacterium P. putida UW4 capable of growth promotion of canola plants under low temperature and salt stress. Six psychrotolerant possessing ACC deaminase activity and capable of secreting different extracellular proteins under cold stress have been reported by Tiryaki, Aydin, & Atici (2019) from cold adapted wild bean plants.

2.1.3  HCN production Hydrogen cyanide (HCN) is mostly synthesized by PGPR that impose a negative effect on root metabolism and root growth and thus work as biological control agents of weeds (Kamei, Dolai, & Kamei, 2014). 31psychrotolerant bacterial strains were reported to produce HCN by Verma et al. (2015). Two psychrotolerant bacterial strains related to Pseudomonas sp. were isolated from glacial ice and reported to produce HCN by Balcazar et al. (2015). Yadav, Sachan, Verma, & Saxena (2015) reported HCN production by 8 bacterial from cold deserts of North Western Himalayan regions. Selvakumar et al. (2008b) reported a HCN producing isolate Serratia marcescens strain SRM from the North-Western Indian Himalayas. Ghyselinck et al. (2013) isolated 14 Pseudomonas strain capable of HCN production from the rhizosphere of potatoes grown at different altitudes of Central Andean Highlands of Peru and Bolivia. Selvakumar et al. (2009b) reported an HCN producing Exiguobacterium acetylicum 1P (MTCC 8707) strain from the rhizosphere of apple trees of North Western Indian Himalayas. 2.2  Siderophore production Iron is a vital micronutrient for plants as it serves as an essential cofactor of several enzymes responsible for catalyzing oxidation and reduction reactions. A major part of iron present in soils is in highly insoluble form of ferric hydroxide; thus, it is limiting nutrient for plant growth even in iron-rich soils. Its availability to the plants is also restricted due to the rapid oxidation of ferrous (Fe++) to ferric (Fe+++) state. Ferric ion occurs in highly insoluble form under physiological conditions and thus isn’t readily available to plant and microbes (Neilands, 1995). Microorganisms have developed unique methods for the assimilating this insoluble form of iron. One of the most important mechanisms of iron assimilation employed by the PGPRs include synthesizing low molecular weight compounds called siderophores, capable of iron-chelation. Siderophores are thus both directly and indirectly responsible for plant growth promotion (Neilands 1981). Siderophores impart an edge for the survival of plant and bacterial species over pathogenic fungus and other microbes’ competitors by a limiting the available form of iron required for survival of all

204

Recent Advancements in Microbial Diversity

(Masalha, Kosegarten, Elmaci, & Mengel, 2000; Wang, Knill, & Defago, 2000). Broadly, siderophores are divided into three groups on the basis of the group that furnishes oxygen ligands for Fe3+ chelation: a) catecholates (phenolates) b) hydroxymates (carboxylate) and c) the mixed types (Neilands, 1981). Thus, siderophores production can also be exploited as a biocontrol method against several soil borne plant pathogens. Katiyar and Goel (2004) have developed a mutant strain of Pseudomonas fluorescens capable of growth at low temperature and increased siderophore production (17-fold) and rhizosphere colonization. This mutant strain was found to enhance growth of Vigna radiata plants in low temperature range of 25°C and 10°C. Negi, Kumar, & Garg (2005) have also described a group of cold-tolerant, siderophore producing Pseudomonads strains isolated from the Garhwal area of the Indian Himalayan region. These strains promoted plantgrowth at 4–25°C and on seed inoculation of garden pea, root-borne diseases were observed to be suppressed. A novel bacterium Exiguobacterium acetylicum strain 1P was isolated from soils of North Western Indian Himalayan region. This strain was capable of siderophore production and a worked as a biocontrol agent against Rhizoctonia solani, Phythium, Fusarium oxysporium and Sclerotium rolfsii (Selvakumar et al., 2009b). A cold-tolerant Pseudomonas sp. strain PGERs17 possessing HCN and siderophore production abilities at 4°C were reported by Mishra et al. (2008). The strain also worked as a biocontrol agent of various pathogenic fungi, S. rolfsii, R. solani, Pythium sp. and F. oxysporum (Mishra et al., 2008). Malviya, Pandey, Trivedi, Gupta, & Kumar (2009) have isolated antagonistic, chitinolytic, psychrotolerant strains of Streptomyces from glaciers of the Indian Himalayas showing biocontrol activities against several plant pathogenic fungi.

2.3  Phosphate solubilization Phosphorus is one of the most essential plant nutrients and thus, phosphorus nutrient cycling is of high importance. Despite the fact that the phosphorus content in the soil is sufficient for plant growth, most forms of phosphorus are present in fixed forms and therefore require transformation. Phosphate in soil is found mainly in two forms: organic and inorganic phosphates. Inorganic phosphate is majorly found in soil and thus not easily available to plants. Inorganic P of soil mostly consists of insoluble mineral composites and are mostly precipitated and thus cannot be drawn by plants. Organic matter accounting for 20–80% of soil phosphate is the major pool of immobilized phosphate in soil (Richardson, 1994). Phosphate solubilizing microbes (PSM) are characterized by their ability to readily and efficiently solubilize mineral forms of inorganic P to a form (orthophosphate) available to plants and thus increase crop yield. PSM employ several mechanisms for P solubilization, which include: (1) liberation of compounds able to dissolve inorganic P e.g. organic acid anions, protons, CO2, hydroxyl ions and siderophores, (2) discharge of enzymes capable

Microbes adapted to cold and their use as biofertilizers Chapter | 8

205

of mineralizing inorganic P termed as biochemical P mineralization and (3) liberation of P by biological mineralization using substrate degradation (McGill & Cole, 1981). PSM also work as sink of P, by immobilization of P even under condition of very low concentration of soil P. Phosphate solubilizing microbes on starvation, predation or death also act as source of P to plants (Butterly, Bunemann, McNeill, Baldock, & Marschner, 2009). Phosphate solubilization by microbes is mainly due to a membrane bound enzyme glucose dehydrogenase which catalyzes the oxidation of glucose to gluconic acid (Goldstein 1995), which is then converted to 2-ketogluconic acid and 2,5-diketogluconic acid. 2-ketogluconic acid is highly effective for phosphate solubilization (Kim et al., 2002). P-solubilization under low temperatures for the first time was reported by Mishra and Goel (1999), which produced cold-tolerant mutants of a well-known PGPR, Pseudomonas fluorescens capable of efficient phosphate solubilization and enhancing plant growth at cold temperature conditions. Das, Katiyar, & Goel (2003) constructed mutants of three different strains of P. fluorescens (ATCC13525, PRS9 and GRS1) by nitrosoguanidine treatment. The mutant strains were found to be more effective than their wild-type for phosphate solubilization under low temperature. Katiyar and Goel. (2003) have reported enhanced growth of wheat and mung bean by P. fluorescens mutants under in vitro and in situ conditions at 10°C. Trivedi and Sa (2008) isolated a psychrotrophic strain of P. corrugata from IHR soils and generated mutants with high P-solubilizing abilities using NTG (N’-methyl-N’-nitro-N-nitrosoguanidine). Taking into consideration, the low stability of mutant strains, progress has also been made in scouting the environment for natural psychrotolerant strains. Native soil bacteria are also found to be excellently acclimatized to the distinct climatic conditions of the specific sites (Paau 1989) and thus can be used. The strain Pseudomonas putida, capable of growth at low temperatures, having phosphate solubilization and bio-control activity, was isolated by Pandey et al. (2006) from the subalpine location of the Indian central Himalayas. Selvakumar et al. (2009a) have described a psychrotolerant strain Pseudomonas fragi CS11RH1 (MTCC 8984) capable of phosphate solubilization, which was isolated from Indian Himalayan region. A rhizosphere-competent strain of Acinetobacter rhizosphaerae isolated from the cold deserts of the Indian Himalayan region was also found to solubilize phosphate (Gulati et al. 2009). Vyas et al. (2009) have isolated 19 P-solubilizing fluorescent Pseudomonas strains from the cold deserts of the trans-Himalayas and characterized their tolerance against temperature, alkalinity, salinity, calcium salts and desiccation-induced stresses. CT-PSB Exiguobacterium strains have been isolated from various diverse extreme environments, including the Siberian permafrost, a glacial ice core sample in Greenland, and hot springs in Yellowstone National Park (Vishnivetskaya et al., 2009). Several other bacterial species belonging to CT-PSB isolated till date include Pseudomonas fluorescens (Egamberdiyeva and Höflich 2003),

206

Recent Advancements in Microbial Diversity

P. lurida (Selvakumar et al., 2011), P. corrugata (Pandey & Palni, 1998), Pantoea agglomerans (Egamberdiyeva & Höflich, 2003), P. dispersa (Selvakumar et al., 2008a), Tetrathiobacter sp. (Kumar et al., 2013), Bacillus subtilis (Malviya et al., 2012), Exiguobacterium acetylicum (Selvakumar et al., 2009b) and Enterobacter ludwigii PS1 (Dolkar, Dolkar, Angmo, Chaurasia, & Stobdan, 2018)

2.4  Nitrogen fixation Available form of nitrogen: nitrate and ammonium have high biological demand but are found only in small amounts. Therefore, biological nitrogen fixation is a significant process and acts as a source of fixed nitrogen (N) in many habitats (Vitousek & Howarth, 1991; Arp, 2000). Biological nitrogen fixation involves the enzymatic conversion of atmospheric nitrogen to biologically available form. Microorganisms are elemental constituent of the ecosystem which play significant role in biogeochemical conversion of elements, including N2 fixation (Atlas and Bartha, 1998; Madigan, Matinko, & Parkar, 2000) and thus are the major means of life sustenance in this planet. Innumerous nitrogen fixing microbes have been reported till date. All the diazotrophs use nitrogenase enzyme for nitrogen fixation. It is involved in catalytic reduction of atmospheric dinitrogen to ammonia coupled with reduction of protons to hydrogen (Kim & Rees, 1994). Nitrogenase is made of two multisubunit metallo-proteins consisting of iron (Fe) protein (dinitrogen reductase) and the molybdenum iron (MoFe) protein (dinitrogenase) (Howard & Rees, 1996). Nitrogenase is coded by the nifHDK genes; these are commonly present in contiguous array in the genome. In the conventional enzymes, Fe-S centers also contain Mo, whereas in “alternative” and “second alternative” nitrogenases in place of Mo, V and Fe are present respectively. All these different nitrogenases contain highly conserved nifH genes (Howard & Rees, 1996). Both types of alternative nitrogenases include nifH, however also include a third protein in the place of the Mo protein that is coded by nifG (nifDGK). The reaction catalyzed by nitrogenase requires 16 ATP and 8 electrons per molecule reduced and thus energetically quite costly. Nitrogenase under in vitro conditions is also quite sensitive to presence of oxygen and becomes inactivated by its presence. Low temperature stress adversely affects the nodulation process of rhizobia, delays root infection and may also suppress nodule function (Lynch & Smith, 1994). McKay and Djordjevic (1993) have reported reduction in synthesis of nod metabolites by R. leguminosarum trifolii under low temperature stress and thus reduction in nodulation and ultimately affecting host legume yield. Thus, it is of utmost importance to identify cold-adapted/tolerant strains of rhizobium to overcome the cold-induced stress. Therefore, ideal rhizobium strain for cold temperatures legumes would be capable of nitrogen fixation under low temperature stress. Such rhizobial strains are capable of retaining fluid nature of cell membranes even under cold stress and are able to synthesize

Microbes adapted to cold and their use as biofertilizers Chapter | 8

207

membrane-associated Nod factors, which are essential for process of nodulation. Considering this, Prevost, Drouin, & Antoun (1999) selected cold-adapted rhizobia from legumes native of arctic and subarctic regions of Canadian soils. The strains selected belonged to Mesorhizobium sp. and were obtained from Astragalus, Oxytropis spp. and R. leguminosarum isolated from Lathryrus spp. Arctic rhizobia were observed to be more effective than temperate species in enhancing the growth of sainfoin and nodule formation under laboratory and field conditions. Biochemical studies revealed increased production of cold shock proteins in the arctic rhizobia than their mesophilic counterparts. Eleven nodulation genes have been characterized from arctic Mesorhizobium strain N33, and the Nod factors involved in the specificity of nodulation have been identified by Prévost et al. (2003). It has been shown that the environment from which rhizobia are isolated relates to their ability to enter into symbiosis with legumes under specific environmental conditions. Rhizobia isolated from the cold regions of North America were capable of enhanced nodulation and nitrogen fixation of soybean as compared to their counterparts isolated from the high temperature southern climatic regions (Zhang et al. 2003). Sinorhizobium meliloti strain capable of nodulation in alfalfa under cold temperatures conditions was isolated by Prévost et al. (2003) and it proved to be effective in growth promotion of alfalfa under both laboratory and field conditions. The strain was also effective in promoting growth of alfalfa after overwintering in low temperature and anaerobic (ice encasement) conditions, stipulating a possibility of cross-adaptation of chosen rhizobial strain for different abiotic stresses native to low temperatures (Prévost et al., 2003). Kaushik, Saxena, & Tilak (2000) chose Tn5: lacZ mutants isogenic to wildtype Azospirillum brasilense that were able to grow under low temperatures. Two strains of A. brasilense were found to enhance wheat growth at suboptimal temperatures in field experiments (Kaushik, Saxena, & Tilak, 2002). Recently, Suyal, Shukla, & Goel (2014) isolated seven cold tolerant microbes from the rhizospheric soil of Red Kidney bean (Phaseolus vulgaris L.) of Western Indian Himalayan region. Furthermore, proteomics of S10724 strain revealed the upregulation of stress proteins under cold diazotrophy.

2.5 Ice– bacteria for frost management Plants are substantially damaged under the chilling conditions, not only of lows nutrient availability or poor hormone production but majorly due to frost settlement on plants and ice crystallization within cells. Different parts of a plant show nonuniform behavior to injury due to freezing conditions have been observed, thus making it complicated. Every year huge losses in the agricultural sector occur because of crops damaged by freezing injury. Microorganisms adapt various strategies to cope with this chilling stress. Microbial parasites found on leave, fruits, or stems induce ice nucleation in plants (Lindow, 1983).

208

Recent Advancements in Microbial Diversity

Ice crystal formation involves ice nucleation and ice growth. Different class of ice crystal controlling protein targets any one of these. Ice nucleation proteins (INPs) activate development of ice crystals and successive freezing around high subzero temperatures (Kawahara, 2008). However, ice nucleation maybe reduced by most PGPR strains, which produce either antifreeze proteins or icenucleating protein complexes that inhibit ice recrystallization or cold acclimation proteins. Ice nucleation proteins (INPs) mimic ice crystal surface and thus reduce supercooling and encourage freezing at temperatures higher than subzero. The “ice plus” bacteria possess Ina protein (ice nucleation-active protein) found on the outer side of cell wall of bacteria, which is the center of nucleation for ice crystals (Lee, Warren, & Gusta, 1995). This promotes ice formation at temperature higher than subzero, while in case of “ice minus” microbes which don’t contain Ina proteins and thus have low ice nucleating temperature (Zachariassen & Kristiansen, 2000). Spraying of ice-minus bacteria on plants thus may save from annual havoc caused due to frosty conditions. P. syringae when applied on tomato and soybean leaves before low lowtemperature stress was observed to enhance the frost susceptibility of these plants (Anderson et al. 1982). Ice nucleation genes in P. syringae have been identified, which has led to formation of “iceminus” mutant. These mutants can further be used for controlling the ice nucleating activity of bacteria and thus helps plants to overcome freezing injury. Lindow (1983) identified the ice-nucleating factor from P. syringae by deletion mutation. A strain of naturally occurring P. fluorescens has been registered commercially as Frostban B for the protection of pear trees (Lindow, 1997; Wilson & Lindow, 1993). Lindow and Panopoulous, 1998 carried out field experiments using P. syringe on potatoes and strawberries and concluded that the incidence of frost injury was significantly lower in inoculated potato plants than in uninoculated control plants in several natural field frost events. Tiryaki et al. (2019) have reported six cold adapted bacteria obtained from the leaf apoplast of coldadapted wild plants. These isolates were observed to reduce freezing injury and ice nucleation and thus can be employed for enhancing the cold tolerance of cold-sensitive crops.

3 Conclusion Hill ecosystems are familiar for the exclusive agricultural as well as agro-forestry methods. Cold-tolerant PGPRs are broadly dispersed in the hill agro-ecosystems and perform different roles such as plant growth promotion, biocontrol agents, nitrogen fixation and alleviation of cold stress in plants. Identification of the tremendous potential of the microbial resource that colonizes such ecosystems globally makes its mark and provides an environmentally friendly alternative to sustainable agriculture. The use of PGPM to develop cold-tolerant biofertilizers to enhance crop production in high altitude regions of the world is of utmost importance for increasing agricultural productivity of small farm

Microbes adapted to cold and their use as biofertilizers Chapter | 8

209

holders. Several cold tolerant bacterial and fungal species have already been identified and tested for PGP ability. However, successful implementation of microbial bioinoculants is dependent on shelf-life, variable efficacy in diverse environments and plants species other than soil forms. Moreover, the inconsistency of bio-inoculant performance and lack of independent validation limit their applications. Therefore, more elementary knowledge is required about microbial behavior and interactions along with dynamics of edaphic and biotic factors for sustainable agriculture.

References Anderson, J. A., Buchanan, D. W., Stall, R. E., & Hall, C. B. (1982). Frost injury of tender plants increased by Pseudomonas syringae van Hall. American Society for Horticultural Science, 107, 123–125. Arora, N. K., Kang, S. C., & Maheshwari, D. K. (2001). Isolation of siderophore-producing strains of Rhizobium meliloti and their biocontrol potential against Macrophomina phaseolina that causes charcoal rot of groundnut. Current Science, 81, 673–677. Arp, D. J. (2000). The nitrogen cycle. In E. W. Triplett (Ed.), Prokaryotic nitrogen fixation (pp. 1–14). Wymondham, Great Britain: Horizon Scientific Press. Ashraf, M., Berge, S. H., & Mahmood, O. T. (2004). Inoculating wheat seedling with exopolysaccharideproducing bacteria restricts sodium uptake and stimulates plant growth under salt stress. Biology and Fertility of Soils, 40, 157–162. Atlas R. and Bartha R. Microbial ecology, fundamentals and applications, Fourth Ed Benjamin Cummings, Mento Park, Ca. 1998, 694. Balcazar, W., Rondon, J., Rengifo, N., Ball, M. M., Melfo, A., Gomez, W., et al. (2015). Bioprospecting glacial ice for plant growth promoting bacteria. Microbiological Research, 177, 1–7. Barka, E. A., Nowak, J., & Clément, C. (2006). Enhancement of chilling resistance of inoculated grapevine plantlets with a plant growth-promoting rhizobacterium, Burkholderia phyto firmans strain PsJN. Applied and Environmental Microbiology, 72, 7246–7252. Beck, E. H., Heim, R., & Hansen, J. (2004). Plant resistance to cold stress: mechanisms and environmental signals triggering frost hardening and dehardening. Journal of Biosciences, 29, 449–459. Bhattacharyya, P. N., & Jha, D. K. (2012). Plant growth-promoting rhizobacteria (PGPR): emergence in agriculture. World Journal of Microbiology & Biotechnology, 28, 1327–1350. Bisht, C. S., Joshi, G. K., & Mishra, P. K. (2014). CspA Encodes a Major Cold Shock Protein in Himalayan Psychrotolerant Pseudomonas Strains. Interdisciplinary Sciences Computational Life Sciences, 6, 140–148. Bottini, R., Cassán, F., & Piccoli, P. (2004). Gibberellin production by bacteria and its involvement in plant growth promotion and yield increase. Applied Microbiology and Biotechnology, 65, 497–503. Bric, J. M., Bostock, R. M., & Silverstone, S. R. (1991). Rapid in situ assay for indole acetic acid production by bacteria immobilized on a nitrocellulose membrane. Journal of Applied Microbiology, 57, 535–538. Burdman, S., Jurkevitch, E., & Okon, Y. (2000). Recent advances in the use of plant growth promoting rhizobacteria (PGPR) in agriculture. In N. S. Subba Rao, & Y. R. Dommergues (Eds.), Microbial interactions in agriculture and forestry (pp. 229–250). Enfield, NH: Science Publishers.

210

Recent Advancements in Microbial Diversity

Butterly, C. R., Bunemann, E. K., McNeill, A. M., Baldock, J. A., & Marschner, P. (2009). Carbon pulses but not phosphorus pulses are related to decrease in microbial biomass during repeated drying and rewetting of soils. Soil Biology and Biochemistry, 41, 1406–1416. Cartieaux, F. P., Nussaume, L., & Robaglia, C. (2003). Tales from the underground: molecular plant– rhizobacteria interactions. Plant, Cell & Environment, 26, 189–199. Cheng, Z., Park, E., & Glick, B. R. (2007). 1-Aminocyclopropane-1-carboxylate (ACC) deaminase from Pseudomonas putida UW4 facilitates the growth of canola in the presence of salt. Canadian Journal of Microbiology, 53, 912–918. Das, K., Katiyar, V., & Goel, R. (2003). P solubilization potential of plant growth promoting Pseudomonas mutants at low temperature. Microbiological Research, 158, 359–362. D’ Amico, S., Collins, T., Marx, J. C., Feller, G., & Gerday, C. (2006). Psychrophilic microorganisms: a challenge for life. EMBO Reports, 7, 385–389. Dolkar, D., Dolkar, P., Angmo, S., Chaurasia, O. P., & Stobdan, T. (2018). Stress tolerance and plant growth promotion potential of Enterobacter ludwigii PS1 isolated from Seabuckthorn rhizosphere. Biocatalysis and Agricultural Biotechnology, doi: 10.1016/j.bcab.2018.04.012. Egamberdiyeva, D., & Höflich, G. (2003). Influence of growth-promoting bacteria on the growth of wheat in different soils and temperatures. Soil Biology and Biochemistry, 35, 973–978. Fages, J., & Arsac, J. F. (1991). Sunflower inoculation with Azospirillum and other plant growth promoting rhizobacteria. Plant and Soil, 137, 87–90. Forster, J. (1887). Ueber einige Eigenschaften leuchtender Bakterien Centr. Bakteriol Parasitenk., 2, 337–340. Freitas, J. R., & Germida, J. J. (1992). Growth promotion of winter wheat by fluorescent pseudomonads under field conditions. Soil Biology and Biochemistry, 24, 1137–1146. Fuentes-Ramírez, L. E., & Caballero-Mellado, J. (2006). Bacterial biofertilizers. In Z. A. Siddiqui (Ed.), PGPR: Biocontrol and biofertilization (pp. 143–172). Netherlands: Springer. Gamalero, E., Berta, G., Massa, N., Glick, B. R., & Lingua, G. (2010). Interactions between Pseudomonas putida UW4 and Gigaspora rosea BEG9 and their consequences on the growth of cucumber under salt stress conditions. Journal of Applied Microbiology, 108, 236–245. Georlette, D., Blaise, V., Collins, T., D’ Amico, S., Gratia, E., Hoyoux, A., et al. (2004). Some like it cold: biocatalysis at low temperatures. FEMS Microbiology Reviews, 28, 25–42. Ghyselinck, J., Velivelli, S. L. S., Heylen, K., O’Herlihy, E., Franco, J., Rojas, M., et al. (2013). Bioprospecting in potato fields in the central Andean highlands: screening of rhizobacteria for plant growth-promoting properties. Systematic and Applied Microbiology, 36, 116–127. Glick, B. R. (1995). The enhancement of plant growth by free-living bacteria. Canadian Journal of Microbiology, 41, 109–117. Glick, B. R., & Bashan, Y. (1997). Genetic manipulation of plant growth-promoting bacteria to enhance biocontrol of fungal phytopathogens. Biocontrol Advances., 15, 353–378. Glick, B. R., Cheng, Z., Czarny, J., Cheng, Z., & Duan, J. (2007). Promotion of plant growth by ACC deaminase-producing soil bacteria. European Journal of Plant Pathology, 119, 329–339. Goldstein, A. H. (1995). Recent progress in understanding the molecular genetics and biochemistry of calcium phosphate solubilization by Gram negative bacteria. Biological Agriculture and Horticulture, 12, 185–193. Gulati, A., Vyas, P., Rahi, P., & Kasana, R. C. (2009). Plant growth-promoting and rhizospherecompetent Acinetobacter rhizosphaerae strain BIHB 723 from the cold deserts of the Himalayas. Current Microbiology, 58, 71–377. Haldiman, P. (1998). Low growth temperature induced changes to pigment composition and photosynthesis in Zea Mays genotypes differing in chilling sensitivity. Plant, Cell & Environment, 21, 200–208.

Microbes adapted to cold and their use as biofertilizers Chapter | 8

211

Hardoim, P. R., Van Overbeek, L. S., & Elsas, J. D. (2008). Properties of bacterial endophytes and their proposed role in plant growth. Trends in Microbiology, 16, 463–471. Howard, J. B., & Rees, D. C. (1996). Structural basis of biological nitrogen fixation. Chemical Reviews, 96, 2965–2982. Kamei, A., Dolai, A. K., & Kamei, A. (2014). Role of hydrogen cyanide secondary metabolite of plant growth promoting rhizobacteria as biopesticides of weeds. Global Journal of Science Frontier Research, 14, 109–112. Kasuga, M., Liu, Q., Miura, S., Yamaguchi-Shinozaki, K., & Shinozaki, K. (1999). Improving plant drought, salt, and freezing tolerance by gene transfer of a single stress-inducible transcription factor. Nature Biotechnology, 17, 287–291. Katiyar, V., & Goel, R. (2003). Solubilization of inorganic phosphate and plant growth promotion by cold tolerant mutants of Pseudomonas fluorescens. Microbiological Research, 158, 163–168. Katiyar, V., & Goel, R. (2004). Siderophore mediated plant growth promotion at low temperature by a mutant fluorescent pseudomonad. Plant Growth Regulation, 42, 239–244. Kaushik, R., Saxena, A. K., & Tilak, K. V. B. R. (2000). Selection of Tn5::lac Z mutants isogenic to wild type Azospirillum brasilense strains capable of growing at sub-optimal temperature. World Journal of Microbiology & Biotechnology, 16, 567–570. Kaushik, R., Saxena, A. K., & Tilak, K. V. B. R. (2002). Can Azospirillum strains capable of growing at a suboptimal temperature perform better in field-grown-wheat rhizosphere. Biology and Fertility of Soils, 35, 92–95. Kawahara H (2008) Cryoprotectants and ice-binding proteins in Psychrophiles: From Biodiversity to Biotechnology. pp. 229–246, Springer, Heidelberg, Germany. Kaymak, D. C. (2010). Potential of PGPR in agricultural innovations. In D. K. Maheshwari (Ed.), Plant growth and health promoting bacteria. Berlin Heidelberg, Germany: Springer- Verlag. Kim, J., & Rees, D. C. (1994). Nitrogenase and biological nitrogen fixation. Biochem, 33, 389–397. Kim, K. Y., Hwangbo, H., Kim, Y. W., Kim, H. J., Park, K. H., Kim, Y. C., et al.(2002). Organic acid production and phosphate solubilization by Enterobacter intermedium 60-2G. Korean Journal of Soil Science and Fertilizer, 35, 59–67. Kloepper, J. W. (1996). Biological control agents vary in specificity for host, pathogen control, ecological habitat and environmental conditions. BioScience, 46, 406–409. Kloepper, J. W., Hume, D. J., Scher, F. M., Singleton, C., Tipping, B., & Lalibert, E. M. (1987). Plant growth-promoting rhizobacteria on canola (rapeseed). Phytopathology., 71, 42–46. Kloepper, J. W., Lifshitz, R., & Zablotowicz, R. M. (1989). Free living bacterial inocula for enhancing crop productivity. Trends in Biotechnology, 7, 39–44. Kloepper JW, Schroth MN (1978) Plant growth-promoting rhizobacteria on radishes. Proceedings of the fourth international conference plant pathogenic bacteria. France: Angers. Kropp, B. R., Thomas, E., Pounder, J. I., & Anderson, A. J. (1996). Increased emergence of spring wheat after inoculation with Pseudomonas chlororaphis isolate 2E3 under field and laboratory conditions. Biology and Fertility of Soils, 23, 200–206. Kumar, S., Suyal, D. C., Dhauni, N., Bhoriyal, M., & Goel, R. (2014). Relative plant growth promoting potential of Himalayan Psychrotolerant Pseudomonas jesenii strain MP1 against native Cicer arietinum (L.)., Vigna mungo (L.) Hepper; Vigna radiata (L.) Wilczek., Cajanus cajan (L.) Millsp. and Eleusine coracana (L.) Gaertn. African Journal of. Microbiology Research, 8(50), 3931–3943. Kumar, V., Singh, P., Jorquera, M. A., Sangwan, P., Kumar, P., Verma, A. K., et al. (2013). Isolation of phytase-producing bacteria from Himalayan soils and their effect on growth and phosphorus uptake of Indian mustard (Brassica juncea). World Journal of Microbiology & Biotechnology, 29, 1361–1369.

212

Recent Advancements in Microbial Diversity

Lee, R. E., Warren, G. J., & Gusta, L. V. (1995). Biochemistry of bacterial ice nuclei. In F. Ray, & W. K. Paul (Eds.), Biological ice nucleation and its application (pp. 63–83). St Paul, MI: APS Press. Lindow, S. E. (1983). The role of bacterial ice nucleation in frost injury to plants. Review of Phytopathology, 21, 363–384. Lindow, S. E. (1997). In J. P. Naks, & C. Hagedron (Eds.), Biotechnology of plant–microbe interactions (pp. 85–110). NewYork: McGraw Hill. Lynch, D. H., & Smith, D. L. (1994). The effects of low temperature stress on two soybean (Glycine max) genotypes when combined with Bradyrhizobium strains of varying geographic origin. Physiologia Plantarum, 90, 105–113. Madigan, T. M., Matinko, J. M., & Parkar, J. (2000). Brock biology of microorganisms (Ninth edition). Upper Saddle River, New Jersey: Prentice Hall. Malviya, M. K., Pandey, A., Trivedi, P., Gupta, G., & Kumar, B. (2009). Chitinolytic activity of cold tolerant antagonistic species of Streptomyces isolated from glacial sites of Indian Himalaya. Current Microbiology, 59, 502–508. Malviya, M. K., Sharma, A., Pandey, A., Rinu, K., Sati, P., & Palni, L. M. S. (2012). Bacillus subtilis NRRL B-30408: a potential inoculant for crops grown under rainfed conditions in the mountains. Journal of Soil Science and Plant Nutrition, 12, 811–824. Masalha, J., Kosegarten, H., Elmaci, O., & Mengel, K. (2000). The central role of microbial activity for iron acquisition in maize and sunflower. Biology and Fertility of Soils, 30, 433–439. Mayak, S., Tirosh, T., & Glick, B. R. (1999). Effect of Wild-Type and Mutant Plant Growth-Promoting Rhizobacteria on the Rooting of Mung Bean Cuttings. Journal of Plant Growth Regulation, 18, 49–53. McCue, P., Zheng, Z., Pinkham, J. L., & Shetty, K. (2000). A model for enhanced pea seedling vigour following low pH and salicylic acid treatments. Process Biochemistry, 35, 603–613. McGill, W. B., & Cole, C. V. (1981). Comparative aspects of cycling of organic C, N, S and P through soil organic matter. Geoderma, 26, 267–268. McKay, I. A., & Djordjevic, M. A. (1993). Production and excretion of nod metabolites by Rhizobium leguminosarum bv. trifolii are disrupted by the same environmental factors that reduce nodulation in the field. Applied and Environmental Microbiology, 59, 3385–3392. Mishra, M., & Goel, R. (1999). Development of a cold resistant mutant of plant growth promoting Pseudomonas fluorescens and its functional characterization. Journal of Biotechnology, 75, 71–75. Mishra, P. K., Joshi, P., Bisht, S. C., Bisht, J. K., & Selvakumar, G. (2011). Cold-tolerant agriculturally important microorganisms. In D. K. Mageswari (Ed.), Plant growth and health promoting bacteria. Microbiology Monographs (pp. 273–296). (V. 18). Berlin: Springer-Verlag. Mishra, P. K., Mishra, S., Bisht, S. C., Selvakumar, G., Kundu, S., Bisht, J. K., et al. (2009). Isolation, molecular characterization and growth-promotion activities of a cold tolerant bacterium Pseudomonas sp. NARs9 (MTCC9002) from the Indian Himalayas. Biological Research, 42, 305–313. Mishra, P. K., Mishra, S., Selvakumar, G., Bisht, S. C., Bisht, J. K., & Gupta, H. S. (2008). Characterization of a psychrotolerant plant growth promoting Pseudomonas sp. strain PGERs17 (MTCC 9000) isolated from North Western Indian Himalayas. Ann Microbiol, 58, 561–568. Miteva, V. I., & Brenchley (2005). Detection and isolation of ultrasmall microorganisms from a 120,000-year-old Greenland glacier ice core. Applied and Environmental Microbiology, 71, 7806–7818. Morita, R. Y. (1975). Psychrophilic bacteria. Bacteriological Reviews, 39, 144–167. Negi, Y. K., Kumar, J., & Garg, S. K. (2005). Cold-tolerant fluorescent Pseudomonas isolates from Garhwal Himalayas as potential plant growth promoting and biocontrol agents in pea. Current Science, 89, 2151–2156.

Microbes adapted to cold and their use as biofertilizers Chapter | 8

213

Nehl, D. B., Allen, S. J., & Brown, J. F. (1997). Deleterious rhizosphere bacteria: integrating perspectives. Applied Soil Ecology, 5, 1–20. Neilands, J. B. (1981). Microbial iron compounds. Annual Review of Biochemistry, 50, 715–731. Neilands, J. D. (1995). Siderophores: structure and function of microbial iron transport compounds. Journal of Biological Chemistry, 270, 26723–26726. Okon, Y., & Labandera-Gonzalez, C. A. (1994). Agronomic applications of azospirillum: An evaluation of 20 years worldwide field inoculation. Soil Biology and Biochemistry, 26, 1591–1601. Paau, M. A. (1989). Improvement of Rhizobium inoculants. Applied and Environmental Microbiology, 55, 862–865. Pandey, A., & Palni, L. M. S. (1998). Isolation of Pseudomonas corrugata from Sikkim Himalaya. World Journal of Microbiology & Biotechnology, 14, 11–413. Pandey, A., Trivedi, P., Kumar, B., & Palni, L. M. S. (2006). Characteristics of a phosphate solubilizing and antagonistic strain of Pseudomonas putida (B0) isolated from a sub-alpine location in the Indian central Himalaya. Current Microbiology, 53, 102–107. Patten, C. L., & Glick, B. R. (2002). Role of Pseudomonas putida indole acetic acid in development of the host plant root system. Applied and Environmental Microbiology, 68, 3795–3801. Pradhan, S., Srinivas, T., Pindi, P. K., Kishore, K. H., Begum, Z., Singh, P. K., Singh, A. K., Pratibha, M., Yasala, A. K., & Reddy, G. (2010). Bacterial biodiversity from Roopkund glacier, Himalayan mountain ranges. India Extrem, 14, 377–395. Prasad, S., Manasa, P., Buddhi, S., Tirunagari, P., Begum, Z., Rajan, S., et al. (2014). Diversity and bioprospective potential (cold-active enzymes) of cultivable marine bacteria from the subarctic glacial fjord, Kongsfjorden. Current Microbiology, 68, 233–238. Prévost, D., Drouin, P., & Antoun, H. (1999). The potential use of cold adapted rhizobia to improve nitrogen fixation in legumes cultivated in temperate regions. In R. Margesin, & F. Schinner (Eds.), Biotechnological application of cold-adapted organisms (pp. 161–176). Berlin: Springer. Prévost, D., Drouin, P., Laberge, S., Bertrand, A., Cloutier, J., & Lévesque, G. (2003). Cold-adapted rhizobia for nitrogen fixation in temperate regions. Canadian Journal of Botany, 81, 1153–1161. Richardson, A. E. (1994). Soil microorganisms and phosphorous availability. In C. E. Pankhurst, B. M. Doube, & V. V. S. R. Gupta (Eds.), Soil biota: management in sustainable farming systems (pp. 50–62). Victoria, Australia: CSIRO. Robertson, G. P., & Grandy, A. S. (2005). Soil system management in temperate regions. In N. T. Uphoff (Ed.), Biological approaches to sustainable soil systems (pp. 27–39). Boca Raton, Florida: CRC Press. Sahay, H., Babu, B. K., Singh, S., Kaushik, R., Saxena, A. K., & Arora, D. K. (2013). Cold-active hydrolases producing bacteria from two different sub-glacial Himalayan lakes. Journal of Basic Microbiology, 53, 703–714. Sandhya, V., Ali, S. K. Z., GroverM, Reddy, G., & Venkateswarlu, B. (2009). Alleviation of drought stress effects in sunflower seedlings by the exopolysaccharides producing Pseudomonas putida strain GAP-P45. Biology and Fertility of Soils, 46, 17–26. Saravanakumar, D., Vijayakumar, C., Kumar, N., & Samiyappan, R. (2007). PGPR induced defense responses in the tea plant against blister blight disease,. Crop Protection, 36, 556–565. Selvakumar, G., Joshi, P., Nazim, S., Mishra, P. K., Bisht, J. K., & Gupta, H. S. (2009a). Phosphate solubilization and growth promotion by Pseudomonas fragi CS11RH1 (MTCC 8984), a psychrotolerant bacterium isolated from a high altitude Himalayan rhizosphere. Biologia, 64, 239–245. Selvakumar, G., Joshi, P., Nazim, S., Mishra, P. K., Kundu, S., & Gupta, H. S. (2009b). Exiguobacterium acetylicum strain 1P (MTCC 8707) a novel bacterial antagonist from the North Western Indian Himalayas. World Journal of Microbiology & Biotechnology, 25, 131–137.

214

Recent Advancements in Microbial Diversity

Selvakumar, G., Joshi, P., Suyal, P., Mishra, P. K., Joshi, G. K., Bisht, J. K., Bhatt, J. C., & Gupta, H. S. (2011). Pseudomonas lurida M2RH3 (MTCC 9245), a psychrotolerant bacterium from the Uttarakhand Himalayas, solubilizes phosphate and promotes wheat seedling growth. World J Microbiol Biotechnol, 27, 1129–1135. Selvakumar, G., Kundu, S., Joshi, P., Gupta, A. D., Nazim, S., Mishra, P. K., & Gupta, H. S. (2008a). Characterization of a cold-tolerant plant growth-promoting bacterium Pantoea dispersa 1A isolated from a sub-alpine soil in the North Western Indian Himalayas. World J Microbiol Biotechnol, 24, 955–960. Selvakumar, G., MohanM, Kundu, S., Gupta, A. D., Joshi, P., Nazim, S., & Gupta, H. S. (2008b). Cold tolerance and plant growth promotion potential of Serratia marcescens strain SRM(MTCC 8708) isolated from flowers of summer squash (Cucurbita pepo). Lett Appl Microbiol, 46, 171– 175. Spaepen, S., Dobbelaere, S., Croonenborghs, A., & Vanderleyden, J. (2008). Effects of Azospirillum brasilense indole-3-acetic acid production on inoculated wheat plants. Plant and Soil, 312, 15–23. Spaepen, S., Vanderleyden, J., & Remans, R. (2007). Indole-3-acetic acid in microbial and microorganism-plant signaling. FEMS Microbiology Reviews, 31, 425–448. Subba Rao, N. S. (1986). Soil Microorganisms and Plant Growth. New Delhi: Oxford and IBH Publishing Company. Suyal, D. C., Shukla, A., & Goel, R. (2014). Growth promontory potential of the psychrophilic diazotroph Pseudmonas migulae S10724 against native Vigna radiata (L.) Wilczek. 3 Biotechnology, 4, 665–668. Timmusk, S., Nicander, B., Granhall, U., & Tillberg, E. (1999). Cytokinin production by Paenibacillus polymyxa. Soil Biology and Biochemistry, 31, 1847–1852. Tiryaki, D., Aydin, I., & Atici, O. (2019). Psychrotolerant bacteria isolated from the leaf apoplast of cold-adapted wild plants improve the cold resistance of bean (Phaseolus vulgarisL.) under low temperature. Cryobiology, 86, 111–119. Trivedi, P., Pandey, A., & Sa, T. (2007). Chromate reducing and plant growth promoting activities of psychrotrophic Rhodococcus erythropolis MtCC 7905. Journal of Basic Microbiology,, 47, 513–517. Trivedi, P., & Sa, T. (2008). Pseudomonas corrugata (NRRL B-30409) mutants increased phosphate solubilization, organic acid production and plant growth at lower temperatures. Current Microbiology, 56, 140–144. Verma, P., Yadav, A. N., Khannam, K. S., Panjiar, N., Kumar, S., Saxena, A. K., & et al. (2015). Assessment of genetic diversity and plant growth promoting attributes of psychrotolerant bacteria allied with wheat (Triticum aestivum) from the northern hills zone of India. Annals of Microbiology, 65, 1885–1899. Vijayan, R., Palaniappan, P., Tongmin, S. A., Elavarasi, P., & Manoharan, N. (2013). Rhizobitoxine enhances nodulation by inhibiting ethylene synthesis of Bradyrhizobium elkanii from Lespedeza species: validation by homology modeling and molecular docking study. World Journal of Pharmacy and Pharmaceutical Sciences, 2, 4079–4094. Vishnivetskaya, T. A., Kathariou, S., & Tiedje, J. M. (2009). The Exiguobacterium genus: biodiversity and biogeography. Extremophiles., 13, 541–555. Vitousek, P. M., & Howarth, R. W. (1991). Nitrogen limitation on land and in the sea: How can it occur? Biogeochemistry, 13, 87–115. Vyas, P., Joshi, R., Sharma, K. C., Rahi, P., & Gulati, A. (2010). Cold-adapted and rhizosphere competent strain of Rahnella sp. with broad-spectrum plant growth-promotion potential. Journal of Microbiology, Biotechnology, 20, 1724–1734.

Microbes adapted to cold and their use as biofertilizers Chapter | 8

215

Vyas, P., Rahi, P., & Gulati, A. (2009). Stress tolerance and genetic variability of phosphate-solubilizing fluorescent Pseudomonas from the cold deserts of the Trans-Himalayas. Microb Ecol, 58, 425–434. Wang, C., Knill, E., & Defago, G. (2000). Effect of transferring 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase genes into Pseudomonas fluorescens strain CHAO and its gacA derivative CHA96 on their growth-promoting and disease-suppressive capacities. Canadian Journal of Microbiology, 46, 898–907. Wilson, M., & Lindow, S. E. (1993). Release of recombinant microorganisms. Annual Review of Microbiology, 47, 913–944. Yadav, A. N., Sachan, S. G., Verma, P., & Saxena, A. K. (2015). Prospecting cold deserts of north western Himalayas for microbial diversity and plant growth promoting attributes. Journal of Bioscience and Bioengineering, 119, 683–693. Zachariassen, K. E., & Kristiansen, E. (2000). Ice nucleation and anti-nucleation in nature. Cryobiology, 41, 257–279. Zhang, H., Prithiviraj, B., Charles, T. C., Driscoll, B. T., & Smith, D. L. (2003). Low temperature tolerant Bradyrhizobium japonicum strains allowing improved nodulation and nitrogen fixation of soybean in a short season (cool spring) area. European Journal of Agronomy, 19, 205–213.

Chapter 9

Actinobacteria: diversity and biotechnological applications Anwesha Gohaina, Surajit De Mandald

Chowlani

Manpoongb,

Ratul

Saikiac

and

a

Department of Botany, Arunachal University of Studies, Namsai, Arunachal Pradesh, India; Faculty of Agriculture Sciences, Arunachal University of Studies, Namsai, Arunachal Pradesh, India; cBiotechnology Group, Biotechnological Science & Technology Division, CSIR-North East Institute of Science & Technology, Jorhat, Assam, India; dKey Laboratory of Bio-Pesticide Innovation and Application of Guangdong Province, College of Agriculture, South China Agricultural University, Guangzhou, P. R. China b

1 Introduction The phylum Actinobacteria represents the largest taxonomic component among the microbial community. They are currently classified within the domain bacteria and contain high levels of guanine-plus-cytosine in their genome (Garrity et al., 2006; Sun et al., 2010). To date, most sequenced actinobacterial genomes show similarities with other organisms associated with human and veterinary medicine, biotechnology, and ecology. Actinobacterial biodiversity can be assumed to be reflected by their genomic heterogeneity (Ventura, Canchaya, Fitzgerald, Gupta, & van Sinderen, 2007).Actinobacteria are aerobic, filamentous, spore-forming, gram positive bacteria. Conventionally, they were thought to be an intermediate group of fungi and bacteria but later taxonomists placed them in the Kingdom bacteria because of their unique properties (Das, Lyla, & Khan,  2008). Although, most actinobacteria are seen as aerobic, some heterotrophic or chemoautotrophic actinobacteria have also been found. However, some chemotherapeutic actinobacteria with high nutritional value were also reported (Lechevalier & Lechevalier, 1965; Zimmermann, 1990).

2  Occurrence and habitats Soil, plants or aquatic environments are common habitats for actinobacteria. Habitat and climatic conditions are the main cause of the population density of actinobacteria. Recent Advancements in Microbial Diversity. http://dx.doi.org/10.1016/B978-0-12-821265-3.00009-8 Copyright © 2020 Elsevier Inc. All rights reserved.

217

218

Recent Advancements in Microbial Diversity

2.1  Soil habitat Soil is the most important habitat for actinobacteria. They can be found as 106–109 – cells per gram of soil (Goodfellow & Williams, 1983). The genus Streptomyces dominates among the soil microorganisms. Williams et al. (1988) reported that 95% of the soil isolates belonged to the genus Streptomyces (Williams & Vickers, 1988). Other environmental factors, namely, temperature, pH, soil moisture also have a large effect on population density, as well as on the types of actinobacteria. Some mesophilic actinobacteria are found with optimal growth temperatures in the range from 25° to 30°. On the other hand, actinobacteria with a growth temperatures between 50° to 60° are called thermophilic (Edwards, 1993). The best pH for the growth of actinobacteria ranges from pH 6.0 to pH 9.0. Their maximum growth was recorded at pH 7.0, therefore they behave like neutrophils. However, a pH below 3.5 is not favourable for the growth of actinobacteria, especially of the genus Streptomycetes (Kim, Lonsdale, Seong, & Goodfellow, 2003). Low humidity promotes the vegetative growth of actinobacteria, while the growth of actinobacteria can be affected in dry soils with less moisture content (Barka et al., 2016).

2.2  Plant habitat Tropical rainforests are the major and rich habitat of endophytic actinomycetes with great biodiversity. The response of the plant to the host is an important criterion in this interaction. It has always been an interesting area of research to know whether endophytic communities are more beneficial to plants or the rhizospheric bacterium. However, the endosphere of plants contains a wide variety of microbial endophytes, which forms a complex micro-ecosystem (El-Shatoury et al., 2013). As a result of the symbiotic association of endophytes with plants, endophytes can obtain certain genetic information and engage in metabolic pathways to produce specific bioactive compounds similar to host plants through horizontal gene transfer. Thus, in this host-endophyte interaction, the host provides nutrients to the microbial endophytes and the microbial community in turn helps in plant protection (Carroll, 1988; Carroll, 1991; Dochhil, Dkhar, & Barman, 2013; Gehring, Cobb, & Whitham,  1997; Hamayun et al., 2009; Ludwig, Chin-A-Woeng, & Bloemberg,  2012; Shimizu, 2011). Although a significant amount of research has been done on bacteria-plant molecular interactions however, information on the molecular mechanism of endophyte-host relationships is limited (Lugtenberg, Chin-A-Woeng, & Bloemberg, 2002; Oldroyd & Downie, 2004). The most biologically diverse and species-rich ecosystems on earth are tropical and temperate rainforests, which are considered the best reservoir for the greatest diversity of endophytes (Strobel & Daisy, 2003). A total of 123 endophytic actinomycetes were isolated from tropical plants collected in several places in Papua New Guinea and Solomon Islands (Janso & Carter, 2010)

2.3  Marine habitat The distribution of actinobacteria in the marine environment has been reported by many researchers. Marine bacteria can also be an important area of research,

Actinobacteria: diversity and biotechnological applications Chapter | 9

219

as they can produce important natural products (Bull & Stach, 2007). Unique marine actinobacteria with rich cellulolytic activity have also been identified (Magarvey, Keller, Bernan, Dworkin, & Sherman, 2004). However, most marine actinobacteria contain polyketide synthetase (PKS) and non-ribosomal polyketide synthetase (NRPS) pathways, indicating their ability to produce secondary metabolites (Cho et al., 2006; Fenical & Jensen, 2006; Jensen, Williams, Oh, Zeigler, & Fenical,  2007; Salomon, Magarvey, & Sherman,  2004).

3  Diversity of actinobacteria Microbial member with high diversity can be seen in biodiversity rich ecosystem. Many actinobacterial representatives belonged to endophytic microorganisms that prevailed in rainforests (Strobel & Daisy, 2003). Medicinal plants with an ethno-botanical history are also considered as potential repertoires for the isolation of endophytic microbes (Yu et al., 2010). Zhao et al. (2011) isolated 560 bioactive endophytic actinomycetes from Chinese medicinal plants and stated that those endophytic actinomycetes have a wide spectrum antimicrobial activity (Zhao et al., 2011). The endophytic diversity of 37 medicinal plants and consequently 600 actinobacteria were recorded, which belong to 34 genera and 7 unknown taxa (Du, Su, Yu, & Zhang,  2013). Plant associated actinobacteria have been described by various authors, however different environmental conditions may also affect the diversity and species distribution among the host plants (Bouizgarne & Aouamar, 2014; Hou et al., 2009). Among actinomycetes, the genus Streptomyces and Micromonospora are mainly found in the soil. Streptomycetes play an important role in the carbon cycle and produces various hydrolytic exoenzymes. The genus Streptomyces exhibits a wide and rational phylogenetic diversity (Aderem, 2005). In addition, streptomyces can be recognized as the most capable chemist of nature, which produces huge and diverse secondary metabolites (Hopwood, 2007). On the other hand, soil Micromonospora consist 32 different species and another 50 genus of Micromonospora are still under identification as per the Bergey's manual (Goodfellow et al., 2012). Similarly, a variety of marine actinomycetes with the potential to produce bioactive compounds have been isolated from the South China Sea and the Yellow Sea. Actinobacillus belongs to the bacterial domain of 5 subclasses, 6 suborders and 14 sub-subspecies. Therefore, all genus of this phyla showed great diversity in terms of morphology, physiology and metabolic capacity (Ludwig et al., 2012; Xi, Ruan, & Huang, 2012).

4  Biotechnology and importance of actinobacteria Microbial resources will always be of great interest because of its stunning ability to produce novel bioactive products. Bedys, 2005 reported that about half of the newly discovered antibiotics till 2002 were obtained from the microbial community (Table 9.1).

220

Recent Advancements in Microbial Diversity

TABLE 9.1 Examples of potent Actinobacteria with bioactive compounds. Bioactive compound producing species

Bioactive compound(s)

Antibacterial Verrucosispora spp.

Abyssomycin

Streptomyces anulatus

Actinomycins

Streptomyces canus

Amphomycin

Micromonospora spp.

Anthracyclin

Streptomyces cattley

Antibiotics and fluorometabolites

Streptomyces canus

Aspartocins

Streptomyces avermitilis

Avermectin

Streptomyces venezuelae

Chloramphenico

Micromonospora spp.

Clostomicins

Streptomyces griseus

Cycloheximide

Streptomyces orchidaceus

Cycloserine

Streptomyces roseosporus

Daptomycin

Saccharopolyspora erythraea

Erythromycin (Ilotycin)

Micromonospora purpurea

Gentamicin

Streptomyces hygroscopicus

Hygromycin

Streptomyces kanamyceticus

Kanamycin

Streptomyces kitasoensis

Leucomycin

Streptomyces lincolnensis

Lincomycin

Marinispora spp.

Marinomycin

Streptomyces fradiae

Neomycins

Micromonospora spp.

Netamicin

Streptomyces niveus

Novobiocin

Streptomyces antibioticus

Oleandomycin

Streptomyces rimosus

Oxytetracycline

Streptomyces spp.

Pristinamycin

Streptomyces lindensis

Retamycin

Streptomyces mediterranei

Rifamycin

Nocardia lurida

Ristocetin

Streptomyces ambofaciens

Spiramycin

Streptomyces virginiae

Staphylomycin

Streptomyces endus

Stendomycin

Streptomyces lydicus

Streptolydigin

Streptomyces griseus

Streptomycin

Actinobacteria: diversity and biotechnological applications Chapter | 9

TABLE 9.1 Examples of potent Actinobacteria with bioactive compounds. (Cont.) Bioactive compound producing species

Bioactive compound(s)

Streptomyces lavendulae

Streptothricin

Streptomyces aureofaciens

Tetracycline

Micromonospora spp.

Thiocoraline

Amycolatopsis orientalis

Vancomycin

Antifungal Streptomyces anulatus

Actinomycins

Streptomyces nodosus

Amphotericin B

Streptomyces griseochromogenes

Blasticidin

Streptomyces griseus

Candicidin

Streptomyces spp.

Carboxamycin

Streptomyces venezuelae

Chloramphenicol

Streptomyces padanus

Fungichromin

Streptomyces galbus

Galbonolides

Streptomyces violaceusniger

Guanidylfungin

Streptomyces venezuelae

Jadomycin

Streptomyces kasugaensis

Kasugamycin

Streptomyces spp.

Kitamycin

Streptomyces natalensis

Natamycin

Streptomyces tendae

Nikkomycin

Streptomyces diastatochromogenes

Oligomycin

Streptomyces humidus

Phenylacetate

Streptomyces cacaoi

Polyoxin B

Streptomyces canus

Resistomycin

Antitumour agents Micromonospora spp.

Anthraquinones

Nocardia asteroides

Asterobactine

Streptomyces spp.

Borrelidine

Micromonospora spp.

Diazepinomicin

Actinomadura spp.

IB-00208

Micromonospora spp.

LL-E33288 complex

Micromonospora spp.

Lomaiviticins

Micromonospora spp.

Lupinacidins

221

222

Recent Advancements in Microbial Diversity

5  Actinobacteria as a source of natural products 5.1  As a source of antibiotics As mentioned earlier, Actinobacteria is importance because it produces natural bioactive secondary products. Actinomycin was the first antibiotic isolated from Streptomycin antibioticus, while streptothricin identified in 1942 from Streptomyces lavedulae, followed by streptomycin, which was isolated from S. griseus by Waksman and his colleagues (Waksman & Woodruff, 1940, Waksman & Woodruff, 1942). According to Ilic et al. (2007), (80)% of the world's antibiotics come from actinobacteria. There are some clinically proven antibiotics that are produced by Actinobacteria (Ilic et al., 2007). Those major classes of antibiotics includes aminoglycosides (neomycin, kanamycin, streptomycin) (Busscher, Rutjes, & Van Delft, 2005; Park, Ban, Sohng, & Yoon, 2013; Vakulenko and Mobashery, 2003), angucyclines (landomycin and moromycin) (Kharel et al., 2012), ansamycins (rifamycin, geldanamycin) (Kang, Shen, & Bai 2012), anthracyclines (daunorubicin) (Minotti, Menna, Salvatorelli, Cairo, & Gianni, 2004), lactams (cephamycins) (Liras, 1999) and lactamase inhibitor clavulanic acid (Jensen and Paradkar, 1999). Others include chloramphenicol (Stuttard and Vining, 2014), glutarimides (cycloheximide) (Kominek, 1975), glycopeptides (vancomycin, teichoplanin) (Butler, Hansford, Blaskovich, Halai,, & Cooper, 2014), lipopeptides (daptomycin) (Baltz, 2010), antibiotics (mersacidin, actagardine) (Barke et al., 2010), macrolides (clarythromycin, erythromycin, tylosin, clarithromycin) (Gaynor and Mankin, 2003), oxazolidinones (cycloserine) (Mulinos, 1955), streptogramins (streptogramin) (Johnston, Mukhtar, & Wright, 2002), and tetracyclines (Okami, 1988). The ability to produce bioactive metabolites varies depending on the genus of actinobacteria. For example, some Streptomyces can produce only one antibiotic, while others can produce a different range of biologically active compounds. The capacity of producing bioactive metabolites varies according to the genus of actinobacteria. For example, only a single antibiotic can be produced by certain Streptomyces, while a different range of bioactive compounds can be produced by others. Secondary metabolites produced by the phylum actinobacteria can be used not only as antibiotics, but also as herbicides, antifungal, antitumor or immunosuppressant and anthelmintic agents (Behal, 2000; Tindall, Kampfer, Euzeby, & Oren, 2006).

5.2  As a source of insecticides Macrotetrolides, a complex produced by certain types of Streptomyces species, have an immune suppressive effect (Ando et al., 1971; Jizba et al., 1991). They also showed activity against ticks, insects (Oishi et al., 1970; Sagawa et al., 1972); coccidia (Sakamoto, Asano, Mizuochi, Sasaki, & Hasegawa, 1978) etc. However, only quaternary actin, dinactin, and ternary actin

Actinobacteria: diversity and biotechnological applications Chapter | 9

223

produced by Streptomyces aureus s-3466 were used commercially (Ando et al., 1971). After the successful administration of ivermectin from Streptomyces avermitilis and the effective use of anthelmintic drugs, it became the first new antiparasitic drug in the world (Omura and Crump, 2014). Thanks to the discovery of anti-malarial artemisinin and avermectin, for which, Tu Youyou, Satoshi Omura and William C. Campbell jointly won the 2015No2015No015No15Nobel Prize in Physiology or Medicine.

5.3  As a source of bioherbicide and bioinsecticide agents Certain compounds produced by actinobacteria are widely used in agriculture. An antifungal agent known as Mildiomycin isolated from Streptoverticillium rimofaciens is used against various crops infected by powderymildews that inhibits the synthesis of fungal protein (Feduchi, Cosin, & Carrasco, 1985; Harada and Kishi, 1978). Commercially used validamycin has been effective against pathogenic microorganismsin rice and in the suppression of diseases of certain vegetable seedlings (Iwasa, Yamamoto, & Shibata, 1970).

5.4  As a source of antifungal and antibacterial agents Umezawa et al. (1965) reported the bactericidal and fungicidal metabolite kasugamycin isolated from Streptomyces kasugaensis. Polyoxins B and D were natural fungicides isolated from S. cacaoi var. Asoensis (Isono, Nagatsu, Kawashima, & Suzuki, 1965).

5.5 Immunomodifers The compounds produced by actinomycetes are low molecular weight and act as immune modulators by enhancing the immune response. The immune response of the mouse was enhanced by Bestatin isolated from Streptomyces olivoreticuli, amastatin from Streptomyces species ME 98-M-3 and phenicine from Streptomyces lavendulae. Fujisawa pharmaceutical company produced FR-900506, an immune suppressive agent from Streptomyces tsukubaensis sp. Nov. and found to be active against interleukin-2 production, mixed lymphocyte reaction, interferon, cytotoxic-T cells and activate factor-C induction (Dilip, Mulaje, & Mohalkar, 2013). In addition to this, Biosurfactants produced by actinobacteria are less toxic, biodegradable and highly specific (Desai, 1987; Drouin and Cooper, 1992; Fiechter, 1992). This phylum also produced low molecular weight enzyme inhibitors (Hütter, Eckhardt, Goodfellow, Williams, & Mordarski, 1988).

6  Actinobacteria as a source of enzymes Apart from its ability to produce bioactive compounds, actinobacteria also have the potential to yield a few vital enzymes (Table 9.2).

224

Recent Advancements in Microbial Diversity

TABLE 9.2 Examples of industrially available enzymes from actinomycetes. Enzyme

Producing strain

Cellulase

Recombinant Streptomyces spp. Thermobifida halotolerans Thermomonospora spp. Streptomyces ruber

Xylanase

Actinomadura spp. Streptomyces spp.

Amylase

Streptomyces spp. Streptomyces erumpens Nocardiopsis spp. Thermobifida fusca

Pectinase

Streptomyces lydicus

Protease

Thermoactinomyces spp. Nocardiopsis spp. Streptomyces spp. Streptomyces pactum Streptomyces thermoviolaceus

Chitinase

Streptomyces thermoviolaceus Microbispora spp. Nocardiopsis prasina

6.1 Amylase Industrially amylases are the most important enzymes because of their ability to convert starch to high fructose syrups (Ammar et al., 2002). Amylases produced by Streptomyces erumpens have high utilization in bakery, brewing, and alcohol industries (Kar and Ray, 2008). Another genus of actinomyces, Nocardiopsis sp. Produced thermostable amylases which also have great applications in bakery and paper industries (Stamford, Coelho, & Araujo, 2001). Besides, amylases have also nutritional values (Yang and Liu, 2004). Detergents, bioethanol producing industries have high utilizations of cold-active α-amylases produced by Actinobacteria (Kuddus, Roohi, & Ramteke, 2011).

6.2 Cellulase The genus Streptomyces are the largest producers of cellulases and have the ability to ferment cellulose. It was reported that cellulases produced by Streptomyces sp. are highly thermostable (Jang and Chang, 2005). However,

Actinobacteria: diversity and biotechnological applications Chapter | 9

225

they can be used as detergents and restore the colour of fabrics (Jones, Van Der Kleij, Van Solingen, Weyler, & Goedegebuur, 2003). Further, some commercially used recombinant cellulases are reported from the genera viz., Thermobifida and Micromonospora (Zhang et al., 2011).

6.3 Xylanases Xylanases are another important enzyme produced by the genus Streptomyces which have been used commercially. Xylanases extracted from two actinomyces species, Actinomadura sp. FC7 and Nonomurae aflexuosa are found be highly thermostable and have specific activity due to which they have high industrial values (Brzezinski, Dery, & Beaulieu, 1999). Xylanase production has also been seen among the members of Thermomonospora fusca (McCarthy, Peace, & Broda, 1985). However, Fagerstrom et al. (2008), reported that paper and pulp industries have high utilization of fused xylanases from fungi and actinomycetes because of its high heat resistant property and pH stability (Fagerstrom et al., 2008). As pure xylane is found to be expensive, actinomyces will be the alternate producers of xylanase that can be used at industrial levels, viz., xylanases produced by Streptomyces spp. can be used as an excellent bioleaching agent when treated with rice straw (Rifaat, Nagieb, & Ahmed, 2006)

6.4 Pectinases Pectinase, another important industrially used enzyme particularly, food industries have a wide utilization of this enzyme viz. clarification of fruit juices, wine making etc. The genus Streptomycetes enormously produced pectinase while scanty reports are available from other genera (Jacob, Poorna, & Prema, 2008).

6.5 Proteases For decades, hunt for new proteases for their industrial utilizations is going on. Certain Streptomyces sp. produces proteases while other genera were reported to produce some salt tolerant proteases (Horikoshi, 1999). Leather industries used proteases Nocardiopsis sp. for the degradation of hides and skins. This is also used as detergent additives (Moreira, Albuquerque, Teixeira, Porto, & Lima Filho,  2002). However, proteases from Streptomyces sp. are used remove goat skin which is found to be economically and environmentally feasible (Mitra and Chakrabartty, 2005). Proteases from Streptomyces sp. have Keratinolytic activity which is used in agro industry processes to degrade feathers, hair, nails, and horn (Brandelli, 2008). Further, the genus Microbispora is also known to produce protease (Jaouadi et al., 2010).

6.6 Chitinases Chitinase, have got attention for their ability to act as biocontrol agents against plant pathogenic fungi, nematodes etc. Likewise, chitinase produced by

226

Recent Advancements in Microbial Diversity

actinomycetes are highly thermostableand can act in varied pH range. For this specific characteristics, this enzyme have wide industrial applications (Horikoshi, 1999). Chitobiose produced by Microbispora sp. have antioxidant property and is used as food additive as well as biomedical applications (Jaouadi et al., 2010).

7  Other aspects of actinomycetes having biotechnological applications A range of different enzymes such as lignin peroxidase, laccase, tyrosinase etc. have been reported from actinomycetes which have potential applications in the field of biotechnology. A sustainable and profitable enzyme esterase and amidase from Nocardia species hydrolyse polyethylene terephthalate and polyamide fibers (Heumann et al., 2006). The High Throughput Screening (HTS) method is a new method that has now been used to select novel actinomycetes with the ability to produce unique enzymes. For example, therapeutically active biomolecules such as Thrombin and L-asparaginase from Streptomyces (Jayaprakashvel, 2012). Actinomycetes have striking ability in microbial biotransformation of contaminants in soil and water. The genus Nocardia has the ability to degrade hydrocarbons through the process hydroxylation. Actinomycetes also hydroxylate aliphatic hydrocarbon chains. They have the ability to degrade pesticides (Atlas, 1981).

8 Conclusion At present, the research on actinomycetes has increased dramatically because it is the most interesting and effective field for discovering new species and biologically active compounds. They can also potentially be used in agriculture, pharmaceutical industry, and human health. Actinomycetes are involved in the production of new bioactive products that are widely used in the pharmaceutical industry. They are promising strains that control pests and pathogens. The enzymes they produce are of high industrial value. As described in this study, past achievements in this field have opened up new horizons for the scientific community. The study aims to outline an overview of actinomycetes and their biotechnological applications. This phylum is diverse and spread across terrestrial and aquatic ecosystems. Although this phylum includes many beneficial species, certain actinomycetes are pathogenic to human. For example, M. tuberculosis is a deadly disease that causes tuberculosis. Certain Streptomyces can cause scab disease in plants. There are only a few enzymes and biologically active compounds available for industrial use, and further research is needed in this area to produce low cost enzymes and biologically active compounds. With the rapid development of genomics, proteomics, synthetic biology, the discovery of drugs, actinomycetes will become the main field of research in the future.

Actinobacteria: diversity and biotechnological applications Chapter | 9

227

References Aderem, A. (2005). Systems biology: its practice and challenges. Cell, 121(4), 511–513. Ammar, Y. B., Matsubara, T., Ito, K., Iizuka, M., Limpaseni, T., Pongsawasdi, P., et al. (2002). New action pattern of a maltose-forming alpha-amylase from Streptomyces sp. and its possible application in bakery. Journal of Biochemistry and Molecular Biology, 35(6), 568–575. Ando, K., Oishi, H., Hirano, S., Okutomi, T., Suzuki, K., Okazaki, H., et al. (1971). Tetranactin, a new miticidal antibiotic. The Journal of Antibiotics, 24(6), 347–352. Atlas, R. M. (1981). Microbial degradation of petroleum hydrocarbons: an environmental perspective. Microbiological Reviews, 45(1), 180. Baltz, R. H. (2010). Genomics and the ancient origins of the daptomycin biosynthetic gene cluster. The Journal of Antibiotics, 63(8), 506. Barka, E. A., Vatsa, P., Sanchez, L., Gaveau-Vaillant, N., Jacquard, C., Klenk, H. P., et al. (2016). Taxonomy, physiology, and natural products of Actinobacteria. Microbiology and Molecular Biology Reviews, 80(1), 1–43. Barke, J., Seipke, R. F., Grüschow, S., Heavens, D., Drou, N., Bibb, M. J., et al. (2010). A mixed community of actinomycetes produce multiple antibiotics for the fungus farming ant Acromyrmexoctospinosus. BMC Biology, 8(1), 109. Bedys, J. (2005). Bioactive microbial metabolites. A person view. The Journal of Antibiotics, 58(1), 1–26. Behal, V. (2000). Bioactive products from Streptomyces. Advances in Applied Microbiology, 47, 113–156. Bouizgarne, B., &Aouamar, A.A. B. (2014). Diversity of plant associated actinobacteria. In Bacterial Diversity in Sustainable Agriculture (pp. 41-99): Springer. Brandelli, A. (2008). Bacterial keratinases: useful enzymes for bioprocessing agroindustrial wastes and beyond. Food and Bioprocess Technology, 1(2), 105–116. Brzezinski, R., Dery, C.V., & Beaulieu, C. (1999). Thermostable xylanase DNA, protein and methods of use. In: Google Patents. Bull, A. T., & Stach, J. E. (2007). Marine actinobacteria: new opportunities for natural product search and discovery. Trends in Microbiology, 15(11), 491–499. Busscher, G. F., Rutjes, F. P., & Van Delft, F. L. (2005). 2-Deoxystreptamine: central scaffold of aminoglycoside antibiotics. Chemical Reviews, 105(3), 775–792. Butler, M. S., Hansford, K. A., Blaskovich, M. A., Halai, R., & Cooper, M. A. (2014). Glycopeptide antibiotics: back to the future. The Journal of Antibiotics, 67(9), 631. Carroll, G. (1988). Fungal endophytes in stems and leaves: from latent pathogen to mutualistic symbiont. Ecology, 69(1), 2–9. Carroll, G. (1991). Fungal associates of woody plants as insect antagonists in leaves and stems. Microbial Mediation of plant-herbivore interactions, 253–271. Cho, J. Y., Kwon, H. C., Williams, P. G., Kauffman, C. A., Jensen, P. R., & Fenical, W. (2006). Actinofuranones A and B, polyketides from a marine-derived bacterium related to the genus Streptomyces (Actinomycetales). Journal of Natural Products, 69(3), 425–428. Das, S., Lyla, P., & Khan, S. A. (2008). Distribution and generic composition of culturable marine actinomycetes from the sediments of Indian continental slope of Bay of Bengal. Chinese Journal of Oceanology and Limnology, 26(2), 166–177. Desai, J. D. (1987). Microbial surfactants: evaluation, types, production and future applications. Journal of Scientific and Industrial Research, 46, 440–449. Dilip, C. V., Mulaje, S., & Mohalkar, R. (2013). A review on actinomycetes and their biotechnological application. International Journal of Pharmaceutical Sciences and Research, 4(5), 1730.

228

Recent Advancements in Microbial Diversity

Dochhil, H., Dkhar, M. S., & Barman, D. (2013). Seed germination enhancing activity of endophytic Streptomyces isolated from indigenous ethno-medicinal plant Centellaasiatica. International Journal of pharmacy and biological sciences, 4(1), 256–262. Drouin, C., & Cooper, D. (1992). Biosurfactants and aqueous two-phase fermentation. Biotechnology and Bioengineering, 40(1), 86–90. Du, H., Su, J., Yu, L., & Zhang, Y. (2013). Isolation and physiological characteristics of endophytic actinobacteria from medicinal plants. Acta Microbiologica Sinica, 53(1), 15–23. Edwards, C. (1993). Isolation properties and potential applications of thermophilic actinomycetes. Applied Biochemistry and Biotechnology, 42(2–3), 161–179. El-Shatoury, S. A., El-Kraly, O. A., Trujillo, M. E., El-Kazzaz, W. M., El-Din, E. -S. G., & Dewedar, A. (2013). Generic and functional diversity in endophytic actinomycetes from wild Compositae plant species at South Sinai–Egypt. Research in Microbiology, 164(7), 761–769. Fagerstrom, R., Lahtinen, T., Lantto, R., Mantyla, A., Paloheimo, M., Suominen, P., et al. (2008). Production and secretion of actinomycete xylanases in a filamentous trichoderma fungus. EP, 876494, B1. Feduchi, E., Cosin, M., & Carrasco, L. (1985). Mildiomycin: a nucleoside antibiotic that inhibits protein synthesis. The Journal of Antibiotics, 38(3), 415–419. Fenical, W., & Jensen, P. R. (2006). Developing a new resource for drug discovery: marine actinomycete bacteria. Nature Chemical Biology, 2(12), 666. Fiechter, A. (1992). Biosurfactants: moving towards industrial application. Trends in Food Science & Technology, 3, 286–293. Garrity, G., Staley, J.T., Boone, D.R., De Vos, P., Goodfellow, M., Rainey, F.A., et al. (2006). Bergey’s Manual of systematic bacteriology: volume two: the proteobacteria: Springer Science & Business Media. Gaynor, M., & Mankin, A. S. (2003). Macrolide antibiotics: binding site, mechanism of action, resistance. Current Topics in Medicinal Chemistry, 3(9), 949–960. Gehring, C. A., Cobb, N. S., & Whitham, T. G. (1997). Three-way interactions among ectomycorrhizal mutualists, scale insects, and resistant and susceptible pinyon pines. The American Naturalist, 149(5), 824–841. Goodfellow, M., & Williams, S. (1983). Ecology of actinomycetes. Annual Review of Microbiology, 37(1), 189–216. Goodfellow, M., Kämpfer, P., Busse, H.-J., Trujillo, M.E., Suzuki, K.-i., Ludwig, W., et al. (2012). Bergey’s Manual of systematic bacteriology: volume five: the actinobacteria, Part A and B: Springer. Hamayun, M., Khan, S. A., Ahmad, N., Tang, D. -S., Kang, S. -M., Na, C. I., et al. (2009). Cladosporium sphaerospermum as a new plant growth-promoting endophyte from the roots of Glycine max (L.) Merr. World Journal of Microbiology and Biotechnology, 25(4), 627–632. Harada, S., & Kishi, T. (1978). Isolation and characterization of mildiomycin, a new nucleoside antibiotic. The Journal of Antibiotics, 31(6), 519–524. Heumann, S., Eberl, A., Pobeheim, H., Liebminger, S., Fischer-Colbrie, G., Almansa, E., et al. (2006). New model substrates for enzymes hydrolysing polyethyleneterephthalate and polyamide fibres. Journal of Biochemical and Biophysical Methods, 69(1–2), 89–99. Hopwood, D.A. (2007). Streptomyces in nature and medicine: the antibiotic makers. Oxford University Press. Horikoshi, K. (1999). Alkaliphiles: some applications of their products for biotechnology. Microbiology and Molecular Biology Reviews, 63(4), 735–750. Hou, B. C., Wang, E. T., Li, Y., Jia, R. Z., Chen, W. F., Man, C. X., et al. (2009). Rhizobial resource associated with epidemic legumes in Tibet. Microbial Ecology, 57(1), 69–81.

Actinobacteria: diversity and biotechnological applications Chapter | 9

229

Hütter, R., Eckhardt, T., Goodfellow, M., Williams, S., & Mordarski, M. (1988). Actinomycetes in Biotechnology. Ilic, S., Konstantinovic, S., Todorovic, Z., Lazic, M., Veljkovic, V., Jokovic, N., et al. (2007). Characterization and antimicrobial activity of the bioactive metabolites in streptomycete isolates. Microbiology, 76(4), 421–428. Isono, K., Nagatsu, J., Kawashima, Y., & Suzuki, S. (1965). Studies on polyoxins, antifungal antibiotics: Part I. Isolation and characterization of polyoxins A and B. Agricultural and Biological Chemistry, 29(9), 848–854. Iwasa, T., Yamamoto, H., & Shibata, M. (1970). Studies on validamycins, new antibiotics. I. The Journal of Antibiotics, 23(12), 595–602. Jacob, N., Poorna, C. A., & Prema, P. (2008). Purification and partial characterization of polygalacturonase from Streptomyces lydicus. Bioresource Technology, 99(14), 6697–6701. Jang, H. D., & Chang, K. S. (2005). Thermostable cellulases from Streptomyces sp.: scale-up production in a 50-l fermenter. Biotechnology Letters, 27(4), 239–242. Janso, J. E., & Carter, G. T. (2010). Biosynthetic potential of phylogenetically unique endophytic actinomycetes from tropical plants. Applied and Environmental Microbiology, 76(13), 4377– 4386. Jaouadi, B., Abdelmalek, B., Fodil, D., Ferradji, F. Z., Rekik, H., Zarai, N., et al. (2010). Purification and characterization of a thermostable keratinolytic serine alkaline proteinase from Streptomyces sp. strain AB1 with high stability in organic solvents. Bioresource Technology, 101(21), 8361–8369. Jayaprakashvel, M. (2012). Therapeutically active biomolecules from marine actinomycetes. Journal of Modern Biotechnology, 1(1), 1–7. Jensen, P. R., Williams, P. G., Oh, D. C., Zeigler, L., & Fenical, W. (2007). Species-specific secondary metabolite production in marine actinomycetes of the genus Salinispora. Applied and Environmental Microbiology, 73(4), 1146–1152. Jensen, S. E., & Paradkar, A. S. (1999). Biosynthesis and molecular genetics of clavulanic acid. Antonie Van Leeuwenhoek, 75(1–2), 125–133. Jizba, J., Sedmera, P., Zima, J., Beran, M., Blumauerová, M., Kandybin, N., et al. (1991). Macrotetrolide antibiotics produced by Streptomyces globisporus. Folia Microbiologica, 36(5), 437–443. Johnston, N. J., Mukhtar, T. A., & Wright, G. D. (2002). Streptogramin antibiotics: mode of action and resistance. Current Drug Targets, 3(4), 335–344. Jones, B.E., Van Der Kleij, W.A., Van Solingen, P., Weyler, W., & Goedegebuur, F. (2003). Cellulase producing actinomycetes, cellulase produced therefrom and method of producing same. In: Google Patents. Kang, Q., Shen, Y., & Bai, L. (2012). Biosynthesis of 3, 5-AHBA-derived natural products. Natural Product Reports, 29(2), 243–263. Kar, S., & Ray, R. C. (2008). Statistical optimization of á-amylase production by Streptomyces erumpens MTCC 7317 cells in calcium alginate beads using response surface methodology. Polish Journal of Microbiology, 57, 49–57. Kharel, M. K., Pahari, P., Shepherd, M. D., Tibrewal, N., Nybo, S. E., Shaaban, K. A., et al. (2012). Angucyclines: Biosynthesis, mode-of-action, new natural products, and synthesis. Natural Product Reports, 29(2), 264–325. Kim, S. B., Lonsdale, J., Seong, C. -N., & Goodfellow, M. (2003). Streptacidiphilus gen. nov., acidophilic actinomycetes with wall chemotype I and emendation of the family Streptomycetaceae (Waksman and Henrici (1943) AL) emend. Rainey et al., 1997. Antonie Van Leeuwenhoek, 83(2), 107–116.

230

Recent Advancements in Microbial Diversity

Kominek, L. (1975). Cycloheximide production by Streptomyces griseus: control mechanisms of cycloheximide biosynthesis. Antimicrobial Agents and Chemotherapy, 7(6), 856–860. Kuddus, M., Roohi, A. J., & Ramteke, P. W. (2011). An overview of cold-active microbial αamylase: adaptation strategies and biotechnological potentials. Biotechnology, 10(3), 246–258. Lechevalier, H., & Lechevalier, M. P. (1965). Classification des actinomycètesaérobiesbasée sur leurmorphologie et leur composition chimique. Paper presented at the ANNALES DE L INSTITUT PASTEUR. Liras, P. (1999). Biosynthesis and molecular genetics of cephamycins. Antonie Van Leeuwenhoek, 75(1–2), 109–124. Ludwig, W., Euzéby, J., Schumann, P., Busse, H.-J., Trujillo, M.E., Kämpfer, P., et al. (2012). Road map of the phylum Actinobacteria. In Bergey’s manual of systematic bacteriology (pp. 1-28): Springer. Lugtenberg, B. J., Chin-A-Woeng, T. F., & Bloemberg, G. V. (2002). Microbe–plant interactions: principles and mechanisms. Antonie Van Leeuwenhoek, 81(1–4), 373–383. Magarvey, N. A., Keller, J. M., Bernan, V., Dworkin, M., & Sherman, D. H. (2004). Isolation and characterization of novel marine-derived actinomycete taxa rich in bioactive metabolites. Applied and Environmental Microbiology, 70(12), 7520–7529. McCarthy, A. J., Peace, E., & Broda, P. (1985). Studies on the extracellular xylanase activity of some thermophilic actinomycetes. Applied Microbiology and Biotechnology, 21(3–4), 238–244. Minotti, G., Menna, P., Salvatorelli, E., Cairo, G., & Gianni, L. (2004). Anthracyclines: molecular advances and pharmacologic developments in antitumor activity and cardiotoxicity. Pharmacological Reviews, 56(2), 185–229. Mitra, P., &Chakrabartty, P.K. (2005). An extracellular protease with depilation activity from Streptomyces nogalator. Moreira, K., Albuquerque, B., Teixeira, M., Porto, A., & Lima Filho, J. (2002). Application of protease from Nocardiopsis sp. as a laundry detergent additive. World Journal of Microbiology and Biotechnology, 18(4), 309. Mulinos, M. (1955). Cycloserine: an antibiotic paradox. Antibiotics Annual, 3, 131–135. Oishi, H., Sugawa, T., Okutomi, T., Suzuki, K., Hayashi, T., Sawada, M., et al. (1970). Insecticidal activity of macrotetrolide antibiotics. The Journal of Antibiotics, 23(2), 105–106. Okami, Y. (1988). Search and discovery of new antibiotics. Actinomycetes in Biotechnology, 33–67. Oldroyd, G. E., & Downie, J. A. (2004). Calcium, kinases and nodulation signalling in legumes. Nature Reviews Molecular Cell Biology, 5(7), 566. Omura, S., & Crump, A. (2014). Ivermectin: panacea for resource-poor communities? Trends in Parasitology, 30(9), 445–455. Park, S. R., Park, J. W., Ban, Y. H., Sohng, J. K., & Yoon, Y. J. (2013). 2-Deoxystreptamine-containing aminoglycoside antibiotics: recent advances in the characterization and manipulation of their biosynthetic pathways. Natural Product Reports, 30(1), 11–20. Rifaat, H., Nagieb, Z., & Ahmed, Y. (2006). Production of xylanases by Streptomyces species and their bleaching effect on rice straw pulp. Applied Ecology and Environmental Research, 4(1), 151–160. Sagawa, T., Hirano, S., Takahashi, H., Tanaka, N., Oishi, H., Ando, K., et al. (1972). Tetranactin, a new miticidal antibiotic. III. Miticidal and other biological properties. Journal of Economic Entomology, 65(2), 372–375. Sakamoto, K., Asano, T., Mizuochi, K., Sasaki, K., & Hasegawa, K. (1978). Makrotetrolid-AntibiotikumzurBekämpfung der Geflügelkokzidiose. Paper presented at the Chem Abstr. Salomon, C. E., Magarvey, N. A., & Sherman, D. H. (2004). Merging the potential of microbial genetics with biological and chemical diversity: an even brighter future for marine natural product drug discovery. Natural Product Reports, 21(1), 105–121.

Actinobacteria: diversity and biotechnological applications Chapter | 9

231

Shimizu, M. (2011). Endophytic actinomycetes: biocontrol agents and growth promoters. In Bacteria in agrobiology: Plant growth responses (pp. 201-220): Springer. Stamford, T., Stamford, N., Coelho, L., & Araujo, J. (2001). Production and characterization of a thermostable α-amylase from Nocardiopsis sp. endophyte of yam bean. Bioresource Technology, 76(2), 137–141. Strobel, G., & Daisy, B. (2003). Bioprospecting for microbial endophytes and their natural products. Microbiology and Molecular Biology Reviews, 67(4), 491–502. Stuttard, C., & Vining, L. (2014). Genetics and biochemistry of antibiotic production (vol. 28). Butterworth-Heinemann. Sun, W., Dai, S., Jiang, S., Wang, G., Liu, G., Wu, H., et al. (2010). Culture-dependent and cultureindependent diversity of Actinobacteria associated with the marine sponge Hymeniacidonperleve from the South China Sea. Antonie Van Leeuwenhoek, 98(1), 65–75. Tindall, B. J., Kampfer, P., Euzeby, J. P., & Oren, A. (2006). Valid publication of names of prokaryotes according to the rules of nomenclature: past history and current practice. International Journal of Systematic and Evolutionary Microbiology, 56(11), 2715–2720. Umezawa, H., Okami, T., Hashimoto, T., Suhara, Y., Hamada, M., & Takeuchi, T. (1965). A new antibiotic, kasugamycin. Journal of Antibiotics Series A.18, 101–103. Vakulenko, S. B., & Mobashery, S. (2003). Versatility of aminoglycosides and prospects for their future. Clinical Microbiology Reviews, 16(3), 430–450. Ventura, M., Canchaya, C., Fitzgerald, G. F., Gupta, R. S., & van Sinderen, D. (2007). Genomics as a means to understand bacterial phylogeny and ecological adaptation: the case of bifidobacteria. Antonie Van Leeuwenhoek, 91(4), 351–372. Waksman, S. A., & Woodruff, H. B. (1940). Bacteriostatic and Bactericidal Substances Produced by a Soil Actinomyces. Proceedings of the Society for Experimental Biology and Medicine, 45(2), 609–614. Waksman, S. A., & Woodruff, H. B. (1942). Selective antibiotic action of various substances of microbial origin. Journal of Bacteriology, 44(3), 373. Williams, S., & Vickers, J. (1988). Detection of actinomycetes in the natural environment: problems and perspectives. Biology of Actinomycetes, 88, 265–270. Xi, L., Ruan, J., & Huang, Y. (2012). Diversity and biosynthetic potential of culturable actinomycetes associated with marine sponges in the China seas. International Journal of Molecular sciences, 13(5), 5917–5932. Yang, C. -H., & Liu, W. -H. (2004). Purification and properties of a maltotriose-producing αamylase from Thermobifida fusca. Enzyme and Microbial Technology, 35(2–3), 254–260. Yu, H., Zhang, L., Li, L., Zheng, C., Guo, L., Li, W., et al. (2010). Recent developments and future prospects of antimicrobial metabolites produced by endophytes. Microbiological Research, 165(6), 437–449. Zhang, F., Chen, J. J., Ren, W. Z., Nie, G. X., Ming, H., Tang, S. K., et al. (2011). Cloning, expression and characterization of an alkaline thermostable GH9 endoglucanase from Thermobifida halotolerans YIM 90462T. Bioresource Technology, 102(21), 10143–10146. Zhao, K., Penttinen, P., Guan, T., Xiao, J., Chen, Q., Xu, J., et al. (2011). The diversity and antimicrobial activity of endophytic actinomycetes isolated from medicinal plants in Panxi plateau. China. Current Microbiology, 62(1), 182–190. Zimmermann, W. (1990). Degradation of lignin by bacteria. Journal of Biotechnology, 13(2–3), 119–130.

Chapter 10

Quorum sensing: the microbial linguistic Vikas Kumara and Jyoti Rawatb a

School of Engineering, The University of British Columbia Okanagan, Kelowna, BC, Canada; Department of Biotechnology, Kumaun University Nainital, Bhimtal campus, Bhimtal Uttarakhand, India b

1  The world of microbes Cellular communication and signal transduction are vital for the evolution of all living multicellular organisms. Not surprisingly, given its considerable importance to the ecosystem, many essential facets of cellular communication are well maintained among unicellular flora, fauna and eukaryotes more than a billion years ago (Bleich et al., 1982; Ferreira, Hemerly, Van Montagu, & Inzé, 1994). Microbes, animals and plants are closely associated with each other because they share common associations, such as in the intestinal microflora of livestock; the rhizosphere and phyllosphere, etc. (Lindow & Brandl, 2003). However, it was initially thought that cellular coordination was limited to multicellular organisms and that bacteria could only coordinate indirectly with neighboring bacteria, such as the detection of nutrient availability and pH fluctuation (Sifri, 2008). Studies over the last 50 years have revealed that microorganisms can talk to each other and adopt a wide range of complex societal activities, including cooperation. These social behaviors are widespread in bacteria. It is now evident that social behaviors have crucial consequences for the establishment of the behavior and form of polymicrobial groups. The growing interest in the know-how of bacterial social behaviors has led to modern methods of understanding dynamic and mixed microbial groups (Abisado, Benomar, Klaus, Dandekar, & Chandler, 2018). The microbial association with humans is not considered positively. Infections and diseases caused by microbes have altered their image in our minds and are perceived as leading to an unhealthy situation. Yet these figures are irrational in relation to the number of microflora that resides in us every-day and everytime in our lives. We consider our body as a “human being”, but beware, we are not just human beings. We are like the rental buildings for many microbes that Recent Advancements in Microbial Diversity. http://dx.doi.org/10.1016/B978-0-12-821265-3.00010-4 Copyright © 2020 Elsevier Inc. All rights reserved.

233

234

Recent Advancements in Microbial Diversity

call us their “home-sweet-home”. It is predicted that the microflora in our body collectively counts for approximately 105 billion cells which is nearly tenfold the number of human cells and proposed that translates for 100 times more exclusive genes than our own genome. Most of the microbes living in the gut, have a very weighty impact on physiology and nutrition, and are an essential part of human life. In addition, the fluctuation in the gut microflora can leads to obesity and many bowel diseases (Qin et al., 2010). Research suggests that the human body accommodate about 160 species of bacteria in their gut, but some humans can harbor up to 1000 species of bacteria; the belly button alone accommodate 67 different bacterial species and about 1000 different species colonize on the skin. The majority of microbes present in our bodies are harmless or extremely useful. They help us absorb the nutrients that protect us from damage and toxins of foreign origin. Some of them help us strengthen our immune system (Qin et al., 2010). Our fitness and healthy appearance can be attributed to Firmicutes and Bacteroidetes (Wexler, 2007). In addition to these, our body inhabited another group of microbes that are pathogenic. This pathogenic affiliation is triggered mainly by two types of pathogens. Depending on their nature, they can stay for a short or long time. The first group can infect the body and cause diseases (such as cholera, diarrhoea, septicemia etc.) and quickly leave the patient in a very short time. Potential pathogens include Klebsiella, Salmonella typhi, Serratia, Shigella, Vibrio cholerae, Escherichia coli, etc.(“Septic Shock”). The second group of pathogens may have a permanent migration to the host body. They colonize certain parts of the body based on their availability of nutrients and stay comfortably there. Pathogens such as Pseudomonas aeruginosa, Burkholderia cepacian, and Mycobacterium tuberculosis invade the host organism by evading the human immune system (Kalia, 2014). Humans encounter situations that spread severe signs of infection and disease. The discovery of antibiotics has changed to the concept of relieving humans in the pain of microbial infection. Yet, microorganisms evolved rapidly and became resilient to antibiotics. It has been discovered that bacteria have an exceptional arrangement of still growth via quorum sensing. Quorum sensing works through a signature molecule, allowing bacteria to detect their inhabitant’s density. At extreme cell density, bacteria produce an arsenal of virulence factors. Quorum sensing-mediated biofilms made with pathogenic bacteria can tolerate excessive doses of antibiotics. This allowed researchers to look for innovative substitutes to antibiotics. This led to the discovery of natural and manmade inhibitors to the quorum sensing mechanism. Recent studies have shown that quorum sensing inhibitors can follow the same fate as antibiotics. The virulence factors existing in pathogenic bacteria help spread the infection in the host. Strong consideration of the basic mechanisms of pathogenicity is how the pathogen is responsible for the pathological changes induced in the host and is up- or down-regulated during quorum sensing to produce this outcome useful for identifying signal transduction pathways. With a surprising

Quorum sensing: the microbial linguistic Chapter | 10

235

upsurge in resistance to antibiotics, information of how virulence factors and quorum sensing interrelate with host receptors and proteins is ground-breaking to help identify the presence of infection at a faster pace and counter this threat. In addition, ideas on the structural and genetic characteristics of virulence factors design drug targets that can fight infection and act as inhibitors of infection through a genetically susceptible individual’s quorum sensing mechanism. A comprehensive analysis also offers insight into the evolutionary interactions involved in the generation of novel species and the interactions between pathogens and symbiotic species in a niche that is adapted to cause potential infections. After studying these many peculiarities and activities of different microbes, the questions that arise are how these microbes can intelligently invade the environment? How do they communicate and transfer information from one cell to another? And what is the communication mechanism? To answer these questions, we need to look deeply into the general mechanism and modules of genetic modification of microbes. This chapter will cover the entire story of microbial linguistic, its mechanism and its potential applications in applied science research. This chapter also addresses the environmental impact of quorum sensing and biofilm formation.

2  Overview of Quorum sensing: social engagement of microbes Bacteria were once believed to have a simple process and single-cell life, but today they are extremely viewed for their capability to act cooperatively in multicellular assemblages (Bassler & Losick, 2006). What explains the cell concentration dependence of gene expression? How does the cell “recognize” that it is crowded? This phenomenon was initially called “quorum sensing”. This seemed to be close to legislative rules that require a minimum number of participants (a quorum) to attend the meeting to complete the work. Synchronised actions embrace bioluminescence, production of virulence factors, and synthesis of secondary metabolites, DNA uptake capacity, and biofilm formation. These progressions are impractical if a single bacterium stand-in performs them alone. On the contrary, accomplishment requires the coordination of the entire population of individual cells. To coordinate the collective behavior, the bacteria use a process of intercellular communication called “quorum sensing” (Mukherjee & Bassler, 2019). It starts with one of the great discovery- a discovery that deeply transformed the way of thinking about microorganisms was made through the study of Aliivibrio fischeri, a unique marine microorganism that settles in the light organs of the Hawaiian bobtailed squid, Euprymna scolopes. During the day, this little squid stays hidden in the mud of a narrow coral reef basin around Hawaii. In the evening, the animals get up and start looking for meals. While swimming on a remarkable lunar night, his luminous organ shines for the sole purpose of

236

Recent Advancements in Microbial Diversity

camouflaging the predatory squid that swims beneath him. By observing, the fish sees the most effective (called “backlighting”), and now not the shadow of the squid moving towards the dim light on the moon’s ground. Nevertheless, the light is not made using squid. Among the luminescent organs of the squid is a luminescent bacterium called Aliivibrio fischeri (formerly Vibrio fischeri). Bacteria, not squid, emit light. However, these microorganisms do not always shine. They illuminate at best when the range of cells and the attention of secreted signaling molecules exceed the limits. The vital density of microorganisms reaches sunset and the genes needed in the light age are “activated”. The symbiosis is conquered when the microorganism collects the nutrients that grow inside the luminescent organs and the squid survives one more night. The term ‘quorum sensing’ was coined by Dr. Steven Winans. In 1994, Dr. Steven Winans published one of the first articles on bacterial self-induction. The term ‘autoinducer’ is used to describe small diffusible molecules involved in biochemical processes. Due to his general confusion with the terms ‘autoinduction’ with ‘autoregulation’, this word seems inappropriate to him (Fuqua, Winans, & Greenberg, 1994). Dr. Winans decided to find an eye-catching new word and generated possible terms such as ‘communiolins’, ‘gridlockins’ and ‘quoromones’. However, the term ‘quorum sensing’ later became common and was happily accepted by other colleagues and the society (Turovskiy, Kashtanov, Paskhover, & Chikindas, 2007). The process of ‘quorum sensing’ in a microorganism is regulated by a variety of chemical signaling molecules, called autoinducers, serving as a “discrete language” of communication. For intra- and interspecific communication, microorganisms use a variety of signaling molecules. In the case of intraspecies communication, the signaling molecules generated to act as a “secret language” for some microbial species. On the other hand, a dedicated signaling pathway is preserved in the microbial world for interspecies communication, and a “common language” is used for this purpose. Most Gram-negative bacteria use acyl-homoserine lactone (AHL) as a discrete communication language. Different types of Gram-negative bacteria produce their own AHL. Likewise, Grampositive bacteria mainly use autoinducing peptides (AIP) as a secret language. The universal language used for communication between species is similar for all microbes called autoinducer-2 (AI-2) (Kalia, Prakash, Koul, & Ray, 2018; Msadek, Kunst, & Rapoport, 1993).

3  Mechanism of Quorum sensing It is relatively more difficult to sense what is happening in the open environment compared to sensing the intracellular conditions. Microorganisms (usually bacteria but now there are pieces of evidence of archaeal quorum sensing (see section 4.3)) use the general mechanism to collect information from the surrounding environment. The Gram-positive and Gram-negative bacterial information collections are based on a series of two-member protein phosphorylation relay

Quorum sensing: the microbial linguistic Chapter | 10

237

FIGURE 10.1  External environment sensing mechanism in microorganism.

systems, known as the two-component signaling system. Fig. 10.1 describes the general mechanism for detecting environmental signaling in a bacterial system. Each two-component system controls a different set of genes. Sensor Kinase, the first protein of each relay, extends over the membrane. Kinases transfer ATP phosphorylation groups to proteins. The sensory domain of most protein kinase sensors is in contact with the external environment (or periplasm), whereas, another end (kinase domain) projects into the cytoplasm. Individual sensor protein in a two-component system finds a varied molecule or state (for example, the two-component PhoP/PhoQ system directs several physicochemical and virulence functions in Salmonella enterica. This system is activated by a low level of Mg2+, antimicrobial peptides and an acidic pH). When triggered, the peripheral sensory domain causes a conformational alteration in the kinase domain and activates autophosphorylation. ATP phosphate is bound to specific histidine residues in different parts of the protein. Next, the phosphorylated protein kinase protein transmits phosphate to an associated (cognate) cytoplasmic protein termed as a response regulator. This transfer, is also known as called transphosphorylation, ensues at certain aspartate residues in the response regulator. Phosphorylation regulators generally bind to governing DNA sequences that precede one or more specific genes to trigger or block the expression. By connecting multiple control schemes, the cells generate complex integrated routes

238

Recent Advancements in Microbial Diversity

with superimposed controls that synchronise various features of cell physiology (Msadek et al., 1993)

3.1  Quorum sensing in Gram-negative bacteria Over the past 10 years, quorum sensing circuits have been discovered in nearly 25 gram-negative bacteria. In each case excluding the M. xanthus and V. harveyi, the quorum-sensing circuit found in Gram-negative bacteria is similar to the quorum sensing circuit of the symbiotic bacterium V. fischeri. To be precise, these Gram-negative bacterial quorum sensing circuits are at least comparable to dual V. fischeri monitoring proteins called LuxI and LuxR. LuxI-like proteins process the biosynthesis of certain acylated homoserine lactone signaling molecules known as autoinducers (AI). The concentration of autoinducer increases with the cumulative cell population density. LuxR-like proteins bind to cognate HSL autoinducers that have reached critical threshold concentrations, and LuxR autoinducer complexes also cause transcription of target genes. This quorum sensing mechanism allows Gram-negative bacteria to efficiently combine gene expression and cell population density variation. Fig. 10.2 describes the overall process of microbial communication in Gram-negative bacteria. Among the 25 bacterial species that facilitate the detection of quorum with LuxI/LuxR type circuits, the best-known species are V. fischeri, Erwinia carotovora, Pseudomonas aeruginosa and Agrobacterium tumefaciens (Bassler, 1999; Fuqua, Winans, & Peter Greenberg, 1996; Kievit, de Kievit, & Iglewski, 2000; Miller & Bassler, 2001; Parsek & Greenberg, 2000).

FIGURE 10.2  External environment sensing mechanism in microorganism.

Quorum sensing: the microbial linguistic Chapter | 10

239

3.2  Quorum sensing in Gram-positive bacteria Gram-positive bacteria also control various processes as cell density increases. Compared to Gram-negative bacteria using the HSL autoinducers system, Gram-positive bacteria secrete peptides and these secreted peptides are employed as autoinducers for quorum sensing. These peptides are secreted by a special transporter system called the ATP-binding cassette transporter. In addition, Gram-positive bacteria use a two-component adaptive response protein to detect autoinducers compared to the Gram-negative LuxR system. The signaling mechanism used here is phosphorylation/dephosphorylation (Bassler, 1999; Kleerebezem, Quadri, Kuipers, & De Vos, 1997; Miller & Bassler, 2001). Fig. 10.1 (Note: In gram-positive bacteria, a transmembrane sensor kinase senses the environmental stress outside the cell whereas in gram-negative bacteria it senses in the periplasmic membrane of the cell.) shows a general model for quorum sensing of Gram-positive bacteria. Briefly, secreted peptide autoinducers accumulated with an increase in cell-population density. The two-component sensor kinases detect the accumulated peptide signals. Interplay with peptide ligands onset a series of phosphorylation events, concluding in phosphorylation of homologous response-regulating proteins. The response regulator phosphorylation stimulates it, binds to DNA, and can alter transcription of the quorum-sensing control target gene. In gram-positive bacteria, the basic signaling mechanisms are maintained, but differences in regulation/synchronization of the system have occurred to increase the efficiency of signal transduction process in a specified situation (Miller & Bassler, 2001).

4  Biofilm: a shield against the challenging environment Biofilms are one of the most effective life forms on the planet, found in almost all habitats (Costerton, Lewandowski, Caldwell, Korber, & Lappin-Scott, 1995; Flemming et al., 2016; Stoodley, Sauer, Davies, & Costerton, 2002). There are commonly recognized but essentially unproven stories that most bacteria and archaea on Earth are present in biofilms (Flemming & Wuertz, 2019). The rationality of the hypothesis that the biofilm is the most successful life form and leads globally can be verified by discussing very basic but important questions that pose real challenges to evaluate bacteria and the archaeal population on Earth. Before that, it is more convenient to understand the term ‘biofilm’; and to approximately estimate the total population of archaea and bacteria inhabiting biofilms.

4.1  What are biofilms? The bacteria attached to the surface may signify a diverse life form compared to planktonic cells was recognized for the first time by ZoBell (Zobell, 1943). The revolutionary work of Marshall, Stout, & Mitchell, (1971) led to the idea of biofilm (Fletcher & Floodgate, 1973; Characklis, 1973; Geesey, Mutch,

240

Recent Advancements in Microbial Diversity

Costerton, & Green, 1978). The sessile communities of microorganisms replicate cooperatively in a self-produced matrix of extracellular macromolecules (such as polysaccharides, nucleic acids, proteins, lipids etc.) and ultimately accumulate in layers called biofilm (Flemming & Wingender, 2010; Flemming & Wuertz, 2019). These aggregates or clusters of cells can grow on all surfaces (solid-liquid, solid-gas, liquid-liquid and liquid-gas), including self-produced surfaces. From an evolutionary point of view, it is motivating and exciting to see that the lifestyle of biofilms has added benefits for its members and the advancement of emerging properties (i.e., properties that do cannot be predicted by its sessile communities). These properties include varied patterns and resistances, novel features, and complex metabolism. The word “aggregate” explains the details that most multilayer biofilm cells are in a close matrix, not a layer attached to the interface. For example, only the underlying biofilm underneath the surface is in direct contact with a substratum that includes soil, pebbles, inert surfaces, sediment, biological surfaces such as plankton, animals, plants, or other organisms (Flemming et al., 2016). Microbial aggregates are very distinct, varying from microclusters and small fragmented colonies to monolayers and confluent biofilms of variable thicknesses, to microbial mats, hot springs, marine snow, and granular sludge biofilms. The number of cells needed to grow a biofilm still is controversial. Yet, it is harmless to accept the fact that there is a breach between single sessile cells and the point where they divide to form small and large clusters, microcolonies, and irregular aggregates.

4.2  How many archaea and bacteria live in biofilms? To answer these questions, few available global approximations of archaea and bacteria on planet help us to extrapolate the results based on the local measurement of data. The current estimate indicates that nearly 1030 cells with a 10-fold ambiguity (Bar-On, Phillips, & Milo, 2018; Magnabosco et al., 2018). Hans- Curt Flemming and Stefan Wuertz in their publication assess the number of cells living in biofilm in the largest abiotic and biotic habitats on Earth with various assumptions and calculations it was estimated that most bacteria and archaea on Earth (1.2 × 1030 cells) exist in the ‘giant five’ territories: oceans (1 × 1029), soil (3 × 1029) deep continental subsurface (3 × 1029), upper oceanic sediment (5 × 1028) and, deep oceanic subsurface (4 × 1029). The residual territories, including groundwater (5 × 1027), the atmosphere (5 × 1022), the ocean surface microlayer (2 × 1023), humans (4 × 1023), phyllosphere (2 × 1026), municipal wastewater (1 × 1026), domestic birds (6 × 1020), cattle (4 × 1024), and other minor habitats account for fewer cells by orders of magnitude. Excluding the oceans that make up about 80% of the bacterial and archaeal population, biofilms dominate in all other habitats. The response to abundant biofilms is complex. About 40% of bacteria and archaea are found underground, 80% of them are found in soil and upper marine sediments as biofilms and 20% in the

Quorum sensing: the microbial linguistic Chapter | 10

241

ocean as planktonic cells. Most of the cells are in the lower continent and lower ocean, with more than 99% of the surface attached. When cells are active, they divide sooner or later and ultimately form clumps, and thus biofilms. Metabolic and microscopic signal reveals that in fact, even at very low growth rates form biofilms, exhibiting 20-80% of the total number of cells. It is assumed that in the subsurface, the biogeochemical processes are usually led by biofilm. This survey highlights the global significance of biofilms that outline lifecycle on Earth (Flemming & Wuertz, 2019).

4.3  Archaeal biofilm production Over the last 30 years, efforts to understand microbial biofilms have focused primarily on medically important bacteria and their role in persistent and chronic diseases. Currently, insight into archaeal biofilms developments, archaeal communication for the biofilm formation and the establishment of planktonic to sessile communities are regulated. Yet, the mechanism of archaeal biofilm formation is little known. It is widely documented that archaea play an significant part in the biogeochemical cycle of elements on the planet, both metabolically and physiologically (Justice et al., 2012; Offre, Spang, & Schleper, 2013). As archaea are universally present in many habitats and play an important role in their environment, it is important to know the development and biology of archaeal biofilms. Initial studies provide suggestions to archaeal cells that biofilm formation have high advantages including resistance to various environmental effects such as varying pH and toxic substances and facilitate horizontal gene transfer; other advantages include symbiotic association with other microorganisms. Early studies suggest that archaeal cells have great benefits from biofilm formation, including resistance to environmental stress, such as pH, temperature, shear stress fluctuation and toxins. Other benefits include the symbiotic association with other microorganisms and enabling facilitates horizontal gene transfer (Koerdt, Gödeke, Berger, Thormann, & Albers, 2010; Lapaglia & Hartzell, 1997; Megaw & Gilmore, 2017; van Wolferen, Orell, & Albers, 2018; Wegener, Krukenberg, Riedel, Tegetmeyer, & Boetius, 2015). Archaeal cells have been detected in many biofilms in different habitats, including marine environments, alpine glacier flow, acid mine drainage, chimneys, and alkaline lakes (Battin, Wille, Sattler, & Psenner, 2001; Couradeau et al., 2011; Edwards, 2000; Webster & Negri, 2006). In addition, growing evidence suggests that archaea (mainly methanogens), by syntrophic association with bacteria, form biofilm clusters in humans (van Wolferen et al., 2018).

4.3.1  Archaeal biofilm and humans In humans, archaea are primarily connected with the intestines, skin, oral cavity and vaginal mucosa (Bang & Schmitz, 2015; Dridi, Raoult, & Drancourt, 2011; Probst, Auerbach, & Moissl-Eichinger, 2013). Initial trials on human gut microbiota were based on culture-dependent methods. Though, the evolution of

242

Recent Advancements in Microbial Diversity

omic technology (for example, proteomics, transcriptomics, genomics, etc.) has transformed the ability to study human-related ecosystems that often exist as biofilms (Dridi, Henry, El Khéchine, Raoult, & Drancourt, 2009; Lagier, Million, Hugon, Armougom, & Raoult, 2012). For example, methanogenic archaea are commonly known to play a vital role in the human intestine by metabolizing fermentation products such as short-chain organic acids, alcohol, carbon dioxide, and hydrogen (McNeil, 1984). Both Methanobrevibacter smithii and Methanosphaera stadtmanae are found in the human intestine. Several archaea were found to be abundant at the site of peri-implantitis (inflammation of the soft tissue near the dental implant) (Faveri et al., 2011), this suggests that archaea also contribute to the disease. However, there is still no solid evidence to advocate the pathogenicity of archaeal cells. The abundance of Archaeal microbes varies from one human to another in some cases, it may be low or high, but to better understand the human physiology, the biofilm containing archaea that live in the human body and their effects on the human health could help to supplement a broad understanding of human microbiome (Evans, 1993).

4.3.2  Cell-cell communication and signaling in archaea Cell signaling and quorum sensing play a key role in biofilm formation. However, cellular communication in the archaea is not well known, the ability of archaeal cells to form a biofilm is still uncertain whether the quorum detection manages these trends. The development of biofilms in the archaea is expected to occur using a quorum sensing mechanism. For example, Halorubrum Lacusprofundi secretes N-acyl homoserine lactone substances into biofilms, giving an ambiguous indication of an identical process similar to the quorum sensing process occurring in archaeal biofilm formation (Liao et al., 2016). Archaeal biofilms can serve as an important platform for various biotechnology processes and applications in environmental engineering, including bioleaching, wastewater treatment, alcohol production, bioremediation and biofilters for water purification (van Wolferen et al., 2018). In Nature, most microbes grow as mixed cultures. Therefore, microbial syntrophy and intracellular and intercellular communication between neighboring microbes in mixed biofilms are important for understanding the development of archaeal biofilms. In addition, the pathways of biochemistry and cellular communication give more hope and become areas of great interest for the further development of various real-life applications.

5  Applications of Quorum sensing Quorum sensing (QS) refers to cell-to-cell communication systems that are used by many microorganisms to assess their local cell densities. This sensing mechanism is based on the synthesis and detection of small signaling molecules, the concentration of which is associated with the wealth of dissimulation of microorganisms in the neighbourhood. When the accumulated signaling molecules impact a threshold limit, the “quorum” is understood to be present, and

Quorum sensing: the microbial linguistic Chapter | 10

243

the collaborating microbes commence a synchronized alteration in their gene expression patterns. As a result, they initiate complex activities which would not have been beneficial at smaller numbers, such as secretion of virulence factors, initiation of biofilm formation, sporulation, competence, mating, root nodulation, bioluminescence, and production of secondary metabolites (Bassler & Losick, 2006). Recently, numerous groups have proved intra- and interspecies artificial transportations through synthetic routes that integrate mechanisms of bacterial QS arrangements. QS-based engineering circuits/routes have a varied application such as tissue engineering, biochemical production, and mixed fermentations. They are also very suitable in designing microbial biosensors to detect microbial species found in the environment and in living creatures. Components of microbial QS systems constitute an important part of several artificial genetic circuits that regulate phenomena such as bistable behavior, pulse response, spatio-temporal control of gene expression, and population control (Purnick & Weiss, 2009).

5.1  Engineered QS system The emerging arena of artificial biology allows creators to hypothesize and enhance multi-faceted genetic circuits that achieve innovative goals, such as the development of DNA-mutilated biofilms and artificial ecosystem conservation (Balagaddé et al., 2008; Kobayashi et al., 2004). Using plug and play strategy complex genetic networks has been created, further these gene networks are then introduced into a well-characterized, stable host cell (also known as a “chassis”), which supplies the necessary raw materials and support machinery. Operation of the synthetic genetic device imparts novel functionalities to the host and creates a microbial cell factory that is capable of executing desired tasks. As the engineered cells synthesize QS signals by themselves, they are able to monitor their own cell density and modulate their activities accordingly, thereby reducing the need for external supervision. One such biological device produces fluorescence at critical AHL density. Utilization of a bistable switch module gives a sharp ON/OFF or binary profile of target gene expression depending on the input concentration. QS engineering systems incorporating bistable switches are expected to be very beneficial in the industrial production of harmful genetic products and in the design of environmentally friendly biosensors.

5.2 Biosensor In engineering of whole-cell microbial biosensors, it is ease to recognize pathogenic microbes existing in the environment and diseased host organisms. It is likely to imagine the formation of innovative anti-cancer therapeutics by the accumulation of cancer-killing modules to these microbial biosensors (Grandclement, Tannieres, Morera, Dessaux, & Faure, 2015).

244

Recent Advancements in Microbial Diversity

Microbial biosensors are microorganisms of natural or artificial origin that produce a detectable signal during environmental stimuli (Yagi 2007, Van Der Meer & Belkin, 2010). In addition to the E. coli, several soil-borne bacteria, such as P. fluorescens, P. putida or S. aureus, have been designed as whole cell biosensors to reduce the influence of native soil components (Renella & Giagnoni, 2016). To date, various target analytes, such as organic xenobiotics (naphthalene, BTEX (benzene, toluene, ethylbenzene and xylene), alkylsulfonates, polychlorinated biphenyls), heavy metals and metalloids (As, Cd, Zn, Ni, Cu, Cr, Cu), or physiologically active molecules can be detected by different types of whole cell biosensors (Yagi, 2007; Van Der Meer & Belkin, 2010). In addition, soil monitoring by whole cell biosensors that can detect molecules such as galactose, galactoside (Bringhurst, Cardon, & Gage, 2001) or nitrate (DeAngelis, Ji, Firestone, & Lindow, 2005) also provides information on interaction between plants and microbes and the ecology of the rhizosphere for sustainable agricultural development. Genotoxins, chemical compounds that cause harmful damage to DNA, can be detected by the umu-test, which is based on the microbial DNA repair system (Biran et al., 2010). Some quorum-detecting peptides support the attack of colon cancer cells and angiogenesis. Such as QS peptide Phr0662 influences tumour development by EPFR (Epidermal Growth Factor Receptor) (Wynendaele et al., 2015). Additional claim of QS and quorum quenching promotes the construction of transgenic plants that are able to protect themselves against common bacterial pathogens. Bacteria such Photobacterium spp., Photorhabsus sp. and Vibrio sp. exists in soil as well as in water (both fresh and marine) as commensals or pathogens take part in QS system (Kalia, 2018). Bioluminescent microorganisms or their lux system can be applicable as biosensors for detection of water quality, lethality testing, for the discovery of anti-toxin deposits and pathogens in sustenance (Thacharodi, Jeganathan, & Thacharodi, 2019). Until now, many bioluminescent reporter bacteria have been genetically modified by placing a lux gene construct under the control of an inducible promoter (Chatterjee, & Meighen, 1995). Hence, resulting biosensors can be highly constructive in bioremediation studies. Biosensors can be used to determine the presence and concentrations of specific contaminants, as well as to distinguish forms of bioavailable contaminants from those in the environment in inert and unavailable forms. For example, Heitzer, Webb, Thonnard, & Sayler (1992) developed a bioassay to evaluate the bioavailability of salicylate and naphthalene in contaminated soils. They used the genetically modified HK44 Pseudomonas fluorescens bacteria that carried the nah-lux indicator plasmid capable of degrading both salicylate and naphthalene (Nunes-Halldorson & Duran, 2003).

5.3  Pathogen diagnostics and therapeutics Most of the whole cell QS biosensors that have been described so far recognize Gram-negative AHLs (Kumari, Pasini, & Daunert, 2008; Steindler &

Quorum sensing: the microbial linguistic Chapter | 10

245

Venturi, 2007). A cognate promoter and a transcriptional regulator sensitive to AHL are distinctive components of the AHL biosensor that guide the transcription of the reporter gene. It has been recommended to use QS signals as a market gene for the pathogens detection in clinical and environmental samples (Girard et al., 2017). Microbial whole-cell biosensors and gene delivery vehicles are of great interest in cancer therapy. Interestingly, intravenous administration of E. coli, Bifidobacterium longum, and attenuated strains of V. cholerae, Salmonella typhimurium, and L. monocytogenes results in their selective localization to, and proliferation in, mouse solid tumors and metastases (Yazawa, Fujimori, Amano, Kano, & Taniguchi, 2000).

5.4 Biocontrol The rhizosphere is a narrow section of soil that settings at root of plants and is affected by chemicals secreted from roots as well as soil microorganisms in the neighbourhood. QS bacteria forms a vital section of the rhizosphere community. For instance, 24% of the bacteria from wild oat rhizospheres produced AHLs (DeAngelis, Lindow, & Firestone, 2008). AHL secretion has been verified in bacterial isolates fitting to numerous plant related species, mutually constructive (Pseudomonas Rhizobium, and Sinorhizobium,) and pathogenic (Pantoea, Agrobacterium, Erwinia, and Xanthomonas) (Cha, Gao, Chen, Shaw, & Farrand, 1998).

5.5  Prevention of biofouling Biofouling is the growth of bacteria, algae, and animals (such as protozoans and crustaceans) on surfaces that experience prolonged contact with water. Hentzer et al. (2002) have demonstrated that P. aeruginosa cultures treated with a synthetic furanone form thinner biofilms and have reduced expression of the virulence factors elastase and chitinase. This suggests that incorporation of QS inhibitors on the device surface is a viable strategy for reducing P. aeruginosa biofouling of surgical implants. Potentially, QS inhibition can be used to provide protection against various pathogens that rely on QS to initiate biofilm formation.

5.6  Biofilm in wastewater treatment Microbes in biofilms break down the various organic elements and nutrients in wastewater. Biofilm wastewater treatment has various advantages that make biofilms a very beneficial system for the treatment of industrial and domestic wastewater. Biofilm provides a microbe-immobilized surface for effective use of dissolved organic matter. It also protects microbes from sudden environmental stresses such as pH fluctuations and toxins in wastewater. Biofilm wastewater treatment plants require less operational space and can operate at high organic and hydraulic loading rates (Nicolella, Van Loosdrecht, & Heijnen, 2000).

246

Recent Advancements in Microbial Diversity

6 Conclusion There is no doubt that the actual application of quorum sensing research has considerable potential. However, it is important to recognize that the course of scientific exploration is always influenced by the views and suggestions of the scientific community. There are many examples in the fascinating but inaccurate scientific history of functional theory that lead to studies to obscure classrooms. Studying the quorum in complex situations such as biofilms and microbiota of eukaryotic host, knowing how cell-to-cell communication works under realistic conditions, and regulating behavior are essential for understanding how quorum sensing is organized outside the laboratory. Exciting research continues in this direction, not only providing basic information, but also detecting the implications of the research. This book chapter attempts to provide a basic overview of quorum detection and its biotechnological applications. We conclude this book chapter with the guiding thoughts of Dr. Albert Einstein- “The whole of science is nothing more than a refinement of everyday thinking.”

References Abisado, R. G., Benomar, S., Klaus, J. R., Dandekar, A. A., & Chandler, J. R. (2018). Bacterial quorum sensing and microbial community interactions. mBio, 9, 3. doi: 10.1128/mBio.02331-17. Balagaddé, F. K., Song, H., Ozaki, J., Collins, C. H., Barnet, M., Arnold, F. H., et al. (2008). A synthetic Escherichia coli predator–prey ecosystem. Molecular Systems Biology, 4(1). Bang, C., & Schmitz, R. A. (2015). Archaea associated with human surfaces: not to be underestimated. FEMS Microbiology Reviews, 39, 631–648. doi: 10.1093/femsre/fuv010. Bar-On, Y. M., Phillips, R., & Milo, R. (2018). The biomass distribution on Earth. Proceedings of the national academy of sciences, 115, 6506–6511. doi: 10.1073/pnas.1711842115. Bassler, B. L. (1999). How bacteria talk to each other: regulation of gene expression by quorum sensing. Current Opinion in Microbiology, 2, 582–587. doi: 10.1016/s1369-5274(99)00025-9. Bassler, B. L., & Losick, R. (2006). Bacterially Speaking. Cell, 125, 237–246. doi: 10.1016/j. cell.2006.04.001. Battin, T. J., Wille, A., Sattler, B., & Psenner, R. (2001). Phylogenetic and functional heterogeneity of sediment biofilms along environmental gradients in a glacial stream. Applied and Environmental Microbiology, 67, 799–807. doi: 10.1128/aem.67.2.799-807.2001. Biran, A., Yagur-Kroll, S., Pedahzur, R., Buchinger, S., Reifferscheid, G., Ben-Yoav, H., et al. (2010). Bacterial genotoxicity bioreporters. Microbial Biotechnology, 3(4), 412–427. Bleich, H. L., Moore, M. J., Roth, J., LeRoith, D., Shiloach, J., Rosenzweig, J. L., et al. (1982). The evolutionary origins of hormones, neurotransmitters, and other extracellular chemical messengers. New England Journal of Medicine, 306, 523–527. doi: 10.1056/nejm198203043060907. Bringhurst, R. M., Cardon, Z. G., & Gage, D. J. (2001). Galactosides in the rhizosphere: utilization by Sinorhizobium meliloti and development of a biosensor. Proceedings of the national academy of sciences, 98(8), 4540–4545. Cha, C., Gao, P., Chen, Y. C., Shaw, P. D., & Farrand, S. K. (1998). Production of acyl-homoserine lactone quorum-sensing signals by gram-negative plant-associated bacteria. Molecular PlantMicrobe Interactions, 11(11), 1119–1129. Characklis, W. G. (1973). Attached microbial growths—I. Attachment and growth. Water Research, 7, 1113–1127. doi: 10.1016/0043-1354(73)90066-3.

Quorum sensing: the microbial linguistic Chapter | 10

247

Chatterjee, J., & Meighen, E. A. (1995). Biotechnological applications of bacterial bioluminescence (lux) genes. Photochemistry and Photobiology, 62(4), 641–650. Costerton, J. W., Lewandowski, Z., Caldwell, D. E., Korber, D. R., & Lappin-Scott, H. M. (1995). Microbial biofilms. Annual Review of Microbiology, 49, 711–745. doi: 10.1146/annurev. mi.49.100195.003431. Couradeau, E., Benzerara, K., Moreira, D., Gérard, E., Kaźmierczak, J., Tavera, R., et al. (2011). Prokaryotic and eukaryotic community structure in field and cultured microbialites from the alkaline Lake Alchichica (Mexico). PloS One, 6(12), e28767. DeAngelis, K. M., Ji, P., Firestone, M. K., & Lindow, S. E. (2005). Two novel bacterial biosensors for detection of nitrate availability in the rhizosphere. Applied and Environmental Microbiology, 71(12), 8537–8547. DeAngelis, K. M., Lindow, S. E., & Firestone, M. K. (2008). Bacterial quorum sensing and nitrogen cycling in rhizosphere soil. FEMS Microbiology Ecology, 66(2), 197–207. Dridi, B., Henry, M., El Khéchine, A., Raoult, D., & Drancourt, M. (2009). High prevalence of Methanobrevibacter smithii and Methanosphaera stadtmanae detected in the human gut using an improved DNA detection protocol. PloS One, 4(9), e7063. Dridi, B., Raoult, D., & Drancourt, M. (2011). Archaea as emerging organisms in complex human microbiomes. Anaerobe, 17, 56–63. doi: 10.1016/j.anaerobe.2011.03.001. Edwards, K. J. (2000). An archaeal iron-oxidizing extreme acidophile important in acid mine drainage. Science, 287, 1796–1799. doi: 10.1126/science.287.5459.1796. Evans, A. S. (1993). Limitations of the Henle—Koch postulates. Causation and Disease, 123–146. doi: 10.1007/978-1-4615-3024-4_7. Faveri, M., Gonçalves, L. F. H., Feres, M., Figueiredo, L. C., Gouveia, L. A., Shibli, J. A., et al. (2011). Prevalence and microbiological diversity of Archaea in peri-implantitis subjects by 16S ribosomal RNA clonal analysis. Journal of Periodontal Research, 46(3), 338–344. Ferreira, P., Hemerly, A., Van Montagu, M., & Inzé, D. (1994). Control of cell proliferation during plant development. Plant Molecular Biology, 26, 1289–1303. doi: 10.1007/bf00016475. Flemming, H. -C., & Wingender, J. (2010). The biofilm matrix. Nature Reviews Microbiology, 8, 623–633. doi: 10.1038/nrmicro2415. Flemming, H. -C., & Wuertz, S. (2019). Bacteria and archaea on earth and their abundance in biofilms. Nature Reviews. Microbiology, 17(4), 247–260. Flemming, H. -C., Wingender, J., Szewzyk, U., Steinberg, P., Rice, S. A., & Kjelleberg, S. (2016). Biofilms: an emergent form of bacterial life. Nature Reviews Microbiology, 14, 563–575. doi: 10.1038/nrmicro.2016.94. Fletcher, M., & Floodgate, G. D. (1973). An electron-microscopic demonstration of an acidic polysaccharide involved in the adhesion of a marine bacterium to solid surfaces. Journal of General Microbiology, 74, 325–334. doi: 10.1099/00221287-74-2-325. Fuqua, C., Winans, S. C., & Peter Greenberg, E. (1996). Census and consensus in bacterial ecosystems: The LuxR-LuxI family of quorum-sensing transcriptional regulators. Annual Review of Microbiology, 50, 727–751. doi: 10.1146/annurev.micro.50.1.727. Fuqua, W. C., Winans, S. C., & Greenberg, E. P. (1994). Quorum sensing in bacteria: the LuxRLuxI family of cell density-responsive transcriptional regulators. Journal of Bacteriology, 176, 269–275. doi: 10.1128/jb.176.2.269-275.1994. Geesey, G. G., Mutch, R., Costerton, J. W., & Green, R. B. (1978). Sessile bacteria: An important component of the microbial population in small mountain streams 1. Limnology and Oceanography, 23, 1214–1223. doi: 10.4319/lo.1978.23.6.1214. Girard, L., Blanchet, É., Intertaglia, L., Baudart, J., Stien, D., Suzuki, M., et al. (2017). Characterization of N-acyl homoserine lactones in Vibrio tasmaniensis LGP32 by a biosensor-based UHPLC-HRMS/MS method. Sensors, 17(4), 906.

248

Recent Advancements in Microbial Diversity

Grandclement, C., Tannieres, M., Morera, S., Dessaux, Y., & Faure, D. (2015). Quorum quenching: role in nature and applied developments. FEMS Microbiology Reviews, 40(1), 86–116. Heitzer, A., Webb, O. F., Thonnard, J. E., & Sayler, G. S. (1992). Specific and quantitative assessment of naphthalene and salicylate bioavailability by using a bioluminescent catabolic reporter bacterium. Applied and Environmental Microbiology, 58(6), 1839–1846. Hentzer, M., Riedel, K., Rasmussen, T. B., Heydorn, A., Andersen, J. B., Parsek, M. R., et al. (2002). Inhibition of quorum sensing in Pseudomonas aeruginosa biofilm bacteria by a halogenated furanone compound. Microbiology, 148, 87–102. Justice, N. B., Pan, C., Mueller, R., Spaulding, S. E., Shah, V., Sun, C. L., et al. (2012). Heterotrophic archaea contribute to carbon cycling in low-ph, suboxic biofilm communities. Applied and Environmental Microbiology, 78, 8321–8330. doi: 10.1128/aem.01938-12. Kalia, V.C. (2014). Quorum sensing vs quorum quenching: A battle with no end in sight. Springer. Kalia, V.C. (Ed.). (2018). Quorum sensing and its biotechnological applications. Springer. Kalia, V. C., Prakash, J., Koul, S., & Ray, S. (2018). Quorum sensing and its inhibition: Biotechnological applications. Quorum Sensing and Its Biotechnological Applications, 3–16. doi: 10.1007/978-981-13-0848-2_1. Kievit, T. R. de, de Kievit, T. R., & Iglewski, B. H. (2000). Bacterial quorum sensing in pathogenic relationships. Infection and Immunity, 68, 4839–4849. doi: 10.1128/iai.68.9.4839-4849.2000. Kleerebezem, M., Quadri, L. E. N., Kuipers, O. P., & De Vos, W. M. (1997). Quorum sensing by peptide pheromones and two-component signal-transduction systems in Gram-positive bacteria. Molecular Microbiology, 24, 895–904. doi: 10.1046/j.1365-2958.1997.4251782.x. Kobayashi, H., Kaern, M., Araki, M., Chung, K., Gardner, T. S., Cantor, C. R., et al. (2004). Programmable cells: interfacing natural and engineered gene networks. Proceedings of the National Academy of Sciences, 101(22), 8414–8419. Koerdt, A., Gödeke, J., Berger, J., Thormann, K. M., & Albers, S. -V. (2010). Crenarchaeal biofilm formation under extreme conditions. PloS One, 5(11), e14104. Kumari, A., Pasini, P., & Daunert, S. (2008). Detection of bacterial quorum sensing N-acyl homoserine lactones in clinical samples. Analytical and Bioanalytical Chemistry, 391(5), 1619–1627. Lagier, J. -C., Million, M., Hugon, P., Armougom, F., & Raoult, D. (2012). Human gut microbiota: repertoire and variations. Frontiers in Cellular and Infection Microbiology, 2, 136. Lapaglia, C., & Hartzell, P. L. (1997). Stress-induced production of biofilm in the hyperthermophile Archaeoglobus fulgidus. Applied and Environmental Microbiology, 63(8), 3158–3163. Liao, Y., Williams, T. J., Ye, J., Charlesworth, J., Burns, B. P., Poljak, A., et al. (2016). Morphological and proteomic analysis of biofilms from the Antarctic archaeon, Halorubrum lacusprofundi. Scientific Reports, 6, 37454. Lindow, S. E., & Brandl, M. T. (2003). Microbiology of the phyllosphere. Applied and Environmental Microbiology, 69(4), 1875–1883. Magnabosco, C. -H., Lin, L., Dong, H., Bomberg, M., Ghiorse, W., Stan-Lotter, H., et al. (2018). The biomass and biodiversity of the continental subsurface. Nature Geoscience, 11, 707–717. doi: 10.1038/s41561-018-0221-6. Marshall, K. C., Stout, R., & Mitchell, R. (1971). Mechanism of the initial events in the sorption of marine bacteria to surfaces. Journal of General Microbiology, 68, 337–348. doi: 10.1099/00221287-68-3-337. McNeil, N. I. (1984). The contribution of the large intestine to energy supplies in man. The American Journal of Clinical Nutrition, 39, 338–342. doi: 10.1093/ajcn/39.2.338. Megaw, J., & Gilmore, B. F. (2017). Archaeal persisters: persister cell formation as a stress response in. Frontiers in Microbiology, 8, 1589.

Quorum sensing: the microbial linguistic Chapter | 10

249

Miller, M. B., & Bassler, B. L. (2001). Quorum sensing in bacteria. Annual Review of Microbiology, 55, 165–199. doi: 10.1146/annurev.micro.55.1.165. Msadek, T., Kunst, F., & Rapoport, G. (1993). Two-component regulatory systems. In Bacillus subtilis and other gram-positive bacteria. American Society of Microbiology, pp. 729-745. Mukherjee, S., & Bassler, B. L. (2019). Bacterial quorum sensing in complex and dynamically changing environments. Nature Reviews Microbiology, 17(6), 371–382. Nicolella, C., Van Loosdrecht, M. C. M., & Heijnen, J. J. (2000). Wastewater treatment with particulate biofilm reactors. Journal of Biotechnology, 80(1), 1–33. Nunes-Halldorson, V. D. S., & Duran, N. L. (2003). Bioluminescent bacteria: lux genes as environmental biosensors. Brazilian Journal of Microbiology, 34(2), 91–96. Offre, P., Spang, A., & Schleper, C. (2013). Archaea in biogeochemical cycles. Annual Review of Microbiology, 67, 437–457. Parsek, M. R., & Greenberg, E. P. (2000). Acyl-homoserine lactone quorum sensing in Gram-negative bacteria: A signaling mechanism involved in associations with higher organisms. Proceedings of the National Academy of Sciences, 97, 8789–8793. doi: 10.1073/pnas.97.16.8789. Probst, A. J., Auerbach, A. K., & Moissl-Eichinger, C. (2013). Archaea on human skin. PloS One, 8(6), e65388. Purnick, P. E., & Weiss, R. (2009). The second wave of synthetic biology: from modules to systems. Nature Reviews Molecular Cell Biology, 10(6), 410. Qin, J., Li, R., Raes, J., Arumugam, M., Burgdorf, K. S., Manichanh, C., et al. (2010). A human gut microbial gene catalogue established by metagenomic sequencing. Nature, 464(7285), 59–65. Renella, G., & Giagnoni, L. (2016). Light dazzles from the black box: whole-cell biosensors are ready to inform on fundamental soil biological processes. Chemical and Biological Technologies in Agriculture, 3(1), 8. Septic Shock. (n.d.). Retrieved October 15, 2019, from http://www2.hawaii.edu/∼johnb/micro/ m130/readings/SepticShock.htm. Sifri, C. D. (2008). Healthcare epidemiology: quorum sensing: bacteria talk sense. Clinical Infectious Diseases: An Official Publication of the Infectious Diseases Society of America, 47(8), 1070–1076. Steindler, L., & Venturi, V. (2007). Detection of quorum-sensing N-acyl homoserine lactone signal molecules by bacterial biosensors. FEMS Microbiology Letters, 266(1), 1–9. Stoodley, P., Sauer, K., Davies, D. G., & Costerton, J. W. (2002). Biofilms as complex differentiated communities. Annual Review of Microbiology, 56, 187–209. doi: 10.1146/annurev.micro.56.012302.160705. Thacharodi, A., Jeganathan, C., & Thacharodi, D. (2019). Biomonitoring of heavy metal pollution by bioluminescent bacterial biosensors. Indian Journal of Science and Technology, 12, 15. Turovskiy, Y., Kashtanov, D., Paskhover, B., & Chikindas, M. L. (2007). Quorum sensing: fact, fiction, and everything in between. Advances in Applied Microbiology, 62, 191–234. Van Der Meer, J. R., & Belkin, S. (2010). Where microbiology meets microengineering: design and applications of reporter bacteria. Nature Reviews Microbiology, 8(7), 511. van Wolferen, M., Orell, A., & Albers, S. -V. (2018). Archaeal biofilm formation. Nature Reviews Microbiology, 16, 699–713. doi: 10.1038/s41579-018-0058-4. Webster, N. S., & Negri, A. P. (2006). Site-specific variation in Antarctic marine biofilms established on artificial surfaces. Environmental Microbiology, 8, 1177–1190. doi: 10.1111/j.14622920.2006.01007.x. Wegener, G., Krukenberg, V., Riedel, D., Tegetmeyer, H. E., & Boetius, A. (2015). Intercellular wiring enables electron transfer between methanotrophic archaea and bacteria. Nature, 526(7574), 587–590.

250

Recent Advancements in Microbial Diversity

Wexler, H. M. (2007). Bacteroides: the good, the bad, and the nitty-gritty. Clinical Microbiology Reviews, 20, 593–621. doi: 10.1128/cmr.00008-07. Wynendaele, E., Verbeke, F., D’Hondt, M., Hendrix, A., Van De Wiele, C., Burvenich, C., et al. (2015). Crosstalk between the microbiome and cancer cells by quorum sensing peptides. Peptides, 64, 40–48. Yagi, K. (2007). Applications of whole-cell bacterial sensors in biotechnology and environmental science. Applied Microbiology and Biotechnology, 73(6), 1251–1258. Yazawa, K., Fujimori, M., Amano, J., Kano, Y., & Taniguchi, S. I. (2000). Bifidobacterium longum as a delivery system for cancer gene therapy: selective localization and growth in hypoxic tumors. Cancer Gene Therapy, 7(2), 269. Zobell, C. E. (1943). The effect of solid surfaces upon bacterial activity. Journal of Bacteriology, 46(1), 39–56.

Chapter 11

Exploration of microbial communities of Indian hot springs and their potential biotechnological applications Sneha Bhandari and Tapan Kumar Nailwal Department of Biotechnology, Kumaun University Nainital, Bhimtal Campus, Bhimtal, Uttarakhand, India

1 Introduction According to scientific reports, the Earth was formed about 4.5 billion years ago as a result of a massive big bang event. It took around 3.5 billion years for life to begin on Earth in the form of primitive single cell microorganisms. With time, these small microscopic biological entities have evolved and diversified with respect to their surrounding environment, so that they adapted to diverse habitat on the globe. Microorganisms are small microscopic living cells which exist either as single-cells or as colony clusters. They are omnipresent, from geothermal vents in lands, hydrothermal vents in oceans, dark caves; high mountains to deep coldest marine regions. Owing to their miscellaneous metabolic activities, these cellular microorganisms have diversified. Among all micro-creatures, archaea and bacteria are the oldest single-celled organisms. Localized environment led to the alteration in cellular metabolic processes and thus the formation of extremophiles occurred (Davies et al., 2007; Fardeau et al., 1997). These extremophiles inhabit and thrive in hot niches, ice, high-salt solutions, acid and alkaline conditions, sometimes they survive in heavy metals, toxic wastes which were initially assessed to be inhospitable for life sustenance. Extremophiles are categorized under the environment they populate: thermophiles (organisms which can tolerate elevated temperature ranges), psychrophiles (organisms which can survive in colder temperatures), halophiles (which are capable of tolerating high-salt concentrations), acidophiles and alkaliphiles (organisms well adapted to extreme acid and alkaline conditions, respectively), barophiles (organisms which survive elevated pressure) (Paul et al., 2012; Recent Advancements in Microbial Diversity. http://dx.doi.org/10.1016/B978-0-12-821265-3.00011-6 Copyright © 2020 Elsevier Inc. All rights reserved.

251

252

Recent Advancements in Microbial Diversity

Rampelotto, 2013). Thermophiles are one of the most important groups of extremophiles discovered so far. These microbial communities are found in various parts of the world such as geothermally heated regions and terrestrial volcanic sites like hot springs, subterranean sites such as oil reservoirs, and solar-heated surface soils (Canganella & Wiegel, 2014) or hydrothermal vents in deep oceans. After the mid-19th century many biologists like botanist Ferdinand Cohn in 1862, biochemist Hoppe-Seyler in1875, keenly surveyed micro-biotas sustaining in thermal springs. Simultaneously it was also found that the water of geothermal springs had medical and curative properties (Vouk, 1950). Hot springs are present in various locations around the world. India harbors many hot springs in different states. Locations include the magnificent Indian Himalayan Region (IHR) in northern region, various states in central, eastern, western, and southern regions of Indian peninsula. Thermophilic extremophiles have drawn a lot of attention due to the production of industrially active components such as lipases, proteases, and polymer degrading enzymes, such as chitinases, cellulases, and amylases (Panda, Sahu, & Tayung, 2013; Gupta, Gupta, Capalash, & Sharma, 2017). Thermo-stability of these enzymes at elevated temperatures makes them advantageous for their production commercially. Solubility of various components in a reaction mixture significantly increases at higher temperatures. Additionally, at elevated temperatures, contamination risks are also reduced (Soy, Nigam, & Sharma, 2019). Water at elevated temperatures holds more dissolved solids as compared to cold water. Therefore, thermal springs generally have an elevated concentrations of minerals like calcium, lithium, and radium. These naturally heated springs are also popular as a tourist destination. Traditional beliefs and proclaimed curative value of some hot springs have made them rehabilitation clinics for a person with disabilities.

2  Hot springs: formation and distribution 2.1 Formation Hot springs are also termed as thermal springs/ geothermal springs. There are several mechanisms through which a hot spring may be formed. Deep below the Earth’s surface, the magma heats the rock up, when the rain or groundwater percolates the Earth’s surface and reaches these heated rocks, formation of hot springs occurs. Regions which have volcanic activity have these kinds of hot springs. Due to heating process, water becomes buoyant and viscid and thus searches for crevices and fissures to escape the Earth’s surface. Deep beneath the Earth’s surface, when there are no routes available to hot water to break out, hence pressurized steam starts forming in pooling chambers, which ultimately leads to formation of geyser (Van Middlesworth & Wood, 1998). Another mechanism for thermal spring formation is when water percolates the ground and gets heated up by radioactive decay of elements present in rock sand soils that it flows through. Radioactive decay of elements present in the

Exploration of microbial communities of Indian hot springs Chapter | 11

253

mantle constitutes 45%–90% of heat escaping from the Earth (Wheeler, 2005; Middlesworth & Wood, 1998). Some of the crucial heat- producing element isotopes are uranium-235, potassium-40, thorium-232, and uranium-238 (Khoonphunnarai et al., 2018). For every 305 meters the water travels down, it gets heated up to additional of 10–15°F. Hot water comes out from cracks and crevices of the Earth’s surface after becoming viscous and buoyant. After reaching the Earth’s surface water may flow at a slow pace, percolating into a still pool, or rapidly converting into a small river. Much like a geyser, hot springs often release massive amounts of pressure.

2.2 Distribution Geothermal springs are located throughout the world in many countries from snowy mountainous regions to tropics. Nations which are renowned for their hot springs are Hungary, New Zealand, Canada, Fiji, Honduras, Iceland, Romania, Chile, Japan, Costa Rica, Turkey, Israel, India, and the United States. Although there are numerous hot springs present, some of the most significant are as follow: Grand Prismatic spring: Yellowstone National Park situated in Wyoming, Montana, and Idaho, is an American Park. This park was established by U.S. Congress on March 1, 1872. It is the largest thermal spring present on the Earth with a depth of around 160 feet and width 300 feet. This spring has magnificent beauty due to its prismatic color effect in center blue colored, which changes to green, yellow, orange, and red covering the boundary just like a rainbow. Due to the existence of various algal and thermophilic microorganisms, this kind of coloration occurs in this spring. It is not only the hot spring which makes this national park a valuable asset but there also exist several exotic floras and fauna species that exist there. The most miraculous discovery found out was Thermus aquaticus, a thermophilic bacterium which produces an enzyme called Taq DNA polymerase, serving as a crucial constituent of PCR. Arkansas hot springs: This hot spring is situated in the city of Arkansas, Ouachita Mountains in the United States. Arkansas is an appellation due to the presence of 47 thermal water springs. About 38 lakhs of water at 62°C flows daily from the springs (Bedinger, Pearson, Reed, Sniegocki, & Stone, 1979). Radiocarbon dating has suggested that spring water which reaches its surface fell as rainfall 4,400 years earlier (Warner et al., 2013). Arkansas is well-known for its bathhouse rows, hot spring National Park and Arkansas Alligator Farm and Petting Zoo. Blood pond: This spectacular hot spring blood pond is named Chinoike Jigoku which means “Bloody hell pond,” situated in Beppu, Japan. Its extraordinary blood coloration is due to acidic iron and magnesium-filled clay oozing from the ground. This coloration alters from season to season,

254

Recent Advancements in Microbial Diversity

that is, in summers, it turns to orange-red while in cloudy weather it shows deep red color. Due to its elevated temperature of 78°C, peoples are not permitted to take a dip. But still, visitors visit this exotic blood pond and also take ointment made up of its clay to treat skin disease. Blue Lagoon: One of the favorite’s tourism spots among tourists is the geothermal spa of Blue Lagoon situated in south-western Iceland. The temperature of the water is around 40°C which is quite enjoyable for tourists for bathing and swimming year-round. Due to high content of silica water appears milky blue shade in color. As the water and mud are rich in silica and minerals, bathers rub this soft white mud on to their skin as its thought to cure skin diseases (Olafsson, 1996). Jigokudani Monkey Park: This monkey park is a part of Joshinetsu Kogen National Park (locally known as Shigakogen), located in Yamanouchi, Nagano Prefecture, Japan. Due to steaming hot boiling water coming out of the fissures of frozen ground, this place is named so, Jigokudani, means “Hell’s Valley.” This place is popular due to large population of wild Japanese macaques (Macaca fuscata), snow monkeys, and often called snow monkeys. To maintain homeostasis, these monkeys’ sojourn in warm waters of onsen (thermal spring) in the day time and return back to steep cliffs and forest in the evenings. Hammam Maskhoutine: It is a thermal complex which means “bath of the damned” used to refer group of hot springs, located in Hammam Debagh, Algeria. There are in total of 10 different thermal springs present in this valley. Water temperature in the spring is so hot (98°C) that one can literally boil eggs in channels outflow. Thermal complex water has a flow rate of 1,00,000 L per minute. Iron and calcium carbonate are the main salts present in the water. Heat along with theses minerals are considered to have therapeutic value for persons having complains of rheumatism and arthritis (Scheffel & Wernert, 1980). Apart from these hot springs, there are still many springs located in many places around the world. Large-scale studies and surveying has been done and massive amounts of data have been collected about thermal springs of different parts of the world. There is also a huge collection of data regarding microbial diversity in these hot springs. However, little work has been done on Indian thermal springs and its ecology in terms of microbial communities. It is not a new fact that hot springs nurture many thermophilic and hyper thermophilic microbial communities which are of industrial importance, as India is one the countries with several thermal springs, thus a detailed study of Indian thermal springs and their microbial species is quite crucial. The present chapter focuses on detailed analysis of major hot springs of India, their microbial diversification, their adaptations to extreme high-temperature ranges, together with the production of biologically active molecules and their potential applications.

Exploration of microbial communities of Indian hot springs Chapter | 11

255

3  India: a hot spring hub According to collected information, there are round about 400 hot springs (Zimik, Farooq, & Prusty, 2017) which have been discovered either as an individual or as a cluster (Verma, Dhiman, Gupta, & Shirkot, 2015a; Mangrola, Dudhagara, Koringa, Joshi, & Patel, 2015a). Geothermal springs are mainly of non-volcanic origin in the Indian subcontinent and have temperature ranges of 30–100°C. They generally prevail in groups adjacent to certain major tectonic trends, continental boundaries and fissured structures. After 1973–74, meticulous exploration and investigation program series were conducted in order to find out the geothermal ability of the nation. Organizations such as The Geological Survey of India and The National Geophysical Research Institute (NGRI) were two important pillars which together carried out research on geothermal springs of India. In current scenario, central and northern departments of The Geological Survey of India are immensely engaged in exploration research (Pandey & Negi, 1995). Major breakthrough came when Schlagintweit began (1865) studies on geothermal status of India in 1864. He recorded 99 hot springs all over the nation.Three hundred thermal springs were documented in an inventory published by Oldham (1888) in India (Bisht, Das, & Tripathy, 2011). Thermal springs are found in almost every state of India. On account of geo-tectonic structures, these hot springs of India are categorized into six geothermal territories (Sharma, 2010): 1. Himalayan region:

Several hot springs were identified in Himalayan Province. Respective to elevation, many were found out at boiling temperature. In the north western Himalayas, thermal activity is robust neighboring to Indus - Tsungbo Suture Zone. Water temperature gradients exceeding 100°C / km and heat flow in excess of 200 mW/m2 in these hot springs. Temperature gradient of 60°C ± 20°C/ km and heat flow values of 130 ± 30 mW/ m2are most common parameters of hot springs of Alaknanda valley, Parbati valley and Sutlej valley. A temperature gradient of 17°C ± 5°C and low heat flow values of 41 ± 10 mW/m2 prevail in the foothill belts of Himalayas. Adjoining the outer Himalayan margin, lukewarm hot springs with lowered temperature are normally located. 2. Aravalli belt, Naga-Lushi, west coast Maharashtrian regions, and SonNarmada lineament: In Aravalli belt, heat flux is of 100 ± 25 mW/m2 while the temperature gradient is of 41°C ± 100°C/km. Features of Naga-Lushi hill ranges in north-eastern Indian province has similarity with that of the north-western Himalayan foothills. Strings of thermal springs located in the west coast of Maharashtra region were investigated thoroughly. This region manifests seismicity, increased gravity with temperature gradients and heat flux value ranges in 55°C ± 5°C/km and 130 ± 10 mW/m2. In the province of Narmada-Tapti (central region of the nation), a huge number of thermal springs have been

256

Recent Advancements in Microbial Diversity

discovered. These have temperature gradients from 40 to 120°C/km while heat flux value ranges from 70 to 300 mW/m2 (Joga Rao, Rao, Midha, Padmanabhan, & Kasavamani, 1989). 3. Volcanic arc of Andaman and Nicobar Island: Various tertiary hilly ranges with quaternary mud volcanism are present on this island. Several thermal springs with different temperature ranges of more than 200°C are present in the neighborhood of active volcanoes (Shanker, 1991). There is a good opportunity for geothermal energy generation in this region. 4. Cambay basin of Gujarat: Cambay Graben Region, a deep sedimentary tertiary aged basin is 200 km long with a width of 50km. These regions have down faulted areas with seismic activity zones and plutonism. There occurs a modest heat flow of 75 ± 18 mW/ m2 with temperature gradients of 40°C ± 15°C / km. Oil wells at a depth of 1.7 km and 1.9 km have the bottom hole temperature range of 100°C to 145°C. At depths ranging from 1.5 km to 3.4 km steam blowouts are also documented in some oil wells. Neo-tectonic activity is found in the thermal wells of northeastern- southwestern ridges of Rajasthan and Haryana province. 5. Radioactive territory (Surajkund, Hazaribagh, Jharkhand): Radioactive Uranium and radium deposits are present in Hazaribagh, due to water leaching from radioactive mines of Tatanagar. Because of this reason, many thermal springs in Hazaribagh, like Surajkund have high content of radioactivity. Apart from radioactive elements, Surajkund hot spring is particularly rich in sulphur. This thermal spring is considered to be the hottest spring in India with a recorded temperature of 87°C on surface while 165°C at subsurface (Soy et al., 2019). 6. Southern Indian peninsular Cratonic region: In southern India, Bendru Theertha (means boiled water) according to the Archaeological Survey of India (ASI) is the only natural hot spring found in Karnataka. It is considered as holy according to Hindu beliefs. People believe that it is auspicious to take holy bathe every year on the occasion of Teertha Amavasya day as the pious water has the power to heal skin diseases like eczema, allergic rashes etc. This hot spring has temperature ranges between 37°C and 41°C. Unlike Himalayan foothills which generally have steaming hot springs, Bendru Theertha has lukewarm water. One distinctive feature about this spring is its location which is a non-volcanic one. It is assumed that underground water gets heated up by the geothermal energy of hot rocks there. Hot water density is less when compared to normal water, thus hot water comes out in the form of spring. As hot springs have temperature near or at boiling point, therefore microbial communities here are in general thermophilic or hyperthermophilic and diversified phylogenetically including bacteria, viruses and archaea. In India, analysis of microbial diversity was started in century 20th when thermal species were detailed by Drouet (1938). Algal micro-flora of Vajreshwari

Exploration of microbial communities of Indian hot springs Chapter | 11

257

(near Bombay) thermal spring was identified and studied (Gonzalves, 1947). Similarly, algal flora was also studied in hot springs of various locations such as Aravali, Lasundra, Ganeshpuri, Akloli, Unapdeo, Tooral, Unai, Sav, Rajewadi, Palli (Thomas & Gonzalves, 1965).

4  Microbial diversity of Indian hot springs Initially, pioneer scientists like Robert Koch and Louis Pasteur played a pivotal role in the field of microbiology by isolating microorganisms in culture-dependent fashion. Due to this culture-dependent method, exploration of microorganisms was done for potential biotechnological practices moreover it also opened way for discovery of novel isolates for future studies (Kumar, Yadav, Tiwari, Prasanna, & Saxena, 2014a; Piterina & Pembroke, 2010), Miquel (1888), first noticed the capability of microorganisms growing at high temperatures. It is believed that maximum temperature growth and survival limit for nonphotosynthetic prokaryotes is 121°C (Kashefi & Lovley, 2003). In general, photosynthetic prokaryotes are at such extreme temperature and normally show the upper range of 70–72°C. These thermophilic prokaryotes are not new to world, in fact, they have been known for over 90 years, while three decades ago hyperthermophilic prokaryotic microorganisms have been documented (Brock, 1978; Stetter et al., 1981; Zillig et al., 1981). Only a few species of fungi in eukaryotic microorganisms’ category can survive the upper temperature limit of 60–62°C (Tansey and Brock, 1978), while there is a slight variation of temperature range of eukaryotic algae and protozoa which is 55–60°C. To survive such extreme temperature, thermophiles have developed certain molecular mechanisms described briefly in Fig. 11.1. Marsh and Larsen (1953) discovered and isolated heat-loving bacteria from Yellowstone National Park via culture-dependent method led to microbial inhabitant studies of hot springs. After that, scientists all around the world started to explore and study the dynamic microbial diversity of thermal springs based on culture-dependent method. For exploring bacterial diversity in thermal springs, several approaches and techniques have been developed. Primarily, these approaches were categorized into two groups, that is culture-dependent and culture-independent approaches. Conventionally, culture-dependent techniques were utilized for isolating premium strains and investigating their properties (Jia, Liu, Daroch, Geng, & Cheng, 2014; Daroch, Shao, Liu, Geng, & Cheng, 2013). Many thermophiles have been isolated and characterized by this method and provide practical importance because isolated strains can have potential biotechnological applications with respect to biomolecules production (Li, Liu, Cheng, Mos, & Daroch, 2015). However, greater numbers of micro-biotas are non-cultivable which makes this technique disadvantageous for them. To avoid this hurdle, culture-independent techniques were designed which basically involved molecular methods to characterise microbial diversity of hot springs

258

Recent Advancements in Microbial Diversity

FIGURE 11.1  Adaptations in thermophiles during high temperature environment.

phylogenetically. Some of the prominent approaches include 16S rRNA gene amplification, cloning, denaturing gradient gel electrophoresis (Ferris, Muyzer, & Ward, 1996), amplified ribosomal DNA restriction analysis (ARDRA) (Kikani, Sharma, & Singh, 2015), random amplified polymorphic DNA (RAPD) (Lepage et al., 2004) and differentiation using amplified fragment length polymorphism (AFLP) (Davies et al., 2007). Apart from these, various other fused techniques have also been used for studying microbial communities such as PCR-sequencingbased approaches (Zhang et al., 2018a) and Scanning Electron Microscopy united with community level physiological profiles (CLPPs) (Zhang et al., 2018b).

4.1  Microbial diversity analysis via culture-dependent method from Indian hot springs An analytical study of microbial communities has been done using culturedependent method for hot springs of several states in India. When detailed microbiological diversity of thermal springs of Himachal Pradesh (Vashist, Tattapani and Manikaran) were carried out, a total of 101 microbial isolates were identified; among them, two were found out to be fungi and remaining all were bacteria. It was analyzed that the major groups of bacteria were rod shaped while the rest were either coccus or coccobacillus. These microbial isolates can thrive the temperature 50°C and above. Four isolates showed Gram-negative behavior. By series of chemical reactions, it was found out that these microorganisms

Exploration of microbial communities of Indian hot springs Chapter | 11

259

have potential of producing industrially important enzymes like xylanases, cellulases, and amylases (Sharma, Vyas, & Pathania, 2013a). Serial dilution and other chemical tests were carried out from the soil samples of two thermal springs; Ringigad and Soldhar (of Garhwal region of Uttarakhand Himalayas). For microbial growth, different nutrient medium such as potato dextrose agar, thiosulfate agar, Pikovskaya medium, tryptone-yeast extract agar, sulfate-reducing medium, actinomycetes isolation agar, sulfur medium and were used. In case of Soldhar hot spring, actinomycetes isolation agar provided the highest aerobic bacterial colony-forming unit (CFU), i.e. 50CFU × 104 g −1, while for Ringigad hot spring; tryptone-yeast extract agar gave highest bacterial CFU of 49CFU × 104 g −1. Soldhar hot springs had higher anaerobic CFU when compared to Ringigad hot spring. Major identified groups were of Bacillus origin with endospores, which is why these were able to stand firm against such high temperatures. Mineral composition of these two hot springs also varied a lot. Ringigad hot spring contains higher amounts of phosphate and absence of Cu while Soldhar hot spring major has amounts Mn, Cu, and Fe (Kumar, Trivedi, Mishra, Pandey, & Palni, 2004). Microbial communities of thermal springs of Odisha (Taptapani, Tarobalo and Atri) were isolated using culture- dependent method and it was found to harbor 48 isolates. In general, families like Enterobacteriaceae, Planococcaceae, Bacillaceae, Pseudomonadaceae, and Paenibacillaceae were prominent. Optimum temperature ranged from 37°C to 50°C wherein Bacillus was most prevalent in all three water springs, but these locations did not have much overlapping when it came to genus. For instance, genus Klebsiella was isolated from Taptapani, but not found in Atri and Tarobalo. In Atri, genus Kurthia was dominant but not in Tarobalo and Taptapani. The genus Brevibacillus was predominant in Atri and Tarobalo but absent in Taptapani (Sen & Maiti, 2014). When we look at microbial diversity of Maharashtrian hot springs (Vajreshwari and Ganeshpuri), which generally have the temperature range of 40–65°C, a total of 73 bacterial isolates were discovered. Out of which, 65 were Eubacteria and the rest 8 were Actinobacteria. They were isolated on soybean casein digest agar and actinomycetes isolation agar medium. Ganeshpuri harbors 27, while 46 bacteria were identified from Vajreshwari. Ganeshpuri thermal spring consisting of 8 rods, 4 coccobacilli Gram-negative bacteria and 8 cocci and 13 rod-shaped Gram- positive bacteria were discovered. A total of 7 rods, 5 coccobacilli-shaped Gram-negative bacteria and 11 rod and 19 cocci Gram-positive bacteria were isolated; rest were Actinobacteria. In Unkeshwar (Maharashtrian hot spring) in Nanded district, ten bacterial isolates were identified, out of which three belonged to class Gammaproteobacteria and seven belonged to class Firmicutes. There were six Gram-positive isolates out of which five were spore formers; three were Gram-negative while one was Gram inconsistent. Important biologically active constituents such as urease, oxidase, lipase, caseinase, gelatinase and amylase were produced by this microbial diversity (Pathak & Rathod, 2015). Apart from being a rich source of bioactive molecules produced via microbial communities, hot springs of India also serve

260

Recent Advancements in Microbial Diversity

as crucial habitat for novel isolates. Many supreme genera and species have been identified and explored from various hot springs of India as enlisted in Table 11.1.

4.2  Microbial diversity analysis via culture-independent method from Indian hot springs Hot springs not only harbor thermophilic microorganisms but also sustain photosynthetic bacteria, heterotrophs, and autotrophs, thus confirming a wellbalanced nutritive interaction among micro-biota. The main drawback of culture-dependent method for microbial diversity investigation is that majority of microorganisms are strenuous to culture due to lack of vital nutrients or other optimal environmental parameters such as temperature, pH, humidity, and necessary gases for survival. As aerobic and anaerobic microbes culture requirements are different so there comes limiting information at genomic and phenotypic level, since most of the organisms remain unknown or unidentified (Kumar, Yadav, Tiwari, Prasanna, & Saxena, 2014a; Piterina & Pembroke, 2010). In order to overcome this hurdle, metagenomics or culture-independent genomics combined with other high-throughput DNA sequencing approaches came into action over the past few years. Content of gene, its function, population diversity, ecological contribution of microbial diversity living in thermal springs are some important areas where metagenomics approach has been proved itself a satisfactory tool (Badhai, Whitman, & Das, 2016). The diversity of bacterial and archaea of the thermal springs of Manikaran, Himachal Pradesh were studied using metagenomic approach (Sharma, Thakur, Thakur, & Bhalla, 2016b). Firmicutes, which are spore-forming, gram-positive bacterial phyla, are reported to dominate among these thermal springs, followed by Aquificae and the Deinococcus-Thermus group. The most abundant bacterial species were found out to be Thermus brockianus, Bacillus sporothermodurans, Thermus thermophiles, Hydrogenobacter sp. GV4-1 and Bacillus megaterium. In case of archaea, Pyrobaculum calidifontis and Pyrobaculum aerophilum were principal species classified under the phylum Crenarchaeota (Bhatia et al., 2015). The genome sequences of several novel microorganisms have not yet been decoded, which makes the phylum Crenarchaeota taxonomically debatable (Bhatia et al., 2015). Metagenomic analysis of the thermal spring of Lasundra (Gujarat) revealed a predominance of bacteria (99.21%), followed by eukaryotes (0.43%) and archaea (0.11%) (Mangrola et al., 2015b). Most dominant phyla present in this hot spring were Firmicutes (95.5%), Proteobacteria (2.0%), Actinobacteria (0.8%), Bacteroidetes (0.1%), Cyanobacteria (0.1%), and Euryarchaeota (0.09%). Notable genera were Bacillus (86.7%), Geobacillus (2.4%), Paenibacillus (1.0%), Clostridium (0.7%), and Listeria (0.5%). Moreover, 3.0% of the identified genes were related to stress such as osmotic stress, detoxification, periplasmic stress, oxidative stress, acid stress, heat shock, and cold shock. COG analysis revealed 104,110 traits, out of which 45.4% were related to metabolism and for 19.6% no particular category was decided, which stipulated the chances of having novelty in genes (Patel, Dave, Braganza, & Modi, 2019b).

Hot spring

Dirang

Manikaran

States

Arunachal Pradesh

Himachal Pradesh

+ve +ve +ve -ve +ve -ve +ve +ve +ve +ve +ve -ve -ve

70°C 70°C 60-70°C 70°C 70°C 70°C 70°C 45°C 34-58°C 28-45°C 60-80°C 20-55°C

Bacillus arsenicus NBM47

Bacillus subtilis NBM48

Thermonema lapsum NBM28

Paenibacillus thiaminolyticus NBM71

Paenibacillus glycanilyticus NBM30

Bacillus mycoides NBM19

Bacillus pumilus NBM31

Brevibacillus thermoruber PS1

Bacillus licheniformis PS4

Fictibacillus halophilus sp. nov.

Thermus parvatiensis sp. nov.

Lampropedia cohaerens sp. nov.

+ve

Gramstaining

40-58°C

25–37°C

Temperature range/ Optimum temperature

Bacillus thermoamylovorans NBM38

Bacillus sp.

Microbial genus/ species

TABLE 11.1 Microbial isolates identified from Indian hot springs.

Tripathi et al., 2016

(Continued)

Dwivedi et al., 2015

Sharma, Kohli, Singh, Schumann, & Lal, 2016a

Verma, Gupta, & Shirkot, 2014

Verma, Gupta, & Shirkot, 2014

Sahay et al., 2017

Sahay et al., 2017

Sahay et al., 2017

Sahay et al., 2017

Sahay et al., 2017

Sahay et al., 2017

Sahay et al., 2017

Sahay et al., 2017

Bora & Bora 2012

References

Exploration of microbial communities of Indian hot springs Chapter | 11

261

Dholera

Gujrat

Tuva Timba

Yumthang

Tatapani

Hot spring

Sikkim

States

+ve +ve +ve

11-57°C 42-75°C

Geobacillus thermoleovorans

-ve

35-60°C

Tepidimonas taiwanese 45°C

+ve

20-65°C

Brevibacillus brostelensis

Bacillus licheniformis

+ve

23-35°C

Bacillus subtillis

Bacillus mojavensis

+ve

15-55°C

Bacillus sonorensis

+ve

60-70°C

Bacillus sp. NBY16 +ve

-ve

70°C

Thermobacillus sp. NBY36 21-37°C

+ve

70-80°C

Brevibacterium halotolerans

variable

60-70°C

Bacillus pumilus NBY4

+ve

NA

45-50°C 55-65°C

Gramstaining

Temperature range/ Optimum temperature

Paenibacillus sp. NBY33

Geobacillus pallidus

Myceliopthora thermophila SH1

Microbial genus/ species

TABLE 11.1 Microbial isolates identified from Indian hot springs (Cont.)

Patel et al., 2019b

Patel et al., 2019b

Patel et al., 2019b

Patel, Dave, Braganza, & Modi, 2019a

Patel, Dave, Braganza, & Modi, 2019a

Patel, Dave, Braganza, & Modi, 2019a

Patel, Dave, Braganza, & Modi, 2019a

Patel, Dave, Braganza, & Modi, 2019a

Sahay et al., 2017

Sahay et al., 2017

Sahay et al., 2017

Sahay et al., 2017

Sharma et al., 2013b

Sharma et al., 2013a

References

262 Recent Advancements in Microbial Diversity

Assam

Odisha

States

Atri

Taptapani

Athamallik

Tulsi Shyam reservoir

Hot spring

-ve variable

25-42°C 20-37°C

Paenibacillus assamensis sp. Nov

-ve

Aquimonas voraii gen. nov. sp. Nov

30–37°C

-ve

5-40°C

Strenotophomonas maltophilia

Thiomonas bhubaneswarensis sp. nov.

-ve

NA

Aeromonas veroni

-ve

15-45°C

Gulbenkiania indica sp. Nov

+ve

-ve

20-45°C

Pannonibacter indica sp. nov.

18-37°C

-ve

12-40°C

Comamonas thiooxidans sp. Nov

Bacillus barbaricus

-ve

20-50°C

Chelatococcus sambhunathii sp. nov.

+ve

+ve

25-50°C

Bacillus tequilensis

60°C

+ve

37-69°C

Anoxybacillus salavatliensis

Anoxybacillus beppuensis TSSC-1

+ve

55-130°C

Geobacillus stearothermophilus

+ve

+ve

45-48°C

Brevibacillus thermoruber

60°C

+ve

55-60°C

Anoxybacillus gonensis

Bacillus amyloliquifaciens TSWK1-1

Gramstaining

Temperature range/ Optimum temperature

Microbial genus/ species

Saha et al., 2005b

Saha et al., 2005a

Panda et al., 2009

Sen et al., 2014

Sen et al., 2014

Sen et al., 2014

(Continued)

Jyoti, Narayan, & Das, 2010

Bandyopadhyay, Schumann, & Das, 2013

Narayan, Pandey, & Das, 2010

Panday & Das, 2010

Kikani & Singh, 2012

Kikani & Singh, 2011

Patel et al., 2019b

Patel et al., 2019b

Patel et al., 2019b

Patel et al., 2019b

Patel et al., 2019b

References Exploration of microbial communities of Indian hot springs Chapter | 11

263

Chhattisgarh

Badi Anhoni

Madhya Pradesh

Balrampur

Tattapani

Chhoti Anhoni

Hot spring

States

+ve

-ve

65°C

Fervidobacterium pennivorans

5-40°C

-ve

65°C

Thermus oshimai

Planococcus sp.

-ve

45-73°C

Thermus scotoductus

+ve

-ve

50-82°C

Thermus thermophiles

4-37°C

-ve

65-70°C

Bacillus aryabhattai

-ve

100°C

Fervidobacterium nodosum

-ve

Pyrobaculum aerophilum

37°C

-ve

Pseudomonas stutzeri

30°C

+ve

20-42°C

Fontibacillus aquaticus gen. nov., sp. nov.

Ramlibacter tataouinensis

-ve

15-42°C

Emticicia oligotrophica gen. nov., sp. nov.

-ve

-ve

15-42°C

Flavobacterium indicum sp. nov.

15-37°C

-ve

15-42°C

Aeromonas sharmana sp. nov.

Acidovorax sp.

Gramstaining

Temperature range/ Optimum temperature

Microbial genus/ species

TABLE 11.1 Microbial isolates identified from Indian hot springs (Cont.)

Kumar, Yadav, Tiwari, Prasanna, & Saxena, 2014b

Kumar, Yadav, Tiwari, Prasanna, & Saxena, 2014b

Saxena et al., 2017

Saxena et al., 2017

Saxena et al., 2017

Saxena et al., 2017

Saxena et al., 2017

Saxena et al., 2017

Saxena et al., 2017

Saxena et al., 2017

Saxena et al., 2017

Saha, Krishnamurthi, Bhattacharya, Sharma, & Chakrabarti, 2010

Saha & Chakrabarti, 2006c

Saha & Chakrabarti, 2006b

Saha & Chakrabarti, 2006a

References

264 Recent Advancements in Microbial Diversity

+ve -ve -ve -ve -ve -ve -ve -ve

25-35°C 25-30°C 35-37°C 30-37°C 25-42°C 37-41°C 30-37°C 45-55°C

Staphylococcus sciuristrain 3-20

Bacillus spp.

Rhizobium

Azospirillum

Caulobacter

Pseudomonas

Phenylobacterium

Methyloversatilis

Caldimonas

Unkeshwar

35-40°C

+ve

+ve

+ve

Nimbavali

≥50°C

20-37°C

Bacillus licheniformis strain UN1

Calidifontibacter indicus. gen. nov., sp. Nov

Sativali, Ganeshpuri

+ve

4-42°C

Exiguobacterium Acetylicum

Maharashtra

+ve

18-45°C

Staphylococcus haemolyticus

Irde, Puttur Taluka

+ve

17-45°C

Lysinibacillus sp.

Karnataka

Gramstaining

Temperature range/ Optimum temperature

Microbial genus/ species

Hot spring

States

(Continued)

Mehetre, Shah, Dastager, & Dharne, 2018

Mehetre, Shah, Dastager, & Dharne, 2018

Mehetre, Shah, Dastager, & Dharne, 2018

Mehetre, Shah, Dastager, & Dharne, 2018

Mehetre, Shah, Dastager, & Dharne, 2018

Mehetre, Shah, Dastager, & Dharne, 2018

Mehetre, Shah, Dastager, & Dharne, 2018

Mehetre, Shah, Dastager, & Dharne, 2018

Jaffer et al., 2019

Jaffer et al., 2019

Ruckmani, Kaur, Schumann, Klenk, & Mayilraj, 2011

Kumar, Yadav, Tiwari, Prasanna, & Saxena, 2014b

Kumar, Yadav, Tiwari, Prasanna, & Saxena, 2014b

Kumar, Yadav, Tiwari, Prasanna, & Saxena, 2014b

References Exploration of microbial communities of Indian hot springs Chapter | 11

265

Hot spring

Jakrem

Surajkund

States

Meghalaya

Jharkhand

+ve +ve +ve +ve +ve -ve

25-37°C 28-37°C 20-40°C 10-60°C 5-30°C 70-75°C

Micrococcus

Microbacterium

Nocardioides

Actinomodura

Dietzia

Thermus

+ve -ve

40-60°C 30-60°C

Anoxybacillus suryakundensis sp. nov

Tepidiphilus thermophilus JHK30T sp. nov.

-ve

+ve

45-60°C

Micromonospora

25-55°C

+ve

25-35°C

Streptomyces

Caldimonas meghalayensis sp. nov.

Gramstaining

Temperature range/ Optimum temperature

Microbial genus/ species

TABLE 11.1 Microbial isolates identified from Indian hot springs (Cont.)

Poddar, Lepcha, & Das, 2014

Deep, Poddar, & Das, 2013

Rakshak, Ravinder, Srinivas, & Kumar, 2013

Mehetre, Shah, Dastager, & Dharne, 2018

Mehetre, Shah, Dastager, & Dharne, 2018

Mehetre, Shah, Dastager, & Dharne, 2018

Mehetre, Shah, Dastager, & Dharne, 2018

Mehetre, Shah, Dastager, & Dharne, 2018

Mehetre, Shah, Dastager, & Dharne, 2018

Mehetre, Shah, Dastager, & Dharne, 2018

Mehetre, Shah, Dastager, & Dharne, 2018

References

266 Recent Advancements in Microbial Diversity

Hot spring

Bakreshwar

Chumathang

Ringigad

States

West Bengal

Jammu and Kashmir

Uttarakhand

+ve -ve -ve +ve Gram variable +ve -ve +ve +ve

20-65°C NA 37°C 10-50°C 5-50°C 37°C 5–40°C 28°C 26°C

Paenibacillus dendritiformis

Bacillus cereus

Bacillus cibi

Streptococcus pyogenes

Strenotrophomonas maltophila

Streptomyces albus

Streptomyces canescens

-ve

4-37°C

Brevundimonas terrae

Aeromonas veronii

+ve

10-40°C

Kocuria palustris

Brevibacillus borstelensis

-ve

10-40°C

+ve

-12–55°C

Exiguobacterium sp.

Aurantimonas altamirensis

+ve

3–45°C

Bacillus megaterium -ve

Gram variable

17–50°C

Bacillus flexus

8-45°C

-ve

15–42°C

Paracoccus sp.

+ve

4–30°C

+ve

60°C

Anoxybacillus gonensis

Pontibacter niistensis

+ve

70°C

Geobacillus icigianus

Bacillus pumilus

Gramstaining

Temperature range/ Optimum temperature

Microbial genus/ species

(Continued)

Kumar & Sharma, 2019

Kumar & Sharma, 2019

Kumar & Sharma, 2019

Kumar & Sharma, 2019

Kumar & Sharma, 2019

Kumar & Sharma, 2019

Kumar & Sharma, 2019

Kumar & Sharma, 2019

Kumar & Sharma, 2019

Kumar et al., 2014b

Kumar et al., 2014b

Kumar et al., 2014b

Kumar et al., 2014b

Kumar et al., 2014b

Kumar et al., 2014b

Kumar et al., 2014b

Kumar et al., 2014b

Kumar et al., 2014b

Soy et al., 2019

Soy et al., 2019

References Exploration of microbial communities of Indian hot springs Chapter | 11

267

Soldhar

Uttarakhand

NA: Not available/applied.

Hot spring

States

+ve +ve +ve +ve +ve +ve NA NA NA NA NA

37°C 25–30°C 45–55°C NA 55-130°C 28°C NA 35–71°C 21–36°C 25°C 15–21°C

Brevibacillus parabrevis

Brevibacillus reuszeri

Geobacillus stearothermophilus

Streptomyces albus

Thermoactinomyces candidus

Thermoactinomyces thalopophilum

Aspergillus tubingensis

Trichoderma harzianum

Sclerotinia sclerotiorum

NA

15-21°C

Sclerotinias clerotiorum

Bacillus subtilis

NA

25–30°C

Fusarium Oxysporum

Streptococcus pyogenes

NA

20–35°C

Sclerotium rolfsii

+ve

+ve

35–71°C

Thermoactinomyces thalopophilum

30-40°C

+ve

NA

Thermoactinomyces candidus

Bacillus cereus

Gramstaining

Temperature range/ Optimum temperature

Microbial genus/ species

TABLE 11.1 Microbial isolates identified from Indian hot springs (Cont.)

Kumar & Sharma, 2019

Kumar & Sharma, 2019

Kumar & Sharma, 2019

Kumar & Sharma, 2019

Kumar & Sharma, 2019

Kumar & Sharma, 2019

Kumar & Sharma, 2019

Kumar & Sharma, 2019

Kumar & Sharma, 2019

Kumar & Sharma, 2019

Kumar & Sharma, 2019

Kumar & Sharma, 2019

Kumar & Sharma, 2019

Kumar & Sharma, 2019

Kumar & Sharma, 2019

Kumar & Sharma, 2019

Kumar & Sharma, 2019

References

268 Recent Advancements in Microbial Diversity

Exploration of microbial communities of Indian hot springs Chapter | 11

269

Comparative environmental genomics of thermal springs; Taptapani (district Ganjam), Atri (district Khorda), Tarabalo (district Nayagarh), Athamallik (district Angul) revealed a predominance of bacteria (54.5%), followed by archaea (1.7%) and eukarya (98%) with Psychrobacter, Halomonas, Aeromonas, Pseudomonas, Paracoccus, Brevundimonas, Rhizobium, Exiguobacterium, Bacillus, Planococcus, Dietzia and Chryseobacterium. Most of them were adopted to survive under extreme environmental conditions such as low temperature, high salt concentration and desiccation (Scott et al., 2015). Analysis of the mangrove soil of Mahanadi river delta, Odisha, India revealed thirty sulphur oxidizing bacteria (Micrococcus spp., Bacillus spp., Pseudomonas spp. and Klebsiella

Microbial diversity and functional potential in wetland ecosystems Chapter | 12

297

spp.) were isolated from six different location, of mangrove soil (Behera, Patra, Dutta, & Thatoi, 2014).

2.2.3  Fungal diversity of wetlands Fungai plays an important role in the wetland ecosystem and the wetland environmental factors play a crucial role in maintaining fungal biodiversity (Fenchel & Finlay, 2005; Fierer & Jackson, 2006; Fuhrman et al., 2008; Wu et al., 2013; Wu, Liu, & Rene, 2018). According to previous studies, the riverine current creates specific environmental conditions and historical contingencies which are more important for fungal and bacterial communities in a particular wetland ecosystem (Green et al., 2004; Martiny et al., 2006; O’Malley, 2007; Wu et al., 2013). Diversified fungal communities were observed in the wetlands based on the interactions of river and sediment (Wu et al., 2013). The most important contribution of a wetland is its biogeography, which itself is an important cause of high fungal diversity. Sometimes local environmental factors and other bacterial communities affect the diversity of fungi in a particular wetland in the absence of any physical barriers (Hewson, Jacobson/Meyers, & Fuhrman, 2007; Wu et al., 2013). Recent findings also suggest that the diversity of the wetland ecosystems corresponds to the scale and type of microorganism (Fierer, Morse, Berthrong, Bernhardt, & Jackson, 2007; Pagaling et al., 2009). There is a true relationship between the fungal community and geographical distance as evidence by various studies from arid soil, rhizospheres and other habitats (Cordier, Robin, Capdevielle, Desprez-Loustau, & Vacher, 2012; Green et al., 2004; Kivlin, Hawkes, & Treseder, 2011).The distribution of the fungal community in wetlands may also reflect the distribution of the plant community in this particular wetland region (Zachow et al., 2009). Mycologist has identified 74000 species of fungi from various wetlands of the world; however this number is about 5% of the total number of fungi (Kennedy & Clipson, 2003). Wu et al. (2013) investigated fungal diversity in wetlands of china and identified 81 genera and 177 species based on the morphological characteristics and phylogenetic analysis. They belonged to Ascomycota, Basidiomycota and the Zygomycota. The identified dominant genera were belonging to Penicillium, Fusarium, Aspergillus, Trichoderma and Talaromyces. Other genera present in low abundance were Mortierella, Acremonium, Verticillium, Cladosporium, Chaetomium, Leptosphaeria, Pycnidiophora, Stachybotrys, Paecilomyces, Alternaria, Dimorphospera (Wu et al., 2013). Analysis of the mangrove along the East coast in India identified the dominant fungal member Aspergillus, followed by Cladosporium, Alternaria and Penicillium (Thamizhmani & Senthilkumaran, 2012). A total of 300 fungi, including Aspergillus sp., Penicillium sp., Sphaeropsis sp., Pericouic sp., Fusarium sp., Xylophpha sp., Umbelopsis sp., Cylindrocladium sp., Llelicocephalum sp. ware isolated from the soil samples from East Kolkata wetland using Czapex Dox Agar media (Nath & Kalam, 2014).

298

Recent Advancements in Microbial Diversity

Arbuscular mycorrhizal (AM) fungi form a mutualistic symbiosis with most of the vascular plants and accounting for 30% of the soil microbial biomass (Olsson, Thingstrup, Jakobsen, & Bååth, 1999; Trappe, 1987). AM fungi belonging to the phylum Glomeromycota are widely explored (Seerangan & Thangavelu, 2014). A summary of AM fungi presents in wetland and the effect of flooding on AM fungal colonization was reviewed and identified Acaulospora; Glomus; Archaeospora; Claroideoglomus claroideum; Racocetra verrucosa; Rhizophagus intraradices; Rhizophagus fasciculatum; Scutellospora; Paraglomus; Archaeospor trappei; Acaulospora koskei; Acaulospor laevis; Enterophospora columbiana; Glomus clarum; Glomus etunicatum; Glomus gerdmannii; Ambispora leptotichum; Dentiscutata heterogama; Diversisporaceae as common AM fungi associated with plants of 99 families living in 31 different habitats (Zhouying, Yihui, JIANG, ZHANG, & Xiaoying, 2016). D’Souza and Rodrigues worked on seasonal diversity of fungi in Mangroves of Goa, India and observed Glomus was the dominant genus followed by Acaulospora, Rhizophagus, Funneliformis, and Racocetra (D’Souza & Rodrigues, 2013). Analysis of Forested fen revealed the presence of Chaetothyriales, Ericoid mycorrhizae Cantharellales, graminoids and/or ericaceous shrubs and ectomycorrhizal root associates (Asemaninejad, Thorn, & Lindo, 2017). Choudhury et al. (2010) studied the distribution of AM fungi in Deepar Beel Ramsar site of Assam, India and identified 18 morphotypes, which were belonging to four genera viz. Glomus, Acaulospora, Gigaspora and Scutellospora. Endophytic fungi present in the leaves and roots of the flora of wetlands have a symbiotic relationship with their host flora. Plant growth promoting activity and induction of systematic resistance by the endophytic fungi has been extensively studied by many researchers (Waller et al., 2005; You, Kwak, Kang, Lee, & Kim, 2015; You et al., 2012; You et al., 2013). Phylogenetic and diversity analyses of the endophytic fungi isolated from Daepyeong and Jilnal wetland of South Korea highlight the presence of genera Aspergillus, Cladosporium, Clonostachys, Fusarium, Leptosphaeria, Penicillium, and Talaromyces (You et al., 2015). Some fungal species belonging of genus Fusarium or Leptosphaeria have been revealed as plant pathogens (You et al., 2015). Investigation on the wetland of tributary in Nakdong river revealed the presence of seventeen fungal genera concretely in Acremonium, Alternaria, Aspergillus, Cladosporium, Emericellopsis, Fusarium, Galactomyces, Leptosphaeria, Microsphaeropsis, Penicillium, Peyronellaea, Phoma, Pseudeurotium, Rhizomucor, Talaromyces, Trematosphaeria and Zalerion (You et al., 2015).Yeasts are a ubiquitous polyphyletic group frequently reported from the flooded forests including peatlands, floodplains or humid forests and are involved in the initial stages of organic matter decomposition (Sampaio, Rodriguez-Gonzalez, Varandas, Cortes, & Ferreira, 2008; Sampaio, Sampaio, & Leão, 2007; Thormann & Rice, 2007; Thormann, Rice, & Beilman, 2007). Thormann et al. (2007) reviewed the yeast communities in the peatlands and revealed that the most prevalent genera were Cryptococcus, Candida, Pichia, and Rhodotorula. Analysis of Bakchar bog at the

Microbial diversity and functional potential in wetland ecosystems Chapter | 12

299

watershed between the Bakchar and Iksa Rivers in the western zone of the Tomsk region identified twenty three yeast species classified under the genera Bullera, Candida, Cryptococcus, Debaryomyces, Hanseniaspora, Metschnikowia, Mrakia, Pichia, Rhodotorula, Saccharomyces, Sporobolomyces, Torulaspora and Trichosporon (Polyakova, Chernov, & Panikov, 2001). Analysis of the Lhalu Wetland situated in Qinghai-Tibet plateau identified 83 yeast isolates belonging to 5 genera, including Cryptococcus, Candida, Protomyces, Rhodotorula and Cystofilobasidium. R. mucilaginosa. This study also reported the high relative abundance of Cryptococcus victoriae and Cryptococcus aspenensis in this wetland (Zhao et al., 2017).

2.2.4  Algal diversity in wetlands Algae are regarded as the key players in the physical, chemical and biological processes of the wetland. They serve as a primary producer, participates in the nutrient cycle as the sources of dissolved organic matter and N and thereby greatly contributes to the wetland food web. Most of the algal groups reported from the wetland ecosystem including, epipelon, epiphyton, metaphyton and phytoplankton. However, the predominant species belonged to diatom, green and blue algae (Li et al., 2003). Analysis of algal diversity from 146 wetlands of the Rio Grande do Sul, Brazil identified 107 genera of algae belongs to Cyanophyta, Heterokontophyta, Dinophyta, Euglenophyta, and Chlorophyta (Matsubara, Maltchik, & Torgan, 2008).

3  Biogeochemical transformations driven by microbes in wetlands Different biogeochemical process prevails in the wetlands results in the exchange of chemical forms of materials and movements of materials within wetlands which in term determine the overall wetland productivity. Microorganism plays an important role in the wetland biogeochemical process, which is influenced by the unique hydrological conditions that prevailed in the wetland.

3.1  Methanogenesis in sediments of wetland Wetlands are the largest source of methane, one of the most powerful ozone harming substances associated with the global climate change (Narrowe et al., 2019; Saunois, Jackson, Bousquet, Poulter, & Canadell, 2016).Therefore, the proper identification of the source of methane by analyzing the metabolic pathway of underground microbes is essential to determine accurate information about methane emission. There is a narrow range of substrates used by archaea and methanogens for methanogenesis, including acetate, hydrogen, carbon dioxide, methylamines and methanol. Demethylation of the methyl groups occurs as a result of methylotrophic methanogenesis (Krzycki, 2004). Decomposition of lignin and pectin derived from plants produce methanol in wetland soils (Schink

300

Recent Advancements in Microbial Diversity

& Zeikus, 1980). The plant derived quaternary amines also produce methylamine compounds in wetlands (Zhalnina et al., 2018). Methylotrophic methanogenesis is considered more frequently occurring, having diverse phylogeny, thus leading to more interest in studying their global distribution and contribution towards global warming (Evans et al., 2015; Vanwonterghem et al., 2016). Methanogens are studied as the most promising microbial group in the wetland ecosystem, have different phylogenies and show significant similarities between the different species that live in the wetlands (Bridgham, Cadillo-Quiroz, Keller, & Zhuang, 2013). Methanogens are studied in two different ways i.e., by studying the composition of targeted 16S rRNA and investigating the functional gene coding for methyl coenzyme M reductase. They emit biogenic CH4 metabolically. The end products CO2, acetate and H2 resulted from the degradation of fermentative members of the sediments are used by the methanogens for the formation of CH4 (Houghton et al., 2001; Laskar et al., 2018). Methanogens were reported to survive in a variety of lake ecosystems among which the humic, oligotrophic and meromictic lakes have been studied vastly but mesotrophic and eutrophic lakes haven’t been studied to such extent (Laskar et al., 2018; Lofton, Whalen, & Hershey, 2015; Lowe, 2006). This may be due to the fact that the substrate in these two ecosystems prefers a different pathway of methanogenesis (Yang et al., 2017).

3.2  Methane oxidation Approximately 20% of the radiative forcing is caused by CH4 in the environment, so CH4 is considered a major cause of climate change. Biogenic sources accounted for more than 70% of CH4 emissions (Wendlandt et al., 2010). The availability of terminal substrates is an important factor controlling the development of CH4. Temporary deposition of acetate in freshwater sediments results in the production of CH4 caused by the temporary interplay of acetate production and consumption in the wetlands (Laskar et al., 2018; Nozhevnikova et al., 2007). In addition, CH4 production in wetland ecosystems is well known to be directly controlled by soil microbiological properties (Shannon & White, 1996). CH4 is known to be an important source of Green House Gas (GHG) with a 25-fold greater contribution than that of CO2. It is estimated that natural wetlands contribute about 20%–39% of CH4 emissions worldwide (Conrad & Babbel, 1989). Wetlands are known to be the main anthropogenic sources of CH4 released into the atmosphere due to the nature of the microbial species that live there, as well as the functional genes causing methanogenesis (Denman et al. 2007; He et al., 2015). At times a balance is formed between the CO2 absorbed by the primary metabolism and the amount of CH4 emissions when a wetland is stated to be moving from a GHG sink to a source (Whiting & Chanton, 2001). The variable physical conditions of wetland impact net CH4 emissions, differing from wetland to wetland (Kayranli, Scholz, Mustafa, & Hedmark, 2010). Numerous microorganisms were examined to determine the

Microbial diversity and functional potential in wetland ecosystems Chapter | 12

301

connection between the development of soil CH4 and the abundance of methanogenic species, although several studies challenged these claims (Bridgham et al., 2013). Many researchers indicated that there is no evidence of a direct connection between methanogenic community diversity and possible development of CH4 in peatlands, although it is linked to the ratio of methyl coenzyme reductase (mcrA) transcripts to α-subunit (Sun, Brauer, Cadillo Quiroz, Zinder, & Yavitt, 2012).The occurrence of methanogens in deep sediment layers (up to 25–50 cm) has proven the oxidation of CH4. Due to the increased oxidation levels of CH4 by the methanotrophic bacteria, a lesser amount of CH4 is diffused into the atmosphere relative to the microbial production rate of CH4. CH4 is one of the most powerful greenhouse gases and the amount of CH4 released from biogenic sources is more than 70%. There was a significant correlation between the production of CH4 and an ecosystem’s methanogenic populations. Habitat environmental factors are connected to the abundance, structure and function of methanogenic communities. The geochemical cycling of nutrients and contaminants depends on the anaerobic microbial freshwater sediment communities. Therefore, to understand the processes of global warming, the study of the diversity of methanogenic populations of archaea is necessary. The continuous development of molecular methods for environmental studies has made it possible to perform molecular characterization of the methanogenic communities. The molecular methods provided a clear picture of researching the structure and complexity of the microbial population and made the process faster and more purposeful. The study of methanogenic archaeal populations has become much more appropriate by the method of 16S rRNA and mcrA gene sequencing, DGGE fingerprinting, Next Generation Sequencing.

3.3  Sulfate cycle in wetland The sulfate cycle is one of the most anaerobic degredation pathways for organic matter and has been studied in the wetland ecosystem. Sulfate reducing microorganisms (SRM) present in these systems involved in the reduction of sulfate to sulphide leads to the removal of the metals and acidity. Sulfur Cycling Processes includes Assimilatory sulfate reduction, Desulfurylation, Sulfide oxidation, Sulfur oxidation and Dissimilatory S reduction. The dissimilatory sulfate-reduction reaction is thought to be among the oldest metabolic processes of life on Earth and contributes up to 36%–50% to anaerobic carbon mineralization in wetland ecosystem (Pester, Knorr, Friedrich, Wagner, & Loy, 2012a). SRM is associated with this process in the anoxic water and sediment ecosystem. These microbes are metabolically versatile and capable of utilizing different substrates including hydrogen, short-chained fatty acids, ethanol, lactate, amino acids, aromatic compounds, alkanes, alkenes, etc (Muyzer & Stams, 2008; Pester et al., 2012a; Rabus, Hansen, & Widdel, 2006). Sulfate reduction is important in the agricultural wetlands since the released H2S can influence the growth and development of the plants. The H2S oxidation found to be stimulated the

302

Recent Advancements in Microbial Diversity

oxidative layers near the root, which protects the plant. However, in the temporarily flooded soil, H2S rarely accumulates until reaching toxic concentration (Zehnder, 1988). The SRM in low-sulfate environments were Desulfovibrio, Desulfobulbus, Desulfotomaculum, and Desulfosporosinus sp identified documented from lake sediments, rice paddy fields, permafrost soil and constructed wetlands (Bak & Pfennig, 1991; Lee, Romanek, & Wiegel, 2009; Pester et al., 2012a; Vatsurina, Badrutdinova, Schumann, Spring, & Vainshtein, 2008; Wind, Stubner, & Conrad, 1999). Most of the study used PCR assays with taxaspecific 16S rRNA gene-targeted primers for the identification of SRM (Scheid & Stubner, 2001; Stahl, Loy, Wagner, Barton, & Hamilton, 2007). Other uses DSR1F–DSR4R primer variants targeting the functional marker genes dsrAB, which codes the alpha- and beta-subunits of dissimilatory (bi) sulfite reductase used by the SRM for the energy conservation (Pereyra et al., 2010; Steger et al., 2011). The dominant SO42- reducers in salt marshes includes deltaproteobacteria belonging to Desulfobacteraceae and Desulfobulbaceae (Cui et al., 2017; Jackson, Whitcraft, & Dillon, 2014).

3.4  Metal reduction In the tidal and riverine wetlands, Fe (III)-reduction appears to be a major sink for C Microorganism with the abilities to reduce Fe (III), Mn (IV) and trace metals were documented in mineral wetlands Geobacter spp. under delta-proteobacteria and Shewanella spp. under gamma-proteobacteria were regarded as the major Fe(III)-reducers in these ecosystems. Other identified Fe(III)reducers were also documented among the members under the phyla Firmicutes, Crenarchaeota, Euryarchaeota and Acidobacteria (Neubauer, Givler, Valentine, & Megonigal, 2005; Sutton-Grier & Megonigal, 2011; Weber, Achenbach, & Coates, 2006; Yarwood, 2018). Metagenomic analysis revealed that analysis of decaheme cytochromes (MtrA, MtrC and their homologs) could be a promising approach to identifying Fe (III)-reducing communities in arctic peat environments (Lipson et al., 2013; Yarwood, 2018).

3.5 Denitrification Denitrification is an anaerobic respiration process performed by facultative anaerobic bacteria where the electron acceptor is nitrate; it starts when oxygen concentration is 4.5) and colonization of anaerobic bacteria (Aldunate et al., 2015), preterm birth (Goldenberg, Hauth, & Andrews, 2000) and a high risk of STD (DiGiulio et al., 2015; Redelinghuys, Magdaleen Ehlers, Dreyer, & Kock, 2015). Indigenous microflora is usually colonized in the human vagina. After the birth of a girl child, the vagina is colonized by Lactobacillus for several weeks. Maternal hormones cause an increase in the pH of the vaginal of the newborn and it remains neutral untill puberty. Different types of aerobic and anaerobic bacteria pre-dominate in the genital tract in childhood and inhabit as a natural microbiota until puberty. It is very susceptible to various pathogens like Streptococcus pyogenes and Neisseria gonorrhoeae. During puberty, Lactobacillus and a small number of other bacterial species and yeast predominate in the vagina and protect the lumen from infection. After menopause, the human vagina becomes vulnerable to infection, as the population of lactobacilli decreases. As a result, pH returns to neutral and the mixed flora develops a mixed population (Witkin, Linhares, & Giraldo, 2007). Glycogen, produced by vaginal epithelium, is also responsible for the symbiotic association between the host and vaginal Lactobacillus since, the estrogen hormones in a woman’s body induce the production of glycogen. Thus the pH of the vagina is decreased to