Rab GTPases: Methods and Protocols (Methods in Molecular Biology, 2293) 1071613456, 9781071613450

Citation preview

Methods in Molecular Biology 2293

Guangpu Li Nava Segev Editors

Rab GTPases Methods and Protocols Second Edition

METHODS

IN

MOLECULAR BIOLOGY

Series Editor John M. Walker School of Life and Medical Sciences University of Hertfordshire Hatfield, Hertfordshire, UK

For further volumes: http://www.springer.com/series/7651

For over 35 years, biological scientists have come to rely on the research protocols and methodologies in the critically acclaimed Methods in Molecular Biology series. The series was the first to introduce the step-by-step protocols approach that has become the standard in all biomedical protocol publishing. Each protocol is provided in readily-reproducible step-bystep fashion, opening with an introductory overview, a list of the materials and reagents needed to complete the experiment, and followed by a detailed procedure that is supported with a helpful notes section offering tips and tricks of the trade as well as troubleshooting advice. These hallmark features were introduced by series editor Dr. John Walker and constitute the key ingredient in each and every volume of the Methods in Molecular Biology series. Tested and trusted, comprehensive and reliable, all protocols from the series are indexed in PubMed.

Rab GTPases Methods and Protocols Second Edition

Edited by

Guangpu Li Department of Biochemistry and Molecular Biology, Peggy and Charles Stephenson Cancer Center, University of Oklahoma Health Sciences Center, Oklahoma City, Oklahoma, USA

Nava Segev Department of Biochemistry and Molecular Genetics, College of Medicine, University of Illinois at Chicago, Chicago, IL, USA

Editors Guangpu Li Department of Biochemistry and Molecular Biology, Peggy and Charles Stephenson Cancer Center University of Oklahoma Health Sciences Center Oklahoma City, Oklahoma, USA

Nava Segev Department of Biochemistry and Molecular Genetics College of Medicine University of Illinois at Chicago Chicago, IL, USA

ISSN 1064-3745 ISSN 1940-6029 (electronic) Methods in Molecular Biology ISBN 978-1-0716-1345-0 ISBN 978-1-0716-1346-7 (eBook) https://doi.org/10.1007/978-1-0716-1346-7 © The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021 This work is subject to copyright. All rights are solely and exclusively licensed by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Cover Caption: The GTPase GFP-Rab8a imaged live in macrophages and depicted as green, red and blue in sequential, superimposed movie frames. Contributed by Y. Hung, D. Brown, J.L. Stow, The University of Queensland. This Humana imprint is published by the registered company Springer Science+Business Media, LLC, part of Springer Nature. The registered company address is: 1 New York Plaza, New York, NY 10004, U.S.A.

Preface Shuttling proteins and membranes in the multiple intracellular traffic pathways allows communication between cellular compartments and between the inside of cells with their environment. Rab GTPases have emerged as key regulators of these pathways. They form the largest family of small GTPases and, together with their interactors, comprise >1% of the human proteome. Because they are required for all the systems in the human body, even slight disturbances in their function can result in diseases ranging from cancer to neurodegenerative disorders. Recent important insights into Rab regulation, localization, interactions, functions, and involvement in human diseases have been made possible by new methods in the fields of molecular genetics and cell biology that have been harnessed to study Rabs. The first Methods in Molecular Biology book on Rab GTPases was published in 2015. We now follow up in this new edition with methods that have been adapted to the bustling research of Rabs in recent years. The overview of the book highlights how insights into the Rab field were made possible in recent years by the new methods and open questions that can be answered by them in the future. The four parts of the book include chapters on methods that have provided novel information on Rab regulation and localization (Part I), interactions (Part II), functions (Part III), and disease (Part IV). We would like to thank the authors of the chapters for sharing their knowledge with the rest of the field. Reviewing the different chapters was challenging because of the breadth of the methods, so we recruited experts and are grateful to our colleagues who helped us with the review process. We hope that the book will be useful for scientists in the fields of Rab and other small GTPases, and beyond. Oklahoma City, OK, USA Chicago, IL, USA

Guangpu Li Nava Segev

v

Contents Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Reviewers and Contributors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

1 Newer Methods Drive Recent Insights into Rab GTPase Biology: An Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Guangpu Li and Nava Segev 2 Rab29 Fast Exchange Mutants: Characterization of a Challenging Rab GTPase . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Rachel C. Gomez, Edmundo G. Vides, and Suzanne R. Pfeffer 3 High-Throughput Assay for Profiling the Substrate Specificity of Rab GTPase-Activating Proteins . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Ashwini K. Mishra and David G. Lambright 4 Detecting Endogenous Rab8 Activation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Samuel J. Tong, Richard M. Lucas, Zhijian Xiao, Lin Luo, and Jennifer L. Stow 5 Testing the Phenotypic Effects of a Rab Chimera that Resolves Exchange Factor Specificity from Effector Specificity . . . . . . . . . . . . . . . . . . . . . . . . Hua Yuan and Peter Novick 6 Profiling Structural Alterations During Rab5 Nucleotide Exchange by HDX-MS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Janelle Lauer and Marino Zerial 7 CLEM Characterization of Rab8 and Associated Membrane Trafficking Regulators at Primary Cilium Structures . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Quanlong Lu and Christopher J. Westlake 8 Imaging of Spatial Cycling of Rab GTPase in the Cell . . . . . . . . . . . . . . . . . . . . . . . Fu Li and Yao-Wen Wu 9 Deconvolution of Multiple Rab Binding Domains Using the Batch Yeast 2-Hybrid Method DEEPN. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Tabitha A. Peterson and Robert C. Piper 10 Determination of the Rab27–Effector Binding Affinity Using a High-Throughput FRET-Based Assay . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Raghdan Z. Al-Saad, Ian Kerr, and Alistair N. Hume 11 Methods to Study the Unique SOCS Box Domain of the Rab40 Small GTPase Subfamily . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Emily D. Duncan, Ezra Lencer, Erik Linklater, and Rytis Prekeris 12 Using GBP Nanotrap to Restore Autophagy in the Rab5/Vps21 Mutant by Forcing Snf7 and Atg17 Interaction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Mengzhu Zhao and Yongheng Liang 13 Establishing Regulation of a Dynamic Process by Ypt/Rab GTPases: A Case for Cisternal Progression . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Jane J. Kim, Zanna Lipatova, and Nava Segev

vii

v ix

1

19

27 45

57

69

91 105

117

143

163

181

189

viii

14 15

16

17 18 19

20 21

Contents

Methods for Assessing the Regulation of a Kinase by the Rab GTPase Ypt1 . . . . Juan Wang, Shensen Wang, and Susan Ferro-Novick Qualitative and Quantitative Assessment of the Role of Endocytic Regulatory and/or Rab Proteins on Mitochondrial Fusion and Fission . . . . . . . . Trey Farmer and Steve Caplan Characterization of the Role of Rab18 in Mediating LD–ER Contact and LD Growth . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Dijin Xu, Peng Li, and Li Xu Methods for Establishing Rab Knockout MDCK Cells . . . . . . . . . . . . . . . . . . . . . . Riko Kinoshita, Yuta Homma, and Mitsunori Fukuda Generating Rab6 Conditional Knockout Mice. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Sabine Bardin and Bruno Goud Use of Immunohistochemistry to Determine Expression of Rab5 Subfamily of GTPases in Mature and Developmental Brains . . . . . . . . . . Kwok-Ling Kam, Paige Parrack, Marcellus Banworth, Sheeja Aravindan, Guangpu Li, and Kar-Ming Fung Assessing Rab5 Activation in Health and Disease . . . . . . . . . . . . . . . . . . . . . . . . . . . Anna Pensalfini, Ying Jiang, Seonil Kim, and Ralph A. Nixon Quantitative Fluorescence Microscopy for Detecting Mammalian Rab Vesicles within the Parasitophorous Vacuole of the Human Pathogen Toxoplasma gondii . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Julia D. Romano, Eric J. Hartman, and Isabelle Coppens

Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

201

213

229 243 257

265

273

295 307

Reviewers and Contributors

Reviewers ALISON ADAMS • Department of Biological Sciences, Northern Arizona University, Flagstaff, AZ, USA STEVE CAPLAN • The Department of Biochemistry and Molecular Biology, Eppley Institute for Research in Cancer and Allied Diseases, The Fred and Pamela Buffett Cancer Center, University of Nebraska Medical Center, Omaha, NE, USA ISABELLE COPPENS • Department of Microbiology and Immunology, Johns Hopkins University, Bloomberg School of Public Health, Baltimore, MD, USA SUSAN FERRO-NOVICK • Department of Cellular and Molecular Medicine, Howard Hughes Medical Institute, University of California at San Diego, La Jolla, CA, USA MITSUNORI FUKUDA • Laboratory of Membrane Trafficking Mechanisms, Department of Developmental Biology and Neurosciences, Graduate School of Life Sciences, Tohoku University, Miyagi, Japan BRUNO GOUD • Molecular Mechanisms of Intracellular Transport, Unite´ Mixte de Recherche 144, Centre National de la Recherche Scientifique, Institut Curie, Paris, France RICHARD KAHN • Department of Biochemistry, Emory University School of Medicine, Atlanta, GA, USA DAVID G. LAMBRIGHT • Program in Molecular Medicine, University of Massachusetts Medical School, Worcester, MA, USA JANELLE LAUER • Max Planck Institute of Molecular Cell Biology and Genetics, MPI-CBG, Dresden, Germany YONGHENG LIANG • College of Life Sciences, Nanjing Agricultural University, Nanjing, Jiangsu, China GUANGPU LI • Department of Biochemistry and Molecular Biology, Peggy and Charles Stephenson Cancer Center, University of Oklahoma Health Sciences Center, Oklahoma City, OK, USA SUZANNE R. PFEFFER • Departments of Biochemistry, Stanford University School of Medicine, Stanford, CA, USA RYTIS PREKERIS • Department of Cell and Developmental Biology, School of Medicine, Anschutz Medical Campus, University of Colorado Denver, Aurora, CO, USA NAVA SEGEV • Department of Biochemistry and Molecular Genetics, University of Illinois at Chicago, Chicago, IL, USA

ix

x

Reviewers and Contributors

Contributors RAGHDAN Z. AL-SAAD • Division of Physiology, Pharmacology and Neuroscience, School of Life Sciences, Queen’s Medical Centre, University of Nottingham, Nottingham, UK; Department of Pharmacology and Toxicology, College of Pharmacy, University of Babylon, Babylon, Iraq SHEEJA ARAVINDAN • Tissue Pathology Shared Resource, Stephenson Cancer Center, University of Oklahoma Health Sciences Center, Oklahoma City, OK, USA MARCELLUS BANWORTH • Department of Biochemistry and Molecular Biology, University of Oklahoma Health Sciences Center, Oklahoma City, OK, USA SABINE BARDIN • Molecular Mechanisms of Intracellular Transport, Institut Curie, PSL Research University, Centre National de la Recherche Scientifique, UMR 144, Paris, France STEVE CAPLAN • Department of Biochemistry and Molecular Biology, Eppley Institute for Research in Cancer and Allied Diseases, The Fred and Pamela Buffett Cancer Center, University of Nebraska Medical Center, Omaha, NE, USA ISABELLE COPPENS • Department of Microbiology and Immunology, Johns Hopkins University Bloomberg School of Public Health, Baltimore, MD, USA EMILY D. DUNCAN • Department of Cell and Developmental Biology, University of Colorado, Anschutz Medical Campus, Aurora, CO, USA TREY FARMER • Department of Biochemistry and Molecular Biology, Eppley Institute for Research in Cancer and Allied Diseases, The Fred and Pamela Buffett Cancer Center, University of Nebraska Medical Center, Omaha, NE, USA SUSAN FERRO-NOVICK • Department of Cellular and Molecular Medicine, University of California at San Diego, La Jolla, CA, USA MITSUNORI FUKUDA • Lab of Membrane Trafficking Mechanisms, Department of Integrative Life Sciences, Graduate School of Life Sciences, Tohoku University, Miyagi, Japan KAR-MING FUNG • Department of Pathology, University of Oklahoma Health Sciences Center, Oklahoma City, OK, USA RACHEL C. GOMEZ • Department of Biochemistry, Stanford University School of Medicine, Stanford, CA, USA BRUNO GOUD • Molecular Mechanisms of Intracellular Transport, Institut Curie, PSL Research University, Centre National de la Recherche Scientifique, UMR 144, Paris, France ERIC J. HARTMAN • Department of Microbiology and Immunology, Johns Hopkins University Bloomberg School of Public Health, Baltimore, MD, USA YUTA HOMMA • Lab of Membrane Trafficking Mechanisms, Department of Integrative Life Sciences, Graduate School of Life Sciences, Tohoku University, Miyagi, Japan ALISTAIR N. HUME • Division of Physiology, Pharmacology and Neuroscience, School of Life Sciences, Queen’s Medical Centre, University of Nottingham, Nottingham, UK YING JIANG • Center for Dementia Research, Nathan Kline Institute, Orangeburg, NY, USA KWOK-LING KAM • Department of Pathology, Northwestern University, Chicago, IL, USA IAN KERR • Division of Physiology, Pharmacology and Neuroscience, School of Life Sciences, Queen’s Medical Centre, University of Nottingham, Nottingham, UK JANE J. KIM • Department of Biochemistry and Molecular Genetics, College of Medicine, University of Illinois at Chicago, Chicago, IL, USA

Reviewers and Contributors

xi

SEONIL KIM • Department of Biomedical Sciences, Colorado State University, Fort Collins, CO, USA RIKO KINOSHITA • Lab of Membrane Trafficking Mechanisms, Department of Integrative Life Sciences, Graduate School of Life Sciences, Tohoku University, Miyagi, Japan DAVID G. LAMBRIGHT • Program in Molecular Medicine, University of Massachusetts Medical School, Worcester, MA, USA JANELLE LAUER • Max Planck Institute of Molecular Cell Biology and Genetics, MPI-CBG, Dresden, Germany EZRA LENCER • Department of Cell and Developmental Biology, University of Colorado, Anschutz Medical Campus, Aurora, CO, USA FU LI • Max-Planck-Institute of Molecular Physiology, Dortmund, Germany GUANGPU LI • Department of Biochemistry and Molecular Biology, Peggy and Charles Stephenson Cancer Center, University of Oklahoma Health Sciences Center, Oklahoma City, OK, USA PENG LI • State Key Laboratory of Membrane Biology, Tsinghua-Peking Center for Life Sciences, Beijing Advanced Innovation Center for Structural Biology, School of Life Sciences, Tsinghua University, Beijing, China YONGHENG LIANG • College of Life Sciences, Key Laboratory of Agricultural Environmental Microbiology, Ministry of Agriculture and Rural Affairs, Nanjing Agricultural University, Nanjing, China ERIK LINKLATER • Department of Cell and Developmental Biology, University of Colorado, Anschutz Medical Campus, Aurora, CO, USA ZANNA LIPATOVA • Department of Biochemistry and Molecular Genetics, College of Medicine, University of Illinois at Chicago, Chicago, IL, USA QUANLONG LU • Laboratory of Cellular and Developmental Signaling, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Frederick, MD, USA RICHARD M. LUCAS • Institute for Molecular Bioscience, The University of Queensland, Brisbane, QLD, Australia LIN LUO • Institute for Molecular Bioscience, The University of Queensland, Brisbane, QLD, Australia ASHWINI K. MISHRA • Program in Molecular Medicine, University of Massachusetts Medical School, Worcester, MA, USA RALPH A. NIXON • Center for Dementia Research, Nathan Kline Institute, Orangeburg, NY, USA PETER NOVICK • Department of Cellular and Molecular Medicine, University of California at San Diego, La Jolla, CA, USA PAIGE PARRACK • Department of Pathology, University of Oklahoma Health Sciences Center, Oklahoma City, OK, USA ANNA PENSALFINI • Center for Dementia Research, Nathan Kline Institute, Orangeburg, NY, USA TABITHA A. PETERSON • Molecular Physiology and Biophysics, Carver College of Medicine, University of Iowa, Iowa City, IA, USA SUZANNE R. PFEFFER • Department of Biochemistry, Stanford University School of Medicine, Stanford, CA, USA ROBERT C. PIPER • Molecular Physiology and Biophysics, Carver College of Medicine, University of Iowa, Iowa City, IA, USA RYTIS PREKERIS • Department of Cell and Developmental Biology, University of Colorado, Anschutz Medical Campus, Aurora, CO, USA

xii

Reviewers and Contributors

JULIA D. ROMANO • Department of Microbiology and Immunology, Johns Hopkins University Bloomberg School of Public Health, Baltimore, MD, USA NAVA SEGEV • Department of Biochemistry and Molecular Genetics, College of Medicine, University of Illinois at Chicago, Chicago, IL, USA JENNIFER L. STOW • Institute for Molecular Bioscience, The University of Queensland, Brisbane, QLD, Australia SAMUEL J. TONG • Institute for Molecular Bioscience, The University of Queensland, Brisbane, QLD, Australia EDMUNDO G. VIDES • Department of Biochemistry, Stanford University School of Medicine, Stanford, CA, USA JUAN WANG • College of Life Science and Bioengineering, Beijing University of Technology, Beijing, People’s Republic of China SHENSEN WANG • College of Life Science and Bioengineering, Beijing University of Technology, Beijing, People’s Republic of China CHRISTOPHER J. WESTLAKE • Laboratory of Cellular and Developmental Signaling, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Frederick, MD, USA YAO-WEN WU • Department of Chemistry, Uema˚ Centre for Microbial Research, Umea˚ University, Umea˚, Sweden ZHIJIAN XIAO • Institute for Molecular Bioscience, The University of Queensland, Brisbane, QLD, Australia DIJIN XU • State Key Laboratory of Membrane Biology, Tsinghua-Peking Center for Life Sciences, Beijing Advanced Innovation Center for Structural Biology, School of Life Sciences, Tsinghua University, Beijing, China LI XU • State Key Laboratory of Membrane Biology, Tsinghua-Peking Center for Life Sciences, Beijing Advanced Innovation Center for Structural Biology, School of Life Sciences, Tsinghua University, Beijing, China HUA YUAN • Department of Cellular and Molecular Medicine, University of California at San Diego, La Jolla, CA, USA MARINO ZERIAL • Max Planck Institute of Molecular Cell Biology and Genetics, MPI-CBG, Dresden, Germany MENGZHU ZHAO • College of Life Sciences, Key Laboratory of Agricultural Environmental Microbiology, Ministry of Agriculture and Rural Affairs, Nanjing Agricultural University, Nanjing, China

Chapter 1 Newer Methods Drive Recent Insights into Rab GTPase Biology: An Overview Guangpu Li and Nava Segev Abstract The conserved Ypt/Rab GTPases regulate all major intracellular protein traffic pathways, including secretion, endocytosis and autophagy. These GTPases undergo distinct changes in conformation between their GTP- and GDP-bound forms and cycle between the cytoplasm and membranes with the aid of their upstream regulators. When activated on the membrane in the GTP-bound form, they recruit their downstream effectors, which include components of vesicular transport. Progress in the past 5 years regarding mechanisms of Rab action, functions, and the effects of disruption of these functions on the well-being of cells and organisms has been propelled by advances in methodologies in molecular and cellular biology. Here, we highlight methods used recently to analyze regulation, localization, interactions, and function of Rab GTPases and their roles in human disease. We discuss contributions of these methods to new insights into Rabs, as well as their future use in addressing open questions in the field of Rab biology. Key words Ypt GTPases, Rab GTPases, Intracellular traffic, New methods, Disease

1

Introduction All eukaryotic proteomes include multiple members of a conserved family of ~20 kDa regulatory GTPases; termed Ypts in the yeast S. cerevisiae and Rabs in mammals (in the following, we will use the term Rabs unless discussing the yeast Ypts). The key role that Rab GTPases play in the regulation of cellular traffic was originally shown three decades ago in yeast for Ypt1 (ortholog of mammalian Rab1) and Sec4 (ortholog of mammalian Rab8), using genetic analysis of mutants [1, 2]. Importantly, the functional conservation of Ypt1 in mammalian cells was established from the start [2]. During the following decade, genome sequencing helped identify other members of the family based on sequence homology with the final tally being 11 Ypts in the budding yeast (9 of these Ypts fall into

Guangpu Li and Nava Segev (eds.), Rab GTPases: Methods and Protocols, Methods in Molecular Biology, vol. 2293, https://doi.org/10.1007/978-1-0716-1346-7_1, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

1

2

Guangpu Li and Nava Segev

6 evolutionarily conserved subfamilies; not much information is available about the other two), and > 60 human Rabs (that fall into 44 subfamilies) [3]. Assignment of the individual Rabs to specific sites and individual steps of protein traffic pathways has been established using expression of loss-of-function and dominant-interfering mutants and localization analyses [4]. During the second decade since their discovery, research focused on mechanisms of Rab action. A combination of biochemistry, structural biology and molecular genetics in multiple labs helped establish that these GTPases are activated by guaninenucleotide exchange factors (GEFs), whereas GTPase-activating proteins (GAPs) stimulate GTP hydrolysis and their inactivation. Rabs transiently associate with membranes through their lipid (prenyl) tail, where they perform their function. A single general accessory factor, GDP-dissociation inhibitor (GDI) helps recycle GDP-bound Rabs from membranes back into cytosol (while binding directly to and protecting the lipid tail) after their inactivation by a GAP [5]. When in the GTP-bound active form, individual Rab GTPases recruit their multiple downstream effectors, which are typically machinery components of vesicular transport, and organize them into membrane subdomains [6]. Rabs are considered “identity markers” for the multiple compartments through which cargos pass during intracellular traffic [7]. They do so because they function in the context of Rab GTPase modules, with each module including a specific GEF, GTPase, GAP, and effector(s) at specific locations throughout the cell (Fig. 1). While the initial interest in this family was due in large part to its similarity to the Ras GTPase oncogene and its major role in cancer, involvement of Rabs in an array of acquired diseases that range from cancer to neurodegeneration, attracted more specific attention to this family of regulators [8, 9]. In addition, the realization that a myriad of human pathogens harness Rabs for their cellular takeover [10], further cemented the central role Rabs play in all protein traffic in eukaryotic cells with clear clinical relevance. During the past 5 years, since the first edition of a Rab Methods book was published [11], the field has progressed with the help of advanced technologies that became available in the cell biology and molecular genetics disciplines. In this book, Rabs GTPases: Methods and Protocols, 2020, we highlight how adding cutting-edge microscopy, gene editing, and high-throughput screening, to the existing methods arsenal, helped refine our knowledge of upstream regulation and localization (Section I), interactions (Section II), and functions (Section III) of Rab GTPases both in vitro and vivo. In addition, developing animal knockout and disease models together with cell biological approaches helped broaden our understanding of the key roles Rabs play in development and disease (Section IV). Here, we summarize the principles of the methods

Newer Methods Drive Recent Insights into Rab GTPase Biology: An Overview

3

Fig. 1 Rab GTPases function in the context of GTPase modules. Rabs switch between their GTP- and GDP-bound forms and cycle between membranes and the cytoplasm. A specific Rab X bound to GDP resides in the cytoplasm in complex with GDI. When recruited to a specific membrane (perhaps with the help of GDI displacement factor, GDF), its lipid tail is inserted into the membrane and Rab X can be activated by its specific GEF X. When in the GTP-bound form, Rab X recruits its specific effectors, X1-N.. To inactivate Rab X, GAP X stimulates GTP hydrolysis, and when it the GDP-bound form, GDI can extract Rab X from the membrane for multiple rounds of function. Whereas the GEF, GAP, and effectors are Rab specific, GDI and GDF are not

(details can be found in individual chapters), the insights they provided, and their possible use for studying other Rabs or GTPases in general. We discuss the methods starting from in vitro and progressing to in vivo methods because the latter methods are lagging behind.

2

Rab Regulation and Localization (Chapters 2–8) When in cytosol, Rabs are bound to GDI, which stabilizes both the GTPase and the bound GDP. The translocation onto a specific membrane and localization of Rabs to a specific membrane of the compartment at which they function is coupled with their activation/GTP-binding, which is catalyzed by a specific GEF and reversed by the action of a specific GAP [12] (Fig. 1). Here, we highlight methods developed and used in recent years to study Rab (1) regulation and (2) cellular localization, including a way to show their inter-dependence. 1. Rab Regulation: Challenges in identifying Rab GEFs and GAPs have been different because while GEFs for individual Rabs do not share sequence similarity (e.g., a Rab GEF domain), Rab GAPs do share one of two such signatures, termed GYP/TBC or DENN. Radioactive nucleotides were used in exchange and hydrolysis (GTPase) assays, to identify many Rab GEFs and GAPs, respectively [5]. In recent years, methods have been developed to better cope with the expansion of the Rab family, the need to establish specificity of these regulators to individual Rabs especially in vivo, and for

4

Guangpu Li and Nava Segev

elucidating specific mechanisms of these reactions. Specifically, we give two examples of adapting in vitro assays for studying a unique Rab and for a use in high throughput screens, describe semi–in vivo and in vivo assays, and finally give an example of a method for revealing structural information about Rab regulation. Assays that follow GDP release and GTP binding using purified, recombinant proteins were instrumental for identifying regulators that affect Rabs nucleotide exchange and thus the activation process [13]. Fluorescently labeled nucleotides (e.g., prebound mant-GDP) allow for continuous monitoring of their release after excess of unlabeled nucleotide is added (to prevent rebinding) [14]. Such an assay was used for determining rates of GDP release from Rab29 [15]. Among its other functions, Rab29 recruits the LRRK2 kinase (associated with familial Parkinson’s disease) to the Golgi and appears to affect its activity [16]. Currently, upstream regulators of Rab29 are not known and the classical Rab activating mutations do not render an activated Rab29 [15]. Therefore, this assay was used for characterizing “fast exchange” Rab29 mutants that are GEF independent yet active in cells (Chapter 2). New potential Rab GAPs can be recognized by sequence analysis, for example, proteins that contain a GYP/TBC (conserved: GYP in yeast, TBC in mammals) or DENN domain (only in mammals) [17]. To identify specific Rab GAP substrates among the 9 Ypts and > 60 Rabs, there is a need for high-throughput assays. Mishra and Lambright described such a quantitative GAP plate assay that uses recombinant proteins and a fluorescent phosphate sensor to detect the inorganic phosphate released after GAP-dependent GTP hydrolysis [18]. This method, which requires low protein concentrations, has already been shown to be powerful in multiple studies of cellular and pathogenic GAPs [19, 20]. The protocol for this method was updated with additional information and clarifications. Moreover, a method for analyzing GAP reaction time courses was added, and it is useful for GTPase–GAP pairs with low KM values (Chapter 3). Because the readout is not dependent on the details of the GAP or the GTPase, the method can be used in large-scale analyses of GAP activity of other GTPases. While in vitro assays can provide information about candidate GEFs and GAPs that act in the context of a specific Rab GTPase module, the final assignment of these regulators has to be verified in vivo. One step closer to in vivo, is measuring levels of activated endogenous Rabs in cell lysates using recombinant effectors, or their Rab-binding domain (RBD), in a pulldown assays. Because effectors bind Rabs preferentially in their GTP-bound form, the level of an activated Rab in cell

Newer Methods Drive Recent Insights into Rab GTPase Biology: An Overview

5

lysates can be determined using pulldown followed by immunoblot analysis. Tong et al. describe such an assay for assessing levels of endogenous Rab8-GTP using RBDs of two of its effectors tagged with GST (Chapter 4). Using this method, the level of activated Rab8 in mouse macrophages could be assessed under different conditions. This method in combination with GEF loss of function mutation can be used for identifying the specific GEF that activates the Rab in specific cells and under specific conditions [21]. This approach can be used for multiple Rabs, with the caveat that it requires knowing the identity of their effectors. Knowing the Rab effector/s can be used also for assessing Rab activation in vivo. GEF-dependent localization of a Rab to a specific compartment and its activation was explored using a Ypt chimera in which the GEF-binding domain was replaced with that of another Ypt. Specifically, a chimera was constructed in which the GEF-binding domain of Ypt1, which functions at the beginning of the yeast exocytic pathway, was replaced with that of Sec4, which functions at the end of the secretory pathway. The effects of expressing this chimera on its localization, effector recruitment and secretion, were determined (Chapter 5). First, because the chimera was recruited to the late Golgi instead of early Golgi, the importance of GEF binding on Ypt1 localization was established. Second, effector recruitment was determined by a change in the localization of GFP-tagged Uso1, a Ypt1 effector. Depending on the expression level of the chimera, its own mis-localization can lead to recruitment of the Ypt1 effector Uso1 to the wrong place, thereby causing protein traffic defects and even toxicity [22]. Importantly, this study supports the interdependence of Rab regulation and localization. Two major approaches have been used to gain structural information of Rabs in complex with their upstream regulators: X-ray crystallography and cryogenic electron microscopy (cryo-EM). Determining the three-dimensional cocrystal structures of Rabs with their regulators has provided valuable information about these complexes and suggested mechanisms for their action [23]. The two basic limitations of this approach are that it analyzes proteins in a nonaqueous environment and provides a snapshot of the structures, rather than details at different steps of catalysis. Cryo-EM, which can provide details at atomic resolution of protein complexes in a more natural environment, was recently used to show a role for an “arginine finger” of a Rab11a GAP complex [24]. Arginine finger is the term used in studies of multiple families of GTPase and refers to the arginine in conserved GAP domains that extend into the nucleotide binding pocket of the GTPase to coordinate the attacking water molecular used to achieve hydrolysis of the

6

Guangpu Li and Nava Segev

bound GTP. Thus, such structures provide valuable and detailed structural and mechanistic insights into this critical regulatory process. However, this method also gives a static picture. Hydrogen deuterium exchange mass spectrometry (HDX-MS) provides a way for gaining more dynamic structural insights into a nucleotide exchange reaction in an aqueous environment. Lauer and Zerial used HDX-MS to analyze the nucleotide exchange reaction of Rab5 in a ternary complex with its GEF/effector complex, Rabex5/Rabaptin5 (Chapter 6). Using this method, a “handover” of Rab5 from the GEF (Rabex5) to the effector (Rabaptin5) could be established [25]. This approach can be used for studying molecular mechanisms of activation and deactivation of other Rabs. 2. Rab Localization: Determining the localization of Rabs to specific compartments of the cell has been a goal pursued since the beginning of the field. However, until recently the localization data have been questionable due to the use of Rab overexpression and the fact that these proteins can reside on more than one compartment. A combination of advanced immunofluorescence (IF), live-cell (including time-lapse) analyses, and electron microscopy (EM), should help localize Rabs more accurately, especially in a dynamic process. Here, we highlight two cutting-edge technologies used recently to study Rab localization; one that combines fluorescent and electron microscopy and the other that makes use of photoactivatable tags. A Rab11-Rab8 cascade functions in assembly of the primary cilium signaling hub [26]. However, precise mechanisms, including the relationships of these Rabs with the membraneshaping proteins EDH1/EDH3, were unknown. Accurate localization of multiple proteins within primary cilia can be achieved using correlative light and electron microscopy (CLEM; Chapter 7). Lu et al. used CLEM for colocalization of Rab8, which localizes to the ciliary membrane, and EDH1/ EDH3, which localize to a ciliary pocket membrane. Using this approach, the localizations of Rab8 and EDH1/EDH3 could be resolved [27]. The CLEM protocol described here can be used for precise localization of other players in ciliogenesis. Mechanistic insights are very often gleaned also from kinetic analyses. For example, visualizing cycling of an individual Rab between the membrane and cytosol is a first step in deciphering how this cycling is regulated. Proteins labeled with a fluorescent moiety (e.g., GFP) and photoactivatable (pa) fluorescent tags (e.g., paGFP) can be used in fluorescence recovery after photobleaching (FRAP) and fluorescence localization after photobleaching (FLAP), respectively [28]. These techniques were used for determining the kinetic parameters of

Newer Methods Drive Recent Insights into Rab GTPase Biology: An Overview

7

spatial cycling of Rab1 in live cells under different conditions, for example, drugs and mutations that inhibit relevant processes (Chapter 8). Coordination of GTPase cycles of Rab1 by GEFs, GAPs, GDF, and GDI, was determined using this approach combined with mathematical modeling [29]. This combination should be effective for studying membrane–cytoplasm cycling of other Rabs.

3

Rab Interactions (Chapters 9–12) The Rab GTPases interactome has been continuously expanding throughout the years of research in the field. Their direct interactors include regulators and downstream effectors that together are estimated to include >200 proteins, which is >1% of the human proteome [30]. Until recently, Rab interactors were identified and confirmed using a combination of biochemical approaches, like coprecipitation, and in vivo approaches, like the yeast two-hybrid system [31]. Improving the efficiency and accuracy of these approaches enabled identification and characterization of multiple new interactors of individual Rabs in vitro and in vivo, and other approaches were used for ensuring the role of these interactions. In this section, we give examples of adapting the yeast two-hybrid (Y2H) system for a high throughput use, refining a FRET assay for assessing affinities of Rab interactions, identifying interactors of a Rab that contains a unique domain, and approaches for determining roles of Rab interactions. Combining deep sequencing, a highly complex library, and the Y2H system using the DEEPN (dynamic enrichment for evaluation of protein networks) approach, allows simultaneous comparisons of interactomes of more than one protein. This approach was used with the GDP- and GTP-bound forms of Rab5 to compare interactors of this Rab in its active and inactive forms [32]. Peterson and Piper describe how to use this approach to differentiate between different Rab proteins that bind the same interactor, determine the Rab nucleotide-bound confirmation, and identify effector subdomains that mediate interactions with the different Rabs (Chapter 9). Fluorescence resonance energy transfer (FRET) has been used to confirm close proximity (60 human Rabs has occupied the field since its inception. In the beginning of the field, studying the effects of Ypt mutations that render loss-offunction or gain-of-function phenotypes, which were based on known Ras oncogenic mutations, dominated the field [48]. The challenge of using either gain-of-function or loss-of-function mutations has been to tease apart direct and indirect effects. This is because disruption of one step in a pathway can affect downstream, and even upstream (e.g., due to traffic congestion), steps. To add to the challenge, it turns out that Rabs can function in more than one pathway, for example, Rab1 in the beginning of the exocytic pathway and autophagy, and Rab5 and Rab7 in endocytosis and late autophagy [49]. In this section, we provide examples of how these challenges have been tackled recently in yeast and mammalian cells. 1. Yeast: Using deletion analyses in yeast, it was shown that while the exocytic Ypts are required for cell viability (Ypt1, Ypt31/32 pair, Sec4), endocytic (Vps21, Ypt52, Ypt53), and recycling (Ypt6) Ypts are not. Therefore, while the roles of endocytic Ypts have been mostly determined using deletion mutants, those of exocytic Ypts were studies using conditional mutations [50]. Here, we give two examples of how combination of lossof-function and activating mutations was used to explore novel roles for Ypts: regulation of Golgi cisternal maturation and control of a kinase activity. One underexplored area in the exocytic pathway has been transport through the Golgi. While cisternal maturation has been the prevailing model regarding transport through the Golgi [51], it was not known if and how this process is regulated. Kim et al. used a combination of classical and molecular genetics together with static and dynamic fluorescence microscopy to explore the localization and roles of the Golgi gatekeepers, Ypt1 and Ypt31, in the regulation of Golgi cisternal maturation. Using this strategy, localization of Ypt1 and Ypt31 to early and late Golgi, respectively, was confirmed. Moreover,

10

Guangpu Li and Nava Segev

the regulation of Golgi cisternal maturation by Rabs was established, and was divided into two steps regulated successively by Ypt1 and Ypt31 [52]. Importantly, showing complementary effects of loss-of-function and activating mutations on the compartment in question is proposed as a strategy for assessing complicated dynamic effects (Chapter 13). While the established role of Rabs is in recruitment of their effectors to membranes, Wang et al. suggest that Ypt1/Rab1 can also regulate a kinase activity [53]. The yeast Hrr25 and its mammalian homolog casein kinase 1 delta (CK1δ), which play roles in cell cycle, mitosis, and meiosis [54], were identified as effectors of Ypt1 and Rab1, respectively. Depletion of Ypt1 (ypt1-3) or Rab1 (by knockdown) resulted in an increase in the level of the kinase in the cytoplasm, supporting a role of the Rab in its recruitment to membranes. Moreover, Hrr25 precipitated from ypt1-3 mutant cells showed lower kinase activity, and addition of activated Ypt1 resulted in its increase (Chapter 14). Although it is not clear that Ypt1 directly regulates the kinase activity of Hrr25, recruitment of CK1δ by Ypt1/Rab1 might control the function of this kinase in membrane traffic. 2. Mammalian cells: In addition to dominant activating mutations, the use of protein depletion technologies to study Rab functions in mammals has progressed from Rab knockdown (KD), through Rab knockout (KO) in tissue-culture cells, to conditional Rab KO in whole organisms. Here we give examples of using Rab KD, KO in combination with protein proximity labeling (e.g., APEX), creating Rab KO cell line collection, and using conditional Rab KO mice for studying Rab function in cells and animals. Commercially available small interfering RNAs, siRNAs, can be used to target Rabs and their effectors in human cell lines. Framer and Caplan delineate combining such KD approach with freely available software, for assessing qualitative and quantitative effects on mitochondrial homeostasis (Chapter 15). Using this approach, they demonstrated the role of the Rab5 effector rabankyrin-5 in mitochondrial dynamics [55]. To identify a Rab that plays a specific role in lipid droplet (LD) growth, Xu et al. started with KD of 20 Rabs that localize to LDs, and followed with KO of Rab18 as the likely culprit. Rab18 KD and KO resulted in accumulation of fewer and smaller LDs [56]. Xu et al. describe methods they used to show opposite effects of Rab18 overexpression and KO on LD growth using fluorescence microscopy, and effects on contact sites of LDs with the endoplasmic reticulum (ER), using APEX-EM technology. In the latter, APEX2, a peroxidase developed for protein proximity labeling, can be used also to

Newer Methods Drive Recent Insights into Rab GTPase Biology: An Overview

11

generate contrast useful for EM imaging [57]. APEX2 fused to GBP (GFP-binding protein) was expressed together with a GFP-tagged marker for the ER (Stx18) to document LD links to the ER (Chapter 16). In a high throughput screen for essential genes in five different human cell lines, no Rabs were found among the 1580 essential genes identified out of the ~20,000 gens screened [58]. This allowed for systematic KO of almost all Rabs in epithelial MDCK cells and this collection of Rab KOs is available for further functional analyses (Chapter 17). At least for Rab1 and Rab5, which have multiple paralogs, KO of all the paralogs reveals their essentiality for cell viability [59, 60]. For others, like Rab2, Rab6, and Rab7, even though KO of the multiple paralogs did not result in lethality, it caused clear transport or morphological defects [60]. While individual Rabs may not be essential in human cell lines, this is not the case in whole animals. This suggests obligate roles during development or in tissue specific contexts, or both. A good example of the essential nature of a Rab is the fact that although Rab6 is not essential for cell viability, homozygous Rab6A KO mice are embryonically lethal. Therefore, Bardin et al. used the Cre/lox system to generate conditional Rab6A KO in mice, from which mouse embryonic fibroblasts (MEFs) were isolated (Chapter 18). Using these MEFs, the roles of Rab6A previously shown in the cellular studies were confirmed [61]. Moreover, using this conditional KO in mammary luminal secretory and T cell lineages established the roles of Rab6 in the lactogenic function of the mammary gland, and T cell activation in the immune synapse [62, 63]. This suggests that the function of Rab6 depends on cell type specialization and tissue context. Therefore, future studies of the effect of the conditional Rab6A KO in other tissues and organs (e.g., in the brain) may well provide additional functional insights into this essential Rab.

5

Rab Dysfunction and Disease (Chapters 19–21) Due to the importance of Rab GTPases and intracellular membrane traffic in cellular physiology and homeostasis, it is perhaps not surprising that mutations or altered expression and localization of Rabs or Rab-interacting proteins are associated with a multitude of diseases. Depending on the transport pathways and cell types/ cargoes affected, these diseases range from neurological disorders and cancer to pathogen infection [64–66]. Here, we summarize methods for determining Rab5 expression levels in developing brain tissues, assessing Rab5 activation in Alzheimer’s disease (AD) and Down syndrome (DS), and capturing Rab vesicles during Toxoplasma gondii infection.

12

Guangpu Li and Nava Segev

Rab5 localizes to early endosomes and regulates early endosome fusion and endocytosis, and its upregulation in specific neurons is associated with AD and mild cognitive impairment [67]. However, Rab5 distribution in brain tissues is currently unknown. To this end, Kam et al. validated a polyclonal Rab5 antibody for usage in immunohistochemistry assays for determining Rab5 expression levels in different regions of developing human brains (Chapter 19). When comparing levels of Rab5 with other members of the Rab5 subfamily (including Rab17, Rab22, and Rab31), it was apparent that Rab5 and Rab22 are highly expressed, albeit in different neurons and regions of the human brain. In addition, Rab expression levels depend on gestational age and maturation of the brain, and in general, fetal brains show higher expression of these Rabs than adult brains. This method should help determine levels of Rabs in general, and Rab5 subfamily members in particular, in diseased brains. In addition to upregulation in the levels of expression, Rab5 is also abnormally activated in brains of AD patients and fibroblasts from DS patients, with increased Rab5-GTP levels and enlarged Rab5-positive endosomes [68, 69]. Pensalfini et al. describe several techniques to detect Rab5 activation in disease models of AD and DS. These include indirect measurements of Rab5 dissociation rate from the endosomes by FRAP, and quantification of early endosomal size by fluorescent and electron microscopy. Direct measurements assess Rab5-GTP levels by immunocytochemistry and immunoprecipitation using antibodies specific for Rab5-GTP, and biochemical analysis of Rab5-GTP using GTP-agarose pulldown (Chapter 20). Rabs are also important for infectious diseases caused by human pathogens, such as viruses, bacteria, and protozoa, which hijack host cell components to facilitate their infection and proliferation. Rabs have emerged as targets for such hijacking by a number of pathogens [10]. One example is the protozoa parasite Toxoplasma gondii, which infects mammalian cells and forms a membrane-bound compartment called the parasitophorous vacuole (PV). The parasite recruits multiple, but distinct, host Rab-coated vesicles and redirects them to the PV. The PV internalizes these vesicles to feed the parasite with their nutrient content [70]. To distinguish between Rab vesicles trapped in the PV from those localized elsewhere, immunofluorescence microscopy techniques were used to identify intra-PV Rab11-positive vesicles (Chapter 21). In combination with advanced image analysis software, these microscopy techniques may be applied to investigate the distribution, morphology and abundance of additional Rab vesicles in the PV of Toxoplasma gondii and other intravacuolar parasites, such as Plasmodium and Chlamydiae.

Newer Methods Drive Recent Insights into Rab GTPase Biology: An Overview

6

13

Future Perspectives: How New Technologies Can Benefit the Rab Field? This overview provides a “tour de force” of recent methods used by Rab researchers during the past 5 years, new insights they have promoted, and possible ways they can be used by the Rab community and beyond. Here, we will comment on open questions in the Rab field and how new methods can contribute to addressing them. Regulation questions: Two major, unresolved issues about regulation are the specificity by which GEFs and GAPs act on individual Rabs in vivo, and elucidation of molecular mechanisms of Rab activation and inactivation. Addressing the first question would require colocalization of individual GTPases with their regulators in cells in which they function, and especially, determining the activation state of the Rab in vivo following depletion of the regulators. The second question can be tackled by a combination of high-resolution structural methods, especially those that can be used to solve the structures of native proteins (e.g., HDS-MS and cryo-EM). Localization challenges: The major challenges in localizing individual Rabs to the specific compartment/s in which they function are: first, assessing localization of Rabs expressed at their endogenous levels, and second, the dynamic nature of these proteins that reside in more than one compartment and sometimes function in more than one pathway. Genome editing to introduce tags in endogenous loci should help in avoiding overexpression of the Rab, and advanced microscopy, including time-lapse analyses, should help localize endogenous Rabs more accurately, especially in dynamic processes. Interaction questions: Because individual Rabs interact with multiple proteins, high-throughput approaches should help define the extended Rab interactome and ideally begin to clarify the extent of functional overlap or redundancy. For individual interactions, colocalization of interacting proteins would support the biological relevance of the interaction and show where in the cell the interaction occurs. Importantly, the role of existing and new interactions should be confirmed in vivo, using interaction-defective mutations. Finally, because individual Rabs can be engaged in multiple interactions, it is important to determine the timing and order of these multiple interactions using dynamic approaches. Function questions: While in yeast the exocytic Ypts are essential for yeast cell viability [50], individual Rabs are not essential for viability in cell culture [58]. At least one reason for this apparent distinction is the existence of multiple Rab paralogs present in the human proteome [3]. Indeed, multiple KOs of the Rab1 and Rab5 paralogs showed that these two are essential for cell viability [59, 60], consistent with the paralogs having some level of functional overlap. Moreover, the fact that a gene is not essential for cell viability does not mean that the protein is not important. It is

14

Guangpu Li and Nava Segev

expected that multiple KOs of some Rab subfamilies would reveal effects, albeit mild, on specific intracellular traffic events. Finally, potential functional overlap or redundancy between Rabs should also be addressed. When progressing from studies in cells to organisms, even if a Rab is not essential for cell viability, its depletion can result in embryonic mortality (e.g., Rab6 KO). This points to the likelihood of tissue specific essential roles for different Rabs. In such cases, a conditional KO is more fruitful for subsequent functional analyses in different tissues [61]. Finally, until recently, the field mostly addressed the roles of Rabs in basic cellular processes conserved from yeast to human cells: secretion, endocytosis, and autophagy. Current research in the Rab field has begun addressing more specialized processes, like formation and maintenance of primary cilia and the role of Rabs in the brain. Rabs in Disease: While depletion of essential Rabs might result in cell or embryonic lethality, more subtle mutations of essential Rabs and depletion of nonessential Rabs can cause human disease. Indeed, the involvement of Rabs in acquired and infectious diseases is well documented [8, 10]. Currently, efforts are underway to use Rabs and their interactors as therapeutic targets for cancer, neurodegenerative, immune, and infectious diseases [71–74]. Finally, information about the involvement of Rabs and their interactors in rare inherited disorders is rapidly growing due to genetic sequencing, like whole-exome sequencing [75, 76]. This information would provide diagnostic markers and allow for gene therapy, for example, rescue of REP-1, a Rab escort protein (catalyzes Rab prenylation), by recombinant adenovirus to cure a retinal degenerative disease [77]. Future summary: Zooming in, the field is going from the big picture, using high-throughput methods, through organizing individual Rabs in GTPase module/s and assigning them to specific cells, compartments, and transport steps, to understanding mechanisms of Rab action at the atomic level. While using existing and new cell biological methods will help develop a more comprehensive picture of Rab biology, incorporating methods from other disciplines (e.g., chemistry, physics, and modeling) would benefit the Rab field even further. We all look forward to such work in the (near) future.

Acknowledgments We thank Rick Kahn for critical reading of the manuscript. This research was supported by the NIH grant R01GM074692 and a PHF grant to G. Li; and grants GM-45444 from the National Institute of General Medical Sciences (NIGMS), and NS-099556 from the National Institute of Neurological Disorders and Stroke (NINDS) to N. Segev.

Newer Methods Drive Recent Insights into Rab GTPase Biology: An Overview

15

References 1. Goud B, Salminen A, Walworth NC, Novick PJ (1988) A GTP-binding protein required for secretion rapidly associates with secretory vesicles and the plasma membrane in yeast. Cell 53 (5):753–768. https://doi.org/10.1016/ 0092-8674(88)90093-1 2. Segev N, Mulholland J, Botstein D (1988) The yeast GTP-binding YPT1 protein and a mammalian counterpart are associated with the secretion machinery. Cell 52(6):915–924. https://doi.org/10.1016/0092-8674(88) 90433-3 3. Diekmann Y, Seixas E, Gouw M, TavaresCadete F, Seabra MC, Pereira-Leal JB (2011) Thousands of Rab GTPases for the cell biologist. PLoS Comput Biol 7(10):e1002217. https://doi.org/10.1371/journal.pcbi. 1002217 4. Segev N (2001) Ypt/Rab gtpases: regulators of protein trafficking. Sci STKE 2001(100):re11. https://doi.org/10.1126/stke.2001.100. re11 5. Segev N (2001) Ypt and Rab GTPases: insight into functions through novel interactions. Curr Opin Cell Biol 13(4):500–511. https://doi. org/10.1016/s0955-0674(00)00242-8 6. Zerial M, McBride H (2001) Rab proteins as membrane organizers. Nat Rev Mol Cell Biol 2 (2):107–117. https://doi.org/10.1038/ 35052055 7. Pfeffer SR (2017) Rab GTPases: master regulators that establish the secretory and endocytic pathways. Mol Biol Cell 28(6):712–715. https://doi.org/10.1091/mbc.E16-10-0737 8. Guadagno NA, Progida C (2019) Rab GTPases: switching to human diseases. Cell 8 (8). https://doi.org/10.3390/cells8080909 9. Banworth MJ, Li G (2018) Consequences of Rab GTPase dysfunction in genetic or acquired human diseases. Small GTPases 9 (1-2):158–181. https://doi.org/10.1080/ 21541248.2017.1397833 10. Spano S, Galan JE (2018) Taking control: hijacking of Rab GTPases by intracellular bacterial pathogens. Small GTPases 9 (1-2):182–191. https://doi.org/10.1080/ 21541248.2017.1336192 11. Rab GTPases (2015) In: Li G (ed) Methods and protocols. Springer, New York 12. Segev N (2011) GTPases in intracellular trafficking: an overview. Semin Cell Dev Biol 22 (1):1–2. https://doi.org/10.1016/j.semcdb. 2010.12.004. 13. Jones S, Richardson CJ, Litt RJ, Segev N (1998) Identification of regulators for Ypt1

GTPase nucleotide cycling. Mol Biol Cell 9 (10):2819–2837. https://doi.org/10.1091/ mbc.9.10.2819 14. Kanie T, Jackson PK (2018) Guanine nucleotide exchange assay using fluorescent MANTGDP. Bio Protoc 8(7). https://doi.org/10. 21769/BioProtoc.2795 15. Gomez RC, Wawro P, Lis P, Alessi DR, Pfeffer SR (2019) Membrane association but not identity is required for LRRK2 activation and phosphorylation of Rab GTPases. J Cell Biol 218 (12):4157–4170. https://doi.org/10.1083/ jcb.201902184 16. Berwick DC, Heaton GR, Azeggagh S, Harvey K (2019) LRRK2 biology from structure to dysfunction: research progresses, but the themes remain the same. Mol Neurodegener 14(1):49. https://doi.org/10.1186/s13024019-0344-2 17. Barr F, Lambright DG (2010) Rab GEFs and GAPs. Curr Opin Cell Biol 22(4):461–470. https://doi.org/10.1016/j.ceb.2010.04.007 18. Mishra AK, Lambright DG (2015) Highthroughput assay for profiling the substrate specificity of Rab GTPase-activating proteins. Methods Mol Biol 1298:47–60. https://doi. org/10.1007/978-1-4939-2569-8_4 19. Mishra AK, Del Campo CM, Collins RE, Roy CR, Lambright DG (2013) The legionella pneumophila GTPase activating protein LepB accelerates Rab1 deactivation by a non-canonical hydrolytic mechanism. J Biol Chem 288(33):24000–24011. https://doi. org/10.1074/jbc.M113.470625 20. Nottingham RM, Pusapati GV, Ganley IG, Barr FA, Lambright DG, Pfeffer SR (2012) RUTBC2 protein, a Rab9A effector and GTPase-activating protein for Rab36. J Biol Chem 287(27):22740–22748. https://doi. org/10.1074/jbc.M112.362558 21. Tong SJ, Wall AA, Hung Y, Luo L, Stow JL (2019) Guanine nucleotide exchange factors activate Rab8a for toll-like receptor signalling. Small GTPases:1–17. https://doi.org/10. 1080/21541248.2019.1587278. 22. Yuan H, Davis S, Ferro-Novick S, Novick P (2017) Rewiring a Rab regulatory network reveals a possible inhibitory role for the vesicle tether, Uso1. Proc Natl Acad Sci U S A 114 (41):E8637–E8E45. https://doi.org/10. 1073/pnas.1708394114. 23. Muller MP, Goody RS (2018) Molecular control of Rab activity by GEFs, GAPs and GDI. Small GTPases 9(1-2):5–21. https://doi.org/ 10.1080/21541248.2016.1276999

16

Guangpu Li and Nava Segev

24. Tang D, Sheng J, Xu L, Zhan X, Liu J, Jiang H et al (2020) Cryo-EM structure of C9ORF72SMCR8-WDR41 reveals the role as a GAP for Rab8a and Rab11a. Proc Natl Acad Sci U S A 117(18):9876–9883. https://doi.org/10. 1073/pnas.2002110117 25. Cezanne A, Lauer J, Solomatina A, Sbalzarini IF (2020) Zerial M. a non-linear system patterns Rab5 GTPase on the membrane. eLife 9. https://doi.org/10.7554/eLife.54434. 26. Blacque OE, Scheidel N, Kuhns S (2018) Rab GTPases in cilium formation and function. Small GTPases 9(1-2):76–94. https://doi. org/10.1080/21541248.2017.1353847 27. Lu Q, Insinna C, Ott C, Stauffer J, Pintado PA, Rahajeng J et al (2015) Early steps in primary cilium assembly require EHD1/EHD3dependent ciliary vesicle formation. Nat Cell Biol 17(4):531. https://doi.org/10.1038/ ncb3155 28. Ishikawa-Ankerhold HC, Ankerhold R, Drummen GP (2012) Advanced fluorescence microscopy techniques--FRAP, FLIP, FLAP, FRET and FLIM. Molecules 17(4):4047–4132. https://doi.org/10.3390/ molecules17044047 29. Voss S, Li F, Ratz A, Roger M, Wu YW (2019) Spatial cycling of Rab GTPase, driven by the GTPase cycle, controls Rab’s subcellular distribution. Biochemistry 58(4):276–285. https:// doi.org/10.1021/acs.biochem.8b00932. 30. Ponomarenko EA, Poverennaya EV, Ilgisonis EV, Pyatnitskiy MA, Kopylov AT, Zgoda VG et al (2016) The size of the human proteome: the width and depth. Int J Anal Chem 2016:7436849. https://doi.org/10.1155/ 2016/7436849 31. Stasi M, De Luca M, Bucci C (2015) Twohybrid-based systems: powerful tools for investigation of membrane traffic machineries. J Biotechnol 202:105–117. https://doi.org/ 10.1016/j.jbiotec.2014.12.007 32. Pashkova N, Peterson TA, Krishnamani V, Breheny P, Stamnes M, Piper RC (2016) DEEPN as an approach for batch processing of yeast 2-hybrid interactions. Cell Rep 17 (1):303–315. https://doi.org/10.1016/j.cel rep.2016.08.095 33. Zaccolo M (2004) Use of chimeric fluorescent proteins and fluorescence resonance energy transfer to monitor cellular responses. Circ Res 94(7):866–873. https://doi.org/10. 1161/01.RES.0000123825.83803.CD 34. Al-Saad RZ, Kerr I, Hume AN (2020) In vitro fluorescence resonance energy transfer-based assay used to determine the Rab27-effectorbinding affinity. Assay Drug Dev Technol 18

(4):180–194. https://doi.org/10.1089/adt. 2019.960 35. Li Z, Fang R, Fang J, He S, Liu T (2018) Functional implications of Rab27 GTPases in cancer. Cell Commun Signal 16(1):44. https://doi.org/10.1186/s12964-018-02559 36. Myat MM, Louis D, Mavrommatis A, Collins L, Mattis J, Ledru M et al (2019) Regulators of cell movement during development and regeneration in drosophila. Open Biol 9 (5):180245. https://doi.org/10.1098/rsob. 180245 37. Lee RH, Iioka H, Ohashi M, Iemura S, Natsume T, Kinoshita N (2007) XRab40 and XCullin5 form a ubiquitin ligase complex essential for the noncanonical Wnt pathway. EMBO J 26(15):3592–3606. https://doi. org/10.1038/sj.emboj.7601781 38. Lipatova Z, Belogortseva N, Zhang XQ, Kim J, Taussig D, Segev N (2012) Regulation of selective autophagy onset by a Ypt/Rab GTPase module. Proc Natl Acad Sci U S A 109(18):6981–6986. https://doi.org/10. 1073/pnas.1121299109 39. Lipatova Z, Kim JJ, Segev N (2015) Ypt1 and TRAPP interactions: optimization of multicolor bimolecular fluorescence complementation in yeast. Methods Mol Biol 1298:107–116. https://doi.org/10.1007/ 978-1-4939-2569-8_9 40. Najumudeen AK, Guzman C, Posada IM, Abankwa D (2015) Rab-NANOPS: FRET biosensors for Rab membrane nanoclustering and prenylation detection in mammalian cells. Methods Mol Biol 1298:29–45. https://doi. org/10.1007/978-1-4939-2569-8_3 41. Alfonzo-Mendez MA, Hernandez-Espinosa DA, Carmona-Rosas G, Romero-Avila MT, Reyes-Cruz G, Garcia-Sainz JA (2017) Protein kinase C activation promotes alpha1Badrenoceptor internalization and late endosome trafficking through Rab9 interaction. Role in heterologous desensitization. Mol Pharmacol 91(4):296–306. https://doi.org/ 10.1124/mol.116.106583 42. Lete MG, Byrne RD, Alonso A, Poccia D, Larijani B (2017) Vesicular PtdIns(3,4,5)P3 and Rab7 are key effectors of sea urchin zygote nuclear membrane fusion. J Cell Sci 130 (2):444–452. https://doi.org/10.1242/jcs. 193771 43. Lipatova Z, Tokarev AA, Jin Y, Mulholland J, Weisman LS, Segev N (2008) Direct interaction between a myosin V motor and the Rab GTPases Ypt31/32 is required for polarized

Newer Methods Drive Recent Insights into Rab GTPase Biology: An Overview secretion. Mol Biol Cell 19(10):4177–4187. https://doi.org/10.1091/mbc.E08-02-0220 44. Rothbauer U, Zolghadr K, Muyldermans S, Schepers A, Cardoso MC, Leonhardt H (2008) A versatile nanotrap for biochemical and functional studies with fluorescent fusion proteins. Mol Cell Proteomics 7(2):282–289. https://doi.org/10.1074/mcp.M700342MCP200 45. Chen YH, Wang GY, Hao HC, Chao CJ, Wang Y, Jin QW (2017) Facile manipulation of protein localization in fission yeast through binding of GFP-binding protein to GFP. J Cell Sci 130(5):1003–1015. https://doi.org/10. 1242/jcs.198457 46. Zhou F, Wu Z, Zhao M, Murtazina R, Cai J, Zhang A et al (2019) Rab5-dependent autophagosome closure by ESCRT. J Cell Biol 218 (6):1908–1927. https://doi.org/10.1083/ jcb.201811173 47. Tang JC, Szikra T, Kozorovitskiy Y, Teixiera M, Sabatini BL, Roska B et al (2013) A nanobodybased system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Cell 154(4):928–939. https://doi.org/10.1016/j. cell.2013.07.021 48. Cherfils J, Zeghouf M (2013) Regulation of small GTPases by GEFs, GAPs, and GDIs. Physiol Rev 93(1):269–309. https://doi.org/ 10.1152/physrev.00003.2012 49. Lipatova Z, Segev N (2014) Ypt/Rab GTPases regulate two intersections of the secretory and the endosomal/lysosomal pathways. Cell Logist 4(3):e954870. https://doi.org/10. 4161/21592780.2014.954870 50. Lipatova Z, Hain AU, Nazarko VY, Segev N (2015) Ypt/Rab GTPases: principles learned from yeast. Crit Rev Biochem Mol Biol 50 (3):203–211. https://doi.org/10.3109/ 10409238.2015.1014023 51. Nakano A, Luini A (2010) Passage through the Golgi. Curr Opin Cell Biol 22(4):471–478. https://doi.org/10.1016/j.ceb.2010.05.003 52. Kim JJ, Lipatova Z, Majumdar U, Segev N (2016) Regulation of Golgi Cisternal progression by Ypt/Rab GTPases. Dev Cell 36 (4):440–452. https://doi.org/10.1016/j. devcel.2016.01.016 53. Wang J, Davis S, Menon S, Zhang J, Ding J, Cervantes S et al (2015) Ypt1/Rab1 regulates Hrr25/CK1delta kinase activity in ER-Golgi traffic and macroautophagy. J Cell Biol 210 (2):273–285. https://doi.org/10.1083/jcb. 201408075 54. Xu P, Ianes C, Gartner F, Liu C, Burster T, Bakulev V et al (2019) Structure, regulation, and (patho-)physiological functions of the

17

stress-induced protein kinase CK1 delta (CSNK1D). Gene 715:144005. https://doi. org/10.1016/j.gene.2019.144005 55. Farmer T, Reinecke JB, Xie S, Bahl K, Naslavsky N, Caplan S (2017) Control of mitochondrial homeostasis by endocytic regulatory proteins. J Cell Sci 130(14):2359–2370. https://doi.org/10.1242/jcs.204537 56. Xu D, Li Y, Wu L, Li Y, Zhao D, Yu J et al (2018) Rab18 promotes lipid droplet (LD) growth by tethering the ER to LDs through SNARE and NRZ interactions. J Cell Biol 217(3):975–995. https://doi.org/10. 1083/jcb.201704184 57. Martell JD, Deerinck TJ, Lam SS, Ellisman MH, Ting AY (2017) Electron microscopy using the genetically encoded APEX2 tag in cultured mammalian cells. Nat Protoc 12 (9):1792–1816. https://doi.org/10.1038/ nprot.2017.065 58. Hart T, Chandrashekhar M, Aregger M, Steinhart Z, Brown KR, MacLeod G et al (2015) High-resolution CRISPR screens reveal fitness genes and genotype-specific cancer liabilities. Cell 163(6):1515–1526. https:// doi.org/10.1016/j.cell.2015.11.015 59. Blomen VA, Majek P, Jae LT, Bigenzahn JW, Nieuwenhuis J, Staring J et al (2015) Gene essentiality and synthetic lethality in haploid human cells. Science 350(6264):1092–1096. https://doi.org/10.1126/science.aac7557 60. Homma Y, Kinoshita R, Kuchitsu Y, Wawro PS, Marubashi S, Oguchi ME et al (2019) Comprehensive knockout analysis of the Rab family GTPases in epithelial cells. J Cell Biol 218(6):2035–2050. https://doi.org/10. 1083/jcb.201810134 61. Bardin S, Miserey-Lenkei S, Hurbain I, GarciaCastillo D, Raposo G, Goud B (2015) Phenotypic characterisation of RAB6A knockout mouse embryonic fibroblasts. Biol Cell 107 (12):427–439. https://doi.org/10.1111/ boc.201400083 62. Carpier JM, Zucchetti AE, Bataille L, Dogniaux S, Shafaq-Zadah M, Bardin S et al (2018) Rab6-dependent retrograde traffic of LAT controls immune synapse formation and T cell activation. J Exp Med 215 (4):1245–1265. https://doi.org/10.1084/ jem.20162042 63. Cayre S, Faraldo M, Sabine Bardin, MisereyLenkei S, Deugnier M, Goud B. RAB6 GTPase is a crucial regulator of the mammary secretory function controlling STAT5 activation. bioRxiv. 2020 64. Banworth MJ, Li G (2018) Consequences of Rab GTPase dysfunction in genetic or acquired

18

Guangpu Li and Nava Segev

human diseases. Small GTPases 9 (1-2):158–181. https://doi.org/10.1080/ 21541248.2017.1397833 65. Corbeel L, Freson K (2008) Rab proteins and Rab-associated proteins: major actors in the mechanism of protein-trafficking disorders. Eur J Pediatr 167(7):723–729. https://doi. org/10.1007/s00431-008-0740-z 66. Seabra MC, Mules EH, Hume AN (2002) Rab GTPases, intracellular traffic and disease. Trends Mol Med 8(1):23–30. https://doi. org/10.1016/s1471-4914(01)02227-4 67. Ginsberg SD, Mufson EJ, Alldred MJ, Counts SE, Wuu J, Nixon RA et al (2011) Upregulation of select Rab GTPases in cholinergic basal forebrain neurons in mild cognitive impairment and Alzheimer’s disease. J Chem Neuroanat 42(2):102–110. https://doi.org/ 10.1016/j.jchemneu.2011.05.012 68. Jiang Y, Mullaney KA, Peterhoff CM, Che S, Schmidt SD, Boyer-Boiteau A et al (2010) Alzheimer’s-related endosome dysfunction in down syndrome is Abeta-independent but requires APP and is reversed by BACE-1 inhibition. Proc Natl Acad Sci U S A 107 (4):1630–1635. https://doi.org/10.1073/ pnas.0908953107 69. Kim S, Sato Y, Mohan PS, Peterhoff C, Pensalfini A, Rigoglioso A et al (2016) Evidence that the rab5 effector APPL1 mediates APP-betaCTF-induced dysfunction of endosomes in down syndrome and Alzheimer’s disease. Mol Psychiatry 21(5):707–716. https:// doi.org/10.1038/mp.2015.97 70. Romano JD, Nolan SJ, Porter C, Ehrenman K, Hartman EJ, Hsia RC et al (2017) The parasite toxoplasma sequesters diverse Rab host vesicles within an intravacuolar network. J Cell Biol 216(12):4235–4254. https://doi.org/10. 1083/jcb.201701108

71. Murray RZ, Stow JL (2014) Cytokine secretion in macrophages: SNAREs, Rabs, and membrane trafficking. Front Immunol 5:538. https://doi.org/10.3389/fimmu.2014. 00538 72. Pashaei-Asl R, Khodadadi K, Pashaei-Asl F, Haqshenas G, Ahmadian N, Pashaiasl M et al (2017) Legionella Pneumophila and dendrimers-mediated antisense therapy. Adv Pharm Bull 7(2):179–187. https://doi.org/ 10.15171/apb.2017.022 73. Qin X, Wang J, Wang X, Liu F, Jiang B, Zhang Y (2017) Targeting Rabs as a novel therapeutic strategy for cancer therapy. Drug Discov Today 22(8):1139–1147. https://doi.org/10.1016/ j.drudis.2017.03.012 74. Zhang X, Huang TY, Yancey J, Luo H, Zhang YW (2019) Role of Rab GTPases in Alzheimer’s disease. ACS Chem Neurosci 10 (2):828–838. https://doi.org/10.1021/ acschemneuro.8b00387 75. Koparir A, Karatas OF, Yilmaz SS, Suer I, Ozer B, Yuceturk B et al (2019) Revealing the functions of novel mutations in RAB3GAP1 in Martsolf and Warburg micro syndromes. Am J Med Genet A 179(4):579–587. https://doi. org/10.1002/ajmg.a.61065 76. Van Bergen NJ, Guo Y, Al-Deri N, Lipatova Z, Stanga D, Zhao S et al (2020) Deficiencies in vesicular transport mediated by TRAPPC4 are associated with severe syndromic intellectual disability. Brain 143(1):112–130. https://doi. org/10.1093/brain/awz374 77. Anand V, Barral DC, Zeng Y, Brunsmann F, Maguire AM, Seabra MC et al (2003) Gene therapy for choroideremia: in vitro rescue mediated by recombinant adenovirus. Vis Res 43(8):919–926. https://doi.org/10.1016/ s0042-6989(02)00389-9

Chapter 2 Rab29 Fast Exchange Mutants: Characterization of a Challenging Rab GTPase Rachel C. Gomez, Edmundo G. Vides, and Suzanne R. Pfeffer Abstract Rab29 has been implicated in multiple membrane trafficking processes with no described effectors or regulating proteins. Its fast nucleotide exchange rate and inability to bind GDI in cytosol make it a unique and poorly understood Rab. Because the conventional, “GTP-locked” Rab mutation does not have the desired effect in Rab29, we present here the use of a fluorescence-based assay to characterize novel Rab29 mutants (I64T and V156G) that display faster nucleotide exchange rates, allowing for GEF-independent Rab29 activation. Key words Rab GTPase, Rab29, MANT-GDP, Fast exchange mutant, Nucleotide exchange

1

Introduction Rab GTPases undergo a cycle between active, GTP bound forms and inactive, GDP-bound forms that interconvert by GTP hydrolysis and subsequent nucleotide exchange [1]. For most Rabs, the rate-limiting step in this cycle is GDP release [1]. Rabs have many chaperones and regulators to modulate their activity. For example, GDI (GDP dissociation inhibitor) binds preferentially to GDP-bound Rabs and solubilizes their prenyl groups [2]. GEFs (guanine nucleotide exchange factors) stabilize Rabs on membranes by activating them and driving subsequent effector binding and stabilization. GEF binding remodels the Rab nucleotide binding site, accelerating GDP dissociation, allowing for the more abundant GTP to bind [3]. GAPs (GTPase activating proteins) inactivate Rabs by stimulating their intrinsic GTP hydrolysis capacity [4]. However, to date, many Rabs have no reported GEFs or GAPs. To study Rab phenotypes and binding partners, mutants are often used. A “GTP-locked” mutant, equivalent to Q67 in Rab1,

Guangpu Li and Nava Segev (eds.), Rab GTPases: Methods and Protocols, Methods in Molecular Biology, vol. 2293, https://doi.org/10.1007/978-1-0716-1346-7_2, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

19

20

Rachel C. Gomez et al.

drastically slows GTP hydrolysis [5]. This mutant aids assays of Rab function and binding partners that prefer the GTP bound Rab. Alternatively, mutations in the G1 motif, equivalent to S21N in Rab9, render Rabs GDP-preferring [cf. [6]]. However, these mutations do not always function as expected [3]. Rab29 is localized to the trans Golgi network and activates Parkinson’s Disease associated LRRK2 kinase [7]. It has also been implicated in ciliogenesis, retrograde endosomal membrane trafficking, Golgi structure, and T-cell receptor trafficking [8, 9]. However, thus far, Rab29 has no reported GEF, GAP, or effector partners. Additionally, unlike all other Rab GTPases studied to date, Rab29 is not bound to GDI in cytosol and it releases GDP much faster than Rab5 [10]. Moreover, the Q67L “GTP-locked” Rab29 mutant does not behave as expected: unlike the wild-type protein, it fails to localize to the Golgi and binds nucleotide only weakly [11]. To better understand Rab29’s function and to discover its binding partners, we created “fast exchange” mutants that exchange nucleotide quickly and may be active in a GEF-independent manner. These mutants were designed based on a predicted structure of Rab29, with the goal of weakening interactions between the Rab and nucleotide. We reported previously that Rab29 D63A binds nucleotide extremely poorly [10]. The D63 residue is conserved throughout the Ras superfamily and coordinates a water molecule adjacent to the Mg2+ ion that holds the nucleotide in place. To characterize additional, similar mutants, we employed a fluorescence-based nucleotide release assay based on work from David Lambright and colleagues [12] and prior work from Roger Goody and colleagues [13] that we describe here. N-Methylanthranioyl (MANT) is a fluorescent modification that can be made to guanine nucleotides; its fluorescence increases when bound to a GTPase and use of MANT-GDP allows for continuous monitoring of nucleotide exchange upon addition of an excess of unlabeled nucleotide. We report here the nucleotide exchange properties of two mutants (I64T and V156G) designed by systematic mutagenesis of residues predicted to surround the nucleotide binding pocket of this unusual Rab GTPase (Figs. 1, 2, and 3).

2

Materials

2.1 Purifying Rab29 and its Mutants

1. His-Sumo Rab29 WT and mutants: human Rab29 coding sequence (full length) with a 6 histidine-Sumo tag flush at the N-terminus in pET15b. 2. BL21 DE3 chemically competent expression cells. 3. Luria broth (LB): 10 g/L Bacto tryptone, 5 g/L yeast extract, 10 g/L NaCl.

Rab29 Nucleotide Binding

21

WT I64T V156G

37 kDa-

-His-Sumo Rab29

20 kDa-

Fluorescence (normalized)

Fig. 1 Purified Rab29. SDS-PAGE gel of the indicated proteins after purification. Impurity at ~20 kDa may be cleaved His-Sumo

wild type wild type + EDTA I64T V156G

100 90 80 70 60 50 0

30

60

90

120

time (min) Fig. 2 Rab mutants I64T and V156G show fast nucleotide dissociation. Fluorescence normalized to time point 0 for wild-type (WT), I64T, and V156G Rab proteins

Half time (min)

50 40 30 20 10 0 WT

I164T

V156G

Fig. 3 Rab29 mutants I64T and V156G show increased nucleotide release rates compared with wild-type Rab29 (WT). Shown are calculated half-times from the fit of the MANT-GDP assay fluorescence data to a pseudo-first order decay

22

Rachel C. Gomez et al.

4. Carbenicillin (2000): 100 mg/mL in water, stored at 20  C. 5. 1 M isopropyl beta-D-thiogalactopyranoside (IPTG); stored at 20  C. 6. PMSF: 100 mM in 100% ethanol; stored at

20  C.

7. Protease inhibitors (100): 100 μg/mL each aprotinin, leupeptin, and pepstatin A; stored at 20  C. 8. Lysis buffer: 50 mM Hepes pH 7.4, 200 mM NaCl, 5 mM MgCl2, 5 mM imidazole, 0.5 mM DTT, 20 μM GTP, 10% glycerol, PMSF, protease inhibitor mix. 9. Elution buffer: 50 mM Hepes pH 7.4, 200 mM NaCl, 5 mM MgCl2, 150 mM imidazole, 0.5 mM DTT, 20 μM GTP, 10% glycerol. 10. Ni-NTA agarose. 11. 1 mL syringe with frit at the bottom. 12. PD MiniTrap G-25. 2.2 MANT-GDP Assay

1. Water bath. 2. 5 Exchange buffer: 100 mM Hepes pH 7.4, 750 mM NaCl, 25 mM EDTA. 3. Glycerol. 4. Rab concentrated at or above 7.2 μM. 5. 5 mM MANT-GDP. 6. 2 M MgCl2. 7. Zeba 7 K 0.5 mL spin column. 8. 2 Desalting buffer: 60 mM Hepes pH 7.4, 150 mM NaCl, 5 mM MgCl2. 9. 1 Desalting buffer: 30 mM Hepes pH 7.4, 150 mM NaCl, 5 mM MgCl2. 10. 500 mM EDTA pH 8.0. 11. 96-well black bottom plate. 12. Plate reader (Tecan 200 Pro). 13. 10 mM GDP.

3

Methods

3.1 Purification of Rab29 Proteins

1. A 10 mL overnight culture of each Rab29 construct grown in LB supplemented with carbenicillin is used to inoculate a 1 L culture of LB supplemented with antibiotics. 2. The culture is grown at 37  C until it reaches an OD600 of ~0.6. The cultures are then transferred to 18  C and induced by

Rab29 Nucleotide Binding

23

adding IPTG to a final concentration of 0.3 mM. Cultures are incubated at 18  C for an additional 16 h. 3. Cells are collected by centrifugation (2700  g, 20 min, 4  C). The pellet can be resuspended in PBS and repelleted. The washed pellet can be snap frozen in liquid nitrogen and stored at 20  C for later processing, if desired. 4. The pellet is resuspended in 30 mL lysis buffer. The cells are broken by passing once through an EmulsiFlex-C5 apparatus at 20,000 psi (Avestin). 5. The homogenate is transferred to chilled Oakridge centrifuge tubes and spun at 13,000  g for 20 min at 4  C. Clarified supernatant is saved for analysis. 6. Clarified supernatant is added to fresh 50 mL conical tubes and incubated with 30 μL nickel-NTA resin (equilibrated in lysis buffer) for 2 h at 4  C with rotation. 7. Flowthrough is collected for analysis. Resin is washed in the conical tube three times with a total of 60 column volumes lysis buffer. 8. Resin is transferred to an empty column (either 1 mL syringe or larger column if necessary) using 500 μL of lysis buffer. 9. Rab is eluted from resin with 500 μL of elution buffer. Samples collected for analysis by SDS-PAGE. 10. Protein is desalted using a PD-10 G25 MiniTrap. Elution from desalting column is collected in 4 fractions. Fractions are assayed for protein concentration by Bradford assay and the most concentrated fractions are pooled and snap frozen in liquid nitrogen and stored at 80  C see Notes 1 and 2. 3.2 MANT-GDP Assay

1. Set up reaction mixture as follows: 1 Exchange buffer, 5 μM Rab, 8% glycerol, and 125 μM MANT-GDP in a final volume of 100 μL. Wrap tube in aluminum foil. 2. Incubate in a 25  C water bath for 2 h. 3. Equilibrate Zeba mini trap desalting column in 1 desalting buffer while there is ~10 min left in the nucleotide exchange reaction. 4. Quench reaction by placing on ice and adding a final concentration of 40 mM MgCl2 (2 μL of 2 M MgCl2). 5. Desalt proteins using the equilibrated Zeba mini trap desalting column. After application of sample onto column, add the recommended 15 μL stacker. 6. Set up the plate on ice with 100 μL final sample volume. Set up reaction in duplicate and have duplicate reactions with EDTA for a control. Use 2 desalting buffer: For samples without

24

Rachel C. Gomez et al.

EDTA: 30 mM Hepes pH 7.4, 150 mM NaCl, 5 mM MgCl2; For samples with EDTA: 30 mM Hepes pH 7.4, 150 mM NaCl, 5 mM MgCl2, 20 mM EDTA. 7. Add 1 μM final concentration of Rab and immediately begin monitoring in the plate reader. Excite samples at 360 nm and monitor fluorescence at 440 nm, scanning every minute and shaking before each measurement. 8. Wait until fluorescence has stabilized (~15–20 min). Continue as soon as measurement has stabilized to maximize protein activity and fluorescence. 9. Add 2 μL of 20 mM GDP for a final concentration of 200 μM GDP (see Note 3). 10. Place plate back in plate reader and continue measurements. It’s important to work quickly here to observe the initial kinetic measurements. 11. Plot and analyze using Prism software, considering the last reading before addition of the unlabeled GDP as time zero. Fit to a single phase decay.

4

Notes 1. Yield from 1 L culture for His-Sumo Rab29 is ~0.5 mg/L; note that nucleotide is maintained throughout and all efforts are made to work quickly in the cold; proteins are snap frozen in aliquots and not repeatedly thawed and refrozen. Cobalt resin may be preferable to nickel-NTA in terms of purity. 2. His-Sumo tag may be cleaved from Rab29 using His-SENP1 protease; the presence of the tag aids in soluble protein yield but is not essential; preps of untagged Rab29 yielded 1.2 mg/ 8 L culture. 3. If preferred, add 20 μL of 1 mM GDP using a multichannel pipette.

References 1. Shoji I, Kikuchi A, Kuroda S, Takai Y (1989) Kinetic analysis of the binding of guanine nucleotide to bovine brain smg p25A. Biochem Biophys Res Commun 162(1):273–281. https://doi.org/10.1016/0006-291x(89) 91992-x 2. Rak A, Pylypenko O, Durek T, Watzke A, Kushnir S, Brunsveld L, Waldmann H, Goody RS, Alexandrov K (2003) Structure of Rab GDP-dissociation inhibitor in complex with prenylated YPT1 GTPase. Science 302

(5645):646–650. https://doi.org/10.1126/ science.1087761 3. Barr F, Lambright DG (2010) Rab GEFs and GAPs. Curr Opin Cell Biol 22(4):461–470. https://doi.org/10.1016/j.ceb.2010.04.007 4. Bos JL, Rehmann H, Wittinghofer A (2007) GEFs and GAPs: critical elements in the control of small G proteins. Cell 129(5):865–877. https://doi.org/10.1016/j.cell.2007.05.018 5. Gavriljuk K, Gazdag EM, Itzen A, Ko¨tting C, Goody RS, Gerwert K (2012) Catalytic

Rab29 Nucleotide Binding mechanism of a mammalian Rab·RabGAP complex in atomic detail. Proc Natl Acad Sci U S A 109(52):21348–21353. https://doi. org/10.1073/pnas.1214431110 6. Riederer MA, Soldati T, Shapiro AD, Lin J, Pfeffer SR (1994) Lysosome biogenesis requires Rab9 function and receptor recycling from endosomes to the trans-Golgi network. J Cell Biol 125(3):573–582. https://doi.org/ 10.1083/jcb.125.3.573 7. Purlyte E, Dhekne HS, Sarhan AR, Gomez R, Lis P, Wightman M, Martinez TN, Tonelli F, Pfeffer SR, Alessi DR (2018) Rab29 activation of the Parkinson’s disease-associated LRRK2 kinase. EMBO J 37(1):1–18. https://doi. org/10.15252/embj.201798099 8. Wang S, Ma Z, Xu X, Wang Z, Sun L, Zhou Y, Lin X, Hong W, Wang T (2014) A role of Rab29 in the integrity of the trans-Golgi network and retrograde trafficking of mannose-6phosphate receptor. PLoS One 9(5):e96242. https://doi.org/10.1371/journal.pone. 0096242 9. Onnis A, Finetti F, Patrussi L, Gottardo M, Cassioli C, Spano S, Baldari CT (2015) The small GTPase Rab29 is a common regulator of immune synapse assembly and ciliogenesis. Cell Death Differ 22(10):1687–1699. https:// doi.org/10.1038/cdd.2015.17

25

10. Gomez RC, Wawro P, Lis P, Alessi DR, Pfeffer SR (2019) Membrane association but not identity is required for LRRK2 activation and phosphorylation of Rab GTPases. J Cell Biol 218 (12):4157–4170. https://doi.org/10.1083/ jcb.201902184 11. Beilina A, Rudenko IN, Kaganovich A, Civiero L, Chau H, Kalia SK, Kalia LV, Lobbestael E, Chia R, Ndukwe K, Ding J, Nalls MA, Olszewski M, Hauser DN, Kumaran R, Lozano AM, Baekelandt V, Greene LE, Taymans JM, Greggio E, Cookson MR, International Parkinson’s Disease Genomics C, North American Brain Expression C (2014) Unbiased screen for interactors of leucine-rich repeat kinase 2 supports a common pathway for sporadic and familial Parkinson disease. Proc Natl Acad Sci U S A 111 (7):2626–2631. https://doi.org/10.1073/ pnas.1318306111 12. Delprato A, Lambright DG (1997) Structural basis for Rab GTPase activation by VPS9 domain exchange factors. Nat Struct Mol Biol 14(5):406–412 13. Simon I, Zerial M, Goody RS (1996) Kinetics of interaction of Rab5 and Rab7 with nucleotides and magnesium ions. J Biol Chem 271 (34):20470–20478

Chapter 3 High-Throughput Assay for Profiling the Substrate Specificity of Rab GTPase-Activating Proteins Ashwini K. Mishra and David G. Lambright Abstract Measurement of intrinsic as well as GTPase-activating Protein (GAP) catalyzed GTP hydrolysis is central to understanding the molecular mechanism and function of GTPases in diverse cellular processes. For the Rab GTPase family, which comprises at least 60 distinct proteins in humans, putative GAPs have been identified from both eukaryotic organisms and pathogenic bacteria. A major obstacle has involved identification of target substrates and determination of the specificity for the Rab family. Here, we describe a sensitive, highthroughput method to quantitatively profile GAP activity for Rab GTPases in microplate format based on detection of inorganic phosphate released after GTP hydrolysis. The method takes advantage of a wellcharacterized fluorescent phosphate sensor, requires relatively low protein concentrations, and can, in principle, be applied to any GAP–GTPase system. Key words GTPase, Rab GTPase, Phosphate-binding protein, Phosphate, PBP-MDCC, GTP hydrolysis, GAP reaction, High-throughput, GAP assay

1

Introduction Spatiotemporal regulation of the GTP hydrolytic activity of guanine nucleotide-binding proteins (commonly referred to as GTPases) is critical for termination of diverse processes including signal transduction, protein synthesis, cytoskeletal dynamics, and membrane trafficking [1]. Slow intrinsic rates of GTP hydrolysis are generally accelerated by GTPase-activating proteins (GAPs) [2]. Impairment of intrinsic or GAP-catalyzed GTPase activity has been implicated in a number of diseases including cancer and diabetes [3, 4]. Numerous putative GAPs for Rab GTPases have been identified by bioinformatic, proteomic, and genetic approaches but in many cases the target Rab substrates and specificity profiles for the Rab family are either unknown or poorly characterized [5]. Thus, efficient, scalable, and generally applicable methods for quantifying GTP hydrolysis reactions are essential for

Guangpu Li and Nava Segev (eds.), Rab GTPases: Methods and Protocols, Methods in Molecular Biology, vol. 2293, https://doi.org/10.1007/978-1-0716-1346-7_3, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

27

28

Ashwini K. Mishra and David G. Lambright

profiling the catalytic activity of GAPs with respect to candidate GTPase substrates and can also be used for mechanistic studies of GTP hydrolytic activity in normal and pathogenic contexts, or to support development of mechanism-based therapeutic interventions. Although GAPs in general stimulate intrinsic GTP hydrolysis by several orders of magnitude or more, the extent of stimulation depends on the kinetic details of the enzyme–substrate combination, including the turnover number kcat and the Michaelis constant KM. Since many GAP reactions occur on cellular membranes, KM is often in the mid micromolar to low millimolar range. For the corresponding in vitro reactions in solution, it is generally feasible to measure the catalytic efficiency (kcat/KM) rather than the individual kinetic constants, although the methods described below can be easily adapted to determine kcat and KM for suitable combinations of GAPs and GTPase substrates. Beyond practical considerations per se, kcat/KM is a salient kinetic property of any enzyme-catalyzed reaction. Indeed, as the concentrationindependent rate constant for an enzyme-catalyzed reaction under conditions where the active sites are not saturated by substrate ([GTPase]
KM), kcat/KM is directly comparable between different GAPs and GTPases, making it a logical metric for kinetic profiles. The ratio of kcat/KM to the intrinsic rate constant (analogous to fold activation) can also be used; however, it is evidently sensitive to differences in intrinsic rate constants as well as GAP activities. A variety of readouts have been used to detect GTP hydrolysis [6–8]. Biophysical methods such as infrared (IR) or nuclear magnetic resonance (NMR) spectroscopies that directly monitor hydrolysis are particularly informative with respect to the structural details of the chemical steps [9, 10]. Other methods indirectly monitor hydrolysis by detecting differences in effector-binding affinity or spectroscopic properties (e.g., intrinsic tryptophan or extrinsic fluorophore-labeled nucleotide fluorescence) between the GTP- and GDP-bound conformations [6, 11] or by monitoring the release of inorganic phosphate (Pi), which can be quantified, for example, by radiolabel detection, enzyme-coupled reactions, or binding to phosphate-binding proteins [12–14]. Despite strengths for particular applications, most readouts for hydrolysis are either inefficient, insensitive, poorly scalable, GTPase-specific, reagent consumptive, or measure end points rather than real-time kinetics. In this chapter, we describe a quantitative, real-time, highthroughput method for profiling Rab GAP catalytic efficiency in which release of inorganic phosphate (Pi) following GTP hydrolysis is continuously monitored using a rapid, fluorescence-based “phosphate sensor” consisting of a engineered cysteine variant of the E. coli phosphate-binding protein labeled with 7-diethylamino-3-

High-Throughput Rab GAP Profile

29

[N-(2-maleimidoethyl) carbamoyl]coumarin (PBP-MDCC) [12, 15]. Due to high binding affinity and rapid association kinetics, the well-characterized PBP-MDCC sensor can detect nanomolar changes in [Pi] on the timescale of a few milliseconds and is suitable for both microplate and stopped flow kinetic measurements [12]. The method described here, along with a related first-generation variation using a less sensitive absorbance-based readout involving the purine nucleoside phosphorylase-coupled reaction of Pi with 7-methyl-thioguanosine substrate (MESG) [13], has been used to identify Rab substrates for GAPs from eukaryotic organisms as well as prokaryotic pathogens [16– 26]. Since the readout is sensitive and does not depend on the details of the particular GAP–GTPase pair, the basic method could easily be adapted to other GTPase families or used for applications requiring large-scale analyses of GAP activity. The chapter has been updated from the original version [27] and includes additional information related to Rab GTPase preparation, purification tags, and nucleotide loading conditions (see Notes 1 and 2). A new figure (Fig. 3) was added to clarify the multichannel liquid dispensing/mixing steps for a typical microplate format used in the initial Rab profile. An additional method for analyzing complete GAP reaction time courses (see Subheading 3.3.3) may be useful for GTPase-GAP systems with low KM values requiring initial GTPase concentrations in excess of KM.

2

Materials

2.1 Reagents and Chemicals

1. Tris(hydroxymethyl)aminomethane hydrochloride HCl), BioUltra grade (Sigma-Aldrich).

(Tris–

2. Sodium Chloride (NaCl), BioXtra grade (Sigma-Aldrich). 3. Ethylenediaminetetraacetic acid (EDTA), trace metal base (Sigma-Aldrich). 4. β-Mercaptoethanol, (BME), BioUltra grade (Sigma-Aldrich), 5. Magnesium chloride hexahydrate (MgCl2·6H2O), BioUltra grade (Sigma-Aldrich). 6. Glycerol, spectrophotometric grade (Sigma-Aldrich). 7. Dimethyl Sulfoxide (DMSO, Sigma). 8. 7-Diethylamino-3-((((2-maleimidyl)ethyl)amino)carbonyl) coumarin (MDCC, Life Technologies). 9. Guanosine 50 -triphosphate sodium salt hydrate (GTP, SigmaAldrich). 10. Dithiothreitol (DTT, Sigma-Aldrich).

30

2.2

Ashwini K. Mishra and David G. Lambright

Supplies

1. 2 ml deep well blocks (Corning). 2. Half area 96-well UV transparent microplates (Corning). 3. Black microfuge tubes (Fisher). 4. Multichannel pipettes, 200 μl, 50 μl (Rainin). 5. 25 ml plastic reservoirs (Corning).

2.3

Proteins

1. Rab GTPases: Full-length Rab proteins or the isolated GTPase domains can be expressed as GST or His6 fusions in E. coli and purified to >95% homogeneity by affinity chromatography, ion exchange, and gel filtration as described [26, 28, 29]. 2. GAP proteins: Full-length GAPs including TBC domain proteins or the catalytic domains can be expressed as 6xHis or 6xHis-SUMO fusions in E. coli and purified by affinity chromatography, ion exchange, and gel filtration as described [16, 22, 26]. 3. Phosphate sensor: A His6 fusion of the E. coli phosphate-binding protein (PBP, A197C mutant) can be expressed, purified, and labeled with MDCC as described [12, 15, 22]. It is important to calibrate the PBP-MDCC sensor using an inorganic phosphate standard over a concentration range appropriate for determining the KD for phosphate binding. The observed signal-to-background will depend on the excitation and emission wavelengths/bandwidths and may vary between sensor preparations and concentrations, due in part to differences in labeling efficiency and ambient levels of Pi. Thus, calibration should be performed on the same batch/concentration of sensor and same fluorescence reader or spectrometer used for GAP assays. With our instrumentation and monochromator settings (Tecan Safire reader, 12 nm bandwidth, 425/457 nm excitation/emission wavelengths), a 3–4 fold maximum change in fluorescence is typically observed in phosphate standard assays using 2.5 μM sensor. Proteins can be dispensed into aliquots and stored as 10% glycerol stocks at 80  C. Purification tags on the GAP or Rab GTPases can be removed if desired or necessary (see Note 1).

2.4

Buffers

Solutions should be prepared in ultrapure sterile water (Milli-Q 18 MΩ water, 0.22 μ filtered) using analytical/ultrapure grade reagents. Unless indicated otherwise, store all reagents and solutions at room temperature. 1. Loading buffer: 20 mM Tris–HCl, pH 8.0, 150 mM NaCl, 5 mM EDTA, 1 mM DTT. 2. Column buffer: 20 mM Tris–HCl, pH 8.0, 150 mM NaCl. 3. Assay buffer: 20 mM Tris–HCl, pH 8.0, 150 mM NaCl, 10 mM MgCl2.

High-Throughput Rab GAP Profile

2.5 Chromatographic Columns

31

The following columns can be used to remove excess nucleotides following GTP loading. GTP-bound Rabs can be eluted from 10 ml desalting columns into deep well blocks in 1 ml fractions using a total of 8 ml of Column buffer. GTP-bound Rab proteins generally elute in fractions 4–5 while excess GTP elutes in later fractions. Desalting columns should be inspected for packing defects or separation between the column bead and frits before use and repacked if necessary. Analytical Superdex 75/200 columns can be used to achieve better separation (e.g., for secondary GAP assays on a smaller number of Rab substrates). 1. Pierce Dextran D-salt columns (Thermo Scientific). 2. Superdex 75/200 columns (GE Healthcare).

2.6

Instruments

The instruments listed below are used in our laboratory. Other equivalent instruments can be substituted with minor changes to the protocols described below as required. 1. Microcentrifuge (Eppendorf). 2. Fluorescence/Absorbance, top/bottom, plate reader with emission/excitation monochromators (Tecan Safire). 3. UV/VIS Spectrophotometer (HP 8453). ¨ KTA FPLC (GE Healthcare). 4. A

2.7

Software

1. Xflour4 (TECAN Safire detection suite); Excel-based data acquisition. 2. DELA (Data Evaluation and Likelihood Analysis); Intel Mac OSX application for efficient data plotting, processing, and analysis; available on request. 3. GraphPad Prism or other graphical analysis software; alternative to DELA.

3

Methods The steps involved in a typical GAP assay are summarized in Fig. 1 and described in detail in the following sections. GAP reactions for as many as 8 Rab GTPases can be analyzed in parallel in a single 96-well plate and it is convenient to process up to 3 plates per day.

3.1 GTP Loading and Preparation of 2 Solutions

Rab GTPases are typically loaded with guanine nucleotides in a buffer containing EDTA and a 25-fold molar excess of the replacing nucleotide. EDTA reduces free Mg2+ to submicromolar levels, which substantially increases the off-rate for nucleotide-binding and consequently the rate of nucleotide exchange. Adequate GTP-loading is critical for monitoring GTP hydrolysis reactions. Loading should be >50% in order to achieve reasonable estimates of kinetic parameters such as catalytic efficiency (see Note 2).

32

Ashwini K. Mishra and David G. Lambright

Fig. 1 Flow chart summarizing the overall approach for quantitative high-throughput profiling of the catalytic efficiency and Rab substrate specificity of candidate Rab GAPs

1. From a concentrated (>10 mg/ml) Rab GTPase stock solution, dispense a volume equivalent to 1 mg for GST fusions or 0.5 mg for His6 fusions into 0.5 ml of loading buffer supplemented with 5 μl from a 100 mM GTP stock solution. The final Rab and GTP concentrations after mixing should be approximately 0.04 and 1.0 mM respectively (see Note 3).

High-Throughput Rab GAP Profile

33

2. Incubate the reaction mixture for 3 h at room temperature (see Note 2). 3. Equilibrate a 10 ml D-Salt column with 50 ml of Mg2+ free Column buffer (see Note 4). 4. Load the reaction mixture onto the D-salt column. Elute into a deep well block with 1 ml aliquots of column buffer per well (see Note 5). 5. Using a multichannel pipette, transfer 167 μl of the eluted fractions into a UV transparent microplate for analysis of the A280/A260 chromatogram and estimation of the GTP-bound Rab protein concentration. 6. Pool the peak Rab-GTP fractions (typically fractions 4–5 or even the single fraction with the highest A280/A260 ratio) and determine the concentration (see Notes 6 and 7). 7. Prepare a 2 Rab-GTP/sensor solution by diluting appropriate volumes of the pooled Rab-GTP fractions and sensor stock with Column buffer to final concentrations of 4 and 5 μM respectively. 8. Prepare 2 GAP solutions of varying concentration (e.g., 0, 0.0625, 0.25, 1, and 4 μM) by diluting the GAP stock with Assay buffer (see Note 8). 3.2 GAP Assay and Measurement

The GAP assays are initiated by mixing equal volumes of each solution in microplate wells. Prior to mixing, the microplate reader should be equilibrated to the desired temperature (e.g., 30  C) and prepared with the appropriate data acquisition parameters including the excitation and emission wavelengths, the number of read cycles (i.e., data points), and the time interval between read cycles. The release of inorganic phosphate is monitored continuously at excitation and emission wavelengths of 425 nm and 457 nm respectively. A typical GAP screen for 4–8 Rab-GTPases in duplicate at 5 different GAP concentrations requires ~1.5–3.0 ml of 2 Rab GTPase/sensor solution per Rab and ~0.35–0.7 ml of the 2 GAP solution. A possible format for the microplate is illustrated in Fig. 2. 1. Equilibrate the microplate reader and assay solutions to the desired temperature (e.g., 30  C). Set the relevant parameters for real-time monitoring of the GTP hydrolysis reaction. For example, excitation wavelength ¼ 425 nm; emission wavelength ¼ 457 nm; bandwidth ¼ 12 nm; integration time ¼ 40 μs; dead time 100 ms; gain ¼ same value used for calibration with the phosphate standard; number of read cycles ¼ 140 (see Note 9). 2. Using a multichannel pipette, transfer 50 μl of each 2 GAP solution at different concentrations into the microplate wells.

34

Ashwini K. Mishra and David G. Lambright

Fig. 2 Example 96-well plate format for high-throughput profile of eight Rab GTPases at four GAP concentrations with two replicate measurements. Also included are two replicates of each Rab GTPase alone and eight replicates each of the phosphate sensor and buffer alone

3. Equilibrate the microplate reader, Rab-GTP/sensor solution, and GAP solution for at least 20 min at the assay temperature (see Note 10). 4. Transfer each Rab-GTP/sensor solution to a separate reagent reservoir and carefully pipette 50 μl using a multichannel pipette and mix with the GAP solutions as illustrated in Fig. 3 (see Note 11). Typical final concentrations of the individual components are: 2 μM Rab-GTP; 2.5 μM sensor; 2.0, 0.5, 0.125, 0.03125, and 0 μM GAP; and 5 mM Mg2+. A lower concentration range may be required for GAPs with high catalytic efficiencies (see for example Figs. 4 and 5). The experiments should also include wells with 100 μl buffer and wells with 50 μl sensor +50 μl buffer for calculation of the conversion factor (see Note 14). Data collection should be initiated as soon as reasonably possible after mixing (see Note 12). 3.3 Kinetic Data Analysis

Analysis of the time courses from the GAP assays is an important step in obtaining estimates of the kinetic constants of interest; in particular, the catalytic efficiencies. Two approaches can in principle be used to analyze the GAP-catalyzed kinetics. In both cases, the data are first plotted as fluorescence intensity (in fluorescence units, f.u.) vs. time (in seconds, s), inspected for quality, and appropriate regions identified for further analysis. The most general approach, which can be used even in cases where the time courses do not

High-Throughput Rab GAP Profile

35

Fig. 3 Multichannel dispensing and mixing into 96-well half area microplates as described in Subheading 3.2. A typical range of GAP concentrations is indicated. Reagent reservoirs can be deep well blocks or other reagent troughs appropriate for multichannel pipettes

proceed to completion (expected for weak or nonsubstrates and low GAP concentrations), involves determining the initial velocity (v0) from the slope of a linear least squares fit to the initial linear phase of each time course. The resulting initial velocities can be converted from f.u. s1 to M s1 (or μM s1, etc.) by multiplying by a conversion factor derived from the Pi standard calibration curve described in Subheading 2.2 and then dividing by the GTPase concentration to obtain v0/[Rab GTPase], with common concentration units used for the sensor and Rab GTPase. Alternatively, the conversion factor can be applied to the time course data rather than the initial velocities. In either case, the catalytic efficiency (kcat/KM) is subsequently obtained from the slope of a linear fit to the data in a plot of v0/[Rab GTPase] vs. [GAP]. A more accurate though less general approach involves fitting complete time courses measured

36

Ashwini K. Mishra and David G. Lambright

Fig. 4 Initial velocity method for determining the catalytic efficiency of Rab GAPs. (a) Calibration of the phosphate sensor using an inorganic phosphate standard as described in Subheading 2.2. The fluorescence intensity as a function of [Pi] was analyzed by fitting with a quadratic binding model and the conversion factor calculated as described in Note 14. (b) Example time courses with the linear region fit by linear regression. (c) Plot of the initial velocity (v0)/[Rab GTPase] as a function of [GAP], where [Rab GTPase] was expressed in the same concentrations units as the conversion factor in A. The slope of a linear fit (solid line) yields kcat/KM

under pseudo-first order conditions ([GTPase]
KM) to an exponential model to directly obtain an observed rate constant (kobs, s1), which is then plotted against the GAP concentration and fit with a linear model, the slope of which yields kcat/KM. Both approaches are easily performed in DELA and the entire analysis can be completed in less than half an hour. Similar analyses can be performed with standard graphical analysis software including Prism. The initial velocity approach is appropriate for a profile of GAP activity whereas exponential fitting is preferred for secondary validation of the “hits” (i.e., best substrates) using an optimized concentration range (e.g., 10–100 fold range in twofold increments). In some cases, it may be possible to obtain separate values for kcat and KM by fitting with the hyperbolic model kintr + (kcat  kintr) [GAP]/(KM + [GAP]), where kintr is the intrinsic hydrolytic rate in absence of a GAP. Alternatively, time courses for GTPase concentrations in the range well above KM can be directly

High-Throughput Rab GAP Profile

37

Fig. 5 Determination of the catalytic efficiency of Rab GAPs by exponential fitting. (a) Example of experimental fluorescence time courses (symbols) fit with an exponential model function (solid lines) as described in Subheading 3.3.2. (b) Determination of kcat/KM from the slope of a linear fit (solid line). Note that this method for determining kcat/KM is independent of [Rab GTPase] and, consequently, is not affected by underloading with GTP. (c) Example of an experimental fluorescence time course (symbols) fit with an integrated Michaelis–Menten model function (solid lines). The initial GTPase and GAP concentrations are 4 μM and 0.5 nM, respectively

fit with an integrated Michaelis–Menten model function as described below. Here it is worth noting that the actual kinetic mechanisms for GAP reactions involve more steps than used in text book Michaelis–Menten (3 state, rapid equilibrium) or Briggs– Haldane (3 state, steady state) treatments of classical enzymecatalyzed reactions. Nevertheless, GAP reactions involve an initial bimolecular binding step and exhibit saturation kinetics. Thus, the observed KM and kcat can be regarded as phenomenological constants related to the steady-state occupation and turnover of active sites as a function of GAP or GTPase concentration. Since phosphate release is detected and may be rate limiting, kcat is likely lower than the rate constants for the chemical steps in the hydrolytic reaction and may even be lower than the rate constant for GAP– GTPase dissociation.

38

Ashwini K. Mishra and David G. Lambright

3.3.1 Initial Velocity Approach

1. Import the kinetic data from the Excel spreadsheet generated by Xfluor (or an equivalent data file for other microplate readers) into the preferred graphical analysis software package (see Note 13). 2. Generate individual plots containing the kinetic time courses for each Rab GTPase at the various GAP concentrations. Repetitions should also be plotted separately. 3. Subtract the initial value (i.e., at t ¼ 0 s) for the intrinsic reaction and multiply by the conversion factor derived from the Pi calibration standard (see Note 14). 4. Limit the data to the initial velocity region by masking any nonlinear regions (see Note 15). 5. Fit the data with a linear model and divide the slope by the total Rab GTPase concentration (in the same concentration units used for the conversion factor) to obtain v0/[Rab GTPase] (see Note 14). 6. Plot v0/[Rab GTPase] vs. [GAP] and fit the data with a linear model, the slope of which is kcat/KM in reciprocal GAP concentration units per second (e.g., μM1 s1 if [GAP] was expressed in units of μM). It may be necessary to exclude high concentrations if the time course is too fast for accurate determination of the initial velocity. An example of the main steps involved in the velocity approach is illustrated in Fig. 4.

3.3.2 Exponential Fit Approach

1. Follow steps 1 and 2 in Subheading 3.3.1. The data can be multiplied by the phosphate standard conversion factor if desired (see Note 14); however, conversion to concentration units is not necessary and will have no impact on the determination kcat/KM. 2. Fit the time course data to the exponential model function.
 F t ¼ F 0 þ ðF 1  F 0 Þ 1  ekobs t to directly obtain the observed rate constant kobs (see Note 16). 3. Plot kobs vs. [GAP] and fit with a linear model to obtain kcat/ KM from the slope. An example of the main steps for the exponential fit approach is illustrated in Fig. 5a, b.

3.3.3 Integrated Michaelis–Menten Approach

In cases where the initial GTPase concentration substantially exceeds KM, an alternative to the initial velocity approach is possible using the integrated Michaelis–Menten equation [30]. F t ¼ F 0 þ ðF 1  F 0 Þ ð1  K M W =½Rab GTPaseÞ

High-Throughput Rab GAP Profile

39

whereW ¼ Lambert_Omega (([Rab GTPase]/KM) exp (([Rab GTPase]  kcat [GAP] t)/KM))and Lambert_Omega is the Lambert Omega function available in some software packages including Matlab. DELA (see Subheading 2.6 above) provides an Integrated Michaelis–Menten model that can be directly fit to time course data. This approach requires accurate estimates of the initial Rab GTPase and GAP concentrations at t ¼ 0. The time course should also be monitored until the signal approaches a constant final value. The main advantage of the integrated Michaelis–Menten analysis is that it allows kcat and KM to be determined from a single time course satisfying the condition initial [GTPase]  KM (see Note 17). As such, it is more likely to be useful for detailed kinetic analyses of top substrate GTPases rather than Rab GTPase profiles for which the initial Rab GTPase concentration is expected to be below KM for most if not all candidate substrates. An example of the integrated Michaelis–Menten fit approach is illustrated in Fig. 5.

4

Notes 1. GST, SUMO and His6 tags can be removed by cleavage with recognition site-specific proteases followed by incubation with the relevant purification beads. Whether tag removal is necessary may depend on the GAP of interest. For a number of characterized GAP domains, the tags do not appear to have major effects on catalytic activity. Nevertheless, it remains possible that the catalytic activity for some GAPs or GAP/Rab combinations could be altered by purification tags. Substantial variations in catalytic activity between different tags or between tagged and cleaved proteins could indicate potential tag interference requiring further investigation. 2. Since the rate of nucleotide release differs between Rab-GTPases, the loading reaction should be incubated for at least 3 h at room temperature to ensure >50% GTP loading [29]. Under the loading conditions with excess GTP, purified Rab GTPases generally tolerate prolonged incubation at room temperature without obvious evidence of aggregation or denaturation. 3. Some Rab GTPases may precipitate in the loading buffer at concentrations in excess of 2 mg/ml. This problem may be more acute for His6 fusions. Precipitation can be minimized by adding the GTPase last or by mixing 2 solutions to achieve the desired final concentrations. The pH and ionic strength can also be adjusted if necessary. 4. GTPase reactions are initiated by mixing GAPs in a buffer containing Mg2+. It is therefore important to exclude Mg2+ from the Column buffer.

40

Ashwini K. Mishra and David G. Lambright

5. Elution of GTP-bound Rab proteins from 10 ml D-salt columns into deep well blocks can be done in parallel, with staggered starts to avoid conflicts between columns. 6. Avoid pooling protein fractions (A280 > A260) with fractions containing excess nucleotides (A260 > A280), which may contain free Pi, resulting in higher background fluorescence and/or multiple turnover kinetics typically manifesting as a linearly increasing fluorescence following the initial exponential phase. 7. The protein concentration can be estimated as c ¼ A280/(ε  b) where b is the path length (¼1 for 167 μl in Corning Half Area microplates) and ε is the extinction coefficient including the Rab construct, tag, and nucleotide. The Protein Calculator server or equivalent software can be used to calculate the protein contribution to the extinction coefficient. The nucleotide contribution is approximately 8000 M1 cm1 at 280 nm. 8. As GTP hydrolysis reactions are initiated by adding buffer solutions containing Mg2+, with or without the GAP, it is important make GAP dilutions in a buffer containing 10 mM MgCl2. 9. To follow the progress of the GTP hydrolysis reactions, it is important to set the measurement parameters to appropriate values. The values provided here were optimized for acquisition of high signal-to-noise/background kinetic data using a Tecan Safire microplate reader. However, changes may be required if other instruments are used. In particular, the gain should be empirically adjusted to adequately fill but not overflow the digitizer. As a general rule of thumb, the gain can be adjusted such that the initial fluorescence signal is approximately 10–30% of the maximum signal that can be digitized, assuming a fourfold increase in fluorescence over the time course. 10. Preequilibration is important for avoiding temperature-related artifacts since both fluorescence and reaction rates are temperature dependent. 11. A total reaction volume of 100 μl is reasonable for bottom reads of the fluorescence in microplate wells and for reducing meniscus-related artifacts in fluorescence intensity. 12. Delay in measurement after mixing will result in truncation of initial data points for faster reactions. However, complete mixing without bubbles is more important than speed. For example, a delay of 30–120 s is not unreasonable for GAP reactions monitored for 30–120 min. Indeed, similar delays are common for automated liquid handling devices, which can be used in place of multichannel pipettes.

High-Throughput Rab GAP Profile

41

13. Data can be imported by cut/paste or from files exported from Excel as tab delimited text. 14. The conversion factor from f.u. to concentration units can be determined by fitting the data for the calibration curve to the quadratic binding model: n
1=2  o F ¼ F 0 þ ΔF =2 b  b 2  4 ac b ¼ 1 þ ½Pi =½PBP  MDCC þ K D =½PBP  MDCC ac ¼ ½Pi =½PBP  MDCC and dividing the [PBP-MDCC] by the amplitude ΔF: conversion factor ¼ ð½PBP  MDCC=ΔF Þ ðF sensor  F buffer Þ=ðF sensor assay  F buffer assay Þ where Fsensorassay and Fbufferassay are the fluorescence intensities of the sensor and buffer alone for the GAP assay and Fsensor and Fbuffer are the fluorescence intensities of the sensor and buffer alone for the phosphate standard calibration experiment. Note that the concentrations above represent total rather than free concentrations. The quadratic form of the binding isotherm is necessary in this case since [PBPMDCC] ~ 2.5 μM  KD ~ 100 nM. It is important to use the same experimental parameters/conditions for both the calibration curve and GAP assays, including wavelengths, bandwidths, gain setting, read mode, well volume, sensor concentration, buffer, and temperature. 15. For initial velocity measurements, only the initial linear portion of the progress curve should be fit (e.g., 60 members in human) function as master regulators of intracellular membrane trafficking. To fulfill their functions, Rab proteins need to localize on specific membranes in cells. It remains elusive how the distinct spatial distribution of Rab GTPases in the cell is regulated. To make a global assessment on the subcellular localization of Rab1, we determined kinetic parameters of the spatial cycling of Rab1 in live cells using photoactivatable fluorescent proteins and live cell imaging. We found that the switching between GTP- and GDP-binding states, which is governed by guanine nucleotide exchange factors (GEFs), GTPase activating proteins (GAPs), GDP dissociation inhibitor (GDI) and GDI displacement factor (GDF), is a major determinant for Rab1’s ability to effectively cycle between cellular compartments and eventually for its subcellular distribution. Herein, we describe the method for monitoring Rab1 dynamics in live cells. This approach can be used to study spatial cycling of other Rab GTPases. Key words Rab1, FRAP, FLAP, TRAPP, PRA1, Live cell imaging, GTPase cycle

1

Introduction Rab GTPases play a key role in intracellular membrane trafficking [1]. Each Rab exerts its particular function through interaction with different interacting partners at a specific subcellular membrane [2]. Rab GTPases work as molecular switches by cycling between an active GTP-bound and an inactive GDP-bound form, which is termed “GTPase cycle.” The nucleotide binding state is tightly regulated by guanine nucleotide exchange factors (GEFs) that catalyze the exchange of GTP for bound GDP and GTPase activating proteins (GAPs) that accelerate the slow intrinsic GTP hydrolysis of GTPases [3]. The GTP-bound Rabs recruit a diverse set of Rab effectors to membranes, which initiate downstream signaling. Rab membrane attachment is mediated through C-terminal lipophilic geranylgeranyl groups. Cycling between the cytosol and membranes is an essential feature of the mode of action of Rabs and is made possible by reversible interaction with GDP dissociation

Guangpu Li and Nava Segev (eds.), Rab GTPases: Methods and Protocols, Methods in Molecular Biology, vol. 2293, https://doi.org/10.1007/978-1-0716-1346-7_8, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

105

106

Fu Li and Yao-Wen Wu

inhibitor (GDI). GDI extracts GDP-bound Rabs from membranes and form soluble complexes to maintain Rabs in the cytosol. GDI displacement factors (GDFs) were proposed to catalyze the dissociation of the Rab-GDI complexes at the destination for proper delivery of Rabs to the target membrane [4–9]. GEF-mediated nucleotide exchange serves as the thermodynamic driving force for Rab membrane targeting [10]. Although the so far only one identified GDF, prenylated Rab acceptor protein 1 (PRA1)/Yip3 (the yeast homolog of PRA1), was proposed to regulate endosomal Rabs [8], very recent data showed that PRA1 also affect the spatial cycling of Rab1, one of non-endosomal Rab proteins [11]. We chose Rab1 as a model Rab protein for our study. Rab1 is found predominantly at the endoplasmic reticulum (ER) and Golgi apparatus in the cell. Rab1 plays an important role in ER-to-Golgi transport and the maintenance of the Golgi structure [12, 13]. Recently, Rab1 was shown to be involved in autophagosome biogenesis during autophagy [14]. Rab1 is also involved in host–pathogen interaction process. Rab1 can be hijacked, activated, and posttranslationally modified by Legionella effector proteins [15–18]. Rab1 is activated by its GEF protein, the transport protein particle (TRAPP) complex and deactivated by its GAP TBC1D20 [19–22]. To understand the mechanisms of Rab1 membrane targeting and cycling, we examined the kinetic parameters of Rab1 spatial cycling under different conditions in live cells [11]. Fluorescent proteins (FPs) are widely used for the tracking of proteins and the visualization of cellular activities in live cells [23]. Compared to green fluorescent proteins (GFP), photoactivatable GFP (paGFP) exhibits very low green emission (max 517 nm) with 488 nm excitation, which can increase 100-fold by stimulation with 405-nm light [24]. The advent of paGFP offers new possibilities to study biomolecules, such as pulse-chase labeling and superresolution imaging. Here, we used EGFP- and paGFP-tagged Rab1 proteins for fluorescence recovery after photobleaching (FRAP) and fluorescence localization after photoactivation (FLAP) experiments to determine the dynamics of Rab1 in live cells. FRAP is a microscopy-based method used to determine the kinetics of diffusion for molecules including lipids and proteins in solution, membranes, condensates, cells, or tissues [25]. Following photobleaching the fluorophore-tagged molecules within a region of interest (ROI), the recovery of fluorescent molecules moving into the ROI is monitored over time (Fig. 1). The extent and rate of the recovery could be quantified to yield kinetic parameters of the molecular dynamics. However, the dynamics of molecules moving out of the ROI (the opposite direction) could not be tracked using FRAP, because the bleached molecules cannot be visualized. Moreover, newly synthesized proteins may complicate the results. Therefore, protein synthesis inhibitors may need to be used in the experiment. FLAP emerges as an alternative approach to overcome

Rab Spatial Cycling

107

Fig. 1 Fluorescence recovery after photobleaching (FRAP) and fluorescence localization after photoactivation (FLAP)

these limitations by using photoactivatable or photoconvertible FPs. FLAP allows the detection and tracking of a subpopulation of molecules with spatial and temporal resolution (Fig. 1) [26]. The combination of FRAP and FLAP techniques provides powerful tools that can quantify the “on” and “off” dynamics of specific molecules at a ROI in living cells (Fig. 1).

2

Major Outcomes and Possible Uses The FRAP and FLAP techniques were used to investigate the spatial cycling of Rab1 in live cells [11]. In this study, we showed that the subcellular localization of Rab1 is highly dynamic with a continuous flux between the cytoplasm and the Golgi compartment. We examined the kinetic parameters of Rab1 cycling between cytoplasm and the Golgi compartment under different cellular conditions. We found that the switching between GTP- and GDP-binding states (GTPase cycle) serves as a major determinant for Rab1’s ability to effectively cycle between cellular compartments and eventually for its subcellular distribution. GEFs, GAPs, GDI, and GDF all play an essential role in regulation of the process. The enzymatic GTPase cycle governed by GEFs and GAPs is required for Rab1 spatial cycling and subcellular distribution. The function of GDF (PRA1) in Rab1 spatial cycling has for the first time been illuminated by using these approaches. PRA1 is required for delivery of Rab1 to the Golgi apparatus but not for the retrieval

108

Fu Li and Yao-Wen Wu

of Rab1 from the Golgi apparatus, in keeping with its proposed GDF function, that is, facilitating the release of Rab from the Rab-GDI complex. The efflux of Rab1 from the Golgi apparatus is mainly mediated by GDI-mediated nonvesicular transport. These approaches could be used to study dynamics of other Rab GTPases and small GTPases in living cells.

3

Materials

3.1 Construction of Plasmids

1. cDNA of Rab1. 2. EGFP or paGFP encoding plasmid for expression in mammalian cells (Clontech). 3. PLL 3.7 vector for shRAN transcription in mammalian cells. 4. Competent E. coli suitable for cloning (DH5α or XL1 blue cell). 5. Primers for insertion of the target gene into the expression vector (Eurofins). 6. Primers for site-directed mutagenesis to introduce QL into the Rab1 gene (Eurofins). 7. Primers for PRA1 and TRAPP complex subunit 4 (TRAPPC4, mammalian homolog of yeast Trs23) knockdown in cells (Integrated DNA Technologies, IDT).

3.2 Mammalian Cell Culture and Transfection Reagents

1. Tissue culture vessels, for example 10 cm diameter petri dishes or T75 flask (Sarstedt). 2. Sterile single packed pipettes (2, 5, 10, and 25 mL) (Sarstedt). 3. Pipette controller. 4. Sterile microliter pipettes and pipette tips (10, 200, and 1000μL). 5. Glass bottom imaging vessels such as 35 mm MatTek dishes (MatTek). 6. 15, 50 mL falcon tubes, sterile (Sarstedt). 7. 1.5 mL Eppendorf tubes, sterile. 8. Inverted light microscope (Leica). 9. HeLa and Cos-7 cells (ATCC® CCL-2 and ATCC® CRL-1651). 10. Cell culture medium: DMEM supplemented with 10% (v/v) FBS, 1% (v/v) NEAA, 1% (v/v) sodium pyruvate, 1% (v/v) Penicillin-Streptomycin (Thermo Fisher). 11. Opti-MEM medium, serum free (Thermo Fisher). 12. X-tremeGene HP transfection reagent (Roche).

Rab Spatial Cycling

109

13. Phosphate-buffered saline (PBS) (Sigma). 14. Nocodazole (Cayman Chemical). 3.3 Generation of PRA1 and TRAPPC4 Knockdown Stable Cell Lines

1. Anti-PRA1 antibody (EPR1747Y, Novus Biologicals). 2. Anti-TRAPPC4 antibody (PA5-44630, Thermo Fisher). 3. Puromycin dihydrochloride (P8833, Sigma). 4. X-tremeGENE HP DNA transfection reagent (Roche). 5. HeLa cells (ATCC® CCL-2).

3.4 In Cellulo Prenylation Experiment

1. Mini EDTA-free protease inhibitor (11836170001, Roche). 2. Compactin or Mevastatin (CAS 73573-88-3, Sigma-Aldrich). 3. Lysis/prenylation buffer: 25 mM HEPES (pH 7.2), 50 mM NaCl, 2 mM MgCl2, 2 mM DTE, 20μM GDP, 0.5% NP-40. 4. Recombinant RabGGTase and REP-1 proteins. 5. Biotin-GPP [27, 28]. 6. Anti-biotin antibody (D5A7, Cell Signaling). 7. Anti-GFP antibody (AS-29779, AnaSpec).

3.5

4

Live Cell Imaging

Inverted confocal laser scanning microscopes (CLSM) (Leica TCS SP5 or SP8 microscope) equipped with a 63
/1.4 HCX PL APO (λ blue) oil immersion objective and incubator for live cells.

Methods

4.1 Design and Cloning of the Target Construct

1. Clone the Rab1 cDNA into an EGFP or paGFP containing plasmid by restriction enzyme digestion and subsequent DNA ligation. Transform the ligation into competent E. coli XL1 blue cells and perform the screening PCR for positive clones. Verify the positive clones by sequencing process. 2. Perform site-directed mutagenesis to generate Rab1 Q67L mutant and verify the sequence of the final construct. 3. Clone the shRNA sequence of PRA1 into PLL 3.7 vector and verify the sequence of the final construct (see Note 1).

4.2 Generation of PRA1 and TRAPPC4 Knockdown Cell Lines

1. Transfect 3μg of pLL3.7-PRA1 or pLL3.7-TRAPPC4 shRNA plasmid with 4.5μL Xtreme GENE HP DNA transfection reagent into 6
105 low passage HeLa cells in 10-cm petri dishes. 2. On the following day, replace the standard media with media containing 1μg/mL puromycin for shRNA knockdown cells (see Note 2). 3. Carefully change the media in the dish every 1 or 2 days, taking care not to pipet directly onto the cells (see Note 3).

110

Fu Li and Yao-Wen Wu

Fig. 2 Knockdown of endogenous PRA1 and TRAPPC4 in HeLa cells. (a, c) The endogenous PRA1 and TRAPPC4 proteins were knocked down with shRNA, detected by western blot using anti-PRA1 and antiTRAPPC4 antibodies, respectively. (b, d) Quantification of the knockdown efficiency. Scr: scrambled, KD: knockdown. (Biochemistry. 2019. 58(4), 276-285)

4. Use sterile tips to pick up the single colony of cells with 10
objective lens under microscope, and culture the cells in 6-well plate (see Note 4). 5. When the wells are confluent, rinse with PBS and detach cells with trypsin-EDTA. Split into one well of a 6-well plate (for passaging) and one well of your choice for western blot in order to screen the colonies and decide which are worth keeping and which should be discarded. 6. Confirm the PRA1 and TRAPPC4 knockdown by western blotting (Fig. 2). 7. Use 0.5μg/mL (half of selecting concentration) puromycin to maintenance the identified cells. 8. Freeze the cells as passage 1. 4.3 Microscopy and Imaging

4.3.1 FRAP Experiments

Lasers and settings used for fluorophore excitation, bleaching, and the respective detection filter settings are listed in Table 1. All measurements were performed in an incubation chamber at 37  C and 5% CO2. 1. Transfect EGFP-Rab1 or EGFP-Rab1Q67L with mKate2Giantin into HeLa cells or the PRA1 or TRAPPC4 knockdown cell line in 35-mm MatTek dishes (see Note 5). 2. Carry out FRAP experiments after transfection overnight.

Rab Spatial Cycling

111

Table 1 Microscopy settings Excitation

Laser

λex (nm)

Emission filter settings (nm)

EGFP

Argon laser LGK 7872 ML05

488

505–555

mKate2

561 DPSS YLK 6120 T02

561

595–685

Bleaching of EGFP

Argon laser LGK 7872 ML05

488

–

Photoactivation of paGFP

Cube 1162002/AF

405

–

3. Choose the bleaching regions of interest (ROI) at the Golgi region within the cell, take images of the cell before bleaching (see Note 6). 4. Bleach the designated ROI by extensive illumination at 488 nm (see Note 7). 5. After bleaching, monitor the fluorescence recovery over a period of at least 400 s with images collected every 2–10 s (see Note 8) (Fig. 3a, b). 6. Incubate cells on ice for 30 min in imaging medium with 5μg/ mL nocodazole and then warm cells to 37  C (see Note 9). Perform FRAP experiments as the steps 3–5. 4.3.2 FLAP Experiments

1. Transfect paGFP-Rab1 or paGFP-Rab1Q67L with mKate2Giantin into HeLa cells or the PRA1 or TRAPPC4 knockdown cell line in 35-mm MatTek dishes 1 day before the FLAP experiments. 2. Choose the bleaching ROI at the Golgi region or outside the Golgi region within the cell, take images of the cell before photoactivation. 3. Photoactivate paGFP-Rab1 proteins at the predefined ROI by extensive illumination at 405 nm (see Note 10). 4. After photoactivation, monitor the fluorescence localization over a period of at least 400 s with images collected every 2–10 s (Fig. 3c–f). 5. Incubate cells on ice for 30 min in imaging medium with 5μg/ mL nocodazole and then warm cells to 37  C. Perform FLAP experiments as the steps 2–4.

4.4 In Cellulo Prenylation Assay

To confirm if the overexpressed EGFP-Rab1 proteins are prenylated in cells, the in cellulo prenylation assay is carried out as follows. 1. Transfect EGFP-Rab1 plasmid into HeLa cells and culture the cells in the presence or absence of 10μM Compactin overnight (16–24 h) (see Note 11).

112

Fu Li and Yao-Wen Wu

Fig. 3 Trafficking of Rab1 between the Golgi apparatus and the cytoplasm (a) Dynamics of EGFP-Rab1 determined by FRAP experiments. The bleached area is circled in red. After bleaching, the increase in the fluorescence intensity at the region of interest (ROI, dashed red line) on the Golgi was followed by time-lapse imaging. Scale bar, 20μm. (b) Plot of individual (n ¼ 5; gray lines) and average (black circles, mean  standard deviation) FRAP profiles from panel a. kon was obtained as the average of individual kobs values. kobs was determined by fitting to a monoexponential function. (c) Dynamics of paGFP-Rab1 determined by FLAP experiments. The area selected for photoactivation is indicated by the dashed blue line. After photoactivation, the increase in fluorescence intensity at the region of interest (ROI, dashed red line) in the Golgi region was followed by time-lapse imaging. The inset shows the Golgi marker, mKate2-Giantin. Scale bar, 10μm. (d) Plot of individual (gray lines) and average (black circles, mean  standard deviation) FLAP profiles from panel c. kon was obtained as the average of individual kobs values. kobs was determined by fitting to a monoexponential function (n ¼ 5). (e) Dynamics of paGFP-Rab1 determined by FLAP experiments. The area selected for photoactivation is highlighted (dashed blue line). After photoactivation, the decrease in fluorescence intensity at the Golgi apparatus was followed by time-lapse imaging. The inset shows the Golgi marker, mKate2Giantin. Scale bar, 10μm. (f) Plot of individual (n ¼ 6; gray lines) and average (black circles, mean  standard deviation) FLAP profiles from panel e. koff was obtained as the average of individual kobs values. kobs was determined by fitting to a monoexponential function. (Biochemistry.2019. 58(4), 276–285)

2. Wash the cells three times with ice-cold PBS and collect transfected HeLa Cells. 3. Lyse the cells in 150μL of lysis/prenylation buffer with 1
complete mini EDTA-free protease inhibitor. Centrifuge the cell lysis for 10 min at 14,000 rpm (~20,000
g) at 4  C. 4. Add 50μL of freshly prepared lysate (1μg/μL) with 2μM RabGGTase, 2μM REP-1, and 5μM Biotin-GPP to initiate the prenylation reaction, and the mixture incubated for 4 h at room temperature. 5. Quench the reaction by adding 10μL of 6
SDS sample buffer.

Rab Spatial Cycling

113

Fig. 4 Expressed Rab1 molecules are largely prenylated in cells. Compactin treatment (10μM, 20 h) led to accumulation of unprenylated EGFP-Rab1 (biotinylated). (Biochemistry. 2019. 58(4), 276–285)

6. Boil the samples for 5 min at 95  C. 7. Perform western blotting to detect the biotinylated Rab1 (unprenylated Rab1) with the anti-biotin antibody. As a loading control, the total GFP-Rab1 proteins are shown by western blot with the anti-GFP antibody (Fig. 4).

5

Notes 1. For shRNA vector construction, order oligos through IDT with 50 phosphates and PAGE purified. Annealing oligos by PCR program: 95  C, 4 min; 70  C, 10 min; Decrease from 70  C to 4  C slowly, 0.1  C/min (Critical!). 2. Puromycin ensures effective positive selection of cells expressing the puromycin-N-acetyl-transferase (pac) gene. In mammalian cells, the recommended working concentration for puromycin is 0.5–10μg/mL. Different cell types and cell culture conditions may require different concentrations of selection antibiotic. Perform a killing curve to determine the optimal working concentration for your experiment. 3. The transfected plasmid undergoes recombination during chromosomal integration. As a result, the shRNA construct could stably incorporate into the genomic DNA. The section usually takes 2–3 weeks. 4. It’s critical for picking up single clone of stable cell lines. Paper cloning discs (07-907-10A, Thermo Fisher) or cloning rings (C1059-1EA, Sigma) are recommended if without good skills. 5. Giantin is a marker for the Golgi compartment. 6. Due to the fluidity of the Golgi membrane, it is crucial that photobleaching covers the entire Golgi region to exclude the recovery through lateral diffusion of unbleached Golgilocalized EGFP-Rab1 proteins. 7. Illumination with 10 repetitions with maximal laser power at 488 nm (100%, argon laser LGK 7872 ML05).

114

Fu Li and Yao-Wen Wu

8. Contribution to the recovery from newly synthesized protein could be excluded through treatment with the protein synthesis inhibitor cycloheximide. Photobleaching over the time course of time-lapse imaging should be determined. 9. Nocodazole is a compound to depolymerize microtubules and actin filaments, thereby disrupting vesicular transport. Under these conditions, Rab dynamics regulated by non-vesicular transport could be investigated. Nocodazole concentration and treatment time should be optimized and verified using GFP-tublin as the marker for microtubules. 10. Illumination was performed at 405 nm with 30–50% of the maximal laser intensity (Cube 1162002/AF). 11. Compactin is a HMG-CoA reductase inhibitor that depleted the cellular geranylgeranyl pyrophosphate (GGPP), which is the lipid substrate for Rab prenylation. Compactin treatment is used as a positive control for the detection of unprenylated Rab proteins in cells.

Acknowledgments We thank Sven Mu¨ller for technical support with Microscopy. This work was supported by the Deutsche Forschungsgemeinschaft, DFG (Grants SPP 1623 and SFB 642), the European Research Council (ERC, ChemBioAP), Vetenskapsra˚det (Nr. 2018-04585), the Knut and Alice Wallenberg Foundation and Goran Gustafsson Foundation for Research in Natural Sciences and Medicine (to Y.W.W.). References 1. Hutagalung AH, Novick PJ (2011) Role of Rab GTPases in membrane traffic and cell physiology. Physiol Rev 91(1):119–149 2. Pylypenko O et al (2018) Rab GTPases and their interacting protein partners: structural insights into Rab functional diversity. Small GTPases 9(1-2):22–48 3. Bos JL, Rehmann H, Wittinghofer A (2007) GEFs and GAPs: critical elements in the control of small G proteins. Cell 129(5):865–877 4. Wu Y-W et al (2007) Interaction analysis of prenylated Rab GTPase with Rab escort protein and GDP dissociation inhibitor explains the need for both regulators. Proc Natl Acad Sci U S A 104(30):12294–12299 5. Pylypenko O et al (2006) Structure of doubly prenylated Ypt1:GDI complex and the mechanism of GDI-mediated Rab recycling. EMBO J 25(1):13–23

6. Pfeffer SR, Dirac-Svejstrup AB, Soldati T (1995) Rab GDP dissociation inhibitor: putting Rab GTPases in the right place. J Biol Chem 270(29):17057–17059 7. Rak A et al (2003) Structure of Rab GDP-dissociation inhibitor in complex with Prenylated YPT1 GTPase. Science 302 (5645):646–650 8. Sivars U, Aivazian D, Pfeffer SR (2003) Yip3 catalyses the dissociation of endosomal Rab–GDI complexes. Nature 425 (6960):856–859 9. Goody Roger S, Mu¨ller Matthias P, Wu Y-W (2017) Mechanisms of action of Rab proteins, key regulators of intracellular vesicular transport. Biol Chem:565 10. Wu Y-W et al (2010) Membrane targeting mechanism of Rab GTPases elucidated by

Rab Spatial Cycling semisynthetic protein probes. Nat Chem Biol 6 (7):534–540 11. Voss S et al (2019) Spatial cycling of Rab GTPase, driven by the GTPase cycle, controls Rab’s subcellular distribution. Biochemistry 58 (4):276–285 12. Plutner H et al (1991) Rab1b regulates vesicular transport between the endoplasmic reticulum and successive Golgi compartments. J Cell Biol 115:31 13. Saraste J, Lahtinen U, Goud B (1995) Localization of the small GTP-binding protein rab1p to early compartments of the secretory pathway. J Cell Sci 108(4):1541–1552 14. Carlos Martı´n Zoppino F et al (2010) Autophagosome formation depends on the small GTPase Rab1 and functional ER exit sites. Traffic 11:1246 15. Mukherjee S et al (2011) Modulation of Rab GTPase function by a protein phosphocholine transferase. Nature 477:103 16. Muller MP et al (2010) The legionella effector protein DrrA AMPylates the membrane traffic regulator Rab1b. Science 329:946 17. Neunuebel MR et al (2011) De-AMPylation of the small GTPase Rab1 by the pathogen legionella pneumophila. Science 333:453 18. Goody PR et al (2012) Reversible phosphocholination of Rab proteins by legionella pneumophila effector proteins. EMBO J 31:1774 19. Jones S et al (2000) The TRAPP complex is a nucleotide exchanger for Ypt1 and Ypt31/32. Mol Biol Cell 11(12):4403–4411

115

20. Wang W, Sacher M, Ferro-Novick S (2000) Trapp stimulates guanine nucleotide exchange on Ypt1p. J Cell Biol 151(2):289–296 21. Cai H et al (2007) TRAPPI tethers COPII vesicles by binding the coat subunit Sec23. Nature 445(7130):941–944 22. Sklan EH et al (2007) TBC1D20 is a Rab1 GTPase-activating protein that mediates hepatitis C virus replication. J Biol Chem 282:36354 23. Rodriguez EA et al (2017) The growing and glowing toolbox of fluorescent and photoactive proteins. Trends Biochem Sci 42 (2):111–129 24. Patterson GH, Lippincott-Schwartz J (2002) A photoactivatable GFP for selective photolabeling of proteins and cells. Science 297:1873 25. Lippincott-Schwartz J, Altan-Bonnet N, Patterson GH (2003) Photobleaching and photoactivation: following protein dynamics in living cells. Nat Cell Biol 5(volume), S7–S14(page) 26. Ishikawa-Ankerhold HC, Ankerhold R, Drummen GPC (2012) Advanced fluorescence microscopy techniques--FRAP, FLIP, FLAP, FRET and FLIM. Molecules 17 (4):4047–4132 27. Wu YW et al (2006) A protein fluorescence amplifier: Continuous fluorometric assay for Rab geranylgeranyltransferase. Chembiochem 7(12):1859–1861 28. Nguyen UT et al (2009) Analysis of the eukaryotic prenylome by isoprenoid affinity tagging. Nat Chem Biol 5(4):227–235

Chapter 9 Deconvolution of Multiple Rab Binding Domains Using the Batch Yeast 2-Hybrid Method DEEPN Tabitha A. Peterson and Robert C. Piper Abstract A hallmark of functionally significant interactions between Rab proteins and their targets is whether that binding depends on the type of nucleotide bound to the Rab GTPase. A system that can directly compare those sets of interactions mediated by a Rab in its GTP-bound conformation versus its GDP bound conformation would provide a direct route to finding biologically relevant partners. Comprehensive large-scale yeast 2-hybrid assays allow a potential method to compare one interactome against another provided that the same set of potentially interacting partners is interrogated between samples. Here we describe the use of such a yeast 2-hybrid system that lends itself toward comparing pairs of Rab mutants, locked in either their GTP or GDP conformation. Importantly, using a complex library of protein fragments as potential binding (“prey”) partners, identification of interacting proteins as well as the domain(s) mediating those interactions can be determined using a series of sequence analyses and binary validation experiments. Key words Next generation sequencing, GTP, GDP, Rab GTPase

1

Introduction Rab GTPases are protein interaction switches that are acutely regulated by toggling between an inactive GDP-bound form and an active GTP-bound form. Exchanging GDP for GTP causes a conformational change allowing for Rab GTPases to bind specific partner proteins or effectors, which then assemble into functional complexes at discrete locations in the cell according to the regulatory mechanisms that govern the distribution of Rab proteins [1]. Knowing the various protein interactions in which Rab proteins participate in vivo is a major requirement for understanding how they function. Importantly, many Rab proteins have been found to have multiple partners that likely engage them under different cellular states and locations, emphasizing the critical goal of identifying specific Rab-interacting proteins. Perhaps the most

Guangpu Li and Nava Segev (eds.), Rab GTPases: Methods and Protocols, Methods in Molecular Biology, vol. 2293, https://doi.org/10.1007/978-1-0716-1346-7_9, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

117

118

Tabitha A. Peterson and Robert C. Piper

important group of Rab-interacting proteins are those that bind Rabs in a nucleotide-specific manner, since those partners would be best implicated in mediating a Rab-regulated function. Rab GTPases fit within a larger family of small molecular weight GTPases (~25 kDa) consisting of six central β-sheets coordinated five α-helices that provide a well conserved guaninenucleotide binding fold [2]. Binding different guanine nucleotides in vivo causes substantial conformational changes in the ‘switch’ regions of Rab GTPases. Rab proteins have variable C-terminal tails that are covalently lipidated. These C-terminal tails also undergo a conformational change upon GTP-binding by disengaging their guanine dissociation inhibitor (GDI) and inserting into a lipid bilayer [3]. Thus, a nucleotide-specific Rab interacting protein would be expected to use these features to achieve specific binding. An important tool that has driven functional studies of Rab GTPases as well as biochemical approaches aimed at finding Rab effectors is based on conserved mutations near the nucleotide binding region. Mutation of Q61 to L in Ras, which blocks GTPase hydrolysis, was originally found as an oncogenic form of Ras [4]. This position is highly conserved amongst Ras-family members, allowing for a similar mutation to be introduced into Rab GTPases to lock them into a GTP-bound conformation [5, 6]. Similarly, mutation of S34 to N locks Ras into a GDP-bound conformation, which can bias interactions toward proteins such as guanine-nucleotide exchange factors [7]. Mutant Rabs (GTP-bound “Q > L” point mutants and GDP-bound “S or T > N” point mutants) have been used in numerous biochemical and genetic approaches to find interacting partners. One particular approach is the yeast 2-hybrid (Y2H) system, in which fusion proteins containing a Rab (aka “bait”) and its interacting partner (aka “prey”), bind to form a functional transcription factor that drives yeast growth [8–10]. The availability of sets of Rab fusion “bait” proteins configured in a GTP-bound (Q > L) and GDP-bound (S or T > N) conformation have made it possible to use a Y2H based matrix to score a particular Rab interacting “prey” protein for its nucleotide and Rab specificity across the whole family of Rab GTPases [11]. However, the limited scale and capacity a traditional Y2H screen has in sampling potential interacting partners within a given “prey” cDNA library has prevented the use of these Rab GTPase “bait” sets to perform comprehensive de novo Y2H screens for Rabs and their nucleotide specific interactions. Rather, finding or not finding an interacting partner in a typical Y2H screen is entirely stochastic and comes without the ability to make quantitative or statistical statements about whether potential interacting candidates do or do not interact with a given Rab GTPase in a nucleotide-specific manner [12]. The advent of deep sequencing has allowed this limitation to be addressed since the composition of a “prey” library can be delineated and quantified from yeast populations grown under

Comparative Rab Interactions by Batch Yeast 2-Hybrid

119

conditions that do and do not select for a positive Y2H interaction. We have developed one of these approaches called DEEPN (Dynamic Enrichment for the Evaluation of Protein Networks), which uses selection for Y2H interactions at a modest stringency in batch using liquid cultures [12]. The abundance of every preyencoding plasmid is determined by deep sequencing and bioinformatic analysis using a dedicated stand-alone software package designed specifically for DEEPN datasets. For the identification of proteins that differentially interact with Rab GTPases, DEEPN offers two main advantages: One is that deep sequencing can confirm that the entire composition of the prey library population within yeast carrying one particular Rab “bait” is the same as that of another particular Rab bait [13]. This allows for a direct comparison between what components one Rab bait interacts with versus a different Rab bait. The DEEPN software also identifies the junctions that connect the prey insert with the expression plasmid, allowing one to computationally determine whether a particular prey gene fragment is in the proper translational reading frame and to determine what portion of a given reading frame encodes the interacting protein fragment [14]. The latter feature is especially useful when using a highly complex library of prey plasmids which contains several different open-reading frame fragments since interacting domains can be quickly delineated. These features offer distinct advantages when searching for Rab interactions. In systematic matrix-driven Y2H screens, Rab proteins have limited representation because their biologically relevant interactions are driven by nucleotide binding and thus, they need to be presented in particular nucleotide-bound conformations that are not represented in genome-wide libraries [15–18]. In both matrixdriven Y2H screens and affinity-isolation/mass-spectrometry experiments, full-length proteins are analyzed rather than protein fragments. Thus, Rab interacting domains may be hidden within the context of larger proteins. Moreover, there is not an immediate indication where in a protein a Rab-interacting domain could lie without interrogating multiple protein fragments later, whereas DEEPN interrogates several gene fragments to yield comparative interacting data for each fragment as an integrated part of the workflow. Here we demonstrate how to analyze a DEEPN dataset for interactors that differentiate between distinct Rab proteins and their nucleotide conformation. Several proteins are known to bind multiple Rab proteins, often within distinct domains. Here we show how DEEPN Y2H data can identify subdomains with such proteins to yield a medium-resolution interaction map and how computational reconstruction of plasmids that yield a positive Y2H interaction can inform downstream validation and hypothesis testing.

120

Tabitha A. Peterson and Robert C. Piper

Major Outcomes and Possible uses. The genome encodes a plethora of Rab proteins, yet only the function of a handful are largely known. Even for these few, how their functions are executed and the set of interacting effector proteins required for that execution remain underdetermined. Rab GTPases work by interacting with other proteins in a manner dependent on their bound nucleotide. To understand their function requires finding those nucleotide specific interactions and characterizing the structural basis of them enough to alter their Rab-interacting motifs and determine how that interaction is relevant to cellular process. The methods described here harness the inexpensive capabilities of highthroughput sequencing and the well-established yeast 2-hybrid protein interaction reporter system to not only query large sets of potential interacting proteins, but statistically determine whether each candidate has specificity for one nucleotide-bound state versus another. Moreover, with a dense library of open-reading frame fragments, one can use computational methods to extrapolate where in a given protein a Rab interacting domain is located. This method can be expanded to not only determine what interactors are dependent on a particular nucleotide-bound conformation but also which ones may be sensitive to disease-causing mutations within Rab proteins [19, 20], thus offering a pathway to discover the biochemical basis for how Rab mutations cause disease.

2

Materials

2.1 Rab Expression Constructs

1. Rab fusion constructs in pTEF-GBD, encoding the Gal4 DNA binding domain. Rab GTPases with mutations that favor a GTP-bound conformation and a GDP-bound conformation. Rab open-reading frames are codon optimized to the S. cerevisiae and the isoprenylation consensus sequence (CAAX box, [21]) minimally mutated to avoid lipidation (Fig. 1).

2.2

1. Illumina sequence datasets from a differential DEEPN Y2H screen. This includes sequence data from plasmid populations grown under nonselective conditions or conditions that select for a positive Y2H interaction (e.g., media lacking Histidine) using the Gal4-DNA-binding bait vector alone or within a fusion construct with Rab mutants locked in their GDP or GTP bound state.

Data Processing

2. DEEPN software programs, including DEEPN, Stat_Maker, and Mapster. (https://github.com/emptyewer) (Fig. 2). 3. Macintosh computer for data processing. (minimum requirements: OS 10.10 or above, quad-core Intel i3 processor, 8 Gb memory, 4 Tb hard disk drive).

Comparative Rab Interactions by Batch Yeast 2-Hybrid

121

Fig. 1 Construction of Rab bait Y2H plasmids. (a) Schematic of the Gal4-DNAbinding domain expressing plasmid pTEF-GBD, a low-copy yeast plasmid with TRP1 for selection in yeast and Kanr for selection in bacteria. (b) Shown is the cloning of a Rab GTPase with alteration of the Rab C-terminal CAAX box. Clone the Rab GTPase of interest into the pTEF-GBD plasmid linearized with either EcoRI/NarI or NcoI/XhoI for N- or C-terminal cloning respectively to the Gal4DNA-binding domain. The CAAX box on Rab proteins directs their lipidation (geranylgeranylation) which would direct their interaction with GDI and also membranes. This would hamper their ability to translocate to the nucleus and thus their ability to interact with Gal4-activation-domain “prey” in the nucleus. To avoid this, the Cysteine residues and remaining residues that define the CAAX box are replaced with alanine codons 2.3 Plasmid Reconstruction

1. Processed data files from DEEPN output (see Note 1). 2. Plasmid: pPL6343—pGal4-AD. 3. Oligonucleotides to amplify gene fragments and clone into pGal4-AD (see Note 2).

2.4

Validation

1. Plasmids: pPL6229—pTEF-GBD, pPL6222—pTEF*-GBD, pPL6343—pGal4-AD. 2. Yeast Strains; PJ69-4A and PLY5725. 3. Glucose Solution (50% w/v): for 500 mL add 220 mL milliQ water to a 600 mL beaker. Add in 250 g D-(+)-glucose slowly

122

Tabitha A. Peterson and Robert C. Piper

Fig. 2 User interface of two software programs used to computationally analyze Illumina sequence data from batch Y2H assays. (a) shows the Mapster program that can be used to Map sequence reads to the relevant genome to create a .sam file used for all subsequent analysis. (b) shows the DEEPN main user window that allows access to analysis modules such as GeneCount, BlastQuery, and ReadDepth

till all dissolved. Add milliQ water up to 500 mL. Filter-sterilize with a 0.22μm PES filter and store at room temperature. 4. Yeast Nitrogen Base (YNB): for 500 mL, add 400 mL milliQ water to a 600 mL beaker. Add 3.35 g Yeast Nitrogen Base without amino acids. Mix well and add milliQ water up to 480 mL. Autoclave and allow to cool till warm to touch. Add 20 mL 50% glucose. Swirl to mix. Store at room temperature. 5. Transformation Buffer: 1 M sorbitol, 1 M lithium acetate dihydrate, 10 mM tris pH 7.6, 0.5 mM EDTA, 0.2 mM calcium chloride. For 500 mL, add 300 mL milliQ water to a 600 mL beaker. Add 91.1 g sorbitol, 10 mL 0.5 M Tris pH 7.6, 5.1 g lithium acetate dihydrate, 500μL 0.5 M EDTA pH 8.0, and 100μL of 1 M Calcium Chloride. Mix well and add milliQ water up to 500 mL. Filter-sterilize with a 0.22μm PES filter and store at room temperature. 6. Yeast extract peptone dextrose (YPD) plates: For 25 plates, weigh out and dissolve 10 g peptone and 5 g yeast extract in 400 mL MilliQ water in a 600 mL beaker. Mix well and add milliQ water up to 480 mL. Add 7.5 g agar. Autoclave and allow to cool till warm to touch. Using a pipette, add 20 mL of 50% glucose. Mix well by swirling. By pipette pour 20 mL into a series of 100 mm plates.

Comparative Rab Interactions by Batch Yeast 2-Hybrid

123

7. Complete synthetic minimal media (CSM) -Trp plates: For 25 plates, weigh out and dissolve 3.35 g Yeast Nitrogen Base without amino acids in 400 mL MilliQ water in a 600 mL beaker. Mix well and add milliQ water up to 480 mL. Add 0.35 g -Trp -Met dropout mix, 10 mg of methionine, and 7.5 g agar. Autoclave and allow to cool till warm to touch. Using a pipette, add 20 mL of 50% glucose. Mix well by swirling. By pipette pour 20 mL into a series of 100 mm plates. 8. CSM -Leu plates: For 25 plates, weigh out and dissolve 5.025 g Yeast Nitrogen Base without amino acids in 400 mL MilliQ water in a 600 mL beaker. Mix well and add milliQ water up to 470 mL. Add 0.5025 g -Leu -Met dropout mix and 7.5 g agar. Autoclave and allow to cool till warm to touch. Using a pipette, add 30 mL of 50% glucose. Mix well by swirling. By pipette pour 20 mL into a series of 100 mm plates. 9. CSM -Leu -Trp plates: For 25 plates, weigh out and dissolve 5.025 g Yeast Nitrogen Base without amino acids in 400 mL MilliQ water in a 600 mL beaker. Mix well and add milliQ water up to 470 mL. Add 0.5025 g -Trp -Leu +40Ade dropout mix, 120 mg adenine, and 7.5 g agar. Autoclave and allow to cool till warm to touch. Using a pipette, add 30 mL of 50% glucose. Mix well by swirling. By pipette pour 20 mL into a series of 100 mm plates. 10. CSM -Leu -Trp -His plates: For 25 plates, weigh out and dissolve 5.025 g Yeast Nitrogen Base without amino acids in 400 mL MilliQ water in a 600 mL beaker. Mix well and add milliQ water up to 470 mL. Add 0.4875 g -Trp -Leu -His +40Ade dropout mix, 120 mg adenine and 7.5 g agar. Autoclave and allow to cool till warm to touch. Using a pipette, add 30 mL of 50% glucose. Mix well by swirling. By pipette pour 20 mL into a series of 100 mm plates. 11. Plate reader or spectrophotometer to read OD600. 12. Sterile sticks and 1.7 mL microcentrifuge tubes.

3

Methods Goal: The statistical software module in DEEPN assesses whether a particular gene, or gene fragment is enriched in the population of plasmids in the Y2H culture placed under conditions that select for a positive Y2H interaction. Typically, the number of sequence reads for a gene that has a true positive Y2H interaction are far higher in the selected population than the nonselective population. For the interaction to be specific for the bait protein of interest, enrichment or increase in the number of sequence reads should be far less for a control bait (e.g., the Y2H vector alone that only expresses the

124

Tabitha A. Peterson and Robert C. Piper

Gal4-DNA binding domain alone). Discerning what is likely to be a true and specific enrichment above the noise in the experiment is provided by the DEEPN software package using a built-in statistical model. The DEEPN software also determines whether the enriched gene/ORF prey inserts are likely in the correct translational reading frame, or not. These two analyses then serve as the first step in identifying likely Y2H-interactors specific to one bait, but not another. A second aspect of informatic processing takes advantage of the fact that prey libraries, such as cDNA libraries, contain fragments of open-reading frames and rarely complete fulllength clones. By determining the exact 50 and 30 ends of the gene fragment that is enriched, bioinformatic analysis can reveal what domains or parts of a particular interacting protein is sufficient for interaction. In addition, by monitoring what gene fragments are not enriched upon Y2H selection, DEEPN can also indicate what domains are not required for Y2H interaction. The more fragments that are in the prey library, the more granular DEEPN analysis can become to determine the relevant interaction domain. Previously, we have made high-density libraries from genomic DNA from S. cerevisiae, an organism with few introns allowing genomic DNA fragments to provide a useful array of open-reading frame fragments. We also have recently made a prey library of openreading-frame fragments derived from the human ORFeome v8.1. These libraries allow for better sampling of a given ORF, which in turn, can provide a higher resolution analysis of interacting and noninteracting ORF fragments through informatic analysis of the sequencing data (Fig. 3). We obtained DEEPN sequence data from screening mutant Rab bait proteins locked in a GDP as well as GTP-locked conformation using a human ORFeome fragment prey library. Following are the steps to process sequence data, identify likely interacting proteins, discern the interacting portion of each candidate from sequence data, and reconstruct the particular library constituent plasmids to perform validation experiments to confirm deduced Y2H interactions. 3.1

Data Processing

1. Obtain Illumina 150 bp paired-end reads from PCR amplicons amplified from DNA isolated from different yeast populations grown under selective and nonselective conditions. PCR amplicons are randomly sheared to ~250–450 bp fragments, modified by bar-coded Illumina sequencing primers prior to sequencing in a flow cell. Between 8 and 20 million reads/ sample is adequate for analysis. 2. Map reads to relevant genome. For screens using the human ORFeome library, map Illumina reads to the human genome hg38. If alternate prey libraries have been used, then use mm10 for the reference mouse genome, or Saccer3 for the reference

Comparative Rab Interactions by Batch Yeast 2-Hybrid

125

Fig. 3 Overview of the process to find differential Rab interacting proteins using DEEPN, a batch yeast two-hybrid approach, and subsequent validation and characterization. Rab “bait” plasmids are constructed as shown in Fig. 1. These are introduced into yeast containing a diverse Y2H “prey” library comprised of gene fragments. After selection for positive Y2H interactions, the entire population of remaining prey plasmids is sequenced to find genes that are enriched, indicating a positive Y2H interaction, and data are further analyzed to determine what gene fragments were selected for. These fragments also define the Rab-interacting region (s) of each prey protein (yellow regions). The computationally deduced plasmids that produce the Rab-interacting protein fragments are then reconstructed and tested in a series of binary Y2H interactions with a matrix of Rab proteins in their GDP and GTP-bound conformations to determine the specificity of interactions

yeast genome. The output must be in the form of a .sam file (sequence alignment map). Programs such as Tophat2 or HiSat2 that can accommodate mapping mRNA sequence data to a complete genome work comparably. For an easy-to-use interface, mapping can be accomplished using the Mapster program included in the suite of DEEPN bioinformatics software. 3. Process the .sam files with the “Gene Count” module within the DEEPN software. Once complete, then run the “Junction Make” module one time to find the 50 ends or the gene fragment insert, and a second time to find the 30 end. For the human ORFeome library, use the following junction sequences to find the 50 and 30 ends of the gene fragment inserts, respectively: CCTCTGCGAGTGGTGGCAACTCTGTGGCCGGCCCAGCCGGCCATGTCAGC, CATGGCCCGGGAGGCC TAGATGAATAATAGAAGACGGGAGACACTAGCAC.

126

Tabitha A. Peterson and Robert C. Piper

Fig. 4 Data from Stat_Maker identifying SSX2IP as an interacting protein with Rab43 (top) and Rab5A (bottom). The first row shows the number of sequence reads found for SSX2IP for three different datasets, Vector alone, Bait 1 (Rab43_QL or Rab5_QL), and Bait 2 (Rab43_TN or Rab5_SN) in ppm. A three-way statistical model used to evaluate the likelihood that there is a specific enrichment in the number or reads for SSX2IP (Y2H interaction) for a given bait versus Vector alone and versus the other bait. These are observed as pBait1 and pBait2 having a maximum probability of 1. The data on top indicate that SSX2IP specifically interacts with Rab43 in its GTP-bound conformation, but not its GDP-bound conformation nor Vector alone. The data below indicate that SSX2IP specifically interacts with Rab5 in its GDP-bound conformation, but not its GTP-bound conformation nor Vector alone. Both sets of data also summarize the percentage of junctions (those sequence reads that span the Gal4-activation domain and the prey protein of interest), that are in the correct translational frame and within the open-reading frame (inframe_inorf). Having a large enrichment of reads for a prey hit as well as a large proportion of those being in the proper reading frame are both criteria to determine the authenticity of the computationally derived Y2H interaction

4. Identify in-frame interacting partners with Stat_Maker. Stat_Maker results display statistical rankings for the differential interaction of a given prey with vector alone, a Rab protein in its GTP-bound conformation, and a Rab protein in its GDP-bound conformation (Fig. 4). This 3-way comparison assigns a probability for finding gene products that specifically interact with only the GTP- or GDP-bound form. Filter the specific interactors to identify those that are in the correct translational reading frame and within the open-reading frame of interest. 5. Use the Blast Query module to analyze the set of 50 and 30 junctions to find what fragments of a given interacting gene is sufficient to yield a positive Y2H interaction. The data that BlastQuery uses is a collection of all the sequences that flank the 50 and 30 ends of each insert. These are subjected to a Blastp search to determine what gene they correspond to and what portion of the open-reading frame is encompassed in the fragment (Fig. 5). Click save to CSV to export data to a spreadsheet file located in QueryResults. 6. Use the ReadDepth module to find the number of sequence reads that were obtained across the prey gene of interest (Fig. 6). Use the gene identifier (NM_*) that corresponds to

Comparative Rab Interactions by Batch Yeast 2-Hybrid

127

Fig. 5 Shown is the display from BlastQuery that compares various fragments of SS2XIP from 3 different datasets: Vector alone, Rab5A_SN (locked in the GDP-found form), and Rab5A_QL (locked into the GTP-bound form). BlastQuery displays data on the different junction fragments of the selected gene that were found in the sequence results in (A) tabular format and (B) graphical format. Junction fragments are those that span the C-terminal end of Gal4-activation domain and the fusion point into the gene of interest. The position within the gene of interest where it is fused to the Gal4 activation domain is listed as well as the number of times this particular junction was found in the dataset (in ppm). Also shown, is a calculation of whether the fragment of the gene of interest is in the coding region and whether it is in the same translational frame as the Gal4activtion domain. For the example here, a fragment of SSX2IP that begins at position 890 is greatly enriched in in the Rab5A-SN dataset (1390 ppm), over what its abundance was in the vector only dataset (0.217 ppm) and Rab5A_QL dataset (0.177). The exact GenBank identifier of the annotated cDNA/transcript to which blast matches were found is given in the top-center and the sequence of that cDNA is provided in the bottom window for unambiguous identification of the prey gene of interest

the gene of interest and also select the correct sample from the selected population that contains the enriched gene of interest. Adjust the interval of sequence match to 20–30 bp to increase resolution of the analysis. Click the save CSV button to write a spreadsheet file with the ReadDepth results.

128

Tabitha A. Peterson and Robert C. Piper

Fig. 6 Display of Read Depth that shows the sequence coverage of a prey gene of interest designated by a GenBank identifier in a particular dataset. The level of sequence coverage indicates the level of enrichment of the corresponding gene region found in the data. This feature can identify which fragments were selected for or enriched by Y2H interactions and which fragments were not. In this case, the interacting gene of interest is SSX2IP, selected for an interaction with Rab5A_SN locked in the GDP-bound form. Two regions appear in the ReadDepth display, a very abundant fragment beginning at position ~900 bp and a more minor fragment beginning at position ~340 bp

7. Collate the data from the BlastQuery tables and the exported data from ReadDepth (Fig. 7). 3.2 Plasmid Reconstruction

Goal. There are two methods to reconstruct a prey plasmid that encompasses the gene fragment within the original Y2H library that produced the positive Y2H interaction that led to the amplification of the plasmid during growth under selective conditions. One is approximate, in that the known stretch of residues within the gene of interest are determined and cloned into the prey plasmid in frame with the Gal4 Transcriptional Activation domain. The other is more precise and relies on finding the sequence reads that correspond to the 50 and 30 junctions of the gene fragment that yields a positive Y2H interaction. These are found manually by searching through the list of junctions compiled in the *.junctions.txt file. 1. Approximate method. The data in Fig. 7 indicate a single gene fragment of interest if a single region is indicated in ReadDepth and flanked by one high-abundance 50 junction and one highabundance 30 junction (see Note 3). The junction data from

Comparative Rab Interactions by Batch Yeast 2-Hybrid

129

Fig. 7 Collated data for Rab Y2H interaction. Shown are the collated data for interaction of SSX2IP with Rab GTPases. DEEPN datasets for multiple Rab GTPases were generated and two different Rab proteins were found to interact with SSX2IP. However, the fragments of SSX2IP mediating the interaction were different between Rab5A_SN (GDP-bound conformation) and Rab43_QL (GTP-bound conformation). By summarizing the junction fragment data available from BlastQuery and the sequence coverage from ReadDepth, a helpful picture of these interactions can be generated for comparison. (A) shows the number of 50 junctions found containing SSX2IP and their position along the length of the SSX2IP cDNA (left) for the dataset for Rab5A_SN interactions. Lines in blue are in the same reading frame as the upstream Gal4-activation domain, whereas the grey are out of frame fusions. Blue arrows indicate the 50 end of fragments that are must abundant and that are shown in tabular format below. Similar junction fusion points are shown for the 30 end of SSX2IP fragments, with the most abundant 30 junction indicated with red arrows and highlighted in tabular format below. Data from ReadDepth (right) is shown overlaid with blue and red arrows corresponding to the abundant 50 and 30 fragment junctions, respectively. Below is the domain organization of the SSX2IP protein, scaled to the nucleotide positions within the read depth data above. Delineated in blue are the putative Rab interacting regions extrapolated from the data. (B) Same analysis in A but for SSX2IP interactions with Rab43-QL (GTP-bound conformation) showing interaction with the 50 fragment corresponding to residues 68-206

BlastQuery will define the beginning and end codons of the gene region of interest. Using the strategy in Fig. 8, construct a DNA map in which the span of DNA encoding the residues of interest within the prey gene of interest are inserted in-frame downstream of the Gal4 transcriptional activation domain. This construct should also include a stop codon after the gene fragment. 2. Precise method. The data in Fig. 7 show the 50 and 30 junction data that correspond to the gene of interest. However, the fragment of interest may be flanked by other nucleotides as a result of the way it was cloned into the vector. Finding an actual sequence that encompasses those junctions allows for the precise reconstitution of the likely library plasmid that gave rise to the Y2H positive interaction. The precise junction of the Gal4AD vector with the 50 and 30 ends of the gene fragment may

130

Tabitha A. Peterson and Robert C. Piper

Fig. 8 BlastQuery can identify particular fragments that are greatly enriched under selection. These fragments are identified by their junction sequences, which are the sequences that are immediately adjacent to the sequence of the Gal4-activation domain with which they are fused. With this information in hand, one can trace back to the original sequence. The data that BlastQuery displays can be found in the associated *.blast. txt file, which contains a series of blast results for each junction sequence found in the original Illumina datafiles. In this example, what is sought is the original sequence that spans the Gal4-activation domain and the gene of interest. (A) BlastQuery shows that the interacting gene is SSX2IP, and the junction homology is found to start at a region beginning at base-pair position 558, with a Q-start of 2 meaning that there is an insertion of a bp in between the end of the Gal4-activation domain and the beginning of the SS2XIP coding region. The exact gene-ID for the SSX2IP that was matched is found in the BlastQuery window as NM_001166295. (B) To find the original sequence read identifier, one needs to open the corresponding *. blast.txt file that lists all the blast hits and search for a blast hit for NM_001166295 and find one that begins at position 558 with a Q-start of 2. Shaded in grey is the Illumina read identifier, in this case: K00274:177: HW3TFBBXX. (C) By searching for the read identifier in B in the *.junctions.txt file, the original sequence read can be found. The junctions.txt file is arranged with the following format: read ID, SAM flag (typically “4” because the read was not mapped), contig name (typically “*” because the read was not mapped), map position (typically “0” because the read was not mapped), the original read (which is what is needed to retrieve), the junction sequence downstream of the Gal4-activation domain (which is used to in the Blast search), and the amino acid translation of the junction sequence. (D) The original sequence read can be extracted from the file and used to reconstruct what the precise sequence is that joins the Gal4-activation domain in the prey plasmid with the gene of interest fused to it

affect the linker region preceding the fragment and the C-terminal region before translation is terminated. The data required from BlastQuery on the gene fragment of interest is the NM_* code of the gene of interest, the Position, and the q-start (Fig. 8). The files needed are the *sample*.blast.txt and

Comparative Rab Interactions by Batch Yeast 2-Hybrid

131

the corresponding *sample*.junctions.txt file. Open the *. blast.txt file. Search for the NM_* code of the gene of interest and find a Blast match that also contains the q-Start and Position numbers that match the q-start and s. start values, respectively. This line also contains the original sequence read identification number found within the original FASTQ file of the Illumina dataset. Copy the sequence ID and search for it in the corresponding *junctions.txt file. Each line within the *.junctions.txt file will contain the original sequence read, the sequence downstream of the flanking sequence used to find each junction, and the amino-acid sequence of the translated flanking region. Using the sequence from both the 50 and 30 *. junctions.txt file, construct a DNA map in which the span of DNA encoding the residues of interest within the prey gene of interest are inserted in-frame downstream of the Gal4 transcriptional activation domain. 3. Making new Gal4-AD “prey” plasmid. From the electronic map generated in Subheadings 3.2, steps 1 or 2, design oligonucleotide primers that have 22–24 bp of homology with the gene insert of interest and that have 15–20 bp of homology with the regions of pGal4-AD that flank the insertion site. Using those primers, amplify the fragment of interest from the genomic DNA previously isolated from the genomic DNA sample of the relevant yeast population that was used to generate the Illumina sequence data. These samples should be greatly enriched for the gene fragment of interest due to their amplification during growth under selection conditions. Once the PCR product is checked for the correct size, use the Gibson method to recombine the fragment into pGal4-AD double cut with SfiI. Once sequenced and verified, these prey gene fragment AD plasmids can be used in binary Y2H validation experiments (Fig. 9). 3.3

Validation

Goal: The goal of this step is to perform a series of binary assays in a traditional format to directly compare Y2H interactions across multiple baits including empty vector alone. This serves to validate the possibly Y2H interactions that computational analysis predicts happened during the batch selection process within the original DEEPN experiment. When used with a variety of bait proteins (such as a large set of Rab protein mutants locked in ether GTPor GDP-bound conformations), this analysis can reveal one of three different outcomes. One is that a given prey fragment has the same interactions with the bait GTPases as found by the batch DEEPN analysis in that a subset of Rab proteins interact while others, including vector alone, do not. Another is that more Rab proteins and possibly vector alone are found to produce a Y2H interaction that was not detected computationally be DEEPN. The reason for

132

Tabitha A. Peterson and Robert C. Piper

Fig. 9 Reconstructing prey plasmids. (A) Schematic of pGAL4-AD, a high-copy LEU2-containing plasmid that expresses an HA-tagged Gal4 activation domain and is used to house yeast genomic and human ORFeome fragment libraries. (B) Sequences corresponding to the flanking regions of a particular fragment of SSX2IP (which was identified to interact with Rab43) as determined by computational reconstruction using BlastQuery as noted in Fig. 8. Underlined portion is the region encoding SSX2IP, bold is the region from the prey plasmid pGAL4-AD. (C) Example oligo primers that are used to amplify the designated fragment of SSX2IP and clone into SfiI double cut pGAL4-AD. Bold shows the SfiI sites

this is that each bait in a DEEPN run can interact with a different set of prey proteins. And while some of those preys may also interact with other bait proteins, the preys may not all be enriched to the same extent across samples. The likely reason is that differential interactions across two baits will create different enriched populations that may crowd out detection of one authentic interacting prey in one sample but not the other. This emphasizes the need to perform the binary validation studies described here. A third possible outcome is that binary assays fail to show a Y2H interaction with a prey fragment computationally identified by DEEPN (Fig. 10).

Comparative Rab Interactions by Batch Yeast 2-Hybrid

133

Fig. 10 Binary Y2H interactions. A “prey” plasmid encoding an interacting portion of SSX2IP, as extrapolated from the sequence data, was reconstructed and introduced into diploid yeast also containing the indicated pTEF-GBD fusion “bait” plasmids expressing Rab fusions (in either the GDP or GTP conformation) as well as vector only (ø). The diploid cells had as their sole source of HIS3 gene a version under the control of the promoter that requires a two-hybrid interaction to complement a split Gal4 transcription factor. Yeast were serially diluted and plated on media containing histidine (+His) or lacking histidine (His), the latter of which reveals positive Y2H interactions indicated by colony growth. To determine Rab specificity, a large matrix is constructed to find whether the particular fragment of SSX2IP interacts with multiple Rab proteins and what the conformational specificity is. In these data, SSX2IP (residues 68-206) is specific only for the GTP-bound conformation of Rab43

1. Lithium Acetate transform vector only pTEF-GBD or pTEF*GBD and bait pTEF-GBD or pTEF*-GBD constructs into PJ69-4A and newly constructed prey AD validation constructs along with vector only pPL6343 into PLY5725. Spread transformations onto CSM -Trp and CSM -Leu -Met plates respectively (see Note 4). Incubate plates in a 30  C incubator for 2–3 days or the appearance of colonies.

134

Tabitha A. Peterson and Robert C. Piper

2. Using a sterile stick, make quarter size patches of about 5–6 single colonies of each transformation onto the appropriate selection plate. Incubate plates 30  C 1 day (see Note 5). 3. Using sterile technique, set-up a mating reaction of each pTEFGBD or pTEF*-GBD vector only and bait construct with Library AD validation construct(s) on a YPD plate. Briefly, take a matchhead of Library AD validation construct, dab it at the top center of the plate, and streak it down the YPD plate. Using a sterile stick, take a matchhead of pTEF-GBD or pTEF*-GBD vector only and bait constructs, dab to the left of the already streaked Library AD validation construct, and streak it to the right through the Library AD validation construct. Do this for all library AD validation constructs/pTEFGBD or pTEF*-GBD constructs needing validated. Incubate plates in a 30  C incubator for 1 day. 4. Using sterile technique, streak the mated yeast onto CSM -Leu-Trp plates to select for a diploid population. Incubate plates in a 30  C incubator for 1 day. 5. For each mating reaction, label a sterile 1.7 mL microcentrifuge tube with construct names. Pipette 500μL of Yeast Nitrogen Base into each tube. 6. Using sterile techniques and a sterile stick, obtain a small matchhead amount of diploid yeast cells and twirl it into the correct 1.7 mL microcentrifuge tube. Do this for all diploid possibilities in a given set. (see Note 6). 7. Make sure samples are mixed well and pipette 140μL of samples into a 96 well plate. Save the remaining yeast diploid suspension in each tube for further dilution, which will depend on the values obtained from the plate reader. 8. Measure the OD600 of the cells. Record the OD (see Note 7). 9. Based on the values from the plate reader, make up a 1:10 dilution series using the YNB starting with an initial concentration of diploids at 0.5 OD and continuing until you have a total of 6 different concentrations. This can be done in either a 96 well plate or in sterile 1.7 mL microcentrifuge tubes (see Note 8). 10. Obtain a CSM -Trp -Leu and a CSM -Trp -Leu -His plate, label/mark the top as top, as well as label it accordingly to the combinations of diploids that will be spotted (see Note 9). 11. Using a pipette, spot 5μL, left to right and least to most concentrated respectively in one row (see Note 10). 12. When all the spots have dried, place all plates in the 30  C incubator for 3 days. 13. After 3 days, pull all the plates out of the 30  C incubator and scan for archive and interpretation (see Notes 11 and 12).

Comparative Rab Interactions by Batch Yeast 2-Hybrid

4

135

Notes 1. DEEPN creates a number of datasets and files that allow easy analysis of sequence data to discern the nature of particular Y2H interactions. One of those datasets is viewed with the module Read Depth, which displays the number of reads obtained along each transcript or ORF. This analysis will indicate which gene fragment(s) were present in each sample and indicate what portion of the gene sustained a Y2H interaction under selective conditions. The second dataset is a description and count of the junctions that join the Gal4-transcriptional activation domain to a particular gene of interest. Here, the 50 and 30 ends of gene fragments that encode interacting portions are collated and counted, and the data summary is viewed using Blast Query. Finally, a *.junctions file is created that lists all of the reads that cover the junctions between the Gal4-AD “prey” vector and the gene inserts. From this file, one can search and retrieve the exact sequence of a given junction in order to computationally reconstruct the exact prey plasmid that supported a positive Y2H enrichment in the DEEPN experiment. 2. The process of plasmid reconstruction uses the processed DEEPN files to computationally reconstruct “prey” plasmids that sustained a Y2H interaction. Once this is done, oligonucleotides are designed to amplify these fragments and clone these fragments into pGal4AD to yield a plasmid that can then be used to validate the Y2H interaction that was indicated by the DEEPN data. 3. Finding the gene fragment of interest to test in further analysis is straightforward when a single fragment was amplified during selection as indicated by a single 50 and 30 junctions that flank a single region visualized by ReadDepth (Fig. 6). However, multiple fragments may also be amplified during selection, making it less clear where fragment boarders are and whether multiple Rab-binding domains are present or whether overlapping fragments simply share a single Rab-interacting region. An example is shown in Fig. 7, where Rab43-GTP interacts with a single fragment of SSX2IP whereas Rab5-GDP interacts with two regions that can be seen using the ReadDepth data. 4. We found that by making the competent cells within 3 months of transformation as well as not freeze thawing these cells allows for more efficient transformations. Plates made within the last week also allow for better transformations efficiencies. 5. The ability to analyze the validation result in confidence hinges on knowing that the bait BD constructs as well as the newly constructed Library AD constructs express protein, therefore it is imperative that the expression of the constructs be checked and confirmed by western blot analysis before continuing.

136

Tabitha A. Peterson and Robert C. Piper

6. Before doing this step, it is imperative that you think through what combinations of diploids you plan on validating on a given set of CSM -Leu -Trp and CSM -Leu -Trp -His plates. For example, you may want to compare one newly constructed library AD construct across multiple Rab GTPases or you may want to compare a few different library AD construct regions across the same set of Rab GTPases in a GDP versus GTP specific manner. You need this planned out for a couple reasons. One, we have seen growth variability between plates so if you want to be able to make direct comparisons, they really should either be all on the same plate or you have a representative control (pTEF-GBD and Library AD construct) on each set of plates. Second, even though diploids are happier in YNB than sterile water, you do not want to leave them sit there for hours while you are setting up validation of other diploid combinations. You can always complete the protocol from here with one set and return to complete for iterative sets. 7. Make sure the cells are properly suspended prior to checking the OD600 reading as cells that have settled will give a false reading. Also, it is imperative that if a plate reader is used to determine the OD600, the reading is multiplied by the correction efficient that allows for the same OD600 reading that would be achieved with a 1 mL solution 1 cm pathlength. 8. In order to make accurate dilutions, make sure to mix the suspension prior to using it to make the next 1:10 dilution set in the series. If this is not mixed properly for dilution here, you will not make an accurate dilution which will make your final result less interpretable. This will be seen by the growth or lack of growth when you compare constructs on the CSM -Trp -Leu plate at the end of the validation. You should see the same growth or ability to grow on CSM -Trp -Leu plates at the end of the validation. 9. Make the CSM -Trp -Leu and CSM -Trp -Leu -His plates the day before spotting. Fresh plates will allow the diploids the best opportunity to grow and give an interpretable result. Plates that are even 3 days old here, will cause a slow growth or what seems to be a stunted growth ability for diploids even on the CSM -Trp -Leu plates alone. 10. It is imperative that you mix the concentrations efficiently right before spotting. This will further ensure that any growth difference seen in diploid comparison sets are accurate and thus interpretable. As mentioned above at the end you should see comparable growth on the CSM -Trp -Leu plates this will give you confidence that any difference seen on the CSM -Trp -Leu -His plates is indeed real. Improper mixing leads to an inability to compare sets and the need to repeat.

Comparative Rab Interactions by Batch Yeast 2-Hybrid

137

11. When interpreting your plates, you want to make sure that the growth is similar across all constructs on the CSM -Trp -Leu plate. If one pair of diploids did not grow as well as another there are a couple reasons for that. One, which is highlighted throughout the notes, is the potential that at one step or another the diploids were not mixed well enough leading to the wrong concentration of diploids being spotted. The other is a little more complicated in the regard that the expression level of the construct is too high and is thus toxic to the cell and a growth defect in the form of cell viability is observed. If expression is in fact too high, you can switch from pTEFGBD vector to pTEF*-GBD that will allow for a lower protein expression level and potentially help with cell viability. If the growth is similar of all diploids across the CSM -Trp -Leu plates than a direct interpretation of growth on the CSM -Trp -Leu -His plates can be made. For example, if there is no growth observed on the CSM -Trp -Leu -His plates, then one would conclude that there is no direct two-hybrid interaction between the Rab GTPase(s) of interest with a given library AD validation construct. You may also observe growth for both the GTP and GDP nucleotide bound states of the Rab GTPase with a given library validation construct of which you could conclude that indeed there is a two-hybrid interaction; however, it is nucleotide nonspecific. Lastly, you may observe that there is growth on only the GTP- or GDP-bound nucleotide state of which you would conclude that the two-hybrid interaction is nucleotide specific for the given pair. If you need to further tease apart the strength of the two-hybrid interaction between different pairs of diploids of the Rab(s)/Validation AD library constructs it is common to add 0.1 mM to 10 mM 3-aminotriazole to the CSM -Trp -Leu -His plates before pouring them. With the system described here, analysis of Rab proteins with the yeast strains and plasmids described, the use of 3-aminotriazole is not necessary. 12. By uncovering Rab interacting protein fragments/domains with a DEEPN screen and then validating those putative interactions with binary Y2H assays over a broad range of Rab GTPases, the Rab-specificity and nucleotide-bound conformational specificity of interactions can be determined. These can help provide immediate insight into how proteins that bind multiple Rab proteins may do this, either by having a single Rab domain that can interact with several different Rab GTPases, or multiple Rab binding sites each with a more exclusive specificity for Rabs. Many proteins that interact with multiple Rab proteins have been described such as RabEP1 [22], Optineurin [23, 24], and MICALL1 [25, 26], all of which have been identified by the approach above to contain

Fig. 11 Hypothesis for SSX2IP. (A) Schematic of the full length SSX2IP protein where CC denotes coiled coil regions of the protein. Also depicted are the regions identified by DEEPN and validation studies for interaction with Rab43-GTP and Rab5A-GDP, which are housed in separate parts of the protein. (B) Binary Y2H analysis with Rab43, Rab5 and an irrelevant control Rab, Rab11, each in their GDP- or GTP-bound conformations alongside of vector alone (ø). Growth is shown only on plates lacking histidine whereby growth indicates a positive protein interaction by Y2H. Shown (right) are the three fragments (a, b, c; residues 223-497, 35-497, and 68-206, respectively) tested for a binary Y2H interaction. (C) Two models for how Rab5 and Rab43 binding could be functionally integrated. Model 1 proposes a Rab cascade where Rab5-GDP binding is triggered by binding of Rab43-GTP. Model 2 proposes that activation of Rab43 allows it to recruit the Rab5 exchange activity of SSX2IP to other Rab43 effectors or Rab43 enriched locations

Comparative Rab Interactions by Batch Yeast 2-Hybrid

139

multiple Rab-binding domains that each have different subsets of Rab specificity. In the example used here, the protein SSX2IP (Synovial Sarcoma X breakpoint 2 Interacting Protein) was found to have two Rab-interacting regions as validated by binary Y2H interactions. One binds Rab5A but only in its GDP-bound conformation, indicating this may be a region that could help SSX2IP work as a nucleotide-exchange factor of Rab5A. A different region binds Rab43, but only in its GTP-bound conformation, indicating that SSX2IP is a specific Rab43 effector. SSX2IP has known roles in centriole assembly and cilia biogenesis [27–29]. Little is known about Rab43; however, one role is to promote trafficking from the ER to the Golgi [30, 31]. Rab5 is known to play a large role in endosomal trafficking, but it also plays a role in maturation of the spindle pole, providing a possible function for an interaction with SSX2IP [32]. Fig. 11 summarizes the differential interactions of Rab43 and Rab5A with SSX2IP. Interestingly, the region that interacts with Rab43-GDP does not appear to do so in the context of full-length protein containing the region that interacts with Rab5A-GTP, suggesting that the binding of one Rab may regulate the binding of another. This suggests two models. One is a Rab cascade whereby Rab5-GTP could bind to SSX2IP and activate its nucleotide exchange activity for Rab43, which would coordinate activities associated with Rab5 with those of Rab43 [33]. Another is that SSX2IP provides a mechanism to localize Rab5 exchange activity to Rab43 membrane compartments or Rab43-containing complexes when Rab43 is activated by GTP binding. References 1. Pfeffer SR (2013) Rab GTPase regulation of membrane identity. Curr Opin Cell Biol 25 (4):414–419. https://doi.org/10.1016/j. ceb.2013.04.002 2. Vetter IR, Wittinghofer A (2001) The guanine nucleotide-binding switch in three dimensions. Science 294(5545):1299–1304. https://doi. org/10.1126/science.1062023 3. Ullrich O, Stenmark H, Alexandrov K, Huber LA, Kaibuchi K, Sasaki T, Takai Y, Zerial M (1993) Rab GDP dissociation inhibitor as a general regulator for the membrane association of Rab proteins. J Biol Chem 268 (24):18143–18150 4. Der CJ, Finkel T, Cooper GM (1986) Biological and biochemical properties of human rasH genes mutated at codon 61. Cell 44(1):167–176. https://doi.org/10.1016/ 0092-8674(86)90495-2

5. Li G, Stahl PD (1993) Structure-function relationship of the small GTPase rab5. J Biol Chem 268(32):24475–24480 6. Stenmark H, Parton RG, Steele-Mortimer O, Lutcke A, Gruenberg J, Zerial M (1994) Inhibition of rab5 GTPase activity stimulates membrane fusion in endocytosis. EMBO J 13 (6):1287–1296 7. Feig LA, Cooper GM (1988) Relationship among guanine nucleotide exchange, GTP hydrolysis, and transforming potential of mutated ras proteins. Mol Cell Biol 8 (6):2472–2478. https://doi.org/10.1128/ mcb.8.6.2472 8. Fukuda M (2010) How can mammalian Rab small GTPases be comprehensively analyzed?: development of new tools to comprehensively analyze mammalian Rabs in membrane traffic.

140

Tabitha A. Peterson and Robert C. Piper

Histol Histopathol 25(11):1473–1480. https://doi.org/10.14670/HH-25.1473 9. Kail M, Barnekow A (2008) Identification and characterization of interacting partners of Rab GTPases by yeast two-hybrid analyses. Methods Mol Biol 440:111–125. https://doi.org/ 10.1007/978-1-59745-178-9_9 10. Langemeyer L, Barr FA (2012) Analysis of Rab GTPases. Curr Protoc Cell Biol. Chapter 15: Unit 15 18. https://doi.org/10.1002/ 0471143030.cb1518s57 11. Fuchs E, Haas AK, Spooner RA, Yoshimura S, Lord JM, Barr FA (2007) Specific Rab GTPase-activating proteins define the Shiga toxin and epidermal growth factor uptake pathways. J Cell Biol 177(6):1133–1143. https://doi.org/10.1083/jcb.200612068 12. Pashkova N, Peterson TA, Krishnamani V, Breheny P, Stamnes M, Piper RC (2016) DEEPN as an approach for batch processing of yeast 2-hybrid interactions. Cell Rep 17 (1):303–315. https://doi.org/10.1016/j.cel rep.2016.08.095 13. Peterson TA, Stamnes MA, Piper RC (2018) A yeast 2-hybrid screen in batch to compare protein interactions. J Vis Exp 136:57801. https://doi.org/10.3791/57801 14. Krishnamani V, Peterson TA, Piper RC, Stamnes MA (2018) Informatic analysis of sequence data from batch yeast 2-hybrid screens. J Vis Exp 136:57802. https://doi. org/10.3791/57802 15. Luck K, Kim DK, Lambourne L, Spirohn K, Begg BE, Bian W, Brignall R, Cafarelli T, Campos-Laborie FJ, Charloteaux B, Choi D, Cote AG, Daley M, Deimling S, Desbuleux A, Dricot A, Gebbia M, Hardy MF, Kishore N, Knapp JJ, Kovacs IA, Lemmens I, Mee MW, Mellor JC, Pollis C, Pons C, Richardson AD, Schlabach S, Teeking B, Yadav A, Babor M, Balcha D, Basha O, Bowman-Colin C, Chin SF, Choi SG, Colabella C, Coppin G, D’Amata C, De Ridder D, De Rouck S, DuranFrigola M, Ennajdaoui H, Goebels F, Goehring L, Gopal A, Haddad G, Hatchi E, Helmy M, Jacob Y, Kassa Y, Landini S, Li R, van Lieshout N, MacWilliams A, Markey D, Paulson JN, Rangarajan S, Rasla J, Rayhan A, Rolland T, San-Miguel A, Shen Y, Sheykhkarimli D, Sheynkman GM, Simonovsky E, Tasan M, Tejeda A, Tropepe V, Twizere JC, Wang Y, Weatheritt RJ, Weile J, Xia Y, Yang X, Yeger-Lotem E, Zhong Q, Aloy P, Bader GD, De Las Rivas J, Gaudet S, Hao T, Rak J, Tavernier J, Hill DE, Vidal M, Roth FP, Calderwood MA (2020) A reference map of the human binary protein interactome.

Nature 580(7803):402–408. https://doi.org/ 10.1038/s41586-020-2188-x 16. Rolland T, Tasan M, Charloteaux B, Pevzner SJ, Zhong Q, Sahni N, Yi S, Lemmens I, Fontanillo C, Mosca R, Kamburov A, Ghiassian SD, Yang X, Ghamsari L, Balcha D, Begg BE, Braun P, Brehme M, Broly MP, Carvunis AR, Convery-Zupan D, Corominas R, Coulombe-Huntington J, Dann E, Dreze M, Dricot A, Fan C, Franzosa E, Gebreab F, Gutierrez BJ, Hardy MF, Jin M, Kang S, Kiros R, Lin GN, Luck K, MacWilliams A, Menche J, Murray RR, Palagi A, Poulin MM, Rambout X, Rasla J, Reichert P, Romero V, Ruyssinck E, Sahalie JM, Scholz A, Shah AA, Sharma A, Shen Y, Spirohn K, Tam S, Tejeda AO, Trigg SA, Twizere JC, Vega K, Walsh J, Cusick ME, Xia Y, Barabasi AL, Iakoucheva LM, Aloy P, De Las Rivas J, Tavernier J, Calderwood MA, Hill DE, Hao T, Roth FP, Vidal M (2014) A proteome-scale map of the human interactome network. Cell 159(5):1212–1226. https://doi.org/10.1016/j.cell.2014.10.050 17. Huttlin EL, Bruckner RJ, Paulo JA, Cannon JR, Ting L, Baltier K, Colby G, Gebreab F, Gygi MP, Parzen H, Szpyt J, Tam S, Zarraga G, Pontano-Vaites L, Swarup S, White AE, Schweppe DK, Rad R, Erickson BK, Obar RA, Guruharsha KG, Li K, Artavanis-Tsakonas S, Gygi SP, Harper JW (2017) Architecture of the human interactome defines protein communities and disease networks. Nature 545(7655):505–509. https:// doi.org/10.1038/nature22366 18. Huttlin EL, Ting L, Bruckner RJ, Gebreab F, Gygi MP, Szpyt J, Tam S, Zarraga G, Colby G, Baltier K, Dong R, Guarani V, Vaites LP, Ordureau A, Rad R, Erickson BK, Wuhr M, Chick J, Zhai B, Kolippakkam D, Mintseris J, Obar RA, Harris T, Artavanis-Tsakonas S, Sowa ME, De Camilli P, Paulo JA, Harper JW, Gygi SP (2015) The BioPlex network: a systematic exploration of the human Interactome. Cell 162(2):425–440. https://doi.org/ 10.1016/j.cell.2015.06.043 19. Banworth MJ, Li G (2018) Consequences of Rab GTPase dysfunction in genetic or acquired human diseases. Small GTPases 9 (1-2):158–181. https://doi.org/10.1080/ 21541248.2017.1397833 20. Li G (2011) Rab GTPases, membrane trafficking and diseases. Curr Drug Targets 12 (8):1188–1193. https://doi.org/10.2174/ 138945011795906561 21. Seabra MC, Goldstein JL, Sudhof TC, Brown MS (1992) Rab geranylgeranyl transferase. A multisubunit enzyme that prenylates

Comparative Rab Interactions by Batch Yeast 2-Hybrid GTP-binding proteins terminating in Cys-XCys or Cys-Cys. J Biol Chem 267 (20):14497–14503 22. Kalin S, Hirschmann DT, Buser DP, Spiess M (2015) Rabaptin5 is recruited to endosomes by Rab4 and Rabex5 to regulate endosome maturation. J Cell Sci 128(22):4126–4137. https:// doi.org/10.1242/jcs.174664 23. Song GJ, Jeon H, Seo M, Jo M, Suk K (2018) Interaction between optineurin and Rab1a regulates autophagosome formation in neuroblastoma cells. J Neurosci Res 96(3):407–415. https://doi.org/10.1002/jnr.24143 24. Hattula K, Peranen J (2000) FIP-2, a coiledcoil protein, links huntingtin to Rab8 and modulates cellular morphogenesis. Curr Biol 10(24):1603–1606. https://doi.org/10. 1016/s0960-9822(00)00864-2 25. Kobayashi H, Etoh K, Ohbayashi N, Fukuda M (2014) Rab35 promotes the recruitment of Rab8, Rab13 and Rab36 to recycling endosomes through MICAL-L1 during neurite outgrowth. Biol Open 3(9):803–814. https://doi. org/10.1242/bio.20148771 26. Rahajeng J, Giridharan SS, Cai B, Naslavsky N, Caplan S (2010) Important relationships between Rab and MICAL proteins in endocytic trafficking. World J Biol Chem 1(8):254–264. https://doi.org/10.4331/wjbc.v1.i8.254 27. Klinger M, Wang W, Kuhns S, Barenz F, Drager-Meurer S, Pereira G, Gruss OJ (2014) The novel centriolar satellite protein SSX2IP targets Cep290 to the ciliary transition zone. Mol Biol Cell 25(4):495–507. https://doi. org/10.1091/mbc.E13-09-0526

141

28. Kurtulmus B, Wang W, Ruppert T, Neuner A, Cerikan B, Viol L, Duenas-Sanchez R, Gruss OJ, Pereira G (2016) WDR8 is a centriolar satellite and centriole-associated protein that promotes ciliary vesicle docking during ciliogenesis. J Cell Sci 129(3):621–636. https:// doi.org/10.1242/jcs.179713 29. Yukawa M, Ikebe C, Toda T (2015) The Msd1-Wdr8-Pkl1 complex anchors microtubule minus ends to fission yeast spindle pole bodies. J Cell Biol 209(4):549–562. https:// doi.org/10.1083/jcb.201412111 30. Cox JV, Kansal R, Whitt MA (2016) Rab43 regulates the sorting of a subset of membrane protein cargo through the medial Golgi. Mol Biol Cell 27(11):1834–1844. https://doi. org/10.1091/mbc.E15-03-0123 31. Li C, Wei Z, Fan Y, Huang W, Su Y, Li H, Dong Z, Fukuda M, Khater M, Wu G (2017) The GTPase Rab43 controls the anterograde ER-Golgi trafficking and sorting of GPCRs. Cell Rep 21(4):1089–1101. https://doi.org/ 10.1016/j.celrep.2017.10.011 32. Das S, Hehnly H, Doxsey S (2014) A new role for Rab GTPases during early mitotic stages. Small GTPases 5:e29565. https://doi.org/10. 4161/sgtp.29565 33. Ortiz D, Medkova M, Walch-Solimena C, Novick P (2002) Ypt32 recruits the Sec4p guanine nucleotide exchange factor, Sec2p, to secretory vesicles; evidence for a Rab cascade in yeast. J Cell Biol 157(6):1005–1015. https://doi.org/10.1083/jcb.200201003

Chapter 10 Determination of the Rab27–Effector Binding Affinity Using a High-Throughput FRET-Based Assay Raghdan Z. Al-Saad, Ian Kerr, and Alistair N. Hume Abstract Thus far, two Rab27 isoforms (Rab27a and Rab27b) have been identified that interact with their eleven downstream effectors proteins, preferentially in their GTP-bound state. In recent years, a number of studies has suggested roles for Rab27–effector protein interactions in the development of cancer cell invasion and metastasis, and immune and inflammatory responses. Here we develop an in vitro fluorescence resonance energy transfer (FRET)-based protein–protein interaction assay to report Rab27 protein interactions with their effectors. We particularly focus on determining the interaction of mouse (m) Synaptotagmin-like protein (Slp)1 and mSlp2 effector proteins with human (h)Rab27. Green fluorescent protein (GFP)-Nterminus Rab27 binding domains (m-Slp1 and m-Slp2) recombinant proteins were used as donor fluorophores, whereas mCherry-hRab27a/b recombinant proteins were used as acceptor fluorophores. The conditions of this assay were validated and optimized, and the specificity of the assay was confirmed. Accordingly, this assay can be used to assess and identify key determinants and/or candidate inhibitors of Rab27–effector interactions. Key words FRET, Protein–protein interaction, Binding affinity, Rab27, Slp1, Slp2

1

Introduction Two Rab27 isoforms (Rab27a and Rab27b) have been identified, and share similar but not identical functions [1, 2]. They exert their specific functions, especially the regulation of the exocytosis of various intracellular secretory granules and organelles by interacting with their downstream effector proteins, preferentially in their GTP-bound state [2–6]. Rab27 proteins are widely distributed among metazoans, but no Rab27 proteins have been identified yet in yeasts and plants [7]. It has been reported that that most of the Rab27a/b interacting residues with their effectors are conserved between them [8], suggesting that tissue expression of these isoforms plays an important role in determining their functional specificity.

Guangpu Li and Nava Segev (eds.), Rab GTPases: Methods and Protocols, Methods in Molecular Biology, vol. 2293, https://doi.org/10.1007/978-1-0716-1346-7_10, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

143

144

Raghdan Z. Al-Saad et al.

Rab27 proteins have been implicated in cancer cell invasion and proliferation, for instance it has been found that overexpression of Rab27b in human MCF-7 breast cancer cells resulted in increasing invasive tumor growth and proliferation, and promoting HSP90α secretion [9]. In addition, shRNA inhibition of RAB27A/B significantly reduced exosome secretion in MDA-MB-231 breast cancer cells [10]. Intriguingly, Rab27 has also been reported to be involved in the regulation of Golgi-dependent trafficking of E-cadherin, thus promoting tumor invasiveness in breast cancer cells [11]. Notably, the degree of Rab27b expression is significantly correlated with tumor size in patients with gastrointestinal tumor, and can be used as a prognostic marker for this type of cancer [12]. Thus, Rab27a/b interactions with their downstream effector proteins plays a considerable role in cancer growth, progression, invasion, and metastasis, and by blocking these interactions, the subsequent signaling pathways promoting cancer cell proliferation, invasion, and metastasis might be inhibited. To date, there are eleven distinct Rab27 effector proteins in human and mouse [2, 13]. The Slp family [14] represents one of the most important classes among Rab27 effector proteins. Thus far, five distinct Slp proteins, Slp1, Slp2-a, Slp3-a, Slp4-a/b, and Slp5, have been identified in mammals [15–17]. Notably, Slp family members interact with Rab27 through two conserved, N-terminal α-helical Rab27 binding domains, termed Slp homology domain (SHD) 1 and 2 [15, 16, 18]. There is a continuous necessity to develop and design in vitro assays to determine the Rab27–effector interactions; hence, these assays can be used in the future for identifying the key determinants of Rab27–effector interactions and testing the effects of the candidate inhibitors of these interactions. In one study, a time-resolved FRET–based assay was used to identify Rab27–effector interaction inhibitors [19]. Furthermore, coimmunoprecipitation and simple GST-pull down assays were used in the past to determine Rab27– effector interactions [20]. However, these techniques require highly specific antibodies which are not always available. Also, these assays involve performing multiple experimental steps, such as sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) and western blot analysis of protein complexes, causing some loss of the bound proteins during performing these experimental steps. Accordingly, these techniques cannot provide accurate quantitative measures for protein–protein interactions. In this chapter we describe an in vitro FRET-based protein– protein interaction assay (Fig. 1) used as a readout for Rab27 proteins interactions (both quantitatively and qualitatively) with their effectors; mSlp1 and mSlp2 [21]. This high-throughput assay provides a feasible, consistent, efficient, faster, and sensitive measure for Rab27–effector interactions, thereby testing large number of samples with fewer experimental steps at a time.

Determination of the Rab27–Effector Binding Affinity Using a High. . .

145

Fig. 1 Determination of Rab27–effector interaction using a FRET-based protein–protein interaction assay. FRET occurs between GFP (light green) as a donor fluorophore fused to effector protein (orange) and mCherry (purple) as an acceptor fluorophore fused to Rab27 (light blue) after binding of Rab27 to its effector protein. As the binding components come close to each other and the distance between them is less than 10 nm, excitation of the donor fluorophore (GFP) at 470–490 nm emits light at 562.5–577.5 nm, leading to excitation of the acceptor fluorophore (mCherry) and emission of light occurs at 600–610 nm. (Reproduced from Al-Saad et al. [21])

Furthermore, the results can be reproduced quantitatively by determining the effective concentration 50 (EC50) or the inhibitory concentration 50 (IC50) values of these interactions with less time and effort. We particularly focus on determining the interaction of mSlp1 and mSlp2 with Rab27; because Slp2 and Rab27a interface of interaction has previously been identified [22], and both Slp1 and Slp2 belong to the same family and structurally related [15]. To this end, GFP-mSlp1 and GFP-mSlp2 (SHD1/2 N-terminus Rab27 binding domains) recombinant proteins were used as donor fluorophores, whereas mCherry-Rab27a/b recombinant proteins were used as acceptor fluorophores. Here, we describe the plasmids used to construct proteins used in this assay. In addition, the optimized conditions for protein production and purification are described in details. The conditions of this assay were validated and optimized, and the specificity of the assay was confirmed. We used this approach to determine Rab27–mSlp1/mSlp2 interactions by measuring the EC50 values of these interactions (Fig. 2). These experiments demonstrated that mSlp2 has higher binding affinity to Rab27 than that of mSlp1; evidenced by EC50 differences. Moreover, the IC50 values of different typical competitive inhibitors were determined using this assay [21]. Accordingly, this high-throughput assay can be used to assess and identify key determinants and/or candidate inhibitors of Rab27–effector interactions by quantitatively determining the EC50 or the IC50 values.

146

Raghdan Z. Al-Saad et al.

Fig. 2 mSlp1 and mSlp2 binding affinity to hRab27b using a FRET-based Assay. The binding affinity of GFP-mSlp1, GFP-mSlp2, and GFP (0.01, 0.03, 0.1, 0.3, 1.0, and 1.5 μM) to 0.15 μM mCherry-hRab27b was determined; EC50 values: GFP-mSlp1 ¼ 0.33 μM, GFP-mSlp2 ¼ 0.15 μM, and GFP ¼ 2.09 μM. In addition, the binding affinity of GFP-mSlp1 and GFP-mSlp2 (0.01, 0.03, 0.1, 0.3, 1.0, and 1.5 μM) to 0.15 μM mCherry was determined; EC50 values: GFP-mSlp1 ¼ 2.47 μM and GFP-mSlp2 ¼ 67.66 μM. These data represent mean  SEM of three independent experiments performed in quadruplicate. (Reproduced from Al-Saad et al. [21])

2

Materials Use Milli-Q water to prepare all solutions used in this assay experiments.

2.1

PCR

1. 200 μl PCR tube. 2. Milli-Q water. 3. Pfu DNA polymerase enzyme. 4. Pfu DNA polymerase reaction buffer. 5. dNTPs mix. 6. Forward primer. 7. Reverse primer. 8. cDNA template.

2.2 Bacterial Expression Plasmids

1. pETDuet-1-mCherry-hRab27a-(1-221) vector to express 6
Histidine-mCherry-hRab27a-(1-221) recombinant protein. 2. pETDuet-1-mCherry-hRab27b-(218) vector to express 6
Histidine-mCherry-hRab27b-(1-218) recombinant protein. 3. pETDuet-1-mCherry to express 6
Histidine-mCherry recombinant protein. 4. pETDuet-1-GFP-mSlp1-(1-116) vector to express 6
Histidine-GFP-mSlp1-(1-116) recombinant protein.

Determination of the Rab27–Effector Binding Affinity Using a High. . .

147

5. pETDuet-1-GFP-mSlp2-(3-80) vector to express 6
Histidine-GFP-mSlp1-(3-80) recombinant protein. 6. pETDuet-1-GFP vector to express 6
Histidine-GFP recombinant protein. 7. pET-14b-rat (r) Rab27a-(1-221) [23], pET-15b-hRab27b(1-218) [24], and pET-14b-hRab5a-(1-216) [25, 26] vectors to express 6
Histidine-rRab27a, 6
Histidine-hRab27b, and 6
Histidine-hRab5 recombinant proteins. 2.3 Preparation of Polyhistidine-Tagged Recombinant Proteins

Transform Rosetta E. coli competent cells with protein expression plasmids for protein expression and purification. 1. Lysogeny broth (LB) medium: Mix 10 g Bacto tryptone, 5 g yeast extract, 10 g sodium chloride, and dissolve in a final volume of 1 l with distilled water, autoclave, and store at room temperature. 2. Prepare LB agar plates using 1.5% w/v agar in LB medium, then autoclave the whole mixture, cool to approximately 50  C, and store at 4  C. 3. Ampicillin (1000
) 100 mg/ml in water, and chloramphenicol (1000
) 35 mg/ml in 100% ethanol; store at 20  C. 4. 0.5 M isopropyl beta-D-thiogalactopyranoside (IPTG) in water; store at 20  C. 5. Phosphate-buffered saline (PBS). 6. Lysis buffer: 50 mM Tris–HCl pH 7.5, 150 mM sodium chloride, 5 mM magnesium chloride, 1 mM β-mercaptoethanol (BME) (see Note 1), one protease inhibitor cocktail tablet/10 ml (see Note 2). 7. Dialysis buffer: 50 mM Tris–HCl pH 7.5, 500 mM sodium chloride, 5 mM magnesium chloride, 1 mM BME. 8. Chelating Sepharose fast flow. 9. 250 mM nickel sulfate in water. 10. Acetate buffer pH 4: mix 41 ml of 0.1 M acetic acid with 9 ml of 0.1 M sodium acetate in a final volume of 100 ml with distilled water at pH 4. 11. Imidazole (20, 50, 100, 200, and 250 mM) in dialysis buffer at pH 8 (see Note 3). 12. Coomassie protein assay reagent. 13. 12–14 kDa molecular weight cutoff Visking dialysis tubing. 14. Guanosine diphosphate (GDP).

2.4 Preparation of 10% (v/v) SDS-PAGE and Protein Staining

1. 10 ml Separating gel: 4.8 ml ddH2O, 2.5 ml 40% acrylamide, 2.5 ml 1.5 M Tris–HCl pH 8.8, 100 μl 10% ammonium persulfate (APS) (freshly prepared at the time of use), 100 μl 10% (w/v) SDS, 4 μl N,N,N,N0 -tetramethylethylenediamine (TEMED).

148

Raghdan Z. Al-Saad et al.

2. 5 ml Stacking gel: 3.65 ml ddH2O, 625 μl 40% acrylamide, 625 μl 1 M Tris–HCl pH 6.8, 50 μl 10% APS, 50 μl 10% SDS, 5 μl TEMED. 3. Running buffer: 25 mM Tris–HCl, 192 mM glycine, 0.1% (w/v) SDS. 4. Loading buffer (5
): 0.3 M Tris–HCl pH 6.8, 10% (w/v) SDS, 40% (v/v) glycerol, 0.02% (w/v) bromophenol blue, 10% (v/v) BME. 5. BLUeye prestained protein ladder. 6. Instant blue protein stain. 2.5 Reagents Used for Western Blot Analysis

1. Polyvinylidene difluoride (PVDF) membrane (0.45 μm). 2. 100% methanol. 3. Transfer buffer: 25 mM Tris–HCl, 192 mM glycine, 20% methanol. 4. Blocking buffer: 1
PBS, 0.1% Tween 20, 5% skimmed milk. 5. Washing buffer: 1
PBS, 0.1% Tween 20. 6. Primary and secondary antibodies listed in Table 1.

2.6 FRET-Based Assay Materials

1. 96-well microplate; clear, flat bottom. 2. Dilution buffer (5
): 250 mM Tris–HCl pH 7.5, 750 mM sodium chloride, 5 mM dithiothreitol (DTT), 5% bovine serum albumin (BSA) (see Note 4). 3. 30 mM Guanosine triphosphate (GTP). 4. Recombinant proteins: 6
Histidine-mCherry-Rab27a, 6
Histidine-mCherry-Rab27b, 6
Histidine-mCherry, 6
Histidine-GFP-mSlp1-(1-116), 6
Histidine-GFP-mSlp2-(3-80), 6
Histidine-GFP, 6
Histidine rRab27a, 6
Histidine hRab27b, 6
Histidine hRab5.

3 3.1

Methods PCR Reaction

Design the PCR primers according to the specifications of the cDNA of interest to be used for PCR amplification. Use Pfu DNA Polymerase in the PCR and site-directed mutagenesis reaction mixtures (see Note 5). Make a standard PCR reaction mixture in the following order using a 200 μl PCR tube: 31 μl Milli-Q water, 5 μl 10x Pfu DNA polymerase reaction buffer, 4 μl dNTPs mix (2.5 mM each), 4 μl forward primer (10 μM), 4 μl reverse primer (10 μM), 1 μl (50 ng/μl) cDNA template, 1 μl (2 units) Pfu DNA polymerase enzyme (see Note 6). Sensoquest thermocycler is used for all the simple PCR and site-directed mutagenesis reactions.

Determination of the Rab27–Effector Binding Affinity Using a High. . .

149

Table 1 List of primary and secondary antibodies

3.2 Expression and Purification of Polyhistidine-Tagged Recombinant Proteins

Primary/Secondary Antibody

Source

Dilution

Goat anti-mCherry

Sicgen

1:1000

Mouse anti-poly-histidine

Sigma-Aldrich

1:1000

Goat anti-GFP

Sicgen

1:1000

Donkey anti-Goat IR800

Licor

1:30,000

Donkey anti-Mouse IR680

Licor

1:10,000

1. Transform protein expression plasmid into Rosetta E. coli competent cells for plating onto LB-Agar plates (100 μg/ml ampicillin and 35 μg/ml chloramphenicol). 2. Pick single colonies from agar plate and inoculate into 5–10 ml LB medium containing the appropriate antibiotic concentration. Then incubate bacterial cell cultures at 37  C with continuous shaking (175–200 rpm) for 16–18 h (to ensure sufficient bacterial growth). 3. Subsequently, grow the 5–10 ml bacterial medium using a 125 ml LB medium containing the appropriate antibiotic concentration (in a 500 ml autoclaved conical flask) at 37  C with continuous shaking (175–200 rpm) for 16–18 h. 4. Then inoculate a 4 l LB medium containing the appropriate antibiotic concentration with 100 ml of bacterial culture using four autoclaved conical flasks (25 ml/l). 5. Bacterial growth is performed under the specified conditions until reaching an optical density600 (OD600) value of 0.4–0.6 at 600 nm (see Note 7). 6. At this point, induce protein expression with 0.5 mM IPTG at 37  C (see Note 8) with continuous shaking at 175 rpm for 2–3 h (Fig. 3). 7. Subsequently, harvest bacterial cells by centrifugation at 5000 rpm for 20 min at 4  C. 8. Resuspend the cell pellets in ice-cold 1
PBS (20 ml/pellet  1 g), harvest by centrifugation at 5000 rpm for 10 min at 4  C, and store at 80  C (in a 50 ml falcon tube) to be used for subsequent protein purification. 9. Resuspend the induced cell pellets in ice-cold lysis buffer: 20 ml/pellet  1 g. 10. Lyse the cell lysates mechanically at 35 kilo-pound-force per square inch (kpsi) using a high pressure cell disruptor (see Note 9), and centrifuge at 100,000
g for 1 h at 4  C using a 10 ml centrifuge tubes (see Note 10).

150

Raghdan Z. Al-Saad et al.

Fig. 3 Small scale induction of the 6
Histidine-GFP-mSlp1-(1–116) recombinant protein production. Rosetta E. coli competent cells were transformed with the pETDuet-1-GFP-mSlp1-(1-116) vector and small scale protein production was induced with different IPTG concentrations (0.0, 0.5, 2.0, and 5.0 mM) for 3 and 20 h at 37  C and 20  C, respectively. Bacterial cultures were pelleted and the cell lysate extracts were then analyzed using instant blue stained 10% SDS-PAGE gel. Abundant protein bands (the arrow indicated bands) were produced at the expected molecular weight (43.97 kDa) for the 6
Histidine-GFP-mSlp1-(1-116) recombinant protein in the IPTG induced bacterial cultures using all the tested IPTG concentrations and conditions

11. Adjust the supernatant to 500 mM sodium chloride and purify using the immobilized metal affinity chromatography (IMAC) system as described below. 12. Prepare nickel Sepharose beads as follows: pour a 10 ml chelating Sepharose fast flow into a sterile 50 ml Falcon tube, centrifuge at 2000 rpm for 3 min, resuspend in 25–50 ml distilled water, centrifuge at 2000 rpm for 3 min, resuspend in 5–10 ml of 250 mM nickel sulfate and incubate for 1 h at room temperature. Subsequently, centrifuge the nickel-Sepharose beads mixture at 2000 rpm for 3 min, resuspend in 25–50 ml distilled water, centrifuge at 2000 rpm for 3 min, resuspend in 25–50 ml acetate buffer pH 4 and centrifuge at 2000 rpm for 3 min. Finally, wash the Nickel-Sepharose beads mixture

Determination of the Rab27–Effector Binding Affinity Using a High. . .

151

several times (2–3 times) by resuspending in 25–50 ml dialysis buffer and centrifuging at 2000 rpm for 3 min. 13. Mix the supernatant with a thoroughly washed nickel sepharose beads (using a 50 ml Falcon tube) in dialysis buffer and incubate with rotation at 4  C for 2–16 h using a rotating wheel (see Note 11). 14. Centrifuge the supernatant-nickel Sepharose beads mixture at 2000 rpm for 3 min at 4  C, and wash with dialysis buffer; repeat at least three times (see Note 12). 15. Resuspend the supernatant-nickel Sepharose beads mixture in a sufficient volume of dialysis buffer, pour into a Poly-Prep chromatography column. Then wash the column several times with dialysis buffer; collect the flow-through, and keep to be analyzed later. 16. Subsequently, use increasing concentrations of imidazole (20, 50, 100, 200, and 250 mM) in dialysis buffer at pH 8 to displace protein from binding to nickel beads; it is recommended to discard the flow-through using 20 mM imidazole (see Note 13). 17. Collect the eluates and test the presence of proteins by adding 5 μl of eluate/60 μl of Coomassie protein assay reagent using a 96-well plate (blue color is considered as an indicator for the presence of the proteins). 18. Dialyze the successful protein eluates using 12–14 kDa molecular weight cutoff Visking dialysis tubing in a 2 l dialysis buffer at 4  C with continuous stirring for 16–18 h. “Note that” to purify Rab proteins, a 0.21 g GDP is added to the dialysis buffer (see Note 14). 19. Perform a further dialysis step using a new 2 l dialysis buffer for 4 h under the same conditions. 20. Collect the purified protein from the dialysis tube, quantify as described in Subheading 3.6. In addition, analyze the protein as described in Subheadings 3.3–3.5. 21. Finally, aliquot the protein, and store at 80  C (see Note 15). 3.3 SDS-PAGE and Protein Staining

1. Cast the gels using the Mini-PROTEAN Tetra Cell system (1.5 mm spacer plates are used), and place in the MiniPROTEAN Tetra Cell tank using SDS-PAGE running buffer. 2. Prepare protein samples by mixing with protein loading buffer (see Note 16), then boil at 100  C for 5–10 min; remix and centrifuge for 1 min at 10,000
g. 3. Load protein samples into 10% (v/v) SDS-PAGE gel and electrophorese at 40 mA per gel until complete separation of the molecular weight standards (the lowest band in the marker reached the bottom edge of the gel) (see Note 17).

152

Raghdan Z. Al-Saad et al.

Fig. 4 Production and purification profile of the 6
Histidine-GFP protein. Rosetta E. coli competent cells were transformed with the pETDuet-1-GFP vector. Protein production was induced with 0.5 mM IPTG for 3 hours at 37  C. Protein production and purification steps were analyzed using an instant blue stained 10% SDS-PAGE gel: M molecular weight standards, PP purified protein, U, I uninduced and induced E. coli cell extracts, BC cell lysates before centrifugation, AC supernatant after centrifugation, FT1, 2, 3; first, second, and third flowthrough from nickel column after several washes with the dialysis buffer. An abundant protein band (the arrow indicated band) was detected at the predicted molecular weight for the 6
Histidine-GFP protein (30.034 kDa)

4. Use a 5 μl of BLUeye Prestained Protein Ladder as a molecular weight standard, and run alongside protein samples. 5. This is followed by either transferring into PVDF membrane for western blot analysis (as described in Subheading 3.4) or staining as described below. 6. The staining involves washing the gel gently with water, then incubation using Instant Blue Protein Stain at room temperature by placing the gel in a tray with continuous agitation for 1–2 h, this is followed by incubation in water for 2–16 h, then washing 2–3
with water to be visualized later as described in Subheading 3.5 (Figs. 4 and 5). 3.4 Western Blot Analysis

1. To transfer medium- to large- molecular weight proteins (greater than 20 kDa), use 0.45 μm PVDF transfer membrane. 2. Presoak the PVDF membrane in 100% methanol for 15–30 s, then incubate in transfer buffer for 2–5 min at room temperature. 3. Place the gel in the transfer sandwich using the following order: two pieces of 7
9 cm 3 mm filter paper, PVDF transfer

Determination of the Rab27–Effector Binding Affinity Using a High. . .

153

Fig. 5 Production and purification profile of the 6
Histidine-rRab27a-(1-221) recombinant protein. Rosetta E. coli competent cells were transformed with the pET-14b-rRab27a-(1-221) vector and protein production was induced using 0.5 mM IPTG for 3 h at 37  C. Protein production and purification steps were analyzed using an instant blue stained 10% SDS-PAGE gel: M molecular weight standards, PP purified protein, U, I uninduced and induced E. coli cell extracts, BC cell lysates before centrifugation, AC supernatant after centrifugation, FT1, 2, 3; first, second, and third flow-through from nickel column after several washes with the dialysis buffer. An abundant protein band (the arrow indicated band) was detected at the predicted molecular weight for the 6
Histidine-rRab27a (1-221) recombinant protein (28.85 kDa)

membrane, the gel, and two pieces of filter paper; immerse in the transfer buffer (see Note 18). 4. Place the transfer sandwich in the Geneflow cassette (Geneflow wet transfer system). 5. Place the cassette in a tank filled with ice-cold transfer buffer. The PVDF membrane is faced to the cathode and transferred at 4  C using either 150 V for 3 h, or 30 V for 18 h (see Note 19). 6. After transfer completion, block the membrane with 1
blocking buffer for 1 h at room temperature to block the nonspecific binding to the primary antibody. 7. Incubate with primary antibody using 1
washing buffer for 16 h at 4  C. 8. Wash the membrane 3
with 1
washing buffer (to remove unbound primary antibody) as follows: place the membrane in a clean tray filled with 1
washing buffer and agitate for 10 min, and rinse; repeat the process three times. 9. Subsequently, incubate the membrane with the appropriate secondary antibody in 1
washing buffer for 1 h at room temperature.

154

Raghdan Z. Al-Saad et al.

Fig. 6 Western blot analysis of different 6
Histidine-mCherry-hRab27 recombinant proteins. The 6
Histidine-mCherry-hRab27b- [(1-218), (1-218; T23N), (1-218; Q78L)] and 6
Histidine-mCherry-hRab27a(1-221) recombinant proteins were loaded into 10% SDS-PAGE gel, transferred into PVDF membrane (0.45 μm), and immunoblotted with anti-mCherry antibody. All the analyzed proteins expressed two bands (mCherry fused proteins). However, abundant protein bands (the arrow indicated bands) were detected at the predicted molecular weights for the transferred proteins (55.3 kDa) (M molecular weight standards)

10. Repeat the washing steps for the primary antibody (to remove unbound secondary antibody) except of using 5 min instead (Figs. 6, 7, 8, and 9). 3.5

Imaging

3.6 Determination of Protein Concentrations

Use the LI-COR Odyssey scanner (LI-COR Biosciences) to visualize SDS-PAGE gels and PVDF membranes. Place the PVDF membrane or gels facing the glass scanning area of the instrument (see Note 20). Image Studio Ver 3.1 software is used to acquire images (see Note 21). Protein concentrations are measured using the ThermoScientific NanoDrop 2000 spectrophotometer. Briefly, clean the upper and lower optical pedestal surfaces using 2 μl HPLC water and wipe using dry lab wipes. Dispense a 2 μl dialysis buffer into the lower

Determination of the Rab27–Effector Binding Affinity Using a High. . .

155

Fig. 7 Western blot analysis profile of different 6
Histidine-Rab recombinant proteins. 6
Histidine-hRab5 (27.20 kDa), 6
Histidine-hRab27b (28.38 kDa), 6
Histidine-rRab27a (28.85 kDa), 6
Histidine-mCherry (30.86 kDa), 6
Histidine-mCherry-hRab27b (55.3 kDa), 6
Histidine-mCherry-hRab27b-(T23N) (55.3 kDa) and 6
Histidine-mCherry-hRab27a (55.3 kDa) recombinant proteins were loaded into 10% SDS-PAGE gel, transferred into PVDF membrane (0.45 μm) and immunoblotted with monoclonal anti-polyhistidine antibody. Abundant protein bands (the arrow indicated bands) were detected at the predicted molecular weights for the transferred proteins (M molecular weight standards)

optical pedestal surface which is considered as a blank, wipe the pedestal surfaces and dry again. Then, dispense a 2 μl protein sample into the lower optical pedestal surface to be measured. The absorbance measurements for the purified proteins are performed at 280 nm using the molecular weight and extinction coefficient of the quantified proteins which are measured using the ExPASy online tool for protein molecular weight determination (http://web.expasy.org/protparam/). Subsequently, measure the concentration of the purified protein by quantifying the band of interest from SDS-PAGE gel using ImageJ software. This is performed by measuring the intensity of the whole well, the background and the band of interest; then the percentage of the band of interest from the total signal of the well is calculated accordingly. Finlay, the concentration of the purified protein is calculated by multiplying the percentage of the band of interest by the already measured protein concentration using the NanoDrop 2000 spectrophotometer.

Fig. 8 Western blot analysis of the 6
Histidine-GFP-mSlp1-(1-116) recombinant protein. 6
Histidine-GFPmSlp1-(1-116) recombinant protein (different protein batches) and 6
Histidine-GFP protein were loaded into 10% SDS-PAGE gel, transferred into PVDF membrane (0.45 μm), and immunoblotted with anti-GFP antibody. Abundant protein bands (the arrow indicated bands) were detected at the predicted molecular weights for the 6
Histidine-GFP-mSlp1-(1-116) (43.97 kDa) and 6
Histidine-GFP (30.03 kDa) proteins (M molecular weight standards)

Fig. 9 Western blot analysis of the 6
Histidine-GFP-mSlp2-(3-80) recombinant protein. 6
Histidine-GFPmSlp2-(3-80) recombinant protein (different protein batches) and 6
Histidine-GFP protein were loaded into 10% SDS-PAGE gel, transferred into PVDF membrane (0.45 μm) and immunoblotted with anti-GFP antibody. The upper and lower abundant protein bands (the arrow indicated) represent 6
Histidine-GFP-mSlp2-(3-80) (41.33 kDa) and 6
Histidine-GFP (30.03 kDa) proteins, respectively

Determination of the Rab27–Effector Binding Affinity Using a High. . .

3.7 FRET-Based Protein–Protein Interaction Assay Experiments

157

A FRET-based in vitro protein–protein interaction assay is used to determine the binding affinity of different Rab27–effector proteins (mSlp1 and mSlp2) to hRab27a/b, therefore it can be used to test and determine the inhibitory effects of the candidate inhibitors of these interactions in the future. Furthermore, this assay can be exploited in determining the key determinants of Rab27–effector interactions. GFP-mSlp1-(1-116) and GFP-mSlp2-(3-80) recombinant proteins are used as donor fluorophores, whereas mCherryhRab27a/b recombinant proteins are used as acceptor fluorophores. The assay reactions are performed as follows; in quadruplicates for 3 independent experiments using a 96-well microplate (see Note 22). 1. Incubate the main reaction mixture: the donor (using a constant concentration of either 6
Histidine-mCherry-Rab27a or 6
Histidine-mCherry-Rab27b) and the acceptor fluorophores (using six different concentrations of either 6
Histidine-GFP-mSlp1 or 6
Histidine-GFP-mSlp2), 3 mM GTP, and 5
dilution buffer (diluted to 1
) in a total reaction volume of 100 μl at room temperature for 2 h using a 96-well microplate. 2. Set up another set of reactions containing the donor fluorophore (for each specific concentration) on the same way with GTP/buffer and incubate using the same conditions. 3. Set up another set of reactions containing the acceptor fluorophore on the same way with GTP/buffer and incubate using the same conditions. 4. Set up another set of reactions containing GTP/buffer (without using any fluorophore) on the same way and incubate using the same conditions. This is performed to quench the effect of GTP and BSA fluorescence on the FRET signals. Therefore, the fluorescence of these reactions is subtracted from the fluorescence of each well of the 96-microplate, that is, the fluorescence of the whole 96-well microplate is normalized against the fluorescence of BSA and GTP. 5. The fluorescence of the wells of the 96-well microplate is then measured using the following settings: 40 flashes per well and the gain is set to 40%, samples are excited at 470–490 nm (excitation wave length of the donor fluorophore; GFP) and the emission of light is measured at 600–610 nm (the emission wave length of the acceptor fluorophore; mCherry). “Note that” the dimensions of the 96-microplate should be requested from the supplier and customized accordingly using the attached software of the microplate reader. The control software is used to interface with the CLARIOstar (BMG

158

Raghdan Z. Al-Saad et al.

Labtech) microplate reader and the MARS Data Analysis Software is used to acquire the data. By subtracting the average of the fluorescence of the individual components of the mixture (GFP and mCherry recombinant proteins) from the fluorescence of the main reaction mixture, the corrected fluorescence is then measured. Here the corrected fluorescence is considered as an indirect readout of the net FRET; for further details, see the following equation: Corrected fluorescence ¼ ½fluorescence of mCherry  hRab27a=b, and GFP  effector mixture ½ðfluorescence of mCherry  hRab27a=bÞ þ ðfluorescence of GFP  effectorÞ

GFP and mCherry recombinant proteins are used as negative controls for these reactions. Accordingly, the EC50 values of GFP-mSlp1-(1-116) and GFP-mSlp2-(3-80) for binding mCherry-hRab27a/b are determined. The significance of determining the EC50 of the binding between Rab27a/b and effector proteins is that these EC50 values can be used to saturate the binding with mCherryhRab27a/b in the competition-binding experiments (by using double the EC50 concentrations and constant concentrations of mCherry-hRab27a/b). Unlabeled rRab27a and hRab27b are used as positive controls (competitive inhibitors) and hRab5 is used as a negative control to disrupt the binding between mCherry-hRab27a/b and either GFP-mSlp1 or GFP-mSlp2, that is, fixed concentrations of both the donor and acceptor fluorophores are used in these competition experiments. Accordingly, the IC50 values of the candidate inhibitors can be determined and compared with that of the positive controls. This allows for identification and testing of large number of candidate inhibitors of Rab27–effector interactions.

4

Notes 1. Tris–HCl is added to regulate the acidity and keep the buffer in the 7.5–9.0 pH range, sodium chloride provides the required ionic strength, BME is working as a reducing agent by breaking disulfide bonds, and magnesium chloride is added to maintain protein stabilization. 2. Protease inhibitor cocktail tablet is better to be added at time of preparation as most of the protease inhibitors are active for 1–3 h after addition to the buffer. Also, most of the protease inhibitors are active in lysis buffers at pH 6.5–8.0. 3. Imidazole is prepared in dialysis buffer at pH 8 to maintain protein stability.

Determination of the Rab27–Effector Binding Affinity Using a High. . .

159

4. In order to block the effect of polycarbonate of the 96-well microplate on the fluorescence of the fluorescent proteins, BSA is added to the dilution buffer. 5. Using of Pfu DNA Polymerase ensures high fidelity and accurate PCR amplification. 6. To ensure homogenous mixing, the PCR mixture can be gently pipetted and centrifuged at 2000 rpm for 1 min. 7. 1–2 h are normally enough to reach sufficient bacterial growth (depending on the rate of bacterial growth and concentration). However, it is better to check bacterial concentration every 15–20 min. 8. To optimize the conditions of protein expression in E. coli, a small scale protein production was performed with different IPTG concentrations (0.5, 2.0, and 5.0 mM) using different conditions: induction for 3 and 20 h at 37  C and 20  C, respectively. Analysis of lysates from the uninduced and induced bacterial cell cultures using 10% SDS-PAGE instant blue staining demonstrated that abundant protein bands were produced at the expected molecular weight in the IPTG induced bacterial cultures using all the tested IPTG concentrations and conditions, whereas this band was absent from the uninduced bacterial cell lysates. This indicates that induction of protein production using 0.5 mM IPTG for 3 h at 37  C is successful and sufficient to produce abundant amount of protein. Accordingly, induction of protein production is performed using 0.5 mM IPTG for 3 h at 37  C in this assay experiments. Therefore, we recommend performing small scale protein induction to optimize protein production conditions and to overcome problems of protein expression and purification. 9. Avoid foam formation (as this indicates protein denaturation with the consequent loss of its biological activity) as much as possible by gentle pipetting cell lysates and use sufficient amounts of ice-cold lysis buffer to hydrate the cell disruptor and to maintain protein’s biological activity. In addition, wash the cell disruptor thoroughly with water (3
) first and then with lysis buffer (3
) before use to avoid protein contamination with previous protein samples. 10. It is crucial to maintain the balance of the ultracentrifuge by weighing the 10 ml centrifuge tubes carefully and adjust the weight accordingly. 11. The principle of the purification process is based on the affinity interaction between Ni2+ and the 6
histidine residues in the 6
histidine-tagged proteins (by binding of the electron donor groups of the imidazole ring of histidine to Nickel) [27].

160

Raghdan Z. Al-Saad et al.

12. To discard the nonspecifically bound proteins to the Nickle Sepharose beads. 13. This might be helpful in removing low affinity bound proteins. 14. This is important to keep Rab proteins in the GDP-bound inactive state and stabilize them as they possess intrinsic GTPase activity [28]. 15. Allow room in Eppendorf tubes for expansion during freezing. 16. To ensure homogenous mixing, multiple pipetting of the mixture is advised. 17. Running SDS-PAGE gels for longer periods is recommended for high molecular weight proteins, whereas for low molecular weight proteins it is better to examine the gel every 15 min to avoid loss of proteins. 18. Avoid air bubbles as much as possible by rolling and socking with transfer buffer. 19. The problem with high voltage and longer periods is the overtransfer of the transferred proteins, especially low molecular weight proteins. To overcome that, lower voltage and 0.2 μm PVDF membranes can be used. 20. To get clear images, air bubbles are avoided as much as possible by wetting the glass surface of the LI-COR Odyssey scanner with 1
PBS. 21. The following settings are applied to acquire images: resolution; 84 μm, quality; high, offset; 0.5 mm, intensity; 5. 22. Air bubbles might affect the fluorescence intensity and give false positive or negative results, this can be reduced by pipetting reaction mixtures gently.

Acknowledgments This work was supported by the Iraqi Ministry of Higher Education and Scientific Research/the Iraqi Cultural Attache´ in the UK funded PhD studentship. References 1. Izumi T (2007) Physiological roles of Rab27 effectors in regulated exocytosis. Endocr J 54:649–657 2. Fukuda M (2013) Rab27 effectors, pleiotropic regulators in secretory pathways. Traffic 14:949–963. https://doi.org/10.1111/tra. 12083 3. Itzen A, Goody RS (2008) Key determinants of Rab specificity. Structure 16:1437–1439. https://doi.org/10.1016/j.str.2008.09.002

4. Izumi T, Gomi H, Kasai K, Mizutani S, Torii S (2003) The roles of Rab27 and its effectors in the regulated secretory pathways. Cell Struct Funct 28:465–474 5. Stenmark H (2009) Rab GTPases as coordinators of vesicle traffic. Nat Rev Mol Cell Biol 10:513–525. https://doi.org/10.1038/ nrm2728 6. Yamaoka M, Ishizaki T, Kimura T (2015) GTP- and GDP-dependent Rab27a effectors

Determination of the Rab27–Effector Binding Affinity Using a High. . . in pancreatic beta-cells. Biol Pharm Bull 38:663–668. https://doi.org/10.1248/bpb. b14-00886 7. Diekmann Y, Seixas E, Gouw M, TavaresCadete F, Seabra MC, Pereira-Leal JB (2011) Thousands of Rab GTPases for the cell biologist. PLoS Comput Biol 7:e1002217. https:// doi.org/10.1371/journal.pcbi.1002217 8. Kukimoto-Niino M, Sakamoto A, Kanno E, Hanawa-Suetsugu K, Terada T, Shirouzu M, Fukuda M, Yokoyama S (2008) Structural basis for the exclusive specificity of Slac2-a/ melanophilin for the Rab27 GTPases. Structure 16:1478–1490. https://doi.org/10. 1016/j.str.2008.07.014 9. Hendrix A, Maynard D, Pauwels P, Braems G, Denys H, Van den Broecke R, Lambert J, Van Belle S, Cocquyt V, Gespach C, Bracke M, Seabra MC, Gahl WA, De Wever O, Westbroek W (2010) Effect of the secretory small GTPase Rab27B on breast cancer growth, invasion, and metastasis. J Natl Cancer Inst 102:866–880. https://doi.org/10.1093/ jnci/djq153 10. Zheng Y, Campbell EC, Lucocq J, Riches A, Powis SJ (2013) Monitoring the Rab27 associated exosome pathway using nanoparticle tracking analysis. Exp Cell Res 319:1706–1713. https://doi.org/10.1016/j. yexcr.2012.10.006 11. Kajiho H, Kajiho Y, Frittoli E, Confalonieri S, Bertalot G, Viale G, Di Fiore PP, Oldani A, Garre M, Beznoussenko GV, Palamidessi A, Vecchi M, Chavrier P, Perez F, Scita G (2016) RAB2A controls MT1-MMP endocytic and E-cadherin polarized Golgi trafficking to promote invasive breast cancer programs. EMBO Rep 17:1061–1080. https://doi.org/10. 15252/embr.201642032 12. Wang W, Ni Q, Wang H, Zhang S, Zhu H (2014) Prognostic value of Rab27b nuclear expression in gastrointestinal stromal tumors. Dis Markers 2014:942181. https://doi.org/ 10.1155/2014/942181 13. Fukuda M (2005) Versatile role of Rab27 in membrane trafficking: focus on the Rab27 effector families. J Biochem 137:9–16. https://doi.org/10.1093/jb/mvi002 14. Kuroda TS, Fukuda M, Ariga H, Mikoshiba K (2002) The Slp homology domain of synaptotagmin-like proteins 1-4 and Slac2 functions as a novel Rab27A binding domain. J Biol Chem 277:9212–9218. https://doi. org/10.1074/jbc.M112414200 15. Fukuda M, Mikoshiba K (2001) Synaptotagmin-like protein 1-3: a novel family of C-terminal-type tandem C2 proteins.

161

Biochem Biophys Res Commun 281:1226–1233. https://doi.org/10.1006/ bbrc.2001.4512 16. Fukuda M, Saegusa C, Mikoshiba K (2001) Novel splicing isoforms of synaptotagmin-like proteins 2 and 3: identification of the Slp homology domain. Biochem Biophys Res Commun 283:513–519. https://doi.org/10. 1006/bbrc.2001.4803 17. Kuroda TS, Fukuda M, Ariga H, Mikoshiba K (2002) Synaptotagmin-like protein 5: a novel Rab27A effector with C-terminal tandem C2 domains. Biochem Biophys Res Commun 293:899–906. https://doi.org/10.1016/ S0006-291X(02)00320-0 18. Fukuda M (2002) The C2A domain of synaptotagmin-like protein 3 (Slp3) is an atypical calcium-dependent phospholipid-binding machine: comparison with the C2A domain of synaptotagmin I. Biochem J 366:681–687. https://doi.org/10.1042/bj20020484 19. Johnson JL, Ramadass M, He J, Brown SJ, Zhang J, Abgaryan L, Biris N, Gavathiotis E, Rosen H, Catz SD (2016) Identification of Nexinhibs, small-molecule inhibitors of neutrophil exocytosis and inflammation. Druggability of the small GTPase Rab27a. J Biol Chem 291:25965–25982. https://doi.org/ 10.1074/jbc.M116.741884 20. Fukuda M (2006) Distinct Rab27A binding affinities of Slp2-a and Slac2-a/melanophilin: hierarchy of Rab27A effectors. Biochem Biophys Res Commun 343:666–674. https://doi. org/10.1016/j.bbrc.2006.03.001 21. Al-Saad RZ, Kerr I, Hume AN (2020) In vitro fluorescence resonance energy transfer-based assay used to determine the Rab27-effectorbinding affinity. Assay Drug Dev Technol 18:180–194. https://doi.org/10.1089/adt. 2019.960 22. Chavas LM, Ihara K, Kawasaki M, Torii S, Uejima T, Kato R, Izumi T, Wakatsuki S (2008) Elucidation of Rab27 recruitment by its effectors: structure of Rab27a bound to Exophilin4/Slp2-a. Structure 16:1468–1477. https://doi.org/10.1016/j.str.2008.07.015 23. Seabra MC, Ho YK, Anant JS (1995) Deficient geranylgeranylation of Ram/Rab27 in choroideremia. J Biol Chem 270:24420–24427 24. Chen D, Guo J, Miki T, Tachibana M, Gahl WA (1997) Molecular cloning and characterization of Rab27a and Rab27b, novel human rab proteins shared by melanocytes and platelets. Biochem Mol Med 60:27–37 25. Farnsworth CC, Seabra MC, Ericsson LH, Gelb MH, Glomset JA (1994) Rab geranylgeranyl transferase catalyzes the

162

Raghdan Z. Al-Saad et al.

geranylgeranylation of adjacent cysteines in the small GTPases Rab1A, Rab3A, and Rab5A. Proc Natl Acad Sci U S A 91:11963–11967 26. Strom M, Hume AN, Tarafder AK, Barkagianni E, Seabra MC (2002) A family of Rab27-binding proteins. Melanophilin links Rab27a and myosin Va function in melanosome transport. J Biol Chem 277:25423–25430. https://doi.org/10. 1074/jbc.M202574200

27. Bornhorst JA, Falke JJ (2000) Purification of proteins using polyhistidine affinity tags. Methods Enzymol 326:245–254 28. Rybin V, Ullrich O, Rubino M, Alexandrov K, Simon I, Seabra MC, Goody R, Zerial M (1996) GTPase activity of Rab5 acts as a timer for endocytic membrane fusion. Nature 383:266–269. https://doi.org/10.1038/ 383266a0

Chapter 11 Methods to Study the Unique SOCS Box Domain of the Rab40 Small GTPase Subfamily Emily D. Duncan, Ezra Lencer, Erik Linklater, and Rytis Prekeris Abstract Despite the critical role of Rab GTPases for intracellular transport, the vast majority of proteins within this family remain poorly characterized, including the Rab40 subfamily. Often recognized as atypical Rabs, the Rab40 family of proteins are unlike any other small GTPase because they contain a C-terminal suppressor of cytokine signaling (SOCS) box. It is well established that this SOCS domain in other proteins mediates an interaction with the scaffold protein Cullin5 in order to form a E3 ubiquitin ligase complex critical for protein ubiquitylation and turnover. Although the function of SOCS/Cullin5 complexes has been well defined in several of these other proteins, this is not yet the case for the Rab40 family of proteins. We have previously shown that the Rab40b family member plays an important role during three-dimensional (3D) breast cancer cell migration. To further this knowledge, we began to investigate the SOCS-dependent role of Rab40b during cell migration. Here, we describe an unbiased approach to identify potential Rab40b/Cullin5 substrates. We anticipate that this method will be useful for studying the function of other Rab40 family members as well as other SOCS box containing proteins. Key words Rab GTPase, Rab40b, Cullin5, SOCS box, Evolution, Ubiquitylation, Immunoprecipitation, Mass spectrometry, Proteomics

1

Introduction With close to 70 members, Rab GTPases constitute the largest family of small monomeric GTPases within the human genome [1]. These proteins are members of the Ras superfamily, and the origins of Rab GTPases is believed to be tightly associated with the evolution of the eukaryotic cell. Rab GTPases are found in all eukaryote lineages and emerge phylogenetically with other defining eukaryote cell features such as the actin and microtubule cytoskeleton, internal membranes, and a nucleus [2–4]. Within eukaryotes, the Rab protein family has expanded dramatically, and vertebrate genomes in particular exhibit some of the largest numbers of Rab paralog family members in comparison to all other taxa [2, 5]. Functionally, Rab proteins are master regulators of intracellular

Guangpu Li and Nava Segev (eds.), Rab GTPases: Methods and Protocols, Methods in Molecular Biology, vol. 2293, https://doi.org/10.1007/978-1-0716-1346-7_11, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

163

164

Emily D. Duncan et al.

membrane trafficking and act as molecular switches, cycling between a GTP-bound “active” state and a GDP-bound “inactive” state [6, 7]. In the active state, Rab proteins bind and recruit/ activate effector proteins to specific intracellular membranes. Together, Rabs and their respective effectors act in a cooperative manner to regulate all stages of membrane and protein traffic [8, 9]. Since their discovery in the 1980s, characterization of about half of known Rab GTPases has helped uncover the impressive complexity and diversity of these proteins [7, 10]. Despite ongoing research and the critical role of Rabs in eukaryotic cells, the vast majority of Rab GTPases remain incompletely understood, both in terms of function and regulation. Given the implication of Rabs in disease pathogenesis [11], it is critical to uncover the function of these small GTPases. The Rab40 family of small GTPases is a prime example of a largely uncharacterized Rab subfamily, with a unique domain architecture that suggests these proteins play functional roles unlike any other Rab. Here we discuss the known functions of the Rab40 family, with special focus on Rab40b, and outline methods for studying the unique Rab40 SOCS box. 1.1 Origins and Evolution of the Rab40 Subfamily

Rab40 paralogs have only been identified in the genomes of bilaterian metazoans (e.g., protostomes and deuterostomes), suggesting that the Rab40 gene family was present in the last bilaterian common ancestor. Prior studies further suggest that the Rab40 subfamily may have emerged as a duplication of Rab18 [5]. However, substantive sequence divergence differentiates Rab40 paralogs from all other Rab proteins [2, 5, 12, 13]. While most Rabs share only a conserved globular G-domain (housing the Switch I and Switch II regions), Rab40 GTPases have an extended C-terminal region that contains the conserved SOCS (suppressor of cytokine signaling) box (Fig. 1a) [2]. This additional domain suggests that Rab40 may be a unique Rab GTPase with novel function, however there is little known about the cellular role or regulation of Rab40 proteins. In addition to an extended C-terminal domain, Rab40 proteins also exhibit noncanonical amino acids at functionally critical sites in the domains responsible for GTPase activity and guanine nucleotide exchange factor (GEF) binding. For instance, most Rab GTPases exhibit a conserved Ser or Thr residue at a critical site in the GTPase domain upstream of Switch I (Fig. 1b) [14]. This site is crucial for GEF binding and is commonly mutagenized by researchers to lock Rabs in a GDP bound (dominant negative) state in order to study Rab function. Surprisingly, the Rab40 gene family has evolved novel amino acids at this conserved residue (Fig. 1b). Drosophila Rab40 exhibits a His at this site, in mosquito this same site is occupied by a Gln (not shown), while in humans the Rab40b and Rab40c paralogs have a Gly at this site (Fig. 1b). Even more remarkable is that primate Rab40a and human Rab40al paralogs

Identifying Rab40b/Cullin5 Substrates using a SOCS Box Mutant

165

Fig. 1 Evolution and structure of the Rab40 gene family. (a) Domain architecture of Rab40 compared to Rab11 shows extended C-terminal SOCS box domain. (b) Sequence alignment of Rab40 subfamily and a subset of well-studied Rabs highlighting GEF binding region (left) and Switch II region (right). Rab40 proteins exhibit a noncanonical Glycine (green) within the GEF binding motif (conserved Serine/Threonine in yellow) and maintain the conserved Glutamine critical for GTPase activity (yellow). (c) Maximum likelihood gene tree (PhyML) of Rab40 coding sequences shows duplications of Rab40 paralogs in vertebrate taxa. Note that Cyclostome Rab40 sequences form a clade with Gnathostome Rab40c sequences, and that Rab40a/al result

166

Emily D. Duncan et al.

have re-evolved a Ser residue at this critical site. The fact that this residue is highly conserved across millions of years of Rab protein evolution, and variable in Rab40 genes suggests exciting possibilities that Rab40 proteins may have unique GTPase activity that is entirely unlike any other Rab protein. Such possibilities, however, will have to remain speculative until further insight into the function of these Rab40 proteins is better understood. On the other hand, note that the Rab40 subfamily do contain the conserved catalytic Gln residue in the Switch II region, strongly suggesting that they still function as GTPases (Fig. 1b). The evolution of the Rab40 gene family is characterized by expansion and lineage specific losses in vertebrates (Fig. 1c). That Rab40 proteins are functional in the cell seems highly likely given the conservation of Rab40 genes in the genomes of most bilaterian organisms. While a single Rab40 gene is found in nonvertebrate bilaterians, a duplication event at the base of the vertebrate lineage resulted in Rab40b and Rab40c paralogs that are conserved across most vertebrate taxa (Fig. 1d). Preliminary analyses date this duplication to before the last vertebrate common ancestor, suggesting that Rab40b and Rab40c may have emerged from genome duplications at the root of the vertebrate phylogeny [15]. This dating is based on the preliminary finding that Cyclostomes (lamprey and hagfish) retain a Rab40c paralog. However, the node supporting this claim has low support in our gene trees, and further work is needed to rule out the possibility that Rab40b and Rab40c evolved in the lineage leading to Gnathostomes (sharks, bony fish, and tetrapods) after it split from Cyclostomes. Important for humans is that a subsequent duplication of Rab40b in the lineage leading to Simiiform primates (e.g., monkeys and apes, ~60 K ybp) resulted in two additional Rab40 paralogs: Rab40a and Rab40al (Fig. 1c, d). Thus, the human genome contains four Rab40 paralogs: Rab40a, Rab40al, Rab40b, and Rab40c. Rab40al lacks introns, a pattern that suggests it may have been duplicated by reverse transcription transposition [2]. Intriguingly, both Rab40a and Rab40al are found on the X chromosome. As noted above, Rab40a and Rab40al have also re-evolved a conserved Ser at a critical functional site. While all primate Rab40a genes exhibit a Ser at this site, only human Rab40al proteins exhibit a Ser residue suggesting a complex evolutionary history for these proteins that may involve gene conversion in the human lineage.

ä Fig. 1 (continued) from a duplication of Rab40b. Larger node sizes correspond to greater bootstrap support. (d) Hypothesis of Rab40 gene family evolution in vertebrates. Rab40 originates in the lineage leading to bilaterians, and duplicates in the lineage leading to vertebrates resulting in Rab40b and Rab40c paralogs. A subsequent duplication in the lineage leading to monkeys and apes results in the addition of Rab40a and Rab40al paralogs

Identifying Rab40b/Cullin5 Substrates using a SOCS Box Mutant

167

Additional lineage specific duplications and deletions in the Rab40 gene subfamily include independent duplications of three Rab40 paralogs, and the potential loss of Rab40b, in Cyclostomes. Teleost fish experienced a whole genome duplication and could retain up to four Rab40 paralogs (e.g., two each of Rab40b and Rab40c). Teleost taxa surveyed, however, appear to have lost paralogs to return to a diploid state. Zebrafish retains a single Rab40b and Rab40c paralog. In contrast, the teleost fish Medaka lost both Rab40b paralogs, but retains two Rab40c paralogs (Fig. 1c). 1.2 Conservation and Function of the Rab40 SOCS Box

Evolution of the Rab40 subfamily is defined by conservation of the C-terminal SOCS box through speciation and duplication events. Although originally identified in the SH2-containing SOCS family, the number of SOCS box containing proteins has expanded, and includes families such as WD40 proteins, SPRY domain proteins, and ankyrin repeat proteins [16–18]. The SOCS box is conserved across these protein families as shown by an alignment in Fig. 2a. This ~40 amino acid motif functions as a substrate recognition module, as part of the larger E3 ubiquitin ligase containing the scaffold protein Cullin5 (Cul5), RING-box protein Rbx2, and adaptor proteins Elongin B and Elongin C (Fig. 2b) [19, 20]. Together, this Cullin-RING ligase (CRL, CRL5 for Cullin5 containing) complex regulates protein turnover via ubiquitylation and subsequent proteasomal degradation [18, 21]. It should also be noted that when the Rab40 subfamily was first grouped with other SOCS box proteins, old nomenclature was utilized to name these proteins which is no longer readily used (RAR2A/Rab40a, RAR2/Rab40al, RAR/Rab40b, and RAR3/ Rab40c). Within the SOCS box, there are two defined motifs including the BC box (critical for binding the adaptor proteins Elongin B and C) and the Cul5 box (Fig. 2a) [22, 23]. The Cul5 box has the consensus sequence φxxLPφPxxφxx (where φ is a hydrophobic residue and x is any amino acid). The LPφ P motif is thought to be the primary determinant of Cul5 binding specificity [16, 24, 25]. The Rab40 Cul5 box contains residues ‘LPLP’, which is 100% conserved across all bilaterian Rab40 sequences and conserved in a number of non-Rab40 SOCS containing proteins (Fig. 2a). This conservation through bilaterian evolution suggests that the SOCS box is functional in Rab40 proteins; however, what role it may play is still unclear.

1.3 Known Functions of Rab40 Paralogs

Despite a novel domain architecture and the retention of duplicate paralogs in vertebrate lineages, there is limited knowledge on the function of the Rab40 subfamily. Based on the current research that is available, it seems likely that the four family members are not fully redundant. While Rab40a, Rab40b, and Rab40c paralogs have

168

Emily D. Duncan et al.

Fig. 2 Conservation and function of the Rab40 SOCS box. (a) Alignment of Rab40 SOCS box and other human SOCS proteins shows sequence conservation. Green highlights the Cul5 box, where the LPLP motif is conserved across all Rab40 sequences and multiple human SOCS box containing proteins. Conserved residues across all human SOCS box containing proteins are summarized at the bottom. (b) Example of a Cullin-RING ligase (CRL) that includes the scaffold protein Cul5, a SOCS-containing adaptor protein, RING-box protein Rbx2, and adaptor proteins Elongin B and Elongin C (left). This CRL5 complex facilitates ubiquitylation of target substrates. Strong evidence from our lab and others shows that Rab40b (and other members of the Rab40 subfamily) is a legitimate SOCS-containing adaptor protein for Cul5 (right)

been shown to interact with Cul5, it still remains to be determined whether these Rab40/Cul5 complexes have unique roles within the cell. Below is a summary of the Rab40 literature as it stands. 1.3.1 Rab40a and Rab40al

Rab40a and Rab40al (97.8% sequence identity), which appear to be unique to Simiiformes, are arguably the least studied amongst the four paralogs. The Rab40a/Cul5 complex has been suggested to

Identifying Rab40b/Cullin5 Substrates using a SOCS Box Mutant

169

target the small GTPase RhoU for ubiquitylation and degradation, which can be protected by the Cdc42 effector protein PAK4 [26]. This study only tested RhoU binding to Rab40a, so it is unclear whether RhoU may be a target of other Rab40/Cul5 complexes. In 2012, a study identified a mutation in Rab40al that is associated with the rare X-linked disorder, Martin–Probst syndrome (MPS) [27]. This missense mutation (variant p. D59G) is located within the highly conserved GTPase domain between β2 and β3 strands. However, several reports since have argued against the pathogenicity of p.D59G, so the linkage between Rab40al and MPS remains controversial [28, 29]. 1.3.2 Rab40b

Work from our lab identified Rab40b as a small GTPase required for targeted matrix metalloproteinase (MMP, specifically MMP2 and MMP9) secretion at invadopodia structures during 3D breast cancer cell migration [30, 31]. While depletion of Rab40a did not have any effect on MMP2 or MMP9 secretion, knockdown of Rab40c did reduce MMP2 secretion, suggesting that there may be some functional overlap between Rab40c and Rab40b in this particular context. Additionally, knockdown of Drosophila Rab40 disrupted salivary gland migration, suggesting a role in cell movement during development [32].

1.3.3 Rab40c

Rab40c is the most studied member of Rab40 subfamily. This includes the very first study citing a functional role for a Rab40– Cul5 complex [33]. The authors demonstrated that Rab40c interacts with Cul5 to form a CRL5 complex that polyubiquitylates Rap2 in order to regulate noncanonical Wnt signaling during Xenopus gastrulation and embryogenesis. Although the notation of XRab40 throughout the paper lends itself to some confusion, it is clear from the methods and supplementary material that the authors of the Xenopus study were indeed working with Rab40c. However, it should be noted that both Rab40b (Gene ID: 779634; XB-GENE-490554) and Rab40c (Gene ID: 100492927; XBGENE-6461049) are annotated within the Xenopus genome. A more recent study identified the protein Varp as a potential Rab40c/Cul5 substrate in melanocytes [34]. Other functions of Rab40c (assumed to be non-SOCS related) have been reported as well, including Rab40c function during oligodendrocyte vesicle transport [35] and lipid droplet biogenesis [36]. Taken together, it is clear that we lack a complete understanding of Rab40c function, and like the other members of the Rab40 subfamily, whether there are clear SOCS-dependent and -independent roles.

1.4 The Rab40b/Cul5 Complex

To further define Rab40b-dependent mechanisms regulating MMP2/9 secretion, it seems critical to establish whether there is a role for Rab40b’s SOCS box during cell migration. Based on previous literature described above, there is precedence for Rab40b acting as a SOCS adaptor protein for the CRL containing Cul5

170

Emily D. Duncan et al.

Fig. 3 Rab40b SOCSAAAA mutant disrupts Cul5 complex interaction. (a) Mutation of LPLP!AAAA within Rab40b Cul5 box to generate Rab40b SOCSAAAA. (b) To test the effect of Rab40b SOCSAAAA binding to Cul5, a pull-down assay was performed. Briefly, MDA-MB-231 lysates overexpressing human FLAG-Rab40b (WT or SOCSAAAA) were incubated with purified human GST-Cul5 or GST alone (control) followed by a standard GST pull-down experiment. Eluates were immunoblotted with α-FLAG mouse antibody. Graph below shows results from three independent experiments, normalized to WT binding. * indicates significant p-value ¼ 0.0213. (c) Mass spectrometry results from two independent experiments shows disruption of CRL5 complex with Rab40b SOCSAAAA. These are raw spectral counts (defined as the total number of spectra identified for a protein)

(Fig. 2b) [18, 33], and we recently demonstrated an interaction between Rab40b and Cul5 in MDA-MB-231 cells (Fig. 3b). Interestingly, the interaction between Rab40b and Cul5 appears to be GTP independent, as locking Rab40b in either a GTP or GDP state had no effect on its ability to interact with Cul5 (data not shown). We next asked whether we could disrupt Rab40b/Cul5 binding in order to study the function of this complex during cell migration. Based on previous biochemical data in other SOCS box proteins (including Rab40c), we designed a Rab40b construct with all four LPLP residues mutated to alanine (AAAA), which we have designated as Rab40b SOCSAAAA (Fig. 3a) [23–25]. While not a complete loss of complex formation, we found a significant decrease in Rab40b SOCSAAAA binding to Cul5 compared to Rab40b WT (Fig. 3b). 1.5 Using the Rab40b SOCSAAAA Mutant to Uncover Function

With generation of the Rab40b SOCSAAAA mutant, we became poised to ask a number of critical questions regarding the role of Rab40b/Cul5 during cell migration. Although we know that these two proteins interact, this complex has not previously been shown

Identifying Rab40b/Cullin5 Substrates using a SOCS Box Mutant

171

to directly regulate MMP secretion, actin dynamics, or cell migration. One way that Rab40b/Cul5 could regulate these processes is through ubiquitylation of downstream substrates. However, putative ubiquitylation targets of the Rab40b/Cul5 complex are not known. To address this gap, we sought to identify potential substrates, with the ultimate goal of studying their function and regulation during cell migration. Pinpointing bona fide ubiquitylation substrates is challenging because most substrates are quickly degraded by the proteasome or processed by deubiquitylases. To overcome this challenge, we utilized the Rab40b SOCSAAAA mutant as a way to capture protein substrates. We hypothesized that Rab40b SOCSAAAA would still bind substrates, but that without Cul5 interaction, ubiquitylation and subsequent turnover/release of the substrate would be inhibited. In effect, we expected that these proteins bound to Rab40b SOCSAAAA would be “stuck” and would accumulate in the cell compared to a WT context. Indeed, using mass spectrometry and proteomic analysis we identified a subset of Rab40b binding proteins that were enriched in Rab40b SOCSAAAA vs. Rab40b WT. Detailed here are the materials and methods. In brief, Rab40b WT and Rab40b SOCSAAAA were N-terminally FLAGtagged, expressed ubiquitously in MDA-MB-231 breast cancer cells, and immunoprecipitated using FLAG beads prior to mass spectrometry analysis. In the Conclusion section, we share our results and our future goals for using this method to test for functional differences in the Rab40 family.

2

Materials

2.1 Cross-Linking of FLAG Antibody to Protein G Sepharose

1. α-FLAG mouse antibody (Clone M2), 2. Mouse IgG. 3. Protein G Sepharose (PGS). 4. Bradford protein assay reagent. 5. Phosphate Buffered Saline (PBS) pH 7.4. 6. Tris buffer: 20 mM Tris pH 8.0, 100 mM NaCl. 7. Borate buffer: 200 mM Na-borate pH 9.0 (see Note 1). 8. Dimethyl pimelimidate dihydrochloride (DMP) cross-linker, 1 M stock in borate buffer (see Note 2). 9. Ethanolamine buffer: 200 mM ethanolamine pH 8.0 (see Note 3). 10. Reaction buffer: 20 mM HEPES pH 7.4, 150 mM NaCl. 11. Gel loading tips (or any ultrathin tip). 12. 1.5 mL microcentrifuge tubes and 15 mL conicals. 13. Equipment: rotator, microcentrifuge at 4  C.

172

Emily D. Duncan et al.

2.2 FLAG-Rab40b Immunoprecipitation

1. MDA-MB-231 cells, one line expressing FLAG-Rab40b WT and one expressing FLAG-Rab40b SOCSAAAA (see Note 4). 2. Ice-cold Reaction buffer for cell lysis: 20 mM HEPES pH 7.4, 150 mM NaCl, 1% Triton X-100, 1 mM phenylmethylsulfonyl Fluoride (PMSF), 1 mM Phosphatase Inhibitors, 10 mM Iodoacetamide (IAA, deubiquitylase inhibitor). 3. 5 mM Ethylenediaminetetraacetic acid (EDTA). 4. 5 mM Guanosine 50 -[β,γ-imido]triphosphate trisodium salt hydrate (GMP-PNP) (see Note 5). 5. 15 mM MgCl2. 6. α-FLAG beads and mice IgG beads prepared in Subheading 2.1. 7. Ice-cold Reaction buffer for washing: 20 mM HEPES pH 7.4, 150 mM NaCl, 0.1% Triton X-100, 1 mM MgCl2. 8. Gel loading tips (or any ultra-thin tip). 9. Elution buffer: 10 mM Tris pH 7.4, 1% sodium dodecyl sulfate (SDS), 100μM dithiothreitol (DTT). 10. Materials required to run an SDS-PAGE gel and perform western blot analysis. 11. 1.5 mL microcentrifuge tubes and 15 mL conicals. 12. Equipment: rotator, microcentrifuge at 4  C, benchtop/ 15 mL conical capacity centrifuge at 4  C, heat bath at 55  C.

2.3

Proteomics

1. Buffer containing 8 M urea and 100 mM ammonium bicarbonate (ABC) pH 8.5. 2. 10 mM DTT made in buffer containing 8 M urea and 100 mM ABC pH 8.5. 3. 25 mM IAA made in buffer containing 8 M urea and 100 mM ABC pH 8.5. 4. 50 mM ABC pH 8.5. 5. ProteaseMax detergent. 6. Mass spectrometry–grade trypsin. 7. 10 kDa molecular weight cutoff filter unit (0.5 mL). 8. Equipment: microcentrifuge 4  C, heat bath at 37  C, UHPLC analytical column, mass spectrometer, Scaffold Proteome Software.

3

Methods

3.1 Cross-Linking of FLAG Antibody to Protein G Sepharose

This protocol is written to make 1 mL of α-FLAG beads and 500μL of mouse IgG beads. 200μL of beads are used for each reaction (i.e., 50μg of antibody). This can be scaled up or down.

Identifying Rab40b/Cullin5 Substrates using a SOCS Box Mutant

173

1. Measure α-FLAG mouse antibody and mouse IgG concentration using Bradford protein assay. 2. Prepare a 50% PGS bead solution in PBS. Keep cold. 3. Combine 300μg of α-FLAG antibody and 250μg of mouse IgG with 1 mL and 500μL of 50% PGS beads, respectively. For these first steps, 1.5 mL tubes are sufficient. Notice switch to 15 mL conical in step 8. 4. Incubate for 2 h at room temperature (RT) while rotating. 5. Spin down antibody-bead solution. 350  g for 5 min at 4  C. Unless otherwise noted, all spins should be performed at these settings. 6. Wash beads 1 with 1 mL of Tris buffer. Spin and discard supernatant. 7. Wash beads 5 with 1 mL of Borate buffer. Spin and discard supernatant between each wash. 8. Resuspend beads in 1 mL of Borate buffer. Transfer solution to 15 mL conical. 9. Add 50μL of 1 M DMP stock to each set of beads. Cover 15 mL conical in foil, as DMP is light sensitive. 10. Incubate at RT for 30 min while rotating. 11. Spin and discard supernatant. 12. Wash beads 1 with 5 mL of Ethanolamine buffer. Spin and discard supernatant. 13. Quench cross-linking reaction for 3 h with 5 mL of Ethanolamine buffer. RT while rotating. 14. Spin and discard supernatant. 15. Wash 5 with 1 mL of Reaction buffer. Spin and discard supernatant between each wash. 16. On the last discard, use gel loading tips (or something similar) to get as much buffer off as possible. Resuspend α-FLAG beads in 500μL of Reaction buffer. Resuspend mouse IgG beads in 250μL of Reaction buffer. Keep cold until use. 3.2 FLAG-Rab40b Immunoprecipitation

Before performing this immunoprecipitation large-scale, we recommend testing the beads in a small-scale reaction first to make sure α-FLAG and mouse IgG are covalently bonded and to troubleshoot any issues with elution see Note 6 for more details. 1. Grow 4  10 cm dishes of MDA-MB-231 FLAG-Rab40b WT cells and FLAG-Rab40b SOCSAAAA cells. 2. Once confluent, wash plates with PBS. Then, lyse cells (250μL per plate) with ice-cold Reaction buffer for cell lysis (can either scrape or lyse from trypsinized pellet).

174

Emily D. Duncan et al.

3. Incubate at 4  C for 1 h while rotating. 4. Pellet lysed cells by centrifugation. 12,000  g for 10 min at 4  C. 5. Take supernatant. Save a small sample for checking FLAG expression later (if needed). Measure lysate concentration using Bradford protein assay. 6. Set 3 tubes. These can either be 1.5 mL tubes or 15 mL conicals, depending on your lysate concentration and volume. Calculate the volume needed for 1.5 mg of lysate. Tube 1 gets 1.5 mg of FLAG-Rab40b WT lysate. Tube 2 gets 1.5 mg of FLAG-Rab40b SOCSAAAA lysate. Tube 3 gets 0.75 mg of FLAG-Rab40b WT lysate and 0.75 mg of FLAG-Rab40b SOCSAAAA lysate. For each tube, make up the difference in volume with Reaction buffer to ensure equal concentration and equal volume. The goal volume should be about 1 mL. 7. Preclear lysates by adding 200μL of 50% PGS solution. Incubate at RT for 30 min while rotating. 8. Spin and move supernatants to new tubes. 9. For lysates in tubes 1 and 2, follow the steps 10–12 for GMP-PNP locking. It is not necessary to lock tube 3 (mouse IgG control). 10. Add EDTA to 5 mM. Incubate at RT for 10 min while rotating. This will chelate Magnesium ions and will remove any GTP/GDP nucleotide bound to Rab40b. 11. Add GMP-PNP to 5 mM. Incubate at RT for 10 min while rotating (see Note 7). 12. Add MgCl2 to 15 mM (3 fold EDTA concentration). Incubate at 37  C for 10 min while rotating. 13. Add 200μL of α-FLAG beads to tubes 1 and 2. Add 100μL of mouse IgG beads to tube 3. 14. Incubate at RT for 2 h while rotating. 15. Spin and remove supernatant. Take a sample of flow through for later analysis (if needed). 16. Wash 5 with 10 mL of ice-cold Reaction buffer for washing. Spin and discard supernatant between each wash. 17. Resuspend beads in 1 mL washing. Transfer beads to supernatant. On this last (or something similar) to possible.

of ice-cold Reaction buffer for 1.5 mL tubes. Spin and discard discard, use gel loading tips remove as much buffer off as

18. Add 100μL of Elution buffer to tubes 1, 2, and 3. 19. Incubate beads with Elution buffer for 15 min at 55  C. 20. Spin and collect eluates.

Identifying Rab40b/Cullin5 Substrates using a SOCS Box Mutant

175

21. Repeat steps 18–20 for a second elution step. 22. Before freezing or proceeding to Subheading 3.3, take 15μL of each elution and run a gel to test the efficiency of the immunoprecipitation. Probe with α-FLAG antibody to check for FLAG-Rab40b in eluates. 3.3

Proteomics

The following protocol was performed by the University of Colorado School of Medicine Biological Mass Spectrometry Facility. In brief, samples from Subheading 3.2 were digested with trypsin in-solution and were analyzed on a Q Exactive HF mass spectrometer. 1. Add 100μL of 10 mM DTT (made in 8 M urea, 100 mM ammonium bicarbonate (ABC) pH 8.5) to protein eluate samples. 2. Incubate for 30 min at RT followed by centrifugation through a 10 kDa molecular weight cutoff filter. Discard flow-through (FT). All spins are at 4  C, 14,000  g for 15 min. 3. Add 100μL of 25 mM IAA (made in 8 M urea, 100 mM ABC pH 8.5). 4. Incubate for 15 min at RT in the dark. Spin and discard FT. 5. Wash 3 with 100μL of 8 M urea, 100 mM ABC pH 8.5 solution. Spin and discard FT. 6. Wash 1 with 100μL of 50 mM ABC pH 8.5. Spin and discard FT. 7. Remove from filter and add ProteaseMax detergent (0.02%) and mass spectrometry-grade trypsin (1:50 dilution) to a final volume of 500μL in 50 mM ABC pH 8.5. 8. Digest at 37  C overnight. 9. Separate peptides and analyze on a mass spectrometer (see Note 8).

3.4 Results and Conclusion

After analyzing protein hits from two independent experiments (including cut off criteria described in Note 8), we identified a set of Rab40b binding proteins that were enriched in Rab40b SOCSAAAA compared to Rab40b WT. From the first run, 43.1% (81/188) of proteins were enriched in SOCSAAAA vs. WT. In the second run, 52.5% (32/61) of proteins were enriched in SOCSAAAA vs. WT. Importantly, all of the core components of the CRL5 were detected in the WT background and noticeably disrupted with the SOCSAAAA mutant in both experiments (Fig. 3c). This disruption of the complex gives us confidence in the overall success of the experiment and the ability to identify true ubiquitylation targets. We are now validating these SOCSAAAA binding proteins through a number of different experiments. In general, we first begin by measuring overall protein levels of substrates in

176

Emily D. Duncan et al.

Rab40b SOCSAAAA and Rab40b knockout cells. This is to directly test the prediction that substrate levels should increase if we disrupt the complex responsible for its degradation and turnover. We follow this up with in vitro binding and ubiquitylation assays to confirm that Rab40b/Cul5 directly regulates a given substrate. Ultimately, the goal is to understand how ubiquitylation, or lack thereof, of a particular substrate impacts 3D cell migration. Given our previous evidence for Rab40b being a positive regulator of cell migration (decreased MMP2/9 secretion in Rab40b depleted cells), we hypothesize that Rab40b/Cul5 degrades negative regulators of cell migration processes. Here we have presented an unbiased approach for identifying potential ubiquitylation targets of the Rab40b/Cul5 complex. The results and knowledge gained from this study will greatly surpass our original goal of elucidating novel Rab40b SOCS-dependent function during breast cancer cell migration, by allowing us to consider bigger picture questions. For example, this method can be broadly applied to other members of the Rab40 family and will help uncover the functional differences between the Rab40/Cul5 complexes. We also anticipate that this workflow will be useful for identifying ubiquitylation substrates of other SOCS box proteins.

4

Notes 1. Make 200 mM boric acid solution in water, and pH to 9.0 with NaOH. It is best to make this buffer fresh each day, as borate has a tendency to precipitate over time. 2. DMP is moisture sensitive and light sensitive. Powder stock should be stored with a desiccant. Once DMP is solubilized, keep in the dark for cross-linking reaction. 3. Ethanolamine hydrochloride was used for this experiment. Do not use any buffers that contain primary amines, as these will compete with the cross-linking reaction. 4. This can be adapted to cells and tagged protein of choice. MDA-MB-231 cells stably expressing either FLAG-Rab40b WT or FLAG-Rab40b SOCSAAAA were generated using lentivirus. Rab40b constructs were cloned into the pLVX-Puro vector and virus was generated using HEK293T cells. This has been described elsewhere [37]. Transient expression is also likely to succeed; however, we did not try this specifically for Rab40b. 5. GMP-PNP was used for this experiment as a nonhydrolyzable form of GTP. It is possible to use other alternatives such as GTPγS, which we have successfully used for other GTP locking experiments.

Identifying Rab40b/Cullin5 Substrates using a SOCS Box Mutant

177

6. It is important to do a small-scale immunoprecipitation test with the beads before moving on to the large-scale experiment. This is to make sure that both FLAG and IgG are covalently attached to the beads, and to troubleshoot any potential issues with elution off the beads. We recommend using 10μg of α-FLAG beads and 10μg of mouse IgG beads for the smallscale test. The amount of lysate needed is dependent on expression of your protein of interest, but for reference, 250μg of lysate was used in our small-scale experiment. For this smaller test, steps from Subheading 3.2 can be significantly shortened or skipped: GMP-PNP loading is not needed, lysate and beads can be incubated for just 1 h, washing steps can be reduced to 1 mL, and so on. We do recommend keeping the preclearing step. 7. Although we know that Rab40b binding to Cul5 is GTP independent (data not shown), it is possible that potential ubiquitylation substrates only bind to Rab40b in a GTP dependent manner. To increase the success rate of capturing GTP-dependent substrates, we locked Rab40b in an active GTP bound state, via GMP-PNP loading (see Note 5). Briefly, we stripped any nucleotide bound (during lysis) with EDTA, then reloaded the GTP binding pocket with GMP-PNP. Finally, MgCl2 was added in excess to quench the reaction and stabilize nucleotide binding. 8. Peptides were separated on a self-made C18 analytical column (100μm internal diameter, 20 cm length) packed with 2.7μm Phenomenex Cortecs particles. Samples were analyzed on a Q Exactive HF quadrupole orbitrap mass spectrometer coupled to an Easy nLC 1000 UHPLC through a nanoelectrospray ion source. MS/MS spectra were extracted from raw data files and converted into mgf files using Proteome Discoverer Subheading 2.2. These mgf files were then independently searched against the mouse uniprotKB database (release date 2018.02) using an in-house Mascot™ server (Version 2.6, Matrix Science). Scaffold (version 4.8.0, Proteome Software) was used to validate MS/MS based peptide and protein identifications. Peptide identifications were accepted if they could be established at greater than 95.0% probability as specified by the Peptide Prophet algorithm. Protein identifications were accepted if they could be established at greater than 99.0% probability and contained at least two identified unique peptides. To determine Rab40b-interacting proteins (both WT and SOCSAAAA), we established the following criteria. First, only proteins >3fold IgG control (spectral counts) were analyzed. Second, any hits identified as nonspecific based on the CRAPome database were dismissed, as well as any additional DNA, RNA, and

178

Emily D. Duncan et al.

mitochondrial proteins [38]. Finally, a 1.5-fold enrichment cutoff (spectral counts) was used to identify proteins preferentially bound to Rab40b SOCSAAAA vs. Rab40b WT.

Acknowledgments We thank the University of Colorado School of Medicine Biological Mass Spectrometry Facility, specifically Monika Dzieciatkowska for performing the mass spectrometry and proteomic analyses. This work was supported by NIHT32GM008730 to EDD, NIHT32CA174648 to EL, and NIH1R01GM122768 to RP. References 1. Stenmark H, Olkkonen VM (2001) The Rab GTPase family. Genome Biol 2: REVIEWS3007–7. https://doi.org/10. 1186/gb-2001-2-5-reviews3007 2. Coppola U, Ristoratore F, Albalat R, D’Aniello S (2019) The evolutionary landscape of the Rab family in chordates. Cell Mol Life Sci 76:4117–4130. https://doi.org/10.1007/ s00018-019-03103-7 3. Je´kely G (2003) Small GTPases and the evolution of the eukaryotic cell. BioEssays 25:1129–1138. https://doi.org/10.1002/ bies.10353 4. Surkont J, Pereira-Leal JB (2016) Are there Rab GTPases in archaea? Mol Biol Evol 33:1833–1842. https://doi.org/10.1093/ molbev/msw061 5. Klo¨pper TH, Kienle N, Fasshauer D, Munro S (2012) Untangling the evolution of Rab G proteins: implications of a comprehensive genomic analysis. BMC Biol 10:71–17. https://doi.org/10.1186/1741-7007-10-71 6. Zerial M, McBride H (2001) Rab proteins as membrane organizers. Nat Rev Mol Cell Biol 2:107–117. https://doi.org/10.1038/ 35052055 7. Stenmark H (2009) Rab GTPases as coordinators of vesicle traffic. Nat Publ Group 10:513–525. https://doi.org/10.1038/ nrm2728 8. Pfeffer SR (2001) Rab GTPases: specifying and deciphering organelle identity and function. Trends Cell Biol 11:487–491. https://doi. org/10.1016/s0962-8924(01)02147-x 9. Grosshans BL, Ortiz D, Novick P (2006) Rabs and their effectors: achieving specificity in membrane traffic. Proc Natl Acad Sci U S A 103:11821–11827. https://doi.org/10. 1073/pnas.0601617103

10. Schwartz SL, Cao C, Pylypenko O et al (2008) Rab GTPases at a glance. J Cell Sci 121:246–246. https://doi.org/10.1242/jcs. 03495 11. Hutagalung AH, Novick PJ (2011) Role of Rab GTPases in membrane traffic and cell physiology. Physiol Rev 91:119–149. https:// doi.org/10.1152/physrev.00059.2009 12. Pereira-Leal JB, Seabra MC (2001) Evolution of the Rab family of small GTP-binding proteins. J Mol Biol 313:889–901. https://doi. org/10.1006/jmbi.2001.5072 13. Pereira-Leal JB, Seabra MC (2000) The mammalian Rab family of small GTPases: definition of family and subfamily sequence motifs suggests a mechanism for functional specificity in the Ras superfamily 1 1Edited by M. Yaniv. J Mol Biol 301:1077–1087. https://doi.org/ 10.1006/jmbi.2000.4010 14. Pylypenko O, Hammich H, Yu I-M, Houdusse A (2018) Rab GTPases and their interacting protein partners: structural insights into Rab functional diversity. Small GTPases 9:22–48. https://doi.org/10.1080/21541248.2017. 1336191 15. Kasahara M, Naruse K, Sasaki S et al (2007) The medaka draft genome and insights into vertebrate genome evolution. Nature 447:714–719. https://doi.org/10.1038/ nature05846 16. Hilton DJ, Richardson RT, Alexander WS et al (1998) Twenty proteins containing a C-terminal SOCS box form five structural classes. Proc Natl Acad Sci U S A 95:114–119. https://doi.org/10.1073/pnas.95.1.114 17. Hilton DJ (1999) Negative regulators of cytokine signal transduction. Cell Mol Life Sci 55:1568–1577. https://doi.org/10.1007/ s000180050396

Identifying Rab40b/Cullin5 Substrates using a SOCS Box Mutant 18. Okumura F, Joo-Okumura A, Nakatsukasa K, Kamura T (2016) The role of cullin 5-containing ubiquitin ligases. Cell Div 11:1–16. https://doi.org/10.1186/s13008016-0016-3 19. Petroski MD, Deshaies RJ (2005) Function and regulation of cullin–RING ubiquitin ligases. Nat Rev Mol Cell Biol 6:9–20. https://doi.org/10.1038/nrm1547 20. Linossi EM, Nicholson SE (2012) The SOCS box-adapting proteins for ubiquitination and proteasomal degradation. IUBMB Life 64:316–323. https://doi.org/10.1002/iub. 1011 21. Kile BT, Schulman BA, Alexander WS et al (2002) The SOCS box: a tale of destruction and degradation. Trends Biochem Sci 27:235–241 22. Mahrour N, Redwine WB, Florens L et al (2008) Characterization of Cullin-box sequences that direct recruitment of Cul2Rbx1 and Cul5-Rbx2 modules to Elongin BC-based ubiquitin ligases. J Biol Chem 283:8005–8013. https://doi.org/10.1074/ jbc.M706987200 23. Kamura T, Sato S, Haque D et al (1998) The Elongin BC complex interacts with the conserved SOCS-box motif present in members of the SOCS, ras, WD-40 repeat, and ankyrin repeat families. Genes Dev 12:3872–3881 24. Kamura T, Maenaka K, Kotoshiba S et al (2004) VHL-box and SOCS-box domains determine binding specificity for Cul2-Rbx1 and Cul5-Rbx2 modules of ubiquitin ligases. Genes Dev 18:3055–3065. https://doi.org/ 10.1101/gad.1252404 25. Kim YK, Kwak MJ, Ku B et al (2013) Structural basis of intersubunit recognition in elongin BC-cullin 5-SOCS box ubiquitin-protein ligase complexes. Acta Cryst D69:1587–1597. https://doi.org/10.1107/ S0907444913011220 26. Dart AE, Box GM, Court W et al (2015) PAK4 promotes kinase-independent stabilization of RhoU to modulate cell adhesion. J Cell Biol 211:863–879. https://doi.org/10.1083/jcb. 201501072 27. Bedoyan JK, Schaibley VM, Peng W et al (2012) Disruption of RAB40AL function leads to Martin–Probst syndrome, a rare X-linked multisystem neurodevelopmental human disorder. J Med Genet 49:332–340. https://doi.org/10.1136/jmedgenet-2011100575 28. Ołdak M, Ruszkowska E, Pollak A et al (2014) A note of caution on the diagnosis of Martin-

179

Probst syndrome by the detection of the p. D59G mutation in the RAB40AL gene. Eur J Pediatr 174:693–696. https://doi.org/10. 1007/s00431-014-2452-x 29. Ołdak M, S´ciez˙yn´ska A, Młynarski W et al (2014) Evidence against RAB40ALBeing the locus for Martin-Probst X-linked deafnessintellectual disability syndrome. Hum Mutat 35:1171–1174. https://doi.org/10.1002/ humu.22620 30. Jacob A, Jing J, Lee J et al (2013) Rab40b regulates trafficking of MMP2 and MMP9 during invadopodia formation and invasion of breast cancer cells. J Cell Sci 126:4647–4658. https://doi.org/10.1242/jcs.126573 31. Jacob A, Linklater E, Bayless BA et al (2016) The role and regulation of Rab40b-Tks5 complex during invadopodia formation and cancer cell invasion. J Cell Sci 129:4341–4353. https://doi.org/10.1242/jcs.193904 32. Myat MM, Louis D, Mavrommatis A et al (2019) Regulators of cell movement during development and regeneration in drosophila. Open Biol 9:180245–180210. https://doi. org/10.1098/rsob.180245 33. Lee RHK, Iioka H, Ohashi M et al (2007) XRab40 and XCullin5 form a ubiquitin ligase complex essential for the noncanonical Wnt pathway. EMBO J 26:3592–3606. https:// doi.org/10.1038/sj.emboj.7601781 34. Yatsu A, Shimada H, Ohbayashi N, Fukuda M (2015) Rab40C is a novel Varp-binding protein that promotes proteasomal degradation of Varp in melanocytes. Biol Open 4:267–275. https://doi.org/10.1242/bio.201411114 35. Rodriguez-Gabin AG, Almazan G, Larocca JN (2004) Vesicle transport in oligodendrocytes: probable role of Rab40c protein. J Neurosci Res 76:758–770. https://doi.org/10.1002/ jnr.20121 36. Tan R, Wang W, Wang S et al (2013) Small GTPase Rab40c associates with lipid droplets and modulates the biogenesis of lipid droplets. PLoS One 8:e63213–e63211. https://doi. org/10.1371/journal.pone.0063213 37. Tandon N, Thakkar K, LaGory E et al (2018) Generation of stable expression mammalian cell lines using lentivirus. Bio-Protocol 8:1–6. https://doi.org/10.21769/BioProtoc.3073 38. Mellacheruvu D, Wright Z, Couzens AL et al (2013) The CRAPome: a contaminant repository for affinity purification–mass spectrometry data. Nat Methods 10:730–736. https://doi. org/10.1038/nmeth.2557

Chapter 12 Using GBP Nanotrap to Restore Autophagy in the Rab5/ Vps21 Mutant by Forcing Snf7 and Atg17 Interaction Mengzhu Zhao and Yongheng Liang Abstract Protein–protein interactions are important for physiology performance. Green fluorescent protein (GFP) is a widely used protein tag to show protein localization in vivo. GFP binding protein (GBP) is a specific domain with high affinity to GFP. A novel technique with GBP fused protein X tagged with red fluorescence protein binding to GFP of GFP fused protein Y to establish a close association for proteins X and Y independently from other proteins has recently been developed. It is found that the interaction and colocalization between Snf7 and Atg17 is impaired in Saccharomyces cerevisiae vps21Δ cells, which are defective in autophagy. In order to determine whether the interaction between Snf7 and Atg17 is important for autophagy, we forced the interaction between Snf7 and Atg17 through GBP–GFP binding. Snf7-GBPmCherry and/or GFP-Atg17 tagged wild-type and vps21Δ cells were compared for autophagy process under starvation by determining the maturation of proprotein of Ape1 (prApe1). Our results showed that the defective autophagy in vps21Δ cells was significantly suppressed when both Snf7-GBP-mCherry and GFP-Atg17 were installed. Our results indicate that the GBP–GFP nanotrap technique is a powerful tool to restore colocalization/interaction in vivo and the Snf7–Atg17 interaction is important for yeast autophagy. Key words Atg17, Autophagy, GBP, GFP, Saccharomyces cerevisiae, Snf7, Vps21

1

Introduction Protein–protein interactions as well as colocalization in vivo are important for their functions. A key challenge in cell biology is to directly link protein localization and interaction to its function [1]. As the interaction or colocalization itself is often regulated by upstream proteins, the restoration of interaction or colocalization in the absence of upstream proteins are extremely important to show the functions of protein–protein interaction or colocalization. A traditional way to bring the protein–protein interaction/colocalization is through constructing a chimera protein, directly connecting the open reading frames of two proteins with a linker

Guangpu Li and Nava Segev (eds.), Rab GTPases: Methods and Protocols, Methods in Molecular Biology, vol. 2293, https://doi.org/10.1007/978-1-0716-1346-7_12, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

181

182

Mengzhu Zhao and Yongheng Liang

peptide between them [2], and then to study the localization and function of the chimera protein. However, such a method of direct increasing the protein sequence often leads to a change in the spatial structure of the connected proteins and causes them to lose their original functions. Alternative ways to make the interaction between two functional proteins in vivo to study physiology roles are in needs. A technique derived from a peptide sequence at 11-13kD of camel heavy-chain antibody with high affinity to GFP, named GFP-binding protein (GBP), was applied to pull the GBP fused protein to bind to GFP-labeled protein in vivo [3]. To visibly observe the interaction/colocalization, a fluorescence protein different from GFP, such as RFP or mCherry, was often further tagged to GBP fused protein. Furthermore, this method can also apply to screen a GFP library in vivo, such as the yeast GFP clone collection of Saccharomyces cerevisiae [4], for colocalization with GBP fused protein in red fluorescence. During our recent series of studies for the roles and molecular mechanism of Vps21/Rab5 in autophagy, we found that both Vps21 and its downstream effector, the endosomal sorting complex required for transport (ESCRT) complex, play roles in autophagy, specifically in phagophore closure. Most importantly, we found that the interaction and colocalization between Atg17 and ESCRT subunit Snf7 were significantly decreased in vps21Δ mutant cells [5, 6]. To elucidate the important roles of Atg17-Snf7 interaction/ colocalization in autophagy, we tried two methods: constructing an Atg17-Snf7 chimera and fusing Snf7 to GBP and mCherry to bind to Atg17-GFP. Although the Atg17-Snf7 chimera lost functions no matter Atg17 was in N-terminal or C-terminal (unpublished), we successfully pulled Atg17 and Snf7 together in vps21Δ mutant cells by the GBP–GFP binding technique to restore autophagy [6]. We are going to introduce this technique we applied in our study and the results we obtained.

2

Materials Two integrating plasmids are used. First, the ATG17-3GFP-PG5 plasmid with URA3 as a selection marker is linearized with Xhol at about 380 bp of the ATG17 sequence to integrate to target strains. Second, we constructed a pHBKA81-SNF7-GBP-mCherry plasmid by inserting SNF7 just before GBP in the pUC119-Padh81/ 21/11/1-GBP-mCherry(C)-hphMX6-lys1* plasmid [1] as shown in Fig. 1.

Using GBP Nanotrap to Restore Autophagy in the Rab5/Vps21 Mutant by. . .

183

Fig. 1 The construction of pHBKA81-SNF7-GBP-mCherry plasmid. PCR amplified SNF7 with NdeI and BamHI sites at the ends was inserted in front of the GBP of pUC119-Padh81/21/11/1-GBP-mCherry(C)-hphMX6-lys1* plasmid [1] to get pHBKA81-SNF7-GBP-mCherry plasmid

3

Methods

3.1 Linearize ATG17-3GFP-PG5

The ATG17-3GFP-PG5 plasmid is linearized with the following enzyme system at 37
C for 10 h. Then it is purified with PCR purification kit and eluted with 40 μL elution buffer. ATG17-3GFP-PG5

30

Xhol

3

H buffer

6

ddH2O

21 60 μL

3.2 Construct pHBKA81SNF7-GBP-mCherry

1. Amplifying the insert SNF7 DNA for restriction enzyme digestion The primers used to amplify SNF7 for inserting into pHBKA81-GBP-mCherry C-terminal labeling plasmid are: HBKC-Ndel-SNF7-forward, 5’- GGGCATATGATGTGGT CATCACTTTTTGG-30 ; HBKC-BamHI-SNF7-reverse, 5’-G GGGGATCCAAGCCCCATTTCTGCTTGTA-30 . The PCR is run at 98
C of melting temperature for 2 min and at 56
C of annealing temperature for 15 s for each cycle with total 30 cycles. The PCR product is purified with PCR

184

Mengzhu Zhao and Yongheng Liang

purification kit according to manufacture manual and digested with NdeI and BamHI to expose the restriction sites at both ends. The specific restriction enzyme digestion and purification systems are the same as shown below for digesting the pHBKA81-GBP-mCherry plasmid. 2. Restriction enzyme digestion for the pHBKA81-GBPmCherry plasmid The pHBKA81-GBP-mCherry plasmid is digested with NdeI and BamHI to expose the restriction sites at both ends. Due to the incompatible buffer and digestion temperature of these two enzymes, the digestion is carried out sequentially with single enzyme digestion. The digestion system and condition with NdeI are as follows: pHBKA81-GBP-mCherry or SNF7

30

Ndel

3

H buffer

6

ddH2O

21 60 μL

The mixture is incubated at 37
C for 10 h. Then it is purified with PCR purification kit and eluted with 40 μL elution buffer for the second digestion. pHBKA81-GBP-mCherry or SNF7

30

BamHI

3

K buffer

6

ddH2O

21 60 μL

The mixture is incubated at 30
C for 10 h. Then it is purified with PCR purification kit and eluted with 40 μL elution buffer for the following ligation. 3. Ligating insert to plasmid Both the insert and plasmid prepared above after digestion with two enzymes and purification are subjected to ligation with T4 ligase at 14
C for 10 h. 4. Transforming the ligation mixture into Escherichia coli The ligation mixture (6 μL) is added into 60 μL of the susceptible E. coli strain Top 10 on ice for 30 min, and then the cells are heated with water bath at 42
C for 40 s. The product is immediately cooled down on ice for 2 min, and added into the Luria–Bertani (LB) medium, cultured at 37
C for 1 h with

Using GBP Nanotrap to Restore Autophagy in the Rab5/Vps21 Mutant by. . .

185

shaking at 150 rpm, and then coated on the LB + Ampicillin plate for growing at 37
C overnight. Regular colony PCR is performed to select successful plasmid for sequential plasmid extraction, restriction enzyme redigestion and sequencing. The final correct pHBKA81-SNF7-GBP-mCherry plasmid is used for integration. 3.3 Integrate ATG17-3GFP-PG5 and/or pHBKA81SNF7-GBP-mCherry Plasmids into Wild-Type and vps21Δ Mutant Cells

Both ATG17-3GFP-PG5 and pHBKA81-SNF7-GBP-mCherry plasmids are yeast integrative plasmids (YIps) [7], when they are linearized and integrated into the host cell genome, YIps are replicated and transmitted to successor cells as part of a chromosome [8]. The linearization of YIps increases the transformation efficiency and defines the genomic integration site. The XhoI digestion site on ATG17 of ATG17-3GFP-PG5 and the XbaI digestion site on SNF7 of pHBKA81-SNF7-GBP-mCherry are used to linearize with the following systems: ATG17-3GFP-PG5

40

Xhol

3

M buffer

6

ddH2O

11 60 μL

pHBKA81-SNF7-GBP-mCherry

40

Xbal

3

M buffer

6

ddH2O

11 60 μL

The linearized plasmid is integrated into yeast by lithium acetate method [9]. The principle of lithium acetate conversion yeast is to use alkaline Li+ to change the permeability of yeast cell membrane and promote the formation of competent cells, so that cells can easily absorb foreign DNA. The integration processes are: 1. Take 1 mL of cultured wild-type and vps21Δ mutant cells in 1.5 mL centrifuge tube, centrifuge with 1500  g for 3 min, and discard the supernatant. 2. Configure PEGLET mixture according to the following formulation. (a) 160 μL 50% PEG (b) 20 μL 1 M LiAc (c) 20 μL 10  TE Buffer Solution

186

Mengzhu Zhao and Yongheng Liang

Fig. 2 The GFP–GBP binding assay to restore the Atg17-Snf7 colocalization in vps21Δ mutant cells for autophagy. (a) A model to depict the colocalization between Atg17 and Snf7 by the affinity between GFP and

Using GBP Nanotrap to Restore Autophagy in the Rab5/Vps21 Mutant by. . .

187

(d) 10 μL ssDNA (boiled 5 min in water bath) (e) 10 μL linearized plasmid DNA. 3. Add the PEGLET mixture into the centrifuge tube containing the cells and vortex until the cells are completely suspended. 4. Set at room temperature for more than 8 h, or heat shock for 30 min at 42
C. 5. Centrifuge the cells at 1500  g for 3 min, discard the supernatant, add 100 μL sterilized water, suck and resuspend the cells. 6. Plate appropriate amount of yeast liquid on the selective medium, that is, the ATG17-3GFP-PG5 integrated yeast is coated on SD-Ura, and the pHBKA81-SNF7-GBP-mCherry integrated yeast is coated on YPD + Hygromycin plate, then culture the cells at 26
C for 3 days. The growing colonies from the selective plates are further screened with the expected corresponding fluorescence. 7. Integrate the second plasmid. ATG17-3GFP-PG5 integrated wild-type and vps21Δ mutant cells are further integrated for pHBKA81-SNF7-GBP-mCherry with the same procedures described above for a second round. 3.4

Result Analysis

After the cells were integrated with the corresponding plasmids, we expected that the cells with both ATG17-3GFP and SNF7-GBPmCherry should be easily observed for Atg17-Snf7 colocalization because of the GBP-GFP binding as described in the schematic (Fig. 2a). In fact, the installation of GBP between Snf7 and mCherry forces Atg17 colocalizing with Snf7 in vps21Δ mutant cells (Fig. 2b). This indicates that Snf7 can be forced to interact with Atg17 independent on Vps21 by using a GFP nanotrap. We were more interested to know whether the recovered Atg17-Snf7 colocalization (supposed also interaction) in vps21Δ mutant cells would restore autophagy or not. We directly determined the levels of Ape1 (Aminopeptidase 1) in wild-type and

ä Fig. 2 (continued) GBP. Atg17 was tagged with 3XGFP and Snf7 was tagged with GBP-mCherry. When both Atg17-3GFP and Snf7-GBP-mCherry coexist, Atg17 and Snf7 will be pulled together by the GFP-GBP binding so that GFP and mCherry will colocalize to generate yellow fluorescence. (b) Atg17 and Snf7 colocalize in wildtype and vps21Δ mutant cells. Indicated cells were grown in nutrient-rich medium to mid-log phase and then starved for nitrogen for 2 h. GFP and/or mCherry fluorescence were observed with a Nikon inverter fluorescence microscopy. Bar, 5μm. Arrows indicate colocalization. (c) Ape1 matured in vps21Δ mutant cells when they were tagged with both Atg17-3GFP and Snf7-GBP-mCherry. Immunoblot to detect the Ape1 levels in wild-type and vps21Δ mutant cells without or with fluorescence tagging with anti-Ape1. G6PDH served as a loading control. When Ape1 matured in wild-type cells (with slight defect in wild-type tagged with Snf7-GBP-mCherry), Ape1 maturation was blocked in vps21Δ mutant cells unless they were tagged with both Atg17-3GFP and Snf7-GBP-mCherry. Cells were grown and treated as in b

188

Mengzhu Zhao and Yongheng Liang

vps21Δ mutant cells without or with ATG17-3GFP and/or SNF7GBP-mCherry tagging by immunoblots for cells under nitrogen starvation. Ape1 is an important marker protein in the process of autophagy. Ape1 in cytoplasm is present as both precursor and maturation forms under rich nutritional condition. When autophagy is induced, the precursor prApe1 is transported to vacuoles to become mature Ape1 (mApe1). Due to the different molecular weight between prApe1 and mApe1, the level of autophagy can be reflected by detecting the mApe1 accounted for the proportion of total Ape1 by immunoblot [10]. Our immunoblot results showed that when the maturation of Ape1 was blocked in vps21Δ mutant cells without or with ATG173GFP or SNF7-GBP-mCherry tagging, but not in wild-type cells, the maturation of Ape1 in vps21Δ mutant cells with ATG17-3GFP and SNF7-GBP-mCherry tagging was significantly increased (Fig. 2c). These results suggest that the Atg17-Snf7 colocalization/interaction is important for autophagy as the autophagy process of Ape1 maturation is defective in vps21Δ mutant cells, in which the Atg17-Snf7 colocalization was almost completely abolished [6], but restoration of Atg17-Snf7 colocalization by GFP– GBP binding suppresses autophagy defect in vps21Δ mutant cells. Together with the similar autophagic defects in phagophore closure in Vps21 mutants and ESCRT mutants, and the both in vivo and in vitro phagophore sealing function by ESCRT subunits Snf7 and Vps4, the results presented here provide a molecular mechanism for how Vps21 regulates phagophore closure through ESCRT.

References 1. Chen YH, Wang GY, Hao HC et al (2017) Facile manipulation of protein localization in fission yeast through binding of GFP-binding protein to GFP. J Cell Sci 130(5):1003–1015 2. Chen X, Zaro JL, Shen WC (2013) Fusion protein linkers: property, design and functionality. Adv Drug Deliv Rev 65(10):1357–1369 3. Rothbauer U, Zolghadr K, Muyldermans S et al (2008) A versatile nanotrap for biochemical and functional studies with fluorescent fusion proteins. Mol Cell Proteomics 7 (2):282–289 4. Huh WK, Falvo JV, Gerke LC et al (2003) Global analysis of protein localization in budding yeast. Nature 425(6959):686–691 5. Chen Y, Zhou F, Zou S et al (2014) A Vps21 endocytic module regulates autophagy. Mol Biol Cell 25(20):3166–3177

6. Zhou F, Wu Z, Zhao M et al (2019) Autophagosome closure by ESCRT: Vps21/RAB5regulated ESCRT recruitment via an Atg17Snf7 interaction. Autophagy 15 (9):1653–1654 7. Gnu¨gge R, Rudolf F (2017) Saccharomyces cerevisiae shuttle vectors. Yeast 34(5):205–221 8. Kunes S, Botstein D, Fox MS (1985) Transformation of yeast with linearized plasmid DNA. Formation of inverted dimers and recombinant plasmid products. J Mol Biol 184(3):375–387 9. Gietz RD, Schiestl RH (2007) High-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method. Nat Protoc 2(1):31–34 10. Yamasaki A, Watanabe Y, Adachi W et al (2016) Structural basis for receptor-mediated selective autophagy of aminopeptidase I aggregates. Cell Rep 16(1):19–27

Chapter 13 Establishing Regulation of a Dynamic Process by Ypt/Rab GTPases: A Case for Cisternal Progression Jane J. Kim, Zanna Lipatova, and Nava Segev Abstract The prevailing model for transport within the Golgi is cisternal maturation. This process can be viewed as switching of cisternal markers using live-cell microscopy in yeast cells since the Golgi cisternae are separated, as opposed to the stacked Golgi seen in other organisms. It is also possible to determine which trafficking machinery components are required for this process by studying mutants depleted for these components. However, determining how cisternal maturation is regulated has been more challenging. The key for demonstrating regulation is not solely to stop the maturation when depleting a vesicular trafficking component, but also to illustrate a change in the speed. The obvious candidates for such regulation are the Ypt/Rab GTPases because of their established mode of action as regulators. Since the precise localization of the Golgi Ypts, Ypt1 and Ypt31, to specific Golgi cisternae has been controversial, we started by carefully colocalizing these Ypts with the Golgi cisternal markers using two independent approaches: immunofluorescence and live-cell microscopy. Next, the opposite effects of depletion versus constitutively activating Ypt mutations on Golgi morphology were determined. Finally, the ability of constitutively activating Ypt mutations to accelerate a specific cisternal-maturation step was established by live-cell timelapse microscopy. Using these approaches, we defined three dynamic Golgi cisternae, early, intermediate, and late, separated two independent steps of cisternal maturation and showed their regulation by two different Ypts. Here, we discuss the major principles and precautions needed for each phase of this research, the main point being definition of a new criterion for regulation of a dynamic process versus requirement of a machinery structural component: acceleration of the dynamics. Key words Golgi, cisternal progression, cisternal maturation, Ypt/Rab GTPases, Ypt1, Ypt31

1

Introduction For the last two decades, the two competing models of transporting cargo through the Golgi have been vesicular transport and cisternal progression/maturation. In the first model, vesicles move cargo through the Golgi cisternae, from cis, through medial, to trans. In the second model, cargo-containing Golgi cisternae mature, and this maturation is propelled by vesicles carrying resident proteins from a later cisterna [1, 2]. The most convincing

Guangpu Li and Nava Segev (eds.), Rab GTPases: Methods and Protocols, Methods in Molecular Biology, vol. 2293, https://doi.org/10.1007/978-1-0716-1346-7_13, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

189

190

Jane J. Kim et al.

evidence that transport through the Golgi moves forward by cisternal maturation has come from yeast [3, 4]. The reason is that, unlike in mammalian Golgi, the yeast Golgi cisternae are separated [5]. This allows for the ability to follow individual cisternae and visualize the switch of cisternal markers during time using live-cell microscopy. It has also been possible to show that depletion of a structural component of the retrograde transport machinery, Cop1, results in a block of this process [6, 7]. Our goal was to determine how this maturation is regulated. Importantly, we realized that to establish regulation, we need to show not only a requirement for a component based on phenotypes of inactivating mutations, as was done with Arf GTPase and cisternal progression [8]. We wished to also illustrate changes in the speed of the process in the presence of constitutively activating mutations. The obvious candidates for such regulation are the Ypt/Rab GTPases due to their inherent role as regulators of intracellular trafficking, and specifically those that function at the Golgi. The accepted mechanism of Ypt/Rabs activity is that when activated, they organize membrane subdomains by recruiting their multiple effectors, which include all the players required for a vesicular transport step [9–12]. Thus, Ypt/Rabs themselves are not structural components that mediate vesicle formation, mobility, tethering or fusion, but they “regulate” proteins that do that. As for the specific Ypts, while we identified Ypt1 and Ypt31 as the yeast Golgi Ypts based on mutation [5, 13–15] and localization analyses [16], their precise localization has been controversial [17, 18]. One reason for that is that it is problematic to precisely localize proteins that function in a dynamic pathway, especially if they can reside on multiple cisternae, as is the case with Ypt1 and Ypt31. Moreover, it turns out that individual cisternal markers used for the dynamic analysis can colocalize at different times with different markers. To address these problems, we started by carefully colocalizing cisternal markers with each other to define the early, middle, and late protein groups that mark cisternae, followed by docking the Ypts to them. This analysis yielded a clear localization of Ypt1 and Ypt31 to opposite sides of the Golgi, with partial colocalization in the middle compartment. We then studied opposite effects of depletion versus activating Ypt mutations on the static state of the Golgi, and the effect of the latter type of mutations on Golgi dynamics [19]. Here, we discuss the strategy and various phases of this project, summarize the major conclusions we could draw, provide information about available reagents and methods for further studies of the yeast Golgi, and suggest ways for studying other Ypt/Rabs in other dynamic processes.

Ypt Regulation of the Golgi Maturation

2

191

Project Strategy and Phases The strategy used for studying the role played by Ypt1 and Ypt31 in Golgi cisternal maturation is combining molecular genetics with advanced static and dynamic fluorescence microscopy. A general requirement for this project was to construct fluorescently tagged proteins, Golgi markers and Ypts, that are not only functional (see more details in Subheading 4) but also keep a strong fluorescence signal for the duration of the dynamic process we followed. The three sequential phases of the project were: (a) Establishing a dynamic map of Golgi cisternal markers; (b) Locking the Ypts to these markers, and (c) Studying the effect of Ypt mutations on the static and dynamic states of the Golgi. IIa. Establishing a dynamic map of Golgi cisternal markers. To be able to study the Golgi Ypts, we first had to choose markers of Golgi cisternae and establish their colocalization with each other. We chose two markers for early Golgi, Cop1 (a Golgi-to-ER vesicle coat subunit) and Vrg4 (an early Golgi membrane protein), and two markers for late Golgi, Sec7 (an Arf nucleotide exchanger) and Chc1 (a trans-Golgi vesicle coat subunit) [3, 4]. For each marker, the endogenous protein was tagged at the C-terminus with green and red fluorescent moieties and pairwise colocalization was determined using live-cell fluorescence microscopy. In agreement with the nature of the markers, quantification of the green puncta showed that while Vrg4 and Sec7 formed 6-7 puncta per cell, there were about twofold more puncta of the vesicle-coat subunits Cop1 and Chc1, ~13-14 per cell. Colocalization of each pair showed that only half of the coat puncta colocalized with the other markers, implying that the rest of the puncta represent separate cisternae and/or vesicles. IIb. Locking the Ypts to these markers. Ypt1 and Ypt31 tagged on the N-termini with a green or yellow fluorescent moiety gave good signal and were fully functional as confirmed by conferring cell viability when expressed as a sole copy (when tagged with mCherry, the Ypts were not fully functional). These Ypts were used for colocalization with the Golgi markers tagged with red moieties. Because the fluorescence intensity of Vrg4 with red protein tags was too low for our analyses, we continued with the three Golgi markers that gave good red signals: Cop1, Sec7, and Chc1. In addition to live-cell microscopy, we also employed two-color immunofluorescence (IF) microscopy using antibodies specific for Ypt1 and Ypt31 [19]. Finally, the Ypts were colocalized with each other and with the red markers using three-color IF microscopy. IIc. Studying the effect of Ypt mutations on the static and dynamic states of the Golgi. Here, we studied the effects of two different kinds of Ypt mutations, depletion and activation, on the static state of the Golgi and the effect of constitutively activating

192

Jane J. Kim et al.

Ypt mutations on Golgi dynamics. Specifically, we studied: (1) the effect of depletion mutants on Golgi static state. Here the limitation is that a depletion effect can establish requirement, and not necessarily regulation; (2) the effect of Ypt activation on the static state of the Golgi. This was done by increasing the protein levels of constitutively active Ypts using overexpression; and (3) the effect of overexpressed constitutively activating mutations on Golgi dynamics. Here we could establish acceleration of a Golgi maturation step by each Ypt.

3

Major Outcomes The major conclusions we drew based on results obtained from the experiments described above are (a) defining three dynamic Golgi compartment; (b) localization of Ypt1 and Ypt31 to opposite sides of the Golgi; and (c) separation of two Ypt-dependent steps of cisternal maturation. IIIa. Defining three dynamic Golgi compartment: early, transitional, and late. We observed ~80–90% colocalization between the two early and the two late Golgi markers. However, ~10–15% of early and late markers also colocalized. We concluded that the colocalization of early and late markers happen on a middle compartment and is transitional (Fig. 1a). We did not use the terms cis, medial, and trans, because these terms were originally defined based on specific cargo modifications that occur in each cisterna [20]. We did not have a specific marker for the middle compartment, but instead it is where early and late markers partially colocalize. In addition, the two Golgi Ypts also overlap on this compartment transiently. Support for the “transitional” nature of the middle compartment comes from different colocalization levels of the Ypts with different markers, the effect of Ypt mutations on colocalization of the markers, and the effect of activated Ypt1 and Ypt31 on maturation into and out of this compartment [19]. IIIb. Localization of Ypt1 and Ypt31 to opposite sides of the Golgi. The localization of Ypt1 and Ypt31 to early and late Golgi was supported by two independent approaches: live-cell and IF microscopy. In addition, ~25% Ypt1 and Ypt31 were colocalized with each other on the middle compartment (Fig. 1b). The finding that Ypt1 and Ypt31 transiently colocalize on the transitional compartment provides an explanation for the confusing localization results in the past. This settles the debate on the Golgi localization of Ypt1 and Ypt31 because it is supported by two independent approaches, and because the live-cell microscopy was done using fully functional and not overexpressed tagged Ypts. IIIc. Separation of two Ypt-dependent steps of cisternal maturation. The effects of depletion and constitutively active Ypts on the static and dynamic states of the Golgi showed that Ypt1 and Ypt31

Ypt Regulation of the Golgi Maturation

a

193

b

Fig. 1 Colocalization of cisternal markers and the Golgi Ypts. (a) Golgi cisternal markers. Cop1 is present as independent puncta representing early Golgi and Golgi-to-ER vesicles and colocalizes with Vrg1 on early Golgi. Chc1 is present as independent puncta representing late Golgi and late-Golgi vesicles, and colocalizes with Sec7 on the late Golgi. About 10–15% of early and late Golgi markers colocalize transiently on a middle compartment we termed transitional. (b) Ypt colocalization with cisternal markers and each other. Using two independent approaches, IF and live-cell fluorescence microscopy, we showed that Ypt1 and Ypt31 localize to the two opposite sides of the Golgi, early and late, respectively. In addition, using three-color IF, we showed that ~25% of Ypt1 and Ypt31 colocalize with each other on the transitional compartment (Sec7)

regulate two successive Golgi cisternal maturation steps, early-totransitional and transitional-to-late, respectively. When looking at the effects of Ypt1 mutations on the static state of the Golgi, while a depletion mutation resulted in an increase in the number of Cop1 puncta that do not colocalize with Sec7, an activating mutation rendered the opposite effect, an increase in Cop1 and Sec7 colocalization (Fig. 2a, b, left). When looking at the effects of Ypt31 on Golgi morphology, a depletion mutation resulted in less Sec7-Chc1 puncta, while an activating mutation caused more Chc1 puncta that do not colocalize with Sec7 (Fig. 2a, b, right). When looking at the effects of constitutively activating mutations on Golgi dynamics, activated Ypt1 accelerated the Cop1 to Sec7 transition, whereas activated Ypt31 accelerated the Sec7 to Chc1 transition (Fig. 2c). Importantly, the effects on the steps were specific to the particular Ypt. In both steps, the acceleration caused by the constitutively activated protein was about 2.5-fold. Specifically, when looking at the time gap of 50% increase in intensity for each maker: Early (Cop1) to transitional (Sec7) ~20 s; the rate with constitutively active Ypt1 (and not Ypt31) was increased by ~2.5fold. The second step, transitional (Sec7) to late (Chc1) was ~10 s; the rate with constitutively active Ypt31 (and not Ypt1) was increased by 2.5-fold.

194

Jane J. Kim et al.

a

b

c

Fig. 2 Using Ypt mutations to determine regulation of Golgi cisternal maturation. (a) Effect of Ypt depletion on the Golgi. Depletion of Ypt1 resulted in a higher number of the Cop1 puncta representing early Golgi and vesicles. Depletion of Ypt31 resulted in less Sec7-Chc1 puncta representing late Golgi. (b) Effect of Ypt activation on the Golgi. Increase in Ypt1 function resulted in more Cop1-Sec7 puncta whereas activation of Ypt31 resulted in more Chc1 puncta representing late Golgi and late-Golgi-derived vesicles. (c) Effect of Ypt activation on Golgi dynamics. Maturation of early-to-transitional, as seen by the gap between arrival of Sec7 to Cop1 puncta, takes ~20 s, and happens 2.5-fold faster when Ypt1 (but not Ypt31) is constitutively active (left). Maturation of transitional-to-late, as seen by the gap between arrival of Chc1 to Sec7 puncta, takes ~10 s, and happens 2.5-fold faster when Ypt31 (but not Ypt1) is constitutively active (right)

Ypt Regulation of the Golgi Maturation

4

195

Reagents, Methods and Precautions for Studying the Yeast Golgi Ypts Here, we detail (a) Reagents and (b) Methods, including precautions we took when planning and performing the experiments. IVa. Reagents. All the specifics of the reagents are detailed in the Supplementary Information of the paper reporting this study [19]. These include yeast strains, plasmids, and antibodies. Yeast strains used for visualizing Golgi cisternal markers were tagged in their endogenous loci at the C-terminus with red and green fluorescent moieties. To ascertain functionality, endogenous proteins were tagged when possible with yeast optimized fluorescent tags [21]. We reasoned that this is especially important when tagging proteins at their N-termini. In addition, the level of each tagged protein was determined using immunoblot analysis to ensure a similar to endogenous expression without major degradation or aggregation when tagged. Moreover, each yeast strain containing the tagged protein was checked to ensure there was no temperature sensitivity at 37  C. Plasmids used for tagged Ypts: Tagging Ypts with a GFP/YFP: Because Ypt/Rabs attach to membranes via a lipid modification at their C-termini, the tag was added to the N-termini of the Ypts. The Ypts were expressed from CEN (centromere) plasmids under their own promoters and terminators for achieving as close to endogenous levels of expression as possible. The ability of these constructs to allow cell viability as a sole copy was tested over the null using a 5FOA plate assay [22]. We also confirmed that the constructs do not confer temperature sensitivity. Types of Ypt mutations: Because Ypt1 and at least one of the Ypt31/32 pair are essential for viability, the loss-of-function mutations that we used were conditional, temperature-sensitive alleles: ypt1ts and ypt31Δ/ypt32ts. The mutation that renders the temperature sensitivity is a change of a conserved amino acid (ypt1-A136D, and ypt32-A141D in the background of ypt31Δ) [13, 14]. The mutation rendering dominant constitutively active Ypts is also a change in a conserved amino acid in one of the GTP-binding motifs (YPT1Q67L and YPT31-Q72L) [23]. The glutamine in this position interacts with the nucleophilic water required for the GTP hydrolysis reaction in all Ras-like GTPases [24]. Replacement of this glutamine with leucine results in a GTP-hydrolysis defect that renders a constitutively active Ypt/Rab [23]. For studying the effect of Ypt activation, we compared the wild-type Ypt expressed under its own promoter and terminator from a CEN (low-copy) plasmid, constitutively active Ypt from the same plasmid, and constitutively active Ypt from a 2 μ (high copy) plasmid. IVb. Methods. All the methods are detailed in the paper reporting this project [19]. Here we will highlight precautions we found important for increasing the chances for success, especially when

196

Jane J. Kim et al.

studying dynamic proteins. A general recommendation is not to use overexpressed proteins for localization analyses, because their localization might not be precise. When tagging proteins, it is preferable to tag endogenous copies when possible, or to express them from a low copy centromere plasmid using the protein’s own promoter and terminator. In our studies, for most protein pairs, the red and green tags were swapped between the markers to further ensure that the localization result was not affected by the specific fluorescent tag. More specific precautions we took for successful localization of the tagged Ypts include: First, ensuring that the tagged Ypt is fully functional over the null. We showed that partially functional Ypt1, which can complement a conditional mutant but not the null, does not localize properly (Fig. S1 in [19]). Second, using two independent approaches. In our study we quantified results from IF and live-cell microscopy and confirmed that they are similar. Third, for the effect of Ypts on cisternal maturation, comparing the effect of two opposing mutations, depletion and activating, and testing two types of effects on the Golgi, its static state and dynamics. The final picture is supported by the effects of both types of mutations. The fact that the effects of Ypt1 and Ypt31 mutations are specific served as control for each other while establishing two separate cisternal maturation steps.

5

Suggestions for Studying Regulation of Dynamic Processes by Ypt/Rabs Here we will discuss the need for clear localization of the Ypt/Rabs to the proposed site of action, the approaches for achieving such clear localization, using more than one approach for ensuring meaningful outcomes, and the use of constitutively active Ypt/Rabs when establishing regulation. It is crucial to show that the Ypt/Rabs reside where they function. Localizing Ypt/Rabs has been especially challenging in mammalian cells and even in yeast. This stems from the fact that both the compartmental markers and the Ypt/Rabs reside on more than one compartment at different times. Another factor that can contribute to confounding results is following proteins that are not fully functional and/or overexpressed. In our case, we found that it was crucial to use only fully functional proteins and express them closely to their endogenous levels for getting meaningful localization. Getting similar localization results when using two independent approaches, IF and live-cell microscopy, is desirable. Importantly, to study a dynamic process, the fluorescently tagged Ypt/Rabs and the compartmental markers need to have a strong enough signal to last throughout the duration of the timelapse process allowing multiple exposures for good resolution (we used about 60 exposures over approximately 2 min in our

Ypt Regulation of the Golgi Maturation

197

experiments). The intensity of the signal, which defines the speed of image capture and length of each time-lapse movie, depends on the tag, protein, and microscope assembly, and needs to be established in the beginning of the project. Furthermore, data obtained through time-lapse microscopy requires post-image capture analysis to ensure the signal photobleaching correction, if needed, and adjustments to reduce noise, improve contrast, and improve resolution. These post-imaging modifications depend again on the microscope assembly and the software used to produce the image or video. In addition, to study the effect of Ypt/Rab mutations, we recommend using two independent approaches by studying effects on the Golgi static and dynamic states. Moreover, we recommend using two opposing types of mutations, loss-of-function and constitutively activating, to see complementary effects. Finally, we argue that a good criterion for establishing a regulatory role versus a requirement of a structural component for a process, is showing a change (especially acceleration) in the rate of the process under investigation. A complete or partial loss-of-function mutation in either a structural or a regulatory component can lead to a complete or partial slowing of the process, respectively. For example, depletion of the structural component Cop1 (a vesicle coat subunit), results in an arrest of Golgi cisternal progression [6, 7]. Similarly, partial depletion of Ypt1 and Ypt31, established regulators because they recruit their effectors to mediate vesicular transport [25], slows transport [13, 14] and affects the static state of the Golgi [19]. Conversely, constitutively activating mutations in regulatory components may drive a process at a faster rate, as we showed for Ypt1 and Ypt31 in Golgi maturation. We propose the ability of constitutively activating mutations to increase the rate of a process be a criterion for establishing a regulatory role in a dynamic process. Luckily, activated Ypt/Rab mutations are well established [24], and can be used for such a purpose. Titrating the level of constitutively active Ypt/Rabs and showing correlating increased effects is persuasive. We also recommend showing specificity of the Ypt/Rab effect on the regulation in question.

Acknowledgments We thank Alison Adams for critical reading of the manuscript. This research was supported by grants GM-45444 from the National Institute of General Medical Sciences (NIGMS), and NS-099556 from the National Institute of Neurological Disorders and Stroke (NINDS) to N. Segev.

198

Jane J. Kim et al.

References 1. Glick BS, Luini A (2011) Models for Golgi traffic: a critical assessment. Cold Spring Harb Perspect Biol 3(11):a005215. https://doi. org/10.1101/cshperspect.a005215 2. Mironov AA, Beznoussenko GV, Polishchuk RS, Trucco A (2005) Intra-Golgi transport: a way to a new paradigm? Biochim Biophys Acta 1744(3):340–350. https://doi.org/10.1016/ j.bbamcr.2005.03.005 3. Losev E, Reinke CA, Jellen J, Strongin DE, Bevis BJ, Glick BS (2006) Golgi maturation visualized in living yeast. Nature 441 (7096):1002–1006. https://doi.org/10. 1038/nature04717 4. Matsuura-Tokita K, Takeuchi M, Ichihara A, Mikuriya K, Nakano A (2006) Live imaging of yeast Golgi cisternal maturation. Nature 441(7096):1007–1010. https://doi.org/10. 1038/nature04737 5. Segev N, Mulholland J, Botstein D (1988) The yeast GTP-binding YPT1 protein and a mammalian counterpart are associated with the secretion machinery. Cell 52(6):915–924. https://doi.org/10.1016/0092-8674(88) 90433-3 6. Ishii M, Suda Y, Kurokawa K, Nakano A (2016) COPI is essential for Golgi cisternal maturation and dynamics. J Cell Sci 129 (17):3251–3261. https://doi.org/10.1242/ jcs.193367 7. Papanikou E, Day KJ, Austin J, Glick BS (2015) COPI selectively drives maturation of the early Golgi. eLife 4:e13232. https://doi. org/10.7554/eLife.13232 8. Bhave M, Papanikou E, Iyer P, Pandya K, Jain BK, Ganguly A et al (2014) Golgi enlargement in Arf-depleted yeast cells is due to altered dynamics of cisternal maturation. J Cell Sci 127(Pt 1):250–257. https://doi.org/10. 1242/jcs.140996 9. Pfeffer SR (2013) Rab GTPase regulation of membrane identity. Curr Opin Cell Biol 25 (4):414–419. https://doi.org/10.1016/j. ceb.2013.04.002 10. Segev N (2001) Ypt and Rab GTPases: insight into functions through novel interactions. Curr Opin Cell Biol 13(4):500–511. https://doi. org/10.1016/s0955-0674(00)00242-8 11. Segev N (2011) GTPases in intracellular trafficking: an overview. Semin Cell Dev Biol 22 (1):1–2. https://doi.org/10.1016/j.semcdb. 2010.12.004 12. Zerial M, McBride H (2001) Rab proteins as membrane organizers. Nat Rev Mol Cell Biol 2

(2):107–117. https://doi.org/10.1038/ 35052055 13. Jedd G, Mulholland J, Segev N (1997) Two new Ypt GTPases are required for exit from the yeast trans-Golgi compartment. J Cell Biol 137 (3):563–580. https://doi.org/10.1083/jcb. 137.3.563 14. Jedd G, Richardson C, Litt R, Segev N (1995) The Ypt1 GTPase is essential for the first two steps of the yeast secretory pathway. J Cell Biol 131(3):583–590. https://doi.org/10.1083/ jcb.131.3.583 15. Lipatova Z, Segev N (2019) Ypt/Rab GTPases and their TRAPP GEFs at the Golgi. FEBS Lett 593(17):2488–2500. https://doi.org/ 10.1002/1873-3468.13574 16. Morozova N, Liang Y, Tokarev AA, Chen SH, Cox R, Andrejic J et al (2006) TRAPPII subunits are required for the specificity switch of a Ypt-Rab GEF. Nat Cell Biol 8 (11):1263–1269. https://doi.org/10.1038/ ncb1489 17. Cai H, Reinisch K, Ferro-Novick S (2007) Coats, tethers, Rabs, and SNAREs work together to mediate the intracellular destination of a transport vesicle. Dev Cell 12 (5):671–682. https://doi.org/10.1016/j. devcel.2007.04.005 18. Sclafani A, Chen S, Rivera-Molina F, Reinisch K, Novick P, Ferro-Novick S (2010) Establishing a role for the GTPase Ypt1p at the late Golgi. Traffic 11(4):520–532. https://doi. org/10.1111/j.1600-0854.2010.01031.x 19. Kim JJ, Lipatova Z, Majumdar U, Segev N (2016) Regulation of Golgi Cisternal progression by Ypt/Rab GTPases. Dev Cell 36 (4):440–452. https://doi.org/10.1016/j. devcel.2016.01.016 20. Franzusoff A, Schekman R (1989) Functional compartments of the yeast Golgi apparatus are defined by the sec7 mutation. EMBO J 8 (9):2695–2702 21. Sheff MA, Thorn KS (2004) Optimized cassettes for fluorescent protein tagging in Saccharomyces cerevisiae. Yeast 21(8):661–670. https://doi.org/10.1002/yea.1130 22. Widlund PO, Davis TN (2005) A highefficiency method to replace essential genes with mutant alleles in yeast. Yeast 22 (10):769–774. https://doi.org/10.1002/yea. 1244 23. Richardson CJ, Jones S, Litt RJ, Segev N (1998) GTP hydrolysis is not important for Ypt1 GTPase function in vesicular transport.

Ypt Regulation of the Golgi Maturation Mol Cell Biol 18(2):827–838. https://doi. org/10.1128/mcb.18.2.827 24. Li G, Zhang XC (2004) GTP hydrolysis mechanism of Ras-like GTPases. J Mol Biol 340 (5):921–932. https://doi.org/10.1016/j. jmb.2004.06.007

199

25. Lipatova Z, Hain AU, Nazarko VY, Segev N (2015) Ypt/Rab GTPases: principles learned from yeast. Crit Rev Biochem Mol Biol 50 (3):203–211. https://doi.org/10.3109/ 10409238.2015.1014023

Chapter 14 Methods for Assessing the Regulation of a Kinase by the Rab GTPase Ypt1 Juan Wang, Shensen Wang, and Susan Ferro-Novick Abstract COPII coated vesicles that bud from the endoplasmic reticulum (ER) normally traffic to the Golgi. However, during starvation, COPII vesicles are redirected to the macroautophagy pathway where they become a membrane source for autophagosomes. Phosphorylation of the coat by the casein kinase 1 (CK1), Hrr25, is a prerequisite for vesicle uncoating and membrane fusion. CK1 family members were initially thought to be constitutively active kinases that are regulated through their subcellular localization. Recent studies, however, have shown that the Rab GTPase Ypt1 binds to and activates Hrr25 (CK1δ in mammals) to spatially regulate its kinase activity. Consistent with a direct role for Hrr25 in macroautophagy, hrr25and ypt1mutants are defective in autophagosome biogenesis. These studies have provided insights into how the itinerary of COPII vesicles is coordinated on two different trafficking pathways. Key words Rab GTPase, Ypt1, Casein kinase, Hrr25, Vesicle traffic

1

Introduction ER-Golgi transport vesicles bud from the ER upon the hierarchical assembly of the COPII coat [1, 2]. The COPII coat is formed when the activated form of the GTPase Sar1 (Sar1-GTP) recruits the cargo adaptor complex, Sec23-Sec24, that sorts cargo into the vesicle. Sec23-Sec24 then recruits the coat outer shell, Sec13Sec31 [1, 2]. After cargo packaging and vesicle scission, COPII vesicles are transported to the Golgi. The directional delivery of ER-derived vesicles to the Golgi is controlled by the sequential interactions of the COPII coat subunit Sec23 and three of its binding partners: Sar1-GTP, TRAPPI and Hrr25 [3]. TRAPPI is aguanine nucleotide exchange factor (GEF) that activates the GTPase Ypt1 [4], and Hrr25 is a CK1 kinase family member [5]. The fidelity of vesicle traffic requires Rab GTPases and their effectors [6]. There are 11 Rabs in yeast (called Ypt) and over 60 Rabs in mammalian cells that regulate a variety of membrane

Guangpu Li and Nava Segev (eds.), Rab GTPases: Methods and Protocols, Methods in Molecular Biology, vol. 2293, https://doi.org/10.1007/978-1-0716-1346-7_14, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

201

202

Juan Wang et al.

Fig. 1 Hrr25 kinase activity is regulated by the Rab GTPase Ypt1. (1) After Sar1 is released from the vesicle, TRAPPI binds to Sec23 and activates (2) Ypt1. (3) Ypt1-GTP then recruits its effectors Hrr25 and the tether (Uso1) that links the vesicle to the Golgi. (4) Activated Hrr25 then phosphorylates the vesicle-bound coat

trafficking steps [7]. Ypt1 and its mammalian homolog Rab1 function in ER to Golgi traffic, intra-Golgi traffic and macroautophagy (herein called autophagy) [4, 8]. The phosphorylation of multiple COPII coat subunits by Hrr25 is a prerequisite for vesicle uncoating and the pairing of the fusion machinery (SNAREs) on the vesicle and target membrane (Fig. 1) [3, 9]. When autophagy is induced, COPII vesicles are diverted to the preautophagosomal structure (PAS) where they contribute membrane for autophagosome biogenesis [10, 11]. Hrr25 phosphorylates the membrane distal surface of Sec24, which enables this COPII coat subunit to bind to Atg9, a transmembrane protein required for autophagosome initiation [12]. Here we present the methods used in Wang et al. (2015) that address how Hrr25 specifically phosphorylates the vesicle–borne pool of the COPII coat on two different pathways: ER-Golgi and autophagy [13]. These methods also address how Wang et al. (2015) showed that Hrr25 is an effector of Ypt1 [13]. Ypt1 directly recruits Hrr25 to COPII vesicles to activate it. This was the first report that the activity of a CK1 family member is regulated by a Rab GTPase.

2 2.1

Materials Culture Media

1. You should use several different types of growth medium for these studies. For growth in rich medium, (YPD): 1% yeast extract, 2% peptone, and 2% dextrose or synthetic minimal media (SMD): 0.67% yeast nitrogen base, 2% dextrose and auxotrophic amino acids as needed. For solid media, agar is added to a final concentration of 2%.

Methods for Assessing the Regulation of a Kinase by the Rab GTPase Ypt1

203

2. You should induce autophagy by starving cells in synthetic minimal medium lacking nitrogen (SD-N)): 0.17% yeast nitrogen base without amino acids and ammonium sulfate, and 2% dextrose. 2.2

Solutions

1. Bacterial lysis buffer 1: 20 mM Tris pH 8, 150 mM NaCl, 1 mM DTT, 1 mM PMSF, and 15 mM imidazole. 2. Bacterial lysis buffer 2: 1
PBS, 1 mM PMSF, and 1 mM DTT. 3. Elution buffer: 20 mM Tris pH 8, 150 mM NaCl, 1 mM DTT, 1 mM PMSF, and 250 mM Imidazole. 4. Binding buffer: 50 mM HEPES pH 7.2, 150 mM NaCl, 1 mM DTT, 1 mM EDTA, 2% Triton X-100, and 5
protease inhibitor cocktail (PIC) from Roche. 5. SDS sample buffer: 50 mM Tris–HCl pH 6.8, 2% SDS, 10% glycerol, 1% β-mercaptoethanol, 12.5 mM EDTA, and 0.02% bromophenol blue. 6. Yeast lysis buffer 1: 1
PBS, 200 mM sorbitol, 1 mM MgCl2, 0.1% Tween 20, and PIC. 7. Spheroplast buffer:1.4 M sorbitol, 10 mM Na azide, 50 mM KPi, pH 7.5, 0.35% β-mercaptoethanol, and 1 mg zymolase. 8. Sorbitol cushion: 1.7 M sorbitol, and 100 mM HEPES, pH 7.4. 9. Yeast lysis buffer 2: 100 mM HEPES, pH 7.2, 1 mM EGTA, 0.2 mM DTT, 1 mM PMSF, and PIC. 10. Tris–HCl buffer: 50 mM Tris–HCl pH 7.4, 100 mM NaCl. 11. Immunoprecipitation buffer: 50 mM Tris–HCl pH 7.4, 100 mM NaCl, 5 mM EDTA, 1 mM PMSF, and PIC. 12. Mammalian lysis buffer: 100 mM HEPES buffer pH 7.2, 1 mM EDTA, 0.2 mM DTT, 5
PIC, 5
phosphatase inhibitor cocktail. 13. Kinase buffer: 50 mM HEPES, pH 7.4, 5 mM MgCl2, 0.2% Nonidet P-40, and 1 mM DTT.

2.3

Reagents

1. Ni-NTA Agarose. 2. Glutathione-Sepharose beads. 3. Spin column with a cutoff filter of 10 kDa. 4. Nitrocellulose membranes. 5. Anti-His antibody. 6. Anti-HA antibody. 7. Anti-rabbit IgG. 8. Anti-mouse IgG. 9. HA affinity matrix. 10. Enhanced chemiluminescence (ECL) detection kit.

204

Juan Wang et al.

11. QuickChange site-directed mutagenesis kit (Stratagene). 12. shRNA expression vector pSilencer 1.0-U6 (Ambion). 13. Transfection reagents: Opti-MEM (Invitrogen) and Lipofectamine 2000 (Life Technologies).

3

Methods

3.1 An In Vitro Binding Assay for Rab1A and CK1δ (Mammalian Homologue of Hrr25)

3.1.1 Purification of Recombinant His6-Rab1A Q70L and His6-Rab1A S25N

To address if CK1δ is an effector of Rab1A, you should test the interaction between CK1δ and Rab1A (GTP or GDP-locked form). Purified recombinant GST-CK1δ is incubated with His6Rab1A Q70L (GTP- locked form) and His6-Rab1A S25N (GDPlocked form). GST-CK1δ should bind to Rab1A Q70L, but not Rab1A S25N. 1. You can use human Rab1A cloned into the pET-15b vector. Q70L and S25N point mutations are made using the QuickChange site-directed mutagenesis kit. His6-Rab1A expressing plasmids are transformed into Rosetta (DE3) cells. 2. A single colony is inoculated in 50 mL of LB medium with 100 μg/mL ampicillin and grown overnight at 37  C. 3. An overnight culture is inoculated into 1 L of LB medium containing 100 μg/mL ampicillin to a starting OD600 of approximately 0.1 and grown at 37  C. When the OD600 reaches 0.6, filter sterilized IPTG is added to a final concentration of 0.5 mM. His6-Rab1A Q70L and His6-Rab1A S25N expression is induced overnight at 20  C. 4. Cells are centrifuged at 6000
g for 5 min and resuspended in 20 mL of bacterial lysis buffer 1. 5. The cells are sonicated eight times for 15 s intervals at 50% amplitude. 6. The sample is centrifuged at 12,000
g for 15 min at 4  C. 7. The cleared lysate is transferred into a fresh 50 mL tube. Prewashed 2 mL Ni-NTA agarose beads are added and incubated at 4  C with rotation (20 rpm) for 30 min (see Note 1). 8. The slurry of Ni-NTA beads and lysate is loaded onto a 0.8
12 cm polypropylene column and washed with 20 mL of bacterial lysis buffer 1. 9. The bound protein is eluted with 8 mL of elution buffer. 10. A spin column, containing a cut-off filter of 10 kDa, is used to concentrate the eluate to approximately 0.5 mL. 11. Purified His6-Rab1A is analyzed on a 13% SDS-PAGE gel and stained with Coomassie Brilliant Blue. The protein concentration is measured using BSA as a standard and analyzed using AlphaView software.

Methods for Assessing the Regulation of a Kinase by the Rab GTPase Ypt1 3.1.2 Purification of Glutathione-Sepharose Beads Containing GST and GST Fusion Proteins

205

1. A single colony is inoculated in 50 mL of LB medium with 100 μg/mL ampicillin and incubated overnight at 37  C. 2. An overnight culture is inoculated into 1 L of LB medium with 100 μg/mL ampicillin at 37  C with a starting OD600 of approximately 0.1. When the OD600 reaches 0.6, IPTG is added to a final concentration of 0.5 mM to induce the expression of GST and GST fusion proteins during an overnight incubation at 20  C. 3. Cells are centrifuged at 6000
g for 10 min and resuspended in 20 mL of bacterial lysis buffer 2. 4. The suspension is sonicated at 50% amplitude for eight times with 15 s intervals. 5. Triton X-100 is added to the sample to a final concentration of 1%. 6. The sample is centrifuged at 12,000
g for 15 min. 7. The cleared lysate is transferred into a fresh 50 mL tube. Prewashed glutathione-sepharose beads (1 mL) are added and incubated at 4  C with rotation (20 rpm) for 30 min (see Note 2). 8. The beads are centrifuged at 500
g for 2 min and washed three times with 10 mL of PBS. 9. SDS-PAGE sample buffer (50 μL) is added to the glutathioneSepharose beads. The bound proteins are analyzed on an 8% SDS-PAGE gel and stained with Coomassie Brilliant Blue. The protein concentration of GST and GST fusion proteins are measured using BSA as a standard and analyzed using AlphaView software.

3.1.3 In Vitro Binding Assay with GST- CK1δ and His6-Rab1A (Q70L and S25N)

1. For these studies, you can clone human CK1δ into plasmid pGEX-4T-2. The plasmid is transformed into BL21(DE3) cells to express GST-CK1δ. Varying concentrations of His6-Rab1A (Q70L or S25N) (examples include 125 nM, 250 nM, 500 nM, and 1000 nM) are incubated with equimolar amounts (0.1 μM) of immobilized GST or GST-CK1δ in a total volume of 500 μL of binding buffer for 3 h at 4  C with rotation (20 rpm) (see Notes 3 and 4). 2. The beads are washed three times with 1 mL of binding buffer without protease inhibitors. 3. The beads are resuspended in 50 μL of SDS-PAGE sample buffer and heated at 100  C for 5 min. 4. The eluate is fractionated on a 13% SDS-PAGE gel and transferred onto nitrocellulose membranes in transfer buffer. 5. The membranes are blocked with blocking solution for 1 h.

206

Juan Wang et al.

6. Anti-His antibody is added to the membranes and incubated at 4  C overnight. 7. The membranes are washed three times with 10 mL of the TBST buffer. 8. Anti-mouse IgG (1:10000 dilution) is added and incubated for 1 h. 9. The membranes are washed three times with 10 mL of TBST buffer and then analyzed using the ECL method. 3.2 Differential Centrifugation Can Be Used to Assess if Ypt1 and Rab1 Regulate the Recruitment of Hrr25 and CK1δ to Membranes

You can address the effect of Ypt1 on the membrane distribution of Hrr25 in yeast in vivo. The membrane distribution of Hrr25 can be examined in the temperature-sensitive ypt1-3 mutant. In mammalian cells, the distribution of CK1δ can be monitored in Rab1A knockdown HeLa cells. WT and ypt1-3 mutant yeast cells are incubated for 1 h at 37  C before cell lysates are fractionated by differential centrifugation into soluble and insoluble fractions. A significant increase in the soluble pool of Hrr25 can be observed in the ypt1-3 mutant. A reproducible increase in the soluble pool of CK1δ can also be seen in Rab1A depleted HeLa cells.

3.2.1 Examining the Membrane Distribution of Hrr25 in WT and the ypt1-3 Mutant

1. WT and ypt1-3 cells are grown in YPD at 25  C and then shifted to 37  C for 1 h. 2. Eighty OD600 units of cells are harvested at 1500
g for 3 min and converted to spheroplasts in 2 mL of spheroplast buffer. 3. Spheroplasts are formed during a 45 min incubation at 37  C, then spun at 1500
g for 5 min through a 2 mL sorbitol cushion. 4. The pellet is resuspended in 1 mL of yeast lysis buffer 2 and lysed with a Dounce homogenizer. 5. The lysate is spun at 500
g for 2 min and the supernatant (100 μL) is mixed with 50 μL of 3
sample buffer (total fraction) and heated to 100  C for 5 min. 6. The remaining portion (500 μL) is centrifuged at 190,000
g for 90 min at 4  C. The lipid layer is removed and the supernatant (100 μL) is mixed with 50 μL of 3
sample buffer (supernatant fraction) and heated to 100  C for 5 min. 7. The pellet is resuspended in 500 μL of lysis buffer. Then, 100 μL is mixed with 50 μL of 3
sample buffer and heated to 100  C for 5 min (pellet fraction). 8. Western blot analysis is performed to detect Hrr25 in total lysates, supernatant and pellet fractions. Membrane and cytoplasmic proteins should be used to monitor the fractionation. The membrane protein Bos1 and cytoplasmic phosphoglycerate kinase 1 (Pgk1) are useful markers for this purpose in budding yeast.

Methods for Assessing the Regulation of a Kinase by the Rab GTPase Ypt1 3.2.2 The Distribution of CK1δ in HeLa Cells After Rab1A Depletion

207

Rab1A is efficiently knocked down (90%) in HeLa cells using shRab1A. The membrane distribution of CK1δ is analyzed using two different loading controls, a marker for the ER (Calnexin) and a cytoplasmic protein (GAPDH). 1. The shRab1A plasmid used to target human Rab1A, 392–410 (50 - AGAAAGTAGTAGACTACAC -30 ) is constructed in the shRNA expression vector pSilencer 1.0-U6. 2. HeLa cells (1.8
105/well) are seeded in 6-well plates 20 h before transfection. The cells are then transfected for 5 h in Opti-MEM with 2 μg DNA (pSilencer 1.0-U6 empty vector control or the shRab1a construct) in the presence of 5 μL Lipofectamine 2000 Transfection Reagent. 3. Four days after transfection, the cells are harvested, and washed twice with cold PBS. 4. The cells are lysed in cold mammalian lysis buffer and passed through a 25G needle 10 times using a syringe. 5. The lysate is spun at 500
g for 2 min and the supernatant (100 μL) is mixed with 50 μL of 3
sample buffer (total fraction) and heated to 100  C for 5 min. 6. The remaining portion is centrifuged at 150,000
g for 90 min at 4  C. The lipid layer is removed and the supernatant (100 μL) is mixed with 50 μL of 3
sample buffer (supernatant fraction) and heated to 100  C for 5 min. 7. The pellet is resuspended in 500 μL of lysis buffer and 100 μL is mixed with 50 μL of 3
sample buffer and heated to 100  C for 5 min (pellet fraction). 8. Western blot analysis is performed to detect CK1δ in the lysate, supernatant and pellet fractions.

3.3

Kinase Assays

3.3.1 Immunoprecipitation of Hrr25-HA from a Yeast Lysate

To ask if Ypt1 regulates Hrr25 kinase activity in yeast, Hrr25-HA can be immunoprecipitated from WT and ypt1-3 mutant cells, and kinase activity is measured in vitro using myelin basic protein (MBP) as a substrate. Although equal amounts of Hrr25-HA are precipitated with anti-HA antibody from both strains, the kinase activity of ypt1-3 is significantly lower compared to that of WT. 1. Wild type and ypt1-3 cells expressing Hrr25-HA are grown overnight in SC-URA medium to early log phase and shifted to 37  C for 2 h. Cells are collected by centrifugation at 500
g for 5 min and washed once with Tris–HCl buffer. 2. The washed cells are lysed in 0.5 mL of immunoprecipitation buffer and vortexed with glass beads. 3. The lysates are transferred to fresh tubes, and the remaining glass beads are washed twice with 0.5 mL of lysis buffer.

208

Juan Wang et al.

4. The washes and lysates are combined and Triton X-100 is added to the samples to a final concentration of 0.75%. The samples are incubated at 4  C on a nutator for 15 min and centrifuged at 10,000
g for 10 min. 5. Clarified lysates (2 mg) are incubated with 2 μg of anti-HA antibody (12CA5) for 2 h at 4  C. 6. Protein-A–conjugated agarose beads (20 μL) are added to the lysates and incubated for an additional 1.5 h (see Note 5). 7. The beads are washed twice with lysis buffer containing 0.75% of Triton X-100 and twice with kinase buffer. 3.3.2 Kinase Activity Assay

1. The purified Hrr25-HA beads (20 μL) are incubated at 30  C for 30 min with 2 μg of MBP, 100 μM ATP, and 5 μCi of 32P γATP in 50 μL of kinase buffer. 2. The reaction is terminated by the addition of 20 μL of 4
SDS sample buffer during a 5 min incubation at 95  C. 3. The reaction mixture is subjected to SDS/PAGE. The incorporation of radiolabeled 32P into MBP is determined by radioautography and the amount of immunopurified Hrr25-HA is determined by immunoblotting.

3.3.3 Purification of His6-Tagged Ypt1 Q67L and WT.

1. Ypt1 is cloned into the pET-29a plasmid and transformed into BL21(DE3) cells to express Ypt1-His6. The Q67L point mutation can be made using the QuickChange site-directed mutagenesis kit. His6-tagged Ypt1 (Q67L and WT) expressing plasmids are transformed into Rosetta (DE3) cells. 2. A single colony is inoculated into 50 mL of LB medium with 30 μg/mL kanamycin and incubated overnight at 37  C. 3. An overnight culture is inoculated into 1 liter of LB medium containing 30 μg/mL kanamycin at 37  C with a starting OD600 of approximately 0.1. When the OD600 reached 0.6, filter sterilized IPTG is added to a final concentration of 0.5 mM. Ypt1-His6 expression is induced overnight at 20  C. 4. Cells are centrifuged at 6000
g for 5 min and resuspended in 20 mL of bacterial lysis buffer 1. 5. The cells are sonicated for 15 s at 50% amplitude for a total of 2 min. 6. The samples are centrifuged at 12,000
g for 15 min at 4  C. 7. The cleared lysate is transferred into a fresh 50 mL tube. Prewashed 2 mL Ni-NTA agarose beads are added and incubated at 4  C with rotation (20 rpm) for 30 min (see Note 3). 8. The slurry of Ni-NTA beads and lysate is loaded onto a 0.8
12 cm polypropylene column and washed with 20 mL of bacterial lysis buffer 1.

Methods for Assessing the Regulation of a Kinase by the Rab GTPase Ypt1

209

9. The bound protein is eluted with 8 mL of elution buffer. 10. A spin column containing a cut-off filter of 10 kDa is used to concentrate the eluate to approximately 0.5 mL. 11. Purified Ypt1-His6 is analyzed on a 13% SDS-PAGE gel and stained with Coomassie Brilliant Blue. The protein concentration of Ypt1-His6 is measured using BSA as a standard and analyzed with AlphaView software. 3.3.4 Reconstitution Assays

1. The purified Hrr25-HA beads are preincubated with purified Ypt1-His6 (Q67L or wild type) in kinase buffer for 15 min at 25  C. 2. The purified Hrr25-HA beads and purified Ypt1-His6 (Q67L or wild type) protein are incubated at 30  C for 30 min with 2 μg of MBP, 100 μM ATP, and 5 μCi of 32P γATP in 50 μL of kinase buffer. 3. The reaction is terminated by the addition of 20 μL of 4
SDS sample buffer and incubated at 95  C for 5 min. The reaction mixture is then subjected to SDS/PAGE. 4.

3.4 The Analysis of Autophagosome Formation by Structured Illumination Microscopy (SIM)

32

P labeled MBP is determined by radioautography and the amount of immunopurified Hrr25-HA is determined by immunoblotting.

Structured illumination microscopy can be used to visualize the biogenesis of autophagosomes, marked by GFP-Atg8, in deconvolved images of WT, hrr25-5, and ypt1-3 mutant cells (see Note 6). 1. Wild type, hrr25-5 and ypt1-3 cells expressing GFP-Atg8 are cultured in SMD selective medium at 25  C to log phase. To mimic starvation, the cells are treated with rapamycin for 1 h at 37  C. 2. Cells are centrifuged at 1500
g for 2 min and approximately 2 μL of the cell pellet is examined on a slide. 3. Image acquisition of GFP-Atg8 is performed on an Applied Precision Delta Vison OMX Super Resolution System using a 100
1.4 NA oil-immersion objective and a Photometrics Evolve 512 EMCCD camera. 4. Images are taken and processed using Delta Vison OMX Master Control software and softWoRx reconstruction and analysis software. Autophagosome number is calculated from more than 300 cells in three separate experiments.

4

Notes 1. Prewash Ni-NTA agarose beads with 10 mL of bacterial lysis buffer 1 three times before use.

210

Juan Wang et al.

2. Prewash glutathione-Sepharose beads with 10 mL of bacterial lysis buffer 2 three times before use. 3. Use blank beads to ensure each binding reaction has equal amounts of beads. To make blank beads, glutathioneSepharose beads are treated with 1 mg/mL BSA for 30 min and washed three times with 10 mL of PBS. 4. Other Rabs, such as Rab2A and Rab4A, are used as controls for in vitro binding experiments with Rab1A and CK1δ. 5. The beads are preincubated with 10 mg/mL of BSA for 1 h before lysate is added. 6. Because Atg8 localizes to more than one structure, this analysis must be done in a ypt7Δ mutant background to ensure Atg8labeled puncta are autophagosomes.

Acknowledgments JW and SW received support from the National Natural Science Foundation of China (No. 91854115, No. 31970044 and No. 31771571). SF-N received support from the ALPHA-1 FO UNDATION and NIGMS under award numbers R01GM114111, R01GM115422, and R35GM131681. References 1. Lord C, Ferro-Novick S, Miller EA (2013) The highly conserved COPII coat complex sorts cargo from the endoplasmic reticulum and targets it to the Golgi. Cold Spring Harb Perspect Biol 5(2):a013367 2. Zanetti G, Pahuja KB, Studer S, Shim S, Schekman R (2011) COPII and the regulation of protein sorting in mammals. Nat Cell Biol 14 (1):20–28 3. Lord C, Bhandari D, Menon S, Ghassemian M, Nycz D, Hay J, Ghosh P, Ferro-Novick S (2011) Sequential interactions with Sec23 control the direction of vesicle traffic. Nature 473 (7346):181–186 4. Barrowman J, Bhandari D, Reinisch K, FerroNovick S (2010) TRAPP complexes in membrane traffic: convergence through a common Rab. Nat Rev Mol Cell Biol 11(11):759–763 5. Knippschild U, Gocht A, Wolff S, Huber N, Lohler J, Stoter M (2005) The casein kinase 1 family: participation in multiple cellular processes in eukaryotes. Cell Signal 17 (6):675–689 6. Grosshans BL, Ortiz D, Novick P (2006) Rabs and their effectors: achieving specificity in

membrane traffic. Proc Natl Acad Sci U S A 103(32):11821–11827 7. Pereira-Leal JB, Seabra MC (2001) Evolution of the Rab family of small GTP-binding proteins. J Mol Biol 313(4):889–901 8. Lynch-Day MA, Bhandari D, Menon S, Huang J, Cai H, Bartholomew CR, Brumell JH, Ferro-Novick S, Klionsky DJ (2010) Trs85 directs a Ypt1 GEF, TRAPPIII, to the phagophore to promote autophagy. Proc Natl Acad Sci U S A 107(17):7811–7816 9. Bhandari D, Zhang J, Menon S, Lord C, Chen S, Helm JR, Thorsen K, Corbett KD, Hay JC, Ferro-Novick S (2013) Sit4p/PP6 regulates ER-to-Golgi traffic by controlling the dephosphorylation of COPII coat subunits. Mol Biol Cell 24(17):2727–2738 10. Davis S, Wang J, Ferro-Novick S (2017) Crosstalk between the secretory and autophagy pathways regulates Autophagosome formation. Dev Cell 41(1):23–32 11. Shima T, Kirisako H, Nakatogawa H (2019) COPII vesicles contribute to autophagosomal membranes. J Cell Biol 218(5):1503–1510

Methods for Assessing the Regulation of a Kinase by the Rab GTPase Ypt1 12. Davis S, Wang J, Zhu M, Stahmer K, Lakshminarayan R, Ghassemian M, Jiang Y, Miller EA, Ferro-Novick S (2016) Sec24 phosphorylation regulates autophagosome abundance during nutrient deprivation. eLife 5: e21167

211

13. Wang J, Davis S, Menon S, Zhang J, Ding J, Cervantes S, Miller E, Jiang Y, Ferro-Novick S (2015) Ypt1/Rab1 regulates Hrr25/CK1delta kinase activity in ER-Golgi traffic and macroautophagy. J Cell Biol 210(2):273–285

Chapter 15 Qualitative and Quantitative Assessment of the Role of Endocytic Regulatory and/or Rab Proteins on Mitochondrial Fusion and Fission Trey Farmer and Steve Caplan Abstract Mitochondria are the major energy generating organelle in the cell; accordingly mitochondrial homeostasis is key to mitochondrial function. In recent years, new paradigms have uncovered roles for endocytic regulatory proteins in the control of mitochondrial fusion and fission, thus highlighting the utility of techniques for the study of mitochondrial morphology. Herein we detail methods to qualitatively and quantitatively measure the impact of select proteins on mitochondrial fusion and fission in human retinal pigmented epithelial (RPE1) cells. We demonstrate how commercially available small interfering RNA (siRNA) can be used to target various endocytic regulatory proteins, and freely available software can be used to evaluate the impact of these proteins on mitochondria by quantifying their effect on mitochondrial morphology. It is our goal to provide simple protocols that may prove useful for researchers new to the realm of endocytic regulatory proteins and mitochondrial homeostasis. Key words Mitochondria, Homeostasis, Fission/fusion, Endocytic regulatory proteins, ImageJ/ FIJI, Mito-Morphology plug-in

1

Introduction Mitochondria are responsible for generating ATP via oxidative phosphorylation, but they also play a role in various other cellular events, including but not limited to reactive oxygen species regulation [1], calcium signaling [2, 3], apoptosis [4], iron homeostasis [5, 6], and cellular aging [7, 8]. Mitochondrial homeostasis is a highly regulated process in which these dynamic organelles must continuously undergo sequential rounds of fission and fusion. Mitochondrial fission and fusion not only ensure that mitochondrial homeostasis is maintained but impact the overall health of the cell. Mitochondria are complex organelles comprised of an outer mitochondrial membrane (OMM), an inner mitochondrial membrane (IMM), and two mitochondrial compartments: the

Guangpu Li and Nava Segev (eds.), Rab GTPases: Methods and Protocols, Methods in Molecular Biology, vol. 2293, https://doi.org/10.1007/978-1-0716-1346-7_15, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

213

214

Trey Farmer and Steve Caplan

intermembrane space and the matrix. Under normal physiological conditions, the two membranes must constantly work together to facilitate serial rounds of fusion and fission, leading to a dynamic homeostatic system within the cell [9]. For fusion of two separate mitochondria, two independent fusion events must occur between opposing mitochondria. First, there is fusion between two OMM, and this is followed by fusion between the IMM. To date, three known mammalian GTPases have been identified that regulate mitochondrial fusion: Mitofusin-1 (Mfn1), Mitofusin-2 (Mfn2), and optic atrophy 1 (OPA1). Mfn1 and Mfn2 regulate OMM fusion, while the IMM fusion is controlled by OPA1. Mitochondrial fusion is crucial for mitochondrial health, and impaired fusion results in a lack of membrane potential, and ultimately, decreased ATP production [10]. Fusion is also vital for the successful transfer of mitochondrial proteins and mitochondrial DNA (mtDNA) to newly synthesized mitochondria, which helps prevent the accumulation of mtDNA mutations and promotes normal mitochondrial function [11]. Just as important as the regulators of mitochondrial fusion for homeostasis are the proteins that are responsible for mitochondrial membrane fission activity. A long-acknowledged key player of mitochondrial fission is the GTPase, dynamin-related protein 1 (Drp1) [12]. However, it has been recently reported that an additional GTPase, dynamin-2 (Dyn2/Dnm2), directly coordinates mitochondrial fission alongside Drp1 [13]. While the GTPases are thought to provide the energy to catalyze fission from GTP hydrolysis, the complete process of fission requires a broader and more elaborate platform involving additional organelles such as the ER, which has been implicated in the initiation of mitochondrial constriction prior to GTPase function. Mitochondrial fission events are crucial for the remodeling and rearrangement of mitochondria within the cell and for the transfer of mitochondria to daughter cells following mitosis [14]. Whereas regulators of mitochondrial fusion and fission are typically GTPases, including Mfn1/2, OPA1, Drp1, and Dyn2/ Dmn2, recent studies suggest that mitochondria homeostasis is considerably more complex than previously envisioned. Upstream events associated with the trafficking and regulation of the mitochondrial GTPases are essential for the regulation of the fusion and fission events. These upstream events thus provide a mechanism for the indirect regulation of mitochondrial fusion and fission. Furthermore, many of the newly identified mitochondrial regulatory proteins that function indirectly (upstream) have also been implicated in mitochondrial-related diseases [15]. It is of interest that a number of Rab proteins (including Rab effectors) and other endocytic regulatory proteins indirectly regulate mitochondrial homeostasis. For example, recent studies show that the vacuolar protein sorting-35 (VPS35) controls the

Qualitative and Quantitative Assessment of the Role of Endocytic. . .

215

trafficking of various mitochondrial proteins [16–18]. VPS35 is a subunit of the trimeric retromer cargo selection complex and was originally described as key for the retrieval of mannose 6-phosphate receptor from peripheral endosomes back to the Golgi complex [19]. Exciting new studies have now implicated VPS35 in the regulation of mitochondrial fusion and fission, establishing a novel connection between an endocytic regulatory protein and mitochondrial homeostasis. Since the discovery of VPS35 as an indirect regulator of mitochondrial homeostasis, several VPS35/ retromer interaction partners, such as EHD1 and Rabankyrin-5, have also been implicated in the regulation of mitochondrial homeostasis [20]. Rabankyrin-5 is a Rab5 effector protein that directly binds to EHD1 and regulates the fusion and fission of endosomal membranes. An example of the impact of EHD1 (or Rabankyrin-5) knock-down on mitochondrial morphology can be seen in Fig. 1, where impaired fission leads to longer mitochondria (Fig. 1B) compared to Mock-treated cells (Fig. 1A). In addition to Rabankyrin-5, other Rabs and Rab effectors have been implicated in mitochondrial fission. For example, Rab7 promotes contact sites between lysosomes and mitochondria that mark the mitochondria for fission [21], the Rab11a effector, FIP1/RCP, regulates Drp1-mediated fission [22], and loss of Rab32 results in elongation of mitochondria, suggesting a role for Rab32 in mitochondrial fission [23]. Now that we have briefly outlined how mitochondrial fusion and fission are regulated, and introduced several of the key regulatory proteins involved in these processes, we will focus on detailing methods that can be used to qualitatively and quantitatively measure the impact of select proteins on mitochondrial fusion and

Fig. 1 RPE1 cells were either Mock-treated (A) or treated with EHD1-siRNA (B) and stained with the outer mitochondrial membrane marker, Tom20. The images depict changes in the mitochondrial morphology upon knock-down of the endocytic regulatory protein, EHD1, and provide an example of cells displaying impaired mitochondrial fission

216

Trey Farmer and Steve Caplan

fission in human retinal pigmented epithelial (RPE1) cells. To this aim, we will show how commercially available small interfering RNA (siRNA) targeting classical endocytic regulatory proteins, along with freely available software, can be used to evaluate the impact of specific endocytic proteins on mitochondria by quantifying their effect on mitochondrial morphology. It is our goal to provide simple protocols that may prove useful for researchers new to the realm of endocytic regulatory proteins and mitochondrial homeostasis.

2 2.1

Materials Major Equipment

Confocal or epifluorescence microscope. Mammalian cell culture incubator. Laminar flow hood (Biosafety Level 2). Computer linked to the internet.

2.2

Small Equipment

Sterilized 12 mm circular glass cover-slips of thickness #1.5 (MERR0012, Midwest Scientific). Double-frosted microscope slides (1324 W, Midwest Scientific). Eppendorf 1.5 ml centrifuge tubes. Forceps. Cell culture dishes (Corning Life Sciences-Fisher Scientific). Parafilm. 12-well dishes (for immunofluorescence). 1.5 ml microfuge tubes. Fiji image software (Fiji Is Just ImageJ). Mitomorph plugin for Fiji.

2.3

Cells

Human hTERT-Retinal Pigmented Epithelial cells (RPE1).

2.4

Reagents

Dulbecco’s Modified Eagle’s Medium (DMEM). Fetal bovine serum (FBS). Glutamine. Penicillin/streptomycin. Bovine serum albumin (BSA, 5470, Sigma). DharmaFECT I (T-2001-03, Horizon/Dharmacon). Cell culture grade water. Optimem medium. Small interfering RNA (siRNA, Dharmacon).

Qualitative and Quantitative Assessment of the Role of Endocytic. . .

217

Tom20 Antibody ((F-10): sc-17,764, Santa Cruz Biotechnology). Goat anti-mouse (Invitrogen).

Alexa

Fluor

568–conjugated

antibody

Formaldehyde 37% (F8775, Sigma) diluted to 3.7% in PBS. Saponin (47036, Sigma). DAPI (D1306m Invitrogen). Mounting media (OB-100-01, Fisher). Nail polish (clear). Microscope lens oil. 2.5

Buffers

Phosphate-buffered saline (calcium and magnesium-free PBS): 3.2 mM Na2HPO4, 0.5 mM KH2PO4, 1.3 mM KCl, 135 mM NaCl, pH 7.4. Staining Buffer: 0.5% BSA and 0.2% saponin in PBS.

3

Methods

3.1 Qualitative Analysis of the Impact of Endocytic Regulatory Proteins on Mitochondrial Fusion and Fission 3.1.1 Experimental Strategies

Qualitative analysis of the impact of endocytic regulatory proteins on mitochondrial fusion and fission has a significant advantage over most quantitative methods, including the quantitative method described later in this paper. Microscopic techniques allow researchers to visualize the mitochondrial morphology under various treatment conditions. Since the overall wellness of a cell depends on the health of its mitochondria, having an opportunity to look at other cellular phenotypes simultaneously may be advantageous. For example, if depletion of a protein causes a change that results in elongation of mitochondria, researchers might be interested in understanding how impaired fission or increased fusion impacts levels of reactive oxygen species (ROS) in the cell, or how much ATP the cell can produce under conditions with abnormal mitochondria. Such studies require the knockdown of a protein combined with use of a fluorescent marker for mitochondria, such as an antibody for an OMM protein like Tom20, that can provide information on the localization and morphology of mitochondria within the cell. In this section, we will describe experimental strategies for protein knock-down and mitochondrial immunostaining with a fluorescently labeled antibody to monitor alterations in mitochondrial morphology by microscopy. If the protein of interest affects mitochondria, it may result in impaired mitochondrial fusion and/or fission compared to normal control cells with healthy mitochondria.

218

Trey Farmer and Steve Caplan

3.1.2 Knock-Down of a Select Protein Using siRNA

1. RPE1 cells should be passaged using standard techniques (routinely tested for Mycoplasma) and plated 24 h prior to the experiment on 35 mm dishes containing round coverslips. Cells should be approximately 50–60% confluent the next day. 2. The following day, cells should be washed 3 with sterile PBS and then placed in DMEM containing 10% FBS, 1 glutamine, and 1 penicillin–streptomycin (in complete DMEM) and placed back in the incubator to equilibrate at 37  C. 3. Under sterile conditions in a laminar flow hood, label 4 Eppendorf centrifuge tubes (follow the experimental flow chart outlined in Fig. 2): Mock, Knock-down, and two with the letter B. In the mock-labeled tube, add 100 μl of Opti-MEM medium and 100 μl of cell culture grade water. In the knockdown–labeled tube, add 100 μl of Opti-MEM medium, 90 μl of cell culture grade water, and 10 μl (may need to be adjusted, depending on the efficiency of the siRNA) of 40 μM siRNA oligonucleotides. In each of the two Eppendorf tubes labeled B, add 194 μl of Optimem medium plus 6 μl of Dharmafect I, so that all 4 tubes have 200 μl of solution. Incubate at room temperature for 5 min. 4. After 5 min, add one of the B-labeled tubes to the Mocklabeled tube and the other B-labeled tube to the knockdown–labeled tube (the mock- and knock-down–labeled tubes should now each have 400 μl volume) and incubate at room temperature for 15 min. Once incubation is complete, add the 400 μl drop-wise to the designated cells for each treatment. 5. Place the cells in a 37  C cell culture incubator for 48-72 h, depending on the knock-down efficiency of the specific siRNA used.

3.1.3 Immunofluorescence

1. Once knock-down is complete, the cells need to be fixed in 3.7% formaldehyde in PBS for 10 min at room temperature. This can be done by transferring the coverslips to a labeled 12-well plate containing 1–2 ml 3.7% formaldehyde (does not need to be sterile at this point). The remaining adherent cells in the 35 mm dish that were not plated on the cover-slips should be used to verify the protein knock-down by immunoblot analysis. 2. The cover-slips should be washed gently 3 with PBS to remove any remaining formaldehyde. The best way to insure that the cells on the coverslips remain adherent is to slowly add PBS to the sides of the well (rather than directly to the coverslip) and carefully aspirate the PBS from the side of the well away from the coverslip.

Fig. 2 Schematic workflow for Mock-treatment or siRNA knock-down of RPE1 cells using DharmaFECT 1 transfection reagent. It is important to note that this workflow needs to be done under sterile conditions inside a laminar flow hood (Biosafety Level 2) and the coverslips need to be incubated following the treatment for at least 48 h

220

Trey Farmer and Steve Caplan

Fig. 3 Schematic diagram illustrating a humidity chamber made out of a 10 or 15 cm culture dish for immunostaining coverslips. The moist filter paper attached to the top cover of the plate is used to insure that the antibody (Ab.) or coverslips do not dry out during the incubation period

3. Dilute the Tom20 antibody in staining buffer according to the manufacturer’s recommendation (calibration to optimize signal intensity and specificity may be needed). 4. To save on reagents, using the forceps, place the coverslip upside down (cell side down) onto a 50 μl drop of antibody solution on a piece of parafilm inside a humidity chamber made with a 10 or 15 cm culture plate for 1 h at room temperature (see Fig. 3). 5. Using forceps, carefully transfer the cover-slips back to a 12-well dish with the cells cell side up and wash 3 with PBS. 6. Dilute the anti-mouse Alexa Fluor 568 secondary antibody in staining buffer. 7. Place the coverslips onto 50 μl drops containing the secondary antibody cell side down and incubate for 30 min at room temperature. 8. Carefully transfer cover-slips back to a 12-well dish with cells cell side up and wash 3 with PBS. 9. If desired, counterstain with DAPI to label the nuclei (follow the manufacturer’s recommendations). 10. The cells should be rinsed once with ddH2O and the coverslips mounted cell side down onto a drop of mounting media (approximately 10–20 μl) placed on a microscope slide.

Qualitative and Quantitative Assessment of the Role of Endocytic. . .

221

11. Seal the coverslips with clear nail polish (adding polish only to the periphery of the coverskip); once the nail polish has dried, gently clean the coverslip with a damp paper towel. Visualize by confocal or epifluorescence microscopy. 3.1.4 Imaging

1. Essentially, any epifluorescence or confocal microscope equipped with a camera can be used. We will describe the imaging process with a Zeiss LSM800 confocal microscope with a 63/1.4 NA oil objective. 2. Place a small drop of oil on the coverslip and turn on the broadrange (xenon) light source. Use the eyepiece to visualize the cells; Tom20-labeled mitochondria should be visible with the red/568 nm filter. 3. To image the mitochondria, switch to the confocal mode and use the appropriate laser and filter combination (in this case, only the 561 nm laser is needed). 4. For calibration and focusing, “Live” or “Scanning” mode should be used. Set the laser power to reduce saturated pixels. Photobleaching should not be an issue since the laser power should be set at minimal levels. 5. The laser power and all other parameters must be recorded and kept at identical settings throughout the imaging process to ensure that comparisons between mitochondria of mocktreated cells and the mitochondria under knock-down conditions are valid. Note: many microscopy systems keep computerized records of the settings and microscopy software programs typically have a “reuse” button to set the parameters back to the same values if altered. 6. Since mitochondria localize throughout the entire depth of the cell, it is recommended to perform z-sections in order to image the entire mitochondrial profile. Once the z-section experiment is selected, z-ranges for the top and bottom of the cell must be set. For a typical RPE1 cell, a z-series should include 6–10 slices at approximately 0.40 μm depth per slice. 7. To combine the slices into a single representative image, convert the stack into a maximal intensity projection image. This will take the 3D image and turn it into a single 2D representative image by including the maximal intensity pixels imaged from each z-section. 8. Save the maximal intensity projection images and export them as tiff images to be used for further quantification or presentation. Note: make sure the chosen pseudocolor for the mitochondria is red, because the program used for quantification only recognizes red.

222

Trey Farmer and Steve Caplan

3.1.5 Post-image Processing

1. Import the tiff image files into ImageJ, Photoshop, or another image processing program. 2. It is vital that the investigator take appropriate precautions when manipulating images; minimal image manipulations should be done before quantification. It is best to optimize imaging conditions to avoid the need for manipulations in post–image processing programs. 3. If adjustments are done, they must be done to the entire field and to every image to ensure that images can be represented and compared appropriately.

3.1.6 Remarks

The above-mentioned protocols may be used to determine the impact of a select protein on mitochondrial homeostasis. While mitochondrial homeostasis is a constant balance between mitochondrial fusion and fission, the machinery that regulates both processes differs under normal conditions. However, disruption of key mitochondrial fission or fusion machinery components results in an imbalance of mitochondrial homeostasis within the cell. For instance, decreased fusion leads to more fragmented mitochondria, which can be seen in disease states such as Alzheimer’s disease, Parkinson’s disease, and Charcot–Marie–Tooth type 2A. Given the importance of mitochondrial homeostasis to the cell’s overall fitness, along with the rapidly growing field of research involving new mitochondrial fission or fusion proteins and the implications in disease states, we expect that many investigators may require tools to study mitochondrial fusion and fission. While the protocols mentioned above are useful starting points, we wish to point out several caveats that the investigator should be aware of: 1. In using siRNA to knock-down a select protein of interest, it is important to note that there is a possibility that not every cell that is imaged will be completely knocked-down. For instance, there might be cells in a field that have retained some expression of the select protein, while others may be completely devoid of this protein. Validation of significant loss of protein expression by immunoblot coupled with obtaining multiple images of fields of cells from at least 3 different experiments will help verify that veracity of the results. 2. Since mitochondrial fusion and fission are highly regulated processes that involve many proteins, most defects that are caused by siRNA-based depletion are partial defects. For example, fission events at the mitochondria are significantly reduced upon EHD1 knock-down, but this does not mean that all mitochondria are incapable of undergoing fission. This may be caused by residual EHD1 left in the cell, through compensation for the loss of EHD1, and/or the involvement of other fission regulating proteins.

Qualitative and Quantitative Assessment of the Role of Endocytic. . .

223

3. The protocols outlined above are for fixed cells, thus only giving a snapshot of the status of the mitochondria. Since mitochondria are highly dynamic structures, live cell imaging can provide a more accurate assessment of the dynamics of mitochondria fusion and fission. Whereas live imaging studies do not rely on antibodies to stain endogenous mitochondrial proteins, there are commercially available mitochondria markers that can be added to cells that are specifically designed for targeting mitochondria and live imaging. 4. It is important to ensure that proper cell culture practice is employed. Mitochondrial morphology is a strong indicator of cell health, so if the cells are compromised before the siRNA treatment, impaired mitochondrial fusion/fission might be discerned. It is also important to ensure that the conditions for fixing the cells are optimized as improper fixation can result in fragmented mitochondria, even in mock-treated cells. 3.2 Quantitative Analysis of the Impact of Endocytic Regulatory Proteins on Mitochondrial Fusion and Fission 3.2.1 Experimental Strategies

3.2.2 Downloading Fiji and Installing the Mito-Morphology Macro

In this section we will discuss how to take the images obtained in the previous section and use them to quantitatively assess mitochondrial morphology. It should be noted that there are a variety of ways to quantify mitochondrial morphology that include commercially available or free image processing software programs. In this chapter, we will prepare the reader for the use of Fiji (Fiji is Just ImageJ) along with the Mito-Morphology macro. Fiji is an open source image processing package that is based on the National Institutes of Health (NIH) ImageJ imaging program, and it was developed to run macro programs that are specifically designed for select functions. For example, the Mito-Morphology macro is specifically coded to measure the interconnectivity and elongation of immunostained mitochondria and this macro is currently maintained and supported by the NIH. Due to the usefulness of this macro and the availability of both the program and the macro free of charge, this method for quantitatively evaluating mitochondrial morphology is popular and easy to master. 1. Visit imagej.net/Fiji/Downloads and select the appropriate download file corresponding to your computer’s operating system (e.g., Windows, MacOS). 2. The files and folders that are downloaded are compressed (zipped) and need to be extracted. In order to do this, right click on the folder that has been downloaded and perform the “extract all” function. Make sure that you save the extracted files in a location that you can find readily. 3. In the location that has been previously chosen, the extracted folder will appear as Fiji.app. Open the Fiji folder and find the application file that will allow opening Fiji (if you are using a Windows 10 operating system, it will be named ImageJwin64).

224

Trey Farmer and Steve Caplan

4. Once Fiji loads, the Mito-Morphology macro will need to be installed as it is not a standard macro. Visit imagejdocu. tudor.lu/plugin/morphology/mitochondrial_morphology _macro-plug-in/start and navigate the download section to find the code needed to run the Mito-Morphology macro (multiple links for the same code). The link will not download a file, but rather will open up the coding sequence needed. 5. This code will need to be copied and saved as a txt file (the code can be pasted into Word or Notepad and saved as a txt file). Save the txt file in the macros folder inside the Fiji.app folder that was previously extracted. 6. Return to the Fiji program and select the Plugin tab on the top task bar. From the dropdown menu, select macros>install. In order to install, find the txt file from the previous step that is located in the macros folder. Once selected, the bottom of the Fiji task bar should indicate that 5 macros have been installed. This will indicate that the Mito-Morphology macro has been successfully installed and ready to use. 3.2.3 Using the Mito-Morphology Macro to Quantitatively Measure Mitochondria

1. The Mito-Morphology macro has keyboard shortcuts that render it user friendly, and the user must activate the macro via these shortcuts. The first step is to open the image using the F9 key (make sure your keyboard allows the “F” keys to be functional). This will open the files, where an image that was taken may be selected using the method listed in the previous section. 2. Once the image is open, press F10. This will process the selected multichannel image and split the channels into blue, green, and red, and at the same time automatically close the blue and green channels. For this reason it is necessary to save the mitochondria-stained images in pseudo-red. After splitting the image into the channels, a threshold for the red channel will be automatically set; however, the user may optimize the threshold as needed. It is important to note that the same threshold levels must be used for every image analyzed. 3. Next, press F11 to analyze the mitochondrial parameters. This function will draw individual outlines around all of the mitochondria observed in the image and calculate the following parameters: number of mitochondria, average circularity, average perimeter, average area, average area/perimeter ratio, average area/perimeter ratios normalized to the minor axis of mitochondria, and circularity. Complete definitions of each of these parameters can be found on the Mito-Morphology macro website listed above. 4. The results for the processed image will open in a new window named “results” that shows the measurements for every mitochondria in the image. For each image processed, the results will be added to a summary window. These results can be saved

Qualitative and Quantitative Assessment of the Role of Endocytic. . .

225

from this window as a txt file or they can be copied to an external graphical/statistical program to further analyze the data (i.e., Excel). 5. Each step above leads to generation of multiple windows, and once the image analysis is complete, pressing F4 will close all the image windows. This will not close the results obtained, but rather will close the windows that have already been analyzed. 6. Follow the series of screen shots in Fig. 4 to help guide you through the image analysis starting with the Mito-Morphology macro already installed. 3.2.4 Remarks

Due to the dynamic nature of mitochondria and uncontrollable experimental/biological inconsistencies, it is recommended that these types of quantitative measurements be based on multiple experiments, using at least 15 analyzed cells per experiment for accurate statistical representation. Quantitatively measured parameters can be presented as a mean from multiple experiments along with standard deviation and appropriate statistical significance tests. It should be noted, however, that in some cases it remains possible that the qualitative data obtained (discussed in the first section of this paper) may not always appear representative of the quantitative data. In such a case, it is possible to try a few or all of the following: 1. Ensure that the same conditions are being used between each experiment. This includes, but is not limited to using the same cell lines, fixation conditions, staining conditions, and imaging settings. If such variables are altered in different experimental repetitions, this will increase the likelihood of fluctuations in the results, and enhance the probability of obtaining high variance. 2. Use the Mito-Morphology threshold tool to optimize the number of mitochondria and level of background included in the subsequent calculations. It is common to inadvertently include large particles in the image that do not correspond to mitochondria, thus skewing the results obtained. 3. If a field of cells is used to perform calculations, but consistent results are not obtained, use images of single cells that are representative of what is observed in the majority of the cells. This will require more images per experiment but will allow optimization of conditions and thresholds more readily. 4. Alternatively, a field of cells may be used in combination with a drawn Region of Interest (ROI), a selected area of the image to be analyzed. For example, Fiji has a “Freehand” tool that allows selecting a ROI around a cell. Once the area is drawn/selected, the sequence of functions listed above can be performed and only that area will be analyzed.

226

Trey Farmer and Steve Caplan

Fig. 4 Screenshot workflow for image analysis after successful installation of the Mito-Morphology macro in Fiji

Qualitative and Quantitative Assessment of the Role of Endocytic. . .

227

References 1. Hamanaka RB, Chandel NS (2010) Mitochondrial reactive oxygen species regulate cellular signaling and dictate biological outcomes. Trends Biochem Sci 35(9):505–513 2. Duchen MR (2000) Mitochondria and calcium: from cell signalling to cell death. J Physiol 529(Pt 1):57–68 3. Nicholls DG (2005) Mitochondria and calcium signaling. Cell Calcium 38 (3–4):311–317 4. Wang C, Youle RJ (2009) The role of mitochondria in apoptosis*. Annu Rev Genet 43:95–118 5. Horowitz MP, Greenamyre JT (2010) Mitochondrial iron metabolism and its role in neurodegeneration. J Alzheimers Dis 20(Suppl 2): S551–S568 6. Richardson DR, Lane DJ, Becker EM, Huang ML, Whitnall M, Suryo Rahmanto Y, Sheftel AD, Ponka P (2010) Mitochondrial iron trafficking and the integration of iron metabolism between the mitochondrion and cytosol. Proc Natl Acad Sci U S A 107(24):10775–10782 7. Srivastava S (2017) The mitochondrial basis of aging and age-related disorders. Genes (Basel) 8(12):398 8. Sun N, Youle RJ, Finkel T (2016) The mitochondrial basis of aging. Mol Cell 61 (5):654–666 9. Suen DF, Norris KL, Youle RJ (2008) Mitochondrial dynamics and apoptosis. Genes Dev 22(12):1577–1590 10. Chen H, Detmer SA, Ewald AJ, Griffin EE, Fraser SE, Chan DC (2003) Mitofusins Mfn1 and Mfn2 coordinately regulate mitochondrial fusion and are essential for embryonic development. J Cell Biol 160(2):189–200 11. Twig G, Shirihai OS (2011) The interplay between mitochondrial dynamics and mitophagy. Antioxid Redox Signal 14 (10):1939–1951 12. Smirnova E, Griparic L, Shurland DL, van der Bliek AM (2001) Dynamin-related protein Drp1 is required for mitochondrial division in mammalian cells. Mol Biol Cell 12 (8):2245–2256 13. Lee JE, Westrate LM, Wu H, Page C, Voeltz GK (2016) Multiple dynamin family members collaborate to drive mitochondrial division. Nature 540(7631):139–143

14. Pagliuso A, Cossart P, Stavru F (2018) The ever-growing complexity of the mitochondrial fission machinery. Cell Mol Life Sci 75 (3):355–374 15. Follett J, Bugarcic A, Collins BM, Teasdale RD (2017) Retromer’s role in endosomal trafficking and impaired function in neurodegenerative diseases. Curr Protein Pept Sci 18 (7):687–701 16. Wang W, Wang X, Fujioka H, Hoppel C, Whone AL, Caldwell MA, Cullen PJ, Liu J, Zhu X (2016) Parkinson’s disease-associated mutant VPS35 causes mitochondrial dysfunction by recycling DLP1 complexes. Nat Med 22(1):54–63 17. Wang W, Ma X, Zhou L, Liu J, Zhu X (2017) A conserved retromer sorting motif is essential for mitochondrial DLP1 recycling by VPS35 in Parkinson’s disease model. Hum Mol Genet 26(4):781–789 18. Tang FL, Liu W, Hu JX, Erion JR, Ye J, Mei L, Xiong WC (2015) VPS35 deficiency or mutation causes dopaminergic neuronal loss by impairing mitochondrial fusion and function. Cell Rep 12(10):1631–1643 19. Arighi CN, Hartnell LM, Aguilar RC, Haft CR, Bonifacino JS (2004) Role of the mammalian retromer in sorting of the cationindependent mannose 6-phosphate receptor. J Cell Biol 165(1):123–133 20. Farmer T, Reinecke JB, Xie S, Bahl K, Naslavsky N, Caplan S (2017) Control of mitochondrial homeostasis by endocytic regulatory proteins. J Cell Sci 130(14):2359–2370 21. Wong YC, Ysselstein D, Krainc D (2018) Mitochondria-lysosome contacts regulate mitochondrial fission via RAB7 GTP hydrolysis. Nature 554(7692):382–386 22. Landry MC, Champagne C, Boulanger MC, Jette A, Fuchs M, Dziengelewski C, Lavoie JN (2014) A functional interplay between the small GTPase Rab11a and mitochondriashaping proteins regulates mitochondrial positioning and polarization of the actin cytoskeleton downstream of Src family kinases. J Biol Chem 289(4):2230–2249 23. Alto NM, Soderling J, Scott JD (2002) Rab32 is an A-kinase anchoring protein and participates in mitochondrial dynamics. J Cell Biol 158(4):659–668

Chapter 16 Characterization of the Role of Rab18 in Mediating LD–ER Contact and LD Growth Dijin Xu, Peng Li, and Li Xu Abstract Lipid droplets (LDs) are dynamic cellular organelles found in most eukaryotic cells. Lipid incorporation from endoplasmic reticulum (ER) to LD is important in controlling LD growth and intracellular lipid homeostasis. However, the molecular link that mediates ER and LD cross talk remains elusive. Here, we describe the methodology used to characterize the function of Rab18 in regulating LD homeostasis and LD-ER contact. First, we focus on the quantitative assay used to measure intracellular LDs morphological changes. This is followed by a detailed description of the use of the APEX-label technology in combination with electron microscope (EM) to visualize ER-LD contact sites. These assays are valuable for the investigation of LD-associated proteins such as Rab18 in establishing membrane contact sites between LDs and other subcellular organelles. Key words Rab GTPase, Membrane contact site, Lipid droplets, Lipid metabolism, APEX-tag

Abbreviations APEX DGAT EM ER GAP GBP GEF GPAT HCV LD TAG

Ascorbate peroxidase Diacylglycerol acyltransferase Electron microscope Endoplasmic reticulum GTPase activating protein GFP binding protein Guanine nucleotide exchange factor Glycerol-3-phosphate acyltransferase Hapatitis Virus C Lipid droplet Triaclglyceride

Guangpu Li and Nava Segev (eds.), Rab GTPases: Methods and Protocols, Methods in Molecular Biology, vol. 2293, https://doi.org/10.1007/978-1-0716-1346-7_16, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

229

230

1

Dijin Xu et al.

Introduction Lipid droplets (LDs) are highly dynamic subcellular organelles primarily responsible for energy storage. They have been linked to multiple cellular processes including virus packing, protein storage and modification, and host defense [1–4]. Structurally, the neutral lipids in the LDs are surrounded by a monolayer of phospholipids and specific LD-associated proteins. LDs undergo dynamic changes including biogenesis, fusion/growth, and degradation [5, 6]. LD dynamics reflect the lipid metabolic status, and uncontrolled LD growth has been linked to the development of multiple metabolic diseases [7–10]. LD biogenesis is initiated at the ER and nascent LDs bud off as individual LDs [11–13]. Several distinct mechanisms by which LDs grow and expand have been discovered. First, nascent LDs mature by acquiring neutral lipids from the ER through continuous association between the two organelles [14, 15]. Second, LD growth can be achieved via local TAG synthesis through LD-associated enzymes such as GPAT4 and DGAT2 [16–19]. Finally, CIDE proteins can promote LD growth via atypical lipid transfer and LD fusion in the adipose tissues, in the liver of high fat diet treated or obese mice, in skin sebocytes, and in lactating mammary epithelial cells [20–25]. Rab GTPases are crucial regulators of vesicle trafficking and membrane dynamics. Their activities are regulated by specific GEFs, GAPs and downstream effectors [26, 27]. Rab18 was shown to be an LD-associated protein in several cell types including 3T3-L1 preadipocytes and differentiated adipocytes [28– 30]. Rab18 plays a potential role in β-adrenergic stimulated lipolysis and insulin-induced lipogenesis in the adipocytes [31]. Rab18 also facilitates HCV replication through its interaction with the nonstructural protein NS5A [29]. Interestingly, point mutations of Rab18 and Rab3GAP1/Rab3GAP2 complex, a specific GEF for Rab18, were discovered in patients with Warburg Micro syndrome (WARBM). WARBM is an autosomal recessive disorder with an accumulation of abnormally large LD in the isolated patients’ fibroblasts [32–34]. In addition, a systematic screening performed on the Drosophila cells for Rab effectors revealed that ZW10 and RINT1 subunits of the NRZ complex, and Syntaxin18, part of the ER SNARE complex may be Rab18 effectors. The NRZ tethering complex consisting of ZW10, NAG, and RINT1 is associated with the ER-localized Q-SNAREs (Use1, Syntaxin18, and BNIP1) [35]. Previously, others have demonstrated the potential role of NRZ complex in Golgi-ER retrograde vesicle trafficking and fusion [36–38]. Overexpression of Rab18 enhances LD association of ZW10 [39]. We have shown that Rab18 is an important regulator of LD dynamics. Rab18 deficiency results in a defective LD growth

Rab18 in LD-ER Contact

231

and maturation but not LD biogenesis [40]. Concomitantly, overexpression of Rab3GAP1/2 complex promotes LD growth by activating and targeting Rab18 to LDs. Upon activation, Rab18 binds to NRZ and ER-associated Q-SNAREs and recruits them to the close proximity of LDs [40]. The Rab18-NRZ-SNARE interaction and complex formation result in the tethering of ER to LD, promoting close contact between the two organelles, thereby facilitating lipid incorporation from ER to LD and promoting LD growth [40]. In addition to Rab3GAP1/Rab3GAP2, Rab18 activity is also regulated by other factors. The TRAPPII complex serves as a Rab18-GEF to activate and recruit Rab18 to LDs in several cell types [41]. In addition, DFCP1 acts as a Rab18 effector for LD localization and interacts with the Rab18-ZW10 complex to mediate ER-LD contact formation [42, 43]. In this chapter, we summarize our methodology to investigate Rab18’s role in mediating ER-LD contacts and LD growth. The protocol consists of two major parts. First, we describe the quantitative assay for the measurement of the LD sizes and numbers. Second, we detail the visualization of the LD-ER contact sites using transmission electron microscopy. Methods described in this chapter can be utilized to study LD-associated proteins, such as Rab GTPases, for their roles in establishing membrane contact sites between LD and other subcellular organelles.

2 2.1

Materials Plasmids

pCDNA-3.1-(
)-Rab18. pCDNA-3.1-(
) vector. pmCherry-C1. pmCherry-Rab18. pEGFP-C1-Syntaxin-18. APEX2-GBP (Addgene: 67651; Gift from Dr. Robert Parton, the University of Queensland).

2.2 Biological Material

3T3-L1 preadipocyte (ATCC, catalog number: CL-173).

2.3

Electroporation buffer (Lonza, V4XC-1024).

Reagents

Rab18-deficient 3T3-L1 preadipocytes.

DPBS (Thermo Fisher, 14190144). 35 mm Labtek glass bottom Cell Culture Dish,Φ 15 mm (Thermo Fisher, 150682). 4% paraformaldehyde in PBS (Santa cruz, 30525-89-4). Sodium oleate (Sigma-Aldrich, O7501).

232

Dijin Xu et al.

Fatty acid free bovine serum albumin (BSA; Sigma-Aldrich, A7030). Bodipy 493/503 (Thermo Fisher, D3922). SPI-Pon 812 Kit (including SPI-pon812, DDSA, NMA and BDMA; SPI Supplies, 02663-AB). Glutaraldehyde (Sigma-Aldrich, G5882). Sodium cacodylate (Electron Microscopy Sciences, 11652). OsO4 (Electron Microscopy Sciences, 20816-12-0). CaCl2 (Sigma-Aldrich, C5670). Ethanol (Sigma-Aldrich, E7023). 3,30 -Diaminobenzidine (DAB; Sigma-Aldrich, D8001). H2O2 (Sigma-Aldrich, H1009). Dulbecco’s Modified 11965092).

Eagle

Medium

(DMEM;

Thermo,

Fetal bovine serum (FBS; Thermo, 10082147). Penicillin–streptomycin (Thermo, 15140122). 2.4 Buffers and Solutions

1. Oleic acid complexed with BSA: 200 μM oleic acids in DPBS solution with 1% BSA (w/v). 2. EM wash buffer: 0.1 M Sodium cacodylate (PH 7.4), 2 mM CaCl2. 3. EM fixation buffer: 0.1 M Sodium cacodylate (PH 7.4), 2 mM CaCl2, 2.5% (v/v) glutaraldehyde. 4. EM quenching buffer: 0.1 M Sodium cacodylate (PH 7.4), 2 mM CaCl2, 20 mM Glycine. 5. APEX sensitization buffer: 0.1 M Sodium cacodylate (PH 7.4), 2 mM CaCl2, 1 mg/mL DAB. 6. APEX reaction buffer: 0.1 M Sodium cacodylate (PH 7.4), 2 mM CaCl2, 1 mg/mL DAB, 5.88 mM H2O2. 7. APEX staining buffer: 0.1 M Sodium cacodylate (PH 7.4), 2 mM CaCl2, 2% (w/v) OsO4. 8. SPI-PON 812 resin mixture: SPI-pon812: 50 mL, DDSA: 16 mL, NMA: 35 mL, BDMA: 2 mL.

2.5

Equipment

1. Electroporation cuvette (Biorad). 2. Amaxa Nucleofector II (Lonza). 3. Nikon A1R+ Confocal Microscope with CFI Plan Apo 100 oil immersion objective (NA 1.45) and GaAsP multidetector photomultiplier (Nikon). 4. Lecia Ultracut R (Leica). 5. H-7650 transmission electron microscopy (Hitachi).

Rab18 in LD-ER Contact

2.6

Software

233

1. Imaris 3.9.1 (Bitplane). 2. NIS-Element (Nikon). 3. Graphpad Prism 8 (GraphPad Software). 4. FIJI (NIH software).

3

Methods

3.1 Characterization of the Function of Rab18 in Regulating LD Growth

3.1.1 Cell Preparation

LD sizes vary greatly depending on the cell types and metabolic status. Here, we develop a quantitative method to measure LD morphology, including LD sizes and numbers. We used this method as a basis to establish Rab18’s role in regulating LD growth. 1. Culture wild-type or Rab18-deficient 3T3-L1 preadipocytes in a 10 cm cell culture dish with DMEM supplemented with 10% FBS, 100 μg/mL streptomycin, and 100 U/mL penicillin. 2. At 80% confluence, trypsinize the cells using 2 mL 0.25% trypsin solution, then terminate the reaction using DMEM containing 10% FBS. 3. Spin down cells with centrifugation at 150  g for 3 min. Wash the cell pellet with PBS, follow by centrifugation at 150  g for 3 min. Discard the supernatant. 4. Cells are resuspended with electroporation buffer to a cell density of 5  106 cells/mL. 5. Aliquot 100 μL cell suspension into 1.5 mL Eppendorf tube. 6. Add 1 μg pCDNA-3.1-(
)-Rab18 or pCDNA-3.1-(
)-vector. 7. To each tube, 0.3 μg pmCherry-N1 is cotransfected to act as an indicator to mark successful Rab18 transfection (see Note 1). 8. Transfer the cell-plasmid DNA suspension mix to a electroporation cuvette. Perform electroporation using Amaxa Nucleofector II with program A-033 (see Note 2). 9. Add 100 μL DMEM into the cuvette. 10. Transfer the cell suspension to a 35 mm Labtek culture dish with 2 mL DMEM containing 10% FBS and 200 μM oleic acid complexed with BSA. 11. 20 h post transfection, cells are washed twice with PBS buffer and fixed in 4% paraformaldehyde in PBS for 20 min at room temperature. 12. Fixed cells are washed in PBS twice. 13. Stain cells with 1 μg/mL Bodipy 493/503 in PBS for 20 min (see Notes 3 and 4).

234

Dijin Xu et al.

3.1.2 Measurement of LD Sizes and Numbers

1. Images are collected using Nikon A1R+ laser scanning confocal microscope from the transfected cells established in Subheading 3.1.1. 2. “FITC” and “TRITC” channels are chosen to image Bodipy 493/503 and mCherry, respectively. Cells with positive mCherry signal are selected for imaging. Z-stack images (1024  1024 pixels in size, line average 2) are obtained with 0.3 μm per optical section (see Note 5). 3. For quantitative analysis of LD size, Z-stack images are loaded into Imaris software (version 9.3.1). LDs are further analyzed by 3D-surface reconstruction tool. Go to the “Surpass” view. Click “Create Surface” icon to start building 3D-surface of LDs. Select FITC channel as source channel. Check the option “Smooth” and set “Surface Area Detail Level” as 0.2 μm. Check the “Background Subtraction” option and set the “Diameter of largest Sphere” to an optimal value (see Note 6). 4. In the “Threshold” adjustment select “Manual.” Adjust lower threshold to an optimal value. Select the “Split touching Objects Enable” option. Set the value of the “Estimated Diameter” (see Note 7). 5. Select “Filter Type: Quality”, select “Manual,” set Lower Threshold. Select “Filter Type: Number of Voxels”, select “Manual,” set Lower Threshold (see Note 7). Surface reconstruction of all identified LDs are then generated. 6. In the “Statistic,” check “Volume” and “Number of Surfaces.” Export the measurement data into Excel for calculating LD numbers and size distribution. Images from approximately 50 cells are required for each distribution histogram.

3.1.3 Representative Data

Using the approach described above, we found that Rab18 is an important regulator of LD growth and maturation [40]. In our assay, over 50 positive cells were selected (Fig. 1a). The average number of mature LDs (stained by Bodipy 493/503) and the average size distribution of LD in each cell were measured. In Rab18-deficient cells, the number of mature LDs in each cell was dramatically decreased (117  13 per cell) compared with that in control cells (938  105 per cell). This represents 88% reduction in the number of mature LDs (Fig. 1b). In contrast, the number of supersized LDs (LDs larger than 2 μm in diameter) in each cell significantly increased in Rab18-deficient cells (Fig. 1c). Reintroduction of Rab18 into Rab18-deficient cells increased the number of mature LDs but decreased the number of supersized LDs (Fig. 1c).

Rab18 in LD-ER Contact

235

Fig. 1 Characterization of the function of Rab18 in regulating LD growth. (a) Representative images of LDs (Green) in control wild-type (NC) or Rab18-deficient (Rab18 KO) 3T3-L1 preadipocytes. Red represents Cherry expression. Scale bar, 10μm (2μm for inlays). (b) Quantification of the number of mature LDs under fluorescent microscope. Data represent mean  SD (***p < 0.001, NS: no significance). (c) Histogram showing the average number of LDs in each diameter in c. Data represent mean  SD (***p < 0.001, NS: no significance). (This research was originally published in Journal of Cell Biology. ©2018 Xu et al. Originally published in Journal of Cell Biology. https://doi.org/10.1083/jcb.201704184) 3.2 Characterization of the Function of Rab18 in Promoting the Formation of ER-LD Contacts

3.2.1 Sample Preparation and TEM Imaging

The Rab18-NRZ-SNARE interaction and complex formation result in tethering ER to LD and generating a close contact between the ER and LDs, therefore facilitating lipid incorporation to promote LD growth. Here we exploit an APEX2 labeled EM method [44, 45] to investigate the function of Rab18 in promoting the formation of ER-LD contacts. In the presence of DAB and OsO4, APEX2 catalyzes the formation of a high-electronic-density substance, thus indicating the contact sites between organelles. 1. Coexpress GFP-Syntaxin18 and APEX-GBP in wildtype, Rab18-overexpressing (pmCherry-Rab18), and Rab18-deficient 3T3-L1 preadipocytes by using the method described in Subheading 3.1.1.

236

Dijin Xu et al.

2. After electroporation, plate cells on 35 mm Labtek culture dish and incubate with 2 mL DMEM containing 10% FBS and 200 μM oleic acids complexed with BSA. 3. After 20 h incubation, fix cells in EM fixation buffer for 1 h at room temperature. Cells are then washed three times with EM wash buffer. 4. Add EM quenching buffer to the cells to quench unreacted aldehyde functional groups for 5 min on ice, followed by washing three times with EM wash buffer. 5. Rinse cells with APEX sensitization buffer for 2 min (see Note 8). 6. Incubate cells with APEX reaction buffer for 30 min at room temperature (see Note 9). 7. Wash cells three times with EM wash buffer. Stain cells with APEX staining buffer for 2 min (see Note 10). 8. Wash cells three times with EM wash buffer to remove the remaining OsO4. Further wash cells for three times with H2O to remove sodium cacodylate. 9. Next, dehydrate cells in increasing concentration of ethanol (30%, 50%, 70%, 90% and 100%) for 8 min each. 10. Infiltrate cells with 500 μLSPI-SPON 812 resin mixture and allow polymerization at 60  C for 24 h. 11. Cut 70 nm ultrathin sections using Lecia Ultracut R. Pick up the cut sections with Formvar-coated copper grids (100 mesh). 12. Samples are studied using a Hitachi H-7650 transmission electron microscopy at 80 kV. 3.2.2 Representative Result

1. ER-localized GFP-Syntaxin18 was observed as a higher density signal as APEX-GBP binds to the N-terminal GFP tag of GFPSyntaxin18 and catalyzes the formation of a high-electronicdensity substance in the presence of DAB and OsO4. Syntaxin18-positive ER cisternae were clearly observed in Rab18-overexpressing cells. Multiple APEX-Syntaxin18-positive signals were detected on the LD surface, indicating multiple direct contact between the ER and LD (Fig. 2a). 2. For quantitative analysis of the percentage of LDs apposing to ER, 11–17 regions of interest (ROIs) from 11 to 17 cells were randomly selected. 143–363 LDs were evaluated for wild-type, Rab18-overexpressing, and Rab18-deficient cells. An LD that was located in close proximity to ER cisternae (within a distance of less than 20 nm) was counted as positive (Fig. 2b). 3. For quantitative analysis of the percentage of LD surface area apposing to ER, 11–17 ROIs were randomly selected from 11 to 17 cells per genotype (143–363 LDs). The length of

Rab18 in LD-ER Contact

237

Fig. 2 Defective LD growth and maturation in Rab18-deficient cells. (a) Representative EM images showing a close contact between ER and LD in Rab18 overexpressing cells. ER cisternae were indicated with blue arrow; ER-LD contact sites were indicated with red arrows. Scale bar, 1–5: 500 nm; 6: 1μm (100 nm for inlays). (b) Quantification of percentage of LDs apposing to ER per ROI. O.E.: overexpression. (Mean  SD, ***p < 0.001). (c) Quantification of percentage of LD surface area apposing to ER per ROI. O.E.: overexpression (Mean  SD, *** p < 0.001). (This research was originally published in Journal of Cell Biology. ©2018 Xu et al. Originally published in Journal of Cell Biology. https://doi.org/10.1083/jcb.201704184)

LD surface apposing to ER and LD circumference was measured using “segmented line” tool in ImageJ-FIJI software. For each LD in an ROI, the ratio of the length of LDER apposition to the LD circumference was calculated and averaged (Fig. 2c).

238

4

Dijin Xu et al.

Notes 1. A bicistronic vector encodes both Rab18 and mCherry can be used alternatively to indicate Rab18-possitive cells. 2. Avoid prolonged incubation of cells in the electroporation buffer. Avoid bubbles when transferring cells suspension to electroporation cuvette. Bubbles affect electroporation efficiency. 3. To preserve a good LD morphology, cell imaging should be perfomed as soon as possible. Prolonged storage may result in deformed LDs, even after fixation. Cells are directly studied in 35 mm culture dish to prevent coverslip mounting-induced LD deformation. 4. Always use low concentration of Bodipy 493/503 in solution to prevent photobleaching during imaging process. 5. Ensure the intensity of fluorescent signal is within the dynamic range of the detector. 6. To set “Diameter of largest Sphere,” go to the “Slice” view to measure the diameter of the largest LD in the image. 7. During image analysis, visual and manual inspection is needed to confirm that all LDs are identified and properly separated. When comparing results between different genotypes or treatments, ensure all the thresholds setting are identical. 8. To ensure DAB effectively penetrate throughout the sample, always freeze DAB stock solution at
20  C and thaw fresh before use. 9. H2O2 concentrations (from 0.1 mM to 10 mM), incubation time (from 5 min to 45 min), and reaction temperature (on ice or at room temperature) significantly affect the final result. Preoptimization of these conditions is recommended. Prolonged incubation may result in high background or cause damage to the subcellular structures. 10. For effective ER-LD contact observation, optimal OsO4 treatment is recommended. Prolonged incubation may result in high background and thus reduces signal-noise ratio.

Acknowledgments This work was supported by grants from the National Natural Science Foundation of China (91854104 and 31690103) and from the National Key R&D Program of China (2018YFA0506901, 2019YFA0801701 and 2016YFA0502002). We thank the members from Dr. P. Li Laboratory at Tsinghua

Rab18 in LD-ER Contact

239

University, Dr. Chua BT at Fudan University for her kind editing, Dr. Ying Li and Jingyu Wang at Center of Biomedical Analysis, Tsinghua University, Dr. Robert G. Parton at the University of Queensland, and Dr. Hongyuan Yang at University of New South Wales for their helpful discussions. References 1. Herker E, Harris C, Hernandez C et al (2010) Efficient hepatitis C virus particle formation requires diacylglycerol acyltransferase-1. Nat Med 16(11):1295–1298. https://doi.org/10. 1038/nm.2238 2. Li Z, Thiel K, Thul Peter J et al (2012) Lipid droplets control the maternal histone supply of drosophila embryos. Curr Biol 22 (22):2104–2113. https://doi.org/10.1016/j. cub.2012.09.018 3. Klemm EJ, Spooner E, Ploegh HL (2011) Dual role of ancient ubiquitous protein 1 (AUP1) in lipid droplet accumulation and endoplasmic reticulum (ER) protein quality control. J Biol Chem 286(43):37602–37614. https://doi.org/10.1074/jbc.M111.284794 4. Anand P, Cermelli S, Li Z et al (2012) A novel role for lipid droplets in the organismal antibacterial response. eLife 1:e00003. https:// doi.org/10.7554/eLife.00003 5. Martin S, Parton RG (2006) Lipid droplets: a unified view of a dynamic organelle. Nat Rev Mol Cell Biol 7(5):373–378. https://doi.org/ 10.1038/nrm1912 6. Walther TC, Farese RV Jr (2012) Lipid droplets and cellular lipid metabolism. Annu Rev Biochem 81:687–714. https://doi.org/10. 1146/annurev-biochem-061009-102430 7. Gross DA, Silver DL (2014) Cytosolic lipid droplets: from mechanisms of fat storage to disease. Crit Rev Biochem Mol Biol 49 (4):304–326. https://doi.org/10.3109/ 10409238.2014.931337 8. Krahmer N, Farese RV, Walther TC (2013) Balancing the fat: lipid droplets and human disease. EMBO Mol Med 5(7):973–983. https://doi.org/10.1002/emmm. 201100671 9. Gong J, Sun Z, Li P (2009) CIDE proteins and metabolic disorders. Curr Opin Lipidol 20 (2):121–126. https://doi.org/10.1097/ MOL.0b013e328328d0bb 10. Xu L, Zhou L, Li P (2012) CIDE proteins and lipid metabolism. Arterioscler Thromb Vasc Biol 32(5):1094–1098. https://doi.org/10. 1161/ATVBAHA.111.241489

11. Wilfling F, Haas JT, Walther TC et al (2014) Lipid droplet biogenesis. Curr Opin Cell Biol 29:39–45. https://doi.org/10.1016/j.ceb. 2014.03.008 12. Pol A, Gross SP, Parton RG (2014) Review: biogenesis of the multifunctional lipid droplet: lipids, proteins, and sites. J Cell Biol 204 (5):635–646. https://doi.org/10.1083/jcb. 201311051 13. Murphy DJ, Vance J (1999) Mechanisms of lipid-body formation. Trends Biochem Sci 24 (3):109–115 14. Jacquier N, Choudhary V, Mari M et al (2011) Lipid droplets are functionally connected to the endoplasmic reticulum in Saccharomyces cerevisiae. J Cell Sci 124(Pt 14):2424–2437. https://doi.org/10.1242/jcs.076836 15. Ohsaki Y, Cheng J, Suzuki M et al (2008) Lipid droplets are arrested in the ER membrane by tight binding of lipidated apolipoprotein B-100. J Cell Sci 121(Pt 14):2415–2422. https://doi.org/10.1242/jcs.025452 16. Wilfling F, Wang H, Haas JT et al (2013) Triacylglycerol synthesis enzymes mediate lipid droplet growth by relocalizing from the ER to lipid droplets. Dev Cell 24(4):384–399. https://doi.org/10.1016/j.devcel.2013.01. 013 17. Krahmer N, Guo Y, Wilfling F et al (2011) Phosphatidylcholine synthesis for lipid droplet expansion is mediated by localized activation of CTP:phosphocholine cytidylyltransferase. Cell Metab 14(4):504–515. https://doi.org/10. 1016/j.cmet.2011.07.013 18. Fujimoto Y, Itabe H, Kinoshita T et al (2007) Involvement of ACSL in local synthesis of neutral lipids in cytoplasmic lipid droplets in human hepatocyte HuH7. J Lipid Res 48 (6):1280–1292. https://doi.org/10.1194/jlr. M700050-JLR200 19. Kuerschner L, Moessinger C, Thiele C (2008) Imaging of lipid biosynthesis: how a neutral lipid enters lipid droplets. Traffic 9 (3):338–352. https://doi.org/10.1111/j. 1600-0854.2007.00689.x

240

Dijin Xu et al.

20. Gong J, Sun Z, Wu L et al (2011) Fsp27 promotes lipid droplet growth by lipid exchange and transfer at lipid droplet contact sites. J Cell Biol 195(6):953–963. https://doi.org/10. 1083/jcb.201104142 21. Xu W, Wu L, Yu M et al (2016) Differential roles of cell death-inducing DNA fragmentation factor-alpha-like effector (CIDE) proteins in promoting lipid droplet fusion and growth in subpopulations of hepatocytes. J Biol Chem 291(9):4282–4293. https://doi.org/10. 1074/jbc.M115.701094 22. Wu L, Zhou L, Chen C et al (2014) Cidea controls lipid droplet fusion and lipid storage in brown and white adipose tissue. Sci China Life Sci 57(1):107–116. https://doi.org/10. 1007/s11427-013-4585-y 23. Zhang S, Shui G, Wang G et al (2014) Cidea control of lipid storage and secretion in mouse and human sebaceous glands. Mol Cell Biol 34 (10):1827–1838. https://doi.org/10.1128/ MCB.01723-13 24. Wang W, Lv N, Zhang S et al (2012) Cidea is an essential transcriptional coactivator regulating mammary gland secretion of milk lipids. Nat Med 18(2):235–243. https://doi.org/ 10.1038/nm.2614 25. Zhou L, Xu L, Ye J et al (2012) Cidea promotes hepatic steatosis by sensing dietary fatty acids. Hepatology 56(1):95–107. https://doi. org/10.1002/hep.25611 26. Zerial M, McBride H (2001) Rab proteins as membrane organizers. Nat Rev Mol Cell Biol 2 (2):107–117. https://doi.org/10.1038/ 35052055 27. Stenmark H (2009) Rab GTPases as coordinators of vesicle traffic. Nat Rev Mol Cell Biol 10 (8):513–525. https://doi.org/10.1038/ nrm2728 28. Ozeki S, Cheng JL, Tauchi-Sato K et al (2005) Rab18 localizes to lipid droplets and induces their close apposition to the endoplasmic reticulum-derived membrane. J Cell Sci 118 (12):2601–2611. https://doi.org/10.1242/ jcs.02401 29. Salloum S, Wang H, Ferguson C et al (2013) Rab18 binds to hepatitis C virus NS5A and promotes interaction between sites of viral replication and lipid droplets. PLoS Pathog 9(8): e1003513. https://doi.org/10.1371/journal. ppat.1003513 30. Martin S, Driessen K, Nixon SJ et al (2005) Regulated localization of Rab18 to lipid droplets: effects of lipolytic stimulation and inhibition of lipid droplet catabolism. J Biol Chem 280(51):42325–42335. https://doi.org/10. 1074/jbc.M506651200

31. Pulido MR, Diaz-Ruiz A, Jimenez-Gomez Y et al (2011) Rab18 dynamics in adipocytes in relation to lipogenesis, lipolysis and obesity. PLoS One 6(7):e22931. https://doi.org/10. 1371/journal.pone.0022931 32. Aligianis IA, Johnson CA, Gissen P et al (2005) Mutations of the catalytic subunit of RAB3GAP cause Warburg Micro syndrome. Nat Genet 37(3):221–223. https://doi.org/10. 1038/ng1517 33. Handley MT, Morris-Rosendahl DJ, Brown S et al (2013) Mutation spectrum in RAB3GAP1, RAB3GAP2, and RAB18 and genotype-phenotype correlations in Warburg micro syndrome and Martsolf syndrome. Hum Mutat 34(5):686–696. https://doi. org/10.1002/humu.22296 34. Liegel RP, Handley MT, Ronchetti A et al (2013) Loss-of-function mutations in TBC1D20 cause cataracts and male infertility in blind sterile mice and Warburg micro syndrome in humans. Am J Hum Genet 93 (6):1001–1014. https://doi.org/10.1016/j. ajhg.2013.10.011 35. Tagaya M, Arasaki K, Inoue H et al (2014) Moonlighting functions of the NRZ (mammalian Dsl1) complex. Front Cell Dev Biol 2:25. https://doi.org/10.3389/fcell.2014.00025 36. Hirose H, Arasaki K, Dohmae N et al (2004) Implication of ZW10 in membrane trafficking between the endoplasmic reticulum and Golgi. EMBO J 23(6):1267–1278. https://doi.org/ 10.1038/sj.emboj.7600135 37. Burri L, Varlamov O, Doege CA et al (2003) A SNARE required for retrograde transport to the endoplasmic reticulum. Proc Natl Acad Sci U S A 100(17):9873–9877. https://doi. org/10.1073/pnas.1734000100 38. Hatsuzawa K, Hirose H, Tani K et al (2000) Syntaxin 18, a SNAP receptor that functions in the endoplasmic reticulum, intermediate compartment, and cis-Golgi vesicle trafficking. J Biol Chem 275(18):13713–13720 39. Gillingham AK, Sinka R, Torres IL et al (2014) Toward a comprehensive map of the effectors of Rab GTPases. Dev Cell 31(3):358–373. https://doi.org/10.1016/j.devcel.2014.10. 007 40. Xu D, Li Y, Wu L et al (2018) Rab18 promotes lipid droplet (LD) growth by tethering the ER to LDs through SNARE and NRZ interactions. J Cell Biol 217(3):975–995. https:// doi.org/10.1083/jcb.201704184 41. Li C, Luo X, Zhao S et al (2017) COPITRAPPII activates Rab18 and regulates its lipid droplet association. EMBO J 36

Rab18 in LD-ER Contact (4):441–457. https://doi.org/10.15252/ embj.201694866 42. Li D, Zhao YG, Li D et al (2019) The ER-localized protein DFCP1 modulates ER-lipid droplet contact formation. Cell Rep 27(2):343–358 e345. https://doi.org/10. 1016/j.celrep.2019.03.025 43. Gao G, Sheng Y, Yang H et al (2019) DFCP1 associates with lipid droplets. Cell Biol Int. https://doi.org/10.1002/cbin.11199

241

44. Ariotti N, Hall TE, Rae J et al (2015) Modular detection of GFP-labeled proteins for rapid screening by electron microscopy in cells and organisms. Dev Cell 35(4):513–525. https:// doi.org/10.1016/j.devcel.2015.10.016 45. Lam SS, Martell JD, Kamer KJ et al (2015) Directed evolution of APEX2 for electron microscopy and proximity labeling. Nat Methods 12(1):51–54. https://doi.org/10.1038/ nmeth.3179

Chapter 17 Methods for Establishing Rab Knockout MDCK Cells Riko Kinoshita, Yuta Homma, and Mitsunori Fukuda Abstract The Rab family small GTPases are key regulators of intracellular membrane traffic that are conserved in all eukaryotic cells. Rabs are thought to regulate various steps of membrane traffic, including the budding, transport, tethering, docking, and fusion of vesicles or organelles. Approximately 60 different Rabs have been identified in mammals, and each Rab is thought to localize to a specific membrane compartment and regulate its trafficking in a timely manner. Although a few mammalian Rabs have been thoroughly studied, the precise function of the majority of them remains poorly understood. In a recent study, we established a comprehensive collection of Rab-knockout (KO) renal epithelial cells (i.e., Madin-Darby canine kidney [MDCK] II cells) by using Cas9-mediated genome editing technology to analyze the function of each Rab or closely related Rabs in cell viability (or growth), organelle morphology, and epithelial morphogenesis. In this chapter, we describe the procedures for generating Rab-KO MDCK II cells in detail. Key words CRISPR/Cas9, Epithelial cells, Gene knockout, MDCK II cells, Membrane traffic, Polarized trafficking, Rab GTPase

1

Introduction Intracellular membrane traffic between various organelles by means of vesicle carriers is one of the fundamental features of eukaryotic cells. The Rab family small GTPases are key regulators of this transport system, and they contribute to the structural and functional identity of organelles. Approximately 60 different Rab isoforms are present in mammals [1], and each isoform is thought to regulate various steps of membrane traffic, including the budding, transport, tethering, docking, and fusion of vesicles or organelles [2–5]. Rab cycling between a GDP-bound inactive state and a GTP-bound active state is spatiotemporally regulated by two key regulatory enzymes, a GTPase-activating protein (GAP) and a guanine nucleotide exchange factor (GEF) [6–10]. In the active state, Rab is thought to localize to a specific membrane compartment(s) and recruit its specific effector(s) that mediate membrane traffic [11, 12]. Although a few mammalian Rabs have been

Guangpu Li and Nava Segev (eds.), Rab GTPases: Methods and Protocols, Methods in Molecular Biology, vol. 2293, https://doi.org/10.1007/978-1-0716-1346-7_17, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

243

244

Riko Kinoshita et al.

thoroughly studied, the precise function of the majority of them remains unknown. Various approaches have been used to analyze the function of Rabs. The two frequently used approaches consist of overexpression of constitutively negative (CN) Rab mutants [13] and specific Rab knockdown with small interfering RNAs (si-RNAs). While these approaches have often been used to elucidate the function of various Rabs, certain drawbacks have become clear in recent years. One of the drawbacks of overexpression of CN Rab mutants is the very low level of expression of the CN mutants of several Rabs in cultured cells [14] and mice [15]. Moreover, Rab (CN) mutants can trap GEFs that activate several phylogenetically similar Rabs; for example, Rabin8 activates both Rab8 and Rab10 [16], which may cause inhibition of unrelated Rabs by a dominantnegative effect. One drawback of the siRNA approach is that the elimination of the target protein is often incomplete. To overcome these difficulties, we have recently established a comprehensive collection of Rab-KO renal epithelial cells (i.e., Madin-Darby canine kidney [MDCK] II cells) by using the Cas9-mediated genome editing technology [17], and we have analyzed their KO phenotypes with a particular focus on cell viability (or growth), organelle morphology, and epithelial morphogenesis. Closely related Rab-paralogs were simultaneously knocked out (e.g., Rab3A, Rab3B, Rab3C, and Rab3D) in our collection as a means of circumventing functional compensation, thereby making our Rab-KO collection a powerful tool for studying various membrane traffic events in the cell biology field. In this chapter, we describe detailed procedures for generating Rab-KO MDCK II cells, including material preparations, gene KO methods, and methods of checking for disruption of the target genes.

2

Materials All solutions should be prepared by using ultrapure water (>18 MΩ at 25
C) and analytical grade reagents.

2.1 MDCK II Cell Culture

1. MDCK II cells (The European Collection of Authenticated Cell Cultures; ECACC). 2. MDCK II cell culture medium: Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum, 100 U/mL penicillin G, and 100 μg/mL streptomycin. Store at 4
C. 3. Dulbecco’s phosphate-buffered saline (PBS). Store at room temperature (RT). 4. Cell dissociation solution: 0.125% or 0.25% trypsin and 0.02% EDTA (ethylenediaminetetraacetic acid). Store at 4
C.

Establishment of Rab Knockout Epithelial Cells

245

5. 15-mL and 50-mL conical tubes. 6. 60-mm and 100-mm cell culture dishes. 7. Cell cryopreservation solution. 2.2 Plasmid Construction

1. pSpCas9(BB)-2A-Puro (PX459) vector (Addgene; now replaced by an improved version 2.0) [18]. 2. BbsI and its 10 specific buffer, both of which can be purchased from various suppliers. Store at 20
C. 3. 1% agarose gel in TAE: 40 mM Tris–acetate and 10 mM EDTA. 4. Agarose gel DNA extraction kit. 5. 50 μM sense and antisense oligonucleotides for single guide RNA. Store at 20
C. 6. 5 M NaCl. 7. TE: 10 mM Tris–HCl, pH 8.0 and 1 mM EDTA. 8. DNA ligation kit. 9. DH5α competent cells and LB (Luria-Bertani) agar plates containing 100 μg/mL ampicillin. 10. 200-μL PCR-tubes. 11. 1.5-mL tubes. 12. Plasmid DNA purification kit. 13. BigDye Terminator v3.1 Cycle Sequencing Kit. 14. 5 μM pSpCas9 sequence primer: 50 -ACTATCATATGCTTACCGTAAC-30 . 15. TA-cloning vector (see Note 1).

2.3 Plasmid Transfection and Selection of KO Cells

1. Parental MDCK II cells cultured in 60-mm cell culture dishes (see Subheadings 2.1 and 3.1). 2. Single guide RNA (sgRNA)- and Cas9-coding plasmids (see Subheadings 2.2 and 3.3). 3. Transfection reagent (see Note 2). 4. Antibiotic for selection: puromycin. Store at 20
C. 5. 12-well, 24-well, and 96-well cell culture plates.

2.4

Immunoblotting

1. Puromycin-selected and cloned MDCK II cells (see Subheadings 2.3 and 3.5.3) in 24-well cell culture plates. 2. Cell lysis buffer (1 SDS sample buffer): 62.5 mM Tris–HCl, pH 6.8, 2% SDS, 0.02% bromophenol blue, 2% 2-mercaptoethanol, and 10% glycerol. 3. Primary antibodies against target gene products. 4. Horseradish antibodies.

peroxidase

(HRP)-conjugated

secondary

246

Riko Kinoshita et al.

5. Chemiluminescence detection kit. 2.5 Genomic PCR and Electrophoresis

1. Parental and cloned MDCK II cells (see Subheadings 2.3 and 3.5.3) in 12-well cell culture plates. 2. Digestion buffer: 100 mM NaCl, 10 mM Tris–HCl, pH 8.0, 25 mM EDTA, 0.5% SDS, and 0.1 mg/mL proteinase K. 3. Phenol–chloroform. 4. 3 M sodium acetate. 5. 100% and 70% ethanol. 6. TE. 7. Takara LA Taq® DNA polymerase with GC Buffer (Clontech Takara, Shiga, Japan). 8. 50 μM genomic PCR sense and antisense primers. 9. 1% agarose gel in TAE. 10. Agarose gel DNA extraction kit.

2.6 Direct Sequencing of Genomic PCR Products

3

1. Purified genomic PCR products of target genes from parental and cloned MDCK II cells (see Subheadings 2.5 and 3.5.3). 2. BigDye Terminator v3.1 Cycle Sequencing Kit. 3. 5 μM genomic PCR sense or antisense primer.

Methods

3.1 MDCK II Cell Culture

1. Check the degree of confluency of MDCK II cells in 100-mm cell culture dishes. MDCK II cells should be passaged at 80% confluency. 2. Aspirate the cell culture medium, and wash the cells with 5 mL of PBS twice. 3. Dissociate the cells with 500 μL of 0.125% trypsin–EDTA at 37
C for 5–10 min. 4. Suspend the cells with 4.5 mL of cell culture medium, and transfer them into a 15-mL conical tube. 5. Centrifuge the cells at 180  g at RT for 2 min. 6. Aspirate the supernatant, and resuspend the cells with 5 mL of fresh cell culture medium. 7. Count the number of cells. 8. Seed 1  105 cells in 10 mL of fresh cell culture medium in a 100-mm cell culture dish. 9. Incubate the cells at 37
C under 5% CO2.

Establishment of Rab Knockout Epithelial Cells

3.2 Selection of KO Target Sites

247

1. Use the web tool, CRISPRdirect [19] (see Fig. 1). 2. Input a coding sequence of a gene of interest (Fig. 1, box 1). 3. Set an animal species (dog in this case) for a specificity check (Fig. 1, box 2). 4. Press the “design” button (Fig. 1, box 3). 5. Choose a target sequence of the CRISPR/Cas9 system from the candidate list. The target sequence should be unique in the genome (i.e., “20 mer + PAM [protospacer adjacent motif] column” in the list should be “1”) (Fig. 1, boxes 4 and 5), and it should not be located in exon/intron (or intron/exon) junctions (see Notes 3 and 4).

3.3 Construction of sgRNAand Cas9-Coding Plasmids

1. Mix together 0.5 μg of pSpCas9(BB)-2A-Puro vector, 1 μL of 10 specific buffer, and 0.5 μL of BbsI, and adjust the volume to 10 μL with sterile ultrapure water in a 1.5-mL tube.

3.3.1 Digestion of the pSpCas9 Vector

3. Separate the vector by performing 1% agarose gel electrophoresis, and purify it from the gel with an agarose gel DNA extraction kit.

2. Incubate the tube at 37
C for ~6 h.

4. Suspend the purified vector in 2 μL of sterile ultrapure water. 3.3.2 Design of Sense and Antisense sgRNACoding-Oligonucleotides and Their Annealing

1. Design and synthesize the sgRNA-coding oligonucleotides commercially as follows (Fig. 1, box 4; see Subheading 2.2, item 5): For the sense strand, add “CACCG” to the 50 side of the target sequence (underlined) (e.g., CACCG ATCCTCATCATCGGCGAGAG for canine Rab18). For the antisense strand, add “AAAC” and “C” to the 50 side and the 30 side, respectively, of the complementary sequence of the target (underlined) (e.g., AAACCTCTCGCCGATGATGAGGAT C for canine Rab18). 2. Mix together a 4 μL volume each of 50 μM sense and antisense oligonucleotides for the guide RNA, 0.4 μL of 5 M NaCl, and 11.6 μL of sterile ultrapure water (total volume: 20 μL) in a 200-μL PCR-tube. 3. Set the tube in a thermal cycler, and gradually reduce its temperature from 95
C to 4
C for ~1 h. 4. Dilute the annealed product 200 fold with TE.

3.3.3 Preparation of pSpCas9 Vector Carrying sgRNA-CodingOligonucleotides

1. Mix together 1.5 μL of annealed oligonucleotides (1/200 diluted; see step 4 in Subheading 3.3.2), 0.5 μL of pSpCas9 vector (BbsI digested; see step 4 in Subheading 3.3.1), and DNA ligation kit solution. 2. Transform DH5α competent cells with the ligation product. 3. Plate the cells on LB agar plates containing ampicillin, and incubate them at 37
C overnight.

248

Riko Kinoshita et al.

Fig. 1 Procedure for selecting a Rab18-KO target site with CRISPRdirect (see Subheading 3.2). [Step 1] Paste a coding sequence of canine Rab18 (or of a gene of interest). [Step 2] Set the animal species of the MDCK II cells to “dog.” [Step 3] Press the “design” button for the search. [Step 4] Select a target sequence for Rab18KO. [Step 5] “20 mer + PAM” in “number of target sites” should be “1” for KO specificity. [Step 6] Check the chromosomal location of the target sequence

Establishment of Rab Knockout Epithelial Cells

249

4. Purify plasmid DNAs by the standard molecular biology techniques using a mini-scale or large-scale plasmid DNA purification kit, and confirm their sequences by using the pSpCas9 sequence primer. 3.4 Primer Design for Genomic PCR 3.4.1 Check for a Genomic Location of the Target Sequence

3.4.2 Acquisition of a Genomic Sequence around the Target Sequence

1. Use the results page of CRISPRdirect searched for the target sequence [19] (see Fig. 1). 2. Press the “detail” button in the “20 mer + PAM” column in the list (Fig. 1, box 5). 3. Check the genomic location of the target sequence (e.g., chromosome 2 [chr2]: 6111833–6111855 for canine Rab18; Fig. 1, box 6). 1. Search for the accession number of a chromosomal sequence containing the target sequence (e.g., NC_006584.3 for canine chr2, in which the Rab18 gene is located) in the National Center for Biotechnology Information (NCBI) database. 2. Acquire the chromosomal region of approximately 1000 bases containing the target sequence (e.g., 6111333–6112333 for canine Rab18, see step 3 in Subheading 3.4.1) as a FASTA format. 3. Save the genomic sequence obtained.

3.4.3 Primer Design for Genomic PCR

1. Design genomic PCR primers (~30 base pairs [bp]) with any available tools to obtain a 300–600 bp PCR product. 2. Check the amplification efficiency of the primers in a genomic PCR by using genomic DNA of parental MDCK II cells as a template in advance (see Subheading 3.6.2).

3.5 Establishment of Rab-KO MDCK II Cell Lines 3.5.1 Transfection of sgRNA/Cas9-Coding Plasmids

1. Seed 1  105 cells in 4 mL of MDCK II cell culture medium in two 60-mm cell culture dishes (one dish is used for untransfected control cells). 2. Incubate the cells at 37
C under 5% CO2 overnight. 3. Transfect the cells with 2 μg of sgRNA/Cas9-coding plasmids by using a transfection reagent (see Notes 2 and 5). 4. Incubate the cells for 24 h at 37
C under 5% CO2.

3.5.2 Selection of PlasmidTransfected Cells

1. Replace the cell culture medium with 3 mL of fresh culture medium, and add puromycin to the medium of two dishes (prepared as described in step 4 in Subheading 3.5.1) (see Note 6). 2. When the untransfected control cells have almost died, replace the medium of the transfected cells with 4 mL of fresh puromycin-free cell culture medium. 3. Incubate the transfected cells for additional 2–3 days.

250

Riko Kinoshita et al.

3.5.3 Cloning of PlasmidTransfected Cells

1. Aspirate the cell culture medium, and wash the transfected cells with 2 mL of PBS twice. 2. Dissociate the cells with 300 μL of 0.125% trypsin–EDTA at 37
C for 5–10 min. 3. Suspend the cells with 3 mL of cell culture medium to separate them from each other, and transfer them into a 15-mL conical tube. 4. Centrifuge the cells at 180  g at RT for 2 min. 5. Aspirate the supernatant, and resuspend the cells with 5 mL of fresh cell culture medium. 6. Count the number of cells. 7. Dilute the cell suspension into 11 mL of fresh medium (final cell number ¼ 110 cells/11 mL) in a 50-mL conical tube. 8. Transfer 100 μL of the diluted cell suspension to each well of a 96-well cell culture plate (see Note 7). 9. Incubate the cells for approximately 7 days. 10. Mark the wells that contain a single colony (see Note 8). 11. Aspirate the medium in the marked wells, and wash the cells with 350 μL of PBS twice (see Note 9). 12. Add 10 μL of 0.25% trypsin–EDTA to the remaining PBS (~100 μL) in the wells, and dissociate the cells at 37
C for 5–10 min. 13. Suspend the cells with 100 μL of the cell culture medium, and transfer them into 1 mL of fresh cell culture medium in 24-well cell culture plates. 14. Continue cell passage in 24-well cell culture plates until disruption of the target genes has been verified (see Subheading 3.6). 15. Preserve the established cell lines by transferring to cell cryopreservation solution and storing in a deep-freezer or liquid nitrogen.

3.6 Check for Disruption of Targeted Genes 3.6.1 Check for Protein Expression by Immunoblotting

1. Seed cloned MDCK II cells (established as described in Subheading 3.5.3) in 1 mL of MDCK II cell culture medium in 24-well cell culture plates. 2. Incubate the cells at 37
C under 5% CO2 overnight. 3. Wash the cells with 500 μL of PBS twice. 4. Add 150 μL of the cell lysis buffer to the well, and transfer the cell lysates into 1.5-mL tubes. 5. Boil the lysates at 98
C for 10 min.

Establishment of Rab Knockout Epithelial Cells

251

Fig. 2 Screening for Rab18-KO clones by immunoblotting (see Subheading 3.6.1). Total cell lysates of the clones isolated were subjected to immunoblot analysis with anti-Rab18 antibody (Ab) (top panel) followed by amido black staining (bottom panel). Note that Rab18 expression was completely lost in four (Rab18-KO clone No. 23, 25, 30, and 31) of the 23 clones isolated

6. Test for protein expression by the target genes by performing SDS polyacrylamide gel electrophoresis (PAGE) followed by conventional immunoblotting using polyvinylidene difluoride (PVDF) membranes. 7. Detect immunoreactive bands by using a chemiluminescence detection kit (a representative result is shown in Fig. 2). 3.6.2 Check for Genomic DNA by Direct Sequencing

1. Seed parental and cloned MDCK II cells (established as described in Subheading 3.5.3) in 1.5 mL of MDCK II cell culture medium in 12-well cell culture plates.

Preparation of Genomic DNA of MDCK II Cells

2. Incubate the cells at 37
C under 5% CO2 overnight. 3. Wash the cells with 1 mL of PBS twice. 4. Add 250–300 μL of the digestion buffer to the wells, and transfer the cell lysates into 1.5-mL tubes. 5. Gently shake the lysates at 50
C overnight. 6. Add 200 μL of phenol–chloroform to the tubes, and vortex the mixtures vigorously. 7. Centrifuge the tubes at 17,800  g at RT for 2 min. 8. Transfer the supernatants into new 1.5-mL tubes. 9. Add 30 μL of 3 M sodium acetate and 750 μL of 100% ethanol to the supernatants, and mix thoroughly. 10. Centrifuge the solutions at 17,800  g at 4
C for 5 min (see Note 10). 11. Remove the supernatants. 12. Rinse the pellets with 400 μL of 70% ethanol. 13. Centrifuge the pellets at 17,800  g at 4
C for 2 min. 14. Remove the supernatants. 15. Repeat steps 12–14 once. 16. Dry, and then dissolve the DNA pellets with 35 μL of TE.

252

Riko Kinoshita et al.

Genomic PCR

1. Mix together 10 μl of 2 GC buffer II, 3.2 μL of 2.5 mM dNTPs, 0.2 μL each of 50 μM sense and antisense genomic PCR primers (designed as described in Subheading 3.4), 1 μL of genomic DNA template (prepared as described in step 16 in Subheading 3.6.2.1), 5.2 μL of sterile ultrapure water, and 0.2 μL of Takara LA Taq® DNA polymerase (total volume: 20 μL) in 200-μL PCR-tubes. 2. Perform a PCR under the following conditions: predenaturation at 94
C for 2 min followed by 35 cycles of denaturation at 94
C for 30 s, annealing at 60
C for 30 s, and extension at 72
C for 1 min.

Direct Sequencing

1. Separate the genomic PCR products (prepared as described in Subheading 3.6.2.2) by 1% agarose gel electrophoresis, and purify them from the gel with an agarose gel DNA extraction kit. 2. Suspend the purified genomic PCR products in 8.3 μL of sterile ultrapure water. 3. Determine the genomic sequence by using 8.3 μL of the purified genomic PCR products as a template, 0.2 μL of 5 μM genomic PCR sense or antisense sequence primer, and BigDye Terminator v3.1 Cycle Sequencing Kit (total volume: 10 μL) (representative results are shown in Fig. 3a). 4. If more than one genomic mutation is observed (see Fig. 3a, heterogeneous mutations), the sequences must be checked separately by cloning the heterogeneous genomic PCR products (proceed to Subheading 3.6.2.4).

Subcloning of Genomic DNA

1. Separate the genomic PCR products (prepared as described in Subheading 3.6.2.2) by performing 1% agarose gel electrophoresis, and purify them from the gel with an agarose gel DNA extraction kit. 2. Suspend the purified genomic PCR products in 1.5 μL of sterile ultrapure water. 3. Mix together 1.5 μL of the purified genomic PCR products, 0.5 μL of TA-cloning vector, and 2 μL of DNA ligation kit solution. 4. Transform DH5α competent cells with the ligation product. 5. Plate the cells on LB agar plates containing an appropriate antibiotic (e.g., ampicillin) for selection, and incubate them at 37
C overnight. 6. Purify plasmid DNAs by the standard molecular biology techniques using a mini-scale plasmid DNA purification kit, and analyze their sequences by using an appropriate sequence primer (see Notes 1 and 11) to determine each genomic mutation (see Fig. 3b and Note 12).

Establishment of Rab Knockout Epithelial Cells

253

Fig. 3 Representative sequences of genomic PCR products from Rab18-KO clones. (a) Sequencing data of genomic PCR products from Rab18-KO#31 and #25 cells. Purified genomic PCR products of Rab18-KO#31 and #25 cells were subjected to direct sequencing analysis with a Rab18-sense-genomic PCR primer and a BigDye Terminator v3.1 Cycle Sequencing Kit (see Subheading 3.6.2.3). [Rab18-KO#31: a homogeneous mutation] When the same mutation occurs in all alleles (i.e., 1-nucleotide (nt) insertion [circle and double arrow] in the target sequence [underlined]), sequences are homogeneous even in the downstream of the PAM (boxed) sequence (i.e., single peaks). [Rab18-KO#25: heterogeneous mutations] When more than one mutation occurs in different alleles, heterogeneous sequences should be observed in the downstream of the PAM sequence (i.e., several mixed peaks). (b) Genomic mutations in Rab18-KO#25 cells. Rab18-KO#25

254

4

Riko Kinoshita et al.

Notes 1. We use pGEM®-T Easy Vector Systems (Promega, Madison, WI) for TA-cloning of genomic PCR products. T7 and SP6 primers are used to sequence pGEM-T Easy vectors that harbor the genomic PCR products. 2. We use Lipofectamine™ 2000 (Thermo Fisher Scientific, Waltham, MA) for efficient transfection of MDCK II cells. 3. We try to choose a target sequence in the conserved aminoterminal phosphate/magnesium-binding motifs or guanine base-binding motifs of Rab small GTPases so that indels (insertions/deletions) occur at the N-terminal region. If frameshift mutations occur at the N-terminal region of a Rab, the remaining C-terminal region would not be expressed at the protein level. A short N-terminal truncated protein would be expressed, but it would be nonfunctional because of the presence of indels in the conserved motifs. 4. If no specific antibody is available to check for expression by immunoblotting, choosing a target sequence that contains a restriction enzyme site is highly recommended, because it would be easy to check for a genomic mutation of the target gene by digestion with an appropriate restriction enzyme (see Fig. 1, “restriction sites” column). 5. When we establish Rab-subfamily KO cells (e.g., Rab2A/2Bdouble KO cells) [17], we simultaneously transfect parental MDCK II cells with up to two sgRNA/Cas9-coding plasmids (e.g., sgRNAs for Rab2A and Rab2B) (1 μg each). 6. We treat the cells with 2 μg/mL puromycin for 24 h to select plasmid-transfected MDCK II cells. However, the concentration used for puromycin treatment should be determined according to the culture conditions in each laboratory prior to selection. 7. Checking for the occurrence of indels in the cell population can be performed by immunofluorescence staining of puromycinselected cells (prepared as described in step 3 in Subheading 3.5.2) or by direct sequencing of the genomic PCR products of target genes (see Subheading 3.6.2).

ä Fig. 3 (continued) genomic PCR products were subcloned into the pGEM-T Easy vector and transformed into DH5α bacteria. Nine independent bacterial colonies were randomly picked up, and their plasmid DNAs were purified followed by sequencing analysis (see Subheading 3.6.2.4). Four different types of mutations (7-nt deletion, 6-nt deletion, 1-nt insertion, and 2-nt insertion) were obtained. The PAM and target sequences are boxed and highlighted in gray, respectively

Establishment of Rab Knockout Epithelial Cells

255

8. In order to obtain a homogenous cell line we avoid wells that contain more than one colonies. 9. When we replate cell colonies from a 96-well cell culture plate to 24-well cell culture plates, we replate a maximum of 15 wells at a time to avoid drying. We strongly recommend leaving a small volume of PBS (~100 μL) in the well when aspirating PBS (i.e., not completely aspirating the PBS), because colonies tend to dry out during the washing process. 10. After centrifugation, white DNA pellets can be seen at the bottom of the 1.5-mL tubes. 11. We determine at least eight cloned genomic sequences in each cell line that contains several different genomic mutations (see Fig. 3b). 12. To exclude any nonspecific effect derived from clonal selection or an off-target effect of Cas9, it is highly recommended to analyze at least two independent KO clones and perform rescue experiments.

Acknowledgments This work was supported in part by Grant-in-Aid for Young Scientists from the Ministry of Education, Culture, Sports, Science and Technology (MEXT) of Japan (grant number 18K14692 to Y.H.), Grant-in-Aid for Scientific Research(B) from the MEXT (grant number 19H03220 to M.F.), and by Japan Science and Technology Agency (JST) CREST (grant Number JPMJCR17H4 to M.F.). The authors declare no competing financial interests. References 1. Pereira-Leal JB, Seabra MC (2001) Evolution of the Rab family of small GTP-binding proteins. J Mol Biol 313:889–901 2. Zerial M, McBride H (2001) Rab proteins as membrane organizers. Nat Rev Mol Cell Biol 2:107–117 3. Fukuda M (2008) Regulation of secretory vesicle traffic by Rab small GTPases. Cell Mol Life Sci 65:2801–2813 4. Stenmark H (2009) Rab GTPases as coordinators of vesicle traffic. Nat Rev Mol Cell Biol 10:513–525 5. Hutagalung AH, Novick PJ (2011) Role of Rab GTPases in membrane traffic and cell physiology. Physiol Rev 91:119–149 6. Nottingham RM, Pfeffer SR (2009) Defining the boundaries: Rab GEFs and GAPs. Proc Natl Acad Sci 106:14185–14186

7. Barr F, Lambright DG (2010) Rab GEFs and GAPs. Curr Opin Cell Biol 22:461–470 8. Fukuda M (2011) TBC proteins: GAPs for mammalian small GTPase Rab? Biosci Rep 31:159–168 9. Ishida M, Oguchi ME, Fukuda M (2016) Multiple types of guanine nucleotide exchange factors (GEFs) for Rab small GTPases. Cell Struct Funct 41:61–79 10. Lamber EP, Siedenburg AC, Barr FA (2019) Rab regulation by GEFs and GAPs during membrane traffic. Curr Opin Cell Biol 59:34–39 11. Fukuda M, Kanno E, Ishibashi K, Itoh T (2008) Large scale screening for novel Rab effectors reveals unexpected broad Rab binding specificity. Mol Cell Proteomics 7:1031–1042

256

Riko Kinoshita et al.

12. Kanno E, Ishibashi K, Kobayashi H, Matsui T, Ohbayashi N, Fukuda M (2010) Comprehensive screening for novel Rab-binding proteins by GST pull-down assay using 60 different mammalian Rabs. Traffic 11:491–507 13. Feig LA (1999) Tools of the trade: use of dominant-inhibitory mutants of Ras-family GTPases. Nat Cell Biol 1:E25–E27 14. Oguchi ME, Etoh K, Fukuda M (2018) Rab20, a novel Rab small GTPase that negatively regulates neurite outgrowth of PC12 cells. Neurosci Lett 662:324–330 15. Ramalho JS, Anders R, Jaissle GB, Seeliger MW, Huxley C, Seabra MC (2002) Rapid degradation of dominant-negative Rab27 proteins in vivo precludes their use in transgenic mouse models. BMC Cell Biol 3:26

16. Homma Y, Fukuda M (2016) Rabin8 regulates neurite outgrowth in both GEF-activitydependent and -independent manners. Mol Biol Cell 27:2107–2118 17. Homma Y, Kinoshita R, Kuchitsu Y, Wawro PS, Marubashi S, Oguchi ME, Ishida M, Fujita N, Fukuda M (2019) Comprehensive knockout analysis of the Rab family GTPases in epithelial cells. J Cell Biol 218:2035–2050 18. Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F (2013) Genome engineering using the CRISPR-Cas9 system. Nat Protoc 8:2281–2308 19. Naito Y, Hino K, Bono H, Ui-Tei K (2015) CRISPRdirect: software for designing CRISPR/Cas guide RNA with reduced off-target sites. Bioinformatics 31:1120–1123

Chapter 18 Generating Rab6 Conditional Knockout Mice Sabine Bardin and Bruno Goud Abstract RAB6 GTPase is the most abundant Golgi-associated RAB protein and regulates several transport steps at the level of this organelle. Homozygous Rab6a knockout (k/o) is embryonic lethal in mouse. To study RAB6 function in cell lineages and tissues, we thus generated various conditional Rab6a knockout (k/o) mice using the Cre/lox system. Key words RAB GTPases, Golgi, knockout (k/o) mice, Cre/lox system

1

Introduction RAB GTPases form a large family of proteins (over 60 in humans) that are key regulators of intracellular vesicular traffic [1]. Most of our knowledge on RAB function in mammals comes from studies performed with cultured cells. However, the available mouse models have been instrumental for clarifying the function of several RAB proteins, including RAB3, RAB8, RAB10, and RAB11, in a physiological context [2]. The RAB6 sub-family consists of 4 proteins named RAB6A, RAB6A’, RAB6B, and RAB6C. RAB6A’ is generated by alternative splicing of the RAB6A gene and differs from RAB6A by only three amino acids [3]. Both proteins are ubiquitously expressed and localize to membranes of the Golgi apparatus and of the transGolgi network (TGN) where they regulate various transport pathways [4]. RAB6B is encoded by a separate gene and is mostly expressed in neurons and neuroendocrine cells [5]. Its exact function is still poorly known. RAB6C is a primate-specific retrogene transcribed in a limited number of human tissues. It localizes to centrosome and is involved in cell cycle progression [6].

Guangpu Li and Nava Segev (eds.), Rab GTPases: Methods and Protocols, Methods in Molecular Biology, vol. 2293, https://doi.org/10.1007/978-1-0716-1346-7_18, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

257

258

Sabine Bardin and Bruno Goud

Fig. 1 The Rab6a gene (that generates the two ubiquitous isoforms RAB6A and RAB6A0 ) consists of 8 exons, the exon 4 being duplicated. LoxP sequences are inserted at each side of this exon (upper panel). The deletion of exon 4 by the Cre recombinase could generate truncated versions of the RAB6 protein (lower panel)

The mouse Rab6a gene is located on chromosome 7 and consists of 8 exons, exon 4 being duplicated to generate the RAB6A and RAB6A’ isoforms. To delete exon 4, loxP sequences were inserted on each side of this exon (Fig. 1, upper panel). The advantage of this strategy is a small distance between the two loxP sites (about 0.5 kb) and a frame shift induced by splicing from exon 3 to exon 5. On the other hand, a truncated protein of 87 aa (including 61 aa of RAB6 N-terminus) might be produced, as well as a truncated protein of 58 aa corresponding to the C-terminus of RAB6 if translation is reinitiated at ATG present in exon 6 (Fig. 1, lower panel). However, we obtained no evidence that these truncated forms were produced. To obtain constitutive and ubiquitous invalidation of Rab6a, the floxed strain was crossed with a mouse strain providing the Cre recombinase gene under the control of the PGK (phosphoglycerate kinase) promoter. The result of this breeding shows that the constitutive Rab6a k/o is embryonic lethal at 5.5 days postcoitum. Rab6 k/o embryos are characterized by a disorganization of the embryonic layers including a loss of polarization of the epiblast cells as well as alterations of the basement membrane [7]. Of note, Rab6 k/o phenotype is very similar to the one resulting from β1 integrin k/o.

Conditional Rab6 k/o

259

To obtain inducible and ubiquitous invalidation of Rab6a, the floxed strain was crossed with a strain expressing a fusion protein of Cre recombinase and a mutant estrogen receptor ligand-binding domain (Cre-ERT2) from the Rosa26 locus. To obtain constitutive or inducible invalidation of Rab6a in specific cell lineages and tissues, the floxed strain was crossed with mouse strains providing the Cre recombinase gene under the control of several specific Cre promoters including Blg (β-lactoglobulin), CD4, Emx1, FoxG1, Nestin, Tyr (Tyrosinase), and Villin. 1.1

2 2.1

2.2

Major outcomes

The generation of several conditional Rab6a k/o mouse models allows to study the contribution of RAB6-dependent trafficking pathways in various cellular processes such as cell adhesion, cell secretion, cell migration, or cell polarity. The depletion of RAB6 in mammary luminal cells has revealed its important role in the lactogenic function of the mammary gland although the polarized organization of the mammary epithelial bilayer is preserved [8]. The depletion of RAB6 in the T cell lineage (CD4+) impairs retrograde transport of LAT (adapter molecule linker for activation of T cells) between the plasma membrane and the Golgi, resulting in strong defects in T cell activation [9]. These results and ongoing work suggest that RAB6 function depend on cell type specialization and tissues context.

Materials Mice

Tamoxifen

l

Breeding in the animal facility of the Institut Curie (see Note 1).

l

Emx1-Cre mice from Jackson Laboratory.

l

PGK-Cre+/; Rab6a loxP/WT.

l

Rosa26CreERT2+/; Rab6a loxP/loxP.

l

Blg-Cre+/; Rab6a loxP/loxP.

l

Tyr-Cre+/; Rab6a loxP/loxP.

l

Villin-Cre+/; Rab6a loxP/WT.

l

Villin-CreERT2+/; Rab6a loxP/loxP.

l

Nestin-Cre+/; Rab6a loxP/loxP.

l

FoxG1-Cre+/; Rab6a loxP/loxP.

l

Emx1-Cre+/; Rab6a loxP/loxP.

l

Stock solution: Sigma T5648; 10 mg/mL in ethanol–corn oil (0.5:9.5) (see Note 2).

260

Sabine Bardin and Bruno Goud

2.3 4-hydroxy (OH) Tamoxifen

l

Stock solution: Sigma H7904; 5 mM in ethanol (see Note 3).

2.4

l

MEFs (mouse embryonic fibroblasts): DMEM (Gibco) supplemented with 10% (v/v) fetal calf serum (Eurobio) and 100 U/ mL penicillin–streptomycin (Gibco); 5% CO2 humidified air incubator.

l

Primary mouse melanocytes: Ham’s F-12 Nutrient Mix (Sigma), GlutaMAX supplement (Gibco) supplemented with 10% FCS (Eurobio), 1% antibiotics (Gibco) and 200 nM phorbol 12-myristate 13-acetate (Sigma) [10, 11]; 5% CO2 humidified air incubator.

l

Primary neurons: Neurobasal (Gibco) supplemented with 2% B27 (Gibco), GlutaMAX supplement (Gibco) and 1% penicillin–streptomycin (Gibco); 5% CO2 humidified air incubator.

l

Immunofluorescence experiments on cultured cells: human anti-RAB6:GTP (AA2) from the Recombinant Antibody Platform of the Institut Curie (https://science.institut-curie.org/ platforms/therapeutic-recombinant-antibodies/) (1:100); rabbit anti-RAB6 (Santa Cruz, sc-310) (1:100); homemade affinity-purified rabbit anti-RAB6 [12] (1:1000).

l

Immunohistofluorescence on tissues: rabbit anti- RAB6 (Santa Cruz, sc-310) (1: 100).

l

Immunoblotting: rabbit anti-RAB6 (Santa Cruz, sc-310) (1: 1000); homemade rabbit anti-RAB6 [12] (1:2000).

2.5

3 3.1

Culture Media

RAB6 Antibodies

Methods In Vitro Studies

Cells are derived from Rosa26CreERT2+/; Rab6aloxP/loxP mice.

3.1.1 Preparation of MEFs (Mouse Embryo Fibroblasts)

MEFs are prepared as described in [13] with the following modifications: E12.5 embryos instead of E13–14; the whole head (and not only the part above the eyes), the heart, the liver, the legs and the tail are removed. To deplete RAB6, cells are incubated with 1μM 4-OH tamoxifen for 96 h [14] (see Note 4).

3.1.2 Preparation of Melanocytes

Primary mouse melanocytes are derived and cultured using an established procedure [15]. Briefly, skin melanocytes are explanted from 4–5-day-old mice. RAB6 depletion is achieved by incubation of cells with 500 nM 4-OH tamoxifen for 5 days.

Conditional Rab6 k/o

261

3.1.3 Preparation of Neurons

Primary neurons are prepared essentially as described in [16]. Briefly, the cortex of mice embryos is dissected at E16.5. After trypsinization, dissociation is achieved with a fire-polished Pasteur pipette. Cells are counted and plated on poly-D-lysine– coated 12 mm diameter glass coverslips at a density of 250,000 cells/cm2. The medium is changed 4 h after plating. To deplete RAB6, cells are treated with 500 nM 4-OH tamoxifen for 4 days.

3.2

The floxed strain is crossed with a mouse strain expressing the Cre recombinase under the control of the tyrosinase (Tyr) promoter. Tyr expression is detected around 10 days postcoitum [17].

In Vivo Studies

3.2.1 RAB6 in the Melanocyte Lineage 3.2.2 RAB6 in the T cell Lineage

The floxed strain is crossed with transgenic CD4-Cre mice [9]. CD4-Cre transgenic mice contain CD4 enhancer, promoter and silencer sequences driving the expression of the Cre recombinase gene. Hemizygotes are viable and fertile. Specifically, Cre recombinase expression is observed in CD4-expressing T cells during sequential stages of T cell development in lymphoid tissues. Cre expression starts at the very late double-negative stage and generally results in >99% deletion of loxP flanked genes by the doublepositive stage of T-cell development.

3.2.3 RAB6 in the Gut Epithelium

The floxed strain is crossed with transgenic mice expressing the Cre recombinase under the control of the Villin promoter. Villin expression starts around 9 days postcoitum [18].

3.2.4 RAB6 in the Mammary Gland

The female floxed strain is crossed with a mouse strain (male) expressing the Cre recombinase under the control of the β-lactoglobin promoter (Blg). β-lactoglobin is expressed in the luminal cells of mammary gland during gestation [19].

3.2.5 RAB6 in the Brain

The floxed strain is crossed with transgenic mice expressing the Cre recombinase under the control of different promoters: Nestin whose expression is detected in the central nervous system at 10.5 days postcoitum [20]; FoxG1 whose expression is detected at 8 days postcoitum [21]; and Emx1 whose expression is detected at 8 days postcoitum [22]. Each promoter has different advantages and disadvantages: specificity and high penetrance (Emx1), specificity and low penetrance (Nestin), and less specificity and high penetrance (FoxG1).

4

Notes 1. The care and use of mice must strictly follow national and international rules for the protection of vertebrate animals dedicated to experimental and other scientific purposes.

262

Sabine Bardin and Bruno Goud

2. This solution is used for intraperitoneal injections. Finding the adequate concentration of tamoxifen requires several assays to determine the right kinetics of injections and the time of analysis postinjection. 3. This solution is used for cultured cells. Finding the adequate concentration of 4-OH tamoxifen requires several assays. The dose and the length of incubation depends on the cell type. Usually, a good depletion is obtained when tamoxifen is added when cells are seeded. Depletion is less efficient when cells are at confluency. 4. Cells are used for experiments until passage 5.

Acknowledgments This work was supported by grants from Institut Curie, CNRS, the European Research Council (ERC, MYODYN project), the Agence Nationale pour la Recherche (ANR), and Inserm for the generation of k/o mice at the MCI/ICS (Institut Clinique de la Souris, Illkirch, France). References 1. Hutagalung AH, Novick PJ (2011) Role of Rab GTPases in membrane traffic and cell physiology. Physiol Rev 91(1):119–149 2. Homma Y, Hiragi S, Fukuda M (2020) Rab family of small GTPases: an updated view on their regulation and functions. FEBS J. https://doi.org/10.1111/febs.15453; Online ahead of print 3. Echard A, Opdam FJ, de Leeuw HJ et al (2000) Alternative splicing of the human Rab6A gene generates two close but functionally different isoforms. Mol Biol Cell 11 (11):3819–3833 4. Goud B, Liu S, Storrie B (2018) Rab proteins as major determinants of the Golgi complex structure. Small GTPases 9(1–2):66–75 5. Opdam FJ, Echard A, Croes HJ et al (2000) The small GTPase Rab6B, a novel Rab6 subfamily member, is cell-type specifically expressed and loclised to the Golgi apparatus. J Cell Sci 113:2725–2735 6. Young J, Me´ne´trey J, Goud B (2010) RAB6C is a retrogene that encodes a centrosomal protein involved in cell cycle progression. J Mol Biol 397(1):69–88 7. Shafaq-Zadah M, Gomes-Santos C, Bardin S et al (2016) Persistent cell migration and adhesion rely on retrograde transport of β1 integrin. Nat Cell Biol 18(1):54–64

8. Cayre S, Faraldo MM, Bardin S et al (2020) RAB6GTPase is a crucial regulator of the mammary secretory function controlling STAT5 activation. Development 147:dev190744 9. Carpier JM, Zuchetti AE, Bataille L et al (2018) Rab6-dependent transport of LAT controls immune synapse formation and T cell activation. J Exp Med 215:1245–1265 10. Eisinger M, Marko O (1982) Selective proliferation of normal human melanocytes in vitro in the presence of phorbol ester and cholera toxin. Proc Natl Acad Sci U S A 79:2018–2022 11. Tamura A, Halaban R, Moellmann G et al (1987) Normal murine melanocytes in culture. In Vitro Cell Dev Biol 23:519–522 12. Goud B, Zahraoui A, Tavitian A et al (1990) Small GTP-binding protein associated with Golgi cisternae. Nature 345:553–556 13. Durkin ME, Qian X, Popescu NC et al (2013) Isolation of Mouse Embryo Fibroblasts. Bio Protoc 3:e908 14. Bardin S, Miserey-Lenkei S, Hurbain I et al (2015) Phenotypic characterisation of RAB6A knockout mouse embryonic fibroblasts. Biol Cell 107:427–439 15. Larue L, Dougherty N, Mintz B (1992) Genetic predisposition of transgenic mouse melanocytes to melanoma results in malignant

Conditional Rab6 k/o melanoma after exposure to a low ultraviolet B intensity non-tumorigenic for normal melanocytes. Proc Natl Acad Sci U S A 89:9534–9538 16. Leterrier C, Laine´ J, Darmon M et al (2006) Constitutive activation drives compartmentselective endocytosis and axonal targeting of type 1 cannabinoid receptors. J Neurosci 26:3141–3153 17. Delmas V, Martinozzi S, Bourgeois Y et al (2003) Cre-mediated recombination in the skin melanocyte lineage. Genesis 36:73–80 18. El Marjou F, Janssen KP, Chang BHJ et al (2004) Tissue-specific and inducible Cre-mediated recombination in the gut epithelium. Genesis 39:186–193 19. Selbert S, Bentley DJ, Melton DW et al (1998) Efficient BLG-Cre mediated gene deletion in

263

the mammary gland. Transgenic Res 7:387–396 20. Tronche F, Kellendonk C, Kretz O et al (1999) Disruption of the glucocorticoid receptor gene in the nervous system results in reduced anxiety. Nat Genet 23:99–103 21. He´bert JM, McConnell SK (2000) Targeting of cre to the Foxg1 (BF-1) locus mediates loxP recombination in the telencephalon and other developing head structures. Dev Biol 222:296–306 22. Gorski JA, Talley T, Qiu M et al (2002) Cortical excitatory neurons and glia, but not GABAergic neurons, are produced in the Emx1-expressing lineage. J Neurosci 22:6309–6314

Chapter 19 Use of Immunohistochemistry to Determine Expression of Rab5 Subfamily of GTPases in Mature and Developmental Brains Kwok-Ling Kam, Paige Parrack, Marcellus Banworth, Sheeja Aravindan, Guangpu Li, and Kar-Ming Fung Abstract Rab GTPases are essentially molecular switches. They serve as master regulators in intracellular membrane trafficking from the formation and transport of vesicles at the originating organelle to its fusion to the membrane at the target organelle. Their functions are diversified and each has their specific subcellular location. Their expression may vary significantly in the same cell when the level of protein production is significantly different in different physiologic status. One of the best examples is the transition from fetal to mature status of cells. Expression and localization of Rab GTPases in mature and developing brains have not been well studied. Immunohistochemistry is an efficient way in the detection, semiquantitation, and localization of Rab GTPases in tissue sections. It is inexpensive and fast which allow efficient mass screening of many sections. In this chapter, we describe the immunohistochemical assay protocol for analyzing several Rab protein expressions of the Rab5 subfamily, including Rab5, Rab17, Rab22, and Rab31, in developmental (fetal) and mature human brains. Key words Brain, Neurodevelopment, Fetal brain, Rab5, Rab17, Rab22, Rab31, GTPase

1

Introduction Rab GTPases are highly conserved molecules and they form the broadest group of GTPases in eukaryotic cells. Rab GTPases are activated by their upstream regulators and the active GTP-bound form activates the downstream effectors. Rab GTPases serve essentially as the traffic controllers and master regulators in intracellular membrane trafficking from the formation and transport of the vesicles from the originating organelles to its target organelles through membrane fusion [1–3]. Their functions are diversified and each has their specific subcellular location. Sixty-six human Rab GTPases have been identified [4]. There is no surprise that this divergent and highly conserved family of

Guangpu Li and Nava Segev (eds.), Rab GTPases: Methods and Protocols, Methods in Molecular Biology, vol. 2293, https://doi.org/10.1007/978-1-0716-1346-7_19, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

265

266

Kwok-Ling Kam et al.

molecules play important roles in normal and pathologic conditions. They are involved in many different functions and pathways [5–7]. Rab GTPases have different roles in both physiologic and disease processes in the central nervous system including formation of synaptic vesicles [7], multiple sclerosis [8], and tumor formation [9]. Defective membrane trafficking is associated with neurodegenerative diseases such as Parkinson’s disease and Huntington’s disease [10]. The Rab5 subfamily members, including Rab5, Rab17, Rab21, Rab22, and Rab31, are involved in endocytosis and endosomal recycling. Rab5 is responsible for early endosome fusion, and is present in plasma membrane, clathrin-coated vesicles, and endosomes [11–13]. Like Rab5, Rab21 is also involved in early endocytosis [14–16]. Rab17 is present in recycling endosomes and is used for transcytosis and postsynaptic trafficking of AMPA and Kainate receptors [17, 18]. Rab22 is for endosomal transport and protein recycling to plasma membrane [19–22]. It is present in early endosomes. Rab31 is used for mannose-6-phosphate receptor transport to endosomes [23] as well as phagocytosis [24]. Elevated Rab31 stabilizes MUC1-C levels in an autoinductive loop that could lead to aberrant signaling and gene expression associated with cancer progression [25]. Defective Rab5 has been shown to impair neuronal migration [26, 27]. Rab3a has been shown to be associated with glioma initiation and progression [28]. However, the in depth functions of different Rab GTPases in the developing brain is yet to be explored [10]. This protocol focuses on the localization of Rab5 subfamily of Rab GTPases, including Rab5, Rab17 (not shown in Fig. 1), Rab22, and Rab31, on tissue section by immunohistochemistry in mature and developing human tissue. Our results [29] showed the general trend that expression of Rab GTPase is high in the late developmental (fetal) stages of human brain but very low in mature human brain with Rab22 as the prototype (Fig. 1).

2

Materials

2.1 Human Autopsy Brain Tissue

Approval from the Institutional Review Board was obtained. Our study materials were limited to brains with no significant histopathologic findings and no significant clinical history of neurologic disorder. The following human brains, including those from the second and third trimesters, were used. 1. Adult brains. 2. Newborn full-term brain.

Use of Immunohistochemistry to Determine Expression of Rab5 Subfamily of. . .

267

Fig. 1 (a, b) Expression of Rab5 in mature cerebellum with the expression limited to the cortex, neuropils of the internal granular layer, and cell body (strong expression) in Purkinje cells. (c) Expression of Rab5 in fetal cerebellum is similar with the exception that it is not expressed in the external granular layer. (d) In contrast, there is no expression of Rab31 in the same fetal brain. (e) Rab22 is highly expressed in the glomerulus in olfactory bulb, the surrounding tissue is only weakly expressed. (f) In contrast, Rab31 is only weakly expressed in the olfactory bulb

3. Fetal brains from 21 weeks to 33 weeks of gestation. 2.2

Antibodies

Four antibodies were used in this study (see Notes 1 and 2). 1. Rabbit anti-Rab5 antibody (Cocalico Biologicals, at 1:400 dilution). 2. Rabbit polyclonal anti-Rab17 antibody (GeneTex, at 1:600 dilution). 3. Rabbit EPR9487 anti-Rab22 antibody (Abcam, at 1:100 dilution). 4. Rabbit HPA019717 anti-Rab31 antibody (Sigma, at 1:800 dilution). Normal human duodenum was used as positive control.

2.3 Staining Materials

1. Leica BOND III automated staining machine (see Notes 1 and 2).

268

3

Kwok-Ling Kam et al.

Methods

3.1 Human Brain Samples 3.1.1 Sample Collection

3.1.2 Processing

The brains were removed intact during autopsy, fixed in neutral buffered formalin for at least 3 weeks (see Note 3), and sliced into slabs of about 1 cm think. The targeted areas were dissected out, trimmed to a thickness of about 3 mm and a surface dimension that can fit into the processing cassettes. Cerebral hemispheres were sectioned along the coronal plan, cerebellums were sectioned along the sagittal plane (adults) or horizontal plane (new born and fetal), and the brain stems were sectioned along the horizontal (axial) plane. Representative regions of the central nervous system, including different locations of the telencephalon including the hippocampus, diencephalon, mesencephalon, metencephalon, myelencephalon, and spinal cord were used. 1. Brain slabs in processing cassettes were infiltrated from formalin through graded alcohol to absolute alcohol and then to xylene followed by paraffin wax in an automated processing machine. 2. The processed tissue slabs were manually embedded into paraffin blocks. 3. Histologic sections were cut at 4μm thick, smoothen out on a warm water bath, attached to positively charged standard sized glass slides, baked at 73  C for 6 min, and cooled down to room temperature.

3.1.3 Hematoxylin-Eosin Stain

A standard hematoxylin–eosin stained section is prepared for general observation. The slide is stained using a Symphony automated staining machine (Ventana, Tucson, AZ).

3.1.4 Immunohistochemistry (see Notes 1, 2, 4)

1. Immunohistochemistry was performed using a Leica-BOND III (Leica Microsystems, Lake County, IL) automated staining machine. 2. The staining process used Leica proprietary chemicals and polymer linked secondary antibodies. 3. Operation was performed as per instruction of the vendor. 4. This system has two antigen retrieval agent based on citrate buffer or EDTA (pH 9.0). The EDTA retrieval program used a heat-induced epitope retrieval (HIER) program. We found that 20-min retrieval using this protocol yielded the best results. 5. The incubation time of primary antibody could be adjusted with this machine and we found 60-min incubation yielded the best results.

Use of Immunohistochemistry to Determine Expression of Rab5 Subfamily of. . .

269

6. We used peroxidase-diaminobenzidine as the chromogenic process. Finished slides were lightly counterstained by hematoxylin, dehydrated in graded alcohol, cleared xylene, and sealed with a cover slip using a mounting media.

4

Comments 1. Depending on the fixation, processing protocol, and sensitivity of your immunohistochemistry detection system; the concentration (dilution ratio) of the primary antibodies, antigen retrieval time and protocol, and primary antibody incubation time may need to be adjusted. 2. Sections of duodenum were used to optimize the staining condition for individual antibodies before staining of the brain sections. 3. Due to the variation of many factors in these autopsy brains such as the length of hypoxic period, the post mortem intervals, fixation length, and other factors, there may be variation between individual cases. However, staining results from similar areas of the same case should be similar.

5

Notes 1. The immunohistochemistry protocol that we used was adopted from the protocol for clinical use. There is no specific staining protocol for the Rab antibodies. However, the Leica BOND III and Leica BOND RX that are available to us provide a variety of antigen retrieval protocols, incubation time, and antibody concentration (dilution ratio). We optimize each antibody individually for these three parameters (antigen retrieval protocol, incubation time, and antibody concentration). 2. In our experience, this protocol is very reliable. We understand that an automated staining machine may not be available. Immunohistochemistry can be performed manually. The quality is likely not as outstanding as using an automated staining machine but it is usually acceptable and can be of publication quality. 3. For autopsy brain, they have all been fixed for over 3 weeks and the length of fixation in formation after 3 weeks does not really affect the quality. 4. This protocol can be easily modified for use in different Rab antibodies after appropriate titration of the antibody concentration that fits the instrumentations available in different facilities.

270

6

Kwok-Ling Kam et al.

Conclusions Immunoreactivity localized in different regions of the brain with different intensity of staining, depending on the gestational age and maturity of the brain. In general, the level of immunoreactivities of all four Rab GTPases were higher in fetal brain than adult brain and the immunoreactivities diminished in newborn. There were some variations in different anatomic locations and stages of brain development (unpublished data). Rab GTPases, including the Rab5 subfamily, have different roles in both physiologic and disease processes in the central nervous system, including neuronal migration and formation of synaptic vesicles, both of which are essential in development of the central nervous system. Defective Rab GTPases are associated with various neurodegenerative diseases and glioma initiation and progression. However, little is known about the localization of the Rabs in developmental human brains as well as other organs during development and maturation. Use of immunohistochemistry for the Rab5 subfamily of GTPases serves as a good tool for studying localization of the Rab proteins in developmental biology.

Acknowledgments This work was supported in part by the NIH grant R01GM074692 and a PHF grant (to G.L.) and by the National Cancer Institute Cancer Center Support Grant P30CA225520 awarded to the University of Oklahoma Stephenson Cancer Center and used the Tissue Pathology Shared Resource. References 1. Li G, Marlin MC (2015) Rab family of GTPases. Methods Mol Biol 1298:1–15. https://doi.org/10.1007/978-1-4939-25698_1 2. Novick P (2016) Regulation of membrane traffic by Rab GEF and GAP cascades. Small GTPases 7(4):252–256. https://doi.org/10. 1080/21541248.2016.1213781 3. Pfeffer SR (2013) Rab GTPase regulation of membrane identity. Curr Opin Cell Biol 25 (4):414–419. https://doi.org/10.1016/j. ceb.2013.04.002 4. Klopper TH, Kienle N, Fasshauer D, Munro S (2012) Untangling the evolution of Rab G proteins: implications of a comprehensive genomic analysis. BMC Biol 10:71. https:// doi.org/10.1186/1741-7007-10-71 5. Banworth MJ, Li G (2018) Consequences of Rab GTPase dysfunction in genetic or acquired

human diseases. Small GTPases 9:158–181. https://doi.org/10.1080/21541248.2017. 1397833 6. Hutagalung AH, Novick PJ (2011) Role of Rab GTPases in membrane traffic and cell physiology. Physiol Rev 91(1):119–149. https://doi.org/10.1152/physrev.00059. 2009 7. Mignogna ML, D’Adamo P (2018) Critical importance of RAB proteins for synaptic function. Small GTPases 9(1–2):145–157. https:// doi.org/10.1080/21541248.2016.1277001 8. Haile Y, Deng X, Ortiz-Sandoval C, Tahbaz N, Janowicz A, Lu JQ, Kerr BJ, Gutowski NJ, Holley JE, Eggleton P, Giuliani F, Simmen T (2017) Rab32 connects ER stress to mitochondrial defects in multiple sclerosis. J Neuroinflammation 14(1):19. https://doi.org/10. 1186/s12974-016-0788-z

Use of Immunohistochemistry to Determine Expression of Rab5 Subfamily of. . . 9. Kore RA, Abraham EC (2016) Phosphorylation negatively regulates exosome mediated secretion of cryAB in glioma cells. Biochim Biophys Acta 1863(2):368–377. https://doi. org/10.1016/j.bbamcr.2015.11.027 10. Kiral FR, Kohrs FE, Jin EJ, Hiesinger PR (2018) Rab GTPases and membrane trafficking in neurodegeneration. Curr Biol 28(8): R471–R486. https://doi.org/10.1016/j.cub. 2018.02.010 11. Bucci C, Parton RG, Mather IH, Stunnenberg H, Simons K, Hoflack B, Zerial M (1992) The small GTPase rab5 functions as a regulatory factor in the early endocytic pathway. Cell 70(5):715–728 12. Gorvel JP, Chavrier P, Zerial M, Gruenberg J (1991) rab5 controls early endosome fusion in vitro. Cell 64(5):915–925 13. Li G, Stahl PD (1993) Structure-function relationship of the small GTPase rab5. J Biol Chem 268(32):24475–24480 14. Li G (2012) Early Endocytosis: Rab5, Rab21, and Rab22. In: Li G, Segev N (eds) Rab GTPases and membrane trafficking. Bentham Science Publishers, Sharjah, pp 93–107 15. Pellinen T, Arjonen A, Vuoriluoto K, Kallio K, Fransen JA, Ivaska J (2006) Small GTPase Rab21 regulates cell adhesion and controls endosomal traffic of beta1-integrins. J Cell Biol 173(5):767–780. https://doi.org/10. 1083/jcb.200509019 16. Simpson JC, Griffiths G, Wessling-Resnick M, Fransen JA, Bennett H, Jones AT (2004) A role for the small GTPase Rab21 in the early endocytic pathway. J Cell Sci 117 (Pt 26):6297–6311. https://doi.org/10. 1242/jcs.01560 17. Mori Y, Fukuda M, Henley JM (2014) Small GTPase Rab17 regulates the surface expression of kainate receptors but not alpha-amino-3hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors in hippocampal neurons via dendritic trafficking of Syntaxin-4 protein. J Biol Chem 289(30):20773–20787. https:// doi.org/10.1074/jbc.M114.550632 18. Zacchi P, Stenmark H, Parton RG, Orioli D, Lim F, Giner A, Mellman I, Zerial M, Murphy C (1998) Rab17 regulates membrane trafficking through apical recycling endosomes in polarized epithelial cells. J Cell Biol 140 (5):1039–1053 19. Kauppi M, Simonsen A, Bremnes B, Vieira A, Callaghan J, Stenmark H, Olkkonen VM (2002) The small GTPase Rab22 interacts with EEA1 and controls endosomal membrane trafficking. J Cell Sci 115(Pt 5):899–911

271

20. Magadan JG, Barbieri MA, Mesa R, Stahl PD, Mayorga LS (2006) Rab22a regulates the sorting of transferrin to recycling endosomes. Mol Cell Biol 26(7):2595–2614. https://doi.org/ 10.1128/MCB.26.7.2595-2614.2006 21. Wang L, Liang Z, Li G (2011) Rab22 controls NGF signaling and neurite outgrowth in PC12 cells. Mol Biol Cell 22(20):3853–3860. https://doi.org/10.1091/mbc.E11-03-0277 22. Weigert R, Yeung AC, Li J, Donaldson JG (2004) Rab22a regulates the recycling of membrane proteins internalized independently of clathrin. Mol Biol Cell 15(8):3758–3770. https://doi.org/10.1091/mbc.E04-04-0342 23. Rodriguez-Gabin AG, Yin X, Si Q, Larocca JN (2009) Transport of mannose-6-phosphate receptors from the trans-Golgi network to endosomes requires Rab31. Exp Cell Res 315 (13):2215–2230. https://doi.org/10.1016/j. yexcr.2009.03.020 24. Yeo JC, Wall AA, Luo L, Stow JL (2015) Rab31 and APPL2 enhance FcgammaRmediated phagocytosis through PI3K/Akt signaling in macrophages. Mol Biol Cell 26 (5):952–965. https://doi.org/10.1091/mbc. E14-10-1457 25. Jin C, Rajabi H, Pitroda S, Li A, Kharbanda A, Weichselbaum R, Kufe D (2012) Cooperative interaction between the MUC1-C oncoprotein and the Rab31 GTPase in estrogen receptorpositive breast cancer cells. PLoS One 7(7): e39432. https://doi.org/10.1371/journal. pone.0039432 26. Kawauchi T, Sekine K, Shikanai M, Chihama K, Tomita K, Kubo K, Nakajima K, Nabeshima Y, Hoshino M (2010) Rab GTPases-dependent endocytic pathways regulate neuronal migration and maturation through N-cadherin trafficking. Neuron 67(4):588–602. https://doi. org/10.1016/j.neuron.2010.07.007 27. Tang BL (2016) Rab, Arf, and Arl-regulated membrane traffic in cortical neuron migration. J Cell Physiol 231(7):1417–1423. https://doi. org/10.1002/jcp.25261 28. Kim JK, Lee SY, Park CW, Park SH, Yin J, Kim J, Park JB, Lee JY, Kim H, Kim SC (2014) Rab3a promotes brain tumor initiation and progression. Mol Biol Rep 41 (9):5903–5911. https://doi.org/10.1007/ s11033-014-3465-2 29. Kam K, Parrack P, Milton C, Banworth M, Williams L, Aravindan S, Li G, Fung K (2018) Temporal and anatomical expression of Rab5 subfamily of GTPases in the central nervous system. J Neuropath Exp Neurol 77:501

Chapter 20 Assessing Rab5 Activation in Health and Disease Anna Pensalfini, Ying Jiang, Seonil Kim, and Ralph A. Nixon Abstract The endocytic pathway is a system of dynamically communicating vesicles, known as early endosomes, that internalize, sort, and traffic nutrients, trophic factors, and signaling molecules to sites throughout the cell. In all eukaryotic cells, early endosome functions are regulated by Rab5 activity, dependent upon its binding to GTP, whereas Rab5 bound to GDP represents the biologically inactive form. An increasing number of neurodegenerative diseases are associated with endocytic dysfunction and, in the case of Alzheimer’s disease (AD) and Down syndrome (DS), an early appearing highly characteristic reflection of endocytic pathway dysfunction is an abnormal enlargement of Rab5 positive endosomes. In AD and DS, endosome enlargement accompanying accelerated endocytosis and fusion, upregulated transcription of endocytosis-related genes, and aberrant signaling by endosomes are caused by pathological Rab5 overactivation. In this chapter, we describe a battery of methods that have been used to assess Rab5 activation in models of AD/DS and are applicable to other cell and animal disease models. These methods include (1) fluorescence recovery after photobleaching (FRAP) assay; (2) quantitative measurement of endosome size by light, fluorescence and electron microscopy; (3) detection of GTP-Rab5 by in situ immunocytochemistry in vitro and ex vivo; (4) immunoprecipitation and GTP-agarose pull-down assay; (5) biochemical detection of Rab5 in endosome-enriched subcellular fractions obtained by OptiPrep™ density gradient centrifugation of mouse brain. Key words Rab5 activity, GTP-binding, Endosomes, Endocytic dysfunction, Neurodegeneration, Alzheimer’s disease, Down syndrome, Endocytosis, GDI

1

Introduction Rab5 is the master regulatory GTPase on early endosomes. Rab5 functions in endocytosis, endosome fusion, maturation, trafficking and signaling are dependent on its membrane localization and cycling between an active, GTP-bound and an inactive, GDP-bound state [1]. Rab5 membrane localization is regulated by guanyl nucleotide (GDP) dissociation inhibitors (GDIs) [2, 3] and GDI displacement factors (GDFs) [4] whereas the activity of guanine nucleotide exchange factors (GEFs) (e.g., Rabex5 [5]) and GTPase-activating proteins (RabGAPs) (e.g., RabGAP5 [6]) facilitate Rab5 activation and inactivation, respectively (Fig. 1). Upon

Guangpu Li and Nava Segev (eds.), Rab GTPases: Methods and Protocols, Methods in Molecular Biology, vol. 2293, https://doi.org/10.1007/978-1-0716-1346-7_20, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

273

274

Anna Pensalfini et al.

Fig. 1 Rab5 activation cycle. Representative diagram showing some of the multiple components involved in Rab5 activation. Inactive GDP-bound Rab5 is present in the cytosol sequestered by GDI. In proximity of the target membrane, GDF may interact with Rab5 to facilitate GDI dissociation and Rab5 insertion into the membrane. Upon GDP dissociation, a GEF promotes GTP binding and subsequent activation of Rab5. In this active state Rab5 can interact with multiple effectors (not shown) to promote vesicle budding, trafficking, and fusion. Rab5 GTP hydrolysis is facilitated by a GAP, which converts Rab5 to its inactive GDP-bound state. Inactive Rab5 can then be extracted from the membrane by GDI and recycled back to the cytosol. Inset, Under conditions promoting an increase in Rab5 expression (or transcription) or, as in the case of AD/DS, in the amyloid precursor protein (APP), Rab5 undergoes hyperactivation, resulting in increased endocytosis and increased endosome fusion

activation, Rab5 recruits effector proteins that mediate the various Rab5 functions in the endocytic pathway. Pathological activation of Rab5 drives endocytic dysfunction in Alzheimer’s disease (AD) and Down syndrome (DS) resulting in a signature enlargement of Rab5 positive early endosomes [7], accelerated endocytosis and fusion, in addition to several other downstream effects on endosome transport, signaling, and neuronal survival [8]. There are different methods to measure Rab5 activation (e.g., [9–12]). The methods reported in this review have been validated by our group in models of AD and DS both in vitro [8, 13, 14] and

Assessing Rab5 Activation in Health and Disease

275

in vivo [15–17] and allow either the direct or indirect determination of Rab5 activation. Indirect measures include analysis of the rate of Rab5 dissociation from the endosomal membrane by fluorescence recovery after photobleaching (FRAP), which inversely correlates with Rab5 activation state. Another indirect measure is the analysis of endosome number, size, and morphology, which reflect endosomal enlargement arising from Rab5-mediated endosome fusion. The direct measures are based on the use of a Rab5-GTP-specific antibody for immunocytochemistry and immunoprecipitation and biochemical analysis of GTP-bound Rab5 by GTP-agarose pull-down. We also describe an optimized method for subcellular fractionation using OptiPrep™ (iodixanol) [18] to efficiently separate and enrich different organelles, including early endosomes, from mouse brain tissue, which can be used for functional assays and further downstream applications. There is a growing interest in the study of endosome and Rab5 due to the involvement of endocytic pathway abnormalities in diverse disease conditions [7, 19–21]. The methods we report therefore represent a foundation to facilitate these expanding investigations.

2

Materials Prepare all solutions by using ultrapure water (prepared using the Milli-Q Ultrapure Water Purification System) and analytical grade or the highest-grade reagents commercially available (unless otherwise specified).

2.1 Fluorescence Recovery After Photobleaching (FRAP) Assay

1. Plasmids. GFP-Rab5a wild-type (WT) construct is cloned from pHSV-Myc-Rab5a plasmid. Dominant active GFP-Rab5a Q79L and dominant negative GFP-Rab5a S34N are generated by PCR based site-directed mutagenesis (Stratagene). The pEGFP-C1 vector is commercially available from Clontech. 2. Mouse neuroblastoma cell line. Neuro-2a cells (N2a cells are from ATCC, CCL-131). 3. Growth media: Dulbecco’s Minimal Essential media (DMEM) supplemented with 5% fetal bovine serum (Thermo Fisher Sci.,16000069) and 100 units/mL penicillin–streptomycin (Thermo Fisher Sci., 15140122). 4. Lipofectamine 2000 reagent and Opti-MEM reduced serum medium (Thermo Fisher Sci.). 5. Zeiss LSM520 confocal microscope (Zeiss). The microscope also has temperature and CO2 controller for live imaging (Zeiss Pecon).

276

Anna Pensalfini et al.

2.2 Quantitative Measurement of Endosome Size Changes

1. Primary human fibroblasts from Down syndrome patients (DS) and diploid age-matched controls (2N) (Coriell Cell Repositories, http://ccr.coriell.org) were used before reaching passage number 15.

2.2.1 Rab5 Positive Endosome Measurement in Human Fibroblasts

2. Cell culture media: MEM (Thermo Fisher Sci., 10370021), plus 10% fetal bovine serum (Thermo Fisher Sci.,16000069) and 100 units/mL penicillin–streptomycin (Thermo Fisher Sci., 15140122). 3. Phosphate-buffered saline (PBS) 1
: 137 mM NaCl, 10 mM Na2HPO4, 1.8 mM KH2PO4, 2.7 mM KCl, adjust pH to 7.4. 4. Fixative solution: 4% PFA (Electron Microscopy Sciences, 15714) in PBS (PFA/PBS). 5. Antibody dilution buffer: 5% goat serum in PBS, plus 0.3% Triton X-100 (Sigma, T8787). 6. Primary antibodies: mouse anti-Rab5 (BD Biosciences, 610282); mouse anti-EEA1 (BD Biosciences, 610457). 7. Fluorescence-conjugated donkey anti-mouse Alexa Fluor secondary antibodies (Thermo Fisher Sci.) 8. Fluoro-Gel 5024704).

mounting

medium

(Thermo

Fisher

Sci.,

9. LSM 510 Meta confocal microscope (Zeiss). 2.2.2 Rab5 Positive Endosome Measurement in Mouse Brain Sections

1. Anesthetic mix: ketamine (100 mg/kg BW) and xylazine (10 mg/kg BW) in PBS. 2. Perfusion/fixation buffer solution: 4% paraformaldehyde (PFA) in 0.1 M sodium cacodylate buffer, pH 7.4 (Electron Microscopy Sciences, 11652). 3. Vibratome (Leica VT1000 S). 4. Tris-buffered saline (TBS) 1
: 50 mM Tris–HCl, pH 7.5, 150 mM NaCl, adjust pH to 7.5. 5. Endogenous peroxidase quenching buffer: 3% H2O2 and 10% methanol in TBS. 6. Permeabilization/Antibody dilution buffer (A): 1% bovine serum albumin (BSA), 1% normal horse serum (NHS) and 0.4% Triton X-100. 7. Permeabilization/Antibody dilution buffer (B): 1% BSA, 1% NHS and 0.05% saponin. 8. Blocking buffer: 20% NHS in PBS. 9. Primary antibodies against Rab5: goat polyclonal anti-Rab5b (Santa Cruz Biotechnology Inc., SC-26569); rabbit polyclonal anti-Rab5a (Santa Cruz Biotechnology Inc., SC-309) and rabbit polyclonal anti-Rab5 (Abcam; 18211).

Assessing Rab5 Activation in Health and Disease

277

10. For DAB staining: biotinylated secondary antibodies (Vector Lab.,1:200-500); VECTASTAIN® ABC HRP Kit (Vector Lab, PK-4000); DAB (Vector Lab, SK-4100). 11. Permount (Fisher Sci, SP15-100). 12. Light microscope (Zeiss Axioskop II microscope). 13. For fluorescence labeling: fluorescence-conjugated donkey anti-goat and anti-rabbit Alexa Fluor secondary antibodies (Thermo Fisher Sci.). 14. Fluoro-Gel 5024704).

mounting

medium

(Thermo

Fisher

Sci.,

15. Fisherbrand Superfrost Plus Microscope slides and glass coverslips (Fisher Sci.). 16. LSM880 laser scanning confocal microscope (ZEISS). 2.2.3 Electron Microscopy (EM) and Postembedding Immuno-EM (iEM) from Mouse Brain

1. Anesthetic mix: as in Subheading 2.2.1.

EM General Method

4. 1% osmium tetroxide.

2. Perfusion/fixation buffer solution: 4% PFA, 2% glutaraldehyde in 0.1 M sodium cacodylate buffer, pH 7.4 (Electron Microscopy Sciences, 11,652). 3. Vibratome (Leica VT1000 S). 5. Ascending ethanol series of 20%, 30%, 50%, 75%, 90%, and 100%. 6. Spurr resin concentrations of 25%, 50%, 75%, and 100%. 7. ACLAR sheets (Electron Microscopy Sciences). 8. Ultramicrotome (Leica Reichert Ultracut S). 9. Nickel grids (200 mesh, Electron Microscopy Sciences). 10. Uranyl acetate (2%). 11. Lead citrate (3%). 12. Electron microscope (Thermo Fisher Talos L120C transmission electron microscope operating at 120 kV).

Postembedding iEM

1. Etching solution: 1% sodium metaperiodate in PBS followed. 2. Double-distilled water (ddH2O). 3. Blocking buffer/Antibody dilution buffer: 1% BSA in PBS. 4. Primary antibodies: mouse anti-Rab5-GTP (NewEast Biosciences, 26911); rabbit anti-Rab5 (Abcam, 18211). 5. Secondary antibodies: 5- and 20-nm gold-conjugated antirabbit and anti-mouse secondary antibodies, respectively (Aurion, 1:10).

278

Anna Pensalfini et al.

2.3 Detection of GTP-Rab5 2.3.1 In Situ Immunofluorescence In Vitro

1. Cell culture: murine neuroblastoma (N2a) cell line (ATCC, CCL-131), control or stably overexpressing human wild-type amyloid precursor protein (N2aAPP). 2. Growth media: Dulbecco’s Minimal Essential media (DMEM) supplemented with 5% fetal bovine serum and penicillin–streptomycin (as in Subheading 2.2.1) and 0.2 mg/mL G418 for selection (Millipore Sigma, G418-RO). 3. Dicer-substrate small interfering RNA (DsiRNA) targeting RabGAP5/Sgsm3 (IDT, mm.Ri.Sgsm3.13.1) and DsiRNA negative control (IDT, 51-01-14-03). 4. Lipofectamine 2000 and Opti-MEM reduced serum medium (Thermo Fisher Sci.). 5. Fixative solution: 4% PFA (Electron Microscopy Sciences, 15714) in PBS (PFA/PBS). 6. Blocking/Antibody dilution buffer: 2% NHS in PBS with 0.05% saponin. 7. Primary antibodies: mouse anti-Rab5-GTP (NewEast Biosciences, 26911); rabbit anti-RabGAP5 (Proteintech, 20825AP). 8. Donkey anti-mouse and anti-rabbit Alexa Fluor secondary antibodies (ThermoFisher Scientific). 9. Fluoro-Gel Sciences).

mounting

medium

(Electron

Microscopy

10. Fisherbrand Superfrost Plus Microscope slides and glass coverslips (Fisher Scientific). 11. LSM880 laser scanning confocal microscope (ZEISS). 2.3.2 In Situ Immunofluorescence Ex Vivo

1. Materials as in Subheading 2.2.2 to prepare mouse brain sections. 2. Permeabilization/antibody dilution buffer: 1% BSA, 1% NHS, and 0.05% saponin in TBS. 3. Blocking buffer: 20% NHS in PBS. 4. Same materials and antibodies as above (Subheading 2.3.1, items 6–11).

2.3.3 Immunoprecipitation from Mouse Brain Tissue/Subcellular Fraction and Western Blot

1. Anesthetic mix as in Subheading 2.2.2. 2. Phosphate-buffered saline (PBS) for perfusion. 3. IP lysis/wash buffer: 50 mM Tris, pH 7.4, 150 mM NaCl, 1 mM MgCl2, 1 mM EDTA, 1% Triton X-100, with protease and phosphatase inhibitors. 4. Method of choice for protein concentration assay (e.g., Bradford or Bicinchoninic acid). 5. Anti-Rab5-GTP (NewEast Biosciences, 26911).

Assessing Rab5 Activation in Health and Disease

279

6. PureProteome™ Protein A/G Magnetic beads (Millipore Sigma). 7. Antibody binding buffer: PBS with 0.01% Tween-20 (PBS-T). 8. Cross-linking reagent: Bis (sulfosuccinimidyl) suberate (BS3) (Thermo Fisher Sci.). 9. Buffers for cross-linking reaction with BS3: coupling buffer, 20 mM sodium phosphate; quench buffer stock, 1 M Tris– HCl, pH 7.5; elution buffer, 0.2 M glycine HCl, pH 2.5. 10. Magnetic separator stand (Promega). 11. 100 μM GTP-γ-S stock (NewEast Biosciences, 30302) in IP lysis/wash buffer. 12. 2
Laemmli sample buffer. 13. Novex™ 4–20% Tris–Glycine gels (Thermo Fisher Sci.). 14. Nitrocellulose Membrane (Millipore). 15. Rabbit polyclonal anti-Rab5 primary antibody (Abcam; 18211). 16. HRP-conjugated goat anti-rabbit IgG (Jackson ImmunoResearch Laboratories). 17. ECL detection system (Invitrogen or Millipore Sigma). 2.3.4 Pull-Down with GTP-Agarose from Mouse Brain Tissue/ Subcellular Fraction and Western Blot

1. Anesthetic mix and PBS for perfusion as in Subheading 2.3.3. 2. GTP-Agarose lysis/wash buffer: 50 mM Tris–HCl pH 7.5, 250 mM NaCl, 5 mM Mg acetate, 0.5% Triton X-100, and protease inhibitors. 3. GTP-agarose beads (Sigma Cat# G9768). 4. 100 μM GTP-γ-S stock (NewEast Biosciences, 30302) in IP lysis/wash buffer. 5. Microcentrifuge (Eppendorf). 6. Method of choice for protein concentration assay (e.g., Bradford or Bicinchoninic acid). 7. For Western Blot analysis materials, primary and secondary antibodies see above (Subheading 2.3.3, items 7–12).

2.4 Endosome Isolation by OptiPrep™ Density Gradient Centrifugation from Mouse Brain Tissue

1. Anesthetic mix and PBS for perfusion as in Subheadings 2.3.3 and 2.3.4. 2. Homogenization buffer: 0.25 M sucrose, 10 mM Tris, pH 7.4, 1 mM EDTA, protease and phosphatase inhibitor cocktail (Sigma). 3. Teflon-coated glass pestle (2 or 5 mL). 4. Method of choice for protein concentration assay (e.g., Bradford or Bicinchoninic acid).

280

Anna Pensalfini et al.

5. 50% (w/v) OptiPrep™ stock: 5 vol. of OptiPrep™ in 1 vol. of 0.25 M sucrose, 6 mM EDTA, 60 mM Tris–HCl, pH 7.4. 6. OptiPrep™ gradient solutions at 5%, 10%, 12.5%, 14%, 15%, 20%, 25% obtained from 50% OptiPrep™ stock diluted with 1
homogenization buffer. 7. SW40 Rotor and ultracentrifuge (Beckman).

3

Methods

3.1 Fluorescence Recovery After Photobleaching (FRAP) Assay

1. Transfection. Plasmid transfection in N2a cells is carried out using lipofectamine 2000. N2a cells are plated at 90–95% confluent at the time of transfection on the 35 mm polylysine-coated glass-bottom dish (BD Biosciences) with 2 mL of the growth media. Plasmids (4 μg of each plasmid expressing GFP-Rab5a WT, dominant active GFP-Rab5a Q79L, or dominant negative GFP-Rab5a S34N) are diluted in 250 μL of Opti-MEM medium (Invitrogen), and 4 μL lipofectamine 2000 (Invitrogen) is mixed in 250 μL of OptiMEM medium, incubated for 5 min and combined with diluted plasmids (total 500 μL) for 20 min at room temperature (RT). Mixture is added into the culture, and cells are incubated overnight at 37  C. 2. Photobleaching. In a FRAP experiment (Fig. 2), an area of the cell containing a fluorescently tagged protein is photobleached and the recovery of the fluorescence in the bleached region is monitored as the fluorescent protein replaces the bleached protein [22] (Fig. 2a). The GTP-loaded active form of Rab5 associates with endosomal membranes while inactive Rab5 (GDP-bound) is cytosolic [1]. Because the rate of dissociation of Rab5 from endosomal membranes is determined by the conversion of the GTP-bound active to the GDP-bound inactive forms, determination of the rate of Rab5 exchange from early endosomes indicates Rab5 activation state (Fig. 2a). Dissociation rates can be calculated from the rate of fluorescence recovery after early endosomes expressing GFP-tagged Rab5 have been photobleached [23]. Thus, FRAP is a useful tool to evaluate Rab5 activity when GFP-tagged Rab5 is introduced in cells. Here, FRAP analysis is carried out on a Zeiss LSM510 confocal microscope (Fig. 2b). GFP-Rab5a is used for visualizing early endosomes. 24 h posttransfection cells are imaged live using a 40
oil immersion objective and a zoom of 6 using a single line excitation at 488 nm and emission BP 520–550 nm filter sets. A ROI (region of interest) is drawn around the GFP-Rab5 positive puncta and laser transmission increased to 100%. Photobleaching results in roughly 70–80% loss of fluorescence in the bleached area.

Assessing Rab5 Activation in Health and Disease

281

Fig. 2 FRAP assay. (a) The principle of FRAP is represented by a schematic diagram of the cell containing GFP-Rab5a-positive endosomes. The graph of FRAP analysis shows a schematic recovery curve that corresponds to the target endosome (1), photobleached endosome (2), and recovered endosome (3). The recovery curve provides an estimate for the overall fraction of the GFP-Rab5a molecules that exhibit activation. (b) Representative images and graphs of GFP-Rab5a WT and Q79L FRAP analysis in N2a cells. WT Rab5 shows marked increased recovery, while dominant active mutant of Rab5a (Q79L) significantly reduces GFP-Rab5a recovery after photobleaching, indicating persistent activation of Rab5 GTPase (n ¼ 20 endosomes in each cell)

3. The recovery. The recovery of the GFP fluorescence in each condition is recorded with 20 time-lapse image series by scanning the whole cell at 15 s intervals. The cells are maintained at 37  C in the growth media on a heating stage (Zeiss Pecon) throughout the experiments. 4. Calculation. To calculate percent of recovery after photobleaching, intensity profiles for the bleach spot are calculated by Zeiss LSM510 image analysis software. 3.2 Quantitative Measurement of Endosome Size Changes 3.2.1 Rab5 Positive Endosome Measurement in Human Fibroblasts

1. Human fibroblasts grown on glass coverslips in 12 well plate until they reached 70% confluency were gently washed with PBS and fixed in 4% PFA/PBS for 20 min. 2. After wash with PBS, anti-Rab5 (1:500) or anti-EEA1 (1:500) in antibody dilution buffer was added and incubated at 4  C overnight with gentle rocking. 3. After wash with PBS, fluorescence conjugated secondary antimouse antibodies (1:500) in antibody dilution buffer were added and incubated for 1–2 h at room temperature.

282

Anna Pensalfini et al.

4. Finally, the coverslips were washed, mounted, and images were taken at 40
magnifications, as previous described [14]. 5. Confocal images were opened with Fiji-ImageJ (imagej.nih. gov/ij), threshold were set and individual cell was outlined. Image J will automatically set the scale unless the preference is to set the scale manually by Analyze-Set Scale. Use Analyze-Set Measurement to check Area, Integrated density, Area Fraction and other parameters as needed, limiting the analysis to threshold. 6. To separate Watershed.

coupled

endosomes,

use

Process-Binary-

7. Use Analyze-Analyze Particles to set the size range depending on the study (0.005 or 0.01 to infinity) and the method to visualize the results (e.g., check “display results”—to obtain individual particle measurements within the cell; check “summarize”—to obtain average particle measurements per cell) and/or to analyze the particles (e.g., “exclude on edges,” “include holes”). After clicking OK, separate windows will appear to show the result of individual endosomes inside the selected cell, as well as summary result, which will be both copied and pasted into a separate Excel work sheet for further data analysis. 8. Between 26 and 52 cells are evaluated for further statistical analysis. Results from Rab5-positive or EEA1-positive endosomes can be expressed as average size, number and volume per cell, or relative number of Rab5-positive or EEA1-positive endosomes per size bin (0.01–0.5 μm2, 0.51–1.4 μm2, 1.41–7.0 μm2) as previously described [13, 14] (also see Note 3) (Fig. 3). Statistical analysis is performed with PrismGraphPad with Student’s t-test or ANOVA to determine significant difference between samples. 3.2.2 Rab5 Positive Endosome Measurement in Mouse Brain Sections

1. Mice are anesthetized and transcardially perfused with perfusion/fixation buffer. Brains are removed and postfixed in the same buffer overnight at 4  C for 48–72 h. 2. Fixed brain are cut into 40 μm-thick coronal sections with a vibratome [15]. Regions of the medial septal nucleus (MSN), hippocampus including dentate gyrus, and neocortex are collected from each animal. 3. Brain sections are rinsed three times in TBS and incubated in endogenous peroxidase quenching solution for 30 min, room temperature (for DAB labeling), then rinsed three times with diluting buffer, before blocking 1 h at room temperature. 4. Various commercial antibodies against Rab5 are used, including anti-Rab5b [16] in diluting buffer (A) and anti-Rab5a (1:100) and anti-Rab5 (1:500) [8] in diluting buffer (B) (see

Assessing Rab5 Activation in Health and Disease

283

Fig. 3 Early endosomes in DS. (a) Representative immunofluorescence micrographs of Rab5-positive endosomes in DS and age-matched 2N controls. DS fibroblast show a striking enlargement in the size of Rab5-positive endosomes compared to 2N. (b) The numbers of EEA1-positive early endosomes in all size groups are also increased in the DS fibroblasts compared to 2N controls (total fibroblasts examined: 2N fibroblasts ¼ 80; DS fibroblasts ¼ 80)

Notes 1 and 2), and brain sections are incubated in the respective primary antibody solutions at 4  C overnight with gentle rocking. 5. Sections are then incubated with biotinylated secondary antibodies for 30 min at room temperature for DAB or with donkey anti-goat (for Rab5b) or donkey anti-rabbit (Rab5a and Rab5) Alexa Fluor secondary antibodies (1:500) for 1–2 h at room temperature. 6. For fluorescence labeling, cell nuclei are counterstained with DAPI (Thermo Fisher Sci, D1306), then brain sections are washed and mounted in Fluoro-Gel. 7. For DAB staining, brain sections are incubated with ABC solution for 1 h at room temperature and DAB for 5–10 min (incubation time may vary depending on antibody and brain

284

Anna Pensalfini et al.

tissue), then washed and mount on to coated glass slide, air dry overnight, before going through the dehydrating step and mounting on glass coverslips with Permount. 8. A light microscope (Zeiss Axioskop II microscope) is used to collect images of DAB-stained sections with 100
magnifications while immunofluorescence images are captured at 40
and 3
zoom on top of 40
magnification with an oil immersion objective and a LSM880 laser scanning confocal microscope (ZEISS) at a resolution of 1024
1024 pixels as previously described [24]. 9. Rab5-positive endosome number and size analysis in neurons are performed as detailed in Subheading 3.2.1 as well as described in previous publication [16, 17] (see also Note 3). 3.2.3 EM and Postembedding Immuno-EM from Mouse Brain General EM Method

1. Anesthetize the mice with the anesthetic mix and perfuse them transcardially with perfusion-fixation buffer. 2. Collect the brain and store in the perfusion-fixation buffer at 4  C 48–72 h. 3. Cut the brains into 80 μm-thick sagittal vibratome sections. 4. Postfix the sections in 1% osmium tetroxide for 30 min. 5. Dehydrate the sections in ascending ethanol solutions, 20–90%, each for 30 min, followed by 100% for 1 h. 6. Infiltrate the sections with increasing concentrations of Spurr resin, 25–75% each for 1 h and 100% overnight and flat embed them in ACLAR sheets. 7. Cut out from the ACLAR sheet regions of interest for ultrastructural analyses (e.g., prefrontal cortex and hippocampal CA1 and Dentate Gyrus areas). 8. Prepare 50 nm ultrathin sections using an ultramicrotome and place them on nickel grids. 9. Briefly stain the grids with uranyl acetate (2%) and lead citrate (3%). 10. Image the material using an electron microscope (we use a Thermo Fisher Talos L120C transmission electron microscope operating at 120 kV). 11. EM ultrastructural characterization. Endosomes are identified as vesicles with single limiting membranes and sparse intraluminal content [25] and most of them are relatively small, with an average diameter generally ranging between 100 and 150 nm [26]. Optimally, EM identification of early endosomes should be validated by immuno-EM (see following). For endosome quantification, acquire approximately n ¼ 40–80 EM images at a direct magnification of 17,500
per mouse per genotype from a specific region of interest (e.g., the pyramidal cell layer

Assessing Rab5 Activation in Health and Disease

285

V of the prefrontal cortex), containing dendritic and synaptic profiles in the proximity (within 5–10 mm) of the neuronal soma. Glial cells are excluded on the basis of their morphology and chromatin patterns. Count the number of endosomes present in each field acquired per mouse and determine (1) the average vesicle diameter; (2) the average diameter size distributions falling within the following bins: 0–0.160 nm, 0.161–300 nm; >300 nm; (3) the endosome area fraction relative to the total image area, using Fiji-ImageJ (imagej.nih. gov/ij) [17]. Postembedding Immuno-EM

1. Mount ultrathin sections prepared as described above (Subheading 3.2.3.2, steps 1–8) on nickel grids and air-dry. 2. Proceed with etching 5 min with 1% sodium metaperiodate in PBS followed by two washes in filtered ddH2O. 3. Incubate sections in blocking solution (1% BSA in PBS) for 2 h at room temperature. 4. Incubate sections with primary antibodies (1:30) in a humidified chamber overnight at 4  C. 5. Following 3
5 min washes in PBS, incubate sections with gold-conjugated anti-rabbit and anti-mouse secondary antibodies (1:10) for 2 h at room temperature. 6. Wash the grids several times and briefly stain with uranyl acetate and lead citrate before examination.

3.3 Detection of GTP-Rab5 3.3.1 In Situ Immunofluorescence In Vitro

1. N2a cells and N2aAPP cells (see Note 4) are seeded at a 70–80% confluency at the time of transfection on polylysinecoated glass coverslips placed at the bottom of a 12-well plate. 2. DsiRNA for RabGAP5/Sgsm3 or DsiRNA control are diluted in Opti-MEM medium and lipofectamine 2000 is mixed in Opti-MEM medium, incubated for 5 min and combined with diluted DsiRNAs for 20 min at room temperature. Mixture is added into the culture at a final 40 nM concentration and incubated with the cells for 4 h at 37  C, followed by addition of fresh DMEM for 48–72 h. RabGAP5 is a Rab5-specific GAP [6]. Here, silencing of Rab5GAP5 in N2a cells acts as a positive control for Rab5 activation. 3. Cells are gently washed with PBS and fixed in 4% PFA/PBS for 20 min. 4. After 3
5 min washes with PBS, cells are blocked with blocking/antibody dilution buffer for 30 min at room temperature. 5. Incubate cells with anti-Rab5-GTP (1:100) and anti-RabGAP5 (1:50) primary antibodies overnight at 4  C, followed by 3
5 min washes with PBS and incubation with donkey anti-

286

Anna Pensalfini et al.

Fig. 4 Direct detection of Rab5-GTP in vitro. (a) Representative immunofluorescence micrographs of N2a and N2aAPP cells double labeled with rabGAP5 antibody (red) and Rab5-GTP antibody (green). rabGAP5 siRNA in N2a cells causes Rab5 over-activation, as shown by the increased intensity of the Rab5GTP antibody. This level of activation is comparable to what is observed in N2aAPP cells (lower panel). (b) Quantification of Rab5-GTP intensity in N2aAPP is approximately twofold greater than in N2a cells (total cells examined: N2a ¼ 98; N2aAPP ¼ 101)

mouse and anti-rabbit Alexa Fluor secondary antibodies in antibody blocking/dilution buffer for 1 h at room temperature. 6. Coverslips are washed, mounted, and images are taken at 40
magnifications using a Zeiss LSM880 laser scanning confocal microscope (Fig. 4). 3.3.2 In Situ Immunofluorescence Ex Vivo

1. Mouse sections for immunofluorescence labeling are obtained as described in Subheading 3.2.2. 2. Sections are washed 3
10 min in permeabilization/antibody dilution buffer and blocked for 1 h at room temperature (see Note 5). 3. Sections are incubated with anti-Rab5-GTP primary antibody in antibody dilution buffer (1:100) overnight at 4  C, followed by incubation with donkey anti-mouse secondary antibodies (1:300) for 1 h at room temperature. 4. Following 10 min wash in TBS, cell nuclei are counterstained with DRAQ5 fluorescent probe for 5 min in PBS (1:2000). 5. Sections are then washed 3
10 min in TBS and mounted on glass coverslips using Fluoro-Gel.

Assessing Rab5 Activation in Health and Disease

287

6. Image acquisition settings and analysis of Rab5-GTP puncta are essentially the same as described in Subheadings 3.2.1 and 3.2.2. In order to minimize analysis of nonspecific signal, once the images are opened in Fiji/ImageJ, it is recommended to perform background subtraction using a rolling ball radius of 50 and apply the Yen’s method of image thresholding, before measuring Rab5-GTP puncta number, intensity, size, and area fraction/cell (e.g., in the cortex) or area fraction/field (e.g., in hippocampal CA1 subregion) [17]. 3.3.3 Immunoprecipitation from Mouse Brain Tissue/Subcellular Fraction and Western Blot

1. Anesthetize the mice and transcardially perfuse using PBS. 2. Collect the mouse brain and proceed to sample preparation by dissecting a specific brain region or by obtaining a specific subcellular fraction of interest (e.g., hippocampal synaptosomes prepared as described by [27] (see Note 6). 3. Prior to sample homogenization (step 11), PureProteome™ Protein A/G Magnetic beads are prepared for antibody binding and cross-linking using BS3. 4. For each antibody binding reaction, 25 μL of magnetic bead slurry are washed in 500 μL of PBS-T, using a magnetic stand to allow bead-solution separation, and 3–5 μg of anti-Rab5GTP, or Normal Mouse IgG, in 100 μL of PBS-T are added to the washed beads and incubated for 1 h at 4  C with continuous mixing. 5. Beads are then washed 3
with PBS-T, applying each time the magnet, followed by 3
washes with 500 μL coupling buffer, briefly vortexing between each wash. Beads are ready for crosslinking. 6. Each cross-linking reaction requires 250 μL of 5 mM BS3 in coupling buffer from a 100 mM stock (see Note 7). 7. Engage the magnet to capture the antibody-bound beads, remove the coupling buffer and add 250 μL of 5 mM BS3 solution to each cross-linking reaction. Incubate for 30–60 min at room temperature with end-over-end mixing. 8. Add 12.5 μL of quench buffer to each reaction to remove the nonreacted cross-linker and incubate for additional 30 at room temperature. During this incubation time it is possible to proceed with sample homogenization (see step 11). 9. To remove any non–cross-linked antibody, beads are washed with 500 μL elution buffer, followed by 3
washes with PBS-T. 10. Homogenize the sample in 300 μL IP lysis/wash buffer, incubate on ice for 30 min and sonicate 3
10 s. 11. Save an aliquot as initial input (~10% vol/vol) and incubate ~0.3 mg of proteins in 300 μL of IP/wash buffer with antiRab5-GTP-, or Normal Mouse IgG-, cross-linked magnetic beads overnight at 4  C with rotation.

288

Anna Pensalfini et al.

12. Carry out a separate reaction in the presence of 10 μM GTP-γ-S, a nonhydrolyzable G-protein-activating analog of GTP, at 30  C for 30 min, prior to sample incubation with the respective beads, to control for specific binding (positive control). 13. Using a magnetic stand to allow bead-solution separation, wash the beads 3
with wash buffer, applying each time the magnet. 14. Resuspended the beads in 2
Laemmli sample buffer and boil 5 min at 95  C. 15. Apply the magnet, collect the supernatant and load onto a 4–20% Tris–Glycine gel. 16. The amount of Rab5-GTP is determined following SDS-PAGE and blotting with an anti-Rab5 antibody (see Note 8). 3.3.4 Pull-Down with GTP-Agarose from Mouse Brain Tissue/ Subcellular Fraction and Western Blot

1. Anesthetize the mice and transcardially perfuse using PBS and proceed to sample preparation as described in Subheading 3.3.3 (see Note 6). 2. Lyse the sample in 150–300 μL GTP-Agarose lysis/wash buffer. 3. Centrifuge the lysates at 13,000
g for 10 min at 4  C and save an aliquot (10% vol–vol) of the supernatants as the loading control (input). 4. Incubate 0.5–1 mg of proteins with 300 μL of GTP-agarose beads for 4 h at 4  C with rotation (incubation can be also extended overnight at 4  C if the reaction is carried out with lower protein amounts). 5. Carry out a separate reaction in the presence of 10 μM GTP-γ-S at 30  C for 30 min, prior to sample incubation with the respective beads, to control for specific binding (in this case GTP-γ-S treatment acts as a negative control, by saturating the sample with GTP and preventing its binding to the GTP-agarose beads). 6. Pellet the beads by centrifugation at 10,000
g for 2 min. 7. Wash the pellets 3
with GTP-Agarose lysis/wash buffer. 8. Resuspend the washed beads in 2
Laemmli Sample buffer, run the pulled-down samples along with the input on SDS-PAGE and blot with an anti-Rab5 antibody. The results are expressed as Rab5-GTP/total Rab5, where total Rab5 is the amount of Rab5 present in the input [17] (see Notes 8 and 9).

Assessing Rab5 Activation in Health and Disease

3.4 Endosome Isolation by OptiPrep™ Density Gradient Centrifugation from Mouse Brain Tissue

289

1. Mice are anesthetized and transcardially perfused with saline (PBS) as in Subheadings 3.3.3 and 3.3.4. 2. Collect the brain and use half for the subcellular fractionation (a specific brain regions can be dissected and used as well). 3. Quickly weigh out the brain tissue and add 10
vol/brain weight homogenization buffer (e.g., for an average weight of 0.15–0.2 g use 1.5–2 mL of homogenization buffer). 4. Homogenize the tissue with 30–40 strokes of a Teflon-coated pestle in ice. 5. Centrifuge the samples at 1000
g for 20 min to pellet nuclei and unbroken tissue and obtain a postnuclear supernatant (PNS). 6. Collect the PNS and determine sample protein concentration (e.g., from one hemibrain homogenized in 1.4 mL of buffer the concentration of the PNS is about 7 mg/mL). 7. Adjust 5–6 mg of PNS in homogenization buffer to 25% OptiPrep™ adding an equal volume of 50% stock solution to a final volume of 2 mL. Keep an aliquot of the adjusted PNS as input (this will be mixed with Laemmli Sample Buffer followed by heat denaturation for western blot analysis). 8. Set up the gradient by loading the PNS in 25% OptiPrep™ at the bottom of a clear centrifuge tube and consecutively overlay with 1.5 mL of 20%, 15%, 14%, 12.5%, and 10% and 5% OptiPrep™ solutions. 9. Load the tube on a SW 40 rotor and centrifuge overnight (18 h) at 100,000
g at 4  C. 10. After centrifugation carefully collect 22
0.5 mL aliquots from the top of the tube and analyze by western blot by loading equal volumes for each fraction collected, following resuspension in 5
Laemmli sample buffer and heat denaturation at 95  C for 5 min. 11. Probe the blots with primary antibodies against different subcellular compartments (Fig. 5), such as Rab5 for early endosomes (Abcam); Rab7 (Abcam) for late endosomes; Cathepsin D (made in house) for lysosomes; Tom20 (Santa Cruz Biotechnology) for mitochondria; sec61B for endoplasmic reticulum (ER) (Proteintech); p58K for cis-Golgi (Sigma); syntaxin6 for trans-Golgi network (TGN) (Cell Signaling Technology). The following enrichment is expected at given OptiPrep™ %: 5–10%, late endosomes; 10–12.5%, early endosomes; 12.5–15%, TGN; 15–20%, ER; 15–25%, lysosomes; 20–25%, mitochondria; 25%, Golgi. This method has been optimized from [18].

290

Anna Pensalfini et al.

Fig. 5 Subcellular fractionation with OptiPrep™. (a) Adult mouse brain homogenates were fractionated with an iodixanol step gradient and 22 fractions collected from the top. Equal volumes of each fraction (to show enrichment), along with the PNS input, are subject to Western blot analysis. Shown are the distributions of Rab5 (early endosome, EE), Rab7 (late endosome, LE), syntaxin6 (trans-Golgi network, TGN), cathepsin D (lysosome, Lys), Sec61B (endoplasmic reticulum, ER), Tom20 (mitochondria, mito) and p58 (Golgi). Membrane proteins, weakly stained by Ponceau red, are enriched between 5% and 20% OptiPrep™)

4

Notes 1. Availability, specificity and quality of Rab5 antibodies are critical to the study of endosomes. Most antibodies such as antiRab5 (BD Biosciences, 610281) and anti-EEA1 (BD Biosciences, 610457) are excellent for staining of cultured cells [14], but fail to work in mouse brain tissue section. The anti-Rab5b antibody (Santa Cruz Biotechnology Inc., SC-26569), which worked well in our previous studies [15, 16], no longer exists. Finding and validating antibodies suitable for one’s specific needs is an ongoing priority task. 2. In order to detect vesicular/membrane-associated Rab5, depending on the antibody and/or systems used (e.g., cell culture vs. mouse tissue), it is of fundamental importance to

Assessing Rab5 Activation in Health and Disease

291

determine the appropriate detergent type and concentration for sample permeabilization and antibody dilution. Nonionic detergents such as Triton X-100 may extract proteins along with the lipids [28], resulting in poor staining. So, for instance, the anti-Rab5b antibody (Santa Cruz Biotechnology) works optimally in the presence of 0.4% Triton X-100, but it gives minimal signal with 0.05% saponin; on the other hand, saponin, which is more selective in targeting cholesterol [28], is preferred for the visualization of endosomes using Rab5a (Santa Cruz Biotechnology), Rab5-GTP (NewEast Biosciences), and Rab5 (Abcam) antibodies, whereas Triton X-100 results in a highly diffuse signal. 3. Size binning of Rab5 endosomes should be adjusted and set according to individual experimental conditions, including the cell type and antibody specificity. Presenting results in terms of a ratio to the experiment control instead of to absolute number is therefore recommended. 4. The stable N2aAPP line is generated after N2a cell transfection with a linearized pcDNA3-APP695 plasmid. Transfected cells are plated on 35 mm dishes for 2 days and subcultured into 100 mm dishes at a 1:10 dilution. Selection is obtained by cell incubation with G418 at 0.6 mg/mL for 2 weeks as previously described [8]. 5. Since the Rab5-GTP antibody is mouse monoclonal, the blocking reagent from the M.O.M kit (Vector Laboratories, BMK-2202) can be used to reduce the background when staining mouse tissue. However, it is recommended to use a custom-made antibody dilution buffer containing the appropriate detergent (e.g., 0.05% saponin), since other detergents eventually present in the commercial kit may affect the Rab5GTP endosomal staining. 6. Synaptosomes can be isolated from mouse hippocampi, following homogenization in 250 μL of a sucrose solution (0.32 mol/L sucrose, 0.1 mmol/L CaCl2, 1 mmol/L MgCl2) with protease and phosphatase inhibitors [27]. After homogenization, samples are adjusted to 1.25 M and sequentially overlaid with 1.0 M Sucrose in 0.1 mM CaCl2 and homogenization buffer. Following sample centrifugation at 100,000
for 3 h at 4  C using a SW55Ti rotor (Beckman Coulter), the interface at 1.25–1.0 M sucrose, enriched in synaptosomes is diluted in ice-cold 0.1 mM CaCl2, centrifuged at 75,000
g for 30 min at 4  C in a SW55Ti rotor and the pellets washed in 0.1 mM CaCl2 and centrifuged again. The resultant washed synaptosome pellet is rich in presynaptic and postsynaptic membranes as well as in and synaptic soluble/ vesicular components.

292

Anna Pensalfini et al.

7. All the BS3 solutions should be prepared immediately before use in amine-free buffer and should not be stored for later use. To prepare 100 mM BS3stock solution, 2 mg of BS3 and dissolving in 35 μL ultrapure water. The solution is then diluted to 5 mM by adding 665 μL coupling buffer. 250 μL is required per sample. BS3 is not cleavable, thus yielding irreversible cross-linking at physiological pH. 8. Since the Rab5-GTP antibody is “conformation-specific,” direct assessment of activated Rab5 by SDS-PAGE (or under denaturing conditions) cannot be performed. 9. In order to carry the Rab5 GTP-Agarose pull-down experiment successfully, the samples must be: (1) fresh (do not freeze and thaw); (2) free of phosphatase inhibitors; (3) contain a cytosolic component, as factors regulating Rab5 activation (GEF) and de-activation (GAP and GDI) are either cytosolic (GDI) or transiently associated with the endosomal membranes (GEF and GAP) [3]. Based on our experience, this assay would not work on isolated membranes.

Acknowledgments We wish to thank Chitra Hindnavis for assistance with manuscript preparation. This work was supported by NIH P01AG017617 and NIH R01AG062376 to R.A.N. References 1. Ullrich O, Horiuchi H, Bucci C, Zerial M (1994) Membrane association of Rab5 mediated by GDP-dissociation inhibitor and accompanied by GDP/GTP exchange. Nature 368(6467):157–160. https://doi.org/10. 1038/368157a0 2. Felberbaum-Corti M, Van Der Goot FG, Gruenberg J (2003) Sliding doors: clathrincoated pits or caveolae? Nat Cell Biol 5 (5):382–384. https://doi.org/10.1038/ ncb0503-382 3. Cavalli V, Vilbois F, Corti M, Marcote MJ, Tamura K, Karin M, Arkinstall S, Gruenberg J (2001) The stress-induced MAP kinase p38 regulates endocytic trafficking via the GDI: Rab5 complex. Mol Cell 7(2):421–432 4. Dirac-Svejstrup AB, Sumizawa T, Pfeffer SR (1997) Identification of a GDI displacement factor that releases endosomal Rab GTPases from Rab-GDI. EMBO J 16(3):465–472. https://doi.org/10.1093/emboj/16.3.465 5. Horiuchi H, Giner A, Hoflack B, Zerial M (1995) A GDP/GTP exchange-stimulatory

activity for the Rab5-RabGDI complex on clathrin-coated vesicles from bovine brain. J Biol Chem 270(19):11257–11262. https:// doi.org/10.1074/jbc.270.19.11257 6. Haas AK, Fuchs E, Kopajtich R, Barr FA (2005) A GTPase-activating protein controls Rab5 function in endocytic trafficking. Nat Cell Biol 7(9):887–893. https://doi.org/10. 1038/ncb1290 7. Nixon RA (2017) Amyloid precursor protein and endosomal-lysosomal dysfunction in Alzheimer’s disease: inseparable partners in a multifactorial disease. FASEB J 31(7):2729–2743. https://doi.org/10.1096/fj.201700359 8. Kim S, Sato Y, Mohan PS, Peterhoff C, Pensalfini A, Rigoglioso A, Jiang Y, Nixon RA (2016) Evidence that the Rab5 effector APPL1 mediates APP-betaCTF-induced dysfunction of endosomes in Down syndrome and Alzheimer’s disease. Mol Psychiatry 21(5):707–716. https://doi.org/10.1038/mp.2015.97 9. Bucci C, Parton RG, Mather IH, Stunnenberg H, Simons K, Hoflack B, Zerial

Assessing Rab5 Activation in Health and Disease M (1992) The small GTPase Rab5 functions as a regulatory factor in the early endocytic pathway. Cell 70(5):715–728 10. Gorvel JP, Chavrier P, Zerial M, Gruenberg J (1991) Rab5 controls early endosome fusion in vitro. Cell 64(5):915–925 11. Qi Y, Liang Z, Wang Z, Lu G, Li G (2015) Determination of Rab5 activity in the cell by effector pull-down assay. Methods Mol Biol 1298:259–270. https://doi.org/10.1007/ 978-1-4939-2569-8_22 12. Zhan K, Xie H, Gall J, Ma M, Griesbeck O, Salehi A, Rao J (2011) Real-time imaging of Rab5 activity using a prequenched biosensor. ACS Chem Biol 6(7):692–699. https://doi. org/10.1021/cb100377m 13. Cataldo AM, Mathews PM, Boiteau AB, Hassinger LC, Peterhoff CM, Jiang Y, Mullaney K, Neve RL, Gruenberg J, Nixon RA (2008) Down syndrome fibroblast model of Alzheimer-related endosome pathology: accelerated endocytosis promotes late endocytic defects. Am J Pathol 173(2):370–384. https://doi.org/10.2353/ajpath.2008. 071053 14. Jiang Y, Mullaney KA, Peterhoff CM, Che S, Schmidt SD, Boyer-Boiteau A, Ginsberg SD, Cataldo AM, Mathews PM, Nixon RA (2010) Alzheimer’s-related endosome dysfunction in Down syndrome is Abeta-independent but requires APP and is reversed by BACE-1 inhibition. Proc Natl Acad Sci U S A 107 (4):1630–1635. https://doi.org/10.1073/ pnas.0908953107 15. Cataldo AM, Petanceska S, Peterhoff CM, Terio NB, Epstein CJ, Villar A, Carlson EJ, Staufenbiel M, Nixon RA (2003) App gene dosage modulates endosomal abnormalities of Alzheimer’s disease in a segmental trisomy 16 mouse model of down syndrome. J Neurosci 23(17):6788–6792 16. Jiang Y, Rigoglioso A, Peterhoff CM, Pawlik M, Sato Y, Bleiwas C, Stavrides P, Smiley JF, Ginsberg SD, Mathews PM, Levy E, Nixon RA (2016) Partial BACE1 reduction in a Down syndrome mouse model blocks Alzheimer-related endosomal anomalies and cholinergic neurodegeneration: role of APP-CTF. Neurobiol Aging 39:90–98. https://doi.org/10.1016/j.neurobiolaging. 2015.11.013 17. Pensalfini A, Seonil K, Subbanna S, Bleiwas C, Goulbourne CN, Stavrides PH, Jiang Y, Lee JH, Darji S, Pawlik M, Huo C, Peddy J, Berg MJ, Smiley JF, Basavarajappa BS, Nixon RA (2020) Endosomal dysfunction induced by directly over-activating Rab5 recapitulates prodromal and neurodegenerative features of

293

Alzheimer’s disease. Cell Rep. 33(8):108420. https://doi.org/10.1016/j.celrep.2020. 108420 18. Lee MS, Kao SC, Lemere CA, Xia W, Tseng HC, Zhou Y, Neve R, Ahlijanian MK, Tsai LH (2003) APP processing is regulated by cytoplasmic phosphorylation. J Cell Biol 163 (1):83–95. https://doi.org/10.1083/jcb. 200301115 19. Shi MM, Shi CH, Xu YM (2017) Rab GTPases: the key players in the molecular pathway of Parkinson’s disease. Front Cell Neurosci 11:81. https://doi.org/10.3389/fncel.2017. 00081 20. Farg MA, Sundaramoorthy V, Sultana JM, Yang S, Atkinson RA, Levina V, Halloran MA, Gleeson PA, Blair IP, Soo KY, King AE, Atkin JD (2014) C9ORF72, implicated in amytrophic lateral sclerosis and frontotemporal dementia, regulates endosomal trafficking. Hum Mol Genet 23(13):3579–3595. https:// doi.org/10.1093/hmg/ddu068 21. Hadano S, Hand CK, Osuga H, Yanagisawa Y, Otomo A, Devon RS, Miyamoto N, Showguchi-Miyata J, Okada Y, Singaraja R, Figlewicz DA, Kwiatkowski T, Hosler BA, Sagie T, Skaug J, Nasir J, Brown RH Jr, Scherer SW, Rouleau GA, Hayden MR, Ikeda JE (2001) A gene encoding a putative GTPase regulator is mutated in familial amyotrophic lateral sclerosis 2. Nat Genet 29(2):166–173. https://doi.org/10.1038/ng1001-166 22. Axelrod D, Koppel DE, Schlessinger J, Elson E, Webb WW (1976) Mobility measurement by analysis of fluorescence photobleaching recovery kinetics. Biophys J 16 (9):1055–1069. https://doi.org/10.1016/ S0006-3495(76)85755-4 23. Vieira OV, Bucci C, Harrison RE, Trimble WS, Lanzetti L, Gruenberg J, Schreiber AD, Stahl PD, Grinstein S (2003) Modulation of Rab5 and Rab7 recruitment to phagosomes by phosphatidylinositol 3-kinase. Mol Cell Biol 23 (7):2501–2514. https://doi.org/10.1128/ mcb.23.7.2501-2514.2003 24. Lee JH, Rao MV, Yang DS, Stavrides P, Im E, Pensalfini A, Huo C, Sarkar P, Yoshimori T, Nixon RA (2018) Transgenic expression of a ratiometric autophagy probe specifically in neurons enables the interrogation of brain autophagy in vivo. Autophagy 15:1–15. https://doi.org/10.1080/15548627.2018. 1528812 25. Gruenberg J, Griffiths G, Howell KE (1989) Characterization of the early endosome and putative endocytic carrier vesicles in vivo and with an assay of vesicle fusion in vitro. J Cell Biol 108(4):1301–1316

294

Anna Pensalfini et al.

26. Huotari J, Helenius A (2011) Endosome maturation. EMBO J 30(17):3481–3500. https:// doi.org/10.1038/emboj.2011.286 27. Louneva N, Cohen JW, Han LY, Talbot K, Wilson RS, Bennett DA, Trojanowski JQ, Arnold SE (2008) Caspase-3 is enriched in postsynaptic densities and increased in

Alzheimer’s disease. Am J Pathol 173 (5):1488–1495. https://doi.org/10.2353/ ajpath.2008.080434 28. Oliver C, Jamur MC (2010) Immunocytochemical methods and protocols. Methods Mol Biol 588:iv–v. https://doi.org/10.1007/ 978-1-59745-324-0

Chapter 21 Quantitative Fluorescence Microscopy for Detecting Mammalian Rab Vesicles within the Parasitophorous Vacuole of the Human Pathogen Toxoplasma gondii Julia D. Romano, Eric J. Hartman, and Isabelle Coppens Abstract Fluorescence microscopy and image analysis are powerful techniques to examine the distribution and interactions of different cellular compartments, including mammalian organelles with intravacuolar pathogens. Toxoplasma gondii is an obligate intracellular protozoan parasite that forms a membrane-bound compartment, the parasitophorous vacuole (PV), upon invasion of mammalian cells. From within the PV, the parasite interacts with many host organelles (without fusion), redirects host vesicles decorated with Rab GTPases to the PV, and internalizes many of these nutrient-filled Rab vesicles into the PV. Here, we report a method to distinguish the host Rab vesicles that are exclusively trapped in the Toxoplasma PV from those localized along the edge of the vacuole. Such a discrimination between the two Rab vesicle populations (inside versus outside of the PV) allows the selective characterization of the intra-PV Rab vesicles, for example, number per PV, volume, and distance from the PV centroid, as well as comparisons between wildtype and mutant Toxoplasma. Key words Toxoplasma gondii, Fluorescence imaging, Rab GTPase, Vesicle trafficking, Parasitophorous vacuole, Host–pathogen interaction

1

Introduction In eukaryotic cells, Rab GTPases are key mediators of intracellular membrane trafficking, regulating many steps including vesicle formation, movement along the cytoskeleton, docking on target membranes and membrane fusion. As such, mammalian Rab GTPases are often targets of intracellular pathogens, including viruses, bacteria and protozoa. The protozoan parasite Toxoplasma gondii, the etiologic agent of toxoplasmosis in humans, actively invades mammalian cells and forms a membrane-bound compartment called the parasitophorous vacuole (PV), which protects the parasite from fusion with destructive endolysosomal organelles of the host cell (reviewed in [1]). Toxoplasma redirects multiple,

Guangpu Li and Nava Segev (eds.), Rab GTPases: Methods and Protocols, Methods in Molecular Biology, vol. 2293, https://doi.org/10.1007/978-1-0716-1346-7_21, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

295

296

Julia D. Romano et al.

distinct host Rab GTPase-coated vesicles to its PV to scavenge their nutrient content. Instead of fusing with the PV membrane (PVM), the vesicles are internalized intact into the PV via an intravacuolar network of membranous tubules (IVN) secreted by the parasite (Fig. 1). The IVN fuses with the PV membrane, creating deep invaginations wherein mammalian vesicles are trapped and then sequestered into the PV [2–5].

GFP-Rab11A, TgGRA7 (PV)

A.

hc PV * 9µm

9µm

B. 4.1µm

2.5µm

4.1µm

4.1µm

2.5µm

4.1µm

Fig. 1 Localization of mammalian Rab11A vesicles inside the Toxoplasma PV. (a) VERO cells expressing GFP-Rab11A (green) were infected with T. gondii for 24 h and immunostained for TgGRA7 (blue) to detect the PV. Individual z-slices are shown for phase and fluorescent images. The red arrow indicates the PV and the blue asterisk indicates an individual parasite. PV, parasitophorous vacuole; hc, host cell. The PV contains ~16 parasites. Bars, 9μm. (b) Magnification of the PV found in (a). Orthogonal views are shown indicating xy, xz, and yz dimensions. White arrows indicate a intra-PV GFP-Rab11A puncta. The red arrow indicates the PVM and the purple arrow indicates the IVN. Bars, 4.1μm (xy, xz) and 2.5μm (yz)

Mammalian Rab Vesicle Interaction with Toxoplasma

297

To measure the internalization of host vesicles into the Toxoplasma PV and compare the ability of different parasite mutants to scavenge host vesicles, we have developed a microscopy-based assay [5]. After acquiring optical z-sections of Toxoplasma-infected cells expressing GFP-Rab11A, we created a measurement protocol using Volocity software that tracks objects in the 3D reconstructed volumes of optical z-slices. We used fluorescence intensity to detect GFP-Rab11A foci within the PV. To identify the PV, we immunostained for two PV resident proteins with different localizations: a membrane-associated protein on the PVM (e.g., TgGRA7) and a soluble protein that diffuses throughout the PV lumen (e.g., TgNTPase [6]). This soluble PV protein aided the imaging software in identifying regions of the PV missed by the membrane marker. Thus, the use of proteins distributed on the PVM and in the PV lumen was key to helping the imaging software identify the entire PV volume. Lastly, the GFP-Rab11 foci localized within the boundary of the PV were pinpointed, and their parameters examined and quantified. This technique, of coupling the localization of two different PV markers (membrane-associated and luminal) to identify the entire volume of the PV using image analysis software, may be applied to other intravacuolar microbes (e.g., Plasmodium, Chlamydiae) to analyze the distribution, morphology and abundance of mammalian GFP-Rab vesicles (or other host organelles) trapped in the microbial vacuole, in infected cells.

2

Materials Prepare all solutions using ultrapure water (prepared by purifying deionized water, to attain a sensitivity of 18 MΩ-cm). For tissue culture, use reagents sterilized by the manufacturer or autoclaving.

2.1 Cell and Parasite Lines

1. HFF, human foreskin fibroblasts (Hs68, ATCC CRL-1635), to propagate Toxoplasma gondii parasites [7]. 2. Toxoplasma gondii RH type I strain. 3. HeLa cells, VERO, or other cell lines that are easily transfected (from ATCC). 4. VERO cells stably expressing GFP-Rab11A, described in [5] (see Note 1).

2.2 Cell Culture and Transfection

1. Laminar flow cabinet and 5% CO2 incubator maintained at 37  C. 2. Growth Medium: Alpha MEM (minimum essential medium with Earle’s salts without ribonucleosides, deoxyribonucleosides, and glutamine) supplemented with 10% (vol/vol) heat inactivated fetal bovine serum (FBS), 2 mM L-glutamine and 100 U/mL penicillin plus 100 mg/mL streptomycin. Store at 4  C (see Note 2).

298

Julia D. Romano et al.

3. 1 Phosphate buffered saline (PBS) (0.1 M): add 8.61 g of Na2HPO4·7H2O, 1 g of KH2PO4, 0.8 g of KCl and 32 g of NaCl to 4 L of ultrapure water. Adjust the pH to 7.4 with HCl. Aliquot to glass bottles (500 mL) and autoclave. Store at 4  C (see Note 2). 4. jetPrime transfection kit (Polyplus-transfection SA). 5. Plasmids: GFP- or mEmerald-tagged Rab genes, as desired. 6. Serological pipettes, tissue culture-treated 6-well and 24-well plates, and presterilized barrier pipette tips. 7. Coverslips, round, 12 mm diameter, German Glass, thickness #1 (Fisher Scientific) (see Note 3). 2.3 Immunofluorescence Reagents

1. 1 PBS: same recipe as listed above but store solution at room temperature. 2. 10 PBS: add 86.1 g of Na2HPO4·7H2O, 10 g of KH2PO4, 8.0 g of KCl, and 320 g of NaCl to 4 L of ultrapure water. Adjust the pH to 7.4 with HCl. Aliquot to glass bottles (500 mL) and autoclave. Store at room temperature. 3. Fixative solution (4% formaldehyde, 0.02% glutaraldehyde): mix 4 mL of 10% methanol-free ultrapure EM grade formaldehyde (Polysciences, Inc., Warrington, PA), 8μL of 25% glutaraldehyde solution grade II (Sigma) and 1 mL of 10 PBS with 5 mL of ultrapure water. Protect from light and store at 4  C for 1 month, maximum. 4. Blocking solution [3% bovine serum albumin (BSA)]: add 1.5 g of BSA (Fraction V) to 50 mL of 1 PBS (see Note 4) Store at 20  C (see Note 5). 5. Permeabilization solution (0.3% Triton X-100): prepare a stock solution of 10% Triton X-100 in 1 PBS and store at room temperature. Prior to use, dilute the stock solution at 1:30 in 1 PBS. 6. Rat anti-GRA7 (Coppens, 2004) (see Note 6), rabbit antiNTPase [6]. 7. Secondary antibodies conjugated to either Alexa Fluor 594 or Alexa Fluor 350, or equivalent fluorochromes. 8. Water wash: 50 mL conical tube filled with ultrapure water to wash coverslips. 9. Mounting medium: ProLong Diamond (ThermoFisher).

2.4 Imaging Equipment and Software

1. Upright Zeiss AxioImager M2 microscope, with a motorized stage for z-stack acquisition, connected to a Hamamatsu ORCA-R2 camera. A Zeiss Plan Apochromat 1.4 NA 100 objective was used for phase and fluorescence imaging.

Mammalian Rab Vesicle Interaction with Toxoplasma

299

2. Image acquisition and analysis: Volocity software (version 6.3.1) (Quorum Technologies). 3. GraphPad Prism software.

3

Methods All procedures must be carried out under the laminar flow hood unless otherwise indicated.

3.1 Propagation of Toxoplasma Gondii RH and Mutant Strains [7]

3.2 Plate Mammalian Cells

1. Seed HFF into the wells of a 6-well tissue culture-treated plate (see Note 7). 2. Grow at 5% CO2 and 37  C until the HFF are confluent. 3. Transfer freshly egressed parasites from 1 well of a 6-well plate to another well to propagate the parasites (see Notes 8 and 9). 1. Transfer sterile coverslips to the wells of a 24-well plate (see Note 10). 2. Seed VERO cells stably expressing GFP-Rab11A (VERO/ GFP-Rab11A) to the sterilized coverslips placed into the wells of a 24-well plate (see Note 11). Since this cell line stably expresses GFP-Rab11A, it can be directly infected with parasites (see Subheading 3.4 Infection). However, if you would like to assay other Rab constructs you can either engineer stable cell lines or transfect the cells for transient expression. 3. Seed HeLa, VERO or equivalent cell line to coverslips in the wells of a 24-well plate. The final volume of medium should be 0.5 mL. The cells are ready for transfection when at 45–50% confluency.

3.3 Transient Transfection (HeLa Cells) (See Note 12)

1. Dilute 0.2μg of plasmid DNA into 50μL jetPrime buffer (see Note 13). 2. Vortex 10 s and spin down. 3. Add 0.4μL of jetPrime reagent to the diluted DNA mixture. 4. Vortex 1 s and spin down. 5. Incubate at room temperature for 10 min. 6. Add 50μL of the DNA/reagent mixture directly to the growth medium in the wells. 7. Incubate in 5% CO2 and at 37  C for 4 h before infection.

3.4

Infection

1. Aspirate the culture medium from the wells. 2. Add approximately 1  106 freshly egressed parasites in a volume of 200–300μL of medium to plated cells and incubate for 30 min in 5% CO2 and at 37  C.

300

Julia D. Romano et al.

3. Wash the cells with 1 PBS using a “cascade” technique (see Note 14) to remove extracellular (noninvaded) parasites (see Note 15). 4. Verify by microscopy the absence of extracellular parasites. 5. Incubate the coverslips in 5% CO2 and at 37  C for 24 h (see Note 16). 3.5 Immunofluorescence

From this point on, all steps occur at room temperature outside of a laminar flow hood. The coverslips must be protected from light. 1. Wash the coverslips twice with 1 PBS. 2. Add 250–500μL of fixative solution to the coverslips for 15 min (see Note 17). 3. Wash the coverslips twice with 1 PBS. 4. Add 250μL of permeabilization solution for 5 min (see Note 18). 5. Wash the coverslips once with 1 PBS. 6. Add 250μL of blocking solution to the coverslips for 1 h (No washing step is needed after the block). 7. Prepare the primary antibody solution by diluting the antibodies with blocking solution (1:600 for rat anti-GRA7 and 1:300 for rabbit anti-NTPase) into a tube. Vortex. Remove the blocking solution from the wells and add 150–250μL of primary antibody solution to each coverslip. Incubate the plates on a rocking shaker at room temperature for 1 h. 8. Wash three times with 500μL PBS per coverslip for 5 min (per wash). 9. Prepare the secondary antibody solution by diluting the antibodies with blocking solution (1:2000 dilution) into a tube. Vortex. Remove PBS from the wells and add 150–250μL of secondary antibody solutions to each coverslip. Incubate the plates on a rocking shaker at room temperature for 45–60 min. 10. Wash three times with 500μL 1 PBS per coverslip for 5 min (per wash). 11. Place a drop of mounting medium onto a slide. 12. Using tweezers, carefully remove the coverslip from the well, keeping track of which side has the attached monolayer of cells. Rinse the coverslip by dipping it into a 50 mL tube containing water. Gently wick away excess water by touching the edge of the coverslip to a Kimwipe. Place the coverslip, cell side down, onto the mounting solution (see Note 19). 13. Allow the coverslip to settle for 10–15 min at room temperature and then store at 4  C overnight for a maximum of 1 week before viewing with the microscope.

Mammalian Rab Vesicle Interaction with Toxoplasma

3.6

Imaging

301

1. Using an 100 objective and a Zeiss AxioImager M2 microscope (or equivalent), acquire optical z-sections, with a spacing of 0.2μm, of infected cells with PVs containing 8–16 parasites (see Note 20). 2. Image at least 20 PVs per parasite strain, selecting infected cells with similar expression levels (green fluorescence intensity) of GFP-Rab11A. (see Note 21).

3.7

Image Analysis

1. Deconvolve the images using the Volocity software restoration module. Use the iterative restoration algorithm with a confidence limit of 100% and an iteration limit of 35 (see Note 22). 2. Crop the images to view only a single PV, using a freehand ROI tool, and set up a measurement tool in the Volocity software quantitation module. 3. To delineate the PV, find objects using fluorescence intensity with a minimum object size of 20μm3 for the distinct TgGRA7 and TgNTPase channels. (see Note 23) Combine the objects from the two channels and close with 6 iterations to create the item “PV” (Fig. 2b). 4. To identify the GFP-Rab11A foci in the infected (host) cell, find objects using percent intensity with a minimum object size of 0.1μm3. Then, use the function “separate touching objects with an object size guide of 0.01μm3” and remove noise from objects using a fine filter (see Note 24). 5. To identify the host GFP-Rab11A foci localized inside the PV, use the “compartmentalize” and “divide items in GFP-Rab11A between items in the PV where the sub-populations are inside” functions. 6. Once the intra-PV GFP-Rab11A foci are identified, the Volocity software can measure different parameters, including the number, volume, shape factor and distance of the intra-PV GFP-Rab11A foci to the PV centroid. 7. Using GraphPad Prism software, calculate the means and standard deviations, for at least three independent biological experiments. 8. Normalize the results against wild-type (control) parasites by setting the control values to 100% and calculating the percent of control values for each sample.

4

Notes 1. To create a stable VERO cell line expressing GFP-Rab11A, the GFP-Rab11A plasmid (generously provided by M. Scidmore, Cornell University College of Veterinary Medicine, Ithaca, NY) was linearized with ApaL1 and transfected (2μg) into VERO

302

Julia D. Romano et al. GFP-Rab11A, TgNTPase, TgGRA7

A. 5.0µm

2.0µm

2.0µm

2.4µm

2.0µm

5.0µm

2.0µm

2.0µm

2.0µm

5.0µm

2.0µm

2.0µm

2.0µm

2.0µm

2.0µm

2.0µm

2.0µm

2.0µm

2.0µm

2.0µm

2.0µm

2.0µm

B. 2.0µm

4. Find objects by fluorescences intensity (GFP-Rab11A); minimum object size 0.1µm3; separate touching objects (size guide 0.01µm3); remove noise (fine filter)

2.0µm

1. Find objects by fluorescence intensity (TgGRA7); minimum object size 20µm3 2.0µm

2.0µm

TgGRA7

2. Find objects by fluorescence intensity (TgNTPase); minimum object size 20µm3

2.0µm

2.0µm

2.0µm

2.0µm

TgNTPase

2.0µm

GFP-Rab11A

2.0µm

5. Compartmentalize by dividing items in GFP-Rab11A between items in PV, where subpopulations are inside 2.0µm

2.0µm

2.0µm

Intra-PV GFP-Rab11A

2.0µm

3. Combine objects (TgGRA7 + TgNTPase); close with six iterations 2.0µm

2.0µm

PV

6. Measure distance of intra-PV GFP-Rab11A foci centroids to PV centroid

2.0µm

2.0µm

Distance

© 2017 Romano et al. Originally published in Journal of Cell Biology. https://doi.org/10.1083/jcb.201701108

Fig. 2 Measurement protocol (Volocity) to assess host GFP-Rab11A vesicles in the PV. (a) VERO cells expressing GFP-Rab11A (green) were infected with T. gondii for 24 h and immunostained for TgNTPase (red) and TgGRA7 (blue) to detect the PV. Individual z-slices are shown, and the arrow in the phase image points to the PV. Bars: 5μm (xy, xz) and 2.4μm (yz). The boxed region is magnified in the six orthogonal views. Bars: 2μm. (b) Description of the steps from the Volocity software measurement protocol. Masks indicate the object detected by the program. Bars: 2μm

Mammalian Rab Vesicle Interaction with Toxoplasma

303

cells using the Amaxa Nucleofector solution R and program V-01, according to the manufacturer’s instructions. Stable clones were selected with 800μg/mL G418 sulfate in Alpha MEM medium plus 20 mM HEPES and cloned by serial dilutions in 96-well plates. 2. Warm to 37  C before use. 3. Sterilize coverslips by autoclaving. Place coverslips into a glass petri dish with a glass cover, place dish into an instant sealing sterilization pouch and autoclave on the dry cycle. Store coverslips in the pouch until use. Open and store in a laminar flow cabinet, keeping the glass cover on during storage. 4. To easily dissolve BSA in PBS, add 1.5 g of BSA to 25 mL PBS in a 50 mL conical tube and warm at 37  C until the BSA is dissolved. Then, add 25 mL of PBS to the mix in the tube. 5. Warm to room temperature before use. 6. Instead of using anti-GRA7 antibodies, any antibodies that recognize the PV membrane and intravacuolar network (IVN) may be used, such as mouse anti-GRA3 antibody (monoclonal clone T6 2H11 (NR-50268) from BEI resources). 7. The HFF can also be seeded to T-25 flasks but using 6-well plates allows the convenient propagation of parasite for a week and a half with one plate. 8. Freshly egressed parasites may be transferred by drops from a sterile transfer pipette or preferentially using a micropipette equipped with filter tips for better control over passaging schedule. The filter tips block the aspiration of parasites onto the base of the micropipette, preventing cross-contamination of parasite strains. 9. Transferring 150μL of freshly egressed parasites from 1 well of a 6-well plate to the next usually results in freshly egressed parasites in 2 days. For mutant parasite strains, the volume/ number of parasites transferred may have to be adjusted based on the replication rate to coordinate the egress timeline of the mutant with wild-type/control parasites. The doubling time of wild-type parasites is around 8 h. 10. To easily transfer coverslips from a glass petri dish to the wells of a 24-well plate, use a sterile Pasteur pipette attached to an aspirator in a laminar flow cabinet. Pick up a sterile coverslip with the Pasteur pipette, using the vacuum to lift the coverslip, and deposit the coverslip into the well by releasing the coverslip using the side of the well. 11. VERO cells stably expressing GFP-Rab11A should be 55–60% confluent at the time of infection. We find that plating 30,000 cells per coverslip approximately 48 h prior to infection leads to

304

Julia D. Romano et al.

the desired confluency. For HeLa cells, we use 22,500 cells per coverslip. Plating cells 48 h beforehand allows the cells plenty of time to recover from trypsinization and attach to the coverslip. 12. Any transfection kit may be substituted for the jetPrime kit. We have also successfully used the Amaxa Nucleofector solution R with program V-01 (for VERO cells) or program I-013 (for HeLa cells), according to the manufacturer’s instructions. Stable clones were selected with 800μg/mL G418 sulfate (Corning Cellgro) (or appropriate selective agent) in Alpha MEM medium with 20 mM Hepes and cloned in serial dilutions in 96-well tissue culture-treated plates. To determine the proper concentration for the selective agent, perform a “kill curve” where cells are killed within 3–5 days. 13. For cell lines other than HeLa, check the manufacturer database for reagent volume and DNA amounts. In general, we have found that higher DNA amount equates to higher expression per cell while higher reagent equates to more transfected cells. However, high expression in a cell may result in protein mislocalization and the reagent is toxic at too high of a level (which varies by cell line and confluency). In this case, the transfection conditions will need to be optimized for each cell line beyond the information available in the Polyplus online database. For VERO cells, we use 0.5μg DNA and 0.50–0.75μL jetPrime reagent. 14. To remove the extracellular parasites, we use a “cascade wash” technique. Tilt the 24-well plate at a roughly 30–45 angle. Place a serological pipette containing 10 mL of sterile 1 PBS at the top of the well and a sterile Pasteur pipette attached to a vacuum line at the bottom of the well. Flow the PBS over the coverslip, aspirating the PBS at the bottom of the well. 15. Removing extracellular parasites after a short invasion time (30 min) will enrich for PVs containing a comparable number of parasites and minimize multi-infected cells. 16. Allowing the infection to continue for 24 h after the removal of extracellular parasites enriches for PVs with 8–16 parasites. 17. Add a large enough volume to the well to ensure that that the entire coverslip is covered by the solution. 18. Do not allow the permeabilization step to continue past 7 min. 19. To make it easier to remove the coverslip with tweezers, use a needle to gently lift the coverslips and then grab the edge of the coverslip with the tweezers. If you experience trouble with breaking coverslips, you can use plastic tweezers instead of metal.

Mammalian Rab Vesicle Interaction with Toxoplasma

305

20. Image only infected cells with PVs that contain a given number of parasites, such as 16, to normalize the data for PV size and developmental phase of the parasites. 21. Use the same exposure time and gain across all of the samples for the same fluorochrome, for example, the same exposure time and gain in the GFP-Rab11A channel. 22. If necessary for your microscope setup, perform a registry correction before deconvolution. We have observed that cropping the images to a single infected cell prior to deconvolution gives a more accurate image. 23. The thresholds of the intensity values for TgGRA7 and TgNTPase were set manually by using the outer TgGRA7 PVM staining as the perimeter of the PV. 24. The thresholds of the intensity values for GFP-Rab11A were set manually, allowing the clear delineation of the GFP-Rab11A puncta in the host cell surrounding the PV.

Acknowledgments We thank the members of the Coppens’s laboratory for helpful discussion during the course of these studies. Support for this research was provided by the NIH (AI060767). References 1. Clough B, Frickel EM (2017) The Toxoplasma Parasitophorous vacuole: an evolving hostparasite frontier. Trends Parasitol 33 (6):473–488 2. Coppens I, Dunn JD, Romano JD et al (2006) Toxoplasma gondii sequesters lysosomes from mammalian hosts in the vacuolar space. Cell 125(2):261–274. https://doi.org/10.1016/j. cell.2006.01.056 3. Romano JD, Sonda S, Bergbower E et al (2013) Toxoplasma gondii salvages sphingolipids from the host Golgi through the rerouting of selected Rab vesicles to the parasitophorous vacuole. Mol Biol Cell 24(12):1974–1995. https://doi.org/ 10.1091/mbc.E12-11-0827 4. Nolan SJ, Romano JD, Coppens I (2017) Host lipid droplets: an important source of lipids

salvaged by the intracellular parasite Toxoplasma gondii. PLoS Pathog 13(6):e1006362. https:// doi.org/10.1371/journal.ppat.1006362 5. Romano JD, Nolan SJ, Porter C et al (2017) The parasite Toxoplasma sequesters diverse Rab host vesicles within an intravacuolar network. J Cell Biol 216(12):4235–4254. https://doi. org/10.1083/jcb.201701108 6. Bermudes D, Peck KR, Afifi MA et al (1994) Tandemly repeated genes encode nucleoside triphosphate hydrolase isoforms secreted into the parasitophorous vacuole of Toxoplasma gondii. J Biol Chem 269(46):29252–29260 7. Khan A, Grigg ME (2017) Toxoplasma gondii: laboratory maintenance and growth. Curr Protoc Microbiol 44:20C.1.1–20C.1.17. https:// doi.org/10.1002/cpmc.26

INDEX A

E

Actin............................................................. 114, 163, 171 Affinities........................................................ 8, 28, 30, 49, 51, 53, 150, 159, 160, 182, 186, 203 Alzheimer’s .....................................................11, 222, 274 APEX ................................... 10, 229, 231, 232, 235, 236 Atg17 ................................................................ 9, 181–188 Atg8 ...................................................................... 209, 210 Autophagy ....................... 9, 14, 106, 181–188, 202, 203

Effectors....................................... 2–7, 10, 19, 20, 45–47, 49, 50, 57–67, 71, 106, 117, 118, 120, 138, 139, 143–145, 158, 164, 169, 182, 201, 202, 204, 215, 230, 231, 243, 274 Electron microscopy (EM) ..........................................5, 6, 11, 12, 60, 62, 63, 65, 92–96, 100, 231, 232, 235–237, 276–278, 283–285, 298 Endocytic dysfunction .................................................. 274 Endocytosis ................................9, 12, 14, 266, 273, 274 Endoplasmic reticulum (ER)..........................10, 11, 106, 139, 201, 202, 207, 230, 231, 235–237, 289, 290 Endosomes .................................... 12, 71, 266, 273–275, 279–285, 289–291 Epithelial................................ 11, 95, 213, 216, 244, 259 Evolution ..................................................... 163, 165, 166 Exocytosis ...................................................................... 143

B Bgl2..................................................................... 59–62, 65 Binding affinities ............................................29, 143–160 Bioinformatics ............................................................... 125 Brains .......................................11, 12, 14, 261, 265–270, 275, 278, 282, 283, 287, 289, 290

C

F

Casein kinase ................................................................... 10 Centrioles .........................................................91, 92, 139 Chimera ...............................................5, 57–65, 181, 182 Cilia ........................................ 6, 14, 91, 92, 97, 100, 139 Ciliary pocket membrane (CPM) ............................91, 92 Ciliogenesis.....................................................6, 20, 92, 95 Cisternal maturation ............................... 9, 190–194, 196 Cisternal progression ........................................... 189–197 Co-immunoprecipitation .............................................. 144 Confocal fluorescence microscopy ................................. 66 Correlative light and electron microscopy (CLEM) .......................................................91–102 Cre/lox system................................................................ 11 CRISPR/Cas9............................................................... 247 Cullin5 ........................................................................... 166 Cytokinesis ............................................................. 54, 164

D

Fast exchange mutants..............................................19–24 Fetal brains ........................................................... 267, 270 Fission ................................................................... 213–227 Fission/fusion endocytic regulatory proteins ... 214–218, 220–225 Fluorescence imaging ...................... 92, 93, 95, 101, 298 Fluorescence localization after photobleaching (FLAP) ................................ 6, 106, 107, 111, 112 Fluorescence recovery after photobleaching (FRAP).........................6, 12, 106, 107, 110–112, 275, 280, 281 Fluorescence resonance energy transfer (FRET) .......7, 8, 144, 145, 157, 158 Fusion ...............................12, 30, 32, 39, 46, 57, 58, 66, 118, 120, 127, 129, 133, 190, 202, 213–225, 230, 243, 259, 265, 266, 273–275, 295

G

DENN domain.................................................................. 4 Diseases.............................................. 2, 4, 11, 12, 14, 20, 120, 164, 214, 222, 266, 270, 273–292 Docking .................................................91, 190, 243, 295 Down syndrome (DS) ................................ 274, 276, 283 Dynamic enrichment for evaluation of protein networks (DEEPN) .............................................. 7, 117–139

G418 ....................................................278, 291, 303, 304 Gal4.................................... 120, 125, 127, 129, 131–133 GAP assays ....................................................30–32, 34, 41 GAP reactions................................... 4, 28, 29, 31, 37, 40 GDI displacement factors (GDFs) ...................... 106, 273

Guangpu Li and Nava Segev (eds.), Rab GTPases: Methods and Protocols, Methods in Molecular Biology, vol. 2293, https://doi.org/10.1007/978-1-0716-1346-7, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

307

RAB GTPASES: METHODS AND PROTOCOLS

308 Index

GDP-dissociation inhibitor (GDI) ........................ 2, 3, 7, 106, 107, 118, 121, 274, 292 GEF, see Guanine-nucleotide exchange factor (GEF) GEF/effector complex ...............................................6, 71 Geranylgeranylation ...................................................... 121 Gene knockout .......................... 244, 245, 247–249, 254, 257–259, 261 GFP-binding protein (GBP) .................... 8, 11, 181–188 Golgi ........................ 4, 5, 9, 20, 58, 106–108, 111, 112, 139, 189–197, 201, 202, 215, 230, 257, 259, 289, 290 Green fluorescent protein (GFP) ......................... 6, 8, 60, 65, 66, 106, 145, 146, 157, 158, 182, 186–188, 236, 281 GST fusion proteins ...................................................... 205 GAPs, see GTPase-activating proteins (GAPs) GTPase-activating proteins (GAPs) ........................2–4, 7, 13, 19, 27–42, 45, 97, 100, 105, 107 GTPase cycle ..................................................58, 105, 107 GTPases ............................................ 1–14, 19–24, 27–32, 34–39, 41, 42, 45, 46, 49, 57, 58, 71, 76, 85, 91, 105–114, 117–121, 129, 136, 137, 160, 163–178, 189–197, 201–210, 214, 230, 231, 243, 254, 257, 265–270, 273, 281 GTP hydrolysis ......................................... 2–4, 19, 20, 27, 28, 31, 32, 40, 58, 71, 105, 195, 214, 274 Guanine-nucleotide exchange factor (GEF) ....... 2–6, 71, 164, 165, 201, 230, 243, 274, 292 Guanosine diphosphate (GDP)......................3, 4, 19–21, 24, 46, 48, 52, 53, 58, 71, 72, 74, 105, 109, 117, 120, 124, 125, 133, 136, 137, 147, 151, 164, 170, 174, 273, 274 Guanosine triphosphate (GTP)............................ 4, 6, 19, 20, 22, 27–29, 31, 32, 37, 39, 46, 53, 58, 71, 75, 77, 79, 87, 105, 117, 120, 133, 136, 137, 139, 148, 157, 170, 174, 176, 177, 204, 260, 274, 288

H High-throughput .................................2, 4, 7, 11, 13, 14, 27–42, 120, 143–160 Hippocampal ........................................................ 284, 287 Homeostasis ................................... 10, 11, 213–216, 222 Host-pathogen interaction ........................................... 106 Hrr25 ............................................ 10, 201, 202, 204–207 Hydrogen-deuterium exchange mass spectrometry (HDX-MS) ....................................................69–88

I ImageJ/FIJI ..........................61, 97, 155, 216, 222–226, 233, 282, 285, 287 Immunoblot ............................................... 5, 50, 53, 187, 188, 218, 222, 251

Immunofluorescence ................................... 12, 216, 218, 220, 221, 254, 260, 283, 284, 286, 298, 300 Immunoprecipitation............................................ 12, 173, 175, 177, 203, 207, 208, 275, 278, 279, 287, 288 Intracellular traffic.......................................................2, 14 Intracellular transport ..................................................... 71 In vitro .....................................2–4, 7, 8, 28, 51, 59, 144, 157, 176, 188, 207, 210, 260, 261, 274, 286 In vivo ............................................................ 3–5, 7–9, 13, 117, 118, 181, 182, 188, 206, 261, 274

K Knockout (k/o) mice .......................................... 257–262

L Lipid droplet (LD)......................... 10, 11, 169, 229–238 Live cell imaging ........................................................... 223 Lysosome....................................................................... 290

M Madin-Darby canine kidney (MDCK) II cells .. 244–246, 248–251, 254 Mammalian ........................................... 1, 9–12, 108, 112, 190, 196, 201–203, 206, 207, 214, 216, 243, 295–305 MANT-GDP ........................................... 4, 20, 21, 23, 24 Mass spectrometry .............. 6, 8, 70, 170–172, 174, 178 Membrane contact sites ................................................ 231 Membrane trafficking.............................................. 20, 27, 91–103, 105, 163, 201, 265, 266, 295 Microscopies................................ 2, 8–10, 12, 13, 60, 63, 65, 92–94, 96, 97, 110–111, 114, 187, 190–193, 196, 209, 217, 220, 221, 295–305 Microtubules ........................................................ 114, 163 Mitochondria.............................................. 213–217, 220, 222–225, 289, 290 Mito-morphology plug-in ................................... 223–226 Mutagenesis........................................................... 20, 108, 109, 148, 204, 208, 275 Mutants.............................................1, 2, 4, 8–10, 19–21, 30, 109, 118, 120, 124, 129, 170, 171, 174, 181–188, 192, 196, 206, 207, 209, 210, 244, 259, 281, 297, 303

N Neurodegeneration ........................................................... 2 New methods .................................................................. 13

O OCRL ...........................................................46, 47, 49–51

RAB GTPASES: METHODS P Parasitophorous vacuole (PV) .......................12, 295–305 PBP-MDCC ....................................................... 29, 30, 41 Phenotypes .................................................. 217, 244, 258 Phosphate-binding protein (PBP) ................................. 30 Phosphoinositide 3-kinase .............................................. 47 Phosphoinositide 3-kinase γ (PI3Kγ) ............................ 47 Phosphorylation ................................................... 202, 213 Plasmids .............................................................49, 63, 64, 72, 96, 101, 108, 109, 111, 112, 119–122, 124, 125, 129–133, 135, 137, 145–147, 149, 182–185, 187, 195, 196, 204, 205, 207, 208, 231, 245, 247–249, 252, 254, 275, 280, 291, 298, 299, 301 Polarity........................................................................... 259 Polarized trafficking ...................................................... 259 Positive feedback ............................................................. 71 Prenylated Rab acceptor protein 1 (PRA1)........ 106–111 Prenylation ............................................ 14, 109, 111–114 Protein dynamics............................................................. 70 Protein-protein interaction................................. 144, 145, 156–158, 181 Protein purification .............................72–75, 85, 86, 149 Proteomics...........................................171, 172, 174, 178 Pull-down ................... 47, 50, 51, 53, 54, 170, 275, 292

R Rab1...................................................... 1, 7, 9–11, 13, 19, 58, 106–109, 112, 113, 202, 206, 207 Rab5............................................................ 6, 7, 9–13, 20, 69–88, 126, 138, 139, 181–188, 215, 265–270, 273–292 Rab6......................................................... 11, 14, 257–262 Rab7............................................9, 11, 47, 215, 289, 290 Rab8...................... 1, 5, 6, 45–54, 58, 91–102, 244, 257 Rab11 ............................................. 46, 58, 138, 165, 257 Rab17 ..................................................................... 12, 266 Rab18 .......................... 10, 164, 230–238, 247–249, 251 Rab21 ............................................................................ 266 Rab22 .............................................................12, 266, 267 Rab27 ............................................................... 7, 143–160 Rab29 ................................................................... 4, 19–24 Rab40b .......................... 8, 164, 166–171, 174, 176–178 Rab activation....................................................... 5, 13, 45 Rabaptin-5 ....................................................................... 72 Rab-binding domain (RBD) .........................4, 46, 49, 50 Rab cascade........................................................... 138, 139 Rab coupling protein (RCP) ........................................ 215 Rab escort protein (REP) ............................................... 14 Rabex-5....................................... 6, 71, 72, 74–77, 86, 87 Rab GTPases .................................. 1, 265, 266, 270, 295

AND

PROTOCOLS Index 309

Rab proteins ................................................. 7, 21, 30, 31, 33, 40, 46, 59, 106, 114, 117–121, 125, 129, 133, 137, 151, 160, 163, 164, 166, 213–225, 257, 270 Recombinant proteins............49, 53, 145–151, 153–158

S Saccharomyces cerevisiae................................................. 182 Sec2.................................................................................. 59 Sec4.............................................................. 1, 5, 9, 58, 59 Secretory pathway .......................................................5, 58 Single-cell assay ............................................................. 225 Slp1 ....................................................................... 144, 145 Slp2 ................................................................................ 145 Small interfering RNA (siRNA) ......................... 216, 218, 219, 222, 223, 244, 278, 286 Snc1 ................................................................................. 64 Snf7 ................................................................... 9, 181–188 SOCS box ......................................................... 8, 163–177

T TBC domain.................................................................... 30 Time-lapse microscopy ................................................. 197 Toxoplasma gondii ................................................ 295–305 Trans-Golgi network (TGN)...................... 257, 289, 290 Transport protein particle (TRAPP) complex............. 106

U Ubiquitylation ..................................................... 166, 168, 169, 171, 174, 176, 177 Uso1 ..........................................................................5, 202

V Vacuole ................................................................... 46, 297 Vectors ............................................. 49, 72, 73, 108, 109, 112, 120, 122, 126, 127, 129, 133–135, 137, 138, 146, 147, 150, 152, 153, 176, 204, 207, 231, 238, 245, 247, 252, 254, 275, 277, 291 Vesicles ........................................................ 11, 12, 58, 59, 63, 91, 92, 169, 189–191, 193, 194, 197, 201, 202, 230, 243, 265, 266, 270, 274, 283, 285, 295–305 Vesicular transport ......................... 2, 114, 189, 190, 197 Vps21 ................................................................ 9, 181–188 Vps35 .................................................................... 214, 215

Y Yeast ................................................... 1, 4, 5, 7, 9, 10, 13, 14, 20, 46, 58–63, 65, 66, 106, 108, 118–125, 131–134, 137, 143, 147, 182, 185, 187, 190, 195, 196, 201–203, 206, 207

RAB GTPASES: METHODS AND PROTOCOLS

310 Index

Yeast two-hybrid ................................................ 7, 46, 125 YFP................................................................................. 195 Ypt1....................................................... 1, 5, 8–10, 58, 59, 62–64, 66, 190–197, 201–210 Ypt1-SW1Sec4 ...................................................... 63, 64, 66

Ypt31 ..........................................................8–10, 190–197 Ypt32 ............................................................................... 58 Ypt52 ................................................................................. 9 Ypt53 ................................................................................. 9 Ypt GTPases ...................................................................... 1